ISSN 1409-3871
VOL. 11, No. 1
APRIL 2011
New species of Aa and new combinations in Myrosmodes (Orchidaceae:
Cranichidinae) from Bolivia and Peru
Delsy Trujillo and Carlos a. Vargas
1
Two new species of Teagueia (Orchidaceae: Pleurothallidinae)
from East-Central Ecuador
lou josT and anDerson sheparD
9
The root colonizing fungi of the terrestrial orchid Cypripedium irapeanum
María ValDés, héCTor BauTisTa guerrero, laura MarTínez
and rafael h. Víquez
15
Population structure of Oncidium poikilostalix (Orchidaceae),
in coffee plantations in Soconusco, Chiapas, México
alfreDo garCía-gonzález, anne DaMon, ligia g. esparza olguín
and jaVier Valle-Mora
21
Aa from lomas formations. A new Orchidaceae record
from the desert coast of Peru
Delsy Trujillo and aMalia DelgaDo roDríguez
33
Anatomía foliar de ocho especies de orquídeas epíitas
rafael aréValo, juana figueroa & sanTiago MaDriñán
39
Conservation of Madagascar’s granite outcrop orchids:
the inluence of ire and moisture
Melissa WhiTMan, MiChael MeDler, jean jaCques ranDriaManinDry
& elisaBeTh raBakonanDrianina
55
Orchid genera lectotypess
peggy alriCh & Wesley higgins
69
I N T E R N AT I O N A L J O U R N A L O N O R C H I D O L O G Y
lankesteriana
InternatIonal Journal on orchIdology
Copyright © 2011 Lankester Botanical Garden, University of Costa Rica
Effective publication date: April 28, 2011
Layout: Jardín Botánico Lankester.
Cover: Aa aurantiaca D. Trujillo. Photograph by D. Trujillo.
Printer: Palabra de Dios S.A.
Printed copies: 500
Printed in Costa Rica / Impreso en Costa Rica
R
Lankesteriana / International Journal on Orchidology
No. 1 (2001)-- . -- San José, Costa Rica: Editorial
Universidad de Costa Rica, 2001-v.
ISSN-1409-3871
1. Botánica - Publicaciones periódicas, 2. Publicaciones
periódicas costarricenses
LANKESTERIANA 11(1): 1—8. 2011.
NEw SPECiES Of AA ANd NEw COMBiNATiONS iN MyrOsMOdes
(OrChidACEAE: CrANiChidiNAE) frOM BOliviA ANd PEru
Delsy Trujillo1,3 & Carlos a. Vargas2
1
Museo de Historia Natural, Universidad Ricardo Palma, Av. Benavides 5440, Lima 33, Perú
2
AECOM, Montréal, Canada
3
Corresponding author: delsytrujillo@gmail.com
aBsTraCT. A new species of Aa from northern Peru is described: Aa aurantiaca, which has highly atypical
orange lowers for the genus. Furthermore, two new combinations of Myrosmodes are proposed: M.
inaequalis and M. gymnandra, with illustrations and diagnostic features of the new species.
resuMen. Se describe una nueva especie de Aa del norte del Perú: Aa aurantiaca; la cual tiene las lores de
color naranja, siendo éste un color inusual para el género. Se proponen además dos nuevas combinaciones
de Myrosmodes: M. inaequalis y M. gymnandra; se presentan ilustraciones y se discuten rasgos diagnósticos
de las nuevas especies.
key WorDs. : Orchidaceae, Cranichideae, Peru, Bolivia, Aa, Myrosmodes
The genera Aa Rchb.f. and Myrosmodes Rchb.f.
consist of terrestrial orchids possessing tiny, white
to greenish-white, non-resupinate lowers. Although
there are some records of Aa paleacea (Kunth) Rchb.f.
in the mountains of Costa Rica (Dressler 1993), the
species of Aa and Myrosmodes are mostly restricted
to the South American Andean mountain range at high
elevations.
The taxonomic status of the representatives of
these genera has remained unclear for many years.
The genera Aa and Myrosmodes were irst described
by Reichenbach ilius in 1854. He distinguished Aa
from Altensteinia Kunth and transferred Altensteinia
paleacea (Kunth) Kunth to Aa [Aa paleacea (Kunth)
Rchb.f.]. However, in a subsequent work Reichenbach
(1878) reassessed his criteria and placed both Aa
and Myrosmodes as synonyms of Altensteinia, and
described nine new species, among them Altensteinia
gymnandra Rchb.f. and Altensteinia inaequalis
Rchb.f.. Later, Schlechter (1912, 1920a, 1920b)
distinguished Aa from Altensteinia again but considered Myrosmodes as a synonym of Aa and combined
it with that genus (e.g., Aa gymnandra (Rchb.f.)
Schltr., Aa inaequalis (Rchb.f.) Schltr.). Subsequent
taxonomists, for instance Schweinfurth (1958),
recognized only Altensteinia as a valid genus and
considered the other two genera as synonyms.
Garay (1978), as part of his work in Flora of
Ecuador, revalidated the genera Aa and Myrosmodes
and transferred some species of Aa and Altensteinia to
Myrosmodes. Since then, the three genera have been
widely accepted as distinct taxa. Further revision of
Myrosmodes in Peru and Colombia led to the transfer
of more species to this genus (Vargas 1995, Ortiz
1995, respectively). Up to the point of this publication,
Myrosmodes comprised about 10 species.
Morphologically, Altensteinia is distinguished from
Aa and Myrosmodes by having a terminal inlorescence,
pubescent column, lobulate clinandrium, small stigma
and anthesis occurring after the full development of
leaves (Garay 1978). Conversely, Aa and Myrosmodes
possess a lateral inlorescence and glabrous column,
and anthesis occurs before the full development of
leaves. Aa has an elongate peduncle enveloped by
tubular hyaline-diaphanous sheaths, with dorsal sepal
and petals free from the column, lip calceolate with
involute and lacerate margins, and in many species, a
pilose ovary. Myrosmodes has at least 6 morphological
and ecological characters that distinguish this genus
from Aa and Altensteinia and the rest of Prescottiinae:
(1) a short peduncle with infundibuliform, scarious
sheaths, (2) a cucullate lip that is tubular or lared, with
imbriolate margins with moniliforms hairs (Garay
1978, Vargas 1997), (3) an accrescent peduncle (after
2
LANKESTERIANA
figure 1. Aa aurantiaca D. Trujillo. A — Habit, plant without spike (left) and inlorescence (right). B — Flower, ventral
and dorsal view. C — Lip, lateral view. D — Lip, ventral view. E — Lip, split. F — Dissected perianth. G — Floral
bract. H — Column, lateral, dorsal and ventral view. Drawing by D. Trujillo based on Trujillo 212.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
Trujillo & Vargas — New Species and Combinations in Aa and Myrosmodes
3
anthesis, the inlorescence peduncle elongates twice
or more its original size, evident even in herbarium
specimens), (4) basipetal loral development (with
lowers growing from the inlorescence apex to its base),
(5) andromonoecious inlorescence (with male lowers
distinctly smaller (up to 300%) than hermaphrodite
lower (Berry & Calvo 1991, Vargas 1997, and Trujillo
pers. obs.), and (6) growing between 3300 to almost
5000 m.a.s.l and mostly in wet puna/paramo highandean bogs from Venezuela to Argentina/Chile
(world’s record by Myrosmodes pumilio (Schltr.) C.
Vargas, observed in Peruvian Andes and in bogs from
Chile, Novoa, Vargas & Cisternas, in prep.).
Although a recent DNA study indicates that
Myrosmodes may be embedded within Aa and that
the recognition of the genus Myrosmodes is tenuous
(Álvarez-Molina & Cameron 2009), the morphological
and ecological evidence still supports its separation
from Aa.
Still, we are a long way from knowing all the species
that constitutes the genera Aa and Myrosmodes. A
careful examination of the loral features is necessary
for the proper identiication of the specimens, and
this is only possible by dissecting the lowers under
a stereomicroscope. For example, in most of the
original descriptions and illustrations of Myrosmodes
(as Aa or Altensteinia) the authors did not indicate or
show the features of the column, mainly the anther
(Reichenbach 1854, 1878, Schlechter 1912, 1920a,
1920b, Mansfeld 1929). The knowledge of these
features in the other Myrosmodes species is required
in order to have a clearer delimitation of the species
that compose this genus.
Based on revisions of the type material from
the Reichenbach Herbarium (W) as part of the
identiication of a new species of Aa from northern
Peru, it has become evident that the following new
combinations in Myrosmodes are necessary. They were
also mentioned by Vargas in his work in Cranichideae
and Prescottiinae (unpublished thesis 1997).
Aa aurantiaca D. Trujillo, sp. nov.
TYPE: Peru. Dept. La Libertad: Prov. Santiago de
Chuco, Quirovilca, Yanivilca, 3509 m, 22 May 2005,
D. Trujillo 212 (holotype, HURP; isotypes, HAO,
SEL, M) (fig. 1, 2).
figure 2. Inlorescence of Aa aurantiaca. Photograph by
D. Trujillo.
Differt ab simili Aa rosea Ames lore aurantiaco,
sepalis dorsaliter pilosis, petalis trinervatis ovatolanceolatis et foramine labelli angustiore.
Plant small, terrestrial. Roots leshy, fasciculate,
pubescent. Leaves withered at lowering time.
Inlorescence slender, erect, up 30 cm long, enclosed
by up to 23 diaphanous sheaths, terminated in a
densely many lowered cylindrical spike 2.2-5.0 cm
long, rachis of the spike sparsely pilose. Floral bracts
ovate, acute to obtuse, margins slightly erose, relexed,
4-5 x 4 mm, somewhat surpassing the lowers. Flowers
non-resupinate, orange to reddish orange. Dorsal
sepal oblong to ovate, obtuse, dorsally hairy, 1-nerved,
relexed, 2.0 x 1.3-1.5 mm. Lateral sepals shortly
connate at the base, obliquely oblong-lanceolate,
obtuse, dorsally hairy, somewhat carinate, 1-nerved,
3.0 x 1.5 mm. Petals obliquely ovate lanceolate,
obtuse, 3-nerved, relexed, up to 2.3 x 1.1 mm. Lip
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
4
LANKESTERIANA
figure 3. Single herbarium sheet at W-R bearing specimens of Myrosmodes gymnandra (Rchb.f.) C. Vargas composed
of a mixed collection. A — Specimen Wilkes s.n. B — Specimens without collector information. C — Specimen
Mandon s.n. (holotype).
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
Trujillo & Vargas — New Species and Combinations in Aa and Myrosmodes
calceolate (semiglobose), transversely elliptic, leshy
(except the margins), obscurely 3-lobed, with a narrow
opening, the involute margins lacerate, base with two
spherical calli, 2.0 x 2.5 mm (natural position). Column
short, with an emarginate transverse rostellum, dilated
above, 1.5 mm long, straight in young lowers and bent
in old lowers. Anther erect, lateral margins lightly
covered by the clinandrium. Stigma quadrate in young
lowers and transversely elongate in old lowers. Ovary
sessile, subcylindric, hairy, 2 mm long.
eTyMology: From Latin aurantiacus, referring to the
orange color of the lowers.
DisTriBuTion: Known only from the Department of La
Libertad, Peru, between 3500 and 4000 m elevation.
phenology: Flowering plants have been recorded
between May and August.
haBiTaT anD eCology: Plants of this species grow on
grassy hillsides. Some populations grow sympatrically
with other Aa species with white lowers; whose sepals
and petals have light-green tones when young turning
into light-cream to cream-brown when older (but never
orange). Besides lower color, this Aa species can be
distinguished from Aa aurantiaca by its wide opening
lip, glabrous sepals and ovary, and acuminate loral
bracts which notoriously surpass the lower (50% larger).
Aa aurantiaca is similar to Aa rosei Ames, but it
can be distinguished by the orange lowers, dorsally
hairy sepals, ovate-lanceolate, 3-nerved petals, and
narrower opening of the lip.
Myrosmodes gymnandra (Rchb.f.) C. Vargas, comb.
nov.
Basionym: Altensteinia gymnandra Rchb.f., Xenia
Orch. 3: 18. 1878. TYPE: Bolivia. Prov. Larecaja,
Mandon s.n. (holotype: W) (Fig. 3, 4).
Aa gymnandra (Rchb.f.) Schltr., Rep. Spec. Nov.
Regni Veg.11: 150. 1912.
Myrosmodes gymnandra belongs to the subgenus
Myrosmodes, i.e. it does not have a rostrate ovary (Vargas
1995). The inlorescence is 13 cm long. The dorsal sepal
is oblong, obtuse, 4.4 x 2.0 mm. The lateral sepals are
oblong, concave, obtuse, somewhat carinate, 6.0 x 2.6
mm. The petals are linear, subacute, with upper margin
erose, 4.5 x 0.6 mm. The lip is obovate, subquadrate,
5
involute, trilobate, middle lobe subquadrate, margin
apical with moniliform hairs, two calli at the base, 4.5 x
3.6 mm. The column is erect, and 3 mm long. The anther
exceeds the apex of the stigma, with a free ilament, 1.1
mm long. The rostellum is triangular and obtuse. The
ovary is ellipsoid, 3.5 mm long. The loral bracts are
subcircular to obovate, 11.0 x 10.2 mm.
In the protologue of the description of A.
gymnandra, Reichenbach indicates that the specimen
used to describe the species was Mandon s.n. Bolivia,
Provincia Larecaja, without referring to a speciic
locality. However, in the Reichenbach Herbarium in
Vienna (W), there was no specimen of A. gymnandra
bearing the characteristic printed label of G. Mandon
(as most of Mandon´s herbarium specimens). There is
a herbarium sheet that contains the lower illustration as
well as notes from Reichenbach with the description of
A. gymnandra and a mix of two specimens (Fig. 3). One
specimen is mounted on the herbarium sheet, which
could be Mandon´s specimen (holotype) and the other
is in an envelope (top left of the herbarium sheet), that
corresponds to Wilkes s.n., collected in Peru between
Culnai and Obrajillo. The illustration showed here is
based on the lower from the smallest envelope (middle)
of the herbarium sheet (Fig. 3B), but it is not possible to
precisely identify the specimen to which it belongs.
In the original description of A. gymnandra,
Reichenbach (1878) did not mention two important
features: the anther exceeds the apex of the stigma
and the anther’s ilament is free (Fig. 4D). In
Reichenbach’s illustrations the free ilament is also
evident but the anther appears smaller (Fig. 3C). The
free ilament has been described as a distinct feature
for Myrosmodes ilamentosum (Mansf.) Garay. Even
though M. gymnandra has some loral features similar
to M. ilamentosum, they can be distinguished because
the latter has larger lowers, a short ovary neck and a
slightly trilobate lip (Garay 1978).
Myrosmodes inaequalis (Rchb.f.) C. Vargas, comb.
nov.
Basionym: Altensteinia inaequalis Rchb.f., Xenia
Orch. 3: 19. 1878. TYPE: Peru. Dept. Puno:
Macusani in puna brava, June 1854, Lechler 1950
(holotype: W, isotype: W, G, AMES, K.). (Fig. 5)
Aa inaequalis (Rchb.f.) Schltr., Rep. Spec. Nov. Regni
Veg. 11: 150. 1912.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
6
LANKESTERIANA
figure 4. Myrosmodes gymnandra (Rchb.f.) C. Vargas. A — Flower. B — Dissected perianth. C — Lip, left natural, right
expanded out. D — Column, dorsal and ventral view. E — Floral bract. Drawing by D. Trujillo based on a specimen
from Reichenbach Herbarium (W).
Myromodes inaequalis belongs to subgenus
Myrosmodes (Vargas 1995). The inlorescence is up
to 7 cm long. The dorsal sepal is oblong to oblongobovate, obtuse to rounded, concave, 2.3 x 1.2 mm.
The lateral sepals are oblong, obtuse, concave,
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
carinate, 2.6 x 1.1 mm. The petals are linear-ligulate,
falcate, subacute, with upper margin erose, 2.0 x 0.4
mm. The lip is cucullate, cuneate at base, obovate to
elliptic when expanded, entire, margin of upper half
with moniliform hairs, two calli at the base, 2.4 x 2.1
Trujillo & Vargas — New Species and Combinations in Aa and Myrosmodes
7
figure 5. Myrosmodes inaequalis (Rchb.f.) C. Vargas. A — Flower. B — Dissected perianth. C — Column and lip. D
— Lip. E — Column, dorsal and ventral view. F — Floral bract. Drawing by D. Trujillo based on Lechler 1950 (W).
mm. The column is erect, 1.6 mm long. The anther is
subcircular and 0.7 mm long. The rostellum is truncate,
emarginate, not triangular (as stated by Reichenbach).
The ovary is elliptic, cylindrical, 3.5 mm long. The
loral bracts are obovate to elliptic, 5 mm long.
Myrosmodes inaequalis resembles Myrosmodes
paludosa (Rchb.f.) P. Ortiz.; however, they can be
distinguished because the latter has a shorter anther,
column dilated above, longer spike with more lowers
and thicker peduncle which is twice as long as the
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
8
LANKESTERIANA
spike (while in M. inaequalis the peduncle is up to
three times longer than the spike).
aCknoWleDgeMenTs. We thank to the curators of the W
for having allowed us access to the type material in the
Reichenbach Herbarium, including rehydration of lowers
of some of the specimens mentioned here; to the Ministerio
de Agricultura of Peru and its Dirección General Forestal
y de Fauna Silvestre (DGFFS) for issuing the collection
permits under which orchid specimens have been collected
(N° 030-2005-INRENA-IFFS-DCB); to the EES Grants for
their sponsorship in visiting the W; to Dr. Günter Gerlach
for his comments on the paper and to Dr. Philomena
Bodensteiner for her help with the Latin diagnosis.
liTeraTure CiTeD
Álvarez-Molina, A. & K.M. Cameron. 2009. Molecular
phylogenetics of Prescottiinae s.l. and their close allies
(Orchidaceae, Cranichideae) inferred from plastid and
nuclear ribosomal DNA sequences. Amer. J. Bot. 96:
1020–1040.
Ames, O. 1922. Aa rosei Ames. Proc. Biol. Soc. Wash. 35:
81.
Berry, P.E. & R.N. Calvo. 1991. Pollinator limitation and
position dependent fruit set in the high Andean orchid
Myrosmodes cochleare (Orchidaceae). Pl. Syst. Evol.
174: 93-101.
Dressler, R.L. 1993. Field guide to the orchids of Costa
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
Rica and Panama. Cornell University Press, Ithaca, New
York.
Garay, L.A. 1978. Orchidaceae. Cypripedioideae
Orchidoideae Neottioideae. In: G. Harling & B. Sparre
(eds.), Flora of Ecuador, 225(1). University of Goteborg,
Stockholm, Sweden.
Mansfeld, R. (ed.). 1929. Figuren-Atlas zu den
Orchideenloren der südamerikanischen Kordillerenstaaten. Repert. Sp. Nov. Regni Veg. Beih 57.
Ortiz, P. 1995. Orquídeas de Colombia. Corporación
Capitalina de Orquideologia, Bogota. 2da. Ed.
Reichenbach, H.G. 1854. Altensteinia, Aa and Myrosmodes.
Xenia Orchid. 1: 17-19.
Reichenbach, H.G. 1878. Orchideae Mandonianae. Xenia
Orchid. 3: 17-19.
Schlechter, R. 1912. Die Orchideen Gattungen Altensteinia
HBK, Aa Rchb.f. und Myrosmodes Rchb.f.. Repert
Spec. Nov. Regni Veg. 11: 147-150.
Schlechter, R. 1920a. Orchidaceae novae et criticae. Repert.
Sp. Nov. Regni Veg. 16: 353-358.
Schlechter, R. 1920b. Orchidaceae novae et criticae. Repert.
Sp. Nov. Regni Veg. 16: 437-450.
Schweinfurth, C. 1958. Orchids of Peru. Fieldiana Bot..
30(1): 1-260.
Vargas, C. 1995. New combinations in Myrosmodes Rchb.f.
(Orchidaceae) Lindleyana 10: 5-6.
Vargas, C. 1997. Phylogenetic analysis of Cranichideae
and Prescottiinae (Orchidaceae) with some taxonomic
changes in Prescottiinae. M.S. thesis, University of
Missouri-St. Luis, St. Louis Missouri, USA.
LANKESTERIANA 11(1): 9—14. 2011.
TwO NEw SPECiES Of TeAGUeIA (OrChidACEAE:
PlEurOThAllidiNAE) frOM EAST-CENTrAl ECuAdOr
lou josT1,3 & anDerson sheparD2
1
Via a Runtun, Baños, Tungurahua, Ecuador
2307 N. Wallace Ave, Bozeman, MT 59715 USA
3
Author for correspondence: loujost@gmail.com
2
aBsTraCT. Abstract: Two new species of Teagueia, T. barbeliana and T. puroana, are described and illustrated.
Their relationship to other Teagueia, their scientiic importance, and their conservation is discussed. Closest
relatives are T. alyssana, T. sancheziae, T. cymbisepala, and T. jostii, and like them, the new species are highelevation (>3100m) endemics of the upper Río Pastaza watershed in the eastern Andes of Ecuador. Teagueia
barbeliana differs from its relatives by broad rounded lower parts, lateral sepals connate for half their length,
column apex winged. Teagueia puroana differs from relatives by its long-acuminate petals and sepals.
resuMen. Se describen e ilustran dos nuevas especies del género Teagueia, T. barbeliana y T. puroana. Se
discuten sus ainidades, su importancia para la ciencia, y su conservación. Las especies más cercanamente
emparentadas con las nuevas son T. alyssana, T. sancheziae, T. cymbisepala, y T. jostii, que al igual que las
nuevas, son endémicas a las alturas (>3100m) de la cuenca alta del Río Pastaza en los Andes Orientales del
Ecuador. Teagueia barbeliana se distingue por sus sépalos y pétalos redondos, sus sépalos laterales unidos hasta
la mitad de su longitud, y las alas en el ápice de la columna. Teagueia puroana se distingue por sus pétalos y
sépalos con colas largas..
key WorDs: Teagueia puroana, Teagueia barbeliana, Ecuador, orchid, new species
Prior to the year 2000, Teagueia Luer was known
from only three Colombian and three Ecuadorian
species, each apparently endemic to very small areas
(Luer 1991). In the year 2000, LJ discovered four
new species of Teagueia in one square meter of moss
at 3100m on a remote mountain in the upper Río
Pastaza watershed in the province of Tungurahua in
Ecuador, on the rim of the Amazonian basin of South
America. Those species were described as T. alyssana
Luer & L. Jost, T. sancheziae Luer & L. Jost, T.
cymbisepala Luer & L. Jost, and T. jostii Luer (Luer
2000). Further investigation led to the discovery of
many more new species on that same mountain and
neighboring mountains, all in cloud forest or páramo
(alpine grassland) above 2800m (Jost 2004). The total
number of new high-elevation morphospecies now
known from the upper Río Pastaza watershed is about
28 (including the four formally described species just
mentioned, and the two new ones described here).
Characteristics of the new species and their
relatives. All of the 28 locally endemic high-elevation
morphospecies are slender, long-repent plants with
loose, successive-lowering inlorescences. The longrepent habit easily distinguishes them from all other
Teagueia species. The lowers also differ slightly from
the previously-known Ecuadorian species of the genus.
Teagueia zeus (Luer & Hirtz) Luer, T. teagueii (Luer)
Luer, and T. tentaculata Luer & Hirtz all have a raised
callus on the lip just below the column. In addition, the
oriice in the center of their lip, which is characteristic
of the genus, is long and narrow, extending almost from
the callus to the apex of the lip. In the 28 long-repent
species, on the other hand, there is no raised callus,
and the oriice occupies less than half the midlobe of
the lip.
Both of the new species described here are easily
distinguished from all other described Teagueia species.
Teagueia barbeliana is most like T. cymbisepala, but
has more rounded lower parts than that species; the
lateral sepals in particular are very broad and connate
for half their length, each with four veins as opposed
to the three or fewer veins of other known species. The
lateral lobes of the lip clasp the column just behind the
10
LANKESTERIANA
stigma. The three-veined petals and winged column
tip are also unusual. Teagueia puroana is most like T.
alyssana, but it is immediately distinguished by the
long tails on all sepals and petals exclusive of the lip,
combined with lateral sepals that are only connate for
1/5 of their length, and lateral lobes of the lip which
clasp the column just behind the stigma.
Evolution of the Teagueia species of the upper río
Pastaza watershed. The similarity of the 28 upper
Río Pastaza watershed long-repent morphospecies
of Teagueia strongly suggests that they form a
monophyletic group. Preliminary results of molecular
work on nearly all morphospecies by Mark Whitten,
Kurt Neubig, and Lorena Endara (University of
Florida- Gainesville), and previous unpublished work
on a subset of species by Alec Pridgeon (Kew) and
by Erik Rothacker (Ohio State University), conirm
this. These morphospecies thus constitute one of the
earth’s most remarkable local plant evolutionary
radiations, with more species in a much smaller area
than better-known recently-evolved plant radiations
such as Darwin’s Scalesia Arn. (Asteraceae) on the
Galapagos Islands (Tye 2000). The only comparable
orchid radiation is the Dendrochilum Blume radiation
on Mount Kinabalu, Borneo (Barkman & Simpson
2001). Molecular work by Mark Whitten’s group
at UF Gainesville may soon be able to assign a time
scale on this Teagueia radiation, which appears to be
very young, like many other Andean plant radiations
(Hughes & Eastwood 2006, Scherson et al. 2008).
distribution patterns of the Teagueia species in the
upper río Pastaza watershed. Almost all of these
28 Teagueia morphospecies appear to be restricted to
a 30km x 20km block of forest bisected by the steep
valley of the Río Pastaza, an important tributary of
the Amazon. Extensive botanizing in the páramos
and high cloud forests along the Quito-Baeza road
and the páramos of Pisayambo (Parque Nacional Los
Llanganates) north of the Río Pastaza failed to turn
up any of these species. South of the Río Pastaza,
we have found only two species on the GuamoteMacas road (70-90 km south of the Río Pastaza) and
no species farther south. There are however many
unexplored high mountains in the Llanganates range
and between the Río Pastaza and the Guamote-Macas
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
road, where additional as-yet-unknown species may
be found.
The distributions of the 28 morphospecies show
strong geographic structure within the upper Río
Pastaza watershed. The morphospecies found north
of the Río Pastaza are not found south of it, and viceversa, with one possible exception. These patterns are
probably not sampling artifacts, as we have intensively
examined each of the mountains where these longrepent Teagueia are known to occur. Such strong local
distribution patterns are remarkable in light of the
dispersal characteristics of orchid seeds. Other orchid
genera in the same area show north-south distribution
bands which cross the Río Pastaza (LJ pers. obs.)
The previously-described members of this group
of 28 morphospecies, T. alyssana, T. sancheziae, T.
cymbisepala, and T. jostii, were all from a mountain
north of the Río Pastaza. The two species described in
the present paper are the irst species described from
south of the Río Pastaza. They are among the most
distinctive of the southern species.
habitat and conservation status. Both species
described here were discovered at very high elevations
on Cerro Candelaria, Tungurahua province, Ecuador.
Fourteen other morphospecies of Teagueia were also
found on Cerro Candelaria. The two species described
here are among the rarest of the Cerro Candelaria
Teagueia species; only a few plants of each were
found during extensive ieldwork on Cerro Candelaria.
Teagueia puroana grows as an epiphyte on low
branches and trunks of isolated stunted treelets in the
páramo. Teagueia barbeliana grows in moss in open
páramo at 3400-3800m. Both species experience hard
freezes on most nights.
Teagueia barbeliana was later found on a second
mountaintop about 18 km west of Cerro Candelaria.
Teagueia puroana remains known only from Cerro
Candelaria. The extraordinary scientiic importance
of this unique evolutionary radiation makes these
mountains a global conservation priority. Shortly
after their discovery, the irst author and his associates
in Ecuador and abroad started a conservation
foundation, Fundación EcoMinga, to protect the
endemic plants and animals of the upper Río Pastaza
watershed. In partnership with the World Land Trust,
Fundación EcoMinga has now purchased much of
josT & sheparD- Two new species of Teagueia
Cerro Candelaria, including habitat for T. puroana
and T. barbeliana and the fourteen other Teagueia
morphospecies which grow there. These purchases
were made possible by donations to the World
Land Trust by Puro Coffee, Albertino Abela, and
PricewaterhouseCoopers.
speCies DesCripTions
Teagueia barbeliana L. Jost & A. Shepard, sp. nov.
Teagueiae cymbisepalae Luer et Jost similis, sed
sepalis petalisque rotundioribus, sepalis lateralibus
connatis per 1/2 marginem suas, lobis lateralibus
labelli circum columnam.
TYPE: Ecuador. Tungurahua: Cerro Candelaria,
1º28’46”S, 78º17’51”W, 3400 m, Nov. 2002, L. Jost
5132 (holotype: QCA!; isotype: QCNE!). Fig. 1.
Plant medium in size for the genus, lithophytic or
terrestrial, long-repent, the rhizome exceeding 20
cm in length, producing a ramicaul and leaf at every
third joint, 7-8 mm between joints; one coarse root
emerging at each ramicaul-bearing joint. Ramicauls
ascending, stout, 3 mm long, enclosed by 1 or 2
imbricating sheaths. Leaf erect, thickly coriaceous,
reticulate-veined, petiolate, elliptical, obtuse, 10-15
mm long, 8-9 mm wide, the base cuneate into the
petiole. which is 15-20 mm long. Inlorescence from
near the apex of the ramicaul; an erect, successive,
distantly several-lowered raceme, 4-6 cm to irst
lower, lowers spaced 12 mm apart, up to 7 lowers;
one to three lowers open at once; loral bracts oblique,
acute, thin, 4 mm long; pedicels 4.4 mm long; ovary
1.8 mm long. Flowers golden yellow suffused orange,
with red on veins, the lip with a red stripe down its
center; dorsal sepal ovate, 6.4 mm long, 4.2 mm wide,
3-veined; lateral sepals broadly ovate, acuminate, 5.3
mm long, 3.9 mm wide, 3-veined, rudimentary fourth
vein, connate for 2.3 mm. Petals ovate, acuminate,
4.1 mm long, 2.8 mm wide, 3-veined. Lip ovate, 3.1
mm long, 2.3 mm wide, the apex truncate, the disc
longitudinally cleft, spreading into a deep oriice
above the middle, the base with angles embracing the
column, curving outward to match the plane of the
midlobe of the lip, the base ixed to the column-foot.
Column terete, recurved at anther, 1.8 mm long, 1
11
mm wide at stigma, laterally winged at anther, wings
conluent with stigma, stigma entire.
eTyMology: Albertino Abela of London contributed
signiicantly to the conservation of this orchid’s
habitat; this species is named in honor of his mother
Barbel, at his request.
paraTypes: Ecuador. Tungurahua: Cerro Candelaria,
1°28’46”S, 78°17’51”W, Nov. 2003, L. Jost, A.
Shepard, S. Grossman, A. Araujo 6197 (QCA!), 6219
(QCA!), 6225 (QCA!), 6227 (QCA!); Cerro Chamana,
1°26’7”S, 78°23’1”W, 3500 m, Dec. 2003, L. Jost et
al. 6580 (QCA!).
DisTriBuTion: Rare and local from 3400-3800 m on
two mountaintops just south of the Río Pastaza near
the town of Baños, Tungurahua, Ecuador.
Teagueia puroana L. Jost & A. Shepard, sp. nov.
Teagueiae alyssanae Luer et Jost similis, sed sepalis
petalisque longi-acuminatis, sepalis lateralibus
connatis per 1/5 marginem suas, lobis lateralibus
labelli circum columnam.
Type: Ecuador. Tungurahua: Cerro Candelaria,
1°28’46”S, 78°17’51”W, 3400 m, Nov. 2002, L. Jost
5149 (holotype: QCA!). Fig. 2.
Plant small-medium in size for the genus, epiphytic,
long-repent, the rhizome exceeding 13 cm long,
producing a ramicaul and leaf at every third joint, 0.81.4 cm between joints; one coarse root emerging at each
ramicaul-bearing joint. Ramicauls ascending, stout,
4 mm long, enclosed by 1 or 2 imbricating sheaths.
Leaf erect, thickly coriaceous, reticulate-veined,
petiolate, elliptical, obtuse, 15-20 mm long, 8-9 mm
wide, the base cuneate into the petiole 15 mm long.
Inlorescence from near the apex of the ramicaul; an
erect, successive, distantly several-lowered raceme,
2-4.5 cm to irst lower, the lowers spaced 5-7 mm
apart, up to 11 lowers, with only one or two lowers
open at once; loral bracts oblique, acute, thin, 4 mm
long; pedicels 3.8-4.5 mm long; ovary 1.5 mm long.
Flowers dark orange suffused dark reddish apically
on all parts; dorsal sepal elliptical-ovate, longacuminate, 7.1 mm long, 3.4 mm wide, 3-veined;
lateral sepals obovate, long-acuminate, 7.6 mm
long, 2.6 mm wide, 3-veined, connate for 1.4 mm;
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
12
LANKESTERIANA
figure 1. Teagueia barbeliana L.Jost & A.Shepard. A — Plant. B — Flower. C — Lateral lower. D — Dissected lower.
E — Oblique lip and column detail. F — Top view, column and lip collar. Scale bars: A, 5 cm; B-D, 2 mm; E-F, 1 mm.
illusTraTion VouCher: L. Jost 5132 (QCA). Illustration by Lou Jost.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
josT & sheparD- Two new species of Teagueia
13
figure 2. Teagueia puroana L.Jost & A.Shepard. A — Plant. B — Flower. C — Lateral lower. D — Dissected lower. E
— Oblique lip and column detail. F — Top view, column and lip collar. Scale bars: A, 4 cm; B-D, 3 mm; E-F, 1 mm.
illusTraTion VouCher: L. Jost 5149 (QCA). Illustration by Lou Jost.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
14
LANKESTERIANA
petals ovate, long-acuminate, 5.1 mm long, 2 mm
wide, 1-veined; lip oblong-ovate, 2.4 mm long, 1.4
mm wide, the apex rounded, the disc longitudinally
cleft, spreading into a deep oriice above the middle,
the base with rounded microscopically ciliate angles
embracing the column, the angles nearly or actually
in contact with each other above the column, the base
ixed to the column-foot. Column terete, recurved at
anther, 1.4 mm long, 0.8 mm wide at stigma; stigma
entire.
eTyMology: Named in honor of Puro Coffee, UK,
which contributed signiicantly to the conservation of
this species.
paraTypes: Ecuador. Tungurahua: Cerro Candelaria,
3600 m, 1º28’46”S, 78º17’51”W, Nov. 2002, L. Jost
5140 (QCA!), 5141 (QCA!), 5209 (QCA!), 5210
(QCA!), L. Jost, A. Shepard, S. Grossman, A. Araujo
6213 (QCNE!), 6218 (QCA!), 6223 (QCA!).
DisTriBuTion: known only from 3600 m on Cerro
Candelaria, just south of the Río Pastaza, near the
town of Baños, Tungurahua, Ecuador.
aCknoWleDgeMenTs. Kurt Neubig, Lorena Endara, Mark
Whitten, and two anonymous reviewers gave advice that
improved the manuscript. The Ministerio del Ambiente del
Ecuador gave permission for this research; permit 12-07 ICFLO- DNBAPVS/MA and previous permits.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
liTeraTure CiTeD
Barkman, T.J., & B.B. Simpson. 2001. Origin of HighElevation Dendrochilum Species (Orchidaceae)
Endemic to Mount Kinabalu, Sabah, Malaysia. Syst.
Bot. 26: 658-669.
Hughes, C., & Eastwood, R. 2006. Island Radiation
on a continental scale: Exceptional rates of plant
diversiication after uplift of the Andes. PNAS,
103:10334-10339.
Jost, L. 2004. Explosive Local Radiation of the Genus
Teagueia (Orchidaceae) in the Upper Pastaza Watershed
of Ecuador. Lyonia 7: 41-47.
Luer, C.A. 1991. Icones Pleurothallidinarum VIII,
Systematics
of
Lepanthopsis,
Restrepiella,
Restrepiopsis, Salpistele & Teagueia. Monogr. Syst.
Bot. Missouri Bot. Gard. 64: 105-114.
Luer, C.A. 2000. Icones Pleurothallidinarum XX.
Systematics of Jostia, Andinia, Barbosella,
Barbodria, and Pleurothallis Subgenus Antilla, Subgenus
Effusia, Subgenus Restrepioidia
(Orchidaceae). Monogr. Syst. Bot. Missouri Bot. Gard.
79:105-114.
Scherson, R., Vidal, R., & Sanderson, M. 2008. Phylogeny,
biogeography, and rates of diversiication of New World
Astragalus (Leguminosae) with an emphasis on South
American radiations. Am. J. Bot. 95: 1030-1039.
Tye, A. 2000. Las plantas vasculares endemicas de
Galapagos. Pages 24-28 in Valencia, R., Pitman, N.,
Leon-Yanez, S., Jorgensen, P. (Eds.) Libro Rojo de las
Plantas endemicas del Ecuador 2000. Herbarium of the
Pontiicia Universidad Catolica del Ecuador. Quito.
LANKESTERIANA 11(1): 15—21. 2011.
ThE rOOT COlONiziNg fuNgi Of ThE TErrESTriAl OrChid
CyprIpedIUM IrApeAnUM
María ValDés1,2, héCTor BauTisTa guerrero1, laura MarTínez1 & rafael h. Víquez1
1
Escuela Nacional de Ciencias Biológicas, Instituto Politécnico Nacional, Plan de Ayala y Carpio,
Colonia Santo Tomás, 11340 México D.F.
2
Author for correspondence: mvaldesr@ipn.mx
aBsTraCT. This study investigated the mycorrhizal status and the identiication of the fungi colonizing the roots
of the terrestrial orchid Cypripedium irapeanu by restriction fragment length polymorphisms and by rDNA
internal transcribed spacer sequencing. The orchid is endemic of differents regions in Mexico, Guatemala and
Honduras; usually at 1400-2250 m. It grows mainly in the remaining oak forests of the highlands and it is in
the Mexican red list of plants in danger. The oak forests in Mexico are threatened constantly. The microscopic
examination of stained root segments of the orchid revealed the presence of fungal structures of both orchidioid
fungi (pelotons and coyled hyphae) and dark septate endophytes (DSE) (mielinized hyphae and microsclerotia).
Analysis of ITS1-5.8-ITS2 region sequences suggested that mycorrhizal tissue was dominated by Tulasnaceae:
Sistotrema sp., Rhizoctonia solani, and Epulorhiza sp. Among the DSE one isolate revealed 100% similarity to
Phomopsis sp XJ-05, and another one 99% to the fungal endophyte MUT 885 which are both reported as dark
septate endophytes. The putative dark septate endophyte Phomopsis sp XJ-05 was isolated not only from the
roots but also from the germinated seeds of C. irapeanum.
resuMen. Este estudio investigó el status micorrízico y la identiicación de los hongos que colonizan la raíz de la
orquídea terrestre Cypripedium irapeanum por medio de los polimorismos de los fragmentos de la restricción y
la secuenciación del espacio tránscrito interno del rDNA. Esta orquídea es endémica de diferentes regiones de
México, Guatemala y Honduras localizándose entre los 1400 y 2250 m de altitud. Crece principalmente en los
remanentes de los bosques de encino del altiplano y está en la lista roja de México de las plantas amenazadas.
Los bosques de encino en este país están constantemente amenazados. El examen al microscopio de los
segmentos de raíces teñidas de las orquídeas nos mostró la presencia de estructuras fúngicas tanto de hongos de
micorriza orquidoide (pelotones e hifas enrrolladas) como de los llamados endóitos obscuros septados (DSE)
(hifas mielinizadas y microesclerosios). El análisis de la secuenciación de la región ITS1-5.6-ITS2 sugiere que
el tejido micorrizado está dominado por Tulasneaceae: Sistotrema sp., Rhizoctonia solani, and Epulorhiza sp.
Entre los DSE, uno de los 10 aislados mostró 100% de similaridad con Phomopsis sp XJ-05, y otro 99% con el
endoito MUT 885, ambos reportados como endóitos obscuros septados. El hipotético endóito septado obscuro
Phomopsis sp XJ-05 fue aislado tanto de las raíces como de las semillas que germinaron de C. irapeanum
restriction fragment length polymorphisms and by rDNA internal transcribed spacer sequencing.
key WorDs: terrestrial orchid, orchidoide mycorrhiza, dark septate endophytes, microsclerotia
introduction. Symbiosis are particularly important
for plants resulting in signiicant nutritional advantage.
Among these are the mycorrhizae from which most
plants obtain the majority of their nutrients, including
those limiting their growth. In general for the terrestial
orchids the mycorrhizal association is fundamental for
the plant during germination and throughout all its life
(Smith & Read 1997).
Of all orchids that have been studied, few have been
the object of mycorrhizal studies. Among the Mexican
terrestrial orchids just 3% of the orchids have been
studied (Ortega-Larrocea & Rangel-Villafranco 2007).
Many species of terrestrial orchids are threatened
or in danger due to the habitat loss by anthropogenic
activities and the attractive beauty of its lowers
(Dearnaley 2007). Cypripedium irapeanum (Fig.
1) grows mainly in the remaining oak forests of the
Mexican highlands. The oak forests in Mexico are
16
LANKESTERIANA
figure 1. Cypripedium irapeanum lower from Puebla
State, Mexico.
threatened constantely by the urban activities and by
the development of recreational sites. The change
of soil use of the oak forests has conducted to the
degradation by soil erosion and loss of these forests and
have allow not only to the soil loss, and cosequently to
the loss of the symbiotic fungi, but also to the decrease
of the number of pollinators and to the increase of
pathogens, specially the attack of the capsules by
screw warms; other problems that this plant has to face
in the degraded habitat are cattle, and weed invasion
(Valdés et al. 2005).
Cypripedium irapeanum was orginally described
based on a collection from the mountains of Irapeo
near the present city of Morelia in Michoacan, Mexico
(Cribb & Soto Arenas 1993). In this country it is
known as pichohuastle, a native name for the plant.
The orchid is endemic of differents regions in Mexico
(Chiapas, Durango, Guerrero, Jalisco, Michoacán,
Morelos, Nayarit, Oaxaca, Sinaloa, Querétaro, Puebla,
Veracruz), Guatemala and Honduras; usually at 14002250 m of altitud. The orchid is in the red list of plants
in danger of the Mexican Department of Natural
Resources (seMarnaT 1995).
