Mycol Progress (2011) 10:389–398 DOI 10.1007/s11557-010-0701-6 REVIEW Three new species of Lentinus from northern Thailand Samantha C. Karunarathna & Zhu L. Yang & Rui-Lin Zhao & Else C. Vellinga & A. H. Bahkali & Ekachai Chukeatirote & Kevin D. Hyde Received: 15 June 2010 / Revised: 22 July 2010 / Accepted: 23 July 2010 / Published online: 12 August 2010 # The Author(s) 2010. This article is published with open access at Springerlink.com Abstract There have been few studies on the taxonomy and biodiversity of the genus Lentinus in Thailand, which is a genus of edible mushrooms. Recently, collections from 17 sites in northern Thailand yielded 47 specimens of Lentinus sensu lato. Three were shown to be new species of Lentinus sensu stricto and Lentinus roseus, L. concentricus and L. megacystidiatus are introduced in this paper. The new species are described and illustrated with line drawings and are justified and compared with similar taxa. Furthermore, ITS sequence data do not match closely with any species presently lodged in GenBank. Keywords Biodiversity . Edible fungi . Taxonomy . Tropical fungi Introduction Tropical regions have the potential to be one of the richest sources of fungal species, and Thailand is no exception. The macrofungi of the Mushroom Research Centre and surrounding areas in northern Thailand are presently being studied (Le et al. 2007; Sanmee et al. 2008; Kerekes and Taxonomic novelties Lentinus roseus Karunarathna, K.D. Hyde & Zhu L. Yang, sp. nov. Lentinus megacystidiatus Karunarathna, K.D. Hyde & Zhu L. Yang, sp. nov. Lentinus concentricus Karunarathna, K.D. Hyde & Zhu L. Yang, sp. nov. S. C. Karunarathna : K. D. Hyde International Fungal Research & Development Centre, The Research Institute of Resource Insects, Chinese Academy of Forestry, Kunming 650034, China Z. L. Yang (*) Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650204, China e-mail: fungiamanita@gmail.com S. C. Karunarathna : E. Chukeatirote : K. D. Hyde School of Science, Mae Fah Luang University 333 Moo1, Tasud, Muang, Chiang Rai 57100, Thailand S. C. Karunarathna : K. D. Hyde Mushroom Research Foundation, 128 M.3 Ban Pa Deng T. Pa Pae, A. Mae Taeng, Chiang Mai 50150, Thailand R.-L. Zhao Key Laboratory of Forest Disaster Warning and Control in Yunnan Province, Faculty of Biology Conservation, Southwest Forestry University, Bailongsi, Kunming 650224, China E. C. Vellinga Department of Plant and Microbial Biology, University of California, Berkeley, CA 94720-3102, USA A. H. Bahkali : K. D. Hyde Botany and Microbiology Department, College of Science, King Saud University, Riyadh, Saudi Arabia 390 Desjardin 2009; Wannathes et al. 2009a, b). Lentinus (Fr.) Quel’ is a cosmopolitan genus with an estimated 63 species (Kirk et al. 2008) which are able to survive over a wide temperature range, are abundant in the tropics, and are frequently found in temperate regions (Pegler 1983). Species of Lentinus are normally wood-decaying basidiomycetes and have decurrent lamellae, dimitic tissues in the basidiome, and hyaline, ellipsoid to cylindric spores. Species in the subgenus Lentinus have hyphal pegs (Corner 1981; Pegler 1983). Generally, the basidiomes are xeromorphic with a tough, firm texture when dry and have a long life span, but in Thailand they fruit only early in the summer rainy season (Sysouphanthong et al. 2010). Traditionally, Lentinus has been placed in the agaric family Tricholomataceae because species possess a lamellate hymenophore and white spore print (e.g., Miller 1973). A close relationship has long been observed between Lentinus and certain polypores (Corner 1981; Pegler 1983; Singer 1986). Lentinus has been grouped under the family Polyporaceae based on the presence of dimitic and amphimitic hyphal systems (Moser 1978; Kühner 1980; Pegler 1983; Singer 1986). Moreover, hyphal pegs, fascicles of sterile hyphae coming out from the hymenium surface, are some of the common features present in some genera of the Polyporaceae and in Lentinus subg. Lentinus (Pegler 1983; Corner 1981). Recent research (e.g., Redhead and Ginns 1985; Hibbett and Vilgalys 1991, 1993; Hibbett and Thorn 1994; Hibbett et al. 1993) has elucidated the Lentinus–Pleurotus–Panus complex; it has shown that Lentinus sensu Pegler is polyphyletic, with Lentinus subg. Lentinus sensu Pegler monophyletic and belonging to the Polyporales (Hibbett and Vilgalys 1991; Kruger and Gargas 2004). Panus Fr., Pleurotus Fr., and Neolentinus Redhead & Ginns are also monophyletic, with Pleurotus belonging to the Agaricales (Fleming 1994; Hibbett and Thorn 1994). These genera have been treated differently by Corner (1981), Kühner (1980), Pegler (1975, 1983) and Singer (1986). Two brown