DE102005011648A1 - A method of increasing fungal resistance in transgenic plants by host-induced suppression of gene expression in fungal pathogens - Google Patents

Abstract

The present invention relates to a method for increasing fungal resistance in transgenic plants, which is characterized in that a recombinant nucleic acid molecule comprising a nucleic acid sequence which is homologous and / or complementary to a nucleic acid sequence of a fungus and which is transcribed in the plant upon infection of the plant with this fungus, the nucleic acid sequence transcribed in the plant interacts with the homologous and / or complementary nucleic acid sequence of the fungus or parts thereof such that the expression of the nucleic acid sequence of the fungus is substantially prevented from being introduced into the plant. DOLLAR A The present invention also relates to a method for the identification of fungal genes in which the inhibition of their expression mediates fungal resistance and the use of nucleic acid sequences which are homologous and / or complementary to a nucleic acid sequence of one or more fungi for the production of transgenic plants with elevated fungal resistance.

Description

The The present invention relates to a method for increasing the Fungal resistance in transgenic plants, which is characterized in that a recombinant nucleic acid molecule comprising a nucleic acid sequence, to a nucleic acid sequence a fungus is homologous and / or complementary and that in the plant is transcribed so that when infected the plant with this Fungus transcribed in the plant nucleic acid sequence with the homologous and / or complementary nucleic acid sequence of the fungus or parts thereof interacts in such a way that expression the nucleic acid sequence The fungus is essentially prevented from being introduced into the plant becomes.

The The present invention also relates to a method of identification of fungal genes in which the inhibition of their expression in transgenic Plant fungal resistance as well as the use of nucleic acid sequences, to a nucleic acid sequence one or more fungi are homologous and / or complementary, for the production of transgenic plants with increased fungal resistance.

Plant diseases by different pathogens such. As viruses, bacteria and Mushrooms can be caused crop crops lead to significant crop failures, which on the one hand has economic consequences, but also the safety of human nutrition threatened. For example, the infestation of cereals with Blumeria graminis, the causative agent of powdery mildew, to yield losses of more than 30% lead.

since The last century will be used to control fungal diseases used chemical fungicides. Through the use of these substances Although the extent of Plant diseases are reduced, but it is still today not be ruled out, that these compounds are harmful Have an effect on humans, animals and the environment. In the long term consumption from conventional It is therefore to reduce pesticides to a minimum important, the natural Pathogen defense of different plants against different pathogens to investigate and identify them through genetic manipulation, z. B. by the insertion external resistance genes or by the manipulation of endogenous gene expression in the plants, for the production of pathogen-resistant plants to make targeted use.

When Resistance is the ability a plant, infested and colonized by a pest prevent or at least limit it. The plants have one certain degree naturally Resistance caused by the formation of specific defense substances such as isoprenoids, flavonoids, enzymes and reactive oxygen compounds is taught.

Therefore There is an approach to produce transgenic plants with increased fungal resistance in it, a herbal gene that contributes to the formation of this specific Defensive substances leads, in the plant to overexpress. Thus, chitinase (WO 92/17591) and pathogenesis could already be related Gene (WO 92/20800) and genes for various oxidizing enzymes such as glucose oxidase (WO 95/21924) and oxalate oxidase (WO 99/04013) are overexpressed in plants and thereby plants with elevated Fungal resistance are produced.

Vice versa but it could also be shown that some plant genes only allow the entry of the fungus into the plant. Therefore, there is one alternative approach for producing transgenic plants with increased fungal resistance therein, the expression of these plant genes, the z. B. for a polyphenol oxidase (WO 02/061101), NADPH oxidase (WO 2004/009820) and the Mlo gene (WO 00/01722) encode in transgenic plants.

however are still not resistant to all fungal pathogenic resistance genes to disposal, which made the plants resistant to these special fungi can be. In addition, some of the known resistance genes mediate only a temporal limited protection and can therefore not for producing a permanent resistance in transgenic Plants are used.

Therefore There is still a need for methods of making transgenic plants with elevated Fungal resistance and by methods for the identification of genes, for the production of transgenic plants with increased fungal resistance can be used.

task The present invention is therefore one of the methods of Prior art alternative method available make it possible with that is to produce transgenic plants with increased fungal resistance. In particular, it is an object of the present invention to provide a Procedure available to produce plants that can be produced a resistance to a broad spectrum of different types of fungi. Further It is an object of the invention to provide a method with which genes can be found that are used for this purpose can, transgenic plants with elevated To produce fungal resistance.

to solution this and other tasks, as it is clear from the description serve the features of the independent claims.

preferred embodiments The invention is defined by the features of the subclaims.

The Problems are solved by the present invention in that a method of increase the fungal resistance provided in transgenic plants characterized in that it comprises a recombinant nucleic acid molecule a nucleic acid sequence, to a nucleic acid sequence a fungus is homologous and / or complementary and that in the plant is transcribed so that when infected the plant with this Fungus transcribed in the plant nucleic acid sequence with the homologous and / or complementary nucleic acid sequence of the fungus or parts thereof interacts in such a way that expression the nucleic acid sequence The fungus is essentially prevented from being introduced into the plant becomes.

The Tasks are also performed by a method of identification solved by fungal genes, in which the inhibition of their expression in transgenic plants fungal resistance comprising the steps of (a) identifying appropriate ones Target genes, (b) preparing RNAi constructs for these target genes in a suitable vector, (c) transform the RNAi constructs in suitable test plants, (d) inoculating the test plants with a suitable fungus and (e) evaluating the fungal attack of the plant with a suitable evaluation method.

While at the prior art methods as described above were either overexpressed, an endogenously present in the plant gene or inhibited so that the plant develops increased fungal resistance, is in a method according to the present Invention chosen a fundamentally different strategy.

It was in fact surprising found that by expressing one to the nucleic acid sequence of a fungal gene homologous and / or complementary nucleic acid sequence in a plant, the fungal resistance of this plant is increased can be inhibited by the expression of the fungal gene. Thus, the "gene silencing" in the fungus by a nucleic acid sequence caused by the host of the fungus, the plant, This method is also referred to as "host-induced gene silencing" (HIGS).

object The invention therefore provides a method for increasing fungal resistance in transgenic Plants, characterized in that a recombinant Nucleic acid molecule comprising a nucleic acid sequence, to a nucleic acid sequence a fungus is homologous and / or complementary and that in the plant is transcribed so that when infected the plant with this Fungus transcribed in the plant nucleic acid sequence with the homologous and / or complementary nucleic acid sequence of the fungus or parts thereof interacts in such a way that expression the nucleic acid sequence The fungus is essentially prevented from being introduced into the plant becomes.

One Another object of the present invention are transgenic plants or plant cells, according to one of the methods of the invention and have increased fungal resistance compared to the wild type.

Also The invention relates to the use of nucleic acid sequences, to a nucleic acid sequence one or more fungi are homologous and / or complementary, for the production of transgenic plants with increased fungal resistance.

"Fungal resistance" means reducing or attenuating disease symptoms of a plant as a result of attack by a fungus. The symptoms may be of a variety of types, but preferably include those directly or indirectly affecting the quality of the plant, the quantity of the yield, the Suitability for use as feed or food or make sowing, cultivation, harvest or processing of the crop difficult. Likewise, "fungal resistance" means that a fungus in a plant shows reduced growth and decreased or absent proliferation.

Under the term "increased fungal resistance" is understood according to the invention, that the transgenic invention Plants or plant cells by fungi less strong and / or less often are infested as non-transformed wild-type plants or plant cells, otherwise treated equally (eg climatic and growing conditions, Mushroom type, etc.). The infestation with fungi is preferably at least about the factor 2, more preferably at least a factor of 3, in particular preferably at least a factor of 5, and most preferably at least reduced by a factor of 10, resulting in a reduction in training of disease symptoms. Of the Term "increased fungal resistance" includes also a so-called transient fungal resistance, i. that the transgenic invention Plants or plant cells only for a limited period one opposite increased the corresponding wild type Have fungal resistance.

fungal pathogens or mushroom-like Pathogens (such as Chromista) are preferably from the group comprising Plasmodiophoramycota, Oomycota, Ascomycota, Chytridiomycetes, Zygomycetes, Basidiomycota and Deuteromycetes (Fungi imperfecti). By way of example, but not limitation, are those in Table 1 mentioned and associated with them To name diseases.

