CSIRO PUBLISHING www.publish.csiro.au/journals/app Australasian Plant Pathology, 2005, 34, 95–98 SHORT RESEARCH NOTES First record of Passalora calotropidis in Australia and its generic position Peter M. WilkinsonA,D , Skye Thomas-HallB , Thomas S. MarneyC and Roger G. ShivasC,E A Tropical Weeds Research Centre, Department of Natural Resources and Mines, Natal Downs Road, PO Box 187, Charters Towers, Qld 4820, Australia. B CRC for Tropical Plant Pathology, Botany Department, The University of Queensland, St Lucia, Qld 4072, Australia. C Plant Pathology Herbarium, Department of Primary Industries and Fisheries, 80 Meiers Road, Indooroopilly, Qld 4068, Australia. D Current address: c/- 105 Albion Street, Warwick, Qld 4370, Australia. E Corresponding author. Email: roger.shivas@dpi.qld.gov.au Abstract. Passalora calotropidis has been found for the first time in Australia on rubber bush (Calotropis procera) in northern Queensland where it was associated with a damaging leaf spot disease. Analysis of sequence data of the ITS region indicated that P. calotropidis belonged to a group that consisted of species of Pseudocercospora. The generic position of P. calotropidis and its potential for biological control are discussed. Additional keywords: ITS, biological control. Rubber bush or calotrope (Calotropis procera, Asclepiadaceae) originates from the African and Indian tropics and has spread to become pantropical (Mabberley 1998). It is a vigorous, invasive weed of much of northern Australia and was thought to have been inadvertently introduced as padding in camel saddles during a gold rush in north-east Queensland. It has been recorded between Cairns and Normanton since 1935 (Hall 1967). First Australian herbarium records are from the early 1940s (Forster 1992). Rubber bush has proven to be a difficult weed to manage and has become especially problematic on alluvial flats and areas degraded through cultivation and overgrazing. In November 2002 the senior author collected diseased leaves of rubber bush growing on sand dunes, overlooking a tidal estuary extending from the Gulf of Carpentaria, adjacent to the Karumba landing ground, Karumba, north Queensland (17◦ 28′ S, 140◦ 50′ E, alt. 3 m). This population of rubber bush was mature, producing flowers and seeds, with plants reaching 2–3 m in height. The disease was widespread in this host population. This report provides evidence that the causal organism is Passalora calotropidis © Australasian Plant Pathology Society 2005 (Ellis & Everh.) U. Braun, a pathogen not previously known to occur in Australia. Cultures of P. calotropidis provided an opportunity to use molecular studies to determine the phylogenetic relationships of this fungus with morphologically similar species. In the early stages, the disease expresses as a dark lesion on either surface of the leaf with a halo of chlorotic yellow tissue. As the lesions increase in size, the chlorotic zone spreads, bounded by the leaf veins (Fig. 1A). On the lower leaf surface, the dark centres grow in size and eventually become covered in mycelium, bearing spores in poorly defined concentric rings. As the disease progresses, the entire leaf becomes yellow, followed by abscission. In the absence of supporting leaves, the branch tips die back, extending to the whole branch as the disease advances. The leaf spots were covered with fascicles of pale brown conidiophores emerging from substomatal stromata, 10–100 × 4–6 µm, mostly simple, occasionally branched; the conidiogenous scars were mostly inconspicuous and not markedly thickened; conidia were pale brown, 1–5 septate, 20–75 × 5–8 µm, mostly with an unthickened 10.1071/AP04074 0815-3191/05/010095 96 Australasian Plant Pathology P. M. Wilkinson et al. Fig. 1. Passalora calotropidis (from BRIP 39358). (A) Lesions on leaf of Calotropis procera. (B) Fasciculate conidiophores. (C) Conidiophores arising from substomatal stromata. (D) Conidium. Bars A = 2 cm; B = 10 µm; C = 20 µm; D = 5 µm. hilum (Fig. 1B–C). This matched the description of a fungus variously known as Phaeoramularia calotropidis (Ellis & Everh.) Kamal, A.S. Moses & R. Chaudhary (1990), Cercospora calotropidis Ellis & Everh. given by Chupp (1954) and Pseudocercospora calotropidis (Ellis & Everh.) Haldar & Ray (2001). Cultures of P. calotropidis were obtained by transferring conidia from leaf lesions to plates of potato-dextrose agar using a needle. The cultures were incubated at 24◦ C in the dark for 10 days, followed by 12 h near-UV light/12 h dark cycles for 21 days. After this period