In relation to the temperate lady’s slipper orchids,
Cypripedium, there are few studies on its associated
fungi. According to Shefferson et al. (2005), the genus
Cypripedium is characterized by high speciicity
mycorrhizal association, then the lack of these fungi
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
may limit their establishment and distribution. Upon
infection of this orchid by a compatible mycorrhizal
fungus the seed (“dust seed”) germinates into a
seedling that consumes the fungal sugars, processus
known as myco-heterotrophy. The plants may retain
the myco-heterotrophy into adulthood (Gill 1989).
The internal transcribed spacer (ITS) regions
of ribosomal DNA, including both ITS1 and ITS2,
have been used extensively used for environmental
sampling as a target because several taxonomic groupspeciic primer sets exist for this gene region (Gardes
& Bruns 1993). The ITS has been the region of choice
for molecular analysis of fungal communities of this
region has been useful since Gardes & Bruns (1996)
used its restriction digests (RFLP) to differenciate
species of mycorrhizal fungi colonizing individual
roots. Furthermore, the DNA sequences of the ITS1
and ITS2 are highly variable being a good marker
to identify fungi to the genera and/or species level
(Gardes & Bruns 1993, Gardes & Bruns 1996, Henrion
et al. 1992, Smith et al. 2007).
Objective of this paper was the isolation and
identiication of the fungal root and seed endophytes
as well as mycorrhyzal fungi of C. irapeanum by
restriction fragment length polymorphisms and by
rDNA internal transcribed spacer sequencing. The term
“endophyte” refers to those fungi that can be detected
at a particular moment within the tissues of apparentky
healthy plant hosts (Schultz & Boyle 2005).
Materials and methods. Collected C. irapeanum is
surviving in a remaining patch of an oak forest which
is located out of Puebla city in the State of Puebla, at
1840 m. We collected C. irapeanum growing close to
an oak tree.
Due to the scarcity of the orchids we obtained
a collect autorization (No. D00.02-3478) from
seMarnaT. Cypripedium irapeanum plants were
collected including the rhizome and the surrounded
soill to ensure that the root system was kept intact. We
also sampled seeds. The soil core with the alive whole
plants were maintened in the greenhouse before to be
processed.
In order to observe the root fungal colonization
in situ the roots were hydrolyzed and stain by the
Philips and Hayman procedures (1970) resulting in
20 to 30 root samples per plant. Inter and intracellular
ValDés et al. — Root colonizing fungi of Cypripedium irapeanum
melanized hyphae with microslclerotia were recorded
as Dark Septate Endophytes (DSE).
The isolation of the seed and root endophytes of
C. irapeanum was done after a surface sterilization
with a 5% sodium hipochlorite solution for 10 min,
followed by a 0.1 % mercuric chloride solution for 2
min, and several washings with sterile distilled water.
This drastic sterilization was done to prevent growth
of root external microorganisms. Seeds were sowed
in lasks containing Knudson (1946) culture medium,
and the root fragments (1 cm long) in Petri plates
containing Melin-Norkrans (Molina & Palmer, 1982)
culture medium. After 4 days of incubation, plates with
the root fragments having supericial contaminants
were eliminated and those with no contaminants
were incubated at 24oC for 3 months. Pure fungal
isolates were propagated in Melin-Norkrans agar
medium. Colonial and microscopic morphology was
photographically documented (data not shown).
Genetic characterization of C. irapeanum
endophytes involved 1) extraction of fungal DNA from
isolated and puriied fungi, 2) ampliication of fungal
genome region useful in determining fungal identity
(ITS1-5.8S-ITS2), 3) restriction and RFLP analysis of
the region, 4) DNA sequencing of the region, and 5)
BLAST analysis for identiication of endophytes.
DNA extraction of isolates was done utilizing
the CTAB method (Gardes & Bruns 1993). Obtained
DNA was puriied with the Concert Nucleic Acid
Puriication (Gibco), according to the manufacturer
instructions. Concentration and purity of the DNA
was evaluated with a GeneQuant spectrophotometer.
The ITS region of the rRNA operon was ampliied
according to Gardes & Bruns (1993) using the
primers ITS1 (TCCGTAGGTGAACCTGCGC),
ITS-1F (CTTGGTCATTTAGAGGAAGTAA), ITS
4 (TCCTCCGCTTATTGATATGC) and ITS4-B
(CAGGAGACTTGTACACGGTCCAG). PCR was
carried out in a Biometra-T personal termocycler
under 94oC for 85 s for the denaturation followed by
25 cycles of ampliication and extension for 13 cycles
at 95oC for 35s, 55oC for 55s and 72oC for 45s. This
was followed by an incubation at 72oC for 10 more
minutes. Obtained bands were visualized in an EtBr
stained agarose gel.
PCR products were puriied (Concert Nucleic Acid,
Gibco) and restricted with enzymes Hinf1 (at 37oC for
17
5 hours), Alul (at 37oC for 1 hour), and Taq1 (at 65oC
for 3 hours). Fragments were analiysed with the Kodak
ID 3.6.1 program.
The amplicons were cloned and ligated using the
TOPO XL PCR cloning (qiagen) according to the
manufacturer’s instructions. The recombinant vector
was used for transforming cells of E. coli DH5α.
Screening for recombinant cells was carried out by
blue/white selection. Sequencing reactions were done
in a Li-Cor 4202 G sequencer. Before sequencing,
the amplicons were puriied with the Pure Link
Quick Gel Extraction kit (Invitrogen) following the
manufacturer’s instructions.
Sequences were subjected to BLAST analysis
to determine their homology with other sequences
available in the Gene Bank for the ITS1-5.8S-ITS2
region. The CLUSTAL package (Thompson et al.
1994) was used to align the sequences with the
corresponding fungal ITS rDNA sequences.
results and discussion. The microscopic examination
of stained root segments of the orchid revealed the
presence of fungal structures of both orchidioid
fungi, pelotons and coyled hyphae (Fig. 2) and DSE,
mielinized hyphae and microsclerotia (Fig. 3). In 40%
of the cortical cells pelotons were seen, and 30% of the
cortical cells revealed the presence of microsclerotia
inside the cells. We found partially digested pelotons in
all C. irapeanum plants, suggesting that C. irapeanum
may have mycoheterotrophic stages.
Table 1 shows the list of the endophytic fungi
recovered from roots and germinated seeds of orchid
Cypripedium irapeanum.
Dark Septate Endophytes were also observed in the
germinated seeds. Two distinct types of microsclerotia
were seen in the roots, one was of round shape and
the other had irregular shapes (Fig. 3). A total of 10
different fungi were isolated, one from a germinated
seed and 9 from the roots. Isolates 7, 9 and 10 were
identiied as DSE; Isolate 7 and 9 from the plants, and
isolate 10 from the seeds. To our knowledge, this is
the irst report of the colonization of Cypripedium
irapeanum by DSE fungi and the irst report of the
colonization and identiication of both types of fungi
in C. irapeanum.
As expected the ampliied ITS1-5.8-ITS2 rDNA
region resulted in a 650 bp product. Negative controls
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
18
LANKESTERIANA
figure 2. Squash preparation of a C. irapeanum stained root showing infection of cells, coiled hyphae and development of
pelotons.
in PCRs (sterile milliporized water) consistently
yielded no PCR product. The ITS 1F-ITS 4
combination yielded most of the PCR products except
for the isolates 8, 9, and 10 which were ampliied with
the ITS 1-ITS 4B combination.
Restriction of the region yielded RFLPs different
for all the analyzed fungi, except fot the isolates 9
and 10 that were identical. Nine RFLP patterns were
yielded with AluI and TaqI restriction enzymes and 7
patterns with HindI (Fig. 4), suggesting the diversity of
the endophytes.
Analysis of ITS1-5.8-ITS2 region sequences
suggested that mycorrhizal tissue was dominated
by Tulasnaceae: isolate 2 (GeneBank Accesion No.
JF313323) revealed 98% identity to Sistotrema sp.,
isolate 3 (GeneBank Accesion No. JF313324) 99% to
Rhizoctonia solani, and isolate 6 (GeneBank Accesion
No. JF313322) 97% to Epulorhiza sp., conirming
Shefferson et al. (2005) and Shimura et al. (2009) results
for the genus Cypripedium. Diverse Tulasnaceae form
mycorrhiza also with epiphytic orchids (Suárez et al.
2006). Figure 5 shows a phylogenetic tree indicating
the placement of the mycorrhizal fungi recovered from
the roots of C. irapeanum.
TaBle 1. Endophytic fungi recovered from roots and germinated seeds of orchid Cypripedium irapeanum
Isolate
Molecular identiication
Type of root colonizing fungus
C1
Fusarium
Fungal endophyte (Bayman & Otero, 2006)
C2
Sistotrema
Mycorrhizal (Currah et al, 1990)
C3
Rhizoctonia solani
Mycorrhizal (Warcup, 1971)
C4
Fusarium
Fungal endophyte (Bayman & Otero, 2006)
C5
Cylindrocarpon
Fungal endophyte (Fisher & Petrini, 1989)
C6
Epulorhiza
Mycorrhizal (Shan et al, 2002)
C7
MUT 885
Dark Septate Endophyte (Girlanda et al, 2002)
C8
Gliocladium catenulatum
Biological control fungus (Paavanen-Huhtala et al,
2004)
C9
Phomopsis
Dark Septate Endophyte (from plant) (Jumpponen,
2001)
C10
Phomopsis
Dark Septate Endophyte (from germinated seeds)
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
ValDés et al. — Root colonizing fungi of Cypripedium irapeanum
19
figure 3. Two distinct microsclerotia (arrowheads) within the roots of C. irapeanum, round shape and irregular shape.
Isolates 9 and 10 revealed 100% identity to
Phomopsis sp XJ-05, and isolate 7 revealed 99% identity
to the fungal endophyte MUT 885 (a DSE fungus
according to Girlanda et al., 2002), corroborating the
results of the RFLP analysis. Phomopsis sp XJ-05
was isolated not only from the roots of C. irapeanum
plants but also from the germinated seeds, indicating a
possible role of stimulation of germination.
Other endophytic fungi belonging to the
Deuteromycetes were also isolated: isolate 1,
identiied as Fusarium sp 440 (99% identity); isolate
4 identiied as Fusarium sp (97% identity); isolate 5 as
Cylindrocarpon sp 4/97.1 (100% identity); and isolate
8 as Gliocladium catenulatum (99% identity).
The genus Sistotrema is deined by Currah et
al. (1990) as a mycorrhizal fungi of boreal species.
Moncalvo et al., (2006) states that this fungus as a
highly phylogenetic. However, analysis of ITS1-5.8ITS2 region sequences of our isolate C2 showed a high
identity to this fungus.
Rhizoctonia is known for its association with
most other orchids (Rasmussen, 1995). This fungus
is a genus based on asexual stages, is a polyphyletic
fungus which includes fungi from the families
Tulasnellaceae, Sebacinaceae and Ceratobasidiaceae.
Rhizoctonia solani is a known anamorph of
Thanatephorus cucumeris, has been isolated from
absorbent tissues of orchids and conirmed as
mycorrhizal endophytes because are able to stimulate
the seed germination and development of the plant in
vitro assays (Warcup, 1971).
The Epulorrhiza species are known as anamorphs
of the genus Rhizoctonia. Shan et al., 2002 mention
that certain species of this genus have been continually
isolated of terrestrial orchids; by means of the RFLP
and CAPS analysis of Rhizoctonia they were able to
classify the genus and its anamorps in 4 groups. Group
II formed by Epulorrhiza showed a high ability to
stimulate the germination and growth of several orchids.
In contrast Group I stimulate a speciic orchid. Other
authors (Sharma et al. 2003) found that in advanced
development of the plant the number of species of
Epulorrhiza is low suggesting that the occurrence of
the fungus may be less critical in this growth stage.
DSE have been reported for nearly 600 plants host
figure 4. Restriction fragmen tlength polymorphisms obtained by endonucleases of the internal transcribed
spacer (ITS1-5.8S-ITS2) region of the different fungi
isolated from C. irapeanum. Digestions were performed
with Alu 1, Hinf 1, and Taq 1. M=molecular weight
marker.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
20
LANKESTERIANA
aCknoWleDgeMenTs. This research was partially funded
with a grant of the Instituto Plotécnico Nacional. RHV
acknowledges support from CONACYT through a M Sc
scholarship. We are grateful to Ms Raquel Escobedo for
providing information on the ubication of the orchids.
Thanks are due to Dr. Heidi Asbjornsen for constructive
English corrections.
liTeraTure CiTeD
figure 5. Neighbor-joining tree obtained from the internal
transcribed spacer (ITS1-5.8S–ITS2) sequence alignment of isolates C2, C3 and C6 with sequences of Tulasnaceae. The Kimura two-parameter model was used
for pairwise distance measurement. Bootstrap values
above 50% are indicated (1000 replicates). Black arrows indicate the mycorrhizal fungal isolates recovered
from the orchid C. irapeanum. Bar = Kimura distance.
species, including plants known to bear different types
of mycorrhizae occurring in highly diverse habitats.
Their widespread occurrence and high abundance
suggests lack of host speciicity and an important role in
the different ecosystems (Jumpponen & Trappe, 1988;
Jumpponen, 1999). Jumpponen (2001) regards the DSE
as nonconventional mycorrhizal symbiosis because some
of them have found to enhance host mineral nutrition
and growth (Fernando & Currah, 1996). The presence of
DSE in the germinated seeds of C. irapeanum and their
lack in the ungerminated seeds suggests its possible role
for the germination of the orchid seed.
In relation of the occurrence of Fusarium as an
endophyte of Cypripedium, Bayman & Otero (2006)
have deined this genus and its telomorphs as a most
interesting group of the orchids endophytes due to
its hability to stimulate the seed germination of C.
reginae.
Other found endophytes in C. irapeanum were
Cylindrocarpum and Gliocladium. Cylindrocarpon
sp. 4/97.1 was reported as an endophyte of roots of
terrestrial orchids and mycoheterotrophic orchids
(Bayman & Otero, 2006). Gliocladium catenulatum is
well known as a biological control agent (PaavanenHuhtala et al., 2004) and parasite of other fungi (Tu &
Vaartaja, 1980) suggesting an important role against
pathogens in the orchid root.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
Bayman, P. & J. Tupac Otero. 2006. In: Microbial Root
Endophytes. B. Shultz, C. Boyle and T. Sieber, Eds.
Springer, Heildeberg, New York. Pp 153-173.
Cribb, P. & M. A. Soto-Arenas. 1993. The genus
Cypripedium in Mexico and Central America. Orquídea
(Mex.) 13:205-214.
Dearnaley, J. D. W. 2007. Further advances in orchid
mycorrhizal research. Mycorrhiza 17: 475-486.
Currah, R. S., A. Smreciu, & S. Hambleton. 1990.
Mycorrhizae and mycorrhizal fungi of boreal species of
Plantanthera and Coeloglossum (Orchidaceae). Canad.
J. Bot. 68: 1171-1181.
Fernando, A. A. & R. S. Currah. 1996. A comparative study
of the effects of the root endophytes Leptodontidium
orchidicola and Phaliocephala fortinii (Fungi
Imperfecti) on the growth of some subalpine plants in
culture. Canad. J. Bot. 74: 1071-1078.
Gardes, M. & T. D. Bruns. 1993. ITS primers with
enhanced speciicity for basidiomycetes-Aplication
to the identiication of mycorrhizae and rusts. Molec.
Ecol. 2:113-118.
Gardes, M. & T. D. Bruns. 1996. Community structure of
ectomycorrhizal fungi in Pinus muricata forest: aboveand below-ground views. Canad. J. Bot. 74: 1572-1573.
Gill, D. E. 1989. Fruiting failure, pollinator ineficiency, and
speciation in orchids. In: D. Otte & J. A. Endler (eds.),
Speciation and its consequences. Sinauer Associates
Sunderland, Massachusetts. Pp. 458-481.
Girlanda, M., S. Ghignone, & A. M. Luppi. 2002. Diversity
of sterile root-associated fungi of two mediterranean
plants. New Phytol. 155: 481-498.
Hadley, G. 1970. Non-speciicity of symbiotic infection in
orchid mycorrhiza. New Phytol. 69: 1015-1023.
Henrion, B. F., F. Le-Tacon & F. Martin. 1992. Rapid
identiication of genetic variation of ectomycorrhizal
fungi by ampliication of ribosomal RNA genes. New
Phytol. 122: 289-298.
Jumpponen, A. 1999. Spatial distribution of discrete RAPD
phenotypes of a root endophytic fungus, Phialocephala
fortinii, at a primary successional site on a glacier
forefront. New Phytol. 141: 333-344.
ValDés et al. — Root colonizing fungi of Cypripedium irapeanum
Jumpponen, A. 2001. Dark septate endophytes – are they
mycorrhizal? Mycorrhiza 11: 207-211.
Jumpponen, A. & J. M. Trappe. 1998. Dark Septate
Endophytes: A review of facultative biotrophic rootcolonizing fungi. New Phytol. 140: 295-310.
Knudson, L. 1946. A new nutrient solution for the
germination of orchid seed. Amer. Orch. Soc. Bull. 214217.
Molina, R. & J. G. Palmer. 1982. Isolation, maintenance
and pure culture manipulation of ectomycorrhizal fungi.
In: Schenck N.C. (ed.), Methods and principles of
mycorrhizal research. Amer. Phytopathol. Soc., St. Paul
Minnesota. Pp. 115-129.
Moncalvo, J-M., R. H. Nilsson, B. Koster, S. M. Dunham, T.
Bernauer, P. B. Matheny, T. M. Torner, S. Margaritescu,
M. Weiß, E. Danell, G. Langer, E. Langer & K-H.
Larsson. 2006. The cantharelloid clade: dealing with
incongruent gene trees and phylogenetic reconstruction
methods. Mycologia 98:937-948.
Ortega-Larrocea, M. P. & M. Rangel-Villafranco. 2007.
Fungus assisted reintroduction and longtem survival of
two Mexican terrestrial orchids in the natural hábitat.
Lankesteriana 7: 317-321.
Paavanen-Huhtala, S., H. Avikainen& T. Yli-Mattil. 2004.
Development of strain-speciic primers for a strain of
Gliocadium catenulatum used in biological control. Eur.
J. Pl. Pathol. 105: 187-198.
Phillips, J. M. & D. S. Hayman. 1970. Improvement
procedures for clearing and staining parasitic and
vesicular-arbuscular mycorrhizal fungi for rapid
assessment of infection. Trans. Brit. Mycol. Soc. 55:
158-161.
Rasmussen, H. N. 1995. Terrestrial Orchids: From Seed
to Mycotrophic Plant. Cambridge University Press,
Cambridge, UK.
seMarnaT. 1995. Gaceta Ecológica 7: 1-72.
Shan, X. C., E. C. Y. Liew, M. A. Weatherhead & I. J.
Hodgkiss. 2002. Characterization and taxonomic
placement of Rhizoctonia-like endophytes from orchid
roots. Mycol. 94:230-239.
Sharma, J., L. W. Zettler & J. W. van Sambeek. 2003.
21
A survey of mycobionts of federally threatened
Platanthera praeclara (Orchidaceae). Symbiosis 34:
145-155.
Shefferson, R. P., M. Weiß, T.I.I.U. Kull & D. Lee
Taylor. 2005. High speciicity generally characterizes
mycorrhizal association in rare lady’s slipper orchids,
genus Cypripedium. Molecul. Ecol. 14: 613-626.
Shimura, H., M. Sadamoto, M. Matsuura, T. Kawahara,
S. Naito & Y. Koda. 2009. Characterization of
mycorrhizal fungi isolated from the threatened
Cypripedium macranthos in a northen island of Japan:
two phylogenetically distinct fungi associated with the
orchid. Mycorrhiza 19:525-534.
Smith, S. E. & D. J. Read. 1997. Mycorrhizal Symbiosis.
Academic Press. Pp. 347-357.
Smith, M. E., G. W. Douhan & D. M. Rizzo. 2007.
Intra-speciic and intra-sporocarp ITS variation of
ectomycorrhizal fungi as assessed by rDNA sequencing
of sporocarps and pooled ectomycorrhizal roots from
Quercus woodland. Mycorrhiza 18:15-22.
Suárez, J. P., M. Weiss, A. Abele, S. Garnica, F. Oberwinkler,
& I. Kottke. 2006. Diverse tullasnelloid fungi form
mycorrhizas with epiphytic orchids in an Andean cloud
forest. Mycol. Res. 110: 1257-1270.
Schulz, B. & C. Boyle. 2005. The endophytic continuum.
Mycol. Res. 109:661-687.
Thompson, J. D., D. G. Higgins & T. J. Gibson. 1994.
CLUSTAL W: improving the sensitivity of progressive
multiple sequence alignment through sequence
weighting, positions-speciic gap penalties and weight
matrix choice. Nucleic Acids Res 22: 4673-4680
doi:10.1093/NAR/22.22.4673.
Tu, J. C. & O. Vaartaja. 1980. The effect of the hyperparasite
Gliocadium virens on a Rhizoctonia root rot of white
beans. Canad. J. Bot. 59: 22-27.
Valdés, M., A. Espinosa & C. Trejo. 2005. Pichohuastle:
orquídea nativa mexicana en peligro de extinción.
Conversus (Instituto Politécnico Nacional) 38: 30-33.
Warcup, J. H. 1971. Speciicity of mycorrhizal association
in some Australian terrestrial orchids. New Phytol. 70:
41-46.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
LANKESTERIANA
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
LANKESTERIANA 11(1): 23—32. 2011.
POPulATiON STruCTurE Of OnCIdIUM pOIkIlOsTAlIx
(OrChidACEAE), iN COffEE PlANTATiONS iN SOCONuSCO,
ChiAPAS, MéxiCO
alfreDo garCía-gonzález1,4, anne DaMon2, ligia g. esparza olguín3
& jaVier Valle-Mora2
Centro de Investigaciones y Servicios Ambientales (ECOVIDA). Carretera a Luis Lazo, km 2.5,
Pinar del Río, Cuba.
2
El Colegio de la Frontera Sur (ECOSUR). Apartado Postal 36, Carretera Antiguo Aeropuerto, km 2.5,
Tapachula, Chiapas, México.
3
El Colegio de la Frontera Sur (ECOSUR). Calle 10 X 61 No. 264, Colonia Centro, Campeche, México.
4
Author for correspondence: alfredmx22@gmail.com
1
aBsTraCT. We studied the population structure of Oncidium poikilostalix (Kraenzl.) M.W. Chase & N.H. Williams
(Orchidaceae) newly reported for México in 2008 in the region of Soconusco (Chiapas state) in southeast Mexico,
growing in shaded coffee plantations in two rural communities, Fracción Montecristo (FM) and Benito Juárez
El Plan (BJ). In 2008-2009, we determined the characteristics of these coffee plantations, and the distribution of
the various life stages (seedling, juvenile, adult) on the two phorophytes: coffee bushes (Coffea arabica L.) and
shade trees (Inga micheliana Harms.). Principal Component Analysis and Discrimination Analysis were used
to compare all the variables evaluated. There were 1123 individuals (82.63%) in FM and 236 (17.37%) in BJ.
Of those, in FM 1060 individuals (94.4%) were epiphytic upon coffee bushes and 214 (91.06%) in BJ, the rest
were epiphytic upon the shade trees (I. micheliana). Despite displaying the characteristics of a twig epiphyte, the
preferred microsites of O. poikilostalix were the branches of the coffee bushes, with 703 individuals (55.18%)
and the trunk of the shade trees, with 78 individuals (91.76%). More than a third of the population was juvenile
stage (37.09%; 504 individuals). Oncidium poikilostalix probably entered México from Guatemala and appears
to be a vigorous plant that is successfully adapting to its new sites of occupancy
resuMen. Se estudió la estructura poblacional de la orquídea epíita Oncidium poikilostalix (Kraenzl.) M.W.
Chase & N.H. Williams (Orchidaceae), nuevo reporte para México en 2008, en la región del Soconusco,
Estado de Chiapas, al sureste del país. Crece en plantaciones de café de sombra en dos comunidades rurales,
Fracción Montecristo (FM) y Benito Juárez El Plan (BJ). En 2008-2009, se determinaron las características de
estas plantaciones de café, y la distribución de los distintos estadíos de vida (plántulas, juveniles, adultos) de
esta orquídea, en los dos foroitos encontrados: plantas de café (Coffea arabica L.) y árboles de sombra (Inga
micheliana Harms.). Se utilizó Análisis de Componentes Principales y Análisis Discriminante, para comparar
todas las variables evaluadas. Hubo 1.123 individuos (82,63%) de O. poikilostalix en FM y 236 (17,37%) en
BJ. De ellos, creciendo sobre cafetos, 1.060 individuos (94,4%) en FM y 214 (91,06%) en BJ, el resto ocupando
árboles de sombra (I. micheliana). A pesar de mostrar las características de una epíita de ramilla, el mayor número
de ejemplares de O. poikilostalix se contabilizó en los cafetos, en el micrositio ramas, con 703 individuos (55,18%)
y en el tronco, en los árboles de sombra, con 78 individuos (91,76%). Más de un tercio de la población fueron
individuos juveniles (504 individuos, 37,09%). Oncidium poikilostalix probablemente entró a México desde
Guatemala y parece ser una planta vigorosa, que se está adaptando con éxito a sus nuevos sitios de ocupación.
keyWorDs / palaBras
cafeto.
ClaVe:
Oncidium poikilostalix, micrositio, estadíos de vida, foroito, árbol de sombra,
introduction. Mexico, with its diversity of ecosystems,
is an orchid rich country with 1150 species currently
registered (Espejo et al. 2004), expected to rise to 1300
- 1400 species (Hágsater et al. 2005). Many orchid
species are conined to rather precise habitat and
climatic parameters, their reproduction is notoriously
slow and scarce (Ávila & Oyama 2002; Hágsater et
al. 2005), and very little is known about most species.
24
LANKESTERIANA
The Soconusco region in the state of Chiapas, in
south-east Mexico bordering with Guatemala, covers an
area of 5475 km² which includes coastal plains and part
of the Sierra Madre mountain range with tropical and
temperate forest ecosystems (Sánchez & Jarquín 2004).
Within that scenario a relatively high number of more
than 280 orchid species have been reported for the region
(Damon, 2011), including various endemic species.
An expanding human population, extending
subsistence and commercial agriculture, forest ires
and severe tropical storms have contributed to the
destruction and fragmentation of natural forests
(INEGI 1999; CNA & CMDI 2000; Tovilla 2004),
and combined with the unsustainable and illegal
exploitation of orchids have led to the rapid decline
of orchid numbers and biodiversity, and the near
extinction of the most vulnerable species, as has
happened in many other parts of the world.
In Soconusco, most of the cloud forest, which is
the most orchid rich ecosystem on the planet (60% of
Mexico’s orchid lora. Hágsater et al. 2005), has been
transformed into coffee plantations. At irst coffee was
planted under the shade of original forest trees heavily
populated by epiphytes, thus maintaining a high
proportion of the original biodiversity (Hágsater et al.
2005). Today, many of those traditional plantations
have been converted to improved varieties of coffee
with monospeciic shade, and some to full sun coffee.
At least 213 orchid species (18.52% of Mexican total)
can be found growing within coffee plantations (Espejo
et al. 2004).
Oncidium poikilostalix (Kraenzl.) M.W. Chase
& N.H. Williams was reported in 2008 as a new
species for Mexico, with small populations in coffee
plantations in two localities in Soconusco, Fracción
Montecristo (FM) (latitude 15° 5’ 31.5”; longitude
92° 9’ 57.9”) and Benito Juárez El Plan (BJ) (latitude
15° 5’ 15.4”; longitude 92° 8’ 54.7”), both within the
municipality of Cacahoatán (Solano et al. in press),
having been previously reported in Guatemala and
Costa Rica as Sigmatostalix costaricensis Rolfe (Behar
& Tinschert 1998) and as Sigmatostalix picta Lindl.
for Nicaragua and South America (Atwood & Mora
de Retana 1999). The colonization of new areas by
O. poikilostalix demonstrates the importance of the
Biological Corridor Boquerón-Tacaná, which connects
both nations and forms part of the Mesoamerican
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
Biological Corridor (CCAD-PNUD/GEF 2002).
In this study we describe the population structure
of O. poikilostalix, comment upon its reproductive
behaviour as observed in 2008-9, and analyse the
relationship with the phorophytes and microsites
available in two shaded coffee plantations in
Soconusco, Chiapas, as an exceptional opportunity
to study the characteristics of an orchid extending
its distribution in these times of climate change and
biodiversity loss.
Materials and Methods
Characterization of the sites — We studied the coffee
plantations where O. poikilostalix grows to describe
the density of the coffee bushes, diversity and density
of the shade trees and the management regimes applied
to the coffee.
Sampling unit — Having analysed the distribution of
O. poikilostalix in FM and BJ we set up three plots,
or sampling units, measuring 625 m² (25 x 25 m;
0.0625 ha) in each coffee plantation, FM (plots 1,
2 and 3) and BJ (plots 4, 5 and 6). These plots are
highly representative of the populations as a whole
and contained the majority of individuals of the orchid
present in these sites at the time of the study.
Determination and characterization of the
phorophytes, Density, Height Above Ground (HAG)
and Diameter at Breast Height (DBH) — In this study,
the term phorophyte is only used for coffee bushes
and shade trees that had one or more individuals of
O. poikilostalix growing on them at the time of the
study. We determined which species were used as
phorophytes by O. poikilostalix within the study sites,
counted the numbers of individuals and determined the
density of each phorophyte.
The HAG of the phorophytes (coffee bushes and
shade trees) was measured with a 4m straight ruler
graduated with 50cm intervals and the DBH was
determined using a metric tape.
Microsites — Guided by the vertical zonation
proposed by Johansson (1974), we developed a
version speciically for the coffee bushes and shade
trees in this study, to describe the different microsites,
or ecological units, available for colonization by
epiphytes, as follows:
garCía-gonzález et al. — Population structure of Oncidium poikilostalix
25
figure 1. Microsites and vertical zonation of the coffee
plants: 1) Trunk, 2) Fork, 3) Branches, 4) Twigs.
Microsites for coffee bushes (Fig. 1):
Zone 1 – Trunk (Tr): From the base of the bush to
the irst primary branches.
Zone 2 – Fork (F): Intersection between branches
at various heights.
Zone 3 – Branches (B): Thick branches with
diameter > 3 cm.
Zona 4 – Twigs (Tw): Thinner, outer branches,
with a diameter < 3 cm.
Microsites for shade trees (Fig. 2):
Zone 1 – Trunk (Tr): From the base of the tree to
the irst primary branches.
Zone 2 – Fork (F): Intersection between branches
at various heights.
Zone 3 – Branches (B): Thick branches with
diameter > 3 cm.
Due to pruning there was no zone 4 for trees. For
each coffee bush and tree the length of Zone 1 and total
length of Zone 3 were measured and numbers of Zone
2 were counted. It was not possible to quantify Zone 4
for the coffee bushes.
Life stages of O. poikilostalix — The plants of O.
poikilostalix were classiied using the following
categories:
Seedling (S): Earliest stage after the protocorm
in which the young plant irst acquires
differentiated structures (2 mm to 2 cm).
figure 2. Microsites and vertical zonation of the shade trees
(Inga micheliana): 1) Trunk, 2) Fork, 3) Branches.
Juvenile (J): Sexually immature but well developed
plant (> 2 cm).
Adult (A): Sexually mature plants that have
lowered at least once.
Sampling — We counted all the individuals of each life
stage on each of the microsites of every phorophyte
within the study sites.
Statistical Analysis — We used the programmes SAS
(Version 5.1.2600) and Minitab (Version 15.1.30.0) to
analyse the data, which included Analysis of Variance
(ANOVA), the Kruskal-Wallis test and the Goodness
of Fit of Chi-squared test. Combining all the variables
measured (plot, phorophyte, HAG, DBH, microsite, life
stage, number of microsites available) we carried out
a Principal Component Analysis and Discrimination
Analysis, corroborated by Pillai’s Trace test and the
Mahalanobis test, to derive the population structure
and preferences of the orchid O. poikilostalix.
results
Characterization of the sites — The coffee plantations
FM and BJ consist of arabica coffee bushes (Coffea
arabica L. Rubiaceae) and monospeciic shade trees
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
26
LANKESTERIANA
TaBle 1. Colonization of phorophytes, coffee, and shade
trees (Inga micheliana) per year of study, in Fracción
Montecristo (FM) and Benito Juárez (BJ).
(“Chalum”; Inga micheliana Harms.: Mimosaceae)
as well as occasional species of native, fruit or timber
trees which also serve to shade the coffee bushes,
such as Cedrela mexicana Roem. (Meliaceae), Citrus
sp. (Rutaceae) and Nectandra sp. (Lauraceae) in FM
and Inga lauriana (Sw.) Willd. (Fabaceae), Citrus
sp., Trema micrantha (L.) Blume (Ulmaceae) and
Vernonia deppeana Less. (Asteraceae), in BJ. Both
plantations can be considered as simple polycultures
(sensu Williams-Linera & López-Gómez, 2008, for
coffee plantations in the Mexican state of Veracruz).
The plantations of FM and BJ are approximately 15
and 20 years old and are situated at an average altitude
of 1410 m and 1440 m, respectively.
In both FM and BJ no agrochemicals are applied,
and management is limited to manually eliminating
weeds with a machete twice a year, and the pruning
of shade trees and coffee bushes once a year. Most
importantly, unlike in most plantations in the region,
these farmers do not eliminate the moss, and with it the
epiphytes, that grow on the branches and trunks of the
coffee bushes.
Determination of the phorophytes — Most of the
trees were I. micheliana and this was the only tree
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
species that acted as a phorophyte. The coffee bushes
themselves were also phorophytes.
As shown in Table 1, not all the coffee bushes
and shade trees were colonized by O. poikilostalix.
The Chi-squared test showed a signiicant difference
between the colonization of the two phorophytes,
with an apparent preference for coffee bushes in
2008 (χ²= 123.662; d.f.= 1; P= 9.98887e-29), which
was maintained in 2009 (χ²= 127.954; d.f.= 1; P=
1.14875e-29). In 2009, 23 O. poikilostalix were lost
due to maintenance activities, thus reducing also the
number of trees determined as phorophytes. “Chalum”
(I. micheliana) was the only tree species to act as a
phorophyte (58 individuals, 79.45% of all trees. 27
FM; 31 BJ) and population sizes of O. poikilostalix
were notably different between sites and phorophytes
(Table 7).
Density of coffee bushes and shade trees — Within
the experimental plots, in FM there were 459 coffee
bushes and 35 shade trees, whereas in BJ there were
410 coffee bushes and 38 shade trees. The density of
coffee bushes was 2448 and 2187 coffee bushes/ha in
FM and BJ, respectively, whereas shade tree density
was more variable, at 187 and 203 trees/ha for FM and
BJ, respectively.
Height Above Ground (HAG) and Diameter at Breast
Height (DBH )of the phorophytes — There were
signiicant differences between the heights of the
coffee bushes in the three plots of FM (Fc= 5.51; d.f.=
5; P= 5.3e-05), but not for the shade trees (Fc= 1.21;
d.f. = 5; P= 0.315) (Table 2). For DBH (Table 2), the
Kruskal-Wallis test showed signiicant differences
between coffee bushes (χ²= 13.73; d.f.= 5; P= 0.017),
but not for shade trees (Fc= 2.04; d.f. = 5; P= 0.084),
evaluating with ANOVA. Some coffee bushes were not
included due to measuring less than 1.30 m in height.
TaBle 2. Height Above Ground (HAG) (m) and Diameter at
Breast Height (DBH) (cm) averages for the phorophytes,
coffee bushes and shade trees, in Fracción Montecristo
(FM) and Benito Juárez (BJ).
garCía-gonzález et al. — Population structure of Oncidium poikilostalix
27
TaBle 3. General average dimensions (m) of the trunk
microsites (Zone 1) and branches (Zone 3) and average
number of forks (Zone 2) for the phorophytes, coffee
bushes and shade trees, in Fracción Montecristo (FM)
and Benito Juárez (BJ).
Availability of Microsites — As was expected, the total
length of the branches (Zone 2) of the coffee bushes
and the length of the trunks (Zone 1) of the trees were
greater than the other microsites of these phorophytes
(Table 3). The forks between branches could be found
at different heights above the ground.
Number of orchids per microsite — The majority
of individuals of O. poikilostalix occupied Zone 3,
the branches, in the case of the coffee bushes (703
individuals) and Zone 1, the trunk, of the shade
trees (78 individuals). Plot 1 (FM) had the greatest
population (762 individuals), with the highest numbers
of individuals in each microsite [Zone 1, 148; Zone
2 (coffee bushes only), 2; Zone 3, 383; Zone 4
(coffee bushes only) 229] and there was a signiicant
difference between Plot 1 as compared to Plots 2 and 3
(χ²= 44.23; d.f.= 2; P= 2.48644e-10) (Fig. 3). For BJ,
the number of orchid individuals on the coffee plants
differed signiicantly between all three plots (χ²= 7.43;
d.f.= 2; P= 0.024) (Fig. 4).
Shade trees were less favoured as phorophytes than
coffee bushes, and no orchids were found growing in
Zone 2, the forks of the trees. However, one specimen
of I. micheliana had 52 individuals, 46 on Zone 1, and
6 on Zone 3.
Principal Component Analysis — Comparing all the
variables for both types of phorophyte (plot, height
above ground, DBH, number of orchid individuals on
each microsite, number available of each microsite) we
determined whether there were differences between
the experimental plots.
For coffee bushes in FM, there was a signiicant
figure 3. Scatter Plot produced by Principal Component
Analysis, for coffee bushes in Fracción Montecristo
(FM). Variables included: Height Above Ground
(HAG), Diameter at Breast Height (DBH), number of
orchid individuals on each microsite, number available
of each microsite.
figure 4. Scatter Plot produced by Principal Component
Analysis, for coffee bushes in Benito Juárez El Plan (BJ).
Variables included: Height Above Ground (HAG), Diameter
at Breast Height (DBH), number of orchid individuals on
each microsite, number available of each microsite.
difference between Plot 1 and Plots 2 and 3, (Table 3)
corroborated by the Mahalanobis test (Table 4). In BJ,
there were signiicant differences between all the plots
(Fig. 4), conirmed by the Mahalanobis test (Table 5).
In the case of the shade trees in FM, Plot 2
was signiicantly different to Plots 1 and 3 (Fig. 5)
corroborated by the Mahalanobis test (Table 6). In
BJ, the apparent signiicant difference between Plot 3
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
28
LANKESTERIANA
TaBle 4. Mahalanobis test in Discriminant Analysis for
shade tree phorophytes in Fracción Montecristo.
TaBle 5. Mahalanobis test in Discriminant Analysis for
coffee plant phorophytes in Benito Juárez.
TaBle 6. Mahalanobis test in Discriminant Analysis for
shade tree phorophytes, Fracción Montecristo.
very few were found on Zone 2 (4). Plot 1 had the most
individuals and the greatest number of all life stages
growing on all the microsites.
discussion
and Plots 1 and 2 was shown to be non-existent by the
application of Pillai’s Trace test (Fig. 6).
Number of individuals of life stages — For the shade
trees, in FM, the distribution of the three life stages
was: S - 35, J - 7, A - 21. In BJ there were no seedlings
observed on the shade trees, J - 10, A - 12. For coffee
bushes in FM: S - 344, J - 399, A - 317; BJ: S - 63, J 88, A - 63. The majority of individuals of all life stages
were found growing on Zone 3 (703 individuals) and
figure 5. Scatter Plot produced by Principal Component
Analysis, for shade trees in Fracción Montecristo (FM).
Variables included: Height Above Ground (HAG),
Diameter at Breast Height (DBH), number of orchid
individuals on each microsite, number available of each
microsite.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
Height, DBH y density of present and potential
phorophytes. Its inluence on the ecosystem — The
density and architecture of present and potential
phorophytes, linked to the HAG and DBH of the trees
and coffee bushes, create variations in the conditions
of temperature and humidity which in turn affect the
germination and establishment of epiphytes (Benzing
1990). In the case of the forks between branches, the
levels of humidity and amount of humus accumulated,
which are favourable for the establishment of many
epiphytes, depend upon the size and position of
the fork in relation to sources of organic matter and
moisture. The combination of these aspects can have
a substantial effect upon the penetration of light, air
figure 6. Scatter Plot of Principal Component Analysis,
for shade trees in Benito Juárez El Plan (BJ). Variables
included: Height Above Ground (HAG), Diameter at
Breast Height (DBH), number of orchid individuals on
each microsite, number available of each microsite.
garCía-gonzález et al. — Population structure of Oncidium poikilostalix
29
TaBle 7. Oncidium poikilostalix: number of individuals per microsite, life stage and type of phorophyte in 2008, for Fracción
Montecristo (FM) and Benito Juárez (BJ).
circulation and the surface available for establishment
of epiphytes. Those same variables will also affect the
abundance and diversity of bacteria and mycorrhizal
fungi, the availability of pollinators and the abundance
of herbivores and their natural enemies.
The density of coffee bushes was 2448 and 2187
coffee bushes/ha in FM and BJ, respectively, which
compares to a density of approximately 2000 bushes/
ha in traditional coffee plantations in Colombia,
contrasting with intensive plantations in that country
which may have up to 10,000 bushes/ha of dwarf, high
yielding varieties (Gallego 2005). Shade tree density
was more variable, at 187 and 203 trees/ha for FM
and BJ, respectively. These densities are similar to the
density of shade trees in coffee plantations in Veracruz,
which range from 193 - 220 trees/ha, but which are
taller than the trees in our study, possibly due to less
aggressive pruning. However, the density of trees in the
original cloud forest is approximately 638 trees/ha, with
a maximum height of approximately 22m (WilliamsLinera & López-Gómez 2008), and O. poikilostalix may
be better adapted to the environmental conditions, and
for attracting pollinators and dispersing seeds within
this denser vegetation of the original cloud forest.
Number of orchids per type of phorophyte and per
microsite — Vascular epiphytes tend to display patterns
of vertical distribution on their phorophytes that relect
their range of tolerance for light and humidity and
other ecophysiological adaptions (Johansson 1974;
Krömer et al. 2007). A study carried out in humid
tropical forests in Alto Orinoco in Venezuela suggests
that forks represent an extremely important microsite
for many epiphytic species of plants, whereas other
species clearly favour vertical substrates (HernándezRosas 2000). In forks, retention of both humidity and
organic matter are greater than for vertical substrates, as
water drains away very quickly on vertical substrates,
carrying with it organic matter and dissolved nutrients.
