WO2014169920A2

WO2014169920A2 - Use of a microbial composition for the degradation of keratinaceous materials

Info

Publication number: WO2014169920A2
Application number: PCT/DK2014/050098
Authority: WO
Inventors: Lene Lange; Peter Kamp Busk; Huang YUHONG
Original assignee: Aalborg Universitet
Priority date: 2013-04-19
Filing date: 2014-04-15
Publication date: 2014-10-23
Also published as: WO2014169920A3

Abstract

The present invention relates to the use of a microbial composition for the degradation of keratinaceous materials. The present invention also pertains to a method for the degradation of keratinaceous materials and compositions comprising a degraded keratinaceous material.

Description

USE OF A MICROBIAL COMPOSITION FOR THE DEGRADATION OF KERATINACEOUS MATERIALS

Technical field of the invention

Background of the invention

In the last decades, poultry-processing plants produce huge quantities feather and pig bristle wastes annually. The large amount of feathers discarded as garbage causes a serious local disposal and accumulative problem leading to environmental pollution and influence human living, β-keratin, a kind of scleroids protein, is the most abundant (90% dry matter) and important structural protein found in feathers (KorniWowicz-Kowalska and Bohacz, 2010). The compound is very resistant to the action of weak acids, alkalis, ethanol, solution or hydrolysis of the common proteolytic enzymes such as trypsin, pepsin and papain due to a high degree of cross-linking by disulfide bonds, hydrogen-bonding and hydrophobic interaction (Riffel et al., 2011). The high content of cysteine residues (3-15%) contribute to keratin stability by forming disulphide bridges between different twists in a single peptide chain and between chain in keratin. Keratin with many cysteine is highly resistant to enzymatic hydrolysis (Mercer, 1957). It is reported that the content of cysteine and cystine in bird feathers reaches 15% (Czeczuga et al., 2004), indicating that feather is very difficult to degrade. Application of physical and chemical methods to convert feathers into feather meal resulted in the loss of

nutritionally essential amino acids and formation of non-nutritive amino acids (Dalev et al., 1997). Biological processes have been studied in respect of keratin degradation. Several species of bacteria (Bacillus sp., Bacillus licheniform, B. subtilis and Streptomyces sp.) (Esawy, 2007; Lin et al., 1992), actinomycetes (Ichida et al., 2001) and fungi (Trichophyton sp., Microsporum sp., Aspergillus sp., Rhizomucor sp., Trichoderma sp. and Chrysosporium sp.) (Avasn Maruthi et al., 2011; Cao et al., 2008; Kim, 2005) are well known for byconversion of feather wastes due to the elaboration of keratinolytic proteases.

Keratinases (EC 3.4.21/24/99.11), are robust enzymes that are mostly serine or metallo proteases (Gupta and Ramnani, 2006). Keratinases have multitude industrial application such as detergent additives, food and feed modification to upgrade the nutritional value of feather meal, dehairing of leather , medicine, cosmetics, biodegradable films and coatings and degrading prions to treat the dreaded mad cow disease. In the industrial enzyme market, the available proteases are mainly from Bacillus strains and the industrial application and commercial exploitation of keratinase is still in the stage of infancy.

Hence, there is a need in the art for an improved conversion of keratinaceous materials such as feather into re-usable materials.

Summary of the invention

Thus, an object of the present invention relates to the use of a microbial composition for the degradation of keratinaceous materials.

In particular, it is an object of the present invention to provide uses and methods that solves the above mentioned problems of the prior art.

Thus, one aspect of the invention relates to the use of (i) one or more

Ascomycetous fungal species, (ii) one or more Basidiomycetous fungal species and/or (iii) microbial products from (i) and/or (ii) for the degradation of keratinaceous materials.

Another aspect of the present invention relates to the use of one or more protein(s) from one or more Ascomycetous fungal species and/or one or more Basidiomycetous fungal species for the degradation of keratinaceous materials.

Yet another aspect of the present invention is to provide a method for the degradation of keratinaceous materials comprising the steps of:

- adding to a keratinaceous material, (i) one or more Ascomycetous fungal species, (ii) one or more Basidiomycetous fungal species, (iii) microbial products from (i) and/or (ii) and/or (iv) one or more protein(s) secreted from one or more Ascomycetous fungal species and/or one or more protein(s) secreted from one or more Basidiomycetous fungal species, and

- obtaining a degraded keratinaceous material.

Still another aspect of the present invention is to provide a composition comprising one or more protein(s) comprising an amino acid sequence selected from the group consisting of:

(i) An amino acid sequence as defined by any one of the SEQ ID NOs: 2, 4, 6, 8 or 10

(ii) A functionally equivalent part of an amino acid sequence as defined in (i); and

(iii) A functionally equivalent analogue of an amino acid sequence as defined in (i) or (ii), the amino acid sequence of said analogue being at least 84% identical to an amino acid sequence as defined in (i) or (ii).

Another aspect of the present invention is to provide a composition comprising (i) one or more Ascomycetous fungal species and/or one or more

Basidiomycetous fungal species and/or microbial products from (i) and (ii) a keratinaceous material.

Another aspect of the present invention relates a feed comprising the degraded keratinaceous material obtained by the method of the present invention.

A further aspect of the present invention relates to a food product comprising the degraded keratinaceous material obtained by the method of the present invention.

Yet another aspect of the present invention relates to a cosmetic product comprising the degraded keratinaceous material obtained by the method of the present invention.

Another aspect of the present invention relates to a pharmaceutical composition comprising the degraded keratinaceous material obtained by the method of the present invention. The strive for unlocking the potentials of nature ^'s enzymes specialized in converting keratinaceous materials into biologically accessible proteins, peptides and amino acids led to looking into the capability of the secreted enzymes from fungi specialized in growing on feather, bristles, hooves, wool and hair; and at the same time avoiding the human pathogens among such fungi. The most highly specialized keratin growing fungus, Onygena corvina Alb. & Schwein. 1805 showed from the very first experiments extraordinary potentials for decomposing keratinaceaous materials. O. corvina grows preferably on feather (β-keratin, figure 1); a very closely related species O. equina grows on hooves (a-keratin). (Among the other Onygena species, O. piligena grows on human nails; and the substrate specificity of O. apus has not been very well described). The keratinase activity of O. corvina was so promising (figures 2 and 3) that it led to continued and determined studies of the enzymes involved in order to unravel the basis for such interesting (first documented ultimo 2012) keratin degrading capabilities: Genome sequencing; bioinformatic analysis; protease prediction; cloning and expression; protease characterization. Mass spectrometry (MS) analysis of the secretome protease composition. Fractionation of the supernatant of the O. corvina culture broth. Activity testing on artificial as well as real item substrates of both partially purified fractions from culture broth, recombinantly expressed enzymes and combinations hereof; and lastly, of use of MS data for identifying the proteases present in the active culture broths and fractions. This endaveour provided basis and evidence to substantiate that the culture broth of Onygena species in its entirety can provide complete degradation of both a- and β-keratin; that blend compositions such as two endo-acting, and two exo-acting keratinases (>687 | 7 | (SEQ ID NO: 1 and 2) and > 1165 | 2 | (SEQ ID NO: 9 and 10) in S8 family and >642 | 3 | (SEQ ID NO: 3 and 4) and >802 | 5 | (SEQ ID NO: 7 and 8) in M28 family); or one endo-acting protease >687| 7 | (SEQ ID NO: 1 and 2, S8 family), one exo-acting protease >642| 3 | (SEQ ID NO: 3 and 4, M28 family), with one metalloprotease >839 | 3 | (SEQ ID NO: 5 and 6, M3 family); or one endo-acting protease >687 | 7 | (SEQ ID NO: 1 and 2, S8 family) alone could result in such successful keratin decomposition. All such five enzymes from O. corvina are novel; identity to closest related known sequences are 72-84%. This difference provide basis for understanding the improved performance and gives room for further evolution, engineering, mutation or shuffling of keratinases of Onygena for even more improved performance and stability. Brief description of the figures

Figure 1 shows feather Stalkball (Onygena corvina) as it grows in nature on feather. Lange and Hora, 1963

Figure 2A is showing the type of duck feather used as substrate in present work. Figure 2B shows to the left an apparently totally decomposed duck feather after treatment with Onygena corvina inoculum, holding both microbial biomass and protease rich supernatant; in the middle, similarly but treated with Trichoderma asperellum -some decomposition is also taking place but much less; to the right, negative control without inoculum

Figure 3 shows pig bristles cut in small pieces, submerged in 2xMcIlvaine buffer, pH 8: To the left (A) with Onygena corvina culture broth supernatant added; and to the right (B) with no supernatant added. Visual inspection indicates almost total degradation of the pig bristles in A.

Figure 4 shows time course recordings of development in protease and keratinase activity in culture broth supernatant from Onygena corvina growing on 1.5 % duck feather. Release of soluble protein from the substrate and of thio-groups also appears from the graph.

Figure 5 shows the influence of different initial pH on the protease and keratinase activity in culture broth supernatant from Onygena corvina growing on 1.5 % duck feather indicates a maximum between pH 6 and pH 8.

Furthermore, the weight loss of the substrate, the release of soluble protein from the substrate, and the release of thio-groups are shown.

Figure 6 shows the influence of different amounts of feather in the production medium on the level of protease activity.

Figure 7 shows the difference in keratinolytic capabilities of Onygena corvina and Trichoderma asperellum.

Figure 8 shows the eEffect of pH and pH stability (above) and of temperature and thermo stability (below) on the activity of protease from Onygena corvina Figure 9 Zymogram showing the apparent size of the proteases from Onygena corvina: (A) molecular weight marker, (B) SDS-PAGE of the crude enzyme preparation, (C) zymogram of the crude enzyme preparation.

Figure 10 Spectrum of protease families in Onygena corvina genome, with indication of how many representatives from each family.

Figure 11 shows a comparative analysis of protease repertoire between a selection of keratin-degrading (to the left) and non-keratin-degrading fungi (to the right), used as basis for selecting keratinase genes characteristic for keratin decomposers.

Figure 12 shows SDS-PAGE of purified recombinant proteases. Proteases >687| 7 | SEQ ID NO: 2 and >399 |8 | were loaded on 12% and 10% (w/v) polyacrylamide gel, respectively. Gels were silver stained using the Pierce Silver Stain Kit (Thermo scientific). Ladder: Page Ruler Plus Pre stained Protein Ladder, 10 to 250 kDa.

Figure 13 shows Mass spectrometry data, identifying protease genes found in Onygena corvina secretome when grown on chicken feather and pig bristles for 11 days.

Figure 14 shows the elution profile of protease from the cation exchange column 5 ml HiTrap SP with 50 mM citrate buffer, pH 3.86. Culture broth supernatant (50ml) was applied to the column and a gradient from 0-lM NaCI was applied to elute the column-bound protein.

Figure 15 shows the elution profile of protease from anion exchange column 1 ml HiTrap Q with 20 mM Tris buffer, pH 8.6. Culture broth supernatant (50ml) was applied to the column and a gradient from 0-lM NaCI was applied to elute the column-bound protein.

Figure 16 shows the degree of degradation of pig bristles by treatment with different fractions. (A: anion exchanged fractions; C: cation exchanged fractions). Fractions C15 and C20 resulted in the strongest degradation.

Explanations: >687 | 7 | is the purified recombinant protease (gene SEQ ID NO: 1, protein SEQ ID NO: 2) expressed in Pichia. Positive controls: culture broth supernatant from Onygena corvina, grown for 11 days on fermentation medium with pig bristle (P) and chicken feather (C), respectively. Negative control : 0.05 ml fraction was replaced by 0.05 ml 2x Mcllvaine buffer (pH 8) and incubated at 40 °C for 24 h with constant agitation at 1000 rpm.

Figure 17 shows the degree of degradation of pig bristles by treatment with a blend of different fractions (A: anion exchanged fractions; C: cation exchanged fractions). Blend of C15 and C20 indicate synergistic effect of blending the two fractions. Positive controls: culture broth supernatant from Onygena corvina, grown for 11 days on fermentation medium with pig bristle (P) and chicken feather (C), respectively. Negative control : 0.05 ml fraction was replaced by 0.05 ml 2x Mcllvaine buffer (pH 8) and incubated at 40 °C for 24 h with agitation at 1000 rpm.

Figure 18 shows the degree of degradation of pig bristles by treatment with purified recombinant protease and blend of fractions (A: anion exchanged fractions; C: cation exchanged fractions). Apparently the recombinant protease >687 | 7| did not give any additional activity when added to C15, C20, A10, or All. >687 |7 | is the purified recombinant protease (gene SEQ ID NO: 1, protein SEQ ID NO: 2) expressed in Pichia. Positive control : culture broth supernatant from Onygena corvina, grown for 11 days on fermentation medium with pig bristle (P) and chicken feather (C), respectively. Negative control : 0.05 ml fraction was replaced by 0.05 ml 2x Mcllvaine buffer (pH 8) and incubated at 40 °C for 24 h with constant agitation at 1000 rpm.

Figure 19 shows the degree of degradation of pig bristles by treatment for 4 days with total supernatant culture broth and with fractions of culture broth supernatant. C15 and C20 are cation exchanged fractions. Fraction C15+0.5 mM EDTA: 0.05 mM metallo peptidase inhibitor Ethylene diamine tetra acetic acid (EDTA) was added when C15 fraction degrade pig bristles. Culture broth supernatant treatment of pig bristles: culture broth supernatant of Onygena corvina grown on pig bristles for 11 days. Culture broth supernatant treatment of chicken feather: culture supernatant after Onygena corvina grown on chicken feather for 11 days. Negative control : 0.05 ml fraction was replaced by 0.05 ml 2x Mcllvaine buffer (pH 8) and incubated at 40 °C with agitation at 1000 rpm.

Figure 20 shows the degree of degradation of pretreated bristles and hooves (source: slaughter house) by treatment for 4 days with culture broth

supernatant of Onygena corvina grown for 11 days on chicken feather. Negative control : 0.05 ml fraction was replaced by 0.05 ml 2x Mcllvaine buffer (pH 8) and incubated at 40 °C with agitation at 1000 rpm.

The present invention will now be described in more detail in the following. Detailed description of the invention

The point of departure for the current invention was the following : So far protease enzymes with potentials for decomposition of keratin in natural materials such as feather (predominantly β-keratin) and hair, wool, and bristles (predominantely a-keratin) has been found and described primarily from fungi that invade animal skin and belong to the group of human

dermatophytes/human pathogens. Furthermore, multiple proteases have been associated with keratin degradation due to that the often broad spectered saprotrophic non-specialized fungus in question is able to grow also on keratinaceous materials also (ex Trichoderma spp, Chrysosporium spp,

Penicillium spp) -for details see Table 1 and prior art section above. For safety reasons the human pathogens / human derpatophytes are not acceptable as production host for enzyme blends for industrial purposes. Further, human pathogens are not preferred choice as origin of genes for recombinant expression of industrially relevant enzymes as the resulting enzymes may have a strong inherent risk for workers and end user health. Among the saprotroph non-keratin specializing fungi no single enzymes or blend of enzymes with strong keratin decomposition potentials have been found. Therefore the start of this endavour was to find a fungus which as its natural habitat was specialized to grow specifically on feather, hooves, horn, and hair incl bristles. And that is had no association or track record as human pathogen what so ever. Such an invention would optimally provide basis for developing an industrially relevant enzyme composition to be used to decompose both a- and β-keratin, viz feather, hooves, horn, and hair incl bristles into bio-accessible proteins, peptides and amino acids; hereby unlocking the potentials of an, in global scale, very substantial protein resource for use as animal feed (and maybe also for essential protein nutrition and treatment for humans).

