Phyllanthus species: scientific evaluation and medicinal applications 9781439821466, 1439821461, 9780429093043, 0429093047, 9781138112537, 1138112534

Table of contents :
Front Cover......Page 1
Contents......Page 7
Series Preface......Page 11
Preface......Page 15
About the Editors......Page 17
Contributors......Page 19
Chapter 1 - Taxonomy of the Genus Phyllanthus......Page 23
Chapter 2 - Current Pharmacopoeial Status of Phyllanthus Species: P. emblica, P. amarus, and P. fraternus......Page 59
Chapter 3 - Cultivation, Economics, and Marketing of Phyllanthus Species......Page 69
Chapter 4 - Phylogenetic Analysis of Phyllanthus Species......Page 93
Chapter 5 - Genetic Resources of Phyllanthus in Southern India: Identification of Geographic and Genetic Hot Spots and Its Implication for Conservation......Page 119
Chapter 6 - Phytochemistry of the Genus Phyllanthus......Page 141
Chapter 7 - Hyphenated Techniques in the Study of the Genus Phyllanthus......Page 161
Chapter 8 - Anti-inflammatory Activity of Various Species of Phyllanthus......Page 171
Chapter 9 - Hepatoprotective Effects of Plants in the Family Phyllanthaceae......Page 179
Chapter 10 - Anticancer Studies of Phyllanthus amarus......Page 193
Chapter 11 - Anticancer Activity of Phyllanthus emblica......Page 205
Chapter 12 - The In Vivo and In Vitro Proapoptotic and Antiangiogenic Effects of Phyllanthus urinaria......Page 215
Chapter 13 - Phyllanthus and Hepatitis B, Hepatitis C, and HIV Infections......Page 227
Chapter 14 - Antiviral Activities of Phyllanthus orbicularis, an Endemic Cuban Species......Page 241
Chapter 15 - Diabetes and Diabetic Complications and Phyllanthus species......Page 257
Chapter 16 - Chemoprotective, Genotoxic, and Antigenotoxic Effects of Phyllanthus Sp.......Page 277
Chapter 17 - Antiaging Effects of Phyllanthus Species......Page 289
Chapter 18 - Toxicity Studies of Phyllanthus Species......Page 301
Chapter 19 - Clinical Trials Involving Phyllanthus Species......Page 311
Chapter 20 - Immunomodulatory Activity of Brahma Rasayana, an Herbal Preparation Containing Phyllanthus emblica as the Main Ingredient......Page 337
Chapter 21 - Triphala: An Ayurvedic Drug Formulation......Page 347
Chapter 22 - Kalpaamruthaa: A Successful Drug against Various Ailments......Page 353
Back Cover......Page 375

Citation preview

Traditional Herbal Medicines for Modern Times

Phyllanthus Species Scientific Evaluation and Medicinal Applications

Edited by

Ramadasan Kuttan K. B. Harikumar

Phyllanthus Species Scientific Evaluation and Medicinal Applications

Traditional Herbal Medicines For Modern Times Each volume in this series provides academia, health sciences, and the herbal medicines industry with in-depth coverage of the herbal remedies for infectious diseases, certain medical conditions, or the plant medicines of a particular country.

Series Editor: Dr. Roland Hardman Volume 1 Shengmai San, edited by Kam-Ming Ko Volume 2 Rasayana: Ayurvedic Herbs for Rejuvenation and Longevity, by H.S. Puri Volume 3 Sho-Saiko-To: (Xiao-Chai-Hu-Tang) Scientific Evaluation and Clinical Applications, by Yukio Ogihara and Masaki Aburada Volume 4 Traditional Medicinal Plants and Malaria, edited by Merlin Wilcox, Gerard Bodeker, and Philippe Rasoanaivo Volume 5 Juzen-taiho-to (Shi-Quan-Da-Bu-Tang): Scientific Evaluation and Clinical Applications, edited by Haruki Yamada and Ikuo Saiki Volume 6 Traditional Medicines for Modern Times: Antidiabetic Plants, edited by Amala Soumyanath Volume 7 Bupleurum Species: Scientific Evaluation and Clinical Applications, edited by Sheng-Li Pan Volume 8 Herbal Principles in Cosmetics: Properties and Mechanisms of Action, by Bruno Burlando, Luisella Verotta, Laura Cornara, and Elisa Bottini-Massa Volume 9 Figs: The Genus Ficus, by Ephraim Philip Lansky and Helena Maaria Paavilainen

Traditional Herbal Medicines for Modern Times

Phyllanthus Species Scientific Evaluation and Medicinal Applications

Edited by

Ramadasan Kuttan K. B. Harikumar

CRC Press Taylor & Francis Group 6000 Broken Sound Parkway NW, Suite 300 Boca Raton, FL 33487-2742 © 2012 by Taylor & Francis Group, LLC CRC Press is an imprint of Taylor & Francis Group, an Informa business No claim to original U.S. Government works Version Date: 20111205 International Standard Book Number-13: 978-1-4398-2146-6 (eBook - PDF) This book contains information obtained from authentic and highly regarded sources. Reasonable efforts have been made to publish reliable data and information, but the author and publisher cannot assume responsibility for the validity of all materials or the consequences of their use. The authors and publishers have attempted to trace the copyright holders of all material reproduced in this publication and apologize to copyright holders if permission to publish in this form has not been obtained. If any copyright material has not been acknowledged please write and let us know so we may rectify in any future reprint. Except as permitted under U.S. Copyright Law, no part of this book may be reprinted, reproduced, transmitted, or utilized in any form by any electronic, mechanical, or other means, now known or hereafter invented, including photocopying, microfilming, and recording, or in any information storage or retrieval system, without written permission from the publishers. For permission to photocopy or use material electronically from this work, please access www.copyright. com (http://www.copyright.com/) or contact the Copyright Clearance Center, Inc. (CCC), 222 Rosewood Drive, Danvers, MA 01923, 978-750-8400. CCC is a not-for-profit organization that provides licenses and registration for a variety of users. For organizations that have been granted a photocopy license by the CCC, a separate system of payment has been arranged. Trademark Notice: Product or corporate names may be trademarks or registered trademarks, and are used only for identification and explanation without intent to infringe. Visit the Taylor & Francis Web site at http://www.taylorandfrancis.com and the CRC Press Web site at http://www.crcpress.com

Contents Series Preface.............................................................................................................ix Preface.................................................................................................................... xiii About the Editors...................................................................................................... xv Contributors............................................................................................................xvii Chapter 1 Taxonomy of the Genus Phyllanthus....................................................1 Sheeja T. Tharakan Identification Manual for Some Species of the Genus Phyllanthus L. of Phyllanthaceae with Special Reference to the Indian Subcontinent............................................................................ 23 A. Lalithamba Chapter 2 Current Pharmacopoeial Status of Phyllanthus Species: P. emblica, P. amarus, and P. fraternus............................................. 37 Raman Mohan Singh and Vivekanandan Kalaiselvan Chapter 3 Cultivation, Economics, and Marketing of Phyllanthus Species........ 47 B. R. Rajeswara Rao Chapter 4 Phylogenetic Analysis of Phyllanthus Species.................................... 71 Srinivasu Tadikamalla Chapter 5 Genetic Resources of Phyllanthus in Southern India: Identification of Geographic and Genetic Hot Spots and Its Implication for Conservation...............................................................97 G. Ravikanth, R. Srirama, U. Senthilkumar, K. N. Ganeshaiah, and R. Uma Shaanker Chapter 6 Phytochemistry of the Genus Phyllanthus........................................ 119 Lutfun Nahar, Satyajit D. Sarker, and Abbas Delazar Chapter 7 Hyphenated Techniques in the Study of the Genus Phyllanthus...... 139 Satyajit D. Sarker, Lutfun Nahar, and Abbas Delazar v

vi

Contents

Chapter 8 Anti-inflammatory Activity of Various Species of Phyllanthus....... 149 K. B. Harikumar and Ramadasan Kuttan Chapter 9 Hepatoprotective Effects of Plants in the Family Phyllanthaceae.... 157 V. V. Asha Chapter 10 Anticancer Studies of Phyllanthus amarus....................................... 171 K. B. Harikumar and Ramadasan Kuttan Chapter 11 Anticancer Activity of Phyllanthus emblica..................................... 183 Jeena Joseph and Ramadasan Kuttan Chapter 12 The In Vivo and In Vitro Proapoptotic and Antiangiogenic Effects of Phyllanthus urinaria........................................................ 193 Jong‑Hwei S. Pang, Sheng-Teng Huang, Rong-Chi Yang, and Hsiao‑Ting Wu Chapter 13 Phyllanthus and Hepatitis B, Hepatitis C, and HIV Infections........205 S. P. Thyagarajan Chapter 14 Antiviral Activities of Phyllanthus orbicularis, an Endemic Cuban Species................................................................................... 219 Gloria del Barrio and Francisco Parra Chapter 15 Diabetes and Diabetic Complications and Phyllanthus species....... 235 Geereddy Bhanuprakash Reddy and Palla Suryanarayana Chapter 16 Chemoprotective, Genotoxic, and Antigenotoxic Effects of Phyllanthus Sp................................................................................... 255 Rakesh K. Johri Chapter 17 Antiaging Effects of Phyllanthus Species......................................... 267 Vasudevan Mani and Shanmugapriya Thulasimani Chapter 18 Toxicity Studies of Phyllanthus Species........................................... 279 K. N. S. Sirajudeen

vii

Contents

Chapter 19 Clinical Trials Involving Phyllanthus Species.................................. 289 Mulyarjo Dirjomuljono and Raymond R. Tjandrawinata Chapter 20 Immunomodulatory Activity of Brahma Rasayana, an Herbal Preparation Containing Phyllanthus emblica as the Main Ingredient.......................................................................................... 315 Praveen K. Vayalil, Ramadasan Kuttan, and Girija Kuttan Chapter 21 Triphala: An Ayurvedic Drug Formulation...................................... 325 Sandhya T. Das and K. P. Mishra Chapter 22 Kalpaamruthaa: A Successful Drug against Various Ailments........ 331 P. Sachdanandam and P. Shanthi

Series Preface Global warming and global travel are contributing factors in the spread of infectious diseases such as malaria, tuberculosis, hepatitis B, and HIV. These are not well controlled by the present drug regimes. Antibiotics also are failing because of bacterial resistance. Formerly less well-known tropical diseases are reaching new shores. A whole range of illnesses, such as cancer, for example, occurs worldwide. Advances in molecular biology, including methods of in vitro testing for a required medical activity, give new opportunities to draw judiciously on the use and research of traditional herbal remedies from around the world. The reexamining of the herbal medicines must be done in a multidisciplinary manner. Since 1997, there have been 49 volumes published in the book series Medicinal and Aromatic Plants—Industrial Profiles (Volumes 47–49 have been on vanilla, sesame, and citrus oils, respectively). The series continues. The same series editor is also covering Traditional Herbal Medicines for Modern Times. Each volume reports on the latest developments and discusses key topics relevant to interdisciplinary health sciences research by ethnobiologists, taxonomists, conservationists, agronomists, chemists, pharmacologists, clinicians, and toxicologists. The series is relevant to all these scientists and will enable them to guide business, government agencies, and commerce in the complexities of these matters. The background to the subject is outlined next. Over many centuries, the safety and limitations of herbal medicines have been established by their empirical use by the “healers” who also took a holistic approach. The healers are aware of the infrequent adverse effects and know how to correct these when they occur. Consequently and ideally, the preclinical and clinical studies of an herbal medicine need to be carried out with the full cooperation of the traditional healer. The plant composition of the medicine, the stage of the development of the plant material, when it is to be collected from the wild or when from its cultivation, its postharvest treatment, the preparation of the medicine, the dosage and frequency, and much other essential information is required. A consideration of the intellectual property rights and appropriate models of benefit sharing may also be necessary. Wherever the medicine is being prepared, the first requirement is a well-documented reference collection of dried plant material. Such collections are encouraged by organizations like the World Health Organization and the United Nations Industrial Development Organization. The Royal Botanic Gardens at Kew (United Kingdom) is building its collection of traditional Chinese dried plant material relevant to its purchase and use by those who sell or prescribe traditional Chinese medicine in the United Kingdom. In any country, the control of the quality of plant raw material, of its efficacy, and of its safety in use is essential. The work requires sophisticated laboratory equipment and highly trained personnel. This kind of “control” cannot be applied to the locally produced herbal medicines in the rural areas of many countries, on which millions of people depend. Local traditional knowledge of the healers has to suffice. ix

x

Series Preface

Conservation and protection of plant habitats are required, and breeding for biological diversity is important. Gene systems are being studied for medicinal exploitation. There can never be too many seed conservation “banks” to conserve genetic diversity. Unfortunately, such banks are usually dominated by agricultural and horticultural crops, with little space for medicinal plants. Developments such as random amplified polymorphic DNA enable the genetic variability of a species to be checked. This can be helpful in deciding whether specimens of close genetic similarity warrant storage. From ancient times, a great deal of information concerning diagnosis and the use of traditional herbal medicines has been documented in the scripts of China, India, and elsewhere. Today, modern formulations of these medicines exist in the form of powders, granules, capsules, and tablets. They are prepared in various institutions, such as government hospitals in China and Korea, and by companies such as the Tsumura Company of Japan, with good quality control. Similarly, products are produced by many other companies in India, the United States, and elsewhere with a varying degree of quality control. In the United States, the Dietary Supplement and Health Education Act of 1994 recognized the class of physiotherapeutic agents derived from medicinal and aromatic plants. Furthermore, under public pressure, the U.S. Congress set up an Office of Alternative Medicine. In 1994, this office assisted in the filing of several Investigational New Drug (IND) applications required for clinical trials of some Chinese herbal preparations. The significance of these applications was that each Chinese preparation involved several plants and yet was handled with a single IND. A demonstration of the contribution to efficacy, of each ingredient of each plant, was not required. This was a major step forward toward more sensible regulations with regard to phytomedicines. The subject of Western herbal medicines is now being taught again to medical students in Germany and Canada. Throughout Europe, the United States, Australia, and other countries, pharmacy and health-related schools are increasingly offering training in phytotherapy. Traditional Chinese medicine clinics are now common outside China. An Ayurvedic hospital now exists in London with a BSc Honors degree course in Ayurveda available: Professor Shrikala Warrier, Resistrar/Dean, MAYUR, Ayurvedic University of Europe, 81 Wimpole Street, London, WIG 9RF, e-mail sw@ unifiedherbal.com. This is a joint venture with a university in Manipal, India. The term integrated medicine is now being used, which selectively combines traditional herbal medicine with “modern medicine.” In Germany, there is now a hospital in which traditional Chinese medicine is integrated with Western medicine. Such comedication has become common in China, Japan, India, and North America by those educated in both systems. Benefits claimed include improved efficacy, reduction in toxicity and the period of medication, as well as a reduction in the cost of the treatment. New terms such as adjunct therapy, supportive therapy, and supplementary medicine now appear as a consequence of such comedication. Either medicine may be described as an adjunct to the other depending on the communicator’s view. Great caution is necessary when traditional herbal medicines are used by doctors not trained in their use and likewise when modern medicines are used by traditional herbal doctors. Possible dangers from drug interactions need to be stressed. In Volume 2 of this series, Rasayana: Ayurvedic Herbs for Rejuvenation and Longevity, by Dr. H. S. Puri, line drawings are given in 58 chapters of plants and

Series Preface

xi

concise medical data covering all the important Rasayanas. Probably the most commonly used herb is Amalaki, the fruit of Phyllanthus emblica. Since Dr. Puri’s book (2003), research reports from around the world have appeared about many species of Phyllanthus, so justifying this review of the genus in Volume 10 of the series. For all their hard work, I am most grateful to the editors, Professor Ramadasan Kuttan, PhD and K. B. Harikumar, PhD. Hari has been most diligent in replying to my e-mails and to those of all the chapter contributors. These also I thank for their enthusiasm and expert information. My thanks are due to the steadfast support of the staff of CRC Press: Barbara Norwitz, executive editor and Jill Jurgensen, senior project coordinator. Roland Hardman, BPharm, BSc (Chemistry), PhD (London), FRPharmS Head of Pharmacognosy (retired), School of Pharmacy and Pharmacology University of Bath, United Kingdom

Preface Astanga Hrdaya, one of the earliest textbooks in Ayurveda (the traditional system of medicine in India), written by Vagbhatta (AD 500), mentioned the following regarding medicinal plants. jagatyevam anoushadham na kinchit vidyate dravyam vashaannaarthayagayoh’ This means “There is nothing in this universe, which is nonmedicinal, which cannot be made use of for many purposes and by many modes.” This illustrates the importance of plants and their uses. The genus Phyllanthus has over 1,000 species, and many of them are reported to possess a wide array of pharmacological activities. Species are distributed throughout the world. Various species of Phyllanthus have been reportedly used for the treatment of a variety of aliments around the world. The uses of Emblica (Indian gooseberry), which is a component of Rasayana, have been found in Siddha, Ayurvedic, Unani, Arabic, Tibetan, and Egyptian texts. Emblica is known by different names in various parts of the world: Amla (India), Melaka (Malaysia), Malaka (Sudan), Makam paun (Thailand), and Amlaj (Arabic). The uses of Emblica were described in the ancient Ayurvedic text Charaka Samhita (3rd century BC) as a rejuvenating drug. Emblica is also known for its high level of ascorbic acid content. According to Ayurveda, Emblica has the ability to maintain the balance in all three doshas (energies believed to govern physiological activity) that is vital for proper functioning of the body. Phyllanthus amarus is another well-known member of this genus. The plant is known by different names, including Bhoomi amalaki, Bhui amla (India); Bhuinamla (Pakistan); gale-wind grass, hurricane weed, cane peas senna, carry me seed (West Indies); Graine en bas fievre (French Guiana); Jar amla (Fiji); Chanca piedra (Peru); Creole senna (Virgin Islands); Deye do (Haiti); Elrageig (Sudan); Mapatan (Papua-New Guinea); Shka-nin-du (Mexico); Viernes santo (Puerto Rico); Ya-taibai (Thailand); and Yerba de san pablo (Philippines). This plant is referred to as the stone breaker because of its ability to dissolve kidney and gallbladder stones in the body. In the Indian system, it is one of the major remedies for liver-related and gastric disorders. Other uses include, but are not limited to, fever, pain, obesity, vaginitis, malaria, and bacterial infections. Many of these uses of the plants were derived from folklore knowledge. Based on this knowledge, scientists have developed different ways to analyze the potential of these plants in a scientific manner. These studies demonstrated the pharmacological action and various chemical entities present in each plant. They validated the folklore claims and helped in designing cost-effective and reliable sources of medicine for humans. xiii

xiv

Preface

This book describes in detail the taxonomy, cultivation and marketing, identification of geographic and genetic hot spots, chemistry, scientific evaluation of various pharmacological properties, clinical trials, and formulations containing various species of Phyllanthus. This is the first book of its kind solely dedicated to the genus Phyllanthus. This book definitely will serve as firsthand information for those in academia, especially teachers and research scholars, and those in industry, agriculture, as well as the general public, providing up-to-date references. We would like to thank Dr. Roland Hardman, series editor, for giving us an opportunity to edit this book and for his continuous support and valuable suggestions. We would like to thank all contributors for their valuable efforts and time. Special thanks to Kanni Das for proofreading the manuscripts. Our sincere thanks are due to Jill Jurgensen and Barbara Norwitz of CRC Press for their unfailing help.

About the Editors Ramadasan Kuttan, PhD, has worked at the Amala Cancer Research Center, Thrissur, Kerala, India since 1984 and presently is the research director of the Center. He earned his doctoral degree from the University of Madras in 1973, receiving a Gold Medal for the outstanding thesis of the year. From 1973 to 1984, he conducted research in the United States, including stints at Roche Institute of Molecular Biology, Nutley, New Jersey, and M. D. Anderson Hospital and Cancer Center in Houston, Texas. His major areas of research include cancer drugs from plant sources and chemoprevention, chemoprotection, radioprotection, immunomodulation, and the like. He has done extensive work on the use of Phyllanthus amarus in cancer using animal models and cell culture. K. B. Harikumar, PhD, received his bachelor’s and master’s degrees in biochemistry from Nagpur University in India. His doctoral research on cancer chemoprevention by natural products was conducted under the direction of Ramadasan Kuttan at Amala Cancer Research Center, affiliated with Mahatma Gandhi University at Kottayam in India. Presently, he is a postdoctoral associate in the Department of Biochemistry and Molecular Biology at Virginia Commonwealth University, Richmond, Virginia. He has over 40 peer-reviewed publications and several book chapters to his credit. His major research focuses are cancer chemoprevention, ubiquitination and nuclear factor kappa B signaling, and the role of bioactive lipids in cell signaling.

xv

Contributors V. V. Asha Rajiv Gandhi Center for Biotechnology Molecular Ethopharmacology Laboratory Thiruvananthapuram, Kerala, India

K. B. Harikumar Virginia Commonwealth University Department of Biochemistry and Molecular Biology Richmond, Virginia, USA

Sandhya T. Das John Hopkins University School of Public Health Baltimore, Maryland, USA

Sheng-Teng Huang Chang Gung Memorial Hospital Kaohsiung Medical Center Department of Chinese Medicine Kaohsiung, Taiwan, Republic of China

Abbas Delazar Tabriz University of Medical Sciences School of Pharmacy Tabriz, Iran

Rakesh K. Johri Indian Institute of Integrative Medicine Division of Pharmacology Jammu-Tawi, India

Gloria del Barrio University of Habana Departament of Microbiology and Virology Faculty of Biology Ciudad de La Habana, Cuba

Jeena Joseph University of Michigan Research Associate Ann Arbor, Michigan, USA

Mulyarjo Dirjomuljono University of Airlangga/Dr. Soetomo General Hospital Department of Ear, Nose, & Throat Faculty of Medicine Surabaya, Indonesia K. N. Ganeshaiah Ashoka Trust for Research in Ecology and Environment, Srirampura, Jakkur Post, Bangalore, India University of Agricultural Sciences School of Ecology and Conservation Bangalore, India

Vivekanandan Kalaiselvan Indian Pharmacopoeia Commission (Ministry of Health and Family Welfare) Raj Nagar, Ghaziabad, India Girija Kuttan Amala Cancer Research Center Amala Nagar, Thrissur, Kerala, India Ramadasan Kuttan Amala Cancer Research Center Amala Nagar, Thrissur, Kerala, India A. Lalithamba D.K. Government College for Women Department of Botany Nellore, India xvii

xviii

Vasudevan Mani University Teknologi MARA (UiTM), Campus Puncak Faculty of Pharmacy Brain Research Laboratory Alam, Malaysia K. P. Mishra Nehru Gram Bharati University Allahabad, India Lutfun Nahar University of Wolverhampton Drug Discovery and Design Research Division Department of Pharmacy West Midland, UK Jong-Hwei S. Pang Chang Gung University, Tao-Yuan Graduate Institute of Clinical Medical Sciences Taiwan, Republic of China Francisco Parra University of Oviedo Institute of Biotechnology of Asturias Department of Biochemistry and Molecular Biology Oviedo, Spain B. R. Rajeswara Rao Central Institute of Medicinal and Aromatic Plants (CIMAP) Resource Center, Boduppal, Uppal Post Hyderabad, India G. Ravikanth Ashoka Trust for Research in Ecology and Environment, Srirampura Jakkur Post Bangalore, India University of Agricultural Sciences School of Ecology and Conservation Bangalore, India

Contributors

Geereddy Bhanuprakash Reddy National Institute of Nutrition Biochemistry Division Hyderabad, India P. Sachdanandam University of Madras, Taramani Campus Department of Medical Biochemistry Chennai, India Satyajit D. Sarker University of Wolverhampton School of Applied Sciences Department of Pharmacy West Midland, UK U. Senthilkumar Ashoka Trust for Research in Ecology and Environment, Srirampura Jakkur Post, Bangalore, India R. Uma Shaanker Ashoka Trust for Research in Ecology and Environment, Srirampura Jakkur Post, Bangalore, India University of Agricultural Sciences Department of Crop Physiology Bangalore, India P. Shanthi University of Madras Taramani Campus Department of Pathology Chennai, India Raman Mohan Singh Indian Pharmacopoeia Commission Ministry of Health and Family Welfare Raj Nagar, Ghaziabad, India K. N. S. Sirajudeen University Sains Malaysia Department of Chemical Pathology Kelantan, Malaysia

xix

Contributors

R. Srirama Ashoka Trust for Research in Ecology and Environment, Srirampura Jakkur Post, Bangalore, India Palla Suryanarayana National Institute of Nutrition Biochemistry Division Hyderabad, India Srinivasu Tadikamalla Rashtrasant Tukadoji Maharaj Nagpur University Department Botany Nagpur, India Sheeja T. Tharakan Vimala College Department of Botany Thrissur, Kerala, India Shanmugapriya Thulasimani Vellalar College for Women, Erode Department of Food and Nutrition Tamil Nadu, India S. P. Thyagarajan Pro-Chancellor, Research Sri Ramachandra University Chennai, India

Raymond R. Tjandrawinata Dexa Laboratories of Biomolecular Sciences Dexa Medica Group Tangerang, Indonesia Praveen K. Vayalil University of Alabama, Birmingham Department of Pharmacology and Toxicology Birmingham, Alabama, USA Hsiao-Ting Wu Chang Gung Memorial Hospital Department of Chinese Medicine Kaohsiung Medical Center Kaohsiung, Taiwan, Republic of China Rong-Chi Yang Chang Gung Memorial Hospital Tao-Yuan Chinese Herbal Pharmacy Taiwan, Republic of China

of the 1 Taxonomy Genus Phyllanthus Sheeja T. Tharakan CONTENTS 1.1 Taxonomy of the Genus Phyllanthus.................................................................3 1.1.1 Introduction........................................................................................... 3 1.1.2 Botanical System of Classification........................................................3 1.1.2.1 Natural System of Classification............................................. 3 1.1.2.2 APG II System........................................................................ 4 1.1.3 General Characters of Genus Phyllanthus............................................ 4 1.1.4 General Characters of Phyllanthus Species.......................................... 4 1.1.4.1 Phyllanthus Amarus Schum. & Thonn................................... 4 1.1.4.2 Phyllanthus emblica L. (Emblica officinalis Gaertner)..........5 1.1.4.3 Phyllanthus acidus L.............................................................. 5 1.1.4.4 Phyllanthus niruri...................................................................6 1.1.4.5 Phyllanthus urinaria L........................................................... 8 1.1.4.6 Phyllanthus polyphyllus Willd...............................................8 1.1.4.7 Phyllanthus myrtifolius Willd................................................. 9 1.1.4.8 Phyllanthus kozhikodianus.....................................................9 1.1.4.9 Phyllanthus reticulatus Poir...................................................9 1.1.4.10 Phyllanthus rheedii Wight...................................................... 9 1.1.4.11 Phyllanthus tenellus Roxb.................................................... 10 1.1.4.12 Phyllanthus lawii Grah......................................................... 10 1.1.4.13 Phyllanthus maderaspatensis L........................................... 10 1.1.4.14 Phyllanthus narayanswamii................................................. 11 1.1.4.15 Phyllanthus virgatus Forster F. (P. simplex Retz.)................ 11 1.1.4.16 Phyllanthus gardnerianus Baill............................................ 12 1.1.4.17 Phyllanthus macraei Muell................................................... 12 1.1.4.18 Phyllanthus rotundifolius Klein........................................... 12 1.1.4.19 Phyllanthus debilis Klein ex Willd....................................... 13 1.1.4.20 Phyllanthus missionis........................................................... 13 1.1.4.21 Phyllanthus speciosus Jacq................................................... 13 1.1.4.22 Phyllanthus pinnatus (Wight) Webster, J............................. 13 1.1.4.23 Phyllanthus acuminates........................................................ 14 1.1.4.24 Phyllanthus caroliniensis..................................................... 14 1.1.4.25 Phyllanthus mirabilis............................................................ 14 1.1.4.26 Phyllanthus caesiifolius........................................................ 14 1

2

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

1.1.4.27 Phyllanthus gentryi............................................................... 14 1.1.4.28 Phyllanthus muellerianus (Kuntze) Exell............................. 14 1.1.4.29 Phyllanthus pulcher Wall. Ex Müll. Arg.............................. 14 1.1.4.30 Phyllanthus fraternus Webster............................................. 14 1.1.4.31 Phyllanthus abnormis........................................................... 15 1.1.4.32 Phyllanthus odontadenius Mull. Arg................................... 15 1.1.4.33 Phyllanthus muellerianus (O Ktze) Exell............................. 15 1.1.4.34 Phyllanthus capillaris Schum. & Thonn.............................. 15 1.1.4.35 Phyllanthus sublanatus Schum. & Thonn............................ 15 1.1.4.36 Phyllanthus beillei Hutch...................................................... 16 1.1.4.37 Phyllanthus indofischeri Bennet........................................... 16 1.1.4.38 Phyllanthus scabrifolius Hook............................................. 16 1.1.4.39 Phyllanthus gradyi................................................................ 16 1.1.4.40 Phyllanthus longipedicellatus.............................................. 17 1.1.4.41 Phyllanthus salesiae............................................................. 18 1.1.4.42 Phyllanthus gongyloides....................................................... 18 1.1.4.43 Phyllanthus indicus Muell.................................................... 19 1.1.4.44 Phyllanthus gunnii Hook. F. (Synonym: Phyllanthus gasstroemii Muell. Arg.)....................................................... 19 1.1.4.45 Phyllanthus lacunarius F. Muell.......................................... 19 1.1.4.46 Phyllanthus carpentariae Muell. Arg. (Synonyms: Phyllanthus hebecarpus Benth., Phyllanthus grandisepalus F. Muell.).......................................................20 1.1.4.47 Phyllanthus fuernrohrii F. Muell..........................................20 1.1.4.48 Phyllanthus hirtellus F. Muell. Ex Muell. Arg.....................20 1.1.4.49 Phyllanthus subcrenulatus F. Muell..................................... 21 1.1.4.50 Phyllanthus similis Muell. Arg............................................. 21 Acknowledgments..................................................................................................... 21 References................................................................................................................. 21 1.2 Identification Manual for Some Species of the Genus Phyllanthus L. of Phyllanthaceae with Special Reference to the Indian Subcontinent............... 23 1.2.1 Introduction......................................................................................... 23 1.2.1.1 The Scientific Classification................................................. 23 1.2.2 The Main Characters of the Genus...................................................... 23 1.2.3 Synoptic Key........................................................................................24 1.2.3.1 Herbs.....................................................................................24 1.2.3.2 Shrubs or Trees.....................................................................25 1.2.4 Descriptions.........................................................................................25 1.2.4.1 Phyllanthus acidus L............................................................25 1.2.4.2 Phyllanthus amarus Schumach & Thonn.............................25 1.2.4.3 Phyllanthus debilis Klein ex Willd. . ................................... 27 1.2.4.4 Phyllanthus emblica L..........................................................28 1.2.4.5 Phyllanthus fraternus G. L. Webster....................................28 1.2.4.6 Phyllanthus gardnerianus (Wt.) Baill.................................. 29 1.2.4.7 Phyllanthus indo-fischeri Gamble........................................ 29 1.2.4.8 Phyllanthus maderaspatensis L........................................... 30

Taxonomy of the Genus Phyllanthus and Identification Manual

3

1.2.4.9 Phyllanthus niruri L............................................................. 31 1.2.4.10 Phyllanthus pinnatus (Wight) G. L. Webster....................... 31 1.2.4.11 Phyllanthus polyphyllus Willd............................................. 32 1.2.4.12 Phyllanthus reticulatus Poir................................................. 32 1.2.4.13 Phyllanthus rheedii Wight.................................................... 33 1.2.4.14 Phyllanthus rotundifolius Klein ex Willd............................ 33 1.2.4.15 Phyllanthus urinaria L.........................................................34 1.2.4.16 Phyllanthus virgatus G. Forst...............................................34 Acknowledgment...................................................................................................... 35 References................................................................................................................. 35

1.1  TAXONOMY OF THE GENUS PHYLLANTHUS 1.1.1  Introduction The genus Phyllanthus belongs to the family Phyllanthaceae. The number of species varies widely, from 750 to 1,200. It has a remarkable diversity, including annual and perennial herbs, shrubs, climbers, floating aquatics, and succulents. It has a wide variety of floral morphologies and a wide range of pollen types. Almost all Phyllanthus species express a specific type of growth called phyllanthoid branching, in which vertical stems bear deciduous, flower-bearing horizontal or oblique stems. It is distributed mainly in tropical and subtropical regions. Leaf flower is the common name for all Phyllanthus species. The name Phyllanthaceae was first validly published by Ivan Ivanovich in 1820 in a Russian book titled Tekhno-botanico Slovar. A proposal to conserve this name was published in 2007 (Reveal et al., 2007). Euphorbiaceae is now defined as a much smaller family than it had been in the twentieth century (Tokuoka, 2007). Pandaceae, Phyllanthaceae, Picrodendraceae, Putranjivaceae, Peraceae, and Centroplaceae have been removed. The obsolete, older concept of Euphorbiaceae, known as Euphorbiaceae sensu lato, is sometimes still used for continuity and convenience.