rot genera, Neolentinus Redhead & Ginns, and Heliocybe Redhead & Ginns, were separated from Lentinus which otherwise comprises white rot species (Gilbertson 1980; Redhead and Ginns 1985). Here, Lentinus will be used to mean Lentinus subg. Lentinus sensu Pegler (1983), which is essentially equivalent to Lentinus sensu Corner (1981). Molecular studies support the view that Lentinus is derived from the Polyporales (Pegler 1983) and suggest that Polyporus arcularius Batsch : Fr. is a closely related outgroup (Hibbett and Vilgalys 1991, 1993). Panus sensu stricto is characterized by the skeletal hyphae, the radial trama, and the purplish pigment of the young basidiomes but absence of metuloides and gloeocystidia are an abnormal feature. Species of Lentinus sensu lato are found on fallen tree trunks and decaying timber. Mycol Progress (2011) 10:389–398 Thailand is rich in species of Lentinus (e.g., L. badius (Berk.) Berk., L. squarrosulus Mont.,L. polychrous Lev., L. cladopus Lev., L. strigosus (Schwein.) Fr., L. velutinus Fr., L. similis Berk. & Broome and L. connatus Berk.) based on the records by Pegler (1983), but no systematic study of the genus has been undertaken so far. Wild mushrooms are one of the higher valued nontimber forest products in northern Thailand. They provide locals with seasonal food, medicine and an alternative income (Sysouphanthong et al. 2010). The richness of wild mushrooms is also one bio-indicator of ecosystem health. The cultivated, non-mycorrhizal mushrooms, such as Agaricus spp., Auricularia spp., Lentinula edodes, Pleurotus sajor-caju (Fr.) Singer, Pleurotus spp., and Volvariella spp. are available throughout the year in markets of northern Thailand; however, edible wild mushrooms can only be found in the wet season from June to September (Sysouphanthong et al. 2010). In Lentinus, almost all the members are edible except those which have a tough texture. It is therefore important to try to introduce members of this genus as commercial species. Although there are many studies on cultivated and wild edible mushrooms in the northern hemisphere and their nutritional value (Aletor 1995; Latiff et al. 1996; Manzi et al. 1999, 2001; Demirbas 2000), there is little information available concerning the taxonomy, biodiversity and potential to introduce Lentinus species from northern Thailand for cultivation. Scientific information on wild mushrooms is essential for the introduction of new species for the table. As part of a study to assess the biodiversity, taxonomy and potential for cultivation of Lentinus species in northern Thailand, we discovered three new species. The objective of this paper is to introduce these three new species. Materials and methods Sample collection Sites in northern Thailand were in Chiang Mai and Chiang Rai Provinces and are listed with details in Table 1. Morphological character examination Macro-morphological characters were described based on fresh material, and documented by photographs. Color designations (e.g., 4B5) are from Kornerup and Wanscher (1978), while the color names with the first letters capitalized (e.g., Grayish yellow) are from Ridgeway (1912). Specimens were dried and placed in plastic bags separately, and then deposited in the Herbarium of Mae Fah Luang University (MFLU). For micro-morphological examination, sections were cut with a razor blade from Mycol Progress (2011) 10:389–398 391 Table 1 Lentinus species from Thailand No. List of species Collection site 1 2 3 4 5 6 7 8 Lentinus badius (Berk.) Berk. L. squarrosulus Mont. L. polychrous Lev. L. cladopus Lev. L. tigrinus (Bull.: Fr.) Fr. L. megacystidiatus sp. nov. L. concenticus sp. nov. L. roseus sp. nov. DCD; Pegler 1983 KL; Pegler 1983 BU; Pegler 1983, SE; Pegler 1983, KKC; Pegler 1983, ST; Pegler 1983 CL; Pegler 1983, CCM; Pegler 1983 HWY; this paper, PT; this paper, MS; this paper PT; this paper MRC; this paper HS; this paper, KK; this paper DCD Doi Chiang Dao Nat. Park; KL Bangkok, Puckdeedindan; Khao Luon; BU Bung; SE Seiracha; KKC Khao Kai Chiang; ST Sri-tan; CL Cangwat Lamphun; CCM Cangwat Chiang Mai MRC THAILAND, Chiang Mai Province, Mae Taeng District, Ban Pha Deng, Mushroom Research Centre, 19°17.123′N, 98°44. 009′E, elevation 900 m, rainforest dominated by Castanopsis armata, Erythrina sp, and Dipterocarpus sp. PT THAILAND, Chiang Mai Province., Mae Taeng District, Ban Pha Deng, Pathummikaram Temple, forest trail, 19°06.288′N, 98°44.47.3′E, elevation 1,050 m, rainforest dominated by Castanopsis armata, and Dipterocarpus sp. HWY THAILAND, Chiang Mai Province, Mae Teng District, Highway 1095 at 22 km marker, 19°07.57′N, 98°45.65′E, elevation 750 m, xeric broad-leaf forest (Dipterocarpus spp. + Tectona grandis) with Pinus kesiya. MS THAILAND, Chiang Mai Province, Mae Taeng, Ban Mae Sae village, on Highway 1095 near 50 km marker, 19°14.599′N, 98°39.456′E, elevation 962 m, rainforest dominated by Castanopsis armata, Castanopsis sp., Pinus sp., Lithocarpus sp. HS THAILAND, Chiang Mai Province, Mae Taeng District, Hot Spring National Park, Pong Duad Pa Pae 40 kms off Chiangmai. 