Table 1: Plant fungal diseases

• – Plasmodiophoromycota wie Plasmodiophora brassicae (Kohlhernie, clubroot of crucifers), Spongospora subterranea (powdery scab of potato tubers), Polymyxa graminis (root disease of cereals and grasses);
• – Oomycota wie Bremia lactucae (Falscher Mehltau an Salat), Peronospora (Falscher Mehltau) bei snapdragon (P. antirrhini), Zwiebel (P. destructor), Spinat (P. effusa), Sojabohne (P. manchurica), Tabak ("blue mold" = Blauschimmel; P. tabacina) Alfalfa und Klee (P. trifolium), Pseudoperonospora humuli (Falscher Mehltau an Hopfen), Plasmopara (Falscher Mehltau bei Trauben) (P. viticola) und Sonnenblume (P. halstedii), Sclerophtohra macrospora (Falscher Mehltau bei Cerealien und Gäsern), Pythium (seed rot, seedling damping-off, and root rot and all types of plants, z.B. Wurzelbrand an Beta-Rübe durch P. debaryanum), Phytophthora infestans (Kraut- und Knollenfäule bei Kartoffel, Braunfäule bei Tomate etc.), Albugo spec. (white rust on cruciferous plants);
• – Ascomycota wie Microdochium nivale (Schneeschimmel an Roggen und Weizen), Fusarium graminearum, Fusarium culmorum (Ährenfäule v.a. bei Weizen), Fusarium oxysporum (Fusarium-Welke an Tomate), Blumeria graminis (Echter Mehltau an Gerste (f.sp. hordei) und Weizen (f.sp. tritici)), Erysiphe pisi (Erbsenmehltau), Nectria galligena (Obstbaumkrebs), Unicnula necator (Echter Mehltau der Weinrebe), Pseudopeziza tracheiphila (Roter Brenner der Weinrebe), Claviceps purpurea (Mutterkorn an z.B. Roggen und Gräsern), Gaeumannomyces graminis (Schwarzbeinigkeit an Weizen, Roggen u.a. Gräsern), Magnaporthe grisea (rice blast disease), Pyrenophora graminea (Streifenkrankheit an Gerste), Pyrenophora teres (Netzfleckenkrankheit an Gerste), Pyrenophora tritici-repentis (Blattfleckenkrankheit (Blattdürre) an Weizen), Venturia inaequalis (Apfelschorf), Sclerotinia sclerotium (Weißstengeligkeit, Rapskrebs), Pseudopeziza medicaginis (Klappenschorf an Luzerne, Weiß- und Rotklee);
• – Basidiomyceten wie Typhula incarnata (Typhula-Fäule an Gerste, Roggen, Weizen), Ustilago maydis (Beulenbrand an Mais), Ustilago nuda (Flugbrand an Gerste), Ustilago tritici (Flugbrand an Weizen, Dinkel), Ustilago avenae (Flugbrand an Hafer), Rhizoctonia solani (Wurzeltöter an Kartoffeln), Sphacelotheca spp. (head smut of sorghum), Melampsora lini (rust of flax), Puccinia graminis (Schwarzrost an Weizen, Gerste, Roggen, Hafer), Puccinia recondita (Braunrost an Weizen), Puccinia dispersa (Braunrost an Roggen), Puccinia hordei (Braunrost an Gerste), Puccinia coronata (Kronenrost an Hafer), Puccinia striiformis (Gelbrost an Weizen, Gerste, Roggen sowie zahlreichen Gräsern), Uromyces appendiculatus (Bohnenrost), Sclerotium rolfsii (root and stem rots of many plants);
• – Deuteromyceten (Fungi imperfecti) wie Septoria nodorum (Spelzenbräune) an Weizen (Septoria tritici), Pseudocercosporella herpotrichoides (Halmbruchkrankheit an Weizen, Gerste, Roggen), Rynchosporium secalis (Blattfleckenkrankheit an Roggen und Gerste), Alternaria solani (Dürrfleckenkrankheit an Kartoffel, Tomate), Phoma betae (Wurzelbrand an Beta-Rübe), Cercospora beticola (Cercospora-Blattfleckenkrankheit an Beta-Rübe), (Alternaria brassicae (Rapsschwärze an Raps, Kohl u.a. Kreuzblütlern), Verticillium dahliae (Rapswelke und -stengelfäule), Colletotrichum lindemuthianum (Brennfleckenkrankheit an Bohne), Phoma lingam – Umfallkrankheit (Schwarzbeinigkeit an Kohl; Wurzelhals- oder Stengelfäule an Raps), Botrytis cinerea (Grauschimmel an Weinrebe, Erdbeere, Tomate, Hopfen etc.).

Particularly preferably, the inhibition of the expression of the fungal gene causes resistance to

• - Plasmodiophoromycota such as Plasmodiophora brassicae (cabbage hernia, clubroot of crucifers), Spongospora subterranea (powdery scab of potato tubers), Polymyxa graminis (root disease of cereals and grasses);
• - Oomycota such as Bremia lactucae (downy mildew on lettuce), Peronospora (downy mildew) at snapdragon (P. antirrhini), onion (P. destructor), spinach (P. effusa), soybean (P. manchurica), tobacco ("blue mold "= blue sky; P. tabacina) alfalfa and clover (P. trifolium), Pseudoperonospora humuli (downy mildew on hops), Plasmopara (downy mildew in grapes) (P. viticola) and sunflower (P. halstedii), Sclerophtohra macrospora ( Downy mildew on cereals and gals), Pythium (seed red, seedling damping-off, and root red and all types of plants, eg root blight on beta beet by P. debaryanum), Phytophthora infestans (late blight on potato, brown rot in tomato etc.), Albugo spec. (white rust on cruciferous plants);
• Ascomycota such as Microdochium nivale (snow mold on rye and wheat), Fusarium graminearum, Fusarium culmorum (ear rot especially in wheat), Fusarium oxysporum (Fusarium wilt on tomato), Blumeria graminis (powdery mildew on barley (f.sp. hordei) and Wheat (f.sp. tritici)), Erysiphe pisi (pea thaw), Nectria galligena (fruit tree crayfish), Unicnula necator (grapevine powdery mildew), Pseudopeziza tracheiphila (red burner of the grapevine), Claviceps purpurea (ergot to eg rye and grass gneus), Gaeumannomyces graminis (blackleg on wheat, rye, etc. grasses), Magnaporthe grisea (rice blast disease), Pyrenophora graminea (barley on barley), Pyrenophora teres (net blotch on barley), Pyrenophora tritici-repentis (leaf blotch (leaf blight) on wheat ), Venturia inaequalis (apple scab), Sclerotinia sclerotium (white stem, rape), Pseudopeziza medicaginis (valve scab on alfalfa, white and red clover);
• - Basidiomycetes such as Typhula incarnata (Typhula blight on barley, rye, wheat), Ustilago maydis (blubber on corn), Ustilago nuda (blaze of barley), Ustilago tritici (blaze of wheat, spelled), Ustilago avenae (blaze of oats) , Rhizoctonia solani (root-killer on potatoes), Sphacelotheca spp. (head smut of sorghum), Melampsina lini (rust of flax), Puccinia graminis (black rust on wheat, barley, rye, oats), Puccinia recondita (brown rust on wheat), Puccinia dispersa (brown rust on rye), Puccinia hordei (brown rust on Barley), Puccinia coronata (crown rust on oats), Puccinia striiformis (yellow rust on wheat, barley, rye and numerous grasses), Uromyces appendiculatus (bean rust), Sclerotium rolfsii (root and stem reds of many plants);
• - Deuteromycetes (Fungi imperfecti) such as Septoria nodorum (teal tubers) on wheat (Septoria tritici), Pseudocercosporella herpotrichoides (wheat strawberries, barley, rye), Rynchosporium secalis (leaf spot disease on rye and barley), Alternaria solani (drought on potato, tomato) , Phoma betae (root burn on beta beet), Cercospora beticola (Cercospora leaf spot disease on beta beet), (Alternaria brassicae (canola black oilseed rape, cabbage and other cruciferous vegetables), Verticillium dahliae (rape wilt and stalk rot), Colletotrichum lindemuthianum (focal blotch disease) Bean), Phoma lingam - turnip disease (blackleg on cabbage, root and stem rot on rape), Botrytis cinerea (gray mold on grapevine, strawberry, tomato, hops, etc.).

At the Most preferred are those by the method of the invention plants resistant to Phytophthora infestans (herbaceous and blight, blight in tomato etc.), Microdochium nivale (formerly Fusarium nivale; Snow mold on rye and wheat), Fusarium graminearum, Fusarium culmorum (wheat rot), Fusarium oxysporum (Fusarium wilt on tomato), Blumeria graminis (Powdery mildew on barley (formerly hordei) and wheat (for sp. Tritici)), Magnaporthe grisea (rice blast disease), Sclerotinia sclerotium (Weißstengeligkeit, Rapeseed), Septoria nodorum and Septoria tritici (tuber of wheat), Alternaria brassicae (rapeseed blackened on rapeseed, cabbage and others Crucifer) Phoma lingam (turnip disease, blackleg on cabbage, root or stem rot on rape).

Under a "wild type" according to the invention is the corresponding not genetically modified Starting organism understood.

According to the invention, transgenic Plants that over an increased Fungus resistance, be prepared by comprising a recombinant nucleic acid molecule a nucleic acid sequence, to a nucleic acid sequence a fungus is homologous and / or complementary and that in the plant is transcribed so that when infected the plants with this Fungus transcribed in the plant nucleic acid sequence with the homologous and / or complementary nucleic acid sequence of the fungus or parts thereof interacts in such a way that expression the nucleic acid sequence The fungus is essentially prevented from being introduced into the plant becomes.

"Substantially suppressed" means in the context of the present invention that the expression level of the nucleic acid sequence of the fungus in the transgenic plants is reduced to a level in which the plants increased one Resistance to Fungal infections show or after initial symptoms of a fungal infection Signs for have a recovery. Under "transgenic Plants with elevated Fungus resistance " understood in the context of the present invention, such plants, show the low symptoms of a fungal infection, however, so weak pronounced are that the usability and usability of the affected plants not questioned. Inventive plants have an im Essentially unchanged phenotype on, i. the use as a useful, food or fodder plant etc. is not questioned.

The Expression level of the nucleic acid sequence of the fungus whose expression is due to that in the transgenic plant transcribed nucleic acid sequence is essentially prevented, can be in infested wild type plants as well as in the transgenic plants z. B. thereby determine that an RT-PCR analysis or a Northern blot analysis with specific Primers or probes performed becomes. It is clear to the person skilled in the art how to select the probes or primers, to the expression of the nucleic acid sequence to examine the fungus. Preferably, the expression level of nucleic acid sequence of the fungus by at least 50%, more preferably by at least 80%, more preferably at least 90%, also in particular preferably at least 95%, and most preferably at least 98 or 99% reduced.

in the For the purposes of the present invention, "sequence homology" or "homology" means that the nucleic acid sequence of a DNA molecule is at least 40%, preferably at least 50%, more preferably at least 60%, also preferably at least 70% and / or 75%, especially preferably at least 80%, 82%, 84%, 86% and / or 88%, in particular preferably at least 90%, 92% and / or 94%, and most preferred at least 95%, 96%, 97%, 98% and / or 99% to the nucleic acid sequences a known DNA or RNA molecule is identical, i. has the same nucleotides in the same 5'-3 'order.

