Conservation of Madagascar&#39;s granite outcrop orchids: the influence of fire and moisture

Melissa Whitman

Three new species of the Andean genus Myrosmodes are described: Myrosmodes cleefi Szlach., Mytnik and S. Nowak, Myrosmodes reticulata Szlach., Mytnik and S. Nowak, and Myrosmodes subnivalis Szlach., Mytnik and S. Nowak. The former two species are known from a single population each, from Columbia, and the latter from Columbia and Ecuador. Each species is described and illustrated, and detailed habitat and distribution data are provided. A distribution map of the new species and the distribution range of the genus is presented. A dichotomous key for determination of the Andean species and Myrosmodes is provided. Conservation status assessments are provided for each species; current International Union for Conservation of Nature (IUCN) red list categories and criteria are listed. A brief discussion of endemism in the Andes and Tropical Andes biodiversity hotspot is presented.

Se describe una nueva especie de Aa del norte del Perú: Aa aurantiaca; la cual tiene las flores de color naranja, siendo éste un color inusual para el género. Se proponen además dos nuevas combinaciones de Myrosmodes: M. inaequalis y M. gymnandra; se presentan ilustraciones y se discuten rasgos diagnósticos de las nuevas especies.

Se presenta una revisión de Myrosmodes del Perú. Se aceptan siete especies para el país. Se describe e ilustra cada especie con base en la revisión del material tipo, protólogos y material peruano. Se evalúa su distribución en el país. Myrosmodes nervosa se registra por primera vez para el Perú. Se proponen nuevos sinónimos: M. cleefii es incluido bajo la sinonimia de M. nubigena, M. inaequalis y M. pumilio bajo M. paludosa, M. weberbaueri bajo M. gymnandra y M. cochlearis bajo M. rhynchocarpa. También se proporciona una clave para identificar las especies reconocidas. Se designa un lectotipo para Aa chiogena.

ISSN 1409-3871 VOL. 11, No. 1 APRIL 2011 New species of Aa and new combinations in Myrosmodes (Orchidaceae: Cranichidinae) from Bolivia and Peru Delsy Trujillo and Carlos a. Vargas 1 Two new species of Teagueia (Orchidaceae: Pleurothallidinae) from East-Central Ecuador lou josT and anDerson sheparD 9 The root colonizing fungi of the terrestrial orchid Cypripedium irapeanum María ValDés, héCTor BauTisTa guerrero, laura MarTínez and rafael h. Víquez 15 Population structure of Oncidium poikilostalix (Orchidaceae), in coffee plantations in Soconusco, Chiapas, México alfreDo garCía-gonzález, anne DaMon, ligia g. esparza olguín and jaVier Valle-Mora 21 Aa from lomas formations. A new Orchidaceae record from the desert coast of Peru Delsy Trujillo and aMalia DelgaDo roDríguez 33 Anatomía foliar de ocho especies de orquídeas epíitas rafael aréValo, juana figueroa & sanTiago MaDriñán 39 Conservation of Madagascar’s granite outcrop orchids: the inluence of ire and moisture Melissa WhiTMan, MiChael MeDler, jean jaCques ranDriaManinDry & elisaBeTh raBakonanDrianina 55 Orchid genera lectotypess peggy alriCh & Wesley higgins 69 I N T E R N AT I O N A L J O U R N A L O N O R C H I D O L O G Y lankesteriana InternatIonal Journal on orchIdology Copyright © 2011 Lankester Botanical Garden, University of Costa Rica Effective publication date: April 28, 2011 Layout: Jardín Botánico Lankester. Cover: Aa aurantiaca D. Trujillo. Photograph by D. Trujillo. Printer: Palabra de Dios S.A. Printed copies: 500 Printed in Costa Rica / Impreso en Costa Rica R Lankesteriana / International Journal on Orchidology No. 1 (2001)-- . -- San José, Costa Rica: Editorial Universidad de Costa Rica, 2001-v. ISSN-1409-3871 1. Botánica - Publicaciones periódicas, 2. Publicaciones periódicas costarricenses LANKESTERIANA 11(1): 1—8. 2011. NEw SPECiES Of AA ANd NEw COMBiNATiONS iN MyrOsMOdes (OrChidACEAE: CrANiChidiNAE) frOM BOliviA ANd PEru Delsy Trujillo1,3 & Carlos a. Vargas2 1 Museo de Historia Natural, Universidad Ricardo Palma, Av. Benavides 5440, Lima 33, Perú 2 AECOM, Montréal, Canada 3 Corresponding author: delsytrujillo@gmail.com aBsTraCT. A new species of Aa from northern Peru is described: Aa aurantiaca, which has highly atypical orange lowers for the genus. Furthermore, two new combinations of Myrosmodes are proposed: M. inaequalis and M. gymnandra, with illustrations and diagnostic features of the new species. resuMen. Se describe una nueva especie de Aa del norte del Perú: Aa aurantiaca; la cual tiene las lores de color naranja, siendo éste un color inusual para el género. Se proponen además dos nuevas combinaciones de Myrosmodes: M. inaequalis y M. gymnandra; se presentan ilustraciones y se discuten rasgos diagnósticos de las nuevas especies. key WorDs. : Orchidaceae, Cranichideae, Peru, Bolivia, Aa, Myrosmodes The genera Aa Rchb.f. and Myrosmodes Rchb.f. consist of terrestrial orchids possessing tiny, white to greenish-white, non-resupinate lowers. Although there are some records of Aa paleacea (Kunth) Rchb.f. in the mountains of Costa Rica (Dressler 1993), the species of Aa and Myrosmodes are mostly restricted to the South American Andean mountain range at high elevations. The taxonomic status of the representatives of these genera has remained unclear for many years. The genera Aa and Myrosmodes were irst described by Reichenbach ilius in 1854. He distinguished Aa from Altensteinia Kunth and transferred Altensteinia paleacea (Kunth) Kunth to Aa [Aa paleacea (Kunth) Rchb.f.]. However, in a subsequent work Reichenbach (1878) reassessed his criteria and placed both Aa and Myrosmodes as synonyms of Altensteinia, and described nine new species, among them Altensteinia gymnandra Rchb.f. and Altensteinia inaequalis Rchb.f.. Later, Schlechter (1912, 1920a, 1920b) distinguished Aa from Altensteinia again but considered Myrosmodes as a synonym of Aa and combined it with that genus (e.g., Aa gymnandra (Rchb.f.) Schltr., Aa inaequalis (Rchb.f.) Schltr.). Subsequent taxonomists, for instance Schweinfurth (1958), recognized only Altensteinia as a valid genus and considered the other two genera as synonyms. Garay (1978), as part of his work in Flora of Ecuador, revalidated the genera Aa and Myrosmodes and transferred some species of Aa and Altensteinia to Myrosmodes. Since then, the three genera have been widely accepted as distinct taxa. Further revision of Myrosmodes in Peru and Colombia led to the transfer of more species to this genus (Vargas 1995, Ortiz 1995, respectively). Up to the point of this publication, Myrosmodes comprised about 10 species. Morphologically, Altensteinia is distinguished from Aa and Myrosmodes by having a terminal inlorescence, pubescent column, lobulate clinandrium, small stigma and anthesis occurring after the full development of leaves (Garay 1978). Conversely, Aa and Myrosmodes possess a lateral inlorescence and glabrous column, and anthesis occurs before the full development of leaves. Aa has an elongate peduncle enveloped by tubular hyaline-diaphanous sheaths, with dorsal sepal and petals free from the column, lip calceolate with involute and lacerate margins, and in many species, a pilose ovary. Myrosmodes has at least 6 morphological and ecological characters that distinguish this genus from Aa and Altensteinia and the rest of Prescottiinae: (1) a short peduncle with infundibuliform, scarious sheaths, (2) a cucullate lip that is tubular or lared, with imbriolate margins with moniliforms hairs (Garay 1978, Vargas 1997), (3) an accrescent peduncle (after 2 LANKESTERIANA figure 1. Aa aurantiaca D. Trujillo. A — Habit, plant without spike (left) and inlorescence (right). B — Flower, ventral and dorsal view. C — Lip, lateral view. D — Lip, ventral view. E — Lip, split. F — Dissected perianth. G — Floral bract. H — Column, lateral, dorsal and ventral view. Drawing by D. Trujillo based on Trujillo 212. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. Trujillo & Vargas — New Species and Combinations in Aa and Myrosmodes 3 anthesis, the inlorescence peduncle elongates twice or more its original size, evident even in herbarium specimens), (4) basipetal loral development (with lowers growing from the inlorescence apex to its base), (5) andromonoecious inlorescence (with male lowers distinctly smaller (up to 300%) than hermaphrodite lower (Berry & Calvo 1991, Vargas 1997, and Trujillo pers. obs.), and (6) growing between 3300 to almost 5000 m.a.s.l and mostly in wet puna/paramo highandean bogs from Venezuela to Argentina/Chile (world’s record by Myrosmodes pumilio (Schltr.) C. Vargas, observed in Peruvian Andes and in bogs from Chile, Novoa, Vargas & Cisternas, in prep.). Although a recent DNA study indicates that Myrosmodes may be embedded within Aa and that the recognition of the genus Myrosmodes is tenuous (Álvarez-Molina & Cameron 2009), the morphological and ecological evidence still supports its separation from Aa. Still, we are a long way from knowing all the species that constitutes the genera Aa and Myrosmodes. A careful examination of the loral features is necessary for the proper identiication of the specimens, and this is only possible by dissecting the lowers under a stereomicroscope. For example, in most of the original descriptions and illustrations of Myrosmodes (as Aa or Altensteinia) the authors did not indicate or show the features of the column, mainly the anther (Reichenbach 1854, 1878, Schlechter 1912, 1920a, 1920b, Mansfeld 1929). The knowledge of these features in the other Myrosmodes species is required in order to have a clearer delimitation of the species that compose this genus. Based on revisions of the type material from the Reichenbach Herbarium (W) as part of the identiication of a new species of Aa from northern Peru, it has become evident that the following new combinations in Myrosmodes are necessary. They were also mentioned by Vargas in his work in Cranichideae and Prescottiinae (unpublished thesis 1997). Aa aurantiaca D. Trujillo, sp. nov. TYPE: Peru. Dept. La Libertad: Prov. Santiago de Chuco, Quirovilca, Yanivilca, 3509 m, 22 May 2005, D. Trujillo 212 (holotype, HURP; isotypes, HAO, SEL, M) (fig. 1, 2). figure 2. Inlorescence of Aa aurantiaca. Photograph by D. Trujillo. Differt ab simili Aa rosea Ames lore aurantiaco, sepalis dorsaliter pilosis, petalis trinervatis ovatolanceolatis et foramine labelli angustiore. Plant small, terrestrial. Roots leshy, fasciculate, pubescent. Leaves withered at lowering time. Inlorescence slender, erect, up 30 cm long, enclosed by up to 23 diaphanous sheaths, terminated in a densely many lowered cylindrical spike 2.2-5.0 cm long, rachis of the spike sparsely pilose. Floral bracts ovate, acute to obtuse, margins slightly erose, relexed, 4-5 x 4 mm, somewhat surpassing the lowers. Flowers non-resupinate, orange to reddish orange. Dorsal sepal oblong to ovate, obtuse, dorsally hairy, 1-nerved, relexed, 2.0 x 1.3-1.5 mm. Lateral sepals shortly connate at the base, obliquely oblong-lanceolate, obtuse, dorsally hairy, somewhat carinate, 1-nerved, 3.0 x 1.5 mm. Petals obliquely ovate lanceolate, obtuse, 3-nerved, relexed, up to 2.3 x 1.1 mm. Lip LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 4 LANKESTERIANA figure 3. Single herbarium sheet at W-R bearing specimens of Myrosmodes gymnandra (Rchb.f.) C. Vargas composed of a mixed collection. A — Specimen Wilkes s.n. B — Specimens without collector information. C — Specimen Mandon s.n. (holotype). LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. Trujillo & Vargas — New Species and Combinations in Aa and Myrosmodes calceolate (semiglobose), transversely elliptic, leshy (except the margins), obscurely 3-lobed, with a narrow opening, the involute margins lacerate, base with two spherical calli, 2.0 x 2.5 mm (natural position). Column short, with an emarginate transverse rostellum, dilated above, 1.5 mm long, straight in young lowers and bent in old lowers. Anther erect, lateral margins lightly covered by the clinandrium. Stigma quadrate in young lowers and transversely elongate in old lowers. Ovary sessile, subcylindric, hairy, 2 mm long. eTyMology: From Latin aurantiacus, referring to the orange color of the lowers. DisTriBuTion: Known only from the Department of La Libertad, Peru, between 3500 and 4000 m elevation. phenology: Flowering plants have been recorded between May and August. haBiTaT anD eCology: Plants of this species grow on grassy hillsides. Some populations grow sympatrically with other Aa species with white lowers; whose sepals and petals have light-green tones when young turning into light-cream to cream-brown when older (but never orange). Besides lower color, this Aa species can be distinguished from Aa aurantiaca by its wide opening lip, glabrous sepals and ovary, and acuminate loral bracts which notoriously surpass the lower (50% larger). Aa aurantiaca is similar to Aa rosei Ames, but it can be distinguished by the orange lowers, dorsally hairy sepals, ovate-lanceolate, 3-nerved petals, and narrower opening of the lip. Myrosmodes gymnandra (Rchb.f.) C. Vargas, comb. nov. Basionym: Altensteinia gymnandra Rchb.f., Xenia Orch. 3: 18. 1878. TYPE: Bolivia. Prov. Larecaja, Mandon s.n. (holotype: W) (Fig. 3, 4). Aa gymnandra (Rchb.f.) Schltr., Rep. Spec. Nov. Regni Veg.11: 150. 1912. Myrosmodes gymnandra belongs to the subgenus Myrosmodes, i.e. it does not have a rostrate ovary (Vargas 1995). The inlorescence is 13 cm long. The dorsal sepal is oblong, obtuse, 4.4 x 2.0 mm. The lateral sepals are oblong, concave, obtuse, somewhat carinate, 6.0 x 2.6 mm. The petals are linear, subacute, with upper margin erose, 4.5 x 0.6 mm. The lip is obovate, subquadrate, 5 involute, trilobate, middle lobe subquadrate, margin apical with moniliform hairs, two calli at the base, 4.5 x 3.6 mm. The column is erect, and 3 mm long. The anther exceeds the apex of the stigma, with a free ilament, 1.1 mm long. The rostellum is triangular and obtuse. The ovary is ellipsoid, 3.5 mm long. The loral bracts are subcircular to obovate, 11.0 x 10.2 mm. In the protologue of the description of A. gymnandra, Reichenbach indicates that the specimen used to describe the species was Mandon s.n. Bolivia, Provincia Larecaja, without referring to a speciic locality. However, in the Reichenbach Herbarium in Vienna (W), there was no specimen of A. gymnandra bearing the characteristic printed label of G. Mandon (as most of Mandon´s herbarium specimens). There is a herbarium sheet that contains the lower illustration as well as notes from Reichenbach with the description of A. gymnandra and a mix of two specimens (Fig. 3). One specimen is mounted on the herbarium sheet, which could be Mandon´s specimen (holotype) and the other is in an envelope (top left of the herbarium sheet), that corresponds to Wilkes s.n., collected in Peru between Culnai and Obrajillo. The illustration showed here is based on the lower from the smallest envelope (middle) of the herbarium sheet (Fig. 3B), but it is not possible to precisely identify the specimen to which it belongs. In the original description of A. gymnandra, Reichenbach (1878) did not mention two important features: the anther exceeds the apex of the stigma and the anther’s ilament is free (Fig. 4D). In Reichenbach’s illustrations the free ilament is also evident but the anther appears smaller (Fig. 3C). The free ilament has been described as a distinct feature for Myrosmodes ilamentosum (Mansf.) Garay. Even though M. gymnandra has some loral features similar to M. ilamentosum, they can be distinguished because the latter has larger lowers, a short ovary neck and a slightly trilobate lip (Garay 1978). Myrosmodes inaequalis (Rchb.f.) C. Vargas, comb. nov. Basionym: Altensteinia inaequalis Rchb.f., Xenia Orch. 3: 19. 1878. TYPE: Peru. Dept. Puno: Macusani in puna brava, June 1854, Lechler 1950 (holotype: W, isotype: W, G, AMES, K.). (Fig. 5) Aa inaequalis (Rchb.f.) Schltr., Rep. Spec. Nov. Regni Veg. 11: 150. 1912. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 6 LANKESTERIANA figure 4. Myrosmodes gymnandra (Rchb.f.) C. Vargas. A — Flower. B — Dissected perianth. C — Lip, left natural, right expanded out. D — Column, dorsal and ventral view. E — Floral bract. Drawing by D. Trujillo based on a specimen from Reichenbach Herbarium (W). Myromodes inaequalis belongs to subgenus Myrosmodes (Vargas 1995). The inlorescence is up to 7 cm long. The dorsal sepal is oblong to oblongobovate, obtuse to rounded, concave, 2.3 x 1.2 mm. The lateral sepals are oblong, obtuse, concave, LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. carinate, 2.6 x 1.1 mm. The petals are linear-ligulate, falcate, subacute, with upper margin erose, 2.0 x 0.4 mm. The lip is cucullate, cuneate at base, obovate to elliptic when expanded, entire, margin of upper half with moniliform hairs, two calli at the base, 2.4 x 2.1 Trujillo & Vargas — New Species and Combinations in Aa and Myrosmodes 7 figure 5. Myrosmodes inaequalis (Rchb.f.) C. Vargas. A — Flower. B — Dissected perianth. C — Column and lip. D — Lip. E — Column, dorsal and ventral view. F — Floral bract. Drawing by D. Trujillo based on Lechler 1950 (W). mm. The column is erect, 1.6 mm long. The anther is subcircular and 0.7 mm long. The rostellum is truncate, emarginate, not triangular (as stated by Reichenbach). The ovary is elliptic, cylindrical, 3.5 mm long. The loral bracts are obovate to elliptic, 5 mm long. Myrosmodes inaequalis resembles Myrosmodes paludosa (Rchb.f.) P. Ortiz.; however, they can be distinguished because the latter has a shorter anther, column dilated above, longer spike with more lowers and thicker peduncle which is twice as long as the LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 8 LANKESTERIANA spike (while in M. inaequalis the peduncle is up to three times longer than the spike). aCknoWleDgeMenTs. We thank to the curators of the W for having allowed us access to the type material in the Reichenbach Herbarium, including rehydration of lowers of some of the specimens mentioned here; to the Ministerio de Agricultura of Peru and its Dirección General Forestal y de Fauna Silvestre (DGFFS) for issuing the collection permits under which orchid specimens have been collected (N° 030-2005-INRENA-IFFS-DCB); to the EES Grants for their sponsorship in visiting the W; to Dr. Günter Gerlach for his comments on the paper and to Dr. Philomena Bodensteiner for her help with the Latin diagnosis. liTeraTure CiTeD Álvarez-Molina, A. & K.M. Cameron. 2009. Molecular phylogenetics of Prescottiinae s.l. and their close allies (Orchidaceae, Cranichideae) inferred from plastid and nuclear ribosomal DNA sequences. Amer. J. Bot. 96: 1020–1040. Ames, O. 1922. Aa rosei Ames. Proc. Biol. Soc. Wash. 35: 81. Berry, P.E. & R.N. Calvo. 1991. Pollinator limitation and position dependent fruit set in the high Andean orchid Myrosmodes cochleare (Orchidaceae). Pl. Syst. Evol. 174: 93-101. Dressler, R.L. 1993. Field guide to the orchids of Costa LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. Rica and Panama. Cornell University Press, Ithaca, New York. Garay, L.A. 1978. Orchidaceae. Cypripedioideae Orchidoideae Neottioideae. In: G. Harling & B. Sparre (eds.), Flora of Ecuador, 225(1). University of Goteborg, Stockholm, Sweden. Mansfeld, R. (ed.). 1929. Figuren-Atlas zu den Orchideenloren der südamerikanischen Kordillerenstaaten. Repert. Sp. Nov. Regni Veg. Beih 57. Ortiz, P. 1995. Orquídeas de Colombia. Corporación Capitalina de Orquideologia, Bogota. 2da. Ed. Reichenbach, H.G. 1854. Altensteinia, Aa and Myrosmodes. Xenia Orchid. 1: 17-19. Reichenbach, H.G. 1878. Orchideae Mandonianae. Xenia Orchid. 3: 17-19. Schlechter, R. 1912. Die Orchideen Gattungen Altensteinia HBK, Aa Rchb.f. und Myrosmodes Rchb.f.. Repert Spec. Nov. Regni Veg. 11: 147-150. Schlechter, R. 1920a. Orchidaceae novae et criticae. Repert. Sp. Nov. Regni Veg. 16: 353-358. Schlechter, R. 1920b. Orchidaceae novae et criticae. Repert. Sp. Nov. Regni Veg. 16: 437-450. Schweinfurth, C. 1958. Orchids of Peru. Fieldiana Bot.. 30(1): 1-260. Vargas, C. 1995. New combinations in Myrosmodes Rchb.f. (Orchidaceae) Lindleyana 10: 5-6. Vargas, C. 1997. Phylogenetic analysis of Cranichideae and Prescottiinae (Orchidaceae) with some taxonomic changes in Prescottiinae. M.S. thesis, University of Missouri-St. Luis, St. Louis Missouri, USA. LANKESTERIANA 11(1): 9—14. 2011. TwO NEw SPECiES Of TeAGUeIA (OrChidACEAE: PlEurOThAllidiNAE) frOM EAST-CENTrAl ECuAdOr lou josT1,3 & anDerson sheparD2 1 Via a Runtun, Baños, Tungurahua, Ecuador 2307 N. Wallace Ave, Bozeman, MT 59715 USA 3 Author for correspondence: loujost@gmail.com 2 aBsTraCT. Abstract: Two new species of Teagueia, T. barbeliana and T. puroana, are described and illustrated. Their relationship to other Teagueia, their scientiic importance, and their conservation is discussed. Closest relatives are T. alyssana, T. sancheziae, T. cymbisepala, and T. jostii, and like them, the new species are highelevation (>3100m) endemics of the upper Río Pastaza watershed in the eastern Andes of Ecuador. Teagueia barbeliana differs from its relatives by broad rounded lower parts, lateral sepals connate for half their length, column apex winged. Teagueia puroana differs from relatives by its long-acuminate petals and sepals. resuMen. Se describen e ilustran dos nuevas especies del género Teagueia, T. barbeliana y T. puroana. Se discuten sus ainidades, su importancia para la ciencia, y su conservación. Las especies más cercanamente emparentadas con las nuevas son T. alyssana, T. sancheziae, T. cymbisepala, y T. jostii, que al igual que las nuevas, son endémicas a las alturas (>3100m) de la cuenca alta del Río Pastaza en los Andes Orientales del Ecuador. Teagueia barbeliana se distingue por sus sépalos y pétalos redondos, sus sépalos laterales unidos hasta la mitad de su longitud, y las alas en el ápice de la columna. Teagueia puroana se distingue por sus pétalos y sépalos con colas largas.. key WorDs: Teagueia puroana, Teagueia barbeliana, Ecuador, orchid, new species Prior to the year 2000, Teagueia Luer was known from only three Colombian and three Ecuadorian species, each apparently endemic to very small areas (Luer 1991). In the year 2000, LJ discovered four new species of Teagueia in one square meter of moss at 3100m on a remote mountain in the upper Río Pastaza watershed in the province of Tungurahua in Ecuador, on the rim of the Amazonian basin of South America. Those species were described as T. alyssana Luer & L. Jost, T. sancheziae Luer & L. Jost, T. cymbisepala Luer & L. Jost, and T. jostii Luer (Luer 2000). Further investigation led to the discovery of many more new species on that same mountain and neighboring mountains, all in cloud forest or páramo (alpine grassland) above 2800m (Jost 2004). The total number of new high-elevation morphospecies now known from the upper Río Pastaza watershed is about 28 (including the four formally described species just mentioned, and the two new ones described here). Characteristics of the new species and their relatives. All of the 28 locally endemic high-elevation morphospecies are slender, long-repent plants with loose, successive-lowering inlorescences. The longrepent habit easily distinguishes them from all other Teagueia species. The lowers also differ slightly from the previously-known Ecuadorian species of the genus. Teagueia zeus (Luer & Hirtz) Luer, T. teagueii (Luer) Luer, and T. tentaculata Luer & Hirtz all have a raised callus on the lip just below the column. In addition, the oriice in the center of their lip, which is characteristic of the genus, is long and narrow, extending almost from the callus to the apex of the lip. In the 28 long-repent species, on the other hand, there is no raised callus, and the oriice occupies less than half the midlobe of the lip. Both of the new species described here are easily distinguished from all other described Teagueia species. Teagueia barbeliana is most like T. cymbisepala, but has more rounded lower parts than that species; the lateral sepals in particular are very broad and connate for half their length, each with four veins as opposed to the three or fewer veins of other known species. The lateral lobes of the lip clasp the column just behind the 10 LANKESTERIANA stigma. The three-veined petals and winged column tip are also unusual. Teagueia puroana is most like T. alyssana, but it is immediately distinguished by the long tails on all sepals and petals exclusive of the lip, combined with lateral sepals that are only connate for 1/5 of their length, and lateral lobes of the lip which clasp the column just behind the stigma. Evolution of the Teagueia species of the upper río Pastaza watershed. The similarity of the 28 upper Río Pastaza watershed long-repent morphospecies of Teagueia strongly suggests that they form a monophyletic group. Preliminary results of molecular work on nearly all morphospecies by Mark Whitten, Kurt Neubig, and Lorena Endara (University of Florida- Gainesville), and previous unpublished work on a subset of species by Alec Pridgeon (Kew) and by Erik Rothacker (Ohio State University), conirm this. These morphospecies thus constitute one of the earth’s most remarkable local plant evolutionary radiations, with more species in a much smaller area than better-known recently-evolved plant radiations such as Darwin’s Scalesia Arn. (Asteraceae) on the Galapagos Islands (Tye 2000). The only comparable orchid radiation is the Dendrochilum Blume radiation on Mount Kinabalu, Borneo (Barkman & Simpson 2001). Molecular work by Mark Whitten’s group at UF Gainesville may soon be able to assign a time scale on this Teagueia radiation, which appears to be very young, like many other Andean plant radiations (Hughes & Eastwood 2006, Scherson et al. 2008). distribution patterns of the Teagueia species in the upper río Pastaza watershed. Almost all of these 28 Teagueia morphospecies appear to be restricted to a 30km x 20km block of forest bisected by the steep valley of the Río Pastaza, an important tributary of the Amazon. Extensive botanizing in the páramos and high cloud forests along the Quito-Baeza road and the páramos of Pisayambo (Parque Nacional Los Llanganates) north of the Río Pastaza failed to turn up any of these species. South of the Río Pastaza, we have found only two species on the GuamoteMacas road (70-90 km south of the Río Pastaza) and no species farther south. There are however many unexplored high mountains in the Llanganates range and between the Río Pastaza and the Guamote-Macas LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. road, where additional as-yet-unknown species may be found. The distributions of the 28 morphospecies show strong geographic structure within the upper Río Pastaza watershed. The morphospecies found north of the Río Pastaza are not found south of it, and viceversa, with one possible exception. These patterns are probably not sampling artifacts, as we have intensively examined each of the mountains where these longrepent Teagueia are known to occur. Such strong local distribution patterns are remarkable in light of the dispersal characteristics of orchid seeds. Other orchid genera in the same area show north-south distribution bands which cross the Río Pastaza (LJ pers. obs.) The previously-described members of this group of 28 morphospecies, T. alyssana, T. sancheziae, T. cymbisepala, and T. jostii, were all from a mountain north of the Río Pastaza. The two species described in the present paper are the irst species described from south of the Río Pastaza. They are among the most distinctive of the southern species. habitat and conservation status. Both species described here were discovered at very high elevations on Cerro Candelaria, Tungurahua province, Ecuador. Fourteen other morphospecies of Teagueia were also found on Cerro Candelaria. The two species described here are among the rarest of the Cerro Candelaria Teagueia species; only a few plants of each were found during extensive ieldwork on Cerro Candelaria. Teagueia puroana grows as an epiphyte on low branches and trunks of isolated stunted treelets in the páramo. Teagueia barbeliana grows in moss in open páramo at 3400-3800m. Both species experience hard freezes on most nights. Teagueia barbeliana was later found on a second mountaintop about 18 km west of Cerro Candelaria. Teagueia puroana remains known only from Cerro Candelaria. The extraordinary scientiic importance of this unique evolutionary radiation makes these mountains a global conservation priority. Shortly after their discovery, the irst author and his associates in Ecuador and abroad started a conservation foundation, Fundación EcoMinga, to protect the endemic plants and animals of the upper Río Pastaza watershed. In partnership with the World Land Trust, Fundación EcoMinga has now purchased much of josT & sheparD- Two new species of Teagueia Cerro Candelaria, including habitat for T. puroana and T. barbeliana and the fourteen other Teagueia morphospecies which grow there. These purchases were made possible by donations to the World Land Trust by Puro Coffee, Albertino Abela, and PricewaterhouseCoopers. speCies DesCripTions Teagueia barbeliana L. Jost & A. Shepard, sp. nov. Teagueiae cymbisepalae Luer et Jost similis, sed sepalis petalisque rotundioribus, sepalis lateralibus connatis per 1/2 marginem suas, lobis lateralibus labelli circum columnam. TYPE: Ecuador. Tungurahua: Cerro Candelaria, 1º28’46”S, 78º17’51”W, 3400 m, Nov. 2002, L. Jost 5132 (holotype: QCA!; isotype: QCNE!). Fig. 1. Plant medium in size for the genus, lithophytic or terrestrial, long-repent, the rhizome exceeding 20 cm in length, producing a ramicaul and leaf at every third joint, 7-8 mm between joints; one coarse root emerging at each ramicaul-bearing joint. Ramicauls ascending, stout, 3 mm long, enclosed by 1 or 2 imbricating sheaths. Leaf erect, thickly coriaceous, reticulate-veined, petiolate, elliptical, obtuse, 10-15 mm long, 8-9 mm wide, the base cuneate into the petiole. which is 15-20 mm long. Inlorescence from near the apex of the ramicaul; an erect, successive, distantly several-lowered raceme, 4-6 cm to irst lower, lowers spaced 12 mm apart, up to 7 lowers; one to three lowers open at once; loral bracts oblique, acute, thin, 4 mm long; pedicels 4.4 mm long; ovary 1.8 mm long. Flowers golden yellow suffused orange, with red on veins, the lip with a red stripe down its center; dorsal sepal ovate, 6.4 mm long, 4.2 mm wide, 3-veined; lateral sepals broadly ovate, acuminate, 5.3 mm long, 3.9 mm wide, 3-veined, rudimentary fourth vein, connate for 2.3 mm. Petals ovate, acuminate, 4.1 mm long, 2.8 mm wide, 3-veined. Lip ovate, 3.1 mm long, 2.3 mm wide, the apex truncate, the disc longitudinally cleft, spreading into a deep oriice above the middle, the base with angles embracing the column, curving outward to match the plane of the midlobe of the lip, the base ixed to the column-foot. Column terete, recurved at anther, 1.8 mm long, 1 11 mm wide at stigma, laterally winged at anther, wings conluent with stigma, stigma entire. eTyMology: Albertino Abela of London contributed signiicantly to the conservation of this orchid’s habitat; this species is named in honor of his mother Barbel, at his request. paraTypes: Ecuador. Tungurahua: Cerro Candelaria, 1°28’46”S, 78°17’51”W, Nov. 2003, L. Jost, A. Shepard, S. Grossman, A. Araujo 6197 (QCA!), 6219 (QCA!), 6225 (QCA!), 6227 (QCA!); Cerro Chamana, 1°26’7”S, 78°23’1”W, 3500 m, Dec. 2003, L. Jost et al. 6580 (QCA!). DisTriBuTion: Rare and local from 3400-3800 m on two mountaintops just south of the Río Pastaza near the town of Baños, Tungurahua, Ecuador. Teagueia puroana L. Jost & A. Shepard, sp. nov. Teagueiae alyssanae Luer et Jost similis, sed sepalis petalisque longi-acuminatis, sepalis lateralibus connatis per 1/5 marginem suas, lobis lateralibus labelli circum columnam. Type: Ecuador. Tungurahua: Cerro Candelaria, 1°28’46”S, 78°17’51”W, 3400 m, Nov. 2002, L. Jost 5149 (holotype: QCA!). Fig. 2. Plant small-medium in size for the genus, epiphytic, long-repent, the rhizome exceeding 13 cm long, producing a ramicaul and leaf at every third joint, 0.81.4 cm between joints; one coarse root emerging at each ramicaul-bearing joint. Ramicauls ascending, stout, 4 mm long, enclosed by 1 or 2 imbricating sheaths. Leaf erect, thickly coriaceous, reticulate-veined, petiolate, elliptical, obtuse, 15-20 mm long, 8-9 mm wide, the base cuneate into the petiole 15 mm long. Inlorescence from near the apex of the ramicaul; an erect, successive, distantly several-lowered raceme, 2-4.5 cm to irst lower, the lowers spaced 5-7 mm apart, up to 11 lowers, with only one or two lowers open at once; loral bracts oblique, acute, thin, 4 mm long; pedicels 3.8-4.5 mm long; ovary 1.5 mm long. Flowers dark orange suffused dark reddish apically on all parts; dorsal sepal elliptical-ovate, longacuminate, 7.1 mm long, 3.4 mm wide, 3-veined; lateral sepals obovate, long-acuminate, 7.6 mm long, 2.6 mm wide, 3-veined, connate for 1.4 mm; LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 12 LANKESTERIANA figure 1. Teagueia barbeliana L.Jost & A.Shepard. A — Plant. B — Flower. C — Lateral lower. D — Dissected lower. E — Oblique lip and column detail. F — Top view, column and lip collar. Scale bars: A, 5 cm; B-D, 2 mm; E-F, 1 mm. illusTraTion VouCher: L. Jost 5132 (QCA). Illustration by Lou Jost. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. josT & sheparD- Two new species of Teagueia 13 figure 2. Teagueia puroana L.Jost & A.Shepard. A — Plant. B — Flower. C — Lateral lower. D — Dissected lower. E — Oblique lip and column detail. F — Top view, column and lip collar. Scale bars: A, 4 cm; B-D, 3 mm; E-F, 1 mm. illusTraTion VouCher: L. Jost 5149 (QCA). Illustration by Lou Jost. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 14 LANKESTERIANA petals ovate, long-acuminate, 5.1 mm long, 2 mm wide, 1-veined; lip oblong-ovate, 2.4 mm long, 1.4 mm wide, the apex rounded, the disc longitudinally cleft, spreading into a deep oriice above the middle, the base with rounded microscopically ciliate angles embracing the column, the angles nearly or actually in contact with each other above the column, the base ixed to the column-foot. Column terete, recurved at anther, 1.4 mm long, 0.8 mm wide at stigma; stigma entire. eTyMology: Named in honor of Puro Coffee, UK, which contributed signiicantly to the conservation of this species. paraTypes: Ecuador. Tungurahua: Cerro Candelaria, 3600 m, 1º28’46”S, 78º17’51”W, Nov. 2002, L. Jost 5140 (QCA!), 5141 (QCA!), 5209 (QCA!), 5210 (QCA!), L. Jost, A. Shepard, S. Grossman, A. Araujo 6213 (QCNE!), 6218 (QCA!), 6223 (QCA!). DisTriBuTion: known only from 3600 m on Cerro Candelaria, just south of the Río Pastaza, near the town of Baños, Tungurahua, Ecuador. aCknoWleDgeMenTs. Kurt Neubig, Lorena Endara, Mark Whitten, and two anonymous reviewers gave advice that improved the manuscript. The Ministerio del Ambiente del Ecuador gave permission for this research; permit 12-07 ICFLO- DNBAPVS/MA and previous permits. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. liTeraTure CiTeD Barkman, T.J., & B.B. Simpson. 2001. Origin of HighElevation Dendrochilum Species (Orchidaceae) Endemic to Mount Kinabalu, Sabah, Malaysia. Syst. Bot. 26: 658-669. Hughes, C., & Eastwood, R. 2006. Island Radiation on a continental scale: Exceptional rates of plant diversiication after uplift of the Andes. PNAS, 103:10334-10339. Jost, L. 2004. Explosive Local Radiation of the Genus Teagueia (Orchidaceae) in the Upper Pastaza Watershed of Ecuador. Lyonia 7: 41-47. Luer, C.A. 1991. Icones Pleurothallidinarum VIII, Systematics of Lepanthopsis, Restrepiella, Restrepiopsis, Salpistele & Teagueia. Monogr. Syst. Bot. Missouri Bot. Gard. 64: 105-114. Luer, C.A. 2000. Icones Pleurothallidinarum XX. Systematics of Jostia, Andinia, Barbosella, Barbodria, and Pleurothallis Subgenus Antilla, Subgenus Effusia, Subgenus Restrepioidia (Orchidaceae). Monogr. Syst. Bot. Missouri Bot. Gard. 79:105-114. Scherson, R., Vidal, R., & Sanderson, M. 2008. Phylogeny, biogeography, and rates of diversiication of New World Astragalus (Leguminosae) with an emphasis on South American radiations. Am. J. Bot. 95: 1030-1039. Tye, A. 2000. Las plantas vasculares endemicas de Galapagos. Pages 24-28 in Valencia, R., Pitman, N., Leon-Yanez, S., Jorgensen, P. (Eds.) Libro Rojo de las Plantas endemicas del Ecuador 2000. Herbarium of the Pontiicia Universidad Catolica del Ecuador. Quito. LANKESTERIANA 11(1): 15—21. 