Monograph on the genus Fusarium

atef A hassan; Mohamed  Refai

This monograph covers history and nomenclature of the Genus Fusarium, Fusarium nomenclature, classification of the genus Fusarium (the Wollenbecher and Reinking classification of Fusarium genus (1935), the Snyder and Hansen classification, 1940, the A. Raillo classification, 1950, the W. Gerlach & H.I. Nierenberg classification, 1982m the C. Booth classification, 1971, the John F. Leslie, Brett A. Summerell classification, the toxigenic Fusarium species ), distribution and diversity of Fusarium species, the Fusarium morphology, Fusarium genomics, Fusarium diseases in plants, man and animals, isolation and identification of Fusarium species , with special emphasis on description of Fusarium species, Fusarium books and some research projects

Monograph On The Genus Fusarium By Mohamed Refai1 Atef Hassan2 and Mai Hamed1 1. Department of Microbiology, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt 2. Department of Mycology and Mycotoxins, Animal Health Research Institute, Agriculture Research Center, Dokki, Giza 2015 1 Preface This Monograph is dedicated to the eminent pathologist Prof. Abdul-Rahman Khater, who was the first to direct my attention in 1966 that the nervous manifestations of donkeys were most probably caused by intoxication, rather than virus infection as propagated at that time. It is also dedicated to Prof. Nabil Hassan, the first veterinarian who studied Fusarium during his PhD mission in Moscow in the late sixty and who gave an excellent talk on fusraiotoxicosis at the International mycotoxicosis conference held in Nairobi, 1978, where I was working as FAO Consultant. Prof. Khater Prof. Nabil in Nairobi Mai Hamed This and other monographs I have uploaded before are intended to be sources for information for the students without any restriction, particularly for those in the developing countries, who are not able to buy expensive books or subscribe in journals or pay to read an article, because of shortage of the hard currency. When I started planning this monograph on the genus Fusarium, I have not imagined that I will find such enormous amounts of data on a single organism, so that I feel now after ending the monograph that I have actually written a synopsis as a guide to the postgraduate students to have an idea about the past history of the genus Fusarium, which was mainly concerned with its discovery and nomenclature , and the recent history of the main discoveries, which are concerned mainly with the molecular characteristics of the organism. The data provided by the assistant lecturer Mai Hamed obliged me to involve her for the first time as a co-author in one of my manuals Prof. Dr. Mohamed Refai, Cairo 22.6.2015 2 Contents 1. Introduction 4 2. History and nomenclature of the Genus Fusarium 8 3. Fusarium nomenclature 36 4. Classification of the genusFusarium 44 4.1. Historical 44 4.2.Wollenbecher and Reinking classification of Fusarium genus (1935) 45 4.3. Snyder and Hansen classification, 1940 50 4.4. A. Raillo classification, 1950 50 4.5. W. Gerlach & H.I. Nierenberg classification, 1982 51 4.6. C. Booth classification, 1971. 55 4.7. John F. Leslie, Brett A. Summerell. The Fusarium Laboratory Manual, 2006 59 4.8. Toxigenic Fusarium species 62 5. Distribution and diversity of Fusarium species 65 6. Fusarium morphology 80 6.1.Macromorphology 80 6.2. Microscopic morphology 81 7. Fusarium genomics 85 7.1. The Fusarium Comparative Project 85 7.2.Publications on Fusarium genome sequences 91 7.3. Synopsis of Fusarium genomics results 96 7.4. Fusarium genomics databases 101 8. Fusarium diseases in plants, man and animals 111 8.1. Fusarium diseases in plants 111 8.2. Fusarium infections in human 115 8.3. Fusarium infections and fusariotoxicosis in birds 124 8.4. Fusariotoxicosis in animals 126 9. Isolation and identification of Fusarium species 127 9.1. Media used 127 9.2. Identification of Fusarium species 130 9.2.1. Morphological identification 130 9.2.2. Molecular Methods for Identification of Fusarium 131 10. Description of Fusarium species 138 11. Fusarium books 237 12. Research projects 243 13. References 265 1. Introduction 3 The Fusarium was always in the back mind of the author since the mid sixties, when several donkeys died in the Sharkia Govornorate at that time with nervous manifestations as the main symptoms. The pathologists diagnosed the cases as encephalomalacia and the virologists failed to isolate a virus. The author had the chance to visit the places, where the donkeys died and noticed that donkeys were eating the corn stumps, which were covered with pink fungal growth, which was identified as Fusarium species. Regrettably, the author had no facilities at that time to continue studying the problem and resorted to education of the farmers to prevent their animals from consuming such mouldy stumbs through lectures and announcement in the daily news paper Al-Ahram. The farmers responded positively, so that in a short time the problem was solved. Al Ahram, 1966 Why madness affects donkeys? Even donkeys are affected by madness! The donkey goes around himself and falls, then becomes severely irritated, loses his vision and then fainted, and most often dies. Its madness disease of donkeys, where research labs ten years ago tried to detect its viral cause, as it was believed. Finally it was discovered by Dr. Abdul Rahman Khater, specialist in pathology of neurological diseases and Dr. Mohamed Kamal Refai, teacher in the College of Veterinary Medicine, Cairo University, that the cause of the disease is related to consumption of corn contaminated with a fungus that secretes toxins that affects the brain. 4 Ministry of Agriculture Department of Veterinary Medicine Call for Farmers and holders of animals The Department of Veterinary Medicine in the Ministry of Agriculture has been informed recently about the death of a number of animals, particularly donkeys and camels with the manifestations of neurological symptoms that end often with their death as a result of feeding on mouldy and damaged maize Therefore calls upon all owners of such animals not to provide such damaged maize to their animals so as not expose them to the disease so as to preserve their animals We hope in such cases to notify the nearest veterinarian to do immediately the necessary first aid Veterinary extension The authors had the chance to consider Fusarium in the studies done later on feeds, which are mentioned above. The evaluation of 160 samples of feed (80 of each of yellow corn and mixed feed) at different seasons of the year for fungal contamination indicated that the Fusarium species were isolated only during winter in tested samples (5, 15%) of yellow corn and mixed feeds respectively.47 Moreover, two studies were done on Fusarium. The first study was concerned with the incidence of Fusarium in equine feeds. In this study 100 equine feeds ( 48 barley, 16 pelleted feeds,14 Soya bean, 12 yellow corn and 10 hay samples) were collected from different farms and clubs and subjected to mycological examination for isolation and identification of Fusarium species. All samples examined were contaminated with moulds. The highest total Fusarium count/g was obtained from the Soya bean samples, however, the Fusarium colony counts constituted the 5 highest percentage of total fungal count in barley, which reached to 71.43% in one sample, 50.0% in one samples, 10-18% in 6 samples and 5.55% in one sample. In Soya bean, the highest contribution of Fusarium in total fungal count was 33.33% in one sample and 18.75% in another sample, while the rest of the samples the contribution varied from 1.52-3.57%. The lowest Fusarium count was observed in corn and hay where it varied from 0.88-11.90% and 2% respectively of the total fungal count only. The incidence of Fusarium was the highest in samples of yellow corn 58.33%, followed by soya, in which the incidence of Fusarium was 42.85%; in barley it was 18.75% and in hay it was 10%. Samples of pelleted feeds were all negative for Fusarium. 44 isolates of Fusarium were recovered from equine feeds. The isolates were identified into 9 Fusarium species. The most common Fusarium species was F. verticillioides (21 isolates), followed by F. anthophilum (9 isolates), F. proliferatum and F. solani (4each), F. dimerum (2 isolates) and one isolate of each of F. nygamai, F. oxysporum, F. poae and F. sporotrichoides. Only one isolate was recovered from hay, which was identified as F. verticillioides.35 The results of the second study were published in the year 2001, where 14 Fusarium species were isolated feedstuffs and identified . Prevalence of Fusarium species in feedstuffs 6 7 2. History and nomenclature of the Genus Fusarium 1809: Link Fusarium roseum Link (1809), 1825: Link Fusarium ciliatum Link (1825); Fusarium ciliatum var. ciliatum Link (1825), Fusarium stilbaster (Link) Link (1825) Fusarium roseum f. roseum Link (1832), Fusarium roseum var. roseum Link (1832), Heinrich F. Link, Christian G. D. Nees von Esenbeck A.C.J. Corda 1816-1818: Nees Fusarium lateritium Nees (1816), Fusarium lateritium f. lateritium Nees (1816), Fusarium lateritium subsp. lateritium Nees (1816), Fusarium lateritium var. lateritium Nees (1816 Fusarium heterosporum Nees (1817), Fusarium heterosporum f. heterosporum Nees & T. Nees (1818), Fusarium heterosporum var. heterosporum Nees & T. Nees (1818), 1823-1824: Schlechtendahl Fusarium tremelloides Grev. (1823), Fusarium oxysporum Schltdl. (1824); Fusarium oxysporum f. oxysporum Schltdl. (1824), Fusarium oxysporum subsp. oxysporum Schltdl. (1824), Fusarium oxysporum var. oxysporum Schltdl. (1824 Fusarium sulphureum Schltdl. (1824); Fusarium expansum Schltdl. (1824); 8 1828-1842:Corda Fusarium flocciferum Corda (1828); Fusarium flocciferum f. flocciferum Corda (1828), Fusarium aurantiacum Corda (1829), Fusarium roseum f. roseum Link (1832), Fusarium roseum var. roseum Link (1832), Fusarium strobilinum Corda (1837), Fusarium merismoides Corda (1838), Fusarium merismoides f. merismoides Corda (1838) Fusarium merismoides var. merismoides Corda (1838) Fusarium cinctum Corda (1842), 1832-1849:Frees Fusarium fructigenum Fr. (1832); Fusarium fructigenum var. fructigenum Fr. (1832), Fusarium herbarum (Corda) Fr. (1849), Fusarium herbarum var. herbarum (Corda) Fr. (1849), Elias M.Fries Samuel H. Schwabe Jean Pierre F. Montagne 1839: Schwabe Fusarium graminearum Schwabe (1839), Fusarium graminearum var. graminearum Schwabe (1839) 1843: Montagne Fusarium reticulatum Mont. (1843); Fusarium reticulatum f. reticulatum Mont. (1843), Fusarium reticulatum var. reticulatum Mont. (1843), Fusarium platani Mont. (1849), 1843-1869: Wellman, Bérenger, Rabenh., Roberge, Westend. Lacroix, Kalchbr. Fusarium retusum Wellman (1943) Fusarium maculans Bérenger (1844), Fusarium oxysporum var. aurantiacum (Corda) Rabenh. 9 (1844), Fusarium subtectum Roberge ex Desm. (1846), Fusarium peltigerae Westend. (1849); Fusarium amentorum Lacroix (1854) Fusarium pteridis Kalchbr. (1861) 1870: Fuckel Fusarium sambucinum Fuckel (1863) Fusarium nervisequum Fuckel (1870) Fusarium nervisequum f. nervisequum Fuckel (1870) Fusarium nervisequum f. platani (Lév.) Fuckel (1870) Fusarium larvarum Fuckel (1870) Fusarium larvarum var. larvarum Fuckel (1870) Fusarium sambucinum f. sambucinum Fuckel (1870) Fusarium sambucinum var. sambucinum Fuckel (1870) Fusarium sphaeriae Fuckel (1870) Fusarium sphaeriae var. sphaeriae Fuckel (1870) Fusarium violaceum Fuckel (1870) 1875: Berk. & Broome & Ravenel (1875) Fusarium heteronemum Berk. & Broome (1865) Fusarium semitectum Berk. & Ravenel (1875) Fusarium semitectum f. semitectum Berk. & Ravenel (1875) Fusarium semitectum var. semitectum Berk. & Ravenel (1875) Fusarium cucumerinum Berk. & Broome (1876), Pier Andrea Saccardo 1877-1955: Saccardo Fusarium miniatum Sacc. (1877), Fusarium pyrochroum (Desm.) Sacc. (1879), 10 Fusarium pyrochroum var. pyrochroum (Desm.) Sacc. (1879) Fusarium album Sacc. (1880) Fusarium album f. album Sacc. (1880) Fusarium album var. album Sacc. (1880) Fusarium album f. piceae-vulgaris Sacc. (1880) Fusarium betae (Desm.) Sacc. (1880), Fusarium roseum var. buxi Sacc. (1881), Fusarium roseum var. calystegiae Sacc. (1881), Fusarium roseum var. cucubali-bacciferi Sacc. (1881), Fusarium roseum var. dulcamarae Sacc. (1881), Fusarium roseum var. filicis Sacc. (1881), Fusarium roseum var. helianti Sacc. (1881) Fusarium roseum var. lupini-albi Sacc. (1881), Fusarium roseum var. maydis Sacc. (1881), Fusarium roseum var. phytolaccae Sacc. (1881), Fusarium roseum var. rosae Sacc. (1881), Fusarium roseum var. rusci Sacc. (1881) Fusarium roseum var. vitalbae Sacc. (1881) Fusarium lycopersici Sacc. (1881), Fusarium obtusiusculum Sacc. (1881), Fusarium solani (Mart.) Sacc. (1881), Fusarium solani f. solani (Mart.) Sacc. (1881), Fusarium solani var. solani (Mart.) Sacc. (1881), Fusarium roseum var. helianti Sacc. (1881) Fusarium roseum var. lupini-albi Sacc. (1881), Fusarium roseum var. maydis Sacc. (1881), Fusarium roseum var. phytolaccae Sacc. (1881), Fusarium roseum var. rosae Sacc. (1881), Fusarium roseum var. rusci Sacc. (1881) Fusarium roseum var. vitalbae Sacc. (1881) Fusarium lycopersici Sacc. (1881), Fusarium obtusiusculum Sacc. (1881), Fusarium solani (Mart.) Sacc. (1881), Fusarium solani f. solani (Mart.) Sacc. (1881), Fusarium solani var. solani (Mart.) Sacc. (1881), Fusarium lateritium f. mori (Desm.) Sacc. (1884), Fusarium oxysporum subsp. lycopersici Sacc. (1886), Fusarium oxysporum var. lycopersici Sacc. (1886), Fusarium pallidoroseum var. pallidoroseum (Cooke) Sacc. (1886), Fusarium rimosum (Peck) Sacc. (1886), Fusarium roseolum (Stephens) Sacc. (1886), Fusarium argillaceum (Fr.) Sacc. (1886) Fusarium avenaceum (Fr.) Sacc. (1886) 11 Fusarium avenaceum f. avenaceum (Fr.) Sacc. (1886), Fusarium avenaceum subsp. avenaceum (Fr.) Sacc. (1886), Fusarium avenaceum var. avenaceum (Fr.) Sacc. (1886), Fusarium bacilligerum (Berk. & Broome) Sacc. (1886), Fusarium berenice (Berk. & M.A. Curtis) Sacc. (1886), Fusarium detonianum Sacc. (1886); Fusarium candidum (Link) Sacc. (1886), Fusarium cerealis (Cooke) Sacc. (1886), Fusarium chilense (Mont.) Sacc. (1886), Fusarium episphaericum (Cooke & Ellis) Sacc. (1886), Fusarium equiseti (Corda) Sacc. (1886), Fusarium equiseti f. equiseti (Corda) Sacc. (1886), Fusarium equiseti subsp. equiseti (Corda) Sacc. (1886), Fusarium equiseti var. equiseti (Corda) Sacc. (1886), Fusarium fuckelii Sacc. (1886), Fusarium incarnatum (Desm.) Sacc. (1886); Fusarium lagenariae (Schwein.) Sacc. (1886), Fusarium tricinctum (Corda) Sacc. (1886), Fusarium tricinctum f. tricinctum (Corda) Sacc. (1886), Fusarium tricinctum var. tricinctum (Corda) Sacc. (1886) Fusarium urticearum (Corda) Sacc. (1886) Fusarium obtusum (Cooke) Sacc. (1886), Fusarium ossicola (Berk. & M.A. Curtis) Sacc. (1886), Fusarium pallidoroseum (Cooke) Sacc. (1886) Fusarium minutissimum (Desm.) Sacc. (1886) Fusarium succisae (J. Schröt.) Sacc., Sylloge Fungorum (1892) Fusarium culmorum (Wm.G. Sm.) Sacc. (1895); Fusarium culmorum f. culmorum (Wm.G. Sm.) Sacc. (1892), Fusarium culmorum var. culmorum (Wm.G. Sm.) Sacc. (1892) Fusarium lolii (Wm.G. Sm.) Sacc. (1895), Fusarium longissimum Sacc. & P. Syd. (1899) Fusarium orthosporum Sacc. (1902), Fusarium spicariae-colorantis Sacc. & Trotter ex De Jonge (1909), Fusarium micropus Sacc. (1921), Fusarium moniliforme var. oryzae Sacc. (1951) Fusarium heterosporum f. aleuritis Saccas & Drouillon (1951), Fusarium equiseti var. intermedium Saccas (1955), 12 Mordecai Cubitt Cooke 1878: Cooke & W.R. Gerard, Thüm. & Pass Fusarium glandicola Cooke & W.R. Gerard (1878), Fusarium tortuosum Thüm. & Pass. (1878), 1879: Pirotta & Riboni Fusarium lactis Pirotta (1879); 1881: Cooke & Harkn Fusarium eucalypti Cooke & Harkn. (1881), Fusarium eucalypti Cooke & Harkn. (1881), 1882: Penzig and Ruan, Y.M. Jiang, W. Luo & J.H. Wan Fusarium dimerum Penzig., Michelia 2 (8): 484 (1882) Fusarium dimerum Penz. (1882), Fusarium dimerum var. dimerum Penz. (1882) Fusarium roseum var. dracaenae Roum. (1882), Fusarium avenaceum f. fabalis X.Y. Ruan, Y.M. Jiang, W. Luo & J.H. Wang (1982), Fusarium avenaceum f. fabarum X.Y. Ruan, Y.M. Jiang, W. Luo & J.H. Wang (1982), 1883: J. Schröt., Cooke & Harkn. Fusarium deformans J. Schröt. (1883), Fusarium obtusisporum Cooke & Harkn. (1884), 1886-1895: Berl. & Voglino and Ellis & Everh Fusarium nivale Ces. ex Berl. & Voglino (1886), Fusarium nivale f. nivale Ces. ex Berl. & Voglino (1886), Fusarium nivale var. nivale Ces. ex Berl. & Voglino (1886), 13 Fusarium caeruleum Lib. ex Sacc. (1886); Fusarium caeruleum var. caeruleum Lib. ex Sacc. (1886) Fusarium heterosporum f. paspali Ellis & Everh. (1886), Fusarium barbatum Ellis & Everh. (1888), Fusarium acuminatum Ellis & Everh. (1895) Fusarium acuminatum subsp. acuminatum Ellis & Everh. Fusarium blasticola Rostr. (1895), (1895) 1887-1890: Cooke & Massee, Briard, Oudem., Fusarium bulbigenum Cooke & Massee (1887) Fusarium bulbigenum f. bulbigenum Cooke & Massee (1887), Fusarium bulbigenum var. bulbigenum Cooke & Massee (1887) Fusarium hypocreoideum Cooke & Massee (1888), Fusarium bugnicourtii Brayford (1987) Fusarium elongatum Cooke (1890); Fusarium asparagi Briard (1890) Fusarium caricis Oudem. (1890), 1891: Lagerh. & Rabenh, Erikss., Allesch., Fusarium aquaeductuum (Radlk. & Rabenh.) Lagerh. & Rabenh. (1891), Fusarium aquaeductuum subsp. aquaeductuum (Radlk. & Rabenh.) Lagerh. & Rabenh. (1891) Fusarium aquaeductuum var. aquaeductuum (Radlk. & Rabenh.) Lagerh. & Rabenh. (1891) Fusarium tritici Erikss. (1891) Fusarium robiniae Pass. (1891), 1892: G.F. Atk, Pass., J. Schröt. Fusarium persicae (Sacc.) G.F. Atk. (1892) Fusarium vasinfectum var. vasinfectum G.F. Atk. (1892), Fusarium vasinfectum G.F. Atk. (1892) Fusarium vasinfectum f. vasinfectum G.F. Atk. (1892) Fusarium cerasi Rolland & Ferry (1892), Fusarium mali Allesch. (1892), Fusarium succisae J. Schröt. (1892); 1893: Pound & Clem, Syd., E.F. Sm Fusarium rhizogenum Pound & Clem. (1893), Fusarium pyrochroum var. diatrypellicola Syd. (1893), 1894: Lambotte & Fautrey Fusarium scirpi Lambotte & Fautrey (1894), Fusarium scirpi f. scirpi Lambotte & Fautrey (1894) 14 Fusarium scirpi subsp. scirpi Lambotte & Fautrey (1894), Fusarium scirpi var. scirpi Lambotte & Fautrey (1894) Fusarium niveum E.F. Sm. (1894), 1895- 1908: Henn Fusarium camerunense Henn. (1895), Fusarium speiranthis Henn. (1896) Fusarium sarcochroum f. polygalae-myrtifoliae Henn. (1898) Fusarium paspalicola Henn. (1899), Paul Christoph Hennings Fusarium stromaticola Henn. (1900); Fusarium vogelii Henn. (1902); Fusarium eucalypticola Henn. (1901); Fusarium euonymi-japonici Henn. (1902); Fusarium derridis Henn. (1902) Fusarium coccidicola Henn. (1904), Fusarium juruanum Henn. (1904); Fusarium paspali Henn. (1905); Fusarium pentaclethrae Henn. (1905); Fusarium sorghi Henn. (1907); Fusarium coniosporiicola Henn. (1907), Fusarium coniosporiicola Henn. (1907) Fusarium coniosporiicola Henn. (1907), Fusarium phyllachorae Henn. (1907); Fusarium lucumae Henn. (1908) 1997-1900: Allesch., Brunaud., Speg., Prill. & Delacr, E.F. Sm., Syd. & P. Syd., Mussat Fusarium roseum var. lonicerae Allesch. (1897), 15 Fusarium roseum f. visci Brunaud (1898 ) Fusarium sapindophilum Speg. (1898), Fusarium dianthi Prill. & Delacr. (1899), Fusarium tracheiphilum E.F. Sm. (1899), Fusarium euonymi Syd. & P. Syd. (1900); Fusarium atrovirens (Berk.) Mussat (1900), 1901-1903: Bolley, Sorauer, Oudem., J.V. Almeida & Sousa da Câmara, Bres., C. Massal., C.J.J. Hall Fusarium lini Bolley (1901), Fusarium nivale (Fr.) Sorauer (1901), Fusarium nicotianae Oudem. (1902), Fusarium dimorphum J.V. Almeida & Sousa da Câmara (1903); Fusarium eichleri Bres. (1903); Fusarium lichenicola C. Massal. (1903), Fusarium vasinfectum var. pisi C.J.J. Hall (1903), 1904-1910: J. Sheld, Schikora, Koord., M.L. Lutz,Brick, Lindau, Peck, E.F. Sm, E.J. Butler Fusarium moniliforme J. Sheld. (1904), Fusarium moniliforme f. moniliforme J. Sheld. (1904) Fusarium moniliforme subsp. moniliforme J. Sheld. (1904), Fusarium moniliforme var. moniliforme J. Sheld. (1904) Fusarium vasinfectum var. pisi Schikora (1906), Fusarium veratri (Allesch.) Höhn. (1906), Fusarium javanicum Koord. (1907), Fusarium theobromae M.L. Lutz (1907), Fusarium decemcellulare Brick (1908), Fusarium didymum (Harting) Lindau (1909), Fusarium hibernans Lindau (1909); Fusarium willkommii Lindau (1909), Fusarium bartholomaei Peck (1909), Fusarium juglandinum Peck (1909); Fusarium cubense E.F. Sm. (1910), Fusarium cubense var. cubense E.F. Sm. (1910), Fusarium udum E.J. Butler (1910), 1910: Appel & Wollenweber Fusarium discolor Appel & Wollenw. (1910 Fusarium discolor var. sulphureum (Schltdl.) Appel & Wollenw. (1910 Fusarium elegans Appel & Wollenw. (1910) Fusarium falcatum Appel & Wollenw. (1910), Fusarium falcatum var. falcatum Appel & Wollenw. (1910), 16 Fusarium gibbosum Appel & Wollenw. (1910), Fusarium gibbosum var. gibbosum Appel & Wollenw. (1910), Fusarium martii Appel & Wollenw. (1910), Fusarium martii f. martii Appel & Wollenw. (1910), Fusarium martii var. martii Appel & Wollenw. (1910), Fusarium metachroum Appel & Wollenw. (1910); Fusarium orthoceras Appel & Wollenw. (1910), Fusarium orthoceras var. orthoceras Appel & Wollenw. (1910), Fusarium rostratum Appel & Wollenw. (1910); Fusarium rubiginosum Appel & Wollenw. (1910); Fusarium sarcochroum f. mali (Allesch.) Ferraris (1910) Fusarium subulatum Appel & Wollenw. (1910) Fusarium ventricosum Appel & Wollenw. (1913 1912: Jacz., Bruschi, Dasz., Kabát & Bubák Fusarium trifolii Jacz. (1912), Fusarium lycopersici Bruschi (1912), Fusarium albidoviolaceum Dasz. (1912) Fusarium fraxini Kabát & Bubák (1912), Dr.H. W. Wollenweber 1912-1935: Wollenweber Fusarium trichothecioides Wollenw. (1912) Fusarium conglutinans Wollenw. (1913), Fusarium conglutinans f. conglutinans Wollenw. (1913), Fusarium conglutinans var. conglutinans Wollenw. (1913), Fusarium lycopersici (Sacc.) Wollenw. (1913), Fusarium poae (Peck) Wollenw. (1914); 17 Fusarium poae f. poae (Peck) Wollenw. (1913), Fusarium redolens var. redolens Wollenw. (1913) Fusarium redolens Wollenw. (1913) Fusarium redolens f. redolens Wollenw. (1913 Fusarium udum (Berk.) Wollenw. (1913), Fusarium udum var. pusillum Wollenw. (1913) Fusarium udum var. udum (Berk.) Wollenw. (1913), Fusarium vasinfectum var. inodoratum Wollenw. (1913), Fusarium orthoceras var. triseptatum Wollenw. (1914 Fusarium batatas Wollenw. (1914), Fusarium batatas var. batatas Wollenw. (1914), Fusarium caudatum Wollenw. (1914) Fusarium orthoceras var. albidoviolaceum (Dasz.) Wollenw. (1916), Fusarium orthoceras var. longius (Sherb.) Wollenw. (1916), Fusarium zonatum (Sherb.) Wollenw. (1916), Fusarium zonatum f. zonatum (Sherb.) Wollenw. (1916) Fusarium zonatum (Sherb.) Wollenw. (1916), Fusarium zonatum f. zonatum (Sherb.) Wollenw. (1916),); Fusarium scirpi var. filiferum (Preuss) Wollenw. (1916), Fusarium scirpi var. longipes (Wollenw. & Reinking) Wollenw. (1916), Fusarium zonatum (Sherb.) Wollenw. (1916), Fusarium zonatum f. zonatum (Sherb.) Wollenw. (1916),); Fusarium filiferum (Preuss) Wollenw. (1916);; Fusarium dimerum var. majusculum Wollenw. (1916), Fusarium asclerotium (Sherb.) Wollenw. (1916), Fusarium anthophilum (A. Braun) Wollenw. (1916) Fusarium anthophilum f. anthophilum (A. Braun) Wollenw. (1916), Fusarium congoense Wollenw. (1916), Fusarium lateritium var. longum Wollenw. (1916), Fusarium moniliforme var. anthophilum (A. Braun) Wollenw. (1916), Fusarium uncinatum Wollenw. (1917), Fusarium uncinatum Wollenw. (1917), Fusarium uncinatum Wollenw. (1917), Fusarium fructigenum var. majus Wollenw. (1917), Fusarium aquaeductuum var. pusillum Wollenw. (1917), Fusarium aquaeductuum var. volutum Wollenw. (1917 Fusarium sambucinum var. coeruleum Wollenw. (1917), Fusarium culmorum var. majus Wollenw. (1924), Fusarium avenaceum var. pallens Wollenw. (1924), Fusarium pusillum Wollenw. (1924) Fusarium stilboides var. stilboides Wollenw. (1924), Fusarium stilboides Wollenw. (1924) Fusarium salicis var. minus Wollenw. (1924), 18 Fusarium fructigenum var. minus Wollenw. (1925), Fusarium oxysporum var. gladioli Massey (1926), Fusarium orthoconium Wollenw. (1926), Fusarium dimerum var. pusillum (Wollenw.) Wollenw. (1930), Fusarium ciliatum var. episphaericum (Cooke & Ellis) Wollenw. (1930), Fusarium ciliatum var. majus Wollenw. (1930) Fusarium conglutinans var. majus Wollenw. (1930), Fusarium cavispermum var. minus Wollenw. (1930), Fusarium culmorum var. cereale (Cooke) Wollenw. (1930), Fusarium dimerum var. violaceum Wollenw. (1930 Fusarium equiseti var. bullatum (Sherb.) Wollenw. (1930), Fusarium equiseti var. crassum Wollenw. (1930), Fusarium herbarum var. avenaceum (Fr.) Wollenw. (1930), Fusarium herbarum var. volutum Wollenw. (1930), Fusarium graminum var. herbarum (Corda) Wollenw. (1930), Fusarium lateritium var. fructigenum (Fr.) Wollenw. (1930), Fusarium lateritium var. majus (Wollenw.) Wollenw. (1930), Fusarium lateritium var. minus (Wollenw.) Wollenw. (1930), Fusarium lateritium var. tenue Wollenw. (1930), Fusarium lateritium var. uncinatum (Wollenw.) Wollenw. (1930), Fusarium herbarum var. graminum (Corda) Wollenw. (1930), Fusarium herbarum var. detonianum (Sacc.) Wollenw. (1930 Fusarium moniliforme var. minus Wollenw. (1930), Fusarium sambucinum var. minus Wollenw. (1930), Fusarium scirpi var. acuminatum (Ellis & Everh.) Wollenw. (1930), Fusarium scirpi var. caudatum (Wollenw.) Wollenw. (1930), Fusarium scirpi var. comma Wollenw. (1930), Fusarium scirpi var. compactum Wollenw. (1930), Fusarium semitectum var. majus Wollenw. (1930) Fusarium solani var. aduncisporum (Weimer & Harter) Wollenw. (1930), Fusarium solani var. martii (Appel & Wollenw.) Wollenw. (1930), Fusarium solani var. medium Wollenw. (1930), Fusarium sphaeriae var. majus Wollenw. (1930) Fusarium sporotrichioides var. minus Wollenw. (1930), Fusarium vasinfectum var. lutulatum (Sherb.) Wollenw. (1930), Fusarium vasinfectum var. zonatum (Sherb.) Wollenw. (1930), Fusarium poae f. pallens Wollenw. (1930), Fusarium solani var. eumartii (C.W. Carp.) Wollenw. (1931),); Fusarium reticulatum var. medium Wollenw. (1931), Fusarium reticulatum var. negundinis (Sherb.) Wollenw. (1931), Fusarium sambucinum var. medium Wollenw. (1931), Fusarium sarcochroum var. robiniae (Pass.) Wollenw. (1931), 19 Fusarium scirpi var. copactum Wollenw. (1931), Fusarium merismoides var. chlamydosporale Wollenw. (1931), Fusarium merismoides var. crassum Wollenw. (1931), Fusarium graminearum var. caricis (Oudem.) Wollenw. (1931), Fusarium heterosporum var. congoense (Wollenw.) Wollenw. (1931 Fusarium heterosporum var. lolii (Wm.G. Sm.) Wollenw. (1931), Fusarium heterosporum var. paspalicola (Henn.) Wollenw. (1931), Fusarium javanicum var. radicicola Wollenw. (1931), Fusarium dimerum var. nectrioides Wollenw. (1931), Fusarium bulbigenum var. batatas Wollenw. (1931), Fusarium bulbigenum var. blasticola (Rostr.) Wollenw. (1931), Fusarium bulbigenum var. niveum (E.F. Sm.) Wollenw. (1931), Fusarium bulbigenum var. tracheiphilum (E.F. Sm.) Wollenw. (1931), Fusarium conglutinans var. citrinum Wollenw. (1931), Fusarium flavum (Fr.) Wollenw. (1931); Fusarium nivale var. majus Wollenw. (1931), Fusarium solani var. striatum (Sherb.) Wollenw. (1931) Fusarium stilboides var. minus (Wollenw.) Wollenw. (1931), Fusarium solani var. eumartii (C.W. Carp.) Wollenw. (1931),); Fusarium solani var. striatum (Sherb.) Wollenw. (1931) Fusarium bactridioides Wollenw. (1934); Fusarium solani var. minus Wollenw. (1935) Fusarium oxysporum var. cubense (E.F. Sm.) Wollenw. (1935), 1915-1928 : Sherbakoff Fusarium anguioides Sherb. (1915) Fusarium anguioides f. anguioides Sherb. (1915) Fusarium anguioides var. anguioides Sherb. (1915) Fusarium anguioides var. caudatum Sherb. (1915) Fusarium angustum Sherb. (1915) Fusarium arthrosporioides Sherb. (1915) Fusarium arthrosporioides var. arthrosporioides Sherb. (1915), Fusarium arthrosporioides var. asporotrichum Sherb. (1915 Fusarium bullatum Sherb. (1915), Fusarium culmorum var. leteius Sherb. (1915), Fusarium cuneiforme Sherb. (1915), Fusarium diversisporum Sherb. (1915) Fusarium falcatum var. fuscum Sherb. (1915) Fusarium oxysporum var. asclerotium Sherb. (1915), Fusarium oxysporum var. longius Sherb. (1915), Fusarium oxysporum var. resupinatum Sherb. (1915), Fusarium lutulatum Sherb. (1915), Fusarium lutulatum var. zonatum Sherb. (1915), 20 Fusarium martii var. minus Sherb. (1915), Fusarium martii var. viride Sherb. (1915), Fusarium redolens var. solani Sherb. (1915), Fusarium sporotrichioides Sherb. (1915); Fusarium sporotrichioides subsp. sporotrichioides Sherb. (1915), Fusarium sporotrichioides var. sporotrichioides Sherb. (1915), Fusarium striatum Sherb. (1915), Fusarium udum var. solani Sherb. (1915), Fusarium redolens var. solani Sherb. (1915), Fusarium sporotrichioides Sherb. (1915); Fusarium sporotrichioides subsp. sporotrichioides Sherb. (1915), Fusarium sporotrichioides var. sporotrichioides Sherb. (1915), Fusarium striatum Sherb. (1915), Fusarium udum var. solani Sherb. (1915), Fusarium solani var. cyanum Sherb. (1915), Fusarium solani var. subfuscum Sherb. (1915 Fusarium sporotrichioides Sherb. (1915); Fusarium sporotrichioides subsp. sporotrichioides Sherb. (1915), Fusarium sporotrichioides var. sporotrichioides Sherb. (1915), Fusarium striatum Sherb. (1915), Fusarium udum var. solani Sherb. (1915), Fusarium negundinis Sherb. (1923) Fusarium spinaciae Sherb. (1923), Fusarium tumidum Sherb. (1928), 1915-1924 : C.W. Carp., Gonz. Frag. Lindf., Beach, E.W. Brandes, Davis, J. Johnson, Cif.m Loubière Fusarium eumartii C.W. Carp. (1915), Fusarium roseum var. phaseoli Gonz. Frag. (1916), Fusarium gymnosporangii Jaap (1916) Fusarium redolens var. angustius Lindf. (1917), Fusarium redolens var. angustius Lindf. (1917), Fusarium conglutinans var. callistephi Beach (1918), Fusarium cubense var. inodoratum E.W. Brandes (1919), Fusarium martii f. phaseoli Burkh. (1919), Fusarium sphaeriae var. robustum Davis (1919), Fusarium oxysporum var. nicotianae J. Johnson (1921), Fusarium roseum var. zeae Cif. (1921), Fusarium sampaioi Gonz. Frag. (1924); Fusarium sarcochroum var. casei Loubière (1924), Fusarium oxysporum var. obtusiusculum (Sacc.) Cif. (1924), 21 1925-1935: Wollenweber & Reinking Fusarium longipes Wollenw. & Reinking, (1925) Fusarium moniliforme var. majus Wollenw. & Reinking (1925), Fusarium moniliforme var. minus Wollenw. & Reinking (1925), Fusarium moniliforme var. subglutinans Wollenw. & Reinking (1925), Fusarium camptoceras Wollenw. & Reinking (1925); Fusarium chlamydosporum Wollenw. & Reinking (1925); Fusarium chlamydosporum var. chlamydosporum Wollenw. & Reinking (1925), Fusarium moniliforme var. erumpens Wollenw. & Reinking (1925), Fusarium neoceras Wollenw. & Reinking (1925); Fusarium neoceras var. neoceras Wollenw. & Reinking (1925) Fusarium coccophilum (Desm.) Wollenw. & Reinking (1935), Fusarium oxysporum var. gladioli Massey (1926), Fusarium orthoconium Wollenw. (1926), Fusarium avenaceum var. volutum (Wollenw.) Wollenw. & Reinking (1935), Fusarium orthoceras var. apii (P.E. Nelson & Sherb.) Wollenw. & Reinking (1935), 1926-1934: Weimer & Harter, Tucker, Caldis, Curzi, Linford, Jacz., Letov, Beeli, D. Stewart, . Benn, Fahmy, Kulk. Fusarium aduncisporum Weimer & Harter (1926) Fusarium batatas var. vanillae Tucker (1927), Fusarium moniliforme var. fici Caldis (1927), Fusarium moronei Curzi (1928); Fusarium oxysporum var. medicaginis Weimer (1928), Fusarium orthoceras var. pisi Linford (1928), Fusarium buharicum Jacz. ex Babajan & Teterevn.-Babajan (1929); Fusarium caucasicum Letov (1929); Fusarium album var. abietinum Beeli (1930) Fusarium conglutinans var. betae D. Stewart (1931), Fusarium vasinfectum var. sesami Zaprom. (1926), Fusarium scirpi var. nigrantum F.T. Benn. (1932), Fusarium scirpi var. pallens F.T. Benn. (1932), Fusarium vasinfectum var. egyptiacum Fahmy (1927), Fusarium albedinis (Kill. & Maire) Malençon (1934) Fusarium vasinfectum var. crotalariae Kulk. (1934), 1934-1936: Reinking , Sartory, R. Sartory, J. Mey. & Bamuli, Kirschst. Fusarium concolor Reinking (1934); Fusarium elongatum Reinking (1934) Fusarium tumidum var. humi Reinking (1934), Fusarium sublunatum Reinking (1934); 22 Fusarium sublunatum var. sublunatum Reinking (1934), Fusarium sublunatum var. elongatum Reinking (1935), Fusarium caeruleum var. cellulosae R. Sartory, J. Mey. & Bamuli (1935) Fusarium phragmiticola Kirschst. (1936); 937-1939: P.E. Nelson & Sherb, Syd., Bugnic., Hepting, Fusarium apii P.E. Nelson & Sherb. (1937) Fusarium apii var. apii P.E. Nelson & Sherb. (1937), Fusarium apii var. pallidum P.E. Nelson & Sherb. (1937) Fusarium andinum Syd. (1939) Fusarium oxysporum var. meniscoideum Bugnic. (1939 Fusarium perniciosum Hepting (1939), Fusarium tumidum var. coeruleum Bugnic. (1939), 1940-1845: Wollenw., Dearn. & House, Toole, Rodigin, T.F. Yu, L. McCulloch, Weimer, Padwick.. Fusarium orthoceras var. ricini Wollenw. (1940), Fusarium orthoceras var. betae Padwick (1940), Fusarium orthoceras var. callistephi Padwick (1940), Fusarium orthoceras var. ciceris Padwick (1940), Fusarium orthoceras var. conglutinans Padwick (1940), Fusarium ulmicola Dearn. & House (1940) Fusarium oxysporum f. perniciosum Toole (1941), Fusarium wolgense Rodigin (1942); Fusarium citriforme Jamal. (1943), Fusarium avenaceum var. fabae T.F. Yu (1944), Fusarium orthoceras var. gladioli L. McCulloch (1944), Fusarium udum var. cajani Padwick (1940), Fusarium udum var. crotalariae Padwick (1940), Fusarium solani f. lupini Weimer (1944) Fusarium oxysporum f. radicis-lupini Weimer (1944) Fusarium brachygibbosum Padwick (1945); W. (Bill) C. Snyder and H. N. Hansen 23 1940-1949: W.C. Snyder & H.N. Hansen Fusarium oxysporum f. apii (P.E. Nelson & Sherb.) W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. batatas (Wollenw.) W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. betae (D. Stewart) W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. callistephi (Beach) W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. cepae (Hanzawa) W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. conglutinans (Wollenw.) W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. cubense (E.F. Sm.) W.C. Snyder & H.N. Hansen (1940 Fusarium oxysporum f. gladioli (Massey) W.C. Snyder & H.N. Hansen (1940) Fusarium oxysporum f. lini (Bolley) W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. lupini W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. lycopersici (Sacc.) W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. melonis W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. medicaginis (Weimer) W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. narcissi W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. dianthi (Prill. & Delacr.) W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. pini (Hartig) W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. pisi (Linford) W.C. Snyder & H.N. Hansen (1940),); Fusarium oxysporum f. tuberosi W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. udum (E.J. Butler) W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. vasinfectum (G.F. Atk.) W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. nicotianae (J. Johnson) W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. niveum (E.F. Sm.) W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. spinaciae (Sherb.) W.C. Snyder & H.N. Hansen (1940), Fusarium oxysporum f. tracheiphilum (E.F. Sm.) W.C. Snyder & H.N. Hansen (1940) Fusarium oxysporum f. barbati W.C. Snyder (1941), 24 Fusarium solani f. cucurbitae W.C. Snyder & H.N. Hansen (1941), Fusarium solani f. eumartii (C.W. Carp.) W.C. Snyder & H.N. Hansen (1941) Fusarium solani f. phaseoli (Burkh.) W.C. Snyder & H.N. Hansen (1941) Fusarium solani f. pisi (F.R. Jones) W.C. Snyder & H.N. Hansen (1941) Fusarium solani f. radicicola (Wollenw.) W.C. Snyder & H.N. Hansen (1941), Fusarium oxysporum f. phaseoli J.B. Kendr. & W.C. Snyder (1942), Fusarium oxysporum f. raphani J.B. Kendr. & W.C. Snyder (1942), Fusarium episphaeria (Tode) W.C. Snyder & H.N. Hansen (1945) Fusarium episphaeria f. coccophilum (Desm.) W.C. Snyder & H.N. Hansen (1945), Fusarium episphaeria f. episphaeria (Tode) W.C. Snyder & H.N. Hansen (1945), Fusarium nivale f. graminicola (Berk. & Broome) W.C. Snyder & H.N. Hansen (1945), Fusarium roseum f. cereale (Cooke) W.C. Snyder & H.N. Hansen (1945 Fusarium rigidiusculum W.C. Snyder & H.N. Hansen (1945) Fusarium tricinctum f. poae (Peck) W.C. Snyder & H.N. Hansen (1945), Fusarium oxysporum f. rhois W.C. Snyder & Hepting (1949), 1948-1949: Steyaer, V.P. Bhide & Uppal, K.F. Baker, T.F. Yu & C.T. Fang, Laskaris, Toovey, Hepting Fusarium xylarioides Steyaert (1948), Fusarium orthoceras var. lathyri V.P. Bhide & Uppal (1948), Fusarium oxysporum f. matthioli K.F. Baker (1948), Fusarium oxysporum f. fabae T.F. Yu & C.T. Fang (1948 Fusarium oxysporum var. lathyri V.P. Bhide & Uppal (1948), Fusarium oxysporum f. delphinii Laskaris (1949), Fusarium oxysporum f. gladioli Toovey (1949), Fusarium lateritium f. pini Hepting (1949), 1950: Raillo. Sawada, Zambett.. (Kill. & Maire) Malençon, Petr., Fusarium aquaeductuum subsp. medium (Wollenw.) Raillo (1950) Fusarium aquaeductuum var. cavispermum (Corda) Raillo (1950) Fusarium aquaeductuum var. flavum (Fr.) Raillo (1950), Fusarium aquaeductuum var. dimerum (Penz.) Raillo (1950), Fusarium avenaceum subsp. volutum (Wollenw.) Raillo (1950), Fusarium avenaceum var. detonianum (Sacc.) Raillo (1950), Fusarium avenaceum var. graminum (Corda) Raillo (1950) Fusarium bulbigenum var. apii (P.E. Nelson & Sherb.) Raillo (1950), Fusarium bulbigenum var. cucumis Raillo (1950 Fusarium bulbigenum var. pisi (Linford) Raillo (1950), Fusarium compactum (Wollenw.) Raillo (1950); 25 Fusarium equiseti subsp. ossicola (Berk. & M.A. Curtis) Raillo (1950), Fusarium heterosporum var. negundinis (Sherb.) Raillo (1950), Fusarium lateritium subsp. majus (Wollenw.) Raillo (1950), Fusarium oxysporum var. callistephi Raillo (1950), Fusarium oxysporum var. cepae (Hanzawa) Raillo (1950), Fusarium oxysporum var. dianthi (Prill. & Delacr.) Raillo (1950) Fusarium oxysporum var. pisi (C.J.J. Hall) Raillo (1950), Fusarium oxysporum var. solani Raillo (1950), Fusarium oxysporum var. trifolii (Jacz.) Raillo (1950), Fusarium martii var. caucasicum Raillo (1950), Fusarium neoceras var. subglutinans (Wollenw. & Reinking) Raillo (1950), Fusarium moniliforme subsp. majus (Wollenw. & Reinking) Raillo (1950), Fusarium sambucinum var. cereale (Cooke) Raillo (1950), Fusarium wollenweberi Raillo (1950); Fusarium wollenweberi f. wollenweberi Raillo (1950), Fusarium scirpi subsp. acuminatum (Ellis & Everh.) Raillo (1950), Fusarium sporotrichioides subsp. minus (Wollenw.) Raillo (1950), Fusarium sporotrichioides var. tricinctum (Corda) Raillo (1950), Fusarium laricis Sawada (1950); Fusarium nivale var. oryzae Zambett. (1950), Fusarium oxysporum var. albedinis (Kill. & Maire) Malençon (1950), Fusarium mindoanum Petr. (1950); 1951-1954:T.T. McClure, Pettinari, Prasad, P.R. Mehta & Lal, (Luc) C. Moreau, W.L. Gordon, Prasad & Patel (1952. Fusarium solani f. batatas T.T. McClure (1951), Fusarium oxysporum var. opuntiarum Pettinari (1951), Fusarium oxysporum f. psidii Prasad, P.R. Mehta & Lal (1952), Fusarium annulatum Bugnic. (1952) Fusarium moniliforme f. subglutinans (Luc) C. Moreau (1952), Fusarium oxysporum var. redolens (Wollenw.) W.L. Gordon (1952) Fusarium lateritium f. cajani (Padwick) W.L. Gordon (1952), Fusarium lateritium f. crotalariae (Padwick) W.L. Gordon (1952), Fusarium oxysporum f. passiflorae W.L. Gordon (1954), Fusarium solani f. nicotianae Prasad & Patel (1952), 1953- Y. Nisik. & Kyoto Watan, Vasudeva & Sriniv., Bagchee , (Steyaert) Delassus, Tochetto, (T.F. Yu) W. Yamam., Cif. Fusarium bulbigenum var. nelumbicola Y. Nisik. & Kyoto Watan. (1953), Fusarium orthoceras var. lentis Vasudeva & Sriniv. (1953), Fusarium solani f. albiziae Bagchee (1954) Fusarium oxysporum f. xylarioides (Steyaert) Delassus (1954), Fusarium oxysporum var. herbemontis Tochetto (1954) Fusarium avenaceum f. fabae (T.F. Yu) W. Yamam. (1955), 26 Fusarium dominicanum Cif. (1955) 1953-1987: Bilaĭ Fusarium sporotrichiella Bilaĭ (1953), Fusarium sporotrichiella var. poae (Peck) Bilaĭ (1953), Fusarium sporotrichiella var. sporotrichiella Bilaĭ (1953), Fusarium sporotrichiella var. sporotrichioides (Sherb.) Bilaĭ (1953), Fusarium sporotrichiella var. tricinctum (Corda) Bilaĭ (1953), Fusarium avenaceum var. herbarum (Corda) Bilaĭ (1955), Fusarium microcera Bilaĭ (1955); Fusarium microcera var. microcera Bilaĭ (1955), Fusarium nivale var. larvarum (Fuckel) Bilaĭ (1955), Fusarium solani var. caeruleum (Lib. ex Sacc.) Bilaĭ (1955), Fusarium solani var. redolens (Wollenw.) Bilaĭ (1955), Fusarium tricinctum var. anthophilum (A. Braun) Bilaĭ (1955), Fusarium sambucinum var. trichothecioides (Wollenw.) Bilaĭ (1955), Fusarium gibbosum var. bullatum (Sherb.) Bilaĭ (1987), Fusarium avenaceum var. anguioides (Sherb.) Bilaĭ (1987), Fusarium moniliforme var. lactis (Pirotta) Bilaĭ (1987), Fusarium sambucinum var. ossicola (Berk. & M.A. Curtis) Bilaĭ (1987), Fusarium sambucinum var. sublunatum (Reinking) Bilaĭ (1987), Fusarium solani var. argillaceum (Fr.) Bilaĭ (1987), Fusarium sporotrichiella var. poae (Peck) Bilaĭ (1987), Fusarium sporotrichiella var. tricinctum (Corda) Bilaĭ (1987), Fusarium oxysporum var. orthoceras (Appel & Wollenw.) Bilaĭ (1987), Fusarium lateritium var. stilboides (Wollenw.) Bilaĭ (1987), Fusarium microcera var. orthoconium (Wollenw.) Bilaĭ (1987), Fusarium microcera var. cerasi (Rolland & Ferry) Bilaĭ (1987), Fusarium gibbosum var. acuminatum (Ellis & Everh.) Bilaĭ (1987), Fusarium sporotrichiella var. anthophilum (A. Braun) Bilaĭ (1987), 1954-1958: Gerlach, (Hepting) Carrera , Sauthoff, J.H. Owen, R.D. Raabe. (Ellis & Everh.) Arx, (Padwick) Erwin, Matus & K. Ishig. Fusarium oxysporum f. cyclaminis Gerlach (1954), Fusarium bulbigenum f. aechmeae Sauthoff & Gerlach (1957), Fusarium vasinfectum var. perniciosum (Hepting) Carrera (1955), Fusarium oxysporum f. cucumerinum J.H. Owen (1956), Fusarium oxysporum f. aechmeae Sauthoff (1957), Fusarium oxysporum f. hebes R.D. Raabe (1957), Fusarium lunatum (Ellis & Everh.) Arx (1957), Fusarium lateritium f. ciceris (Padwick) Erwin (1958), Fusarium oxysporum f. melongenae Matus & K. Ishig. (1958), 27 1959-1962: Sawada, Petr., W.L. Gordon ex B.K. Bakshi & S. Singh ter , (Desm.) Matuo & K. Satô, (Cooke & Harkn.) Arya & G.L. Jain, W. Yamam. Fusarium biseptatum Sawada (1959); Fusarium ramulicola Sawada (1959); Fusarium solani f. mori Sawada (1959), Fusarium kurdicum Petr. (1959); Fusarium solani f. dalbergiae W.L. Gordon ex B.K. Bakshi & S. Singh ter (1959), Fusarium splendens Matuo & Takah. Kobay. (1960); Fusarium solani f. piperis F.C. Albuq. (1961), Fusarium solani f. xanthoxyli Y. Sakurai & Matuo (1961), Fusarium lateritium f. mori (Desm.) Matuo & K. Satô (1962), Fusarium oxysporum f. ciceris Matuo & K. Satô (1962), Fusarium oxysporum f. eucalypti (Cooke & Harkn.) Arya & G.L. Jain (1962 Fusarium phyllostachydicola W. Yamam. (1962); 1964-1965:Y.N. Ming & T.F. Yu, G.M. Armstr. & J.K. Armstr., N. Barros Fusarium otomycosis Y.N. Ming & T.F. Yu (1966); Fusarium oxysporum f. cassiae G.M. Armstr. & J.K. Armstr. (1966), Fusarium roseum f. phaseoli N. Barros (1966), Fusarium solani f. keratitis Y.N. Ming & T.F. Yu (1966), Fusarium solani f. viridiflavum Y.N. Ming & T.F. Yu (1964), Fusarium solani f. robiniae Matuo & Y. Sakurai (1965), 1968-1969: Messiaen & R. Cass, Batikyan & Abramyan Fusarium roseum var. arthrosporioides (Sherb.) Messiaen & R. Cass. (1968), Fusarium roseum var. gibbosum (Appel & Wollenw.) Messiaen & R. Cass. (1968), Fusarium semitectum var. violaceum Batikyan & Abramyan (1969), Fusarium buxicola var. chlamydosporum Batikyan (1969), Fusarium lateritium var. microconidium Batikyan & Abramyan (1969), Fusarium martiellae-discolorioides Batikyan (1969); 1971: C. Booth, (E.J. Butler) W. Gams, (Padwick) Subram. Fusarium epistroma (Höhn.) C. Booth (1971), Fusarium fusarioides (Gonz. Frag. & Cif.) C. Booth (1971 Fusarium illudens C. Booth (1971) Fusarium stoveri C. Booth (1971), Fusarium lateritium var. buxi C. Booth (1971), Fusarium solani var. caeruleum (Lib. ex Sacc.) C. Booth (1971), Fusarium redolens f. spinaciae (Sherb.) Subram. (1971) Fusarium solani f. hibisci Ribeiro et al. (1971), 28 Fusarium sacchari (E.J. Butler) W. Gams, Cephalosporium-artige Schimmelpilze: 218 (1971) Fusarium merismoides f. ciceris (Padwick) Subram. (1971), 1973-1976: Joffe, P.K.S. Gupta, Tubaki, C. Booth & T. Harada Fusarium equiseti var. compactum (Wollenw.) Joffe (1973), Fusarium solani var. ventricosum (Appel & Wollenw.) Joffe (1973), Fusarium equiseti var. caudatum (Wollenw.) Joffe (1974), Fusarium equiseti var. longipes (Wollenw. & Reinking) Joffe (1974), Fusarium sporotrichioides var. chlamydosporum (Wollenw. & Reinking) Joffe (1974), Fusarium psidii P.K.S. Gupta (1974); Fusarium enterolobii P.K.S. Gupta (1974); Fusarium merismoides var. acetilereum Tubaki, C. Booth & T. Harada (1976), Fusarium merismoides var. ecetilereum Tubaki, C. Booth & T. Harada (1976) 1976-1977: Nirenberg, T. Aoki & Samuels, Gerlach Fusarium fijikuroi Nirenberg (1976); Fusarium proliferatum (Matsush.) Nirenberg (1976); Fusarium proliferatum var. minus Nirenberg (1976), Fusarium sacchari var. elongatum Nirenberg (1976), Fusarium sacchari var. subglutinans (Wollenw. & Reinking) Nirenberg (1976), Fusarium verticillioides (Sacc.) Nirenberg (1976), Fusarium proliferatum (Matsush.) Nirenberg ex Gerlach & Nirenberg (1982); Fusarium proliferatum var. proliferatum (Matsush.) Nirenberg ex Gerlach & Nirenberg (1982), Fusarium setosum Nirenberg & Samuels (1989); Fusarium setosum Nirenberg & Samuels (1989); Fusarium torulosum (Berk. & M.A. Curtis) Nirenberg (1995); Fusarium venenatum Nirenberg (1995); Fusarium nisikadoi T. Aoki & Nirenberg (1997); Fusarium zealandicum Nirenberg & Samuels (2000), Fusarium robustum Gerlach (1977); Fusarium larvarum var. rubrum Gerlach (1977), Fusarium lunulosporum Gerlach (1977) Fusarium merismoides var. violaceum Gerlach (1977), Fusarium chlamydosporum var. fuscum Gerlach (1977) 29 Wally F. O. Marasas 1982-1983: L.W. Burgess, P.E. Nelson & Toussoun, Marasas Fusarium crookwellense L.W. Burgess, P.E. Nelson & Toussoun (1982); Fusarium subglutinans (Wollenw. & Reinking) P.E. Nelson, Toussoun & Marasas (1983), Fusarium subglutinans var. subglutinans (Wollenw. & Reinking) P.E. Nelson, Toussoun & Marasas (1983), 1983-1984: Subrahm, Rossman, Samuels & Rogerson Fusarium lacertarum Subrahm. (1983); Fusarium tasmanicum (McAlpine) Rossman (1983); , Fusarium staphyleae Samuels & Rogerson (1984), 1986-1987: L.W. Burgess & Trimboli, Marasas, P.E. Nelson, Toussoun & P.S. van Wyk Fusarium nygamai L.W. Burgess & Trimboli (1986), Fusarium polyphialidicum Marasas, P.E. Nelson, Toussoun & P.S. van Wyk (1986); Fusarium dlaminii Marasas, P.E. Nelson & Toussoun (1986) Fusarium beomiforme P.E. Nelson, Toussoun & L.W. Burgess, Mycologia 79: 884-889 (1987) 1987-1991: Chen Fusarium solani var. petroliphilum Q.T. Chen & X.H. Fu (1987), Fusarium sphaerosporum Q.T. Chen & X.H. Fu (1987); Fusarium merismoides var. artocarpi X.H. Fu & Q.T. Chen (1989), Fusarium merismoides var. persicicola X.H. Fu & Q.T. Chen (1989), Fusarium moniliforme var. annulatum (Bugnic.) F.J. Chen (1991), Fusarium subglutinans var. succisae (J. Schröt.) F.J. Chen (1991), 30 1988-1989: Tivoli, P.E. Nelson & Rabie, R.F. Castañeda, P. Oliva, Fresneda & N. Rodr., Fusarium roseum f. compactum Tivoli (1988), Fusarium napiforme Marasas, P.E. Nelson & Rabie (1988); Fusarium pallidoroseum var. majus (Wollenw.) R.F. Castañeda, P. Oliva, Fresneda & N. Rodr. (1989) Fusarium setosum Nirenberg & Samuels (1989); 1990-1993:Agnihothr. & Nirenberg, A. Pande & V.G. Rao , Gruyter & J.H.M. Schneid, Fusarium ambrosium (Gadd & Loos) Agnihothr. & Nirenberg (1990) Fusarium oxysporum f. tabernaemontanae A. Pande & V.G. Rao (1990 Fusarium cereale (P. Karst.) Gruyter & J.H.M. Schneid. (1991), Fusarium torulosum (Berk. & M.A. Curtis) Gruyter & J.H.M. Schneid. (1991); Fusarium moniliforme var. hangzhouense Gong C. Wang & Q.M. Ye (1992), 1993-1998: G.A. Forbes, Windels & L.W. Burgess, Sangal., Summerell, Marasas & Logrieco, Klittich, J.F. Leslie, P.E. Nelson Fusarium acuminatum subsp. armeniacum G.A. Forbes, Windels & L.W. Burgess (1993) Fusarium avenaceum subsp. aywerte Sangal. & L.W. Burgess (1995) Fusarium avenaceum subsp. nurragi Summerell & L.W. Burgess (1995), Fusarium babinda Summerell, C.A. Rugg & L.W. Burgess (1995); Fusarium globosum Rheeder, Marasas & P.E. Nelson (1996); Fusarium thapsinum Klittich, J.F. Leslie, P.E. Nelson & Marasas (1997), Fusarium musarum Logrieco & Marasas (1998); Fusarium nelsonii Marasas & Logrieco (1998); Kerry O'Donnell 31 1998: Nirenberg & O'Donnell, T. Aoki, Fusarium acutatum Nirenberg & O'Donnell (1998) Fusarium begoniae Nirenberg & O'Donnell (1998) Fusarium brevicatenulatum Nirenberg & O'Donnell (1998) Fusarium bulbicola Nirenberg & O'Donnell (1998); Fusarium circinatum Nirenberg & O'Donnell (1998), Fusarium concentricum Nirenberg & O'Donnell (1998); Fusarium denticulatum Nirenberg & O'Donnell (1998); Fusarium guttiforme Nirenberg & O'Donnell (1998); Fusarium pseudocircinatum O'Donnell & Nirenberg (1998); Fusarium pseudonygamai O'Donnell & Nirenberg (1998); Fusarium pseudoanthophilum Nirenberg, O'Donnell & Mubat. (1998); Fusarium ramigenum O'Donnell & Nirenberg (1998); Fusarium kyushuense O'Donnell & T. Aoki (1998); Fusarium phyllophilum Nirenberg & O'Donnell (1998); 1999-2000: O'Donnell & T. Aoki, W. Gams, Klamer, Benyon, Summerell & L.W. Burgess, Fusarium pseudograminearum O'Donnell & T. Aoki (1999), Fusarium miscanthi W. Gams, Klamer & O'Donnell (1999); Fusarium aywerte (Sangal. & L.W. Burgess) Benyon & L.W. Burgess (2000) Fusarium nurragi (Summerell & L.W. Burgess) Benyon, Summerell & L.W. Burgess (2000); Fusarium armeniacum (G.A. Forbes, Windels & L.W. Burgess) L.W. Burgess & Summerell (2000); 2000-2002: Koord.) Q.M. Ye, Geiser & Juba, Palacios-Prü & V. Marcano, Marasas, Rheeder, Lampr., K.A. Zeller & J.F. Leslie, T. Aoki, O'Donnell & K. Ichik. Fusarium solani var. javanicum (Koord.) Q.M. Ye (2000), Fusarium hostae Geiser & Juba (2001); Fusarium alkanophilum Palacios-Prü & V. Marcano (2001) Fusarium andiyazi Marasas, Rheeder, Lampr., K.A. Zeller & J.F. Leslie (2001) Fusarium fractiflexum T. Aoki, O'Donnell & K. Ichik. (2001); Fusarium falciforme (G. Carrión) Summerb. & Schroers (2002 2003: T. Aoki, O'Donnell, K. Ichik, Britz, Marasas, M.J. Wingf., Summerell, J.F. Leslie, Yosh. Homma, Lattanzi Fusarium sterilihyphosum Britz, Marasas & M.J. Wingf. (2002); Fusarium mangiferae Britz, M.J. Wingf. & Marasas (2002); Fusarium konzum Zeller, Summerell & J.F. Leslie (2003), 32 Fusarium tucumaniae T. Aoki, O'Donnell, Yosh. Homma & Lattanzi (2003); Fusarium virguliforme O'Donnell & T. Aoki (2003); Fusarium phaseoli (Burkh.) T. Aoki & O'Donnell (2003), B. A. Summerell, John F. Leslie H Corby. Kistler 2004:Torp, Nirenberg, L.W. Burgess, Summerell, O'Donnell, T. Aoki, Kistler & Geiser, Baayen & Hooftman Fusarium langsethiae Torp & Nirenberg (2004); Fusarium gaditjirrii Phan, L.W. Burgess & Summerell (2004), Fusarium acaciae-mearnsii O'Donnell, T. Aoki, Kistler & Geiser (2004) Fusarium asiaticum O'Donnell, T. Aoki, Kistler & Geiser (2004) Fusarium austroamericanum T. Aoki, Kistler, Geiser & O'Donnell (2004) Fusarium boothii O'Donnell, T. Aoki, Kistler & Geiser (2004); Fusarium brasilicum T. Aoki, Kistler, Geiser & O'Donnell (2004); Fusarium meridionale T. Aoki, Kistler, Geiser & O'Donnell (2004); Fusarium mesoamericanum T. Aoki, Kistler, Geiser & O'Donnell (2004); Fusarium foetens Schroers, O'Donnell, Baayen & Hooftman (2004); Fusarium matuoi Hosoya & Tubaki (2004), Fusarium cortaderiae O'Donnell, T. Aoki, Kistler & Geiser (2004); H.P. Bachmann 2005-2008: H.P. Bachm., T. Aoki & O'Donnell, Starkey, L.R. Gale, Kistler, Aberra, Z.H. Zhao & G.Z. Lu Fusarium brasiliense T. Aoki & O'Donnell (2005); Fusarium cuneirostrum O'Donnell & T. Aoki (2005); Fusarium gerlachii T. Aoki, Starkey, L.R. Gale, Kistler & O'Donnell (2007); 33 Fusarium vorosii B. Tóth, Varga, Starkey, O'Donnell, H. Suga & T. Aoki (2007); Fusarium aethiopicum O'Donnell, Aberra, Kistler & T. Aoki (2008) Fusarium delphinoides Schroers, Summerb., O'Donnell & Lampr. (2009), Fusarium sinensis Z.H. Zhao & G.Z. Lu (2008); Yli-Mattila Tapani R.C. Ploetz Gabriel Otero-Colina S. Freeman 2009-2010: Schroers, Summerb. & O'Donnell, T. Aoki, Gagkaeva, Yli-Mattila, Kistler, , S. Freeman, Otero-Colina, Rodr.-Alv., Fern.-Pav., R.C. Ploetz, A. Jacobs, Marasas & P.S. van Wyk Fusarium biseptatum Schroers, Summerb. & O'Donnell (2009), Fusarium nectrioides (Wollenw.) Schroers, Summerb. & O'Donnell (2009), Fusarium penzigii Schroers, Summerb. & O'Donnell (2009), Fusarium ussurianum T. Aoki, Gagkaeva, Yli-Mattila, Kistler & O'Donnell (2009); Fusarium mexicanum T. Aoki, S. Freeman, Otero-Colina, Rodr.-Alv., Fern.Pav., R.C. Ploetz & O'Donnell (2010); Fusarium ananatum A. Jacobs, Marasas & P.S. van Wyk (2010) F. Ameena Nalim Antonio Moretti E.C.Y. Liew 2011: Samuels, Nalim & Geiser, Summerell & E.C.Y. Liew, T. Aoki & O'Donnell, P. Nicholson, Gagkaeva, Burkin, Kononenko, Gavrilova, Yli-Mattila, Van Hove, Waalwijk, Munaut, Logrieco & Ant. Moretti, Scaufl. & Munaut Fusarium pseudensiforme Samuels, Nalim & Geiser (2011); Fusarium rectiphorum Samuels, Nalim & Geiser (2011) Fusarium kelerajum Samuels, Nalim & Geiser (2011); 34 Fusarium haematococcum Nalim, Samuels & Geiser (2011 Fusarium kurunegalense Samuels, Nalim & Geiser (2011) Fusarium mahasenii Samuels, Nalim & Geiser (2011); Fusarium burgessii M.H. Laurence, Summerell & E.C.Y. Liew (2011); Fusarium crassistipitatum Scandiani, T. Aoki & O'Donnell (2011); Fusarium louisianense L.R. Gale, Kistler, O'Donnell & T. Aoki (2011); Fusarium nepalense T. Aoki, Jon Carter, P. Nicholson, Kistler & O'Donnell (2011); Fusarium sibiricum Gagkaeva, Burkin, Kononenko, Gavrilova, O'Donnell, T. Aoki & Yli-Mattila (2011); Fusarium musae Van Hove, Waalwijk, Munaut, Logrieco & Ant. Moretti (2011); Fusarium temperatum Scaufl. & Munaut (2011); Takayuki Aoki David M. Geise Ning Zhang Cristiano S. Lima 2012-2013: T. Aoki, H. Suga, F. Tanaka, Scandiani & O'Donnell, C.S. Lima, Pfenning & J.F. Leslie, Geiser, Short & Ning Zhang Fusarium cicatricum (Berk.) O'Donnell & Geiser (2013); Fusarium azukiicola T. Aoki, H. Suga, F. Tanaka, Scandiani & O'Donnell (2012); Fusarium tupiense C.S. Lima, Pfenning & J.F. Leslie (2012); Fusarium cyanostomum (Sacc. & Flageolet) O'Donnell & Geiser (2013); Fusarium cicatricum (Berk.) O'Donnell & Geiser (2013); Fusarium keratoplasticum D. Geiser, O’Donnell, Short & Ning Zhang (2013); Fusarium neocosmosporiellum O'Donnell & Geiser (2013) Fusarium torreyae T. Aoki, J.A. Sm., L. Mount, Geiser & O’Donnell (2013); Fusarium petroliphilum (Q.T. Chen & X.H. Fu) D. Geiser, O’Donnell, Short & Ning Zhang (2013), 35 3. Fusarium nomenclature 3.1. The name  The genus Fusarium was first described and named by Link (1809), based on the classical shape of its fusiform macroconidia, then it was sanctioned under Fries 1821.  The anamorphs within this clade have consistently been described as Fusarium, with occasional isolates or species classified in other genera including Acremonium, Cylindrocarpon, Pycnofusarium,Trichofusarium, Cephalosporium, and others particularly when the macroconidia are not observed.  A number of lineages basal to the terminal Fusarium clade that produce Fusarium-like anamorphs were recently moved to new, revised, or existing genera based on morphological and phylogenetic considerations, such as Microcera, Macroconia, Fusicolla, and Stylonectria  With the abandonment of dual nomenclature, a broad consensus within the global community of Fusarium researchers has strongly supported the unitary use of the name Fusarium instead of several teleomorph names linked to it. 3.2. One Fungus, One Name  In a letter to the editor, Geiser et al., 2013, advocated recognizing the genus Fusarium as the sole name for a group that includes virtually all Fusarium species causing infection or mycotoxicosis in plants, man and animals.  This circumscription will free scientists from any obligation to use other genus names, including teleomorphs, for species nested within this clade, and 36  preserve the application of the name Fusarium in the way it has been used for almost a century. Due to recent changes in the International Code of Nomenclature for algae, fungi, and plants, this is an urgent matter that requires community attention. The alternative is to break the longstanding concept of Fusarium into nine or more genera, and remove important taxa such as those in the F. solani species complex from the genus, a move they believe is unnecessary. 3.3. Species concepts and phylogenetic classification:  Morpho-species concept (MSC): Current classifications schemes are based exclusively on a morphological species concept (MSC), typically Fusarium species are defined on the basis of a few distinctive morphological features: o curved, transversely septate conidia (“macroconidia”) produced from sporodochia or pionnotes, o generally smaller conidia of various shapes and septation (“microconidia” and/or “mesoconidia”) produced from unbranched or branched mycelial conidiophores, producing conidiogenous cells with one (monophialidic) or more (polyphialidic) openings, and o thick-walled, generally globose thallospores (chlamydospores) produced in or on hyphae or conidia, singly or in chains or bunches. o Sexual spores, when observed, produced in flaskshaped fruiting bodies (perithecia) that are usually in shades of red, orange, blue or purple, with little or no stromatal tissue. Asci produced from distinct hymenia, single37 walled (unitunicate) containing eight ascospores, which usually possess one or more septa, but can be aseptate.   Biological species concept (BSC): o The biological species concept defines a species as members of populations that actually or potentially interbreed in nature, i.e. they produce sexual spores (teleomorph). o The biological species concept is verified by mating experiments o The biological species concept has been used to identify species in the Gibberella fujikuroi F. solani species complexes, that are known to produce teleomorph spores o This approach cannot be used for species that do not produce a teleomorph, such as F. oxysporum. o Thus, the concept has been developed for only a few species and mating experiments take about one month to complete, many strain fail to mate with standard testers, and negative data are equivocal. Phylogenetic species concept (PSC) : These species are defined as the smallest group of populations for which a unique profile of character states, including autapomorphies o An same (autapomorphy) is a derived trait that is unique to one group, o A same (synapomorphy) is a derived trait shared by two or more groups. and synapomorphies, are fixed within the populations 38 o Such species defining derived characters (apomorphies) form the basis of a cladistic analysis that are extending to all species of Fusarium. 3.4. Clades/Complexes The genus Fusarium encompasses at least 20 genealogically exclusive clades, lineages or complexes: 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. F. sambucinum, F. chlamydosporum, F. incarnatum-equiseti F. tricinctum F. heterosporum F. fujikuroi F. nisikadoi F. oxysporum F. redolens F. babinda F. concolor F. lateritium F. buharicum F. buxicola F. staphyleae F. solani F. decemcellulare F. albidum F. dimerum F. ventricosum species complexes or clades. Each clade or complex comprises several species, e.g. 5 phylogenetically distinct species were identified within Fusarium oxysporum and approximately 50 species within Fusarium solani. 3.5. Formae speciales 39 Pathogenic strains of F. oxysporum cause wilt diseases on a number of agronomically important crops. Isolates that attack the same crop are included in the same forma specialis. Most formae speciales are pathogenic to a single crop e.g.  F. oxysporum f. sp. cubense on banana,  F. oxysporum f. sp. dianthi on carnation,  F. oxysporum f. sp. vasinfectum on cotton.  Some attack more than one crop, e.g. F. oxysporum f. sp. cucumerinum affects both cucumber and melon.  Within F. oxysporum species, there is a high level of host specificity with over 120 described formae speciales. 3.6. Races Most formae speciales of F. oxysporum are comprised of two or more races, whereas a small proportion are monotypic (e.g. F. oxysporum f. sp. radicis-lycopersici). Races in F. oxysporum are defined by their impact on differential host cultivars.  F. oxysporum can be distinguished into physiological races on the basis of the capacity of the pathogen to attack differential carnation cultivars. To date, ten races have been described worldwide. o Races 1 and 8 apparently originated in the Italian Riviera, where they are associated with Mediterranean carnation ecotypes found in Italy, France, and Spain. It attacks, mostly Gros Michel, Silk, Pome and Latundan cultivars o Race 2 is widespread in all areas of carnation cultivation in the world. It attacks Bluggoe and other plantain (ABB genome) bananas o Race 4 is found in carnation cultivars in the United States, Italy, Israel, Spain, and Colombia. It is pathogenic to Cavendish bananas 40 o Race 3 was initially classified as a Fod race, but DNA-based methods recently reclassified it as F. redolens, revealing that F. redolens and F. oxysporum not only are different species but also lack a sister group relationship. Isolates in race 4 are further subdivided into Foc ‘tropical’ and Foc ‘subtropical’, based on whether or not they cause disease on Cavendish bananas under tropical environmental conditions. 3.7. Characterization of formae speciales based on pathogenicity This can be problematic , because: o complete sets of differentials may no longer be available o pathogenicity tests can be influenced by temperature, host age, method of inoculation and other variables, those conducted in different laboratories may generate incongruent results. o field testing is time-consuming, expensive, and appropriate test sites may not be available for a given race or for the needed length of time. o F. oxysporum cannot be morphologically distinguished from other formae speciales that cause wilting in other hosts and other non-pathogenic F. oxysporum endophytes, saprophytes and antagonists. 3.8. Characterization of formae speciales into vegetative compatibility groups (VCG): o Vegetative compatibility is controlled in Fusarium spp. by several vegetative (vic) or heterokaryon (het) incompatibility loci. o For two individuals to be vegetatively compatible and form a stable heterokaryon, they need to share a common allele at each vic locus. 41 o VCGs represent good phenotypic characters for assessing diversity within populations. o Vegetative compatibility may be determined with complementation assays between auxotrophic nutritional mutants. o Puhalla (1985) developed an efficient technique for determining compatibility. o Vegetative compatibility test in FOC has been assessed with nitratenonutilizing, nit, mutants. (A) Wildtype isolates are cultured on a chlorate containing medium on which mutant sectors eventually form (lower righthand corner). (B) Mutant sectors that develop usually grow diffusely on a medium that contains nitrate as the sole source of N. These nit mutants are phenotyped for utilization of different nitrogen sources to determine the portion of the nitrate utilization pathway that has been affected. (C) nit mutants have been plated on a basal medium that contains either ammonium (upper left), nitrate (upper right), hypoxanthine (lower left) or nitrite (lower right). The mutant at the top of each of these plates is a NitM mutant since it utilizes neither nitrate nor hypoxanthine. All that remain, except that on the lower left, utilize all but nitrate and are nit1 mutants. (D) Wild-type growth at the intersection of complementary mutants, as seen in the following picture, (Ploetz, R.C. 2005. Panama Disease: An Old Nemesis Rears its Ugly Head Part 2) 42 VCGs of Fusarium oxysporum To date, more than 20 VCGs of Fusarium oxysporum have been reported.  Some are distributed worldwide,  others have narrow distributions.  Some of the VCGs have been recovered from a wide array of cultivars and genomes,  some have come from specific banana genomes, and  others have been found on a single cultivar. 3.9. Chemotypes of the Fusarium graminearum Complex (Fg complex) Every species within the Fg complex is capable of producing type B trichothecenes in plants. Based on the chemical structure, including the acetylation position, 5 type B trichothecene chemotypes have been identified within the Fg complex: 1. 3-acetyldeoxy-nivalenol (3-AcDON): F. ussurianum strains 2. 15-acetyldeoxynivalenol (15-AcDON): F. aethiopicum, F. boothii and F.vorosii strains 3. 4-acetylnivalenol (NIV): F. meridionale and F. gerlachii strains 4. 3-AcDON, 15-AcDON and NIV: F. graminearum s.s. and F. asiaticum. 5. AcDON and NIV: F. mesoamericanum, F. austroamericanum, F. cortaderiae, F. brasilicumcan and F. acaciae-mearnsii. 43 4. Classification of the genusFusarium 4.1. Historical:  The genus Fusarium was erected by Link in 1809 for fungi with canoe- or banana-shaped conidia  Approximately 1000 species had been described in the period 1809-1935  Wollenweber & Reinking , Germany (1935)- organized the genus in 16 sections,65 species, 55 varieties, 22 forms  Snyder& Hansen (1940s), U SA- compressed the 16 sections into nine species, and the species in section Elegans into a single species, F. oxysporum.  Railo (1950), Russia –mentioned 55 species  Gordon (1952), Canada- mentioned 26 species  Bilai (1955 ), Russia –mentioned 9 sections, 26 species, 29 varieties  Messiaen & Cassi (1968), France-mentioned 9 species  Booth (1971), England- 48 species and 104 forms and varieties  Mato(1972), Japan- 10 species  Joffe (1974), Isael-13 sections,33 species,14 varieties  Gerlach (1982) , Germany-78 species  Nelson, Toussoun & Massas (1983), USA -30 species  Leslie and Summerell (2006) summarized information for 70 species of Fusarium, and this monographic publication was the first for the genus to integrate morphological and phylogenetic information. 44 4.2.Wollenbecher and Reinking classification of Fusarium genus (1935) 4.2.1. Fusarium species I. Section: Eupionnotes (Nectria) 1. F. aquaeductuum (Radlk. et Rabh.) Lagh (N. episphaeriae v. coronate) 2. F. cavispermum, Corda 3. F. melanochlorum (Casp.) Sacc . (N. flavor-viridis) 4. F. merismoides Corda 5. F. dimerum Penzig 6. F. flavum (Fr.) Wr. II. Section:Macroconia (Nectria) 7. 8. 9. 10. F. coccophilum n.c. (N. coccophila) F. buxicola Sacc, (N. Desmazierii) F. expansum Schlechtendahl (N. stilbosporae) F. sphaeriae Fuckel: (N. leptosphaeriae) 11. F. gigas Spegazzini III. Section:Spicarioides (Calonectria) 12. F. decemcellulare Brick( Calonectria rigidinscula ) IV. Section: Submicrocera (Calonectria) 13. F. ciliatum Link (Calonectria decora) 14. F. cerasi Roll. et Ferry V. Section:Pseudomicrocera ( Calonectria) 15. F. juruanum P. Henn (Calonectria diploa) 16. F. orthoconium Wr. VI. Section:Arachnites (Calonectria) 17. F. nivale (Fr.) Ces (Calonectria graminicola) 18. F. kühnii (Fuck.) Sacc. 19. F. larvarum Fuck VII. Section:Sporotrichiella 20. 21. 22. 23. F. poae (Peck) Wr. F. chlamydosporum Wr. et RG. F. tricinctum (Cda.) Sacc. F. sporotrichioides Sherb. VIII. Section:Roseum 45 24. 25. 26. 27. F. avenaceum (Fr.) Sacc. F. graminum Corda F. arthrosporioides Sherb. F. De Tonianum Sacc. IX. Section:Arthrosporiella 28. 29. 30. 31. 32. F. semitectum Berk. et Rav. F. camptoceras Wr. et Rg. F. anguioides Sherb. F. concolor Rh. F. diversisporum Sherb. X. Section:Gibbosum (Gibberella) 33. F. scirpi Lamb. et Fautr. with var. acuminatum (G. acuminate) 34. F. equiseti (Cda.) Sacc. with var. bullatum (G. intricans) XI. Section:Discolor (Gibberella) Subsection Neesiola 35. F. heterosporum Nees 36. F. reticulatum Mont. (Gibberella cyanea ?) Subsection Saubinetii (gibberella) 37. 38. 39. 40. 41. 42. 43. F. graminearum Schwabe: (G. saubinetii) F. sambucinum Fuckel (G. pulicaris) F. culmorum (W.G.Sm.) Sacc. F. flocciferum Corda (G. heterochroma) F. sublunatum Rg. F. macroceras Wr. et Rg. F. tumidum Sherb. Subsection Trichthecioides 44. F. trichothecioides Wr. 45. F. bacteridioides Wr. XII. Section:Laterituim (Gibberella) 46. F. lateritium Nees (Gibberella baccata) 47. F. sacrochroum (Desm. ) Sacc (G. pseudopulicaris) 48. F. stilboides Wr. XIII. Section:Liseola (Gibberella) 49. F. moniliforme Sheld. (Gibberella fujikuroi) 50. F. lactis Pir. et Rib. 51. F. neoceras Wr. et Rg XIV. Section:Elegans Subsection Ortocera 46 52. 53. 54. 55. 56. F. orthoceras App et Wr. F. conglutinans Wr F. lini Bolley F. bostrycoides Wr. et Rg. F. angustum Sherb Subsection Constrictum 57. F. bulbigenum Cke. et Mass Subsection Oxysporum 58. 59. 60. 61. F. oxysporum Schl. F. dianthi Prill. et Del. F. vasinfectum Atk. F. redolens Wr. XV. Section:Martiella (Hypomyces) 62. F. javanicum Koord. (Hypomyces) 63. F. solani (Mart. Pr. P.) App. et Wr. 64. F. coeruleum (Lib.) Sacc XVI. Section:Ventrocosum (Hypomyces) 65. F. argillaceum Fr.) Sacc.: (Hypomyces solani) 4.2.2. Fusarium varieties 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. F. aquaeductuum (Radlk. et Rabh.) Lagh. v. medium F. avenaceum (Fr.) Sacc. v. volutum n.c. F. bulbigenum Cke. et Mass v. batatas Wr. F. bulbigenum Cke. et Mass v. blasticola (Rostr.) Wr. F. bulbigenum Cke. et Mass v. lycopersici (Brushi)Wr. F. bulbigenum Cke. et Mass v. niveum (E.F.S,.) Wr. F. bulbigenum Cke. et Mass v. tracheiphilum (E.F.S,.) Wr. F. conglutinans Wr. v. betae Stewart F. conglutinans Wr. v. citrinum Wr. F. conglutinans Wr. v. callistephi Beach F. culmorum (W.G.Sm.) Sacc. v. cereal (Cke.) Wr. F. dimerum Penzig v. nectrioides Wr. F. dimerum Penzig v. pusillum Wr. F. dimerum Penzig v. violaceum Wr. F. equiseti (Cda.) Sacc. v. bullatum (Sherb.)Wr.: Gibberella intricans Wr. 16. F. heterpsporum Nees v. congoense Wr. 47 17. F. javanicum Koord. v. ensiforme (wr. et Rg.) Wr.:Hypomyces ipomoeae (Hals.) v. major Wr, 18. F. javanicum Koord. v. radicicola Wr.: : Hypomyces ipomoeae (Hals.) f. 1 Wr. 19. F. lateritium Nees v. longum Wr. 20. F. lateritium Nees v.majus Wr.: Gibberella baccata (Wallr.) Sacc. v. major Wr. 21. F. lateritium Nees v. minus Wr. 22. F. lateritium Nees v. mori Desm.: Gibberella baccata (Wallr.) Sacc. v. moricola (DNtrs.) Wr. 23. F. lateritium Nees v. uncinatum Wr. 24. F. merismoides Corda v. chlamydosporale Wr. 25. F. merismoides Corda v. crassum Wr. 26. F. moniliforme Sheldon: Gibberella Fujikuroi (Saw.) Wr. 27. F. moniliforme Sheldon v. anthophilum (A.Br.) Wr. 28. F. moniliforme Sheldon v. minus Wr. 29. F. moniliforme Sheldon v. subglutinans Wr. et Rg.: Gibberella Fujikuroi (Saw) Wr. v. subglutinans Edw. 30. F. nivale (Fr.) Ces.: v. majus Wr.: Calonectria graminicola (Berk. et Brme.) Wr. v. neglecta Krpe 31. F. orthoceras App et Wr. v. apii (Nels. et Cochr.) n.c. 32. F. orthoceras App et Wr. v. pisi Linford 33. F. oxysporum Schl. v. aurantiacum (Lk.) Wr. 34. F. oxysporum Schl. v. cubense (F.F.Sm.) n.c. 35. F. oxysporum Schl. v. Gladioli Mass. 36. F. oxysporum Schl. v. medicaginis Weimer 37. F. oxysporum Schl. v. nicotianae Johns. 38. F. reticulatum Mont. v. negundinis (Sherb.) Wr. 39. F. sambucinum Fuck. v. minus Wr. 40. F. scirpi Lamb. et Fautr. v. acuminatum (Ell. et Ev.) Wr.: Gibberella accuminata Wr. 41. F. scirpi Lamb. et Fautr. v. caudatum Wr. 42. F. scirpi Lamb. et Fautr. v. compactum Wr. 43. F. scirpi Lamb. et Fautr. v. filiferum (Presuu) Wr. 44. F. semitectum Berk. et Rav. v. majus Wr. 45. F. solani (Mart. Pr. P.) App. et Wr. v. aduncisporum (Weim et Hart) Wr. 46. F. solani (Mart. Pr. P.) App. et Wr. v. eumartii (Carp.) Wr. Hypomyces haematococcus (Berk et Brme.) Wr. 48 47. F. solani (Mart..) v. Martii (App. et Wr.) Wr. 48. F. solani (Mart. ) App. et Wr. v. minus Wr. hypomyces haematococcus (Berk. et Brme.) v. breviconus Wr. 49. F. solani (Mart.) App. et Wr. v. striatum (Sherb.) Wr.: hypomyces haematococcus (Berk. et Brme.) v. cancri (Rutg.) Wr. 50. F. sporotrichioides Sherb. v. minus Wr. 51. F. sublunatum v. elongatum Rg. 52. F. tumidum Sherb. v. humi Rg. 53. F. vasinfectum Atk. v. lutulatum (Sherb.) Wr. 54. F. vasinfectum Atk. v. zonatum (Sherb.) Wr. 55. F. aquaeductuum (Radlk. et Rabh.) Lagh. v. medium Wr.: Necteria episphaeria (Tode) Fr. 4.2.3. Fusarium formae 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. F. avenaceum (Fr.) Sacc. f.1 n.c. F. orthoceras App et Wr. v. apii (Nels. et Cochr.) f. 1. n.c. F. oxysporum Schl. f. 1 Wr F. oxysporum Schl. f. 2 Wr F. oxysporum Schl. f. 6 Wr F. oxysporum Schl. f. 7 Wr F. oxysporum Schl. f. 8 Snyder F. oxysporum Schl. v. aurantiacum (Lk.) f. 1 Wr. F. redolens f. 1 Wr. F. reticulatum Mont. f. 1 Wr. F. sambucinum Fuck. f. 1 Wr. F. sambucinum Fuck. f. 2 Wr. F. sambucinum Fuck. f. 4 Wr. F. sambucinum Fuck. f. 5 Wr. F. sambucinum Fuck. f, 6 Wr. F. solani (Mart..) v. Martii (App. et Wr.) f. 1 Wr. F. solani (Mart..) v. Martii (App. et Wr.) Wr. f. 2 Snyder F. solani (Mart..) v. Martii (App. et Wr.) Wr. f. 3 Snyder F. vasinfectum Atk. f; 1 Wr. F. vasinfectum Atk. f; 2 n.c. F. vasinfectum Atk. v. zonatum (Sherb.) f. 1 (Lk.) et Bail.) Wr. F. vasinfectum Atk. v. zonatum (Sherb.) f. 2 (Lk.) et Bail.) Wr. 49 4.3. Snyder and Hansen classification, 1940 1. 2. 3. 4. 5. 6. 7. 8. 9. Fusarium episphaeria Fusarium rigidiuscula Fusarium nivale Fusarium tricinctum Fusarium roseum Fusarium lateritium Fusarium moniliforme Fusarium oxysporum Fusarium solani 4.4. A. Raillo classification, 1950 1. Fusarium anguioides f. 1 Raillo 2. Fusarium anguioides f. 2 Raillo 3. Fusarium anthophilum f. 1 Raillo 4. Fusarium anthophilum f. 2 Raillo 5. Fusarium aquaeductuum subsp. medium (Wollenw.) Raillo, 6. Fusarium aquaeductuum var. cavispermum (Corda) Raillo, 7. Fusarium aquaeductuum var. dimerum (Penz.) Raillo 8. Fusarium aquaeductuum var. flavum (Fr.) Raillo 9. Fusarium avenaceum subsp. volutum (Wollenw.) Raillo 10. Fusarium avenaceum var. detonianum (Sacc.) Raillo 11. Fusarium avenaceum var. graminum (Corda) Raillo 12. Fusarium bulbigenum var. apii (R. Nelson & Sherb.) Raillo 13. Fusarium bulbigenum var. cucumis Raillo 14. Fusarium bulbigenum var. pisi (Linford) Raill 15. Fusarium caudatum f. 1 Raillo 16. Fusarium caudatum var. filiferum Raillo 17. Fusarium compactum (Wollenw.) Raillo 18. Fusarium conglutinans f. 1 Raillo 19. Fusarium equiseti f. 1 Raillo 20. Fusarium equiseti f. 1 Raillo 21. Fusarium equiseti f. 2 Raillo 22. Fusarium equiseti subsp. ossicola (Berk. & M.A. Curtis) Raillo 50 23. Fusarium flocciferum f. 1 Raillo 24. Fusarium heterosporum f. 1 Raillo 25. Fusarium heterosporum f. 2 Raillo 26. Fusarium heterosporum var. negundinis (Sherb.) Raillo 27. Fusarium javanicum subsp. ensiforme (Wollenw. & Reinking) Raillo 28. Fusarium lateritium subsp. majus (Wollenw.) Raillo 29. Fusarium martii var. caucasicum Raillo 30. Fusarium moniliforme subsp. majus (Wollenw. & Reinking) Raillo 31. Fusarium neoceras var. subglutinans (Wollenw. & Reinking) Raillo 32. Fusarium oxysporum var. callistephi Raillo 33. Fusarium oxysporum var. cepae (Hanzawa) Raillo 34. Fusarium oxysporum var. dianthi (Prill. & Delacr.) Raillo, 35. Fusarium oxysporum var. pisi (C.J.J. Hall) Raillo 36. Fusarium oxysporum var. solani Raillo 37. Fusarium oxysporum var. trifolii (Jacz.) Raillo 38. Fusarium poae f. 1 Raillo 39. Fusarium sambucinum f. 1 Raillo 40. Fusarium sambucinum f. 2 Raillo 41. Fusarium sambucinum var. cereale (Cooke) Raillo 42. Fusarium sarcochroum f. 1 Raillo 43. Fusarium scirpi subsp. acuminatum (Ellis & Everh.) Raillo 44. Fusarium semitectum f. 1 Raillo 45. Fusarium sporotrichioides subsp. minus (Wollenw.) Raillo 46. Fusarium sporotrichioides var. tricinctum (Corda) Raillo 47. Fusarium wollenweberi Raillo 48. Fusarium wollenweberi f. 1 Raillo 4.5. W. Gerlach & H.I. Nierenberg classification, 1982 1. 2. 3. 4. 5. Fusarium acuminatum Ell. & Kellerm. Fusarium anguioides Sherb. Fusarium annulatum Bugnicourt Fusarium anthophilum (A. Braun) Wollenw. Fusarium aquaeductuum (Radlk. & Rabenh.) Lagerh. var. aquaeductuum 6. Fusarium aquaeductuum (Radlk. & Rabenh.) Lagerh. var. medium Wollenw. 7. Fusarium arthrosporioides Sherb. 51 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. Fusarium avenaceum (Fr.) Sacc. var. avenaceum Fusarium avenaceum (Fr.) Sacc. var. volutum Wollenw. & Reinking Fusarium bactridioides Wollenw. Fusarium buharicum Jaczewski ex Babayan & Temereyenkoyea Fusarium buxicola Sacc Fusarium camtoceras Wollenw. & Reinking Fusarium caucasicum Letov Fusarium cavispermum Corda Fusarium chlamydosporum Wollenw. & Reinking var. chlamydosporum Fusarium chlamydosporum Wollenw. & Reinking var. fuscum Gerlach Fusarium ciliatum Link Fusarium coccidicola P. Henn Fusarium coccophilum (Desm.) Wollenw. & Reinking Fusarium coeruleum (Libert) ex Sacc. Fusarium compactum (Wollenw.) Gordon Fusarium concolor Reinking Fusarium culmorum (W. G. Smith) Sacc. Fusarium decemcellulare Brick. Fusarium detonianum Sacc. Fusarium dimerum Penzig in Sacc. Fusarium diversisporum Sherb. Fusarium epistroma (Höhnel) C. Booth Fusarium equiseti (Corda) Sacc. var. equiseti Fusarium eumartii Carpenter Fusarium expansum Schlecht. Fusarium flavum (Fr.) Wollenw. Fusarium flocciferum Corda Fusarium fujikuroi Nirenberg Fusarium gigas Speg. Fusarium graminearum Schwabe Fusarium graminum Corda 52 39. Fusarium heterosporum Nees ex Fr. var. congoense (Wollenw.) Wollenw. 40. Fusarium heterosporum Nees ex Fr. var. heterosporum 41. Fusarium illudens C. Booth 42. Fusarium inflexum R. Schneider in Schneider & Dalchow 43. Fusarium javanicum Koorders 44. Fusarium kuehnii (Fuckel) Sacc. 45. Fusarium lactis Pirotta & Riboni 46. Fusarium larvarum Fuckel 47. Fusarium larvarum Fuckel var. rubrum Gerlach 48. Fusarium lateritium Nees ex Link. var. lateritium 49. Fusarium lateritium Nees ex Link. var. longum Wollenw. 50. Fusarium lateritium Nees ex Link. var. majus (Wollenw.) Wollenw. 51. Fusarium longipes Wollenw. & Reinking 52. Fusarium lunulosporum Gerlach 53. Fusarium macroceras Wollenw. & Reinking 54. Fusarium melanochlorum (Casp.) Sacc. 55. Fusarium merismoides (Corda) var. merismoides 56. Fusarium merismoides Corda var. acetilereum Tubakai, C. Booth & Harada 57. Fusarium merismoides Corda var. chlamydosporale Wollenw. 58. Fusarium merismoides Corda var. crassum Wollenw. 59. Fusarium merismoides Corda var. violaceum Gerlach 60. Fusarium neoceras Wollenw. & Reinking 61. Fusarium nivale Ces. Ex Sacc. var majus Wollenw. 62. Fusarium nivale Ces. Ex Sacc. var. nivale 63. Fusarium orthoconium Wollenw. 64. Fusarium oxysporum Schlecht. var. meniscoideum Bugnicourt 65. Fusarium oxysporum Schlecht. var. Oxysporum 66. Fusarium poae (Peck) Wollenw. in Lewis 67. Fusarium proliferatum (Matsushima) Nirenberg 68. Fusarium proliferatum (Matsushima) Nirenberg var. minus Nirenberg 69. Fusarium redolens Wollenw. 70. Fusarium reticulatum Montagne var. reticulatum 53 71. 