CN102296120A - Specific PCR detection method for plasmodiophora brassicae in soil - Google Patents
Specific PCR detection method for plasmodiophora brassicae in soil Download PDFInfo
- Publication number
- CN102296120A CN102296120A CN2011102652909A CN201110265290A CN102296120A CN 102296120 A CN102296120 A CN 102296120A CN 2011102652909 A CN2011102652909 A CN 2011102652909A CN 201110265290 A CN201110265290 A CN 201110265290A CN 102296120 A CN102296120 A CN 102296120A
- Authority
- CN
- China
- Prior art keywords
- primer
- soil
- seq
- sequence
- plasmodiophora
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses a specific PCR detection method for plasmodiophora brassicae in soil. The invention is characterized in that primers are designed as shown in SEQ ID No 1,2,3,5 according to 1-1028 sequences in a SEQ ID No 10 to form primer pairs 2,4,5 for performing the specific PCR detection. The method of the invention has the advantages of rapid detection, sensitive method, good specificity, wide application and simple operation, and can be taken as an effective technology means for detecting brassica plasmodiophora brassicae in soil and plant organization which has high practical value.
Description
Technical field
The present invention relates to the PCR method for detecting specificity of pathogen plasmodiophora in a kind of soil (Plasmodiophora brassicae), particularly relate to the PCR method for detecting specificity of rape pathogen plasmodiophora in a kind of soil.
Background technology
The cress club root is to infect a kind of worldwide soil-borne disease that causes by rape plasmodiophora brassicae (Plasmodiophora brassicae), can endanger many cresss such as green vegetables, Caulis et Folium Brassicae capitatae, wild cabbage, Spiderflower, Caulis et Folium Brassicae capitatae, rape, cause the lopsided enlargement of plant underground part root and the overground part plant is short and small, wilt, cause serious the decline or total crop failure of output of crop.Pathogenic bacteria discharges a large amount of zoospores from septic enlargement root tissue, and then develops into statospore and enter the field piece, and in a single day the field piece is subjected to the pollution of pathogen plasmodiophora, will carry disease germs for a long time, no longer the suitable cultivation cress.Therefore, the production of this disease serious threat crop in cruciferae.
The cress club root is found in the west bank, Mediterranean Sea and the south of europe in 18-19 century the earliest, and all there is generation in present many countries.At provinces such as China Zhejiang, Guangdong, Guangxi, Hunan, Fujian, Jiangxi, Jiangsu, Anhui, Sichuan, Yunnan, Xinjiang, Tibet, Liaoning, Shandong, Taiwan, Shanghai, Beijing distribution is arranged all.In recent years, China's some areas Chinese cabbage club root generation area sharply increases, and in Shanghai, suburb of Shanghai Caulis et Folium Brassicae capitatae export base club root seriously took place in 2006, caused Caulis et Folium Brassicae capitatae because of can not almost having no harvest by balling, can only replant other non-crop in cruciferae.
The pathogen plasmodiophora statospore can be survived in soil more than 15 years according to reports, the statospore of plasmodiophora brassicae in the soil of carrying disease germs is easy to modes such as the transplanting of the ight soil by farm machinery, shoes, domestic animal, the plant that carries disease germs and irrigation water and propagates, and this uprushes the quantity of pathogen plasmodiophora statospore in the soil.Because Plasmodiophora brassicae belongs to obligate parasite, can not on artificial medium, grow, so can not detect soil and whether carry disease germs by separation, cultivation as other non-obligate parasite.
Use susceptible indication crop and can measure soil and whether carry disease germs, yet this method requires the soil content of molds at least 10
3Individual spore/more than the gram dry ground, and need 8 time-of-weeks just can observe the enlargement of plant root.Utilize the development of molecule means detection pathogen plasmodiophora rapid, Faggian etc. (1999) are the specificity PCR primer of report detection pathogen plasmodiophora just, yet because of the sensitivity that exists a large amount of inhibitory substance to disturb pathogen plasmodiophora PCR to detect in the soil, the sensitivity that many detection methods detect during pathogen plasmodiophora in detecting soil is not high.
Therefore, need be a kind of very efficient, sensitive detection method remedies above-mentioned deficiency.
Summary of the invention
Technical problem to be solved by this invention is to provide the PCR method for detecting specificity of pathogen plasmodiophora in a kind of soil, to significantly improve the sensitivity of pathogen plasmodiophora detection method in the existing soil, remedies the defective of prior art.
The present invention is by mensuration and analysis to suburb of Shanghai Plasmodiophora brassicae Causing Cruciferae Clubroot rDNA ITS sequence, compare with common kind and Cruciferae encountered pathogenic bacteria in nearly source kind, the soil, 6 pairs of primers have been designed, compare through the PCR detection of specificity check, several different methods extraction soil DNA and with existing detection primer, set up a kind of more sensitive PCR detection method, had very important realistic meaning and using value for the fast monitored of club root in the soil and the risk assessment of field piece club root harm.
Specifically, the present invention has measured the germ rDNA ITS sequence that causes area, Shanghai Cruciferae green vegetables pathogen plasmodiophora, by not of the same race with Plasmodiophoromycetes, the comparison of an Oomycete Different Kinds of Pathogens bacterial classification and sickle-like bacteria sequence not of the same race in the soil, 2 (PbF1 of specificity forward primer that rape pathogen plasmodiophora PCR detects have been designed, PbF2), 3 (PbR1 of reverse primer, PbR2, PbR3), it is right to form 6 pairs of primers, carry out target green vegetables pathogen plasmodiophora, other pathogenic bacteria kind on the green vegetables, the specificity check of Oomycete various pathogenic bacteria kind and sickle-like bacteria different sorts pcr amplification reaction, and the pcr amplification reaction that the soil DNA that adopts different methods to extract is carried out pathogen plasmodiophora sensitivity detection.
Wherein, 6 pairs of designed primers of the present invention are distinguished as follows to sequence:
Primer is to 1: forward primer PbF1:5 ' atcattaaca cagtgggcgg 3 ' (referring to SEQ ID No 1)
Reverse primer PbR1:5 ' cgcgcaaacg aacagaaa 3 ' (referring to SEQ ID No 2)
Primer is to 2: forward primer PbF1:5 ' atcattaaca cagtgggcgg 3 ' (referring to SEQ ID No 1)
Reverse primer PbR2:5 ' gcagcaaagc tcattgtctt 3 ' (referring to SEQ ID No 3)
Primer is to 3: forward primer PbF1:5 ' atcattaaca cagtgggcgg 3 ' (referring to SEQ ID No 1)
Reverse primer PbR3:5 ' tcgttcaagc tatgccgc 3 ' (referring to SEQ ID No 4)
Primer is to 4: forward primer PbF2:5 ' ctagcgctgc atcccatat 3 ' (referring to SEQ ID No 5)
Reverse primer PbR1:5 ' cgcgcaaacg aacagaaa 3 ' (referring to SEQ ID No 2)
Primer is to 5: forward primer PbF2:5 ' ctagcgctgc atcccatat 3 ' (referring to SEQ ID No 5)
Reverse primer PbR2:5 ' gcagcaaagc tcattgtctt 3 ' (referring to SEQ ID No 3)
Primer is to 6: forward primer PbF2:5 ' ctagcgctgc atcccatat 3 ' (referring to SEQ ID No 5)
Reverse primer PbR3:5 ' tcgttcaagc tatgccgc 3 ' (referring to SEQ ID No 4)
Described pcr amplification reaction system is 20 μ l, comprises template DNA 1 μ L, and primer is to (forward and reverse primer) each 2 μ L, dNTP mixture (every kind of 2.5mM/) 2 μ L, PCR reaction buffer (10 *) 2 μ L, MgCl
2Solution (25mmol/L) 2 μ L, Taq enzyme (1U/ μ L) 0.4 μ l replenishes deionized water to 20 μ l.