Growing O. corvina on feather and analyzing the resulting culture broth (in total or supernatant alone) gave an astonishing result. Both fungus and culture broth broke down the substrate efficiently. Being bristles, or feather, representing a- and β-keratin, respectively it was observed to be broken down completely. The result was that what started as pieces of keratinaceous materials in a clear, minimal liquid medium ended up in being a liquid in which the remnants of the keratinaceous materials was dissolved (Figures 2 and 3).

Genome sequencing resulted, however, in a very long and extensive list of proteases belonging to a very wide spectrum af protease families. Modern industrial biotechnology have shown that commercially viable industrially applicable, (viz. fitting within the rather low priced window of opportunity) are products composed of a single recombinantly expressed (in extraordinarily high yield), as e.g. enzymes for textile, detergents and animal feed purposes. The next phase contributing to the successful invention was to unlock the

surprisingly strong and overall keratin decomposition ability of the wild type blend of proteases, developed through evolution of the specialized fungus (O. onygena/O. equina). Note: keratinaceous materials as feather and hair, consist of several differently packed and layered proteinaceous structures. Still culture broth of just one fungus could result in what appears to be complete

decomposition (see Fig. 2).

Very surprisingly it was possible to connect the strong keratin-degrading capability of O. corvina/O. quinea to only very few specific protease genes. This conclusion could be reached after a long series of investigations, approaching the resolution from three different angles (genomics, bioinformatics-based predictions, cloning, expression and characterization; MS elucidation of protein composition; and fractionation of supernatant of culture broth). Activity testing on artificial substrates followed up by activity testing on real item materials (on duck feather and pig bristles) and use of the MS results to deduct identity of proteins present in the active fractions and for selecting most promising proteases to express gave a very surprising result:

The interesting activity observed, documented and confirmed from culture broth of O. corvina, originates from just in all 5 novel genes. There are no record in GenBank or literature about sequencing enzyme genes of O. corvina (or O. equina); and also no record on characterizing enzyme genes of same species. These 5 genes belong to just 3 protein families (S8 (two, endo- acting, >687| 7 | (SEQ ID NO: 1 and 2) and > 1165 | 2 | (SEQ ID NO: 9 and 10)); M28 (two, exo-acting, >642 | 3 | (SEQ ID NO: 3 and 4) and >802 | 5 | (SEQ ID NO: 7 and 8)), M3 (metalloprotease, >839 | 3 | (SEQ ID NO: 5 and 6)) and most of such activity can presumably be achieved by using just 3 of these proteases, one from each family; and more specifically just two of such enzymes, one endo-acting and one exo-acting, may be needed to achieve sufficient

decomposition; and even more specifically only one enzyme >687| 7 | (SEQ ID NO: 1 and 2, S8) may have, or can be engineered to have, sufficient activity to provide keratin decomposition to bioaccessible proteins, peptides and amino acids to make up a product for converting keratinaceous waste materials into valuable protein rich animal feed ingredient.

The five genes documented to have specifically interesting and convincing a- and β-keratin degrading capabilities are belonging to the same protein families as the well known keratin-acting proteases from the human pathogens

Trichophyton spp. The sequence identity is, however, found to be only between 72 and 84 percent. The sequence differences are interpreted to be the basis for this very strong performance of the newly discovered protease genes from the genus Onygena, more specifically O. corvina / O. equina.

It is assumed that the wild type genes can be even further improved by artificial evolution of each of the genes (random and targeted mutations; linker engineering; domain and family shuffling etc). Further, hybride genes between the two selected M28 and the two S8 genes may lead to even stronger exo- and endoacting enzymes, respectively.

Furthermore, expression of such 1, 2, 3, 4, or 5 genes into one expression and production host may give basis for a production host with capability for in one fermentation to give the strongest blend of enzymes for breaking down keratin to proteins (peptides and amino acids).

Sources of fungal keratinase

Microorganisms are the most important sources of keratinolytic enzymes and a broad spectrum of reports of keratin growing microbes are published (see Table 1). Surprisingly as of today there is still not any widely acceptyed, efficient and commercialized process for breaking down keratinaceous, animal derived bio- waste or bio-side stream products. It is reported that a vast variety of bacteria, actinomycetes and fungi are keratin degraders. A large proportion of

commercially protease originate from Bacillus strains but the unexploited resource of fungal keratinolytic enzymes has great potential for industrial applications is being increasingly realized. In Table 1, the most keratinolytic fungi are listed.

Onygena corvina (feather stalkball) and O. equina (horn stalkball), both species of the fungal genus Onygena in the Onygenaceae family, can live as

saprophytes on horns, hooves, feathers and animal hair, incl pig bristles. As a nondermatophytic fungi, these species have great potential for industrial keratin decomposition e.g. feather decomposition and upgrade used for food and feed ingredients and biotechnological applications. Many Onygenales are keratinophilic fungi that either behave as saprophyte on keratin substrate or are pathogens of birds, mammals and human (Doveri et al., 2012). However, little is known about the keratinolytic potential of Onygena spp, more

specifically O. corvina /O. equina. Only the ecological niche and keratinaceaous substrate colonization of these species have been described.

The present study aimed to investigate the capability of O. corvina to degrade poultry feather and produce alkaline keratinolytic protease in liquid culture with duck feather as sole carbon and nitrogen source. O. corvina readily growed on and degraded duck feather and expressed high protease and keratinase activity. The protease and keratinase characterization was further analyzed with respect to pH optimum and thermal stability. The findings of this study show that O. corvina (and the closely related species O. equina) have great potential of bioconverting feather waste into economically products, such as animal feed and food ingredients.

With regard to prior art only seven fungi have genes for proteases with only 80- 84 % amino acid identity to one or more of the sequences of the proteins described here from O. corvina. These fungi are the human pathogenic dermatophytes Arthroderma benhamiae, Arthroderma gypseum, Arthroderma otae (Microsporum cam^'s), Trichophyton equinum, Trichophyton rubrum, Trichophyton tonsurans and Trichophyton verrucosum. Due to the pathogenicity these fungi are not useful for direct expression of proteases or keratinases as this would pose a severe health risk. The keratinase-activity of some of these fungi has been partly characterized without identification of the involved genes (Cheung and Maniotis, 1973)(Giudice et al., 2012) and some of the genes have been found but without demonstrating their activity (Kano et al., 2005).

Furthermore, some of the proteases of these fungi have been purified or recombinantly expressed to investigate their role in infection but not for investigation of their potential use as industrial keratinases (Asahi et al., 1985; Brouta et al., 2002; Chen et al., 2010; Lee et al., 1987; Sriranganadane et al., 2011).

Degradation of duck feather by Onygena corvina

Onygena corvina was cultivated in liquid medium (initial pH 8) with 1.5 % (w/v) duck feather as sole carbon and nitrogen source. After incubated at 25 °C, 200 rpm for 8 days, the pH value of the culture filtrate increased to 8.47 and the protease activity and keratinase activity were 1435 and 72 U/ml, respectively (Figure 4). Soluble protein and thiol formation increased from day 2 to 10. Furthermore, the amount of insoluble nondegraded feather decreased with time. The increased keratinase activity appeared to be related to an increase of soluble protein indicating that the keratinase activity depends on O. corvina growth. The accumulation of soluble proteins during the cultivation may be caused by both enzyme secretion and keratin solubilization. Keratinolysis is not only accomplished by keratinase, but also by disulfide reduction mechanisms, such as through disulfide reductases, sulfite, sulfide or thiosulfate chemical mechanisms, or by a cell-bound redox system (Gupta and Ramnani, 2006). So the increase in thiol groups during cultivation may be attributed to the disruption of disulfide bridges.

Effect of different pH on the protease production medium

To investigate the suitable initial pH in the medium for duck feather

degradation, O. corvina was cultivated in duck feather medium with different initial pH values between 4 and 11 (Figure 5). The highest protease and keratinase activities were obtained when the initial pH was 8. Interestingly, the pH increased to about 8.40 when the initial pH was between 4 and 8 whereas the pH decreased to 7.02, 7.39 and 8.47, respectively when the initial pH was 9, 10 and 11. Very low protease and keratinase activity was detected in the high pH media although the duck feather was partially degraded. However, the alkaline environment contributed slightly to keratinolysis: It seemed to make the feather more accessible for degradation by the fungal proteins. This may be caused by partial dissolution of the feather by the alkaline environment although O. corvina does not grow well in the medium with initial pH 9 to 11. At pH 8 partial dissolved feather may stimulate the keratinase production resulting in complete degradation of the feather. The results suggesting that the tendency towards the increase in pH of the acidic medium may be due to the keratinolysis of feather, and the decline in pH of the alkaline medium may caused by the accumulation of acidic sulfur compounds products in the medium. So, the change in pH at the end fermentation is an indicator for keratinolysis.

Effect of different amount on the protease production medium

To optimize the amount of substrate, 0.5 %, 1.5 %, 2.5 % and 3.5 % (w/v) duck feather was added in the medium at pH 6 and incubated with O. corvina at 25 °C, 200 rpm for 8 days. Highest protease activity was found when the amount of duck feather was 0.5 % (Figure 6). However, the highest yield measured as soluble protein, thiol formation and keratinase was found when the amount of duck feather was 1.5 %.

Different keratinolysis capability between Onygena corvina and Trichoderma asperellum

Other nonpathogenic /non-dermatophytic fungi with potentials for

biotechnological convertion of feathers into feather meal are species of

Trichoderma (see Table 1). Furthermore, Trichoderme species are known as extraordinarily good enzyme secreters and could be a good choice for production of such blend of enzymes for keratin decomposition. Therefore, Trichoderma asperellum was chosen as a putatively positive control for duck feather degradation. T. asperellum incubated for 8 days at 25 °C in duck feather medium lead to a slight degradation of the duck feather (Figure 7). However, O. corvina was able to degrade most of the duck feather under the same conditions. There was no degradation of the feather in the negative control without fungi. The weight loss of the duck feather incubated with O. corvina was 75 % whereas T. asperellum only gave a weight loss of 23 %. Moreover, O. corvina increased the amount of soluble protein, thiol formation and the protease and keratinase activities much more than T. asperellum did (Figure 2). The results indicate that the O. corvina has a high potential for feather recycling and bioconverting them into high value-added and economical product, such as animal meal. Other kinds of nonpathogenic fungi, such as Aspergillus niger, Alter n aria altanata, Curvularia lunata, Fusarium oxysporum, Myrothecium roridum and Penicillium spp., can also degrade the feather but also these species give weaker reactions and need longer time to decompose keratin as compared to O. corvina.

Characterization of the Onygena corvina feather-degrading enzymes

Influence of temperature and pH on enzyme activity

Figure 8 shows that the proteases from O. corvina were active at a broad range of pH values (pH 6 to 11) and temperature (40-60 °C). Such wide pH and temperature range might be useful for industrial application. Maximal protease activity was obtained at pH 9 and 50 °C, respectively. The protease was stable at pH 5-11 at 4 °C, and more than 71 % residual activity was conserved at these pH values. The enzyme was stable for 1 h at 30 °C, at 40 °C, the residual activity was 48 %.

Effects of metal ions, proteinase inhibitors, organic solvents, detergents and reducing agents

The keratinase activity of O. corvina was partially inhibited by Mg²⁺, Cu²⁺, Zn²⁺ and Mn²⁺ and stimulated by Ca²⁺ and Fe²⁺ (Table 2). It is expected that, divalent metal ions like Ca²⁺, Mg²⁺ and Mn²⁺ stimulated the keratinase activity, and heavy metal ions such as Cu²⁺, Zn²⁺ will inhibit the keratinase activity. But for O. corvina, Mg²⁺ and Mn²⁺ have negative effects on keratinase activity. Fungal keratinases mostly belong to the class of serine proteases that are inhibited by PMSF and EDTA. In present work, keratinase activity was partially inhibited by 1 mM EDTA and ImM PMSF. This indicated that the keratinase activity from O. corvina may be include serine protease. Different organic solvents such as ethanol, methanol, isopropanol, tween-20, tween-80 inhibited the keratinase activity to some degree. But the enzyme from O. corvina was stable in the present of glycerol. The keratinase activity was decreased by SDS and triton X-100 detergents. Reducing agents like DTT and β-mercaptoethanol generally enhance keratinase activity because the addition of reducing agents can breaking disulfide bond to help sulfitolysis but the keratinase activity of O. corvina was inhibited by DTT and β-mercaptoethanol.

SDS-PAGE electrophoresis and zymoqraphy

Zymogram of the crude enzyme preperation revealed in preliminary

experiments two clear bands (Figure 9) suggesting the present of at least two kinds of proteases. According to SDS-PAGE, the molecular mass of the O.

corvina proteases were estimated to 35 kDa and 20 kDa, respectively. The molecular masses of keratinases ranges from 18-200 kDa (Gupta and Ramnani, 2006), so the two proteases from for O. corvina are of medium and small size.

Conclusion regarding the rich potentials of Onyaena corvina secreted proteases with keratin degrading capabilities

As shown above O. corvina secreted dominant activity of alkaline protease and keratinase when it was cultured on duck feather medium. Comepared to the putative feather degrading fungi Trichoderma, O. corvina shows much greater potential in biotechnological process of bioconverting feather waste into economically products, especially for animal feed.

Further aspects of the invention

The term "origin" used in the context of amino acid sequences or nucleic acid sequences is to be understood as referring to the organism from which it derives. Said sequence may be expressed by another organism using gene technology methods well known to a person skilled in the art. This also encompasses sequences which have been chemically synthesized. Furthermore, said sequences may comprise minor changes such as codon optimization, deletions, insertions, base substitutions or shuffling, i.e. changes in the nucleic acid sequences which do not significantly (i) affect the amino acid sequence and/or (ii) the functionality of the protein.

The protein(s) of interest e.g. the endo-acting protease(s), the exo-acting protease(s), the metalloprotease(s) and/ or the serine protease(s) of the present invention may in particular be produced as a recombinant protein, i.e. a nucleotide sequence encoding the polypeptide of interest may be introduced into a cell for expression of the polypeptide of interest. The recombinant expression may be homologous or heterologous, i.e. the polypeptide of interest may be expressed in cell which it is naturally expressed by (homologous expression) or it may be expressed by a cell which it is not naturally expressed by (heterologous expression).

The recombinant polypeptide of interest may be expressed by any host cell suitable for recombinant production of the particular polypeptide of interest. Examples of suitable host cells include but are not limited to prokaryotic cells, such as E.coli cells and Bacillus cells. Examples of suitable eukaryotic cells include but is not limited to a fungal cell such as Ascomycete cells and

Trichoderma cells.

The term "recombinant polypeptide" or "recombinant polypeptide of interest" denotes herein a recombinant produced polypeptide.

