Monograph
On
The Genus Fusarium
By
Mohamed Refai1
Atef Hassan2 and Mai Hamed1
1. Department of Microbiology, Faculty of Veterinary Medicine, Cairo
University, Giza, Egypt
2. Department of Mycology and Mycotoxins, Animal Health Research
Institute, Agriculture Research Center, Dokki, Giza
2015
1
Preface
This Monograph is dedicated to the eminent pathologist Prof. Abdul-Rahman Khater,
who was the first to direct my attention in 1966 that the nervous manifestations of
donkeys were most probably caused by intoxication, rather than virus infection as
propagated at that time. It is also dedicated to Prof. Nabil Hassan, the first
veterinarian who studied Fusarium during his PhD mission in Moscow in the late sixty
and who gave an excellent talk on fusraiotoxicosis at the International mycotoxicosis
conference held in Nairobi, 1978, where I was working as FAO Consultant.
Prof. Khater
Prof. Nabil in Nairobi
Mai Hamed
This and other monographs I have uploaded before are intended to be sources for
information for the students without any restriction, particularly for those in the
developing countries, who are not able to buy expensive books or subscribe in
journals or pay to read an article, because of shortage of the hard currency.
When I started planning this monograph on the genus Fusarium, I have not imagined
that I will find such enormous amounts of data on a single organism, so that I feel
now after ending the monograph that I have actually written a synopsis as a guide to
the postgraduate students to have an idea about the past history of the genus
Fusarium, which was mainly concerned with its discovery and nomenclature , and the
recent history of the main discoveries, which are concerned mainly with the molecular
characteristics of the organism. The data provided by the assistant lecturer Mai
Hamed obliged me to involve her for the first time as a co-author in one of my
manuals
Prof. Dr. Mohamed Refai, Cairo 22.6.2015
2
Contents
1. Introduction 4
2. History and nomenclature of the Genus Fusarium 8
3. Fusarium nomenclature 36
4. Classification of the genusFusarium 44
4.1. Historical 44
4.2.Wollenbecher and Reinking classification of Fusarium genus (1935) 45
4.3. Snyder and Hansen classification, 1940 50
4.4. A. Raillo classification, 1950 50
4.5. W. Gerlach & H.I. Nierenberg classification, 1982 51
4.6. C. Booth classification, 1971. 55
4.7. John F. Leslie, Brett A. Summerell. The Fusarium Laboratory Manual, 2006 59
4.8. Toxigenic Fusarium species 62
5. Distribution and diversity of Fusarium species 65
6. Fusarium morphology 80
6.1.Macromorphology 80
6.2. Microscopic morphology 81
7. Fusarium genomics 85
7.1. The Fusarium Comparative Project 85
7.2.Publications on Fusarium genome sequences 91
7.3. Synopsis of Fusarium genomics results 96
7.4. Fusarium genomics databases 101
8. Fusarium diseases in plants, man and animals 111
8.1. Fusarium diseases in plants 111
8.2. Fusarium infections in human 115
8.3. Fusarium infections and fusariotoxicosis in birds 124
8.4. Fusariotoxicosis in animals 126
9. Isolation and identification of Fusarium species 127
9.1. Media used 127
9.2. Identification of Fusarium species 130
9.2.1. Morphological identification 130
9.2.2. Molecular Methods for Identification of Fusarium 131
10. Description of Fusarium species 138
11. Fusarium books 237
12. Research projects 243
13. References 265
1. Introduction
3
The Fusarium was always in the back mind of the author since the mid
sixties, when several donkeys died in the Sharkia Govornorate at that time
with nervous manifestations as the main symptoms. The pathologists
diagnosed the cases as encephalomalacia and the virologists failed to isolate a
virus. The author had the chance to visit the places, where the donkeys died
and noticed that donkeys were eating the corn stumps, which were covered
with pink fungal growth, which was identified as Fusarium species.
Regrettably, the author had no facilities at that time to continue studying the
problem and resorted to education of the farmers to prevent their animals from
consuming such mouldy stumbs through lectures and announcement in the
daily news paper Al-Ahram. The farmers responded positively, so that in a
short time the problem was solved.
Al Ahram, 1966
Why madness affects donkeys?
Even donkeys are affected by madness! The donkey goes around himself and falls,
then becomes severely irritated, loses his vision and then fainted, and most often dies.
Its madness disease of donkeys, where research labs ten years ago tried to detect its
viral cause, as it was believed. Finally it was discovered by Dr. Abdul Rahman
Khater, specialist in pathology of neurological diseases and Dr. Mohamed Kamal
Refai, teacher in the College of Veterinary Medicine, Cairo University, that the cause
of the disease is related to consumption of corn contaminated with a fungus that
secretes toxins that affects the brain.
4
Ministry of Agriculture
Department of Veterinary Medicine
Call for
Farmers and holders of animals
The Department of Veterinary
Medicine in the Ministry of
Agriculture has been informed
recently about the death of a number
of animals, particularly donkeys and
camels with the manifestations of
neurological symptoms that end often
with their death as a result of feeding
on mouldy and damaged maize
Therefore calls upon all owners of
such animals not to provide such
damaged maize to their animals so as
not expose them to the disease so as
to preserve their animals
We hope in such cases to notify the
nearest veterinarian to do
immediately the necessary first aid
Veterinary extension
The authors had the chance to consider Fusarium in the studies
done later on feeds, which are mentioned above. The evaluation of 160
samples of feed (80 of each of yellow corn and mixed feed) at different
seasons of the year for fungal contamination indicated that the
Fusarium species were isolated only during winter in tested samples
(5, 15%) of yellow corn and mixed feeds respectively.47
Moreover, two studies were done on Fusarium. The first study
was concerned with the incidence of Fusarium in equine feeds. In this
study 100 equine feeds ( 48 barley, 16 pelleted feeds,14 Soya bean,
12 yellow corn and 10 hay samples) were collected from different farms
and clubs and subjected to mycological examination for isolation and
identification of Fusarium species. All samples examined were
contaminated with moulds.
The highest total Fusarium count/g was obtained from the Soya
bean samples, however, the Fusarium colony counts constituted the
5
highest percentage of total fungal count in barley, which reached to
71.43% in one sample, 50.0% in one samples, 10-18% in 6 samples
and 5.55% in one sample. In Soya bean, the highest contribution of
Fusarium in total fungal count was 33.33% in one sample and 18.75%
in another sample, while the rest of the samples the contribution varied
from 1.52-3.57%. The lowest Fusarium count was observed in corn
and hay where it varied from 0.88-11.90% and 2% respectively of the
total fungal count only. The incidence of Fusarium was the highest in
samples of yellow corn 58.33%, followed by soya, in which the
incidence of Fusarium was 42.85%; in barley it was 18.75% and in hay
it was 10%. Samples of pelleted feeds were all negative for Fusarium.
44 isolates of Fusarium were recovered from equine feeds. The
isolates were identified into 9 Fusarium species. The most common
Fusarium species was F. verticillioides (21 isolates), followed by F.
anthophilum (9 isolates), F. proliferatum and F. solani (4each), F.
dimerum (2 isolates) and one isolate of each of F. nygamai, F.
oxysporum, F. poae and F. sporotrichoides. Only one isolate was
recovered from hay, which was identified as F. verticillioides.35
The results of the second study were published in the year
2001, where 14 Fusarium species were isolated feedstuffs and
identified .
Prevalence of Fusarium species in feedstuffs
6
7
2. History and nomenclature of the Genus Fusarium
1809: Link
Fusarium roseum Link (1809),
1825: Link
Fusarium ciliatum Link (1825);
Fusarium ciliatum var. ciliatum Link (1825),
Fusarium stilbaster (Link) Link (1825)
Fusarium roseum f. roseum Link (1832),
Fusarium roseum var. roseum Link (1832),
Heinrich F. Link, Christian G. D. Nees von Esenbeck A.C.J. Corda
1816-1818: Nees
Fusarium lateritium Nees (1816),
Fusarium lateritium f. lateritium Nees (1816),
Fusarium lateritium subsp. lateritium Nees (1816),
Fusarium lateritium var. lateritium Nees (1816
Fusarium heterosporum Nees (1817),
Fusarium heterosporum f. heterosporum Nees & T. Nees (1818),
Fusarium heterosporum var. heterosporum Nees & T. Nees
(1818),
1823-1824: Schlechtendahl
Fusarium tremelloides Grev. (1823),
Fusarium oxysporum Schltdl. (1824);
Fusarium oxysporum f. oxysporum Schltdl. (1824),
Fusarium oxysporum subsp. oxysporum Schltdl. (1824),
Fusarium oxysporum var. oxysporum Schltdl. (1824
Fusarium sulphureum Schltdl. (1824);
Fusarium expansum Schltdl. (1824);
8
1828-1842:Corda
Fusarium flocciferum Corda (1828);
Fusarium flocciferum f. flocciferum Corda (1828),
Fusarium aurantiacum Corda (1829),
Fusarium roseum f. roseum Link (1832),
Fusarium roseum var. roseum Link (1832),
Fusarium strobilinum Corda (1837),
Fusarium merismoides Corda (1838),
Fusarium merismoides f. merismoides Corda (1838)
Fusarium merismoides var. merismoides Corda (1838)
Fusarium cinctum Corda (1842),
1832-1849:Frees
Fusarium fructigenum Fr. (1832);
Fusarium fructigenum var. fructigenum Fr. (1832),
Fusarium herbarum (Corda) Fr. (1849),
Fusarium herbarum var. herbarum (Corda) Fr. (1849),
Elias M.Fries
Samuel H. Schwabe
Jean Pierre F. Montagne
1839: Schwabe
Fusarium graminearum Schwabe (1839),
Fusarium graminearum var. graminearum Schwabe (1839)
1843: Montagne
Fusarium reticulatum Mont. (1843);
Fusarium reticulatum f. reticulatum Mont. (1843),
Fusarium reticulatum var. reticulatum Mont. (1843),
Fusarium platani Mont. (1849),
1843-1869: Wellman, Bérenger, Rabenh., Roberge, Westend. Lacroix, Kalchbr.
Fusarium retusum Wellman (1943)
Fusarium maculans Bérenger (1844),
Fusarium oxysporum var. aurantiacum (Corda) Rabenh.
9
(1844),
Fusarium subtectum Roberge ex Desm. (1846),
Fusarium peltigerae Westend. (1849);
Fusarium amentorum Lacroix (1854)
Fusarium pteridis Kalchbr. (1861)
1870: Fuckel
Fusarium sambucinum Fuckel (1863)
Fusarium nervisequum Fuckel (1870)
Fusarium nervisequum f. nervisequum Fuckel (1870)
Fusarium nervisequum f. platani (Lév.) Fuckel (1870)
Fusarium larvarum Fuckel (1870)
Fusarium larvarum var. larvarum Fuckel (1870)
Fusarium sambucinum f. sambucinum Fuckel (1870)
Fusarium sambucinum var. sambucinum Fuckel (1870)
Fusarium sphaeriae Fuckel (1870)
Fusarium sphaeriae var. sphaeriae Fuckel (1870)
Fusarium violaceum Fuckel (1870)
1875: Berk. & Broome & Ravenel (1875)
Fusarium heteronemum Berk. & Broome (1865)
Fusarium semitectum Berk. & Ravenel (1875)
Fusarium semitectum f. semitectum Berk. & Ravenel (1875)
Fusarium semitectum var. semitectum Berk. & Ravenel (1875)
Fusarium cucumerinum Berk. & Broome (1876),
Pier Andrea Saccardo
1877-1955: Saccardo
Fusarium miniatum Sacc. (1877),
Fusarium pyrochroum (Desm.) Sacc. (1879),
10
Fusarium pyrochroum var. pyrochroum (Desm.) Sacc. (1879)
Fusarium album Sacc. (1880)
Fusarium album f. album Sacc. (1880)
Fusarium album var. album Sacc. (1880)
Fusarium album f. piceae-vulgaris Sacc. (1880)
Fusarium betae (Desm.) Sacc. (1880),
Fusarium roseum var. buxi Sacc. (1881),
Fusarium roseum var. calystegiae Sacc. (1881),
Fusarium roseum var. cucubali-bacciferi Sacc. (1881),
Fusarium roseum var. dulcamarae Sacc. (1881),
Fusarium roseum var. filicis Sacc. (1881),
Fusarium roseum var. helianti Sacc. (1881)
Fusarium roseum var. lupini-albi Sacc. (1881),
Fusarium roseum var. maydis Sacc. (1881),
Fusarium roseum var. phytolaccae Sacc. (1881),
Fusarium roseum var. rosae Sacc. (1881),
Fusarium roseum var. rusci Sacc. (1881)
Fusarium roseum var. vitalbae Sacc. (1881)
Fusarium lycopersici Sacc. (1881),
Fusarium obtusiusculum Sacc. (1881),
Fusarium solani (Mart.) Sacc. (1881),
Fusarium solani f. solani (Mart.) Sacc. (1881),
Fusarium solani var. solani (Mart.) Sacc. (1881),
Fusarium roseum var. helianti Sacc. (1881)
Fusarium roseum var. lupini-albi Sacc. (1881),
Fusarium roseum var. maydis Sacc. (1881),
Fusarium roseum var. phytolaccae Sacc. (1881),
Fusarium roseum var. rosae Sacc. (1881),
Fusarium roseum var. rusci Sacc. (1881)
Fusarium roseum var. vitalbae Sacc. (1881)
Fusarium lycopersici Sacc. (1881),
Fusarium obtusiusculum Sacc. (1881),
Fusarium solani (Mart.) Sacc. (1881),
Fusarium solani f. solani (Mart.) Sacc. (1881),
Fusarium solani var. solani (Mart.) Sacc. (1881),
Fusarium lateritium f. mori (Desm.) Sacc. (1884),
Fusarium oxysporum subsp. lycopersici Sacc. (1886),
Fusarium oxysporum var. lycopersici Sacc. (1886),
Fusarium pallidoroseum var. pallidoroseum (Cooke) Sacc. (1886),
Fusarium rimosum (Peck) Sacc. (1886),
Fusarium roseolum (Stephens) Sacc. (1886),
Fusarium argillaceum (Fr.) Sacc. (1886)
Fusarium avenaceum (Fr.) Sacc. (1886)
11
Fusarium avenaceum f. avenaceum (Fr.) Sacc. (1886),
Fusarium avenaceum subsp. avenaceum (Fr.) Sacc. (1886),
Fusarium avenaceum var. avenaceum (Fr.) Sacc. (1886),
Fusarium bacilligerum (Berk. & Broome) Sacc. (1886),
Fusarium berenice (Berk. & M.A. Curtis) Sacc. (1886),
Fusarium detonianum Sacc. (1886);
Fusarium candidum (Link) Sacc. (1886),
Fusarium cerealis (Cooke) Sacc. (1886),
Fusarium chilense (Mont.) Sacc. (1886),
Fusarium episphaericum (Cooke & Ellis) Sacc. (1886),
Fusarium equiseti (Corda) Sacc. (1886),
Fusarium equiseti f. equiseti (Corda) Sacc. (1886),
Fusarium equiseti subsp. equiseti (Corda) Sacc. (1886),
Fusarium equiseti var. equiseti (Corda) Sacc. (1886),
Fusarium fuckelii Sacc. (1886),
Fusarium incarnatum (Desm.) Sacc. (1886);
Fusarium lagenariae (Schwein.) Sacc. (1886),
Fusarium tricinctum (Corda) Sacc. (1886),
Fusarium tricinctum f. tricinctum (Corda) Sacc. (1886),
Fusarium tricinctum var. tricinctum (Corda) Sacc. (1886)
Fusarium urticearum (Corda) Sacc. (1886)
Fusarium obtusum (Cooke) Sacc. (1886),
Fusarium ossicola (Berk. & M.A. Curtis) Sacc. (1886),
Fusarium pallidoroseum (Cooke) Sacc. (1886)
Fusarium minutissimum (Desm.) Sacc. (1886)
Fusarium succisae (J. Schröt.) Sacc., Sylloge Fungorum (1892)
Fusarium culmorum (Wm.G. Sm.) Sacc. (1895);
Fusarium culmorum f. culmorum (Wm.G. Sm.) Sacc. (1892),
Fusarium culmorum var. culmorum (Wm.G. Sm.) Sacc. (1892)
Fusarium lolii (Wm.G. Sm.) Sacc. (1895),
Fusarium longissimum Sacc. & P. Syd. (1899)
Fusarium orthosporum Sacc. (1902),
Fusarium spicariae-colorantis Sacc. & Trotter ex De Jonge (1909),
Fusarium micropus Sacc. (1921),
Fusarium moniliforme var. oryzae Sacc. (1951)
Fusarium heterosporum f. aleuritis Saccas & Drouillon (1951),
Fusarium equiseti var. intermedium Saccas (1955),
12
Mordecai Cubitt Cooke
1878: Cooke & W.R. Gerard, Thüm. & Pass
Fusarium glandicola Cooke & W.R. Gerard (1878),
Fusarium tortuosum Thüm. & Pass. (1878),
1879: Pirotta & Riboni
Fusarium lactis Pirotta (1879);
1881: Cooke & Harkn
Fusarium eucalypti Cooke & Harkn. (1881),
Fusarium eucalypti Cooke & Harkn. (1881),
1882: Penzig and Ruan, Y.M. Jiang, W. Luo & J.H. Wan
Fusarium dimerum Penzig., Michelia 2 (8): 484 (1882)
Fusarium dimerum Penz. (1882),
Fusarium dimerum var. dimerum Penz. (1882)
Fusarium roseum var. dracaenae Roum. (1882),
Fusarium avenaceum f. fabalis X.Y. Ruan, Y.M. Jiang, W. Luo & J.H. Wang
(1982),
Fusarium avenaceum f. fabarum X.Y. Ruan, Y.M. Jiang, W. Luo & J.H.
Wang (1982),
1883: J. Schröt., Cooke & Harkn.
Fusarium deformans J. Schröt. (1883),
Fusarium obtusisporum Cooke & Harkn. (1884),
1886-1895: Berl. & Voglino and Ellis & Everh
Fusarium nivale Ces. ex Berl. & Voglino (1886),
Fusarium nivale f. nivale Ces. ex Berl. & Voglino (1886),
Fusarium nivale var. nivale Ces. ex Berl. & Voglino (1886),
13
Fusarium caeruleum Lib. ex Sacc. (1886);
Fusarium caeruleum var. caeruleum Lib. ex Sacc. (1886)
Fusarium heterosporum f. paspali Ellis & Everh. (1886),
Fusarium barbatum Ellis & Everh. (1888),
Fusarium acuminatum Ellis & Everh. (1895)
Fusarium acuminatum subsp. acuminatum Ellis & Everh.
Fusarium blasticola Rostr. (1895),
(1895)
1887-1890: Cooke & Massee, Briard, Oudem.,
Fusarium bulbigenum Cooke & Massee (1887)
Fusarium bulbigenum f. bulbigenum Cooke & Massee (1887),
Fusarium bulbigenum var. bulbigenum Cooke & Massee (1887)
Fusarium hypocreoideum Cooke & Massee (1888),
Fusarium bugnicourtii Brayford (1987)
Fusarium elongatum Cooke (1890);
Fusarium asparagi Briard (1890)
Fusarium caricis Oudem. (1890),
1891: Lagerh. & Rabenh, Erikss., Allesch.,
Fusarium aquaeductuum (Radlk. & Rabenh.) Lagerh. & Rabenh. (1891),
Fusarium aquaeductuum subsp. aquaeductuum (Radlk. & Rabenh.) Lagerh.
& Rabenh. (1891)
Fusarium aquaeductuum var. aquaeductuum (Radlk. & Rabenh.) Lagerh. &
Rabenh. (1891)
Fusarium tritici Erikss. (1891)
Fusarium robiniae Pass. (1891),
1892: G.F. Atk, Pass., J. Schröt.
Fusarium persicae (Sacc.) G.F. Atk. (1892)
Fusarium vasinfectum var. vasinfectum G.F. Atk. (1892),
Fusarium vasinfectum G.F. Atk. (1892)
Fusarium vasinfectum f. vasinfectum G.F. Atk. (1892)
Fusarium cerasi Rolland & Ferry (1892),
Fusarium mali Allesch. (1892),
Fusarium succisae J. Schröt. (1892);
1893: Pound & Clem, Syd., E.F. Sm
Fusarium rhizogenum Pound & Clem. (1893),
Fusarium pyrochroum var. diatrypellicola Syd. (1893),
1894: Lambotte & Fautrey
Fusarium scirpi Lambotte & Fautrey (1894),
Fusarium scirpi f. scirpi Lambotte & Fautrey (1894)
14
Fusarium scirpi subsp. scirpi Lambotte & Fautrey (1894),
Fusarium scirpi var. scirpi Lambotte & Fautrey (1894)
Fusarium niveum E.F. Sm. (1894),
1895- 1908: Henn
Fusarium camerunense Henn. (1895),
Fusarium speiranthis Henn. (1896)
Fusarium sarcochroum f. polygalae-myrtifoliae Henn. (1898)
Fusarium paspalicola Henn. (1899),
Paul Christoph Hennings
Fusarium stromaticola Henn. (1900);
Fusarium vogelii Henn. (1902);
Fusarium eucalypticola Henn. (1901);
Fusarium euonymi-japonici Henn. (1902);
Fusarium derridis Henn. (1902)
Fusarium coccidicola Henn. (1904),
Fusarium juruanum Henn. (1904);
Fusarium paspali Henn. (1905);
Fusarium pentaclethrae Henn. (1905);
Fusarium sorghi Henn. (1907);
Fusarium coniosporiicola Henn. (1907),
Fusarium coniosporiicola Henn. (1907)
Fusarium coniosporiicola Henn. (1907),
Fusarium phyllachorae Henn. (1907);
Fusarium lucumae Henn. (1908)
1997-1900: Allesch., Brunaud., Speg., Prill. & Delacr, E.F. Sm., Syd. & P. Syd.,
Mussat
Fusarium roseum var. lonicerae Allesch. (1897),
15
Fusarium roseum f. visci Brunaud (1898 )
Fusarium sapindophilum Speg. (1898),
Fusarium dianthi Prill. & Delacr. (1899),
Fusarium tracheiphilum E.F. Sm. (1899),
Fusarium euonymi Syd. & P. Syd. (1900);
Fusarium atrovirens (Berk.) Mussat (1900),
1901-1903: Bolley, Sorauer, Oudem., J.V. Almeida & Sousa da Câmara, Bres., C.
Massal., C.J.J. Hall
Fusarium lini Bolley (1901),
Fusarium nivale (Fr.) Sorauer (1901),
Fusarium nicotianae Oudem. (1902),
Fusarium dimorphum J.V. Almeida & Sousa da Câmara (1903);
Fusarium eichleri Bres. (1903);
Fusarium lichenicola C. Massal. (1903),
Fusarium vasinfectum var. pisi C.J.J. Hall (1903),
1904-1910: J. Sheld, Schikora, Koord., M.L. Lutz,Brick, Lindau, Peck, E.F. Sm,
E.J. Butler
Fusarium moniliforme J. Sheld. (1904),
Fusarium moniliforme f. moniliforme J. Sheld. (1904)
Fusarium moniliforme subsp. moniliforme J. Sheld. (1904),
Fusarium moniliforme var. moniliforme J. Sheld. (1904)
Fusarium vasinfectum var. pisi Schikora (1906),
Fusarium veratri (Allesch.) Höhn. (1906),
Fusarium javanicum Koord. (1907),
Fusarium theobromae M.L. Lutz (1907),
Fusarium decemcellulare Brick (1908),
Fusarium didymum (Harting) Lindau (1909),
Fusarium hibernans Lindau (1909);
Fusarium willkommii Lindau (1909),
Fusarium bartholomaei Peck (1909),
Fusarium juglandinum Peck (1909);
Fusarium cubense E.F. Sm. (1910),
Fusarium cubense var. cubense E.F. Sm. (1910),
Fusarium udum E.J. Butler (1910),
1910: Appel & Wollenweber
Fusarium discolor Appel & Wollenw. (1910
Fusarium discolor var. sulphureum (Schltdl.) Appel & Wollenw. (1910
Fusarium elegans Appel & Wollenw. (1910)
Fusarium falcatum Appel & Wollenw. (1910),
Fusarium falcatum var. falcatum Appel & Wollenw. (1910),
16
Fusarium gibbosum Appel & Wollenw. (1910),
Fusarium gibbosum var. gibbosum Appel & Wollenw. (1910),
Fusarium martii Appel & Wollenw. (1910),
Fusarium martii f. martii Appel & Wollenw. (1910),
Fusarium martii var. martii Appel & Wollenw. (1910),
Fusarium metachroum Appel & Wollenw. (1910);
Fusarium orthoceras Appel & Wollenw. (1910),
Fusarium orthoceras var. orthoceras Appel & Wollenw. (1910),
Fusarium rostratum Appel & Wollenw. (1910);
Fusarium rubiginosum Appel & Wollenw. (1910);
Fusarium sarcochroum f. mali (Allesch.) Ferraris (1910)
Fusarium subulatum Appel & Wollenw. (1910)
Fusarium ventricosum Appel & Wollenw. (1913
1912: Jacz., Bruschi, Dasz., Kabát & Bubák
Fusarium trifolii Jacz. (1912),
Fusarium lycopersici Bruschi (1912),
Fusarium albidoviolaceum Dasz. (1912)
Fusarium fraxini Kabát & Bubák (1912),
Dr.H. W. Wollenweber
1912-1935: Wollenweber
Fusarium trichothecioides Wollenw. (1912)
Fusarium conglutinans Wollenw. (1913),
Fusarium conglutinans f. conglutinans Wollenw. (1913),
Fusarium conglutinans var. conglutinans Wollenw. (1913),
Fusarium lycopersici (Sacc.) Wollenw. (1913),
Fusarium poae (Peck) Wollenw. (1914);
17
Fusarium poae f. poae (Peck) Wollenw. (1913),
Fusarium redolens var. redolens Wollenw. (1913)
Fusarium redolens Wollenw. (1913)
Fusarium redolens f. redolens Wollenw. (1913
Fusarium udum (Berk.) Wollenw. (1913),
Fusarium udum var. pusillum Wollenw. (1913)
Fusarium udum var. udum (Berk.) Wollenw. (1913),
Fusarium vasinfectum var. inodoratum Wollenw. (1913),
Fusarium orthoceras var. triseptatum Wollenw. (1914
Fusarium batatas Wollenw. (1914),
Fusarium batatas var. batatas Wollenw. (1914),
Fusarium caudatum Wollenw. (1914)
Fusarium orthoceras var. albidoviolaceum (Dasz.) Wollenw. (1916),
Fusarium orthoceras var. longius (Sherb.) Wollenw. (1916),
Fusarium zonatum (Sherb.) Wollenw. (1916),
Fusarium zonatum f. zonatum (Sherb.) Wollenw. (1916)
Fusarium zonatum (Sherb.) Wollenw. (1916),
Fusarium zonatum f. zonatum (Sherb.) Wollenw. (1916),);
Fusarium scirpi var. filiferum (Preuss) Wollenw. (1916),
Fusarium scirpi var. longipes (Wollenw. & Reinking) Wollenw. (1916),
Fusarium zonatum (Sherb.) Wollenw. (1916),
Fusarium zonatum f. zonatum (Sherb.) Wollenw. (1916),);
Fusarium filiferum (Preuss) Wollenw. (1916);;
Fusarium dimerum var. majusculum Wollenw. (1916),
Fusarium asclerotium (Sherb.) Wollenw. (1916),
Fusarium anthophilum (A. Braun) Wollenw. (1916)
Fusarium anthophilum f. anthophilum (A. Braun) Wollenw. (1916),
Fusarium congoense Wollenw. (1916),
Fusarium lateritium var. longum Wollenw. (1916),
Fusarium moniliforme var. anthophilum (A. Braun) Wollenw. (1916),
Fusarium uncinatum Wollenw. (1917),
Fusarium uncinatum Wollenw. (1917),
Fusarium uncinatum Wollenw. (1917),
Fusarium fructigenum var. majus Wollenw. (1917),
Fusarium aquaeductuum var. pusillum Wollenw. (1917),
Fusarium aquaeductuum var. volutum Wollenw. (1917
Fusarium sambucinum var. coeruleum Wollenw. (1917),
Fusarium culmorum var. majus Wollenw. (1924),
Fusarium avenaceum var. pallens Wollenw. (1924),
Fusarium pusillum Wollenw. (1924)
Fusarium stilboides var. stilboides Wollenw. (1924),
Fusarium stilboides Wollenw. (1924)
Fusarium salicis var. minus Wollenw. (1924),
18
Fusarium fructigenum var. minus Wollenw. (1925),
Fusarium oxysporum var. gladioli Massey (1926),
Fusarium orthoconium Wollenw. (1926),
Fusarium dimerum var. pusillum (Wollenw.) Wollenw. (1930),
Fusarium ciliatum var. episphaericum (Cooke & Ellis) Wollenw. (1930),
Fusarium ciliatum var. majus Wollenw. (1930)
Fusarium conglutinans var. majus Wollenw. (1930),
Fusarium cavispermum var. minus Wollenw. (1930),
Fusarium culmorum var. cereale (Cooke) Wollenw. (1930),
Fusarium dimerum var. violaceum Wollenw. (1930
Fusarium equiseti var. bullatum (Sherb.) Wollenw. (1930),
Fusarium equiseti var. crassum Wollenw. (1930),
Fusarium herbarum var. avenaceum (Fr.) Wollenw. (1930),
Fusarium herbarum var. volutum Wollenw. (1930),
Fusarium graminum var. herbarum (Corda) Wollenw. (1930),
Fusarium lateritium var. fructigenum (Fr.) Wollenw. (1930),
Fusarium lateritium var. majus (Wollenw.) Wollenw. (1930),
Fusarium lateritium var. minus (Wollenw.) Wollenw. (1930),
Fusarium lateritium var. tenue Wollenw. (1930),
Fusarium lateritium var. uncinatum (Wollenw.) Wollenw. (1930),
Fusarium herbarum var. graminum (Corda) Wollenw. (1930),
Fusarium herbarum var. detonianum (Sacc.) Wollenw. (1930
Fusarium moniliforme var. minus Wollenw. (1930),
Fusarium sambucinum var. minus Wollenw. (1930),
Fusarium scirpi var. acuminatum (Ellis & Everh.) Wollenw. (1930),
Fusarium scirpi var. caudatum (Wollenw.) Wollenw. (1930),
Fusarium scirpi var. comma Wollenw. (1930),
Fusarium scirpi var. compactum Wollenw. (1930),
Fusarium semitectum var. majus Wollenw. (1930)
Fusarium solani var. aduncisporum (Weimer & Harter) Wollenw. (1930),
Fusarium solani var. martii (Appel & Wollenw.) Wollenw. (1930),
Fusarium solani var. medium Wollenw. (1930),
Fusarium sphaeriae var. majus Wollenw. (1930)
Fusarium sporotrichioides var. minus Wollenw. (1930),
Fusarium vasinfectum var. lutulatum (Sherb.) Wollenw. (1930),
Fusarium vasinfectum var. zonatum (Sherb.) Wollenw. (1930),
Fusarium poae f. pallens Wollenw. (1930),
Fusarium solani var. eumartii (C.W. Carp.) Wollenw. (1931),);
Fusarium reticulatum var. medium Wollenw. (1931),
Fusarium reticulatum var. negundinis (Sherb.) Wollenw. (1931),
Fusarium sambucinum var. medium Wollenw. (1931),
Fusarium sarcochroum var. robiniae (Pass.) Wollenw. (1931),
19
Fusarium scirpi var. copactum Wollenw. (1931),
Fusarium merismoides var. chlamydosporale Wollenw. (1931),
Fusarium merismoides var. crassum Wollenw. (1931),
Fusarium graminearum var. caricis (Oudem.) Wollenw. (1931),
Fusarium heterosporum var. congoense (Wollenw.) Wollenw. (1931
Fusarium heterosporum var. lolii (Wm.G. Sm.) Wollenw. (1931),
Fusarium heterosporum var. paspalicola (Henn.) Wollenw. (1931),
Fusarium javanicum var. radicicola Wollenw. (1931),
Fusarium dimerum var. nectrioides Wollenw. (1931),
Fusarium bulbigenum var. batatas Wollenw. (1931),
Fusarium bulbigenum var. blasticola (Rostr.) Wollenw. (1931),
Fusarium bulbigenum var. niveum (E.F. Sm.) Wollenw. (1931),
Fusarium bulbigenum var. tracheiphilum (E.F. Sm.) Wollenw. (1931),
Fusarium conglutinans var. citrinum Wollenw. (1931),
Fusarium flavum (Fr.) Wollenw. (1931);
Fusarium nivale var. majus Wollenw. (1931),
Fusarium solani var. striatum (Sherb.) Wollenw. (1931)
Fusarium stilboides var. minus (Wollenw.) Wollenw. (1931),
Fusarium solani var. eumartii (C.W. Carp.) Wollenw. (1931),);
Fusarium solani var. striatum (Sherb.) Wollenw. (1931)
Fusarium bactridioides Wollenw. (1934);
Fusarium solani var. minus Wollenw. (1935)
Fusarium oxysporum var. cubense (E.F. Sm.) Wollenw. (1935),
1915-1928 : Sherbakoff
Fusarium anguioides Sherb. (1915)
Fusarium anguioides f. anguioides Sherb. (1915)
Fusarium anguioides var. anguioides Sherb. (1915)
Fusarium anguioides var. caudatum Sherb. (1915)
Fusarium angustum Sherb. (1915)
Fusarium arthrosporioides Sherb. (1915)
Fusarium arthrosporioides var. arthrosporioides Sherb. (1915),
Fusarium arthrosporioides var. asporotrichum Sherb. (1915
Fusarium bullatum Sherb. (1915),
Fusarium culmorum var. leteius Sherb. (1915),
Fusarium cuneiforme Sherb. (1915),
Fusarium diversisporum Sherb. (1915)
Fusarium falcatum var. fuscum Sherb. (1915)
Fusarium oxysporum var. asclerotium Sherb. (1915),
Fusarium oxysporum var. longius Sherb. (1915),
Fusarium oxysporum var. resupinatum Sherb. (1915),
Fusarium lutulatum Sherb. (1915),
Fusarium lutulatum var. zonatum Sherb. (1915),
20
Fusarium martii var. minus Sherb. (1915),
Fusarium martii var. viride Sherb. (1915),
Fusarium redolens var. solani Sherb. (1915),
Fusarium sporotrichioides Sherb. (1915);
Fusarium sporotrichioides subsp. sporotrichioides Sherb. (1915),
Fusarium sporotrichioides var. sporotrichioides Sherb. (1915),
Fusarium striatum Sherb. (1915),
Fusarium udum var. solani Sherb. (1915),
Fusarium redolens var. solani Sherb. (1915),
Fusarium sporotrichioides Sherb. (1915);
Fusarium sporotrichioides subsp. sporotrichioides Sherb. (1915),
Fusarium sporotrichioides var. sporotrichioides Sherb. (1915),
Fusarium striatum Sherb. (1915),
Fusarium udum var. solani Sherb. (1915),
Fusarium solani var. cyanum Sherb. (1915),
Fusarium solani var. subfuscum Sherb. (1915
Fusarium sporotrichioides Sherb. (1915);
Fusarium sporotrichioides subsp. sporotrichioides Sherb. (1915),
Fusarium sporotrichioides var. sporotrichioides Sherb. (1915),
Fusarium striatum Sherb. (1915),
Fusarium udum var. solani Sherb. (1915),
Fusarium negundinis Sherb. (1923)
Fusarium spinaciae Sherb. (1923),
Fusarium tumidum Sherb. (1928),
1915-1924 : C.W. Carp., Gonz. Frag. Lindf., Beach, E.W. Brandes, Davis, J.
Johnson, Cif.m Loubière
Fusarium eumartii C.W. Carp. (1915),
Fusarium roseum var. phaseoli Gonz. Frag. (1916),
Fusarium gymnosporangii Jaap (1916)
Fusarium redolens var. angustius Lindf. (1917),
Fusarium redolens var. angustius Lindf. (1917),
Fusarium conglutinans var. callistephi Beach (1918),
Fusarium cubense var. inodoratum E.W. Brandes (1919),
Fusarium martii f. phaseoli Burkh. (1919),
Fusarium sphaeriae var. robustum Davis (1919),
Fusarium oxysporum var. nicotianae J. Johnson (1921),
Fusarium roseum var. zeae Cif. (1921),
Fusarium sampaioi Gonz. Frag. (1924);
Fusarium sarcochroum var. casei Loubière (1924),
Fusarium oxysporum var. obtusiusculum (Sacc.) Cif. (1924),
21
1925-1935: Wollenweber & Reinking
Fusarium longipes Wollenw. & Reinking, (1925)
Fusarium moniliforme var. majus Wollenw. & Reinking (1925),
Fusarium moniliforme var. minus Wollenw. & Reinking (1925),
Fusarium moniliforme var. subglutinans Wollenw. & Reinking (1925),
Fusarium camptoceras Wollenw. & Reinking (1925);
Fusarium chlamydosporum Wollenw. & Reinking (1925);
Fusarium chlamydosporum var. chlamydosporum Wollenw. & Reinking
(1925),
Fusarium moniliforme var. erumpens Wollenw. & Reinking (1925),
Fusarium neoceras Wollenw. & Reinking (1925);
Fusarium neoceras var. neoceras Wollenw. & Reinking (1925)
Fusarium coccophilum (Desm.) Wollenw. & Reinking (1935),
Fusarium oxysporum var. gladioli Massey (1926),
Fusarium orthoconium Wollenw. (1926),
Fusarium avenaceum var. volutum (Wollenw.) Wollenw. & Reinking (1935),
Fusarium orthoceras var. apii (P.E. Nelson & Sherb.) Wollenw. & Reinking
(1935),
1926-1934: Weimer & Harter, Tucker, Caldis, Curzi, Linford, Jacz., Letov, Beeli,
D. Stewart, . Benn, Fahmy, Kulk.
Fusarium aduncisporum Weimer & Harter (1926)
Fusarium batatas var. vanillae Tucker (1927),
Fusarium moniliforme var. fici Caldis (1927),
Fusarium moronei Curzi (1928);
Fusarium oxysporum var. medicaginis Weimer (1928),
Fusarium orthoceras var. pisi Linford (1928),
Fusarium buharicum Jacz. ex Babajan & Teterevn.-Babajan (1929);
Fusarium caucasicum Letov (1929);
Fusarium album var. abietinum Beeli (1930)
Fusarium conglutinans var. betae D. Stewart (1931),
Fusarium vasinfectum var. sesami Zaprom. (1926),
Fusarium scirpi var. nigrantum F.T. Benn. (1932),
Fusarium scirpi var. pallens F.T. Benn. (1932),
Fusarium vasinfectum var. egyptiacum Fahmy (1927),
Fusarium albedinis (Kill. & Maire) Malençon (1934)
Fusarium vasinfectum var. crotalariae Kulk. (1934),
1934-1936: Reinking , Sartory, R. Sartory, J. Mey. & Bamuli, Kirschst.
Fusarium concolor Reinking (1934);
Fusarium elongatum Reinking (1934)
Fusarium tumidum var. humi Reinking (1934),
Fusarium sublunatum Reinking (1934);
22
Fusarium sublunatum var. sublunatum Reinking (1934),
Fusarium sublunatum var. elongatum Reinking (1935),
Fusarium caeruleum var. cellulosae R. Sartory, J. Mey. & Bamuli (1935)
Fusarium phragmiticola Kirschst. (1936);
937-1939: P.E. Nelson & Sherb, Syd., Bugnic., Hepting,
Fusarium apii P.E. Nelson & Sherb. (1937)
Fusarium apii var. apii P.E. Nelson & Sherb. (1937),
Fusarium apii var. pallidum P.E. Nelson & Sherb. (1937)
Fusarium andinum Syd. (1939)
Fusarium oxysporum var. meniscoideum Bugnic. (1939
Fusarium perniciosum Hepting (1939),
Fusarium tumidum var. coeruleum Bugnic. (1939),
1940-1845: Wollenw., Dearn. & House, Toole, Rodigin, T.F. Yu, L. McCulloch,
Weimer, Padwick..
Fusarium orthoceras var. ricini Wollenw. (1940),
Fusarium orthoceras var. betae Padwick (1940),
Fusarium orthoceras var. callistephi Padwick (1940),
Fusarium orthoceras var. ciceris Padwick (1940),
Fusarium orthoceras var. conglutinans Padwick (1940),
Fusarium ulmicola Dearn. & House (1940)
Fusarium oxysporum f. perniciosum Toole (1941),
Fusarium wolgense Rodigin (1942);
Fusarium citriforme Jamal. (1943),
Fusarium avenaceum var. fabae T.F. Yu (1944),
Fusarium orthoceras var. gladioli L. McCulloch (1944),
Fusarium udum var. cajani Padwick (1940),
Fusarium udum var. crotalariae Padwick (1940),
Fusarium solani f. lupini Weimer (1944)
Fusarium oxysporum f. radicis-lupini Weimer (1944)
Fusarium brachygibbosum Padwick (1945);
W. (Bill) C. Snyder and H. N. Hansen
23
1940-1949: W.C. Snyder & H.N. Hansen
Fusarium oxysporum f. apii (P.E. Nelson & Sherb.) W.C. Snyder & H.N.
Hansen (1940),
Fusarium oxysporum f. batatas (Wollenw.) W.C. Snyder & H.N. Hansen
(1940),
Fusarium oxysporum f. betae (D. Stewart) W.C. Snyder & H.N. Hansen
(1940),
Fusarium oxysporum f. callistephi (Beach) W.C. Snyder & H.N. Hansen
(1940),
Fusarium oxysporum f. cepae (Hanzawa) W.C. Snyder & H.N. Hansen
(1940),
Fusarium oxysporum f. conglutinans (Wollenw.) W.C. Snyder & H.N.
Hansen (1940),
Fusarium oxysporum f. cubense (E.F. Sm.) W.C. Snyder & H.N. Hansen
(1940
Fusarium oxysporum f. gladioli (Massey) W.C. Snyder & H.N. Hansen
(1940)
Fusarium oxysporum f. lini (Bolley) W.C. Snyder & H.N. Hansen (1940),
Fusarium oxysporum f. lupini W.C. Snyder & H.N. Hansen (1940),
Fusarium oxysporum f. lycopersici (Sacc.) W.C. Snyder & H.N. Hansen
(1940),
Fusarium oxysporum f. melonis W.C. Snyder & H.N. Hansen (1940),
Fusarium oxysporum f. medicaginis (Weimer) W.C. Snyder & H.N. Hansen
(1940),
Fusarium oxysporum f. narcissi W.C. Snyder & H.N. Hansen (1940),
Fusarium oxysporum f. dianthi (Prill. & Delacr.) W.C. Snyder & H.N.
Hansen (1940),
Fusarium oxysporum f. pini (Hartig) W.C. Snyder & H.N. Hansen (1940),
Fusarium oxysporum f. pisi (Linford) W.C. Snyder & H.N. Hansen (1940),);
Fusarium oxysporum f. tuberosi W.C. Snyder & H.N. Hansen (1940),
Fusarium oxysporum f. udum (E.J. Butler) W.C. Snyder & H.N. Hansen
(1940),
Fusarium oxysporum f. vasinfectum (G.F. Atk.) W.C. Snyder & H.N. Hansen
(1940),
Fusarium oxysporum f. nicotianae (J. Johnson) W.C. Snyder & H.N. Hansen
(1940),
Fusarium oxysporum f. niveum (E.F. Sm.) W.C. Snyder & H.N. Hansen
(1940),
Fusarium oxysporum f. spinaciae (Sherb.) W.C. Snyder & H.N. Hansen
(1940),
Fusarium oxysporum f. tracheiphilum (E.F. Sm.) W.C. Snyder & H.N.
Hansen (1940)
Fusarium oxysporum f. barbati W.C. Snyder (1941),
24
Fusarium solani f. cucurbitae W.C. Snyder & H.N. Hansen (1941),
Fusarium solani f. eumartii (C.W. Carp.) W.C. Snyder & H.N. Hansen (1941)
Fusarium solani f. phaseoli (Burkh.) W.C. Snyder & H.N. Hansen (1941)
Fusarium solani f. pisi (F.R. Jones) W.C. Snyder & H.N. Hansen (1941)
Fusarium solani f. radicicola (Wollenw.) W.C. Snyder & H.N. Hansen
(1941),
Fusarium oxysporum f. phaseoli J.B. Kendr. & W.C. Snyder (1942),
Fusarium oxysporum f. raphani J.B. Kendr. & W.C. Snyder (1942),
Fusarium episphaeria (Tode) W.C. Snyder & H.N. Hansen (1945)
Fusarium episphaeria f. coccophilum (Desm.) W.C. Snyder & H.N. Hansen
(1945),
Fusarium episphaeria f. episphaeria (Tode) W.C. Snyder & H.N. Hansen
(1945),
Fusarium nivale f. graminicola (Berk. & Broome) W.C. Snyder & H.N.