the cultures were 3–5 cm in diameter. Nine representative living isolates as well as herbarium material of infected leaves have been lodged in the Plant Pathology Herbarium, Queensland Department of Primary Industries and Fisheries as BRIP 39185 and BRIP 39358. Hyphae from three isolates were inoculated into potato-dextrose broth and incubated at 25◦ C in the dark for 14 days. Culture purity was checked microscopically, then hyphae were harvested and washed twice with milli Q water for DNA extraction. Genomic DNA was extracted according to the method described by Stewart and Via (1993). PCR was done according to the methods described by White et al. (1990), using primers NS7 (GAGGCAATAACAGGT CTGTGATGC) and R635 (GGTCCGTGTTTCAAGACGG) (Johanson and Jeger 1993). PCR products were purified using the UltraClean PCR Clean-up kit (Mo Bio Laboratories USA). Direct sequencing was performed using BigDye V3.1 as described in the manufacturer’s directions (Applied Biosystems). Forwards sequence was obtained using 20 ng of purified product with primer ITS5 (GGAAGTAAAAGTCGTAACAAGG) and reverse sequence using primer ITS4 (TCCTCCGCTTATT CATATGC). Sequencing reactions were analysed on an First record of Passalora calotropidis 75 Australasian Plant Pathology 97 Cercospora asparagi (AF297229) Passalora sojina (AY266158) Cercospora sorghi (AF291707) 85 Passalora dulcamarae (AF362048) Passalora manihotis (AF284385) Pseudocercospora rhapisicola (AF222846) 97 Cercospora canescens (AY266164) Cercospora caricis (AF284387) Cercospora zeae-maydis (AF291709) Mycosphaerella latebrosa (AF362051) Septoria epambrosiae (AF279582) 97 Pseudocercospora colombiensis (AF309612) Pseudocercospora colombiensis (AF222838) 100 Pseudocercospora heimii (AF222841) 83 Pseudocercospora irregulariramosa (AF468878) Pseudocercospora cruenta (AY266153) 59 Pseudocercospora fijiensis (AF181705) 62 70 Pseudocercospora musicola (AF181706) 82 Pseudocercospora eucalyptorum (AF309599) Pseudocercospora luzardii (AF362057) 99 78 Pseudocercospora macrospora (AF362055) Passalora calotropidis (AY303969) 100 Passalora tasmaniensis (AF173307) 100 Passalora eucalypti (AF309617) Passalora saururi (AF222836) Mycosphaerella africana (AF309602) Pseudocercospora rubi (AF362058) Passalora henningsii (AF284389) 100 Passalora colocasiae (AF393693) Passalora fulvum (AF393701) Passalora bellynckii (AF222831) Passalora vaginae (AF222832) Passalora dissiliens (AF222835) Mycosphaerella musae (AY257484) Mycosphaerella musae (AY424802) 98 53 100 81 66 5 changes Fig. 2. Phylogenetic relationships of Passalora calotropidis based on conserved nucleic acid sequences in the ribosomal ITS region. GenBank accession numbers are provided in parentheses. Current anamorphic names have been used if available. AB3730XL sequencer by the Australian Genomic Research Facility, Brisbane. Forwards and reverse sequences were aligned and edited using Sequencher 3.0 (Gene Codes Corporation). The ITS sequences were identical for each of the three cultures tested. This sequence was submitted to GenBank (AF303969). Sequences for 34 of the closest related species were obtained through a BLAST search (Zhang and Madden 1997) with Mycosphaerella musae chosen as the outgroup. Sequences were aligned using Sequencher 3.0. Phylogenetic analysis was performed using Paup 4.0b8, (Swofford 1999). Bootstrap analysis (1000 replicates) was 98 Australasian Plant Pathology P. M. Wilkinson et al. performed using a parsimonious heuristic search with random addition of sequences (1000 replicates), tree bisectionreconnection, branch swapping and MULPAR effective. The most parsimonious distance tree is presented with the bootstrap values. Comparison of the ITS region of P. calotropidis (Fig. 2), showed that P. calotropidis was phylogenetically distinct, differing by 45 nucleotide variations (including gap insertions) from the closest phylogenetic relation Pseudocercospora luzardii Furlan. & Dianese. The alignment resulted in 135 parsimony informative characters and 39 variable characters that were parsimony uninformative. The consistency index for the dataset was 0.65 and retention index 0.844. The parsimonious heuristic search associated P. calotropidis with a clade of anamorphic Pseudocercospora species, and this was given 78% support by the bootstrap analysis. Braun (2000) re-examined the type of C. calotropidis and recombined it into Passalora noting that it was very variable and intermediate between Passalora (that has fasciculate conidiophores and conidia formed singly), Phaeoramularia (that has