Use

In one aspect the present invention pertains to the use of (i) one or more Ascomycetous fungal species, (ii) one or more Basidiomycetous fungal species and/or (iii) microbial products from (i) and/or (ii) for the degradation of keratinaceous materials.

The microbial products may comprise protetin(s) and be e.g. present in a culture broth supernatant from one or more Ascomycetous fungal species and/or one or more Basidiomycetous fungal species.

In a futher embodiment the keratinous material is selected from the group consisting of feather, hair, hoof, horn and bristles.

In an even further embodiment the one or more Ascomycetous fungal species belongs to Eurotiomycetes. In another embodiment the one or more

Ascomycetous fungal species belongs to Onygenales. In yet an embodiment the the one or more Ascomycetous fungal species belongs to Onygenaceae. In a further embodiment the one or more Ascomycetous fungal species belongs to the genus Onygena. In a preferred embodiment the one or more Ascomycetous fungal species belongs to the species Onygena equina or Onygena corvina. In a further embodiment the species Onygena equina or Onygena corvina is selected from the group consisting of strains, isolates and mutants of the species Onygena equina or Onygena corvina. The invention may futher employ a consortia of bacterial species such as but not limited to Gram-positive bacteria such as Bacillus sp. and/or Gram-negative bacteria such as Pseudomonas spp. A further aspect of the present invention pertains to the use of one or more protein(s) from one or more Ascomycetous fungal species and/or one or more Basidiomycetous fungal species for the degradation of keratinaceous materials. The protein(s) may be membrane bound or secreted. In a futher embodiment the one or more protein(s) may be selected from the group consisting of endo- acting protease(s), exo-acting protease(s), metalloprotease(s) and serine protease(s). The endo-acting protease(s) may belong to the Merops family S8 or Merops family M3 whereas the exo-acting protease(s) may belong to the Merops family M28.

In a futher embodiment the one or more protein(s) may comprise an amino acid sequence selected from the group consisting of:

Reference to a particular protein of interest e.g. the endo-acting protease(s), exo-acting protease(s), metalloprotease(s) and serine protease(s) mentioned above , includes in the context of the present invention also functionally equivalent parts or analogues of the polypeptide of interest. For example, if the polypeptide of interest is an enzyme a functionally equivalent part of the enzyme could be a domain or subsequence of the enzyme which includes the necessary catalytic site to enable the domain or subsequence to exert substantially the same enzymatic activity as the full-length enzyme or alternatively a gene coding for the catalyst. The term "substantially the same enzymatic activity" refers to an equivalent part or analogue having at least 50%, preferably at least 60%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95% and most preferably at least 97%, at least 98% or at least 99% of the activity of the natural enzyme. An example of an enzymatically equivalent analogue of the enzyme could be a fusion protein which includes the catalytic site of the enzyme in a functional form, but it can also be a homologous variant of the enzyme derived from another species. Also, completely synthetic molecules that mimic the specific enzymatic activity of the relevant enzyme would also constitute "enzymatic equivalent analogues". Generally, the skilled person will be able to readily devise appropriate assays for the determination of enzymatic acitivity.

In another embodiment the present invention relates to one or more protein(s) with the amino acid sequence according to any one of SEQ ID NO: 1, 3, 5, 7 or 9 or an amino acid sequence that has a sequence identity of at least 84% to any one of SEQ ID NO: 1, 3, 5, 7 or 9, such as at least 85 % identity, 86 % identity, 87 % identity, 88 % identity, 89 identity, 90 % identity, 91 % identity, 92 % identity, 93 % identity, 94 % identity, 95 % identity, 96 % identity, 97 % identity, 98 % identity, 98.1 % identity, 98.2 % identity, 98.3 % identity, 98.4 % identity, 98.5 % identity, 98.6 % identity, 98.7 % identity, 98.8 % identity, 98.9 % identity, 99 % identity, 99.1 % identity, 99.2 % identity, 99.3 % identity, 99.4 % identity, 99.5 % identity, 99.6 % identity, 99.7 % identity, 99.8 % identity, or 99,9 %.

In a further embodiemt the one or more protein(s) may be encoded by a nucleic acid sequence selected from the group consisting of:

(i) a nucleic acid sequence as defined by any of SEQ ID NOs: 1, 3, 5, 7 and 9; and

(ii) a nucleic acid sequence which is at least 84% identical to a nucleic acid sequence as defined in (i).

In yet an embodiment the one or more protein(s) may be produced by native or heterologous expression of a nucleic acid sequence selected from the group consisting of:

(ii) a nucleic acid sequence which is at least 84% identical to a nucleic acid sequence as defined in (i). In a further embodiment of the present invention, the nucleic acid molecule encoding the one or more protein(s) comprises a nucleic acid sequence according to any one of SEQ ID NO: 2, 4, 6, 8 or 10 or nucleic acid sequence with a sequence identity of at least 84% to any one of SEQ ID NO: 2, 4, 6, 8 or 10, such as 85 % identity, 86 % identity, 87 % identity, 88 % identity, 89 identity, 90 % identity, 91 % identity, 92 % identity, 93 % identity, 94 % identity, 95 % identity, 96 % identity, 97 % identity, 98 % identity, 98.1 % identity, 98.2 % identity, 98.3 % identity, 98.4 % identity, 98.5 % identity, 98.6 % identity, 98.7 % identity, 98.8 % identity, 98.9 % identity, 99 % identity, 99.1 % identity, 99.2 % identity, 99.3 % identity, 99.4 % identity, 99.5 % identity, 99.6 % identity, 99.7 % identity, 99.8 % identity, or 99,9 %.

A method for the degradation of keratinaceous materials

A further aspect of the present invention pertains to a method for the degradation of keratinaceous materials comprising the steps of:

- adding to a keratinaceous material (i) one or more Ascomycetous fungal species, (ii) one or more Basidiomycetous fungal species, (iii) microbial products from (i) and/or (ii) and/or (iv) one or more protein(s) secreted from one or more Ascomycetous fungal species and/or one or more protein(s) secreted from one or more Basidiomycetous fungal species, and

- obtaining a degraded keratinaceous material.

In an embodiment of the present invention the degraded keratinaceous material comprises protein(s), peptides and amino acids.

As mentioned above the amino acid sequence and/or the nucleic acid sequence of the protein(s) may comprise minor changes such as codon optimization, deletions, insertions, base substitutions or shuffling, i.e. changes that may essentially improve the functionality of the proteins and lead to a keratinaceous material having improve the bioaccessibility, nutrition and/or digestability.

Obviously the various embodiments stated under the heading "use" are also relevant to the method of the present invention. Composition

Yet another aspect of the present invention pertains to a composition comprising one or more protein(s) comprising an amino acid sequence selected from the group consisting of:

In an embodiment the composition may further comprising a keratinaceous material.

In an even further aspect the present invention pertains to a composition comprising (i) one or more Ascomycetous fungal species and/or one or more Basidiomycetous fungal species and/or microbial products from one or more Ascomycetous fungal species and/or one or more Basidiomycetous fungal species, and (ii) a keratinaceous material.

In a futher aspect the present invention pertains to a feed comprising the degraded keratinaceous material obtained by the method of the present invention.

The feed may be for non-ruminant one stomach animals. Thus, the feed may be selected from the group consisting of pig, mink, chicken and fish feed.

In an aspect the present invention pertains to a food product comprising the degraded keratinaceous material obtained by the method of the present invention.

In a further aspect the present invention pertains to a cosmetic product comprising the degraded keratinaceous material obtained by the method of the present invention. In an even further aspect the present invention pertains to a pharmaceutical composition comprising the degraded keratinaceous material obtained by the method of the present invention.

Obviously the various embodiments stated under the headings "Use" and "A method for the degradation of keratinaceous materials" are also relevant to the the various compositions of the present invention.

Alignments

As commonly defined "identity" is here defined as sequence identity between genes or proteins at the nucleotide or amino acid level, respectively.

Thus, in the present context "sequence identity" is a measure of identity between proteins at the amino acid level and a measure of identity between nucleic acids at nucleotide level. The protein sequence identity may be determined by comparing the amino acid sequence in a given position in each sequence when the sequences are aligned. Similarly, the nucleic acid sequence identity may be determined by comparing the nucleotide sequence in a given position in each sequence when the sequences are aligned.

To determine the percent identity of two nucleic acid sequences or of two amino acids, the sequences are aligned for optimal comparison purposes (e.g., gaps may be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = # of identical positions/total # of positions (e.g., overlapping positions) x 100). In one embodiment the two sequences are the same length.

One may manually align the sequences and count the number of identical nucleic acids or amino acids. Alternatively, alignment of two sequences for the determination of percent identity may be accomplished using a mathematical algorithm. Such an algorithm is incorporated into the NBLAST and XBLAST programs. BLAST nucleotide searches may be performed with the NBLAST program, score = 100, word length = 12, to obtain nucleotide sequences homologous to a nucleic acid molecules of the invention. BLAST protein searches may be performed with the XBLAST program, score = 50, word length = 3 to obtain amino acid sequences homologous to a protein molecule of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST may be utilised. Alternatively, PSI-Blast may be used to perform an iterated search, which detects distant relationships between molecules. When utilising the NBLAST, XBLAST, and Gapped BLAST programs, the default parameters of the respective programs may be used. See

http://www.ncbi.nlm.nih.gov. Alternatively, sequence identity may be calculated after the sequences have been aligned e.g. by the BLAST program in the EMBL database (www.ncbi.nlm.gov/cgi-bin/BLAST). Generally, the default settings with respect to e.g. "scoring matrix" and "gap penalty" may be used for alignment. In the context of the present invention, the BLASTN and PSI BLAST default settings may be advantageous.

The percent identity between two sequences may be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, only exact matches are counted.

Items

Item 1.1

1. Keratinous bio-materials such as e.g. feather, hair, hooves, and horn or bone can be decomposed in domestic or industrial processes by:

Degradation of keratinous materials such as but not limited to animal feather, hair, hooves by colonization of the material by fungal species or by consortia of fungal and/or bacterial species, which are able to colonize and grow in nature on keratinous materials such as but not limited to feather, hair, hooves, and horn or bone.

2. A blend composition of secreted proteins produced by fungal species or consortia consisting of fungal and/or bacterial species able to grow on such keratinous materials such as but not limited to feather, hair, hooves, and horn or bone. 3. As claim 1 and 2 where the fungal species is an Ascomycetous fungal species able to grow on such keratinous materials such as feather, hair, hooves, and horn or bone.

4. A As claim 1 and 2 where the fungal species belong to Eurotiomycetes, able to grow on such keratinous materials such as feather, hair, hooves, and horn or bone.

5. As claim 1 and 2 where the fungal species belong to Onygenales, able to grow on such keratinous materials such as feather, hair, hooves, and horn or bone.

6. As claim 1 and 2 where the fungal species belong to Onygenaceae, able to grow on such keratinous materials such as feather, hair, hooves, and horn or bone.

7. As claim 1 and 2 where the fungal species belong to the genus Onygena*) able to grow on such keratinous materials such as feather, hair, hooves and horn or bone.

8. As claim 1 and 2 where the fungal species consists of strains, isolates or mutants of the fungal species Onygena corvina able to grow on such keratinous materials such as feather, hair, hooves and horn or bone.

9. As claims 3-8 above but where the blend is not the full wild type composition but an optimized selection of 1-10 different enzymes/ proteins.

10. As claims 3-8 above but where the blend is not the full wild type

composition but an optimized selection of 1-10 different enzymes/ proteins where one, some or all have been heterologously expressed in a suitable biological production host.

11. As claims 3-8 and 10 above but where the blend is not the full wild type composition but an optimized selection of 1-10 different enzymes/ proteins added a supplementing boosting principle.

12. As claim 1 but where the decomposition is done by the blend of secreted proteins from the fungal/bacterial consortium, with or without boosting principles and native or heterolog expression.

13. As claim 10 and 11 but where the genes encoding the heterologously expressed proteins have been modified by deletion, insertion or base substitution but still show significant sequence identity such as more than 99 %, or more than 95 %, or more than 90 %, or more than 80 % to the wild type gene(s).

Item 1.2

Keratinous bio-materials such as e.g. feather, hair (incl bristles), hooves, and horn can be decomposed in domestic or industrial processes by:

1. Degradation of keratinous materials such as but not limited to animal feather, hair (incl bristles), hooves, and horn by colonization of the material by one or more fungal species or by consortia of fungal species, where the fungal species is one or more Ascomycetous or Basidiomycetous fungal species, which colonize and grow predominantly on keratinous materials such as but not limited to feather, hair (incl bristles), hooves, and horn in nature.

2. A blend composition of one or more secreted proteins produced by one or more fungal species where the fungal species is one or more Ascomycetous fungal species, which colonize and grow predominantly on such keratinous materials such as but not limited to feather, hair (incl bristles), hooves, and horn in nature.

3. As claim 1 and 2 where the fungal species is one or more Eurotiomycetes fungal species which colonize and grow predominantly on such keratinous materials such as feather, hair (incl bristles), hooves, and horn in nature.

4. As claim 1 and 2 where the fungal species is one or more Onygenales, which colonize and grow predominantly on such keratinous materials such as feather, hair (incl bristles), hooves, and horn in nature. 5. As claim 1 and 2 where the fungal species is one or more Onygenaceae, which colonize and grow predominantly on such keratinous materials such as feather, hair (incl bristles), hooves, and horn in nature.

6. As claim 1 and 2 where the fungal species is one or more species of the genus Onygena, which colonize and grow predominantly on such keratinous materials such as feather, hair (incl bristles), hooves, and horn in nature.

7. As claim 1 and 2 where the fungal species is one or more strains, isolates or mutants of a sister species of the genus Onygena, more specifically Onygena equina, known to grow on trimming clippings of hooves and horn.

8. As claim 1 and 2 where the fungal species is one or more strains, isolates or mutants of the fungal species Onygena corvina able to grow on such keratinous materials such as feather, hair (incl bristles), hooves, and horn in nature.

9. As claims 1-8 above but where the blend is not the full wild type composition but an optimized selection of 1-10 different enzymes/ proteins selected from the group consisting of:

(a) one or more endo-acting or exo-acting or metalloprotease or serine proteases;

(b) one or more endo-acting (e.g. Merops family S8 or Merops family M3) or exo-acting (e.g. Merops family M28) proteases;

(c) one or more endo-acting serine proteases having at least 85 % sequence identity to the polypeptide of SEQ ID NO: 2 or SEQ ID NO: 10, an exo-acting protease having at least 84 % sequence identity to the polypeptide of SEQ ID No: 4 or SEQ ID No: 8), and an endo-acting metalloproteinase having at least 84 % sequence identity to the polypeptide of SEQ ID No: 6);

(d) one or more endo-acting serine proteases having at least 90 % sequence identity to the polypeptide of SEQ ID NO: 2 or SEQ ID NO: 10, an exo-acting protease having at least 90 % sequence identity to the polypeptide of SEQ ID No: 4 or SEQ ID No: 8), and an endo-acting metalloproteinase having at least 90 % sequence identity to the polypeptide of SEQ ID No: 6);

(e) one or more endo-acting serine proteases having at least 95 % sequence identity to the polypeptide of SEQ ID NO: 2 or SEQ ID NO: 10, an exo-acting protease having at least 95 % sequence identity to the polypeptide of SEQ ID No: 4 or SEQ ID No: 8), and an endo-acting metalloproteinase having at least 95 % sequence identity to the polypeptide of SEQ ID No: 6);

(f) one or more endo-acting serine proteases encoded by a nucleotide sequence having at least 85 % sequence identity to the nucleotide of SEQ ID NO: 1 or SEQ ID NO: 9, an exo-acting protease encoded by a nucleotide sequence having at least 85 % sequence identity to the nucleotide sequence of SEQ ID No: 3 or SEQ ID No: 7), and an endo-acting metalloproteinase encoded by a nucleotide sequence having at least 84 % sequence identity to the nucleotide sequence of SEQ ID No: 5).