In this study, the percentage colonization of both
phorophytes was similar, 13.79% of shade trees and
16.8% of coffee bushes, and the higher numbers of O.
poikilostalix on coffee bushes could simply be due to
the presence of more than 10 times more coffee bushes
(869) than shade trees (73) in the experimental plots.
Oncidium poikilostalix has a relatively high
pollination rate and each capsule contains thousands
of seeds (García-González 2009, unpublished
data) which are carried by multidirectional
breeze and thermal currents, the similarity of the
percent colonization, despite the great difference
in the quantities of potential phorophytes in the
experimental plots, suggest that only this small, and
constant fraction of phorophyte populations have the
necessary microorganisms and /or environmental
conditions to permit the establishment of colonies of
O. poikilostalix and that it is a minority case.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
30
LANKESTERIANA
From a numerical point of view 1273 out of a
total of 1358 (93.74%) individuals of O. poikilostalix
were found growing on coffee bushes indicating
that they offer adequate conditions for germination
and development, and conditions that are probably
similar to the original substrate preferences of this
orchid. This is interesting as Coffea arabica is an
introduced species, with just over one century in the
Soconusco region (Baxter 1997; ICO 2009) and has
effectively creating a new habitat or opportunity. In
tropical forests the canopy is closed, there is little
vegetation on the forest loor and even twig epiphytes
growing on the outer extremes of the branches are
not exposed to full sun or extreme dryness. In coffee
plantations the canopy is more open, shade trees
are widely spaced and light penetrates down to the
coffee bushes. We have no information concerning
the type of phorophytes and microsites colonized by
O. poikilostalix in natural habitats, but obviously the
branches of coffee bushes, followed by the trunks
of coffee bushes and shade trees are the conditions
that most clearly fulil the requirements and mimic
the natural habit of O. poikilostalix. In the case of
shade trees, the trunk is maybe too thick, too dark,
and maybe even too constantly damp, whereas
the pruned branches are maybe too exposed in this
more open type of vegetation cover. The trees are
regularly pruned, to increase the light reaching the
coffee plants, and the profusion of thinner branches is
eliminated and with it any orchids attached to them.
The long ibrous roots capable of wrapping round
thin branches and the size of O. poikilostalix indicate
twig epiitism but in this study this species was shown
to prefer thicker branches and to be able to establish
on trunks, but this may be an artefact of management
practices carried out within coffee plantations wherein
thinner branch growth is annually pruned out, both
in shade trees and coffee bushes. The branches
represent an intermediate microsite, in terms of light
intensity, air currents, bark texture, available surface
area, thickness, and in the absence of stable twig
microsites, may offer the next best option and fall
within the natural range of tolerance of this orchid.
Twig epiphytes tend to mature relatively rapidly
but have shorter lifecycles than most orchid species
that may be a relection of their risky and ephemeral
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
habitat (Gravendeel et al. 2004; Hágsater et al. 2005;
Mondragón et al. 2007). Various species of small twig
epiphytes colonize the thinnest branches of coffee
bushes in Soconusco region, especially Erycina
crista galli (Rchb.f.) N.H.Williams & M.W.Chase,
Leochilus labiatus (Sw.) Kuntze, L. oncidioides
Knowles & Westc., L. scriptus (Sw.) Rchb.f., Notylia
barkeri Lindl., and Ornithocephalus tripterus Schltr.
(Damon 2009, unpublished data), and all are even
smaller than O. pokilostalix, which may explain why
this orchid appears to fall outside of the twig epiphyte
category.
Differences between Plots and number of individuals
of life stages — We found signiicant differences
between the coffee bushes and the shade trees,
affecting all the variables monitored, but mainly due
to the great difference in the number of plants of
each category. All life stages of O. poikilostalix were
found on the trunk of the shade trees (Table 7). In FM,
with the largest and most established population of
O. poikilostalix, our data for the number of seedlings
and numbers of adult plants indicate low survival
rates on Zone 1, the trunk (Table 7). The trunks of
the trees will receive orchid seeds falling from above
and the high humidity possible favours the presence
of mycorrhizal fungi which facilitate the germination
of the seeds. However, later on, development of the
young plant may be hindered by low light levels,
reduced air circulation and, during the rainy season,
humidity may reach intolerable levels complicated by
mud splashed from the ground. In BJ the behaviour
of the orchid appeared to be different, with far greater
levels of survival on the trunks, but the population is
still too small to draw conclusions.
On the branch microsite, in both FM and BJ,
where a greater number of individuals were found
from all three life stages, recruitment of seedlings
was relatively lower, although survival rates were
higher in most of the Plots (Table 7). After Zone 3,
the next most occupied microsite was the twigs, Zone
4 (Table 7), although in Plots 3 and 5 no individual
were observed on this microsite. Plot 3 had a slightly
greater density of coffee bushes implying less light
reaching the coffee twigs, but Plot 5 was no different,
making it dificult to explain this difference. The
garCía-gonzález et al. — Population structure of Oncidium poikilostalix
relative abundance on this microsite agrees with the
size and physical characteristics of O. poikilostalix,
but levels of survival were not high, as few adult
plants were observed in comparison with the numbers
of seedlings and juveniles, although this could simply
be due to the rough handling and breakage of twigs
during the harvest, and partial removal of twigs
during annual pruning.
In the case of shade trees the low numbers of
individuals of O. poikilostalix (Table 7) prevented an
adequate analysis of the distribution of individuals of
the three life stages.
Oncidium poikilostalix is an orchid that appears
to be well adapted to the conditions in the coffee
agroecosytems of southeast Mexico, colonizing
most of the available microsites on both shade trees
and coffee bushes, although we have no means of
comparing our data with populations inhabiting the
original, natural habitat of this plant. Despite our
observation that a small proportion of individuals
of O. poikilostalix were lost due to management
practices in 2009, the majority of the coffee
plantations in Soconusco region are administered by
small producers, which for cultural and economic
reasons carry out the bare minimum of maintenance
procedures, which favours stability and the persistence
of epiphytes. Under these conditions, O. poikilostalix
is slowly expanding its distribution and may threaten
the smaller populations of the similar Sigmatostalix
guatemalensis (awaiting veriication of its new name
within Oncidium. Rodolfo Solano-Gómez, personal
communication), which is a protected plant in Mexico
and established in small numbers within the coffee
plantations FM and BJ.
aCknoWleDgeMenTs. This study formed part of the
Project: “Diversity and conservation of the orchids of the
Biological Corridor Tacana-Boqueron”, and we are grateful
to the National Council for Science and Technology
(CONACYT-FONDOS MIXTOS-CHIAPAS, CHIS–2006–
206–45802) for funding. We thank the coffee producers of
the communities Fracción Montecristo and Benito Juárez El
Plan, for permitting us access to their plantations to carry
out the ield work for this study.
31
liTeraTure CiTeD
Atwood, J.T. & D.E. Mora de Retana. 1999. Family
# 39 Orchidaceae: Tribe Maxillarieae: subtribes
Maxillariinae and Oncidiinae. Fieldiana, Bot. 40 (1-4):
1-82.
Ávila, I. & K. Oyama. 2002. Manejo sustentable de
Laelia
speciosa
(Orchidaceae).
Biodiversitas
(Boletín Bimestral de la Comisión Nacional para el
Conocimiento y Uso de la Biodiversidad) 7 (43): 9-12.
Baxter, J. 1997. El libro del café. Susaeta Ediciones, Madrid.
Behar, M. & O. Tinschert. 1998. Guatemala y sus orquídeas.
Bancafé, Guatemala.
Benzing, D.H. 1990. Vascular Epiphytes. Cambridge
University Press, New York.
CCAD-PNUD/GEF. 2002. El Corredor Biológico
Mesoamericano,
México.
Proyecto
Para
la
Consolidación del Corredor Biológico Mesoamericano.
Serie Técnica 05. [Internet page] [cited on 20 december
2009]. Available at URL: http:www.ccad.ws/pccbm/
docs/cbmmexico.pdf
CNA & CMDI (Comisión Nacional del Agua y Centro
para la Migración y el Desarrollo Internacional). 2000.
Plan de conservación de suelos y agua para la costa de
Chiapas, México.
Damon, A. 2011. Diversidad y conservación de las
orquídeas del corredor biológico Tacaná-Boquerón.
Final report of project. FONDOS MIXTOS-CHIAPAS:
CHIS-2006-C06-45802. 2007-2010.
Espejo, A., A.R. López-Ferrari; R. Jiménez & L. Sánchez.
2004. Las orquídeas de los cafetales en México: una
opción para el uso sostenible de ecosistemas tropicales.
Rev. Biol. Trop. 53 (1-2): 73-84.
Gallego, M.C. 2005. Intensidad de manejo del agroecositema
del café (Coffea arabica L.) (monocultivo y policultivo)
y riqueza de especies de hormigas generalistas. Boletín
del Museo de Entomología de la Universidad del Valle
6 (2): 16-29.
Gravendeel, B., A. Smithson, F.J.W. Slik & A. Schuiteman.
2004. Epiphytism and pollinator specialization: drivers
for orchid diversity?. Phil. Trans. R. Soc. Lond. B. 359:
1523-1535.
Hágsater, E.; M. Soto; G. Salazar; R. Jiménez; M. López &
R. Dressler. 2005. Las Orquídeas de México. Productos
Farmacéuticos, S.A. of C.V, México.
Hernández-Rosas, J.I. 2000. Patrones de distribución de las
epíitas vasculares y arquitectura de los foroitos de un
bosque húmedo tropical del Alto Orinoco, Estado de
Amazonas, Venezuela. Acta Biológica Venezuelica 20
(3): 43-60.
ICO (International Coffee Organization). 2009. Historical
data. [Internet page] [cited on 22 october 2009].
Available at URL: http:www.ico.org/historical.asp
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
32
LANKESTERIANA
INEGI (Instituto Nacional de Estadística, Geografía e
Informática). 1999. El crecimiento de la población y
sus repercusiones sobre el medio ambiente de México.
Anuario Estadístico, México.
Johansson, D. 1974. Ecology of vascular epiphytes in West
African Rain Forest. Acta Phytogeogr. Suecica 59:1-129.
Krömer, T.; M. Kessler & S.R. Gradstein. 2007. Vertical
stratiication of vascular epiphytes in submontane and
montane forest of the Bolivian Andes: the importance
of the understory. Plant Ecol. 189: 261-278.
Mondragón, D.; C. Maldonado & R. Aguilar-Santelises.
2007. Life history and demography of a twig epiphyte:
a case study of Erycina crista-galli (Orchidaceae).
Selbyana 28 (2): 137-144.
Sánchez, J.E. & R. Jarquín (ed.). 2004. La Frontera Sur.
Relexiones sobre el Soconusco, Chiapas, y sus
problemas ambientales, poblacionales y productivos.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
CD. ECOSUR.
Solano, R., Jiménez-Machorro, R. & Damon, A. (in press).
Two new records and one rediscovery for Orchidaceae
of Mexico. Acta Botánica Mexicana.
Tovilla, C. 2004. La dimensión de la crisis ambiental en
la costa de Chiapas y la necesidad de un programa de
ordenamiento de las actividades. In: Sánchez, J.E. & R.
Jarquín (ed.). 2004. La Frontera Sur. Relexiones sobre
el Soconusco, Chiapas, y sus problemas ambientales,
poblacionales y productivos. CD. ECOSUR.
Williams-Linera, G. & A. López-Gómez. 2008. Estructura
y diversidad de la vegetación leñosa. In: Manson,
R.H.; V. Hernández-Ortiz; S. Gallina & K. Mehltreter
(ed.). 2008. Agroecosistemas cafetaleros de Veracruz:
biodiversidad, manejo y conservación. Instituto de
Ecología A.C. (INECOL) e Instituto Nacional de
Ecología (INE-SEMARNAT), México, pp. 55-68.
LANKESTERIANA 11(1): 33—38. 2011.
AA frOM lOMAS fOrMATiONS. A NEw OrChidACEAE rECOrd
frOM ThE dESErT COAST Of PEru
Delsy Trujillo1,3 and aMalia DelgaDo roDríguez2
Research Associate, Herbario MOL, Facultad de Ciencias Forestales, Universidad Nacional Agraria
La Molina. Av. La Universidad s/n. La Molina. Apartado 12-056 - Lima, Perú.
2
Laboratorio de Dicotiledóneas. Museo de Historia Natural, Universidad Nacional Mayor de San Marcos.
Av. Arenales 1256. Jesús María - Lima, Perú.
3
Corresponding author: delsytrujillo@gmail.com
1
aBsTraCT. Orchid species of the genus Aa have been described as mostly restricted to high elevations zones in
the Andes and mountains of Costa Rica. Here, we record populations of Aa weddelliana at lower elevations in
lomas formations from the desert coast of Peru; this is the fourth species of Orchidaceae registered in Peruvian
lomas. Furthermore, we illustrate and discuss some loral features of Aa weddelliana.
resuMen. Las especies del género Aa han sido descritas como orquídeas restringidas generalmente a zonas altas
de los Andes y montañas de Costa Rica. Se presenta el registro de poblaciones de Aa weddelliana a elevaciones
más bajas, en formaciones de lomas en la costa desértica del Perú, siendo ésta la cuarta especie de Orchidaceae
registrada para las formaciones de lomas. Asimismo, ilustramos y discutimos algunos aspectos lorísticos de Aa
weddelliana.
keyWorDs / palaBras ClaVe: Orchidaceae, Peru, Lomas formations, Desert, Aa
The western coast of South America between
Peru and Chile (5º-30ºS latitude) is occupied by a
continuous belt of desert of 3500 km long and a surface
area of about 2900 km2. Its aridity is mainly due to the
Humboldt Current and the South Paciic anticyclone
(Rundell et al. 1991). A combination of climate factors
on the coast during winter (June-September) allows
the formation of thick fog masses in the ocean. Fog
comes into the continent and is intercepted by foothills
near the sea, creating ample water for vegetation to
lourish for a period of months. This peculiar habitat
is called lomas formations and is unique in its plant
community (Weberbauer 1945, Oka & Ogawa 1984,
Ferreyra 1993, Dillon et al. 2003). Lomas formations
occur in the desert as “fog oases” or “islands of
vegetation” in disconnected localities along the coast
of Peru and Chile, at elevations that generally do not
exceed the 1000 m. In Peru, it has been identiied in
over 70 localities ranging from Trujillo (8° S latitude)
to Tacna (18º S latitude). These localities are composed
of a variable mixture of annuals, short-lived perennials
and in some cases even woody vegetation (Dillon et
al. 2003). Some years are affected by ENSO (El Niño
Southern Oscillation) events, where the occurrence
of unusual precipitations during summer (DecemberMarch) alters the normal cycle of vegetation, allowing
for the development of vegetation during this period.
The genus Aa Rchb.f. includes terrestrial orchids
with tiny and non-resupinate lowers distributed from
Venezuela to the north of Chile and Argentina with
a disjunct population in Costa Rica. Although some
authors have claimed the distribution of Aa in South
America is restricted to the highest zone of the Andes
(i.e. above 3100 m.a.s.l.; Wood 2003, Álvarez-Molina
& Cameron 2009), there are some populations of Aa at
lower elevations. For instance, Aa achalensis Schltr.
reaches 700 m of elevation in north-central Argentina
(Cucucci 1964).
The revision of the orchid collection at USM and
recent ield work in the Southern Peruvian lomas
reveal the presence of populations of Aa at elevations
between 300 to 1000 m in four lomas formations
from 11°21’ S to 15º 46’S latitude: Lomas de Lachay
National Reserve, Department of Lima; a locality at
south of Nazca, Department of Ica (the exact locality
was not recorded by the collector); and Los Cerrillos
34
LANKESTERIANA
and Lomas de Atiquipa, Department of Arequipa (Fig
1,2). Except for the different size of the lowers – the
larger lowers are from the more southerly lomas
specimens– all the specimens studied correspond to
Aa weddelliana (Rchb.f.) Schltr. (Fig 3,4). Previously,
this species has only been recorded at elevations
between 2700-3800 m in Peru, Bolivia and Argentina
(Schweinfurth 1958, Tropicos.org 2010).
To the best of our knowledge, there are no previous
records of Orchidaceae from the Departments of Ica
and Arequipa. Therefore, A. weddelliana is the irst
record from these departments. Nevertheless, it is not
the only orchid recorded from the Peruvian lomas
formations (Fig 1). Previous authors have identiied
plants of Chloraea pavonii Lindl. in Lomas de
Chancay and Amancaes; and Malaxis andicola (Ridl.)
O. Ktze. in Cerro Cabras (Schweinfurth 1958, 1959,
Correa 1969, Garay & Romero-González 1998).
The revision of herbaria collections also shows the
presence of Pelexia matucanensis (Kraenzl.) Schltr.
in Cerro Campana, Cerro Cabras and Casma (A.Lopez
710, HUT; N. Angulo 765, HUT and Ferreyra 8049,
MOL respectively). Like A. weddelliana, most of the
records of C. pavonii, M. andicola and P. matucanensis
came from the localities of middle to high elevation of
the Andean Cordillera (Bennett & Christenson 1998,
Schweinfurth 1958).
The origin of vascular plant species within lomas
formations have been grouped into 4 categories:
(1) pan-tropical or weedy species, (2) long-distance
disjunctions from the Northern Hemisphere desert, (3)
species disjunct from the adjacent Andean Cordillera,
and (4) plants restricted to the coastal desert (Dillon et
al. 2003, 2009). The origin of orchid species in lomas
formations likely belongs to the third category.
Álvarez-Molina and Cameron (2009) point out
several morphological traits found in plants of Aa
as Myrosmodes Rchb.f. (Aa’s closely related genus
and also considered a high elevation specialist of
the Andes) that allow them to cope with the moist,
freezing, and windy environments of the paramos and
the arid conditions of the puna. Probably, equivalent
traits will also allow A. weddelliana to develop in the
harsh conditions of lomas, especially the luctuations
between arid and humid conditions and strong winds
that come from the sea.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
figure 1. Map including Peruvian lomas formations
localities where Orchidaceae species have been
recorded. Aa weddelliana (triangle), Chloraea
pavonii (circle), Malaxis andicola (asterisk), Pelexia
matucanensis (square).
figure 2. Aa weddelliana in the Lomas de Atiquipa,
Department of Arequipa. A. Panoramic view of Lomas
de Atiquipa during winter. B. Plant of Aa weddelliana.
C. Habitat of Aa weddelliana in Lomas de Atiquipa.
D. Inlorescence of Aa weddelliana. Photographs by
Amalia Delgado.
Trujillo & DelgaDo — Aa from lomas formations
35
figure 3. Aa weddelliana. A. Habit. B. Flower, three views. C. Lip in natural position. D. Dissected perianth. E. Floral bract.
F. Column, three views. Drawing by D. Trujillo based on K. Rahn 198, USM.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
36
LANKESTERIANA
figure 4. Comparison of the lowers of Aa weddelliana. A. Flower from the holotype (G. Mandon 1167, W). B. Flower of a
plant from Lomas de Lachay (A. Cano 710, USM-161164). C. Flower of a plant from Lomas de Atiquipa (R. Ferreyra
14034, USM). a– Flower. b– Floral bract. c– Dissected perianth. d– Column, ventral and dorsal view. Drawing by D.
Trujillo.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
Trujillo & DelgaDo — Aa from lomas formations
Regardless, more ield work and a careful examination
of Aa material from the herbarium collection are
necessary in order to document the real distribution of
A. weddelliana, its ecology, morphological diversity
and adaptations to different environments.
The following description of A. weddelliana was
based on the type material and specimens from the
lomas formations studied in the present work.
Aa weddelliana (rchb.f.) Schltr., Repert. Spec. Nov.
Regni Veg. 11: 150. 1912. Altensteinia weddelliana
Rchb. f.. Xenia Orchidacea 3: 19. 1878.
TYPE: Bolivia, Vicinity Soratta. Paracollo, in
Scritosis. 3400 m. December 1856-January 1857.
Mandon 1167 (holotype: W; isotype: G,K). Fig.
4A.
Plant small, terrestrial herb. Roots fasciculate,
leshy. Leaves (present before lowering) forming a
basal rosette, narrowly oblong, acute to acuminate,
up to 11.0 x 1.7 cm. Inlorescence slender, erect, up
50 cm long, enclosed by 10 to 13 diaphanous sheaths,
terminated in a densely many lowered cylindrical
spike of 4-12 cm long, rachis of the spike sparsely
pilose. Floral bracts ovate, acute to acuminate, margins
slightly erose, relexed, 4-6 x 2.5- 3.0 mm, somewhat
surpassing the lowers. Flowers non-resupinate, white
with pink-brown tones. Dorsal sepal oblong-ovate,
acute, 1-nerved, 1.5-2.5 x 0.8-1.0 mm. Lateral sepals
shortly connate at the base, obliquely oblong, obtuse,
dorsally hairy at the base, apex slightly erose, 1-nerved,
2.5-3.0 x 0.7-1.0 mm. Petals falcate-ligulate, obtuse to
acute, margin variable erose (mostly the distal half),
1-nerved, 1.6-2.7 x 0.7-1.0 mm. Lip calceolate, the
opening slightly projected toward, transverse, entire
to obscurely 3-lobed, margins lacerate, base with two
calli, 4 mm wide when expand. Column short, retuse
rostelum, 0.7-1.5 mm long, straight in young lowers
and bent in old lowers. Stigma quadrate in young
lowers and transversely elongate in old lowers..
Ovary subcylindric, hairy, 2.0-2.5 mm long.
MaTerial sTuDieD: PERU. Arequipa: Caravelí,
Arajaipampa, Lomas de Atiquipa, 980 m en suelo franco
arcilloso, creciendo bajo el refugio de Cytharexylum
lexuosum, lores blancas, 16 febrero 2008, A. Delgado
4021. Caravelí, lomas de Los Cerrillos, entre Nazca y
Chala, 700 m, habitat rocoso, sépalos y pétalos rosado-
37
parduzcos, labelo blanquecino, 23 setiembre 1958, R.
Ferreyra 13455, USM. Caravelí, encima de Atiquipa,
sobre rocas, 600-700 m, lores blancas, 20 diciembre
1959, R. Ferreyra 14034, USM (illustration voucher,
Fig. 4C). ica: Nazca, km 52.4 al sur de Nazca, entre
rocas, 18 octubre 1957, K. Rahn 198, USM (illustration
voucher, Fig. 3). lima: Huaura, Lomas de Lachay,
suelo arenoso, con zonas pedregoso-rocoso, 300-700
m, hierba epíita, escasa, sólo frutos secos, 23 febrero
1996, A. Cano et al. 7101, USM-166101. Chancay,
Lomas de Lachay, Km 105 carretera Panamericana
Norte, suelos arenosos, arenoso-arcillosos, con partes
pedregosas y rocosas, 300-700 m, hierba epíita,
escasa, solo frutos secos, 24 febrero 1996, A. Cano et
al. 7101, USM-161164 (illustration voucher, Fig. 4B).
oTher reCorDs: PERU. ica: Ica, Santiago, Lomas
de Amara - Ullujalla, loma con gran captación de
humedad de neblina y vientos fuertes, 834 m, suelo
arenoso semidescubierto con parches dispersos, 7
diciembre 2007, A. Orellana & O. Whaley 353 (digital
photo).
DisTriBuTion: Central and southern coast of Peru,
Bolivia and North Argentina, between 300 and 3800
m of elevation.
haBiTaT anD eCology: In sandy, sandy-clay, stony
and rocky soils of lomas formations, paramos and
puna. Occasionally plants of A. weddelliana can grow
on decaying tree trunks in the lomas formations and
is recorded as epiphyte (personal communication
with the collector of A. Cano 7101). Flowering from
September to February.
In the original description of A. weddelliana,
Reichenbach (1878) indicated that the loral bracts are
shorter than the lower and 5-lobed rostellum. However,
after examination of the type material in W (Fig 4A.),
it was found that when the loral bracts –relexed in
natural position– are expanded and measured, they are
longer than the lower. The rostellum is without lobes;
the appearance of lobes must be a deformation created
during the preparation of the herbarium material or
the rehydration of the lower for study. Two loral
features were also noticed during the present study that
were neither mentioned in the original description of
Reichenbach, nor in the work of Schweinfurth (1958):
petals with erose margin and ovary hairy.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
38
LANKESTERIANA
aCknoWleDgeMenTs. We want to thank to the curators
of W and USM for having allowed us access to study the
herbarium material and to rehydrate some of the specimens
mentioned here. To Jose Roque for his help in the map
elaboration. To William R. Morrison III for his suggestions
on improving the manuscript. To the Lomas de Atiquipa´s
inhabitants for their logistical support. And, to Oliver
Whaley and Alonso Orellana for sharing their photographic
records of Lomas de Amara.
liTeraTure CiTeD
Álvarez-Molina, A. & K.M. Cameron. 2009. Molecular
phylogenetics of Prescottiinae s.l. and their close allies
(Orchidaceae, Cranichideae) inferred from plastid and
nuclear ribosomal DNA sequences. Amer. J. Bot. 96:
1020–1040.
Bennett, D.E. & E.A.Christenson 1998. Chloraea pavoni
Lindl. Icones Orchid. Peruv. pl. 425.
Cocucci, A.E. 1964. The life-history of Aa achalensis
Schlechter (Orchidaceae) Phytomorphology 14: 588597.
Correa, M.N. 1969. “Chloraea” género sudamericano de
Orchidaceae. Darwiniana 15:374-500.
Dillon, M.O., M. Nakazawa & S. Leiva. 2003. The
lomas formations of coastal Peru: composition and
biogeographic history. Pp. 1-9 in: J. Haas & M.O.
Dillon (eds.), El Niño in Peru: biology and culture over
10,000 years. Fieldiana Bot. 43.
Dillon, M.O., T. Tu, L. Xie, V. Quipuscoa & J. Wen. 2009.
Biogeographic diversiication in Nolana (Solanaceae),
a ubiquitous member of the Atacama and Peruvian
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
deserts along the western coast of South America. J.
Syst. Evol. 47: 457–476.
Ferreyra, R. 1993. Registros de la vegetación en la costa
peruana en relación con el Fenómeno El Niño. Bull.
Inst. fr. etudes andines. 22: 259-266.
Garay, L.A. & G. Romero-González. 1998. Schedulae
Orchidum. Harvard Pap. Bot. 3: 53-62.
Oka, S. & H. Ogawa. 1984. The distribution of lomas
vegetation and its climatic environments along the
Paciic Coast of Peru. Geogr. Rep. Tokyo metrop. Univ.
19:113-125.
Reichenbach, H.G. 1878. Orchideae Mandonianae. Xenia
Orchid. 3: 17-19.
Rundell, P.W., M.O. Dillon, B. Palma, H.A. Mooney, S.L.
Gulmon & J.R. Erlenberg. 1991. The phytogeography
and ecology of the coastal Atacama and Peruvian
deserts. Aliso 13: 1-49.
Schlechter, R. 1912. Die Orchideen Gattungen Altensteinia
HBK, Aa Rchb.f. und Myrosmodes Rchb.f.. Repert
Spec. Nov. Regni Veg. 11: 147-150.
Schweinfurth, C. 1958. Orchids of Peru. Fieldiana Bot. 30:
1-260.
Schweinfurth, C. 1959. Orchids of Peru. Fieldiana Bot. 30:
261-531.
Tropicos.org. 2010. Missouri Botanical Garden. http://
www.tropicos.org/Name/23505925. Accessed 08 Nov
2010.
Weberbauer, A. 1945. El mundo vegetal de los Andes
peruanos. Estudio itogeográico. Lima. Ministerio de
Agricultura.
Wood, J. 2003. Aa. Pp. 24-26 in: A.M. Pridgeon, P.J.
Cribb, N.W. Chase & F.N. Rasmussen (eds.), Genera
Orchidacearum, 3: Orchidoideae part 2, Vanilloideae.
Oxford University Press, Oxford.
LANKESTERIANA 11(1): 39—54. 2011.
ANATOMíA fOliAr dE OChO ESPECiES dE OrquídEAS EPífiTAS
rafael aréValo1,2,3, juana figueroa2 & sanTiago MaDriñán2
1
Department of Botany, University of Wisconsin-Madison, 430 Lincoln Drive, Madison, WI 53706-1381, U.S.A.
2
Laboratorio de Botánica y Sistemática, Universidad de los Andes, Bogotá, Apartado 4976, Colombia.
3
Autor para correspondencia: rafarev@gmail.com
resuMen. Para contribuir con el conocimiento de las bases vegetativas del epiitismo en Orchidaceae,
se desarrolló un estudio de las variaciones anatómicas foliares que pueden presentarse en diferentes
tipos de plantas epiitas. Se escogieron cuatro especies que representaran las diferentes categorías de
epíitas—epíita de humus (Oncidium abortivum Rchb.f.), epíita de corteza (Epidendrum excisum Lindl.)
y epiitas de ramita (Rodriguezia lehmannii Rchb.f. e Hirtzia escobarii Dodson) —, y cuatro especies
que crecieran como epíitas y como plantas terrestres—Elleanthus oliganthus (Poepp. & Endl.) Rchb.f.,
Elleanthus purpureus (Rchb.f.) Rchb.f., Pleurothallis cordifolia Rchb.f. & H.Wagener, y Stelis sp.
Distintas combinaciones de caracteres xerofíticos propios de plantas adaptadas a crecer en ambientes con
baja disponibilidad de recursos hídricos se evidenciaron en todas las especies: mayor desarrollo de células
de la epidermis adaxial, engrosamientos de las paredes periclinales de la epidermis, tricomas glandulares,
estomas con poro protegido, ocurrencia de hipodermis, haces de células esclerenquimáticas, presencia de
diferentes tipos de idioblastos y células esclerenquimáticas rodeando los haces vasculares. Las epíitas de
ramita, restringidas a los ejes más pequeños y expuestos de sus hospederos, presentaron varios de estos
caracteres.
aBsTraCT. Leafs of representative epiphytic orchids were examined for anatomical detail. Four species
representing the different epiphyte categories were selected for the study: Oncidium abortivum Rchb.f.
(humus epiphyte), Epidendrum excisum Lindl. (branch epiphyte), Rodriguezia lehmannii Rchb.f., and
Hirtzia escobarii Dodson(twig epiphytes). Additionally, four orchid species capable of developing as
terrestrial plants and as epiphytes were also examined: Elleanthus oliganthus (Poepp. & Endl.) Rchb.f.,
Elleanthus purpureus (Rchb.f.) Rchb.f. Pleurothallis cordifolia Rchb.f. & H.Wagener, and Stelis sp.
Various xerophytic characters, that could be considered leaf adaptations to water shortage in the epiphytic
habit, were common for most species: greater development of adaxial epidermal cells, stomata with
protected pores, occurrence of hypodermis, presence of iber bundles, different type of idioblasts, and
sclerenchyma present adjacent to the xylem and phloem. Twig epiphytes, restricted to the outermost axes
of their hosts, exhibit several of these modiications.
palaBras ClaVe / key WorDs: Anatomía foliar, Orchidaceae, Epiitismo, Adaptación, Leaf anatomy,
Epiphytism, Adaptation.
introducción. La familia Orchidaceae es considerada
una de las familias más grandes de plantas vasculares
con más de 25,000 especies distribuidas por todo el
planeta (Dressler 1981, 2005). Con el 70% de sus
especies presentando una forma de vida epíita,
constituyen más de dos tercios de todas las epíitas
vasculares, siendo el grupo más diverso de este tipo
de plantas (Atwood 1986, Kress 1986). Con el objeto
de clasiicar a las orquídeas epíitas, Dressler (1981)
planteó tres categorías ecológicas generales: las epíitas
de humus, que crecen solamente donde exista una capa
de humus; las epíitas de corteza, que se adhieren con
irmeza a troncos y ramas grandes; y las epíitas de
ramita, plantas diminutas que se encuentran en los ejes
más pequeños y expuestos de sus hospederos.
Varias modiicaciones estructurales y adaptaciones
isiológicas están relacionadas con la expresión y
surgimiento del epiitismo dentro de las Orchidaceae.
Estas incluyen: la anatomía particular de sus raíces
(presencia de exodermis y velamen); los pseudobulbos
40
LANKESTERIANA
o engrosamientos en el tallo; la disposición, morfología
y anatomía de las hojas; los patrones de crecimiento;
y la ruta metabólica fotosintética conocida como
metabolismo ácido de las crasulaceas–CAM, por
sus siglas en inglés (Dressler 1981, Benzing & Ott
1981, Benzing et al. 1983, Benzing & Atwood 1984,
Benzing 1989, Benzing 1990, Sinclair 1990, Silvera
et al. 2009). La interacción de estos caracteres y
mecanismos, en combinación con las características
reproductivas únicas que presentan—como la
gran cantidad de semillas diminutas adaptadas a la
dispersión por viento (microspermia), la relación
simbiótica con micorrizas para la germinación
(micotrofía), y la estructura loral modiicada para
polinizadores especíicos (resupinación, labelo,
columna y polinaria)—, han otorgado a las orquídeas
grandes oportunidades evolutivas que han facilitado su
expansión y la colonización del dosel en los bosques
tropicales (Benzing & Atwood 1984, Benzing 1986,
Goh & Kluge 1989).
Se ha argumentado que la limitante abiótica
más relevante para el crecimiento y funcionamiento
vegetativo de las epíitas vasculares es la escasez de
agua (Zotz & Hietz 2001). La toma efectiva de agua,
el almacenamiento dentro de la planta y el control
de la pérdida de ésta, son factores determinantes en
la expresión del epiitismo en las orquídeas (Sinclair
1990). Johansson (1975) sostuvo que el patrón de
distribución espacial de las orquídeas epíitas parecía
ser el resultado de la interacción entre la necesidad por
captar altas intensidades lumínicas y la capacidad de
tolerar la fuerza de evaporación del aire. Puesto que las
hojas son el lugar principal en donde se lleva a cabo la
fotosíntesis, estas deben mantener un intercambio de
gases adecuado con el aire circundante, lo que conlleva
una pérdida de agua inevitable. Cualquier planta sujeta
a escasez de agua, debe poseer modiicaciones en la
morfología, anatomía y isiología de sus hojas, y la
estructura de estas, también debe relejar la respuesta
de la planta a los recursos que se encuentran a su
disposición (Sinclair 1990, Garnier & Laurent 1994,
Reich et al. 1999).
La reducción de la transpiración y el almacenamiento
de agua, hacen parte de las estrategias que poseen las
hojas para tolerar sequías. En las orquídeas, dentro los
caracteres de las hojas que permiten reducir la pérdida
de agua se encuentran: el grosor de la cutícula, la
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
densidad y distribución de los estomas, la presencia
de pelos supericiales y el hecho de ser deciduas
(Sinclair 1990). Para el almacenamiento de agua, las
hojas de algunas orquídeas poseen una hipodermis
que funciona como tejido de acumulación de agua ,
que en algunos géneros puede llegar a ocupar hasta el
80% del volumen de la hoja (Pridgeon 1986). Dentro
del tejido hipodérmico también se pueden encontrar
idioblastos con paredes engrosadas que acumulan agua
y evitan el colapso del tejido durante los periodos de
desecación (Olatunji et al. 1980). En otros casos, las
células del mesóilo se agrandan y pueden asumir una
función de almacenamiento mientras retienen algunos
cloroplastos (Sinclair 1990).
Con el presente trabajo se amplía el conocimiento
sobre los caracteres foliares asociados con el hábito
epíito, basándose en ocho especies de orquídeas
que representan formas de crecimiento variado.
A continuación, se describe la anatomía foliar de
cuatro especies que representan a los distintos tipos
ecológicos de epíitas propuestos por Dressler (1981),
y cuatro especies que se encontraron creciendo como
plantas terrestres y como epíitas.
Materiales y métodos. Se escogieron cuatro
especies de orquídeas que representaran a cada una
de las categorías de epíitas propuestas por Dressler
(1981)—epíita de humus, epíita de corteza y epíita
de ramita—y cuatro especies de orquídeas que crecían
como plantas terrestres, enraizadas y expuestas en
taludes de una carretera y como epíitas de corteza,
sobre árboles dentro de un bosque húmedo de montaña
(Tabla 1).
Las especies estudiadas fueron colectadas en su
hábitat natural: Elleanthus oliganthus, E. purpureus,
Pleurothaillis cordifolia, Stelis sp. y Rodriguezia
lehmannii, en la vereda Monte Bello , municipio de
Pueblo Rico, departamento de Risaralda (05º14’40”
N, 76º06’15” W); Oncidium abortivum y Epidendrum
excisum, en un bosque húmedo de montaña de la
vereda Cedeño , municipio Támesis, departamento
de Antioquia (05º34’53” N, 75º42’13” W); e Hirtzia
escobarii en cultivos de guayaba en la vereda Toriba
Bajo , Municipio San Francisco, departamento de
Cundinamarca (04º37’0” N, 74º48’0” W).
Los individuos muestreados fueron plantas adultas,
en estado de loración y que no presentaban síntomas
aréValo et al. — Anatomía Foliar de Orquídeas Epíitas
41
TaBla 1. Lista de especies de orquídeas estudiadas.
Especie
Categoría de epíita
Colector y No.
Herbario
Oncidium abortivum Rchb.f.
Epíia de humus
J. Figueroa 36
ANDES
Epidendrum excisum Lindl.
Epíita de corteza
J. Figueroa 14
ANDES
Hirtzia escobarii Dodson
Epíita de ramita
J. Figueroa 7
ANDES
Rodriguezia lehmannii Rchb.f.
Epíita de ramita
R. Arévalo 684
ANDES
Elleanthus oliganthus (Poepp. & Endl.) Rchb.f
Epíita de corteza / terrestre
R. Arévalo 456
ANDES
Elleanthus purpureus (Rchb.f) Rchb.f
Epíita de corteza / terrestre
R. Arévalo 679
ANDES
Pleurothallis cordifolia Rchb.f. & H.Wagener
Epíita de corteza / terrestre
R. Arévalo 482
ANDES
Stelis sp.
Epíita de corteza / terrestre
R. Arévalo 504
ANDES
de ataques por parte de patógenos o herbívoros.
Hojas maduras y completamente expandidas (1
hoja por planta, 5 plantas por especie) fueron
almacenadas en solución ijadora 1:1:18 de 40%
formol, ácido acético y 70% alcohol (70%) (FAA)
para ser llevadas al laboratorio donde se efectuaron los
análisis anatómicos. A cada hoja se le hicieron cortes
transversales a mano alzada y a nivel de la parte media.
Se tomaron medidas del grosor de la hoja y de las
cutículas (5 medidas por hoja, 25 por especie) usando
un microscopio Nikon® Eclipse 4000 equipado
con un micrómetro ocular. Los resultados fueron
registrados a través de microfotografías. La presencia
de elementos ligniicados se detectó mediante el uso
de azul de toluidina 0 (Herr 1993). Se describe la
anatomía foliar de las distintas especies teniendo en
cuenta múltiples observaciones (cortes) y con base en
los siguientes caracteres: cutícula, células epidérmicas,
estomas, haces ibrosos, hipodermis, mesóilo y haces
vasculares.
resultados
epífiTa De huMus
Oncidium abortivum: hojas coriáceas, duras,
conduplicadas, lanceoladas, 332.4 ± 64.9 mm de grosor.
Cutícula adaxial 2.7 ± 0.3 mm de grosor; abaxial 1.5
± 0.2 mm de grosor. Células epidérmicas oblongas;
las células adaxiales más grandes que las abaxiales.
Estomas al mismo nivel de las células epidérmicas;
cámara subestomática más grande que células del
mesóilo adyacentes. Haces ibrosos abaxiales en dos
series que se alternan (Fig. 1A). Hipodermis adaxial
uniseriada, interrumpida por idioblastos angulares con
paredes ligniicadas gruesas (Fig. 1B); abaxial ausente.
Mesóilo homogéneo, 10–12 células de grosor,
redondas a oblongas, con paredes delgadas. Haces
vasculares de diferentes tamaños, intercalados; xilema
y loema rodeado por vaina vascular más gruesa hacia
los polos.
epífiTa De CorTeza
epidendrum excisum: hojas coriáceas, carnosas,
conduplicadas, ovadas, 1014.0 ± 161.62 mm de
grosor. Cutícula 12.7 ± 1.68 mm de grosor; 8.7 ± 0.82
mm de grosor. Células epidérmicas rectangulares a
cuadradas, paredes celulares periclinales engrosadas
(Fig. 2A). Estomas ligeramente hundidos en relación
a las células epidérmicas; cámara subestomática más
pequeña que células adyacentes del mesóilo; con
proyecciones cuticulares (Fig. 2B). Haces ibrosos
ausentes. Hipodermis adaxial 3–4 células de grosor,
presencia de idioblastos con leves engrosamientos
parietales en bandas irregulares (Fig. 2A); abaxial
uniseriada. paredes celulares engrosadas. Mesóilo
homogéneo, 13–15 células de grosor, células con
grandes vacuolas (Fig. 2C); idioblastos con raidios de
gran tamaño (Fig. 2D). Haces vasculares de diferentes
tamaños, intercalados; xilema y loema rodeado por
vaina vascular más gruesa hacia el polo del xilema en
los haces más grandes (Fig. 2C).
epifiTas De raMiTa
Hirtzia escobarii: hojas coriáceas, carnosas,
fuertemente conduplicadas, elípiticas, angostas, 2315.4
± 196.9 mm de grosor. Cutícula adaxial 5.6 ± 0.2 mm
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
42
LANKESTERIANA
figura 1. Oncidium abortivum: A. Aspecto general; células de la epidermis adaxial (ead) de mayor tamaño que las de la
epidermis abaxial, células del mesóilo (m) redondas a oblongas, haces vasculares (hv) de varios tamaños, dos series
de haces ibrosos en región abaxial (hf). B. Idioblasto angular con engrosamiento parietal ligniicado (il). Escalas:
A=300mm; B=40mm.
de grosor; abaxial 3.8 ± 0.82 mm de grosor. Células
epidérmicas oblongas. Estomas al mismo nivel de las
demás células epidérmicas; cámara subestomática
más pequeña que células adyacentes del mesóilo;
proyecciones cuticulares externas presentes. Haces
ibrosos compuestos por varias células con paredes
ligniicadas gruesas, dispuestos en una serie a nivel de
la hipodermis abaxial (Fig. 3A: hf). Hipodermis adaxial
uniseriada, células dipuestas anticlinalmente, de tamaño
variado, con paredes ligniicadas gruesas (Fig. 3B: hl);
abaxial uniseriada, células isodiamétricas a oblongas,
con paredes ligniicadas gruesas, interrumpida por haces
ibrosos (Fig. 3A). Mesóilo homogéneo, alrededor de
20 células de grosor, células isodiamétricas hacia la
parte media, alargadas anticlinalmente hacia ambas
supericies, células con grandes vacuolas que ocupan
gran parte del volumen celular; idioblastos globosos
con leves engrosamientos transversales en bandas
irregulares (Fig. 3C). Haces vasculares de diferentes
tamaños, intercalados; xilema y loema rodeado por
vaina vascular cuyas células esclerenquimáticas
presentan paredes más gruesas hacia los polos (Fig. 3D).
rodriguezia lehmannii: hojas coriáceas,
carnosas, conduplicadas y elípticas, 1570.4 ± 265.07
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
mm de grosor. Cutícula adaxial lisa, 12.3 ± 2.67 mm
de grosor; abaxial ligeramente bulada, 6.0 ± 1.01 mm
de grosor. Células epidérmicas oblongas, dispuestas
periclinalmente, de mayor tamaño en la supericie
adaxial (Fig. 4A). Estomas al mismo nivel de las
demás células epidérmicas; cámara subestomática de
menor tamaño que células adyacentes del mesóilo;
proyecciones cuticulares externas pronunciadas
formando una cámara supraestomática (Fig. 4B).