Described pcr amplification reaction condition is: 1 circulation of 95 ℃ of 5min; 95 ℃ of 30sec, 54 ℃ of 30sec, 72 ℃ of 45sec, 35 circulations; 1 circulation of 72 ℃ of 10min.
Above-mentioned pcr amplification product through Agrose gel electrophoresis post analysis, be found that: primer can increase in the club root diseased tissues rape pathogen plasmodiophora in the target fragment of 353bp, 300bp and 331bp special respectively, delicately to 2,4 and 5 pcr amplification method.
Respectively with primer to 2, primer is that the outer ring primer is right to 5, is that the inner ring primer all can go out the target fragment of the club root soil DNA of 3 kinds of methods extractions at 300bp by specific amplification to two kinds of nest-type PRC amplification methods forming with primer to 4, wherein primer is more more clear to the fragment of 4 amplifications to 2/ primer than primer to the 4 nest-type PRC amplified fragments of forming to 5/ primer, bright, and with primer to 7 be the outer ring primer to primer to 8 for the nest-type PRC of inner ring primer composition only can the club root soil DNA of a kind of method extraction of specific amplification in the rape pathogen plasmodiophora in the target fragment of 507bp.
Primer all can detect the pathogen plasmodiophora that is equivalent in the 1 μ g old complaint as the right pcr amplification of outer ring primer respectively to 2,5 and 7.Is the outer ring primer with primer to 7, primer to 4 and primer carry out nest-type PRC reaction sensitivity check as the inner ring primer respectively to 8, primer can detect 1fg first round PCR product to 4, and primer is to 8 first round PCR products that only can detect 10ng.
Explanation thus: primer is right as the outer ring primer to 2, primer is right as the outer ring primer to 5 as inner ring primer and primer to 4, and primer detects rape pathogen plasmodiophora in the soil to 4 two kinds of nest-type PRCs as the inner ring primer method is more sensitiveer as the nested PCR detection method of inner ring primer to 8 as outer ring primer, primer to 7 than the primer of existing bibliographical information.
Wherein primer is distinguished as follows to 7,8 sequence:
Primer is to 7: forward primer PbITS1:5 ' acttgcatcg attacgtccc 3 ' (referring to SEQ ID No 6)
Reverse primer PbITS2:5 ' ggcattctcg agggtatcaa 3 ' (referring to SEQ ID No 7)
Primer is to 8: forward primer PbITS6:5 ' caacgagtca gcttgaatgc 3 ' (referring to SEQ ID No 8)
Reverse primer PbITS7:5 ' tgtttcggct aggatggttc 3 ' (referring to SEQ ID No 9)
The specific PCR discrimination method of rape pathogen plasmodiophora can be used as the detection effective technology means of rape pathogen plasmodiophora in a kind of soil, the plant tissue (Plasmodiophora brassicae) in the soil of the present invention.
Advantage of the present invention:
1) detect fast: the detection of finishing pathogen plasmodiophora in the soil only needs 8-9 hour; Detecting by the susceptible biomaterial of tradition plantation need be more than 8 week.
2) method sensitivity: technology first run PCR of the present invention can detect and be equivalent to rape pathogen plasmodiophora in the 1 μ g old complaint, and second takes turns the DNA product that nest-type PRC can detect the above first run pcr amplification of 1fg.Prior art second is taken turns the DNA product that primer can only detect the above first run pcr amplification of 10ng.
3) specificity is good: the present invention can specific detection Cruciferae club root diseased tissues, the rape pathogen plasmodiophora in the soil.
4) suitability is wide: specific PCR of the present invention is applicable to the rape pathogen plasmodiophora in the detection soil DNA that (3 kinds of methods) extracted from multiple method, and prior art only can detect pathogen plasmodiophora from the DNA that a kind of method is extracted.
5) easy and simple to handle: the present invention only needs 1 pcr amplification instrument and the required conventional reagent of pcr amplification reaction.
Therefore method of the present invention has very high practical value.
Description of drawings
Fig. 1 is the electrophorograms of 6 pairs of primers of the present invention to rape pathogen plasmodiophora in the amplification green vegetables old complaint, wherein M:marker; 1-6 be followed successively by primer to 1 (PbF1/PbR1), primer to 2 (PbF1/PbR2), primer to 3 (PbF1/PbR3), primer to 4 (PbF2/PbR1), primer to 5 (PbF2/PbR2), primer to 6 (PbF2/PbR3).
Fig. 2 for primer of the present invention to 1 electrophorogram that carries out other pathogenic bacteria of pcr amplification green vegetables, wherein M:marker; 1: positive control; 2:Erwinia carotovora subsp.carotovora; 3,4:Colletotrichum higginsianum; 5: negative control.
Fig. 3 for primer of the present invention to 1 electrophorogram that carries out pathogenic bacteria in the pcr amplification Oomycete, wherein M:marker; 1: positive control; 2:Pythium aphanidermatuma; 3:Pythium ultimum; 4:Pythiumaphanidermatuma; 5:Phytopathora capsci; 6: negative control.
Fig. 4 is the electrophorogram of the total DNA of different methods extraction rape club root sick soil of the present invention, wherein M:marker; 1: method one; 2: method two; 3: method three; 4: method four; 5: old complaint.
Fig. 5 for PbITS1/PbITS2 as the outer ring primer to detecting pathogen plasmodiophora electrophorogram, wherein M:marker among 4 kinds of different methods extraction sick soil DNA as the inner ring primer to carrying out PCR with PbF1/PbR1; 1: method one; 2: method two; 3: method three; 4: method four; 5: positive control; 6: negative control.
Fig. 6 for PbITS1/PbITS2 as the outer ring primer to detecting pathogen plasmodiophora electrophorogram, wherein M:marker among 4 kinds of different methods extraction sick soil DNA as the inner ring primer to carrying out PCR with PbF1/PbR2; 1: method one; 2: method two; 3: method three; 4: method four; 5: positive control; 6: negative control.
Fig. 7 for PbITS1/PbITS2 as the outer ring primer to detecting pathogen plasmodiophora electrophorogram, wherein M:marker among 4 kinds of different methods extraction sick soil DNA as the inner ring primer to carrying out PCR with PbF2/PbR1; 1: method one; 2: method two; 3: method three; 4: method four; 5: positive control; 6: negative control.