conidia formed in chains) and Mycovellosiella (that has secondary superficial hyphae with solitary conidiophores). Furthermore, Braun (2000) cited C. calotropidis as an example, which showed that Passalora, Phaeoramularia and Mycovellosiella must be lumped (Crous et al. 2001). The synonyms for P. calotropidis listed by Crous and Braun (2003) did not include Pseudocercospora calotropidis (Ellis & Everh.) Haldar & Ray. Pseudocercospora accommodates cercosporoid hyphomycetes with pigmented conidiophores and inconspicuous, unthickened, undarkened conidiogenous loci, and differs from Passalora, which has conspicuous, somewhat thickened, darkened conidiogenous loci (Crous et al. 2001). Braun (2000) described the conidiogenous loci of Passalora calotropidis as conspicuous, slightly thickened and somewhat darkened. Haldar and Ray (2001) described the conidial scar at the tip of the conidiophores of Pseudocercospora calotropidis as inconspicuous. The conidiophores that we examined had mostly inconspicuous, and not markedly thickened, conidiogenous loci, which indicate Pseudocercospora. Furthermore, our molecular analysis indicated that P. calotropidis was phylogenetically distinct yet fell within a clade of Pseudocercospora species. An examination of morphological characteristics and sequence data from isolates of P. calotropodis from around the world might shed further light on its generic position. Barreto et al. (1999) listed the fungal pathogens of rubber bush and discussed their potential as biocontrol agents. One of these pathogens, Phaeoramularia calotropidis (Ellis & Everh.) Kamal, Moses & Chaudhary (= Passalora calotropidis (Ellis & Everh.) U. Braun), was mentioned as having been spread or introduced with its host, Calotropis procera, throughout the tropics of Central and South America but with no confirmed reports in Australasia. Its absence from Australasia may have been because no mycological study of this host has been undertaken in this region (Barreto et al. 1999). The severity of the disease caused by P. calotropidis in northern Queensland indicates that it may have potential as a mycoherbicide for calotrope. The most immediate work that needs to be done is the fulfilment of Koch’s postulates and the development of a method to inoculate potted plants. References Barreto RW, Evans HC, Pomella AWV (1999) Fungal pathogens of Calotropis procera (rubber bush), with two new records from Brazil. Australasian Plant Pathology 28, 126–130. Braun U (2000) Annotated list of Cercospora spp. described by C. Spegazzini. Schlechtendalia 5, 57–79. Chupp C (1954) ‘A monograph of the fungus genus Cercospora.’ (Ithaca, New York) Crous PW, Braun U (2003) ‘Mycosphaerella and its anamorphs. 1. Names published in Cercospora and Passalora’. (Centraalbureau voor Schimmelcultures: Utrecht, The Netherlands) Crous PW, Kang J-C, Braun U (2001) A phylogenetic redefinition of anamorph genera in Mycosphaerella based on ITS rDNA sequence and morphology. Mycologia 93, 1081–1101. Forster PI (1992) A taxonomic account of the genus Calotropis R.Br. (Asclepiadaceae) in Australia. Nuytsia 8, 201–208. Haldar D, Ray JB (2001) Leaf inhabiting fungi from West Bengal, India. Journal of Mycopathological Research 39, 43–47. Hall NH (1967) Noxious weeds: rubber bush. Primary Industries Branch, Northern Territories Administration Pamphlet 13, Darwin. Johanson A, Jeger MJ (1993) Use of PCR for detection of Mycosphaerella fijiensis and M. musicola, the causal agents of Sigatoka leaf spots in banana and plantain. Mycological Research 97, 670–674. Kamal, Moses AS, Chaudhary R (1990) Two new species and a new combination in Phaeoramularia from Uttar Pradesh, India. Mycological Research 94, 714–717. Mabberley DJ (1998) ‘The plant-book.’ (Cambridge University Press) Stewart CN, Via LE (1993) A rapid CTAB DNA isolation technique useful for RAPD fingerprinting and other PCR applications. Biological Techniques 14, 748–750. Swofford DL (1999) ‘PAUP∗ . Phylogenetic analysis using parsimony (∗ and other methods) version 4.’ (Sinauer Associates: Sunderland, Massachusetts, USA) White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In ‘PCR protocols: a sequencing guide to methods and applications’. (Eds MA Innis, DH Gelfand, JJ Sninsky, TJ White) pp. 315–322. (Academic Press: San Diego, USA) Zhang J, Madden TL (1997) PowerBLAST: A new network BLAST application for interactive or automated sequence analysis and annotation. Genome Research 7, 649–656. Received 29 October 2003, accepted 17 June 2004 http://www.publish.csiro.au/journals/app