Haces ibrosos compuestos por grupos de células
esclerenquimáticas, en una serie y al mismo nivel
de la hipodermis abaxial (Fig. 4A y C). Hipodermis
adaxial uniseriada interrumpida por idioblastos
elipsoidales a cilíndricos y con engrosamientos
parietales helicoidales (Fig. 4D); la abaxial
uniseriada, con células de paredes ligniicadas
gruesas intercalándose con haces ibrosos (Fig. 4C).
Mesóilo relativamente homogéneo, 9–10 células de
grosor, las adaxiales con más cloroplastos y todas
con vacuolas grandes que ocupan gran parte del
volumen celular (Fig. 4D). Haces vasculares hacia
la parte media de la hoja; xilema y loema rodeado
por vaina vascular cuyas células esclerenquimáticas
presentan paredes celulares más gruesas hacia el polo
del loema (Fig.4E).
aréValo et al. — Anatomía Foliar de Orquídeas Epíitas
43
figura 2. Epidendrum cf. excisum. A. Idioblasto (i) con engrosamiento parietal secundario en forma de bandas irregulares,
paredes periclinales de la epidermis gruesas (ep). B. Estoma (e) con células guardia de lumen triangular y cámara
subestomática (csb) de menor tamaño que células del mesóilo adyacentes. C. Aspecto general; vacuolas (v) que ocupan
gran parte del volumen celular. d. Raidios de gran tamaño. Escalas: A=10mm; B,D=30 mm; C=200 mm.
epífiTas y TerresTres
elleanthus oliganthus: hojas plicadas, ovadas,
217.0 ± 15.8 mm de grosor en epíitas y 228.8 ±
20.2 mm de grosor en terrestres. Cutícula adaxial
levemente bulada, 4.6 ± 0.8 mm de grosor en epíitas
y 4.2 ± 1.0 en terrestres; abaxial de textura algo
verrugosa—con pequeñas proyecciones granulares
(Fig. 5A), 2.3 ± 0.4 mm de grosor en epíitas y 2.4 ±
0.2 mm de grosor en terrestres. Células epidérmicas
oblongas a isodiamétricas, las adaxiales más grandes
e isodiamétricas; tricomas glandulares situados en
supericie abaxial (Fig. B). Estomas al mismo nivel de
las demás células epidérmicas; cámara subestomática
del mismo tamaño que células adyacentes del mesóilo;
leves proyecciones cuticulares externas e internas (Fig.
5A, e). Haces ibrosos ausentes. Hipodermis ausente.
Mesóilo relativamente homogéneo, 5–7 células de
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
44
LANKESTERIANA
figura 3. Hirtzia escobarii: A. Hipodermis abaxial ligniicada (hl) interrumpida por haces ibrosos (hf). B. Hipodermis
adaxial de células con paredes ligniicadas gruesas (hl), vacuolas (v) que ocupan gran parte del volumen celular. C.
Idioblasto globoso con engrosamiento parietal secundario en forma de bandas irregulares (i). d. Disposición radiada
de células que rodean haz vascular (hv), xilema y loema rodeado por vaina vascular (vv). Escalas: A,B=60mm , C=30
mm. D=10mm.
grosor, células oblongas; idioblastos con raidios
presentes (Fig. 5C). Haces vasculares de diferentes
tamaños, haces grandes se alternan con dos tipos de
haces mas pequeños; los haces grandes con el xilema
y loema rodeado por vaina vascular más gruesa hacia
los polos (Fig. 5D).
elleanthus purpureus: hojas plicadas, ovadas,
175.4 ± 9.4 mm de grosor en epíitas y 255.3 ± 14.6 mm
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
de grosor. Cutícula adaxial lisa a ligeramente bulada
a lo largo del contorno de las células epidérmicas,
4.5 ± 0.4 mm de grosor en epíitas y 7.0 ± 0.9 mm
de grosor en terrestres; abaxial inamente bulada
a lo largo del contorno de las células epidérmicas,
1.9 ± 0.3 mm de grosor en epíitas y 3.7 ± 0.5 mm de
grosor en terrestres (Fig. 6A). Células epidérmicas
isodiamétricas a oblongas; tricomas glandulares
situados en depresiones epidérmicas presentes en
aréValo et al. — Anatomía Foliar de Orquídeas Epíitas
45
figura 4. Rodriguezia lehmannii: A. Aspecto general; células de la epidermis adaxial (ead) de mayor tamaño que las de
la epidermis abaxial, hipodermis adaxial (h) constituida por idioblastos (i) con engrosamientos parietales helicoidales,
células del mesóilo con vacuolas que ocupan gran parte del volumen celular (v), haces vasculares (hv) grandes y
pequeños. B. Estoma (e) con proyecciones cuticulares (pc) pronunciadas y cámara supraestomática (csp) alargada. C.
Hipodermis abaxial ligniicada (hl) interrumpida por haces ibrosos (hf). d. Idioblasto (i) elipsoidal con engrosamiento
parietal secundario helicoidal. E. Haz vascular (x y f) rodeado por vaina vascular (vv), cuyas células esclerenquimáticas
presentan paredes celulares más gruesas hacia el polo del loema (f). Escalas: A,B,C=30mm; D=400 mm; E=40mm.
ambas supericies (Fig. 6B). Estomas al mismo
nivel de las demás células epidérmicas; cámara
subestomática de igual o mayor tamaño que células
adyacentes del mesóilo; proyecciones cuticulares
externas presentes (Fig. 6A). Haces ibrosos ausentes.
Hipodermis ausente. Mesóilo heterogéneo, 7–10
células de grosor, las células abaxiales, dispuestas
periclinalmente, oblongas a isodiamétricas, con
espacios intercelulares conspicuos (parénquima
esponjoso); las adaxiales en dos series de células
isiodiamétricas (parénquima empalizada) (Fig. 6C);
idioblastos con raidios e idioblastos mucílaginosos
presentes. Haces vasculares de diferentes tamaños,
haces grandes se alternan con dos tipos de haces
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
46
LANKESTERIANA
figura 5. Elleanthus oliganthus. A. Estoma (e) con células guardia de lumen triangular y cámara subestomática. (csb) de
igual tamaño a células del mesóilo adyacentes, leves proyecciones cuticulares. internas (pc). B. Tricoma glandular de la
supericial abaxial de la hoja. C. Aspecto general; cutícula adaxial levemente abollada (cad), cutícula abaxial abollada
de textura verrugosa (cab), células del mesóilo oblongas dispuestas periclinalmente (m), idioblasto con raidios (ir). C.
Haz vascular central (hvc), células de esclerénquima (ce) concentradas hacia los polos del loema y del xilema. Escalas:
A=30 mm; B=50mm; C=100 mm; D=200 mm.
más pequeños; xilema y loema rodeado por vaina
vascular más gruesa hacía los polos.
pleurothallis cordifolia: hojas coriáceas, algo
carnosas, fuertemente cordadas, 838.7 ± 75.6 mm
de grosor en epíitas y 942.1 ± 71.3 mm de grosor en
terrestres. Cutícula adaxial lisa, 7.9 ± 0.7 mm de grosor
en epíitas y 7.9 ± 1.4 mm de grosor en terrestres;
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
abaxial lisa, 2.1 ± 0.2 mm de grosor en epíitas y 2.6
± 0.4 mm de grosor en terrestres. Células epidérmicas
oblongas a rectangulares; tricomas glandulares situados
en depresiones epidérmicas presentes en ambas
supericies (Fig. 7A). Estomas al mismo nivel de las
demás células epidérmicas; cámara subestomática
de mayor o igual tamaño que células adyacentes
del mesóilo (Fig. 7B). Haces ibrosos ausentes.
aréValo et al. — Anatomía Foliar de Orquídeas Epíitas
47
figura 6. Elleanthus purpureus. A. Cutícula abaxial
inamente abollada (cab), estoma (e) con proyecciones
cuticulares curvas y cámara subestomática (csb) de
menor tamaño que células del mesóilo adyacentes. B.
Tricoma glandular (tg). C. Aspecto general; cutícula
adaxial lisa a ligeramente abollada (cad), células del
mesóilo (m) oblongas a isodiamétricas con espacios
intracelulares conspicuos (ei). Escalas: A=30 mm; B=50
mm; C=300 mm.
Hipodermis adaxial compuesta por dos series, células
con engrosamientos parietales helicoidales; abaxial
uniseriada, células con engrosamientos parietales
helicoidales. Mesóilo heterogéneo, 8–10 células
de grosor; el parénquima esponjoso compuesto por
células oblongas a isodiamétricas; grandes idioblastos
ovoides, con engrosamientos helicoidales e idioblastos
con rafídios (Fig. 7C y D); el parénquima empalizada
compuesto por dos series, una serie de células
columnares, y otra de células oblongas a isodiamétricas
(Fig. 7E); en algunas células del mesóilo se presentan
pequeñas gotas amarillas de aceite. Haces vasculares
de diferentes tamaños, distribuidos en una serie ubicada
entre el mesóilo de empalizada y el esponjoso: xilema y
loema rodeado por vaina vascular; una serie de células
esclerenquimáticas separa el xilema del loema.
stelis sp.: hojas coriáceas, carnosas, ovadas, 661.3
± 60.5 mm de grosor en epíitas y 814.0 ± 121.7 mm
de grosor en terrestres. Cutícula adaxial lisa, 4.6 ±
0.4 mm de grosor en epíitas y 7.2 ± 2.1 mm de grosor
en terrestres; abaxial lisa 2.0 ± 0.1 mm de grosor en
epíitas y 2.8 ± 0.9 mm de grosor en terrestres. Células
epidérmicas dispuestas periclinalmente y oblongas a
rectangulares, las adaxiales más grandes; tricomas
glandulares en depresiones epidérmicas presentes en
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
48
LANKESTERIANA
figura 7. Pleurothallis cordifolia. A. Tricoma glandular (tg).
B. Estoma (e) con células guardia de lumen triangular y
cámara subestomática (csb) de igual tamaño que células
del mesóilo adyacentes. C. Idioblastos (i) ovoides
con engrosamiento parietal secundario helicoidal. d.
Idioblasto con raidios (ir). E. Aspecto general; células
de la epidermis adaxial (ead) de mayor tamaño que las
de la epidermis abaxial, parénquima empalizada (pem)
de células columnares y dispuestas anticlinalmente,
parénquima esponjoso (pes) de células oblongas a
isodiamétricas. Escalas: A=50mm; B=30mm; C=100mm;
D=40mm; E=300mm.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
aréValo et al. — Anatomía Foliar de Orquídeas Epíitas
49
figura 8. Stelis sp. A. Cutícula abaxial lisa (cab), estoma
(e) con células guardia de lumen triangular y cámara
subestomática (csb) de mayor tamaño que células
adyacentes del mesóilo. B. Aspecto general; células
de la epidermis adaxial (ead) de mayor tamaño que las
de la epidermis abaxial, parénquima empalizada (pem)
de células columnares dispuestas anticlinalmente,
parénquima esponjoso (pes) de células oblongas a
isodiamétricas, hipodermis adaxial (had) de 2 a 3 capas
de células, hipodermis abaxial (hab) uniseriada. C. Haz
vascular con serie de células esclerenquimáticas (ce)
separando el xilema del loema. Escalas: A=30mm,
B=400 mm, C=10mm.
ambas caras y más abundantes en la supericie abaxial
(no se muestran). Estomas al mismo nivel de las demás
células epidérmicas; cámara subestomática de mayor
tamaño que células adyacentes del mesóilo; pequeñas
proyecciones cuticulares externas presentes (Fig. 8A).
Haces ibrosos ausentes. Hipodermis adaxial 2–4
células de grosor, isodiamétricas; abaxial uniseriada.
Mesóilo heterogéneo, 12–15 células de grosor; el
parénquima esponjoso más grueso, compuesto por
células oblongas a isiodiamértricas y dispuestas
periclinalmente, espacios intercelulares conspicuos;
el parénquima empalizada compuesto por 1–2 series
adaxiales de células columnares y otra serie abaxial de
células oblongas a isodiámétricas (Fig. 8B); presencia
de idioblastos elongados con engrosamientos parietales
helicoidales (no mostrados). Haces vasculares de
varios tamaños, distribuidos en una serie; los más
grandes ubicados entre los dos tipos de mesóilo y
los más pequeños abaxiales; esclerénquima ocurre en
forma de vainas vasculares conspicuas y completas;
una serie de células esclerenquimáticas separa el
xilema del loema (Fig. 8C).
Resumen. En las especies estudiadas se presentaron
los dos tipos de hojas que se pueden encontrar en
las orquídeas (sensu Withner et al. 1974), plicadas y
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
50
LANKESTERIANA
coriáceas. Todas las especies se diferenciaron en cuanto
al grosor de sus hojas y las más delgadas fueron las hojas
plicadas de las dos especies de Elleanthus. Entre las
especies con hojas coriáceas, las dos epíitas de ramita
(Hirtzia escobarii y Rodriguezia lehmannii) presentaron
las hojas más gruesas, mientras la epíita de humus
(Oncidium abortivum) presentó las hojas más delgadas.
En cuanto al grosor de la cutícula, en todas las especies
se encontró que la cutícula adaxial era más gruesa que
la cutícula abaxial. Al igual que en otros representantes
de la familia (Ayensu & Williams 1972, Mohana-Rao &
Khasim 1987, Stern et al. 1993, Kurzweil et al. 1995),
las hojas de O. abortivum, E. purpureus, R. lehmannii,
Pleurothallis cordifolia y Stelis sp., presentaron una
epidermis adaxial con células más grandes que las de
la epidermis abaxial (Tabla 2). Tricomas glandulares
fueron evidenciados tanto en las hojas coriáceas de las
especies de Pleurothallis, como en las hojas plicadas de
ambas especies de Elleanthus, aunque en E. oliganthus
se observaron únicamente a nivel de la supericie abaxial
(Tabla 2). Todas las especies estudiadas presentaron hojas
hipoestomáticas y con los estomas al mismo nivel de las
demás células epidérmicas (o ligeramente hundidos como
Epidendrum excisum). En algunas especies estudiadas se
observaron pequeñas proyecciones cuticulares curvas
sobre las células guardia, similares a las que ya han sido
descritas en otras especies de orquídeas (Ferreira 1992,
Leiria 1997). La epíita de ramita, R. lehmannii, presentó
proyecciones cuticulares externas pronunciadas,
formando una cámara externa bastante alargada (Fig.
4B).
La hipodermis, considerada una de las
características más comunes en plantas de crecimiento
epiito, se evidenció en todas las especies de hojas
coriáceas, pero de manera distinta (Tabla 2). Constituida
por células de mayor tamaño que las de la epidermis,
se presentó adaxial y abaxialmente, exceptuando a la
epíita de humus (Oncidium abortivum), donde solo
ocurrió adaxialmente (Fig. 1A). En epiitas de corteza
como Epidendrum excisum y Stelis sp. se observó
una hipodermis adaxial de varias series, con algunas
células de paredes gruesas en E. excisum (Fig. 2A) . En
las epíitas de ramita (Hirtzia escobarii y Rodriguezia
lehmannii), además de presentar hipodermis
uniseriadas, gruesas y ligniicadas, la hipodermis
abaxial se ve interrumpida, en intervalos mas o menos
regulares, por haces ibrosos (Fig. 4C). Estos haces
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
también fueron observados a nivel del mesóilo en la
epiita de humus O. abortivum (Fig. 1A).
Se presentaron especies con hojas de mesóilo
homogéneo y especies con hojas de mesóilo heterogéneo.
En aquellas especies con mesóilo heterogéneo
(Pleurothallis cordifolia, Stelis sp. y Elleanthus
purpureus), el mesóilo se diferencia claramente en
parénquima de empalizada y parénquima esponjoso.
En las especies en las que el mesóilo es relativamente
homogéneo (E. oliganthus y Rodriguezia lehmannii),
se observan variaciones en el tamaño y forma de las
células, así como en la cantidad de cloroplastos, sin
embargo no existe una clara diferenciación en dos tipos
de parénquima. En el mesóilo de la epíita de corteza
Epidendrum excisum, y de las epiitas de ramita, Hirtzia
escobarii y Rodriguezia lehmannii, predominan células
con vacuolas bastante grandes que ocupan la mayor
parte del volumen celular (Fig. 3A y 4D). Además, estas
especies presentan espacios intercelulares reducidos,
donde las cámaras subestomáticas son de menor tamaño
que las células adyacentes del mesóilo (Fig. 2B).
Se encontraron diferentes tipos de idioblastos—
globosos en Hirtzia escobarii , elipsoidales a
cilíndricos en Rodriguezia lehmannii, angulares en
Oncidium abortivum, elongados en Stelis sp. y ovoides
en Pleutothallis cordifolia—, con distintos tipos de
engrosamiento parietal—irregulares en Epidendrum
excisum e H. escobarii y helicoidales en R. lehmannii,
P. cordifolia y Stelis sp. En las epíitas de corteza, E.
excisum , Elleanthus oliganthus, E. purpureus y P.
cordifolia, se presentaron idioblastos con raidios de
oxalato de calcio (Fig. 2D, 5B, y 7D), corroborando
descripciones anteriores sobre otros representantes
de la familia (Metcalfe 1963; Wattendorff 1976;
Franceschi & Horner; Kauschik 1982; Pridgeon
1982; Campos Leite & Oliveira 1987; Ferreira 1992;
Widholzer 1993; Leiria 1997; Godoy & Costa 2003).
En todas las especies los haces vasculares son
colaterales y presentan células esclerenquimáticas
que los envuelven parcial o totalmente. De acuerdo
a la especie, estas células esclerenquimáticas que
conforman la vaina vascular pueden estar más
concentradas hacia los polos y/o variar en el grosor
de sus paredes. En las dos especies de Elleanthus, en
Oncidium abortivum y en Epidendrum excisum, la
vaina vascular es mucho más gruesa hacia los polos
del xilema y el loema que hacia la parte media. En
aréValo et al. — Anatomía Foliar de Orquídeas Epíitas
51
TaBla 2. Caracteres morfológicos y anatómicos presentes en ocho especies de orquídeas epíitas. + = presente; – =
ausente.
Caracteres foliares relacionados con almacenamiento de agua
y resistencia a desecación
Especie
Pseudobulbos
Epidermis
Tricomas
Celulas epidérmicas
glandulares
Elleanthus oliganthus
–
Elleanthus purpureus
–
Epidendrum excisum
–
–
Hirtzia escobarii
+
_
+
adaxiales más
+
desarrolladas
(abaxial)
adaxiales más
Oncidium abortivum
+
Pleurothallis cordifolia
–
Stelis sp.
–
adaxiales más
+
adaxiales más
Rodriguezia
lehmannii
Mesóilo
_
desarrolladas
desarrolladas
desarrolladas
las epíitas de ramita Hirtzia escobarii y Rodriguezia
lehmannii, las células esclerenquimáticas se encuentran
mas concentradas hacia el polo del xilema y las células
que se encuentran hacia el polo contrario del loema
presentan paredes más gruesas (Fig 3D y 4E).
Cabe resaltar, que dentro de las especies estudiadas
que no presentaron pseudobulbos se pueden evidenciar
dos tendencias. En las especies de Pleurothallis
cordifolia, Stelis sp. y Epidendrum excisum, la ausencia
de engrosamientos a nivel del tallo se ve contrarrestada
por el desarrollo de hojas suculentas con hipodermis
adaxial y abaxial, además de la presencia de células
con engrosamiento parietal secundario (Tabla 2). Por
su parte, en las especies de Elleanthus la ausencia de
pseudobulbos se ve acompañada por hojas delgadas
que no presentan tejido de almacenamiento de agua, ni
células esclerenquimáticas (Tabla 2).
discusión. En este estudio se pudo evidenciar como
especies más expuestas a los rayos solares presentan
hojas y cutículas más gruesas, como el caso de la
_
hipodermis, idioblastos
hipodermis ligniicada, idioblastos,
haces ibrosos
hipodermis, idioblastos, haces
ibrosos
+
hipodermis, idioblastos
+
hipodermis, idioblastos
hipodermis ligniicada, idioblastos,
haces ibrosos
epíitas de ramita (Rodriguezia lehmannii y Hirtzia
escobarii). De la misma manera, individuos terrestres
de las especies de Elleanthus purpureus, Pleurothallis
cordifoila y Stelis sp., que se encontraban expuestos
en los taludes de la carretera, presentaron hojas y
cutículas signiicativamente más gruesas (R. Arévalo,
unpubl. data). Según Kurzweil et al. (1995), las
células epidérmicas de mayor tamaño pueden estar
relacionadas con la función de reserva de agua
(Oliveira & Sajo 1999), especialmente en aquellas
hojas que no poseen tejidos de almacenamiento, como
es el caso de E. purpureus. Se ha demostrado que los
tricomas glandulares en especies de Pleurothallis no
están involucrados en procesos de toma de agua y
nutrientes por parte de la hoja (Benzing & Pridgeon
1983). Sin embargo, la función de estas estructuras
podría consistir en la secreción de mucílago, que
actuaría reduciendo la transpiración (Pridgeon 1982),
o contribuyendo con la absorción de agua (Raciborski
1898), y de cierta manera compensando la ausencia de
tallos engrosados/pseudobulbos.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
52
LANKESTERIANA
Puesto que en Orchidaceae los estomas raramente
ocurren hundidos (Rasmussen 1987), estos suelen
exhibir otros caracteres xeromóricos. A menudo los
estomas se encuentran rodeados por proyecciones
cuticulares externas que forman una cámara
supraestomática que protege contra la pérdida excesiva
de agua y gases (Eames & MacDaniels 1925, Metcalfe
1963, Machado & Barros 1995). Estas cámaras
supraestomáticas mantienen un compartimiento de
aire húmedo que permite reducir la transpiración y
son comunes en orquídeas epiitas que enfrentan altas
temperaturas y poca disponibilidad de agua (Rosso
1966, Rasmussen 1987), como el caso de la epíita de
ramita Rodriguezia lehmannii.
Los grupos de células esclerenquimáticas, o haces
ibrosos, conieren resistencia mecánica a las hojas
en casos de deshidratación y suelen presentarse en
las hojas de orquídeas especializadas a sobrevivir
en hábitats xerofíticos (Withner et al. 1974). Por
consiguiente, era de esperarse la presencia de estos
haces en las epíitas de ramita, aunque también fueron
observados a nivel del mesóilo en la epiita de humus
Oncidium abortivum (Tabla 2).
La abundancia de células del mesóilo con
vacuolas bastante grandes que ocupan la mayor
parte del volumen celular en la epíita de corteza
Epidendrum excisum y en las de ramita (Rodriguezia
lehmannii y Hirtzia escobarii), se presenta junto con
espacios intercelulares reducidos, donde las cámaras
subestomáticas son de menor tamaño que las células
adyacentes del mesóilo. Éstas características foliares
suelen estar asociadas a plantas con metabolismo
CAM (Nelson et al. 2005). La presencia de idioblastos
en el mesóilo estaría relacionada con la retención
de agua y/o el soporte mecánico, evitando el colapso
celular durante la desecación (Pridgeon 1982).
Adicionalmente, se ha argumentado que los idioblastos
con raidios, que se hayaron en las epíitas de corteza
(excepto Stelis sp.), pueden estar relacionados con el
balance iónico y osmoregulación de la planta (Bonates
1993).
El engrosamiento en las paredes de las células
esclerenquimáticas que conforman la vaina vascular
podría conferirle mayor resistencia mecánica a las
hojas en casos de deshidratación. La presencia de estos
engrosamientos estaría relacionada entonces con la
menor disponibilidad de agua que existe en un hábito
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
epíito extremo, como el que se presenta en los ejes
más pequeños y expuestos de los árboles hospederos–
las ramitas.
El análisis de las hojas estudiadas indica la
presencia de caracteres que pueden ser interpretados
como adaptaciones a la economía de agua. En
cada una de las plantas estudiadas se presenta una
particular combinación de estos, aunque no se
evidencia una clara diferenciación en la anatomía
de las plantas según la categoría ecológica a la que
pertenecen. Sin embargo, las epifitas de ramita se
diferencian de las demás al presentar una hipodermis
lignificada y varios de los caracteres propios de
plantas adaptadas a crecer en ambientes con baja
disponibilidad de recursos hídricos: (1) hojas y
cutículas bastante gruesas; (2) estomas con cámaras
supraestomáticas (en el caso de Rodriguezia
lehmannii); (3) haces fibrosos; (4) hipodermis
abaxial y adaxial; (5) células con grandes vacuolas;
(6) vainas vasculares gruesas; y (7) teniendo en
cuenta las características celulares del mesófilo,
muy probablemente metabolismo CAM. Estas
características deben facilitarles la colonización
de la zona más expuesta a alta luminosidad y con
mayor fluctuación en la disponibilidad de agua
que puede encontrarse en un árbol hospedero—
las ramitas. Los resultados encontrados apoyan la
idea que estas plantas constituyen un ejemplo de
extrema modificación morfológica y fisiológica al
epifitsimo.
agraDeCiMienTos. Al Parque Nacional Natural Tatamá
(Unidad Administrativa Especial del Sistema de Parques
Nacionales Naturales), a su director H. Ballesteros y a
todos sus funcionarios, por el apoyo logístico prestado.
A los asistentes en el trabajo de campo y de laboratorio
durante las distintas etapas del proyecto: A. Tapasco, O.
Velez, E. Cárdenas, S. Cournier, y E Realpe, J. Agudelo y J.
Betancur. A P. Ortíz por su colaboración en la identiicación
de especies; y a L. Nieto por su asesoría en la edición de
las imágenes. A los revisores anónimos por la lectura crítica
del manuscrito. Este trabajo fue parcialmente inanciado
por la Fundación para la Promoción de la Investigación
y la Tecnología del Banco de la República (Proyecto No.
2053), y el programa Proyectos Semilla del Comité de
Investigaciones y Posgrados de la Facultad de Ciencias de
la Universidad de los Andes. A los revisores anónimos por
la lectura crítica del manuscrito y sus sugerencias para esta
versión inal.
aréValo et al. — Anatomía Foliar de Orquídeas Epíitas
liTeraTura CiTaDa
Atwood, J.T. 1986. The size of the Orchidaceae and the
systematic distribution of epiphytic orchids. Selbyana
9: 171–186.
Ayensu, E.S. & N.H. Williams. 1972. Leaf anatomy
of Palumbina and Odontoglossum, subgenus
Osmoglossum. Amer. Orchid Soc. Bull. 41: 687–696.
Benzing, D.H. & A.M. Pridgeon. 1983. Foliar trichomes
of Pleurothallidinae (Orchidaceae): Functional
signiicance. Amer. J. Bot. 70(2): 173–180.
Benzing, D.H. & D.W. Ott. 1981. Vegetative reduction in
epiphytic Bromeliaceae and Orchidaceae: Its Origin
and signiicance. Biotropica 13: 131–140.
Benzing, D.H. & J.T. Atwood. 1984. Orchidaceae: ancestral
habitats and current status in forest canopies. Syst. Bot.
9: 155–165.
Benzing, D.H. 1986. The genesis of orchid diversity:
emphasis on loral biology leads to misconceptions.
Lindleyana 1(2): 73–89.
Benzing, D.H. 1989. The evolution of epiphytism. Vol.
76, Pp. 15–40 en: U. Lüttge (ed.), Vascular plants as
epiphytes: evolution and ecophysiology. SpringerVerlag, Berlin.
Benzing, D.H. 1990. Vascular epiphytes. Cambridge
University Press, Cambridge.
Benzing, D.H., W.E. Friedman, G. Peterson & A. Renfrow.
1983. Shootlessness, velamentous roots, and the preeminence of Orchidaceae in the epiphytic biotope.
Amer. J. Bot. 70(1): 121–133.
Bonates, L.C.M. 1993. Estudos ecoisiológicos de
Orchidaceae da Amazonia II – Anatomia ecológica
foliar de espécies com metabolismo CAM de uma
campina da Amazônia Central. Acta Amazonica 23(4):
315–348.
Campos Leite, V.M. & P.L. Oliveira. 1987. Morfoanaomia
foliar de Cattleya intermedia (Orchidaceae). Napaea 2:
1–10.
Dressler, R.L. 1981. The orchids: Natural History and
Classiication. Harvard University Press, Cambridge.
Dressler, R.L. 2005. How many orchid species? Selbyana
26(1): 155–158.
Eames, A.J. & L.H. MacDaniels. 1925. An introduction
to plant anatomy. McGraw-Hill Book Company Inc,
Nueva York.
Ferreira, J.L.B. 1992. Anatomia foliar de espécies da
subtribo Pleurohallidinae (Orchidaceae). Tesis de
Maestría. Universidade Federal do Rio Grande do Sul,
Porto Alegre.
Franceschi, V.R. & H.T. Horner Jr. 1980. Calcium oxalate
crystals in plants. Bot. Rev. 46: 361–427.
Garnier E. & G. Laurent. 1994. Leaf anatomy, speciic mass
and water content in congeneric annual and perennial
53
grass species. New Phytol. 128: 725–736.
Godoy, R. & C. Costa. 2003. Anatomia foliar de quarto
espécies do gênero Cattleya Lindl. (Orchidaceae) do
Planalto Central Brasileiro. Acta Bot. Brasil. 17(1):
101–118.
Goh C.J. & M. Kluge 1989. Gas exchange and water
relations in epiphytic orchids. Cap. 6, Pp. 139–163 en:
L. Ulrich (ed), Vascular Plants as epiphytes, Evolution
and ecophysiology. Springer-Verlag, Berlin.
Herr, J.M. 1993. Clearing techniques for the study of
vascular plant tissues in whole structures and thick
sections. Vol. 5, Pp. 63–84 en: C.A. Goldman, P.L.
Hauta, M.A. O’Donnell, S.E. Andrew and R. Vna der
Heiden (eds), Tested studies for laboratory teaching.
Proceedings of the 5th Workshop/Conference of the
Association for Biology Laboratory Education (ABLE).
Johansson, D.A. 1975. Ecology of epiphytic orchids in
west African rain forest. Amer. Orchid Soc. Bull. 44:
125–136.
Kauschik, P. 1982. Anatomy of Aerides (Orchidaceae) and its
ecological and taxonomical bearing. Phytomorphology
40: 157–166.
Kress, W.J. 1986. The systematic distribution of vascular
epiphytes: an update. Selbyana 9: 2–22.
Kurzweil, H., H.P. Linder, W.L. Stern & A.M. Pridgeon.
1995. Comparative vegetative anatomy and
classiication of Diseae (Orchidaceae). Bot. J. Linn.
Soc. 117: 171–220.
Leiria, D.P.S. 1997. Anatomia foliar das especies nativas do
gênero Oncidium Sw., Seção Synsepala (Orchidaceae)
ocorrentes no morro Santana (POA) – RS. Tesis de
Maestría. Universidade Federal do Rio Grande do Sul,
Porto Alegre.
Machado, R.D. & C.F. Barros. 1995. Epidermis and
epicuticular waxes of Syagrus coronata lealets. Canad.
J. Bot. 73: 1947–1952.
Metcalfe, C. 1963. Comparative Anatomy as a Modern
Botanical Discipline. Vol. 1. Advance in Botanical
Research. Academic Press, Londres y Nueva York.
Mohana-Rao, P.R. & S.M. Khasim. 1987. Anatomy of three
species of Bulbophyllum (Orchidaceae) with comments
on their ecological adaptability and taxonomy. Proc.
Indian Acad. of Sci. Pl. Sci. 97: 391–397.
Nelson, E.A., T.L. Sage & R.F. Sage. 2005. Functional leaf
anatomy of plants with crassulacean acid metabolism.
Funct. Plant Biol. 32: 409–419.
Olaunji, O.A. & R.O. Nengim. 1980. Ocurrence and
distribution of tracheoidal elements in the Orchidaceae.
Bot. J. Linn. Soc. 80: 357–370.
Oliveira, V.D.C & M.D.G. Sajo. 1999. Anatomia foliar de
especies epiitas de Orchidaceae. Revista Brasil. Bot.
22(3): 365–374.
Pridgeon, A.M. 1981. Absorbing trichomes in the
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
54
LANKESTERIANA
Pleurothallidinae (Orchidaceae). Amer. J. Bot. 68(1):
64–71.
Pridgeon, A.M. 1982. Diagnostic anatomical characters
in the Pleurothallidinae (Orchidaceae). Amer. J. Bot.
69(6): 921-938.
Pridgeon, A.M. 1986. Anatomical adaptations in
Orchidaceae. Lindleyana 1: 90–101.
Raciborski, M. 1898. Biologische Mittheilungen aus Java.
Flora 85: 325–361.
Rasmussen, H. 1987. Orchid stomata structure,
differentiation, funtion, and phylogeny. Vol. IV, Pp.
105–138 en: J. Arditti (ed), Orchid biology: reviews
and perspectives. Cornell Universiy Press, Nueva
York,
Reich P.B., D.S. Ellsworth, M.B. Walters, J.M. Vose, C.
Gresham, J.C. Volin & W.D. Bowman. 1999. Generality
of leaf trait relationships: a test across six biomes.
Ecology 80(6): 1955–1969.
Rosso, S.W. 1966. The vegetative anatomy of the
Cypripedioideae (Orchidaceae). Bot. J. Linn. Soc. 59:
309–341
Sinclair, R. 1990. Water relations in orchids. Vol. V, Pp.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
63–120 en: J. Arditti (ed.), Orchid biology–reviews and
perspectives. Timber Press, Portland, Oregon.
Stern, W.L., M.W. Morris, W.S. Judd, A.M. Pridgeon &
R.L. Dressler. 1993. Comparative vegetative anatomy
and systematics of Spiranthoideae (Orchidaceae). Bot.
J. Linn. Soc. 113: 161–197.
Wattendof, J.A. 1976. Third type of raphide crystal in the
plant kingdom: Six-sided raphides with laminated
sheaths in Agave americana L. Planta 130: 303–311.
Widholzer, C.F. 1993. Morfo-anatomia foliar de espécies
do gênero Sophronites Ldl. (Orchidaceae) ocorrentes
o Rio Grande do Sul, Brasil. Dissertação de Mestrado.
Universidade Federal do Rio Grande do Sul, Porto
Alegre.
Withner, C.L., P.K. Nelson, & P.J. Wejksnora. 1974. The
anatomy of orchids. Pp. 267-334 en: C.L. Withner (ed),
The Orchids: scientiic studies. John Wiley, Nueva
York,
Zotz G, V. Thomas & W. Hartung. 2001. Ecophysiological
consequences of differences in plant size: abscisic
acid relationships in the epiphytic orchid Dimerandra
emarginata. Oecologia 129:179–185.
LANKESTERIANA 11(1): 55—67. 2011.
CONSErvATiON Of MAdAgASCAr’S grANiTE OuTCrOP OrChidS:
ThE iNfluENCE Of firE ANd MOiSTurE¹
Melissa WhiTMan1,5, MiChael MeDler2, jean jaCques ranDriaManinDry3
& elisaBeTh raBakonanDrianina4
1
School of Biological Sciences, University of Nebraska, 208 Manter Hall, Lincoln, Nebraska 68588, U.S.A.
2
Huxley College of the Environment, Western Washington University, 516 High Street, Bellingham,
Washington, 98225, U.S.A.
3
BP 1571, Antananarivo 101, Madagascar.
4
Département de Biologie et Ecologie Végetale. Faculté des Sciences,
Université d’Antananarivo: BP 906, Antananarivo 101, Madagascar
5
Corresponding author: islandevolution@gmail.com
aBsTraCT. Is there a difference in response to disturbance, or resource limitation, by similar taxa based on
micro-site habitat heterogeneity? For this study we examined how ire and moisture availability inluences the
distribution of terrestrial and lithophytic orchids speciic to Madagascar’s granite outcrops (inselbergs). We
compared orchid density in an area with a complex mosaic of burned and non-burned vegetation patches (three
years after the event). Lithophytic species (subtribe Angraecinae) were sensitive to ire, but tolerant of limited
moisture availability, and had a uniform distribution pattern associated with vegetation mat size. In contrast,
most terrestrial species (subtribe Habenariinae) were not impacted by ire, but were limited to slopes with high
water seepage, and had a clumped distribution pattern. The results suggest varying ecological niches between
orchid subtribes, and among species, occurring on shared substrate. Within the larger area, we also compared
three inselbergs with different ire disturbance history. One site with potential for lightning based ires, but
absence of anthropogenic ires, had the greatest diversity (subtribes, genera, and species) of orchids and the
highest occurrence of species restricted to a single site. For land management purposes it is inappropriate to
assume that inselberg speciic orchids will have the same response to environmental stressors. Angraecinae
orchids are especially at risk from human associated ire disturbance and should be regarded as indicators for
future conservation efforts.
resuMé. Quelle est la réponse aux perturbations, et la limitation de l’humidité, par des taxons similaires basés
sur l’hétérogénéité des micro-site de l’habitat? Pour cette étude nous avons examiné comment la disponibilité de
feu et de l’humidité inluence la répartition des orchidées endémiques malgaches spéciique des afleurements
de granit (inselbergs). Trois ans après le passage du feu, nous avons compare les modes de distribution et
l’abondance d’orchidées dans un habitat d’une mosaïque complexe de brûlures, en tenant compte de la densité
par rapport à l’intensité des dégâts d’incendie et de la disponibilité de l’humidité. Les espèces du soustribu Angraecinae ont été sensibles au feu, mais tolérant à une disponibilité limitée de l’humidité. orchidées
Angraecinae avait un modèle uniforme de la distribution inluencée par la taille du tapis de végétation. Les
espèces de la sous-tribu Habenariae étaient tolérants de feu, mais limitée aux pentes rocheuses humides par des
écoulements d’eau. Habenariae ont été randomizes regroupés en masses compactes, inluencée par des facteurs
non encore identiiés. Les résultats suggèrent l’existence de différentes stratégies de survie des espèces. Il serait
inexact de penser que les orchidées voisins sur un substrat de granite aurait la même réponse à des facteurs
environnementaux ou de perturbation. orchidées Angraecoid sur les inselbergs sont exposés à des menaces
spéciiques et doivent être considérées comme des espèces indicatrices de la conservation est prioritaire à
l’avenir.
key WorDs / MoTs-Clés: conservation; inselberg de granit; Le Madagascar; Orchidaceae; Angraecinae;
Habenariinae
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
56
LANKESTERIANA
introduction. Madagascar is considered to be an
international conservation priority area because of
the high concentration of endemism and biodiversity
threatened with extinction (Bosser et al. 1996, Barthlott
& Porembski 1998, Du Puy & Moat 1998, Myers
et al. 2000). The majority of conservation efforts to
date have focused on evergreen humid forests, or
deciduous, seasonally dry forests (Bosser et al. 1996,
Du Puy & Moat 1998), rather than granite outcrops
known as inselbergs - a habitat noted for unique lora
that includes orchids, succulents, carnivorous, and
desiccant tolerant species (Bosser et al. 1996, Barthlott
& Porembski 1998, Fischer & Theisen 2000, Porembski
& Barthlott 2000).The lack of inselberg protection is in
part explained by the dificulty in identifying priority
habitat at the landscape scale (based on vegetation
type and subtle habitat characteristics) using satellite
imagery (Du Puy & Moat 1998). There is also less
social incentive to protect inselbergs because of the
absence of charismatic species (such as lemurs) that
appeal to ecotourism and environmental organizations
(Leader-Williams & Dublin 2000), however recent
multi-taxa analyses recognize the conservation
importance of sites that were previously neglected such
as habitat with sparse forest cover (ie central plateau
massifs) or smaller sized forest remnants (Bosser et al.
1996, Kremen et al. 2008). A different challenge with
managing, and maintaining, inselberg biodiversity
is due to the limited number of ecological studies
available (Barthlott & Porembski 1998, Fischer &
Theisen 2000, Porembski & Barthlott 2000), especially
those that investigate the role of disturbance on plant
communities speciic to this habitat type (Bosser et al.
1996, Porembski et al. 2000, Yates et al. 2003).
Fire is one of the most common forms of habitat
disturbance within Madagascar and is primarily
associated with human activities rather than lightning
(Bloesch 1999, Kull 2000). Culturally, ire is used for
agriculture, cattle grazing, deforestation, and even as
form of political protest (Bloesch 1999, Kull 2000,
Kull 2002, Klein 2004). Restriction of human based
ires is often at odds with the interests of villagers,
except in instances where the local belief systems (ie
taboos against burning holy sites) either directly or
indirectly beneits conservation efforts (Bloesch 1999,
Klein 2004). Even though ire has been a part of the
Malagasy landscape for many generations, there is still
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
much debate about the impact of ire disturbance on
native habitat and the appropriate ire management
approach for the future (Bloesch 1999, Kull 2000, Kull
2002, Klien 2004, Raxworthy & Nussbaum 2006).