(g) one or more endo-acting serine proteases encoded by a nucleotide sequence having at least 90 % sequence identity to the nucleotide of SEQ ID NO: 1 or SEQ ID NO: 9, an exo-acting protease encoded by a nucleotide sequence having at least 90 % sequence identity to the nucleotide sequence of SEQ ID No: 3 or SEQ ID No: 7), and an endo-acting metalloproteinase encoded by a nucleotide sequence having at least 90 % sequence identity to the nucleotide sequence of SEQ ID No: 5).

(h) one or more endo-acting serine proteases encoded by a nucleotide sequence having at least 95 % sequence identity to the nucleotide of SEQ ID NO: 1 or SEQ ID NO: 9, an exo-acting protease encoded by a nucleotide sequence having at least 95 % sequence identity to the nucleotide sequence of SEQ ID No: 3 or SEQ ID No: 7), and an endo-acting metalloproteinase encoded by a nucleotide sequence having at least 95 % sequence identity to the nucleotide sequence of SEQ ID No: 5).

(i) a variant comprising the polypeptide of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO: 10 comprising a substitution, deletion, and/or insertion at one or more (e.g., several) positions;

(j) a fragment of the polypeptide of (a), (b), (c), (d), (e), (f), (g), (h) or (i) that has protease activity; and

a fragment of the polypeptide of (a), (b), (c), (d), (e), (f), (g), (h) or (i) that has keratinase activity.

10. As claims 1-8 above but where the blend is not the full wild type

composition but an optimized selection of 1-10 different polypeptides, comprising but not limited to the polypeptides of claim 9, where one, some or all of the polypeptides have been heterologously expressed in a suitable biological production host; more specifically in a fungus, even more specifically in a suitable Ascomycete production host, or even more specifically in a species of Trichoderma where the homologue secreted proteins may add to the total keratinolytic capability of the resulting culture broth composition

11. As claims 1-8 but where the production host is a strain improved and engineered to express 2-10 of the above mentioned polypeptides, comprising but not limited to the polypeptides of claim 9.

12. As claim 10 but where the blend is not the full wild type composition but an optimized selection of 1-10 different polypeptides added a supplementing boosting principle

13. As claim 1 but where the decomposition is done by the blend of secreted polypeptides from the fungi, with or without boosting principles and native or heterolog expression

14. As claim 10 and 11 but where the genes encoding the heterologously expressed proteins have been modified by deletion, insertion, base substitution or shuffling, but still show significant sequence identity such as more than 99 %, or more than 95 %, or more than 90 %, or more than 80 % to the wild type gene(s).

It should be noted that embodiments and features described in the context of one of the aspects of the present invention also apply to the other aspects of the invention.

All patent and non-patent references cited in the present application, are hereby incorporated by reference in their entirety.

The invention will now be described in further details in the following non- limiting examples. Examples

7.1.1 Microorganism and growth conditions

Onygena corvina (accession number: CBS 281.48) was obtained from CBS- KNAW fungal Biodiversity Centre (Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands) and kept on potato dextrose agar plate at 4 °C. Subculturing was done once a month.

For protease production, 4 mm² square of Onygena corvina mycellium from a PDA plate was inoculated in a minimal liquid medium containing 15 g/l duck feather/10 g/l chicken feather/lOg/l dog wool/20g/l pig bristles; 2 g/l KH₂P0₄, 0.15 g/l MgS0₄-7H₂0, 0.3 g/l CaCI₂, 3.3 g/l Tween 80, pH 8 and cultured at 25 °C on a rotary shaker (200 rpm) for eight to eleven days.

Trichoderma asperellum (accession number: CBS 131938) was also obtained from CBS-KNAW fungal Biodiversity Centre (Centraalbureau voor

Schimmelcultures, Utrecht, The Netherlands).

7.1.2 Materials

Duck feather was obtained from Valbyparkens, Denmark (2012). Chicken feather was obtained from Rose Poultry (Vinderup, Skovsgaard, Denmark) on 27. Nov.2013. Pig bristles were obtained from Danish Crown (Bragesvej, Denmark) on 12. Nov.2013. Dog wool was kindly provided by Peter Busk.

Pretreated bristles and hooves was obtained from Danish Crown (Bragesvej, Denmark) on 22. Mar. 2014. Feather and bristles were washed three times with tap water, distilled water and MilliQ water. Then they were cut into about 1 cm pieces and air dried. Before used as sole carbon and nitrogen source in the minimal liquid medium, they were further dried in an oven at 50 °C until the weight was constant.

7.1.3 Optimization of protease and keratinase production medium

According to duck feather medium as 7.1, different initial pH (pH 4, 5, 6, 7, 8, 9, 10, 11) and different duck feather amount (g/l : 5, 15, 25, 35) in the medium allowing the maximum protease production was performed. To estimate the suitable period of the maximum protease production, the protease activity of 0, 2, 4, 6, 8, 10 days of the cultures were measured.

Cultures were centrifuged at 10000 xg for 10 min to remove residue feather. The supernatant was used for estimation of protease and keratinase activities, soluble protein and thiol formation. All the analyses were performed in duplicate and repeated at least twice.

7.1.4 Determination of weight loss of the substrate in protease and keratinase production medium

Weight loss of the substrate in protease and keratinase production medium was estimated by determining the loss of the duck feather dry weight. Initial feather weight was determined as dry feather weight after dehydration at 50 °C. Final feather weight was measured as the dry weight of the residual feather after dehydration at 50 °C.

The weight loss in each experiment was determined using the formula :

Weight loss (%) = (initial feather weight-final feather weight)/initial feather weight x 100.

7.1.5 Determination of enzyme activity

7.1.5.1 Assay of protease activity with Azocasein

Protease activity was assayed by mixing 20 μΙ 1.5 % Azocasein (Sigma-Aldrich. Denmark) suspension in 50 mM sodium carbonate buffer (pH 9.0) and 20 μΙ diluted enzyme. The reactions were carried out at 50 °C for 60 min with constant agitation at 300 rpm by using a TS-100 Thermo-Shaker, SC-20 (Biosan Ltd). After incubation, the reactions were stopped by adding 100 μΙ 0.4 M trichloroacetic acid (TCA) and incubated at 4 °C for 30 min. Then the mixture was centrifuged at 16000xg for 1 min to remove the substrate. 100 μΙ supernatant was transferred to a microtiter plate already containing 25 μΙ of 1.8 M NaOH. Absorbance was read at 405 nm in a plate reader. As a control, 20 μΙ 1.5% Azocasein suspension in the same buffer with addition of 100 μΙ 0.4 M TCA before adding 20 μΙ enzyme solution was used. The mixture was incubated at 50 °C for 60 min and treated in the same way as the sample.

One unit (U) of protease activity was defined as the amount of enzyme causing 0.01 absorbance increase between the sample and control at 405 nm under the assay conditions.

7.1.5.2 Assay of keratinase activity

Keratinase activity was measured with keratin azure (Sigma-Aldrich, USA) as substrate. The keratin azure was ground to a fine powder with a mortar and pestle in liquid nitrogen. Next, 0.4 g keratin azure powder was mixed with 100 ml 50 mM sodium carbonate buffer (pH 9.0). The reaction mixture contained 50 μΙ keratin azure suspension and 50 μΙ enzyme solution. Assays were carried out at 50 °C for 24 h with constant agitation at 1000 rpm in a TS-100 Thermo- Shaker, SC-20 (Biosan Ltd). After incubation, the reactions were stopped by adding 100 μΙ 0.4 M TCA followed by centrifuging at 16000xg for 1 min to remove the substrate. Release of azo dye was measured as absorbance of the supernatant at 595 nm. As a control, 50 μΙ 0.4 % keratin azure suspension in the same buffer was mixed with 100 μΙ 0.4 M TCA before addition of 50 μΙ enzyme solution and incubation at 50 °C for 24 h. One unit keratinase activity was defined as the amount of enzyme that resulted in an increase of 0.01 in absorbance at 595 nm under the reaction conditions.

7.1.5.3 Assay of protease activity with pig bristles

0.05 ml cultural supernatant was incubated with 0.004 g pig bristles in 0.2 ml 2x Mcllvaine buffer (pH 8). Assays were carried out at 40 °C for 24 h with constant agitation at 1000 rpm. The initial and final soluble protein in supernatant was measured at 280 nm by nanodroplOOO (Thermo Scientific) before and after incubation. The increased soluble protein was calculated as the difference between the final and initial soluble protein. As a control, 0.05 ml culture supernatant was replaced by 0.05 ml 2x Mcllvaine buffer (pH 8) and incubated at 40 °C for 24 h with constant agitation at 1000 rpm. The initial and final soluble protein in supernatant was measured at 280 nm before and after incubation. Purified Bovine serum albumin (BSA) (10 mg/ml) was series diluted to 0, 0.1, 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4, 1.6, 1.8, 2.0 mg/ml in 2x Mcllvaine buffer (pH 8). Standard curve was generated by measuring diluted BSA absorbance at 280 nm. The soluble protein before and after pig bristles degradation were calculated according to the BSA standard curve. Pig bristles degradation degree (%) was calculated by the following equation :

Degradation degree (%) = increased soluble protein (mg) /initial pig bristles weight (mg)*100

7.1.6 Protein determination

The protein content was determined by the Bradford method with the BCA Protein Assay Kit (Thermo scientific. No 23227) and bovine serum albumin (BSA) as standard.

7.1.7 Determination of thiol formation

Free thiol groups were analysis by mixing 100 μΙ sample with 20 μΙ NH₄OH, 100 μΙ of 0.5 g/l NaCN and 100 μΙ MilliQ water. The mixture was incubated for 20 min at 25 °C, following by addition of 20 μΙ of 0.5 g/l sodium nitroprusside. Absorbance at 530 nm was measured within two min.

7.1.8 Characterization of the Onygena corvina feather-degrading enzymes

7.1.8.1 Influence of temperature and pH on enzyme activity

To investigate the effect of temperature, enzyme reactions were carried out at different temperature (30, 40, 50, 60 °C) for 60 min in 50 mM sodium carbonate buffer (pH 9). In order to study thermo stability, the enzyme solution was pre-incubated for 60 min at 30, 40, 50, 60 °C in 50 mM sodium carbonate buffer (pH 9) where after the residual activity was measured.

The optimum pH of the enzyme cultures were carried out over a pH range of 4.0-11.0 at 50 °C. To study pH stability, the enzyme cultures were incubated in buffers of different pH (McIIvaine Buffer (pH 4, 5, 6, 7 and 8) or 50 mM sodium carbonate buffer (pH 9, 10 and 11)) for 60 min at 4 °C. Residual protease activity was determined after incubation.

7.1.8.2 Effects of metal ions, proteinase inhibitors, organic solvents, detergents and reducing agents

The effects of various metal ions, inhibitors, detergent and organic solvents on protease and keratinase activity were investigated by assaying the enzyme activity as described above after pre-incubation with each chemical for 15 min at room temperature. The following chemicals were used : CaCI₂, MgCI₂-7H₂0, CuCI₂, ZnCI₂, FeCI₂ and MnS0₄ (1 mM), phenylmethylsulfonyl fluoride (PMSF) (1 mM), β-mercaptoethanol (1 %) and ethylene diamine tetraacetic acid (EDTA) (1 mM), SDS , DTT (5 mM), ethanol, methanol, isopropyl alcohol, glycerol, triton X-100, tween-20, tween-80 (1 %).

7.1.9 SDS-PAGE electrophoresis and zymography

SDS-PAGE was performed with 12 % polyacrylamide gels. PageRuler™

Prestained Protein Ladder (10 - 170 kDa. Thermo Scientific) was included. After the electrophoresis, the gels were silver stained following the protocol of Pierce Silver Stain Kit (Thermo Scientific).

To prepare a zymogram assay, protease sample was mixed with native electrophoresis sample buffer (3.1 ml 1 mol/L Tris-HCI buffer (pH 6.8), 5 ml 50% glycerol. 0.5 ml 1.0% bromophenol blue and 1.9 ml MilliQ water) in a 4: 1 ratio without heat denaturation. SDS-PAGE was carried out at 4 °C with a constant voltage of 80 V in a 12 % polyacrylamide gel. The gel was washed with 2.5 % Triton X-100 (v/v) in 50 mM Tris-HCI buffer (pH 9) for 30 min. Then washed with 50 mM Tris-HCI buffer (pH 9) for 30 min. Casein (1% w/v) in 50 mM Tris-HCI buffer (pH 9) was poured onto the gel. After 60 min incubation at 37 °C, the gel was stained with PageBlue Protein Staining Solution (Thermo scientific. No 24620) during 15 min and protease bands appeared on a blue background, then the gel was washed using MilliQ water.

7.1.10 Supernatant precipitation for MS analysis

Fermentation culture was harvested by centrifugation at 10.000 g for 15 min at 4 °C, and the supernatant was filtered (Sartorius, Minisart® NML Syringe Filters 16534, 0.2 μηι). The secreted proteins were precipitated by incubating 30 ml filtered supernatant with freshly prepared 3 g crystalline trichloroacetic acid (final concentration 10% w/v) and kept in -20°C freezer overnight. The precipitate was pelleted by thawing and centrifugation at 10.000 g for 30 min at 4°C. The protein pellet was washed three times with 1ml ice-cold acetone and centrifuge at 14000 g for 5 min at 4 °C. Finally, the protein pellet was air dried.

7.1.11 In Solution Digestion and desalting of the peptides

The protein pellet was solubilized in digestion buffer (1 % sodium deoxycholate, 50 mM triethylammonium bicarbonate, pH 8.0) and heated to 99 °C for 5-10 min. The sample was kept above 37 °C and 1 pg Tris (2-carboxyethyl) phosphine was added per 25 pg sample protein and incubated for 30 min at 60 °C. Next, 1 pg iodoacetamide (IAA) was added (from a 2.5 Mg/μΙ iodoacetamide stock solution in water) per 10 pg sample protein and incubated for 20 min at 37 °C in the dark. Then the sample was digested by the addition of 1 pg

Trypsin (from a 0.1 Mg/μΙ trypsin stock solution) per 50 pg sample protein and incubated overnight at 37 °C. The reaction was stopped by addition of formic acid to a final concentration of 2.0 %, mixed and incubated at room

temperature for 5 min. The sample was centrifuge at 13.000 g for 20 min at 4 °C and the supernatant was dried down. Finally, the peptides were desalted by C18 microcolumn cleaning.