1.1.2  Botanical System of Classification 1.1.2.1  Natural System of Classification George Bentham and Sir Joseph Dalton Hooker have taken De Candolle’s and Lindley’s views regarding the basic categories and principles. The description of plants is original and is based on personal observations. Bentham made one of the most valuable contributions, the Genera Plantarum, listing 97,205 specimens. According to Bentham and Hooker, the systematic position of Phyllanthus is as follows. Class: Dicotyledonae; subclass: Monochlamydeae; series: Unisexuales; family: Euphorbiaceae; genus: Phyllanthus

4

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

1.1.2.2  APG II System A modern system of plant taxonomy, the APG II system of plant classification was published in April 2003 by the Angiosperm Phylogeny Group (APG). The APG II system recognized 45 orders, 5 more than the APG system. It also recognized 457 families, 5 fewer than the APG system. Thirty-five of the APG II families were not placed in any order. The APG III system is a modern system of plant taxonomy for flowering plant classification. It was published in 2009 by the Angiosperm Phylogeny Group. In October 2009, members of the Linnaean Society proposed an accompanying forma phylogenetic classification of all land plants, compatible with the APG III system of classification (Chase & Reveal, 2009). Domain: Eukaryota; regnum: Plantae; clade: Angiospermae; clade: Eudicots; clade: Core eudicots; clade: rosids; clade: eurosidsI; order: Malpigiales; family: Phyllanthaceae; genus: Phyllanthus

1.1.3  General Characters of Genus Phyllanthus Habit: Herbs or shrubs Leaves: Small, alternate, distichous, the branchlets resembling pinnate leaves, stipules narrow Flowers: Very small, monoecious, in axillary clusters or solitary, bracteate, disk in male flowers of small glands and in female flowers of glands or annular Calyx: Lobes 5–6, imbricate Petals: 0 Stamens: 3, more or less free or the filaments combined in a column, anthers oblong, didynamous, dehiscing vertically or transversely Ovary: 3 celled, styles 3, free or connate at base Fruit: A capsule with crustaceous or thin 2-valved cocci Seeds: Trigonous, rounded at back

1.1.4  General Characters of Phyllanthus Species The number of species in this genus varies widely, from 750 to 1,200. Various species of this genus and its characters are listed in the next sections. 1.1.4.1  Phyllanthus Amarus Schum. & Thonn. Common name: Phyllanthus, carry me seed Phyllanthus Amarus Schum. & Thonn. is a herb and is seen in moist deciduous, forest plantations and in plains. It is distributed mainly in the tropics. It is a weed of gardens and cultivated land. It is seen in all districts of Kerala. It is a branching annual herb reaching 12–18 inches high (Figure 1.1a). Flowering and fruiting of this plant will be in July–October. It is often used in native medicine (Gamble, 1925).

Taxonomy of the Genus Phyllanthus and Identification Manual

5

Leaves: Membranous; usually glaucous beneath; usually broadly obtuse at apex; very variable in size, but usually under 0.5 inches long; elliptic-obovate or oblong; prominently distichous so that the branchlets resemble pinnate leaves; stipules not peltate, lanceolate and oblong, 1 mm, subsessile, scarious. Flowers: Monoecious, male and female flowers occur solitarily or in clusters of 2 or 3 in axils of lower leaves of a branch, bracteate, subsessile, actinomorphic, hypogynous, cyclic, minute, green. Tepals: 5; ovate, valvate; a glandular disk is present within the perianth; each lobe has a distinct green midrib. Stamens: 5, exerted, monadelphous, filaments connate in a column with three bithecous anther lobe borne at its tip, anthers sessile, introse, dehiscing by slits. Carpel: 3, syncarpous, ovary superior, trilocular, each loculus with two ovules, placentation axile, ovary globular. Styles: 3, short, not dilated, bilobed, at maturity ovary becomes hexalocular. Fruit: Capsule dry, dehiscent, more or less verrucose, and glandular. Seeds: Regular lines of very minute tubercles joined by minute crossbars, muriculate, triquetrous. 1.1.4.2  Phyllanthus emblica L. (Emblica officinalis Gaertner) Common name: Indian Gooseberry Phyllanthus emblica L. (Emblica officinalis Gaertner) is a tree. It is seen in dry and moist deciduous and cultivated in plains. It is distributed throughout the tropics and is seen in all districts of Kerala. Flowering and fruiting of this plants will be in February–May (Gamble, 1925). Leaves: Small, distichous, linear, obtuse, appearing like pinnate, stipules ovate, acute. Flowers: Greenish yellow, in axillary fascicles on leaf-bearing branches, often on the naked portion below the leaves, with fimbricate bracts at base. Male flowers many on short slender pedicels and disk with glands. Female flowers few, subsessile, disk cup-like. Tepals: 6, valvate, oblong in male flowers. Stamens: 3 on a short central column in male flowers, anthers connate, dehiscence vertical. Ovary: 3, carpellate, 1.5 mm. Styles: 3, bifid, erect, broadly fimbriate. Fruit: Drupe, fleshy, globose with 6, indehiscent, more than 1.5 cm across, obscure vertical furrows. Seed: Pale yellow of 3 two-seeded crustaceous cocci (Figure 1.1c). 1.1.4.3  Phyllanthus acidus L. Common name: Star gooseberry, Tahitian gooseberry tree Phyllanthus acidus L. is a tree. It was considered a native of Brazil. It is cultivated in all districts of Kerala, is monoecious and semievergreen, and fruits are juicy (Gamble, 1925).

6

Phyllanthus Species: Scientific Evaluation and Medicinal Applications a

b

FIGURE 1.1  Floral characters of different species of Phyllanthus. (a) P. amarus: 1, roots; 2, twig; 3, flower; 4, androecium; 5, perianth; 6, pistil entire; 7, pistil L.S; 8, ovary T.S; 9, branchlet with fruits. (b) P. niruri: A, twig; B, male flower; C, female flower; D, ovary c.s; E, male floral diagram; F, female floral diagram. (Figure 1.1a is adapted from Mathew 1982, 1988a,b, and Figure 1.1b from Sukla and Misra, 1997.) (continued)

Leaves: Elliptic to obovate, base rounded, margin entire, apex acute or acuminate, and petiole to 0.4 cm, stipules toothed. Flowers: Pedicel to 5 mm, inflorescence an axillary fascicle, disk without an inner corona in female flowers. Tepals: 4, unequal 2 + 2, ovate, 2 mm, 1 nerved, subacute. Stamens: 4, exerted, free, stamens not inserted in disk, filaments recurved, anthers oblong, dehiscence vertical. Ovary: 2 or 3 locular, subglobose. Styles: 3 or 4, reflexed, forked into subacute arms, not dilated, ovules 2 per locule. Fruits: Drupe, indehiscent, juicy, 1 cm across, 6–8 lobed, angular, fruits notably enlarged, endocarp hard. 1.1.4.4  Phyllanthus niruri Common name: Stonebreaker Phyllanthus niruri is an annual herb. It is a widespread tropical plant commonly found in coastal areas. The root is a branched taproot, the stem is erect, cylindrical, branched, solid, and glabrous (Gamble, 1925). Leaves: Stipulate, lanceolate and oblong, subsessile, alternate, entire, apex rounded, glaucous ventrally. Flowers: Monoecious, male flowers occur solitary or in clusters of 2 or 3 in axils of lower leaves of a branch, bracteate, subsessile, actinomorphic, hypogynous, cyclic, minute, green. Tepals: 6, in two whorls of 3 each,

Taxonomy of the Genus Phyllanthus and Identification Manual a

7

b

c. P.emblica: 1. Twig; 2. Fruit; 3. Male flower; 4. Perianth; 5.Bract; 6−8.Anthers; 9.Androecium; 10 Female flowers; 11. Ovary T.S; 12. Ovary L. S. d. P. deblis: 1. Twig; 2. Male flower; 3. Female flower; 4. Stamens; 5&6. Anther; 7. Pistil; 8. Ovary T. S; 9. Ovary L. S; 10. Capsule.

FIGURE 1.1  (continued) Floral characters of different species of Phyllanthus. (c) P. emblica: 1, twig; 2, fruit; 3, male flower; 4, perianth; 5, bract; 6–8, anthers; 9, androecium; 10, female flowers; 11, ovary T.S; 12, ovary L. S. (d) P. deblis: 1, twig; 2, male flower; 3, female flower; 4, stamens; 5 and 6, anther; 7, pistil; 8,ovary T. S; 9, ovary L. S; 10, capsule. (Adapted from Mathew 1982, 1988a,b.)

e

f

e. P.polyphyllus: 1. Twig; 2. Pistil; 3. Flower; 4. Ovary L. S; 5. Ovary T.S; 6. Male flower; 7. Stamens; 8. Seed. f. P.urinaria: 1. Habit; 2. Leaf; 3. Male flower; 4. Stamens; 5. Female flower; 6. Pistil entire; 7. Pistil T.S; 8. Pistil L. S; 9. Capsule; 10. Seed.

FIGURE 1.1  (continued) Floral characters of different species of Phyllanthus. (e) P. polyphyllus: 1, twig; 2, pistil; 3, flower; 4, ovary L. S; 5, ovary T. S; 6, male flower; 7, stamens; 8, seed. (f) P. urinaria: 1, habit; 2, leaf; 3, male flower; 4, stamens; 5, female flower; 6, pistil entire; 7, pistil T.S; 8, pistil L. S; 9, capsule; 10, seed. (Adapted from Mathew 1982, 1988a,b.)

8

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

valvate, a glandular disk is present within the perianth, each lobe has a distinct green midrib. Stamens: 3, exerted, monadelphous, filaments connate in a column with three bithecous anther lobes borne at its tip, anthers sessile, introse, dehiscing by slits. Female flowers occur singly in the axils of upper leaves of a branch, rarely in clusters, bracteolate, subsessile, actinomorphic, hypogynous, small, and green. Perianth: 3 + 3, free, a glandular disk is present internal to the base of perianth lobes, persistent with a distinct green midrib. Carpels: 3, syncarpous, ovary superior, trilocular, each loculus with two ovules, placentation axile, ovary globular. Styles: 3, short, not dilated, bilobed, at maturity ovary becomes hexalocular. Fruit: Depressed and globose capsule. Seeds: Endospermic and trigonous. This species is often confused with P. amarus. Phyllanthus amarus has 5 perianth lobes, while P. niruri has 6. Phyllanthus amarus has 3 stamens while P. niruri has 6 (Figure 1.1b). 1.1.4.5  Phyllanthus urinaria L. Common name: Chamberbitter Phyllanthus urinaria L. is an annual or perennial erect herb with more or less sensitive leaflets that are sometimes pink when young. It is seen in all districts of plains and deciduous forests. It is a native of tropical East Asia. Now, it is regarded as a weed. In Kerala, it is noted in all districts. Flowering and fruiting of this plant will be in July–October. Although of Asian origin, the weed is widely found in all tropical regions of the world. In the United States, it is found in southern states such as Florida, Georgia, Alabama, South Carolina, New Mexico, and Texas (Gamble, 1925). Leaves: Glabrous or hispid on the margins, chartaceous, oblong, apiculate, up to 0.75 inches long, stipules subulate. Flowers: Male flowers very minute, female flowers larger, sessile, disk annular. Tepals: 6. Stamens: 3, anthers sessile, connate, dehiscence vertical, styles spreading, not fimbriate. Fruit: Capsules 3 valved, verrucose, dry, dehiscent, less than 0.5 cm across. Seeds: Prominently transversely ridged and with faint crossbars (Figure 1.1f). 1.1.4.6  Phyllanthus polyphyllus Willd Phyllanthus polyphyllus Willd is a shrub or small tree somewhat resembling Emblica officinalis in leaf but quite different in fruit. It is seen in rocky areas in semievergreen forests. It grows in Deccan; hill forests of Kurnool, Cuddapah, Chittoor, and Nellore; Kambakam Hill in Chingleput; Carnatic; Javadi Hills in South Arcot; southern hills of Tinnevelly, up to 4,000 feet; and eastern slopes of Nilgiris. It is distributed in India and Sri Lanka. In Kerala, it is seen only in Kollam district. Flowering and fruiting of this plant will be in February–June (Gamble, 1925).

Taxonomy of the Genus Phyllanthus and Identification Manual

9

Leaves: Leaf branchlets 2–6 inches long; leaves oblong, obtuse, or apiculate; 0.4–0.75 inches long; main nerves 6–8 pairs. Flowers: Disk with glands in male flowers. Tepals: 6. Stamens: 3. Anthers: Erect, connate, the cells dehiscing vertically, the filaments united in a column, ovary 3 locular, styles spreading. Fruit: Capsule, dry, dehiscent, less than 0.5 cm across. Seed: Foveolate, seed pits very minute (Figure 1.1e). 1.1.4.7  Phyllanthus myrtifolius Willd Common name: Mousetail plant Phyllanthus myrtifoslius Willd is a shrub. It is a hedge plant grown in gardens. It is a native of Sri Lanka. It is seen in all districts of Kerala. 1.1.4.8  Phyllanthus kozhikodianus Phyllanthus kozhikodianus is a herb. It is seen in dry and moist deciduous, semievergreen, and forest plantations. It is distributed in Western Ghats and the eastern Himalayas. It is seen in Kozhikode, Malappuram, Idukki, Thrissur, and Palakkad districts of Kerala. Flowering and fruiting of this plant will be in July–October (Manilal and Sivarajan, 1982). 1.1.4.9  Phyllanthus reticulatus Poir. Phyllanthus reticulatus Poir. is a shrub 3 m high; it is seen in stream banks, lakeshores, and moist deciduous and semievergreen forests. It is seen in all districts of Kerala, savanna forest, and often on riverbanks, throughout the region from Senegal to northern and southern Nigeria; it is widespread elsewhere in tropical Africa. Flowering and fruiting of this plant will be in August–December (Mathew, 1982). Leaves: Oblong-elliptic, obtuse or acute, thin, glabrous, at both ends, leaf margin entire, distichous, petioles long and slender, stipules long, ovate, acute, bristle pointed. Flowers: Axillary, male flowers in fascicles, female is solitary. Tepals: 5 in male and female flowers, unequal, obovate, imbricate, obtuse, disk with glands in male flowers. Stamens: 5, connectives connate, outer free, anthers subsessile or raised by filaments, dehiscence vertical. Ovary: 5 or 12 locular, and ovules superposed, 2 per locule, styles as many as or fewer than locules. Disk glands 5. Fruits: Berry, fleshy, indehiscent, dark blue, fruits not glochidiate. Seeds: Trigonous, superposed, unitegmic, testa crustaceous. 1.1.4.10  Phyllanthus rheedii Wight. Phyllanthus rheedii Wight. is a slender, branching, erect herb or small undershrub. It is seen in Western Ghats, most districts from south Canara to Nilgiris, Annamalais, and the hills of Tinnevelly above 5,000 feet. It is distributed in India and Sri Lanka. In

10

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

Kerala, it is seen in Kannur, Palakkad, Idukki, Kottayam, Pathanamthitta, and Kollam. Flowering and fruiting of this plant will be in November–January (Gamble, 1925). Leaves: glabrous, membranous, elliptic or ovate, acute up to 1.25 inches long, stipules lanceolate, decurrent. Flower: Male flowers minute, fascicled; female flowers solitary, on thickened pedicels. Calyx: Calyx lobes usually white margined. Stamen: Anthers free above. Fruit: Capsules smooth. Seeds: With concentric lines of minute tubercles and minute crossbars. 1.1.4.11  Phyllanthus tenellus Roxb. Common name: Mascarene Island leaf-flower Phyllanthus tenellus Roxb. is a herb and is seen in waste places for discarded materials and plantations. It is reported in Australia. In Kerala, it is seen in Malappuram, Alappuzha, and Thiruvananthapuram. Flowering and fruiting of this plant will be in June–December. Leaves: Elliptic to obovate, 6–25 mm long, 2–10 mm wide, margins flat, wavy, lower surface paler. Flowers: Solitary or 2 or 3 males and 1 or 2 females together, peduncle to 5 mm long, perianth segments narrow-ovate, about 1 mm long, margins broad, white, not enlarging under fruit. Stamens: 5, filaments free. Fruit: Capsule 1.5–2 mm diameter, greenish; seeds about 1 mm long, orangebrown, dorsally minutely tuberculate in longitudinal rows. 1.1.4.12  Phyllanthus lawii Grah. Phyllanthus lawii Grah. was reported in Northern Circars, in Godavari and Hrishna, Carnatic hills of Salem, Western Ghats, Wynaad to Travancore, gregarious on the banks and in the beds of rocky rivers. It is a straggling shrub with long purplish branches armed with stipular tubercles bearing small thorns (Gamble, 1925). Leaf: Leaf branchlets 1–3 inches long or a little more, leaves elliptic-oblong, obtuse or apiculate, 0.2–0.3 inches long, main nerves obscure. Flowers: Axillary, males solitary or a few together, female solitary, white. Stamen: 3, anthers erect, the cells dehiscing vertically, the filaments united in a column. Ovary: styles 3, short, bifid, short lobes recurved. Fruit: Capsule. Seed: Foveolate, seed-pits very minute. 1.1.4.13  Phyllanthus maderaspatensis L. Phyllanthus maderaspatensis L. is seen in northern Circars, Deccan, and Carnatic on dry lands, especially black cotton soils and near the seacoast. It is an erect or decumbent herb or small undershrub (Gamble, 1925).

Taxonomy of the Genus Phyllanthus and Identification Manual

11

Leaves: Linear, to obovate, glabrous, subcoriaceous, obovate or oblanceolate, cuneate, rounded or retuse at apex, mucronate, glaucous, up to 1.25 inches long, stipules lanceolate, peltate with white margins. Flower: Male flowers above, minute, fascicled, disk with glands; female flowers solitary, on filiform pedicels, bracts 2, acute, disk 6 lobed. Tepals: 6, obovate, margin scarious, obtuse. Stamen: 3, anthers subsessile, filaments connate, dehiscence vertical, styles spreading, not fimbricate. Ovary: 3 lobed, styles horizontally spreading, stigma obtuse. Fruit: Capsules dry, dehiscent, less than 0.5 cm across, smooth, the seeds with concentric lines of minute tubercles and minute crossbars. Seeds: Triquetrous, vertically muriculate. Capsule: With longitudinal rows of minute tubercles. 1.1.4.14  Phyllanthus narayanswamii Phyllanthus narayanswamii is seen in northern Circars, Rampa Hills of Godavari at 4,500 feet. It is a small, wiry undershrub with many branchlets from a stout rootstock (Gamble, 1925). Leaves: Elliptic, obtuse, apiculate, the margins thickened, the nerves 4–5 prominent, joining in arches, 0.2–0.4 inches long, 0.1–0.3 inches broad, stipules peltate, subsagittate. Flower: Male flowers subsessile, female flowers pedicelled, disk of male flowers are large flat glands and female flowers saucer shaped, thin and wavy. Stamen: Anthers subglobose, the cells dehiscing transversely or on a slant, filaments free. Ovary: Style lobes recurved, flattened on the ovary. Fruit: Capsule more or less verrucose, glandular. Seeds: Minutely tubercled. 1.1.4.15  Phyllanthus virgatus Forster F. (P. simplex Retz.) Phyllanthus virgatus Forster F. (P. simplex Retz.) grows in northern Circars and Carnatic from the Chilka Lake to Madras, Deccan, and North Coimbatore on hot dry soils up to 3,000 feet in a hilly area. It is a stiff, almost woody, herb with long flattened branches (Gamble, 1925). Leaves: Linear-oblong, obtuse or acute at apex, apiculate, the margins thickened, the nerves invisible, 0.5–0.75 inches long, 0.1–0.3 inches broad, stipules peltate, subsagittate. Flower: Male flowers few, minute, subsessile; female flowers more numerous on filiform pedicels; disks of male flowers are large flat glands and female flowers saucer shaped, thin and wavy. Tepals: 6, oblong, obtuse, mucronate. Stamen: 3, free, included, anthers subglobose, the cells dehiscing transversely or on a slant, filaments free. Ovary: Style lobes recurved, flattened on the ovary. Fruit: Capsule more or less verrucose, glandular. Seeds: Minutely tubercled.

12

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

1.1.4.16  Phyllanthus gardnerianus Baill. Phyllanthus gardnerianus Baill. is seen in Western Ghats, in all districts from south Canara to Tinnevelly, Nilgiris, Anamalai, and Pulneys. It is a slender shrub with woody rootstock and long branches and leaves smaller in size. Plants of dry hilltops were found to be dwarf with very small leaves (Gamble, 1925). Leaves: Upper branchlets elliptic, obtuse, about 0.3 inches long; lower stems elliptic-oblong up to 0.75 inches long, 0.4 inches broad; the nerves about 5 pairs, faint, glaucous apiculate, the margins thickened, the nerves 4–5 prominent, joining in arches, 0.2–0.4 inches long, 0.1–0.3 inches broad, stipules peltate, subsagittate. Flower: Male flowers subsessile, female flowers pedicelled, disks of male flowers are large flat glands and female flowers saucer shaped, thin and wavy. Stamen: Anthers subglobose, the cells dehiscing transversely or on a slant, filaments free. Ovary: Style lobes recurved, flattened on the ovary. Fruit: Capsule more or less verrucose, glandular. Seeds: Minutely tubercled. 1.1.4.17  Phyllanthus macraei Muell. Phyllanthus macraei Muell. is seen in Western Ghats, Sholas of the Pulney hills at 5,000–7,000 feet, Agastiamalai Peak, and Tinnevelly. It is a shrub, apparently reaching 2–3 feet in height with long, weak, flattened branchlets and capsules prominently warted when wet, leaf margins sometimes ciliate (Gamble, 1925). Leaves: Elliptic or elliptic-oblong, obtuse, up to 2 inches long, 1 inch broad, the nerves about 7 pairs, glaucous beneath, glabrous or hispid, stipules peltate, subsagittate. Flower: Male flowers fascicled, shortly pedicelled, female flowers long pedicelled, disks of male flowers are large flat glands and female flowers cushion shaped, thick. Stamen: Anthers subglobose, the cells dehiscing transversely or on a slant, filaments free. Ovary: Style lobes erect, spreading. Fruit: Capsule more or less verrucose. Seeds: Minutely tubercled. 1.1.4.18  Phyllanthus rotundifolius Klein Phyllanthus rotundifolius Klein is an annual herb, about 40 cm high, found across the West African Sahel, particularly in proximity to rivers, and extending to Northern Circars and Carnatic and sands on the seacoast. It is a prostrate or slightly ascending fleshy herb with stout rootstock and long trailing branches (Gamble, 1925). Leaves: Coriaceous or fleshy, orbicular or obvate, obtuse or apiculate, scarcely 0.25 inches in diameter, stipules not peltate, lanceolate. Flower: Male flowers subsessile, female flowers pedicelled, disks of male flowers of minute glands and female flowers cushion shaped, thin and wavy.

Taxonomy of the Genus Phyllanthus and Identification Manual

13

Stamen: Anthers subglobose, the cells dehiscing transversely or on a slant, filaments connate in a column. Ovary: Style arms recurved with short lobes. Fruit: Capsule more or less verrucose, glandular. Seeds: Regular lines of very minute tubercles joined by minute crossbars. 1.1.4.19  Phyllanthus debilis Klein ex Willd Phyllanthus debilis Klein ex Willd was reported from Northern Circars and Carnatic and west to the eastern slopes of the Ghats. It grows in shady places in the hill forests. It may be a herb or an undershrub. Leaves: Membraneous, usually glaucous beneath, acute, elliptic-ovate, sometimes rounded at apex, elliptic or obovate up to at most 0.75 inches long, stipules lanceolate, long acuminate. Flowers: Rather large, disks of male flowers of star-like glands and female flowers saucer shaped, crenulate or lobed, tepal 6, lobes with prominent scarious margins. Stamens: 3, anther free, slits transverse, filaments connate in a column, staminal column long. Ovary: style erect, shortly bifid. Fruit: Capsule, 3 valved. Seeds: Regular lines of very minute tubercles joined by minute crossbars (Figure 1.1d). 1.1.4.20  Phyllanthus missionis Phyllanthus missionis is seen in Western Ghats, on eastern slopes and Coimbatore to Tinnevelly at low levels. It is an erect undershrub with rather distant leaves (Gamble, 1925). Leaves: Membraneous, usually glaucous beneath, acute, sometimes rounded at apex, elliptic or obovate up to at most 0.75 inches long, stipules ovate, acute or acuminate, small. Flowers: Very small, disks of male flowers with peltate glands and female flowers cushion like, broadly lobed, tepal lobes with obscure scarious margins, anther reniform, filaments connate in a column, staminal column slender, style erect, with slender lobes. Seeds: Regular lines of very minute tubercles joined by minute crossbars. 1.1.4.21  Phyllanthus speciosus Jacq Phyllanthus speciosus Jacq is a shrub with flattened branches often found in gardens in the plains. 1.1.4.22  Phyllanthus pinnatus (Wight) Webster, J. Phyllanthus pinnatus (Wight) Webster, J. is a subshrub. Branchlets are glaucous (Mathew, 1982). Leaves: Elliptic to (sub)orbicular, base cuneate, apex acute, peiole to 0.4 cm.

14

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

Flowers: Male flowers numerous, female flowers fewer, long stalked, tepals 6, free, ovate, entire to fimbriate, (sub)acute. Stamens: 6, free, exerted, filaments filiform, anthers oblong, parallel, dehiscence vertical. Ovary: 3 lobed, styles 3, forked, horizontally appressed in fruit, disk 6, free in male flowers, connate in female flowers. Fruit: Capsule dry, depressed-globose, of 3, bivalved cocci. 1.1.4.23  Phyllanthus acuminates Common name: Jamaican gooseberry tree Phyllanthus acuminates is a herb. It is seen in Central America and South America. This plant is used by the local population as a piscicide. 1.1.4.24  Phyllanthus caroliniensis Phyllanthus caroliniensis is a flowering plant native to the Americas, from the southeastern United States all the way to Argentina. It may have medical uses, specifically in reducing pain. Flowers are small and axillary (Catapan et al., 2000). 1.1.4.25  Phyllanthus mirabilis Phyllanthus mirabilis is a plant species endemic to Thailand. It is the only Phyllanthus to be caudiciform. The leaves fold together at night. 1.1.4.26  Phyllanthus caesiifolius Phyllanthus caesiifolius is a species endemic to Cameroon. Its natural habitat is subtropical or tropical moist lowland forests. It is threatened by habitat loss. 1.1.4.27  Phyllanthus gentryi Phyllanthus gentryi is a species endemic to Panama. It is threatened by habitat loss. 1.1.4.28  Phyllanthus muellerianus (Kuntze) Exell Phyllanthus muellerianus (Kuntze) Exell is a native of Africa. 1.1.4.29  Phyllanthus pulcher Wall. Ex Müll. Arg. Common name: Tropical leaf flower Phyllanthus pulcher Wall. Ex Müll. Arg. is a native of Malaysia. Shrubs are 0.5–1.5 m tall, monoecious, stem and branches terete; branches to 40 cm, puberulent. Leaves are distichous, 15–30 pairs along each branchlet; stipules, membranous, abaxially gray-green, adaxially green, margins slightly revolute; inflorescence a bisexual axillary fascicle, usually with several male and 1 female flower. 1.1.4.30  Phyllanthus fraternus Webster Phyllanthus fraternus Webster. is an erect, herbaceous weed of roadsides, cultivated land, waste places of the forest and savanna, generally rare in Senegal, Ivory Coast,

Taxonomy of the Genus Phyllanthus and Identification Manual

15

Ghana, and Nigeria. It is widely distributed in Asia and in the West Indies. It is probably native to western India and Pakistan (Gamble, 1925). Leaves: Leaf blade oblong-elliptic, obtuse at apex, rounded or subcordate at base, stipules lanceolate, basally attached. Flower: Perianth lobes 5, filaments connate, anthers subglobose, dehiscing transversely. Seeds: Trigonous, minutely tubercled in regular concentric lines. 1.1.4.31  Phyllanthus abnormis Phyllanthus abnormis is a North American plant that contains an unidentified toxin that causes liver and kidney damage, manifested by compulsive walking, tenesmus, rectal prolapse, petechiation, and death. 1.1.4.32  Phyllanthus odontadenius Mull. Arg. Phyllanthus odontadenius Mull. Arg. is a subwoody herb to 1 m high, a common weed of the forested area from Guinea-Bissau to West Cameroons and Fernando Po and to Sudan and Angola. The way in which the flowers and fruits are borne on the underside of the leaves gives rise to the Ghanaian names likening the plant to a child carried pickaback. The leaves are chewed with guinea grains in Ghana to cure cough. The Ijo of the Niger Delta have a superstitious use of the plant to drive away bad spirits: A person who suffers fever every evening that is attributed to the spirit of a dead person should urinate on the plant, pick the leaves for addition to a bath with local soap, and be relieved of the spirits (Burkill, 1985). 1.1.4.33  Phyllanthus muellerianus (O Ktze) Exell Phyllanthus muellerianus (O Ktze) Exell is a shrub or climber, occasionally arborescent, deciduous, in secondary forests from Guinea-Bissau, Mali to West Cameroons, Fernando Po, and widespread in other areas of tropical Africa. The stem seldom becomes large. In Bendel State of Nigeria, it is reported as a weed of rice fields, plainly by lack of timely cultivation. In Kenya, it is said to yield excellent firewood (Burkill, 1985). 1.1.4.34  Phyllanthus capillaris Schum. & Thonn. Phyllanthus capillaris Schum. & Thonn. is a shrub, 1.70 m high, and is widespread from Guinea to West Cameroon, Fernando Po, and widespread elsewhere in tropical Africa. No usage is recorded for the West African region. In Kenya, a decoction of the whole plant is taken as a remedy for vomiting, and crushed roots are eaten for stomachache (Burkill, 1985). 1.1.4.35  Phyllanthus sublanatus Schum. & Thonn. Phyllanthus sublanatus Schum. & Thonn. is a semiwoody herb that grows to 50 cm high and is widespread from Mali to South Nigeria. It is a weed of cultivation and is found in Sierra Leone invading cultivated swampland (Burkill, 1985).

16

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

1.1.4.36  Phyllanthus beillei Hutch. Phyllanthus beillei Hutch. is a shrub that grows to 3 m tall, of foothill savanna in a few localities from Senegal to South Nigeria and the Cameroon Republic and East Africa. No use is recorded within the region. The root is reportedly used in Tanganyika as an aphrodisiac (Burkill, 1985). 1.1.4.37  Phyllanthus indofischeri Bennet. Phyllanthus indofischeri Bennet. is a tree; its young branchlets are white tomentose, and it grows in peninsular India (Gamble, 1925). Leaves: Obtuse, rounded, or subcordate at the base, less than 50 per branchlet, oblong or elliptic. Flowers: Usually dioecious, disk of six small glands. 1.1.4.38  Phyllanthus scabrifolius Hook. Phyllanthus scabrifolius Hook. is an annual leafy herb; its stem is erect, branched from the base and upward, and branches are angular. Leaves: Broadly elliptic or obovate at the apex, pale when dry, scaberulous beneath and with undulate margins, main nerves 4–5 pairs, distinct on both surfaces, petioles minute, stipules lanceolate, subulate, membranous. Flowers: Very shortly pedicellate, sepals oblong or obovate-oblong, with white scarious margins, female flowers long, male flowers short, filaments short, united to the middle, the apex recurved, anther cells at length confluent. Styles: 3, distinct, long, bifid, the lobes recurved. Disk of male flowers is rounded, female a low crenate cup. Fruit: Capsule, depressed globose, smooth or slightly granulate. Seeds: Long, broad, trigonous, rounded, with 7–9 parallel ribs on the back and concentric ribs on the faces. 1.1.4.39  Phyllanthus gradyi The Phyllanthus gradyi species appears to be restricted to humid forests in northeastern Brazil. It has been found in the states of Pernambuco and Alagoas, as well as in montane forests. As a tree, it is monoecious, with stem densely branched, the branching nonphyllanthoid, and branches cylindrical, gray, densely tomentose on young parts; trichomes are rust colored (Silva and Sales, 2006). Leaves: Stipules 2–2.8 mm long, lanceolate, acuminate, rigid, densely tomentose on external face, glabrous on internal face, midvein evident, and margin ciliate, green to vinaceous. Petiole 1.3–2.1 mm long, cylindrical, hirsute, leaf blade 3.5–11 and 1.5–4.5 cm, firmly chartaceous, elliptic to widely elliptic, base obtuse, apex acuminate and mucronate, margin entire, adaxial surface dark green, abaxial surface light green to brown when young, hirsute at base in midvein, brochidodromous, principal and secondary veins prominent only in the abaxial surface.

Taxonomy of the Genus Phyllanthus and Identification Manual

17

Flower: Fascicles axillary, 6 to 13 staminate and 2 to 3 pistillate flowers, bracts 6 to 9 per fascicle, 1.2–2 and 0.5–0.6 mm, widely triangular, external pubescent. Staminate flowers with pedicel 0.7–1.3 cm long, filiform, glabrous, greenish, sepals 4, ovate, obtuse-rounded at the tip, yellowish, midvein evident; disk glandular, cupuliform, fleshy, margin tetragonal; stamens 2, free, facing each other, filaments thickened, anthers with enlarged connective, dehiscing horizontally; pistillate flowers with pedicel 1.2–3.1 cm long, filiform, vinaceous to whitish near receptacle; sepals 6, oblong to lanceolate, apex obtuse to rounded, midvein evident, yellow-green to light green; disk glandular, upuliform, fleshy, margin irregularly lobed; ovary 1.1–1.2 and 2.5–2.6 mm, oblong; styles 3, free, bifurcate, recurved, stigmas acute. Fruit: Capsule 2.5–2.6 and 5–5.2 mm, spheroid, styles persistent, fruiting pedicel 2.2–2.8 mm, long, glabrous to glabrescent. Seeds: 3–3.1 and 2.5–2.8 mm, trigonous, areolate. 1.1.4.40  Phyllanthus longipedicellatus Phyllanthus longipedicellatus is known only from the type collection, from southern Bahia State in Brazil. It grows in the coastal rain forest in shaded, humid areas on clay soils covered by leaf litter. The plant is monopodial, a shrublet, 30 cm high, with stems erect, terete, papillose in the young parts with blackish trichomes; branching is phyllanthoid; cataphylls and cataphyllary stipules are 0.8–1 and 0.5–0.7 mm, triangular, not auriculate, escariose, glabrous, margins hyaline, plagiotropic branchlets 6–14 cm with 30 to 57 leaves, axis about 0.2 mm wide, slightly flattened and with dark papillae (Silva, 2009). Leaves: Subsessile, stipules 1–1.1 mm, lanceolate, acuminate, escarious, glabrous on both surfaces, petiole, 1 mm, leaf blades 5–6 and 2.9–3.9 mm, oblong-falcate to falcate-asymmetrical, obtuse-mucronulate, oblique at base, margins obscurely serrulate, membranaceous, adaxial surface dark green, abaxial surface light grayish green, dull, glabrous, venation, brochidodromous, midvein slightly prominent abaxially, secondary veins impressed abaxially. Flower: Staminate flowers 2 or 3 in cymules at proximal axils, pistillate flowers solitary at distal axils, staminate pedicel 9–9.2 mm, capillary, finely papillose; sepals 5, 2.1–2.2 and 1.4–1.5 mm, obovate, rounded, membranaceous, 1 nerved, disk segments 5, alternisepalous, obtriangulate and finely papillose; stamens 3, filaments free, 2.4–2.5 mm, anthers 0.2 mm, connective not enlarged, thecae not deeply emarginate, dehiscing horizontally, pistillate pedicel 10–10.2 mm, capillary, finely papillose, sepals 5, 2.9–3 and 2–2.1 mm, widely elliptic, acute, membranaceous, venation pinnate; disk patelliform, margins finely undulate, ovary 0.8–0.9 and 0.9–0.91 mm, style branches 1.2–1.3 mm, free, bipartite, tips obtuse. Fruits and seeds are unknown.

