DE202015009072U1 - Primer and primer pair for quantitative detection of contamination of a liquid by a microorganism by quantitative polymerase chain reaction - Google Patents

Abstract

A primer pair for quantitatively detecting contamination of a liquid comprising an organic compound by a microorganism comprising a nucleotide sequence selected from:

Description

 The invention is in the field of specific detection of microbial contamination of fuels, e.g. Kerosene, diesel, biodiesel or fuel oil due to microorganisms, such as fungi and bacteria.

 The ability of certain microorganisms to grow in liquid hydrocarbons, especially in fuels, is well known. Negative effects of microbial growth in fuels have received increased attention recently, especially with respect to biofuels. The microorganisms form water and other metabolic products, which may result, for example due to corrosion, restrictions on the functionality of engine components. Under certain circumstances, the microorganisms can also immediately offset or block filters and narrow lines. Against this background, knowledge of the presence of microorganisms in fuels, particularly stored fuels and / or in fuel tanks or fuel storage tanks, is an important quality criterion for the tank plant and stored product. Quantitative and qualitative microbial monitoring of fuels can lead to failure-free operation of internal combustion engines, if appropriate countermeasures are taken in good time on the basis of

The detection of the microbial contamination of fuels can be carried out analytically by the customary in microbiology cultivation and enumeration of colony-forming units. A corresponding commercially available test kit is commercially available under the name MikrobMonitor2 Kit (ECHA Microbiology Ltd, Cardiff, UK). The detection is limited to culturable microorganisms and is neither selective nor sensitive. Another detection method is available under the name Aviation FUELSTAT ^® resinae PLUS (conidia Bioscience Ltd, Surrey, UK). It is an immunochromatographic rapid test (lateral flow assay) based on gold-labeled antibodies, which allows the detection of Hormoconis resinae from fuels, preferably from the water phase of contaminated fuels. This mushroom is also known under the name of diesel mushroom or kerosene mushroom. The sensitivity and selectivity of this test are highest when - due to metabolism - there is already a water phase that can be investigated. At this time, however, the colonization of the fuel is already considerably advanced. Thus, also in this test, the sensitivity and the selectivity are insufficient to meet the requirements for effective monitoring, including the early detection of microbial contamination of a fuel.

 Against this background, primer pairs for the quantitative detection of microorganisms in a liquid for protection claim 1, a test kit comprising an oligonucleotide sequence as a primer for the detection of Hormoconis resinae according to protection claim 10 and primer for detecting microbial contamination by H. Resinae, fungi or bacteria according to protection claim 14th proposed. Other embodiments, modifications, and improvements will become apparent from the following description and the appended claims.

• – Gewinnen eines Feststoffanteils der Flüssigkeit;
• – Isolieren der DNS aus dem Feststoffanteil;
• – Amplifizieren eines spezifischen Abschnitts der isolierten DNS mittels qPCR und Erhalten eines Amplifikats;
• – Bestimmen einer absoluten Masse des amplifizierten DNS-Abschnitts an Hand einer Fluoreszenz des Amplifikats;
• – Beurteilen eines Grades der Kontamination der Flüssigkeit, optional umfassend ein Abschätzen einer Zellzahl der Mikroorganismen je Volumeneinheit der Flüssigkeit;

According to a first embodiment, a method is proposed for the quantitative detection of a contamination of a liquid comprising an organic compound by microorganisms, which comprises the following steps:

• - Obtaining a solids content of the liquid;
• - Isolating the DNA from the solids content;
• Amplifying a specific portion of the isolated DNA using qPCR and obtaining an amplificate;
• Determining an absolute mass of the amplified DNA segment by means of fluorescence of the amplificate;
• - assessing a degree of contamination of the liquid, optionally comprising estimating a cell count of the microorganisms per unit volume of the liquid;

Dabei entsprecht die vorstehende Schreibweise von links nach rechts der jeweiligen Sequenz vom 3‘ Ende zum 5‘ Ende. Weiterhin stehen die den in Klammern angeführten Kurznamen abschließenden Buchstaben „F“ und „R“ für „vorwärts“ bzw. für „rückwärts“, bzw. steht F für eine 5→3' Verlängerung (vorwärts) und R steht entsprechend für eine 3→5' Verlängerung (rückwärts) des Oligonukleotid-Stranges. Dem entsprechend, sind die in 3 angegebenen R-Primer spiegelschriftlich dargestellt, da eine biosynthetische Kettenverlängerung stets zu einem Wachstum des Stranges von dessen 5‘ Ende zu dessen 3‘ führt. Die Zahl im Kurznamen gibt die jeweilige Nukleotid-Startposition auf dem amplifizierten Genabschnitt wieder. Unter einer organischen Verbindung wird hier eine jegliche Verbindung verstanden, die zumindest ein Kohlenstoffatom in kovalenter Bindung mit einem Wasserstoff enthält, wobei die organische Verbindung bevorzugt zumindest eine C-C-Bindung umfasst. Derartige organische Verbindungen können von bestimmten Mikroorganismen als Kohlenstoff-Quelle genutzt und somit besiedelt werden. Unter der „absoluten Masse des amplifizierten DNS-Abschnitts“ wird die Masse aller spezifisch amplifizierten DNS-Abschnitte verstanden. wherein the fluorescence of the amplificate is based on a label of adjacent nucleotides of a DNA strand with a fluorescent dye, and the amplified specific portion of the DNA is defined by means of a primer pair comprising one of the following four pairs of two nucleotide sequences (primers) :

The above notation corresponds from left to right of the respective sequence from the 3 'end to the 5' end. Further, the letters "F" and "R" terminating in parentheses represent "forward" and "backward", respectively, F stands for a 5 → 3 'extension (forward) and R correspondingly stands for a 3 → 5 'extension (backwards) of the oligonucleotide strand. Accordingly, the in 3 R-primers shown in a mirror-image, since a biosynthetic chain extension always leads to a growth of the strand from its 5 'end to its 3'. The number in the nickname represents the particular nucleotide start position on the amplified gene segment. By an organic compound is meant herein any compound containing at least one carbon atom in covalent bond with a hydrogen, which organic compound preferably comprises at least one C-C bond. Such organic compounds can be used by certain microorganisms as a carbon source and thus populated. The "absolute mass of the amplified DNA segment" is understood as meaning the mass of all specifically amplified DNA segments.

 Advantages of the analytical method result from the high specificity of the primers used to identify a gene segment. They primarily relate to the high detection specificity and detection selectivity in a liquid comprising a carbon source. This can be either a technical fluid (fuel, coolant, lubricant, solvent, paint, lacquer), as well as a liquid intermediate or end product of the chemical industry (including the pharmaceutical industry), the food industry or biotechnology. For example, the detection method makes it possible to assess the microbial infestation of a fuel based solely on the extraction of about one hundred cells of the microorganism in question. The nucleotide sequences of the primers are 100% identical to H. resinae, whereas they differ from other fungal DNA sequences, i. they vary in single nucleotides and therefore can not bind to the DNA of the other fungi. It should be noted, however, that there are various possible variations with respect to the primer nucleotide sequences. Minor changes in the nucleotide sequence do not necessarily result in a change in the functionality of the primers. In particular, extensions or truncations of the sequence of the specified oligonucleotides by a few nucleotides, preferably by at most five nucleotides, more preferably by at most three nucleotides, most preferably by at most one nucleotide, can lead to primer molecules which are equally suitable for the proposed method according to the invention. This relates in particular to an extension at the 5 'end of the oligonucleotide. In addition, it is clear to the person skilled in the art that even individual nucleotide exchanges do not impair the amplification capability of the primers. Variants in which one or two nucleotides have been exchanged at such sites that the resulting oligonucleotide still hybridizes sufficiently can therefore also be used according to the invention. Therefore, the use of said variants is covered by the proposed method. For all oligonucleotides disclosed in this application, it is also possible to use variants in the sense defined above.

wobei der nachgewiesene Mikroorganismus ein Pilz ist. According to another embodiment, the amplified specific portion of the DNA is defined by means of at least one primer pair comprising one of the following nucleotide sequences:

wherein the detected microorganism is a fungus.