The sequence identity will over a set of programs based on different algorithms, certainly. The algorithms of Needleman and Wunsch deliver or Smith and Waterman particularly reliable results. For the sequence comparisons became the program PileUp (Feng and Doolittle (1987) J. Mol. Evolution 25: 351-360; Higgins et al. (1989) CABIOS 5: 151-153) or the GAP programs and Best Fit (Needleman and Wunsch (1970) J. Mol. Biol. 48: 443-453 and Smith and Waterman (1981) Adv. Appl. Math. 2: 482-489), in the GCG software package (Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA).

The Sequence identity values given above in percent were with the program CAP over determines the entire sequence area with the following settings: Gap Weight: 50, Length Weight: 3, Average Match: 10000 and Average Mismatch: 0.000.

With the term complementarity becomes the ability a nucleic acid molecule described due to another nucleic acid molecule of hydrogen bonds between complementary ones Hybridize bases. The skilled worker knows that two nucleic acid molecules do not have a 100% complementarity feature have to, to be able to hybridize with each other. A nucleic acid sequence is preferred, those with a different nucleic acid sequence hybridize to this at least 40%, at least 50%, to at least 60%, preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95% and most preferably at least 98 or 100% complementary.

at the method according to the invention for the production of transgenic plants with increased fungal resistance, the Suppression of the expression of the nucleic acid sequence of a fungus different strategies are achieved. The expression of nucleic acid sequence a fungus can be found in transgenic plants z. By "silencing" in essence repressed become. In silencing, a nucleic acid sequence becomes homologous to a nucleic acid sequence a fungus and / or is complementary to transferred to the plant. To ensure that the plants transgene for the transferred nucleic acids are, which is to be transferred nucleic acid usually by a vector, such as. B. transferred a plasmid to the plant, which is able to become stable within the plant cell replicate or transferred nucleic acid to integrate into the plant genome.

Especially preferred for the silencing of nucleic acid sequences a fungus using the RNAi method. This is a Vector transferred to the plant cell, in the 5'-3 'direction the following Elements comprises: a promoter operable in plants; operationally bound a DNA sequence containing the antisense sequence of a nucleic acid sequence a fungus or parts thereof; an intron comprising splice donor and splice acceptor sequences; a DNA sequence containing the sense sequence of a nucleic acid sequence a fungus or parts thereof; and a termination sequence. Of course, the position of the antisense and sense sequences in the vector can be reversed become.

Become such vectors stably transferred to plant cells, arises at the Transcription of these vectors, first a pre-mRNA, the from a first exon containing the antisense sequence of a nucleic acid sequence a fungus or parts thereof, an intron and a second one Exon, which is the sense sequence of a nucleic acid sequence of a fungus or Parts of it, consists. Because the splice process removes the intron is created, a continuous RNA molecule with areas that are related to each other complementary are. Such an RNA molecule becomes a double-stranded Structure (Smith et al (2000) Nature 407: 319-320).

Such double-stranded RNA molecules are capable of specifically silencing the mRNA of certain fungal proteins by induction of the PTGS system, as a result of which these particular fungal proteins are no longer expressed. Which fungal proteins are no longer expressed is determined by the appropriate choice of antisense and sense sequences. Depending on whether these antisense and sense sequences include a sequence that is specific for a particular gene, or include sequences that in meh Therefore, it is possible to simultaneously silence either only one fungal gene or a multiplicity of fungal genes. The sequences characteristic of a particular protein can be determined by sequence homology programs available, for example, at http://www.ncbi.nlm.nih.gov/BLAST/. The finding of protein-characteristic sequences belongs to the usual knowledge of a person skilled in the art. Likewise, these programs can be used to select nucleic acid sequences which give plants increased resistance to several fungal pathogens. For this purpose, nucleic acid sequences from different fungal pathogens can be compared with one another and the sequence sections conserved between the pathogens can be identified, which are then used for the production of the transgenic plants by the method according to the invention in order to confer increased resistance to a plurality of fungal pathogens with the aid of a nucleic acid sequence of a plant.

Of the Expert also knows that different vectors for the RNAi method or PTGS can be used. Such vectors may, for. B. be constructed so that the sense and antisense sequences respectively transcribed from a U6 promoter, in the cell hybridize and induce the PTGS system (Tuschl (2002) Nat. Biotechnol. 20: 446-448; Miyagishi et al. (2002) Nat. Biotechnol. 20: 497-500; Lee et al. (2002) Nat. Biotechnol. 20: 500-505). For other vectors, the sense and antisense sequences are linked by a "loop" sequence and are transcribed from a human RNAse P RNA H1 promoter. By refolding the "loop" can be the Sense and antisense sequences hybridize, double-stranded RNA train and induce the PTGS system (Tuschl (2002) vide supra; Paul et al. (2002) Nat. Biotechnol. 20: 505-508; Paddison et al. (2002) Genes Dev. 16 (8): 948-958; Brummelkamp et al. (2002) Science 296: 550-553).

at another embodiment of the invention include those for transmission of the nucleic acids used Vectors in 5'-3 'orientation Promoter, operatively linked to a DNA sequence containing the antisense sequence the nucleic acid sequence the for comprising the fungal gene or parts thereof, as well as a termination sequence. In the transcription of this sequence in Plant cells creates an RNA molecule whose sequence is complementary to the for the Is fungal gene or parts thereof coding sequence. By hybridization the antisense sequence with mRNA sequences of fungal genes in vivo can therefore the expression of fungal genes in plant cells can be suppressed.

In a further embodiment include the vectors used for transmission used the nucleic acids become one in 5'-3 'orientation Promoter, operatively linked to the identical or homologous sequence the for the fungal gene or parts thereof encoding sequence that to itself complementary sections contains and a termination sequence. In the transcription of these vectors in the plant cell arise RNA molecules that have sequence areas that can hybridize with itself. Thereby can in the cell double-stranded RNA molecules occur to the PTGS system induce what then causes that the mRNA of the corresponding fungal genes is specifically degraded. This method, also referred to as co-suppression, for silencing of plant proteins requires that the mRNA of the suppressed Fungal gene over Has sections, complementary to each other are. Such sections can by a person skilled in the art by simple visual inspection of the respective DNA sequence or by appropriate sequence programs such. B. DNAStar the DNASTAR Inc., Madison, USA.

at another embodiment the method according to the invention become for transfer of the nucleic acids to the plant cells using vectors in the 5'-3 'orientation a plant-functional promoter, operatively linked to a DNA sequence encoding a ribozyme, the specifically recognizes the mRNA of fungal genes, as well as a termination sequence include. The skilled worker is known as ribozymes, the one against have a particular mRNA-directed endonuclease activity, can be produced. In detail, this is z. In Steinecke et al. (1992) EMBO J. 11: 1525 - 1530 described. In the context of this invention, the term "ribozyme" also includes such RNA sequences meant, which in addition to the actual ribozyme still comprise guide sequences, which are complementary to the mRNA of the fungal genes or parts thereof and so the mRNA-specific ribozyme even more targeted to the mRNA substrate of the ribozyme.

Another alternative for the production of transgenic plants with increased viral resistance is the transfer of nucleic acids by vectors which in the 5'-3 'orientation a plant-functional promoter operably linked to a DNA sequence, the antisense sequences of the fungal gene or parts thereof encoding sequence and the RNAse P coding sequence, as well as include a termination sequence. In the transcription of such vectors, RNA molecules are produced in the cell which have a leader sequence (the antisense sequence) which results in RNAse P to the mRNA of the fungal gene, causing cleavage of the mRNA by RNAse P (US Pat 5,168,053). Preferably around For example, the leader sequence comprises 10 to 15 nucleotides complementary to the DNA sequence of the fungal gene and a 3'-NCCA nucleotide sequence, where N is preferably a purine. The transcripts of the external leader sequence bind to the target mRNA through the formation of base pairs, allowing cleavage of the mRNA by RNAse P at nucleotide 5 'of the paired region. Such a cleaved mRNA can not be translated into a functional protein.

If in the context of the present invention of nucleic acid sequences is spoken for the fungal genes or encode parts of it, then they are both the complete coding DNA sequence of the respective fungal gene as well as the complete MRNA sequence or the respective sub-areas meant. Because some of the mentioned above Process for the preparation of transgenic plants capable of are to significantly reduce expression of the fungal gene based that specific hybridization between the endogenous mRNA of the fungal gene and the sequences involved in the transcription of mentioned above Arise vectors (such as the antisense strategy), he knows Professional that the transferred nucleic acids not always the whole for the fungal gene encoding sequence, whether it is the Sense or antisense sequence must contain. Much more can for one specific hybridization already has relatively short regions of fungal genes coding sequences sufficient for efficient silencing be.

at Vectors whose transcription leads to double-stranded RNA molecules are sufficient it looks like if the sequences surrounding the sequence areas of the mRNA of a Fungus gene correspond to include the 25 nucleotides. The transferred Sequences usually comprise between 20-5000 nucleotides, preferably between 100-2000 Nucleotides, more preferably around 250-1000 and 400-700 nucleotides. It can but also sequences can be used that are between 25-500 nucleotides, between 25-300 Nucleotides, between 25-150 Nucleotides and between 25-100 Nucleotides include.

