Genetic Diversity in Sclerotinia Species Merrick Ekins B. Sc. (Hons. I) U.Q. A thesis submitted for the degree of Doctor of Philosophy within the University of Queensland Department of Botany The University of Queensland St. Lucia 4072 Brisbane Queensland Australia June 1999 DECLARATION The work presented in this thesis is, to the best of my knowledge and belief, original except as acknowledged in the text. Due acknowledgment has been given for any assistance received. I hereby declare that I have not submitted this material either in whole or part, for a degree at this or any other institution. Merrick Ekins _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species II ACKNOWLEDGMENTS I would like to express my deepest thanks and appreciation to the following people who have provided assistance during the research and construction of this thesis. Dr Ken Goulter, Dr Elizabeth Aitken and Dr Linda Kohn for their guidance, help and support as supervisors throughout this project. Thanks to Richard Wilson for his help with statistical analysis of isolate aggressiveness. Thanks also to Andre Drenth for his discussions on analysis of population genetics. Special thanks to the best lab pal Helen Hayden. Thanks to Edward Liew for help with PCR and DNA extractions, Steve Whisson with RFLPs, and Lexie Press with Cloning. Thanks to all those people in Canada who made the research over there so productive especially Yatika Kohli, Ignasio Carbone, Tania Baker, Deena Errampalli, Barry Saville, Jim Anderson, and Daisy Cavallaro. Thanks also to all my colleagues at the Cooperative Research Centre for Tropical Plant Pathology and Botany Department especially Julie Mackie, Lois Eden, Sharon Pearson, Barbara Engel, Kendle Gerlach, Michelle Riedlinger, Lawrence Smith, Viki Cramer and Rosie Bruce. Due acknowledgement also goes to GRDC Grains Research Development Corporation for scholarship and research funding, HRDC Horticultural Research Development Corporation and QFVG Queensland Fruit and Vegetable Growers for research funding. Also to Botany Department and CRCTPP for scholarship extensions. I would also like to thank members of QDPI in particular Joe Kochman, Mal Ryley, Gary Kong and Jeff Tatnell. As well as Pacific Seeds, Pioneer Seeds (Greg Wallwork ), Ag-Seed (Ed Dubbelde) and all those farmers who let me trapse across their sunflower fields in search of Sclerotinia spp. Thanks also to those other scientists involved in mycology and plant pathology who have sent me isolates of Sclerotinia throughout this project, including: Paul Cotterill, Paul Schupp, Alex Nikandrow, Chris Wilmshurst, Cheryl Brewester, Peter Trevorow, Andrew Watson, John Heaton, Leif Forsberg, Ross Fitzell, J. McClements, Michael Priest, John Alcorn, Ron Clarke, Martin Barbetti, Ron Cruickshank, J. Yates, Mark Ramsey, James Wong, David Trimboli, Beth Sanswell and Ian Porter. I would also like to thank those friends I have ignored during my quest for science and their support and understanding over this time especially: Connor Talty, Janet Lupton, Lisel _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species III Sweetser, Callum Pritchard, Ingrid Christiansen, Samantha Donovan, Kristin Smeltzer, Denzil Hildebrand, Tim Stevenson and Sarah Scragg. Thanks also to those members of other departments also undergoing Ph.D. who have provided advice along the way especially Michelle Spuller. I would also like to thank girlfriends who have provided so much strength throughout the loop de loops of the Ph.D. especially Tracey O‟Connell, Sue Dabulskis, and Gabrielle Wagels. I would most wholeheartedly like to thank Liam Town for providing the motivation that enables one to climb mountains. Finally I would like to thank all the extended family for their support that only family can provide throughout the years. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species IV DEDICATION I would like to dedicate this thesis to the living memory of Anne Ekins. Who in Death showed me the value of life It is only in closeness to death is life valued so highly. Pain is weakness leaving the body And this thesis was painful! Indecisiveness is the key to flexibility _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species V ABSTRACT The general aim of this research was to analyse the genetic diversity in Sclerotinia species. More specifically the aims of this research were: to separate the three species of Sclerotinia, S. sclerotiorum (Lib.) de Bary, S. minor Jagger and S. trifoliorum Erikss.; to determine the breeding mechanism in S. minor and S. sclerotiorum; to test S. minor for the possibility of causing head rot of sunflower; to examine isolates of S. sclerotiorum from sunflower for aggressiveness for correlates with underlying genetic diversity. Sclerotinia species were separated using a variety of morphological and molecular criteria. S. minor, S. sclerotiorum and S. trifoliorum were analyzed on characters including host, sclerotial diameters, ascospore morphism, breeding type and RFLP analysis. Cloned DNA fragments from S. sclerotiorum were used as probes, these were compared with a cloned rDNA probe from Neurospora. These probes enabled clear separation of the Sclerotinia species. Sclerotial diameters appear to be a good criterion for separating S. minor from S. sclerotiorum and S. trifoliorum. Host species may be sufficient criteria for separating S. sclerotiorum and S. trifoliorum for the plant pathologist in the field, but it was inadequate to accurately separate all isolates. S. minor and S. sclerotiorum were found to be homothallic ascomycetes. Apothecia were raised from all eight ascospores of a single tetrad from four isolates of S. minor and from an isolate of S. sclerotiorum indicating that inbreeding may be the predominant breeding type mechanism of S. minor. Ascospores from asci of S. minor and S. sclerotiorum were predominantly monomorphic, but rare examples of ascospore dimorphism similar to S. trifoliorum were found. Ascospores of S. minor were shown to be capable of causing head rot of sunflower (Helianthus annuus L.) when inoculated onto the floral face during anthesis. This is the first record of the carpogenic germination of S. minor and of the demonstration of infectivity of the ascospores on sunflower in Australia. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species VI Isolates of S. sclerotiorum differ significantly in aggressiveness on sunflower. One hundred and twenty isolates were collected from head and basal stem rots of sunflower in two locations in south east Queensland. The inoculation of sunflower stems with mycelial plugs and the measurement of lesion development was found to be a reliable indicator of differences in aggressiveness between isolates. The time of assessment after inoculation was found to be of significance. Assessment two days after inoculation was more reliable than after three days or the linear rate of lesion development. The significant differences between isolates indicated that the pathogenicity testing method would also be good for virulence testing. The significant differences between the isolates however, was not consistent with repetition and division of the isolates into groups with different aggressive levels was therefore not possible. Differences in aggressiveness were more indicative of a continuous variation in pathogenicity rather than discrete aggressive groups. The number of significantly different isolates was most associated with the statistical test employed. The different multiple comparison procedures used made more difference in interpretation of aggressiveness than the data itself. Isolate aggressiveness did not correspond to the location of collection. Isolates collected from both head and basal stem rots were capable of causing stem infections therefore no specificity for mode of reproduction or infection was found. S. sclerotiorum attacking sunflower in Queensland and New South Wales was found to belong to one large population. Hierarchical sampling detected only one example of a plant lesion infected by more than one genotype. Thus, most diseased plants are the result of a single infection only. Population substructuring could not be detected using 11 single copy Restriction Fragment Length Polymorphism (RFLP) loci, suggesting gene flow occurs within the Australian population. Mycelial Compatibility Groups (MCGs), Random Amplified Polymorphic DNAs (RAPDs) single and multicopy RFLPs analysis indicated differences amongst the genotypes identified by each criteria. From 120 isolates the number of genotypes ranged from 13 to 24 depending on the marker used. However there were many similarities in the assemblages of isolates within each genotype. Genotypic diversity could not be correlated with aggressiveness. Initial mode of infection could not be correlated with genotypic differences. Genotypes were also not specific to geographic locations around Australia. However, genotypes identified in Australia were different from genotypes identified in Canada and United States. Temporal studies also indicated a single _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species VII population, as genetic uniformity was maintained between years. Frequent recovery of the same genotypes around Australia suggests a clonal population structure. The Australian population of S. sclerotiorum which attacks sunflower appears to have a large asexual component most likely due to the sclerotial production and homothallic sexual reproduction. Gametic disequilibrium was found for all the populations. However, clonal correction of the samples meant that the majority of populations were not at gametic disequilibrium, indicating random associations among loci. Therefore genetic exchange and recombination would appear to be a component of the reproductive cycle of S. sclerotiorum in Australia. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species VIII TABLE OF CONTENTS DECLARATION ............................................................................................................................................. II ACKNOWLEDGMENTS .............................................................................................................................. III DEDICATION ..................................................................................................................................................V ABSTRACT .................................................................................................................................................... VI TABLE OF CONTENTS ............................................................................................................................... IX LIST OF FIGURES ..................................................................................................................................... XIII LIST OF TABLES......................................................................................................................................... XV CHAPTER 1: GENERAL INTRODUCTION .............................................................................................. 1 1.1 INTRODUCTION ........................................................................................................................................ 1 1.2 THE PATHOGENS ...................................................................................................................................... 3 1.2.1 Taxonomy ........................................................................................................................................ 4 1.2.1.1 Genera ...................................................................................................................................................... 4 1.2.1.2 Species...................................................................................................................................................... 6 1.3 THE DISEASE ........................................................................................................................................... 8 1.3.1 Host Ranges .................................................................................................................................... 8 1.3.2 Pathogenesis ................................................................................................................................... 9 1.3.3 The Disease on Sunflowers ........................................................................................................... 10 1.3.3.1 Control Methods ..................................................................................................................................... 12 1.3.3.1.1 Traditional ...................................................................................................................................... 12 1.3.3.1.1.1 Cultural Control ..................................................................................................................... 12 1.3.3.1.1.2 Chemical Control ................................................................................................................... 13 1.3.3.1.1.3 Biological Control .................................................................................................................. 15 1.3.3.1.1.4 Resistant Cultivars ................................................................................................................. 16 1.3.3.1.2 New Methods of Control ................................................................................................................ 17 1.3.3.1.2.1 Oxalic Acid Degradation ....................................................................................................... 17 1.3.3.1.2.2 Pathogenesis Related Proteins (PRPs) and Anti Fungal Proteins (AFPs) ............................. 18 1.4 POPULATION GENETICS ......................................................................................................................... 19 1.4.1 Factors Affecting Genetic Variation in S. sclerotiorum ................................................................ 23 1.4.1.1 Breeding Type in Sclerotinia Species..................................................................................................... 23 1.4.1.2 Sexual Reproduction .............................................................................................................................. 24 1.4.1.3 Virulence and Aggressiveness ................................................................................................................ 26 1.5 THE OBJECTIVES OF THIS STUDY ............................................................................................................ 27 CHAPTER 2: IDENTIFICATION OF SCLEROTINIA SPECIES ............................................................ 28 2.1 INTRODUCTION ...................................................................................................................................... 28 2.2 MATERIALS AND METHODS ................................................................................................................... 31 2.2.1 Fungal Isolates.............................................................................................................................. 31 2.2.2 Carpogenic Germination .............................................................................................................. 32 2.2.3 DNA Extraction ............................................................................................................................. 33 2.2.4 Creation of Single Copy Probes.................................................................................................... 33 2.2.5 RFLP Analysis .............................................................................................................................. 36 2.3 RESULTS ................................................................................................................................................ 38 2.3.1 Sclerotial Diameters ..................................................................................................................... 38 2.3.2 Dimorphic Ascospores .................................................................................................................. 38 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species IX 2.3.3 Restriction Fragment Length Polymorphisms............................................................................... 39 2.4 DISCUSSION ........................................................................................................................................... 46 CHAPTER 3: HOMOTHALLISM IN SCLEROTINIA SPECIES ............................................................ 49 3.1 INTRODUCTION ................................................................................................................................... 49 3.2 MATERIALS AND METHODS .................................................................................................................... 53 3.2.1 Observation of Ascospore Dimorphism ........................................................................................ 53 3.2.2 Fertility of Single Ascospore Cultures .......................................................................................... 53 3.2.3 Fertility of Random Single Ascospore Cultures and Mass Spored Cultures ................................. 54 3.2.4 Fertility Within Individual Asci ..................................................................................................... 54 3.3 RESULTS ................................................................................................................................................. 55 3.3.1 Observation of Ascospore Dimorphism ........................................................................................ 55 3.3.2 Fertility of Single Ascospore Cultures .......................................................................................... 58 3.3.3 Fertility of Random Single Ascospore Cultures and Mass Spored Cultures ................................. 59 3.3.4 Fertility Within Individual Asci ..................................................................................................... 60 3.4 DISCUSSION ........................................................................................................................................... 61 CHAPTER 4: HEAD ROT OF SUNFLOWER CAUSED BY ASCOSPORES OF SCLEROTINIA MINOR ............................................................................................................................................................ 64 4.1 INTRODUCTION ...................................................................................................................................... 64 4.2 MATERIALS AND METHODS ................................................................................................................... 68 4.2.1 Fungal Material ............................................................................................................................ 68 4.2.2 Identification of Isolates................................................................................................................ 68 4.2.3 Carpogenic Germination .............................................................................................................. 68 4.2.4 Inoculation Protocol ..................................................................................................................... 68 4.3 RESULTS ................................................................................................................................................ 70 4.4 DISCUSSION ........................................................................................................................................... 72 CHAPTER 5: AGGRESSIVENESS AMONG ISOLATES OF SCLEROTINIA SCLEROTIORUM FROM SUNFLOWER ................................................................................................................................... 75 5.1 INTRODUCTION ...................................................................................................................................... 75 5.1.1 Pathogenicity testing ...................................................................................................................... 75 5.1.1.1 Virulence Testing .................................................................................................................................... 76 5.1.1.2 Aggressiveness Testing ........................................................................................................................... 76 5.2 MATERIALS AND METHODS ................................................................................................................... 80 5.2.1 Fungal Material ............................................................................................................................ 80 5.2.2 Plant Material ............................................................................................................................... 80 5.2.3 Inoculation Procedure .................................................................................................................. 82 5.2.4 Statistical Analysis ........................................................................................................................ 82 5.3 RESULTS ................................................................................................................................................ 83 5.3.1 Analysis of Isolate Pathogenicity Testing ..................................................................................... 84 5.3.2 Comparison of Multiple Range Tests to Assess Significant Differences Between Aggressiveness 85 5.3.3 Aggressiveness of Isolates ............................................................................................................. 88 5.3.4 Aggressiveness of Same Plant Isolates ......................................................................................... 92 5.3.5 Aggressiveness of Genotypes ........................................................................................................ 94 5.4 DISCUSSION ........................................................................................................................................... 96 5.4.1 Pathogenicity Testing Methods ..................................................................................................... 96 5.4.2 Statistical Methods ........................................................................................................................ 97 5.4.3 Aggressiveness of Isolates ............................................................................................................. 98 CHAPTER 6: POPULATION GENETICS OF SCLEROTINIA SCLEROTIORUM ATTACKING SUNFLOWER IN AUSTRALIA ................................................................................................................ 103 6.1 INTRODUCTION .................................................................................................................................... 