Fig. 8 for PbITS1/PbITS2 as the outer ring primer to detecting pathogen plasmodiophora electrophorogram, wherein M:marker among 4 kinds of different methods extraction sick soil DNA as the inner ring primer to carrying out PCR with PbF2/PbR2; 1: method one; 2: method two; 3: method three; 4: method four; 5: positive control; 6: negative control.
Fig. 9 for PbITS1/PbITS2 as the outer ring primer to detecting pathogen plasmodiophora electrophorogram, wherein M:marker among 4 kinds of different methods extraction sick soil DNA as the inner ring primer to carrying out PCR with PbITS6/PbITS7; 1: method one; 2: method two; 3: method three; 4: method four; 5: positive control; 6: negative control.
Figure 10 carries out the electrophorogram that PCR detects the sensitivity of club root old complaint, wherein 1:1mg old complaint for primer to 2; 2:100 μ g old complaint; 3:10 μ g old complaint; 4:1 μ g old complaint; The 5:100ng old complaint; The 6:10ng old complaint; 7: negative control.
Figure 11 carries out the electrophorogram that PCR detects the sensitivity of club root old complaint, wherein 1:1mg old complaint for primer to 5; 2:100 μ g old complaint; 3:10 μ g old complaint; 4:1 μ g old complaint; The 5:100ng old complaint; The 6:10ng old complaint; 7: negative control.
Figure 12 carries out the sensitivity electrophorogram that PCR detects the club root old complaint, wherein 1:1mg old complaint for primer to 7; 2:100 μ g old complaint; 3:10 μ g old complaint; 4:1 μ g old complaint; The 5:100ng old complaint; The 6:10ng old complaint; 7: negative control.
Figure 13 be primer to 4 electrophorograms as the right nest-type PRC augmentation detection sensitivity of inner ring primer, wherein the amplimer of first round PCR be primer to 7, respectively getting 1 μ L behind the amplified production doubling dilution is that template is carried out second nest-type PRC of taking turns; M:marker; 1-10: the inner ring primer is to 4; 11-20: the inner ring primer is to 8; 1,11:100ng; 2,12:10ng; 3,13:1ng; 4,14:100fg; 5,15:10fg; 6,16:1fg; 7,17:100pg; 8,18:10pg; 9,19:1pg; 10,20:0.1pg.
Figure 14 is for detecting electrophorogram that 4 kind different methods extract in sick soil DNAs pathogen plasmodiophora, wherein M:marker as the inner ring primer to carrying out pcr amplification to 4 to, primer as the outer ring primer to 2 with primer; 1: method one; 2: method two; 3: method three; 4: method four; 5: positive control; 6: negative control.
Figure 15 is for detecting electrophorogram that 4 kind different methods extract in sick soil DNAs pathogen plasmodiophora, wherein M:marker as the inner ring primer to carrying out pcr amplification to 4 to, primer as the outer ring primer to 5 with primer; 1: method one; 2: method two; 3: method three; 4: method four; 5: positive control; 6: negative control.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after the content of having read the present invention's instruction, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
The mensuration of area, embodiment 1 Shanghai green vegetables pathogen plasmodiophora characterization of molecules sequence
1) pathogen plasmodiophora foundation group DNA extraction
Grind the old complaint of the green vegetables of wash clean deformity enlargement levigate with liquid nitrogen, get old complaint sample adding 1mL extracting solution (the 50mmol/L Tris-HCl that 50mg grinds, 150mmol/L NaCl, 100mmol/L EDTA) in 1.5mL Eppendorf centrifuge tube, the vibration mixing, add 0.1mL 20%SDS mixing again, then centrifuge tube is placed in the shaking table 37 ℃ slowly to shake 1h, every pipe adds 0.15mL 5mol/L NaCl solution, slow mixing, add 0.13mL CTAB/NaCl solution (10%CTAB in 0.7mol/L NaCl), mixing, 65 ℃ of water-bath 20min shake 1 time every several minutes, and room temperature is put in cooling, add equal-volume chloroform/primary isoamyl alcohol, in shaking table, acutely shake 5min, 10, the centrifugal 12min of 000r/min, supernatant 12, the centrifugal 5min of 000r/min, supernatant liquor move in the new pipe, add the Virahol of 0.6 times of volume precooling,-20 ℃ of placements are spent the night, 10, the centrifugal 12min of 000rmp abandons supernatant liquor, inversion is flow to end tube wall liquid, 70% dehydrated alcohol is washed precipitation, and room temperature is placed dry 5～10min, is dissolved in 50 μ L ddH
2Among the O, add RNaseA (10 μ g/ μ L) 1 μ L, 37 ℃ of water-bath 30min ,-20 ℃ of preservations are standby.
2) pcr amplification
The pathogen plasmodiophora kan gene group DNA of said extracted acquisition is carried out the pcr amplification of germ characteristic sequence.Pcr amplification reaction system volume 20 μ L are comprising the sick sample template DNA of 1 μ L, 2 μ L, 10 * PCR reaction buffer, 2 μ LMgCl
2(25mmol/L), 2 μ L dNTPs (every kind of 2.5mmol/L), 2 μ L primer PbITS1 (10 μ mol/L), 2 μ L primer PbITS2 (10 μ mol/L), 0.4 μ L Taq enzyme (1u/ μ L) replenishes deionized water to 20 μ l.
Wherein, the sequence of described primer PbITS1, PbITS2 is as follows respectively:
PbITS1:5 ' acttgcatcgattacgtccc 3 ' (referring to SEQ ID No 6)
PbITS2:5 ' ggcattctcgagggtatcaa 3 ' (referring to SEQ ID No 7)
Amplification condition is as follows: 95 ℃ of 5min, 1 circulation; 95 ℃ of 60s, 60 ℃ of 60s, 72 ℃ of 90s, totally 35 circulations; 72 ℃ of 10min, 1 circulation.
Entrust Shanghai to give birth to the order-checking of worker's biotechnology company limited the PCR product that above-mentioned amplification obtains, obtain the characterization of molecules sequence SEQ ID No 10 of green vegetables pathogen plasmodiophora Pb-Shanghai.
Different sorts pathogenic bacteria and other different types of pathogenic soil bacterium comparison in embodiment 2 Shanghai area green vegetables pathogen plasmodiophora characterization of molecules sequence and the Plasmodiophoromycetes
Different sorts sickle-like bacteria in different sorts pathogenic bacteria and the soil in the characterization of molecules sequence of the green vegetables pathogen plasmodiophora bacterial strain of above-mentioned acquisition and the different types of pathogenic bacteria of Plasmodiophoromycetes, the Oomycete is carried out the similarity comparison respectively, seek the specific regions of green vegetables pathogen plasmodiophora bacterial strain DNA.