35 kms from the Highway Route No 1095: Mae Malai-Pai and turn right for 6.5 kms, humid montane rainforest with Quercus, Castanopsis, Lithocarpus echinops. KK THAILAND, Chiang Rai Province, Tambon Mae Korn and Tambon Huay Chompoo, Muang District, Khun Korn Waterfall, 19°51–54′N, 99°35.39′E, elevation 1,208 m, moist upper mixed deciduous forest (Royal Forest Department, 1962). MFLU THAILAND, Chiang Rai Province, Thasud, Muang District, Mae Fah Luang University park, 18°05′59.1″N, 102°40′02.9″E, elevation 488 m, dominated by Dipterocarpus sp., Ficus sp., and Tabebuia chrysantha. dried specimens and mounted on slides in 5% KOH and Congo red, and then observed, measured and illustrated under a compound microscope (Zeiss Axioskop 40, Germany). In the description of the basidiospores: n indicates the number of spores which were measured; Lm is the mean spore length over a population of spores; Wm the mean spore width over a population of spores; Q the length/width ratio (L/W) of a spore in side view; Q the average Q of all spores measured. 94C° for 1 min, 52C° for 50 s and 72C° for 1 min, with a final extension step of 72C° for 10 min. The PCR products were verified by staining with ethidium bromide on 1% agarose electrophoresis gels stained with ethidium bromide in 1×Tris-boric acid EDTA buffer. ITS 1 and ITS 4 were used to sequence both strands of the DNA molecules at the International Fungal Research and Development Centre, and The Research Institute of Resource Insects, the Chinese Academy of Forestry, China. DNA extraction, PCR and sequencing Phylogenetic analysis Dried mushroom samples were used to extract genomic DNA. Genomic DNA was extracted using a Biospin Fungus Genomic DNA Extraction Kit (Bio Flux) according to the instructions of the manufacturer. DNA concentrations were estimated visually in agarose gel by comparing band intensity with a DNA ladder 1,000 bp (Transgen Biotech). The PCR reactions were performed in a 50 μl volume (0.3 mM primers (ITS1:5′TCC GTA GGT GAA CCTTGC GG 3′) and ITS4:5′TCCTCCGCTTATTGATATGC3′(White et al. 1990); 10–20 ng DNA template, 1×buffer, 0.2 mM dNTPs, 1.5 units Taq and sterile water). The thermal cycles consisted of 94C° for 3 min, followed by 30–35 cycles at The taxa information and GenBank accession numbers in molecular work are listed in Table 2. Sequences for each strain were aligned using Clustal X (Thompson et al. 1997). Alignments were manually adjusted to allow maximum sequence similarity. Gaps were treated as missing data. Phylogenetic analysis were performed using PAUP* 4.0b10 (Swofford 1998). Ambiguously aligned regions were excluded from all analyses. Trees were inferred using the heuristic search option with TBR branch swapping and 1,000 random sequence additions. Maxtrees were unlimited, branches of zero length were collapsed and all multiple parsimonious trees were saved. Clade stability of the trees resulting from the 392 Table 2 Taxon information and GenBank accession numbers in molecular work Mycol Progress (2011) 10:389–398 Resource and herbarium accession number Pleurotus ostreatus Lentinus squarrosulus GenBank GenBank EU520193 (Unpublished data) GQ849475 (Unpublished data) Lentinus squarrosulus Lentinus tigrinus Lentinus tigrinus Lentinus tigrinus Lentinus tigrinus Lentinus tigrinus Lentinus tigrinus Lentinus tigrinus Lentinus tigrinus Lentinus tigrinus Lentinus tigrinus Lentinus polychrous L. concentricus sp. nov. L. megacystidiatus sp. nov. Polyporus lepideus Polyporus tricholoma Polyporus squamosus GenBank GenBank GenBank GenBank GenBank GenBank GenBank GenBank GenBank GenBank GenBank GenBank MFLU08 1375 MFLU08 1388 GenBank GenBank GenBank AB478883 (Sotome et al. 2009) GQ849476 (Unpublished data) FJ755219 (Unpublished data) EU543989 (Unpublished data) DQ056860 (Unpublished data) AF516521 (Krueger 2002) AF516520 (Krueger 2002) AF516519 (Krueger 2002) AF516518 (Krueger 2002) AF516517 (Krueger 2002) AY218419 (Unpublished data) AB478882 (Sotome et al. 2009) (new sequence in this study) (new sequence in this study) GU731572 (Unpublished data) AF518753 (Krueger 2002) DQ267123 (Unpublished data) parsimony analyses were assessed by bootstrap analysis with 1,000 replicates, each with 10 replicates of random stepwise addition of taxa (Felsenstein 1985). Trees were figured in Treeview. DNA extract material GenBank