Mycologia, 104(6), 2012, pp. 1397–1407. DOI: 10.3852/11-374 2012 by The Mycological Society of America, Lawrence, KS 66044-8897 # Zymoseptoria ardabiliae and Z. pseudotritici, two progenitor species of the septoria tritici leaf blotch fungus Z. tritici (synonym: Mycosphaerella graminicola) Eva H. Stukenbrock INTRODUCTION Max Planck Institute for Terrestrial Microbiology, Karl von Frisch Strasse 10, 35043 Marburg, Germany The genus Mycosphaerella in recent years has been revealed to be polyphyletic, not only incorporating numerous genera within Mycosphaerellaceae but also within Davidiellaceae, Dissoconiaceae, Schizothyriaceae and Teratosphaeriaceae (Crous et al. 2007, 2009a, b). In this regard, Zymoseptoria recently was proposed as a novel genus within Mycosphaerellaceae to accommodate Septoria-like species occurring on Poaceae (Quaedvlieg et al. 2011). Zymoseptoria also includes the prominent wheat pathogen Z. tritici (synonyms Mycosphaerella graminicola and Septoria tritici), which is the causal agent of septoria tritici leaf blotch on wheat. The pathogen can be found on wheat worldwide. Population genetics and evolutionary studies indicated that the center of origin of Z. tritici was in the Middle East, overlapping the center of origin of its wheat host in the Fertile Crescent (Banke and McDonald 2005, Stukenbrock et al. 2007). To further investigate the evolutionary history of Z. tritici material from uncultivated graminicolous species showing septoria-like leaf symptoms was collected from five locations along a transect of approximately 600 km in the northwestern province, Ardabil, in Iran. Two distinct fungal populations were isolated and identified as close relatives of Z. tritici based on sequencing of seven loci (Stukenbrock et al. 2007). One of the two new Zymoseptoria populations called S1 was recognized as the closest known relative of Z. tritici. The two species share the same sequence for 500 base pairs of the ribosomal internal transcribed spacer region (rDNA ITS) that often is used to distinguish ascomycete species (White et al. 1990, Seifert 2009). Coalescent analyses of a multilocus dataset including more than 100 isolates resolved Z. tritici and the two new species into distinct lineages and suggested that the divergence of Z. tritici from the closest of the new Zymoseptoria species took place ,11 000 y ago (Stukenbrock et al. 2007). Subsequent genome sequencing of the three Zymoseptoria lineages revealed a genome-wide divergence of 6% and 10% between Z. tritici and the two Iranian lineages (Stukenbrock et al. 2010, 2011), supporting the separation of these lineages as distinct species. The Zymoseptoria species most closely related to Z. tritici (S1) was isolated from the grass hosts Elymus repens and Dactylis glomerata, and the other species (named S2) was isolated from Dactylis glomerata and Lolium perenne. Both species were found along a William Quaedvlieg CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, the Netherlands, and Microbiology, Department of Biology, Utrecht University, Padualaan 8, 3584 CH Utrecht, the Netherlands Mohammad Javan-Nikhah Department of Plant Protection, Faculty of Agriculture, University of Tehran, Plant Pathology Building, Karaj, Iran Marcello Zala Plant Pathology, Institute of Integrative Biology, ETHZurich LFW B14, 8092 Zurich, Switzerland Pedro W. Crous CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, the Netherlands, and Wageningen University and Research Centre (WUR), Laboratory of Phytopathology, Droevendaalsesteeg 1, 6708 PB Wageningen, the Netherlands Bruce A. McDonald1 Plant Pathology, Institute of Integrative Biology, ETHZurich LFW B16, 8092 Zurich, Switzerland Abstract: Zymoseptoria is a newly described genus that includes the prominent wheat pathogen Zymoseptoria tritici (synonyms Mycosphaerella graminicola and Septoria tritici). Studies indicated that the center of origin of Z. tritici is in the Middle East where this important pathogen emerged during the domestication of wheat. Several Zymoseptoria species have been found on uncultivated grasses in the Middle East, and in this article we describe two new Zymoseptoria species from Iran. These species, isolated from Elymus repens, Dactylis glomerata and Lolium perenne, are named Z. ardabiliae and Z. pseudotritici. Both species were identified by means of morphological characteristics and phylogenetic analyses of a seven-gene DNA dataset. These taxa comprise some of the closest known relatives of the wheat pathogen Z. tritici, confirming the reported close phylogenetic relationship between Z. tritici and Z. pseudotritici. Key words: Dactylis sp., ITS, Lolium sp., LSU, multilocus sequence typing, Mycosphaerella, Septoria, systematics, Triticum aestivum Submitted 12 Nov 2011; accepted 21 Mar 2012. 1 Corresponding author. E-mail: bruce.mcdonald@usys.ethz.ch 1397 1398 TABLE I. Cultures subjected to DNA sequencing Species CBS 118712 CBS 137.56 Host Location Collected by CAL ITS TUB RPB2 LSU EF1 — — — — — — — — JQ739858 GQ852583 JQ739859 JF700933 — — — — — — JQ739860 JF700934 — — Hedysarum coronarium Beta vulgaris Fiji Italy Australia M.J. Barbetti — — — — JQ739861 JQ739815 — CBS 122453 Trifolium subterraneum Musa acuminata India I. Buddenhagen — — — — JQ739862 JQ739816 — CBS 113265 Quercus robur the Netherlands G. Verkley CBS 114866 Eucalyptus nitens South Africa P.W. Crous — — — — JQ739864 JQ739817 — CBS 120738 Eucalyptus sp. Italy W. Gams — — — — JQ739865 JQ739818 — CBS 111175 Eucalyptus robus South Africa P.W. Crous — — — — JQ739866 JQ739819 — CBS 120726 Italy W. Gams — — — — JQ739867 JQ739820 — CPC 11312 CBS 182.93 Eucalyptus grandiflora Vicia amurens Succissa pratensis Korea France H.D. Shin H.A. van de Aa — — — — — — — — JQ739868 JQ739821 JQ739869 JQ739822 — — CBS 128662 Stachydis riederi S.B. Hong — — — — JQ739870 JQ739823 — G. Verkley G. Verkley G. Verkley L. Marvanová — — — — — — — — — — — — — — — — JQ739871 JQ739872 JQ739873 JQ739874 — — — — CBS 124.31 CBS 118790 CBS CBS CBS CBS 102337 102376 113438 604.66 Romania Republic of Korea Stachys sylvatica Netherlands Stellaria media Netherlands Verbena officinalis New Zealand Nymphoides peltata Netherlands STIR04 5.9.1 Dactylis glomerata (5 CBS 130976) STIR04 2.2.1 Dactylis sp. Iran Iran STIR04 3.11.1 Agropyron sp. Iran STIR04 4.3.1 Agropyron sp. Iran IRAN1485C (5 CPC 18102) Phalaris paradoxa Iran P. Tyler M. Ribaldi ACT — M. JavanNikkhah M. JavanNikkhah M. JavanNikkhah M. JavanNikkhah — JQ739739 JQ739759 JQ739802 JQ739752 JQ739863 DQ470968 JQ739771 JQ739824 JQ739825 JQ739826 JQ739827 JN982476 JN982478 JN982480 JN982484 JN982482 JQ739828 JQ739772 JQ739740 JQ739760 JQ739803 JQ739753 JQ739875 JQ739829 JQ739773 JQ739741 JQ739761 JQ739804 JQ739754 JQ739876 JQ739830 JQ739774 JQ739742 JQ739762 JQ739805 JQ739755 JQ739877 JQ739831 JQ739775 JF701035 JF701103 JF700866 JF700967 JQ739878 JQ739832 JQ739776 MYCOLOGIA Cercospora apii Cercospora ariminensis Cercospora beticola Cercospora zebrina Dissoconium musae Mycosphaerella punctiformis Pseudocercospora eucalyptorum Pseudocercospora norchiensis Pseudocercospora robusta Ramularia eucalypti Ramularia lamii Septoria scabiosicola Septoria stachydicola Septoria stachydis Septoria stellariae Septoria verbenae Septoria villarsiae Zymoseptoria pseudotritici Zymoseptoria pseudotritici Zymoseptoria pseudotritici Zymoseptoria pseudotritici Zymoseptoria brevis Isolate noa TABLE I. Continued Species Location Collected by ACT CAL ITS TUB RPB2 LSU EF1 CPC 18106 (5 8S) Phalaris minor 5 CBS 128853 IRAN1486C Phalaris minor (5 CPC 18107) CPC 18109 (5 81) Phalaris paradoxa Iran — JF701036 JF701104 JF700867 JF700968 JF700798 JQ739833 JQ739777 Iran — JF701037 JF701105 JF700868 JF700969 JF700799 JQ739834 JQ739778 Iran — JF701038 JF701106 JF700869 JF700970 JF700800 JQ739835 JQ739779 CPC 18110 (5 83) Phalaris paradoxa Iran — JF701039 JF701107 JF700870 JF700971 JF700801 JQ739836 JQ739780 CPC 18111 (5 84) Phalaris paradoxa Iran — JF701040 JF701108 JF700871 JF700972 JF700802 JQ739837 JQ739781 CPC 18112 (5 85) Phalaris paradoxa Iran — JF701041 JF701109 JF700872 JF700973 JF700803 JQ739838 JQ739782 CPC 18113 (5 86) Phalaris paradoxa Iran — JF701042 JF701110 JF700873 JF700974 JF700804 JQ739839 JQ739783 CPC 18114 (5 87) Phalaris paradoxa Iran — JF701043 JF701111 JF700874 JF700975 JF700805 JQ739840 JQ739784 CPC 18115 (5 88) Phalaris paradoxa Iran — JF701044 JF701112 JF700875 JF700976 JF700806 JQ739841 JQ739785 IRAN1483C (5 CPC 18105) 5 CBS 128854 CBS 120382 Hordeum glaucum Iran — JF701045 JF701113 JF700876 JF700977 JF700808 JQ739842 JQ739786 Hordeum vulgare USA S. Goodwin JF701046 JF701114 JF700877 JF700978 JF700809 JQ739843 JQ739787 CBS 120384 Hordeum vulgare USA S. Ware JF701047 JF701115 JF700878 JF700979 JF700810 JQ739844 JQ739788 CBS 120385 Hordeum vulgare USA S. Ware JF701048 JF701116 CJF700879JF700980 JF700811 JQ739845 JQ739789 STIR04 1.1.1 Lolium perenne (5 CBS 130977) STIR04 3.13.1 Agropyron sp. Iran JN982477 JN982479 JQ739806 JN982485 JN982483 JQ739846 JQ739790 STIR04 3.3.2 Agropyron sp. Iran STIR04 1.1.2 Lolium sp. Iran CBS 392.59 Triticum aestivum M. JavanNikkhah M. JavanNikkhah M. JavanNikkhah M. JavanNikkhah E. Becker JF701055 JF701123 AY152603 JF700987 JF700818 JQ739850 JQ739794 CBS 398.52 Triticum aestivum Switzerland E. Muller JF701056 JF701124 JF700886 JF700988 JF700819 JQ739851 JQ739795 CPC 18099 Aegilops tauschii Iran M. Razavi JQ739746 JQ739766 JF700880 JF700981 JQ739881 JQ739852 JQ739796 Iran — TRITICI PROGENITORS JQ739743 JQ739763 JQ739807 JQ739756 JQ739878 JQ739847 JQ739791 JQ739744 JQ739764 JQ739808 JQ739757 JQ739879 JQ739848 JQ739792 JQ739745 JQ739765 JQ739809 JQ739758 JQ739880 JQ739849 JQ739793 1399 Zymoseptoria passerinii Zymoseptoria passerinii Zymoseptoria passerinii Zymoseptoria ardabiliae Zymoseptoria ardabiliae Zymoseptoria ardabiliae Zymoseptoria ardabiliae Zymoseptoria tritici Zymoseptoria tritici Zymoseptoria tritici Host STUKENBROCK ET AL.: Z. Zymoseptoria brevis Zymoseptoria brevis Zymoseptoria brevis Zymoseptoria brevis Zymoseptoria brevis Zymoseptoria brevis Zymoseptoria brevis Zymoseptoria brevis Zymoseptoria brevis Zymoseptoria halophila Isolate noa a CBS: CBS-KNAW Fungal Biodiversity Centre, Utrecht, the Netherlands; CPC: Culture collection of Pedro Crous, housed at CBS; STIR04: Culture collection of Bruce McDonald, Institute of Integrative Biology, ETH Zurich, Switzerland. JQ739751 JQ739771 JQ739814 JF700986 JQ739886 JQ739857 JQ739801 A.M. Gohari Iran Avena sp. CPC 18117 JQ739750 JQ739770 JQ739813 JF700982 JQ739885 JQ739856 JQ739800 M. Razavi Iran Aegilops tauschii CPC 18100 JQ739749 JQ739769 JQ739812 JF700983 JQ739884 JQ739855 JQ739799 M. Razavi Iran Aegilops tauschii CPC 18101 LSU RPB2 TUB ITS CAL ACT JQ739748 JQ739768 JQ739811 JF700984 JQ739883 JQ739854 JQ739798 M. Razavi Iran Calamagrostis sp. CPC 18103 A.M. Gohari Collected by Location Iran Host Avena sp. CPC 18116 Isolate noa Species Continued TABLE I. Zymoseptoria tritici Zymoseptoria tritici Zymoseptoria tritici Zymoseptoria tritici Zymoseptoria tritici EF1 MYCOLOGIA JQ739747 JQ739767 JQ739810 JF700985 JQ739882 JQ739853 JQ739797 1400 transect of approximately 600 km, indicating they are widely distributed within this region. Of note, the two new species were not found on wheat hosts in adjacent fields. Only Z. tritici was isolated from leaves sampled in wheat fields. Similarly Z. tritici was not found on the undomesticated grass hosts, consistent with the evolution of host specificity among the Zymoseptoria pathogens. Experimental infection on detached leaves let us demonstrate that, although all three species can infect the same hosts, T. aestivum, E. repens, D. glomerata and L. perenne, they differ in their degree of virulence on them (Stukenbrock et al. 2011). Given this overlapping host range, this complex of Zymoseptoria pathogen species provides an excellent model system to study host specialization and speciation processes. Here we present descriptions for the two Iranian Zymoseptoria species based on phylogenetic analyses of seven loci sequenced in multiple, closely related Zymoseptoria. We also present a detailed description of morphological and culture characteristics. Our multilocus sequence analyses place the two new Iranian Zymoseptoria species within the boundaries of the Zymoseptoria clade and confirm the reported close phylogenetic relationship with Z. tritici. MATERIALS AND METHODS Isolates.—Leaves with visible asexual fruiting bodies, pycnidia, were incubated in moist chambers to stimulate sporulation. Single-conidial isolates were established on malt extract agar (MEA; 20 g/L Biolab malt extract, 15 g/L Biolab agar) using the procedure of Crous et al. (2009c). Cultures were plated on fresh MEA, 2% tap water agar supplemented with green, sterile barley leaves (WAB), synthetic nutrient-poor agar (SNA), 2% potato-dextrose agar (PDA) and oatmeal agar (OA) (Crous et al. 2009c) and incubated at 25 C under near-ultraviolet light to promote sporulation. Reference strains are maintained in the culture collection of the CBS-KNAW Fungal Biodiversity Centre, Utrecht (TABLE I). Descriptions, nomenclature and illustrations were deposited in MycoBank (www.mycobank.org, Crous et al. 2004). DNA extraction, amplification and sequencing.—Genomic DNA was extracted from mycelium on MEA with the UltraCleanH Microbial DNA Isolation Kit (MoBio Laboratories Inc., Solana Beach, California). These strains were screened for seven loci, namely ITS, LSU, actin (ACT), calmodulin (CAL), RNA polymerase II second largest subunit (RPB2), translation elongation factor 1-alpha (EF1) and b-tubulin (TUB) (TABLE I). DNA amplification and sequencing reactions were performed as described by Cheewangkoon et al. (2008). (See TABLE II for detailed primer descriptions.) Phylogenetic analysis.—A basic alignment of the obtained sequence data was completed with MAFFT 6 (Katoh et al. STUKENBROCK ET AL.: Z. TABLE II. 1401 TRITICI PROGENITORS Primers used in this study for generic amplification and sequencing Locus Primer Primer sequence 59–39: Orientation Reference Actin Actin Calmodulin Calmodulin Calmodulin Elongation factor-1a Elongation factor-1a b-tubulin b-tubulin RPB2 RPB2 LSU LSU ITS ITS ACT-512F ACT2Rd CAL-235F CAL-228F CAL2Rd EF1-728F EF-2 T1 b-Sandy-R fRPB2-5F fRPB2-414R LSU1Fd LR5 ITS1 ITS4 ATGTGCAAGGCCGGTTTCGC ARRTCRCGDCCRGCCATGTC TTCAAGGAGGCCTTCTCCCTCTT GAGTTCAAGGAGGCCTTCTCCC TGRTCNGCCTCDCGGATCATCTC CAT CGA GAA GTT CGA GAA GG GGA RGT ACC AGT SAT CAT GTT AACATGCGTGAGATTGTAAGT GCRCGNGGVACRTACTTGTT GAYGAYMGWGATCAYTTYGG ACMANNCCCCARTGNGWRTTRTG GRATCAGGTAGGRATACCCG TCCTGAGGGAAACTTCG GAAGTAAAAGTCGTAACAAGG TCC TCC GCT TAT TGA TAT GC Forward Reverse Forward Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Carbone and Kohn (1999) Quaedvlieg et al. (2011) Present study Carbone and Kohn (1999) Quaedvlieg et al. (2011) Carbone and Kohn (1999) O’Donnell et al. (1998) O’Donnell and Cigelnik (1997) Present study Liu et al. (1999) Quaedvlieg et al. (2011) Crous et al. (2009a) Vilgalys and Hester (1990) White et al. (1990) White et al. (1990) 2002) and consequently checked manually in BioEdit 7.0.5.2 (Hall 1999). A Bayesian analysis (critical value for the topological convergence diagnostic set to 0.01) was performed for both the generic RPB2/LSU tree and the ACT, CAL, EF1, TUB, RPB2, ITS and LSU multilocus tree with MrBayes 3.1.1 (Huelsenbeck and Ronquist 2001). Parallel to this, a neighbor joining distance tree (1000 repeats) was generated for the RPB2/LSU dataset with the Kimura 2-parameter substitution model to augment the Bayesian posterior probability values with bootstrap support values. These datasets consisted of approximately 1028 nucleotides for the RPB2/LSU tree (293 nucleotides for RPB2 and 735 nucleotides for LSU) and approximately 2991 nucleotides for the multilocus tree (293 nucleotides for RPB2, 735 nucleotides for LSU, 224 nucleotides for ACT, 269 nucleotides for CAL, 334 nucleotides for EF1, 392 nucleotides for TUB and 478 nucleotides for ITS). Dissoconium musae (CBS 122453) was used as outgroup for the RPB2/LSU analyses while Mycosphaerella punctiformis (CBS 113265) was used as outgroup for the multigene analyses (see TABLE II for detailed primer descriptions). All novel sequences derived from this study were deposited in GenBank (TABLE I). To determine whether the multilocus DNA sequence datasets were congruent a partition homogeneity test (Farris et al. 1994) of all possible combinations was performed in PAUP 4.0b10 (Swofford 2003) with 1000 replications. Parallel to this, a 70% neighbor joining (NJ) reciprocal bootstrap method with maximum likelihood distance (Mason-Gamer and Kellogg 1996, Lombard et al. 2010) also was employed to check congruency. Morphology.—Descriptions were based on fungal cultures sporulating in vitro on WAB, incubated under continuous near-ultraviolet light 2–4 wk. Wherever possible, 30 measurements (1000 3 magnification) were made of structures mounted in lactic acid, with the extremes of spore measurements in parentheses. Colony colors (surface and reverse) were assessed after 2 wk on MEA, PDA and OA at 25 C in the dark with the color charts of Rayner (1970). RESULTS Phylogenetic analyses.—In the Zymoseptoria dataset, multilocus sequence data of four Z. ardabiliae and four Z. pseudotritici isolates were combined partially with the existing dataset used in Quaedvlieg et al. (2011). The adjusted sequence alignment for each locus consisted of 46 ingroup taxa with Dissoconium musae (CBS 122453) acting as outgroup. Congruency testing.—The strict consensus tree (unpubl), based on the multilocus maximum parsimony analysis, had an identical topology to those of the strict consensus trees obtained for the individual loci. Partition homogeneity tests for all the possible multigene combinations of all seven loci consistently yielded a P value of 0.001 and thus were incongruent. However, the 70% reciprocal bootstrap trees of the individual gene regions showed no conflicting tree topologies between the individual loci. Based on these results, the DNA sequences of the seven loci were concatenated and used for phylogenetic analyses (Mason-Gamer and Kellogg 1996, Cunningham 1997). The RPB2/LSU dataset contains 47 taxa (including the outgroup taxon). The multilocus dataset contains 31 taxa (including the outgroup taxon). Well supported clades for both Z. ardabiliae and Z. pseudotritici emerged alongside the four previously described Zymoseptoria species at both the generic(Rpb2/LSU) (FIG. 1) and species-level (multigene) trees (FIG. 2). The RPB2/LSU tree (FIG. 1) provides strong posterior probability support for the separation of Ramularia from Zymoseptoria (0.98). This support is enhanced by the neighbor joining bootstrap support values (calculated with the K2P substitution model), depicted on the right side of the 1402 MYCOLOGIA FIG. 1. A Bayesian 50% majority rule RPB2/LSU consensus tree, containing all known Zymoseptoria species, and representative taxa from four closely related genera. Bayesian posterior probabilities and neighbor joining K2M bootstrap support values for the genus nodes. A stop rule (set to 0.01) for the critical value for the topological convergence diagnostic was used for the Bayesian analysis. The tree was rooted to Dissoconium musae (CBS 122453). Bar indicates 0.1 expected changes per site. STUKENBROCK ET AL.: Z. TRITICI PROGENITORS 1403 FIG. 2. A Bayesian 50% majority rule ACT, CAL, EF1, TUB, RPB2, ITS and LSU consensus tree, containing all known Zymoseptoria species, including the newly described Z. ardabiliae and Z. pseudotritici. Bayesian posterior probabilities and neighbor joining K2M bootstrap support values are at the nodes. A stop rule (set to 0.01) for the critical value for the topological convergence diagnostic was used for the Bayesian analysis. The tree was rooted to Mycosphaerella punctiformis (CBS 113265). Bar indicates 0.1 expected changes per site. 1404 MYCOLOGIA FIG. 3. Zymoseptoria ardabiliae (CBS 130977). A. Colony sporulating on oatmeal agar. B. Yeast-like growth on synthetic nutrient-poor agar. C–G. Type I conidia undergoing microcyclic conidiation and Type III conidia (yeast-like). H. Type II conidia (phragmospores). Bars 5 10 mm. posterior probability values. Bootstrap values also strongly support the split between Ramularia and Zymoseptoria because these clades only cluster together randomly (51%) in the generated NJ trees. TAXONOMY Based on the multigene dataset (FIG. 2), and differences observed in morphology, two new species are introduced herewith for taxa occurring on Poaceae. Zymoseptoria ardabiliae B. McDonald, Stukenbrock & Crous, sp. nov. FIG. 3 MycoBank MB560629 Zymoseptoriae triticii similis, sed conidiis minoribus, (15–) 20–25(–30) 3 2(–3) mm. On sterile barley leaves on WA. Conidiomata pycnidial, semi-immersed to erumpent, dark brown to black, subglobose, up to 250 mm diam, with central ostiole, up to 20 mm diam; wall of 3–4 layers of brown textura angularis. Conidiophores reduced to conidiogenous cells, lining the inner cavity. Conidiogenous cells hyaline, smooth, tightly aggregated, ampulliform to doliiform, 5–12 3 3–4 mm, with 1–2 inconspicuous, percurrent proliferations at apex, 1–1.5 mm diam. Type I conidia rarely observed, solitary, hyaline, smooth, guttulate, narrowly cylindrical to subulate, tapering toward acutely rounded apex, with tapered, subtruncate to truncate base, (0–)1-septate, (15–)20–25(–30) 3 2(–3) mm. Type II conidia (phragmospores) rarely observed, subcylindrical, guttulate, aseptate, 8–15 3 2– 3 mm. Type III conidia abundant on all media studied; hyaline, smooth, guttulate, subcylindrical, 8–12(–15) 3 2(–3) mm. Culture characteristics. Colonies on OA erumpent, spreading, with moderate, dirty white aerial mycelium and lobate, feathery margins; olivaceous gray to fuscous black; on PDA spreading, erumpent, with sparse to moderate aerial mycelium and feathery, lobate margins, olivaceous gray (surface and reverse); reaching 15 mm diam after 2 wk at 25 C; fertile. Etymology. Named after the location where it was first collected, Ardabil Province, Iran. Specimen examined. IRAN, ARDABIL PROVINCE: Lolium sp. (presumably L. perenne), Sep 2004, coll. M. JavanNikkhah, (holotype CBS H-20732, culture ex-type CBS 130977 5 S2). Notes. Zymoseptoria ardabiliae is phylogenetically closest related to Z. brevis (FIGS. 1, 2). Morphologically, however, it is most similar to Z. passerinii (conidia 1–3-septate, 21–52 3 1.5–2.2 mm), although its conidia are shorter and wider (conidia 0–1-septate, 15–30 3 2– 3 mm) (Quaedvlieg et al. 2011). Zymoseptoria pseudotritici B. McDonald, Stukenbrock & Crous, sp. nov. FIG. 4 MycoBank MB560628 Zymoseptoriae triticii similis, sed conidiis minoribus, (7–) 10–12(–22) 3 2.5(–3) mm. On sterile barley leaves on WA. Conidiomata pycnidial, semi-immersed to erumpent, dark brown to black, subglobose, up to 200 mm diam, with central ostiole, up to 20 mm diam; wall of 3–4 layers of brown textura angularis. Conidiophores reduced to conidiogenous STUKENBROCK ET AL.: Z. 1405 TRITICI PROGENITORS FIG. 4. Zymoseptoria pseudotritici (CBS 130976). A. Colony sporulating on oatmeal agar. B. Yeast-like growth on synthetic nutrient-poor agar. C, D. Type III conidia (yeast-like) on synthetic nutrient-poor agar. E. Type I conidia undergoing microcyclic conidiation. F. Type III conidia (yeast-like) formed on potato dextrose agar. Bars 5 10 mm. cells, lining the inner cavity. Conidiogenous cells hyaline, smooth, tightly aggregated, ampulliform to doliiform, 6–10 3 3–6 mm, with 1–3 inconspicuous, percurrent proliferations at apex, 1–2 mm diam. Type I conidia rarely observed, solitary, hyaline, smooth, guttulate, narrowly cylindrical to subulate, tapering toward acutely rounded apex, with bluntly rounded to truncate base, 0(–1)-septate, (7–)10–12(–22) 3 2.5 (–3) mm. Forming Type II conidia (phragmospores), subcylindrical, 8–20 3 1.5–3 mm, and Type III conidia (microcyclic conidiation) on SNA. Type III conidia abundant on all media studied, hyaline, smooth, guttulate, subcylindrical, apex obtuse, base truncate, aseptate, (5–)10–12(–15) 3 1.5–2(–3) mm. Culture characteristics. Colonies on OA somewhat erumpent, spreading, with sparse aerial mycelium and smooth, even margins; olivaceous black with patches of pale violet; on PDA surface more erumpent than on OA, with moderate aerial mycelium and feathery, lobate margins, pale olivaceous gray with patches of olivaceous gray; reverse olivaceous gray; reaching 25– 30 mm diam after 2 wk at 25 C; fertile. Etymology. Named after its close phylogenetic affinity to Zymoseptoria tritici. Specimen examined. IRAN, ARDABIL PROVINCE: Dactylis sp. (presumably D. glomerata), Sep 2004, coll. M. JavanNikkhah, (holotype CBS H-20731, culture ex-type CBS 130976 5 S1). Notes. Zymoseptoria pseudotritici is phylogenetically closely related to Z. tritici, although it has much shorter and wider pycnidial conidia (one-septate, 7–22 3 2.5–3 mm) than Z. tritici (three-septate, 28–85 3 1.5– 2.2 mm), and is more similar to Z. brevis (one-septate, 12–17 3 2–2.5 mm) (Quaedvlieg et al. 2011). Genome data of Z. pseudotritici are deposited in the NCBI fungal genome database under accession numbers STIR04_5.9.1: AFIT00000000 and of Z. ardabiliae STIR04_1.1.1: AFIU00000000. DISCUSSION Although the genus Mycosphaerella had been regarded as the largest genus of Ascomycetous fungi (Crous 2009), it recently was shown to be polyphyletic (Crous et al. 2007, 2009b). To complicate matters further, the recent trend to delineate genera as natural monophyletic lineages and to link these to single names in contrast to dual nomenclature (Hawksworth et al. 2011, Wingfield et al. 2012) has resulted in many anamorph names being used to name the former Mycosphaerella-like clades. Because many of the type species of these anamorph genera currently are being recollected, it has become possible to better delineate the application of different generic names (Frank et al. 2010, Minnis et al. 2011). With the characterization of Septoria cytisi, the type of the genus Septoria, and the subsequent introduction of Zymoseptoria to accommodate species occurring on Poaceae, a new niche was discovered representing many Zymoseptoria species on grasses. Although the bootstrap support for the separation of Zymoseptoria from Ramularia was inconclusive (82% in the parsimony analysis of Quaedvlieg et al. 2011), this value has been significantly improved by adding more genes to the analyses 1406 MYCOLOGIA in the present study (0.98 posterior probability, 51% bootstrap support, Rpb2/LSU, FIG. 1). The separation of Ramularia (Mycosphaerella s.str.) from Zymoseptoria on morphological grounds also is defendable because the former genus consists of more than 1000 names, representing fasciculate hyphomycetes with hyaline, septate, catenulate conidia having darkened, thickened scars (Braun 1998), none of which have ever been observed to have coelomycete synanamorphs or to exhibit a yeast-like state in culture. Many fungal pathogens within the newly described genus Zymoseptoria in recent years have been isolated and characterized from uncultivated grasses collected in the Middle East (Stukenbrock et al. 2007, Seifbarghi et al. 2009, Quaedvlieg et al. 2011). Among these are the two new species, Z. pseudotritici and Z. ardabiliae, described here. Z. pseudotritici (formerly called Mycosphaerella S1) and Z. ardabiliae (formerly called Mycosphaerella S2) were isolated from wild grasses in Iran to study their genealogical relationship with the prominent wheat pathogen Z. tritici. The evolutionary history of Z. tritici was inferred by coalescent analyses using DNA sequence information from the three species. It was shown that Z. tritici emerged in parallel with the domestication and cultivation of wheat in the Fertile Crescent 10 000– 11 000 y ago from a common ancestor of Z. tritici and Z. pseudotritici (Stukenbrock et al. 2007, 2011). Z. ardabiliae represents another closely related species of both Z. tritici and Z. pseudotritici that diverged about 20 000–22 000 y ago (Stukenbrock et al. 2007, 2011). Here we describe the phylogenetic and morphological characters of the two pathogens, Z. pseudotritici and Z. ardabiliae. Z. pseudotritici shares the same ITS sequence as Z. tritici but can be resolved as a distinct species based on multilocus phylogenetic analyses, comparative genomics and morphological characters. This close relative of Z. tritici also was able to infect T. aestivum in a detached leaf assay but to our knowledge has never been sampled from wheat fields in the Middle East. The pathogen however was isolated from grass hosts of different genera (Dactylis sp. and Elymus sp.), suggesting that the species can infect a variety of grass hosts. Between Z. tritici and Z. pseudotritici the overall genome identity at the nucleotide level is 94%, supporting the distinction of the pathogens as different species. This high genome-wide nucleotide similarity let us compare .9000 predicted genes (80% of the total number of predicted genes; Goodwin et al. 2011) and to identify a small set of positively selected genes (Stukenbrock et al. 2010). These genes likely played a role in either host specialization or speciation, and their functional roles currently are being investigated. In addition to Z. pseudotritici we also provide here a detailed description of the other close relative of Z. tritici, Z. ardabiliae. Like Z. pseudotritici, Z. ardabiliae produces lesions on grass hosts similar to the septoria tritici leaf blotch symptoms caused by Z. tritici on wheat. Zymoseptoria ardabiliae was isolated from Elymus sp. and Lolium sp. and has a broad host range similar to Z. pseudotritici. Our comparative genome analyses of Z. ardabiliae and Z. tritici have an average nucleotide identity of 90%, supporting the multilocus phylogenetic analyses reported here that place Z. ardabiliae more distant to Z. tritici than Z. pseudotritici. In Z. ardabiliae we also have identified a set of positively selected genes, which likely are involved in host specialization or speciation processes. The detailed species characterization of Z. pseudotritici and Z. ardabiliae contributes to our understanding of Zymoseptoria species. Zymoseptoria tritici has co-evolved with a cultivated host and thereby became specifically adapted to the wheat agroecosystem. On the other hand Z. pseudotritici and Z. ardabiliae both evolved in natural grassland. The host ranges of the three species likely reflect the host environments where the fungi exist and where they have evolved. This group of closely related dothideomycete species provides an excellent model system to investigate processes of host specialization in plant pathogenic fungi and to increase our understanding of speciation processes in fungi. LITERATURE CITED Banke S, McDonald BA. 2005. Migration patterns among global populations of the pathogenic fungus Mycosphaerella graminicola. Mol Ecol 14:1881–1896, doi:10.1111/j.1365-294X.2005.02536.x Braun U. 1998. A monograph of Cercosporella, Ramularia and allied genera (phytopathogenic hyphomycetes). Vol. 2. Eching, Germany: IHW-Verlag. Cheewangkoon R, Crous PW, Hyde KD, Groenewald JZ, Toanan C. 2008. Species of Mycosphaerella and related anamorphs on Eucalyptus leaves from Thailand. Persoonia 21:77–91, doi:10.3767/003158508X370857 Crous PW. 2009. Taxonomy and phylogeny of the genus Mycosphaerella and its anamorphs. Fungal Divers 38:1–24. ———, Braun U, Groenewald JZ. 2007. Mycosphaerella is polyphyletic. Stud Mycol 58:1–32, doi:10.3114/ sim.2007.58.01 ———, Gams W, Stalpers JA, Robert V, Stegehuis G. 2004. MycoBank: an online initiative to launch mycology into the 21st century. Stud Mycol 50:19–22. ———, Schoch CL, Hyde KD, Wood AR, Gueidan C, Hoog GS de, Groenewald JZ. 2009a. Phylogenetic lineages in the Capnodiales. Stud Mycol 64:17–47, doi:10.3114/ sim.2009.64.02 ———, Summerell BA, Carnegie AJ, Wingfield MJ, Hunter GC, Burgess TI, Andjic V, Barber PA, Groenewald JZ. STUKENBROCK ET AL.: Z. 2009b. Unraveling Mycosphaerella: Do you believe in genera? Persoonia 23:99–118, doi:10.3767/003158509X479487 ———, Verkley GJM, Groenewald JZ, Samson RA, eds. 2009c., Fungal biodiversity. CBS Laboratory Manual Series 1:1–269. Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands. Cunningham CW. 1997. Can three incongruence tests predict when data should be combined? Mol Biol Evol 14:733–740, doi:10.1093/oxfordjournals.molbev.a025813 Farris JS, Källersjö M, Kluge AG, Bult C. 1994. Testing significance of incongruence. Cladistics 10:315–319, doi:10.1111/j.1096-0031.1994.tb00181.x Frank J, Crous PW, Groenewald JZ, Oertel B, Hyde KD, Phengsintham P, Schroers HJ. 2010. Microcyclospora and Microcyclosporella: novel genera accommodating epiphytic fungi causing sooty blotch on apple. Persoonia 24:93–105, doi:10.3767/003158510X510560 Goodwin SB, Ben M’barek S, Dhillon B, Wittenberg A, Crane CF, et al. 2011. Finished genome of Mycosphaerella graminicola reveals stealth pathogenesis and extreme plasticity. PLoS Genet 7:e1002070. doi:10.1371/journal. pgen.1002070., doi:10.1371/journal.pgen.1002070 Hawksworth DL, Crous PW, Redhead SA, Reynolds DR, Samson RA, Seifert KA, Taylor JW, Wingfield MJ, et al. 2011. The Amsterdam declaration on fungal nomenclature. IMA Fungus 2:105–112, doi:10.5598/imafungus. 2011.02.01.14 Lombard L, Crous PW, Wingfield BD, Wingfield MJ. 2010. Multigene phylogeny and mating tests reveal three cryptic species related to Calonectria pauciramosa. Stud Mycol 66:15–30, doi:10.3114/sim.2010.66.02 Mason-Gamer RJ, Kellogg EA. 1996. Testing for phylogenetic conflict among molecular datasets in the tribe Triticeae (Gramineae). Syst Biol 45:524–545, doi:10.1093/ sysbio/45.4.524 Minnis AM, Kennedy AH, Grenier DB, Rehner SA, Bischoff JF. 2011. Asperisporium and Pantospora (Mycosphaerellaceae): epitypifications and phylogenetic placement. Persoonia 27:1–8, doi:10.3767/003158511X602071 Page RDM. 1996. TreeVIEW: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12:357–358. Posada D, Crandall KA. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14:817–818, doi:10.1093/bioinformatics/14.9.817 TRITICI PROGENITORS 1407 Quaedvlieg W, Kema GHJ, Groenewald JZ, Verkley GJM, Seifbarghi S, Razavi M, Mirzadi Gohari A, Mehrabi R, Crous PW. 2011. Zymoseptoria gen. nov.: a new genus to accommodate Septoria-like species occurring on graminicolous hosts. Persoonia 26:57–69, doi:10.3767/ 003158511X571841 Rayner RW. 1970. A mycological color chart. Kew, Surrey, UK: CMI and British Mycological Society. Seifbarghi S, Razavi M, Aminian H, Zare R, Etebarian H. 2009. Studies on the host range of Septoria species on cereals and some wild grasses in Iran. Phytopathol Mediterr 48:422–429. Seifert KA. 2009. Progress toward DNA barcoding of fungi. Mol Ecol Resour 9:83–89, doi:10.1111/j.1755-0998.2009.02635.x Stukenbrock EH, Banke S, Javan-Nikkhah M, McDonald BA. 2007. Origin and domestication of the fungal wheat pathogen Mycosphaerella graminicola via sympatric speciation. Mol Biol Evol 24:398–411, doi:10.1093/ molbev/msl169 ———, Bataillon T, Dutheil JY, Hansen TT, Li R, Zala M, McDonald BA, Wang J, Schierup MH. 2011. The making of a new pathogen: insights from comparative population genomics of the domesticated wheat pathogen Mycosphaerella graminicola and its wild sister species. Genome Res. doi: 10.1101/gr.118851.110 ———, Jørgensen FG, Zala M, Hansen TT, McDonald BA, Schierup MH. 2010. Whole genome and chromosome evolution associated with host adaptation and speciation of the wheat pathogen Mycosphaerella graminicola. PLoS Genet 6:e1001189, doi:10.1371/journal.pgen. 1001189 Swofford DL. 2003. PAUP* 4.0: phylogenetic analysis using parsimony (*and other methods). Sunderland, Massachusetts: Sinauer Associates. White TJ, Bruns TD, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. New York: Academic Press. p 315– 322. Wingfield MJ, de Beer ZW, Slippers B, Wingfield BD, Groenewald JZ, Lombard L, Crous PW. 2011. One fungus, one name promotes progressive plant pathology. Mol Plant Path, doi:10.1111/J.1364-3703.2011. 00768.X