18

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

1.1.4.41  Phyllanthus salesiae Phyllanthus salesiae is known only from the araucaria forest in Minas Gerais State, Brazil, growing at an altitude of 1525 m at Pico do Itaguaré, with riparian vegetation in clay soils. It is a shrublet, 30 cm high, and is dioecious; stems are erect, sparsely to densely ramified, papillose, branching, nonphyllanthoid with lateral branches, persistent and distichous. Branchlets are terete to slightly flattened, papillose, with cataphylls and cataphyllary stipules lacking (Silva, 2009). Leaves: Stipules 2–2.1 mm, triangular, acuminate, auriculate at base, lacerate margins, escarious, glabrous on both faces, reddish, petioles 1.9–2 mm, cylindrical, greenish, papillose, leaf blades 1.9–4.3 and 0.9–1.9 cm, elliptic, acute, obtuse at base, margins minutely papillose, membranaceous, adaxial surface dark green, abaxial surface opaque, grayish green with papillae concentrated around the midvein, venation brochidodromous, midvein slightly prominent and secondary veins impressed abaxially. Flower: Pistillate cymules with 1 or 2 flowers, bracteoles 1 mm, triangular, acuminate, margins slightly serrulate, pedicels 1.7–1.8 mm, terete, visibly articulate; sepals 5, 1.1– 1.2 mm, widely elliptic to obovate, acute to obtuse, pinnate venation with whitish margins, disk deeply 5-segmented, margins slightly undulate; ovary 0.4–0.5 and 0.5–0.6 mm, depressed ovate, smooth; styles 3, incurved, bifid, stigma subcapitate. Fruit: Capsule 2–2.1 and 3.1–3.2 mm, depressed globose, light brown when dry, glabrous, dehiscing loculicidally and septifragally, calyx and style persistent in fruit. Seeds: 1.8–1.9 and 1.1–1.2 mm, trigonous, brownish, longitudinally, finely dark punctate. 1.1.4.42  Phyllanthus gongyloides Phyllanthus gongyloides is a subshrub; it is dioecious, glabrous, 40–50 cm high; stems are persistent, sparsely branching, with branchlets that are terete to slightly flattened, smooth (Cordeiro and Carneiro-Torres, 2004). Leaves: Oval to orbicular blades, subcoriaceous, rounded at apex, mucronulate, rounded at base, glabrous, 7–12 mm long, 6–11 mm broad; lateral veins 4–6 per side, arching, obscure adaxially, prominulous abaxially, petiole 1–1.5 mm long; stipules widely deltate, acute, glandulose, reddish, glabrous, 1 mm long. Flower: Inflorescence axillary, bracts deltate, 1 mm long, staminate cymules with 2–4 flowers, pedicel 1.5–2.5 mm long; sepals 6, widely elliptic, obtuse, 3 mm, long, disk segments 6, obconics; stamens 3, filaments, completely connate into a column, tecae distinct, divergent, dehiscing horizontally; pollen grains prolate, 4 colporate, sexine reticulate; pistillate cymules with 2–3 flowers, pedicel 3–4 mm long; sepals 6, widely elliptic, obtuse, 2 mm long; disk segments 6, obconics; ovary glabrous, globose, styles spreading, bifid, branches acute. Fruit: Capsule 2.5 mm long.

Taxonomy of the Genus Phyllanthus and Identification Manual

19

Seeds: Trigonous, brownish, 1.5 mm long, with longitudinally finely puncticulate striae. 1.1.4.43  Phyllanthus indicus Muell. Phyllanthus indicus Muell. is a very branched deciduous tree that is 30–40 feet high; the bark is white, scaly, smooth, and exfoliating in plates. Leaves: Membranous, distichous, elliptic or elliptic-lanceolate, obtuse, acute or acuminate, apiculate, glabrous, glaucous beneath, base acute, deciduous. Flowers: Dioecious, pedicellate, pale-green, males in fascicles, in the axils and on the branches on capillary pedicels, long, female flowers larger, umbellate cluster, stout pedicel, tepal 4, rarely 5, oblong, obtuse, two out larger, in male flowers stamens 4, filaments free, anthers oblong, adnate, extrose, dehiscing longitudinally, disk annular, fleshy, large, rudimentary ovary, in female flowers stamens absent, disk small, narrow, ovary 3 celled, ovules 2 in each cell, styles very short, deeply bifid, the lobes recurved. Fruit: Capsule, globose, reticulately rugose, cocci bivalved, two seeded. Seeds: Trigonous, blue, surrounded by an aril. 1.1.4.44 Phyllanthus gunnii Hook. F. (Synonym: Phyllanthus gasstroemii Muell. Arg.) Common name: Scrubby spurge Phyllanthus gunnii Hook. F. (synonym: Phyllanthus gasstroemii Muell. Arg.) is an erect shrub to 2 m high; it is glabrous and grows in dry sclerophyll forest on rocky slopes and along riverbanks and frequently on sandstone in Australia (James and Harden, 2010). Leaves: Lamina broad-ovate to circular, sometimes obovate-oblong, mostly 10–20 mm long and 8–12 mm wide, apex notched. Flower: Male flowers in clusters of 3–7 on peduncles 1–4 mm long, female flowers solitary on peduncles lengthening to 8 mm in fruit, perianth segments ovate, 1.5–2 mm long, margins whitish, stamens 3, filaments free, slender, glands prominent, ovary glabrous, styles mostly linear, entire. Fruit: Capsule, 4 mm diameter, often reddish brown; seeds with irregular, longitudinal ridges. 1.1.4.45  Phyllanthus lacunarius F. Muell. Phyllanthus lacunarius F. Muell. is an annual herb with prostrate to ascending stems to 25 cm long and glaucous. Leaves: Obovate to cuneate, 4–20 mm long, 1–7 mm wide; stipules subulate, 1–1.5 mm long, whitish (James and Harden, 1999). Flowers: Clustered with 1 female and 2 or 3 males on peduncles to 1 mm long, lengthening to 2.5 mm in fruit, perianth segments narrow, reddish

20

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

with white margins, 1 mm long in fruit, often reflexed, stamens 3, filaments free. Fruit: Capsule 3–4 mm diameter. Seeds: 1.5–2 mm long, finely longitudinally striate, brown. 1.1.4.46 Phyllanthus carpentariae Muell. Arg. (Synonyms: Phyllanthus hebecarpus Benth., Phyllanthus grandisepalus F. Muell.) Phyllanthus carpentariae Muell. Arg. (synonyms: Phyllanthus hebecarpus Benth., Phyllanthus grandisepalus F. Muell.) is a procumbent to erect shrub that grows to 1 m high; it is tomentose or villous and is reported in Australia (James and Harden, 1999). Leaves: Oblong to obovate, mostly 10–25 mm long, 5–10 mm wide, apex obtuse. Flowers: Solitary or 1 male and 1 female together on peduncles to 1.5 mm long, lengthening to 5 mm in fruit, in male flowers perianth segments narrow, 1.5 mm long, female segments broader, herbaceous, with a narrow white margin, 5 mm long in fruit, stamens 3, filaments free, glands large, styles divided to the middle. Fruit: Capsule 5 mm diameter. Seeds: 2 mm long, may or may not be smooth with fine, horizontal striations and obscure, longitudinal bands. 1.1.4.47  Phyllanthus fuernrohrii F. Muell. Phyllanthus fuernrohrii F. Muell. is a many-stemmed subshrub that grows to 40 cm high and is hoary-tomentose. Leaves: Broad-obovate or obovate to oblong, 8–29 mm long, 3–10 mm wide, apex obtuse, minutely mucronate, very shortly petiolate (James and Harden, 1999). Flower: Male flowers 1 or 2 together on peduncles 2–3 mm long, female flowers on slender peduncles 4–9 mm long, solitary or with male flowers, perianth segments 1–1.5 mm long, pubescent with scarious margins, female segments 2 mm long, extending to 3–4 mm in fruit, stamens 3, filaments free, ovary pubescent, styles 3, divided to midway. Fruit: Capsule 3–5 mm wide. Seeds: 1.5 mm long, smooth. 1.1.4.48  Phyllanthus hirtellus F. Muell. Ex Muell. Arg. Phyllanthus hirtellus F. Muell. Ex Muell. Arg. is common in heath and dry sclerophyll forest of Australia (James and Harden, 1999). Leaves: Broad-obovate to narrow-oblanceolate, 2–8 mm long, apex obtuse, mucronate, truncate or emarginate, margins may or may not be flat, recurved or revolute, midrib prominent below; may or may not be sessile. Flower: Male flowers 2 or 3 together, female flowers solitary, peduncles to 2 mm long, perianth segments ovate, 1.5–2 mm long, stamens 3, filaments free, ovary pubescent; styles deeply bifid.

Taxonomy of the Genus Phyllanthus and Identification Manual

21

Fruit: Capsule 4 mm diameter, pubescent. Seeds: 2 mm long, finely reticulate. 1.1.4.49  Phyllanthus subcrenulatus F. Muell. Phyllanthus subcrenulatus F. Muell. is a shrub, 2 m high, but often less than 1 m; branchlets are angular, glabrous. It grows in dry rain forest or eucalypt woodland in rocky places of Australia (James and Harden, 1999). Leaves: Ovate to lanceolate, mostly 8–40 mm long, 4–15 mm wide, minutely crenate. Flowers: Solitary or a few together, peduncles 3 mm long, lengthening to 10 mm long in fruit, in female flowers perianth segments herbaceous with white margins, to 3 mm long in fruit, male segments petaloid, shorter, stamens 3; filaments free, glands conspicuous, styles 3, slender, divided to midway. Fruit: Capsule globose, glabrous, 6 mm diameter. Seeds: 2–2.5 mm long, slightly striate longitudinally. 1.1.4.50  Phyllanthus similis Muell. Arg. Phyllanthus similis Muell. Arg. is an erect subshrub that grows to 60 cm high; it is rhizomatous, glabrous, well branched with distinctly reddish stems and branches. It grows along creeks or at the edge of rain forest, mainly on the coast of Australia (James and Harden, 1999). Leaves: 2 ranked, lamina obovate to elliptic, mostly 10–20 mm long, 6–10 mm wide, apex obtuse to acute or mucronate. Flower: Male flowers in 2- or 3-flowered clusters on peduncles to 1 mm long, females usually solitary, on peduncles lengthening to 3 mm long in fruit. Perianth segments ovate, 1.5 mm long, slightly enlarging in fruit, stamens 3, filaments free, styles short, deeply bifid. Fruit: Capsule 3.5–4 mm diameter, pale yellow-orange; seeds orangebrown, striated.

ACKNOWLEDGMENTS I am thankful to Dr. John Britto, Director, The Rapinat Herbarium, St. Joseph’s College, Thiruchirapalli, India for allowing me to use the figures from the book The Flora of the Tamilnadu Carnatic.

REFERENCES Taxonomy of the Genus Phyllanthus Burkill, H. M. 1985. The useful plants of west tropical Africa, volume 2. Chicago: The University of Chicago Press. Catapan, E., Otuki, M. F., Viana, A. M., et al. 2000. Pharmacological activity and chemical composition of callus culture extracts from selected species of Phyllanthus. Die Pharmazie 55: 945–946.

22

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

Chase, M. W., and Reveal, J. L. 2009. A phylogenetic classification of the land plants to accompany APG III. Bot. J. Linn. Soc. 122–127. Cordeiro, I., and Carneiro-torres, D. S. 2004. A new species of Phyllanthus (Phyllanthaceae) from chapada diamantina, Bahia, Brazil. Bot. J. Linn. Soc. 146: 247–250. Gamble, J. S. 1925. Flora of presidency of Madras, volume 2, 1286–1290. London: West, Newman and Adlard. James, T. A., and Harden, G. J. 1999. Taxon concept: flora of New South Wales flora, Suppl. 1. Available at http://plantnet.rbgsyd.nsw.gov.au/cgibin/NSWfl.pl?page=nswfl&lvl= sp&name= Phyllanthus~gunnii (accessed December 27, 2010). Manilal, K. S., and Sivarajan, V. V. 1982. Flora of Calicut. Dehra Dun, India: Saujanya Books. Mathew, K. M. 1982. The flora of the Tamilnadu Carnatic. Madras: Ranipat Herbareum, St. Joseph’s College, Tiruchirapalli. Mathew, K. M. 1988a. Further illustrations on the flora of the Tamilnadu Carnatic, 578–581. Madras: Ranipat Herbareum, St. Joseph’s College, Tiruchirapalli. Mathew, K. M. 1988b. Illustrations on the flora of the Tamilnadu Carnatic, 648–649. Madras: Ranipat Herbareum, St. Joseph’s College, Tiruchirapalli. pp. 648–649. Reveal, J. L., Hoffmann P., Doweld, A., and Wurdack, K. J. 2007. Proposal to conserve the name Phyllanthaceae. Taxon 56: 266. Shukla, P., and Misra, S. P. 1997. An introduction to taxonomy of angiosperms. Delhi: Vikas. Silva, M. J., and Sales, M. F. 2006. A new species of Phyllanthus (Phyllanthaceae) from northeastern Brazil. Novon 16: 421–423. Silva, M. J. 2009. Two new Brazilian species of Phyllanthus (Phyllanthaceae). Novon 19: 229–233. Tokuoka, T. 2007. Molecular phylogenetic analysis of Euphorbiaceae sensu stricto based on plastid and nuclear DNA sequences and ovule and seed character evolution. J. Plant Res. 120: 511–522.

Taxonomy of the Genus Phyllanthus and Identification Manual

23

1.2 IDENTIFICATION MANUAL FOR SOME SPECIES OF THE GENUS PHYLLANTHUS L. OF PHYLLANTHACEAE WITH SPECIAL REFERENCE TO THE INDIAN SUBCONTINENT

A. Lalithamba

1.2.1  Introduction The genus Phyllanthus L. is distributed in tropic and subtropical areas. The genus is the largest in the family Phyllanthaceae, with more than 750 species throughout the world. (Kathriarachchi et al., 2005; Stevens, 2001; Webster, 1994). In India, about 50 species of the genus are recorded. Some species of Phyllanthus L. are used as medicinal herbs in different medical systems throughout the world. A total of 24 species of the genus Phyllanthus L. are recorded as medicinal plants by the ENVIS Center on Medicinal Plants in India (2010). The two popular and well-known taxa with potential medicinal values are the Amla and the Bhuaamla. In this section, eight species native to India and eight species naturalized in India are described. 1.2.1.1  The Scientific Classification As per the Bentham and Hooker system (Bentham and Hooker, 1880) (this system is widely followed in India), the following is the scientific classification: Class: Dicotyledones; subclass: Monochlamideae; series: Unisexuales; family: Euphorbiaceae; genus: Phyllanthus As per the APG (Angiospermic Phylogeny Group) system, the genus belongs to the family Phyllanthaceae: Kingdom: Plantae; division: Angiospermae; (unranked clade): Eudicots; (unranked clade): Rosids; order: Malpighiales; family: Phyllanthaceae; tribe: Phyllanthae; genus: Phyllanthus L. (Stevens, 2001) The genus Phyllanthus L. includes the genera earlier known as Anisonema, Cicca Linnaeus, Diasperus Kuntze, Emblica Gaertner, Epistylium Swartz, Kirganelia Jussieu, Phyllanthus L, and Xylophylla based on molecular analysis (APG II classification, Hoffmann et al., 2006; Kathriarachchi, et al., 2006).

1.2.2  The Main Characters of the Genus This genus is characterized by pinnate leaf-like plagiotropic branchlets that are deciduous and flower bearing. The name Phyllanthus L. is derived from Greek words meaning leaf-flower, an indirect reference to the apparent bearing of flowers on the leaves. The leaves on the main axis are reduced to scale leaves, which are known as cataphylls (Webster, 1994). The growth form ranges from annual and perennial herbs to shrubs and trees. Latex is absent. The branching is specific to this genus

24

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

and is known as “Phyllanthoid branching”; the branchlets resemble pinnate leaves with limited growth. Foliar leaves alternate and are distichous, simple, with narrow stipules and margins entire. Plants are dioecious, flowers monoecious (unisexual). Flowers are axillary, solitary, or in fascicles; three bracteate, small, actinomorphic and are white, light yellow, green, or pink. Perianth lobes (5 or 6) are imbricate, characterized by a white scaly margin. Disk is present in male and female flowers. Stamens (3 or 6) are free or the filaments are combined into a column; anthers are bithecate and oblong, dehiscing vertically or transversely. Ovary is three celled and superior; styles are usually bifid, free or connate at the base, and the stigma with an adaxial furrow. Pistillodes or staminodes are absent. Fruit is a septicidal capsule or drupe with three crustaceous or two-valved cocci. Seeds are large, trigonous, rounded at back; the seed coat is hard, brown, exotegman (outer seed coat) with radially elongated furrows; caruncle is absent, and cotyledons are flat (Gamble, 1921; Hutchinson, 1973; Stevens, 2001; Webster, 1957).

1.2.3  Synoptic Key 1.2.3.1  Herbs A. Perianth lobes 5: 1. Foliar leaves distichous, branchlets horizontal, pinnate leaf-like; capsule smooth, regular longitudinal ribs on seed coat: amarus 2. Leaves not distichous, pedicels filiform, male clustered, female solitary: rheedi B. Perianth lobes 6: 1. Stamens 6: a. Plant prostrate, fleshy: rotundifolius 2. Stamens 3: a. Plant erect, leaves distichous, membranous, seed segmented, dark brown tubercles on one side, vertical ridges on other side: fraternus (native of India) b. Branchlets plagiotropic, leaves distichous, minute, seed coat stellate and verucose: niruri (native of America) c. Base subwoody, suberect, foliar branches not deciduous, male flowers, subsessile, female pedicellate, capsule not glandular: gardenerianus d. Slender herb, leaves prominently nervose, flowers in androgynous fascicles, perianth purple with white margins: virgatus e. Branches erect, leaves not distichous, coriaceous: maderaspatensis f. Stipules subulose, leaf acute, capsule verucose, the seeds prominently transversely ridged and with crossbars: urinaria g. Leaves thin, pedicel thickened, flowers drooping, flowers rather large: debilis

Taxonomy of the Genus Phyllanthus and Identification Manual

1.2.3.2  Shrubs or Trees A. Perianth lobes 4: Trees, flower pinkish green, stamens 4, free: acidus B. Perianth lobes 5: Shrubs, male flowers pink, stamens 3, ovary more than 3 celled: reticulatus C. Perianth lobes 6: 1. Stamens 3: a. Tree, fruit a fleshy drupe; glands in male flowers minute: emblica b. Small tree, leaves large and coriaceous, glands in male flowers not conspicuous: indofischieri c. Large shrub, fruit a dry dehiscent capsule: polyphyllus

1.2.4  Descriptions 1.2.4.1  Phyllanthus acidus L Vernacular names: Sanskrit: Lavaliphala; Hindi: Harfarauri; Tamil: Aranelli; Telugu: Raacha usiri; Bengali: Hariphal; English: Otaheite gooseberry, star gooseberry. Description: 5–8 m tall tree with robust branches and slender deciduous leafy branches clustered at the upper part of the woody branches. Leaves alternate, simple, distichous on 30–50 cm long branches; petiole 0.5–1 cm long, leaf blade 5–8 × 2.5–3.5 cm, obliquely ovate, base rounded, apex acute, pale beneath. Flowers about 3–4 mm diameter, pinkish, monoecious, actinomorphic, subsessile, densely clustered on 5–12 cm long axillary racemes arising from nodes along the branches; male and female flowers mixed. Male flower: Calyx lobes 4, about 2–3 mm long, petals 0; disk glands conspicuous. Stamens 4, inserted, filaments free; anthers bithecate, about 1 mm long. Female flower: Calyx 4, petals 0; disk annular; ovary superior, subglobose, 3 celled, about 1–2 mm diameter; styles 3, stigma bifid. The fruits develop densely on the branches. Fruit: Fleshy drupe; pale yellow or greenish white, waxy, about 1–2 cm diameter, globose with slightly flattened poles, with 6–8 shallow vertical ribs and 1-seeded. Flowering and fruiting season: Flowers and fruits twice a year March–May and November–January. Distribution: It is a native of Madagascar and cultivated in gardens and in villages throughout India for fruit. Naturalized in Philippines, Indonesia, Vietnam, Laos, Malaya, Hawaii, and some other Pacific Islands; southern Mexico and Central America, Colombia, Venezuela, Surinam, Peru, and Brazil. Fruit is edible. The species is named acidus because the taste of the fruit is acidic (highly sour) (Figure 2.b; also see color insert). 1.2.4.2  Phyllanthus amarus Schumach & Thonn. Synonymously used as P. niruri auct. Non. L. Vernacular names: English: carry me seed, black catnip, stone breaker; Sanskrit: Bhuaamlaki; Hindi: Bhuaamla; Kannada: Kirunelli, Nela nelli; Malayalam: Kilanelli, Kizhararnelli; Telugu: Nelausiri.

25

26

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

(a)

(b)

(c)

(d)

(e)

(f)

(g)

(h)

(i)

(j)

(k)

(l)

(m)

(n)

(o)

(p)

FIGURE 1.2  See color insert. Morphology of some of the common species of Phyllanthus (a–n): (a) Phyllanthus amarus (inset: a twig showing flowers); (b) P. acidus; (c) P. gardnerianus; (d) P. pinnatus; (e) P. polyphyllus; (f) P. rheedi; (g) P. rotundifolius; (h) P. urinaria; (i) P. indofisheri; (j) P. virgatus; (k) P. emblica flower; (l) P. simplex; (m) P. deblis male flower; (n) P. deblis female flower. (o) Fruit of P. emblica; (p) seeds of P. urinaria.

Description: Annual slender herb, 10–30 cm tall; main shoots terete, flowering branchlets horizontal. Leaves on the main axis reduced to scale leaves. Scale leaves 1–1.2 mm long, linear, subulate; stipules triangular, lanceolate, 1 mm long; foliage leaves alternate, distichous; petiole 2–3 mm long; leaf blade 5–9 × 2–4 mm, oblong, obtuse at both ends, glaucous beneath, 5–7 pairs of nerves, nerves not conspicuous on the upper surface, visible only in the lower side. Flowers axillary, 1–2 mm across; male flowers yellowish white, female flowers pale green in color; perianth with a white margin on either side in both sexes. Male flowers 1–3 together on the upper part of the branch; pedicel 1 mm long, perianth lobes 5, petaloid, triangular, apex acute, 0.5 mm long; stamens 5, alternate to perianth lobes, connate below; disk glands 5, minute; anthers 0.2–0.3 mm long, vertical; bithecate; pollen, subprolate, tectal surface fine reticulate (Perveen and Quaiser, 2005). Female flower: Solitary; on the lower part of the branch; pedicel 1 mm long extending up to 1.5–2 mm in fruit; perianth lobes 5, sepaloid, apex acute, persistent; disk 0.5 mm across, flat, 5 lobed; ovary superior, about 3–4 mm in diameter, subsessile, subglobose, 3 celled; 1–2 ovules in each cell; styles 3, about 0.3 mm long, free, spreading, stigma 2 fid. Fruit: Capsule, globose

Taxonomy of the Genus Phyllanthus and Identification Manual

and dark brown in color when dry, 1.5–2 mm across, smooth walled; burst open and the seeds are hurled away. Seed: 1 × 0.5 mm, light brown, triquetrous; longitudinal ridges are seen on the rounded back side (Machado et al., 2006). Flowering and fruiting season: Throughout the year but very common after monsoon. Additional notes: The plant is bitter to taste. When the fresh juice of the plant is kept on white cotton, it turns black. This taxon is often synonymously referred to as P. niruri L. in Indian floras, which is native of America. It is easily distinguished from P. niruri L. by its equilateral leaf base and ribbed seeds (Machado et al., 2006). This taxon is used as a healing herb for jaundice by Ayurvedic (traditional system of Indian medicine) and ethnomedical practitioners throughout India and in tropical countries. It is referred to as stone breaking plant because it is also used to dissolve urinary stones in traditional medical systems in tropical countries. Unfortunately, there remains a great deal of confusion among scientists regarding plant identification, and in many cases misidentification of this taxon makes evaluation of published information difficult (Rao et al., 1999) (Figure 1.2a; also see color insert). Distribution: Indigenous to India and widely naturalized in tropics. Common in plains, absent in hilly areas. Normally germinates after monsoon. 1.2.4.3  Phyllanthus debilis Klein ex Willd. Vernacular names: Sanskrit: Bhupatri, Bhupushpi; Hindi: Bhonyaabbali, Bhuinanvalah; Tamil: Kilanelli. Description: Annual herbs, 10–40 cm tall; branches slender. Leaves distichous; stipules lanceolate, long acuminate, about 2–3 mm long; petiole 3–4 mm long; lamina thin,1–1.5 × 0.7–1 cm, sometimes rounded at base, elliptic or obovate, acute at apex. Flowers monoecious; green, about 4–5 mm diameter, rather larger than other species, male flowers in the lower part of the branchlets, female flowers on the distal part of the branchlet, drooping, pedicel 2–2.5 mm long, thick. Male flower: Perianth lobes 6, arranged in 2 whorls of 3 each, the outer 3 larger, green with prominent scarious white margins, rounded at tip, 0.4–0.6 cm long; disk glands 3, star-like, stamens 3, filaments slightly connate below, staminal column slender; anthers erect, about 2–3 mm long, slit transverse. Female flower: Perianth lobes similar to that of male flowers; disk is saucer shaped and lobed, ovary 3 celled, smooth, about 2–3 mm diameter, globose with three white vertical stripes alternating with green stripes; styles 3, short, free, bifid at middle. Fruit: Capsule, about 2.5–3 mm diameter, globose, 3 celled. Seeds brown, obovate, and irregularly ribbed. Flowering and fruiting season: August–December. Distribution: Native of Indian subcontinent, but naturalized in tropical countries (Warren et al., 1999). Found in India, Bhutan, Sri Lanka, and New Guinea. Within India, it is found in northwestern India, Sikkim, Bihar,

27

28

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

Assam, and peninsular India on plateaus above an altitude of 600 m. This plant is a common weed in cultivated fields of hilly forest outskirts (Figure 1.2m and 1.2n; also see color insert). 1.2.4.4  Phyllanthus emblica L. Synonym: Emblica officinalis Gaertn. Vernacular names: Sanskrit: Hindi: Bengali: Amla, Amlaki; English: Emblic, Ambal, Amioki, Indian gooseberry; Telugu: Usiri; Tamil: Nelli; Malayalam: Amalakam, Nelli; Kannada: Amalaka, Chattu, Nellka, Sudhe, Aamalakee. Description: 4–8 m tall deciduous tree, bark light gray and fissured, wood hard, red, and close grained; foliar branchlets distichous, looks like pinnate leaves, branchlets villous, about 15–40 cm long, leaves on the branchlets very many (up to 100), deciduous. Foliar leaves stipulate, stipules minute (1 mm), scarious, triangular, brown; petiole 1 mm long; lamina 1–1.5 × 0.3– 0.4 cm, linear oblong, apiculate, base subcordate, subcoriaceous. Unisexual flowers arise in clusters in the axils of leaves. Before the onset of flowering, the tree almost sheds the leaves. Flowers about 3–5 mm diameter, greenish yellow, male and female mixed. Male flower: Pedicels 1 mm long; perianth lobes 6, 3–4 mm long, oblong or spatulate (spatula-like), spreading, margin white and entire, apex rounded, light yellow; disk glands 6, minute, stamens 3, connate into a column, the anthers erect, cohering by the connective, cells distinct. Female flower: Pedicel 0.5–1 mm; perianth lobes 6, 3–4 mm long, oblong, light yellow, spatulate, spreading, apex rounded, margins thin; disk cupular (cup-like); ovary ovoid, 1.5–2 mm across, 3 celled, ovules 2 in each cell, styles 3–4 mm long, thick and greenish, connate at the base and stigmas twice bifid and recurved. Fruit: Fleshy drupe, 2–3 cm across, slightly depressed, globose, pale green with 6 faint vertical lines. Seed: 4–5 × 2–3 mm, trigonous, reddish brown, exotegman hard with faint vertical furrows. Flowering and fruiting season: March–October. Distribution: Native of India and distributed frequently in hilly forest areas in the tropical parts of Indian subcontinent. Besides native varieties, hybrid varieties are cultivated for fruits in gardens because fruits are edible and widely used in medicinal preparations. (Gamble, 1921). Webster retained it under Phyllanthus L. Phyllanthus L. and Emblica Gaertn. were treated as cogeneric by Webster (1986) (JAA38:75.1975) and Airy Shaw (1980b) (KB.36.337.1981) (Suryanarayana and Rao, 2002). 1.2.4.5  Phyllanthus fraternus G. L. Webster Vernacular names: English: Gulf leaf-flower; Sanskrit: Bhudhatri; Hindi: Jar amla/Bhu amla; Tamil: Keelanelli; Kannada: Kirunelli. Description: A slender annual herb, 15–40 cm tall, main shoot erect, foliar branches horizontal up to 10 cm. Scale leaves 1 mm long, foliar leaves subsessile, stipules 1 mm long, linear lanceolate with one midrib, lamina 0.8–1 × 0.3–0.5 cm, elliptic-oblong or linear-oblong. Flowers axillary, unisexual; yellowish or greenish in color. Male flower: 1–3 in axillary fascicles,

Taxonomy of the Genus Phyllanthus and Identification Manual

29

pedicel 0.5 mm long, flower 1.5–2 mm across; perianth lobes 6, in 2 whorls of 3 each, outer 3 apiculate, inner 3 obtuse, translucent with a green midrib; disk glands 6, flat, stamens 3, filaments connate into a column, anthers reniform, oblique, pollen grain tectal surface moderately reticulate. Female flower: Solitary, 3 mm across; pedicel 0.5–1 mm long; perianth lobes 6, about 1 mm long, slightly accrescent about 2 mm long in fruit; disk flat, minute, ovary 1.5–2 mm across, subglobose, 3 celled; styles 3, shortly bifid; stigmas recurved. Fruit: 1–1.2 × 1.5 mm capsule, 3 lobed, smooth, slightly 6 ridged, depressed. Seed: Trigonous, yellowish brown, about 1 mm long, segmented, with dark brown tubercles on one side and concentric vertical ridges on other side (Machado et al., 2006). Distribution: This species is probably native of Pakistan or Western India, globally distributed throughout tropics except in Australia. Within India, it is found as a common winter weed on roadsides and waste places throughout the hotter parts (Rao, 1999). Note: The species is named fraternus because the reproductive organs are on the lower side of the branches. Fraternus means to carry children on the back in local dialect in Ghana. Phyllanthus fraternus Webster, P. amarus, P. niruri L., and P. urinaria L. are synonymously used by many pharmacists (Chatterjee and Prakashi, 2003). The pollen and seed morphology is different in P. amarus, P. asperulatus, P. fraternus, P. urinaria, and P. niruri.(Schmelzer and Gurib-Fakim, 2008, Machado et al.,2006). All five species are different. 1.2.4.6  Phyllanthus gardnerianus (Wt.) Baill. Vernacular Names: Hindi: Bhiuavate; Telugu: Uchiusiri. Description: Slender, slightly woody herb, 15–50 cm tall, branches angular, long and slender, stem reddish. Leaves alternate; stipules scaly broad or peltate, 1 mm long, brown; petiole short, leaves subsessile; lamina leathery, 1–2.5 × 0.5–0.8 cm, elliptic oblong, base slightly cordate, obtuse at apex, glacous beneath. Flowers axillary, monoecious. Male flowers in fascicles; subsessile, about 1.2–2 mm diameter, perianth lobes 6, broadly ovate, 0.5–1 mm long; disk glands 6, flat, stamens 3, filaments free, anthers about 0.5 mm diameter, subglobose. Female flower: Solitary, pedicel filiform up to 1–1.5 cm long; flowers pale green, about 2–3 mm diameter, sepals 6, ovate, 1 mm long; ovary globose, smooth, about 1–2 mm diameter, 3 celled, styles 3, bifid and recurved. Fruit: Capsule, about 2–3 mm diameter, fruiting pedicel long, capsule slightly 3 lobed, smooth. Seed: 1–2 mm long, trigonous, minutely tubercled. Flowering and fruiting season: August–December. Distribution: Common in waste places and moist places in latterite soils in forest foothills. Common in peninsular India (Figure 1.2c; also see color insert). 1.2.4.7  Phyllanthus indo-fischeri Gamble. Synonym: Phyllanthus indo fischeri Bennet (Bennet, 1987).

30

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

Vernacular name: Tamil: Perunelli; Telugu: Chittiusiri. Description: 3–4 m tall deciduous trees, plants look similar to P. emblica but smaller in size. Branchlets pale brown, leaves larger and thicker than those of P. emblica. Foliar leaves distichous; stipules brown, triangular and minute; petiole short and thick; leaf blade 1–1.8 × 0.5 cm elliptic-oblong, coriaceous, rounded or retuse at apex. Flowers also look similar to P. emblica, 3–4 mm across, greenish-yellow in axillary dense fascicles. Style in female flower is more slender than that of P. emblica and twice bifid. Drupes are smaller than those of P. emblica. Fruit: Drupe, about 1.5–2 cm diameter, globose, fleshy, pale green. Flowering and fruiting season: October–February. Distribution: Found in hilly areas in high altitudes above 350 m. Limited to peninsular India, Karnataka, Tamilnadu, and Velugonda Hills of Nellore District of Andhra Pradesh (Nayyar, 1980). Associated with P. emblica and P. polyphyllus in hilly areas (Ahmedullah and Nayar,1987). Unless closely observed, it is difficult to distinguish the two species. Fruits are not as tasty as Amla and hence not preferred for eating (Figure 1.2i; also see color insert). Phyllanthus L. and Emblica Gaertn. were treated as cogeneric by Webster (1986) (JAA38:75.1975) and Airy Shaw (1980b) (KB.36.337.1981) (Suryanarayana and Rao, 2002). 1.2.4.8  Phyllanthus maderaspatensis L. Vernacular names: English: Madras leaf flower; Telugu: Nelausiri; Hindi: Bazarmani, Ranavali; San: Bhuamlaki; Kanada: madaras nelli; Urdu: Kanocha (ENVIS, 2010). Description: Annual erect herbs, 15–80 cm tall; branches all similar, erect and ascending, branchlets not horizontal and do not resemble pinnate leaves. Scale leaves minute on main axis, foliar leaves alternate, distichous nature absent, stipules about 1–2 mm long; petiole short, 1–2 mm long; leaf blade thin, subcoriaceous, glabrous, oblong-obovate, obtuse, base cuneate, rounded or retuse at apex, mucronate, glaucous, 0.7–2 × 0.3–0.8 cm, main nerve visible on upper surface. Flowers axillary, unisexual, bracteate, actinomorphic, about 2–3 mm diameter, pale yellow. Male flowers 1–3 in upper part of the branch; pedicel 1 mm long; perianth lobes 6 in 2 whorls of 3 each, about 2 mm long, suborbicular, entire; disk glands 6, small; stamens 3, about 1.5–2 mm long, filaments connate below, anthers subsessile. Female flower: Solitary, pedicel 1 mm, extending to 1.5–2 mm long in fruit, perianth similar to that of male flower in size and shape, green in color with white margin, spreading, apex rounded, accrescent in fruit up to 2 mm; disk glands 6, ovary globose, about 1.5 mm diameter, 3 celled; styles 3, free, bifid. Fruit: Capsule, about 2–3 mm diameter, epicarp smooth, globose, 3 valved, 6 seeded. Seed: 1–1.5 mm long, triquetrous, brown, with concentric lines of minute tubercles and minute crossbars. Flowering and fruiting season: Throughout the year.