accession numbers (ITS) Taxa Dried sample Dried sample echinops, 05 July 2008, Samantha C. Karunarathna (MFLU08 1376). Etymology roseus, in reference to the rose color of the mature fruiting body. Taxonomy 1. Lentinus roseus Karunarathna, K.D. Hyde & Zhu L. Yang, sp. nov. (Figs. 1a–f and 2b) MycoBank: 518240 Pileus 5–5.5 cm latus, coriaceus, profunde cyathiformis, centro pallide alboluteolo, marginem versus fuscatum ipsum pallide roseum, siccus, estriatus, ezonatus. Lamellae profunde decurrentes, lamellulis 5 seriebus. Stipes 1.5– 2 cm longus, 0.5–0.7 cm latus, centralis fusiformis. Basidiosporae 5–7(9) μm longae 3–4(6) μm, latae ellipsoideae ad elongatae. Basidia 18–24 μm longa, 5–7 μm lata, anguste clavata, sterigmatibus 4. Cheilocystidia 19–37 μm longa, 5.5–8 μm lata clavata, hyalina, parietate tenui. Metuloids 36–45(60) μm longa, 9–15 μm lata, clavata, hyalina, apice late rotundato. Holotype THAILAND, Chiang Mai Province, Mae Taeng District, Hot Spring National Park, Pong Duad Pa Pae, 40 kms off Chiangmai, 35 kms from the Highway Route No 1095: Mae Malai-Pai and turn right for 6.5 kms, humid montane rainforest with Quercus, Castanopsis, Lithocarpus Description Basidiomes relatively small (Fig. 2b). Pileus 5–5.5 cm in diameter, leathery, deeply cyathiform, when seen from above rounded flabelliform; margin eroded; surface pale yellow cream (4A3) at centre, darker towards margin and there reddish grey (11B2), not changing on bruising, dry, neither striate nor zonate. Lamellae deeply decurrent, with 5 tiers of lamellulae, 0.5 mm wide, reddish grey (11B2) close to pileus margin, pale yellow cream (4A3), towards stipe in old and young specimens, with entire edge. Stipe 1.5–2×0.5–0.7 cm, central, 1.5–2×5 mm at apex, expanding towards base 1.5–2×7 mm attached to a discoid base, solid, fusiform, yellowish white (4A2), floccose, leathery, solid, with white cottony context. Generative hyphae (Fig. 1f) 4–5 μm diameter, inflated with a slightly thickened wall, more or less radially parallel but frequently branching and with large clamp connections. Skeletal hyphae (Fig. 1e) 5–6 μm in diameter, hyaline, very thick walled with only a very narrow lumen, typically unbranched. Basidiospores (Fig. 1a) 5–7(−9)×3–4 (−6) μm (n=40, Lm =5.93 μm, Wm = 3.72 μm, Q=1.36–1.85, Q=1.59), ellipsoid to elongate, occasionally broadly ellipsoid or rarely subglobose, hyaline, thin walled, with few contents. Basidia (Fig. 1c) 18–24×5– 7 μm, elongate clavate, bearing 4 sterigmata. Cheilocystidia Mycol Progress (2011) 10:389–398 393 pink pileus, large, clavate metuloids mostly with a broad rounded apex, ellipsoid to elongate basidiospores with a hyaline thin wall, a dimitic hyphal system with very thick walled unbranched skeletal hyphae. In many aspects, it bears superficial resemblance to Lentinus sajor-caju (Fr.) Singer. Lentinus sajor-caju (Fr.) Singer, however, has larger basidiomes with a whitish cream to mottled gray pileus, an annulate stipe and relatively narrower basidiospores. Lentinus roseus also bears superficial resemblance with L. strigosus (Schwein.) Fr. and L. torulosus (Pers.: Fr.) Lloyd. Lentinus strigosus differs from Lentinus roseus in having whitish to pallid ochraceous, more brownish basidiomes, and the pileipellis is a trichodermial epicutis, whereas L. roseus has characteristic rose basidiomes and the pileipellis is not a trichodermial epicutis. Lentinus torulosus differs from L. roseus in having narrowly clavate pleurocystidia with an obtusely rounded apex, whereas L. roseus lacks pleurocystidia (Corner 1981; Pegler 1983). Lentinus roseus forms clusters of basidiomes on dead and decaying wood. Initially, the young fruiting bodies are whitish pink, and they become pink with maturity. 2. Lentinus megacystidiatus Karunarathna, K.D. Hyde & Zhu L. Yang, sp. nov. (Figs. 2c–d and 3a–g) MycoBank: 518277 Fig. 1 Lentinus roseus (MFLU08 1376) a Basidiospores, b cheilocystidia, c basidia, d metuloids, e skeletal hyphae, f generative hyphae. Scale bars (a–d) 20 μm, (e,f) 10 μm (Fig. 1b) 19–37×5.5–8 μm, clavate, hyaline, thin walled. Metuloids (Fig. 1d) abundant to occasional on both sides and edges of the lamellae, 36–45(−60)×9–15 μm, mostly clavate with a broadly rounded apex, thick walled, hyaline. Clamp connections are prominent in generative hyphae. Habitat Clustered on rotten wood, in a forest with Quercus, Castanopsis and Lithocarpus echinops and in moist upper mixed deciduous forest Additional specimen examined THAILAND, Chiang Rai Province, Tambon Mae Korn and Tambon Huay Chompoo, Muang District, Khun Korn Waterfall, 19°51–54′N, 99° 35.39′E, elevation 1,208 m, moist upper mixed deciduous forest (Royal forest Department, 1962), 22 July 2009, Sam T-09 (MFLU10 0145). Distribution Only known from northern Thailand. Notes This new species is distinguished by its relatively small basidiomes with a leathery, deeply cyathiform and Pileus 0.6–2 cm latus, tenuis, convexus, coriaceus, umbilicatus ad infundibuliformis. Lamellae arcuatae, profunde decurrentes confertae. Stipes centralis, rarissime lateralis, cylindricus. Basidiosporae 6–8 μm longae, 3–4 μm latae, ellipsoideae ad cylindricae. Basidia 18–24 μm longa, 5–7 μm lata clavata, sterigmatibus 4. Cheilocystidia 19–35 μm longa, 4–6.5 μm lata, inflate clavata. Sclerocystidia dispersa 37– 52 μm longa, 10–16 μm lata pariete incrassato (ad 3 μm), hyalino vel pallide brunneo. Holotype THAILAND, Chiang Mai Province, Mae Taeng District, Ban Pha Deng Village, Pathummikaram Temple, forest trail, 19°06.288′N, 98°44.473′E, elevation 1050 m., rainforest dominated by Castanopsis armata and Dipterocarpus sp., 15 July 2008, Samantha C. Karunarathna (MFLU08 1388) Etymology megacystidiatus, in reference to the very large sclerocystidia of the taxon. Description Basidiomes very small (Figs. 2c–d). Pileus 0.6–2 cm in diameter, thin, convex, coriaceous, umbilicate to infundibuliform; margin inflexed, entire, thin at first reflexed, involute at maturity; surface grayish orange (5B4), dry, uniformly velutinous to slightly long-hispid or subsquamulose furfuraceous, zonate, densely ciliate; hairs dark 394 Mycol Progress (2011) 10:389–398 Fig. 2 a Basidiomes of Lentinus concentricus (MFLU08 1375), b basidiomes of L. roseus (MFLU08 1376), c,d basidiomes of L. megacystidiatus (MFLU08 1388). Scale bars (b) 50 mm, (c,d) 30 mm brown (6F7). Lamellae arcuate, deeply decurrent, up to 0.25 mm wide, crowded with 6 tiers of lamellulae, grayish orange (5B4), with entire edge. Stipe 0.2–1.4 cm×2–4 mm, central, excentric, rarely lateral, cylindrical, slender, solid, yellowish brown (5E8), uniformly and persistently velutinous, with dark brown (6F7) hairs; context 2–3 mm, white in color, consisting of a dimitic hyphal system with generative and skeletal hyphae. Generative hyphae 5– 6 μm diameter, hyaline, very thin walled, frequently branched, with prominent clamp connexions. Skeletal hyphae 9–10 μm diameter, hyaline with a thickened wall, unbranched or with an occasional short, lateral branch, either terminal or intercalary in origin. Basidiospores (Fig. 3a) 6–8 × 3–4 μm (n = 40, Lm = 6.37 μm, Wm = 3.6 μm, Q=1.50–2.16, Q=1.76), ellipsoid to cylindrical, occasionally broadly ellipsoid or even subglobose, hyaline, thin walled, with few contents. Basidia (Fig. 3b) 18–24×5– 7 μm, clavate, bearing 4 sterigmata. Cheilocystidia (Fig. 3d) 19–35×4–6.5 μm, narrowly clavate, to utriform, hyaline, thin-walled with some contents. Sclerocystidia (Fig. 3c) scattered, 37–52×10–16 μm, with a thickened, hyaline or pale brown wall up to 3 μm thick. Hairs on the pileus (Fig. 3e) dense, 8–10 μm in diameter, with a thickened pale brown wall up to 4 μm thick. Clamp connections are prominent in generative hyphae. Habitat On dead wood, in clusters, in rainforest dominated by Castanopsis armata, Dipterocarpus sp., Ficus sp. and Tabebuia chrysantha. Additional specimen examined THAILAND, Chiang Rai Province., Thasud, Muang Dist., Mae Fah Luang University Park, 18°05′59.1″N, 102°40′02.9″E, elevation 488 m., dominated by Dipterocarpus sp., Ficus sp., and Tabebuia chrysantha. 18 June 2009, BJP 021 (MFLU10 0151). Distribution Only known from northern Thailand. Notes This new species is characterized by its small, grayish orange basidiomes and very large, 37–52×10– 16 μm, scattered, clavate sclerocystidia with a broadly rounded apex. In some aspects Lentinus megacystidiatus bears superficial resemblance to L. strigosus (Schwein.) Fr. but L. strigosus differs in having pallid ochraceous to brownish basidiomes and cylindric, subclavate or subventricose metuloids with an obtusely rounded apex (Corner 1981; Pegler 1983). Lentinus megacystidiatus also bears superficial resemblance to L. torulosus (Pers.: Fr.) Lloyd, which has very large, clavate cheilocystidia, 24–60× 7–16 μm, whereas L. megacystidiatus has moderate sized (19–35×4–6.5 μm), narrowly clavate, cheilocystidia (Corner Mycol Progress (2011) 10:389–398 395 17.123′N, 98°44.009′E, elevation 900 m, rainforest dominated by Castanopsis armata, Erythrina sp, and Dipterocarpus sp., 15 July 2008, Samantha C. Karunarathna (MFLU08 1375) Etymology concentricus, in reference to the prominent concentric zonations on the pileus surface. Description Basidiomes medium-sized to large (Fig. 2a). Pileus 6.5–7 cm in diameter, thin, with deeply umbilicate centre, when seen from above circular, yellowish brownclay (5D5) at margin, yellowish brown (5E8) towards centre, surface