WO2017151059A1

WO2017151059A1 - Multiplexable activation of silent biosynthetic clusters in native actinomycete hosts for natural product discovery

Info

Publication number: WO2017151059A1
Application number: PCT/SG2017/050092
Authority: WO
Inventors: Mingzi Zhang; Fong Tian Wong; Huimin Zhao
Original assignee: Agency For Science, Technology And Research
Priority date: 2016-02-29
Filing date: 2017-02-28
Publication date: 2017-09-08

Abstract

Disclosed herein are recombinant methods of activating expression of one or more biosynthetic gene cluster(s), or one or more target gene(s) in a biosynthetic gene cluster comprising more than one gene, the method comprising inserting one or more promoter(s) using CRISPR technology at one or more transcriptionally functional location(s) relative to the biosynthetic gene cluster(s) or the target gene(s) in the biosynthetic gene cluster(s), whereby the insertion of the promoter(s) results in increased expression of the biosynthetic gene cluster(s) or target gene(s) compared to the expression level of an unmodified biosynthetic gene cluster(s) or target gene(s). Also disclosed herein are recombinant expression plasmids for activating expression of a biosynthetic gene cluster(s).

Description

MULTIPLEXABLE ACTIVATION OF SILENT BIOSYNTHETIC CLUSTERS IN NATIVE ACTINOMYCETE HOSTS FOR NATURAL PRODUCT DISCOVERY

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority of Singapore provisional application No. 10201601523W, filed 29 February 2016, the contents of it being hereby incorporated by reference in its entirety for all purposes.

FIELD OF THE INVENTION

[0002] The present invention relates generally to the field of molecular biology. In particular, the present invention relates to recombinant genomic editing methods and protein expression.

BACKGROUND OF THE INVENTION

[0003] The use of natural products in medicine and health has been documented by occidental and orient civilizations throughout human history. Today, the myriad of structurally diverse and complex molecules produced by plants and microorganisms remain a fertile source of pharmaceuticals and bioactive scaffolds. Approximately 50% of all FDA approved drugs, 69% of anti-infective agents and 80% of anti-cancer drugs that have been isolated since 1981 are natural products and natural product derivatives. About half of small molecule New Chemical Entities (NCEs) approved between 2000 to 2010 are natural products or their derivatives. One major issue preventing access to the chemical diversity encoded by, for example, naturally occurring biosynthetic gene clusters (BGCs) is the low or non-existent functional expression of the relevant genes. This, in turn, hampers production of that metabolite for identification and bioactivity assays purposes. With cancer, cardiovascular, neurodegenerative and infectious diseases being the leading causes of deaths globally, there is an urgent need for new pharmaceuticals with novel chemical scaffolds and bioactivities.

[0004] Thus, it is an object of the present invention to provide a method allowing access to such naturally occurring biosynthetic gene clusters (BGCs)

SUMMARY

[0005] In one aspect, the present invention refers to a recombinant method of activating expression of one or more biosynthetic gene cluster(s), or one or more target gene(s) in a biosynthetic gene cluster comprising more than one gene, the method comprising inserting one or more promoter(s) at one or more transcriptionally functional location(s) relative to the biosynthetic gene cluster(s) or the target gene(s) in the biosynthetic gene cluster(s), whereby the insertion of the promoter(s) results in increased expression of the biosynthetic gene cluster(s) or target gene(s) compared to the expression level of an unmodified biosynthetic gene cluster(s) or target gene(s), wherein the promoter(s) is/are inserted using CRISPR technology.

[0006] In another aspect, the present invention refers to a recombinant expression plasmid for activating expression of a biosynthetic gene cluster(s), the plasmid comprising one or more promoter(s) as disclosed herein, a biosynthetic gene cluster(s) or one or more target gene(s) as disclosed herein.

BRIEF DESCRIPTION OF THE DRAWINGS

[0007] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:

[0008] Fig. 1 shows that the use of CRISPR-Cas9 technology improves genome engineering of Streptomyces. (A) Conventional gene replacement and genetic knock-in by homologous recombination in Streptomyces involve two steps. In the first step, integration of the suicide plasmid by single crossover is selected for by positive selection. Crossover can occur at either of the homologous regions marked in different shades. Subsequent negative selection yields double crossover clones with either wild type sequence or desired genomic modification. (B) The gRNA- guided Cas9 nuclease encoded on a replicative plasmid creates a double stranded break at the target genomic locus adjacent to the PAM sequence. Cells that carry out homology-directed repair in the presence of an editing template with homologous flanks survive. For this method, only a single selection step for the plasmid is needed.

[0009] Fig. 2 shows the activation of the silent indigiodine biosynthetic gene cluster and introduction of heterologous gene in 5. albus. (A) Part of the indigiodine cluster in 5. albus (not to scale). Indicated is the target site of CRISPR -Cas9 and the introduction site of the kasO*p or tsr- kasO*p for activation of the cluster depending on the donor DNA used, tsr encodes for a thiostrepton resistant gene product. (B) Knock-in efficiencies of kasO*p or tsr-kasO*p in 5. albus with and without (no protopsacer) targeted double-stranded breaks by CRISPR-Cas9. Two protospacers targeting the same region upstream of the IndC-like indigiodine synthetase gene was used and two different lengths of homology ends of the donor DNA was explored (1 kb vs 2 kb). (C) Wild type (wt) or indicated engineered strains are streaked on ISP2 or ISP2+ thiostrepton plates.

[0010] Fig. 3 shows the results of the activation of the silent undecyprodigionine (RED) biosynthetic gene cluster in 5. lividans. (A) Part of the RED cluster in 5. lividans (not to scale). Indicated is the target site of CRISPR-Cas9 and the introduction site of the kasO*p by homologous recombination with donor DNA harbouring homologous ends. Arrowheads indicate the relative positions and identities of the primers used for diagnostic PCR to determine knock -in efficiencies. Orange arrowheads indicate kasO*p-specific primers not present in 5. lividans genome. (B) Knock-in efficiencies of 5. lividans with and without (that is, no protospacer present) targeted double-stranded breaks by CRISPR-Cas9. (C) Diagnostic PCR from genomic DNA isolated from wild type (wt) and exconjugants using the indicated primers to determine kasO*p knock -in at the designated genomic locus. For control PCR of the left and right flanks, primer pairs 1+2 and 3+4 were used respectively. For detection of kasO*p knock-in, primer pairs 1+5 and 3+6 were used. (D) Wild type and engineered 5. lividans strains on ISP2 plates. (E) Liquid ISP2 cultures of wild type and engineered 5. lividans strains.

[0011] Fig. 4 shows the results of the activation of the silent actinorhodin (ACT) biosynthetic gene cluster in 5. lividans. (A) Part of the RED cluster in 5. lividans (not to scale). Indicated is the target site of CRISPR-Cas9 and the introduction site of the kasO*p by homologous recombination with donor DNA harbouring homologous ends. The red arrowheads represent primers beyond the homologous regions used for diagnostic PCR of successful knock-in. (B) Efficiency of kasO*p knock-in for the ACT cluster in 5. lividans. Diagnostic PCR from genomic DNA isolated from wild type (wt) and exconjugants were subjected to BstBI-digest to determine kasO*p knock-in at the designated genomic locus. M refers to molecular weight ladder. (C) Wild type or engineered 5. lividans strains with an activated ACT cluster were streaked onto an ISP2 plate for 3 days. The plate was then subjected to ammonia fuming to validated production of the pH-sensitive actinorhodin antibiotic.

[0012] Fig. 5 shows the activation of a silent phosphonate biosynthetic gene cluster in 5. roseosporus. (A) Uncharacterized phosphonate cluster in 5. roseosporus with homology to the known FR-900098 cluster in S. rubellomurinus in addition to genes predicted to encode for NRPSs and phosphonate transporters. Inset shows a more detailed view of the FR-900098 biosynthetic gene homologs. Promoters are inserted by targeting CRISPR-Cas9 to a region between pepM and frbC homologs indicated by the diverging ORFs in red. (B) Identity of the promoters and mutations introduced for pepM and frbC homologs in the cluster using the CRISPR-Cas9 technology. Editing efficiencies for the different constructs are shown. (C) ³¹P-NMR spectra of methanol extracts from culture supernatants of wild type and indicated engineered 5. roseosporus strains. (*) refers to new peaks with chemical shifts corresponding to phosphonates. Spiking of FR-900098 into the Bi samples followed by ³¹P-NMR analysis under the same conditions increased intensity of the (*)-labelled peaks but did not alter spectrum profile. It is estimated that the engineered Bi strain produced 10-12 mg/L of FR-900098.

[0013] Fig. 6 shows the results of multiplex activation and engineering of silent and/or cryptic biosynthetic gene clusters in actinomycetes for natural product discovery. Strategic insertion of constitutive promoters is sufficient to activate expression of relevant genes within the biosynthetic gene cluster and production of the cognate natural product. The same technology can also be used to perform in situ engineering of the gene cluster for the generation of natural product derivatives. Altogether, these approaches will increase the chemical diversity of existing actinomycete strain collections for bioactivity screening and accelerate the natural product discovery process.

[0014] Fig. 7 presents data showing the relative promoter strengths in different actinomycetes. Using a pSET plasmid, a copy of the xylE gene driven by the indicated promoters were integarated into the genomes of (A) 5. roseosporus, (B) Micromonospora sp. and (C) 5. erythraea. 1, 2 and 3 day old cultures were harvested and specific xylE activity of the cell lysates was determined.

[0015] Fig. 8 shows a representation of the biosynthetic pathway for FR-900098. (A) Part of the phosphonate biosynthetic gene cluster in 5. roseosporus with homology to FR-900098 cluster in 5. rubellomurinus. Genes are labelled according to their homologs in 5. rubellomurinus. Site of promoter(s) insertion is indicated by the red arrow. (B) FR-900098 cluster in 5. rubellomurinus and the proposed biosynthetic pathway of FR-900098. Figure is obtained from Metcalf et al l (C) Table showing % identity between homologous genes in the phosphonate cluster of 5. roseosporus and those from the FR-900098 cluster in 5. rubellomurinus.

[0016] Fig. 9 shows the nucleic acid sequences of the constitutive promoters used for cluster activation. ATG start codons of genes to be activated are underlined.

[0017] Fig. 10 shows a scheme and sequences of adapters introduced into pCRISPomyces at the Xbal site for making promoter (single and bidirectional) knock-in constructs. For other promoters such as ermE*p and rcfp, the adapter sequences used are the same.

[0018] Fig. 11 shows a scheme of different cloning schemes for CRISPR/Cas9 editing plasmids for cluster activation. Three cloning schemes were tested over the course of this study to assembly the final genome editing plasmids. Scheme 1 was used to generate editing plasmids for 5. albus. Scheme 2 was used to assemble S. lividans plasmids and a fraction of the 5. roseosporus constructs. Scheme 3 involving modified pCM2 plasmids proved to be the most efficient and were used to make majority of the plasmids in the study. The advantages and limitations of each scheme are listed.

[0019] Fig. 12 shows a schematic and the results of CRISPR-Cas9-based promoter knock-in strategy to activate silent biosynthetic gene clusters in streptomycetes. (a) Using CRISPR-Cas9, efficient and precise introduction of promoter cassettes (bidirectional arrows) drive expression of biosynthetic genes (gray) and trigger the production of unique metabolites (*) that are not detected for the parent strain, (b) Knock-in efficiencies with and without use of CRISPR-Cas9 in different Streptomyces species, namely 1) 5. albus, 2) 5. lividans, 3) 5. roseosporus, and 4) 5. venezuelae. See Table 7 for actual values. For 5. albus, the knock-in efficiencies for different sized inserts (100 bp vs 1 kb) using editing templates with different homology lengths (1 kb vs 2 kb) were examined, n.d., not determined, (c) Wild type (wt) or indicated engineered 5. albus strains on MGY or MGY+thiostrepton plates, (d) Wild type and engineered 5. lividans strains with activated RED (left panel) or ACT (right panel) clusters on MGY plates. Ammonia fuming confirmed production of pH-sensitive actinorhodin- related pigments (Fig. 23).

[0020] Fig. 13 shows graphs depicting the result of the activation of biosynthetic gene clusters in multiple streptomycetes. (a) HPLC analysis of ethyl acetate extracts from wild type 5. roseosporus and an engineered strain in which kasO*p was introduced into cluster 24. Indicated are the two major polycyclic tetramate macrolactam compounds that are isolated from the engineered strain. Stereochemistry was not assigned for 2. See Fig. 26 and Fig. 37 to 40 for full chromatograms and chemical characterization data, (b) ³¹P-NMR spectra of methanol extracts from wild type 5. roseosporus and an engineered strain in which a bidirectional P8-kasO*p cassette was introduced into the phosphonate cluster 10. Also shown are the ³¹P-NMR spectra of authentic FR-900098 sample and FR-900098 spiked into the extract of the P8-kasO*p strain. HRMS and HMBC analyses confirmed FR-900098 production (Fig. 37 to 40). Difference in chemical shifts in authentic and spiked FR- 900098 is due to difference in sample pH.22 (c-e) LC-MS analyses of culture extracts from wild type (black) and engineered 5. roseosporus (gray), 5. venezuelae (gray) strains in which kasO*p was introduced into the respective clusters. Major metabolites uniquely produced by the engineered strains and not observed for the wild type strains are highlighted with their indicated m/z values. It is noted that there are additional differences between the metabolic profiles of the engineered and the respective wildtype strains. For details, full chromatograms and mass spectra, see Fig. 31 to 33.

[0021] Fig. 14 shows the results of large scale purification and structural identification of major products from activated polycyclic tetramate macrolactam cluster in 5. roseosporus. (A) HPLC analysis of crude and fractionated ethyl acetate extracts from 100 ISP2 plates. Extracted ion chromatograms of the 100% methanol fraction contains the major ions m/z 511 and 513 that were produced with activation of the cryptic polycyclic tetramate macrolactam cluster. (B) The two major products were identified to be photocyclized alteramide A and HSAF. Minor products are likely to be alteramide A and its derivative. Fig. 15 depicts the results of the activation of type II PKS biosynthetic gene cluster in 5. viridochromogenes, which yields a novel pigmented compound, (a) Production of brown pigment by the engineered strain but not wild type (wt) 5. viridochromogenes on MGY medium, (b) HPLC analysis of extracts from an engineered 5. viridochromogenes strain harbouring a kasO*p knock-in in front of SSQG_RS26895 (gray) and the parent wild type strain (black). Indicated is the major metabolite 4 that is uniquely produced by the engineered strain. Here the focus is on the major distinct metabolite produced by the engineered strain but it is noted that there are additional differences between the engineered and wild type strain (Fig. 34). (c) Chemical structure of 4. The five rings are labelled A to E.

[0022] Fig. 16 shows the results of a CRISPR-Cas9 mediated promoter knock-in for activation of pigment biosynthetic gene clusters (BCGs). (a) PCR product from genomic DNA isolated from wild type (wt) and exconjugants were subjected to BstBI-digestion to determine tsr-kasO*p knock-in at the designated genomic locus within the indigoidine cluster in 5. albus. (b) Diagnostic PCR from genomic DNA isolated from wild type (wt) and exconjugants using the indicated primers to determine kasO*p knock-in at the designated genomic locus within the RED cluster in 5. lividans. For control PCR of the left and right flanks, primer pairs 1+2 and 3+4 were used respectively. For detection of kasO*p knock-in, primer pairs 1+5 and 3+6 were used, (c) PCR product from genomic DNA isolated from wild type (wt) and exconjugants were subjected to BstBI-digestion to determine kasO*p knock- in at the designated genomic locus within the ACT cluster in 5. lividans. M refers to molecular weight ladder. Arrow heads refer to location of primers used for polymerase chain reactions (PCR).

[0023] Fig. 17 shows graphs depicting the results of liquid chromatography-mass spectrometry (LCMS) analysis of 5. albus strain with activated indigoidine biosynthetic gene cluster, (a) HPLC analysis (UV detection at 600 nm) of acidic methanol from wild type (WT) S. albus and the indicated engineered strain (Indigoidine) in which kasO*p was introduced into indigoidine cluster in front of the indC-like ORF.l (b) The masses of the two new major metabolites at 5 min and 5.3 min, indicated by (*), are consistent with indigoidine -related metabolites (m/z 249, 250) and their adducts (m/z 308, 292).

[0024] Fig. 18 shows graphs depicting the results of liquid chromatography-mass spectrometry (LCMS) analysis of 5. lividans strain with activated RED cluster, (a) HPLC analysis (UV detection at 500 nm) of methanol extracts from wild type (WT) 5. lividans and the indicated engineered strain (RED) in which kasO*p was introduced into RED cluster. The masses of the two new major metabolites at 15.3 min and 15.8 min, indicated by (*), are consistent with that of undecylprodigiosin (m/z 394).3 (b) MS/MS analysis of the major metabolites at 15.3 min and 15.8 min with m/z 394 yielded fragmentation patterns that are consistent with undecylprodigiosin.

[0025] Fig. 19 shows images of the production of pH-sensitive pigments by engineered 5. lividans strain. Wild type (wt) and engineered 5. lividans strains with activated ACT cluster were streaked onto MGY medium. The plate (left panel) was exposed to ammonia fumes (right panel) to confirm the production of pH-sensitive pigments.

[0026] Fig. 20 shows graphs depicting results of liquid chromatography-mass spectrometry (LCMS) analysis of 5. lividans strain with activated ACT cluster, (a) High-performance liquid chromatograph analysis (HPLC; UV detection at 500 nm) of acidic methanol extracts from wild type (WT) 5. lividans and the indicated engineered strain (ACT) in which kasO*p was introduced into ACT cluster, (b) The masses of the two new major metabolites at 12.1 min and 12.5 min, indicated by (*), are consistent with an actinorhodin -related metabolite (m/z 645) and gamma-actinorhodin (m/z 631) respectively. The ACT cluster in 5. coelicolor is known to produce different actinorhodin-related metabolites, including gamma-actinorhodin. (c) MS/MS analysis of the major metabolites at 12.1 min and 12.5 min with m/z 645 and m/z 631 respectively yielded fragmentation patterns that are similar to that of actinorhodin.

[0027] Fig. 21 show the results of RT-qPCR analysis of 5. roseosporus polycyclic tetramate macrolactam cluster 24. (a) Relative gene expression of each indicated gene after normalization to the housekeeping rpsL gene for both wild type and engineered strains. Error bars represent the standard deviation of biological triplicates, n.d. indicates undetectable transcript levels, (b) Part of the polycyclic tetramate macrolactam biosynthetic gene cluster (cluster 24) in 5. roseosporus. Genes that were examined by RT-qPCR are highlighted in yellow. SSGG_ RS02310 is located within the gene cluster and was used as a negative control (NC) for RT-qPCR assay as an example of a gene whose expression is unaffected by knock-in of the kasO*p promoter cassette. Site of kasO*p knock-in is indicated by the arrowhead.

[0028] Fig. 22 shows the results of LCMS analyses of polycyclic tetramate macrolactam compounds produced by 5. roseosporus. (a) HPLC analysis (UV detection at 320 nm) of ethyl acetate extracts from wild type 5. roseosporus and the indicated engineered strain in which kasO*p is introduced into cluster 24. (b) Mass spectra of 1 and 2 at the indicated retention times.

[0029] Fig. 23 shows the results of RT-qPCR analysis of 5. roseosporus phosphonate cluster 10. (a, b) Relative gene expression of each indicated gene after normalization to the housekeeping rpsL gene for both wild type (dark gray) and engineered strains. SSGG_RS 16990 and SSGG_RS 16985 are plotted separately due to differences in scale. Error bars represent the standard deviation of biological triplicates, n.d. indicates undetectable transcript levels, (c) Phosphonate biosynthetic gene cluster (cluster 10) in 5. roseosporus. Genes that were examined by RT-qPCR are highlighted in yellow. SSGG_RS 16955 is located near the FR-900098 cluster and was used as a negative control (NC) for the RT-qPCR assay as an example of a gene whose expression is unaffected by knock -in of the kasO*p-P8 promoter cassette. Site of kasO*p-P8 promoter cassette knock-in is indicated by the arrowhead.

[0030] Fig. 24 shows the introduction of kasO*p-P8 promoter cassette for activation of the phosphonate biosynthetic gene cluster in 5. roseosporus. Shown from bottom to top are 1) the native genomic locus with the location of chosen PAM and protospacer sequences, 2) the edited genome locus with the inserted kasO*p-P8 promoter cassette and 3) the sequence traces of the two junctions flanking the promoter cassette. Biosynthetic genes needed for FR-900009 are highlighted in dark and middle gray.

[0031] Fig. 25 shows the schematic locations of promoter knock-in for 5. roseosporus clusters. Dark gray genes are putative biosynthetic genes while middle gray genes are transport-related and regulation-related genes, respectively. Sites of single or bidirectional promoter cassette knock -in are indicated by the arrowheads. [0032] Fig. 26 shows the schematic location of promoter knock-in for S. venezuelae cluster 16. Indicated in dark gray are putative biosynthetic genes while middle gray genes are transport -related and regulation-related genes, respectively. Site of bidirectional kasO*p-P8 cassette knock-in is indicated by the arrowhead.