Taxonomy of the Genus Phyllanthus and Identification Manual

Distribution: Native of tropical Africa and globally distributed in the paleotropics. Within India, it is found throughout the drier parts in waste places as a weed and naturalized in tropical Asia. It is also used as a medicinal herb by ethnomedical practitioners (see Figure 3.1 in the color insert). 1.2.4.9  Phyllanthus niruri L. Vernacular name: English: Chanca Piedra. Description: An annual up to 30 cm high; stem closely sulcate, smooth; flowering branchlets up to 10 cm long, compressed or slightly winged, smooth. Leaves oblong or oblong-elliptic, rounded at both ends, 3–6 × 1.5–3 mm, membranous, glabrous on both surfaces; lateral nerves nearly invisible; petiole 1 mm; stipules lanceolate-subulate, membranous, glabrous. Flower: Minute, 1–2 mm across, axillary and unisexual. Male flower: Solitary in the lower side of the branch, sepals 6, small, 1 nerved, with membranous margins; disk glands 6, small; stamens 3, filaments connate, anthers bithecate, pollen grain 3–4 colpate (Perveen and Quaiser et al., 2005). Female flower: Solitary, arises in the upper parts of the branchlets; pedicel elongates up to 1–1.5 mm in fruit, glabrous; sepals 6, larger than that of the male; disk thin and flat, about 10 toothed; ovary subglobose, smooth; styles very short, suberect, bifid. Seed: Trigonous, stellate verucose cross bars aligned on 6 long ribs with crusts (Machado et al., 2006). Distribution: It is a native of the Amazon region of South America and naturalized in tropics throughout the world. It is not an Indian species. Note: The four species P. amarus Schumach & Thonn., P. asperulatus Hutch., P. fraternus G. L. Webster., and P. niruri L. are often synonymously used. These three species look very similar, are called by the same vernacular names, and hence often are misidentified by pharmacists or indigenous medical practitioners (Khatoon et al., 2006). In clinical research papers, the identification characters of the taxon worked on were never enumerated, and the names were indicated as synonymous with one another, creating confusion. The species P. niruri L. appears to be endemic to America (Webster, 1957) and specimens from other areas often are misidentified as P. niruri L. The seed morphology of the four species P. amarus, P. asperulatus, P. fraternus, and P. niruri is different (Machado et al., 2006). 1.2.4.10  Phyllanthus pinnatus (Wight) G. L. Webster. Synonym: P. wightianus Muell, Reidia floribunda Wight. Vernacular names: Telugu: Pachaari. Description: 1–2 m tall shrubs; branchlets glaucous, foliar branches 6–12 cm long, pinnate leaf-like. Foliar leaves stipulate, stipules minute; pedicel 1–2 mm long; leaf blade 1–2 × 0.5–1 cm, elliptic, obovate or orbicular, obtuse, base acute. Flowers monoecious, 3–4 mm across, greenish yellow in axillary fascicles. Male flower: Pedicellate; perianth lobes 6, in 2 whorls of 3 each, about 2–3 mm diameter; disk glands 6, stamens 6, filaments 4–5 mm long, exerted, anthers 2 celled, about 1 mm diameter, bithecate. Female flower: Pedicellate; perianth lobes 6, ovary 3 celled, about 2–3

31

32

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

mm diameter, globose; styles 3, bifid, recurved. Fruit: Capsule, 0.8–1.5 cm across, depressed globose with papery pericarp and drooping. Flowering and fruiting season: June–October (Figure 1.2d; also see color insert). Distribution: Common and gregarious on latterite soils near foothills. Limited to peninsular India (Ahmedullah and Nayar, 1987). 1.2.4.11  Phyllanthus polyphyllus Willd Vernacular names: Kannada: Manikanni, Krishna neli; Telugu: Kondapachaari; Malayalam: Kattunelli, Kilaranelli (ENVIS, 2010). Description: 2–3 m tall shrub or a small tree. In vegetative phase, it resembles P. emblica L. except the size of the plant. Foliar branchlets 6–20 cm long, pinnate leaf-like. Foliar leaves distichous, 0.5–1.5 × 0.3–0.6 cm, oblong, obtuse or apiculate, base rounded, apex mucronate, stipules 1 mm long, brown, petiole short. Flowers monoecious, axillary, white or pale yellow. Male flowers 1–3 axillary in simple cymes, on the lower side of the leafy branches; flower white, about 5–6 mm across; pedicel 4–5 mm long; perianth lobes 6, in 2 whorls of 3 each, membranous, translucent, margin entire, apex rounded; disk glands 3, conspicuous, stamens 3, 2–3 mm long, filaments united into a column, anthers erect, 1 mm long, bithecate. Female flowers are on the upper part of the branchlets, subsessile; solitary, 4–5 mm across; perianth lobes 6, accrescent up to 3 mm in fruit; disk small, flat, ovary 3 celled, subglobose, about 2–3 mm diameter; styles 3, spreading, bifid and recurved. Fruit: Schizocarp, 4–6 mm across, light yellowish-green when young, black when dry and dehisces to three lobes. Seeds triquetrous, coarse with foveolate testa (seed pits conspicuous), pits are on longitudinal rows. Flowering and fruiting season: May–September. Distribution: Common on rocky boulders. Limited to peninsular India (Ahmedullah and Nayar, 1987). Found in association with Pterocarpus santalinus L.f., and Anogeissus latifolia (Roxb ex DC) Wall. in eastern ghats of Andhra Pradesh. This taxon is often mistaken as Phyllanthus emblica L. in the vegetative phase, which it resembles in leaf but is different in flower and fruit (also see Figure 1.2 in color insert). 1.2.4.12  Phyllanthus reticulatus Poir. Vernacular names: English: black-honey shrub, black-berried featherfoil; Sanskrit: Krishna-kamboji; Hindi: Panjhuli; Bengali: Pansheuli; Tamil: Kattukilanelli, Telugu: Nallapurgudu (ENVIS, 2010). Description: Straggling shrubs, 1–3.5 m tall; young branchlets bear leaves, branches not pinnate leaf-like. Foliar leaves alternate, not distichous, stipules 1–2 mm long, lanceolate, brown, hard and spiny when dry; petiole 2–5 mm long; leaf blade membranous or papery, 1–2.5 × 0.5 cm elliptic-oblong, rounded or acute at both ends, margin entire, lateral nerves clearly seen on both surfaces. The flowering shoots and pedicels are covered with short, velvety hairs. Flowers in axillary fascicles, monoecious, male and female mixed, pedicellate, actinomorphic, about 2–3 mm diameter. Male flower:

Taxonomy of the Genus Phyllanthus and Identification Manual

Pale pink, pedicel 5–8 mm, filiform; perianth lobes 5 or 6 in 2 whorls, unequal, obovate, 2–4 mm long; disk glands 5, fleshy, minute, stamens 5, in two series, inner 3 longer and connate at the base, the remaining 2 short and free. Female flower: Green, fruiting pedicel up to 1 cm long, filiform; perianth similar to that of male flower in size and shape; disk glands 5, obovate, fleshy, ovary smooth, 3–5 celled, ovules 2 per each cell; styles 3, free, bifid at apex. Fruit: Berry, 4–6 mm across, 6–10 seeded, subglobose, black or deep purple when ripe. Seed: 1–2 mm long, trigonous, and brown. Flowering and fruiting season: Throughout the year. Distribution: This taxon is globally distributed in the paleotropics. Within India, it is found along riverbanks and among scrubs in moist deciduous and semievergreen forests up to an altitude of 600 m. 1.2.4.13  Phyllanthus rheedii Wight. Vernacular names: Not known. Description: Annual herb, 15–30 cm tall, stems slender, terete, branchlets angular. Foliar leaves thin, stipules 1–2 mm long, lanceolate, decurrent; leaf blade about 1.2–2 × 0.8–1 cm, thin, glabrous, elliptic, apiculate or ovate. Flowers axillary; unisexual, pedicellate, solitary or in fascicles. Perianth lobes 5 in male and female flowers green with white scaly margins on either side. Male flower: Minute, about 1–1.5 mm diameter, pedicel filiform, 0.5–1 cm long; disk glandular, stamens 5, erect, the filaments united into a column, free above; anthers longish, dithecous. Female flowers solitary on thickened pendulous pedicels; disk small, flat, ovary trilocular, slighitly ridged; styles 3, stigmas bifid. Fruit: Capsule, about 3–5 mm diameter, globose. Seeds with rather distant longitudinal very slender ridges and minute cross lines. Flowering and fruiting season: July–December (Figure 1.2f; also see color insert). Distribution: Common in forest undergrowth. Found in hilly areas at high altitudes in India. 1.2.4.14  Phyllanthus rotundifolius Klein ex Willd Vernacular names: Not known. Description: Prostrate or slightly ascending, fleshy herb with trailing branches, from a stout rootstock. Leaves coriaceous or fleshy, stipules minute, lanceolate; petiole short, leaf blade 0.8–1 × 0.4–0.8 cm orbicular or obovate, obtuse or apiculate glabrous on both surfaces. Flowers monoecious, 2–3 mm across, pale green, 2–3 males and 1 female together in each axil. Male flower: 2 mm across, perianth lobes 6, one nerved, membranous, apex rounded; disk glands 6, minute and wrinkled; stamens 6, filaments connate into a column, anthers free. Female flower: Perianth lobes 6, larger than that of male flower; disk cushion shaped, ovary trilocular, depressed-globose; styles 3 distinct, style arms recurved with short lobes. Fruit: Capsule, 3–4 mm across, globose or ovoid. Seeds trigonous with remarkable longitudinal furrows on the back. Flower and fruiting season: July–September.

33

34

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

Distribution: On open sandy soils. Found in tropical Africa, Arabia, Sri Lanka, and peninsular India (Figure 1.2g; also see color insert). 1.2.4.15  Phyllanthus urinaria L. Vernacular names: Sanskrit: Tamlaki; Hindi, Bengali: Hazarmani; Tamil: Shivappukinelli; Malayalam: Chirukizhukanelli, Chukanna-kizha-nelli; Marathi: Bhumyavli, Bhooyimabi; Kannada: Kempu nelanelli. Description: Annual or perennial erect herbs up to 30 cm tall, stem woody at base, longitudinally sulcate, subterete and foliar branches ascending, 5–6 cm long, angled, wings asperulate. Leaves variable in size, distichous; oblong, stipules pinkish, broad and auriculate at base, up to 1 mm long; petiole short and compressed; leaf blade 1–1.5 × 0.4–0.6 cm glabrous, dark green above, glacous beneath, chartaceous, margins hispid, base unequal sided, apex shortly pointed, lateral nerves looped close to the margin. Flowers monoecious, axillary. Male flowers 2–4 together in leaf axils on the lower part of branchlets, minute, up to 2 mm across, pedicels 1 mm long, perianth lobes 6 in 2 whorls of 3 each, greenish white, elliptic-oblong, apex rounded; disk minute, stamens 3, filaments subsessile, united into a column, anthers erect. Female flower solitary on the axils of leaves on the abaxial side of branchlets; larger up to 3 mm across; sessile; perianth lobes 6, greenish white, persistent, slightly accrescent and reflexed in fruit; disk entire, ovary depressed globose and warty; styles 3, free, short, adjacent to the ovary, once bifid at the apex and recurved. Fruit: Capsule, reddish brown in color, 2–3 mm across, 6 seeded, pericarp verucose with 6 faint vertical lines. Seed: Trigonous, about 1–1.2 mm long, dark brown, prominently transversely ridged and with faint crossbars on the rounded back side (Figure 1.2h; also see color insert). Flowering and fruiting season: July–December. Distribution: Native of East Asia. Common in India in all plains, in the forest undergrowth along moist, shady localities. This taxon is also used as an alternative to P. amarus Schumach & Thonn. and P. fraternus G. L. Webster. in indigenous medicine. Because of its diuretic property it is named urinaria (Satyavathy et al., 1987). 1.2.4.16  Phyllanthus virgatus G. Forst. Synonymously used for P. simplex Retz. Vernacular names: Telugu: Uchchi usiri; Hindi: Bhiuavate; Kannada: Kaadu nelli; Malayalam: Niruri (ENVIS, 2010). Description: Slender, branched, glabrous suffruticose herb up to 60 cm tall; branchlets angled. Leaves alternate, distichous, subsessile; stipules peltate, 1 mm long, brown, petiole short, leaf blade slightly leathery, elliptic-oblong or sublinear, prominently nervose, lateral nerves obscure, base obliquely rounded or acute at apex, apiculate, about 1–1.5 cm long and 2–4 mm wide. Flowers in androgynous axillary fascicles, male flowers few, female flowers many, often associated with 1 or 2 males; pedicellate. Male flower: Pedicel 2 mm long, perianth lobes 6, oblong,

Taxonomy of the Genus Phyllanthus and Identification Manual

35

disk glandular; stamens 3 free, filaments short, anthers subglobose. Female flowers on longer pedicels, pedicel 6–9 mm long, perianth lobes 6, oblong, reflexed, purple with whitish membranous margin, persistent, disk annular, undivided; ovary globose, 3 celled, styles 3, free, bifid, short, recurved. Fruit: Capsule, depressed-globose, about 3 mm wide, smooth or slightly rugose (Benjamin, 1970; Stone, 1970). Seeds trigonous and minutely tubercled. Flowering and fruiting season: April–May to November (Figure 1.2j; also see color insert). Distribution: Widely distributed in the Old World tropics and presumably indigenous in Asia or Malaysia. Its introduction throughout the southern Pacific was doubtless aboriginal and inadvertent (Smith, 1981).

ACKNOWLEDGMENT I am thankful to Dr. K. S. Murty, scientist retired, CCRAS, New Delhi, for his valuable suggestions and encouragement in preparing the chapter.

REFERENCES Identification Manual for Some Species of the Genus Phyllanthus L. of Phyllanthaceae with Special Reference to the Indian Subcontinent Ahmedullah, M., and Nayar, M. P. 1987 Endemic plants of the Indian region, 212. Howrah, India: Botanical Survey of India. Airy Shaw, H. K. 1980a. The Euphorbiaceae of New Guinea. Kew Bull. (Additional series) 8: 185–186. Airy Shaw, H. K. 1980b. Notes on the Euphorbiaceae from Indomalesia, Australia and the Pacific. Kew Bull. 35: 383–399. Albert, S. C. 1981. Flora Vitiensis nova: a new flora of Fiji, volume 2, 810. Lawaii, Hawaii: Pacific Tropical Botanical Garden. The wealth of India: a dictionary of Indian raw materials and industrial products, volume 8, 34–36. 1948–1976. New Delhi: Council of Scientific and Industrial Research, India. Bennet, S. S. R. 1987. Name changes in flowering plants in India and adjacent regions, 429– 430. Dehradun, India: Triseas. Bentham, G., and Hooker, J. D. 1880. Phyllanthus L. In Genera plantarum, 272–275. London: Reeve. Chatterjee, A., and Prakashi, S. C. 2003. Treatise on Indian medicinal plants, volume 3, 49–55. New Delhi: NISCAIR. ENVIS. 2010. Encyclopedia on Indian medicinal plants. Available at http://envis.frlht.org.in/ (accessed November 11, 2010). Gamble, J. S. 1921. Flora of the presidency of Madras, 3, 1286–1290. London: Adlard. Hoffmann, P., Kathriarachchi, H., and Wurdack, K. J. 2006. A phylogenetic classification of Phyllanthaceae. Kew Bull. 61: 37–53. Hooker, J. D. 1872. The flora of British India, 288–298. London: Reeve. Hutchinson, J. 1973. The families of flowering plants: arranged according to a new system based on their probable phylogeny, 3rd ed. London: Oxford University Press.

36

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

Kathriarachchi, H., Hoffmann, P., Samuel, R., Wurdack, K. J., and Chase, M. W. 2005. Molecular phylogenetics of Phyllanthaceae inferred from five genes (plastid atpB, matK, 3’ndhF, rbcL, and nuclear PHYC). Mol. Phylogenet. Evol. 36: 112–134. Kathriarachchi, H., Samuel, R., Hoffmann, P., et al. 2006. Phylogenetics of tribe Phyllantheae (Phyllanthaceae; Euphorbiaceae sensu lato) based on nrITS and plastid matK DNA sequence data. Am. J. Bot. 93: 637–655. Khatoon, S., Rai, V., Rawat, A. K., and Mehrotra, S. 2006. Comparative pharmacognostic studies of three Phyllanthus species. J. Ethnopharmacol. 104: 79–86. Linne, C. V., and Willdenow, C. L. 1753. Caroli a Linné. Species Plantarum 2: 981–982. Machado, C. A., de Oliveira, P. L., and Mentz, L. A. 2006. SEM observations on seeds of some herbaceous Phyllanthus L. species (Phyllanthaceae). Rev. Bras. Farmacogn. [online] 16: 31–41. Nayar, M. P., Ahmed, M., and Raju, D. C. S. 1984. Endemic and rare plants of Eastern Ghats. Indian J. Forestry 7: 35–42. Nayyar, M. P. 1980. Endemic plants of peninsular India and its significance. Bull. Bot. Surv. India 22: 12–23. Perveen, P., and Quaiser, M. 2005. Pollen flora of Pakistan XLVII—Euphorbiaceae. Pak. J. Bot. 785–796. Rao, R. S., Sudhakar, S., and Venkanna, P. 1999. Flora of East Godavari District, Andhra Pradesh, India. Hyderbad, India: Indian National Trust for Art and Cultural Heritage, p. 632. Rao, R. S., Sudhakar, S., and Venkanna, P. 1999. Flora of East Godavari District, Andhra. Pradesh, India. Hyderbad, India: Indian National Trust for Art and Cultural Heritage, p. 632. Satyavati, G. V., Gupta, A. K., and Tandon, N. 1987. Medicinal plants of India, volume 2, 405. New Delhi: Indian Council of Medical Research. Schmelzer, G. H., and Gurib-Fakim, A. 2008. Medicinal plants. Plant Resources of Tropical Africa (Program) PROTA, pp. 425–426. Stevens, P. F. 2001 onward. Angiosperm phylogeny Web site. Version 9, June 2008 [updated since]. Available at http://www.mobot.org/MOBOT/research/APweb/. Stone, B. C. 1970. The flora of Guam. A manual for the identification of the vascular plants of the Island. Micronesica 6: 1–659. Suryanarayana, B., and Rao, A. S. 2002. Flora of Nellore District: Eastern Veligonda hill ranges and Sriharikota Island, 490–495. Shri Rampur, India: Gurudev Prakashan. Warren, L. W., Derral, R. H., and Sohmer, S. H. 1999. Manual of the flowering plants of Hawaii, rev. ed. Bernice P. Bishop Museum special publication. Honolulu: University of Hawai’i Press/Bishop Museum Press. Webster, G. L. 1957. A monographic study of the West Indian species of Phyllanthus. J. Arnold Arboretum 38: 51–80, 170–198, 295–373. Webster, G. L. 1994. Classification of the Euphorbiacea. Ann. Mo. Bot. Gard. 81: 3–32. Webster, G. L. 1986. A revision of Phyllanthus (Euphorbiaceae) in Eastern Melanesia. Pacific Sci. 40: 1–4.

Pharmacopoeial 2 Current Status of Phyllanthus Species P. emblica, P. amarus, and P. fraternus Raman Mohan Singh and Vivekanandan Kalaiselvan CONTENTS 2.1 Introduction..................................................................................................... 38 2.2 Phyllanthus emblica........................................................................................ 38 2.2.1 Description........................................................................................... 38 2.2.2 Identifications...................................................................................... 39 2.2.2.1 Macroscopic.......................................................................... 39 2.2.2.2 Microscopic........................................................................... 39 2.2.2.3 By Thin-Layer Chromatography.......................................... 39 2.2.3 Assay.................................................................................................... 39 2.2.4 Pharmacopoeial Comparison..............................................................40 2.3 Phyllanthus amarus.........................................................................................40 2.3.1 Description........................................................................................... 41 2.3.2 Identifications...................................................................................... 41 2.3.2.1 Macroscopic.......................................................................... 41 2.3.2.2 Microscopic........................................................................... 42 2.3.2.3 By Thin-Layer Chromatography.......................................... 42 2.3.3 Assay.................................................................................................... 42 2.3.4 Pharmacopoeial Comparison.............................................................. 43 2.4 Phyllanthus fraternus...................................................................................... 43 2.4.1 Identifications......................................................................................44 2.4.1.1 Macroscopic..........................................................................44 2.4.1.2 Microscopic...........................................................................44 2.5 Other Parameters............................................................................................. 45 2.6 Conclusion....................................................................................................... 45 References.................................................................................................................46 37

38

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

2.1  INTRODUCTION Pharmacopoeial standards are prescribed to control the quality of raw herbal drugs and finished formulations and so to maintain safety and efficacy. Various pharmacopoeial bodies, such as the Indian Pharmacopoeia (2010), The Ayurvedic Pharmacopoeia of India, British Pharmacopoeia (2010), and Chinese Pharmacopoeia (2005), prescribed the standards for Phyllanthus species, including their description, identification test, ethanol- and water-soluble extractive values, microbial limit, and assay. The standards given in the pharmacopoeias would be applied to differentiate species-to-species identification and to detect adulterants. High-performance thin-layer chromatography (HPTLC) and highperformance liquid chromatography (HPLC) are invaluable quality assessment tools for the evaluation of herbal products and marker compounds. The Indian Pharmacopoeia and the British Pharmacopoeia applied HPTLC and HPLC techniques for identification and assay of certain Phyllanthus species. This chapter focuses on the different pharmacopoeial standards and comparative status of Phyllanthus species. Monographs of Phyllanthus emblica and Phyllanthus amarus are available in the fist edition of the Ayurvedic Pharmacopoeia of India, 1990 and the monograph of Phyllanthus fraternus is available in the Indian Herbal Pharmacopoeia.

2.2  PHYLLANTHUS EMBLICA The drug consists of the dried fruit pericarp of Phyllanthus emblica. Family: Phyllanthaceae Vernacular names: English: Emblic myrobalan, Indian gooseberry Sanskrit: Aamalaki Hindi: Amla Kannada: Nelli kayi Marathi: Amla Gujarati: Ambla Malayalam: Nellikka Tamil: Nelli Telugu: Usirikaya Kashmir: Aonla

2.2.1  Description The dried fruit has a highly shriveled and wrinkled external surface. The taste is sour and astringent followed by a delicately sweet tinge.

Current Pharmacopoeial Status of Phyllanthus Species

39

2.2.2  Identifications 2.2.2.1  Macroscopic The dried fruit shows a broad, highly shriveled and wrinkled convex surface, with the lateral surface transversely wrinkled. The external surface exhibits a few whitish specks; occasionally, some pieces show a portion of stony testa. 2.2.2.2  Microscopic The epicarpic cells are rectangular, and their walls are highly cuticularized. The anomocytic type of stomata is found rarely. Collateral fibrovascular bundles are scattered throughout the inner mesocarp. Pitted and helical tracheids with tapering ends are seen. At places in the phloem, large cavities filled with crystal mass are present. 2.2.2.3  By Thin-Layer Chromatography Determination by thin-layer chromatography (TLC) is made by coating the plate with silica gel GF 254. Mobile phase: A mixture of 20 volumes of toluene, 45 volumes of ethyl acetate, 20 volumes of glacial acetic acid, and 5 volumes of formic acid is used. Test solution: Reflux 2 g of coarsely powdered substance under examination with 50–75 ml methanol for 15 min; cool and filter. Reflux the residue an additional two times with 75 ml methanol; cool and filter. Combine all the filtrates and concentrate under vacuum to 50 ml. Reference solution (RS): Reflux 0.4 g of coarsely powdered amalaki RS with 50–75 ml methanol for 15 min; cool and filter. Reflux the residue an additional two times with 75 ml methanol; cool and filter. Combine all the filtrates and concentrate under vacuum to 10 ml. Apply to the plate 10 µl of each solution as bands 10 mm by 2 mm. Allow the mobile phase to raise 8 cm. Dry the plate in air and examine in ultraviolet light at 254 nm and 365 nm; spray with anisaldehyde sulfuric acid reagent. Heat the plate at 100°C for 5–10 min and examine in daylight. The chromatographic profile of the test solution is similar to that of the reference solution.

2.2.3  Assay Determination by liquid chromatography is as follows: Test solution: Weigh accurately about 0.5 g of coarsely powdered substance under examination; add 50 ml of water, sonicate for 3 min, and heat on a boiling water bath for 15 min; cool and dilute to 100 ml with water and filter. Reference solution: A 0.01% w/v (weight/volume) solution of gallic acid RS in water.

40

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

Chromatographic system: • A stainless steel column 25 cm × 4.6 mm packed with octadecylsilane bonded to porous silica (5 µm) • Mobile phase: A. A solution prepared by dissolving 0.136 g of potassium dihydrogen orthophosphate in 500 ml of water; add 0.5 ml of orthophosphoric acid and dilute to 1,000 ml with water. B. Acetonitrile • A linear gradient program using the following conditions: −− Flow rate 1.5 ml/min −− Spectrophotometer set at 270 nm −− Injection volume 20 µl Time (in min)

Mobile Phase A (% v/v)

Mobile Phase B (% v/v)

 0 18 25 30

100   55   20 100

 0 45 80  0

−− Inject the reference solution. The test is not valid unless the relative standard deviation for the replicate injections is not more than 2.0%. Inject the test solution and the reference solution. −− Calculate the content of gallic acid.

2.2.4  Pharmacopoeial Comparison Available data for the Phyllanthus emblica standards are compared for the Indian Pharmacopoeia, British Pharmacopoeia, and Chinese Pharmacopoeia in Table 2.1. The data show a limited difference in physical parameters, but the assay of active marker compounds is available by a liquid chromatographic (LC) method only in the Indian Pharmacopoeia and the British Pharmacopoeia; no assay method is available in the Chinese Pharmacopoeia.

2.3  PHYLLANTHUS AMARUS The drug consists of aerial tender branches of Phyllanthus amarus Schum & Thon. Family: Phyllanthaceae Vernacular names: Sanskrit: Bhoomyaamalakee, Taamalakee Bengali: Bhuiamla, Sadahazuramani Gujarati: Bhonyaanvali Hindi: Bhuiavla, Jangli amla Kannada: Nelanelli, Kirunelli Malayalam: Kizhkkayinelli, Keezharnelli

41

Current Pharmacopoeial Status of Phyllanthus Species

TABLE 2.1 Standards of Phyllanthus emblica According to Different Pharmacopoeias Indian Pharmacopoeia 2010

Monograph Details Monograph name

Amalaki

Assay

Amalaki contains not less than 1.0% w/w gallic acid calculated on dried basis (LC method) Not less than 30.0%

Ethanol-soluble extractive Foreign matter Water-soluble extractive Total ash Acid-insoluble ash Loss on drying Foreign organic matter Heavy metals

Microbial contamination Water

— Not less than 40% Not more than 5.0% Not more than 2.0% Not more than 12.0% Not more than 3.0% 1.0 g complies with the limit test for heavy metals (20 ppm) Complies with microbial contamination tests —

British Pharmacopoeia 2010 Phyllanthus emblica pericarp It contains not less than 6.0% tannins (LC method)

Not less than 15.0% Not more than 5% Not less than 50% Not more than 7.0% — Not more than 10.0% — —

—

—

Chinese Pharmacopoeia 2005 Fructus phyllanthi —

— — Not less than 30% Not more than 5.0% Not more than 1.5% — — —

—

Not more than 13.0%

Marathi: Bhuiavala Tamil: Keela nelli, Kilkkayanelli Telugu: Nela virika, Nelavusuri

2.3.1  Description The powdered drug of Phyllanthus amarus is green to greenish yellow in color, and the taste is slightly bitter.

2.3.2  Identifications 2.3.2.1  Macroscopic Stem teret is 1–4 mm in diameter. Leaves are oblong 5 × 3 mm, short stalked, and greenish brown in color.

42

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

2.3.2.2  Microscopic Chlorenchymetous cells are present in the inner cortex of the stem. Leaf stomata are mostly paracytic; the epidermal cell wall is markedly sinuous; rosette and prismatic crystals of calcium oxalate appear along the veins and midrib. 2.3.2.3  By Thin-Layer Chromatography Determine by TLC, coating the plate with silica gel GF 254. Mobile phase: A mixture of 6 volumes of toluene, 2 volumes of ethyl acetate, 1 volume of formic acid, and 0.2 volume of methanol is used. Test solution: Reflux 2 g of coarsely powdered substance under examination with 50 ml methanol on a boiling water bath for 30 min; cool and filter. Reflux the residue again twice with 50 ml methanol; cool and filter. Combine all the filtrates and concentrate under vacuum to 10 ml. Reference solution: Reflux 1 g of Bhuiamla RS with 50 ml methanol on a boiling water bath for 30 min; cool and filter. Reflux the residue again twice with 50 ml methanol; cool and filter. Combine all the filtrates and concentrate under vacuum to 5 ml. Apply 10 µl of each solution to the plate as bands 10 by 2 mm. Allow the mobile phase to raise 8 cm. Dry the plate in air and examine in ultraviolet light at 254 and 365 nm; spray with methanolic sulfuric acid (10% v/v). Heat the plate at 120°C for 5–10 min and examine in daylight. The chromatographic profile of the test solution is similar to that of the reference solution.

2.3.3  Assay Determine by LC as follows: Test solution: Reflux 2 g of coarsely powdered substance under examination with 50 ml of methanol on a water bath for 15 min; cool and filter. Reflux the residue again with methanol until the last extract turns colorless; cool and filter. Combine all the filtrates and concentrate to 10 ml. Reference solution a: This is a 0.020% w/v solution of phyllanthin RS in methanol. Reference solution b: This is a 0.020% w/v solution of hypophyllanthin RS in methanol. Chromatographic system: • A stainless steel column 25 cm × 4.6 mm packed with octadecylsilane bonded to porous silica (5 µm) • Mobile phase: A mixture of 65 volumes of methanol and 35 volumes of water • Flow rate 1.5 ml/min • Spectrophotometer set at 230 nm • Injection volume 20 µl

43

Current Pharmacopoeial Status of Phyllanthus Species

TABLE 2.2 Comparative Standards for Phyllanthus amarus in the Indian Pharmacopoeia and the Indian Herbal Pharmacopoeia Monograph Details Assay

Foreign organic matter Ethanol-soluble extractive Water-soluble extractive Total ash Acid-insoluble ash Heavy metals Loss on drying Microbial contamination n-Hexane-soluble extractive

Indian Pharmacopoeia 2010 Not less than 0.25% w/w total phyllanthin and hypophyllanthin calculated on dried basis (LC method) Not more than 2.0% Not less than 6.0% Not less than 15.0% Not more than 8.0% Not more than 5.0% 1.0 g complies with the limit test for heavy metals (20 ppm) Not more than 12.0% Complies with microbial contamination tests —

Indian Herbal Pharmacopoeia —

Not more than 2.0% — Not less than 15.0% Not more than 8.0% Not more than 5.0% — — — Not less than 15.0%

Inject reference solutions a and b. The test is not valid unless the relative standard deviation for the replicate injections for both the analyte peaks corresponding to phyllanthin and hypophyllanthin is not more than 2.0%. Inject the test solution, reference solution a and b. Calculate the contents of phyllanthin and hypophyllanthin. Available data on the standards for Phyllanthus emblica are compared next for the Indian, British, and Chinese Pharmacopoeias.

2.3.4  Pharmacopoeial Comparison Available data on the standards for Phyllanthus amarus are compared for the Indian Pharmacopoeia and the Indian Herbal Pharmacopoeia in Table  2.2. The data show that the assay of active marker compounds is available by the LC method only in the Indian Pharmacopoeia; also, some other parameters, like heavy metals (20 ppm) and microbial contamination tests, are available in the Indian Pharmacopoeia only.