Hansen (1945),
Fusarium roseum f. cereale (Cooke) W.C. Snyder & H.N. Hansen (1945
Fusarium rigidiusculum W.C. Snyder & H.N. Hansen (1945)
Fusarium tricinctum f. poae (Peck) W.C. Snyder & H.N. Hansen (1945),
Fusarium oxysporum f. rhois W.C. Snyder & Hepting (1949),
1948-1949: Steyaer, V.P. Bhide & Uppal, K.F. Baker, T.F. Yu & C.T. Fang,
Laskaris, Toovey, Hepting
Fusarium xylarioides Steyaert (1948),
Fusarium orthoceras var. lathyri V.P. Bhide & Uppal (1948),
Fusarium oxysporum f. matthioli K.F. Baker (1948),
Fusarium oxysporum f. fabae T.F. Yu & C.T. Fang (1948
Fusarium oxysporum var. lathyri V.P. Bhide & Uppal (1948),
Fusarium oxysporum f. delphinii Laskaris (1949),
Fusarium oxysporum f. gladioli Toovey (1949),
Fusarium lateritium f. pini Hepting (1949),
1950: Raillo. Sawada, Zambett.. (Kill. & Maire) Malençon, Petr.,
Fusarium aquaeductuum subsp. medium (Wollenw.) Raillo (1950)
Fusarium aquaeductuum var. cavispermum (Corda) Raillo (1950)
Fusarium aquaeductuum var. flavum (Fr.) Raillo (1950),
Fusarium aquaeductuum var. dimerum (Penz.) Raillo (1950),
Fusarium avenaceum subsp. volutum (Wollenw.) Raillo (1950),
Fusarium avenaceum var. detonianum (Sacc.) Raillo (1950),
Fusarium avenaceum var. graminum (Corda) Raillo (1950)
Fusarium bulbigenum var. apii (P.E. Nelson & Sherb.) Raillo (1950),
Fusarium bulbigenum var. cucumis Raillo (1950
Fusarium bulbigenum var. pisi (Linford) Raillo (1950),
Fusarium compactum (Wollenw.) Raillo (1950);
25
Fusarium equiseti subsp. ossicola (Berk. & M.A. Curtis) Raillo (1950),
Fusarium heterosporum var. negundinis (Sherb.) Raillo (1950),
Fusarium lateritium subsp. majus (Wollenw.) Raillo (1950),
Fusarium oxysporum var. callistephi Raillo (1950),
Fusarium oxysporum var. cepae (Hanzawa) Raillo (1950),
Fusarium oxysporum var. dianthi (Prill. & Delacr.) Raillo (1950)
Fusarium oxysporum var. pisi (C.J.J. Hall) Raillo (1950),
Fusarium oxysporum var. solani Raillo (1950),
Fusarium oxysporum var. trifolii (Jacz.) Raillo (1950),
Fusarium martii var. caucasicum Raillo (1950),
Fusarium neoceras var. subglutinans (Wollenw. & Reinking) Raillo (1950),
Fusarium moniliforme subsp. majus (Wollenw. & Reinking) Raillo (1950),
Fusarium sambucinum var. cereale (Cooke) Raillo (1950),
Fusarium wollenweberi Raillo (1950);
Fusarium wollenweberi f. wollenweberi Raillo (1950),
Fusarium scirpi subsp. acuminatum (Ellis & Everh.) Raillo (1950),
Fusarium sporotrichioides subsp. minus (Wollenw.) Raillo (1950),
Fusarium sporotrichioides var. tricinctum (Corda) Raillo (1950),
Fusarium laricis Sawada (1950);
Fusarium nivale var. oryzae Zambett. (1950),
Fusarium oxysporum var. albedinis (Kill. & Maire) Malençon (1950),
Fusarium mindoanum Petr. (1950);
1951-1954:T.T. McClure, Pettinari, Prasad, P.R. Mehta & Lal, (Luc) C. Moreau,
W.L. Gordon, Prasad & Patel (1952.
Fusarium solani f. batatas T.T. McClure (1951),
Fusarium oxysporum var. opuntiarum Pettinari (1951),
Fusarium oxysporum f. psidii Prasad, P.R. Mehta & Lal (1952),
Fusarium annulatum Bugnic. (1952)
Fusarium moniliforme f. subglutinans (Luc) C. Moreau (1952),
Fusarium oxysporum var. redolens (Wollenw.) W.L. Gordon (1952)
Fusarium lateritium f. cajani (Padwick) W.L. Gordon (1952),
Fusarium lateritium f. crotalariae (Padwick) W.L. Gordon (1952),
Fusarium oxysporum f. passiflorae W.L. Gordon (1954),
Fusarium solani f. nicotianae Prasad & Patel (1952),
1953- Y. Nisik. & Kyoto Watan, Vasudeva & Sriniv., Bagchee , (Steyaert)
Delassus, Tochetto, (T.F. Yu) W. Yamam., Cif.
Fusarium bulbigenum var. nelumbicola Y. Nisik. & Kyoto Watan. (1953),
Fusarium orthoceras var. lentis Vasudeva & Sriniv. (1953),
Fusarium solani f. albiziae Bagchee (1954)
Fusarium oxysporum f. xylarioides (Steyaert) Delassus (1954),
Fusarium oxysporum var. herbemontis Tochetto (1954)
Fusarium avenaceum f. fabae (T.F. Yu) W. Yamam. (1955),
26
Fusarium dominicanum Cif. (1955)
1953-1987: Bilaĭ
Fusarium sporotrichiella Bilaĭ (1953),
Fusarium sporotrichiella var. poae (Peck) Bilaĭ (1953),
Fusarium sporotrichiella var. sporotrichiella Bilaĭ (1953),
Fusarium sporotrichiella var. sporotrichioides (Sherb.) Bilaĭ (1953),
Fusarium sporotrichiella var. tricinctum (Corda) Bilaĭ (1953),
Fusarium avenaceum var. herbarum (Corda) Bilaĭ (1955),
Fusarium microcera Bilaĭ (1955);
Fusarium microcera var. microcera Bilaĭ (1955),
Fusarium nivale var. larvarum (Fuckel) Bilaĭ (1955),
Fusarium solani var. caeruleum (Lib. ex Sacc.) Bilaĭ (1955),
Fusarium solani var. redolens (Wollenw.) Bilaĭ (1955),
Fusarium tricinctum var. anthophilum (A. Braun) Bilaĭ (1955),
Fusarium sambucinum var. trichothecioides (Wollenw.) Bilaĭ (1955),
Fusarium gibbosum var. bullatum (Sherb.) Bilaĭ (1987),
Fusarium avenaceum var. anguioides (Sherb.) Bilaĭ (1987),
Fusarium moniliforme var. lactis (Pirotta) Bilaĭ (1987),
Fusarium sambucinum var. ossicola (Berk. & M.A. Curtis) Bilaĭ (1987),
Fusarium sambucinum var. sublunatum (Reinking) Bilaĭ (1987),
Fusarium solani var. argillaceum (Fr.) Bilaĭ (1987),
Fusarium sporotrichiella var. poae (Peck) Bilaĭ (1987),
Fusarium sporotrichiella var. tricinctum (Corda) Bilaĭ (1987),
Fusarium oxysporum var. orthoceras (Appel & Wollenw.) Bilaĭ (1987),
Fusarium lateritium var. stilboides (Wollenw.) Bilaĭ (1987),
Fusarium microcera var. orthoconium (Wollenw.) Bilaĭ (1987),
Fusarium microcera var. cerasi (Rolland & Ferry) Bilaĭ (1987),
Fusarium gibbosum var. acuminatum (Ellis & Everh.) Bilaĭ (1987),
Fusarium sporotrichiella var. anthophilum (A. Braun) Bilaĭ (1987),
1954-1958: Gerlach, (Hepting) Carrera , Sauthoff, J.H. Owen, R.D. Raabe. (Ellis
& Everh.) Arx, (Padwick) Erwin, Matus & K. Ishig.
Fusarium oxysporum f. cyclaminis Gerlach (1954),
Fusarium bulbigenum f. aechmeae Sauthoff & Gerlach (1957),
Fusarium vasinfectum var. perniciosum (Hepting) Carrera (1955),
Fusarium oxysporum f. cucumerinum J.H. Owen (1956),
Fusarium oxysporum f. aechmeae Sauthoff (1957),
Fusarium oxysporum f. hebes R.D. Raabe (1957),
Fusarium lunatum (Ellis & Everh.) Arx (1957),
Fusarium lateritium f. ciceris (Padwick) Erwin (1958),
Fusarium oxysporum f. melongenae Matus & K. Ishig. (1958),
27
1959-1962: Sawada, Petr., W.L. Gordon ex B.K. Bakshi & S. Singh ter , (Desm.)
Matuo & K. Satô, (Cooke & Harkn.) Arya & G.L. Jain, W. Yamam.
Fusarium biseptatum Sawada (1959);
Fusarium ramulicola Sawada (1959);
Fusarium solani f. mori Sawada (1959),
Fusarium kurdicum Petr. (1959);
Fusarium solani f. dalbergiae W.L. Gordon ex B.K. Bakshi & S. Singh ter
(1959),
Fusarium splendens Matuo & Takah. Kobay. (1960);
Fusarium solani f. piperis F.C. Albuq. (1961),
Fusarium solani f. xanthoxyli Y. Sakurai & Matuo (1961),
Fusarium lateritium f. mori (Desm.) Matuo & K. Satô (1962),
Fusarium oxysporum f. ciceris Matuo & K. Satô (1962),
Fusarium oxysporum f. eucalypti (Cooke & Harkn.) Arya & G.L. Jain (1962
Fusarium phyllostachydicola W. Yamam. (1962);
1964-1965:Y.N. Ming & T.F. Yu, G.M. Armstr. & J.K. Armstr., N. Barros
Fusarium otomycosis Y.N. Ming & T.F. Yu (1966);
Fusarium oxysporum f. cassiae G.M. Armstr. & J.K. Armstr. (1966),
Fusarium roseum f. phaseoli N. Barros (1966),
Fusarium solani f. keratitis Y.N. Ming & T.F. Yu (1966),
Fusarium solani f. viridiflavum Y.N. Ming & T.F. Yu (1964),
Fusarium solani f. robiniae Matuo & Y. Sakurai (1965),
1968-1969: Messiaen & R. Cass, Batikyan & Abramyan
Fusarium roseum var. arthrosporioides (Sherb.) Messiaen & R. Cass. (1968),
Fusarium roseum var. gibbosum (Appel & Wollenw.) Messiaen & R. Cass.
(1968),
Fusarium semitectum var. violaceum Batikyan & Abramyan (1969),
Fusarium buxicola var. chlamydosporum Batikyan (1969),
Fusarium lateritium var. microconidium Batikyan & Abramyan (1969),
Fusarium martiellae-discolorioides Batikyan (1969);
1971: C. Booth, (E.J. Butler) W. Gams, (Padwick) Subram.
Fusarium epistroma (Höhn.) C. Booth (1971),
Fusarium fusarioides (Gonz. Frag. & Cif.) C. Booth (1971
Fusarium illudens C. Booth (1971)
Fusarium stoveri C. Booth (1971),
Fusarium lateritium var. buxi C. Booth (1971),
Fusarium solani var. caeruleum (Lib. ex Sacc.) C. Booth (1971),
Fusarium redolens f. spinaciae (Sherb.) Subram. (1971)
Fusarium solani f. hibisci Ribeiro et al. (1971),
28
Fusarium sacchari (E.J. Butler) W. Gams, Cephalosporium-artige
Schimmelpilze: 218 (1971)
Fusarium merismoides f. ciceris (Padwick) Subram. (1971),
1973-1976: Joffe, P.K.S. Gupta, Tubaki, C. Booth & T. Harada
Fusarium equiseti var. compactum (Wollenw.) Joffe (1973),
Fusarium solani var. ventricosum (Appel & Wollenw.) Joffe (1973),
Fusarium equiseti var. caudatum (Wollenw.) Joffe (1974),
Fusarium equiseti var. longipes (Wollenw. & Reinking) Joffe (1974),
Fusarium sporotrichioides var. chlamydosporum (Wollenw. & Reinking)
Joffe (1974),
Fusarium psidii P.K.S. Gupta (1974);
Fusarium enterolobii P.K.S. Gupta (1974);
Fusarium merismoides var. acetilereum Tubaki, C. Booth & T. Harada
(1976),
Fusarium merismoides var. ecetilereum Tubaki, C. Booth & T. Harada
(1976)
1976-1977: Nirenberg, T. Aoki & Samuels, Gerlach
Fusarium fijikuroi Nirenberg (1976);
Fusarium proliferatum (Matsush.) Nirenberg (1976);
Fusarium proliferatum var. minus Nirenberg (1976),
Fusarium sacchari var. elongatum Nirenberg (1976),
Fusarium sacchari var. subglutinans (Wollenw. & Reinking) Nirenberg
(1976),
Fusarium verticillioides (Sacc.) Nirenberg (1976),
Fusarium proliferatum (Matsush.) Nirenberg ex Gerlach & Nirenberg (1982);
Fusarium proliferatum var. proliferatum (Matsush.) Nirenberg ex Gerlach &
Nirenberg (1982),
Fusarium setosum Nirenberg & Samuels (1989);
Fusarium setosum Nirenberg & Samuels (1989);
Fusarium torulosum (Berk. & M.A. Curtis) Nirenberg (1995);
Fusarium venenatum Nirenberg (1995);
Fusarium nisikadoi T. Aoki & Nirenberg (1997);
Fusarium zealandicum Nirenberg & Samuels (2000),
Fusarium robustum Gerlach (1977);
Fusarium larvarum var. rubrum Gerlach (1977),
Fusarium lunulosporum Gerlach (1977)
Fusarium merismoides var. violaceum Gerlach (1977),
Fusarium chlamydosporum var. fuscum Gerlach (1977)
29
Wally F. O. Marasas
1982-1983: L.W. Burgess, P.E. Nelson & Toussoun, Marasas
Fusarium crookwellense L.W. Burgess, P.E. Nelson & Toussoun (1982);
Fusarium subglutinans (Wollenw. & Reinking) P.E. Nelson, Toussoun &
Marasas (1983),
Fusarium subglutinans var. subglutinans (Wollenw. & Reinking) P.E. Nelson,
Toussoun & Marasas (1983),
1983-1984: Subrahm, Rossman, Samuels & Rogerson
Fusarium lacertarum Subrahm. (1983);
Fusarium tasmanicum (McAlpine) Rossman (1983); ,
Fusarium staphyleae Samuels & Rogerson (1984),
1986-1987: L.W. Burgess & Trimboli, Marasas, P.E. Nelson, Toussoun & P.S.
van Wyk
Fusarium nygamai L.W. Burgess & Trimboli (1986),
Fusarium polyphialidicum Marasas, P.E. Nelson, Toussoun & P.S. van Wyk
(1986);
Fusarium dlaminii Marasas, P.E. Nelson & Toussoun (1986)
Fusarium beomiforme P.E. Nelson, Toussoun & L.W.
Burgess, Mycologia 79: 884-889 (1987)
1987-1991: Chen
Fusarium solani var. petroliphilum Q.T. Chen & X.H. Fu (1987),
Fusarium sphaerosporum Q.T. Chen & X.H. Fu (1987);
Fusarium merismoides var. artocarpi X.H. Fu & Q.T. Chen (1989),
Fusarium merismoides var. persicicola X.H. Fu & Q.T. Chen (1989),
Fusarium moniliforme var. annulatum (Bugnic.) F.J. Chen (1991),
Fusarium subglutinans var. succisae (J. Schröt.) F.J. Chen (1991),
30
1988-1989: Tivoli, P.E. Nelson & Rabie, R.F. Castañeda, P. Oliva, Fresneda & N.
Rodr.,
Fusarium roseum f. compactum Tivoli (1988),
Fusarium napiforme Marasas, P.E. Nelson & Rabie (1988);
Fusarium pallidoroseum var. majus (Wollenw.) R.F. Castañeda, P. Oliva,
Fresneda & N. Rodr. (1989)
Fusarium setosum Nirenberg & Samuels (1989);
1990-1993:Agnihothr. & Nirenberg, A. Pande & V.G. Rao , Gruyter & J.H.M.
Schneid,
Fusarium ambrosium (Gadd & Loos) Agnihothr. & Nirenberg (1990)
Fusarium oxysporum f. tabernaemontanae A. Pande & V.G. Rao (1990
Fusarium cereale (P. Karst.) Gruyter & J.H.M. Schneid. (1991),
Fusarium torulosum (Berk. & M.A. Curtis) Gruyter & J.H.M. Schneid.
(1991);
Fusarium moniliforme var. hangzhouense Gong C. Wang & Q.M. Ye (1992),
1993-1998: G.A. Forbes, Windels & L.W. Burgess, Sangal., Summerell, Marasas
& Logrieco, Klittich, J.F. Leslie, P.E. Nelson
Fusarium acuminatum subsp. armeniacum G.A. Forbes, Windels & L.W.
Burgess (1993)
Fusarium avenaceum subsp. aywerte Sangal. & L.W. Burgess (1995)
Fusarium avenaceum subsp. nurragi Summerell & L.W. Burgess (1995),
Fusarium babinda Summerell, C.A. Rugg & L.W. Burgess (1995);
Fusarium globosum Rheeder, Marasas & P.E. Nelson (1996);
Fusarium thapsinum Klittich, J.F. Leslie, P.E. Nelson &
Marasas
(1997),
Fusarium musarum Logrieco & Marasas (1998);
Fusarium nelsonii Marasas & Logrieco (1998);
Kerry O'Donnell
31
1998: Nirenberg & O'Donnell, T. Aoki,
Fusarium acutatum Nirenberg & O'Donnell (1998)
Fusarium begoniae Nirenberg & O'Donnell (1998)
Fusarium brevicatenulatum Nirenberg & O'Donnell (1998)
Fusarium bulbicola Nirenberg & O'Donnell (1998);
Fusarium circinatum Nirenberg & O'Donnell (1998),
Fusarium concentricum Nirenberg & O'Donnell (1998);
Fusarium denticulatum Nirenberg & O'Donnell (1998);
Fusarium guttiforme Nirenberg & O'Donnell (1998);
Fusarium pseudocircinatum O'Donnell & Nirenberg (1998);
Fusarium pseudonygamai O'Donnell & Nirenberg (1998);
Fusarium pseudoanthophilum Nirenberg, O'Donnell & Mubat. (1998);
Fusarium ramigenum O'Donnell & Nirenberg (1998);
Fusarium kyushuense O'Donnell & T. Aoki (1998);
Fusarium phyllophilum Nirenberg & O'Donnell (1998);
1999-2000: O'Donnell & T. Aoki, W. Gams, Klamer, Benyon, Summerell & L.W.
Burgess,
Fusarium pseudograminearum O'Donnell & T. Aoki (1999),
Fusarium miscanthi W. Gams, Klamer & O'Donnell (1999);
Fusarium aywerte (Sangal. & L.W. Burgess) Benyon & L.W. Burgess (2000)
Fusarium nurragi (Summerell & L.W. Burgess) Benyon, Summerell & L.W.
Burgess (2000);
Fusarium armeniacum (G.A. Forbes, Windels & L.W. Burgess) L.W.
Burgess & Summerell (2000);
2000-2002: Koord.) Q.M. Ye, Geiser & Juba, Palacios-Prü & V. Marcano,
Marasas, Rheeder, Lampr., K.A. Zeller & J.F. Leslie, T. Aoki, O'Donnell & K.
Ichik.
Fusarium solani var. javanicum (Koord.) Q.M. Ye (2000),
Fusarium hostae Geiser & Juba (2001);
Fusarium alkanophilum Palacios-Prü & V. Marcano (2001)
Fusarium andiyazi Marasas, Rheeder, Lampr., K.A. Zeller & J.F. Leslie
(2001)
Fusarium fractiflexum T. Aoki, O'Donnell & K. Ichik. (2001);
Fusarium falciforme (G. Carrión) Summerb. & Schroers (2002
2003: T. Aoki, O'Donnell, K. Ichik, Britz, Marasas, M.J. Wingf., Summerell,
J.F. Leslie, Yosh. Homma, Lattanzi
Fusarium sterilihyphosum Britz, Marasas & M.J. Wingf. (2002);
Fusarium mangiferae Britz, M.J. Wingf. & Marasas (2002);
Fusarium konzum Zeller, Summerell & J.F. Leslie (2003),
32
Fusarium tucumaniae T. Aoki, O'Donnell, Yosh. Homma & Lattanzi
(2003);
Fusarium virguliforme O'Donnell & T. Aoki (2003);
Fusarium phaseoli (Burkh.) T. Aoki & O'Donnell (2003),
B. A. Summerell,
John F. Leslie
H Corby. Kistler
2004:Torp, Nirenberg, L.W. Burgess, Summerell, O'Donnell, T. Aoki, Kistler &
Geiser, Baayen & Hooftman
Fusarium langsethiae Torp & Nirenberg (2004);
Fusarium gaditjirrii Phan, L.W. Burgess & Summerell (2004),
Fusarium acaciae-mearnsii O'Donnell, T. Aoki, Kistler & Geiser (2004)
Fusarium asiaticum O'Donnell, T. Aoki, Kistler & Geiser (2004)
Fusarium austroamericanum T. Aoki, Kistler, Geiser & O'Donnell (2004)
Fusarium boothii O'Donnell, T. Aoki, Kistler & Geiser (2004);
Fusarium brasilicum T. Aoki, Kistler, Geiser & O'Donnell (2004);
Fusarium meridionale T. Aoki, Kistler, Geiser & O'Donnell (2004);
Fusarium mesoamericanum T. Aoki, Kistler, Geiser & O'Donnell (2004);
Fusarium foetens Schroers, O'Donnell, Baayen & Hooftman (2004);
Fusarium matuoi Hosoya & Tubaki (2004),
Fusarium cortaderiae O'Donnell, T. Aoki, Kistler & Geiser
(2004);
H.P. Bachmann
2005-2008: H.P. Bachm., T. Aoki & O'Donnell, Starkey, L.R. Gale, Kistler,
Aberra, Z.H. Zhao & G.Z. Lu
Fusarium brasiliense T. Aoki & O'Donnell (2005);
Fusarium cuneirostrum O'Donnell & T. Aoki (2005);
Fusarium gerlachii T. Aoki, Starkey, L.R. Gale, Kistler & O'Donnell (2007);
33
Fusarium vorosii B. Tóth, Varga, Starkey, O'Donnell, H. Suga & T. Aoki
(2007);
Fusarium aethiopicum O'Donnell, Aberra, Kistler & T. Aoki (2008)
Fusarium delphinoides Schroers, Summerb., O'Donnell & Lampr. (2009),
Fusarium sinensis Z.H. Zhao & G.Z. Lu (2008);
Yli-Mattila Tapani R.C. Ploetz
Gabriel Otero-Colina S. Freeman
2009-2010: Schroers, Summerb. & O'Donnell, T. Aoki, Gagkaeva, Yli-Mattila,
Kistler, , S. Freeman, Otero-Colina, Rodr.-Alv., Fern.-Pav., R.C. Ploetz, A.
Jacobs, Marasas & P.S. van Wyk
Fusarium biseptatum Schroers, Summerb. & O'Donnell (2009),
Fusarium nectrioides (Wollenw.) Schroers, Summerb. & O'Donnell (2009),
Fusarium penzigii Schroers, Summerb. & O'Donnell (2009),
Fusarium ussurianum T. Aoki, Gagkaeva, Yli-Mattila, Kistler & O'Donnell
(2009);
Fusarium mexicanum T. Aoki, S. Freeman, Otero-Colina, Rodr.-Alv., Fern.Pav., R.C. Ploetz &
O'Donnell (2010);
Fusarium ananatum A. Jacobs, Marasas & P.S. van Wyk (2010)
F. Ameena Nalim Antonio Moretti E.C.Y. Liew
2011: Samuels, Nalim & Geiser, Summerell & E.C.Y. Liew, T. Aoki &
O'Donnell, P. Nicholson, Gagkaeva, Burkin, Kononenko, Gavrilova, Yli-Mattila,
Van Hove, Waalwijk, Munaut, Logrieco & Ant. Moretti, Scaufl. & Munaut
Fusarium pseudensiforme Samuels, Nalim & Geiser (2011);
Fusarium rectiphorum Samuels, Nalim & Geiser (2011)
Fusarium kelerajum Samuels, Nalim & Geiser (2011);
34
Fusarium haematococcum Nalim, Samuels & Geiser (2011
Fusarium kurunegalense Samuels, Nalim & Geiser (2011)
Fusarium mahasenii Samuels, Nalim & Geiser (2011);
Fusarium burgessii M.H. Laurence, Summerell & E.C.Y. Liew (2011);
Fusarium crassistipitatum Scandiani, T. Aoki & O'Donnell (2011);
Fusarium louisianense L.R. Gale, Kistler, O'Donnell & T. Aoki (2011);
Fusarium nepalense T. Aoki, Jon Carter, P. Nicholson, Kistler & O'Donnell
(2011);
Fusarium sibiricum Gagkaeva, Burkin, Kononenko, Gavrilova, O'Donnell, T.
Aoki & Yli-Mattila (2011);
Fusarium musae Van Hove, Waalwijk, Munaut, Logrieco & Ant. Moretti
(2011);
Fusarium temperatum Scaufl. & Munaut (2011);
Takayuki Aoki David M. Geise
Ning Zhang
Cristiano S. Lima
2012-2013: T. Aoki, H. Suga, F. Tanaka, Scandiani & O'Donnell, C.S. Lima,
Pfenning & J.F. Leslie, Geiser, Short & Ning Zhang
Fusarium cicatricum (Berk.) O'Donnell & Geiser (2013);
Fusarium azukiicola T. Aoki, H. Suga, F. Tanaka, Scandiani & O'Donnell
(2012);
Fusarium tupiense C.S. Lima, Pfenning & J.F. Leslie (2012);
Fusarium cyanostomum (Sacc. & Flageolet) O'Donnell & Geiser (2013);
Fusarium cicatricum (Berk.) O'Donnell & Geiser (2013);
Fusarium keratoplasticum D. Geiser, O’Donnell, Short & Ning Zhang
(2013);
Fusarium neocosmosporiellum O'Donnell & Geiser (2013)
Fusarium torreyae T. Aoki, J.A. Sm., L. Mount, Geiser & O’Donnell (2013);
Fusarium petroliphilum (Q.T. Chen & X.H. Fu) D. Geiser, O’Donnell, Short
& Ning Zhang (2013),
35
3. Fusarium nomenclature
3.1. The name
The genus Fusarium was first described and named by Link
(1809), based on the classical shape of its fusiform
macroconidia, then it was sanctioned under Fries 1821.
The anamorphs within this clade have consistently been
described as Fusarium, with occasional isolates or species
classified in other genera including Acremonium,
Cylindrocarpon,
Pycnofusarium,Trichofusarium,
Cephalosporium, and others particularly when the macroconidia
are not observed.
A number of lineages basal to the terminal Fusarium clade that
produce Fusarium-like anamorphs were recently moved to new,
revised, or existing genera based on morphological and
phylogenetic considerations, such as Microcera, Macroconia,
Fusicolla, and Stylonectria
With the abandonment of dual nomenclature, a broad consensus
within the global community of Fusarium researchers has
strongly supported the unitary use of the name Fusarium instead
of several teleomorph names linked to it.
3.2. One Fungus, One Name
In a letter to the editor, Geiser et al., 2013, advocated
recognizing the genus Fusarium as the sole name for a
group that includes virtually all Fusarium species
causing infection or mycotoxicosis in plants, man and
animals.
This circumscription will free scientists from any
obligation to use other genus names, including
teleomorphs, for species nested within this clade, and
36
preserve the application of the name Fusarium in the
way it has been used for almost a century.
Due to recent changes in the International Code of
Nomenclature for algae, fungi, and plants, this is an
urgent matter that requires community attention. The
alternative is to break the longstanding concept of
Fusarium into nine or more genera, and remove
important taxa such as those in the F. solani species
complex from the genus, a move they believe is
unnecessary.
3.3. Species concepts and phylogenetic classification:
Morpho-species concept (MSC):
Current classifications schemes are based exclusively on a
morphological species concept (MSC), typically Fusarium
species are defined on the basis of a few distinctive
morphological features:
o curved, transversely septate conidia (“macroconidia”)
produced from sporodochia or pionnotes,
o generally smaller conidia of various shapes and septation
(“microconidia” and/or “mesoconidia”) produced from
unbranched or branched mycelial conidiophores,
producing
conidiogenous
cells
with
one
(monophialidic)
or
more
(polyphialidic)
openings, and
o thick-walled,
generally
globose
thallospores
(chlamydospores) produced in or on hyphae or conidia,
singly or in chains or bunches.
o Sexual spores, when observed, produced in flaskshaped
fruiting bodies (perithecia) that are usually in shades of
red, orange, blue or purple, with little or no stromatal
tissue. Asci produced from distinct hymenia, single37
walled (unitunicate) containing eight ascospores, which
usually possess one or more septa, but can be aseptate.
Biological species concept (BSC):
o The biological species concept defines a species as
members of populations that actually or potentially
interbreed in nature, i.e. they produce sexual spores
(teleomorph).
o The biological species concept is verified by mating
experiments
o The biological species concept has been used to identify
species in the Gibberella fujikuroi F. solani species
complexes, that are known to produce teleomorph spores
o This approach cannot be used for species that do not
produce a teleomorph, such as F. oxysporum.
o Thus, the concept has been developed for only a few
species and mating experiments take about one month to
complete, many strain fail to mate with standard testers,
and negative data are equivocal.
Phylogenetic species concept (PSC) :
These species are defined as the smallest group of populations
for which a unique profile of character states, including
autapomorphies
o An same (autapomorphy) is a derived trait that is
unique to one group,
o A same (synapomorphy) is a derived trait shared by
two or more groups. and synapomorphies, are fixed
within the populations
38
o Such
species
defining
derived
characters
(apomorphies) form the basis of a cladistic analysis
that are extending to all species of Fusarium.
3.4. Clades/Complexes
The genus Fusarium encompasses at least 20 genealogically
exclusive clades, lineages or complexes:
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
F. sambucinum,
F. chlamydosporum,
F. incarnatum-equiseti
F. tricinctum
F. heterosporum
F. fujikuroi
F. nisikadoi
F. oxysporum
F. redolens
F. babinda
F. concolor
F. lateritium
F. buharicum
F. buxicola
F. staphyleae
F. solani
F. decemcellulare
F. albidum
F. dimerum
F. ventricosum species complexes or clades.
Each clade or complex comprises several species, e.g. 5
phylogenetically distinct species were identified within
Fusarium oxysporum and approximately 50 species within
Fusarium solani.
3.5. Formae speciales
39
Pathogenic strains of F. oxysporum cause wilt diseases on a
number of agronomically important crops. Isolates that attack
the same crop are included in the same forma specialis. Most
formae speciales are pathogenic to a single crop e.g.
F. oxysporum f. sp. cubense on banana,
F. oxysporum f. sp. dianthi on carnation,
F. oxysporum f. sp. vasinfectum on cotton.
Some attack more than one crop, e.g. F. oxysporum f. sp.
cucumerinum affects both cucumber and melon.
Within F. oxysporum species, there is a high level of host
specificity with over 120 described formae speciales.
3.6. Races
Most formae speciales of F. oxysporum are comprised of two or
more races, whereas a small proportion are monotypic (e.g. F.
oxysporum f. sp. radicis-lycopersici). Races in F. oxysporum are
defined by their impact on differential host cultivars.
F. oxysporum can be distinguished into physiological
races on the basis of the capacity of the pathogen to
attack differential carnation cultivars. To date, ten races
have been described worldwide.
o Races 1 and 8 apparently originated in the Italian
Riviera, where they are associated with
Mediterranean carnation ecotypes found in Italy,
France, and Spain. It attacks, mostly Gros
Michel, Silk, Pome and Latundan cultivars
o Race 2 is widespread in all areas of carnation
cultivation in the world. It attacks Bluggoe and
other plantain (ABB genome) bananas
o Race 4 is found in carnation cultivars in the
United States, Italy, Israel, Spain, and Colombia.
It is pathogenic to Cavendish bananas
40
o Race 3 was initially classified as a Fod race, but
DNA-based methods recently reclassified it as F.
redolens, revealing that F. redolens and F.
oxysporum not only are different species but also
lack a sister group relationship.
Isolates in race 4 are further subdivided into Foc ‘tropical’ and
Foc ‘subtropical’, based on whether or not they cause disease on
Cavendish bananas under tropical
environmental conditions.
3.7. Characterization of formae speciales based on
pathogenicity
This can be problematic , because:
o complete sets of differentials may no longer be available
o pathogenicity tests can be influenced by temperature, host age,
method of inoculation and other variables, those conducted in
different laboratories may generate incongruent results.
o field testing is time-consuming, expensive, and appropriate test
sites may not be available for a given race or for the needed
length of time.
o F. oxysporum cannot be morphologically distinguished from
other formae speciales that cause wilting in other hosts and other
non-pathogenic F. oxysporum endophytes, saprophytes and
antagonists.
3.8. Characterization of formae speciales into vegetative
compatibility groups (VCG):
o Vegetative compatibility is controlled in Fusarium spp. by
several vegetative (vic) or heterokaryon (het) incompatibility
loci.
o For two individuals to be vegetatively compatible and form a
stable heterokaryon, they need to share a common allele at each
vic locus.
41
o VCGs represent good phenotypic characters for assessing
diversity within populations.
o Vegetative compatibility may be determined with
complementation assays between auxotrophic nutritional
mutants.
o Puhalla (1985) developed an efficient technique for determining
compatibility.
o Vegetative compatibility test in FOC has been assessed with nitratenonutilizing, nit, mutants.
(A) Wildtype isolates are cultured on a chlorate containing medium on
which mutant sectors eventually form (lower righthand corner).
(B) Mutant sectors that develop usually grow diffusely on a medium that
contains nitrate as the sole source of N. These nit mutants are phenotyped for
utilization of different nitrogen sources to determine the portion of the nitrate
utilization pathway that has been affected.
(C) nit mutants have been plated on a basal medium that contains
either ammonium (upper left), nitrate (upper right), hypoxanthine (lower left) or
nitrite (lower right). The mutant at the top of each of these plates is a NitM mutant
since it utilizes neither nitrate nor hypoxanthine. All that remain, except that on the
lower left, utilize all but nitrate and are nit1 mutants.
(D) Wild-type growth at the intersection of complementary mutants, as
seen in the following picture,
(Ploetz, R.C. 2005. Panama Disease: An Old Nemesis Rears its Ugly Head Part 2)
42
VCGs of Fusarium oxysporum
To date, more than 20 VCGs of Fusarium oxysporum have been
reported.
Some are distributed worldwide,
others have narrow distributions.
Some of the VCGs have been recovered from a wide array of
cultivars and genomes,
some have come from specific banana genomes, and
others have been found on a single cultivar.
3.9. Chemotypes of the Fusarium graminearum Complex
(Fg complex)
Every species within the Fg complex is capable of producing type B
trichothecenes in plants. Based on the chemical structure, including the
acetylation position, 5 type B trichothecene chemotypes have been identified
within the Fg complex:
1. 3-acetyldeoxy-nivalenol (3-AcDON): F. ussurianum strains
2. 15-acetyldeoxynivalenol (15-AcDON): F. aethiopicum, F.
boothii and F.vorosii strains
3. 4-acetylnivalenol (NIV):
F. meridionale and F. gerlachii strains
4. 3-AcDON, 15-AcDON and NIV:
F. graminearum s.s. and F. asiaticum.
5. AcDON and NIV:
F. mesoamericanum, F. austroamericanum, F.
cortaderiae, F. brasilicumcan and F. acaciae-mearnsii.
43
4. Classification of the genusFusarium
4.1. Historical:
The genus Fusarium was erected by Link in 1809 for fungi with
canoe- or banana-shaped conidia
Approximately 1000 species had been described in the period
1809-1935
Wollenweber & Reinking , Germany (1935)- organized the
genus in 16 sections,65 species, 55 varieties, 22 forms
Snyder& Hansen (1940s), U SA- compressed the 16 sections
into nine species, and the species in section Elegans into a single
species, F. oxysporum.
Railo (1950), Russia –mentioned 55 species
Gordon (1952), Canada- mentioned 26 species
Bilai (1955 ), Russia –mentioned 9 sections, 26 species, 29
varieties
Messiaen & Cassi (1968), France-mentioned 9 species
Booth (1971), England- 48 species and 104 forms and varieties
Mato(1972), Japan- 10 species
Joffe (1974), Isael-13 sections,33 species,14 varieties
Gerlach (1982) , Germany-78 species
Nelson, Toussoun & Massas (1983), USA -30 species
Leslie and Summerell (2006) summarized information for 70
species of Fusarium, and this monographic publication was the
first for the genus to integrate morphological and phylogenetic
information.
44
4.2.Wollenbecher and Reinking classification of
Fusarium genus (1935)
4.2.1. Fusarium species
I. Section: Eupionnotes (Nectria)
1. F. aquaeductuum (Radlk. et Rabh.) Lagh (N. episphaeriae v.
coronate)
2. F. cavispermum, Corda
3. F. melanochlorum (Casp.) Sacc . (N. flavor-viridis)
4. F. merismoides Corda
5. F. dimerum Penzig
6. F. flavum (Fr.) Wr.
II. Section:Macroconia (Nectria)
7.
8.
9.
10.
F. coccophilum n.c. (N. coccophila)
F. buxicola Sacc,
(N. Desmazierii)
F. expansum Schlechtendahl (N. stilbosporae)
F. sphaeriae Fuckel: (N. leptosphaeriae)
11. F. gigas Spegazzini
III. Section:Spicarioides (Calonectria)
12. F. decemcellulare Brick( Calonectria rigidinscula )
IV. Section: Submicrocera (Calonectria)
13. F. ciliatum Link (Calonectria decora)
14. F. cerasi Roll. et Ferry
V. Section:Pseudomicrocera ( Calonectria)
15. F. juruanum P. Henn (Calonectria diploa)
16. F. orthoconium Wr.
VI. Section:Arachnites (Calonectria)
17. F. nivale (Fr.) Ces (Calonectria graminicola)
18. F. kühnii (Fuck.) Sacc.
19. F. larvarum Fuck
VII. Section:Sporotrichiella
20.
21.
22.
23.
F. poae (Peck) Wr.
F. chlamydosporum Wr. et RG.
F. tricinctum (Cda.) Sacc.
F. sporotrichioides Sherb.
VIII. Section:Roseum
45
24.
25.
26.
27.
F. avenaceum (Fr.) Sacc.
F. graminum Corda
F. arthrosporioides Sherb.
F. De Tonianum Sacc.
IX. Section:Arthrosporiella
28.
29.
30.
31.
32.
F. semitectum Berk. et Rav.
F. camptoceras Wr. et Rg.
F. anguioides Sherb.
F. concolor Rh.
F. diversisporum Sherb.
X. Section:Gibbosum (Gibberella)
33. F. scirpi Lamb. et Fautr. with var. acuminatum (G. acuminate)
34. F. equiseti (Cda.) Sacc. with var. bullatum (G. intricans)
XI. Section:Discolor (Gibberella)
Subsection Neesiola
35. F. heterosporum Nees
36. F. reticulatum Mont. (Gibberella cyanea ?)
Subsection Saubinetii (gibberella)
37.
38.
39.
40.
41.
42.
43.
F. graminearum Schwabe: (G. saubinetii)
F. sambucinum Fuckel (G. pulicaris)
F. culmorum (W.G.Sm.) Sacc.
F. flocciferum Corda (G. heterochroma)
F. sublunatum Rg.
F. macroceras Wr. et Rg.
F. tumidum Sherb.
Subsection Trichthecioides
44. F. trichothecioides Wr.
45. F. bacteridioides Wr.
XII. Section:Laterituim (Gibberella)
46. F. lateritium Nees (Gibberella baccata)
47. F. sacrochroum (Desm. ) Sacc (G. pseudopulicaris)
48. F. stilboides Wr.
XIII. Section:Liseola (Gibberella)
49. F. moniliforme Sheld. (Gibberella fujikuroi)
50. F. lactis Pir. et Rib.
51. F. neoceras Wr. et Rg
XIV. Section:Elegans
Subsection Ortocera
46
52.
53.
54.
55.
56.
F. orthoceras App et Wr.
F. conglutinans Wr
F. lini Bolley
F. bostrycoides Wr. et Rg.
F. angustum Sherb
Subsection Constrictum
57. F. bulbigenum Cke. et Mass
Subsection Oxysporum
58.
59.
60.
61.
F. oxysporum Schl.
F. dianthi Prill. et Del.
F. vasinfectum Atk.
F. redolens Wr.
XV. Section:Martiella (Hypomyces)
62. F. javanicum Koord. (Hypomyces)
63. F. solani (Mart. Pr. P.) App. et Wr.
64. F. coeruleum (Lib.) Sacc
XVI. Section:Ventrocosum (Hypomyces)
65. F. argillaceum Fr.) Sacc.: (Hypomyces solani)
4.2.2. Fusarium varieties
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
F. aquaeductuum (Radlk. et Rabh.) Lagh. v. medium
F. avenaceum (Fr.) Sacc. v. volutum n.c.
F. bulbigenum Cke. et Mass v. batatas Wr.
F. bulbigenum Cke. et Mass v. blasticola (Rostr.) Wr.
F. bulbigenum Cke. et Mass v. lycopersici (Brushi)Wr.
F. bulbigenum Cke. et Mass v. niveum (E.F.S,.) Wr.
F. bulbigenum Cke. et Mass v. tracheiphilum (E.F.S,.) Wr.
F. conglutinans Wr. v. betae Stewart
F. conglutinans Wr. v. citrinum Wr.
F. conglutinans Wr. v. callistephi Beach
F. culmorum (W.G.Sm.) Sacc. v. cereal (Cke.) Wr.
F. dimerum Penzig v. nectrioides Wr.
F. dimerum Penzig v. pusillum Wr.
F. dimerum Penzig v. violaceum Wr.
F. equiseti (Cda.) Sacc. v. bullatum (Sherb.)Wr.: Gibberella
intricans Wr.
16. F. heterpsporum Nees v. congoense Wr.
47
17. F. javanicum Koord. v. ensiforme (wr. et Rg.) Wr.:Hypomyces
ipomoeae (Hals.) v. major Wr,
18. F. javanicum Koord. v. radicicola Wr.: : Hypomyces ipomoeae
(Hals.) f. 1 Wr.
19. F. lateritium Nees v. longum Wr.
20. F. lateritium Nees v.majus Wr.: Gibberella baccata (Wallr.) Sacc. v.
major Wr.
21. F. lateritium Nees v. minus Wr.
22. F. lateritium Nees v. mori Desm.: Gibberella baccata (Wallr.) Sacc.
v. moricola (DNtrs.) Wr.
23. F. lateritium Nees v. uncinatum Wr.
24. F. merismoides Corda v. chlamydosporale Wr.
25. F. merismoides Corda v. crassum Wr.
26. F. moniliforme Sheldon: Gibberella Fujikuroi (Saw.) Wr.
27. F. moniliforme Sheldon v. anthophilum (A.Br.) Wr.
28. F. moniliforme Sheldon v. minus Wr.
29. F. moniliforme Sheldon v. subglutinans Wr. et Rg.: Gibberella
Fujikuroi (Saw) Wr. v. subglutinans Edw.
30. F. nivale (Fr.) Ces.: v. majus Wr.: Calonectria graminicola (Berk. et
Brme.) Wr. v. neglecta Krpe
31. F. orthoceras App et Wr. v. apii (Nels. et Cochr.) n.c.
32. F. orthoceras App et Wr. v. pisi Linford
33. F. oxysporum Schl. v. aurantiacum (Lk.) Wr.
34. F. oxysporum Schl. v. cubense (F.F.Sm.) n.c.
35. F. oxysporum Schl. v. Gladioli Mass.
36. F. oxysporum Schl. v. medicaginis Weimer
37. F. oxysporum Schl. v. nicotianae Johns.
38. F. reticulatum Mont. v. negundinis (Sherb.) Wr.
39. F. sambucinum Fuck. v. minus Wr.
40. F. scirpi Lamb. et Fautr. v. acuminatum (Ell. et Ev.) Wr.:
Gibberella accuminata Wr.