[0033] Fig. 27 shows graphs depicting the results of LCMS analysis of 5. roseosporus strain with an engineered cluster 3. (a) HPLC analysis (UV detection at 254 nm) of ethyl acetate extracts from wild type 5. roseosporus and the indicated engineered strain in which kasO*p is introduced into cluster 3. The major unique product produced by the engineered strain is indicated by (*). (b) Mass spectra of engineered (top) and wild type (bottom) strains at retention time 20 min. (c) Extraction ion chromatogram (m/z 405) of engineered (top) and wild type (bottom) strains. It is common to observe multiple changes in metabolic profiles with cluster activation. Regulatory crosstalk between clusters and competition for common precursors can result in increased and decreased production of metabolites that are not products of the target cluster. Until the compounds are isolated, identified, and their biosynthesis accounted for by genes encoded by the respective clusters, additional peaks observed for the engineered strains may not be rules out are related products, intermediates may not be shunned or, simply, a result of pleiotropic changes in the host's secondary metabolism as a result of activating the target cluster.

[0034] Fig. 28 shows graphs depicting the results of LCMS analysis of 5. roseosporus strain with an engineered cluster 18. (a) HPLC analysis (UV detection at 254 nm) of ethyl acetate extracts from wild type 5. roseosporus and the indicated engineered strain in which kasO*p is introduced into cluster 18. The major unique ion detected for the engineered strain is indicated by (*). (b) Mass spectra of engineered (top) and wild type (bottom) strains at retention time 30.3 min. m/z 380 is the doubly charged species of m/z 780. (c) Extracted ion chromatograms (m/z 780) of engineered (top) and wild type (bottom) strains. It is common to observe multiple changes in metabolic profiles with cluster activation. Regulatory crosstalk between clusters and competition for common precursors can result in increased and decreased production of metabolites that are not products of the target cluster. Until the compounds are isolated, identified, and their biosynthesis accounted for by genes encoded by the respective clusters, it cannot be ruled out that additional peaks observed for the engineered strains are related products, shunt intermediates or simply a result of pleiotropic changes in the host's secondary metabolism as a result of activating the target cluster.

[0035] Fig. 29 shows the results of LCMS analysis of 5. venezuelae strain with an engineered cluster 16. (a) Wild type (WT) and engineered strain in which kasO*p is introduced into cluster 16 on MGY plates, (b) HPLC analysis (UV detection at 320 nm) of ethyl acetate extracts from wild type 5. venezuelae and the indicated engineered strain. The major unique ion detected for the engineered strain is indicated by (*). (c) Mass spectra of engineered (red) and wild type (black) strains at retention times 31.2 min. (d) Extracted ion chromatograms (m/z 425) of engineered (top) and wild type (bottom) strains. It is common to observe multiple changes in metabolic profiles with cluster activation. Regulatory crosstalk between clusters and competition for common precursors can result in increased and decreased production of metabolites that are not products of the target cluster. Until the compounds are isolated, identified, and their biosynthesis accounted for by genes encoded by the respective clusters, it cannot be ruled out that additional peaks observed for the engineered strains are related products, shunt intermediates or simply a result of pleiotropic changes in the host's secondary metabolism as a result of activating the target cluster.

[0036] Fig. 30 depicts that data showing that a distinct type II polyketide is produced by 5. viridochromogenes with promoter knock-in. (a) Partial schematic of NZ_GG657757 containing majority of biosynthetic genes and the position of kasO*p knock-in. This operon contains contained the minimal set of type II PKS enzymes, including a ketosynthase (SSQG_RS26900), chain-length factor (SSQG_RS26905) and an acyl carrier protein (SSQG_RS26910), together with a polyketide cyclase (SSQG_RS26915), monooxygenase (SSQG_RS26930) and cytochrome P450 (SSQG_RS26935). Except for an additional cytochrome P450, NZ_GG657757 has high homology and similar gene arrangement as a spore pigment biosynthetic gene cluster in 5. avermitilis (Accession number: AB070937.1). (b) HPLC analysis of extracts from the engineered 5. viridochromogenes strain harbouring a kasO*p in front of SSQG_RS26895 (bottom) compared to that from the parent wild type strain (top). The major unique metabolite 4 is indicated. It is common to observe multiple changes in metabolic profiles with cluster activation. Regulatory crosstalk between clusters and competition for common precursors can result in increased and decreased production of metabolites that are not products of the target cluster. Until the compounds are isolated, identified, and their biosynthesis accounted for by genes encoded by the respective clusters, it cannot be ruled out that additional peaks observed for the engineered strains are related products, shunt intermediates or simply a result of pleiotropic changes in the host's secondary metabolism as a result of activating the target cluster.

[0037] Fig. 31 shows data pertaining to constitutive promoters used for cluster activation, (a) Sequences of constitutive promoters used. ATG start codons of genes to be activated are underlined, (b, c) Scheme and sequences of adapters introduced into pCRISPomyces at the Xbal site for making (b) mono-directional and (c) bi-directional promoter knock-in constructs. Restriction sites of selected enzymes are indicated in the sequence maps.

[0038] Fig. 32 shows the schematic workflow for constructing genome editing plasmid for promoter knock-in. Helper pCRISPomyces-2 plasmids (e.g. pCRISPomyces-2-kasO*p) for making promoter knock-in constructs were made by ligating adapter sequences, containing restriction sites flanking the promoter of choice to facilitate insertion of homology arms into pCRISPomyces -2.7 The protospacer of a target cluster was first inserted via Bbsl-mediated Golden Gate Assembly. The final editing plasmid was achieved by sequential insertion of the first and second homology arms by Gibson assembly.

[0039] Fig. 33 shows graphs showing the results of the chemical characterisation of compound 1. NMR analyses of 1. (a) *H NMR (CD₃OD). (b) COSY (CD₃OD) (c) HSQC (CD₃OD). (d) HMBC (CD₃OD).

[0040] Fig. 34 shows graphs showing the results of the chemical characterisation of compound 2. NMR analyses of 2 (a) *H NMR of 2 (CD₃OD). (b) COSY of 2 (CD₃OD).

[0041] Fig. 35 shows graphs showing the results of the chemical characterisation of compound 3. ³¹P HMBC of authentic FR -900098 sample and 3 produced by the engineered 5. roseosporus strain upon activation of phosphonate biosynthetic gene cluster (cluster 10).

[0042] Fig. 36 shows graphs showing the results of the chemical characterisation of compound 4. (a) *H NMR of 4 (DMSO- e). (b) 13C NMR of 4 (DMSO- e). (c) COSY of 4 (DMSO- e). (d) TOCSY of 4 (DMSO- e). (e) HSQC of 4 (DMSO- e) (f) HMBC of 4 (DMSO- e) (g) table showing the NMR peak assignment for 4.

[0043] Fig. 37 shows the results of the simultaneous introduction of kasO*p and a frameshift mutation into the 5. roseosporus FR-900098 biosynthetic gene cluster. The top panel shows the results of sequence alignments of engineered strains with kasO*p (top 3 sequences) or kasO*p + frameshift mutation (next 4 sequences) introduced into the indicated open reading frame in a single knock-in step. Bottom right panel shows the representative sequence traces of each group of engineered strains in the region containing the frameshift mutation. Bottom left panel shows the knock-in efficiencies for the indicated genomic edits.

DEFINITION OF TERMS

[0044] As used herein, the term "biosynthetic gene cluster" refers to a physically clustered group of two or more genes in a particular genome that together encode a biosynthetic pathway for the production of one or more specialised metabolites, including chemical variants thereof. A wide variety of enzymatic pathways that produce specialized metabolites in bacteria, fungi and plants are known to be encoded in biosynthetic gene clusters. It is noted that is a difference between the terms "biosynthetic gene cluster" and "gene cluster" per se, the latter of which is defined as being a group of two or more genes found within an organism's DNA that encode for similar polypeptides, or proteins, which collectively share a generalized function and are often located within a few thousand base pairs of each other. In contrast, a biosynthetic gene cluster need not necessarily encode for similar proteins and therefore can encode for proteins that do not have any functional relation. Furthermore, while the term "biosynthetic gene cluster" implies that 2 or more genes are present, the present invention also allows for targeting of only one of the genes present in a biosynthetic gene cluster. For example, in a biosynthetic gene cluster with 2 genes, the method can either be used to activate only one or both genes. In a biosynthetic gene cluster with 3 genes, the method can be used to activate only one or two of the three or all three genes.

[0045] As used herein, the term "silent", when used in reference to genes, refers to a gene that has no phenotypical effect on the host. This non-effect of the silent gene can be due to the either low or non-existent expression of the silent gene. The term "silent gene" may also refer to a transcriptionally inactive gene.

[0046] As used herein, the term "orphan", when used in reference to genes, refers to genes that lack detectable similarity to genes in other species and, therefore, do not allow for the inference of common descent (i.e., homology). Orphans are an enigmatic portion of the genome because their origin and function are mostly unknown and they typically can represent up to 10% to 30% of all genes in a genome. Several case studies demonstrated that orphans can contribute to lineage-specific adaptation. Without being bound by theory, it is postulated that orphan genes arise from duplication and rearrangement processes followed by fast divergence; however, de novo evolution out of non- coding genomic regions is emerging as an important additional mechanism for the creation of orphan genes. In other words, orphans are a subset of taxonomically-restricted genes (TRGs), which are unique to a specific taxonomic level (for example, plant -specific). In contrast to non-orphan taxonomically-restricted genes, orphans are usually considered unique to a very narrow taxon, generally a species. The classic model of evolution is based on duplication, rearrangement, and mutation of genes with the idea of common descent. If no orthologous proteins can be found in nearby species, then a gene may be tentatively termed an orphan. Orphan genes differ in that they are lineage- specific and do not show any known history of shared duplication and rearrangement outside of their specific species or clade. Orphan genes may arise through a variety of mechanisms, such as horizontal gene transfer, duplication and rapid divergence, and de novo origination, and may act at different rates in insects, primates, and plants. Despite their relatively recent origin, orphan genes may encode functionally important proteins.

[0047] The method of preparing or assembling exogenous, homologous and/or heterologous DNA for expression within a host organism is called molecular cloning. In a conventional molecular cloning experiment, the DNA to be cloned is obtained from an organism of interest, and subsequently treated with enzymes in the reaction tube to generate smaller DNA fragments. Subsequently, these fragments are then combined with vector DNA to generate recombinant DNA molecules. The recombinant DNA is then introduced into a host organism (typically an easy-to-grow, benign, laboratory strain of E. coli bacteria). This will generate a population of organisms in which recombinant DNA molecules are replicated along with the host DNA. Because they contain foreign DNA fragments, these are transgenic or genetically modified microorganisms (GMO). This process takes advantage of the fact that a single bacterial cell can be induced to take up and replicate a single recombinant DNA molecule. This single cell can then be expanded exponentially to generate a large amount of bacteria, each of which contain copies of the original recombinant molecule. Thus, both the resulting bacterial population, and the recombinant DNA molecule, are commonly referred to as "clones". Strictly speaking, recombinant DNA refers to DNA molecules, while molecular cloning refers to the experimental methods used to assemble them.

[0048] The method of molecular cloning can also be used to regulate gene expression. In general, regulation of gene expression comprises and includes a wide range of mechanisms that are used by cells to increase or decrease the production of specific gene products (protein or RNA). Sophisticated programs of gene expression are widely observed and know in the art, for example as a mechanism to trigger developmental pathways, respond to environmental stimuli, or adapt to new food sources. Virtually any step of gene expression can be modulated, from transcriptional initiation, to RNA processing, and to the post-translational modification of a protein. Often, one gene regulator controls another, and so on, resulting in a complex gene regulatory network. The process of gene expression itself can be divided into two major processes, transcription and translation. One place in which the production of specific gene products can be influenced is during transcription, which is the process of transcribing DNA to RNA, which ultimately has an effect of the protein expressed during a later process called translation (also known as protein synthesis). Transcriptional regulation is the means by which a cell regulates the conversion of DNA to RNA (transcription), thereby orchestrating gene activity. A single gene can be regulated in a range of ways, from altering the number of copies of RNA that are transcribed, to the temporal control of when the gene is transcribed. Transcriptional regulation also influences when which proteins are ultimately expressed. This control allows the cell or organism to respond to a variety of intra- and extracellular signals and thus mount a response. Some examples of this include producing the mRNA that encode enzymes to adapt to a change in a food source, producing the gene products, including proteins, involved in cell cycle specific activities, and producing the gene products, including proteins, responsible for cellular differentiation in higher eukaryotes

[0049] As used herein, the term "CRISPR-Cas9" refers to genome editing technology based on the capability of clustered regularly interspaced palindromic repeats (CRISPR) and the CRISPR- associated protein-9 nuclease (Cas9) from, for example, Streptococcus pyogenes to induce, for example, double-strand (ds) DNA breaks in a specific location that is complementary to the synthetic guide RNA (sgRNA) sequence integrated into the CRISPR-Cas9 complex, thereby allowing the deletion, addition, and/or modification of genes and/or other genomic elements, such as transcription elements, promoters, promoter enhancers, transcription enhancers, restriction sites, mutations, selection markers, for example antibiotic selection cassettes, and the like. In one example, an antibiotic selection cassette is also added to the genome, preceding, simultaneously with, or following insertion of genetic material using the CRISPR technology.

[0050] Thus, in one example, deletion of promoter regions, site -directed mutations, mutations and gene deletion (knock-out) is/are performed before, simultaneously or after the addition of the one or more promoter(s) as disclosed herein. In one example, deletion of promoter regions, site -directed mutations, mutations and gene deletion (knock-out) is/are performed before performing CRISP- mediated knock-in of the promoter(s). In another example, deletion of promoter regions, site-directed mutations, mutations and gene deletion (knock-out) is/are performed after performing CRISP- mediated knock-in of the promoter(s). In one example, deletion of promoter regions, site -directed mutations, mutations and gene deletion (knock-out) is/are performed at the same time CRISP- mediated knock-in of the promoter(s) is/are being performed. Thus, in one example, one or more promoter regions were concurrently deleted. In another example, site mutations were concurrently introduced into selected genes.

[0051] The functions of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) and CRISPR-associated (Cas) genes are essential in adaptive immunity in select bacteria and archaea, enabling the organisms to respond to and eliminate invading genetic material. Three types of CRISPR mechanisms have been identified so far, of which type II is the most well-studied. Also, other combinations of CRISPR, for example CRISPR -Cpfl have been developed. Also contemplated herein is the use of CRISPR technologies, wherein the Cas proteins or functionally analogue proteins are not isolated from 5. pyogenes. Examples of Cas 9 proteins are, but are not limited to, Cas 9 proteins, or proteins with the same functionality, isolated from 5. pyogenees, Staphylococcus aureus, or any representatives of the archaea kingdom (Woese, Kandler & Wheelis, 1990). Cas 9 proteins can also be substituted with so-called CasX and CasY proteins. In another example, examples of Cpfl proteins, or proteins with the same functionality are isolated from, but are not limited to, Acidaminococcus sp. and Lachnospiraceae . In terms of adaptive immunity, the mechanism of CRISPR-Cas9 mediated defence is as follows: invading DNA from viruses or plasmids is cut into small fragments and incorporated into a CRISPR locus amidst a series of short repeats (around 20 bps). The loci are transcribed, and transcripts are then processed to generate small RNAs (crRNA - CRISPR RNA; also referred to as synthetic guide RNA (sgRNA) in an in vitro setting), which are used to guide effector endonucleases that target invading DNA based on sequence complementarity. In terms of gene editing, the CRISPR - Cas9 works according to the same principle, with the sgRNA guiding the effector nucleases to the desired sections of the DNA, in which the excision is to be made.

[0052] As used herein, the term "protospacer" refers to part of the so-called "sgRNA" and is a user defined, 17 to 23 nucleotide long base-pairing region for specific DNA binding. The term "sgRNA" refers to "single guide RNA" or "synthetic guide R A" and is, in the context of CRISPR technology, a chimera of CRISPR RNAs (crRNA) and trans -activating crRNA (tracrRNA), which is typically about 100 nucleotides in length and consists of three regions: a user defined, 17 to 23 nucleotide long base-pairing region for specific DNA binding (which is called a protospacer), a roughly 40 nucleotide long Cas9 handle hairpin for Cas9 protein binding; and a roughly 40 nucleotide long transcription terminator derived from 5. pyogenes, that contains hairpin structures that provide stability to the RNA molecule.

[0053] As used herein, the term "cassette" refers to a nucleic acid sequence that is introduced into the target genome, for example during the knock-in process. Examples of a cassette are, but are not limited to mono- or bidirectional promoter sequence, and may also include other elements, such as, for example, an antibiotic resistance marker.

[0054] As used herein, the term "promoter" refers to a region of a nucleic acid sequence that initiates transcription of a particular gene. Promoters are usually located near the transcription start sites of genes, on the same strand and are usually found upstream on the nucleic acid sequence (towards the 5' region of the sense strand). Promoters can vary in length, from about 100 to 1000 base pairs. Promoters are understood as binding and initiation sites of, for example, RNA polymerases, enzymes which have transcriptional activity, thereby initiating transcription of, for example, DNA to RNA. Different promoters can give genes different expression patterns within a host cell and can also cause simultaneous expression of different genes. Some promoters are active in all cells at all times, while others are specific to different organisms, tissue types (spatial control) or even specific times during the host's development (temporal control). Others promoters are sensitive to external signals, such as changes in temperature or the presence or absence of a certain chemical. Such promoters are known as controllable or inducible on/off switches for genes.

[0055] As used herein, the term "bidirectional promoter" refers to regulatory regions that are shared between two genes, when those two genes are transcribed away from one another. The genes are said to be in a head-to-head arrangement, with their transcription start sites (TSSs) positioned nearby one another. By working definition, the intergenic distance between these genes (that is, the promoter length) can be no greater than 1000 base pairs. This distance is measured from the TSS of the gene on the left of the promoter to the TSS of the gene on the right of the promoter. Head -to-head genes are spaced at this distance more frequently than expected in, for example, the human genome, suggesting a regulatory theme in gene expression. Conversely, other promoters are termed mono- directional promoters.

[0056] As used herein, the term "kasO*p" refers to an engineered version of the kasO promoter region (also known as kasOp) from Streptomyces coelicolor. kasO (also known as cpkO or SCO6280), encodes a SARP family regulator and is an activator of a cryptic type I polyketide synthase gene cluster responsible for coelimycin PI production in 5. coelicolor.

[0057] As used herein, the term "ermE*p" refers to an engineered version of the ermE promoter (aka ermEp) from Saccharopolyspora erythraea. ermEp is the promoter of the erythromycin resistance gene.

[0058] As used herein, the terms "P2", "P3"; "P6", "P8", "P25" and "rcfP" refer to different promoter regions of housekeeping genes in Streptomyces albus.

[0059] As used herein, the term "activation" refers to an upregulation of gene expression or transcriptional activation of a gene that was previously not expressed or only expressed in small amounts. Conversely, the term "suppression" or "repression" refers to a downregulation of gene expression or transcriptional activity of a gene.

[0060] As used herein, the term "gene or genome editing" refers to modifying the genetic sequence of an organism, virus, or any other genetic element, to add, delete and/or modify the genetic sequence compare to the sequence as it is present in nature. These alterations are also called mutations (permanent alterations to the nucleotide sequence of an organism, virus, or any other genetic elements) and can also occur naturally.

[0061] As used herein, the term "knock-in", as used in molecular cloning and biology, refers to a type of targeted mutation in which a gene function is produced (also known as a gain of function mutation). This genetic engineering method can involve a one-for-one substitution of DNA sequence information with a wild-type copy in a genetic locus or the insertion of sequence information not found within the locus, and can be performed by inserting, adding or substituting the wild-type genetic material with other, for example exogenous genetic material or genetic material not usually found at that location. The difference between knock-in technology and traditional transgenic techniques is that, for example, a knock-in involves a gene inserted into a specific locus, and is thus considered to be a "targeted" insertion, while transgenic techniques involve modification of the target genome by insertion of the modifying nucleic acid sequence (also known as a trans-gene). With transgenic techniques, the inserted nucleic acid sequence stays in a trans position to the modified sequence, so there is a recombination or transposition between two DNA fragments: the naturally occurring DNA sequence and the inserted cell-modifying nucleic acid sequence. Having said that, the nomenclature understood in the art is as follows: an animal with expressing a newly inserted gene is a knock-in animal; and that both knock-in and knock-out animals are transgenic animals, if, and only then, these animals were obtained by introduction of a nucleic acid, which modified the original genomic sequence. It is understood in the art that with transgenic animals, there is also the additional conditions that need to be fulfilled. For example, the inserted modification must be stable, for example in the germline, meaning that the offspring of such a transgenic animal must also have the inserted modification. Methods for generating gene knock-ins are known in the art, for example transposon-mediated systems (lox-Cre system), homologous recombination or the recent CRISPR - Cas9 technology.

[0062] As used herein, the term "exconjugant" refers to a protozoan just after the separation following conjugation, during which an exchange of DNA material has taken place.