Advantages of this embodiment result from the achievable high selectivity and sensitivity of a PCR with these primers for the detection of fungi.

• – Hormoconis resinae;
• – Myxotrichum deflexum und/oder Myxotrichum cancellatum;
• – Oidiodendron chlamydosporicum und/oder Oidiodendron setiferum;
• – Aspergillus versicolor und/oder Aspergillus niger;
• – Penicillium citrinum; Penicillium funiculosum und/oder Penicillium brevicompactum;
• – Cladosporium sphaerospermum und/oder Cladosporium herbarum;
• – Alternaria alternata;
• – Chaetomium globosum;
• – Paecilomyces variotii;
• – Phoma violacea;
• – Trichoderma virens;
• – Ulocladium atrum;
• – Fusarium solani;
• – Candida lipolytica; und/oder
• – Rhodotorula mucilaginosa.

According to a development of the preceding embodiment, the detected fungus is selected from:

• - Hormoconis resinae;
• - Myxotrichum deflexum and / or Myxotrichum cancellatum;
• - Oidiodendron chlamydosporicum and / or Oidiodendron setiferum;
• - Aspergillus versicolor and / or Aspergillus niger;
• - Penicillium citrinum; Penicillium funiculosum and / or Penicillium brevicompactum;
• - Cladosporium sphaerospermum and / or Cladosporium herbarum;
• - Alternaria alternata;
• - Chaetomium globosum;
• - Paecilomyces variotii;
• - Phoma violacea;
• - Trichoderma virens;
• - Ulocladium atrum;
• - Fusarium solani;
• - Candida lipolytica; and or
• - Rhodotorula mucilaginosa.

 Advantages result from the possibility of highly sensitive detection of these important germs. Their growth can lead to significant restrictions on the usability of the liquid populated by these fungi, or completely prohibit the usability of the liquid in question.

und der Mikroorganismus Hormoconis resinae ist. According to a further embodiment, the amplified specific portion of the DNA is defined by means of at least one primer pair, the primer pair comprising one of the following nucleotide sequences:

and the microorganism is Hormoconis resinae.

Advantages of this embodiment result from the reliable detection of an infection of the examined respective sample material with H. resinae.

wobei der Mikroorganismus ein Bakterium und/oder einen Bakterienstamm umfasst. According to a further embodiment of the proposed method, the PCR-amplified specific portion of the DNA is defined by means of at least one primer pair comprising at least one of the following nucleotide sequences:

wherein the microorganism comprises a bacterium and / or a bacterial strain.

Advantages of this embodiment are the safe and highly sensitive detection of a bacterial colonization of the sample material investigated. The determined on the basis of the current findings severity can beispielswese as an objective basis for decision on the alternatives Discard the microbial be used contaminated liquid, other uses or destruction of the liquid. In addition, targeted countermeasures can be taken, eg a targeted use of biocides with a type and concentration of a biocide adapted to the respectively determined contamination.

 According to a further embodiment, one of the nucleotide sequences used for the PCR comprises at least 80% to 85% of the nucleotide sequence given above.

 Such correspondence also includes extension or truncation of at least one of the named nucleotide sequences by 3 to 5 nucleotides. As already explained above, such changes in the nucleotide sequence do not necessarily lead to a change in the functionality of the primers. In particular, extensions or truncations of the sequence of the indicated oligonucleotides by at most five nucleotides, for example by at most three nucleotides, in particular by at most one nucleotide, can lead to primer molecules which are just as suitable for the method according to the invention. This relates in particular to extensions at the 5 'end of the oligonucleotide. It is clear to the person skilled in the art that individual nucleotide exchanges do not adversely affect the amplification capacity of the primers. Such variants, in which one or two nucleotides are exchanged at such sites that they still hybridize sufficiently, can therefore also be used according to the invention. Therefore, the use of said variants in the method of the invention is encompassed by the present invention. For all oligonucleotides (primers) disclosed in this application, it is also possible to use variants in the sense defined above.

 In another embodiment, the qPCR comprises extending the primer in synchronism with annealing the primer.

 Advantages of synchronicity arise with a considerable simplification of the analysis protocol and a shortening of the time required for a meaningful test. Exact analysis results are therefore available within a shorter period of time between sampling and evaluation.

 According to another embodiment of the proposed method, a temperature for attaching the primer and a temperature for extending the primer are identical.

 The advantages of this embodiment include a reduction in the time required to perform the analysis for microbial contamination of a liquid, such as a fuel or other liquid containing organic components.

 According to a further embodiment, the liquid is selected from: a fuel, a diesel fuel, a paint, a paint, an intermediate of the petrochemical industry, coolants, lubricants, a milk, a whey, a juice, and / or an intermediate liquid at room temperature Food industry, a final or intermediate product of the pharmaceutical or cosmetics industry.

 Said liquids come as a carbon source for the microorganisms discussed here (H. resinae, fungi, bacteria) into consideration. An infestation can completely destroy the suitability of the product or intermediate product (contamination) or considerably reduce it by requiring additional purification steps or by making processes (for example spraying and spraying processes) no longer or only partially practicable. Advantageously, the qPCR described here can be carried out using at least one of the described primer pairings. In this case, the said primer pairings comprise two nucleotide sequences which are specific for the organism to be detected.

 It should be noted, however, that there are various possible variations with respect to the primer nucleotide sequences. Minor changes in the nucleotide sequence do not necessarily result in a change in the functionality of the primers. In particular, extensions or truncations of the sequence of the oligonucleotides according to the invention by a few nucleotides, preferably by at most five nucleotides, more preferably by at most three nucleotides, most preferably by at most one nucleotide, can lead to molecules which are equally suitable for the method according to the invention. This relates in particular to extensions at the 5 'end of the oligonucleotide. In addition, it is clear to the person skilled in the art that even individual nucleotide exchanges do not impair the amplification capability of the primers. Such variants, in which one or two nucleotides are exchanged at such sites that they still hybridize sufficiently, can therefore also be used according to the invention. Therefore, the use of said variants in the method of the invention is encompassed by the present invention. For all oligonucleotides disclosed in this application, it is also possible to use variants in the sense defined above.

In another embodiment, it is proposed to use an oligonucleotide sequence as a primer to detect colonization of a fluid comprising an organic compound by Hormoconis resinae using a polymerase chain reaction-based assay, wherein the oligonucleotide sequence is selected from:

 Advantages of this use result from the reliable detection of a microbial colonization of the examined sample, or a highly sensitive detection of the growth of the liquid or of the surfaces in contact with it by Hormoconis resinae, by a fungus or by a bacterium. Of particular practical importance for the detection of undesired microbial colonization by at least one fungus or by at least one bacterium (a strain of bacteria) outside the use of fuels, e.g. in biotechnology, the pharmaceutical and / or cosmetics industry, food technology or in drinking water treatment are the primer pairs NL1F / LS2R (fungi) and 338F / 518R (bacteria). In these areas, the colonization of certain process fluids by microorganisms is typically undesirable, therefore sensitive detection even before the onset of health hazards or economic damage is highly desirable.

 According to one development of the proposed use, at least one of the specified oligonucleotide sequences is modified by the fact that at least one adenine base by a thymine base or a guanine base, or a thymine base by an adenine base or a cytosine base, or a Guanine base replaced by a cytosine base or a cytosine base by a guanine base.