Of the Professional knows that in RNAi or PTGS those used for the formation of double-stranded RNA molecules Sense and antisense RNAs may also comprise around 21-23 nucleotides with a characteristic 3 'overhang (Tuschl (2002) Nat. Biotechnol. 20: 446-448).

If in the context of the present invention of sense sequences spoken is meant, then those sequences are meant that the coding Strand of the fungal genes correspond or comprise parts thereof. Such Sequences have to but not 100% identical to the fungal genes of interest. It is sufficient, if the sequences are sufficiently similar to the fungal genes, that their expression in plant cells becomes efficient and specific silencing of the fungal genes in the cell, e.g. B. by RNA interference or co-suppression results. It should be enough when these sequences are at least 50% identical, preferred at least 60%, more preferably at least 70% more preferably at least 80%, more preferably to at least 90% and most preferably at least 95% identical are. With such degrees of identity becomes according to the invention thereof spoken that the sequences are homologous to each other or one Have homology. The deviations from that for fungal genes or parts thereof coding sequence can thereby by deletion, addition, substitution and / or insertion originated. The expert is of course clear that with decreasing identity the probability increases that several fungal genes are gesilenct. Sequences whose identity or degree of homology is so low that the expression endogenous Proteins of the transgenic plant gesilenct are for the inventive method not sufficiently specific and not suitable as it is in the metabolism the plant can intervene.

If is spoken accordingly by antisense sequences, then according to the invention those Sequences meant the non-coding DNA strand of the fungal genes correspond. Of course, these sequences do not have to be one hundred percent identical to the sequence of the non-coding DNA strand of the may be the respective fungal gene, but may have the above-mentioned degrees of homology exhibit. This fact is also expressed in the circumstance antisense sequences, which by definition are complementary to the mRNA of a gene, not 100% complementary need to be to this mRNA. You can z. B. also at least 50% complementary, preferably at least 60% complementary, especially preferably at least 70% complementary, still more preferred at least 80% complementary, especially preferably at least 90% complementary and on most preferably at least 95%, 98% and / or 99% complementary. As stated above, is it sufficient if the antisense sequences are able specifically with the mRNA of the respective fungal gene of interest, but not with the endogenous mRNA of the transgenic plant to hybridize. Hybridization of an antisense sequence with an mRNA sequence of the fungus typically takes place in vivo under cellular conditions or in vitro.

Especially includes the nucleic acid sequence of the fungus whose expression interacts with that in the plant transcribed nucleic acid sequence is inhibited, a sequence having the SEQ ID Nos. 1, 2, 3, 4, 5, 6 or 7 and / or DNA sequences comprising nucleotide sequences, which under stringent conditions with a complementary strand of such a nucleotide sequence hybridize.

At the Most preferred are sequences having SEQ ID NOS: 8, 9, 10 or 11 used to produce RNAi constructs that, if they transcribed in the plant, inhibiting the expression of the fungal gene.

Of the Term "hybridization under stringent conditions " in the context of this invention that hybridization in vitro performed under conditions which is stringent enough to be a specific hybridization to ensure. Stringent in vitro hybridization conditions are known to those skilled in the art known and can from the literature (eg Sambrook and Russell (2001) Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). The term "specific hybridization" refers to the fact that a molecule under stringent conditions preferential to a particular nucleic acid sequence, The target sequence binds when this part of a complex mixture from Z. B. DNA or RNA molecules, but not or at least significantly reduced to other sequences.

Stringent conditions depend on the circumstances. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected so that the hybridization temperature is approximately 5 ° C below the melting point (T _m ) for the specific sequence at a defined ionic strength and pH. The T _m is the temperature (at a defined pH, a defined ionic strength and a defined nucleic acid concentration) at which 50% of the molecules complementary to the target sequence hybridize to the target sequence in the equilibrium state. Typically, stringent conditions are those in which the salt concentration is at least about 0.01 to 1.0 M sodium ion concentration (or other salt concentration) at a pH between 7.0 and 8.3 and the temperature is at least 30 ° C for short molecules (FIG. ie, for example, 10 to 50 nucleotides). In addition, stringent conditions, the addition of substances such. For example, formamide which destabilizes the hybrids. When hybridized under stringent conditions as used herein, nucleotide sequences that are at least 60% homologous to each other usually remain hybridized to each other. Preferably, the stringent conditions are selected such that sequences that are at least about 65%, preferably at least about 70%, and most preferably at least about 75% or greater, homologous to each other usually remain hybridized to each other. A preferred, non-limiting example of stringent hybridization conditions are hybridizations in 6x sodium chloride / sodium citrate (SSC) at about 45 ° C, followed by one or more washes in 0.2x SSC, 0.1% SDS at 50-65 ° C. For example, under standard hybridization conditions, the temperature varies between 42 ° C and 58 ° C in aqueous buffer at a concentration of 0.1 to 5x SSC (pH 7.2), depending on the type of nucleic acid.

If organic solvent, z. B. 50% formamide, is present in the above buffer, the temperature is under standard conditions at about 42 ° C. Preferably, the hybridization conditions for DNA are DNA hybrids for example 0.1 × SSC and 20 ° C up to 45 ° C, preferably 30 ° C up to 45 ° C. Preferably, the hybridization conditions for DNA are RNA hybrids for example, 0.1 × SSC and 30 ° C up to 55 ° C, preferably between 45 ° C up to 55 ° C. The above-mentioned hybridization temperatures are, for example for one nucleic acid with about 100 base pairs in length and a G / C content of 50% in the absence of formamide. The expert knows such as the required hybridization conditions from textbooks, such as the aforementioned or the following textbooks Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989) Hames and Higgins (Eds.) 1985, Nucleic Acids Hybridization: A Practical Approach, IRL Press at Oxford University Press, Oxford; Brown (ed.) 1991, Essential Molecular Biology: A Practical Approach, IRL Press at Oxford University Press, Oxford.

Typical hybridization and washing buffers have z. For example, the following composition: prehybridization solution: 0.5% SDS 5 x SSC 50 mM NaPO ₄ , pH 6.8 0.1% Na pyrophosphate 5 x Denhardt's solution 100 μg / ml salmon sperm DNA Hybridization solution: Prähybridisierungslsg. 1 × 10 ⁶ cpm / ml probe (5-10 min 95 ° C) 20 × SSC: 3 M NaCl 0.3 M sodium citrate ad pH 7 with HCl 50 × Denhardt's reagent: 5 g Ficoll 5 g polyvinylpyrrolidone 5 g bovine serum albumin ad 500 ml A. dist.

A typical procedure for the hybridization looks like this:

optional: blot 30 min in 1 × SSC / 0.1% SDS at 65 ° C to wash prehybridization: at least 2 h at 50-55 ° C

hybridization: over night at 55-60 ° C To wash: 05 min 2 × SSC / 0.1% SDSHybridisierungstemp. 30 min 2 × SSC / 0.1% SDS hybridization temp. 30 min 1 × SSC / 0.1% SDS hybridization temp. 45 min. 0.2 x SSC / 0.1% SDS 65 ° C 5 min 0.1 × SSC room temperature

Of the Professional knows that the solutions mentioned and the protocol shown may be modified depending on the application can or have to.

The Nucleic acid molecules used in the method can be prepared using molecular biological Standard techniques and the sequence information provided here be isolated. Also can with the help of comparison algorithms, as z. On the NCBI homepage can be found at http://www.ncbi.nlm.nih.gov, for example a homologous sequence or homologous, conserved sequence regions at the DNA or amino acid level be identified. Essential parts of this sequence or the entire homologous sequence can as a hybridization probe using standard hybridization techniques (as described, for example, in Sambrook et al., vide supra) for isolation more useful in the process nucleic acid sequences from other organisms by the screening of cDNA and / or genomic Banks are used. moreover let yourself a nucleic acid molecule Isolate polymerase chain reaction, wherein oligonucleotide primer on the base of sequences or parts of databases thereof (eg, a nucleic acid molecule comprising the complete sequence or a part thereof, by polymerase chain reaction using isolated from oligonucleotide primers based on this same sequence have been created). For example, can be isolate mRNA from cells (eg, by the guanidinium thiocyanate extraction method by Chirgwin et al. (1979) Biochemistry 18: 5294-5299) and from it by means of reverse Transcriptase (eg, Moloney MLV Reverse Transcriptase, available from Gibco / BRL, Bethesda, MD or AMV Reverse Transcriptase, available from Seikagaku America, Inc., St. Petersburg, FL). A nucleic acid can using cDNA or alternatively genomic DNA as Template and appropriate oligonucleotide primers using standard PCR amplification techniques be amplified. The nucleic acid amplified in this way can be cloned into a suitable vector and characterized by DNA sequence analysis become. Oligonucleotides that are used to amplify the desired Sequence are suitable by standard synthesis methods, for example with an automatic DNA synthesizer, getting produced.

In one embodiment, multiple recombinant nucleic acid molecules each comprising a nucleic acid sequence that is homologous and / or complementary to a nucleic acid sequence of a fungus and transcribed in the plant such that upon infection of the plant with this fungus, the nucleic acid sequence transcribed in the plant is homologous and / or complementary nucleic acid sequence of the fungus or parts thereof, so that the expression of the nucleic acid sequence of the fungus in essence is prevented, introduced into the plant. As a result, the expression of several fungal genes can be inhibited simultaneously in the plant and the transgenic plant is given increased resistance to various fungal pathogens.