[0063] As used herein, the term "pentagular" refers to a structure having five angles and five sides. This refers to any structure that is derived from or based on the shape of a pentagon, or which is pentagonal. DETAILED DESCRIPTION OF THE PRESENT INVENTION

[0064] Natural products have been a major and indispensable source of pharmaceuticals and bioactive scaffolds. Genome sequencing of privileged natural product producers, for example, such as actinomycetes reveals a vast untapped resource in the form of silent biosynthetic gene clusters, which can be mined to meet the burgeoning demand for natural products with new bioactivities. The present disclosure demonstrates that CRISPR-Cas9 mediates rapid, multiplex knock-in of heterologous genetic parts in multiple actinomycetes, achieving 50% to 100% knock-in efficiency in one step. It is further shown that this general method of promoter knock-in can be used to activate silent, unexplored biosynthetic gene clusters and to induce the production of secondary metabolites belonging to distinct chemical classes in native producers. While CRISPR technology has been demonstrated, for example, genetic for generating knock-outs in Streptomyces, it has not been used for generating more challenging genetic knock-ins, and more importantly for the refactoring and activation of silent biosynthetic gene clusters in native hosts. This method and strategy provides a complementary avenue to better explore the biosynthetic capability and chemical diversity of existing actinomycete strain collections for natural product discovery. Also shown herein is an efficient CRISPR -Cas9 knock-in strategy to activate silent biosynthetic gene clusters (BGCs) in various representatives of the Streptomycetes species. For example, the greatly enhanced knock-in efficiency afforded by CRISPR- Cas9, which enables the genetic manipulation of strains that are usually not genetically amendable and how it can be applied towards activating silent biosynthetic gene clusters. For example, 5. roseosporus has 0% knock-in efficiency in the absence of a protospacer compared to 50% with a functional CRISPR-Cas9. This one-step strategy was used to activate multiple biosynthetic gene clusters of different classes in five Streptomyces species and triggered the production of unique metabolites, including a novel pentangular type II polyketide in Streptomyces viridochromo genes. However, this method can be used in any organism (prokaryotic or eukaryotic) to access biosynthetic gene clusters, silent or otherwise, or any target gene(s). For example, this CRISPR-Cas9 meditated knock-in technology is used in actinomycetes (also known as actinomycetales or actinobacteria) and can be used in other bacteria, for example, but not limited to, cyanobacteria, Streptomyces sp. or Bacillus sp. In essence, as long as the bacteria or host cell is amenable to introduction of heterologous or homologous DNA, the method outlined in the present invention can be implemented. This potentially scalable strategy complements existing activation approaches and facilitates discovery efforts to uncover new compounds with interesting bioactivities. Before CRISPR, knock-in in Streptomycetes requires long circuitous selection/screens that are traditionally used to sequentially identify single and double crossover events. This increase in knock-in efficiency due to the use of CRISPR technology also allows genetic manipulation of Streptomycetes to be performed using shorter homology arms and also allows for more challenging genetic manipulations, like the introduction of larger genetic elements to be performed. It is of note that knock-in efficiency drops when the knock-in fragment length increases from 100 base pairs to 1 kilo base pairs. In other words, the presently disclosed technology also enables the use of shorter homologous arms (1-2 kilo base pairs instead of much longer arms), which would otherwise be highly inefficient without CRISPR - Cas9. Homologous recombination is known to be relatively inefficient in Streptomycetes, with double crossover events being very rare events. Increasing homology lengths of the editing template help to increase HR efficiency, with a >3 kb homology on each side traditionally used to obtain double crossover recombinants. The length of homology for achieving homologous recombination at acceptable efficiency depends on the Streptomyces strains being engineered but is typically multi-kb in length. Overall, these improvements enable cluster activation by promoter knock -in to be a general and scalable process, which is not possible before.

[0065] Thus, in one example, the biosynthetic gene cluster(s) or target gene(s) is/are isolated from an Actinobacterium (also known as actinomycetes or actinomycetales). In another example, the Actinobacterium is of the genus Streptomyces (nomenclature according to Waksman and Henrici, 1943; synonyms of which include Actinopycnidium (Genus) Krasil'nikov 1962, Actinosporangium (Genus) Krasil'nikov & Yuan 1961, Chainia (Genus) Thirumalachar 1955, Elytrosporangium (Genus) Falcao de Morais et al. 1966, Kitasatoa (Genus) Matsumae & Hata 1968, and Microellobosporia (Genus) Cross et al. 1963. Synonyms according to G.M. Garrity et al., 2007). In another example, the biosynthetic gene cluster(s) or target gene(s) is/are isolated from one or more representatives of the Streptomyces genus. In yet another example, the Actinobacterium of the Streptomyces genus is, but is not limited to Streptomyces abietis, Streptomyces abikoensi, Streptomyces aburaviensis, Streptomyces achromogenes, Streptomyces acidiscabies, Streptomyces actinomycinicus, Streptomyces acrimycini, Streptomyces actuosus, Streptomyces aculeolatus, Streptomyces abyssalis, Streptomyces afghaniensis, Streptomyces aidingensis, Streptomyces africanus, Streptomyces alanosinicus, Streptomyces albaduncus, Streptomyces albiaxialis, Streptomyces albidochromogenes, Streptomyces albiflavescens, Streptomyces albiflaviniger, Streptomyces albidoflavus, Streptomyces albofaciens, Streptomyces alboflavus, Streptomyces albogriseolus, Streptomyces albolongus, Streptomyces alboniger, Streptomyces albospinus, Streptomyces albulus, Streptomyces albus, Streptomyces aldersoniae, Streptomyces alfalfa, Streptomyces alkaliphilus, Streptomyces alkalithermotolerans, Streptomyces almquistii, Streptomyces alni, Streptomyces althioticus, Streptomyces amakusaensis, Streptomyces ambofaciens, Streptomyces amritsarensis, Streptomyces anandii, Streptomyces angustmyceticus, Streptomyces anthocyanicus, Streptomyces antibioticus, Streptomyces antimycoticus, Streptomyces anulatus, Streptomyces aomiensis, Streptomyces araujoniae, Streptomyces ardus, Streptomyces arenae, Streptomyces armeniacus, Streptomyces artemisiae, Streptomyces arcticus, Streptomyces ascomycinicus, Streptomyces asiaticus, Streptomyces asterosporus, Streptomyces atacamensis, Streptomyces atratus, Streptomyces atriruber, Streptomyces atroolivaceus, Streptomyces atrovirens, Streptomyces aurantiacus, Streptomyces aurantiogriseus, Streptomyces auratus, Streptomyces aureocirculatus, Streptomyces aureofaciens, Streptomyces aureorectus, Streptomyces aureoverticillatus, Streptomyces aureus, Streptomyces avellaneus, Streptomyces avermitilis, Streptomyces avicenniae, Streptomyces avidinii, Streptomyces axinellae, Streptomyces azureus, Streptomyces bacillaris, Streptomyces badius, Streptomyces bambergiensis, Streptomyces bangladeshensis, Streptomyces baliensis, Streptomyces barkulensis, Streptomyces beijiangensis, Streptomyces bellus, Streptomyces bikiniensis, Streptomyces blastmyceticus, Streptomyces bluensis, Streptomyces bobili, Streptomyces bohaiensis, Streptomyces bottropensis, Streptomyces brasiliensis, Streptomyces brevispora, Streptomyces bullii, Streptomyces bungoensis, Streptomyces burgazadensis, Streptomyces cacaoi, Streptomyces caelestis, Streptomyces caeruleatus, Streptomyces calidiresistens, Streptomyces calvus, Streptomyces canaries, Streptomyces canchipurensis, Streptomyces candidus, Streptomyces cangkringensis, Streptomyces caniferus, Streptomyces canus, Streptomyces capillispiralis, Streptomyces capoamus, Streptomyces carpaticus, Streptomyces carpinensis, Streptomyces castelarensis, Streptomyces catbensis, Streptomyces catenulae, Streptomyces cavourensis, Streptomyces cello staticus, Streptomyces celluloflavus, Streptomyces cellulolyticus, Streptomyces cellulosae, Streptomyces chartreusis, Streptomyces chattanoogensis, Streptomyces cheonanensis, Streptomyces chiangmaiensis, Streptomyces chrestomyceticus, Streptomyces chromofuscus, Streptomyces chryseus, Streptomyces chilikensis, Streptomyces chlorus, Streptomyces chumphonensis, Streptomyces cinereorectus, Streptomyces cinereoruber, Streptomyces cinereospinus, Streptomyces cinereus, Streptomyces cinerochromogenes, Streptomyces cinnabarinus, Streptomyces cinnamonensis, Streptomyces cinnamoneus, Streptomyces cirratus, Streptomyces ciscaucasicus, Streptomyces clavifer, Streptomyces clavuligerus, Streptomyces coacervatus, Streptomyces cocklensis, Streptomyces coelescens, Streptomyces coelicoflavus, Streptomyces coelicolor, Streptomyces coeruleoflavus, Streptomyces coeruleofuscus, Streptomyces coeruleoprunus, Streptomyces coeruleorubidus, Streptomyces coerulescens, Streptomyces collinus, Streptomyces colombiensis, Streptomyces corchorusii, Streptomyces costaricanus, Streptomyces cremeus, Streptomyces crystallinus, Streptomyces cuspidosporus, Streptomyces cyaneofuscatus, Streptomyces cyaneus, Streptomyces cyanoalbus, Streptomyces cyslabdanicus, Streptomyces daghestanicus, Streptomyces daliensi, Streptomyces daqingensis, Streptomyces deccanensis, Streptomyces decoyicus, Streptomyces demainii, Streptomyces deserti, Streptomyces diastaticus, Streptomyces diastatochromogenes, Streptomyces djakartensis, Streptomyces drozdowiczii, Streptomyces durhamensis, Streptomyces durmitorensis, Streptomyces echinatus, Streptomyces echinoruber, Streptomyces ederensis, Streptomyces emeiensis, Streptomyces endophyticus, Streptomyces endus, Streptomyces enissocaesilis, Streptomyces erythraeus (also known as Saccharopolyspora erythraea), Streptomyces erythrogriseus, Streptomyces erringtonii, Streptomyces eurocidicus, Streptomyces europaeiscabiei, Streptomyces eurythermus, Streptomyces exfoliates, Streptomyces faba, Streptomyces fenghuangensis, Streptomyces ferralitis, Streptomyces filamentosus, Streptomyces fildesensis, Streptomyces filipinensis, Streptomyces fimbriatus, Streptomyces finlayi, Streptomyces flaveolus, Streptomyces flaveus, Streptomyces flavofungini, Streptomyces flavotricini, Streptomyces flavovariabilis, Streptomyces flavovirens, Streptomyces flavoviridis, Streptomyces fradiae, Streptomyces fragilis, Streptomyces fukangensis, Streptomyces fulvissimus, Streptomyces fulvorobeus, Streptomyces fumanus, Streptomyces fumigatiscleroticus, Streptomyces galbus, Streptomyces galilaeus, Streptomyces gancidicus, Streptomyces gardneri, Streptomyces gelaticus, Streptomyces geldanamycininus, Streptomyces geysiriensis, Streptomyces ghanaensis, Streptomyces gilvifuscus, Streptomyces glaucescens, Streptomyces glauciniger, Streptomyces glaucosporus, Streptomyces glaucus, Streptomyces globisporus, Streptomyces globosus, Streptomyces glomeratus, Streptomyces glomeroaurantiacus, Streptomyces glycovorans, Streptomyces gobitricini, Streptomyces goshikiensis, Streptomyces gougerotii, Streptomyces graminearus, Streptomyces gramineus, Streptomyces graminifolii, Streptomyces graminilatus, Streptomyces graminisoli, Streptomyces griseiniger, Streptomyces griseoaurantiacus, Streptomyces griseocarneus, Streptomyces griseochromogenes, Streptomyces griseoflavus, Streptomyces griseofuscus, Streptomyces griseoincarnatus, Streptomyces griseoloalbus, Streptomyces griseolus, Streptomyces griseoluteus, Streptomyces griseomycini, Streptomyces griseoplanus, Streptomyces griseorubens, Streptomyces griseoruber, Streptomyces griseorubiginosus, Streptomyces griseosporeus, Streptomyces griseostramineus, Streptomyces griseoviridis, Streptomyces griseus, Streptomyces guanduensis, Streptomyces gulbargensis, Streptomyces hainanensis, Streptomyces haliclonae, Streptomyces halophytocola, Streptomyces halstedii, Streptomyces harbinensis, Streptomyces hawaiiensis, Streptomyces hebeiensis, Streptomyces heilongjiangensis, Streptomyces heliomycini, Streptomyces helvaticus, Streptomyces herbaceous, Streptomyces herbaricolor, Streptomyces himastatinicus, Streptomyces hiroshimensis, Streptomyces hirsutus, Streptomyces hokutonensis, Streptomyces hoynatensis, Streptomyces humidus, Streptomyces humiferus, Streptomyces hundungensis, Streptomyces hyderabadensis, Streptomyces hygroscopicus, Streptomyces hypolithicus, Streptomyces iakyrus, Streptomyces iconiensis, Streptomyces incanus, Streptomyces indiaensis, Streptomyces indigoferus, Streptomyces indicus, Streptomyces indonesiensis, Streptomyces intermedius, Streptomyces inusitatus, Streptomyces ipomoeae, Streptomyces iranensis, Streptomyces janthinus, Streptomyces javensis, Streptomyces jietaisiensis, Streptomyces jiujiangensis, Streptomyces kaempferi, Streptomyces kanamyceticus, Streptomyces karpasiensis, Streptomyces kasugaensis, Streptomyces katrae, Streptomyces kebangsaanensis, Streptomyces klenkii, Streptomyces koyangensis, Streptomyces kunmingensis, Streptomyces kurssanovii, Streptomyces labedae, Streptomyces lacrimifluminis, Streptomyces lacticiproducens, Streptomyces laculatispora, Streptomyces lanatus, Streptomyces lannensis, Streptomyces lateritius, Streptomyces laurentii, Streptomyces lavendofoliae, Streptomyces lavendulae, Streptomyces lavenduligriseus, Streptomyces leeuwenhoekii, Streptomyces lavendulocolor, Streptomyces levis, Streptomyces libani, Streptomyces lienomycini, Streptomyces lilacinus, Streptomyces lincolnensis, Streptomyces litmocidini, Streptomyces litoralis, Streptomyces lomondensis, Streptomyces longisporoflavus, Streptomyces longispororuber, Streptomyces lopnurensis, Streptomyces longisporus, Streptomyces longwoodensis, Streptomyces lucensis, Streptomyces lunaelactis, Streptomyces lunalinharesii, Streptomyces luridiscabiei, Streptomyces luridus, Streptomyces lusitanus, Streptomyces lushanensis, Streptomyces luteireticuli, Streptomyces luteogriseus, Streptomyces luteosporeus, Streptomyces lydicus, Streptomyces macrosporus, Streptomyces malachitofuscus, Streptomyces malachitospinus, Streptomyces malaysiensis, Streptomyces mangrove, Streptomyces marinus, Streptomyces marokkonensis, Streptomyces mashuensis, Streptomyces massasporeus, Streptomyces matensis, Streptomyces mayteni, Streptomyces mauvecolor, Streptomyces megaspores, Streptomyces melanogenes, Streptomyces melanosporofaciens, Streptomyces mexicanus, Streptomyces michiganensis, Streptomyces microflavus, Streptomyces milbemycinicus, Streptomyces minutiscleroticus, Streptomyces mirabilis, Streptomyces misakiensis, Streptomyces misionensis, Streptomyces mobaraensis, Streptomyces monomycini, Streptomyces mordarskii, Streptomyces morookaense, Streptomyces muensis, Streptomyces murinus, Streptomyces mutabilis, Streptomyces mutomycini, Streptomyces naganishii, Streptomyces nanhaiensis, Streptomyces nanshensis, Streptomyces narbonensis, Streptomyces nashvillensis, Streptomyces netropsis, Streptomyces neyagawaensis, Streptomyces niger, Streptomyces nigrescens, Streptomyces nitrosporeus, Streptomyces niveiciscabiei, Streptomyces niveiscabiei, Streptomyces niveoruber, Streptomyces niveus, Streptomyces noboritoensis, Streptomyces nodosus, Streptomyces nogalater, Streptomyces nojiriensis, Streptomyces noursei, Streptomyces novaecaesareae, Streptomyces ochraceiscleroticus, Streptomyces olivaceiscleroticus, Streptomyces olivaceoviridis, Streptomyces olivaceus, Streptomyces olivicoloratus, Streptomyces olivochromo genes, Streptomyces olivomycini, Streptomyces olivoverticillatus, Streptomyces omiyaensis, Streptomyces osmaniensis, Streptomyces orinoci, Streptomyces pactum, Streptomyces panacagri, Streptomyces panaciradicis, Streptomyces paradoxus, Streptomyces parvulus, Streptomyces parvus, Streptomyces pathocidini, Streptomyces paucisporeus, Streptomyces peucetius, Streptomyces phaeochromogenes, Streptomyces phaeofaciens, Streptomyces phaeogriseichromatogenes, Streptomyces phaeoluteichromatogenes, Streptomyces phaeoluteigriseus, Streptomyces phaeopurpureus, Streptomyces pharetrae, Streptomyces pharmamarensis, Streptomyces phytohabitans, Streptomyces pilosus, Streptomyces platensis, Streptomyces plicatus, Streptomyces plumbiresistens, Streptomyces pluricolorescens, Streptomyces pluripotens, Streptomyces polyantibioticus, Streptomyces polychromogenes, Streptomyces polygonati, Streptomyces polymachus, Streptomyces poonensis, Streptomyces prasinopilosus, Streptomyces prasinosporus, Streptomyces prasinus, Streptomyces pratens, Streptomyces pratensis, Streptomyces prunicolor, Streptomyces psammoticus, Streptomyces pseudoechinosporeus, Streptomyces pseudogriseolus, Streptomyces pseudovenezuelae, Streptomyces pulveraceus, Streptomyces puniceus, Streptomyces puniciscabiei, Streptomyces purpeofuscus, Streptomyces purpurascens, Streptomyces purpureus, Streptomyces purpurogeneiscleroticus, Streptomyces qinglanensis, Streptomyces racemochromogenes, Streptomyces radiopugnans, Streptomyces rameus, Streptomyces ramulosus, Streptomyces rapamycinicus, Streptomyces recifensis, Streptomyces rectiviolaceus, Streptomyces regensis, Streptomyces resistomycificus, Streptomyces reticuliscabiei, Streptomyces rhizophilus, Streptomyces rhizosphaericus, Streptomyces rimosus, Streptomyces rishiriensis, Streptomyces rochei, Streptomyces rosealbus, Streptomyces roseiscleroticus, Streptomyces roseofulvus, Streptomyces roseolilacinus, Streptomyces roseolus, Streptomyces roseosporus, Streptomyces roseoviolaceus, Streptomyces roseoviridis, Streptomyces ruber, Streptomyces rubidus, Streptomyces rubiginosohelvolus, Streptomyces rubiginosus, Streptomyces rubrisoli, Streptomyces rubrogriseus, Streptomyces rubrus, Streptomyces rutgersensis, Streptomyces samsunensis, Streptomyces sanglieri, Streptomyces sannanensis, Streptomyces sanyensis, Streptomyces sasae, Streptomyces scabiei, Streptomyces scabrisporus, Streptomyces sclerotialus, Streptomyces scopiformis, Streptomyces scopuliridis, Streptomyces sedi, Streptomyces seoulensis, Streptomyces seranimatus, Streptomyces seymenliensis, Streptomyces shaanxiensis, Streptomyces shenzhenensis, Streptomyces showdoensis, Streptomyces silaceus, Streptomyces sindenensis, Streptomyces sioyaensis, Streptomyces smyrnaeus, Streptomyces sodiiphilus, Streptomyces somaliensis, Streptomyces sudanensis, Streptomyces sparsogenes, Streptomyces sparsus, Streptomyces specialis, Streptomyces spectabilis, Streptomyces speibonae, Streptomyces speleomycini, Streptomyces spinoverrucosus, Streptomyces spiralis, Streptomyces spiroverticillatus, Streptomyces spongiae, Streptomyces spongiicola, Streptomyces sporocinereus, Streptomyces sporoclivatus, Streptomyces spororaveus, Streptomyces sporoverrucosus, Streptomyces staurosporininus, Streptomyces stelliscabiei, Streptomyces stramineus, Streptomyces subrutilus, Streptomyces sulfonofaciens, Streptomyces sulphurous, Streptomyces sundarbansensis, Streptomyces synnematoformans, Streptomyces tacrolimicus, Streptomyces tanashiensis, Streptomyces tateyamensis, Streptomyces tauricus, Streptomyces tendae, Streptomyces termitum, Streptomyces thermoalcalitolerans, Streptomyces thermoautotrophicus, Streptomyces thermocarboxydovorans, Streptomyces thermocarboxydus, Streptomyces thermocoprophilus, Streptomyces thermodiastaticus, Streptomyces thermogriseus, Streptomyces thermolineatus, Streptomyces thermospinosisporus, Streptomyces thermoviolaceus, Streptomyces thermovulgaris, Streptomyces thinghirensis, Streptomyces thioluteus, Streptomyces torulosus, Streptomyces toxytricini, Streptomyces tremellae, Streptomyces tritolerans, Streptomyces tricolor, Streptomyces tsukubensis, Streptomyces tubercidicus, Streptomyces tuirus, Streptomyces tunisiensis, Streptomyces turgidiscabies, Streptomyces tyrosinilyticus, Streptomyces umbrinus, Streptomyces variabilis, Streptomyces variegatus, Streptomyces varsoviensis, Streptomyces verticillus, Streptomyces vastus, Streptomyces venezuelae, Streptomyces vietnamensis, Streptomyces vinaceus, Streptomyces vinaceusdrappus, Streptomyces violaceochromogenes, Streptomyces violaceolatus, Streptomyces violaceorectus, Streptomyces violaceoruber, Streptomyces violaceorubidus, Streptomyces violaceus, Streptomyces violaceusniger, Streptomyces violarus, Streptomyces violascens, Streptomyces violens, Streptomyces virens, Streptomyces virginiae, Streptomyces viridis, Streptomyces viridiviolaceus, Streptomyces viridobrunneus, Streptomyces viridochromogenes, Streptomyces viridodiastaticus, Streptomyces viridosporus, Streptomyces vitaminophilus, Streptomyces wedmorensis, Streptomyces wellingtoniae, Streptomyces werraensis, Streptomyces wuyuanensis, Streptomyces xanthochromogenes, Streptomyces xanthocidicus, Streptomyces xantholiticus, Streptomyces xanthophaeus, Streptomyces xiamenensis, Streptomyces xinghaiensis, Streptomyces xishensis, Streptomyces yaanensis, Streptomyces yanglinensis, Streptomyces yangpuensis, Streptomyces yanii, Streptomyces yatensis, Streptomyces yeochonensis, Streptomyces yerevanensis, Streptomyces yogyakartensis, Streptomyces yokosukanensis, Streptomyces youssoufiensis, Streptomyces yunnanensis, Streptomyces zagrosensis, Streptomyces zaomyceticus, Streptomyces zhaozhouensis, Streptomyces zinciresistens , or Streptomyces ziwulingensis.