The described substitutions which, together with other further substitutions in 3 (see areas of the nucleotide sequences surrounded by dot-lines) - the hybridizability of the oligonucleotides used as primers typically does not or only marginally differ. Such a modified primer will still bind to the target sequence and thus not hinder the PCR reaction.

 According to a further embodiment, the above-described replacement of an adenine base, a thymine base, a guanine base or a cytosine base by any other base or even omission thereof relates to a central portion of the oligonucleotide sequence used as a primer. Here, a middle section is understood to mean that region of the specified oligonucleotide sequence which is at least one, preferably three, more preferably 5 nucleotide bases away from one end of the oligonucleotide.

 Advantages correspond to those already named. Replacement of bases by structurally similar purine or pyrimidine bases, typically less than 25% of the total nucleotides of the oligonucleotide sequence, does not necessarily result in loss of its suitability as a primer according to the applications described herein.

 According to a further embodiment, the use of one of the specified oligonucleotides according to the described method is proposed, wherein at least one primer of one of the named primer pairs is extended or shortened by five nucleotides, by at most three nucleotides, or by at most one nucleotide. In the case of an extension, this extension is preferably present at the 5 'end of the oligonucleotide.

 Advantages of prolongation may be manifested in increased specificity towards the target organism or in a more pronounced melting curve. In this way, for example, the course of a melting curve can be modified so that - without impairing the specificity for the test - the readability of the test is facilitated.

• a) einem für Hormoconis resinae spezifischen Primer, umfassend ein Oligonukleotid, ausgewählt unter:
  
• b) einem pilzspezifischer Primer, umfassend eine Oligonukleotid, ausgewählt unter:
  
• c) einem bakterienspezifischer Primer, umfassend ein Oligonukleotid, ausgewählt unter:
  

According to a further embodiment, a primer for detecting a microbial contamination of an organic compound by means of polymerase chain reaction (PCR) in a buffer solution comprising fluorescent dye-labeled nucleotides is proposed, wherein the primer for the detection of microbial contamination is selected from:

• a) a Hormoconis resinae specific primer comprising an oligonucleotide selected from:
  
• b) a fungal-specific primer comprising an oligonucleotide selected from:
  
• c) a bacterial-specific primer comprising an oligonucleotide selected from:
  

 A truncation or extension of the above-mentioned primers (Hr556F, Hr814R, Hr101F, Hr408R, NL1F, LS2R, 338F, 518R, F1, R1, F2, R2, F3, R3, F4 or R4) by 1 to 3 nucleotides to the 5 'or 3' ends can - with simultaneously matched in terms of temperature and number of cycles specific PCR conditions - lead to a successful amplification of the respective target sequence. Thus, also those shortened by 1 to 3 nucleotides at the 5 'or at the 3' end and those extended by 1 to 3 nucleotides at the 5 'or 3' end are o.g. Primer or oligonucleotides subject of the present patent application. This applies both to the primers specific for H. resinae and to those listed for fungi and to the bacteria-specific primers listed. Advantages result from the possibility of an application-specific cutting of a test protocol: The specificity of a test can be increased, for example, or the time required for the test can be reduced, possibly at the cost of a reduced specificity. The latter can be particularly advantageous if only a small number (highly metabolized with regard to their metabolism) of bacterial or fungal strains (for example so-called extremophilic microorganisms) come into consideration for the particular organic compound, ie the reduced specificity has no disadvantageous effects. Positive effects include further reduced costs for the primers and the performance of the PCR-based assay.

 According to one development of this embodiment, at least one of the stated oligonucleotides is shortened or extended at the 3 'end and / or at the 5' end by five nucleotides, by at most three nucleotides, or by at most one nucleotide, in which case an extension is preferred on the 5 th 'End of the oligonucleotide is present.

 In addition to the above-mentioned advantages of slightly modified primers, the advantages of this embodiment relate to the provision of a detection method adapted to the respective application. Applications mainly concern the so-called microbial screening in food industry and analysis and in drinking water analysis. For example, in a medium known to contain a particular fungus or bacterium, a counting method (which, for example, may prove difficult to achieve in filamentous fungi, can be circumvented or replaced if a colonization or growth phase is to be evaluated Also, in an unknown measurement situation, a general colonization of a pasty medium or a liquid by fungi or by bacteria can be quantified without a specific detection method being available for the fungi or bacteria which are unknown in detail Common counting methods would fail here, the use of common plating or incubation methods (liquid nutrient media or selective nutrient media, etc.) would be considerably more costly in terms of time and costs.

According to a further embodiment, primers are proposed for detecting a microbial colonization of an organic compound or of a substance mixture comprising at least one organic compound, the primers being specific for Hormoconis resinae. Furthermore, the above primers F1 and R1 each specifically hybridize with a sequence of a gene for a second largest subunit of an RNA polymerase II (RPB2) and thus define a portion of this gene specific for H. resinae. Furthermore, the above-mentioned primers F2 and R2 each hybridize specifically with a sequence of a Gene for the internally transcribed spacer (ITS) of H. resinae and thus define a gene section specific for H. resinae only.

 This advantageously allows for a specific detection method for Hormoconis resinae. Primers F1 and R1 define a portion of the gene for the second largest subunit of RNA polymerase II (RPB2) of Hormoconis resinae and primers F2 and R2 define a portion of the gene for the internally transcribed spacer (ITS) of Hormoconis resinae. Thus, any tests based on said primer pairings, for example PCR-based assays, are highly specific. If H. resinae can use the investigated organic compound as a carbon source and is present in a corresponding sample, an infestation of the relevant sample can also be detected after appropriate extraction of the DNA with such tests.

 According to a further embodiment, primers are proposed for detecting a microbial colonization of an organic compound or of a substance mixture comprising at least one organic compound, wherein the primers are specific for fungi. The used o.g. Primers F3 and R3 each specifically hybridize to portions of the large subunit of a 28S rRNA gene (also referred to by the abbreviation 28S).

 This advantageously allows a fungi-specific detection method. Each of primers F3 and R3 defines specific sequences of the gene encoding the large subunit of a 28S rRNA of fungi, thereby defining a fungal specific gene segment. Thus, any assays based on said primer pairing, e.g. PCR-based analysis method, highly specific. If any fungi use the studied organic compound as a carbon source and there is only one fungal strain (strain in the sense of a small taxonomic unit) in a corresponding sample, fungal infestation of the sample in question can also be detected after appropriate extraction of the DNA with such assays.

 According to a further embodiment, primers are proposed for detecting a microbial colonization of an organic compound or of a substance mixture comprising at least one organic compound, the primers being specific for bacteria. Here, the o.g. Primers F4 and R4 each specifically with a nucleotide sequence of a gene of the small subunit of a 16S rRNA gene of bacteria (which is also designated with the abbreviation 16S) and thus enable the specific amplification of a defined gene segment.

 This advantageously allows a detection method that is specific to bacteria in general. The primers F4 and R4 each define specific sequences of the gene encoding the small subunit of a 16S rRNA gene, thereby defining a bacterial specific gene segment. Thus, any assays based on said primer pairing, e.g. PCR-based analysis method, highly specific for bacteria. If any bacteria use the investigated organic compound as the carbon source and there is only one bacterial strain (strain in the sense of a small taxonomic unit) in a corresponding sample, bacterial infestation of the sample in question can also be detected after appropriate extraction of the DNA with such assays.

 The described embodiments can be combined with each other as desired.