2.4  PHYLLANTHUS FRATERNUS The drug consists of the root, stem, and leaf of Phyllanthus fraternus Webst. (Syn. Phyllanthus miruri Hook. F. non Linn.). Family: Phyllanthaceae; an annual herb, 20–60 cm high, found in central and southern India and extending to Ceylon

44

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

Vernacular names: Sanskrit: Mahidhatrika, Bhumyamalaki, Bahuphala Assam: Bhuin Amla Bengali: Bhumamla, Bhumi amalaki Gujarati: Bhoi Amali, Bhony amari, Bhonyamali Hindi: Bhui Amala Kannada: Nelanelli Malayalam: Kizanelli, Keezhanelli, Ajjhada Marati: Bhuiawali Orissa: Bhuin Amla Tamil: Kizhukai nelli, Kizanelli Telugu: Nela usirika

2.4.1  Identifications 2.4.1.1  Macroscopic Root: The root is small, 2.5–11.0 cm long and nearly straight, gradually tapering, with a number of fibrous secondary and tertiary roots; external surface is light brown; fracture is short. Stem: The stem is slender, glabrous; light brown, cylindrical, 20–75 cm long; branching is profuse toward upper region, bearing 5–10 pairs of leaves, with internode 1–3.5 cm long; odor is indistinct; taste is slightly bitter. Leaf: The leaf is compound, and leaflets are arranged in two rows with a rachis; alternate, opposite and decussate almost sessile, stipulate, oblong, entire; up to 1.5 cm long and 0.5 cm wide; greenish-brown in color; odor is indistinct; taste is slightly bitter. 2.4.1.2  Microscopic Root: The transverse section shows 4–6 layers of cork consisting of thinwalled, rectangular, tangentially elongated, and radially arranged cells filled with reddish-brown contents; the secondary cortex consists of 8–10 layers of thin-walled, tangentially elongated, parenchymatous cells; the secondary phloem narrow consists of sieve elements, phloem parenchyma, and is traversed by narrow phloem rays; secondary xylem is represented by a broad zone of tissue composed of vessels, tracheids, fibers, and parenchyma, all elements being thick walled and lignified with simple pits; xylem rays are uniseriate. Stem: A transverse section shows a single-layer epidermis composed of thickwalled, flattened, tangentially elongated cells; an older stem shows four or five layers of cork composed of thin-walled, tabular, tangentially elongated, and radially arranged cells filled with reddish-brown contents; the cortex is composed of four to six layers of oval, tangentially elongated, thin-walled, parenchymatous cells and some cortical cells filled with yellowish-brown contents; the endodermis is quite distinct; the pericycle represented by a

Current Pharmacopoeial Status of Phyllanthus Species

45

discontinuous ring composed of several tangentially elongated strands of lignified fibers with thick walls and narrow lumen; secondary phloem is narrow, composed of sieve elements, dispersed in a mass of phloem parenchyma; secondary xylem is composed of vessels, fibers, and parenchyma and is traversed by numerous uniseriate rays; vessels are mostly simple pitted, with a few show spiral thickenings; fibers are narrow elongated, with narrow or sometimes blunt ends with simple pits; the center is occupied by a pith composed of thin-walled, circular-to-oval parenchymatous cells; occasionally, cluster crystals of calcium oxalate are present in parenchymatous cells of ground tissue. Leaf: The transverse section of leaf shows a biconvex outline; epidermis on either side is a single layer covered externally by a thick cuticle; a palisade layer is present beneath the upper epidermis, intercepted by a few parenchymatous cells in the middle; meristele is composed of small strands of xylem toward the upper surface and phloem toward the lower surface; the rest of the leaf tissue is composed of thin-walled, parenchymatous cells, some having cluster crystals of calcium oxalate; lamina shows a dorsiventral structure, with mesophyll differentiated into palisade and spongy parenchyma; epidermis on either side is composed of thin-walled, tangentially elongated cells covered externally by a thick cuticle; anisocytic-type stomata are present on both epidermises; single-layer palisade; mesophyll is composed of three to five layers of loosely arranged cells with a number of veins traversing this region; a few clusters of crystals of calcium oxalate are present in spongy parenchyma. Powder: The drug powder is brown color; under the microscope it shows fragments of cork cells, vessels, and fibers.

2.5  OTHER PARAMETERS Foreign matter: Not more than 2%. Total ash: Not more than 16%. Acid-insoluble ash: Not more than 7%. Alcohol-soluble extractive: Not less than 3%. Water-soluble extractive: Not less than 13%.

2.6  CONCLUSION The current pharmacopoeial standards for Phyllanthus species as prescribed in different pharmacopoeias shows that the assay method of active marker compound is available in the Indian and British Pharmacopoeias only. However, the other physicochemical parameters are also prescribed in these pharmacopoeias and show minor differences in their limits.

46

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

REFERENCES Ayurvedic Pharmacopoeia of India, Part I, Vol. 1, pp. 111–112. Department of AYUSH, Ministry of Health and Family Welfare, Government of India. Published by the Controller of Publications, New Delhi. British Pharmacopoeia, Volume 3, pp. 3692–3693. 2010. M. G. Lee, MHRAA (Medicines and Healthcare Products Regulatory Agency), London. Chinese Pharmacopoeia, Volume 1, p. 105. 2005. People’s Medical Publishing House, Beijing. Indian Pharmacopoeia, Vol. 3, pp. 2471–2472, 2488. 2010. Ghaziabad: Indian Pharmacopoeia Commission, Ministry of Health and Family Welfare, Government of India, Ghaziabad.

Economics, 3 Cultivation, and Marketing of Phyllanthus Species B. R. Rajeswara Rao CONTENTS 3.1 Introduction..................................................................................................... 48 3.2 Phyllanthus emblica L. Syn. Emblica officinalis Gaertner............................. 49 3.2.1 Origin and Distribution....................................................................... 49 3.2.2 Botanical Classification....................................................................... 50 3.2.2.1 Cronquist System.................................................................. 50 3.2.2.2 APGII System (APG: Angiosperm phylogeny group).......... 50 3.2.3 Habit..................................................................................................... 50 3.2.4 Genetic Diversity and Conservation.................................................... 51 3.2.5 Cultivars............................................................................................... 51 3.2.6 Soil and Climate.................................................................................. 52 3.2.7 Propagation.......................................................................................... 52 3.2.8 Planting................................................................................................ 53 3.2.9 Pruning................................................................................................ 53 3.2.10 Irrigation.............................................................................................. 54 3.2.11 Cropping System and Weeding........................................................... 54 3.2.12 Manures and Fertilizers....................................................................... 54 3.2.13 Pests and Diseases............................................................................... 54 3.2.14 Fruit Development, Harvesting, and Yield.......................................... 55 3.2.15 Economics and Marketing................................................................... 56 3.2.16 Grading, Packing, and Storage............................................................ 57 3.2.17 Products from Indian Gooseberry....................................................... 57 3.2.18 Chemical Composition........................................................................ 57 3.2.19 Uses...................................................................................................... 58 3.2.20 Nutritive Value of the Fruits................................................................ 58 3.2.20.1 China..................................................................................... 58 3.2.21 Limits for Quality Parameters............................................................. 59 3.3 Phyllanthus amarus Schumach. and Thonn. . ................................................ 59 3.3.1 Species, Origin, and Distribution........................................................ 59 3.3.2 Botanical Classification.......................................................................60 3.3.2.1 Cronquist System..................................................................60 3.3.2.2 APGII System.......................................................................60 47

48

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

3.3.3 Habit..................................................................................................... 61 3.3.4 Genetic Diversity and Conservation.................................................... 61 3.3.5 Cultivars............................................................................................... 62 3.3.6 Soil and Climate.................................................................................. 62 3.3.7 Propagation.......................................................................................... 62 3.3.8 Transplanting....................................................................................... 62 3.3.9 Irrigation.............................................................................................. 63 3.3.10 Weed Control....................................................................................... 63 3.3.11 Fertilizers and Manures....................................................................... 63 3.3.12 Pests and Diseases............................................................................... 63 3.3.13 Harvesting and Yield........................................................................... 63 3.3.14 Economics and Marketing...................................................................64 3.3.15 Chemical Composition........................................................................64 3.3.16 Uses......................................................................................................64 3.3.17 Safety Issues and Adulteration............................................................64 3.4 Cultivation of Other Phyllanthus Species....................................................... 65 3.4.1 Phyllanthus urinaria L. and Related Species...................................... 65 3.4.2 Phyllanthus acidus (L.) Skeel (Syn. Cicca acida (L.) Merr., Averrhoa acida L.)............................................................................... 65 3.4.3 Phyllanthus indofischeri Bennet (Syn. Emblica fischeri Gamble)......66 3.4.4 Phyllanthus reticulatus Poir. (Syn. Kirganelia reticulata (Poir.) Baill.)...................................................................................................66 3.4.5 Phyllanthus piscatorum Kunth............................................................66 3.4.6 Phyllanthus sellowianus Mull. Arg., Phyllanthus stipulatus (Raf.) Webster......................................................................................66 3.5 Conclusions...................................................................................................... 67 Acknowledgment...................................................................................................... 67 References................................................................................................................. 67

3.1  INTRODUCTION Medicinal plants (MPs) and their products constitute a treasury of immense value to humankind. Nearly 72,000 MP have been used in diverse human cultures, and many are contemporary local and external trade commodities. The majority of MP supplies are sourced from the wild, and not more than 900 are cultivated (Schippmann et al., 2006). Loss of habitat through conversion of forestland to agriculture, forest fires, and encroachment for habitation is causing a rapid decline of native MP populations. Emphasis is placed on systematic MP cultivation for conservation and sustainable supplies (Schippmann et al., 2006). The genus Phyllanthus of Euphorbiaceae (Phyllanthaceae) comprises more than 800 species of aquatic plants, trees, shrubs, climbers, and annual and perennial herbs distributed in tropical and subtropical regions of both hemispheres (Webster, 1994). A number of species provide food, fodder, fruit, fuel, timber, dyes, and pharmaceutical, cosmeceutical, nutraceutical, and industrial products. Several species find extensive use in local medicine systems, and a few are cultivated in countries of origin on a small scale. Cultivation of Phyllanthus emblica, P. amarus, and other species is described.

Cultivation, Economics and Marketing of Phyllanthus Species

49

3.2 PHYLLANTHUS EMBLICA L. SYN. EMBLICA OFFICINALIS GAERTNER Phyllanthus emblica (amlaki, amla, aonla, Indian gooseberry, emblic myrobalan, and emblica) has been known in India for 3,500 years (Murthy and Joshi, 2007), with mention in ancient texts of religion and Ayurveda (medicine system) and is worshipped with the belief that it nurtures humankind. In China, it is called Yuganzi. It is popular in the East, where a number of countries utilize diverse plant parts in local medicine systems. It is grown in the Indian subcontinent, China, Taiwan, Indonesia, Malaysia, Thailand, Sri Lanka, Honduras, Costa Rica, and Reunion Island (Murthy and Joshi, 2007) in orchards, agricultural field bunds, home gardens, avenues, wastelands, and forests. Wild fruits are important nontimber forest products of trade for tribal/ethnic groups and food for wild animals. In India, P. emblica is cultivated in Uttar Pradesh, Gujarat, Rajasthan, Tamilnadu, Andhra Pradesh, Maharashtra, and Madhya Pradesh in over 50,000 hectares (ha) with more than 200,000 tonnes (t) fruit production, which includes wild collections. Figure 3.1 (also see color insert) shows the morphology of common Phyllanthus species.

3.2.1  Origin and Distribution Emblica is native to tropical southeastern Asia, specifically central and southern India (Firminger, 1947), and is found growing in dry, hot, deciduous, and moist forests up to 2,000 m altitude from Myanmar to Afghanistan, Sri Lanka to China, and in Cuba, Hawaii, Iran, Iraq, Malaysia, West Indies, Indonesia, Puerto Rico, Singapore, Thailand, and Trinidad and Tobago.

(a)

(b)

(c)

(d)

FIGURE 3.1  See color insert. Morphology of some of the common species of Phyllanthus. (a) Phyllanthus emblica tree (insert: a fruiting branch); (b) Emblica orchard; (c) P. maderaspatensis; (d) P. reticulatus (insert: a twig with fruit).

50

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

3.2.2  Botanical Classification 3.2.2.1  Cronquist System Domain: Eukaryota Kingdom: Plantae Subkingdom: Viridaeplantae Phylum: Tracheophyta Subphylum: Euphyllophytina Superdivision: Spermatophyta Division: Magnoliophyta Class: Magnoliopsida Subclass: Rosidae Order: Euphorbiales Family: Euphorbiaceae Subfamily: Phyllanthoideae Tribe: Phyllantheae Subtribe: Flueggeinae Genus: Phyllanthus Species: emblica L. Synonyms: Emblica officinalis Gaertner, Cicca emblica Kurz., Mirobalanus emblica Burm., Phyllanthus mairei Lev. 3.2.2.2  APGII System (APG: Angiosperm phylogeny group) Domain: Eukaryota Regnum: Plantae Clade: Angiospermae Clade: Eudicots Clade: Core eudicots Clade: Rosids Clade: Eurosids I Order: Malpighiales Family: Phyllanthaceae Subfamily: Phyllanthoideae Tribe: Phyllantheae Subtribe: Flueggeinae Genus: Phyllanthus Species: emblica L.

3.2.3  Habit Emblic is a small-to-medium (8–18 m tall) size tree (Hong Kong and Borneo: 23–32 m tall) having a crooked trunk with smooth, grayish-brown, thin, exfoliating bark. The tree produces two types of shoots: The short, determinate type, which are shed annually, bear flowers; the long, indeterminate shoots add annual growth. Branchlets are round, glabrous or finely pubescent, deciduous. Light green, lemon-like smelling, oblong, feathery, subsessile leaves are simple,

Cultivation, Economics and Marketing of Phyllanthus Species

51

alternate, and distichous and are closely arranged; the apex is obtuse to acute, base rounded, asymmetrical, glaucous below; the margins are entire and thickened. Stipules are oval. Emblic flowers during February to May. Warm temperature is conducive for floral bud initiation. Small, apetalous, unisexual, greenish-yellow flowers appear in clusters of 6–10 in leaf axils as cymules. Basal flowers are pedicellate male flowers with six calyx lobes and three connate stamens; apical flowers are sessile, yellow, with the female flowers having six perianth lobes and an ovary crowned by three styles deeply bifid at the apex. Male flowers open in the morning and/or the afternoon, dehiscing anthers soon after. Female flowers open in stages, requiring 72 h for completion. The stigma becomes receptive on the third day of anthesis. Flowering lasts for 3 weeks. Flowers are pollinated by wind and honey bees. Self-pollination results in low fruit set. Open and cross pollinations produce 45–82% fruit set with 10–50% retention at maturity. Flower and fruitlet shedding is common due to lack of pollination/fertilization, adverse weather, and physiological reasons. After fruit set in March–June, fruitlets pass through auxin-induced dormancy for 3½ months before resuming growth during the monsoon; they ripen during October–February (7–8 months). A dry spell during monsoon induces fruit shedding and delays fruit growth and maturity. Smooth and hard fruit, a capsule with six striations extending from base to the apex, is globose, depressed at the poles, 1–5 cm in diameter with fleshy, acidulous pulp; shining yellowish-green/greenish-yellow when ripe, the fruit encases a hard, hexagonal, stony endocarp. Fruit skin is thin and translucent and is firmly attached to the crisp, juicy flesh. The fruit weighs 15–50 g. The stone, tightly set in the center of the flesh, is six ribbed with fleshy pericarp, enclosing two hard, trigonous seeds, each in three crustaceous cocci. The seed weighs 0.4–2.0 g. Dry fruits have a shriveled and wrinkled surface with whitish specks of mucic acid crystals. The fruit tastes sour and astringent with sweet, bitter, and pungent secondary tastes. Somatic chromosome number 2n = 28, 98, or 104 (Ammal and Bhagawan, 1957; Jansen, 2005).

3.2.4  Genetic Diversity and Conservation Western Ghats, Eastern Ghats, Central India, and Yunnan Province in China (Li and Zhao, 2007) are rich sources of genetic diversity. Establishment of forest gene banks for in situ conservation of genetic diversity was suggested, but the unsustainable harvest methods of local communities are quickly eroding the genetic base. Alternate conservation strategies need to be urgently devised.

3.2.5  Cultivars Several cultivars with differing maturity periods are grown in India. Banarsi, Krishna, and Balwant are early maturing (October–November); Francis, Kanchan, and Amrit are medium-early maturing (November–December); Neelam, BSR-1, and Chakaiya are late maturing (December–January). BGK-1, Faizabad, Gujarat amla-1, Anand-1,2,3, NA-8,9,18, Mehrun, Dongri, Banarsired, Agrabold, and Modibagh are also grown with local types. In Pakistan the Desi, Shisa, and Banarsi varieties and

52

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

in China, Lanfeng, Fen’gan, Liuyuebai, Bian’gan, Quibai, and Shan’gan varieties (Wang et al., 2006) are commercially cultivated. Balwant and Kanchan are suitable for rain-fed, dry areas; Banarsi, Kanchan, BSR-1, Chakaiya, Amrit, Neelam, and Balwant are suitable for saline/sodic soils.

3.2.6  Soil and Climate The deep root system and reduced foliage make emblic a hardy tree suitable for subtropical, tropical, dry, arid, semiarid, and humid regions. Annual rainfall of 600–800 mm produces a good yield. Young trees are sensitive to dry, hot winds and low temperatures. Mature trees tolerate freezing and high temperatures (46°C). Emblic is susceptible to frost but survives forest fires through regeneration and is suitable for growing in sandy loam to clay, poor-to-marginal soils with pH 6.5–9.5, 30 ESP: (exchangeable sodium percentage), ds/m: deciSiemens meter, and up to 10 dS/m EC (electrical conductivity). well-drained, deep, fertile sandy loams are ideal for cultivation. Waterlogged, heavy, and sandy soils are unsuitable (Tiwari et al., 2007).

3.2.7  Propagation Seed and vegetative propagation is feasible. Seed propagation results in a heterogeneous population bearing small-size fruits. Natural regeneration in forests continues through seeds. Orchards are raised with grafted or budded plants. Ripe fruits collected in December–February are sun dried until they release seeds, which are floated in water to discard floaters and are utilized for raising rootstock. Germination (35–50%) starts within 20 days and is complete in 40 days after sowing. Seeds treated with 100–500 ppm GA3, (gibberellic acid) 100 ppm kinetin, 1% thiourea, 0.5–1% potassium nitrate, VAM (vesicular arbiscular micorrhizal) fungi, Azospirillum brasilens, Azotobacter chroococcum, and Trichoderma viride exhibit enhanced germination (70–93%), seedling growth, and vigor (Aseri and Rao, 2004; Kumari et al., 2007; Tiwari et al., 2007). Seeds are sown in March–April in raised beds or polyethylene tubes/bags. Seedlings that are 6–12 months old are grafted or budded. Pesticide-treated seeds (8–10% moisture) packed in a cloth bag can be stored for 21 months under ambient conditions and for 24 months in 700-gauge polyethylene bags at 5°C (Srimathi and Sujatha, 2007). Vegetative propagation through budding (patch, shield, ring, eye, T) (Singh et al., 2005), grafting (approach, cleft, wedge, veneer, softwood), and cuttings (softwood or hardwood) is practiced with 60–90% success. Inarching is impractical due to erect habit and availability of a limited number of shoots. Pencil thick, 8- to 10-cm long scion sticks with four to six activated buds cut from semihardwood or softwood branches are good for grafting with 95% success (Panchbhai et al., 2006). Scion sticks can be preserved for 5–7 days. Grafting is performed 2–15 cm above the collar region depending on rootstock thickness and age. Pencil-thick shoots of the previous season with four or five plump buds swollen up to 2 mm are suitable for budding (Panchbhai et al., 2006). Storing buds even for a day results in poor sprouting (33%). Spring (February–March) and rainy (July–September) seasons sustain

Cultivation, Economics and Marketing of Phyllanthus Species

53

successful grafting and budding. Grafting or budding is performed in the nursery, a room (bench grafting), or the field (in situ). Grafts and buds start sprouting 10–30 days after grafting and budding, reaching measurable growth in 2 months. Seedling growth can be hastened by applying biofertilizers. Old or unproductive orchards are rejuvenated with top working through patch budding or wedge grafting (Tiwari et al., 2007). In situ grafting on field-grown rootstock is ideal for dry and rain-fed areas. Softwood and semihardwood stem cuttings with four to six leaves are amenable for rooting with hormones (5,000 ppm IBA: (Indole butyric acid) + 5,000 ppm NAA (naphthylacetic acid)) but are rarely utilized for raising orchards. Micropropagationmediated plant multiplication techniques have been standardized in India and China but are yet to be commercialized.

3.2.8  Planting Rainy (July–September) or spring (February–March) season planting is adopted by digging 50- to 100-cm3 pits that are kept open for a few weeks. Pits are filled with dug soil mixed with 20 kg FYM (farmyard manure), 1 kg neem cake, 500 g bone meal, 1 kg single superphosphate, and 100 g 10% BHC (benzene hexachloride) or carbaryl (+5–8 kg gypsum in saline/sodic soils) and watered (Tiwari et al., 2007). Budded or grafted plants are transplanted, maintaining a population density of 156– 494 plants/ha, adjusting inter- and intrarow distance from 4 to 8 m (4.5 × 4.5, 6 × 6, 7 × 7, 8 × 8 m or 8 ×4 or 5 m, etc.) in square or rectangular (hedge) planting methods. Self-incompatibility and lack of pollination results in 70% flower shedding in singlecultivar orchards. Two or more cultivars are planted in suitable ratios (Tiwari et al., 2007), often including plants raised through seeds to encourage open and cross pollinations for high fruit set.

3.2.9  Pruning Branches are brittle; therefore, to avoid breakage from heavy fruit loads, to develop a strong framework, and to facilitate easy harvesting trees are pruned to medium head size. Young trees are pruned to grow straight up to 75–100 cm without branches and are trained to a modified central leader system. Two to four opposite branches with wide crotch angles are retained during early years, and four to six branches are retained in subsequent years. During March to April, crowded branches are clipped. Pruning fruit-bearing trees induces growth and early flowering and increases fruit set, retention, fruit size, volume, and yield (Singh and Singh, 2008). Dead, infested, broken, overlapping, twisted branches and rootstock suckers are removed periodically.

3.2.10  Irrigation Indian gooseberry is drought hardy. Mulching with pruned branches, organic material (paddy husk, maize straw, grasses), or 200-gauge black polyethylene sheet is very effective in establishing orchards in sodic soils, ravines, and rain-fed, semiarid, and dry areas and for conserving moisture and increasing yield (Shukla et al.,

54

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

2000; Tiwari et al., 2007). Mulching over time helps in building soil organic matter, infiltration rate, and biological activity. Pitcher watering is followed in water-scarce areas. Young plants are watered immediately after planting and at 10- to 15-day intervals in summer and the nonrainy season. Established fruit-bearing plantations are irrigated once every 15–20 days during summer, fruit setting, and development stages to reduce fruit drop and increase fruit yield. Irrigation is withheld during flowering. Plants need 10 (1–2 years), 15 (3–5 years), and 20–30 (6 years and older) liters water/day. Flooding, basin, and ring methods are in practice. Drip irrigation conserves water (40–50%), regulates weed growth, and allows simultaneous fertilizer application. Alternate-day drip irrigation is superior to basin irrigation (Shukla et al., 2000) and is practiced in recently established orchards.

3.2.11  Cropping System and Weeding Orchards are kept weed free through mechanical and manual methods for good plant growth and to control pests harboring on weeds. Wide-spaced emblic is suitable for a two- or three-tier cropping system. Flower, vegetable, spice, agricultural, medicinal, and aromatic crops (Awasthi et al., 2009; Singh, 2006; Singh et al., 2008c; Tiwari et al., 2007) are intercropped for additional revenue. A hortipastoral system with Dichanthium annulatum, Chrysopogon fulvus, Cenchrus ciliaris and Stylosanthes hamata provides fodder, controls soil and water runoff, and conserves moisture and nutrients. Emblic is cultivated as a companion crop in coconut, guava, ber, tea, and other orchards.

3.2.12  Manures and Fertilizers To sustain high fruit yields during productive life (50–75 years), manure and fertilizer application is essential. A 1-year-old tree is supplied with 10 kg FYM, 100 g nitrogen, 50 g phosphorus, and 75 g potassium, and the rate is increased with age up to 10 years in required proportions. Ten- to 12-year-old trees need 0.5–1.5 kg nitrogen, 0.25–1.0 kg phosphorus, 0.375–0.8 kg potassium, 50.0 kg FYM, and 5.0 kg pressmud per year. Half of the fertilizer rate is applied before flowering and the rest in the rainy season or after fruit set (Singh et al., 2008a; Tiwari et al., 2007). Boron deficiency-induced fruit necrosis is prevented by three sprays of 0.6% borax. Nitrogen, potasisum, zinc, copper, boron (0.2–0.6%), 10 ppm NAA, calcium nitrate spraying improves plant growth, fruit retention, yield, and physicochemical properties (Singh et al., 2008b). Vermicompost, VAM fungi (Glomus fasciculatum), Azospirillum brasilens, and Azotobacter chroococcum application is beneficial. Alkali soils need the addition of gypsum.

3.2.13  Pests and Diseases Sucking, boring insect pests, nematodes, and fungal and bacterial diseases (Table  3.1) adversely affect fruit yield and quality (Tiwari et al., 2007). Insect pests are controlled by contact, systemic insecticides 0.05% endosulfan, 0.05% monocrotophos, phorate10G 10 g/plant, 0.05% quinalphos, and 0.04% dimethoate.

Cultivation, Economics and Marketing of Phyllanthus Species

55

TABLE 3.1 Pests and Diseases of Indian Gooseberry Pest/Disease Bark-eating caterpillar Shoot gall maker Leaf-rolling/hairy caterpillar Aphid Mealybug Plant bug Anar butterfly Termite Fruit midge Stone borer Aonla rust Fruit rot/blue mold Leaf/fruit rust Seedling root rot Anthracnose Dieback of branches Dry fruit rot Soft rot Brown fruit rot

Causal Organism Indarbela tetraonis/quadrinotata Betousa (Hypolamprus) stylophora Garcillaria acidula, Selepa celtis, Tonica ziziphy Schoutedenia (Cerciaphis) emblica/bougainvilliae (ralumensis) Nipaecoccus vastator/viridis, Drosicha mangiferae Scutellaria nobilis Virachola (Deudorix) isocrates Odontotermes species Clinodiplosis species Cuaulio species Ravenelia emblicae var. pinnular/fructiocolar Penicillium oxalicum/islandicum/citinum, Aspergillus niger/terreus, Pestalotia cruenta, Nigospora sphaerica Phakospora phyllanthii Rhizoctonia solani Glomerella cingulata Lasiodiplodia (Botryodiplodia) theobromae Phoma emblicae/putaminum, Cladosporium tenuissimum, Alternaria alternata Phomopsis phyllanthii, Syncephalastrum racemosum Colletotrichum sp., Aspergillus luchuensis, Fusarium acuminatum, Fusarium moniliforme var. subglutinans, Fusarium equiseti, Penicillium funiculosum

Fungal diseases are controlled by 1% bordeax mixture, 0.3% mancozeb, 0.1% carbendazim, and 0.3% copper oxychloride. Natural enemies Cheilomenes sexmaculata/septempunctata, Cotesia ruficrus, Charops obtusus, and Apanteles species control aphids and sucking pests. Four spider species (Neoscona, Peucetia, Argiope, Oxyopes) feed on mealybugs. Mantids prey on different pests. Emblic trees suffer damage through plant parasite mistletoe (Taxillus tomentosus, family: Loranthaceae); in China, this occurs through brown spot (Phyllosticta emblicae), false anthracnose (Kabatiella emblicae), powdery mildew (Oidium sp.), and leaf spot (Pestalotiopsis heterocornis).

3.2.14  Fruit Development, Harvesting, and Yield Emblica is a long-day tree, producing flowers in March–May in northern India and June–July and February–March in southern India. High temperatures and hot, dry winds adversely affect fruit set and add to flower and fruitlet shedding. Adequate humidity is essential for fruit growth initiation. Initial growth is rapid, and fruit development follows a double sigmoid growth pattern (Singh et al., 2008d). Grafted,

56

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

budded trees start fruiting 3–5 years after planting and produce commercial yield in 8–10 years. Seed-raised trees have a 6- to 12-year gestation period. Fruit maturity is judged by changes in physicochemical properties. Maturity indices provide primary armor against deterioration of physical appeal, quality loss, and microbial decay and determine harvesting stage, shelf life, marketability, and price (Tiwari et al., 2007). During development, the fruit size and weight increase, and the color changes from green to yellow; the seed color changes from creamy white to brown or black; specific gravity, total soluble solids (TSS), total and reducing sugars, and ascorbic acid contents increase until maturity; acidity decreases as the fruits reach maturity (Singh et al., 2008d). Fruit length and diameter increase for up to 90 days; volume increases for up to 75 days, and color change appears 120 days after fruit set. Forest fruits are hand picked by climbing trees or lopping, pollarding, and coppicing the branches. In extreme cases, trees are cut. Market demand-driven competition triggers harvesting immature fruits. For tanning, unripe fruits are harvested, branches are coppiced, and the bark is quickly sun dried. Orchards are manually harvested in the morning using bamboo, a ladder, or a harvester, exercising care not to injure the fruits. Shaking trees and spreading a plastic or canvas sheet are also in practice. Delayed harvesting affects yield in the following year. Fruit yield is cultivar dependent. Potentially, a tree can yield 300 kg of fruit. Calculated potential yields with 156 (8 × 8 m) and 494 (4.5 × 4.5 m) plants are 46.8 and 148.2 t/ha, respectively. Average fruit yield is 25–50 kg/tree in rainfed, arid, semiarid areas and 50–70 kg/tree or 15–25 t/ha with good management. At provincial and national levels, average yield is 3–5 t/ha. In China, 8 t/ha yield is reported.

3.2.15  Economics and Marketing Initial orchard establishment cost, excluding land cost, ranges from Rs 17,000 to 54,500/ha ($350–1,250) and recurring cost for the first 3 years from Rs 32,000 to 35,000/ha ($700–800). Production cost from the 4th year ranges from Rs 41,000 to 49,000/ha ($900–1,100). Returns start from the 4th year, reaching a maximum in the 15th year and remaining profitable thereafter. The estimated gross and net returns, respectively, are as follows: Rs 99,000–118,000 ($2,200–2,700) and Rs 58,000– 68,700/ha ($1,300–1550). The net return is highest in the 15th year (Rs 152,600/ ha or $3,400) (Gondalia and Patel, 2007). Net returns ranging from Rs 20,000 to 49,250/ha ($450–1,100) for pure emblica and more than Rs 90,000/ha ($2,000) for intercropped emblica (Singh, 2006) have been reported. It is more profitable to maintain a nursery with a maintenance cost of Rs 293,600 ($6,500) and a net profit of Rs 246,400 ($5,500) (Bhatia et al., 2007). The fruit price is low (Rs 4–5/kg) in the north and high (Rs 15–30) in southern India, where Kerala Province, with number of Ayurvedic pharmacies, is the major market. In the north, herbal pharmacies consume large quantities. A small quantity (30 t) is exported from southern India to Singapore and Malaysia. Lack of interest in the West restricts the market to producing countries, although products and extracts are offered for sale by several companies on the Internet, with no trade data provided.

Cultivation, Economics and Marketing of Phyllanthus Species

57

3.2.16  Grading, Packing, and Storage Fruits are graded into three sizes; large fruits (4-cm diameter) are utilized for manufacturing preserve (murabba), candy, pickles; medium fruits are used for making other products, and small fruits are used for pharmaceutical products. A considerable proportion of fruits is lost through spoilage due to imperfect packing and storage. Proper fruit packing and storage should arrest metabolic deterioration and extend the shelf life for marketing and processing. Harvested fruits of different cultivars can be stored at room temperature for 4–7 days in gunnysacks and baskets lined with newspapers. Shelf life can be extended to 9 days by storing fruits in perforated polyethylene bags, 12–18 days in a low-energy cool chamber (Kumar and Nath, 1993), 30 days in 200-gauge high-density polyethylene bags kept in cardboard boxes, 60 days at 5–7°C, 90 days in 15% brine solution at room temperature (Kumar et al., 1992), and 24 months in polyethylene bags after gamma-ray irradiation. For longdistance transport, polyethylene-lined wooden boxes or corrugated fiberboard boxes are best suited (Pathak et al., 1989; Singh et al., 2009). Spraying chemicals/fungicides during fruit development; dipping fruits in boiling water (blanching), diphenyl, potassium metabisulfite, calcium nitrate, growth hormones (GA3, kinetin), and fungicides extends shelf life. Dehydration or drying fruits or fruit segments, slices, shreds, flakes, powder through diverse methods (sun, shade, solar, oven, osmo-air, osmo-vacuum, vacuum, cabinet air, fluidized bed, alternating current high electric field exposure) and treating them with chemicals, growth regulators, and wax emulsion coating were tested for retaining ascorbic acid content and extending shelf life and provided with different degrees of success. Reduction in physiological mass, ascorbic acid content, and acidity and increase in TSS, total and reducing sugars, total phenols, and carotenoids occur during storage; decrease in mass, chemical constituents; browning and spoilage occur due to disease infection.

3.2.17  Products from Indian Gooseberry Emblica is used in 35 ways (Murthy and Joshi, 2007) as a vegetable, for quenching thirst, seasoning, and flavoring; for making food, pharmaceuticals, cosmeceuticals, nutraceuticals, and industrial products. Different cultivars lend themselves for preparing different products: Amrit and Neelam for candy, sweets, jam, chutney, chyawanprash, pickles, squash; Kanchan and Krishna for candy, jam, pickles; Banarsi for drying and preserves; Chakaiya for pickles, syrup, chutney; Francis for preserves; and Balwant for dehydration and pickles. Herbal tea, toffee, dehydrated fruit segments/slices, jelly, juice, beverages, powder, sauce, supari, gulkand, pomace, hair oil/dye, ink, face cream/pack, shampoo, tooth powder, and fabric dye are also made from fruits.

3.2.18  Chemical Composition Tannins (18–35% unripe fruit, 8–21% stem bark, 12–24% twig bark, 22–28% leaves), and ascorbic acid are major fruit constituents. The sensitivity of water-soluble, volatile ascorbic acid to heat, oxygen, and light makes it liable to be lost first by oxidation

58

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

to dehydroascorbic acid and then to 2,3-keto gulonic acid during cleaning, drying, storing, cooking, and processing. Under ambient conditions and at 4°C, fruits lose 45–60% and 32–45% ascorbic acid, respectively in 4 days. Complete oxidation is prevented by tannins in the fruit. The presence of ascorbic acid in the fruit was questioned (Ghosal et al., 1996), but the controversy was put to rest by proving its presence by precise analytical techniques (Raghu et al., 2007). Alkaloids, flavonoids, saponins, glycosides, terpenoids, phenolics, and polyphenols have also been isolated from plant parts. Seeds contain essential oil (β-caryophyllene, β-bourbonene, pentadecanone, heptadecanol, eugenol, nerol, thymol, borneol) and brownish-yellow fixed oil (16–22% with 44% linoleic, 28% oleic, 6–9% linolenic, 3% palmitic, 2% steric, and 1% myristic acids).