1) the different types of nosophyte numerator characteristic sequence of green vegetables pathogen plasmodiophora and Plasmodiophoromycetes similarity comparison (wherein, the higher base of same position same frequency indicates with grey):
A wherein: the sequence (SEQ ID No 10) that goes up Ulva lactuca L. pathogen plasmodiophora Pb-Shanghai
B:Plasmodiophora brasiccae sequence (GenBank accession number Y12831)
C:Polymyxa graminis sequence (GenBank accession number Y12824)
D:Polymyxa betae sequence (GenBank accession number Y12827)
E:Spongospora subterranea sequence (GenBank accession number Y12829)
F:Olpidium brassicae sequence (GenBank accession number Y12830)
2) the different types of nosophyte numerator characteristic sequence of green vegetables pathogen plasmodiophora and Oomycete similarity comparison (wherein, the base that the same position same frequency is the highest indicates with grey):
A wherein: the sequence (SEQ ID No 1) that goes up Ulva lactuca L. pathogen plasmodiophora Pb-Shanghai
B:Plasmodiophora brasiccae sequence (accession number Y12831)
G:Phytopathora capsici sequence (Phytophthora capsici, bacterial strain 070713-01, SEQ ID No 11)
H:Phytopathora capsici sequence (Phytophthora capsici, bacterial strain FW-Pi, SEQ ID No 12)
I:Pythium aphanidermatum sequence (the melon and fruit corruption is mould, bacterial strain CP080620-03, SEQ ID No 13)
J:Pythium μ ltimum sequence (ultimate corruption is mould, bacterial strain 090525-2, SEQ ID No 14)
K:Pythium irreg μ lare sequence (deformity is rotten mould, bacterial strain 20110303-3, SEQ ID No 15)
3) green vegetables pathogen plasmodiophora and the different types of nosophyte numerator characteristic sequence of soil sickle-like bacteria similarity comparison (wherein, the base that the same position same frequency is the highest indicates with grey):
A wherein: the sequence (SEQ ID No 1) that goes up Ulva lactuca L. pathogen plasmodiophora Pb-Shanghai
B:Plasmodiophora brasiccae sequence (accession number Y12831)
L:Fusarium oxysporum f.sp.niveum sequence (withered germ of water-melon, strain X F20000414, SEQ IDNo 16)
M:Fusarium oxysporum f.sp.melonis sequence (muskmelon wilt, bacterial strain 20101029-1-3, SEQID No 17)
N:Fusarium solani sequence (eggplant fusarium, bacterial strain 091029-1, SEQ ID No 18)
O:Fusarium proliferatum sequence (layer goes out sickle spore bacterium, bacterial strain LS080327-01, SEQ ID No 19)
P:Fusarium acuminatum sequence (sharp top sickle spore bacterium, bacterial strain 090527-02, SEQ ID No 20)
Q:Fusarium moniliformis (having another name called Gibberella moniliformis) sequence (fusarium moniliforme, bacterial strain 090527-03, SEQ ID No 21)
R:Rhizoctonia sonali sequence (dry thread Pyrenomycetes, bacterial strain Rs060522, SEQ ID No 22)
S:Rhizoctonia cerealis sequence (cereal rhizoctonia, bacterial strain 20071217-01, SEQ ID No 23)
The specific PCR of rape pathogen plasmodiophora amplification in the embodiment 3 green vegetables club root old complaints
By and the club root order in the comparison of sequence between Oomycete pathogen species and reaping hook bacterial classification in other kind, soil, it is right to design 6 primers, and the Tm value right according to primer, determine the annealing temperature of pcr amplification, then green vegetables old complaint pathogen plasmodiophora is carried out pcr amplification, amplification reaction system is identical with embodiment 1.
Amplification reaction condition is as follows: 1 circulation of 95 ℃ of 5min; 95 ℃ of 30sec, 54 ℃ of 30sec, 72 ℃ of 45sec, 35 circulations; 1 circulation of 72 ℃ of 10min.
With above-mentioned pcr amplification product through the 1%Agrose gel electrophoresis, the result shows: 6 primers that design in the test are to the target pathogenic bacteria--and green vegetables old complaint rape pathogen plasmodiophora primer is to 1,2,4,5, the 6 unique specific fragments that amplify 322bp, 353bp, 300bp, 331bp and 347bp respectively, and primer is to 3 specific fragments (referring to Fig. 1) that then do not amplify 369bp.
Wherein, six pairs of primers are as follows respectively to sequence:
Primer is to 1: forward primer PbF1:5 ' atcattaaca cagtgggcgg 3 ' (referring to SEQ ID No 1)
Reverse primer PbR1:5 ' cgcgcaaacg aacagaaa 3 ' (referring to SEQ ID No 2)
Primer is to 2: forward primer PbF1:5 ' atcattaaca cagtgggcgg 3 ' (referring to SEQ ID No 1)
Reverse primer PbR2:5 ' gcagcaaagc tcattgtctt 3 ' (referring to SEQ ID No 3)
Primer is to 3: forward primer PbF1:5 ' atcattaaca cagtgggcgg 3 ' (referring to SEQ ID No 1)
Reverse primer PbR3:5 ' tcgttcaagc tatgccgc 3 ' (referring to SEQ ID No 4)
Primer is to 4: forward primer PbF2:5 ' ctagcgctgc atcccatat 3 ' (referring to SEQ ID No 5)
Reverse primer PbR1:5 ' cgcgcaaacg aacagaaa 3 ' (referring to SEQ ID No 2)
Primer is to 5: forward primer PbF2:5 ' ctagcgctgc atcccatat 3 ' (referring to SEQ ID No 5)
Reverse primer PbR2:5 ' gcagcaaagc tcattgtctt 3 ' (referring to SEQ ID No 3)
Primer is to 6: forward primer PbF2:5 ' ctagcgctgc atcccatat 3 ' (referring to SEQ ID No 5)
Reverse primer PbR3:5 ' tcgttcaagc tatgccgc 3 ' (referring to SEQ ID No 4)
The specificity check of the pcr amplification of embodiment 4 rape pathogen plasmodiophoras
According to embodiment 3, select to carry out the check of pcr amplification specificity to 1,2,3,4 with primer.Wherein, amplification reaction system is identical with embodiment 1, and amplification reaction condition is identical with embodiment 3.
The bacterial strain of pcr amplification specificity check and originate as follows:
A. germ on the green vegetables:
Pathogen plasmodiophora (Plasmodiophora brassicae): bacterial strain 20090507, separate from white crane town, Qingpu, Shanghai magnificent king's green vegetables club root old complaint, be stored in the Shanghai City Agriculture Academy of Science Plant Protection Institute and plant the disease laboratory.
Green vegetables Bacteria erwinia (Erwinia carotovora subsp.carotovora): bacterial strain ECC070319-01, separate mortise green vegetables soft rot diseased plant from Minhang, Shanghai China, be stored in the Shanghai City Agriculture Academy of Science Plant Protection Institute and plant the disease laboratory.
Green vegetables anthrax bacteria (Colletotrichum higginsianum): bacterial strain 07072301, separate from the sick leaf of Kingsoft, Shanghai imperial garden spot green vegetables anthrax of silver, be stored in the Shanghai City Agriculture Academy of Science Plant Protection Institute and plant the disease laboratory.
Green vegetables anthrax bacteria (Colletotrichum higginsianum): bacterial strain Qc060309, planting disease by Agricultural University Of Nanjing is that professor Zhang Zhengguang gives, and is stored in the Shanghai City Agriculture Academy of Science Plant Protection Institute and plants the disease laboratory.