A variety of microorganisms, mainly fungi and bacteria, can use organic compounds, in particular liquid hydrocarbons as a substrate. This becomes of practical interest when the liquid hydrocarbons are, for example, fuels. Microbial contamination leads to a reduction in fuel quality, the blockage of fuel lines and filter systems and promotes the corrosion of fuel tanks ( Gaylarde et al. 1999, Rauch et al. 2006, Raikos et al. 2011 ). The filamentous fungus Hormoconis resinae, previously described as Cladosporium resinae and known as "kerosene mushroom" or "diesel mushroom", is considered to be one of the major organisms in this regard. This is due to its capacity to produce large quantities of biomass, as well as its ability to use numerous carbon sources as a source of nutrients ( Seiffert et al. 2007; Sheridan et al. 1972 ). However, recent studies show that not only H. resinae is responsible for the contamination of fuels ( Rauch et al. 2006, Raikos et al. 2011 ), but a variety of fungi and bacteria. Against this background, a specific test for this important fungus as well as the quantification of a total existing fungal and bacterial contamination of a sample is of practical interest.

The polymerase chain reaction, referred to below as PCR, represents a powerful method for the selective amplification of a DNA section of the totality of all DNA present in a sample, which is specified by means of appropriate primers. For certain questions, enrichment of a specific DNA segment may occur be of interest, for example, to the exact order (the sequence) of the nucleotides in the enriched material (the amplificate) to be able to sequence analysis. For other questions, the amplification of an a priori known DNA sequence can be used by means of PCR for qualitative characterization of a sample, for example for detecting the presence of a gene, a mutation, or even a microorganism. One example relates to the use of PCR in forensics. Still other issues address a quantitative detection of a particular DNA target sequence for the quantitative analysis of a sample for contamination to be determined, for example, a liquid or a product (eg, a food) by a particular microorganism.

 A variant of the PCR, also referred to as real-time PCR / RT-PCR, is based on the use of dye-labeled nucleotides and allows quasi real-time, during the PCR, to make statements on the currently synthesized copy number of the target sequence. This method is also called quantitative PCR (qPCR).

• 1. (optional) Anreichern fester Bestandteile der Kraftstoffprobe;
• 2. Extraktion der DNS aus den angereicherten festen Bestandteilen der Probe (Sediment);
• 3. Bestimmung der DNS Konzentration mittels spektroskopischen Methoden;
• 4. Quantifizierung einer Pilzkontamination mittels qPCR; 4.1 Aufspalten (Denaturierung) der doppelsträngigen DNS in Einzelstränge unter der Einwirkung von Hitze; 4.2 Anlagern (Annealing) der spezifischen Oligonukleotide (DNS-Sequenzen, Primer) bei einer für den jeweiligen Primer spezifisch definierten Temperatur an die aufgespaltenen Einzelstränge; 4.3 Verlängern (Elongation) der angelagerten Primer DNS Sequenz durch die Wirkung der DNS-Polymerase in Gegenwart farbstoffmarkierter Nukleotide;
• 5. Spezifitätskontrolle;
• 6. Auswertung der Ergebnisse.

The proposed method is based on the principle of qPCR. It includes the steps:

• 1. (optional) enriching solid constituents of the fuel sample;
• 2. extraction of the DNA from the enriched solid components of the sample (sediment);
• 3. Determination of DNA concentration by spectroscopic methods;
• 4. Quantification of fungal contamination using qPCR; 4.1 splitting (denaturing) the double-stranded DNA into single strands under the influence of heat; 4.2 Annealing the specific oligonucleotides (DNA sequences, primers) at a specific temperature for each primer to the split single strands; 4.3 Extending (elongating) the annealed primer DNA sequence by the action of the DNA polymerase in the presence of dye-labeled nucleotides;
• 5. specificity control;
• 6. Evaluation of the results.

 The individual method steps are described below with reference to practical exemplary embodiments in the analysis of a fuel sample.

1. (optional) enriching solid constituents of the fuel sample

If the contamination of a fuel sample can not yet be detected on the basis of turbidity, enrichment of the microorganisms which are initially present only in small numbers will have to be carried out. The enrichment can be carried out by centrifugation and / or filtration in order to detect and analyze all non-soluble constituents of the fuel. Preferably, 10 ml of the fuel to be examined are centrifuged for 10 min at 5000 g. After centrifugation of this sample, a sediment is present. The overlying supernatant is discarded, the sediment is subjected to further analysis. Alternatively, an aliquot of the sample may also be analyzed directly, without prior centrifugation. Advantageously, a sample whose general microbial contamination is known can be shaken out with a small amount of water or an aqueous buffer solution suitable for DNA extraction. Typically, weak alkaline pH 7.5 to pH 8 buffers are used. Likewise, biomaterial can be obtained from a fuel sample by means of suitable filters, for example nuclear magnetic membrane filters usually used for sterile filtration. This biomaterial is then dissolved in a suitable buffer solution, e.g. TNE buffer (10mM Tris-HCl, 100mM NaCl, 1mM EDTA, pH 8) was resuspended and the DNA extracted.

2. Extraction of the DNA from the enriched solid components of the sample (sediment)

 The solid sediment or solid components obtained by filtration or shaking presumably contain microorganisms whose DNA is to be recovered for analysis by PCR. For example, DNA extraction is performed using the FastDNS Spin Kit for Soil (MP Biomedical) or a conventional (phenol-based) DNA extraction method, such as that used to study soil samples. This DNA extraction involves disrupting the cells (lysis), precipitating the DNA from the lysed cell material, purifying the precipitated DNA, and, finally, dissolving the DNA in sterile water so that the resulting aqueous solution eventually releases the DNA from the cells Centrifugation, filtration or shaking extracted solid components of the examined fuel sample comprises.

3. Determination of the DNA concentration by means of spectroscopic methods Since it is desirable to know the amount of DNA to be used for the PCR, it is first necessary to determine their concentration in the extract. The determination of the DNA concentration is typically spectrophotometric, preferably at 260 nm. For example, a commercially available UV-Vis spectrophotometer can be used with a device-internal calibration curve, eg Nanodrop (Thermo Scientific). For this, the absorption of 1 μl of an aqueous DNA solution against distilled water in the wavelength range from 200 to 300 nm is measured and from the absorption at 260 nm the DNA concentration is determined by comparison with a calibration curve. In addition, the purity of the DNA solution can be determined on the basis of the quotient of the absorption of the sample at 230 nm and 280 nm.

4. Quantification of a fungal contamination of a sample by means of quantitative PCR (qPCR)

• 4.1 Aufspalten (Denaturierung) der doppelsträngigen DNS in Einzelstränge unter der Einwirkung von Hitze;
• 4.2 Anlagern (Annealing) der spezifischen Oligonukleotide (DNS-Sequenzen, Primer) bei einer für den jeweiligen Primer spezifisch definierten Temperatur an die aufgespaltenen Einzelstränge;
• 4.3 Verlängern (Elongation) der angelagerten Primer DNS Sequenz durch die Wirkung der DNS-Polymerase in Gegenwart farbstoffmarkierter Nukleotide.

The quantitative determination of a present microbial contamination is carried out by means of polymerase chain reaction (hereinafter referred to as PCR), for example using a thermal cycler (C1000 thermocycler, Biorad) according to a special protocol, which is adapted to the primers used for the specific detection. Like other PCR protocols, the primer-specific PCR used here is divided into three parts:

• 4.1 splitting (denaturing) the double-stranded DNA into single strands under the influence of heat;
• 4.2 Annealing the specific oligonucleotides (DNA sequences, primers) at a specific temperature for each primer to the split single strands;
• 4.3 Lengthening (elongation) of the annealed primer DNA sequence by the action of the DNA polymerase in the presence of dye-labeled nucleotides.