103 6.1.1 Genetic Diversity ........................................................................................................................ 103 6.1.1.1 Distribution of Genetic Diversity Within Populations........................................................................... 104 6.1.1.2 Distribution of Genetic Diversity Between Populations ....................................................................... 105 6.1.1.2.1 Temporal Differences ................................................................................................................... 105 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species X 6.1.2 Production and Maintenance of Diversity .................................................................................. 106 6.1.3 Sclerotinia sclerotiorum .............................................................................................................. 107 6.2 MATERIALS AND METHODS ................................................................................................................. 110 6.2.1 Isolate Collection ........................................................................................................................ 110 6.2.1.1 Distribution of Genetic Diversity Within Populations .......................................................................... 110 6.2.1.1.1 Diversity Within Sclerotia ............................................................................................................ 110 6.2.1.1.2 Diversity Within Plants ................................................................................................................ 110 6.2.1.1.3 Diversity Within Fields ................................................................................................................ 110 6.2.1.2 Distribution of Genetic Diversity Between Populations ....................................................................... 111 6.2.1.2.1 Diversity Between Fields ............................................................................................................. 111 6.2.1.2.2 Temporal Differences ................................................................................................................... 111 6.2.1.2.3 Diversity Between Modes of Infection ......................................................................................... 112 6.2.1.3 Detecting Genotypic Diversity ............................................................................................................. 112 6.2.1.4 Production and Maintenance of Genetic Diversity ............................................................................... 112 6.2.2 Genetic Markers.......................................................................................................................... 112 6.2.2.1 6.2.2.2 6.2.2.3 6.2.2.4 Mycelial Compatibility Groups ............................................................................................................ 112 DNA Extraction .................................................................................................................................... 113 Random Amplified Polymorphic DNAs (RAPDs) ............................................................................... 113 Restriction Fragment Length Polymorphisms (RFLPs) ........................................................................ 114 6.2.3 Data Analysis .............................................................................................................................. 114 6.2.3.1 6.2.3.2 6.2.3.3 6.2.3.4 6.2.3.5 Detecting Genotypic Diversity ............................................................................................................. 114 Comparing Genotypic Diversity ........................................................................................................... 115 Comparing Gene Diversities ................................................................................................................ 116 Distribution of Genetic Diversity ......................................................................................................... 116 Production and Maintenance of Genetic Diversity ............................................................................... 117 6.3 RESULTS .............................................................................................................................................. 119 6.3.1 Detecting Genetic Diversity ........................................................................................................ 119 6.3.1.1 Mycelial Compatibility Groups (MCGs) .............................................................................................. 120 6.3.1.2 Random Amplified Polymorphic DNAs (RAPDs) ............................................................................... 122 6.3.1.3 Restriction Fragment Length Polymorphisms (RFLPs) ........................................................................ 123 6.3.2 Distribution of Genetic Diversity ................................................................................................ 127 6.3.2.1 Frequent Recovery of Genotypes ......................................................................................................... 127 6.3.3 Distribution of Genetic Diversity Within Populations ................................................................ 128 6.3.3.1 Diversity Within Sclerotia .................................................................................................................... 128 6.3.3.2 Diversity Within Plants ........................................................................................................................ 129 6.3.3.3 Diversity Within Fields ........................................................................................................................ 129 6.3.4 Distribution of Genetic Diversity Between Populations ............................................................. 130 6.3.4.1 6.3.4.2 6.3.4.3 6.3.4.4 Diversity Between Fields ..................................................................................................................... 130 Diversity Between States in Australia .................................................................................................. 131 Diversity Between Modes of Infection ................................................................................................. 132 Temporal Differences ........................................................................................................................... 132 6.3.5 Production and Maintenance of Diversity .................................................................................. 136 6.3.5.1 Gametic Disequilibrium ....................................................................................................................... 136 6.3.5.2 Multilocus Associations ....................................................................................................................... 138 6.3.5.3 Comparison of Genotypic Diversity and Gene Diversity .................................................................... 139 6.4 DISCUSSION ......................................................................................................................................... 142 6.4.1 Distribution of Genetic Diversity Within Populations ................................................................ 142 6.4.1.1 Diversity Within Single Sclerotia ......................................................................................................... 142 6.4.1.2 Diversity Within Plants ........................................................................................................................ 142 6.4.1.3 Distribution of Genetic Diversity Between Populations ....................................................................... 143 6.4.2 Contributions of sexual/asexual components .............................................................................. 145 6.4.2.1 6.4.2.2 6.4.2.3 6.4.2.4 6.4.2.5 6.4.2.6 6.4.2.7 Presence of Sexual Structures ............................................................................................................... 146 Frequent Recovery of Genotypes ........................................................................................................ 147 Repeated Temporal Recovery of Common Genotypes ......................................................................... 148 Correlation Between Independent Markers .......................................................................................... 148 Gametic Disequilibrium ....................................................................................................................... 152 Multilocus Association ......................................................................................................................... 153 Comparison of Genotypic Diversity and Gene Diversity ..................................................................... 154 CHAPTER 7: GENERAL DISCUSSION .................................................................................................. 157 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species XI BIBLIOGRAPHY ........................................................................................................................................ 162 APPENDIX 1 ................................................................................................................................................ 188 APPENDIX 2 ................................................................................................................................................ 190 APPENDIX 3 ................................................................................................................................................ 191 APPENDIX 4 ................................................................................................................................................ 201 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species XII LIST OF FIGURES Figure 1.1 Sexual reproduction in Sclerotinia species. ................................................................................ 25 Figure 2.1 Southern hybridizations of S. sclerotiorum (Ss), S. minor (Sm) and S. trifoliorum (St) DNAs, digested with BamHI, with probes: A pME241, B pME230, C pME147 and D pME163. .......... 40 Figure 2.2 Southern hybridizations of EcoR1 digested S. sclerotiorum (Ss), S. minor (Sm) and S. trifoliorum (St) DNAs with radiolabelled probe pMF2. ................................................................... 45 Figure 3.1 Apothecia produced from sclerotia of S. minor isolate UQ 1112.............................................. 55 Figure 3.2 Ascospores displaying size dimorphism within a single ascus of S. trifoliorum (UQ 3326). ....................................................................................................................................................... 57 Figure 3.3 Ascospores displaying monomorphism (Left) and dimorphism (Right) in the same isolate of S. sclerotiorum (UQ 808) . ............................................................................................................. 57 Figure 3.4 Ascospores displaying monomorphism (Left) and dimorphism (Right) in the same isolate of S. minor (UQ 2568) . ...................................................................................................................... 58 Figure 4.1 Lifecycle of S. sclerotiorum on sunflower. Carpogenic germination of sclerotia resulting in head rot and mycelial germination of sclerotia resulting in basal stem rot of sunflower. ................... 65 Figure 4.2 Approximate distribution of S. minor on sunflower and other crops in Australia. ................ 66 Figure 4.3 Approximate distribution of S. sclerotiorum on sunflower and other crops in Australia. This indicates areas where S. sclerotiorum probably produces apothecia in Australia. ........................... 66 Figure 4.4 S. minor causing head rot of sunflower. .................................................................................... 71 Figure 5.1 Sunflower plant inoculated with S. sclerotiorum isolate UQ 1346-2. ...................................... 83 Figure 5.2 Lesion on a sunflower stem following inoculation with a mycelial plug of S. sclerotiorum. The lesion is displaying both bleached girdling and water soaking around the inoculation point. The tissue damage is obvious by the breakage of the stem at the point of weakness. ............................... 84 Figure 5.3 The isolates with aggressiveness significantly different from and not significantly different from the most aggressive isolate UQ 1276-3 in Experiment 1 Day 1 for each multiple comparison test. A: Fisher’s Protected Least Significant Difference (FLSD), B: Duncan’s Multiple Range Test (DMRT), C: Student Newman Keuls (SNK), D: Tukey Significance Difference (HSD), E: Scheffe Significance Difference (SSD). ............................................................................................................................................ 88 Figure 5.4 Rank ordered mean lesion length Experiment 1 Day 1. ........................................................... 90 Figure 5.5 Rank ordered mean lesion length Experiment 2 Day 1. .......................................................... 90 Figure 5.6 Mean lesion length Experiment 2 Day 1 rank ordered as for Experiment 1 Day 1. .............. 90 Figure 5.7 Isolates significantly different from the least aggressive isolate UQ 1328-2 in Experiment 1 Day 1, FLSD........................................................................................................................ 91 Figure 5.8. Mean lesion lengths with standard deviation for 120 isolates grouped into 40 same plant isolates from Experiment 1 Day 1. ...................................................................................................... 94 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species XIII Figure 5.9 Mean lesion lengths with standard deviation for 120 isolates from Experiment 1 Day 1 grouped into 13 genotypes as based on MCGs (Chapter 6). ....................................................................... 95 Figure 6.1 Mycelial compatibility demonstrating and incompatible interaction with barrage zone (Left) and a compatible interaction (Right). ...................................................................................... 121 Figure 6.2 Number of isolates observed in each mycelial compatibility group of 120 S. sclerotiorum isolates collected to study distribution of genetic diversity within populations. ..................................... 121 Figure 6.3 A RAPD gel showing polymorphisms (presence or absence of bands) in isolates of S. sclerotiorum collected to study distribution of genetic diversity within populations detected with primer OPW04. .................................................................................................................................... 122 Figure 6.4 Southern hybridization of BamHI digested DNA from 30 S. sclerotiorum isolates. Plasmid probe pME032 hybridized to one RFLP locus with two alleles. ................................................ 123 Figure 6.5 Southern hybridization of BamHI digested DNA from S. sclerotiorum isolates hybridized to plasmid probe pME017. ...................................................................................................... 124 Figure 6.6 Histogram of the number of isolates for each genotype detected in both the 1994 and the 1996 Australian population using RFLP probe pLK44.20. ......................................................... 128 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species XIV LIST OF TABLES Table 1.1 Some fungicides showing activity against Sclerotinia species. .................................................... 14 Table 2.1 List of isolates, putative species, host, location and collector of Sclerotinia species used in this study. ........................................................................................................................................... 31 Table 2.2 Comparison of characters for species characterisation of isolates. ........................................... 39 Table 2.3 Sizes in kilobases of DNA fragments from pME probes. ............................................................ 42 Table 3.1 Sclerotial size, stipe formation, apothecial formation and ascospore dimorphism of the isolates used in this study. .............................................................................................................................. 56 Table 3.2 Apothecial and stipe production per culture from one generation and percentage of maximum after successive generations of single spored cultures ............................................................... 58 Table 3.3 Stipe and apothecial production from cultures of mass spored and randomly selected single ascospore cultures ................................................................................................................................ 59 Table 3.4 Apothecial and stipe formation of all eight ascospores from a single ascus for isolates of S. minor and S. sclerotiorum ......................................................................................................................... 60 Table 4.1 Size of sclerotia recovered and number of sunflower plants from which the sclerotia were recovered after inoculation of sunflower lines. ................................................................................... 70 Table 4.2 Incidence of infection and sclerotial recovery as well as sclerotial sizes recovered from inoculation of 16 sunflower plants with ascospores of S. minor and S. sclerotiorum. ............................. 71 Table 5.1 List of the isolates of S. sclerotiorum, the location and type of infection from which the isolates were collected and used in this study. .............................................................................................. 81 Table 5.2 ANOVA between inoculation experiments for both Day 1, Day 2 and rate of lesion extension. .......................................................................................................................................... 85 Table 5.3 Number of significant differences in aggressiveness detected between individual isolates and between same plant isolates, and the number of significant interactions between those individual isolates and same plant isolates using different multiple comparison tests ................... 86 Table 5.4 ANOVA between isolates for both experiments for Day 1, Day 2 and rate of lesion extension. ......................................................................................................................................... 88 Table 5.5 ANOVA between isolates for location and mode of infection (head rot or basal stem rot). .... 92 Table 5.6 ANOVA between isolates from different plants for both experiments and days. .................... 93 Table 5.7 ANOVA between same plant isolates of UQ 1276 for both experiments. ................................. 93 Table 5.8 ANOVA between same plant isolates of UQ 1291 for both experiments. ................................. 93 Table 5.9 ANOVA between genotypes groups as based on results in Chapter 6 for both experiments and days. .................................................................................................................................... 95 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species XV Table 6.1 Total number of isolates (N), total number of genotypes, genotypic diversity (G) and genotypic diversity of maximum (G/N) of all populations, using multicopy probe pLK44.20. .............. 119 Table 6.2 The number of additional genotypes identified in each mycelial compatibility group (MCG) by alternative molecular markers from 120 isolates collected from Gatton and Wyreema in 1994. .... 125 Table 6.3 Number of genotypes, number of isolates in the largest genotype, genotypic diversity (G), genotypic diversity of maximum (G/N), Shannon’s index of diversity (D) and Shannon’s index of diversity population size corrected (D) of MCGs, multicopy RFLPs, single copy RFLPs (haplotype) and RAPDs for 120 isolates. .................................................................................................... 125 Table 6.4 The probability of any two individual isolates having the same fragments and the expected frequency of the theoretical most common fingerprint for each marker used. ....................... 127 Table 6.5 Nei’s measure of gene diversity for each subpopulation (Hi), gene diversity in the total population (HT), gene diversity within subpopulations (HS), average gene diversity between subpopulations (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for all 11 RFLP loci in two fields at Gatton (A) and Wyreema (B) in 1994 and 1996. .......................................................................................................................................... 131 Table 6.6 Nei’s measure of gene diversity for each subpopulation (Hi), gene diversity in the total population (HT), gene diversity within subpopulations (HS), average gene diversity between subpopulations (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for all 11 RFLP loci in Australian populations of S. sclerotiorum collected from sunflower in Queensland (QLD) (A) and New South Wales (NSW) (B). ........................ 131 Table 6.7 Nei’s measure of gene diversity for each subpopulation (Hi), gene diversity in the total population (HT), gene diversity within subpopulations (HS), average gene diversity between subpopulations (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for all 11 RFLP loci in Australian populations of S. sclerotiorum collected from head rot (A) and basal stem rot (B) of sunflower. ............................................................ 132 Table 6.8 Nei’s measure of gene diversity for each subpopulation (Hi), gene diversity in the total population (HT), gene diversity within subpopulations (HS), average gene diversity between subpopulations (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for all 11 RFLP loci in Australian populations of S. sclerotiorum collected from sunflower in 1994 (A) and 1996 (B).................................................................................... 133 Table 6.9 Measures of gametic disequilibrium among pairs of RFLP loci in 120 Sclerotinia isolates collected in 1994 at Gatton and Wyreema. ................................................................................................. 134 Table 6.10 Measures of gametic disequilibrium among pairs of RFLP loci in 40 Sclerotinia isolates collected in 1996 at Gatton and Wyreema. ................................................................................................. 135 Table 6.11 Summary of significant loci with gametic disequilibrium and Bonferroni correction for temporal populations 1994 and 1996 at Gatton and Wyreema. ........................................................ 