B. Oomycete pathogenic bacteria:
Melon and fruit corruption mould (Pythium aphanidermatum): bacterial strain Pa-NCSU, it is that professor Tredway gives that disease is planted by U.S. north card state university, is stored in the Shanghai City Agriculture Academy of Science Plant Protection Institute and plants the disease laboratory.
Ultimate corruption mould (Pythium μ ltimum): bacterial strain Pu-NCSU, it is that professor Tredway gives that disease is planted by U.S. north card state university, is stored in the Shanghai City Agriculture Academy of Science Plant Protection Institute and plants the disease laboratory.
Phytophthora capsici (Phytopathora capsici): bacterial strain 070713-01, separate from Chongming, Shanghai capsicum epidemic disease branch, be stored in the Shanghai City Agriculture Academy of Science Plant Protection Institute and plant the disease laboratory.
C. common sickle-like bacteria cause of disease bacterium in the soil:
Lily wilt (Fusarium oxysporum f.sp.lili): bacterial strain B090725, professor Zhu Maoshan of plant protection institute of Liaoning Academy of Agricultural Sciences gives, and is stored in the Shanghai City Agriculture Academy of Science Plant Protection Institute and plants the disease laboratory
Withered germ of water-melon (Fusarium oxysporum f.sp.niveum): strain X F20000414 separates from Songjiang, Shanghai watermelon blight diseased plant, is stored in the Shanghai City Agriculture Academy of Science Plant Protection Institute and plants the disease laboratory.
Strawberry Fusarium Wilt (Fusarium oxysporum f.sp.fragariae): bacterial strain 07062903, separate and collect strawberry blight diseased plant from Qingpu, Shanghai Zhao, be stored in the Shanghai City Agriculture Academy of Science Plant Protection Institute and plant the disease laboratory.
Eggplant fusarium (Fusarium solani): bacterial strain NF051128, separate and collect strawberry blight diseased plant from Qingpu, Shanghai Zhao, be stored in the Shanghai City Agriculture Academy of Science Plant Protection Institute and plant the disease laboratory.
Sharp top sickle spore bacterium (Fusarium acuminatum): 090527-02 (referring to SEQ ID No 20) separates the mortise lily bulb morbidity scale from Minhang, Shanghai China, is stored in the Shanghai City Agriculture Academy of Science Plant Protection Institute and plants the disease laboratory.
Fusarium moniliforme (Fusarium moniliformis): 090527-03 (referring to SEQ ID No 21) separates the mortise lily bulb morbidity scale from Minhang, Shanghai China, is stored in the Shanghai City Agriculture Academy of Science Plant Protection Institute and plants the disease laboratory.
Layer goes out sickle spore bacterium (Fusariumproliferatum): LS080327-01, separates from Chongming, the Shanghai asparagus underground part disease stem of falling ill, and is stored in the Shanghai City Agriculture Academy of Science Plant Protection Institute and plants the disease laboratory.
Above-mentioned described separation all refers to conventional strain separation method.
1) adopt primer to carry out other pathogenic bacteria of pcr amplification green vegetables, Oomycete pathogenic bacteria and soil sickle-like bacteria when adopting primer to carry out other pathogenic bacteria of pcr amplification green vegetables to 1 to 1, in Erwinia carotovora subsp.carotovora (green vegetables Bacteria erwinia), amplify the fragment that is slightly larger than 322bp purpose clip size, and in Colletotrichumhigginsianum (green vegetables anthrax bacteria), do not amplify any fragment (referring to Fig. 2).
When adopting primer to carry out pcr amplification Oomycete pathogenic bacteria to 1, in Phytopathora capsci (pepper anthracnose bacterium), amplify faint and the similar fragment of 322bp purpose fragment, and in Pythium aphanidermatuma (the melon and fruit corruption is mould), Pythium ultimum (ultimate corruption is mould), all do not amplify any fragment (referring to Fig. 3).
When adopting primer to carry out pcr amplification soil sickle-like bacteria, in Fusarium oxysporum f.sp.Lili (lily wilt), Fusarium oxysporum f.sp.Niveum (withered germ of water-melon), Fusarium oxysporum f.sp.Fragariae (Strawberry Fusarium Wilt), Fusarium solani (eggplant fusarium), Fusarium cuminatum (sharp top sickle spore bacterium), Fusarium moniliformis (fusarium moniliforme) and Fusarium proliferatum (fusarium prolifertum), all do not amplify any fragment to 1.
2) adopt primer to carry out other pathogenic bacteria of pcr amplification green vegetables, Oomycete pathogenic bacteria and soil sickle-like bacteria to 2
When adopting primer to carry out other pathogenic bacteria of pcr amplification green vegetables, in Erwinia carotovora subsp.carotovora (green vegetables Bacteria erwinia), Colletotrichum higginsianum (green vegetables anthrax bacteria), all do not amplify any fragment to 2.
When adopting primer to carry out pcr amplification Oomycete pathogenic bacteria, in Phytopathora capsci (pepper anthracnose bacterium), Pythium aphanidermatuma (the melon and fruit corruption is mould), Pythium ultimum (ultimate corruption is mould), all do not amplify any fragment to 2.
When primer carries out pcr amplification soil sickle-like bacteria to 2, in Fusarium oxysporum f.sp.lili (lily wilt), Fusarium oxysporum f.sp.niveum (withered germ of water-melon), Fusarium oxysporum f.sp.fragariae (Strawberry Fusarium Wilt), Fusarium solani (eggplant fusarium), Fusarium cuminatum (sharp top sickle spore bacterium), Fusarium moniliformis (fusarium moniliforme) and Fusarium proliferatum (fusarium prolifertum), all do not amplify any fragment.
3) adopt primer to carry out other pathogenic bacteria of pcr amplification green vegetables, Oomycete pathogenic bacteria and soil sickle-like bacteria to 4
When adopting primer to carry out other pathogenic bacteria of pcr amplification green vegetables, in Erwinia carotovora subsp.carotovora (green vegetables Bacteria erwinia), Colletotrichum higginsianum (green vegetables anthrax bacteria), all do not amplify any fragment to 4.
When adopting primer to carry out pcr amplification Oomycete pathogenic bacteria, in Phytopathora capsci (pepper anthracnose bacterium), Pythium aphanidermatuma (the melon and fruit corruption is mould), Pythium ultimum (ultimate corruption is mould), all do not amplify any fragment to 4.
When adopting primer to carry out pcr amplification soil sickle-like bacteria, in Fusarium oxysporum f.sp.lili (lily wilt), Fusarium oxysporum f.sp.niveum (withered germ of water-melon), Fusarium oxysporum f.sp.fragariae (Strawberry Fusarium Wilt), Fusarium solani (eggplant fusarium), Fusarium cuminatum (sharp top sickle spore bacterium), Fusarium moniliformis (fusarium moniliforme) and Fusarium proliferatum (fusarium prolifertum), all do not amplify any fragment to 4.