The process steps 4.1 to 4.3 are typically repeated 40 times. According to specific embodiments of the qPCR proposed here, the temperature at which the primers are attached and the temperature at which the primer extension takes place, ie the annealing temperature and the extension temperature, are identical to one another. In this way, the otherwise separate steps attaching and extending can be done synchronously. This causes a shortening of the time required for the analysis. Each repetition of the process steps attaching and extending is preceded by a remelting of the double-stranded DNA generated under the action of the DNA polymerase (see Table 1). Table 1: PCR protocol for the determination of fungal contamination in diesel step time temperature Split before PCR 5 min 95 ° C Attach and extend the primer 30 s *) Splitting between individual repetitions 5 s 95 ° C *) The temperatures for the attachment of the primers and for the strand extension are dependent on the respective primer and thus each represent a primer-specific temperature. They are for the primer Hr556F / Hr814R: 60 ° C; for the primers Hr101F / Hr408R: 65 ° C; for the primers NL1F / LS2R: 60 ° C; and for primers 338F / 518R: 60 ° C.

 The abovementioned attachment and extension temperatures were determined experimentally by gradient PCR experiments. The PCR results for temperatures between 50 ° C and 65 ° C were compared. The temperatures thus determined provide the best amplification of the PCR products from the individual target genes while minimizing amplifications of other DNA sequences. In particular, a specific DNA segment (also referred to herein as a target sequence) is defined by two primers. One of the two primers (the 3 '→ 5' or R primer) defines the end of the target sequence at its 3 'end, the other primer (the 5' → 3 'or F primer) defines the target sequence at its 3' end 5 'end.

As a result of the cyclic repeated DNA synthesis, the multi-enriched target sequence is present in the analysis fluid. As is known, the amount of target sequence exponentially expands according to 2 ⁿ in n PCR steps. The continuous synthesis of the target sequence can be achieved by measuring the Fluorescence emission are directly tracked, since the individual nucleotides used for the synthesis of the amplificates are bound to a dye. In a practical embodiment, the commercially available iTaq universal SYBR Green Supermix (Biorad) was used. Of course, the executability of the qPCR is not tied to the use of the named supermix. Likewise, fluorescence-labeled nucleotides can be used elsewhere. The enrichment of the target sequence correlates exponentially with the emitted fluorescence.

 For the embodiments described herein, the specific primers and the specially adapted time and temperature protocol are characteristic. The listed gene sequences of each organism were obtained from the NCBI (National Center for Biotechnology Information) database and compared for possible matches and differences across taxonomic boundaries. The software "CLC Genomics Workbench" was used for this. For H. resinae, a DNA sequence was selected for the primers, which is detectable only in this fungus, while for the general fungal-specific primers, a sequence was selected which, at least in the genome of the fungi indicated in Table 3, if not in is identical to all mushrooms. The primer for the specific amplification of the DNA sequence was determined using the software "Primer Blast" and corresponding primers were synthesized.

By selecting and aligning DNA sequences of a wide variety of fungi with particular regard to conserved genes, DNA sequences were identified which are specific for H. resinae, which are specific to fungi in general and which are specific to bacteria in general. Corresponding primer sequences of at least 16 base pairs in length were used as primers for the qPCR. Their name, sequence and corresponding gene of the corresponding taxon used herein are summarized in the following table. Table 2: Primer sequences for the determination of DNA concentrations in fuels

In the described analysis of available genome sequences of fungi or microorganisms thus the sequence of RNA polymerase II, the large subunit (28S) of the rRNA gene and the ribosomal spacer ITS were used (see legend to Table 2). For finding a general bacterial specific primer, the small (16S) subunit of the rRNA gene can be used because it is particularly conserved.

5. Specificity control

To verify the specificity of the DNA extension, a controlled melting of the double-stranded DNA is performed at the end of the PCR. The resulting melting curve gives information about the length and the composition of the amplificate and is specific for the respective DNA enrichments. According to a preferred embodiment of the invention, therefore, a melting curve analysis of certain PCR products can be carried out after the amplification reaction. For this purpose, after the PCR, the products are heat denatured, cooled rapidly to 50 ° C and then heated slowly (0.1 ° C / s) to 99 ° C. The fluorescence of a dye that intercalates in the double strand (eg SYBR Green) is measured during the heating phase. An application example is in 4 shown.

6. Evaluation of the results

In a final sixth step, the results of the PCR are evaluated. For this purpose, preferably a suitable software, such as the program CFX Manager 3.1 (Biorad) is used. With this software, the fluorescence intensity can be determined after each repetition of DNA extension in order to calculate from it the DNA amount of the specific DNA extension present in the total DNA after the PCR.

 On the basis of experimentally prepared calibration curves (example of embodiment), primers specific for fungi as well as primers specific for the detection of Hormoconis resinae have been developed, which make possible a clear quantification of a contamination of fuel by fungi in general or especially by Hormoconis resinae.

 The process steps described above may be used analogously for the study of other liquids whose colonization by microorganisms, e.g. Fungi or bacteria (strains) should be assessed. Such liquids include, in particular, coolants and lubricants in industrial plants, liquid starting materials, intermediate products and end products of food technology and / or the pharmaceutical or cosmetics industry or products of the chemical industry, in particular paints and coatings and their use in spraying and spraying processes. If necessary, individual process steps will be slightly adapted. Advantageous in the application of the described procedure is in any case the simple and highly sensitive detection of fungi and / or bacteria using the primers for fungi in general ("NL1F": ATATCAATAAGCGGAGGAAAAG and "LS2": RATTCCCAAACAACTCGACTC) or for bacteria in general ("338F"). : ACTCCTACGGGAGGCAGCAG and "518R": ATTACCGCGGCTGCTGG), as fungi and bacteria, of whatever species, are not ordinarily included in the fluids concerned. Consequently, their evidence is an indication of an existing contamination, which may be suppressed or prevented by targeted countermeasures.

 Based on an analysis of the genome sequence of the target organisms, the primers Hr556F / Hr814R and Hr101F / Hr408R were developed. For this purpose, the database of the NCBI (National Center for Biotechnology Information) was used, and using software (CLC Workbench) the sequences compared and primer determined using Primer Express software. For H. resinae two independent DNA target sequences were used. In particular, the primer pair Hr556F / Hr814R was developed on the basis of the gene of RNA polymerase (RPB2, large subunit) and the primer pair Hr101F / Hr408R was developed from the ITS sequence (Internal Transcribed Spacers). The sequences of the primers are listed in Table 2.

 The two primers - one for the forward translation, the other for the backward translation (see Table 2, legend to column 1) each represent the opposite strand to its "primer partner". The primers proposed here for the described PCR for the specific detection of microorganisms comprise at least 16, preferably 17, more preferably at least 20 defined consecutive nucleotides.

The gene sequences corresponding to the primer sequences used are found exclusively in H. resinae. To ensure the specificity of the primers, the sequences of a variety of fungi (listed in Table 2 below) from the NCBI database using the CLC Workbench software and confirming the uniqueness of the primer sequences: Table 3 species Sample number in the agarose gel (FIG. 1) Myxotrichum deflexum 3 Myxotrichum cancellatum 4 Oidiodendron chlamydosporicum 5 Oidiodendron setiferum 6 Aspergillus versicolor 7 Aspergillus niger 8th Penicillium citrinum 9 Penicillium funiculosum 10 Penicillium brevicompactum 11 Cladosporium sphaerospermum 12 Cladosporium herbarum 13 Alternaria alternata 14 Chaetomium globosum 15 Paecilomyces variotii 16 Phoma violacea 17 Trichoderma virens 18 Ulocladium atrum 19 Fusarium solani 20 Candida lipolytica 21 Rhodotorula mucilaginosa 22

 Some of the designated fungi come into consideration as potential fouling in fuels. Likewise, however, some of the designated fungi come as undesirable germs, for example in tank systems, boilers or pipelines for the transport and storage of food, such as milk and / or whey or of fruit juices or concentrates into consideration. Likewise, a colonization of liquid intermediates and end products of the chemical or pharmaceutical industry by representatives of the mushrooms mentioned is known.