41. F. scirpi Lamb. et Fautr. v. caudatum Wr.
42. F. scirpi Lamb. et Fautr. v. compactum Wr.
43. F. scirpi Lamb. et Fautr. v. filiferum (Presuu) Wr.
44. F. semitectum Berk. et Rav. v. majus Wr.
45. F. solani (Mart. Pr. P.) App. et Wr. v. aduncisporum (Weim et Hart)
Wr.
46. F. solani (Mart. Pr. P.) App. et Wr. v. eumartii (Carp.) Wr.
Hypomyces haematococcus (Berk et Brme.) Wr.
48
47. F. solani (Mart..) v. Martii (App. et Wr.) Wr.
48. F. solani (Mart. ) App. et Wr. v. minus Wr. hypomyces
haematococcus (Berk. et
Brme.) v. breviconus Wr.
49. F. solani (Mart.) App. et Wr. v. striatum (Sherb.) Wr.: hypomyces
haematococcus (Berk. et
Brme.) v. cancri (Rutg.) Wr.
50. F. sporotrichioides Sherb. v. minus Wr.
51. F. sublunatum v. elongatum Rg.
52. F. tumidum Sherb. v. humi Rg.
53. F. vasinfectum Atk. v. lutulatum (Sherb.) Wr.
54. F. vasinfectum Atk. v. zonatum (Sherb.) Wr.
55. F. aquaeductuum (Radlk. et Rabh.) Lagh. v. medium Wr.: Necteria
episphaeria (Tode) Fr.
4.2.3. Fusarium formae
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
F. avenaceum (Fr.) Sacc. f.1 n.c.
F. orthoceras App et Wr. v. apii (Nels. et Cochr.) f. 1. n.c.
F. oxysporum Schl. f. 1 Wr
F. oxysporum Schl. f. 2 Wr
F. oxysporum Schl. f. 6 Wr
F. oxysporum Schl. f. 7 Wr
F. oxysporum Schl. f. 8 Snyder
F. oxysporum Schl. v. aurantiacum (Lk.) f. 1 Wr.
F. redolens f. 1 Wr.
F. reticulatum Mont. f. 1 Wr.
F. sambucinum Fuck. f. 1 Wr.
F. sambucinum Fuck. f. 2 Wr.
F. sambucinum Fuck. f. 4 Wr.
F. sambucinum Fuck. f. 5 Wr.
F. sambucinum Fuck. f, 6 Wr.
F. solani (Mart..) v. Martii (App. et Wr.) f. 1 Wr.
F. solani (Mart..) v. Martii (App. et Wr.) Wr. f. 2 Snyder
F. solani (Mart..) v. Martii (App. et Wr.) Wr. f. 3 Snyder
F. vasinfectum Atk. f; 1 Wr.
F. vasinfectum Atk. f; 2 n.c.
F. vasinfectum Atk. v. zonatum (Sherb.) f. 1 (Lk.) et Bail.) Wr.
F. vasinfectum Atk. v. zonatum (Sherb.) f. 2 (Lk.) et Bail.) Wr.
49
4.3. Snyder and Hansen classification, 1940
1.
2.
3.
4.
5.
6.
7.
8.
9.
Fusarium episphaeria
Fusarium rigidiuscula
Fusarium nivale
Fusarium tricinctum
Fusarium roseum
Fusarium lateritium
Fusarium moniliforme
Fusarium oxysporum
Fusarium solani
4.4. A. Raillo classification, 1950
1. Fusarium anguioides f. 1 Raillo
2. Fusarium anguioides f. 2 Raillo
3. Fusarium anthophilum f. 1 Raillo
4. Fusarium anthophilum f. 2 Raillo
5. Fusarium aquaeductuum subsp. medium (Wollenw.) Raillo,
6. Fusarium aquaeductuum var. cavispermum (Corda) Raillo,
7. Fusarium aquaeductuum var. dimerum (Penz.) Raillo
8. Fusarium aquaeductuum var. flavum (Fr.) Raillo
9. Fusarium avenaceum subsp. volutum (Wollenw.) Raillo
10. Fusarium avenaceum var. detonianum (Sacc.) Raillo
11. Fusarium avenaceum var. graminum (Corda) Raillo
12. Fusarium bulbigenum var. apii (R. Nelson & Sherb.) Raillo
13. Fusarium bulbigenum var. cucumis Raillo
14. Fusarium bulbigenum var. pisi (Linford) Raill
15. Fusarium caudatum f. 1 Raillo
16. Fusarium caudatum var. filiferum Raillo
17. Fusarium compactum (Wollenw.) Raillo
18. Fusarium conglutinans f. 1 Raillo
19. Fusarium equiseti f. 1 Raillo
20. Fusarium equiseti f. 1 Raillo
21. Fusarium equiseti f. 2 Raillo
22. Fusarium equiseti subsp. ossicola (Berk. & M.A. Curtis) Raillo
50
23. Fusarium flocciferum f. 1 Raillo
24. Fusarium heterosporum f. 1 Raillo
25. Fusarium heterosporum f. 2 Raillo
26. Fusarium heterosporum var. negundinis (Sherb.) Raillo
27. Fusarium javanicum subsp. ensiforme (Wollenw. & Reinking) Raillo
28. Fusarium lateritium subsp. majus (Wollenw.) Raillo
29. Fusarium martii var. caucasicum Raillo
30. Fusarium moniliforme subsp. majus (Wollenw. & Reinking) Raillo
31. Fusarium neoceras var. subglutinans (Wollenw. & Reinking) Raillo
32. Fusarium oxysporum var. callistephi Raillo
33. Fusarium oxysporum var. cepae (Hanzawa) Raillo
34. Fusarium oxysporum var. dianthi (Prill. & Delacr.) Raillo,
35. Fusarium oxysporum var. pisi (C.J.J. Hall) Raillo
36. Fusarium oxysporum var. solani Raillo
37. Fusarium oxysporum var. trifolii (Jacz.) Raillo
38. Fusarium poae f. 1 Raillo
39. Fusarium sambucinum f. 1 Raillo
40. Fusarium sambucinum f. 2 Raillo
41. Fusarium sambucinum var. cereale (Cooke) Raillo
42. Fusarium sarcochroum f. 1 Raillo
43. Fusarium scirpi subsp. acuminatum (Ellis & Everh.) Raillo
44. Fusarium semitectum f. 1 Raillo
45. Fusarium sporotrichioides subsp. minus (Wollenw.) Raillo
46. Fusarium sporotrichioides var. tricinctum (Corda) Raillo
47. Fusarium wollenweberi Raillo
48. Fusarium wollenweberi f. 1 Raillo
4.5. W. Gerlach & H.I. Nierenberg classification, 1982
1.
2.
3.
4.
5.
Fusarium acuminatum Ell. & Kellerm.
Fusarium anguioides Sherb.
Fusarium annulatum Bugnicourt
Fusarium anthophilum (A. Braun) Wollenw.
Fusarium aquaeductuum (Radlk. & Rabenh.) Lagerh. var.
aquaeductuum
6. Fusarium aquaeductuum (Radlk. & Rabenh.) Lagerh. var. medium
Wollenw.
7. Fusarium arthrosporioides Sherb.
51
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
Fusarium avenaceum (Fr.) Sacc. var. avenaceum
Fusarium avenaceum (Fr.) Sacc. var. volutum Wollenw. & Reinking
Fusarium bactridioides Wollenw.
Fusarium buharicum Jaczewski ex Babayan & Temereyenkoyea
Fusarium buxicola Sacc
Fusarium camtoceras Wollenw. & Reinking
Fusarium caucasicum Letov
Fusarium cavispermum Corda
Fusarium chlamydosporum Wollenw. & Reinking var.
chlamydosporum
Fusarium chlamydosporum Wollenw. & Reinking var. fuscum
Gerlach
Fusarium ciliatum Link
Fusarium coccidicola P. Henn
Fusarium coccophilum (Desm.) Wollenw. & Reinking
Fusarium coeruleum (Libert) ex Sacc.
Fusarium compactum (Wollenw.) Gordon
Fusarium concolor Reinking
Fusarium culmorum (W. G. Smith) Sacc.
Fusarium decemcellulare Brick.
Fusarium detonianum Sacc.
Fusarium dimerum Penzig in Sacc.
Fusarium diversisporum Sherb.
Fusarium epistroma (Höhnel) C. Booth
Fusarium equiseti (Corda) Sacc. var. equiseti
Fusarium eumartii Carpenter
Fusarium expansum Schlecht.
Fusarium flavum (Fr.) Wollenw.
Fusarium flocciferum Corda
Fusarium fujikuroi Nirenberg
Fusarium gigas Speg.
Fusarium graminearum Schwabe
Fusarium graminum Corda
52
39. Fusarium heterosporum Nees ex Fr. var. congoense (Wollenw.)
Wollenw.
40. Fusarium heterosporum Nees ex Fr. var. heterosporum
41. Fusarium illudens C. Booth
42. Fusarium inflexum R. Schneider in Schneider & Dalchow
43. Fusarium javanicum Koorders
44. Fusarium kuehnii (Fuckel) Sacc.
45. Fusarium lactis Pirotta & Riboni
46. Fusarium larvarum Fuckel
47. Fusarium larvarum Fuckel var. rubrum Gerlach
48. Fusarium lateritium Nees ex Link. var. lateritium
49. Fusarium lateritium Nees ex Link. var. longum Wollenw.
50. Fusarium lateritium Nees ex Link. var. majus (Wollenw.) Wollenw.
51. Fusarium longipes Wollenw. & Reinking
52. Fusarium lunulosporum Gerlach
53. Fusarium macroceras Wollenw. & Reinking
54. Fusarium melanochlorum (Casp.) Sacc.
55. Fusarium merismoides (Corda) var. merismoides
56. Fusarium merismoides Corda var. acetilereum Tubakai, C. Booth &
Harada
57. Fusarium merismoides Corda var. chlamydosporale Wollenw.
58. Fusarium merismoides Corda var. crassum Wollenw.
59. Fusarium merismoides Corda var. violaceum Gerlach
60. Fusarium neoceras Wollenw. & Reinking
61. Fusarium nivale Ces. Ex Sacc. var majus Wollenw.
62. Fusarium nivale Ces. Ex Sacc. var. nivale
63. Fusarium orthoconium Wollenw.
64. Fusarium oxysporum Schlecht. var. meniscoideum Bugnicourt
65. Fusarium oxysporum Schlecht. var. Oxysporum
66. Fusarium poae (Peck) Wollenw. in Lewis
67. Fusarium proliferatum (Matsushima) Nirenberg
68. Fusarium proliferatum (Matsushima) Nirenberg var. minus Nirenberg
69. Fusarium redolens Wollenw.
70. Fusarium reticulatum Montagne var. reticulatum
53
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
92.
93.
94.
95.
96.
97.
98.
99.
Fusarium robustum Gerlach
Fusarium sacchari (Butler) W. Gams
Fusarium sacchari (Butler) W. Gams var. elongatum Nirenberg
Fusarium sacchari (Butler) W. Gams var. subglutinans (Wollenw. &
Reinking) Nirenberg
Fusarium sambucinum Fuckel var. coeruleum Wollenw.
Fusarium sambucinum Fuckel var. sambucinum
Fusarium sarcochroum (Desm.) Sacc.
Fusarium semitectum Berk. & Rav. in Berkeley var. majus Wollenw.
Fusarium semitectum Berk. & Rav. in Berkeley var. semitectum
Fusarium solani (Mart.) Sacc. var. solani
Fusarium sphaeriae Fuckel
Fusarium sporotrichioides Sherb. var. minus Wollenw.
Fusarium sporotrichioides Sherb. var. sporotrichioides
Fusarium stilboides Wollenw. var. stilboides
Fusarium stoveri
Fusarium sublunatum Reinking var. elongatum (Reinking) Reinking
in Wollenweber & Reinking
Fusarium sublunatum Reinking var. sublunatum
Fusarium succisae (Schröter) Sacc.
Fusarium sulphureum Schlecht.
Fusarium tabacinum (Beyma) W. Gams in Gams & Gerlagh
Fusarium trichothecioides Wollenw. in Jamieson & Wollenweber
Fusarium tricinctum (Corda) Sacc.
Fusarium tumidum Sherb. var. coeruleum Bugnicourt
Fusarium tumidum Sherb. var. humi Reinking
Fusarium tumidum Sherb. var. tumidum
Fusarium udum Butler
Fusarium ventricosum Appel & Wollenw.
Fusarium verticillioides (Sacc.) Nirenberg
Fusarium xylarioides Steyaert
54
4.6. C. Booth classification, 1971.
4.6.1. Fusarium species
1. Section:Arachnites
1.
2.
3.
4.
F. stoveri Booth
F. tabacinum (Beyma) W. Gams
F. dimerum Penzig
F. nivale (Fr.) Ces. Rabenh.
[Submicrocera]
2. Section:Martiella
[Ventricosum]
5.
6.
7.
8.
F. solani (Mart.) Sacc.
F. illudens Booth
F. ventricosum Appel & Wollenweber
F. tumidum Sherb
3. Section:Epispheria
[Eupionnotes and Macroconia]
9.
10.
11.
12.
13.
14.
15.
F. aquaeductuum Lagh.
F. buxicola Sacc.
F. epistromum (Höhn.) Sacc.
F. melanochlorum (Casp.) Sacc.
F. merismoides Corda
F. sphaeriae Fockel
F. gigas Speg.
4. Section:Spicarioides
16. F. decemcellulare Brick.
5. Section: Sporotrichiella
17. F. poae (Peck) Wrollenweber
18. F. tricinctum (Corda.) Sacc
6. Section: Arthrosporiella
19. F. sporotrichioides Sherb.
20. F. fusarioides (Frag. & Cif,) Booth
[Roseum]
21. F. avenaceum (Corda ex Fr.) Sacc.
22. F. camptoceras Wollenw. & Reink.
23. F. semitectum Berk. & Berkeley
7. Section: Coccophilum
55
24. F. larvarum Fuckel.
[Pseudomicrocera and Macroconia]
25. F. coccophilum (Desm.) Wollenw.
26. F. juruanum P. Henn.
8. Section: Lateritium
27.
28.
29.
30.
31.
F. lateritium Nees
F. lateritium var. buxi
F. udum Butler
F. stilboides Wollenw.
F. xylarioidesSteyaert
9. Section: Liseola
32. F. moniliforme Sheldon.
10. Section: Elegens
33. F. oxysporum Schlech.
34. F. oxysporum var. redolens
11. Section: Gibbosum
35.
36.
37.
38.
F. concolor Reinking
F. equiseti (Corda) Sacc.
F. acuminatum Ellis & Everhart
F. arthrosporioides Sherb.
12 . Section: Discolor
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
F. trichothecioides Wollenw
F. bubaricum Jaczewski
F. sambucinum Fuckel
F. sambucinum Fuckel var. corruleum Wollenw.
F. culmorum (W. G. Smith) Sacc.
F. heterosporum Nees
Gibberella gordonia spec. nov.
F. graminearum Schwabe
F. flocciferum Corda
F. sulphureum Sclechtendahl
4.6.2.Fusarium varieties
1.
2.
3.
4.
F. solani (Mart.) Sacc. f. sp. albizziae
F. solani (Mart.) Sacc. f. sp. aurantifoliae
F. solani (Mart.) Sacc. f. sp. batatas
F. solani (Mart.) Sacc. f. sp. cucurbitae
56
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
F. solani (Mart.) Sacc. f. sp. dalbergiae
F. solani (Mart.) Sacc. f. sp. cumartii
F. solani (Mart.) Sacc. f. sp. fabae
F. solani (Mart.) Sacc. f. sp. keratitis
F. solani (Mart.) Sacc. f. sp. lupini
F. solani (Mart.) Sacc. f. sp. mori
F. solani (Mart.) Sacc. f. sp. otomycosis
F. solani (Mart.) Sacc. f. sp. phaseoli
F. solani (Mart.) Sacc. f. sp. piperis
F. solani (Mart.) Sacc. f. sp. pisi
F. solani (Mart.) Sacc. f. sp. radicicola
F. solani (Mart.) Sacc. f. sp. robiniae
F. solani (Mart.) Sacc. f. sp. viridiflavum
F. solani (Mart.) Sacc. f. sp. Xanthoxyli
F. solani (Mart.) Sacc. f. sp. Coeruleum
F. aquaeductuum var. medium
F. avenaceum (Corda ex Fr.) Sacc. fabae
F. semitectum var. majus
F. lateritium (Nees) emend. Snyd & Hansen f. sp. cerealis
F. lateritium (Nees) emend. Snyd & Hansen f. sp.ciceri
F. lateritium (Nees) emend. Snyd & Hansen f. sp. mori
F. lateritium (Nees) emend. Snyd & Hansen f. sp. pini
F. lateritium (Nees) emend. Snyd & Hansen f. sp. buxi var. nov.
F. lateritium var. buxi Booth var. nov.
F. udum Butler f. sp. crotalariae
F. moniliforme var. subglutinans
Fusarium oxysporum f.sp. aechmeae
Fusarium oxysporum f.sp. albedinis
Fusarium oxysporum f.sp. anethi
Fusarium oxysporum f.sp. asparagi
Fusarium oxysporum f.sp. batatas
Fusarium oxysporum f.sp. betae
Fusarium oxysporum f.sp. callisephi
Fusarium oxysporum f.sp. cannabis
Fusarium oxysporum f.sp. carthami
Fusarium oxysporum f.sp. cassia
Fusarium oxysporum f.sp. cattleyae
Fusarium oxysporum f.sp. cepae
Fusarium oxysporum f.sp. ciceris
57
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
Fusarium oxysporum f.sp. chrysanthemi
Fusarium oxysporum f.sp. coffeae
Fusarium oxysporum f.sp. conglutinans
Fusarium oxysporum f.sp. coriandrii
Fusarium oxysporum f.sp. cubense
Fusarium oxysporum f.sp. cucumerinum
Fusarium oxysporum f.sp. cumini
Fusarium oxysporum f.sp. cyclaminis
Fusarium oxysporum f.sp. delphinii
Fusarium oxysporum f.sp. dianthi
Fusarium oxysporum f.sp. elacagni
Fusarium oxysporum f.sp. elacidis
Fusarium oxysporum f.sp. eucalypti
Fusarium oxysporum f.sp. fabae
Fusarium oxysporum f.sp.fragariae
Fusarium oxysporum f.sp. gerberae
Fusarium oxysporum f.sp. gladioli
Fusarium oxysporum f.sp. glycines
Fusarium oxysporum f.sp. hebae
Fusarium oxysporum f.sp. herbemontis
Fusarium oxysporum f.sp. gladioli
Fusarium oxysporum f.sp. langenariae
Fusarium oxysporum f.sp. lathyri
Fusarium oxysporum f.sp. lentis
Fusarium oxysporum f.sp. lini
Fusarium oxysporum f.sp. luffae
Fusarium oxysporum f.sp.lupini
Fusarium oxysporum f.sp. lycopersici
Fusarium oxysporum f.sp. mathioli
Fusarium oxysporum f.sp. medicaginis
Fusarium oxysporum f.sp. melonis
Fusarium oxysporum f.sp. narcissi
Fusarium oxysporum f.sp. nicotianae
Fusarium oxysporum f.sp. niveum
Fusarium oxysporum f.sp. opuntiarum
Fusarium oxysporum f.sp. passiflorae
Fusarium oxysporum f.sp. passiflorae
Fusarium oxysporum f.sp. perniciosum
Fusarium oxysporum f.sp. phaseoli
58
83. Fusarium oxysporum f.sp. pini
84. Fusarium oxysporum f.sp. pisi
85. Fusarium oxysporum f.sp. psidii
86. Fusarium oxysporum f.sp. querci
87. Fusarium oxysporum f.sp. radici-lupini
88. Fusarium oxysporum f.sp.raphani
89. Fusarium oxysporum f.sp. rauvoltiae
90. Fusarium oxysporum f.sp. rhois
91. Fusarium oxysporum f.sp. ricini
92. Fusarium oxysporum f.sp. stedi
93. Fusarium oxysporum f.sp. sesame
94. Fusarium oxysporum f.sp. sesbaniae
95. Fusarium oxysporum f.sp. spinaciae
96. Fusarium oxysporum f.sp. stachydis
97. Fusarium oxysporum f.sp. tracheiphilum
98. Fusarium oxysporum f.sp. trifolii
99. Fusarium oxysporum f.sp. tuberosi
100.
Fusarium oxysporum f.sp. tulipae
101.
Fusarium oxysporum f.sp. vanillae
102.
Fusarium oxysporum f.sp. vasinfectum
103.
Fusarium oxysporum f.sp. zingiberi
104.
F. heterosporum Nees Ex Fr. f. sp. aleuritidis
4.7. John F. Leslie, Brett A. Summerell. The Fusarium
Laboratory Manual, 2006
1. Fusarium acuminatum Ellis & Everhart
2. Fusarium acutatum Nirenberg & O’Donnell
3. Fusarium andiyazi Marasas, Rheeder, Lampr., K.A. Zeller & J.F.
Leslie,
4. Fusarium anthophilum (A. Braun) Wollenweber
5. Fusarium armeniacum ( Forbes, Windels & Burgess) Burgess
& Summerell
6. Fusarium avenaceum (Fries) Saccardo
59
7. Fusarium aywerte (Sangalng & L.W. Burgess) Benyon & L.W.
Burgess
8. Fusarium babinda Summerell, C.A. Rugg & L.W. Burgess
9. Fusarium begoniae Nirenberg and O’ Donnell
10. Fusarium beomiforme P.E. Nelson, Toussoun & L.W. Burgess
11. Fusarium brevicatenulatum Nirenberg , O’Donnell, Kroschel &
Andrianaivo
12. Fusarium bulbicola Nirenberg & O’Donnell,
13. Fusarium camptoceras Wollenweber & Reinking,emend. Marasas
& Logrieco
14. Fusarium chlamydosporum Wollenw. & Reinking
15. Fusarium circinatum Nirenberg & O’Donnell, emend Britz,
Coutinho, Wingfield and Marasas
16. Fusarium compactum (Wollenweber) Gordon
17. Fusarium concentricum Nirenberg & O’Donnell
18. Fusarium crookwellense L.W. Burgess, P.E. Nelson & Toussoun
19. Fusarium culmorum (W.G. Smith) Saccardo
20. Fusarium decemcellulare Brick
21. Fusarium denticulatum Nirenberg & O’Donnell
22. Fusarium dimerum Penzig
23. Fusarium dlaminii Marasas, P.E. Nelson & Toussoun
24. Fusarium equiseti (Corda) Saccardo
25. Fusarium foetens Schroers, O’Donnell, Baayen & Hooftman
26. Fusarium fujikuroi Nirenberg
27. Fusarium globosum Rheeder, Marasas & P.E. Nelson
28. Fusarium graminearum Schwabe
29. Fusarium guttiforme Nirenberg & O’Donnell
30. Fusarium heterosporum Nees ex Fries
31. Fusarium hostae Geiser & Juba
32. Fusarium konzum Zeller, Summerell & J.F. Leslie
33. Fusarium lactis Pirotta & Riboni
34. Fusarium lateritium Nees
35. Fusarium longipes Wollenw. & Reinking
36. Fusarium mangiferae Britz, M.J. Wingf. & Marasas
60
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
Fusarium merismoides Corda
Fusarium miscanthi W. Gams, Klamer & O’Donnell
Fusarium musarum Logrieco & Marasas
Fusarium napiforme Marasas, P.E. Nelson & Rabie
Fusarium nelsonii Marasas & Logrieco
Fusarium nisikadoi T. Aoki & Nirenberg
Fusarium nurragi (Summerell & L.W. Burgess) Benyon,
Summerell & L.W. Burgess
Fusarium nygamai L.W. Burgess & Trimboli
Fusarium oxysporum Schlchtendahl
Fusarium phyllophilum Nirenberg & O’Donnell
Fusarium poae (Peck) Wolleweber
Fusarium polyphialidicum Marasas, P.E. Nelson, Toussoun & P.S.
van Wyk
Fusarium proliferatum (Matsush.) Nirenberg
Fusarium pseudoanthophilum Nirenberg & O'Donnell
Fusarium pseudocircinatum Nirenberg & O'Donnell
Fusarium pseudograminearum O'Donnell & T. Aoki
Fusarium pseudonygamai Nirenberg & O'Donnell
Fusarium ramigenum Nirenberg & O'Donnell
Fusarium redolens Wollenweber
Fusarium sacchari (E.J. Butler) W. Gams
. Fusarium sambucinum Fuckel
Fusarium scirpi Lambotte & Fautrey
Fusarium semitectum Berkeley & Ravenel
Fusarium solani (Martius) Appel & Wollenweber, emend, Snyder
& Hansen
Fusarium sporotrichioides Sherbakoff
Fusarium sterilihyphosum Britz, Marasas & M.J. Wingfield
Fusarium subglutinans (Wollenweber & Reinking) P.E. Nelson,
Toussoun & Marasas
Fusarium succisae (J. Schröter) Saccardo
Fusarium thapsinum Klittich, J.F. Leslie, P.E. Nelson & Marasas
Fusarium torulosum (Berkeley & M.A. Curtis) Nirenberg
61
67.
68.
69.
70.
Fusarium tricinctum (Corda) Saccardo
Fusarium udum E.J. Butler
Fusarium venenatum Nirenberg
Fusarium verticillioides (Saccardo) Nirenberg
4.8. Toxigenic Fusarium species
1. Fusarium acaceae-mearnsii: nivalenol, 3A- Deoxynivalenol
2. Fusarium acuminatum: trichothecenes, enniatin B,
moniliformin
3. Fusarium acutatum: beauvericin, fumonisin
4. Fusarium aethiopicum : 15A- Deoxynivalenol
5. Fusarium anantum: fumonisins
6. Fusarium andiyazi: moniliformin, fumonisins
7. Fusarium anthophilum: moniliformin, fumonisins
8. Fusarium armeniacum: T-2. HT-2, neosolaniol
9. Fusarium asiaticum: trichothecines
10. Fusarium astroamericanum: nivalenol, 3A- Deoxynivalenol
11. Fusarium avenaceum: beauvericin, fusarin C, moniliformin,
enniatins A,B,C
12. Fusarium begonia: moniliformin, fumonisin B1
13. Fusarium beomiforme: moniliformin, beauvericin
14. Fusarium boothii : 15A- Deoxynivalenol
15. Fusarium brasilicum: nivalenol, 3A- Deoxynivalenol
16. Fusarium brevicatenulatum: fumonisin B1
17. Fusarium chlamydosporum: moniliformin
18. Fusarium circinatum: beauvericin, fusaric acid
19. Fusarium compactum trichothecenes
20. Fusarium concentricum: fumonisins
21. Fusarium crookwellense: nivalenol, zearalenone, fusaric acid,
fusarin C
22. Fusarium culmorum: moniliformin,deoxynivalenol, fusarin C,
zearalenone, trichothecines
62
23. Fusarium dactylidis: nivalenol , zearalenone
24. Fusarium delphinoides: indole-3-acetic acid
25. Fusarium denticulatum: moniliformin
26. Fusarium dlaminii: beauvericin, moniliformin, fumonisins
27. Fusarium equiseti: butenolidem, beauvericin, trichothecenes,
nivalenol, T-2 toxin, fusarochromanon, zearalenone, equisetin,
28. Fusarium fujikuroi: moniliformin, beauvericin, fusaric acid
29. Fusarium gerlachii: nivalenol
30. Fusarium globosum: fumonisin, beauvericin, fusaproliferin
31. Fusarium graminearum: zearalenon, nivalenol, 3ADeoxynivalenol, 15A-Deoxynivalenol
32. Fusarium guttiforme: beauvericin, fusaproliferin
33. Fusarium heterosporum: fusaric acid
34. Fusarium konzum: fumonisins, beauvericin, fusaproliferin
35. Fusarium kyushuense: trichothecenes
36. Fusarium lactis: moniliformin
37. Fusarium lateritium: enniatins, lateropyrone
38. Fusarium longipes: beauvericin
39. Fusarium langsethiae: diacetoxyscirpenol, T-2 toxin , HT2 toxin, neosolaniol culmorins, chrysogine, aurofusarin, and
enniatins
40. Fusarium louisianense: nivalenol
41. Fusarium mangiferae: azepinostatin
42. Fusarium meridionale: nivalenol
43. Fusarium mesoamerricanum: nivalenol, 3A- Deoxynivalenol
44. Fusarium musae: moniliformin
45. Fusarium musarum: trichothecenes
46. Fusarium napiforme: moniliformin, fusaric acid, fumonisins
47. Fusarium nepalense: 15A- Deoxynivalenol
48. Fusarium nisikadoi: moniliformin
49. Fusarium nygamai: beauvericin, fusaric acid, fumonisins,
moniliformin
50. Fusarium oxysporum: beauvericin, bikaverin, enniatins,
fusaric acid, fusarin C, isoverrucanol, moniliformin,
sambutoxin, wortmannin, fumonisins
63
51. Fusarium phyllophilum: fumonisins, moniliformin,
beauvericin, fusaproliferin
52. Fusarium poae: beauvericin, fusarin C, trichothecenes
53. Fusarium polyphialidicum: fuminosins
54. Fusarium proliferatum: gibberellic acid, beauvericin,
fusaproliferin, fusaric acid, fusarins,,moniliformin
55. Fusarium pseudoanthophilum: beauvericin
56. Fusarium pseudocircinatum: moniliformin, fusaproliferin,
fumonisins
57. Fusarium pseudograminearum: deoxynivalenol, 3-acetyl
deoxynivalenol, zearalenone
58. Fusarium pseudonygamai: moniliformin, fusaproliferin,
fumonisins
59. Fusarium ramigenum: moniliformin, fusaproliferin,
beauvericin, fumonisin B1, fumonisin B2
60. Fusarium redolens: fusaric acid, fumonisins
61. Fusarium sacchari: fusaric acid, fumonisins
62. Fusarium sambucinum: enniatins, beauvericin, fusaric acid,
fusarin C, sambutoxin, wortmannin
63. Fusarium semitectum: apicidins, beauvericin, equisetin,
fusapyrone, moniliformin, sambutoxin, trichothecenes,
zearalenone
64. Fusarium sibiricum : trichothecenes
65. Fusarium solani: deoxynivalenol, T-2 toxin, zearalenone
66. Fusarium sporotrichioides: butenolide, fusarin C,
monilformin, scirpentriol, zearalenone, T-2 toxin
67. Fusarium sterilihyphosum: monilformin
68. Fusarium subglutinans: moniliformin, beauvericin, fusaric
acid, fusaproliferin, fumonisins
69. F. succisae fusaproliferin
70. Fusarium temperatum: moniliformin, beauvericin, enniatins,
fumonisin B1
71. Fusarium thapsinum: moniliformin, fusaric acid, fumonisins
72. Fusarium torulosum: enniatin B, wortmannin
73. Fusarium tricinctum :fusarin C, enniatins, moniliformin
64
74. Fusarium tumidum: neosolaniol
75. Fusarium udum: fusaric acid
76. Fusarium ussurianum : trichothecenes 3A- Deoxynivalenol
77. Fusarium venenatum: trichothecenes
78. Fusarium virguliforme: toxin FvTox1
79. Fusarium verticillioides : fumonisins, fusaric acid, fusarin C,
beauvericin
80. F. vorosi: trichothecenes 3A-Deoxynivalenol
5. Distribution and diversity of Fusarium species
Fusarium species are widely distributed in all major geographic regions of
the world
They are commonly found in soils, and persist as
chlamydospores or as hyphae in plant residues and organic
matter.
Many Fusarium species are abundant in fertile cultivated and
rangeland soils, rather than in forest soils
Fusarium colony was found abundant and diverse in cultivated
soils.
A high degree of variability in morphology and physiological
characteristics enable some species such as F. oxysporum and F.
equiseti to occupy the diverse ecological niches in many
geographic regions
5.1. F. graminearum
F. graminearum is the most important Fusarium species in
central Europe and in large areas in North America and Asia
During the last years F. graminearum has been spreading to the
north in Europe in the Netherlands, England, Sweden, Finland
65
and north-western Russia and it has been replacing the closely
related F. culmorum, which is less effective in producing DON .
F. graminearum is dominant in Europe and North America.
Lineage 7 of F. graminearum dominates in northern Europe and
Asia and has been replacing the closely related F. culmorum in
northern Europe.
In Iran, the diversity and prevalence of Fusarium species and
their chemotypes on wheat in the North-West and North of Iran
was determined. Wheat in these areas is severely affected by
Fusarium Head Blight (FHB), with Fusarium graminearum as
prevalent species causing 96% of the infections in the NorthWest and 50% in the Northern provinces. Fusarium
graminearum strains producing 15-ADON were abundant in
Ardabil (NW of Iran), while in Golestan province (N of Iran) at
the other side of the Caspian Sea especially nivalenol-producing
strains and a variety of other Fusarium species were observed.
Strains producing 3-ADON were rarely found in both areas.
In Canada, Fusarium head blight of wheat and ear rot of corn
causes significant yield and quality losses as well as
contaminates grains with trichothecene mycotoxins. The fungus
is also a potato pathogen and is routinely recovered from potato
tubers showing symptoms of Fusarium dry rot in Canada.
Interestingly, all the G. zeae strains from potatoes were 3Acetyl-DON (3ADON) types. The ability of representative
isolates to produce 3ADON and 15ADON was verified in rice
culture
In Brazil, F. graminearum with a 15-ADON genotype is
dominant in wheat (83%), followed by F. meridionale with a
NIV genotype (12.8%), F. cortaderiae with mostly NIV and a
few 3-acetyl deoxynivalenol (3-ADON) (2.6%), F.
austroamericanum with mostly 3-ADON and a few NIV (1.2%)
66
and F. asiaticum with the NIV genotype (0.4%). Frequency of F.
meridionale in wheat increased with the decrease of latitudes.
For the maize kernel population, F. meridionale is dominant
(72%), followed by F. graminearum with the 15-ADON
genotype (14.5%) and F. cortaderiae with the 3-ADON and NIV
genotypes (13.5%). For the maize stubble population, F.
meridionale is dominant (50%), followed by F. graminearum
with the 15-ADON genotype (30%) and F. cortaderiae with the
NIV and 3-ADON genotypes (20%). F. asiaticum with the NIV
genotype is the sole species found in rice kernels. These results
show that several species coexist in the subtropical to tropical
agricultural regions of Brazil where host and geographic
(climatic) region shape species composition.
Fusarium graminearum www.discoverlife.org
The 3ADON chemotype of F. graminearum is prevalent in
Scandinavia, Finland and north-western Russia
The 15ADON chemotype of F. graminearum is more common
in the more southern areas in Europe and China.
67
Both the 3ADON and 15ADON chemotypes of F. graminearum are
common in the Russian Far East.
Fusarium root rot is a widespread disease of soybean in the United States
and elsewhere in the world. Affecting seedlings as well as adult plants, it can
be caused by numerous Fusarium species, and its severity is highly variable.
Fusarium oxysporum is the most common species, followed by
F. solani, F. graminearum, and F. acuminatum.
Representative isolates of these species cause seedling blight,
root rot symptoms and detrimental effects on root system
growth and development.
F. graminearum isolates are consistently aggressive pathogens
on soybean roots.
Several species other species such as are also involved as F.
armeniacum, F. commune, F. proliferatum
68
Fusarium root rot, caused by Fusarium solani can cause damping-off of
seedlings and root rot on older plants. Infected seedlings can result in poor
weak stands, late emergence or stunted plants.
Fusarium root rot is an important widespread disease of field
pea worldwide • Can attack the crop at various growth stages,
symptoms in seedlings to mature plants • Problematic in Alberta
since ~2010
Fusarium root rot is common in North Dakota but severe
damage has often been observed in association with stressed
plants, such as in drought conditions or with herbicide damage.
Fusarium root rot, or dry root rot, is the most common and
important root rot of beans in North Carolina. Green bean is the
main host but lima bean, southern pea, and garden pea are also
affected. It occurs mostly in hot weather in acid and poorly
fertilized soils. The disease tends to be evenly distributed over a
field.
Fusarium head blight is one of the most devastating plant diseases in the
world.
The United States Department of Agriculture (USDA) ranks
FHB as the worst plant disease to hit the US since the rust
epidemics in the 1950s. Since 1990, wheat and barley
Farmers in the United States have lost over $3 billion dollars
due to FHB epidemics.
Canada has also experienced severe losses since 1990.
69
Major outbreaks of Fusarium head blight (red) on wheat and barley. www.apsnet.org
The Fusarium head blight causing species are common all over Europe but
their importance is different depending on the climatic conditions.
The increase in importance of F. graminearum reported earlier
in Central Europe has been observed during the past ten years,
especially in Norway where high deoxynivalenol contents have
been frequently analysed in oats in some areas.
Signs of the same development have also been observed in
Sweden and Finland, where DON contaminations have
previously been lower.
Fusarium head blight species can produce mycotoxins that accumulate in the
grains, creating a threat to human and animal health.
In Europe, type B trichothecenes, especially deoxynivalenol
(DON), are frequently found in grain batches.
Most of the genes involved in producing these mycotoxins (TRI
genes) are grouped in a 12-gene core cluster (TRI cluster).
Fusarium graminearum, F. culmorum and F. cerealis possess
this cluster, but the presence or absence of certain TRI genes, as
well as their functionality, results in a strain capable of
70
producing either nivalenol (NIV) or deoxynivalenol and a
related acetylated derivative (3- or 15-ADON).
5.2.
F. oxysporum
Fungi of the Fusarium oxysporum species complex are
ubiquitous soil and plant inhabiting microbes.
As plant pathogens, F. oxysporum
appears to be
largely cosmopolitan meaning that it can be found almost
everywhere, with higher concentrations of the various Formae
speciales in different areas across the globe.
FOSC strains can cause wilt and root rot diseases on over 120
plant species. Many FOSC strains can infect plant roots without
apparent effect or can even protect plants from subsequent
infection
FOSC isolates also have been identified as human pathogens
causing localized or disseminated infections that may become
life-threatening in neutropenic individuals
Fusarium wilt of banana (Panama disease) is a destructive fungal
disease of banana plants.
It is caused by Fusarium oxysporum f. sp. cubense (Foc).
It first became epidemic in Panama in 1890 and proceeded to
devastate the Central American and Caribbean banana industries
that were based on the ‘Gros Michel’ (AAA) variety in the
1950s and 1960s.
Once Foc is present in the soil, it cannot be eliminated.
Fusarium wilt of banana is caused by 35 different strains or
genotypes of Fusarium oxysporum f. sp. cubense.
71
The distribution of clonal lineages of Fusarium oxysporum f. sp. cubenseon banana
plantations around the world. Each symbol represents a different clonal lineage. The
most diverse concentration of lineages corresponds with the presumed center of origin
in Southeast Asia (circled). www.apsnet.org
There are four recognised races of the pathogen which are
separated based on host susceptibility.
Race 1, which was responsible for the epidemics in
‘Gros Michel’ plantations, also attacks ‘Lady Finger’
(AAB) and ‘Silk’ (AAB) varieties.
Race 2 affects cooking bananas such as ‘Bluggoe’
(ABB)
Race 3 affects Heliconia spp., a close relative of banana,
and is not considered to be a banana pathogen. ‘
Race 4 is capable of attacking ‘Cavendish’ (AAA) as
well as the other varieties of banana affected by races 1
and 2. These three races have been present on the east
72
coast of Australia for many years and race 1 is present in
WA.
Race 4 is further divided into ‘sub-tropical’ and
‘tropical’ strains. ‘Tropical’ race 4 is a more virulent
form of the pathogen and is capable of causing disease in
‘Cavendish’ growing under any conditions, whereas
‘subtropical’ race 4 generally only causes disease in
plants growing sub-optimally (cool temperatures, water
stress, poor soil).
The strain associated with TR4 was identified in 1990 in
samples from Taiwan1. For the next 20 years or so, the
distribution of
TR4 was limited to parts of Asia and Australia's
Northern Territory.
The first report of TR4 outside the Asia-Pacific region
dates to 2013 when it was announced that the fungal
strain had been confirmed in Jordan.
Later that year it was also reported to be in Mozambique.
The capacity of TR4 to survive decades in the soil, along
with its lethal impact and wide host range, are among the
main reasons it was ranked as the greatest threat to
banana production.
The severity of the damage depends on interactions
between the strain, its host and environmental
conditions.
To avoid further losses to the pathogen, the United
Nations' Food and Agriculture Organization (FAO) has
called on banana-producing countries to step up
monitoring and reporting, and to contain suspected
incursions to prevent the fungus from getting established
73
Fusarium wilt of tomatoes was first described by G.E. Massee in England in
1895.
It is of worldwide importance where at least 32 countries had reported
the disease, which is particularly severe in countries with warm
climate.
At one time, the disease nearly destroyed tomato production in
parts of Florida and the southeastern states of United
States. However, the development and use of resistant cultivars
have nearly eliminate the concern over this disease.
Three physiological races of this pathogen have been reported.
Race 1 is the most widely distributed and has been
reported from most geographical areas.
Race 2, though it was first reported in Ohio in 1940, it
did not become widespread or of economic concern until
its discovery in Florida in 1961. Since then, it was
rapidly reported in several of the states and in several
other countries, including Australia, Brazil, Great
Britain, Israel, Mexico, Morocco, the Netherlands, and
Iraq.
74
Race 3 was reported in 1966 in Brazil. Thereafter, it has
been found in Australia and in Florida and California.
F. oxysporum f.sp. lycopersici, which causes tomato wilt, has
been found in at least 32 different countries alone. F. oxysporum
distribution maps show that this fungus has invaded North and
South America, Europe, Africa, Asia, and Oceania.
Fusarium oxysporum - MicrobeWikiThis map depicts how F. oxysporum
affects 6 of the 7 continents on Earth.
Fusarium wilt of watermelon is one of the oldest described Fusarium
wilt diseases and the most economically important disease of
watermelon worldwide. It occurs on every continent except Antarctica
and new races of the pathogen continue to impact production in many
areas around the world. Long-term survival of the pathogen in the soil
and the evolution of new races make management of Fusarium wilt
difficult.
Fusarium wilt of hemp (Fusarium oxysporum f.sp. cannabis)
The disease was first described on hemp in Eastern Europe about 50 years ago,
but is now found throughout the Northern hemisphere.
Fusarium wilt of hemp is a serious disease in eastern Europe,
Italy and southern France.
Extremely virulent strains reduce Cannabis survival by up to
80%
75
Fusarium wilt of hemp (Fusarium oxysporum f.sp. cannabis).
Fusarium wilt of lettuce is of worldwide occurrence of 1955 Japan
1990 U.S. (California; Fresno County) 1995 Iran 1998 Taiwan 2000
Brazil 2001 U.S. (Arizona; Yuma County) 2002 Italy. Races of
Fusarium oxysporum f. sp. lactucae Races 1,2,3: Japan Race 1: Brazil,
Iran, Italy, Taiwan, United States
Fusarium wilt of cotton, caused by the fungus Fusarium oxysporum
Schlechtend. f. sp. vasinfectum, was first identified in 1892 in cotton
growing in sandy acid soils in Alabama (8). Although the disease was
soon discovered in other major cotton-producing areas, it did not
become global until the end of the next century. After its original
discovery, Fusarium wilt of cotton was reported in Egypt (1902), India
(1908), Tanzania (1954), California (1959), Sudan (1960), Israel
(1970), Brazil (1978), China (1981), and Australia (1993). In addition
to a worldwide distribution, Fusarium wilt occurs in all four of the
domesticated cottons, Gossypium arboretum L., G. barbadense L., G.
herbaceum L., and G. hirsutum L.. Disease losses in cotton are highly
variable within a country or region. In severely infested fields planted
with susceptible cultivars, yield losses can be high
5.3. Fusarium verticillioides is the causal agent of kernel and ear rot of
maize. This destructive disease occurs virtually everywhere that maize
is grown worldwide. In years with high temperatures, drought, and
76
heavy insect damage, the disease can significantly diminish crop
quality.
Fusarium verticillioides (teleomorph Gibberella moniliformis) is
the main fungal agent of ear and kernel rot of maize (Zea mays
L.) worldwide. F.verticillioides is a highly toxigenic species
since it is able to produce the carcinogenic mycotoxins
fumonisins.