The Vectors used for silencing of fungal genes include next to the transfer nucleic acid sequence further regulatory elements. Which specific regulatory Elements must contain these vectors, in each case depends on the method which is to be performed with these vectors. About which regulatory elements and also other elements of these vectors need to have those skilled in the art using the various methods of manufacturing mentioned above of transgenic plants, in which the expression of a protein is prevented, familiar, known.

typically, these are the regulatory elements that make up the vectors to include those that facilitate transcription and, if desired, translation in the plant cell.

So can the ones to be transferred nucleic acid sequences for example, under the control of functional in plant cells Promoters stand. These promoters may be constitutive, but also inducible or tissue- or development-specific Promoters act.

typically, one becomes as a promoter for Vectors use the constitutive 35S promoter. Furthermore can Naturally Also other promoters are used, which are different Sources such as B. from plants or plant viruses and for the expression of genes in plants are suitable. The selection of the promoter as well as other regulatory sequences while the spatial and temporal expression patterns and thus the silencing of Fungal genes in transgenic plants.

Next other constitutive promoters such as the actin promoter (McElroy et al. (1990) Plant Cell 2: 163-171) and the ubiquitin promoter (Binet et al. (1991) Plant Science 79: 87-94) are tissue-specific Promote the phosphoenolpyruvate carboxylase promoters Maize (Hudspeth et al. (1989) Plant Mol. Biol. 12: 579) or fructose 1,6-bisphosphatase from potato (WO 98/18940), which mediate leaf-specific expression, in question. It can also wounding, light or pathogen-induced and other development-dependent promoters or control sequences are used (Xu et al. (1993) Plant Mol. Biol. 22: 573-588; Logemann et al. (1989) Plant Cell 1: 151-158; Stockhaus et al. (1989) Plant Cell 1: 805-813; Puente et al. (1996) EMBO J. 15: 3732-3734; Gough et al. (1995) Mol. Gen. Genet. 247: 323-337). A summary of useful control sequences can be found z. In Zuo et al. (2000) Curr. Opin. Biotech. 11: 146-151.

suitable Promoters also include promoters that express only guarantee in photosynthetic tissues such. B. the ST-LS1 promoter (Stockhaus et al., (1987) Proc Natl Acad Sci., USA 84: 7943-7947; et al. (1989) EMBO J. 8: 2445-2451). Also can be used Promoters during plant transformation, plant regeneration or certain Stages of these processes are active, such. B. cell division specific Promoters such as the histone H3 promoter (Kapros et al. (1993) In Vitro Cell Dev. Biol. Plant 29: 27-32) or the chemically inducible Tet repressor system (Gatz et al. (1991) Mol. Gen. Genet. 227: 229-237). Other suitable promoters may be the literature, z. Ward (1993, Plant Mol. Biol. 22: 361-366) become. The same applies to inducible and cell or tissue specific promoters such as meristem specific Promoters which have also been described in the literature and are also suitable within the scope of the invention.

Further Inducible promoters include fungal inducible promoters such as the GAFP-2 promoter (Sa et al. (2003) Plant Cell Rep. 22: 79-84), the z. B. induced by the fungus Trichoderma viride, or the PAL promoter, which is induced by inoculation with Pyricularia oryzae (Wang et al. (2004) Plant Cell Rep. 22: 513-518).

In addition, one of ordinary skill in the art will be able to isolate other suitable promoters by routine methods. Thus, the skilled person with the help of common molecular biology methods, eg. For example, hybridization experiments or DNA-protein binding studies can identify storage organ-specific regulatory nucleic acid elements. This z. For example, in a first step, from storage organ tissues of the desired organism from which the regulatory sequences are to be isolated, isolate all poly (A) ⁺ RNA and construct a cDNA library. In a second step, by means of cDNA clones based on poly (A) ⁺ RNA molecules from a non-storage organ tissue, from the first bank by hybridization those clones are identified whose corresponding poly (A) ⁺ RNA Only accumulate molecules in the tissue of the storage organ. Subsequently, with the help of these so identified cDNAs Pro isolated engines that have storage organ-specific regulatory elements. The skilled person is also available further PCR-based methods for the isolation of suitable storage organ specific promoters available.

In a further embodiment it is the promoter of the class I patatin gene B33 from potato. Further preferred promoters are those which are particularly useful in fruits are active. Which includes for example, the promoter of a polygalacturonase gene, e.g. From tomato, while the maturity of tomato fruits Expression (Nicholass et al. (1995) Plant Mol. Biol. 28: 423-435), the promoter of an ACC oxidase, e.g. From apple, transgenic Tomato maturity and fruit specificity (Atkinson et al. (1998) Plant Mol. Biol. 38: 449-460), or the 2A11 promoter from tomato (van Haaren et al. (1991) Plant Mol. Biol. 17: 615-630).

Also in the case of fruit-specific promoters the skilled person may further take appropriate promoters from the literature or, as above for storage organ-specific Promoters described isolate by routine methods.

Of the Professional knows that the use of inducible promoters is the production of plants and plant cells allowing the sequences of the invention only transiently express and thus transient silencers. Such Transient expression allows the production of plants that only a transient increase Show fungal resistance. Such a transiently increased resistance may e.g. B. then be desirable if there is a risk of fungal contamination and the plants therefore only for have to be resistant to the fungus for a certain period of time. Further Situations in which a transient resistance is desirable is known in the art. The skilled person is beyond Also known to be unstable in plant cells by use replicating vectors containing the corresponding sequences for silencing of fungal genes, a transient epitaxy and thus a transient one Silencing and transient resistance can be achieved.

The vectors of the invention can as regulatory elements also z. B. include enhancer elements, furthermore They resistance genes, replication signals and other DNA areas containing a propagation of the vectors in bacteria such. B. E. coli. The regulatory elements also include sequences that stabilize effect the vectors in the host cells. In particular, include such regulatory elements sequences that provide stable integration of the vector into the host genome of the plant or an autonomous replication of the vector in the plant cells. Such regulatory Elements are known to the person skilled in the art.

at the so-called termination sequences are sequences, ensuring that the transcription or translation ends properly becomes. Should the transferred Nucleic acids are translated typically, they are stop codons and corresponding regulatory sequences; should the transferred nucleic acids only transcribed, are usually poly-A sequences.

According to the invention are with Vectors plasmids, cosmids, viruses and other vectors commonly used in genetic engineering meant by which nucleic acid molecules on plants or transferred to plant cells can be.

to Preparation of the introduction foreign genes in higher Plants or their cells are a large number of cloning vectors to disposal, which is a replication signal for E. coli and a marker gene for selection of transformed bacterial cells contain. Examples for such vectors are pBR322, pUC series, M13mp series, pACYC184 etc. The desired Sequence may be at a convenient restriction site in the Vector introduced become. The resulting plasmid is used for the transformation of E. coli cells used. Transformed E. coli cells are in a bred suitable medium and subsequently harvested and lysed. The plasmid is recovered. As an analysis method to characterize the recovered plasmid DNA are generally Restriction analyzes, gel electrophoresis and other biochemical-molecular biological Methods used. After each manipulation, the plasmid DNA split and recovered DNA fragments can linked to other DNA sequences become. Each plasmid DNA sequence can be cloned into the same or other plasmids. standard procedures for cloning Sambrook et al., 2001 (Molecular cloning: A laboratory manual, 3rd edition, Cold Spring Harbor Laboratory Press).

For the introduction of DNA into a plant host cell, a variety of known techniques for The skilled person can determine the appropriate method without difficulty. These techniques include transformation of plant cells with T-DNA using Agrobacterium tumefaciens or Agrobacterium rhizogenes as transformants, fusion of protoplasts, direct gene transfer of isolated DNA into protoplasts, electroporation of DNA, introduction of DNA by the biolistic method, and others Options. Both stable and transient transformants can be generated.

at injection and electroporation of DNA into plant cells per se no special requirements for the plasmids used posed. something similar applies to the direct gene transfer. It can simple plasmids such as pUC derivatives can be used. But should regenerate whole plants from such transformed cells be the presence of a selectable marker gene is necessary. the Specialists are the common ones Selection marker known and it is not a problem for him, a to select suitable markers. common Secondary markers are those that affect the transformed plant cells Resistance to a biocide or an antibiotic such as kanamycin, G418, bleomycin, Hygromycin, methotrexate, glyphosate, streptomycin, sulfonyl urea, Gentamycin or phosphinotricin and the like.

ever after introduction method desired Genes in the plant cell can additional DNA sequences to be required. For example, for the transformation of the plant cell the Ti or Ri plasmid used, at least the right Limit, often however, the right and left boundaries of the Ti and Ri plasmids contained T-DNA as flank area with the introduced Genes are linked.

Become for the Transformations used by Agrobacteria must be the DNA to be introduced be cloned into specific plasmids, either in one intermediate or in a binary Vector. The intermediary Vectors can due to sequences homologous to sequences in the T-DNA, by homologous recombination into the Ti or Ri plasmid of the agrobacteria to get integrated. This contains Furthermore the for the transfer of T-DNA necessary vir region. intermediaries Vectors can do not replicate in agrobacteria. By means of a helper plasmid can the intermediary Vector can be transferred to Agrobacterium tumefaciens (conjugation). binary Vectors can replicate in both E. coli and Agrobacteria. They contain a selection marker gene and a linker or polylinker which be framed by the right and left T-DNA border regions. You can be transformed directly into the agrobacteria (Holsters et al. (1978) Molecular and General Genetics 163: 181-187). The serving as a host cell Agrobacterium is said to contain a plasmid carrying a vir region. The vir region is for the transfer of T-DNA into the plant cell necessary. In addition, can T-DNA be present. The thus transformed Agrobacterium is used to transform plant cells.

The use of T-DNA for the transformation of plant cell is intensively studied and sufficient in EP 120 515 been described.