3.2.19  Uses Fruit is acidic and cooling, refrigerant, carminative, laxative, alexiteric, antipyretic, and diuretic and an antioxidant and is used in treating diabetes, cough, chronic dysentery, diarrhea, dyspepsia, peptic ulcer, hemorrhage, anemia, jaundice; diseases of the chest, head, heart, reproductive organs; and metabolic and aging disorders. The seed is employed for treating asthma, bronchitis, biliousness, nausea, and diabetes, and burnt seed oil is used for skin afflictions. The bark is utilized for tanning (reddish-brown, less-flexible leather), dyeing fabric, and curing gonorrhea, diarrhea, jaundice, and myalgia; fresh bark juice is used for gonorrhea. Root bark is astringent and is useful for ulcerative stomatitis and mouth inflammation. Flowers are refrigerant and aperient. Leaves (4.5% ash, 48.0% carbon, 1.5–2.1% nitrogen, 2.0% calcium, 15–36 ppm zinc, 4–8 ppm copper, 45–72 ppm manganese, 318–972 ppm iron) are used as fodder for cattle, for green manure, mulch, tanning, dyeing fabric, and alleviating dysentery, dyspepsia, conjunctivitis, and inflammation. Wood (red, hard, and flexible, undergoes warping and splitting, 720–930 kg/m3 at 15% moisture) is used for minor construction and for making furniture, implements, water-conducting pipes, water clarification; it serves as fuel and as a source of charcoal.

3.2.20  Nutritive Value of the Fruits The fruit is the richest source of vitamin C next to Barbados cherry, containing 20 times that of two oranges and 160 times that of apple. The fruit contains higher concentrations of minerals (Table 3.2) and amino acids (5% alanine, 5% lysine, 14% proline, and 8% aspartic and 29% glutamic acids) than apple (Murthy and Joshi, 2007). 3.2.20.1  China In China, nutritive values of the fruits are as follows: 79.8–87.0% moisture, 6.6– 14.1% carbohydrates, 0.2–1.1% fats, 0.7–2.2% protein, 6.7% reducing sugar, 0.3–0.6% sugar, 1.1–2.9% glucose, 1.8–2.9% fructose, 200–1,561 mg/100 g ascorbic acid, and 13.0 g fruit weight (Chen et al., 2003).

59

Cultivation, Economics and Marketing of Phyllanthus Species

TABLE 3.2 Physicochemical Characteristics of Indian Gooseberry Fruit Factor Value Factor

Fruit Size (cm2) 8–16

Volume (cm3) 30–57

Value (%)

Factor

Length (cm) 3.0–4.5 Value (%)

Moisture Protein

77.0–84.0 (6.0–9.0) 0.5–0.75 (2.5–3.5)

Pulp Pectin

86.0–95.0 2.4–3.1

Fat Carbohydrate Fiber Minerals Calcium

0.1–0.5 (1.2–2.0) 14.1–21.9 (53.0) 1.1–4.3 (17.0) 0.5–2.4 (4.0–6.0) 0.012–0.05

Phosphorus

0.03–0.2

Ash Miscellaneous

0.5–0.6 0.5–0.7 (2.5–3.5)

Seed TSS Acidity Phenols Reducing sugars Nonreducing sugars Total sugars Specific gravity

Breadth (cm) 3.5–5.0 Factor

Value (mg/100 g) 0.5–1.2 0.2

4.0–6.0 8.0–23.0 1.4–3.2 2.0–5.0 3.4–11.0

Iron Nicotinic acid Vitamin C Carotene Thiamine Riboflavin Tryptophan

1.1–3.2

Methionine

2.0

3.5–16.7 1.0–1.2

Lysine —

17.0

200–1,814 0.01 0.03 0.05 3.0

—

Source: Several published reports. Note: Values in parentheses are for dried fruit.

3.2.21  Limits for Quality Parameters For industrial use and export, the limits for quality are as follows: not more than 3% foreign matter; not more than 5% total ash; not more than 2% acid-insoluble ash; not less than 40% alcohol-soluble extractive; and not less than 40% water-soluble extractive.

3.3  PHYLLANTHUS AMARUS SCHUMACH. AND THONN. Phyllanthus amarus (carry me seed, Bhumyamalaki) and related species have been known in India for over 2,000 years for their medicinal value. Phyllanthus amarus is derived from the Greek words phyllon or phulon (leaf) and anthos (flower or flower cluster) and the Latin word amara (bitter). The name alludes to flowers produced in bitter leaf axils. The plant shot into prominence after its activity against hepatitis B and related hepadna viruses was scientifically proved. It is cultivated in southern India in less than 100 ha with less than 100 t biomass production.

3.3.1  Species, Origin, and Distribution Ambiguity prevailed in the past on the true identity of Phyllanthus amarus, P. debilis Klein ex Willd. (niruri), P. fraternus Webster (gulf leaf flower), P. niruri L. (stone

60

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

breaker, chanca piedra), and P. urinaria L. (hurricane weed, chamber bitter). Recent studies of macromorphology, micromorphology, and histochemistry and electron microscopic, chemical, and DNA profiles clearly differentiated these species. Phyllanthus niruri is indigenous to Amazon and other tropical regions. Phyllanthus amarus originated in the Caribbean as a vicarious species of P. abnormis and has spread around the tropics (Webster, 1957). Phyllanthus debilis is native to the Indian subcontinent and is naturalized in many countries. Phyllanthus fraternus is native to western India and Pakistan and is distributed in Asia and the West Indies. Phyllanthus urinaria is indigenous to India, China, and the Bahamas. Phyllanthus amarus and P. urinaria occur throughout India; P. amarus is more common in Eastern Ghats and P. urinaria in northern India. Phyllanthus fraternus is more abundant in northwestern India and P. debilis in Western and Eastern Ghats. These species grow as weeds in cultivated fields and abandoned terrains.

3.3.2  Botanical Classification 3.3.2.1  Cronquist System Domain: Eukaryota Kingdom: Plantae Subkingdom: Viridaeplantae Phylum: Tracheophyta Subphylum: Euphyllophytina Superdivision: Spermatophyta Division: Magnoliophyta Class: Magnoliopsida Subclass: Rosidae Order: Euphorbiales Family: Euphorbiaceae Subfamily: Phyllanthoideae Tribe: Phyllantheae Subtribe: Phyllanthinae Genus: Phyllanthus Subgenus: Phyllanthus Section: Phyllanthus Subsection: Swartziani Species: amarus Schumach. and Thonn. Synonyms: Phyllanthus nanus Hook. Phyllanthus niruri auct. non L. 3.3.2.2  APGII System Domain: Eukaryota Regnum: Plantae Clade: Angiospermae Clade: Eudicots Clade: Core eudicots

Cultivation, Economics and Marketing of Phyllanthus Species

61

Clade: Rosids Clade: Eurosids I Order: Malpighiales Family: Phyllanthaceae Subfamily: Phyllanthoideae Tribe: Phyllantheae Subtribe: Phyllanthinae Genus: Phyllanthus Subgenus: Phyllanthus Section: Phyllanthus Subsection: Swartziani Species: amarus Schumach. and Thonn.

3.3.3  Habit Phyllanthus amarus is an erect, annual herb, 10–60 cm tall, attaining 1.0 m height at maturity. Mature plants have a slightly woody, simple or branched, smooth, terete, straminous, or brownish stem. Cataphylls are stipulate, broadly deltoid, acuminate, entire, scarious, brownish; the blade is subulate, acuminate. Branchlets are subterete, smooth, or sometimes slightly scabridulous. Leaves are 5–11 mm long, 3–6 mm broad; somewhat thickened; closely arranged; stipulate; elliptic oblong, obovateoblong, or even obovate; entire, obtuse or rounded and apiculate at apex; obtuse or rounded, slightly inequilateral at base; bright green above; grayish beneath; margins are plane, smooth, or obscurely, minutely roughened. Flowers are monoecious, with the proximal one or two axils with unisexual cymules of one or two male flowers; all succeeding axils have bisexual cymules, each with one male and one female flower. The plant flowers throughout its lifetime. The male flower is pedicellate with five calyx lobes, five disc segments, three stamens, and divergent anther sacs, which dehisce obliquely or horizontally; pollen grains are finely reticulate. The female flower is pedicellate with five calyx lobes, five lobed disc, styles are free, and it is shallowly bifid. Pollination is through wind, small insects, and ants (Sharma et al., 2009). Capsules are oblate, 1.8–2.1 mm in diameter, smooth, and stramineous. There are six seeds, which are sharply trigonous; light brown, tan, or yellow; 0.9–1.0 mm long; 0.7–0.8 mm radially and tangentially; and with five or six ribs on the back (Bagchi et al., 1999). Seeds attain maturity 55 days after anthesis (Reddy et al., 2007). The somatic chromosome number 2n = 26.

3.3.4  Genetic Diversity and Conservation Plants collected from diverse Indian regions exhibited less than 70% variation and polymorphism (Jain et al., 2003; Meenakshisundaram and Maheswaran, 2008). Wide distribution of the species and ability to produce abundant seeds do not warrant conservation of the species at present.

62

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

3.3.5  Cultivars Red, green, and intermediate stem color types were identified in Florida; the intermediate type produced higher yields (Unander et al., 1993). Local, Navyakrit (78 cm tall, 2.0 g/plant dry biomass yield, 0.52% phyllanthin), and CIM-Jeevan (65 cm tall, 11.0 g/plant dry biomass yield, 0.7–0.77% phyllanthin and 0.32–0.37% hypophyllanthin) (Gupta et al., 2003) varieties are cultivated in India. Agrobacterium tumefaciens-mediated transgenic plants were developed using shoot tip explants (Banerjee and Chattopadhyay, 2009). Somaclone development through tissue culture was attempted. Calli, calli-mediated shoots, and roots contained higher concentrations of alkaloids, saponins, tannins, and other compounds compared to mother plants (Marimuthu, 2007).

3.3.6  Soil and Climate Phyllanthus amarus grows well under semitemperate to tropical conditions at up to 800 m altitude. It rarely survives under dry or very low temperatures but tolerates waterlogging. Plant growth is restricted under shade. The plant is well adapted to calcareous, well-drained, light-textured soils with acidic to alkaline pH. Soils contaminated with heavy metals are unsuitable due to toxicity (Rai et al., 2005; Rai and Mehrotra, 2008).

3.3.7  Propagation The crop is seed propagated. Optimum temperature for germination is 20–35°C. Seed germination is less than 50% and is complete within 10 days after sowing. Germination of freshly collected seeds is slower than older seeds. Freezer-stored (−20°C) seeds retain viability for 30 months (Unander et al., 1995). Density grading by floating in petroleum ether or acetone and discarding the lighter seeds improves germination (92–94%) (Kalavathi et al., 2001). Soaking seeds in 200 ppm GA3, 150 ppm thiourea, or 4% potassium nitrate enhances germination, root and shoot growth, and vigor (Balakumbahan et al., 2008). Seeds need light to germinate and should not be covered at sowing (Unander et al., 1995). Direct seeding results in poor stands; therefore, seeds are sown in April–May in nursery beds mixed with FYM. Seeds are mixed with dry soil, sand, or cellulose gel for uniform dispersal on the nursery bed. Adequate moisture is maintained until seedlings are ready for planting. For a hectare, 1 kg seeds is sufficient. Being self-seeding, stands can be established in cultivated fields with weed management strategies.

3.3.8  Transplanting Seedlings that are 30–40 days old and 10–15 cm tall are transplanted with 15–25 × 10–20cm spacing (Bagchi et al., 1999; Chezhiyan et al., 2003) during the rainy season. October planting with 40 × 20 cm spacing for Brazil (Figueira et al., 2006) and December or March planting with 20–40 cm intrarow spacing for Florida (Unander et al., 1993) are suggested.

63

Cultivation, Economics and Marketing of Phyllanthus Species

3.3.9  Irrigation In southern India, the rainy season harvest needs no irrigation; subsequent harvests are flood or sprinkler irrigated once every 10–15 days. In northern India, fortnightly irrigations are necessary. Drip irrigation is advocated in Florida (Unander et al., 1993).

3.3.10  Weed Control The field is kept weed free through regular manual weeding. Plastic mulch controlled weeds in Florida (Unander et al., 1993).

3.3.11  Fertilizers and Manures Fertilizer application increases biomass yield without affecting activity against hepatitis B and related hepadna viruses (Unander et al., 1993). The recommended rates of manure and fertilizer applications for harvesting yields with high biomass are depicted in Table 3.3.

3.3.12  Pests and Diseases Whiteflies, thrips, aphids, stem blight (Corynespora cassiicola), and little leaf (phytoplasma) damage the crop. Spraying 5% neem seed kernel extract reduced insect pest populations by 54.0–58.0% (Rathikannu and Sivasubramanian, 2008). Foliar spray and seedling dipping in talc-based Bacillus subtilis formulation controlled stem blight (Mathiyazhagan et al., 2004).

3.3.13  Harvesting and Yield Plants are harvested when they are green and herbaceous as leaf yield decreases with age due to leaf fall and stems tend to become woody. Since lignans are concentrated TABLE 3.3 Recommended Rates of Manure and Fertilizer Applications for Carry Me Seed Manure/Fertilizer Rate 67 kg N + 134 kg P + 134 kg K/ha 5 t poultry manure + 2 kg Azospirillum + 2 kg phosphobacteria/ha for highest biomass yield 15 t FYM for highest herb yield and 12 t FYM + 2.5 kg Azospirillum + 2.5 kg phophobacteria/ha for highest seed yield 75 kg N + 37.5 kg P + 2 kg Azophos/ha (fresh biomass 7.2 t/ha, dry biomass 3.3 t/ha, phyllanthin 0.68–0.70%, and hypophyllanthin 0.21–0.23%) 10 t/ha each of FYM + pressmud + fly ash (39.7 g herbage yield/plant)

Reference Unander et al., 1993 Chezhiyan et al., 2003 Annamalai et al., 2004 Balakumbahan et al., 2005

Arumugum and Rajeswari, 2006

64

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

more in the leaves, production of higher leaf mass is desired. In India, plants are harvested in September and subsequently at 70- to 90-day intervals. Three harvests are feasible. In Florida, 6- to 7-month-old plants (planted in December and harvested in July–August) yield 40.5 kg/ha dry biomass, and two crops planted during winter and summer are possible (Unander et al., 1993). In Brazil, an 80-day-old crop yielded 16.9–20.7 g/plant (2,110–2,580 kg/ha) fresh biomass having 0.52–1.0% phyllanthin and 0.13–0.24% hypophyllanthin (Figueira et al., 2006).

3.3.14  Economics and Marketing In India, cost of cultivation is Rs 10,000 ($200–250)/ha. Gross and net returns, respectively, with 1,500 kg/ha dry biomass yield and Rs 20/kg market price are Rs 30,000 ($600–650)/ha and Rs 20,000 ($400–450)/ha. The entire production, including wild collections, is locally utilized for herbal drug manufacturing. Yield is low in the United States and hence is not economical for large-scale cultivation. The ubiquitous nature of carry me seed and related species makes them commodities of local trade, and export is limited, although products and extracts are offered for sale by several companies on the Internet, with no trade data available.

3.3.15  Chemical Composition Alkaloids, benzenoids, flavonoids, terpenoids, lignans, tannins, coumarins, sterols, and lipids have been isolated from different plant parts. Important constituents are lignans: bitter phyllanthin (0.5% herb, 1.56% leaf, 0.01% root, and 0.007% stem) and nonbitter hypophyllanthin.

3.3.16  Uses Roots, shoots, and the whole plant are used in folk medicine. The herb is bitter and is reported to possess hepatoprotective, antiviral, astringent, deobstruent, stomachic, antidiabetic, diuretic, febrifugal, antipyretic, anti-inflammatory, and antiseptic properties. The plant is used in the treatment of jaundice, kidney and gall bladder stones, dyspepsia, diarrhea, dysentery, dropsy, diseases of the genitourinary system, edema, ulcers, ophthalmia, diabetes, and skin affections. Wild and cultivated plants possess identical activities (Unander et al., 1993).

3.3.17  Safety Issues and Adulteration For industrial use and export, the limits for quality parameters are as follows: not more than 2.0% foreign organic matter; not more than 8.0% total ash; not more than 5.0% acid-insoluble ash; not less than 15.0% water-soluble extractive; not less than 3.0% n-hexane-soluble extractive. Phyllanthus amarus is easily confused and mixed with similar-looking species. Adulteration is detected with the help of the bitterness value or SCAR (sequence characterized amplified region) markers (Jain et al., 2008). Phyllanthus amarus is 70 times more bitter than P. fraternus, P. simplex Retz., and P. urinaria and 14 times more bitter than P. maderaspatensis L.

Cultivation, Economics and Marketing of Phyllanthus Species

65

3.4  CULTIVATION OF OTHER PHYLLANTHUS SPECIES Several Phyllanthus species are commercially important for local trade in countries of origin. Most of them are collected by the local population from natural sources or grown on a limited scale in home gardens or as companion crops in agricultural or horticultural crops. A literature survey revealed scattered attempts to discern such aspects as isolation of chemicals from plant parts, biological activities of extracts, micropropagation protocols, isolation of chemicals from callus cultures, seed germination and seedling growth, pest and disease incidence, VAM fungal association, accumulation of heavy metals, and taxonomic and nutrient studies. Cultivation protocols are lacking.

3.4.1  Phyllanthus urinaria L. and Related Species Phyllanthus debilis, P. fraternus, P. niruri, P. urinaria, P. maderaspatensis, and P. mimicus Webster are collected for their therapeutic value similar to P. amarus. Phyllanthus urinaria is cultivated in China in warm, well-drained, sandy soils; is fertilized with sources high in nitrogen and potassium; and is susceptible to nutrient and moisture stresses; P. debilis is more hardy (Unander and Blumberg, 1991). Seed stratification, scarification, and treatment with growth hormones improve germination in P. niruri, P. fraternus, and P. urinaria. In vitro regeneration protocols are in place for P. niruri and P. fraternus. Phyllanthus niruri responds to nitrogen application (Becker et al., 2000) and organic manures (12.5 t FYM + 2.5 t vermicopost + 3% panchagavya gave 44.2 g/plant yield) (Ponni and Shakila, 2007). With fine-tuning, P. amarus cultivation practices can be adopted for these species.

3.4.2  P  hyllanthus acidus (L.) Skeel (Syn. Cicca acida (L.) Merr., Averrhoa acida L.) Commonly known as Otaheite/Tahitian/star/country/West Indian/Malay gooseberry, the tree of Madagascan origin reaches 5–9 m high and is distributed in southeastern Asian countries. Yellow, waxy, crisp, juicy, acrid, single-seeded fruits with six to eight ribs are borne in thick clusters and are edible. The tree is raised in home gardens in India, Thailand, Taiwan, Philippines, Malaysia, Brazil, Indonesia, Sri Lanka, Australia, and Venezuela (Murthy and Joshi, 2007); it is grown with mango in Trinidad and Tobago (Roberts, 2004). The tree prefers moist soil and is propagated by seeds or by budding, greenwood cuttings, and air layering. Trees bear two crops (April–May, August–September) in southern India; elsewhere, the crop is harvested in January. In India, fruit is eaten fresh or pickled. In Grenada, leaf tea finds use as a mouthwash to treat a sore throat; fruits are eaten fresh or as stew. In Vietnam, the fruit is cooked in sugar or salted, and juice is consumed as a beverage. In Puerto Rico, fruit is eaten as a dessert. Phyllanthusol A and B and triterpenoids have been isolated.

66

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

3.4.3  Phyllanthus indofischeri Bennet (Syn. Emblica fischeri Gamble) The tree of Phyllanthus indofischeri Bennet (up to 12 m tall, monoecious) is endemic to peninsular India. Leaves (2.8 × 1.3 cm) and fruits (pale or marble green, drupaceous, globose, capsule, 2.5–4.0 cm across with marked striations along the septa and containing six gray seeds) are larger than emblic. Trees grow in dry, deciduous, scrub forests at low altitudes. Tribal communities collect fruits along with emblic for trading in local markets. Fruits are pickled; they are sun dried, stored, and eaten with minor millets and are used as a substitute for emblic. Two varieties, Champakkad large and Krishna, are released for cultivation in southern India. Indiscriminate fruit collection is leading to a rapid decline in the population, necessitating conservation (Ganesan, 2003).

3.4.4  Phyllanthus reticulatus Poir. (Syn. Kirganelia reticulata (Poir.) Baill.) Commonly known as seaside laurel, the potato plant Phyllanthus reticulatus Poir. is a monoecious, deciduous, branched shrub or small tree reaching 4–5 m high. It is widespread in the tropics, from Africa to Indochina and southeastern Asia. Flowers have a potato smell. The fruit is a fleshy berry, reddish purple or bluish black when mature, and contains six to many seeds; it is sour and edible. Leaves are used for treating sores, burns, fever, paralysis, bleeding gums, diabetes, asthma, sore throat, snakebites, diarrhea, and mental problems; the fruits are used for infantile diarrhea; stem sap is used for conjunctivitis; stem bark as a treatment for dysentery; root powder, sap, and decoction are used for ear infections, pain, spasms, headache, dysmenorrhea, gonorrhea, and abscesses. Stems are used as roof binders, twigs as chew sticks, and wood as firewood and for local construction. Red and black dyes are made from fruits, leaves, bark, and roots to dye fishing nets, cotton, and cloth. Black ink is made from ripe fruits. The plant contains tannins and triterpenoids and is occasionally grown by Indian tribal communities. Root bark, stem bark, and leaves are collected and traded in Africa (Arbonnier, 2004).

3.4.5  Phyllanthus piscatorum Kunth Phyllanthus piscatorum Kunth is a shrub grown for its piscidal property by Yanomami Amerindian ethnic women groups in Venezuela. Aerial parts are used as fish poison and to treat wounds and fungal infections, and leaves are used as a substitute for tobacco. The plant holds promise as a remedy for skin infection caused by Candida albicans (Gertsch et al., 2004).

3.4.6  P  hyllanthus sellowianus Mull. Arg., Phyllanthus stipulatus (Raf.) Webster Attempts were made to grow Phyllanthus sellowianus Mull. Arg. and Phyllanthus stipulatus in Brazil. Phyllanthus stipulatus responds to 4 kg/m2 compost application; it is used to reduce the blood uric acid level and to eliminate kidney stones

Cultivation, Economics and Marketing of Phyllanthus Species

67

(Silva et al., 1997). Leaves and stems of P. sellowianus possess antidiabetic, diuretic, laxative, antiseptic, and analgesic properties. The plant is propagated by stem cuttings to control bund erosion in water courses (Sutili et al., 2004).

3.5  CONCLUSIONS In spite of a large number of economically important species in the genus Phyllanthus, scientific data on cultivation techniques are not available except for emblic and carry me seed. Due to their widespread nature and relative abundance, Phyllanthus species collected from natural sources are traded locally in the producing countries. Gradual loss of habitat due to anthropological reasons and changing weather patterns as a consequence of global warming is rapidly declining natural populations, calling for urgent conservation and cultivation strategies for sustainable supplies. Products and extracts of Phyllanthus species are offered for sale on the Internet by agencies of different countries. In 2008, global export of pharmaceutical herbs was valued at US$1,781.54 million, with a 42.1% growth rate between 2004 and 2008 (U.N. comtrade database (http://comtrade.un.org/db/ce/cesearch.aspx). As many herbs are exported without declaring their species identity, the contribution of Phyllanthus species to global trade is difficult to ascertain. The increasing global demand for medicinal herbs warrants development of cultivation practices for sustainable harvests and exports.

ACKNOWLEDGMENT I am beholden to the director, CIMAP, Lucknow, for facilities and encouragement.

REFERENCES Ammal, E.K.J., and Bhagawan, R.S. 1957. Physiology and vitamin C in Emblica officinalis. Proc. Indian Acad. Sci. B-46: 312–314. Annamalai, A., Lakshmi, P.T.V., Lalithakumari, D., and Murugesan, K. 2004. Optimization of biofertilizers on growth, biomass and seed yield of Phyllanthus amarus (Bhumyamalaki) in sandy loam soil. J. Med. Arom. Plant Sci. 26: 717–720. Arbonnier, M. 2004. Trees, shrubs and lianas of West African dry zones. Paris: CIRAD, Margraf. Arumugum, S., and Rajeswari, R. 2006. Effect of FYM and industrial wastes on productivity of Phyllanthus amarus. Adv. Plant Sci. 19: 525–529. Aseri, G.K., and Rao, A.V. 2004. Effect of bioinoculants on seedlings of Indian gooseberry (Emblica officinalis Gaertn.). Indian J. Microbiol. 44: 109–112. Awasthi, O.P., Singh, I.S., and More, T.A. 2009. Performance of intercrops during establishment phase of aonla (Emblica officinalis) orchard. Indian J. Agric. Sci. 79: 587–591. Bagchi, G., Chaudhuri, P.K., and Kumar, S. 1999. Cultivation of Bhumyamalaki Phyllanthus amarus in India. Farm Bulletin No. 10. Lucknow, India: Central Institute of Medicinal and Aromatic Plants. Balakumbahan, R., Sadasakthi, A., Kumanan, K., and Rajamani, K. 2008. Role of growth regulators on seedling characters of Phyllanthus amarus. Plant Arch. 8: 709–710. Balakumbahan, R., Sadasakthi, A., Kumar, S., and Sarvanan, A. 2005. Effects of inorganic and biofertilizers on biomass and alkaloids yield of keelanelli (Phyllanthus amarus). J. Med. Arom. Plant Sci. 27: 449–453.

68

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

Banerjee, A., and Chattopadhyay, S. 2009. Genetic transformation of a hepatoprotective plant, Phyllanthus amarus. In Vitro Cell Mol. Biol. Plant 45: 57–64. Becker, L., Furtini, N.A.E., Pinto, J.E.B.P., et al. 2000. Growth and total alkaloid production of Phyllanthus niruri in relation to lime and nitrogen fertilizer application. Hort. Brasiliera. 18: 100–104. Bhatia, S.K., Dudi, S.S., and Kumar, O.P.M. 2007. Economic analysis of raising aonla (Emblica officinalis Gaertn.) buddlings in nursery. Environ. Ecol. 25 (special issue): 951–952. Chen, Z.Y., Liu, X.M., Wu, J.J., Li, S.F., and Zhou, Y.X. 2003. The biological characters and the fruit nutrients of yuganzi tree. South China Fruits 32: 71–73. Chezhiyan, N., Saraswathy, S., and Vasumathi, R. 2003. Studies on organic manures, biofertilizers and plant density on growth, yield and alkaloid content of bhumyamalaki (Phyllanthus amarus Schum., and Thonn.). South Indian Hort. 52: 96–101. Figueira, G.M., de Magalhaes, P.M., Rehder, V.I.G., Sartoratto, A., and Vaz, A.P.A. 2006. Chemical preliminary evaluation of selected genotype of Phyllanthus amarus Schumach. grown in four different counties of Sao Paulo State. Rev. Bras. Pl. Med. Botucatu. 8: 43–45. Firminger, T.A. 1947. Firminger’s manual of gardening for India (8th ed.). Calcutta, India: Thacker, Spink. Ganesan, R. 2003. Identification, distribution and conservation of Phyllanthus indofischeri, another source of Indian gooseberry. Curr. Sci. 84: 1515–1518. Gertsch, J.N., Roost, K.N.D., and Sticher, O. 2004. Phyllanthus piscatorum, ethnopharmacological studies on a women’s medicinal plant of the Yanomami Amerindians. J. Ethnopharm. 91: 181–188. Ghosal, S., Tripathi, V.K., and Chauhan, S. 1996. Active constituents of Emblica officinalis: part 1—the chemistry and antioxidative effects of two new hydrolysable tannins, emblicanin A and B. Indian J. Chem. Sec B. 35: 941–948. Gondalia, V.K., and Patel, G.N. 2007. An economic evaluation of investment on aonla (Emblica officinalis G.) in Gujarat. Agric. Econ. Res. Rev. 20: 385–394. Gupta, A.K., Khanuja, S.P.S., Gupta, M.M., et al. 2003. High herb, phyllanthin and hypophyllanthin yielding variety of Bhumyamalaki (Phyllanthus amarus): CIM-Jeevan. J. Med. Arom. Plant Sci. 25: 743–745. Jain, N., Shasany, A.K., Singh, S., Khanuja, S.P.S., and Kumar, S. 2008. SCAR markers for correct identification of Phyllanthus amarus, P. fraternus, P. debilis and P. urinaria used in scientific investigations and dry leaf bulk herb trade. Planta Med. 74: 296–301. Jain, N., Shasany, A.K., Sundaresan, V., et al. 2003. Molecular diversity in Phyllanthus amarus assessed through RAPD analysis. Curr. Sci. 85: 1454–1458. Jansen, P.C.M. 2005. Phyllanthus emblica L. Record from Protabase. PROTA (Plant Resources of Tropical Africa), ed. P.C.M. Jansen and D. Cardon. http://database.prota. org/PROTAhtml/Phyllanthus%20emblica_En.htm (accessed January 7, 2010). Kalavathi, D., Karivaratharaju, T.V., and Nargis, S. 2001. Fixing up of optimum sieve for seed processing in some important medicinal plants. In Conservation and utilization of medicinal and aromatic plants, ed. S. Sahoo, D.B. Ramesh, Y.R. Rao, B.K. Debata, and V.K. Misra, 95–98. Bhubaneswar, India: Regional Research Laboratory. Kumar, S., and Nath, V. 1993. Storage stability of aonla fruit—a comparative study of zeroenergy cool chamber versus room temperature. J. Food Sci. Technol. (Mysore) 30: 202–203. Kumar, S., Nath, V., Singh, I.S., and Nainwal, N.C. 1992. Preliminary studies on storage of aonla fruit in salt solution. Progressive Hort. 24: 83–86. Kumari, R, Sindhu, S.S., Sehrawat, S.K., and Dudi, O.P. 2007. Germination studies in aonla (Emblica officinalis Gaertn.). Haryana J. Hort. Sci. 36: 9–11. Li, Q.M., and Zhao, J.L. 2007. Genetic diversity of Phyllanthus emblica populations in dryhot valleys in Yunnan. Biodiv. Sci. 15: 84–91.

Cultivation, Economics and Marketing of Phyllanthus Species

69

Marimuthu, J. 2007. Somaclonal variation studies on Phyllanthus amarus Schum. & Thonn. Indian J. Biotechnol. 5: 240–245, 253. Mathiyazhagan, S., Kavitha, K., Nakkeeran, S., et al. 2004. PGPR mediated management of stem blight of Phyllanthus amarus Schum. and Thonn. caused by Corynespora cassiicola (Berk and Curt) Wei. Arch. Phytopathol. Plant Protect. 37: 183–199. Meenakshisundaram, P., and Maheswaran, M. 2008. RAPD and ISSR analyses reveal low levels of genetic diversity in Phyllanthus amarus. Acta Hort. 765: 179–187. Murthy, Z.V.P., and Joshi, D. 2007. Fluidized bed drying of aonla (Emblica officinalis). Drying Technol. 25: 883–889. Panchbhai, D.M., Athavale, R.B., Jogdande, N.D., and Dalal, S.R. 2006. Soft wood grafting— aonla propagation made easy. Agric. Sci. Digest 26: 71–72. Pathak, S., Pathak, P.K., and Singh, I.S. 1989. Effect of packing containers on losses of aonla fruits during transportation. Indian J. Hort. 46: 468–469. Ponni, C., and Shakila, A. 2007. Effect of certain organic manures and biostimulants on growth and yield of Phyllanthus niruri. Asian J. Hort. 2: 148–150. Raghu, V., Patel, K., and Srinivasan, K. 2007. Comparison of ascorbic acid content of Emblica offcinalis fruits determined by different analytical methods. J. Food Comp. Anal. 20: 529–533. Rai, V., Bisht, S.K., and Mehrotra, S. 2005. Effect of cadmium on growth, ultramorphology of leaf and secondary metabolites of Phyllanthus amarus Schum. and Thonn. Chemosphere 61: 1644–1650. Rai, V., and Mehrotra, S. 2008. Chromium induced changes in ultramorphology and secondary metabolites of Phyllanthus amarus Schum. & Thonn.—an hepatoprotective plant. Environ. Monit. Assess. 147: 307–315. Rathikannu, S., and Sivasubramanian, P. 2008. Efficacy of botanicals against sucking pests of Phyllanthus amarus. J. Plant Protect. Environ. 5: 95–101. Reddy, H.S.S., Rame Gowda, D.M.V., and Vishwanath, K. 2007. Studies on physiological maturity in Phyllanthus amarus Schum. and Thonn. Seed Res. 35: 202–204. Roberts, N.L.B. 2004. Evaluation of young fruit tree performance in hillside trials in Trinidad and Tobago. Acta Hort. 638: 459–464. Schippmann, U., D. Leaman, and A.B. Cunningham. 2006. A comparison of cultivation and wild collection of medicinal and aromatic plants under sustainability aspects. In Medicinal and aromatic plants, ed. R.J. Rogers, L.E. Craker, and D. Lange, 75–95. The Netherlands: Springer. Sharma, I., Sharma, N., and Kour, H. 2009. Studies on the role of ants in reproductive efficiency of three species of Phyllanthus L. Curr Sci. 96: 283–287. Shukla, A.K., Pathak, R.K., Tiwari, R.P., and Nath, V. 2000. Influence of irrigation and mulching on plant growth and leaf nutrient status of aonla (Emblica officinalis G.) under sodic soil. J. Appl. Hort. (Lucknow) 2: 37–38. Silva, F.D.F., da Noda, H., Clement, C.R., and Machado, F.M. 1997. Effect of organic manure on biomass production of quebra-pedra (Phyllanthus stipulatus, Euphorbiaceae) in Manuas, Amazonas, Brazil. Acta Amazonica 27: 73–80. Singh, A., Yadav, A.L., Yadav, D.K., and Misra, S.K. 2008a. Effect of integrated nutrient management on yield and quality of aonla (Emblica officinalis Gaertn.) cv. NA-10. Plant Arch. 8: 473–474. Singh, B.K., Sharma, S., and Niwas, R. 2005. Effect of methods and time of budding on shoot development pattern in aonla (Emblica officinalis Gaertn.) cv. Chakaiya. Haryana J. Hort. Sci. 34: 16–17. Singh, J.K., Prasad, J., Singh, H.K., and Singh, A. 2008b. Effect of micronutrients and plant growth regulators on plant growth and fruit drop in aonla (Emblica officinalis Gaertn.) fruits cv. Narendra Aonla-10. Plant Arch. 8: 911–912.