7.1.12 Analysis of proteins by LC-MS/MS

Peptides were reconstituted in 0.1% trifluoroacetic acid / 2 % acetonitrile solution. A volume of 8 μΙ of each sample was injected by the autosampler and concentrated on a trapping column (PepmaplOO, C18, 100 m x 2 cm, 5 μηι, Thermo Fisher Scientific) with water containing 0.1% formic acid and 2% ACN at a flow rate of 4 μΙ/ min. After 10 min, the peptides were eluted into a separation column (PepmapRSLC, C18, 75 μηι x 50 cm, 2 μηη, Thermo Fisher Scientific). Chromatography was performed with 0.1 % formic acid in solvent A (100 % water) and B (100 % acetonitrile) and the solvent B gradient was set in the first 5 min from 4 to 12 % and subsequently 30 min from 10 to 30 % solvent B. After this, solvent B was increased from 30 % to 90 % within 1 min for additional 5 min using a nano-high pressure liquid chromatography system (Ultimate3000 UHPLC, Thermo Fisher Scientific). Ionized peptides were measured and fragmented by a Q-Exactive mass spectrometer (Thermo Fisher Scientific). For an unbiased analysis continuous scanning of eluted peptide ions was carried out between 400-12000 m/ z, automatically switching to MS/MS higher energy collisional dissociation (HCD) mode and twelve MS/MS events per survey scan. For MS/MS HCD measurements a dynamic precursor exclusion of 30 s, peptide match and an apex trigger of 2 to 10 s were enabled.

7.1.13 MS data analysis

Protein identification was done with the open-source software MaxQuant (v. 1.4.1.2). The minimum peptide length was set to seven amino acids and the maximum false discovery rate (FDR) of 0.01 was required for proteins and peptides. The Onygena corvina genome/6 frame database was used as a search database. Carbamidomethyl (C) was set as a fixed modification and acetyl (Protein N-term)/Oxidation (M) modifications were included in protein quantification. Razor peptides were used for protein quantification. A standard minimum ratio count of 2 was set to quantify the analysis. The "match between runs" option was enabled with a matching time window of 1 min. The Biological triplicates were performed to normalize the label-free quantification (LFQ) values, and LFQ intensities in each sample were log2-transformed. To estimate the proteome variance, comparisons were performed using T-test (two-tailed, heteroscedastic). Batch CD-search was used to search for conserved domains and annotation of identified protein

(http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cqi^').

7.1.14 Genomic DNA extraction

Onygena corvina was cultured in YPD liquid medium on a rotary shaker (130 rpm) at 25 °C for 3 days. The mycelia were filtered on a nylon mesh and grinded with liquid nitrogen. The genomic DNA was extracted with the DNeasy plant mini kit (Qiagen) following the manufacturer's protocol. The quantity and quality of the genomic DNA was measured on a NanodroplOOO (Thermo Scientific) and by electrophoresis on a 1 % agarose gel.

7.1.15 De novo draft genome assembly

The genome of Onygena corvina was sequenced de novo on an Illumina Hiseq 2000 in one multiplexed lane as paired-end libraries with Truseq chemistry by AROS Applied Biotechnology A/S, Denmark. Based on the estimated genome size the sequence coverage was 370 times. The raw sequences were filtered for residual adapter sequences and trimmed with AdapterRemoval vl.5.2 and Seqtk. The clean sequences were assembled with CLC Genomic Workbench. Assembly statistics were calculated with the Assemblathon script.

7.1.16 Gene annotation by finding homology to peptide patterns (Hotpep) Each genome was split into 2000 bases long fragments with 100 bases overlap between fragments. Each fragment was translated in all six reading frames, which was given a score for each subfamily-specific peptide lists for each protease family by:

1. Finding all the peptides from the list that were present in the reading frame.

2. Sum the frequency of these peptides. This gave the subfamily-specific frequency score.

A hit was considered significant if any of the open reading frames:

1. Included at least three conserved peptides from a subfamily.

2. The sum of the frequency of these peptides was higher than 1.0 3. The conserved peptides covered at least ten amino acids of the ORF. (Three hexapeptides that may be overlapping can cover from 8 (maximal overlap) to 18 (no overlap) residues of an amino acid sequence).

If all three conditions were met a sequence fragment was assigned to the Merops family and to the PPR-generated subfamily with the highest subfamily- specific frequency score as previously described (Busk and Lange, 2013). If two fragments were assigned to the same Merops family and the distance between them in the original genome sequence was less than 6000 bases, the fragments were considered to be part of the same gene and counted as one hit.

Although each sequence fragment could only be assigned once to each Merops family it was possible for a fragment to be assigned to two or more different families.

The predicted protein sequences of the hits were confirmed by BLAST. Full length genes of the validated proteases were obtained by assembling the related contigs with the CLC Main Workbench 6

(http://www.clcsupport.com/clcmainworkbench/current/index.php7manuaNIntr oduction_CLC_Main_Workbench.html), and the open reading frame (ORF) was predicted by Augustus (http://bioinf.uni-greifswald.de/augustus/submission). The ORF were further validated by BLAST.

7.1.17 Protease comparison

The genomes of nine keratin-degrading fungi and of three non-keratin- degrading fungi were downloaded from GenBank

(https://www.ncbi.nlm.nih.gov/genbank/).

Keratin-degrading fungi : Arthroderma otae (Assembly: GCA_000151145.1); Arthroderma gypseum (Assembly: GCA_000150975.1); Batrachochytrium dendrobatidis (Assembly: GCA_000149865.1); Coccidioides posadasii

(Assembly: Find on Monday); Coccidioides immitis (Assembly:

GCA_000149335.1); Onygena corvina (New assembly); Trichophyton rubrum (Assembly: GCA_000151425.1); Trichophyton tonsurans (Assembly:

GCA_000151455.1); Trichophyton verrucosum (Assembly: GCF_000151505.1); Non-keratin-degrading fungi : Homoloaphlyctis polyrhiza

(Assembly:GCA_000235945.1); Saccharomyces cerevisiae (Assembly:GCA_000146045.2); Talaromyces stipitatus

(Assembly:GCA_000003125.1); Wickerhamomyces anomalus

(Assembly:GCA_000147375.2).

The number of proteases of each Merops family found in the genome of Onygena corvina and the eight keratin-degrading fungi downloaded from GenBank were compared to the number of proteases of each Merops family found in the genomes of the four non-keratin-degrading fungi downloaded from GenBank.

7.1.18 Signal peptide prediction

Signal peptides were predicted with SignalP 4.1

(http://www.cbs.dtu.dk/services/SiqnalP/^').

7.1.19 RNA extraction

Onygena corvina was grown on feather or pig bristles or dog wool for seven days whereafter around 100 mg of mycelium together with keratin materials (feather or pig bristles) was thoroughly disrupted in lysis buffer by 3x 20 seconds pulses in the FastPrep®-24 homogenizer (MP Bio), and total RNA was extracted with the RNeasy plant mini kit (Qiagen). Genomic DNA was removed by treatment with DNase I (RNase-free) (M0303L, New England Biolabs Inc.). The quality and quantity of the RNA was measured by NanodroplOOO (Thermo scientific) and electrophoresis on a 1% agarose gel.

7.1.20 cDNA synthesis

200 ng total RNA was mixed with 1 μΙ primer (oligodT: Random primer 1 : 3 (0.5 Mg/μΙ)), and RNAse free H2O to 5 μΙ. The sample was heated 5 min at 70 °C and chilled immediately in an ice-bath for 5 min. Then it was spun down and added to a mix made of 4 μΙ 5x ImProm II buffer, 1 μΙ dNTP mix (lOmM each), 2 μΙ 25 mM MgCI₂ and ΙμΙ ImProm-Π™ Reverse Transcriptase (Promega) and RNAse-free H2O was added to a final volume of 15 μΙ. The reaction was heated 5 min at 25 °C and incubated 1 h at 42 °C.

7.1.21 Amplification and cloning of putative keratinase genes

18 predicted keratinase genes from Onygena corvina (Example 3) were amplified from cDNA made of RNA extracted from Onygena corvina growing on feather, pig bristles or dog wool with specific primers with a His-tag-encoding sequence added at the 5'-end of the reverse primer. The PCR reaction mixtures contained 1.5 μΙ diluted cDNA, 10 μΙ 5xPhusion® HF Buffer, 1 μΙ 10 mM dNTP (Fermentas), 2.5 μΙ 10 μΜ each primer and 1 U Phusion® High-Fidelity DNA Polymerase (M0530S, New England Biolabs Inc.) in 50 μΙ. The PCR reaction was performed in Biometra Thermocyclers T3000. The initial denaturation step (98 °C, 30sec) was followed by 30 cycles of denaturation (98 °C, 10 sec), annealing (30 sec), elongation (72 °C, 30 sec per kb), and a final elongation step (72 °C, 10 min) after the final cycle. The PCR products were purified with the GeneJET Gel Extraction and DNA Cleanup Mini Kit (K0831, Thermo Scientific) and digested with the restriction enzymes (New England Biolabs Inc.).

The vector pPinka-HC (PichiaPink™ Expression System, Invitrogen) was digested with Stul and Fsel restriction enzymes and purified. The digested PCR products were inserted into pPinka-HC vector with T4 DNA Ligase (EL0011, Thermo Scientific). The recombinant plasmids were transformed to E. coli DH5a. Positive clones were selected on LB plates with 100 μg/ml ampicillin and identified by colony PCR and sequencing. About 5-10 μg vector with protease genes were linearized with Spel (except gene > 399181 , which linearized by EcoN I) and transform in to PichiaPink™ Strain 4 (Invitrogen) by electroporation according to the manufacturer's manual. After incubated in YPDS medium 2 h at 30 °C without shaking, positive clones were selected on PAD plates (A11156, PichiaPink™ Media Kit, Invitrogen) by incubation at 30 °C for 3-7 days.

7.1.22 Expression of recombinant protease in PichiaPink™ Strain 4

A single white clone was chosen for each recombinant protease genes and cultivated in 25 ml BMGY medium at 28 °C, 260 rpm until OD600 of 2-5 (after approximately 24 h). 25 ml of the culture was transferred to 1 I BMGY medium and divided in to two 2 liter baffled flasks. The Pichia was grown at 28 °C, 260 rpm until the culture reached OD600 of 2-5 (after approximately 24 h). The cells were harvested by centrifuging in sterile centrifuge bottles at 1500 xg for 5 min at room temperature. To induce expression, the supernatant was decanted and resuspended in 200 ml BMMY medium and incubated at 28 °C and 260 rpm. Every 24 hours 1ml of 100% methanol was added to induce enzyme production. The supernatant was harvested after 4 days incubation by centrifugation at 1500 x g for 5 minutes at room temperature and filtered through a 0.2 μηι filter (Minisart Syringe Filters) and store at -80 °C. 7.1.23 Purification of expressed proteases

The His-tagged proteases were purified by fast protein liquid chromatography (FPLC) (AKTA Purifier) by the UNICORN method on a 1 ml HisTrap FF crude affinity column (GE Healthcare). First, the column was equilibrated with binding buffer (20 mM sodium phosphate, 500 mM NaCI, 30 mM imidazole, pH 7.4) with a flow rate of 1 ml/min. Then, 100 ml sample was loaded onto the column, followed by washing with binding buffer until the absorbance reached a steady baseline. The His-tagged proteases were finally eluted with elution buffer (20 mM sodium phosphate, 500 mM NaCI, 500 mM imidazole, pH 7.4).

7.1.24 Assay of purified recombinant protease with fluorescein-labeled casein The purified proteases were assayed with fluorescein-labeled casein

(PierceFluorescent Protease Assay Kit, 23266, Thermo Scientific). The protease activity was measured by fluorescence resonance energy transfer (FRET) on a Corbett Rotor Gene 6000 (Corbett Research). The fluorescein excitation and emission filters are 470 nm and 510 nm, respectively. FTC-Casein Working Reagent was prepared by diluting 5 mg/ml FTC-Casein stock solution 1 : 500 in TBS buffer (25mM Tris-HCI, 0.15 M NaCI, pH 7.2). Trypsin standard was made by diluting the stock solution (50 mg/ml) to 0.5 Mg/ml in TBS buffer, serially dilute this solution to yield 6-8 standards. First 20 μΙ sample or standard was added to QIAsafe DNA Tubes (SAP 1055470). Next, 20 μΙ FTC-Casein Working Reagent was added to the tubes and the mixture was incubated at 30 °C for 60-90 min. The protease activity was measured as the increase in real time fluorescence over the reaction time.

7.1.25 Assay of purified recombinant protease activity with pig bristles

25 μΙ purified recombinant protease was incubated with 4 mg pig bristles in 0.2 ml 2x Mcllvaine buffer (pH 8). Assays were carried out at 40 °C for 24 h with constant agitation at 1000 rpm. The initial and final soluble protein in

supernatant was measured as described in 10.1.5.3.

7.1.26 SDS-PAGE of purified recombinant proteases

Samples of 30 μΙ purified enzyme were mixed and analyzed SDS-PAGE electrophoresis.

7.1.27 Protein determination for the purified recombinant protease The protein concentration of purified recombinant enzyme was calculated according to the molar extinction coefficient of the related protease protein sequence (http ://encorbio.com/protocols/Prot-MW-Abs. htm). The absorbance of the protein at the ultraviolet wavelength of 280 nm was measured with a NanodroplOOO (Thermo Scientific).

7.1.28 Ion exchange chromatography

Culture supernatant was harvest by centrifugation at 10000 x g for 10 min at 4 °C after fermentation. The supernatant was filtered (0.45 μηι). The culture was fractionated using two separate strategies: 1. Cation exchange (5 ml HiTrap SP column, 50 mM citrate buffer, pH 3.86). 2. Anion exchange (1 ml HiTrap Q column, 20 mM Tris buffer, pH 8.6). In both cases, volumes corresponding to 50 ml of culture fluid were applied to the column and a NaCI gradient from 0 - 1M NaCI was applied to elute the bound protein.

7.1.29 Protease identification by in-solution digestion and LC-MS/MS

200 μΙ anion exchange fractions and 400 μΙ cation exchange fractions were heated to 90 °C for 15 min and dried down. Protease identification by in- solution digestion and LC-MS/MS were performed as described in 10.1.11.

7.1.30 Assay of protease activity of fractions with azocasein

Protease activity of fractions was assayed with azocasein.

7.1.31 Assay of protease activity of fractions with pig bristles

50 μΙ of each ion exchange purified fraction were incubated with 4 mg pig bristles in 0.2 ml 2x Mcllvaine buffer (pH 8). Assays were incubated at 40 °C for 24 h with constant agitation at 1000 rpm. The initial and final soluble protein in supernatant was measured as described in 10.1.11.

7.1.32 Fraction blend degrading pig bristles

Fraction blends were made as Table 3, pig bristles was degraded as described in 10.1.31.

7.1.33 Purified recombinant protease and fraction blend degrading pig bristles Purified recombinant protease and fraction blend were made as Table 4, pig bristles was degraded as described in Assay of protease activity of fractions with pig bristles.