72. 73. 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. 93. 94. 95. 96. 97. 98. 99. Fusarium robustum Gerlach Fusarium sacchari (Butler) W. Gams Fusarium sacchari (Butler) W. Gams var. elongatum Nirenberg Fusarium sacchari (Butler) W. Gams var. subglutinans (Wollenw. & Reinking) Nirenberg Fusarium sambucinum Fuckel var. coeruleum Wollenw. Fusarium sambucinum Fuckel var. sambucinum Fusarium sarcochroum (Desm.) Sacc. Fusarium semitectum Berk. & Rav. in Berkeley var. majus Wollenw. Fusarium semitectum Berk. & Rav. in Berkeley var. semitectum Fusarium solani (Mart.) Sacc. var. solani Fusarium sphaeriae Fuckel Fusarium sporotrichioides Sherb. var. minus Wollenw. Fusarium sporotrichioides Sherb. var. sporotrichioides Fusarium stilboides Wollenw. var. stilboides Fusarium stoveri Fusarium sublunatum Reinking var. elongatum (Reinking) Reinking in Wollenweber & Reinking Fusarium sublunatum Reinking var. sublunatum Fusarium succisae (Schröter) Sacc. Fusarium sulphureum Schlecht. Fusarium tabacinum (Beyma) W. Gams in Gams & Gerlagh Fusarium trichothecioides Wollenw. in Jamieson & Wollenweber Fusarium tricinctum (Corda) Sacc. Fusarium tumidum Sherb. var. coeruleum Bugnicourt Fusarium tumidum Sherb. var. humi Reinking Fusarium tumidum Sherb. var. tumidum Fusarium udum Butler Fusarium ventricosum Appel & Wollenw. Fusarium verticillioides (Sacc.) Nirenberg Fusarium xylarioides Steyaert 54 4.6. C. Booth classification, 1971. 4.6.1. Fusarium species 1. Section:Arachnites 1. 2. 3. 4. F. stoveri Booth F. tabacinum (Beyma) W. Gams F. dimerum Penzig F. nivale (Fr.) Ces. Rabenh. [Submicrocera] 2. Section:Martiella [Ventricosum] 5. 6. 7. 8. F. solani (Mart.) Sacc. F. illudens Booth F. ventricosum Appel & Wollenweber F. tumidum Sherb 3. Section:Epispheria [Eupionnotes and Macroconia] 9. 10. 11. 12. 13. 14. 15. F. aquaeductuum Lagh. F. buxicola Sacc. F. epistromum (Höhn.) Sacc. F. melanochlorum (Casp.) Sacc. F. merismoides Corda F. sphaeriae Fockel F. gigas Speg. 4. Section:Spicarioides 16. F. decemcellulare Brick. 5. Section: Sporotrichiella 17. F. poae (Peck) Wrollenweber 18. F. tricinctum (Corda.) Sacc 6. Section: Arthrosporiella 19. F. sporotrichioides Sherb. 20. F. fusarioides (Frag. & Cif,) Booth [Roseum] 21. F. avenaceum (Corda ex Fr.) Sacc. 22. F. camptoceras Wollenw. & Reink. 23. F. semitectum Berk. & Berkeley 7. Section: Coccophilum 55 24. F. larvarum Fuckel. [Pseudomicrocera and Macroconia] 25. F. coccophilum (Desm.) Wollenw. 26. F. juruanum P. Henn. 8. Section: Lateritium 27. 28. 29. 30. 31. F. lateritium Nees F. lateritium var. buxi F. udum Butler F. stilboides Wollenw. F. xylarioidesSteyaert 9. Section: Liseola 32. F. moniliforme Sheldon. 10. Section: Elegens 33. F. oxysporum Schlech. 34. F. oxysporum var. redolens 11. Section: Gibbosum 35. 36. 37. 38. F. concolor Reinking F. equiseti (Corda) Sacc. F. acuminatum Ellis & Everhart F. arthrosporioides Sherb. 12 . Section: Discolor 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. F. trichothecioides Wollenw F. bubaricum Jaczewski F. sambucinum Fuckel F. sambucinum Fuckel var. corruleum Wollenw. F. culmorum (W. G. Smith) Sacc. F. heterosporum Nees Gibberella gordonia spec. nov. F. graminearum Schwabe F. flocciferum Corda F. sulphureum Sclechtendahl 4.6.2.Fusarium varieties 1. 2. 3. 4. F. solani (Mart.) Sacc. f. sp. albizziae F. solani (Mart.) Sacc. f. sp. aurantifoliae F. solani (Mart.) Sacc. f. sp. batatas F. solani (Mart.) Sacc. f. sp. cucurbitae 56 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. F. solani (Mart.) Sacc. f. sp. dalbergiae F. solani (Mart.) Sacc. f. sp. cumartii F. solani (Mart.) Sacc. f. sp. fabae F. solani (Mart.) Sacc. f. sp. keratitis F. solani (Mart.) Sacc. f. sp. lupini F. solani (Mart.) Sacc. f. sp. mori F. solani (Mart.) Sacc. f. sp. otomycosis F. solani (Mart.) Sacc. f. sp. phaseoli F. solani (Mart.) Sacc. f. sp. piperis F. solani (Mart.) Sacc. f. sp. pisi F. solani (Mart.) Sacc. f. sp. radicicola F. solani (Mart.) Sacc. f. sp. robiniae F. solani (Mart.) Sacc. f. sp. viridiflavum F. solani (Mart.) Sacc. f. sp. Xanthoxyli F. solani (Mart.) Sacc. f. sp. Coeruleum F. aquaeductuum var. medium F. avenaceum (Corda ex Fr.) Sacc. fabae F. semitectum var. majus F. lateritium (Nees) emend. Snyd & Hansen f. sp. cerealis F. lateritium (Nees) emend. Snyd & Hansen f. sp.ciceri F. lateritium (Nees) emend. Snyd & Hansen f. sp. mori F. lateritium (Nees) emend. Snyd & Hansen f. sp. pini F. lateritium (Nees) emend. Snyd & Hansen f. sp. buxi var. nov. F. lateritium var. buxi Booth var. nov. F. udum Butler f. sp. crotalariae F. moniliforme var. subglutinans Fusarium oxysporum f.sp. aechmeae Fusarium oxysporum f.sp. albedinis Fusarium oxysporum f.sp. anethi Fusarium oxysporum f.sp. asparagi Fusarium oxysporum f.sp. batatas Fusarium oxysporum f.sp. betae Fusarium oxysporum f.sp. callisephi Fusarium oxysporum f.sp. cannabis Fusarium oxysporum f.sp. carthami Fusarium oxysporum f.sp. cassia Fusarium oxysporum f.sp. cattleyae Fusarium oxysporum f.sp. cepae Fusarium oxysporum f.sp. ciceris 57 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67. 68. 69. 70. 71. 72. 73. 74. 75. 76. 77. 78. 79. 80. 81. 82. Fusarium oxysporum f.sp. chrysanthemi Fusarium oxysporum f.sp. coffeae Fusarium oxysporum f.sp. conglutinans Fusarium oxysporum f.sp. coriandrii Fusarium oxysporum f.sp. cubense Fusarium oxysporum f.sp. cucumerinum Fusarium oxysporum f.sp. cumini Fusarium oxysporum f.sp. cyclaminis Fusarium oxysporum f.sp. delphinii Fusarium oxysporum f.sp. dianthi Fusarium oxysporum f.sp. elacagni Fusarium oxysporum f.sp. elacidis Fusarium oxysporum f.sp. eucalypti Fusarium oxysporum f.sp. fabae Fusarium oxysporum f.sp.fragariae Fusarium oxysporum f.sp. gerberae Fusarium oxysporum f.sp. gladioli Fusarium oxysporum f.sp. glycines Fusarium oxysporum f.sp. hebae Fusarium oxysporum f.sp. herbemontis Fusarium oxysporum f.sp. gladioli Fusarium oxysporum f.sp. langenariae Fusarium oxysporum f.sp. lathyri Fusarium oxysporum f.sp. lentis Fusarium oxysporum f.sp. lini Fusarium oxysporum f.sp. luffae Fusarium oxysporum f.sp.lupini Fusarium oxysporum f.sp. lycopersici Fusarium oxysporum f.sp. mathioli Fusarium oxysporum f.sp. medicaginis Fusarium oxysporum f.sp. melonis Fusarium oxysporum f.sp. narcissi Fusarium oxysporum f.sp. nicotianae Fusarium oxysporum f.sp. niveum Fusarium oxysporum f.sp. opuntiarum Fusarium oxysporum f.sp. passiflorae Fusarium oxysporum f.sp. passiflorae Fusarium oxysporum f.sp. perniciosum Fusarium oxysporum f.sp. phaseoli 58 83. Fusarium oxysporum f.sp. pini 84. Fusarium oxysporum f.sp. pisi 85. Fusarium oxysporum f.sp. psidii 86. Fusarium oxysporum f.sp. querci 87. Fusarium oxysporum f.sp. radici-lupini 88. Fusarium oxysporum f.sp.raphani 89. Fusarium oxysporum f.sp. rauvoltiae 90. Fusarium oxysporum f.sp. rhois 91. Fusarium oxysporum f.sp. ricini 92. Fusarium oxysporum f.sp. stedi 93. Fusarium oxysporum f.sp. sesame 94. Fusarium oxysporum f.sp. sesbaniae 95. Fusarium oxysporum f.sp. spinaciae 96. Fusarium oxysporum f.sp. stachydis 97. Fusarium oxysporum f.sp. tracheiphilum 98. Fusarium oxysporum f.sp. trifolii 99. Fusarium oxysporum f.sp. tuberosi 100. Fusarium oxysporum f.sp. tulipae 101. Fusarium oxysporum f.sp. vanillae 102. Fusarium oxysporum f.sp. vasinfectum 103. Fusarium oxysporum f.sp. zingiberi 104. F. heterosporum Nees Ex Fr. f. sp. aleuritidis 4.7. John F. Leslie, Brett A. Summerell. The Fusarium Laboratory Manual, 2006 1. Fusarium acuminatum Ellis & Everhart 2. Fusarium acutatum Nirenberg & O’Donnell 3. Fusarium andiyazi Marasas, Rheeder, Lampr., K.A. Zeller & J.F. Leslie, 4. Fusarium anthophilum (A. Braun) Wollenweber 5. Fusarium armeniacum ( Forbes, Windels & Burgess) Burgess & Summerell 6. Fusarium avenaceum (Fries) Saccardo 59 7. Fusarium aywerte (Sangalng & L.W. Burgess) Benyon & L.W. Burgess 8. Fusarium babinda Summerell, C.A. Rugg & L.W. Burgess 9. Fusarium begoniae Nirenberg and O’ Donnell 10. Fusarium beomiforme P.E. Nelson, Toussoun & L.W. Burgess 11. Fusarium brevicatenulatum Nirenberg , O’Donnell, Kroschel & Andrianaivo 12. Fusarium bulbicola Nirenberg & O’Donnell, 13. Fusarium camptoceras Wollenweber & Reinking,emend. Marasas & Logrieco 14. Fusarium chlamydosporum Wollenw. & Reinking 15. Fusarium circinatum Nirenberg & O’Donnell, emend Britz, Coutinho, Wingfield and Marasas 16. Fusarium compactum (Wollenweber) Gordon 17. Fusarium concentricum Nirenberg & O’Donnell 18. Fusarium crookwellense L.W. Burgess, P.E. Nelson & Toussoun 19. Fusarium culmorum (W.G. Smith) Saccardo 20. Fusarium decemcellulare Brick 21. Fusarium denticulatum Nirenberg & O’Donnell 22. Fusarium dimerum Penzig 23. Fusarium dlaminii Marasas, P.E. Nelson & Toussoun 24. Fusarium equiseti (Corda) Saccardo 25. Fusarium foetens Schroers, O’Donnell, Baayen & Hooftman 26. Fusarium fujikuroi Nirenberg 27. Fusarium globosum Rheeder, Marasas & P.E. Nelson 28. Fusarium graminearum Schwabe 29. Fusarium guttiforme Nirenberg & O’Donnell 30. Fusarium heterosporum Nees ex Fries 31. Fusarium hostae Geiser & Juba 32. Fusarium konzum Zeller, Summerell & J.F. Leslie 33. Fusarium lactis Pirotta & Riboni 34. Fusarium lateritium Nees 35. Fusarium longipes Wollenw. & Reinking 36. Fusarium mangiferae Britz, M.J. Wingf. & Marasas 60 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. Fusarium merismoides Corda Fusarium miscanthi W. Gams, Klamer & O’Donnell Fusarium musarum Logrieco & Marasas Fusarium napiforme Marasas, P.E. Nelson & Rabie Fusarium nelsonii Marasas & Logrieco Fusarium nisikadoi T. Aoki & Nirenberg Fusarium nurragi (Summerell & L.W. Burgess) Benyon, Summerell & L.W. Burgess Fusarium nygamai L.W. Burgess & Trimboli Fusarium oxysporum Schlchtendahl Fusarium phyllophilum Nirenberg & O’Donnell Fusarium poae (Peck) Wolleweber Fusarium polyphialidicum Marasas, P.E. Nelson, Toussoun & P.S. van Wyk Fusarium proliferatum (Matsush.) Nirenberg Fusarium pseudoanthophilum Nirenberg & O'Donnell Fusarium pseudocircinatum Nirenberg & O'Donnell Fusarium pseudograminearum O'Donnell & T. Aoki Fusarium pseudonygamai Nirenberg & O'Donnell Fusarium ramigenum Nirenberg & O'Donnell Fusarium redolens Wollenweber Fusarium sacchari (E.J. Butler) W. Gams . Fusarium sambucinum Fuckel Fusarium scirpi Lambotte & Fautrey Fusarium semitectum Berkeley & Ravenel Fusarium solani (Martius) Appel & Wollenweber, emend, Snyder & Hansen Fusarium sporotrichioides Sherbakoff Fusarium sterilihyphosum Britz, Marasas & M.J. Wingfield Fusarium subglutinans (Wollenweber & Reinking) P.E. Nelson, Toussoun & Marasas Fusarium succisae (J. Schröter) Saccardo Fusarium thapsinum Klittich, J.F. Leslie, P.E. Nelson & Marasas Fusarium torulosum (Berkeley & M.A. Curtis) Nirenberg 61 67. 68. 69. 70. Fusarium tricinctum (Corda) Saccardo Fusarium udum E.J. Butler Fusarium venenatum Nirenberg Fusarium verticillioides (Saccardo) Nirenberg 4.8. Toxigenic Fusarium species 1. Fusarium acaceae-mearnsii: nivalenol, 3A- Deoxynivalenol 2. Fusarium acuminatum: trichothecenes, enniatin B, moniliformin 3. Fusarium acutatum: beauvericin, fumonisin 4. Fusarium aethiopicum : 15A- Deoxynivalenol 5. Fusarium anantum: fumonisins 6. Fusarium andiyazi: moniliformin, fumonisins 7. Fusarium anthophilum: moniliformin, fumonisins 8. Fusarium armeniacum: T-2. HT-2, neosolaniol 9. Fusarium asiaticum: trichothecines 10. Fusarium astroamericanum: nivalenol, 3A- Deoxynivalenol 11. Fusarium avenaceum: beauvericin, fusarin C, moniliformin, enniatins A,B,C 12. Fusarium begonia: moniliformin, fumonisin B1 13. Fusarium beomiforme: moniliformin, beauvericin 14. Fusarium boothii : 15A- Deoxynivalenol 15. Fusarium brasilicum: nivalenol, 3A- Deoxynivalenol 16. Fusarium brevicatenulatum: fumonisin B1 17. Fusarium chlamydosporum: moniliformin 18. Fusarium circinatum: beauvericin, fusaric acid 19. Fusarium compactum trichothecenes 20. Fusarium concentricum: fumonisins 21. Fusarium crookwellense: nivalenol, zearalenone, fusaric acid, fusarin C 22. Fusarium culmorum: moniliformin,deoxynivalenol, fusarin C, zearalenone, trichothecines 62 23. Fusarium dactylidis: nivalenol , zearalenone 24. Fusarium delphinoides: indole-3-acetic acid 25. Fusarium denticulatum: moniliformin 26. Fusarium dlaminii: beauvericin, moniliformin, fumonisins 27. Fusarium equiseti: butenolidem, beauvericin, trichothecenes, nivalenol, T-2 toxin, fusarochromanon, zearalenone, equisetin, 28. Fusarium fujikuroi: moniliformin, beauvericin, fusaric acid 29. Fusarium gerlachii: nivalenol 30. Fusarium globosum: fumonisin, beauvericin, fusaproliferin 31. Fusarium graminearum: zearalenon, nivalenol, 3ADeoxynivalenol, 15A-Deoxynivalenol 32. Fusarium guttiforme: beauvericin, fusaproliferin 33. Fusarium heterosporum: fusaric acid 34. Fusarium konzum: fumonisins, beauvericin, fusaproliferin 35. Fusarium kyushuense: trichothecenes 36. Fusarium lactis: moniliformin 37. Fusarium lateritium: enniatins, lateropyrone 38. Fusarium longipes: beauvericin 39. Fusarium langsethiae: diacetoxyscirpenol, T-2 toxin , HT2 toxin, neosolaniol culmorins, chrysogine, aurofusarin, and enniatins 40. Fusarium louisianense: nivalenol 41. Fusarium mangiferae: azepinostatin 42. Fusarium meridionale: nivalenol 43. Fusarium mesoamerricanum: nivalenol, 3A- Deoxynivalenol 44. Fusarium musae: moniliformin 45. Fusarium musarum: trichothecenes 46. Fusarium napiforme: moniliformin, fusaric acid, fumonisins 47. Fusarium nepalense: 15A- Deoxynivalenol 48. Fusarium nisikadoi: moniliformin 49. Fusarium nygamai: beauvericin, fusaric acid, fumonisins, moniliformin 50. Fusarium oxysporum: beauvericin, bikaverin, enniatins, fusaric acid, fusarin C, isoverrucanol, moniliformin, sambutoxin, wortmannin, fumonisins 63 51. Fusarium phyllophilum: fumonisins, moniliformin, beauvericin, fusaproliferin 52. Fusarium poae: beauvericin, fusarin C, trichothecenes 53. Fusarium polyphialidicum: fuminosins 54. Fusarium proliferatum: gibberellic acid, beauvericin, fusaproliferin, fusaric acid, fusarins,,moniliformin 55. Fusarium pseudoanthophilum: beauvericin 56. Fusarium pseudocircinatum: moniliformin, fusaproliferin, fumonisins 57. Fusarium pseudograminearum: deoxynivalenol, 3-acetyl deoxynivalenol, zearalenone 58. Fusarium pseudonygamai: moniliformin, fusaproliferin, fumonisins 59. Fusarium ramigenum: moniliformin, fusaproliferin, beauvericin, fumonisin B1, fumonisin B2 60. Fusarium redolens: fusaric acid, fumonisins 61. Fusarium sacchari: fusaric acid, fumonisins 62. Fusarium sambucinum: enniatins, beauvericin, fusaric acid, fusarin C, sambutoxin, wortmannin 63. Fusarium semitectum: apicidins, beauvericin, equisetin, fusapyrone, moniliformin, sambutoxin, trichothecenes, zearalenone 64. Fusarium sibiricum : trichothecenes 65. Fusarium solani: deoxynivalenol, T-2 toxin, zearalenone 66. Fusarium sporotrichioides: butenolide, fusarin C, monilformin, scirpentriol, zearalenone, T-2 toxin 67. Fusarium sterilihyphosum: monilformin 68. Fusarium subglutinans: moniliformin, beauvericin, fusaric acid, fusaproliferin, fumonisins 69. F. succisae fusaproliferin 70. Fusarium temperatum: moniliformin, beauvericin, enniatins, fumonisin B1 71. Fusarium thapsinum: moniliformin, fusaric acid, fumonisins 72. Fusarium torulosum: enniatin B, wortmannin 73. Fusarium tricinctum :fusarin C, enniatins, moniliformin 64 74. Fusarium tumidum: neosolaniol 75. Fusarium udum: fusaric acid 76. Fusarium ussurianum : trichothecenes 3A- Deoxynivalenol 77. Fusarium venenatum: trichothecenes 78. Fusarium virguliforme: toxin FvTox1 79. Fusarium verticillioides : fumonisins, fusaric acid, fusarin C, beauvericin 80. F. vorosi: trichothecenes 3A-Deoxynivalenol 5. Distribution and diversity of Fusarium species Fusarium species are widely distributed in all major geographic regions of the world     They are commonly found in soils, and persist as chlamydospores or as hyphae in plant residues and organic matter. Many Fusarium species are abundant in fertile cultivated and rangeland soils, rather than in forest soils Fusarium colony was found abundant and diverse in cultivated soils. A high degree of variability in morphology and physiological characteristics enable some species such as F. oxysporum and F. equiseti to occupy the diverse ecological niches in many geographic regions 5.1. F. graminearum  F. graminearum is the most important Fusarium species in central Europe and in large areas in North America and Asia  During the last years F. graminearum has been spreading to the north in Europe in the Netherlands, England, Sweden, Finland 65     and north-western Russia and it has been replacing the closely related F. culmorum, which is less effective in producing DON . F. graminearum is dominant in Europe and North America. Lineage 7 of F. graminearum dominates in northern Europe and Asia and has been replacing the closely related F. culmorum in northern Europe. In Iran, the diversity and prevalence of Fusarium species and their chemotypes on wheat in the North-West and North of Iran was determined. Wheat in these areas is severely affected by Fusarium Head Blight (FHB), with Fusarium graminearum as prevalent species causing 96% of the infections in the NorthWest and 50% in the Northern provinces. Fusarium graminearum strains producing 15-ADON were abundant in Ardabil (NW of Iran), while in Golestan province (N of Iran) at the other side of the Caspian Sea especially nivalenol-producing strains and a variety of other Fusarium species were observed. Strains producing 3-ADON were rarely found in both areas. In Canada, Fusarium head blight of wheat and ear rot of corn causes significant yield and quality losses as well as contaminates grains with trichothecene mycotoxins. The fungus is also a potato pathogen and is routinely recovered from potato tubers showing symptoms of Fusarium dry rot in Canada. Interestingly, all the G. zeae strains from potatoes were 3Acetyl-DON (3ADON) types. The ability of representative isolates to produce 3ADON and 15ADON was verified in rice culture In Brazil, F. graminearum with a 15-ADON genotype is dominant in wheat (83%), followed by F. meridionale with a NIV genotype (12.8%), F. cortaderiae with mostly NIV and a few 3-acetyl deoxynivalenol (3-ADON) (2.6%), F. austroamericanum with mostly 3-ADON and a few NIV (1.2%) 66 and F. asiaticum with the NIV genotype (0.4%). Frequency of F. meridionale in wheat increased with the decrease of latitudes. For the maize kernel population, F. meridionale is dominant (72%), followed by F. graminearum with the 15-ADON genotype (14.5%) and F. cortaderiae with the 3-ADON and NIV genotypes (13.5%). For the maize stubble population, F. meridionale is dominant (50%), followed by F. graminearum with the 15-ADON genotype (30%) and F. cortaderiae with the NIV and 3-ADON genotypes (20%). F. asiaticum with the NIV genotype is the sole species found in rice kernels. These results show that several species coexist in the subtropical to tropical agricultural regions of Brazil where host and geographic (climatic) region shape species composition.   Fusarium graminearum www.discoverlife.org The 3ADON chemotype of F. graminearum is prevalent in Scandinavia, Finland and north-western Russia The 15ADON chemotype of F. graminearum is more common in the more southern areas in Europe and China. 67  Both the 3ADON and 15ADON chemotypes of F. graminearum are common in the Russian Far East. Fusarium root rot is a widespread disease of soybean in the United States and elsewhere in the world. Affecting seedlings as well as adult plants, it can be caused by numerous Fusarium species, and its severity is highly variable.     Fusarium oxysporum is the most common species, followed by F. solani, F. graminearum, and F. acuminatum. Representative isolates of these species cause seedling blight, root rot symptoms and detrimental effects on root system growth and development. F. graminearum isolates are consistently aggressive pathogens on soybean roots. Several species other species such as are also involved as F. armeniacum, F. commune, F. proliferatum 68 Fusarium root rot, caused by Fusarium solani can cause damping-off of seedlings and root rot on older plants. Infected seedlings can result in poor weak stands, late emergence or stunted plants.    Fusarium root rot is an important widespread disease of field pea worldwide • Can attack the crop at various growth stages, symptoms in seedlings to mature plants • Problematic in Alberta since ~2010 Fusarium root rot is common in North Dakota but severe damage has often been observed in association with stressed plants, such as in drought conditions or with herbicide damage. Fusarium root rot, or dry root rot, is the most common and important root rot of beans in North Carolina. Green bean is the main host but lima bean, southern pea, and garden pea are also affected. It occurs mostly in hot weather in acid and poorly fertilized soils. The disease tends to be evenly distributed over a field. Fusarium head blight is one of the most devastating plant diseases in the world.    The United States Department of Agriculture (USDA) ranks FHB as the worst plant disease to hit the US since the rust epidemics in the 1950s. Since 1990, wheat and barley Farmers in the United States have lost over $3 billion dollars due to FHB epidemics. Canada has also experienced severe losses since 1990. 69 Major outbreaks of Fusarium head blight (red) on wheat and barley. www.apsnet.org The Fusarium head blight causing species are common all over Europe but their importance is different depending on the climatic conditions.   The increase in importance of F. graminearum reported earlier in Central Europe has been observed during the past ten years, especially in Norway where high deoxynivalenol contents have been frequently analysed in oats in some areas. Signs of the same development have also been observed in Sweden and Finland, where DON contaminations have previously been lower. Fusarium head blight species can produce mycotoxins that accumulate in the grains, creating a threat to human and animal health.    In Europe, type B trichothecenes, especially deoxynivalenol (DON), are frequently found in grain batches. Most of the genes involved in producing these mycotoxins (TRI genes) are grouped in a 12-gene core cluster (TRI cluster). Fusarium graminearum, F. culmorum and F. cerealis possess this cluster, but the presence or absence of certain TRI genes, as well as their functionality, results in a strain capable of 70 producing either nivalenol (NIV) or deoxynivalenol and a related acetylated derivative (3- or 15-ADON). 5.2. F. oxysporum  Fungi of the Fusarium oxysporum species complex are ubiquitous soil and plant inhabiting microbes.  As plant pathogens, F. oxysporum appears to be largely cosmopolitan meaning that it can be found almost everywhere, with higher concentrations of the various Formae speciales in different areas across the globe.  FOSC strains can cause wilt and root rot diseases on over 120 plant species. Many FOSC strains can infect plant roots without apparent effect or can even protect plants from subsequent infection  FOSC isolates also have been identified as human pathogens causing localized or disseminated infections that may become life-threatening in neutropenic individuals Fusarium wilt of banana (Panama disease) is a destructive fungal disease of banana plants.  It is caused by Fusarium oxysporum f. sp. cubense (Foc).  It first became epidemic in Panama in 1890 and proceeded to devastate the Central American and Caribbean banana industries that were based on the ‘Gros Michel’ (AAA) variety in the 1950s and 1960s.  Once Foc is present in the soil, it cannot be eliminated.  Fusarium wilt of banana is caused by 35 different strains or genotypes of Fusarium oxysporum f. sp. cubense. 71 The distribution of clonal lineages of Fusarium oxysporum f. sp. cubenseon banana plantations around the world. Each symbol represents a different clonal lineage. The most diverse concentration of lineages corresponds with the presumed center of origin in Southeast Asia (circled). www.apsnet.org  There are four recognised races of the pathogen which are separated based on host susceptibility.  Race 1, which was responsible for the epidemics in ‘Gros Michel’ plantations, also attacks ‘Lady Finger’ (AAB) and ‘Silk’ (AAB) varieties.  Race 2 affects cooking bananas such as ‘Bluggoe’ (ABB)  Race 3 affects Heliconia spp., a close relative of banana, and is not considered to be a banana pathogen. ‘  Race 4 is capable of attacking ‘Cavendish’ (AAA) as well as the other varieties of banana affected by races 1 and 2. These three races have been present on the east 72  coast of Australia for many years and race 1 is present in WA.  Race 4 is further divided into ‘sub-tropical’ and ‘tropical’ strains. ‘Tropical’ race 4 is a more virulent form of the pathogen and is capable of causing disease in ‘Cavendish’ growing under any conditions, whereas ‘subtropical’ race 4 generally only causes disease in plants growing sub-optimally (cool temperatures, water stress, poor soil). The strain associated with TR4 was identified in 1990 in samples from Taiwan1. For the next 20 years or so, the distribution of  TR4 was limited to parts of Asia and Australia's Northern Territory.  The first report of TR4 outside the Asia-Pacific region dates to 2013 when it was announced that the fungal strain had been confirmed in Jordan.  Later that year it was also reported to be in Mozambique.  The capacity of TR4 to survive decades in the soil, along with its lethal impact and wide host range, are among the main reasons it was ranked as the greatest threat to banana production.  The severity of the damage depends on interactions between the strain, its host and environmental conditions.  To avoid further losses to the pathogen, the United Nations' Food and Agriculture Organization (FAO) has called on banana-producing countries to step up monitoring and reporting, and to contain suspected incursions to prevent the fungus from getting established 73 Fusarium wilt of tomatoes was first described by G.E. Massee in England in 1895.    It is of worldwide importance where at least 32 countries had reported the disease, which is particularly severe in countries with warm climate. At one time, the disease nearly destroyed tomato production in parts of Florida and the southeastern states of United States. However, the development and use of resistant cultivars have nearly eliminate the concern over this disease. Three physiological races of this pathogen have been reported.  Race 1 is the most widely distributed and has been reported from most geographical areas.  Race 2, though it was first reported in Ohio in 1940, it did not become widespread or of economic concern until its discovery in Florida in 1961. Since then, it was rapidly reported in several of the states and in several other countries, including Australia, Brazil, Great Britain, Israel, Mexico, Morocco, the Netherlands, and Iraq. 74   Race 3 was reported in 1966 in Brazil. Thereafter, it has been found in Australia and in Florida and California. F. oxysporum f.sp. lycopersici, which causes tomato wilt, has been found in at least 32 different countries alone. F. oxysporum distribution maps show that this fungus has invaded North and South America, Europe, Africa, Asia, and Oceania. Fusarium oxysporum - MicrobeWikiThis map depicts how F. oxysporum affects 6 of the 7 continents on Earth. Fusarium wilt of watermelon is one of the oldest described Fusarium wilt diseases and the most economically important disease of watermelon worldwide. It occurs on every continent except Antarctica and new races of the pathogen continue to impact production in many areas around the world. Long-term survival of the pathogen in the soil and the evolution of new races make management of Fusarium wilt difficult. Fusarium wilt of hemp (Fusarium oxysporum f.sp. cannabis) The disease was first described on hemp in Eastern Europe about 50 years ago, but is now found throughout the Northern hemisphere.   Fusarium wilt of hemp is a serious disease in eastern Europe, Italy and southern France. Extremely virulent strains reduce Cannabis survival by up to 80% 75 Fusarium wilt of hemp (Fusarium oxysporum f.sp. cannabis).  Fusarium wilt of lettuce is of worldwide occurrence of 1955 Japan 1990 U.S. (California; Fresno County) 1995 Iran 1998 Taiwan 2000 Brazil 2001 U.S. (Arizona; Yuma County) 2002 Italy. Races of Fusarium oxysporum f. sp. lactucae Races 1,2,3: Japan Race 1: Brazil, Iran, Italy, Taiwan, United States Fusarium wilt of cotton, caused by the fungus Fusarium oxysporum Schlechtend. f. sp. vasinfectum, was first identified in 1892 in cotton growing in sandy acid soils in Alabama (8). Although the disease was soon discovered in other major cotton-producing areas, it did not become global until the end of the next century. After its original discovery, Fusarium wilt of cotton was reported in Egypt (1902), India (1908), Tanzania (1954), California (1959), Sudan (1960), Israel (1970), Brazil (1978), China (1981), and Australia (1993). In addition to a worldwide distribution, Fusarium wilt occurs in all four of the domesticated cottons, Gossypium arboretum L., G. barbadense L., G. herbaceum L., and G. hirsutum L.. Disease losses in cotton are highly variable within a country or region. In severely infested fields planted with susceptible cultivars, yield losses can be high 5.3. Fusarium verticillioides is the causal agent of kernel and ear rot of maize. This destructive disease occurs virtually everywhere that maize is grown worldwide. In years with high temperatures, drought, and 76 heavy insect damage, the disease can significantly diminish crop quality.  Fusarium verticillioides (teleomorph Gibberella moniliformis) is the main fungal agent of ear and kernel rot of maize (Zea mays L.) worldwide. F.verticillioides is a highly toxigenic species since it is able to produce the carcinogenic mycotoxins fumonisins.  The most significant economic impact of F. verticillioides is its ability to produce fumonisin mycotoxins. Various diseases caused by fumonisins have been reported in animals, such as liver and kidney cancer as well as neural tube defects in rodents, leukoencephalomalacia in equines and pulmonary edema in pigs  Epidemiological correlations have been established between human esophageal cancer and the consumption of fumonisincontaminated maize in some regions of the world where maize is a dietary staple. 5.4. Fusarium fujikuroi is a phytopathogenic ascomycete causing the bakanae disease (“foolish seedlings”) in rice plants. This disease is triggered by the best known secondary metabolites produced by the fungus, namely gibberellins. 77   F. fujikuroi is able to produce several other well investigated secondary metabolites which we can easily detect and quantify by now (i.e. bikaverin, fusarubin, fusarin C). F. fujikuroi also possesses the potential to produce a broad spectrum of further, yet unknown, secondary metabolites. A genome-wide bioinformatical screening approach revealed that the F. fujikuroi genome encodes 45 key enzymes for secondary metabolite production, like 18 polyketide synthases (PKSs) and 16 nonribosomal peptide synthetases (NRPSs), all organized in putative gene clusters. 5.5. Fusarium avenaceum is often associated with diseased grains in temperate areas, either alone or in co-occurrence with other Fusarium species, but its prevalence is also increasing in warmer regions throughout the world. The major problems caused by F. avenaceum are crown rot and head blight of wheat and barley, and the contamination of grains with mycotoxins   In Finland and other northern agricultural areas, F. avenaceum is a common fungus on living and dead organic substrates It is frequently found on cereal grains, where it may cause seedling and head blight and produce mycotoxins. F. avenaceum is associated with foot and root rot diseases of all cereals grown in Finland. A wide range of variation in pathogenicity between isolates has been reported In Norway, Fusarium avenaceum, F. graminearum, F. culmorum, F. langsethiae, and F. poae are some of the most common fungal species causing Fusarium Head Blight in cereals. F. graminearum has shown increased prevalence the last decade, resulting in increased deoxynivalenol contamination of cereal grains. The increased prevalence of F. graminearum in 78 Norwegian cereals is likely to be associated with the recent increased use of reduced tillage in combination with weather conditions promoting development and dispersal of this fungal species. 5.6. Fusarium proliferatum is considered worldwide as an emerging pathogen of garlic. F. proliferatum is know to produce Fumonisins B1 and B2 on different vegetable matrices and Fumonisins contamination of garlic bulbs has been already reported in Germany. 5.7. Fusarium. langsethiae is a new European species of type A trichothecene producer. F.langsethiae can be divided into two lineages based on molecular markers. T-2-producing.   The European F. langsethiae has only been found in Europe, while the Asian F. langsethiae in Siberia and the Russian Far East seems actually to be a lineage of F. sporotrichioides based on molecular data. In Finland, increase of F. langsethiae, the most important producer of T-2 and HT-2- toxins has already been observed on oats and barley under reduced tillage. While DON production is enhanced by high humidity, F. langsethiae can infect and produce toxins in dry conditions 5.8. F. sibiricum is distributed in Siberia and Russian Far East with two single isolates from Norway and Iran. So, it is probable that the actual distribution of F. sibiricum will be much larger than the present known distribution. 79 5.9.Fusarium temperatum is a new described species occurring on maize in Belgium, closely related to F. subglutinans. Both species are considered morphologically identical and associated to the Fusarium maize ear rot disease complex. 6. Fusarium morphology 6.1.Macromorphology Most Fusarium species produce woolly to cottony, flat, spreading colonies. The colour of the colony may be white, cream, tan, salmon, cinnamon, yellow, red, violet, pink or purple; and on the reverse, it may be colorless, tan, red, dark purple, or brown www.pf.chiba-u.ac.jp www.medical-labs.net www.mycology.adelaide.edu.au 80 www.ppis.moag.gov.il fungi.myspecies.info www.sun.ac.za www.bioforsk.no show.wnmu.edu 6.2. Microscopic morphology Sporodochia Sporodochia consist of masses of branched conidiophores,.In culture they build up and are seen macroscopically as light coloured raised bodies on the surface of the plectochymatic culture mat. Macroconidia Macroconidia are borne in sporodochia. They are mostly long, slender, rather pointed at both end, dorso-ventrally curved, sickle-shaped, septated, and posses a basal foot cell (that is, the basal cell of the septated spore has a slight notch on the dorsal side near the attachment point to the conidiophore). Macroconidia are phialospores, i.e. they are produced in a phialide, which is a small opening at the tip of the conidiophore from which the spores emerge one by one, appearing apex end first, all initially attached to the conidiophore. 81 Microconidia Microconidia may be formed. Typically they are present on the aerial mycelium of the culture growth, appearing as small, usually one-celled spores, and oval-shaped, although in some species they may be apiculate, tear-drop or pear-shaped and sometimes even spherical. Microconidia may be phialospores or they may also be blastospores, which are dry spores produced by budding at the tip of the conidiophore. These sporogenesis features are also used by taxonomists to distinguish species, however they are often difficult to ascertain and in some isolates production of both spore types occur. Sometimes microconidia from phialides remain attached to each other in sequence to form chains. This is also a character used in taxonomy. Microconidia are usually moisture-borne, but they can be air-borne, usually for relatively short distances. Mesoconidia. Mesoconidia are the fusoid conidia that are longer than microconidia with 3-4 septa but shorter than macroconidia with lack of foot-shaped and notched basal cell. These conidia are produced in the aerial mycelium on the polyphialides that appear as “rabbit ears” when viewed in-situ Chlamydospores Chlamydospores, exist in some, but not all Fusarium spp. Such spores are more or less sphaerical, approximately 7-16 in diameter. They occur often singly, but sometimes they are doubles or are even in chains or in big clumps in some species. They have thick, double, often very rough cell walls, and their cytoplasm contains a great deal of nutrients, as is evident by oily globules therein. Microscopically the walls appear as light yellowish in colour, but when viewed en masse macroscopically they are brown. Thus large clumps in culture may appear as brown clumps, sometimes below the agar surface. They form in conidia or in hyphae, either terminally or intercalary, and appear usually when the available nutrients are becoming depleted and the culture is already old. Perithecia 82 Some Fusarium species are capable of producing a sexual stage. Perithecia bearing ascospores may appear in nature and in culture under certain specific conditions, such as proper lighting, temperature and moisture. www.e-ijd.org coursewares.mju.ac.th en.wikipedia.org www.emlab.com ishareimage.com ishareimage.com www.grainscanada.gc.ca coursewares.mju.ac.thimgbuddy.com 83 6.3. Descriptioon of macro- and microconidia and chlamydodpores Macroconidial shapes: A: Typical macroconidia with apical cell on the left and basal cell on the right, C: macroconidia with dorsoventral curvature, D: macroconidia with dorsal side more curved than the ventral Apical cell, E: apical cell blunt, F: apical cell papillate, G:apical cell hooked, H:apical cell tapering, Basal cell, I: basal cell foot-shaped, J: basal cell elongated foot-shaped, K: basal cell distinctly notched, L: basal cell barely notched Microconidia M: oval, N: two-celled, O: three-celled, P: rentiform, Q: obvoid with a truncate base, R: pyriform, S: napiform, T: globose 84 Phialides U and V: monophialides, W and X:polyphialides,: Microconidial chains Y: short, Z : long. From Fusarium Laboratory Manual www.mycologia.org From Fusarium Laboratory Manual 7. Fusarium genomics 7.1. The Fusarium Comparative Project The Fusarium comparative genomics database provides accesses to multiple sequenced Fusarium genomes simultaneously to facilitate the comparative analysis among these closely related fungal species. The Fusarium comparative project is part of the Broad Fungal Genome 85 Initiative and was funded by the U.S. Department of Agriculture's National Institute for Food and Agriculture. The main collaborators of Fusarium comparative project Dr. Corby Kistler at USDA, ARS Cereal Disease Lab of University of Minnesota, Dr. JinRong Xu ant Purdue University, Dr. Frances Trail at Michigan State University, Dr. Seogchan Kang at Penn State University, Dr. Won-Bo Shim at Texas A&M University, Dr. Charles Woloshuk at Purdue University Activities     In 2002, the F. graminearum sequencing project was funded by the National Research Initiative, which is within the U.S. Department of Agriculture's National Institute for Food and Agriculture. The Fusarium graminearum sequencing project represents a partnership between the Broad and the International Gibberella zeae Genomics Consortium (IGGR). Fusarium oxysporum and F. verticillioides have been selected at the same time to study evolutionary biology among these closely related but biologically distinct Fusarium species. A three-way comparison of F. oxysporum, F. verticillioides and F.graminearum offers powerful synergy in studies of pathogenicity and virulence factors, and their evolution within this genus. 