 Rapid and sensitive detection of the presence of fungal contamination or bacterial contamination in pipelines and tanks of industrial plants such as the food industry or pharmaceutical and / or biotechnology is highly desirable for understandable reasons. Against this background, the detection method for fungi described here using the example of detecting a microbial contamination of a liquid hydrocarbon (fuel) in general using the primers NL1F / LS2R can also be used to detect fungal contamination, e.g. also be used in the food industry.

 Furthermore, the primers 338F / 518R used to detect bacteria can be used for highly sensitive detection of bacterial contamination in different sample matrices.

 The accompanying figures illustrate embodiments and, together with the description, serve to explain the principles of the invention. The elements of the figures are shown relative to each other and not necessarily to scale.

1 shows an agarose gel after electrophoresis of amplificates of a PCR with 10 ng DNA of different fungi, which was performed with the H. Resinae specific primers. Staining of DNA was carried out with SYBR ^® Green.

2 shows calibration curves for the quantitative determination of the DNA concentration of H. resinae in a DNA sample for the primers Hr556F / Hr814R (a) and Hr101F / Hr408R (b).

3 shows in the panel (a) the comparison of the gene sequences of H. resinae, M. deflexum and A. niger on the two RPB2 primers and in the panel (b) the comparison of the gene sequences of H. resinae, M. deflexum and A. niger on the two IST primers.

4 shows melting curves of the amplificates according to qPCR of the H. resinae specific primers: in the partial image (a) for the amplicon obtained using Hr556F / Hr814R and in the partial image (b) the melting curve for the amplicon obtained with the primers Hr101F / Hr408R.

In particular, occupied 1 the specificity of the primers for all fungi included in the review. Using a conventional PCR protocol, the primer Hr556F / Hr814R ( 1a ) and the primer Hr101F / Hr408R ( 1b ) to detect H. resinae DNA in the sample DNA.

 For this purpose, identical amounts of 10 ng each of the DNA of the species from Table 2 were amplified in a conventional PCR. Subsequently, the amplificates were separated electrophoretically in 2% agarose gels. The mass standard (M) used was a 1 kb conductor from Thermo Scientific.

The DNA separated in band 1 and band 2 comprise amplicons from two different H. resinae strains (BAM 123 and DSM 1203). Using a conventional PCR protocol, the primer Hr556F / Hr814R ( 1a ) and the primer Hr101F / Hr408R ( 1b ) to detect H. resinae DNA in the sample DNA. Bands 3 to 22 correspond to amplificates of 10 ng DNA each of the fungi indicated in Table 2, after PCR otherwise carried out under identical conditions. The absence of a colored band with a mass of the amplicons from bands 2 and 3 demonstrates the absence of the target sequence. On the other hand, the absence of another colored higher mass band demonstrates that the primers do not bind nonspecifically on a strand and thus flank any foreign sequence. Overall, this demonstrates the specificity of the primers used for H. resinae. In 3 the sequences for the employed H. resinae - specific primers are shown in comparison to the sequences of the tested fungi. It becomes clear that only the sequence of H. resinae is identical, in the other fungi the sequence differs in some positions, therefore no amplification can take place. It should be noted, however, that there are various possible variations with respect to the primer nucleotide sequences. Minor changes in the nucleotide sequence do not necessarily result in a change in the functionality of the primers. In particular, extensions or truncations of the sequence of the oligonucleotides according to the invention by a few nucleotides, preferably by at most five nucleotides, more preferably by at most three nucleotides, most preferably by at most one nucleotide, can lead to molecules which are equally suitable for the method according to the invention. This relates in particular to extensions at the 5 'end of the oligonucleotide. In addition, it is clear to the person skilled in the art that even individual nucleotide exchanges do not impair the amplification capability of the primers. Such variants, in which one or two nucleotides are exchanged at such sites that they still hybridize sufficiently, can therefore also be used according to the invention. Therefore, the use of said variants in the method of the invention is encompassed by the present invention. For all oligonucleotides disclosed in this application, it is also possible to use variants in the sense defined above.

 The staining of one zone in the first two samples at the corresponding DNA length demonstrates the amplification of the DNA in these samples and the non-staining of the DNA in the other samples demonstrates a non-amplification and thus a specificity of the two primers for H. resinae. The negative control (C) was carried out with water instead of DNS. In this sample no amplification was expected and also not detected. M represents the standard of mass to verify the amplified DNA lengths. The staining present in all samples in the lower part of the gel is due to the primers used (lower mass than that of the amplicons), which is contained in all samples.

The sequences of the primers generally proposed herein for the determination of the DNA concentration of fungi, ie those primers which flank a target sequence common to all fungi studied, resulted from the identification of a gene segment (a nucleotide sequence) common to all the fungi listed above is identical. The identified sequence is located on the 28S ribosomal RNA gene. Other such sequences are expected for other conserved gene segments, such as actin or chromatin coding regions. The corresponding primer was designated NL1F / LS2R. This conserved region was chosen to ensure that the DNA sequence in all fungi is identical, yet significantly different from bacteria and other eukaryotes. This task is made easier by the fact that naturally not all eukaryotes are found in such an extreme habitat as in liquid hydrocarbons. Thus, even if homologous sequences were found in additional taxa, they did not necessarily cause false-positive PCR results since the taxa in question do not necessarily live in and from fuel.

 It should be noted that the primers for detection of fungal contamination generally correspond to a sequence found in all fungi which may be different in amplified DNA sequences in their DNA sequence, but should not differ significantly in length from each other in different species or strains. Variations in the length and sequence of the amplified target sequences cause a variation in the melting temperature of the double-stranded amplificate. The melting point of the amplificate is used as an independent control criterion of the quality of the qPCR, but is assigned to a temperature range and no specific temperature. It can thus be determined whether a PCR product amplified with the respective primers is generally to be assigned to fungi, or whether a false amplification has occurred. The different profiles of the melting curves of the amplification products are due to the different GC% content and the sequence differences of the various DNA sequences.

 The DNA sequence of this "commonly fungal-specific" primer is complementary to fungi in general. This means that with the primers NL1F and LS2R in a sample containing bacteria, fungi and other organisms, specifically a qualitative detection of the presence of fungi can be performed and on the level of contamination (quantitative detection) (or germ count) can be inferred. In such extreme habitats as, for example, fuels, a test kit based on the use of these primers is also suitable for the (nonspecific) detection of H. resinae, in particular for rapid detection of H. resinae, since this fungus is commonly known in practical terms is or is at least associated with a pest.

 Another nucleotide sequence generally suitable for the synthesis of primers for determining a concentration of bacteria was found on the 16S gene of the small subunit of ribosomal RNA. The sequences were determined according to the NCBI database, compared with each other by means of CLC Workbench and suitable primers were determined with the "Primer Express" software. The appropriate primer (338F / 518R) was aligned with available bacterial genomes to ensure the presence of the desired general specificity "for bacteria in general". It was found that the designated sequence provides consistent results for the strains available.

• – Dermatococcus sp.;
• – Pseudomonas aeruginosa;
• – Bukholderia sp.;
• – Cupriavidus sp.

Bacterial cultures isolated from diesel samples used to test the specificity of the primers (338F / 518R) based on analysis of the 16S rRNA gene are:

• - Dermatococcus sp .;
• - Pseudomonas aeruginosa;
• - Bukholderia sp .;
• - Cupriavidus sp.