The most significant economic impact of F. verticillioides is its
ability to produce fumonisin mycotoxins. Various diseases
caused by fumonisins have been reported in animals, such as
liver and kidney cancer as well as neural tube defects in rodents,
leukoencephalomalacia in equines and pulmonary edema in pigs
Epidemiological correlations have been established between
human esophageal cancer and the consumption of fumonisincontaminated maize in some regions of the world where maize
is
a
dietary
staple.
5.4. Fusarium fujikuroi is a phytopathogenic ascomycete causing the
bakanae disease (“foolish seedlings”) in rice plants. This disease is triggered
by the best known secondary metabolites produced by the fungus, namely
gibberellins.
77
F. fujikuroi is able to produce several other well investigated
secondary metabolites which we can easily detect and quantify
by now (i.e. bikaverin, fusarubin, fusarin C).
F. fujikuroi also possesses the potential to produce a broad
spectrum of further, yet unknown, secondary metabolites. A
genome-wide bioinformatical screening approach revealed that
the F. fujikuroi genome encodes 45 key enzymes for secondary
metabolite production, like 18 polyketide synthases (PKSs) and
16 nonribosomal peptide synthetases (NRPSs), all organized in
putative gene clusters.
5.5. Fusarium avenaceum is often associated with diseased grains in
temperate areas, either alone or in co-occurrence with other Fusarium species,
but its prevalence is also increasing in warmer regions throughout the world.
The major problems caused by F. avenaceum are crown rot and head blight of
wheat and barley, and the contamination of grains with mycotoxins
In Finland and other northern agricultural areas, F. avenaceum
is a common fungus on living and dead organic substrates It is
frequently found on cereal grains, where it may cause seedling
and head blight and produce mycotoxins. F. avenaceum is
associated with foot and root rot diseases of all cereals grown in
Finland. A wide range of variation in pathogenicity between
isolates has been reported
In Norway, Fusarium avenaceum, F. graminearum, F.
culmorum, F. langsethiae, and F. poae are some of the most
common fungal species causing Fusarium Head Blight in
cereals. F. graminearum has shown increased prevalence the last
decade, resulting in increased deoxynivalenol contamination of
cereal grains. The increased prevalence of F. graminearum in
78
Norwegian cereals is likely to be associated with the recent
increased use of reduced tillage in combination with weather
conditions promoting development and dispersal of this fungal
species.
5.6. Fusarium proliferatum is considered worldwide as an emerging
pathogen of garlic. F. proliferatum is know to produce Fumonisins B1 and B2
on different vegetable matrices and Fumonisins contamination of garlic bulbs
has been already reported in Germany.
5.7. Fusarium. langsethiae is a new European species of type A
trichothecene producer. F.langsethiae can be divided into two lineages based
on molecular markers. T-2-producing.
The European F. langsethiae has only been found in Europe,
while the Asian F. langsethiae in Siberia and the Russian Far
East seems actually to be a lineage of F. sporotrichioides based
on molecular data.
In Finland, increase of F. langsethiae, the most important
producer of T-2 and HT-2- toxins has already been observed on
oats and barley under reduced tillage. While DON production is
enhanced by high humidity, F. langsethiae can infect and
produce toxins in dry conditions
5.8. F. sibiricum is distributed in Siberia and Russian Far East with two single
isolates from Norway and Iran. So, it is probable that the actual distribution of
F. sibiricum will be much larger than the present known distribution.
79
5.9.Fusarium temperatum is a new described species occurring on
maize in Belgium, closely related to F. subglutinans. Both species are
considered morphologically identical and associated to the Fusarium
maize ear rot disease complex.
6. Fusarium morphology
6.1.Macromorphology
Most Fusarium species produce woolly to cottony, flat, spreading colonies.
The colour of the colony may be white, cream, tan, salmon, cinnamon, yellow,
red, violet, pink or purple; and on the reverse, it may be colorless, tan, red,
dark purple, or brown
www.pf.chiba-u.ac.jp www.medical-labs.net www.mycology.adelaide.edu.au
80
www.ppis.moag.gov.il
fungi.myspecies.info www.sun.ac.za
www.bioforsk.no
show.wnmu.edu
6.2. Microscopic morphology
Sporodochia
Sporodochia consist of masses of branched conidiophores,.In culture they
build up and are seen macroscopically as light coloured raised bodies on the
surface of the plectochymatic culture mat.
Macroconidia
Macroconidia are borne in sporodochia. They are mostly long, slender, rather
pointed at both end, dorso-ventrally curved, sickle-shaped, septated, and
posses a basal foot cell (that is, the basal cell of the septated spore has a slight
notch on the dorsal side near the attachment point to the conidiophore).
Macroconidia are phialospores, i.e. they are produced in a phialide, which is a
small opening at the tip of the conidiophore from which the spores emerge one
by one, appearing apex end first, all initially attached to the conidiophore.
81
Microconidia
Microconidia may be formed. Typically they are present on the aerial
mycelium of the culture growth, appearing as small, usually one-celled spores,
and oval-shaped, although in some species they may be apiculate, tear-drop or
pear-shaped and sometimes even spherical. Microconidia may be phialospores
or they may also be blastospores, which are dry spores produced by budding at
the tip of the conidiophore. These sporogenesis features are also used by
taxonomists to distinguish species, however they are often difficult to
ascertain and in some isolates production of both spore types occur.
Sometimes microconidia from phialides remain attached to each other in
sequence to form chains. This is also a character used in taxonomy.
Microconidia are usually moisture-borne, but they can be air-borne, usually
for relatively short distances.
Mesoconidia.
Mesoconidia are the fusoid conidia that are longer than microconidia with 3-4
septa but shorter than macroconidia with lack of foot-shaped and notched
basal cell. These conidia are produced in the aerial mycelium on the
polyphialides that appear as “rabbit ears” when viewed in-situ
Chlamydospores
Chlamydospores, exist in some, but not all Fusarium spp. Such spores are
more or less sphaerical, approximately 7-16 in diameter. They occur often
singly, but sometimes they are doubles or are even in chains or in big clumps
in some species. They have thick, double, often very rough cell walls, and
their cytoplasm contains a great deal of nutrients, as is evident by oily
globules therein. Microscopically the walls appear as light yellowish in colour,
but when viewed en masse macroscopically they are brown. Thus large
clumps in culture may appear as brown clumps, sometimes below the agar
surface. They form in conidia or in hyphae, either terminally or intercalary,
and appear usually when the available nutrients are becoming depleted and the
culture is already old.
Perithecia
82
Some Fusarium species are capable of producing a sexual stage. Perithecia
bearing ascospores may appear in nature and in culture under certain specific
conditions, such as proper lighting, temperature and moisture.
www.e-ijd.org
coursewares.mju.ac.th
en.wikipedia.org
www.emlab.com
ishareimage.com ishareimage.com
www.grainscanada.gc.ca
coursewares.mju.ac.thimgbuddy.com
83
6.3. Descriptioon of macro- and microconidia and
chlamydodpores
Macroconidial shapes: A: Typical macroconidia with apical cell on the left
and basal cell on the right, C: macroconidia with dorsoventral curvature, D:
macroconidia with dorsal side more curved than the ventral
Apical cell, E: apical cell blunt, F: apical cell papillate, G:apical cell hooked,
H:apical cell tapering,
Basal cell, I: basal cell foot-shaped, J: basal cell elongated foot-shaped, K:
basal cell distinctly notched, L: basal cell barely notched
Microconidia
M: oval, N: two-celled, O: three-celled, P: rentiform, Q:
obvoid with a truncate base, R: pyriform, S: napiform, T: globose
84
Phialides U and V: monophialides, W and X:polyphialides,: Microconidial chains Y:
short, Z : long. From Fusarium Laboratory Manual www.mycologia.org
From Fusarium Laboratory Manual
7. Fusarium genomics
7.1. The Fusarium Comparative Project
The Fusarium comparative genomics database provides accesses to multiple
sequenced Fusarium genomes simultaneously to facilitate the comparative
analysis
among
these
closely
related
fungal
species.
The Fusarium comparative project is part of the Broad Fungal Genome
85
Initiative and was funded by the U.S. Department of Agriculture's National
Institute for Food and Agriculture.
The main collaborators of Fusarium comparative project
Dr. Corby Kistler at USDA, ARS Cereal Disease Lab of University of Minnesota, Dr. JinRong Xu ant Purdue University, Dr. Frances Trail at Michigan State University, Dr.
Seogchan Kang at Penn State University, Dr. Won-Bo Shim at Texas A&M University,
Dr. Charles Woloshuk at Purdue University
Activities
In 2002, the F. graminearum sequencing project was funded by
the National Research Initiative, which is within the U.S.
Department of Agriculture's National Institute for Food and
Agriculture.
The Fusarium graminearum sequencing project represents a
partnership between the Broad and the International Gibberella
zeae Genomics Consortium (IGGR).
Fusarium oxysporum and F. verticillioides have been selected
at the same time to study evolutionary biology among these
closely related but biologically distinct Fusarium species.
A
three-way
comparison
of F.
oxysporum, F.
verticillioides and F.graminearum offers powerful synergy in
studies of pathogenicity and virulence factors, and their
evolution within this genus.
1. Fusarium oxysporum
86
The F. oxysporum comparative genomes project has sought to
make available genome sequence data for FOSC strains with a
range of host specificities. The first genome made available in
2007 was from a tomato wilt strain FOL 4287 (NRRL 34936)
which was used for comparative analysis with the genomes of F.
graminearum and F. verticillioides.
Results of this comparison led to the discovery of mobile
supernumerary chromosomes in this strain of F. oxysporum f.
sp. lycopersici (race 2 - VCG 0030) containing genes required
for host specific infection and disease (Ma et al., 2010).
Eleven additional FOSC strains now have been sequenced. Two
of these additional strains also infect tomato.
o MN25 (NRRL 54003) is a strain of F. oxysporum f.
sp. lycopersici (race 3 - VCG 0033) from Manatee
County, Florida.
o CL57 (NRRL 26381) is a tomato crown rot pathogen F.
oxysporum f. sp. radicis-lycopersici (VCG 0094) from
Collier County, Florida.
Two FOSC strains sequenced have specificity to crucifers.
o PHW808 (NRRL 54008) is a strain of F. oxysporum f.
sp. conglutinans, race 2 (VCG 0101) from California
that causes cabbage yellows disease.
o PHW815 (NRRL 54005) is a strain of F. oxysporum f.
sp. raphani (VCG 0102) from France that causes radish
wilt. Both strains cause wilt disease in Arabidopsis.
A strain of F. oxysporum f. sp. cubense tropical race 4 (VCG
01213) Fusarium wilt of banana in Indonesia was sequenced.
Strains of the fungus causing wilt disease on melon (F.
oxysporum f. sp. melonisNRRL 26406), cotton (F. oxysporum f.
sp. vasinfectum NRRL 25433) and pea (F. oxysporum f.
sp. pisi NRRL 37622) also were sequenced.
F. oxysporum strain NRRL 32931, obtained from human blood,
represents a distinct haplotype ST 128 and is closely related to
FOSC 3-a/ST 333-a
87
F. oxysporum strain Fo47 (NRRL 54002) well-known for its
biological control properties, originally isolated from disease
suppressive soils from the Chateaurenard region of France and
demonstrated to colonize host roots and to be the biotic
component of wilt disease suppression.
Summary Table of the strains:
NRRL Strain
forma specialis
Host
37622
HDV247
pisi
Pisum
32931
NRRL32931
(human)
Homo
54002
Fo47
(biocontrol)
Soil
54003
MN25
lycopersici race 3 Lycopersicum
54008
PHW808
conglutinans, race Brassica/Arabidopsis
2
54005
PHW815
raphani
Raphanus/Arabidopsis
26381
CL57
radicislycopersici
Lycopersicum
54006
II5
cubense tropical
race 4
Musa
26406
melonis
Cucurbita
25433
vasinfectum
Gossypium
2. Fusarium graminearum
The strain chosen for sequencing by the International Gibberella
zeae Genomics Consortium (IGGR) was PH-1 (NRRL 31084).
It is the predominant FHB species causing scab of wheat and
barley in North America and Europe and is distributed
worldwide
Isolated in Michigan,
88
PH-1 is highly fertile,
It produces trichothecenes and zearalenone ,
It sporulates abundantly in pure culture and is highly pathogenic
to wheat and barley.
The strain can be readily transformed and is closely related to
strain GZ3639 (NRRL 29169) that has been studied for
trichothecene biosynthesis and strain 00-676 (NRRL 34097)
used as one parent with PH-1 for the genetic map
3, Fusarium verticillioides
Strain 7600 (FRC M3125=NRRL 20956), which has been used
extensively in molecular and pathological studies, was selected
for the genome project.
This strain is available at FGSC, NCAUR-ARS-USDA and the
Fusarium Research Center at Penn State.
The genome size is estimated to be 46 Mb with 12
chromosomes
Genome Statistics Summary
_____________________________________________
Size
Chrs
%GC
Genes
tRNAs
rRNAs
F. verticillioides 7600 (FV3)
41.78 Mb
--
48.70
15,869
296
75
F. verticillioides 7600 mito
93.92 Kb
--
32.06
0
31
--
F. graminearum PH-1 (FG3) 36.45 Mb
--
48.33
13,321
322
88
F. graminearum PH-1 mito
107.73 Kb --
31.86
0
21
--
F. oxysporum 4287 (FO2)
61.36 Mb
--
48.40
20,925
308
121
F. oxysporum 4287 mito
84.76 Kb
--
31.01
0
21
--
F. oxysporum Fo47
49.66 Mb
--
47.68
18,191
305
60
F. oxysporum NRRL32931
47.91 Mb
--
47.63
17,280
302
60
F. oxysporum HDV247
55.19 Mb
--
47.61
19,623
318
59
F. oxysporum MN25
48.64 Mb
--
47.75
17,931
305
61
F. oxysporum CL57
49.36 Mb
--
47.62
18,238
313
59
89
F. oxysporum Cotton
52.91 Mb
--
47.67
18,905
305
61
F. oxysporum II5
46.55 Mb
--
47.51
16,634
281
60
F. oxysporum melonis
54.03 Mb
--
47.51
19,661
311
61
F. oxysporum PHW808
53.58 Mb
--
47.73
19,854
311
67
F. oxysporum PHW815
53.5 Mb
--
47.83
19,306
299
58
F. oxysporum Fo5176 (454)
54.95 Mb
--
47.81
21,087
296
58
Size length of complete genome sequence, calculated by adding lengths of all
scaffolds together Chrs number of chromosomes, %GC GC content of scaffolds,
Genes number of predicted protein-coding genes in genome, tRNAs number of
predicted tRNA genes in genome, rRNAs number of predicted rRNA genes in
genome
Genome statistics..of F. oxysporum, F. verticillioides and F.
graminearum. Li-Jun Ma Nature 464, 367-373 (2010)
Species
F.
oxysporum
F.
verticillioides
F.
graminearum
Strain
4287
7600
PH-1
Sequence coverage
(fold)
6
8
10
Genome size (Mb)
59.9
41.7
36.2
Number of
chromosomes
15
11*
4
Total scaffolds
114
31
36
N50 scaffold length
(Mb)
1.98
1.96
5.35
Coding genes
17,735
14,179
13,332
Median gene length
(bp)
1,292
1,397
1,355
90
Repetitive
sequence (Mb)
16.83
0.36
0.24
Transposable
elements (%)
3.98
0.14
0.03
*Fv was reported to contain 12 chromosomes7, 11 chromosomes were mapped to
the assembled genome, and no genetic markers from the smallest chromosome
(600 kb or less) were found in the sequence data. N50 represents the size N such that
50% of the nucleotides is contained in scaffolds of size N or greater.
7.2.Publications on Fusarium genome sequences
2007: The Fusarium graminearum Genome Reveals a Link Between
Localized
Polymorphism and Pathogen Specialization.
Science 317:1400–1402
Cuomo CA, Güldener U, Xu JR, Trail F, Turgeon BG, DiPietro A,Walton J,
Ma LJ, Baker SE, Rep M, Adam G, Antoniw J, Baldwin T,Calvo S, Chang Y
L, DeCaprio D, Gale LR, Gnerre S, Goswami RS,HammondKosack K, Harri
s LJ, Hilburn K, Kennell JC, Kroken S,Magnuson JK, Mannhaupt G, Mauceli
E,Mewes HW, Mitterbauer R,Muehlbauer G, Münsterkötter M, Nelson D, O
’Donnell K, Ouellet T,Qi W, Quesneville H, Roncero MI, Seong KY, Tetko I
V, Urban M,Waalwijk C, Ward TJ, Yao J,Birren BW, Kistler HC.
Cuomo CA,
Li-Jun Ma
91
Jeffrey J Coleman
2009:The genome of Nectria haematococca: contribution of
supernumerary chromosomes to gene expansion. PLoS Genet. 2009
Aug;5(8):e1000618.
Coleman
JJ
, Rounsleym
SD, Rodriguez-Carres
M, Kuo
A, WasmannmCC, Grimwood J, Schmutz J, Taga M, White GJ, Zhou
S, Schwartz DC, Freitag M, Ma LJ,Danchin EG, Henrissat B, Coutinho
PM, Nelson DR, Straney D, Napoli CA, Barker BM, Gribskov M, Rep
M, Kroken S, Molnár I, Rensing C, Kennell JC, Zamora J, Farman
ML, Selker EU, Salamov A, Shapiro H, Pangilinan J, Lindquist E, Lamers
C, Grigoriev IV, Geiser DM, Covert SF, Temporini E, Vanetten HD..
2010: Comparative genomics reveals mobile pathogenicity chromosomes
in
Fusarium.
Nature 464,
367-373
(18
March
2010)
| doi:10.1038/nature08850
Li-Jun Ma1, H. Charlotte van der Does, Katherine A. Borkovich, Jeffrey J.
Coleman, Marie-Jose´e Daboussi,Antonio Di Pietro6, Marie Dufresne,
Michael Freitag, Manfred Grabherr1, Bernard Henrissat8,Petra M.
Houterman, Seogchan Kang, Won-Bo Shim10, Charles Woloshuk11,
Xiaohui Xie, Jin-Rong Xu,John Antoniw, Scott E. Baker, Burton H. Bluhm,
Andrew Breakspear, Daren W. Brown16,Robert A. E. Butchko, Sinead
Chapman1, Richard Coulson17, Pedro M. Coutinho8, Etienne G. J. Danchin,
Andrew Diener, Liane R. Gale, Donald M. Gardiner, Stephen Goff20, Kim E.
Hammond-Kosack, Karen Hilburn, Aure´lie Hua-Van, Wilfried Jonkers2,
Kemal Kazan, Chinnappa D. Kodira1, Michael Koehrsen1, Lokesh Kumar1,
Yong-Hwan Lee, Liande Li, John M. Manners, Diego Miranda-Saavedra,
Mala Mukherjee,Gyungsoon Park, Jongsun Park, Sook-Young Park, Robert
H. Proctor, Aviv Regev, M. Carmen Ruiz-Roldan6,Divya Sain, Sharadha
Sakthikumar1, Sean Sykes1, David C. Schwartz, B. Gillian Turgeon, Ilan
Wapinski,Olen Yoder, Sarah Young1, Qiandong Zeng, Shiguo Zhou, James
Galagan, Christina A. Cuomo1,H. Corby Kistler & Martijn Rep.
92
Jeong H,
Wingfield, Brenda D
Kennell JC
2012: First fungal genome sequence from Africa: a preliminary analysis.
African Journal of Science, 108(01-09
Wingfield, Brenda D., Steenkamp, Emma T., Santana, Quentin C.,
Coetzee, Martin P.A., Bam, Stefan, Barnes, Irene, Beukes, Chrizelle W.,
Yin Chan, Wai, de Vos, Lieschen, Fourie, Gerda, Friend, Melanie,
Gordon, Thomas R., Herron, Darryl A., Holt, Carson, Korf, Ian, Kvas,
Marija, Martin, Simon H., Mlonyeni, X. Osmond, Naidoo, Kershney,
Phasha, Mmatshepho M., Postma, Alisa, Reva, Oleg, Roos, Heidi,
Simpson, Melissa, Slinski, Stephanie, Slippers, Bernard, Sutherland,
Rene, van der Merwe, Nicolaas A., van der Nest, Magriet A., Venter,
Stephanus N., Wilken, Pieter M., Yandell, Mark, Zipfel, Renate, &
Wingfield, Mike J.. South 1-2),
2O12: Comparative analysis
of Fusarium mitochondrial genomes reveals a highly variable region
that encodes an exceptionally large open reading frame.
Al-Reedy RM, Malireddy R, Dillman CB, Kennell JC..
Fungal Genet
Biol. 2012 Jan;49(1):2-14.
2013: Draft genome sequence of Fusarium fujikuroi B14, the causal
agent of the Bakanae Disease of rice.Genome
Jeong H, Lee S, Choi GJ, Lee T, Yun S-H Announcements.
2013;1(1):e00035-13.
2013: Genome sequences of six wheat-infecting Fusarium species
isolates. Genome Announc. 1(5):e0067093
Moolhuijzen PM, Manners JM, Wilcox SA, Bellgard
Gardiner DM. 2013.
Subodh K
Ma LJ,
MI,
Magriet A. van der Nest
2014: The Genome Sequence of the Fungal Pathogen Fusarium
virguliforme That Causes Sudden Death Syndrome in
Soybean. Plos One, 2014.
Subodh K. Srivastava,Xiaoqiu Huang,Hargeet K. Brar,Ahmad, M.
Fakhoury,Burton H.Bluhm,Madan, K. Bhattacharyya
2014: Genome Sequence of Fusarium oxysporum f. sp. melonis Strain
NRRL 26406, a Fungus Causing Wilt Disease on Melon. Genome
Announc. 2014 Jul 31;2(4).
Ma LJ, Shea T, Young S, Zeng Q, Kistler HC.
2014: Genome and Transcriptome Analysis of the Fungal
PathogenFusarium oxysporum f. sp. cubense Causing Banana Vascular
Wilt Disease. Published: April 17, 2014, DOI: 10.1371/journal.pone.0095543
Lijia Guo ,Lijuan Han ,Laying Yang , Huicai Zeng, Dingding Fan,. Yabin
Zhu, Yue Feng, Guofen Wang, Chunfang Peng, Xuanting Jiang, Dajie Zhou,
Peixiang Ni, Changcong Liang, Lei Liu, Jun Wang, Chao Mao, Xiaodong
Fang , Ming Peng , Junsheng Huang . Plos One,
2014: Draft genomes of Amanita jacksonii, Ceratocystis
albifundus, Fusarium circinatum, Huntiella omanensis, Leptographium
procerum, Rutstroemia sydowiana, and Sclerotinia echinophila. IMA Fungus
2014 Dec
94
Magriet A. van der Nest, Lisa A. Beirn, Jo Anne Crouch, Jill E.
Demers, Z. Wilhelm de Beer, Lieschen De Vos, Thomas R. Gordon, JeanMarc Moncalvo, Kershney Naidoo, Santiago Sanchez-Ramirez, Danielle
Roodt, Quentin C. Santana, Stephanie L. Slinski, Matt Stata, Stephen J.
Taerum, P. Markus Wilken, Andrea M. Wilson, Michael
J.Wingfield, and Brenda D. Wingfield .
Erik Lysøe
Kemal Kazan
2014: The genome of the generalist plant pathogen Fusarium
avenaceum is enriched with genes involved in redox, signaling and
secondary metabolism.PLoS One. 2014 19;9(11):
Erik Lysøe ,Linda J. Harris,Sean Walkowiak,Rajagopal Subramaniam,Hege
H. Divon,Even S. Riiser,Carlos Llorens,Toni Gabaldón,H. Corby
Kistler,Wilfried Jonkers,Anna-Karin Kolseth,Kristian F. Nielsen,Ulf
Thrane,Rasmus J. N. Frandsen
2014:Genome Sequence of Fusarium graminearum Isolate CS3005
Donald M. Gardiner, Jiri Stiller, and Kemal Kazan
Martin Urban
Zhitian Zheng
95
2015: Whole-genome analysis of Fusarium graminearuminsertional
mutants identifies virulence associated genes and unmasks
untagged chromosomal deletions. . BMC
Genomics 2015, 16:261 doi:10.1186/s12864-015-1
Martin Urban , Robert King , Keywan Hassani-Pak and Kim E HammondKosack
2015: Whole-genome sequencing reveals that mutations in myosin-5
confer resistance to the fungicide phenamacril in Fusarium graminearum.
Science Reports, 5, 4, 2015
Zhitian Zheng, Yiping Hou, Yiqiang Cai, Yu Zhang, Yanjun Li & Mingguo
Zhou.
2015: Genome-wide analysis in three Fusariumpathogens identifies
rapidly evolving chromosomes and genes associated with pathogenicity.
Genome Biol Evol (2015) doi: 10.1093/gbe/evv092First published online: May 19,
2015
Jana Sperschneider, Donald M. Gardiner, Louise F. Thatcher, Rebecca
Lyons,Karam B. Singh, John M. Manners and Jennifer M. Taylor
Jana Sperschneide Louise F. Thatcher, Rebecca
Lyons
7.3. Synopsis of Fusarium genomics results
The five completely sequenced Fusarium genomes which
also have mostly completed genetic and physical maps
available, are
1. F. graminearum,
2. F. oxysporum f. sp. lycopersici,
3. F. pseudograminearum,
96
4. F. ‘solani’ f. sp. pisi, and
5. F. verticillioides),
Their genomes vary greatly in size and repeat content
genome of F. graminearum: 36-Mb
genome of F. ‘solani’ f. sp. pisi genome: 51
Mb.
genome of F. oxysporum f. sp. Lycopersici:
61-Mb , which is the largest fusarial genome
sequenced so far.
F. verticillioides has distributed fumonisin and gibberellin gene clusters, are
present in some but not all species of the F. fujikuroi and F. oxysporum
species complexes and fusarin biosynthetic genes, which are widely
distributed in Fusarium are absent in all F. oxysporum isolates that have been
examined
Comparative analyses have revealed that the Fusarium genome
is compartmentalized into regions responsible for primary
metabolism and reproduction (core genome), and pathogen
virulence, host specialization, and possibly other functions
(adaptive genome).
Genes involved in virulence and host specialization are located
on pathogenicity chromosomes within strains pathogenic to
tomato (Fusarium oxysporum f. sp. lycopersici ) and pea
(Fusarium ‘solani’ f. sp. pisi ).
The experimental transfer of pathogenicity chromosomes from
F. oxysporum f. sp. lycopersici into a nonpathogen transformed
the latter into a tomato pathogen. Thus, horizontal transfer may
explain the polyphyletic origins of host specificity within the
genus.
The genome assembly of Fol has 15 chromosomes,
the Fv assembly 11 and theFg assembly only four
97
The smaller number of chromosomes in Fg is the result of
chromosome fusion relative to Fv and Fo, and fusion sites
in Fgmatch previously described high diversity regions
Global comparison among the three Fusarium genomes shows
that the increased genomic territory in Fol is due to additional,
unique sequences that reside mostly in extra chromosomes.
Syntenic regions in Fol cover approximately 80% of the Fg and
more than 90% of the Fv genome referred to as the ‘core’ of the
genomes.
Except for telomere-proximal regions, all 11 mapped
chromosomes in the Fv assembly (41.1 Mb) correspond to 11 of
the 15 chromosomes in Fol (41.8 Mb).
The co-linear order of genes between Fol and Fv has been
maintained within these chromosomes, except for one
chromosomal translocation event and a few local
rearrangements
F. oxysporum genome is divided into “core” and “accessory” regions.
The vertically transmitted “core” is conserved and performs all
essential functions.
The horizontally transmitted “accessory” genome in the form of
lineage-specific (LS) chromosomes –
The Fol LS regions differ considerably in sequence
among Fo strains with different host specificities
only occurs in specific pathotypes and encodes hostspecific virulence factors.
The lineage-specific (LS) genomic regions in F.
oxysporum include four entire chromosomes and
account for more than one-quarter of the genome.
The transfer of the LS chromosomes between strains
of F. oxysporum was demonstrated experimentally and
resulted in the conversion of a non-pathogenic strain into
a pathogen
98
Origin of LS regions
Three possible explanations for the origin of LS regions in
the Fol genome were considered:
(1) Fol LS regions were present in the last common ancestor of the
four Fusarium species but were then selectively and independently lost
in Fv,Fg and Fs lineages during vertical transmission;
(2) LS regions arose from the core genome by duplication and
divergence
within the Fol lineage; and
(3) LS regions were acquired by horizontal transfer.
Secondary metabolite biosynthetic genes in Fusarium.
the five genomes have 35 and 31 nonorthologous PKS and NRPS
genes, respectively (12, 33), indicating that the five species have the
collective potential to produce 35 and 31 distinct families of polyketide
and nonribosomal peptide-derived secondary metabolites.
Pathogenicity genes
Basic pathogenicity genes
shared by Fusarium and other pathogenic fungi;
encode essential components of pathways
involved in sensing of exogenous or endogenous
signals,
Specialized pathogenicity genes
specific to individual Fusarium spp. on specific
hosts.
directly involved in host-pathogen interactions:
o F. oxysporum f. sp. lycopersici has
established a gene-for-gene interaction
with its tomato host.
o Virulence factors, such as SIX (secreted
in xylem) genes , play significant roles in
determining host specificity.
99
o SIX genes are located on the F.
oxysporum f. sp. lycopersici pathogenicity
.
o
Other specialized virulence factors that act in a hostor pathogen-specific manner include mycotoxins.
Comparative analyses have revealed
Fusarium genomes are compartmentalized into regions
responsible for essential functions (core genome) and for host
specialization and pathogen virulence (adaptive/accessory
genome).
Horizontal inheritance of supernumerary chromosomes
enriched for host-specific virulence may have played a major
role in the polyphyletic distribution of host specificity within
the F. oxysporum species complex and the rapid emergence of
novel pathogens.
Comparative genome analyses suggest that Fusarium has the
genetic potential to produce many more secondary metabolites
than previously indicated by chemical analyses.
Multiple evolutionary processes, including vertical inheritance,
horizontal gene transfer, gene duplication, and gene deletion,
could have given rise to the current distribution of secondary
metabolite biosynthetic gene clusters and production in
Fusarium.
Deletion of genes with roles in the production of asexual and
sexual spore types tends to have pleiotropic effects.
Transcriptomic studies indicate that a large number of genes
are differentially expressed in the sexual cycle.
100
7.4. Fusarium genomics databases
Cyber infrastructure for Fusarium (CiF);
http://www.fusariumdb.org/;
The CiF consists of three components:
Fusarium-ID
Fusarium Comparative Genomics Platform (FCGP),
Fusarium Community Platform (FCP),
Several databases specialized for fungal genome sequences or gene
families and functional groups, include
Fungal Transcription Factor Database (FTFD),
Fungal Secretome Database (FSD),
Seoul National University Genome Browser (SNUGB),
Fungal Cytochrome P450 Database (FCPD),
Comparative Fungal Genomics Platform (CFGP),
Phytophthora Database
(PD)
101
1. Fusarium-ID
Current statistics of the database
78 Species
There are 7 species complex
1,905 Isolates
5,747 Sequences
The Fusarium-ID enables users to explore the diversity
of Fusarium and accurately identify new isolates based on their
sequence similarity to previously characterized species.
The Fusarium-ID was first released in 2004 (Geiser et al., 2004)
based on sequences of the translation elongation factor 1 alpha
(EF-1α) gene.
Since then, sequences of multiple marker loci that represent
almost all known species have been added, as well as
information associated with characterized isolates, and more
data analysis and visualization tools.
More than 35,000 strains isolated from various substrates
around the world are accessioned in the Fusarium Research
Center (FRC) at Penn State University and the USDA-ARS
NRRL Culture Collection in Peoria (Illinois).
Using this rich strain resource, extensive molecular phylogenetic
studies have been conducted to asses their diversity and
evolutionary relationships (Aoki et al., 2005; Geiser et al., 2004;
O'Donnell et al., 1998a; O'Donnell et al., 2009; O'Donnell et al., 1998b;
O'Donnell et al., 2000a; O'Donnell et al., 2000b; O'Donnell et al., 2007;
O'Donnell et al., 2004a; O'Donnell et al., 2004b; O'Donnell et al., 2010;
Schroers et al., 2009; Starkey et al., 2007; Zhang et al., 2006).
Despite these advances, a significant amount of diversity has yet
to be explored, and some species complexes are quite poorly
characterized phylogenetically.
102
The main goal of Fusarium-ID is to support and coordinate these
remaining tasks by systematically archiving available
phylogenetic data and associated cultures in a format that is
readily accessible and searchable by members of the
global Fusarium research community.
Without a robust phylogenetic framework and community-wide
knowledge sharing, discovery and characterization of
novel Fusarium species will likely be fragmented, creating
confusion instead of the order that taxonomy should provide.
Via the Folder function, users can create two types of data
storage space:
private folder for storing selected data and results
from previous analyses and
(ii) shared folder that permits data sharing with
others designated by the creator of the folder (by
assigning user IDs permitted to access the folder).
A suite of web tools, named the Phyloviewer, allows users
to build phylogenetic trees on the fly using sequences in
BLAST outputs, including the query sequence, and any data
stored in the Cart.
Sequence data in the resulting tree are linked to information
associated with corresponding isolates so that users can
browse if any notable patterns exist among the isolates
included in the tree.
Restriction fragment length polymorphism (RFLP) analysis
of PCR products has been utilized as a means for rapid
strain identification.
The Virtual Gel function supports this diagnostic method by
generating predicted RFLP patterns from chosen sequences
and restriction enzyme(s) via a virtual gel.
A geographic information system (GIS) tool will function
as a digitized atlas showing the genotypic and phenotypic
diversity of Fusarium worldwide in geospatial and temporal
contexts. This functionality will help establish a baseline for
monitoring the migration and variation of Fusarium species.
103
*Correspondence concerning phylogenetics data stored in
Fusarium-ID
should
be
sent
to:
KerryO'Donnell (309-681-6383)
and/or David
M.
Geiser (814-865-9773)
2. Fusarium Comparative Genomics Platform (FCGP)
Introduction to the Fusarium Comparative Genomics Platform (FCGP)
Rapidly accumulating genome sequence data from diverse
Fusarium species with different traits offers tremendous
opportunities for understanding the molecular and evolutionary
mechanisms underpinning functional diversification at a genome
level. The FCGP was developed to facilitate the realization of
such
opportunities.
Currently,
the
genomes
of
four Fusarium species,
including F.
graminearum (two
strains), F. oxysporum, F. verticillioides, and F. solani, have
been published (Coleman et al., 2009; Cuomo et al., 2007; Ma et
al., 2010) with more species and isolates currently being
sequenced or annotated.
The first three species were sequenced by the Broad Institute,
while
the Department
of
Energy
Joint
Genome
Institute sequenced F. solani.
The SNU Genome Browser (SNUGB) (Jung et al., 2008)
supports visualization and utilization of genome sequences and
features both within and across species.
All sequence data and contig information are displayed through
the Contig Browser.
Annotation information in a chosen region, such as transcripts,
ORFs, tRNAs/rRNAs, exon/intron structure, SignalP, PSort and
InterPro domains, can be displayed in multiple formats.
104
The Chromosome Viewer shows the chromosomal locations of
the phylogenetic markers stored in Fusarium-ID. The FCGP also
presents computed characteristics of multiple gene families and
functional groups using the Fungal Transcription Factor
Database (FTFD) (Park et al., 2008b), the Fungal Cytochrome
P450 Database (FCPD) (Park et al., 2008a), and the Fungal
Secretome Database (FSD) (Choi et al., 2010).
Currently available data include 3,095 transcription factors
(TFs), 579 cytochrome P450s, and 11,905 putative secretory
proteins, and provide an overview of these proteins within and
across species.
A BLAST server for each dataset is available for quick search.
Moreover, genes that appear unique to each species, as well as
those that are present in subsets of the four species, were
identified through BLASTMatrix2, a modified BLAST program
that searches gene(s) homologous to a query in multiple species
simultaneously.
In addition to depositing newly released Fusarium genome sequences,
characteristics of additional protein groups, such as ABC
transporters and carbohydrate degrading enzymes, will be added
once the corresponding fungal kingdom-wide databases are
established.
Available expressed sequence tags from Fusarium species will
also be archived and linked to the corresponding genomes.
In combination with the phylogenetic framework
accessioned cultures available through Fusarium-ID,
and
the FCGP will help users study the evolution of Fusarium genes,
gene networks, and whole genomes.
105
Fusarium Comparative Genomics Platform (FCGP)
Statistics of the FCGP
Species name
# of
chromosomes
# of
proteins
# of
TFs
# of
P450s
Fusarium verticillioides
11
14,188
626
129
Fusarium oxysporum f.
sp. lycopersici
15
17,701
810
169
Fusarium graminearum
4
13,321
648
118
Fusarium solani f. sp.
batatas
17
15,707
991
162
60,917
3,075
578
Total
List of sequences of Fusarium species
This is the first page, as example, of 288 pages containing a list of 5747
sequences of Fusarium species
Sequence Name
Species Name
FD_01791_RPB2-711 Fusarium lunatum
Isolate
FD_01791
Marker
RPB2-711
FD_00705_EF-1a_2
Fusarium oxysporum
FD_00705
EF-1a
FD_01170_BTub
Fusarium sacchari
FD_01170
BTub
FD_01865_ITS
Fusarium solani
FD_01865
ITS
FD_01866_ITS
Fusarium solani
FD_01866
ITS
FD_01867_ITS
Fusarium solani
FD_01867
ITS
106
FD_01692_EF-1a_2
Fusarium sp
FD_01692
EF-1a
FD_00001_EF-1a
Fusarium graminearum FD_00001
EF-1a
FD_00033_EF-1a
F.mesoamericanum
FD_00033
EF-1a
FD_00034_EF-1a
F.pseudograminearum
FD_00034
EF-1a
FD_00038_EF-1a
Fusarium graminearum FD_00038
EF-1a
FD_00077_BTub
Fusarium sp
FD_00077
B-tub
FD_00930_EF-1a
Fusarium langsethiae
FD_00930
EF-1a
FD_00929_EF-1a
Fusarium sp
FD_00929
EF-1a
FD_00002_EF-1a
Fusarium graminearum FD_00002
EF-1a
FD_00036_EF-1a
F.pseudograminearum
FD_00036
EF-1a
FD_00037_EF-1a
F.pseudograminearum
FD_00037
EF-1a
FD_00035_EF-1a
FD_00032_EF-1a
FD_00030_EF-1a
F. pseudograminearum FD_00035
Fusarium meridionale FD_00032
Fusarium asiaticum
FD_00030
EF-1a
EF-1a
EF-1a
3. FUSARIUM MLST DATABASE
Because less than one-third of clinically relevant fusaria can be accurately
identified to species level using phenotypic data (i.e., morphological species
recognition), we constructed a three-locus DNA sequence database to
facilitate molecular identification of the 69 Fusarium species associated with
human or animal mycoses encountered in clinical microbiology laboratories.
The database comprises partial sequences from three nuclear
genes: translation elongation factor 1α (EF-1α), the largest
subunit of RNA polymerase (RPB1), and the second largest
subunit of RNA polymerase (RPB2).
These three gene fragments can be amplified by PCR and
sequenced using primers that are conserved across the
phylogenetic breadth of Fusarium.
Phylogenetic analyses of the combined dataset reveal that, with
the exception of two monotypic lineages, all clinically relevant
107
fusaria are nested in one of eight variously sized and strongly
supported species complexes.
The monophyletic lineages have been named informally to
facilitate communication of an isolate’s clade membership and
genetic diversity.
To identify isolates to species included within the database,
partial DNA sequence data from one or more of the three genes
can be used as a BLAST query against the database which is
web-accessible
at
FUSARIUM-ID
(http://isolate.fusariumdb.org) and the CBS-KNAW Fungal
Biodiversity Center (http://www.cbs.knaw.nl/Fusarium).
Alternatively, isolates can be identified via phylogenetic
analysis by adding sequences of unknowns to the DNA
sequence alignment, which can be downloaded from the two
aforementioned websites.
The utility of this database should increase significantly as
members of the clinical microbiology community deposit
cultures of novel mycosis-associated fusaria in internationally
accessible culture collections (e.g., CBS-KNAW or the
Fusarium Research Center), along with associated, corrected
sequence chromatograms and data, so that the sequence results
can be verified and isolates are made available for future study.
People involved in the Fusarium MLST project
Kerry O’Donnell, Deanna A. Sutton, Michael G. Rinaldi, Brice A. J. Sarver 3, S.
Arunmozhi Balajee4, Hans-Josef Schroers, Richard C. Summerbell, Vincent A. R. G.
Robert, Pedro W. Crous7, Ning Zhang, Takayuki Aoki, Kyongyong Jung, Jongsun
Park, Yong-Hwan Lee10, Seogchan Kang, Bongsoo Park11, and David M. Geiser
108
Kerry O’Donnell
Deanna A. Sutton Michael G. Rinaldi Hans-Josef Schroers
R. C. Summerbell Pedro W. Crous Takayuki Aoki David M. Geiser
Searching and Identification
The Fusarium MLST website hosted by the CBS-KNAW Fungal Biodiversity
Centre allows one to access a database of 1365 well studied isolates and 2692
associated sequences from the following regions: Translation elongation factor
1 alpha gene (EF1), RNA polymerase I beta subunit gene (RPB1), RNA
polymerase II beta subunit gene (RPB2), Calmodulin gene (CAL), betatubulin gene (TUBB), Histone gene, IGS, Internal transcribed spacers (ITS1
and ITS2), 28S ribosomal RNA large subunit (28S - LSU) and Mitochondrial
gene. It must be noted that, for the time being, only a small portion of the
strains have been sequenced for all the genes. In Fusarium chlamydosporum
species complex, EF1, RPB2, CAL, ITS and LSU sequences are available. For
Fusarium dimerum species complex, EF1, TUBB, ITS and LSU are most of
the time present. Strains belonging to Fusarium incarnatum-equiseti species
complex have been sequenced for EF1, RPB2, CAL, ITS and LSU. Fusarium
oxysporum species complex is well represented in terms of strains but only a
few EF1, and LSU are more or less consistently present while TUBB as well
as ITS have been sequenced in a few cases. For Fusarium solani species
complex, several genes (EF1, RPB2, CAL, TUBB, ITS and LSU) are
109
represented but few strains have been sequenced for all of them. Finally,
Gibberella fujikuroi species complex have been well studied and most strains
have data for EF1, CAL, TUBB, Histone, IGS, ITS, LSU and Mitochondrial
gene.
Simple and advanced queries on the strains table are possible via a user-friendly
interface.
For the identification, two major options are possible. The first one is
the Single sequence alignment algorithm comparing a unique unknown
sequence against the ones present in our Fusarium MLST sequences reference
database. It’s also possible to compare it against all fungal sequences available
from both Genbank and the CBS-KNAW sequences database . The second
option (Multiple sequences) allows the alignment of several sequences of
several loci at the same time against the Fusarium MLST database using the
polyphasic comparison tools of the BioloMICS software. Since not all the
sequences are available for all the strains, comparisons will be based on
unequal datasets and might lead to unbalanced identifications. This being said,
these multi-locus sequences comparisons are extremely powerful and usually
allow more reliable identifications
Examples of physical and optical maps of Fusarium species
F. graminearum
F.verticillioides
110
Fusarium oxysporum physical map of 15 chromosomes
8. Fusarium diseases in plants, man and animals
8.1. Fusarium diseases in plants
Fusarium species are among the most diverse and widely dispersed plantpathogenic fungi, causing economically important blights, root rots or wilts 1.
Some species, such as F. graminearum and F. verticillioides , have a narrow
host range, infecting predominantly the cereals. By contrast, F. oxysporum,
has a remarkably broad host range, infecting both monocotyledonous and
dicotyledonous plants
Fusarium graminearum is one of the causal agents of head blight disease in
wheat and barley. This devastating pathogen and other head blight causes
important losses in crops worldwide
Fusarium oxysporum comprises a group of soil inhabitants that can exist as
saprophytes in the soil debris but also as pervasive plant endophytes
colonizing the plant roots. Many strains of these species are pathogenic to
111
plant crops. One of these strains, Fusarium oxysporum f.sp. lycopersici, is the
causal agent of fusarium wilt in tomatoes. The first symptoms of the plant are
yellowing and weakness in one side of the plant and progress with wilting of
the leaves and browning of the vascular system leading eventually to leaf
death and inhability to produce fruits.