For the transfer the DNA into the plant cell Plant explants expediently cultured with Agrobacterium tumefaciens or Agrobacterium rhizogenes become. From the infected plant material (for example leaf pieces, stem segments, Roots, but also protoplasts or suspension-cultured plant cells) can then in a suitable medium containing antibiotics or biocides for selection of transformed cells may contain, whole again Plants are regenerated. The regeneration of the plants takes place according to usual Regeneration methods using known nutrient media. The plants or plant cells thus obtained can then be tested for the presence of introduced DNA are examined.

Other options the introduction foreign DNA using the biolistic method or by Protoplast transformation are known to the person skilled in the art (cf L. Willmitzer (1993) Transgenic Plants in: Biotechnology, A Multi-Volume Comprehensive Treatise (Editor: H.J. Rehm et al.), Vol. 2, 627-659, VCH Weinheim, Germany).

While the Transformation of dicotyledonous plants or cells via Ti plasmid vector systems with the help of of Agrobacterium tumefaciens has long been well established is, can now also monocotyledonous plants or their cells by means of on Agrobacterium-based vectors are transformed (see et al Chan et al. (1993) Plant Mol. Biol. 22: 491-506).

Alternative systems for the transformation of monocotyledonous plants or their cells are the transformation by means of the biolistic approach (Wan and Lemaux (1994) Plant Physiol 104: 37-48, Vasil et al. (1993) Bio / Technology 11: 1553-1558; Ritala et al. (1994) Plant Mol. Biol. 24: 317-325; Spencer et al. (1990) Theor. Appl. Genet. 79: 625-631), protoplast transformation, electroporation of partially permeabilized cells, and introduction of DNA via glass fibers.

The transformed cells grow within the plant in the usual way See also McCormick et al. (1986) Plant Cell Reports 5: 81-84). The resulting plants can be attracted to normal and with plants that transformed the same Own or inherited genetic material, to be crossed. The resulting hybrid individuals have the corresponding phenotypic Properties.

It should be tightened two or more generations to make sure that the phenotypic Characteristic stable maintained and inherited. Also should be seeds be harvested to ensure that the corresponding phenotype or other peculiarities have been preserved.

As well can according to usual Methods transgenic lines are determined, which are homozygous for the new nucleic acid molecules are and you are phenotypical Behavior regarding an existing or non-existent one Pathogen-responsiveness examined and compared with that of hemizygous lines.

Of course, plant cells, containing the nucleic acid molecules of the invention, also as plant cells (including protoplasts, calli, Suspension cultures and the like).

The can be shown above vectors be transferred to plant cells in different ways. Whether the vectors in linear or circular Have to be in shape depends on the respective application. The person skilled in the art knows whether and when he may or may not use corresponding linearized vectors.

According to the invention the term transgenic plant both the plant in its entirety, as well as all plant parts in which the homologous to fungal genes and / or complementary nucleic acid sequences be transcribed. Such plant parts may be Plant cells act to turn plant seeds, around leaves, around flowers, and around pollen. With "transgenic plant" according to the invention is also the Propagating material of transgenic plants according to the invention meant such as B. seeds, fruits, Cuttings, tubers, root pieces etc., wherein this propagation material optionally transgenic described above Contains plant cells, as well as transgenic parts of these plants such as protoplasts, plant cells and calli.

at The production of transgenic plants offers various Methods and possibilities, as already stated above has been. Generally speaking Plants or plant cells using conventional genetic engineering Transformation methods are modified so that the new Nucleic acid molecules in the integrated plant genome, i. that stable transformants be generated and the transferred nucleic acid molecules with the replicated to the plant genome. Depending on the vector system used can according to the invention also transgenic Plants are prepared in which the nucleic acids to be transferred in the plant cell or the plant as a self-replicating system are. The transfer The vectors used in the plants must then be matched via DNA sequences feature, the replication of for transmission allow used plasmids within the cell.

Under a transgenic plant or plant cell according to the invention is as stated above to understand that the plant contains nucleic acid sequences that naturally not occur in the plant, but homologous and / or complementary to parts of the fungal genome. These nucleic acid sequences are not in able to interact with endogenous plant sequences and their Influence expression.

Examples for monocots Plants are plants that belong to the genera Avena (oats), Triticum (Wheat), Secale (rye), Hordeum (barley), Oryza (rice), Panicum, Pennisetum, setaria, sorghum (millet), zea (corn) and the like belong.

Dicotyledonous crops include, among others, cotton, legumes such as legumes, and especially alfalfa, soybean, rapeseed. Canola, tomato, sugar beet, potato, sunflower, ornamental plants and trees. Other crops may include fruits (especially apples, pears, cherries, grapes, citrus, pineapple and bananas), oil palms, tea, cocoa and coffee bushes, tobacco, sisal and medicinal herbs Rauwolfia and Digitalis. The cereals are particularly preferably wheat, rye, oats, barley, rice, Corn and millet, as well as the dicotyledonous plants sugar beet, rapeseed, soy, tomato, potato and tobacco. Other crops can be found in US Pat. No. 6,137,030.

preferred Plants are Tagetes, Sunflower, Arabidopsis, Tobacco, Red Pepper, Soy, tomato, eggplant, pepper, carrot, potato, corn, salads and cabbages, cereals, alfalfa, oats, barley, rye, wheat, Triticale, millet, rice, alfalfa, flax, cotton, hemp, Brassicacaeen such as rapeseed or canola, sugar beet, sugar cane, nut and wine species or woody plants such as aspen or yew.

One Another object of the invention relates to the use of the transgenic plants according to the invention and the cells, cell cultures, parts and transgenic derived from them Propagating materials for the production of food and feed, Pharmaceuticals or fine chemicals.

• (a) Identifizieren geeigneter Zielgene,
• (b) Herstellen von RNAi-Konstrukten für diese Zielgene in einem geeigneten Vektor,
• (c) Transformieren der RNAi-Konstrukte in geeignete Testpflanzen,
• (d) Inokulieren der Testpflanzen mit einem geeigneten Pilz und
• (e) Auswerten des Pilzbefalls der Pflanze mit einem geeigneten Auswerteverfahren.

Likewise provided by the present invention is a method for identifying fungal genes in which the inhibition of their expression in transgenic plants mediates fungal resistance, comprising the steps:

• (a) identifying suitable target genes,
• (b) preparing RNAi constructs for these target genes in a suitable vector,
• (c) transforming the RNAi constructs into suitable test plants,
• (d) inoculating the test plants with a suitable fungus and
• (e) evaluating fungal infestation of the plant with a suitable evaluation method.

The With such a procedure identify fungal genes can for one is to form recombinant nucleic acid molecules which are homologous and / or complementary nucleic acid sequences which can be expressed and expressed in a transgenic plant as described above to increase the Fungal resistance in the transgenic plant. The with the above However, process-identified fungal genes can also serve as new targets for fungicides serve. Furthermore Such identified fungal genes are also suitable for development RNA-based drugs against human fungal diseases, such as z. B. cutaneous mycoses or mucosal mycoses.

Under "target genes" are under the present invention, such fungi genes understood in which There is a chance that their inhibition may be fungal resistance to lead can. The identification of such target genes can, inter alia, by Genome analysis of the respective fungal genome done. Preferably takes place the identification of suitable target genes by the study of differential expression in plant tissues such as the epidermis, infected with the fungus or left uninfected. Also should be safe by a suitable sequence comparison be put that a suitable target gene or a homologous to it Sequence not endogenous in the plant to be used, since otherwise also endogenous processes taking place in the plant could be inhibited something undesirable is. By a sequence comparison with the genome of other species of fungi than that used in the experiment to identify the target genes Mushroom leaves Find out if the inhibition of the expression of the identified Target gene increased Resistance to mediate only one type of mushroom or a whole range of mushroom species becomes.

In an "RNAi construct", the target genes identified in step (a) of the method are present in a recombinant nucleic acid molecule comprising in the 5'-3 'direction the following elements: a promoter operable in plants; operably linked thereto, a DNA sequence comprising the antisense sequence of the sequence encoding the target gene or portions thereof; an intron comprising a splice donor and a splice acceptor sequence; a DNA sequence comprising the sense sequence, the DNA sequence encoding the particular target gene or portions thereof; and a termination sequence. To form a variety of such RNAi constructs in as few steps as possible, the target genes are preferably not by cloning, but by homologous recombination, such as with the GATEWAY ^® system (Invitrogen) or the BD Creator ^™ system (BD Biosciences Clontech Co .) is introduced into the vector. Of course, the conventional cloning methods such as restriction digestion and subsequent ligation for the production of RNAi constructs, but which are much more time-consuming than homologous recombination.

The transformation of the test plants with the RNA library can be carried out by any known transformation method, e.g. B. are the biolistic method, the Agrobacterium -mediated transformation, the protoplast transformation, the electroporation of partially permeabilized cells and the introduction of DNA by means of glass fibers. The most suitable method for transformation depends on the test plant used. The test plants are preferred by the biolistic transformation transformed, because this approach leads particularly quickly and effectively to a transformation with a variety of different recombinant nucleic acid molecules.

The Selection of suitable test plants depends on the fungus to be tested from. The test plants used must be susceptible to this fungus used, as a host plant for can serve this mushroom, and the fungal infection must be proven by simple methods. The test plants are preferably wheat or barley plants, the z. B. be inoculated with the mildew fungus Blumeria graminis. By "inoculating" this is meant Contacting the plant with the fungus that infects the plant should be, or the infectious Divide it under conditions in which the fungus invades a wild-type plant can.