4) adopt primer to carry out other pathogenic bacteria of pcr amplification green vegetables, Oomycete pathogenic bacteria and soil sickle-like bacteria to 5
When adopting primer to carry out other pathogenic bacteria of pcr amplification green vegetables, in Erwinia carotovora subsp.carotovora (green vegetables Bacteria erwinia), Colletotrichum higginsianum (green vegetables anthrax bacteria), all do not amplify any fragment to 5.
When adopting primer to carry out pcr amplification Oomycete pathogenic bacteria, in Phytopathora capsci (pepper anthracnose bacterium), Pythium aphanidermatuma (the melon and fruit corruption is mould), Pythium ultimum (ultimate corruption is mould), all do not amplify any fragment to 5.
When adopting primer to carry out pcr amplification soil sickle-like bacteria, in Fusarium oxysporum f.sp.lili (lily wilt), Fusarium oxysporum f.sp.niveum (withered germ of water-melon), Fusarium oxysporum f.sp.fragariae (Strawberry Fusarium Wilt), Fusarium solani (eggplant fusarium), Fusarium cuminatum (sharp top sickle spore bacterium), Fusarium moniliformis (fusarium moniliforme) and Fusarium proliferatum (fusarium prolifertum), all do not amplify any fragment to 5.
This shows: adopt primer to carry out the specificity height of pcr amplification to 2,4,5, and adopt primer to 1 specificity of carrying out pcr amplification than primer to 2,4,5 low.
Extract total DNA in the soil with 4 kinds of different methods, 4 kinds of methods all can be extracted the dna fragmentation (referring to Fig. 4) greater than 10kb from rape club root sick soil.
1) the soil pretreatment process is as follows respectively in 4 kinds of different methods:
Method one: get the 200mg sick soil without any pre-treatment, directly carry out the extraction of DNA in the soil.
Method two: get the clean granulated glass sphere of 200mg sick soil and 200mg in the 1.5mL centrifuge tube, add 1.0mL TENPbuffer[50mmol/L Tris (pH 8.0), 20mmol/L EDTA, 100mmol/L NaCl, l% (w/v) PVP], violent vortex mixing 2min, the centrifugal 3min of 10000r/min then, abandon supernatant liquor, repetitive operation 2 times.Precipitate standby.
Method three: get the clean granulated glass sphere of 200mg sick soil and 200mg in the 1.5mL centrifuge tube, add 1.0mL and take off rotten damping fluid (100mmol/L Tris, 100mmol/L Na
4PO
7, 100mmol/L Na
2EDTA, 1.0%PVP, 100mmol/L NaCl, 0.05%Triton X-100, pH 10.0), violent vortex mixing 2min, the centrifugal 5min of 12000r/min abandons supernatant.
Method four: get the clean granulated glass sphere of 200mg sick soil and 200mg in the 1.5mL centrifuge tube, add 1.0mL and take off rotten damping fluid (100mmol/L Tris, 100mmol/L Na4PO
7, 100mmol/L Na
2EDTA, 1.0%PVP, 100mmol/L NaCl, 0.05%Triton X-100, pH 10.0), violent vortex mixing 2min, the centrifugal 5min of 12000r/min abandons supernatant.The calcium chloride solution that adds 1mL 0.5mol/L, violent vortex mixing 2min, the centrifugal 5min of 12000r/min abandons supernatant.The sodium oxalate solution (pH 7.96) that adds 1mL 0.05mol/L, violent vortex mixing 2min, the centrifugal 5min of 12000r/min abandons supernatant liquor.
2) carry out DNA extraction after the soil pre-treatment respectively:
The pretreated 200mg sick soil of above-mentioned each method is added 0.5mLDNA extracting solution [100mmol/L Tris (pH8.0) respectively, 100mmol/L EDTA, 200mmol/L NaCl, 2% (w/v) CTAB], violent vortex vibration 2-3min, add 50 μ L N,O-Diacetylmuramidases (100mg/mL), 37 ℃ of water-bath 30min, the centrifuge tube that turns upside down during this time adds 0.5mL SDS buffer[100mmol/L Tris (pH8.0), 100mmol/L EDTA after water-bath finishes for several times, 200mmol/L NaCI, 2% (w/v) SDS], 68 ℃ of water-bath 30min, during turn upside down centrifuge tube for several times.The centrifugal 5min of 10000r/min collects supernatant liquor.The Virahol that adds 2/3 times of volume ,-20 ℃ of precipitation 30min, the centrifugal 5min of 12000r/min abandons supernatant liquor.Precipitation is dissolved in 50 μ L ddH with 70% washing with alcohol 1 time after the lyophilize
2Among the O ,-20 ℃ of preservations.
Is that the outer ring primer is right with primer to 7, respectively with primer to 1,2,4,5 and 8 for the inner ring primer extracts rape pathogen plasmodiophora in the soil DNAs to carrying out 4 kinds of different methods of nest-type PRC amplification, amplification reaction system is identical with embodiment 1.
The outer ring primer is right--and primer to 7 pcr amplification reaction condition is: 95 ℃ of 5min, 1 circulation; 95 ℃ of 60s, 60 ℃ of 60s, 72 ℃ of 90s, totally 35 circulations; 72 ℃ of 10min, 1 circulation.
The inner ring primer is right--and primer to 1,2,4,5 and 8 pcr amplification reaction condition is: 1 circulation of 95 ℃ of 5min; 95 ℃ of 30sec, 54 ℃ of 30sec, 72 ℃ of 45sec, 35 circulations; 1 circulation of 72 ℃ of 10min.
Primer amplifies the target fragment (result is referring to Fig. 5) of 322bp respectively from method 2, method 4 to 1 nest-type PRC to 7/ primer.
Primer amplifies the target fragment (result is referring to Fig. 6) of 353bp respectively from method 2, method 4 to 2 nest-type PRC to 7/ primer.
Primer amplifies the target fragment of 300bp to 7/ primer respectively to 4 nest-type PRC from method 2, method 3, method 4, but amplifies fragment weak (result is referring to Fig. 7) in the method 3.
Primer amplifies the target fragment (result is referring to Fig. 8) of 331bp respectively from method 2, method 4 to 5 nest-type PRC to 7/ primer.
Primer only amplifies the target fragment (result is referring to Fig. 9) of 507bp from method 2 to 8 nest-type PRC to 7/ primer.
This shows: right as the inner ring primer, primer is the highest to 4 its detection sensitivities, can extract in the soil DNAs 3 kinds of methods and detect the rape pathogen plasmodiophora, but in method 3, amplify fragment a little less than; Primer takes second place to 5,2,1, can detect the rape pathogen plasmodiophora from 2 kinds of methods, and wherein primer is the brightest to 5 dna fragmentations that increase is primer to the most responsive in 5,2,1; Primer only can detect the rape pathogen plasmodiophora to 8 from a kind of method.