7.1.34 Prolonged culture broth and fraction degrading pig bristles

50 μΙ culture broth after Onygena corvina growing on fermentation medium with pig bristles or chicken feather 11 days or fraction C15 and C20 were incubated with 4 mg pig bristles in 0.2 ml 2x Mcllvaine buffer (pH 8). Assays were incubated at 40 °C for 4 days with constant agitation at 1000 rpm. The initial and each day soluble protein in supernatant was measured as described in 10.1.11.

7.1.35 Culture broth degraded pretreated bristles and hooves

50 μΙ culture broth after Onygena corvina growing on fermentation medium with chicken feather 11 days was incubated with 4 mg pretreated bristles and hooves in 0.2 ml 2x Mcllvaine buffer (pH 8). Assays were incubated at 40 °C for 4 days with constant agitation at 1000 rpm. The initial and each day soluble protein in supernatant was measured as described in 10.1.11.

7.2 Summary of Results of the Patent examples 1-8

The results of the present investigation showed that upon incubation with keratinous material such as feather, hair or pig bristles the fungus O. corvina could colonize the material and degrade it completely to soluble compounds such as proteins, peptides or amino acids. Genome sequencing and mining of the genome for protease-encoding genes identified 75 putative protease genes. This list was further reduced to 18 candidate genes of which 12 were amplified by PCR, cloned and heterologously expressed in Pichia pastoris. The PCR showed that the gene with SEQ ID NO: 1 was expressed by O. corvina when growing on either a- or β-keratin and the product of this gene (SEQ ID NO: 2) was found in the culture broth supernatant from O. corvina grown on feather. Three of the heterologously expressed gene products exhibited high protease activity and one of the gene products (expressed from the gene with SEQ ID NO: 1) was also able to degrade pig bristle.

Furthermore, fractionation of the culture broth supernatant from O. corvina growing on feather led to the identification of several partially purified fractions with high keratinase activity. Some of these fractions named A10, All, C15 and C20 did not contain the full wild type composition of secreted proteins but could nevertheless degrade the keratin in pig bristles. Mas spectrometry of the fractions led to the identification of sequences with SEQ ID NO: 2, 4 and 6 in fraction C15 and SEQ ID NO: 2, 4, 8 and 10 in fraction C20. From the genomic sequence the full length of SEQ ID NO: 2, 4, 6, 8 and 10 could be identified and genes encoding the polypeptides were identified as SEQ ID NO: 1, 3, 5, 7 and 9.

Interestingly, mixing of fractions C15 and C20 lead to a higher degree of degradation of pig bristles than either of the two fractions alone. This result shows that there is a synergistic effect of this optimized blend of proteases from O. corvina.

In a long term experiment incubation, the culture broth supernatant from O. corvina grown on feather or on pig bristles was able to degrade at least 60 % of a pig bristle substrate despite the abscense of keratin-destabilizing agents that have been shown to increase the activity of keratinases three fold. Hence, addition of such agent is expected to lead to complete degradation of the material as was observed for the fungus growing directly on the substrate. The partially purified fractions C15 (containing SEQ ID NO: 2, 4 and 6) and C20 (containing of SEQ ID NO: 2, 4, 8, and 10) degraded 50 % of the pig bristle under the same conditions without keratin-destabilizing agents. It is very surprising and highly positive, strengthening the invention, that such a high degree of degradation can be achieved with the isolated protease containing fractions C15 and C20 in the abscence of an agent that breaks the cysteine bridges of the keratin.

Finally, we found that the culture broth supernatant from O. corvina grown on feather was able to degrade almost 50 % of the industrially relevant substrate pretreated bristles and hooves obtained from a slaughter house, despite the lack of keratin-destabilizing agents. Hence in the presence of such agents it is expected that the culture broth supernatant from O. corvina will be able to complete degrade the material 7.3 Patent Examples Example 1

The fungus Onygena corvina can degrade feather and hair completely

A sample of duck feather was cut into small pieces, embedded in in a minimal liquid medium containing 2 g/1 KH₂P0₄, 0.15 g/1 MgS0₄.7H₂0, 0.3 g/1 CaCI₂, 3.3 g/1 Tween 80, pH 8 and inoculated with a) mycelium of the ascomycetoues non-pathogenic fungus Onygena corvina, which in nature grows specifically on feather, and b) with the ascomycetous non-pathogenic fungus Trichoderma asperellum, which in nature grows saprotrophically on a range of substrates, including keratinaceous materials. Negative control : Same material without fungus. After 8 days incubation the result was scored by visual inspection (Figure 2) . Surprisingly a total break down of the keratinaceous feather was observed when O. corvina was used as inoculum.

A sample of pig bristles was cut in small pieces and submerged in the

supernatant from O. corvina culture broth. O. corvina had been grown for 11 days on keratinaceous materials (chicken feather) after which period the aquous supernatant was separated from the fungal biomass by centrifugation of the total culture broth. The result was scored by visual inspection (Figure 3) . It was surprisingly seen that incubation in the aquous supernatant of O. corvina held sufficient enzyme activities for apparently almost total break down of the keratin after just 24 hrs incubation, also of pig bristles, composed of a-keratin.

Example 2

Onygena corvina genome sequencing, protease prediction and protease comparative analysis resulting in selection of list of 18 keratinase candidates Onygena corvina (accession number: CBS 281.48) was genome sequenced by Illumina Hiseq 2000. A comprehensive list of O. corvina proteases, distributed on protein families, was deducted by Peptide Pattern Recognition (PPR) analysis as described in Methods. 10. 1. The proteases with the strongest propability for being capable of breaking down keratin, totally or in part, was identified based on a comparative analysis of proteases of non-keratin degrading fungi as compared to proteases of keratin degrading fungi. This included 18 putative secreted proteases from 4 protease families (Table 8) and could responsible for the keratin decomposition by O. corvina (see example 1).

Genome sequencing and de novo assembly

After Illumina Hiseq 2000 sequencing, we obtained 81,538,322 PE 100 bp reads. The raw reads were cleaned, pooled together and de novo assembled with the CLC Genomic Workbench. Finally we obtained 992 contigs with length > 198 bp. The average contig length was 22,096 bp and the maximum was 933,412 bp. N75 was 160,383 bp, N50 was 260,639 bp and N25 was 517,260 bp (Table 5). The genome size of O. corvina is 21.92 Mb. This genome is a little smaller than other Onygenales found in GenBank. According to the summary statistics of genome assembly (Table 6), 98.92% reads were matched successfully and 91.34% reads in pairs. The GC content of of O. corvina genome is 48.05%.

Prediction of protease genes in O. corvina genome by PPR

The assembly sequence was divided into 8 pools. Each pool was further divided into 1445 sequences with the length of 2000 bp except the last one (eg, in fragment 1, 1 | 1 | to 1444| 1 | sequences with the length of 2000 bp, the last one 1445111 with the length of 1144 bp). The 8^th pool had 1426 sequences.

Neighbouring sequences were overlapping with 100. The protease genes of O. corvina were predicted by PPR as described (Busk and Lange, 2013). After prediction, full length genes were confirmed by Blast and full length ORFs were found with Augustus. Finally, 75 kinds of proteases were identified (Table 7). Clan information was based on the Merops database and the families were classified based on the conserved domains. The results show that O. corvina has a high numbers of S8, S33 and M28 family proteases (Figure 10). 12 of the 13 S8 family proteases and most of M28 family have a signal peptide suggesting that they are secreted proteins, whereas, none of S33 family protease had a signal peptide.

Comparative analysis of protease repertoire between keratin-degrading and non-keratin-degrading fungi

The protease repertoire of 9 keratin-degraders and 4 non-keratin-degraders was compared. The results showed that M36, M35, M43, C15 and S8 families are more abundant in keratin-degrader (Figure 11). A2 family also showed a little high relative difference because only keratin-degrader Coccidioides posadasii showed high number of A2 family protease. Thus, combined with the signal peptide information, M36, M35, M43 and S8 families proteases were chosen for expression in Pichia.

Example 3

Predicted keratinolytic protease genes, amplification, cloning, expression, and activity testing

According to the comparative analysis of protease repertoire between keratin- degrading and non-keratin-degrading fungi (Example 2), proteases belong to S8, M35, M36 and M43 families have great potential for keratin degradation. We tried to amplify the 18 protease genes by PCR with specific primers (Table 8) from RNA isolated from O. corvina grown on chicken feather (rich in β- keratin), pig bristles or dog wool (rich in a-keratin). 12 genes could be amplified, most from the cDNA made fromO. corvina growing on a-keratin- containing pig hair or dog wool (Table 9).

The Pichia pastoris system, PichiaPink™ Expression System (Invitrogen) was chosen for expressing protease genes. PichiaPink™ Strain 4 is double knock-out for both proteinases A and B (i.e., pepA and prbl), therefore has low

background protease activity. The protease genes in Table 8 were inserted to pPinka-HC vector. As expected, all 13 proteases genes (including the synthetic >830 | 1 | gene) were successfully cloned into pPinka-HC vector and transformed to PichiaPink™ Strain 4 which showed white color.

Recombinant proteases purification and protein determination

The recombinant proteases were purified by fast protein liquid chromatography (FPLC) (AKTA Purifier) according to the UNICORN method on a 1 ml HisTrap FF crude affinity column (GE Healthcare). The results indicated that all of the 13 genes with His tag were successfully expressed and purified. Purified

recombinant protease protein concentration was calculated according to the Molar Extinction Coefficient (Table 10).

Recombinant proteases activity and pig bristles degradation FTC-Casein is native casein that has been labeled with a large molar excess of fluorescein isothiocyanate (FITC). Proteases can digest fluorescein-labeled casein into smaller, labeled fragments that result in a measurable change in fluorescence properties. We applied a FRET-based measurement on a Corbett Rotor Gene 6000(Corbett Life Science) to detect the change in fluorescence when FTC-Casein was degraded by the purified recombinant proteases.

Compared to the fluorescence curve, protease >687 | 7 | (SEQ ID NO: 1 and SEQ ID NO: 2, S8 family) showed highest protease activity. Also protease >399 | 8 | (M36 family) and protease >830 | 1 | (M35 family) showed high activity. The other purified recombinant proteases had very low protease activity. SDS- PAGE results show that protease >687 | 7| and >399 | 8| were very purified and only one band in the gel.

The protease with highest activity, >687 | 7 | (SEQ ID NO: 1 and 2, S8 family) was further applied to degrade pig bristles. The results showed that 50 μΙ and 25 μΙ recombinant protease >687 | 7 | degrade 22% and 19%, respectively, of the pig hair in 24 hours at 40 °C.

Example 4

MS analysis of protease composition of Onygena corvina secretome

The result reported in Examples 2 and 3 are based on genome sequencing, analysis and bioinformatic predictions and confirmed by activity testing of predicted candidate proteases. In order to take advantage of direct

identification of the proteases present in the culture broth that was shown (Example 1) to decompose a- and β-keratin, an MS analysis was made of the Onygena corvina secretome in this culture broth.

In all 29 different proteases were identified in the culture broth from O. corvina grown on chicken feather. The same composition was found in the culture broth from O. corvina grown on pig bristles (Table 11). More M28 and S8 family proteins were found than of the other proteases (Figure 13). Hence, these two families may play an important role for keratin degradation. Example 5

Ion exchange fractionation of supernatant of culture broth of Onygena corvina and activity testing of the fractions

To further identify proteases involved in the keratin-degrading activity of the Onygena corvina culture broth supernatant (Example 1), the supernatant was fractionated by anionic and cationic chromatography. Subsequently activity testing of all resulting fractions was done. Based on MS data (Example 4) determination of which proteases were found in the most active fractions could be made to protein family level.

Usually, the buffer for ion exchange chromatography is chosen so the protein of interest is at least 1 pH unit from the isoelectric point. But since the protease of interest was of unknown composition (and isoelectric point) it was necessary to guess what would be the best pH of the buffer. A citrate buffer (pH 3.86) was chosen for the cation exchange fractionation and a Tris-HCI buffer (pH 8.6) was chosen for the anion exchange fractionation.

Both the anion and the cation exchange column were able to bind proteins with active protease activity (Azocasein used as substrate). The cation exchange experiment resulted in several fractions with strong protease activity (fractions 20-26 and possibly adjacent fractions) (Figure 14 and Table 12). The activity for these samples was much stronger than that of the initial culture fluid. The anion experiment gave fractions with lower activity compared to the cation exchange experiment (Figure 15 and Table 13).

In conclusion, both ion exchanges columns were able to fractionate an O.

corvina culture supernatant. Fractionation resulted in several, distinct, fractions with high proteolytic activity. These fractions containing cation exchange fractions (12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30) and anion exchange fractions (8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20) were further applied to protease identification and keratin materials degradation.

Protease identification of fractions with protease activity by LC-MS/MS

Fractions with protease activity were in-solution digested and LC-MS/MS analyzed to further identify the protease composition (Table 14). Compared with the 29 proteases found in culture broth supernatant from O. corvina grown on chicken feather and pig bristles (example 4), only 6 proteases

(fungi_t_q_l_(paired)_contig_105:True: 161893, S41 peptidase;

fungi_t_q_l_(paired)_contig_25:True:449121, M36 putative secreted metalloprotease; fungi_t_q_l_(paired)_contig_25:True:451737, M14 carboxypeptidase;

fungi_t_q_l_(paired)_contig_31 :True:98258, M28 peptidase;

fungi_t_q_l_(paired)_contig_77:True: 67317/

fungi_t_q_l_(paired)_contig_77:True: 67702, ornithine aminotransferase); fungi_t_q_l_(paired)_contig_125: False: 104994/

fungi_t_q_l_(paired)_contig_125: False: 106584, S9 Dipeptidyl-peptidase) were not identified in all the fractions. Anion exchanged fractions (A) have much higher abundance of proteases than the cation exchanged fractions (C).

Fraction A13 has 18 proteases, which followed by A10 and A14 with 15 and 14 proteases, respectively. Most of cation exchanged fractions have around 2-5 proteases.

Pig bristles degradation by fractions

To further discover keratinolytic proteases, fractions with protease activity (azocasein as substrate) were applied for pig bristles degradation. The results (Figure 16) indicated that all of the fractions can degrade pig bristles at different levels. C15, C20, All and A10 have much higher degradation degree compared to the other fractions. The degradation capabilities of fraction C15 and C20 are even much higher than the positive control with full composition proteases.

According to the protease identification results, C15 mainly have 3 proteases >687| 7 | (SEQ ID NO: 1 and 2), >642 | 3 | (SEQ ID NO: 3 and 4) and >839 | 3| (SEQ ID NO: 5 and 6) in S8, M28 and M3 family, respectively. C20 mainly have 2 proteases >642 | 3| (SEQ ID NO: 3 and 4) and >802 | 5| (SEQ ID NO: 7 and 8) in M28 family and 2 proteases >687 | 7 | (SEQ ID NO: 1 and 2) and > 1165 |2 | (SEQ ID NO: 9 and 10) in S8 family. Both of these two fractions share one >642| 3 | (SEQ ID NO: 3 and 4) and one >687 | 7| (SEQ ID NO: 1 and 2) protease. The results indicated that proteins/ proteases in fraction C15 and C20 play an important role for keratin degradation. Fraction All has 12 kinds of protease including 2 proteases >642|3| and >684|4| from the M28 family, 3 proteases >1435|4|, >1181|3| and >687|7| from the S8 family, 1 protease >577|5|, >839|3|, >883|2|, >714|2|,

>1339|4| and >399|8| from the Ml, M3, M20, M14, M49 and M36 family, respectively, and 1 unclassified protease >847|2|.