Some scientiic studies estimate that deforestation
accounts for the rapid loss of 40% to 80% of
Madagascar’s original forest cover (Du Puy & Moat
1998, Harper et al. 2007), while other studies indicate
that habitat destruction has been grossly overestimated
(Kull 2000, Kull 2002, Klein 2004).
The historic landscape of the highlands of
Madagascar was most likely a non-continuous mix
of schlerophyllous forest, shrubland, and montane
heathland with seasonal ires associated with lightning
(Raxworthy & Nussbaum 1996, Bloesch 2002, Burney
et al. 2003). The introduction of human set ires,
extinction of megafauna, and the spread of livestock
grazing dramatically changed the ire regime; ire
intensity and frequency increased and resulted in
the emergence of homogenous prairie grasslands
as the dominant vegetation type (Bosser et al. 1996,
Raxworthy & Nussbaum 1996, Du Puy & Moat 1998,
Bloesch 1999, Fischer & Theisen 2000, Bloesch 2002,
Burney et al. 2003). The conversion of mountain forest
to grassland is considered to be nearly irreversible
(Bloesch 1999). Within Madagascar, inselbergs have
been described as naturally protected against ire with
the bare rock around their base that acts a barrier to
inhibit the spread of ire from adjacent locations
(Nilsson & Rabakonandrianina 1988). The assessment
of inselbergs as refuge for ire sensitive species in a ire
prone landscape is consistent with observations of rock
outcrops in Australia (Hopper 2000, Clarke 2002).
This observation does not exclude potential lightning
based ires from occurring; other studies have noted
extensive ires from this ignition source (Yates et al.
2003). However high elevation areas, or other habitat
with sparse or stunted vegetation (ie inselbergs), have
a reduced fuel capacity that tends to result in lower
intensity ires restricted to patches (Bloesch 2002) in
contrast to dynamics of ires in dense forests (Clarke
2002).
We addressed this ecological knowledge gap
by examining the impact of ire disturbance, and
moisture availability, on lora speciic to inselbergs of
Madagascar. Orchids were used as indicator species
of this habitat type because of the complexity of their
WhiTMan et. al — Madagascar’s inselberg orchids
57
ecological relationships and high levels of endemism
(Nilsson & Rabakonandrianina 1988, Nilsson et al.
1992, Pettersson & Nilsson 1993, Jacquemyn et al.
2005, Linder et al. 2005). We also recognized the lack
of ecological research on Malagasy orchids, aside
from those related to evolution or pollination biology
(Bosser et al. 1996). For the irst portion of the study we
included a general examination of orchid biodiversity
and ire history of the Mt. Angavokely area, followed by
a comparison of species occurrence and turnover within,
and between, three inselbergs. We then performed a more
in-depth analysis of orchid abundance on the inselberg
that was most recently burned. Overall we determined
that some endemic orchid species were highly sensitive
to ire disturbance, while others were more inluenced
by moisture availability, in an area with high micro-site
habitat heterogeneity.
(Barthlott & Porembski 1998, Fischer & Theisen
2000, Porembski & Barthlott 2000, Porembski et al.
2000). Inselbergs are often describe as ‘biological
islands’ because their habitat characteristics and
vegetation is exceptionally distinct from the
surrounding landscape matrix (Porembski et al.
2000). The vegetation is dominated by species such
as Helichrysum spp. and Senecio spp. (Asteraceae);
Kalanchoe
synsepala
Baker
(Crassulaceae);
Coleochloa setifera (Ridl.) Gilly (Cyperaceae); Aloe
capitata Baker (Liliaceae); Angraecum sororium
Schltr. (Orchidaceae); Nematostylis anthophylla
A. Rich. (Rubiaceae); Xerophyta dasyliriodes
Baker (Velloziaceae); and various specis of moss,
lichen, cyanobacteria, carnivorous plants, and ferns
(Barthlott & Porembski 1998, Fischer & Theisen
2000, Kluge & Brulfert 2000) (Fig. 1).
Methods
Fire History – Our study took place in 2004, three
years after a ire that burned an estimated third of
the Mt. Angavokely area. The timing allowed us
to assess signs of species recovery or colonization
post ire disturbance. We assessed ire history using
historical site descriptions and photographs (Nilsson
& Rabakonandrianina 1988, Nilsson et al. 1992,
Pettersson & Nilsson 1993), and by interviewing
local residents and elders of the neighbouring villages
of Ambohijafy and Ambohimiadona. Additional
photographs, taken post-ire by J.J. Randriamanindry
were also used as reference. Within the Mt. Angavokely
forest area, we speciically researched the ire history
of three of the largest inselbergs (Ambatolava,
Ambatomisondrotra, Angavobe).
The irst inselberg, Ambatolava, 1645m, had
a ire that occurred in November 200l. The ire was
believed to be human caused because it occurred
during a period of political instability. Villagers may
have used arson as a form of protest, or as an attempt
to expand agropastoral ires during civil unrest
(Bloesch 1999, Kull 2002). The intensity of the ire
was also inluenced by the surrounding plantations
of pyrophytic Eucalyptus robusta Sm., Pinus patula
Schltdl. and Cham., and Pinus khasya Royle ex Hook.
f.. with a higher fuel load accumulation (dry needles,
fallen leaves, and bark) than the neighboring sections
of native forest. In addition, the ire was ignited
towards the lower side of Ambatolava and resulted
Site Description – Our primary (in-depth) study
took place on the Ambatolava inselberg of the Mt.
Angavokely Forest Station located in the central
highlands of Madagascar, 40 km SE of Antananarivo
(18°55’4” S, 47°43’9” E). The site is managed
by Direction Générale des Eaux et Forêts. Over
the past twenty years, signiicant orchid related
research has occurred at Mt. Angavokely (Nilsson
& Rabakonandrianina 1988, Nilsson et al. 1992,
Pettersson & Nilsson 1993, Kluge et al. 1998, Kluge
& Brulfert 2000), in part because of the presence of
high orchid diversity with 101 species and 22 genera
identiied (Ceplitis & Broström 1998). The property
is 695 ha in size, of which inselbergs with rupicolous
shrubland vegetation comprise 110 ha, plantations of
non-native pine and eucalyptus comprise 435 ha, and a
mix of moist sub-montane forest and schlerophyllous
forests occur in the remaining area (estimate of 1949
aerial photograph, Ceplitis & Broström 1998). The
elevation ranges from 1,365m to 1,770m. Annual
precipitation ranges from 1,500mm to 2,000mm,
occurring 180 days of the year (Ceplitis & Broström
1998), with fog as the primary source of moisture
during the dry season that spans from April to October
(Kluge & Brulfert 2000).
The inselbergs of Madagascar have granite
substrate, high levels of UV radiation and wind,
temperature luctuations, and thin nutrient poor soils
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
58
LANKESTERIANA
A
B
Figure 1. A. The orchid Angraecum sororium on an unburned vegetation mat in the foreground. Severely burned vegetation
mats are neighboring in the background. Whitman, 2003. B. The orchid Cynorkis unilora on a wet slope amongst
charred vegetation remains. Randriamanindry, 2003.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
WhiTMan et. al — Madagascar’s inselberg orchids
in an uphill burn pattern of higher intensity (Bloesch
1999) in contrast to lightning based ires (ignition at
the highest point) that tend to have a downhill burn
pattern of reduced destructive potential. Prior to the
2001 ire, Ambatolava was noted for its high density of
A. sororium (Nilsson & Rabakonandrianina 1988).
The second inselberg, Ambatomisondrotra, 1650m,
was the site of a high intensity ire that occurred in
the early 1990’s (also believed to be human caused).
Prior reports noted that the area once had similar
vegetation composition as the unburned regions of the
Ambatolava inselberg (unpubl. data). The ire resulted
in near complete removal of larger shrubs from the mid
to upper portion of the inselberg. Ambatomisondrotra
had a more uniform burn pattern than Ambatolava
because of the steepness of the slope (Bloesch 1999)
and from observations of the site shortly after the event
(Randriamanindry, pers. comm. 2004).
The third inselberg Angavobe, 1755m, was a site
with unique cultural signiicant that inluenced the ire
regime history. Local villagers described social fady,
a taboo based belief system, that discouraged people
from setting ire to the forest because of the presence
of royal tombs (featuring pre and post Christianity
stylization) and sacriicial stones (Randriamanindry,
pers. comm. 2004). The oldest tomb was associated
with Andrianajavonana, “the noble who disappeared” a
Merina king of the Central Highlands estimated to be
from the 14th century (Randriamanindry, pers. comm.
2004). Commoners were socially prohibited from
harming the forest on Angavobe nearest the tombs
because it was considered to be property of royalty
even after death (Randriamanindry, pers. comm. 2004).
A secondary social incentive was reinforced in the
1800’s during the reign of Queen Ranavalona I when
the Angavobe caves were used as refuge from slavery
and religious prosecution (Randriamanindry, pers.
comm. 2004). This social belief system created small
protected areas of native vegetation where lightning, but
not human based ires, have existed for generations.
General Orchid Survey – We conducted a rapid
biodiversity assessment of orchid occurrence (presence
or absence of species) at the Ambatolava, Angavobe,
and Ambatomisondrotra inselbergs, and a more indepth survey of orchid abundance speciically at
Ambatolava. Plants were photographed and identiied
59
to genus or species in the ield. No plants were taken
from the site or harmed due to the endangered status of
many endemic orchids. Species lists and images were
then compared to botanical inventories conducted by
the University of Antananarivo, Madagascar; Uppsala
University, Sweden (Ceplitis & Broström1998); the
Missouri Botanical Gardens W3TROPICOS database;
and species descriptions by Perrier (1939 & 1941), Du
Puy et al. (1999), Hermans et al. (2007), and Cribb &
Hermans (2010).
Patterns of Orchid Diversity. – For the larger-scale portion
of this study we compared the species present on all the
three inselbergs (γ-diversity), per inselberg (α-diversity),
and between inselbergs (β-diversity), using data from
the general orchid survey. We were especially interested
in the beta-diversity measures of species turnover
between sites (Ambatolava, Ambatomisondrotra, and
Angavobe) that were similar in elevation range, climate,
geological history, and that shared a regional species
pool, yet possessed differing ire history. Our goal was
to gain a preliminary understanding of how gradients
of historical habitat disturbance, rather than elevation
(Jacquemyn et al. 2005), might inluence the distribution
patterns of orchids. The inselbergs (going east to west)
were arranged: Angavobe to Ambatomisondrotra to
Ambatolava, and ran roughly in a line 5km in length
and separated by a minimum of 2 km from each other.
We used three equations (Jaccard distance, Sørensen
distance, and Simple Matching Coeficent) based on
the applied recommendations for presence/absence
data noted by Anderson et al. (2011). All indices used
emphasized distance or dissimilarity between sites
(value of 0 meaning identical species composition).
The beta-diversity was calculated as follows: Jaccard
distance dJ [1 – a/(a + b + c)]; Sørensen distance dS =
[1 – 2a/(2a + b + c)]; and Simple Matching Coeficient,
dSM = 1 - (a + e) / (a + b + c + e); where a is a species
presence at both sites (11), b (10) or c (01) is a species
present at only one of the two sites, and e (00) is a
species missing from both sites but found within the
greater area (Anderson et al. 2011).
In-depth Survey of Orchid Abundance. - For the site
speciic (more intensive) portion of this study we
focused on the Ambatolava Inselberg, the only location
with burn patterns that could be clearly evaluated in
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
60
LANKESTERIANA
relation to a ire with a known occurrence date (2001).
At the Ambatolava site we surveyed seven 50m x
2m line transects located between 1460m to 1645m
in elevation. We drew the transect lines across all
accessible regions using a 50m survey tape, compass,
and GPS (Garmin Geko 301). The line transects were
a minimum distance of 75m apart and ran horizontally
from south to north on the central ridge or eastern
slope (the western side was inaccessible). Within 1m
on either side of the transect line per vegetation mat
we counted the number of orchids present based on
distinct above ground growth, rather than the number
of canes, stems, or underground growth. We deined a
vegetation mat in a generalized manner that included
monocotyledonous mats dominated by C. setifera or
X. dasyliriodes, ephemeral lush vegetation, moss
cushions, or charred humus or vegetation remains
(Barthlott & Porembski 1998, Fischer & Theisen 2000,
Kluge & Brulfert 2000, Porembski & Barthlott 2000,
Porembski et al. 2000).
We identiied lowering species along the transect
lines and categorized all orchids as lithophytic (epilithic)
or terrestrial. Lithophytic orchids are found primarily
on granite (or occasionally as epiphytes), and are slow
growing with drought tolerant waxy leaves and aerial
roots. Many lithophytic species in Madagascar are
associated with the subtribe Angraecinae (species such
as Angraecum sororium or Jumellea rigida Schltr.)
or from the subtribe Aerangidinae with species such
as Aerangis ellisii (B.S. Williams) Schltr.. Terrestrial
orchids are also found on inselbergs and occasionally
grasslands, with tuberous roots and periods of
underground dormancy during the dry season. Many
terrestrial orchids are from the subtribe Habenariinae
(such as Cynorkis unilora Lindl.) or Brownleeinae
(such as Brownleea coerulea Harv. ex Lindl.).
Environmental Factors – We surveyed environmental
factors that were hypothesised to play a signiicant role
in the micro-site distribution patterns of orchids. The
irst environmental factor we examined in the ield was
based on the impact of ire, categorized by severity and
deined as:
•
•
Non-burned: areas with no signs of ire or
signiicant heat damage;
Minor to moderate: areas with a mosaic of heat
or ire damage to no more than two thirds of the
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
•
vegetation, upper branches of plants may have had
some heat damage or ire effects but little to no
signs of ground level ire;
Severe: majority of the pre-ire vegetation charred
or dead with signs of high heat intensity and ire
effects at ground level.
The second factor examined was the inluence of
moisture availability (separate from water acquired
directly from precipitation, fog, or dew accumulation
on leaves) deined as:
•
•
Wet: areas with continuous water seepage,
dark granite slick from moisture saturation and
cyanobacteria, with thick layers of moss or
ephemeral lush vegetation (Barthlott & Porembski,
1998; Porembski et al. 2000; Fischer & Theisen,
2000).
Dry: areas with no sign of water seepage, dry soil,
and granite above and below the vegetation mat
light in color.
Statistical Analyses – We analyzed the evenness
of vegetation mat categories (combinations of ire
severity and moisture availability) using a two by three
contingency table. The relationship between orchid
density per m² and ire severity (non-burned, minormoderate, and severe) was analyzed using a nonparametric Kruskal-Wallis test; moisture availability
(with or without presence of seasonal water seepage)
was analyzed using a two-sample Wilcoxon test. We
analyzed the number of orchids in relation to the size
of non-burned vegetation mats with linear regression,
if there was a signiicant positive relationship then a
pre-ire population estimate would be made. Next, we
analyzed the interspecies interaction for orchids in all
areas using linear correlation. Lastly, we described the
spatial distribution (random, even, or clumped) using the
Index of Dispersion and Index of Clumping. All analyses
were speciic to species, genus, or subtribe depending
on the sample size and evenness between groups. All
statistical analyses had α=0.05 and were performed with
R software version 2.3.1 (www.r-project.org).
results
General Orchid Survey – A total of seventeen orchid
species from seven genera and six subtribes (plus two
unusual white morphs) were found on one or more of
61
WhiTMan et. al — Madagascar’s inselberg orchids
TaBle 1. General survey of orchid presence and absence on three inselbergs at the Mt. Angavokely Forest Station.
Angavobe
Ambatolava
Aerangis ellisii
X
X
Angraecum sororium
X
X
X
Angraecinae
Jumellea maxillarioides
X
X
X
Brownleeinae
Brownlea coerulea
X
Habenariinae
Bulbophyllum sp. 1
X
Cynorkis angustipetala
Aerangidinae
Angraecinae
Angraecinae
Bulbophyllinae
Habenariinae
Habenariinae
Habenariinae
Habenariinae
Habenariinae
Habenariinae
Habenariinae
Habenariinae
Habenariinae
Jumellea rigida
X
Cynorkis baronii
X
Cynorkis coccinelloides
X
Cynorkis fastigiata
X
Cynorkis gibbosa
X
Cynorkis gibbosa*
X
Cynorkis lilacina
Cynorkis perrieri
Cynorkis unilora
Cynorkis unilora*
X
X
X
X
X
X
X
Cynorkis sp. 1
X
Polystachyeae
Polystachya rosea
X
Cynorkis sp. 2
X
X
Habenariinae
Habenariinae
Ambatomisodrotra
X
* Unusual white lower morph
the inselbergs surveyed (Table 1 & 2). The orchids
present were estimated to represent 17% of the overall
Orchidaceae diversity across all habitats of the greater
Mt. Angavokely area (Ceplitis & Broström1998), and
represented 17 out of 33 (51%) of the inselberg speciic
species found in Madagascar (Fischer & Theisen
2000). The most common orchids encountered at all
three inselbergs included Cynorkis fastigiata Thouars,
Cynorkis unilora, and Angraecum sororium. Some
species were found at two locations, such Aerangis
ellisii, Cynorkis gibbosa Ridl., and Jumellea rigida.
However, a total of eleven orchids (65%) were
restricted to a single site (Table 1 & 2).
The Ambatolava inselberg was the only site with
Cynorkis angustipetala Ridl., Cynorkis lilacina
Ridl., and an unidentiied Cynorkis sp. Thouars..
Ambatomisondrotra was the only site with Cynorkis
baronii Rolfe, or Cynorkis coccinelloides Schltr., and
was unique in that it was also the site of the largest
colony of C. unilora noted. We also observed a
distinct absence of Angraecinae species (including
seedlings) from the entire upper region of the inselberg
that had been burned; the exception being a J. rigida
near the unburned forest edge. Angavobe, the area
with lightning but not human associated ires, had
the highest diversity of orchids unique to a single
site, including Brownleea coerulea, unidentiied
Bulbophyllum sp. Thouars, Cynorkis perrieri
Schltr., unidentiied Cynorkis sp. Thouars, Jumellea
maxillarioides (Ridl.) Schltr., Polystachya rosea Ridl.
and unusual white morphs of Cynorkis gibbosa Ridl.
and Cynorkis unilora Lindl.. Angavobe was notable
as the location with the most massive A. sororium
surveyed with individual canes >4m in length (max.
height of 1.5m noted elsewhere) and with >250 nodes
present that typically mark annual growth (one pair of
leaves per year). We estimated the largest A. sororium
(individual or colony) at Angavobe to be hundreds of
years old.
Patterns of Orchid Diversity - The transition
of species diversity (β-diversity) using Jaccard
distance (dJ), Sørensen distance (dS), and Simple
Matching Coeficient (dSM) was estimated for paired
site combinations. Each individual inselberg was
represented by a single letter as follows: Ambatolava
(L) – burned 2001, Ambatomisondrotra (M) – burned
1990’s, and Angavobe (G) –human ires absent. The
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
62
LANKESTERIANA
TaBle 2. Patterns of orchid diversity on inselbergs.
Unique occurrence count
Total Diversity of Inselbergs Surveyed
Combined list of all species found on the three inselbergs, Angavobe,
Ambatolava, and Ambatomisondrotra
SUBTRIBE
GENUS
SPECIES
6
7
17
Diversity per Inselberg
Fire History
Total for Angavobe
Absence of human associated ires
6
7
Total for Ambatomisondrotra
Human associated ire in 1990’s
2
3
8
Total for Ambatolava
Human associated ire in 2001
3
4
7
SUBTRIBE
GENUS
SPECIES
SUBTRIBE
GENUS
SPECIES
11
Orchid Distribution, Patterns of Overlap or Isolation
Description
Distribution
Code
Widespread
Angavobe, Ambatolava, & Ambatomisodrotra
GLM
2
3
3
Variable
Angavobe & Ambatolava
GL
1
1
1
Variable
Angavobe & Ambatomisodrotra
GM
0
0
1
Variable
Ambatolava & Ambatomisodrotra
LM
0
0
1
6
Site speciic
Angavobe only
G
3
3
Site speciic
Ambatolava only
L
0
0
2
Site speciic
Ambatomisondrotra only
M
0
0
3
results are summarized as: L & M - (dJ = 0.64, dS =
0.47, dSM = 0.41), L & G (dJ = 0.71, dS = 0.56, dSM =
0.59), and M & G (dJ = 0.73, dS = 0.58, dSM = 0.65). All
indices revealed a similar trend; paired burned sites (L
& M) had a lower β-diversity distance score (reduced
turnover and greater similarity of species present)
than pairing of inselbergs with burned and nonburned ire history. The inclusion of information on
species absence (relative to γ-diversity) resulted in the
greatest dissimilarity between inselberg combinations
as noted with the Matching Coeficient (dSM max - dSM
= 0.24), compared to Jaccard distance (dJ max – dJ min
min
= 0.10) and Sørensen distance (dS max – dS min = 0.11)
that emphasized joint species presence. Joint absences
also revealed that the combined species diversity for
burned sites (Ambatolava and Ambatomisondrotra)
was missing six out of the seventeen possible inselberg
orchids surveyed from the larger area (30% of the
γ-diversity).
In-depth Survey of Orchid Abundance – At
Ambatolava, we surveyed 700 m², and counted 45
vegetation mats totaling 450.7 m². The vegetation
mats varied greatly in shape, size (5.35m²±SE0.83)
and distance (2.65m²±SE0.74) from each other edge
to edge. We counted a total of 45 lithophytic orchids
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
from the subtribe Angraecinae (36 A. sororium and
nine Jumellea rigida) and 310 terrestrial orchids from
the subtribe Habenariinae (one Cynorkis angustipetala
Ridl., 52 C. fastigiata Thou., and 257 C. unilora).
All species were endemic to Madagascar, except for
C. fastigiata, a species indigenous to Madagascar,
Comoros, the Mascarenes, and Seychelles (Perrier
1939 & 1941). Both subtribes were present at an equal
number of sites (fourteen out of forty ive vegetation
mats), but the distribution by individual species was
unpredictable. Some orchids were relatively abundant,
but restricted to a limited number of locations (such
as C. unilora with 257 individuals at eight sites). We
then found it necessary to group the orchids together
by subtribe for a more even comparison of the taxa.
Environmental Factors – We categorized 15 of the
vegetation mats as non-burned (118m² = 26%), 11
with minor to moderate ire damage (113m² = 25%),
and 19 (219.70² = 49%) as having severe ire damage.
Non-burned and severely burned vegetation mats were
observed directly neighboring each other. The moisture
of the slopes also varied, 25 mats (285.8m² = 63%)
ranged from being damp to having continuous water
seepage, and the other 20 mats (164.90m² =36%) were
extremely dry. The 2x3 contingency table analysis
WhiTMan et. al — Madagascar’s inselberg orchids
showed a signiicant difference in the evenness of the
ire/moisture combinations of vegetation mat categories
(Pearson’s Chi Square= 8.246, p=0.016), but there
was no clear pattern to predict which areas would be
burned (wet with severe ire damage was the most
common combination). However, other factors might
have inluenced ire patterns such as wind exposure,
steepness of slope, or distance to the plantation tree
line. Vegetation mats that were the least impacted by
ire were in depressions or issures in the rock; sheltered
from wind; or were isolated from each other.
Orchid Response to Environmental Factors – For the
lithophytic Angraecinae orchids, ire severity was
highly signiicant Fig 1. A. (all species, KruskalWallace chi-squared 18.6445, df = 2, p-value =
<0.001; A. sororium, Kruskal-Wallace chi-squared
19.025, df = 2, p-value = <0.001) There was no
signiicant relationship between orchid density and
moisture availability by subgroup or by species. The
orchids had the highest density (0.32 per m², equal to
84% of those surveyed) in unburned areas, followed
by (0.06 per m², equal to 16% of those surveyed) in
minor to moderately burned areas, and no individuals
in severely burned areas. The signiicant results for
the terrestrial Habenariinae were opposite from that of
the lithophytic Angraecineae. Fire was not signiicant,
yet moisture availability was highly signiicant Fig 1.
B. (all species, Wilcox rank sum, w= 149, p-value =
0.005; C. unilora, Wilcox rank sum, w= 170, p-value
= 0.006). The exception to the Habenariinae trend
was C. fastigata, which was not sensitive to moisture
availability, but was to ire (Kruskal-Wallis chisquared = 8.210, df = 2, p-value = 0.016). Terrestrial
Habenariinae orchids had the highest density average
(1.1 per m², equal to 99% of those surveyed) in wet
areas, including locations with severe ire damage.
Species level analyses were non-signiicant for the
least common of the orchids surveyed, C. angustipetala
(Habenariinae) and J. rigida (Angraecinae).
Orchid Distribution - Angraecinae had a signiicant
relationship between the number of orchids and the
size of a non-burned vegetation mat (adjusted R² =
0.473, p-value = 0.003, n=15), but Habenariinae did
not, even in wet non-burned areas. Preire population
estimates were made for Angraecinae (but could
not be made for Habenariinae) based on the linear
63
equation (number of orchids= 0.251 * mat size +
0.562). We estimated that 67% of the lithophytic
Angraecinae orchids at Ambatolava perished during
the 2001 ire.
There was no signiicant interaction between the
two orchid subtribes (Angraecinae and Habenariinae);
including results from a post-hoc analysis of positive
environmental factors (non-burned sites, wet sites,
and non-burned wet sites). There was a positive
association between A. sororium and C. fastigata
(Kendall’s Rank Correlation, tau = 0.590, p-value =
<0.001) and to a lesser extent between A. sororium
and J. rigida (Kendall’s Rank Correlation, tau = 0.273
, p-value = 0.049). Angraecinae had a uniform pattern
of distribution (Index of Dispersion = 0.436, Index of
Clumping = -0.564) with the highest density in nonburned areas. Habenariinae had a clumped pattern of
distribution (Index of Dispersion = 8.711, Index of
Clumping = 7.711) with the highest density in wet areas.
discussion
General Orchid Survey – The diversity of endemic
orchids on inselbergs, and the vulnerability of some
species to anthropogenic disturbance, reinforces the
conservation importance of this unique habitat type. The
most compelling observation from the general orchid
survey was the higher biodiversity at Angavobe, a site
with lightning based ires but absence of anthropogenic
ires, compared to Ambatomisondrotra (ire in 1990’s)
or Ambatolava (ire in 2001). Angavobe was also
the site with the highest number of species (six) and
genera (three) restricted to a single site. One concern
for the future is whether or not Angavobe will continue
to be regarded as an important cultural site, or if the
traditional knowledge of restricted burning near tombs
and sacriicial stones will be lost with the passing of
generations or the immigration of individuals from
different regions who are unaware of this social fady.
Additional conservation protection of the Angavobe
inselberg, ideally in partnership with neighboring
villagers, environmental organizations, and regional
land managers, is highly recommended.
Spatial Patterns of Orchid Diversity – We found
that sites with a shared history of ire disturbance
(Ambatomisondrotra and Ambatolava) had species
composition more similar to each other than
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
64
LANKESTERIANA
combinations with differing ire history regardless of
spatial orientation; a pattern most noticeable when
factoring in joint-absences of species (Matching
Coeficent). Our average Sørensen distance (0.53)
was more similar to the average value (0.5) noted on
African (Cameroon, Gabon, Guinea) inselbergs across
a range of plant formations (Parmentier et al. 2005),
than the beta-diversity of orchids (0.25) observed
across elevational gradients on the neighboring island
of Réunion (Jacquemyn et al. 2005), suggesting that
our results may be more of a relection of inselberg
plant communities than patterns speciic to orchids.
A larger scale analysis of Malagasy orchid betadiversity, especially in relation to gradients of habitat
disturbance, is recommended for the future.
Orchid Response to Environmental Factors –
Lithophytic Angraecinae orchids were ire sensitive
and were interpreted to rely on other adaptations
to successfully tolerate temperature and moisture
luxuations and to compete against dominant
inselberg vegetation such as X. dasyliriodes or A.
capitata. Angraecinae survival adaptations include
environmental stress tolerance (Kluge et al. 1998,
Kluge & Brulfert 2000), year round photosynthesis,
and the ability to grow taller than neighboring
shrubs or forbs to compete for resources. Inter and
intraspeciic competition may explain the uniform
distribution pattern noted.
We were surprised that Angraecinae orchids were
so sensitive to heat damage given that Porembski &
Barthlott (2000) noted that some drought tolerant
monocots were protected from ire by the dense
growth of leaves and roots covering the pseudostem.
However we did observe that A. sororium had more
signs of heat damage than leshy succulents (ie Aloe
capitata) of similar height in the same area. Post-ire
regeneration by A. sororium in areas of moderate ire
damage was only noted at the center of exceptionally
large orchid patches. Angraecinae orchids may be
more vulnerable to ire due to their year round foliage,
aerial roots, and tolerance for the driest slopes. They
also tend to acquire a thick cushion of moss, leaves,
and organic material around their base (Kluge &
Brulfert 2000) that helps to hold moisture, but may
also increases the available fuel biomass (intensity of
ire) per vegetation mat.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
An important conservation question raised by
this study is: “how long will it take for Angraecinae
to recover from human associated ire damage?”
Populations may be resilient against disturbance
events by the longevity of reproductively successful
individuals, but only if the habitat conditions remain
suitable for their offspring and enough unique
individuals remain to prevent a genetic bottleneck. The
largest Angraecinae observed lowering (A. sororium)
was interpreted to be very long lived (multi-decade,
or even multi-century at Angavobe), an age span
consistent with other inselberg species (Porembski &
Barthlott 2000). However no Angraecinae seedlings
were found repopulating burned mats three years or
even >10 years post-ire despite the relatively high
availability of seed sources from multiple individuals
within the area (unpubl. data). Inhibited establishment
of seedlings post-ire has also been described for
other non mat-forming inselberg species (Porembski
& Barthlott 2000) and is a threat to endemic lora as
the rate of human caused ires increases. For future
studies it would be useful to gain a more expansive
and long-term (multi-generational) understanding of
metapopulation dynamics of Angraecinae orchids,
especially compared to Habenariinae, to establish a
stronger estimate of recovery time post-disturbance.
The terrestrial Habenariinae orchids of our
study were limited primarily by their micro-habitat
preference for wet slopes rather than by ire. Prior
studies of C. unilora also noted the highest orchid
abundance in locations with continuous or ephemeral
water seepage (Nilsson et al. 1992, Fischer & Theisen
2000). The smaller size (10-30cm), lack of water
storing leshy leaves or pseudobulbs, and the rapid
season-speciic growth of these orchids may explain
their moisture dependency. Future studies that include
other environmental factors found to be signiicant
for inselberg lora, such as soil pH, depth, or distance
to native forest (Parmentier 2003), might explain
why Habenariinae orchids displayed such clumped
patterns of distribution and abundance independent
from vegetation mat size or co-occurrence of
Angraecinae species.
The enigmatic orchid of this study was C.
fastigiata, with habitat preferences similar to A.
sororium. One possible explanation is that both
orchids share similar mycorrhizal fungi preferences
WhiTMan et. al — Madagascar’s inselberg orchids
for germination; or that C. fastigiata ills a different
habitat or successional niche than C. unilora or C.
angustipetala. This result raises the debate as to
whether species should be grouped together based on
phylogenetic similarity or by habitat needs.
Within Madagascar, it has been noted that
Habenariinae orchids (genus Cynorkis and
Habenaria) and similar terrestrial orchids of various
other subtribes (genus Liparis, Eulophia, Benthamia,
Lissochilus, Disa, Satyrium) beneit from occasional
ires and sustainable disturbance that create “orchid
meadows” with reduced interspecies competition
(Rabetaliana et al. 1999, Bloesch et al. 2002). This
trend has also been described globally for terrestrial
orchids in locations such as Australia (Yates et al.
2003), and South Africa (Linder et al. 2005), with
some pyrogenic orchids (such as Cyanicula ashbyae
Hopper and A.P.Br.) only lowering within the irst
year post-ire (Yates et al. 2003). Fire may be less
of a threat to Habenariinae orchids because of their
tuberous roots, underground dormancy during the dry
season, and tolerance of thinner topsoil that can occur
after burning and erosion.
A different question raised by this study is:
“why did the two orchid subtribes have different
survival strategies, or ecological niches, within a
shared habitat if their distribution was independent
from each other?” One explanation is that when ire
occurs, it creates an irregular mosaic-like pattern
of ire disturbance, allowing for different stages
of succession per vegetation mat with reduced
competition for resources. Another perspective is that
inselbergs might support both equilibrium and nonequilibrium based plant communities within a small
spatial scale and that the differences between orchid
subtribes are a relection of larger species composition
trends. Angraecinae might be considered to be a
part of an equilibrium (or late-successional) based
community, inluenced by biotic competition year
round; whereas Habenariinae might be within a nonequilibrium, ephemeral lush vegetation community
heavily inluenced by abiotic conditions or stochastic
disturbances (Porembski et al. 2000).
Conclusion. From this study it can be concluded
that it is inappropriate to assume that all species of
inselberg Orchidaceae have the same response to
65
ire or habitat moisture requirements. Lithophytic
Angraecinae were sensitive to ire, but tolerant of
limited moisture availability, and had a uniform
pattern of distribution. In contrast, terrestrial
Habenariinae were not as affected by ire but were
limited to slopes with high water seepage and had
a clumped pattern of distribution. Lithophytic
Angraecinae orchids are considered to be at risk and
an increase in the frequency or severity of ire may
negatively affect sustainable population sizes. Further
conservation of inselberg habitat and its unique lora
is strongly recommended.
aCknoWleDgeMenTs. Special thanks to David Mason
and Fairhaven College for the Adventure Learning Grant;
the Northwest Orchid Society; Seacology; University of
Antananarivo; Direction Générale des Eaux et Forêts;
Kathryn Anderson, John Bower, Robin Matthews, and
John McLaughlin of Western Washington University;
Zachary Rogers and the Missouri Botanical Gardens;
Nivo Raharison; and Urs Bloesch, L. Anders Nilsson,
Ingrid Parmentier, and Nathan G. Swenson for feedback.
Additional thanks to Lankesteriana reviewers, and
anonymous feedback received at the 18th World Orchid
Conference (Dijon, France) and the Sigma Xi Conference
(Seattle, U.S.A). In Memoriam of Joyce Stewart (1936 2011) and her advocacy of Angraecoid orchid conservation.
liTeraTure CiTeD
Anderson, M.J., T.O. Crist, J.M. Chase, M. Vellend, B.D.
Inouye, A.L. Freestone, N.J. Sanders, H.V. Cornell, L.S.
Comita, K.F. Davies, S.P. Harrison, N.J.B. Kraft, J.C.
Stegen & N.G. Swenson. 2011. Navigating the multiple
meanings of beta diversity: a roadmap for the practicing
ecologist. Ecol. Lett. 14: 19-28.
Barthlott, W. & S. Porembski. 1998. Diversity and
phytogeographical afinities of Inselberg vegetation in
tropical Africa and Madagascar. Pp. 119-129 in: C.R.
Huxley, J.M. Lock & D.F. Cutler (eds.), Chorology,
taxonomy and ecology of the loras of Africa and
Madagascar. Kew, Kew Publishing.
Bloesch 1999. Fire as a tool in the management of a
savanna/dry forest reserve in Madagascar. Appl. Veg.
Sci. 2: 117-124.
Bloesch, U., Bosshard, A.P. Shachenmann, H. Rabetaliana
& F. Klötzli. 2002. Biodiversity of the subalpine
forest-grassland ecotone of the Andringitra Massif,
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
66
LANKESTERIANA
Madagascar. Pp. 165-175 in: C. Körner & E.M. Spehn
(eds.), Mountain biodiversity- a global assessment.
London, Parthenon Publishing.
Bosser, J.M., Du Puy, D.J. & P. Phillipson. 1996.
Madagascar and surrounding islands. Pp. 103-107 in:
IUCN/SSC Orchid Specialist Group; Status Survey and
Conservation Action Plan – Orchids. IUCN Switzerland
and UK.
Burney, D.A., G.S. Robinson & L.P. Burney. 2003.
Sporomiella and the late Holocene extinctions in
Madagascar. P Natl. Acad. Sci. 100: 10800-10805.
Ceplitis, A. & A. Broström. 1998. Vascular plant diversity in a
mountain rainforest at Station Forestière d’Angavokely,
Madagascar. Minor ield study report 039. Uppsalla,
Committee for Tropical Ecology Uppsalla University.
Clarke, P.J. 2002. Habitat islands in ire-prone vegetation: do
landscape features inluence community composition?
J. Biogeogr. 29: 677-684.
Cribb, P.J. & J. Hermans. 2010. Field guide to the orchids of
Madagascar. Kew, Kew Publishing.
De La Bathie, H.P. 1939, 1941. Flora of Madagascar,
49th Family - Orchids. Paris, France. Translated by
S. Beckman. 1981. Volume I and II combined. Lodi,
California.
Du Puy, D. & J.F. Moat. 1998. Vegetation mapping and
classiication in Madagascar (using GIS): implications
and recommendations for the conservation of
biodiversity. Pp 97 -117 in: C.R. Huxley, J.M. Lock, &
D.F. Culter (eds.), Chronology, taxonomy and ecology
of the loras of Africa and Madagascar. Kew, Kew
Publishing.
Du Puy, D., P.J. Cribb, J. Bosser, J. Hermans & C. Hermans.
1999. The Orchids of Madagascar. First edition. Kew,
Royal Botanical Gardens.
Fischer, E. & I. Theisen. 2000. Vegetation of Malagasy
inselbergs. Pp. 259-276 in: S. Porembski & W. Barthlott
(eds.), Inselbergs biotic diversity of isolated rock
outcrops in tropical and temperate Regions. Berlin,
Springer-Verlag.
Jacquemyn, H., C. Micheneau, D.L. Roberts & T. Pailler.
2005. Elevation gradients of species diversity, breeding
system and loral traits of orchid species on Réunion
Island. J. Biogeogr. 32: 1751-1761.
Klein, J. 2004. Fiddling while Madagascar burns.
Deforestation discourses and highland history. Norw. J.
Geog. 58: 11-22.
Kluge, M., B.Vinson & H. Ziegler. 1998. Ecophysiological
studies on orchids of Madagascar: incidence and
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
plasticity of crassulacean acid metabolism in species
of the genus Angraecum Bory. Plant Ecol. 135: 43-57.
Kluge, M & J. Brulfert. 2000. Modes of photosynthesis
in plants of Mt. Angavokely (Central High Plateau of
Madagascar). Pp. 161-174 in: S. Porembski and W.
Barthlott (eds.), Inselbergs biotic diversity of isolated
rock outcrops in tropical and temperate regions. Berlin,
Springer-Verlag.
Kull, C.A. 2000. Deforestation, erosion, and ire:
degradation myths in the environmental history of
Madagascar. Environ. Hist. 6: 423-450.
Kull, C.A. 2002. Madagascar alame: landscape burning as
peasant protest, resistance, or a resource management
tool? Pol. Geogr. 21: 927-953.
Kremen, C., A. Cameron, A. Moilanen, S.J. Philips, C.D.
Thomas, H. Beentje, J. Dransield, B.L. Fischer, F.
Glaw, T.C. Good, G.J. Harper, R.J. Hijams, D.C.
Lees, E. Louis Jr., R.A. Nussbaum, C.J. Raxworthy,
A. Razaimpahanana, G.E. Schatz, M. Vences, D.R.
Vieties, P.C. Wright & M.L. Zjhra. 2008. Aligning
conservation priorities across taxa in Madagscar with
High-Resolution Planning Tools. Science 320: 222-226.
Harper, G.J., M.K. Steininger, C.J. Tucker, D. Juhn &
F. Hawkins. 2007. Fifty years of deforestation and
forest fragmentation in Madagascar. Environmental
Conservation 34: 325-333.
Hopper, S.D. 2000. Creation of conservation reserves and
managing ire on granite outcrops – a case of study of
Chiddarcooping Nature Reserve in Western Australian
wheatbelt. J. Roy. Soc. W. Aust. 83: 173-186.
Hermans, J., C. Hermans, D. du Puy, P.J. Cribb & J. Bosser.
2007. Orchids of Madagascar. Second edition. Kew,
Kew Publishing.
Leader-Williams, N & H.T. Dublin. 2000. Charismatic
megafauna as ‘lagship species’. Pp 53-81 in: A.
Entwistle & N. Dunstone (eds.), Priorities for the
Conservation of Mammalian Diversity: Has the Panda
Had its Day? Cambridge, Cambridge University Press.
Linder, H.P., H. Kurzweil & S.D. Johnson. 2005. The
Southern African orchid lora: composition, sources and
endemism. J. Biogeogr. 32: 29-47.
Myers, N., Mittermeier, R.A., Mittermeier, C.G., da
Fonseca, G.A.B & J. Kent. 2000. Biodiversity hotspots
for conservation priorities. Nature. 403: 853 – 858.
Nilsson, L.A. & E. Rabakonandrianina. 1988. Hawk-moth
scale analysis and pollination specialization in the
epilithic Malagasy endemic Aerangis ellisii (Reichenb.
il.) Schltr. (Orchidaceae.) Bot. J. Linn. Soc. 97: 49-61.
WhiTMan et. al — Madagascar’s inselberg orchids
Nilsson, L.A., E. Rabakonandrianina, R. Rotaharivelo &
J.J. Randriamanindry. 1992. Long pollinia on eyes:
hawk-moth pollination of Cynorkis unilora Lindley
(Orchidaceae) in Madagascar. Bot. J. Linn. Soc.109:
145-160.
Parmentier, I. 2003. Study of the vegetation composition
in three inselbergs from continental equatorial Guinea
(western central Africa): effects of site, soil factors, and
position relative to forest fringe. Belg. J. Bot. 136: 6372.
Pettersson, B. & L.A. Nilsson. 1993. Floral variation and
deceit pollination in Polystachya rosea (Orchidaceae)
on an inselberg in Madagascar. Opera Bot. 121: 237245.
Porembski, S. & W. Barthlott. 2000. Granitic and gneissic
outcrops (Inselbergs) as centers of diversity for desic-
67
cation-tolerant vascular plants. Plant Ecol. 151: 19-28.
Porembski, S., R. Seine & W. Barthlott. 2000. Factors
controlling species richness of Inselbergs. Pp. 451-481
in: S. Porembski and W. Barthlott (eds.), Inselbergs
biotic diversity of isolated rock outcrops in tropical and
temperate regions. Berlin, Springer-Verlag.
Rabetaliana, H., M. Randriambololona & P. Schachenmann.