Wherein, primer is to 1,2,4,5 referring to embodiment 3, and primer is as follows respectively to 7 and 8 sequences:
Primer is to 7: forward primer PbITS1:5 ' acttgcatcg attacgtccc 3 ' (referring to SEQ ID No 6)
Reverse primer PbITS2:5 ' ggcattctcg agggtatcaa 3 ' (referring to SEQ ID No 7)
Primer is to 8: forward primer PbITS6:5 ' caacgagtca gcttgaatgc 3 ' (referring to SEQ ID No 8)
Reverse primer PbITS7:5 ' tgtttcggct aggatggttc 3 ' (referring to SEQ ID No 9)
Primer can be with reference to following document to 7 and 8:
Faggian，R.，Bulman，S.R.，Lawrie，A.C.，and?Porter，I.J.1999.Specific?polymerase?chain?reaction?primers?for?the?detection?of?Plasmodiophora?brassicae?in?soil?and?water.Phytopathology?89：392-397.
1) green vegetables club root old complaint DNA extraction method is as follows:
Get green vegetables club root old complaint adding 0.5mL DNA extraction liquid [the 100mmol/L Tris (pH8.0) that the 50mg liquid nitrogen grinds, 100mmol/L EDTA, 200mmol/L NaCl, 2% (W/V) CTAB], violent vortex vibration 2-3min, add 50 μ L N,O-Diacetylmuramidases (100mg/mL), 37 ℃ of water-bath 30min, the centrifuge tube that turns upside down during this time adds 0.5mL SDS buffer[100mmol/L Tris (pH8.0), 100mmol/L EDTA after water-bath finishes for several times, 200mmol/L NaCI, 2% (W/V) SDS], 68 ℃ of water-bath 30min, during turn upside down centrifuge tube for several times.The centrifugal 5min of 10000r/min collects supernatant liquor.The Virahol that adds 2/3 times of volume ,-20 ℃ of precipitation 30min, the centrifugal 5min of 12000r/min abandons supernatant liquor.Precipitation is dissolved in 50 μ L ddH with 70% washing with alcohol 1 time after the lyophilize
2Among the O ,-20 ℃ of preservations.
2) pcr amplification
50mg liquid nitrogen ground green vegetables club root old complaint is extracted total DNA and is dissolved in 50 μ L ddH
2O.Get 1 μ L DNA stoste (being equivalent to 1mg old complaint DNA), 10 respectively
-1(100 μ g old complaint DNA), 10
-2(10 μ g old complaint DNA), 10
-3(1 μ g old complaint DNA), 10
-4(100ng old complaint DNA), 10
-5(10ng old complaint DNA) diluent carries out pcr amplification as template, and amplification reaction system is identical with embodiment 1.
Primer to 2,5 amplification pcr amplification condition is: 1 circulation of 95 ℃ of 5min; 95 ℃ of 30sec, 54 ℃ of 30sec, 72 ℃ of 45sec, 35 circulations; 1 circulation of 72 ℃ of 10min.
Primer to 7 amplification pcr amplification condition is: 95 ℃ of 5min, 1 circulation; 95 ℃ of 60s, 60 ℃ of 60s, 72 ℃ of 90s, totally 35 circulations; 72 ℃ of 10min, 1 circulation.
The result shows: primer all can minimumly detect rape club root germ (referring to Figure 10,11,12) to 2,5 and 7 pcr amplifications that carry out from 1 μ g green vegetables club root old complaint.
To 7 for the outer ring primer carries out the specific amplification of rape pathogen plasmodiophora to green vegetables club root old complaint DNA, amplify the target dna fragment of 1087bp with primer.First round PCR product is diluted to 100ng, 10ng, 1ng, 100pg, 10pg, 1pg, 100fg, 10fg, 1fg and 0.1pg totally 10 extent of dilution, is that the inner ring primer is to carrying out the second nest-type PRC amplification of taking turns with primer to 4 and 8 respectively.Amplification reaction system is identical with embodiment 1.
The outer ring primer is right--and primer to 7 pcr amplification reaction condition is: 95 ℃ of 5min, 1 circulation; 95 ℃ of 60s, 60 ℃ of 60s, 72 ℃ of 90s, totally 35 circulations; 72 ℃ of 10min, 1 circulation.
The inner ring primer is right--and primer to 4,8 nest-type PRC amplification reaction condition is: 1 circulation of 95 ℃ of 5min; 95 ℃ of 30sec, 54 ℃ of 30sec, 72 ℃ of 45sec, 35 circulations; 1 circulation of 72 ℃ of 10min.
The result shows: the inner ring primer can increase 1fg first round outer ring primer to 7 pcr amplification product to 4 nest-type PRC, and the inner ring primer only can increase 10pg first round outer ring primer to 7 pcr amplification product (referring to Figure 13) to 8 nest-type PRC, this shows that primer is significantly higher than primer to 8 to 4 PCR nido augmentation detection sensitivity.
The optimization of the pcr amplification of rape pathogen plasmodiophora among the total DNA of embodiment 9 soil
Respectively with primer to 5 and primer to 2 as the outer ring primer to, with primer to 4 as the inner ring primer to the rape pathogen plasmodiophora in the soil DNA that carries out 4 kinds of different methods of nest-type PRC amplification and extract, amplification reaction system is identical with embodiment 1.
Outer ring, inner ring primer are the pcr amplification reaction condition: 1 circulation of 95 ℃ of 5min; 95 ℃ of 30sec, 54 ℃ of 30sec, 72 ℃ of 45sec, 35 circulations; 1 circulation of 72 ℃ of 10min.
Primer all amplifies the rape club root target dna fragment (referring to Figure 14) of 300bp from the total DNA that extracts according to method two, method three and method four pretreated sick soils to 4 nest-type PRC to 2/ primer.
Primer all amplifies the rape club root target dna fragment of 300bp to 5/ primer to 4 nest-type PRC from the total DNA that extracts according to method two, method three and method four pretreated sick soils, the fragment more clear and bright (referring to Figure 15) that its amplified fragments amplifies 4 nest-type PRC 2/ primer than primer.
Claims (7)
1. the PCR method for detecting specificity of pathogen plasmodiophora in the soil is characterized in that, according to the primer of the design of the 1-1028 bit sequence among the SEQ ID No 10 shown in SEQ ID No 1,2,3,5, forms primer and carries out specific PCR to 2,4,5 and detect.
2. the PCR method for detecting specificity of pathogen plasmodiophora is characterized in that in the soil according to claim 1,
Primer to the sequence of 2 forward primer PbF1 and reverse primer PbR2 respectively shown in SEQ ID No 1,3;
Primer to the sequence of 4 forward primer PbF2 and reverse primer PbR1 respectively shown in SEQ ID No 5,2;
Primer to the sequence of 5 forward primer PbF2 and reverse primer PbR2 shown in SEQ ID No 5,3.
3. the PCR method for detecting specificity of pathogen plasmodiophora is characterized in that in the soil according to claim 1, and is right as the outer ring primer to 2,5 with primer, carries out pcr amplification.
4. the PCR method for detecting specificity of pathogen plasmodiophora is characterized in that in the soil according to claim 1, and is right as the inner ring primer to 4 with primer, carries out the nest-type PRC amplification.
5. the PCR method for detecting specificity of pathogen plasmodiophora is characterized in that in the soil according to claim 1, and is right as the outer ring primer to 2 or 5 with primer, right as the inner ring primer to 4 with primer, carries out pcr amplification.
6. the described PCR method for detecting specificity of claim 1～5 application in the pathogen plasmodiophora detection in soil.