Of the Fungal attack of the plant leaves afterwards evaluate with a suitable evaluation method. This is suitable especially the visual evaluation, in which the trained fungal structures detected in the plant and quantified. To be successful To identify transformed cells is preferred together with the RNAi construct a reporter gene such as e.g. the β-glucuronidase (GUS) gene from E. coli, a fluorescent gene such as the Green Fluorescence protein (GFP) gene from Aequoria victoria, the luciferase gene from Photinus pyralis or the β-galactosidase (lacZ) gene from E. coli, whose expression in the plant cells by simple Method can be detected, cotransformed in a suitable vector. optional can the formed fungal structures for better determination by methods, which are known in the art to be stained, z. By Coomassie or trypan blue staining.

The fungal genes identified by the method described above can used to transgenic plants with increased fungal resistance by producing a recombinant nucleic acid molecule comprising a nucleic acid sequence, to a nucleic acid sequence a fungus is homologous and / or complementary and that in the plant is transcribed so that when infected the plant with this Fungus transcribed in the plant nucleic acid sequence with the homologous and / or complementary nucleic acid sequence of the fungus or parts thereof interacts in such a way that expression the nucleic acid sequence The fungus is essentially prevented from being introduced into the plant becomes.

The exemplary identification of fungal genes arising in the process of the present invention, and their use for increasing the Fungal resistance in transgenic plants will now be presented below. The following examples should not be construed as limiting become. The content of all cited in this patent application, patent applications, Patents and published patent applications is incorporated herein by reference.

Example 1: Preparation of RNAi constructs

In cDNA array analyzes with barley-leafed pernicious-mouse cDNA using the mildew fungus Blumeria graminis inoculated for certain periods of time was or was not inoculated (control) were differentially expressed genes (Zierold et al. (2005) Mol. Plant Pathol .: in press). 13 EST clones that were differentially expressed and high sequence homology to fungal genes selected and with these RNAi constructs produced. These were EST clones with the vector primer MVR-26 (5 'CTCACTAAAGGGAACAAAAGCTGGAG 3 ') as "forward primer "and primers, specific for the respective EST clone; or for HO15I23 the universal Primer M13-21 PE, as "reverse primer "amplified, around fragments with a length of about 500 base pairs.

The EST-specific primers had the following sequences:
HO16G03 5 'CTGGGAATTTTTCGGCTTTG 3'
HO0SG22 5 'TATCCTCGCAAATCTTGGCA 3'
HO03O15 5 'CCGAGTTCATCACAAAACCG 3'
HO13O22 5 'CAGGTGGACGACGTAGGAGA 3'
HO14D22 5 'CGCTGGGTCATCTTGACTGT 3'
HO08J20 5 'CATGATCAAGGGTGGGTGAC 3'
HO08B23 5 'GCTGAATTACCATTGCGGTG 3'
HO09I03 5 'TGACCCAGCCTAGACCAGTG 3'
HO15123 5 'ACGACGTTGTAAAACGACGGCCAG 3'
HO06F11 5 'AAGAACATTCAAGCCGGGAG 3'
HO14N21 5 'CTCGAATTTGCCGAGAAGGT 3'
HO15J13 5 'CGAATCGCCACACCAAGAAT 3'
HO11N21 5 'CCGCAAATGCGTCTATTGTC 3'

The following approach was used to amplify the DNA of the EST clones:

The PCR conditions used were as follows:

The Sequences generated by amplification of the EST clones HO15I23, HO14N21, HO15J13 and HO11N21 PCR products are shown in SEQ ID NO. 8, 9, 10 and 11 are shown.

Subsequently, the PCR products were purified by replenishing each PCR reaction with 30 μl H ₂ O and then purifying it with the Qiagen Minelut UF96-well kit. The PCR products were then eluted with 20 μl H ₂ O. These purified PCR products were then cloned into the pIPKTA38 vector, which contains a multiple cloning site between two recombinase recognition sequences and is a derivative of Invitrogen's pENTRY vector. For this purpose, the following ligation mixture was first prepared:

From this ligation mixture, 6 μl was added to each well of a 96 well PCR plate and 4 μl of purified PCR product. This mixture was incubated at 25 ° C for one hour before the reaction was stopped by passing the mixture for 10 min. was heated to 65 ° C. Subsequently, 5 μl of the SwaI mixture (see below) was added to each well to resect the religated vector molecules.

This approach was incubated for one hour at 25 ° C before competent E. coli cells were transformed in 96-well plates with the ligation products. The transformation and subsequent minipreparation of the DNA was done according to standard protocols in the 96-well plate format. Subsequently, the PCR products present in the vector pIPKTA38 vector were introduced by homologous recombination into the RNAi vector pIPKTA30 to produce the RNAi constructs. The following reaction mixture was used for this:

This reaction was incubated at room temperature overnight or for at least 6 hours. Subsequently, the pIPKTA30 plasmids thus obtained were again transformed into E. coli cells according to standard protocols, before the correctness of the cloning was confirmed by the preparation of the plasmid DNA and a control digestion. A flow chart showing the steps described above for the preparation of the RNAi constructs is in 1 shown.

Example 2: Transformation the plants

The barley cells in which the effect of the RNAi constructs prepared in Example 1 were to be tested for fungal resistance were transformed by means of the biolistic method with one RNAi construct each. First, 50 mg of Biorad gold particles were mixed with 1 ml of sterile H ₂ O, vortexed and for 30 sec. treated with ultrasound. Thereafter, these particles were spun down and washed again with 1 ml of sterile H ₂ O, vortexed and sonicated for 30 seconds. This step was then repeated with 100% ethanol before the gold particles were dried in the incubator and sterile in 1 ml of 50% glycerol and diluted to a concentration of 25 mg / ml with 50% glycerol.

The coating of the gold particles thus prepared was carried out with 7 μg of the reporter gene (pUbiGUS, Schweizer et al., (1999) Plant J. 20: 541-552) and 7 μg of the empty control vector pIKTA30 or the vector containing the RNAi construct, the with 87.5 μl of gold particles (25 mg / ml in 50% glycerol). Subsequently, 87.5 μl of 1 M Ca (NO ₃ ) ₂ pH 10 were added dropwise while vortexing. The particle suspension was for 10 min. allowed to stand at room temperature before being briefly centrifuged. The supernatant was removed with a pipette and discarded and the pellet washed with 1 ml of 100% ethanol before adding 30 μl of ethanol and resuspending the pellet therein.

The coating suspension consisting of the DNA and the gold particle was for 10 sec. treated with ultrasound, before each 3 ul of this suspension applied to each Makrocarrier and for 2-5 Mi were allowed to dry. The transformation was carried out with a helium pressure of 1100 psi and a vacuum of 27.5 mm Hg. For this purpose, the primary leaves of barley were cut and with the adaxial side up on Phytoagar Petri dishes (0.5 to 1% agarose and 50 ul benzimidazole ( 40 mg / ml in ethanol)), where they were bombarded. The bombarded leaves were incubated for 4 hours in lightly opened Petri dishes and then stored until inoculation with the fungus at 20 ° C on a north window. Three days after bombardment, the leaves were transferred to large Petri dishes containing 1% Phytoagar with 20 ppm benzimidazole. The leaves were inoculated with mildew (Blumeria graminis hordei) (density about 200 conidia / mm ² ). For inoculation, the freshest possible conidia were used, ie either from older plants shaken 24 to 48 hours before inoculation or from fresh plants inoculated 7 days before. Until GUS staining, the leaves were stored at 20 ° C and daylight (no direct sunlight).

Example 3: Evaluation the fungal attack

to staining The transformed cells were first subjected to GUS staining. To were the leaves About 40 hours after inoculation with the fungus, it was transferred into 10 ml of GUS staining solution and mixed with it. The tubes were then placed in a suction bottle for vacuum infiltration and applied 2 to 3 times vacuum. The infiltration was complete, though the leaves become transparent and sink. The tubes were then filled with 14 ml the staining solution filled up, good closed and over Incubated at 37 ° C overnight.

GUS staining solution

• 100 mM Na phosphate buffer, final pH 7.0
• 10 mM Na-EDTA
• 1.4 mM K-hexacyanoferrate (II)
• 1.4 mM K-hexacyanoferrate (III)
• 0.1% Triton X-100
• 20% methanol
• 1 mg / ml X-Gluc.

to staining If necessary, a Coomassie staining can be carried out on the fungal structures. For this, the GUS staining solution is after the overnight incubation carefully poured off and the tubes with 8 ml Coomassie solution filled. The leaves be for 5 min. incubate with the staining solution at room temperature before decanting the staining solution and rinse the samples twice with distilled water.

Coomassie solution

For 500 ml:

• • 1.5 Dissolve the Coomassie R 250 (0.3%) in 250 ml of methanol
• • Pre-dissolve 37.5 g of trichloroacetic acid (7.5%) in H ₂ O.
• • Mix both solutions and make up to the final volume of 500 ml with H ₂ O.
• • Coomassie staining solution Paper filter in blue caps FL. filter

If no Coomassie staining carried out becomes, the leaves become after GUS staining for 5 min. bathed in decolorizing solution (7.5% TCA, 50% methanol) and then with distilled water rinsed.

The leaves were carefully removed from the tube after GUS and possibly Coomassie staining and placed adaxial side up on the slide. 200 μl of distilled water were added per slide and the cover slip was carefully placed. Subsequently, the fungal infestation of the plant was evaluated microscopically (cf. 3 ).

To quantify the fungal infestation, the petorial index (HI) of the GUS-positive, ie transformed, cells was calculated according to the following formula: HI = number of haustoria / number of GUS-stained cells × 100 Relative HI (%) = HI test gene / HI control × 100

The relative HI of the barley cells transformed with the 13 RNAi constructs tested is in 4 shown.