1999. The Andringitra National Park in Madagascar.
Unasylva 50: 25-30.
Raxworthy, C.J. & R.A. Nussbaum. 1996. Montane
amphibian and reptile communities in Madagascar.
Conserv. Biol. 10: 750-756.
Yates, C.J., S.D. Hopper, A. Brown & S. van Leeuwen.
2003. Impact of two wildires on endemic granite
outcrop vegetation in Western Australia. J. Veg. Sci.
14: 185-193.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
LANKESTERIANA
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
LANKESTERIANA 11(1): 69—94. 2011.
OrChid gENErA lECTOTyPES
peggy alriCh1 & Wesley higgins2,3
13955 Matanzas Dr. SE, Fort Myers, FL 33905, U.S.A.
Herbarium, Florida Museum of Natural History; Centro de Investigación en Orquídeas de los Andes,
Universidad Alfredo Pérez Guerero, Ecuador; Lake Park Botanical Gardens, Fort Myers, FL, U.S.A.
3
Corresponding author: 5317 Delano Ct., Cape Coral, FL 33904, U.S.A.; Higgins@alumni.ul.edu
1
2
aBsTraCT. The typiication of Orchidaceae genera has been disorganized since currently there is not an up to
date central database to track these nomenclatural publications. A listing of published generic typiications for
Orchidaceae is provided.
key WorDs: Nomenclature, Typiication, Orchidaceae
introduction. When an orchid genus is described it in
based on a speciic species known as the type species.
When that species is described the name is based on
a speciic specimen, the holotype. The International
Code of Botanic Nomenclature (ICBN) states: The
application of names of taxa of the rank of family or
below is determined by means of nomenclatural types
(types of names of taxa). The application of names
of taxa in the higher ranks is also determined by
means of types when the names are ultimately based
on generic names (Article 7.1) and a nomenclatural
type (typus) is that element to which the name of a
taxon is permanently attached, whether as the correct
name or as a synonym. The nomenclatural type is not
necessarily the most typical or representative element
of a taxon (Article 7.2).
There are many kinds of types deined in the
ICBN. Loosely used the term type can have many
meanings and should be clariied.
• paratype. A specimen cited in the protologue that
is neither the holotype nor an isotype, nor one
of the syntypes if two or more specimens were
simultaneously designated as types (Art. 9.5).
• neotype. A specimen or illustration selected to
serve as nomenclatural type if no original material
is extant or as long as it is missing (Art. 9.6).
• lectotype. A specimen or illustration designated
from the original material as the nomenclatural
type if no holotype was indicated at the time of
publication, or if it is missing, or if it is found to
belong to more than one taxon (Art. 9.2).
• epitype. A specimen or illustration selected to
serve as an interpretative type when the holotype,
lectotype, or previously designated neotype, or
all original material associated with a validly
published name cannot be identiied for the
purpose of precise application of the name of a
taxon (Art.9.7).
• nomenclatural type. The element to which the
name of a taxon is permanently attached (Art.
7.2).
• holotype. The one specimen or illustration used
by the author or designated by the author as the
nomenclatural type (Art. 9.1).
• isotype. A duplicate specimen of the holotype
(Art. 9.3).
• syntype. Any specimen cited in the protologue
when there is no holotype, or any of two or more
specimens simultaneously designated as types
(Art. 9.4).
• isosyntype. A duplicate of a syntype (Art. 9.10).
why is this important? Many genera were described
before a type designation was required and a type
species was not designated. Publication on or after
1 January 1958 of the name of a new taxon of the
rank of genus or below is valid only when the type
of the name is indicated (Art. 37.1). However the
ICBN does provide that if the name of a new genus
reference to one species name only, or the citation
of the holotype or lectotype of one previously or
simultaneously published species name only, even if
that element is not explicitly designated as type, is
acceptable as indication of the type (Art. 37.3). This
leaves many genera without type species.
70
LANKESTERIANA
and it can be shown that all the other original
material differs taxonomically from the destroyed
type, a neotype may be selected to preserve the
usage established by the previous typiication
(Art. 9.14).
Recognizing that all taxa do not have a type the
ICBN provides that one can be selected:
• If no holotype was indicated by the author of a
name of a species or infraspeciic taxon, or when
the holotype has been lost or destroyed, or when
the material designated as type is found to belong to
more than one taxon, a lectotype or, if permissible a
neotype as a substitute for it may be designated (Art.
9.9).
There are additional rules for typiication of taxa
that require the proper use of terminology. Article
9.8. states that The use of a term deined in the ICBN
as denoting a type, in a sense other than that in which
it is so deined, is treated as an error to be corrected
(for example, the use of the term lectotype to denote
what is in fact a neotype).
The type of typiication is dependent on
availability of original material:
• A lectotype is a specimen or illustration designated
from the original material as the nomenclatural
type, if no holotype was indicated at the time of
publication, or if it is missing, or if it is found to
belong to more than one taxon (Art. 9.2).
• A neotype is a specimen or illustration selected
to serve as nomenclatural type if no original
material is extant, or as long as it is missing (see
also Art. 9.6).
Further guidance is given by the ICBN for the
selection of a new type
•
•
In lectotype designation, an isotype must be
chosen if such exists, or otherwise a syntype if
such exists. If no isotype, syntype or isosyntype
(duplicate of syntype) is extant, the lectotype must
be chosen from among the paratypes if such exist.
If no cited specimens exist, the lectotype must be
chosen from among the uncited specimens and
cited and uncited illustrations which comprise
the remaining original material, if such exist (Art.
9.10).
If no original material is extant or as long as it is
missing, a neotype may be selected. A lectotype
always takes precedence over a neotype (Art.
9.11), except when the holotype or a previously
designated lectotype has been lost or destroyed
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
Some authors in the past have listed a type species
for a genus even when the original author did not
designate a type. This had the inadvertent effect of
lectotypiication or neotypiication of the genus. The
ICBN how requires that the designation of a new
type use of the term “lectotypus” or “neotypus” and
location of the type.
•
•
On or after 1 January 1990, lectotypiication
or neotypiication of a name of a species or
infraspeciic taxon by a specimen or unpublished
illustration is not effected unless the herbarium
or institution in which the type is conserved is
speciied (Art.9.20).
On or after 1 January 2001, lectotypiication
or neotypiication of a name of a species or
infraspeciic taxon is not effected unless indicated
by use of the term “lectotypus” or “neotypus”,
its abbreviation, or its equivalent in a modern
language (Art.9.21).
Currently typification is not adequately tracked
in the online taxonomic databases, such as, Index
Nominum Genericorum (ING), International Plant
Names Index (IPNI), Tropicos, World Checklist of
Selected Plant Families. The authors encourage the
database owners to add this valuable information
since earlier type choices have priority. An excellent
example of a database is the Linnaean Plant
Name Typification Project, based at The Natural
History Museum (London), that has been collating
and cataloguing information on published type
designations for Linnaean plant names and, where
none exists, has been collaborating with specialists
in designating appropriate types. For each species,
the database provides the place of publication, stated
provenance, the type specimen (or illustration) and
a reference to where the type choice was published,
and an indication of the current name of the taxon
within which Linnaeus’ original binomial is now
placed.
alriCh & higgins — Orchid genera typiication
71
The Typiication of Orchidaceae Genera
Aa Rchb.f., Xenia Orchid., 1: 18 (1854).
Type speCies: A. paleacea (Kunth) Schltr. (Ophrys
paleacea Kunth) selected by Schlechter, Repert. Spec.
Nov. Regni Veg., 11: 147 (1912); Baillon, Dict. Bot.,
4: 309 (1892); and Pfeiffer, Nomencl. Bot. (Pfeiffer),
1(1): 1 (1871).
Acampe Lindl., Fol. Orchid., 4: Acampe, 1 (1853).
Type speCies: A. multilora (Lindl.) Lindl. (Vanda
multilora Lindl.) selected by Pfeiffer, Nomencl. Bot.
(Pfeiffer), 1(1): 9 (1871).
leCToType: A. rigida (Buch.-Ham. ex Sm.) P.F.Hunt
(Aerides rigida Buch.-Ham. ex Sm.) designated by
Seidenfaden, Bot. Mus. Leal., 25(2): 54 (1977); and
indirectly by Averyanov, Bot. Zhurn. (Moscow &
Leningrad), 76(6): 890 (1991).
Aceras R.Br., Hortus Kew., ed. 2, 5: 191 (1813).
leCToType: A. anthropophorum (L.) R.Br. (Ophrys
anthropophora L.) designated by H. Baumann et al.,
Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3):
437 (1989).
Achroanthes Raf., Med. Repos., ser. 2, 5: 352 (1808)
Type speCies: A. unifolia (Michx.) Raf. (Malaxis
unifolia Michx.) selected by Pfeiffer, Nomencl. Bot.
(Pfeiffer), 1(1): 22 (1871).
Achroanthes Raf. Amer. Monthly Mag. & Crit. Rev.,
2: 268 (1818) and 4: 195 (1819).
Type speCies: Malaxis ophioglossoides Muhl. ex Willd.
(Arethusa ophioglossoides Muhl.) selected by Garay &
H.R. Sweet, J. Arnold Arbor., 53(1): 515 (1972).
Acianthera Scheidw., Allg. Gartenzeitung, 10(37):
292 (1842).
neoType speCies: A. punctata Scheidw. designated by
Luer, Monogr. Syst. Bot. Missouri Bot. Gard., 20: 12
(1986).
Acineta Lindl., Edwards’s Bot. Reg., 29(Misc.): 67
(1843).
Type speCies: A. superba (Kunth) Rchb.f. (Anguloa
superba Kunth) selected by G. Gerlach, Gen. Orch.,
5: 399 (2009).
Acianthus R.Br., Prodr. Fl. Nov. Holland., 321 (1810).
Type speCies: A. exsertus R.Br. selected by N. Hallé, Fl.
Nouvelle Caledonie & Depend., 8: 418 (1977).
Type speCies: A. fornicatus R.Br. selected by M.A.
Clements, Austral. Orchid Res., 1: 9 (1989) and Jones,
D.L. & Clements, M.A., Lindleyana, 2: 157 (1987).
Acostaea Schltr., Repert Spec. Nov. Regni Veg. Beih,
19: 22, 283 (1923).
leCToType: A. costaricensis Schltr. designated by
Summerhayes, Index Nom. Gen. (Pl.), 1: 16 (1967)
card #64/24402 (1967); and Pupulin, Bot. J. Linn.
Soc., 163: 116 (2010).
Aerides Lour., Fl. Cochinch., 2: 516 & 525 (1790).
leCToType: A. maculosa (Wight) Lindl. (Saccolabium
speciosum Wight) designated by Christenson, Kew
Bulletin, 41(4): 837 (1986).
Aeridium Salisb., Trans. Hort. Soc. London, 1: 295
(1812).
Type speCies: A. odorum Salisb. selected by Pfeiffer,
Nomencl. Bot. (Pfeiffer), 1(1): 67 (1871).
Aerobion Kaempf. ex Spreng. Syst Veg. 3: 679 (1826).
leCToType: A. superbum (Thouars) Spreng.
(Angraecum superbum Thouars) designated by Garay,
Kew Bull., 28(3): 496 (1973).
Altensteinia Kunth, Nov. Gen. Sp. Pl., 1: 332 (1816).
Type speCies: A. imbriata Kunth selected by
Reichenbach f., Xenia Orchid., 1: 18 (1854).
Amalia Rchb.f., Herb. Nomen., 52 (1841).
leCToType: Bletia grandilora La Llave designated by
Garay & H.R. Sweet, J. Arnold Arb., 53: 515 (1972).
Amparoa Schltr., Repert. Spec. Nov. Regni Veg. Beih.,
19: 64 (1923).
leCToType: A. costaricensis Schltr. designated by
Pupulin, Bot. J. Linn. Soc., 163: 119 (2010).
Amphigena Rolfe, Fl. Cap. (Harvey), 5(3): 197 (1913).
Type speCies: A. leptostachya (Sond.) Rolfe (Disa
leptostachys Sond.) selected by E.P. Phillips, Gen. S.
Afr. Fl. Pl., ed. 2, 236 (1951).
Amphorkis Thouars, Nouv. Bull. Sci. Soc. Philom.
Paris, 1(19): 316 (1809).
leCToType: A. inermis Thouars designated by A.
Richard, Mem. Soc. Hist. Nat., Paris, 4: 30 (1828).
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
72
LANKESTERIANA
Anacamptis Rich., De Orchid. Eur., 19, 25 (1817), and
Mém. Mus. Hist. Nat., 4: 47, 55 (1818).
leCToType: A. pyramidalis (L.) Rich. (Orchis
pyramidalis L.) designated by H. Baumann et al., Mitt.
Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 439
(1989).
Anathallis Barb.Rodr., Gen. Sp. Orchid, 1: 23, t. 470
(1877).
leCToType: A. fasiculata Barb.Rodr. designated by
Garay, Orquideología, 9: 122 (1974).
Ancistrorhynchus Finet, Bull. Soc. Bot. France, 54(9):
44 (1907).
Type speCies: A. recurvus Finet selected by
Summerhayes, Bot. Mus. Leal., 11: 204, 213 (1944).
Anguloa Ruiz & Pavón, Fl. Peruv. Prodr., 118, t. 26
(1794).
Type speCies: A. unilora Ruiz & Pavón selected by
Ruiz & Pavón, Syst. Veg. Fl. Peruv. Chil., 1: 228 (1798)
and Oakeley, Orchid Digest, 63(4 Suppl.): 3 (1999).
Ania Lindl., Gen. Sp. Orchid. Pl., 129 (1831).
Type speCies: A. angustifolia Lindl. selected by
Senghas, Orchideen (Schlechter), ed. 3, 1: 863 (1984).
leCToType: A. angustifolia Lindl. designated by H.
Turner, Orch. Monog., 6: 49 (1992) and P.J. Cribb,
Gen. Orch., 4: 159 (2005).
Anochilus Schltr. ex Rolfe, Fl. Cap. (Harvey), 5:(3):
280 (1913).
Type speCies: A. inversus (Thunberg) Rolfe (Ophrys
inversa Thunberg) selected by E.P. Phillips, Gen. S.
Afr. Fl. Pl., ed. 2, 238 (1951).
Appendicula Blume, Bijdr. Fl. Ned. Ind., 7: 297, t. 40
(1825).
Type speCies: A. alba Blume selected by N. Hallè, Fl.
Nouvelle Caledonie & Depend., 8: 345 (1977).
leCToType: A. alba Blume designated by Averyanov,
Bot. Zhurn. (Moscow & Leningrad), 76(1): 123 (1991).
Appendiculopsis Szlach., Fragm. Florist. Geobot.,
3(Suppl.): 119 (1995).
leCToType: A. stipulata (Grifith) Szlach. (Appendicula
stipulata Grifith) designated by Szlachetko, Fragm.
Florist. Geobot., 3(Suppl.): 119 (1995).
Arachnis Blume, Bijdr. Fl. Ned. Ind., 8: 365, t. 26
(1825).
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
leCToType: A. los-aeris (L.) Rchb.f. (Epidendrum
los-aeris L.) designated by J.J. Wood, Taxon, 48: 47
(1999).
Arethusa L., Sp. Pl. (Linnaeus), ed. 1, 2: 950 (1753).
Type speCies: A. bulbosa L. selected by Britton &
Brown, Ill. Fl. N.U.S., ed 2, 1: 562 (1913).
Arundina Blume, Bijdr. Fl. Ned. Ind., 8: 401, t. 73
(1825).
leCToType: A. speciosa Blume designated by Garay &
H.R. Sweet, Orchids S. Ryukyu Islands, 52 (1974).
Ascocentrum Schltr., Repert. Spec. Nov. Regni Veg.
Beih., 1: 975 (1913).
leCToType: A. miniatum (Lindl.) Schltr. (Saccolabium
minitum Lindl.) designated by Summerhayes, Index
Nom. Gen. (Pl.), 1: 139 (1967) card #64/24468.
leCToType: A. ampullaceum (Roxburgh) Schltr.
(Aerides ampullacea Roxburgh) designated by
Christenson, Kew Bulletin, 41(4): 836 (1986).
Ascochilus Ridl., J. Linn. Soc., Bot., 32: 374 (1896).
leCToType: A. siamensis Ridl. designated by Garay,
Bot. Mus. Leal., 23(4): 161 (1972).
Auliza Salisb., Trans. Hort. Soc. London, 1: 294
(1812).
Type speCies: A. ciliaris (L.) Salisb. (Epidendrum
ciliaris L.) selected by Pfeiffer, Nomencl. Bot.
(Pfeiffer), 1(1): 321 (1871).
Type speCies: A. nocturna (Jacq.) Small selected by
Small, Fl. Miami, 56 (1913) and Garay & H.R. Sweet,
J. Arnold Arbor., 53(4): 516 (1972).
leCToType: A. nocturna (Jacq.) Small (Epidendrum
nocturnum Jacq.) invalidly designated by Hágsater &
Soto Arenas, Gen. Orch., 4: 237 (2005).
Barbosella Schltr., Repert. Spec. Nov. Regni. Veg., 15:
259 (1918).
leCToType: B. miersii (Lindl.) Schltr. (Pleurothallis
miersii Lindl.) designated by Angely, Fl. Analitica São
Paulo, 6: 1282 (1973).
Type speCies: B. gardneri (Lindl.) Schltr. (Pleurothallis
gardneri Lindl.) selected by Luer, Selbyana, 5: 386
(1981).
Bartholina, R.Br., Hortus Kew., ed. 2, 5: 194 (1813)
Type speCies: B. pectinata (Thunberg) R.Br. nom. illeg.
(Orchis pectinata Thunberg nom. illeg.). This type
alriCh & higgins — Orchid genera typiication
name is now considered a synonym of Bartholina
burmanniana (L.) Ker-Gawler (Orchis burmanniana
L.) which was lectotyped by H.P. Linder, Taxon, 48:
48 (1999).
Beloglottis Schltr., Beih. Bot. Centralbl., 37(2): 364
(1920).
Type B. costaricensis (Rchb.f.) Schltr. selected by
Garay, Fl. Ecuador, 9: 253 (1978).
leCToType: B.
boliviensis
Schltr.
designated
superluously by Burns-Balogh, Amer. J. Bot., 69(7):
1131 (1982).
leCToType: B.
costaricensis
(Rchb.f.)
Schltr.
(Spiranthes costaricensis Rchb.f.) designated by
Rutkowski et al., Phylogeny & Taxonomy Subtribes
Spiranthinæ, 132 (2008).
Benthamia A.Rich., Mem. Soc. Hist. Nat. Paris, 4: 37
(1828).
leCToType: B. latifolia A.Rich. designated by P.J.
Cribb, Gen. Orch., 2: 261 (2001).
Bifrenaria Lindl., Gen. Sp. Orchid. Pl., 152 (1832).
Type speCies: B. atropurpurea (Loddiges) Lindl.
(Maxillaria atropurpurea Loddiges) selected by S.
Koehler, Brittonia, 56(4): 318 (2004).
Bipinnula Comm. ex Juss., Gen. Pl., 65 (1789).
leCToType: B. biplumata (L.f.) Rchb.f. (Arethusa
biplumata L.f.) designated by M.N. Correa, Gen.
Orch., 3: 5 (2003).
Blephariglotis Raf., Fl. Tellur., 2: 38 (1837).
Type speCies: B. albilora (Michx.) Raf. (Orchis cilaris
var. alba Michx.) selected by Britton & Brown, Ill. Fl.
N.U.S., ed. 2, 1: 556 (1913).
Bletia Ruiz & Pav., Fl. Peruv. Prodr., 119, t. 26 (1794).
Type speCies: B. catenulata Ruiz & Pav. selected by
Britton & Millspaugh, Bahama Fl., 96 (1920).
Bletilla Rchb.f., Fl. Serres Jard. Eur., ser. 1, 8: 246
(1853).
Type speCies: B. gebina (Lindl.) Rchb.f. (Bletia gebina
Lindl.) typ. cons.
Type speCies: B. florida (Salisb.) Rchb.f.
(Limodorum floridum Salisb.) this name is currently
considered a species of the genus Bletia, invalidly
selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(1):
423 (1871).
73
Bolusiella Schltr., Beih. Bot. Centralbl., 36(2): 105
(1918).
leCToType: B. maudae (Bolus) Schltr. (Angraecum
maudae Bolus) designated by Butzin, Taxon, 32(4):
630 (1983).
Bontiana Petiver, Gaz., 1: 70, t. 44 (1704).
leCToType: B. luzonica Petiver designated by P.J.
Cribb, Taxon, 48: 47 (1999).
Brachionidium Lindl., Fol. Orchid., 8: Brachionidium
8 (1859).
TType
speCies: B.
parvifolium
(Lindl.) Lindl.
(Restrepia parvifolia Lindl.) selected by Garay, Canad.
J. Bot., 34(4): 729 (1956).
Brachystele Schltr., Beih. Bot. Centralbl., 37(2): 370
(1920).
leCToType: B. unilateralis (Poiret) Schltr. (Ophrys
unilateralis Poiret) designated by M.N. Corrêa, Fl.
Patagónica, 8(2): 208 (1969) and Darwiniana, 11(1):
29 (1955); Cabrera, DAGI Publ. Técn., 1(6): 16 (1942);
and Angely, Fl. Analitica São Paulo, 6: 1270 (1973)
leCToType: B. guayanensis (Lindl.) Schltr. (Goodyera
guayanensis Lindl.) designated superluously by
Burns-Balogh, Amer. J. Bot., 69(7): 1131 (1982).
Brasiliorchis R.B. Singer, S. Koehler & Carnevali,
Novon, 17(1): 94 (2007).
leCToType: B. picta (Hook.) R.B. Singer, S. Koehler
& Carnevali (Maxillaria picta Hook.) designated by
R.B. Singer, Novon, 17: 97 (2007).
Brenesia Schltr., Repert. Spec. Nov. Regni Veg. Beih.,
19: 200 (1923).
leCToType: B. costaricensis Schltr. designated by K.
Barringer, Fieldiana, Bot., 17: 4 (1986).
Brownleea Harvey ex Lindl., J. Bot. (Hooker), 1: 16
(1842).
Type speCies: B. parvilora Harvey ex Lindl. selected
by E.P. Phillips, Gen. S. Afr. Fl. Pl., ed. 2, 235 (1951).
Buchtienia Schltr., Repert. Spec. Nov. Regni Veg.
Beih., 27: 33 (1929).
leCToType: B. boliviensis Schltr. designated by
Rutkowski et al., Phylogeny & Taxonomy Subtribes
Spiranthinæ, 153 (2008).
Bulbophyllum Thouars, Hist. Orchid., Table 3, sub 3u,
tt. 93-110 (1822).
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
74
LANKESTERIANA
leCToType: B. nutans Thouars designated by M.L.
Green, Prop. Brit. Bot., 100 (1929); and Greuter et al.,
Regnum Veg., 118: 186 (1983).
Caladenia R.Br., Prodr. Fl. Nov. Holland., 323 (1810).
Type speCies: C. carnea R.Br. selected by M.A.
Clements, Aust. Orch. Res., 1: 20 (1989); not Caladenia
lava R.Br. selected by Pitzer, Nat. Planzenfam., 2(6):
104. (1889); not Caladenia catenata (Sm.) Druce
selected by (N. Hallè 1977).
Caleana R.Br., Prodr. Fl. Nov. Holland., 329 (1810).
Type speCies: C. major R.Br., selected by Blaxell,
Contr. New South Wales Natl. Herb., 4: 279 (1972).
Calochilus R.Br., Prodr. Fl. Nov. Holland., 320 (1810).
Type speCies: C. paludosus R.Br. selected by M.A.
Clements, Austral. Orchid Res., 1: 35 (1989).
Calopogon R.Br., Hortus Kew, ed. 2, 5: 204 (1813).
Type speCies: C. tuberosus (L.) Britton, Sterns
& Poggenb. (Limodorum tuberosum L.) selected by
Mackenzie, Rhodora, 27: 195 (1925).
leCToType: C. pulchellus (Salisb.) R.Br. nom. illeg.
(Limodorum pulchellum Salisb. nom. illeg.), designated
by M.L. Green, Prop. Brit. Bot., 100 (1929).
Calypso Salisb., Parad. Lond., 2: t. 89 (1807).
leCToType: C. bulbosa (L.) Oakes (Cypripedium
bulbosum L.) designated by H. Baumann et al., Mitt.
Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 441
(1989).
Calymmanthera Schltr., Repert. Spec. Nov. Regni
Veg. Beih., 1: 955 (1913).
leCToType: C. tenuis Schltr., designated by Kores,
Allertonia, 5: 183 (1989).
Capanemia Barb.Rodr., Gen. Sp. Orchid., 1: 137, t.
354 (1877).
Type speCies: C. uliginosa Barb.Rodr. selected by
M.W. Chase, Gen. Orchid., 5: 237 (2009).
Caularthron Raf., Fl. Tellur., 2: 40 (1837).
leCToType: C. bicornutum (Hook.f.) Raf. (Epidendrum
bicornutum Hook.f.) designated by van den Berg,
Gen. Orch., 4: 218 (2005).
Centranthera Scheidw., Allg. Gartenzeitung, 10(37):
293 (1842).
neoType speCies: C. punctata Scheidw. designated by
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
Luer, Monogr. Syst. Bot. Missouri Bot. Gard., 20: 12
(1986).
Centrogenium Schltr., Beih. Bot. Centralbl., 37(2):
451 (1920).
leCToType: C. calcaratum (Sw.) Schltr. (Neottia
calcarata Sw.) designated by M.N. Correa, Darwiniana,
11: 81 (1955) and Angely, Fl. Analitica São Paulo, 6:
1277 (1973).
Centroglossa Barb.Rodr., Gen. Sp. Orchid., 2: 234
(1882).
leCToType: C. tripollinica (Barb.Rodr.) Barb.Rodr.
(Ornithocephalus tripollinica Barb.Rodr.) designated
by Summerhayes, Index Nom. Gen. (Pl.) 1: 312
(1962), card #64/15478 ; and Toscano, Lindleyana,
16(3): 189 (2001).
Centrostigma Schltr., Bot. Jahrb. Syst., 53: 522 (1915).
Type speCies: C. occultans (Welw. ex Rchb.f.) Schltr.
(Habenaria occultans Welw. ex Rchb.f.) selected by
Summerhayes, Kew Bull., 11(2): 219 (1956).
Type speCies: C. schlechteri (Kraenzl.) Schltr.
(Habenaria schlechteri Kraenzl.) selected by E.P.
Phillips, Gen. S. Afr. Fl. Pl., ed. 2, 232 (1951).
Cephalanthera Rich., De Orchid. Eur., 21, 29, 38
(1817).
Type speCies: C. damasonium (Mill.) Druce (Serapias
damasonium Mill.) selected by Druce, Ann. Scot. Nat.
Hist., 60: 225 (1906).
Ceratandra Eckl. ex F.A. Bauer, Ill. Orch. Pl. (Bauer
& Lindl.), t. 16 (1837).
Type speCies: C. atrata (L.) T. Durand & Schinz
(Ophrys atrata L.) selected by T. Durand & Schinz,
Consp. Fl. Africa, 5: 123 (1895).
Type speCies: C. chloroleuca Eckl. ex F.A. Bauer selected
by E.P. Phillips, Gen. S. Afr. Fl. Pl., ed. 2, 238 (1951).
leCToType: C. chloroleuca Eckl. ex F.A. Bauer
designated by H.P. Linder, Taxon, 48: 48 (1999).
Ceratandropsis Rolfe, Fl. Cap. (Harvey), 5(3): 266
(1913).
Type speCies: C. grandilora (Lindl.) Rolfe (Ceratandra
grandilora Lindl.) selected by E.P. Phillips, Gen. S.
Afr. Fl. Pl., ed. 2, 238 (1951).
Ceratostylis Blume, Bijdr. Fl. Ned. Ind., 7: 304, t. 56
(1825).
alriCh & higgins — Orchid genera typiication
leCToType: C. subulata Blume designated by Butzin,
Taxon, 32(4): 630 (1983); and Royen, Orchid. High
Mts. New Guinea, 455 (1979).
leCToType: C. graminea Blume designated by
Averyanov, Bot. Zhurn. (Moscow & Leningrad), 76(1):
126 (1991); and P.J. Cribb, Gen. Orch., 4: 546 (2005).
Cestichis Thouars ex Pitzer, Entwurf Anordn. Orch.,
56, 101 (1887).
Type speCies: C. caespitosa (Lam.) Ames (Epidendrum
caespitosum Lam.) selected by D.L. Jones & M.A.
Clements, Orchidian, 15(1): 37 (2005).
Chaetocephala Barb.Rodr., Gen. Sp. Orchid., 2: 37, t.
802 (1881).
leCToType: C. punctata Barb.Rodr. designated by
Summerhayes, Index Nom. Gen. (Pl.), 1 : 327 (1967)
card #64/15508.
Chamaeangis Schltr., Beih. Bot. Centralbl., 36(2): 107
(1918).
leCToType: C. gracilis (Thouars) Schltr. (Angraecum
gracile Thouars) designated by Garay, Bot. Mus.
Leal., 23(4): 165 (1972) and Butzin, Taxon, 32(4):
630 (1983).
Chamorchis Rich., De Orchid. Eur., 20, 27, 35 (1817),
and Mém. Mus. Hist. Nat., 4: 49 (1818).
leCToType: C. alpina (L.) Rich. (Ophrys alpina L.)
designated by H. Baumann et al., Mitt. Bl. Arbeitskr.
Heim. Orch. Baden-Württ., 21(3): 445 (1989).
Cheirorchis Carrière, Gard. Bull. Straits Settlem., 7:
40 (1932).
Type speCies: C. breviscapa Carrière indirectly selected
by Holttum, Kew Bull., 14: 272 (1960).
Chelonanthera Blume, Bijdr. Fl. Ned. Ind., 8: 382, t.
51 (1825).
Type speCies: C. gibbosa Blume NOTE: ING lists the
name as lectotyped by Pitzer, Planzenr., IV. 50 IIB
(Heft 32): 141 (1907) but there is nothing listed in the
article as a type.
75
polystachya Sw.) indirectly selected by Cogniaux, Fl.
Bras. (Martius), 3(4): 276 (1895).
Chloraea Lindl., Quart. J. Sci. Lit. Arts, ser. 2, 1: 47
(1827).
leCToType: C. virescens (Willd.) Lindl. (Cymbidium
virescens Willd.) designated by M.N. Correa, Fl.
Patagonica, 7(2): 200 (1970) and Gen. Orch., 3: 7
(2003).
Christensonella Szlach., Mytnik, Górniak & Smiszek
Polish Bot. J., 51(1): 57 (2006).
Type speCies: C. paulistana (Hoehne) Szlach., Mytnik,
Górniak & Smiszek (Maxillaria subulata Hoehne)
selected by M.W. Chase, Gen. Orchid., 5: 135 (2009).
Chrysoglossum Blume, Bijdr. Fl. Ned. Ind., 7: 337, t.
7 (1825).
Type speCies: C. ornatum Blume selected by J.J. Smith,
Bull. Jard. Bot. Buitenzorg, ser. 2, 8: 3 (1912).
Chytroglossa
Rchb.f.,
Hamburger
GartenBlumenzeitung, 19: 546 (1863).
leCToType: C. aurata Rchb.f. designated by Angely,
Fl. Analítica São Paulo, 6: 1328 (1973).
leCToType: C. marileoniae Rchb.f. designated by
Toscano, Lindleyana, 16(3): 189 (2001).
Cirrhaea Lindl., Edwards’s Bot. Reg., 18: t. 1538
(1832).
Type speCies: Cirrhaea dependens (Loddiges) Loudon
(Cymbidium dependens Loddiges) selected by G.
Gerlach, Gen. Orch., 5: 404 (2009).
Cirrhopetalum Lindl., Gen. Sp. Orchid. Pl., 58 (1830),
and Bot. Reg., 10: sub 832 (1824)
leCToType: Bulbophyllum longilorum Thouars
designated by Garay et al., Nord. J. Bot., 14(6): 614
(1994).
Chitonanthera Schltr., Nachtr. Fl. Schutzgeb. Südsee,
193 (1905).
Type speCies: C. angustifolia Schltr. selected by
Schuiteman & de Vogel, Blumea, 48: 511 (2003).
Cladobium Schltr., Beih. Bot. Centralbl., 37(2): 431
(1920).
leCToType: C. ceracifolium (Barb.Rodr.) Schltr.
(Spiranthes ceracifolia Barb.Rodr.) designated by
Burns-Balogh, Amer. J. Bot., 69: 1131 (1982).
Type speCies: C. ceracifolium (Barb.Rodr.) Schltr.
indirectly selected by Garay, Bot. Mus. Leal. 28: 330
(1982).
Chloidia Lindl., Gen. Sp. Orchid. Pl., 484 (1840).
Type speCies: C. polystachya (Sw.) Rchb.f. (Serapias
Cleisostoma Blume, Bijdr. Fl. Ned. Ind., 8: 362, t. 27
(1825).
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
76
LANKESTERIANA
Type speCies: C. sagittatum Blume selected by Garay,
Bot. Mus. Leal., 23(4): 168 (1972) and Christenson,
Kew Bulletin, 41(4): 835 (1986).
leCToType: C. sagittatum Blume designated by
Averyanov, Bot. Zhurn. (Moscow & Leningrad),
76(6): 893 (1991).
Cleistes Rich. ex Lindl., Gen. Sp. Orchid. Pl., 409
(1840).
Type speCies: C. grandilorum (Aublet) Schltr.
(Limodorum grandilorum Aublet) selected by Pfeiffer,
Nomencl. Bot. (Pfeiffer), 1(1): 781 (1871).
Cnemidia Lindl., Edwards’s Bot. Reg., 19: sub 1618
(1833).
Type speCies: Cnemidia angulosa Lindl. selected by
Hooker f., Fl. Brit. Ind., 6: 92 (1890).
Coccineorchis Schltr., Beih. Bot. Centralbl., 37(2):
434 (1920).
leCToType: C. corymbose Kraenzl. designated by
Burns-Balogh, Amer. J. Bot., 69: 1131 (1982).
leCToType: C. cernua (Lindl.) Garay (Stenorrhynchos
cernuum Lindl.) designated by Rutkowski et al.,
Phylogeny & Taxonomy Subtribes Spiranthinæ, 158
(2008).
Codonorchis Lindl., Gen. Sp. Orch. Pl., 410 (1840).
leCToType: C. lessonii (d’Urville) Lindl. (Epipactis
lessonii d’Urville) designated by M.N. Correa, Fl.
Patagónica, 8(2): 191 (1969).
Coelia Lindl., Gen. Sp. Orchid. Pl., 36 (1830).
Type speCies: C. bauerana Lindl., nom. illeg.
Type speCies: C. triptera (Sm.) G. Don ex Steudel,
(Epidendrum tripterum Sm.) selected by Steudel,
Nomencl. Bot., 1: 394 (1841).
Coeloglossum Hartman, Handb. Skand. Fl., 323, 329
(1820).
Type speCies: C. viride (L.) Hartman (Satyrium viride
L.) selected by Britton & Brown, Ill. Fl. N.U.S., ed. 2,
1: 552 (1913).
leCToType: C. viride (L.) Hartman designated by
H. Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch.
Baden-Württ., 21(3): 447 (1989).
Coelogyne Lindl., Collect. Bot., sub t. 33 (1821).
Type speCies: C. cristata Lindl. selected by C.H. Curtis,
Orchids (Curtis), 82 (1950).
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
leCToType: C. cristata Lindl., designated by Butzin,
Taxon, 32(4): 630 (1983); Averyanov, Bot. Zhurn.
(Moscow & Leningrad), 75(12): 1767 (1990);
Cogniauxiocharis (Schltr.) Hoehne, Arq. Bot. Estado
São Paulo, n.s., 1(6): 132 (1944).
leCToType: C. glazioviana (Cogn.) Hoehne (Pelexia
glazioviana Cogn.) designated by Rutkowski et al.,
Phylogeny & Taxonomy Subtribes Spiranthinæ, 167
(2008).
Coilostylis Raf., Fl. Tellur., 4: 37 (1838).
leCToType: C. emarginata (L.) Raf. (Epidendrum
ciliare L.) designated by Christenson, Richardiana, 3:
114 (2003).
Colax Lindl., Edwards’s Bot. Reg., 29(Misc): 50
(1843).
Type speCies: C. viridis (Lindl.) Lindl. (Maxillaria
viridis Lindl.) selected by Pupulin, Gen. Orchid., 5(2):
517 (2009).
Comparettia Poepp. & Endl., Nova Gen. Sp., 1: 42, t.
73 (1836).
Type speCies: C. falcata Poepp. & Endl. indirectly
selected by Reichenbach f., Ann. Bot. Syst., 6: 688
(1863).
Type speCies: C. saccata Poepp. & Endl. selected by
Britton & Wilson, Sci, Surv. Porto Rico, 5(2): 211
(1924).
leCToType: C. falcata Poepp. & Endl. designated by
Angely, Fl. Analitica São Paulo, 6: 1321 (1973).
Comperia K. Koch, Linnaea, 22: 287 (1849).
Type speCies: C. comperiana (Steven) Asch. & Graebn.
(Orchis comperiana Steven) selected by Ascherson
& Graebner, Syn. Mitteleur. Fl., 3: 620 (1907); and
Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 837 (1872)
indirectly selected type species.
Corallorhiza Gagnebin, Acta Helv. Phys.-Math., 2: 61
(1755).
Type speCies: C. innata R.Br. indirectly selected by
McVaugh, Fl. Novo-Galiciana, 16: 57 (1983).
leCToType: C. triida (L.) Châtelain (Ophrys
corallorrhiza L.) designated by H. Baumann et al.,
Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3):
449 (1989).
Corybas Salisb., Parad. Lond., 2: t. 83 (1807).
alriCh & higgins — Orchid genera typiication
Type speCies: Corysanthes bicalcarata R.Br. This name
is considered a synonym of Corybas aconitilorus
Salisb. selected by Pfeiffer, Nomencl. Bot. (Pfeiffer),
1(2): 883 (1872).
Corycium Sw., Kongl. Vetensk. Acad. Nya Handl., ser.
2, 21: 220, t. 3g (1800).
Type speCies: C. crispum (Thunberg) Sw. (Arethusa
crispa Thunberg) selected by Pfeiffer, Nomencl. Bot.
(Pfeiffer), 1(2): 883 (1872).
Type speCies: C. orobanchoides (L.f.) Sw. (Satyrium
orobanchoides L.f.) selected by H. Kurzweil, Gen.
Orch., 2: 23 (2001).
Corysanthes R.Br., Prodr. Fl. Nov. Holland., 328
(1810).
Type speCies: C. imbriata R.Br. selected by Endlicher,
Gen. Pl. (Endlicher), 218 (1837).
Costaricaea Schltr., Repert. Spec. Nov. Regni Veg.
Beih., 19: 30 (1923).
leCToType: C. amparoana Schltr. designated by
Pupulin, Bot. J. Linn. Soc., 163: 122 (2010).
Cranichis Sw., Nov. Gen. Spec, Pl. Prodr., 8: 120
(1788).
Type speCies: C. muscosa Sw. selected by Acuña, Cat.
Descr. Orquid. Cuba, 60: 48 (1939).
Cremastra Lindl., Gen. Sp. Orchid. Pl., 172 (1833).
Type speCies: Cremastra wallichiana Lindl. nom.
illeg. This type name is now considered a synonym
of C. appendiculata (D. Don) Makino (Cymbidium
appendiculatum D. Don) selected by Pfeiffer,
Nomencl. Bot. (Pfeiffer), 1(2): 908 (1872).
Crepidium Blume, Bijdr. Fl. Ned. Ind., 8: 387, t. 63
(1825).
leCToType: C. reedii Blume designated by Seidenfaden,
Dansk Bot. Arkiv, 33 (1): 43 (1978).
Type speCies: C. reedii Blume selected by Szlachetko,
Fragm. Florist. Geobot. Suppl., 3: 123 (1995).
Cryptophoranthus Barb.Rodr., Gen. Sp. Orchid. Nov.,
2: 79, t. 476 (1881).
Type speCies: C. fenestratus (Barb.Rodr.) Barb.Rodr.
(Pleurothallis fenestrata Barb.Rodr.) selected by Acuña, Cat. Descr. Cuba, 60: 115 (1939).
leCToType: C. fenestratus (Barb.Rodr.) Barb.Rodr.
designated by Butzin, Taxon, 32(4): 631 (1983); and
77
Angely, Fl. Analitica São Paulo, 6: 1279 (1973).
Cryptostylis R.Br., Prodr. Fl. Nov. Holland., 317
(1810).
Type speCies: C. erecta R.Br. selected by N. Hallé, Fl.
Nouvelle Caledonie & Depend., 8: 481 (1977).
leCToType: C. longifolia R.Br., designated by
Averyanov, Bot. Zhurn. (Moscow & Leningrad), 75:
1021 (1990).
Cybelion Spreng., Veg. (Sprengel), ed. 16, 3: 679, 721
(1826).
Type speCies: C. pulchellum (Kunth) Spreng. (Ionopsis
pulchella Kunth) selected by Garay & H.R. Sweet, J.
Arnold Arbor., 53(4) 518 (1972).
Cymbidiella Rolfe, Orchid Rev., 26: 58 (1918).
leCToType: C. labellata (Thouars) Rolfe (Cymbidium
labellatum Thouars) designated by Alrich & W.E.
Higgins, Ill. Dict. Orchid Gen., 108 (2008).
Type speCies: C. labellata (Thouars) Rolfe selected by
M.W. Chase, Gen. Orchid., 5: 98 (2009).
Cymbidium Sw., Nova Acta Regiae Soc. Sci. Upsal.,
ser. 2, 6: 70 (1799).
leCToType: C. aloifolium (L.) Sw. (Epidendrum
aloifolium L.) designated by P.F. Hunt, Kew Bull.,
24(1): 94 (1970) and Averyanov, Bot. Zhurn. (Moscow
& Leningrad), 76(6): 884 (1991).
Cymbiglossum Halbinger, Orquidea (Mexico City),
n.s., 9(1): 1-2 (1983).
Type speCies: C. cervantesii (Lex.) Halbinger
(Odontoglossum cervantesii Lex.) selected by M.W.
Chase, Gen. Orchid., 5: 341 (2009).
Cynorkis Thouars, Nouv. Bull. Sci. Soc. Philom Paris,
1: 317 (1809).