2011. ThE rOOT COlONiziNg fuNgi Of ThE TErrESTriAl OrChid CyprIpedIUM IrApeAnUM María ValDés1,2, héCTor BauTisTa guerrero1, laura MarTínez1 & rafael h. Víquez1 1 Escuela Nacional de Ciencias Biológicas, Instituto Politécnico Nacional, Plan de Ayala y Carpio, Colonia Santo Tomás, 11340 México D.F. 2 Author for correspondence: mvaldesr@ipn.mx aBsTraCT. This study investigated the mycorrhizal status and the identiication of the fungi colonizing the roots of the terrestrial orchid Cypripedium irapeanu by restriction fragment length polymorphisms and by rDNA internal transcribed spacer sequencing. The orchid is endemic of differents regions in Mexico, Guatemala and Honduras; usually at 1400-2250 m. It grows mainly in the remaining oak forests of the highlands and it is in the Mexican red list of plants in danger. The oak forests in Mexico are threatened constantly. The microscopic examination of stained root segments of the orchid revealed the presence of fungal structures of both orchidioid fungi (pelotons and coyled hyphae) and dark septate endophytes (DSE) (mielinized hyphae and microsclerotia). Analysis of ITS1-5.8-ITS2 region sequences suggested that mycorrhizal tissue was dominated by Tulasnaceae: Sistotrema sp., Rhizoctonia solani, and Epulorhiza sp. Among the DSE one isolate revealed 100% similarity to Phomopsis sp XJ-05, and another one 99% to the fungal endophyte MUT 885 which are both reported as dark septate endophytes. The putative dark septate endophyte Phomopsis sp XJ-05 was isolated not only from the roots but also from the germinated seeds of C. irapeanum. resuMen. Este estudio investigó el status micorrízico y la identiicación de los hongos que colonizan la raíz de la orquídea terrestre Cypripedium irapeanum por medio de los polimorismos de los fragmentos de la restricción y la secuenciación del espacio tránscrito interno del rDNA. Esta orquídea es endémica de diferentes regiones de México, Guatemala y Honduras localizándose entre los 1400 y 2250 m de altitud. Crece principalmente en los remanentes de los bosques de encino del altiplano y está en la lista roja de México de las plantas amenazadas. Los bosques de encino en este país están constantemente amenazados. El examen al microscopio de los segmentos de raíces teñidas de las orquídeas nos mostró la presencia de estructuras fúngicas tanto de hongos de micorriza orquidoide (pelotones e hifas enrrolladas) como de los llamados endóitos obscuros septados (DSE) (hifas mielinizadas y microesclerosios). El análisis de la secuenciación de la región ITS1-5.6-ITS2 sugiere que el tejido micorrizado está dominado por Tulasneaceae: Sistotrema sp., Rhizoctonia solani, and Epulorhiza sp. Entre los DSE, uno de los 10 aislados mostró 100% de similaridad con Phomopsis sp XJ-05, y otro 99% con el endoito MUT 885, ambos reportados como endóitos obscuros septados. El hipotético endóito septado obscuro Phomopsis sp XJ-05 fue aislado tanto de las raíces como de las semillas que germinaron de C. irapeanum restriction fragment length polymorphisms and by rDNA internal transcribed spacer sequencing. key WorDs: terrestrial orchid, orchidoide mycorrhiza, dark septate endophytes, microsclerotia introduction. Symbiosis are particularly important for plants resulting in signiicant nutritional advantage. Among these are the mycorrhizae from which most plants obtain the majority of their nutrients, including those limiting their growth. In general for the terrestial orchids the mycorrhizal association is fundamental for the plant during germination and throughout all its life (Smith & Read 1997). Of all orchids that have been studied, few have been the object of mycorrhizal studies. Among the Mexican terrestrial orchids just 3% of the orchids have been studied (Ortega-Larrocea & Rangel-Villafranco 2007). Many species of terrestrial orchids are threatened or in danger due to the habitat loss by anthropogenic activities and the attractive beauty of its lowers (Dearnaley 2007). Cypripedium irapeanum (Fig. 1) grows mainly in the remaining oak forests of the Mexican highlands. The oak forests in Mexico are 16 LANKESTERIANA figure 1. Cypripedium irapeanum lower from Puebla State, Mexico. threatened constantely by the urban activities and by the development of recreational sites. The change of soil use of the oak forests has conducted to the degradation by soil erosion and loss of these forests and have allow not only to the soil loss, and cosequently to the loss of the symbiotic fungi, but also to the decrease of the number of pollinators and to the increase of pathogens, specially the attack of the capsules by screw warms; other problems that this plant has to face in the degraded habitat are cattle, and weed invasion (Valdés et al. 2005). Cypripedium irapeanum was orginally described based on a collection from the mountains of Irapeo near the present city of Morelia in Michoacan, Mexico (Cribb & Soto Arenas 1993). In this country it is known as pichohuastle, a native name for the plant. The orchid is endemic of differents regions in Mexico (Chiapas, Durango, Guerrero, Jalisco, Michoacán, Morelos, Nayarit, Oaxaca, Sinaloa, Querétaro, Puebla, Veracruz), Guatemala and Honduras; usually at 14002250 m of altitud. The orchid is in the red list of plants in danger of the Mexican Department of Natural Resources (seMarnaT 1995). In relation to the temperate lady’s slipper orchids, Cypripedium, there are few studies on its associated fungi. According to Shefferson et al. (2005), the genus Cypripedium is characterized by high speciicity mycorrhizal association, then the lack of these fungi LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. may limit their establishment and distribution. Upon infection of this orchid by a compatible mycorrhizal fungus the seed (“dust seed”) germinates into a seedling that consumes the fungal sugars, processus known as myco-heterotrophy. The plants may retain the myco-heterotrophy into adulthood (Gill 1989). The internal transcribed spacer (ITS) regions of ribosomal DNA, including both ITS1 and ITS2, have been used extensively used for environmental sampling as a target because several taxonomic groupspeciic primer sets exist for this gene region (Gardes & Bruns 1993). The ITS has been the region of choice for molecular analysis of fungal communities of this region has been useful since Gardes & Bruns (1996) used its restriction digests (RFLP) to differenciate species of mycorrhizal fungi colonizing individual roots. Furthermore, the DNA sequences of the ITS1 and ITS2 are highly variable being a good marker to identify fungi to the genera and/or species level (Gardes & Bruns 1993, Gardes & Bruns 1996, Henrion et al. 1992, Smith et al. 2007). Objective of this paper was the isolation and identiication of the fungal root and seed endophytes as well as mycorrhyzal fungi of C. irapeanum by restriction fragment length polymorphisms and by rDNA internal transcribed spacer sequencing. The term “endophyte” refers to those fungi that can be detected at a particular moment within the tissues of apparentky healthy plant hosts (Schultz & Boyle 2005). Materials and methods. Collected C. irapeanum is surviving in a remaining patch of an oak forest which is located out of Puebla city in the State of Puebla, at 1840 m. We collected C. irapeanum growing close to an oak tree. Due to the scarcity of the orchids we obtained a collect autorization (No. D00.02-3478) from seMarnaT. Cypripedium irapeanum plants were collected including the rhizome and the surrounded soill to ensure that the root system was kept intact. We also sampled seeds. The soil core with the alive whole plants were maintened in the greenhouse before to be processed. In order to observe the root fungal colonization in situ the roots were hydrolyzed and stain by the Philips and Hayman procedures (1970) resulting in 20 to 30 root samples per plant. Inter and intracellular ValDés et al. — Root colonizing fungi of Cypripedium irapeanum melanized hyphae with microslclerotia were recorded as Dark Septate Endophytes (DSE). The isolation of the seed and root endophytes of C. irapeanum was done after a surface sterilization with a 5% sodium hipochlorite solution for 10 min, followed by a 0.1 % mercuric chloride solution for 2 min, and several washings with sterile distilled water. This drastic sterilization was done to prevent growth of root external microorganisms. Seeds were sowed in lasks containing Knudson (1946) culture medium, and the root fragments (1 cm long) in Petri plates containing Melin-Norkrans (Molina & Palmer, 1982) culture medium. After 4 days of incubation, plates with the root fragments having supericial contaminants were eliminated and those with no contaminants were incubated at 24oC for 3 months. Pure fungal isolates were propagated in Melin-Norkrans agar medium. Colonial and microscopic morphology was photographically documented (data not shown). Genetic characterization of C. irapeanum endophytes involved 1) extraction of fungal DNA from isolated and puriied fungi, 2) ampliication of fungal genome region useful in determining fungal identity (ITS1-5.8S-ITS2), 3) restriction and RFLP analysis of the region, 4) DNA sequencing of the region, and 5) BLAST analysis for identiication of endophytes. DNA extraction of isolates was done utilizing the CTAB method (Gardes & Bruns 1993). Obtained DNA was puriied with the Concert Nucleic Acid Puriication (Gibco), according to the manufacturer instructions. Concentration and purity of the DNA was evaluated with a GeneQuant spectrophotometer. The ITS region of the rRNA operon was ampliied according to Gardes & Bruns (1993) using the primers ITS1 (TCCGTAGGTGAACCTGCGC), ITS-1F (CTTGGTCATTTAGAGGAAGTAA), ITS 4 (TCCTCCGCTTATTGATATGC) and ITS4-B (CAGGAGACTTGTACACGGTCCAG). PCR was carried out in a Biometra-T personal termocycler under 94oC for 85 s for the denaturation followed by 25 cycles of ampliication and extension for 13 cycles at 95oC for 35s, 55oC for 55s and 72oC for 45s. This was followed by an incubation at 72oC for 10 more minutes. Obtained bands were visualized in an EtBr stained agarose gel. PCR products were puriied (Concert Nucleic Acid, Gibco) and restricted with enzymes Hinf1 (at 37oC for 17 5 hours), Alul (at 37oC for 1 hour), and Taq1 (at 65oC for 3 hours). Fragments were analiysed with the Kodak ID 3.6.1 program. The amplicons were cloned and ligated using the TOPO XL PCR cloning (qiagen) according to the manufacturer’s instructions. The recombinant vector was used for transforming cells of E. coli DH5α. Screening for recombinant cells was carried out by blue/white selection. Sequencing reactions were done in a Li-Cor 4202 G sequencer. Before sequencing, the amplicons were puriied with the Pure Link Quick Gel Extraction kit (Invitrogen) following the manufacturer’s instructions. Sequences were subjected to BLAST analysis to determine their homology with other sequences available in the Gene Bank for the ITS1-5.8S-ITS2 region. The CLUSTAL package (Thompson et al. 1994) was used to align the sequences with the corresponding fungal ITS rDNA sequences. results and discussion. The microscopic examination of stained root segments of the orchid revealed the presence of fungal structures of both orchidioid fungi, pelotons and coyled hyphae (Fig. 2) and DSE, mielinized hyphae and microsclerotia (Fig. 3). In 40% of the cortical cells pelotons were seen, and 30% of the cortical cells revealed the presence of microsclerotia inside the cells. We found partially digested pelotons in all C. irapeanum plants, suggesting that C. irapeanum may have mycoheterotrophic stages. Table 1 shows the list of the endophytic fungi recovered from roots and germinated seeds of orchid Cypripedium irapeanum. Dark Septate Endophytes were also observed in the germinated seeds. Two distinct types of microsclerotia were seen in the roots, one was of round shape and the other had irregular shapes (Fig. 3). A total of 10 different fungi were isolated, one from a germinated seed and 9 from the roots. Isolates 7, 9 and 10 were identiied as DSE; Isolate 7 and 9 from the plants, and isolate 10 from the seeds. To our knowledge, this is the irst report of the colonization of Cypripedium irapeanum by DSE fungi and the irst report of the colonization and identiication of both types of fungi in C. irapeanum. As expected the ampliied ITS1-5.8-ITS2 rDNA region resulted in a 650 bp product. Negative controls LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 18 LANKESTERIANA figure 2. Squash preparation of a C. irapeanum stained root showing infection of cells, coiled hyphae and development of pelotons. in PCRs (sterile milliporized water) consistently yielded no PCR product. The ITS 1F-ITS 4 combination yielded most of the PCR products except for the isolates 8, 9, and 10 which were ampliied with the ITS 1-ITS 4B combination. Restriction of the region yielded RFLPs different for all the analyzed fungi, except fot the isolates 9 and 10 that were identical. Nine RFLP patterns were yielded with AluI and TaqI restriction enzymes and 7 patterns with HindI (Fig. 4), suggesting the diversity of the endophytes. Analysis of ITS1-5.8-ITS2 region sequences suggested that mycorrhizal tissue was dominated by Tulasnaceae: isolate 2 (GeneBank Accesion No. JF313323) revealed 98% identity to Sistotrema sp., isolate 3 (GeneBank Accesion No. JF313324) 99% to Rhizoctonia solani, and isolate 6 (GeneBank Accesion No. JF313322) 97% to Epulorhiza sp., conirming Shefferson et al. (2005) and Shimura et al. (2009) results for the genus Cypripedium. Diverse Tulasnaceae form mycorrhiza also with epiphytic orchids (Suárez et al. 2006). Figure 5 shows a phylogenetic tree indicating the placement of the mycorrhizal fungi recovered from the roots of C. irapeanum. TaBle 1. Endophytic fungi recovered from roots and germinated seeds of orchid Cypripedium irapeanum Isolate Molecular identiication Type of root colonizing fungus C1 Fusarium Fungal endophyte (Bayman & Otero, 2006) C2 Sistotrema Mycorrhizal (Currah et al, 1990) C3 Rhizoctonia solani Mycorrhizal (Warcup, 1971) C4 Fusarium Fungal endophyte (Bayman & Otero, 2006) C5 Cylindrocarpon Fungal endophyte (Fisher & Petrini, 1989) C6 Epulorhiza Mycorrhizal (Shan et al, 2002) C7 MUT 885 Dark Septate Endophyte (Girlanda et al, 2002) C8 Gliocladium catenulatum Biological control fungus (Paavanen-Huhtala et al, 2004) C9 Phomopsis Dark Septate Endophyte (from plant) (Jumpponen, 2001) C10 Phomopsis Dark Septate Endophyte (from germinated seeds) LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. ValDés et al. — Root colonizing fungi of Cypripedium irapeanum 19 figure 3. Two distinct microsclerotia (arrowheads) within the roots of C. irapeanum, round shape and irregular shape. Isolates 9 and 10 revealed 100% identity to Phomopsis sp XJ-05, and isolate 7 revealed 99% identity to the fungal endophyte MUT 885 (a DSE fungus according to Girlanda et al., 2002), corroborating the results of the RFLP analysis. Phomopsis sp XJ-05 was isolated not only from the roots of C. irapeanum plants but also from the germinated seeds, indicating a possible role of stimulation of germination. Other endophytic fungi belonging to the Deuteromycetes were also isolated: isolate 1, identiied as Fusarium sp 440 (99% identity); isolate 4 identiied as Fusarium sp (97% identity); isolate 5 as Cylindrocarpon sp 4/97.1 (100% identity); and isolate 8 as Gliocladium catenulatum (99% identity). The genus Sistotrema is deined by Currah et al. (1990) as a mycorrhizal fungi of boreal species. Moncalvo et al., (2006) states that this fungus as a highly phylogenetic. However, analysis of ITS1-5.8ITS2 region sequences of our isolate C2 showed a high identity to this fungus. Rhizoctonia is known for its association with most other orchids (Rasmussen, 1995). This fungus is a genus based on asexual stages, is a polyphyletic fungus which includes fungi from the families Tulasnellaceae, Sebacinaceae and Ceratobasidiaceae. Rhizoctonia solani is a known anamorph of Thanatephorus cucumeris, has been isolated from absorbent tissues of orchids and conirmed as mycorrhizal endophytes because are able to stimulate the seed germination and development of the plant in vitro assays (Warcup, 1971). The Epulorrhiza species are known as anamorphs of the genus Rhizoctonia. Shan et al., 2002 mention that certain species of this genus have been continually isolated of terrestrial orchids; by means of the RFLP and CAPS analysis of Rhizoctonia they were able to classify the genus and its anamorps in 4 groups. Group II formed by Epulorrhiza showed a high ability to stimulate the germination and growth of several orchids. In contrast Group I stimulate a speciic orchid. Other authors (Sharma et al. 2003) found that in advanced development of the plant the number of species of Epulorrhiza is low suggesting that the occurrence of the fungus may be less critical in this growth stage. DSE have been reported for nearly 600 plants host figure 4. Restriction fragmen tlength polymorphisms obtained by endonucleases of the internal transcribed spacer (ITS1-5.8S-ITS2) region of the different fungi isolated from C. irapeanum. Digestions were performed with Alu 1, Hinf 1, and Taq 1. M=molecular weight marker. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 20 LANKESTERIANA aCknoWleDgeMenTs. This research was partially funded with a grant of the Instituto Plotécnico Nacional. RHV acknowledges support from CONACYT through a M Sc scholarship. We are grateful to Ms Raquel Escobedo for providing information on the ubication of the orchids. Thanks are due to Dr. Heidi Asbjornsen for constructive English corrections. liTeraTure CiTeD figure 5. Neighbor-joining tree obtained from the internal transcribed spacer (ITS1-5.8S–ITS2) sequence alignment of isolates C2, C3 and C6 with sequences of Tulasnaceae. The Kimura two-parameter model was used for pairwise distance measurement. Bootstrap values above 50% are indicated (1000 replicates). Black arrows indicate the mycorrhizal fungal isolates recovered from the orchid C. irapeanum. Bar = Kimura distance. species, including plants known to bear different types of mycorrhizae occurring in highly diverse habitats. Their widespread occurrence and high abundance suggests lack of host speciicity and an important role in the different ecosystems (Jumpponen & Trappe, 1988; Jumpponen, 1999). Jumpponen (2001) regards the DSE as nonconventional mycorrhizal symbiosis because some of them have found to enhance host mineral nutrition and growth (Fernando & Currah, 1996). The presence of DSE in the germinated seeds of C. irapeanum and their lack in the ungerminated seeds suggests its possible role for the germination of the orchid seed. In relation of the occurrence of Fusarium as an endophyte of Cypripedium, Bayman & Otero (2006) have deined this genus and its telomorphs as a most interesting group of the orchids endophytes due to its hability to stimulate the seed germination of C. reginae. Other found endophytes in C. irapeanum were Cylindrocarpum and Gliocladium. Cylindrocarpon sp. 4/97.1 was reported as an endophyte of roots of terrestrial orchids and mycoheterotrophic orchids (Bayman & Otero, 2006). Gliocladium catenulatum is well known as a biological control agent (PaavanenHuhtala et al., 2004) and parasite of other fungi (Tu & Vaartaja, 1980) suggesting an important role against pathogens in the orchid root. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. Bayman, P. & J. Tupac Otero. 2006. In: Microbial Root Endophytes. B. Shultz, C. Boyle and T. Sieber, Eds. Springer, Heildeberg, New York. Pp 153-173. Cribb, P. & M. A. Soto-Arenas. 1993. The genus Cypripedium in Mexico and Central America. Orquídea (Mex.) 13:205-214. Dearnaley, J. D. W. 2007. Further advances in orchid mycorrhizal research. Mycorrhiza 17: 475-486. Currah, R. S., A. Smreciu, & S. Hambleton. 1990. Mycorrhizae and mycorrhizal fungi of boreal species of Plantanthera and Coeloglossum (Orchidaceae). Canad. J. Bot. 68: 1171-1181. Fernando, A. A. & R. S. Currah. 1996. A comparative study of the effects of the root endophytes Leptodontidium orchidicola and Phaliocephala fortinii (Fungi Imperfecti) on the growth of some subalpine plants in culture. Canad. J. Bot. 74: 1071-1078. Gardes, M. & T. D. Bruns. 1993. ITS primers with enhanced speciicity for basidiomycetes-Aplication to the identiication of mycorrhizae and rusts. Molec. Ecol. 2:113-118. Gardes, M. & T. D. Bruns. 1996. Community structure of ectomycorrhizal fungi in Pinus muricata forest: aboveand below-ground views. Canad. J. Bot. 74: 1572-1573. Gill, D. E. 1989. Fruiting failure, pollinator ineficiency, and speciation in orchids. In: D. Otte & J. A. Endler (eds.), Speciation and its consequences. Sinauer Associates Sunderland, Massachusetts. Pp. 458-481. Girlanda, M., S. Ghignone, & A. M. Luppi. 2002. Diversity of sterile root-associated fungi of two mediterranean plants. New Phytol. 155: 481-498. Hadley, G. 1970. Non-speciicity of symbiotic infection in orchid mycorrhiza. New Phytol. 69: 1015-1023. Henrion, B. F., F. Le-Tacon & F. Martin. 1992. Rapid identiication of genetic variation of ectomycorrhizal fungi by ampliication of ribosomal RNA genes. New Phytol. 122: 289-298. Jumpponen, A. 1999. Spatial distribution of discrete RAPD phenotypes of a root endophytic fungus, Phialocephala fortinii, at a primary successional site on a glacier forefront. New Phytol. 141: 333-344. ValDés et al. — Root colonizing fungi of Cypripedium irapeanum Jumpponen, A. 2001. Dark septate endophytes – are they mycorrhizal? Mycorrhiza 11: 207-211. Jumpponen, A. & J. M. Trappe. 1998. Dark Septate Endophytes: A review of facultative biotrophic rootcolonizing fungi. New Phytol. 140: 295-310. Knudson, L. 1946. A new nutrient solution for the germination of orchid seed. Amer. Orch. Soc. Bull. 214217. Molina, R. & J. G. Palmer. 1982. Isolation, maintenance and pure culture manipulation of ectomycorrhizal fungi. In: Schenck N.C. (ed.), Methods and principles of mycorrhizal research. Amer. Phytopathol. Soc., St. Paul Minnesota. Pp. 115-129. Moncalvo, J-M., R. H. Nilsson, B. Koster, S. M. Dunham, T. Bernauer, P. B. Matheny, T. M. Torner, S. Margaritescu, M. Weiß, E. Danell, G. Langer, E. Langer & K-H. Larsson. 2006. The cantharelloid clade: dealing with incongruent gene trees and phylogenetic reconstruction methods. Mycologia 98:937-948. Ortega-Larrocea, M. P. & M. Rangel-Villafranco. 2007. Fungus assisted reintroduction and longtem survival of two Mexican terrestrial orchids in the natural hábitat. Lankesteriana 7: 317-321. Paavanen-Huhtala, S., H. Avikainen& T. Yli-Mattil. 2004. Development of strain-speciic primers for a strain of Gliocadium catenulatum used in biological control. Eur. J. Pl. Pathol. 105: 187-198. Phillips, J. M. & D. S. Hayman. 1970. Improvement procedures for clearing and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection. Trans. Brit. Mycol. Soc. 55: 158-161. Rasmussen, H. N. 1995. Terrestrial Orchids: From Seed to Mycotrophic Plant. Cambridge University Press, Cambridge, UK. seMarnaT. 1995. Gaceta Ecológica 7: 1-72. Shan, X. C., E. C. Y. Liew, M. A. Weatherhead & I. J. Hodgkiss. 2002. Characterization and taxonomic placement of Rhizoctonia-like endophytes from orchid roots. Mycol. 94:230-239. Sharma, J., L. W. Zettler & J. W. van Sambeek. 2003. 21 A survey of mycobionts of federally threatened Platanthera praeclara (Orchidaceae). Symbiosis 34: 145-155. Shefferson, R. P., M. Weiß, T.I.I.U. Kull & D. Lee Taylor. 2005. High speciicity generally characterizes mycorrhizal association in rare lady’s slipper orchids, genus Cypripedium. Molecul. Ecol. 14: 613-626. Shimura, H., M. Sadamoto, M. Matsuura, T. Kawahara, S. Naito & Y. Koda. 2009. Characterization of mycorrhizal fungi isolated from the threatened Cypripedium macranthos in a northen island of Japan: two phylogenetically distinct fungi associated with the orchid. Mycorrhiza 19:525-534. Smith, S. E. & D. J. Read. 1997. Mycorrhizal Symbiosis. Academic Press. Pp. 347-357. Smith, M. E., G. W. Douhan & D. M. Rizzo. 2007. Intra-speciic and intra-sporocarp ITS variation of ectomycorrhizal fungi as assessed by rDNA sequencing of sporocarps and pooled ectomycorrhizal roots from Quercus woodland. Mycorrhiza 18:15-22. Suárez, J. P., M. Weiss, A. Abele, S. Garnica, F. Oberwinkler, & I. Kottke. 2006. Diverse tullasnelloid fungi form mycorrhizas with epiphytic orchids in an Andean cloud forest. Mycol. Res. 110: 1257-1270. Schulz, B. & C. Boyle. 2005. The endophytic continuum. Mycol. Res. 109:661-687. Thompson, J. D., D. G. Higgins & T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-speciic gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673-4680 doi:10.1093/NAR/22.22.4673. Tu, J. C. & O. Vaartaja. 1980. The effect of the hyperparasite Gliocadium virens on a Rhizoctonia root rot of white beans. Canad. J. Bot. 59: 22-27. Valdés, M., A. Espinosa & C. Trejo. 2005. Pichohuastle: orquídea nativa mexicana en peligro de extinción. Conversus (Instituto Politécnico Nacional) 38: 30-33. Warcup, J. H. 1971. Speciicity of mycorrhizal association in some Australian terrestrial orchids. New Phytol. 70: 41-46. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. LANKESTERIANA LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. LANKESTERIANA 11(1): 23—32. 2011. POPulATiON STruCTurE Of OnCIdIUM pOIkIlOsTAlIx (OrChidACEAE), iN COffEE PlANTATiONS iN SOCONuSCO, ChiAPAS, MéxiCO alfreDo garCía-gonzález1,4, anne DaMon2, ligia g. esparza olguín3 & jaVier Valle-Mora2 Centro de Investigaciones y Servicios Ambientales (ECOVIDA). Carretera a Luis Lazo, km 2.5, Pinar del Río, Cuba. 2 El Colegio de la Frontera Sur (ECOSUR). Apartado Postal 36, Carretera Antiguo Aeropuerto, km 2.5, Tapachula, Chiapas, México. 3 El Colegio de la Frontera Sur (ECOSUR). Calle 10 X 61 No. 264, Colonia Centro, Campeche, México. 4 Author for correspondence: alfredmx22@gmail.com 1 aBsTraCT. We studied the population structure of Oncidium poikilostalix (Kraenzl.) M.W. Chase & N.H. Williams (Orchidaceae) newly reported for México in 2008 in the region of Soconusco (Chiapas state) in southeast Mexico, growing in shaded coffee plantations in two rural communities, Fracción Montecristo (FM) and Benito Juárez El Plan (BJ). In 2008-2009, we determined the characteristics of these coffee plantations, and the distribution of the various life stages (seedling, juvenile, adult) on the two phorophytes: coffee bushes (Coffea arabica L.) and shade trees (Inga micheliana Harms.). Principal Component Analysis and Discrimination Analysis were used to compare all the variables evaluated. There were 1123 individuals (82.63%) in FM and 236 (17.37%) in BJ. Of those, in FM 1060 individuals (94.4%) were epiphytic upon coffee bushes and 214 (91.06%) in BJ, the rest were epiphytic upon the shade trees (I. micheliana). Despite displaying the characteristics of a twig epiphyte, the preferred microsites of O. poikilostalix were the branches of the coffee bushes, with 703 individuals (55.18%) and the trunk of the shade trees, with 78 individuals (91.76%). More than a third of the population was juvenile stage (37.09%; 504 individuals). Oncidium poikilostalix probably entered México from Guatemala and appears to be a vigorous plant that is successfully adapting to its new sites of occupancy resuMen. Se estudió la estructura poblacional de la orquídea epíita Oncidium poikilostalix (Kraenzl.) M.W. Chase & N.H. Williams (Orchidaceae), nuevo reporte para México en 2008, en la región del Soconusco, Estado de Chiapas, al sureste del país. Crece en plantaciones de café de sombra en dos comunidades rurales, Fracción Montecristo (FM) y Benito Juárez El Plan (BJ). En 2008-2009, se determinaron las características de estas plantaciones de café, y la distribución de los distintos estadíos de vida (plántulas, juveniles, adultos) de esta orquídea, en los dos foroitos encontrados: plantas de café (Coffea arabica L.) y árboles de sombra (Inga micheliana Harms.). Se utilizó Análisis de Componentes Principales y Análisis Discriminante, para comparar todas las variables evaluadas. Hubo 1.123 individuos (82,63%) de O. poikilostalix en FM y 236 (17,37%) en BJ. De ellos, creciendo sobre cafetos, 1.060 individuos (94,4%) en FM y 214 (91,06%) en BJ, el resto ocupando árboles de sombra (I. micheliana). A pesar de mostrar las características de una epíita de ramilla, el mayor número de ejemplares de O. poikilostalix se contabilizó en los cafetos, en el micrositio ramas, con 703 individuos (55,18%) y en el tronco, en los árboles de sombra, con 78 individuos (91,76%). Más de un tercio de la población fueron individuos juveniles (504 individuos, 37,09%). Oncidium poikilostalix probablemente entró a México desde Guatemala y parece ser una planta vigorosa, que se está adaptando con éxito a sus nuevos sitios de ocupación. keyWorDs / palaBras cafeto. ClaVe: Oncidium poikilostalix, micrositio, estadíos de vida, foroito, árbol de sombra, introduction. Mexico, with its diversity of ecosystems, is an orchid rich country with 1150 species currently registered (Espejo et al. 2004), expected to rise to 1300 - 1400 species (Hágsater et al. 2005). Many orchid species are conined to rather precise habitat and climatic parameters, their reproduction is notoriously slow and scarce (Ávila & Oyama 2002; Hágsater et al. 2005), and very little is known about most species. 24 LANKESTERIANA The Soconusco region in the state of Chiapas, in south-east Mexico bordering with Guatemala, covers an area of 5475 km² which includes coastal plains and part of the Sierra Madre mountain range with tropical and temperate forest ecosystems (Sánchez & Jarquín 2004). Within that scenario a relatively high number of more than 280 orchid species have been reported for the region (Damon, 2011), including various endemic species. An expanding human population, extending subsistence and commercial agriculture, forest ires and severe tropical storms have contributed to the destruction and fragmentation of natural forests (INEGI 1999; CNA & CMDI 2000; Tovilla 2004), and combined with the unsustainable and illegal exploitation of orchids have led to the rapid decline of orchid numbers and biodiversity, and the near extinction of the most vulnerable species, as has happened in many other parts of the world. In Soconusco, most of the cloud forest, which is the most orchid rich ecosystem on the planet (60% of Mexico’s orchid lora. Hágsater et al. 2005), has been transformed into coffee plantations. At irst coffee was planted under the shade of original forest trees heavily populated by epiphytes, thus maintaining a high proportion of the original biodiversity (Hágsater et al. 2005). Today, many of those traditional plantations have been converted to improved varieties of coffee with monospeciic shade, and some to full sun coffee. At least 213 orchid species (18.52% of Mexican total) can be found growing within coffee plantations (Espejo et al. 2004). Oncidium poikilostalix (Kraenzl.) M.W. Chase & N.H. Williams was reported in 2008 as a new species for Mexico, with small populations in coffee plantations in two localities in Soconusco, Fracción Montecristo (FM) (latitude 15° 5’ 31.5”; longitude 92° 9’ 57.9”) and Benito Juárez El Plan (BJ) (latitude 15° 5’ 15.4”; longitude 92° 8’ 54.7”), both within the municipality of Cacahoatán (Solano et al. in press), having been previously reported in Guatemala and Costa Rica as Sigmatostalix costaricensis Rolfe (Behar & Tinschert 1998) and as Sigmatostalix picta Lindl. for Nicaragua and South America (Atwood & Mora de Retana 1999). The colonization of new areas by O. poikilostalix demonstrates the importance of the Biological Corridor Boquerón-Tacaná, which connects both nations and forms part of the Mesoamerican LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. Biological Corridor (CCAD-PNUD/GEF 2002). In this study we describe the population structure of O. poikilostalix, comment upon its reproductive behaviour as observed in 2008-9, and analyse the relationship with the phorophytes and microsites available in two shaded coffee plantations in Soconusco, Chiapas, as an exceptional opportunity to study the characteristics of an orchid extending its distribution in these times of climate change and biodiversity loss. Materials and Methods Characterization of the sites — We studied the coffee plantations where O. poikilostalix grows to describe the density of the coffee bushes, diversity and density of the shade trees and the management regimes applied to the coffee. Sampling unit — Having analysed the distribution of O. poikilostalix in FM and BJ we set up three plots, or sampling units, measuring 625 m² (25 x 25 m; 0.0625 ha) in each coffee plantation, FM (plots 1, 2 and 3) and BJ (plots 4, 5 and 6). These plots are highly representative of the populations as a whole and contained the majority of individuals of the orchid present in these sites at the time of the study. Determination and characterization of the phorophytes, Density, Height Above Ground (HAG) and Diameter at Breast Height (DBH) — In this study, the term phorophyte is only used for coffee bushes and shade trees that had one or more individuals of O. poikilostalix growing on them at the time of the study. We determined which species were used as phorophytes by O. poikilostalix within the study sites, counted the numbers of individuals and determined the density of each phorophyte. The HAG of the phorophytes (coffee bushes and shade trees) was measured with a 4m straight ruler graduated with 50cm intervals and the DBH was determined using a metric tape. Microsites — Guided by the vertical zonation proposed by Johansson (1974), we developed a version speciically for the coffee bushes and shade trees in this study, to describe the different microsites, or ecological units, available for colonization by epiphytes, as follows: garCía-gonzález et al. — Population structure of Oncidium poikilostalix 25 figure 1. Microsites and vertical zonation of the coffee plants: 1) Trunk, 2) Fork, 3) Branches, 4) Twigs. Microsites for coffee bushes (Fig. 1): Zone 1 – Trunk (Tr): From the base of the bush to the irst primary branches. Zone 2 – Fork (F): Intersection between branches at various heights. Zone 3 – Branches (B): Thick branches with diameter > 3 cm. Zona 4 – Twigs (Tw): Thinner, outer branches, with a diameter < 3 cm. Microsites for shade trees (Fig. 2): Zone 1 – Trunk (Tr): From the base of the tree to the irst primary branches. Zone 2 – Fork (F): Intersection between branches at various heights. Zone 3 – Branches (B): Thick branches with diameter > 3 cm. Due to pruning there was no zone 4 for trees. For each coffee bush and tree the length of Zone 1 and total length of Zone 3 were measured and numbers of Zone 2 were counted. It was not possible to quantify Zone 4 for the coffee bushes. Life stages of O. poikilostalix — The plants of O. poikilostalix were classiied using the following categories: Seedling (S): Earliest stage after the protocorm in which the young plant irst acquires differentiated structures (2 mm to 2 cm). figure 2. Microsites and vertical zonation of the shade trees (Inga micheliana): 1) Trunk, 2) Fork, 3) Branches. Juvenile (J): Sexually immature but well developed plant (> 2 cm). Adult (A): Sexually mature plants that have lowered at least once. Sampling — We counted all the individuals of each life stage on each of the microsites of every phorophyte within the study sites. Statistical Analysis — We used the programmes SAS (Version 5.1.2600) and Minitab (Version 15.1.30.0) to analyse the data, which included Analysis of Variance (ANOVA), the Kruskal-Wallis test and the Goodness of Fit of Chi-squared test. Combining all the variables measured (plot, phorophyte, HAG, DBH, microsite, life stage, number of microsites available) we carried out a Principal Component Analysis and Discrimination Analysis, corroborated by Pillai’s Trace test and the Mahalanobis test, to derive the population structure and preferences of the orchid O. poikilostalix. results Characterization of the sites — The coffee plantations FM and BJ consist of arabica coffee bushes (Coffea arabica L. Rubiaceae) and monospeciic shade trees LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 26 LANKESTERIANA TaBle 1. Colonization of phorophytes, coffee, and shade trees (Inga micheliana) per year of study, in Fracción Montecristo (FM) and Benito Juárez (BJ). (“Chalum”; Inga micheliana Harms.: Mimosaceae) as well as occasional species of native, fruit or timber trees which also serve to shade the coffee bushes, such as Cedrela mexicana Roem. (Meliaceae), Citrus sp. (Rutaceae) and Nectandra sp. (Lauraceae) in FM and Inga lauriana (Sw.) Willd. (Fabaceae), Citrus sp., Trema micrantha (L.) Blume (Ulmaceae) and Vernonia deppeana Less. (Asteraceae), in BJ. Both plantations can be considered as simple polycultures (sensu Williams-Linera & López-Gómez, 2008, for coffee plantations in the Mexican state of Veracruz). The plantations of FM and BJ are approximately 15 and 20 years old and are situated at an average altitude of 1410 m and 1440 m, respectively. In both FM and BJ no agrochemicals are applied, and management is limited to manually eliminating weeds with a machete twice a year, and the pruning of shade trees and coffee bushes once a year. Most importantly, unlike in most plantations in the region, these farmers do not eliminate the moss, and with it the epiphytes, that grow on the branches and trunks of the coffee bushes. Determination of the phorophytes — Most of the trees were I. micheliana and this was the only tree LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. species that acted as a phorophyte. The coffee bushes themselves were also phorophytes. As shown in Table 1, not all the coffee bushes and shade trees were colonized by O. poikilostalix. The Chi-squared test showed a signiicant difference between the colonization of the two phorophytes, with an apparent preference for coffee bushes in 2008 (χ²= 123.662; d.f.= 1; P= 9.98887e-29), which was maintained in 2009 (χ²= 127.954; d.f.= 1; P= 1.14875e-29). In 2009, 23 O. poikilostalix were lost due to maintenance activities, thus reducing also the number of trees determined as phorophytes. “Chalum” (I. micheliana) was the only tree species to act as a phorophyte (58 individuals, 79.45% of all trees. 