70

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

Singh, R.K. 2006. Studies on economic feasibility and suitability of intercrops in aonla plantation under sodic soil. PhD diss., Naredra Deva University of Agriculture and Technology. Singh, R.K., Singh, J.K., Prasad, J., and Singh, H.K. 2008c. Effect of intercrops on plant growth, yield and quality of aonla (Emblica officinalis Gaertn.) fruits cv. NA-6. Plant Arch. 8: 903–905. Singh, S., Singh, A.K., and Joshi, H.K. 2008d. Standardization of maturity indices in aonla (Emblica officinalis Gaertn.) under semi-arid environment of western India. Ann. Arid Zone. 47: 209–212. Singh, S., Singh, A.K., Joshi, H.K., Bagale, B.G., and Dhandar, D.G. 2009. Evaluation of packages for transportation and storability of aonla (Emblica officinalis) under semi-arid environment of western India. J. Food Sci. Technol. (Mysore) 46: 127–131. Singh, S.K., and Singh, H.K. 2008. Pruning behavior in aonla (Emblica officinalis Gaertern.) cv. Narendra Aonla-7. Environ. Ecol. 26: 1039–1041. Srimathi, P., and Sujatha, K. 2007. Influence of biocides on stability of amla (Emblica officinalis) seeds. J. Ecobiol. 20: 19–24. Sutili, F.J., Durlo, M.A., and Bressan, D.A. 2004. Biotechnical capability of “sarandi-branco” (Phyllanthus sellowianus Mull. Arg.) and “vime” (Salix viminalis L.) for revegetation water course edges. Ciencia Florestal. 14: 13–20. Tiwari, J.P., Mishra, D.S., Misra, K.K., and Mishra, N.K. 2007. Indian gooseberry. In Medicinal and aromatic crops, ed. Jitendra Singh, 112–124. Jaipur, India: Avishkar. Unander, D.W., and Blumberg, B.S. 1991. In vitro activity of Phyllanthus (Euphorbiaceae) species against the DNA polymerase of hepatitis viruses: effects of growing environment and inter- and intra-specific differences. Econ. Bot. 45: 225–242. Unander, D.W., Bryan, H.H., Lance, C.J., and McMillan, R.T., Jr. 1993. Cultivation of Phyllanthus amarus and evaluation of variables potentially affecting yield and the inhibition of viral DNA polymerase. Econ. Bot. 47: 79–88. Unander, D.W., Bryan, H.H., Lance, C.J., and McMillan, R.T., Jr. 1995. Factors affecting germination and stand establishment of Phyllanthus amarus (Euphorbiaceae). Econ. Bot. 49: 49–55. Wang, K.L., Yao, X.H., Ren, H.D., and Ding, M. 2006. Growth characteristics of bearing base branch and fruit branch of Phyllanthus emblica. Forest Res. Beijing 3: 326–330. Webster, G.L. 1957. A monographic study of the West Indian species of Phyllanthus. J. Arnold Arboric. Harv. Univ. 39: 49–100. Webster, G.L. 1994. Synopsis of the genus and suprageneric taxa of Euphorbiaceae. Ann. Mo. Bot. Gard. 81: 33–144.

Analysis 4 Phylogenetic of Phyllanthus Species Srinivasu Tadikamalla CONTENTS 4.1 Introduction..................................................................................................... 71 4.2 Phylogenetics................................................................................................... 72 4.2.1 Variation at the DNA Level................................................................. 72 4.2.2 Internal Transcribed Spacer Region.................................................... 73 4.2.3 Phylogenetic Tree................................................................................. 74 4.2.4 Tree Terminology................................................................................ 75 4.3 Materials and Methods.................................................................................... 76 4.3.1 Agarose Gel Electrophoresis............................................................... 77 4.3.2 Procedure............................................................................................. 77 4.3.3 Gel Documentation.............................................................................. 78 4.3.4 Polymerase Chain Reaction................................................................. 78 4.3.5 BLAST................................................................................................. 79 4.3.5.1 Protocol................................................................................. 79 4.3.6 FASTA................................................................................................. 79 4.3.6.1 Protocol................................................................................. 79 4.4 Multiple-Sequence Alignment.........................................................................80 4.5 Clustal W.........................................................................................................80 4.5.1 Protocol................................................................................................80 4.6 Phylogenetic Analysis...................................................................................... 81 4.6.1 Protocol................................................................................................ 81 4.7 Results and Discussion.................................................................................... 81 4.7.1 Sequence Obtained for Phyllanthus tenellus....................................... 81 4.7.2 Sequence Obtained for Phyllanthus fraternus.................................... 82 References.................................................................................................................94

4.1  INTRODUCTION Phyllanthus is the largest genus in the family Euphorbiaceae. Phyllanthus has a remarkable diversity of growth forms, including annual and perennial herbaceous, arborescent, climbing, floating aquatic, pachycaulous, and phyllocladous. It has a wide variety of floral morphologies and chromosome number and has one of the widest varieties of pollen types of any plant genus. Phyllanthus has more than 700 species in at least 10 subgenera (Holm-Nielsen, 1979; Webster, 1956, 1957). The 71

72

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

circumscription of this genus has been so confusing that molecular phylogenetic analysis of Phyllanthaceae (Phyllanthoideae pro parte, Euphorbiaceae sensu lato) using plastid RBCL DNA sequences (Wurdack et al., 2004) and evidence from plastid matK and nuclear PHYC sequences (Samuel et al., 2005) were carried out. This chapter deals with the phylogenetic analysis of Indian Phyllanthus species using ITS nr DNA sequences. The word species literally means outward or visible form. It comprises groups of actually or potentially interbreeding natural populations that are reproductively isolated from other such groups. The Linnaean concept of species as relatively constant units with most of the variations occurring among them is different from Darwin’s theory of evolution by gradual change, which states that the variations between species must be generated from variation within species. The historical review of the species and their varieties continued to the end of 19th century, and it was during this period that Mendel’s concept of heredity made its appearance. Later, as the integration of Mendelian genetics and Darwin’s evolutionary theory, often termed neo-Darwinism, was making its impact on biology, the significance of genetic variations within species invited wide attention. Studies on intraspecific (genetic) variations were initiated and further elaborated by many workers. During the 1920s, based on his epoch-making observations on genetic diversity of cultivated plants and their wild relatives, Vavilov described what are known today as the geographical centers of genetic diversity/origin, mostly in the tropical belt. Although these earlier workers described a vast wealth of previously unknown genetic variations, little attention was paid to the necessity to preserve these reservoirs of genetic diversity or “natural gene pools” (Mayr, 1940).

4.2  PHYLOGENETICS In biology, phylogenetics is the study of evolutionary relatedness among various groups of organisms (e.g., species, populations). It is also known as phylogenetic systematics or cladistics. Phylogenetics treats a species as a group of lineage-connected individuals over time. Taxonomy, the classification of organisms according to similarity, has been richly informed by phylogenetics but remains methodologically and logically distinct (Edwards and Cavalli-Sforza, 1964). Evolution is regarded as a branching process by which populations are altered over time and may speciate into separate branches, hybridize together, or terminate by extinction. The problem posed by phylogenetics is that genetic data are only available for the present, and fossil records are sporadic and less reliable. Our knowledge of how evolution operates is used to reconstruct the full tree (Cavalli-Sforza and Edwards, 1967).

4.2.1  Variation at the DNA Level The ability to investigate DNA sequences directly became available to population biologists only during the late 1970s. Currently, three major DNA-based techniques have been widely used for analyzing the genetic diversity in natural populations. These include (1) restriction fragment length polymorphism (Botstein et al., 1980);

73

Phylogenetic Analysis of Phyllanthus Species L ITS R

18 sr RNA

L 5.8SR

ITS 1

5.8 s

ITS 2

L 5.8 S 300 -350 bp

28 sr RNA LITSV

700-750 bp

900 -1130 bp

FIGURE 4.1  Internal transcribed spacer region.

(2) polymerase chain reaction (PCR; Mullis and Faloona, 1987) and its derivatives, termed random amplified polymorphic DNA (RAPD) (Williams et al., 1990) and arbitrarily primed PCR (fingerprinting of RNA) (AP-PCR; Welsh and McClelland, 1990); and (3) a hybrid of both these techniques called amplification fragment length polymorphism (Vos et al., 1995).

4.2.2  Internal Transcribed Spacer Region The internal transcribed spacer (ITS) has been used in numerous systematic studies at the generic and specific levels of a wide array of plant taxa (Baldwin et al., 1995). The two internal spacers, ITS1 and ITS2, are located between genes encoding the 18S, 5.8S, and 28S nuclear ribosomal RNA (nrRNA) subunits (Baldwin, 1993). ITS1 and ITS2, in addition to the 5.8S nrRNA, are referred to as the ITS region (Baldwin et al., 1995). Individually, ITS1 and ITS2 are around 300 bp in length, and the 5.8S subunit is almost invariant in length within angiosperms (163–164 bp), making the entire ITS region approximately 700 bp (Figure 4.1). Even though ITS1 and ITS2 are part of the ribosomal transcriptional unit, these sequences are not incorporated into the mature ribosome. The two ITS sequences, however, do appear to function in the maturation of nrRNAs; the specific deletions or point mutations in ITS1 can inhibit production of mature large- and small-subunit rRNAs (ribosomal RNAs), and deletions or point mutations in ITS2 prevent or reduce processing of large-subunit rRNAs. Given the short length and the highly conserved nature of the flanking ribosomal subunit genes, the ITS region is easily amplified from small amounts of genomic DNA by PCR (Baldwin, 1993). The ITS refers to a segment of nonfunctional RNA located between structural rRNAs on a common precursor transcript. Read from 5ʹ to 3ʹ, this polycistronic rRNA precursor transcript contains the 5ʹ external transcribed sequence (5ʹ ETS), 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, and finally the 3ʹ ETS. During rRNA maturation, ETS and ITS pieces are excised and, as nonfunctional maturation byproducts, are rapidly degraded. Genes encoding rRNA and spacers occur in tandem

74

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

repeats that are thousands of copies long, each separated by regions of nontranscribed DNA termed intergenic spacers (IGSs) or nontranscribed spacers (NTSs). Sequence comparison of the ITS region is widely used in taxonomy and molecular phylogeny because (due to the high copy number of rRNA genes) it is easy to amplify even from small quantities of DNA and has a high degree of variation even between closely related species. This can be explained by the relatively low evolutionary pressure acting on such nonfunctional sequences. It has proved to be useful for checking relationships among species and various genera in Asteraceae (Baldwin, 1993). Eukaryotic ribosomal RNA genes (known as ribosomal DNA or rDNA) are found as parts of repeat units that are arranged in tandem arrays, located at the chromosomal sites known as nucleolar organizing regions (NORs). Each repeat unit consists of a transcribed region (having genes for 18S, 5.8S, and 28S rRNAs and the external transcribed spacers, i.e., ETS1 and ETS2) and an NTS region. In the transcribed region, ITSs are found on either side of the 5.8S rRNA gene and are described as ITS1 and ITS2. The length and sequences of ITS regions of rDNA repeats are believed to be fast evolving and therefore may vary. Universal PCR primers designed from highly conserved regions flanking the ITS and its relatively small size (600–700 bp) enable easy amplification of the ITS region due to high copy number, up to 30,000 per cell (Dubouzet and Shinoda, 1999), of rDNA repeats. This makes the ITS region an interesting subject for evolutionary or phylogenetic investigations (Baldwin et al., 1995; Hershkovitz and Zimmer, 1996; Hershkovitz et al., 1999) as well as biogeographic investigations (Baldwin, 1993; Suh et al., 1993; Hsiao et al., 1994; Dubouzet and Shinoda, 1999).

4.2.3  Phylogenetic Tree A phylogenetic tree (also known as an evolutionary tree), is a tree showing the evolutionary relationships among various biological species or other entities that are believed to have a common ancestor. In a phylogenetic tree, each node with descendants represents the most recent common ancestor of the descendants, and the edge lengths in some trees correspond to time estimate. A rooted phylogenetic tree is a directed tree (data structure) with a unique node corresponding to the (usually imputed) most recent common ancestor of all the entities at the leaves of the tree. The most common method for rooting trees is the use of an uncontroversial out-group—close enough to allow inference from sequence or trait data but far enough to be a clear out-group. Unrooted trees illustrate the relatedness of the leaf nodes without making assumptions about common ancestry. While unrooted trees can always be generated from rooted ones by simply omitting the root, a root cannot be inferred from an unrooted tree without some means of identifying ancestry; this is normally done by including an out-group in the input data or introducing additional assumptions about the relative rates of evolution on each branch, such as an application of the molecular clock hypothesis (Maher, 2002) (Figure 4.2).

75

Phylogenetic Analysis of Phyllanthus Species DISTANCE SCALE AA species A

0.1

Distance between species A and species B = AA + BB BRANCH LENGTH

species B BB species C NODE species D

species E BRANCH

species F ROOT

FIGURE 4.2  Explanation of various tree terminologies.

4.2.4  Tree Terminology Node: A node represents a taxonomic unit. This can be a taxon (an existing species) or an ancestor (unknown species; represents the ancestor of two or more species). Branch: A branch is defined as the relationship between the taxa in terms of descent and ancestry. Topology: This is the branching pattern. Branch length: Branch length often represents the number of changes that have occurred in that branch. Root: The root is the common ancestor of all taxa. Distance scale: This scale represents the number of differences between sequences (e.g., 0.1 means 10% differences between two sequences). Phylogenetic trees can be drawn in different ways. There are trees with unscaled branches and with scaled branches, as shown in Figure 4.3. Unscaled branches: In this case, the length is not proportional to the number of changes that occurred. Sometimes, the number of changes is indicated on the branches with numbers. The nodes represent the divergence event on a time scale.

76

Phyllanthus Species: Scientific Evaluation and Medicinal Applications Unscaled branches

root

species A

species A

species B

species B

species C species D

species D

species E

Time

species A species B root

species C

root

Scaled branches

species A species B

species C

species D

species C species D

species E

species E

one unit

root

Unrooted tree scaled branches species A

species C

species B species D

species E

species E

Time

one unit

Unrooted tree unscaled branches species A

species C

species B

one unit

species E

species D

FIGURE 4.3  Different types of scaled and unscaled branches.

Scaled branches: Here, the length of the branch is proportional to the number of changes that occurred. The distance between two species is the sum of the length of all branches connecting them. It is also possible to draw these trees with or without a root. For rooted trees, the root is the common ancestor. For each species, there is a unique path that leads from the root to that species. The direction of each path corresponds to evolutionary time. An unrooted tree specifies the relationships among species and does not define the evolutionary path (Baldwin, 1993).

4.3  MATERIALS AND METHODS The plant materials were collected from Veer Mata Jijabai Bhonsale Udyan, Byculla, in Mumbai (India). The samples (leaves) were washed, and total cellular DNAs were isolated by a Hi-media DNA purification spin kit protocol. Briefly, add 400 µl of lysis buffer and 20 µl of RNase A (ribonuclease A) stock solution to 100 mg of homogenated sample and vortex vigorously. Incubate the mixture for 10 min at 65°C and mix the contents two or three times by inverting the tube. Add 130 µl of precipitation buffer to the lysate, mix, and incubate for 5 min on ice. Centrifuge the lysate for 8 min at 10,000 rpm. Load lysate in a HiShredder placed in a 2-ml collection tube, and centrifuge for 5 min at 10,000 rpm, and transfer the fraction to a new 2-ml collection tube without disturbing the cell debris pellet. Add 1.5 volumes of binding buffer to the cleared lysate and mix by pipette. The proportion of lysate and binding buffer should be 450 and 675 µl. The volume can be reduced

Phylogenetic Analysis of Phyllanthus Species

77

accordingly if less lysate is obtained. Add 650 µl of the mixture of lysate and binding buffer to the HiElute Spin column sitting in a 2-ml collection tube. Centrifuge for 1 min at 8,000 rpm. Discard the flow-through and repeat it with the remaining sample. Discard the flow-through liquid and the 2-ml collection tube. Place the HiElute Spin column in a new 2-ml collection tube, add 500 µl of wash buffer, and centrifuge for 1 min at 8,000 rpm. Add another 500 µl of the wash buffer to the HiElute Spin column and centrifuge for 5 min at 10,000 rpm to dry the membrane. For DNA elution, pipette 100 µl of the elution buffer directly without spilling to the sides. Incubate for 1 min at room temperature. Centrifuge at 10,000 rpm for 1 min to elute the DNA. Repeat the step with another 100 µl of elution buffer for high DNA yield. Incubate for 5 min at room temperature to increase the elution efficiency, then centrifuge. The elute contains pure genomic DNA. It can be stored at 2–8°C for short-term or −20°C for long-term storage. The elution buffer will help stabilize the DNA at these temperatures. The quality and quantity of DNA samples were checked on agarose gel using lambda DNA as a marker.

4.3.1  Agarose Gel Electrophoresis Agarose gel electrophoresis is a method used to separate DNA or RNA molecules by size. This is achieved by moving negatively charged nucleic acid molecules through an agarose matrix with an electric field (electrophoresis). Shorter molecules move faster and migrate further than longer ones. Increasing the agarose concentration of a gel reduces the migration speed and enables separation of smaller DNA molecules. The higher the voltage, the faster the DNA migrates. But, voltage is limited by the fact that it heats and ultimately causes the gel to melt. High voltages also decrease the resolution (above about 5 to 8 V/cm). The most common dye used for agarose gel electrophoresis is ethidium bromide (EtBr). It fluoresces under ultraviolet (UV) light when intercalated into DNA (or RNA). By running DNA through an EtBr-treated gel and visualizing it with UV light, distinct bands of DNA become visible. Loading buffers are added with the DNA to visualize it (dye) and sediment it in the gel well (sucrose or glycerol). In our study, we used Orange G, a negatively charged indicator to keep track of the migration of the DNA through the gel.

4.3.2  Procedure Our procedure is to seal the edges of a clean, dry, glass plate with autoclave tape to form a mold. Set the mold on a horizontal section of the bench (check with a level). Prepare sufficient electrophoresis buffer to fill the electrophoresis tank and to prepare the gel. Add the correct amount of powdered agarose to a measured quantity of electrophoresis buffer in an Erlenmeyer flask or a glass bottle with a loose-fitting cap. The buffer should not occupy more than 50% of the volume of the flask or bottle. It is important to use the same batch of electrophoresis buffer in both the electrophoresis tank and the gel. Any change in the ionic strength or pH creates fronts in the gel that can greatly affect the mobility of DNA fragments.

78

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

Heat the slurry in a microwave oven until the agarose dissolves. Cool the solution to 60°C and add EtBr (from a stock solution of 10 mg/ml in water) to a final concentration of 0.5 µg/ml and mix thoroughly. Position the comb 0.5–1.0 mm above the plate so that the complete well is formed when the agarose is added. If the comb is closer to the glass plate, there is a risk that the base of the well may tear when the comb is withdrawn, allowing the sample to leak between the gel and the glass plate. Pour the warm agarose solution into the mold. After the gel is completely set (30–45 min at room temperature), carefully remove the tape and the comb and mount the gel in the electrophoresis tank. Add enough electrophoresis buffer to cover the gel to a depth of about 1 mm. Mix the samples of DNA with the desired gel loading buffer and slowly load the mixture into the slots of the submerged gel using a micropipette. (Gel loading buffer serves three purposes: It increases the density of the sample, ensuring that the DNA drops evenly into the well; it adds color to the sample, thereby simplifying the loading process; and it contains dyes that, in an electric field, moved toward the anode at predictable rates.) Close the lid of the gel tank and attach the electrical leads so that the DNA will migrate toward the anode (red lead). Turn off the electric current, remove the leads and lid from the gel tank, and examine the gel by UV light.

4.3.3  Gel Documentation Photos of gels are invaluable as records of size marker locations, DNA digestion comparison of DNA concentration, and migration distances. A convenient apparatus includes a Polaroid Land camera station and a UV transilluminator. A filter on the camera is required. The specifications for the filter unit will depend on the film and suggested guidelines for the transilluminator. EtBr-stained DNA fluoresces under UV irradiation and therefore is readily photographed. Caution should be exercised during this process to minimize the time of exposure because DNA can be damaged when stained with EtBr and exposed to UV irradiation.

4.3.4  Polymerase Chain Reaction The PCR (Helena Biosciences, UK) usually consists of a series of 20 to 35 repeated temperature changes called cycles; each cycle typically consists of two or three discrete temperature steps. Most commonly, PCR is carried out with cycles that have three temperature steps. The cycling is often preceded by a single temperature step (called hold) at a high temperature (>90°C) and followed by one hold at the end for final product extension or brief storage. The temperatures used and the length of time they are applied in each cycle depend on a variety of parameters. These include the enzyme used for DNA synthesis, the concentration of divalent ions and dNTPs (deoxynucleotide triphosphates) in the reaction, and the melting temperature Tm of the primers. The ITS1-5.8S-ITS2 rDNA region was amplified using the following universal primers: forward primer (GGAAGGAGAAGTCGTAACAAGG) and reverse primer (TCCTCCGCTTATTGATATGC). Amplifications were carried out in a 50-µl

Phylogenetic Analysis of Phyllanthus Species

79

reaction mixture containing 33.7 µl sterile water, 5 µl of 10x PCR buffer, 3 µl of 25 mM MgCl2, 4 µl of 10 mM dNTPs, 1 µl of each primer (10 pM), 0.3 µl (3 U/µl) of Taq polymerase, and 2 µl of template DNA. A PerkinElmer DNA thermal cycler was used with the following PCR profile: an initial denaturation for 5 min at 94°C; 35 thermal cycles (30 s to 1 min at 94°C, 30 s at 55°C, and 1 min at 72°C); and a final 5 min extension at 72o C. The amplified DNA was purified using a PCR purification kit following the manufacturer’s instructions.

4.3.5  BLAST In bioinformatics, the Basic Local Alignment Search Tool (BLAST) is an algorithm for comparing primary biological sequence information, such as the nucleotides of a DNA sequence or amino acid sequence of different proteins. It is one of the most widely used bioinformatics programs because it addresses a fundamental problem, and the algorithm emphasizes speed over sensitivity. This emphasis on speed is vital to make the algorithm practical on the huge genome database currently available, although subsequent algorithms can be even faster. The BLAST algorithm and the computer program implemented were developed by Altschul et al. (1997) at the U.S. National Center for Biotechnology Information (NCBI). 4.3.5.1  Protocol 1. Go to the BLAST home page (http://blast.ncbi.nlm.nih.gov/Blast.cgi). 2. Choose nucleotide BLAST program to run from the submenu. 3. Paste the query sequence in the FASTA format/accession no./GI in the dialogue box choose database type as others (nr etc.). 4. Select program to optimize for highly similarly sequences (megablast) and Click BLAST button/icon. 5. The page displays the result.

4.3.6  FASTA FASTA is a DNA and protein sequence alignment package first developed (as FASTA P) by Lipman and William in 1985 and Pearson in 1990 the article Rapid and sensitive protein similarity searches. The original FASTA P program was designed for protein sequence similarity searching. As described in 1988, FASTA added the ability to do DNA: DNA searches. There are several programs in this package that allow the alignment of protein sequences and DNA sequences. The current FASTA package contains programs for protein: protein, DNA: DNA, protein: translated DNA (with frameshift), and ordered or unordered peptide searches. The most recent version of the FASTA package includes special translated search algorithms that correctly handle frameshift errors when comparing nucleotide-to-protein sequence data. 4.3.6.1  Protocol 1. Go to the FASTA home page (http://www.ebi.ac.uk/Tools/sss/fasta/). 2. Choose the FASTA-nucleotide tool.

80



Phyllanthus Species: Scientific Evaluation and Medicinal Applications

3. Paste the given query sequence in the dialogue box given, keeping the rest of the parameters at the default setting. 4. Click RUN FASTA. 5. The page displayed shows a FASTA summary table with the following self-explanatory headings: Align, DBID, source, length, score, identities, positives, and E-value. Each entry is hyperlinked to its detail.

4.4  MULTIPLE-SEQUENCE ALIGNMENT A comparison of many sequences of proteins or nucleic acid at a time is called multiple-sequence alignment (MSA). It tries to align all the sequences such that there is maximum alignment of identities or similarities possible within the sequence analyzed. The MSA determines the level of homology (relatedness) between members of the series of globally related sequences. It is important for finding similar domains in a set of sequences and for doing phylogenic analysis. There are several approaches for conducting sequence alignment. The aim of MSA is to generate a concise, information-rich summary of sequence data to aid decision making on the relatedness of sequence to a gene family. It is also useful for distinguishing between proteins that perform the same function in different species and those that perform different but related functions within one organism among sequences of homologues.

4.5  CLUSTAL W CLUSTAL W is a program commonly used for MSA. Paula Hogeway first described CLUSTAL W in the early 1980s. Later, it was completely developed by Larkin et al. (2007).

4.5.1  Protocol





1. Paste a set of DNA sequences in FASTA format, keeping other options default and submit. 2. The page displayed shows Clustal W2 results without color. Click on show color icon, the same results are displayed in green (conserved), red colors (non-conserved nucleotides) and ‘-’ as indels. MSA shows alignment scores on the right side in a separate column. It uses the alignment score using the neighbor-joining method. a. Sequence alignment: The sequences of ITS1–5.8S-ITS2 regions are aligned with the corresponding sequences already available in the database. b. Sequence submission: Sequences of DNA are submitted directly to GenBank through Bankit (a World Wide Web sequence submission server available at the NCBI home page, http://www.ncbi.nlm.nih.gov). The sequences are available online at this NCBI home page and can be located by accession numbers or GI numbers.

Phylogenetic Analysis of Phyllanthus Species

81

4.6  PHYLOGENETIC ANALYSIS The field of phylogeny has the goals of working out the evolutionary relationships among species, population by analysis of family of related nucleic acid. Studies of gene evolution involve comparison of homologue sequences that have common origins but may or may not have common activity. Homology specifically means descent from a common ancestor, while similarity is the measurement of resemblance or difference, independent of the source of resemblance. An evolutionary tree is a two-dimensional (2-D) graph showing evolutionary relationships among organisms or in certain genes from separate organisms. It represents an estimated pedigree of the inherited relationships among organisms, molecules, or both. A dendogram is a broad term for the diagrammatic representation of a phylogenetic tree. Many sequence alignment methods, such as CLUSTAL W, produce both sequence alignments and phylogenic trees. Phylogenetic trees can be calculated by DISTANCE-MATRIX methods (e.g., neighbor joining); those that calculate genetic distances from multiple sequence alignments are the simplest to implement. Distance is calculated for all pairwise combinations of operational taxonomic units, and then the distances are assembled into a tree.

4.6.1  Protocol

1. Select query sequence. 2. Use CLUSTAL W to align all the sequences. 3. Obtain a dendogram of the sequences by the selection option. 4. Analyze the dendogram to determine evolutionary relationships.

4.7  RESULTS AND DISCUSSION Phyllanthus tenellus and P. fraternus are two species belongs to family Phyllanthaceae. The ancestral relationship and evolutionary history of these two species were studied by sequencing the ITS of the ribosomal DNA ITS region, which is highly variable and lies between conserved regions ITS1 (which lies between 18S and 5.8S) and ITS2 (which lies between 5.8S and 28S).

4.7.1  Sequence Obtained for Phyllanthus tenellus >II35_T_G1 TCGTAGGTGACCTGCGGAAGGA TCATTGTCGAACCTGCACAGCAG TACGACCCGCGAACAAGTTTATA CACTGCGGAAGGTGTCTCGTGCA CCCGATGCAAGGTCCCGTGGGGT GCTACGCTCCTCGCGGTGGCCA CGTAAAAAACCCCCGGCGCGGAA AGCGCCAAGGAAAATAAACATA CAAGCGAGAACCCTCTAATCACC

82

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

CTGGAGACTCCGGTGCGTGTTTG GTAGGTGTTTCTCCTTTAGTAA CAAAAACGACTCTCGGCAACGG ATATCTCGGCTCTCGCATCGATG AAGAACGTAGCGAAATGCGATAC TTGGTGTGAATTGCAGAATCCCGT GAACCATCGAGTTTTTGAACGCAA GTTGCGCCCGAAGCCTTTTGGTC GAGGGCACGTCTGCCTGGGTGTCA CGCAACGTCGCTCCCTCACTCCC TCACTCGAGGCATGTGAATTCGG GGCGGAAAATGGCCTCCCGTGAA CTTCGTGATCGCGGTTGGCCCAAA CATGAGACCAATTCGGCCAATGC CGTGGCATTCGGTGGTTGAAAATA CCTTACTATTGCCTCGTTCATTTGT CCGAACAAACAAGGATCTCGACGA CCCTCTATGTATCCGACGCGACC CCAGGTCAGGCGGGATTACCCG CTGAGTTTAAGCTAATTAAAAGGGGGAAGGAAAGTTTT GenBank accession numbers: Phyllanthus tenellus ITS1: EU580530 Phyllanthus tenellus 5.8S: EU580531 Phyllanthus tenellus ITS2: EU580532

4.7.2  Sequence Obtained for Phyllanthus fraternus >II35_F_G1 CTCGGTGGTGACCTGCGGAGGATCA TTGTCGAAACCTGCTCTGCAGTATGACC CGCGAACAAGTTTATACACTGCCGAAGG TGCCTTGTGCTCCTGACGCGAGGCCCCGT TGGGTGCTACGCTCCCTGCGGTGGCCACG TAACAAACCCCGGCGCGGAAAGCGCCAAG GAAAATGAACATACAAGCGAGAACCCAAC AGGCTCCCCGGAAACGGTGCGTGCTTTGCTG AGTTTCTCCTTACGTAACCAAAACGACTCTC GGCAACGGATATCTCGGCTCTCGCATCGA TGAAGAACGTAGCGAAATGCGATACTTGG TGTGAATTGCAGAATCCCGTGAACCATCG AGTTTTTGAACGCAAGTTGCGCCCAACGC CTTCGGGTCGAGGGCACGTCTGCCTGGGT GTCACGCAACGTCGCTCCCTCACTCCCGC GTGGAACGTGAATTTCGAGCGGAATATGGC CTCCCGTGAACTCTTCGATCGCGGTTGGCC

Phylogenetic Analysis of Phyllanthus Species

83

TAAACACGAGACCATGTCGGCCAATGCC GTGGCATTCGGTGGTTGAAATACCCTCAAAACGCCTCGTT CGTTTGGCCGCGCTAAAAAGGTTTTCAA CGACCCTCTACTATCCGACGCGACCCCAGGT CAGGCGGGATTACCCGCTGAGTTTAAGCATAAATT AAAGCGGCGGAAGGAAAGTTTTTGTTTGTGT CTTGCTTCTGTGCGCTGGTGAGGGGTGTGGTGGGTGT TGGGGGGGGGGTGGGGGGGGGTAGTGTGGGA AATTGATATTGTAAGTTTGATCGGTGGGGGTTTT GenBank accession numbers: Phyllanthus fraternus ITS1: EU580527 Phyllanthus fraternus 5.8S: EU580528 Phyllanthus fraternus ITS2: EU580529 Fourteen species sequences were downloaded from the NCBI GenBank to align with ITS sequences of Phyllanthus tenellus and Phyllanthus fraternus (Figure 4.4). The following are the species and their GenBank accession numbers: Phyllanthus debilis: AY936686.1 Phyllanthus niruri: AY765286.1 Phyllanthus acidus: AY725468.1 Phyllanthus madagascariensis: AY936706.1 Phyllanthus nummulariifolius: AY936714.1 Phyllanthus rheedii: AY936729.1 Phyllanthus graveolens: AY936696.1 Phyllanthus polyphyllus: AY936725.1 Phyllanthus oxyphyllus: AY936719.1 Phyllanthus clarkei: AY765288.1 Phyllanthus reticulates: AY835843.2 Phyllanthus discolor: AY936688.1 Phyllanthus emblica: AY830087.1 Phyllanthus acuminatus: AY936667.1 MSA is a sequence alignment of three or more biological sequences, generally protein, DNA, or RNA. In general, the query sequences in the input set are assumed to have an evolutionary relationship by which they share a lineage and are descended from a common ancestor. From the resulting MSA, sequence homology can be inferred, and phylogenetic analysis can be conducted to assess the shared evolutionary origins of the sequences. Visual depictions of the alignment as in Figure  4.4 illustrate mutation events such as point mutations (single amino acid or nucleotide changes), which appear as differing characters in a single alignment column, and insertion or deletion mutations (or indels), which appear as gaps in one or more of the sequences in the alignment. MSA is often used to assess sequence conservation of protein domains, tertiary and secondary structures, and even individual amino acids or nucleotides. Thus, MSA of the set of the query sequences was performed, and phylogenetic and evolutionary analyses were carried out.

84

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

FIGURE 4.4  Clustal 2.0.12 multiple-sequence alignment of the species belonging to genus Phyllanthus.  (continued)

Phylogenetic Analysis of Phyllanthus Species

85

FIGURE 4.4  Clustal 2.0.12 multiple-sequence alignment of the species belonging to genus Phyllanthus.  (continued)

86

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

FIGURE 4.4  Clustal 2.0.12 multiple-sequence alignment of the species belonging to genus Phyllanthus.  (continued)

Phylogenetic Analysis of Phyllanthus Species

87

FIGURE 4.4  Clustal 2.0.12 multiple-sequence alignment of the species belonging to genus Phyllanthus.  (continued)

88

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

FIGURE 4.4  Clustal 2.0.12 multiple-sequence alignment of the species belonging to genus Phyllanthus.  (continued)

Phylogenetic Analysis of Phyllanthus Species

89

FIGURE 4.4  Clustal 2.0.12 multiple-sequence alignment of the species belonging to genus Phyllanthus.  (continued)

90

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

FIGURE 4.4  Clustal 2.0.12 multiple-sequence alignment of the species belonging to genus Phyllanthus.  (continued)

Phylogenetic Analysis of Phyllanthus Species

91

FIGURE 4.4  Clustal 2.0.12 multiple-sequence alignment of the species belonging to genus Phyllanthus.  (continued)

92

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

FIGURE 4.4  (continued) Clustal 2.0.12 multiple-sequence alignment of the species belonging to genus Phyllanthus.

As we assume that all species evolve from a common ancestor, the phylogram shows Phyllanthus fraternus is closely related to Phyllanthus niruri, and they are sister taxa. Phyllanthus tenellus is closely related to Phyllanthus clarkei, and they form sister taxa. But, these two species (Phyllanthus tenellus and Phyllanthus fraternus) are distantly related to each other, so they do not support a monophyletic lineage. As the branch length indicates the amount of evolution, Phyllanthus tenellus is more evolved than Phyllanthus clarkei, and Phyllanthus fraternus is more evolved than Phyllanthus niruri (Figure 4.5). A cladogram is a tree-like diagram showing evolutionary relationships. Any two branch tips sharing the same immediate node are most closely related. All taxa that Phyllanthus madagascariensis Phyllanthus rheedii Phyllanthus debilis Phyllanthus fratenus Phyllanthus niruri Phyllanthus graveolens Phyllanthus acuminatus Phyllanthus discolor Phyllanthus reticulatus Phyllanthus polyphyllus Phyllanthus oxyphyllus Phyllanthus emblica Phyllanthus acidus Phyllanthus nummulariifolius Phyllanthus tenellus Phyllanthus clarkei

FIGURE 4.5  Phylogram.