from centre to margin velvety, soft, concentrically zonate, with brownish grey (6F8) hairs at margin; hairs grayish orange (5B4) towards centre. Lamellae deeply decurrent, 0.5 mm broad, with 5 tiers of lamellulae, pompeian yellow (5C6) when young and old, with entire edge. Stipe 4–4.5×5–6 mm, cylindric, solid, leathery, dry, yellowish brown-clay (5D5) when young, raw umber (5F8) when old, surface velvety/velutinous, short/soft hairs; brownish grey color (6F8); with white context up to 2 mm thick at the disk, consisting of a dimitic hyphal systems with skeletal hyphae Fig. 3 Lentinus megacystidiatus (MFLU08 1388). a Spores, b basidia, c sclerocystidia, d cheilocystidia, e hairs on the pileus, f skeletal hyphae, g generative hyphae. Scale bars (a–d) 20 μm, (e–g) 10 μm 1981; Pegler 1983). Lentinus megacystidiatus forms clusters of basidiomes on dead and decaying wood. 3. Lentinus concentricus Karunarathna, K.D. Hyde & Zhu L. Yang, sp. nov. (Figs. 2a and 4a–e) MycoBank: 518249 Pileus 6.5–7 cm diam., tenuis, centro profunde umbilicatus, velutinus, mollis, zonatus. Lamellae profunde decurrentes, lamellulis 5 seriebus confertis. Stipes 4–4.5 mm longus, 5–6 mm latus, cylindricus. Basidiosporae 5–7 μm longae, 2.5–4 μm latae ellipsoideae ad cylindricae. Basidia 19–25 μm longa, 5–6.5 μm lata, sterigmatibus 4. Cheilocystidia 20– 30 μm longa, 5–7 μm lata, anguste clavata, aliquot appendicibus apicalibus (10–12 μm longis), hyalina, parietate tenui. Pagina pilei pilis 5–5.5 μm diam. Holotype THAILAND, Chiang Mai Province, Mae Taeng District, Ban Pha Deng, Mushroom Research Centre, 19° Fig. 4 Lentinus concentricus (MFLU08 1375). a Spores, b cheilocystidia, c basidia, d generative hyphae and skeletal hyphae, e hairs on the pileus. Scale bars (a–c) 20 μm, (d,e) 10 μm 396 Mycol Progress (2011) 10:389–398 (Fig. 4d). Generative hyphae (Fig. 4d) 3–4 μm diameter, not inflated, hyaline, thin-walled, frequently branched, with clamp connections. Skeletal hyphae 3–4.5 μm diameter, sinuous, cylindric, hyaline, with a thickened wall and narrow lumen, unbranched. Diameter of hairs on the surface of pileus 5–5.5 μm. Basidiospores (Fig. 4a) 5–7×2.5–4 μm (n=20, Lm =6.78 μm, Wm =3.75 μm, Q=1.5–2.4, Q=1.8) ellipsoid to cylindrical, occasionally broadly ellipsoid or even subglobose, hyaline, thin-walled, with few contents. Basidia (Fig. 4c) 19–25×5–6.5 μm, clavate, bearing 4 sterigmata. Lamella edge sterile with crowded cheilocystidia. Cheilocystidia (Fig. 4b) 20–30×5–7 μm, narrowly clavate, some with apical excrescence (10–12 μm long) hyaline, thin-walled. Sclerocystidia absent. Hairs on the pileus (Fig. 4e) dense, 5–10 μm in diameter, with a thickened pale brown wall up to 4 μm thick. Habitat On dead wood, in cluster, in rainforest dominated by Castanopsis armata. Distribution Only known from northern Thailand. Notes This new species is characterized by its yellowish brown-clay, velvety, concentrically zonate, leathery, solid, dry and hard small basidiomes, absence of sclerocystidia and 19–25×5–6.5 μm, clavate basidia. The prominent zonation of the pileus is the main characteristic feature of Lentinus concentricus. In some aspects it bears superficial Fig. 5 Maximum parsimony phylogram showing phylogenetic relationships among two new Lentinus species L. concentricus (MFLU08 1375) and L. megacystidiatus (MFLU08 1388) with some selected Lentinus sensu stricto and Polyporus species based on ITS sequences. Data were analyzed with random addition sequence, unweighted parsimony and gaps were treated as missing data. Values above the branches are parsimony boostrap (≥50%).The tree is rooted with Pleurotus ostreatus (EU520193) resemblance to Lentinus fasciatus Berk. which differs in having off-whitish to pale ochraceous basidiomes and abundant clavate or fusoid, 22–32×4–9 μm sclerocystidia on the sides of the lamellae (Corner 1981; Pegler 1983). Lentinus concentricus also bears a superficial resemblance to Lentinus bertieri (Fr.) Fr. and Lentinus ciliatus Lév. Lentinus bertieri differs from L. concentricus in having narrowly clavate basidia, 13.5–17×3.5–4.5 μm and Lentinus ciliatus also differs in having narrowly clavate basidia, 16–20×4–5.5 μm and 19–32×4–8 μm clavate to fusoid sclerocystidia (Corner 1981; Pegler 1983). Results and discussion We collected 47 Lentinus specimens from 17 sites in northern Thailand, belonging to 8 species of Lentinus sensu lato: L. connatus, L. polychrous, L. similis, L. tigrinus, L. velutinus and three new species. In this paper, three new species are fully described and illustrated with line drawings. We investigated the position of L. concentricus and L. megacystidiatus, based on phylogenetic analyses of the nrITS sequences (Fig. 5). The