1. Fusarium oxysporum 86        The F. oxysporum comparative genomes project has sought to make available genome sequence data for FOSC strains with a range of host specificities. The first genome made available in 2007 was from a tomato wilt strain FOL 4287 (NRRL 34936) which was used for comparative analysis with the genomes of F. graminearum and F. verticillioides. Results of this comparison led to the discovery of mobile supernumerary chromosomes in this strain of F. oxysporum f. sp. lycopersici (race 2 - VCG 0030) containing genes required for host specific infection and disease (Ma et al., 2010). Eleven additional FOSC strains now have been sequenced. Two of these additional strains also infect tomato. o MN25 (NRRL 54003) is a strain of F. oxysporum f. sp. lycopersici (race 3 - VCG 0033) from Manatee County, Florida. o CL57 (NRRL 26381) is a tomato crown rot pathogen F. oxysporum f. sp. radicis-lycopersici (VCG 0094) from Collier County, Florida. Two FOSC strains sequenced have specificity to crucifers. o PHW808 (NRRL 54008) is a strain of F. oxysporum f. sp. conglutinans, race 2 (VCG 0101) from California that causes cabbage yellows disease. o PHW815 (NRRL 54005) is a strain of F. oxysporum f. sp. raphani (VCG 0102) from France that causes radish wilt. Both strains cause wilt disease in Arabidopsis. A strain of F. oxysporum f. sp. cubense tropical race 4 (VCG 01213) Fusarium wilt of banana in Indonesia was sequenced. Strains of the fungus causing wilt disease on melon (F. oxysporum f. sp. melonisNRRL 26406), cotton (F. oxysporum f. sp. vasinfectum NRRL 25433) and pea (F. oxysporum f. sp. pisi NRRL 37622) also were sequenced. F. oxysporum strain NRRL 32931, obtained from human blood, represents a distinct haplotype ST 128 and is closely related to FOSC 3-a/ST 333-a 87  F. oxysporum strain Fo47 (NRRL 54002) well-known for its biological control properties, originally isolated from disease suppressive soils from the Chateaurenard region of France and demonstrated to colonize host roots and to be the biotic component of wilt disease suppression. Summary Table of the strains: NRRL Strain forma specialis Host 37622 HDV247 pisi Pisum 32931 NRRL32931 (human) Homo 54002 Fo47 (biocontrol) Soil 54003 MN25 lycopersici race 3 Lycopersicum 54008 PHW808 conglutinans, race Brassica/Arabidopsis 2 54005 PHW815 raphani Raphanus/Arabidopsis 26381 CL57 radicislycopersici Lycopersicum 54006 II5 cubense tropical race 4 Musa 26406 melonis Cucurbita 25433 vasinfectum Gossypium 2. Fusarium graminearum  The strain chosen for sequencing by the International Gibberella zeae Genomics Consortium (IGGR) was PH-1 (NRRL 31084).  It is the predominant FHB species causing scab of wheat and barley in North America and Europe and is distributed worldwide  Isolated in Michigan, 88     PH-1 is highly fertile, It produces trichothecenes and zearalenone , It sporulates abundantly in pure culture and is highly pathogenic to wheat and barley. The strain can be readily transformed and is closely related to strain GZ3639 (NRRL 29169) that has been studied for trichothecene biosynthesis and strain 00-676 (NRRL 34097) used as one parent with PH-1 for the genetic map 3, Fusarium verticillioides  Strain 7600 (FRC M3125=NRRL 20956), which has been used extensively in molecular and pathological studies, was selected for the genome project.  This strain is available at FGSC, NCAUR-ARS-USDA and the Fusarium Research Center at Penn State.  The genome size is estimated to be 46 Mb with 12 chromosomes Genome Statistics Summary _____________________________________________ Size Chrs %GC Genes tRNAs rRNAs F. verticillioides 7600 (FV3) 41.78 Mb -- 48.70 15,869 296 75 F. verticillioides 7600 mito 93.92 Kb -- 32.06 0 31 -- F. graminearum PH-1 (FG3) 36.45 Mb -- 48.33 13,321 322 88 F. graminearum PH-1 mito 107.73 Kb -- 31.86 0 21 -- F. oxysporum 4287 (FO2) 61.36 Mb -- 48.40 20,925 308 121 F. oxysporum 4287 mito 84.76 Kb -- 31.01 0 21 -- F. oxysporum Fo47 49.66 Mb -- 47.68 18,191 305 60 F. oxysporum NRRL32931 47.91 Mb -- 47.63 17,280 302 60 F. oxysporum HDV247 55.19 Mb -- 47.61 19,623 318 59 F. oxysporum MN25 48.64 Mb -- 47.75 17,931 305 61 F. oxysporum CL57 49.36 Mb -- 47.62 18,238 313 59 89 F. oxysporum Cotton 52.91 Mb -- 47.67 18,905 305 61 F. oxysporum II5 46.55 Mb -- 47.51 16,634 281 60 F. oxysporum melonis 54.03 Mb -- 47.51 19,661 311 61 F. oxysporum PHW808 53.58 Mb -- 47.73 19,854 311 67 F. oxysporum PHW815 53.5 Mb -- 47.83 19,306 299 58 F. oxysporum Fo5176 (454) 54.95 Mb -- 47.81 21,087 296 58 Size length of complete genome sequence, calculated by adding lengths of all scaffolds together Chrs number of chromosomes, %GC GC content of scaffolds, Genes number of predicted protein-coding genes in genome, tRNAs number of predicted tRNA genes in genome, rRNAs number of predicted rRNA genes in genome Genome statistics..of F. oxysporum, F. verticillioides and F. graminearum. Li-Jun Ma Nature 464, 367-373 (2010) Species F. oxysporum F. verticillioides F. graminearum Strain 4287 7600 PH-1 Sequence coverage (fold) 6 8 10 Genome size (Mb) 59.9 41.7 36.2 Number of chromosomes 15 11* 4 Total scaffolds 114 31 36 N50 scaffold length (Mb) 1.98 1.96 5.35 Coding genes 17,735 14,179 13,332 Median gene length (bp) 1,292 1,397 1,355 90 Repetitive sequence (Mb) 16.83 0.36 0.24 Transposable elements (%) 3.98 0.14 0.03 *Fv was reported to contain 12 chromosomes7, 11 chromosomes were mapped to the assembled genome, and no genetic markers from the smallest chromosome (600 kb or less) were found in the sequence data. N50 represents the size N such that 50% of the nucleotides is contained in scaffolds of size N or greater. 7.2.Publications on Fusarium genome sequences 2007: The Fusarium graminearum Genome Reveals a Link Between Localized Polymorphism and Pathogen Specialization. Science 317:1400–1402 Cuomo CA, Güldener U, Xu JR, Trail F, Turgeon BG, DiPietro A,Walton J, Ma LJ, Baker SE, Rep M, Adam G, Antoniw J, Baldwin T,Calvo S, Chang Y L, DeCaprio D, Gale LR, Gnerre S, Goswami RS,HammondKosack K, Harri s LJ, Hilburn K, Kennell JC, Kroken S,Magnuson JK, Mannhaupt G, Mauceli E,Mewes HW, Mitterbauer R,Muehlbauer G, Münsterkötter M, Nelson D, O ’Donnell K, Ouellet T,Qi W, Quesneville H, Roncero MI, Seong KY, Tetko I V, Urban M,Waalwijk C, Ward TJ, Yao J,Birren BW, Kistler HC. Cuomo CA, Li-Jun Ma 91 Jeffrey J Coleman 2009:The genome of Nectria haematococca: contribution of supernumerary chromosomes to gene expansion. PLoS Genet. 2009 Aug;5(8):e1000618. Coleman JJ , Rounsleym SD, Rodriguez-Carres M, Kuo A, WasmannmCC, Grimwood J, Schmutz J, Taga M, White GJ, Zhou S, Schwartz DC, Freitag M, Ma LJ,Danchin EG, Henrissat B, Coutinho PM, Nelson DR, Straney D, Napoli CA, Barker BM, Gribskov M, Rep M, Kroken S, Molnár I, Rensing C, Kennell JC, Zamora J, Farman ML, Selker EU, Salamov A, Shapiro H, Pangilinan J, Lindquist E, Lamers C, Grigoriev IV, Geiser DM, Covert SF, Temporini E, Vanetten HD.. 2010: Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium. Nature 464, 367-373 (18 March 2010) | doi:10.1038/nature08850 Li-Jun Ma1, H. Charlotte van der Does, Katherine A. Borkovich, Jeffrey J. Coleman, Marie-Jose´e Daboussi,Antonio Di Pietro6, Marie Dufresne, Michael Freitag, Manfred Grabherr1, Bernard Henrissat8,Petra M. Houterman, Seogchan Kang, Won-Bo Shim10, Charles Woloshuk11, Xiaohui Xie, Jin-Rong Xu,John Antoniw, Scott E. Baker, Burton H. Bluhm, Andrew Breakspear, Daren W. Brown16,Robert A. E. Butchko, Sinead Chapman1, Richard Coulson17, Pedro M. Coutinho8, Etienne G. J. Danchin, Andrew Diener, Liane R. Gale, Donald M. Gardiner, Stephen Goff20, Kim E. Hammond-Kosack, Karen Hilburn, Aure´lie Hua-Van, Wilfried Jonkers2, Kemal Kazan, Chinnappa D. Kodira1, Michael Koehrsen1, Lokesh Kumar1, Yong-Hwan Lee, Liande Li, John M. Manners, Diego Miranda-Saavedra, Mala Mukherjee,Gyungsoon Park, Jongsun Park, Sook-Young Park, Robert H. Proctor, Aviv Regev, M. Carmen Ruiz-Roldan6,Divya Sain, Sharadha Sakthikumar1, Sean Sykes1, David C. Schwartz, B. Gillian Turgeon, Ilan Wapinski,Olen Yoder, Sarah Young1, Qiandong Zeng, Shiguo Zhou, James Galagan, Christina A. Cuomo1,H. Corby Kistler & Martijn Rep. 92 Jeong H, Wingfield, Brenda D Kennell JC 2012: First fungal genome sequence from Africa: a preliminary analysis. African Journal of Science, 108(01-09 Wingfield, Brenda D., Steenkamp, Emma T., Santana, Quentin C., Coetzee, Martin P.A., Bam, Stefan, Barnes, Irene, Beukes, Chrizelle W., Yin Chan, Wai, de Vos, Lieschen, Fourie, Gerda, Friend, Melanie, Gordon, Thomas R., Herron, Darryl A., Holt, Carson, Korf, Ian, Kvas, Marija, Martin, Simon H., Mlonyeni, X. Osmond, Naidoo, Kershney, Phasha, Mmatshepho M., Postma, Alisa, Reva, Oleg, Roos, Heidi, Simpson, Melissa, Slinski, Stephanie, Slippers, Bernard, Sutherland, Rene, van der Merwe, Nicolaas A., van der Nest, Magriet A., Venter, Stephanus N., Wilken, Pieter M., Yandell, Mark, Zipfel, Renate, & Wingfield, Mike J.. South 1-2), 2O12: Comparative analysis of Fusarium mitochondrial genomes reveals a highly variable region that encodes an exceptionally large open reading frame. Al-Reedy RM, Malireddy R, Dillman CB, Kennell JC.. Fungal Genet Biol. 2012 Jan;49(1):2-14. 2013: Draft genome sequence of Fusarium fujikuroi B14, the causal agent of the Bakanae Disease of rice.Genome Jeong H, Lee S, Choi GJ, Lee T, Yun S-H Announcements. 2013;1(1):e00035-13. 2013: Genome sequences of six wheat-infecting Fusarium species isolates. Genome Announc. 1(5):e0067093 Moolhuijzen PM, Manners JM, Wilcox SA, Bellgard Gardiner DM. 2013. Subodh K Ma LJ, MI, Magriet A. van der Nest 2014: The Genome Sequence of the Fungal Pathogen Fusarium virguliforme That Causes Sudden Death Syndrome in Soybean. Plos One, 2014. Subodh K. Srivastava,Xiaoqiu Huang,Hargeet K. Brar,Ahmad, M. Fakhoury,Burton H.Bluhm,Madan, K. Bhattacharyya 2014: Genome Sequence of Fusarium oxysporum f. sp. melonis Strain NRRL 26406, a Fungus Causing Wilt Disease on Melon. Genome Announc. 2014 Jul 31;2(4). Ma LJ, Shea T, Young S, Zeng Q, Kistler HC. 2014: Genome and Transcriptome Analysis of the Fungal PathogenFusarium oxysporum f. sp. cubense Causing Banana Vascular Wilt Disease. Published: April 17, 2014, DOI: 10.1371/journal.pone.0095543 Lijia Guo ,Lijuan Han ,Laying Yang , Huicai Zeng, Dingding Fan,. Yabin Zhu, Yue Feng, Guofen Wang, Chunfang Peng, Xuanting Jiang, Dajie Zhou, Peixiang Ni, Changcong Liang, Lei Liu, Jun Wang, Chao Mao, Xiaodong Fang , Ming Peng , Junsheng Huang . Plos One, 2014: Draft genomes of Amanita jacksonii, Ceratocystis albifundus, Fusarium circinatum, Huntiella omanensis, Leptographium procerum, Rutstroemia sydowiana, and Sclerotinia echinophila. IMA Fungus 2014 Dec 94 Magriet A. van der Nest, Lisa A. Beirn, Jo Anne Crouch, Jill E. Demers, Z. Wilhelm de Beer, Lieschen De Vos, Thomas R. Gordon, JeanMarc Moncalvo, Kershney Naidoo, Santiago Sanchez-Ramirez, Danielle Roodt, Quentin C. Santana, Stephanie L. Slinski, Matt Stata, Stephen J. Taerum, P. Markus Wilken, Andrea M. Wilson, Michael J.Wingfield, and Brenda D. Wingfield . Erik Lysøe Kemal Kazan 2014: The genome of the generalist plant pathogen Fusarium avenaceum is enriched with genes involved in redox, signaling and secondary metabolism.PLoS One. 2014 19;9(11): Erik Lysøe ,Linda J. Harris,Sean Walkowiak,Rajagopal Subramaniam,Hege H. Divon,Even S. Riiser,Carlos Llorens,Toni Gabaldón,H. Corby Kistler,Wilfried Jonkers,Anna-Karin Kolseth,Kristian F. Nielsen,Ulf Thrane,Rasmus J. N. Frandsen 2014:Genome Sequence of Fusarium graminearum Isolate CS3005 Donald M. Gardiner, Jiri Stiller, and Kemal Kazan Martin Urban Zhitian Zheng 95 2015: Whole-genome analysis of Fusarium graminearuminsertional mutants identifies virulence associated genes and unmasks untagged chromosomal deletions. . BMC Genomics 2015, 16:261 doi:10.1186/s12864-015-1 Martin Urban , Robert King , Keywan Hassani-Pak and Kim E HammondKosack 2015: Whole-genome sequencing reveals that mutations in myosin-5 confer resistance to the fungicide phenamacril in Fusarium graminearum. Science Reports, 5, 4, 2015 Zhitian Zheng, Yiping Hou, Yiqiang Cai, Yu Zhang, Yanjun Li & Mingguo Zhou. 2015: Genome-wide analysis in three Fusariumpathogens identifies rapidly evolving chromosomes and genes associated with pathogenicity. Genome Biol Evol (2015) doi: 10.1093/gbe/evv092First published online: May 19, 2015 Jana Sperschneider, Donald M. Gardiner, Louise F. Thatcher, Rebecca Lyons,Karam B. Singh, John M. Manners and Jennifer M. Taylor Jana Sperschneide Louise F. Thatcher, Rebecca Lyons 7.3. Synopsis of Fusarium genomics results  The five completely sequenced Fusarium genomes which also have mostly completed genetic and physical maps available, are 1. F. graminearum, 2. F. oxysporum f. sp. lycopersici, 3. F. pseudograminearum, 96 4. F. ‘solani’ f. sp. pisi, and 5. F. verticillioides),  Their genomes vary greatly in size and repeat content  genome of F. graminearum: 36-Mb  genome of F. ‘solani’ f. sp. pisi genome: 51 Mb.  genome of F. oxysporum f. sp. Lycopersici: 61-Mb , which is the largest fusarial genome sequenced so far. F. verticillioides has distributed fumonisin and gibberellin gene clusters, are present in some but not all species of the F. fujikuroi and F. oxysporum species complexes and fusarin biosynthetic genes, which are widely distributed in Fusarium are absent in all F. oxysporum isolates that have been examined     Comparative analyses have revealed that the Fusarium genome is compartmentalized into regions responsible for primary metabolism and reproduction (core genome), and pathogen virulence, host specialization, and possibly other functions (adaptive genome). Genes involved in virulence and host specialization are located on pathogenicity chromosomes within strains pathogenic to tomato (Fusarium oxysporum f. sp. lycopersici ) and pea (Fusarium ‘solani’ f. sp. pisi ). The experimental transfer of pathogenicity chromosomes from F. oxysporum f. sp. lycopersici into a nonpathogen transformed the latter into a tomato pathogen. Thus, horizontal transfer may explain the polyphyletic origins of host specificity within the genus. The genome assembly of Fol has 15 chromosomes, the Fv assembly 11 and theFg assembly only four 97      The smaller number of chromosomes in Fg is the result of chromosome fusion relative to Fv and Fo, and fusion sites in Fgmatch previously described high diversity regions Global comparison among the three Fusarium genomes shows that the increased genomic territory in Fol is due to additional, unique sequences that reside mostly in extra chromosomes. Syntenic regions in Fol cover approximately 80% of the Fg and more than 90% of the Fv genome referred to as the ‘core’ of the genomes. Except for telomere-proximal regions, all 11 mapped chromosomes in the Fv assembly (41.1 Mb) correspond to 11 of the 15 chromosomes in Fol (41.8 Mb). The co-linear order of genes between Fol and Fv has been maintained within these chromosomes, except for one chromosomal translocation event and a few local rearrangements F. oxysporum genome is divided into “core” and “accessory” regions.   The vertically transmitted “core” is conserved and performs all essential functions. The horizontally transmitted “accessory” genome in the form of lineage-specific (LS) chromosomes –  The Fol LS regions differ considerably in sequence among Fo strains with different host specificities  only occurs in specific pathotypes and encodes hostspecific virulence factors.  The lineage-specific (LS) genomic regions in F. oxysporum include four entire chromosomes and account for more than one-quarter of the genome.  The transfer of the LS chromosomes between strains of F. oxysporum was demonstrated experimentally and resulted in the conversion of a non-pathogenic strain into a pathogen 98 Origin of LS regions Three possible explanations for the origin of LS regions in the Fol genome were considered: (1) Fol LS regions were present in the last common ancestor of the four Fusarium species but were then selectively and independently lost in Fv,Fg and Fs lineages during vertical transmission; (2) LS regions arose from the core genome by duplication and divergence within the Fol lineage; and (3) LS regions were acquired by horizontal transfer. Secondary metabolite biosynthetic genes in Fusarium. the five genomes have 35 and 31 nonorthologous PKS and NRPS genes, respectively (12, 33), indicating that the five species have the collective potential to produce 35 and 31 distinct families of polyketide and nonribosomal peptide-derived secondary metabolites.  Pathogenicity genes  Basic pathogenicity genes  shared by Fusarium and other pathogenic fungi;  encode essential components of pathways involved in sensing of exogenous or endogenous signals,  Specialized pathogenicity genes  specific to individual Fusarium spp. on specific hosts.  directly involved in host-pathogen interactions: o F. oxysporum f. sp. lycopersici has established a gene-for-gene interaction with its tomato host. o Virulence factors, such as SIX (secreted in xylem) genes , play significant roles in determining host specificity. 99  o SIX genes are located on the F. oxysporum f. sp. lycopersici pathogenicity . o Other specialized virulence factors that act in a hostor pathogen-specific manner include mycotoxins. Comparative analyses have revealed  Fusarium genomes are compartmentalized into regions responsible for essential functions (core genome) and for host specialization and pathogen virulence (adaptive/accessory genome).     Horizontal inheritance of supernumerary chromosomes enriched for host-specific virulence may have played a major role in the polyphyletic distribution of host specificity within the F. oxysporum species complex and the rapid emergence of novel pathogens. Comparative genome analyses suggest that Fusarium has the genetic potential to produce many more secondary metabolites than previously indicated by chemical analyses. Multiple evolutionary processes, including vertical inheritance, horizontal gene transfer, gene duplication, and gene deletion, could have given rise to the current distribution of secondary metabolite biosynthetic gene clusters and production in Fusarium. Deletion of genes with roles in the production of asexual and sexual spore types tends to have pleiotropic effects. Transcriptomic studies indicate that a large number of genes are differentially expressed in the sexual cycle. 100 7.4. Fusarium genomics databases Cyber infrastructure for Fusarium (CiF); http://www.fusariumdb.org/; The CiF consists of three components:    Fusarium-ID Fusarium Comparative Genomics Platform (FCGP), Fusarium Community Platform (FCP), Several databases specialized for fungal genome sequences or gene families and functional groups, include   Fungal Transcription Factor Database (FTFD),  Fungal Secretome Database (FSD),  Seoul National University Genome Browser (SNUGB),  Fungal Cytochrome P450 Database (FCPD),  Comparative Fungal Genomics Platform (CFGP), Phytophthora Database (PD) 101 1. Fusarium-ID Current statistics of the database 78 Species There are 7 species complex 1,905 Isolates 5,747 Sequences       The Fusarium-ID enables users to explore the diversity of Fusarium and accurately identify new isolates based on their sequence similarity to previously characterized species. The Fusarium-ID was first released in 2004 (Geiser et al., 2004) based on sequences of the translation elongation factor 1 alpha (EF-1α) gene. Since then, sequences of multiple marker loci that represent almost all known species have been added, as well as information associated with characterized isolates, and more data analysis and visualization tools. More than 35,000 strains isolated from various substrates around the world are accessioned in the Fusarium Research Center (FRC) at Penn State University and the USDA-ARS NRRL Culture Collection in Peoria (Illinois). Using this rich strain resource, extensive molecular phylogenetic studies have been conducted to asses their diversity and evolutionary relationships (Aoki et al., 2005; Geiser et al., 2004; O'Donnell et al., 1998a; O'Donnell et al., 2009; O'Donnell et al., 1998b; O'Donnell et al., 2000a; O'Donnell et al., 2000b; O'Donnell et al., 2007; O'Donnell et al., 2004a; O'Donnell et al., 2004b; O'Donnell et al., 2010; Schroers et al., 2009; Starkey et al., 2007; Zhang et al., 2006). Despite these advances, a significant amount of diversity has yet to be explored, and some species complexes are quite poorly characterized phylogenetically. 102    The main goal of Fusarium-ID is to support and coordinate these remaining tasks by systematically archiving available phylogenetic data and associated cultures in a format that is readily accessible and searchable by members of the global Fusarium research community. Without a robust phylogenetic framework and community-wide knowledge sharing, discovery and characterization of novel Fusarium species will likely be fragmented, creating confusion instead of the order that taxonomy should provide. Via the Folder function, users can create two types of data storage space:  private folder for storing selected data and results from previous analyses and  (ii) shared folder that permits data sharing with others designated by the creator of the folder (by assigning user IDs permitted to access the folder).  A suite of web tools, named the Phyloviewer, allows users to build phylogenetic trees on the fly using sequences in BLAST outputs, including the query sequence, and any data stored in the Cart.  Sequence data in the resulting tree are linked to information associated with corresponding isolates so that users can browse if any notable patterns exist among the isolates included in the tree.  Restriction fragment length polymorphism (RFLP) analysis of PCR products has been utilized as a means for rapid strain identification.  The Virtual Gel function supports this diagnostic method by generating predicted RFLP patterns from chosen sequences and restriction enzyme(s) via a virtual gel.  A geographic information system (GIS) tool will function as a digitized atlas showing the genotypic and phenotypic diversity of Fusarium worldwide in geospatial and temporal contexts. This functionality will help establish a baseline for monitoring the migration and variation of Fusarium species. 103 *Correspondence concerning phylogenetics data stored in Fusarium-ID should be sent to: KerryO'Donnell (309-681-6383) and/or David M. Geiser (814-865-9773) 2. Fusarium Comparative Genomics Platform (FCGP) Introduction to the Fusarium Comparative Genomics Platform (FCGP)      Rapidly accumulating genome sequence data from diverse Fusarium species with different traits offers tremendous opportunities for understanding the molecular and evolutionary mechanisms underpinning functional diversification at a genome level. The FCGP was developed to facilitate the realization of such opportunities. Currently, the genomes of four Fusarium species, including F. graminearum (two strains), F. oxysporum, F. verticillioides, and F. solani, have been published (Coleman et al., 2009; Cuomo et al., 2007; Ma et al., 2010) with more species and isolates currently being sequenced or annotated. The first three species were sequenced by the Broad Institute, while the Department of Energy Joint Genome Institute sequenced F. solani. The SNU Genome Browser (SNUGB) (Jung et al., 2008) supports visualization and utilization of genome sequences and features both within and across species. All sequence data and contig information are displayed through the Contig Browser. Annotation information in a chosen region, such as transcripts, ORFs, tRNAs/rRNAs, exon/intron structure, SignalP, PSort and InterPro domains, can be displayed in multiple formats. 104    The Chromosome Viewer shows the chromosomal locations of the phylogenetic markers stored in Fusarium-ID. The FCGP also presents computed characteristics of multiple gene families and functional groups using the Fungal Transcription Factor Database (FTFD) (Park et al., 2008b), the Fungal Cytochrome P450 Database (FCPD) (Park et al., 2008a), and the Fungal Secretome Database (FSD) (Choi et al., 2010). Currently available data include 3,095 transcription factors (TFs), 579 cytochrome P450s, and 11,905 putative secretory proteins, and provide an overview of these proteins within and across species. A BLAST server for each dataset is available for quick search. Moreover, genes that appear unique to each species, as well as those that are present in subsets of the four species, were identified through BLASTMatrix2, a modified BLAST program that searches gene(s) homologous to a query in multiple species simultaneously. In addition to depositing newly released Fusarium genome sequences,     characteristics of additional protein groups, such as ABC transporters and carbohydrate degrading enzymes, will be added once the corresponding fungal kingdom-wide databases are established. Available expressed sequence tags from Fusarium species will also be archived and linked to the corresponding genomes. In combination with the phylogenetic framework accessioned cultures available through Fusarium-ID, and the FCGP will help users study the evolution of Fusarium genes, gene networks, and whole genomes. 105 Fusarium Comparative Genomics Platform (FCGP) Statistics of the FCGP Species name # of chromosomes # of proteins # of TFs # of P450s Fusarium verticillioides 11 14,188 626 129 Fusarium oxysporum f. sp. lycopersici 15 17,701 810 169 Fusarium graminearum 4 13,321 648 118 Fusarium solani f. sp. batatas 17 15,707 991 162 60,917 3,075 578 Total List of sequences of Fusarium species This is the first page, as example, of 288 pages containing a list of 5747 sequences of Fusarium species Sequence Name Species Name FD_01791_RPB2-711 Fusarium lunatum Isolate FD_01791 Marker RPB2-711 FD_00705_EF-1a_2 Fusarium oxysporum FD_00705 EF-1a FD_01170_BTub Fusarium sacchari FD_01170 BTub FD_01865_ITS Fusarium solani FD_01865 ITS FD_01866_ITS Fusarium solani FD_01866 ITS FD_01867_ITS Fusarium solani FD_01867 ITS 106 FD_01692_EF-1a_2 Fusarium sp FD_01692 EF-1a FD_00001_EF-1a Fusarium graminearum FD_00001 EF-1a FD_00033_EF-1a F.mesoamericanum FD_00033 EF-1a FD_00034_EF-1a F.pseudograminearum FD_00034 EF-1a FD_00038_EF-1a Fusarium graminearum FD_00038 EF-1a FD_00077_BTub Fusarium sp FD_00077 B-tub FD_00930_EF-1a Fusarium langsethiae FD_00930 EF-1a FD_00929_EF-1a Fusarium sp FD_00929 EF-1a FD_00002_EF-1a Fusarium graminearum FD_00002 EF-1a FD_00036_EF-1a F.pseudograminearum FD_00036 EF-1a FD_00037_EF-1a F.pseudograminearum FD_00037 EF-1a FD_00035_EF-1a FD_00032_EF-1a FD_00030_EF-1a F. pseudograminearum FD_00035 Fusarium meridionale FD_00032 Fusarium asiaticum FD_00030 EF-1a EF-1a EF-1a 3. FUSARIUM MLST DATABASE Because less than one-third of clinically relevant fusaria can be accurately identified to species level using phenotypic data (i.e., morphological species recognition), we constructed a three-locus DNA sequence database to facilitate molecular identification of the 69 Fusarium species associated with human or animal mycoses encountered in clinical microbiology laboratories.    The database comprises partial sequences from three nuclear genes: translation elongation factor 1α (EF-1α), the largest subunit of RNA polymerase (RPB1), and the second largest subunit of RNA polymerase (RPB2). These three gene fragments can be amplified by PCR and sequenced using primers that are conserved across the phylogenetic breadth of Fusarium. Phylogenetic analyses of the combined dataset reveal that, with the exception of two monotypic lineages, all clinically relevant 107     fusaria are nested in one of eight variously sized and strongly supported species complexes. The monophyletic lineages have been named informally to facilitate communication of an isolate’s clade membership and genetic diversity. To identify isolates to species included within the database, partial DNA sequence data from one or more of the three genes can be used as a BLAST query against the database which is web-accessible at FUSARIUM-ID (http://isolate.fusariumdb.org) and the CBS-KNAW Fungal Biodiversity Center (http://www.cbs.knaw.nl/Fusarium). Alternatively, isolates can be identified via phylogenetic analysis by adding sequences of unknowns to the DNA sequence alignment, which can be downloaded from the two aforementioned websites. The utility of this database should increase significantly as members of the clinical microbiology community deposit cultures of novel mycosis-associated fusaria in internationally accessible culture collections (e.g., CBS-KNAW or the Fusarium Research Center), along with associated, corrected sequence chromatograms and data, so that the sequence results can be verified and isolates are made available for future study. People involved in the Fusarium MLST project Kerry O’Donnell, Deanna A. Sutton, Michael G. Rinaldi, Brice A. J. Sarver 3, S. Arunmozhi Balajee4, Hans-Josef Schroers, Richard C. Summerbell, Vincent A. R. G. Robert, Pedro W. Crous7, Ning Zhang, Takayuki Aoki, Kyongyong Jung, Jongsun Park, Yong-Hwan Lee10, Seogchan Kang, Bongsoo Park11, and David M. Geiser 108 Kerry O’Donnell Deanna A. Sutton Michael G. Rinaldi Hans-Josef Schroers R. C. Summerbell Pedro W. Crous Takayuki Aoki David M. Geiser Searching and Identification The Fusarium MLST website hosted by the CBS-KNAW Fungal Biodiversity Centre allows one to access a database of 1365 well studied isolates and 2692 associated sequences from the following regions: Translation elongation factor 1 alpha gene (EF1), RNA polymerase I beta subunit gene (RPB1), RNA polymerase II beta subunit gene (RPB2), Calmodulin gene (CAL), betatubulin gene (TUBB), Histone gene, IGS, Internal transcribed spacers (ITS1 and ITS2), 28S ribosomal RNA large subunit (28S - LSU) and Mitochondrial gene. It must be noted that, for the time being, only a small portion of the strains have been sequenced for all the genes. In Fusarium chlamydosporum species complex, EF1, RPB2, CAL, ITS and LSU sequences are available. For Fusarium dimerum species complex, EF1, TUBB, ITS and LSU are most of the time present. Strains belonging to Fusarium incarnatum-equiseti species complex have been sequenced for EF1, RPB2, CAL, ITS and LSU. Fusarium oxysporum species complex is well represented in terms of strains but only a few EF1, and LSU are more or less consistently present while TUBB as well as ITS have been sequenced in a few cases. For Fusarium solani species complex, several genes (EF1, RPB2, CAL, TUBB, ITS and LSU) are 109 represented but few strains have been sequenced for all of them. Finally, Gibberella fujikuroi species complex have been well studied and most strains have data for EF1, CAL, TUBB, Histone, IGS, ITS, LSU and Mitochondrial gene. Simple and advanced queries on the strains table are possible via a user-friendly interface. For the identification, two major options are possible. The first one is the Single sequence alignment algorithm comparing a unique unknown sequence against the ones present in our Fusarium MLST sequences reference database. It’s also possible to compare it against all fungal sequences available from both Genbank and the CBS-KNAW sequences database . The second option (Multiple sequences) allows the alignment of several sequences of several loci at the same time against the Fusarium MLST database using the polyphasic comparison tools of the BioloMICS software. Since not all the sequences are available for all the strains, comparisons will be based on unequal datasets and might lead to unbalanced identifications. This being said, these multi-locus sequences comparisons are extremely powerful and usually allow more reliable identifications Examples of physical and optical maps of Fusarium species F. graminearum F.verticillioides 110 Fusarium oxysporum physical map of 15 chromosomes 8. Fusarium diseases in plants, man and animals 8.1. Fusarium diseases in plants Fusarium species are among the most diverse and widely dispersed plantpathogenic fungi, causing economically important blights, root rots or wilts 1. Some species, such as F. graminearum and F. verticillioides , have a narrow host range, infecting predominantly the cereals. By contrast, F. oxysporum, has a remarkably broad host range, infecting both monocotyledonous and dicotyledonous plants Fusarium graminearum is one of the causal agents of head blight disease in wheat and barley. This devastating pathogen and other head blight causes important losses in crops worldwide Fusarium oxysporum comprises a group of soil inhabitants that can exist as saprophytes in the soil debris but also as pervasive plant endophytes colonizing the plant roots. Many strains of these species are pathogenic to 111 plant crops. One of these strains, Fusarium oxysporum f.sp. lycopersici, is the causal agent of fusarium wilt in tomatoes. The first symptoms of the plant are yellowing and weakness in one side of the plant and progress with wilting of the leaves and browning of the vascular system leading eventually to leaf death and inhability to produce fruits. Fusarium oxysporum has many Formae speciales that exist as plant pathogens, which are differentiated by host range, causing storage, root, stem, and fruit rot, as well as vascular wilt.        F. oxysporum f.sp. cubense causes Banana wilt F. oxysporum f.sp. vasinfectum causes wilt of cotton F. oxysporum f.sp. batatas causes wilt of sweet potatoes and stem rot F. oxysporum f.sp. lycopersici causes tomato wilt F. oxysporum f.sp. asparagi causes asparagus wilt F. oxysporum f.sp. melonis causes muskmelon and cantaloupe wilt F. oxysporum f.sp. zingiberi causes ginger wilt Fusarium solani is responsible for disease on about 100 genera of plants. Fusarium verticillioides is a fungal plant pathogen. It causes a disease in rice called bakanae, which is japanese and means "foolish seedlings". The afflicted plants are at best infertile with empty panicles, producing no edible grains; at worst, they are incapable of supporting their own weight, topple over, and die (hence "foolish seedling").The earliest known report of bakanae is from 1828. Bakanae affects rice crops in Asia, Africa, and North America; in 2003, the International Rice Research Institute estimated bakanae-related crop losses at between 20% and 50%. Fusarium verticillioides is the causal agent of kernel and ear rot of maize. This destructive disease occurs virtually everywhere that maize is grown worldwide. In years with high temperatures, drought, and 112 heavy insect damage, the disease can significantly diminish crop quality. Gallery of fusarium infections in plants 1. Fusarium wilt Fusarium wilt of banana www.apsnet.org, galleryhip.com Fusarium Wilt Little trip www.ext.colostate.edu, Tomato pixgood.com Fusarium Wilt Palm pixgood.com www.infonet-biovision.org Chili plant wilt 113 2. Head scab and head blight fyi.uwex.edu . Fusarium head scab on a wheat head wikimedia.org Fusarium head blight of barley. 3. Fusarium ear rot in corn www.strikepointpioneer.com Fusarium ear rot is the most widespread disease of all corn kernel 4. Fusarium Crown and Foot Rot ag.umass.edu Fusarium Crown and Foot Rot of pumpkin, Squash www.plantvillage 114 pnwhandbooks.org Fusarium Root and Crown Rot. Red clover, Crown and root rot diseases of strawberries .www.agric.wa.gov.au 5. Fusarium Basal Rot www.alamy.comgardener.wikia.com Onion Fusarium basal rot Iris, Bulbous -Fusarium Basal Rot..pnwhandbooks.org 8.2. Fusarium infections in human        Fusarium is capable of causing mycetomas, Fusarium has repeatedly been isolated from human keratitis and corneal ulcers. Most cases concern keratitis. Fusarium has been reported as an agent in endophthalmitis, Fusarium has been reported as an agent in subcutaneous and cutaneous infections, Fusarium has been reported as an agent in septic arthritis. Cases of sinusitis and catheter infection have been reported. Upon initial exposure, Fusarium generally ascends right into the colon, then through the tissues and through the central nervous system. 115  Seven Fusarium species complexes are associated with described cases of human infections: 1. F. dimerum species complex (FDSC), 2. F. solani species complex (FSSC), 3. F. oxysporum species complex (FOSC), 4. F.fujikuroi species complex (FFSC, encompassing F. proliferatum and F. verticillioides), 5. F. incarnatum-equiseti species complex (FIESC) 6. F. chlamydosporum species complex (FCSC), and 7. F. sporotrichioides (FSAMSC).  Only a few other Fusarium species outside these species (complexes) have occasionally been implicated in human or mammal infections.The majority of Fusarium human infections are due to members of the FSSC, followed by FOSC.  The commonly recorded diseases are: 116  Onychomycoses and skin infections  Etiological agents: members of FSSC, FOSC, FFSC, rarely FDSC and FIESC.  The prevalence of onychomycoses in humans lies in the range of 5–15 % of the adult population. Fusarium spp. can make up to 10–15 % of the cases  Suggested predisposing factors for onychomycosis in general include increasing age, but also immunosuppression, poor peripheral circulation, trauma, and tinea pedis.  Fungal keratitis is often linked with trauma, especially with vegetable or other organic matter. The infection is more common in tropical areas and in areas with a relatively large agrarian population. However, prevalence data are still approximate.  Disseminated fusarioses in the immunocompromised host,  Etiological agents: members of FSSC, FFSC, FOSC, FDSC, or rarely by FIESC. Clinical Spectra of Fusarium Species   The Fusarium solani species complex (FSSC) globally is the most common group encountered in human infections. It contains sixty or more haplotypes, some of which are predominant in patients.  Of these, F. falciforme, F. keratoplasticum, F. lichenicola, and F. petroliphilum are capable of human infection.  Reported cases by members of FSSC range from onychomycosis to disseminated infection The Fusarium dimerum species complex (FDSC) contains at least 12 lineages, of which at least F. dimerum sensu stricto, F. delphinoides, and F. penzigii have been involved in human 117 infection. Most case reports on F. dimerum were published prior to its recognition as a species complex. the infections range from onychomycoses, keratitis, and other localized infections to disseminated infections in haematooncological patients.    Fusarium chlamydosporum species complex (FCSC) (F. chlamydosporum sensu lato) contains at least four distinct species. The complex has only once been implicated in a keratitis, but more often in onychomycoses, cutaneous and deep localized infections, and in disseminated infections in haematooncological patients. Fusarium incarnatum-equiseti species complex (FIESC) at least 28 species can be recognized. They have repeatedly been involved in onychomycoses, skin, eye, and deep localized and disseminated infections, especially in leukemic patients. Fusarium fujikuroi species complex (FFSC)  F. proliferatum and F. verticillioides are most commonly observed in human infections are However,  members of FFSC are increasingly identified in especially invasive and disseminated infections in haematooncological patients.  