In 2 calibration curves are shown, from which the DNA concentration in the sample can be calculated using the qPCR results. From the emitted fluorescence, the absolute DNA concentration of the sample (H. resinae, fungi, bacteria) can be determined, since the PCR was in each case based on 10 μg of DNA and the concentration of DNA in the sediment, which originates from a 10 ml aliquot , is known. The determined amount can then be set in relation to the total DNA in order to calculate the proportion of the organisms to be determined. The total concentration of the sample (H. resinae, fungi, bacteria) is thus calculated from the amount of fuel subjected to an analysis. It should be noted that not the fluorescence intensity is determined, but the so-called ct value, ie the value at which the fluorescence intensity during the PCR goes into the exponential phase.

The calibration curves shown refer to 2 (a) the determination of the DNA concentration of H. resinae in a sample for the primers Hr556F / Hr814R and in 2 B) Determination of the DNA concentration of H. resinae in a sample for the primers Hr101F / Hr408R (b).

In the 3 The sequences shown illustrate the identical DNA sequence of the primers with the H. resinae DNA and at the same time the distinction made by framing to others Example fungi (A. niger and M. deflexum). The specificity of the primers becomes clear since, for example, M. deflexum has only 3 or 5 nucleotides difference in the ITS primer and no DNA amplification under the given PCR conditions is possible. In addition, it becomes clear that a variation in the sequence in terms of length and starting point is possible. Minor changes in the nucleotide sequence do not necessarily result in a change in the functionality of the primers. Variants in which one or two nucleotides are exchanged at such sites that they still hybridize sufficiently can therefore also be used according to the invention. Extensions or truncations of the sequence of the oligonucleotides according to the invention by a few nucleotides, preferably by at most five nucleotides, more preferably by at most three nucleotides, most preferably by at most one nucleotide, can lead to molecules which are equally suitable for the method according to the invention. This relates in particular to extensions at the 5 'end of the oligonucleotide. Variants in the sense defined above can also be used for all oligonucleotides disclosed in this application and are thus part of this application, for which protection is likewise claimed.

Illustrated in this sense 3 primarily the high specificity of the primers developed here. On the other hand, the example of the 3 but also a possible tolerance of the qPCR described for certain minor substitutions of individual bases of the primer serving oligonucleotides be explained. The person skilled in the art will determine quickly and with little effort whether an exchange of one or the other base of one of the primers described here, preferably in a central region of the primer, interferes with the hybridization. As described, a minor extension (eg, by five nucleotides), especially at the 5 'end of the primer, is not critical.

 The correct sequence of the amplification of the specific PCR sequences is checked after the reaction by a melting test. The heating of a double-stranded DNA results in a change in the fluorescence that is measured, depending on the length and the nucleotide composition. The temperature-dependent fluorescence curve or the resulting melting curve is specific for the respective primer / DNA and can thus be used for quality control of the amplificate (the correct sequence of the amplification of the specific PCR sequence). Both the temperature maximum (that is, the temperature at which most DNA strands become single-stranded) and the curve are a decisive control criterion.

In 4 in each case a melting curve of the Amplifikates obtained with different primer pairs for the detection of H. resinae is shown. In particular shows 4 left (a) the melting curve of the amplicons according to qPCR of the H. resinae specific primer Hr556F / Hr814R and right (b) the melting curve of the amplicons according to qPCR with the H. resinae specific primers Hr101F / Hr408R. Here, the specific melting temperature for the amplificate for the primer Hr556F / Hr814R is 81.5 ° C and for the amplificate for the primer Hr101F / Hr408R at 81.5 ° C and 85.5 ° C.

• – Anreichern eines Feststoff-Anteils aus der Flüssigkeit, z.B. aus einer Probe des flüssigen Kohlenwasserstoffs (Kraftstoff-Probe) oder aus einer anderen, eine Kohlenstoffquelle gelöst oder dispergiert enthaltenden Flüssigkeit;
• – Extrahieren von DNS aus dem angereicherten Feststoff-Anteil;
• – Durchführen von qPCR für spezifische DNS-Fragmente in der extrahierten DNS;
• – Messen eines Fluoreszenzsignals während oder nach der qPCR;
• – Korrelieren einer Intensität des gemessenen Fluoreszenzsignals mit einer Anzahl Zellen eines oder mehrerer Taxa, welches oder welche durch die spezifischen DNS-Fragmente repräsentiert sind;
• – Bestimmen eines Kontaminationsgrades der Kraftstoffprobe.
• – Optional kann ein Konzipieren und/oder Durchführen einer Behandlung des flüssigen Kraftstoffs anschließen. Dabei kann das Konzipieren ein Wählen zwischen Verwerfen des flüssigen Kohlenwasserstoffs (beispielsweise durch Verbrennen) und Behandeln des flüssigen Kohlenwasserstoffs (beispielsweise durch Zusatz eines Biozids) umfassen. Der Schritt Konzipieren kann dabei auf einem Abschätzen eines Kontaminationsgrades des Kraftstoffs an Hand der Analysenergebnisse der Kraftstoffprobe basieren.

According to the described embodiments, the proposed analytical method comprises quantitatively detecting the contamination of a liquid comprising a carbon source, in particular a liquid organic compound, for example a hydrocarbon (or a fuel) at room temperature, by the following steps:

• - enriching a solid portion of the liquid, eg from a sample of the liquid hydrocarbon (fuel sample) or from another, a carbon source dissolved or dispersed containing liquid;
• - Extracting DNA from the enriched solids content;
• Performing qPCR on specific DNA fragments in the extracted DNA;
• Measuring a fluorescence signal during or after the qPCR;
• Correlating an intensity of the measured fluorescence signal with a number of cells of one or more taxa, which are represented by the specific DNA fragments;
• - Determining a degree of contamination of the fuel sample.
• Optionally, it may be followed by designing and / or performing a treatment of the liquid fuel. The design may include selecting between discarding the liquid hydrocarbon (for example by burning) and treating the liquid hydrocarbon (for example by adding a biocide). The designing step may be based on estimating a degree of contamination of the fuel based on the analysis results of the fuel sample.

In this context, a carbon source, as is customary in microbiology, is understood as meaning a compound which contains carbon in the form of a carbon compound. Such carbon compounds typically have a covalent CC bond. The carbon source can be used as a substrate for the growth of Hormoconis resinae, fungi, bacteria, and other microorganisms discussed here.

 In order to assess the degree of contamination, the number of cells of the particular taxon per unit volume of the sample liquid is typically determined. In this context, a taxon or (multiple) taxa is understood as meaning a microorganism or a group of microorganisms. For example, a taxon may have a taxonomic unit, e.g. a bacterial strain, a fungal species, a fungus strain, e.g. be a yeast or a yeast strain. But of practical importance is also the proof of a totality of different fungi or different bacteria or their socialization with each other. It can be approximately assumed that a DNA amount in the picogram range is due to the presence of a cell. A DNA amount in the nanogram range therefore corresponds to a cell count of at least 100 to one thousand cells.

 The results can be used to determine, firstly, whether there is bacterial or fungal contamination, second, DNA quantification (DNA as biomass equivalent), and, thirdly, how much can be determined, for example in the case of a fuel sample the proportion of H. resinae is.

• – Erstens: Pilz oder/und Bakterienkontamination.
• – Zweitens: Qualifikation der Kontamination auf Ebene der DNS (Biomasseäquivalent) und
• – Drittens (Im Falle der Untersuchung eines Kraftstoffs): Qualifikation des Anteils von H. resinae an der Gesamtpilzkontamination.

Overall, the proposed method allows a differentiated quantification of microbial contamination:

• - First: fungus and / or bacterial contamination.
• - Secondly: qualification of contamination at the level of DNA (biomass equivalent) and
• - Thirdly (in the case of a fuel test): Qualification of the share of H. resinae in total fungal contamination.