results from these analyses are preliminary as the nrITS region is very variable and it is not the best region to use for phylogenetic inference (Bruns 2001). A multi-gene phylogeny of Lentinus is needed based on a sampling of a wide range of species. The morphological data, however, support the Polyporus squamosus DQ267123 L. concentricus sp. nov. 89 L. megacystidiatus sp. nov Polyporus tricholoma AF518753 65 100 37 Lentinus tigrinus AY218419 Lentinus tigrinus AF516521 5 Lentinus tigrinus AF516520 Lentinus tigrinus DQ056860 50 95 Lentinus tigrinus AF516519 28 98 Lentinus tigrinus AF516518 Lentinus tigrinus EU543989 Lentinus tigrinus AF516517 0 Lentinus polychrous AB478882 45 42 99 Lentinus tigrinus FJ755219 Polyporus lepideus GU731572 Lentinus squarrosulus GQ849475 100 Lentinus tigrinus GQ849476 66 Lentinus squarrosulus AB478883 Pleurotus ostreatus EU520193 Mycol Progress (2011) 10:389–398 introduction of the new species. Lentinus concentricus and L. megacystidiatus are positioned, with high bootstrap support, in the same clade as L. tigrinus. This group is in need of further phylogenetic research, and it has to be seen whether the genus Lentinus should be maintained as a separate genus. The main focus of this paper has been on biodiversity and taxonomy; however, it is worth noting that basidiomes of most Lentinus species are potentially edible and cultivatable. In most countries, there is a well-established consumer acceptance for cultivated mushrooms (e.g., Agaricus bisporus, Auricularia spp., Pleurotus spp., Lentinula edodes and Volvariella volvacea) (Sanmee et al. 2003). Pleurotus tuber-regium and L. squarrosulus are popular throughout central Africa as a source of food (Watling 1993), while Chin (1981) stated that Lentinus sajor-caju and Lentinus strigosus are edible. Lentinus sajor-caju is also widely sold at the local markets in Thailand. Mushrooms have been shown to have great potential for anti-oxidant activity (Yang et al. 2002; Vattem et al. 2004; Mau et al. 2005). Burkill (1966) stated that Lentinus subnudus is an edible species. Pleurotus giganteus, locally referred to as “Uru Paha” in Sri Lanka, is one of the largest of edible mushrooms, and has been treated as a special food since ancient times as mentioned in Buddhist literature (Udugama and Wickramaratna 1991; Berkeley 1847). Furthermore, Pleurotus tuber-regium is a very valuable medicine against diarrhea (Burkill 1966). It is also possible that the three new species described in this study are likely to be edible and may be cultivated and may eventually reach the table. Our future studies will attempt to cultivate these taxa. Acknowledgements We are grateful to Phongeun Sysouphanthong for his help in collecting and suggestions, Sitthisack Phoulivong, Natchanun Phunthanateerakul, Pheng Phengsintham, Bang Feng and Liping Tang are gratefully acknowledged for their valuable discussions. Dr Jan Frits Veldkamp (L) is thanked for providing the Latin diagnosis. We wish to acknowledge the help with field work provided by Kobeke Van de Putte, Michael Pilkington, Putarak Chomnunti, Jian Kui-Liu and Thida Win Ko Ko. Kanjana Niraphai (MFLU) is thanked for her assistance in the herbarium. This study was financially supported by the project “Value added products from Basidiomycetes: Putting Thailand’s biodiversity to use” (BRN049/2553). Study in China was supported by a grant from the Ministry of Science and Technology of the People’s Republic of China (2008FY110300). Open Access This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited. References Aletor VA (1995) Compositional studies on edible tropical species of mushrooms. Food Chem 54:265–268 Berkeley MJ (1847) Decades of fungi XII–XIV. Lond J Bot 6:312– 326 397 Bruns TD (2001) ITS reality. Inoculum 52(6):2–3 Burkill IH (1966) A dictionary of the economic products of the Malay Peninsula, vol. II. Governments of Malaysia and Singapore by the Ministry of Agriculture and Co-operatives, Kuala Lampur Chin FH (1981) Edible and poisonous fungi from the forest of Sarawak. Part 1. Sarawak Mus J 50:211–225 Corner EJH (1981) The agaric genera Lentinus, Panus, and Pleurotus with particular reference to Malaysian species. Nova Hedwig Beih 69:1–169 Demirbas A (2000) Accumulation of heavy metals in some edible mushrooms from Turkey. Food Chem 68:415–419 Felsenstein J (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783–791 Fleming R (1994) Neolentinus—a well-founded genus in Pleurotaceae that includes Heliocybe. Mycol Res 98:542–544 Gilbertson RL (1980) Wood-rotting fungi of North America. Mycologia 72:1–49 Hibbett DS, Thorn RG (1994) Nematode-trapping in Pleurotus tuberregium. Mycologia 86(5):696–699 Hibbett DS, Vilgalys R (1991) Evolutionary relationships of Lentinus to the Polyporaceae—Evidence from restriction analysis of enzymatically amplified ribosomal DNA. Mycologia 83(4):425– 439 Hibbett DS, Vilgalys R (1993) Phylogenetic relationships of Lentinus (Basidiomycotina) inferred from molecular and morphological characters. Syst Bot 18(3):409–433 Hibbett DS, Murakami S, Tsuneda A (1993) Hymenophore development and evolution in Lentinus. Mycologia 85(3):428–443 Kerekes J, Desjardin DE (2009) A monograph of the genera Crinipellis and Moniliophthora from Southeast Asia including a molecular phylogeny of the nrITS region. Fungal Divers 37:101– 152 Kirk PM, Cannon P, David JC, Stalpers JA (eds) (2008) Ainsworth and Bisby’s dictionary of the fungi, 10th edn. CAB International, Wallingford, Oxon, UK Kornerup A, Wanscher JH (1978) Methuen handbook of colour, 3rd edn. Methuen, London Krueger D (2002) Monographic studies in the genus Polyporus (Basidiomycotina) Thesis (2002) Department of Botany, University of Tennessee, Knoxville, TN, USA Kruger D, Gargas A (2004) The basidiomycete genus Polyporus—an emendation based on phylogeny and putative secondary structure of ribosomal RNA molecules. Feddes Repert 115:530–546 Kühner R (1980) Les Hyménomycètes agaricoïdes. Bull Soc Linn Lyon 49:1027 Latiff LA, Daran ABM, Mohamed AB (1996) Relative distribution of minerals in the pileus and stalk of some selected edible mushrooms. Food Chem 56(2):115–121 Le TH, Nuytinck J, Verbeken A, Lumyong S, Desjardin ED (2007) Lactarius in Northern Thailand: 1. Lactarius subgenus Piperites. Fungal Divers 24:173–224 Manzi P, Gambelli L, Marconi S, Vivanti V, Pizzoferrato L (1999) Nutrients in edible mushrooms: an inter-species comparative study. Food Chem 65:477–482 Manzi P, Aguzzi A, Pizzoferrato L (2001) Nutitional value of mushrooms widely consumed in Italy. Food Chem 73:321–325 Mau JL, Tsai SY, Tseng YH, Huang SJ (2005) Antioxident properties of hot water extracts from Ganoderma tsugae Murrill. LWT Food Sci Technol 38:589–597 Miller O (1973) Mushrooms of North America. Dutton, New York Moser M (1978) Keys to Agarics and Boleti. Phillips, London Pegler DN (1975) The classification of the genus Lentinus Fr. (Basidiomycota). Kavaka 3:11–20 Pegler DN (1983) The genus Lentinus: a world monograph. HMSO, London 398 Redhead SA, Ginns JH (1985) A reappraisal of agaric genera associated with brown rots of wood. Trans Mycol Soc Jpn 26:349–381 Ridgeway R (1912) Color standards and color nomenclature. Ridgeway, Washington DC Sanmee R, Dell B, Lumyong P, Izumori K, Lumyong S (2003) Nutritive value of popular wild edible mushrooms from northern Thailand. Food Chem 82:527–532 Sanmee R, Tulloss RE, Lumyong P, Dell B, Lumyong S (2008) Studies on Amanita (Basidiomycetes: Amanitaceae) in Northern Thailand. Fungal Divers 32:97–123 Singer R (1986) The Agaricales in modern taxonomy, 4th edn. Koeltz, Koenigstein, Germany Sotome K, Hattori T, Ota Y, Kakishima M (2009) Second report of Polyporus longiporus and its phylogenetic position. Mycoscience 50:415–420 Swofford DL (1998) PAUP and other methods. Phylogenetic analysis using parsimony, version 4. Sinauer Associates, Sunderland, Mass. Sysouphanthong P, Thongkantha S, Zhao R, Soytong K, Hyde KD (2010) Mushroom diversity in sustainable shade tea forest and the effect of fire damage. Biodivers Conserv. doi:10.1007/ s10531-009-9769-1 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 24:4876–4882 Mycol Progress (2011) 10:389–398 Udugama S, Wickramaratna K (1991) Artificial production of naturally occurring Lentinus giganteus (Uru Paha), a Sri Lankan edible mushroom. Horticultural Crop Research & Development Institute (HORDI), Gannoruwa, Peradeniya Vattem DA, Lin YT, Ghaedian R, Shetty K (2004) Cranberry synergies for dietary management of Helicobacter pylori infections process. Biochemistry 40(5):1583–1592 Wannathes N, Desjardin DE, Lumyong S (2009a) Four new species of Marasmius section Globulares from Northern Thailand. Fungal Divers 36:155–163 Wannathes N, Desjardin DE, Hyde KD, Perry BA, Lumyong S (2009b) A monograph of Marasmius (Basidiomycota) from Northern Thailand based on morphological and molecular (ITS sequences). Fungal Divers 37:209–306 Watling R (1993) Comparison of the macromycete biotas in selected tropical areas of Africa and Australia. In: Isaac S, Frankland J, Watling R, Whalley AJS (eds) Aspects of tropical mycology. Cambridge University Press, Cambridge, pp 171–182 White TJ, Bruns T, Lee S, Taylor JW (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR protocols: a guide to methods and applications. Academic, New York, pp 315–322 Yang JH, Lin HC, Mau JL (2002) Antioxident properties of several commercial mushrooms. Food Chem 77:229–235