27 FM; 31 BJ) and population sizes of O. poikilostalix were notably different between sites and phorophytes (Table 7). Density of coffee bushes and shade trees — Within the experimental plots, in FM there were 459 coffee bushes and 35 shade trees, whereas in BJ there were 410 coffee bushes and 38 shade trees. The density of coffee bushes was 2448 and 2187 coffee bushes/ha in FM and BJ, respectively, whereas shade tree density was more variable, at 187 and 203 trees/ha for FM and BJ, respectively. Height Above Ground (HAG) and Diameter at Breast Height (DBH )of the phorophytes — There were signiicant differences between the heights of the coffee bushes in the three plots of FM (Fc= 5.51; d.f.= 5; P= 5.3e-05), but not for the shade trees (Fc= 1.21; d.f. = 5; P= 0.315) (Table 2). For DBH (Table 2), the Kruskal-Wallis test showed signiicant differences between coffee bushes (χ²= 13.73; d.f.= 5; P= 0.017), but not for shade trees (Fc= 2.04; d.f. = 5; P= 0.084), evaluating with ANOVA. Some coffee bushes were not included due to measuring less than 1.30 m in height. TaBle 2. Height Above Ground (HAG) (m) and Diameter at Breast Height (DBH) (cm) averages for the phorophytes, coffee bushes and shade trees, in Fracción Montecristo (FM) and Benito Juárez (BJ). garCía-gonzález et al. — Population structure of Oncidium poikilostalix 27 TaBle 3. General average dimensions (m) of the trunk microsites (Zone 1) and branches (Zone 3) and average number of forks (Zone 2) for the phorophytes, coffee bushes and shade trees, in Fracción Montecristo (FM) and Benito Juárez (BJ). Availability of Microsites — As was expected, the total length of the branches (Zone 2) of the coffee bushes and the length of the trunks (Zone 1) of the trees were greater than the other microsites of these phorophytes (Table 3). The forks between branches could be found at different heights above the ground. Number of orchids per microsite — The majority of individuals of O. poikilostalix occupied Zone 3, the branches, in the case of the coffee bushes (703 individuals) and Zone 1, the trunk, of the shade trees (78 individuals). Plot 1 (FM) had the greatest population (762 individuals), with the highest numbers of individuals in each microsite [Zone 1, 148; Zone 2 (coffee bushes only), 2; Zone 3, 383; Zone 4 (coffee bushes only) 229] and there was a signiicant difference between Plot 1 as compared to Plots 2 and 3 (χ²= 44.23; d.f.= 2; P= 2.48644e-10) (Fig. 3). For BJ, the number of orchid individuals on the coffee plants differed signiicantly between all three plots (χ²= 7.43; d.f.= 2; P= 0.024) (Fig. 4). Shade trees were less favoured as phorophytes than coffee bushes, and no orchids were found growing in Zone 2, the forks of the trees. However, one specimen of I. micheliana had 52 individuals, 46 on Zone 1, and 6 on Zone 3. Principal Component Analysis — Comparing all the variables for both types of phorophyte (plot, height above ground, DBH, number of orchid individuals on each microsite, number available of each microsite) we determined whether there were differences between the experimental plots. For coffee bushes in FM, there was a signiicant figure 3. Scatter Plot produced by Principal Component Analysis, for coffee bushes in Fracción Montecristo (FM). Variables included: Height Above Ground (HAG), Diameter at Breast Height (DBH), number of orchid individuals on each microsite, number available of each microsite. figure 4. Scatter Plot produced by Principal Component Analysis, for coffee bushes in Benito Juárez El Plan (BJ). Variables included: Height Above Ground (HAG), Diameter at Breast Height (DBH), number of orchid individuals on each microsite, number available of each microsite. difference between Plot 1 and Plots 2 and 3, (Table 3) corroborated by the Mahalanobis test (Table 4). In BJ, there were signiicant differences between all the plots (Fig. 4), conirmed by the Mahalanobis test (Table 5). In the case of the shade trees in FM, Plot 2 was signiicantly different to Plots 1 and 3 (Fig. 5) corroborated by the Mahalanobis test (Table 6). In BJ, the apparent signiicant difference between Plot 3 LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 28 LANKESTERIANA TaBle 4. Mahalanobis test in Discriminant Analysis for shade tree phorophytes in Fracción Montecristo. TaBle 5. Mahalanobis test in Discriminant Analysis for coffee plant phorophytes in Benito Juárez. TaBle 6. Mahalanobis test in Discriminant Analysis for shade tree phorophytes, Fracción Montecristo. very few were found on Zone 2 (4). Plot 1 had the most individuals and the greatest number of all life stages growing on all the microsites. discussion and Plots 1 and 2 was shown to be non-existent by the application of Pillai’s Trace test (Fig. 6). Number of individuals of life stages — For the shade trees, in FM, the distribution of the three life stages was: S - 35, J - 7, A - 21. In BJ there were no seedlings observed on the shade trees, J - 10, A - 12. For coffee bushes in FM: S - 344, J - 399, A - 317; BJ: S - 63, J 88, A - 63. The majority of individuals of all life stages were found growing on Zone 3 (703 individuals) and figure 5. Scatter Plot produced by Principal Component Analysis, for shade trees in Fracción Montecristo (FM). Variables included: Height Above Ground (HAG), Diameter at Breast Height (DBH), number of orchid individuals on each microsite, number available of each microsite. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. Height, DBH y density of present and potential phorophytes. Its inluence on the ecosystem — The density and architecture of present and potential phorophytes, linked to the HAG and DBH of the trees and coffee bushes, create variations in the conditions of temperature and humidity which in turn affect the germination and establishment of epiphytes (Benzing 1990). In the case of the forks between branches, the levels of humidity and amount of humus accumulated, which are favourable for the establishment of many epiphytes, depend upon the size and position of the fork in relation to sources of organic matter and moisture. The combination of these aspects can have a substantial effect upon the penetration of light, air figure 6. Scatter Plot of Principal Component Analysis, for shade trees in Benito Juárez El Plan (BJ). Variables included: Height Above Ground (HAG), Diameter at Breast Height (DBH), number of orchid individuals on each microsite, number available of each microsite. garCía-gonzález et al. — Population structure of Oncidium poikilostalix 29 TaBle 7. Oncidium poikilostalix: number of individuals per microsite, life stage and type of phorophyte in 2008, for Fracción Montecristo (FM) and Benito Juárez (BJ). circulation and the surface available for establishment of epiphytes. Those same variables will also affect the abundance and diversity of bacteria and mycorrhizal fungi, the availability of pollinators and the abundance of herbivores and their natural enemies. The density of coffee bushes was 2448 and 2187 coffee bushes/ha in FM and BJ, respectively, which compares to a density of approximately 2000 bushes/ ha in traditional coffee plantations in Colombia, contrasting with intensive plantations in that country which may have up to 10,000 bushes/ha of dwarf, high yielding varieties (Gallego 2005). Shade tree density was more variable, at 187 and 203 trees/ha for FM and BJ, respectively. These densities are similar to the density of shade trees in coffee plantations in Veracruz, which range from 193 - 220 trees/ha, but which are taller than the trees in our study, possibly due to less aggressive pruning. However, the density of trees in the original cloud forest is approximately 638 trees/ha, with a maximum height of approximately 22m (WilliamsLinera & López-Gómez 2008), and O. poikilostalix may be better adapted to the environmental conditions, and for attracting pollinators and dispersing seeds within this denser vegetation of the original cloud forest. Number of orchids per type of phorophyte and per microsite — Vascular epiphytes tend to display patterns of vertical distribution on their phorophytes that relect their range of tolerance for light and humidity and other ecophysiological adaptions (Johansson 1974; Krömer et al. 2007). A study carried out in humid tropical forests in Alto Orinoco in Venezuela suggests that forks represent an extremely important microsite for many epiphytic species of plants, whereas other species clearly favour vertical substrates (HernándezRosas 2000). In forks, retention of both humidity and organic matter are greater than for vertical substrates, as water drains away very quickly on vertical substrates, carrying with it organic matter and dissolved nutrients. In this study, the percentage colonization of both phorophytes was similar, 13.79% of shade trees and 16.8% of coffee bushes, and the higher numbers of O. poikilostalix on coffee bushes could simply be due to the presence of more than 10 times more coffee bushes (869) than shade trees (73) in the experimental plots. Oncidium poikilostalix has a relatively high pollination rate and each capsule contains thousands of seeds (García-González 2009, unpublished data) which are carried by multidirectional breeze and thermal currents, the similarity of the percent colonization, despite the great difference in the quantities of potential phorophytes in the experimental plots, suggest that only this small, and constant fraction of phorophyte populations have the necessary microorganisms and /or environmental conditions to permit the establishment of colonies of O. poikilostalix and that it is a minority case. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 30 LANKESTERIANA From a numerical point of view 1273 out of a total of 1358 (93.74%) individuals of O. poikilostalix were found growing on coffee bushes indicating that they offer adequate conditions for germination and development, and conditions that are probably similar to the original substrate preferences of this orchid. This is interesting as Coffea arabica is an introduced species, with just over one century in the Soconusco region (Baxter 1997; ICO 2009) and has effectively creating a new habitat or opportunity. In tropical forests the canopy is closed, there is little vegetation on the forest loor and even twig epiphytes growing on the outer extremes of the branches are not exposed to full sun or extreme dryness. In coffee plantations the canopy is more open, shade trees are widely spaced and light penetrates down to the coffee bushes. We have no information concerning the type of phorophytes and microsites colonized by O. poikilostalix in natural habitats, but obviously the branches of coffee bushes, followed by the trunks of coffee bushes and shade trees are the conditions that most clearly fulil the requirements and mimic the natural habit of O. poikilostalix. In the case of shade trees, the trunk is maybe too thick, too dark, and maybe even too constantly damp, whereas the pruned branches are maybe too exposed in this more open type of vegetation cover. The trees are regularly pruned, to increase the light reaching the coffee plants, and the profusion of thinner branches is eliminated and with it any orchids attached to them. The long ibrous roots capable of wrapping round thin branches and the size of O. poikilostalix indicate twig epiitism but in this study this species was shown to prefer thicker branches and to be able to establish on trunks, but this may be an artefact of management practices carried out within coffee plantations wherein thinner branch growth is annually pruned out, both in shade trees and coffee bushes. The branches represent an intermediate microsite, in terms of light intensity, air currents, bark texture, available surface area, thickness, and in the absence of stable twig microsites, may offer the next best option and fall within the natural range of tolerance of this orchid. Twig epiphytes tend to mature relatively rapidly but have shorter lifecycles than most orchid species that may be a relection of their risky and ephemeral LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. habitat (Gravendeel et al. 2004; Hágsater et al. 2005; Mondragón et al. 2007). Various species of small twig epiphytes colonize the thinnest branches of coffee bushes in Soconusco region, especially Erycina crista galli (Rchb.f.) N.H.Williams & M.W.Chase, Leochilus labiatus (Sw.) Kuntze, L. oncidioides Knowles & Westc., L. scriptus (Sw.) Rchb.f., Notylia barkeri Lindl., and Ornithocephalus tripterus Schltr. (Damon 2009, unpublished data), and all are even smaller than O. pokilostalix, which may explain why this orchid appears to fall outside of the twig epiphyte category. Differences between Plots and number of individuals of life stages — We found signiicant differences between the coffee bushes and the shade trees, affecting all the variables monitored, but mainly due to the great difference in the number of plants of each category. All life stages of O. poikilostalix were found on the trunk of the shade trees (Table 7). In FM, with the largest and most established population of O. poikilostalix, our data for the number of seedlings and numbers of adult plants indicate low survival rates on Zone 1, the trunk (Table 7). The trunks of the trees will receive orchid seeds falling from above and the high humidity possible favours the presence of mycorrhizal fungi which facilitate the germination of the seeds. However, later on, development of the young plant may be hindered by low light levels, reduced air circulation and, during the rainy season, humidity may reach intolerable levels complicated by mud splashed from the ground. In BJ the behaviour of the orchid appeared to be different, with far greater levels of survival on the trunks, but the population is still too small to draw conclusions. On the branch microsite, in both FM and BJ, where a greater number of individuals were found from all three life stages, recruitment of seedlings was relatively lower, although survival rates were higher in most of the Plots (Table 7). After Zone 3, the next most occupied microsite was the twigs, Zone 4 (Table 7), although in Plots 3 and 5 no individual were observed on this microsite. Plot 3 had a slightly greater density of coffee bushes implying less light reaching the coffee twigs, but Plot 5 was no different, making it dificult to explain this difference. The garCía-gonzález et al. — Population structure of Oncidium poikilostalix relative abundance on this microsite agrees with the size and physical characteristics of O. poikilostalix, but levels of survival were not high, as few adult plants were observed in comparison with the numbers of seedlings and juveniles, although this could simply be due to the rough handling and breakage of twigs during the harvest, and partial removal of twigs during annual pruning. In the case of shade trees the low numbers of individuals of O. poikilostalix (Table 7) prevented an adequate analysis of the distribution of individuals of the three life stages. Oncidium poikilostalix is an orchid that appears to be well adapted to the conditions in the coffee agroecosytems of southeast Mexico, colonizing most of the available microsites on both shade trees and coffee bushes, although we have no means of comparing our data with populations inhabiting the original, natural habitat of this plant. Despite our observation that a small proportion of individuals of O. poikilostalix were lost due to management practices in 2009, the majority of the coffee plantations in Soconusco region are administered by small producers, which for cultural and economic reasons carry out the bare minimum of maintenance procedures, which favours stability and the persistence of epiphytes. Under these conditions, O. poikilostalix is slowly expanding its distribution and may threaten the smaller populations of the similar Sigmatostalix guatemalensis (awaiting veriication of its new name within Oncidium. Rodolfo Solano-Gómez, personal communication), which is a protected plant in Mexico and established in small numbers within the coffee plantations FM and BJ. aCknoWleDgeMenTs. This study formed part of the Project: “Diversity and conservation of the orchids of the Biological Corridor Tacana-Boqueron”, and we are grateful to the National Council for Science and Technology (CONACYT-FONDOS MIXTOS-CHIAPAS, CHIS–2006– 206–45802) for funding. We thank the coffee producers of the communities Fracción Montecristo and Benito Juárez El Plan, for permitting us access to their plantations to carry out the ield work for this study. 31 liTeraTure CiTeD Atwood, J.T. & D.E. Mora de Retana. 1999. Family # 39 Orchidaceae: Tribe Maxillarieae: subtribes Maxillariinae and Oncidiinae. Fieldiana, Bot. 40 (1-4): 1-82. Ávila, I. & K. Oyama. 2002. Manejo sustentable de Laelia speciosa (Orchidaceae). Biodiversitas (Boletín Bimestral de la Comisión Nacional para el Conocimiento y Uso de la Biodiversidad) 7 (43): 9-12. Baxter, J. 1997. El libro del café. Susaeta Ediciones, Madrid. Behar, M. & O. Tinschert. 1998. Guatemala y sus orquídeas. Bancafé, Guatemala. Benzing, D.H. 1990. Vascular Epiphytes. Cambridge University Press, New York. CCAD-PNUD/GEF. 2002. El Corredor Biológico Mesoamericano, México. Proyecto Para la Consolidación del Corredor Biológico Mesoamericano. Serie Técnica 05. [Internet page] [cited on 20 december 2009]. Available at URL: http:www.ccad.ws/pccbm/ docs/cbmmexico.pdf CNA & CMDI (Comisión Nacional del Agua y Centro para la Migración y el Desarrollo Internacional). 2000. Plan de conservación de suelos y agua para la costa de Chiapas, México. Damon, A. 2011. Diversidad y conservación de las orquídeas del corredor biológico Tacaná-Boquerón. Final report of project. FONDOS MIXTOS-CHIAPAS: CHIS-2006-C06-45802. 2007-2010. Espejo, A., A.R. López-Ferrari; R. Jiménez & L. Sánchez. 2004. Las orquídeas de los cafetales en México: una opción para el uso sostenible de ecosistemas tropicales. Rev. Biol. Trop. 53 (1-2): 73-84. Gallego, M.C. 2005. Intensidad de manejo del agroecositema del café (Coffea arabica L.) (monocultivo y policultivo) y riqueza de especies de hormigas generalistas. Boletín del Museo de Entomología de la Universidad del Valle 6 (2): 16-29. Gravendeel, B., A. Smithson, F.J.W. Slik & A. Schuiteman. 2004. Epiphytism and pollinator specialization: drivers for orchid diversity?. Phil. Trans. R. Soc. Lond. B. 359: 1523-1535. Hágsater, E.; M. Soto; G. Salazar; R. Jiménez; M. López & R. Dressler. 2005. Las Orquídeas de México. Productos Farmacéuticos, S.A. of C.V, México. Hernández-Rosas, J.I. 2000. Patrones de distribución de las epíitas vasculares y arquitectura de los foroitos de un bosque húmedo tropical del Alto Orinoco, Estado de Amazonas, Venezuela. Acta Biológica Venezuelica 20 (3): 43-60. ICO (International Coffee Organization). 2009. Historical data. [Internet page] [cited on 22 october 2009]. Available at URL: http:www.ico.org/historical.asp LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 32 LANKESTERIANA INEGI (Instituto Nacional de Estadística, Geografía e Informática). 1999. El crecimiento de la población y sus repercusiones sobre el medio ambiente de México. Anuario Estadístico, México. Johansson, D. 1974. Ecology of vascular epiphytes in West African Rain Forest. Acta Phytogeogr. Suecica 59:1-129. Krömer, T.; M. Kessler & S.R. Gradstein. 2007. Vertical stratiication of vascular epiphytes in submontane and montane forest of the Bolivian Andes: the importance of the understory. Plant Ecol. 189: 261-278. Mondragón, D.; C. Maldonado & R. Aguilar-Santelises. 2007. Life history and demography of a twig epiphyte: a case study of Erycina crista-galli (Orchidaceae). Selbyana 28 (2): 137-144. Sánchez, J.E. & R. Jarquín (ed.). 2004. La Frontera Sur. Relexiones sobre el Soconusco, Chiapas, y sus problemas ambientales, poblacionales y productivos. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. CD. ECOSUR. Solano, R., Jiménez-Machorro, R. & Damon, A. (in press). Two new records and one rediscovery for Orchidaceae of Mexico. Acta Botánica Mexicana. Tovilla, C. 2004. La dimensión de la crisis ambiental en la costa de Chiapas y la necesidad de un programa de ordenamiento de las actividades. In: Sánchez, J.E. & R. Jarquín (ed.). 2004. La Frontera Sur. Relexiones sobre el Soconusco, Chiapas, y sus problemas ambientales, poblacionales y productivos. CD. ECOSUR. Williams-Linera, G. & A. López-Gómez. 2008. Estructura y diversidad de la vegetación leñosa. In: Manson, R.H.; V. Hernández-Ortiz; S. Gallina & K. Mehltreter (ed.). 2008. Agroecosistemas cafetaleros de Veracruz: biodiversidad, manejo y conservación. Instituto de Ecología A.C. (INECOL) e Instituto Nacional de Ecología (INE-SEMARNAT), México, pp. 55-68. LANKESTERIANA 11(1): 33—38. 2011. AA frOM lOMAS fOrMATiONS. A NEw OrChidACEAE rECOrd frOM ThE dESErT COAST Of PEru Delsy Trujillo1,3 and aMalia DelgaDo roDríguez2 Research Associate, Herbario MOL, Facultad de Ciencias Forestales, Universidad Nacional Agraria La Molina. Av. La Universidad s/n. La Molina. Apartado 12-056 - Lima, Perú. 2 Laboratorio de Dicotiledóneas. Museo de Historia Natural, Universidad Nacional Mayor de San Marcos. Av. Arenales 1256. Jesús María - Lima, Perú. 3 Corresponding author: delsytrujillo@gmail.com 1 aBsTraCT. Orchid species of the genus Aa have been described as mostly restricted to high elevations zones in the Andes and mountains of Costa Rica. Here, we record populations of Aa weddelliana at lower elevations in lomas formations from the desert coast of Peru; this is the fourth species of Orchidaceae registered in Peruvian lomas. Furthermore, we illustrate and discuss some loral features of Aa weddelliana. resuMen. Las especies del género Aa han sido descritas como orquídeas restringidas generalmente a zonas altas de los Andes y montañas de Costa Rica. Se presenta el registro de poblaciones de Aa weddelliana a elevaciones más bajas, en formaciones de lomas en la costa desértica del Perú, siendo ésta la cuarta especie de Orchidaceae registrada para las formaciones de lomas. Asimismo, ilustramos y discutimos algunos aspectos lorísticos de Aa weddelliana. keyWorDs / palaBras ClaVe: Orchidaceae, Peru, Lomas formations, Desert, Aa The western coast of South America between Peru and Chile (5º-30ºS latitude) is occupied by a continuous belt of desert of 3500 km long and a surface area of about 2900 km2. Its aridity is mainly due to the Humboldt Current and the South Paciic anticyclone (Rundell et al. 1991). A combination of climate factors on the coast during winter (June-September) allows the formation of thick fog masses in the ocean. Fog comes into the continent and is intercepted by foothills near the sea, creating ample water for vegetation to lourish for a period of months. This peculiar habitat is called lomas formations and is unique in its plant community (Weberbauer 1945, Oka & Ogawa 1984, Ferreyra 1993, Dillon et al. 2003). Lomas formations occur in the desert as “fog oases” or “islands of vegetation” in disconnected localities along the coast of Peru and Chile, at elevations that generally do not exceed the 1000 m. In Peru, it has been identiied in over 70 localities ranging from Trujillo (8° S latitude) to Tacna (18º S latitude). These localities are composed of a variable mixture of annuals, short-lived perennials and in some cases even woody vegetation (Dillon et al. 2003). Some years are affected by ENSO (El Niño Southern Oscillation) events, where the occurrence of unusual precipitations during summer (DecemberMarch) alters the normal cycle of vegetation, allowing for the development of vegetation during this period. The genus Aa Rchb.f. includes terrestrial orchids with tiny and non-resupinate lowers distributed from Venezuela to the north of Chile and Argentina with a disjunct population in Costa Rica. Although some authors have claimed the distribution of Aa in South America is restricted to the highest zone of the Andes (i.e. above 3100 m.a.s.l.; Wood 2003, Álvarez-Molina & Cameron 2009), there are some populations of Aa at lower elevations. For instance, Aa achalensis Schltr. reaches 700 m of elevation in north-central Argentina (Cucucci 1964). The revision of the orchid collection at USM and recent ield work in the Southern Peruvian lomas reveal the presence of populations of Aa at elevations between 300 to 1000 m in four lomas formations from 11°21’ S to 15º 46’S latitude: Lomas de Lachay National Reserve, Department of Lima; a locality at south of Nazca, Department of Ica (the exact locality was not recorded by the collector); and Los Cerrillos 34 LANKESTERIANA and Lomas de Atiquipa, Department of Arequipa (Fig 1,2). Except for the different size of the lowers – the larger lowers are from the more southerly lomas specimens– all the specimens studied correspond to Aa weddelliana (Rchb.f.) Schltr. (Fig 3,4). Previously, this species has only been recorded at elevations between 2700-3800 m in Peru, Bolivia and Argentina (Schweinfurth 1958, Tropicos.org 2010). To the best of our knowledge, there are no previous records of Orchidaceae from the Departments of Ica and Arequipa. Therefore, A. weddelliana is the irst record from these departments. Nevertheless, it is not the only orchid recorded from the Peruvian lomas formations (Fig 1). Previous authors have identiied plants of Chloraea pavonii Lindl. in Lomas de Chancay and Amancaes; and Malaxis andicola (Ridl.) O. Ktze. in Cerro Cabras (Schweinfurth 1958, 1959, Correa 1969, Garay & Romero-González 1998). The revision of herbaria collections also shows the presence of Pelexia matucanensis (Kraenzl.) Schltr. in Cerro Campana, Cerro Cabras and Casma (A.Lopez 710, HUT; N. Angulo 765, HUT and Ferreyra 8049, MOL respectively). Like A. weddelliana, most of the records of C. pavonii, M. andicola and P. matucanensis came from the localities of middle to high elevation of the Andean Cordillera (Bennett & Christenson 1998, Schweinfurth 1958). The origin of vascular plant species within lomas formations have been grouped into 4 categories: (1) pan-tropical or weedy species, (2) long-distance disjunctions from the Northern Hemisphere desert, (3) species disjunct from the adjacent Andean Cordillera, and (4) plants restricted to the coastal desert (Dillon et al. 2003, 2009). The origin of orchid species in lomas formations likely belongs to the third category. Álvarez-Molina and Cameron (2009) point out several morphological traits found in plants of Aa as Myrosmodes Rchb.f. (Aa’s closely related genus and also considered a high elevation specialist of the Andes) that allow them to cope with the moist, freezing, and windy environments of the paramos and the arid conditions of the puna. Probably, equivalent traits will also allow A. weddelliana to develop in the harsh conditions of lomas, especially the luctuations between arid and humid conditions and strong winds that come from the sea. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. figure 1. Map including Peruvian lomas formations localities where Orchidaceae species have been recorded. Aa weddelliana (triangle), Chloraea pavonii (circle), Malaxis andicola (asterisk), Pelexia matucanensis (square). figure 2. Aa weddelliana in the Lomas de Atiquipa, Department of Arequipa. A. Panoramic view of Lomas de Atiquipa during winter. B. Plant of Aa weddelliana. C. Habitat of Aa weddelliana in Lomas de Atiquipa. D. Inlorescence of Aa weddelliana. Photographs by Amalia Delgado. Trujillo & DelgaDo — Aa from lomas formations 35 figure 3. Aa weddelliana. A. Habit. B. Flower, three views. C. Lip in natural position. D. Dissected perianth. E. Floral bract. F. Column, three views. Drawing by D. Trujillo based on K. Rahn 198, USM. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 36 LANKESTERIANA figure 4. Comparison of the lowers of Aa weddelliana. A. Flower from the holotype (G. Mandon 1167, W). B. Flower of a plant from Lomas de Lachay (A. Cano 710, USM-161164). C. Flower of a plant from Lomas de Atiquipa (R. Ferreyra 14034, USM). a– Flower. b– Floral bract. c– Dissected perianth. d– Column, ventral and dorsal view. Drawing by D. Trujillo. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. Trujillo & DelgaDo — Aa from lomas formations Regardless, more ield work and a careful examination of Aa material from the herbarium collection are necessary in order to document the real distribution of A. weddelliana, its ecology, morphological diversity and adaptations to different environments. The following description of A. weddelliana was based on the type material and specimens from the lomas formations studied in the present work. Aa weddelliana (rchb.f.) Schltr., Repert. Spec. Nov. Regni Veg. 11: 150. 1912. Altensteinia weddelliana Rchb. f.. Xenia Orchidacea 3: 19. 1878. TYPE: Bolivia, Vicinity Soratta. Paracollo, in Scritosis. 3400 m. December 1856-January 1857. Mandon 1167 (holotype: W; isotype: G,K). Fig. 4A. Plant small, terrestrial herb. Roots fasciculate, leshy. Leaves (present before lowering) forming a basal rosette, narrowly oblong, acute to acuminate, up to 11.0 x 1.7 cm. Inlorescence slender, erect, up 50 cm long, enclosed by 10 to 13 diaphanous sheaths, terminated in a densely many lowered cylindrical spike of 4-12 cm long, rachis of the spike sparsely pilose. Floral bracts ovate, acute to acuminate, margins slightly erose, relexed, 4-6 x 2.5- 3.0 mm, somewhat surpassing the lowers. Flowers non-resupinate, white with pink-brown tones. Dorsal sepal oblong-ovate, acute, 1-nerved, 1.5-2.5 x 0.8-1.0 mm. Lateral sepals shortly connate at the base, obliquely oblong, obtuse, dorsally hairy at the base, apex slightly erose, 1-nerved, 2.5-3.0 x 0.7-1.0 mm. Petals falcate-ligulate, obtuse to acute, margin variable erose (mostly the distal half), 1-nerved, 1.6-2.7 x 0.7-1.0 mm. Lip calceolate, the opening slightly projected toward, transverse, entire to obscurely 3-lobed, margins lacerate, base with two calli, 4 mm wide when expand. Column short, retuse rostelum, 0.7-1.5 mm long, straight in young lowers and bent in old lowers. Stigma quadrate in young lowers and transversely elongate in old lowers.. Ovary subcylindric, hairy, 2.0-2.5 mm long. MaTerial sTuDieD: PERU. Arequipa: Caravelí, Arajaipampa, Lomas de Atiquipa, 980 m en suelo franco arcilloso, creciendo bajo el refugio de Cytharexylum lexuosum, lores blancas, 16 febrero 2008, A. Delgado 4021. Caravelí, lomas de Los Cerrillos, entre Nazca y Chala, 700 m, habitat rocoso, sépalos y pétalos rosado- 37 parduzcos, labelo blanquecino, 23 setiembre 1958, R. Ferreyra 13455, USM. Caravelí, encima de Atiquipa, sobre rocas, 600-700 m, lores blancas, 20 diciembre 1959, R. Ferreyra 14034, USM (illustration voucher, Fig. 4C). ica: Nazca, km 52.4 al sur de Nazca, entre rocas, 18 octubre 1957, K. Rahn 198, USM (illustration voucher, Fig. 3). lima: Huaura, Lomas de Lachay, suelo arenoso, con zonas pedregoso-rocoso, 300-700 m, hierba epíita, escasa, sólo frutos secos, 23 febrero 1996, A. Cano et al. 7101, USM-166101. Chancay, Lomas de Lachay, Km 105 carretera Panamericana Norte, suelos arenosos, arenoso-arcillosos, con partes pedregosas y rocosas, 300-700 m, hierba epíita, escasa, solo frutos secos, 24 febrero 1996, A. Cano et al. 7101, USM-161164 (illustration voucher, Fig. 4B). oTher reCorDs: PERU. ica: Ica, Santiago, Lomas de Amara - Ullujalla, loma con gran captación de humedad de neblina y vientos fuertes, 834 m, suelo arenoso semidescubierto con parches dispersos, 7 diciembre 2007, A. Orellana & O. Whaley 353 (digital photo). DisTriBuTion: Central and southern coast of Peru, Bolivia and North Argentina, between 300 and 3800 m of elevation. haBiTaT anD eCology: In sandy, sandy-clay, stony and rocky soils of lomas formations, paramos and puna. Occasionally plants of A. weddelliana can grow on decaying tree trunks in the lomas formations and is recorded as epiphyte (personal communication with the collector of A. Cano 7101). Flowering from September to February. In the original description of A. weddelliana, Reichenbach (1878) indicated that the loral bracts are shorter than the lower and 5-lobed rostellum. However, after examination of the type material in W (Fig 4A.), it was found that when the loral bracts –relexed in natural position– are expanded and measured, they are longer than the lower. The rostellum is without lobes; the appearance of lobes must be a deformation created during the preparation of the herbarium material or the rehydration of the lower for study. Two loral features were also noticed during the present study that were neither mentioned in the original description of Reichenbach, nor in the work of Schweinfurth (1958): petals with erose margin and ovary hairy. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 38 LANKESTERIANA aCknoWleDgeMenTs. We want to thank to the curators of W and USM for having allowed us access to study the herbarium material and to rehydrate some of the specimens mentioned here. To Jose Roque for his help in the map elaboration. To William R. Morrison III for his suggestions on improving the manuscript. To the Lomas de Atiquipa´s inhabitants for their logistical support. And, to Oliver Whaley and Alonso Orellana for sharing their photographic records of Lomas de Amara. liTeraTure CiTeD Álvarez-Molina, A. & K.M. Cameron. 2009. Molecular phylogenetics of Prescottiinae s.l. and their close allies (Orchidaceae, Cranichideae) inferred from plastid and nuclear ribosomal DNA sequences. Amer. J. Bot. 96: 1020–1040. Bennett, D.E. & E.A.Christenson 1998. Chloraea pavoni Lindl. Icones Orchid. Peruv. pl. 425. Cocucci, A.E. 1964. The life-history of Aa achalensis Schlechter (Orchidaceae) Phytomorphology 14: 588597. Correa, M.N. 1969. “Chloraea” género sudamericano de Orchidaceae. Darwiniana 15:374-500. Dillon, M.O., M. Nakazawa & S. Leiva. 2003. The lomas formations of coastal Peru: composition and biogeographic history. Pp. 1-9 in: J. Haas & M.O. Dillon (eds.), El Niño in Peru: biology and culture over 10,000 years. Fieldiana Bot. 43. Dillon, M.O., T. Tu, L. Xie, V. Quipuscoa & J. Wen. 2009. Biogeographic diversiication in Nolana (Solanaceae), a ubiquitous member of the Atacama and Peruvian LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. deserts along the western coast of South America. J. Syst. Evol. 47: 457–476. Ferreyra, R. 1993. Registros de la vegetación en la costa peruana en relación con el Fenómeno El Niño. Bull. Inst. fr. etudes andines. 22: 259-266. Garay, L.A. & G. Romero-González. 1998. Schedulae Orchidum. Harvard Pap. Bot. 3: 53-62. Oka, S. & H. Ogawa. 1984. The distribution of lomas vegetation and its climatic environments along the Paciic Coast of Peru. Geogr. Rep. Tokyo metrop. Univ. 19:113-125. Reichenbach, H.G. 1878. Orchideae Mandonianae. Xenia Orchid. 3: 17-19. Rundell, P.W., M.O. Dillon, B. Palma, H.A. Mooney, S.L. Gulmon & J.R. Erlenberg. 1991. The phytogeography and ecology of the coastal Atacama and Peruvian deserts. Aliso 13: 1-49. Schlechter, R. 1912. Die Orchideen Gattungen Altensteinia HBK, Aa Rchb.f. und Myrosmodes Rchb.f.. Repert Spec. Nov. Regni Veg. 11: 147-150. Schweinfurth, C. 1958. Orchids of Peru. Fieldiana Bot. 30: 1-260. Schweinfurth, C. 1959. Orchids of Peru. Fieldiana Bot. 30: 261-531. Tropicos.org. 2010. Missouri Botanical Garden. http:// www.tropicos.org/Name/23505925. Accessed 08 Nov 2010. Weberbauer, A. 1945. El mundo vegetal de los Andes peruanos. Estudio itogeográico. Lima. Ministerio de Agricultura. Wood, J. 2003. Aa. Pp. 24-26 in: A.M. Pridgeon, P.J. Cribb, N.W. Chase & F.N. Rasmussen (eds.), Genera Orchidacearum, 3: Orchidoideae part 2, Vanilloideae. Oxford University Press, Oxford. LANKESTERIANA 11(1): 39—54. 2011. ANATOMíA fOliAr dE OChO ESPECiES dE OrquídEAS EPífiTAS rafael aréValo1,2,3, juana figueroa2 & sanTiago MaDriñán2 1 Department of Botany, University of Wisconsin-Madison, 430 Lincoln Drive, Madison, WI 53706-1381, U.S.A. 2 Laboratorio de Botánica y Sistemática, Universidad de los Andes, Bogotá, Apartado 4976, Colombia. 