 Advantageously, the proposed quantifying detection method is both sensitive and selective. For the individual microorganisms, the detection limit is in the pg range. This corresponds approximately to the DNA amount of 100 fungal and 1000 bacteria cells, respectively. On the other hand, the proposed detection method provides an overview of the nature or composition of the mixed contamination typically present under practical conditions. Currently known test systems are either nonspecific or not sensitive enough to ensure early detection of fungal contamination. In addition, culturing-based test systems are always time-consuming, since the sample must be incubated on a special nutrient medium in order to count out colonies (colony-forming units). Furthermore, it can be distinguished with the aid of the proposed method between a bacterial or a fungal infection of the sample liquid. Such a distinction opens up possibilities for more effective control of the present contamination, since the efficacy of a biocide against bacteria may differ from that of fungi.

 The present invention has been explained with reference to exemplary embodiments. These embodiments should by no means be construed as limiting the present invention. The following claims are a first, non-binding attempt to broadly define the invention.

References:

• Bates ST, Garcia-Pichel F (2009). A culture-independent study of free-living fungi in biological soil crusts of the Colorado Plateau: their diversity and relative contribution to microbial biomass. Environ Microbiol 11: 56-67 ,
• Fierer N, Jackson JA, Vilgalys R, Jackson RB (2005). Quantitative PCR assays structure by use of taxon-specific assessment of soil microbial community. Appl Environ Microbiol 71: 4117-4120 ,
• Gaylarde CC, Bento FM, Kelley J (1999). Microbial contamination of stored hydrocarbon fuels and its control. Mini-review. Rev Microbiol 30: 01-10 ,
• Raikos V, Vamvakas SS, Kapolos J, Koliadima A, Karaiskakis G (2011). Identification and characterization of microbial contaminants isolated from stored aviation fuels by DNA sequencing and restriction fragment length analysis of a PCR-amplified region of the 16S rRNA gene. Fuel 90: 695-700 ,
• Smoke ME, Graef HD, Rozenhauk SM, Jones SE, Bleckmann CA, Kruger RL, Naik RR, Stone MO (2006). Characterization of microbial contamination in United States Air force aviation fuel tanks. J Ind Microbiol Biotechnol 33: 29-36 ,
• Seeds KA, Hughes SJ, Boulay H, Louis Seize G (2007). Taxonomy, nomenclature and phylogeny of three cladosporium -like hyphomycetes, Sorocybe resinae, Seifertia azalea and the Hormoconis anamorph of Amorphotheca resinae. Stud Mycol 58: 235-245 ,
• Sheridan JE, Tan YL, Nelson J (1972). Studies on the 'Kerosene Fungus' Cladosporium resinae (Lindau) De Vries - Part III. Morphology, Taxonomy and Physiology. Tuatara 19: 130-165 ,

QUOTES INCLUDE IN THE DESCRIPTION

This list of the documents listed by the applicant has been generated automatically and is included solely for the better information of the reader. The list is not part of the German patent or utility model application. The DPMA assumes no liability for any errors or omissions.

Cited non-patent literature

• Gaylarde et al. 1999, Rauch et al. 2006, Raikos et al. 2011 [0044]
• Seiffert et al. 2007; Sheridan et al. 1972 [0044]
• Rauch et al. 2006, Raikos et al. 2011 [0044]

Claims (18)

A primer pair for quantitatively detecting contamination of a liquid comprising an organic compound by a microorganism comprising a nucleotide sequence selected from:

A primer pair according to claim 1 wherein the primer pair comprising a nucleotide sequence selected from:

is specific for the detection of a fungus.  Primer pair according to protection claim 2, wherein the fungus is selected from: - Hormoconis resinae; - Myxotrichum deflexum; - Myxotrichum cancellatum; - Oidiodendron chlamydosporicum; - Oidiodendron setiferum; - Aspergillus versicolor; - Aspergillus niger; - Penicillium citrinum; - Penicillium funiculosum; - Penicillium brevicompactum; - Cladosporium sphaerospermum; - Cladosporium herbarum; - Alternaria alternata; - Chaetomium globosum; - Paecilomyces variotii; - Phoma violacea; - Trichoderma virens; - Ulocladium atrum; - Fusarium solani; - Candida lipolytica; - Rhodotorula mucilaginosa. A primer pair according to claim 1, wherein at least one primer pair comprising a nucleotide sequence selected from:

is specific for the detection of the microorganism Hormoconis resinae. A primer pair according to claim 1, wherein at least one primer pair comprising at least one nucleotide sequence is selected from:

is specific for the detection of a bacterium and / or a bacterial strain.  A primer pair according to any one of claims 1, 2, 4 or 5, wherein the nucleotide sequence of the primer pair comprises at least 80% to 85% of the indicated nucleotide sequence.  A primer pair according to any one of the preceding claims, wherein the nucleotide sequence is extendable in a qPCR in synchrony with annealing.  Primer pair according to one of the preceding claims, wherein the nucleotide sequences are attachable and extendable in a PCR at identical temperatures.  Primer pair according to one of the preceding claims, wherein the liquid is selected from: a fuel, a diesel fuel, a paint, a paint, an intermediate of the chemical or petrochemical industry, a coolant, a lubricant, a milk, a whey, a juice, a liquid at room temperature intermediate chemical industry, food technology, pharmaceutical Industry or the cosmetics industry. A test kit comprising an oligonucleotide sequence as a primer for detecting colonization of a fluid comprising an organic compound by Hormoconis resinae using a polymerase chain reaction-based assay, wherein the oligonucleotide sequence is selected from:

 Test kit according to claim 10, wherein at least one of said oligonucleotide sequences is modified by at least one adenine base by a thymine base or a guanine base, or a thymine base by an adenine base or a cytosine base, or a Guanine base is replaced by a cytosine base or a cytosine base by a guanine base.  Test kit according to claim 11, wherein a replacement of an adenine base by a thymine base, a thymine base by an adenine base, a guanine base by a cytosine base or a cytosine base by a guanine base in a middle Section of the oligonucleotide sequence is carried out, wherein the middle section is at least three, preferably 5 nucleotide bases away from one end of the oligonucleotide.  Test kit according to one of the claims 10 to 12, wherein at least one of said oligonucleotide sequences is extended or shortened by five nucleotides, by at most three nucleotides, or by at most one nucleotide, wherein in case of extension, this extension preferably at the 5 'end of the oligonucleotide sequence is present. A primer for detecting microbial contamination of an organic compound by polymerase chain reaction in a buffer solution comprising fluorescent dye-labeled nucleotides, said primer being selected for detection of microbial contamination under a) a Hormoconis resinae-specific primer comprising an oligonucleotide selected from:

b) a fungal-specific primer comprising an oligonucleotide selected from:

c) a bacterial-specific primer comprising an oligonucleotide selected from:

 A primer according to claim 14, wherein at least one of the indicated oligonucleotides is shortened or extended at the 3 'end and / or at the 5' end by five nucleotides, by at most three nucleotides, or by at most one nucleotide, wherein in the case of an extension an extension is preferred 5 'end of the oligonucleotide is present.  Primer according to protection claim 14 or 15, wherein the primers are specific for Hormoconis resinae, wherein - primers F1 and R1 specifically hybridize to a portion of a gene for a second largest subunit of an RNA polymerase II (RPB2); - hybridize the primers F2 and R2 specifically with a portion of an internally transcribed spacer gene (ITS).  Primer according to protection claim 14 or 15, wherein the primers are specific for fungi, wherein - Primers F3 and R3 specifically hybridize to a portion of a large subunit of a 28S rRNA gene (28S).  Primer according to protection claim 14 or 15, wherein the primers are specific for bacteria, wherein - hybridize primers F4 and R4 specifically with a portion of a gene of a small subunit of a 16S rRNA gene (16S).

Images