[0066] In another example, the Actinobacterium is, but is not limited to, Streptomyces albus, Streptomyces avermilitis, Streptomyces erythraeus (also known as Saccharopolyspora erythraed), Streptomyces lividans, Streptomyces griseus, Streptomyces rapamycinicus, Streptomyces roseosporus, Streptomyces rubellomurinus, Streptomyces venezuelae, or Streptomyces viridochomogenes.

[0067] In one other example, the biosynthetic gene cluster(s) comprise silent or orphan genes. In yet another example, the target gene(s) is/are silent or orphan genes. In one example, the biosynthetic gene cluster(s) or target gene(s) is/are, but are not limited to, SEQ ID NO: 193 to 201. [0068] The overrepresentation of natural products and their derivatives in existing drug and drug lead pipelines, despite the decreasing emphasis on natural product discovery programs, in favour of combinatorial synthetic library screens by pharmaceutical companies, underscores the privileged chemical and functional space occupied by natural products. In addition to the enormous structural complexity and diversity unsurpassed by any combinatorial library, natural products are evolutionarily selected over millions of years for interactions with biomolecules using a myriad of core chemical scaffolds optimized for bioactivity. Yet remarkably, genomics and meta-genomics studies have revealed that the surface of the chemical repertoire that nature has to offer has barely been scratched. More than 99% of microorganisms in the environment cannot be cultivated in the laboratory and until recently, have been inaccessible, unappreciated sources of small molecules. Even for cultured microorganisms that are traditionally mined for natural products such as Actinobacteria, it is estimated merely 10-20% of their biosynthetic capabilities have been explored. Successful genome mining and activation of silent and uncharacterized biosynthetic gene clusters unveiled entirely new classes of molecules. Given the vast chemical diversity of natural products that are evolved for an eclectic range of bioactivities and drug-like properties, bacterial natural products from unexplored biosynthetic gene clusters will undoubtedly continue to be a major source of novel drugs and drug leads.

[0069] Thus, in one example, there is disclosed a recombinant method of activating expression of one or more biosynthetic gene cluster(s), or one or more target gene(s) in a biosynthetic gene cluster comprising more than one gene, the method comprising inserting one or more promoter(s) at one or more transcriptionally functional location(s) relative to the biosynthetic gene cluster(s) or the target gene(s) in the biosynthetic gene cluster(s), whereby the insertion of the promoter(s) results in increased expression of the biosynthetic gene cluster(s) or target gene(s) compared to the expression level of an unmodified biosynthetic gene cluster(s) or target gene(s). In another example, there is disclosed a recombinant expression plasmid for activating expression of a biosynthetic gene cluster(s), the plasmid comprising one or more promoter(s) as disclosed herein, a biosynthetic gene cluster(s) or one or more target gene(s) as disclosed herein. In another example, the method claimed herein is used to insert the promoters into the genomes of native producing hosts without cloning the cluster. In another example, promoter(s) is/are inserted into the genome using a plasmid. Insertion of the promoter relies on homologous recombination, which is induced by CRISPR/Cas9-mediated double stranded breaks. The CRISPR/Cas9 and the editing template for the promoter knock-in are encoded in the plasmid. But, in the end, the promoter is inserted into the genome and the plasmid is removed.

[0070] In one example, the biosynthetic gene cluster(s) are activated by insertion of a promoter. In another example, the biosynthetic gene cluster(s) are activated by insertion of two or more promoters, that is the multiple promoters are used to express the same target gene or multiple target genes. In a further example, multiple biosynthetic gene clusters are simultaneously or subsequently activated by the insertion of multiple promoters. In another example, multiple promoters are inserted into the same biosynthetic gene cluster. In another yet example, multiple promoters are inserted into different biosynthetic gene cluster(s) within the same host genome. Temporal differentiated use can be instigated, for example, by using two different promoters which are under the different transcription regulatory control or by, for example, using inducible promoters, which are promoters which are activated or repressed by the presence and/or absence of key compounds. One non-limiting example of an inducible promoter is a tetracycline (tet) -inducible system, for which the inducer is tetracycline. In another example, the promoter is a bidirectional promoter. In another example, the promoter is a unidirectional promoter. Therefore, in one example, the promoter is, but is not limited to, kasO*p, ermE*p, P2, P3, P6, P8, P25, or rcfp. In one example, the promoter is kasO*p. In another example, the promoter is P8-kasO*p. In another example, the promoter is rcpf. In another example, the promoter is a cloned native promoter of the target biosynthetic gene cluster(s) or the target gene(s). The choice of promoter depends on the characteristics of the gene to be expressed, for example, the host or species in which the gene is naturally present. Having said that, it is also possible to express a gene of one species with a promoter isolated from another species, or even a completely different organism. In one example, the promoter(s) and the biosynthetic gene cluster(s) or target gene(s) are of the same species. In another example, the promoter(s) and the biosynthetic gene cluster(s) or target gene(s) are of different species.

[0071] The location for the insertion of the promoter need not be localised near or within immediate proximity to the target gene(s) or biosynthetic gene cluster(s). As known in the art, transcription regulatory elements can be found along stretches of the genome that may not appear to be in immediate proximity to the target gene(s) or biosynthetic gene cluster(s). However, through tertiary structures and conformational changes of the genome during transcription, it is possible that regulatory sequences (for example promoters) that are not in immediate proximity to the target gene(s) or biosynthetic gene cluster(s) are then brought into proximity of the transcription target(s), thereby resulting in functional expression of the target gene(s) or biosynthetic gene cluster(s). Thus, in one example, the promoters are inserted at transcriptionally functional location(s), which is/are upstream of the biosynthetic gene cluster(s) or target gene(s). In another example, the promoters are inserted at transcriptionally functional location(s), which is/are downstream of the biosynthetic gene cluster(s) or target gene(s). In yet another example, the promoters are inserted at transcriptionally functional location(s), which is/are both upstream and downstream of the biosynthetic gene cluster(s) or target gene(s).

[0072] Microbial natural products are a rich source of pharmaceutical agents and current advances in genomics have unveiled a vast source of potential unexplored biosynthetic gene clusters. Because majority of encoded metabolites of these biosynthetic gene clusters are undetectable using current analytical methods due to minimal or zero biosynthetic gene cluster expression under laboratory conditions (such biosynthetic gene clusters are commonly defined as silent biosynthetic gene clusters), strategies to activate biosynthetic gene cluster expression and trigger metabolite production are critical to realize the full potential of nature's chemical repertoire. While heterologous expression bypass native regulation networks and can be engineered rationally, entire biosynthetic pathways often spanning large areas of genomes will have to be cloned and refactored. Additionally, heterologous hosts may lack regulatory, enzymatic or metabolic requirements necessary for product biosynthesis. Inducing cluster expression in native hosts circumvents these limitations but may be hindered by low homologous recombination efficiencies.

[0073] Actinobacteria are traditionally rich sources of natural products but 50-80% of biosynthetic gene clusters in actinomycetes with encoding for pathways to potentially novel bioactive compounds are silent under normal laboratory conditions.

[0074] CRISPR (clustered regularly interspaced palindromic repeat) technology has revolutionized genome engineering, enabling the genetic manipulation of a number of genetically recalcitrant organisms, including mammals, plants and Streptomyces. Compared to other site-specific genome engineering technologies, Cas9 nucleases can be directed to any site on the genome simply by transcribing a synthetic guide RNA (sgRNA), requiring only a protospacer adjacent motif (PAM) sequence at the target site. Staphylococcus pyogenes Cas9 PAMs (NGG) are especially abundant in the GC-rich actinomycete genomes, greatly increasing the number of potential target sites and coverage of CRISPR-Cas9 genome editing in these natural product relevant organisms. Thus, in one example, the promoter(s) is/are inserted using CRISPR-Cas9 technology. In other words, one aim of the disclosed method is to yield and/or increase production of one or more molecules encoded by a biosynthetic gene cluster.

[0075] The CRISPR-Cas9 has been reconstituted in multiple Streptomyces strains and used to perform precise deletions of individual genes and entire biosynthetic gene clusters of up to 82.2 kb8, at high efficiencies of 60-100% with minimal off-target activity. This unprecedented recovery of desired mutants can be due to the fact that CRISPR-Cas9 selects against wild type sequences in favour of double-crossover recombinants in the presence of double stranded homology-flanked editing templates (Fig. 1). In addition, the CRISPR/Cas9 technology reduces the required time for homology-directed recombination by one -half by circumventing the conventional two-step selection/screening method for single and double crossover events (Fig. 1). CRISPR technology has also enabled the genetic manipulation of many genetically recalcitrant organisms. The Streptococcus pyogenes CRISPR-Cas9 system is recently reconstituted in model Streptomycetes to delete genes and entire biosynthetic gene clusters, as well as perform site-directed mutagenesis and gene replacement at significantly improved efficiencies. The CRISPR-Cas9 technology has been extended to perform strategic promoter knock-in for the activation of silent biosynthetic gene clusters in native Streptomyces hosts (Fig. 12a). Shown herein is the use of this technology to perform strategic promoter knock-in and site-directed mutagenesis for efficient activation of silent and uncharacterized biosynthetic gene clusters in multiple actinomycetes.

[0076] Using CRISPR-Cas9 technology to achieve efficient multiplex knock-in of constitutive promoters to force expression of the regulatory or biosynthetic genes, the activation of different classes of silent biosynthetic gene clusters (e.g. type I/II/III PKS, hybrid PKS/NRPS, nucleoside NRPS, phosphonate) and induction of secondary metabolite production in multiple actinomycete strains has been demonstrated. It is also shown that the technology can be used to introduce site- directed mutations or other heterologous functions into the actinomycete genomes in a scar-less fashion for in situ engineering of biosynthetic clusters (Fig. 6). This is the first demonstration of CRISPR-Cas9 mediated knock-in in actinomycetes and together with reported CRISPR-Cas9 mediated knockout, it provides an opportunity to fully explore the biosynthetic capabilities of these prolific natural product producers. It is conceivable that other scalable technologies capable of creating targeted double stranded breaks in actinomycete genomes will also work for the disclosed strategy.

[0077] The striking discrepancy between the number of predicted biosynthetic gene clusters in sequenced actinomycete genomes and the number of natural products known to be produced by the respective strains hints at a vast unexplored chemical diversity waiting to be mined for societal needs. Different strategies have been employed towards activating silent biosynthetic gene clusters that are not expressed under normal laboratory conditions. These include manipulating growth conditions such as media composition to ensure expression of pathway-specific activator(s), presence of physiological and environmental co-inducers, engineering of the translational and transcriptional machineries, suppression of the genes regulated by repressor(s), overexpressing pathway-specific regulator(s), testing a variety of heterologous hosts to express target clusters and silencing major secondary metabolite biosynthetic pathways to relieve competition for key precursors. Screening growth conditions is time and labour intensive while the other strategies can only applied on a case- by-case basis. Furthermore, this strategy does not enable one to identify the biosynthetic gene cluster responsible for a given secondary metabolite, knowledge of which will be valuable towards structure identification and downstream titer improvement. The current understanding of regulation hierarchy, while greatly enhanced in the post genomics era, remains insufficient to accurately predict the functions of all the regulatory elements involved so the regulatory mechanism of each gene cluster has to be examined individually to identify a suitable context for its activation. In addition, refactoring of gene clusters in heterologous hosts is highly context dependent, relying on the existence of specific host cellular factors, chemical inducers or biosynthetic precursors, many of which are unknown. Previously, 40 Streptomyces strains had been screened for the ability to express 100 non-refactored type II PKS pathways and only the top 2 strains were able to successfully express up to 13% of the pathways while the remaining strains expressed <\% of the pathways (unpublished). The strategy disclosed herein of activating biosynthetic gene clusters in the native producers by promoter knock-in does not require prior knowledge of environmental or biological cues and complements existing methods to discover new natural products from actinomycetes.

[0078] There are advantages to activating silent and/or orphan clusters in native actinomycete strains. While genes required for natural product biosynthesis are generally co-localized and much progress has been made to pinpoint the boundaries of biosynthetic gene clusters and to predict the functions of individual genes within identification and complete reconstitution of all necessary genes for production in a heterologous system still involve substantial trial and error, especially for uncharacterized biosynthetic gene clusters. On the other hand, native hosts are equipped with all the necessary cellular factors to synthesize the natural product of interest, including those needed for precursor and product biosynthesis, regulation, resistance, export and relatively smaller and fewer genetic perturbations are needed to induce metabolite production. In this study, the activation of sizable biosynthetic gene clusters (7-18 kb) and the induction of production of FR-900098 and polycyclic tetramate macrolactams is shown in a previously unknown producer 5. roseosporus by knocking in single or divergent promoters, bypassing extensive cloning and refactoring of these clusters for expression in heterologous hosts. Notably, all the genes within the PTM cluster in 5. roseosporus is >90% identical to those in 5. griseus but the polycyclic tetramate macrolactams identified in the present study are different from those produced by 5. lividans expressing the refactored 5. griseus polycyclic tetramate macrolactam cluster. It will be interesting to determine if the difference is a result of cluster refactoring and heterologous expression or specificity divergence of the biosynthetic enzymes despite their high sequence identities.

[0079] A major consideration of the disclosed activation strategy is the selection of site(s) for promoter knock-in. With improved understanding of the major families of regulators governing secondary metabolism in actinomycetes, the activators and repressors can be predicted with certain confidence. Of the known pathway-specific transcriptional activators, members of the Streptomyces antibiotic regulatory protein (SARP) family are heavily represented. Members of the large ATP- binding regulators of the LuxR (LAL) family also tend to be activators of biosynthetic gene cluster expression. These will be obvious genes to activate if they are present in the target biosynthetic gene cluster. For majority (>90%) of the clusters in this work, pathway-specific activators are not present or cannot be identified. In these cases, the core operon(s) encoding for key biosynthetic enzymes within the biosynthetic gene clusters have been targeted, inserting promoters in front of the first open reading frame of an operon. Multiplex promoter knock-in will be useful for more "fragmented" biosynthetic gene clusters that require the introduction of multiple promoters for activation.

[0080] To demonstrate that CRISPR-Cas9 can be used to efficiently and precisely introduce heterologous promoters into Streptomyces genomes for biosynthetic genetic cluster activation, well- characterized pigment biosynthetic genetic clusters were selected, namely the indigoidine cluster in Streptomyces albus, as well as the actinorhodin (ACT) and undecylprodigiosin (RED) clusters in Streptomyces lividans. Using CRISPR-Cas9 mediated knock-in, upstream promoter regions of main biosynthetic operons or pathway-specific activators were replaced with constitutive promoters that are stronger than the commonly used ermE* promoter and work in multiple Streptomyces species (Fig. 16). In 5. albus, CRISPR-Cas9 increased knock-in efficiency of the kasO* promoter upstream of the indC-like indigoidine synthase gene compared to without CRISPR-Cas9 (Fig. 12b). Higher knock-in efficiency observed with 2 kb homologous arms as compared to 1 kb arms is consistent with homology-directed repair of Cas9-induced double stranded breaks. Co-introduction of longer inserts such as the ~1 kb thiostrepton -resistance cassette (tsr) with kasO*p was achieved at lower efficiencies but it was still higher than that of inserting kasO*p alone without CRISPR-Cas9. Selected solely on apramycin, tsr-kasO*p knock-in strains grew on thiostrepton plates while maintaining pigment production as expected of an activated indigoidine synthase cluster (Fig. 12c and Fig. 17). Similar to 5. albus, recovery of desired kasO*p knock-in strains in 5. lividans was greatly enhanced with the use of CRISPR-Cas9 (Fig. 12b). Confirming successful activation of the RED and ACT clusters, the engineered strains produced red undecylprodigiosin and pH-responsive actinorhodin-related metabolites respectively (Fig. 12d and Figs. 18 to 20).

[0081] Together these results demonstrated that CRISPR-Cas9 can be used to precisely introduce heterologous genetic elements into Streptomyces genomes at relatively high efficiencies for secondary metabolite production from silent biosynthetic gene clusters. The enhanced knock-in efficiencies allowed use of donor DNA with shorter homology flanks as well as the introduction of larger genetic elements, both of which will be challenging without CRISPR-Cas9. While homologous recombination occurs efficiently in model strains like 5. lividans and 5. albus without CRISPR-Cas9, for other strains like Streptomyces roseosporus, the increase in efficiency afforded by CRISPR-Cas9 is critical and allows genetic manipulation of otherwise challenging strains (Fig. 12b).

[0082] Next, this strategy was employed to activate two silent unexplored biosynthetic gene clusters from 5. roseosporus with relatively high homology to known biosynthetic gene clusters. The 5. roseosporus NRRL15998 genome contains 29 predicted biosynthetic gene clusters, the majority of which are yet to be characterized (Table 6). One of the predicted biosynthetic gene clusters showed >90% sequence identity to the polycyclic tetramate macrolactam (PTM) cluster in Streptomyces griseus (Table 7), which was refactored for expression in 5. lividans by introducing individual promoters in front of each of the six genes. Notably, insertion of a single strong promoter failed to drive cluster expression in the heterologous system. Here in the native 5. roseosporus host, knock-in of kasO*p upstream of the first open reading frame (ORF) was sufficient to drive expression of polycyclic tetramate macrolactam biosynthetic genes (Fig. 22) and yielded the production of photocyclized alteramide A (1, m/z 511.2808, [M+H]+) and a second polycyclic tetramate macrolactam with the same planar structure as dihydromaltophilin (2, m/z 513.2961, [M+H]+) (Fig. 13a and Figs. 33 to 36). Since alteramide A photocyclization is spontaneous, it was surmised, without being bound by theory, that alteramide A was the original metabolite produced by 5. roseosporus. Interestingly, 2 was not identified in the previous study involving the almost identical 5. griseus cluster, suggesting possible host-dependent factors or differences between native and heterologous hosts.

[0083] 5. roseosporus also possesses a phosphonate biosynthetic gene cluster with genes showing high homology and synteny to the Streptomyces rubellomurinus FR-900098 biosynthetic gene cluster (Table 8). Intriguingly, BLASTP search within -2000 NCBI-deposited actinobacteria assemblies for FR-900098 biosynthetic enzymes did not uncover similar biosynthetic gene clusters, suggesting that 5. roseosporus has the uncommon biosynthetic potential to synthesize the antimalarial compound, which to date has been attributed to 5. rubellomurinus and 5. lavendulae. To determine if 5. roseosporus can produce FR-900098, a bidirectional P8-kasO*p promoter cassette was introduced to drive expression of the putative frbD operon and frbC homolog (Fig. 23 and 24). The engineered strain produced 3 with ³¹P-NMR, HMBC and mass values consistent with FR-900098 (Fig. 13b, and Figs. 33 to 36), validating the inherent ability of 5. roseosporus to make FR-900098. The estimated FR-900098 titer of 6-10 mg/L in the engineered strain, while lower than the 22.5 mg/L reported for 5. rubellomurinus, is -1000-fold higher than the minimum inhibitory concentration against the malarial parasite, suggesting that this activation strategy may be applied for bioactivity-guided discovery.

[0084] Notably, two of the biosynthetic gene clusters in 5. roseosporus failed to produce any unique peaks after promoter knock-in (Table 1) and there are, without being bound by theory, many possible reasons why this happens. Firstly, the biosynthetic gene cluster may already be active in the wild type strain and further "activation" will not result in new metabolites being produced. In these cases, one may expect alterations in the production level of the metabolite in the engineered strain. Secondly, it is likely that growth (e.g. oxygen levels, trace elements, biosynthetic precursors) or workup (extraction or detection methods) conditions do not allow us to observe the production of new metabolites. Testing a panel of extraction protocols may minimize these possibilities. Thirdly, as demonstrated for the FR-900098 biosynthetic gene cluster, it is possible that genes that are critical for the biosynthesis of the product and its precursors were not expressed. Lastly, the biosynthetic gene clusters may be extinct and rendered non-functional by mutations occurring beyond the biosynthetic gene clusters. A better understanding of the reasons biosynthetic gene clusters go extinct will be needed to revive them. Nonetheless, the detection of the production of unique chemical by liquid chromatography-mass spectrometry (LCMS) in majority of the engineered strains is encouraging. Given the large number of silent uncharacterized clusters in actinomycete genomes, the ability to activate a fraction of them will give us access to a sizable number of potentially new compounds.