some species of FFSC species, e.g., F. acutatum, F. anthophilum, F. andiyazi, F. nygamai, and F. sacchari have a limited geographic distribution and/or are associated with specific climatic conditions. Outside the above-described species complexes, a few other Fusarium species have been implicated. Both F. lateritium and F. polyphialidicum were 118 recorded causing keratitis, while F. lateritium also caused a disseminated infection in an HIV-patient. Gallary of some clinical cases Slit lamp photograph showing infected cornea involving regions of sclera, Fusarium temperatum. Al-Hatmi et al., 2014 A, Patient 1 has classic characteristics of fungal keratitisB, Patient 2 has severe fungal keratitis Left: www. consumerist.com, A 34-year-old man, a piece of wood hit his eye. Culture results were positive for F. solani. Right: www.intechopen.com Satellite lesions, hypopyon in anterior and posterior chamber in a Fusarium keratitis in 45 year-old male. 119 Onychomycosis in a male gardener (a, b) Finger and thumb nails showing signs of total dystrophic onychomycosis. Fusarium equiseti , Jandial S, Sumbali G.m 2012 Onychomycosis in a male: (a, b) Big toe and little toe finger nails showing signs of onychomycosis. Fusarium heterosporum , Jandial S, Sumbali G.m 2012 Toenail Fusarium infection, habee.hubpages.com EARL et al., 1959 Case Reports Cutaneous Infection by Fusarium solani in a Patient ...www.thinkzon.com 120 A and B – Fingers nail with yellow-white discoloration roughness and thickening in distal surfaces. C and D – Toenails with yellowish discoloration, hyperkeratosis and roughness of the distal nail plates. Fusarium oxysporum Vania O. Carvalho et al., 2014 multiple cutaneous ulcers, F. solani. www.perfecthealthinfo.com. Alex Banger Cutaneous fusariosis by a species of the Fusarium dimerum species .www.elsevier.es 121 Heel of left foot showing swelling with nodules and verrucous hyperplasia, Plantar surface of right forefoot showing a superficial ulcer, Fusarium solani, Kudur MH et al., 2013 Ulcer with black eschar on forehead, Lesion on left knee Kritika Vishwanath Singha et al., 2012 Disseminated Fusarium infection with skin lesions Left: Fatal disseminated infection with Fusarium petroliphilum Ersal et al., 2015, Disseminated Fusarium infection in a patient with acute myeloid leukemia and prolonged neutropenia. (A) Multiple tender cutaneous nodules 122 Liu, Y., Wang, N., Ye, R., & Kao, W. (2014). Disseminated Fusarium infection in a patient with acute lymphoblastic leukemia: A case report and review of the literature. Oncology Letters, 7, 334-336. Fusarium solani: An Emerging Fungus in Chronic Diabetic Ulcer..Pai R et al., J Lab Physicians. 2010 Non-speciﬁc infection and calciﬁcated thickening of pleura (asbestos exposure). New inﬁltration areas and cavitations in someconsolidations. N. Kebabcı et al. 2013 Blackwell Verlag GmbH 123 8.3. Fusarium infections and fusariotoxicosis in birds A sandhill crane suffering from fusariotoxicosis, Fluid beneath the skin of the head and neck of a sandhill showing wing and head droop, Ronald M. Windingstad crane with fusariotoxicosis. J. Christian Franso Inflammation and ulceration of the mucosal surface of the oesophagus in a sandhill crane with fusariotoxicosis. James Runningen Stomatitis following consumption of T2 fusariotoxin. Chick showing stomatitis attributed to T2.fusariotoxicosis, Dr.Mohamed Abdel - Moniem Amer 124 Ivan Dinev, Diseases of Poultry erosions and ulcers in gizzard cuticulum , thickened wall of the proventriculus hyperaemic and haemorrhagic mucous coat of the gizzard Ivan Dinev, Diseases of Poultry reddening and hemorrhage of intestinal muscosa. Ivan Dinev, Diseases of Poultry .Frequent findings in fusariotoxicoses are the massive subcapsular liver haematomas, causing sudden death in broilers. Ivan Dinev, Diseases of Poultry The fusariotoxin zearalenone has an effect, identical to that of oestrogenic hormones and results in reduction of testes in cocks. Left - normal; right 125 atrophied testis in a cock, in whose diet high zearalenone concentrations have been determined. Microscopically, the testes of cocks with zearalenone fusario-toxicosis, show a fatty infiltration and atrophy of the germinative epithelium with the exception of the basal layer as well as interruption of the spermatogenesis., Fusarochromanone causes tibial dyschondroplasia in broiler chickens, manifested with long bone deformation. Ivan Dinev, Diseases of Poultry 8.4. Fusariotoxicosis in animals    Fumonisins cause a neurological disease, equine leucoencephalomalacia in horses, pulmonary edema in swine, hepatotoxic and nephrotoxic effects in other domestic animals, and carcinogenesis in laboratory animals. Vomitoxin causes pigs to vomit following consumption of feed with high concentrations of the toxin. Swine are the most sensitive livestock species to vomitoxin. The most common effect of vomitoxin is reduced feed intake or feed refusal. Ruminants appear to be less sensitive to dietary vomitoxin concentrations than are monogastrics (particularly swine), perhaps due to the presence of rumen microorganisms. Zearalenone possesses estrogenic activity and, When consumed by animals, has been associated with reproductive problems, such as abortions, false heat, recycling, reabsorption of fetuses and mummies, and vulvaluterine prolapse. Swine are the most susceptible to the effects of zearalenone. Poultry Broiler chicks and laying hens are not greatly affected by zearalenone, even when consuming large quantities of the toxin Zearalenone, in swine www.apsnet.org 126 this horse isdisplaying: staggering, ataxia, paresis. drowsiness, listlessness. Death will occurr after a few days. www.healthvalue.net 9. Isolation and identification of Fusarium species 9.1. Media used Selective culture media, such as Nash and Snyder medium (NS), dichloranchloramphenicol peptone agar (DCPA), modified Czapek-Dox agar (MCz), Czapek Dox iprodione dichloran agar (CZID), potato dextrose iprodione dichloran agar (PDID), or malachite green agar (MGA 2.5), have been developed for isolating and enumerating Fusarium spp. from natural samples. Tap water Agar (TWA) Agar Distilled water ad 20.0 g 1000.0 ml Sterilise by autoclaving at 121°C for 15 minutes. 127 Carnation Leaf-Piece Agar (CLA). Fresh carnation leaves cut into 5-8 mm² pieces, dried in a forced-air oven (~ 70°C) for 1-2 hours, sterilized by gamma irradiation (2.5 megarads), placed into a Petri dish, add sterile 1.2% water agar Carrot Agar. Fresh carrots, washed, peeled and diced 400 g add in a flask in 400 ml of water, autoclave for 20 minutes, blend, add 500 ml of distilled water, add 20 g of agar, autoclave for 30 minutes. Oat Agar, whole (OA) Quaker Oats*................ 10 flakes/20 ml Agar*............................................... 15 g Distilled water............................... 1 liter 5. Potato Dextrose Agar (PDA)* Potato extract (see below) ......... 200 ml Glucose* ......................................... 10 g Agar*............................................... 15 g Distilled Water........................... 1 liter To prepare potato extract: place 200 g diced potatoes into 500 ml dist. water, cook 1 hour in steamer or 40 min. in autoclave. strain potato infusion through cloth, melt agar in 500 ml dist. water, 128 add 200 ml potato extract to melted agar, add glucose, adjust volume to 1000 ml autoclave. Soil Agar (SA). 250-500 g of sieved dry soil into a flask add to 1 L with tap water autoclave for 15 min. add 15 g agar autoclave for 15 min. Komada’s Medium. D-Galactose L-Asparagine 20.0 g 2.0 g 1.0 g 0.5 g 0.5 g 1.0g 10.0 mg 1000.0 ml K2HPO4 KCl MgSO4•7H2O PCNB (Terraclor 75 % WP) Fe3Na EDTA Distilled water to The streptomycin stock solution is 5 g of streptomycin in 100 ml distilled H2O, and is used at the rate of 6 ml/L of medium. The Oxgall stock solution contains 5 g Oxgall and 10 g Na 2B4O7•10H2O in distilled H2O, and is used at the rate of 10 ml/L of medium. Nash-Snyder Medium Difco peptone K2HPO4 MgSO4 • 7 H2O Agar 15.0 g 1.0 g 0.5 g 15.0 g 129 Distilled water PCNB (Terraclor 75 % WP) Streptomycin neomycin sulfate 1000.0.ml 1.0 g 0.3 g 0.12 g Dichloran-chloramphenicol peptone agar (DCPA) Peptone 15.0 g; KH2PO4, 1.0 g; MgSO4 7H20, 0.5 g; chloramphenicol, 0.2 g; Dichloran (0.2% solution in ethanol), 1 ml (equivalent to 2 pg/ml); Agar, 20.0 g; Distilled water to 1000.0 ml. The medium is sterilized at 121°C for 15 min; the final pH was; Czapek’s Agar (CZ)* Sucrose (commercial grade). .......... 30.0 g NaNO3 ............................................... 3.0 g K2HPO4 .............................................. 1.0 g MgSO4 x 7 H2O ............................. 0.50 g KCl ..............................................0.50 g FeSO4 x 7 H20 ............................... 0.01 g Agar .............................................. 20.0 g Distilled water .............................. 1000.0ml 9.2. Identification of Fusarium species 9.2.1. Morphological identification Fusarium cultures are examined for macromophological features typical for Fusarium species namely, woolly to cottony, flat, spreading colonies, white, 130 cream, tan, salmon, cinnamon, yellow, red, violet, pink or purple; and on the reverse, it may be colourless, tan, red, dark purple, or brown, and the micromorphological features namely: curved, transversely septate conidia macroconidia, produced from sporodochia or pionnotes, smaller conidia of various shapes and septation (“microconidia” and/or “mesoconidia”) produced from unbranched or branched mycelial conidiophores, producing conidiogenous cells with monophialidic polyphialidic openings, and chlamydospores which are thick-walled, generally globose thallospores, produced in or on hyphae or conidia, singly or in chains or bunches, in addition to sexual spores, when observed, which are produced in flask-shaped fruiting bodies (perithecia) that are usually in shades of red, orange, blue or purple, with little or no stromatal tissue. Asci produced from distinct hymenia, single-walled (unitunicate) containing eight ascospores, which usually possess one or more septa, but can be aseptate. 9.2.2. Molecular Methods for Identification of Fusarium Molecular biology has offered a number of insights into the detection and enumeration of fungal pathogens and information on identifying unknown species from their DNA sequences. In recent years, there has been vast progress in the development of molecular biological tools and technologies. Each technique can be used as a tool to study variation amongst fungal isolates, and hence provide important information on genetic relationships, taxonomy, population structure and epidemiology associated with fungi. Molecular markers used for identification of Fusarium  sequence characterized amplified regions (SCAR),  single strand conformational polymorphism (SSCP),  randomly amplified polymorphic DNA (RAPD),  amplified fragment length polymorphism (AFLP),  restriction fragment length polymorphism (RFLP),  sequence related amplified polymorphism (SRAP),  single nucleotide polymorphism (SNP),  variable number of tandem repeat (VNTR) 131  SNP-based multilocus genotyping assay Steps:  PCR amplification DNA sequencing of, e.g.  the translation elongation factor 1 alpha gene (EF-1α);  the nuclear rRNA internal transcribed spacer (ITS),  the large subunit (LSU),  the intergenic spacer (IGS) regions;  the second largest subunit of the RNA polymerase gene (RPB2);  the calmodulin gene (CAM);  the mitochondrial small subunit (mtSSU) rRNA gene. Comparison of sequenced DNA to DNA sequence databases  Identification by comparison with databases  The FUSARIUM-ID server at http://fusarium.cbio.psu.edu  BLAST search tool that allows users to query unknown sequences against the database.  GenBank database is publicly available for identification purposes, and can be accessed via the Entrez website at the US National Center for Biotechnology Information (NCBI): http://www.ncbi.nlm.nih.gov/Entrez/.  It is strongly recommend to use FUSARIUM-ID because it contains vouchered and well-characterized sequences that correspond to publicly available cultures that can be used for confirmation.  FUSARIUM-ID can be used in conjunction with GenBank. Primers used for Fusarium List of primers developed for rapid detection of Fusarium sp. and F. solani. (Arif et al., 2012) 132 TEF-1α ~420 bp Fusarium species TEF-Fu3f GGTATCGACAAGCGAACCAT TEF-Fu3r TAGTAGCGGGGAGTCTCGAA ITS2-rDNA subunit ~466 bp Fusarium species ITS-Fu1f ACAACTCATAACCCTGTGAACAT ITS-Fu1r CAGAAGTTGGGTGTTTTACGG TEF-1α 658 bp F. solani TEF-Fs4f ATCGGCCACGTCGACTCT TEF-Fs4r GGCGTCTGTTGATTGTTAGC ITS1, ITS2 595 bp F. solani ITS-Fu2f CCAGAGGACCCCCTAACTCT ITS-Fu2r CTCTCCAGTTGCGAGGTGTT ITS2-rDNA subunit 485 bp F. solani ITS-Fs5f CGTCCCCCAAATACAGTGG ITS-Fs5r TCCTCCGCTTATTGATATGCTT Amplification profile of 25 isolates of Fusarium spp. obtained using PP1 primer.( Arif, et al., 2011) List of primers designed from the sequences of F. sambucinum and F. coeruleum ITS region using primer set ITS1 x LR1. (Assefa et al., 2012) C1F TCAAGCTCTGCTTGGTGTTG C1R TTGACCTCGGATCAGGTAGG F. coeruleum C2R ACTCGCCTCAAAACAATTGG 133 C3R1ATTTCGGAGCGCAGTACATC C4F ACAAGGTTTCCGTAGGTGA C4R AGACTCGCCTCAAAACAATT C5F GCTTTGCCTGCTACTATCTCTTAC C5R TCAATAAGCGGAGGAAAAG S1F ATCTCTTGGTTCTGGCATCG S1R AAATACATTGGCGGTCTTGC F. sambucinum S2R CGAAATACATTGGCGGTCTT S3F GGAGGGATCATTACCGAGTTTACA S3R TAAAACCCCAACTTGTGAATGTGA Species-specific PCR primers designed from the ITS region for the identi¢cation of Fusarium species (Prashan et al.,2003) F. culmorum 175F 5P-TTTTAGTGGAACTTCTGAGTAT-3P 430R 5P-AGTGCAGCAGGACTGCAGC-3P F. sambucinum FSF1 5P-ACATACCTTTATGTTGCCTCG-3P FSR1 5P-GGAGTGTCAGACGACAGCT-3P F. oxysporum FOF1 5P-ACATACCACTTGTTGCCTCGFOR1 5P-CGCCAATCAATTTGAGGAACG-3P F. equiseti FEF1 5P-CATACCTATACGTTGCCTCG-3P FER1 5P-TTACCAGTAACGAGGTGTATG-3P F. avenaceum FAF1 5P-AACATACCTTAATGTTGCCTCGG-3P FAR 5P-ATCCCCAACACCAAACCCGAG-3 Genus and species-specific primers (KONIETZNY et al., ]. 2003) 134 DNA of Chinese and Canadian Fusarium graminearumchemotypes amplified using Fg16 F/R primers. The 497 bp represents SCAR group V and 410 bp represents SCAR group I. Lane M: Marker; Lanes 1 and 2: NIV chemotypes, China (Fg -0921, 0905); Lanes 3 and 4: 15-ADON chemotype, China (Fg-1960, 0819); Lanes 5-7: 3ADON chemotypes, China (Fg-0919, 0926, 0970); Lanes 8-10: 3-ADON chemotypes, Canada (M5-06-01, ON-06-39, DF-Fg-2); Lanes 11-13: 15-ADON chemotypes, Canada (DF-Fg- 144, ON-06-05, 55-1); Lane C: Control. Amarasinghe et al., 2011 135 RAPD banding patterns of nine fusarium isolates isolated from horse feed staff using five selected random primers, M: 1 kbp plus DNA ladder, Lane (13): F. verticillioides, Lane 4-6 areF. anthophilum and lane 7-9 F. proliferatum (Abo El Yazid et al. (2011) Diagnostic multiplex PCR for MAT-1 and MAT-2 (Steenkamp et al., 2000). The multiplex PCR included the four primers GFmat1a, GFmat1b, GFmat2c, and GFmat2d: GF GF Gf GF at a 5′-GTTCATCAAAGGGCAAGCG- ′ at 5′-TAAGCGCCCTCTTAACGCCTTC- ′ at 5′-AGCGTCATTATTCGATCAAG- ′ . at d 5′-CTACGTTGAGAGCTGTACAG- ′ . 136 PCR amplification of the MAT region by using a multiplex PCR. The larger differential band (∼800 bp) is from amplification of the MAT-2 region. The smaller differential band (∼200 bp) is from amplification of the MAT-1 region. The constant band beneath both of the amplified bands is unincorporated primer. (A) Segregation of MAT-1 and MAT-2 in 8 of the progeny from the mapping cross of F. verticillioides (23). Lane 1, size markers (200, 400, 800, 1,200, and 2,000 bp); lanes 2 to 9, progeny from A-0015 × A-4643. (B) MAT-1 and MAT-2 alleles from the matingtype tester strains for G. fujikuroi mating populations A, B, D, and H. Lane 5, size markers; lanes 1 to 4, MAT-1 tester strains; lanes 6 to 9, MAT-2 tester strains. 137 10. Description of Fusarium species 1. Fusarium acacia-mearunsii Macroconidia 5-septate,gradually curved, asymmetric upper and lower haves, widest above and lower mid-region,narrow apical beak 2. Fusarium acuminatum Ellis & Everh., Proc. Acad.Nat. Sci.Philad. 47: 441 (1895) ≡Fusarium scirpi var. acuminatum (Ellis & Everh.) Wollenw., Fusaria Autographice Delineata 3: 930-933 (1930) ≡Fusarium scirpi subsp. Acuminatum (Ellis & Everh.) Raillo, Fungi of the genus Fusarium: 177 (1950) ≡Fusarium gibbosum var. acuminatum (Ellis & Everh.) Bilai, Mykrobiologichnyi Zhurnal Kiev 49 (6): 6 (1987) Morphology Colonies are slow-growing, with white aerial mycelium, developing brownish pigmentation in the center on PDA. The dorsal side of the colony has rose to burgundy pigmentation. Macroconidia are broadly falcate with 3-5 septa, apical cell long and tapered, basal cell foot138 shaped. Microconidia are sparse, fusiform, 0-1 septa, conidiogenous cell monophialides and chlamydospores formed in chains. F. acuminatum colony, Paul Cannon Chlamydospores, conidiogenous cells, macroconidia, Leslie and Summerell 3. Fusarium acutatum Nirenberg & O'Donnell, Mycologia 90: 435 (1998) Colonies produce white to pinkish-white mycelium with light orange pigments in the agar. Macroconidia sparse, fulacate, thin-walled, 3septate, apical cell bent, basal cell foot-shaped. Microconidia abundant, oval-fusoid, conidiogenous cell monoor polyphialides. Chlamydospores develop slowly, in chains and clusters Fusarium acutatum colony www.boldsystems.org,, conidia, Leslie and Summerell 139 4. Fusarium aethiopicum O'Donnell, Aberra, Kistler & T. Aoki (2008) F. aethiopicum produces mostly straight conidia, which are asymmetrical in that they are typically widest above the mid-region 5. Fusarium andiyazi Marasas, Rheeder, Lampr., K.A. Zeller & J.F. Leslie, Mycologia 93: 1205 (2001) = Fusarium moniliforme = Fusarium verticillioides Colonies on PDA produce white powdery to floccose mycelium and orange sporodochia, violet pigmentation is seen in the agar. Macroconidia are formed in sporodochia, on monophilides or on branched conidiophores, 3-6 septa, apical cell slightly curved, basal cell pedicillate. Microconida abundant, clavate to ovoid, in chains on monophilides, 0-septa. Chlamydospores absent, pseudochlamydospores may be present. A,b 10-day old culture of Fusarium andiyazi on oatmeal agar, C sporodochia,. Kebabci et al., 2013 140 Macroconidia, microconidia,pseudochlamydospores, John F. Leslie and Brett A. Summerell 6. Fusarium anthophilum (A. Braun) Wollenw., Fusaria Autographice Delineata 1: 176 (1916) ≡Fusisporium anthophilum A. Braun, Fung. Europ.: no. 1964 (1875) ≡Fusarium moniliforme var. anthophilum (A. Braun) Wollenw., Fusaria Autographice Delineata 3: 975 (1930) ≡Fusarium wollenweberi Raillo, Fungi of the genus Fusarium: 189 (1950) ≡Fusarium tricinctum var. anthophilum (A. Braun) Bilai, Fusarii (Biologija i sistematika): 251 (1955) ≡Fusarium sporotrichiella var. anthophilum (A. Braun) Bilai, Mykrobiologichnyi Zhurnal Kiev 49 (6): 7 (1987) Colonies on PDA form abundant white floccose mycelium turn to greyish violet in old cultures. Pigmentation in agar violet grey or dark. Sporodochia pale orange. Macroconidia are thin-walled, long, slender, almost straight, 3-5 septa,produced from monophilides on branched conidiophores in the sporodochia or on the hyphae, basal cell notched or foot-shaped, apical cell curved and tapered. Microconidia are abundant, from poly- or monophialides, globose, 1-2 celled, globose, or ovoid, in false heads. Chlamydospores absent. 141 Leslie and Summerell , Hagedorn, Burhenne & Nirenberg 7. Fusarium armeniacum (G.A. Forbes, Windels & L.W. Burgess) L.W. Burgess & Summerell, Mycotaxon 75: 347 (2000) ≡Fusarium acuminatum subsp. Armeniacum G.A. Forbes, Windels & L.W. Burgess, Mycologia 85: 120 (1993) Colonies on PDA produce white aerial mycelium, red to apricot pigment in agar, and bright orange sporodochia in the center of the culture. Some isolates produce a pionnotal form of slow-growing colonies with little aerial mycelium and abundant orange sporodochia. Macroconidia in orange sporodochia and chlamydospores formed abundantly, but microconidia are absent. 142 Leslie and Summerell 8. Fusarium asiaticum O'Donnell, T. Aoki, Kistler & Geiser, Fungal Genetics & Biology 41 (6): 619 (2004) Colonies pink to dark red, cottony, produce white to pink mycelia Sporodochia pale orange. Macroconidia hyaline, falcate with single foot cella, 3-5 septate. Microconidia absent. Chlamydospores round, single or in chains Kawakami, et al., 2015 143 9. Fusarium austroamericanum. T. Aoki, Kistler, Geiser & O'Donnell, Fungal Genetics & Biology 41 (6): 617 (2004) Macroconidia 5-septate, with longitudinal axis typically straight, asymmetric lower and upper halves, widest in mid-region, with narrow apical beak. 10. Fusarium avenaceum (Fr.) Sacc., Sylloge Fungorum 4: 713 (1886) Fusisporium avenaceum Fries, Systema Mycologicum 3: 444 (1832) ≡Fusarium herbarum var. avenaceum (Fries) Wollenw., Fusaria Autographice Delineata 144 3: 899 (1930) [MB#252553] =Selenosporium herbarum Corda, Icones fungorum hucusque cognitorum 3: 34, t. 6:88 (1839) Colonies initially form abundant fluffy white mycelium and produce a golden orange pigment on PDA at 25°C. Sporodochia pale orange, Macroconidia are slightly falcate, thin-walled, usually 3 to 5 septate, with a tapering apical cell , basal cell notched. Microconidia are rare, fusoid, 1-2 septa, single. Chlamydospores are absent. F, avenaceum colonies, www.grainscanada.gc.ca. Mycota, G. Hagedorn, M. Burhenne & H. I. Nirenberg 11. Fusarium aywerte (Sangal. & L.W. Burgess) Benyon & L.W. Burgess, Mycological Research 104 (10): 1171 (2000) ≡Fusarium avenaceum subsp. Aywerte Sangal. & L.W. Burgess, Mycological Research 99: 287 (1995) 145 John F. Leslie and Brett A. Summerell 12. Fusarium azukiicola T. Aoki, H. Suga, F. Tanaka, Scandiani & O'Donnell (2012). Mycologia. 2012 t;104(5):1068-84. Colonies produce loose to floccose, white to yellowish white or reddish white to pale red aerial mycelium. Reverse pigmentation absent or sometimes grayish yellow, grayish orange to brownish orange. Macroconidia mostly falcate, sometimes cylindrical and gradually curved, widest at midregion or more frequently widening gradually upward, often with a slightly rostrate apex, sometimes with a rounded apex, gradually narrowing toward base often with a distinct, slightly protruding basal foot cell or sometimes rounded, 1–5-septate. Microconidia oblong to naviculate or short-clavate, sometimes ellipsoidal, straight or curved, with a rounded apex and a truncate base, 0–2-septate. Chlamydospores formed abundantly in hyphae and in conidia, mostly subglobose, intercalary or terminal, mostly single, rarely in chains. Aoki et al., 2012 146 13. Fusarium babinda Summerell, C.A. Rugg & L.W. Burgess, Mycological Research 99: 1345 (1995) Colonies produce floccose aerial mycelium, initially white, later darkening to pink or pale orange, in some strains with a violet centre; reverse salmon pink, in some strains becoming violet topurple slate; Microconidia formed from scattered conidiogenous cells, monophialides and polyphialides, aggregating in slimy droplets, hyaline, 0-1 septate, ovoid, ellipsoid to allantoid. Macroconidia formed from scattered conidiogenous cells (monophialides) in the aerial mycelium, later from irregularly branching clusters of conidiogenous cells on the agar surface, developing into slimy, pale pink sporodochia, 3-5-septate, fusiform to cylindrical, slightly curved, apical cell strongly curved, tapering to a point; basal cell with projecting pedicel. Chlamydospores subglobose, thick-walled, hyaline to pale brownish, mostly intercalary, in chains or clusters, sometimes single. John F. Leslie and Brett A. Summerell 14. Fusarium bactridioides Wollenw., Science 79: 572. 1934. Colonies produce poorly developed stroma and orange-white to light orange sporodochia. Macroconidia 3–6 septate; the ventral surface is more or less straight or gently curved, and the dorsal surface is moderately curved, with the walls more or less parallel in the central 147 two cells of the conidia, with the widest point near the middle or above the middle. The apical cell is bluntly rounded, and roughly the same length as the penultimate cell. The basal cell is tapered more acutely than apical cell; the base is rounded, flat, or has a slight indentation on the dorsal side or central papilla, indicating a foot cell. Microconidia are abundant in the sporodochia, are 0–3 septate, and vary in shape and size from small, ellipsoidal, oblong-ellipsoidal or allantoid cells that are obviously microconidia to fusiform to clavate, septate spores that intergrade with macroconidia. Hagedorn, Burhenne & Nirenberg,Seifert & Gräfenhan, 2002 15. Fusarium begoniae Nirenberg & O’Donnell, Mycologia 90: 446 (1998) Colonies with entire margin. Aerial mycelium almost white, cottony. Pigmentation in reverse greyish-yellow. Microconidia borne in the aerial mycelium oval to allantoid and obovoid, 1-0 Septate, 148 Macroconidia, abundant, borne in sporodochia slender, long falcate but almost straight, with a slightly beaked apical cell and a footlike basal cell, mostly 3-4 septate. Chlamydospores absent. John F. Leslie and Brett A. Summerell 16. Fusarium beomiforme P.E. Nelson, Toussoun & L.W. Burgess, Mycologia 79: 884-889 (1987) Colonies with floccose, white-pink aerial mycelium, developing a diffuse, orange-reddish-brown colouration in reverse. Microconidia of two forms: (a) abundant, ovoid to cylindrical; (b) less abundant, larger, globose to napiform, typically vacuolate; chains absent, spores collecting in slimy droplets. Conidiogenous cells monophialides, cylindrical, tapering slightly at the tip, with periclinal thickening. Macroconidia 3-4 (-5)-septate, falcate, apical cell slightly curved, tapering to a point, basal cell pedicellate. Chlamydospores hyaline, smooth, typically terminal, single or in pairs, not in intercalary chains. Fusarium beomiforme colonies,Truman State University Macroconidia and microconidia of Fusarium beoforme, Leslie and Summerell 149 17. Fusarium biseptatum Schroers, Summerb. & O'Donnell (2009), Colonies produce sparse white or slightly rose to pale orange aerial mycelium on agar. Colony reverse on PDA with ochraceous or brown pigments, mostly without orange pigments. Monophialides formed terminally or laterally on hyphaemin well developed sporodochia, forming few-membered whorls on short supporting cells. Microconidia mostly 0-, rarely 1-septate, typically ellipsoidal, straight or curved, allantoid formed on SNA on submerged or aerial hyphae. Macroconidia typically widest in the upper third or the middle, with central part minutely curved or nearly straight, a pointed and mostly beaked distal end and a slightly pedicellate and curved proximal end; from well developed sporodochia, 0-3-septate. Chlamydospores common, typically intercalary, solitary in short chains or terminal. Fusarium biseptatum. Schroers, Summerb. & O'Donnell (2009), 150 18. Fusarim boothii O'Donnell, T. Aoki, Kistler & Geiser, Fungal Genetics & Biology 41 (6): 618 (2004) Colonies produce white mycelium with light brown coloue in the center, macroconida 5-septate , gradually curved, upper and lower halves are mostly symmetric, widest in the mid-region, with a narrow apical peak, Lee et al., 2011 19. Fusarium brasilicumT. Aoki, Kistler, Geiser & O'Donnell, Fungal Genetics & Biology 41 (6): 620 (2004) Macroconidia 5-septate , straight or gradually curved, upper and lower halves asymmetrical, widest below the mid- region and narrow apical peak 151 20. Fusarium brevicatenulatum Nirenberg & O’Donnell, Mycologia 90: 446 (1998) Colony margin entire. Aerial mycelium whitish; lanose to fluffy. Pigmentation in reverse greyish orange, becoming dark bluish-gray. Sporodochia formed after 10 days. Conidiophores on the aerial mycelium prostrate, mostly identical with phialides, occasionally with one lateral branch. Phialides of conidiophores on the aerial mycelium cylindrical, mostly monophialidic, occasionally polyphialidic. Microonidia borne on the aerial mycelium long-oval to obovoid, mostly O-septate, sometimes 1- and 2-septate. Macroconidia borne in sporodochia rare, falcate, slender, straight, up to 3-4 septate, apical cell bent, basal cell foot-like. Chlamydospores absent. John F. Leslie and Brett A. Summerell 21. Fusarium bulbicola Nirenberg & O’Donnell, Mycologia 90: 446 (1998) ≡Fusarium sacchari var. elongatum Nirenberg, Mitteilungen der Biologischen Bundesanstalt für Land- und Forstwirtschaft 169: 59 (1976) Colony margin entire. Aerial myclium almost white. later tinged ruby by the substrate: short. hairy to lanose. Pigmentation in reverse dark ruby. Conidiophores in the aerial mycelium erect, branched in 1 or 2 cylindrical phialides. Sporodochial conidiophores verticillately 152 branched. Conidiophores in the aerial mvcelium mono- and polyphialidic; sporodochial phialides flask- shaped and monophialidic. Micronidia borne on the aerial mycelium long-oval to allantoid, mostJy O-Septate. Macronidia borne in sporodochia long and slender. falcate with a slightly elongate apical cell and a foot-like basal cell. mostly 3to 5 septate: 3-septate. Chlamydospores absent. John F. Leslie and Brett A. Summerell 22. Fusarium camptoceras Wollenw. & Reinking, Phytopathology 15 (3): 158 (1925) Colonies form white to cream-coloured mycelium and produce pigmentation in the agar. Macroconidia: predominantly 3-7 cells, falcate, abundant in sporodochia, apical cell pointed, basal cell pointed and notched. Sporodochia: cream-orange. Microconidia: long, up to 6 septe, single from a phialide, abundant. Chlamydospores : sparse, on aerial hyphae or submerged in agar, in pairs, chains or clusters 153 154 23. Fusarium chlamydosporum Wollenw. & Reinking, Phytopathology 15 (3): 156 (1925) =Fusarium sporotrichioides var. chlamydosporum (Wollenw. & Reinking) Joffe, Mycopathologia et Mycologia Applicata 52 (1-4): 211 (1974) Colonies produce white mycelium with grayish rose to burgundy or yellowish to pale brown pigmentation.Macroconidia: abundant, thickwalled, moderately curved, 3-5 septa, apicalcell short, curved and pointed, basal cell notched or foot-shaped. Sporodochia: rare. Microconidia: comma-shaped, 0-2 septe, single or in pairs fro, a phialide, abundant. Chlamydospores : abundant after 2-4 weeks, on aerial hyphae or submerged in agar, in pairs, chains or clusters, pale brown Mycobanc, G. Hagedorn, M. Burhenne & H. I. Nirenberg 155 24. Fusarium cicatricum (Berkeley) O'Donnell & Geiser, Phytopathology 103 (5): 404 (2013) Colony reverse lacking red pigments, after 14-21 d on PDA at 15-25 °C with weak pigment production, pale to light yellow (4A3-4A5), at 30 °C, somewhat pale orange. Colony surface on PDA with pustules or cushions of white aerial mycelium with scattered sporodochia covered with pale yellow conidial masses, smooth at margin, wax-like, pale yellow. Phialides more or less cylindrical, tapering towards apex, wide at base and in middle. Microconidia not observed. Macroconidia formed in pale yellow slimy masses, typically gently curved throughout, less commonly almost straight, with pronounced pedicellate foot cell, and a more or less inequilaterally fusoid and hooked apical cell, 2-8-septate: Chlamydospores not observed 25. Fusarium circinatum Nirenberg & O’Donnell, Mycologia 90: 446 (1998) Colonies on PDA with entire margin. Aerial mycelium almost white, hairy to lanose-funiculose. Pigmentation in reverse greyish white to grey to dark violet at the center of the colom. Conidiophores of the aerial mycelium erect. strongly branched, branches terminating mostly in I or 2 phialides. Sporodochial conidiophores verticillately branched. Phialides of the aerial conidiophores cylindrical, mono- and polyphialidic. Micrconidia borne in the aerial mycelium mostly obovoid, occasionally oval to allantoid, mostly 0-1 septate, occasionally l-septate. Macronidia borne in sporodochia slender, cylindrical, mostly 3-septate. Chlamydospores absent. 156 F. circinatum www.scielo. Circinus Macro and Microconidias Mono and PolyPhialides, www.efa-dip.org, John F. Leslie and Brett A. Summerell 26. Fusarium compactum (Wollenw.) Raillo, Fungi of the genus Fusarium: 180 (1950) ≡Fusarium scirpi var. compactum Wollenw., Fusaria Autographice Delineata 3: 924 (1930) [MB#124046] ≡Fusarium compactum (Wollenw.) W.L. Gordon, Canadian Journal of Botany 30 (2): 224 (1952) [MB#532662] ≡Fusarium equiseti var. compactum (Wollenw.) Joffe, Plant and Soil 38: 440 (1973) Macroconidia: abundant, thick-walled, strongly curved, 5 septa, apicalcell elongate and tapering, curved and pointed, basal cell footshaped. Sporodochia: orange. Microconidia: absent. Chlamydospores abundant after 2-4 weeks, on aerial hyphae or submerged in agar, in chains or clusters 157 John F. Leslie and Brett A. Summerell , G. Hagedorn, M. Burhenne & H. I. Nirenberg 27. Fusarium concentricum Nirenberg & O’Donnell, Mycologia 90: 446 (1998) Colonies on PDA show entire margin. aerial mycelium reddish-white: velvety to lanose, reverse pale orange and reddish-grey concentric rings. Conidia borne in false heads: later forming pale orange sporodochia on the surface of the substrate. Conidiophores of the aerial mycelium mainly prostrate. unbranched, with one lateral branch. usually with one phialide. sometimes with a whorl of 4 phialides at the tip; sporodochial conidiophores verticillately branched. Phialides of the aerial conidiophores cylindrical, mono- and polyphialidic, sporodochial phialides flask-shaped. Microconidia borne in the aerial mycelium obovoid or oval to allantoid, O-1 septate. Macroconidia borne in 158 sporodochia slender, long, with a slightly beaked apical cell and a footlike basal cell, 3-5 septate. Chlamydospores absent. John F. Leslie and Brett A. Summerell 28. Fusarium cortaderiae O'Donnell, T. Aoki, Kistler & Geiser, Fungal Genetics & Biology 41 (6): 620 (2004) Macroconidia 5-septate, straight or gradually curved, asymmetric upper and lower halves, widest below mid-region, narrow apical peak 29. Fusarium crookwellense Burgess, Nelson & Toussoun, Transa. Brit. Mycol. Soci.79,498 (1982) =Fusisporium cereale Cooke, Grevillea 6 (40): 139 (1878) 159 =Fusisporium cerealis Cooke, Grevillea 6 (40): 139 (1878) =Gibberella roseum f. cerealis (Cooke) W.C. Snyder & H.N. Hansen, American Journal of Botany 32: 664 (1945) Macroconidia: abundant, pronounced dorsal curvature and straight ventrally, 5 septa, apical cell curved and tapering and pointed , basal cell foot-shaped. Sporodochia: pale orange –dark brown, abundant. Microconidia: absent. Chlamydospores : abundant after 4-6 weeks, smooth, in chains and clusters John F. Leslie and Brett A. Summerell 30. Fusarium culmorum (W.G. Sm.) Sacc., Sylloge Fungorum 11: 651 (1895) =Fusisporium culmorum Wm.G. Sm., Diseases of field and garden crops, chiefly as are caused by fungi: 209 (1884) ≡Fusariu ul oru W.G. S . M Alpi e, Agri ultural Gazette of New South Wales 7: 299-306 (1896) Macroconidia: abundant, relat. Short, thick-walled, dorsal curvature and straight ventrally, 5 septa, apical cell rounded ant blunt , basal cell notched. Sporodochia: orange –brown, abundant. Microconidia: absent. Chlamydospores : abundant in 3-5 weeks, in hyphae and macroconidia, in chains and clusters 160 John F. Leslie and Brett A. Summerell , G. Hagedorn, M. Burhenne & H. I. Nirenberg, Wikipedia 31. Fusarium dactylidis. Takayuki Aoki, Martha M. Vaughan , Susan P. McCormick Mark Busman,Todd J. Ward, Amy Kelly Kerry O'Donnell, Peter R. Johnston and David M. Geise. at Mycologia, 2014 Colonies produce abundant loose to densely floccose aerial mycelium ; reverse white at margin, reddish pigmentation centrally, reddish white, pale red to violet brown. Sporodochia formed on agar surface. Sporodochial conidia formed directly from phialides on substrate hypha. Sporodochial conidiophores form conidia on monophialides. Macroconidia of a single type, typically falcate and curved, dorsiventral, 1–7-septate, usually widest at or slightly above the midregion of their length, tapering and curving equally toward both ends, with an acute apical cell and a distinct basal foot cell. Upper and lower halves of conidia nearly symmetrical. Chlamydospores and 161 sclerotia absent, but round intercalary or terminal cell swellings sometimes present in hyphae or older conidia. 32. Fusarium decemcellulare Brick, Jahrb. Vereinig. Angew. Bot.: 227 (1908) Macroconidia: abundant, very long, curved, thick-walled, 5-9 septa, apicalcell rounded and blunt , basal cell foot-shaped. Sporodochia: yellow. Microconidia: abundant, 0-septe, in long chains. Chlamydospores : absent G. Hagedorn, M. Burhenne & H. I. Nirenberg 162 33. Fusarium delphinoides Schroers, Summerb., O'Donnell & Lampr., Mycologia 101 (1): 57 (2009) = Fusarium dimerum Penzig var. majusculum Wollenw., Fus. autogr. delin. 1:90. 1916. Colonies produce sparse white or pale orange aerial mycelium. Colony reverse pale orange and with dark dirty orange or brown hues; often with brownish pigment. Monophialides formed terminally or laterally along hyphae formed well developed sporodochia, polyphialides not seen. Microconidia mostly 0-1-septate, typically ellipsoidal, straight or curved, allantoid. Macroconidia typically widest in the upper third, with central and basal cells nearly straight but basal cells minutely curved, tapering and pedicellate, distal ends mostly more strongly curved than the proximal end and gently beaked; 0-3-septate. Chlamydospores common, typically intercalary, solitary, in short chains or terminal, not or rarely aggregated 34. Fusarium denticulatum Nirenberg & O’Donnell, Mycologia 90: 445 (1998) Colonies on PDA are funiculose. Pigmentation in reverse greyishorange to brownish-orange with the center blackish-blue. 163 Conidiophores of the aerial mycelium, prostrate, short. often identical with phialides, sometimes branched; sporodochial conidiophores verticillatelv branched. Phialides of the aerial conidiophores. mono- or polyphialidic; polyphialidic openings often denticulate in a rectangular arrangement. Macroconidia: abundant, relatively slender, slightly curved , 5-9 septa, apical cell beaked and blunt , basal cell foot-shaped. Sporodochia: yellow. Microconidia: abundant, long, oval, 0-1 septe .Chlamydospores : absent John F. Leslie and Brett A. Summerell 35. Fusarium dimerum Penzig., Michelia 2 (8): 484 (1882) ≡Fusarium aquaeductuum var. dimerum (Penz.) Raillo, Fungi of the genus Fusarium: 279 (1950) ≡Microdochium dimerum (Penz.) Arx, Transactions of the British Mycological Society 83 (2): 374 (1984) ≡Bisifusarium dimerum (Penzig) L. Lombard & Crous, Studies in Mycology 80: 225 (2015) Macroconidia: abundant, very, short , evenly curved on both sides, 0-2 septa, apical cell rounded and often hooked, basal cell blunt . Sporodochia: not distinct. Microconidia: absent . Chlamydospores : rare, single, in pairs or in chains 164 www.nature.com www.gefor.4t.com Fusarium dimerum , Mycobank 36. Fusarium dlaminii Marasas, P.E. Nelson & Toussoun, Mycologia 77: 971 (1986) Macroconidia: abundant in sporodochia , moderately long , thinwalled, falcate or straight, 3-5 septa, apical cell curved and tapering, 165 basal cell foot-shaped. Sporodochia: orange. Microconidia: abundant on aerial myceliamostly fusiform non-septate and some are napiform , 0-1 septa. Chlamydospores abundant in 4-6 weeks, single, in pairs , in chains, or in clumps, in aerial or submerged, terminal or intercalary John F. Leslie and Brett A. Summerell 37. Fusarium domesticum (Fr. : Fr.) Bachmann, LWT -Food Sci Tech 38:405. 2005. ?Trichothecium domesticum Fr., Syst. mycol. (Lundae) 3:427. 