Interestingly, show the two cDNA fragments HO11N21 and HO15J13, their RNAi constructs the susceptibility to host from barley opposite Significantly reduce Blumeria graminis, highly significant homologies at the protein level to fungal β-1,3-glucanosyltranferases but are little homologous to each other at the DNA level, so that a cross-silencing of the glucanosyltransferase genes can be excluded by one RNAi construct.

description of the pictures

1 : Preparation of RNAi constructs (flow chart) I, PCR Amplification of cDNA fragments of fungal genes of interest; IIa, ligation of the PCR fragments into the intermediate vector pIPKTA38 in the presence of the restriction endonuclease SwaI, which prevents the religation of the vector; IIb, trimming of all religated vector molecules; III, Recombination of the cloned cDNA fragments in the RNAi vector pIPKTA30 by means of LR clonase.

2 : Testing of RNAi Constructs in Transgenic Plants (Flowchart)

3 : Microscopic evaluation of fungal infestation of barley cells transformed with an empty RNAi vector (a) or the RNAi construct pIKTA30_HO11N21 (b) and inoculated with Blumeria graminis. In (a) the fungus may form a haustorium and grow on the leaf surface with secondary, elongated hyphae, while in (b) the colonization of the barley cell is already stopped during the penetration stage by the RNAi construct.

4 : Effects of RNAi constructs on the susceptibility of barley to mildew (Blumeria graminis). Mean values from 3-5 independent experiments ± SD are shown. Red columns indicate statistically significant resistance effects with p <0.05. The barley cells transformed with the RNAi constructs pIKTA30-HO15I23, pIKTA30-HO11N21, pIKTA30-HO14N21 and pIKTA30-HO15J13 show a statistically significantly reduced susceptibility to Blumeria graminis.

It follows a sequence listing according to WIPO St. 25. This can from the official publication platform downloaded from the DPMA.

Claims (35)

A method for increasing fungal resistance in transgenic plants, characterized in that a recombinant nucleic acid molecule comprising a nucleic acid sequence which is homologous and / or complementary to a nucleic acid sequence of a fungus and which is transcribed in the plant so that upon infection of the plant with this fungus in the plant transcribed nucleic acid sequence interacts with the homologous and / or complementary nucleic acid sequence of the fungus or parts thereof such that the expression of the nucleic acid sequence of the fungus is substantially prevented, is introduced into the plant. The method of claim 1, wherein in the plant expressed nucleic acid sequence at least 50%, preferably at least 60%, also preferred at least 70%, more preferably at least 80%, in particular preferably at 90, 92 or 94% and most preferably at least 96, 98 or 99% homologous to a nucleic acid sequence of the fungus or Sharing is. The method of claim 1, wherein in the plant expressed nucleic acid sequence at least 50%, preferably at least 60%, also preferred at least 70%, more preferably at least 80%, in particular preferably at 90, 92 or 94% and most preferably at least 96, 98 or 99% complementary to a nucleic acid sequence of the mushroom or parts thereof. Method according to one of claims 1 to 3, wherein the nucleic acid sequence, the homologous and / or complementary to the nucleic acid sequence of the fungus is 20 to 5000 nucleotides, preferably 100 to 2000 nucleotides, more preferably 250 to 1000 nucleotides and most preferred Comprising 400 to 700 nucleotides. Method according to one of claims 1 to 4, wherein the recombinant Nucleic acid molecule includes: (A) one functional in plants promoter (b) operatively linked to the identical or homologous Antisense sequence of for the fungal gene coding sequence or parts thereof, (c) an intron comprising splice donor and splice acceptor sequences, (D) the identical or homologous sense sequence of the for the fungal gene coding sequence or parts thereof, and (e) a termination sequence. Method according to one of claims 1 to 4, wherein the recombinant Nucleic acid molecule includes: (A) one functional in plants promoter (b) operatively linked to the homologous antisense sequence the for the fungal gene encoding sequence, and (c) a termination sequence. Method according to one of claims 1 to 4, wherein the recombinant Nucleic acid molecule includes: (A) one functional in plants promoter (b) operatively linked to the identical or homologous Antisense sequence of for the fungal gene encoding sequence, wherein the sequence is over self-complementary regions features, and (c) a termination sequence. Method according to one of claims 1 to 4, wherein the recombinant Nucleic acid molecule includes: (A) one functional in plants promoter (b) operably linked to a DNA sequence, the to the for the mRNA of the fungal gene or parts thereof coding sequence is complementary, (C) a DNA sequence for Ribonuclease P coded, and (d) a termination sequence. Method according to one of claims 5 to 8, wherein the promoter is a constitutive promoter. Method according to one of claims 5 to 8, wherein the promoter is an inducible promoter. Method according to one of claims 5 to 8, wherein the promoter is a tissue-specific promoter. Method according to one of the preceding claims, wherein the nucleic acid sequence selected from the mushroom is made up of the group (i) comprising DNA sequences Nucleotide sequences comprising SEQ ID Nos. 1, 2, 3, 4, 5, 6 or 7 or Fragments thereof include, and / or (ii) comprising DNA sequences Nucleotide sequences that under stringent conditions with a complementary Strand of a nucleotide sequence of (i) hybridize. Method according to one of the preceding claims, wherein more than one recombinant nucleic acid molecule as in the preceding claims described is introduced into the plant. Method according to one of the preceding claims, wherein the transgenic plants have increased resistance show against mildew. The method of claim 14, wherein the Mildew is around Blumeria graminis. Method according to one of the preceding claims, wherein the transgenic plants are dicotyledonous plants. Method according to one of claims 1 to 15, wherein it is in the transgenic plants are monocotyledonous plants. The method of claim 17, wherein the Plants around cereal plants, in particular wheat or barley is. Transgenic plant cell with increased fungal resistance, produced according to a method according to one of claims 1 to 18. Transgenic plant cell containing a recombinant Nucleic acid molecule comprising a nucleic acid sequence, to a nucleic acid sequence of a fungus is homologous and / or complementary. Transgenic plant cell according to claim 19 or 20, wherein the to the nucleic acid sequence a fungus homologous nucleic acid sequence in the plant at least 50%, preferably at least 60%, also preferably at least 70%, more preferably at least 80%, especially preferred to be 90, 92 or 94% and most preferred at least 96, 98 or 99% homologous to a nucleic acid or parts it is. Transgenic plant cell according to one of claims 19 to 21, wherein the nucleic acid sequence, the homologous and / or complementary to the nucleic acid sequence of the fungus is 50 to 5000 nucleotides, preferably 100 to 2000 nucleotides, more preferably 250 to 1000 nucleotides and most preferred Comprising 400 to 700 nucleotides. Transgenic plant cell according to one of claims 19 to 22, wherein the recombinant nucleic acid molecule comprises: (a) an in Plant functional promoter (b) operatively linked to the identical or homologous Antisense sequence of for the fungal gene encoding sequence, the sequence being recognizable at its 3 'end by the spliceosome 3 'exon sequences having, (c) an intron, (d) the identical or homologous Sense sequence of the for the fungal gene encoding sequence, the sequence being recognizable at its 5 'end by the spliceosome Has 5'-exon sequences, and (e) a termination sequence. Transgenic plant cell according to one of claims 19 to 22, wherein the recombinant nucleic acid molecule comprises: (a) an in Plant functional promoter (b) operatively linked to the identical or homologous Antisense sequence of for the fungal gene encoding sequence, and (c) a termination sequence. Transgenic plant cell according to one of claims 19 to 22, wherein the recombinant nucleic acid molecule comprises: (a) an in Plant functional promoter (b) operatively linked to the identical or homologous Antisense sequence of for the fungal gene encoding sequence, wherein the sequence is over self-complementary regions features, and (c) a termination sequence. Transgenic plant cell according to one of claims 19 to 22, wherein the recombinant nucleic acid molecule comprises: (a) an in Plant functional promoter (b) operably linked to a DNA sequence, the to the for the mRNA of the fungal gene or parts thereof coding sequence is complementary, (C) a DNA sequence for Ribonuclease P coded, and (d) a termination sequence. Transgenic plant cell according to one of claims 19 to 26, wherein the homologous nucleic acid sequence selected from the mushroom is made up of the group (i) comprising DNA sequences Nucleotide sequences comprising SEQ ID no. 1, 2, 3, 4, 5, 6 or 7 or Fragments thereof include, and / or (ii) comprising DNA sequences Nucleotide sequences that under stringent conditions with a complementary Strand of a nucleotide sequence of (i) hybridize. Transgenic plant containing a plant cell according to one of the claims 19 to 27. A method of identifying fungal genes in which inhibition of their expression in transgenic plants mediates fungal resistance, comprising the steps of: (a) identifying appropriate target genes, (b) preparing RNAi constructs for these target genes in a suitable vector, (c) transforming the RNAi constructs into suitable test plants, (d) inoculating the test plants with a suitable fungus and (e) evaluating fungal infestation of the plant by a suitable evaluation method. The method of claim 29, wherein the appropriate Target genes or parts thereof prior to making the RNAi constructs to amplify cDNA. The method of claim 30, wherein the RNAi constructs by site-specific recombination of the cDNA into the appropriate vector getting produced. A method according to any one of claims 29 to 31, wherein the test plants be transformed by the biolistic method. A method according to any one of claims 29 to 32, wherein it is when the suitable fungus is powdery mildew. Method according to one of claims 29 to 33, wherein the evaluation fungal infestation by visual inspection of the plants. Use of nucleic acid sequences resulting in a nucleic acid sequence of a fungus are homologous and / or complementary, for the production of fungus-resistant transgenic plants.