Fraction A10 has 15 kinds of protease including 2 proteases >642|3| and >684|4| from the M28 family, 3 proteases >1435|4|, >1181|3| and >687|7| from the S8 family, 2 proteases >294|5| and >714|2| from the M14 family, 1 protease >839|3|, >883|2|, >1339|4|, >1029|1|, >900|5|, >400|5| and >399|8| from the M3, M20, M49, S28, S9, S10 and M36 family, respectively, and 1 unclassified protease >847|2|.

Example 6

Activity testing of blends, composed of mixing of most active fractions

To test for synergistic action between the different amounts and types of proteases present in the fractions from ion exchange chromatography, the fractions were mixed in different combinations and tested for degradation of pig bristles. The blends were set up as described in the methods section.

Result

Mixing of fraction C15 and C20 gave the highest activity, much higher than testing the two fractions individually, when adjusted for equal enzyme load (Figure 17). The enzymes found in these fractions are an endoactive protease (two S8), exoactive proteases (two M28), and a metalloprotease (M3).

The degradation degrees of 25 μΙ fraction C15 and C20 were 17 % and 17%. The degradation degree of blend 12.5 μΙ fraction C15 and 12.5 μΙ fraction C20 was 21%. Therefore, the proteases >687|7| (SEQ ID NO: 1 and 2), >642|3| (SEQ ID NO: 3 and 4) and >839|3| (SEQ ID NO: 5 and 6) in fraction C15 and >642|3| (SEQ ID NO: 3 and 4), >802|5| (SEQ ID NO: 7 and 8), >687|7| (SEQ ID NO: 1 and 2) and >1165|2| (SEQ ID NO: 9 and 10) in fraction 20 may have synergistic effect. Fraction All and A10 have much higher degradation degree. Example 7

Comparative activity testing of best performing recombinant protease and best performing fractions

To test for synergistic action between the proteases present in the fractions and the recombinant protease >687 | 7| (SEQ ID NO: 1 and 2), the fractions were with the mixed recombinant protease >687 |7 | (SEQ ID NO: 1 and 2) and tested for degradation of pig bristles. The blends were set up as described in the methods section.

The results indicate that the degradation degree by the recombinant protease >687| 7 | (SEQ ID NO: 1 and 2) was 19%. The blends with recombinant protease >687 |7 | did not show increased degradation degree (Figure 18). Thus, recombinant protease >687 | 7 | is an robust enzyme to degrade pig bristles. In combination, the results of patent examples 6 and 7 suggest that the interesting activity observed from culture broth of O. corvina originates from in all 5 genes belonging to 3 protein families; and that most of such activity can be achieved by using 3-4 of these protease; and most of it also by only using the protease >687 |7 | (S8).

Example 8

To test the ability of the proteases in the culture broth from O. corvina and fractions from ion exchange chromatography to degrade pig bristles in a long term incubation, the different fractions C15, C20, A10, All and the culture broth from O. corvina grown on chicken feather or big brisles were incubated with pig bristles at 40 °C and the degradation was followed for four days by determining the soluble protein in the samples by measuring E280 on a

Nanodrop.

Furthermore, as protease >839 | 3 | (SEQ ID NO: 5 and 6) is an M3 family metallopeptidasethe function of this protease in the C15 fraction was measured vby adding 0.5 mM metallopeptidase inhibitor ethylenediaminetetraacetic acid (EDTA) to the C15 fraction degrading pig bristles. The results showed that after addition of EDTA, the pig bristles degradation degree was strongly decreased (Figure 19). This result indicated that protease >839 | 3 | (SEQ ID NO: 5 and 6) is important for keratin (here, pig bristles) degradation in combination with proteases >687 |7 | (SEQ ID NO: 1 and 2) and >642 | 3 | (SEQ ID NO: 3 and 4) in fraction C15.

After 3 days incubation, culture broth on chicken feather, culture broth on pig bristles, fraction C20 and fraction C15 degraded 63 %, 57 %, 52 % and 49 % of the pig bristle, respectively (Figure 19). In nature, keratin degrading fungi are known to secrete sulfite to destabilize the keratin by breaking the cysteine bridges, thereby making the keratin more susceptible to proteolysis and increasing the activity of keratinases three folds (Kunert, 1992).

Therefore, it is surprising that 49 - 52 % degradation can be reached with the partially purified proteases in fractions C15 and C20 without addition of sulfite to break the cysteine bridges of the keratin and is likely that even higher levels of degradation would be reached by adding sulfite as reported by Kunert (1992). It is possible that the slightly higher degradation (57 - 63 %) obtained with culture broth is due to the presence of sulfite secreted by O. corvina during growth. These findings therefore give additional support also to the findings of the almost complete decomposition observed by visual inspection in Example 1

To assess the degradation capacity of the O. corvina proteases of an industrially relevant substrate pretreated bristles and hooves obtained from a slaughter house were incubated with culture broth from chicken feather. After four days incubation, the culture broth had degraded nearly half (47 %) of the pretreated bristles and hooves (Figure 20). Hence, the proteases secreted by O. corvina are able to degrade this substrate to a large degree even without the addition of sulfite. References

Avasn Maruthi, Y., Aruna Lakshmi, K., Ramakrishna Rao, S., Apta Chaitanya, D., 2011. Degradation of feather and hair by Chrysosporium tropicum: A potent 5 keratinophilic fungus. Af r J Biotechnol 10, 3579-3584.

Cao, L, Tan, H., Liu, Y., Xue, X., Zhou, S., 2008. Characterization of a new keratinolytic Trichoderma atroviride strain F6 that completely degrades native chicken feather. 46, 389-394.

10

Czeczuga, B., Godlewska, A., Kiziewicz, B., 2004. Aquatic Fungi Growing on Feathers of Wild and Domestic Bird Species in Limnologically Different Water Bodies. Pol. J. Environ. Stud. 13, 21-31.

15 Dalev, P., Ivanov, I., Liubomirova, A., 1997. Enzymic Modification of Feather Keratin Hydrolysates with Lysine Aimed at Increasing the Biological Value. J Sci Food Agric. 73, 242-244.

Doveri, F., Pecchia, S., Vergara, M., Sarrocco, S., Vannacci, G., 2012. A comparative study of Neogymnomyces virgineus, a new keratinolytic species from 20 dung, and its relationships with the Onygenales. Fungal Diversity. 52, 13-34.

Esawy, M.A., 2007. Isolation and partial characterization of extracellular keratinase from a novel mesophilic Streptomyces albus AZA. Res J Agr Biol Sci. 3, 808-817.

25

Gupta, R., Ramnani, P., 2006. Microbial keratinases and their prospective applications: an overview. Appl Microbiol Biotechnol. 70, 21-33.

Ichida, J.M., Krizova, L, LeFevre, C.A., Keener, H.M., Elwell, D.L., Burtt Jr, E.H., 30 2001. Bacterial inoculum enhances keratin degradation and biofilm formation in poultry compost. 47, 199-208.

Kim, J.D., 2005. Immobilization of Keratinase from Aspergillus flavus K-03 for Degradation of Feather Keratin. Mycobiology 33, 121-123. Kornillowicz-Kowalska, T., Bohacz, J., 2010. Dynamics of growth and succession of bacterial and fungal communities during composting of feather waste. Bioresour Technol. 101, 1268-1276. Lin, X., Lee, C.-G., Ellen S. Casale, Shih, J.C.H., 1992. Purification and

Characterization of a Keratinase from a Feather-Degrading Bacillus licheniformis Strain. Applied and Environmental Microbiology. 58, 3271-3275.

Mercer, E.H., 1957. The Fine Structure of Keratin. 27, 860-866.

Riffel, A., Daroit, D.J., Brandelli, A., 2011. Nutritional regulation of protease production by the feather-degrading bacterium Chryseobacterium sp. kr6. N Biotechnol. 28, 153-157. Yamamura, S., Morita, Y., Hasan, Q., Yokoyama, K., Tamiya, E., 2002. Keratin degradation : a cooperative action of two enzymes from Stenotrophomonas sp. 294, 1138-1143.

Asahi, M., Lindquist, R., Fukuyama, K., Apodaca, G., Epstein, W.L., and McKerrow, J.H. (1985). Purification and characterization of major extracellular proteinases from Trichophyton rubrum. Biochem. J. 232, 139-144.

Brouta, F., Descamps, F., Monod, M., Vermout, S., Losson, B., and Mignon, B. (2002). Secreted metalloprotease gene family of Microsporum canis. Infect.

Immun. 70, 5676-5683.

Chen, J., Yi, J., Liu, L, Yin, S., Chen, R., Li, M., Ye, C, Zhang, Y., and Lai, W. (2010). Substrate adaptation of Trichophyton rubrum secreted endoproteases. Microb. Pathog. 48, 57-61. Cheung, S.S., and Maniotis, J. (1973). A genetic study of an extracellular elastin- hydrolysing protease in the ringworm fungus Arthroderma benhamiae. J. Gen. Microbiol. 74, 299-304.

Giudice, M.C., Reis-Menezes, A. A., Rittner, G.M.G., Mota, A. J., and Gambale, W. (2012). Isolation of Microsporum gypseum in soil samples from different geographical regions of brazil, evaluation of the extracellular proteolytic enzymes activities (keratinase and elastase) and molecular sequencing of selected strains. Braz. J. Microbiol. Publ. Braz. Soc. Microbiol. 43, 895-902. Kano, R., Yamada, T., Makimura, K., Yamaguchi, H., Watanabe, S., and

Hasegawa, A. (2005). Metalloprotease gene of Arthroderma gypseum. Jpn. J. Infect. Dis. 58, 214-217.

Lee, K.H., Park, K.K., Park, S.H., and Lee, J.B. (1987). Isolation, purification and characterization of keratinolytic proteinase from Microsporum canis. Yonsei Med. J. 28, 131-138.

Sriranganadane, D., Waridel, P., Salamin, K., Feuermann, M., Mignon, B., Staib, P., Neuhaus, J.-M., Quadroni, M., and Monod, M. (2011). Identification of novel secreted proteases during extracellular proteolysis by dermatophytes at acidic pH. Proteomics 11, 4422-4433.

Lange Morten and Hora F. Bayard, Collins guide to mushrooms & toadstool, Collins ST James's place, London, 1963. P49.

Busk, P. K., Lange, L., 2013. Function-based classification of carbohydrate-active enzymes by recognition of short, conserved peptide motifs. Appl Environ

Microbiol. 79, 3380-3391. Kunert J., 1992. Effect of reducing agents on proteolytic and keratinolytic activity of enzymes of Microsporum gypseum. Mycoses. 35(ll-12) : 343-8

Tables

Table 1

Keratin-degrading fungi, substrates and sources

Keratinophilic

Substrate Isolated

fungi

Trichophyton human stratum

rubrum corneum

Microsporum

gypseum

Microsporum

cam^'s

Trichophyton

mentagrophytes

Trichophyton

rubrum

chicken

feathers,high

Microsporum poultry soil

keratin degrading

capability

Penicillium chicken feathers poultry soil

Aspergillus chicken feathers poultry soil

Fusarium chicken feathers poultry soil

Cladosporium chicken feathers poultry soil

Chaetomium chicken feathers poultry soil

chicken

Staphylotrichu feathers,high

poultry soil m keratin degrading

capability

Gleocladium chicken feathers poultry soil

high keratin

Chrysosporium

degrading sand pits

keratinophilum

capability

Microsporum

sand pits

gypseum

Trichophyton

menthagrophyt sand pits

es

Chrysosporium

sand pits

evolceanui

Microsporum garden, field and river bank soil

Chrysosporum garden, field and river bank soil

Microsporum sandy texture soil, details about human hair

gypseum biochemical characters:

30% blood meal,

Aspergillus 26% cottonseed

bovine rumen oryzae meal,

4% feather meal,

Aspergillus hair bait soil samples of five different regions like f lav us technique fertile lands, animal herds, slaughter houses, poultries and barbers'shops soil samples of five different regions like

Aspergillus hair bait

fertile lands, animal herds, slaughter fumigatus technique

houses, poultries and barbers'shops soil samples of five different regions like

Aspergillus hair bait

fertile lands, animal herds, slaughter wentii technique

houses, poultries and barbers'shops soil samples of five different regions like hair bait

Botrytis cinaria fertile lands, animal herds, slaughter technique

houses, poultries and barbers'shops soil samples of five different regions like

Chochliobolus hair bait

fertile lands, animal herds, slaughter lunatus technique

houses, poultries and barbers'shops soil samples of five different regions like

Chrysosporum hair bait

fertile lands, animal herds, slaughter asperatum technique

houses, poultries and barbers'shops soil samples of five different regions like

Fu sari urn hair bait

fertile lands, animal herds, slaughter species technique

Mucor species fertile lands, animal herds, slaughter technique

houses, poultries and barbers'shops soil samples of five different regions like

Penicillium hair bait

fertile lands, animal herds, slaughter species technique

houses, poultries and barbers'shops isolated and identified in the Laboratory of Botany, Faculty of Medicine and Pharmacy,University of Franche-Comte ^',

Paecilomyces

soy flour Besan^ on, France, and are deposited in marquandii

the Culture Collection of the National Institute of Chemistry (MZKI), Ljubljana,

Slovenia

isolated and identified in the Laboratory of Botany, Faculty of Medicine and Pharmacy,University of Franche-Comte ^',

Dora torn yces

soy flour Besan^ on, France, and are deposited in microsporus

Slovenia

human hair, pig

hair, feather

Aspergillus

meal, chicken citrus waste

niger

feathers, and

bovine horn

soil samples collected from poultry dump

Aspergillus chicken feathers

areas using chicken feathers as the sole parasiticus and keratin

source of carbon and nitrogen

Alternaria chicken feather hicken farm wastes containing decayed tenuissima K2 powder feathers

Aspergillus chicken feather chicken farm wastes containing decayed nidulans K2 powder feathers Trichoderma

chicken feather decaying feathers

atroviride

Onygena

Duck feather Goat wool

corvina

Table 2

Effect of different compounds on the crude protease and keratinase activity of

Onygena corvina

Table 3

Experiment set up for making fraction blend (A: anion exchanged fractions; C: cation exchanged fractions). Positive control P: culture supernatant after Onygena corvina growing on fermentation medium with pig bristles 11 days. Positive control C: culture supernatant after Onygena corvina growing on fermentation medium with chicken feather 11 days. Negative control : 0.05 ml fraction was replaced by 0.05 ml 2x Mcllvaine buffer (pH 8) and incubated at 40 °C for 24 h with constant agitation at 1000 rpm

Experiment set up

C20 (25 μΙ)

C15 (25 μΙ)

All (25 μΙ)

A10 (25μΙ)

C20 (12.5 μΙ)+015(12.5 μΙ)

C20 (12.5 μΙ)+Α11(12.5 μΙ)

C20 (12.5 μΙ)+Α10(12.5 μΙ)

C20 (12.5 μΙ)+Α10(6.25 μΙ)+Α11(6.25μΙ) positive control Ρ (25 μΙ)

positive control C (25 μΙ)

negative control (25 μΙ buffer)

Table 4

Experiment set up for making purified recombinant protease and fraction blend ((A: anion exchanged fractions; C: cation exchanged fractions). >687| 7 | is the purified recombinant protease (S8) expressed in pichia. Positive control P: culture supernatant after Onygena corvina growing on fermentation medium with pig bristles 11 days. Positive control C: culture supernatant after Onygena corvina growing on fermentation medium with chicken feather 11 days. Negative control : 0.05 ml fraction was replaced by 0.05 ml 2x Mcllvaine buffer (pH 8) and incubated at 40 °C for 24 h with constant agitation at 1000 rpm.