1832 Colonies produce scanty, felt-like to somewhat cottony aerial mycelium. Colony reverse off-white to cream or somewhat pale yellow. Phialides cylindrical and slightly tapering toward the tip. Macroconidia cylindrical to ellipsoidal, straight, distally weakly tapering, rarely rounded, typically with a laterally displaced and slightly extruding hilum, 1- 2-septate. Microconidia clavate to pyriform, formed in small heads on the phialide tip. Chlamydospores intercalary, subglobose, in short chains, 1-celled or with 1 median septum. 166 38. Fusarium equiseti (Corda) Sacc., Sylloge Fungorum 4: 707 (1886) ≡Selenosporium equiseti Corda, Icones fungorum hucusque cognitorum 2: 7, t. 9:32 (1838) =Fusarium gibbosum Appel & Wollenw., Arbeiten aus der Kaiserlichen Biologischen Anstalt für Land- und Forstwirtschaft 8: 190 (1910) =Fusarium caudatum Wollenw., Journal of Agricultural Research 2: 262 (1914) =Fusarium bullatum Sherb., Memoirs Cornell Univ. Agri. Exper. Stat. 6: 198-201 (1915) Macroconidia: abundant in sporodochia , long , slender, dorsoventral curvature, 5-7 septa, apical cell elongate and tapering, basal cell footshaped. Sporodochia: orange. Microconidia: absent. Chlamydospores abundant in 2 -6 weeks, single, in pairs , in chains, or in clumps, in aerial or submerged, terminal or intercalary Fusarium equiseti, colony on potato sucrose agar, fungi.myspecies.info Fusarium equiseti, macroconidia, conidiogenous cells stained in lactofuchsin. fungi.myspecies.info 167 Mycobank draaf.lorraine.agriculture.gouv.fr 39. Fusarium ensiforme , Samuels, Nalim & Geiser Mycologia,. 103, 6 1302-1330 (2011); The macroconidia arise from sporodochia, long, slightly curved with 3– 8-septate , with papillate and somewhat curved apical cell and welldeveloped foot cell. The microconidia are oval and elongated oval, mostly 0-septate. Chlamydospores are smooth walled Fusarium ensiforme , multiseptate macroconidiaconidia and Chlamydospores. Samuels, Nalim & Geiser (2011); 168 40. Fusarium euwallaceae S. Freeman, Z. Mendel, T. Aoki & O’Donnell, Mycologia 105 (6): 1599 (2013) Colonies produce sparse aerial loose to floccose, white to yellowish white, or reddish gray, brownish gray, or purplish gray mycelium. Reverse pigmentation absent or pale yellow grayish orange to brownish orange or sometimes with diffusing pigmentation of brown to reddish brown. Microconidia ellipsoidal, fusiform-ellipsoidal to short clavate, occasionally reniform, 0−2-septate. Macroconidia falcate to long clavate, sometimes curved cylindrical, 1-4-septate, swollen in upper parts, tapering toward the base, often with a round and papillate apical cell, and a distinct foot-like basal cell. Chlamydospores formed abundantly in hyphae and in conidia, mostly subglobose to round ellipsoidal, intercalary or terminal, single, or often in chains, ordinary hyaline to pale yellow, later becoming bluish to brownish when strongly pigmented, smooth to often rough-walled. S. Freeman, Z. Mendel, T. Aoki & O’Donnell, Mycologia 105 (6): 1599 (2013) 169 41. Fusarium falciforme (Carrion) Summerb. & Schroers, Journal of Clinical Microbiology 40 (8): 2872 (2002) ≡Cephalosporium falciforme Carrión, Mycologia 43: 523 (1951) ≡Acremonium falciforme (Carrion) W. Gams, Cephalosporium-artige Schimmelpilze: 139 (1971) ≡Neocosmospora falciformis (Carrión) L. Lombard & Crous, Studies in Mycology 80: 227 (2015) Colonies on malt agar off-white to pale cream, velvety or slightly fluffy. Conidiophores sparse, more or less erect, septate, unbranched, colourless, thin-walled, variable in length, not noticeably tapered towards the apex. Conidiogenous cells terminal, with no distinct collarette, producing conidia from the apex in succession. Conidia colourless, ellipsoidal to reniform, aseptate or septate, sometimes with a somewhat truncated base, sometimes aggregating in small groups. 'Chlamydospores' produced abundantly, sometimes in greater numbers than conidia, either singly or in chains, terminal or intercalary, elongated or swollen, with thin or substantially thickened walls. Fusarium falciforme , Chehri et al., 2015 170 42. Fusarium fracticaudum Herron, Marinc. & M.J. Wingf., . Studies in Mycology 2015 No. 80 pp. 131-150 Macroconidia abundant, elongate, straight, 3–5 septa, apical cells tapering, curved, basal cells distinctly notched to footshaped. Microconidia abundant, fusiform to obovoid, occasionally curved, 0–1 septum, arranged in false heads. Conidiogenous cells monophialidic or polyphialidic, microconidia 43. Fusarium foetens Schroers, O’Donnell, Baayen & Hooftman, Mycologia 96 (2): 398 (2004) Macroconidia: abundant in sporodochia, falcate, 3-5 septa, apical cell curved, basal cell rounded to foot-shaped. Sporodochia: pale- light orange. Microconidia: ovoid, 0-septa, abundant on the aerial mycelia. Chlamydospores few, single, terminal , smooth or verrucose 171 Fusarium foetens on OA. Densely aggregated sporodochial conidiomata, each forming several hemispherical to allantoid conidial masses along the streaked inoculum after 14 d. Solitary sporodochia in other parts of the colony after 28 d. and chlamydospores,micro and macroconidia. H.-J. Schroers, Mycologia, 2004 John F. Leslie and Brett A. Summerell 44. Fusarium fujikuroi Nirenberg, Mitteilungen der Biol. Bundesanstalt Land- Forstwirtschaft 169: 32 (1976) 172 Macroconidia: abundant in sporodochia, slender, insign. Curved, medium length, 3-5 septa, apical cell tapered, basal cell poorly developed. Sporodochia: orange. Microconidia: ovoid or club-shaped, 0-1 septa, abundant on the aerial mycelia. Chlamydospores : absent A, B; colony of F. fujikuroi, C; macroconidia, D; microconidia,Tae Jin An et al.,2013, G. Hagedorn, M. Burhenne & H. I. Nirenberg 45. Fusarium gerlachii T. Aoki, Starkey, L.R. Gale, Kistler & O'Donnell (2007); Fusarium gerlachii is morphologically similar to F. graminearum including colony characters on PDA, but has slightly different conidial features from it and other species within the F. graminearum clade. Macroconidia 5-septate, gradually curved and often widest at the midregion, and frequently with a narrow beak at the apex 173 46. Fusarium globosum Rheeder, Marasas & P.E. Nelson, Mycologia 88: 509 (1996) Macroconidia: abundant in sporodochia, slender-slightly curved, thinwalled, 3-5 septa, apical cell slightly curved, basal cell foot-shaped. Sporodochia: orange. Microconidia: oval-clavate in chains, globose more common single or in small clumps. Chlamydospores : absent. F. globosum, www.nias.affrc.go.jp 47. Fusarium graminearum Schwabe, Flora Anhaltina 2: 285 (1839) Macroconidia: abundant in sporodochia, slender-slightly curved, thickwalled, 5-6 septa, apical cell tapering, basal cell foot-shaped. Sporodochia: pale orange. Microconidia: absent . Chlamydospores : are formed in the macroconidia, finely roughened, single, in chains or clumps 174 48. Fusarium guttiforme Nirenberg & O’Donnell, Mycologia 90: 446 (1998) Colonies on PDA showing average mycelial growth rate; colony margin entire. Aerial mycelium almost white. later sometimes tinged greyishviolet by the substrate; short, lanose. Pigmentation in reverse greyishorange to dark-violet. Sporulation starting early in the aerial mycelium, conidia aggregated in false heads; sporodochia not observed. Conidiophores of the aerial mycelium erect or prostrate, strongly branched, branches terminating mostly in 1 or 2 phialides. Phialides of the aerial mycelium cylindrical, monophialidic but mostly polyphialidic. Micronidia borne in the aerial mycelium obovoid, mostly o-septate, occasionally l-septate. Chlamydospores absent. 175 John F. Leslie and Brett A. Summerell 49. Fusarium haematococcum Nalim, Samuels & Geiser, Mycologia 103 (6): 1322 (2011) Colonies produce abundant white, slimy sporodochia on the surface of the agar, scant erect, mononematous, acremonium-like conidiophores from the agar surface and the aerial mycelium. Mononematous conidiophores unbranched, monophialidic, tip of phialide with periclinal thickening, collarette not flared. Sporodochial conidiophores typically repeatedly branched, ultimate branches terminating in one or two phialides; phialides typically somewhat swollen toward the middle. Macroonidia uniformly arcuate, apical cell often beaked; basal cell pedicellate, 5-7septate. Perithecia subglobose, orange-red with lighter warts, basally immersed, grossly warted, becoming cupulate or laterally pinched when dry, gregarious. Asci clavate,, apex broad, simple, ascospores biseriate with overlapping ends. Ascospores ellipsoidal to subfusiform. 176 ( Nalim, Samuels & Geiser, Mycologia 103 (6): 1322 (2011) 50. Fusarium heterosporum Nees, Nova Acta Acad. Caes. Leop.-Carol. German. Nat. Cur.: 135 (1817) Fusisporium lolii Wm.G. Sm., Diseases of field and garden crops, chiefly as are caused by fungi: 213 (1884)) Macroconidia: abundant, 3-5 septa, thin-walled, slender to straight . Apical cell tapering, basal cell foot-shaped. Sporodochia: abundant, bright orange. Microconidia: absent. Chlamydospres: absent 177 Jandial and Sumbali, 2012 G. Hagedorn, M. Burhenne & H. I. Nirenberg 51. Fusarium hostae Geiser & Juba, Mycologia 93: 672 (2001) Colonies form limited aerial mycelium/ Macroconidia: rare, 2-4 septa, fulcate to fusiform . Apical cell curved or hooked, basal cell footshaped. Sporodochia: abundant, purple-yellow-pink. Microconidia: abundant, on aerial mycelia, fusiform, 0-2 septa. Chlamydospres: abundant in 4-6 weeks, single, in chains or clumps, interstitial or terminal. 178 John F. Leslie and Brett A. Summerell 52. Fusarium incarnatum (Roberge) Sacc., Sylloge Fungorum 4: 712 (1886) ≡Fusisporium incarnatum Roberge ex Desm., Ann Sci Natur Bot 11: 274 (1849) =Fusarium semitectum Berk. & Ravenel, Grevillea 3 (27): 98 (1875) [MB#179598] =Fusarium semitectum var. semitectum (1875) =Fusisporium pallidoroseum Cooke, Grevillea 6 (40): 139 (1878) =Fusarium semitectum var. majus Wollenw., Fusaria Autographice Delineata 3: 907-910 (1931) Colonies produce floccose aerial mycelium, at first whitish, later becoming avellaneous to buff-brown; reverse pale, becoming peachcoloured. Conidiophores scattered in the aerial mycelium, loosely branched; polyblastic conidiogenous cells abundant. Sporodochial macroconidia slightly curved, with foot-cell, 3-7-septate. Conidia on aerial conidiophores (blastoconidia) usually borne singly on scattered denticles, fusiform to falcate, mostly 3-5-septate. Microconidia sparse or absent. Chlamydospores sparse, spherical, intercalary, single or in chains 179 Fusarium incarnatum www.ppis.moag.gov.il 53. Fusarium inflexum R. Schneid., Phytopathologische Zeitschrift 82 (1): 80 (1975) Fusarium inflexum colony 180 G. Hagedorn, M. Burhenne & H. I. Nirenberg 181 54. Fusarium kelerajum Samuels, Nalim & Geiser, Mycologia 103 (6): 1326 (2011) Colonies produce scanty aerial mycelium; conidia arise from scattered mononematous acremonium-like conidiophores and from white to pale orange, slimy sporodochia on the agar surface. Sporodochial conidiophores richly branched, sometimes slightly stipitate; sporodochial phialides cylindrical or slightly swollen in the middle. Macroconidia slightly curved, tip acuminate and somewhat strongly beaked, with a well developed foot cell, 3-9-septate. 182 55. Fusarium keratoplasticum D. Geiser, O’Donnell, Short et Zhang, Fungal Genetics and Biology 53 (2013) 59–70 = Cephalosporium keratoplasticum T. Morik., Mycopathologia 2(1): 66 (1939), nom. nud. (Invalid.) =Hyalopus keratoplasticum (T. Morik.) M.A.J. Barbosa, Notarisia: 19 (1941) Colonies produce white, salmon, peach, vinaceous grey and pale olivaceous grey mycelium; reverse pigmentation in shades of pale olivaceous grey, flesh, salmon, olivaceous buff, ochreous and pale luteous. Macroconidia generally 3–5 septate, usually cylindrical and gently curved, sometimes falcate, with dorsal and ventral lines nearly parallel or gradually wider basally, with an acuate apical cell and a distinct basal foot cell.Aerial conidiophores formed abundantly, branched or unbranched; monophialides. Microconidiaconidia hyaline, oval, fusiform, pyriform, napiform or cylindrical, 0–3 septate. Chlamydospores formed frequently, after several weeks, in hyphae and in conidia, mostly subglobose, often intercalary, single, frequently in pairs, hyaline, pale to yellowish grey, smooth to rough-walled. 183 56. Fusarium konzum Zeller, Summerell & J.F. Leslie, Mycologia 95 (5): 947 (2003) Colonies on PDA produce abundant floccose mycelium that are initially white and become violet. Sporodochia are rare; sporodochia from leaf pieces on CLA are pale orange. Macroconidia are not common. Typically macroconidia are hyaline, 3–5 septate, falcate, with a pedicellate foot cell and a slightly curved apical cell. Microconidia are produced on monophialides and polyphialides produced laterally in the aerial hyphae . Microconidia are produced either singly or in small false heads consisting of 2–4 microconidia per phialide. Three types of microconidia are produced: oval, hyaline 0–1 septate microconidia, pyriform, 0-1 septate and larger napiform to globose, 0-septate microconidia. Chlamydospores absent. Zeller, Summerell & J.F. Leslie, Mycologia 95 (5): 947 (2003) 57. Fusarium kurunegalense Samuels, Nalim & Geiser, Mycologia 103 (6): 1323 (2011) Colonies produce scanty aerial mycelium scant; conidia arising from mononematous conidiophores scattered throughout the colony and in white slime on the agar surface. Mononematous conidiophores acremonium-like, septate, terminating in a single phialide; tip of 184 phialides with periclinal thickening, not flared; sometimes proliferating to form a second phialide. Macroconidia slightly curved or arcuate, tip more sharply hooked; basal cell typically wedge-shaped, weakly pedicelate, 4-10-septate Fusarium kurunegalense Samuels, Nalim & Geiser (2011) 58. Fusarium lactis Pirotta & Riboni, Arch. Lab. Bot. crittog. Pavia: 316 (1879 ) ≡Fusarium moniliforme var. lactis (Pirotta & Riboni) Bilai, Mykrobiologichnyi Zhurnal Kiev 49 (6): 7 (1987) Macroconidia: rare, 2-4 septa, thin-walled, slender and straight to slightly curved . Apical cell bent, basal cell notched. Sporodochia: rare, 185 light orange. Microconidia: abundant in the aerial mycelia, obvoid, 01septa, short to medium lenthg zigzag chains. Chlamydospres: absent Leslie and Summerell , Hagedorn, Burhenne & Nirenberg 59. Fusarium langsethiae Torp & Nirenberg, Int. J.Food Microbiol. 95 (3): 248 (2004) Fusarium langsethiae was initially referred to as ‘powdery F. poae’ due to its abundant production of small napiform to globose conidia, giving the colony a powdery-like appearance. It has spore morphology similar to F. poae. Fusarium langsethiae differs from F. poae by its slower growth, production of fewer aerial mycelia and lack of peach-like odour on synthetic media.The fungal colonies colour on synthetic solid media 186 range from whitish, yellowish white, pinkish white, pale red and/or pastel red. Some of the strains can produce a pigment called aurofusarin, which is produced by nearly all strains of F. poae and F. sporotrichioides and influences colony colour development. www.aya-plus.ru www.terre-net.fr www.bioforsk.no Imathiu et al., 2013 60. Fusarium lateritium Nees, System der Pilze und Schwämme: 31, t. 2:26 (1817) Selenosporium lateritium (Nees) Desm., Flore Cryptogamique des Flandres 2: 99 (1867) Macroconidia: rare, 2-4 septa, thin-walled, long,falcate to straight to slightly curved with parallel walls . Apical cell hooked, basal cell footshaped or notched. Sporodochia: abundant, pale orange. Microconidia: abundant in the aerial mycelia, elliptical, oval, spindle or club-shaped. Chlamydospres: may be present 187 O. A. Awoyinka et al., 2012, Hagedorn, Burhenne & Nirenberg 61. Fusarium lichenicola C. Massal., Ann. Mycol. 1 (3): 223 (1903) ≡Bactridium lichenicola (C. Massal.) Wollenw., Fusaria Autographice Delineata 1: no. 456 (1916) ≡Bactridium lichenicolum (C. Massal.) Wollenw. (1916) ≡Cylindrocarpon lichenicola (C. Massal.) D. Hawksw., Bull. Brit. Museum Natural History 6 (3): 273 (1979) =Cylindrocarpon tonkinense Bugnic., Encyclopédie Mycologique 11: 181 (1939) [MB#255134] =Euricoa dominguesii Bat. & H. Maia, Anais da Soc.Biol.de Pernambuco 13 (1): 152 (1955) =Euricoa dominguiesii Bat. & H. Maia (1955) =Mastigosporium heterosporum R.H. Petersen, Mycologia 51: 729 (1959) =Moeszia pernambucensis Bat., S.K. Shome & Maciel, Public. Instit. Micolo. Univ. Recife 445: 6 (1965) 188 Colonies produce white, floccose to felted aerial mycelium, becoming pale brown with age, and making the agar beige to dark brown with age. Conidia produced from simple, subulate conidiogenous cells on sparsely branched conidiophores. Conidiogenous cells with periclinal thickening and sometimes a distinct collarette at their apices. Macroconidia, 3-7septate, ellipsoid or obovate to cylindrical, each with a bluntly rounded apex and distinct basal pedicel. 'Chlamydospores' abundant, thick-walled, globose, pale brown, smooth or spinulose, Mycobank 62. Fusarium longipes Wollenw. & Reinking, Phytopathol 15 (3): 160 (1925) ≡Fusarium scirpi var. longipes (Wollenw. & Reinking) Wollenw., Fusaria Autographice Delineata 3: 937 (1930) [MB#277671] ≡Fusarium equiseti var. longipes (Wollenw. & Reinking) Joffe, Mycopathologia et Mycologia Applicata 52 (1-4): 221 (1974) Macroconidia: rare, 5-7 septa, thin-walled, extremely long, pronounced curvure . Apical cell long and whip-like and tapering, basal cell elongated foot-shaped. Sporodochia: large, bright orange. Microconidia: absent. Chlamydospres: in chains or clusters 189 . Leslie and Summerell , Hagedorn, Burhenne &. Nirenberg 63. Fusarium louisianense Gale, Kistler, O’Donnell & T. Aoki, Fungal Genetics & Biology 48: 1105 (2011) Colonies produce abundant, dense floccose to pannose, white, reddishwhite, pale red to grayish red aerial mycelium on agar. Sporulation abundant, from conidiophores formed directly on hyphae or aggregated in sporodochia on or in the agar; sporodochia formed abundantly. Conidiophores branched verticillately or unbranched, terminating with monophialides, Phialides simple, subulate, ampulliform to subcylindric, 190 monophialidic. Conidia of a single type, typically falcate and gradually curved, sometimes sigmoid or straight, dorsiventral, most frequently widest at the midregion of their length, tapering and curving toward both ends, with an arcuate apical cell and a distinct basal foot cell, upper and lower halves asymmetric, 3-7-septate. Chlamydospores absent Sarver et al., 2011 64. Fusarium lunatum (Ellis & Everh.) von Arx, Verh Konink Akad Vetensch Amsterdam 51:101. 1957 ≡Gloeosporium lunatum Ellis & Everh., Proc. Acad. Nat. Sci. Philadel 43: 82 (1891) [ ≡Microdochium lunatum (Ellis & Everh.) Arx, Trans Brit Mycol So 83 (2): 374 (1984) ≡Bisifusarium lunatum (Ellis & Everhart) L. Lombard & Crous, Stud Mycol 80: 225 (2015) =Fusarium dimerum var. violaceum Wollenw., Fusaria Autographice Delineata 3: 854 (1930) Colonies produce sparse white aerial mycelium on agar, colony reverse brownish yellow, brownish orange or vinaceous, dark violet or dark carmine. Sporulation sparse; monophialides formed terminally or laterally on hyphae, in well developed sporodochia, forming fewmembered whorls on short supporting cells; polyphialides not seen. Microconidia mostly curved, allantoid to lunate, or less frequently 191 almost straight and ellipsoidal; curved microconidia either almost uniformly rounded at both ends or with a minutely beaked and a slightly pointed distal and proximal end, mostly 0- 2-septate. Macroconidia 03-septate. Chlamydospores globose to subglobose,, partly branched chains or aggregated in irregular clusters Fusarium lunatum, Schroers, Summerb. & O'Donnell, Mycologia 101 (1): 61 (2009) 65. Fusarium mahasenii Samuels, Nalim & Geiser, Mycologia 103 (6): 1325 (2011) Colonies produce scanty aerial mycelium; conidia arise from mononematous conidiophores arising from the agar surface and sparsely from the aerial mycelium and from yellowish slimy sporodochia on the surface of the agar. Mononematous conidiophores acremonium-like, wide at base, tapering uniformly from base to tip; a single phialide comprising the terminal, tip with periclinal thickening, collarette not flared; sporodochial conidiophores richly branched, sometimes stipitate; sporodochial phialides cylindrical or slightly 192 swollen in the middle. Macroconidia straight to slightly curved, with a well developed foot cell, 4-6-septate Fusarium mahasenii Samuels, Nalim & Geiser (2011); 66. Fusarium mangiferae Britz, M.J. Wingf. & Marasas, Mycologia 94 (4): 725 (2002) Colonies forms white aerial mycelium, floccose. Reverse of colonies sometimes rosy buff to dark purple. Conidiophores on aerial mycelium originating erect and prostrate from substrate. Conidiophores sympodially branched bearing mono- and polyphialides. Polyphialides have 2–5 conidiogenous openings. Microconidia variable in shape, obovoid conidia the most abundant type, oval to allantoid conidia occurring occasionally . Microconidia mostly 0-1 septate , conidia occurring less abundantly . Sporodochia present, cream and orange. Macroconidia long and slender, usually 3–5 septate . Chlamydospores absent. 193 Britz et al., 2002.Fusarium mangiferae. 1. Branched conidiophores bearing polyphialides with 3 conidiogenous openings (scale bar: 5 μm). 2. Branched conidiophores bearing mono- and polyphialides (scale bar: 5 μm). 3. Microconidia (scale bar: 15 μm). 4. Macrocondium (scale bars: 15 μm) 67. Fusarium merismoides Corda, Icones fungorum hucusque cognitorum 2: 4, t. 8:16 (1838) =Fusicolla merismoides (Corda) Gräfenhan, Seifert & Schroers, Studies in Mycology 68: 101 (2011) 194 Leslie and Summerell , G. Hagedorn, M. Burhenne & H. I. Nirenberg 68. Fusarium miscanthi W. Gams, Klamer & O’Donnell, Mycologia 91: 264 (1999) Macroconidia: abundant in sporodochia, 3-5 septa, thin-walled, straight to falcate, apical cell curved and tapering, basal cell foot-shaped. Sporodochia: pale orange after 3 weeks. Microconidia:pyriform and clavate, 0-septa, long chains. Chlamydospores: absent 195 John F. Leslie and Brett A. Summerell 69. Fusarium musae Van Hove, Waalwijk, Munaut, Logrieco & Moretti, Mycologia 103 (3): 579 (2011) Colonies produce white to vinaceous aerial mycelium. Colonies from above and below reddish. Pseudochlamydospores single and globose, at the ends of hyphae, conidiophores unbranched or branched, bearing monophialidic conidiogenous cells. Microconidia abundant, borne in chains or false heads, hyaline, claviform or ellipsoidal, often truncated, aseptate or rarely one-septate. Sporodochia absent. Macroconidia absent. Fusarium musae , Van Hove, Waalwijk, Munaut, Logrieco & Moretti, Mycologia 103 (3): 579 (2011) 196 70. Fusarium musarum Logrieco & Marasas, Mycologia 90: 510 (1998) Macroconidia: absent. Sporodochia: absent. Microconidia/Mesoconidia: abundant, 2-9 septa, falcate and thick-walled with a pointed apical cell and a conical basal cell. Microconidia: pyriform and clavate, 0-septa, long chains. Chlamydospores: produced slowly and sparsely, smooth, globose, single, in clusters or in chains John F. Leslie and Brett A. Summerell 71. Fusarium napiforme Marasas, P.E. Nelson & Rabie, Mycologia 79 (6): 910 (1987) Macroconidia: abundant in sporodochia, 3-5 septa, moderately long, falcate, apical cell curved and tapering, basal cell foot-shaped. Sporodochia: bright orange. Microconidia:lemon-shaped and napiform, 0-1 septa, long chains. Chlamydospores: produced slowly 197 John F. Leslie and Brett A. Summerell , Mycobank 72. Fusarium nelsonii Marasas & Logrieco, Mycologia 90: 508 (1998) Macroconidia: abundant in sporodochia, 3-5 septa, straight or curved and falcate, apical cell curved and beak-shaped, basal cell foot-shaped. Sporodochia: pale cream. Microconidia: abundant, fusiform or straigt to slightly curved, 0-3septa. Chlamydospores: abundant, produced rapidly John F. Leslie and Brett A. Summerell 198 73. Fusarium nepalense T. Aoki, Carter, Nicholson, Kistler & O’Donnell, Fungal Genetics & Biology 48: 1105 Colonies abundant, sometimes sparsely developed, loosely to dense floccose, white, reddish-white, pale red to grayish red, grayish-orange aerial mycelium. Colony margin entire to undulate, often forming colony sectors of different growth rates. Sporodochia formed abundantly or sparsely. Conidiophores branched or unbranched, terminating with monophialides on the apices. Phialides simple, subulate, ampulliform to subcylindric, monophialidic. Conidia of a single type, typically falcate and curved, dorsiventral, most frequently widest slightly above the midregion of their length, tapering and gradually curving toward both ends, with an arcuate and beaked apical cell and a distinct basal foot cell, upper and lower halves asymmetric, 37-septate. Chlamydospores absent. Sarver BA1, Ward TJ, Gale LR, Broz K, Kistler HC, Aoki T, Nicholson P, Carter J, O'Donnell K Fungal Genet Biol. 199 74. Fusarium nisikadoi T. Aoki & Nirenberg, Mycoscience 38 (3): 330 (1997) Macroconidia: abundant in sporodochia, 1-9 septa, long, straight and falcate, apical cell curved and beak-shaped, basal cell foot-shaped. Sporodochia: rare, orange. Microconidia: abundant,occasionaly pyriform 0-3septa , commonly clavate, long chain, often zigzag.Chlamydospores: absent 75. Fusarium nurragi (Summerell & L.W. Burgess) Benyon, Summerell & L.W. Burgess, Mycological Research 104 (10): 1171 (2000) Macroconidia: abundant in sporodochia, 5- septa, long, thin and whiplike, straight and falcate, apical cell long and tapering, basal cell elongate foot-shaped. Sporodochia: orange. Microconidia: absent. Chlamydospores: absent 200 76. Fusarium nygamai L.W. Burgess & Trimboli, Mycologia 78: 223 (1986) Macroconidia: abundant in sporodochia, 5-septa, moderately long, straight to slightly curved, apical cell short and tapering, basal cell notched or foot-shaped. Sporodochia: abundant, orange. Microconidia: small, oval or club-shaped, 0-1 septa. Chlamydospores: rare to abundant Mycobank 77. Fusarium oxysporum Schltdl., Flora Berolinensis, Pars secunda: Cryptogamia: 106 (1824) =Fusarium bulbigenum Cooke & Massee, Grevillea 16 (78): 49 (1887) =Fusarium orthoceras Appel & Wollenw., aus der Kaiserlichen Biologischen Anstalt für Land- und Forstwirtschaft 8: 152 (1910) =Fusarium citrinum Wollenw., Bull. Maine Agric. Exp. Sta.: 256 (1913) =Fusarium angustum Sherb., Memoirs of the Cornell University Agricultural Experimental Station 6: 203 (1915) =Fusarium oxysporum var. longius Sherb., Memoirs of the Cornell University 201 Agricultural Experimental Station 6: 223 (1915) =Fusarium lutulatum Sherb., Memoirs of the Cornell University Agricultural Experimental Station 6: 209 (1915) =Fusarium lutulatum var. zonatum Sherb., Memoirs of the Cornell University Agricultural Experimental Station 6: 214 (1915) =Fusarium bostrycoides Wollenw. & Reinking, Phytopathology 15 (3): 166 (1925) =Diplosporium vaginae Nann., Atti Reale Accad. Fisiocrit. Siena: 491 (1926) Macroconidia: abundant in sporodochia, 3- septa, thin-walled, short to moderately long, straight , apical cell short and slightly hooked, basal cell notched or foot-shaped. Sporodochia: abundant, pale orange . Microconidia: small, oval , elliptical or kidney-shaped, 0- septa. Chlamydospores: abundant 202 Mycobank G. Hagedorn, M. Burhenne & H. I. Nirenberg 78. Fusarium phyllophilum Nirenberg & O’Donnell, Mycologia 90: 447 (1998) Colonies produce white aerial mycelium, later tinged greyish-violet; lanose to funiculose. Pigmentation in reverse in some isolates greyishwhite or greyish-orange to greyish-violet, or greyish-violet to bluishgrey. Sclerotia absent. Conidiophores of the aerial mycelium prostrate and erect, unbranched, with one lateral branch or verticillately branched, terminating mostly in 1 to 3 phialides, cells beneath the phialides often swollen; sporodochial conidiophores absent. Phialides of the aerial mycelium cylindrical, mono- and polyphialidic. Microconidia borne in the aerial mycelium clavate, mostly O-septate. occasionally 12-septate. Macroconidia few thin. falcate up to 5-septate. Chlamydospores absent. 203 John F. Leslie and Brett A. Summerell 79. Fusarium penzigii Schroers, Summerb. & O'Donnell, Mycologia 101 (1): 61 (2009) Aerial mycelium sparse, white, felt-like to cottony. Monophialides formed terminally or laterally on hyphae, in well developed sporodochia, forming few whorls on short supporting cells, polyphialides sometimes observed in several week old, well developed sporodochia. Microconidia mostly 0-1-septate, typically ellipsoidal, straight or curved, allantoid. Macroconidia typically widest in the upper third or the middle, with central part minutely curved or nearly straight, a pointed and mostly beaked distal end and a slightly pedicellate and curved proximal end; 0-3-septate. Chlamydospores common, typically intercalary, solitary, in short chains or terminal, rarely in groups. 204 80. Fusarium petroliphilum: (Q.T. Chen & X.H. Fu) D. Geiser, O’Donnell, Short et Zhang, Microconidia formed directly on the side of hyphae in the pionnotal mycelium, 0-septate, oval, ellipsoid, and reniform, long conidiophores and macroconidia typical for members of the FSSC 81. Fusarium pininemorale Herron, Herron, Marinc. & M.J. Wingf., Studies in Mycology 2015 No. 80 pp. 131-150. . Macroconidia abundant, elongate, straight, with 3–4 septa, apical cells tapering, curved, basal cells foot-shaped, elongated foot shape, barely to 205 distinctly notched. Microconidia scarce, fusiform to obovoid, 0–1 septa, arranged in false heads. Conidiogenous cells monophialidic or polyphialidic, . 82. Fusarium poae (Peck) Wollenw., Bull. Maine Agric. Exp. Sta.: 254 (1914) ≡Sporotrichum poae Peck, Bulletin of the New York State Museum 67: 29 (1903) [MB#206241] ≡Fusarium tricinctum f. poae (Peck) W.C. Snyder & H.N. Hansen, American Journal of Botany 32: 663 (1945) [MB#351715] ≡Fusarium sporotrichiella var. poae (Peck) Bilai, [Poisonous fungi on cereal seed]: 86 (1953) [MB#448746] ≡Fusarium sporotrichiella var. poae (Peck) Bilai, Mykrobiologichnyi Zhurnal Kiev 49 (6): 6 (1987) [MB#353477] =Sporotrichum anthophilum Peck, Bulletin of the New York State Museum 105: 28 (1906) Macroconidia: sparse, 3- 5 septa, slender and short, fulcate to lunate, apical cell curved and tapering, basal cell foot cell well developed. Sporodochia: absent. Microconidia: abundant, globose to napiform, 0-1 septa . Chlamydospores: rare, in clumps or chains in mycelium of old cultures 206 G. Hagedorn, M. Burhenne & H. I. Nirenberg 83. Fusarium polyphialidicum Marasas, P.E. Nelson, Toussoun & P.S. van Wyk, Mycologia 78 (4): 678 (1986) Macroconidia: abundant, large, 3-7 septa, slightly falcate, thick-walled, apical cell curved and tapering, basal cell foot-shaped. Sporodochia: white to pale orange. Microconidia: abundant in the aerial mycelia, fusiform or subclavate, 0-3 septa. Chlamydospores: in pairs, clumps or chains 207 84. Fusarium proliferatum (Matsush.) Nirenberg, Biologischen Bundesanstalt für Land- und Forstwirtschaft 169: 38 (1976) ≡Cephalosporium proliferatum Matsush., Microfungi of the Solomon Islands and Papua-New Guinea: 11 (1971) ≡Fusarium proliferatum (Matsush.) Nirenberg ex Gerlach & Nirenberg, Mitteilungen der Biologischen Bundesanstalt für Land- und Forstwirtschaft 209: 309 (1982) Macroconidia: in chains of moderate length, thin-walled, straight, 3-5 septa, apical cell curved, basal cell poorly developed,. Sporodochia: pale orange. Microconidia, club-shaped to pyriform, 0-septa, may be in chains. Chlamydospores: absent 208 www.ppis.moag.gov.il www.ppis.moag.gov. jcm.asm.org G. Hagedorn, M. Burhenne & H. I. Nirenberg, Ferrer et al., 2005 85.Fusarium pseudensiforme Samuels, Nalim & Geiser, Mycologia 103 (6): 1323 (2011) Colonies produce scanty aerial mycelium; conidiophores arising abundantly in the aerial mycelium and in white slimy sporodochia on the agar surface. Phialides arise from conidiomata, cylindrical or somewhat swollen in the middle. Macroconidia arise from sporodochia, 0-8-septate, typically slightly curved with a well developed foot cell. 209 Fusarium pseudensiforme Samuels, Nalim & Geiser (2011); 86. Fusarium pseudocircinatum Nirenberg & O'Donnell, Mycologia 90: 448 (1998) Macroconidia: abundant, slender, slightly falcate, thin-walled, apical cell beaked, basal cell foot-shaped Sporodochia: sparseMicroconidia: abundant, oval, 0-1 septa John F. Leslie and Brett A. Summerell 87. Fusarium pseudograminearum O'Donnell & T. Aoki, Mycologia 91 (4): 604 (1999) Macroconidia: slender, almost straight to moderately curved, 1-11 septa, apical cell curved, basal cell foot-shaped. Sporodochia: abundant, pale orange. Microconidia: absent. Chlamydospores: abundant within 4 weeks 210 Colony morphology (a) and macroconidia of Fusarium pseudograminearum, Saremi et al., 2007 John F. Leslie and Brett A. Summerell 88. Fusarium pseudonygamai Nirenberg & O'Donnell, Mycologia 90: 449 (1998) Macroconidia: rare, 3-4 septa, fusoid, apical cell gapering, basal cell poorly foot-shaped. Sporodochia: rare. Microconidia: abundant in the aerial mycelia, obvoid to clavate, 0-septa. Chlamydospores: absent 211 John F. Leslie and Brett A. Summerell 89. Fusarium ramigenum Nirenberg & O'Donnell, Mycologia 90: 451 (1998) Macroconidia: rare, 5- septa, falcate, apical cell bent, basal cell notched. Sporodochia: rare. Microconidia: abundant in the aerial mycelia, obvoid, 0-1 septa. Chlamydospores: absent John F. Leslie and Brett A. Summerell 90. Fusarium rectiphorum Samuels, Nalim & Geiser, Mycologia 103 (6): 1324 (2011) =Fusarium rectiphorus Samuels, Nalim & Geiser, Mycologia 103 (6): 1324 (2011) Colonies produce scanty aerial mycelium; conidia produced by erect, mononematous conidiophores arising from the surface of the colony 212 and sparingly in the aerial mycelium and from cream-coloured sporodochia on the surface of the agar. Mononematous conidiophores unbranched and acremonium-like or branched, or branched once or twice and each branch terminating in two or three phialides, or phialides arising directly from the lower half of the acremonium-like conidiophore. Macroconidia slightly curved, more strongly at tip, basal cell pedicellate, 3-8-septate Samuels et al., 2011 213 91. Fusarium redolens Wollenw., Phytopathology 3 (1): 29 (1913) ≡Fusarium oxysporum var. redolens (Wollenw.) W.L. Gordon, Canadian Journal of Botany 30 (2): 238 (1952) Macroconidia: abundant, 3-5 septa, thick-walled, upper third wide, apical cell hooked, basal cell foot-shaped. Sporodochia: sparse, pale brown. Microconidia: common in the aerial mycelia, oval to cylidrical, 0-1 septa. Chlamydospores: absent John F. Leslie and Brett A. Summerell ,Truman Univ. Feng Pan,et al.,2015 G. Hagedorn, M. Burhenne & H. I. Nirenberg 92. Fusarium sacchari (E.J. Butler) W. Gams, Cephalosporium-artige Schimmelpilze: 218 (1971) Macroconidia:sparse, 3- septa, thick-walled, slender, apical cell curved, basal cell poorly developed. Sporodochia: sparse, orange. Microconidia: 214 abundant, common in the aerial mycelia, oval, 0- 2 septa. Chlamydospores: absent Leslie JF, Summerell BA, Bullock S, Doe FJ,Mycologia, 2—5, G. Hagedorn, M. Burhenne & H. I. Nirenberg 93. Fusarium sambucinum Fuckel, Hedwigia 2 (15): 135, Fung. Rhen. no 211 (1863) =Fusarium roseum Link, Magazin der Gesellschaft Naturforschenden Freunde Berlin 3: 10, t. 1:10 (1809) =Fusarium sulphureum Schltdl., Flora Berolinensis, Pars secunda: Cryptogamia: 139 (1824) =Fusarium sambucinum var. sambucinum , Jahrbücher des Nassauischen Vereins für Naturkunde 23-24: 167 (1870) [ =Fusarium trichothecioides Wollenw., Journal of the Washington Academy of Sciences 2: 147 (1912) =Fusarium sambucinum var. minus Wollenw., Fusaria Autographice Delineata 3: 941 215 (1930) =Fusarium sambucinum f. 2 Wollenw., Fusaria Autographice Delineata 3: 942 (1930) =Fusarium sambucinum var. medium Wollenw., Zeitschrift für Parasitenkunde 3: 358 (1931) =Fusarium sambucinum f. 6 Wollenw., Zeitschrift für Parasitenkunde 3: 358 (1931) Macroconidia: abundant in sporodochia, 3-5 septa, falcate, slender, short, apical cell pointed, basal cell foot-shaped. Sporodochia: orange, common. Microconidia: oval, 0-1 septa. Chlamydospores: in chains or clusters ddis.ifas.ufl.edu G. Hagedorn, M. Burhenne & H. I. Nirenberg 94. Fusarium scirpi Lambotte & Fautrey, Revue Mycol. (Toulouse): 111 (1894) Macroconidia: abundant, long. slender, thin-walled, curved, 6-7 septa, apical cell tapering and elongate, basal cell foot-shaped. Sporodochia: 216 orange. Microconidia: club-shaped on short phialides. Chlamydospores: abundant, in clumps or chains John F. Leslie and Brett A. Summerell 95. Fusarium semitectum Berk. & Ravenel, Grevillea 3 (27): 98 (1875) ≡Pseudofusarium semitectum (Berk. & Ravenel) Matsush., Icones Microfungorum a Matsushima lectorum: 119 (1975) =Fusisporium incarnatum Roberge ex Desm., Annales des Sciences Naturelles Botanique 11: 274 (1849) =Fusarium semitectum var. semitectum (1875) =Fusisporium pallidoroseum Cooke, Grevillea 6 (40): 139 (1878) =Fusarium semitectum var. majus Wollenw., Fusaria Autographice Delineata 3: 907-910 (193] Macroconidia: abundant, slender, curved dorsal surface, 3-5 septa, apical cell curved and tapering , basal cell foot-shaped. Sporodochia: orange. Microconidia: pyriform, 1-septa, mesoconidia spindle-shaped, 3-5 septa. Chlamydospores: globose 217 file.scirp.org, ecoport.org, Galería de imágenes, EcoPort Picture, Databank 96. Fusarium sibiricum Gagkaeva, Burkin, Kononenko, Gavrilova, O'Donnell, T. Aoki, et Yli-Mattila, International Journal of Food Microbiology 147: 64 (2011) Colonies produce sparse to floccose aerial mycelium on PSA, more abundant centrally, often crateriform with bald spot in the very centre of colonies. Colour of aerial mycelium white, sometimes with a tint of orange grey. Reverse with white to cream shades. Conidiophores formed in aerial mycelium or on running hyphae on the agar, erect or prostrate, at first unbranched, later branched densely terminating with ampuliform monophialides, having a noticeable collarette and rarely with cylindrical, straight monophialides. Conidiophores often consist of a long and nodose stipe terminating with a whorl of phialides, intermingled with the short monophialides formed directly on the aerial mycelium. Polyphialides not observed. Microconidia apiculate and globose, mostly one-celled, hyaline, formed abundantly in false heads; 218 0-septate. Multiseptate macroconidia. sporodochia. chlamydospores and sclerotial bodies absent. Mattila et al., 2011 97. Fusarium sinensis Z.H. Zhao & G.Z. Lu, Mycologia 100 (5): 747 (2008) Colonies are villous-floccose, yellow brown in the center and rose-tocarmine often with a white margin. Colony reverse red brown. Conidiophores single or simply branched on the aerial mycelium and monophialidic. Two types of microconidia are formed: fusiform-toreniform and napiform-to-pyriform,1-2-septate, formed on monophialides. Macroconidia rare, straight or slightly curved; 3-septate, 219 apical cells slightly curved and narrowing to a point; basal cells footshaped to distinctly notched. Chlamydospores found in chains or clumps, oval to globose, hyaline to pale brown, smooth to warted. Zhao and Lu, 2008 98. Fusarium solani (Mart.) Sacc., Michelia 2 (7): 296 (1881) ≡Fusisporium solani Mart., Die Kartoffel-Epidemie der letzten Jahre oder die Stockfäule und Räude der Kartoffeln: 20 (1842) ≡Fusarium solani (Mart.) Appel & Wollenw., Kaiserlichen Biologischen Anstalt für Land- und Forstwirtschaft 8: 64-78 (1910) ≡Neocosmospora solani (Martius) L. Lombard & Crous, Studies in Mycology 80: 228 (2015) =Fusarium martii Appel & Wollenw., Arbeiten aus der Kaiserlichen Biologischen Anstalt für Land- und Forstwirtschaft 8: 83 (1910) =Nectria cancri Rutgers, Ann. Jard. Bot. Buitenzorg, II: 59 (1913) 220 =Fusarium striatum Sherb., Memoirs of the Cornell University Agricultural Experimental Station 6: 255 (1915) =Fusarium solani var. minus Wollenw., Fusaria Autographice Delineata 1: 403 (1916) =Fusarium solani f. 2 W.C. Snyder, Zentralblatt für Bakteriologie und Parasitenkunde Abteilung 2 91: 174 (1934) =Cephalosporium keratoplasticum T. Morik., Mycopath. Mycol. appl.: 66 (1939) =Fusarium solani f. keratitis Y.N. Ming & T.F. Yu, Acta Microbiologica Sinica 12: 184 (1966) =Cylindrocarpon vaginae C. Booth, Y.M. Clayton & Usherw., Proc. Indian Acad. Sciences (Plant Sciences) 94 (2-3): 436 (1985) Macroconidia: abundant, wide, straight or slightly curved , 3-7 septa, apical cell blunt and round, basal cell foot-shaped or cylindrical with notched end. Sporodochia: abundant, cream, blue or green. Microconidia: oval to fusiform, 0-2 sept. Chlamydospores: abundant, in 2-4 weeks, single, in pairs, in clumps or chains, terminal or intercalary www.mycology.adelaide.edu.au, www.pf.chiba-u.ac.jp, Mycoya, Mycobank, Br J Ophthalmol. 