Fusarium oxysporum has many Formae speciales that exist as plant
pathogens, which are differentiated by host range, causing storage, root, stem,
and fruit rot, as well as vascular wilt.
F. oxysporum f.sp. cubense causes Banana wilt
F. oxysporum f.sp. vasinfectum causes wilt of cotton
F. oxysporum f.sp. batatas causes wilt of sweet potatoes and stem rot
F. oxysporum f.sp. lycopersici causes tomato wilt
F. oxysporum f.sp. asparagi causes asparagus wilt
F. oxysporum f.sp. melonis causes muskmelon and cantaloupe wilt
F. oxysporum f.sp. zingiberi causes ginger wilt
Fusarium solani is responsible for disease on about 100 genera of
plants.
Fusarium verticillioides is a fungal plant pathogen. It causes a disease
in rice called bakanae, which is japanese and means "foolish seedlings".
The afflicted plants are at best infertile with empty panicles, producing
no edible grains; at worst, they are incapable of supporting their own
weight, topple over, and die (hence "foolish seedling").The earliest
known report of bakanae is from 1828. Bakanae affects rice crops in
Asia, Africa, and North America; in 2003, the International Rice
Research Institute estimated bakanae-related crop losses at between
20% and 50%.
Fusarium verticillioides is the causal agent of kernel and ear rot of
maize. This destructive disease occurs virtually everywhere that maize
is grown worldwide. In years with high temperatures, drought, and
112
heavy insect damage, the disease can significantly diminish crop
quality.
Gallery of fusarium infections in plants
1. Fusarium wilt
Fusarium wilt of banana www.apsnet.org,
galleryhip.com Fusarium Wilt Little trip
www.ext.colostate.edu, Tomato
pixgood.com
Fusarium Wilt Palm pixgood.com
www.infonet-biovision.org Chili plant wilt
113
2. Head scab and head blight
fyi.uwex.edu . Fusarium head scab on a wheat head wikimedia.org Fusarium head blight of
barley.
3. Fusarium ear rot in corn
www.strikepointpioneer.com Fusarium ear rot is the most widespread disease of all corn kernel
4. Fusarium Crown and Foot Rot
ag.umass.edu Fusarium Crown and Foot Rot of pumpkin, Squash
www.plantvillage
114
pnwhandbooks.org Fusarium Root and Crown Rot. Red clover, Crown and root rot diseases of
strawberries .www.agric.wa.gov.au
5. Fusarium Basal Rot
www.alamy.comgardener.wikia.com Onion Fusarium basal rot Iris, Bulbous -Fusarium Basal
Rot..pnwhandbooks.org
8.2. Fusarium infections in human
Fusarium is capable of causing mycetomas,
Fusarium has repeatedly been isolated from human keratitis and
corneal ulcers. Most cases concern keratitis.
Fusarium has been reported as an agent in endophthalmitis,
Fusarium has been reported as an agent in subcutaneous and
cutaneous infections,
Fusarium has been reported as an agent in septic arthritis.
Cases of sinusitis and catheter infection have been reported.
Upon initial exposure, Fusarium generally ascends right into the
colon, then through the tissues and through the central nervous
system.
115
Seven Fusarium species complexes are associated with
described cases of human infections:
1. F. dimerum species complex (FDSC),
2. F. solani species complex (FSSC),
3. F. oxysporum species complex (FOSC),
4. F.fujikuroi
species
complex
(FFSC,
encompassing
F. proliferatum and F.
verticillioides),
5. F. incarnatum-equiseti species complex (FIESC)
6. F. chlamydosporum species complex (FCSC),
and
7. F. sporotrichioides (FSAMSC).
Only a few other Fusarium species outside these species
(complexes) have occasionally been implicated in human or
mammal infections.The majority of Fusarium human infections are
due to members of the FSSC, followed by FOSC.
The commonly recorded diseases are:
116
Onychomycoses and skin infections
Etiological agents: members of FSSC, FOSC,
FFSC, rarely FDSC and FIESC.
The prevalence of onychomycoses in humans lies
in the range of 5–15 % of the adult population.
Fusarium spp. can make up to 10–15 % of the
cases
Suggested
predisposing
factors
for
onychomycosis in general include increasing age,
but also immunosuppression, poor peripheral
circulation, trauma, and tinea pedis.
Fungal keratitis is often linked with trauma, especially with
vegetable or other organic matter. The infection is more
common in tropical areas and in areas with a relatively large
agrarian population. However, prevalence data are still
approximate.
Disseminated fusarioses in the immunocompromised host,
Etiological agents: members of FSSC, FFSC, FOSC,
FDSC, or rarely by FIESC.
Clinical Spectra of Fusarium Species
The Fusarium solani species complex (FSSC) globally is the
most common group encountered in human infections. It
contains sixty or more haplotypes, some of which are
predominant in patients.
Of these, F. falciforme, F. keratoplasticum, F.
lichenicola, and F. petroliphilum are capable of human
infection.
Reported cases by members of FSSC range from
onychomycosis to disseminated infection
The Fusarium dimerum species complex (FDSC) contains at
least 12 lineages, of which at least F. dimerum sensu stricto, F.
delphinoides, and F. penzigii have been involved in human
117
infection. Most case reports on F. dimerum were published prior
to its recognition as a species complex.
the infections range from onychomycoses, keratitis, and other
localized infections to disseminated infections in haematooncological patients.
Fusarium chlamydosporum species complex (FCSC) (F.
chlamydosporum sensu lato) contains at least four distinct
species. The complex has only once been implicated in a
keratitis, but more often in onychomycoses, cutaneous and deep
localized infections, and in disseminated infections in haematooncological patients.
Fusarium incarnatum-equiseti species complex (FIESC)
at least 28 species can be recognized. They have repeatedly been
involved in onychomycoses, skin, eye, and deep localized and
disseminated infections, especially in leukemic patients.
Fusarium fujikuroi species complex (FFSC)
F. proliferatum and F. verticillioides are most
commonly observed in human infections are
However,
members of FFSC are increasingly identified in
especially invasive and disseminated infections
in haematooncological patients.
some species of FFSC species, e.g., F. acutatum,
F. anthophilum, F. andiyazi, F. nygamai, and F.
sacchari have a limited geographic distribution
and/or are associated with specific climatic
conditions.
Outside the above-described species complexes, a few other Fusarium species
have been implicated. Both F. lateritium and F. polyphialidicum were
118
recorded causing keratitis, while F. lateritium also caused a disseminated
infection in an HIV-patient.
Gallary of some clinical cases
Slit lamp photograph showing infected cornea involving regions of sclera, Fusarium
temperatum. Al-Hatmi et al., 2014
A, Patient 1 has classic characteristics of fungal keratitisB, Patient 2 has severe fungal keratitis
Left: www. consumerist.com, A 34-year-old man, a piece of wood hit his eye. Culture
results were positive for F. solani.
Right: www.intechopen.com Satellite lesions, hypopyon in anterior and posterior
chamber in a Fusarium keratitis in 45 year-old male.
119
Onychomycosis in a male gardener (a, b) Finger and thumb nails showing signs of
total dystrophic onychomycosis. Fusarium equiseti , Jandial S, Sumbali G.m 2012
Onychomycosis in a male: (a, b) Big toe and little toe finger nails showing signs of
onychomycosis. Fusarium heterosporum , Jandial S, Sumbali G.m 2012
Toenail Fusarium infection, habee.hubpages.com EARL et al., 1959
Case Reports Cutaneous Infection by Fusarium solani in a Patient ...www.thinkzon.com
120
A and B – Fingers nail with yellow-white discoloration roughness and thickening in distal
surfaces. C and D – Toenails with yellowish discoloration, hyperkeratosis and roughness of the
distal nail plates. Fusarium oxysporum Vania O. Carvalho et al., 2014
multiple cutaneous ulcers, F. solani. www.perfecthealthinfo.com. Alex Banger
Cutaneous fusariosis by a species of the Fusarium dimerum species .www.elsevier.es
121
Heel of left foot showing swelling with nodules and verrucous hyperplasia, Plantar surface of
right forefoot showing a superficial ulcer, Fusarium solani, Kudur MH et al., 2013
Ulcer with black eschar on forehead, Lesion on left knee
Kritika Vishwanath Singha et al., 2012
Disseminated Fusarium infection with skin lesions
Left: Fatal disseminated infection with Fusarium petroliphilum Ersal et al., 2015, Disseminated
Fusarium infection in a patient with acute myeloid leukemia and prolonged neutropenia. (A)
Multiple tender cutaneous nodules
122
Liu, Y., Wang, N., Ye, R., & Kao, W. (2014). Disseminated Fusarium infection in a patient with
acute lymphoblastic leukemia: A case report and review of the literature. Oncology Letters, 7,
334-336.
Fusarium solani: An Emerging Fungus in Chronic Diabetic Ulcer..Pai R et al., J Lab
Physicians. 2010
Non-specific infection and calcificated thickening of pleura (asbestos exposure). New
infiltration areas and cavitations in someconsolidations. N. Kebabcı et al. 2013
Blackwell Verlag GmbH
123
8.3. Fusarium infections and fusariotoxicosis in birds
A sandhill crane suffering from fusariotoxicosis, Fluid beneath the skin of the head and neck of
a sandhill showing wing and head droop, Ronald M. Windingstad crane with
fusariotoxicosis. J. Christian Franso
Inflammation and ulceration of the mucosal surface of the oesophagus in a sandhill crane
with fusariotoxicosis. James Runningen
Stomatitis following consumption of T2 fusariotoxin. Chick showing stomatitis attributed to
T2.fusariotoxicosis, Dr.Mohamed Abdel - Moniem Amer
124
Ivan Dinev, Diseases of Poultry
erosions and ulcers in gizzard cuticulum , thickened wall of the proventriculus hyperaemic and
haemorrhagic mucous coat of the gizzard Ivan Dinev, Diseases of Poultry
reddening and hemorrhage of intestinal muscosa. Ivan Dinev, Diseases of Poultry
.Frequent findings in fusariotoxicoses are the massive subcapsular liver haematomas, causing
sudden death in broilers. Ivan Dinev, Diseases of Poultry
The fusariotoxin zearalenone has an effect, identical to that of oestrogenic
hormones and results in reduction of testes in cocks. Left - normal; right 125
atrophied testis in a cock, in whose diet high zearalenone concentrations have
been determined. Microscopically, the testes of cocks with zearalenone
fusario-toxicosis, show a fatty infiltration and atrophy of the germinative
epithelium with the exception of the basal layer as well as interruption of the
spermatogenesis., Fusarochromanone causes tibial dyschondroplasia in broiler
chickens, manifested with long bone deformation. Ivan Dinev, Diseases of
Poultry
8.4. Fusariotoxicosis in animals
Fumonisins cause a neurological disease, equine
leucoencephalomalacia in horses, pulmonary edema in swine,
hepatotoxic and nephrotoxic effects in other domestic animals,
and carcinogenesis in laboratory animals.
Vomitoxin causes pigs to vomit following consumption of feed
with high concentrations of the toxin. Swine are the most
sensitive livestock species to vomitoxin. The most common
effect of vomitoxin is reduced feed intake or feed refusal.
Ruminants appear to be less sensitive to dietary vomitoxin
concentrations than are monogastrics (particularly swine),
perhaps due to the presence of rumen microorganisms.
Zearalenone possesses estrogenic activity and, When consumed
by animals, has been associated with reproductive problems,
such as abortions, false heat, recycling, reabsorption of fetuses
and mummies, and vulvaluterine prolapse. Swine are the most
susceptible to the effects of zearalenone. Poultry Broiler chicks
and laying hens are not greatly affected by zearalenone, even
when consuming large quantities of the toxin
Zearalenone, in swine www.apsnet.org
126
this horse isdisplaying: staggering, ataxia, paresis. drowsiness, listlessness. Death will
occurr after a few days. www.healthvalue.net
9. Isolation and identification of Fusarium species
9.1. Media used
Selective culture media, such as Nash and Snyder medium (NS), dichloranchloramphenicol peptone agar (DCPA), modified Czapek-Dox agar (MCz),
Czapek Dox iprodione dichloran agar (CZID), potato dextrose iprodione
dichloran agar (PDID), or malachite green agar (MGA 2.5), have been
developed for isolating and enumerating Fusarium spp. from natural samples.
Tap water Agar (TWA)
Agar
Distilled water ad
20.0 g
1000.0 ml
Sterilise by autoclaving at 121°C for 15 minutes.
127
Carnation Leaf-Piece Agar (CLA).
Fresh carnation leaves cut into 5-8 mm² pieces, dried in a forced-air oven (~
70°C) for 1-2 hours, sterilized by gamma irradiation (2.5 megarads), placed
into a Petri dish, add sterile 1.2% water agar
Carrot Agar.
Fresh carrots, washed, peeled and diced 400 g add in a flask in 400 ml
of water, autoclave for 20 minutes, blend, add 500 ml of distilled water,
add 20 g of agar, autoclave for 30 minutes.
Oat Agar,
whole (OA) Quaker Oats*................ 10 flakes/20 ml
Agar*............................................... 15 g
Distilled water...............................
1 liter 5.
Potato Dextrose Agar (PDA)*
Potato extract (see below) .........
200 ml
Glucose* ......................................... 10 g
Agar*............................................... 15 g
Distilled Water...........................
1 liter
To prepare potato extract:
place 200 g diced potatoes into 500 ml dist. water,
cook 1 hour in steamer or 40 min. in autoclave.
strain potato infusion through cloth,
melt agar in 500 ml dist. water,
128
add 200 ml potato extract to melted agar,
add glucose,
adjust volume to 1000 ml
autoclave.
Soil Agar (SA).
250-500 g of sieved dry soil into a flask
add to 1 L with tap water
autoclave for 15 min.
add 15 g agar
autoclave for 15 min.
Komada’s Medium.
D-Galactose
L-Asparagine
20.0 g
2.0 g
1.0 g
0.5 g
0.5 g
1.0g
10.0 mg
1000.0 ml
K2HPO4
KCl
MgSO4•7H2O
PCNB (Terraclor 75 % WP)
Fe3Na EDTA
Distilled water
to
The streptomycin stock solution is 5 g of streptomycin in 100 ml distilled
H2O, and is used at
the rate of 6 ml/L of medium.
The Oxgall stock solution contains 5 g Oxgall and 10 g Na 2B4O7•10H2O in
distilled H2O, and is used at the rate of 10 ml/L of medium.
Nash-Snyder Medium
Difco peptone
K2HPO4
MgSO4 • 7 H2O
Agar
15.0 g
1.0 g
0.5 g
15.0 g
129
Distilled water
PCNB (Terraclor 75 % WP)
Streptomycin
neomycin sulfate
1000.0.ml
1.0 g
0.3 g
0.12 g
Dichloran-chloramphenicol peptone agar (DCPA)
Peptone
15.0 g;
KH2PO4,
1.0 g;
MgSO4 7H20,
0.5 g;
chloramphenicol,
0.2 g;
Dichloran (0.2% solution in ethanol), 1 ml (equivalent to 2 pg/ml);
Agar,
20.0 g;
Distilled water to
1000.0 ml.
The medium is sterilized at 121°C for 15 min; the final pH was;
Czapek’s Agar (CZ)*
Sucrose (commercial grade).
.......... 30.0 g
NaNO3
............................................... 3.0 g
K2HPO4
.............................................. 1.0 g
MgSO4 x 7 H2O
............................. 0.50 g
KCl
..............................................0.50 g
FeSO4 x 7 H20
............................... 0.01 g
Agar
.............................................. 20.0 g
Distilled water ..............................
1000.0ml
9.2. Identification of Fusarium species
9.2.1. Morphological identification
Fusarium cultures are examined for macromophological features typical for
Fusarium species namely, woolly to cottony, flat, spreading colonies, white,
130
cream, tan, salmon, cinnamon, yellow, red, violet, pink or purple; and on the
reverse, it may be colourless, tan, red, dark purple, or brown, and the
micromorphological features namely: curved, transversely septate conidia
macroconidia, produced from sporodochia or pionnotes, smaller conidia of
various shapes and septation (“microconidia” and/or “mesoconidia”) produced
from unbranched or branched mycelial conidiophores, producing
conidiogenous cells with monophialidic polyphialidic openings, and
chlamydospores which are thick-walled, generally globose thallospores,
produced in or on hyphae or conidia, singly or in chains or bunches, in
addition to sexual spores, when observed, which are produced in flask-shaped
fruiting bodies (perithecia) that are usually in shades of red, orange, blue or
purple, with little or no stromatal tissue. Asci produced from distinct hymenia,
single-walled (unitunicate) containing eight ascospores, which usually possess
one or more septa, but can be aseptate.
9.2.2. Molecular Methods for Identification of Fusarium
Molecular biology has offered a number of insights into the detection
and enumeration of fungal pathogens and information on identifying
unknown species from their DNA sequences. In recent years, there has
been vast progress in the development of molecular biological tools and
technologies. Each technique can be used as a tool to study variation
amongst fungal isolates, and hence provide important information on
genetic relationships, taxonomy, population structure and epidemiology
associated with fungi.
Molecular markers used for identification of Fusarium
sequence characterized amplified regions (SCAR),
single strand conformational polymorphism (SSCP),
randomly amplified polymorphic DNA (RAPD),
amplified fragment length polymorphism (AFLP),
restriction fragment length polymorphism (RFLP),
sequence related amplified polymorphism (SRAP),
single nucleotide polymorphism (SNP),
variable number of tandem repeat (VNTR)
131
SNP-based multilocus genotyping assay
Steps:
PCR amplification DNA sequencing of, e.g.
the translation elongation factor 1 alpha gene (EF-1α);
the nuclear rRNA internal transcribed spacer (ITS),
the large subunit (LSU),
the intergenic spacer (IGS) regions;
the second largest subunit of the RNA polymerase gene
(RPB2);
the calmodulin gene (CAM);
the mitochondrial small subunit (mtSSU) rRNA gene.
Comparison of sequenced DNA to DNA sequence
databases
Identification by comparison with databases
The
FUSARIUM-ID
server
at
http://fusarium.cbio.psu.edu
BLAST search tool that allows users to query unknown
sequences against the database.
GenBank database is publicly available for identification
purposes, and can be accessed via the Entrez website at
the US National Center for Biotechnology Information
(NCBI): http://www.ncbi.nlm.nih.gov/Entrez/.
It is strongly recommend to use FUSARIUM-ID because
it contains vouchered and well-characterized sequences
that correspond to publicly available cultures that can be
used for confirmation.
FUSARIUM-ID can be used in conjunction with
GenBank.
Primers used for Fusarium
List of primers developed for rapid detection of Fusarium sp. and
F. solani. (Arif et al., 2012)
132
TEF-1α ~420 bp Fusarium species
TEF-Fu3f GGTATCGACAAGCGAACCAT
TEF-Fu3r TAGTAGCGGGGAGTCTCGAA
ITS2-rDNA subunit ~466 bp Fusarium species
ITS-Fu1f ACAACTCATAACCCTGTGAACAT
ITS-Fu1r CAGAAGTTGGGTGTTTTACGG
TEF-1α 658 bp F. solani
TEF-Fs4f ATCGGCCACGTCGACTCT
TEF-Fs4r GGCGTCTGTTGATTGTTAGC
ITS1, ITS2 595 bp F. solani
ITS-Fu2f CCAGAGGACCCCCTAACTCT
ITS-Fu2r CTCTCCAGTTGCGAGGTGTT
ITS2-rDNA subunit 485 bp F. solani
ITS-Fs5f CGTCCCCCAAATACAGTGG
ITS-Fs5r TCCTCCGCTTATTGATATGCTT
Amplification profile of 25 isolates of Fusarium spp. obtained using PP1
primer.( Arif, et al., 2011)
List of primers designed from the sequences of F. sambucinum and
F. coeruleum ITS region using primer set ITS1 x LR1. (Assefa et
al., 2012)
C1F TCAAGCTCTGCTTGGTGTTG
C1R TTGACCTCGGATCAGGTAGG F. coeruleum
C2R ACTCGCCTCAAAACAATTGG
133
C3R1ATTTCGGAGCGCAGTACATC
C4F ACAAGGTTTCCGTAGGTGA
C4R AGACTCGCCTCAAAACAATT
C5F GCTTTGCCTGCTACTATCTCTTAC
C5R TCAATAAGCGGAGGAAAAG
S1F ATCTCTTGGTTCTGGCATCG
S1R AAATACATTGGCGGTCTTGC F. sambucinum
S2R CGAAATACATTGGCGGTCTT
S3F GGAGGGATCATTACCGAGTTTACA
S3R TAAAACCCCAACTTGTGAATGTGA
Species-specific PCR primers designed from the ITS region for the identi¢cation
of Fusarium species (Prashan et al.,2003)
F. culmorum
175F 5P-TTTTAGTGGAACTTCTGAGTAT-3P
430R 5P-AGTGCAGCAGGACTGCAGC-3P
F. sambucinum FSF1 5P-ACATACCTTTATGTTGCCTCG-3P
FSR1 5P-GGAGTGTCAGACGACAGCT-3P
F. oxysporum
FOF1 5P-ACATACCACTTGTTGCCTCGFOR1 5P-CGCCAATCAATTTGAGGAACG-3P
F. equiseti
FEF1 5P-CATACCTATACGTTGCCTCG-3P
FER1 5P-TTACCAGTAACGAGGTGTATG-3P
F. avenaceum FAF1 5P-AACATACCTTAATGTTGCCTCGG-3P
FAR
5P-ATCCCCAACACCAAACCCGAG-3
Genus and species-specific primers (KONIETZNY et al., ]. 2003)
134
DNA of Chinese and Canadian Fusarium graminearumchemotypes amplified using
Fg16 F/R primers. The 497 bp represents SCAR group V and 410 bp represents
SCAR group I. Lane M: Marker; Lanes 1 and 2: NIV chemotypes, China (Fg -0921,
0905); Lanes 3 and 4: 15-ADON chemotype, China (Fg-1960, 0819); Lanes 5-7: 3ADON chemotypes, China (Fg-0919, 0926, 0970); Lanes 8-10: 3-ADON
chemotypes, Canada (M5-06-01, ON-06-39, DF-Fg-2); Lanes 11-13: 15-ADON
chemotypes, Canada (DF-Fg- 144, ON-06-05, 55-1); Lane C: Control.
Amarasinghe et al., 2011
135
RAPD banding patterns of nine fusarium isolates isolated from horse feed
staff using five selected random primers, M: 1 kbp plus DNA ladder, Lane (13): F. verticillioides, Lane 4-6 areF. anthophilum and lane 7-9 F. proliferatum
(Abo El Yazid et al. (2011)
Diagnostic multiplex PCR for MAT-1 and MAT-2 (Steenkamp et al., 2000).
The multiplex PCR included the four primers GFmat1a, GFmat1b, GFmat2c,
and GFmat2d:
GF
GF
Gf
GF
at a 5′-GTTCATCAAAGGGCAAGCG- ′
at
5′-TAAGCGCCCTCTTAACGCCTTC- ′
at 5′-AGCGTCATTATTCGATCAAG- ′ .
at d 5′-CTACGTTGAGAGCTGTACAG- ′ .
136
PCR amplification of the MAT region by using a multiplex PCR. The larger
differential band (∼800 bp) is from amplification of the MAT-2 region. The smaller
differential band (∼200 bp) is from amplification of the MAT-1 region. The constant
band beneath both of the amplified bands is unincorporated primer. (A) Segregation
of MAT-1 and MAT-2 in 8 of the progeny from the mapping cross of F.
verticillioides (23). Lane 1, size markers (200, 400, 800, 1,200, and 2,000 bp); lanes 2
to 9, progeny from A-0015 × A-4643. (B) MAT-1 and MAT-2 alleles from the matingtype tester strains for G. fujikuroi mating populations A, B, D, and H. Lane 5, size
markers; lanes 1 to 4, MAT-1 tester strains; lanes 6 to 9, MAT-2 tester strains.
137
10. Description of Fusarium species
1. Fusarium acacia-mearunsii
Macroconidia 5-septate,gradually curved, asymmetric upper and
lower haves, widest above and lower mid-region,narrow apical
beak
2. Fusarium acuminatum
Ellis & Everh., Proc. Acad.Nat. Sci.Philad. 47:
441 (1895)
≡Fusarium scirpi var. acuminatum (Ellis & Everh.) Wollenw., Fusaria Autographice
Delineata 3: 930-933 (1930)
≡Fusarium scirpi subsp. Acuminatum (Ellis & Everh.) Raillo, Fungi of the genus
Fusarium: 177 (1950)
≡Fusarium gibbosum var. acuminatum (Ellis & Everh.) Bilai, Mykrobiologichnyi
Zhurnal Kiev 49 (6): 6 (1987)
Morphology
Colonies are slow-growing, with white aerial mycelium, developing
brownish pigmentation in the center on PDA. The dorsal side of the
colony has rose to burgundy pigmentation. Macroconidia are broadly
falcate with 3-5 septa, apical cell long and tapered, basal cell foot138
shaped. Microconidia are sparse, fusiform, 0-1 septa, conidiogenous
cell monophialides and chlamydospores formed in chains.
F. acuminatum colony, Paul Cannon
Chlamydospores, conidiogenous cells, macroconidia, Leslie and Summerell
3. Fusarium acutatum
Nirenberg & O'Donnell, Mycologia 90: 435 (1998)
Colonies produce white to pinkish-white mycelium with light orange
pigments in the agar. Macroconidia sparse, fulacate, thin-walled, 3septate, apical cell bent, basal cell foot-shaped. Microconidia abundant,
oval-fusoid,
conidiogenous
cell
monoor
polyphialides.
Chlamydospores develop slowly, in chains and clusters
Fusarium acutatum colony www.boldsystems.org,, conidia, Leslie and Summerell
139
4. Fusarium aethiopicum O'Donnell, Aberra, Kistler & T. Aoki (2008)
F. aethiopicum produces mostly straight conidia, which are
asymmetrical in that they are typically widest above the mid-region
5. Fusarium andiyazi
Marasas, Rheeder, Lampr., K.A. Zeller & J.F. Leslie,
Mycologia 93: 1205 (2001)
= Fusarium moniliforme
= Fusarium verticillioides
Colonies on PDA produce white powdery to floccose mycelium and
orange sporodochia, violet pigmentation is seen in the agar.
Macroconidia are formed in sporodochia, on monophilides or on
branched conidiophores, 3-6 septa, apical cell slightly curved, basal cell
pedicillate. Microconida abundant, clavate to ovoid, in chains on
monophilides, 0-septa. Chlamydospores absent, pseudochlamydospores
may be present.
A,b 10-day old culture of Fusarium andiyazi on oatmeal agar,
C sporodochia,. Kebabci et al., 2013
140
Macroconidia, microconidia,pseudochlamydospores, John F. Leslie and Brett A.
Summerell
6. Fusarium anthophilum (A. Braun) Wollenw., Fusaria Autographice
Delineata 1: 176 (1916)
≡Fusisporium anthophilum A. Braun, Fung. Europ.: no. 1964 (1875)
≡Fusarium moniliforme var. anthophilum (A. Braun) Wollenw., Fusaria Autographice
Delineata 3: 975 (1930)
≡Fusarium wollenweberi Raillo, Fungi of the genus Fusarium: 189 (1950)
≡Fusarium tricinctum var. anthophilum (A. Braun) Bilai, Fusarii (Biologija i sistematika):
251 (1955)
≡Fusarium sporotrichiella var. anthophilum (A. Braun) Bilai, Mykrobiologichnyi Zhurnal
Kiev 49 (6): 7 (1987)
Colonies on PDA form abundant white floccose mycelium turn to
greyish violet in old cultures. Pigmentation in agar violet grey or dark.
Sporodochia pale orange. Macroconidia are thin-walled, long, slender,
almost straight, 3-5 septa,produced from monophilides on branched
conidiophores in the sporodochia or on the hyphae, basal cell notched
or foot-shaped, apical cell curved and tapered. Microconidia are
abundant, from poly- or monophialides, globose, 1-2 celled, globose, or
ovoid, in false heads. Chlamydospores absent.
141
Leslie and Summerell , Hagedorn, Burhenne & Nirenberg
7. Fusarium armeniacum
(G.A. Forbes, Windels & L.W. Burgess) L.W.
Burgess & Summerell, Mycotaxon 75: 347 (2000)
≡Fusarium acuminatum subsp. Armeniacum G.A. Forbes, Windels & L.W. Burgess,
Mycologia 85: 120 (1993)
Colonies on PDA produce white aerial mycelium, red to apricot
pigment in agar, and bright orange sporodochia in the center of the
culture. Some isolates produce a pionnotal form of slow-growing
colonies with little aerial mycelium and abundant orange sporodochia.
Macroconidia in orange sporodochia
and chlamydospores formed
abundantly, but microconidia are absent.
142
Leslie and Summerell
8. Fusarium asiaticum O'Donnell, T. Aoki, Kistler & Geiser, Fungal
Genetics & Biology 41 (6): 619 (2004)
Colonies pink to dark red, cottony, produce white to pink mycelia
Sporodochia pale orange. Macroconidia hyaline, falcate with single foot
cella, 3-5 septate. Microconidia absent. Chlamydospores round, single or in
chains
Kawakami, et al., 2015
143
9. Fusarium austroamericanum. T. Aoki, Kistler, Geiser & O'Donnell,
Fungal Genetics & Biology 41 (6): 617 (2004)
Macroconidia 5-septate, with longitudinal axis typically straight,
asymmetric lower and upper halves, widest in mid-region, with narrow
apical beak.
10. Fusarium avenaceum
(Fr.) Sacc., Sylloge Fungorum 4: 713 (1886)
Fusisporium avenaceum Fries, Systema Mycologicum 3: 444 (1832)
≡Fusarium herbarum var. avenaceum (Fries) Wollenw., Fusaria Autographice Delineata
144
3: 899 (1930) [MB#252553]
=Selenosporium herbarum Corda, Icones fungorum hucusque cognitorum 3: 34, t. 6:88
(1839)
Colonies initially form abundant fluffy white mycelium and produce a
golden orange pigment on PDA at 25°C. Sporodochia pale orange,
Macroconidia are slightly falcate, thin-walled, usually 3 to 5 septate,
with a tapering apical cell , basal cell notched. Microconidia are rare,
fusoid, 1-2 septa, single. Chlamydospores are absent.
F, avenaceum colonies, www.grainscanada.gc.ca. Mycota, G. Hagedorn, M.
Burhenne & H. I. Nirenberg
11. Fusarium aywerte
(Sangal. & L.W. Burgess) Benyon & L.W. Burgess,
Mycological Research 104 (10): 1171 (2000)
≡Fusarium avenaceum subsp. Aywerte Sangal. & L.W. Burgess, Mycological Research
99: 287 (1995)
145
John F. Leslie and Brett A. Summerell
12. Fusarium azukiicola T. Aoki, H. Suga, F. Tanaka, Scandiani &
O'Donnell (2012). Mycologia. 2012 t;104(5):1068-84.
Colonies produce loose to floccose, white to yellowish white
or
reddish white to pale red aerial mycelium. Reverse pigmentation absent
or sometimes grayish yellow, grayish orange to brownish orange.
Macroconidia mostly falcate, sometimes cylindrical and gradually
curved, widest at midregion or more frequently widening gradually
upward, often with a slightly rostrate apex, sometimes with a rounded
apex, gradually narrowing toward base often with a distinct, slightly
protruding basal foot cell or sometimes rounded, 1–5-septate.
Microconidia oblong to naviculate or short-clavate, sometimes
ellipsoidal, straight or curved, with a rounded apex and a truncate base,
0–2-septate. Chlamydospores formed abundantly in hyphae and in
conidia, mostly subglobose, intercalary or terminal, mostly single,
rarely in chains.
Aoki et al., 2012
146
13. Fusarium babinda
Summerell, C.A. Rugg & L.W. Burgess,
Mycological Research 99: 1345 (1995)
Colonies produce floccose aerial mycelium, initially white, later
darkening to pink or pale orange, in some strains with a violet centre;
reverse salmon pink, in some strains becoming violet topurple slate;
Microconidia formed from scattered conidiogenous cells,
monophialides and polyphialides, aggregating in slimy droplets,
hyaline, 0-1 septate, ovoid, ellipsoid to allantoid. Macroconidia formed
from scattered conidiogenous cells (monophialides) in the aerial
mycelium, later from irregularly branching clusters of conidiogenous
cells on the agar surface, developing into slimy, pale pink sporodochia,
3-5-septate, fusiform to cylindrical, slightly curved, apical cell strongly
curved, tapering to a point; basal cell with projecting pedicel.
Chlamydospores subglobose, thick-walled, hyaline to pale brownish,
mostly intercalary, in chains or clusters, sometimes single.
John F. Leslie and Brett A. Summerell
14. Fusarium bactridioides Wollenw., Science 79: 572. 1934.
Colonies produce poorly developed stroma and orange-white to light
orange sporodochia. Macroconidia 3–6 septate; the ventral surface is
more or less straight or gently curved, and the dorsal surface is
moderately curved, with the walls more or less parallel in the central
147
two cells of the conidia, with the widest point near the middle or above
the middle. The apical cell is bluntly rounded, and roughly the same
length as the penultimate cell. The basal cell is tapered more acutely
than apical cell; the base is rounded, flat, or has a slight indentation on
the dorsal side or central papilla, indicating a foot cell. Microconidia are
abundant in the sporodochia, are 0–3 septate, and vary in shape and size
from small, ellipsoidal, oblong-ellipsoidal or allantoid cells that are
obviously microconidia to fusiform to clavate, septate spores that
intergrade with macroconidia.
Hagedorn, Burhenne & Nirenberg,Seifert & Gräfenhan, 2002
15. Fusarium begoniae
Nirenberg & O’Donnell, Mycologia 90:
446 (1998)
Colonies with entire margin. Aerial mycelium almost white, cottony.
Pigmentation in reverse greyish-yellow. Microconidia borne in the
aerial mycelium oval to allantoid and obovoid, 1-0 Septate,
148
Macroconidia, abundant, borne in sporodochia slender, long falcate but
almost straight, with a slightly beaked apical cell and a footlike basal
cell, mostly 3-4 septate. Chlamydospores absent.
John F. Leslie and Brett A. Summerell
16. Fusarium beomiforme
P.E. Nelson, Toussoun & L.W. Burgess,
Mycologia 79: 884-889 (1987)
Colonies with floccose, white-pink aerial mycelium, developing a
diffuse, orange-reddish-brown colouration in reverse. Microconidia of
two forms: (a) abundant, ovoid to cylindrical; (b) less abundant, larger,
globose to napiform, typically vacuolate; chains absent, spores
collecting in slimy droplets. Conidiogenous cells monophialides,
cylindrical, tapering slightly at the tip, with periclinal thickening.
Macroconidia 3-4 (-5)-septate, falcate, apical cell slightly curved,
tapering to a point, basal cell pedicellate. Chlamydospores hyaline,
smooth, typically terminal, single or in pairs, not in intercalary chains.
Fusarium beomiforme colonies,Truman State University
Macroconidia and microconidia of Fusarium beoforme, Leslie and Summerell
149
17. Fusarium biseptatum Schroers, Summerb. & O'Donnell (2009),
Colonies produce sparse white or slightly rose to pale orange aerial
mycelium on agar. Colony reverse on PDA with ochraceous or brown
pigments, mostly without orange pigments. Monophialides formed
terminally or laterally on hyphaemin well developed sporodochia,
forming few-membered whorls on short supporting cells. Microconidia
mostly 0-, rarely 1-septate, typically ellipsoidal, straight or curved,
allantoid formed on SNA on submerged or aerial hyphae. Macroconidia
typically widest in the upper third or the middle, with central part
minutely curved or nearly straight, a pointed and mostly beaked distal
end and a slightly pedicellate and curved proximal end; from well
developed sporodochia, 0-3-septate. Chlamydospores common,
typically intercalary, solitary in short chains or terminal.
Fusarium biseptatum. Schroers, Summerb. & O'Donnell (2009),
150
18. Fusarim boothii O'Donnell, T. Aoki, Kistler & Geiser, Fungal Genetics &
Biology 41 (6): 618 (2004)
Colonies produce white mycelium with light brown coloue in the
center, macroconida 5-septate , gradually curved, upper and lower
halves are mostly symmetric, widest in the mid-region, with a narrow
apical peak,
Lee et al., 2011
19. Fusarium brasilicumT. Aoki, Kistler, Geiser & O'Donnell, Fungal
Genetics & Biology 41 (6): 620 (2004)
Macroconidia 5-septate , straight or gradually curved, upper and lower
halves asymmetrical, widest below the mid- region and narrow apical
peak
151
20. Fusarium brevicatenulatum
Nirenberg & O’Donnell,
Mycologia 90: 446 (1998)
Colony margin entire. Aerial mycelium whitish; lanose to fluffy.
Pigmentation in reverse greyish orange, becoming dark bluish-gray.
Sporodochia formed after 10 days. Conidiophores on the aerial
mycelium prostrate, mostly identical with phialides, occasionally with
one lateral branch. Phialides of conidiophores on the aerial mycelium
cylindrical, mostly monophialidic, occasionally polyphialidic.
Microonidia borne on the aerial mycelium long-oval to obovoid, mostly
O-septate, sometimes 1- and 2-septate. Macroconidia borne in
sporodochia rare, falcate, slender, straight, up to 3-4 septate, apical cell
bent, basal cell foot-like. Chlamydospores absent.
John F. Leslie and Brett A. Summerell
21. Fusarium bulbicola
Nirenberg & O’Donnell, Mycologia 90: 446
(1998)
≡Fusarium sacchari var. elongatum Nirenberg, Mitteilungen der Biologischen
Bundesanstalt für Land- und Forstwirtschaft 169: 59 (1976)
Colony margin entire. Aerial myclium almost white. later tinged ruby
by the substrate: short. hairy to lanose. Pigmentation in reverse dark
ruby. Conidiophores in the aerial mycelium erect, branched in 1 or 2
cylindrical phialides. Sporodochial conidiophores verticillately
152
branched. Conidiophores in the aerial mvcelium mono- and
polyphialidic; sporodochial phialides flask- shaped and monophialidic.
Micronidia borne on the aerial mycelium long-oval to allantoid, mostJy
O-Septate. Macronidia borne in sporodochia long and slender. falcate
with a slightly elongate apical cell and a foot-like basal cell. mostly 3to 5 septate: 3-septate. Chlamydospores absent.
John F. Leslie and Brett A. Summerell
22. Fusarium camptoceras
Wollenw. & Reinking, Phytopathology 15
(3): 158 (1925)
Colonies form white to cream-coloured mycelium and produce
pigmentation in the agar. Macroconidia: predominantly 3-7 cells,
falcate, abundant in sporodochia, apical cell pointed, basal cell pointed
and notched. Sporodochia: cream-orange. Microconidia: long, up to 6
septe, single from a phialide, abundant. Chlamydospores : sparse, on
aerial hyphae or submerged in agar, in pairs, chains or clusters
153
154
23. Fusarium chlamydosporum
Wollenw. & Reinking, Phytopathology
15 (3): 156 (1925)
=Fusarium sporotrichioides var. chlamydosporum (Wollenw. & Reinking) Joffe,
Mycopathologia et Mycologia Applicata 52 (1-4): 211 (1974)
Colonies produce white mycelium with grayish rose to burgundy or
yellowish to pale brown pigmentation.Macroconidia: abundant, thickwalled, moderately curved, 3-5 septa, apicalcell short, curved and
pointed, basal cell notched or foot-shaped. Sporodochia: rare.
Microconidia: comma-shaped, 0-2 septe, single or in pairs fro, a
phialide, abundant. Chlamydospores : abundant after 2-4 weeks, on
aerial hyphae or submerged in agar, in pairs, chains or clusters, pale
brown
Mycobanc, G. Hagedorn, M. Burhenne & H. I. Nirenberg
155
24. Fusarium cicatricum (Berkeley) O'Donnell & Geiser, Phytopathology 103
(5): 404 (2013)
Colony reverse lacking red pigments, after 14-21 d on PDA at 15-25 °C
with weak pigment production, pale to light yellow (4A3-4A5), at 30
°C, somewhat pale orange. Colony surface on PDA with pustules or
cushions of white aerial mycelium with scattered sporodochia covered
with pale yellow conidial masses, smooth at margin, wax-like, pale
yellow. Phialides more or less cylindrical, tapering towards apex, wide
at base and in middle. Microconidia not observed. Macroconidia
formed in pale yellow slimy masses, typically gently curved
throughout, less commonly almost straight, with pronounced pedicellate
foot cell, and a more or less inequilaterally fusoid and hooked apical
cell, 2-8-septate: Chlamydospores not observed
25. Fusarium circinatum
Nirenberg & O’Donnell, Mycologia 90:
446 (1998)
Colonies on PDA with entire margin. Aerial mycelium almost white,
hairy to lanose-funiculose. Pigmentation in reverse greyish white to
grey to dark violet at the center of the colom. Conidiophores of the
aerial mycelium erect. strongly branched, branches terminating mostly
in I or 2 phialides. Sporodochial conidiophores verticillately branched.
Phialides of the aerial conidiophores cylindrical, mono- and
polyphialidic.
Micrconidia borne in the aerial mycelium mostly
obovoid, occasionally oval to allantoid, mostly 0-1 septate, occasionally
l-septate. Macronidia borne in sporodochia slender, cylindrical, mostly
3-septate. Chlamydospores absent.
156
F. circinatum www.scielo. Circinus Macro and Microconidias Mono and PolyPhialides, www.efa-dip.org, John F. Leslie and Brett A. Summerell
26. Fusarium compactum
(Wollenw.) Raillo, Fungi of the genus
Fusarium: 180 (1950)
≡Fusarium scirpi var. compactum Wollenw., Fusaria Autographice Delineata 3: 924
(1930) [MB#124046]
≡Fusarium compactum (Wollenw.) W.L. Gordon, Canadian Journal of Botany 30 (2): 224
(1952) [MB#532662]
≡Fusarium equiseti var. compactum (Wollenw.) Joffe, Plant and Soil 38: 440 (1973)
Macroconidia: abundant, thick-walled, strongly curved, 5 septa,
apicalcell elongate and tapering, curved and pointed, basal cell footshaped. Sporodochia: orange. Microconidia: absent. Chlamydospores
abundant after 2-4 weeks, on aerial hyphae or submerged in agar, in
chains or clusters
157
John F. Leslie and Brett A. Summerell , G. Hagedorn, M. Burhenne & H. I.
Nirenberg
27. Fusarium concentricum
Nirenberg & O’Donnell, Mycologia 90:
446 (1998)
Colonies on PDA show entire margin. aerial mycelium reddish-white:
velvety to lanose, reverse pale orange and reddish-grey concentric rings.
Conidia borne in false heads: later forming pale orange sporodochia on
the surface of the substrate. Conidiophores of the aerial mycelium
mainly prostrate. unbranched, with one lateral branch. usually with one
phialide. sometimes with a whorl of 4 phialides at the tip; sporodochial
conidiophores verticillately branched. Phialides of the aerial
conidiophores cylindrical, mono- and polyphialidic, sporodochial
phialides flask-shaped. Microconidia borne in the aerial mycelium
obovoid or oval to allantoid, O-1 septate. Macroconidia borne in
158
sporodochia slender, long, with a slightly beaked apical cell and a
footlike basal cell, 3-5 septate. Chlamydospores absent.
John F. Leslie and Brett A. Summerell
28. Fusarium cortaderiae
O'Donnell, T. Aoki, Kistler & Geiser, Fungal
Genetics & Biology 41 (6): 620 (2004)
Macroconidia 5-septate, straight or gradually curved, asymmetric upper
and lower halves, widest below mid-region, narrow apical peak
29. Fusarium crookwellense
Burgess, Nelson & Toussoun, Transa.
Brit. Mycol. Soci.79,498 (1982)
=Fusisporium cereale Cooke, Grevillea 6 (40): 139 (1878)
159
=Fusisporium cerealis Cooke, Grevillea 6 (40): 139 (1878)
=Gibberella roseum f. cerealis (Cooke) W.C. Snyder & H.N. Hansen, American
Journal of Botany 32: 664 (1945)
Macroconidia: abundant, pronounced dorsal curvature and straight
ventrally, 5 septa, apical cell curved and tapering and pointed , basal
cell foot-shaped. Sporodochia: pale orange –dark brown, abundant.