[0085] It was next analysed whether the disclosed activation strategy can be generally applied to uncharacterized biosynthetic gene clusters of different classes in multiple Streptomyces species, namely Streptomyces roseosporus (Table 6), Streptomyces venezuelae (Table 1) and Streptomyces viridochromogenes (Table 10). For pathway-specific activation, single and bidirectional promoter cassettes to the first open reading frame(s) of the main biosynthetic operon(s) were targeted and predicted based on gene directionality alone or if available, predicted transcriptional activators (Fig. 25, 26). Introduction of single or bidirectional promoter cassettes into additional clusters in 5. roseosporus and 5. venezuelae yielded production of unique compounds that were not observed for the parent strains (Fig. 13c to e). For example, cluster 3 in 5. roseosporus was predicted to be a nucleoside-type I PKS with biosynthetic enzymes for incorporation of a 3-amino-5-hydroxybenzoic acid starter unit and naphthalene ring formation. Insertion of kasO*p upstream of the main synthase gene encoding a loading domain and three PKS modules triggered the production of a major metabolite with m/z 405 (Fig. 17c). A distinct compound with m/z 780 was observed for another engineered 5. roseosporus strain, in which kasO*p was introduced upstream of a predicted LuxR-type regulator within a type I PKS cluster (Fig. 17d). In 5. venezuelae, insertion of a bidirectional promoter cassette between a type III PKS gene encoding an RppA synthase and a cytochrome P450 gene resulted in production of pigmented products (Fig. 17e). Production of these newly observed metabolites was independently validated at least three times in solid and liquid MGY media to be unique to the respective knock-in strains and detected in the parent wild type strains.

[0086] Identification of a novel compound using CRISPR-Cas9 based promoter knock-in further demonstrates its potential of this strategy for natural product discovery. The major product selectively produced by an engineered Streptomyces viridochromogenes strain, in which kasO*p was inserted in front of the main biosynthetic operon SSQG_RS26895-26920 of an uncharacterized type II PKS gene cluster NZ_GG657757 (Fig. 30), was isolated and characterised. Except for an additional cytochrome P450, NZ_GG657757 has high homology and similar gene arrangement as a spore pigment biosynthetic gene cluster in Streptomyces avermitilis (Accession number: AB070937.1). The engineered 5. viridochromogenes strain produced an obvious brown pigment in liquid and solid medium before sporulation with a major unique metabolite 4 observed by high-performance liquid chromatography (HPLC; Fig. 15 a, b). HRMS of the 4 predicted a molecular formula C₂3H₁₆0₈. NMR, ¹³C NMR, COSY/TOCSY, HSQC and HMBC analyses of 4 revealed a novel polyketide with a dihydrobenzo[a]naphthacenequinone core that is shared by a family of polyketides including frankiamycin, benastatin and pradimicin (Fig. 15c, Figs. 33 to 36). The cyclohexanone (ring E) in 4 is atypical and has not been observed for pentangular aromatic polyketides.

[0087] It is shown that relatively small genome perturbations in the form of strategically introduced promoters using the CRISPR-Cas9 technology, are sufficient to activate biosynthetic gene clusters of different classes in multiple Streptomyces species, including type I, II and III PKSs, NRPS, hybrid PKS-NRPS and phosphonate clusters. Present efforts focus on biosynthetic gene clusters with one to two major predicted biosynthetic operons.

[0088] The activation of multiple clusters in different Streptomyces species highlights the potential of this approach to complement existing strategies, including heterologous expression, to discover, characterize and reengineer biosynthetic gene clusters. This strategy is shown to be generally applicable and potentially scalable to better explore the biosynthetic potential of Streptomycetes.

[0089] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.

[0090] The invention has been described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

[0091] Other embodiments are within the following claims and non- limiting examples. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.

EXPERIMENTAL SECTION CRISPR-Cas9 system enables efficient cluster activation by promoter knock-in

[0092] To demonstrate that the CRISPR-Cas9 technology can be used to efficiently knock in promoters at a specified genomic locus, three silent biosynthetic gene clusters in two Streptomyces strains were chosen - the indigiodine cluster in Streptomyces albus as well as the actinorhodin (ACT) and undecylprodigionine (RED) clusters in Streptomyces lividans. These well-characterized clusters are not expressed under normal growth conditions but can be activated under specific growth conditions or with known genetic perturbations. Additionally, the pigmented products of these biosynthetic gene clusters provide a rapid readout of successful cluster activation and facilitate troubleshooting, making them ideal test beds for cluster activation strategies.

[0093] To determine the constitutive promoter to be used for cluster activation, several previously published promoters were compared, including several of the strongest promoters from 5. albus, all of which are known to be stronger than that routinely used constitutive ermE* promoter. KasO*p was selected for its strong constitutive expression in multiple actinomycete hosts across different stages of growth based on quantitative xylE reporter assays (Fig. 7 and 9). Notably, studies have also demonstrated kasO*p to be one of the strongest promoters in different Streptomyces hosts. If precisely introduced, kasO*p should force expression of its downstream gene or genes in the same operon for cluster activation.

[0094] Given that introduction of a constitutive promoter in front of the indigiodine synthetase gene of the indigiodine cluster in 5. albus has been demonstrated to induce blue pigment production, it was deducted that this will be a good system to determine if CRISPR-Cas9 can be used to enhance the knock-in efficiency of heterologous genetic elements. The CRISPR-Cas9 system for gene knockout in Streptomyces was adapted by changing the editing template to include kasO*p (Fig. 2A). Since isothermal assembly is error-prone and inefficient with overlaps at promoters, a linker with adapter sequences that allows for assembly of the homologous flanks and promoter by restriction digest-ligation or isothermal assembly with the adapters as overlaps (Fig. 10) was introduced. When the editing constructs were introduced into 5. albus by conjugation, exconjugants were obtained in all cases with different protospacers and length of homology arms, indicating successful knock -in (Fig. 2B and C). Higher knock-in efficiencies were observed with longer 2 kb homologous flanks compared to 1 kb, most likely due to more efficient homologous recombination repair in the former (Fig. 2B). Targeted double stranded breaks upstream of the indigiodine synthetase gene mediated by CRISPR- Cas9 significantly enhanced knock-in efficiency compared to conventional homologous recombination without CRISPR-Cas9 function (no protospacer), even achieving 100% efficiency for one of the constructs (Fig. 2B). Co-introduction of a heterologous 1 kb thiostrepton-resistance cassette (tsr) with kasO*p was achieved at comparable efficiencies and the resulting exconjugants were able to grow on thiostrepton-containing plates while maintaining production of the blue pigment (Fig. 2C). [0095] In 5. lividans, environmental cues required for the activation of the RED and ACT clusters can be bypassed by cloning and overexpressing pathway-specific transcriptional activators redD and ActII-orf4 respectively. Here it was sought to overexpress redD and ActII-orf4 by knocking in kasO*p in front of the genes, a strategy that has not been demonstrated for these clusters. Using an editing template with 2 kb homology arms, promoter knock -in at the target locus for all exconjugants (Fig. 3 A, B, C) was achieved, which produced the expected red cell-wall associated antibiotic on solid and in liquid ISP2 media (Fig. 2D, E). Wild type 5. lividans does not produce any pigmented product in this medium. Likewise for the ACT cluster, kasO*p was knocked-in in front of ActII-orf4 at 100% efficiency as determined by diagnostic PCR -digestion and sequencing (Fig. 4A, B). Consistent with forced expression of the ACT pathway-specific positive regulator and production of the pH-sensitive actinorhodin antibiotic, engineered 5. lividans strains were pigmented and turned dark blue with ammonia fuming (Fig. 4C).

[0096] It is shown that the CRISPR-Cas9 system can be used for cluster activation and induction of secondary metabolite production in Streptomyces by mediating efficient promoter knock -in at target genomic loci to drive the expression of biosynthetic or regulatory genes. It was also shown that heterologous genes or functionalities can be introduced in the same step at comparable efficiencies, a property that can be exploited to further improve production titer from the activated biosynthetic gene clusters. This system, with the potential for simultaneous knock-ins within the same biosynthetic gene clusters or different biosynthetic gene clusters, should provide a powerful means to activate silent biosynthetic gene clusters and induce secondary metabolite production in actinomycetes for natural product discovery.

Multiplex promoter knock-in

[0097] The high knock-in efficiency obtained with the CRISPR-Cas9 technology prompted us to test the utility of the technology for multiplex promoter knock -in within the same biosynthetic gene cluster or in different biosynthetic gene clusters. To perform a one-step activation of both the ACT and RED clusters in 5. lividans, a Cas9 plasmid was constructed with two editing templates and tandem sgRNA expression cassettes targeting the RED and ACT clusters. With CRISPR-Cas9, 50% (1/2) of the exconjugants obtained had kasO*p introduced into both the RED and ACT clusters while none of the exconjugants (0/4) obtained without CRISPR-Cas9 function (no protospacer) showed tandem promoter knock-in. This is comparable to the 45-100% efficiency observed for simultaneous deletion of two unlinked open reading frames (ORFs) from distinct biosynthetic gene clusters by co- transcribing two sgRNAs. Despite the high editing efficiency with the tandem knock-in, there is a noticeable reduction in the absolute number of exconjugants presumably due to the inherent toxicity of CRISPR-Cas9 expression. Activation of silent biosynthetic gene clusters (BCGs) in S. roseosporus with minimal genetic perturbation

[0098] Streptomyces roseosporus is best known and studied for being the native producer of lipopeptide antibiotic daptomycin, which is one of the frontline antibiotics against drug resistant gram positive pathogens. While mass spectrometry studies further identified additional non-ribosomal peptide synthetase products with antimicrobial activities (arylomycin, napsamycin and stenothricin), the relevant biosynthetic genes have yet to be identified, hindering efforts to overproduce these products by microbial fermentation using engineered hosts. Using the CRISPR-Cas9 system to strategically knock in constitutive promoters, the biosynthetic capability of 5. roseosporus was explored and as revealed by an additional 28 biosynthetic gene clusters predicted by antiSMASH besides the known daptomycin biosynthetic gene cluster. antiSMASH stands for antibiotics & Secondary Metabolite Analysis Shell, a genome-mining software that is capable of analysing the sequenced genome in silico, identifying potential biosynthetic gene clusters and predicting core structures of encoded metabolites. See for example https://antismash.secondarymetabolites.org/.

[0099] 5. roseosporus is not known to produce phosphonate compounds but its genome encodes a predicted phosphonate biosynthetic gene cluster with the genes showing high homology and synteny (>94% identity) to those within the reported biosynthetic gene cluster of antimalarial FR-900098 in Streptomyces rubellomurinus (Fig. 5 A and Fig. 8). Targeting genes involved in the first two steps in the FR-900098 biosynthetic pathway (Fig. 8B), diverging p8-kasO* promoters (Fig.14) were knocked in to force the constitutive expression of the frbD operon and frbC using the CRISPR-Cas9 system, yielding a strain that produced a new compound with ³¹P-NMR chemical shifts corresponding to phosphonates of 21-22 ppm (Fig. 5B, C). Production of this new compound that is absent in the wild type strain requires expression of both the frbD operon and frbC as functional disruption of each by means of a frame shift deletion in frbD and removal of the entire frbC promoter region completely abolished phosphonate production (Fig. 5B, C). Notably, these mutations were introduced in the same step as the promoter knock-in, underscoring the flexibility of the method in introducing site-directed mutations in addition to knocking in heterologous genetic elements.

[00100] The new phosphonate compound produced by the engineered strain with the bidirectional promoter knock-in was determined to be FR-900098 when spiking of an authentic sample increased the intensity of the signals at -21-22 ppm with no change in spectrum profile (Fig. 5C). The estimated FR-900098 titer of 10-12 mg/L is more than 100-fold higher than the IC₅₀ against Plasmodium falciparum, demonstrating that this strategy of knocking in promoters can be used to activate production of secondary metabolites from silent biosynthetic gene clusters at sufficient quantities for bioactivity screening. In comparison, cloning and refactoring of the 11.3 kb biosynthetic gene cluster into Escherichia coli yielded 6 mg/L FR-900098 prior to pathway optimization. a-N-Derivatisation of FR-900098 is known to significantly improve its inhibitory activity against the malarial parasite

[00101] Interestingly, between the FR-900098 homology region and the tandem open reading frames (ORFs) encoding for phosphonate transporters in 5. roseosporus, there are additional non- ribosomal peptide synthetase modules that may serve to further modify the FR-900098 phamacophore (Fig. 5A). Without being bound by theory, this hypothesis of additional tailoring by NRPS is supported by the presence of a different set of NRPS modules in close proximity to the FR-900098 cluster in 5. rubellomurinus.

[00102] It was next sought to activate a predicted biosynthetic gene cluster with high homology (>90% sequence identity) to the characterized polycyclic tetramate macrolactam (PTM) cluster in Streptomyces griseus. This 18 kb hybrid PKS-NRPS (polyketide synthase - non-ribosomal peptide synthase) cluster consisting of six open reading frames (ORFs) was previously refactored and heterologously expressed in 5. lividans. Here, cluster activation is shown and production of polycyclic tetramate macrolactam products in 5. roseosporus can be achieved by knocking in a single 97 base pairs kasO*p in front of the first open reading frame of the cluster that encodes a sterol desaturase. LCMS (liquid chromatography-mass spectrometry) analysis of wild type and activated strain revealed a series of new peaks at retention times of 21 to 23 minutes with two major products identified by their mass values of m/z 511 and 513 (Fig. 14A). Minor products with m/z 501, 511, 515 and 555 were also detected. Using ¾ ¹³C, COSY (correlation spectroscopy), HSQC (heteronuclear single quantum coherence), HMBC (heteronuclear multiple bond correlation) and NOESY spectroscopy (nuclear Overhauser effect spectroscopy, a type of 2D nuclear magnetic resonance spectroscopy), major products were identified to be previously reported compounds, namely photocyclized alteramide A (m/z 511) and heat-stable antifungal factor (HSAF, m/z 513) (Fig. 14B). *H and COSY spectra of the minor products indicate that two of the minor products may be alteramide A and a close derivative of alteramide A. Given that alteramide A photocyclization is a spontaneous and efficient reaction with quantitative conversion following 6 hours of light exposure, it was inferred that the photocyclized compound is most likely a by-product of the workup and alteramide A is the original metabolite produced by 5. roseosporus. Whether alteramide A is a biosynthetic precursor to HSAF remains to be determined.

[00103] Collectively, these results demonstrate that the CRISPR-Cas9 system allows for efficient one-step introduction of mutations and heterologous genetic parts such as promoters in Streptomyces and that strategic introduction of promoter(s) is sufficient to activate expression of silent biosynthetic gene clusters and drive production of the cognate secondary metabolites at sufficient quantities for detection and bioassays without extensive genetic manipulation and refactoring of multi-gene biosynthetic pathways. In addition, it is the first time that 5. roseosporus has been shown to produce FR-900098 phosphonate and polycyclic tetramate macrolactam, underscoring the unexplored biosynthetic potential of even well-studied natural product producers. Activation of uncharacterized biosynthetic gene clusters in S. roseosporus

[00104] In the event that the introduction of promoter(s) is sufficient to activate silent characterized FR-900098 and polycyclic tetramate macrolactam biosynthetic gene clusters in 5. roseosporus, this strategy could then also be used to activate uncharacterized biosynthetic gene clusters. Uncharacterized biosynthetic gene clusters have little homology to known biosynthetic gene clusters, increasing the odds in discovering metabolites with new molecular structures that can be later screened for desired bioactivities. To test this, 5. roseosporus clusters with low homology (<10%) to known biosynthetic gene clusters were selected for activation by promoter knock-in.

[00105] One of these clusters is a small hybrid type I PKS-NRPS cluster, consisting of one polyketide synthase (PKS) module with a ketosynthase (KS) domain and one NRPS module with two condensation domains. Its closest homologous biosynthetic gene cluster is the antifungal ECO-02301 in Streptomyces aizunenesis, of which only 7% of the genes show homology to the 5. roseosporus cluster. Introducing kasO*p before the first open reading frame, which encodes a transporter of the major facilitator superfamily, of the main PKS-NRPS operon corresponded with the production of a new metabolite at 8.6 min retention time with m/z 344 (Fig. 14). The presence of the m/z 687 [2M⁺H]⁺ ion supported that the new detected m/z 344 ion is derived from a new metabolite being produced in the activated strain.

[00106] Another target cluster is an uncharacterized nucleoside-type I polyketide synthase (PKS) biosynthetic gene cluster, which encodes a 3-amino-5-hydroxybenzoic acid (AHBA) synthase and a beta-ketoacyl synthase containing a Coenzyme A-ligase (CAL) loading domain, two KR-KS-AT-DH (ketoreductase-ketosynthase-acyltransferase-dehydratase) modules and a KR-KS-AT module, as well as three discrete ketoreductase (KR) domains. Knocking in kasO*p before the beta-ketoacyl synthase gene triggered the production new compounds observed as off-white solids after ethyl acetate extraction. These compounds with m/z 405 and 624 were observed as two distinct peaks by LCMS (data not shown). Based on the 20% sequence homology to rifamycin biosynthetic gene cluster, in silico analysis and mass of the observed products, without being bound by theory, it is predicted that the new metabolites are made up of an AHBA as the starter unit, followed by five or more elongation steps involving malonyl Coenzyme A (malonyl CoA) or methylmalonyl Coenzyme A (methylmalonyl Co A). This follows that this PKS is non-canonical with module iteration and/or substrate promiscuity. A rapid and scalable strategy for natural product discovery [00107] To further demonstrate the utility of the claimed strategy, activation is being tested a diverse set of uncharacterized clusters in multiple Streptomyces and rare actinomycetes (non- Streptomyces), including, but not limited to Streptomyces venezuelae, Streptomyces avermitilis, Streptomyces viridochromogenes, Streptomyces rapamycinicus, and Saccharopolyspora erythraea (Table 2). To increase the odds of discovering novel natural products with desirable bioactivities, the focus is on uncharacterized clusters with little (<40%) or no homology to any known biosynthetic gene clusters. Uncharacterized biosynthetic gene clusters that are not expressed under normal laboratory experiments as determined by available transcriptomics and proteomics data are preferentially selected. Preliminary results showed that the activation strategy was successful in 5. viridochromogenes and 5. venezuelae (Table 2). Activation of uncharacterized type II and type III PKS biosynthetic gene clusters in 5. viridochromogenes and 5. venezuelae induced production of purple/brown and red pigments, respectively (data not shown).

[00108] Overall, it was demonstrated that the claimed strategy was successful activating the production of various metabolites from phosphonate, type I/II/III PKS, hybrid PKS-NRPS and nucleoside-PKS biosynthetic gene clusters. Scale up and purification experiments are ongoing to determine the identity of the metabolites from uncharacterized clusters. Further exploration of the remaining uncharacterized biosynthetic gene clusters, including NRPS, lantipeptide, siderophore and terpene clusters in different actinomycete strains (Tables 1 and 2) is also underway. MATERIALS AND METHODS

Media recipes

[00109] 1 L of ISP2 medium contains 10 g malt extract broth (Sigma- Aldrich), 4 g Bacto yeast extract (BD Biosciences), 4 g glucose (Sigma -Aldrich) and for ISP2 agar plates an additional 20 g of agar (BD Biosciences). Conjugation experiments involving WM6026 and WM3780 E. coli strains were performed on R2 agar without sucrose: 0.25 g K2S04 (Sigma), 10.12 g MgCl₂ ^,6H₂0, 10 g glucose, 0.1 g Bacto casamino acids (BD Biosciences), 5.73 g TES (Sigma), 20 g agar in 1 L water, autoclaved, after which 1 mL filter-sterilized 50 mg/mL KH₂P0₄ solution and filter-sterilized 2.94 g CaCl₂ ^,2H₂0 and 3 g L-proline in 5 mL 1 N NaOH were added to the medium. Conjugation experiments involving the ET 12567 E. coli strain was performed on SFM agar with 10 mM MgCl₂: 20 g/L mannitol, 20 g/L soya flour, 20 g/L agar were stirred at 95 C for 2 to 4 hours prior to autoclaving. After which, 1 M MgCl₂ was added to the medium for a final concentration of 10 mM.

Strains and growth conditions

[00110] Strains and plasmids used in this study are listed in Table 1. Unless otherwise indicated, strains are propagated on ISP2 medium at 30 C. Spore preparations and conjugation protocols were similar to those described by Keiser and Bibb.50 For spore preparations, 1 : 1000 of a spore preparation or 50-100 μL· of a saturated seed culture is plated on sporulation medium (ISP2 or SFM) and incubated at 30 »C until thick spores are observed. Spores were then scraped off the plate using a sterile glass slide or glass beads and resuspended in sterile TX buffer (50 mM Tris pH 7.4, 0.001% v/v Triton X) by vigorous vortexing for 30 seconds. When the glass slide was used, the suspension was and passed through a syringe containing a cotton ball to trap cellular debris and mycelia. The eluent containing free spores were pelleted by spinning at maximum speed in an Eppendorf 5810R centrifuge for 10 min and resuspended in 1 mL sterile water and re -pelleted. The spores were then resuspended in water and stored at -80 °C. A good spore prep contains -109 spores/mL as determined by plating serial dilutions of the prep.