2002, Mycobank 221 99. Fusarium sororula Herron, Marinc. & M.J. Wingf., Studies in Mycology 2015 No. 80 pp. 131-150 Macroconidia scarce, elongate, straight, with 1–3 septa, apical cells hooked, basal cells foot-shaped, barely to distinctly notched, some producing secondary conidia. Microconidia abundant, fusiform to obovoid or pyriform, arranged in false heads, with 0–1 septum. Conidiogenous cells monophialidic or polyphialidic. 100. Fusarium sporotrichioides Sherb., Memoirs of the Cornell University Agricultural Experimental Station 6: 183 (1915) ≡Fusarium sporotrichiella var. sporotrichioides (Sherb.) Bilai, [Poisonous fungi on cereal seed]: 87 (1953) Colonies produce profuse white to pale red mycelium. Macroconidia abundant in orange sporodochia, falcate to lunate,3-5 septate, apical cell curved and tapering, basal cell poorly developed. Microconidia 222 produced from mono- or polyphialides, pyriform 0-1 septate or fusiform up to 5-septate. Chlamydospores abundant. www.drjacksonkungu.com www.flickr.com John F. Leslie and Brett A. Summerell www.marmaramedicaljournal.org G. Hagedorn, M. Burhenne & H. I. Nirenberg 101. Fusarium sterilihyphosum Britz, Marasas & M.J. Wingf., Mycologia 94 (4): 726 (2002) Colonies on PDA, aerial mycelium almost white, reverse straw to grayish rose and light purple. Conidiophores on aerial mycelium erect, occasionally prostrate. Conidiophores sympodially branched bearing mono- and polyphialides. Phialides on aerial conidiophores mono- and polyphialidic. Sterile hyphae present. Microconidia obovoid, oval to allantoid, 0-1 septate, abundant. Sporodochia rare, cream. Macroconidia slightly beaked apical cells, a footlike basal cell, 3–5 septate. Chlamydospores absent. 223 John F. Leslie and Brett A. Summerell, Britz et al., 2002 102. Fusarium subglutinans (Wollenw. & Reinking) P.E. Nelson, Toussoun & Marasas, Fusarium species, an illustrated manual for identification: 135 (1983) ≡Fusarium moniliforme var. subglutinans Wollenw. & Reinking, Phytopathol 15 (3): 163 (1925) ≡Gibberella fujikuroi var. subglutinans (Wollenw. & Reinking) E.T. Edwards, Agri. Gazette of New South Wales 44 (12): 896 (1933) ≡Fusarium neoceras var. subglutinans (Wollenw. & Reinking) Raillo, Fungi of the genus Fusarium: 263 (1950) ≡Fusarium sacchari var. subglutinans (Wollenw. & Reinking) Nirenberg, Mitteil. Biolog. Bund.. Land- un. Forstwirt. 169: 53 (1976) ≡Gibberella subglutinans (E.T. Edwards) P.E. Nelson, Toussoun & Marasas, Fusarium species, an illustrated manual for identification: 135 (1983) Colonies produce white mycelium, becomes violate in old cultures. Macroconidia sparse, in tan-orange sporodochia, slender, slighltly falcate, thin-walled, apical cell curves, basal cell poorly developed. 224 Microconidia in false heads from mon- and polyphialides, oval 0septate or fusiform 2-3 septate. Chlamydospores absent Nelson et al., 1983, Mycobank 103. Fusarium succisae (J. Schröt.) Sacc., Sylloge Fungorum 10: 724 (1892) ≡Fusisporium succisae J. Schröt., Hedwigia: 180 (1874) ≡Fusarium subglutinans var. succisae (J. Schröt.) F.J. Chen, Variation within Fusarium section Moniliforme (= Liseola) [Ph.D.Thesis]: 150 (1991) Colonies produce white mycelium, turne grey-violate and red, and bright orange sporodochia. Macroconidia sparse, falcate to u-shaped curved,3-septate, basal cell foot-shaped, apical cellcurved and tapering. Microconidia abundant,oval or ellipsoid, 0-2 septate, in false heads on mono- or polyphialides. Chlamydospores absent 225 G. Hagedorn, M. Burhenne & H. I. Nirenberg 226 104. Fusarium temperatum J. Scauflaire & F. Munaut, Mycologia 103 (3): 593 (2011) Colonies produce yellowish orange sporodochia. Agar pigmentation ranges from colorless to dark purple on OA; pigmentation of colony reverse is in shades of light pink. Aerial mycelium cottony, initially white, becoming pinkish white, turning violet in the colony center in a later stage. Conidiophores in the aerial mycelium erect, branched, terminating in 1-3 phialides. Microconidia oval, abundant, grouped in masses; hyaline and non-septate. Macroconidia hyaline, with 3-6, slender, slightly falcate, with a beaked, curved apical cell and a footlike basal cell, thin cell wall. Polyphialides and monophialides are present. Chlamydospores absent. Fusarium temperatum colonies. Al-Hatmi et al., 2014 Fusarium temperatum, Scauflaire et al., 2011 227 105. Fusarium thapsinum Klittich, J.F. Leslie, P.E. Nelson & Marasas, Mycologia 89: 644 (1997) Colonies produce white mycelium, violete pigments with age. Sporodochia rare, pale orange. Macroconidia rare, slender, falcate or straight, thin-walled, 3-5-septate, apical cell curved and tapering, foot cell poorly-shaped, Microconidia abundant, on monophiliedes, clubshaped, 0-septate. Chlamydospores absent Fusarium thapsinum Klittich, J.F. Lesl 106. Fusarium torreyae. Aoki T , Smith JA, Mount LL, Geiser DM, O'Donnell K. Mycologia. 2013,105(2):312-9 Colonies produce loosely floccose, sometimes funiculose, white to yellowish white mycelium. Pigmentation in the reverse pale yellow, or light orange, grayish orange, orange to reddish orange. Sporodochial conidiophores verticillately or irregularly branched, forming apical monophialides or sometimes intercalary phialides. Macroconidia variable in morphology, 1–9-septate, falcate and curved, often long and slender and cylindrical, dorsiventral, often widest around the midregion of their length, tapering gradually toward both ends, with an acuminate apical cell and a distinct foot-like basal cell. Chlamydospores present or absent, smooth to rough, thick-walled, intercalary or terminal, solitary, in pairs or catenate. 228 Aoki et al., 2013 107. Fusarium torulosum (Berk. & M.A. Curtis) Gruyter & J.H.M. Schneid., Jaarboek. Plantenziektenkundige Dienst: 135 (1991) ≡Fusidium torulosum Berk. & M.A. Curtis, Grevillea 3 (27): 112 (1875) [MB#207053] ≡Fusoma torulosum (Berk. & M.A. Curtis) Sacc., Sylloge Fungorum 4: 220 (1886) ≡Fusarium torulosum (Berk. & M.A. Curtis) Nirenberg, Mycopathol129 (3): 136 (1995) =Fusarium sambucinum var. coeruleum Wollenw., Annales Mycologici 15 (1-2): 55 (1917))) Colonies produce initially white lannose mycelium, red pigments in agar.Sporodochia orange. Macroconidia abundant, short, falcate, 5septate, apical cell pointed, basal cell foot-shaped. Microconidia rare, oval, on monophilides, 0-1-septate, single or in false heads. Chlamydospores abundant 229 108. Fusarium tricinctum (Corda) Sacc., Sylloge Fungorum 4: 700 (1886) ≡Selenosporium tricinctum Corda, Icones fungorum hucusque cogn 2: 7, t. 9:33 (1838) ≡Fusarium sporotrichioides var. tricinctum (Corda) Raillo, Fungi of the genus Fusarium: 197 (1950) ≡Fusarium sporotrichiella var. tricinctum (Corda) Bilai, [Poisonous fungi on cereal seed]: 87 (1953) ≡Fusarium sporotrichiella var. tricinctum (Corda) Bilai, Mykrobiologichnyi Zhurnal Kiev 49 (6): 7 (1987) =Fusarium citriforme Jamal., Valt. Maatalousk. Julk.: 11 (1943) Colonies form dense white mycelium, become pink, red or purple. Sporodochia pale orange, abundant. Macroconidia abundant, slender to falcate, 3-5 –septate, apical cell curved and tapering, basa; cell footshaped. Microconidia abundant, napiform, oval, pyriform and citriform, 0-1-septate, may be clustered in false heads. Chlamydospores found singly or in chains www.invasive.orgwww.andrewmccullagh.com draaf.lorraine.agriculture.gouv.fr, en.engormix.com 230 109. Fusarium tupiense Lima, Pfenning & Leslie, Mycologia 104 (6): 1414 (2012) Colonies produce white, in some cultures grayish violet; hairy to lanose-funiculose aerial mycelium. Pigmentation in reverse grayish white to gray to dark violet. Microconidia borne in the aerial mycelium mostly obovoid, occasionally oval to allantoid, 0-3 –septate, aggregated in false heads. Conidiophores on aerial mycelia erect, occasionally prostrate, sympodially branching, branches terminating in up to five phialides, often proliferating and associated with coiled sterile hyphae; phialides of aerial conidiophores cylindrical, mono- and polyphialidic. Sporodochia cream to orange. Sporodochial conidiophores verticillately branched. Macroconidia slightly beaked in the apical cells, with a footlike basal cell, 3-5 septate. Chlamydospores absent. Lima et al., 2012 110. Fusarium udum E.J. Butler, Mem. Dept. Agric. India: 54 (1910) ≡Fusarium oxysporum f.sp. udum (E.J. Butler) W.C. Snyder & H.N. Hansen, American Journal of Botany 27: 66 (1940) [MB#509372] =Fusarium uncinatum Wollenw., Annales Mycologici 15 (1-2): 54 (1917) Colonies form white mycelium with pink to purple pigments in the agar, pink to salmon sporodochia. Macroconidia abundant in sporodochia, straight to fulcate, thin-walled, 1-5-septate, apical cell curved-hooked, basal cell foot-shaped. Microconidia sparse, fusiform or oval, 0-1 septate. Chlamydospores single or in clusters. 231 John F. Leslie and Brett A. Summerell , G. Hagedorn, M. Burhenne & H. I. Nirenberg 111. Fusarium ussurianum T. Aoki, Gagkaeva, Yli-Mattila, Kistler & O'Donnell, Mycologia 101 (6): 841-852 (2009) Colonies produce loose to densely floccose, white, reddish-white, brownish-yellow, brownish-orange to grayish-brown mycelium. Conidiophores branched verticillately or unbranched, forming monophialides. Phialides simple, subulate, ampulliform to subcylindrical, sometimes doliiform, monophialidic. Conidia of a single type, typically falcate and curved, dorsiventral, most frequently widest slightly above the mid-region of their length, mostly tapering and curving equally toward both ends, with an arcuate apical cell and a distinct basal foot cell, forming symmetrical upper and lower halves, 17-septate. Chlamydospores and sclerotia absent but some globose 232 hyphal swelling sometimes present, intercalary or occasionally terminal. Fusarium ussurianum , T. Aoki et a;. (2009) 112. Fusarium venenatum Nirenberg, Mycopathologia 129 (3): 136 (1995) Colonies produce long, dense, cottony, white toorange, gray or red mycelium, Red pigments. Sporodochia abundant, reddish brown to brown. Macroconidia abundant, short, slender, 5-septate. Microconidia absent. Chlamydospores abundant, singly and in chains twicemice.com 233 113. Fusarium virguliforme O'Donnell & T. Aoki, Mycologia 95 (4): 667 (2003) [MB#489315] ≡Neocosmospora virguliforme (O'Donnell & T. Aoki) L. Lombard & Crous, Studies in Mycology 80: 228 (2015) Colonies are white to yellowish-white or pale yellow, sometimes with bluish-gray. Aerial mycelium sparse or sometimes developed abundantly, then loose to dense floccose. Colony margin entire to often undulate. Reverse pigmentation often absent, sometimes grayish, grayish-orange to brownish-orange or olive brown to yellowish-brown. Yellowish exudate sometimes present. Chlamydospores formed abundantly in mycelium and in conidia, mostly subglobose, intercalary or terminal, mostly single, rarely in chains, hyaline to pale or paleyellow, smooth to rough-walled. sporodochia normally formed abundantly. Aerial conidiophores unbranched or sparsely branched, forming monophialides integrated in the apices. Aerial phialides simple, subulate to subcylindrical, often with a conspicuous collarette at the tip. Macroconidia typically falcate, dorsiventral, most frequently widest at the midregion of their length, often tapering and curving equally toward both ends, with the apex and foot cell typically similarly pointed and often indistinguishable, 2-5-septate. Microconidia comma-shaped to sometimes short-clavate, with a swollen apex often rounded but rarely pointed and with a tapering and curving base, 0--2-septate. Fusarium virguliforme Kevin Bugg, 2010, www.cals.ncsu.edu 234 114. Fusarium verticillioides (Sacc.) Nirenberg, Mitteilungen der Biologischen Bundesanstalt für Land- und Forstwirtschaft 169: 26 (1976) ≡Oospora verticillioides Sacc., Fung. Ital.: fig. 789 (1881) ≡Alysidium verticillioides (Sacc.) Kuntze, Revisio generum plantarum 3: 442 (1898) ≡Alysidium verticilliodes (Sacc.) Kuntze (1898) =Fusarium moniliforme J. Sheld., Annual Report of the Nebraska Agricultural Experimental Station 17: 23 (1904) =Fusarium celosiae Abe, Mem. Coll. Agric. Kyoto Univ.: 51-64 (1928) =Oospora cephalosporioides Luchetti & Favilli, Ann. Fac. Agrar. R. Univ. Pisa N.S.: 399 (1938) Colonies produce white mycelium, violete pigmenta with age. Macroconidia rare, in pale orange sporodochia, long. Slender,thinwalled, 3-5-septate, apical cell curved and pointed, basal cell notched to foot-shaped. Microconidia, monophilides abundant on the aerial mycelium, club-shaped, 0-septate. Chlamydospores absent 115. Fusarium vorosii B. Tóth, Varga, Starkey, O'Donnell, H. Suga & T. Aoki, Fungal Genetics & Biology 44 (11): 1191-1204 (2007) Fusarium vorosii is morphologically similar to F. graminearum including colony characters on PDA, but has slightly different conidial features from it. Macroconidia 5-septate, typically straight but sometimes gradually curved and frequently widest above the mid-region. O’Donnell et al 2008 235 116. Fusarium xylarioides Steyaert, Bulletin de la Société Royale de Botanique de Belgique 80 (1-2): 42 (1948) [MB#286515] ≡Fusarium oxysporum f.sp. xylarioides (Steyaert) Delassus, Bull. Sci. Minist. Colon. Sect. Agric. trop.: 347 (1954) ≡Fusarium oxysporum f. xylarioides (Steyaert) Delassus, Bull. sci. Minist. Colon. Sect. Agric. trop.: 347 (1954) ≡Fusarium lateritium f.sp. xylarioides (Steyaert). Gordon, Canad J Bot 43, 1317 (1965) Schroers et al., 2009 236 www.ppis.moag.gov.il www.drjacksonkungu.com www.ianrpubs.unl.edu 237 11. Fusarium books 238 239 240 241 242 12. Research projects 1. Intestinal toxicity and oral resorption of conjugated Fusarium mycotoxins, frequently found in food & feed, Gent University Promotor: Siska Croubels (UGent) Within this project the first focus will lay on the synthesis and isolation of glycosylated derivates of deoxynivalenol (DON) and zearalenone (ZEN) as well as acetylated DON derivates, and this in amounts sufficient to conduct further in vitro and in vivo trials.These synthesized masked mycotoxins will be utilized to determine the intestinal cytotoxicity and the influence on the cytokine response of these compounds. In a further stage, the oral bioavailability and in vivo degree of hydrolysis will be determined of these conjugated toxins by using in vitro en in vivo toxicokinetic models. Pigs and chickens will serve as target animals as these animals have the highest natural exposure to these toxins and are economically 243 relevant. Additionally, pigs can serve as a model for human toxicokinetics.The research will generate data concerning the toxicokinetic en toxicological properties of masked mycotoxins. Based on these properties one can make a more informed decision on the potential need to include these compounds in routine controls, and possibly legislation. 2. Rapid multiplex detection of toxigenic Fusarium species The Norwegian Veterinary Institute (NVI) Project leader: Dr. Arne Holst-Jensen, Section of Food and Feed Microbiology, Department of Feed and Food Hygiene In the present study the phylogenetic relationship between the most frequently isolated Fusarium species detected on Norwegian cereal grains was clarified. The phylogeny was largely concurrent with previous reports, but revealed lack of concordance between sections and the species traditionally assigned to the sections. All but one species formed monophyletic groups, and the phylogeny revealed a clear division between the trichothecene and non-trichothecene producing species. Phylotoxigenic relationship was observed for the major groups of trichothecene producers, and these trichothecene producing species could be divided into the strict type A trichothecene producers, the strict type B trichothecene producers and those that produce both type A and B trichothecenes. Based on the results of the phylogenetic analyses and published chemical and morphological reports, F. arthrosporioides was placed as a synonym to F. avenaceum. Potential diagnostic sequence motifs detected for molecular methods, were retrieved from the phylogenetic analyses. Main goal::Develop a rapid multiplex phylogeny-based assay for identification of toxigenic Fusarium species in plant matrixes Sub-goals::Sequence the ribosomal intergenic spacer (IGS), introns of b-tubulin , translation elongation factor 1a or other genes of approximately 150 strains of Fusarium/other relevant fungal/host plant taxa. 244 Perform phylogenetic analyses based on new sequences and sequences from databases and collaborators. Map features associated with the strains on the phylogenetic trees, e.g. taxonomy, metabolite profile, geographic origin, host. Retrieve diagnostic sequence motifs from phylogenetic trees. Develop and validate diagnostic probes in single strain and multiplex PCR/hybridisation assays. 3. Mycotoxins and mycotoxigenic fungi in China: analytical tools, dietary exposure and Fusarium diversity Promotor: Sarah De Saeger (UGent) Belgian partners: Stéphane Declerck (Université catholique de Louvain, UCL), Alfons Callebaut (CODA-CERVA), Geert Haesaert (University College Ghent, Hogent) Chinese partners: Dr.Y.Qi (Chinese Academy of Tropical Agricultural Sciences, CATAS), Prof. Y.-C. Liao (Huazhong Agricultural University, HZAU), S. Peng (Shanghai Food and Drug Administration, SHFDA), H. Gao (Shanghai Food and Drug Administration, SHFDA), Prof. J. Shen (China Agricultural University, CAU), Prof. S. Zhang (China Agricultural University, CAU), Prof. D. Zhang (Shanghai Jiao Tong University, SJTU), Dr. A. Wu (Shanghai Academy of Agricultural Sciences, SAAS) Researchers: J. Diana Di Mavungu (Ghent University, UGent), N. Beloglazova (Ghent University, UGent), F. Munaut (Université catholique de Louvain, UCL), F. Van Hove (Université catholique de Louvain, UCL), Kris Audenaert (University College Ghent, Hogent), B. Huybrechts (CODA-CERVA), E. Tangni (CODA-CERVA), Ph. Debongnie (CODA-CERVA), H.-P. Li (Huazhong Agricultural University, HZAU), J.-B. Zhang (Huazhong Agricultural University, HZAU), J.-H.Wang (Huazhong Agricultural University, HZAU), Z. Wang (China Agricultural University, CAU) 245 The major aim of this proposal is to bring together experts from both China and Belgium to conduct research on mycotoxins and mycotoxigenic fungi, including Fusarium and related toxins. The different partners will be complementary as they are focused on different aspects of this research topic. Multidisciplinarity and cross-border research are the key issues in this project. More specifically, the project will have the following objectives: 1. Development of analytical tools to assess mycotoxin dietary exposure in China. 2. Study on the genetic and mycotoxigenic diversity of Fusarium on wheat, maize and banana in China. 4. Assessment of mycotoxin exposure in the Belgian population using biomarkers Promotors: Stefaan De Henauw (UGent) and Alfons Callebaut (Coda-Cerva) The objectives of this project are: • Measurement of mycotoxins via biomarkers in urine taken in samples of a representative part of the Belgian population, using validated analytical methods • Perform an exposure assessment via biomarkers for a number of mycotoxins to which the Belgian population is exposed (mainly through dietary intake) • Investigate the correlation between the measured biomarkers and the reported consumption of different groups of food commodities 5. MYTOXPLEX: Is the occurrence of the T2/HT-2 mycotoxin complex in cereals a new and actual problem in the food and feed chain? This project will use an explorative approach to: 1. Assemble qualitative and quantitative T2 and HT-2 data in small grain cereals (wheat, barley, oat, spelt and triticale) and derived cereal products produced and handled in Belgium. 2. Elucidate the occurrence of T2 and HT-2 producing Fusarium species and their genetic diversity in order to come up with appropriate control measures. 246 3. Identify the presence of other mycotoxins produced by F. poae and F. langsethiae. 4. Assess the importance of other Fusarium species within the T2/HT-2 complex. 5. Implement a preliminary risk assessment for T2, HT-2 and other eventual mycotoxins within the F. poae group based on an exposure estimation. Promotors: Geert Haesaert (HoGent), Kris Audenaert (HoGent), Sarah De Saeger (Ugent), Françoise Munaut (UCL) and Mia Eeckhout (HoGent) 6. Researching Fusarium poae: its mycotoxines, chemotype and influence of oxidative stress triggers Copromotors: Monica Höfte (HoGent) Collaborator: Adriaan Vanheule (HoGent) Thorough research at the Ghent University College recently attempted to shed light on the ever changing composition of the Fusarium complex. It was found that in Flanders, Fusarium poaehas an important place within this disease complex. Up to recently, research in this field did not focus on F. poae, as other species were much more aggressive within the complex. Its rising presence, its nature as a secondary attacker and its potential to produce mycotoxins which could be much more toxic than those of other species, illustrate the large need for research on this topic.The Fusarium poae research at the Ghent University College aspires to fill the gaps in the scientific community’s knowledge on this fungus. Field isolates that originate from several testing locations in Belgium are characterized pursuing a multidisciplinary approach of chromatographic, genetic and pathological methods. LC-MS/MS techniques are used to unravel the chemotype of the isolates. To this end, the Fusarium poae project has ties with the ‘Mytox’ Association Research Group (AOG), and research is carried out in the Bromatology lab at the Faculty of Farmaceutical Sciences at the University Ghent. The qualitative and quantitative production of toxins is examined under different conditions and influences of stress, such as fungicide treatment. A further characterization of the field samples involves fungicide resistance assays of F. 247 poaeand the related species F. langsethiae to fungicides such as triazoles and strobilurines. Experiments to examine the physiological effects of fungicide treatments on both a macroscopic and a microscopic level are set up. This work is carried out in the broader framework of oxidative stress as a trigger for toxin production, which could be a central dogma in toxin production in all toxigenic fungi. To find a measure for aggressivity of the isolates, detached leaf assays are used. This technique also allows us to test several sources of resistance in wheat for its strength against F. poae. Again, microscopy visualization techniques are employed, this time to gain insight in the infection strategy of the fungus and the plant’s corresponding response. The last piece of the puzzle is filled in when AFLP-fingerprinting lets us unravel the genotype of the different isolates.These different approaches of the Fusarium poae problem allow us to paint a fairly complete picture of the fungus, and as such meet the scientific community’s need for more knowledge on this organism with its importance increasing now more than ever. 7. MycoHunt: Rapid biosensor for the detection of mycotoxin in wheat Mia Eeckhout (coordinator HoGent), Collaborator: Yirong Guo (UGent), Melanie Sanders (UGent), Freya Martens MycoHunt is a project granted in the EU7 framework program for the development of a rapid online biosensor for the detection of mycotoxin in wheat.The project aims to increase the competitiveness of a large group of “Small and Medium Enterprises (SME) Associations” in Europe by developing a cost-effective method to detect the contamination of deoxynivalenol (DON) in wheat grains. This mycotoxin forms a major threat in the food and feed sector of the European industry. A group of SME Associations, covering the relevant sectors and representing a vast number of sector SMEs, participate in the project. In this way, they will gain knowledge and resources to further exploit the results of the novel technology developed by providing a thorough sampling and measurement method of grain.In the framework of the project the development of an online, non-destructive sampling apparatus for dust and other low molecular weight particles is targeted. Another aspect of the research is the development of a specific sensor based on an immunoassay method using DON specific monoclonal antibodies. Beside the technological objectives, the research focuses on the determination of parameters (temperature, pressure, vacuum, etc.) affecting the sampling precision. Also different immobilizing methods for the DON specific monoclonal antibodies will be investigated. The determination of the cross-reactivity of these monoclonal antibodies against other trichothecenes, like 3-acetyl-DON, 15-acetyl-DON, nivalenol, is also an interesting point to consider. 8. Fusarium Research, at University of the Free State/ South Africa 248 The most effective means to prevent damage caused by Fusarium spp. to agricultural crops is by planting tolerant or resistant material. Such tolerance/resistance depends on the ability of the fungus to enter, colonise and damage the plant, and the ability of the plant to prevent or resist damage caused by the fungus. To exploit plant resistance as a means of disease management, a proper knowledge of Fusarium, its genetics, pathogenicity and toxicity, under different environmental conditions, is required. In this programme, the interaction between agricultural crops and Fusarium spp. is investigated by means of comparative and functional genetics of the Fusarium-plant interactions, the isolation and identification of defence-related genes in agricultural crops, the identification of virulence genes in Fusarium, studies on the evolutionary biology and phylogenetics of Fusarium, and the unconventional improvement of plants for resistance to Fusarium spp. Greenhouse and field evaluation of natural and induced resistance to Fusarium pathogens of agricultural crops are also conducted in collaboration with the ARC. students MSc students: Ankia Rabie - Isolation and identification of putative pathogenicity genes in a mutant population of Fusarium oxysporum f. sp. cubense Morgana Miller - Containment of Fusarium oxysporum f.sp. cubense 'tropical' race 4 on a banana farm in northern Mozambique Anushka Gokul Epidemiological investigations of the Fusarium graminearum species complex (FGSC) in South African wheat and maize, grown in rotation Nakisani Netshifhefhe - Investigating the mechanisms of resistance in maize to Fusarium verticillioides and fumonisin Londiwe Mabuza - Monitoring Fusarium and Gibberella ear rots and the mycotoxins they produce in maize grown under different conservation tillage/rotation systems PhD students: 249 Lindy Rose - Unconventional improvement of maize for resistance to Fusarium verticillioides and their fumonisins Gert van Coller - identification and management of toxin-producing Fusarium species responsible for head blight and crown rot of wheat in South Africa Reuben Ssali - identification, characterisation and genetic mapping of Fusarium wilt resistance loci in Musa Sharon McFarlane - Development of a management strategy for Eldana saccharina Walker in sugarcane using Fusarium endophytes Edson Ncube - Interactive effect of Busseola fusca and Fusarium verticillioides on ear rot and fumonisin production in maize Saif Al-Kaabi - The diversity, distribution and management of Fusarium oxysporum f.sp. cubense in the Sultanate of Oman 9. Characterisation and management of Fusarium wilt of watermelon The project is financially supported by the NT DPIF, Horticulture Australia Limited, Monsanto Australia and Rijk Zwaan Australia. Fusarium wilt is one of the most severe diseases in watermelon and is caused by a fungus called Fusarium oxysporum f. sp. niveum (Fon). This strain is only pathogenic on watermelons and can be divided into four races (0, 1, 2 and 3). The disease is one of the major yield limiting factors in production, worldwide. Fon was first detected in the Northern Territory (NT) in May 2011. The disease affected three different varieties of watermelon seedlings and plants from six different locations. To date, two of the races have been detected in Australia. However there is limited published information about the Australian Fon races. It is unclear what race the NT Fon strain is, whether it is a new race and its level of aggressiveness. 250 Lucy Tran-Nguyen (project leader): 8999 2235 (lucy.tran-nguyen@nt.gov.au), Barry Conde (project member) 8999 2265 (barry.conde@nt.gov.au). The objectives of the projects are    Identify the NT Fusarium oxysporum f. sp. niveum race(s) and compare with other Fon races (Australia and international). Screen rootstocks and grafted watermelons for resistance to Fusarium oxysporum f. sp. niveum [all race(s)]. Extension strategies to raise awareness of Fusarium wilt of watermelon, deliver outcomes to industry and propose management strategies. The project outcomes include    Obtain a better understanding of the pathogen's biology by project completion. Determining the NT Fon race(s) and its relatedness to Australian and overseas Fon races by project completion. These findings would assist commercial breeding programs. By the end of 2015, seedling nurseries and growers are using an integrated strategy for management of Fon that allows them to sustainably produce watermelons on their current infected farms, as a result of the extension activities from this project. Project update:  Race differential trials in the NT have so far had mixed results. Trials on two varieties of watermelon, 'Kalahari' and 'SP-4' have suggested that 251      two Fon NT isolates are of race 2. The most recent trial however, conducted again on the 'SP-4' variety, has suggested that the NT isolates may actually be of race 3. To date, race 3 has not been reported as present in Australia. This trial will be repeated, and highlights the importance of conducting race differential trials on several varieties of watermelon before race can be determined conclusively. Multiplication of 'Charleston Grey' and 'Calhoun Grey' seeds, which are traditionally used for Fon race differentials, has been completed and will be used for trials to determine which race is present in the NT and NSW. Samples from melon growing regions in the NT, NSW, Qld and WA have been taken by University of Sydney post graduate student, Victor Puno. Preliminary race differential trials have found that four isolates from Qld are race 2. Isolates from the NT, NSW and WA have been determined as being either race 2 or 3, with ongoing trials being conducted to differentiate them. Glasshouse and field trials to determine the effects of temperature on the susceptibility of plants to Fon are currently being conducted in 2014, after being disrupted in 2013 due to resource reallocation during the banana freckle outbreak. These trials will again be repeated in 2015 to assess the reliability of results. Molecular studies on Fon isolates aim to develop a relatively quick and reliable molecular test for race identification. Thus far, studies have been made difficult due to the restrictions on importing live Fusarium cultures into Australia and the lack of quarantine facilities for working with them. Instead DNA from two isolates of each Fon race are to be imported from the US for future inclusion in comparative molecular studies of Fonisolates. Molecular characterisation of Fon isolates has commenced by searching for pathogenicity genes. Genome sequencing has been conducted on two NT isolates, and the presence of pathogenic genes has been found. One isolate appears it may be slightly more virulent than the other, but this is yet to be verified. 10. Epidemiology and agro-ecology of Fusarium oxysporum f.sp. cubense (PANAMA DISEASE PhD project 3) The aim of this PhD project is developing statistically sound sampling strategies and (quantitative) diagnostics. This will result in internationally sought 'TR4 alerts' and effective rational and quantifiable management practices. Project code: PANAMA DISEASE Status: In progress Start project: Jan 1, 2012 252 End project: Dec 31, 2017 Partners:  Plant Research International  Soil Geography and Landscape  Knowledge Technology and Innovation Other parties involved: Embrapa (Empresa Brasileira de Pesquisa Agropecuária); CIB (Cooperación de Investigaciónes Biológicas); UNAL (Universidad Nacional de Colombia, Medellín); Augura (National Banana Corporation of Colombia); Colciencias (National Science Foundation); CORBANA (Corporación Bananera Nacional); Bioversity International; Chiquita; Dole; Earth University; AEBE (Association of Ecuadorian Banana Exporters); Senescyt (National Science Foundation); ESPOL-CIBE (Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnológicas del Ecuador); FHIA (Fundación Hondureña de Investigación Agrícola); OIRSA (Organismo Internacional Regional de Sanidad Agropecuaria) (Philippines Banana Growers and Exporters Association); Federation of Cooperatives in Mindanao and MBFEA (Mindanao Banana Farmers and Exporters Association); University of the Philippines-Mindanao; University of the Philippines-Los Baños; CHED (Commissioner of Higher Education); PCCARD (Philippine Council for Agriculture, Forestry and Natural Resources Research and Development); IITA (International Institute for Tropical Agriculture); SUA (Sokoine University of Agriculture); CIRAD (Centre de coopération internationale en recherche agronomique pour le développement); FAO-World Banana Forum; AgroFair; BLGG (Bedrijfslaboratorium voor Grond en Gewasonderzoek 11. Panama disease: Multi-level solutions for a global problem Panama disease: Multi-level solutions for a global problem is a collaborative project led by Wageningen University & Research Centre and funded by Wageningen University’s Interdisciplinary Research and Education Fund (INREF)1. The premise of the project is that controlling Fusarium wilt, caused by Fusarium oxysporum f. sp. cubense (Foc), requires an approach that integrates new insights, such as on the impact of genetic and agro-ecological diversity on the spread and severity of the disease, with coordinated action and regulation. The project aims to address the management and containment of tropical race 4 (TR4) under different production settings in a range of agro-ecological environments and various governance structures by establishing methods for immediate containment and management of TR4 where it is present, or arrives, and by developing long-term control strategies in bananaproducing regions affected by the other races of the Fusarium fungus. 253 The INREF project is one of three research projects on Fusarium wilt that are managed Wageningen University & Research Centre. The other two are: KNAWSPIN, a Scientific Program Indonesia Netherlands (SPIN) funded by the Royal Netherlands Academy of Arts and Sciences, which aims to deliver fundamental knowledge on banana and Foc, and PromoBanana (Protect and Modernize Philippine Banana Production), which aims to establish a professional service laboratory to detect and contain rapidly spreading diseases, and to optimize fertilizer management 2. Study areas Project activities take place in the Philippines (where TR4 is present), Ecuador, Colombia, Costa Rica and Tanzania (where other Fusarium wilt races are present) and the Netherlands (for specific laboratory and greenhouse experiments). The study areas represent different types of production systems (smallholder and large-scale commercial plantations) as well as different agro-ecological setting and governance models and histories. Main research questions The analytical framework of the research approach considers three main domains that are important drivers of disease outbreaks: biology, environment and human action. The multidisciplinary approach is programmed in a series of projects that address seven main research questions linking the different domains and scale levels, from individual plants to entire regions. 1. What Foc genotypes are present in different banana growing regions, and which banana cultivars are susceptible to these strains? 2. What banana and plantain cultivars are resistant to TR4 and what is the genetic basis for resistance to TR 4 and other Foc strains? 3. What are the dispersal and survival strategies of Foc under various agroecological settings? 4. What is the contribution of diversified germplasm pools and diverse agroecological conditions to lowering Fusarium wilt pressure in mixed cropping systems? 5. What are the effects of abiotic stress or specific farm management strategies on the alleviation of disease pressure in susceptible banana germplasm in areas infested with Race 1 of Foc? 254 6. What are the enabling and constraining mechanisms for coordination and joint action in managing Fusarium wilt in the diverse banana industry in southern Mindanao? 7. What are the conditions for effective forms of governance that help to control Fusarium wilt at different levels? Partners by country The project brings together 25 partners in 10 countries. Brazil Embrapa (Empresa Brasileira de Pesquisa Agropecuária), Colombia, CIB (Cooperación de Investigaciónes Biológicas), UNAL (Universidad Nacional de Colombia), Augura (National Banana Corporation of Colombia), Colciencias (National Science Foundation), Costa Rica, CORBANA (Corporación Bananera Nacional), Chiquita Dole, Earth University, Ecuador, AEBE (Association of Ecuadorian Banana Exporters) Senescyt (National Science Foundation), ESPOL-CIBE (Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnológicas del Ecuador), El Salvador, OIRSA (Organismo Internacional Regional de Sanidad Agropecuaria), Philippines, PBGEA (Philippines Banana Growers and Exporters Association) Federation of Cooperatives in Mindanao, MBFEA (Mindanao Banana Farmers and Exporters Association), University of the Philippines-Mindanao, Tanzania, SUA (Sokoine University of Agriculture), France CIRAD (Centre de coopération internationale en recherche agronomique pour le développement), Italy FAO-World Banana Forum, Netherlands, AgroFair, BLGG (bedrijfslaboratorium voor grond en gewasonderzoek) 12. PE 022 - Pepper: Improved control of Fusarium internal fruit rot through increased knowledge exchange with the Netherlands and Belgium and targeted application of plant protection products This project aims to reduce losses to Fusarium internal fruit rot through: (1) agreed information exchange and a joint work programme with Dutch/Belgium researchers; (2) examination of rockwool cubes as a source of F. lactis and F. oxysporum; (3) devising experiments to determine if the level of flower infection can be used to 255 predict risk of fruit infection; (4) determining the duration of reduction in fruit infection provided by a single application of Serenade ASO to a crop row, cube surface and floor; (5) determining if use of biopesticides / plant resistance inducers applied preventatively provide protection to flowers and/or fruit against infection; (6) communication of results to growers. 