Microconidia: absent. Chlamydospores : abundant after 4-6 weeks,
smooth, in chains and clusters
John F. Leslie and Brett A. Summerell
30. Fusarium culmorum
(W.G. Sm.) Sacc., Sylloge Fungorum 11: 651
(1895)
=Fusisporium culmorum Wm.G. Sm., Diseases of field and garden crops,
chiefly as are caused by fungi: 209 (1884)
≡Fusariu ul oru W.G. S . M Alpi e, Agri ultural Gazette of New
South Wales 7: 299-306 (1896)
Macroconidia: abundant, relat. Short, thick-walled, dorsal curvature
and straight ventrally, 5 septa, apical cell rounded ant blunt , basal cell
notched. Sporodochia: orange –brown, abundant. Microconidia: absent.
Chlamydospores : abundant in 3-5 weeks, in hyphae and macroconidia,
in chains and clusters
160
John F. Leslie and Brett A. Summerell , G. Hagedorn, M. Burhenne & H. I.
Nirenberg, Wikipedia
31. Fusarium dactylidis. Takayuki Aoki, Martha M. Vaughan , Susan P.
McCormick Mark Busman,Todd J. Ward, Amy Kelly Kerry O'Donnell, Peter R.
Johnston and David M. Geise. at Mycologia, 2014
Colonies produce abundant loose to densely floccose aerial mycelium ;
reverse white at margin, reddish pigmentation centrally, reddish white,
pale red to violet brown. Sporodochia formed on agar surface.
Sporodochial conidia formed directly from phialides on substrate
hypha. Sporodochial conidiophores form conidia on monophialides.
Macroconidia of a single type, typically falcate and curved,
dorsiventral, 1–7-septate, usually widest at or slightly above the
midregion of their length, tapering and curving equally toward both
ends, with an acute apical cell and a distinct basal foot cell. Upper and
lower halves of conidia nearly symmetrical. Chlamydospores and
161
sclerotia absent, but round intercalary or terminal cell swellings
sometimes present in hyphae or older conidia.
32. Fusarium decemcellulare
Brick, Jahrb. Vereinig. Angew. Bot.: 227
(1908)
Macroconidia: abundant, very long, curved, thick-walled, 5-9 septa,
apicalcell rounded and blunt , basal cell foot-shaped. Sporodochia:
yellow. Microconidia:
abundant,
0-septe, in long chains.
Chlamydospores : absent
G. Hagedorn, M. Burhenne & H. I. Nirenberg
162
33. Fusarium delphinoides
Schroers, Summerb., O'Donnell & Lampr.,
Mycologia 101 (1): 57 (2009)
= Fusarium dimerum Penzig var. majusculum Wollenw., Fus. autogr.
delin. 1:90. 1916.
Colonies produce sparse white or pale orange aerial mycelium. Colony
reverse pale orange and with dark dirty orange or brown hues; often
with brownish pigment. Monophialides formed terminally or laterally
along hyphae formed well developed sporodochia, polyphialides not
seen. Microconidia mostly 0-1-septate, typically ellipsoidal, straight or
curved, allantoid. Macroconidia typically widest in the upper third, with
central and basal cells nearly straight but basal cells minutely curved,
tapering and pedicellate, distal ends mostly more strongly curved than
the proximal end and gently beaked; 0-3-septate. Chlamydospores
common, typically intercalary, solitary, in short chains or terminal, not
or rarely aggregated
34. Fusarium denticulatum
Nirenberg & O’Donnell, Mycologia 90: 445
(1998)
Colonies on PDA are funiculose. Pigmentation in reverse greyishorange to brownish-orange with the center blackish-blue.
163
Conidiophores of the aerial mycelium, prostrate, short. often identical
with phialides, sometimes branched; sporodochial conidiophores
verticillatelv branched. Phialides of the aerial conidiophores. mono- or
polyphialidic; polyphialidic openings often denticulate in a rectangular
arrangement. Macroconidia: abundant, relatively slender, slightly
curved , 5-9 septa, apical cell beaked and blunt , basal cell foot-shaped.
Sporodochia: yellow. Microconidia: abundant, long, oval, 0-1 septe
.Chlamydospores : absent
John F. Leslie and Brett A. Summerell
35. Fusarium dimerum Penzig., Michelia 2 (8): 484 (1882)
≡Fusarium aquaeductuum var. dimerum (Penz.) Raillo, Fungi of the genus Fusarium:
279 (1950)
≡Microdochium dimerum (Penz.) Arx, Transactions of the British Mycological Society 83
(2): 374 (1984)
≡Bisifusarium dimerum (Penzig) L. Lombard & Crous, Studies in Mycology 80: 225
(2015)
Macroconidia: abundant, very, short , evenly curved on both sides, 0-2
septa, apical cell rounded and often hooked, basal cell blunt .
Sporodochia: not distinct. Microconidia: absent . Chlamydospores :
rare, single, in pairs or in chains
164
www.nature.com
www.gefor.4t.com
Fusarium dimerum , Mycobank
36. Fusarium dlaminii Marasas, P.E. Nelson & Toussoun, Mycologia 77:
971 (1986)
Macroconidia: abundant in sporodochia , moderately long , thinwalled, falcate or straight, 3-5 septa, apical cell curved and tapering,
165
basal cell foot-shaped. Sporodochia: orange. Microconidia: abundant
on aerial myceliamostly fusiform non-septate and some are napiform ,
0-1 septa. Chlamydospores abundant in 4-6 weeks, single, in pairs , in
chains, or in clumps, in aerial or submerged, terminal or intercalary
John F. Leslie and Brett A. Summerell
37. Fusarium domesticum (Fr. : Fr.) Bachmann, LWT -Food Sci Tech
38:405. 2005. ?Trichothecium domesticum Fr., Syst. mycol. (Lundae) 3:427. 1832
Colonies produce scanty, felt-like to somewhat cottony aerial
mycelium. Colony reverse off-white to cream or somewhat pale yellow.
Phialides cylindrical and slightly tapering toward the tip. Macroconidia
cylindrical to ellipsoidal, straight, distally weakly tapering, rarely
rounded, typically with a laterally displaced and slightly extruding
hilum, 1- 2-septate. Microconidia clavate to pyriform, formed in small
heads on the phialide tip. Chlamydospores intercalary, subglobose, in
short chains, 1-celled or with 1 median septum.
166
38. Fusarium equiseti (Corda) Sacc., Sylloge Fungorum 4: 707 (1886)
≡Selenosporium equiseti Corda, Icones fungorum hucusque cognitorum 2: 7, t. 9:32
(1838)
=Fusarium gibbosum Appel & Wollenw., Arbeiten aus der Kaiserlichen Biologischen
Anstalt für Land- und Forstwirtschaft 8: 190 (1910)
=Fusarium caudatum Wollenw., Journal of Agricultural Research 2: 262 (1914)
=Fusarium bullatum Sherb., Memoirs Cornell Univ. Agri. Exper. Stat. 6: 198-201 (1915)
Macroconidia: abundant in sporodochia , long , slender, dorsoventral
curvature, 5-7 septa, apical cell elongate and tapering, basal cell footshaped. Sporodochia: orange. Microconidia: absent. Chlamydospores
abundant in 2 -6 weeks, single, in pairs , in chains, or in clumps, in
aerial or submerged, terminal or intercalary
Fusarium equiseti, colony on potato sucrose agar, fungi.myspecies.info
Fusarium equiseti, macroconidia, conidiogenous cells stained in lactofuchsin.
fungi.myspecies.info
167
Mycobank
draaf.lorraine.agriculture.gouv.fr
39. Fusarium ensiforme ,
Samuels, Nalim & Geiser Mycologia,. 103,
6 1302-1330 (2011);
The macroconidia arise from sporodochia, long, slightly curved with 3–
8-septate , with papillate and somewhat curved apical cell and welldeveloped foot cell. The microconidia are oval and elongated oval,
mostly 0-septate. Chlamydospores are smooth walled
Fusarium ensiforme , multiseptate macroconidiaconidia and
Chlamydospores. Samuels, Nalim & Geiser (2011);
168
40. Fusarium euwallaceae S. Freeman, Z. Mendel, T. Aoki &
O’Donnell, Mycologia 105 (6): 1599 (2013)
Colonies produce sparse aerial loose to floccose, white to yellowish
white, or reddish gray, brownish gray, or purplish gray mycelium.
Reverse pigmentation absent or pale yellow grayish orange to brownish
orange or sometimes with diffusing pigmentation of brown to reddish
brown. Microconidia ellipsoidal, fusiform-ellipsoidal to short clavate,
occasionally reniform, 0−2-septate. Macroconidia falcate to long
clavate, sometimes curved cylindrical, 1-4-septate, swollen in upper
parts, tapering toward the base, often with a round and papillate apical
cell, and a distinct foot-like basal cell. Chlamydospores formed
abundantly in hyphae and in conidia, mostly subglobose to round
ellipsoidal, intercalary or terminal, single, or often in chains, ordinary
hyaline to pale yellow, later becoming bluish to brownish when
strongly pigmented, smooth to often rough-walled.
S. Freeman, Z. Mendel, T. Aoki & O’Donnell, Mycologia 105 (6): 1599 (2013)
169
41. Fusarium falciforme (Carrion) Summerb. & Schroers, Journal of
Clinical Microbiology 40 (8): 2872 (2002)
≡Cephalosporium falciforme Carrión, Mycologia 43: 523 (1951)
≡Acremonium falciforme (Carrion) W. Gams, Cephalosporium-artige Schimmelpilze:
139 (1971)
≡Neocosmospora falciformis (Carrión) L. Lombard & Crous, Studies in Mycology 80:
227 (2015)
Colonies on malt agar off-white to pale cream, velvety or slightly
fluffy. Conidiophores sparse, more or less erect, septate, unbranched,
colourless, thin-walled, variable in length, not noticeably tapered
towards the apex. Conidiogenous cells terminal, with no distinct
collarette, producing conidia from the apex in succession. Conidia
colourless, ellipsoidal to reniform, aseptate or septate, sometimes with a
somewhat truncated base, sometimes aggregating in small groups.
'Chlamydospores' produced abundantly, sometimes in greater numbers
than conidia, either singly or in chains, terminal or intercalary,
elongated or swollen, with thin or substantially thickened walls.
Fusarium falciforme , Chehri et al., 2015
170
42. Fusarium fracticaudum
Herron, Marinc. & M.J. Wingf., . Studies
in Mycology 2015 No. 80 pp. 131-150
Macroconidia abundant, elongate, straight, 3–5 septa, apical cells
tapering, curved, basal cells distinctly notched to footshaped. Microconidia abundant, fusiform to obovoid, occasionally
curved, 0–1 septum, arranged in false heads. Conidiogenous
cells monophialidic or polyphialidic, microconidia
43. Fusarium foetens Schroers, O’Donnell, Baayen & Hooftman, Mycologia 96
(2): 398 (2004)
Macroconidia: abundant in sporodochia, falcate, 3-5 septa, apical cell
curved, basal cell rounded to foot-shaped. Sporodochia: pale- light
orange. Microconidia: ovoid, 0-septa, abundant on the aerial mycelia.
Chlamydospores few, single, terminal , smooth or verrucose
171
Fusarium foetens on OA. Densely aggregated sporodochial conidiomata, each forming
several hemispherical to allantoid conidial masses along the streaked inoculum after 14 d.
Solitary sporodochia in other parts of the colony after 28 d. and chlamydospores,micro and
macroconidia. H.-J. Schroers, Mycologia, 2004
John F. Leslie and Brett A. Summerell
44. Fusarium fujikuroi Nirenberg, Mitteilungen der Biol. Bundesanstalt
Land- Forstwirtschaft 169: 32 (1976)
172
Macroconidia: abundant in sporodochia, slender, insign. Curved,
medium length, 3-5 septa, apical cell tapered, basal cell poorly
developed. Sporodochia: orange. Microconidia: ovoid or club-shaped,
0-1 septa, abundant on the aerial mycelia. Chlamydospores : absent
A, B; colony of F. fujikuroi, C; macroconidia, D; microconidia,Tae Jin An et
al.,2013, G. Hagedorn, M. Burhenne & H. I. Nirenberg
45. Fusarium gerlachii T. Aoki, Starkey, L.R. Gale, Kistler &
O'Donnell (2007);
Fusarium gerlachii is morphologically similar to F. graminearum
including colony characters on PDA, but has slightly different conidial
features from it and other species within the F. graminearum clade.
Macroconidia 5-septate, gradually curved and often widest at the midregion, and frequently with a narrow beak at the apex
173
46. Fusarium globosum Rheeder, Marasas & P.E. Nelson, Mycologia 88: 509
(1996)
Macroconidia: abundant in sporodochia, slender-slightly curved, thinwalled, 3-5 septa, apical cell slightly curved, basal cell foot-shaped.
Sporodochia: orange. Microconidia: oval-clavate in chains, globose
more common single or in small clumps. Chlamydospores : absent.
F. globosum, www.nias.affrc.go.jp
47. Fusarium graminearum Schwabe, Flora Anhaltina 2: 285 (1839)
Macroconidia: abundant in sporodochia, slender-slightly curved, thickwalled, 5-6 septa, apical cell tapering, basal cell foot-shaped.
Sporodochia: pale orange. Microconidia: absent . Chlamydospores : are
formed in the macroconidia, finely roughened, single, in chains or
clumps
174
48. Fusarium guttiforme Nirenberg & O’Donnell, Mycologia 90:
446 (1998)
Colonies on PDA showing average mycelial growth rate; colony margin
entire. Aerial mycelium almost white. later sometimes tinged greyishviolet by the substrate; short, lanose. Pigmentation in reverse greyishorange to dark-violet. Sporulation starting early in the aerial mycelium,
conidia aggregated in false heads; sporodochia not observed.
Conidiophores of the aerial mycelium erect or prostrate, strongly
branched, branches terminating mostly in 1 or 2 phialides. Phialides of
the aerial mycelium cylindrical, monophialidic but mostly
polyphialidic. Micronidia borne in the aerial mycelium obovoid, mostly
o-septate, occasionally l-septate. Chlamydospores absent.
175
John F. Leslie and Brett A. Summerell
49. Fusarium haematococcum Nalim, Samuels & Geiser, Mycologia
103 (6): 1322 (2011)
Colonies produce abundant white, slimy sporodochia on the surface of
the agar, scant erect, mononematous, acremonium-like conidiophores
from the agar surface and the aerial mycelium. Mononematous
conidiophores unbranched, monophialidic, tip of phialide with
periclinal thickening, collarette not flared. Sporodochial conidiophores
typically repeatedly branched, ultimate branches terminating in one or
two phialides; phialides typically somewhat swollen toward the middle.
Macroonidia uniformly arcuate, apical cell often beaked; basal cell
pedicellate, 5-7septate. Perithecia subglobose, orange-red with lighter
warts, basally immersed, grossly warted, becoming cupulate or laterally
pinched when dry, gregarious. Asci clavate,, apex broad, simple,
ascospores biseriate with overlapping ends. Ascospores ellipsoidal to
subfusiform.
176
(
Nalim, Samuels & Geiser, Mycologia 103 (6): 1322 (2011)
50. Fusarium heterosporum Nees, Nova Acta Acad. Caes. Leop.-Carol.
German. Nat. Cur.: 135 (1817)
Fusisporium lolii Wm.G. Sm., Diseases of field and garden crops, chiefly as are caused
by fungi: 213 (1884))
Macroconidia: abundant, 3-5 septa, thin-walled, slender to straight .
Apical cell tapering, basal cell foot-shaped. Sporodochia: abundant,
bright orange. Microconidia: absent. Chlamydospres: absent
177
Jandial and Sumbali, 2012
G. Hagedorn, M. Burhenne & H. I. Nirenberg
51. Fusarium hostae
Geiser & Juba, Mycologia 93: 672 (2001)
Colonies form limited aerial mycelium/ Macroconidia: rare, 2-4 septa,
fulcate to fusiform . Apical cell curved or hooked, basal cell footshaped. Sporodochia: abundant, purple-yellow-pink. Microconidia:
abundant, on aerial mycelia, fusiform, 0-2 septa. Chlamydospres:
abundant in 4-6 weeks, single, in chains or clumps, interstitial or
terminal.
178
John F. Leslie and Brett A. Summerell
52. Fusarium incarnatum (Roberge) Sacc., Sylloge Fungorum 4: 712 (1886)
≡Fusisporium incarnatum Roberge ex Desm., Ann Sci Natur Bot 11: 274 (1849)
=Fusarium semitectum Berk. & Ravenel, Grevillea 3 (27): 98 (1875) [MB#179598]
=Fusarium semitectum var. semitectum (1875)
=Fusisporium pallidoroseum Cooke, Grevillea 6 (40): 139 (1878)
=Fusarium semitectum var. majus Wollenw., Fusaria Autographice Delineata 3: 907-910
(1931)
Colonies produce floccose aerial mycelium, at first whitish, later
becoming avellaneous to buff-brown; reverse pale, becoming peachcoloured. Conidiophores scattered in the aerial mycelium, loosely
branched; polyblastic conidiogenous cells abundant. Sporodochial
macroconidia slightly curved, with foot-cell, 3-7-septate. Conidia on
aerial conidiophores (blastoconidia) usually borne singly on scattered
denticles, fusiform to falcate, mostly 3-5-septate. Microconidia sparse
or absent. Chlamydospores sparse, spherical, intercalary, single or in
chains
179
Fusarium incarnatum www.ppis.moag.gov.il
53. Fusarium inflexum R. Schneid., Phytopathologische Zeitschrift 82
(1): 80 (1975)
Fusarium inflexum colony
180
G. Hagedorn, M. Burhenne & H. I. Nirenberg
181
54. Fusarium kelerajum Samuels, Nalim & Geiser, Mycologia 103 (6):
1326 (2011)
Colonies produce scanty aerial mycelium; conidia arise from scattered
mononematous acremonium-like conidiophores and from white to pale
orange, slimy sporodochia on the agar surface. Sporodochial
conidiophores richly branched, sometimes slightly stipitate;
sporodochial phialides cylindrical or slightly swollen in the
middle. Macroconidia slightly curved, tip acuminate and somewhat
strongly beaked, with a well developed foot cell, 3-9-septate.
182
55. Fusarium keratoplasticum D. Geiser, O’Donnell, Short et Zhang,
Fungal Genetics and
Biology 53 (2013) 59–70
= Cephalosporium keratoplasticum T. Morik., Mycopathologia 2(1): 66 (1939), nom. nud. (Invalid.)
=Hyalopus keratoplasticum (T. Morik.) M.A.J. Barbosa, Notarisia: 19 (1941)
Colonies produce white, salmon, peach, vinaceous grey and pale
olivaceous grey mycelium; reverse pigmentation in shades of pale
olivaceous grey, flesh, salmon, olivaceous buff, ochreous and pale
luteous. Macroconidia generally 3–5 septate, usually cylindrical and
gently curved, sometimes falcate, with dorsal and ventral lines nearly
parallel or gradually wider basally, with an acuate apical cell and a
distinct basal foot cell.Aerial conidiophores formed abundantly,
branched or unbranched; monophialides. Microconidiaconidia hyaline,
oval, fusiform, pyriform, napiform or cylindrical, 0–3 septate.
Chlamydospores formed frequently, after several weeks, in hyphae and
in conidia, mostly subglobose, often intercalary, single, frequently in
pairs, hyaline, pale to yellowish grey, smooth to rough-walled.
183
56. Fusarium konzum Zeller, Summerell & J.F. Leslie, Mycologia 95 (5): 947
(2003)
Colonies on PDA produce abundant floccose mycelium that are initially
white and become violet. Sporodochia are rare; sporodochia from leaf
pieces on CLA are pale orange. Macroconidia are not common.
Typically macroconidia are hyaline, 3–5 septate, falcate, with a
pedicellate foot cell and a slightly curved apical cell. Microconidia are
produced on monophialides and polyphialides produced laterally in the
aerial hyphae . Microconidia are produced either singly or in small false
heads consisting of 2–4 microconidia per phialide. Three types of
microconidia are produced: oval, hyaline 0–1 septate microconidia,
pyriform, 0-1 septate and larger napiform to globose, 0-septate
microconidia. Chlamydospores absent.
Zeller, Summerell & J.F. Leslie, Mycologia 95 (5): 947 (2003)
57. Fusarium kurunegalense Samuels, Nalim & Geiser, Mycologia 103
(6): 1323 (2011)
Colonies produce scanty aerial mycelium scant; conidia arising from
mononematous conidiophores scattered throughout the colony and in
white slime on the agar surface. Mononematous conidiophores
acremonium-like, septate, terminating in a single phialide; tip of
184
phialides with periclinal thickening, not flared; sometimes proliferating
to form a second phialide. Macroconidia slightly curved or arcuate, tip
more sharply hooked; basal cell typically wedge-shaped, weakly
pedicelate, 4-10-septate
Fusarium kurunegalense Samuels, Nalim & Geiser (2011)
58. Fusarium lactis Pirotta & Riboni, Arch. Lab. Bot. crittog. Pavia: 316 (1879 )
≡Fusarium moniliforme var. lactis (Pirotta & Riboni) Bilai, Mykrobiologichnyi Zhurnal
Kiev 49 (6): 7 (1987)
Macroconidia: rare, 2-4 septa, thin-walled, slender and straight to
slightly curved . Apical cell bent, basal cell notched. Sporodochia: rare,
185
light orange. Microconidia: abundant in the aerial mycelia, obvoid, 01septa, short to medium lenthg zigzag chains. Chlamydospres: absent
Leslie and Summerell , Hagedorn, Burhenne & Nirenberg
59. Fusarium langsethiae Torp & Nirenberg, Int. J.Food
Microbiol. 95
(3): 248 (2004)
Fusarium langsethiae was initially referred to as ‘powdery F. poae’ due
to its abundant production of small napiform to globose conidia, giving
the colony a powdery-like appearance. It has spore morphology similar
to F. poae. Fusarium langsethiae differs from F. poae by its slower
growth, production of fewer aerial mycelia and lack of peach-like odour
on synthetic media.The fungal colonies colour on synthetic solid media
186
range from whitish, yellowish white, pinkish white, pale red and/or
pastel red. Some of the strains can produce a pigment called
aurofusarin, which is produced by nearly all strains of F. poae and F.
sporotrichioides and influences colony colour development.
www.aya-plus.ru
www.terre-net.fr
www.bioforsk.no
Imathiu et al., 2013
60. Fusarium lateritium
Nees, System der Pilze und Schwämme: 31, t. 2:26
(1817)
Selenosporium lateritium (Nees) Desm., Flore Cryptogamique des Flandres 2: 99 (1867)
Macroconidia: rare, 2-4 septa, thin-walled, long,falcate to straight to
slightly curved with parallel walls . Apical cell hooked, basal cell footshaped or notched. Sporodochia: abundant, pale orange. Microconidia:
abundant in the aerial mycelia, elliptical, oval, spindle or club-shaped.
Chlamydospres: may be present
187
O. A. Awoyinka et al., 2012, Hagedorn, Burhenne & Nirenberg
61. Fusarium lichenicola C. Massal., Ann. Mycol. 1 (3): 223 (1903)
≡Bactridium lichenicola (C. Massal.) Wollenw., Fusaria Autographice Delineata 1: no.
456 (1916)
≡Bactridium lichenicolum (C. Massal.) Wollenw. (1916)
≡Cylindrocarpon lichenicola (C. Massal.) D. Hawksw., Bull. Brit. Museum Natural
History 6 (3): 273 (1979)
=Cylindrocarpon tonkinense Bugnic., Encyclopédie Mycologique 11: 181 (1939)
[MB#255134]
=Euricoa dominguesii Bat. & H. Maia, Anais da Soc.Biol.de Pernambuco 13 (1): 152
(1955)
=Euricoa dominguiesii Bat. & H. Maia (1955)
=Mastigosporium heterosporum R.H. Petersen, Mycologia 51: 729 (1959)
=Moeszia pernambucensis Bat., S.K. Shome & Maciel, Public. Instit. Micolo. Univ.
Recife 445: 6 (1965)
188
Colonies produce white, floccose to felted aerial mycelium, becoming
pale brown with age, and making the agar beige to dark brown with
age. Conidia produced from simple, subulate conidiogenous cells on
sparsely branched conidiophores. Conidiogenous cells with periclinal
thickening and sometimes a distinct collarette at their apices.
Macroconidia, 3-7septate, ellipsoid or obovate to cylindrical, each with
a bluntly rounded apex and distinct basal pedicel. 'Chlamydospores'
abundant, thick-walled, globose, pale brown, smooth or spinulose,
Mycobank
62. Fusarium longipes Wollenw. & Reinking, Phytopathol 15 (3): 160 (1925)
≡Fusarium scirpi var. longipes (Wollenw. & Reinking) Wollenw., Fusaria Autographice
Delineata 3: 937 (1930) [MB#277671]
≡Fusarium equiseti var. longipes (Wollenw. & Reinking) Joffe, Mycopathologia et
Mycologia Applicata 52 (1-4): 221 (1974)
Macroconidia: rare, 5-7 septa, thin-walled, extremely long, pronounced
curvure . Apical cell long and whip-like and tapering, basal cell
elongated foot-shaped. Sporodochia: large, bright orange.
Microconidia: absent. Chlamydospres: in chains or clusters
189
. Leslie and Summerell , Hagedorn, Burhenne &. Nirenberg
63. Fusarium louisianense Gale, Kistler, O’Donnell & T. Aoki, Fungal
Genetics & Biology 48: 1105 (2011)
Colonies produce abundant, dense floccose to pannose, white, reddishwhite, pale red to grayish red aerial mycelium on agar. Sporulation
abundant, from conidiophores formed directly on hyphae or aggregated
in sporodochia on or in the agar; sporodochia formed abundantly.
Conidiophores branched verticillately or unbranched, terminating with
monophialides, Phialides simple, subulate, ampulliform to subcylindric,
190
monophialidic. Conidia of a single type, typically falcate and gradually
curved, sometimes sigmoid or straight, dorsiventral, most frequently
widest at the midregion of their length, tapering and curving toward
both ends, with an arcuate apical cell and a distinct basal foot cell,
upper and lower halves asymmetric, 3-7-septate. Chlamydospores
absent
Sarver et al., 2011
64. Fusarium lunatum
(Ellis & Everh.) von Arx, Verh Konink Akad
Vetensch Amsterdam 51:101. 1957
≡Gloeosporium lunatum Ellis & Everh., Proc. Acad. Nat. Sci. Philadel 43: 82 (1891) [
≡Microdochium lunatum (Ellis & Everh.) Arx, Trans Brit Mycol So 83 (2): 374 (1984)
≡Bisifusarium lunatum (Ellis & Everhart) L. Lombard & Crous, Stud Mycol 80: 225 (2015)
=Fusarium dimerum var. violaceum Wollenw., Fusaria Autographice Delineata 3: 854
(1930)
Colonies produce sparse white aerial mycelium on agar, colony
reverse brownish yellow, brownish orange or vinaceous, dark violet or
dark carmine. Sporulation sparse; monophialides formed terminally
or laterally on hyphae, in well developed sporodochia, forming fewmembered whorls on short supporting cells; polyphialides not seen.
Microconidia mostly curved, allantoid to lunate, or less frequently
191
almost straight and ellipsoidal; curved microconidia either almost
uniformly rounded at both ends or with a minutely beaked and a slightly
pointed distal and proximal end, mostly 0- 2-septate. Macroconidia 03-septate. Chlamydospores globose to subglobose,, partly branched
chains or aggregated in irregular clusters
Fusarium lunatum, Schroers, Summerb. & O'Donnell, Mycologia 101 (1): 61
(2009)
65. Fusarium mahasenii Samuels, Nalim & Geiser, Mycologia 103 (6):
1325 (2011)
Colonies produce scanty aerial mycelium; conidia arise from
mononematous conidiophores arising from the agar surface and
sparsely from the aerial mycelium and from yellowish slimy
sporodochia on the surface of the agar. Mononematous conidiophores
acremonium-like, wide at base, tapering uniformly from base to tip; a
single phialide comprising the terminal, tip with periclinal thickening,
collarette not flared; sporodochial conidiophores richly branched,
sometimes stipitate; sporodochial phialides cylindrical or slightly
192
swollen in the middle. Macroconidia straight to slightly curved, with a
well developed foot cell, 4-6-septate
Fusarium mahasenii Samuels, Nalim & Geiser (2011);
66. Fusarium mangiferae Britz, M.J. Wingf. & Marasas, Mycologia 94 (4):
725 (2002)
Colonies forms white aerial mycelium, floccose. Reverse of colonies
sometimes rosy buff to dark purple. Conidiophores on aerial mycelium
originating erect and prostrate from substrate. Conidiophores
sympodially branched bearing mono- and polyphialides. Polyphialides
have 2–5 conidiogenous openings. Microconidia variable in shape,
obovoid conidia the most abundant type, oval to allantoid conidia
occurring occasionally . Microconidia mostly 0-1 septate , conidia
occurring less abundantly . Sporodochia present, cream and orange.
Macroconidia long and slender, usually 3–5 septate . Chlamydospores
absent.
193
Britz et al., 2002.Fusarium mangiferae. 1. Branched conidiophores bearing
polyphialides with 3 conidiogenous openings (scale bar: 5 μm). 2. Branched
conidiophores bearing mono- and polyphialides (scale bar: 5 μm). 3. Microconidia
(scale bar: 15 μm). 4. Macrocondium (scale bars: 15 μm)
67. Fusarium merismoides Corda, Icones fungorum hucusque cognitorum
2: 4, t. 8:16 (1838)
=Fusicolla merismoides (Corda) Gräfenhan, Seifert & Schroers, Studies in Mycology 68:
101 (2011)
194
Leslie and Summerell , G. Hagedorn, M. Burhenne & H. I. Nirenberg
68. Fusarium miscanthi W. Gams, Klamer & O’Donnell, Mycologia 91: 264
(1999)
Macroconidia: abundant in sporodochia, 3-5 septa, thin-walled, straight
to falcate, apical cell curved and tapering, basal cell foot-shaped.
Sporodochia: pale orange after 3 weeks. Microconidia:pyriform and
clavate, 0-septa, long chains. Chlamydospores: absent
195
John F. Leslie and Brett A. Summerell
69. Fusarium musae Van Hove, Waalwijk, Munaut, Logrieco & Moretti,
Mycologia 103 (3): 579 (2011)
Colonies produce white to vinaceous aerial mycelium. Colonies from
above and below reddish. Pseudochlamydospores single and globose, at
the ends of hyphae, conidiophores unbranched or branched, bearing
monophialidic conidiogenous cells. Microconidia abundant, borne in
chains or false heads, hyaline, claviform or ellipsoidal, often truncated,
aseptate or rarely one-septate. Sporodochia absent. Macroconidia
absent.
Fusarium musae , Van Hove, Waalwijk, Munaut, Logrieco & Moretti,
Mycologia 103 (3): 579 (2011)
196
70. Fusarium musarum
Logrieco & Marasas, Mycologia 90: 510 (1998)
Macroconidia: absent. Sporodochia: absent. Microconidia/Mesoconidia:
abundant, 2-9 septa, falcate and thick-walled with a pointed apical cell
and a conical basal cell. Microconidia: pyriform and clavate, 0-septa,
long chains. Chlamydospores: produced slowly and sparsely, smooth,
globose, single, in clusters or in chains
John F. Leslie and Brett A. Summerell
71. Fusarium napiforme Marasas, P.E. Nelson & Rabie, Mycologia 79 (6):
910 (1987)
Macroconidia: abundant in sporodochia, 3-5 septa, moderately long,
falcate, apical cell curved and tapering, basal cell foot-shaped.
Sporodochia: bright orange. Microconidia:lemon-shaped and napiform,
0-1 septa, long chains. Chlamydospores: produced slowly
197
John F. Leslie and Brett A. Summerell , Mycobank
72. Fusarium nelsonii Marasas & Logrieco, Mycologia 90: 508 (1998)
Macroconidia: abundant in sporodochia, 3-5 septa, straight or curved
and falcate, apical cell curved and beak-shaped, basal cell foot-shaped.
Sporodochia: pale cream. Microconidia: abundant, fusiform or straigt to
slightly curved, 0-3septa. Chlamydospores: abundant, produced rapidly
John F. Leslie and Brett A. Summerell
198
73. Fusarium nepalense T. Aoki, Carter, Nicholson, Kistler & O’Donnell,
Fungal Genetics & Biology 48: 1105
Colonies abundant, sometimes sparsely developed, loosely to dense
floccose, white, reddish-white, pale red to grayish red, grayish-orange
aerial mycelium. Colony margin entire to undulate, often forming
colony sectors of different growth rates. Sporodochia formed
abundantly or sparsely. Conidiophores branched or unbranched,
terminating with monophialides on the apices. Phialides simple,
subulate, ampulliform to subcylindric, monophialidic. Conidia of a
single type, typically falcate and curved, dorsiventral, most frequently
widest slightly above the midregion of their length, tapering and
gradually curving toward both ends, with an arcuate and beaked apical
cell and a distinct basal foot cell, upper and lower halves asymmetric, 37-septate. Chlamydospores absent.
Sarver BA1, Ward TJ, Gale LR, Broz K, Kistler HC, Aoki T, Nicholson P, Carter J, O'Donnell
K Fungal Genet Biol.
199
74. Fusarium nisikadoi T. Aoki & Nirenberg, Mycoscience 38 (3): 330 (1997)
Macroconidia: abundant in sporodochia, 1-9 septa, long, straight and
falcate, apical cell curved and beak-shaped, basal cell foot-shaped.
Sporodochia: rare, orange. Microconidia: abundant,occasionaly
pyriform 0-3septa , commonly clavate, long chain, often
zigzag.Chlamydospores: absent
75. Fusarium nurragi (Summerell & L.W. Burgess) Benyon, Summerell &
L.W. Burgess, Mycological Research 104 (10): 1171 (2000)
Macroconidia: abundant in sporodochia, 5- septa, long, thin and whiplike, straight and falcate, apical cell long and tapering, basal cell
elongate foot-shaped. Sporodochia:
orange. Microconidia: absent.
Chlamydospores: absent
200
76. Fusarium nygamai L.W. Burgess & Trimboli, Mycologia 78: 223 (1986)
Macroconidia: abundant in sporodochia, 5-septa, moderately long,
straight to slightly curved, apical cell short and tapering, basal cell
notched or foot-shaped. Sporodochia: abundant, orange. Microconidia:
small, oval or club-shaped, 0-1 septa. Chlamydospores: rare to abundant
Mycobank
77. Fusarium oxysporum Schltdl., Flora Berolinensis, Pars secunda:
Cryptogamia: 106 (1824)
=Fusarium bulbigenum Cooke & Massee, Grevillea 16 (78): 49 (1887)
=Fusarium orthoceras Appel & Wollenw., aus der Kaiserlichen Biologischen Anstalt für
Land- und Forstwirtschaft 8: 152 (1910)
=Fusarium citrinum Wollenw., Bull. Maine Agric. Exp. Sta.: 256 (1913)
=Fusarium angustum Sherb., Memoirs of the Cornell University Agricultural
Experimental Station 6: 203 (1915)
=Fusarium oxysporum var. longius Sherb., Memoirs of the Cornell University
201
Agricultural Experimental Station 6: 223 (1915)
=Fusarium lutulatum Sherb., Memoirs of the Cornell University Agricultural
Experimental Station 6: 209 (1915)
=Fusarium lutulatum var. zonatum Sherb., Memoirs of the Cornell University
Agricultural Experimental Station 6: 214 (1915)
=Fusarium bostrycoides Wollenw. & Reinking, Phytopathology 15 (3): 166 (1925)
=Diplosporium vaginae Nann., Atti Reale Accad. Fisiocrit. Siena: 491 (1926)
Macroconidia: abundant in sporodochia, 3- septa, thin-walled, short to
moderately long, straight , apical cell short and slightly hooked, basal
cell notched or foot-shaped. Sporodochia: abundant, pale orange .
Microconidia: small, oval , elliptical or kidney-shaped, 0- septa.
Chlamydospores: abundant
202
Mycobank
G. Hagedorn, M. Burhenne & H. I. Nirenberg
78. Fusarium phyllophilum Nirenberg & O’Donnell, Mycologia 90: 447
(1998)
Colonies produce white aerial mycelium, later tinged greyish-violet;
lanose to funiculose. Pigmentation in reverse in some isolates greyishwhite or greyish-orange to greyish-violet, or greyish-violet to bluishgrey. Sclerotia absent. Conidiophores of the aerial mycelium prostrate
and erect, unbranched, with one lateral branch or verticillately
branched, terminating mostly in 1 to 3 phialides, cells beneath the
phialides often swollen; sporodochial conidiophores absent. Phialides of
the aerial mycelium cylindrical, mono- and polyphialidic. Microconidia
borne in the aerial mycelium clavate, mostly O-septate. occasionally 12-septate. Macroconidia few thin. falcate up to 5-septate.
Chlamydospores absent.
203
John F. Leslie and Brett A. Summerell
79. Fusarium penzigii Schroers, Summerb. & O'Donnell, Mycologia 101 (1):
61 (2009)
Aerial mycelium sparse, white, felt-like to cottony. Monophialides
formed terminally or laterally on hyphae, in well developed
sporodochia, forming few whorls on short supporting cells,
polyphialides sometimes observed in several week old, well developed
sporodochia. Microconidia mostly 0-1-septate, typically ellipsoidal,
straight or curved, allantoid. Macroconidia typically widest in the upper
third or the middle, with central part minutely curved or nearly straight,
a pointed and mostly beaked distal end and a slightly pedicellate and
curved proximal end; 0-3-septate. Chlamydospores common, typically
intercalary, solitary, in short chains or terminal, rarely in groups.
204
80. Fusarium petroliphilum: (Q.T. Chen & X.H. Fu) D. Geiser,
O’Donnell, Short et Zhang,
Microconidia formed directly on the side of hyphae in the pionnotal
mycelium, 0-septate, oval, ellipsoid, and reniform, long conidiophores
and macroconidia typical for members of the FSSC
81. Fusarium pininemorale Herron,
Herron, Marinc. & M.J.
Wingf., Studies in Mycology 2015 No. 80 pp. 131-150.
.
Macroconidia abundant, elongate, straight, with 3–4 septa, apical cells
tapering, curved, basal cells foot-shaped, elongated foot shape, barely to
205
distinctly notched. Microconidia scarce, fusiform to obovoid, 0–1 septa,
arranged in false heads. Conidiogenous cells monophialidic or
polyphialidic,
.
82. Fusarium poae (Peck) Wollenw., Bull. Maine Agric. Exp. Sta.: 254 (1914)
≡Sporotrichum poae Peck, Bulletin of the New York State Museum 67: 29 (1903)
[MB#206241]
≡Fusarium tricinctum f. poae (Peck) W.C. Snyder & H.N. Hansen, American Journal of
Botany 32: 663 (1945) [MB#351715]
≡Fusarium sporotrichiella var. poae (Peck) Bilai, [Poisonous fungi on cereal seed]: 86
(1953) [MB#448746]
≡Fusarium sporotrichiella var. poae (Peck) Bilai, Mykrobiologichnyi Zhurnal Kiev 49 (6):
6 (1987) [MB#353477]
=Sporotrichum anthophilum Peck, Bulletin of the New York State Museum 105: 28
(1906)
Macroconidia: sparse, 3- 5 septa, slender and short, fulcate to lunate,
apical cell curved and tapering, basal cell foot cell well developed.
Sporodochia: absent. Microconidia: abundant, globose to napiform, 0-1
septa . Chlamydospores: rare, in clumps or chains in mycelium of old
cultures
206
G. Hagedorn, M. Burhenne & H. I. Nirenberg
83. Fusarium polyphialidicum Marasas, P.E. Nelson, Toussoun & P.S.
van Wyk, Mycologia 78 (4): 678 (1986)
Macroconidia: abundant, large, 3-7 septa, slightly falcate, thick-walled,
apical cell curved and tapering, basal cell foot-shaped. Sporodochia:
white to pale orange. Microconidia: abundant in the aerial mycelia,
fusiform or subclavate, 0-3 septa. Chlamydospores: in pairs, clumps or
chains
207
84. Fusarium proliferatum (Matsush.) Nirenberg,
Biologischen
Bundesanstalt für Land- und Forstwirtschaft 169: 38 (1976)
≡Cephalosporium proliferatum Matsush., Microfungi of the Solomon Islands and
Papua-New Guinea: 11 (1971)
≡Fusarium proliferatum (Matsush.) Nirenberg ex Gerlach & Nirenberg, Mitteilungen der
Biologischen Bundesanstalt für Land- und Forstwirtschaft 209: 309 (1982)
Macroconidia: in chains of moderate length, thin-walled, straight, 3-5
septa, apical cell curved, basal cell poorly developed,. Sporodochia:
pale orange. Microconidia, club-shaped to pyriform, 0-septa, may be in
chains. Chlamydospores: absent
208
www.ppis.moag.gov.il www.ppis.moag.gov. jcm.asm.org G. Hagedorn, M.
Burhenne & H. I. Nirenberg, Ferrer et al., 2005
85.Fusarium pseudensiforme
Samuels, Nalim & Geiser, Mycologia
103 (6): 1323 (2011)
Colonies produce scanty aerial mycelium; conidiophores arising
abundantly in the aerial mycelium and in white slimy sporodochia on
the agar surface. Phialides arise from conidiomata, cylindrical or
somewhat swollen in the middle. Macroconidia arise from sporodochia,
0-8-septate, typically slightly curved with a well developed foot cell.
209
Fusarium pseudensiforme Samuels, Nalim & Geiser (2011);
86. Fusarium pseudocircinatum Nirenberg & O'Donnell, Mycologia 90:
448 (1998)
Macroconidia: abundant, slender, slightly falcate, thin-walled, apical
cell beaked, basal cell foot-shaped Sporodochia: sparseMicroconidia:
abundant, oval, 0-1 septa
John F. Leslie and Brett A. Summerell
87. Fusarium pseudograminearum O'Donnell & T. Aoki, Mycologia 91
(4): 604 (1999)
Macroconidia: slender, almost straight to moderately curved, 1-11
septa, apical cell curved, basal cell foot-shaped. Sporodochia: abundant,
pale orange. Microconidia: absent. Chlamydospores: abundant within 4
weeks
210
Colony morphology (a) and macroconidia of Fusarium pseudograminearum,
Saremi et al., 2007
John F. Leslie and Brett A. Summerell
88. Fusarium pseudonygamai
Nirenberg & O'Donnell, Mycologia 90:
449 (1998)
Macroconidia: rare, 3-4 septa, fusoid, apical cell gapering, basal cell
poorly foot-shaped. Sporodochia: rare. Microconidia: abundant in the
aerial mycelia, obvoid to clavate, 0-septa. Chlamydospores: absent
211
John F. Leslie and Brett A. Summerell
89. Fusarium ramigenum Nirenberg & O'Donnell, Mycologia 90: 451 (1998)
Macroconidia: rare, 5- septa, falcate, apical cell bent, basal cell notched.
Sporodochia: rare. Microconidia: abundant in the aerial mycelia,
obvoid, 0-1 septa. Chlamydospores: absent
John F. Leslie and Brett A. Summerell
90. Fusarium rectiphorum Samuels, Nalim & Geiser, Mycologia 103
(6): 1324 (2011)
=Fusarium rectiphorus Samuels, Nalim & Geiser, Mycologia 103 (6): 1324 (2011)
Colonies produce scanty aerial mycelium; conidia produced by erect,
mononematous conidiophores arising from the surface of the colony
212
and sparingly in the aerial mycelium and from cream-coloured
sporodochia on the surface of the agar. Mononematous conidiophores
unbranched and acremonium-like or branched, or branched once or
twice and each branch terminating in two or three phialides, or phialides
arising directly from the lower half of the acremonium-like
conidiophore. Macroconidia slightly curved, more strongly at tip, basal
cell pedicellate, 3-8-septate
Samuels et al., 2011
213
91. Fusarium redolens Wollenw., Phytopathology 3 (1): 29 (1913)
≡Fusarium oxysporum var. redolens (Wollenw.) W.L. Gordon, Canadian Journal of
Botany 30 (2): 238 (1952)
Macroconidia: abundant, 3-5 septa, thick-walled, upper third wide,
apical cell hooked, basal cell foot-shaped. Sporodochia: sparse, pale
brown. Microconidia: common in the aerial mycelia, oval to cylidrical,
0-1 septa. Chlamydospores: absent
John F. Leslie and Brett A. Summerell ,Truman Univ. Feng Pan,et al.,2015 G.