3 Autor para correspondencia: rafarev@gmail.com resuMen. Para contribuir con el conocimiento de las bases vegetativas del epiitismo en Orchidaceae, se desarrolló un estudio de las variaciones anatómicas foliares que pueden presentarse en diferentes tipos de plantas epiitas. Se escogieron cuatro especies que representaran las diferentes categorías de epíitas—epíita de humus (Oncidium abortivum Rchb.f.), epíita de corteza (Epidendrum excisum Lindl.) y epiitas de ramita (Rodriguezia lehmannii Rchb.f. e Hirtzia escobarii Dodson) —, y cuatro especies que crecieran como epíitas y como plantas terrestres—Elleanthus oliganthus (Poepp. & Endl.) Rchb.f., Elleanthus purpureus (Rchb.f.) Rchb.f., Pleurothallis cordifolia Rchb.f. & H.Wagener, y Stelis sp. Distintas combinaciones de caracteres xerofíticos propios de plantas adaptadas a crecer en ambientes con baja disponibilidad de recursos hídricos se evidenciaron en todas las especies: mayor desarrollo de células de la epidermis adaxial, engrosamientos de las paredes periclinales de la epidermis, tricomas glandulares, estomas con poro protegido, ocurrencia de hipodermis, haces de células esclerenquimáticas, presencia de diferentes tipos de idioblastos y células esclerenquimáticas rodeando los haces vasculares. Las epíitas de ramita, restringidas a los ejes más pequeños y expuestos de sus hospederos, presentaron varios de estos caracteres. aBsTraCT. Leafs of representative epiphytic orchids were examined for anatomical detail. Four species representing the different epiphyte categories were selected for the study: Oncidium abortivum Rchb.f. (humus epiphyte), Epidendrum excisum Lindl. (branch epiphyte), Rodriguezia lehmannii Rchb.f., and Hirtzia escobarii Dodson(twig epiphytes). Additionally, four orchid species capable of developing as terrestrial plants and as epiphytes were also examined: Elleanthus oliganthus (Poepp. & Endl.) Rchb.f., Elleanthus purpureus (Rchb.f.) Rchb.f. Pleurothallis cordifolia Rchb.f. & H.Wagener, and Stelis sp. Various xerophytic characters, that could be considered leaf adaptations to water shortage in the epiphytic habit, were common for most species: greater development of adaxial epidermal cells, stomata with protected pores, occurrence of hypodermis, presence of iber bundles, different type of idioblasts, and sclerenchyma present adjacent to the xylem and phloem. Twig epiphytes, restricted to the outermost axes of their hosts, exhibit several of these modiications. palaBras ClaVe / key WorDs: Anatomía foliar, Orchidaceae, Epiitismo, Adaptación, Leaf anatomy, Epiphytism, Adaptation. introducción. La familia Orchidaceae es considerada una de las familias más grandes de plantas vasculares con más de 25,000 especies distribuidas por todo el planeta (Dressler 1981, 2005). Con el 70% de sus especies presentando una forma de vida epíita, constituyen más de dos tercios de todas las epíitas vasculares, siendo el grupo más diverso de este tipo de plantas (Atwood 1986, Kress 1986). Con el objeto de clasiicar a las orquídeas epíitas, Dressler (1981) planteó tres categorías ecológicas generales: las epíitas de humus, que crecen solamente donde exista una capa de humus; las epíitas de corteza, que se adhieren con irmeza a troncos y ramas grandes; y las epíitas de ramita, plantas diminutas que se encuentran en los ejes más pequeños y expuestos de sus hospederos. Varias modiicaciones estructurales y adaptaciones isiológicas están relacionadas con la expresión y surgimiento del epiitismo dentro de las Orchidaceae. Estas incluyen: la anatomía particular de sus raíces (presencia de exodermis y velamen); los pseudobulbos 40 LANKESTERIANA o engrosamientos en el tallo; la disposición, morfología y anatomía de las hojas; los patrones de crecimiento; y la ruta metabólica fotosintética conocida como metabolismo ácido de las crasulaceas–CAM, por sus siglas en inglés (Dressler 1981, Benzing & Ott 1981, Benzing et al. 1983, Benzing & Atwood 1984, Benzing 1989, Benzing 1990, Sinclair 1990, Silvera et al. 2009). La interacción de estos caracteres y mecanismos, en combinación con las características reproductivas únicas que presentan—como la gran cantidad de semillas diminutas adaptadas a la dispersión por viento (microspermia), la relación simbiótica con micorrizas para la germinación (micotrofía), y la estructura loral modiicada para polinizadores especíicos (resupinación, labelo, columna y polinaria)—, han otorgado a las orquídeas grandes oportunidades evolutivas que han facilitado su expansión y la colonización del dosel en los bosques tropicales (Benzing & Atwood 1984, Benzing 1986, Goh & Kluge 1989). Se ha argumentado que la limitante abiótica más relevante para el crecimiento y funcionamiento vegetativo de las epíitas vasculares es la escasez de agua (Zotz & Hietz 2001). La toma efectiva de agua, el almacenamiento dentro de la planta y el control de la pérdida de ésta, son factores determinantes en la expresión del epiitismo en las orquídeas (Sinclair 1990). Johansson (1975) sostuvo que el patrón de distribución espacial de las orquídeas epíitas parecía ser el resultado de la interacción entre la necesidad por captar altas intensidades lumínicas y la capacidad de tolerar la fuerza de evaporación del aire. Puesto que las hojas son el lugar principal en donde se lleva a cabo la fotosíntesis, estas deben mantener un intercambio de gases adecuado con el aire circundante, lo que conlleva una pérdida de agua inevitable. Cualquier planta sujeta a escasez de agua, debe poseer modiicaciones en la morfología, anatomía y isiología de sus hojas, y la estructura de estas, también debe relejar la respuesta de la planta a los recursos que se encuentran a su disposición (Sinclair 1990, Garnier & Laurent 1994, Reich et al. 1999). La reducción de la transpiración y el almacenamiento de agua, hacen parte de las estrategias que poseen las hojas para tolerar sequías. En las orquídeas, dentro los caracteres de las hojas que permiten reducir la pérdida de agua se encuentran: el grosor de la cutícula, la LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. densidad y distribución de los estomas, la presencia de pelos supericiales y el hecho de ser deciduas (Sinclair 1990). Para el almacenamiento de agua, las hojas de algunas orquídeas poseen una hipodermis que funciona como tejido de acumulación de agua , que en algunos géneros puede llegar a ocupar hasta el 80% del volumen de la hoja (Pridgeon 1986). Dentro del tejido hipodérmico también se pueden encontrar idioblastos con paredes engrosadas que acumulan agua y evitan el colapso del tejido durante los periodos de desecación (Olatunji et al. 1980). En otros casos, las células del mesóilo se agrandan y pueden asumir una función de almacenamiento mientras retienen algunos cloroplastos (Sinclair 1990). Con el presente trabajo se amplía el conocimiento sobre los caracteres foliares asociados con el hábito epíito, basándose en ocho especies de orquídeas que representan formas de crecimiento variado. A continuación, se describe la anatomía foliar de cuatro especies que representan a los distintos tipos ecológicos de epíitas propuestos por Dressler (1981), y cuatro especies que se encontraron creciendo como plantas terrestres y como epíitas. Materiales y métodos. Se escogieron cuatro especies de orquídeas que representaran a cada una de las categorías de epíitas propuestas por Dressler (1981)—epíita de humus, epíita de corteza y epíita de ramita—y cuatro especies de orquídeas que crecían como plantas terrestres, enraizadas y expuestas en taludes de una carretera y como epíitas de corteza, sobre árboles dentro de un bosque húmedo de montaña (Tabla 1). Las especies estudiadas fueron colectadas en su hábitat natural: Elleanthus oliganthus, E. purpureus, Pleurothaillis cordifolia, Stelis sp. y Rodriguezia lehmannii, en la vereda Monte Bello , municipio de Pueblo Rico, departamento de Risaralda (05º14’40” N, 76º06’15” W); Oncidium abortivum y Epidendrum excisum, en un bosque húmedo de montaña de la vereda Cedeño , municipio Támesis, departamento de Antioquia (05º34’53” N, 75º42’13” W); e Hirtzia escobarii en cultivos de guayaba en la vereda Toriba Bajo , Municipio San Francisco, departamento de Cundinamarca (04º37’0” N, 74º48’0” W). Los individuos muestreados fueron plantas adultas, en estado de loración y que no presentaban síntomas aréValo et al. — Anatomía Foliar de Orquídeas Epíitas 41 TaBla 1. Lista de especies de orquídeas estudiadas. Especie Categoría de epíita Colector y No. Herbario Oncidium abortivum Rchb.f. Epíia de humus J. Figueroa 36 ANDES Epidendrum excisum Lindl. Epíita de corteza J. Figueroa 14 ANDES Hirtzia escobarii Dodson Epíita de ramita J. Figueroa 7 ANDES Rodriguezia lehmannii Rchb.f. Epíita de ramita R. Arévalo 684 ANDES Elleanthus oliganthus (Poepp. & Endl.) Rchb.f Epíita de corteza / terrestre R. Arévalo 456 ANDES Elleanthus purpureus (Rchb.f) Rchb.f Epíita de corteza / terrestre R. Arévalo 679 ANDES Pleurothallis cordifolia Rchb.f. & H.Wagener Epíita de corteza / terrestre R. Arévalo 482 ANDES Stelis sp. Epíita de corteza / terrestre R. Arévalo 504 ANDES de ataques por parte de patógenos o herbívoros. Hojas maduras y completamente expandidas (1 hoja por planta, 5 plantas por especie) fueron almacenadas en solución ijadora 1:1:18 de 40% formol, ácido acético y 70% alcohol (70%) (FAA) para ser llevadas al laboratorio donde se efectuaron los análisis anatómicos. A cada hoja se le hicieron cortes transversales a mano alzada y a nivel de la parte media. Se tomaron medidas del grosor de la hoja y de las cutículas (5 medidas por hoja, 25 por especie) usando un microscopio Nikon® Eclipse 4000 equipado con un micrómetro ocular. Los resultados fueron registrados a través de microfotografías. La presencia de elementos ligniicados se detectó mediante el uso de azul de toluidina 0 (Herr 1993). Se describe la anatomía foliar de las distintas especies teniendo en cuenta múltiples observaciones (cortes) y con base en los siguientes caracteres: cutícula, células epidérmicas, estomas, haces ibrosos, hipodermis, mesóilo y haces vasculares. resultados epífiTa De huMus Oncidium abortivum: hojas coriáceas, duras, conduplicadas, lanceoladas, 332.4 ± 64.9 mm de grosor. Cutícula adaxial 2.7 ± 0.3 mm de grosor; abaxial 1.5 ± 0.2 mm de grosor. Células epidérmicas oblongas; las células adaxiales más grandes que las abaxiales. Estomas al mismo nivel de las células epidérmicas; cámara subestomática más grande que células del mesóilo adyacentes. Haces ibrosos abaxiales en dos series que se alternan (Fig. 1A). Hipodermis adaxial uniseriada, interrumpida por idioblastos angulares con paredes ligniicadas gruesas (Fig. 1B); abaxial ausente. Mesóilo homogéneo, 10–12 células de grosor, redondas a oblongas, con paredes delgadas. Haces vasculares de diferentes tamaños, intercalados; xilema y loema rodeado por vaina vascular más gruesa hacia los polos. epífiTa De CorTeza epidendrum excisum: hojas coriáceas, carnosas, conduplicadas, ovadas, 1014.0 ± 161.62 mm de grosor. Cutícula 12.7 ± 1.68 mm de grosor; 8.7 ± 0.82 mm de grosor. Células epidérmicas rectangulares a cuadradas, paredes celulares periclinales engrosadas (Fig. 2A). Estomas ligeramente hundidos en relación a las células epidérmicas; cámara subestomática más pequeña que células adyacentes del mesóilo; con proyecciones cuticulares (Fig. 2B). Haces ibrosos ausentes. Hipodermis adaxial 3–4 células de grosor, presencia de idioblastos con leves engrosamientos parietales en bandas irregulares (Fig. 2A); abaxial uniseriada. paredes celulares engrosadas. Mesóilo homogéneo, 13–15 células de grosor, células con grandes vacuolas (Fig. 2C); idioblastos con raidios de gran tamaño (Fig. 2D). Haces vasculares de diferentes tamaños, intercalados; xilema y loema rodeado por vaina vascular más gruesa hacia el polo del xilema en los haces más grandes (Fig. 2C). epifiTas De raMiTa Hirtzia escobarii: hojas coriáceas, carnosas, fuertemente conduplicadas, elípiticas, angostas, 2315.4 ± 196.9 mm de grosor. Cutícula adaxial 5.6 ± 0.2 mm LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 42 LANKESTERIANA figura 1. Oncidium abortivum: A. Aspecto general; células de la epidermis adaxial (ead) de mayor tamaño que las de la epidermis abaxial, células del mesóilo (m) redondas a oblongas, haces vasculares (hv) de varios tamaños, dos series de haces ibrosos en región abaxial (hf). B. Idioblasto angular con engrosamiento parietal ligniicado (il). Escalas: A=300mm; B=40mm. de grosor; abaxial 3.8 ± 0.82 mm de grosor. Células epidérmicas oblongas. Estomas al mismo nivel de las demás células epidérmicas; cámara subestomática más pequeña que células adyacentes del mesóilo; proyecciones cuticulares externas presentes. Haces ibrosos compuestos por varias células con paredes ligniicadas gruesas, dispuestos en una serie a nivel de la hipodermis abaxial (Fig. 3A: hf). Hipodermis adaxial uniseriada, células dipuestas anticlinalmente, de tamaño variado, con paredes ligniicadas gruesas (Fig. 3B: hl); abaxial uniseriada, células isodiamétricas a oblongas, con paredes ligniicadas gruesas, interrumpida por haces ibrosos (Fig. 3A). Mesóilo homogéneo, alrededor de 20 células de grosor, células isodiamétricas hacia la parte media, alargadas anticlinalmente hacia ambas supericies, células con grandes vacuolas que ocupan gran parte del volumen celular; idioblastos globosos con leves engrosamientos transversales en bandas irregulares (Fig. 3C). Haces vasculares de diferentes tamaños, intercalados; xilema y loema rodeado por vaina vascular cuyas células esclerenquimáticas presentan paredes más gruesas hacia los polos (Fig. 3D). rodriguezia lehmannii: hojas coriáceas, carnosas, conduplicadas y elípticas, 1570.4 ± 265.07 LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. mm de grosor. Cutícula adaxial lisa, 12.3 ± 2.67 mm de grosor; abaxial ligeramente bulada, 6.0 ± 1.01 mm de grosor. Células epidérmicas oblongas, dispuestas periclinalmente, de mayor tamaño en la supericie adaxial (Fig. 4A). Estomas al mismo nivel de las demás células epidérmicas; cámara subestomática de menor tamaño que células adyacentes del mesóilo; proyecciones cuticulares externas pronunciadas formando una cámara supraestomática (Fig. 4B). Haces ibrosos compuestos por grupos de células esclerenquimáticas, en una serie y al mismo nivel de la hipodermis abaxial (Fig. 4A y C). Hipodermis adaxial uniseriada interrumpida por idioblastos elipsoidales a cilíndricos y con engrosamientos parietales helicoidales (Fig. 4D); la abaxial uniseriada, con células de paredes ligniicadas gruesas intercalándose con haces ibrosos (Fig. 4C). Mesóilo relativamente homogéneo, 9–10 células de grosor, las adaxiales con más cloroplastos y todas con vacuolas grandes que ocupan gran parte del volumen celular (Fig. 4D). Haces vasculares hacia la parte media de la hoja; xilema y loema rodeado por vaina vascular cuyas células esclerenquimáticas presentan paredes celulares más gruesas hacia el polo del loema (Fig.4E). aréValo et al. — Anatomía Foliar de Orquídeas Epíitas 43 figura 2. Epidendrum cf. excisum. A. Idioblasto (i) con engrosamiento parietal secundario en forma de bandas irregulares, paredes periclinales de la epidermis gruesas (ep). B. Estoma (e) con células guardia de lumen triangular y cámara subestomática (csb) de menor tamaño que células del mesóilo adyacentes. C. Aspecto general; vacuolas (v) que ocupan gran parte del volumen celular. d. Raidios de gran tamaño. Escalas: A=10mm; B,D=30 mm; C=200 mm. epífiTas y TerresTres elleanthus oliganthus: hojas plicadas, ovadas, 217.0 ± 15.8 mm de grosor en epíitas y 228.8 ± 20.2 mm de grosor en terrestres. Cutícula adaxial levemente bulada, 4.6 ± 0.8 mm de grosor en epíitas y 4.2 ± 1.0 en terrestres; abaxial de textura algo verrugosa—con pequeñas proyecciones granulares (Fig. 5A), 2.3 ± 0.4 mm de grosor en epíitas y 2.4 ± 0.2 mm de grosor en terrestres. Células epidérmicas oblongas a isodiamétricas, las adaxiales más grandes e isodiamétricas; tricomas glandulares situados en supericie abaxial (Fig. B). Estomas al mismo nivel de las demás células epidérmicas; cámara subestomática del mismo tamaño que células adyacentes del mesóilo; leves proyecciones cuticulares externas e internas (Fig. 5A, e). Haces ibrosos ausentes. Hipodermis ausente. Mesóilo relativamente homogéneo, 5–7 células de LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 44 LANKESTERIANA figura 3. Hirtzia escobarii: A. Hipodermis abaxial ligniicada (hl) interrumpida por haces ibrosos (hf). B. Hipodermis adaxial de células con paredes ligniicadas gruesas (hl), vacuolas (v) que ocupan gran parte del volumen celular. C. Idioblasto globoso con engrosamiento parietal secundario en forma de bandas irregulares (i). d. Disposición radiada de células que rodean haz vascular (hv), xilema y loema rodeado por vaina vascular (vv). Escalas: A,B=60mm , C=30 mm. D=10mm. grosor, células oblongas; idioblastos con raidios presentes (Fig. 5C). Haces vasculares de diferentes tamaños, haces grandes se alternan con dos tipos de haces mas pequeños; los haces grandes con el xilema y loema rodeado por vaina vascular más gruesa hacia los polos (Fig. 5D). elleanthus purpureus: hojas plicadas, ovadas, 175.4 ± 9.4 mm de grosor en epíitas y 255.3 ± 14.6 mm LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. de grosor. Cutícula adaxial lisa a ligeramente bulada a lo largo del contorno de las células epidérmicas, 4.5 ± 0.4 mm de grosor en epíitas y 7.0 ± 0.9 mm de grosor en terrestres; abaxial inamente bulada a lo largo del contorno de las células epidérmicas, 1.9 ± 0.3 mm de grosor en epíitas y 3.7 ± 0.5 mm de grosor en terrestres (Fig. 6A). Células epidérmicas isodiamétricas a oblongas; tricomas glandulares situados en depresiones epidérmicas presentes en aréValo et al. — Anatomía Foliar de Orquídeas Epíitas 45 figura 4. Rodriguezia lehmannii: A. Aspecto general; células de la epidermis adaxial (ead) de mayor tamaño que las de la epidermis abaxial, hipodermis adaxial (h) constituida por idioblastos (i) con engrosamientos parietales helicoidales, células del mesóilo con vacuolas que ocupan gran parte del volumen celular (v), haces vasculares (hv) grandes y pequeños. B. Estoma (e) con proyecciones cuticulares (pc) pronunciadas y cámara supraestomática (csp) alargada. C. Hipodermis abaxial ligniicada (hl) interrumpida por haces ibrosos (hf). d. Idioblasto (i) elipsoidal con engrosamiento parietal secundario helicoidal. E. Haz vascular (x y f) rodeado por vaina vascular (vv), cuyas células esclerenquimáticas presentan paredes celulares más gruesas hacia el polo del loema (f). Escalas: A,B,C=30mm; D=400 mm; E=40mm. ambas supericies (Fig. 6B). Estomas al mismo nivel de las demás células epidérmicas; cámara subestomática de igual o mayor tamaño que células adyacentes del mesóilo; proyecciones cuticulares externas presentes (Fig. 6A). Haces ibrosos ausentes. Hipodermis ausente. Mesóilo heterogéneo, 7–10 células de grosor, las células abaxiales, dispuestas periclinalmente, oblongas a isodiamétricas, con espacios intercelulares conspicuos (parénquima esponjoso); las adaxiales en dos series de células isiodiamétricas (parénquima empalizada) (Fig. 6C); idioblastos con raidios e idioblastos mucílaginosos presentes. Haces vasculares de diferentes tamaños, haces grandes se alternan con dos tipos de haces LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 46 LANKESTERIANA figura 5. Elleanthus oliganthus. A. Estoma (e) con células guardia de lumen triangular y cámara subestomática. (csb) de igual tamaño a células del mesóilo adyacentes, leves proyecciones cuticulares. internas (pc). B. Tricoma glandular de la supericial abaxial de la hoja. C. Aspecto general; cutícula adaxial levemente abollada (cad), cutícula abaxial abollada de textura verrugosa (cab), células del mesóilo oblongas dispuestas periclinalmente (m), idioblasto con raidios (ir). C. Haz vascular central (hvc), células de esclerénquima (ce) concentradas hacia los polos del loema y del xilema. Escalas: A=30 mm; B=50mm; C=100 mm; D=200 mm. más pequeños; xilema y loema rodeado por vaina vascular más gruesa hacía los polos. pleurothallis cordifolia: hojas coriáceas, algo carnosas, fuertemente cordadas, 838.7 ± 75.6 mm de grosor en epíitas y 942.1 ± 71.3 mm de grosor en terrestres. Cutícula adaxial lisa, 7.9 ± 0.7 mm de grosor en epíitas y 7.9 ± 1.4 mm de grosor en terrestres; LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. abaxial lisa, 2.1 ± 0.2 mm de grosor en epíitas y 2.6 ± 0.4 mm de grosor en terrestres. Células epidérmicas oblongas a rectangulares; tricomas glandulares situados en depresiones epidérmicas presentes en ambas supericies (Fig. 7A). Estomas al mismo nivel de las demás células epidérmicas; cámara subestomática de mayor o igual tamaño que células adyacentes del mesóilo (Fig. 7B). Haces ibrosos ausentes. aréValo et al. — Anatomía Foliar de Orquídeas Epíitas 47 figura 6. Elleanthus purpureus. A. Cutícula abaxial inamente abollada (cab), estoma (e) con proyecciones cuticulares curvas y cámara subestomática (csb) de menor tamaño que células del mesóilo adyacentes. B. Tricoma glandular (tg). C. Aspecto general; cutícula adaxial lisa a ligeramente abollada (cad), células del mesóilo (m) oblongas a isodiamétricas con espacios intracelulares conspicuos (ei). Escalas: A=30 mm; B=50 mm; C=300 mm. Hipodermis adaxial compuesta por dos series, células con engrosamientos parietales helicoidales; abaxial uniseriada, células con engrosamientos parietales helicoidales. Mesóilo heterogéneo, 8–10 células de grosor; el parénquima esponjoso compuesto por células oblongas a isodiamétricas; grandes idioblastos ovoides, con engrosamientos helicoidales e idioblastos con rafídios (Fig. 7C y D); el parénquima empalizada compuesto por dos series, una serie de células columnares, y otra de células oblongas a isodiamétricas (Fig. 7E); en algunas células del mesóilo se presentan pequeñas gotas amarillas de aceite. Haces vasculares de diferentes tamaños, distribuidos en una serie ubicada entre el mesóilo de empalizada y el esponjoso: xilema y loema rodeado por vaina vascular; una serie de células esclerenquimáticas separa el xilema del loema. stelis sp.: hojas coriáceas, carnosas, ovadas, 661.3 ± 60.5 mm de grosor en epíitas y 814.0 ± 121.7 mm de grosor en terrestres. Cutícula adaxial lisa, 4.6 ± 0.4 mm de grosor en epíitas y 7.2 ± 2.1 mm de grosor en terrestres; abaxial lisa 2.0 ± 0.1 mm de grosor en epíitas y 2.8 ± 0.9 mm de grosor en terrestres. Células epidérmicas dispuestas periclinalmente y oblongas a rectangulares, las adaxiales más grandes; tricomas glandulares en depresiones epidérmicas presentes en LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 48 LANKESTERIANA figura 7. Pleurothallis cordifolia. A. Tricoma glandular (tg). B. Estoma (e) con células guardia de lumen triangular y cámara subestomática (csb) de igual tamaño que células del mesóilo adyacentes. C. Idioblastos (i) ovoides con engrosamiento parietal secundario helicoidal. d. Idioblasto con raidios (ir). E. Aspecto general; células de la epidermis adaxial (ead) de mayor tamaño que las de la epidermis abaxial, parénquima empalizada (pem) de células columnares y dispuestas anticlinalmente, parénquima esponjoso (pes) de células oblongas a isodiamétricas. Escalas: A=50mm; B=30mm; C=100mm; D=40mm; E=300mm. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. aréValo et al. — Anatomía Foliar de Orquídeas Epíitas 49 figura 8. Stelis sp. A. Cutícula abaxial lisa (cab), estoma (e) con células guardia de lumen triangular y cámara subestomática (csb) de mayor tamaño que células adyacentes del mesóilo. B. Aspecto general; células de la epidermis adaxial (ead) de mayor tamaño que las de la epidermis abaxial, parénquima empalizada (pem) de células columnares dispuestas anticlinalmente, parénquima esponjoso (pes) de células oblongas a isodiamétricas, hipodermis adaxial (had) de 2 a 3 capas de células, hipodermis abaxial (hab) uniseriada. C. Haz vascular con serie de células esclerenquimáticas (ce) separando el xilema del loema. Escalas: A=30mm, B=400 mm, C=10mm. ambas caras y más abundantes en la supericie abaxial (no se muestran). Estomas al mismo nivel de las demás células epidérmicas; cámara subestomática de mayor tamaño que células adyacentes del mesóilo; pequeñas proyecciones cuticulares externas presentes (Fig. 8A). Haces ibrosos ausentes. Hipodermis adaxial 2–4 células de grosor, isodiamétricas; abaxial uniseriada. Mesóilo heterogéneo, 12–15 células de grosor; el parénquima esponjoso más grueso, compuesto por células oblongas a isiodiamértricas y dispuestas periclinalmente, espacios intercelulares conspicuos; el parénquima empalizada compuesto por 1–2 series adaxiales de células columnares y otra serie abaxial de células oblongas a isodiámétricas (Fig. 8B); presencia de idioblastos elongados con engrosamientos parietales helicoidales (no mostrados). Haces vasculares de varios tamaños, distribuidos en una serie; los más grandes ubicados entre los dos tipos de mesóilo y los más pequeños abaxiales; esclerénquima ocurre en forma de vainas vasculares conspicuas y completas; una serie de células esclerenquimáticas separa el xilema del loema (Fig. 8C). Resumen. En las especies estudiadas se presentaron los dos tipos de hojas que se pueden encontrar en las orquídeas (sensu Withner et al. 1974), plicadas y LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 50 LANKESTERIANA coriáceas. Todas las especies se diferenciaron en cuanto al grosor de sus hojas y las más delgadas fueron las hojas plicadas de las dos especies de Elleanthus. Entre las especies con hojas coriáceas, las dos epíitas de ramita (Hirtzia escobarii y Rodriguezia lehmannii) presentaron las hojas más gruesas, mientras la epíita de humus (Oncidium abortivum) presentó las hojas más delgadas. En cuanto al grosor de la cutícula, en todas las especies se encontró que la cutícula adaxial era más gruesa que la cutícula abaxial. Al igual que en otros representantes de la familia (Ayensu & Williams 1972, Mohana-Rao & Khasim 1987, Stern et al. 1993, Kurzweil et al. 1995), las hojas de O. abortivum, E. purpureus, R. lehmannii, Pleurothallis cordifolia y Stelis sp., presentaron una epidermis adaxial con células más grandes que las de la epidermis abaxial (Tabla 2). Tricomas glandulares fueron evidenciados tanto en las hojas coriáceas de las especies de Pleurothallis, como en las hojas plicadas de ambas especies de Elleanthus, aunque en E. oliganthus se observaron únicamente a nivel de la supericie abaxial (Tabla 2). Todas las especies estudiadas presentaron hojas hipoestomáticas y con los estomas al mismo nivel de las demás células epidérmicas (o ligeramente hundidos como Epidendrum excisum). En algunas especies estudiadas se observaron pequeñas proyecciones cuticulares curvas sobre las células guardia, similares a las que ya han sido descritas en otras especies de orquídeas (Ferreira 1992, Leiria 1997). La epíita de ramita, R. lehmannii, presentó proyecciones cuticulares externas pronunciadas, formando una cámara externa bastante alargada (Fig. 4B). La hipodermis, considerada una de las características más comunes en plantas de crecimiento epiito, se evidenció en todas las especies de hojas coriáceas, pero de manera distinta (Tabla 2). Constituida por células de mayor tamaño que las de la epidermis, se presentó adaxial y abaxialmente, exceptuando a la epíita de humus (Oncidium abortivum), donde solo ocurrió adaxialmente (Fig. 1A). En epiitas de corteza como Epidendrum excisum y Stelis sp. se observó una hipodermis adaxial de varias series, con algunas células de paredes gruesas en E. excisum (Fig. 2A) . En las epíitas de ramita (Hirtzia escobarii y Rodriguezia lehmannii), además de presentar hipodermis uniseriadas, gruesas y ligniicadas, la hipodermis abaxial se ve interrumpida, en intervalos mas o menos regulares, por haces ibrosos (Fig. 4C). Estos haces LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. también fueron observados a nivel del mesóilo en la epiita de humus O. abortivum (Fig. 1A). Se presentaron especies con hojas de mesóilo homogéneo y especies con hojas de mesóilo heterogéneo. En aquellas especies con mesóilo heterogéneo (Pleurothallis cordifolia, Stelis sp. y Elleanthus purpureus), el mesóilo se diferencia claramente en parénquima de empalizada y parénquima esponjoso. En las especies en las que el mesóilo es relativamente homogéneo (E. oliganthus y Rodriguezia lehmannii), se observan variaciones en el tamaño y forma de las células, así como en la cantidad de cloroplastos, sin embargo no existe una clara diferenciación en dos tipos de parénquima. En el mesóilo de la epíita de corteza Epidendrum excisum, y de las epiitas de ramita, Hirtzia escobarii y Rodriguezia lehmannii, predominan células con vacuolas bastante grandes que ocupan la mayor parte del volumen celular (Fig. 3A y 4D). Además, estas especies presentan espacios intercelulares reducidos, donde las cámaras subestomáticas son de menor tamaño que las células adyacentes del mesóilo (Fig. 2B). Se encontraron diferentes tipos de idioblastos— globosos en Hirtzia escobarii , elipsoidales a cilíndricos en Rodriguezia lehmannii, angulares en Oncidium abortivum, elongados en Stelis sp. y ovoides en Pleutothallis cordifolia—, con distintos tipos de engrosamiento parietal—irregulares en Epidendrum excisum e H. escobarii y helicoidales en R. lehmannii, P. cordifolia y Stelis sp. En las epíitas de corteza, E. excisum , Elleanthus oliganthus, E. purpureus y P. cordifolia, se presentaron idioblastos con raidios de oxalato de calcio (Fig. 2D, 5B, y 7D), corroborando descripciones anteriores sobre otros representantes de la familia (Metcalfe 1963; Wattendorff 1976; Franceschi & Horner; Kauschik 1982; Pridgeon 1982; Campos Leite & Oliveira 1987; Ferreira 1992; Widholzer 1993; Leiria 1997; Godoy & Costa 2003). En todas las especies los haces vasculares son colaterales y presentan células esclerenquimáticas que los envuelven parcial o totalmente. De acuerdo a la especie, estas células esclerenquimáticas que conforman la vaina vascular pueden estar más concentradas hacia los polos y/o variar en el grosor de sus paredes. En las dos especies de Elleanthus, en Oncidium abortivum y en Epidendrum excisum, la vaina vascular es mucho más gruesa hacia los polos del xilema y el loema que hacia la parte media. En aréValo et al. — Anatomía Foliar de Orquídeas Epíitas 51 TaBla 2. Caracteres morfológicos y anatómicos presentes en ocho especies de orquídeas epíitas. + = presente; – = ausente. Caracteres foliares relacionados con almacenamiento de agua y resistencia a desecación Especie Pseudobulbos Epidermis Tricomas Celulas epidérmicas glandulares Elleanthus oliganthus – Elleanthus purpureus – Epidendrum excisum – – Hirtzia escobarii + _ + adaxiales más + desarrolladas (abaxial) adaxiales más Oncidium abortivum + Pleurothallis cordifolia – Stelis sp. – adaxiales más + adaxiales más Rodriguezia lehmannii Mesóilo _ desarrolladas desarrolladas desarrolladas las epíitas de ramita Hirtzia escobarii y Rodriguezia lehmannii, las células esclerenquimáticas se encuentran mas concentradas hacia el polo del xilema y las células que se encuentran hacia el polo contrario del loema presentan paredes más gruesas (Fig 3D y 4E). Cabe resaltar, que dentro de las especies estudiadas que no presentaron pseudobulbos se pueden evidenciar dos tendencias. En las especies de Pleurothallis cordifolia, Stelis sp. y Epidendrum excisum, la ausencia de engrosamientos a nivel del tallo se ve contrarrestada por el desarrollo de hojas suculentas con hipodermis adaxial y abaxial, además de la presencia de células con engrosamiento parietal secundario (Tabla 2). Por su parte, en las especies de Elleanthus la ausencia de pseudobulbos se ve acompañada por hojas delgadas que no presentan tejido de almacenamiento de agua, ni células esclerenquimáticas (Tabla 2). discusión. En este estudio se pudo evidenciar como especies más expuestas a los rayos solares presentan hojas y cutículas más gruesas, como el caso de la _ hipodermis, idioblastos hipodermis ligniicada, idioblastos, haces ibrosos hipodermis, idioblastos, haces ibrosos + hipodermis, idioblastos + hipodermis, idioblastos hipodermis ligniicada, idioblastos, haces ibrosos epíitas de ramita (Rodriguezia lehmannii y Hirtzia escobarii). De la misma manera, individuos terrestres de las especies de Elleanthus purpureus, Pleurothallis cordifoila y Stelis sp., que se encontraban expuestos en los taludes de la carretera, presentaron hojas y cutículas signiicativamente más gruesas (R. Arévalo, unpubl. data). Según Kurzweil et al. (1995), las células epidérmicas de mayor tamaño pueden estar relacionadas con la función de reserva de agua (Oliveira & Sajo 1999), especialmente en aquellas hojas que no poseen tejidos de almacenamiento, como es el caso de E. purpureus. Se ha demostrado que los tricomas glandulares en especies de Pleurothallis no están involucrados en procesos de toma de agua y nutrientes por parte de la hoja (Benzing & Pridgeon 1983). Sin embargo, la función de estas estructuras podría consistir en la secreción de mucílago, que actuaría reduciendo la transpiración (Pridgeon 1982), o contribuyendo con la absorción de agua (Raciborski 1898), y de cierta manera compensando la ausencia de tallos engrosados/pseudobulbos. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 52 LANKESTERIANA Puesto que en Orchidaceae los estomas raramente ocurren hundidos (Rasmussen 1987), estos suelen exhibir otros caracteres xeromóricos. A menudo los estomas se encuentran rodeados por proyecciones cuticulares externas que forman una cámara supraestomática que protege contra la pérdida excesiva de agua y gases (Eames & MacDaniels 1925, Metcalfe 1963, Machado & Barros 1995). Estas cámaras supraestomáticas mantienen un compartimiento de aire húmedo que permite reducir la transpiración y son comunes en orquídeas epiitas que enfrentan altas temperaturas y poca disponibilidad de agua (Rosso 1966, Rasmussen 1987), como el caso de la epíita de ramita Rodriguezia lehmannii. Los grupos de células esclerenquimáticas, o haces ibrosos, conieren resistencia mecánica a las hojas en casos de deshidratación y suelen presentarse en las hojas de orquídeas especializadas a sobrevivir en hábitats xerofíticos (Withner et al. 1974). Por consiguiente, era de esperarse la presencia de estos haces en las epíitas de ramita, aunque también fueron observados a nivel del mesóilo en la epiita de humus Oncidium abortivum (Tabla 2). La abundancia de células del mesóilo con vacuolas bastante grandes que ocupan la mayor parte del volumen celular en la epíita de corteza Epidendrum excisum y en las de ramita (Rodriguezia lehmannii y Hirtzia escobarii), se presenta junto con espacios intercelulares reducidos, donde las cámaras subestomáticas son de menor tamaño que las células adyacentes del mesóilo. Éstas características foliares suelen estar asociadas a plantas con metabolismo CAM (Nelson et al. 2005). La presencia de idioblastos en el mesóilo estaría relacionada con la retención de agua y/o el soporte mecánico, evitando el colapso celular durante la desecación (Pridgeon 1982). Adicionalmente, se ha argumentado que los idioblastos con raidios, que se hayaron en las epíitas de corteza (excepto Stelis sp.), pueden estar relacionados con el balance iónico y osmoregulación de la planta (Bonates 1993). El engrosamiento en las paredes de las células esclerenquimáticas que conforman la vaina vascular podría conferirle mayor resistencia mecánica a las hojas en casos de deshidratación. La presencia de estos engrosamientos estaría relacionada entonces con la menor disponibilidad de agua que existe en un hábito LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. epíito extremo, como el que se presenta en los ejes más pequeños y expuestos de los árboles hospederos– las ramitas. El análisis de las hojas estudiadas indica la presencia de caracteres que pueden ser interpretados como adaptaciones a la economía de agua. En cada una de las plantas estudiadas se presenta una particular combinación de estos, aunque no se evidencia una clara diferenciación en la anatomía de las plantas según la categoría ecológica a la que pertenecen. Sin embargo, las epifitas de ramita se diferencian de las demás al presentar una hipodermis lignificada y varios de los caracteres propios de plantas adaptadas a crecer en ambientes con baja disponibilidad de recursos hídricos: (1) hojas y cutículas bastante gruesas; (2) estomas con cámaras supraestomáticas (en el caso de Rodriguezia lehmannii); (3) haces fibrosos; (4) hipodermis abaxial y adaxial; (5) células con grandes vacuolas; (6) vainas vasculares gruesas; y (7) teniendo en cuenta las características celulares del mesófilo, muy probablemente metabolismo CAM. Estas características deben facilitarles la colonización de la zona más expuesta a alta luminosidad y con mayor fluctuación en la disponibilidad de agua que puede encontrarse en un árbol hospedero— las ramitas. Los resultados encontrados apoyan la idea que estas plantas constituyen un ejemplo de extrema modificación morfológica y fisiológica al epifitsimo. agraDeCiMienTos. Al Parque Nacional Natural Tatamá (Unidad Administrativa Especial del Sistema de Parques Nacionales Naturales), a su director H. Ballesteros y a todos sus funcionarios, por el apoyo logístico prestado. A los asistentes en el trabajo de campo y de laboratorio durante las distintas etapas del proyecto: A. Tapasco, O. Velez, E. Cárdenas, S. Cournier, y E Realpe, J. Agudelo y J. Betancur. A P. Ortíz por su colaboración en la identiicación de especies; y a L. Nieto por su asesoría en la edición de las imágenes. A los revisores anónimos por la lectura crítica del manuscrito. Este trabajo fue parcialmente inanciado por la Fundación para la Promoción de la Investigación y la Tecnología del Banco de la República (Proyecto No. 2053), y el programa Proyectos Semilla del Comité de Investigaciones y Posgrados de la Facultad de Ciencias de la Universidad de los Andes. A los revisores anónimos por la lectura crítica del manuscrito y sus sugerencias para esta versión inal. aréValo et al. — Anatomía Foliar de Orquídeas Epíitas liTeraTura CiTaDa Atwood, J.T. 1986. The size of the Orchidaceae and the systematic distribution of epiphytic orchids. Selbyana 9: 171–186. Ayensu, E.S. & N.H. Williams. 1972. Leaf anatomy of Palumbina and Odontoglossum, subgenus Osmoglossum. Amer. Orchid Soc. Bull. 41: 687–696. Benzing, D.H. & A.M. Pridgeon. 1983. Foliar trichomes of Pleurothallidinae (Orchidaceae): Functional signiicance. Amer. J. Bot. 70(2): 173–180. Benzing, D.H. & D.W. Ott. 1981. Vegetative reduction in epiphytic Bromeliaceae and Orchidaceae: Its Origin and signiicance. Biotropica 13: 131–140. Benzing, D.H. & J.T. Atwood. 1984. Orchidaceae: ancestral habitats and current status in forest canopies. Syst. Bot. 9: 155–165. Benzing, D.H. 1986. The genesis of orchid diversity: emphasis on loral biology leads to misconceptions. Lindleyana 1(2): 73–89. Benzing, D.H. 1989. The evolution of epiphytism. Vol. 76, Pp. 15–40 en: U. Lüttge (ed.), Vascular plants as epiphytes: evolution and ecophysiology. SpringerVerlag, Berlin. Benzing, D.H. 1990. Vascular epiphytes. Cambridge University Press, Cambridge. Benzing, D.H., W.E. Friedman, G. Peterson & A. Renfrow. 