13. Fusarium mycotoxins in straw and feed: Effedts on pig reproduction and health Project manager: Per Häggblom CRC60097: Fusarium TR4 - PhD This research project will increase our knowledge about the epidemiology and biology of the exotic plant pathogenFusarium wilt of banana caused by Fusarium oxysporum f. sp. cubense ‘tropical' race 4 (Foc TR4) 14. Institute for Biotechnology in Plant Production Research Projects Christian Doppler Laboratory for Mycotoxin Metabolism (CDL Berthiller) Project type: Research project (§ 26 & § 27) Project Leader: Berthiller Franz ; BOKU Research Units: Center for Analytical Chemistry ; Department of Applied Genetics und Cell Biology ;Institute for Biotechnology in Plant Production ; Institute of Animal Nutrition, Livestock Products, and Nutrition Physiology (TTE) ; Funded by: Christian Doppler Forschungsgesellschaft (CDG), Sensengasse 1, 1090 Wien, Austria Duration: 01.01.2011-31.12.2017 256 The effort will be concentrated on the Fusarium mycotoxins deoxynivalenol, zearalenone and fumonisin B1, as these compounds are significant contaminants of European cereal crops. The first module will establish the extent of formation of bound mycotoxins in plant systems. The second module will investigate microbial interactions with free and bound toxins with a view to identifying possible detoxification routes. The third module will pursue animal feeding trials to establish the fate of bound toxins in vivo, as well as the effectiveness of detoxification strategies. Radiolabeled mycotoxins will facilitate these studies and biomarkers will be used extensively to monitor the fate of toxins in ani-mal systems. In summary, the overall project aims to answer the following key questions: Which plant metabolites of mycotoxins are formed in agriculturally important crops and in which quantity? What is the bioavailability and toxicity of these soluble (conjugated) and insoluble (bound) forms compared to the native toxins? What is the influence of microbes (either gut bacteria or deactivators) to conjugated and bound toxins? How efficient are various mycotoxin deactivators to detoxify both native mycotoxins and their altered forms? Plant metabolism of T-2 and HT-2 toxin in wheat, barley and oats Project type: Research project (§ 26 & § 27) Project Leader: BOKU Research Units: Center for Analytical Chemistry ; Institute for Biotechnology in Plant Production ; Funded by: Fonds zur Förderung der wissenschaftlichen Forschung (FWF) , Sensengasse 1, 1090 Wien, Austria Duration: 01.12.2013-30.11.2016 In this project we want to 1) investigate the metabolic fate of T2/HT2 in planta, 2) develop suitable analytical methods for detection and quantification of possible new metabolites and 3) produce standards of such metabolites. To detect metabolites a 1:1 mixture of natural and U-[13C]-toxins will be applied on wheat/barley ears and oat panicles. At different time points after application both known (i.e. predicted) and unknown metabolites will be traced and identified by liquid chromatography – high resolution mass spectrometry (LC-HRMS). Similar tests will be done with 14Clabeled toxins to assess the insoluble amount, measured by scintillation counting. A solvolysis procedure will be established to access the extractable biopolymer-bound and the non-soluble toxin fractions from the plant matrix. A molar sum of all metabolites will be estimated and compared to the total amount of toxins applied. To demonstrate the significance of the detected T2/HT2 biotransformation products, we will confirm their production after artificial inoculation with T2/HT2 producing Fusarium spp. and we will study their presence in naturally infected samples in the scope of a small survey. The resistance mechanism to T2/HT2 in wheat carrying Fhb1 is investigated using near-isogenic wheat lines with and without this QTL. To this end 257 differential formation of T2 and HT2 metabolisation products will be studied by LCHRMS. 15. Integrated management of Fusarium wilt of bananas in the Philippines and Australia.(Australian Centre for International Agricultural Research) Project Leader:: Mr Stewart Lindsay Collaborating Institutions Australian Banana Growers Council, Australia Provincial Agricultural Office-Rigion XI, Davao Del Norte, Philippines University of Southeastern Philippines, Philippines MegaManila Pest Management Specialists Inc., Philippines This project aims to identify practices for smallholder banana growers to reduce FW spread through soil movement, understand mechanisms that suppress the symptoms and identify effective disposal of infected plant residue. It also aims to profile current knowledge of banana growers and the barriers to adopting relevant practices. The project will draw on experiences managing the disease in Australia, Indonesia and the Philippines though various Australian industry-funded projects, ACIAR HORT/2008/040 and Bioversity International and their coordination role with other national research projects. Commissioned Organisation Queensland Department of Agriculture, Fisheries and Forestry, Australia 16. Cereal pathology: improving the genetic basis of host resistance to fungal diseases. Fungal diseases pose a major problem for cereal production in Ireland for two reasons: firstly, they significantly reduce yield, and secondly, some fungal diseases lead to contamination of grains with mycotoxins, compounds that are harmful for both human 258 and animal health. UCD currently has an active research programme in fungal molecular plant pathology. By increasing the critical mass of this research group, this project aims to use biotechnology to better understand the potential for reduced pesticide input for controlling such diseases, thus leading to more competitive and sustainable low-input crop production in Ireland. The specific objectives of this project are to: 1. 2. Better understand the susceptibility/resistance of Irish-grown barley cultivars toFusarium head blight disease and associated mycotixin contamination. Dissect the genetics of wheat resistance to Fusarium head blight disease. Achieving these objectives will allow the selection of wheat and barley cultivars with lower fungicide requirements and will thus facilitate the move towards competitive low-input sustainable crop production. Funding: Department of Agriculture, Food and Rural Development (Ireland). 17. Reduction of fungicide input in Irish cereal farming: biological control of cereal foliar and head blight fungal pathogens. Researchers: Eleanor O`Brien, Mojibur Khan Collaborators: Dr. Brian Carney, Letterkenny Institute of Technology, Co. Donegal, Ireland. Funding: Department of Agriculture, Food and Rural Development (Ireland). In Ireland, the most important fungal diseases of cereals in terms of yield loss include Septoria tritici leaf blotch of wheat, Pyrenophora (Dreschlera) teres net blotch of 259 wheat and Fusariumhead blight (FHB) of both wheat and barley caused by various Fusarium species. FHB also poses a threat in terms of human and animal health in that many of the Fusarium species that we have commonly found in Ireland (F. culmorum, F. graminearum and F. poae) have the potential to produce a range of toxic secondary metabolites known as mycotoxins in grain. Currently, control of such diseases is attempted by fungicide application. Our ultimate aim is to reduce fungicide inputs in Irish tillage and in this project we will investigate the potential of developing environmentally friendly alternatives: biological control microorganisms/biochemicals. We will isolate, characterise and assess the biological control potential of microorganisms and crustacean biochemicals. We will determine the mode of action of potential biological control organisms/biochemicals using microscopic and molecular studies. In addition to our microbial studies, we will assess the effectiveness of chitosan, a deacetylated derivative of chitin that activates many of the plant's defense responses to microbial diseases against cereal pathogens. 18. Effect of trichothecene mycotoxins on programmed cell death in wheat The selective regulation of programmed cell death (PCD) offers tremendous potential rewards for plant and animal disease modulation. We recently identified that several fungal toxins retard PCD in Arabidopsis in a concentration-dependent manner. To the best of our knowledge, this is the first evidence of a fungal toxic metabolite inhibiting cell death in either plant or animal cells. We wish to analyse the effect of this these mycotoxins on stress-induced PCD in host plants (wheat and maize). Also, we will determine if the retardation of plant PCD by mycotoxins is an attack strategy adopted by pathogens during plant pathogenesis. Researcher:Guillaume Erard. Collaborators:Dr. Paul McCabe, Dept. of Botany, UCD, Belfield, Dublin 4, Ireland. 19. Functional genomics of plant-mycotoxin interactions 260 Researchers:Dr. Josephine Brennan, Stephanie Walter Collaborators: Dr. Gerhard Adam, Center of Applied Genetics, University of Agricultural Sciences, Vienna 18, A-1190 Vienna, Austria. Dr. Paul Nicholson, Disease and Stress Biology, John Innes Centre, Norwich Research Park, Colney, Norwich NR4 7UH, UK. Dr. Bodo Trognitz, Austrian Research Centre Seiberdorf GmbH,A-2444 Seibersdorf, Austria. Mycotoxins are toxic fungal secondary metabolites. Fusarium fungi pathogenic to wheat produce trichothecene mycotoxins that act as disease virulence factors, aiding host parasitism; the wheat genome has consequently co-evolved with the Fusarium pathogen and its toxic metabolites. Current knowledge about the influence of trichothecenes on eukaryotic signal transduction cascades and downstream gene products is limited, especially in plants. Trichothecene resistance is postulated to be one of wheat's mechanisms to resist Fusarium head blight disease.We have recently identified several trichothecene-responsive wheat genes; many show no homology to previously characterised genes. This project will use microarray analyses to identify more wheat genes overexpressed in response to trichothecenes. We will also elucidate gene function using host, heterologous expression and gene regulatory studies. Gene expression analysis in a range of wheat tissues and genotypes in response to various treatments will determine if trichothecene-responsive genes are a component of the plants general stress response, if they are specifically up-regulated in response to trichothecenes, how these genes are developmentally regulated, and if they play a role in disease resistance. Analysis of the effect of trichothecenes on both Saccharomyces cerevisiae andArabidopsis thaliana that are heterologously expressing trichotheceneresponsive wheat genes will indicate the ability of genes to directly conferring trichothecene tolerance and their phenotypic effects. For genes differentially expressed among wheat genotypes, RNA stability studies and analysis of upstream regulatory elements will enable us to determine if genes are pre- or post- 261 transcriptionally up-regulated due to trichothecene treatment and if regulatory region polymorphisms could account for differential gene expression. 20. Trichothecene mycotoxin up-regulated wheat genes: analysis of function and regulation. Researcher: Khairul Ansari Collaborators: Prof. Dr. P. Ruckenbauer, Dr. M. Lemmens, Dr. H. Buerstmayr and Dr. U. Scholz, Institute for Agrobiotechnology, Austria Dr. K. Hjortsholm. Sejet Plantbreeding, Denmark Dr. F. Lšschenberger, Saatzucht Donau GmbH., Austria Dr. J. Weyen. Saaten-Union Resistenzlabor GmbH, Germany Prof. Dr. A. Mesterhazy. Cereal Research non profit Co., Hungary Prof. B. M. Cooke. University College Dublin, Ireland Dr. G. Adam. University of Agricultural Sciences, Austria Dr. P. Nicholson. Disease and Stress Biology, John Innes Centre, UK Wheat-pathogenic Fusarium fungi produce toxic trichothecene mycotoxins that act as Fusarium head blight disease virulence factors, and trichothecene resistance is postulated to be one of wheat's mechanisms to resist Fusaria. We recently identified several characterised and uncharacterised trichothecene-responsive wheat genes. Wheat gene expression studies will determine if gene up-regulation is trichothecenespecific or part of the plants general stress response, how these genes are developmentally regulated and if they play a role in disease resistance. The ability of trichothecene-responsive wheat genes to enhance the trichothecene tolerance of Saccharomyces cerevisiae will elucidate their role, if any, in directly conferring 262 trichothecene tolerance Candidate genes for resistance, toxification, detoxification and toxin efflux. Deoxynivalenol (DON) is a trichothecene mycotoxin produced by cerealpathogenicFusaria and evidence suggests that it acts as a phytotoxic disease virulence factor aiding host pathogenesis. RNA fingerprinting offers the potential of identifying novel "expression" markers for screening for host trichothecene tolerance/degradation. We determined the effect of DON (20 ppm) on gene expression in roots of different wheat genotypes. Despite inhibition of protein synthesis being the mode of action of this toxin, at least 70 transcripts were overexpressed in the wheat roots of different cultivars in response to DON. We assessed the effect of DON treatment of wheat roots and Fusarium culmorum infection of wheat heads on the (EF- ), class III plant peroxidase, structure-specific recognition protein (SSRP),adenosine kinase (ADK), retrotransposon-like homologs and genes of unknown function. Ongoing research is investigating the potential implications of these genes on the host cell response to trichothecenes and trichothecene-producing Fusaria. 21. Project Part: Comparative annotation and analysis of multiple Fusarium genomes and the genomes of Brachypodium and crop plants with emphasis on toxin biosynthesis and detoxification reactions Project Part Leader: Univ. Prof. Dr. Hans-Werner Mewes This project part focuses on the bioinformatic analysis of fungal and plant genomes as well as integration of expression data. On the fungal part we aim to complete and improve the annotation of Fusarium genomes. This will be achieved by automatic and manual comparative gene calling methods. The main focus in the analysis is the identification of new targets in particular of fungal secondary metabolite and 263 mycotoxin clusters. Expression data, functional annotation and putative regulatory motifs are all integrated to explore the pathogen-host interaction. The model plant Brachypodium distachyon will be annotated. The Brachypodium genome will sub-sequentially be used as a model for the closely related but much more complex and larger genomes of barley and wheat although their genomes are currently not fully sequenced. Specific targets of interest are UDPglucosyltransferases, acetyltransferases among others. They will be first identified in the model genome and via homology and synteny driven orthology assignments counterparts in the crop genomes will be identified and knowledge transferred to the more complex genomes. 22, projects at University of Massachusetts, Amherst. The Department of Biochemistry and Molecular Biology Li-Jun Ma, Principal Investigators Professor Li-Jun Ma is interested in using the rich fungal genomic resources to explore the mechanisms that guide eukaryotic genome evolution. Dr. Ma is leading several comparative genomics projects to study the genetic determinants of fungal pathogenicity and host specificity, and participating in functional studies to test the hypotheses generated through genomic analyses. Li Guo, Post-Doctoral Research, Biochemistry and Molecular Biology Dr. Guo, completed his PhD through the Plant Pathology Graduate Program at Penn State, is focusing on functional genomics 264 of Fusarium species using comparative approaches. He studies comparative transcriptomics using both microarray and RNA-seq data. Greg DeIulio , Ph.D Candidate (Plant Biology Graduate Program) Greg is interested in understanding the epigenomic influence on genome evolution of Fusarium species using bisulfite-sequencing. 13. References 1. Abel Atukwase, Archileo N. Kaaya, Charles Muyanja, Hester Vismer and John P. Rheeder, 2012. Diversity of Gibberella fujikuroi Species Complex Isolated from Maize Produced in Uganda. International Journal of Plant Pathology, 3: 1-13. 2. Abu Shamim Mohammad Nahiyan & Louisa Robinson Boyer & Peter Jeffries & Yoh-ichi Matsubara. PCR-SSCP analysis of Fusarium diversity in asparagus decline in Japan Eur J Plant Pathol (2011) 130:197–203 3. Ahearn DG1, Zhang S, Stulting RD, Schwam BL, Simmons RB, Ward MA, Pierce GE, Crow SA Jr. Fusarium keratitis and contact lens wear: facts and speculations. Med Mycol. 2008 Aug;46(5):397-410. 4. Alastruey-Izquierdo A1, Cuenca-Estrella M, Monzón A, Mellado E, Rodríguez-Tudela JL. Antifungal susceptibility profile of clinical Fusarium spp. isolates identified by molecular methods. J Antimicrob Chemother. 2008 Apr;61(4):805-9 5. Alfonso E C Cantu-Dibildox JMunir WM et al. et al. Insurgence of Fusarium Keratitis Associated With Contact Lens Wear. Arch Ophthalmol.2006;124(7):941-947. doi:10.1001/archopht.124.7.ecs60039. 6. Amarasinghe C, Wang JH, Liao YC, Fernando WG. Difference in TRI13 gene sequences between the 3-acetyldeoxynivalenol producing Fusarium graminearum chemotypes from Canada and China. Int J Mol Sci. 2011;12(9):6164-75. doi: 10.3390/ijms12096164. Epub 2011 Sep 20. 265 7. Anaissie EJ1, Kuchar RT, Rex JH, Francesconi A, Kasai M, Müller FM, Lozano-Chiu M, Summerbell RC, Dignani MC, Chanock SJ, Walsh TJ. Fusariosis associated with pathogenic fusarium species colonization of a hospital water system: a new paradigm for the epidemiology of opportunistic mold infections. Clin Infect Dis. 2001 Dec 1;33(11):1871-8. Epub 2001 Oct 24. 8. Anne D. van Diepeningen & Abdullah M. S. Al-Hatmi &Balázs Brankovics & G. Sybren de Hoog. Taxonomy and Clinical Spectra of Fusarium Species:Where Do We Stand in 2014?. Curr Clin Micro Rpt (2014) 1:10–18 9. Aoki,T., Gagkaeva, Yli-Mattila, Kistler & O'Donnell. Fusarium ussurianum , Mycologia 101 (6): 841-852 (2009) 10. Aoki T, O'Donnell K, Homma Y, Lattanzi AR. Sudden-death syndrome of soybean is caused by two morphologically and phylogenetically distinct species within the Fusarium solani species complex--F. virguliforme in North America and F. tucumaniae in South America. Mycologia. 2003 JulAug;95(4):660-84 11. Aoki T , Smith JA, Mount LL, Geiser DM, O'Donnell K. Fusarium torreyae sp. nov., a pathogen causing canker disease of Florida torreya (Torreya taxifolia), a critically endangered conifer restricted to northern Florida and southwestern Georgia. Mycologia. 2013 Mar-Apr;105(2):312-9 12. Aoki, T., H. Suga, F. Tanaka, Scandiani & O'Donnell Fusarium azukiicola. Mycologia. 2012;104(5):1068-84. 13. Aoki T, Vaughan MM, McCormick SP, Busman M2, Ward TJ, Kelly A, O'Donnell K, Johnston PR, Geiser DM4. Fusarium dactylidis sp. nov., a novel nivalenol toxin-producing species sister to F. pseudograminearum isolated from orchard grass (Dactylis glomerata) in Oregon and New Zealand. Mycologia. 2015 Mar-Apr;107(2):409-18 14. Aoki T, Ward TJ, Kistler HC, O’Donnell K (2012c) Systematics, phylogeny and trichothecene mycotoxin potential of Fusarium head blightcereal pathogens. Mycotoxins 62:91–102 20. Arif, M., D. R. Pani, N. W. Zaidi, and U. S. Singh, “PCR-Based Identification and Characterization of Fusariumsp. Associated with Mango Malformation,” Biotechnology Research International, 2011, Article ID 141649, doi:10.4061/2011/141649 21. Arif, M., Shilpi Chawla , N. W. Zaidi , J. K. Rayar M. Variar and U. S. Singh. Development of specific primers for genus Fusarium and F. solani using rDNA sub-unit and transcription elongation factor (TEF-1α) gene. African Journal of Biotechnology 11(2), pp. 444-447 266 22. Baayen, R. P., O’Donnell, K., Breeuwsma, S., Geiser, D. M., and Waalwijk, C. 2001. Molecular relationships of fungi within the Fusarium redolens–F. hostae clade. Phytopathology 91:1037-1044. 23. Bhale UN, Chatage VS, Ambuse MG (2012) First Report of Fusarium proliferatum Inciting Wilt of Rumex acetosa L. in Maharashtra, India. J Plant Pathol Microbiol 3:116. doi: 10.4172/2157-7471.1000116 24. Bernal, MD, Acharya NR, Lietman TM, Strauss EC, McLeod SD, Hwang DG/ Outbreak of Fusarium keratitis in soft contact lens wearers in San Francisco. Arch Ophthalmol2006;1241051- 1053 25. Biazio, Gleison Ricardo de, Leite, Gabriela Guimarães Sousa, Tessmann, Dauri José, & Barbosa-Tessmann, Ione Parra. (2008). A new PCR approach for the identification of Fusarium graminearum. Brazilian Journal of Microbiology, 39(3), 554-560. 26. Bigley VH1, Duarte RF, Gosling RD, Kibbler CC, Seaton S, Potter M. Fusarium dimerum infection in a stem cell transplant recipient treated successfully with voriconazole. Bone Marrow Transplant. 2004 Nov;34(9):815-7. 27. Britz H, Steenkamp ET, Coutinho TA, Wingfield BD, Marasas WF, Wingfield MJ. Two new species of Fusarium section Liseola associated with mango malformation. Mycologia. 2002 Jul-Aug;94(4):722-30. 28. Castellá G1, Cabañes FJ. Phylogenetic diversity of Fusarium incarnatumequiseti species complex isolated from Spanish wheat. Antonie Van Leeuwenhoek. 2014 Aug;106(2):309-17. 29. Cavallini GM, Ducange P, Volante V, Benatti C. Successful treatment of Fusarium keratitis after photo refractive keratectomy. Indian J Ophthalmol 2013;61:669-71 30. Chehri K, Salleh B, Zakaria L. Morphological and Phylogenetic Analysis ofFusarium solani Species Complex in Malaysia. Microbial Ecology. 2015;69(3):457-471. doi:10.1007/s00248-014-0494-2. 31. Chehri, K. , B. Salleh, T. Yli-Mattila, M.J. Soleimani and A.R. Yousefi, 2010. Occurrence, Pathogenicity and Distribution of Fusarium spp. in Stored Wheat Seeds Kermanshah Province, Iran. Pakistan Journal of Biological Sciences, 13: 1178-1186 32. Coleman JJ, Daboussi MJ, Di Pietro A et al (2010) Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium. Nature 464(7287):367– 373. 33. Creekmore , Lynn H. Field Manual of Wildlife Diseases. Chapter 37 Mycotoxins 267 34. Dursun, Dilek M.D.; Fernandez, Viviana M.D.; Miller, Darlene M.S., M.P.H.; Alfonso, Eduardo C. Advanced Fusarium Keratitis Progressing to Endophthalmitis. Cornea: May 2003 - Volume 22 - Issue 4 - pp 300-303 35. Dylan P. G. Short,1* Kerry O’Donnell,2 Ning Zhang,3 Jean H. Juba,1 and David M. Geiser. Widespread Occurrence of Diverse Human Pathogenic Types ofthe Fungus Fusarium Detected in Plumbing Drains. JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 2011, p. 4264–4272 36. Dylan P.G. Short a,⇑, Kerry O’Donnell b, Ulf Thrane c, Kristian Fog Nielsen c, Ning Zhang d, Jean H. Juba a,David M. Geiser Phylogenetic relationships among members of the Fusarium solani speciescomplex in human infections and the descriptions of F. keratoplasticum sp. nov. and F. petroliphilum stat. nov.Fungal Genetics and Biology 53 (2013) 59–70 37. Emma T. Steenkamp, Brenda D. Wingfield, Teresa A. Coutinho, Kurt A. Zeller, Michael J. Wingfield, Walter F. O. Marasas, and John F. Leslie. PCRBased Identification of MAT-1 and MAT-2 in the Gibberella fujikuroiSpecies Complex. Appl Environ Microbiol. 2000 Oct; 66(10): 4378–4382. 38. Earl B. Ritchie; Mary E. Pinkerton. Fusarium Oxysporum Infection of the Nail. Report of Cases. AMA Arch Derm. 1959;79(6):705-708. 39. Ersal T, Al-Hatmi AS, Cilo BD, Curfs-Breuker I, Meis JF, Özkalemkaş F, Ener B, van Diepeningen AD. Fatal disseminated infection with Fusarium petroliphilum. Mycopathologia. 2015 Feb;179(1-2):119-24 40. Ferrer C, Alio J, Rodriguez A, Andreu M, Colom F. Endophthalmitis caused by Fusarium proliferatum. J Clin Microbiol. 2005 Oct;43(10):5372-5. 41. Freeman S1, Sharon M, Maymon M, Mendel Z, Protasov A, Aoki T, Eskalen A, O'Donnell K. Fusarium euwallaceae sp. nov.--a symbiotic fungus of Euwallacea sp., an invasive ambrosia beetle in Israel and California. Mycologia. 2013 Nov-Dec;105(6):1595-606. 42. Gale LR, Bryant JD, Calvo S, Giese H, Katan T, O'Donnell K, Suga H, Taga M, Usgaard TR, Ward TJ, Kistler HC..Chromosome Complement of the Fungal Plant Pathogen Fusarium Graminearum Based on Genetic and Physical Mapping and Cytological Observations.” Genetics 171.3 (2005): 985–1001. 43. Gaujoux, Thomas MD; Chatel, Marc Antoine MD; Chaumeil, Christine; Laroche, Laurent MD; Borderie, Vincent M . Outbreak of Contact LensRelated Fusarium Keratitis in France. Cornea:October 2008 - Volume 27 Issue 9 - pp 1018-1021 44. Geiser DM, Ivey ML, Hakiza G, Juba JH, Miller SA. Gibberella xylarioides (anamorph: Fusarium xylarioides), a causative agent of coffee wilt disease in 268 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. Africa, is a previously unrecognized member of the G. fujikuroi species complex. Mycologia. 2005 Jan-Feb;97(1):191-201. Gerda, F., E.T. Steenkamp , T.R. Gordon. and A. Viljoen . Evolutionary relationships among the vegetative compatibility groups of Fusarium oxysporum f.sp. cubense. Appl. Environ. Microbiol. doi:10.1128/AEM.0037009 Guarro , J. Fusariosis, a complex infection caused by a high diversity of fungal species refractory to treatment . Eur J Clin Microbiol Infect Dis. 2013 Dec;32(12):1491-500 Guarro J, Nucci M, Akiti T, Gené J, Barreiro MD, Gonçalves RT. Fungemia due to Fusarium sacchari in an immunosuppressed patient. J Clin Microbiol. 2000 Jan;38(1):419-21. Gugnani HC, Talwar RS, Njoku-Obi AN, Kodilinye HC. Mycotic keratitis in Nigeria. A study of 21 cases. Br J Ophthalmol. 1976 Sep;60(9):607-13. Harrow SA, Farrokhi-Nejad R, Pitman AR, Scott IA, Bentley A, Hide C, Cromey MG. Characterisation of New Zealand Fusarium populations using a polyphasic approach differentiates the F. avenaceum/F. acuminatum/F. tricinctum species complex in cereal and grassland systems. Fungal Biol. 2010 Apr;114(4):293-311. Heidy Abo El Yazeed; Atef Hassan; Reda E.A. Moghaieb, 1Mai Hamed and Mohamed Refai. Molecular Detection of Fumonisin-producing Fusarium Species in Animal Feeds Using Polymerase Chain Reaction (PCR). Journal of Applied Sciences Research,7(4): 420-427, 2011 Heidy Abo Al-Yazeed, Atef Hassan, Mahmoud EL-Hariri, Mai Hamed and Mohamed Refai (2010): Studies on Fusarium species and fumonisinsproducing isolates in horse’s feeds in Egypt.Mycotoxin Conference. NRC. Oct. 2010. HERNANDES, L; MARANGON, AV; SALCI, T and SVIDZINSKI, TIE. Toxic thermoresistant metabolites of Fusarium oxysporum are capable of inducing histopathological alterations in Wistar rats. J. Venom. Anim. Toxins incl. Trop. Dis[online]. 2012, vol.18, n.2 [cited 2015-04-02], pp. 144-149 . Herron, D. A.; Wingfield, M. J.; Wingfield, B. D.; Rodas, C. A.; Marincowitz, S.; Steenkamp, E. T. Novel taxa in the Fusarium fujikuroi species complex from Pinus spp. Studies in Mycology 2015 No. 80 pp. 131-150 Ingle, A. and Rai, M. (2011) Genetic diversity among Indian phytopathogenic isolates of Fusarium semitectum Berkeley and Ravenel. Advances in Bioscience and Biotechnology, 2, 142-148. doi:10.4236/abb.2011.23023. Jacobs A1, Van Wyk PS, Marasas WF, Wingfield BD, Wingfield MJ, Coutinho TA. Fusarium ananatum sp. nov. in the Gibberella fujikuroi 269 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67. 68. 69. species complex from pineapples with fruit rot in South Africa. Fungal Biol. 2010 Jul;114(7):515-27 Jandial S, Sumbali G. Fusarial onychomycosis among gardeners: A report of two cases. Indian J Dermatol Venereol Leprol 2012;78:229 Jian-Hua Wang, Mbacke Ndoye,1 Jing-Bo Zhang,1,2 He-Ping Li,1 and Yu-Cai Liao , Population Structure and Genetic Diversity of the Fusarium graminearumSpecies Complex. Toxins (Basel). 2011 Aug; 3(8): 1020–1037. Jima, T. A. PCR-based identification of Fusarium spp. and impact of wound healing time on dry rot infection, MS Thesis, 2012, Uppsala Jørgensen JS, Prause JU, Kiilgaard JF. Bilateral endogenous Fusarium solani endophthalmitis in a liver-transplanted patient: a case report. J Med Case Rep. 2014 Mar 24;8:101 Kawakami, A., Kato, N.,Sasaya, T., Tomioka, K.Inoue, H.,Miyasaka,A. and Hirayae,K.Gibberella ear rot of corn caused by Fusarium asiaticum in Japan. J.Gen. Plant Pathol.29 April, 2015 KONIETZNY, Ursula and GREINER, Ralf. The application of PCR in the detection of mycotoxigenic fungi in foods. Braz. J. Microbiol. [online]. 2003, vol.34, n.4 pp. 283-300 Kebabcı N, van Diepeningen AD, Ener B, Ersal T, Meijer M, Al-Hatmi AM, Ozkocaman V, Ursavaş A, Cetinoğlu ED, Akalın H. Fatal breakthrough infection with Fusarium andiyazi: new multi-resistant aetiological agent crossreacting with Aspergillus galactomannan enzyme immunoassay Mycoses. 2014 Apr;57(4):249-55. Kevin Bugg .Pathogen Profile : Fusarium virguliforme (a.k.a F. solani f. sp. glycines). PP728 Class Project Fall 2010. Khor W, Aung T, Saw S, et al. An Outbreak of Fusarium Keratitis Associated With Contact Lens Wear in Singapore. JAMA.2006;295(24):2867-2873. doi:10.1001/jama.295.24.2867. Khosrow Chehri & Baharuddin Salleh & Latiffah Zakaria. Morphological and Phylogenetic Analysis of Fusarium solani Species Complex in Malaysia. Microb Ecol (2015) 69:457–471 Kritika Vishwanath Singhal , Vikrant Saoji , Sandhya V Saoji. Fusarium skin infection: A case report. Dermatology Online Journal 18 (4): 6 ,2012 Kudur MH, Prakash P Y, Savitha M. Fusarium solani causing quasi-invasive infection of the foot in an immunocompetent middle-aged man from South India. Indian J Dermatol 2013;58:241 Lee KM, Yu J, Son M, Lee YW, Kim KH. Transmission of Fusarium boothii mycovirus via protoplast fusion causes hypovirulence in other 270 70. 71. 72. 73. 74. 75. 76. 77. 78. 79. 80. phytopathogenic fungi. PLoS One. 2011;6(6):e21629. doi: 10.1371/journal.pone.0021629. Epub 2011 Jun 29. Leslie JF, Summerell BA, Bullock S, Doe FJ. Description of Gibberella sacchari and neotypification of its anamorph Fusarium sacchari. Mycologia. 2005 May-Jun;97(3):718-24. Leslie JF Zeller KA, Logrieco A, Mulè G, Moretti A, Ritieni A. Species diversity of and toxin production by Gibberella fujikuroi species complex strains isolated from native prairie grasses in Kansas. Appl Environ Microbiol. 2004 Apr;70(4):2254-62. Li-Jun Ma, David M. Geiser, Robert H. Proctor, Alejandro P. Rooney, Kerry O’Donnell, Frances Trail, Donald M. Gardiner, John M. Manners, and Kemal Kazan. Fusarium Pathogenomics. Annu. Rev. Microbiol. 2013.67:399-416. Li-Jun Ma et al (2010): Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium.Nature 464, 367-373 Lima CS1, Pfenning LH, Costa SS, Abreu LM, Leslie JF. Fusarium tupiense sp. nov., a member of the Gibberella fujikuroi complex that causes mango malformation in Brazil. Mycologia. 2012 Nov-Dec;104(6):1408-19. Marcio Nucci and Elias Anaissie . Fusarium Infections in Immunocompromised Patients. Clin Microbiol Rev. 2007 Oct; 20(4): 695– 704. Marín P, Moretti A, Ritieni A, Jurado M, Vázquez C, González-Jaén MT. Phylogenetic analyses and toxigenic profiles of Fusarium equiseti and Fusarium acuminatum isolated from cereals from Southern Europe. Food Microbiol. 2012 Sep;31(2):229-37. Mesfin Bogale, Brenda D. Wingfield, Michael J. Wingfield and Emma T. Steenkamp. Species-specific primers for Fusarium redolens and a PCR-RFLP technique to distinguish among three clades ofFusarium oxysporum. FEMS Microbiology Letters 271, 1. 27 – 32 Mishra, Prashant K. , Roland T.V. Fox, Alastair Culham. Development of a PCR-based assay for rapid and reliable identi¢cation of pathogenic Fusaria FEMS Microbiology Letters 218 (2003) 329^332 Monds RD, Cromey MG, Lauren DR, di Menna M, Marshall J. Fusarium graminearum, F. cortaderiae and F. pseudograminearum in New Zealand: molecular phylogenetic analysis, mycotoxin chemotypes and co-existence of species. Mycol Res. 2005 Apr;109(Pt 4):410-20. Mustafa Özyurt, Nurittin Ardıç, Kadir Turan, Şenol Yıldız, Oğuz Özyaral, Uğur Demirpek, Tuncer Haznedaroğlu, Türkan YurdunTHE ISOLATION OF FUSARIUM SPOROTRICHIOIDES FROM A DIABETIC FOOT WOUND SAMPLE AND IDENTIFICATION Marmara Med. J. 21, 68-72, 2008 271 81. Nalim FA, Samuels GJ, Wijesundera RL, Geiser DM. New species from the Fusarium solani species complex derived from perithecia and soil in the old World tropics. Mycologia. 2011 Nov-Dec;103(6):1302-30. 82. O'Donnell & T. Aoki. Fusarium virguliforme Mycologia 95 (4): 667 (2003) [MB#489315] 83. O'Donnell, K., E Cigelnik, HI Nirenberg. Molecular systematics and phylogeography of the Gibberella fujikuroi species complex. Mycologia, 90(3), 1998, pp. 465-493 84. O'Donnell K1, Sutton DA, Fothergill A, McCarthy D, Rinaldi MG, Brandt ME, Zhang N, Geiser DM. Molecular phylogenetic diversity, multilocus haplotype nomenclature, and in vitro antifungal resistance within the Fusarium solani species complex. J Clin Microbiol. 2008 Aug;46(8):2477-90. 85. O'Donnell K, Sutton DA, Rinaldi MG, Gueidan C, Crous PW, Geiser DM. Novel multilocus sequence typing scheme reveals high genetic diversity of human pathogenic members of the Fusarium incarnatum-F. equiseti and F. chlamydosporum species complexes within the United States. J Clin Microbiol. 2009 Dec;47(12):3851-61 86. O'Donnell K, Ward TJ, Geiser DM, Corby Kistler H, Aoki T. Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genet Biol. 2004 Jun;41(6):600-23. 87. Oechsler RA1, Feilmeier MR, Ledee DR, Miller D, Diaz MR, Fini ME, Fell JW, Alfonso EC. Utility of molecular sequence analysis of the ITS rRNA region for identification of Fusarium spp. from ocular sources. Invest Ophthalmol Vis Sci. 2009 May;50(5):2230-6. 88. Pai R, Boloor R, Shreevidya K, Shenoy D. Fusarium solani: An Emerging Fungus in Chronic Diabetic Ulcer. J Lab Physicians. 2010 Jan;2(1):37-9. doi: 10.4103/0974-2727.66710. 89. Pérez-Balbuena, Ana Lilia MD; Vanzzini-Rosano, Virginia QFB; ValadézVirgen, José de Jesús MD; Campos-Möller, Xavier MD. Fusarium Keratitis in Mexico. Med Mycol. 2008 Aug;46(5):397-410. doi: 10.1080/13693780801961352. Epub 2008 Apr 4. 90. Peterson A, Pham MH, Lee B, Commins D, Cadden J, Giannotta SL, Zada G. Intracranial Fusarium Fungal Abscess in an Immunocompetent Patient: Case Report and Review of the Literature. Journal of Neurological Surgery Reports Vol. 75 No. R2/2014 91. Samuel M. Imathiu, Simon G. Edwards, Rumiana V. Ray, Matthew A. Back. Fusarium langsethiae – a HT-2 and T-2 Toxins Producer that Needs More Attention/Journal of Phytopathology 161, 1, 1–10, 2013 272 92. Saremi, H., A. Ammarellou and H. Jafary,, 2007. Incidence of crown rot disease of wheat caused by Fusarium pseudograminearum as a new soil born fungal species in North West Iran.. Pak. J. Biol. Sci., 10: 3606-3612. 93. Sarver BA1, Ward TJ, Gale LR, Broz K, Kistler HC, Aoki T, Nicholson P, Carter J, O'Donnell K. Novel Fusarium head blight pathogens from Nepal and Louisiana revealed by multilocus genealogical concordance. Fungal Genet Biol. 2011 Dec;48(12):1096-107. 94. Saw S, Ooi P, Tan DH, et al. Risk Factors for Contact Lens–Related Fusarium Keratitis: A Case-Control Study in Singapore. Arch Ophthalmol. 2007;125(5):611-617. doi:10.1001/archopht.125.5.611. 95. Scauflaire J, Gourgue M, Munaut F. Fusarium temperatum sp. nov. from maize, an emergent species closely related to Fusarium subglutinans. Mycologia. 2011 May-Jun;103(3):586-97. 96. Short DP, O'Donnell K, Zhang N, Juba JH, Geiser DM. Widespread occurrence of diverse human pathogenic types of the fungus Fusarium detected in plumbing drains. J Clin Microbiol. 2011 Dec;49(12):4264-72. 97. Short DP1, O'Donnell K, Thrane U, Nielsen KF, Zhang N, Juba JH, Geiser DM. Phylogenetic relationships among members of the Fusarium solani species complex in human infections and the descriptions of F. keratoplasticum sp. nov. and F. petroliphilum stat. nov. Fungal Genet Biol. 2013 Apr;53:59-70 98. Schroers HJ1, Baayen RP, Meffert JP, de Gruyter J, Hooftman M, O'Donnell K. Fusarium foetens, a new species pathogenic to begonia elatior hybrids (Begonia x hiemalis) and the sister taxon of the Fusarium oxysporum species complex. Mycologia. 2004 Mar-Apr;96(2):393-406. 99. Schroers HJ, O'Donnell K, Lamprecht SC, Kammeyer PL, Johnson S, Sutton DA, Rinaldi MG, Geiser DM, Summerbell RC. Taxonomy and phylogeny of the Fusarium dimerum species group. Mycologia. 2009 Jan-Feb;101(1):44-70. 100. Starkey David E. , Todd J. Ward , Takayuki Aoki , Liane R. Gale , H. Corby Kistler David M. Geiser , Haruhisa Suga , Bea´ta To´th , Ja´nos Varga , Kerry O’Donnell.. Global molecular surveillance reveals novel Fusarium head blight species and trichothecene toxin diversity Fungal Genetics and Biology 44 (2007) 1191–1204 101. Taj-Aldeen SJ1, Gene J, Al Bozom I, Buzina W, Cano JF, Guarro J. Gangrenous necrosis of the diabetic foot caused by Fusarium acutatum. Med Mycol. 2006 Sep;44(6):547-52. 102. Tóth, B. Varga, Starkey, O'Donnell, H. Suga & T. Aoki, Fusarium vorosii Fungal Genetics & Biology 44 (11): 1191-1204 (2007) 273 103. Torp & Nirenberg. Fusarium langsethiae International Journal of Food Microbiology 95 (3): 248 (2004) 104. Treikale O, Priekule I, Javoisha B, Lazareva L. Fusarium head blight: distribution in wheat in Latvia. Commun Agric Appl Biol Sci. 2010;75(4):627-34. 105. Van der Lee T, Zhang H, van Diepeningen A, Waalwijk C. Biogeography ofFusarium graminearum species complex and chemotypes: a review. Food Additives & Contaminants Part A, Chemistry, Analysis, Control, Exposure & Risk Assessment. 2015;32(4):453-460. doi:10.1080/19440049.2014.984244. 106. Van Hove F, Waalwijk C, Logrieco A, Munaut F, Moretti A. Gibberella musae (Fusarium musae) sp. nov., a recently discovered species from banana is sister to F. verticillioides. Mycologia. 2011 MayJun;103(3):570-85. 107. Vania O. Carvalho , Vania A. Vicente, Betina Werner, Renata R. Gomes, Gheniffer Fornari,Patricia F. Herkert, Cristina O. Rodrigues, Kerstin T. Abagge, Renata Robl, Ricardo H Camiña Onychomycosis by Fusarium oxysporum probably acquired in utero. Medical Mycology Case Reports. Volume 6, October–December 2014, Pages 58–61 108. Yang, L., van der Lee, T., Yang, X., Yu, D., Waalwijk, C., 2008. Fusarium populations on Chinese barley show a dramatic gradient in mycotoxin profiles. Phytopathology 98, 719–727 109. Yli-Mattila T1, Gagkaeva T, Ward TJ, Aoki T, Kistler HC, O'Donnell K. A novel Asian clade within the Fusarium graminearum species complex includes a newly discovered cereal head blight pathogen from the Russian Far East. Mycologia. 2009 Nov-Dec;101(6):841-52. 110. Yli-Mattila T Gagkaeva T, Ward TJ, Aoki T, Kistler HC, O'Donnell K. A novel Asian clade within the Fusarium graminearum species complex includes a newly discovered cereal head blight pathogen from the Russian Far East. Mycologia. 2009 Nov-Dec;101(6):841-52. 111. Yli-Mattila T, Ward TJ, O'Donnell K, Proctor RH, Burkin AA, Kononenko GP, Gavrilova OP, Aoki T, McCormick SP, Gagkaeva TY. Fusarium sibiricum, Int J Food Microbiol. 2011 112. Wang C, Lin Y, Lin Y, Chung W (2014) Correction: Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan. PLoS ONE 9(1): 2013 274 113. Zhao ZH, Lu GZ. Fusarium sinensis sp. nov., a new species from wheat in China. Mycologia. 2008 Sep-Oct;100(5):746-51. 275

RELATED PAPERS

RELATED TOPICS

Log In

Monograph on the genus Fusarium

Monograph on the genus Fusarium

Related Papers

RELATED PAPERS

RELATED TOPICS