Hagedorn, M. Burhenne & H. I. Nirenberg
92. Fusarium sacchari (E.J. Butler) W. Gams, Cephalosporium-artige
Schimmelpilze: 218 (1971)
Macroconidia:sparse, 3- septa, thick-walled, slender, apical cell curved,
basal cell poorly developed. Sporodochia: sparse, orange. Microconidia:
214
abundant, common in the aerial mycelia, oval, 0- 2 septa.
Chlamydospores: absent
Leslie JF, Summerell BA, Bullock S, Doe FJ,Mycologia, 2—5, G. Hagedorn, M.
Burhenne & H. I. Nirenberg
93. Fusarium sambucinum Fuckel, Hedwigia 2 (15): 135, Fung. Rhen. no
211 (1863)
=Fusarium roseum Link, Magazin der Gesellschaft Naturforschenden Freunde Berlin 3:
10, t. 1:10 (1809)
=Fusarium sulphureum Schltdl., Flora Berolinensis, Pars secunda: Cryptogamia: 139
(1824)
=Fusarium sambucinum var. sambucinum , Jahrbücher des Nassauischen Vereins für
Naturkunde 23-24: 167 (1870) [
=Fusarium trichothecioides Wollenw., Journal of the Washington Academy of Sciences
2: 147 (1912)
=Fusarium sambucinum var. minus Wollenw., Fusaria Autographice Delineata 3: 941
215
(1930)
=Fusarium sambucinum f. 2 Wollenw., Fusaria Autographice Delineata 3: 942 (1930)
=Fusarium sambucinum var. medium Wollenw., Zeitschrift für Parasitenkunde 3: 358
(1931)
=Fusarium sambucinum f. 6 Wollenw., Zeitschrift für Parasitenkunde 3: 358 (1931)
Macroconidia: abundant in sporodochia, 3-5 septa, falcate, slender,
short, apical cell pointed, basal cell foot-shaped. Sporodochia: orange,
common. Microconidia: oval, 0-1 septa. Chlamydospores: in chains or
clusters
ddis.ifas.ufl.edu
G. Hagedorn, M. Burhenne & H. I. Nirenberg
94. Fusarium scirpi Lambotte & Fautrey, Revue Mycol. (Toulouse): 111 (1894)
Macroconidia: abundant, long. slender, thin-walled, curved, 6-7 septa,
apical cell tapering and elongate, basal cell foot-shaped. Sporodochia:
216
orange. Microconidia: club-shaped on short phialides. Chlamydospores:
abundant, in clumps or chains
John F. Leslie and Brett A. Summerell
95. Fusarium semitectum Berk. & Ravenel, Grevillea 3 (27): 98 (1875)
≡Pseudofusarium semitectum (Berk. & Ravenel) Matsush., Icones Microfungorum a
Matsushima lectorum: 119 (1975)
=Fusisporium incarnatum Roberge ex Desm., Annales des Sciences Naturelles
Botanique 11: 274 (1849)
=Fusarium semitectum var. semitectum (1875)
=Fusisporium pallidoroseum Cooke, Grevillea 6 (40): 139 (1878)
=Fusarium semitectum var. majus Wollenw., Fusaria Autographice Delineata 3: 907-910
(193]
Macroconidia: abundant, slender, curved dorsal surface, 3-5 septa,
apical cell curved and tapering , basal cell foot-shaped. Sporodochia:
orange. Microconidia: pyriform, 1-septa, mesoconidia spindle-shaped,
3-5 septa. Chlamydospores: globose
217
file.scirp.org, ecoport.org, Galería de imágenes, EcoPort Picture, Databank
96. Fusarium sibiricum Gagkaeva, Burkin, Kononenko, Gavrilova,
O'Donnell, T. Aoki, et Yli-Mattila, International Journal of Food Microbiology
147: 64 (2011)
Colonies produce sparse to floccose aerial mycelium on PSA, more
abundant centrally, often crateriform with bald spot in the very centre of
colonies. Colour of aerial mycelium white, sometimes with a tint of
orange grey. Reverse with white to cream shades. Conidiophores
formed in aerial mycelium or on running hyphae on the agar, erect or
prostrate, at first unbranched, later branched densely terminating with
ampuliform monophialides, having a noticeable collarette and rarely
with cylindrical, straight monophialides. Conidiophores often consist of
a long and nodose stipe terminating with a whorl of phialides,
intermingled with the short monophialides formed directly on the aerial
mycelium. Polyphialides not observed. Microconidia apiculate and
globose, mostly one-celled, hyaline, formed abundantly in false heads;
218
0-septate. Multiseptate macroconidia. sporodochia. chlamydospores and
sclerotial bodies absent.
Mattila et al., 2011
97. Fusarium sinensis Z.H. Zhao & G.Z. Lu, Mycologia 100 (5): 747
(2008)
Colonies are villous-floccose, yellow brown in the center and rose-tocarmine often with a white margin. Colony reverse red brown.
Conidiophores single or simply branched on the aerial mycelium and
monophialidic. Two types of microconidia are formed: fusiform-toreniform
and
napiform-to-pyriform,1-2-septate,
formed
on
monophialides. Macroconidia rare, straight or slightly curved; 3-septate,
219
apical cells slightly curved and narrowing to a point; basal cells footshaped to distinctly notched. Chlamydospores found in chains or
clumps, oval to globose, hyaline to pale brown, smooth to warted.
Zhao and Lu, 2008
98. Fusarium solani (Mart.) Sacc., Michelia 2 (7): 296 (1881)
≡Fusisporium solani Mart., Die Kartoffel-Epidemie der letzten Jahre oder die Stockfäule
und Räude der Kartoffeln: 20 (1842)
≡Fusarium solani (Mart.) Appel & Wollenw., Kaiserlichen Biologischen Anstalt für
Land- und Forstwirtschaft 8: 64-78 (1910)
≡Neocosmospora solani (Martius) L. Lombard & Crous, Studies in Mycology 80: 228
(2015)
=Fusarium martii Appel & Wollenw., Arbeiten aus der Kaiserlichen Biologischen Anstalt
für Land- und Forstwirtschaft 8: 83 (1910)
=Nectria cancri Rutgers, Ann. Jard. Bot. Buitenzorg, II: 59 (1913)
220
=Fusarium striatum Sherb., Memoirs of the Cornell University Agricultural Experimental
Station 6: 255 (1915)
=Fusarium solani var. minus Wollenw., Fusaria Autographice Delineata 1: 403 (1916)
=Fusarium solani f. 2 W.C. Snyder, Zentralblatt für Bakteriologie und Parasitenkunde
Abteilung 2 91: 174 (1934)
=Cephalosporium keratoplasticum T. Morik., Mycopath. Mycol. appl.: 66 (1939)
=Fusarium solani f. keratitis Y.N. Ming & T.F. Yu, Acta Microbiologica Sinica 12: 184
(1966)
=Cylindrocarpon vaginae C. Booth, Y.M. Clayton & Usherw., Proc. Indian Acad.
Sciences (Plant Sciences) 94 (2-3): 436 (1985)
Macroconidia: abundant, wide, straight or slightly curved , 3-7 septa,
apical cell blunt and round, basal cell foot-shaped or cylindrical with
notched end. Sporodochia: abundant, cream, blue or green.
Microconidia: oval to fusiform, 0-2 sept. Chlamydospores: abundant, in
2-4 weeks, single, in pairs, in clumps or chains, terminal or intercalary
www.mycology.adelaide.edu.au, www.pf.chiba-u.ac.jp, Mycoya, Mycobank,
Br J Ophthalmol. 2002, Mycobank
221
99. Fusarium sororula
Herron, Marinc. & M.J. Wingf., Studies in
Mycology 2015 No. 80 pp. 131-150
Macroconidia scarce, elongate, straight, with 1–3 septa, apical cells
hooked, basal cells foot-shaped, barely to distinctly notched, some
producing secondary conidia. Microconidia abundant, fusiform to
obovoid or pyriform, arranged in false heads, with 0–1
septum. Conidiogenous cells monophialidic or polyphialidic.
100. Fusarium sporotrichioides Sherb., Memoirs of the Cornell
University Agricultural Experimental Station 6: 183 (1915)
≡Fusarium sporotrichiella var. sporotrichioides (Sherb.) Bilai, [Poisonous fungi on cereal
seed]: 87 (1953)
Colonies produce profuse white to pale red mycelium. Macroconidia
abundant in orange sporodochia, falcate to lunate,3-5 septate, apical cell
curved and tapering, basal cell poorly developed. Microconidia
222
produced from mono- or polyphialides, pyriform 0-1 septate or fusiform
up to 5-septate. Chlamydospores abundant.
www.drjacksonkungu.com www.flickr.com John F. Leslie and Brett A. Summerell
www.marmaramedicaljournal.org G. Hagedorn, M. Burhenne & H. I. Nirenberg
101. Fusarium sterilihyphosum Britz, Marasas & M.J. Wingf.,
Mycologia 94 (4): 726 (2002)
Colonies on PDA, aerial mycelium almost white, reverse straw to
grayish rose and light purple. Conidiophores on aerial mycelium erect,
occasionally prostrate. Conidiophores sympodially branched bearing
mono- and polyphialides. Phialides on aerial conidiophores mono- and
polyphialidic. Sterile hyphae present. Microconidia obovoid, oval to
allantoid, 0-1 septate, abundant. Sporodochia rare, cream. Macroconidia
slightly beaked apical cells, a footlike basal cell, 3–5 septate.
Chlamydospores absent.
223
John F. Leslie and Brett A. Summerell, Britz et al., 2002
102. Fusarium subglutinans (Wollenw. & Reinking) P.E. Nelson, Toussoun
& Marasas, Fusarium species, an illustrated manual for identification: 135 (1983)
≡Fusarium moniliforme var. subglutinans Wollenw. & Reinking, Phytopathol 15 (3): 163
(1925)
≡Gibberella fujikuroi var. subglutinans (Wollenw. & Reinking) E.T. Edwards, Agri.
Gazette of New South Wales 44 (12): 896 (1933)
≡Fusarium neoceras var. subglutinans (Wollenw. & Reinking) Raillo, Fungi of the genus
Fusarium: 263 (1950)
≡Fusarium sacchari var. subglutinans (Wollenw. & Reinking) Nirenberg, Mitteil. Biolog.
Bund.. Land- un. Forstwirt. 169: 53 (1976)
≡Gibberella subglutinans (E.T. Edwards) P.E. Nelson, Toussoun & Marasas, Fusarium
species, an illustrated manual for identification: 135 (1983)
Colonies produce white mycelium, becomes violate in old cultures.
Macroconidia sparse, in tan-orange sporodochia, slender, slighltly
falcate, thin-walled, apical cell curves, basal cell poorly developed.
224
Microconidia in false heads from mon- and polyphialides, oval 0septate or fusiform 2-3 septate. Chlamydospores absent
Nelson et al., 1983, Mycobank
103. Fusarium succisae
(J. Schröt.) Sacc., Sylloge Fungorum 10: 724
(1892)
≡Fusisporium succisae J. Schröt., Hedwigia: 180 (1874)
≡Fusarium subglutinans var. succisae (J. Schröt.) F.J. Chen, Variation within Fusarium
section Moniliforme (= Liseola) [Ph.D.Thesis]: 150 (1991)
Colonies produce white mycelium, turne grey-violate and red, and
bright orange sporodochia. Macroconidia sparse, falcate to u-shaped
curved,3-septate, basal cell foot-shaped, apical cellcurved and tapering.
Microconidia abundant,oval or ellipsoid, 0-2 septate, in false heads on
mono- or polyphialides. Chlamydospores absent
225
G. Hagedorn, M. Burhenne & H. I. Nirenberg
226
104. Fusarium temperatum J. Scauflaire & F. Munaut, Mycologia 103
(3): 593 (2011)
Colonies produce yellowish orange sporodochia. Agar pigmentation
ranges from colorless to dark purple on OA; pigmentation of colony
reverse is in shades of light pink. Aerial mycelium cottony, initially
white, becoming pinkish white, turning violet in the colony center in a
later stage. Conidiophores in the aerial mycelium erect, branched,
terminating in 1-3 phialides. Microconidia oval, abundant, grouped in
masses; hyaline and non-septate. Macroconidia hyaline, with 3-6,
slender, slightly falcate, with a beaked, curved apical cell and a footlike basal cell, thin cell wall. Polyphialides and monophialides are
present. Chlamydospores absent.
Fusarium temperatum colonies. Al-Hatmi et al., 2014
Fusarium temperatum, Scauflaire et al., 2011
227
105. Fusarium thapsinum Klittich, J.F. Leslie, P.E. Nelson & Marasas,
Mycologia 89: 644 (1997)
Colonies produce white mycelium, violete pigments with age.
Sporodochia rare, pale orange. Macroconidia rare, slender, falcate or
straight, thin-walled, 3-5-septate, apical cell curved and tapering, foot
cell poorly-shaped, Microconidia abundant, on monophiliedes, clubshaped, 0-septate. Chlamydospores absent
Fusarium thapsinum Klittich, J.F. Lesl
106. Fusarium torreyae. Aoki T , Smith JA, Mount LL, Geiser
DM, O'Donnell K. Mycologia. 2013,105(2):312-9
Colonies produce loosely floccose, sometimes funiculose, white to
yellowish white mycelium. Pigmentation in the reverse pale yellow, or
light orange, grayish orange, orange to reddish orange. Sporodochial
conidiophores verticillately or irregularly branched, forming apical
monophialides or sometimes intercalary phialides. Macroconidia
variable in morphology, 1–9-septate, falcate and curved, often long and
slender and cylindrical, dorsiventral, often widest around the midregion
of their length, tapering gradually toward both ends, with an acuminate
apical cell and a distinct foot-like basal cell. Chlamydospores present or
absent, smooth to rough, thick-walled, intercalary or terminal, solitary,
in pairs or catenate.
228
Aoki et al., 2013
107. Fusarium torulosum (Berk. & M.A. Curtis) Gruyter & J.H.M.
Schneid., Jaarboek. Plantenziektenkundige Dienst: 135 (1991)
≡Fusidium torulosum Berk. & M.A. Curtis, Grevillea 3 (27): 112 (1875) [MB#207053]
≡Fusoma torulosum (Berk. & M.A. Curtis) Sacc., Sylloge Fungorum 4: 220 (1886)
≡Fusarium torulosum (Berk. & M.A. Curtis) Nirenberg, Mycopathol129 (3): 136 (1995)
=Fusarium sambucinum var. coeruleum Wollenw., Annales Mycologici 15 (1-2): 55
(1917)))
Colonies produce initially white lannose mycelium, red pigments in
agar.Sporodochia orange. Macroconidia abundant, short, falcate, 5septate, apical cell pointed, basal cell foot-shaped. Microconidia rare,
oval, on monophilides, 0-1-septate, single or in false heads.
Chlamydospores abundant
229
108. Fusarium tricinctum (Corda) Sacc., Sylloge Fungorum 4: 700 (1886)
≡Selenosporium tricinctum Corda, Icones fungorum hucusque cogn 2: 7, t. 9:33 (1838)
≡Fusarium sporotrichioides var. tricinctum (Corda) Raillo, Fungi of the genus Fusarium:
197 (1950)
≡Fusarium sporotrichiella var. tricinctum (Corda) Bilai, [Poisonous fungi on cereal seed]:
87 (1953)
≡Fusarium sporotrichiella var. tricinctum (Corda) Bilai, Mykrobiologichnyi Zhurnal Kiev
49 (6): 7 (1987)
=Fusarium citriforme Jamal., Valt. Maatalousk. Julk.: 11 (1943)
Colonies form dense white mycelium, become pink, red or purple.
Sporodochia pale orange, abundant. Macroconidia abundant, slender to
falcate, 3-5 –septate, apical cell curved and tapering, basa; cell footshaped. Microconidia abundant, napiform, oval, pyriform and citriform,
0-1-septate, may be clustered in false heads. Chlamydospores found
singly or in chains
www.invasive.orgwww.andrewmccullagh.com
draaf.lorraine.agriculture.gouv.fr, en.engormix.com
230
109. Fusarium tupiense Lima, Pfenning & Leslie, Mycologia 104
(6): 1414 (2012)
Colonies produce white, in some cultures grayish violet; hairy to
lanose-funiculose aerial mycelium. Pigmentation in reverse grayish
white to gray to dark violet. Microconidia borne in the aerial mycelium
mostly obovoid, occasionally oval to allantoid, 0-3 –septate, aggregated
in false heads. Conidiophores on aerial mycelia erect, occasionally
prostrate, sympodially branching, branches terminating in up to five
phialides, often proliferating and associated with coiled sterile hyphae;
phialides of aerial conidiophores cylindrical, mono- and polyphialidic.
Sporodochia cream to orange. Sporodochial conidiophores verticillately
branched. Macroconidia slightly beaked in the apical cells, with a footlike basal cell, 3-5 septate. Chlamydospores absent.
Lima et al., 2012
110. Fusarium udum E.J. Butler, Mem. Dept. Agric. India: 54 (1910)
≡Fusarium oxysporum f.sp. udum (E.J. Butler) W.C. Snyder & H.N. Hansen, American
Journal of Botany 27: 66 (1940) [MB#509372]
=Fusarium uncinatum Wollenw., Annales Mycologici 15 (1-2): 54 (1917)
Colonies form white mycelium with pink to purple pigments in the
agar, pink to salmon sporodochia. Macroconidia abundant in
sporodochia, straight to fulcate, thin-walled, 1-5-septate, apical cell
curved-hooked, basal cell foot-shaped. Microconidia sparse, fusiform or
oval, 0-1 septate. Chlamydospores single or in clusters.
231
John F. Leslie and Brett A. Summerell , G. Hagedorn, M. Burhenne & H. I.
Nirenberg
111. Fusarium ussurianum T. Aoki, Gagkaeva, Yli-Mattila,
Kistler & O'Donnell, Mycologia 101 (6): 841-852 (2009)
Colonies produce loose to densely floccose, white, reddish-white,
brownish-yellow, brownish-orange to grayish-brown mycelium.
Conidiophores branched verticillately or unbranched, forming
monophialides. Phialides simple, subulate, ampulliform to
subcylindrical, sometimes doliiform, monophialidic. Conidia of a single
type, typically falcate and curved, dorsiventral, most frequently widest
slightly above the mid-region of their length, mostly tapering and
curving equally toward both ends, with an arcuate apical cell and a
distinct basal foot cell, forming symmetrical upper and lower halves, 17-septate. Chlamydospores and sclerotia absent but some globose
232
hyphal swelling sometimes present, intercalary or occasionally
terminal.
Fusarium ussurianum , T. Aoki et a;. (2009)
112. Fusarium venenatum Nirenberg, Mycopathologia 129 (3): 136 (1995)
Colonies produce long, dense, cottony, white toorange, gray or red
mycelium, Red pigments. Sporodochia abundant, reddish brown to
brown. Macroconidia abundant, short, slender, 5-septate.
Microconidia absent. Chlamydospores abundant, singly and in chains
twicemice.com
233
113. Fusarium virguliforme O'Donnell & T. Aoki, Mycologia 95 (4):
667 (2003) [MB#489315]
≡Neocosmospora virguliforme (O'Donnell & T. Aoki) L. Lombard & Crous, Studies in
Mycology 80: 228 (2015)
Colonies are white to yellowish-white or pale yellow, sometimes with
bluish-gray. Aerial mycelium sparse or sometimes developed
abundantly, then loose to dense floccose. Colony margin entire to often
undulate. Reverse pigmentation often absent, sometimes grayish,
grayish-orange to brownish-orange or olive brown to yellowish-brown.
Yellowish exudate sometimes present. Chlamydospores formed
abundantly in mycelium and in conidia, mostly subglobose, intercalary
or terminal, mostly single, rarely in chains, hyaline to pale or paleyellow, smooth to rough-walled. sporodochia normally formed
abundantly. Aerial conidiophores unbranched or sparsely branched,
forming monophialides integrated in the apices. Aerial phialides simple,
subulate to subcylindrical, often with a conspicuous collarette at the tip.
Macroconidia typically falcate, dorsiventral, most frequently widest at
the midregion of their length, often tapering and curving equally toward
both ends, with the apex and foot cell typically similarly pointed and
often indistinguishable, 2-5-septate. Microconidia comma-shaped to
sometimes short-clavate, with a swollen apex often rounded but rarely
pointed and with a tapering and curving base, 0--2-septate.
Fusarium virguliforme Kevin Bugg, 2010, www.cals.ncsu.edu
234
114. Fusarium verticillioides (Sacc.) Nirenberg, Mitteilungen der
Biologischen Bundesanstalt für Land- und Forstwirtschaft 169: 26 (1976)
≡Oospora verticillioides Sacc., Fung. Ital.: fig. 789 (1881)
≡Alysidium verticillioides (Sacc.) Kuntze, Revisio generum plantarum 3: 442 (1898)
≡Alysidium verticilliodes (Sacc.) Kuntze (1898)
=Fusarium moniliforme J. Sheld., Annual Report of the Nebraska Agricultural
Experimental Station 17: 23 (1904)
=Fusarium celosiae Abe, Mem. Coll. Agric. Kyoto Univ.: 51-64 (1928)
=Oospora cephalosporioides Luchetti & Favilli, Ann. Fac. Agrar. R. Univ. Pisa N.S.: 399
(1938)
Colonies produce white mycelium, violete pigmenta with age.
Macroconidia rare, in pale orange sporodochia, long. Slender,thinwalled, 3-5-septate, apical cell curved and pointed, basal cell notched to
foot-shaped. Microconidia, monophilides abundant on the aerial
mycelium, club-shaped, 0-septate. Chlamydospores absent
115. Fusarium vorosii B. Tóth, Varga, Starkey, O'Donnell, H. Suga & T.
Aoki, Fungal Genetics & Biology 44 (11): 1191-1204 (2007)
Fusarium vorosii is morphologically similar to F. graminearum including
colony characters on PDA, but has slightly different conidial features from it.
Macroconidia 5-septate, typically straight but sometimes gradually curved
and frequently widest above the mid-region.
O’Donnell et al 2008
235
116. Fusarium xylarioides Steyaert, Bulletin de la Société Royale de
Botanique de Belgique 80 (1-2): 42 (1948) [MB#286515]
≡Fusarium oxysporum f.sp. xylarioides (Steyaert) Delassus, Bull. Sci. Minist. Colon. Sect.
Agric. trop.: 347 (1954)
≡Fusarium oxysporum f. xylarioides (Steyaert) Delassus, Bull. sci. Minist. Colon. Sect.
Agric. trop.: 347 (1954)
≡Fusarium lateritium f.sp. xylarioides (Steyaert). Gordon, Canad J Bot 43, 1317 (1965)
Schroers et al., 2009
236
www.ppis.moag.gov.il www.drjacksonkungu.com www.ianrpubs.unl.edu
237
11. Fusarium books
238
239
240
241
242
12. Research projects
1. Intestinal toxicity and oral resorption of conjugated Fusarium mycotoxins,
frequently found in food & feed, Gent University
Promotor: Siska Croubels (UGent)
Within this project the first focus will lay on the synthesis and isolation of
glycosylated derivates of deoxynivalenol (DON) and zearalenone (ZEN) as well as
acetylated DON derivates, and this in amounts sufficient to conduct further in
vitro and in vivo trials.These synthesized masked mycotoxins will be utilized to
determine the intestinal cytotoxicity and the influence on the cytokine response of
these compounds. In a further stage, the oral bioavailability and in vivo degree of
hydrolysis will be determined of these conjugated toxins by using in vitro en in
vivo toxicokinetic models. Pigs and chickens will serve as target animals as these
animals have the highest natural exposure to these toxins and are economically
243
relevant. Additionally, pigs can serve as a model for human toxicokinetics.The
research will generate data concerning the toxicokinetic en toxicological properties of
masked mycotoxins. Based on these properties one can make a more informed
decision on the potential need to include these compounds in routine controls, and
possibly legislation.
2. Rapid multiplex detection of toxigenic Fusarium species
The Norwegian Veterinary Institute (NVI)
Project leader:
Dr. Arne Holst-Jensen, Section of Food and Feed Microbiology, Department of Feed
and Food Hygiene
In the present study the phylogenetic relationship between the most frequently
isolated Fusarium species detected on Norwegian cereal grains was clarified. The
phylogeny was largely concurrent with previous reports, but revealed lack of
concordance between sections and the species traditionally assigned to the sections.
All but one species formed monophyletic groups, and the phylogeny revealed a clear
division between the trichothecene and non-trichothecene producing species.
Phylotoxigenic relationship was observed for the major groups of trichothecene
producers, and these trichothecene producing species could be divided into the strict
type A trichothecene producers, the strict type B trichothecene producers and those
that produce both type A and B trichothecenes. Based on the results of the
phylogenetic analyses and published chemical and morphological reports, F.
arthrosporioides was placed as a synonym to F. avenaceum. Potential diagnostic
sequence motifs detected for molecular methods, were retrieved from the phylogenetic
analyses.
Main goal::Develop a rapid multiplex phylogeny-based assay for identification of
toxigenic Fusarium species in plant matrixes
Sub-goals::Sequence the ribosomal intergenic spacer (IGS), introns of b-tubulin ,
translation elongation factor 1a or other genes of approximately 150 strains
of Fusarium/other relevant fungal/host plant taxa.
244
Perform phylogenetic analyses based on new sequences and sequences from databases
and collaborators.
Map features associated with the strains on the phylogenetic trees, e.g. taxonomy,
metabolite profile, geographic origin, host.
Retrieve diagnostic sequence motifs from phylogenetic trees.
Develop and validate diagnostic probes in single strain and multiplex
PCR/hybridisation assays.
3. Mycotoxins and mycotoxigenic fungi in China: analytical tools, dietary
exposure and Fusarium diversity
Promotor: Sarah De Saeger (UGent)
Belgian partners: Stéphane Declerck (Université catholique de Louvain, UCL),
Alfons Callebaut (CODA-CERVA), Geert Haesaert (University College Ghent,
Hogent)
Chinese partners: Dr.Y.Qi (Chinese Academy of Tropical Agricultural Sciences,
CATAS), Prof. Y.-C. Liao (Huazhong Agricultural University, HZAU), S. Peng
(Shanghai Food and Drug Administration, SHFDA), H. Gao (Shanghai Food and
Drug Administration, SHFDA), Prof. J. Shen (China Agricultural University,
CAU), Prof. S. Zhang (China Agricultural University, CAU), Prof. D. Zhang
(Shanghai Jiao Tong University, SJTU), Dr. A. Wu (Shanghai Academy of
Agricultural Sciences, SAAS)
Researchers: J. Diana Di Mavungu (Ghent University, UGent), N. Beloglazova
(Ghent University, UGent), F. Munaut (Université catholique de Louvain, UCL),
F. Van Hove (Université catholique de Louvain, UCL), Kris Audenaert
(University College Ghent, Hogent), B. Huybrechts (CODA-CERVA), E. Tangni
(CODA-CERVA), Ph. Debongnie (CODA-CERVA), H.-P. Li (Huazhong
Agricultural University, HZAU), J.-B. Zhang (Huazhong Agricultural
University, HZAU), J.-H.Wang (Huazhong Agricultural University, HZAU), Z.
Wang (China Agricultural University, CAU)
245
The major aim of this proposal is to bring together experts from both China and
Belgium to conduct research on mycotoxins and mycotoxigenic fungi, including
Fusarium and related toxins. The different partners will be complementary as they are
focused on different aspects of this research topic. Multidisciplinarity and cross-border
research are the key issues in this project.
More specifically, the project will have the following objectives:
1. Development of analytical tools to assess mycotoxin dietary exposure in China.
2. Study on the genetic and mycotoxigenic diversity of Fusarium on wheat, maize and
banana in China.
4. Assessment of mycotoxin exposure in the Belgian population using
biomarkers
Promotors: Stefaan De Henauw (UGent) and Alfons Callebaut (Coda-Cerva)
The objectives of this project are:
• Measurement of mycotoxins via biomarkers in urine taken in samples of a
representative part of the Belgian population, using validated analytical methods
• Perform an exposure assessment via biomarkers for a number of mycotoxins to
which the Belgian population is exposed (mainly through dietary intake)
• Investigate the correlation between the measured biomarkers and the reported
consumption of different groups of food commodities
5. MYTOXPLEX: Is the occurrence of the T2/HT-2 mycotoxin complex in
cereals a new and actual problem in the food and feed chain?
This project will use an explorative approach to:
1. Assemble qualitative and quantitative T2 and HT-2 data in small grain cereals
(wheat, barley, oat, spelt and triticale) and derived cereal products produced and
handled in Belgium.
2. Elucidate the occurrence of T2 and HT-2 producing Fusarium species and their
genetic diversity in order to come up with appropriate control measures.
246
3. Identify the presence of other mycotoxins produced by F. poae and F. langsethiae.
4. Assess the importance of other Fusarium species within the T2/HT-2 complex.
5. Implement a preliminary risk assessment for T2, HT-2 and other eventual
mycotoxins within the F. poae group based on an exposure estimation.
Promotors: Geert Haesaert (HoGent), Kris Audenaert (HoGent), Sarah De
Saeger (Ugent), Françoise Munaut (UCL) and Mia Eeckhout (HoGent)
6. Researching Fusarium poae: its mycotoxines, chemotype and influence of
oxidative stress triggers
Copromotors: Monica Höfte (HoGent)
Collaborator: Adriaan Vanheule (HoGent)
Thorough research at the Ghent University College recently attempted to shed light on
the ever changing composition of the Fusarium complex. It was found that in
Flanders, Fusarium poaehas an important place within this disease complex. Up to
recently, research in this field did not focus on F. poae, as other species were much
more aggressive within the complex. Its rising presence, its nature as a secondary
attacker and its potential to produce mycotoxins which could be much more toxic than
those of other species, illustrate the large need for research on this topic.The Fusarium
poae research at the Ghent University College aspires to fill the gaps in the scientific
community’s knowledge on this fungus. Field isolates that originate from several
testing locations in Belgium are characterized pursuing a multidisciplinary approach
of chromatographic, genetic and pathological methods. LC-MS/MS techniques are
used to unravel the chemotype of the isolates. To this end, the Fusarium poae project
has ties with the ‘Mytox’ Association Research Group (AOG), and research is carried
out in the Bromatology lab at the Faculty of Farmaceutical Sciences at the University
Ghent. The qualitative and quantitative production of toxins is examined under
different conditions and influences of stress, such as fungicide treatment. A further
characterization of the field samples involves fungicide resistance assays of F.
247
poaeand the related species F. langsethiae to fungicides such as triazoles and
strobilurines. Experiments to examine the physiological effects of fungicide
treatments on both a macroscopic and a microscopic level are set up. This work is
carried out in the broader framework of oxidative stress as a trigger for toxin
production, which could be a central dogma in toxin production in all toxigenic fungi.
To find a measure for aggressivity of the isolates, detached leaf assays are used. This
technique also allows us to test several sources of resistance in wheat for its strength
against F. poae. Again, microscopy visualization techniques are employed, this time
to gain insight in the infection strategy of the fungus and the plant’s corresponding
response. The last piece of the puzzle is filled in when AFLP-fingerprinting lets us
unravel the genotype of the different isolates.These different approaches of
the Fusarium poae problem allow us to paint a fairly complete picture of the fungus,
and as such meet the scientific community’s need for more knowledge on this
organism with its importance increasing now more than ever.
7. MycoHunt: Rapid biosensor for the detection of mycotoxin in wheat
Mia Eeckhout (coordinator HoGent), Collaborator: Yirong Guo (UGent),
Melanie Sanders (UGent), Freya Martens MycoHunt is a project granted in the
EU7 framework program for the development of a rapid online biosensor for the
detection of mycotoxin in wheat.The project aims to increase the competitiveness
of a large group of “Small and Medium Enterprises (SME) Associations” in
Europe by developing a cost-effective method to detect the contamination of
deoxynivalenol (DON) in wheat grains. This mycotoxin forms a major threat in
the food and feed sector of the European industry. A group of SME Associations,
covering the relevant sectors and representing a vast number of sector SMEs,
participate in the project. In this way, they will gain knowledge and resources to
further exploit the results of the novel technology developed by providing a
thorough sampling and measurement method of grain.In the framework of the
project the development of an online, non-destructive sampling apparatus for dust
and other low molecular weight particles is targeted. Another aspect of the
research is the development of a specific sensor based on an immunoassay
method using DON specific monoclonal antibodies. Beside the technological
objectives, the research focuses on the determination of parameters (temperature,
pressure, vacuum, etc.) affecting the sampling precision. Also different
immobilizing methods for the DON specific monoclonal antibodies will be
investigated. The determination of the cross-reactivity of these monoclonal
antibodies against other trichothecenes, like 3-acetyl-DON, 15-acetyl-DON,
nivalenol, is also an interesting point to consider.
8. Fusarium Research, at University of the Free State/ South Africa
248
The most effective means to prevent damage caused by Fusarium spp. to agricultural
crops is by planting tolerant or resistant material. Such tolerance/resistance depends
on the ability of the fungus to enter, colonise and damage the plant, and the ability of
the plant to prevent or resist damage caused by the fungus. To exploit plant resistance
as a means of disease management, a proper knowledge of Fusarium, its genetics,
pathogenicity and toxicity, under different environmental conditions, is required. In
this programme, the interaction between agricultural crops and Fusarium spp. is
investigated by means of comparative and functional genetics of the Fusarium-plant
interactions, the isolation and identification of defence-related genes in agricultural
crops, the identification of virulence genes in Fusarium, studies on the evolutionary
biology and phylogenetics of Fusarium, and the unconventional improvement of
plants for resistance to Fusarium spp. Greenhouse and field evaluation of natural and
induced resistance to Fusarium pathogens of agricultural crops are also conducted in
collaboration with the ARC.
students
MSc students:
Ankia Rabie - Isolation and identification of putative pathogenicity genes in a mutant
population of Fusarium oxysporum f. sp. cubense
Morgana Miller - Containment of Fusarium oxysporum f.sp. cubense 'tropical' race 4
on a banana farm in northern Mozambique
Anushka
Gokul Epidemiological
investigations
of
the Fusarium
graminearum species complex (FGSC) in South African wheat and maize, grown in
rotation
Nakisani Netshifhefhe - Investigating the mechanisms of resistance in maize
to Fusarium verticillioides and fumonisin
Londiwe Mabuza - Monitoring Fusarium and Gibberella ear rots and the mycotoxins
they produce in maize grown under different conservation tillage/rotation systems
PhD students:
249
Lindy Rose - Unconventional improvement of maize for resistance to Fusarium
verticillioides and their fumonisins
Gert van Coller - identification and management of toxin-producing Fusarium species
responsible for head blight and crown rot of wheat in South Africa
Reuben Ssali - identification, characterisation and genetic mapping of Fusarium wilt
resistance loci in Musa
Sharon McFarlane - Development of a management strategy for Eldana
saccharina Walker in sugarcane using Fusarium endophytes
Edson Ncube - Interactive effect of Busseola fusca and Fusarium verticillioides on ear
rot and fumonisin production in maize
Saif Al-Kaabi - The diversity, distribution and management of Fusarium
oxysporum f.sp. cubense in the Sultanate of Oman
9. Characterisation and management of Fusarium wilt of watermelon
The project is financially supported by the NT DPIF, Horticulture Australia Limited,
Monsanto Australia and Rijk Zwaan Australia.
Fusarium wilt is one of the most severe diseases in watermelon and is caused by a
fungus called Fusarium oxysporum f. sp. niveum (Fon). This strain is only pathogenic
on watermelons and can be divided into four races (0, 1, 2 and 3). The disease is one
of the major yield limiting factors in production, worldwide. Fon was first detected in
the Northern Territory (NT) in May 2011. The disease affected three different
varieties of watermelon seedlings and plants from six different locations. To date, two
of the races have been detected in Australia. However there is limited published
information about the Australian Fon races. It is unclear what race the NT Fon strain
is, whether it is a new race and its level of aggressiveness.
250
Lucy Tran-Nguyen (project leader): 8999 2235 (lucy.tran-nguyen@nt.gov.au), Barry
Conde (project member) 8999 2265 (barry.conde@nt.gov.au).
The objectives of the projects are
Identify the NT Fusarium oxysporum f. sp. niveum race(s) and compare with
other Fon races (Australia and international).
Screen rootstocks and grafted watermelons for resistance to Fusarium
oxysporum f. sp. niveum [all race(s)].
Extension strategies to raise awareness of Fusarium wilt of watermelon,
deliver outcomes to industry and propose management strategies.
The project outcomes include
Obtain a better understanding of the pathogen's biology by project
completion.
Determining the NT Fon race(s) and its relatedness to Australian and
overseas Fon races by project completion. These findings would assist
commercial breeding programs.
By the end of 2015, seedling nurseries and growers are using an integrated
strategy for management of Fon that allows them to sustainably produce
watermelons on their current infected farms, as a result of the extension
activities from this project.
Project update:
Race differential trials in the NT have so far had mixed results. Trials on two
varieties of watermelon, 'Kalahari' and 'SP-4' have suggested that
251
two Fon NT isolates are of race 2. The most recent trial however, conducted
again on the 'SP-4' variety, has suggested that the NT isolates may actually be
of race 3. To date, race 3 has not been reported as present in Australia. This
trial will be repeated, and highlights the importance of conducting race
differential trials on several varieties of watermelon before race can be
determined conclusively.
Multiplication of 'Charleston Grey' and 'Calhoun Grey' seeds, which are
traditionally used for Fon race differentials, has been completed and will be
used for trials to determine which race is present in the NT and NSW.
Samples from melon growing regions in the NT, NSW, Qld and WA have
been taken by University of Sydney post graduate student, Victor Puno.
Preliminary race differential trials have found that four isolates from Qld are
race 2. Isolates from the NT, NSW and WA have been determined as being
either race 2 or 3, with ongoing trials being conducted to differentiate them.
Glasshouse and field trials to determine the effects of temperature on the
susceptibility of plants to Fon are currently being conducted in 2014, after
being disrupted in 2013 due to resource reallocation during the banana
freckle outbreak. These trials will again be repeated in 2015 to assess the
reliability of results.
Molecular studies on Fon isolates aim to develop a relatively quick and
reliable molecular test for race identification. Thus far, studies have been
made difficult due to the restrictions on importing live Fusarium cultures into
Australia and the lack of quarantine facilities for working with them. Instead
DNA from two isolates of each Fon race are to be imported from the US for
future inclusion in comparative molecular studies of Fonisolates.
Molecular characterisation of Fon isolates has commenced by searching for
pathogenicity genes. Genome sequencing has been conducted on two NT
isolates, and the presence of pathogenic genes has been found. One isolate
appears it may be slightly more virulent than the other, but this is yet to be
verified.
10. Epidemiology and agro-ecology of Fusarium oxysporum f.sp. cubense
(PANAMA DISEASE PhD project 3)
The aim of this PhD project is developing statistically sound sampling strategies and
(quantitative) diagnostics. This will result in internationally sought 'TR4 alerts' and
effective rational and quantifiable management practices.
Project code: PANAMA DISEASE
Status: In progress
Start project: Jan 1, 2012
252
End project: Dec 31, 2017
Partners:
Plant Research International
Soil Geography and Landscape
Knowledge Technology and Innovation
Other parties involved:
Embrapa (Empresa Brasileira de Pesquisa Agropecuária); CIB (Cooperación
de Investigaciónes Biológicas); UNAL (Universidad Nacional de Colombia,
Medellín); Augura (National Banana Corporation of Colombia); Colciencias
(National Science Foundation); CORBANA (Corporación Bananera
Nacional); Bioversity International; Chiquita; Dole; Earth University; AEBE
(Association of Ecuadorian Banana Exporters); Senescyt (National Science
Foundation); ESPOL-CIBE (Escuela Superior Politecnica del Litoral, Centro
de Investigaciones Biotecnológicas del Ecuador); FHIA (Fundación
Hondureña de Investigación Agrícola); OIRSA (Organismo Internacional
Regional de Sanidad Agropecuaria) (Philippines Banana Growers and
Exporters Association); Federation of Cooperatives in Mindanao and
MBFEA (Mindanao Banana Farmers and Exporters Association); University
of the Philippines-Mindanao; University of the Philippines-Los Baños;
CHED (Commissioner of Higher Education); PCCARD (Philippine Council
for Agriculture, Forestry and Natural Resources Research and Development);
IITA (International Institute for Tropical Agriculture); SUA (Sokoine
University of Agriculture); CIRAD (Centre de coopération internationale en
recherche agronomique pour le développement); FAO-World Banana Forum;
AgroFair;
BLGG
(Bedrijfslaboratorium
voor
Grond en Gewasonderzoek
11. Panama disease: Multi-level solutions for a global problem
Panama disease: Multi-level solutions for a global problem is a collaborative project
led by Wageningen University & Research Centre and funded by Wageningen
University’s Interdisciplinary Research and Education Fund (INREF)1. The premise
of the project is that controlling Fusarium wilt, caused by Fusarium oxysporum f.
sp. cubense (Foc), requires an approach that integrates new insights, such as on the
impact of genetic and agro-ecological diversity on the spread and severity of the
disease, with coordinated action and regulation. The project aims to address the
management and containment of tropical race 4 (TR4) under different production
settings in a range of agro-ecological environments and various governance structures
by establishing methods for immediate containment and management of TR4 where it
is present, or arrives, and by developing long-term control strategies in bananaproducing regions affected by the other races of the Fusarium fungus.
253
The INREF project is one of three research projects on Fusarium wilt that are
managed Wageningen University & Research Centre. The other two are: KNAWSPIN, a Scientific Program Indonesia Netherlands (SPIN) funded by the Royal
Netherlands Academy of Arts and Sciences, which aims to deliver fundamental
knowledge on banana and Foc, and PromoBanana (Protect and Modernize Philippine
Banana Production), which aims to establish a professional service laboratory to
detect and contain rapidly spreading diseases, and to optimize fertilizer management 2.
Study areas
Project activities take place in the Philippines (where TR4 is present), Ecuador,
Colombia, Costa Rica and Tanzania (where other Fusarium wilt races are present) and
the Netherlands (for specific laboratory and greenhouse experiments). The study areas
represent different types of production systems (smallholder and large-scale
commercial plantations) as well as different agro-ecological setting and governance
models and histories.
Main research questions
The analytical framework of the research approach considers three main domains that
are important drivers of disease outbreaks: biology, environment and human action.
The multidisciplinary approach is programmed in a series of projects that address
seven main research questions linking the different domains and scale levels, from
individual plants to entire regions.
1. What Foc genotypes are present in different banana growing regions, and which
banana cultivars are susceptible to these strains?
2. What banana and plantain cultivars are resistant to TR4 and what is the genetic
basis for resistance to TR 4 and other Foc strains?
3. What are the dispersal and survival strategies of Foc under various agroecological
settings?
4. What is the contribution of diversified germplasm pools and diverse agroecological
conditions to lowering Fusarium wilt pressure in mixed cropping systems?
5. What are the effects of abiotic stress or specific farm management strategies on the
alleviation of disease pressure in susceptible banana germplasm in areas infested with
Race 1 of Foc?
254
6. What are the enabling and constraining mechanisms for coordination and joint
action in managing Fusarium wilt in the diverse banana industry in southern
Mindanao?
7. What are the conditions for effective forms of governance that help to control
Fusarium wilt at different levels?
Partners by country
The project brings together 25 partners in 10 countries.
Brazil Embrapa (Empresa Brasileira de Pesquisa Agropecuária), Colombia, CIB
(Cooperación de Investigaciónes Biológicas), UNAL (Universidad Nacional de
Colombia), Augura (National Banana Corporation of Colombia), Colciencias
(National Science Foundation), Costa Rica, CORBANA (Corporación Bananera
Nacional), Chiquita
Dole, Earth University, Ecuador, AEBE (Association of Ecuadorian Banana
Exporters)
Senescyt (National Science Foundation), ESPOL-CIBE (Escuela Superior Politecnica
del Litoral, Centro de Investigaciones Biotecnológicas del Ecuador), El Salvador,
OIRSA (Organismo Internacional Regional de Sanidad Agropecuaria), Philippines,
PBGEA (Philippines Banana Growers and Exporters Association)
Federation of Cooperatives in Mindanao, MBFEA (Mindanao Banana Farmers and
Exporters Association), University of the Philippines-Mindanao, Tanzania, SUA
(Sokoine University of Agriculture), France
CIRAD (Centre de coopération internationale en recherche agronomique pour le
développement), Italy
FAO-World Banana Forum, Netherlands, AgroFair, BLGG (bedrijfslaboratorium
voor grond en gewasonderzoek)
12. PE 022 - Pepper: Improved control of Fusarium internal fruit rot through
increased knowledge exchange with the Netherlands and Belgium and targeted
application of plant protection products
This project aims to reduce losses to Fusarium internal fruit rot through: (1) agreed
information exchange and a joint work programme with Dutch/Belgium researchers;
(2) examination of rockwool cubes as a source of F. lactis and F. oxysporum; (3)
devising experiments to determine if the level of flower infection can be used to
255
predict risk of fruit infection; (4) determining the duration of reduction in fruit
infection provided by a single application of Serenade ASO to a crop row, cube
surface and floor; (5) determining if use of biopesticides / plant resistance inducers
applied preventatively provide protection to flowers and/or fruit against infection; (6)
communication of results to growers.