Construction of genome editing plasmids

[00111] All DNA manipulations were carried out in Escherichia coli DH5a or chemically competent 2 T1^R Escherichia coli cells (OmniMAX, Thermo Fisher). Primers used in this study are listed in Table 2. Three cloning schemes were tested over the course of the study to assembly the final genome editing plasmids (Fig.16). Scheme 1 was used to generate editing plasmids for 5. albus. Scheme 2 was used to assemble 5. lividans plasmids and a fraction of the 5. roseosporus plasmids. Scheme 3, involving modified pCRISPomyces-2 plasmids, proved to be the most efficient and was used to make majority of the plasmids in the study. In Scheme 3, pCRISPomyces-2 plasmids for making promoter knock-in constructs were made by inserting adapter sequences with restriction sites flanking the promoter of choice to facilitate insertion of homology arms (Fig.15). Protospacer for a target cluster was first inserted via Bbsl Golden Gate Assembly. The helper plasmid was linearized using Spel and assembled with the downstream homology arm by Gibson assembly (New England Biolab). The second upstream homology arm is also inserted by Gibson assembly using Hindlll or Nhel linearized construct containing the first homology arm.

Interspecies conjugation

[00112] Promoter knock-in constructs are transformed into conjugating E. coli strains and colonies with the appropriate antibiotic resistance (e.g. 50 mg/L apramycin (Sigma)) were picked into Luria-Bertani (LB) medium with antibiotics. Note that WM6026 requires diaminopimelic acid (Sigma) in LB medium for growth and subsequent wash and re-suspension steps involving LB medium. Overnight cultures were diluted 1 : 100 into fresh LB medium with antibiotics and grown to an optical density (OD600) of 0.4 to 0.6. 400 μL· of the culture was pelleted, washed twice and resuspended in LB medium without antibiotics. The washed E. coli cells were then mixed with spores at 1 :5 volume ratio and spotted on R2 plate. After incubation for 16 to 20 hours at 30 C, the plates were flooded with nalidixic acid and apramycin and incubated until exconjugants appear. Exconjugants were streaked into ISP2 plates containing apramycin at 30 °C followed by re -streaking to ISP2 plates at 37 C to cure the CRISPR-Cas9 plasmid containing a temperature sensitive origin of replication. Apramycin-sensitive clones growing at 37 C were then subjected to validation of promoter knock -in and genome editing as described below.

Validation of promoter knock-in and genome editing

[00113] Genomic DNA from wild type and exconjugants from the indicated strains were isolated from liquid cultures using the Blood and Tissue DNeasy kit (Qiagen) after pre -treating the cells with 20 mg/mL lysozyme for 0.5 to 1 hour at 30 C. Polymerase chain reaction (PCR) was performed using control primers beyond the homology regions or knock-in specific primers (Table 4) with Taq polymerase (KODXtreme, Millipore) with the following step-down cycling conditions: 94 C for 2 minutes; [98 C for 10 seconds, 68 C for 1 kb/minute] x 5 cycles; [98 C for 10 seconds, 66 C for 10 seconds, 68 C for 1 kb/minute] x 5 cycles; [98 C for 10 seconds, 64 C for 10 seconds, 68 C for 1 kb/minute] x 5 cycles; [98 C for 10 seconds, 62 C for 10 seconds, 68 C for 1 kb/minute] x 15 cycles; hold 4 C. Where indicated, PCR products were subjected to digest with specific restriction enzymes to differentiate between PCR products were further wild type genomic sequences and successful genome editing by knock-ins. Positive samples were purified using Qiaquick PCR purification kit (Qiagen) and validated by Sanger sequencing.

Fermentation and extraction and LC-MS analysis of poly cyclic tetramate macrolactam (PTM) and other compounds

[00114] Spores stocks of wild type and engineered 5. roseosporus strains were diluted in water and plated on ISP2 agar plates and incubated at 30 C for 2 weeks. Agar was then chopped up, extracted with ethyl acetate twice and was dried using a rotary evaporator. Samples were then resuspended in methanol and analysed by LC/MSD trap (Agilent) equipped with a C¹⁸ reverse phase column. HPLC parameters were as follows: solvent A, 0.1% formic acid in water; solvent B, 0.1% formic acid in acetonitrile; gradient at a constant flow rate of 0.3 mL/ minute, 10% B for 5 minutes, 10% to 100% B in 25 minutes, maintain at 100% B for 10 minutes, return to 10% B in 1 minute and finally maintain at 10% B for 9 minutes; detection by ultraviolet spectroscopy at 210, 254 and 280 nm.

Fermentation and extraction and ³¹P-NMR analysis of phosphonate compounds

[00115] Liquid seed cultures (2 mL ISP2) of wildtype and engineered 5. roseosporus strains were inoculated from a plate or spore stock in the 14 mL culture tube. Seed cultures were incubated at 30 C with 250 rpm shaking until achieving turbidity or high particle density (typically 2 to 3 days). Seed cultures were diluted 1 : 100 into 50 mL of ISP2 broth in 250 mL baffled flasks containing -30-40 5 mm glass beads (Sigma) and incubated at 30 °C with 250 rpm shaking for 14 days. The cultures harvested by pelleting at maximum speed in an Eppendorf 5810R centrifuge for 10 minutes. The cell pellet was stored at -80 °C while the supernatants were split into two 50 mL falcon tubes, flash frozen liquid nitrogen and lyophilized to dryness. 25 and 10 mL of methanol was added to each tube containing dried supernatant and frozen cell pellets respectively. The methanol mixtures were vortexed for 1 minute each and incubated on a platform shaker at 4 C for 2 hours. Samples were clarified by spinning at maximum speed in an Eppendorf 5810R centrifuge for 10 minutes twice and pooling the methanol extracts from the respective pellets and lyophilized culture supernatants. A generous amount of anhydrous sodium sulfate was added to the extracts and stirred. The extracts were decanted, was dried using a rotary evaporator and resuspended in 700 μL· deuterium oxide (Sigma) added in two 350 μL· aliquots. A spatula-full of Chelex 100 resin (Bio-Rad) was added to each sample in a 1.7 mL centrifuge tube, which was incubated for 30 minutes at room temperature with agitation on a Thermo microplate shaker. The samples were clarified twice by centrifuging at maximum speed in an Eppendorf bench-top centrifuge for 1 minute each time. The supernatants were then filtered using a 10 kDa cut-off centrifugal concentration column (Vivaspin, GE Healthcare) and the filtrates were transferred to a 5 mm NMR tube for NMR analysis. ³¹P-NMR has been acquired using a Bruker DRX-600 spectrometer. Proton decoupled ³¹P-NMR spectra are referenced to an external H₃P0₄(aq) standard (δ 0.0 ppm). All samples have been acquired for 6000 scans. Production titers were estimated by spiking in known amounts of FR-900098 (Sigma).

Exemplary workflow

A. Basic strain culture conditions activation studies

[00116] Reagents and Media. Unless otherwise indicated, all reagents are obtained from Sigma. 1 L of MGY medium contains 10 g malt extract broth, 4 g Bacto yeast extract (BD Biosciences), 4 g glucose (1st Base, Axil Scientific) and for MGY agar plates, an additional 20 g of Bacto agar (BD Biosciences). Conjugation experiments involving WM6026 and WM3780 E. coli strains were performed on R2 agar without sucrose: 0.25 g K₂S0₄, 10.12 g MgCl₂ ^,6H₂0, 10 g glucose, 0.1 g Bacto casamino acids (BD Biosciences), 5.73 g TES, 20 g agar in 1 L water, autoclaved, after which 1 mL filter-sterilized 50 mg/mL KH2P04 solution and filter-sterilized 2.94 g CaCl₂ ^,2H₂0 and 3 g L-proline in 5 mL 1 N NaOH were added to the medium.

[00117] Strains and Growth conditions. Strains and plasmids used in this study are listed in Table 1. Unless otherwise indicated, strains are propagated in MGY medium at 30 °C. Spore preparations and conjugation protocols were similar to those described by Keiser and Bibb. For spore preparations, 1 : 1000 of a spore preparation or 1 : 100 dilution of a saturated seed culture is plated on MGY plates and incubated at 30 °C until thick spores are observed. Spores were removed from the plate using 5 mm glass beads (Sigma) and resuspended in sterile TX buffer (50 mM Tris pH 7.4, 0.001% (v/v) Triton X) by vigorous vortexing for 30 seconds. The eluent containing free spores were pelleted by spinning at maximum speed in an Eppendorf 5810R centrifuge for 10 min, resuspended in 1 mL sterile water and re -pelleted. The spores were then resuspended in water and stored at -80 °C. A typical spore preparation contains -107-109 spores/mL as determined by serial dilution plating.

B. Design of promoter knock-in plasmids

[00118] 1. For cluster of interest, potential promoter knock-in sites were selected based on: a. the presence of a potential transcriptional activator; b. minimal set of core biosynthetic genes; and/or c. if multiple promoters need to be inserted.

[00119] 2. The actual start codon of the first gene of the operon to be activated has to be manually checked (optimization step).

[00120] 3. PAMs and protospacer sequences were designed to be as close as possible to cut sites. Select a 20 nt protospacer of interest. The 3' protospacer adjacent sequence (PAM) must be NGG, where N is any nucleotide. Preference is given to one or more of the following: sequences with purines (A, G) occupying the last four (3') bases of the protospacer; sequences on the non-coding strand; and/or sequences in which the last 12 nt of protospacer + 3 nt PAM (15 nt total) are unique in the genome. The sequences are verified using BLAST.

[00121] 4. Homology arms are designed according to one or more of the following criteria: a. for robust PCR - optimization performed, primer design (and by extension, homology arm junction) is key; b. removal of Cas9-recutting site while minimizing genetic perturbation (e.g. disruption of genes or remaining sequences). While the latter step is not required for deletion studies, it is required for activation studies.

C. Construction of promoter knock-in plasmids

[00122] Construction of genome editing plasmids. All DNA manipulations were carried out in Escherichia coli DH5a or chemically competent 2 T1^R Escherichia coli cells (OmniMAX, Thermo Fisher). Primers used in this study are listed in Table 2. Restriction enzymes were obtained from New England Biolabs. Helper pCRISPomyces-2 plasmids for making promoter knock-in constructs were made by ligating adapter sequences, containing restriction sites flanking the promoter of choice (Fig. 31) to facilitate insertion of homology arms, at the Xbal site of pCRISPomyces-2. The protospacer of a target cluster was first inserted via Bbsl-mediated Golden Gate Assembly as previously described. The helper plasmid (pCRISPomyces-2-kasO*p, pCRISPomyces-2-P8-kasO*p) was linearized using Spel and assembled with the downstream homology arm, which is 2 kb unless otherwise indicated (data not shown) by Gibson assembly (New England Biolabs). The second upstream homology arm (2 kb, unless otherwise indicated) was subsequently inserted by Gibson assembly using Hindlll or Nhel linearized construct containing the first homology arm. See Fig. 32 for workflow to construct genome editing plasmids. Different workflows for assembling the knock-in plasmids were tried and this workflow was deemed most attractive in terms of ease, efficiency and modularity (see Fig. 11).

D. Insertion of protospacer prior to insertion of first and second homology arms into helper plasmid

[00123] First, select a 20 nt protospacer of interest. The 3' protospacer adjacent sequence (PAM) must be NGG, where N is any nucleotide. Preference is given to one or more of the following: sequences with purines (A, G) occupying the last four (3') bases of the protospacer; sequences on the non-coding strand; sequences in which the last 12 nt of protospacer + 3 nt PAM (15 nt total) are unique in the genome (check by BLAST with all four possible NGG sequences). Secondly, design two 24 nt oligonucleotides (4 nt 5 ' sticky end + 20 nt spacer sequence) with the sticky ends ACGC on the forward primer and AAAC on the reverse primer. For example, if the spacer sequence is CTCACGGACGGAGACCAGGA, then the two primers are: (a) Spacer-for: 5 ' - ACGCCTC ACGGACGGAGACC AGGA-3 ' and (b) Spacer-rev:

5 ' - AAACTCCTGGTCTCCGTCCGTGAG-3 ' , such that the annealed product will be: 5 ' - ACGCCTC ACGGACGGAGACC AGGA-3 ' ; and 3'- GAGTGCCTGCCTCTGGTCCTCAAA-5 ' . Thirdly, anneal spacer oligos as follows: re-suspend both oligos to ΙΟΟμΜ in water. Mix 5 μL· FOR + 5 REV and 90 μΕ 30mM HEPES, pH 7.8. Heat to 95 °C for 5 minutes, then ramp to 4 °C at a rate of 0.1 °C/second. Insert annealed spacer by Golden Gate assembly. Perform the chosen assembly method to insert the 2 kb homology arms sequentially in the digested, dephosphorylated backbone (see above.)

E. Introduction of CRISPR/Cas9 + knock-in template from previous step into Streptomyces (native producers) for promoter knock-in

[00124] Interspecies conjugation. Promoter knock-in constructs were used to transform conjugating E. coli strains and colonies with the appropriate antibiotic resistance (e.g. 50 mg/L apramycin) were picked into Luria-Bertani (LB) medium with antibiotics. WM6026 requires diaminopimelic acid in LB medium for growth and it was added to LB medium for subsequent wash and re-suspension steps. Overnight cultures were diluted 1 : 100 into fresh LB medium with antibiotics and grown to an OD600 of 0.4-0.6. 400 μL· of the culture was pelleted, washed twice and re- suspended in LB medium without antibiotics. The washed E. coli cells were then mixed with spores at 1 :5 volume ratio and spotted on R2 without sucrose plates. After incubation for 16 to 20 hours at 30 °C, the plates were flooded with nalidixic acid and apramycin and incubated until exconjugants appear. Exconjugants were streaked onto MGY plates containing apramycin at 30 °C followed by restreaking to MGY plates at 37 °C to cure the CRISPR-Cas9 plasmid containing a temperature- sensitive origin of replication. Apramycin-sensitive clones growing at 37 °C were then subjected to validation of promoter knock-in and genome editing as described below.

F. Validation of promoter knock-in into desired genomic locus of native Streptomyces hosts [00125] Validation of promoter knock-in and genome editing. Genomic DNA from wild type and exconjugants from the indicated strains were isolated from liquid cultures using the Blood and Tissue DNeasy kit (Qiagen) after pre -treating the cells with 20 mg/mL lysozyme for 0.5 to 1 hours at 30 °C. PCR was performed using control primers beyond the homology regions or knock-in specific primers (Table 4) with KODXtreme Taq polymerase (Millipore). PCR conditions were optimised for high GC templates. Where indicated, PCR products were subjected to digest with specific restriction enzymes to differentiate between PCR products of wild type genomic sequences and successful genome editing by knock-ins. Positive samples were purified using Qiaquick PCR purification kit (Qiagen) and validated by Sanger sequencing. A schematic example of PCR-digest determination of promoter knock-in can be seen in Fig. 16.

G. Validation of activated gene expression of gene cluster as a result of CRISPR/Cas9 mediated promoter knock in

[00126] RNA isolation and Real-time quantitative PCR (RT-qPCR). RNA from wild type and engineered 5. roseosporus were isolated using RNAsy Midi Kit (Qiagen) 72 hours after seed cultures were diluted 1 : 100 into 50 mL of MGY broth in 250 mL baffled flasks containing -30 to 40 5 mm glass beads and growth at 30 °C. Isolated RNA was treated with DNase (Qiagen) before being reverse transcribed with random hexamers using Superscript III (Invitrogen). RT-qPCR was performed on a Roche LightCycler 480 using SYBR FAST qPCR master mix (KAPA). The housekeeping rpsL gene of 5. roseosporus was used as constitutive reference to normalize gene expression of each target gene such that rpsL expression = 1.27 Technical triplicates of three biological repeats were performed per condition. Gene-specific primers are listed in Table 2.

H. Fermentation conditions of engineered strains harbouring activated clusters, subsequent detection, isolation and extraction of unique compounds made and subsequence structure identification

[00127] Fermentation, ethyl acetate extraction and LC-MS analysis metabolites from wild type and engineered Streptomyces strains. Liquid seed cultures (2 mL MGY) of wild type and engineered 5. roseosporus and 5. venezuelae strains were inoculated from a plate or spore stock in 14 mL culture tubes. Seed cultures were incubated at 30 °C with 250 rpm shaking until achieving turbidity or high particle density (typically 2 to 3 days). Seed cultures were diluted 1: 100 into 50 mL of MGY broth in 250 mL baffled flasks containing -30-40 5 mm glass beads and incubated at 30 °C with 250 rpm shaking (10 to 14 days for 5. roseosporus, 5 to 7 days for 5. venezuelae). The cultures were harvested by pelleting at maximum speed in an Eppendorf 5810R centrifuge for 10 minutes. The cell pellet was stored at -80 °C while the supernatants were split into two 50 mL falcon tubes. Culture supernatants were extracted three times with equal volume ethyl acetate. For solid-state cultures, the strains were grown on MGY plates at 30 °C for 10 days. The plates were chopped into small pieces and extracted twice with ethyl acetate. Extracts were dried and resuspended in methanol, and analysed by LCMS using ESI source in positive ion mode (Bruker, Amazon SL Ion Trap) equipped with a Kinetex 2.6 μπι ΧΒ-08 100 A (Phenomenex). HPLC parameters were as follows: solvent A, 0.1% trifluoroacetic acid in water; solvent B, 0.1% trifluoroacetic acid in acetonitrile; gradient at a constant flow rate of 0.2 mL/min, 10% B for 5 minutes, 10% to 100% B in 35 minutes, maintain at 100% B for 10 minutes, return to 10% B in 1 minutes and finally maintain at 10% B for 10 minutes; detection by ultraviolet spectroscopy at 210 nm, 254 nm, 280 nm, 320 nm.

[00128] Extraction and NMR analysis of phosphonate compounds. Liquid seed cultures (2 mL MGY) of wild type and engineered 5. roseosporus strains were inoculated from a plate or spore stock into 14 mL culture tubes. Seed cultures were incubated at 30 °C with 250 rpm shaking until achieving turbidity or high particle density (typically 2 to 3 days). Seed cultures were diluted 1 : 100 into 50 mL of MGY broth in 250 mL baffled flasks containing -30-40 5 mm glass beads and incubated at 30 °C with 250 rpm shaking for 10 to 14 days. The cultures were harvested by pelleting at maximum speed in an Eppendorf 5810R centrifuge for 10 minutes. The cell pellet was stored at -80 °C while the supernatants were split into two 50 mL falcon tubes, flash frozen liquid nitrogen and lyophilized to dryness. 25 and 10 mL of methanol was added to each tube containing dried supernatant and frozen cell pellets respectively. The methanol mixtures were vortexed for 1 min each and incubated on a platform shaker at 4 °C for 2 hours. Samples were clarified by spinning at maximum speed in an Eppendorf 5810R centrifuge for 10 minutes twice and pooling the methanol extracts from the respective pellets and lyophilized culture supernatants. A generous amount of anhydrous sodium sulfate was added to the extracts and stirred. The extracts were decanted, concentrated to dryness and resuspended in 700 μL· deuterium oxide added in two 350 μL· aliquots. A spatula-full of Chelex-100 resin (Bio-Rad) was added to each sample in a 1.7 mL centrifuge tube, which was incubated for 30 minutes at room temperature with agitation on a Thermo microplate shaker. The samples were clarified twice by centrifuging at maximum speed in an Eppendorf bench top centrifuge for 1 minute each time. The supernatants were then filtered using a 10 kDa Vivaspin column (GE Healthcare) and the filtrates were transferred to a 5 mm NMR tube for NMR analysis. ³¹P-NMR has been acquired using a Bruker DRX-600 spectrometer equipped with a 5mm BBFO cryoprobe. Proton decoupled ³¹P- NMR spectra are referenced to an external H₃P0₄ (aq) standard (δ 0.0 ppm). All samples have been acquired for 6000 scans. Identity of FR-900098 was confirmed by 1) spiking with the sample with authentic FR-900098, 2) ³¹P HMBC data comparison; 3) HRMS data. Production titers were estimated by spiking in known amounts of FR-900098.

[00129] Isolation and NMR analysis of PTM compounds. The crude extract was fractionated using silica gel flash chromatography and generated 11 fractions: Fl (5% ethyl acetate with 95% hexanes), F2 (15% ethyl acetate with 85% hexanes), F3 (20% ethyl acetate with 80% hexanes), F4 (30% ethyl acetate with 70% hexanes), F5 (40% ethyl acetate with 60% hexanes), F6 (50% ethyl acetate with 50% hexanes), F7 (60% ethyl acetate with 40% hexanes), F8 (80% ethyl acetate with 20% hexanes), F9 (100% ethyl acetate), F10 (100% acetone), Fl l (100% methanol). PTM was eluted in Fl l according to LCMS analysis. Fl l was subjected to semi-prep HPLC using a C18 column (Phenomenex, 250 x 10 mm) with the following gradient: 5-40 minutes 5%-20% acetonitrile in water with 0.1% formic acid; 40-60 minutes 20%-50% acetonitrile in water with 0.1% formic acid; 60-70 min 50%-60% acetonitrile in water with 0.1% formic acid. 2 was eluted at 62 minutes. 1 was eluted at 61 minutes. NMR analysis was performed on an Agilent 600 MHz NMR spectrometer.