93

Phylogenetic Analysis of Phyllanthus Species

Phyllanthus Phyllanthus Phyllanthus Phyllanthus Phyllanthus Phyllanthus Phyllanthus Phyllanthus Phyllanthus Phyllanthus Phyllanthus Phyllanthus Phyllanthus Phyllanthus Phyllanthus Phyllanthus

madagascariensis rheedii debilis fratenus niruri graveolens acuminatus discolor reticulatus polyphyllus oxyphyllus emblica acidus nummulariifolius tenellus clarkei

FIGURE 4.6  Cladogram.

can be traced directly to one node (that is, they are “upstream of a node”) are said to be members of a monophyletic group. Each branch on a cladogram is referred to as a clade and can have two or more arms. Taxa sharing arms branching from the same clade are referred to as sister groups or sister taxa. Thus, Phyllanthus clarkei and Phyllanthus tenellus can be referred to as sister taxa, while Phyllanthus fraternus and Phyllanthus niruri can be termed sister taxa. But, Phyllanthus fraternus and Phyllanthus tenellus can be termed distinctly related but not sister taxa from both of phylogeny trees (Figure 4.6). The sequence divergence of the ITS1 in wild barley due to substitutions ranged from 0.0 to 2.71%, and that due to substitutions plus indels ranged from 0.0 to 5.42%, which was lower than those observed in wheat (0.0 to 3.12% for substitutions and 0.44 to 7.0% for substitutions plus indels). The sequence divergence of the ITS2 in wild barley due to substitutions ranged from 0.0 to 2.28%, and that due to substitutions plus indels ranged from 0.0 to 5.0%. In wheat, substitutions ranged from 0.45 to 2.26%, and for substitutions plus indels, the range was from 0.45 to 4.07%. Thus, in both wild barley and wheat, sequence divergence was greater in the ITS1 than in the ITS2 region. The higher level of divergence in ITS1 observed during the present study was in conformity with earlier reports in a variety of plant species (Kollipara et al., 1997; Baldwin, 1993; Moller and Cronk, 1997). The deletions within ITS1 and ITS2 were believed to interfere with rRNA processing. For instance, in vivo mutational studies in yeast (Saccharomyces cerevisiae) indicated that deletions of certain regions within ITS1 inhibited production of mature small- and large-subunit rRNAs (Musters et al., 1990; Nues et al., 1994), whereas certain deletions and point mutations in ITS2 prevented or reduced processing of large-subunit rRNA (Sande et al., 1992). Thus, it was concluded that the data on length and sequence of an ITS may be a useful parameter for the assessment of genetic diversity at the intraspecific level

94

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

in species like barley and wheat, although the level of diversity detected using ITS data at interspecific level was much higher in different groups of plants (Sharma et al., 2000). In general, it is assumed that all the species of Phyllanthus evolved from a common ancestor. In the present study of Phyllanthus phylogenetics, the cladogram obtained on a molecular basis (based on their ITS region) justified that these species bear some common morphological features and shows that these two species are closely related to each other; at the same time, some distinguished morphological variations indicate that they are distinctly related and do not support the monophyletic lineage proposal.

REFERENCES Altschul, S.F., Madden, T.L., Schaffer, A.A., et al. 1997. Gapped BLAST and PSI.BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389–3402. Baldwin, B.G. 1993. Molecular phylogenetic of Calcydenia (Compositae) based on ITS sequences of nuclear ribosomal DNA: chromosomal and morphological evolution reexamined. Am. J. Bot. 80: 222–238. Baldwin, B.G., Sanderson, M.J., Porter, J.M., et al. 1995. The ITS region of nuclear ribosomal DNA: a valuable source of evidence on angiosperm phylogeny. Ann. Mo. Bot. Gard. 82: 247–277. Botstein, D., White, R.L., Skolnick, M., et al. 1980. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 32: 314–331. Cavalli-Sforza, L.L., and Edwards, A.W.F. 1967. Phylogenetic analysis: models and estimation procedures. Evolution 21: 550–570. Dubouzet, J.G., and Shinoda, K. 1999. Relationships among old and new world Alliums according to ITS DNA sequence analysis. Theor. Appl. Genet. 98: 422–433. Edwards, A.W.F., and Cavalli-Sforza, L.L. 1964. Phenetic and phylogenetic classification: reconstruction of evolutionary trees. Systematics Assoc. 6: 67–76. Govaerts, R., Frodin, D.G., Radcliffe-Smith, A. 2000. World checklist and bibliography of Euporbiaceae (and pandaceae). Kew: Royal Botanic Gardens. Hershkovitz, M.A., and Zimmer, E.A .1996. Conservation patterns in angiosperm rDNA ITS2 sequences. Nucleic Acid Res. 24: 2857–2867. Hershkovitz, M.A., Zimmer, E.A., and Hahn, W.J. 1999. Ribosomal DNA sequences and angiosperm systematics. In Molecular systematics and plant evolution, ed. P.M. Hollingsworth, R.M. Bateman, and R.J. Gornall, 268–326. London: Taylor and Francis. Holm-Nielsen, L.B. 1979. Comments on the distribution and evolution of the genus Phyllanthus (Euphorbiaceae). In Tropical botany, ed. K. Larsen and L.B. Holm-Nielsen, 277–290. New York: Academic Press. Hsiao, C., Chatterton, N.J., Asay, K.H., et al. 1994. Phylogenetic relationships of 10 grass species: an assessment of phylogenetic utility of the internal transcribed spacer region in nuclear ribosomal DNA in monocots. Genome 37: 112–120. Kollipara, K.P., Singh, R.J., and Hymowitz, T. 1997. Phylogenetic and genomic relationship in the genus Glycine Wild based on sequences from the ITS region rDNA. Genome 40: 57–68. Larkin, M.A., Blackshields, G., Brown, N.P., et al. 2007. ClustalW2 and ClustalX version 2. Bioinformatics 23: 2947–2948. Maher, B.A. 2002. Uprooting the tree of life. The Scientist 16: 18. Mayr, E. 1940. Speciation phenomena in birds. Am. Nat. 74: 249–278.

Phylogenetic Analysis of Phyllanthus Species

95

Moller, M., and Cronk, Q.C.B. 1997. Origin and relationships of Santipulia (Gesneriaceae) based on ribosomal DNA internal transcribed spacer (ITS) sequences. Am. J. Bot. 84: 956–965. Mullis, K.B., and Faloona, F.A. 1987. Specific synthesis of DNA in vitro via a polymerasecatalyzed chain reaction. Methods Enzymol. 155: 335–350. Musters, W., Boon, K., Sande Van Der, C.A.F.M., et al. 1990. Function analysis of transcribed spacers of yeast ribosomal DNA. EMBO J. 9: 3989–3996. Nues, R.W., Van Rientjes, J.M.J., Sande Van Der, C.A.F.M., et al. 1994. Separate structural elements within internal transcribed spacer of Sacchromyces cerviasiae precursor ribosomal RNA direct the formation of 17S and 26S rRNA. Nucl. Acids Res. 22: 912–919. Samuel, R.H., Kathriarachchi, P., Hoffman, P.M. et al. 2005. Molecular phylogenetics of Phyllanthaceae: evidence from plastid matK and nuclear PHYC sequences. Am. J. Bot. 92: 132–141. Sande Van Der, C.A.F.M., Kwa, M., Van Nues, R.W., et al. 1992. Functional analysis of internal transcribed spacer 2 of Saccharomyces cerevisae ribosomal DNA. J. Mol. Biol. 223: 899–910. Sharma, S., Rustgi, S., Balyan, H.S., et al. 2000. Internal transcribed spacer (ITS) sequences of ribosomal DNA of wild barley and their comparison with ITS sequences in common wheat. Barley Gen. Newsl. 32. Suh, Y., Thien, L.B., Reeve, H.E., et al. 1993. Molecular evolution and phylogenetic implications of ribosomal DNA in Winteraceae. Am. J. Bot. 80: 1042–1055. Vos, P., Hogers, R.B., Hornes, M., et al. 1995. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23: 4407–4414. Webster, G.L. 1956. A monographic study of the West Indian species of Phyllanthus. J. Arnold Arbor. 37: 91–122, 340–359. Webster, G.L. 1957. A monographic study of the West Indian species of Phyllanthus. J. Arnold Arbor. 38: 51–80. Welsh, J., and McClelland, M. 1990. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Res. 18: 7213–7218. Williams, J.G.K., Kubelik, A.R., Livak, K.J., et al. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acid Res. 18: 6531–6535. Wurdack, K.J., Hoffman, P., Samuel, R. et al. 2004. Molecular phylogenetic analysis of Phyllanthaceae (Phyllanthoideae propaste, euphorbiaceae sensu lato) using plastid RBCL DNA sequences. Am. J. Botany. 91: 1882–1900.

Resources 5 Genetic of Phyllanthus in Southern India Identification of Geographic and Genetic Hot Spots and Its Implication for Conservation G. Ravikanth, R. Srirama, U. Senthilkumar, K. N. Ganeshaiah, and R. Uma Shaanker CONTENTS 5.1 Introduction..................................................................................................... 98 5.2 Distribution of Phyllanthus Species.............................................................. 104 5.2.1 Identification of Geographic Hot Spots of Phyllanthus in South India: Contours of Species Richness................................................. 104 5.3 Identification of Genetic Hot Spots of Economically Important Phyllanthus Species....................................................................................... 107 5.3.1 Phyllanthus emblica.......................................................................... 107 5.3.2 Phyllanthus amarus........................................................................... 108 5.4 Impact of Harvesting on the Genetic Variability of P. emblica.................... 108 5.5 Phyllanthus: Taxonomic Incongruities, Species Adulteration, and DNA Bar Coding..................................................................................................... 110 5.6 Implications for Utilization and Conservation.............................................. 111 Acknowledgments................................................................................................... 112 References............................................................................................................... 113

97

98

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

5.1  INTRODUCTION The genus Phyllanthus (family: Phyllanthaceae) is one of the most important groups of plants traded as a raw herbal drug in India (Ved and Goraya, 2008). Plants of this genus have been used in traditional medicine for a variety of uses, including as an antipyretic, laxative, tonic, antibacterial, antioxidative, immunomodulatory, antiviral, antiatherosclerotic, and antineoplasic (Unander et al., 1991, 1995; Calixto et al., 1998). In India, Phyllanthus is used as a common folk remedy for the treatment of jaundice and hepatitis. The genus is also used as a general tonic and to treat weakness in infants (Unander et al., 1991). A number of taxa are cultivated for their fleshy edible fruits and for preparation of herbal drugs. Among the Phyllanthus species in India, P. amarus, P. debilis, P. fraternus, P. urinaria, P. kozhikodianus, P. maderaspatensis, P. emblica, and P. indofischeri are widely used as herbal medicines, and some of these species are also cultivated in southern India (Table 5.1). Phyllanthus amarus, a predominant species occurring in southern India, has been shown to suppress the growth and replication of hepatitis B virus (Venkateswaran et al., 1987; Thyagarajan et al., 1988; Yeh et al., 1993; Jayaram and Thyagarajan, 1996; Lee et al., 1996; Paranjape, 2001). A few species, such as P. amarus, P. fraternus, and P. debilis, have been reported to be extensively used for curing jaundice; P. urinaria has been recommended for curing urinary tract diseases (Table 5.1; Jain et al., 2008). Phyllanthin and hypophyllanthin, both present in P. amarus, have been shown to protect hepatocytes against carbon tetrachloride (CCl4) and galactosamineinduced cytotoxicity in rats (Syamasundar et al., 1985). Phyllanthus emblica is another medicinally important species widely distributed across the Indian subcontinent. It is commonly called the Indian gooseberry. Traditionally, it has been used to treat digestive disorders, constipation, fever, cough, and asthma and to stimulate hair growth. Extracts of P. emblica have been shown to possess several pharmacological actions, such as analgesic, anti-inflammatory, antioxidant, and chemoprotective, (Calixto et al., 1998; Vormisto et al., 1997; Khopde et al., 2001). The fruits contain diterpenes; triterpenes; lupeol; flavonoids such as kaempherol-3-O-fl-D-glucoside and quercetin-3-O-fl-D-glucoside; polyphenols such as emblicanin A and B; punigluconin and pedunculagin, and other molecules (Calixto et al., 1998; Bhattacharya et al., 1999; Summanen, 1999; Ghosal et al., 1996). Phyllanthus emblica fruits are used for preparations of pickles, jams, and juices. The fruits are also used by the cosmetic, hair dye and shampoo industries (Ganesan and Shetty, 2004). The annual volume of Phyllanthus trade in India is estimated to be about 2,000– 5,000 metric tonnes of herbaceous material and about 16,000–18,000 metric tonnes of fruits (Ved and Goraya, 2008). Several species are also exported in powder form for the extraction of a number of phytochemicals or for use in the preparation of traditional formulations in the treatment of liver disorders (Kamble et al., 2008). Because of its multifarious use and demand, Phyllanthus species form an important nontimber forest product resource. Most of the material for trade is sourced from the wild by forest-dwelling communities, and only a small percentage is obtained from cultivation (Ved and Goraya, 2008). Because of the often-indiscriminate harvesting,

99

Genetic Resources of Phyllanthus in Southern India

TABLE 5.1 Phyllanthus L. Species in India and Their Pharmacological Activities Sl No.

Phyllanthus Species

Habit

Status

Bioactivity

References

1

P. acidus (L.) Skeels

Tree

Cultivated

2

P. airyshawii Brunel & Roux P. ajmerianus L.B. Chaudhary & R.R. Rao P. amarus Schumach.

Herb

Rare

Immunomodulatory effect against gastrointestinal disorders No reports

Herb

Endemic

No reports

Herb

Common

P. anamalayanus (Gamble) G.L. Webster P. andamanicus N.P. Balakr. & N.G. Nair P. arbuscula (Sw.) J.F. Gmelin P. baeobotryoides Wall. P. baillonianus Muell.Arg. P. beddomei Gamble P. brevipes Hook.f.

Shrub

Endemic

Antioxidant, Abhyankar et al., 2010; anticancer, Adeneye and Benebo, nephroprotective 2008; activity, Chirdchupunseree and hepatoprotective Pramyothin, 2010; activity, antibacterial Eldeen et al., 2010; activity, Faremi et al., 2008; antiinflammatory, Kassuya et al., 2006; antiallodynic, Kiemer et al., 2003; antitumor Kumar and Kuttan, 2005; Naaz et al., 2007; Narendranathan et al., 1997; Notka et al., 2003; Notka et al., 2004; Rajeshkumar and Kuttan, 2000; Rajeshkumar et al., 2002; Raphael and Kuttan, 2003 No reports

Shrub

Endemic

No reports

Shrub

Cultivated

No reports

Shrub

Rare

No reports

Shrub

Endemic

No reports

Shrub Shrub

Endemic Endemic

No reports No reports

3

4

5

6 7 8 9 10 11

Kundu et al., 2009

(continued)

100

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

TABLE 5.1 (continued) Phyllanthus L. Species in India and Their Pharmacological Activities Sl No. 12

13 14 15 16

17 18

19

20 21 22 23 24

Phyllanthus Species

Habit

Status

P. chandrabosei Govaets & Radcl.-Sm. P. clarkei Hook.f. P. columnaris Muell. Arg. P. debilis Klein ex Willd. P. emblica L.

Shrub

Endemic

No reports

Bioactivity

Shrub Shrub

Very rare Rare

No reports No reports

Herb

No reports

Tree

Common in plains Common

P. fimbriatus (Wight) Muell. Arg. P. fraternus G.L. Webster

Shrub

Endemic

Herb

Uncommon

Hepatoprotective activity

P. gageanus (Gamble) M. Mohanan P. glaucus Wall.

Shrub

Endemic

No reports

Shrub

No reports

P. gomphocarpus Hook.f. P. griffithii Muell. Arg. P. heyneanus Muell. Arg. P. indofischeri Bennet

Shrub

Common in northeast Rare

Shrub

Endemic

No reports

Shrub

Endemic

No reports

Tree

Endemic

No reports

References

Antioxidant, Al-Rehaily et al., 2002; antisecretory, Bandyopadhyay et al., antiulcer, and 2000; Jose et al., 2001; cytoprotective Liu et al., 2008; Luo et properties; antitumor, al., 2009; Mathur et al., free radical 1996; Nosál’ová et al., scavenging activity, 2003; Perianayagam et hypolipidaemic al., 2004; Pramyothin et activity, antitussive, al., 2006; Reddy et al., antipyretic, analgesic, 2009; Sai Ram et al., hepatoprotective 2002; Sharma et al., activity 2009; Sultana et al., 2008 No reports Gopi and Setty, 2010; Padma and Setty, 1999; Sailaja and Setty, 2006; Sebastian and Setty, 1999

No reports

(continued)

101

Genetic Resources of Phyllanthus in Southern India

TABLE 5.1 (continued) Phyllanthus L. Species in India and Their Pharmacological Activities Sl No.

Phyllanthus Species

Habit

Status

25

P. juniperinoides Muell. Arg.

Shrub

26

P. leschenaultii Muell. Arg. P. macraei Muell. Arg. P. macrocalyx Muell. Arg P. maderaspatensis L.

Shrub

Endemic to peninsular India Very rare

No reports

Shrub

Endemic

No reports

Shrub

Endemic

No reports

Herb

Common

P. megacarpus (Gamble) Kumari & Chandrab. P. myrtifolius (Wight) Muell. Arg.

Shrub

Endemic

Hepatoprotective activity No reports

Shrub

Cultivated

P. narayanaswamii Gamble P. parvifolius Buch.-Ham.ex D.Don P. pendulus Roxb. P. pinnatus (Wight) G.L Webster P. polyphyllus Willd.

Herb

Endemic

Antibacterial, Eldeen et al., 2010 antioxidant, anti-HIV activity No reports

Shrub

Rare

No reports

Shrub Shrub

Endemic Uncommon

No reports No reports

Shrub

Common in peninsular India Rare

Anti-inflammatory activity

Rare

No reports

Cultivated

Antitumor, antioxidant, anti-HIV activity Antioxidant, antidiabetic Hepatoprotective activity

27 28 29 30

31

32 33

34 35 36

37

39

P. praetervisus Muell. Shrub Arg. P. pseudoparvifolius Shrub R.L. Mitra & Sanjappa P. pulcher Wall. Shrub

40

P. reticulatus Poir.

Shrub

41

P. rheedei Wight

Herb

42

P. roeperianus Wall.

Shrub

38

Very common Rare in peninsular India Rare

Bioactivity

References

No reports

Asha et al., 2004; Asha et al., 2007

Rao et al., 2006

No reports

Stanslas et al., 2008; Eldeen et al., 2010 Eldeen et al., 2010; Kumar et al., 2008 Suresh and Asha, 2008

No reports (continued)

102

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

TABLE 5.1 (continued) Phyllanthus L. Species in India and Their Pharmacological Activities Sl No.

Phyllanthus Species

Habit

43

P. rotundifolius Klein ex Willd.

Herb

44

P. sanjappae Chakrab. & M. Gangop. P. scabrifolius Hook.f. P. sikkimensis Muell. Arg. P. simplex Retz

Status

Bioactivity

Shrub

Common in coastal areas Endemic

No reports

Herb

Endemic

No reports

Shrub

Very rare

No reports

Herb

Common

Shrub

Endemic

49 50

P. singampattianus (Sebastine & A.N Henry) Kumari & Chandrab. P. talbotii Sedgw. P. tenellus Roxb.

Antidiabetic, antioxidant activity No reports

Shrub Herb

Endemic Naturalized

51 52

P. tetrandrus Roxb. P. urinaria L.

Shrub Herb

Rare Common

53

P. wightianus Muell. Arg.

Shrub

Endemic

45 46 47 48

References

No reports

Shabeer et al., 2009

No reports Immunomodulatory Ignácio et al., 2001 effect against microbial activity No reports Antibacterial, Eldeen et al., 2010; antioxidant, anti-HIV Chudapongse et al., activity, 2010; Fang et al., 2008; hepatoprotective Hau et al., 2009; Huang activity, antiet al., 2003; Huang et inflammatory, al., 2004; Huang et al., anticancer, antitumor, 2006; Lai et al., 2008; antiangiogenic, Lin et al., 2008; Yang et chemopreventive al., 2005; Yang et al., agent for peptic ulcer, 2007 anti-HSV No reports

many of the species face the risk of local or regional extinction of their populations (Uma Shaanker et al., 2002, Ravikanth et al., 2009). In this chapter, we briefly review the status of Phyllanthus resources in southern India with the overall aim of understanding the spatial distribution of the species as well as its genetic diversity. This information is critical in designing strategies for the long-term utilization and conservation of Phyllanthus genetic resources.

103

Genetic Resources of Phyllanthus in Southern India

TABLE 5.2 Phyllanthus Species Traded in India and Molecular Regions that Have Been Sequenced Along with Their Accession Numbers Sl No. 1

Phyllanthus Species (Trade Name) P. amarus (Bhumiamla)

2

P. debilis (Bhumiamla)

3

P. fraternus (Bhumiamla) P. maderaspatensis (Kanocha)

4

5

P. reticulatus (Buinowla)

6

P. urinaria (Lal-BhuinAnvalah)

7

P. virgatus (Niruri)

Molecular Regions ITS psbA-trnH

GenBank Accession No.

References Pruesapan et al., 2008 Srirama et al., 2010

ITS psbA-trnH rbcL matK, trnK

EU623557.1 GU598561–65, GU598577 EU643742 FJ235474.1 FJ235356 FJ235310.1 EU861193.1 AY765265.1 AY936686 AY936591 FJ235265 FJ235311 FJ235357 FJ235475 GU598567–68 GU598566, 69 EU876847 GU598536–38 AY936609 AY936707 AY765290 AY936629 FJ235270 FJ235316 FJ235362 FJ235480 GU598539–40 AY765305 AY936736 AY936637

ITS atpB ndhF phyC atpB matK trnK, matK

AY765268 GU598573–74 FJ235485 FJ235367 FJ235321 FJ235275 AY936639

Lee et al., 2006 Srirama et al., 2010 Unpublished Kathriarachchi et al., 2006 Kathriarachchi et al., 2006 Kawakita and Kato, 2009 Kawakita and Kato, 2009 (continued)

ndhF phyC atpB trnL rbcL trnK, matK psbA-trnH ndhF phyC atpB matK trnK ITS ITS psbA-trnH ITS trnK psbA-trnH psbA-trnH ndhF phyC atpB matK

Pruesapan et al., 2008 Kawakita and Kato, 2009 Kawakita and Kato, 2009 Kawakita and Kato, 2009 Unpublished Lee et al., 2006 Srirama et al., 2010 Kawakita and Kato, 2009 Kawakita and Kato, 2009 Kawakita and Kato, 2009 Kawakita and Kato, 2009 Kathriarachchi et al., 2006 Kathriarachchi et al., 2006 Srirama et al., 2010 Unpublished Srirama et al., 2010 Kathriarachchi et al., 2006 Kathriarachchi et al., 2006 Kawakita and Kato, 2009 Srirama et al., 2010 Kawakita and Kato, 2009 Kawakita and Kato, 2009 Kathriarachchi et al., 2006 Kawakita and Kato, 2009 Lee et al., 2006 Lee et al., 2006 Kathriarachchi et al., 2006 Kathriarachchi et al., 2006

104

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

TABLE 5.2 (continued) Phyllanthus Species Traded in India and Molecular Regions that Have Been Sequenced Along with Their Accession Numbers Sl No.

Phyllanthus Species (Trade Name)

8

P. emblica (Amla)

9

P. indofischeri (Amla/Ittu nelli)

Molecular Regions ITS rbcL psbA-trnH ndhF phyC atpB trnK, matK ITS rbcL trnL matK psbA-trnH trnL

GenBank Accession No. AY936738 GU441778 EU643743 FJ847837 GU441788 AY936689 AY936594 FJ235297 FJ235343 FJ235461 GU598547 GU598558–60 GU930706

Reference Kawakita and Kato, 2009 Kawakita and Kato, 2009 Srirama et al., 2010 Kawakita and Kato, 2009 Kawakita and Kato, 2009 Kawakita and Kato, 2009 Kathriarachchi et al., 2006 Kathriarachchi et al., 2006 Unpublished Unpublished Pruesapan et al., 2008 Srirama et al., 2010 Unpublished

5.2  DISTRIBUTION OF PHYLLANTHUS SPECIES Phyllanthus is one of the most species-rich genera of the family Phyllanthaceae, comprising over 800 species worldwide (Calixto et al., 1998; Govaerts et al., 2000; Wurdack et al., 2004). The genus is subdivided into 11 subgenera: Isocladus, Kirganelia, Cicca, Emblica, Conani, Gomphidium, Phyllanthodendron, Xylophylla, Botryanthus, Ericoccus, and Phyllanthus. Plants of this genus are characterized by diverse growth forms, including shrubs, trees, and annual or biennial herbs and are distributed throughout the tropical and subtropical regions of both hemispheres. A few species of Phyllanthus are notorious weeds and occur in four continents (America, Africa, Asia, and Australia). India has 53 species of Phyllanthus, of which 23 species are endemic (Balakrishnan and Chakrabarty, 2007). These are distributed throughout the Indian subcontinent, with higher densities in the southern region. As many as 17 species are endemic to peninsular India, 2 species to the Andaman and Nicobar Islands, and others restricted to central and northeastern India (Balakrishnan and Chakrabarty, 2007).

5.2.1  Identification of Geographic Hot Spots of Phyllanthus in South India: Contours of Species Richness One of the key strategies to the sustainable management of any natural resource is to obtain spatially explicit information on its distribution. Spatially explicit distribution maps of the species could facilitate the management and utilization of these resources, tracking the dynamics of the resources over time; aid in preparing

Genetic Resources of Phyllanthus in Southern India

105

germplasm collections; and help in assigning conservation value and priorities. Using geographic information systems, Ganeshaiah and Uma Shaanker (2003) developed a spatially explicit distribution map of all herbaceous species of Phyllanthus in India (Figure 5.1). Secondary data of occurrence of the species were obtained from various sources, like floras, herbaria, books, and other published sources, and then digitized. Species richness of Phyllanthus was summated on grids (1° latitude × 1° longitude), and contours of species richness were plotted (Figure 5.1). Among the 53 species of Phyllanthus, 37 are shrubs, 13 are herbs, and 3 are trees (Balakrishnan and Chakrabarty, 2007). The 13 herbaceous species of Phyllanthus are primarily concentrated in the states of Tamil Nadu, Kerala, Karnataka, Maharashtra, and Andhra Pradesh. A few species of Phyllanthus, such as P. amarus, are distributed throughout the country. Two herbs (i.e., P. rheedii and P. kozhikodianus) are endemic to peninsular India and Sri Lanka. Similarly, P. scabrifolius is endemic to Maharashtra and northern Karnataka. Phyllanthus ajmerianus is endemic to

FIGURE 5.1  See color insert. Hypsographic view of Phyllanthus species richness in India. The data on the distribution of the species were obtained from diverse sources (monographs, etc.), and the latitude and longitude were assigned for each record and mapped. The density of the species in each grid of the size 10 km × 10 km was computed and the contours for the density obtained. Based on the contour data, the three-dimensional view was constructed using suitable GIS software.

106

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

Phyllanthus emblica 4 to 4 (1) 3 to 3 (1) 2 to 2 (98) 1 to 1 (295)

FIGURE 5.2  Resource map of Phyllanthus emblica. The map was developed using data collected from primary sources. Each pixel is the size of 6.25 km × 6.25 km. The lighter shades indicate higher densities. The numbers in brackets indicate the number of records at each pixel.

Rajasthan. Among the shrubs, about 7 species are endemic to India. Phyllanthus indofischeri is the only tree species endemic to the Deccan Plateau (Ganesan, 2003; Balakrishnan and Chakrabarty, 2007). The distribution of P. indofischeri overlaps with P. emblica; while P. emblica is distributed throughout the Deccan peninsular region and some parts of central India (Figure 5.2), P. indofischeri is restricted to southern India (Ganesan and Shetty, 2004). These contour maps depicting the relative richness of the species on the Indian landscape are extremely useful both in guiding conservation strategies and in planning the sustained utilization of the resources (Ravikanth et al., 2001, 2002). Besides the species richness maps described, Ganeshaiah and U. Shaanker (2007) also developed species-specific maps, especially for those in trade. For example, specific maps have been developed for P. emblica, one of the most important species in trade (Figure 5.2). These maps, with grids resolution of 6.25 × 6.25 km, provide

Genetic Resources of Phyllanthus in Southern India

107

precise spatial information on the resource stock of the species. Further, when overlaid with other parameters, such as demand levels and production data (supply), the species-specific maps can be used to develop a user-friendly resource management system that can advise on a variety of issues, including the optimal levels of harvesting, rotation schedules of harvesting over the distributional range of the species, and finally providing a dynamic inventory of the resource (Uma Shaanker et al., 2004).

5.3 IDENTIFICATION OF GENETIC HOT SPOTS OF ECONOMICALLY IMPORTANT PHYLLANTHUS SPECIES One of the major limitations in planning the effective utilization and conservation of genetic resources of medicinal plant species is the lack of critical information on the spatial distribution of genetic variability of the species. Spatially explicit analysis of the genetic variability of the species could aid in (1) identification of genetic hot spots of the species, (2) appropriately designing germplasm collections, and (3) deciding on what and where to conserve. Unfortunately for many medicinally important species, there is a severe dearth of information with respect to the spatial distribution of variability. Here, we briefly review attempts that have been carried out to identify the genetic hot spots for the two most important medicinal plants in the genus Phyllanthus.

5.3.1  Phyllanthus emblica Phyllanthus emblica L. constitutes one of the important medicinal plants in the Phyllanthus genus. Phyllanthus emblica is a medium-size tree, and all its parts are used for various medicinal applications. It is widely distributed in the deciduous forests in southern India. The tree is one of the most important nontimber forest product species and is a source of livelihood for scores of forest-dwelling communities in India (Ganesan and Shetty, 2004). In recent years, because of the increase in the demand for herbal products, there has been intense extraction of the fruits. Destructive harvesting practices could have a detrimental effect on the populations of P. emblica (Sinha and Bawa, 2002). This consequently can reduce the regeneration of the species, leading to a loss of genetic variability. Uma Shaanker and Ganeshaiah (1997) assessed the genetic diversity of P. emblica populations in southern India spread across three states, namely, Karnataka, Tamil Nadu, and Kerala. These populations are geographically isolated and represent diverse biogeographic strata from the three states. Based on isozyme analysis of six enzyme systems, the genetic variability of seven populations was assessed. Populations in southern Kerala had the highest allelic diversity as well as allele richness compared to the other populations (Uma Shaanker and Ganeshaiah, 1997). The relative abundance of most of the alleles was also found to be high in the Kerala populations. Based on these genetic parameters, Uma Shaanker and Ganeshaiah (1997) argued that the populations in Kerala could represent a potential hot spot of genetic variability of P. emblica.

108

Phyllanthus Species: Scientific Evaluation and Medicinal Applications

5.3.2  Phyllanthus amarus Phyllanthus amarus is traditionally used in the treatment of bile and urinary conditions, hepatitis, flu, cold, jaundice, liver cancer, tuberculosis, diabetes, hypertension, pains, and other maladies (Amaechina and Omogbai, 2007). Phyllanthus amarus is reported to contain lignans such as phyllanthin and hypophyllanthin, alkaloids, and flavonoids such as quercetin (Santos et al., 1995). Phyllanthus amarus is traded as a raw herbal drug and exported for various medicinal formulations for the treatment of liver disorders (Kamble et al., 2008). However, most of the raw trade of P. amarus involves widespread collection of the individuals from the wild. Jain et al. (2003) assessed the molecular diversity of P. amarus across India using RAPD (random amplified polymorphic DNA) markers. The genetic variability was assessed across 33 locations covering the states of Tamil Nadu, Karnataka, Maharashtra, Gujarat, Assam, West Bengal, Tripura, Uttar Pradesh, Punjab, and Haryana. Intrapopulation variation was larger in accessions from southern India compared to other parts of the country (Jain et al., 2003). In another study, Murthy (2004) assessed the population genetic variability of P. amarus in three southern states of India (Karnataka, Tamil Nadu, and Kerala) and a union territory (Pondicherry). The population genetic parameters were assessed using 10 intersequence simple repeat (ISSR) primers. Kerala populations had the highest percentage of polymorphic loci, while the Karnataka populations had the least. The highest diversity was also found to be in the populations collected from Kerala. There was a clear genetic differentiation of populations based on their sites of origin. In summary, studies of both P. emblica and P. amarus suggested that Kerala populations in southern India are genetically most diverse. It is likely that species radiated and diverged from this region into the rest of the country.

5.4 IMPACT OF HARVESTING ON THE GENETIC VARIABILITY OF P. EMBLICA Phyllanthus species are among the most highly traded medicinal plant species in the country. Fruits of the species (such as P. emblica and P. indofischeri) and whole plants (in case of herbaceous species such as P. amarus, P. debilis, etc.) are extracted mostly from their natural populations. In recent years, because of resurgence of the herbal market globally, there has been an upsurge in the extraction of several medicinal plant species, including Phyllanthus, from their natural populations (Ved and Goraya, 2008; Ravikanth et al., 2009). In most cases, harvesting of the medicinal plants goes on unabated with few regulations on the extent and the nature of harvest. Consequently, such high extraction pressures could have a severe impact on the demographic and genetic profile of the populations. For example, a seemingly low-impact use, such as harvesting of Phyllanthus emblica fruits, may have a high long-term effect on populations, either because of the effect on seedling recruitment or because fruit collection involves pruning of branches or sometimes even tree felling (Figure 5.3; Padmini et al., 2001; Uma Shaanker et al., 1996). Among the possible impacts of harvesting, that on the genetic variability and structure of populations has been the least studied (Uma Shaanker et al., 2001;

109

Genetic Resources of Phyllanthus in Southern India

90 80

Percentage

70 60 50 40 30 20 10 0

Control

Mild Disturbance levels

High

FIGURE 5.3  Percentage seedlings and saplings (