13. Fusarium mycotoxins in straw and feed: Effedts on pig reproduction and
health
Project manager:
Per Häggblom
CRC60097: Fusarium TR4 - PhD
This research project will increase our knowledge about the epidemiology and biology
of the exotic plant pathogenFusarium wilt of banana caused by Fusarium
oxysporum f. sp. cubense ‘tropical' race 4 (Foc TR4)
14. Institute for Biotechnology in Plant Production
Research Projects
Christian Doppler Laboratory for Mycotoxin Metabolism (CDL Berthiller)
Project type: Research project (§ 26 & § 27)
Project Leader: Berthiller Franz ;
BOKU Research Units: Center for Analytical Chemistry ; Department of Applied
Genetics und Cell Biology ;Institute for Biotechnology in Plant Production ; Institute
of Animal Nutrition, Livestock Products, and Nutrition Physiology (TTE) ;
Funded by: Christian Doppler Forschungsgesellschaft (CDG), Sensengasse 1, 1090
Wien, Austria
Duration: 01.01.2011-31.12.2017
256
The effort will be concentrated on the Fusarium mycotoxins deoxynivalenol,
zearalenone and fumonisin B1, as these compounds are significant contaminants of
European cereal crops. The first module will establish the extent of formation of
bound mycotoxins in plant systems. The second module will investigate microbial
interactions with free and bound toxins with a view to identifying possible
detoxification routes. The third module will pursue animal feeding trials to establish
the fate of bound toxins in vivo, as well as the effectiveness of detoxification
strategies. Radiolabeled mycotoxins will facilitate these studies and biomarkers will
be used extensively to monitor the fate of toxins in ani-mal systems. In summary, the
overall project aims to answer the following key questions: Which plant metabolites
of mycotoxins are formed in agriculturally important crops and in which quantity?
What is the bioavailability and toxicity of these soluble (conjugated) and insoluble
(bound) forms compared to the native toxins? What is the influence of microbes
(either gut bacteria or deactivators) to conjugated and bound toxins? How efficient are
various mycotoxin deactivators to detoxify both native mycotoxins and their altered
forms?
Plant metabolism of T-2 and HT-2 toxin in wheat, barley and oats
Project type: Research project (§ 26 & § 27)
Project Leader:
BOKU Research Units: Center for Analytical Chemistry ; Institute for Biotechnology
in Plant Production ;
Funded by: Fonds zur Förderung der wissenschaftlichen Forschung (FWF) ,
Sensengasse 1, 1090 Wien, Austria
Duration: 01.12.2013-30.11.2016
In this project we want to 1) investigate the metabolic fate of T2/HT2 in planta, 2)
develop suitable analytical methods for detection and quantification of possible new
metabolites and 3) produce standards of such metabolites. To detect metabolites a 1:1
mixture of natural and U-[13C]-toxins will be applied on wheat/barley ears and oat
panicles. At different time points after application both known (i.e. predicted) and
unknown metabolites will be traced and identified by liquid chromatography – high
resolution mass spectrometry (LC-HRMS). Similar tests will be done with 14Clabeled toxins to assess the insoluble amount, measured by scintillation counting. A
solvolysis procedure will be established to access the extractable biopolymer-bound
and the non-soluble toxin fractions from the plant matrix. A molar sum of all
metabolites will be estimated and compared to the total amount of toxins applied. To
demonstrate the significance of the detected T2/HT2 biotransformation products, we
will confirm their production after artificial inoculation with T2/HT2 producing
Fusarium spp. and we will study their presence in naturally infected samples in the
scope of a small survey. The resistance mechanism to T2/HT2 in wheat carrying Fhb1
is investigated using near-isogenic wheat lines with and without this QTL. To this end
257
differential formation of T2 and HT2 metabolisation products will be studied by LCHRMS.
15. Integrated management of Fusarium wilt of bananas in the Philippines and
Australia.(Australian Centre for International Agricultural Research)
Project Leader:: Mr Stewart Lindsay
Collaborating Institutions
Australian Banana Growers Council, Australia
Provincial Agricultural Office-Rigion XI, Davao Del Norte, Philippines
University of Southeastern Philippines, Philippines
MegaManila Pest Management Specialists Inc., Philippines
This project aims to identify practices for smallholder banana growers to
reduce FW spread through soil movement, understand mechanisms that suppress the
symptoms and identify effective disposal of infected plant residue. It also aims to
profile current knowledge of banana growers and the barriers to adopting relevant
practices. The project will draw on experiences managing the disease in Australia,
Indonesia and the Philippines though various Australian industry-funded
projects, ACIAR HORT/2008/040 and Bioversity International and their coordination
role with other national research projects.
Commissioned Organisation
Queensland Department of Agriculture, Fisheries and Forestry, Australia
16. Cereal pathology: improving the genetic basis of host resistance to fungal
diseases.
Fungal diseases pose a major problem for cereal production in Ireland for two reasons:
firstly, they significantly reduce yield, and secondly, some fungal diseases lead to
contamination of grains with mycotoxins, compounds that are harmful for both human
258
and animal health. UCD currently has an active research programme in fungal
molecular plant pathology. By increasing the critical mass of this research group, this
project aims to use biotechnology to better understand the potential for reduced
pesticide input for controlling such diseases, thus leading to more competitive and
sustainable low-input crop production in Ireland. The specific objectives of this
project are to:
1.
2.
Better understand the susceptibility/resistance of Irish-grown barley
cultivars toFusarium head blight disease and associated mycotixin
contamination.
Dissect the genetics of wheat resistance to Fusarium head blight disease.
Achieving these objectives will allow the selection of wheat and barley cultivars with
lower fungicide requirements and will thus facilitate the move towards competitive
low-input sustainable crop production.
Funding:
Department of Agriculture, Food and Rural Development (Ireland).
17. Reduction of fungicide input in Irish cereal farming: biological control of
cereal foliar and head blight fungal pathogens.
Researchers:
Eleanor O`Brien, Mojibur Khan
Collaborators:
Dr. Brian Carney, Letterkenny Institute of Technology, Co. Donegal, Ireland.
Funding:
Department of Agriculture, Food and Rural Development (Ireland).
In Ireland, the most important fungal diseases of cereals in terms of yield loss include
Septoria tritici leaf blotch of wheat, Pyrenophora (Dreschlera) teres net blotch of
259
wheat and Fusariumhead blight (FHB) of both wheat and barley caused by
various Fusarium species. FHB also poses a threat in terms of human and animal
health in that many of the Fusarium species that we have commonly found in Ireland
(F. culmorum, F. graminearum and F. poae) have the potential to produce a range of
toxic secondary metabolites known as mycotoxins in grain. Currently, control of such
diseases is attempted by fungicide application. Our ultimate aim is to reduce
fungicide inputs in Irish tillage and in this project we will investigate the potential of
developing environmentally
friendly alternatives:
biological
control
microorganisms/biochemicals. We will isolate, characterise and assess the biological
control potential of microorganisms and crustacean biochemicals. We will determine
the mode of action of potential biological control organisms/biochemicals using
microscopic and molecular studies. In addition to our microbial studies, we will assess
the effectiveness of chitosan, a deacetylated derivative of chitin that activates many of
the plant's defense responses to microbial diseases against cereal pathogens.
18. Effect of trichothecene mycotoxins on programmed cell death in wheat
The selective regulation of programmed cell death (PCD) offers tremendous potential
rewards for plant and animal disease modulation. We recently identified that several
fungal toxins retard PCD in Arabidopsis in a concentration-dependent manner. To the
best of our knowledge, this is the first evidence of a fungal toxic metabolite inhibiting
cell death in either plant or animal cells. We wish to analyse the effect of this these
mycotoxins on stress-induced PCD in host plants (wheat and maize). Also, we will
determine if the retardation of plant PCD by mycotoxins is an attack strategy adopted
by pathogens during plant pathogenesis.
Researcher:Guillaume Erard.
Collaborators:Dr. Paul McCabe, Dept. of Botany, UCD, Belfield, Dublin 4, Ireland.
19. Functional genomics of plant-mycotoxin interactions
260
Researchers:Dr. Josephine Brennan, Stephanie Walter
Collaborators:
Dr. Gerhard Adam, Center of Applied Genetics, University of Agricultural Sciences,
Vienna 18, A-1190 Vienna, Austria.
Dr. Paul Nicholson, Disease and Stress Biology, John Innes Centre, Norwich Research
Park, Colney, Norwich NR4 7UH, UK.
Dr. Bodo Trognitz, Austrian Research Centre Seiberdorf GmbH,A-2444 Seibersdorf,
Austria.
Mycotoxins are toxic fungal secondary metabolites. Fusarium fungi pathogenic to
wheat produce trichothecene mycotoxins that act as disease virulence factors, aiding
host parasitism; the wheat genome has consequently co-evolved with
the Fusarium pathogen and its toxic metabolites. Current knowledge about the
influence of trichothecenes on eukaryotic signal transduction cascades and
downstream gene products is limited, especially in plants. Trichothecene resistance is
postulated to be one of wheat's mechanisms to resist Fusarium head blight disease.We
have recently identified several trichothecene-responsive wheat genes; many show no
homology to previously characterised genes. This project will use microarray analyses
to identify more wheat genes overexpressed in response to trichothecenes. We will
also elucidate gene function using host, heterologous expression and gene regulatory
studies. Gene expression analysis in a range of wheat tissues and genotypes in
response to various treatments will determine if trichothecene-responsive genes are a
component of the plants general stress response, if they are specifically up-regulated
in response to trichothecenes, how these genes are developmentally regulated, and if
they play a role in disease resistance.
Analysis of the effect of trichothecenes on both Saccharomyces
cerevisiae andArabidopsis thaliana that are heterologously expressing trichotheceneresponsive wheat genes will indicate the ability of genes to directly conferring
trichothecene tolerance and their phenotypic effects. For genes differentially
expressed among wheat genotypes, RNA stability studies and analysis of upstream
regulatory elements will enable us to determine if genes are pre- or post-
261
transcriptionally up-regulated due to trichothecene treatment and if regulatory region
polymorphisms could account for differential gene expression.
20. Trichothecene mycotoxin up-regulated wheat genes: analysis of function and
regulation.
Researcher: Khairul Ansari
Collaborators:
Prof. Dr. P. Ruckenbauer, Dr. M. Lemmens, Dr. H. Buerstmayr and Dr. U.
Scholz, Institute for Agrobiotechnology, Austria
Dr. K. Hjortsholm. Sejet Plantbreeding, Denmark
Dr. F. Lšschenberger, Saatzucht Donau GmbH., Austria
Dr. J. Weyen. Saaten-Union Resistenzlabor GmbH, Germany
Prof. Dr. A. Mesterhazy. Cereal Research non profit Co., Hungary
Prof. B. M. Cooke. University College Dublin, Ireland
Dr. G. Adam. University of Agricultural Sciences, Austria
Dr. P. Nicholson. Disease and Stress Biology, John Innes Centre, UK
Wheat-pathogenic Fusarium fungi produce toxic trichothecene mycotoxins that act as
Fusarium head blight disease virulence factors, and trichothecene resistance is
postulated to be one of wheat's mechanisms to resist Fusaria. We recently identified
several characterised and uncharacterised trichothecene-responsive wheat genes.
Wheat gene expression studies will determine if gene up-regulation is trichothecenespecific or part of the plants general stress response, how these genes are
developmentally regulated and if they play a role in disease resistance. The ability of
trichothecene-responsive wheat genes to enhance the trichothecene tolerance of
Saccharomyces cerevisiae will elucidate their role, if any, in directly conferring
262
trichothecene tolerance
Candidate genes for resistance, toxification, detoxification and toxin efflux.
Deoxynivalenol (DON) is a trichothecene mycotoxin produced by cerealpathogenicFusaria and evidence suggests that it acts as a phytotoxic disease virulence
factor aiding host pathogenesis. RNA fingerprinting offers the potential of identifying
novel
"expression"
markers
for
screening
for
host
trichothecene
tolerance/degradation. We determined the effect of DON (20 ppm) on gene expression
in roots of different wheat genotypes. Despite inhibition of protein synthesis being the
mode of action of this toxin, at least 70 transcripts were overexpressed in the wheat
roots of different cultivars in response to DON. We assessed the effect of DON
treatment of wheat roots and Fusarium culmorum infection of wheat heads on the
(EF- ),
class III plant peroxidase, structure-specific recognition protein (SSRP),adenosine
kinase (ADK), retrotransposon-like homologs and genes of unknown function.
Ongoing research is investigating the potential implications of these genes on the host
cell response to trichothecenes and trichothecene-producing Fusaria.
21. Project Part: Comparative annotation and analysis of multiple Fusarium genomes
and the genomes of Brachypodium and crop plants with emphasis on toxin
biosynthesis and detoxification reactions
Project Part Leader: Univ. Prof. Dr. Hans-Werner Mewes
This project part focuses on the bioinformatic analysis of fungal and plant genomes as
well as integration of expression data. On the fungal part we aim to complete and
improve the annotation of Fusarium genomes. This will be achieved by automatic and
manual comparative gene calling methods. The main focus in the analysis is the
identification of new targets in particular of fungal secondary metabolite and
263
mycotoxin clusters. Expression data, functional annotation and putative regulatory
motifs are all integrated to explore the pathogen-host interaction.
The
model
plant Brachypodium distachyon will
be
annotated.
The Brachypodium genome will sub-sequentially be used as a model for the closely
related but much more complex and larger genomes of barley and wheat although
their genomes are currently not fully sequenced. Specific targets of interest are UDPglucosyltransferases, acetyltransferases among others. They will be first identified in
the model genome and via homology and synteny driven orthology assignments
counterparts in the crop genomes will be identified and knowledge transferred to the
more complex genomes.
22, projects at University of Massachusetts, Amherst. The Department of
Biochemistry and Molecular Biology
Li-Jun Ma, Principal Investigators
Professor Li-Jun Ma is interested in using the rich fungal genomic resources to
explore the mechanisms that guide eukaryotic genome evolution. Dr. Ma is leading
several comparative genomics projects to study the genetic determinants of fungal
pathogenicity and host specificity, and participating in functional studies to test the
hypotheses generated through genomic analyses.
Li Guo, Post-Doctoral Research, Biochemistry and Molecular Biology
Dr. Guo, completed his PhD through the Plant Pathology Graduate
Program at Penn State, is focusing on functional genomics
264
of Fusarium species using comparative approaches. He studies
comparative transcriptomics using both microarray and RNA-seq data.
Greg DeIulio , Ph.D Candidate (Plant Biology Graduate Program)
Greg is interested in understanding the epigenomic influence on genome
evolution of Fusarium species using bisulfite-sequencing.
13. References
1. Abel Atukwase, Archileo N. Kaaya, Charles Muyanja, Hester Vismer and
John P. Rheeder, 2012. Diversity of Gibberella fujikuroi Species Complex
Isolated from Maize Produced in Uganda. International Journal of Plant
Pathology, 3: 1-13.
2. Abu Shamim Mohammad Nahiyan & Louisa Robinson Boyer & Peter Jeffries
& Yoh-ichi Matsubara. PCR-SSCP analysis of Fusarium diversity in
asparagus decline in Japan Eur J Plant Pathol (2011) 130:197–203
3. Ahearn DG1, Zhang S, Stulting RD, Schwam BL, Simmons RB, Ward
MA, Pierce GE, Crow SA Jr. Fusarium keratitis and contact lens wear: facts
and speculations. Med Mycol. 2008 Aug;46(5):397-410.
4. Alastruey-Izquierdo A1, Cuenca-Estrella M, Monzón A, Mellado
E, Rodríguez-Tudela JL. Antifungal susceptibility profile of clinical Fusarium
spp. isolates identified by molecular methods. J Antimicrob Chemother. 2008
Apr;61(4):805-9
5. Alfonso E C Cantu-Dibildox JMunir WM et al. et al. Insurgence of
Fusarium Keratitis Associated With Contact Lens Wear. Arch
Ophthalmol.2006;124(7):941-947. doi:10.1001/archopht.124.7.ecs60039.
6. Amarasinghe C, Wang JH, Liao YC, Fernando WG. Difference in TRI13 gene
sequences between the 3-acetyldeoxynivalenol producing Fusarium
graminearum chemotypes from Canada and China. Int J Mol
Sci. 2011;12(9):6164-75. doi: 10.3390/ijms12096164. Epub 2011 Sep 20.
265
7. Anaissie EJ1, Kuchar RT, Rex JH, Francesconi A, Kasai M, Müller
FM, Lozano-Chiu M, Summerbell RC, Dignani MC, Chanock SJ, Walsh TJ.
Fusariosis associated with pathogenic fusarium species colonization of a
hospital water system: a new paradigm for the epidemiology of opportunistic
mold infections. Clin Infect Dis. 2001 Dec 1;33(11):1871-8. Epub 2001 Oct
24.
8. Anne D. van Diepeningen & Abdullah M. S. Al-Hatmi &Balázs Brankovics &
G. Sybren de Hoog. Taxonomy and Clinical Spectra of Fusarium
Species:Where Do We Stand in 2014?. Curr Clin Micro Rpt (2014) 1:10–18
9. Aoki,T., Gagkaeva, Yli-Mattila, Kistler & O'Donnell. Fusarium ussurianum ,
Mycologia 101 (6): 841-852 (2009)
10. Aoki T, O'Donnell K, Homma Y, Lattanzi AR. Sudden-death syndrome of
soybean is caused by two morphologically and phylogenetically distinct
species within the Fusarium solani species complex--F. virguliforme in North
America and F. tucumaniae in South America. Mycologia. 2003 JulAug;95(4):660-84
11. Aoki T , Smith JA, Mount LL, Geiser DM, O'Donnell K. Fusarium torreyae
sp. nov., a pathogen causing canker disease of Florida torreya (Torreya
taxifolia), a critically endangered conifer restricted to northern Florida and
southwestern Georgia. Mycologia. 2013 Mar-Apr;105(2):312-9
12. Aoki, T., H. Suga, F. Tanaka, Scandiani & O'Donnell Fusarium azukiicola.
Mycologia. 2012;104(5):1068-84.
13. Aoki T, Vaughan MM, McCormick SP, Busman M2, Ward TJ, Kelly
A, O'Donnell K, Johnston PR, Geiser DM4. Fusarium dactylidis sp. nov., a
novel nivalenol toxin-producing species sister to F. pseudograminearum
isolated from orchard grass (Dactylis glomerata) in Oregon and New Zealand.
Mycologia. 2015 Mar-Apr;107(2):409-18
14. Aoki T, Ward TJ, Kistler HC, O’Donnell K (2012c) Systematics, phylogeny
and trichothecene mycotoxin potential of Fusarium head blightcereal
pathogens. Mycotoxins 62:91–102
20. Arif, M., D. R. Pani, N. W. Zaidi, and U. S. Singh, “PCR-Based Identification
and Characterization of Fusariumsp. Associated with Mango
Malformation,” Biotechnology Research International, 2011, Article ID
141649, doi:10.4061/2011/141649
21. Arif, M., Shilpi Chawla , N. W. Zaidi , J. K. Rayar M. Variar and U. S. Singh.
Development of specific primers for genus Fusarium and F. solani using
rDNA sub-unit and transcription elongation factor (TEF-1α) gene. African
Journal of Biotechnology 11(2), pp. 444-447
266
22. Baayen, R. P., O’Donnell, K., Breeuwsma, S., Geiser, D. M., and Waalwijk,
C. 2001. Molecular relationships of fungi within the Fusarium redolens–F.
hostae clade. Phytopathology 91:1037-1044.
23. Bhale UN, Chatage VS, Ambuse MG (2012) First Report of Fusarium
proliferatum Inciting Wilt of Rumex acetosa L. in Maharashtra, India. J Plant
Pathol Microbiol 3:116. doi: 10.4172/2157-7471.1000116
24. Bernal, MD, Acharya NR, Lietman TM, Strauss EC, McLeod SD,
Hwang DG/ Outbreak of Fusarium keratitis in soft contact lens wearers in
San Francisco. Arch Ophthalmol2006;1241051- 1053
25. Biazio, Gleison Ricardo de, Leite, Gabriela Guimarães Sousa, Tessmann,
Dauri José, & Barbosa-Tessmann, Ione Parra. (2008). A new PCR approach
for the identification of Fusarium graminearum. Brazilian Journal of
Microbiology, 39(3), 554-560.
26. Bigley VH1, Duarte RF, Gosling RD, Kibbler CC, Seaton S, Potter M.
Fusarium dimerum infection in a stem cell transplant recipient treated
successfully with voriconazole. Bone Marrow Transplant. 2004
Nov;34(9):815-7.
27. Britz H, Steenkamp ET, Coutinho TA, Wingfield BD, Marasas WF, Wingfield
MJ. Two new species of Fusarium section Liseola associated with mango
malformation. Mycologia. 2002 Jul-Aug;94(4):722-30.
28. Castellá G1, Cabañes FJ. Phylogenetic diversity of Fusarium incarnatumequiseti species complex isolated from Spanish wheat. Antonie Van
Leeuwenhoek. 2014 Aug;106(2):309-17.
29. Cavallini GM, Ducange P, Volante V, Benatti C. Successful treatment
of Fusarium keratitis after photo refractive keratectomy. Indian J Ophthalmol
2013;61:669-71
30. Chehri K, Salleh B, Zakaria L. Morphological and Phylogenetic Analysis
ofFusarium solani Species Complex in Malaysia. Microbial Ecology.
2015;69(3):457-471. doi:10.1007/s00248-014-0494-2.
31. Chehri, K. , B. Salleh, T. Yli-Mattila, M.J. Soleimani and A.R. Yousefi, 2010.
Occurrence, Pathogenicity and Distribution of Fusarium spp. in Stored Wheat
Seeds Kermanshah Province, Iran. Pakistan Journal of Biological Sciences,
13: 1178-1186
32. Coleman JJ, Daboussi MJ, Di Pietro A et al (2010) Comparative genomics
reveals mobile pathogenicity chromosomes in Fusarium. Nature
464(7287):367– 373.
33. Creekmore , Lynn H. Field Manual of Wildlife Diseases. Chapter 37 Mycotoxins
267
34. Dursun, Dilek M.D.; Fernandez, Viviana M.D.; Miller, Darlene M.S., M.P.H.;
Alfonso, Eduardo C. Advanced Fusarium Keratitis Progressing to
Endophthalmitis. Cornea: May 2003 - Volume 22 - Issue 4 - pp 300-303
35. Dylan P. G. Short,1* Kerry O’Donnell,2 Ning Zhang,3 Jean H. Juba,1 and
David M. Geiser. Widespread Occurrence of Diverse Human Pathogenic
Types ofthe Fungus Fusarium Detected in Plumbing Drains. JOURNAL OF
CLINICAL MICROBIOLOGY, Dec. 2011, p. 4264–4272
36. Dylan P.G. Short a,⇑, Kerry O’Donnell b, Ulf Thrane c, Kristian Fog Nielsen
c, Ning Zhang d, Jean H. Juba a,David M. Geiser Phylogenetic relationships
among members of the Fusarium solani speciescomplex in human infections
and the descriptions of F. keratoplasticum sp. nov. and F. petroliphilum stat.
nov.Fungal Genetics and Biology 53 (2013) 59–70
37. Emma T. Steenkamp, Brenda D. Wingfield, Teresa A. Coutinho, Kurt A.
Zeller, Michael J. Wingfield, Walter F. O. Marasas, and John F. Leslie. PCRBased Identification of MAT-1 and MAT-2 in the Gibberella fujikuroiSpecies
Complex. Appl Environ Microbiol. 2000 Oct; 66(10): 4378–4382.
38. Earl B. Ritchie; Mary E. Pinkerton. Fusarium Oxysporum Infection of the
Nail. Report of Cases. AMA Arch Derm. 1959;79(6):705-708.
39. Ersal T, Al-Hatmi AS, Cilo BD, Curfs-Breuker I, Meis JF, Özkalemkaş
F, Ener B, van Diepeningen AD. Fatal disseminated infection with Fusarium
petroliphilum. Mycopathologia. 2015 Feb;179(1-2):119-24
40. Ferrer C, Alio J, Rodriguez A, Andreu M, Colom F. Endophthalmitis caused
by Fusarium proliferatum. J Clin Microbiol. 2005 Oct;43(10):5372-5.
41. Freeman S1, Sharon M, Maymon M, Mendel Z, Protasov A, Aoki T, Eskalen
A, O'Donnell K. Fusarium euwallaceae sp. nov.--a symbiotic fungus of
Euwallacea sp., an invasive ambrosia beetle in Israel and California.
Mycologia. 2013 Nov-Dec;105(6):1595-606.
42. Gale LR, Bryant JD, Calvo S, Giese H, Katan T, O'Donnell K, Suga H, Taga
M, Usgaard TR, Ward TJ, Kistler HC..Chromosome Complement of the
Fungal Plant Pathogen Fusarium Graminearum Based on Genetic and
Physical Mapping and Cytological Observations.” Genetics 171.3 (2005):
985–1001.
43. Gaujoux, Thomas MD; Chatel, Marc Antoine MD; Chaumeil, Christine;
Laroche, Laurent MD; Borderie, Vincent M . Outbreak of Contact LensRelated Fusarium Keratitis in France. Cornea:October 2008 - Volume 27 Issue 9 - pp 1018-1021
44. Geiser DM, Ivey ML, Hakiza G, Juba JH, Miller SA. Gibberella xylarioides
(anamorph: Fusarium xylarioides), a causative agent of coffee wilt disease in
268
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
Africa, is a previously unrecognized member of the G. fujikuroi species
complex. Mycologia. 2005 Jan-Feb;97(1):191-201.
Gerda, F., E.T. Steenkamp , T.R. Gordon. and A. Viljoen . Evolutionary
relationships among the vegetative compatibility groups of Fusarium
oxysporum f.sp. cubense. Appl. Environ. Microbiol. doi:10.1128/AEM.0037009
Guarro , J. Fusariosis, a complex infection caused by a high diversity of fungal
species refractory to treatment . Eur J Clin Microbiol Infect Dis. 2013
Dec;32(12):1491-500
Guarro J, Nucci M, Akiti T, Gené J, Barreiro MD, Gonçalves RT. Fungemia
due to Fusarium sacchari in an immunosuppressed patient. J Clin
Microbiol. 2000 Jan;38(1):419-21.
Gugnani HC, Talwar RS, Njoku-Obi AN, Kodilinye HC. Mycotic keratitis in
Nigeria. A study of 21 cases. Br J Ophthalmol. 1976 Sep;60(9):607-13.
Harrow SA, Farrokhi-Nejad R, Pitman AR, Scott IA, Bentley A, Hide
C, Cromey MG. Characterisation of New Zealand Fusarium populations
using a polyphasic approach differentiates the F. avenaceum/F. acuminatum/F.
tricinctum species complex in cereal and grassland systems. Fungal Biol. 2010
Apr;114(4):293-311.
Heidy Abo El Yazeed; Atef Hassan; Reda E.A. Moghaieb, 1Mai Hamed and
Mohamed Refai. Molecular Detection of Fumonisin-producing Fusarium
Species in Animal Feeds Using Polymerase Chain Reaction (PCR). Journal of
Applied Sciences Research,7(4): 420-427, 2011
Heidy Abo Al-Yazeed, Atef Hassan, Mahmoud EL-Hariri, Mai Hamed and
Mohamed Refai (2010): Studies on Fusarium species and fumonisinsproducing isolates in horse’s feeds in Egypt.Mycotoxin Conference. NRC.
Oct. 2010.
HERNANDES, L; MARANGON, AV; SALCI, T and SVIDZINSKI,
TIE. Toxic thermoresistant metabolites of Fusarium oxysporum are capable of
inducing histopathological alterations in Wistar rats. J. Venom. Anim. Toxins
incl. Trop. Dis[online]. 2012, vol.18, n.2 [cited 2015-04-02], pp. 144-149 .
Herron, D. A.; Wingfield, M. J.; Wingfield, B. D.; Rodas, C. A.; Marincowitz,
S.; Steenkamp, E. T. Novel taxa in the Fusarium fujikuroi species complex
from Pinus spp. Studies in Mycology 2015 No. 80 pp. 131-150
Ingle, A. and Rai, M. (2011) Genetic diversity among Indian phytopathogenic
isolates of Fusarium semitectum Berkeley and Ravenel. Advances in
Bioscience and Biotechnology, 2, 142-148. doi:10.4236/abb.2011.23023.
Jacobs A1, Van Wyk PS, Marasas WF, Wingfield BD, Wingfield
MJ, Coutinho TA. Fusarium ananatum sp. nov. in the Gibberella fujikuroi
269
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
species complex from pineapples with fruit rot in South Africa. Fungal
Biol. 2010 Jul;114(7):515-27
Jandial S, Sumbali G. Fusarial onychomycosis among gardeners: A report of
two cases.
Indian J Dermatol Venereol Leprol 2012;78:229
Jian-Hua Wang, Mbacke Ndoye,1 Jing-Bo Zhang,1,2 He-Ping Li,1 and Yu-Cai
Liao , Population Structure and Genetic Diversity of the Fusarium
graminearumSpecies Complex. Toxins (Basel). 2011 Aug; 3(8): 1020–1037.
Jima, T. A. PCR-based identification of Fusarium spp. and impact of wound
healing time on dry rot infection, MS Thesis, 2012, Uppsala
Jørgensen JS, Prause JU, Kiilgaard JF. Bilateral endogenous Fusarium solani
endophthalmitis in a liver-transplanted patient: a case report. J Med Case
Rep. 2014 Mar 24;8:101
Kawakami, A., Kato, N.,Sasaya, T., Tomioka, K.Inoue, H.,Miyasaka,A. and
Hirayae,K.Gibberella ear rot of corn caused by Fusarium asiaticum in Japan.
J.Gen. Plant Pathol.29 April, 2015
KONIETZNY, Ursula and GREINER, Ralf. The application of PCR in the
detection of mycotoxigenic fungi in foods. Braz. J. Microbiol. [online]. 2003,
vol.34, n.4 pp. 283-300
Kebabcı N, van Diepeningen AD, Ener B, Ersal T, Meijer M, Al-Hatmi
AM, Ozkocaman V, Ursavaş A, Cetinoğlu ED, Akalın H. Fatal breakthrough
infection with Fusarium andiyazi: new multi-resistant aetiological agent crossreacting with Aspergillus galactomannan enzyme immunoassay
Mycoses. 2014 Apr;57(4):249-55.
Kevin Bugg .Pathogen Profile : Fusarium virguliforme (a.k.a F. solani f.
sp. glycines). PP728 Class Project Fall 2010.
Khor W, Aung T, Saw S, et al. An Outbreak of Fusarium Keratitis Associated
With Contact Lens Wear in Singapore. JAMA.2006;295(24):2867-2873.
doi:10.1001/jama.295.24.2867.
Khosrow Chehri & Baharuddin Salleh & Latiffah Zakaria. Morphological and
Phylogenetic Analysis of Fusarium solani Species Complex in Malaysia.
Microb Ecol (2015) 69:457–471
Kritika Vishwanath Singhal , Vikrant Saoji , Sandhya V Saoji. Fusarium skin
infection: A case report. Dermatology Online Journal 18 (4): 6 ,2012
Kudur MH, Prakash P Y, Savitha M. Fusarium solani causing quasi-invasive
infection of the foot in an immunocompetent middle-aged man from South
India. Indian J Dermatol 2013;58:241
Lee KM, Yu J, Son M, Lee YW, Kim KH. Transmission of Fusarium boothii
mycovirus via protoplast fusion causes hypovirulence in other
270
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
phytopathogenic fungi. PLoS One. 2011;6(6):e21629. doi:
10.1371/journal.pone.0021629. Epub 2011 Jun 29.
Leslie JF, Summerell BA, Bullock S, Doe FJ. Description of Gibberella
sacchari and neotypification of its anamorph Fusarium sacchari.
Mycologia. 2005 May-Jun;97(3):718-24.
Leslie JF Zeller KA, Logrieco A, Mulè G, Moretti A, Ritieni A. Species
diversity of and toxin production by Gibberella fujikuroi species complex
strains isolated from native prairie grasses in Kansas. Appl Environ
Microbiol. 2004 Apr;70(4):2254-62.
Li-Jun Ma, David M. Geiser, Robert H. Proctor, Alejandro P. Rooney, Kerry
O’Donnell, Frances Trail, Donald M. Gardiner, John M. Manners, and Kemal
Kazan. Fusarium Pathogenomics. Annu. Rev. Microbiol. 2013.67:399-416.
Li-Jun Ma et al (2010): Comparative genomics reveals mobile pathogenicity
chromosomes in Fusarium.Nature 464, 367-373
Lima CS1, Pfenning LH, Costa SS, Abreu LM, Leslie JF. Fusarium tupiense
sp. nov., a member of the Gibberella fujikuroi complex that causes mango
malformation in Brazil. Mycologia. 2012 Nov-Dec;104(6):1408-19.
Marcio Nucci and Elias Anaissie . Fusarium Infections in
Immunocompromised Patients. Clin Microbiol Rev. 2007 Oct; 20(4): 695–
704.
Marín P, Moretti A, Ritieni A, Jurado M, Vázquez C, González-Jaén MT.
Phylogenetic analyses and toxigenic profiles of Fusarium equiseti and
Fusarium acuminatum isolated from cereals from Southern Europe. Food
Microbiol. 2012 Sep;31(2):229-37.
Mesfin Bogale, Brenda D. Wingfield, Michael J. Wingfield and Emma T.
Steenkamp. Species-specific primers for Fusarium redolens and a PCR-RFLP
technique to distinguish among three clades ofFusarium oxysporum. FEMS
Microbiology Letters 271, 1. 27 – 32
Mishra, Prashant K. , Roland T.V. Fox, Alastair Culham. Development of a
PCR-based assay for rapid and reliable identi¢cation of pathogenic Fusaria
FEMS Microbiology Letters 218 (2003) 329^332
Monds RD, Cromey MG, Lauren DR, di Menna M, Marshall J. Fusarium
graminearum, F. cortaderiae and F. pseudograminearum in New Zealand:
molecular phylogenetic analysis, mycotoxin chemotypes and co-existence of
species. Mycol Res. 2005 Apr;109(Pt 4):410-20.
Mustafa Özyurt, Nurittin Ardıç, Kadir Turan, Şenol Yıldız, Oğuz Özyaral,
Uğur Demirpek, Tuncer Haznedaroğlu, Türkan YurdunTHE ISOLATION OF
FUSARIUM SPOROTRICHIOIDES FROM A DIABETIC FOOT WOUND
SAMPLE AND IDENTIFICATION Marmara Med. J. 21, 68-72, 2008
271
81. Nalim FA, Samuels GJ, Wijesundera RL, Geiser DM. New species from the
Fusarium solani species complex derived from perithecia and soil in the old
World tropics. Mycologia. 2011 Nov-Dec;103(6):1302-30.
82. O'Donnell & T. Aoki. Fusarium virguliforme Mycologia 95 (4): 667 (2003)
[MB#489315]
83. O'Donnell, K., E Cigelnik, HI Nirenberg. Molecular systematics and
phylogeography of the Gibberella fujikuroi species complex. Mycologia,
90(3), 1998, pp. 465-493
84. O'Donnell K1, Sutton DA, Fothergill A, McCarthy D, Rinaldi MG, Brandt
ME, Zhang N, Geiser DM. Molecular phylogenetic diversity, multilocus
haplotype nomenclature, and in vitro antifungal resistance within the Fusarium
solani species complex. J Clin Microbiol. 2008 Aug;46(8):2477-90.
85. O'Donnell K, Sutton DA, Rinaldi MG, Gueidan C, Crous PW, Geiser DM.
Novel multilocus sequence typing scheme reveals high genetic diversity of
human pathogenic members of the Fusarium incarnatum-F. equiseti and F.
chlamydosporum species complexes within the United States. J Clin
Microbiol. 2009 Dec;47(12):3851-61
86. O'Donnell K, Ward TJ, Geiser DM, Corby Kistler H, Aoki T. Genealogical
concordance between the mating type locus and seven other nuclear genes
supports formal recognition of nine phylogenetically distinct species within
the Fusarium graminearum clade. Fungal Genet Biol. 2004 Jun;41(6):600-23.
87. Oechsler RA1, Feilmeier MR, Ledee DR, Miller D, Diaz MR, Fini ME, Fell
JW, Alfonso EC. Utility of molecular sequence analysis of the ITS rRNA
region for identification of Fusarium spp. from ocular sources. Invest
Ophthalmol Vis Sci. 2009 May;50(5):2230-6.
88. Pai R, Boloor R, Shreevidya K, Shenoy D. Fusarium solani: An Emerging
Fungus in Chronic Diabetic Ulcer. J Lab Physicians. 2010 Jan;2(1):37-9. doi:
10.4103/0974-2727.66710.
89. Pérez-Balbuena, Ana Lilia MD; Vanzzini-Rosano, Virginia QFB; ValadézVirgen, José de Jesús MD; Campos-Möller, Xavier MD. Fusarium Keratitis in
Mexico. Med Mycol. 2008 Aug;46(5):397-410. doi:
10.1080/13693780801961352. Epub 2008 Apr 4.
90. Peterson A, Pham MH, Lee B, Commins D, Cadden J, Giannotta SL, Zada G.
Intracranial Fusarium Fungal Abscess in an Immunocompetent Patient: Case
Report and Review of the Literature. Journal of Neurological Surgery Reports
Vol. 75 No. R2/2014
91. Samuel M. Imathiu, Simon G. Edwards, Rumiana V. Ray, Matthew A. Back.
Fusarium langsethiae – a HT-2 and T-2 Toxins Producer that Needs More
Attention/Journal of Phytopathology 161, 1, 1–10, 2013
272
92. Saremi, H., A. Ammarellou and H. Jafary,, 2007. Incidence of crown rot
disease of wheat caused by Fusarium pseudograminearum as a new soil born
fungal species in North West Iran.. Pak. J. Biol. Sci., 10: 3606-3612.
93. Sarver BA1, Ward TJ, Gale LR, Broz K, Kistler HC, Aoki T, Nicholson
P, Carter J, O'Donnell K. Novel Fusarium head blight pathogens from Nepal
and Louisiana revealed by multilocus genealogical concordance. Fungal Genet
Biol. 2011 Dec;48(12):1096-107.
94. Saw S, Ooi P, Tan DH, et al. Risk Factors for Contact Lens–Related Fusarium
Keratitis: A Case-Control Study in Singapore. Arch
Ophthalmol. 2007;125(5):611-617. doi:10.1001/archopht.125.5.611.
95. Scauflaire J, Gourgue M, Munaut F. Fusarium temperatum sp. nov. from
maize, an emergent species closely related to Fusarium subglutinans.
Mycologia. 2011 May-Jun;103(3):586-97.
96. Short DP, O'Donnell K, Zhang N, Juba JH, Geiser DM. Widespread
occurrence of diverse human pathogenic types of the fungus Fusarium
detected in plumbing drains. J Clin Microbiol. 2011 Dec;49(12):4264-72.
97. Short DP1, O'Donnell K, Thrane U, Nielsen KF, Zhang N, Juba JH, Geiser
DM. Phylogenetic relationships among members of the Fusarium solani
species complex in human infections and the descriptions of F.
keratoplasticum sp. nov. and F. petroliphilum stat. nov. Fungal Genet
Biol. 2013 Apr;53:59-70
98. Schroers HJ1, Baayen RP, Meffert JP, de Gruyter J, Hooftman M, O'Donnell
K. Fusarium foetens, a new species pathogenic to begonia elatior hybrids
(Begonia x hiemalis) and the sister taxon of the Fusarium oxysporum species
complex. Mycologia. 2004 Mar-Apr;96(2):393-406.
99. Schroers HJ, O'Donnell K, Lamprecht SC, Kammeyer PL, Johnson S, Sutton
DA, Rinaldi MG, Geiser DM, Summerbell RC. Taxonomy and phylogeny of
the Fusarium dimerum species group. Mycologia. 2009 Jan-Feb;101(1):44-70.
100.
Starkey David E. , Todd J. Ward , Takayuki Aoki , Liane R. Gale , H.
Corby Kistler David M. Geiser , Haruhisa Suga , Bea´ta To´th , Ja´nos
Varga , Kerry O’Donnell.. Global molecular surveillance reveals novel
Fusarium head blight species and trichothecene toxin diversity Fungal
Genetics and Biology 44 (2007) 1191–1204
101.
Taj-Aldeen SJ1, Gene J, Al Bozom I, Buzina W, Cano JF, Guarro J.
Gangrenous necrosis of the diabetic foot caused by Fusarium acutatum. Med
Mycol. 2006 Sep;44(6):547-52.
102.
Tóth, B. Varga, Starkey, O'Donnell, H. Suga & T. Aoki, Fusarium
vorosii Fungal Genetics & Biology 44 (11): 1191-1204 (2007)
273
103.
Torp & Nirenberg. Fusarium langsethiae International Journal of Food
Microbiology 95 (3): 248 (2004)
104.
Treikale O, Priekule I, Javoisha B, Lazareva L. Fusarium head blight:
distribution in wheat in Latvia. Commun Agric Appl Biol
Sci. 2010;75(4):627-34.
105.
Van der Lee T, Zhang H, van Diepeningen A, Waalwijk C.
Biogeography ofFusarium graminearum species complex and chemotypes: a
review. Food Additives & Contaminants Part A, Chemistry, Analysis, Control,
Exposure & Risk Assessment. 2015;32(4):453-460.
doi:10.1080/19440049.2014.984244.
106.
Van Hove F, Waalwijk C, Logrieco A, Munaut F, Moretti A.
Gibberella musae (Fusarium musae) sp. nov., a recently discovered species
from banana is sister to F. verticillioides. Mycologia. 2011 MayJun;103(3):570-85.
107.
Vania O. Carvalho , Vania A. Vicente, Betina Werner, Renata R.
Gomes, Gheniffer Fornari,Patricia F. Herkert, Cristina O. Rodrigues, Kerstin
T. Abagge, Renata Robl, Ricardo H Camiña Onychomycosis by Fusarium
oxysporum probably acquired in utero. Medical Mycology Case Reports.
Volume 6, October–December 2014, Pages 58–61
108.
Yang, L., van der Lee, T., Yang, X., Yu, D., Waalwijk, C., 2008.
Fusarium populations on Chinese barley show a dramatic gradient in
mycotoxin profiles. Phytopathology 98, 719–727
109.
Yli-Mattila T1, Gagkaeva T, Ward TJ, Aoki T, Kistler HC, O'Donnell
K. A novel Asian clade within the Fusarium graminearum species complex
includes a newly discovered cereal head blight pathogen from the Russian Far
East. Mycologia. 2009 Nov-Dec;101(6):841-52.
110.
Yli-Mattila T Gagkaeva T, Ward TJ, Aoki T, Kistler HC, O'Donnell
K. A novel Asian clade within the Fusarium graminearum species complex
includes a newly discovered cereal head blight pathogen from the Russian Far
East. Mycologia. 2009 Nov-Dec;101(6):841-52.
111.
Yli-Mattila T, Ward TJ, O'Donnell K, Proctor RH, Burkin
AA, Kononenko GP, Gavrilova OP, Aoki T, McCormick SP, Gagkaeva TY.
Fusarium sibiricum, Int J Food Microbiol. 2011
112.
Wang C, Lin Y, Lin Y, Chung W (2014) Correction: Modified
Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates
That Have Biological Control Potential against Fusarium Wilt of Cucumber in
Taiwan. PLoS ONE 9(1): 2013
274
113.
Zhao ZH, Lu GZ. Fusarium sinensis sp. nov., a new species from
wheat in China. Mycologia. 2008 Sep-Oct;100(5):746-51.
275