Type speCies: C. fastigiata Thouars selected by P.J.
Cribb, Man. Cult. Orch. Sp., 108 (1981).
Cypripedium L., Sp. Pl. (Linnaeus), ed. 1, 2: 951
(1753).
leCToType: C. calceolus L. designated by H. Baumann
et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ.,
21(3): 452 (1989).
Cyperorchis Blume, Rumphia, 4: 47 (1849), and Mus.
Bot., 1: 48 (1849).
leCToType: Cyperorchis elegans (Lindl.) Blume
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
78
LANKESTERIANA
(Cymbidium elegans Lindl.) designated by P.F. Hunt,
Kew Bull., 24(1): 94 (1970).
Cyrtidiorchis Rauschert, Taxon, 31(3): 560 (1982).
Type speCies: C. rhomboglossum (F. Lehmann &
Kraenzl.) Schltr. (Chrysocycnis rhomboglossa F.
Lehmann & Kraenzl.) selected by P. Ortiz, Orquid.
Colombia, ed. 2, 70 (1995).
Cyrtidium Schltr., Repert. Spec. Nov. Regni Veg.
Beih., 27: 178 (1924).
Type speCies: C. rhomboglossum (F. Lehmann &
Kraenzl.) Schltr. (Chrysocycnis rhomboglossa
F. Lehmann & Kraenzl.) selected by Garay,
Orquideologia, 4: 8 (1969).
Cyrtochilum Kunth, Nov. Gen. Pl., 1: 349, t. 84 (1816).
leCToType: C. undulatum Kunth designated by Garay,
Bradea, 1(40): 398 (1974).
Cyrtopera Lindl., Gen. Sp. Orchid. Pl., 189 (1833).
Type
speCies: C.
woodfordii
(Sims) Lindl.
(Cyrtopodium woodfordii Sims) selected by A.
Richard, Dict. Univ. Hist. Nat., 4: 561 (1844).
Cyrtorchis Schltr., Orchideen (Schlechter), ed. 1, 595
(1914).
leCToType: C. arcuata (Lindl.) Schltr. (Angraecum
arcuatum Lindl.) designated by Summerhayes, Kew
Bull., 3: 278 (1948).
Cyrtosia Blume, Bijdr. Fl. Ned. Ind., 8: 396, t. 6 (1825).
Type speCies: C. javanica Blume selected by Blume,
Rumphia, 1: 199 (1837).
leCToType: C. javanica Blume designated by
Averyanov, Bot. Zhurn. (Moscow & Leningrad),
75(12): 1760 (1990).
Cystorchis Blume, Coll. Orch., 1: 87 (1855).
Type speCies: C. variegata Blume selected by Ridley, J.
Linn. Soc. (Bot.), 32: 399 (1896).
Type speCies: D. umbrosa (Karelin & Kirilov) Nevski
(Orchis umbrosus Karelin & Kirilov) selected by Soó,
Jahresber. Naturwiss. Vereins Wuppertal, 21-22: 13
(1968).
deiregyne Schltr., Beih. Bot. Centralbl., 37(2): 425
(1920).
leCToType: D.
chloreaeformis
(A.Rich.
& Galeotti) Schltr. (Spiranthes chloreaeformis A.Rich.
& Galeotti) designated by Garay, Bot. Mus. Leal., 28:
312 (1980). noTe: The choice of D. chloreaeformis is
against the protologue, see Szlachetko, Fragm. Florist.
Geobot., 40: 794 (1995)
leCToType: D. hemichrea (Lindl.) Schltr. (Spiranthes
hemichrea Lindl.) designated by Burns-Balogh, Amer.
J. Bot., 69: 1131 (1982).
dendrobium Sw., Nova Acta Regiæ Soc. Sci. Upsal.,
ser. 2, 6: 82 (1799).
Type speCies: D. moniliforme (L.) Sw. (Epidendrum
moniliforme L.) selected by Pfeiffer, Nomencl. Bot.
(Pfeiffer), 1(2): 1030 (1872) and M.A. Clements,
Austral. Orchid Res., 1: 57 (1989).
leCToType: D. moniliforme (L.) Sw. designated by R.K.
Brummitt, Taxon, 31: 542 (1982) and Averyanov, Bot.
Zhurn. (Moscow & Leningrad), 76(1): 125 (1991).
dendrochilum Blume, Bijdr. Fl. Ned. Ind., 8: 398, t.
52 (1825).
Type speCies: D. aurantiacum Blume selected by
Bechtel et al., Man. Cult. Orchid Sp., ed 1, 127 (1981).
dendrocolla Blume, Bijdr. Fl. Ned. Ind., 7: 286, t. 67
(1825).
Type speCies: D. hystrix Blume designated by J.J.
Smith, Bull. Jard. Bot. Buitenzorg, ser. 3, 3: 303
(1921).
dendrolirium Blume, Bijdr. Fl. Ned. Ind., 7: 343, t.
69 (1825).
Type speCies: D. ornatum Blume selected by Breiger,
Orchideen (Schlechter), ed. 3, 11/12: 717 (1981).
Cytherea Salisb., Parad. Lond., 2(1): errata (1807),
and Trans. Hort. Soc. London, 1: 301 (1812).
Type speCies: C. bulbosa (L.) Oakes (Cypripedium
bulbosum L.) selected by Pfeiffer, Nomencl. Bot.
(Pfeiffer), 1(2): 994 (1872).
desmotrichum Blume, Bijdr. Fl. Ned. Ind., 329 (1825).
leCToType: D. angulatum Blume designated by P.F.
Hunt & Summerhayes, Taxon, 10: 102 (1961).
dactylorhiza Necker ex Nevski, Trudy Bot. Inst.
Akad. Nauk S.S.S.R., ser. 1, Fl. Sist. Vyssh. Rast., 4:
332 (1937).
diaphananthe Schltr., Orchideen (Schlechter), ed. 1,
593 (1914).
leCToType: D. pellucida (Lindl.) Schltr. (Angraecum
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
alriCh & higgins — Orchid genera typiication
79
pellucidum Lindl.) designated by Schlechter, Beih.
Bot. Centralbl., 36(2): 97 (1918).
Type speCies: Satyrium viride L. selected by Pfeiffer,
Nomencl. Bot. (Pfeiffer), 1(2): 1099 (1871).
dichaea Lindl., Gen. Sp. Orchid. Pl., 208 (1833).
Type speCies: D. echinocarpa (Sw.) Lindl. (Epidendrum
echinocarpon Sw.) selected by Lindley, Bot. Reg., 18:
sub 1530 (1832); and Britton & Wilson, Sci. Surv.
Porto Rico, 5(2): 214 (1924).
discyphus Schltr., Repert. Spec. Nov. Regni Veg.
Beih., 15: 417 (1919).
leCToType: D. scopulariae (Rchb.f.) Schltr. (Spiranthes
scopulariae Rchb.f.) designated by Rutkowski et al.,
Phylogeny & Taxonomy Subtribes Spiranthinæ, 153
(2008).
dichaeopsis Pitzer, Entwurf Anordn, Orch., 107
(1887).
leCToType: D. graminoides (Sw.) Schltr. (Epidendrum
graminoides Sw.) designated by Garay & H.R. Sweet,
J. Arnold Arbor., 53(4): 519 (1972).
dicrypta Lindl., Gen. Sp. Orchid. Pl., 44, 152 (1830).
Type speCies: D. crassifolia (Lindl.) Lindl. (Heterotaxis
crassifolia Lindl.) selected by I. Ojeda, Gen. Orchid.,
5(2): 147 (2009).
didactyle Lindl., Fol. Orchid., 1: Didactyle, 1 (1852).
Type speCies: Bulbophyllum gladiatum Lindl. invalidly
selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2):
1070 (1872).
dikylikostigma Kraenzl., Notizbl. Bot. Gart. BerlinDahlem., 7: 321 (1919).
leCToType: D. preussii Kraenzl. designated by
Rutkowski et al., Phylogeny & Taxonomy Subtribes
Spiranthinæ, 153 (2008).
dimerandra Schltr., Repert. Spec. Nov. Regni Veg.
Beih., 17: 43 (1922).
Type
speCies: D.
rimbachii
(Schltr.) Schltr.
(Epidendrum rimbachii Schltr.) designated by
Siegerist, Bot. Mus. Leal., 30: 204 (1986).
dinema Lindl., Orchid. Scelet., 16 (1826).
Type speCies: D. polybulbon (Sw.) Lindl. (Epidendrum
polybulbon Sw.) selected by Lindley, Coll. Bot.,
Append.: no. 125 (1826).
disperis Sw., Kongl. Vetensk. Acad. Nya Handl., 21:
218, t. 3f (1800).
Type speCies: D. circumlexa (L.) T. Durand & Schinz
(Ophrys circumlexa L.) selected by E.P. Phillips, Gen.
S. Afr. Fl. Pl., ed. 2, 237 (1951) and H.P. Linder et al.,
Orchid S. Afr., 299 (1999).
leCToType: D. circumlexa (L.) T. Durand & Schinz
designated by J.C. Manning, Taxon, 48: 48 (1999).
leCToType: D. capensis (L.) Sw. (Arethusa capensis
L.) designated by J.C. Manning, Taxon, 48: 46 (1999).
diuris Sm., Trans. Linn. Soc. London, Bot., 4: 222
(1798).
Type speCies: D. aurea Sm., selected by Smith, Exot.
Bot., 1: 15 (1805).
domingoa Schltr., Symb. Antill., 7: 496 (1913).
Type speCies: D. haematochila (Rchb.f.) Carabia
(Epidendrum haematochilum Rchb.f.) selected by
Carabia, Mem. Soc. Cub. Hist. Nat., 17(2): 143 (1943)
and Acuña, Cat. Descr. Orquid. Cuba, 60: 64 (1938).
dorycheile Rchb., Deut. Bot. Herb.-Buch, 56 (1841).
Type speCies: D. rubra (L.) Fuss (Serapias rubra
L.) selected by Fuss, Fl. Transsilv., 628 (1866) and
Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 1128 (1872).
drakaea Lindl., Sketch Veg. Swan R., Appendix: 55
(1840).
Type speCies: D. elastica Lindley designated by
Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 1134 (1872)
and Clements, M.A. Aust. Orch. Res., 1: 72 (1989).
diphryllum Raf., Med. Repos., ser. 2, 5: 357 (1808).
Type speCies: Diphryllum bifolium Raf. designated by
Rainesque.
Type speCies: Listera convallarioides (Sw.) Nuttall
(Epipactis convallarioides Sw.) selected by Pfeiffer,
Nomencl. Bot. (Pfeiffer), 1(2): 1091 (1872).
dryadorchis Schltr., Repert. Spec. Nov. Regni Veg.
Beih., 1: 976 (1913).
Type speCies: D. barbellata Schltr. selected by Senghas,
Orchideen (Schlechter), ed. 3, 1(19-20): 1201 (1988).
diplorrhiza Ehrhart, Beitr. Naturk. (Ehrhart), 4: 147
(1789).
dryopeia Thouars, Hist. Orchid., tt. 1-3 (1822).
leCToType: D. oppositifolia Thouars designated by
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
80
LANKESTERIANA
Kurzweil & Manning, Adansonia, ser. 3, 27(2): 167
(2005).
dryorkis Thouars, Nouv. Bull. Sci. Soc. Philom. Paris,
1: 316 (1809).
leCToType: D. tripetaloides Thouars designated by
Kurzweil & Manning, Adansonia, ser. 3, 27(2): 172
(2005).
elleanthus C. Presl, Rel. Haenk., 1: 97 (1827).
Type speCies: E. lancifolius C. Presl. selected by Britton
& Wilson, Sci. Surv. Porto Rico, 5(2): 203 (1924).
eltroplectris Raf., Fl. Tellur., 2: 51 (1836).
Type speCies: E. calcarata (Sw.) Garay & H.R. Sweet
(Neottia calcarata Sw.) selected by Britton & Wilson,
Sci. Surv. Porto Rico, 5(2): 186 (1924) and Garay, Fl.
Ecuador, 9: 239 (1978).
ephemerantha P.F.Hunt & Summerhayes, Taxon,
10(4): 102 (1961).
leCToType: E. angulata (Blume) P.F. Hunt
& Summerhayes (Desmotrichum angulatum Blume)
designated by P.F. Hunt & Summerhayes, Taxon,
10(4): 102 (1961).
epiblastus Schltr., Nachtr. Fl. Deutsch. Schutzgeb.
Südsee, 136 (1905).
Type speCies: E. ornithidioides Schltr. selected by van
Royen, Alpine Fl. New Guinea, 2: 489 (1979).
epidendrum L., Sp. Pl. (Linnaeus), ed. 1, 2: 952
(1753) (nom. rej.).
Type speCies: E. nodosum L. selected by Britton &
Wilson, Sci. Surv. Puerto Rico, 5(2): 203 (1924).
epidendrum L., Sp. Pl. (Linnaeus), ed. 2, 2: 1347
(1763) (nom. cons.).
leCToType: E. nocturnum Jacq. designated by Sprague,
Prop. Brit. Bot., 53 (1929) and Voss et al., Regnum Veg
111: 335 (1983).
epilyna Schltr., Beih. Bot. Centralbl., 36(2): 374 (1918).
leCToType: E. jimenezii Schltr. designated by Pupulin,
Bot. J. Linn. Soc., 163: 132 (2010).
epipactis Zinn, Cat. Pl. Hort. Gott., 85 (1757).
leCToType: E. helleborine (L.) Crantz (Serapias
helleborine L.) designated by H. Baumann et al., Mitt.
Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 470
(1989), P.J. Cribb & J.J. Wood, Taxon, 48: 49 (1999)
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
and Voss et al., Regnum Veg 111: 333 (1983).
epipogium J.G. Gmelin ex Borkhausen, Tent. Disp.
Pl. German., 139 (1792).
leCToType: E. aphyllum Sw. (Satyrium epipogium L.)
designated by H. Baumann et al., Mitt. Bl. Arbeitskr.
Heim. Orch. Baden-Württ., 21(3): 477 (1989).
eriochilus R.Br., Prodr. Fl. Nov. Holland., 323 (1810).
TYPE SPECIES: E. cucullatus (Labillardière) Rchb.f.
(Epipactis cucullata Labillardière) selected by Pfeiffer,
Nomencl. Bot. (Pfeiffer), 1(2): 1240 (1872).
Type speCies: E. autumnalis R.Br. (nom. illeg.) selected
by S.D. Hopper & A.P. Brown, Nuytsia 16(1): 30
(2006).
erporkis Thouars, Nouv. Bull. Sci. Soc. Phil., Paris,
1: 317 (1809).
leCToType: Goodyera occulta Thouars designated by
Ormerod, Gen. Orch., 3: 136 (2003).
eulophia R.Br. ex Lindl.. Bot. Reg., 7: sub 578 [573],
as Eulophus (1821), and Bot. Reg., 8: t. 686 (1822).
leCToType: Eulophia guineensis Lindl. designated by
W. Greuter et al., Regnum Veg., 118: 186 (1988).
eurycentrum Schltr., Nachtr. Fl. Deutsch Schutzgeb.
Südsee, 89 (1905).
leCToType: E. obscurum (Blume) Schltr. (Cystorchis
obscura Blume) designated by Ormerod, Gen. Orch.,
3: 90 (2003).
eurystyles Wawra, Österr. Bot. Zeitschr., 13: 223
(1863).
leCToType: E. cotyledon Wawra designated by
Rutkowski et al., Phylogeny & Taxonomy Subtribes
Spiranthinæ, 149 (2008).
evelyna Poepp. & Endl., Nova Gen. Sp., 1: 32 (1836).
Type speCies: E. capitata Poepp. & Endl. selected
by Dressler, Gen. Orch., 4: 598 (2005) and Pfeiffer,
Nomencl. Bot. (Pfeiffer), 1(2): 1321 (1874).
evota Rolfe, Fl. Cap. (Harvey), 5(3): 268 (1913).
Type speCies: E. harveyana (Lindl.) Rolfe (Ceratandra
harveyana Lindl.) selected by E.P. Phillips, Gen. S.
Afr. Fl. Pl., ed. 2, 238 (1951).
Fernandezia Ruiz & Pavón, Fl. Peruv. Prodr., 123, t.
27 (1794).
leCToType: E. subbilora Ruiz & Pavón designated
alriCh & higgins — Orchid genera typiication
81
by Dunsterville & Garay, Venez. Orchids Ill., 5: 124
(1972).
designated by Christenson, Kew Bulletin, 41(4): 836
(1986).
Flickingeria A.D. Hawkes, Orchid Weekly, 2(46): 451
(1961).
leCToType: F. angulata (Blume) A.D. Hawkes
(Desmotrichum angulatum Blume) designated by
Averyanov, Bot. Zhurn. (Moscow & Leningrad),
76(1): 125 (1991).
Gavilea Poepp., Frag. Syn. Pl. Chil., 188 (1833).
leCToType: G. leucantha Poepp. designated by M.N.
Corrêa, Fl. Patagónica, 8(2): 191 (1969) and Gen.
Orch., 3: 10 (2003).
Fractiunguis Schltr., Anexos Mem. Inst. Butantan,
Secç. Bot. 1(4): 56 (1922).
Type speCies: F. relexus (Rchb.f.) Schltr. (Hexisea
relexa Rchb.f.) selected by Acuña, Cat. Descr. Orquid.
Cuba, 60: 89. (1938).
leCToType: F. relexus (Rchb.f.) Schltr. designated by
Dressler, Gen. Orch., 4: 310 (2005).
Funkiella Schltr., Beih. Bot. Centralbl., 37(2): 430
(1920).
leCToType: F. hyemalis (A.Rich. & Galeotti) Schltr.
(Spiranthes hyemalis A.Rich. & Galeotti) designated
by Rutkowski et al., Phylogeny & Taxonomy Subtribes
Spiranthinæ, 168 (2008) and Burns-Balogh, Amer. J.
Bot., 69: 1131 (1982).
Galearis Raf., Herb. Raf., 71 (1833).
leCToType: G. spectabilis (L.) Raf. (Orchis spectabilis
L.) designated by Sheviak, Taxon, 48: 49 (1999).
Galeoglossum A.Rich. & Galeotti, Ann. Sci. Nat.,
Bot., sér. 3, 3: 31 (1845).
Type speCies: G. prescottioides A.Rich. & Galeotti
selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2):
1401 (1872).
leCToType: G. prescottioides A.Rich. & Galeotti
designated by Salazar, Proc. Second Sci. Conf.
Andrean Orchids, 169 (2009).
Galeottiella Schltr., Beih. Bot. Centralbl., 37(2): 360
(1920).
leCToType: G. sarcoglossa (A.Rich. & Galeotti)
Schltr. (Spiranthes sarcoglossa A.Rich. & Galeotti)
designated by Burns-Balogh, Amer. J. Bot., 69(7):
1131 (1982) and Rutkowski et al., Phylogeny &
Taxonomy Subtribes Spiranthinæ, 146 (2008).
Gastrochilus D. Don, Prodr. Fl. Nepal., 32 (1825).
leCToType: G. calceolaris (Buch.-Ham. ex Sm.)
D. Don (Aerides calceolare Buch.-Ham. ex Sm.)
Gennaria Parlatore, Fl. Ital. (Parlatore), 3: 404 (1860).
Type speCies: G. diphylla (Link) Parlatore (Satyrium
diphyllum Link) selected by Schlechter, Repert. Spec.
Nov. Regni Veg., 15: 296 (1918).
Gigliolia Barb.Rodr., Gen. Sp. Orch. Nov., 1: 25
(1877).
leCToType: G. geraensis Barb.Rodr. indirectly
designated by Garay, Orquideologia, 9: 117 (1974).
Glossochilopsis Szlach., Fragm. Florist. Geobot.,
3(Suppl.): 122 (1995).
leCToType: G. chamaeorchis (Schltr.) Szlach.
(Microstylis chamaeorchis Schltr.) designated by
Margonska, Richardiana, 8(2): 75 (2008).
Glossodia R.Br., Prodr. Fl. Nov. Holland., 325 (1810).
Type speCies: G. major R.Br. selected by M.A.
Clements, Austral. Orchid. Res., 1: 83 (1989).
Gonogona Link, Enum. Hort. Berol. Alt., 2: 369
(1822).
Type speCies: Goodyera repens (L.) R.Br. (Satyrium
repens L.) selected by Pfeiffer, Nomencl. Bot.
(Pfeiffer), 1(2): 1481 (1872).
Goodyera R.Br., Hortus Kew, ed. 2, 5: 197 (1813).
Type speCies: G. repens (L.) R.Br. (Satyrium repens
L.) selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2):
1485 (1872), Britton & Brown, Ill. Fl. N.U.S., ed. 2, 1:
569 (1913) and Sprague, J. Bot., 64: 113 (1926).
leCToType: G. repens (L.) R.Br. designated by H.
Baumann et al., Mitt. Bl. Arbeitskr. Heim. Orch.
Baden-Württ., 21(3): 479 (1989).
Grastidium Blume, Bijdr. Fl. Ned. Ind., 7: 333, 433
(1825).
Type speCies: G. salaccense Blume selected by Breiger,
Orchideen (Schlechter), ed. 3, 11/12: 653 (1981).
Gymnadenia R.Br., Hortus Kew., ed. 2, 5: 191 (1813).
leCToType: G. conopsea (L.) R.Br. (Orchis conopsea
L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
82
LANKESTERIANA
Heim. Orch. Baden-Württ., 21(3): 482 (1989).
Gymnadeniopsis Rydb., Man. Fl. N. States (Britton),
293 (1901).
Type speCies: G. nivea (Nuttall) Rydb. (Orchis nivea
Nuttall) selected by Britton & Brown, Ill. Fl. N.U.S.,
ed. 2, 1: 552 (1913).
Gyrostachys Pers. ex Blume, Coll. Orch., 127 (1859).
Type speCies: G. spiralis (L.) Pers. ex Blume (Ophrys
spiralis L.) selected by Kuntze, Rev. Gen. Pl., 2: 663
(1891).
leCToType: G. spiralis (L.) Pers. ex Blume designated
by Garay, Bot. Mus. Leal., 28(4) 360 (1980)[1982].
Habenaria Willd., Sp. Pl., ed. 4, 44 (1805).
Type speCies: H. macroceratitis Willd. (Orchis
habenaria L.) selected by Kraenzlin, Bot. Jahrb. Syst.,
16: 58 (1892).
Type speCies: H. monorrhiza (Sw.) Rchb.f. (Orchis
monorrhiza Sw.) invalidly selected by Lindley,
Bot. Reg., 18: sub 1499 (1832). The above type
name is now considered a synonym of the species
Habenaria quinqueseta var. macroceratitis (Willd.)
Luer (Habenaria macroceratitis Willd.) which was
lectotyped by P.J. Cribb, Taxon, 48: 48 (1999).
Hammarbya Kuntze, Revis. Gen. Pl., 2: 665 (1891).
leCToType: H. paludosa (L.) Kuntze (Ophrys paludosa
L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr.
Heim. Orch. Baden-Württ., 21(3): 487 (1989).
Hapalorchis Schltr., Beih. Bot. Centralbl., 37(2): 362
(1920).
Type
speCies: H.
candidus
(Kraenzl.) Schltr.
(Sauroglossum candidum Kraenzl.) selected by Britton
& Wilson, Sci. Surv. Porto Rico, 5(2): 186 (1924).
leCToType: H. cheirostyloides Schltr. designated by
Rutkowski et al., Phylogeny & Taxonomy Subtribes
Spiranthinæ, 134 (2008).
Haraella Kudô, J. Soc. Trop. Agric., 2: 26 (1930).
leCToType: H. retrocalla (Hayata) Kudô (Saccolabium
retrocallum Hayata) designated by Butzin, Taxon,
32(4): 631 (1983).
Herminium L., Opera Var., 251 (1758), and Fl. Lapp.
(Linnaeus), 247 (1737).
leCToType: H. monorchis (L.) R.Br. (Orchis monorchis
L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
Heim. Orch. Baden-Württ., 21(3): 489 (1989); and
Averyanov, Bot. Zhurn. (Moscow & Leningrad),
75(7): 1027 (1990).
Hetaeria Blume, Bijdr. Fl. Ned. Ind., 8: 409, t. 14
(1930).
leCToType: H. oblongifolia Blume designated by L.G.
Adams, Taxon, 36(3): 651 (1987).
Himantoglossum Spreng., Syst. Veg. (Sprengel), ed.
16, 3: 675, 694 (1826).
leCToType: H. hircinum (L.) Spreng. (Satyrium
hircinum L.) designated by H. Baumann et al., Mitt.
Bl. Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 491
(1989).
Holothrix Rich. ex Lindl., Gen. Sp. Orchid. Pl., 257,
283 (1835).
Type speCies: H. hispidula (L.f.) T. Durand & Schinz
(Orchis hispidula L.f.) selected by Pfeiffer, Nomencl.
Bot. (Pfeiffer), 1(2): 1658 (1872).
Humboldtia Ruiz & Pavón, Fl. Peruv. Chil. Prodr.,
121, t. 27 (1794).
leCToType: H. purpurea Ruiz & Pavón designated
by Garay & H.R. Sweet, J. Arnold Arbor., 53(4): 522
(1972).
Huntleya Bateman ex Lindl., Edwards’s Bot. Reg., 23:
sub 1991 (1837).
Type speCies: H. sessililora Bateman ex Lindl.
selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2):
1680 (1872).
Ibidium Salisb., Trans. Hort. Soc. London, 1: 291
(1812).
Type speCies: I. spirale (L.) Salisb. (Ophyrs spiralis L.)
selected by House, Bull. Torr. Club, 32: 380 (1905).
Ionopsis Kunth, Nov. Gen. Sp., 1: 348, t. 83 (1815).
Type speCies: I. utricularioides (Sw.) Lindl.
(Epidendrum utricularioides Sw.) selected by M.W.
Chase, Gen. Orchid., 5: 281 (2009).
Isochilus R.Br., Hortus Kew, ed. 2, 5: 209 (1813).
leCToType: I. linearis (Jacq.) R.Br. (Epidendrum
lineare Jacq.), designated by Angely, Fl. Analitica São
Paulo, 6: 1303 (1973) and Summerhayes, Index Nom.
Gen. (Pl.), 2: 880 (1979) card #64/23515.
Type speCies: I. linearis (Jacq.) R.Br. selected by
alriCh & higgins — Orchid genera typiication
Pfeiffer, Nomencl. Bot. (Pfeiffer), 1(2): 1767 (1872);
and type indirectly selected by Reichenbach f.,
Bonplandia (Hannover), 2: 22 (1854).
Jacquiniella Schltr., Repert. Spec. Nov. Regni Veg.
Beih., 7: 123 (1920).
Type speCies: J. globosa (Jacq.) Schltr. (Epidendrum
globosum Jacq.) selected by Britton & Wilson, Sci.
Surv. Porto Rico, 5(2): 197 (1924).
Jensoa Raf., Fl. Tellur., 4: 38 (1836)[1837]
leCToType: J. ensata (Thunberg) Raf. nom. illeg.
(Limodorum ensatum Thunberg) designated by P.F.
Hunt, Kew Bull., 24(1): 94 (1970).
Jimensia Raf., Fl. Tellur., 4: 38 (1836)[1837].
Type speCies: J. nervosa Raf., nom. illeg., Bletilla
striata (Thunberg) Rchb.f. (Limodorum striatum
Thunberg), indirectly selected by Garay & R.E.
Schultes, Bot. Mus. Leal., 18(5): 184 (1958).
Jumellea Schltr., Orchideen (Schlechter), ed. 1, 609
(1914).
leCToType: J. recurva (Thouars) Schltr. (Angraecum
recurum Thouars) designated by Garay, Bot. Mus.
Leal., 23(4): 182 (1972).
kefersteinia Rchb.f., Bot. Zeitung (Berlin), 10: 633
(1852).
Type speCies: K. graminea (Lindl.) Rchb.f.
(Zygopetalon gramineum Lindl.) designated by Garay,
Orquideologia, 4: 150 (1969).
kingidium P.F. Hunt, Kew Bull., 24(1): 97 (1970).
leCToType: K. taeniale (Lindl.) P.F.Hunt (Aerides
taenialis Lindl.) designated by Averyanov, Bot. Zhurn.
(Moscow & Leningrad), 76(6): 891 (1991).
kingiella Rolfe, Orchid Rev., 25(297): 196 (1917).
leCToType: K. taenialis (Lindl.) Rolfe (Aerides
taenialis Lindl.) designated by P.F. Hunt, Amer. Orchid
Soc. Bull., 40(12): 1094 (1971).
kraenzlinorchis Szlach., Orchidee (Hamburg), 55(1):
57 (2004).
leCToType: K. mandersii (Collett & Hemsl.) Szlach.
(Habenaria mandersii Collett & Hemsl.) designated
by H. Kurzweil, Thai For. Bull. (Bot.), 77 (2009).
kuhlhasseltia J.J. Sm., Icon. Bogor., 4: 1, t. 301
(1910).
leCToType: K. javanica J.J.Sm. designated
Ormerod, Gen. Orch., 3: 110 (2003).
83
by
laelia Lindl., Gen. Sp. Orch. Pl., 115 (1831).
Type speCies: L. grandilora (Lex.) Lindl. (Bletia
grandilora Lex.) indirectly selected by Dandy, Kew
Bull., 86. (1935).
lanium Lindl. ex Benth., Hooker’s Icon. Pl., 14: 24,
t. 1334 (1881).
Type speCies: L. avicula (Lindl.) Benth. (Epidendrum
avicula Lindl.) selected by Angely, Fl. Analitica São
Paulo, 6: 1294 (1973).
lecanorchis Blume, Mus. Bot., 2: 188 (1856).
leCToType: L. javanica Blume designated by Garay &
H.R. Sweet, Orchids S. Ryukyu Islands, 49 (1974).
leochilus Knowles & Westc., Fl. Cab., 2: 143 (1838).
Type speCies: L. oncidioides Knowles & Westc.
designated by Knowles & Westcott.
Type speCies: Oncidium macrantherum Hook. invalidly
selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(1): 64
(1874).
lepanthes Sw., Nova Acta Regiae Soc. Sci. Upsal., 6:
85 (1799).
Type speCies: L. concinna Sw. selected by Britton &
Wilson, Sci. Surv. Porto Rico, 5(2): 206 (1924).
lepanthopsis Ames, Bot. Mus. Leal., 1(9): 3 (1933).
Type speCies: L. loripecten (Rchb.f.) Ames
(Pleurothallis loripecten Rchb.f.)
selected by Garay, Orquideologia, 9: 116 (1974).
leptoceras (R.Br.) Lindl., Sketch Veg. Swan River
Colony, 53 (1840).
Type speCies: L. menziesii (R.Br.) Lindl. (Caladenia
menziesii R.Br.) selected by A.S. George, Nuytsia, 1:
183 (1971).
leucostachys Hoffmannsegg, Verz. Orchid., 26 (1842).
Type speCies: L. procera (Ker Gawler) Hoffmannsegg
(Neottia procera Ker Gawler) selected by Pfeiffer,
Nomencl. Bot. (Pfeiffer), 2(1): 102 (1874).
limnorchis Rydb., Mem. New York Bot. Gard., 1: 104
(1900).
Type speCies: L. hyperborea (L.) Rydb. (Orchis
hyperborea L.) selected by Britton & Brown, Ill. Fl.
N.U.S., ed. 2, 1: 554 (1913).
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
84
LANKESTERIANA
limodorum Boehm. (nom. cons.), Deinitiones
Generum Plantarum: 358 (1760).
leCToType: L. abortivum (L.) Sw. (Orchis abortiva L.)
designated by Greuter et al., Regnum Veg. 118: 183
(1988) and H. Baumann et al., Mitt. Bl. Arbeitskr.
Heim. Orch. Baden-Württ., (3): 493 (1989).
limodorum L., Sp. Pl., ed. 1, 2: 950 (1753).
Type speCies: L. tuberosum L. selected by & Brown, Ill.
Fl. N.U.S., ed. 2, 1: 562 (1913).
liparis Rich., De Orchid. Eur., 21, 30 & 38, f. 10
(1817).
leCToType: L. loeselii (L.) Rich. (Ophrys loeselii L.)
designated by H. Baumann et al., Mitt. Bl. Arbeitskr.
Heim. Orch. Baden-Württ., 21(3): 495 (1989).
lissochilus R.Br. ex Lindl., Bot. Reg., 7: t. 573, sub
578 (1821), and Coll. Bot. (Lindley), t. 31 (1822).
Type speCies: L. speciosus R.Br. ex Lindl. selected by
Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(1): 135 (1874).
listera R.Br., Hortus Kew., ed. 2, 5: 201 (1813).
leCToType: L. ovata (L.) R.Br. (Ophrys ovata L.)
selected by H. Baumann et al., Mitt. Bl. Arbeitskr.
Heim. Orch. Baden-Württ., 21(3): 499 (1989).
listrostachys Rchb.f., Bot. Zeitung (Berlin), 10: 930
(1852).
Type speCies: L. jenischiana Rchb.f. designated by
H.G. Reichenbach.
Type speCies: L. pertusa (Lindl.) Rchb.f. (Angraecum
pertusum Lindl.) selected by Pfeiffer, Nomencl. Bot.
(Pfeiffer), 2(1): 136 (1874).
ludisia A.Rich., Dict. Class. Hist. Nat., 7: 437 (1825).
leCToType: L. discolor (Ker Gawler) A.Rich.
(Goodyera discolor Ker Gawler) designated by
Ormerod, Lindleyana, 17(4): 211 (2002).
luisia Gaudichaud-Beaupré, Voy. Uranie, Bot., 426, t.
37 (1826)[1829].
Type speCies: L. tenuifolia Blume not validly selected
by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(1): 168 (1874).
lycaste Lindl., Edwards’s Bot. Reg., 29(Misc): 14
(1843).
Type speCies: L. macrophylla (Poepp.) Lindl.
(Maxillaria macrophylla Poepp.) selected by Acuña,
Cat. Descr. Orquid. Cuba, 60: 165 (1938).
leCToType: L. macrophylla (Poepp.) Lindl. designated
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
by Bullock, Kew Bull., 13: 254 (1958).
leCToType: L. plana Lindl. designated by Oakeley,
Lycaste, Ida and Anguloa, 22 (2008) and McVaugh, Fl.
Novo-Galiciana, 16: 188 (1985).
lyperanthus R.Br., Prodr. Rl. Nov. Holland., 325
(1810).
Type speCies: L. suaveolens R.Br. selected by M.A.
Clements, Austral. Orchid. Res., 1: 90 (1989).
lyroglossa Schltr., Beih. Bot. Centralbl., 37(2): 448
(1920).
leCToType: L. bradei Schltr. ex Mansf. designated by
Burns-Balogh, Amer. J. Bot., 69(7): 1132 (1982).
Type speCies: L. grisebachii (Cogn.) Schltr. (Spiranthes
grisebachii Cogn.) selected by Angely, Fl. Analitica
São Paulo, 6: 1277 (1973).
Macdonaldia Gunn ex Lindl., Sketch Veg. Swan Riv.,
50, t. 9 (1840).
Type speCies: M. smithiana Lindl. selected by M.A.
Clements, Austral. Orchid Res., 1: 137 (1989).
leCToType: M. antennifera Lindl. designated by
Szlachetko, Fragm. Florist. Geobot., 3(Suppl.): 112
(1995).
Malaxis Sw., Prodr. (Swartz), 8: 119 (1788).
Type speCies: M. rheedii Sw. invalidly selected by
Ascherson, Fl. Prov. Brandenb., 1: 699 (1864).
Type speCies: M. spicata Sw. selected by Britton &
Brown, Ill. Fl. N.U.S., ed. 2, 1: 570 (1913).
Malleola Schltr., Repert. Spec. Nov. Regni Veg. Beih.,
1: 119 (1913).
leCToType: M. sphingoides J.J.Sm. designated by
Garay, Bot. Mus. Leal., 23(4): 184 (1972) and
Averyanov, Bot. Zhurn. (Moscow & Leningrad),
76(6): 894 (1991).
Type speCies: M. undulata J.J.Sm. & Schltr. selected by
Christenson, Kew Bulletin, 41(4): 837 (1986).
Maxillaria Ruiz & Pavón, Fl. Peruv. Prodr., 116, t. 25
(1794).
Type speCies: M. longipetala Ruiz & Pavón invalidly
selected by Acuña, Cat. Descr. Orquid. Cuba, 60: 171
(1938).
leCToType: M. ramosa Ruiz & Pavón designated by
Garay & H.R. Sweet, J. Arnold Arbor., 53(4): 524
(1972).
Type speCies: M. platypetala Ruiz & Pavón selected
alriCh & higgins — Orchid genera typiication
Brieger & P.F. Hunt, Taxon, 18: 602 (1969).
leCToType: M. platypetala Ruiz & Pavón designated
by Garay, Harvard Pap. Bot., 2: 52 (1997).
Megastylis (Schltr.) Schltr., Bot. Jahrb. Syst., 45: 379,
384 (1911).
Type speCies: M. gigas (Rchb.f.) Schltr. (Caladenia
gigas Rchb.f.) selected by N. Hallé, Fl. Nouvelle
Caledonie & Depend., 8: 487 (1977).
Menadenium Raf. ex Cogn., Fl. Bras. (Martius), 3(5):
581 (1902).
Type speCies: M. kegelii (Rchb.f.) Cogn. (Zygopetalum
kegelii Rchb.f.) selected by Pupulin, Gen. Orchid., 5:
544 (2009).
Mesadenella Pabst & Garay, Arquin. Jard. Bot. Rio,
12: 205 (1952).
Type speCies: M. esmeraldae (Linden & Rchb.f.) Pabst
& Garay (Spiranthes esmeraldae Linden & Rchb.f.)
selected by M.N. Correa, Darwiniana, 11: 68 (1955).
leCToType: M. esmeraldae (Linden & Rchb.f.) Pabst
& Garay designated by Burns-Balogh, Amer. J. Bot.,
69: 1132 (1982).
Mesadenus Schltr., Beih. Bot. Centralbl., 37(2): 367
(1920).
Type speCies: M. galeottianus (A.Rich.) Schltr.
(Spiranthes galeottiana A.Rich.) selected by Britton
& Wilson, Sci. Surv. Porto Rico, 5(2): 186 (1924).
Microchilus C. Presl, Rel. Haenk., 1: 94 (1827).
leCToType: M. minor C. Presl designated by Ormerod,
Gen. Orch., 3: 121 (2003).
Microtatorchis Schltr., Nachtr. Fl. Deutsch. Schutzgeb.
Südsee, 234 (1905).
leCToType: M. perpusilla Schltr. designated by
Bullock, Index Nom. Gen. (Pl.), 2: 1093 (1976) card
#30/05211 (1958).
Microtis R.Br., Prodr. Fl. Nov. Holland., 320 (1810).
leCToType: M. rara R.Br. designated by Garay & H.R.
Sweet, Orchids S. Ryukyu Islands, 42 (1974).
Mischobulbum Schltr., Repert. Spec. Nov. Regni Veg.
Beih., 1: 98 (1911).
Type speCies: M. scapigerum (Hook.f.) Schltr.
(Nephelaphyllum scapigerum Hook.f.) selected by
Senghas, Orchideen (Schlechter), ed. 3, 1: 851 (1984).
leCToType: M. scapigerum (Hook.f.) Schltr. designated
85
by Averyanov, Bot. Zhurn. (Moscow & Leningrad),
75(12): 1765 (1990).
Monadenia Lindl., Gen. Sp. Orchid. Pl., 356 (1838).
leCToType: M. brevicornis Lindl. designated by H.P.
Linder, Bothalia, 13(3-4): 342 (1981).
Monanthochilus R. Rice, Oasis (Dora Creek),
3(Suppl.): 2 (2004).
leCToType: M. chrysanthus (Schltr.) R. Rice
(Sarcochilus chrysanthus Schltr.) designated by R.
Rice, Oasis (Dora Creek), 3(Suppl.): 2 (2004).
Monixus Finet, Bull. Soc. Bot. France Mém., 54(9):
15 (1907).
leCToType: M. striatus (Thouars) Finet (Angraecum
striatum Thouars) designated by Garay, Kew Bull., 28:
496 (1973).
Mycaranthes Blume, Bijdr. Fl. Ned. Ind., 7: 352, t. 57
(1825).
Type speCies: M. lobata Blume selected by P.J. Cribb,
Gen. Orch., 4: 564 (2005).
Myrobroma Salisb., Parad. Lond., 2: t. 82 (1807).
Type speCies: M. fragrans Salisb. nom. illeg. This
species is now considered a synonym of Vanilla
planifolia Jacks. ex Andrews.
Type speCies: Vanilla planifolia Jacks. ex Andrews not
validly selected by Pfeiffer, Nomencl. Bot. (Pfeiffer),
2(1): 395 (1874).
leCToType: Vanilla planifolia Jacks. ex Andrews
designated by Garay & H.R. Sweet, Fl. Lesser Antilles,
44 (1974).
Mystacidium Lindl., Compan. Bot. Mag., 2(19): 205
(1837).
Type speCies: Limodorum longicornu Sw. This name is
now accepted as a synonym of Mystacidium capense
(L.f.) Schltr. (Epidendrum capense L.f.) invalidly
selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(1):
401 (1874).
nematoceras Hook.f., Fl. Nov.-Zel., 1(4): 249, t. 57
(1853).
Type speCies: N. oblonga Hook.f. invalidly selected by
Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(1): 426 (1874).
Type speCies: N. macranthum Hook.f. selected by
D.L. Jones & M.A. Clements, Orchadian, 13(10): 449
(2002).
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
86
LANKESTERIANA
neokoehleria Schltr. Repert. Spec. Nov. Regni Veg.,
10: 390 (1912).
Type speCies: N. equitans Schltr. selected by M.W.
Chase, Gen. Orchid., 5: 248 (2009).
neotinea Rchb.f., De Pollin. Orchid., 9, 18 & 29
(1852).
Type speCies: Aceras intactum (Link) Rchb.f. (Orchis
intacta Link) invalidly selected by Pfeiffer, Nomencl.
Bot. (Pfeiffer), 2(1): 428 (1874).
neottia Guettard (nom. cons.), Hist. Acad. Roy. Sci.
Mém. Math. Phys. (Paris), 4: 374 (1754).
leCToType: N. nidus-avis (L.) Rich. (Ophrys nidusavis L.) designated by H. Baumann et al., Mitt. Bl.