[00130] Isolation and NMR analysis of type II polyketide from S. viridochromogenes. Large-scale cultivation on solid plates (equivalent to 5 L liquid culture) of the knock-in strain was carried out to obtain sufficient amounts of potential new compound. 10-day growth solid plates were soaked in equal volume ethyl acetate overnight. The extract was fractionated using CI 8 flash column chromatography and the fraction containing the target compound was further subjected to silica gel flash column chromatography. The column elution was monitored by TLC and the fractions containing the target compound were further confirmed by HPLC. NMR analysis was performed on an Agilent 600 MHz NMR spectrometer. [00131] Fermentation, extraction and LC-MS analysis of RED, ACT and indigoidine from wild type and engineered Streptomyces strains. Liquid seed cultures (2 mL MGY) of wild type and engineered 5. lividans and 5. albus strains were inoculated from a plate or spore stock in 14 mL culture tubes. Seed cultures were incubated at 30 °C with 250 rpm shaking until achieving turbidity or high particle density (typically 1 to 2 days). For 5. lividans, seed cultures were diluted 1 : 100 and plated onto MGY plates and grown at 30 °C for 3 to 4 days. The plates were chopped into small pieces and extracted with methanol (RED) or acidified methanol (ACT). For 5. albus, seed cultures were diluted 1 : 100 into 50 mL of MGY broth in 250 mL baffled flasks and grown at 25 °C with 250 rpm shaking for 2 to 3 days. Culture supernatants of wild type and engineered 5. albus strains were extracted twice with equal volume ethyl acetate containing 1 % (v/v) formic acid. Extracts were dried and re-suspended in methanol prior to analysis by LCMS using ESI source in positive ion mode (Bruker, Amazon SL Ion Trap) equipped with a Kinetex 2.6 μπι XB-C18 100 A (Phenomenex). HPLC parameters were as follows: solvent A, 0.1% trifluoroacetic acid in water; solvent B, 0.1% trifluoroacetic acid in acetonitrile; gradient at a constant flow rate of 1 mL/minute, 5% B for 2 minutes, 5% to 100% B in 15 minutes, maintain at 100% B for 2 minutes, return to 5% B and maintain for 2 minutes; detection by ultraviolet spectroscopy at 500 nm (RED, ACT) or 600 nm (indigoidine). MS/MS was performed in positive auto MS(n) mode with scan range m z 100-1000.

TABLES

[00132] Table 1: Bacterial strains and plasmids used in this study. Plasmids with editing templates used for promoter knock-in are included below the respective engineered strains in underlined font.

William

Escherichia coli

diaminopimelic acid auxotroph Metcalf WM6026

laboratory

William

Escherichia coli

dam dcm Metcalf WM3780

laboratory daml 3 : :Tn9(ChlR) dcm-6 hsdM hsdR recF143 zjj-

Escherichia coli 201::TnlO galK2 galT22 aral4 lacYl xyl-5 leuB6 Eriko Takano ET12567-pUZ8002 thi-1 tonA31 rpsL136 hisG4 tsx-78 mtll glnV44, laboratory

pUZ8002(KanR)

Slrcplnni ccs slriiins iu 1 pkismids used lor cluster ncliuilion

Streptomyces albus Zhao

wild type

J1074 laboratory

Streptomyces albus This

kasO*p-indC

J1074-BLUE application pCM2 with sgRNA 1 targeting upstream region of This pCM2-kasO *p-indC- indC and editing template consisting of kasO*p application 2k-l

flanked by 2 kb homology arms

pCM2-kasO *p-indC- pCM2-kasO*p-indC-2k-l with a different sgRNA This

2k-2 (sgRNA 2) application pCM2-kasO *p-indC- pCM2-kasO*p-indC-2k-l with 1 kb homology arms This lk-1 instead of 2kb application pCM2-kasO *p-indC- pCM2-kasO *p-indC-2k-2 with 1 kb homology arms This lk-2 instead of 2kb application pCM2-kasO *p-indC- This

pCM2-kasO*p-indC-2k-l without sgRNA

2k-neg application

Streptomyces albus This

tsr-kasO *p-indC

J1074-tsr-BLUE application pCM2-tsr-kasO*p- pCM2 with sgRNA 1 targeting upstream region of This indC-2k-l indC and editing template consisting of thiostrepton application resistance cassette and kasO*p flanked by 2 kb

homology arms

pCM2-tsr-kasO*p- pCM2-tsr-kasO*p-indC-2k-l with a different sgRNA This indC-2k-2 (sgRNA 2) application pCM2-tsr-kasO*p- pCM2-tsr-kasO*p-indC-2k-l with 1 kb homology This indC-lk-1 arms instead of 2kb application pCM2-tsr-kasO*p- pCM2-tsr-kasO *p-indC-2k-2 with 1 kb homology This indC-lk-2 arms instead of 2kb application pCM2-tsr-kasO*p- This pCM2-tsr-kasO*p-indC-2k-l without sgRNA

indC-2k-neg application

Zhao

Streptomyces lividans

wild type laboratory 66

stock

Streptomyces lividans This kasO*p-redD

66-RED application pCM2 with sgRNA targeting upstream region of redD This pCM2-kasO *p-redD-2k and editing template consisting of kasO *p flanked by 2 application kb homology arms

pCM2-kasO*p-redD- This pCM2-kasO*p-redD-2k without sgRNA

2k-neg application

Streptomyces lividans This kasO*p-ActII-Orf4

66-ACT application pCM2 with sgRNA upstream of ActII-Orf4 and editing

pCM2-kasO*p-ActII- This template consisting of kasO*p flanked by 2 kb

Orf4-2k application homology arms

Streptomyces lividans This kasO*p-redD kasO*p-ActII-Orf4

66-RED-ACT application pCM2 combining two sgRNAs cassettes and two This pCM2-kasO*p-redD- editing templates from pCM2-kasO *p-redD-2k and application 2k-ActII-Orf4-1.5k

CM2-kasO *p-ActII- Orf4-2k pCM2-kasO*p-redD- This

OCM2-kasO*p-redD-2k-ActII-Orf4-1.5k without

2k-nee-ActII-Orf4-1.5k- application sgRNAs

neg

Streptomyces Zhao roseosporus wild type laboratory

NRRL15998 stock

Streptomyces

This roseosporus P8-frbC kasO*p-pepM

application

NRRL15998-R13bi

pCM2 with sgRNA targeting region between frbC and

pCM2-frbC-P8- This pepM and editing template consisting of bidirectional kasO *p-pepM-2k application

P8-kasO*p flanked by 2 kb homology arms

Streptomyces

roseosporus This

AfrbC kasO*p-pepM

NRRL15998- application R13kasO*p

pCM2 with sgRNA targeting region between frbC and

pCM2-kasO *p-pepM- pepM and editing template consisting of kasO*p This

2k flanked by 2kb homology arms, which includes a application complete removal of the native frbC promoter region

Streptomyces This roseosporus P8-frbC ApepM application

NRRL15998-R13P8

pCM2-frbC-P8- pCM2-frbC-P8-kasO*p-pepM-2k with a frameshift This kasO *p-pepMdel-2k deletion in pepM in the editing template application

Streptomyces This roseosporus ApepM AfrbC application

NRRL15998-R13KO

pCM2-kasO*p- pCM2-kasO*p-pepM-2k with a frameshift deletion in This pepMdel-2k pepM in the editing template application

Streptomyces kasO*p-SSGG_RS0133915 (sterol desaturase) This roseosporus application NRRL15998-R30

pCM2 with sgRNA targeting N-terminal region of This CMl-kasO*p- SSGG RS0133915 and editing template consisting of application

SSGG RS0133915-2k kasO*p flanked by 2 kb homology arms that includes a

synonymous mutation of the PAM

Streptomyces This roseosporus kasO*p-SSGG_RS01465 (MFS transporter) application

NRRL15998-R32

pCM2 with sgRNA targeting N-terminal region of This CMl-kasO*p- SSGG RS01465 and editing template consisting of application

SSGG RS01465-2k kasO*p flanked by 2 kb homology arms that includes a

synonymous mutation of the PAM

Streptomyces This roseosporus kasO*p-SSGG_RS0131465 (beta-ketoacyl synthase) application

NRRL15998-R3

pCM2 with sgRNA targeting upstream region of This pCM2-kasO*D-

SSGG RS0131465 and editing template consisting of application SSGG RS0131465-2k

kasO*p flanked by 2 kb homology arms

Streptomyces This roseosporus kasO*p-SSGG_RS00390 (NRPS) application

NRRL15998-R35

pCM2 with sgRNA targeting upstream region of

pCM2-kasO*D- SSGG RS00390 and editing template consisting of This

SSGG RS00390-2k kasO*p flanked by 2 kb homology arms that includes a application synonymous mutation of the PAM

Streptomyces This roseosporus kasO*p-SSGG_RS06425 (hypothetical protein) application

NRRL15998-R22

pCM2 with sgRNA targeting N-terminal region of This CMl-kasO*p-

SSGG RS06425 and editing template consisting of application SSGG RS06425 -2k

kasO*p flanked by 2 kb homology arms that includes a synonymous mutation of the PAM

Streptomyces This

roseosporus kasO*p-degG application

NRRL15998-R26

pCM2 with sgRNA targeting upstream region of degG This

pCM2-kasO *p-degG-2k homolog and editing template consisting of kasO*p application

flanked by 2 kb homology arms

Streptomyces avermitlis

wild type NRRL

ATCC31267

Streptomyces

wild type NRRL venezualae ATCC10712

Streptomyces

venezualae kasO*p-SVEN_RS26640 (PKS) NRRL

ATCC10712-Svl6

pCM2 with sgRNA targeting upstream region of

pCM2-kasO*p- This

SVEN RS26640 and editing template consisting of

SVEN RS26640-2k application

kasO*p flanked by 2 kb homology arms

Streptomyces Zhao viridochromogenes wild type laboratory DSM 40736 stock

Zhao

Streptomyces

wild type laboratory viridochromogenesTu57

stock

William W Metcalf, G. William Arends Professor in Molecular and Cellular Biology, Professor of Microbiology, metcalf@life.illinois.edu, Office: (217) 244-1943, Lab: (217) 265-0771 ; Mail to: MC- 110, 601 S Goodwin Ave.; Urbana, IL 61801.

NRRL refers to the ARS Culture Collection (NRRL), a culture collection of the Agricultural Research Service (ARS). [00133] Table 2: Oligonucleotides used in this study

SEQ ID

Primers Sequence Comments NO:

Complementary oligonucleotides for Bsal Golden Gate assembly of protospacers. 20 bp protospacer sequences are represented in lowercase letters.

1 npPP6 ACGCcccgagtgtgtgatctgcga Indigiodine BLUE cluster protospacer 1 in

2

npPP7 AAACtcgcagatcacacactcggg

5. albus

3 npPP8 ACGCatcgcagatcacacactcgg Indigiodine BLUE cluster protospacer 2 in

4

npPP9 AAACccgagtgtgtgatctgcgat

5. albus

5 npPP288 ACGCgcccgaatccgatcgttcgg RED cluster protospacer

6 npPP289 AAACccgaacgatcggattcgggc in 5. lividans

7 npPP20 ACGCatcccgcatcggtgattaca ACT cluster protospacer

8 npPP21 AAACtgtaatcaccgatgcgggat in 5. lividans

9 npPP207 ACGCaagcgttccacgaaaacagg R13 cluster (cluster 10) protospacer in 5.

10

npPP208 AAACcctgttttcgtggaacgctt

roseosporus

11 npPP209 ACGCctgtcagatgacacgtgtaa R26 cluster protospacer

12 npPP210 A A ACttac acgtgtcatctgacag in 5. roseosporus

13 npPP255 ACGCaatgaatttcgccat R30 cluster (cluster 24) protospacer in 5.

14

npPP256 AAACatggcgaaattcatt

roseosporus

15 npPP257 ACGCcgccggagacgtcccgacga R23 cluster protospacer

16 npPP258 AAACtcgtcgggacgtctccggcg in 5. roseosporus

17 npPP259 ACGCgcgtttttaagatcattctc R35 cluster protospacer

18 npPP260 AAACgagaatgatcttaaaaacgc in 5. roseosporus

19 npPP261 ACGCggcctggtcaaggcatgtac R3 cluster (cluster 3)

20 npPP262 AAACgtacatgccttgaccaggcc protospacer in 5. roseosporus

21 npPP277 ACGCaagtgagtatgtctgaagac R22 cluster protospacer

22 npPP278 AAACgtcttcagacatactcactt in 5. roseosporus

23 npPP586 ACGCctcttacgagactgccacga R5 cluster protospacer

24 npPP587 AAACtcgtggcagtctcgtaagag in 5. roseosporus

25 npPP588 ACGCcggccaccaggaatcgaaaa R14 cluster protospacer

26 npPP589 AAACttttcgattcctggtggccg in 5. roseosporus

27 npPP590 ACGCtttgggtcagcagtgtagaa R23 cluster protospacer

28 npPP591 AAACttctacactgctgacccaaa in 5. roseosporus

29 npPP592 ACGCatacccccatcctgcccaca R28 cluster protospacer

30 npPP593 AAACtgtgggcaggatgggggtat in 5. roseosporus

31 npPP624 ACGCgcgcgcccggacgcttacgc Svl6 cluster (cluster 16) protospacer in 5.

32

npPP625 AAACgcgtaagcgtccgggcgcgc

venezuelae

33 npPP786 ACGCcccgtacatgcattgaacga Cluster 18 protospacer

34 npPP787 AAACtcgttcaatgcatgtacggg in 5. roseosporus

35 pCm2-

ACGCccatggtccgtctccaaggt

C22-for Cluster 22 protospacer

36 pCm2- in 5. viridochromogenes

AAACaccttggagacggaccatgg

C22-rev

C loiiiniz <> 1 ditinii 11, inks

SEQ ID

Primers Sequence Comments NO:

37 TTTTTTtctagagctagcactagtcatatgCGATCCCACG

npPP264 PCR flank 1 for 5.

GCTTTAATCACGCC

roseosporus R30 cluster

38 aaaCATATGaatacgacagcgtgcaggactgggggagttATG

npPP266 editing construct

GATGAGCGCGAGCTCGCC

39 npPP267 atggatgagcgcgagctcgccgcGgatggcgaaattcattcggc PCR flank 2 for 5. roseosporus R30 cluster npPP268 ttttttGCTAGCttcggtgtggccgatgttcgtcttg

editing construct ggcgtgattaaagccgtgggatcgTgttcacattcgaacggtctctgctt PCR kasO*p for Gibson npPP294

tgacaacatg assembly into 5.

roseosporus R30 editing npPP295 CATaactcccccagtcctgcacgctgtcg

construct (Scheme 2)

AAAAAAgctagcGGTTCGCTGTCTGGTGGGTC PCR flank 1 for 5. npPP230

ACGG roseosporus R13 cluster npPP231 ttttttCATATGtgaataaacgatccatgttgcgcaatgccatttct editing construct

AAAAAAtctagagctagcactagtcatatgTCATGACCAT

npPP232 PCR flank 2 for 5.

GCGCGACGACATCATCCTT

roseosporus R13 cluster

TTTTTTtctagaTGGGGCGGAGTCCTGACGGTC

npPP233 editing construct

ATTG

tgtcctcaaggatgatgtcgtcgcgcatggtcatgatgttcacattcgaac PCR kasO*p for Gibson npPP248

ggtctctgc assembly into 5. cacgagaaatggcattgcgcaacatggatcgtttattCATaactcccc roseosporus R13 editing npPP249

cagtcctgcacg construct (Scheme 2) npPP269 aaaaaaTCTAGActcaggaacggtcggttccggg PCR flank 1 for 5.

ttttttTCTAGAGCTAGCACTAGTCATATGtgatacc roseosporus R32 cluster npPP270

gcgccggtcagccaaca editing construct npPP271 aaaaaaCATATGatgaagcgtttccgcttactcgtcctc PCR flank 2 for 5.

roseosporus R32 cluster npPP302 ttttttGCTAGCgagccgcgaacgtcttcttgtcgga

editing construct tgagaggaagaatgttggctgaccggcgcggtatcatgttcacattcga PCR kasO*p for Gibson npPP350

acggtctctgc assembly into 5. agtccgttgccgaggacgagtaagcggaaacgcttCATaactcccc roseosporus R32 editing npPP351

cagtcctgcacg construct (Scheme 2) npPP273 aaaaaaTCTAGAacgccatcccgatgacggctgc PCR flank 1 for 5.

ttttttTCTAGAGCTAGCACTAGTCATATGgtggag roseosporus R35 cluster npPP274

caccacatgacgctgctg editing construct npPP275 aaaaaaCATATGcgcaagttctcAggagaatgatcttaaaaacgc PCR flank 2 for 5.

roseosporus R35 cluster npPP276 ttttttGCTAGCctcgaacgcgcctgggacgagaa

editing construct cgcgcgtttttaagatcattctccggagaacttgcgtgttcacattcgaac PCR kasO*p for Gibson npPP352

ggtctctgc assembly into 5. gtccagcagtacatccagcagcgtcatgtggtgctcCATaactcccc roseosporus R35 editing npPP353

cagtcctgcacg construct (Scheme 2) npPP281 aaaaaaTCTAGAtgccacagcagatagtgcggatcaca PCR flank 1 for 5.

ttttttTCTAGAGCTAGCACTAGTCATATGcgtcact roseosporus R22 cluster npPP282

ttacgagcggaagaacgac editing construct npPP283 aaaaaaCATATGatgtctgaagacagActggtcggcgcg PCR flank 2 for 5.

roseosporus R22 cluster npPP303 ttttttGCTAGCcggaactcctccaggacgggttccatga

editing construct attccccccgtcgttcttccgctcgtaaagtgacgtgttcacattcgaacg PCR kasO*p for Gibson npPP348

gtctctgc assembly into 5.

roseosporus R22 editing npPP349 gccgaccagcctgtcttcagaCATaactcccccagtcctgcacg

construct (Scheme 2)

AAAAAAgctagcGTCGATGCGATGTTCCATGG

npPP223 PCR flank 1 for 5.

TGC

roseosporus R26 cluster

TTTTTTcatatgGTCATGCCGGGGTACGTCGAA

npPP216 editing construct

TAGCCT

AAAAAAtctagagctagcactagtcatatgTGGAACGGT

npPP226 PCR flank 2 for 5.

CGTACGAGATTCCTTACC

roseosporus R26 cluster

TTTTTTactagtCTGTCGGGGATCAGTTCCAGC

npPP224 editing construct

ACCG

atcgagcaacaactgcttgagtacgtccacggacacTGTTCACA PCR kasO*p for Gibson npPP252

TTCGAACGGTCTCTGC assembly into 5. atccgagttccgggtaaggaatctcgtacgaccgttccaTaactccccc roseosporus R26 editing npPP229

agtcctgcacg construct (Scheme 2) npPP596 ggtaataagaactacacgactggatactgacttttcaCTTGCCGG PCR flank 1 for 5. GGTGCTCGGTCTGGA roseosporus R3 cluster editing construct

AATACGACAGCGTGCAGGACTGGGGGAGTT

npPP597

ATGCTGCGCACAGAGCTGGTACGACC

GTCAAAGCAGAGACCGTTCGAATGTGAACA

npPP598 PCR flank 2 for 5.

GTAGGGGATGGAACCCCTAACAGCCC

roseosporus R3 cluster

TCTAGAgctagcatgcatatgaagcttGAATCTACGAGT

npPP599 editing construct

CCGCGGCGCGTG

AAGAACTACACGACTGGATACTGACTTTTC

npPP608 PCR flank 1 for 5.

ACACTAGGAGAGCGTGGAGCCCTTCACCGG

roseosporus R14 cluster

AATACGACAGCGTGCAGGACTGGGGGAGTT

npPP609 editing construct

ATGGCCGGATACGCGGTGTCTTCGTAC

GTCAAAGCAGAGACCGTTCGAATGTGAACA

npPP612 PCR flank 2 for 5.

GCTCGGAGACCGCCGTGTCCCG

roseosporus R14 cluster

TCTAGAGCTAGCATGCATATGAAGCTTaccgc

npPP613 editing construct

caggccaccgcgaagatca

TCTAGAGCTAGCATGCATATGAAGCTTGCT

npPP600 PCR flank 1 for 5.

GTTCGCGTACATGCGACAGCTCTG

roseosporus R23 cluster

GTCAAAGCAGAGACCGTTCGAATGTGAACA

npPP601 editing construct

CTTTTCGGACACGCCGCTCAGCCTTC

AATACGACAGCGTGCAGGACTGGGGGAGTT

npPP602 PCR flank 2 for 5.

ATGACCTTGACCCCCGCGGCGCACA

roseosporus R23 cluster

ACACGACTGGATACTGACTTTTCACACTAG

npPP603 editing construct

GGGCCCTCACCCTGCAGATCGTC

AAAAAATCTAGAGCTAGCATGCATATGAAG

npPP604 PCR flank 1 for 5.