7. the extension of forward primer PbF1, PbF2 and reverse primer PbR1, PbR2 and sequence thereof or the shortening sequence application in the pathogen plasmodiophora detection in soil.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110265290 CN102296120B (en) | 2011-09-08 | 2011-09-08 | Specific PCR detection method for plasmodiophora brassicae in soil |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110265290 CN102296120B (en) | 2011-09-08 | 2011-09-08 | Specific PCR detection method for plasmodiophora brassicae in soil |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102296120A true CN102296120A (en) | 2011-12-28 |
| CN102296120B CN102296120B (en) | 2013-03-27 |
Family
ID=45356795
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110265290 Active CN102296120B (en) | 2011-09-08 | 2011-09-08 | Specific PCR detection method for plasmodiophora brassicae in soil |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102296120B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104232782A (en) * | 2014-09-29 | 2014-12-24 | 云南省烟草农业科学研究院 | PCR (polymerase chain reaction) primer for detecting tobacco soil-borne fungal pathogens as well as application and method of PCR primer |
| CN104694658A (en) * | 2015-03-19 | 2015-06-10 | 中国农业大学 | Detection method for phytopathogen content in soil |
| CN106636401A (en) * | 2016-12-22 | 2017-05-10 | 福建省农业科学院植物保护研究所 | Anoectochilus roxburghii stalk rot pathogen molecular detection primers and detection method thereof |
| CN107557445A (en) * | 2017-10-31 | 2018-01-09 | 青岛农业大学 | Detection causes the nucleic acid, kit and method of begonia damping-off, spot disease and powdery mildew pathogen simultaneously |
| CN107893124A (en) * | 2017-12-15 | 2018-04-10 | 浙江大学 | A kind of primer and authentication method for Rapid identification crucifer club root |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1934951A (en) * | 2006-09-27 | 2007-03-28 | 宁夏大荣化工冶金有限公司 | Pesticide for preventing and treating stemmustard disease and its use method |
-
2011
- 2011-09-08 CN CN 201110265290 patent/CN102296120B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1934951A (en) * | 2006-09-27 | 2007-03-28 | 宁夏大荣化工冶金有限公司 | Pesticide for preventing and treating stemmustard disease and its use method |
Non-Patent Citations (2)
| Title |
|---|
| 吕理: "十字花科蔬菜根肿病", 《云南农业大学学报》, vol. 17, no. 2, 30 June 2002 (2002-06-30) * |
| 杨佩文等: "十字花科蔬菜根肿病菌休眠孢子的分离与检测", 《云南农业大学学报》, vol. 17, no. 3, 30 September 2002 (2002-09-30) * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104232782A (en) * | 2014-09-29 | 2014-12-24 | 云南省烟草农业科学研究院 | PCR (polymerase chain reaction) primer for detecting tobacco soil-borne fungal pathogens as well as application and method of PCR primer |
| CN104694658A (en) * | 2015-03-19 | 2015-06-10 | 中国农业大学 | Detection method for phytopathogen content in soil |
| CN106636401A (en) * | 2016-12-22 | 2017-05-10 | 福建省农业科学院植物保护研究所 | Anoectochilus roxburghii stalk rot pathogen molecular detection primers and detection method thereof |
| CN107557445A (en) * | 2017-10-31 | 2018-01-09 | 青岛农业大学 | Detection causes the nucleic acid, kit and method of begonia damping-off, spot disease and powdery mildew pathogen simultaneously |
| CN107557445B (en) * | 2017-10-31 | 2020-06-16 | 青岛农业大学 | Nucleic acid, kit and method for simultaneously detecting pathogen causing blight, spot disease and powdery mildew of begonia |
| CN107893124A (en) * | 2017-12-15 | 2018-04-10 | 浙江大学 | A kind of primer and authentication method for Rapid identification crucifer club root |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102296120B (en) | 2013-03-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Postma et al. | Effect of successive cauliflower plantings and Rhizoctonia solani AG 2-1 inoculations on disease suppressiveness of a suppressive and a conducive soil | |
| Paradis et al. | The combined effect of arbuscular mycorrhizas and short‐term cold exposure on wheat | |
| CN102296120B (en) | Specific PCR detection method for plasmodiophora brassicae in soil | |
| Trojanová et al. | Methodology of virulence screening and race characterization of Plasmopara halstedii, and resistance evaluation in sunflower–a review | |
| Narasimha Murthy et al. | Induction of systemic resistance in tomato against Ralstonia solanacearum by Pseudomonas fluorescens | |
| CN100427927C (en) | Green smut bug real-time fluorescent quantitative PCR test kit and its use | |
| CN103966307A (en) | Fluorescent quantitative PCR detection technology of brassicaceous vegetable plasmodiophoromycetes, and its application | |
| Haapalainen et al. | Frequency and occurrence of the carrot pathogen ‘Candidatus Liberibacter solanacearum’haplotype C in Finland | |
| Lazreg et al. | Pathogenicity of Fusarium spp. associated with diseases of Aleppo-pine seedlings in Algerian forest nurseries. | |
| Cao et al. | Quantifying resistance to P lasmodiophora brassicae in B rassica hosts | |
| Wang et al. | Race distribution and distribution of sensitivities to mefenoxam among isolates of Phytophthora parasitica var. nicotianae in Guizhou province of China | |
| d'Entremont et al. | Examining arbuscular mycorrhizal fungi in saltmarsh hay (Spartina patens) and smooth cordgrass (Spartina alterniflora) in the Minas Basin, Nova Scotia | |
| Feng et al. | Pathogenicity and fungicide sensitivity of Pythium and Phytopythium spp. associated with soybean in the Huang‐Huai region of China | |
| Gent et al. | PCR detection of Pseudoperonospora humuli in air samples from hop yards | |
| XU et al. | Species-specific PCR-based assays for identification and detection of Botryosphaeriaceae species causing stem blight on blueberry in China | |
| CN103205504A (en) | Real-time fluorescence quantification PCR (Polymerase Chain Reaction) method for detecting ustilago scitaminea | |
| CN104726595B (en) | The multiple PCR detection kit and its primer special and multi-PCR detection method of three kinds of bacillary seed-borne diseases | |
| Karlsson et al. | Quantification of host and pathogen DNA and RNA transcripts in the interaction of Norway spruce with Heterobasidion parviporum | |
| Zhang et al. | Identification of a specific SCAR marker for detection of Tilletia foetida (Wall) Liro pathogen of wheat | |
| Khumalo | Lucerne (Medicago sativa L.) establishment after inoculation with different carriers of Ensifer meliloti sown on five dates at Lincoln University | |
| Kwaśna et al. | Microbiota in wheat roots evaluated by cloning of ITS1/2 rDNA and sequencing | |
| Ramchandra et al. | Morphological and molecular identification of Fusarium isolated from cumin wilt. | |
| Verdier et al. | Cassava bacterial blight, caused by Xanthomonas axonopodis pv. manihotis | |
| CN102864221A (en) | Polymerase chain reaction (PCR) detection method for colletotrichum falcatum went | |
| CN103451189A (en) | Cotton homologous structure field transcription factor gene GbHDTF1 and and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |