Multiple origins of symbioses between ascomycetes and bryophytes suggested by a five-gene phylogeny

Seppo Huhtinen; Jaakko Hyvönen; Leena Myllys

We present a 6-gene, 420-species maximum-likelihood phylogeny of Ascomycota, the largest phylum of Fungi. This analysis is the most taxonomically complete to date with species sampled from all 15 currently circumscribed classes. A number of superclass-level nodes that have previously evaded resolution and were unnamed in classifications of the Fungi are resolved for the first time. Based on the 6-gene phylogeny we conducted a phylogenetic informativeness analysis of all 6 genes and a series of ancestral character state reconstructions that focused on morphology of sporocarps, ascus dehiscence, and evolution of nutritional modes and ecologies. A gene-by-gene assessment of phylogenetic informativeness yielded higher levels of informativeness for protein genes (RPB1, RPB2, and TEF1) as compared with the ribosomal genes, which have been the standard bearer in fungal systematics. Our reconstruction of sporocarp characters is consistent with 2 origins for multicellular sexual reproductive structures in Ascomycota, once in the common ancestor of Pezizomycotina and once in the common ancestor of Neolectomycetes. This first report of dual origins of ascomycete sporocarps highlights the complicated nature of assessing homology of morphological traits across Fungi. Furthermore, ancestral reconstruction supports an open sporocarp with an exposed hymenium (apothecium) as the primitive morphology for Pezizomycotina with multiple derivations of the partially (perithecia) or completely enclosed (cleistothecia) sporocarps. Ascus dehiscence is most informative at the class level within Pezizomycotina with most superclass nodes reconstructed equivocally. Character-state reconstructions support a terrestrial, saprobic ecology as ancestral. In contrast to previous studies, these analyses support multiple origins of lichenization events with the loss of lichenization as less frequent and limited to terminal, closely related species.

The kingdom Fungi is one of the more diverse clades of eukaryotes in terrestrial ecosystems, where they provide numerous ecological services ranging from decomposition of organic matter and nutrient cycling to beneficial and antagonistic associations with plants and animals. The evolutionary relationships of the kingdom have represented some of the more recalcitrant problems in systematics and phylogenetics. The advent of molecular phylogenetics, and more recently phylogenomics, has greatly advanced our understanding of the patterns and processes associated with fungal evolution, however. In this article, we review the major phyla, subphyla, and classes of the kingdom Fungi and provide brief summaries of ecologies, morphologies, and exemplar taxa. We also provide examples of how molecular phylogenetics and evolutionary genomics have advanced our understanding of fungal evolution within each of the phyla and some of the major classes. In the current classification we recognize 8 phyla, 12 subphyla, and 46 classes within the kingdom. The ancestor of fungi is inferred to be zoosporic, and zoosporic fungi comprise three lineages that are paraphyletic to the remainder of fungi. Fungi historically classified as zygomycetes do not form a monophyletic group and are paraphyletic to Ascomycota and Basidiomycota. Ascomycota and Basidiomycota are each monophyletic and collectively form the subkingdom Dikarya.

Although significant progress has been made resolving deep branches of the fungal tree of life, many fungal systematists are interested in species-level questions to both define species and assess fungal biodiversity. Fungal genome sequences are a useful resource to systematic biologists for developing new phylogenetic markers that better represent the whole genome. Here we report primers for two newly identified single-copy protein-coding genes, FG1093 and MS204, for use with ascomycetes. Although fungi were the focus of this study, this methodological approach could be easily applied to marker development for studies of other organisms. The tests used here to assess phylogenetic informativeness are computationally rapid, require only rudimentary datasets to evaluate existing or newly developed markers, and can be applied to other non-model organisms to assist in experimental design of phylogenetic studies. Phylogenetic utility of the markers was tested in two genera, Gnomoniopsis and Ophiognomonia (Gnomoniaceae, Diaporthales). The phylogenetic performance of β-tubulin, ITS, and tef-lα was compared with FG1093 and MS204. Phylogenies inferred from FG1093 and MS204 were largely in agreement with β-tubulin, ITS, and tef-1α although some topological conflict was observed. Resolution and support for branches differed based on the combination of markers used for each genus.

Cladistics Cladistics 26 (2010) 281–300 10.1111/j.1096-0031.2009.00284.x Multiple origins of symbioses between ascomycetes and bryophytes suggested by a ﬁve-gene phylogeny Soili Stenroosa, Tomi Laukkab,*, Seppo Huhtinenb, Peter Döbbelerc, Leena Myllysa, Kimmo Syrjänend and Jaakko Hyvönene a Botanical Museum, FI-00014 University of Helsinki, Helsinki, Finland; bHerbarium, FI-20014 University of Turku, Turku, Finland; cLudwigMaximilians-Universität München, D-80638 München, Germany; dFinnish Environment Institute, FI-00251 Helsinki, Finland; ePlant Biology, FI-00014 University of Helsinki, Helsinki, Finland Accepted 11 July 2009 Abstract Numerous species of microscopic fungi inhabit mosses and hepatics. They are severely overlooked and their identity and nutritional strategies are mostly unknown. Most of these bryosymbiotic fungi belong to the Ascomycota. Their fruit-bodies are extremely small, often reduced and simply structured, which is why they cannot be reliably identiﬁed and classiﬁed by their morphological and anatomical characters. A phylogenetic hypothesis of bryosymbiotic ascomycetes is presented. New sequences of 78 samples, including 61 bryosymbionts, were produced, the total amount of terminals being 206. Of these, 202 are Ascomycetes. Sequences from the following ﬁve gene loci were used: rDNA SSU, rDNA LSU, RPB2, mitochondrial rDNA SSU, and rDNA 5.8S. The program TNT was used for tree search and support value estimation. We show that bryosymbiotic fungi occur in numerous lineages, one of which represents a newly discovered lineage among the Ascomycota and exhibits a tripartite association with cyanobacteria and sphagna. A new genus Trizodia is proposed for this basal clade. Our results demonstrate that even highly specialized life strategies can be adopted multiple times during evolution, and that in many cases bryosymbionts appear to have evolved from saprobic ancestors. The Willi Hennig Society 2009. Diverse microscopic fungi are known to associate with bryophytes. The types of these associations vary enormously, including pathogenic, parasitic, saprobic, and commensal interactions (Davey and Currah, 2006). However, this list is a simpliﬁcation, as each of the relationships has its own peculiarities, and many of the associations are poorly known or yet to be described. The diversity, phylogeny, distribution, speciﬁcity, life cycles, infection mechanisms, nutritional strategies, and disease etiology of the bryosymbionts are largely unknown. The term ‘‘bryophilous’’ is commonly used to deﬁne fungi associated with bryophytes, but we have chosen to apply the term ‘‘bryosymbiont’’ following the original deﬁnition of symbiosis by de Bary (1879). Altogether, 350 bryosymbiotic fungi belonging to more than 90 genera are currently known (Döbbeler, 2002). The *Corresponding author: E-mail address: tojula@utu.ﬁ The Willi Hennig Society 2009 most common of them are ascomycetes, although basidiomycetes, chytridiomycetes, and some representatives of the ‘‘zygomycetes’’ and oomycetes, or water moulds, are also known (see Racovitza, 1959; Felix, 1988; Kost, 1988; Döbbeler, 1997). Some of the ascomycete bryosymbionts are lichenized but most are not. Both mosses and hepatics include host taxa highly favoured by these fungi; some fungi are generalists and some are very strictly specialized to their host or even to a speciﬁc host organ (Döbbeler, 1997). However, almost all are speciﬁc to at least some extent: they are conﬁned to bryophytes only. Research has so far been concentrated mainly on describing new species or listing various types of fungal– bryophytic association. Phylogenetic analyses including bryosymbiotic microfungi have practically been nonexistent, the work by Hambleton et al. (2003) being among the rare exceptions. The review by Davey and Currah (2006) provides an excellent survey of all research done in the ﬁeld so far. 282 S. Stenroos et al. / Cladistics 26 (2010) 281–300 Even though many bryosymbionts have been assigned to families, their accurate relationships based on molecular data have not been conﬁrmed. Morphological or even anatomical data are often not enough, as these fungi can be extremely reduced phenotypically. Our main goal was to present a comprehensive phylogenetic analysis incorporating a number of bryosymbiotic ascomycetes, which were screened during our research project ‘‘Epibryophytic and lichenicolous fungi in Finland (2003–08)’’. Materials and methods Acquisition of sequence data Bryosymbiotic microfungi were screened from freshly collected bryophyte hosts and were successfully isolated from the moss genera Atrichum, Ceratodon, Paraleucobryum, Pleurozium, Polytrichastrum, Polytrichum, and Sphagnum, as well as hepatic genera Blepharostoma, Cephalozia, Diplophyllym, Frullania, Gymnomitrion, Jungermannia, Lophocolea, Lophozia, Pellia, Plagiochila, Ptilidium, and Scapania. Of Sphagnum, the following species were studied: S. angustifolium, S. capillifolium, S. centrale, S. compactum, S. fimbriatum, S. flexuosum, S. fuscum, S. girgensohnii, S. lindbergii, S. magellanicum, S. palustre, S. riparium, S. rubellum, S. russowii, and S. squarrosum. Isolated ascospores or ascomata were cultured on malt extract agar (MEA) containing chloramphenicol. Spores were isolated in two ways. The coarser method was to attach a living ascoma to a drop of agar on the inside of a lid of a Petri dish, where it was allowed to release ascospores on the agar plate for a few hours or up to 1 day, depending on the rate of spore release. If this method was ineﬀectual, single spores were isolated from ascomata using micromanipulation equipment. In a few cases where spores could not be isolated or they would not germinate on agar, whole ascomata or pieces of them were cultured, but this was soon realized to be a possible source of contamination. Mycelia were allowed to grow for ca. 2 months at room temperature. Cultures are deposited at the CBS Fungal Biodiversity Centre (http://www.cbs.knaw.nl). For further information, please contact the authors. Total DNA was extracted either from these cultures or, if cultures could not be produced or they were suspected to be contaminated, directly from ascomata, the number of ascomata being a few or a few hundred, depending on their size. All ascomata of bryosymbiotic fungi used in DNA extraction were collected directly from fresh or dried bryophyte hosts. DNA extraction was performed using the QIAamp DNA Mini Kit (Qiagen) according to the manufacturerÕs protocol. The following ﬁve gene loci were ampliﬁed: partial rDNA SSU (ca. 1700 bp), partial rDNA LSU (c. 1300 bp), partial RPB2 (c. 900 bp), partial mitochondrial rDNA SSU (c. 1100 bp), and rDNA 5.8S (c. 170 bp). Primers are listed in Table 1. illustra puReTaq ReadyTo-Go PCR Beads (GE Healthcare) were used in the ampliﬁcation and the reactions were performed with the GeneAmp PCR System 9700 (PE Applied Biosystems). The PCR conditions were as follows: 60 s at 95 C (denaturation); 60 s at 56 C (SSU), 52 C (LSU), 55 C (RPB2) or 60 C (5.8S; annealing); and 60 s at 72 C (extension). Thirty cycles were used, preceded by 5 min at 95 C (initial denaturation), and followed by 7 min at 72 C (ﬁnal extension). For mtSSU rDNA, 35 cycles were used. Denaturation and annealing times were 30 s, and annealing temperatures were 52 C for cycles 1– 5 and 50 C for cycles 6–35. The PCR products obtained were puriﬁed with illustra GFX PCR DNA and the Gel Band Puriﬁcation Kit (GE Healthcare) according to the manufacturerÕs protocol. BigDye Terminator Cycle Sequencing Ready Reaction Kit ver. 1.1 (Applied Biosystems) was used for the sequencing reactions. They were run using the same equipment as for the PCR. A 25-cycle sequencing schedule was performed with a denaturation temperature of 96 C for 30 s, an annealing temperature of 50 C for 15 s, and an extension temperature of 60 C for 4 min. The post-reaction puriﬁcation of samples was done using Montage SEQ96 Sequencing Reaction Cleanup Kit (Millipore) according to the manufacturerÕs protocol. Sequencing was carried out with the MegaBACE 1000 DNA Analysis System (GE Healthcare). Part of the sequencing was performed at Macrogen Inc. (http://www.macrogen.com) in Seoul, South Korea. Primers used in sequencing are listed in Table 1. Phylogenetic analysis For the present study we included 202 samples of the Ascomycota, including representatives from the classes Arthoniomycetes, Dothideomycetes, Eurotiomycetes, Lecanoromycetes, Leotiomycetes, Lichinomycetes, Neolectomycetes, Orbiliomycetes, Pezizomycetes, Saccharomycetes, and Sordariomycetes. Four representatives of the Basidiomycota were included as outgroup species. We sequenced 78 samples, 61 of which are bryosymbiotic fungi. The rest of the sequence data were obtained from the National Center for Biotechnology Information (NCBI) database (http://www.ncbi.nlm.nih.gov). A list of all taxa and the GenBank accession numbers are provided in Table 2. Voucher specimens are deposited in the Herbarium, University of Turku, Finland (TUR). Sequence alignments were produced with ClustalX and complemented by manual adjustments in order to maximize positional homology. Ambiguously aligned regions and introns were excluded. 283 S. Stenroos et al. / Cladistics 26 (2010) 281–300 Table 1 Primers used in PCR and sequencing reactions Primer Sequence Type Reference SSU-0021-5¢ SSU-0072-5¢(NS17UCB) SSU-0402-5¢(NS19UCB) SSU-0497-3¢(NS18UCB) SSU-0819-5¢(NS21UCB) SSU-0852-3¢(NS20UCB) SSU-1203-5¢(NS23UCB) SSU-1293-3¢(NS22UCB) SSU-1750-3¢(NS24UCB) SR8R SR4 CTGGTTGATTCTGCCAGT CATGTCTAAGTTTAAGCAA CCGGAGAAGGAGCTTGAGAAAC CTCATTCCAATTACAAGACC GAATAATAGAATAGGACG CGTCCCTATTAATCATTACG GACTCAACACGGGGAAACTC AATTAAGCAGACAAATCACT AAACCTTGTTACGACTTTTA GAACCAGGACTTTTACCTT AAACCAACAAAATAGAA PCR, sequencing PCR, sequencing PCR, sequencing Sequencing PCR, sequencing PCR, sequencing Sequencing PCR, sequencing PCR, sequencing PCR, sequencing Sequencing Gargas and DePriest (1996) Gargas and Taylor (1992) Gargas and Taylor (1992) Gargas and Taylor (1992) Gargas and Taylor (1992) Gargas and Taylor (1992) Gargas and Taylor (1992) Gargas and Taylor (1992) Gargas and Taylor (1992) Vilgalys (2008) Vilgalys (2008) LR0R LR7 LR3R LR5 LR3 ACCCGCTGAACTTAAGC TACTACCACCAAGATCT GTCTTGAAACACGGACC TCCTGAGGGAAACTTCG CCGTGTTTCAAGACGGG PCR, sequencing PCR, sequencing Sequencing Sequencing Sequencing Cubeta et al. (1991) Vilgalys and Hester (1990) Rehner and Samuels (1995) Rehner and Samuels (1995) Rehner and Samuels (1995) fRPB2-7cF fRPB2-11aR RPB2-7F RPB2-3053R ATGGGYAARCAAGCYATGGG GCRTGGATCTTRTCRTCSACC ATGGGKAAGCARGCWATGGG TGRATYTTRTCRTCSACCATRTG PCR PCR Sequencing Sequencing Liu et al. (1999) Liu et al. (1999) Liu et al. (1999) Reeb et al. (2004) ITS1-LM ITS2-KL ITS1-F ITS4 ITS5 GAACCTGCGGAAGGATCATT ATGCTTAAGTTCAGCGGGTA CTTGGTCATTTAGAGGAAGTAA TCCTCCGCTTATTGATATGC GGAAGTAAAAGTCGTAACAAGG PCR, sequencing PCR, sequencing PCR PCR Sequencing Myllys et al. (1999) Lohtander et al. (1998) Gardes and Bruns (1993) White et al. (1990) White et al. (1990) mtSSU1-KL mtSSU2-KL AGTGGTGTACAGGTGAGTA ATGTGGCACGTCTATAGCCCA PCR, sequencing PCR, sequencing Lohtander et al. (2002) Lohtander et al. (2002) Phylogenetic trees were constructed using parsimony as an optimality criterion in the analysis performed with MacOSX TNT ver. 1.1 (Goloboﬀ et al., 2008). Gaps were treated as a ﬁfth character state. Heuristic searches were performed sequentially using command xmult (set at levels 7–10 on the scale of 0–10), which is composed of sectorial searches, drifting, ratchet and fusing combined. This was repeated seven times with the total number of rearrangements evaluated during each search ranging from 1.65 to 51.8 · 109. Altogether, 31 equally parsimonious trees were found (length 26 433). The strict consensus tree is shown in Fig. 1. Jackknife support values (Farris et al., 1996) for the branches were calculated using TNT. The removal probability for characters in parsimony jackkniﬁng is e)1, making these support values comparable with bootstrap values, as originally described by Farris et al. (1996). Results and discussion recently published (James et al., 2006; Spatafora et al., 2006). In the cladogram, the classes Eurotiomycetes, Lecanoromycetes, Leotiomycetes, Lichinomycetes, Orbiliomycetes, Pezizomycetes (excluding Peziza quelepidotia), Saccharomycetes, and Sordariomycetes appear as monophyletic entities. Arthoniomycetes (represented by Lecanactis abietina) was placed within the Dothideomycetes. The newly discovered taxon, Trizodia acrobia, was placed basal to the Leotiomycetes, and could be included in it (Figs 1 and 2). Bryosymbiotic fungi were found in six diﬀerent classes: Dothideomycetes, Eurotiomycetes, Lecanoromycetes, Leotiomycetes, Pezizomycetes, and Sordariomycetes, suggesting multiple independent origins of the fungus–bryophyte associations (Figs 1 and 2). These are discussed in alphabetical order below. Of the 19 bryophyte host genera screened, Plagiochila, Polytrichum, Ptilidium, and Sphagnum displayed the highest diversity of associated fungi. Altogether, we found three unknown genera and 30 unknown species of ascomycete, and resolved the relationships of many more. Phylogenetic reconstructions Dothideomycetes Analysis of combined data sets of ﬁve gene loci resulted in a highly resolved phylogeny of the Ascomycota (Figs 1 and 2), which largely agrees with those Dothideomycetes contains bitunicate ascostromatic fungi, which act as pathogens, endophytes or epiphytes 284 S. Stenroos et al. / Cladistics 26 (2010) 281–300 Table 2 List of taxa, herbarium voucher numbers at TUR, and GenBank accession numbers GenBank accession number Taxa TUR herbarium voucher number SSU LSU 5.8S mtSSU RPB2 *Absconditella sphagnorum *Absconditella sphagnorum M24 Absconditella sp. Acarospora schleicheri Acarosporina microspora *Acrospermum adeanum M133 Acrospermum compressum M151 Acrospermum graminum Acrospermum graminum M152 Aleuria aurantia Alternaria alternata Arachnopeziza variepilosa M337 Baeomyces placophyllus Bisporella citrina M253 Bombardia bombarda Botryosphaeria ribis *Bryocentria brongniartii M139 *Bryocentria brongniartii M190 *Bryocentria metzgeriae M140 *Bryochiton microscopicus M331 *Bryochiton monascus M218 *Bryochiton perpusillus M202 *Bryochiton sp. M198 Bryoglossum gracile *Bryoscyphus dicrani M141 *Bryoscyphus sp. M230 Bulgaria inquinans Byssochlamys nivea Byssothecium circinans Calicium viride Candida albicans Capnodium citri Capronia mansonii Capronia pilosella Cephalotheca sulfurea Ceratocystis pilifera Cercophora caudata Chaetomella raphigera Cheilymenia stercorea Cheilymenia vitellina M169 Coenogonium luteum Coltricia perennis Cordyceps militaris Cudonia circinans Cudoniella clavus Curvularia brachyspora Cyathicula microspora M267 Delphinella strobiligena Dermatocarpon luridum Diaporthe phaseolorum Didymella cucurbitacearum (+Didymella bryoniae) Diploschistes scruposus *Discinella schimperi M168 *Discinella schimperi M191 *Discinella schimperi M192 Discosphaerina fagi Discula destructiva Dothidea insculpta – 165532 – – – – 178063 – 178061 – – 99569 – 173277 – – 178069 172139 178068 185347 181772 39898 181399 – 185318 185312 – – – – – – – – – – – – – 185346 – – – – – – 178003 – – – – – – 185323 185320 185324 – – – – EU940022 – AY640986 AY584667 EU940031 EU940012 AF242259 EU940013 AY544698 U05194 – AY640988 EU940014 DQ471021 AF271129 EU940032 EU940052 – EU940073 EU940059 EU940058 EU940057 AY789419 EU940034 EU940065 AY789343 M83256 AY016339 AF356669 X53497 AY016340 X79318 U42473 AF096173 DQ471003 DQ368659 AY487078 AY544705 EU940044 AF279386 U59064 AB084156 AF107343 DQ470992 L36995 EU940015 AY016341 AY640989 L36985 AY293779 – AF279388 EU940043 EU940053 EU940054 AY016342 AF429719 DQ247810 AY300824 EU940095 AY300825 AY640945 AY584643 EU940104 EU940084 – EU940085 AY544654 AB192875 EU940086 AY640947 EU940087 DQ470970 AY004336 EU940105 EU940125 EU940106 EU940149 EU940132 EU940131 EU940130 AY789420 EU940107 EU940139 AY789344 AY176750 AY016357 AF356670 X70659 AY004337 AY004338 AF279378 AF431950 DQ470955 AY999113 AY487077 AY544661 EU940117 AF279387 AF311004 AF327374 AF279379 DQ470944 AF279380 EU940088 AY016358 AY640948 U47830 AY293792 – AF279389 EU940116 EU940126 EU940127 AY016359 AF408359 DQ247802 – EU940172 – AY853353 – EU940180 EU940161 – EU940162 AF072090 AY787684 EU940163 – EU940164 – AF027744 EU940181 – EU940182 EU940224 EU940208 EU940207 EU940206 AY789421 EU940183 EU940215 AY789345 AY376406 – AY450582 AY672930 – AF050247 AF050255 – AY934516 AY999135 AY487076 DQ491500 EU940193 – DQ234559 AB084156 – DQ491502 AF212308 EU940165 – AF333133 AY745987 AY293804 – AJ458287 EU940192 EU940202 EU940203 – AF429748 AF027764 AY300872 EU940247 AY300873 AY853305 AY584612 EU940256 EU940237 – EU940238 – AY278849 – – EU940239 – AF271148 EU940257 – EU940258 EU940289 EU940276 EU940275 EU940274 – – – – AY176703 – AY584696 – AF346421 AF346422 AY584697 AF431953 – – – AY544733 – AY584699 U27028 AB027357 AY584700 – AY584701 EU940240 – AY607744 AY779326 – – AY584692 EU940265 – EU940271 – – – – EU940311 – AY641026 AY584682 EU940320 EU940301 – EU940302 – – – AY641030 EU940303 – – EU940321 EU940338 EU940322 – EU940345 EU940344 EU940343 – EU940323 EU940351 – AF107794 – AY641031 AF107787 – AF107797 AF107798 – – – – – EU940329 AY641038 AY218526 AY932763 AY641033 DQ470888 AF107803 EU940304 – AY641035 AY641036 – AF107801 AY641039 EU940328 EU940339 EU940340 – – DQ247792 285 S. Stenroos et al. / Cladistics 26 (2010) 281–300 Table 2 (Continued) GenBank accession number Taxa TUR herbarium voucher number SSU LSU 5.8S mtSSU RPB2 *Epibryon bryophilum M2 *Epibryon diaphanum M122 *Epibryon hepaticola M10 *Epibryon hepaticola M224 *Epibryon intercapillare M125 *Epibryon interlamellare M1 *Epibryon interlamellare M32 *Epibryon interlamellare M223 *Epibryon plagiochilae M187 *Epibryon turfosorum M292 *Epibryon sp. D M274 *Epibryon sp. E M175 *Epiglia gloeocapsae M193 *Epiglia gloeocapsae M257 Exophiala jeanselmei Fabrella tsugae Fungal endophyte 2712 Fungal endophyte 2834 Fungal endophyte 3277 Fungal endophyte 3377 Fungal endophyte 4221 Fungal endophyte 4245 Fungal endophyte 4466 Fungal endophyte 4573 Fungal endophyte 4603 Fungal endophyte 4780 Fungal endophyte 4939 Fungal endophyte 4947A Fungal endophyte 5095 Fungal endophyte 5246 Fungal endophyte 5607 Fungal endophyte 5627 Gautieria otthii Geoglossum nigritum Glyphium elatum Gyalecta ulmi Heyderia abietis Hyaloscypha albohyalina M259 Hyaloscypha aureliella M234 Hyaloscypha aureliella M235 Hyaloscypha daedaleae Hyaloscypha fuckelii M233 *Hyaloscypha hepaticola M171 *Hyaloscypha hepaticola M339 *Hyaloscypha paludosa aff. A M178 *Hyaloscypha paludosa aff. A M228 *Hyaloscypha paludosa aff. A M229 *Hyaloscypha paludosa aff. B M132 Hyaloscypha vitreola M39 Hyaloscypha vitreola M236 *Hyaloscypha sp. A M19 *Hyaloscypha sp. A M25 *Hyaloscypha sp. B M20 *Hyaloscypha sp. B M288 Hymenoscyphus fructigenus M159 Hymenoscyphus scutula *Hymenoscyphus sp. A M33 *Hymenoscyphus sp. A M35 *Hymenoscyphus sp. A M68 165759 174744 174793 174766 174738 159617 164917 174960 185319 174926 174711 174751 185311 185313 – – – – – – – – – – – – – – – – – – – – – – – 185317 172136 173173 – 172135 180982 180981 185321 185322 185314 174761 164914 173172 165550 165551 165549 174933 164966 – 165568 165554 185343 EU940017 EU940028 EU940018 EU940062 EU940029 EU940016 EU940024 EU940135 – – EU940067 EU940047 EU940055 – X80705 AF106015 DQ979465 DQ979469 DQ979472 DQ979480 DQ979487 DQ979488 DQ979490 DQ979492 DQ979494 DQ979498 DQ979499 DQ979500 DQ979503 DQ979504 DQ979753 DQ979757 AF393043 AY544694 AF346419 AF465464 AY789295 EU940075 EU940076 EU940077 – EU940078 EU940045 EU940074 EU940048 EU940063 EU940064 EU940030 EU940079 EU940080 EU940019 EU940023 EU940020 EU940069 EU940081 AY789430 EU940025 EU940026 EU940027 EU940090 EU940101 EU940091 EU940136 EU940102 EU940089 EU940097 EU940211 EU940124 EU940145 EU940142 EU940120 EU940128 EU940140 AF050271 AF356694 DQ979419 DQ979423 DQ979426 DQ979434 DQ979441 DQ979442 DQ979444 DQ979446 DQ979448 DQ979452 DQ979453 DQ979454 DQ979457 DQ979458 DQ979460 DQ979461 AF336249 AY544650 AF346420 AF465463 AY789296 EU940151 EU940152 EU940153 AY789414 EU940154 EU940118 EU940150 EU940121 EU940137 EU940138 EU940103 EU940155 EU940156 EU940092 EU940096 EU940093 EU940144 EU940157 AY789431 EU940098 EU940099 EU940100 EU940167 EU940178 EU940168 EU940212 – EU940166 EU940174 EU940278 EU940201 EU940221 EU940218 EU940196 EU940204 EU940216 AF050271 U92304 DQ979516 DQ979534 DQ979552 DQ979584 DQ979611 DQ979614 DQ979633 DQ979663 DQ979671 DQ979707 DQ979711 DQ979713 DQ979726 DQ979728 DQ979506 DQ979507 AF377073 DQ491490 – – AY789297 EU940227 EU940228 EU940229 AY789415 EU940230 EU940194 EU940226 EU940197 EU940213 EU940214 EU940179 EU940231 EU940232 EU940169 EU940173 EU940170 EU940220 EU940233 AY789432 EU940175 EU940176 EU940177 EU940242 EU940253 EU940243 EU940279 EU940254 EU940241 EU940249 EU940348 – EU940285 – EU940268 EU940272 – – – – – – – – – – – – – – – – – – – AF393085 AY544740 AF346425 AY300888 – EU940291 EU940292 EU940293 AY789416 EU940294 EU940266 EU940290 EU940269 EU940280 EU940281 EU940255 EU940295 EU940296 EU940244 EU940248 EU940245 EU940284 EU940297 – EU940250 EU940251 EU940252 EU940306 EU940317 EU940307 EU940349 EU940318 EU940305 EU940313 EU940337 EU940355 – EU940332 EU940341 – AF107796 – – – – – – – – – – – – – – – – – AY218486 – – AY641044 – EU940360 EU940361 EU940362 – EU940363 EU940330 EU940359 EU940333 – EU940350 EU940319 EU940364 – EU940308 EU940312 EU940309 EU940354 EU940365 – EU940314 EU940315 EU940316 286 S. Stenroos et al. / Cladistics 26 (2010) 281–300 Table 2 (Continued) GenBank accession number Taxa TUR herbarium voucher number SSU LSU 5.8S mtSSU RPB2 *Hymenoscyphus sp. B M293 *Hymenoscyphus sp. B M329 Hymenoscyphus sp. M315 Hypocrea citrina Hypoxylon fragiforme Lachnum virgineum *Lamprospora sp. M185 Lasiosphaeria ovina M176 Lecanactis abietina Lempholemma polyanthes Lentinula lateritia Leptogium cyanescens *Leptomeliola ptilidii M186 *Lizonia sexangularis M179 *Lizonia sexangularis M222 Lobaria quercizans (+Pseudocyphellaria dissimilis) Lophodermium pinastri Merimbla ingelheimense Microascus trigonosporus Microglossum rufum *Microscypha sp. A M147 *Microscypha sp. A M155 Mitrula brevispora *Mniaecia jungermanniae M145 *Mniaecia nivea M167 *Monascostroma sphagnophilum M23 Morchella esculenta Mycosphaerella punctiformis Myriangium duriaei Nectria cinnabarina Neobulgaria lilacina M258 Neolecta vitellina Neurospora crassa *Octosporella erythrostigma M144 *Octosporella jungermanniarum M221 Oidiodendron tenuissimum Ombrophila violacea Orbilia auricolor Orbilia vinosa Otidea onotica Peltula umbilicata Pertusaria amara Petractis luetkemuelleri Peziza quelepidotia *Pezoloma ciliifera M283 *Pezoloma ciliifera M295 Phaeosphaeria avenaria Phaeotrichum benjaminii Phialophora pedrosoi Phoma herbarum Piedraia hortae Pilidium concavum Placopsis perrugosa Placynthiella icmalea M173 Placynthium nigrum Pleomassaria siparia Pleopsidium chlorophanum *Pleostigma jungermannicola M174 174911 178009 178202 – – – 185344 178059 – – – – 174713 178070 178053 – – – – – – 174024 185175 – 168869 185325 165543 – – – – 185315 – – 178060 178050 – – – – – – – – – 174364 174910 – – – – – – – 168868 – – – 168873 EU940070 EU940072 – AY544693 AB014045 AY544688 EU940050 EU940082 AY548805 AF356690 AF026596 AF356671 EU940051 EU940049 EU940061 AF279396 – AF106014 D14406 L36987 DQ257358 EU940037 EU940039 AY789292 EU940036 EU940042 EU940021 U42642 AY490775 AY016347 AB003949 EU940066 Z27393 X04971 EU940035 EU940060 AB015787 AY789364 DQ471001 DQ471000 AF006308 AF356688 AF274104 AF465461 U42665 EU940068 EU940071 AY544725 AY016348 L36997 AY293777 AY016349 AY487099 AF356659 EU940083 AF356673 AF164373 AY316151 EU940046 EU940146 EU940148 EU940158 AY544694 AY083829 AY544646 EU940123 EU940159 AY548812 AF356691 AF356165 AF356672 – EU940122 EU940134 AF279397 – AY004334 AB000620 U47835 DQ257359 EU940110 EU940112 AY789293 EU940109 EU940115 EU940094 AF279398 AY490776 AY016365 AF193237 EU940141 DQ470985 AF286411 EU940108 EU940133 AB040706 AY789365 DQ470953 DQ470952 AF335121 AF356689 AF356683 AF465454 AY640959 EU940143 EU940147 AY544684 AY004340 AF356666 AY293790 AY016366 AY487098 AF356660 EU940160 AF356674 AY004341 AY640960 EU940119 EU940222 EU940225 EU940234 DQ491488 AY618235 DQ491485 EU940199 EU940235 AY548804 – AF031192 – EU940200 EU940198 EU940210 AF524921 – AY247753 AF454075 DQ491513 DQ257360 EU940186 EU940189 AY789294 EU940185 EU940188 EU940171 AJ543741 AY490763 – AB237663 EU940217 – AY681193 EU940184 EU940209 AF062807 AY789366 DQ491512 DQ491511 AF072068 – – – – EU940219 EU940223 U77359 AY538349 AF050276 AY293802 – AY487097 AY584716 EU940236 – – AY853384 EU940195 EU940286 EU940288 EU940298 AY544743 – AY544745 – EU940299 AY548813 AY584709 U27047 AY340496 – EU940270 EU940277 – AM235370 AY584710 AY584707 – – EU940260 EU940262 – EU940259 EU940264 EU940246 AF346426 – AY350575 AF315209 EU940282 – AF442356 – – – – – – – AY584711 AY584713 AY584714 AY584715 EU940283 EU940287 – – – – – – – EU940300 AY584717 – AY853335 EU940267 EU940356 EU940358 EU940366 – – DQ470877 EU940335 EU940367 AH013900 AY641050 – AY641051 EU940336 EU940334 EU940347 AY641052 – – AY641082 AF107792 – – – – EU940324 – EU940310 AY641054 AY485626 – – EU940352 AF107786 AF107789 – EU940346 – – DQ470903 – – AY641046 AY641059 AY641061 AF107809 EU940353 EU940357 DQ499814 – – – – – AY641063 EU940368 AY641052 – AY641064 EU940331 287 S. Stenroos et al. / Cladistics 26 (2010) 281–300 Table 2 (Continued) GenBank accession number Taxa TUR herbarium voucher number SSU LSU 5.8S mtSSU RPB2 Porpidia albocaerulescens Preussia terricola Pseudonectria rousseliana *Puttea margaritella M149 Pyrenula cruenta Rhytisma acerinum (+Rhytisma salicinum) Saccharomyces cerevisiae Saitoella complicata *Scleroconidioma sphagnicola Sclerotinia sclerotiorum Setomelanomma holmii Setosphaeria monoceras Seynesia erumpens Sistotrema muscicola Sordaria macrospora Spathularia flavida Sphaerophorus globosus Stephanonectria keithii Stereocaulon alpinum (+Stereocaulon paschale) Stictis radiata Stylodothis puccinioides *Teichospora sp. M195 Trematosphaeria heterospora Trichoglossum hirsutum *Trizodia acrobia M157 *Trizodia acrobia M160 Verrucaria pachyderma Verruculina enalia Vibrissea truncorum Westerdykella cylindrica Xylaria acuta – – – 174756 – – – – – – – – – – – – – – – – – – – 185316 – – 165560 165562 – – – – – AF356675 AY544726 AF543767 EU940038 AF279406 AF356695 – J01353 AY548297 AY220610 L37541 AY161121 AY016352 AF279409 AF334936 AY641007 Z30239 AF117983 AY489695 – AF279412 U20610 AY016353 EU940056 AY016354 AY544697 EU940040 EU940041 AF356667 AY016346 AY789401 AY016355 AY544719 AF356676 AY544686 U17416 EU940111 AF279407 AF356696 – J01355 AY548296 – AF431951 AF525678 AY016368 AF279410 AF518649 AY346301 AF433142 AF356680 AY489727 DQ534486 AF279413 AF356663 AY004342 EU940129 AY016369 AY544653 EU940113 EU940114 AF356668 AY016363 AY789402 AY004343 AY544676 – – – EU940187 – – AY465516 AY247400 – AY220610 DQ059577 AF525675 AF071340 – AJ606040 AF246293 AF433152 AY256779 AF210671 – – AY527308 – EU940205 – DQ491494 EU940190 EU940191 – – AY789403 DQ491519 DQ491493 AY584718 AY544754 – EU940261 AY584719 – – J01459 AY548290 – AF431961 – – AY584721 AF334892 AY584722 AY575101 AY584723 – – AY340525 AY527308 AF346428 EU940273 AF346429 AY584733 – EU940263 AY584730 – – AF346430 AY544759 AY641066 – – EU940325 AY641067 AY641070 – M15693 AY548300 – DQ470916 – – AY641073 – AY641074 – AY485632 – AY641078 AY641079 – EU940342 – AY641087 EU940326 EU940327 – – – DQ470925 DQ247797 The following taxa are combined in the matrices: Didymella cucurbitacearum + D. bryoniae, Lobaria quercizans + Pseudocyphellaria dissimilis, Rhytisma acerinum + R. salicinum, and Stereocaulon alpinum + S. paschale. Bryosymbiotic fungi are marked with an asterisk (*); taxa followed by a laboratory code beginning with M (e.g. M1) were sequenced for this study. of plants; saprobes on plant litter or dung; or parasites of fungi or animals; some are even lichenized (Schoch et al., 2006; Spatafora et al., 2006). The class also contains some of the most virulent parasites of bryophytes. These parasites are distributed into at least three diﬀerent orders. Lizonia sexangularis is a necrotrophic parasite on Polytrichastrum sexangulare. It occupies the hostÕs gametangia, preventing their development and causing the death of the apical plant region (Döbbeler, 1987). A few other bryosymbiotic species of Lizonia are also known, all of which are speciﬁc to a certain species of the Polytrichaceae (Döbbeler, 1978). Lizonia has so far been assigned to the Pseudoperisporiaceae, a family of uncertain position in the Dothideomycetes (Lumbsch and Huhndorf, 2007a). However, our analysis places Lizonia in the order Pleosporales. Genus Bryochiton comprises ﬁve bryosymbiotic species, of which B. monascus and B. perpusillus are among the tiniest of all ascomycetes: their ascomata range from 25 to 50 lm in size (Döbbeler, 1978, 2007). Similar to Lizonia, Bryochiton has been assigned to the Pseudoperisporiaceae, although with uncertainty (Lumbsch and Huhndorf, 2007a). It is clearly separate from Lizonia, forming a clade in the Capnodiales, with B. microscopicus being left out from the rest of the group. Their phylogeny is consistent with morphology and ecology: B. microscopicus has fusoid or narrowly ellipsoid spores and it is conﬁned to the hepatic genus Gymnomitrion, while other Bryochiton species have ellipsoid spores with broadly rounded ends and occur on leaves of the Polytrichaceae and some other mosses, mostly with leaves ending in a hyaline hair-point, although B. perpusillus has a wider host spectrum extending to hepatics (Döbbeler, 1978, 288 S. Stenroos et al. / Cladistics 26 (2010) 281–300 (a) Fig. 1. A strict consensus of 31 trees obtained from the ﬁve-gene parsimony analysis using TNT. Jackknife support values are given at nodes. Bryosymbiotic fungi are marked with black dots. Taxa followed by a laboratory code beginning with M (e.g. M1) were sequenced for this study. (a) The uppermost part of the tree containing Basidiomycota, Neolectomycetes, Saccharomycetes, Pezizomycetes, Orbiliomycetes, Geoglossaceae, and Leotiomycetes. The location of the novel ascomycete lineage, represented by Trizodia acrobia, is indicated with an arrow. (b) The medial part of the tree containing Lecanoromycetes and Dothideomycetes + Arthoniomycetes. (c) The lowest part of the tree containing Lichinomycetes, Sordariomycetes, and Eurotiomycetes. 289 S. Stenroos et al. / Cladistics 26 (2010) 281–300 (b) Fig. 1b. (Continued) 2007). In fact, B. microscopicus seems more closely related to Monascostroma sphagnophilum, which is a species growing on dying, bleached, algae-covered shoots of Sphagnum. Unlike Bryochiton, M. sphagnophilum does not have an ostiolum through which spores are released, but the outer layer of the ascoma ruptures at maturity (Döbbeler, 1978). Monascostroma has been assigned to the family Pleosporaceae of the order Pleosporales (Lumbsch and Huhndorf, 2007a), but at least M. sphagnophilum seems to belong to the Capnodiales. Species of Acrospermum are mostly saprobic: A. compressum grows on dead stems of Urtica dioica and A. graminum on grass culms. Acrospermum adeanum (Fig. 3a), however, is a necrotrophic parasite and has been observed on 32 diﬀerent moss species from 22 diﬀerent genera, most of which belong to the pleurocarpous superorder Hypnanae (Döbbeler, 1979a; Bell and Newton, 2004). The host plants grow on calcareous rocks and bark of deciduous trees, so the wide host selection of A. adeanum might best be explained by its preference for certain ecological conditions instead of taxonomically closely related hosts (Döbbeler, 1979a). Acrospermum has been placed in family Acrospermaceae, the ordinal placement of 290 S. Stenroos et al. / Cladistics 26 (2010) 281–300 (c) Fig. 1c. (Continued) which is unclear (Lumbsch and Huhndorf, 2007a). On the basis of our analysis, the genus is situated close to, or possibly within, the order Pleosporales. Scleroconidioma sphagnicola is an anamorphic fungus described from necrotic patches of Sphagnum fuscum (Tsuneda et al., 2000; Scleroconidioma was not collected in this study). It is parasitic on its host, penetrating into chlorophyllose cells and causing the degeneration of chloroplasts (Tsuneda et al., 2001). The ascomata of Scleroconidioma have never been encountered. Scleroconidioma is placed in the Dothideales, as suggested by Hambleton et al. (2003). An unidentiﬁed vascular endophyte (no. 4947A), found on Picea mariana in the southern boreal forest of Quebec, Canada (Higgins et al., 2007), appears in an unresolved clade together with Scleroconidioma and Delphinella. Arthoniomycetes (here represented by Lecanactis abietina) has proven to be closely related to the Dothideomycetes in many earlier analyses. Lutzoni et al. (2004) showed a non-monophyletic Dothideomycetes with Arthoniomycetes in between the subgroupings, a result somewhat similar to ours. The latest results show a sister relationship of these two classes, and they are referred to as ‘‘Dothideomyceta’’ (Schoch et al., 2009). Eurotiomycetes All of the bryosymbiotic taxa in this clade are placed in the subclass Chaetothyriomycetidae, order Chaetothyriales, which comprises bitunicate, ascostromatic, non-lichenized species (see Spatafora et al., 2006). Hitherto the genus Epibryon (Fig. 3d) has, although with uncertainty, been assigned to the family Pseudoperisporiaceae, which belongs to the Dothideomycetes (Lumbsch and Huhndorf, 2007a). Since it is currently unclear which morphological characters are associated with the Chaetothyriomycetidae and which with the Dothideomycetes (Lumbsch and Huhndorf, 2007b), it is not surprising that molecular evidence now places the genus into a class diﬀerent from that previously assumed. Also, Leptomeliola ptilidii, S. Stenroos et al. / Cladistics 26 (2010) 281–300 291 extensive sampling and use of sequence-level characters. This is very challenging because uncontaminated cultures of these minute fungi are extremely laborious to produce, as these species do not release their spores easily. It also seems that some taxa hitherto considered as species may actually consist of several species that we cannot tell apart at the moment (e.g. E. interlamellare). The sister clade of Epibryon intercapillare, E. hepaticola, and an undescribed species consists of saprobes and facultative human ⁄ animal pathogens from the family Herpotrichiellaceae (Untereiner et al., 1995; Geiser et al., 2006). Of the species in this clade, Glyphium has been regarded as a genus of uncertain position in the Chaetothyriomycetidae (Lumbsch and Huhndorf, 2007a). Lecanoromycetes Fig. 2. A simpliﬁcation of the strict consensus tree illustrated in Fig. 1. The newly found bryosymbiont, Trizodia acrobia, was placed basal to the Leotiomycetes in the parsimony analysis. Pleostigma jungermannicola, and Teichospora sp. belong to the Chaetothyriales of the Chaetothyriomycetidae. All these taxa have so far been assigned to the Dothideomycetes. Epibryon is a so-called ‘‘waste-basket genus’’ (Döbbeler, 1997), with over 40 species assigned to it. Many of the species are very common and have broad geographical distributions; most are biotrophic parasites and some act as saprobes (Döbbeler, 1978). Morphologically, the species are rather diverse but share certain characters: their ascomata are globose or semiglobose, usually setose at the upper part; spores are two- or multi-celled, hyaline to brown, smooth; and hymenial gel stains red with LugolÕs solution (Döbbeler, 1978). The polyphyly of Epibryon would probably have been even more obvious had the taxon sampling been more comprehensive. In the current cladogram, there is one species from another genus, Leptomeliola, nested within one of the Epibryon groupings. Also, the notable diﬀerences in rDNA ITS sequences detected during the aligning process might indicate that Epibryon species are probably not very closely related. Epibryon will possibly be split into several smaller genera, but this requires The class Lecanoromycetes includes the majority of all lichen-forming fungi. They form bipartite or tripartite symbioses with chlorococcalean or ﬁlamentous green algae, or with cyanobacteria (for instance see Miadlikowska et al., 2006). Some of the taxa are nonlichenized, and some of both the lichenized and nonlichenized taxa are lichenicolous, that is, they grow on lichen thalli. Epiphytes are common in this class, and bryoparasitic lichens are known from genera Bacidia, Micarea, Protothelenella, Vezdaea, and several others (Poelt, 1985). Two of the screened bryosymbionts, Absconditella spagnorum (Fig. 3b) and Lecidea margaritella, belong here. Both taxa are lichenized with a green alga, but neither forms a clearly structured thallus. Absconditella sphagnorum was found on the apical shoots of Sphagnum compactum, S. fuscum and S. magellanicum (see also Vězda, 1965). It is apparently a necrotrophic parasite, which eventually kills its host. Absconditella belongs to the Ostropales s. lat. (sensu Miadlikowska et al., 2006). Its closest relatives are members of the Stictidaceae, which are preliminarily saprobic, but some have a peculiar ability to develop either as lichens or saprobes depending on their substrate (Wedin et al., 2006). The analyses, for example by Lumbsch et al. (2004), show ‘‘Neobelonia’’ of the Stictidaceae as a sister to Absconditella. However, ‘‘Neobelonia’’ has not been oﬃcially described and probably belongs to Absconditella (Z. Palice, pers. commun.). Lecidea margaritella (see Poelt and Döbbeler, 1975) was recently placed in a new genus, Puttea. It belongs to a clade comprising the Pilocarpaceae, Psoraceae, Ramalinaceae, and Sphaerophoraceae (Stenroos et al., 2009). Puttea margaritella is either a necrotrophic parasite, or colonizes already decaying parts of its host. It has been observed only on the hepatic Ptilidium pulcherrimum, never on the closely related sympatric P. ciliare, despite intensive screening. 292 S. Stenroos et al. / Cladistics 26 (2010) 281–300 Fig. 3. Examples of bryosymbiotic microfungi from diﬀerent classes of the Ascomycota. (a) Acrospermum adeanum (Dothideomycetes, dry specimen). (b) Absconditella sphagnorum (Lecanoromycetes, dry specimen). (c) Mniaecia jungermanniae (Leotiomycetes, fresh specimen). (d) Epibryon plagiochilae (Eurotiomycetes, SEM image). Scale bars: (a–c) 1 mm, (d) 50 lm. Image (b) was composed by combining a series of partially focused photographs to extend the depth of ﬁeld (Hadley, 2008). Leotiomycetes Leotiomycetes comprises non-lichenized, inoperculate, unitunicate apothecial species that are associated with plants (Spatafora et al., 2006). Bryosymbiotic species of the class Leotiomycetes are well represented in the phylogenetic tree, partly because it is relatively easy to culture them for DNA extraction. This clade contains several undescribed species (identiﬁed with capital letters in the tree), some of which have not yet been assigned to a proper genus. They will be covered later in separate papers. At least two genera are restricted to bryophytes: Mniaecia (Fig. 3c) and Bryoscyphus (with one reported exception; see Alstrup and Cole, 1998). Species in both genera are biotrophic parasites, growing on living parts of their hosts but not causing apparent damage to them (Kirk and Spooner, 1984; De Sloover, 2001; Pressel and Duckett, 2006). Epiglia gloeocapsae has recently been combined to genus Mniaecia (Ayel and Van Vooren, 2005), but our results do not support this. The genus Bryoscyphus was erected to include bryosymbiotic, brown-coloured species with clavatefusoid asci and fusoid-rhomboidal ascospores, to diﬀerentiate it from the closely related Hymenoscyphus and Phaeohelotium (Kirk and Spooner, 1984). In the phylogenetic tree, Bryoscyphus, together with Cyathicula microspora, indeed appears as sister to the Hymenoscyphus clade (genera Hymenoscyphus, Ombro- phila, and Cudoniella) recognized by Wang et al. (2006a). This class also contains bryosymbiotic representatives belonging to several other genera, such as Microscypha, Hyaloscypha, Pezoloma, and Discinella. The majority of these species are biotrophic parasites as well. Only Pezoloma ciliifera is clearly saprobic: all bryophyteassociated specimens were collected from decomposing lower parts of the shoots. Additionally, this species is known to occur on other plant debris (Garcia and Van Vooren, 2005), so it could probably be best described as a general saprobe. Until now, the genus Hyaloscypha has been regarded as a solely saprobic genus, its species being abundant on bulky wood substrates, more rarely on arboreal or herbaceous litter (Huhtinen, 1989). However, our screening revealed three previously unknown bryosymbionts belonging to this genus. One of them, H. hepaticola, has recently been assigned to the genus (Baral et al., 2009). The remaining two will be dealt with in a separate paper. These species do not form a monophyletic group, and the bryosymbiotic life style may have evolved multiple times in the genus. Neobulgaria lilacina is a lignicolous species growing on diﬀerent hardwoods. It often occurs together with hepatics, but this association is coincidental: both the fungus and hepatics merely share similar habitat requirements. Recently the species has been treated as Ombrophila lilacina (Raitviir and Huhtinen, 2002), but in our analysis S. Stenroos et al. / Cladistics 26 (2010) 281–300 it was not placed in the Hymenoscyphus clade with O. violacea, the type species of the genus. The current combination (Dennis, 1971) seems uncertain, therefore the true aﬃnities of the species need re-examination. Although the taxon sampling is not extensive enough to resolve the relationships inside the class reliably, our analysis supports the prevailing view that Leotiomycetes includes non-monophyletic taxa (Wang et al., 2006a,b). This is especially evident in the Helotiaceae: the species assigned to this family (Lumbsch and Huhndorf, 2007a) fall into ﬁve separate clades in addition to the Hymenoscyphus clade, which possibly forms the core of monophyletic Helotiaceae s. str. (see Wang et al., 2006b). Pezizomycetes Pezizomycetes (Pezizales) forms the basal lineage of the Pezizomycotina. It contains apothecial operculate taxa, which are mostly saprobic or mycorrhizal, although in many cases the deﬁnitive ecology is not known (Spatafora et al., 2006). There are also some plant parasites, including bryosymbiotic genera Lamprospora and Octosporella, which are present in the current cladogram. Lamprospora and the closely related genera Neottiella and Octospora fruit mainly on soil or sometimes directly on host shoots, in the former case their hyphae being obligately associated with underground rhizoids or protonemata of their bryophyte hosts (Döbbeler, 1979b, 2002; Benkert, 1987, 1993, 1995). Octosporella diﬀers from the above-mentioned genera in the shape of the apothecium, which has evolved into a closed structure that resembles a perithecium (Döbbeler, 1979b). This has been interpreted by Corner (1929) as ‘‘a persistently juvenile form of apothecium consequent on depauperation and xerophily’’. Octosporella produces its minute apothecia directly on its hepatic hosts: O. erythrostigma is parasitic on Frullania dilatata (Döbbeler, 2004a), whereas O. jungermanniarum parasitizes several diﬀerent species (Döbbeler, 1979b). All octosporaceous taxa are characterized by an elaborate infection structure consisting of an appressorium and an intracellular haustorium. A recent study based on partial rDNA LSU sequences (Perry et al., 2007) shows that species of Lamprospora, Neottiella, and Octospora, along with some non-bryosymbiotic taxa, form a separate clade within Pyronemataceae, the largest family of the Pezizales. Octosporella will probably be placed in this clade as well: in our cladogram it forms a well supported clade with Lamprospora. This result raises a question about the monophyly of Octosporella, since Lamprospora sp. is nested between the two Octosporella species. Döbbeler (1979b) pointed out the wide variability in morphological characters among Octosporella and expressed his doubt regarding the unity of the genus. 293 Additionally, Yao and Spooner (1996) introduced the new genus Filicupula for one of the Octosporella species. This suggests that the unique perithecium-like ascoma is not, at least from the evolutionary point of view, as unique as it may have appeared, but instead has arisen independently many times, and thus cannot be used as a delimiting character at generic level. A similar phenomenon has been observed with cleistothecial and truﬄelike apothecia in the Pezizales (see Perry et al., 2007). Of the other bryosymbiotic genera, Lamprospora seems monophyletic, whereas Neottiella and Octospora appear to be polyphyletic (Perry et al., 2007). Most species of Cheilymenia are conﬁned to coprophilous habitats and of the few exceptions, only C. sclerotiorum and C. villosa can be classiﬁed as bryosymbiotic. The former has sclerotia and occasionally apothecia attached to its host moss; the latter, known only from type collection, grew on decaying leaves of a hepatic (Moravec, 2005). Cheilymenia vitellina prefers nitrogen-rich soil containing excrements, but is often also associated with mosses (Moravec, 2005), as is the case with the specimen included in our analysis. However, given the facultative nature of this association, it is probably coincidental. Since there are relatively few plant parasites in Pezizales, but parasitism has probably arisen several times in other, more recent lineages, it can be assumed that the majority of Pezizales have retained an ancestral saprobic lifestyle (Gargas and Taylor, 1995). Consequently, bryosymbionts in this group are likely to have evolved from saprobic ancestors. The evidence suggests that this transition has taken place no more than once or twice in the Lamprospora–Neottiella–Octospora clade (Perry et al., 2007), but a separate transition must have happened in Cheilymenia, which is phylogenetically distant from the above-mentioned genera. A more extensive sampling is needed to resolve the phylogenetic relationships of these bryosymbiotic taxa and the evolution of bryosymbiotic lifestyle in the Pezizales. Sordariomycetes The obligately bryophilous genus Bryocentria belongs to this class, and two of its three species, B. brongniartii and B. metzgeriae, were included in the analysis. Bryocentria belongs to the order Hypocreales, which includes, among others, more than 30 species of mostly obligate parasites of mosses and hepatics; these are assigned to the families Bionectriaceae and Nectriaceae (Döbbeler, 2005 and references therein). The Hypocreales are known from a variety of substrates: for instance, some function as virulent plant pathogens, others produce antibiotics or are sources of potent mycotoxins. The close relationship of Bryocentria with Stephanonectria in our cladogram shows that Bryocentria is a member of Bionectriaceae (Castlebury et al., 2004). The 294 S. Stenroos et al. / Cladistics 26 (2010) 281–300 teleomorphs of Stephanonectria keithii grow on dead stipes of Brassica sp. or on bark of dead trees, such as Elaeagnus (Schroers et al., 1999). Bryocentria brongniartii is a biotrophic parasite found solely on Frullania dilatata, whereas B. metzgeriae is a necrotrophic parasite on a more variable selection of hepatic hosts, such as Frullania dilatata, Lejeunea cavifolia, Metzgeria furcata, Porella platyphylla, Porella sp., and Radula complanata. These hosts are typically epiphytes and they often grow together and in similar habitats (Döbbeler, 2004b). An unidentiﬁed vascular endophyte (no. 4780), which inhabits Dryas integrifolia in the Canadian arctic (Higgins et al., 2007), appears as a sister to the Bionectriaceae. The other relatives are saprobes. Trizodia – a newly discovered lineage within the Ascomycota Trizodia Laukka, gen. nov. MycoBank no. MB513102 Apothecia superﬁcialia, minuta, sessilia vel brevistipitata, subglobosa vel turbinata, convexa, immarginata, glabra, albida. Excipulum externum textura porrecta. Asci unitunicati, inoperculati, clavati, basi uncinata, parietibus post solutionem kalii iodo omnino caerulescentibus. Sporae ellipsoideae vel ovatae vel pyriformes, laeves, unicellulares, guttulatae. Paraphyses copiosae, ﬁlamentosae, septatae, longitudine ascorum. Hyphae hyalinae. Typus generis. Trizodia acrobia Laukka Apothecia superﬁcial, minute, sessile or short-stipitate, subglobose or turbinate, convex, immarginate, glabrous, whitish. Ectal excipulum textura porrecta. Asci unitunicate, inoperculate, clavate, often with a long and narrow base, arising from croziers, wall hemiamyloid (IKI; Baral, 1987) for the entire length of asci with KOH pretreatment. Spores of variable shape from ellipsoid to ovate to pyriform, smooth, one-celled, with one large or several small oil droplets. Paraphyses abundant, ﬁlamentous, septate, not exceeding the asci. Hyphae colourless. Trizodia acrobia Laukka, sp. nov. (Figs 4 and 5) MycoBank no. MB513103 Apothecia in foliis Sphagni, superﬁcialia, solitaria vel gregaria, sessilia vel brevistipitata, subglobosa vel paulum turbinata, glabra, immarginata, convexa, specimina exciccata usque ad 240 lm diam. et 160 lm alta, colore in vivo albo translucido vel subroseo, in sicco ﬂavidobrunneo. Excipulum externum textura porrecta, cellulis c. 4 lm latis, in solutionibus Melzeri et Lugolii inamyloideis. Asci 92–233 · 15–26 lm, unitunicati, inoperculati, clavati, octospori, basi uncinata, apicibus in solutione Melzeri inamyloideis, parietibus post solutionem kalii iodo omnino caerulescentibus. Sporae 12.0–20.5 · 7.5– 12.0 lm, ellipsoideae vel ovatae vel pyriformes vel paulum deformes, hyalinae, laeves, aseptatae, una guttula magna vel multiguttulatae. Paraphyses copiosae, ﬁlamentosae, longitudine ascorum, 2.0–2.4 lm latae, interdum ramosae, septatae, cellulis terminalibus 17–32 lm longis. Hyphae hyalinae, circum colonias cyanobacteriorum supra folia et in cellulis hyalinis Sphagnorum. Holotypus Finland: Keski-Pohjanmaa: Haapavesi, Löytölänperä, in the southern part of Kaijanneva bog, grid 27E 7107:411, on Sphagnum magellanicum, 16 August 2003 T. Laukka 154 (TUR). Apothecia (Figs 4g, h and 5a–c) superﬁcial on basal leaves of the apical branches of Sphagnum, solitary to gregarious, sessile or short-stipitate, subglobose to slightly turbinate, glabrous, immarginate, convex, up to 240 lm in diameter and 160 lm in height when dry, translucent white to light pink when fresh, yellowish brown (N65; Cailleux, 1981) when dry. Ectal excipulum (Fig. 4a) textura porrecta, hyphae c. 4 lm wide, walls MLZ–, IKI–, margin composed of cylindrical hyphal ends. Asci (Fig. 4b) 92–233 · 15–26 lm, mean = 158.1 · 21.1 lm (CR, n = 39 from nine populations), unitunicate, inoperculate, clavate, often with a long and narrow base, eight-spored, wall ﬁrm, asci arising from croziers, these CR+, apex MLZ–, with an apical thickening clearly visible after spore discharge, in IKI with KOH pretreatment ascus wall hemiamyloid (Baral, 1987) for the entire length of asci, without KOH pretreatment this reaction is less clear. Spores (Fig. 4d–f) 12.0–20.5 · 7.5–12.0 lm, mean =17.5 · 12.0 lm, Q = 1.2–2.4, mean Q = 1.8 (CR, n = 88 from ten populations), shape variable from ellipsoid to ovate to pyriform to slightly deformed, hyaline, smooth, aseptate, wall ﬁrm, spores usually contain one large and ⁄ or several small oil droplets. Paraphyses (Fig. 4c) abundant, ﬁlamentous, not exceeding the asci, 2.0– 2.4 lm wide, sometimes branched, septate, terminal cells 17–32 lm long, devoid of inner structures in all reagents studied. Hyphae (Fig. 5c, d) colourless, on Sphagnum leaves and around colonies of cyanobacteria inhabiting leaf surfaces and hyaline cells of Sphagnum. Anamorph not observed. Etymology. Trizodia (Greek), meaning small tripartite being, and acrobia (latinized Greek) meaning living at apex. Distribution. Finland. Expected to be associated with Sphagnum also in the neighbouring areas. During the screening of bryosymbionts we isolated a hitherto unknown fungus, which turned out to be a representative of a previously unknown lineage of the Ascomycota (Figs 1 and 2). It only inhabits the living shoot apices of Sphagnum: despite the screening of thousands of shoots, it was never observed on their S. Stenroos et al. / Cladistics 26 (2010) 281–300 295 Fig. 4. Microscopic characters of Trizodia acrobia, gen. et sp. nov. (a) Margin and excipulum (Laukka 190). (b) Variability of asci (ﬁve diﬀerent specimens). (c) Paraphyses (Ilmanen 334). (d–f) Ascospores: (d) (holotype); (e) (Paajanen 848); (f) (Laukka 155). (g) Rehydrated apothecia. (h) Growth habit of three apothecia with their surrounding cyanobacterial colonies (darkened; Laukka 252). Scale bars: (b, c) 50 lm, (a, d–f) 10 lm, (g) 250 lm, (h) 1 mm. Drawings (a–d, f) were made in Congo Red, (e) in KOH. 296 S. Stenroos et al. / Cladistics 26 (2010) 281–300 Fig. 5. Trizodia acrobia, gen. et sp. nov. (a) Shoot apex of Sphagnum girgensohnii with cyanobacteria (small dark green patches) and apothecia (white globules). (b) Close-up photograph of the three symbionts. (c) SEM image showing an apothecium (right) from which hyphae run to adjacent cyanobacterial colony (left). (d) Light microscope image of a cyanobacterial colony inside a hyaline cell of Sphagnum. Fungal hyphae enter the cell through round pores and envelop the colony. Dyed with cotton blue. Scale bars: (a) 2 mm, (b) 1 mm, (c) 50 lm, (d) 30 lm. Images (a, b, d) were composed by combining a series of partially focused photographs to extend their depth of ﬁeld (Hadley, 2008). middle parts or dead bases. The fungus occupies the basal leaves of the apical branches of the host mosses and produces whitish, sessile or short-stipitate apothecia (Figs 4g, h and 5a–c). It was found in boreal bogs and coniferous forests on eight Sphagnum species belonging to diﬀerent sections, namely S. angustifolium, S. capillifolium, S. flexuosum, S. girgensohnii, S. magellanicum, S. rubellum, S. russowii, and S. squarrosum. Colonies of nitrogen-ﬁxing cyanobacteria, mostly of the genus Nostoc, often reside on Sphagnum leaves and in the hyaline cells. The hyaline moss cells may provide an escape for the nitrogen-ﬁxing cyanobacteria from unfavourable pH and oﬀer a site for eﬃcient exchange of nutrients. Granhall and Hofsten (1976; see also Solheim and Zielke, 2002) studied Nostoc colonization on Sphagnum and found intracellular colonization at a lower pH, and only epiphytic and free-living cyanobacteria at higher pH conditions. Sphagnum–Nostoc associations have been found highly beneﬁcial in various ecosystems due to the increased nitrogen-ﬁxation activity (Solheim and Zielke, 2002). The Trizodia hyphae are extracellular on the living Sphagnum cells and enter the water-ﬁlled, dead hyaline cells through the cell pores. They envelop the cyanobacterial colonies both on the moss surface as well as inside the leaf (Fig. 5c, d). We found that the fungus was invariably present in all of the 44 Sphagnum–Nostoc associations studied, but it was not found in Sphagnum populations where cyanobacteria were absent. This suggests highly evolved interactions between the partners in which the fungus shows obligate cyanotrophy and, at the same time, is speciﬁc to its moss substrate. The association does not appear harmful to the partners, but it is not yet known if it is beneﬁcial to the moss or the cyanobacterial populations. The fungal hyphae may help in the positioning and chemical controlling of the cyanobacterial colonies, and participate in passive water transport; these kinds of function are observed in lichen thalli (Honegger, 2001, 2006, 2008). Even though the degree of lichenization among ascomycetes varies greatly, and in some cases the fungal hyphae are fairly loosely associated with the photobiont, the newly found symbiosis between Trizodia and Nostoc probably cannot be categorized as a lichen per se: it does not form organized thallus structures, which characterize lichens (Hawksworth, 1988; Honegger, 2008). Nonetheless, this association appears rather stable, despite the fact that the moss is continuously growing and producing new apical shoots for the fungus and cyanobacteria to occupy. It also seems that the fungus is dependent on its associates, as is typically the case in lichen symbioses. In addition, the fungus has yet another lichen characteristic: a hemiamyloid ascus wall. The association might perhaps be described as a structurally undeveloped, ‘‘primitive’’ form of a bryosymbiotic cyanolichen, which represents a link in the continuum of multitude of forms of symbiotic associations. These range from the quite inconspicuous and most obscure associations to dual lichen thalli that are substantially diﬀerentiated S. Stenroos et al. / Cladistics 26 (2010) 281–300 into complex, stable structures (Hawksworth, 1988; see also Döbbeler, 1980, 1984, 1995). Some other bryosymbionts are, in fact, lichenized. According to the Protolichenes hypothesis (Eriksson, 2005), early ascomycetes most probably lived in symbioses with microalgae or cyanobacteria. The symbiosis was subsequently lost in the early lineages such as Orbiliomycetes and Pezizomycetes, which branch oﬀ further down near the base of the clade. Trizodia acrobia has probably maintained the early symbiosis, which characterized the hypothetical Protolichenes. Mosses as ancient hosts may have been ideal for the preservation of this symbiosis. Ecologically, Sphagnum is without doubt the single most important plant genus of the boreal zone (Shaw et al., 2003). Because of its fundamental role, the signiﬁcance of Trizodia and its functions in the symbiosis with Sphagnum cannot be overestimated. The hyaline Sphagnum cells are often inhabited by non-photobiont bacteria, which have been seen in direct contact with cyanobacteria (Solheim and Zielke, 2002). Non-photobiont bacteria were also observed in the hyaline cells of Trizodia-infected specimens. The identity of these bacteria is yet to be determined. It is possible that the newly described association has synergistic interactions with the non-photobiont bacteria in the nutrient-poor, acidic environments, thus functioning as a complex of four instead of three partners. Trizodia acrobia represents a separate lineage, which appears basal to the Leotiomycetes of the Ascomycota. The exact placement and relationships with surrounding clades will probably be conﬁrmed by the addition of protein-coding genes, which have been shown to yield higher levels of information compared with the ribosomal genes (Spatafora et al., 2006). The ribosomal genes form the bulk of the present data, as is typically still the case in current fungal phylogenetic analyses at higher taxonomic levels. Evolution of lifestyles It may be noteworthy that bryosymbiotic fungi rarely appear related to endophytic fungi of vascular plants (Fig. 1; Higgins et al., 2007). Our preliminary characterstate reconstructions indicate that bryosymbionts mostly appear to derive from saptrotrophic ancestors. Our results show that even an ultimate nutritional microniche utilization can be adopted multiple times during the evolution. Even though mosses are not among the most desirable substrates due to their poorly biodegradable cell wall components and antimicrobial compounds (Verhoeven and Liefveld, 1997), they have been favoured as hosts by diverse fungi. Within at least ﬁve of the above-mentioned six Ascomycete classes, the shift has occurred multiple times, and it has even occurred within genera, which suggests speciation both 297 before and after the switching of lifestyles. An example of the former case is the primarily saprobic genus Hyaloscypha, which includes three unrelated bryosymbiotic species. Moreover, the closest relatives of the bryosymbiont Acrospermum adeanum, A. compressum and A. graminum, grow as saprobes on decaying plant material. On the other hand, there are several examples of exclusively bryosymbiotic genera, such as Bryocentria and Mniaecia, indicating speciation on mosses and hepatics. The apparent success in utilizing bryophytes as a substrate suggests preadaptation: some of the saprobic ancestors of bryosymbionts may have had active enzymatic control mechanisms, which have been involved in the decaying of substrates such as peaty soils and wood; bryophyte gametophytes are notable of a chemical composition similar to those found in these substrates (Redhead, 1984). The most aggressive necrotrophs, Acrospermum adeanum and Absconditella sphagnorum, belong to the Dothideomycetes and Lecanoromycetes, respectively. However, less harmful parasitic interactions are the most common among bryosymbionts, and these fungi range from relatively few generalists to extreme specialists, the latter of which occupy remarkably narrow ecological niches on their hosts, such as the underground rhizoids, lamellar interspaces of leaves, hyaline leaf tips or antheridial cups of hair cap mosses (Polytrichaceae). To allow abundant infections by diverse fungi, often simultaneously by several taxa (Döbbeler, 1999), and not lose their vitality, bryophytes are likely to have a genetically controlled mode or modes of defence mechanism. Resistance mechanisms as defence against pathogens in vascular plants are well known. In fact, the bacterial pathogen causing soft rot can cause similar symptoms in the model moss Physcomitrella patens (Andersson et al., 2005). It is therefore likely that resistance mechanisms against fungi are well developed and widespread among bryophytes, and many of them may be similar to those in vascular plants. Bryophytes represent the oldest lineages of embryophytes (Qiu et al., 2006). Therefore, it is possible that their fungal associates have been the earliest fungal invaders on land plants, and the mechanisms developed during these earliest encounters are the basis for the current overwhelming diversity of associations between embryophytes and fungi. Acknowledgements We thank A. Lesonen, N. Bell, S. Olsson, P. Wäli, M. Kukkonen, A.-P. Nieminen, A. Puolasmaa, T. Marsh, R. Ilmanen, R. Penttinen, J. Vaahtera, T. Timonen and J. Kekkonen for assistance, and the Willi Hennig Society for TNT. S.S. and co-workers were funded by the Ministry of Environment in Finland, and S.S. by the Academy of Finland (211171). 298 S. Stenroos et al. / Cladistics 26 (2010) 281–300 References Alstrup, V., Cole, M.S., 1998. Lichenicolous fungi of British Columbia. Bryologist 101, 221–229. Andersson, R.A., Akita, M., Pirhonen, M., Gammelgård, E., Valkonen, J.P.T., 2005. Moss–Erwinia pathosystem reveals possible similarities in pathogenesis and pathogen defense in vascular and nonvascular plants. J. Gen. Plant. Pathol. 71, 23–28. Ayel, A., Van Vooren, N., 2005. Catalogue des Ascomycètes récoltés dans la Loire 2e partie: Leotiomycetes, Orbiliomycetes et aﬃnes (discomycètes inoperculés). Bull. Mens. Soc. Linn. Lyon 74, 5–32. Baral, H.-O., 1987. LugolÕs solution ⁄ IKI versus MelzerÕs reagent: hemiamyloidity, a universal feature of the ascus wall. Mycotaxon 29, 399–450. Baral, H.-O., De Sloover, J.R., Huhtinen, S., Laukka, T., Stenroos, S., 2009. An emendation of the genus Hyaloscypha to include Fuscoscypha (Hyaloscyphaceae, Helotiales, Ascomycotina). Karstenia 49, 1–17. de Bary, H.A. 1879. Die Erscheinung der Symbiose: Vortrag gehalten auf der Versammlung deutscher Naturforscher und Aerzte zu Cassel. Karl J. Trübner, Strassburg. Bell, N., Newton, A.E. 2004. Systematic studies of non-Hypnanaean pleurocarps: establishing a phylogenetic framework for investigating the origins of pleurocarpy. In: Goﬃnet, B., Hollowell, V., Magill, R. (Eds.), Monographs in Systematic Botany from the Missouri Botanical Garden 98. Missouri Botanical Garden Press, St Louis, Missouri, pp. 290–319. Benkert, D., 1987. Beiträge zur Taxonomie der Gattung Lamprospora (Pezizales). Z. Mykol. 53, 195–271. Benkert, D., 1993. Bryoparasitic Pezizales: ecology and systematics. In: Pegler, D.N., Boddy, L., Ing, B., Kirk, P.M. (Eds.), Fungi of Europe: Investigation, Recording and Conservation. Royal Botanic Gardens, Kew, pp. 147–156. Benkert, D., 1995. Becherlinge als Moosparasiten. Boletus 19, 97–127. Cailleux, A., 1981. Code des Couleurs de Sols. Boubée, Paris. Castlebury, L.A., Rossman, A.Y., Sung, G.-H., Hyten, S., Spatafora, J.W., 2004. Multigene phylogeny reveals new lineage for Stachybotrys chartarum, the indoor air fungus. Mycol. Res. 108, 864–872. Corner, E.J.H., 1929. A humariaceous fungus parasitic on a liverwort. Ann. Bot. 43, 491–505. Cubeta, M.A., Echandi, E., Abernethy, T., Vilgalys, R., 1991. Characterization of anastomosis groups of binucleate Rhizoctonia species using restriction analysis of an ampliﬁed ribosomal RNA gene. Phytopathology 81, 1395–1400. Davey, M.L., Currah, R.S., 2006. Interactions between mosses (Bryophyta) and fungi. Can. J. Bot. 84, 1509–1519. De Sloover, J., 2001. Présence en Belgique de Mniaecia nivea et M. jungermanniae (Ascomycota : Leotiales). Lejeunia 166, 1–13. Dennis, R.W.G., 1971. New or interesting British microfungi. Kew. Bull. 25, 335–374. Döbbeler, P., 1978. Moosbewohnende Ascomyceten I. Die pyrenocarpen, den Gametophyten besiedelnden Arten. Mitt. Bot. Staatssaml. München 14, 1–360. Döbbeler, P., 1979a. Moosbewohnende Ascomyceten II. Acrospermum adeanum. Mitt. Bot. Staatssaml. München 15, 175–191. Döbbeler, P., 1979b. Untersuchungen an moosparasitischen Pezizales aus der Verwandtschaft von Octospora. Nova Hedwigia 31, 817– 864. Döbbeler, P., 1980. Phycorella scytonematis (Dothideales), ein neuer Symbiont der Blaualge Scytonema. Sydowia 33, 33–38. Döbbeler, P., 1984. Symbiosen zwischen Gallertalgen und Gallertpilzen der Gattung Epigloea (Ascomycetes). Nova Hedwig Beih 79, 203–239. Döbbeler, P. 1987. Ascomycetes growing on Polytrichum sexangulare. In: Laursen, G.A., Ammirati, J.F., Redhead, S.A. (Eds.), Arctic and Alpine Mycology II. Environ. Sci. Res. 34, 87–107. Döbbeler, P., 1995. Myxophora tjibodensis spec. nov. (Dothideales), ein weiterer Symbiont der Blaualge Scytonema. Bibl. Lichenol. 58, 74–80. Döbbeler, P., 1997. Biodiversity of bryophilous ascomycetes. Biodivers. Conserv. 6, 721–738. Döbbeler, P., 1999. Polytrichadelphus magellanicus – a mycological Eldorado: ﬁve new ascomycetes on a single collection from Tierra del Fuego. Haussknechtia Beih. 9, 79–96. Döbbeler, P., 2002. Microniches occupied by bryophilous ascomycetes. Nova Hedwigia 75, 275–306. Döbbeler, P., 2004a. Octosporella erythrostigma (Pezizales) and Pithyella frullaniae (Helotiales), two remarkable ascomycetes on Frullania dilatata. Feddes Repert. 115, 5–14. Döbbeler, P., 2004b. Bryocentria (Hypocreales), a new genus of bryophilous Ascomycetes. Mycol. Prog. 3, 247–256. Döbbeler, P., 2005. Ascospore diversity of bryophilous Hypocreales and two new hepaticolous Nectria species. Mycologia 97, 924– 934. Döbbeler, P., 2007. Ascomycetes on Polytrichadelphus aristatus (Musci). Mycol. Res. 111, 1406–1421. Eriksson, O., 2005. Ascomyceternas ursprung och evolution – Protolichenes-hypothesen. Svensk Mykol. Tidskr. 26, 22–29. Farris, J.S., Albert, V.A., Källersjö, M., Lipscomb, D., Kluge, A.G., 1996. Parsimony jackkniﬁng outperforms neighbor-joining. Cladistics 12, 99–124. Felix, H., 1988. Fungi on bryophytes, a review. Bot. Helv. 98, 239–269. Garcia, G., Van Vooren, N., 2005. Un discomycète inoperculé plutôt discret, Pezoloma ciliifera, et remarques sur le genre Pezoloma. Bull. Mens. Soc. Linn. Lyon 74, 115–129. Gardes, M., Bruns, T.D., 1993. ITS primers with enhanced speciﬁcity for basidiomycetes – application to the identiﬁcation of mycorrhizae and rusts. Mol. Ecol. 2, 113–118. Gargas, A., DePriest, P.T., 1996. A nomenclature for fungal PCR primers with examples from intron-containing SSU rDNA. Mycologia 88, 745–748. Gargas, A., Taylor, J.W., 1992. Polymerase chain reaction (PCR) primers for amplifying and sequencing 18S rDNA from lichenized fungi. Mycologia 84, 589–592. Gargas, A., Taylor, J.W., 1995. Phylogeny of Discomycetes and early radiations of the apothecial Ascomycotina inferred from SSU rDNA sequence data. Exp. Mycol. 19, 7–15. Geiser, D.M., Gueidan, C., Miadlikowska, J., Lutzoni, F., Kauﬀ, F., Hofstetter, V., Fraker, E., Schoch, C.L., Tibell, L., Untereiner, W.A., Aptroot, A., 2006. Eurotiomycetes: Eurotiomycetidae and Chaetothyriomycetidae. Mycologia 98, 1053–1064. Goloboﬀ, P.A., Farris, J.S., Nixon, K.C., 2008. TNT, a free program of phylogenetic analysis. Cladistics 24, 774–786. Granhall, U., Hofsten, A., 1976. Nitrogenase activity in relation to intracellular organisms in Sphagnum mosses. Physiol. Plant. 36, 88–94. Hadley, A. 2008. CombineZM. An image stacking software program available at http://www.hadleyweb.pwp.blueyonder.co.uk/CZM/ combinezm.htm. Hambleton, S., Tsuneda, A., Currah, R.S., 2003. Comparative morphology and phylogenetic placement of two microsclerotial black fungi from Sphagnum. Mycologia 95, 959–975. Hawksworth, D.L., 1988. The variety of fungal–algal symbioses, their evolutionary signiﬁcance, and the nature of lichens. Bot. J. Linn. Soc. 96, 3–20. Higgins, K.L., Arnold, A.E., Miadlikowska, J., Sarvate, S.D., Lutzoni, F., 2007. Phylogenetic relationships, host aﬃnity, and geographic structure of boreal and arctic endophytes from three major plant lineages. Mol. Phylogenet. Evol. 42, 543–555. Honegger, R., 2001. The symbiotic phenotype of lichen-forming Ascomycetes. In: Hock, B. (Ed.), The Mycota IX. Springer-Verlag, Berlin, Heidelberg, pp. 165–188. S. Stenroos et al. / Cladistics 26 (2010) 281–300 Honegger, R. 2006. Water relations in lichens. In: Gadd, G.M., Watkinson, S.C., Dyer, P. (Eds.), Fungi in the Environment. Cambridge University Press, Cambridge, pp. 185–200. Honegger, R. 2008. Mycobionts. In: Nash, T.H. III (Ed.), Lichen Biology, 2nd edn. Cambridge University Press, Cambridge, pp. 27– 39. Huhtinen, S., 1989. A monograph of Hyaloscypha and allied genera. Karstenia 29, 45–252. James, T.Y., Kauﬀ, F., Schoch, C.L., Matheny, P.B., Hofstetter, V., Cox, C.J., Celio, G., Gueidan, C., Fraker, E., Miadlikowska, J., Lumbsch, H.T., Rauhut, A., Reeb, V., Arnold, A.E., Amtoft, A., Stajich, J.E., Hosaka, K., Sung, G.-H., Johnson, D., OÕRourke, B., Crockett, M., Binder, M., Curtis, J.M., Slot, J.C., Wang, Z., Wilson, A.W., Schüssler, A., Longcore, J.E., OÕDonnell, K., Mozley-Standridge, S., Porter, D., Letcher, P.M., Powell, M.J., Taylor, J.W., White, M.M., Griﬃth, G.W., Davies, D.R., Humber, R.A., Morton, J.B., Sugiyama, J., Rossman, A.Y., Rogers, J.D., Pﬁster, D.H., Hewitt, D., Hansen, K., Hambleton, S., Shoemaker, R.A., Kohlmeyer, J., Volkmann-Kohlmeyer, B., Spotts, R.A., Serdani, M., Crous, P.W., Hughes, K.W., Matsuura, K., Langer, E., Langer, G., Untereiner, W.A., Lücking, R., Büdel, B., Geiser, D.M., Aptroot, A., Diederich, P., Schmitt, I., Schultz, M., Yahr, R., Hibbett, D.S., Lutzoni, F., McLaughlin, D.J., Spatafora, J.W., Vilgalys, R., 2006. Reconstructing the early evolution of the fungi using a six gene phylogeny. Nature 443, 818–822. Kirk, P.M., Spooner, B.M., 1984. An account of the fungi of Arran, Gigha and Kintyre. Kew. Bull. 38, 503–597. Kost, G., 1988. Moss inhabiting basidiomycetes: interactions between basidiomycetes and Bryophyta. Endocytobiosis Cell. Res. 5, 287– 308. Liu, Y.J., Whelen, S., Hall, B.D., 1999. Phylogenetic relationships among ascomycetes: evidence from an RNA polymerase II subunit. Mol. Biol. Evol. 16, 1799–1808. Lohtander, K., Myllys, L., Sundin, R., Källersjö, M., Tehler, A., 1998. The species pair concept in the lichen Dendrographa leucophaea (Arthoniales): analyses based on ITS sequences. Bryologist 101, 404–411. Lohtander, K., Oksanen, I., Rikkinen, J., 2002. A phylogenetic study of Nephroma (lichen-forming Ascomycota). Mycol. Res. 106, 777– 787. Lumbsch, H.T., Huhndorf, S.M. (Eds.) 2007a. Outline of Ascomycota – 2007. Myconet 13, 1–58. Lumbsch, H.T., Huhndorf, S.M., 2007b. Whatever happened to the pyrenomycetes and loculoascomycetes? Mycol. Res. 111, 1064– 1074. Lumbsch, H.T., Schmitt, I., Palice, Z., Wiklund, E., Ekman, S., Wedin, M., 2004. Supraordinal phylogenetic relationships of Lecanoromycetes based on a Bayesian analysis of combined nuclear and mitochondrial sequences. Mol. Phyl. Evol. 31, 822–832. Lutzoni, F., Kauﬀ, F., Cox, C.J., McLaughlin, D., Celio, G., Dentinger, B., Padamsee, M., Hibbett, D., James, T.Y., Baloch, E., Grube, M., Reeb, V., Hofstetter, V., Schoch, C., Arnold, A.E., Miadlikowska, J., Spatafora, J., Johnson, D., Hambleton, S., Crockett, M., Shoemaker, R., Sung, G.-H., Lücking, R., Lumbsch, T., OÕDonnell, K., Binder, M., Diederich, P., Ertz, D., Gueidan, C., Hansen, K., Harris, R.C., Hosaka, K., Lim, Y.-W., Matheny, B., Nishida, H., Pﬁster, D., Rogers, J., Rossman, A., Schmitt, I., Sipman, H., Stone, J., Sugiyama, J., Yahr, R., Vilgalys, R., 2004. Assembling the fungal tree of life: progress, classiﬁcation, and evolution of subcellular traits. Am. J. Bot. 91, 1446–1480. Miadlikowska, J., Kauﬀ, F., Hofstetter, V., Fraker, E., Grube, M., Hafellner, J., Reeb, V., Hodkinson, B., Kukwa, M., Lücking, R., Hestmark, G., Garcia Otalora, M., Rauhut, A., Büdel, B., Scheidegger, C., Timdal, E., Stenroos, S., Brodo, I., Perlmutter, G.B., Ertz., D., Diedrich, P., Lendemer, J.C., May, P., Schoch, C.L., Arnold, A.E., Gueidan, C., Tripp, E., Yahr, R., Robertson, C., Lutzoni, F., 2006. New insights into classiﬁcation and evolution 299 of the Lecanoromycetes (Pezizomycotina, Ascomycota) from phylogenetic analyses of three ribosomal RNA- and two proteincoding genes. Mycologia 98, 1088–1103. Moravec, J., 2005. A world monograph of the genus Cheilymenia (Discomycetes, Pezizales, Pyronemataceae). Libri Botanici 21, 1–256. Myllys, L., Lohtander, K., Källersjö, M., Tehler, A., 1999. Sequence insertions and ITS data provide congruent information on Roccella canariensis and R. tuberculata (Arthoniales, Euascomycetes) phylogeny. Mol. Phylogenet. Evol. 12, 295–309. Perry, B.A., Hansen, K., Pﬁster, D.H., 2007. A phylogenetic overview of the family Pyronemataceae (Ascomycota, Pezizales). Mycol. Res. 111, 549–571. Poelt, J., 1985. Über auf Moosen parasitierende Flechten. Sydowia 38, 241–254. Poelt, J., Döbbeler, P., 1975. Lecidea margaritella, eine an ein Lebermoos gebundene Flechte, und ihr Vorkommen in Mitteleuropa. Herzogia 3, 327–333. Pressel, S., Duckett, J.G., 2006. The parasitic ascomycete Mniaecia jungermanniae induces the formation of giant perichaetia and apogamous sporophytes in leafy liverworts. Can. J. Bot. 84, 384– 392. Qiu, Y.-L., Li, L., Wang, B., Chen, Z., Knoop, V., Groth-Malonek, M., Dombrovska, O., Lee, J., Kent, L., Rest, J., Estabrook, G.F., Hendry, T.A., Taylor, D.W., Testa, C.M., Ambros, M., CrandallStotler, B., Duﬀ, R.J., Stech, M., Frey, W., Quandt, D., Davis, C.C., 2006. The deepest divergences in land plants inferred from phylogenomic evidence. Proc. Natl Acad. Sci. USA 103, 15511– 15516. Racovitza, A. 1959. Étude systématique et biologique des champignons bryophiles. Mém. Mus. Natl Hist. Nat., Sér. B Bot., 10, 1– 288, pls 1–84. Raitviir, A., Huhtinen, S., 2002. A few out of many – interesting inoperculate, lignicolous discomycetes from Norway. Folia Cryptog. Estonica 39, 13–26. Redhead, S.A., 1984. Arrhenia and Rimbachia, expanded generic concepts, and a reevaluation of Leptoglossum with emphasis on muscicolous North American taxa. Can. J. Bot. 62, 865–892. Reeb, V., Lutzoni, F., Roux, C., 2004. Contribution of RPB2 to multilocus phylogenetic studies of the euascomycetes (Pezizomycotina, Fungi) with special emphasis on the lichen-forming Acarosporaceae and evolution of polyspory. Mol. Phylogenet. Evol. 32, 1036–1060. Rehner, S.A., Samuels, G.J., 1995. Molecular systematics of the Hypocreales: a teleomorph gene phylogeny and the status of their anamorphs. Can. J. Bot. 73 (Suppl. 1), S816–S823. Schoch, C.L., Shoemaker, R.A., Seifert, K.A., Hambleton, S., Spatafora, J.W., Crous, P.W., 2006. A multigene phylogeny of the Dothideomycetes using four nuclear loci. Mycologia 98, 1041– 1052. Schoch, C.L., Sung, G.-H., López-Giráldez, F., Townsend, J.P., Miadlikowska, J., Hofstetter, V., Robbertse, B., Matheny, P.B., Kauﬀ, F., Wang, Z., Gueidan, C., Andrie, R.M., Trippe, K., Ciufetti, L.M., Wynns, A., Fraker, E., Hodkinson, B.P., Bonito, G., Groenewald, J.Z., Arzanlou, M., de Hoog, G.S., Crous, P.W., Hewitt, D., Pﬁster, D.H., Peterson, K., Gryzenhout, M., Wingﬁeld, M.J., Aptroot, A., Suh, S.-O., Blackwell, M., Hillis, D.M., Griﬃth, G.W., Castlebury, L.A., Rossman, A.Y., Lumbsch, H.T., Lücking, R., Büdel, B., Rauhut, A., Diederich, P., Ertz, D., Geiser, D.M., Hosaka, K., Inderbitzin, P., Kohlmeyer, J., Volkmann-Kohlmeyer, B., Mostert, L., OÕDonnell, K., Sipman, H., Rogers, J.D., Shoemaker, R.A., Sugiyama, J., Summerbell, R.C., Untereiner, W., Johnston, P., Stenroos, S., Zuccaro, A., Dyer, P.S., Crittenden, P.D., Cole, M.S., Hansen, K., Trappe, J.M., Yahr, R., Lutzoni, F., Spatafora, J.W., 2009. The Ascomycota tree of life: a phylum-wide phylogeny clariﬁes the origin and evolution of fundamental reproductive and ecological traits. Syst. Biol. 58, 224–239. 300 S. Stenroos et al. / Cladistics 26 (2010) 281–300 Schroers, H.-J., Samuels, G.J., Gams, W., 1999. Stephanonectria, a new genus of the Hypocreales (Bionectriaceae), and its sporodochial anamorph. Sydowia 51, 114–126. Shaw, A.J., Cox, C.J., Boles, S.B., 2003. Global patterns in peatmoss diversity. Mol. Ecol. 12, 2553–2570. Solheim, B., Zielke, M. 2002. Associations between cyanobacteria and mosses. In: Rai, A.N., Bergman, B., Rasmussen, U. (Eds.), Cyanobacteria in Symbiosis. Kluwer, New York, pp. 137– 152. Spatafora, J.W., Sung, G.-H., Johnson, D., Hesse, C., OÕRourke, B., Serdani, M., Spotts, R., Lutzoni, F., Hofstetter, V., Miadlikowska, J., Reeb, V., Gueidan, C., Fraker, E., Lumbsch, T., Lücking, R., Schmitt, I., Hosaka, K., Aptroot, A., Roux, C., Miller, A.N., Geiser, D.M., Hafellner, J., Hestmark, G., Arnold, A.E., Büdel, B., Rauhut, A., Hewitt, D., Untereiner, W.A., Cole, M.S., Scheidegger, C., Schultz, M., Sipman, H., Schoch, C.L., 2006. A ﬁve-gene phylogeny of Pezizomycotina. Mycologia 98, 1018–1028. Stenroos, S., Huhtinen, S., Lesonen, A., Palice, Z., Printzen, C. 2009. Puttea, gen. nov., erected for the enigmatic lichen Lecidea margaritella. Bryologist 112, 544–557. Tsuneda, A., Thormann, M.N., Currah, R.S., 2000. Scleroconidioma, a new genus of dematiaceous Hyphomycetes. Can. J. Bot. 78, 1294– 1298. Tsuneda, A., Chen, M.H., Currah, R.S., 2001. Characteristics of a disease of Sphagnum fuscum caused by Scleroconidioma sphagnicola. Can. J. Bot. 79, 1217–1224. Untereiner, W.A., Straus, N.A., Malloch, D., 1995. A molecular-morphotaxonomic approach to the systematics of the Herpotrichiellaceae and allied black yeasts. Mycol. Res. 99, 897– 913. Verhoeven, J.T.A., Liefveld, W.M., 1997. The ecological signiﬁcance of organochemical compounds in Sphagnum. Acta Bot. Neerl. 46, 117–130. Vězda, A., 1965. Flechtensystematische Studien II. Absconditella, eine neue Flechtengattung. Preslia 37, 237–245. Vilgalys, R. 2008. Conserved Primer Sequences for PCR Ampliﬁcation and Sequencing from Nuclear Ribosomal RNA. Duke University, Durham, NC. http://www.biology.duke.edu/fungi/mycolab/primers.htm. Vilgalys, R., Hester, M., 1990. Rapid gene identiﬁcation and mapping of enzymatically ampliﬁed ribosomal DNA from several Cryptococcus species. J. Bacteriol. 172, 4238–4246. Wang, Z., Binder, M., Schoch, C.L., Johnston, P.R., Spatafora, J.W., Hibbett, D.S., 2006a. Evolution of helotialean fungi (Leotiomycetes, Pezizomycotina): a nuclear rDNA phylogeny. Mol. Phyl. Evol. 41, 295–312. Wang, Z., Johnston, P.R., Takamatsu, S., Spatafora, J.W., Hibbett, D.S., 2006b. Toward a phylogenetic classiﬁcation of the Leotiomycetes based on rDNA data. Mycologia 98, 1065–1075. Wedin, M., Döring, H., Gilenstam, G., 2006. Stictis s. lat. (Ostropales, Ascomycota) in northern Scandinavia, with a key and notes on morphological variation in relation to lifestyle. Mycol. Res. 110, 773–789. White, T.J., Bruns, T., Lee, S., Taylor, J., 1990. Ampliﬁcation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. (Eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, pp. 315–322. Yao, Y.-J., Spooner, B.M., 1996. Notes on British Octosporella with a new genus, Filicupula (Pezizales). Kew. Bull. 51, 193–196.

RELATED PAPERS

RELATED TOPICS

Log In

Multiple origins of symbioses between ascomycetes and bryophytes suggested by a five-gene phylogeny

Multiple origins of symbioses between ascomycetes and bryophytes suggested by a five-gene phylogeny

Related Papers

RELATED PAPERS

RELATED TOPICS