Experiment set up

>687 |7 | (25 μΙ)

C20 (25 μΙ)

C15 (25 μΙ)

All (25 μΙ)

A10 (25μΙ)

>687| 7 | (12.5 μΙ)+015(12.5μΙ)

>687| 7 | (12.5 μΙ)+Ο20(12.5μΙ)

>687| 7 | (12.5 μΙ)+Α10(12.5μΙ)

>687| 7 | (12.5 μΙ)+Α11(12.5μΙ)

>687| 7 | (8.5 μΙ)+αΐ5(8.25μΙ)+Ο20(8.25

Ml) >687 | 7 | (6.25M I) +C20 (6.25 μ Ι)+Α10(6.25 μΙ)+Α11(6.25μΙ)

positive control P (25 μΙ)

positive control C (25 μΙ)

negative control(25 μΙ buffer)

Table 5

Assembly quality of genomes

Assembly quality of genome

Length³ Length^b

N75 160383 125887

N50 260639 224872

N25 517260 324265

Minimum 198 120

Maxim um 933412 922970

Average 22096 18022

Count 992 1216

Total 21919116 21914624

a Contig measurements (including scaffolded regions); ^b Contig measurements (exclud ing scaffolded regions)

Table 6

Summary statistics of genome assem bly

Count Average length Total bases

Matched 80660745 78,65 6343750062

Not matched 877577 62,09 54487838

Contigs 992 22095 21919116

Reads in pa irs 74474370 182,91

Broken pa ired reads 6186375 76,37

Table 7

Predictions results of repertoire of protease genes in O. corvina genome by PPR.

Table 8

Primer sequences for PCR. Restriction site was underlined in each primer sequence, stop code "TTA" was italicize in each reverse primer, His tag was added in each reverse primer (bold sequence).

Coding gene length Restriction

Gene Family Primer Sequence 5 '-3'

(bp) site

ForwardAAAAGGCCTGGTGTTTTGAAGTTCATTTCCAT Stul

>750|8| S8/SUB1 1473

Reverse TGCGGCCGGCC7 ATGATGATGATGATGATGATGGTGAGACCACCACCAAG Fsel

ForwardTCGAGGATATCCAGCTCTTCAGCCTCCTCCT EcoBN >626|6| S8/SUB2 1248

Reverse TGCGGCCGGCC7 ATGATGATGATGATGATGCTGCTGCACCTTGGAGCG Fsel

ForwardAAAAGGCCTGGCTGCATCAAGGTCATCTCCG Stul >687|7| S8/SUB3 1182

Reverse TGCGGCCGGCC7 ATGATGATGATGATGATGTTGGCCGCTTCCGTTGTAGAG Fsel

ForwardAAAAGGCCTTTCTCCCTCAAGACTTTGTCCA Stul >870|2| S8/SUB4 1197

Reverse TGCGGCCGGCC7 ATGATGATGATGATGATGGTATCCGCTTCCGTTGTACA Fsel

ForwardAAAAGGCCTGGTTTCATTACCAAGGCCCTC Stul >854|5| S8/SUB7 1203

Reverse TGCGGCCGGCC7 ATGATGATGATGATGATGCATGCCAGAGCCGTTGTTGAT Fsel

ForwardAAAAGGCCTAAGATCGCGGAGAGAGCATTC Stul >1165|2| S8/SUB7 1209

Reverse TGCGGCCGGCC7 ATGATGATGATGATGATGGCGTCCGCTCCCATTGTA Fsel

ForwardAAAAGGCCTAAGGGCCTCCTCAGCCTCTC Stul >1181|3| S8/SUB8 1473

Reverse TGCGGCCGGCCmATGATGATGATGATGATGTACAATGATGGCGTCCTTGAGCT iel

ForwardAAAAGGCCTGGTTTCTTCCGCGCCTTATT Stul >712|2| S8/SUB9 1209

Reverse TGCGGCCGGCC7 ATGATGATGATGATGATGCGCCCCGCTACCGTTGT Fsel

ForwardTCGAGGATATCGGTTTCCTCAAGACCATTGC EcoRN >1435|4| S8/SUB11 1200

Reverse TGCGGCCGGCC7 ATGATGATGATGATGATGCTGACCGCTACCGTTATACA Fsel

ForwardTCGAGGATATCTTTCTCTTGAAACCCTTGGTG EcoBN >658|2| S8/SUB12 1212

Reverse TGCGGCCGGCC7 ATGATGATGATGATGATGAGCTCCACTATCGTTGTAGAG Fsel

ForwardTCGAGGATATCCAAGTCATTGTTGCTCTTGCT EcoRN >830| 1| M35/NPIIB 1101

Reverse TGCGGCCGGCC7X ATGATGATGATGATGATGGCAGCCAACGTAGATAGCG Fsel

ForwardTCGAGGATATCCAATTTATTGCTGCCCTCTCG EcoKV

>775|8| M35/NPIID 1098

Reverse TGCGGCCGGCC7 ATGATGATGATGATGATGGCAGTTGACATAGATGGCATT Fsel

ForwardAAAAGGCCTCACGGTTTACTCCTTGCCG Stul

>1100|2|M36 MEP1 1899

Reverse TGCGGCCGGCC7 ATGATGATGATGATGATGCTGCACTCTGGTGGGACA Fsel

ForwardAAAAGGCCTCACGGACTCTTGCTCGCCG Stul

>1252|6|M36 MEP2 1884

Reverse TGCGGCCGGCC7 ATGATGATGATGATGATGGCAAGCACCGTCGAAAGACATG Fsel

ForwardTCGAGGATATCCACGGCCTCTTGCTTGCC EcoEN

>881|4| M36 MEP3 1902

Reverse TGCGGCCGGCC7 ATGATGATGATGATGATGGCATCCTGGGGGGAGCTG Fsel

ForwardAAAAGTACTCACGGCCTTCTGCTTGCTG Seal

>399|8| M36 MEP4 1905

Reverse TGCGGCCGGCC7 ATGATGATGATGATGATGACATCCTTCAGGGAGCTTGTT Fsel

ForwardAAAAGGCCTCGTCTCTCTGTCCTTCTCTCCG Stul

>370|5| M43 MEP6 813

Reverse TGCGGCCGGCC7 ATGATGATGATGATGATGGTATGGAGCACGGAACGCAT Fsel

ForwardAAAAGGCCTCGTGTCTCTCTATCTCTTCTTGGC Stul

>629|6| M43 MEP8 822

Reverse TGCGGCCGGCC7X ATGATGATGATGATGATGTTTGCCGGCACGCAGCT Fsel

Table 9

Predicted protease genes amplification results from cDNA made from Onygena corvina grown on chicken feather, pig bristles and dog wool. "+" indicated the protease coding sequence can be amplified from cDNA template, the related RNA was extracted from Onygena corvina when it grown on chicken feather, pig bristles or dog wool. "-" indicated the protease coding sequence cannot be amplified from cDNA template.

a The cDNA sequence of the >830 | 1 | was synthesized and cloned into pUC57 by GenScript (USA)

Table 10

Protein determination of purified recombinant proteases

A280nm Purified

Molar

A280nm (purified protease

Gene Extinction

(1 mg/ml) recombinant concentration Coefficient

protease) (mg/ml)

>750 | 8 | 64860 1,257 0,420 0,334

>687 | 7 | 40910 1,007 0,426 0,423

>870 | 2 | 42860 1,031 0,444 0,431

>854| 5 | 38390 0,930 0,617 0,663 >1165|2| 35410 0,842 0,428 0,508

>1181|3| 53860 1,028 1,196 1,163

>712|2| 45380 1,069 0,421 0,394

>1435|4| 56380 1,349 0,356 0,264

>830|1| 25330 0,643 0,449 0,698

>775|8| 23840 0,604 0,403 0,667

>399|8| 100730 1,442 0,399 0,277

>370|5| 30370 1,051 0,309 0,294

>629|6| 24870 0,835 0,282 0,338

Table 11

MS analysis of protease composition of Onygena corvina secretome when it grows on chicken feather (C) or pig bristles (P). The biological triplicates were performed to normalize the label-free quantification (LFQ) values, and LFQ intensities in each sample were log2-transformed. To estimate the proteome variance, comparisons were performed using T-test (two-tailed, heteroscedastic).

Table 12

Protease activity profile of selected fraction from cation exchange

chromatography. Sample prior to loading : 50 ml culture supernatant was diluted to 100 ml sample prior to load. Negative control : fraction was replaced by 50 mM citric acid buffer, pH 3.86.

Table 13

Protease activity profile of selected fraction from anion exchange chromatography. Negative control : fraction was replaced by 20 mM Tris-HCI buffer, pH 8.6.

Table 14

Proteases identification by LC-MS/MS for the fractions with protease activity (azocasein as substrate). A: Anion exchanged fractions; C: Cation exchanged fractions

Sequence listing

Sequence description Sequence

identifier

Gene encoding a recombinant protease sequence belonging to SEQ ID NO. : 1 S8 family. This protease has high keratinase activity and is also

included in the keratinolytic fractions C15, C20, A10 and All.

Translation of SEQ ID NO 1 SEQ ID NO. : 2

Gene encoding an M28 family N-terminal protease. This SEQ ID NO. : 3 protease was found in the keratinolytic fractions C15, C20, A10

and All.

Translation of SEQ ID NO 3 SEQ ID NO. : 4

Gene encoding an M3 family metaiioprotease. This protease was SEQ ID NO. : 5 found in the keratinolytic fractions C15 that lost half of the

activity by inhibition of metalloproteases and in A10 and All.

Translation of SEQ ID NO 5 SEQ ID NO. : 6

Gene encoding an M28 family N-terminal protease. This SEQ ID NO. : 7 protease was found in the keratinolytic fractions C20.

Translation of SEQ ID NO 7 SEQ ID NO. : 8

Gene encoding an S8 family serine protease. This protease was SEQ ID NO. : 9 found in the keratinolytic fractions C20.

Translation of SEQ ID NO 9 SEQ ID NO. : 10

Claims

1. Use of (i) one or more Ascomycetous fungal species, (ii) one or more

Basidiomycetous fungal species and/or (iii) microbial products from (i) and/or (ii) for the degradation of keratinaceous materials.

2. The use according to claim 1, wherein the keratinous material is selected from the group consisting of feather, hair, hoof, horn and bristles.

3. The use according to any one of claims 1 or 2, wherein the one or more Ascomycetous fungal species belongs to Eurotiomycetes.

4. The use according to any one of the preceding claims, wherein the one or more Ascomycetous fungal species belongs to Onygenales.

5. The use according to any one of the preceding claims, wherein the one or more Ascomycetous fungal species belongs to Onygenaceae.

6. The use according to any one of the preceding claims, wherein the one or more Ascomycetous fungal species belongs to the genus Onygena.

7. The use according to any one of the preceding claims, wherein the one or more Ascomycetous fungal species belongs to the species Onygena equina or Onygena corvina.

8. The use according to claim 7, wherein the species Onygena equina or Onygena corvina is selected from the group consisting of strains, isolates and mutants of the species Onygena equina or Onygena corvina.

9. The use according to any one of the preceding claims further comprises a consortia of bacterial species such as but not limited to Gram-positive bacteria such as Bacillus sp. and/or Gram-negative bacteria such as Pseudomonas spp.

10. Use of one or more protein(s) from one or more Ascomycetous fungal species and/or one or more Basidiomycetous fungal species for the degradation of keratinaceous materials.

11. The use according to claim 10, wherein the one or more protein(s) is selected from the group consisting of endo-acting protease(s), exo-acting protease(s), metalloprotease(s) and serine protease(s).

12. The use according to claim 11, wherein the endo-acting protease(s) belongs to the Merops family S8 or Merops family M3.

13. The use according to claim 11, wherein the exo-acting protease(s) belongs to the Merops family M28.

14. The use according to any one of claims 10-13, wherein the one or more protein(s) comprises an amino acid sequence selected from the group consisting of:

(ii) A functionally equivalent part of an amino acid sequence as defined in (i); and (iii) A functionally equivalent analogue of an amino acid sequence as defined in (i) or (ii), the amino acid sequence of said analogue being at least 84% identical to an amino acid sequence as defined in (i) or (ii).

15. The use according to any one of claims 10-14, wherein the one or more protein(s) is encoded by a nucleic acid sequence selected from the group consisting of:

16. The use according to any one of claims 10-15, wherein the one or more protein(s) are produced by native or heterologous expression of a nucleic acid sequence selected from the group consisting of:

(i) a nucleic acid sequence as defined by any of SEQ ID NOs: 1, 3, 5, 7 and 9; and (ii) a nucleic acid sequence which is at least 84% identical to a nucleic acid sequence as defined in (i).

17. A method for the degradation of keratinaceous materials comprising the steps 5 of:

- adding to a keratinaceous material, (i) one or more Ascomycetous fungal species, (ii) one or more Basidiomycetous fungal species, (iii) microbial products from (i) and/or (ii) and/or (iv) one or more protein(s) secreted from one or more Ascomycetous fungal species and/or one or more protein(s) secreted from one or

10 more Basidiomycetous fungal species, and

- obtaining a degraded keratinaceous material.

18. A composition comprising one or more protein(s) comprising an amino acid sequence selected from the group consisting of:

15 (i) An amino acid sequence as defined by any one of the SEQ ID NOs: 2, 4, 6, 8 or 10

(iii) A functionally equivalent analogue of an amino acid sequence as defined in (i) or (ii), the amino acid sequence of said analogue being at least 84% identical to

20 an amino acid sequence as defined in (i) or (ii).

19. A composition according to claim 18, further comprising a keratinaceous material.

25 20. A composition comprising :

(i) one or more Ascomycetous fungal species and/or one or more Basidiomycetous fungal species and/or microbial products from one or more Ascomycetous fungal species and/or one or more Basidiomycetous fungal species, and

(ii) a keratinaceous material.

30

21. A feed comprising the degraded keratinaceous material according to claim 17.

22. The feed according to claim 21, wherein the feed is for a non-ruminant one stomach animal.

35

23. The feed according to any one of claims 21-22, wherein the feed is a pig, mink, chicken or fish feed.

24. A food product comprising the degraded keratinaceous material according to 5 claim 17.

25. A cosmetic product comprising the degraded keratinaceous material according to claim 17.

10 26. A pharmaceutical composition comprising the degraded keratinaceous

material according to claim 17.

15