1983. Shootlessness, velamentous roots, and the preeminence of Orchidaceae in the epiphytic biotope. Amer. J. Bot. 70(1): 121–133. Bonates, L.C.M. 1993. Estudos ecoisiológicos de Orchidaceae da Amazonia II – Anatomia ecológica foliar de espécies com metabolismo CAM de uma campina da Amazônia Central. Acta Amazonica 23(4): 315–348. Campos Leite, V.M. & P.L. Oliveira. 1987. Morfoanaomia foliar de Cattleya intermedia (Orchidaceae). Napaea 2: 1–10. Dressler, R.L. 1981. The orchids: Natural History and Classiication. Harvard University Press, Cambridge. Dressler, R.L. 2005. How many orchid species? Selbyana 26(1): 155–158. Eames, A.J. & L.H. MacDaniels. 1925. An introduction to plant anatomy. McGraw-Hill Book Company Inc, Nueva York. Ferreira, J.L.B. 1992. Anatomia foliar de espécies da subtribo Pleurohallidinae (Orchidaceae). Tesis de Maestría. Universidade Federal do Rio Grande do Sul, Porto Alegre. Franceschi, V.R. & H.T. Horner Jr. 1980. Calcium oxalate crystals in plants. Bot. Rev. 46: 361–427. Garnier E. & G. Laurent. 1994. Leaf anatomy, speciic mass and water content in congeneric annual and perennial 53 grass species. New Phytol. 128: 725–736. Godoy, R. & C. Costa. 2003. Anatomia foliar de quarto espécies do gênero Cattleya Lindl. (Orchidaceae) do Planalto Central Brasileiro. Acta Bot. Brasil. 17(1): 101–118. Goh C.J. & M. Kluge 1989. Gas exchange and water relations in epiphytic orchids. Cap. 6, Pp. 139–163 en: L. Ulrich (ed), Vascular Plants as epiphytes, Evolution and ecophysiology. Springer-Verlag, Berlin. Herr, J.M. 1993. Clearing techniques for the study of vascular plant tissues in whole structures and thick sections. Vol. 5, Pp. 63–84 en: C.A. Goldman, P.L. Hauta, M.A. O’Donnell, S.E. Andrew and R. Vna der Heiden (eds), Tested studies for laboratory teaching. Proceedings of the 5th Workshop/Conference of the Association for Biology Laboratory Education (ABLE). Johansson, D.A. 1975. Ecology of epiphytic orchids in west African rain forest. Amer. Orchid Soc. Bull. 44: 125–136. Kauschik, P. 1982. Anatomy of Aerides (Orchidaceae) and its ecological and taxonomical bearing. Phytomorphology 40: 157–166. Kress, W.J. 1986. The systematic distribution of vascular epiphytes: an update. Selbyana 9: 2–22. Kurzweil, H., H.P. Linder, W.L. Stern & A.M. Pridgeon. 1995. Comparative vegetative anatomy and classiication of Diseae (Orchidaceae). Bot. J. Linn. Soc. 117: 171–220. Leiria, D.P.S. 1997. Anatomia foliar das especies nativas do gênero Oncidium Sw., Seção Synsepala (Orchidaceae) ocorrentes no morro Santana (POA) – RS. Tesis de Maestría. Universidade Federal do Rio Grande do Sul, Porto Alegre. Machado, R.D. & C.F. Barros. 1995. Epidermis and epicuticular waxes of Syagrus coronata lealets. Canad. J. Bot. 73: 1947–1952. Metcalfe, C. 1963. Comparative Anatomy as a Modern Botanical Discipline. Vol. 1. Advance in Botanical Research. Academic Press, Londres y Nueva York. Mohana-Rao, P.R. & S.M. Khasim. 1987. Anatomy of three species of Bulbophyllum (Orchidaceae) with comments on their ecological adaptability and taxonomy. Proc. Indian Acad. of Sci. Pl. Sci. 97: 391–397. Nelson, E.A., T.L. Sage & R.F. Sage. 2005. Functional leaf anatomy of plants with crassulacean acid metabolism. Funct. Plant Biol. 32: 409–419. Olaunji, O.A. & R.O. Nengim. 1980. Ocurrence and distribution of tracheoidal elements in the Orchidaceae. Bot. J. Linn. Soc. 80: 357–370. Oliveira, V.D.C & M.D.G. Sajo. 1999. Anatomia foliar de especies epiitas de Orchidaceae. Revista Brasil. Bot. 22(3): 365–374. Pridgeon, A.M. 1981. Absorbing trichomes in the LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 54 LANKESTERIANA Pleurothallidinae (Orchidaceae). Amer. J. Bot. 68(1): 64–71. Pridgeon, A.M. 1982. Diagnostic anatomical characters in the Pleurothallidinae (Orchidaceae). Amer. J. Bot. 69(6): 921-938. Pridgeon, A.M. 1986. Anatomical adaptations in Orchidaceae. Lindleyana 1: 90–101. Raciborski, M. 1898. Biologische Mittheilungen aus Java. Flora 85: 325–361. Rasmussen, H. 1987. Orchid stomata structure, differentiation, funtion, and phylogeny. Vol. IV, Pp. 105–138 en: J. Arditti (ed), Orchid biology: reviews and perspectives. Cornell Universiy Press, Nueva York, Reich P.B., D.S. Ellsworth, M.B. Walters, J.M. Vose, C. Gresham, J.C. Volin & W.D. Bowman. 1999. Generality of leaf trait relationships: a test across six biomes. Ecology 80(6): 1955–1969. Rosso, S.W. 1966. The vegetative anatomy of the Cypripedioideae (Orchidaceae). Bot. J. Linn. Soc. 59: 309–341 Sinclair, R. 1990. Water relations in orchids. Vol. V, Pp. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 63–120 en: J. Arditti (ed.), Orchid biology–reviews and perspectives. Timber Press, Portland, Oregon. Stern, W.L., M.W. Morris, W.S. Judd, A.M. Pridgeon & R.L. Dressler. 1993. Comparative vegetative anatomy and systematics of Spiranthoideae (Orchidaceae). Bot. J. Linn. Soc. 113: 161–197. Wattendof, J.A. 1976. Third type of raphide crystal in the plant kingdom: Six-sided raphides with laminated sheaths in Agave americana L. Planta 130: 303–311. Widholzer, C.F. 1993. Morfo-anatomia foliar de espécies do gênero Sophronites Ldl. (Orchidaceae) ocorrentes o Rio Grande do Sul, Brasil. Dissertação de Mestrado. Universidade Federal do Rio Grande do Sul, Porto Alegre. Withner, C.L., P.K. Nelson, & P.J. Wejksnora. 1974. The anatomy of orchids. Pp. 267-334 en: C.L. Withner (ed), The Orchids: scientiic studies. John Wiley, Nueva York, Zotz G, V. Thomas & W. Hartung. 2001. Ecophysiological consequences of differences in plant size: abscisic acid relationships in the epiphytic orchid Dimerandra emarginata. Oecologia 129:179–185. LANKESTERIANA 11(1): 55—67. 2011. CONSErvATiON Of MAdAgASCAr’S grANiTE OuTCrOP OrChidS: ThE iNfluENCE Of firE ANd MOiSTurE¹ Melissa WhiTMan1,5, MiChael MeDler2, jean jaCques ranDriaManinDry3 & elisaBeTh raBakonanDrianina4 1 School of Biological Sciences, University of Nebraska, 208 Manter Hall, Lincoln, Nebraska 68588, U.S.A. 2 Huxley College of the Environment, Western Washington University, 516 High Street, Bellingham, Washington, 98225, U.S.A. 3 BP 1571, Antananarivo 101, Madagascar. 4 Département de Biologie et Ecologie Végetale. Faculté des Sciences, Université d’Antananarivo: BP 906, Antananarivo 101, Madagascar 5 Corresponding author: islandevolution@gmail.com aBsTraCT. Is there a difference in response to disturbance, or resource limitation, by similar taxa based on micro-site habitat heterogeneity? For this study we examined how ire and moisture availability inluences the distribution of terrestrial and lithophytic orchids speciic to Madagascar’s granite outcrops (inselbergs). We compared orchid density in an area with a complex mosaic of burned and non-burned vegetation patches (three years after the event). Lithophytic species (subtribe Angraecinae) were sensitive to ire, but tolerant of limited moisture availability, and had a uniform distribution pattern associated with vegetation mat size. In contrast, most terrestrial species (subtribe Habenariinae) were not impacted by ire, but were limited to slopes with high water seepage, and had a clumped distribution pattern. The results suggest varying ecological niches between orchid subtribes, and among species, occurring on shared substrate. Within the larger area, we also compared three inselbergs with different ire disturbance history. One site with potential for lightning based ires, but absence of anthropogenic ires, had the greatest diversity (subtribes, genera, and species) of orchids and the highest occurrence of species restricted to a single site. For land management purposes it is inappropriate to assume that inselberg speciic orchids will have the same response to environmental stressors. Angraecinae orchids are especially at risk from human associated ire disturbance and should be regarded as indicators for future conservation efforts. resuMé. Quelle est la réponse aux perturbations, et la limitation de l’humidité, par des taxons similaires basés sur l’hétérogénéité des micro-site de l’habitat? Pour cette étude nous avons examiné comment la disponibilité de feu et de l’humidité inluence la répartition des orchidées endémiques malgaches spéciique des afleurements de granit (inselbergs). Trois ans après le passage du feu, nous avons compare les modes de distribution et l’abondance d’orchidées dans un habitat d’une mosaïque complexe de brûlures, en tenant compte de la densité par rapport à l’intensité des dégâts d’incendie et de la disponibilité de l’humidité. Les espèces du soustribu Angraecinae ont été sensibles au feu, mais tolérant à une disponibilité limitée de l’humidité. orchidées Angraecinae avait un modèle uniforme de la distribution inluencée par la taille du tapis de végétation. Les espèces de la sous-tribu Habenariae étaient tolérants de feu, mais limitée aux pentes rocheuses humides par des écoulements d’eau. Habenariae ont été randomizes regroupés en masses compactes, inluencée par des facteurs non encore identiiés. Les résultats suggèrent l’existence de différentes stratégies de survie des espèces. Il serait inexact de penser que les orchidées voisins sur un substrat de granite aurait la même réponse à des facteurs environnementaux ou de perturbation. orchidées Angraecoid sur les inselbergs sont exposés à des menaces spéciiques et doivent être considérées comme des espèces indicatrices de la conservation est prioritaire à l’avenir. key WorDs / MoTs-Clés: conservation; inselberg de granit; Le Madagascar; Orchidaceae; Angraecinae; Habenariinae LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 56 LANKESTERIANA introduction. Madagascar is considered to be an international conservation priority area because of the high concentration of endemism and biodiversity threatened with extinction (Bosser et al. 1996, Barthlott & Porembski 1998, Du Puy & Moat 1998, Myers et al. 2000). The majority of conservation efforts to date have focused on evergreen humid forests, or deciduous, seasonally dry forests (Bosser et al. 1996, Du Puy & Moat 1998), rather than granite outcrops known as inselbergs - a habitat noted for unique lora that includes orchids, succulents, carnivorous, and desiccant tolerant species (Bosser et al. 1996, Barthlott & Porembski 1998, Fischer & Theisen 2000, Porembski & Barthlott 2000).The lack of inselberg protection is in part explained by the dificulty in identifying priority habitat at the landscape scale (based on vegetation type and subtle habitat characteristics) using satellite imagery (Du Puy & Moat 1998). There is also less social incentive to protect inselbergs because of the absence of charismatic species (such as lemurs) that appeal to ecotourism and environmental organizations (Leader-Williams & Dublin 2000), however recent multi-taxa analyses recognize the conservation importance of sites that were previously neglected such as habitat with sparse forest cover (ie central plateau massifs) or smaller sized forest remnants (Bosser et al. 1996, Kremen et al. 2008). A different challenge with managing, and maintaining, inselberg biodiversity is due to the limited number of ecological studies available (Barthlott & Porembski 1998, Fischer & Theisen 2000, Porembski & Barthlott 2000), especially those that investigate the role of disturbance on plant communities speciic to this habitat type (Bosser et al. 1996, Porembski et al. 2000, Yates et al. 2003). Fire is one of the most common forms of habitat disturbance within Madagascar and is primarily associated with human activities rather than lightning (Bloesch 1999, Kull 2000). Culturally, ire is used for agriculture, cattle grazing, deforestation, and even as form of political protest (Bloesch 1999, Kull 2000, Kull 2002, Klein 2004). Restriction of human based ires is often at odds with the interests of villagers, except in instances where the local belief systems (ie taboos against burning holy sites) either directly or indirectly beneits conservation efforts (Bloesch 1999, Klein 2004). Even though ire has been a part of the Malagasy landscape for many generations, there is still LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. much debate about the impact of ire disturbance on native habitat and the appropriate ire management approach for the future (Bloesch 1999, Kull 2000, Kull 2002, Klien 2004, Raxworthy & Nussbaum 2006). Some scientiic studies estimate that deforestation accounts for the rapid loss of 40% to 80% of Madagascar’s original forest cover (Du Puy & Moat 1998, Harper et al. 2007), while other studies indicate that habitat destruction has been grossly overestimated (Kull 2000, Kull 2002, Klein 2004). The historic landscape of the highlands of Madagascar was most likely a non-continuous mix of schlerophyllous forest, shrubland, and montane heathland with seasonal ires associated with lightning (Raxworthy & Nussbaum 1996, Bloesch 2002, Burney et al. 2003). The introduction of human set ires, extinction of megafauna, and the spread of livestock grazing dramatically changed the ire regime; ire intensity and frequency increased and resulted in the emergence of homogenous prairie grasslands as the dominant vegetation type (Bosser et al. 1996, Raxworthy & Nussbaum 1996, Du Puy & Moat 1998, Bloesch 1999, Fischer & Theisen 2000, Bloesch 2002, Burney et al. 2003). The conversion of mountain forest to grassland is considered to be nearly irreversible (Bloesch 1999). Within Madagascar, inselbergs have been described as naturally protected against ire with the bare rock around their base that acts a barrier to inhibit the spread of ire from adjacent locations (Nilsson & Rabakonandrianina 1988). The assessment of inselbergs as refuge for ire sensitive species in a ire prone landscape is consistent with observations of rock outcrops in Australia (Hopper 2000, Clarke 2002). This observation does not exclude potential lightning based ires from occurring; other studies have noted extensive ires from this ignition source (Yates et al. 2003). However high elevation areas, or other habitat with sparse or stunted vegetation (ie inselbergs), have a reduced fuel capacity that tends to result in lower intensity ires restricted to patches (Bloesch 2002) in contrast to dynamics of ires in dense forests (Clarke 2002). We addressed this ecological knowledge gap by examining the impact of ire disturbance, and moisture availability, on lora speciic to inselbergs of Madagascar. Orchids were used as indicator species of this habitat type because of the complexity of their WhiTMan et. al — Madagascar’s inselberg orchids 57 ecological relationships and high levels of endemism (Nilsson & Rabakonandrianina 1988, Nilsson et al. 1992, Pettersson & Nilsson 1993, Jacquemyn et al. 2005, Linder et al. 2005). We also recognized the lack of ecological research on Malagasy orchids, aside from those related to evolution or pollination biology (Bosser et al. 1996). For the irst portion of the study we included a general examination of orchid biodiversity and ire history of the Mt. Angavokely area, followed by a comparison of species occurrence and turnover within, and between, three inselbergs. We then performed a more in-depth analysis of orchid abundance on the inselberg that was most recently burned. Overall we determined that some endemic orchid species were highly sensitive to ire disturbance, while others were more inluenced by moisture availability, in an area with high micro-site habitat heterogeneity. (Barthlott & Porembski 1998, Fischer & Theisen 2000, Porembski & Barthlott 2000, Porembski et al. 2000). Inselbergs are often describe as ‘biological islands’ because their habitat characteristics and vegetation is exceptionally distinct from the surrounding landscape matrix (Porembski et al. 2000). The vegetation is dominated by species such as Helichrysum spp. and Senecio spp. (Asteraceae); Kalanchoe synsepala Baker (Crassulaceae); Coleochloa setifera (Ridl.) Gilly (Cyperaceae); Aloe capitata Baker (Liliaceae); Angraecum sororium Schltr. (Orchidaceae); Nematostylis anthophylla A. Rich. (Rubiaceae); Xerophyta dasyliriodes Baker (Velloziaceae); and various specis of moss, lichen, cyanobacteria, carnivorous plants, and ferns (Barthlott & Porembski 1998, Fischer & Theisen 2000, Kluge & Brulfert 2000) (Fig. 1). Methods Fire History – Our study took place in 2004, three years after a ire that burned an estimated third of the Mt. Angavokely area. The timing allowed us to assess signs of species recovery or colonization post ire disturbance. We assessed ire history using historical site descriptions and photographs (Nilsson & Rabakonandrianina 1988, Nilsson et al. 1992, Pettersson & Nilsson 1993), and by interviewing local residents and elders of the neighbouring villages of Ambohijafy and Ambohimiadona. Additional photographs, taken post-ire by J.J. Randriamanindry were also used as reference. Within the Mt. Angavokely forest area, we speciically researched the ire history of three of the largest inselbergs (Ambatolava, Ambatomisondrotra, Angavobe). The irst inselberg, Ambatolava, 1645m, had a ire that occurred in November 200l. The ire was believed to be human caused because it occurred during a period of political instability. Villagers may have used arson as a form of protest, or as an attempt to expand agropastoral ires during civil unrest (Bloesch 1999, Kull 2002). The intensity of the ire was also inluenced by the surrounding plantations of pyrophytic Eucalyptus robusta Sm., Pinus patula Schltdl. and Cham., and Pinus khasya Royle ex Hook. f.. with a higher fuel load accumulation (dry needles, fallen leaves, and bark) than the neighboring sections of native forest. In addition, the ire was ignited towards the lower side of Ambatolava and resulted Site Description – Our primary (in-depth) study took place on the Ambatolava inselberg of the Mt. Angavokely Forest Station located in the central highlands of Madagascar, 40 km SE of Antananarivo (18°55’4” S, 47°43’9” E). The site is managed by Direction Générale des Eaux et Forêts. Over the past twenty years, signiicant orchid related research has occurred at Mt. Angavokely (Nilsson & Rabakonandrianina 1988, Nilsson et al. 1992, Pettersson & Nilsson 1993, Kluge et al. 1998, Kluge & Brulfert 2000), in part because of the presence of high orchid diversity with 101 species and 22 genera identiied (Ceplitis & Broström 1998). The property is 695 ha in size, of which inselbergs with rupicolous shrubland vegetation comprise 110 ha, plantations of non-native pine and eucalyptus comprise 435 ha, and a mix of moist sub-montane forest and schlerophyllous forests occur in the remaining area (estimate of 1949 aerial photograph, Ceplitis & Broström 1998). The elevation ranges from 1,365m to 1,770m. Annual precipitation ranges from 1,500mm to 2,000mm, occurring 180 days of the year (Ceplitis & Broström 1998), with fog as the primary source of moisture during the dry season that spans from April to October (Kluge & Brulfert 2000). The inselbergs of Madagascar have granite substrate, high levels of UV radiation and wind, temperature luctuations, and thin nutrient poor soils LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 58 LANKESTERIANA A B Figure 1. A. The orchid Angraecum sororium on an unburned vegetation mat in the foreground. Severely burned vegetation mats are neighboring in the background. Whitman, 2003. B. The orchid Cynorkis unilora on a wet slope amongst charred vegetation remains. Randriamanindry, 2003. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. WhiTMan et. al — Madagascar’s inselberg orchids in an uphill burn pattern of higher intensity (Bloesch 1999) in contrast to lightning based ires (ignition at the highest point) that tend to have a downhill burn pattern of reduced destructive potential. Prior to the 2001 ire, Ambatolava was noted for its high density of A. sororium (Nilsson & Rabakonandrianina 1988). The second inselberg, Ambatomisondrotra, 1650m, was the site of a high intensity ire that occurred in the early 1990’s (also believed to be human caused). Prior reports noted that the area once had similar vegetation composition as the unburned regions of the Ambatolava inselberg (unpubl. data). The ire resulted in near complete removal of larger shrubs from the mid to upper portion of the inselberg. Ambatomisondrotra had a more uniform burn pattern than Ambatolava because of the steepness of the slope (Bloesch 1999) and from observations of the site shortly after the event (Randriamanindry, pers. comm. 2004). The third inselberg Angavobe, 1755m, was a site with unique cultural signiicant that inluenced the ire regime history. Local villagers described social fady, a taboo based belief system, that discouraged people from setting ire to the forest because of the presence of royal tombs (featuring pre and post Christianity stylization) and sacriicial stones (Randriamanindry, pers. comm. 2004). The oldest tomb was associated with Andrianajavonana, “the noble who disappeared” a Merina king of the Central Highlands estimated to be from the 14th century (Randriamanindry, pers. comm. 2004). Commoners were socially prohibited from harming the forest on Angavobe nearest the tombs because it was considered to be property of royalty even after death (Randriamanindry, pers. comm. 2004). A secondary social incentive was reinforced in the 1800’s during the reign of Queen Ranavalona I when the Angavobe caves were used as refuge from slavery and religious prosecution (Randriamanindry, pers. comm. 2004). This social belief system created small protected areas of native vegetation where lightning, but not human based ires, have existed for generations. General Orchid Survey – We conducted a rapid biodiversity assessment of orchid occurrence (presence or absence of species) at the Ambatolava, Angavobe, and Ambatomisondrotra inselbergs, and a more indepth survey of orchid abundance speciically at Ambatolava. Plants were photographed and identiied 59 to genus or species in the ield. No plants were taken from the site or harmed due to the endangered status of many endemic orchids. Species lists and images were then compared to botanical inventories conducted by the University of Antananarivo, Madagascar; Uppsala University, Sweden (Ceplitis & Broström1998); the Missouri Botanical Gardens W3TROPICOS database; and species descriptions by Perrier (1939 & 1941), Du Puy et al. (1999), Hermans et al. (2007), and Cribb & Hermans (2010). Patterns of Orchid Diversity. – For the larger-scale portion of this study we compared the species present on all the three inselbergs (γ-diversity), per inselberg (α-diversity), and between inselbergs (β-diversity), using data from the general orchid survey. We were especially interested in the beta-diversity measures of species turnover between sites (Ambatolava, Ambatomisondrotra, and Angavobe) that were similar in elevation range, climate, geological history, and that shared a regional species pool, yet possessed differing ire history. Our goal was to gain a preliminary understanding of how gradients of historical habitat disturbance, rather than elevation (Jacquemyn et al. 2005), might inluence the distribution patterns of orchids. The inselbergs (going east to west) were arranged: Angavobe to Ambatomisondrotra to Ambatolava, and ran roughly in a line 5km in length and separated by a minimum of 2 km from each other. We used three equations (Jaccard distance, Sørensen distance, and Simple Matching Coeficent) based on the applied recommendations for presence/absence data noted by Anderson et al. (2011). All indices used emphasized distance or dissimilarity between sites (value of 0 meaning identical species composition). The beta-diversity was calculated as follows: Jaccard distance dJ [1 – a/(a + b + c)]; Sørensen distance dS = [1 – 2a/(2a + b + c)]; and Simple Matching Coeficient, dSM = 1 - (a + e) / (a + b + c + e); where a is a species presence at both sites (11), b (10) or c (01) is a species present at only one of the two sites, and e (00) is a species missing from both sites but found within the greater area (Anderson et al. 2011). In-depth Survey of Orchid Abundance. - For the site speciic (more intensive) portion of this study we focused on the Ambatolava Inselberg, the only location with burn patterns that could be clearly evaluated in LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 60 LANKESTERIANA relation to a ire with a known occurrence date (2001). At the Ambatolava site we surveyed seven 50m x 2m line transects located between 1460m to 1645m in elevation. We drew the transect lines across all accessible regions using a 50m survey tape, compass, and GPS (Garmin Geko 301). The line transects were a minimum distance of 75m apart and ran horizontally from south to north on the central ridge or eastern slope (the western side was inaccessible). Within 1m on either side of the transect line per vegetation mat we counted the number of orchids present based on distinct above ground growth, rather than the number of canes, stems, or underground growth. We deined a vegetation mat in a generalized manner that included monocotyledonous mats dominated by C. setifera or X. dasyliriodes, ephemeral lush vegetation, moss cushions, or charred humus or vegetation remains (Barthlott & Porembski 1998, Fischer & Theisen 2000, Kluge & Brulfert 2000, Porembski & Barthlott 2000, Porembski et al. 2000). We identiied lowering species along the transect lines and categorized all orchids as lithophytic (epilithic) or terrestrial. Lithophytic orchids are found primarily on granite (or occasionally as epiphytes), and are slow growing with drought tolerant waxy leaves and aerial roots. Many lithophytic species in Madagascar are associated with the subtribe Angraecinae (species such as Angraecum sororium or Jumellea rigida Schltr.) or from the subtribe Aerangidinae with species such as Aerangis ellisii (B.S. Williams) Schltr.. Terrestrial orchids are also found on inselbergs and occasionally grasslands, with tuberous roots and periods of underground dormancy during the dry season. Many terrestrial orchids are from the subtribe Habenariinae (such as Cynorkis unilora Lindl.) or Brownleeinae (such as Brownleea coerulea Harv. ex Lindl.). Environmental Factors – We surveyed environmental factors that were hypothesised to play a signiicant role in the micro-site distribution patterns of orchids. The irst environmental factor we examined in the ield was based on the impact of ire, categorized by severity and deined as: • • Non-burned: areas with no signs of ire or signiicant heat damage; Minor to moderate: areas with a mosaic of heat or ire damage to no more than two thirds of the LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. • vegetation, upper branches of plants may have had some heat damage or ire effects but little to no signs of ground level ire; Severe: majority of the pre-ire vegetation charred or dead with signs of high heat intensity and ire effects at ground level. The second factor examined was the inluence of moisture availability (separate from water acquired directly from precipitation, fog, or dew accumulation on leaves) deined as: • • Wet: areas with continuous water seepage, dark granite slick from moisture saturation and cyanobacteria, with thick layers of moss or ephemeral lush vegetation (Barthlott & Porembski, 1998; Porembski et al. 2000; Fischer & Theisen, 2000). Dry: areas with no sign of water seepage, dry soil, and granite above and below the vegetation mat light in color. Statistical Analyses – We analyzed the evenness of vegetation mat categories (combinations of ire severity and moisture availability) using a two by three contingency table. The relationship between orchid density per m² and ire severity (non-burned, minormoderate, and severe) was analyzed using a nonparametric Kruskal-Wallis test; moisture availability (with or without presence of seasonal water seepage) was analyzed using a two-sample Wilcoxon test. We analyzed the number of orchids in relation to the size of non-burned vegetation mats with linear regression, if there was a signiicant positive relationship then a pre-ire population estimate would be made. Next, we analyzed the interspecies interaction for orchids in all areas using linear correlation. Lastly, we described the spatial distribution (random, even, or clumped) using the Index of Dispersion and Index of Clumping. All analyses were speciic to species, genus, or subtribe depending on the sample size and evenness between groups. All statistical analyses had α=0.05 and were performed with R software version 2.3.1 (www.r-project.org). results General Orchid Survey – A total of seventeen orchid species from seven genera and six subtribes (plus two unusual white morphs) were found on one or more of 61 WhiTMan et. al — Madagascar’s inselberg orchids TaBle 1. General survey of orchid presence and absence on three inselbergs at the Mt. Angavokely Forest Station. Angavobe Ambatolava Aerangis ellisii X X Angraecum sororium X X X Angraecinae Jumellea maxillarioides X X X Brownleeinae Brownlea coerulea X Habenariinae Bulbophyllum sp. 1 X Cynorkis angustipetala Aerangidinae Angraecinae Angraecinae Bulbophyllinae Habenariinae Habenariinae Habenariinae Habenariinae Habenariinae Habenariinae Habenariinae Habenariinae Habenariinae Jumellea rigida X Cynorkis baronii X Cynorkis coccinelloides X Cynorkis fastigiata X Cynorkis gibbosa X Cynorkis gibbosa* X Cynorkis lilacina Cynorkis perrieri Cynorkis unilora Cynorkis unilora* X X X X X X X Cynorkis sp. 1 X Polystachyeae Polystachya rosea X Cynorkis sp. 2 X X Habenariinae Habenariinae Ambatomisodrotra X * Unusual white lower morph the inselbergs surveyed (Table 1 & 2). The orchids present were estimated to represent 17% of the overall Orchidaceae diversity across all habitats of the greater Mt. Angavokely area (Ceplitis & Broström1998), and represented 17 out of 33 (51%) of the inselberg speciic species found in Madagascar (Fischer & Theisen 2000). The most common orchids encountered at all three inselbergs included Cynorkis fastigiata Thouars, Cynorkis unilora, and Angraecum sororium. Some species were found at two locations, such Aerangis ellisii, Cynorkis gibbosa Ridl., and Jumellea rigida. However, a total of eleven orchids (65%) were restricted to a single site (Table 1 & 2). The Ambatolava inselberg was the only site with Cynorkis angustipetala Ridl., Cynorkis lilacina Ridl., and an unidentiied Cynorkis sp. Thouars.. Ambatomisondrotra was the only site with Cynorkis baronii Rolfe, or Cynorkis coccinelloides Schltr., and was unique in that it was also the site of the largest colony of C. unilora noted. We also observed a distinct absence of Angraecinae species (including seedlings) from the entire upper region of the inselberg that had been burned; the exception being a J. rigida near the unburned forest edge. Angavobe, the area with lightning but not human associated ires, had the highest diversity of orchids unique to a single site, including Brownleea coerulea, unidentiied Bulbophyllum sp. Thouars, Cynorkis perrieri Schltr., unidentiied Cynorkis sp. Thouars, Jumellea maxillarioides (Ridl.) Schltr., Polystachya rosea Ridl. and unusual white morphs of Cynorkis gibbosa Ridl. and Cynorkis unilora Lindl.. Angavobe was notable as the location with the most massive A. sororium surveyed with individual canes >4m in length (max. height of 1.5m noted elsewhere) and with >250 nodes present that typically mark annual growth (one pair of leaves per year). We estimated the largest A. sororium (individual or colony) at Angavobe to be hundreds of years old. Patterns of Orchid Diversity - The transition of species diversity (β-diversity) using Jaccard distance (dJ), Sørensen distance (dS), and Simple Matching Coeficient (dSM) was estimated for paired site combinations. Each individual inselberg was represented by a single letter as follows: Ambatolava (L) – burned 2001, Ambatomisondrotra (M) – burned 1990’s, and Angavobe (G) –human ires absent. The LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 62 LANKESTERIANA TaBle 2. Patterns of orchid diversity on inselbergs. Unique occurrence count Total Diversity of Inselbergs Surveyed Combined list of all species found on the three inselbergs, Angavobe, Ambatolava, and Ambatomisondrotra SUBTRIBE GENUS SPECIES 6 7 17 Diversity per Inselberg Fire History Total for Angavobe Absence of human associated ires 6 7 Total for Ambatomisondrotra Human associated ire in 1990’s 2 3 8 Total for Ambatolava Human associated ire in 2001 3 4 7 SUBTRIBE GENUS SPECIES SUBTRIBE GENUS SPECIES 11 Orchid Distribution, Patterns of Overlap or Isolation Description Distribution Code Widespread Angavobe, Ambatolava, & Ambatomisodrotra GLM 2 3 3 Variable Angavobe & Ambatolava GL 1 1 1 Variable Angavobe & Ambatomisodrotra GM 0 0 1 Variable Ambatolava & Ambatomisodrotra LM 0 0 1 6 Site speciic Angavobe only G 3 3 Site speciic Ambatolava only L 0 0 2 Site speciic Ambatomisondrotra only M 0 0 3 results are summarized as: L & M - (dJ = 0.64, dS = 0.47, dSM = 0.41), L & G (dJ = 0.71, dS = 0.56, dSM = 0.59), and M & G (dJ = 0.73, dS = 0.58, dSM = 0.65). All indices revealed a similar trend; paired burned sites (L & M) had a lower β-diversity distance score (reduced turnover and greater similarity of species present) than pairing of inselbergs with burned and nonburned ire history. The inclusion of information on species absence (relative to γ-diversity) resulted in the greatest dissimilarity between inselberg combinations as noted with the Matching Coeficient (dSM max - dSM = 0.24), compared to Jaccard distance (dJ max – dJ min min = 0.10) and Sørensen distance (dS max – dS min = 0.11) that emphasized joint species presence. Joint absences also revealed that the combined species diversity for burned sites (Ambatolava and Ambatomisondrotra) was missing six out of the seventeen possible inselberg orchids surveyed from the larger area (30% of the γ-diversity). In-depth Survey of Orchid Abundance – At Ambatolava, we surveyed 700 m², and counted 45 vegetation mats totaling 450.7 m². The vegetation mats varied greatly in shape, size (5.35m²±SE0.83) and distance (2.65m²±SE0.74) from each other edge to edge. We counted a total of 45 lithophytic orchids LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. from the subtribe Angraecinae (36 A. sororium and nine Jumellea rigida) and 310 terrestrial orchids from the subtribe Habenariinae (one Cynorkis angustipetala Ridl., 52 C. fastigiata Thou., and 257 C. unilora). All species were endemic to Madagascar, except for C. fastigiata, a species indigenous to Madagascar, Comoros, the Mascarenes, and Seychelles (Perrier 1939 & 1941). Both subtribes were present at an equal number of sites (fourteen out of forty ive vegetation mats), but the distribution by individual species was unpredictable. Some orchids were relatively abundant, but restricted to a limited number of locations (such as C. unilora with 257 individuals at eight sites). We then found it necessary to group the orchids together by subtribe for a more even comparison of the taxa. Environmental Factors – We categorized 15 of the vegetation mats as non-burned (118m² = 26%), 11 with minor to moderate ire damage (113m² = 25%), and 19 (219.70² = 49%) as having severe ire damage. Non-burned and severely burned vegetation mats were observed directly neighboring each other. The moisture of the slopes also varied, 25 mats (285.8m² = 63%) ranged from being damp to having continuous water seepage, and the other 20 mats (164.90m² =36%) were extremely dry. The 2x3 contingency table analysis WhiTMan et. al — Madagascar’s inselberg orchids showed a signiicant difference in the evenness of the ire/moisture combinations of vegetation mat categories (Pearson’s Chi Square= 8.246, p=0.016), but there was no clear pattern to predict which areas would be burned (wet with severe ire damage was the most common combination). However, other factors might have inluenced ire patterns such as wind exposure, steepness of slope, or distance to the plantation tree line. Vegetation mats that were the least impacted by ire were in depressions or issures in the rock; sheltered from wind; or were isolated from each other. Orchid Response to Environmental Factors – For the lithophytic Angraecinae orchids, ire severity was highly signiicant Fig 1. A. (all species, KruskalWallace chi-squared 18.6445, df = 2, p-value = <0.001; A. sororium, Kruskal-Wallace chi-squared 19.025, df = 2, p-value = <0.001) There was no signiicant relationship between orchid density and moisture availability by subgroup or by species. The orchids had the highest density (0.32 per m², equal to 84% of those surveyed) in unburned areas, followed by (0.06 per m², equal to 16% of those surveyed) in minor to moderately burned areas, and no individuals in severely burned areas. The signiicant results for the terrestrial Habenariinae were opposite from that of the lithophytic Angraecineae. Fire was not signiicant, yet moisture availability was highly signiicant Fig 1. B. (all species, Wilcox rank sum, w= 149, p-value = 0.005; C. unilora, Wilcox rank sum, w= 170, p-value = 0.006). The exception to the Habenariinae trend was C. fastigata, which was not sensitive to moisture availability, but was to ire (Kruskal-Wallis chisquared = 8.210, df = 2, p-value = 0.016). Terrestrial Habenariinae orchids had the highest density average (1.1 per m², equal to 99% of those surveyed) in wet areas, including locations with severe ire damage. Species level analyses were non-signiicant for the least common of the orchids surveyed, C. angustipetala (Habenariinae) and J. rigida (Angraecinae). Orchid Distribution - Angraecinae had a signiicant relationship between the number of orchids and the size of a non-burned vegetation mat (adjusted R² = 0.473, p-value = 0.003, n=15), but Habenariinae did not, even in wet non-burned areas. Preire population estimates were made for Angraecinae (but could not be made for Habenariinae) based on the linear 63 equation (number of orchids= 0.251 * mat size + 0.562). We estimated that 67% of the lithophytic Angraecinae orchids at Ambatolava perished during the 2001 ire. There was no signiicant interaction between the two orchid subtribes (Angraecinae and Habenariinae); including results from a post-hoc analysis of positive environmental factors (non-burned sites, wet sites, and non-burned wet sites). There was a positive association between A. sororium and C. fastigata (Kendall’s Rank Correlation, tau = 0.590, p-value = <0.001) and to a lesser extent between A. sororium and J. rigida (Kendall’s Rank Correlation, tau = 0.273 , p-value = 0.049). Angraecinae had a uniform pattern of distribution (Index of Dispersion = 0.436, Index of Clumping = -0.564) with the highest density in nonburned areas. Habenariinae had a clumped pattern of distribution (Index of Dispersion = 8.711, Index of Clumping = 7.711) with the highest density in wet areas. discussion General Orchid Survey – The diversity of endemic orchids on inselbergs, and the vulnerability of some species to anthropogenic disturbance, reinforces the conservation importance of this unique habitat type. The most compelling observation from the general orchid survey was the higher biodiversity at Angavobe, a site with lightning based ires but absence of anthropogenic ires, compared to Ambatomisondrotra (ire in 1990’s) or Ambatolava (ire in 2001). Angavobe was also the site with the highest number of species (six) and genera (three) restricted to a single site. One concern for the future is whether or not Angavobe will continue to be regarded as an important cultural site, or if the traditional knowledge of restricted burning near tombs and sacriicial stones will be lost with the passing of generations or the immigration of individuals from different regions who are unaware of this social fady. Additional conservation protection of the Angavobe inselberg, ideally in partnership with neighboring villagers, environmental organizations, and regional land managers, is highly recommended. Spatial Patterns of Orchid Diversity – We found that sites with a shared history of ire disturbance (Ambatomisondrotra and Ambatolava) had species composition more similar to each other than LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 64 LANKESTERIANA combinations with differing ire history regardless of spatial orientation; a pattern most noticeable when factoring in joint-absences of species (Matching Coeficent). Our average Sørensen distance (0.53) was more similar to the average value (0.5) noted on African (Cameroon, Gabon, Guinea) inselbergs across a range of plant formations (Parmentier et al. 2005), than the beta-diversity of orchids (0.25) observed across elevational gradients on the neighboring island of Réunion (Jacquemyn et al. 2005), suggesting that our results may be more of a relection of inselberg plant communities than patterns speciic to orchids. A larger scale analysis of Malagasy orchid betadiversity, especially in relation to gradients of habitat disturbance, is recommended for the future. Orchid Response to Environmental Factors – Lithophytic Angraecinae orchids were ire sensitive and were interpreted to rely on other adaptations to successfully tolerate temperature and moisture luxuations and to compete against dominant inselberg vegetation such as X. dasyliriodes or A. capitata. Angraecinae survival adaptations include environmental stress tolerance (Kluge et al. 1998, Kluge & Brulfert 2000), year round photosynthesis, and the ability to grow taller than neighboring shrubs or forbs to compete for resources. Inter and intraspeciic competition may explain the uniform distribution pattern noted. We were surprised that Angraecinae orchids were so sensitive to heat damage given that Porembski & Barthlott (2000) noted that some drought tolerant monocots were protected from ire by the dense growth of leaves and roots covering the pseudostem. However we did observe that A. sororium had more signs of heat damage than leshy succulents (ie Aloe capitata) of similar height in the same area. Post-ire regeneration by A. sororium in areas of moderate ire damage was only noted at the center of exceptionally large orchid patches. Angraecinae orchids may be more vulnerable to ire due to their year round foliage, aerial roots, and tolerance for the driest slopes. They also tend to acquire a thick cushion of moss, leaves, and organic material around their base (Kluge & Brulfert 2000) that helps to hold moisture, but may also increases the available fuel biomass (intensity of ire) per vegetation mat. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. An important conservation question raised by this study is: “how long will it take for Angraecinae to recover from human associated ire damage?” Populations may be resilient against disturbance events by the longevity of reproductively successful individuals, but only if the habitat conditions remain suitable for their offspring and enough unique individuals remain to prevent a genetic bottleneck. The largest Angraecinae observed lowering (A. sororium) was interpreted to be very long lived (multi-decade, or even multi-century at Angavobe), an age span consistent with other inselberg species (Porembski & Barthlott 2000). However no Angraecinae seedlings were found repopulating burned mats three years or even >10 years post-ire despite the relatively high availability of seed sources from multiple individuals within the area (unpubl. data). Inhibited establishment of seedlings post-ire has also been described for other non mat-forming inselberg species (Porembski & Barthlott 2000) and is a threat to endemic lora as the rate of human caused ires increases. For future studies it would be useful to gain a more expansive and long-term (multi-generational) understanding of metapopulation dynamics of Angraecinae orchids, especially compared to Habenariinae, to establish a stronger estimate of recovery time post-disturbance. The terrestrial Habenariinae orchids of our study were limited primarily by their micro-habitat preference for wet slopes rather than by ire. Prior studies of C. unilora also noted the highest orchid abundance in locations with continuous or ephemeral water seepage (Nilsson et al. 1992, Fischer & Theisen 2000). The smaller size (10-30cm), lack of water storing leshy leaves or pseudobulbs, and the rapid season-speciic growth of these orchids may explain their moisture dependency. Future studies that include other environmental factors found to be signiicant for inselberg lora, such as soil pH, depth, or distance to native forest (Parmentier 2003), might explain why Habenariinae orchids displayed such clumped patterns of distribution and abundance independent from vegetation mat size or co-occurrence of Angraecinae species. The enigmatic orchid of this study was C. fastigiata, with habitat preferences similar to A. sororium. One possible explanation is that both orchids share similar mycorrhizal fungi preferences WhiTMan et. al — Madagascar’s inselberg orchids for germination; or that C. fastigiata ills a different habitat or successional niche than C. unilora or C. angustipetala. This result raises the debate as to whether species should be grouped together based on phylogenetic similarity or by habitat needs. Within Madagascar, it has been noted that Habenariinae orchids (genus Cynorkis and Habenaria) and similar terrestrial orchids of various other subtribes (genus Liparis, Eulophia, Benthamia, Lissochilus, Disa, Satyrium) beneit from occasional ires and sustainable disturbance that create “orchid meadows” with reduced interspecies competition (Rabetaliana et al. 1999, Bloesch et al. 2002). This trend has also been described globally for terrestrial orchids in locations such as Australia (Yates et al. 2003), and South Africa (Linder et al. 2005), with some pyrogenic orchids (such as Cyanicula ashbyae Hopper and A.P.Br.) only lowering within the irst year post-ire (Yates et al. 2003). Fire may be less of a threat to Habenariinae orchids because of their tuberous roots, underground dormancy during the dry season, and tolerance of thinner topsoil that can occur after burning and erosion. A different question raised by this study is: “why did the two orchid subtribes have different survival strategies, or ecological niches, within a shared habitat if their distribution was independent from each other?” One explanation is that when ire occurs, it creates an irregular mosaic-like pattern of ire disturbance, allowing for different stages of succession per vegetation mat with reduced competition for resources. Another perspective is that inselbergs might support both equilibrium and nonequilibrium based plant communities within a small spatial scale and that the differences between orchid subtribes are a relection of larger species composition trends. Angraecinae might be considered to be a part of an equilibrium (or late-successional) based community, inluenced by biotic competition year round; whereas Habenariinae might be within a nonequilibrium, ephemeral lush vegetation community heavily inluenced by abiotic conditions or stochastic disturbances (Porembski et al. 2000). Conclusion. From this study it can be concluded that it is inappropriate to assume that all species of inselberg Orchidaceae have the same response to 65 ire or habitat moisture requirements. Lithophytic Angraecinae were sensitive to ire, but tolerant of limited moisture availability, and had a uniform pattern of distribution. In contrast, terrestrial Habenariinae were not as affected by ire but were limited to slopes with high water seepage and had a clumped pattern of distribution. Lithophytic Angraecinae orchids are considered to be at risk and an increase in the frequency or severity of ire may negatively affect sustainable population sizes. Further conservation of inselberg habitat and its unique lora is strongly recommended. aCknoWleDgeMenTs. Special thanks to David Mason and Fairhaven College for the Adventure Learning Grant; the Northwest Orchid Society; Seacology; University of Antananarivo; Direction Générale des Eaux et Forêts; Kathryn Anderson, John Bower, Robin Matthews, and John McLaughlin of Western Washington University; Zachary Rogers and the Missouri Botanical Gardens; Nivo Raharison; and Urs Bloesch, L. Anders Nilsson, Ingrid Parmentier, and Nathan G. Swenson for feedback. Additional thanks to Lankesteriana reviewers, and anonymous feedback received at the 18th World Orchid Conference (Dijon, France) and the Sigma Xi Conference (Seattle, U.S.A). In Memoriam of Joyce Stewart (1936 2011) and her advocacy of Angraecoid orchid conservation. liTeraTure CiTeD Anderson, M.J., T.O. Crist, J.M. Chase, M. Vellend, B.D. Inouye, A.L. Freestone, N.J. Sanders, H.V. Cornell, L.S. Comita, K.F. Davies, S.P. Harrison, N.J.B. Kraft, J.C. Stegen & N.G. Swenson. 2011. Navigating the multiple meanings of beta diversity: a roadmap for the practicing ecologist. Ecol. Lett. 14: 19-28. Barthlott, W. & S. Porembski. 1998. Diversity and phytogeographical afinities of Inselberg vegetation in tropical Africa and Madagascar. Pp. 119-129 in: C.R. Huxley, J.M. Lock & D.F. Cutler (eds.), Chorology, taxonomy and ecology of the loras of Africa and Madagascar. Kew, Kew Publishing. Bloesch 1999. Fire as a tool in the management of a savanna/dry forest reserve in Madagascar. Appl. Veg. Sci. 2: 117-124. Bloesch, U., Bosshard, A.P. Shachenmann, H. Rabetaliana & F. Klötzli. 2002. Biodiversity of the subalpine forest-grassland ecotone of the Andringitra Massif, LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 66 LANKESTERIANA Madagascar. Pp. 165-175 in: C. Körner & E.M. Spehn (eds.), Mountain biodiversity- a global assessment. London, Parthenon Publishing. Bosser, J.M., Du Puy, D.J. & P. Phillipson. 1996. Madagascar and surrounding islands. Pp. 103-107 in: IUCN/SSC Orchid Specialist Group; Status Survey and Conservation Action Plan – Orchids. IUCN Switzerland and UK. Burney, D.A., G.S. Robinson & L.P. Burney. 2003. Sporomiella and the late Holocene extinctions in Madagascar. P Natl. Acad. Sci. 100: 10800-10805. Ceplitis, A. & A. Broström. 1998. Vascular plant diversity in a mountain rainforest at Station Forestière d’Angavokely, Madagascar. Minor ield study report 039. Uppsalla, Committee for Tropical Ecology Uppsalla University. Clarke, P.J. 2002. Habitat islands in ire-prone vegetation: do landscape features inluence community composition? J. Biogeogr. 29: 677-684. Cribb, P.J. & J. Hermans. 2010. Field guide to the orchids of Madagascar. Kew, Kew Publishing. De La Bathie, H.P. 1939, 1941. Flora of Madagascar, 49th Family - Orchids. Paris, France. Translated by S. Beckman. 1981. Volume I and II combined. Lodi, California. Du Puy, D. & J.F. Moat. 1998. Vegetation mapping and classiication in Madagascar (using GIS): implications and recommendations for the conservation of biodiversity. Pp 97 -117 in: C.R. Huxley, J.M. Lock, & D.F. Culter (eds.), Chronology, taxonomy and ecology of the loras of Africa and Madagascar. Kew, Kew Publishing. Du Puy, D., P.J. Cribb, J. Bosser, J. Hermans & C. Hermans. 1999. The Orchids of Madagascar. First edition. Kew, Royal Botanical Gardens. Fischer, E. & I. Theisen. 2000. Vegetation of Malagasy inselbergs. Pp. 259-276 in: S. Porembski & W. Barthlott (eds.), Inselbergs biotic diversity of isolated rock outcrops in tropical and temperate Regions. Berlin, Springer-Verlag. Jacquemyn, H., C. Micheneau, D.L. Roberts & T. Pailler. 2005. Elevation gradients of species diversity, breeding system and loral traits of orchid species on Réunion Island. J. Biogeogr. 32: 1751-1761. Klein, J. 2004. Fiddling while Madagascar burns. Deforestation discourses and highland history. Norw. J. Geog. 58: 11-22. Kluge, M., B.Vinson & H. Ziegler. 1998. Ecophysiological studies on orchids of Madagascar: incidence and LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. plasticity of crassulacean acid metabolism in species of the genus Angraecum Bory. Plant Ecol. 135: 43-57. Kluge, M & J. Brulfert. 2000. Modes of photosynthesis in plants of Mt. Angavokely (Central High Plateau of Madagascar). Pp. 161-174 in: S. Porembski and W. Barthlott (eds.), Inselbergs biotic diversity of isolated rock outcrops in tropical and temperate regions. Berlin, Springer-Verlag. Kull, C.A. 2000. Deforestation, erosion, and ire: degradation myths in the environmental history of Madagascar. Environ. Hist. 6: 423-450. Kull, C.A. 2002. Madagascar alame: landscape burning as peasant protest, resistance, or a resource management tool? Pol. Geogr. 21: 927-953. Kremen, C., A. Cameron, A. Moilanen, S.J. Philips, C.D. Thomas, H. Beentje, J. Dransield, B.L. Fischer, F. Glaw, T.C. Good, G.J. Harper, R.J. Hijams, D.C. Lees, E. Louis Jr., R.A. Nussbaum, C.J. Raxworthy, A. Razaimpahanana, G.E. Schatz, M. Vences, D.R. Vieties, P.C. Wright & M.L. Zjhra. 2008. Aligning conservation priorities across taxa in Madagscar with High-Resolution Planning Tools. Science 320: 222-226. Harper, G.J., M.K. Steininger, C.J. Tucker, D. Juhn & F. Hawkins. 2007. Fifty years of deforestation and forest fragmentation in Madagascar. Environmental Conservation 34: 325-333. Hopper, S.D. 2000. Creation of conservation reserves and managing ire on granite outcrops – a case of study of Chiddarcooping Nature Reserve in Western Australian wheatbelt. J. Roy. Soc. W. Aust. 83: 173-186. Hermans, J., C. Hermans, D. du Puy, P.J. Cribb & J. Bosser. 2007. Orchids of Madagascar. Second edition. Kew, Kew Publishing. Leader-Williams, N & H.T. Dublin. 2000. Charismatic megafauna as ‘lagship species’. Pp 53-81 in: A. Entwistle & N. Dunstone (eds.), Priorities for the Conservation of Mammalian Diversity: Has the Panda Had its Day? Cambridge, Cambridge University Press. Linder, H.P., H. Kurzweil & S.D. Johnson. 2005. The Southern African orchid lora: composition, sources and endemism. J. Biogeogr. 32: 29-47. Myers, N., Mittermeier, R.A., Mittermeier, C.G., da Fonseca, G.A.B & J. Kent. 2000. Biodiversity hotspots for conservation priorities. Nature. 403: 853 – 858. Nilsson, L.A. & E. Rabakonandrianina. 1988. Hawk-moth scale analysis and pollination specialization in the epilithic Malagasy endemic Aerangis ellisii (Reichenb. il.) Schltr. (Orchidaceae.) Bot. J. Linn. Soc. 97: 49-61. WhiTMan et. al — Madagascar’s inselberg orchids Nilsson, L.A., E. Rabakonandrianina, R. Rotaharivelo & J.J. Randriamanindry. 1992. Long pollinia on eyes: hawk-moth pollination of Cynorkis unilora Lindley (Orchidaceae) in Madagascar. Bot. J. Linn. Soc.109: 145-160. Parmentier, I. 2003. Study of the vegetation composition in three inselbergs from continental equatorial Guinea (western central Africa): effects of site, soil factors, and position relative to forest fringe. Belg. J. Bot. 136: 6372. Pettersson, B. & L.A. Nilsson. 1993. Floral variation and deceit pollination in Polystachya rosea (Orchidaceae) on an inselberg in Madagascar. Opera Bot. 121: 237245. Porembski, S. & W. Barthlott. 2000. Granitic and gneissic outcrops (Inselbergs) as centers of diversity for desic- 67 cation-tolerant vascular plants. Plant Ecol. 151: 19-28. Porembski, S., R. Seine & W. Barthlott. 2000. Factors controlling species richness of Inselbergs. Pp. 451-481 in: S. Porembski and W. Barthlott (eds.), Inselbergs biotic diversity of isolated rock outcrops in tropical and temperate regions. Berlin, Springer-Verlag. Rabetaliana, H., M. Randriambololona & P. Schachenmann. 1999. The Andringitra National Park in Madagascar. Unasylva 50: 25-30. Raxworthy, C.J. & R.A. Nussbaum. 1996. Montane amphibian and reptile communities in Madagascar. Conserv. Biol. 10: 750-756. Yates, C.J., S.D. Hopper, A. Brown & S. van Leeuwen. 2003. Impact of two wildires on endemic granite outcrop vegetation in Western Australia. J. Veg. Sci. 14: 185-193. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. LANKESTERIANA LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. LANKESTERIANA 11(1): 69—94. 2011. OrChid gENErA lECTOTyPES peggy alriCh1 & Wesley higgins2,3 13955 Matanzas Dr. SE, Fort Myers, FL 33905, U.S.A. Herbarium, Florida Museum of Natural History; Centro de Investigación en Orquídeas de los Andes, Universidad Alfredo Pérez Guerero, Ecuador; Lake Park Botanical Gardens, Fort Myers, FL, U.S.A. 3 Corresponding author: 5317 Delano Ct., Cape Coral, FL 33904, U.S.A.; Higgins@alumni.ul.edu 1 2 aBsTraCT. The typiication of Orchidaceae genera has been disorganized since currently there is not an up to date central database to track these nomenclatural publications. A listing of published generic typiications for Orchidaceae is provided. key WorDs: Nomenclature, Typiication, Orchidaceae introduction. When an orchid genus is described it in based on a speciic species known as the type species. When that species is described the name is based on a speciic specimen, the holotype. The International Code of Botanic Nomenclature (ICBN) states: The application of names of taxa of the rank of family or below is determined by means of nomenclatural types (types of names of taxa). The application of names of taxa in the higher ranks is also determined by means of types when the names are ultimately based on generic names (Article 7.1) and a nomenclatural type (typus) is that element to which the name of a taxon is permanently attached, whether as the correct name or as a synonym. The nomenclatural type is not necessarily the most typical or representative element of a taxon (Article 7.2). There are many kinds of types deined in the ICBN. Loosely used the term type can have many meanings and should be clariied. • paratype. A specimen cited in the protologue that is neither the holotype nor an isotype, nor one of the syntypes if two or more specimens were simultaneously designated as types (Art. 9.5). • neotype. A specimen or illustration selected to serve as nomenclatural type if no original material is extant or as long as it is missing (Art. 9.6). • lectotype. A specimen or illustration designated from the original material as the nomenclatural type if no holotype was indicated at the time of publication, or if it is missing, or if it is found to belong to more than one taxon (Art. 9.2). • epitype. A specimen or illustration selected to serve as an interpretative type when the holotype, lectotype, or previously designated neotype, or all original material associated with a validly published name cannot be identiied for the purpose of precise application of the name of a taxon (Art.9.7). • nomenclatural type. The element to which the name of a taxon is permanently attached (Art. 7.2). • holotype. The one specimen or illustration used by the author or designated by the author as the nomenclatural type (Art. 9.1). • isotype. A duplicate specimen of the holotype (Art. 9.3). • syntype. Any specimen cited in the protologue when there is no holotype, or any of two or more specimens simultaneously designated as types (Art. 9.4). • isosyntype. A duplicate of a syntype (Art. 9.10). why is this important? Many genera were described before a type designation was required and a type species was not designated. Publication on or after 1 January 1958 of the name of a new taxon of the rank of genus or below is valid only when the type of the name is indicated (Art. 37.1). However the ICBN does provide that if the name of a new genus reference to one species name only, or the citation of the holotype or lectotype of one previously or simultaneously published species name only, even if that element is not explicitly designated as type, is acceptable as indication of the type (Art. 37.3). This leaves many genera without type species. 70 LANKESTERIANA and it can be shown that all the other original material differs taxonomically from the destroyed type, a neotype may be selected to preserve the usage established by the previous typiication (Art. 9.14). Recognizing that all taxa do not have a type the ICBN provides that one can be selected: • If no holotype was indicated by the author of a name of a species or infraspeciic taxon, or when the holotype has been lost or destroyed, or when the material designated as type is found to belong to more than one taxon, a lectotype or, if permissible a neotype as a substitute for it may be designated (Art. 9.9). There are additional rules for typiication of taxa that require the proper use of terminology. Article 9.8. states that The use of a term deined in the ICBN as denoting a type, in a sense other than that in which it is so deined, is treated as an error to be corrected (for example, the use of the term lectotype to denote what is in fact a neotype). The type of typiication is dependent on availability of original material: • A lectotype is a specimen or illustration designated from the original material as the nomenclatural type, if no holotype was indicated at the time of publication, or if it is missing, or if it is found to belong to more than one taxon (Art. 9.2). • A neotype is a specimen or illustration selected to serve as nomenclatural type if no original material is extant, or as long as it is missing (see also Art. 9.6). Further guidance is given by the ICBN for the selection of a new type • • In lectotype designation, an isotype must be chosen if such exists, or otherwise a syntype if such exists. If no isotype, syntype or isosyntype (duplicate of syntype) is extant, the lectotype must be chosen from among the paratypes if such exist. If no cited specimens exist, the lectotype must be chosen from among the uncited specimens and cited and uncited illustrations which comprise the remaining original material, if such exist (Art. 9.10). If no original material is extant or as long as it is missing, a neotype may be selected. A lectotype always takes precedence over a neotype (Art. 9.11), except when the holotype or a previously designated lectotype has been lost or destroyed LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. Some authors in the past have listed a type species for a genus even when the original author did not designate a type. This had the inadvertent effect of lectotypiication or neotypiication of the genus. The ICBN how requires that the designation of a new type use of the term “lectotypus” or “neotypus” and location of the type. • • On or after 1 January 1990, lectotypiication or neotypiication of a name of a species or infraspeciic taxon by a specimen or unpublished illustration is not effected unless the herbarium or institution in which the type is conserved is speciied (Art.9.20). On or after 1 January 2001, lectotypiication or neotypiication of a name of a species or infraspeciic taxon is not effected unless indicated by use of the term “lectotypus” or “neotypus”, its abbreviation, or its equivalent in a modern language (Art.9.21). Currently typification is not adequately tracked in the online taxonomic databases, such as, Index Nominum Genericorum (ING), International Plant Names Index (IPNI), Tropicos, World Checklist of Selected Plant Families. The authors encourage the database owners to add this valuable information since earlier type choices have priority. An excellent example of a database is the Linnaean Plant Name Typification Project, based at The Natural History Museum (London), that has been collating and cataloguing information on published type designations for Linnaean plant names and, where none exists, has been collaborating with specialists in designating appropriate types. For each species, the database provides the place of publication, stated provenance, the type specimen (or illustration) and a reference to where the type choice was published, and an indication of the current name of the taxon within which Linnaeus’ original binomial is now placed. alriCh & higgins — Orchid genera typiication 71 The Typiication of Orchidaceae Genera Aa Rchb.f., Xenia Orchid., 1: 18 (1854). Type speCies: A. paleacea (Kunth) Schltr. (Ophrys paleacea Kunth) selected by Schlechter, Repert. Spec. Nov. Regni Veg., 11: 147 (1912); Baillon, Dict. Bot., 4: 309 (1892); and Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(1): 1 (1871). Acampe Lindl., Fol. Orchid., 4: Acampe, 1 (1853). Type speCies: A. multilora (Lindl.) Lindl. (Vanda multilora Lindl.) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(1): 9 (1871). leCToType: A. rigida (Buch.-Ham. ex Sm.) P.F.Hunt (Aerides rigida Buch.-Ham. ex Sm.) designated by Seidenfaden, Bot. Mus. Leal., 25(2): 54 (1977); and indirectly by Averyanov, Bot. Zhurn. (Moscow & Leningrad), 76(6): 890 (1991). Aceras R.Br., Hortus Kew., ed. 2, 5: 191 (1813). leCToType: A. anthropophorum (L.) R.Br. (Ophrys anthropophora L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 437 (1989). Achroanthes Raf., Med. Repos., ser. 2, 5: 352 (1808) Type speCies: A. unifolia (Michx.) Raf. (Malaxis unifolia Michx.) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(1): 22 (1871). Achroanthes Raf. Amer. Monthly Mag. & Crit. Rev., 2: 268 (1818) and 4: 195 (1819). Type speCies: Malaxis ophioglossoides Muhl. ex Willd. (Arethusa ophioglossoides Muhl.) selected by Garay & H.R. Sweet, J. Arnold Arbor., 53(1): 515 (1972). Acianthera Scheidw., Allg. Gartenzeitung, 10(37): 292 (1842). neoType speCies: A. punctata Scheidw. designated by Luer, Monogr. Syst. Bot. Missouri Bot. Gard., 20: 12 (1986). Acineta Lindl., Edwards’s Bot. Reg., 29(Misc.): 67 (1843). Type speCies: A. superba (Kunth) Rchb.f. (Anguloa superba Kunth) selected by G. Gerlach, Gen. Orch., 5: 399 (2009). Acianthus R.Br., Prodr. Fl. Nov. Holland., 321 (1810). Type speCies: A. exsertus R.Br. selected by N. Hallé, Fl. Nouvelle Caledonie & Depend., 8: 418 (1977). Type speCies: A. fornicatus R.Br. selected by M.A. Clements, Austral. Orchid Res., 1: 9 (1989) and Jones, D.L. & Clements, M.A., Lindleyana, 2: 157 (1987). Acostaea Schltr., Repert Spec. Nov. Regni Veg. Beih, 19: 22, 283 (1923). leCToType: A. costaricensis Schltr. designated by Summerhayes, Index Nom. Gen. (Pl.), 1: 16 (1967) card #64/24402 (1967); and Pupulin, Bot. J. Linn. Soc., 163: 116 (2010). Aerides Lour., Fl. Cochinch., 2: 516 & 525 (1790). leCToType: A. maculosa (Wight) Lindl. (Saccolabium speciosum Wight) designated by Christenson, Kew Bulletin, 41(4): 837 (1986). Aeridium Salisb., Trans. Hort. Soc. London, 1: 295 (1812). Type speCies: A. odorum Salisb. selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(1): 67 (1871). Aerobion Kaempf. ex Spreng. Syst Veg. 3: 679 (1826). leCToType: A. superbum (Thouars) Spreng. (Angraecum superbum Thouars) designated by Garay, Kew Bull., 28(3): 496 (1973). Altensteinia Kunth, Nov. Gen. Sp. Pl., 1: 332 (1816). Type speCies: A. imbriata Kunth selected by Reichenbach f., Xenia Orchid., 1: 18 (1854). Amalia Rchb.f., Herb. Nomen., 52 (1841). leCToType: Bletia grandilora La Llave designated by Garay & H.R. Sweet, J. Arnold Arb., 53: 515 (1972). Amparoa Schltr., Repert. Spec. Nov. Regni Veg. Beih., 19: 64 (1923). leCToType: A. costaricensis Schltr. designated by Pupulin, Bot. J. Linn. Soc., 163: 119 (2010). Amphigena Rolfe, Fl. Cap. (Harvey), 5(3): 197 (1913). Type speCies: A. leptostachya (Sond.) Rolfe (Disa leptostachys Sond.) selected by E.P. Phillips, Gen. S. Afr. Fl. Pl., ed. 2, 236 (1951). Amphorkis Thouars, Nouv. Bull. Sci. Soc. Philom. Paris, 1(19): 316 (1809). leCToType: A. inermis Thouars designated by A. Richard, Mem. Soc. Hist. Nat., Paris, 4: 30 (1828). LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 72 LANKESTERIANA Anacamptis Rich., De Orchid. Eur., 19, 25 (1817), and Mém. Mus. Hist. Nat., 4: 47, 55 (1818). leCToType: A. pyramidalis (L.) Rich. (Orchis pyramidalis L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 439 (1989). Anathallis Barb.Rodr., Gen. Sp. Orchid, 1: 23, t. 470 (1877). leCToType: A. fasiculata Barb.Rodr. designated by Garay, Orquideología, 9: 122 (1974). Ancistrorhynchus Finet, Bull. Soc. Bot. France, 54(9): 44 (1907). Type speCies: A. recurvus Finet selected by Summerhayes, Bot. Mus. Leal., 11: 204, 213 (1944). Anguloa Ruiz & Pavón, Fl. Peruv. Prodr., 118, t. 26 (1794). Type speCies: A. unilora Ruiz & Pavón selected by Ruiz & Pavón, Syst. Veg. Fl. Peruv. Chil., 1: 228 (1798) and Oakeley, Orchid Digest, 63(4 Suppl.): 3 (1999). Ania Lindl., Gen. Sp. Orchid. Pl., 129 (1831). Type speCies: A. angustifolia Lindl. selected by Senghas, Orchideen (Schlechter), ed. 3, 1: 863 (1984). leCToType: A. angustifolia Lindl. designated by H. Turner, Orch. Monog., 6: 49 (1992) and P.J. Cribb, Gen. Orch., 4: 159 (2005). Anochilus Schltr. ex Rolfe, Fl. Cap. (Harvey), 5:(3): 280 (1913). Type speCies: A. inversus (Thunberg) Rolfe (Ophrys inversa Thunberg) selected by E.P. Phillips, Gen. S. Afr. Fl. Pl., ed. 2, 238 (1951). Appendicula Blume, Bijdr. Fl. Ned. Ind., 7: 297, t. 40 (1825). Type speCies: A. alba Blume selected by N. Hallè, Fl. Nouvelle Caledonie & Depend., 8: 345 (1977). leCToType: A. alba Blume designated by Averyanov, Bot. Zhurn. (Moscow & Leningrad), 76(1): 123 (1991). Appendiculopsis Szlach., Fragm. Florist. Geobot., 3(Suppl.): 119 (1995). leCToType: A. stipulata (Grifith) Szlach. (Appendicula stipulata Grifith) designated by Szlachetko, Fragm. Florist. Geobot., 3(Suppl.): 119 (1995). Arachnis Blume, Bijdr. Fl. Ned. Ind., 8: 365, t. 26 (1825). LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. leCToType: A. los-aeris (L.) Rchb.f. (Epidendrum los-aeris L.) designated by J.J. Wood, Taxon, 48: 47 (1999). Arethusa L., Sp. Pl. (Linnaeus), ed. 1, 2: 950 (1753). Type speCies: A. bulbosa L. selected by Britton & Brown, Ill. Fl. N.U.S., ed 2, 1: 562 (1913). Arundina Blume, Bijdr. Fl. Ned. Ind., 8: 401, t. 73 (1825). leCToType: A. speciosa Blume designated by Garay & H.R. Sweet, Orchids S. Ryukyu Islands, 52 (1974). Ascocentrum Schltr., Repert. Spec. Nov. Regni Veg. Beih., 1: 975 (1913). leCToType: A. miniatum (Lindl.) Schltr. (Saccolabium minitum Lindl.) designated by Summerhayes, Index Nom. Gen. (Pl.), 1: 139 (1967) card #64/24468. leCToType: A. ampullaceum (Roxburgh) Schltr. (Aerides ampullacea Roxburgh) designated by Christenson, Kew Bulletin, 41(4): 836 (1986). Ascochilus Ridl., J. Linn. Soc., Bot., 32: 374 (1896). leCToType: A. siamensis Ridl. designated by Garay, Bot. Mus. Leal., 23(4): 161 (1972). Auliza Salisb., Trans. Hort. Soc. London, 1: 294 (1812). Type speCies: A. ciliaris (L.) Salisb. (Epidendrum ciliaris L.) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(1): 321 (1871). Type speCies: A. nocturna (Jacq.) Small selected by Small, Fl. Miami, 56 (1913) and Garay & H.R. Sweet, J. Arnold Arbor., 53(4): 516 (1972). leCToType: A. nocturna (Jacq.) Small (Epidendrum nocturnum Jacq.) invalidly designated by Hágsater & Soto Arenas, Gen. Orch., 4: 237 (2005). Barbosella Schltr., Repert. Spec. Nov. Regni. Veg., 15: 259 (1918). leCToType: B. miersii (Lindl.) Schltr. (Pleurothallis miersii Lindl.) designated by Angely, Fl. Analitica São Paulo, 6: 1282 (1973). Type speCies: B. gardneri (Lindl.) Schltr. (Pleurothallis gardneri Lindl.) selected by Luer, Selbyana, 5: 386 (1981). Bartholina, R.Br., Hortus Kew., ed. 2, 5: 194 (1813) Type speCies: B. pectinata (Thunberg) R.Br. nom. illeg. (Orchis pectinata Thunberg nom. illeg.). This type alriCh & higgins — Orchid genera typiication name is now considered a synonym of Bartholina burmanniana (L.) Ker-Gawler (Orchis burmanniana L.) which was lectotyped by H.P. Linder, Taxon, 48: 48 (1999). Beloglottis Schltr., Beih. Bot. Centralbl., 37(2): 364 (1920). Type B. costaricensis (Rchb.f.) Schltr. selected by Garay, Fl. Ecuador, 9: 253 (1978). leCToType: B. boliviensis Schltr. designated superluously by Burns-Balogh, Amer. J. Bot., 69(7): 1131 (1982). leCToType: B. costaricensis (Rchb.f.) Schltr. (Spiranthes costaricensis Rchb.f.) designated by Rutkowski et al., Phylogeny & Taxonomy Subtribes Spiranthinæ, 132 (2008). Benthamia A.Rich., Mem. Soc. Hist. Nat. Paris, 4: 37 (1828). leCToType: B. latifolia A.Rich. designated by P.J. Cribb, Gen. Orch., 2: 261 (2001). Bifrenaria Lindl., Gen. Sp. Orchid. Pl., 152 (1832). Type speCies: B. atropurpurea (Loddiges) Lindl. (Maxillaria atropurpurea Loddiges) selected by S. Koehler, Brittonia, 56(4): 318 (2004). Bipinnula Comm. ex Juss., Gen. Pl., 65 (1789). leCToType: B. biplumata (L.f.) Rchb.f. (Arethusa biplumata L.f.) designated by M.N. Correa, Gen. Orch., 3: 5 (2003). Blephariglotis Raf., Fl. Tellur., 2: 38 (1837). Type speCies: B. albilora (Michx.) Raf. (Orchis cilaris var. alba Michx.) selected by Britton & Brown, Ill. Fl. N.U.S., ed. 2, 1: 556 (1913). Bletia Ruiz & Pav., Fl. Peruv. Prodr., 119, t. 26 (1794). Type speCies: B. catenulata Ruiz & Pav. selected by Britton & Millspaugh, Bahama Fl., 96 (1920). Bletilla Rchb.f., Fl. Serres Jard. Eur., ser. 1, 8: 246 (1853). Type speCies: B. gebina (Lindl.) Rchb.f. (Bletia gebina Lindl.) typ. cons. Type speCies: B. florida (Salisb.) Rchb.f. (Limodorum floridum Salisb.) this name is currently considered a species of the genus Bletia, invalidly selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(1): 423 (1871). 