Arbeitskr. Heim. Orch. Baden-Württ., 21(3): 504
(1989) and Greuter et al., Regnum Vegetabile 118: 184
(1988).
neottianthe Rchb., Icon. Bot. Pl. Crit., 6: 26 (1828).
leCToType: N. cucullata (L.) Schltr. (Orchis cucullata
L.) designated by H. Baumann et al., Mitt. Bl. Arbeitskr.
Heim. Orch. Baden-Württ., 21(3): 506 (1989).
nephelaphyllum Blume, Bijdr. Fl. Ned. Ind., 8: 372,
t. 22 (1825).
leCToType: N. pulchrum Blume designated by
Averyanov, Bot. Zhurn.(Moscow & Leningrad),
75(12): 1765 (1990).
nigritella Rich., De Orchid. Eur., 19, 26, 34 (1817).
leCToType: N. nigra (L.) Rchb.f. (Satyrium nigrum L.)
designated by H. Baumann et al., Mitt. Bl. Arbeitskr.
Heim. Orch. Baden-Württ., 21(3): 507 (1989).
notylia Lindl., Bot. Reg., 11: sub 930 (1825).
leCToType: N.
punctata
(Ker-Gawler)
Lindl.
(Pleurothallis punctata Ker-Gawler) designated by
Butzin, Taxon, 32(4): 631 (1983).
Odontochilus Blume, Coll. Orchid., 79 (1859).
leCToType: O.
lavescens
(Blume)
Blume
(Anoetochilus lavescens Blume) designated by
Averyanov, Turcazaninowia, 11(1): 136 (2008).
Oeceoclades Lindl., Edwards’s Bot. Reg., 18: sub
1522 (1832).
Type speCies: O. maculata (Lindl.) Lindl. selected by
Lindley, J. Proc. Linn. Soc., Bot., 3: 36 (1859).
leCToType: O. maculata (Lindl.) Lindl. (Angraecum
maculatum Lindl.) designated by Garay & P. Taylor,
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
Bot. Mus. Leal., 24(9): 253 (1976).
Oeoniella Schltr., Beih. Bot. Centralbl., 33(2): 439
(1915).
Type speCies: O. polystachys (Thouars) Schltr.
(Epidendrum polystachys Thouars) selected by
Senghas, Orchidee (Hamburg), 14: 215 (1963).
Oncidium Sw., Vet. Akad. Handl. Stockholm, 21: 239
(1800).
Type speCies: O. altissimum (Jacq.) Sw. (Epidendrum
alissimum Jacq.) selected by Pfeiffer, Nomencl. Bot.
(Pfeiffer), 2(1): 497 (1874) and M.W. Chase, Gen.
Orch., 5: 308 (2009).
leCToType: O. variegatum Sw. designated by Garay,
Bradea, 1(40): 398 (1974).
Type speCies: O. carthagenense (Jacq.) Sw.
(Epidendrum carthagenense Jacq.) invalidly selected
by Britton & Wilson, Bahama Fl., 97 (1920).
Ophrys L., Sp. Pl. (Linnaeus), ed. 1, 2: 945 (1753).
leCToType: O. insectifera L. designated by M.L.
Green, Prop. Brit. Bot., 185 (1929) and H. Baumann
et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ.,
21(3): 512 (1989).
Orchis L., Sp. Pl. (Linnaeus), ed. 1, 2: 939 (1753).
Type speCies: O. militaris L. selected by Britton &
Brown, Ill. Fl. N.U.S., ed. 2, 1: 551 (1913).
leCToType: O. militaris L. designated by H. Baumann
et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ.,
21(3): 521 (1989).
Oreorchis Lindl., J. Proc. Linn. Soc., Bot., 3: 26
(1858).
leCToType: O. patens (Lindl.) Lindl. (Corallorhiza
patens Lindl.) designated by Pearce & P.J. Cribb,
Edinb. J. Bot., 54: 292 (1997).
Orthoceras R.Br., Prodr. Fl. Nov. Holland., 316 (1810).
Type speCies: O. strictum R.Br. selected by M.A.
Clements, Austral. Orchid. Res., 1: 100 (1989).
Orthopenthea Rolfe, Fl. Cap. (Harvey), 5(3): 179
(1912).
Type speCies: O. bivalvata (L.f.) Rolfe (Ophrys
bivalvata L.f.) selected by E.P. Phillips, Gen. S. Afr.
Fl. Pl., ed. 2, 235 (1951).
Otochilus Lindl., Gen. Sp. Orchid. Pl., 53 (1830).
leCToType: O. porrectus Lindl. designated by Butzin,
alriCh & higgins — Orchid genera typiication
87
Taxon, 32(4): 631 (1983).
leCToType: O. fuscus Lindl. designated by Averyanov,
Bot. Zhurn. (Moscow & Leningrad), 75(12): 1767
(1990).
pelatantheria Ridl., J. Linn. Soc., Bot., 32: 371 (1896).
leCToType: P. ctenoglossum Ridl. designated by
Butzin, Taxon, 32(4): 632 (1983) and Averyanov, Bot.
Zhurn. (Moscow & Leningrad), 76(6): 893 (1991).
Otostylis Lindl., Gen. Sp. Orchid. Pl., 53 (1830).
Type speCies: O. brachystalix (Rchb.f.) Schltr.
(Zygopetalum brachystalix Rchb.f.) selected by
Pupulin, Gen. Orch., 5: 515 (2009).
pelexia Poiteau ex Lindl., Bot. Reg., 12: sub 985
(1826).
Type speCies: P. spiranthoides Lindl. This name is now
considered a synonym of
P. adnata (Sw.) Poiter ex Rich. (Satyrium adnatum
Sw.) which was lectotyped by Garay, Fl. Less. Antill.,
Orchid., 68 (1974).
Oxystophyllum Blume, Bijdr. Fl. Ned. Ind., 7: 335, t.
38 (1825).
Type speCies: O. rigidum Blume selected by Breiger,
Orchideen (Schlechter), ed. 3, 11/12: 676 (1981).
pachygenium Szlach., Tamayo & Rutk., Polish Bot.
J., 46(1): 3 (2001).
leCToType: P. albicans Cogn. designated by BurnsBalogh, Amer. J. Bot., 69: 1131 (1982).
leCToType: P. oestriferum (Rchb.f. & Warm.) Szlach.,
Tamayo & Rutk. (Spiranthes oestriferum Rchb.f. &
Warm.) designated by Szlachetko, Tamayo & Rutkowski, Polish Bot. J., 46(1): 3 (2001).
pachyplectron Schltr., Bot. Jahrb. Syst., 39: 51 (1906).
Type speCies: P. arifolium Schltr. selected by N. Hallé,
Fl. Nouvelle Caledonie & Depend., 8: 506 (1977) and
P.J. Cribb, Gen. Orch., 3: 131 (1999).
pachystelis Rauschert, Feddes Repert., 94: 456 (1983).
leCToType: P.
jimenezii
(Schltr.)
Rauschert
(Scaphyglottis jimenezii Schltr.) designated by
Rauschert, Feddes Repert., 94: 456 (1983).
palmorchis Barb.Rodr., Gen. Sp. Orch. Nov., 1: 169
(1877).
Type speCies: P. pubescens Barb.Rodr. selected by
Schlechter, Repert. Spec. Nov. Regni Veg., 16: 442
(1920).
pecteilis Raf., Fl. Tellur., 2: 37 (1837).
Type speCies: P. susannae (L.) Raf. selected by
Schlechter, Repert. Spec. Nov. Regni Veg., 4: 120
(1919).
leCToType: P. susannae (L.) Raf. (Orchis susannae L.)
designated by Butzin, Taxon, 32(4): 631 (1983), P.J.
Cribb, Taxon, 48: 49 (1999).
Type speCies: P. gigantea (Sm.) Raf. (Orchis gigantea
Sm.) invalidly selected by S. Misra, Orchids Orissa,
139 (2004).
pennilabium J.J.Sm., Bull. Jard. Bot. Buitenzorg, ser.
2, 13: 47 (1914).
leCToType: P. angraecum (Ridl.) J.J.Sm. (Saccolabium
angraecum Ridl.) designated by Garay, Bot. Mus.
Leal., 23(4): 189 (1972) and Averyanov, Bot. Zhurn.
(Moscow & Leningrad), 76(6): 892 (1991).
penthea Lindl., Gen. Sp. Orchid. Pl., 360 (1838) and
Intr. Nat. Syst. Bot., ed. 2, 446 (1836).
Type speCies: P. patens (L.f.) Lindl. (Ophrys patens
L.f.) selected by E.P. Phillips, Gen. S. Afr. Fl. Pl., ed.
2, 236 (1951).
Type speCies: P. melaleuca (Thunberg) Lindl. (Serapias
melaleuca Thunberg) invalidly selected by Pfeiffer,
Nomencl. Bot. (Pfeiffer), 2(1): 627 (1874).
pentisea (Lindl.) Szlach., Polish Bot. J., 46(1): 19 (2001).
leCToType: P. gemmata (Lindl.) Szlach. (Calaenia
gemmata Lindl.) designated by Szlachetko, Polish Bot.
J., 46(1): 19 (2001).
peristylus Blume, Bijdr. Fl. Ned. Ind., 8: 404 (1825).
gemmata: P. grandis Blume designated by Greuter et
al., Regnum Veg., 118: 183 (1988) and Seidenfaden,
Dansk Bot. Arkiv, 31(3): 27 (1977).
petalochilus R.S.Rogers, J. Bot., 62: 65 (1924).
Type speCies: P. calyciformis R.S. Rogers selected by
D.L. Jones & M.A. Clements, Orchadian, 13(9): 406
(2001).
phloeophila Hoehne & Schltr., Arch. Bot. São Paulo,
1(3): 199 (1926).
leCToType: P. paulensis Hoehne & Schltr. designated
by Garay, Orquideologia, 9: 117 (1974).
pholidota Lindl. ex Hook., Exot. Fl., 2: t. 138 (1825).
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
88
LANKESTERIANA
Type speCies: P. imbricata Hook. selected by M.A.
Clements, Austral. Orchid. Res., 1: 105 (1989). This
selection was not needed as Hooker originally had just
one species.)
phragmipedium (Pitzer) Rolfe, Orchid Rev., 4: 331
(1896).
Type speCies: P. caudatum (Lindl.) Rolfe (Cypripedium
caudatum Lindl.) selected by Sprague & Summerhayes,
Kew Bulletin, 309 (1927).
phymatidium Lindl., Gen. Sp. Orchid. Pl., 209 (1833).
leCToType: P. delicatum Lindl. designated by Angely,
Fl. Analitica São Paulo, 6: 1328 (1973) and Toscano,
Lindleyana, 16(3): 209 (2001).
physoceras Schltr., Repert. Spec. Nov. Regni Veg.
Beih., 33: 78 (1924).
leCToType: P. bellum Schltr. designated by
Summerhayes, Index Nom. Gen. (Pl.), 3: 1335 (1979)
card #64/24066 and J. & C. Hermans et al., Orchids
Madagascar, 249 (2007).
physosiphon Lindl., Edwards’s Bot. Reg., 21: sub
1797 (1835).
Type speCies: P. loddigesii Lindl., nom. illeg.
Type speCies: P. tubatus (Loddiges) Rchb.f. (Stelis
tubata Loddiges) selected by Pfeiffer, Nomencl. Bot.
(Pfeiffer), 2(1): 705 (1873).
leCToType: Pseudostelis spiralis (Lindl.) Schltr.
(Physosiphon spiralis Lindl.) designated by Garay,
Orquideologia, 9: 118 (1974).
physurus Rich. ex Lindl., Gen. Sp. Orchid. Pl., 501
(1840).
Type speCies: P. plantagineus (L.) Lindl. (Satyrium
plantagineum L.) selected by Britton & Millspaugh,
Bahama Fl., 87 (1920).
pilophyllum Schltr., Orchideen (Schlechter), ed. 1,
131 (1914).
leCToType: P. villosum (Blume) Schltr. (Chrysoglossum
villosum Blume) designated by van der Burgh & de
Vogel, Orchid Monog., 8: 172 (1997).
pilumna Lindl., Edwards’s Bot. Reg., 30(Misc.): 73
(1844).
Type speCies: P. laxa Lindl. selected by M.W. Chase,
Gen. Orch., 5: 380 (2009).
piperia Rydb., Bull. Torrey Bot. Club, 28: 269, 632 (1901).
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
Type speCies: P. elegans (Lindl.) Rydb. (Platanthera
elegans Lindl.) selected by Britton & Brown, Ill. Fl. N.
U.S., ed. 2, 1: 555 (1913).
pityphyllum Schltr., Repert. Spec. Nov. Regni Veg.
Beih., 7: 162 (1920).
leCToType: P. antioquiense Schltr. designated by H.R.
Sweet, Orquideologia, 7: 205 (1973).
platanthera Rich., De Orchid. Eur., 20, 26, 35 (1817).
leCToType: P. bifolia (L.) Rich. (Orchis bifolia L.)
designated by H. Baumann et al., Mitt. Bl. Arbeitskr.
Heim. Orch. Baden-Württ., 21(3):539 (1989).
platyclinis Benth., J. Linn. Soc., Bot., 18: 295 (1881).
leCToType: P. abbreviata (Blume) Benth. ex Hemsl.
(Dendrochilum abbreviatum Blume) designated by
H.A. Pedersen, J.J. Wood & J.B. Comber, Opera Bot.,
130: 29 (1997).
pleione D. Don, Prodr. Fl. Nepal., 36 (1825).
leCToType: P. praecox (J.E. Sm.) D. Don (Epidendrum
praecox J.E. Sm.) designated by Zhu and S. Chen,
Novon, 8: 461 (1998).
pleuranthium Benth., J. Linn. Soc., Bot., 18: 312
(1881).
Type speCies: P. dendrobii (Rchb.f.) Benth.
(Epidendrum dendrobii Rchb.f.) selected by Pitzer,
Nat. Planzenfam., 2(6): 145 (1889).
pogonia Juss., Gen. Pl. (Jussieu), 65 (1789).
Type speCies: P. ophioglossoides (L.) Ker-Gawler
(Arethusa ophioglossoides L.) selected by Britton &
Brown, Ill. Fl. N. U.S., ed. 2, 1: 559 (1913).
polycyncis Rchb.f., Bonplandia, 3(15-16): 218 (1855).
Type speCies: P. muscifera (Lindl. & Paxton) Rchb.f.
(Cycnoches musciferum Lindl. & Paxton) selected by
G. Gerlach, Gen. Orchid., 5: 434 (2009).
ponera Lindl., Gen. Sp. Orchid. Pl., 113 (1831).
Type speCies: P. juncifolia Lindl. designated by Lindley.
Type speCies: P. graminifolia (Knowles & Westc.)
Lindl. (Nemaconia graminifolia Knowles & Westc.)
invalidly selected by Pfeiffer, Nomencl. Bot. (Pfeiffer),
2(2): 812 (1874).
prasophyllum R.Br., Prodr. Fl. Nov. Holland., 317
(1810).
Type speCies: P. australe R.Br. selected by M.A.
alriCh & higgins — Orchid genera typiication
Clements, Austral. Orchid. Res., 1: 109 (1989).
pristiglottis Cretz. & J.J.Sm., Acta Fauna Fl.
Universali, ser. 2, 1: 4 (1934).
Type speCies: P. unilora (Blume) Cretz. & J.J.Sm.
(Cystopus unilorus Blume) selected by Weatherby,
Bull. Misc. Inform., 1935: 421 (1935).
promenaea Lindl., Edwards’s Bot. Reg., 29(Misc): 13
(1843).
leCToType: P. lentiginosa (Lindl.) Lindl. (Maxillaria
lentiginosa Lindl.) designated by Butzin, Taxon, 32(4):
632 (1983).
pseuderiopsis Rchb.f., Linnaea, 22: 852 (1850).
leCToType: P. schomburgkii Rchb.f. designated by
Romero, Harvard Pap. Bot., 10(2): 245 (2005).
pseudoeurystyles Hoehne, Arq. Bot. Ext. S. Paulo, 1:
129 (1943).
leCToType: P. lorenzii (Cogn.) Hoehne (Stenoptera
lorenzii Cogn.) designated by Angely, Fl. Analitica São
Paulo, 6: 1273 (1973).
pseudogoodyera Schltr., Beih. Bot. Centralbl., 37(2):
369 (1920).
leCToType: P. wrightii (Rchb.f.) Schltr. (Goodyera
wrightii Rchb.f.) designated by Swart, Index
Nom. Gen. (Pl.), 3 : 1434 (1979) card #10/23843;
Rutkowski et al., Phylogeny & Taxonomy Subtribes
Spiranthinæ, 144 (2008); and Burns-Balogh, Amer. J.
Bot., 69(7): 1131 (1982).
pseudorchis Ség., Pl. Veron., 3: 254 (1754).
leCToType: P. albidus (L.) Á. Löve & D. Löve
(Satyrium albidum L.) designated by H. Baumann et
al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ.,
21(3): 544 (1989).
pseudostelis Schltr., Anexos Mem. Inst. Butantan, 1:
36 (1922).
Type speCies: P. spiralis (Lindl.) Schltr. (Physosiphon
spiralis Lindl.) selected by Garay, Orquideologia, 9:
118 (1974).
leCToType: Stelis deregularis Barb.Rodr., designated
superlously Luer, Monogr. Syst. Bot. Missouri Bot.
Gard., 20: 36 (1986).
pteroglossa Schltr., Beih. Bot. Centralbl., 37(2): 450
(1920).
leCToType: P. macrantha (Rchb.f.) Schltr. (Spiranthes
89
macrantha Rchb.f.) designated by Angely, Fl. Analitica
São Paulo, 6: 1277 (1973), Rutkowski et al., Phylogeny
& Taxonomy Subtribes Spiranthinæ, 168 (2008) and
Burns-Balogh, Amer. J. Bot., 69: 1132 (1982).
pterostylis R.Br., Prodr. Fl. Nov. Holland., 326 (1810).
Type speCies: P. obtusa R.Br. selected by Pfeiffer,
Nomencl. Bot. (Pfeiffer), 2(2): 875 (1874).
leCToType: P. curta R.Br. designated by Greuter et al.,
Regnum Veg., 118: 183 (1988).
pterygodium Sw., Kongl. Vetensk. Acad. Nya Handl.,
ser. 2, 21: 217, t. 3e (1800).
Type speCies: P. alatum (Thunberg) Sw. (Ophrys
alata Thunberg) selected by Pfeiffer, Nomencl. Bot.
(Pfeiffer), 2(2): 876 (1874).
Type speCies: P. catholicum (Thunberg) Sw. (Ophrys
alata Thunberg) selected by E.P. Phillips, Gen. S. Afr.
Fl. Pl., ed. 2, 237 (1951).
leCToType: P. catholicum (Thunberg) Sw. designated
by K.E. Steiner, Taxon, 48: 48 (1999).
rhipidoglossum Schltr., Beih. Bot. Centralbl., 36(2):
80 (1918).
leCToType: R. xanthopollinium (Rchb.f.) Schltr.
(Aeranthus xanthopollinius Rchb.f.) designated by
Summerhayes, Blumea, Suppl., 1: 80 (1937).
rhynchopera Klotzsch, Icon. Pl. Rar. (Link), 2: 103,
t. 41 (1844).
Type speCies: R. pedunculata Klotzsch designated by
Klotzsch.
Type speCies: R. punctata H. Karsten not validly
selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(2):
962 (1874).
rhynchophreatia Schltr., Bot. Jahrb. Syst., 56: 488
(1921)
leCToType:
Rhynchophreatia
wariana
Schltr.
designated by Fosberg & Sachet, Micronesica, 20: 151
(1987).
rhynchostylis Blume, Bijdr. Fl. Ned. Ind., 7: 285, t.
49 (1825)
leCToType: R. retusa (L.) Blume (Epidendrum retusum
L.) designated by Christenson, Kew Bulletin, 41(4):
836 (1986).
robiquetia Gaudichaud-Beaupré, Freycinet’s Voy.
Uranie, Bot., 426, t. 34 (1826)[1829]
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
90
LANKESTERIANA
leCToType: R. brevifolia (Lindl.) Garay (Saccolabium
brevifolium Lindl.) designated by Christenson, Kew
Bulletin, 41(4): 835 (1986).
rodriguezia Ruiz & Pavón, Fl. Peruv. Prodr., 115, t.
25 (1794).
leCToType: R. lanceolata Ruiz & Pavón designated by
Garay & H.R. Sweet, J. Arnold Arbor., 53: 527 (1972).
rodrigueziopsis Schltr., Repert. Spec. Nov. Regni
Veg., 16: 427. (1920).
leCToType: R. eleutherosepala (Barb.Rodr.) Schltr.
(Rodriguezia eleutherosepala Barb.Rodr.) designated
by Angely, Fl. Analitica São Paulo, 6: 1322 (1973) and
Garay & H.R. Sweet, J. Arnold Arbor., 53: 527 (1972).
Type speCies: Rodrigueziopsis microphyton (Barb.
Rodr.) Schltr. (Rodriguezia microphyta Barb.Rodr.)
selected by M.W. Chase, Gen. Orchid., 5: 271 (2009).
roeperocharis Rchb.f., Otia Bot. Hamburg., 104
(1881).
leCToType: R. bennettiana Rchb.f. designated by P.J.
Cribb, Gen. Orch., 2: 359 (2001).
roezliella Schltr., Repert. Spec. Nov. Regni Veg., 15:
146 (1918)
Type speCies: R. dilatata (Rchb.f.) Schltr. (Sigmatostalix
dilatata Rchb.f.) selected by M.W. Chase, Gen.
Orchid., 5: 308 (2009).
saccolabium Blume, Bijdr., 292, t. 50 (1825).
leCToType: S. pusillum Blume designated
Christenson, Kew Bull., 41(4): 835 (1986).
by
sanderella Kuntze, Revis. Gen. Pl., 2: 649 (1891).
Type speCies: S. discolor (Barb.Rodr.) Cogn.
(Parlatorea discolor Barb.Rodr.) selected by
Cogniaux, Fl. Bras., 3(6): 239 (1905).
sarcopodium Lindl. & Paxton, Paxton’s Fl. Gard., 1:
155 (1850).
Type speCies: S. lobbii (Lindl.) Lindl. & Paxton
(Bulbophyllum lobbii Lindl.) selected by Pfeiffer,
Nomencl. Bot. (Pfeiffer), 2(2): 1051 (1874).
Type speCies: S. amplum (Lindl.) Lindl. (Dendrobium
amplum Lindl.) invalidly selected by Kraenzlin,
Planzenr. IV. 50. II(B) 21 (Heft 45): 319 (1910).
satyrium L., Sp. Pl. (Linnaeus), ed. 1, 2: 944 (1753).
leCToType: S. viride L. designated by M.L. Green,
Prop. Brit. Bot., 185 (1929).
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
sauroglossum Lindl., Edwards’s Bot. Reg., 19: t. 1618
(1833).
leCToType: S. elatum Lindl. designated by Rutkowski et
al., Phylogeny & Taxonomy Subtribes Spiranthinæ,
144 (2008).
scaphosepalum Pitzer, Nat. Planzenfam., 2(6): 139
(1888).
leCToType: S.
ochthodes
(Rchb.f.)
Pitzer
(Masdevallia ochthodes Rchb.f.) designated by Garay,
Orquideologia, 9: 124 (1974).
scaphyglottis Poepp. & Endl., Nov. Gen. Sp. Pl., 1: 58
(1836).
Type speCies: S. parvilora Poepp. & Endl. invalidly
selected by Pfeiffer, Nomencl. Bot. (Pfeiffer), 2(2):
1068 (1874). The accepted name for S. parvilora is
Camaridium vestitum (Sw.) Lindl.
leCToType: S. graminifolia (Ruiz & Pavón) Poepp.
& Endl. (Fernandezia graminifolia Ruiz & Pavón)
designated by Dressler, Taxon, 9: 214 (1960) and
Garay & H.R. Sweet, J. Arnold. Arbor., 53: 528 (1972).
schiedeella Schltr., Beih. Bot. Centralbl., 37(2): 379
(1920).
leCToType: S. saltensis (Ames) Schltr. (Spiranthes
saltensis Ames) designated by Burns-Balogh, Amer. J.
Bot., 69(7): 1131 (1982).
Type speCies: S. transversalis (A.Rich. & Galeotti)
Schltr. (Spiranthes transversalis A.Rich. & Galeotti)
selected by Garay, Bot. Mus. Leal., 28(4): 357 (1982).
leCToType: S. llaveana (Lindl.) Schltr. (Spiranthes
llaveana Lindl.) designated by Rutkowski et al.,
Phylogeny & Taxonomy Subtribes Spiranthinæ, 173
(2008).
schoenorchis Blume, Bijdr. Fl. Ned. Ind., 8: 361
(1825).
Type speCies: S. juncifolia Blume selected by Garay,
Bot. Mus. Leal., 23(4): 202 (1972).
leCToType: Schoenorchis gemmata (Lindl.) J.J.Sm.
(Saccolabium gemmatum Lindl.) designated by
Christenson, Kew Bulletin, 41(4): 836 (1986).
leCToType: S. juncifolia Blume designated by
Averyanov, Bot. Zhurn. (Moscow & Leningrad),
76(6): 894 (1991).
selenipedium Rchb.f., Xenia Orch., 1: 3, t. 2 (1854).
Type speCies: S. chica Rchb.f. selected by Sprague &
alriCh & higgins — Orchid genera typiication
Summerhayes, Bull. Misc. Inform., 308 (1927).
sepalosaccus Schltr., Repert. Spec. Nov. Regni Veg.
Beih., 19: 245 (1923).
leCToType: S. humilis Schltr. designated by K.
Barringer, Fieldiana, Bot., 17: 18 (1986).
serapias L., Sp. Pl. (Linnaeus), ed. 1, 2: 949 (1753).
Type speCies: S. lingua L. selected by Sw., Kongl.
Vetensk. Acad. Nya Handl., 21: 224 (1800).
leCToType: S. lingua L. designated by H. Baumann
et al., Mitt. Bl. Arbeitskr. Heim. Orch. Baden-Württ.,
21(3): 558 (1989).
smithsonia C.J.Saldanha, J. Bombay Nat. Hist. Soc.,
71(1): 73 (1974).
leCToType: S. viridilora (Dalzell) C.J. Saldanha
(Micropera viridilora Dalzell) designated by
Christenson, Kew Bulletin, 41(4): 836 (1986).
Sobennikofia Schltr., Repert. Spec. Nov. Regni Veg.
Beih., 33: 361 (1925).
leCToType: S. robusta (Schltr.) Schltr. (Oeonia robusta
Schltr.) designated by Butzin, Taxon, 32(4): 632 (1983).
sobralia Ruiz & Pavón, Fl. Peruv. Prodr. 120, t. 26
(1794).
leCToType: S. dichotoma Ruiz & Pavón designated by
Angely, Fl. Analítica São Paulo, 6: 1268 (1973).
specklinia Lindl., Gen. Sp. Orchid. Pl., 8 (1830).
leCToType: S. lanceola (Sw.) Lindl. (Epidendrum
lanceola Sw.) designated by Garay & H.R. Sweet, J.
Arnold Arbor., 53: 528 (1972).
spiranthes Rich., De Orchid. Eur., 20, 28 & 36 (1817).
leCToType: S. spiralis (L.) Chevallier (Ophrys spiralis
L.) designated by M.L. Green, Prop. Brit. Bot., 100
(1929) and H. Baumann et al., Mitt. Bl. Arbeitskr.
Heim. Orch. Baden-Württ., 21(3): 562 (1989).
Type speCies: S. aestivalis (Poiret) Rich. (Ophrys
aestivalis Poiret) invalidly selected by Correll, Fl.
Texas, 3(3): 169 (1944).
stauropsis
Rchb.f.,
Hamburger
GartenBlumenzeitung, 16: 117 (1860).
Type speCies: S. philippinensis (Lindl.) Rchb.f.
(Trichoglottis philippinensis Lindl.) selected by
Reichenbach f., Ann. Bot. Syst., 6: 882, 932 (1864).
stelis Sw., J. Bot. (Schrader), 2: 239 (1799).
91
leCToType: S.
ophioglossoides
(Jacq.)
Sw.
(Epidendrum ophioglossoides Jacq.) designated by
M.L. Green, Prop. Brit. Bot., 100 (1929) and Pridgeon,
Gen. Orch., 4: 405 (2005).
leCToType: S. purpurea (Ruiz & Pav.) Willd.
(Humboldtia purpurea Ruiz & Pavón) designated by
Garay & H.R. Sweet, J. Arnold Arbor., 53: 528 (1972).
stenorrhynchos Rich. ex Spreng., Syst. Veg.
(Sprengel), ed. 16, 3: 677 (1826).
Type speCies: S. speciosum (Jacq.) Spreng. (Neottia
speciosa Jacq.) selected by Britton & Millspaugh,
Bahama Fl., 86 (1920).
leCToType: S. speciosum (Jacq.) Spreng. designated by
Burns-Balogh, Amer. J. Bot., 69(7): 1131 (1982).
leCToType: S. orchioides (Sw.) Rich. (Satyrium
orchioides Sw.) invalidly designated by M.N. Corrêa,
Darwiniana, 11: 70 (1955).
stichorkis Thouars, Nouv. Bull. Soc. Philom., 19: 318
(1809).
leCToType: S. disticha (Thouars) Pitzer (Malaxis
disticha Thouars) designated by Rasmussen, Bot. Not.,
132: 390 (1979).
sullivania F.Muell., J. Proc. Roy. Soc. New South
Wales, 15: 229 (1882).
Type speCies: Caleya sullivanii F.Muell. selected by
D.L. Jones & M.A. Clements, Orchadian, 15(1): 36
(2005).
synassa Lindl., Bot. Reg., 19: sub 1618 (1833).
leCToType: S. corymbosa Lindl. designated by
Rutkowski et al., Phylogeny & Taxonomy Subtribes
Spiranthinæ, 145 (2008).
synoplectris Raf., Fl. Tellur., 2: 87 (1837).
leCToType: S. grandilora (Hook.) Klotzsch (Neottia
grandilora Hook.) designated by Garay, Bot. Mus.
Leal., 28: 352 (1982).
systeloglossum Schltr., Repert. Spec. Nov. Regni Veg.
Beih., 19: 252 (1923).
leCToType: S. costaricense Schltr. designated by
Barringer, Fieldiana, Bot., 17: 21 (1986).
Taeniophyllum Blume, Bijdr. Fl. Ned. Ind., 8: 355, t.
70 (1825).
leCToType: T. obtusum Blume designated by Garay,
Bot. Mus. Leal., 23(4): 205 (1972) and Averyanov,
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
92
LANKESTERIANA
Bot. Zhurn. (Moscow & Leningrad), 76(6): 892
(1991).
Telipogon Kunth, Nov. Gen. Sp., 1: 335, t. 75 (1815).
Type speCies: T. nervosus (L.) Druce (Tradescantia
nervosa L.) selected by M.W. Chase, Gen. Orch., 5:
362 (2009).
Tetragamestus Rchb.f., Bonplandia, 2: 21 (1854).
Type speCies: Scaphyglottis arundinacea Regel
invalidly selected by Pfeiffer, Nomencl. Bot. (Pfeiffer),
2(2): 1373 (1874).
Type speCies: T. aureus Rchb.f. indirectly selected by
Reichenbach f., Linnaea, 41: 85 (1876).
Thelasis Blume, Bijdr. Fl. Ned. Ind., 8: 385, t. 75
(1825).
Type speCies: T. carinata Blume selected by M.A.
Clements, Austral. Orchid. Res., 1: 137 (1989).
leCToType: T. obtusa Blume designated by Averyanov,
Bot. Zhurn. (Moscow & Leningrad), 76(1): 124 (1991).
Type speCies: T. obtusa Blume selected by J.J. Wood,
Gen. Orch., 4: 593 (2005).
Thelychiton Endl., Prodr. Fl. Norfolk., 32 (1833).
Type speCies: T. macropus Endl. selected by M.A.
Clements, Austral. Orchid Res., 1: 56 (1989).
Tomotris Raf., Fl. Tellur., 2: 89 (1837).
leCToType: T. lava (Sw.) Rchb.f. (Serapias lava
Sw.) designated by Rasmussen, Bot. Tidssk., 71: 168
(1977).
Trachelosiphon Schltr., Beih. Bot. Centralbl., 37(2):
423 (1920).
leCToType: Eurystyles actinosophylla (Barb.Rodr.)
Schltr. (Spiranthes actinosophila Barb.Rodr.)
designated by Acuña, Cat. Descr. Orquid. Cuba., 60:
43 (1938).
leCToType: T. ananassocomos Rchb.f. designated by
Burns-Balogh, Amer. J. Bot., 69(7): 1131 (1982).
Trachyrhizum (Schltr.) Brieger, Schlechter Orchideen
(ed. 3), 1(11-12): 687 (1981).
Type speCies: T. schlechteri (Schltr.) Rauschert
(Dendrobium trachyrhizum Schltr.) selected by
Rauschert, Feddes Repert., 94(7-8): 469 (1983).
Type speCies: Dendrobium chalmersii F.Muell.
invalidaly selected by M.A. Clements, Telopea., 10(1):
280 (2003).
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
Traunsteinera Rchb., Fl. Saxon., 87 (1842), and Deut.
Bot. Herb.-Buch, 50 (1841).
leCToType: T. globosa (L.) Rchb. (Orchis globosa L.)
designated by H. Baumann et al., Mitt. Bl. Arbeitskr.
Heim. Orch. Baden-Württ., 21(3): 564 (1989).
Trichoceros Kunth, Nov. Gen. Sp., 1: 337, t. 76 (1815).
Type speCies: T. antennifer (Humb. & Bonpl.) Kunth
(Epidendrum antenniferum Humb. & Bonpl.) selected
by M.W. Chase, Gen. Orch., 5: 378 (2009).
Trichoglottis Blume, Bijdr. Fl. Ned. Ind., 8: 359, t. 8
(1825).
Type speCies: T. retusa Blume selected by Garay, Bot.
Mus. Leal., 23(4): 208 (1972).
leCToType: T. miserum (Ridl.) Holttum (Saccolabium
miserum Ridl.) designated by Christenson, Kew
Bulletin, 41(4): 836 (1986).
Trichotosia Blume, Bijdr. Fl. Ned. Ind., 7: 342 (1825).
leCToType: T. paucilora Blume designated by
Averyanov, Bot. Zhurn. (Moscow & Leningrad),
76(1): 126 (1991).
Type speCies: T. paucilora Blume selected by P.J.
Cribb, Gen. Orch., 4: 583 (2005).
Tridactyle Schltr., Orchideen (Schlechter), ed. 1, 602
(1914).
leCToType: T. bicaudata (Lindl.) Schltr. (Angraecum
bicaudatum Lindl.) designated by Summerhayes, Kew
Bull., 282 (1948).
Trigonanthe (Schltr.) Brieger, Schlechter’s Orchideen,
ed. 3, 7: 448 (1975).
Type speCies: Masdevallia simula Rchb.f. selected by
Luer, Monogr. Syst. Bot. Missouri Bot. Gard. 15: 26
(1986).
Triphora Nuttall, Gen. N. Amer., Pl., 192 (1818).
Type speCies: T. pendula Nuttall, nom. illeg. (Arethusa
pendula Willd., nom. illeg). This type name is now
considered a synonym of T. trianthophora (Sw.) Rydb.
(Arethusa trianthophoros Sw.) selected by Pfeiffer,
Nomencl. Bot. (Pfeiffer), 2(2): 1484 (1874).
Triphorhiza Ehrhart, Beitr. Naturk. (Ehrhart), 4: 149
(1789).
Type speCies: Satyrium albidum L. selected by Pfeiffer,
Nomencl. Bot. (Pfeiffer), 2(2): 1486 (1874).
alriCh & higgins — Orchid genera typiication
Tylostigma Schltr., Beih. Bot. Centralbl., 4: 298 (1916).
leCToType: T. madagascariensis Schltr. designated by
P.J. Cribb, Gen. Orch., 2: 379 (2001).
Uncifera Lindl., J. Proc. Linn. Soc., Bot., 3: 39 (1859)
leCToType: U. obtusifolia Lindl. designated by
Christenson, Kew Bulletin, 41(4): 837 (1986) and
Averyanov, Bot. Zhurn. (Moscow & Leningrad),
76(6): 893 (1991).
Vanilla Plum. ex Mil., Gard. Dict., abridged ed. 4, 3:
without page number (1754).
Type speCies: V. mexicana Mil. designated by Mansfeld,
Kulturplanze, 2: 587 (1959); Angely, Fl. Analitica São
Paulo, 6: 1267 (1973), and Averyanov, Bot. Zhurn.
(Moscow & Leningrad), 75(12): 1760 (1990).
Type speCies: V. mexicana Mil. selected by Britton &
Wilson, Bahama Fl., 83 (1920).
leCToType: V. planifolia Jacks. designated by Garay &
H.R. Sweet, Fl. Lesser Antilles, 44 (1974).
Vrydagzynea Blume, Coll. Orchid., 71, tt. 17 (1858).
leCToType: V. albida (Blume) Blume (Hetaeria
albida Blume) designated by Averyanov, Bot. Zhurn.
(Moscow & Leningrad), 75(7): 1023 (1990).
Warczewiczella Rchb.f., Bot. Zeitung (Berlin), 10: 635
(1852).
Type speCies: W. discolor (Lindl.) Rchb.f. (Warrea
discolor Lindl.) selected by Britton & Wilson, Sci.
Surv. Porto Rico, 5(2): 214 (1924).
Zeuxine Lindl., Coll. Bot. (Lindl.), App. [n. 18] (1826).
Type speCies: Z. stratematica (L.) Schltr. (Orchis
stratematica L.) designated by P.J. Cribb, Taxon, 48:
49 (1999).
Zygosepalum Rchb.f., Ned. Kruidk. Arch., 4: 330
(1859).
Type speCies: Z. kegelii (Rchb.f.) Rchb.f. (Zygopetalum
kegelii Rchb.f.) selected by Pupulin, Gen. Orch., 5:
544 (2009).
Zygostates Lindl., Edwards’s Bot. Reg., 23: 1927 (1837)
leCToType: Z. lunata Lindl. designated by Angely, Fl.
Analítica São Paulo, 6: 1328 (1973).
leCToType: Z. cornuta Lindl. designated by Toscano,
Lindleyana, 16(3): 193 (2001).
1
These lists are only current as of March 1 2010.
93
Commentary. When using various sources for basic
lectotype research we have come across some listings
that state the name as being lectotypiied, but upon
further investigation of the original cited literature ind
the statement to be untrue. All the taxonomic citations
in this paper have been veriied with original literature.
There are many names currently listed in Index
Nominum Genericorum (ING) as being lectotypiied.
Many of the names are correctly listed, but there are
also many names that are not true lectotypes but just
various authors listing a name as a type species for
a given genus (selected). There are others listed as
having lectotypes but upon reading the literature cited
ind that the authors provided no types or lectotype
names1.
Genus names listed in ING that are just listings
of type species for a genus and have NOT been
lectotypiied:
Aa, Amphigena, Ancistrorhynchus, Anochilus,
Arethusa,
Blephariglotis,
Bletia,
Brownleea,
Centrostigma,
Cephalanthera,
Ceratandropsis,
Chrysoglossum,
Cladobium,
Cleisostoma,
Comparettia, Corysanthes, Crepidium, Cyrtopera,
Cyrtosia, Cystorchis, Dryadorchis, Epiblastus,
Evota, Gennaria, Gymnadeniopsis, Habenaria,
Kefersteinia, Limnorchis, Malaxis, Oeceoclades,
Orthopenthea, Palmorchis, Penthea, Physosiphon,
Physurus, Piperia, Pleione, Pogonia, Pterygodium,
Satyrium, Schoenorchis, Stauropsis, Stenorrhynchos,
Trichoglottis, Triphora.
These names are listed in ING as lectotypiied,
which at the time they were not, but have since been
lectotypiied by various authors in other literature:
Ania, Barbosella, Coelogyne, Cypripedium,
Cyrtochilum, Disperis, Goodyera, Ophrys, Orchis,
Pecteilis, Schiedeella.
These are names listed in ING as lectotypiied, but
they are NOT:
Capanemia,
Diaphananthe.
Chelonanthera,
Dendrochilum,
The names that Alrich previously published
(Selbyana 29(2) 2008) as published by Pfeiffer, are
just that a list of type names for various genera and are
NOT true lectotypes.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
94
LANKESTERIANA
aCknoWleDgeMenTs. We thank Eileen Downing of the Lee
County (Florida) Public Library System for assistance in
obtaining copies of original literature. We also acknowledge
Google Books, Botanicus Digital Library, Biodiversity
Heritage Library, Kew Library, Gallica Bibliothèque and
Real Jardín Botánico Digital Library as sources for the
botanical literature researched and cited.
liTeraTure CiTeD
Farr, E. R. & G. Zijlstra (eds.). Index Nominum Genericorum
(Plantarum). 1996+. Published on the Internet; http://
botany.si.edu/ing/ (accessed 1 March 2010).
Govaerts, R., J. Pfahl (Florida, 2006), M.A. Campacci
(Brazil, 2005), D. Holland Baptista (Brazil, 2005),
H. Tigges (Germany, 2005), J.Shaw (RHS, 2005), P.
LANKESTERIANA 11(1), April 2011. © Universidad de Costa Rica, 2011.
Cribb (K, 2003), A. George (K, 2003), K. Kreuz (2004,
Europe), J. Wood (K, 2003, Europe). 2010. World
Checklist of Orchidaceae. The Board of Trustees of the
Royal Botanic Gardens, Kew. Published on the Internet;
http://www.kew.org/wcsp/ (accessed 1 March 2010).
McNeill, J., F. R. Barrie, H. M. Burdet, V. Demoulin, D. L.
Hawksworth, K. Marhold, D. H. Nicolson, J. Prado, P.
C. Silva, J. E. Skog, J. H. Wiersema & N. J. Turland.
2006. International Code of Botanical Nomenclature
(Vienna Code). Regnum Vegetabile 146. A.R.G.
Gantner Verlag KG.
The International Plant Names Index., 2008. Published on
the Internet; http://www.ipni.org (accessed 1 March
2010).
Tropicos, botanical information system at the Missouri
Botanical Garden. Published on the Internet; http://
www.tropicos.org (accessed 1 March 2010).