CTTGCCGACCTCGACCACGAACGGG

roseosporus R28 cluster

TTGTCAAAGCAGAGACCGTTCGAATGTGAA

npPP605 editing construct

CATGCTGCGAAACGGCGCAAAAGACCCG

AATACGACAGCGTGCAGGACTGGGGGAGTT PCR flank 2 for 5. npPP606

ATGACCCGCATCGCCGCGGTGCA roseosporus R28 cluster npPP607 ACACGACTGGATACTGACTTTTCACACTAG editing construct TGACAACGCGTACCCCGAGGGCTG

89 TACACGACTGGATACTGACTTTTCACACTA

npPP618 PCR flank 1 for 5.

GGCAGTTGGTTCTCGATCTCGCCGATCTCG

roseosporus R5 cluster

90 AATACGACAGCGTGCAGGACTGGGGGAGTT

npPP619 editing construct

ATGACGATCACTGGAGCACCGCAGCG

91 GACCCCCAGTCCTGGGAGGACCACTTCACA

npPP620 PCR flank 2 for 5.

ATGCGCAGTGATGACGACGCCCTGG

roseosporus R5 cluster

92 TCTAGAGCTAGCATGCATATGAAGCTTAAG

npPP621 editing construct

CCGTCGCCGAGGATGTGGTGG

93 TCTAGAGCTAGCATGCATATGAAGCTTgttcac

npPp664 PCR flank 1 for 5.

ggccgagttctcccagctgt

venezuelae SV16 cluster

94 AGTCCTGGGAGGACCACTTCACAatgacctccga

npPP665 editing construct

gacgacctccgaagc

95 AATACGACAGCGTGCAGGACTGGGGGAGTT

npPP666 PCR flank 2 for 5.

Atggtgactttgtgcaagcccgcggt

venezuelae SV16 cluster

96 AACTACACGACTGGATACTGACTTTTCACAc

npPP667 editing construct

gacttcaccgtgcaggtgtccctg

97 npPP290 aaaaaaTCTAGAttcaaggagaacctctcctggcgca PCR flank 1 for 5.

98 ttttttTCTAGAGCTAGCACTAGTCATATGgtttgcc lividans RED cluster npPP291

cgtcgagccgaaagagga editing construct

99 aaaaaacatatGACAGCGTGCAGGACTGGGGGAG PCR flank 2 for 5.

npPP292

TTatgacgggtgggggagtgcttgc lividans RED cluster

100 npPP293 ttttttGCTAGCcagtaccgacgcgtacacccggt editing construct

101 ttcatcttcctctttcggctcgacgggcaaactgttcacattcgaacggtct PCR kasO*p for Gibson npPP354

ctgc assembly into 5.

lividans RED editing

102

npPP355 CATaactcccccagtcctgcacg

construct (Scheme 2)

Diiiiiiiosli I'C^'K mid SC(|llC'IH-lllfi

SEQ ID

Primers Sequence Comments NO: PCR of target genomic npPP356 cccggcgagacccatacgctcgc

locus for 5. roseosporus npPP357 ggtgctcgatgctcagcacggtcttg R30 cluster (cluster 24)

Sequencing primers for npPP300 ttccgtaaggcttccccggataaaagcgc

edited genomic region (5. roseosporus R30 npPP301 cgatcaggaaaagcggactgacccacg

cluster (cluster 24))

PCR of target genomic npPP283 ggacctgtccttgttccacgccga

locus for 5. roseosporus npPP284 gacgacacgcaccatcaggaacgcc R13 cluster (cluster 10) npPP246 cagtcagcgagcaccggcag Sequencing primers for edited genomic region, npPP247 cccatggcggggatgccgat 5. roseosporus R13 cluster (cluster 10) npPP358 cattgtccgatgctcgtaccgacggg PCR of target genomic locus for 5. roseosporus npPP359 cgcgaacgtcttcttgtcggagccg

R32 cluster

npPP342 caggcggcgtcgcttttcag Sequencing primers for edited genomic region npPP343 tagacgaaaacgttcaacgccacca (5. roseosporus R32 cluster)

npPP360 gatgagcaggtcccagaaggcctcgg PCR of target genomic locus for 5. roseosporus npPP361 gttcgccgtgctcgaagtcctgatcgg

R35 cluster

npPP344 gccacggacatgcacgacga Sequencing primers for edited genomic region npPP345 gcgagcggttccacggtgt (5. roseosporus R35 cluster)

npPP362 cgttcggcgatcgcgttcatcgcc PCR of target genomic locus for 5. roseosporus npPP363 gtcgcgttgattccgaccatcgccc

R22 cluster

npPP340 agtttgccgggcattctgtcca Sequencing primers for edited genomic region npPP341 gcgtccatgagccgcttgttct (5. roseosporus R22 cluster)

npPP286 tccggcgaagtgcacatggcagtc PCR of target genomic locus for 5. roseosporus npPP287 accagcgccatctcgaagacctgga

R26 cluster

npPP244 gcaactgaatctccaggtcgg Sequencing primers for edited genomic region npPP245 cagcgccacggttccactg (5. roseosporus R26 cluster)

npPP674 ggacgggaagatcacaccggtctccgtgg PCR of target genomic locus for 5. roseosporus npPP675 ctgcgaccgcttcgtcaggtcgcattcg

R3 cluster (cluster 3)

Sequencing primer for edited genomic region, npPP676 gacagcggacttgagggagcgtcataggtc

5. roseosporus R3 cluster (cluster 3) npPP677 tcctggaggagaagatccgttcgctgggga PCR of target genomic locus for 5. roseosporus npPP678 cgcagcacctcgacggccttgatcagccc

R14 cluster npPP679 cggtatcgaccggtccgagggtgattcacg Sequencing primers for edited genomic region npPP701 cccggcccgtcgtctcgtagacgaagagat (5. roseosporus R14 cluster) npPP680 ccgcgactggctgcgcgtgaagacgagag PCR of target genomic locus for 5. roseosporus npPP681 ccggccttccaggagggtcacgtcgagt

R23 cluster

Sequencing primer for edited genomic region npPP682 tagggcgatacgccgctccaccgacgctc

(5. roseosporus R23 cluster) npPP683 tgtcggtcgggtccaccagcgccgagac PCR of target genomic locus for 5. roseosporus npPP684 aaggcggccaggtgctggtcgtagggac

R28 cluster

Sequencing primer for edited genomic region npPP685 acaggaacggaacccgtcggaccggcgt

(5. roseosporus R28 cluster)

npPP693 gaaggtcggcgaagatctcgccccagtacg PCR of target genomic locus for 5. roseosporus npPP694 cgcttgtcggtcttgccgttcggcgtgagc

R5 cluster

npPP695 acgtaccccgtgacgaaggcctgttcacc Sequencing primers for edited genomic region npPP696 gtaccggaccgcccgtacatcgatatcggg (5. roseosporus R5 cluster)

npPP689 gtcaccatcggctcctacgacggggtgcac PCR of target genomic locus for 5. venezuelae npPP699 ccttcggcatgatctcgcaggcgctgatgg

SV16 cluster (cluster 16) npPP700 ccggtcatcttggtgacctgctggtcgagc Sequencing primers for edited genomic region, npPP701 gcttcagggtctcctcgatgggctgcacg 5. venezuelae SV16 cluster (cluster 16) npPP200 gcctccgccgcgacctgtgaacggta PCR of target genomic locus for 5. lividans npPP201 cggcgagtcagcaggactccgaacggac

A CT cluster

npPP164 cgtgatcgacgacgaaccgcaga PCR of target genomic locus for 5. lividans npPP178 gcgcctggagggcgttgaggacg RED cluster - control primer pair for left flank

PCR of target genomic locus for 5. lividans npPP355 cataactcccccagtcctgcacg RED cluster - kasO*p- specific primer for left flank, used with npPP164

npPP176 cggcaccccatccgctcatgggag PCR of target genomic locus for 5. lividans RED cluster - control npPP227 tggtagaggtcccggtcgaacaactcggccgg

primer pair for right flank

PCR of target genomic locus for 5. lividans RED cluster - kasO*p- npPP196 agtcgtggccaggagaatacgacagcgtgc

specific primer for right flank, used with npPP227

npPP183 ggcctcgaactccagcacctcgacg PCR of target genomic locus for 5. albus BLUE npPP186 cacgcgttcatggtgcccggcatc cluster (5. albus indigoidine cluster) npPP802 agagcggtttcgagctcacgaccgatgtcg PCR of target genomic locus for 5. roseosporus npPP803 tcgagctgctgtctcgccagatcacggg

cluster 18

Sequencing primers for edited genomic region npPP804 caccacagtgccagtaggtctggtacggta

(5. roseosporus cluster 18)

C22_Up

PCR of target genomic

-2kbL- cggtttgtcacaatgggcgg

locus for 5. for

viridochromogenes

C22- tggacgacgaacacgaact cluster 22

Seq-rev

C22- Sequencing primers for agcaccgtcttccaccggg

Seq-for edited genomic region

C22- (5. viridochromogenes tggacgacgaacacgaact

Seq-rev cluster 22) ( ιΙΊΙΟ-Spoi L'il i prim s lor R 1 (|I'C R

SEQ ID

Primers Sequence Comments NO:

165 n.a. atcgaggtcacggcctacatc

rpsL

166 n.a. cgcggatgatcttgtaacgaac

167 n.a. ttggaggcactggaagagag

SSGG RS107025

168 n.a. atcctggccaacaaggaatcc

169 n.a. aactggtcgacgacaacatc

SSGG RS107020

170 n.a. cgttctcgacattgatccacag

171 n.a. gctcgacaaagacgaaattcgc

SSGG RS107010

172 n.a. atttgcggagagttgtgtgc

173 n.a. cgaatgagttctgcggatgc

SSGG RS107000

174 n.a. tattcgacccagcgctgac

175 n.a. agttggaaaacgtcgctcac

SSGG RS106990

176 n.a. atcaccgccatgcagaaaag

177 n.a. tgggattcaaggccgtacac

SSGG RS106985

178 n.a. tccttggccatcttgatcagc

179 n.a. tgtggtcgatgatcagactctc

SSGG RS0132525

180 n.a. caaatacaccgatgggctgttc

181 n.a. tcgaggacaagtgtcagcatc

SSGG RSI 6955

182 n.a. gcaatcgccggtctatttgc

183 n.a. aagaacttgtacggggagcag

SSGG RS02310

184 n.a. gcgttgctgtacgtggac

185 n.a. tcggagtgatcgcctatttgg

SSGG RS0133915

186 n.a. agcaggaagtagatgccgtac

187 n.a. aacgcatcaaggacgaactg SSGG_RS02305

[00134] Table 3: Efficiencies of CRISPR-Cas9 mediated knock-in for Streptomycetes.

a Unless otherwise indicated, knock-ins were performed with editing templates containing the indicated insert with 2 kb homology flanks. No protospacer refers to the same knock-in constructs for the indicated cluster without a protospacer.

b kasO*p and P8-kasO*p cassettes are 97 and 774 bp respectively, tsr refers to a ~1 kb thiostrepton- resistance cassette. [00135] Table 4: AntiSMASH analyses of 5. roseosporus NRRL15998 (NCBI Reference Sequence: NZ_DS999644.1). Previously observed compounds include daptomycin (clusters 1, 2), napsamycin (cluster 9), stenothricin (cluster 5) and arylomycin (cluster 20).

Cluster Type From To Compound Study

Cluster 1 Nrps 294555 342186

Liu et al,

Cluster 2 Nrps 327150 404865 Daptomycin

2014

Cluster 3 Nucleoside-t 1 pks 542942 610237 m/z 405 This study

Cluster 4 Terpene 749569 770645

Liu et al,

Cluster 5 Nrps 867981 941249 Stenothricin

2014

Cluster 6 Ectoine 1254796 1265194

Cluster 7 Lantipeptide 2310568 2333055

Cluster 8 Siderophore 2417885 2429663

Liu et al,

Cluster 9 Nrps 3338145 3408899 Napsamycin

2014

This

Cluster 10 Phosphonate 3538559 3564634 3

application

Cluster 11 T2pks 4069279 4111773

Cluster 12 Siderophore-nrps 4243258 4290705

Cluster 13 Lantipeptide 4435763 4459002

Cluster 14 Nrps 5067958 5119039

Cluster 15 Terpene 5593701 5614678

Cluster 16 Nrps 5627322 5683180

Cluster 17 Siderophore 6039454 6054198

This

Cluster 18 Tlpks 6088404 6152437 m/z 780

application

Tlpks-

Cluster 19 6137252 6204339

oligosaccharide

Liu et al,

Cluster 20 Nrps 6206554 6271974 Arylomycin

2014⁹

Cluster 21 Nrps-tlpks 6373968 6429540

Cluster 22 Bacteriocin 6529256 6540056

Cluster 23 Terpene 7116845 7143418 This

Cluster 24 Nrps-tlpks 7222916 7272356 1, 2

application

Cluster 25 Bacteriocin 7309635 7320432

Cluster 26 Tlpks-nrps 7435742 7486384

Cluster 27 Melanin 7520011 7530493

Cluster 28 T3pks 7565600 7606652

Cluster 29 Nrps-tlpks 7691684 7743884

[00136] Table 5: Sequence homology of 5. roseosporous cluster 24 to reported PTM clusters

5. griseus. Sequence identity

Frontalamide Cluster 24 Predicted

PTM of cluster 24 to 5. biosynthetic (ftd) equivalent Function

cluster griseus equivalent

FtdA SGR 815 SSGG_RS0133915 Sterol desaturase

polyketide

FtdB SGR 814 SSGG RS02305 95%

synthase

FAD-dependent

FtdC SGR 813 SSGG RS02300 98%

oxidoreductase

phytoene

FtdD SGR 812 SSGG RS02295 96%

dehydrogenase

alcohol

FtdE SGR 811 SSGG RS02290 97%

dehydrogenase

putative

FtdF SGR 810 SSGG_RS02285 cytochrome P450

hydroxylase

[00137] Table 6: Sequence homology of 5. roseosporous cluster 10 to FR-900098 biosynthetic gene cluster from S. rubellomurinus.

FR-900098 Cluster 10 Sequence

Predicted Function

cluster equivalent Identity

Frbl SSGG_RS17015 NUDIX hydrolase 60%

L-threonine-O-3 -phosphate

FrbH SSGG_RS17010 74%

decarboxylase [Streptomyces]

FrbG SSGG_RS17005 Hypothetical protein 60%

AAC(3) family N-

FrbF SSGG_RS17000 73%

acetyltransferase

FrbE SSGG_RS 16995 Isocitrate dehydrogenase 63%

FrbD SSGG_RS 16990 Phosphoenolpyruvate synthase 76%

FrbC SSGG_RS 16985 Hypothetical protein 87% [00138] Table 7: AntiSMASH analyses of 5. venezuelae ATCC10712 (NCBI Reference Sequence: NC_018750.1). Previously observed compounds from 5. venezuelae include chloramphenicol (cluster 7) and jadomycin (cluster 20).

Cluster Type From To Compound Study

Cluster 1 Ectoine 237842 248258

Cluster 2 Terpene 274553 296739

Cluster 3 Tlpks-T3pks-Nrps 504136 604067

Lantipeptide-

Cluster 4 614220 645285

Terpene

Cluster 5 Lantipeptide 707463 730315

Cluster 6 Indole 867489 890695

He et al,

Cluster 7 Other 1031023 1073914 Chloramphenicol

2001

Cluster 8 Other 2055965 2096690

Cluster 9 Siderophore 2794931 2806751

Cluster 10 Lassopeptide 3408328 3430687

Cluster 11 Other 4408196 4451900

Cluster 12 Butyrolactone 4522206 4533171

Cluster 13 Melanin 5003818 5014228

Cluster 14 Butyrolactone 5477370 5502716

Cluster 15 Thiopeptide 5531076 5557501

This

Cluster 16 T3pks 5785193 5826323 m/z 425

application

Cluster 17 Siderophore 5869901 5883169

Cluster 18 Siderophore 5936046 5950407

Cluster 19 Bacteriocin 6350466 6361866

Doull et al,

Cluster 20 Butyrolactone -T2pks 6494470 6531416 Jadomycin

1993

Cluster 21 Other 6672467 6716369

Cluster 22 Nrps-Ladderane 6720590 6814598

Cluster 23 Nrps 6800195 6855167

Cluster 24 Terpene 7021575 7048100

Cluster 25 Bacteriocin 7128838 7139692

Cluster 26 T2pks 7421589 7464101

Cluster 27 Melanin 7484949 7495338 Cluster 28 Nrps 7706602 7760938 Cluster 29 Terpene 7788497 7809951 Cluster 30 T3pks 7946146 7987237 Cluster 31 Terpene-Nrps 8189935 8226158

[00139] Table 8: AntiSMASH analyses of 5. viridochr omo genes DSM 40736 (NCBI Reference Sequence: NZ_ACEZ00000000.1). Previously observed product from 5. viridochromogenes include phosphinothricin.

Cluster Type From To Compound Study

Cluster 1 Terpene-nrps -t 1 pks 147228 209213

Cluster 2 Melanin-terpene 350984 374124

Cluster 3 Nrps 614938 667909 Coelichelin⁸

Cluster 4 T lpks-butyrolactone 925309 1004775

Cluster 5 Lassopeptide 996947 1020529

Cluster 6 Tlpks 1023099 1074657

Cluster 7 Tlpks 1068135 1123254

Cluster 8 Nrps -tlpks 1124345 1179652

Metcalf et al,

Cluster 9 Nrp s -pho sphonate 1172570 1240729 Phosphonothricin

2005

Cluster 10 Ectoine 1986466 1997781 Ectoine^b

Cluster 11 NRPS-tlPKS 2482772 2542826

Cluster 12 Terpene 2721388 2743906

Cluster 13 Lassopeptide 3108492 3120837

Cluster 14 Melanin 3108492 3120837

Cluster 15 Siderophore 4468051 3223680

Cluster 16 Butyrolactone 5785193 4479215

Cluster 17 Lantipeptide 4691917 4720311

Cluster 18 Tlpks 4852429 4915920

Cluster 19 Linaridin 4917000 4938204

Cluster 20 Lantipeptide-nrps 5099822 5150004

Cluster 21 Terpene 5973704 5895857

This

Cluster 22 T2pks 6046899 6089394 4

application

Cluster 23 Siderophore 6516102 6529476

Cluster 24 Tlpks 6568627 6618163

Cluster 25 Ectoine 6692399 6703527

Cluster 26 Bacteriocin 6914884 6926688

Cluster 27 Terpene 6959775 6982425

Cluster 28 Siderophore 7169194 7182469

Cluster 29 Terpene 7611221 7638254

Cluster 30 Terpene 8121206 8142742

Bacteriocin-

Cluster 31 8164951 8193467

lantipeptide Cluster 32 Tlpks 8282728 8326427

Cluster 33 Other 8476453 8521258

100% of genes show similarity with coelichelin biosynthetic gene clusters of 5. coelicolor A3(2). 100% of genes show similarity with ectoine biosynthetic gene clusters of 5. chrysomallus.

Claims

1. A recombinant method of activating expression of one or more biosynthetic gene cluster(s), or one or more target gene(s) in a biosynthetic gene cluster comprising more than one gene, the method comprising inserting one or more promoter(s) at one or more transcriptionally functional location(s) relative to the biosynthetic gene cluster(s) or the target gene(s) in the biosynthetic gene cluster(s), whereby the insertion of the promoter(s) results in increased expression of the biosynthetic gene cluster(s) or target gene(s) compared to the expression level of an unmodified biosynthetic gene cluster(s) or target gene(s), wherein the promoter(s) is/are inserted using CRISPR technology.

2. The method of claim 1, wherein the biosynthetic gene cluster(s) comprise silent or orphan genes, or wherein the target gene(s) is/are silent or orphan genes.

3. The method of claim 2, wherein the biosynthetic gene cluster(s) or target gene(s) is/are isolated from an Actinobacterium.

4. The method of claim 3, wherein the Actinobacterium genus is of the genus Streptomyces.

5. The method of claims 3 to 4, wherein the Actinobacterium is selected from the group consisting of Streptomyces albus, Streptomyces avermilitis, Streptomyces erythraeus (Saccharopolyspora erythraea), Streptomyces griseus, Streptomyces lividans, Streptomyces rapamycinicus, Streptomyces roseosporus, Streptomyces rubellomurinus, Streptomyces venezuelae, and Streptomyces viridochomogenes .

6. The method of claim 1, wherein the biosynthetic gene cluster(s) or target gene(s) is/are selected from the group consisting of SEQ ID NO: 193 to 201.

7. The method of claim 1, wherein the promoter(s) and the biosynthetic gene cluster(s) or target gene(s) are of the same species or are of different species.

8. The method of claim 1, wherein the promoter(s) is selected from the group consisting of kasO*p, ermE*p, P2, P3, P8, P25, and rcfp.

9. The method of claim 1, wherein the transcriptionally functional location(s) is/are upstream, or downstream or both upstream and downstream of the biosynthetic gene cluster(s) or target gene(s).

The method of claim 1, wherein the CRISPR technology is CRISPR-Cas9.

11. The method of claim 1 , wherein one or more of the actions selected from the group consisting of deletion of promoter regions, site-directed mutations, mutations and gene deletion (knockout) is/are performed before, simultaneously or after the addition of the one or more promoter(s) according to claim 1.

12. A recombinant expression plasmid for activating expression of a biosynthetic gene cluster(s), the plasmid comprising one or more promoter (s) according to claim 8, a biosynthetic gene cluster(s) or one or more target gene(s) according to any of claims 1 to 5.