73 Bolusiella Schltr., Beih. Bot. Centralbl., 36(2): 105 (1918). leCToType: B. maudae (Bolus) Schltr. (Angraecum maudae Bolus) designated by Butzin, Taxon, 32(4): 630 (1983). Bontiana Petiver, Gaz., 1: 70, t. 44 (1704). leCToType: B. luzonica Petiver designated by P.J. Cribb, Taxon, 48: 47 (1999). Brachionidium Lindl., Fol. Orchid., 8: Brachionidium 8 (1859). TType speCies: B. parvifolium (Lindl.) Lindl. (Restrepia parvifolia Lindl.) selected by Garay, Canad. J. Bot., 34(4): 729 (1956). Brachystele Schltr., Beih. Bot. Centralbl., 37(2): 370 (1920). leCToType: B. unilateralis (Poiret) Schltr. (Ophrys unilateralis Poiret) designated by M.N. Corrêa, Fl. Patagónica, 8(2): 208 (1969) and Darwiniana, 11(1): 29 (1955); Cabrera, DAGI Publ. Técn., 1(6): 16 (1942); and Angely, Fl. Analitica São Paulo, 6: 1270 (1973) leCToType: B. guayanensis (Lindl.) Schltr. (Goodyera guayanensis Lindl.) designated superluously by Burns-Balogh, Amer. J. Bot., 69(7): 1131 (1982). Brasiliorchis R.B. Singer, S. Koehler & Carnevali, Novon, 17(1): 94 (2007). leCToType: B. picta (Hook.) R.B. Singer, S. Koehler & Carnevali (Maxillaria picta Hook.) designated by R.B. Singer, Novon, 17: 97 (2007). Brenesia Schltr., Repert. Spec. Nov. Regni Veg. Beih., 19: 200 (1923). leCToType: B. costaricensis Schltr. designated by K. Barringer, Fieldiana, Bot., 17: 4 (1986). Brownleea Harvey ex Lindl., J. Bot. (Hooker), 1: 16 (1842). Type speCies: B. parvilora Harvey ex Lindl. selected by E.P. Phillips, Gen. S. Afr. Fl. Pl., ed. 2, 235 (1951). Buchtienia Schltr., Repert. Spec. Nov. Regni Veg. Beih., 27: 33 (1929). leCToType: B. boliviensis Schltr. designated by Rutkowski et al., Phylogeny & Taxonomy Subtribes Spiranthinæ, 153 (2008). Bulbophyllum Thouars, Hist. Orchid., Table 3, sub 3u, tt. 93-110 (1822). LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 74 LANKESTERIANA leCToType: B. nutans Thouars designated by M.L. Green, Prop. Brit. Bot., 100 (1929); and Greuter et al., Regnum Veg., 118: 186 (1983). Caladenia R.Br., Prodr. Fl. Nov. Holland., 323 (1810). Type speCies: C. carnea R.Br. selected by M.A. Clements, Aust. Orch. Res., 1: 20 (1989); not Caladenia lava R.Br. selected by Pitzer, Nat. Planzenfam., 2(6): 104. (1889); not Caladenia catenata (Sm.) Druce selected by (N. Hallè 1977). Caleana R.Br., Prodr. Fl. Nov. Holland., 329 (1810). Type speCies: C. major R.Br., selected by Blaxell, Contr. New South Wales Natl. Herb., 4: 279 (1972). Calochilus R.Br., Prodr. Fl. Nov. Holland., 320 (1810). Type speCies: C. paludosus R.Br. selected by M.A. Clements, Austral. Orchid Res., 1: 35 (1989). Calopogon R.Br., Hortus Kew, ed. 2, 5: 204 (1813). Type speCies: C. tuberosus (L.) Britton, Sterns & Poggenb. (Limodorum tuberosum L.) selected by Mackenzie, Rhodora, 27: 195 (1925). leCToType: C. pulchellus (Salisb.) R.Br. nom. illeg. (Limodorum pulchellum Salisb. nom. illeg.), designated by M.L. Green, Prop. Brit. Bot., 100 (1929). Calypso Salisb., Parad. Lond., 2: t. 89 (1807). leCToType: C. bulbosa (L.) Oakes (Cypripedium bulbosum L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 441 (1989). Calymmanthera Schltr., Repert. Spec. Nov. Regni Veg. Beih., 1: 955 (1913). leCToType: C. tenuis Schltr., designated by Kores, Allertonia, 5: 183 (1989). Capanemia Barb.Rodr., Gen. Sp. Orchid., 1: 137, t. 354 (1877). Type speCies: C. uliginosa Barb.Rodr. selected by M.W. Chase, Gen. Orchid., 5: 237 (2009). Caularthron Raf., Fl. Tellur., 2: 40 (1837). leCToType: C. bicornutum (Hook.f.) Raf. (Epidendrum bicornutum Hook.f.) designated by van den Berg, Gen. Orch., 4: 218 (2005). Centranthera Scheidw., Allg. Gartenzeitung, 10(37): 293 (1842). neoType speCies: C. punctata Scheidw. designated by LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. Luer, Monogr. Syst. Bot. Missouri Bot. Gard., 20: 12 (1986). Centrogenium Schltr., Beih. Bot. Centralbl., 37(2): 451 (1920). leCToType: C. calcaratum (Sw.) Schltr. (Neottia calcarata Sw.) designated by M.N. Correa, Darwiniana, 11: 81 (1955) and Angely, Fl. Analitica São Paulo, 6: 1277 (1973). Centroglossa Barb.Rodr., Gen. Sp. Orchid., 2: 234 (1882). leCToType: C. tripollinica (Barb.Rodr.) Barb.Rodr. (Ornithocephalus tripollinica Barb.Rodr.) designated by Summerhayes, Index Nom. Gen. (Pl.) 1: 312 (1962), card #64/15478 ; and Toscano, Lindleyana, 16(3): 189 (2001). Centrostigma Schltr., Bot. Jahrb. Syst., 53: 522 (1915). Type speCies: C. occultans (Welw. ex Rchb.f.) Schltr. (Habenaria occultans Welw. ex Rchb.f.) selected by Summerhayes, Kew Bull., 11(2): 219 (1956). Type speCies: C. schlechteri (Kraenzl.) Schltr. (Habenaria schlechteri Kraenzl.) selected by E.P. Phillips, Gen. S. Afr. Fl. Pl., ed. 2, 232 (1951). Cephalanthera Rich., De Orchid. Eur., 21, 29, 38 (1817). Type speCies: C. damasonium (Mill.) Druce (Serapias damasonium Mill.) selected by Druce, Ann. Scot. Nat. Hist., 60: 225 (1906). Ceratandra Eckl. ex F.A. Bauer, Ill. Orch. Pl. (Bauer & Lindl.), t. 16 (1837). Type speCies: C. atrata (L.) T. Durand & Schinz (Ophrys atrata L.) selected by T. Durand & Schinz, Consp. Fl. Africa, 5: 123 (1895). Type speCies: C. chloroleuca Eckl. ex F.A. Bauer selected by E.P. Phillips, Gen. S. Afr. Fl. Pl., ed. 2, 238 (1951). leCToType: C. chloroleuca Eckl. ex F.A. Bauer designated by H.P. Linder, Taxon, 48: 48 (1999). Ceratandropsis Rolfe, Fl. Cap. (Harvey), 5(3): 266 (1913). Type speCies: C. grandilora (Lindl.) Rolfe (Ceratandra grandilora Lindl.) selected by E.P. Phillips, Gen. S. Afr. Fl. Pl., ed. 2, 238 (1951). Ceratostylis Blume, Bijdr. Fl. Ned. Ind., 7: 304, t. 56 (1825). alriCh & higgins — Orchid genera typiication leCToType: C. subulata Blume designated by Butzin, Taxon, 32(4): 630 (1983); and Royen, Orchid. High Mts. New Guinea, 455 (1979). leCToType: C. graminea Blume designated by Averyanov, Bot. Zhurn. (Moscow & Leningrad), 76(1): 126 (1991); and P.J. Cribb, Gen. Orch., 4: 546 (2005). Cestichis Thouars ex Pitzer, Entwurf Anordn. Orch., 56, 101 (1887). Type speCies: C. caespitosa (Lam.) Ames (Epidendrum caespitosum Lam.) selected by D.L. Jones & M.A. Clements, Orchidian, 15(1): 37 (2005). Chaetocephala Barb.Rodr., Gen. Sp. Orchid., 2: 37, t. 802 (1881). leCToType: C. punctata Barb.Rodr. designated by Summerhayes, Index Nom. Gen. (Pl.), 1 : 327 (1967) card #64/15508. Chamaeangis Schltr., Beih. Bot. Centralbl., 36(2): 107 (1918). leCToType: C. gracilis (Thouars) Schltr. (Angraecum gracile Thouars) designated by Garay, Bot. Mus. Leal., 23(4): 165 (1972) and Butzin, Taxon, 32(4): 630 (1983). Chamorchis Rich., De Orchid. Eur., 20, 27, 35 (1817), and Mém. Mus. Hist. Nat., 4: 49 (1818). leCToType: C. alpina (L.) Rich. (Ophrys alpina L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 445 (1989). Cheirorchis Carrière, Gard. Bull. Straits Settlem., 7: 40 (1932). Type speCies: C. breviscapa Carrière indirectly selected by Holttum, Kew Bull., 14: 272 (1960). Chelonanthera Blume, Bijdr. Fl. Ned. Ind., 8: 382, t. 51 (1825). Type speCies: C. gibbosa Blume NOTE: ING lists the name as lectotyped by Pitzer, Planzenr., IV. 50 IIB (Heft 32): 141 (1907) but there is nothing listed in the article as a type. 75 polystachya Sw.) indirectly selected by Cogniaux, Fl. Bras. (Martius), 3(4): 276 (1895). Chloraea Lindl., Quart. J. Sci. Lit. Arts, ser. 2, 1: 47 (1827). leCToType: C. virescens (Willd.) Lindl. (Cymbidium virescens Willd.) designated by M.N. Correa, Fl. Patagonica, 7(2): 200 (1970) and Gen. Orch., 3: 7 (2003). Christensonella Szlach., Mytnik, Górniak & Smiszek Polish Bot. J., 51(1): 57 (2006). Type speCies: C. paulistana (Hoehne) Szlach., Mytnik, Górniak & Smiszek (Maxillaria subulata Hoehne) selected by M.W. Chase, Gen. Orchid., 5: 135 (2009). Chrysoglossum Blume, Bijdr. Fl. Ned. Ind., 7: 337, t. 7 (1825). Type speCies: C. ornatum Blume selected by J.J. Smith, Bull. Jard. Bot. Buitenzorg, ser. 2, 8: 3 (1912). Chytroglossa Rchb.f., Hamburger GartenBlumenzeitung, 19: 546 (1863). leCToType: C. aurata Rchb.f. designated by Angely, Fl. Analítica São Paulo, 6: 1328 (1973). leCToType: C. marileoniae Rchb.f. designated by Toscano, Lindleyana, 16(3): 189 (2001). Cirrhaea Lindl., Edwards’s Bot. Reg., 18: t. 1538 (1832). Type speCies: Cirrhaea dependens (Loddiges) Loudon (Cymbidium dependens Loddiges) selected by G. Gerlach, Gen. Orch., 5: 404 (2009). Cirrhopetalum Lindl., Gen. Sp. Orchid. Pl., 58 (1830), and Bot. Reg., 10: sub 832 (1824) leCToType: Bulbophyllum longilorum Thouars designated by Garay et al., Nord. J. Bot., 14(6): 614 (1994). Chitonanthera Schltr., Nachtr. Fl. Schutzgeb. Südsee, 193 (1905). Type speCies: C. angustifolia Schltr. selected by Schuiteman & de Vogel, Blumea, 48: 511 (2003). Cladobium Schltr., Beih. Bot. Centralbl., 37(2): 431 (1920). leCToType: C. ceracifolium (Barb.Rodr.) Schltr. (Spiranthes ceracifolia Barb.Rodr.) designated by Burns-Balogh, Amer. J. Bot., 69: 1131 (1982). Type speCies: C. ceracifolium (Barb.Rodr.) Schltr. indirectly selected by Garay, Bot. Mus. Leal. 28: 330 (1982). Chloidia Lindl., Gen. Sp. Orchid. Pl., 484 (1840). Type speCies: C. polystachya (Sw.) Rchb.f. (Serapias Cleisostoma Blume, Bijdr. Fl. Ned. Ind., 8: 362, t. 27 (1825). LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 76 LANKESTERIANA Type speCies: C. sagittatum Blume selected by Garay, Bot. Mus. Leal., 23(4): 168 (1972) and Christenson, Kew Bulletin, 41(4): 835 (1986). leCToType: C. sagittatum Blume designated by Averyanov, Bot. Zhurn. (Moscow & Leningrad), 76(6): 893 (1991). Cleistes Rich. ex Lindl., Gen. Sp. Orchid. Pl., 409 (1840). Type speCies: C. grandilorum (Aublet) Schltr. (Limodorum grandilorum Aublet) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(1): 781 (1871). Cnemidia Lindl., Edwards’s Bot. Reg., 19: sub 1618 (1833). Type speCies: Cnemidia angulosa Lindl. selected by Hooker f., Fl. Brit. Ind., 6: 92 (1890). Coccineorchis Schltr., Beih. Bot. Centralbl., 37(2): 434 (1920). leCToType: C. corymbose Kraenzl. designated by Burns-Balogh, Amer. J. Bot., 69: 1131 (1982). leCToType: C. cernua (Lindl.) Garay (Stenorrhynchos cernuum Lindl.) designated by Rutkowski et al., Phylogeny & Taxonomy Subtribes Spiranthinæ, 158 (2008). Codonorchis Lindl., Gen. Sp. Orch. Pl., 410 (1840). leCToType: C. lessonii (d’Urville) Lindl. (Epipactis lessonii d’Urville) designated by M.N. Correa, Fl. Patagónica, 8(2): 191 (1969). Coelia Lindl., Gen. Sp. Orchid. Pl., 36 (1830). Type speCies: C. bauerana Lindl., nom. illeg. Type speCies: C. triptera (Sm.) G. Don ex Steudel, (Epidendrum tripterum Sm.) selected by Steudel, Nomencl. Bot., 1: 394 (1841). Coeloglossum Hartman, Handb. Skand. Fl., 323, 329 (1820). Type speCies: C. viride (L.) Hartman (Satyrium viride L.) selected by Britton & Brown, Ill. Fl. N.U.S., ed. 2, 1: 552 (1913). leCToType: C. viride (L.) Hartman designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 447 (1989). Coelogyne Lindl., Collect. Bot., sub t. 33 (1821). Type speCies: C. cristata Lindl. selected by C.H. Curtis, Orchids (Curtis), 82 (1950). LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. leCToType: C. cristata Lindl., designated by Butzin, Taxon, 32(4): 630 (1983); Averyanov, Bot. Zhurn. (Moscow & Leningrad), 75(12): 1767 (1990); Cogniauxiocharis (Schltr.) Hoehne, Arq. Bot. Estado São Paulo, n.s., 1(6): 132 (1944). leCToType: C. glazioviana (Cogn.) Hoehne (Pelexia glazioviana Cogn.) designated by Rutkowski et al., Phylogeny & Taxonomy Subtribes Spiranthinæ, 167 (2008). Coilostylis Raf., Fl. Tellur., 4: 37 (1838). leCToType: C. emarginata (L.) Raf. (Epidendrum ciliare L.) designated by Christenson, Richardiana, 3: 114 (2003). Colax Lindl., Edwards’s Bot. Reg., 29(Misc): 50 (1843). Type speCies: C. viridis (Lindl.) Lindl. (Maxillaria viridis Lindl.) selected by Pupulin, Gen. Orchid., 5(2): 517 (2009). Comparettia Poepp. & Endl., Nova Gen. Sp., 1: 42, t. 73 (1836). Type speCies: C. falcata Poepp. & Endl. indirectly selected by Reichenbach f., Ann. Bot. Syst., 6: 688 (1863). Type speCies: C. saccata Poepp. & Endl. selected by Britton & Wilson, Sci, Surv. Porto Rico, 5(2): 211 (1924). leCToType: C. falcata Poepp. & Endl. designated by Angely, Fl. Analitica São Paulo, 6: 1321 (1973). Comperia K. Koch, Linnaea, 22: 287 (1849). Type speCies: C. comperiana (Steven) Asch. & Graebn. (Orchis comperiana Steven) selected by Ascherson & Graebner, Syn. Mitteleur. Fl., 3: 620 (1907); and Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 837 (1872) indirectly selected type species. Corallorhiza Gagnebin, Acta Helv. Phys.-Math., 2: 61 (1755). Type speCies: C. innata R.Br. indirectly selected by McVaugh, Fl. Novo-Galiciana, 16: 57 (1983). leCToType: C. triida (L.) Châtelain (Ophrys corallorrhiza L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 449 (1989). Corybas Salisb., Parad. Lond., 2: t. 83 (1807). alriCh & higgins — Orchid genera typiication Type speCies: Corysanthes bicalcarata R.Br. This name is considered a synonym of Corybas aconitilorus Salisb. selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 883 (1872). Corycium Sw., Kongl. Vetensk. Acad. Nya Handl., ser. 2, 21: 220, t. 3g (1800). Type speCies: C. crispum (Thunberg) Sw. (Arethusa crispa Thunberg) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 883 (1872). Type speCies: C. orobanchoides (L.f.) Sw. (Satyrium orobanchoides L.f.) selected by H. Kurzweil, Gen. Orch., 2: 23 (2001). Corysanthes R.Br., Prodr. Fl. Nov. Holland., 328 (1810). Type speCies: C. imbriata R.Br. selected by Endlicher, Gen. Pl. (Endlicher), 218 (1837). Costaricaea Schltr., Repert. Spec. Nov. Regni Veg. Beih., 19: 30 (1923). leCToType: C. amparoana Schltr. designated by Pupulin, Bot. J. Linn. Soc., 163: 122 (2010). Cranichis Sw., Nov. Gen. Spec, Pl. Prodr., 8: 120 (1788). Type speCies: C. muscosa Sw. selected by Acuña, Cat. Descr. Orquid. Cuba, 60: 48 (1939). Cremastra Lindl., Gen. Sp. Orchid. Pl., 172 (1833). Type speCies: Cremastra wallichiana Lindl. nom. illeg. This type name is now considered a synonym of C. appendiculata (D. Don) Makino (Cymbidium appendiculatum D. Don) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 908 (1872). Crepidium Blume, Bijdr. Fl. Ned. Ind., 8: 387, t. 63 (1825). leCToType: C. reedii Blume designated by Seidenfaden, Dansk Bot. Arkiv, 33 (1): 43 (1978). Type speCies: C. reedii Blume selected by Szlachetko, Fragm. Florist. Geobot. Suppl., 3: 123 (1995). Cryptophoranthus Barb.Rodr., Gen. Sp. Orchid. Nov., 2: 79, t. 476 (1881). Type speCies: C. fenestratus (Barb.Rodr.) Barb.Rodr. (Pleurothallis fenestrata Barb.Rodr.) selected by Acuña, Cat. Descr. Cuba, 60: 115 (1939). leCToType: C. fenestratus (Barb.Rodr.) Barb.Rodr. designated by Butzin, Taxon, 32(4): 631 (1983); and 77 Angely, Fl. Analitica São Paulo, 6: 1279 (1973). Cryptostylis R.Br., Prodr. Fl. Nov. Holland., 317 (1810). Type speCies: C. erecta R.Br. selected by N. Hallé, Fl. Nouvelle Caledonie & Depend., 8: 481 (1977). leCToType: C. longifolia R.Br., designated by Averyanov, Bot. Zhurn. (Moscow & Leningrad), 75: 1021 (1990). Cybelion Spreng., Veg. (Sprengel), ed. 16, 3: 679, 721 (1826). Type speCies: C. pulchellum (Kunth) Spreng. (Ionopsis pulchella Kunth) selected by Garay & H.R. Sweet, J. Arnold Arbor., 53(4) 518 (1972). Cymbidiella Rolfe, Orchid Rev., 26: 58 (1918). leCToType: C. labellata (Thouars) Rolfe (Cymbidium labellatum Thouars) designated by Alrich & W.E. Higgins, Ill. Dict. Orchid Gen., 108 (2008). Type speCies: C. labellata (Thouars) Rolfe selected by M.W. Chase, Gen. Orchid., 5: 98 (2009). Cymbidium Sw., Nova Acta Regiae Soc. Sci. Upsal., ser. 2, 6: 70 (1799). leCToType: C. aloifolium (L.) Sw. (Epidendrum aloifolium L.) designated by P.F. Hunt, Kew Bull., 24(1): 94 (1970) and Averyanov, Bot. Zhurn. (Moscow & Leningrad), 76(6): 884 (1991). Cymbiglossum Halbinger, Orquidea (Mexico City), n.s., 9(1): 1-2 (1983). Type speCies: C. cervantesii (Lex.) Halbinger (Odontoglossum cervantesii Lex.) selected by M.W. Chase, Gen. Orchid., 5: 341 (2009). Cynorkis Thouars, Nouv. Bull. Sci. Soc. Philom Paris, 1: 317 (1809). Type speCies: C. fastigiata Thouars selected by P.J. Cribb, Man. Cult. Orch. Sp., 108 (1981). Cypripedium L., Sp. Pl. (Linnaeus), ed. 1, 2: 951 (1753). leCToType: C. calceolus L. designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 452 (1989). Cyperorchis Blume, Rumphia, 4: 47 (1849), and Mus. Bot., 1: 48 (1849). leCToType: Cyperorchis elegans (Lindl.) Blume LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 78 LANKESTERIANA (Cymbidium elegans Lindl.) designated by P.F. Hunt, Kew Bull., 24(1): 94 (1970). Cyrtidiorchis Rauschert, Taxon, 31(3): 560 (1982). Type speCies: C. rhomboglossum (F. Lehmann & Kraenzl.) Schltr. (Chrysocycnis rhomboglossa F. Lehmann & Kraenzl.) selected by P. Ortiz, Orquid. Colombia, ed. 2, 70 (1995). Cyrtidium Schltr., Repert. Spec. Nov. Regni Veg. Beih., 27: 178 (1924). Type speCies: C. rhomboglossum (F. Lehmann & Kraenzl.) Schltr. (Chrysocycnis rhomboglossa F. Lehmann & Kraenzl.) selected by Garay, Orquideologia, 4: 8 (1969). Cyrtochilum Kunth, Nov. Gen. Pl., 1: 349, t. 84 (1816). leCToType: C. undulatum Kunth designated by Garay, Bradea, 1(40): 398 (1974). Cyrtopera Lindl., Gen. Sp. Orchid. Pl., 189 (1833). Type speCies: C. woodfordii (Sims) Lindl. (Cyrtopodium woodfordii Sims) selected by A. Richard, Dict. Univ. Hist. Nat., 4: 561 (1844). Cyrtorchis Schltr., Orchideen (Schlechter), ed. 1, 595 (1914). leCToType: C. arcuata (Lindl.) Schltr. (Angraecum arcuatum Lindl.) designated by Summerhayes, Kew Bull., 3: 278 (1948). Cyrtosia Blume, Bijdr. Fl. Ned. Ind., 8: 396, t. 6 (1825). Type speCies: C. javanica Blume selected by Blume, Rumphia, 1: 199 (1837). leCToType: C. javanica Blume designated by Averyanov, Bot. Zhurn. (Moscow & Leningrad), 75(12): 1760 (1990). Cystorchis Blume, Coll. Orch., 1: 87 (1855). Type speCies: C. variegata Blume selected by Ridley, J. Linn. Soc. (Bot.), 32: 399 (1896). Type speCies: D. umbrosa (Karelin & Kirilov) Nevski (Orchis umbrosus Karelin & Kirilov) selected by Soó, Jahresber. Naturwiss. Vereins Wuppertal, 21-22: 13 (1968). deiregyne Schltr., Beih. Bot. Centralbl., 37(2): 425 (1920). leCToType: D. chloreaeformis (A.Rich. & Galeotti) Schltr. (Spiranthes chloreaeformis A.Rich. & Galeotti) designated by Garay, Bot. Mus. Leal., 28: 312 (1980). noTe: The choice of D. chloreaeformis is against the protologue, see Szlachetko, Fragm. Florist. Geobot., 40: 794 (1995) leCToType: D. hemichrea (Lindl.) Schltr. (Spiranthes hemichrea Lindl.) designated by Burns-Balogh, Amer. J. Bot., 69: 1131 (1982). dendrobium Sw., Nova Acta Regiæ Soc. Sci. Upsal., ser. 2, 6: 82 (1799). Type speCies: D. moniliforme (L.) Sw. (Epidendrum moniliforme L.) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 1030 (1872) and M.A. Clements, Austral. Orchid Res., 1: 57 (1989). leCToType: D. moniliforme (L.) Sw. designated by R.K. Brummitt, Taxon, 31: 542 (1982) and Averyanov, Bot. Zhurn. (Moscow & Leningrad), 76(1): 125 (1991). dendrochilum Blume, Bijdr. Fl. Ned. Ind., 8: 398, t. 52 (1825). Type speCies: D. aurantiacum Blume selected by Bechtel et al., Man. Cult. Orchid Sp., ed 1, 127 (1981). dendrocolla Blume, Bijdr. Fl. Ned. Ind., 7: 286, t. 67 (1825). Type speCies: D. hystrix Blume designated by J.J. Smith, Bull. Jard. Bot. Buitenzorg, ser. 3, 3: 303 (1921). dendrolirium Blume, Bijdr. Fl. Ned. Ind., 7: 343, t. 69 (1825). Type speCies: D. ornatum Blume selected by Breiger, Orchideen (Schlechter), ed. 3, 11/12: 717 (1981). Cytherea Salisb., Parad. Lond., 2(1): errata (1807), and Trans. Hort. Soc. London, 1: 301 (1812). Type speCies: C. bulbosa (L.) Oakes (Cypripedium bulbosum L.) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 994 (1872). desmotrichum Blume, Bijdr. Fl. Ned. Ind., 329 (1825). leCToType: D. angulatum Blume designated by P.F. Hunt & Summerhayes, Taxon, 10: 102 (1961). dactylorhiza Necker ex Nevski, Trudy Bot. Inst. Akad. Nauk S.S.S.R., ser. 1, Fl. Sist. Vyssh. Rast., 4: 332 (1937). diaphananthe Schltr., Orchideen (Schlechter), ed. 1, 593 (1914). leCToType: D. pellucida (Lindl.) Schltr. (Angraecum LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. alriCh & higgins — Orchid genera typiication 79 pellucidum Lindl.) designated by Schlechter, Beih. Bot. Centralbl., 36(2): 97 (1918). Type speCies: Satyrium viride L. selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 1099 (1871). dichaea Lindl., Gen. Sp. Orchid. Pl., 208 (1833). Type speCies: D. echinocarpa (Sw.) Lindl. (Epidendrum echinocarpon Sw.) selected by Lindley, Bot. Reg., 18: sub 1530 (1832); and Britton & Wilson, Sci. Surv. Porto Rico, 5(2): 214 (1924). discyphus Schltr., Repert. Spec. Nov. Regni Veg. Beih., 15: 417 (1919). leCToType: D. scopulariae (Rchb.f.) Schltr. (Spiranthes scopulariae Rchb.f.) designated by Rutkowski et al., Phylogeny & Taxonomy Subtribes Spiranthinæ, 153 (2008). dichaeopsis Pitzer, Entwurf Anordn, Orch., 107 (1887). leCToType: D. graminoides (Sw.) Schltr. (Epidendrum graminoides Sw.) designated by Garay & H.R. Sweet, J. Arnold Arbor., 53(4): 519 (1972). dicrypta Lindl., Gen. Sp. Orchid. Pl., 44, 152 (1830). Type speCies: D. crassifolia (Lindl.) Lindl. (Heterotaxis crassifolia Lindl.) selected by I. Ojeda, Gen. Orchid., 5(2): 147 (2009). didactyle Lindl., Fol. Orchid., 1: Didactyle, 1 (1852). Type speCies: Bulbophyllum gladiatum Lindl. invalidly selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 1070 (1872). dikylikostigma Kraenzl., Notizbl. Bot. Gart. BerlinDahlem., 7: 321 (1919). leCToType: D. preussii Kraenzl. designated by Rutkowski et al., Phylogeny & Taxonomy Subtribes Spiranthinæ, 153 (2008). dimerandra Schltr., Repert. Spec. Nov. Regni Veg. Beih., 17: 43 (1922). Type speCies: D. rimbachii (Schltr.) Schltr. (Epidendrum rimbachii Schltr.) designated by Siegerist, Bot. Mus. Leal., 30: 204 (1986). dinema Lindl., Orchid. Scelet., 16 (1826). Type speCies: D. polybulbon (Sw.) Lindl. (Epidendrum polybulbon Sw.) selected by Lindley, Coll. Bot., Append.: no. 125 (1826). disperis Sw., Kongl. Vetensk. Acad. Nya Handl., 21: 218, t. 3f (1800). Type speCies: D. circumlexa (L.) T. Durand & Schinz (Ophrys circumlexa L.) selected by E.P. Phillips, Gen. S. Afr. Fl. Pl., ed. 2, 237 (1951) and H.P. Linder et al., Orchid S. Afr., 299 (1999). leCToType: D. circumlexa (L.) T. Durand & Schinz designated by J.C. Manning, Taxon, 48: 48 (1999). leCToType: D. capensis (L.) Sw. (Arethusa capensis L.) designated by J.C. Manning, Taxon, 48: 46 (1999). diuris Sm., Trans. Linn. Soc. London, Bot., 4: 222 (1798). Type speCies: D. aurea Sm., selected by Smith, Exot. Bot., 1: 15 (1805). domingoa Schltr., Symb. Antill., 7: 496 (1913). Type speCies: D. haematochila (Rchb.f.) Carabia (Epidendrum haematochilum Rchb.f.) selected by Carabia, Mem. Soc. Cub. Hist. Nat., 17(2): 143 (1943) and Acuña, Cat. Descr. Orquid. Cuba, 60: 64 (1938). dorycheile Rchb., Deut. Bot. Herb.-Buch, 56 (1841). Type speCies: D. rubra (L.) Fuss (Serapias rubra L.) selected by Fuss, Fl. Transsilv., 628 (1866) and Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 1128 (1872). drakaea Lindl., Sketch Veg. Swan R., Appendix: 55 (1840). Type speCies: D. elastica Lindley designated by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 1134 (1872) and Clements, M.A. Aust. Orch. Res., 1: 72 (1989). diphryllum Raf., Med. Repos., ser. 2, 5: 357 (1808). Type speCies: Diphryllum bifolium Raf. designated by Rainesque. Type speCies: Listera convallarioides (Sw.) Nuttall (Epipactis convallarioides Sw.) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 1091 (1872). dryadorchis Schltr., Repert. Spec. Nov. Regni Veg. Beih., 1: 976 (1913). Type speCies: D. barbellata Schltr. selected by Senghas, Orchideen (Schlechter), ed. 3, 1(19-20): 1201 (1988). diplorrhiza Ehrhart, Beitr. Naturk. (Ehrhart), 4: 147 (1789). dryopeia Thouars, Hist. Orchid., tt. 1-3 (1822). leCToType: D. oppositifolia Thouars designated by LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 80 LANKESTERIANA Kurzweil & Manning, Adansonia, ser. 3, 27(2): 167 (2005). dryorkis Thouars, Nouv. Bull. Sci. Soc. Philom. Paris, 1: 316 (1809). leCToType: D. tripetaloides Thouars designated by Kurzweil & Manning, Adansonia, ser. 3, 27(2): 172 (2005). elleanthus C. Presl, Rel. Haenk., 1: 97 (1827). Type speCies: E. lancifolius C. Presl. selected by Britton & Wilson, Sci. Surv. Porto Rico, 5(2): 203 (1924). eltroplectris Raf., Fl. Tellur., 2: 51 (1836). Type speCies: E. calcarata (Sw.) Garay & H.R. Sweet (Neottia calcarata Sw.) selected by Britton & Wilson, Sci. Surv. Porto Rico, 5(2): 186 (1924) and Garay, Fl. Ecuador, 9: 239 (1978). ephemerantha P.F.Hunt & Summerhayes, Taxon, 10(4): 102 (1961). leCToType: E. angulata (Blume) P.F. Hunt & Summerhayes (Desmotrichum angulatum Blume) designated by P.F. Hunt & Summerhayes, Taxon, 10(4): 102 (1961). epiblastus Schltr., Nachtr. Fl. Deutsch. Schutzgeb. Südsee, 136 (1905). Type speCies: E. ornithidioides Schltr. selected by van Royen, Alpine Fl. New Guinea, 2: 489 (1979). epidendrum L., Sp. Pl. (Linnaeus), ed. 1, 2: 952 (1753) (nom. rej.). Type speCies: E. nodosum L. selected by Britton & Wilson, Sci. Surv. Puerto Rico, 5(2): 203 (1924). epidendrum L., Sp. Pl. (Linnaeus), ed. 2, 2: 1347 (1763) (nom. cons.). leCToType: E. nocturnum Jacq. designated by Sprague, Prop. Brit. Bot., 53 (1929) and Voss et al., Regnum Veg 111: 335 (1983). epilyna Schltr., Beih. Bot. Centralbl., 36(2): 374 (1918). leCToType: E. jimenezii Schltr. designated by Pupulin, Bot. J. Linn. Soc., 163: 132 (2010). epipactis Zinn, Cat. Pl. Hort. Gott., 85 (1757). leCToType: E. helleborine (L.) Crantz (Serapias helleborine L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 470 (1989), P.J. Cribb & J.J. Wood, Taxon, 48: 49 (1999) LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. and Voss et al., Regnum Veg 111: 333 (1983). epipogium J.G. Gmelin ex Borkhausen, Tent. Disp. Pl. German., 139 (1792). leCToType: E. aphyllum Sw. (Satyrium epipogium L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 477 (1989). eriochilus R.Br., Prodr. Fl. Nov. Holland., 323 (1810). TYPE SPECIES: E. cucullatus (Labillardière) Rchb.f. (Epipactis cucullata Labillardière) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 1240 (1872). Type speCies: E. autumnalis R.Br. (nom. illeg.) selected by S.D. Hopper & A.P. Brown, Nuytsia 16(1): 30 (2006). erporkis Thouars, Nouv. Bull. Sci. Soc. Phil., Paris, 1: 317 (1809). leCToType: Goodyera occulta Thouars designated by Ormerod, Gen. Orch., 3: 136 (2003). eulophia R.Br. ex Lindl.. Bot. Reg., 7: sub 578 [573], as Eulophus (1821), and Bot. Reg., 8: t. 686 (1822). leCToType: Eulophia guineensis Lindl. designated by W. Greuter et al., Regnum Veg., 118: 186 (1988). eurycentrum Schltr., Nachtr. Fl. Deutsch Schutzgeb. Südsee, 89 (1905). leCToType: E. obscurum (Blume) Schltr. (Cystorchis obscura Blume) designated by Ormerod, Gen. Orch., 3: 90 (2003). eurystyles Wawra, Österr. Bot. Zeitschr., 13: 223 (1863). leCToType: E. cotyledon Wawra designated by Rutkowski et al., Phylogeny & Taxonomy Subtribes Spiranthinæ, 149 (2008). evelyna Poepp. & Endl., Nova Gen. Sp., 1: 32 (1836). Type speCies: E. capitata Poepp. & Endl. selected by Dressler, Gen. Orch., 4: 598 (2005) and Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 1321 (1874). evota Rolfe, Fl. Cap. (Harvey), 5(3): 268 (1913). Type speCies: E. harveyana (Lindl.) Rolfe (Ceratandra harveyana Lindl.) selected by E.P. Phillips, Gen. S. Afr. Fl. Pl., ed. 2, 238 (1951). Fernandezia Ruiz & Pavón, Fl. Peruv. Prodr., 123, t. 27 (1794). leCToType: E. subbilora Ruiz & Pavón designated alriCh & higgins — Orchid genera typiication 81 by Dunsterville & Garay, Venez. Orchids Ill., 5: 124 (1972). designated by Christenson, Kew Bulletin, 41(4): 836 (1986). Flickingeria A.D. Hawkes, Orchid Weekly, 2(46): 451 (1961). leCToType: F. angulata (Blume) A.D. Hawkes (Desmotrichum angulatum Blume) designated by Averyanov, Bot. Zhurn. (Moscow & Leningrad), 76(1): 125 (1991). Gavilea Poepp., Frag. Syn. Pl. Chil., 188 (1833). leCToType: G. leucantha Poepp. designated by M.N. Corrêa, Fl. Patagónica, 8(2): 191 (1969) and Gen. Orch., 3: 10 (2003). Fractiunguis Schltr., Anexos Mem. Inst. Butantan, Secç. Bot. 1(4): 56 (1922). Type speCies: F. relexus (Rchb.f.) Schltr. (Hexisea relexa Rchb.f.) selected by Acuña, Cat. Descr. Orquid. Cuba, 60: 89. (1938). leCToType: F. relexus (Rchb.f.) Schltr. designated by Dressler, Gen. Orch., 4: 310 (2005). Funkiella Schltr., Beih. Bot. Centralbl., 37(2): 430 (1920). leCToType: F. hyemalis (A.Rich. & Galeotti) Schltr. (Spiranthes hyemalis A.Rich. & Galeotti) designated by Rutkowski et al., Phylogeny & Taxonomy Subtribes Spiranthinæ, 168 (2008) and Burns-Balogh, Amer. J. Bot., 69: 1131 (1982). Galearis Raf., Herb. Raf., 71 (1833). leCToType: G. spectabilis (L.) Raf. (Orchis spectabilis L.) designated by Sheviak, Taxon, 48: 49 (1999). Galeoglossum A.Rich. & Galeotti, Ann. Sci. Nat., Bot., sér. 3, 3: 31 (1845). Type speCies: G. prescottioides A.Rich. & Galeotti selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 1401 (1872). leCToType: G. prescottioides A.Rich. & Galeotti designated by Salazar, Proc. Second Sci. Conf. Andrean Orchids, 169 (2009). Galeottiella Schltr., Beih. Bot. Centralbl., 37(2): 360 (1920). leCToType: G. sarcoglossa (A.Rich. & Galeotti) Schltr. (Spiranthes sarcoglossa A.Rich. & Galeotti) designated by Burns-Balogh, Amer. J. Bot., 69(7): 1131 (1982) and Rutkowski et al., Phylogeny & Taxonomy Subtribes Spiranthinæ, 146 (2008). Gastrochilus D. Don, Prodr. Fl. Nepal., 32 (1825). leCToType: G. calceolaris (Buch.-Ham. ex Sm.) D. Don (Aerides calceolare Buch.-Ham. ex Sm.) Gennaria Parlatore, Fl. Ital. (Parlatore), 3: 404 (1860). Type speCies: G. diphylla (Link) Parlatore (Satyrium diphyllum Link) selected by Schlechter, Repert. Spec. Nov. Regni Veg., 15: 296 (1918). Gigliolia Barb.Rodr., Gen. Sp. Orch. Nov., 1: 25 (1877). leCToType: G. geraensis Barb.Rodr. indirectly designated by Garay, Orquideologia, 9: 117 (1974). Glossochilopsis Szlach., Fragm. Florist. Geobot., 3(Suppl.): 122 (1995). leCToType: G. chamaeorchis (Schltr.) Szlach. (Microstylis chamaeorchis Schltr.) designated by Margonska, Richardiana, 8(2): 75 (2008). Glossodia R.Br., Prodr. Fl. Nov. Holland., 325 (1810). Type speCies: G. major R.Br. selected by M.A. Clements, Austral. Orchid. Res., 1: 83 (1989). Gonogona Link, Enum. Hort. Berol. Alt., 2: 369 (1822). Type speCies: Goodyera repens (L.) R.Br. (Satyrium repens L.) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 1481 (1872). Goodyera R.Br., Hortus Kew, ed. 2, 5: 197 (1813). Type speCies: G. repens (L.) R.Br. (Satyrium repens L.) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 1485 (1872), Britton & Brown, Ill. Fl. N.U.S., ed. 2, 1: 569 (1913) and Sprague, J. Bot., 64: 113 (1926). leCToType: G. repens (L.) R.Br. designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 479 (1989). Grastidium Blume, Bijdr. Fl. Ned. Ind., 7: 333, 433 (1825). Type speCies: G. salaccense Blume selected by Breiger, Orchideen (Schlechter), ed. 3, 11/12: 653 (1981). Gymnadenia R.Br., Hortus Kew., ed. 2, 5: 191 (1813). leCToType: G. conopsea (L.) R.Br. (Orchis conopsea L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 82 LANKESTERIANA Heim. Orch. Baden-Württ., 21(3): 482 (1989). Gymnadeniopsis Rydb., Man. Fl. N. States (Britton), 293 (1901). Type speCies: G. nivea (Nuttall) Rydb. (Orchis nivea Nuttall) selected by Britton & Brown, Ill. Fl. N.U.S., ed. 2, 1: 552 (1913). Gyrostachys Pers. ex Blume, Coll. Orch., 127 (1859). Type speCies: G. spiralis (L.) Pers. ex Blume (Ophrys spiralis L.) selected by Kuntze, Rev. Gen. Pl., 2: 663 (1891). leCToType: G. spiralis (L.) Pers. ex Blume designated by Garay, Bot. Mus. Leal., 28(4) 360 (1980)[1982]. Habenaria Willd., Sp. Pl., ed. 4, 44 (1805). Type speCies: H. macroceratitis Willd. (Orchis habenaria L.) selected by Kraenzlin, Bot. Jahrb. Syst., 16: 58 (1892). Type speCies: H. monorrhiza (Sw.) Rchb.f. (Orchis monorrhiza Sw.) invalidly selected by Lindley, Bot. Reg., 18: sub 1499 (1832). The above type name is now considered a synonym of the species Habenaria quinqueseta var. macroceratitis (Willd.) Luer (Habenaria macroceratitis Willd.) which was lectotyped by P.J. Cribb, Taxon, 48: 48 (1999). Hammarbya Kuntze, Revis. Gen. Pl., 2: 665 (1891). leCToType: H. paludosa (L.) Kuntze (Ophrys paludosa L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 487 (1989). Hapalorchis Schltr., Beih. Bot. Centralbl., 37(2): 362 (1920). Type speCies: H. candidus (Kraenzl.) Schltr. (Sauroglossum candidum Kraenzl.) selected by Britton & Wilson, Sci. Surv. Porto Rico, 5(2): 186 (1924). leCToType: H. cheirostyloides Schltr. designated by Rutkowski et al., Phylogeny & Taxonomy Subtribes Spiranthinæ, 134 (2008). Haraella Kudô, J. Soc. Trop. Agric., 2: 26 (1930). leCToType: H. retrocalla (Hayata) Kudô (Saccolabium retrocallum Hayata) designated by Butzin, Taxon, 32(4): 631 (1983). Herminium L., Opera Var., 251 (1758), and Fl. Lapp. (Linnaeus), 247 (1737). leCToType: H. monorchis (L.) R.Br. (Orchis monorchis L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. Heim. Orch. Baden-Württ., 21(3): 489 (1989); and Averyanov, Bot. Zhurn. (Moscow & Leningrad), 75(7): 1027 (1990). Hetaeria Blume, Bijdr. Fl. Ned. Ind., 8: 409, t. 14 (1930). leCToType: H. oblongifolia Blume designated by L.G. Adams, Taxon, 36(3): 651 (1987). Himantoglossum Spreng., Syst. Veg. (Sprengel), ed. 16, 3: 675, 694 (1826). leCToType: H. hircinum (L.) Spreng. (Satyrium hircinum L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 491 (1989). Holothrix Rich. ex Lindl., Gen. Sp. Orchid. Pl., 257, 283 (1835). Type speCies: H. hispidula (L.f.) T. Durand & Schinz (Orchis hispidula L.f.) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 1658 (1872). Humboldtia Ruiz & Pavón, Fl. Peruv. Chil. Prodr., 121, t. 27 (1794). leCToType: H. purpurea Ruiz & Pavón designated by Garay & H.R. Sweet, J. Arnold Arbor., 53(4): 522 (1972). Huntleya Bateman ex Lindl., Edwards’s Bot. Reg., 23: sub 1991 (1837). Type speCies: H. sessililora Bateman ex Lindl. selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 1680 (1872). Ibidium Salisb., Trans. Hort. Soc. London, 1: 291 (1812). Type speCies: I. spirale (L.) Salisb. (Ophyrs spiralis L.) selected by House, Bull. Torr. Club, 32: 380 (1905). Ionopsis Kunth, Nov. Gen. Sp., 1: 348, t. 83 (1815). Type speCies: I. utricularioides (Sw.) Lindl. (Epidendrum utricularioides Sw.) selected by M.W. Chase, Gen. Orchid., 5: 281 (2009). Isochilus R.Br., Hortus Kew, ed. 2, 5: 209 (1813). leCToType: I. linearis (Jacq.) R.Br. (Epidendrum lineare Jacq.), designated by Angely, Fl. Analitica São Paulo, 6: 1303 (1973) and Summerhayes, Index Nom. Gen. (Pl.), 2: 880 (1979) card #64/23515. Type speCies: I. linearis (Jacq.) R.Br. selected by alriCh & higgins — Orchid genera typiication Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 1767 (1872); and type indirectly selected by Reichenbach f., Bonplandia (Hannover), 2: 22 (1854). Jacquiniella Schltr., Repert. Spec. Nov. Regni Veg. Beih., 7: 123 (1920). Type speCies: J. globosa (Jacq.) Schltr. (Epidendrum globosum Jacq.) selected by Britton & Wilson, Sci. Surv. Porto Rico, 5(2): 197 (1924). Jensoa Raf., Fl. Tellur., 4: 38 (1836)[1837] leCToType: J. ensata (Thunberg) Raf. nom. illeg. (Limodorum ensatum Thunberg) designated by P.F. Hunt, Kew Bull., 24(1): 94 (1970). Jimensia Raf., Fl. Tellur., 4: 38 (1836)[1837]. Type speCies: J. nervosa Raf., nom. illeg., Bletilla striata (Thunberg) Rchb.f. (Limodorum striatum Thunberg), indirectly selected by Garay & R.E. Schultes, Bot. Mus. Leal., 18(5): 184 (1958). Jumellea Schltr., Orchideen (Schlechter), ed. 1, 609 (1914). leCToType: J. recurva (Thouars) Schltr. (Angraecum recurum Thouars) designated by Garay, Bot. Mus. Leal., 23(4): 182 (1972). kefersteinia Rchb.f., Bot. Zeitung (Berlin), 10: 633 (1852). Type speCies: K. graminea (Lindl.) Rchb.f. (Zygopetalon gramineum Lindl.) designated by Garay, Orquideologia, 4: 150 (1969). kingidium P.F. Hunt, Kew Bull., 24(1): 97 (1970). leCToType: K. taeniale (Lindl.) P.F.Hunt (Aerides taenialis Lindl.) designated by Averyanov, Bot. Zhurn. (Moscow & Leningrad), 76(6): 891 (1991). kingiella Rolfe, Orchid Rev., 25(297): 196 (1917). leCToType: K. taenialis (Lindl.) Rolfe (Aerides taenialis Lindl.) designated by P.F. Hunt, Amer. Orchid Soc. Bull., 40(12): 1094 (1971). kraenzlinorchis Szlach., Orchidee (Hamburg), 55(1): 57 (2004). leCToType: K. mandersii (Collett & Hemsl.) Szlach. (Habenaria mandersii Collett & Hemsl.) designated by H. Kurzweil, Thai For. Bull. (Bot.), 77 (2009). kuhlhasseltia J.J. Sm., Icon. Bogor., 4: 1, t. 301 (1910). leCToType: K. javanica J.J.Sm. designated Ormerod, Gen. Orch., 3: 110 (2003). 83 by laelia Lindl., Gen. Sp. Orch. Pl., 115 (1831). Type speCies: L. grandilora (Lex.) Lindl. (Bletia grandilora Lex.) indirectly selected by Dandy, Kew Bull., 86. (1935). lanium Lindl. ex Benth., Hooker’s Icon. Pl., 14: 24, t. 1334 (1881). Type speCies: L. avicula (Lindl.) Benth. (Epidendrum avicula Lindl.) selected by Angely, Fl. Analitica São Paulo, 6: 1294 (1973). lecanorchis Blume, Mus. Bot., 2: 188 (1856). leCToType: L. javanica Blume designated by Garay & H.R. Sweet, Orchids S. Ryukyu Islands, 49 (1974). leochilus Knowles & Westc., Fl. Cab., 2: 143 (1838). Type speCies: L. oncidioides Knowles & Westc. designated by Knowles & Westcott. Type speCies: Oncidium macrantherum Hook. invalidly selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(1): 64 (1874). lepanthes Sw., Nova Acta Regiae Soc. Sci. Upsal., 6: 85 (1799). Type speCies: L. concinna Sw. selected by Britton & Wilson, Sci. Surv. Porto Rico, 5(2): 206 (1924). lepanthopsis Ames, Bot. Mus. Leal., 1(9): 3 (1933). Type speCies: L. loripecten (Rchb.f.) Ames (Pleurothallis loripecten Rchb.f.) selected by Garay, Orquideologia, 9: 116 (1974). leptoceras (R.Br.) Lindl., Sketch Veg. Swan River Colony, 53 (1840). Type speCies: L. menziesii (R.Br.) Lindl. (Caladenia menziesii R.Br.) selected by A.S. George, Nuytsia, 1: 183 (1971). leucostachys Hoffmannsegg, Verz. Orchid., 26 (1842). Type speCies: L. procera (Ker Gawler) Hoffmannsegg (Neottia procera Ker Gawler) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(1): 102 (1874). limnorchis Rydb., Mem. New York Bot. Gard., 1: 104 (1900). Type speCies: L. hyperborea (L.) Rydb. (Orchis hyperborea L.) selected by Britton & Brown, Ill. Fl. N.U.S., ed. 2, 1: 554 (1913). LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 84 LANKESTERIANA limodorum Boehm. (nom. cons.), Deinitiones Generum Plantarum: 358 (1760). leCToType: L. abortivum (L.) Sw. (Orchis abortiva L.) designated by Greuter et al., Regnum Veg. 118: 183 (1988) and H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., (3): 493 (1989). limodorum L., Sp. Pl., ed. 1, 2: 950 (1753). Type speCies: L. tuberosum L. selected by & Brown, Ill. Fl. N.U.S., ed. 2, 1: 562 (1913). liparis Rich., De Orchid. Eur., 21, 30 & 38, f. 10 (1817). leCToType: L. loeselii (L.) Rich. (Ophrys loeselii L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 495 (1989). lissochilus R.Br. ex Lindl., Bot. Reg., 7: t. 573, sub 578 (1821), and Coll. Bot. (Lindley), t. 31 (1822). Type speCies: L. speciosus R.Br. ex Lindl. selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(1): 135 (1874). listera R.Br., Hortus Kew., ed. 2, 5: 201 (1813). leCToType: L. ovata (L.) R.Br. (Ophrys ovata L.) selected by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 499 (1989). listrostachys Rchb.f., Bot. Zeitung (Berlin), 10: 930 (1852). Type speCies: L. jenischiana Rchb.f. designated by H.G. Reichenbach. Type speCies: L. pertusa (Lindl.) Rchb.f. (Angraecum pertusum Lindl.) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(1): 136 (1874). ludisia A.Rich., Dict. Class. Hist. Nat., 7: 437 (1825). leCToType: L. discolor (Ker Gawler) A.Rich. (Goodyera discolor Ker Gawler) designated by Ormerod, Lindleyana, 17(4): 211 (2002). luisia Gaudichaud-Beaupré, Voy. Uranie, Bot., 426, t. 37 (1826)[1829]. Type speCies: L. tenuifolia Blume not validly selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(1): 168 (1874). lycaste Lindl., Edwards’s Bot. Reg., 29(Misc): 14 (1843). Type speCies: L. macrophylla (Poepp.) Lindl. (Maxillaria macrophylla Poepp.) selected by Acuña, Cat. Descr. Orquid. Cuba, 60: 165 (1938). leCToType: L. macrophylla (Poepp.) Lindl. designated LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. by Bullock, Kew Bull., 13: 254 (1958). leCToType: L. plana Lindl. designated by Oakeley, Lycaste, Ida and Anguloa, 22 (2008) and McVaugh, Fl. Novo-Galiciana, 16: 188 (1985). lyperanthus R.Br., Prodr. Rl. Nov. Holland., 325 (1810). Type speCies: L. suaveolens R.Br. selected by M.A. Clements, Austral. Orchid. Res., 1: 90 (1989). lyroglossa Schltr., Beih. Bot. Centralbl., 37(2): 448 (1920). leCToType: L. bradei Schltr. ex Mansf. designated by Burns-Balogh, Amer. J. Bot., 69(7): 1132 (1982). Type speCies: L. grisebachii (Cogn.) Schltr. (Spiranthes grisebachii Cogn.) selected by Angely, Fl. Analitica São Paulo, 6: 1277 (1973). Macdonaldia Gunn ex Lindl., Sketch Veg. Swan Riv., 50, t. 9 (1840). Type speCies: M. smithiana Lindl. selected by M.A. Clements, Austral. Orchid Res., 1: 137 (1989). leCToType: M. antennifera Lindl. designated by Szlachetko, Fragm. Florist. Geobot., 3(Suppl.): 112 (1995). Malaxis Sw., Prodr. (Swartz), 8: 119 (1788). Type speCies: M. rheedii Sw. invalidly selected by Ascherson, Fl. Prov. Brandenb., 1: 699 (1864). Type speCies: M. spicata Sw. selected by Britton & Brown, Ill. Fl. N.U.S., ed. 2, 1: 570 (1913). Malleola Schltr., Repert. Spec. Nov. Regni Veg. Beih., 1: 119 (1913). leCToType: M. sphingoides J.J.Sm. designated by Garay, Bot. Mus. Leal., 23(4): 184 (1972) and Averyanov, Bot. Zhurn. (Moscow & Leningrad), 76(6): 894 (1991). Type speCies: M. undulata J.J.Sm. & Schltr. selected by Christenson, Kew Bulletin, 41(4): 837 (1986). Maxillaria Ruiz & Pavón, Fl. Peruv. Prodr., 116, t. 25 (1794). Type speCies: M. longipetala Ruiz & Pavón invalidly selected by Acuña, Cat. Descr. Orquid. Cuba, 60: 171 (1938). leCToType: M. ramosa Ruiz & Pavón designated by Garay & H.R. Sweet, J. Arnold Arbor., 53(4): 524 (1972). Type speCies: M. platypetala Ruiz & Pavón selected alriCh & higgins — Orchid genera typiication Brieger & P.F. Hunt, Taxon, 18: 602 (1969). leCToType: M. platypetala Ruiz & Pavón designated by Garay, Harvard Pap. Bot., 2: 52 (1997). Megastylis (Schltr.) Schltr., Bot. Jahrb. Syst., 45: 379, 384 (1911). Type speCies: M. gigas (Rchb.f.) Schltr. (Caladenia gigas Rchb.f.) selected by N. Hallé, Fl. Nouvelle Caledonie & Depend., 8: 487 (1977). Menadenium Raf. ex Cogn., Fl. Bras. (Martius), 3(5): 581 (1902). Type speCies: M. kegelii (Rchb.f.) Cogn. (Zygopetalum kegelii Rchb.f.) selected by Pupulin, Gen. Orchid., 5: 544 (2009). Mesadenella Pabst & Garay, Arquin. Jard. Bot. Rio, 12: 205 (1952). Type speCies: M. esmeraldae (Linden & Rchb.f.) Pabst & Garay (Spiranthes esmeraldae Linden & Rchb.f.) selected by M.N. Correa, Darwiniana, 11: 68 (1955). leCToType: M. esmeraldae (Linden & Rchb.f.) Pabst & Garay designated by Burns-Balogh, Amer. J. Bot., 69: 1132 (1982). Mesadenus Schltr., Beih. Bot. Centralbl., 37(2): 367 (1920). Type speCies: M. galeottianus (A.Rich.) Schltr. (Spiranthes galeottiana A.Rich.) selected by Britton & Wilson, Sci. Surv. Porto Rico, 5(2): 186 (1924). Microchilus C. Presl, Rel. Haenk., 1: 94 (1827). leCToType: M. minor C. Presl designated by Ormerod, Gen. Orch., 3: 121 (2003). Microtatorchis Schltr., Nachtr. Fl. Deutsch. Schutzgeb. Südsee, 234 (1905). leCToType: M. perpusilla Schltr. designated by Bullock, Index Nom. Gen. (Pl.), 2: 1093 (1976) card #30/05211 (1958). Microtis R.Br., Prodr. Fl. Nov. Holland., 320 (1810). leCToType: M. rara R.Br. designated by Garay & H.R. Sweet, Orchids S. Ryukyu Islands, 42 (1974). Mischobulbum Schltr., Repert. Spec. Nov. Regni Veg. Beih., 1: 98 (1911). Type speCies: M. scapigerum (Hook.f.) Schltr. (Nephelaphyllum scapigerum Hook.f.) selected by Senghas, Orchideen (Schlechter), ed. 3, 1: 851 (1984). leCToType: M. scapigerum (Hook.f.) Schltr. designated 85 by Averyanov, Bot. Zhurn. (Moscow & Leningrad), 75(12): 1765 (1990). Monadenia Lindl., Gen. Sp. Orchid. Pl., 356 (1838). leCToType: M. brevicornis Lindl. designated by H.P. Linder, Bothalia, 13(3-4): 342 (1981). Monanthochilus R. Rice, Oasis (Dora Creek), 3(Suppl.): 2 (2004). leCToType: M. chrysanthus (Schltr.) R. Rice (Sarcochilus chrysanthus Schltr.) designated by R. Rice, Oasis (Dora Creek), 3(Suppl.): 2 (2004). Monixus Finet, Bull. Soc. Bot. France Mém., 54(9): 15 (1907). leCToType: M. striatus (Thouars) Finet (Angraecum striatum Thouars) designated by Garay, Kew Bull., 28: 496 (1973). Mycaranthes Blume, Bijdr. Fl. Ned. Ind., 7: 352, t. 57 (1825). Type speCies: M. lobata Blume selected by P.J. Cribb, Gen. Orch., 4: 564 (2005). Myrobroma Salisb., Parad. Lond., 2: t. 82 (1807). Type speCies: M. fragrans Salisb. nom. illeg. This species is now considered a synonym of Vanilla planifolia Jacks. ex Andrews. Type speCies: Vanilla planifolia Jacks. ex Andrews not validly selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(1): 395 (1874). leCToType: Vanilla planifolia Jacks. ex Andrews designated by Garay & H.R. Sweet, Fl. Lesser Antilles, 44 (1974). Mystacidium Lindl., Compan. Bot. Mag., 2(19): 205 (1837). Type speCies: Limodorum longicornu Sw. This name is now accepted as a synonym of Mystacidium capense (L.f.) Schltr. (Epidendrum capense L.f.) invalidly selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(1): 401 (1874). nematoceras Hook.f., Fl. Nov.-Zel., 1(4): 249, t. 57 (1853). Type speCies: N. oblonga Hook.f. invalidly selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(1): 426 (1874). Type speCies: N. macranthum Hook.f. selected by D.L. Jones & M.A. Clements, Orchadian, 13(10): 449 (2002). LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 86 LANKESTERIANA neokoehleria Schltr. Repert. Spec. Nov. Regni Veg., 10: 390 (1912). Type speCies: N. equitans Schltr. selected by M.W. Chase, Gen. Orchid., 5: 248 (2009). neotinea Rchb.f., De Pollin. Orchid., 9, 18 & 29 (1852). Type speCies: Aceras intactum (Link) Rchb.f. (Orchis intacta Link) invalidly selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(1): 428 (1874). neottia Guettard (nom. cons.), Hist. Acad. Roy. Sci. Mém. Math. Phys. (Paris), 4: 374 (1754). leCToType: N. nidus-avis (L.) Rich. (Ophrys nidusavis L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 504 (1989) and Greuter et al., Regnum Vegetabile 118: 184 (1988). neottianthe Rchb., Icon. Bot. Pl. Crit., 6: 26 (1828). leCToType: N. cucullata (L.) Schltr. (Orchis cucullata L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 506 (1989). nephelaphyllum Blume, Bijdr. Fl. Ned. Ind., 8: 372, t. 22 (1825). leCToType: N. pulchrum Blume designated by Averyanov, Bot. Zhurn.(Moscow & Leningrad), 75(12): 1765 (1990). nigritella Rich., De Orchid. Eur., 19, 26, 34 (1817). leCToType: N. nigra (L.) Rchb.f. (Satyrium nigrum L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 507 (1989). notylia Lindl., Bot. Reg., 11: sub 930 (1825). leCToType: N. punctata (Ker-Gawler) Lindl. (Pleurothallis punctata Ker-Gawler) designated by Butzin, Taxon, 32(4): 631 (1983). Odontochilus Blume, Coll. Orchid., 79 (1859). leCToType: O. lavescens (Blume) Blume (Anoetochilus lavescens Blume) designated by Averyanov, Turcazaninowia, 11(1): 136 (2008). Oeceoclades Lindl., Edwards’s Bot. Reg., 18: sub 1522 (1832). Type speCies: O. maculata (Lindl.) Lindl. selected by Lindley, J. Proc. Linn. Soc., Bot., 3: 36 (1859). leCToType: O. maculata (Lindl.) Lindl. (Angraecum maculatum Lindl.) designated by Garay & P. Taylor, LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. Bot. Mus. Leal., 24(9): 253 (1976). Oeoniella Schltr., Beih. Bot. Centralbl., 33(2): 439 (1915). Type speCies: O. polystachys (Thouars) Schltr. (Epidendrum polystachys Thouars) selected by Senghas, Orchidee (Hamburg), 14: 215 (1963). Oncidium Sw., Vet. Akad. Handl. Stockholm, 21: 239 (1800). Type speCies: O. altissimum (Jacq.) Sw. (Epidendrum alissimum Jacq.) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(1): 497 (1874) and M.W. Chase, Gen. Orch., 5: 308 (2009). leCToType: O. variegatum Sw. designated by Garay, Bradea, 1(40): 398 (1974). Type speCies: O. carthagenense (Jacq.) Sw. (Epidendrum carthagenense Jacq.) invalidly selected by Britton & Wilson, Bahama Fl., 97 (1920). Ophrys L., Sp. Pl. (Linnaeus), ed. 1, 2: 945 (1753). leCToType: O. insectifera L. designated by M.L. Green, Prop. Brit. Bot., 185 (1929) and H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 512 (1989). Orchis L., Sp. Pl. (Linnaeus), ed. 1, 2: 939 (1753). Type speCies: O. militaris L. selected by Britton & Brown, Ill. Fl. N.U.S., ed. 2, 1: 551 (1913). leCToType: O. militaris L. designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 521 (1989). Oreorchis Lindl., J. Proc. Linn. Soc., Bot., 3: 26 (1858). leCToType: O. patens (Lindl.) Lindl. (Corallorhiza patens Lindl.) designated by Pearce & P.J. Cribb, Edinb. J. Bot., 54: 292 (1997). Orthoceras R.Br., Prodr. Fl. Nov. Holland., 316 (1810). Type speCies: O. strictum R.Br. selected by M.A. Clements, Austral. Orchid. Res., 1: 100 (1989). Orthopenthea Rolfe, Fl. Cap. (Harvey), 5(3): 179 (1912). Type speCies: O. bivalvata (L.f.) Rolfe (Ophrys bivalvata L.f.) selected by E.P. Phillips, Gen. S. Afr. Fl. Pl., ed. 2, 235 (1951). Otochilus Lindl., Gen. Sp. Orchid. Pl., 53 (1830). leCToType: O. porrectus Lindl. designated by Butzin, alriCh & higgins — Orchid genera typiication 87 Taxon, 32(4): 631 (1983). leCToType: O. fuscus Lindl. designated by Averyanov, Bot. Zhurn. (Moscow & Leningrad), 75(12): 1767 (1990). pelatantheria Ridl., J. Linn. Soc., Bot., 32: 371 (1896). leCToType: P. ctenoglossum Ridl. designated by Butzin, Taxon, 32(4): 632 (1983) and Averyanov, Bot. Zhurn. (Moscow & Leningrad), 76(6): 893 (1991). Otostylis Lindl., Gen. Sp. Orchid. Pl., 53 (1830). Type speCies: O. brachystalix (Rchb.f.) Schltr. (Zygopetalum brachystalix Rchb.f.) selected by Pupulin, Gen. Orch., 5: 515 (2009). pelexia Poiteau ex Lindl., Bot. Reg., 12: sub 985 (1826). Type speCies: P. spiranthoides Lindl. This name is now considered a synonym of P. adnata (Sw.) Poiter ex Rich. (Satyrium adnatum Sw.) which was lectotyped by Garay, Fl. Less. Antill., Orchid., 68 (1974). Oxystophyllum Blume, Bijdr. Fl. Ned. Ind., 7: 335, t. 38 (1825). Type speCies: O. rigidum Blume selected by Breiger, Orchideen (Schlechter), ed. 3, 11/12: 676 (1981). pachygenium Szlach., Tamayo & Rutk., Polish Bot. J., 46(1): 3 (2001). leCToType: P. albicans Cogn. designated by BurnsBalogh, Amer. J. Bot., 69: 1131 (1982). leCToType: P. oestriferum (Rchb.f. & Warm.) Szlach., Tamayo & Rutk. (Spiranthes oestriferum Rchb.f. & Warm.) designated by Szlachetko, Tamayo & Rutkowski, Polish Bot. J., 46(1): 3 (2001). pachyplectron Schltr., Bot. Jahrb. Syst., 39: 51 (1906). Type speCies: P. arifolium Schltr. selected by N. Hallé, Fl. Nouvelle Caledonie & Depend., 8: 506 (1977) and P.J. Cribb, Gen. Orch., 3: 131 (1999). pachystelis Rauschert, Feddes Repert., 94: 456 (1983). leCToType: P. jimenezii (Schltr.) Rauschert (Scaphyglottis jimenezii Schltr.) designated by Rauschert, Feddes Repert., 94: 456 (1983). palmorchis Barb.Rodr., Gen. Sp. Orch. Nov., 1: 169 (1877). Type speCies: P. pubescens Barb.Rodr. selected by Schlechter, Repert. Spec. Nov. Regni Veg., 16: 442 (1920). pecteilis Raf., Fl. Tellur., 2: 37 (1837). Type speCies: P. susannae (L.) Raf. selected by Schlechter, Repert. Spec. Nov. Regni Veg., 4: 120 (1919). leCToType: P. susannae (L.) Raf. (Orchis susannae L.) designated by Butzin, Taxon, 32(4): 631 (1983), P.J. Cribb, Taxon, 48: 49 (1999). Type speCies: P. gigantea (Sm.) Raf. (Orchis gigantea Sm.) invalidly selected by S. Misra, Orchids Orissa, 139 (2004). pennilabium J.J.Sm., Bull. Jard. Bot. Buitenzorg, ser. 2, 13: 47 (1914). leCToType: P. angraecum (Ridl.) J.J.Sm. (Saccolabium angraecum Ridl.) designated by Garay, Bot. Mus. Leal., 23(4): 189 (1972) and Averyanov, Bot. Zhurn. (Moscow & Leningrad), 76(6): 892 (1991). penthea Lindl., Gen. Sp. Orchid. Pl., 360 (1838) and Intr. Nat. Syst. Bot., ed. 2, 446 (1836). Type speCies: P. patens (L.f.) Lindl. (Ophrys patens L.f.) selected by E.P. Phillips, Gen. S. Afr. Fl. Pl., ed. 2, 236 (1951). Type speCies: P. melaleuca (Thunberg) Lindl. (Serapias melaleuca Thunberg) invalidly selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(1): 627 (1874). pentisea (Lindl.) Szlach., Polish Bot. J., 46(1): 19 (2001). leCToType: P. gemmata (Lindl.) Szlach. (Calaenia gemmata Lindl.) designated by Szlachetko, Polish Bot. J., 46(1): 19 (2001). peristylus Blume, Bijdr. Fl. Ned. Ind., 8: 404 (1825). gemmata: P. grandis Blume designated by Greuter et al., Regnum Veg., 118: 183 (1988) and Seidenfaden, Dansk Bot. Arkiv, 31(3): 27 (1977). petalochilus R.S.Rogers, J. Bot., 62: 65 (1924). Type speCies: P. calyciformis R.S. Rogers selected by D.L. Jones & M.A. Clements, Orchadian, 13(9): 406 (2001). phloeophila Hoehne & Schltr., Arch. Bot. São Paulo, 1(3): 199 (1926). leCToType: P. paulensis Hoehne & Schltr. designated by Garay, Orquideologia, 9: 117 (1974). pholidota Lindl. ex Hook., Exot. Fl., 2: t. 138 (1825). LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 88 LANKESTERIANA Type speCies: P. imbricata Hook. selected by M.A. Clements, Austral. Orchid. Res., 1: 105 (1989). This selection was not needed as Hooker originally had just one species.) phragmipedium (Pitzer) Rolfe, Orchid Rev., 4: 331 (1896). Type speCies: P. caudatum (Lindl.) Rolfe (Cypripedium caudatum Lindl.) selected by Sprague & Summerhayes, Kew Bulletin, 309 (1927). phymatidium Lindl., Gen. Sp. Orchid. Pl., 209 (1833). leCToType: P. delicatum Lindl. designated by Angely, Fl. Analitica São Paulo, 6: 1328 (1973) and Toscano, Lindleyana, 16(3): 209 (2001). physoceras Schltr., Repert. Spec. Nov. Regni Veg. Beih., 33: 78 (1924). leCToType: P. bellum Schltr. designated by Summerhayes, Index Nom. Gen. (Pl.), 3: 1335 (1979) card #64/24066 and J. & C. Hermans et al., Orchids Madagascar, 249 (2007). physosiphon Lindl., Edwards’s Bot. Reg., 21: sub 1797 (1835). Type speCies: P. loddigesii Lindl., nom. illeg. Type speCies: P. tubatus (Loddiges) Rchb.f. (Stelis tubata Loddiges) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(1): 705 (1873). leCToType: Pseudostelis spiralis (Lindl.) Schltr. (Physosiphon spiralis Lindl.) designated by Garay, Orquideologia, 9: 118 (1974). physurus Rich. ex Lindl., Gen. Sp. Orchid. Pl., 501 (1840). Type speCies: P. plantagineus (L.) Lindl. (Satyrium plantagineum L.) selected by Britton & Millspaugh, Bahama Fl., 87 (1920). pilophyllum Schltr., Orchideen (Schlechter), ed. 1, 131 (1914). leCToType: P. villosum (Blume) Schltr. (Chrysoglossum villosum Blume) designated by van der Burgh & de Vogel, Orchid Monog., 8: 172 (1997). pilumna Lindl., Edwards’s Bot. Reg., 30(Misc.): 73 (1844). Type speCies: P. laxa Lindl. selected by M.W. Chase, Gen. Orch., 5: 380 (2009). piperia Rydb., Bull. Torrey Bot. Club, 28: 269, 632 (1901). LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. Type speCies: P. elegans (Lindl.) Rydb. (Platanthera elegans Lindl.) selected by Britton & Brown, Ill. Fl. N. U.S., ed. 2, 1: 555 (1913). pityphyllum Schltr., Repert. Spec. Nov. Regni Veg. Beih., 7: 162 (1920). leCToType: P. antioquiense Schltr. designated by H.R. Sweet, Orquideologia, 7: 205 (1973). platanthera Rich., De Orchid. Eur., 20, 26, 35 (1817). leCToType: P. bifolia (L.) Rich. (Orchis bifolia L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3):539 (1989). platyclinis Benth., J. Linn. Soc., Bot., 18: 295 (1881). leCToType: P. abbreviata (Blume) Benth. ex Hemsl. (Dendrochilum abbreviatum Blume) designated by H.A. Pedersen, J.J. Wood & J.B. Comber, Opera Bot., 130: 29 (1997). pleione D. Don, Prodr. Fl. Nepal., 36 (1825). leCToType: P. praecox (J.E. Sm.) D. Don (Epidendrum praecox J.E. Sm.) designated by Zhu and S. Chen, Novon, 8: 461 (1998). pleuranthium Benth., J. Linn. Soc., Bot., 18: 312 (1881). Type speCies: P. dendrobii (Rchb.f.) Benth. (Epidendrum dendrobii Rchb.f.) selected by Pitzer, Nat. Planzenfam., 2(6): 145 (1889). pogonia Juss., Gen. Pl. (Jussieu), 65 (1789). Type speCies: P. ophioglossoides (L.) Ker-Gawler (Arethusa ophioglossoides L.) selected by Britton & Brown, Ill. Fl. N. U.S., ed. 2, 1: 559 (1913). polycyncis Rchb.f., Bonplandia, 3(15-16): 218 (1855). Type speCies: P. muscifera (Lindl. & Paxton) Rchb.f. (Cycnoches musciferum Lindl. & Paxton) selected by G. Gerlach, Gen. Orchid., 5: 434 (2009). ponera Lindl., Gen. Sp. Orchid. Pl., 113 (1831). Type speCies: P. juncifolia Lindl. designated by Lindley. Type speCies: P. graminifolia (Knowles & Westc.) Lindl. (Nemaconia graminifolia Knowles & Westc.) invalidly selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(2): 812 (1874). prasophyllum R.Br., Prodr. Fl. Nov. Holland., 317 (1810). Type speCies: P. australe R.Br. selected by M.A. alriCh & higgins — Orchid genera typiication Clements, Austral. Orchid. Res., 1: 109 (1989). pristiglottis Cretz. & J.J.Sm., Acta Fauna Fl. Universali, ser. 2, 1: 4 (1934). Type speCies: P. unilora (Blume) Cretz. & J.J.Sm. (Cystopus unilorus Blume) selected by Weatherby, Bull. Misc. Inform., 1935: 421 (1935). promenaea Lindl., Edwards’s Bot. Reg., 29(Misc): 13 (1843). leCToType: P. lentiginosa (Lindl.) Lindl. (Maxillaria lentiginosa Lindl.) designated by Butzin, Taxon, 32(4): 632 (1983). pseuderiopsis Rchb.f., Linnaea, 22: 852 (1850). leCToType: P. schomburgkii Rchb.f. designated by Romero, Harvard Pap. Bot., 10(2): 245 (2005). pseudoeurystyles Hoehne, Arq. Bot. Ext. S. Paulo, 1: 129 (1943). leCToType: P. lorenzii (Cogn.) Hoehne (Stenoptera lorenzii Cogn.) designated by Angely, Fl. Analitica São Paulo, 6: 1273 (1973). pseudogoodyera Schltr., Beih. Bot. Centralbl., 37(2): 369 (1920). leCToType: P. wrightii (Rchb.f.) Schltr. (Goodyera wrightii Rchb.f.) designated by Swart, Index Nom. Gen. (Pl.), 3 : 1434 (1979) card #10/23843; Rutkowski et al., Phylogeny & Taxonomy Subtribes Spiranthinæ, 144 (2008); and Burns-Balogh, Amer. J. Bot., 69(7): 1131 (1982). pseudorchis Ség., Pl. Veron., 3: 254 (1754). leCToType: P. albidus (L.) Á. Löve & D. Löve (Satyrium albidum L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 544 (1989). pseudostelis Schltr., Anexos Mem. Inst. Butantan, 1: 36 (1922). Type speCies: P. spiralis (Lindl.) Schltr. (Physosiphon spiralis Lindl.) selected by Garay, Orquideologia, 9: 118 (1974). leCToType: Stelis deregularis Barb.Rodr., designated superlously Luer, Monogr. Syst. Bot. Missouri Bot. Gard., 20: 36 (1986). pteroglossa Schltr., Beih. Bot. Centralbl., 37(2): 450 (1920). leCToType: P. macrantha (Rchb.f.) Schltr. (Spiranthes 89 macrantha Rchb.f.) designated by Angely, Fl. Analitica São Paulo, 6: 1277 (1973), Rutkowski et al., Phylogeny & Taxonomy Subtribes Spiranthinæ, 168 (2008) and Burns-Balogh, Amer. J. Bot., 69: 1132 (1982). pterostylis R.Br., Prodr. Fl. Nov. Holland., 326 (1810). Type speCies: P. obtusa R.Br. selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(2): 875 (1874). leCToType: P. curta R.Br. designated by Greuter et al., Regnum Veg., 118: 183 (1988). pterygodium Sw., Kongl. Vetensk. Acad. Nya Handl., ser. 2, 21: 217, t. 3e (1800). Type speCies: P. alatum (Thunberg) Sw. (Ophrys alata Thunberg) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(2): 876 (1874). Type speCies: P. catholicum (Thunberg) Sw. (Ophrys alata Thunberg) selected by E.P. Phillips, Gen. S. Afr. Fl. Pl., ed. 2, 237 (1951). leCToType: P. catholicum (Thunberg) Sw. designated by K.E. Steiner, Taxon, 48: 48 (1999). rhipidoglossum Schltr., Beih. Bot. Centralbl., 36(2): 80 (1918). leCToType: R. xanthopollinium (Rchb.f.) Schltr. (Aeranthus xanthopollinius Rchb.f.) designated by Summerhayes, Blumea, Suppl., 1: 80 (1937). rhynchopera Klotzsch, Icon. Pl. Rar. (Link), 2: 103, t. 41 (1844). Type speCies: R. pedunculata Klotzsch designated by Klotzsch. Type speCies: R. punctata H. Karsten not validly selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(2): 962 (1874). rhynchophreatia Schltr., Bot. Jahrb. Syst., 56: 488 (1921) leCToType: Rhynchophreatia wariana Schltr. designated by Fosberg & Sachet, Micronesica, 20: 151 (1987). rhynchostylis Blume, Bijdr. Fl. Ned. Ind., 7: 285, t. 49 (1825) leCToType: R. retusa (L.) Blume (Epidendrum retusum L.) designated by Christenson, Kew Bulletin, 41(4): 836 (1986). robiquetia Gaudichaud-Beaupré, Freycinet’s Voy. Uranie, Bot., 426, t. 34 (1826)[1829] LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 90 LANKESTERIANA leCToType: R. brevifolia (Lindl.) Garay (Saccolabium brevifolium Lindl.) designated by Christenson, Kew Bulletin, 41(4): 835 (1986). rodriguezia Ruiz & Pavón, Fl. Peruv. Prodr., 115, t. 25 (1794). leCToType: R. lanceolata Ruiz & Pavón designated by Garay & H.R. Sweet, J. Arnold Arbor., 53: 527 (1972). rodrigueziopsis Schltr., Repert. Spec. Nov. Regni Veg., 16: 427. (1920). leCToType: R. eleutherosepala (Barb.Rodr.) Schltr. (Rodriguezia eleutherosepala Barb.Rodr.) designated by Angely, Fl. Analitica São Paulo, 6: 1322 (1973) and Garay & H.R. Sweet, J. Arnold Arbor., 53: 527 (1972). Type speCies: Rodrigueziopsis microphyton (Barb. Rodr.) Schltr. (Rodriguezia microphyta Barb.Rodr.) selected by M.W. Chase, Gen. Orchid., 5: 271 (2009). roeperocharis Rchb.f., Otia Bot. Hamburg., 104 (1881). leCToType: R. bennettiana Rchb.f. designated by P.J. Cribb, Gen. Orch., 2: 359 (2001). roezliella Schltr., Repert. Spec. Nov. Regni Veg., 15: 146 (1918) Type speCies: R. dilatata (Rchb.f.) Schltr. (Sigmatostalix dilatata Rchb.f.) selected by M.W. Chase, Gen. Orchid., 5: 308 (2009). saccolabium Blume, Bijdr., 292, t. 50 (1825). leCToType: S. pusillum Blume designated Christenson, Kew Bull., 41(4): 835 (1986). by sanderella Kuntze, Revis. Gen. Pl., 2: 649 (1891). Type speCies: S. discolor (Barb.Rodr.) Cogn. (Parlatorea discolor Barb.Rodr.) selected by Cogniaux, Fl. Bras., 3(6): 239 (1905). sarcopodium Lindl. & Paxton, Paxton’s Fl. Gard., 1: 155 (1850). Type speCies: S. lobbii (Lindl.) Lindl. & Paxton (Bulbophyllum lobbii Lindl.) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(2): 1051 (1874). Type speCies: S. amplum (Lindl.) Lindl. (Dendrobium amplum Lindl.) invalidly selected by Kraenzlin, Planzenr. IV. 50. II(B) 21 (Heft 45): 319 (1910). satyrium L., Sp. Pl. (Linnaeus), ed. 1, 2: 944 (1753). leCToType: S. viride L. designated by M.L. Green, Prop. Brit. Bot., 185 (1929). LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. sauroglossum Lindl., Edwards’s Bot. Reg., 19: t. 1618 (1833). leCToType: S. elatum Lindl. designated by Rutkowski et al., Phylogeny & Taxonomy Subtribes Spiranthinæ, 144 (2008). scaphosepalum Pitzer, Nat. Planzenfam., 2(6): 139 (1888). leCToType: S. ochthodes (Rchb.f.) Pitzer (Masdevallia ochthodes Rchb.f.) designated by Garay, Orquideologia, 9: 124 (1974). scaphyglottis Poepp. & Endl., Nov. Gen. Sp. Pl., 1: 58 (1836). Type speCies: S. parvilora Poepp. & Endl. invalidly selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(2): 1068 (1874). The accepted name for S. parvilora is Camaridium vestitum (Sw.) Lindl. leCToType: S. graminifolia (Ruiz & Pavón) Poepp. & Endl. (Fernandezia graminifolia Ruiz & Pavón) designated by Dressler, Taxon, 9: 214 (1960) and Garay & H.R. Sweet, J. Arnold. Arbor., 53: 528 (1972). schiedeella Schltr., Beih. Bot. Centralbl., 37(2): 379 (1920). leCToType: S. saltensis (Ames) Schltr. (Spiranthes saltensis Ames) designated by Burns-Balogh, Amer. J. Bot., 69(7): 1131 (1982). Type speCies: S. transversalis (A.Rich. & Galeotti) Schltr. (Spiranthes transversalis A.Rich. & Galeotti) selected by Garay, Bot. Mus. Leal., 28(4): 357 (1982). leCToType: S. llaveana (Lindl.) Schltr. (Spiranthes llaveana Lindl.) designated by Rutkowski et al., Phylogeny & Taxonomy Subtribes Spiranthinæ, 173 (2008). schoenorchis Blume, Bijdr. Fl. Ned. Ind., 8: 361 (1825). Type speCies: S. juncifolia Blume selected by Garay, Bot. Mus. Leal., 23(4): 202 (1972). leCToType: Schoenorchis gemmata (Lindl.) J.J.Sm. (Saccolabium gemmatum Lindl.) designated by Christenson, Kew Bulletin, 41(4): 836 (1986). leCToType: S. juncifolia Blume designated by Averyanov, Bot. Zhurn. (Moscow & Leningrad), 76(6): 894 (1991). selenipedium Rchb.f., Xenia Orch., 1: 3, t. 2 (1854). Type speCies: S. chica Rchb.f. selected by Sprague & alriCh & higgins — Orchid genera typiication Summerhayes, Bull. Misc. Inform., 308 (1927). sepalosaccus Schltr., Repert. Spec. Nov. Regni Veg. Beih., 19: 245 (1923). leCToType: S. humilis Schltr. designated by K. Barringer, Fieldiana, Bot., 17: 18 (1986). serapias L., Sp. Pl. (Linnaeus), ed. 1, 2: 949 (1753). Type speCies: S. lingua L. selected by Sw., Kongl. Vetensk. Acad. Nya Handl., 21: 224 (1800). leCToType: S. lingua L. designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 558 (1989). smithsonia C.J.Saldanha, J. Bombay Nat. Hist. Soc., 71(1): 73 (1974). leCToType: S. viridilora (Dalzell) C.J. Saldanha (Micropera viridilora Dalzell) designated by Christenson, Kew Bulletin, 41(4): 836 (1986). Sobennikofia Schltr., Repert. Spec. Nov. Regni Veg. Beih., 33: 361 (1925). leCToType: S. robusta (Schltr.) Schltr. (Oeonia robusta Schltr.) designated by Butzin, Taxon, 32(4): 632 (1983). sobralia Ruiz & Pavón, Fl. Peruv. Prodr. 120, t. 26 (1794). leCToType: S. dichotoma Ruiz & Pavón designated by Angely, Fl. Analítica São Paulo, 6: 1268 (1973). specklinia Lindl., Gen. Sp. Orchid. Pl., 8 (1830). leCToType: S. lanceola (Sw.) Lindl. (Epidendrum lanceola Sw.) designated by Garay & H.R. Sweet, J. Arnold Arbor., 53: 528 (1972). spiranthes Rich., De Orchid. Eur., 20, 28 & 36 (1817). leCToType: S. spiralis (L.) Chevallier (Ophrys spiralis L.) designated by M.L. Green, Prop. Brit. Bot., 100 (1929) and H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 562 (1989). Type speCies: S. aestivalis (Poiret) Rich. (Ophrys aestivalis Poiret) invalidly selected by Correll, Fl. Texas, 3(3): 169 (1944). stauropsis Rchb.f., Hamburger GartenBlumenzeitung, 16: 117 (1860). Type speCies: S. philippinensis (Lindl.) Rchb.f. (Trichoglottis philippinensis Lindl.) selected by Reichenbach f., Ann. Bot. Syst., 6: 882, 932 (1864). stelis Sw., J. Bot. (Schrader), 2: 239 (1799). 91 leCToType: S. ophioglossoides (Jacq.) Sw. (Epidendrum ophioglossoides Jacq.) designated by M.L. Green, Prop. Brit. Bot., 100 (1929) and Pridgeon, Gen. Orch., 4: 405 (2005). leCToType: S. purpurea (Ruiz & Pav.) Willd. (Humboldtia purpurea Ruiz & Pavón) designated by Garay & H.R. Sweet, J. Arnold Arbor., 53: 528 (1972). stenorrhynchos Rich. ex Spreng., Syst. Veg. (Sprengel), ed. 16, 3: 677 (1826). Type speCies: S. speciosum (Jacq.) Spreng. (Neottia speciosa Jacq.) selected by Britton & Millspaugh, Bahama Fl., 86 (1920). leCToType: S. speciosum (Jacq.) Spreng. designated by Burns-Balogh, Amer. J. Bot., 69(7): 1131 (1982). leCToType: S. orchioides (Sw.) Rich. (Satyrium orchioides Sw.) invalidly designated by M.N. Corrêa, Darwiniana, 11: 70 (1955). stichorkis Thouars, Nouv. Bull. Soc. Philom., 19: 318 (1809). leCToType: S. disticha (Thouars) Pitzer (Malaxis disticha Thouars) designated by Rasmussen, Bot. Not., 132: 390 (1979). sullivania F.Muell., J. Proc. Roy. Soc. New South Wales, 15: 229 (1882). Type speCies: Caleya sullivanii F.Muell. selected by D.L. Jones & M.A. Clements, Orchadian, 15(1): 36 (2005). synassa Lindl., Bot. Reg., 19: sub 1618 (1833). leCToType: S. corymbosa Lindl. designated by Rutkowski et al., Phylogeny & Taxonomy Subtribes Spiranthinæ, 145 (2008). synoplectris Raf., Fl. Tellur., 2: 87 (1837). leCToType: S. grandilora (Hook.) Klotzsch (Neottia grandilora Hook.) designated by Garay, Bot. Mus. Leal., 28: 352 (1982). systeloglossum Schltr., Repert. Spec. Nov. Regni Veg. Beih., 19: 252 (1923). leCToType: S. costaricense Schltr. designated by Barringer, Fieldiana, Bot., 17: 21 (1986). Taeniophyllum Blume, Bijdr. Fl. Ned. Ind., 8: 355, t. 70 (1825). leCToType: T. obtusum Blume designated by Garay, Bot. Mus. Leal., 23(4): 205 (1972) and Averyanov, LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 92 LANKESTERIANA Bot. Zhurn. (Moscow & Leningrad), 76(6): 892 (1991). Telipogon Kunth, Nov. Gen. Sp., 1: 335, t. 75 (1815). Type speCies: T. nervosus (L.) Druce (Tradescantia nervosa L.) selected by M.W. Chase, Gen. Orch., 5: 362 (2009). Tetragamestus Rchb.f., Bonplandia, 2: 21 (1854). Type speCies: Scaphyglottis arundinacea Regel invalidly selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(2): 1373 (1874). Type speCies: T. aureus Rchb.f. indirectly selected by Reichenbach f., Linnaea, 41: 85 (1876). Thelasis Blume, Bijdr. Fl. Ned. Ind., 8: 385, t. 75 (1825). Type speCies: T. carinata Blume selected by M.A. Clements, Austral. Orchid. Res., 1: 137 (1989). leCToType: T. obtusa Blume designated by Averyanov, Bot. Zhurn. (Moscow & Leningrad), 76(1): 124 (1991). Type speCies: T. obtusa Blume selected by J.J. Wood, Gen. Orch., 4: 593 (2005). Thelychiton Endl., Prodr. Fl. Norfolk., 32 (1833). Type speCies: T. macropus Endl. selected by M.A. Clements, Austral. Orchid Res., 1: 56 (1989). Tomotris Raf., Fl. Tellur., 2: 89 (1837). leCToType: T. lava (Sw.) Rchb.f. (Serapias lava Sw.) designated by Rasmussen, Bot. Tidssk., 71: 168 (1977). Trachelosiphon Schltr., Beih. Bot. Centralbl., 37(2): 423 (1920). leCToType: Eurystyles actinosophylla (Barb.Rodr.) Schltr. (Spiranthes actinosophila Barb.Rodr.) designated by Acuña, Cat. Descr. Orquid. Cuba., 60: 43 (1938). leCToType: T. ananassocomos Rchb.f. designated by Burns-Balogh, Amer. J. Bot., 69(7): 1131 (1982). Trachyrhizum (Schltr.) Brieger, Schlechter Orchideen (ed. 3), 1(11-12): 687 (1981). Type speCies: T. schlechteri (Schltr.) Rauschert (Dendrobium trachyrhizum Schltr.) selected by Rauschert, Feddes Repert., 94(7-8): 469 (1983). Type speCies: Dendrobium chalmersii F.Muell. invalidaly selected by M.A. Clements, Telopea., 10(1): 280 (2003). LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. Traunsteinera Rchb., Fl. Saxon., 87 (1842), and Deut. Bot. Herb.-Buch, 50 (1841). leCToType: T. globosa (L.) Rchb. (Orchis globosa L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 564 (1989). Trichoceros Kunth, Nov. Gen. Sp., 1: 337, t. 76 (1815). Type speCies: T. antennifer (Humb. & Bonpl.) Kunth (Epidendrum antenniferum Humb. & Bonpl.) selected by M.W. Chase, Gen. Orch., 5: 378 (2009). Trichoglottis Blume, Bijdr. Fl. Ned. Ind., 8: 359, t. 8 (1825). Type speCies: T. retusa Blume selected by Garay, Bot. Mus. Leal., 23(4): 208 (1972). leCToType: T. miserum (Ridl.) Holttum (Saccolabium miserum Ridl.) designated by Christenson, Kew Bulletin, 41(4): 836 (1986). Trichotosia Blume, Bijdr. Fl. Ned. Ind., 7: 342 (1825). leCToType: T. paucilora Blume designated by Averyanov, Bot. Zhurn. (Moscow & Leningrad), 76(1): 126 (1991). Type speCies: T. paucilora Blume selected by P.J. Cribb, Gen. Orch., 4: 583 (2005). Tridactyle Schltr., Orchideen (Schlechter), ed. 1, 602 (1914). leCToType: T. bicaudata (Lindl.) Schltr. (Angraecum bicaudatum Lindl.) designated by Summerhayes, Kew Bull., 282 (1948). Trigonanthe (Schltr.) Brieger, Schlechter’s Orchideen, ed. 3, 7: 448 (1975). Type speCies: Masdevallia simula Rchb.f. selected by Luer, Monogr. Syst. Bot. Missouri Bot. Gard. 15: 26 (1986). Triphora Nuttall, Gen. N. Amer., Pl., 192 (1818). Type speCies: T. pendula Nuttall, nom. illeg. (Arethusa pendula Willd., nom. illeg). This type name is now considered a synonym of T. trianthophora (Sw.) Rydb. (Arethusa trianthophoros Sw.) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(2): 1484 (1874). Triphorhiza Ehrhart, Beitr. Naturk. (Ehrhart), 4: 149 (1789). Type speCies: Satyrium albidum L. selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(2): 1486 (1874). alriCh & higgins — Orchid genera typiication Tylostigma Schltr., Beih. Bot. Centralbl., 4: 298 (1916). leCToType: T. madagascariensis Schltr. designated by P.J. Cribb, Gen. Orch., 2: 379 (2001). Uncifera Lindl., J. Proc. Linn. Soc., Bot., 3: 39 (1859) leCToType: U. obtusifolia Lindl. designated by Christenson, Kew Bulletin, 41(4): 837 (1986) and Averyanov, Bot. Zhurn. (Moscow & Leningrad), 76(6): 893 (1991). Vanilla Plum. ex Mil., Gard. Dict., abridged ed. 4, 3: without page number (1754). Type speCies: V. mexicana Mil. designated by Mansfeld, Kulturplanze, 2: 587 (1959); Angely, Fl. Analitica São Paulo, 6: 1267 (1973), and Averyanov, Bot. Zhurn. (Moscow & Leningrad), 75(12): 1760 (1990). Type speCies: V. mexicana Mil. selected by Britton & Wilson, Bahama Fl., 83 (1920). leCToType: V. planifolia Jacks. designated by Garay & H.R. Sweet, Fl. Lesser Antilles, 44 (1974). Vrydagzynea Blume, Coll. Orchid., 71, tt. 17 (1858). leCToType: V. albida (Blume) Blume (Hetaeria albida Blume) designated by Averyanov, Bot. Zhurn. (Moscow & Leningrad), 75(7): 1023 (1990). Warczewiczella Rchb.f., Bot. Zeitung (Berlin), 10: 635 (1852). Type speCies: W. discolor (Lindl.) Rchb.f. (Warrea discolor Lindl.) selected by Britton & Wilson, Sci. Surv. Porto Rico, 5(2): 214 (1924). Zeuxine Lindl., Coll. Bot. (Lindl.), App. [n. 18] (1826). Type speCies: Z. stratematica (L.) Schltr. (Orchis stratematica L.) designated by P.J. Cribb, Taxon, 48: 49 (1999). Zygosepalum Rchb.f., Ned. Kruidk. Arch., 4: 330 (1859). Type speCies: Z. kegelii (Rchb.f.) Rchb.f. (Zygopetalum kegelii Rchb.f.) selected by Pupulin, Gen. Orch., 5: 544 (2009). Zygostates Lindl., Edwards’s Bot. Reg., 23: 1927 (1837) leCToType: Z. lunata Lindl. designated by Angely, Fl. Analítica São Paulo, 6: 1328 (1973). leCToType: Z. cornuta Lindl. designated by Toscano, Lindleyana, 16(3): 193 (2001). 1 These lists are only current as of March 1 2010. 93 Commentary. When using various sources for basic lectotype research we have come across some listings that state the name as being lectotypiied, but upon further investigation of the original cited literature ind the statement to be untrue. All the taxonomic citations in this paper have been veriied with original literature. There are many names currently listed in Index Nominum Genericorum (ING) as being lectotypiied. Many of the names are correctly listed, but there are also many names that are not true lectotypes but just various authors listing a name as a type species for a given genus (selected). There are others listed as having lectotypes but upon reading the literature cited ind that the authors provided no types or lectotype names1. Genus names listed in ING that are just listings of type species for a genus and have NOT been lectotypiied: Aa, Amphigena, Ancistrorhynchus, Anochilus, Arethusa, Blephariglotis, Bletia, Brownleea, Centrostigma, Cephalanthera, Ceratandropsis, Chrysoglossum, Cladobium, Cleisostoma, Comparettia, Corysanthes, Crepidium, Cyrtopera, Cyrtosia, Cystorchis, Dryadorchis, Epiblastus, Evota, Gennaria, Gymnadeniopsis, Habenaria, Kefersteinia, Limnorchis, Malaxis, Oeceoclades, Orthopenthea, Palmorchis, Penthea, Physosiphon, Physurus, Piperia, Pleione, Pogonia, Pterygodium, Satyrium, Schoenorchis, Stauropsis, Stenorrhynchos, Trichoglottis, Triphora. These names are listed in ING as lectotypiied, which at the time they were not, but have since been lectotypiied by various authors in other literature: Ania, Barbosella, Coelogyne, Cypripedium, Cyrtochilum, Disperis, Goodyera, Ophrys, Orchis, Pecteilis, Schiedeella. These are names listed in ING as lectotypiied, but they are NOT: Capanemia, Diaphananthe. Chelonanthera, Dendrochilum, The names that Alrich previously published (Selbyana 29(2) 2008) as published by Pfeiffer, are just that a list of type names for various genera and are NOT true lectotypes. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. 94 LANKESTERIANA aCknoWleDgeMenTs. We thank Eileen Downing of the Lee County (Florida) Public Library System for assistance in obtaining copies of original literature. We also acknowledge Google Books, Botanicus Digital Library, Biodiversity Heritage Library, Kew Library, Gallica Bibliothèque and Real Jardín Botánico Digital Library as sources for the botanical literature researched and cited. liTeraTure CiTeD Farr, E. R. & G. Zijlstra (eds.). Index Nominum Genericorum (Plantarum). 1996+. Published on the Internet; http:// botany.si.edu/ing/ (accessed 1 March 2010). Govaerts, R., J. Pfahl (Florida, 2006), M.A. Campacci (Brazil, 2005), D. Holland Baptista (Brazil, 2005), H. Tigges (Germany, 2005), J.Shaw (RHS, 2005), P. LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011. Cribb (K, 2003), A. George (K, 2003), K. Kreuz (2004, Europe), J. Wood (K, 2003, Europe). 2010. World Checklist of Orchidaceae. The Board of Trustees of the Royal Botanic Gardens, Kew. Published on the Internet; http://www.kew.org/wcsp/ (accessed 1 March 2010). McNeill, J., F. R. Barrie, H. M. Burdet, V. Demoulin, D. L. Hawksworth, K. Marhold, D. H. Nicolson, J. Prado, P. C. Silva, J. E. Skog, J. H. Wiersema & N. J. Turland. 2006. International Code of Botanical Nomenclature (Vienna Code). Regnum Vegetabile 146. A.R.G. Gantner Verlag KG. The International Plant Names Index., 2008. Published on the Internet; http://www.ipni.org (accessed 1 March 2010). Tropicos, botanical information system at the Missouri Botanical Garden. Published on the Internet; http:// www.tropicos.org (accessed 1 March 2010).

RELATED PAPERS

RELATED TOPICS

Log In

Conservation of Madagascar's granite outcrop orchids: the influence of fire and moisture

Conservation of Madagascar's granite outcrop orchids: the influence of fire and moisture

Related Papers

RELATED PAPERS

RELATED TOPICS