135 Table 6.12 Measures of gametic disequilibrium among pairs of RFLP loci for 1996 Australian populations of S. sclerotiorum. ..................................................................................................................... 137 Table 6.13 Summary of significant loci with gametic disequilibrium and Bonferroni correction for 1996 Australian populations of S. sclerotiorum ................................................................................... 137 Table 6.14 Measures of gametic disequilibrium among pairs of RFLP loci for 1994 and 1996 Australian populations of S. sclerotiorum................................................................................................... 138 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species XVI Table 6.15 Summary of significant loci with gametic disequilibrium and Bonferroni correction for 1994 and 1996 Australian populations of S. sclerotiorum . ................................................................. 138 Table 6.16 Multilocus associations among 11 RFLP loci in Australian populations of S. sclerotiorum. .............................................................................................................................................. 139 Table 6.17 Total number of genotypes, total number of isolates (N), genotypic diversity (G), genotypic diversity of maximum (G/N) and Nei’s gene diversity (h) of all populations, using multicopy probe pLK44.20. ............................................................................................................... 140 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species XVII Chapter 1: General Introduction _________________________________________________________________________ Chapter 1: General Introduction 1.1 INTRODUCTION Virtually all agricultural crop species grown in Australia, with the exception of macadamia, have been introduced into Australia from other countries where they have coevolved with most of their respective pathogens. The majority of diseases afflicting agricultural crops in Australia have probably been introduced with their hosts over the last two hundred years. Other diseases such as flax rust may have been in Australia longer, parasitizing wild relatives of crop species (Burdon and Jarosz 1992; Burdon and Roberts 1995). During the 18th and 19th centuries, movement of the crops and associated diseases was by sailing ship, and the inability to survive during the long sea voyages probably acted as quarantine barriers against some pathogens (Gibbs 1986). Other pathogens were not as constrained. Burdon et al. (1982) indicated Puccinia graminis Pers. f. sp. tritici Eriks. and Henn. had migrated to Australia from Africa via windblown spores indicating the potential for gene flow on a global scale. Close et al. (1978) found that within two years of new wheat rust races affecting wheat crops in Australia, the same races were detected in New Zealand, and were believed to be wind dispersed between the two countries. Australia, because of its geographic isolation as an island, provides a unique opportunity to study pathogen diversity. Since genetic diversity in the colonizing pathogen population will only be a fraction of the genetic diversity in the source population, comparisons of populations in Australia and other countries should indicate the origins of possible migrations into Australia. At the genetic level, migration represents gene flow or the movement of alleles or genotypes between populations. Migration does not mean however, that genetic exchange will occur, especially since exchange may require the presence of mating types or vegetatively compatible strains. Introduction of an organism into a new environment is often associated with „founder effect‟ and population bottlenecks, both of which result in genetic drift and further differentiation between populations (Nei et al. 1975). Founder populations are small _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 1 Chapter 1: General Introduction _________________________________________________________________________ subpopulations which may not be genetically representative of the original population. With population bottlenecks (a drastic reduction in population numbers and possible extinction of rare genotypes) the populations of introduced pathogens would be expected to show little variation within the population compared with between population diversity. Founder populations of pathogens which have successfully colonized Australia may have since received little migration from internationally genetically heterogenous populations. Goodwin et al. (1993) found low levels of genetic variation in Rhynchosporium secalis (Oud.) Davis, within Australia which was thought to be the result of a bottleneck. There were however higher levels of genetic variation between countries but not as high as would be expected due to recent migrations. Genetic variability is decreased during bottlenecks, but diversity is also dependent on the length of time that the population remains small. Most pathogen populations on agricultural hosts in Australia experience this bottleneck but because of monocultured hosts the population could rapidly expand. Goodwin et al. (1993) also found high levels of genetic variation maintained in separated populations apparently caused by spatial and temporal differences in selection pressures. Variation in racial and virulence structure of populations of flax rust (Melampsora lini Ehrenb.) found in Australia was attributed to genetic drift from annual bottlenecks and repeated extinction and recolonization cycles (Burdon and Jarosz 1992). One common observation in plant pathology is that the release of resistant host cultivars is usually followed by the appearance of a virulent pathogen, often with dramatic consequences. The ability of pathogens to evolve rapidly and adapt to any new resistance or chemical controls is encouraged by the strong selection pressure provided by practices in modern agricultural systems. The effect of host resistance is heightened through growth of genetically uniform crops. It seems unlikely there will be a major shift away from genetic uniformity towards use of cultivar diversity in commercial agriculture. Instead the shift is even more intensively towards uniformity through the adoption of genetically engineered crops. Evolutionary forces such as mutation and recombination may create pathogen strains capable of overcoming this resistance. Measuring genetic variation within a fungal pathogen may reveal how rapidly it can change genetically to overcome resistance and therefore how durable the control measures are likely to be. Knowledge of the distribution of genetic variation is also likely to indicate more effective methods of disease control. If _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 2 Chapter 1: General Introduction _________________________________________________________________________ certain genotypes are restricted to certain locations then quarantine measures could be applied to prevent them combining into one large population. Controlled deployment of resistance genes may also increase the durability of resistance. However, if large amounts of genetic variation are found in the pathogen populations within individual fields then other control strategies may be required within the field such as use of fungicides or cultivar mixtures. Gene pyramiding utilizing combinations of genes (whether conventional or supplemented with molecular biology), may provide more durable resistance but again, this durability is a function of the capacity of the pathogen to recombine virulence genes. The research presented in this study examines some of the genetic forces influencing the Australian population of Sclerotinia sclerotiorum (Lib.) de Bary attacking the introduced crop sunflower (Helianthus annuus L.). Detection of genetic variation in S. sclerotiorum attacking sunflower in Australia, will enable the prediction of the durability of any resistance incorporated by either conventional breeding or novel gene techniques. The failure of conventional breeding to produce Sclerotinia resistant crops has encouraged the use of genetic engineering to introduce genes that will increase resistance. To ensure the success of the recombinant host it must be screened against a diverse range of pathogen genotypes that should include the most common genotypes as well as the most pathogenic. Durability of such acquired „resistance‟ may be short-lived once released into commercial use if unrecognized genotypes in the pathogen population overcome this resistance. This study also includes research on aspects of the related fungi S. minor Jagger and S. trifoliorum Erikss. The three species are now examined in more detail. 1.2 THE PATHOGENS The genus Sclerotinia is composed of three economically important species, S. sclerotiorum, S. minor and S. trifoliorum. These species were separated most convincingly by Kohn (1979a) on the basis of morphology of the sexual stage. However, variability in taxonomic criteria has in the past resulted in these Sclerotinia species being regarded as a single species (Morrall et al. 1972; Price and Colhoun 1975b; Purdy 1955). Classification in the genus Sclerotinia has always been surrounded by confusion. Accurate identification of species is critical for population genetic analysis to predict population _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 3 Chapter 1: General Introduction _________________________________________________________________________ substructuring within species. Identification techniques have moved towards molecular methods due to difficulty in obtaining simultaneous production of morphological characters to enable classification (Kohn et al. 1988). Restriction Fragment Length Polymorphism (RFLP) analysis has been used to separate the three species of Sclerotinia (Kohn et al. 1988), as have Random Amplified Polymorphic DNA (RAPD) analysis (Ekins et al. 1994b). S. sclerotiorum and S. minor are economically important pathogens because they attack a wide range of horticultural and oilseed crops. However, S. trifoliorum, has a host range restricted to clover (Trifolium spp.). Commercially-adapted resistant cultivars are not available and chemical control is often not cost effective. Sclerotinia species produce sclerotia which are vegetative survival structures composed of melanised compacted mycelium. Sclerotia can survive in the soil for several years (Grogan 1979). Consequently once a field is infested with sclerotia eradication is difficult. Sclerotial formation also enables movement through machinery, seed and irrigation. These three species are ascomycetes, and produce apothecia as a result of sexual fertilization. Ascospores are released enabling airborne dispersal and infection. 1.2.1 Taxonomy 1.2.1.1 Genera Sclerotinia sclerotiorum as it is known today was initially described by Libert (1837) as Peziza sclerotiorum. Fuckel (1870) was the first to erect the genus Sclerotinia (apothecia arising from a true sclerotium) incorporating Peziza sclerotiorum but changed the name to Sclerotinia libertiana. The genus thus included S. candolleana (Lev.) Fuckel, S. fuckeliana (de Bary) Fuckel, Fuckel (= Peziza sclerotiorum Lib.), S. tuberosa (Hedw.) Fuckel, and S. baccata Fuckel. The name S. libertiana was ignored by de Bary (1884) who changed Peziza sclerotiorum to Sclerotinia sclerotiorum. Wakefield (1924) supported the use of the name S. sclerotiorum as the specific name must be retained when transfers between genera occur. Ramsey (1924) proposed a new species S. intermedia based on differences in sclerotial sizes, different ascus and ascospore sizes and growth rates at lower temperatures between _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 4 Chapter 1: General Introduction _________________________________________________________________________ S. minor and S. sclerotiorum. Honey (1928) whilst studying the monilioid conidia bearing members of the genus Sclerotinia indicated the related genera as including Ciboria, Monilinia, Rutstroemia, Stromatinia and Sclerotinia. Honey (1928) then nominated S. candolleana as the type species of Sclerotinia and Monilinia fructicola (Winter) Honey (=Sclerotinia fructicola (Winter) Rehm) as the type species of the new genera Monilinia. Drayton (1934) proposed the creation of a new binomial from Sclerotium gladioli Massey to Sclerotinia gladioli (Massey) Drayton. Whetzel (1945) transferred Sclerotinia gladioli as Stromatinia gladioli (Drayton) Whetzel to the genus Stromatinia. Drayton (1937) then proposed the binomial Sclerotinia convoluta from Botrytis convoluta Whetzel and Drayton. Drayton (1943) also proposed a new species S. sativa with sclerotia similar in size to S. minor but with darker apothecia, smaller asci and ascospores. Whetzel (1945) transferred S. candolleana to a new genus Ciborinia, and named S. sclerotiorum as the type species of the genus Sclerotinia which was the type genus of Sclerotiniaceae. the family Whetzel (1945) delimited the genus Sclerotinia using the criteria of apothecia arising from a definite sclerotium, inoperculate asci containing usually eight ellipsoidal hyaline ascospores, globose spermatia and lacking conidia. this new genus were then: S. curreyana (Berkley) Karste, S. sclerotiorum, S. The members of caricis-ampullaceae Nyberg, S. duriaeana (Tul.) Rehm, S. intermedia Ramsey, S. longisclerotialis Whetzel, S. minor, S. panacis Rankin, S. sativa, S. scirpicola Rehm, S. sulcata Whetzela, S. trifoliorum, and S. vahliana Rostr. Dennis (1956) separated the genus Sclerotinia into four subgenera: subgenus Sclerotinia with S. sclerotiorum as type species and including S. minor, S. bulborum (Wakker) Rehm, S. serica Keay, S. trifoliorum, and S. tuberosa; subgenus Ciborinia with S. candolleana as type species; subgenus Myriosclerotinia with S. curreyana; and subgenus Botryotinia with S. fuckeliana. Dumont and Korf (1971) stated that when Whetzel (1945) removed the type species S. candolleana from Sclerotinia and transferred it to Ciborinia, that Sclerotinia should replace Ciborinia, because it was the type species. The generic name Myriosclerotinia was then suggested by Dumont and Korf (1971) to replace Sclerotinia. Korf and Dumont (1972) then erected a new genus Whetzelinia with type species S. sclerotiorum and containing S. tuberosa. Dennis (1974) proposed that Sclerotinia be retained with _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 5 Chapter 1: General Introduction _________________________________________________________________________ S. sclerotiorum as type species. Buchwald and Neergaard (1976) also supported the retainment of S. sclerotiorum as type species of Sclerotinia and subsequently Ciborinia be retained with Ciborinia candolleana as type species. Kohn (1979a) delimited the genera Sclerotinia to include only those species with the outermost layer of the apothecium (ectal excipulum) composed of globose cells in chains orientated at right angles to the surface. The species belonging to Sclerotinia were then S. sclerotiorum, S. minor and S. trifoliorum. 1.2.1.2 Species Keay (1939) suggested that S. sclerotiorum and S. trifoliorum could be distinguished from each other by: cultural characteristics; apothecial structure; ascospore size and asci size. Henson and Valleau (1940) and Williams and Western (1965b) both indicated that S. sclerotiorum produces apothecia in spring and S. trifoliorum produces apothecia in autumn, but Williams and Western (1965b) regarded this as insufficient for describing the species, as exceptions to this occur. Purdy (1955) pooled previous studies of ascus, ascospore and sclerotial sizes along with his own measurements, and concluded that S. sclerotiorum, S. minor and S. trifoliorum were all the same species. The continuous variation within S. sclerotiorum would allow for any differences such as sclerotial diameters and hosts which were regarded as insufficient to warrant separate speciation. The former species such as S. minor was then referred to as the horticultural variety of S. sclerotiorum "Minor"; S. intermedia, was then referred to as S. sclerotiorum "Intermedia", and the large sclerotium forms as S. sclerotiorum "Major" (Purdy 1955). This continuous variation was also accepted by Morrall et al. (1972) after trying unsuccessfully to classify Sclerotinia isolates on the basis of morphological, pathological, physiological, host, geographical or even combined characteristics. Price and Colhoun (1975b) also agreed on the variability displayed by S. sclerotiorum on the basis of measurements of sclerotia, asci and ascospores. Tariq et al. (1985), by using sclerotial diameters and patterns on media, were also able to distinguish S. minor from S. trifoliorum and S. sclerotiorum, but not between the latter two. A large number of workers agree that small sclerotial diameters are consistent with S. minor as opposed to large sclerotia consistent with _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 6 Chapter 1: General Introduction _________________________________________________________________________ S. sclerotiorum or S. trifoliorum (Jagger 1920; Kohn 1979a; Letham et al. 1978; Petersen et al. 1982; Tariq et al. 1985; Willets and Wong 1971; Wong 1979). Loveless (1951) described the appearance of dimorphic ascospores as a common but not essential criteria of ascospores in S. trifoliorum and S. trifoliorum var. fabae Keay. Kohn (1979a; 1979b) established dimorphism in ascospore size with a 4:4 segregation into large and small ascospores as a character specific to S. trifoliorum. Uhm and Fujii (1983a) found all mature ascospores had a 4:4 dimorphic segregation. Cytological studies have also distinguished the three main species, on the basis of chromosome numbers and the number of nuclei in the ascospores (Wong and Willetts 1979). S. minor and S. trifoliorum were tetranucleate with a haploid chromosome number of four for S. minor and eight for S. trifoliorum, whilst S. sclerotiorum was binucleate with a haploid chromosome number of eight. Kohn (1979a) listed the most important criteria for separating the three Sclerotinia species as: S. trifoliorum: dimorphic ascospores (usually 4:4), tetranucleate, ascospore length/width ratio (1.9- 2.0). S. minor: ascospores tetranucleate, ectal excipulum composed of globose cells in chains perpendicular to apothecial margin. S. sclerotiorum: ascospores binucleate, ascospore length/width ratio > 2.0, ectal excipulum at apothecial margin composed of prosenchymatous cells parallel to the asci gradually “turning out” perpendicularly to the apothecial surface. Jayachandran et al. (1987) also recognized the differences in ectal excipulum but considered them insufficient for separating the three species. Host specificity has been used to separate the species in the genus Sclerotinia. S. sclerotiorum and S. minor have extremely wide host ranges with a large amount of overlap (Pratt 1992). S. trifoliorum was unique amongst the Sclerotinia species because of its restricted host range (Held and Haenseler 1953; Keay 1939). S. sclerotiorum isolates have also been found to overlap the S. trifoliorum host range (Cappellini 1960; Jellis et al. 1990; Pratt et al. 1988; Pratt and Rowe 1995) and isolates of S. trifoliorum have been found to infect other legumes (Jellis et al. 1990; Pratt et al. 1988). S. trifoliorum is not limited to herbage legumes and thus the definition of the species of S. trifoliorum has changed from _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 7 Chapter 1: General Introduction _________________________________________________________________________ one of host restricted species to one delimited by characters such as the presence of dimorphic ascospores. Molecular methods have recently been used to separate the species. Protein electrophoresis has been used (Cruickshank 1983; Petersen et al. 1982; Tariq et al. 1985; Wong and Willetts 1973; Wong and Willetts 1975a). Kohn et al. (1988) used restriction fragment length polymorphisms (RFLPs) of DNA to separate S. sclerotiorum, S. minor, S. trifoliorum, a new species S. asari Wu and Wang and unknown species of Sclerotinia later described as Sclerotinia nivalis Saito (Saito 1997). Kohn et al. (1988) also included S. ficariae Rehm with S. sclerotiorum. Ekins (1993) was also able to separate S. sclerotiorum, S. minor and S. trifoliorum using random amplified polymorphic DNA (RAPD). Sequencing of the internal transcribed spacer 1 (ITS 1) by Carbone (1993) detected very little interspecific variation, with a single base substitution separating S. trifoliorum from S. sclerotiorum and S. minor. New species of Sclerotinia incorporated into this genus using morphological criteria include: Sclerotinia atrostipitata Svrcek (Svrcek 1988), Sclerotinia verrucispora Baral (Baral 1989) and Sclerotinia glacialis Graf and Schumach. (Graf and Schumacher 1995). Morphological characteristics were also combined with molecular markers for identifying Sclerotinia tetraspora Holst-Jensen and Schumach. (Holst-Jensen and Schumacher 1994) as a new species. 1.3 THE DISEASE 1.3.1 Host Ranges Sclerotinia species have very wide host ranges. Boland and Hall (1994) listed 75 families containing 278 genera and 408 species as hosts of S. sclerotiorum. S. minor has a more restricted host range but overlaps in many species with S. sclerotiorum. Melzer et al. (1997) listed the host range of S. minor which included 21 families, 66 genera and 94 species with two examples in Monocotyledonae. S. trifoliorum however, has a very restricted distribution being mainly limited to herbage legumes (Held and Haenseler 1953; Keay 1939). However, this host range has since been found to overlap with the wide host range _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 8 Chapter 1: General Introduction _________________________________________________________________________ of S. sclerotiorum and S. minor on other additional members of the family Leguminoseae (Cappellini 1960; Jellis et al. 1990; Pratt et al. 1988; Pratt and Rowe 1995). 1.3.2 Pathogenesis Pathogenesis is the chain of events or processes that lead to disease (Scheffer 1997). Colonization of host tissue is the first stage of disease development and this is an intercellular penetration by infection hyphae in any combination of mechanical (Lumsden and Dow 1973; Tariq and Jeffries 1984) and enzymatic degradation (Prior and Owen 1964). Hyphae can directly infect through stomata (Jones 1976; Lumsden and Wergin 1980). However, ascospores generally germinate and form appressoria and infection cushions followed by infection pegs (Lumsden and Dow 1973; Prior and Owen 1964). Vesicles with radiating intercellular hyphae develop between the cuticle and epidermis within 12-24 hours (Lumsden 1979). Enzymes involved in degrading the middle lamella include pectin methylesterase, endo-polygalacturonase and exo-polygalacturonase (Lumsden 1976). Ascospore infection generally requires an exogenous energy source such as injured or dead tissue to invade healthy tissue (Abawi and Grogan 1975; Abawi and Grogan 1979; Abawi et al. 1975; Lithourgidis et al. 1989; Lumsden 1979; Lumsden and Dow 1973). However, infection from S. minor has been shown to cause infection without an exogenous energy source (Imolehin and Grogan 1980; Wymore and Lorbeer 1987). Nutrition during pathogenesis can also be provided by cell wall degrading enzymes such as cellulase, hemicellulase, exo-polygalacturonase, phosphatidase and proteolytic enzyme which release simple carbohydrates and amino acids (Lumsden 1979). Infection hyphae are either orientated parallel to the stem and subcuticular tissue causing watersoaked lesions or cortical infection hyphae resulting in the girdling of the stem (Lumsden 1979). Ramifying hyphae are then produced which branch rapidly and attack inter- and intracellularly invading the cortex and vascular tissue, resulting in vascular plugging and wilting (Lumsden 1979). These ramifying hyphae emerge from host tissue to form sclerotial initials followed by sclerotia (Lumsden and Dow 1973). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 9 Chapter 1: General Introduction _________________________________________________________________________ Oxalic acid produced and released by the fungus is involved from early stages of disease development in conjunction with pectolytic enzymes. It is a strong chelator of calcium and other cations that inhibit the action of endo- and exo- polygalacturonases (Lumsden 1979). Oxalic acid reduces the pH lowering cell viability (Maxwell and Lumsden 1970) and increasing the activity of cell wall degrading enzymes produced by Sclerotinia (Lumsden 1979). Correlation between levels in the production of oxalic acid and virulence has not always been found (Lumsden 1979) although some researchers have found an association (Godoy et al. 1990; Noyes and Hancock 1981). Production of pectolytic enzymes (Hancock 1966), phosphatidase (Lumsden 1976), pectin methylesterase (Morrall et al. 1972) or polygalacturonase (Morrall et al. 1972) were also not correlated with virulence. However, endo-polygalacturonase had a positive correlation with virulence (Lumsden 1976). More recent work in the field of pathogenesis has shifted towards characterization and cloning of cell wall degrading enzymes such as beta-galactosidase (Waksman 1988; Waksman 1989), polygalacturonases (Reymond-Cotton et al. 1996) and endopolygalacturonases (Favaron et al. 1997; Fraissinet-Tachet et al. 1995; Martel et al. 1998). Characterization of these could also identify enzyme inhibitors useful for future incorporation into resistant hosts. 1.3.3 The Disease on Sunflowers The disease lifecycle of S. sclerotiorum on sunflower has two modes of infection: direct infection following myceliogenic germination of sclerotia and from airborne ascospores resulting from carpogenic germination of sclerotia. S. minor has only been recorded infecting sunflower via direct germination of sclerotia. Wilt or basal stem rot of sunflower is caused by direct attack of the root or base of the stem (Huang and Dueck 1980; Huang and Hoes 1980). Root exudates stimulate mycelial germination of the sclerotia, with subsequent formation of infection hyphae and appressoria penetrating the root or stem base. The first symptom of infection is the formation of an obvious lesion, with mycelium of the fungus travelling directly behind the lesion front (Sedun and Brown 1989). The lesion rapidly travels up the stem, which may develop the appearance of either: water soaking or a white bleached girdling. This is usually followed by wilt of the plant. Under moist _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 10 Chapter 1: General Introduction _________________________________________________________________________ conditions white fluffy mycelium may be present on the lesion. It is the characteristic formation of the black sclerotia in all the different infection types that makes the causal agent of these fungal attacks obvious. When sunflower are affected by wilt, transmittance to adjacent plants can also occur through root to root contact. Middle stalk rot is very similar in appearance to basal stem rot. However, it is caused by ascospores landing on wounded leaves or leaves exudating sugars (Sedun and Brown 1986) and establishing infections that result in a lesion starting in the middle of the stem and spreading in both directions. This generally results in a wilt when girdling is complete and the plant stem may collapse at this point. Wilt can occur at any stage of the sunflower lifecycle, whereas head rot occurs after anthesis. Head rot is due to ascospore infection and as such is limited to periods of cool moist conditions conducive to apothecial production and ascospore liberation. Ascospores thus released, first land on and colonize the florets. Water soaked lesions become obvious on the dorsal face of the flower and under moist conditions fluffy white mycelia may be present. The floral head is usually totally destroyed except for the vascular tissue (Masirevic and Gulya 1992). Sclerotia develop within the cavity of the capitulum but with sufficient moisture can further develop into grilles across the face of the flower with seeds providing a grid on which the sclerotia forms a regular lattice pattern. All modes of infection with sufficient moisture and nutrition will result in sclerotial formation. The sclerotia develop from masses of intermingling hyphae which form tightly bound white balls of which the outer rind finally melanises. The sclerotia can fall from the plant at any time or during harvesting and will thus be returned to the soil. The sclerotia may remain in the trash on the ground or be ploughed into the soil. In addition they can be transported away with the harvested sunflower seed. Sclerotia can have extremely high survival rates in the soil. Williams and Western (1965a) found 95% survival in the soil of sclerotia of S. sclerotiorum after 2 years. Survival in the soil has also been reported for up to 8 years (Grogan 1979). Williams and Western (1965a) concluded that sclerotia in the top 5 cm of soil could produce apothecia and secondary sclerotia but were more easily destroyed, meanwhile those at greater depths tended to last longer. Adams (1975) studied survival of sclerotia in the soil and found they survived better in the first 30 cm than at greater depths. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 11 Chapter 1: General Introduction _________________________________________________________________________ Observations of the modes of transmission are very important for implementation of disease management strategies such as establishment of quarantine zones. The movement of sclerotia around Queensland by contract harvesters is one important example, as is the movement with seed. Although internal infection of sunflower seeds is rare (Merriman and Heathcote 1979), sclerotia can occur as contaminants amongst commercial planting seed (Miclaus et al. 1988; personal observations). As well as direct movement of the asexual propagules (sclerotia) S. sclerotiorum can also travel via the sexual ascospores. Under conducive environmental conditions such as the rapid movement of storms, there is the potential for movement of ascospores several hundred kilometres within hours. Meier et al. (1933) found viable spores of Sclerotinia spp. in air currents at altitudes of 150 to 5500 metres. 1.3.3.1 Control Methods 1.3.3.1.1 Traditional 1.3.3.1.1.1 Cultural Control As with all diseases, prevention is better than cure and the use of disease free seed is the first stage, although commercial sunflower seed is not necessarily free of sclerotia (personal observations). Currently the most effective mechanism employed for controlling Sclerotinia in sunflower is the judicious timing of planting and employment of crop rotation. Planting of cultivars early to ensure they mature before cool moist conditions reduces damage especially to head rot (Clarke et al. 1992; Slatter 1992). Rotating an infested field with nonhosts such as cereals can reduce disease incidence, by preventing continual build up of sclerotia in the soil (Stovold and Moore 1972). However studies by Morrall and Dueck (1982) have found that despite rotation with non-hosts, sclerotia still survive in the soil and influxes of ascospores from surrounding areas can still occur thus making some crop rotations ineffective. Weed hosts can function as alternate hosts during rotation with non hosts, thus reducing the effectiveness of crop rotation as a control strategy (Phillips 1992). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 12 Chapter 1: General Introduction _________________________________________________________________________ Cultural methods such as rouging diseased plants and removal of stubble are useful in preventing inoculum build up and infection of next years crop. Sclerotia can remain in the soil for many years, whilst mycelia can only remain viable in sunflower tissue until the next season (Huang and Kozub 1993). The burial of crop debris by deep ploughing can minimize sclerotial survival (Merriman 1976; Mitchell and Wheeler 1990) but plowing can also return sclerotia to the surface and stimulate apothecial germination (Williams and Western 1965b). Spread of disease can be minimized by altering plant spacing distances to reduce the spread of wilt between neighboring plants (Huang and Hoes 1980). However, other research found plant density had no significant effect, but inoculum density was important (Holley and Nelson 1986). Changing irrigating systems can also influence the spread of disease as well as altering losses. Flood irrigation and overhead irrigation may favour the development of wilt and head rot respectively in a crop. However, the flooding of soil for three weeks has been suggested as a method for destroying sclerotia (Moore 1949; Williams and Western 1965a). Soil solarization has been suggested as a possible means of killing sclerotia (Phillips 1990). Reduction of nitrogen fertilization applications can also limit Sclerotinia infections (Masirevic and Gulya 1992). 1.3.3.1.1.2 Chemical Control Chemical control can be effective with judicious spraying techniques, application volumes and timing. However injudicious chemical usage can easily be cost ineffective (Clarke et al. 1992; Morrall 1993; Sackston 1992; Warmington 1981). Chemical control has always been controlled by economics but has recently been influenced by public perceptions of environmental consequences. In addition, applications of fungicide may have detrimental effects on crop production by destroying beneficial microorganisms in the soil, such as those which parasitize sclerotia. Chemical control can take the form of soil fumigant to kill sclerotia and direct crop sprays and as a preventative seed treatment. Chemicals usually only prevent further disease increases during high risk periods, as eradication of Sclerotinia is extremely difficult (Porter et al. 1994). Some of the chemicals used for control of Sclerotinia include Benomyl and Dichloran (Warmington 1981), Procymidone, phosphorus acid and diniconazole (Porter et al. 1994). The appearance of fungicide resistance in Sclerotinia (Hubbard et al. 1997; Smith et al. 1991; Smith et al. 1995) suggests an erosion _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 13 Chapter 1: General Introduction _________________________________________________________________________ of the potential of chemicals to control these fungi. Other examples of fungicides used to control Sclerotinia spp. are listed in Table 1.1. Table 1.1 Some fungicides showing activity against Sclerotinia species. Fungicide Reference Benomyl (Jones and Gray 1973) (Beute et al. 1975; Chambers 1993; Gabrielson et al. 1973; Henning and Franca Neto 1985; Herd and Phillips 1988; Letham et al. 1976; Porter and Phipps 1985a; Spalding and Reeder 1974; Steadman 1979) Benzotriazole (Jones and Gray 1973) Carboxin (Henning and Franca Neto 1985) Chlorothalonil (Beute et al. 1975) Chlozolinate (Smith et al. 1991) Cyanamide (Gabrielson et al. 1973) Dazomet (Jones 1974; Wong and Willetts 1979) DCNA (Beute et al. 1975; Letham et al. 1976; Patterson and Grogan 1985; Spalding and Reeder 1974; Steadman 1979) Dicloran (Brenneman 1987; Brenneman et al. 1987; Porter and Phipps 1985a; Porter and Phipps 1985b) Fluazinam (Chambers 1993; Smith et al. 1991) Fluorophenylalanine (LeTourneau 1984) Iprodione (Brenneman 1987; Brenneman et al. 1987; Chambers 1993; Herd and Phillips 1988; Patterson and Grogan 1985; Porter and Phipps 1985b; Smith et al. 1991) Maleic acid hydrazide (Jones and Gray 1973) Metham sodium (Wong and Willetts 1979) Parabanic acid (Jones and Gray 1973) PCNB (Beute et al. 1975; Brenneman 1987; Steadman 1979) Procymidone (Herd and Phillips 1988; Porter and Phipps 1985a; Porter and Phipps 1985b) Thiophanate-methyl (Chambers 1993; Letham et al. 1976) Thiabendazol (Henning and Franca Neto 1985; Natti 1971; Spalding and Reeder 1974) Vinclozolin (Brenneman 1987; Brenneman et al. 1987; Herd and Phillips 1988; Patterson and Grogan 1985; Porter and Phipps 1985b; Smith et al. 1991) _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 14 Chapter 1: General Introduction _________________________________________________________________________ 1.3.3.1.1.3 Biological Control Biological control of Sclerotinia in sunflower has not yet reached commercial application, although experiments involving biocontrol have shown promising results against sunflower wilt (Huang and Kozub 1991a). Indeed the hyperparasites are most likely working all the time in the environment without being observed. Huang (1977) demonstrated an oscillating pattern in populations between S. sclerotiorum and Coniothyrium minitans Campbell indicating a functioning relationship between the two fungal species. Other examples of work done on biological control of Sclerotinia in sunflower include the use of: C. minitans (Huang 1977; Huang and Kozub 1991a; Whipps and Gerlagh 1992), Trichoderma spp. (Huang and Kozub 1991a; Wu 1991), Gliocladium virens Miller and Foste (Wu 1991), Sporidesmium sclerotivorum Uecker, Ayers and Adams (Adams and Ayers 1981; Adams and Ayers 1983), Teratosperma oligocladum Uecker, Ayers and Adams, (Adams and Ayers 1983) and Bacillus spp. (Wu 1991). Recent research concentrating on hypovirulence associated with double-stranded ribonucleic acids (dsRNA) indicates a new avenue for biological control (Boland 1992). However, the presence of mycelial compatibility groups (MCGs) may inhibit transmission of these hypovirulence factors (Melzer and Boland 1996). This list is far from exhaustive and many more mycoparasites of Sclerotinia have been studied in other crops and are listed in Table 1.2. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 15 Chapter 1: General Introduction _________________________________________________________________________ Table 1.2. Antagonists and mycoparasites of Sclerotinia spp. Antagonists and Mycoparasites Authors Achaetomium sp. (Boland and Inglis 1988) Alternaria alternata (Fr.) Keiessler (Boland and Inglis 1988) Bacillus spp. (Wu 1991) Chaetomium globosum Kunze (Boland and Inglis 1988) Cladosporium cladosporioides (Fres.)de Vries (Boland and Inglis 1988) Coniothyrium minitans Dictyosporium elegans Corda (Adams 1989; Huang 1977; Huang and Kozub 1991a; Keane and Merriman 1982; McQuilken et al. 1997; Mitchell et al. 1995; Phillips 1989; Whipps and Gerlagh 1992; Zazzerini and Tosi 1985) (Adams 1989) Drechslera sp. (Boland and Inglis 1988) Epicoccum purpurascens Ehrenheb. (Boland and Inglis 1988) Fusarium graminearum Schwabe (Boland and Inglis 1988) Fusarium heterosporum (Fr) Nees (Boland and Inglis 1988) Fusarium oxysporum Schlect. (Zazzerini and Tosi 1985) Fusarium solani (Mart.) Sacc (Zazzerini and Tosi 1985) Gliocladium catenulatum Gilman and Abott (Huang 1978; Zazzerini and Tosi 1985) Gliocladium roseum Bain Gliocladium virens (Boland and Inglis 1988; Phillips 1989; Zazzerini and Tosi 1985) (Adams 1989; Phillips 1986; Phillips 1989; Wu 1991) Penicillium citrinum Thom (Adams 1989; Akem and Melouk 1987) Penicillium griseofulvum Dierchx (Zazzerini and Tosi 1985) Sporidesmium sclerotivorum (Adams and Ayers 1981; Adams and Ayers 1983) Talaromyces flavus (Klocker) Stolk and Samson (Adams 1989) Teratosperma oligocladum (Adams 1989; Adams and Ayers 1983) Trichoderma spp. (Adams 1989; Huang and Kozub 1991a; Wu 1991) Trichoderma viride Pers. ex Fr. (Boland and Inglis 1988; Huang 1978; Zazzerini and Tosi 1985) (Phillips 1989; Phipps and Porter 1993; Zazzerini and Tosi 1985) Trichoderma harzianum Rifai 1.3.3.1.1.4 Resistant Cultivars Screening for resistance in sunflower is perhaps one of the most effective measures of disease control, provided that it is durable, since it is environmentally and economically sound. Conventional breeding requires the identification of sunflower genotypes with some form of resistance and then selecting for, and attempting to breed this resistance into elite cultivars. Appropriate techniques must be used to ensure that selection is for resistant _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 16 Chapter 1: General Introduction _________________________________________________________________________ phenotypes. Much research has been conducted to find resistant cultivars and to create effective resistance assays (Castano et al. 1993). The various methods employed by researchers may yield differing evaluations of the resistance of cultivars (Sedun and Brown 1989; Skoric and Rajcan 1992). This raises the possibility that each inoculation/screening method may be detecting different resistance/defence mechanisms (Vear and Tourvieille 1984). Variation in susceptibility amongst sunflower genotypes to Sclerotinia wilt has been noticed for some time (Putt 1958). Resistance has since been observed (Sedun and Brown 1989), although these resistant cultivars are not commercially available (Huang and Dedio 1982; Skoric and Rajcan 1992) as they also possess agronomically undesirable traits such as decreased yields (Gulya 1985). For information on resistant sunflower cultivars see Gulya (1985), Gulya et al. (1989), Huang and Dedio (1982), Huang and Dorrell (1978), Sedun and Brown (1989), Pereyra et al. (1992), Masirevic and Gulya (1992). The use of interspecific hybridization and molecular techniques has opened up the field for incorporating any of the 49 wild Helianthus species into commercial sunflower. Skoric and Rajcan (1992) reported high levels of resistance in H. maximilianai Schrader, and high levels of tolerance in inbred lines (Skoric and Rajcan 1992). 1.3.3.1.2 New Methods of Control 1.3.3.1.2.1 Oxalic Acid Degradation Toxic metabolite production has shown potential for resistance screening as well as for elucidating pathogenesis in host pathogen systems (Huang and Dorrell 1978). The discovery of oxalic acid production by S. sclerotiorum provided an opportunity to use this toxin in host screening trials without the need for inoculation with the fungus (Callahan and Rowe 1991; Marciano et al. 1983; Maxwell and Lumsden 1970; Noyes and Hancock 1981). Godoy (1990) showed with mutants of S. sclerotiorum incapable of producing oxalic acid that this chemical is a major component of pathogenesis. Correlation between _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 17 Chapter 1: General Introduction _________________________________________________________________________ virulence and levels of oxalic acid production or enzymes degrading oxalic acid such as oxalate oxidase and oxalate carboxylase has not always been found (Lumsden 1979; Magro et al. 1988), however other researchers have found an association (Godoy et al. 1990; Noyes and Hancock 1981). Oxalic acid has therefore become a target in the belief that engineering the capacity to degrade oxalic acid into plants will enhance resistance to S. sclerotiorum. One such approach of biological control has been to introduce bacteria that degrade oxalic acid produced by S. sclerotiorum, thus reducing infection (Dickman and Chet 1998). 1.3.3.1.2.2 Pathogenesis Related Proteins (PRPs) and Anti Fungal Proteins (AFPs) The characterization of host cell wall degrading enzymes in fungi e.g. endopolygalacturonases has lead to an understanding that inhibitors of these proteins could be incorporated using genetic engineering into hosts for resistance. Research is currently concentrating on characterization of polygalacturonase inhibiting proteins (Favaron et al. 1997) for future use to protect the plant against these enzymes by either totally inhibiting reactions or merely slowing the process whilst defense mechanisms are activated by the host. Other pathogenesis related proteins that might be active against Sclerotinia include the chitinase and  1,3- glucanase enzymes (Dann et al. 1996). Anti fungal proteins less than 100 amino acids are referred to as peptides and generally are about 50 amino acids long (Rao 1995). Many peptides that inhibit fungal growth in-vitro have been discovered and thus are candidates for future incorporation into hosts. Anti fungal proteins with activity against S. sclerotiorum have been isolated from radish seeds (Terras et al. 1992). Antimicrobial peptides have also been isolated from native Australian plants with some activity against S. sclerotiorum (Harrison et al. 1997; Marcus et al. 1997). A peptide with strong antifungal activity against S. sclerotiorum was isolated from sunflower leaves infected with S. sclerotiorum (Regente et al. 1997). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 18 Chapter 1: General Introduction _________________________________________________________________________ 1.4 POPULATION GENETICS It is essential to have an understanding of the biology of a pathogen in order to predict how it is likely to evolve in the future, especially in response to different control measures. The role of population genetics is to elucidate some of the forces that are affecting evolution of a particular pathogen. One of the first issues to be addressed is the amount and distribution of genetic diversity within and between pathogen populations. The definition of what constitutes a population is based on these factors and the effect of other forces such as gene flow (migration), genetic drift (founder effect or bottleneck) and selection. These forces are estimated by examining the changes in allele frequencies over space and time. Population genetics in plant pathology requires the usage of informative markers which, traditionally have involved the use of phenotypic markers such as fungicide resistance and virulence (Brown and Simpson 1994; Brown and Wolfe 1990; Burdon and Roberts 1995; Burdon and Roelfs 1985b). In the case of virulence, direct interpretation of population structure is possible with relevance to host pathogen systems if a set of differential cultivars exist. However virulence genes represent only a small part of the genome and are under strong selection pressures. Isozymes were one of the first molecular markers to be used in population genetics as they detect variation in the protein amino acid sequence (Burdon and Roberts 1995; Burdon and Roelfs 1985b; McDermott et al. 1989). However, they are tissue and developmentally specific in addition to only producing a restricted number of markers. Another phenotypic marker that has been used with fungi is Vegetative Compatibility Groups (VCGs) (Liu et al. 1996; Tantaoui et al. 1996). Vegetative compatibility occurs when there is successful hyphal fusion (i.e. not followed by hyphal lysis) (Julian et al. 1996). Heterokaryons may result from vegetatively compatible isolates, however this is distinct from sexual heterokaryons which are usually governed by different loci (Leslie 1993). Genotypes in S. sclerotiorum are readily identified using Mycelial Compatibility Groups (MCGs) and fingerprinting RFLPs (Kohli et al. 1992). Mycelial compatibility groups are a phenotypic trait and are thought to be a component of vegetative compatibility groups (Kohn et al. 1990). Ford et al. (1995) created vegetative heterokaryons of _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 19 Chapter 1: General Introduction _________________________________________________________________________ S. sclerotiorum but were unable to find any correlation between MCGs and VCGs. The use of phenotypic traits such as VCGs in population genetics is limited to calculating phenotypic diversity (Milgroom et al. 1992). The development of techniques such as Southern hybridization and the Polymerase Chain Reaction (PCR) has enabled the extensive use of molecular markers such as single and multicopy RFLPs (Chapter 2) and Random Amplified Polymorphic DNAs (RAPDs) (Welsh and McClelland 1990; Williams et al. 1990). These markers have the potential to screen the whole genome, are unaffected by the environment and are not tissue or development specific. A preliminary study using RAPDs found polymorphisms in S. sclerotiorum giving similar genotypic identification to MCGs (Ekins et al. 1994a). RAPDs thus provide a quick method of determining if intraspecific genetic variation is present before embarking on extensive RFLP population genetic studies. RAPD technology is quicker and cheaper than the use of RFLPs and can be conducted with no prior information of the DNA of interest and with small amounts of DNA (Foster et al. 1993; Welsh and McClelland 1990; Williams et al. 1990). RAPDs have been used extensively for detecting genotypic diversity within a species e.g. (Barasubiye et al. 1995; Ekins et al. 1994b; Goodwin and Annis 1991; McDermott et al. 1994; Meijer et al. 1994; Raina et al. 1997). Peever and Milgroom (1994), and Lynch and Mulligan (1994) have derived estimates based on RAPD data of population genetic parameters for genotype frequencies, gene frequencies, population subdivision, genetic distance and gametic disequilibrium (non random association between alleles of different loci). Single copy RFLP probes detect alleles at a locus and are a powerful method to determine population genetic parameters e.g. (Carlier et al. 1996; Keller et al. 1997a; McDonald and Martinez 1990). Multicopy probes generally screen many loci throughout the genome simultaneously, producing fingerprints which enable separation of individual genotypes for use in population studies (Kohli et al. 1992; McDonald and Martinez 1991; Milgroom et al. 1992). Genotypes identified using a single multicopy „fingerprint‟ RFLP in conjunction with MCGs have been used in S. sclerotiorum to predict the mode of reproduction of _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 20 Chapter 1: General Introduction _________________________________________________________________________ populations in Canada as clonal (Kohli et al. 1992). Fingerprinting probes have been regarded as being useful only for genotypic identification and not for genetic analysis (Lynch 1988; Lynch 1990; McDonald and Martinez 1991; McDonald and McDermott 1993). Due to the nature of multicopy probes any estimate of gametic disequilibrium, genetic drift, gene diversity or population subdivision should be treated with caution as they rely on the assumptions that comigrating bands are identical, and individual fragments are independent loci (Milgroom et al. 1992). Multicopy probes can give a measure of the number of genotypes, which enables calculation of genotypic diversity. The genotypes can then be used for direct measures of gene flow and population subdivision. However, fingerprinting probes have been used to estimate gametic disequilibrium in S. sclerotiorum (Kohli and Kohn 1998). Direct correlation between genotypes and phenotypes should not be assumed (McDonald 1997). Genotypes do not always correspond with VCGs (Appel and Gordon 1996; Pipe et al. 1995). However, because of the „considerable‟ genetic variation found within VCGs of Cryphonectria parsitica (Murrill) Barr (Liu et al. 1996) it is unlikely that VCGs represent clones (Milgroom 1995). Evolution of different pathotypes within clonal lineages has also been reported (Drenth et al. 1996; Goodwin et al. 1995; Levy et al. 1991). Milgroom (1995) also notes that recombination may create new VCGs. Changes in genetic diversities are affected by mutation and sexual and asexual reproductive strategies of the pathogen. Recombination is one mechanism occurring in sexual organisms during meiosis where crossing over occurs between sections of homologous chromosomes. Recombination shuffles genes and combinations of alleles creating new genotypes and reducing linkage disequilibrium. Repeated sampling of common genotypes in populations of some fungi indicates that sexual recombination only provides a small component of overall reproduction (Leung et al. 1993; McDonald et al. 1989). Tibayrenc et al. (1991) defines a clonal population as having stable uniparental lineages not obscured by low levels of sex. The antithesis of clonality is the process of genetic exchange and recombination (Anderson and Kohn 1995). Fungi lacking a sexual stage can undergo recombination through parasexuality or somatic hybridization (Geiser et al. 1994; McDermott et al. 1989; McDonald and Martinez 1991; McDonald et al. 1989). The extent to which these mechanisms will affect the genetic diversity of fungi is unknown (Burdon 1993). Recombination is also a means of purging deleterious alleles (Lynch and Gabriel 1990) as _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 21 Chapter 1: General Introduction _________________________________________________________________________ opposed to „Mullers ratchet‟ in asexual populations which accumulates mutation thus driving them towards lower fitness (Muller 1964). Gene diversity is a function of allele frequencies, whilst genotypic diversity is affected by reproductive strategies (Milgroom et al. 1992). Genotypic diversity estimates the relative contribution of sexual and asexual reproductive strategies. If sexual reproduction is shown to be occurring in a population (indicated by the presence of sexual structures), the presence of recombination is most evidenced by the presence of recombinant genotypes. Direct measures that may indicate a clonal reproduction involve repeated recovery of the same genotypes spatially and temporarily (Kohn 1995). Indirect measures of random assortment include: gametic disequilibrium (Chen and McDonald 1996), multilocus association (Milgroom 1996), different phylogenies at different loci (Anderson and Kohn 1998; Taylor et al. 1999) and high genotypic and gene diversities (Milgroom 1996). Sampling strategies can greatly influence the results and conclusions of sexual/asexual contributions. Populations can appear to change from gametic disequilibrium to gametic equilibrium once repeated sampling is corrected for (McDonald et al. 1994). Gene diversity and genotypic diversity should be higher at centre of origins given the longer times for accumulation of mutations and recombinations. McDonald et al. (1995) in a worldwide study of Mycosphaerella graminicola (Fuckel) Schrot. found greater levels of gene diversity, genotypic diversity, and private alleles in Israel than in other locations around the world suggesting Israel is the centre of origin. Founder effects or bottlenecks should result in a loss of some alleles and fixation of other alleles from genetic drift and thus new populations should have fewer alleles than older established populations (McDonald 1997). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 22 Chapter 1: General Introduction _________________________________________________________________________ 1.4.1 Factors Affecting Genetic Variation in S. sclerotiorum 1.4.1.1 Breeding Type in Sclerotinia Species These ascomycete fungi have known sexual stages with carpogenic germination of sclerotia leading to production of apothecia. S. sclerotiorum is thought to be homothallic and inbreeding whilst S. trifoliorum is known to have both heterothallic and homothallic ascospores in the same ascus. Breeding type in S. minor is uncertain although Patterson (1984a) suggested some isolates were heterothallic. The breeding mechanism will influence the ability of the fungus to recombine new genetic combinations which may increase fitness. Inbreeding will limit the genetic pool from which new combinations can be made. However, if a fungus is homothallic this does not exclude the possibility of it being able to outbreed and crossings performed in the lab may not be a good example of what is happening in the wild. In addition, outbreeding can result from other methods such as somatic recombination. The presence of mycelial compatibility groups (MCGs) hint that such mechanisms may exist in these fungi. If the fungus, such as S. sclerotiorum, appears to be largely homothallic then the detection of recombinant genotypes in the laboratory is likely to be rare. In absence of direct recombinants other methods in population genetics such as determination of linkage equilibrium are required as indirect measures of recombination. In order to detect this, large samples sizes, hierarichally sampled and screened with neutral single copy probes are required. The breeding mechanism is one of the most important aspects of the biology that must be understood before inferences about how a population will behave can be made. It is the single largest factor dictating whether a fungus is clonal or panmictic. S. sclerotiorum and S. minor have both been regarded as homothallic because of the ability of single spore isolates to produce apothecia (Drayton and Groves 1943; Henson 1935; Keay 1939; Saito 1973). However, this may not be a reliable indicator of obligate homothallism as self fertility does not rule out the possibility that self sterility (heterothallism) may also exist. An example of this is S. trifoliorum which was regarded as homothallic by single ascospore apothecial production (Henson 1935; Keay 1939; Lane and Sproston 1955; _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 23 Chapter 1: General Introduction _________________________________________________________________________ Loveless 1951). However, in a more thorough analysis, Uhm and Fujii (1983a) demonstrated that the fungus had dimorphic ascospores and that self fertility correlated with large ascospores and self sterility correlated with small ascospores consistently in the same asci. The small self sterile ascospores could be fertilized by spermatia of the large ascospore cultures to produce apothecia (Uhm and Fujii 1983b). S. trifoliorum maintains an outbreeding mechanism in addition to the ability to self fertilize. This mechanism means the fungus has the ability to reproduce asexually (using the sclerotial stage) and to disseminate a genotype as rapidly as a clonal organism. However it still retains the ability to recombine genotypes and to generate new combinations as with a sexual organism. 1.4.1.2 Sexual Reproduction The haploid mycelium is the vegetative stage of Sclerotinia species. A sexual cross may occur with the fusion of two haploid mycelia or from the microconidia (spermatia) fertilizing the sclerotia (Uhm and Fujii 1983b). Microconidia can be formed from germinated ascospores or directly from phialides or mycelium (Ramsey 1925). Microconidia of S. trifoliorum were suggested to be non-functional and sclerotia to be self fertile with the dikaryotic phase developing directly from homokaryotic mycelium (Bjorling 1952). However Fujii and Uhm (1988) concluded that the microconidia in S. trifoliorum function as spermatia. Hyphal „nests‟ within the sclerotia of S. trifoliorum were regarded as ascogonia, as these „nests‟ appeared in both small and large spored cultures (Fujii and Uhm 1988). Nests of hyphae within carpogenically germinating sclerotia were observed but no trichogynes were observed in S. sclerotiorum indicating that apothecial initiation in S. sclerotiorum can occur without spermatization (Kosasih and Willetts 1975a). The sexual reproduction of Sclerotinia species from the initial contact to ascospore formation is illustrated in Figure 1.1. The haploid mycelium is representative of what may also be spermatial and ascogonial contact. After copulation, plasmogamy occurs and the dikaryotic cells develop the apothecial stipe and disk. The formation of apothecial stipe was regarded as indicative of fertility in S. trifoliorum (Fujii and Uhm 1988). Karyogamy, meiosis and one round of mitosis result in the formation of eight haploid ascospores in an ascus, with additional rounds of mitosis increasing the number of nuclei per ascospore (Wong and Willetts 1979). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 24 Chapter 1: General Introduction _________________________________________________________________________ Haploid Mycelium n Plasmogamy Terminal dikaryotic cell (n) n Conjugate mitosis Apical Cell (n) Karyogamy Diploid (2n) Zygote Meiosis I Haploid Binucleate Terminal Cell (n) Dikaryotic 8 Ascospores (n) Mitosis Meiosis II Haploid Tetranucleate Additional mitosis S. sclerotiorum (binucleate ) Additional mitosis S. minor S. trifoliorum (tetranucleate ) Figure 1.1 Sexual reproduction in Sclerotinia species. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 25 Chapter 1: General Introduction _________________________________________________________________________ 1.4.1.3 Virulence and Aggressiveness With the development of the gene for gene theory (Flor 1956) came the realization that a change in a single gene in the pathogen can result in total host losses. One example of this process is Magnaporthe grisea Barr. the causal agent of rice blast, occurs frequently despite continual introduction of new resistant rice cultivars (Levy et al. 1991). The wide host range of both S. sclerotiorum and S. minor has meant host specificity is unlikely within these fungi (Ekins 1993; Pratt and Rowe 1995). S. trifoliorum on the other hand, is the only Sclerotinia species considered to have a limited host range as indicated by its specific binomial (Keay 1939). Typification of races or pathotypes of Sclerotinia species has not been conclusively proven since any differential reactions observed within hosts of either S. sclerotiorum isolates or S. minor isolates have not been repeated. This is despite substantial work on pathogenicity and virulences of isolates within each species. Previous studies have shown that individual isolates are capable of infecting different hosts (Ekins 1993; Price and Colhoun 1975a). The variation in aggressiveness displayed by this fungus has not yet been correlated to any other phenotypic or genotypic trait. However, significant variation in aggressiveness within and between natural populations of Sclerotinia have been long recognized (Kreitlow 1951). This variability is most likely underscored by a large amount of genetic variation. Information on pathogen variation is essential to enable breeding for resistance to Sclerotinia to be carried out effectively, to ensure any incorporated resistance, whether it be bred traditionally (field selection) or artificially (recombinant gene technology) is durable. Often only one isolate of Sclerotinia is used for screening (Melouk et al. 1992; Pratt and Rowe 1991) but this one isolate may not be representative of the population and may give erroneous indications of field resistance as cautioned by Mancl and Shein (1982). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 26 Chapter 1: General Introduction _________________________________________________________________________ 1.5 THE OBJECTIVES OF THIS STUDY In order to design effective control strategies, population genetic approaches should be used to obtain an understanding of the genetics of these pathogens, as control strategies should be aimed at populations and not individuals. The overall aim of this research was therefore to evaluate the genetic diversity of these pathogens. This aim requires basic questions of biology to be answered as well as more complicated genetic questions using molecular techniques. 1. To create RFLP probes that separate the three species of Sclerotinia; S. sclerotiorum, S. minor and S. trifoliorum, and compare to other taxonomic criteria. 2. To determine the breeding type of S. sclerotiorum and S. minor, that is, are they homothallic, heterothallic or bipolar heterothallic? 3. To determine if Australian isolates of S. minor can produce fertile apothecia and whether the ascospores generated are capable of causing head rot of sunflower. 4. To determine if isolates of S. sclerotiorum have differing aggressive abilities on sunflower. 5. To determine the underlying genetic diversity and roles of recombination and clonality in the Australian population of S. sclerotiorum attacking sunflower using MCGs, RAPDs, and single and multicopy probes of RFLPs. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 27 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ Chapter 2: Identification of Sclerotinia Species 2.1 INTRODUCTION Despite consensus on the taxonomic delineations in the genus Sclerotinia, recognition of the individual species using too few taxonomic characters can still result in false identification. Recent advances in molecular diagnostic techniques have allowed better definition of many fungal species once the data has been compared to already defined taxonomic characters which, in fungi, usually involve the teleomorph (sexual stage). From a plant pathologists point of view, relevant taxonomic characters may simply involve host, symptoms and signs. For many practical applications this may be all that is required for disease identification and control. However, for population genetics, identification of isolates to species is critical as overlapping species will totally distort any predictions of evolutionary biology. The rapid and repeated appearance of new strains of rust fungi attacking „resistant‟ cereals is a clear demonstration of forces involved in population genetics. Despite the contraction of Sclerotinia from 250 species into three species, S. sclerotiorum, S. minor and S. trifoliorum (Kohn 1979b), there is still some confusion in classification (Kohn et al. 1988). However, other research has supported the designation of three species (Bjorling 1952; Buchwald and Neergaard 1976; Cruickshank 1983; Henson 1935; Kohn 1979a; Petersen et al. 1982; Pratt et al. 1988; Tariq et al. 1985; Willetts and Wong 1980; Wong and Willetts 1973; Wong and Willetts 1975a; Wong and Willetts 1979). In contrast, morphological characters which have been used to define species have been interpreted by some workers as too continuous to separate species and thus have been used as evidence of the existence of only a single species (Morrall et al. 1972; Price and Colhoun 1975b; Purdy 1955). Sclerotial dimensions are easily identifiable criteria for separating Sclerotinia species. Small sclerotia easily enabled separation of S. minor from the larger S. sclerotiorum and S. trifoliorum (Jagger 1920; Kohn 1979a; Letham et al. 1978; Petersen et al. 1982; Tariq et al. 1985; Willets and Wong 1971; Wong 1979). Sclerotial shape and arrangement in culture _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 28 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ was additionally used to separate S. sclerotiorum from S. trifoliorum (Petersen et al. 1982). However, Purdy (1955) found that although sclerotial diameters were continuous between species they still gave the strongest evidence for separation of the species amongst the continuous characteristics examined. The perfect stage of many fungi represents a character that is often difficult to obtain and thus not readily available for most identification purposes. Within Sclerotinia, the presence of both large and small ascospores within an ascus (dimorphism) is a morphological character that has enabled the separation of S. trifoliorum from S. sclerotiorum and S. minor (Kohn 1979a; Uhm and Fujii 1983a). The number of nuclei within ascospores has also been found useful for separating S. minor and S. trifoliorum from S. sclerotiorum (Kohn 1979a; Wong and Willetts 1979). Ascospore length/width ratios have also been used for separating S. sclerotiorum from S. trifoliorum (Kohn 1979a). Cytological examination of apothecial structure, more specifically the ectal excipulum, was a character used by Kohn (1979a) to delimit the species but was considered as unreliable by Jayachandran et al. (1987). Host specificity is a character used primarily to describe the restricted host range of S. trifoliorum (Held and Haenseler 1953; Keay 1939). However, this host range has since been found to overlap with the wide host range of S. sclerotiorum and S. minor (Cappellini 1960; Jellis et al. 1990; Pratt et al. 1988; Pratt and Rowe 1995). Molecular markers have recently become useful as taxonomic criteria for Sclerotinia species especially in the absence of other characters. Molecular markers which have been used for separating species of Sclerotinia include: proteins (Cruickshank 1983; Petersen et al. 1982; Tariq et al. 1985; Wong and Willetts 1975a), Random Amplified Polymorphic DNAs (RAPDs) (Ekins et al. 1994b) and Restriction Fragment Length Polymorphisms (RFLPs) (Kohn et al. 1988). An RFLP probe (pMF2) containing a Pst-1 fragment from rDNA of Neurospora crassa has previously been used for separation of S. sclerotiorum, S. minor and S. trifoliorum (Kohn et al. 1988). The aim of this project was to create RFLP probes suitable for identification of individual species of Sclerotinia. A second aim was to predict the usefulness of morphological characters such as host and sclerotial dimensions in the field, in comparison with molecular _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 29 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ markers. Isolates of S. sclerotiorum, S. minor and S. trifoliorum used in the present study were collected from around Australia. Putative identifications were as made by the collectors. Host species were also recorded. Sclerotial diameters were measured in culture. Asci obtained from carpogenically germinated isolates were examined for ascospore dimorphism. All isolates were screened using RFLP probes created for identification of Sclerotinia species and compared to previously created RFLP probes (Kohn et al. 1988). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 30 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ 2.2 MATERIALS AND METHODS 2.2.1 Fungal Isolates Isolates of S. sclerotiorum, S. trifoliorum and S. minor collected from various locations and hosts around Australia, are listed in Table 2.1. The species names listed in Table 2.1 are those provided by the collectors. Sclerotia were removed from plant tissue or culture, immersed in a mixture of 4% sodium hypochlorite and 70% ethanol for 2 minutes before being rinsed in sterile distilled water and blotted dry on sterile filter paper and then plated onto V8 agar plates (10% V8 Vegetable Juice, Campbell‟s Soups Australia, 1.5 % Agar) and grown in the dark at room temperature. Advancing mycelia were subcultured after 2-3 days and subsequently hyphal tipped and transferred to fresh V8 agar media. Sclerotial diameters were then measured for the isolates after two weeks growth on V8 agar media. Table 2.1 List of isolates, putative species, host, location and collector of Sclerotinia species used in this study. Isolate UQ 403 UQ 1106 UQ 1109 UQ 1111 UQ 1112 UQ 2567 UQ 2568 UQ 583 UQ 808 UQ 1113 UQ 1114 UQ 2103 UQ 3316 UQ 3317 UQ 3318 UQ 3319 UQ 3320 UQ 3321 UQ 3322 UQ 3323 UQ 3324 UQ 3325 UQ 3326 UQ 1113 UQ 1261-1 UQ 1264-1 Putative Species S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. trifoliorum S. trifoliorum S. sclerotiorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. sclerotiorum S. sclerotiorum S. sclerotiorum Host Xanthium spinosum L. Arachis hypogaea L. A. hypogaea A. hypogaea A. hypogaea Helianthus annuus L. H. annuus Trifolium repens L. T. subterraneum L. Matthiola incana L. T. ambiguum L. Trifolium sp. Trifolium sp. Trifolium sp. Trifolium sp. Trifolium sp. Trifolium sp. Trifolium sp. Trifolium sp. Trifolium sp. Trifolium sp. Trifolium sp. Trifolium sp. Matthiola incana H. annuus H. annuus Location Katunga VIC Kingaroy QLD Kingaroy QLD Kingaroy QLD Kingaroy QLD Blackville NSW Blackville NSW Tasmania Manjimup WA Tinderbox TAS Tasmania Mundulla SA Tasmania Tasmania Tasmania Tasmania Tasmania Tasmania Tasmania Tasmania Tasmania Tasmania Tasmania Tasmania Gatton QLD Gatton QLD Collector R. Clarke M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins ? M. Barbetti R. Cruickshank J. Yates M. Ramsey J. Wong J. Wong J. Wong J. Wong J. Wong J. Wong J. Wong J. Wong J. Wong J. Wong J. Wong R. Cruickshank M. Ekins M. Ekins _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 31 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ Table 2.1 Continued Isolate UQ 1278-1 UQ 1278-2 UQ 1284-3 UQ 1278-3 UQ 1290-1 UQ 1293-2 UQ 2460 UQ 2462 UQ 2466 UQ 2478 UQ 2481 UQ 2526 UQ 2532 UQ 2537 UQ 2543 UQ 2546 UQ 2547 UQ 2605 UQ 2611 UQ 2658 UQ 2661 UQ 2670 UQ 2686 UQ 2696 UQ 2812-1 UQ 2815-2 UQ 2815-3 UQ 2816-1 UQ 2816-2 UQ 2816-3 UQ 2816-4 UQ 2817-1 UQ 2817-2 UQ 2817-3 UQ 2817-4 UQ 2818-1 UQ 2818-2 UQ 2818-3 UQ 2818-4 UQ 3193 Putative Species S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sp. Host H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus H. annuus T. repens Location Wyreema QLD Wyreema QLD Wyreema QLD Wyreema QLD Wyreema Wyreema Clifton QLD Clifton QLD Clifton QLD Allora QLD Allora QLD Evernslea QLD Evernslea QLD Yallori NSW Yallori NSW Yallori NSW Yallori NSW Moree NSW Moree NSW Moree NSW Moree NSW Moree NSW Clifton QLD Clifton QLD Wyreema QLD Wyreema QLD Wyreema QLD Wyreema QLD Wyreema QLD Wyreema QLD Wyreema QLD Wyreema QLD Wyreema QLD Wyreema QLD Wyreema QLD Wyreema QLD Wyreema QLD Wyreema QLD Wyreema QLD Forbes NSW Collector M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins M. Ekins A. Nikandrow 2.2.2 Carpogenic Germination Apothecia were raised from a subset of isolates identified as belonging to either S. sclerotiorum, S. minor and S. trifoliorum, using the method outlined by Hawthorne (1973; 1976). Isolates were grown for 4 weeks on wholemeal agar (50 g wholemeal flour, 20 g agar, 1 litre distilled water) at 20 oC. Sclerotia were scraped off the agar and air dried _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 32 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ for 2-3 days. The dried sclerotia were transferred to deep Petri dishes (96 mm X 25 mm) with 10 ml of sterile water and incubated for 6-8 weeks in the dark at 15 0C for 8 hrs and 10 0C for 16 hrs. When stipes formed, usually within 4-8 weeks, the Petri dishes were transferred to another incubator and illuminated for 8 hrs/day at 150C -180C for 14-21 days under daylight fluorescent tubes until apothecial discs were formed. 2.2.3 DNA Extraction For DNA extraction the isolates were grown for 2 days on CYM (complete yeast medium) containing 0.46 g KH2PO4, 1.0 g K2HPO4.3H2O, 0.5 g MgSO4.7H2O, 20.0 g D-glucose, 2.0 g Yeast Extract (Difco) and 2.0 g Bacto-peptone (Difco) per litre. The mycelium was harvested and freeze-dried. DNA was extracted using the method of Zolan and Pukkila (1986) with the following modifications. The initial incubation with the extraction buffer was carried out at room temperature for 30 minutes with 15-20 mg of mycelium coarsely broken with a spatula. -mercaptoethanol was not included in the extraction buffer. After the addition of chloroform-isoamyl alcohol (24:1) the samples were vortexed for 30 seconds. Only one DNA precipitation was carried out with ammonium acetate and absolute ethanol. The pellet was finally rinsed in 70 % ethanol, before vacuum drying and resuspension in 50 l TE buffer with 2 l RNAse (10mg/ml) (Sigma Aldrich Pty., Ltd, Australia). 2.2.4 Creation of Single Copy Probes Partial digestions were carried out by digesting DNA from S. sclerotiorum UQ 2554 at varying enzyme/DNA ratios ranging from 1/256th to 1 unit of Sau3AI (New England Biolabs, Genesearch Pty. Ltd, Queensland, Australia) per g DNA. These digested DNAs were electrophoresed on a 0.3% agarose gel at 25 Volts for 24 hours at 4 oC. From these results a ratio of 1/8th of a unit Sau3AI per g fungal DNA was selected for subsequent digests. Digests to generate species specific probes consisted of 50 l DNA of S. sclerotiorum isolate UQ 2573 ( at 250 ng/l), 30 l 10X buffer, 30 l 10X BSA, 190 l of 10 mM TrisCl and 0.195 l Sau3AI (1/8th of a unit) at 37 oC for 1 hour and then a 20 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 33 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ minute stop reaction at 65 oC. The digested DNA was electrophoresed as described above and fragments between 3 kb and 0.5 kb were excised from the gel and extracted using the QIAquick Gel Extraction Kit (Qiagen Pty. Ltd. Victoria, Australia) according to manufacturers directions. Cloning of the DNA was carried out using a BamHI predigested and CIAP (Calf Intestinal Alkaline Alkaline Phosphatase) treated Lambda Zap express vector (Stratagene, Integrated Sciences, New South Wales, Australia). Pilot test ligations were carried out varying the ratio of insert/vector from 5:1 to 0.2:1. Ligation of DNA was carried out with the following reaction: 1 l Zap express vector (1 g/l), 1 l DNA (100ng/l), 0.5 l 10X ligase buffer, 2 l H20 and 0.5 l T4 ligase. All 5 l of the ligation reaction was subsequently added to MaxPlax lambda packaging extract (Epicentre Technologies, Astral Scientific, New South Wales, Australia) and incubated at room temperature for two hours. The packaged lambda vector was then diluted from 10-1 to 10-6. A dilution of 10-1 was found to give a titer of 1.46 x 105 pfu/ml giving a recombination efficiency of 90% to 98%. The packaged library was mixed with XL1-Blue MRF strain of E. coli and incubated for 15 minutes at 37oC and then plated onto large (15 cm) NZY (5 g NaCl, 2 g MgSO4.7H2O, 5 g yeast extract, 10 g caesin hydrolysate, 15 g agar in 1 litre distilled water, pH 7.5) plates. Some of the plaques were transferred to nylon membranes in an attempt to differentiate plaques containing high and low copy DNA inserts. The large NZY plates (15 cm) containing the plaques were overlaid with nylon membranes (Hybond-N+, Amersham Australia Pty. Ltd, Australia) for 2 minutes. The lifted membranes were denatured in 1.5M NaCl and 0.5M NaOH for 2 minutes, followed by neutralization in 1.5M NaCl and 0.5M Tris-HCl (pH 8.0) for 5 minutes. This was then rinsed for thirty seconds in 0.2M Tris-HCl (pH 7.5) and 2 X SSC, then blotted and UV crosslinked. The nylon disks were hybridized with 25 ng of genomic DNA using the same hybridization protocol outlined in RFLP analysis Section 2.2.5. The remainder of the plaques not transferred to membranes were used for amplification of the lambda library. The large NZY plates were overlaid with 10 ml of SM buffer and gently rocked overnight, allowing the phage to diffuse out of the agarose. The recovered _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 34 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ bacteriophage suspension was centrifuged for 10 minutes at 500 rpm with 5% chloroform and the resulting supernatant was stored at -70oC with 7% DMSO (dimethylsulfoxide). For mass excision of the plasmids, the library was added to XL1-Blue MRF strain of E. coli at a ratio of 1:10 lambda phage to bacterial cells, i.e. 10 ml of 1.46 x 10 5 pfu/ml to 100 l bacterial cells giving 8 x 107 cells. To this 1.48 l of Exassist helper phage (Stratagene, Integrated Sciences, New South Wales, Australia) was added to give a 1:1 Phage to cell ratio. This was then incubated for 15 minutes at 37 oC before addition of NZY broth and a 3 hour incubation at 37 oC, followed by twenty minutes at 65 oC. The solution was centrifuged for 10 minutes at 1000 rpm and 1 l of the decanted supernatant was added to 200 l of XLOLR strain of E. coli cells. This was then incubated at 37 oC for 15 minutes, to which 40 l of 5 X NZY was added and incubated at 37 oC for a further 45 minutes and then plated onto LB kanamycin agar plates (50 g/ml) with IPTG (isopropylthio--Dgalactoside) and Xgal (5-bromo-4-chloro-3-indolyl--D-galactoside). White recombinant colonies were picked off and used for plasmid minipreps. Blue non-recombinant colonies made up only 46% of the total number of colonies. The single colonies were added to 2 ml of LB broth with kanamycin and incubated overnight at 37 oC. Cells were pelleted and dried before plasmid DNA extraction was carried out by the alkaline lysis method as outlined in Sambrook (1989). All plasmids created were given the prefix pME (Merrick Ekins) followed by a number. Plasmid DNA was screened for internal priming sites and was amplified using the polymerase chain reaction (PCR). Amplification of the probe was carried out with 25 l reaction mixtures consisting of: 7.7 l distilled H20, 1.5 l of MgCl2 (25 mM), 4l dNTPs (200 m) (Biotech International Ltd., WA, Australia), 2.5 l of 10 X Buffer (Biotech International Ltd., WA, Australia), 4 l of T3 universal primer (AATTAACCCTCACTAAAGGG), 4 l of T7 universal primer (CGGGATATCACTCAGCATAATG), 1 l of the plasmid DNA (12 ng/l), and 0.3 l Tth DNA polymerase (0.32 units/l) (Biotech International Ltd., WA, Australia). For the PCR a MJ Research PTC-100 Thermal Cycler was used with an initial denaturation stage of 4 minutes at 94o C, before 35 cycles of 30 seconds at 94 oC, 30 seconds at 50 oC, and 2 minutes at 72 oC, with a final 7 minute extension step at 72 oC. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 35 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ An RFLP probe (pMF2) containing a Pst-1 fragment from rDNA of Neurospora crassa, previously cloned into pBR322 was obtained from Robert Metzenberg (Free et al. 1979). 2.2.5 RFLP Analysis Total fungal DNA was restriction digested with BamHI or EcoRI at 37oC for 3 hours. A typical digest consisted of 5 g DNA, 0.5 l of BamHI restriction endonuclease (New England Biolabs, USA) and 2.5 l 10x Reaction Buffer. Loading dye (4 l, 0.25% bromophenol blue, 0.25% xylene cyanol FF and 15% Ficoll)(Sambrook et al. 1989) was added to each tube and the DNA was separated on a 0.8% agarose gel at 45 Volts for 24 hours. The gels were soaked in 0.25N HCl for 15 minutes followed by a rinse in dH2O, and a 30 minute soak in 0.5M Tris (pH7.5) + 1.5m NaCl. The gel was soaked in 10x SSC for 15 minutes before being overlayed with nylon membrane (Hybond-N+, Amersham Australia Pty. Ltd, Australia) and two pieces chromatography paper soaked in 10x SSC. Paper towels were placed on the chromatography paper providing capillary action to draw the DNA up onto the nylon membrane. The membrane was removed after 2-12 hours and dipped in 0.4N NaOH before soaking in 0.2M Tris (pH7.5) + 2x SSC. The blot was UV crosslinked for 30 sec at 1 200 MJ and dried at 65 oC for two hours. Prehybridizations were carried out at 65 oC for 2-6 hours. Blots were wet with 5x SSPE and loaded into the hybridization tubes with 10 ml of Kerk‟s Buffer (0.36M Na2HPO4, 0.14M NaH2PO4.2H2O, 1mM EDTA and 7% SDS) and 100l of sheared salmon sperm (5 mg/ml) (Sigma Aldrich Pty. Ltd, Australia). Probes were labelled using a Megaprime labelling kit and hybridizations were carried out according to manufacturers directions (Amersham Australia Pty., Ltd, Australia). A typical reaction consisting of 27l dH2O, 5 l Primer and 1 l of plasmid DNA was boiled for 5 minutes to denature the DNA. To the reaction was added 10l of buffer, 5 l of  labelled 32 P-dCTP (10 Ci/l) (Amrad Pharmacia) and 2 l of DNA polymerase 1 Klenow fragment (cloned) (1 unit/l). This was incubated at 37 oC for 10 minutes followed by 5 minutes at 100 oC. The randomly labelled probe was added to the blot and hybridized for 12 hours at 65 oC. The blots were washed twice in 5 X SSPE, twice in 1 X SSPE + 0.1% SDS and once in 0.1 X SSPE + 0.1% SDS at _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 36 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ 20 minute intervals at 65 oC. Blots were placed in cassettes with X-ray film and exposed at -70 oC for 4- 24 hours before being developed. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 37 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ 2.3 RESULTS 2.3.1 Sclerotial Diameters Sclerotial diameters were consistent with small size (1-2 mm) correlating with isolates identified as S. minor and large sclerotia (3-10 mm) corresponding to those identified as S. sclerotiorum and S. trifoliorum (Table 2.2). One exception was UQ 2103 (identified as S. trifoliorum based on host) which had small sclerotia. 2.3.2 Dimorphic Ascospores The production of ascospores allowed separation of S. trifoliorum from S. sclerotiorum and S. minor using the criteria identified by Kohn (1979a) and Uhm (1983a). Dimorphic ascospores that are characteristic of S. trifoliorum were produced regularly (Table 2.2). This contrasts with monomorphic ascospores of S. sclerotiorum and S. minor. Not all isolates were used for induction of apothecia thus an absence of a result in Table 2.2 does not indicate a failure to form apothecia or absence of self fertility. Consistent observation of dimorphic ascospores were found in five isolates (UQ 583, UQ 3193, UQ 3316, UQ 3323 and UQ 3326) which had been identified as S. trifoliorum from host and sclerotial sizes. Rare examples of dimorphism were found in four isolates (UQ 808, UQ 1112, UQ 2103 and UQ 2568). Isolates UQ 808 and UQ 2103 were initially designated as S. trifoliorum on the basis of host but were reclassified as S. sclerotiorum and S. minor respectively during the course of this study. Low frequency of dimorphism among only some asci is not a characteristic of S. trifoliorum and is examined in more detail in Chapter 3. Isolates originally described as S. trifoliorum (UQ 808 and UQ 2103) produced 4.9% and 3.5% of the asci displaying dimorphic ascospores respectively. Other isolates putatively identified as S. minor also displayed a low frequency of ascospore dimorphism; UQ 1112 and UQ 2568 had 2% and less than 1% of asci displaying dimorphic ascospores respectively. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 38 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ Table 2.2 Comparison of characters for species characterisation of isolates. Isolate Putative Species Host UQ 403 UQ 1106 UQ 1109 UQ 1111 UQ 1112 UQ 2567 UQ 2568 UQ 583 UQ 808 UQ 1114 UQ 2103 UQ 3193 UQ 3316 UQ 3317 UQ 3318 UQ 3319 UQ 3321 UQ 3322 UQ 3323 UQ 3324 UQ 3325 UQ 3326 UQ 1113 UQ 1261-1 UQ 1290-1 UQ 1293-2 UQ 2460 S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum Xanthium spinosum Arachis hypogaea A. hypogaea A. hypogaea A. hypogaea H. annuus H. annuus Trifolium repens T. subterraneum T. ambiguum Trifolium sp. T. repens Trifolium sp. Trifolium sp. Trifolium sp. Trifolium sp. Trifolium sp. Trifolium sp. Trifolium sp. Trifolium sp. Trifolium sp. Trifolium sp. Matthiola incana H. annuus H. annuus H. annuus H. annuus Sclerotial Dimorphic pME Diametera asci b Phenotypec S S S S S S S L L L S L L L L L L L L L L L L L L L L N -e N 2% N 1% Y 4.9% 3.5% Y Y Y Y N N - S. minor S. minor S. minor S. minor S. minor -f S. trifoliorum S. sclerotiorum S. trifoliorum S. minor S. trifoliorum S. trifoliorum S. trifoliorum S. sclerotiorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum pMF2 EcoR1 Phenotyped pMF2 BamH1 Phenotyped S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. trifoliorum NFIg S. trifoliorum S. minor S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. sclerotiorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum NFI NFI NFI S. sclerotiorum S. minor or S. trifoliorum S. minor or S. trifoliorum S. minor or S. trifoliorum S. minor or S. trifoliorum S. minor or S. trifoliorum S. minor or S. trifoliorum S. minor or S. trifoliorum S. minor or S. trifoliorum S. sclerotiorum S. minor or S. trifoliorum S. minor or S. trifoliorum S. minor or S. trifoliorum S. minor or S. trifoliorum S. minor or S. trifoliorum S. minor or S. trifoliorum S. sclerotiorum S. minor or S. trifoliorum S. minor or S. trifoliorum S. minor or S. trifoliorum S. minor or S. trifoliorum S. minor or S. trifoliorum S. minor or S. trifoliorum NFI S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum a Sclerotia were either small (S) 1-2 mm or large (L) 3-10 mm Ascospore dimorphism was either always present (Y) or always absent (N) or at a low percentage c Classification of the isolate based on pME RFLP probes d Classification of the isolate based on pMF2 RFLP probe e - indicates apothecia were not produced for that isolate f No Further Information available from this probe g – indicates isolate was not screened with these probes b 2.3.3 Restriction Fragment Length Polymorphisms DNA of the isolates was extracted and digested with BamHI and independently probed with pME032, pME082, pME106, pME147, pME163, pME230, pME241, pME283, pME285. The probes were selected for screening the isolates because in an initial screen of a range of isolates of Sclerotinia species they were found to be single copy probes producing easily separable fragments. DNA from the same isolates were also separately digested with BamHI and EcoRI and probed with pMF2. The sizes of the fragments from pME probes are shown in Table 2.3. Autoradiograms of representative isolates of each species probed with pME probes are shown in Figure 2.1 and probed with pMF2 in Figure 2.2. All three species were found to have unique patterns of fragments of the pME and pMF2 probes. Seven of nine probes tested could be used for separating Sclerotinia species. All three species, _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 39 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ S. sclerotiorum, S. minor and S. trifoliorum could be separated using a single probe chosen from either pME147, pME241, or pME285. Separation of S. sclerotiorum from S. minor and S. trifoliorum could be achieved using pME106, pME163 or pME283. S. trifoliorum can be separated from S. minor and S. sclerotiorum using probe pME230. Probes pME032 and pME082 were not useful for separating the species and as a consequence are not tabulated. 11 kb 8.5 kb A 22 kb 11 kb B 6 kb 10 kb 8 kb C 5 kb 3.5 kb 11 kb 8.5 kb D SS UQ 1290-1 SS UQ 1278-3 SS UQ 1278-2 SS UQ 1278-1 SS UQ 2460 SM UQ 2103 ST UQ 1114 ST UQ 583 SM UQ 403 SS UQ 808 TS-8 SS UQ 808 TS-7 SS UQ 808 TS-6 SS UQ 808 TS-5 SS UQ 808 TS-4 SS UQ 808 TS-3 SS UQ 808 TS-2 SS UQ 808 TS-1 SS UQ 808 SS UQ 2818-4 SS UQ 2818-3 SS UQ 2818-2 SS UQ 2818-1 SS UQ 2817-4 SS UQ 2817-3 SS UQ 2817-2 SS UQ 2817-1 SS UQ 2816-4 SS UQ 2816-3 SS UQ 2816-2 SS UQ 2816-1 2 kb Figure 2.1 Southern hybridizations of S. sclerotiorum (Ss), S. minor (Sm) and S. trifoliorum (St) DNAs, digested with BamHI, with probes: A pME241, B pME230, C pME147 and D pME163. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 40 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ S. minor and S. trifoliorum were both identified by a lack of any bands using probe pME106, whilst isolates of S. sclerotiorum had fragment sizes of either: 14, 16, 20 or 24 kb (Table 2.3). An isolate previously identified as S. trifoliorum (UQ 3319) had a 20 kb fragment identical to that displayed by other isolates of S. sclerotiorum. Isolates of and derived from UQ 808, initially identified as S. trifoliorum contained a 14 kb fragment identical with isolates of S. sclerotiorum. Using probe pME147, S. minor was typified by 3.5 kb fragments. An isolate identified as S. trifoliorum (UQ 2103) also had a 3.5 kb fragment, whilst the remaining S. trifoliorum were represented by 8 kb fragments, with the exception of UQ 3319 and UQ 808 which had a 10kb fragment. The 10 kb fragment and a 5 kb fragment were otherwise characteristic of S. sclerotiorum. S. minor and S. trifoliorum were inseparable using the probe pME163 as both species were identified by a 2 kb fragment. However, S. minor and S. trifoliorum could be easily distinguished from isolates of S. sclerotiorum which had either an 8.5 kb or 11 kb fragments. UQ 3319 and UQ 808 only had a single 8.5 kb fragment. S. trifoliorum was separated from isolates of S. sclerotiorum and S. minor by the presence of a 6 kb fragment using probe pME230. S. minor had only an 11 kb fragment whilst S. sclerotiorum had either 11 or 22 kb fragments. UQ 3319, UQ 2130 and UQ 808 all contained 11 or 22 kb fragments identified as either S. sclerotiorum or S. minor. The absence of any bands using probe pME241 indicated isolates of S. minor, whilst an 8.4, 8.5 or 11 kb fragment indicated the isolate belonged to either S. sclerotiorum or S. trifoliorum. Isolate UQ 2103 also had no bands present for this probe. Probe pME283 produced no bands for isolates of S. trifoliorum and some S. minor isolates (UQ 1106, UQ 1112). The remaining S. minor isolates had a 24 kb fragment. Isolates of S. sclerotiorum were identified by either 7 or 12 kb fragments. UQ 3319 and all UQ 808 isolates had the 12 kb fragment of S. sclerotiorum. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 41 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ S. minor was identified using probe pME285 by either the absence of a band or a 1 kb fragment. S. trifoliorum was typified by a 3.5 or 5.5 kb fragment, whilst S. sclerotiorum has either 0.05 or 0.075 kb fragments. UQ 808 and UQ 3319 had bands identical to S. sclerotiorum isolates, whilst UQ 2103 had the 1 kb fragment identical to isolates of S. minor. The phenotypic designation of the isolates based on the pME probes are shown in Table 2.2. Table 2.3 Sizes in kilobases of DNA fragments from pME probes. Isolate UQ 403 UQ 1106 UQ 1109 UQ 1111 UQ 1112 UQ 2103 UQ 583 UQ 1114 UQ 3316 UQ 3317 UQ 3318 UQ 3319 UQ 3320 UQ 3321 UQ 3322 UQ 3323 UQ 3324 UQ 3325 UQ 3326 UQ 808 UQ 808 TS-1b UQ 808 TS-2 UQ 808 TS-3 UQ 808 TS-4 UQ 808 TS-5 UQ 808 TS-6 UQ 808 TS-7 UQ 808 TS-8 UQ 1113 UQ 1261-1 UQ 1264-1 UQ 1278-1 UQ 1278-2 UQ 1278-3 UQ 1284-3 UQ 1283-1 UQ 1290-1 UQ 1293-2 UQ 2460 UQ 2462 UQ 2466 UQ 2478 UQ 2478 UQ 2481 UQ 2526 UQ 2532 UQ 2537 UQ 2543 UQ 2546 UQ 2547 Putative Species S. minor S. minor S. minor S. minor S. minor S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum pME106 -a 20 14 14 14 14 14 14 14 14 14 20 20 14 14 14 14 14 24 24 20 24 16 24 24 24 24 14 20 14 24 24 24 pME147 3.5 3.5 3.5 3.5 3.5 3.5 8 8 8 8 8 10 8 8 8 8 8 8 8 10 10 10 10 10 10 10 10 10 10 5 10 10 10 10 10 10 5 5 10 10 10 10 10 5 10 5 10 10 5 10 pME163 2 2 2 2 2 2 2 2 2 2 2 8.5 2 2 2 2 2 2 2 8.5 8.5 8.5 8.5 8.5 8.5 8.5 8.5 8.5 8.5 8.5 11 8.5 8.5 8.5 8.5 11 8.5 8.5 11 8.5 11 11 11 8.5 8.5 8.5 11 11 8.5 11 pME230 11 11 11 11 11 11 6 6 6 6 6 22 6 6 6 6 6 6 6 11 11 11 11 11 11 11 11 11 22 11 22 11 11 11 11 22 11 11 22 11 22 22 22 11 11 11 22 22 11 22 pME241 8.4 8.4 8.4 8.4 8.4 11 8.4 8.4 8.4 8.4 8.4 8.4 8.4 8.5 8.5 8.5 8.5 8.5 8.5 8.5 8.5 8.5 11 11 8.5 8.5 8.5 8.5 8.5 8.5 8.5 11 8.5 8.5 8.5 8.5 8.5 8.5 8.5 11 8.5 8.5 8.5 8.5 pME283 24 24 24 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 7 12 12 12 12 12 12 7 12 12 12 12 7 12 pME285 1 1 1 1 1 3.5 3.5 3.5 3.5 5.5 0.05 3.5 3.5 3.5 3.5 3.5 3.5 3.5 0.075 0.075 0.075 0.075 0.075 0.075 0.075 0.075 0.075 0.05 0.05 0.075 0.05 0.05 0.05 0.075 0.05 0.075 0.05 0.05 0.075 0.05 0.05 0.05 0.075 0.05 0.05 0.075 0.05 0.075 0.05 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 42 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ Table 2.3 Continued Isolate UQ 2605 UQ 2611 UQ 2658 UQ 2661 UQ 2670 UQ 2686 UQ 2696 UQ 2812-1 UQ 2815-2 UQ 2815-3 UQ 2816-1 UQ 2816-2 UQ 2816-3 UQ 2816-4 UQ 2817-1 UQ 2817-2 UQ 2817-3 UQ 2817-4 UQ 2818-1 UQ 2818-2 UQ 2818-3 UQ 2818-4 a b Putative Species S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum pME106 16 24 20 20 20 24 24 20 20 20 14 14 14 14 20 20 20 20 14 14 14 14 pME147 10 10 5 5 5 10 10 5 5 5 10 10 10 10 5 5 5 5 10 10 10 10 pME163 8.5 11 8.5 8.5 8.5 11 11 8.5 8.5 8.5 8.5 8.5 8.5 8.5 8.5 8.5 8.5 8.5 11 11 11 11 pME230 11 22 11 11 11 22 22 11 11 11 11 11 11 11 11 11 11 11 22 22 22 22 pME241 8.5 8.5 11 11 11 8.5 8.5 11 11 11 8.5 8.5 8.5 8.5 11 11 11 11 8.5 8.5 8.5 8.5 pME283 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 pME285 0.075 0.05 0.05 0.05 0.05 0.05 0.05 0.05 0.05 0.05 0.05 0.05 0.05 0.05 0.05 0.05 0.05 0.05 0.075 0.075 0.075 0.075 indicates no band was present TS indicates ascospores from the same tetrad RFLPs of EcoRI digested DNAs probed with pMF2 produced several different fragment sizes. Some of the combination of fragment sizes correspond directly to those observed by (Kohn et al. 1988) but there were additional new DNA fragments and in new combinations that did not allow classification of the isolate using this probe. There were three new combinations, the first contained two isolates UQ 1261-1 and UQ 1293-2 with fragment sizes 2.2, 3.9 and 4.3 kb. The second combination UQ 1290-1 has fragments 2.4, 3.9 and 4.8 kb. Another isolate, UQ 808 had another combination of fragment sizes 2.2, 3.9, 4.3 and 6.4 kb. This fragment of 6.4 kb has only ever been recorded as belonging to S. minor. The different combination of fragments appear to be very close to those fragments previously identified as sharing the most fragments in common as in S. sclerotiorum. Only two isolates UQ 2460 and UQ 3319 produced fragments that perfectly aligned with S. sclerotiorum phenotype a (Kohn et al. 1988). All of the isolates identified as S. minor had the 3.5 and 6.4 kb fragments that were specific for S. minor (Kohn et al. 1988). All S. trifoliorum isolates had only 4.1 and 7.2 kb fragments which were found in two of the four genotypes identified as S. trifoliorum by Kohn et al. (1988). The probe enzyme combination of BamHI and pMF2 revealed the differences between S. sclerotiorum and S. minor or S. trifoliorum. It could identify isolates of S. sclerotiorum _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 43 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ that could not be identified using EcoRI and pMF2. The DNA fragments were of only two forms, either 11 kb or >24 kb, which were similar to the two recorded sizes of 11 kb and >24 kb. In the autoradiograph in Kohn et al. (1988). The phenotypic designation of pMF2 screening of the isolates with both EcoRI and BamHI are shown in Table 2.2. Phenotypes identified by pME probes were in most cases matched by phenotypes identified by pMF probes (Table 2.2). Isolates identified as S. minor by pME were also identified as this species by pMF2 with EcoRI, but when pMF2 with BamHI was used they could have been identified as either S. minor or S. trifoliorum. Isolates identified as S. trifoliorum by pME were also identified as S. trifoliorum by probe pMF2 with EcoRI but it was either S. minor or S. trifoliorum using pMF2 with BamHI. Of the seven isolates of S. sclerotiorum identified by pME probes, only two could also be identified as S. sclerotiorum using pMF2 with EcoRI. However, pMF2 with BamHI could identify six isolates as S. sclerotiorum. The probe pMF2 using both restriction enzymes EcoRI and BamHI, could also identify six of the seven isolates as S. trifoliorum. One isolate (UQ 808) was originally designated as S. trifoliorum because it was collected from T. subterraneum. This species is also a host of S. sclerotiorum (Cappellini 1960). Indeed, UQ 808 was shown to be S. sclerotiorum by all criteria (Table 2.2). The most definitive of the characteristics was the absence of consistent dimorphic ascospores, as all eight spores from a single tetrad were monomorphic and self fertile (Chapter 3). Dimorphism of ascospores within an ascus is a diagnostic feature of S. trifoliorum (Kohn 1979a; Uhm and Fujii 1983a). All seven pME RFLP probes tested provided evidence for the designation of UQ 808 as S. sclerotiorum. The probe pMF2 in combination with enzyme BamHI identified it as S. sclerotiorum but pMF2 in combination with EcoRI provided no information. UQ 3319 was another isolate collected from a clover and thus designated as S. trifoliorum but molecular evidence also proved it to be S. sclerotiorum. There were no sexual structures formed but fragments matched those typical for S. sclerotiorum with pME and pMF2 probes. UQ 2103 was another isolate collected from clover and thus putatively identified as S. trifoliorum. The presence of small sclerotia and the absence of uniform dimorphism in the asci indicated that the isolate was possibly S. minor. It was identified as S. minor using _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 44 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ combinations of probes pME147 and pME230, pME241, pME285 and pMF2. An isolate of S. sclerotiorum (UQ 1113) collected from Matthiola incana L. with large sclerotia and monomorphic ascospores was identified as S. sclerotiorum using pME RFLP probes but was identified as S. trifoliorum using pMF2 with EcoRI and no information was provided from the same pMF2 probe with BamHI. 23.1 kb 9.4 kb 6.6 kb 4.4 kb 2.3 kb Ss UQ 1290-1 Ss UQ 1293-2 Sm UQ 2568 Sm UQ 2567 Ss UQ 1113 Sm UQ 1112 Sm UQ 1111 Sm UQ 1109 Sm UQ 1106 St UQ 3326 St UQ 3325 St UQ 3324 St UQ 3323 St UQ 3322 St UQ 3321 Ss UQ 3319 St UQ 3318 St UQ 3317 St UQ 3316 St UQ 3193 Sm UQ 2103 St UQ 1114 Ss UQ 808 St UQ 583 Sm UQ 403 Ss UQ 2460 Ss UQ 1290-1 Ss UQ 1261-1 Marker 2.0 kb Figure 2.2 Southern hybridizations of EcoR1 digested S. sclerotiorum (Ss), S. minor (Sm) and S. trifoliorum (St) DNAs with radiolabelled probe pMF2. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 45 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ 2.4 DISCUSSION Several pME probes created from S. sclerotiorum produced diagnostic polymorphic patterns between and amongst the three Sclerotinia species. Probes pME147, pME241 and pME285 were useful for separating all three species simultaneously. Alternatively all three species of Sclerotinia could be identified using pME230 in conjunction with either pME106, pME163 or pME283. Some probes were more efficient at detecting S. sclerotiorum (pME106, pME147, pME163 and pME283), whilst others S. minor (pME241) or S. trifoliorum (pME230). Probes pME032 and pME082 detected no interspecific variation but still detected intraspecific polymorphisms. All nine single copy pME probes detected polymorphisms within the species of S. sclerotiorum. This is consistent with other genetic variation that has been found amongst S. sclerotiorum (Ekins et al. 1994a; Kohli et al. 1992; Kohn et al. 1988). The only polymorphisms detected within S. minor were with probes pME163 and pME283 and these were only loss of bands (possible deletion of the restriction site). Previous research has found diversity within this species (Ekins et al. 1994a) using RAPDs but other work using RFLPs has also found little variation (Kohn et al. 1988). No polymorphisms were found amongst the Australian isolates of S. trifoliorum which is in contrast to the variation which has been found previously in this species in other parts of the world (Kohn et al. 1988). This may be indicative of a founder effect in Australia. The molecular methods presented for typification of Sclerotinia species were shown to be complementary to other methods. The RFLP pME probes created are useful as taxonomic characters to identify the species when other characters are not available. The precision with which these probes predicted the identity of the isolates when compared to other criteria indicates their usefulness for identification of isolates for use in population genetics studies. The probes created in this study were more efficient than the pMF2 probes for identifying species of Sclerotinia. The majority of phenotypes identified with pMF2 correspond directly to those observed by Kohn (1988) but there were new fragments, and in new combinations. The large amount of genotypic divergence found amongst isolates of _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 46 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ S. sclerotiorum (Chapter 6) means that a multicopy probe such as pMF2 will allow detection of more phenotypes as the sample size increases. The hosts of all S. trifoliorum isolates were Trifolium species. The only taxonomic error in this study was that isolates from Trifolium species identified tentatively as S. trifoliorum were later identified as either S. sclerotiorum or S. minor. Consequently, host is not always a valid criterion for identification of a Sclerotinia isolate. Isolates collected from Trifolium species and shown to be either S. sclerotiorum or S. minor by molecular data and sclerotial diameters included UQ 808, UQ 3319 and UQ 2103. Clover is thus a host of both S. sclerotiorum and S. minor. However, the majority of isolates that were collected from Trifolium species are S. trifoliorum. Thus, host may still be of some use in the field for initial identification purposes despite the overlapping host ranges. Host in conjunction with sclerotial sizes may be sufficient for most identifications, because both characters are readily available to the plant pathologist in the field. There was one case of S. minor attacking clover which could have easily been correctly identified by the appearance of small sclerotia. Sclerotial diameters were the best criteria for separating S. minor from S. sclerotiorum and S. trifoliorum, i.e. small and large sclerotial isolates. Small sclerotial isolates were shown to be S. minor by RFLP analysis using the probes pME147, pME241, pME285 and pMF2, in addition to ascospore morphology. Large sclerotial isolates belong to either S. sclerotiorum or S. trifoliorum so these two species cannot be separated using sclerotial sizes as a criterion. Apothecia were successfully raised for representative isolates of the three species of Sclerotinia. Ascospore dimorphism in the asci can be a very good character for separating S. trifoliorum from S. sclerotiorum once the laborious task of raising apothecia has been conducted. Ascospore dimorphism must be used in conjunction with other characters such as sclerotial diameters in order to distinguish all three species. However, for population genetics studies molecular identification of all three species is much more accurate. RFLPs also have the advantage of providing quicker results than carpogenic germination. Use of _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 47 Chapter 2: Identification of Sclerotinia Species _________________________________________________________________________ the pME probes as taxonomic criteria have the extra benefit of using the same blots and probes for genotyping and allele comparisons required in population genetics. Sequencing of the RFLP probes developed in this study could enable creation of primers for use as a diagnostic PCR kit for even faster identification as in other plant pathogenic fungi (Murillio et al. 1998; Schesser et al. 1991). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 48 Chapter 3: Homothallism in Sclerotinia Species _________________________________________________________________________ Chapter 3: Homothallism in Sclerotinia Species 3.1 INTRODUCTION Sexuality greatly influences the population genetics of an organism, especially since the degree of variability of the population often reflects whether the organism is outbreeding or inbreeding. Amongst fungi, the presence of fertile sexual structures indicates a sexually reproducing organism. However, sexually reproducing fungi are not necessarily outbreeders as they can be either homothallic (self fertile) or heterothallic (self sterile) or exhibit both breeding strategies in the one species. Over time, a strictly homothallic fungus would evolve in a similar fashion to an asexual organism with the appearance of clonal reproduction since meiotic events would not lead to the recombination of new alleles. Outbreeding is usually characterised by recombination. Heterothallic fungi are self sterile and require different compatible or opposite mating types for sexual reproduction. In the absence of opposite mating types, genetic variability is often greatly reduced. For example a single mating type of the heterothallic oomycete Phytophthora infestans de Bary that spread to most of the world from South America behaved as a clonal lineage. The migration of the second mating type in the last 20 years has seen an occurrence of sexual reproduction and generation of recombinant genotypes (Goodwin 1997). However, the occurrence of a sexual stage is not imperative for variability, as demonstrated by the fungus Rhynchosporium secalis which causes barley scald disease. R. secalis has no known sexual stage but maintained higher levels of genetic diversity than expected for purely asexual reproduction (Goodwin et al. 1993). In most fungi such as Mycosphaerella graminicola (Chen and McDonald 1996) and Phaeosphaeria nodorum (E. Müller) Hedjaroude (Keller et al. 1997b) which reproduce both sexually and asexually it is possible to determine the contributions of each reproductive system to the genetic structure. Such information can be used to better understand disease epidemiology. Sclerotinia species are sexually reproducing ascomycete fungi that lack an asexual conidial spore stage but have an asexual sclerotial somatic stage for survival and dispersal. The breeding system in the genus Sclerotinia has been described both as homothallic by _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 49 Chapter 3: Homothallism in Sclerotinia Species _________________________________________________________________________ Drayton (1943) and Whetzel (1945), and heterothallic by Buller (1941). S. sclerotiorum has been regarded as homothallic because of the ability to raise apothecia from sclerotia derived from single ascospores (Drayton and Groves 1943; Ford et al. 1993; Henson 1935; Huang and Kozub 1991b; Keay 1939; Kohli et al. 1992; Saito 1973; Uhm and Fujii 1982). However, single ascospore isolates of S. sclerotiorum have also been found which were functionally sterile since they were unable to produce stipes or apothecia (Smith and Boland 1989) but fertilization with the microconidia (spermatia) of other isolates which would have indicated heterothallism was not attempted. This raises the possibility that both systems may exist within S. sclerotiorum. S. trifoliorum was originally regarded as homothallic because of the ability of single spore isolates to produce apothecia (Bjorling 1952; Carr 1954; Henson 1935; Keay 1939; Lane and Sproston 1955; Loveless 1951; Sproston and Pease 1957). However, the observation that ascospore dimorphism (production of phenotypically different ascospore sizes within an ascus) was correlated to fertility indicated that S. trifoliorum was bipolar heterothallic (Uhm and Fujii 1983a). Apothecia were only produced by large spored strains (fertile) or small spored strains (sterile) spermatized with microconidia (Uhm and Fujii 1983b). Four of the ascospores (large) in a single ascus are self fertile and thus homothallic while the remaining four ascospores (small) are self sterile and thus heterothallic. Ascospore dimorphism in all asci has been regarded as a characteristic feature of S. trifoliorum (Arseniuk and Macewicz 1994; Kohn 1979a; Uhm and Fujii 1983a). S. minor has been regarded as homothallic because of the production of apothecia produced from single spore cultures (Drayton and Groves 1943; Keay 1939). However, appearance of heterothallic isolates within a predominantly homothallic population has also been suggested (Patterson and Grogan 1984a). Apothecial production of S. minor has been described (Drayton and Groves 1943; Hartill and Underhill 1976; Hawthorne 1973; Jagger 1920; Keay 1939). Jagger (1920) observed that moisture and light were essential for apothecial formation in S. minor, similar to conditions required for apothecial development in S. sclerotiorum (Letham et al. 1978). However, the narrower temperature range suitable for apothecial _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 50 Chapter 3: Homothallism in Sclerotinia Species _________________________________________________________________________ production in S. minor has meant apothecia of this fungus are more difficult to produce than apothecia of S. sclerotiorum (Hawthorne 1976). S. minor can produce stipes within a range 9-19oC (Hawthorne 1976) with the optimal at 15oC (Hawthorne 1973). Whilst the cardinal temperatures for S. sclerotiorum are between 4-20oC (Huang and Kozub 1991b; Smith and Boland 1989) the optimum has been suggested to be either 10oC (Abawi and Grogan 1975), 14oC (Henson and Valleau 1940), or 15oC (Vandervort and Kucharek 1994). Most of these temperature discrepancies were explained by Huang and Kozub (1991b) as being related to geographic latitude of sclerotial collection. Moreover, temperature of sclerotial formation can affect temperatures required for carpogenic germination (Huang and Kozub 1989). Apothecia have been observed in the field for S. sclerotiorum (Kohn et al. 1991), S. minor (Hawthorne 1976) and S. trifoliorum (Henson 1935). In this study the breeding type mechanism of S. sclerotiorum and S. minor was examined for expression of homothallism, heterothallism or bipolar heterothallism. As a prelude to indirect measures of random mating (Chapter 6), observations of fertility displayed by single ascospores were conducted. Fertility in Sclerotinia was indicated by the induction of stipes (Fujii and Uhm 1988). The recognition that S. trifoliorum is partially heterothallic whilst individual ascospores are self fertile and thus appear homothallic prompted re-examination of other Sclerotinia species for partial heterothallism. The experiments examined:  Observation of Ascospore Dimorphism Individual isolates of S. minor, S. sclerotiorum and S. trifoliorum were induced to form apothecia for selection of single ascospore cultures for the next stage and, to check for ascospore dimorphism.  Fertility of Single Ascospore Cultures Single ascospore cultures were induced to form apothecia to determine the fertility of the isolate.  Fertility of Random Single Ascospore Cultures and Mass Spored Cultures Single ascospore cultures and mass spored cultures were induced to form apothecia. If the isolates were heterothallic only mass spored cultures would produce apothecia, if the _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 51 Chapter 3: Homothallism in Sclerotinia Species _________________________________________________________________________ isolates were homothallic both single and mass spored cultures would produce apothecia and if bipolar heterothallic the mass spored cultures and half of the single spored cultures would produce apothecia.  Fertility Within Individual Asci The fertility of all eight ascospores in a single ascus was determined by excising individual asci from apothecia which themselves had been developed from sclerotia produced in single ascospore cultures, and the ability of each of the ascospores to ultimately produce apothecia was ascertained. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 52 Chapter 3: Homothallism in Sclerotinia Species _________________________________________________________________________ 3.2 MATERIALS AND METHODS Isolates used in this investigation are listed in Table 3.1. Sclerotia from isolates of Sclerotinia species were removed from plant tissue or culture, immersed in 4% sodium hypochlorite and 70% ethanol for 2 minutes before being rinsed in sterile distilled water and blotted dry on sterile filter paper. They were then plated out onto V8 agar plates and grown in the dark at room temperature. Advancing mycelia were subcultured after 2-3 days and subsequently hyphal tipped, and transferred to fresh V8 agar media. In all experiments, sclerotia were induced to produce apothecia using methods similar to that of Hawthorne (1973; 1976). Isolates were grown for 4 weeks on wholemeal agar at 20oC. Sclerotia were scraped off the agar and air dried for 2-3 days. The sclerotia were then placed in 2 cm deep Petri dishes in 10 ml sterile distilled water and incubated in the dark at 15 0C for 8 hours and 10 0C for 16 hours until stipe formation occurred (4-8) weeks. The stiped sclerotia were then illuminated for 8 hours/day at 150C –180C under daylight fluorescent tubes until apothecial disc formation occurred (1-4) weeks. 3.2.1 Observation of Ascospore Dimorphism To determine ascospore dimorphism, asci and ascospores were teased from the apothecial disc and stained with lactophenol blue and observed for differences in spore size using an Olympus BH-2 compound microscope. Dimorphic ascospores were characterised by the presence of four large and four small ascospores within the same ascus. 3.2.2 Fertility of Single Ascospore Cultures Single spore isolates were established from the ascospore cultures which successfully produced apothecia. These isolates were also subjected to the same conditions to induce apothecia. The success of fertility was determined from observations of the number of stipes and apothecial discs produced. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 53 Chapter 3: Homothallism in Sclerotinia Species _________________________________________________________________________ 3.2.3 Fertility of Random Single Ascospore Cultures and Mass Spored Cultures Isolates were compared for their ability to produce apothecia from single spore cultures and mass spore cultures. Twenty randomly selected ascospores were taken from each apothecia and individually cultured. Sclerotia produced from these cultures were induced to form apothecia. Mass spore cultures were grown from many ascospores fired en masse from the apothecia of the same isolate onto a single V8 agar plate to determine if the mass of ascospores provided the spermatia necessary for fertilization. For each isolate the number of mass spored cultures ranged from 1-5, and the number of random single ascospore cultures ranged from 3-20. 3.2.4 Fertility Within Individual Asci All eight ascospores in an ascus were separated by singling out an individual ascus and releasing the ascospores by slicing off the tip and stem of the ascus using a Leica Leitz DMIL micromanipulator (Leica Instruments Pty., Ltd. Queensland, Australia) with a drawn-out microforged capillary tube prepared using a Narishige microforge (Narishige Co., Ltd. Japan). A single ascus from each of four isolates of S. minor and one isolate of S. sclerotiorum was analysed. All eight ascospores from the one tetrad were germinated on 1.5% water agar for 24 hours at room temperature to determine viability. The germinated ascospores were individually transferred to V8 agar plates and incubated for 2 weeks until sclerotial formation had occurred. Sclerotia from each colony were induced to form apothecia representative of individual ascospores. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 54 Chapter 3: Homothallism in Sclerotinia Species _________________________________________________________________________ 3.3 RESULTS 3.3.1 Observation of Ascospore Dimorphism The majority of isolates listed in Table 3.1 produced apothecia as shown in Figure 3.1. Stipes were produced by 45 of the 56 isolates and subsequent apothecial formation developed in 37 of these. The reasons for loss of carpogenic germination in some isolates include contamination, drying out and heavy handling. Of the S. minor isolates seven did not form apothecia although three of these produced stipes. Fourteen of the 37 isolates that produced apothecia were examined for ascospore dimorphism. Five isolates showed no dimorphism in spore size, whereas five isolates classified as S. trifoliorum (UQ 583, UQ 3316, UQ 3323 and UQ 3326) showed complete dimorphic ascospores in most asci (Figure 3.2). The additional unclassified Sclerotinia isolate (UQ 3193) also had dimorphic ascospores and is on this basis very likely to be S. trifoliorum. RFLP analysis (Chapter 2) also confirmed the identity of this isolate as S. trifoliorum. Four additional isolates possessed dimorphic ascospores at very low levels, one isolate of S. sclerotiorum UQ 808 (4.9% dimorphism) (Figure 3.3), and three isolates of S. minor UQ 1112 (2% dimorphism), UQ 2103 (3.5% dimorphism) and UQ 2568 (1% dimorphism) (Figure 3.4). Figure 3.1 Apothecia produced from sclerotia of S. minor isolate UQ 1112. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 55 Chapter 3: Homothallism in Sclerotinia Species _________________________________________________________________________ Table 3.1 Sclerotial size, stipe formation, apothecial formation and ascospore dimorphism of the isolates used in this study. Isolate Species UQ 401 UQ 403 UQ 581 UQ 607 UQ 861 UQ 1101 UQ 1102 UQ 1103 UQ 1104 UQ 1105 UQ 1106 UQ 1107 UQ 1108 UQ 1109 UQ 1110 UQ 1111 UQ 1112 UQ 1218 UQ 1223 UQ 1505 UQ 1506 UQ 2103 UQ 2563 UQ 2564 UQ 2565 UQ 2566 UQ 2567 UQ 2568 UQ 2570 UQ 2826 UQ 808 UQ 1113 UQ 1280-1 UQ 1280-2 UQ 1287-1 UQ 1291-2 UQ 1292-3 UQ 1293-1 UQ 1293-2 UQ 1342 UQ 2102 UQ 2571 UQ 3319 UQ 583 UQ 1114 UQ 3316 UQ 3317 UQ 3318 UQ 3320 S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. sclerotiorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum Host Species Collector Sclerotial Stipe Apothecial Ascospore Size a Formationb Formationb Dimorphismc Lycopersicon Y. Mazor S Y N -d esculentumspinosum Mill. L. R. Clarke Xanthium S Y Y N Lactuca sativa L M. Priest S N N L. sativa D. Trimboli S Y Y L. sativa I. Porter S Y Y Arachis hypogaea L. M.Ekins S Y Y A. hypogaea M.Ekins S Y Y A. hypogaea M.Ekins S Y Y A. hypogaea M.Ekins S Y Y A. hypogaea M.Ekins S Y Y A. hypogaea M.Ekins S N N A. hypogaea M.Ekins S Y N A. hypogaea M.Ekins S Y Y A. hypogaea M.Ekins S Y Y A. hypogaea M.Ekins S N N A. hypogaea M.Ekins S Y Y N A. hypogaea M.Ekins S Y Y 2% Helianthus annuus L. M.Ekins S Y Y H. annuus M.Ekins S Y Y L. esculentum Y. Mazor S Y Y Phaseolus sp. N. Drew S Y N Trifoliorum. Sp. M. Ramsey S Y Y 3.5% H. annuus M.Ekins S N N H. annuus M.Ekins S Y Y H. annuus M.Ekins S Y Y H. annuus M.Ekins S Y N H. annuus M.Ekins S Y Y N H. annuus M.Ekins S Y Y 1% H. annuus M.Ekins S Y Y Medicago sativa L. J. Irwin S Y Y T. subterraneum M. Barbetti L Y Y 4.9% Matthiola incana R. Cruickshank L Y Y N H. annuus M.Ekins L Y Y H. annuus M.Ekins L Y Y H. annuus M.Ekins L Y Y H. annuus M.Ekins L N N H. annuus M.Ekins L Y Y H. annuus M.Ekins L Y Y H. annuus M.Ekins L Y Y N H. annuus M.Ekins L N N Brassica juncea L. M. Ramsey L N N H. annuus M.Ekins L Y Y T. sp. J. Wong L N N T. repens M. Priest L Y Y Y T. ambiguum J. Yates L Y N T. sp. J. Wong L Y Y Y T. sp. J. Wong L Y Y T. sp. J. Wong L N N T. sp. J. Wong L Y N - _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 56 Chapter 3: Homothallism in Sclerotinia Species _________________________________________________________________________ Table 3.1 Continued Isolate Species Host Species Collector UQ 3321 UQ 3322 UQ 3323 UQ 3324 UQ 3325 UQ 3326 UQ 3193 S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum S. trifoliorum Sclerotinia sp. T. sp. T. sp. T. sp. T. sp. T. sp. T. sp. T. repens J. Wong J. Wong J. Wong J. Wong J. Wong J. Wong E. Elliot Sclerotial Stipe Apothecial Ascospore Size a Formationb Formationb Dimorphismc L Y Y -d L N N L Y Y Y L Y N L N N L Y N Y L Y Y Y a Sclerotia were either small (S) 1-2 mm or large (L) 3-10 mm. Stipe and Apothecial formation either: present (Y) or absent (N). c Ascospore dimorphism was present in all asci of some cultures (Y), absent in all asci (N) or ascospore dimorphism was present in rare asci and is expressed as a percentage of the total number of asci observed. d – indicates observation of dimorphism was not conducted on these isolates. b Figure 3.2 Ascospores displaying size dimorphism within a single ascus of S. trifoliorum (UQ 3326) x700. Figure 3.3 Ascospores displaying monomorphism (Left) and dimorphism (Right) in the same isolate of S. sclerotiorum (UQ 808) x700. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 57 Chapter 3: Homothallism in Sclerotinia Species _________________________________________________________________________ Figure 3.4 Ascospores displaying monomorphism (Left) and dimorphism (Right) in the same isolate of S. minor (UQ 2568) x700. 3.3.2 Fertility of Single Ascospore Cultures Two generations of single spored isolates were induced to produce stipes and apothecia (Table 3.2). Apothecial production was evidence of fertility within these isolates. For each species the majority of isolates showed greater than 50% carpogenic germination. Bipolar heterothallism would be demonstrated by 50% apothecial production, however there was only one isolate of S. minor (UQ 1223) and one isolate of S. sclerotiorum (UQ 1342) with less than 69% apothecial production. Levels of carpogenic germination differed between experiments, e.g. UQ 1505 had an overall carpogenic germination of 69% but the same isolate had produced 100% carpogenic germination of sclerotia from cultures derived from all eight ascospores within an ascus (Table 3.4). A similar occurrence occurred with S. sclerotiorum where six from six ascospores from one ascus of UQ 1287-1 were self fertile, while in the overall apothecial germination only 79% of cultures were successful. Table 3.2 Apothecial and stipe production per culture from one generation and percentage of maximum after successive generations of single spored cultures Isolate Species Stipes Apothecia % Stipe % Apothecial Produced Produced Production Production UQ 1108 S. minor 33/33 33/33 100 % 100 % UQ 1111 S. minor 8/8 8/8 100 % 100 % UQ 1112 S. minor 6/6 6/6 100 % 100 % UQ 1223 S. minor 6/6 0/6 *a 100 % 0% UQ 1505 S. minor 36/45 31/45 * 80 % 69 % UQ 2567 S. minor 15/15 14/15 100 % 93 % UQ 2568 S. minor 8/8 8/8 100 % 100 % UQ 808 S. sclerotiorum 16/16 16/16 100 % 100 % UQ 1287-1 S. sclerotiorum 54 /66 52/66 82 % 79 % UQ 1342 S. sclerotiorum 1/17 * 1/17 * 6% 6% a 2 * indicates significant difference from expected 100% fertility using  (P=0.05). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 58 Chapter 3: Homothallism in Sclerotinia Species _________________________________________________________________________ 3.3.3 Fertility of Random Single Ascospore Cultures and Mass Spored Cultures The majority of isolates produced apothecia from both random and mass spored isolates as listed in Table 3.3. There were no examples of isolates producing apothecia from mass spored cultures and not from single spored cultures. Only two isolates UQ 1342 and UQ 2571 (S. sclerotiorum) did not produce apothecia from either mass spores or random ascospores. Two isolates of S. minor (UQ 1102 and UQ 1223) produced apothecia from random ascospores but not from mass spored cultures. Table 3.3 Stipe and apothecial production from cultures of mass spored and randomly selected single ascospore cultures Isolates Species UQ 1101 UQ 1102 UQ 1103 UQ 1108 UQ 1111 UQ 1223 UQ 1505 UQ 2564 UQ 2567 UQ 2568 UQ 2570 UQ 808 UQ 1342 UQ 2571 S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. minor S. sclerotiorum S. sclerotiorum S. sclerotiorum Mass Spored Cultures Stipe Apothecial Productiona Production 100 % 100 % 0% 0% 20 % 20 % 100 % 100 % 100 % 100 % -b 80 % 80 % 100 % 100 % 100 % 80 % 100 % 100 % 100 % 80 % 72 % 72 % 0% 0% 0% 0% Single Spored Cultures Stipe Apothecial Production Production 75 % 25 % *c 29 % * 5%* 18 % * 9%* 100 % 100 % 100 % 100 % 88 % 18 % * 90 % 65 % 100 % 100 % 100 % 100 % 100 % 60 % 80 % 80 % 67 % 67 % 0%* 0%* 0%* 0%* a mass spored isolates only had 1-7 cultures - indicates the isolate was lost c * indicates significant difference from expected 100% fertility using 2 (P=0.05). b There were only two isolates of S. minor (UQ 1102 and UQ 1103 ) in which there were less than 50% stipe formation. If stipes do not represent fertility but development of mature apothecial discs do represent fertility then UQ 1101 and UQ 1223 additionally indicate potential for sterility as they had reduced apothecial disc formation. S. minor had 36.4% of isolates with 100% apothecial production, and 63.6% of isolates had greater than 50% apothecial production. Apothecial development from mass ascospore cultures was less than 100%, indicating that other factors may affect apothecial disc development. The absence of _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 59 Chapter 3: Homothallism in Sclerotinia Species _________________________________________________________________________ any isolates that could produce apothecia from only mass spored cultures is particularly pertinent. Two of the three isolates of S. sclerotiorum (UQ 2571 and UQ 1342) did not produce apothecia in either single spored or mass spored cultures. The third isolate of S. sclerotiorum (UQ 808) produced no significant differences in apothecia in single spored and mass spored cultures (67% and 72% respectively). 3.3.4 Fertility Within Individual Asci Single asci of four isolates of S. minor (UQ 1108, UQ 1111, UQ 1505, UQ 2568) and one isolate of S. sclerotiorum (UQ 808) were tested for fertility of ascospores within the ascus. In each case all eight ascospores within a single ascus were self fertile (Table 3.4). Table 3.4 Apothecial and stipe formation of all eight ascospores from a single ascus for isolates of S. minor and S. sclerotiorum Isolate Species UQ 1108 UQ 1111 UQ 1505 UQ 2568 UQ 808 S. minor S. minor S. minor S. minor S. sclerotiorum Stipe Apothecia Production Production 8/8 8/8 8/8 8/8 8/8 8/8 8/8 8/8 8/8 8/8 Self Fertility 100 % 100 % 100 % 100 % 100 % _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 60 Chapter 3: Homothallism in Sclerotinia Species _________________________________________________________________________ 3.4 DISCUSSION Isolates of S. minor were shown to be homothallic by the production of apothecia from all eight single ascospore cultures from the same ascus. All members of a tetrad of four isolates of S. minor were self fertile and did not require any spermatization from another mating type. In addition, self fertility in S. minor was consistent throughout several generations as evidenced from continued production of apothecia from single spore cultures over several generations. Random single spore and mass spore cultures of S. minor both produced apothecia. If an isolate was heterothallic only mass spored isolates would be expected to produce apothecia. However if the isolate was homothallic then both types of cultures would produce apothecia. The latter was the case. However, if an isolate was bipolar heterothallic as in S. trifoliorum (Uhm and Fujii 1983b) mass spored cultures would produce apothecia but only 50% of random spored cultures would produce apothecia and sterility would occur in 50% of all single ascospore cultures (Rehnstrom and Free 1993). In S. trifoliorum bipolar heterothallism is linked to spore size, large spores are fertile, and small spores are sterile (Uhm and Fujii 1983a). In this study there was a notable absence of any isolates that produced apothecia from mass spored cultures only and not from random single ascospore cultures. The majority of single spore cultures of S. minor display self fertility as evidence of homothallism, because 92% of cultures produced stipes and 82.6% mature apothecia. The failure of every isolate to produce stipes and apothecia does not prove that heterothallism is present, but rather may be a function of the method used for carpogenic germination. Other factors that contributed to non-production of apothecia include contamination, drying out and rough handling. Apothecial stipes were shown to only appear in large spored (fertile) cultures and spermatized (fertilized) small spored cultures of S. trifoliorum (Fujii and Uhm 1988), thus formation of stipes was interpreted as evidence of fertility in the isolate. Most examples of isolates not producing apothecia, did actually produce stipes. The production of apothecia by the majority of Australian S. minor isolates contrasts with results of Patterson and Grogan (1984a) who found that although some North American isolates of S. minor were homothallic most were heterothallic, as evidenced by the production of apothecia from spermatized sclerotia only. The abundance of homothallic _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 61 Chapter 3: Homothallism in Sclerotinia Species _________________________________________________________________________ isolates of S. minor in Australia could be an example of the founder effect where the population was founded by homothallic strains. Homothallism was also demonstrated by self fertility of all eight ascospores from a single ascus of an isolate of S. sclerotiorum. Isolates of S. sclerotiorum also produced apothecia from consecutive single spore cultures at each generation, also indicating homothallism. Random single spore and mass spore cultures of S. sclerotiorum both produced apothecia. S. sclerotiorum single spore cultures were self fertile as evidenced by stipe formation in 71.7% of cultures and mature apothecia in 69.7% of cultures. This in conjunction with the low amount of apothecial production from single and mass spored cultures indicates isolates of S. minor have inherently greater fertility than isolates of S. sclerotiorum under the conditions used in these experiments. Fertility of cultures in S. sclerotiorum has been variable, for example, 51.8% (Errampalli et al. 1994) and 40% (Uhm and Fujii 1982). Germination of ascospores from single apothecia of S. sclerotiorum also varied from 30% to 100% depending on the isolate (Kohli et al. 1992). The production of 50% or less apothecia by 40% of S. sclerotiorum isolates indicates that the problems are more likely to be environmental rather than genetic. There were no examples of S. sclerotiorum isolates from mass spored cultures producing apothecia whilst single spore isolates could not. These results agree with the homothallism previously shown in S. sclerotiorum (Ford et al. 1993; Huang and Kozub 1991b; Kohli et al. 1992; Uhm and Fujii 1982) and as such S. sclerotiorum is a control in this experiment to compare with S. minor. Homothallism itself does not mean that outbreeding cannot occur. Ascospore dimorphism with a 4:4 segregation has been regarded as a character specific to S. trifoliorum (Arseniuk and Macewicz 1994; Kohn 1979a; Kohn 1979b; Uhm and Fujii 1983a). The consistent presence of dimorphic ascospores has been indicative of S. trifoliorum in this research and it even confirmed the designation of an unknown isolate (UQ 3193) as S. trifoliorum. DNA analysis described in Chapter 2 also identified this isolate as S. trifoliorum. However, some isolates of S. minor and S. sclerotiorum (UQ 808, UQ 1112, UQ 2103 and UQ 2568) displayed rare examples of ascospore dimorphism in their asci (Table 3.2). UQ 808 was originally classified as S. trifoliorum on the basis of its host (T. subterraneum) but ascospore monomorphism and RFLP data has indicated it is S. sclerotiorum (Chapter 2). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 62 Chapter 3: Homothallism in Sclerotinia Species _________________________________________________________________________ Another isolate, UQ 2103 was also originally classified as S. trifoliorum but with sclerotial dimensions and RFLP patterns similar to S. minor (Chapter 2). If heterothallism is associated with ascospore size in these two fungi then some individual asci and thus individual ascospores in Australian isolates of S. minor and S. sclerotiorum may still retain the heterothallic ability. In contrast, Patterson (1984a) suggested the majority of S. minor isolates in North America are heterothallic. However, dimorphic ascospores observed in the present experiment accounted for less than 5% of all asci for both S. sclerotiorum and S. minor. Other reports of isolates unable to produce apothecia (Smith and Boland 1989) may be due to sterile cultures as a consequence of heterothallism at low levels. Further experimentation is needed to determine whether the dimorphic ascospores of UQ 808, UQ 1112, UQ 2103 and UQ 2568 give rise to sterile but fertilizable sclerotia that truly represent maintenance of the capacity for heterothallism at low frequency in S. minor and S. sclerotiorum. Future research to prove the presence of heterothallism could involve spermatial addition to those cultures that appeared to be sterile. Subsequent production of apothecia on fertilized sclerotia, with no development on unfertilized duplicate sclerotia, would prove that heterothallism could also exist in S. minor and S. sclerotiorum. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 63 Chapter 4: Head rot of sunflowers caused by ascospores of Sclerotinia minor _________________________________________________________________________ Chapter 4: Head rot of sunflower caused by ascospores of Sclerotinia minor 4.1 INTRODUCTION On sunflower, S. minor is currently known only to infect by direct penetration of the root or base of the stem, causing wilt or basal stem rot (Huang and Dueck 1980; Huang and Hoes 1980; Sedun and Brown 1986). The presence of root exudates has been shown to stimulate mycelial germination of the sclerotia (Burgess and Hepworth 1996; Burgess et al. 1995), with subsequent formation of appressoria and infection hyphae penetrating the root or stem base. One of the symptoms of infection is the formation of an obvious bleached or watersoaked lesion, with mycelium of the fungus travelling directly behind the lesion front (Sedun et al. 1989). The lesion which rapidly spreads up the stem may have the appearance of either water soaking or a white bleached girdling of the stem, which is usually followed by the characteristic wilt of the plant. The formation of characteristic small black sclerotia of S. minor aid in identification of this fungus. S. sclerotiorum can cause similar symptoms to S. minor in sunflower by also directly attacking roots or stem bases following mycelial germination of sclerotia (Huang and Dueck 1980; Huang and Hoes 1980). However, ascospores released after carpogenic germination of sclerotia of S. sclerotiorum can also cause disease in sunflower through the upper stem, leaves, terminal bud and capitulum (Castano et al. 1993), as outlined in the life cycle (Figure 4.1). Capitulum or head rot occurs when ascospores land on the florets, germinate, infect, and after an indefinite quiescent period cause a water soaked lesion which becomes obvious on the dorsal surface of the capitulum. Under moist conditions fluffy white mycelium may be present on the exterior of colonized tissue. The floral head is usually totally destroyed except for the vascular tissue (Masirevic and Gulya 1992). Following infection of the floral head a new generation of sclerotia develop in the infected tissue. These are returned to the soil during harvest and cultivation. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 64 Chapter 4: Head rot of sunflowers caused by ascospores of Sclerotinia minor _________________________________________________________________________ Ascospores Sclerotia Apothecia Carpogenic Germination (Sexual) Mycelial Germination (Asexual) Figure 4.1 Lifecycle of S. sclerotiorum on sunflower. Carpogenic germination of sclerotia resulting in head rot and mycelial germination of sclerotia resulting in basal stem rot of sunflower. S. minor has been recorded in Australia since at least 1896 with reports of it causing sunflower wilt from as early as 1907 (Porter and Clarke 1992). S. minor and S. sclerotiorum have long since been present within the sunflower growing regions of Australia; in Queensland, New South Wales and Victoria (Clarke 1982; Clarke et al. 1993; Porter and Clarke 1992). On a worldwide basis Sclerotinia wilt of sunflower caused by S. minor has been reported in: South and North America (Creelman 1965; Gulya et al. 1991; Sackston 1956; Sackston 1957), Europe (Iliescu et al. 1988) and South Africa (Baard and Los 1989). This distribution overlaps significantly with the geographic range of S. sclerotiorum which has been recorded causing head rot as well as root, basal stem rot or wilt in sunflower in Australia (Kondo et al. 1988), South and North America (Acimovic 1988; Gulya et al. 1991; Henning and Franca Neto 1985; Kondo et al. 1988; Sackston 1956), Europe (Acimovic 1988) and Japan (Kondo et al. 1988). Inherent in the overlap of S. minor distribution are regions with conditions conducive for apothecial formation of S. sclerotiorum evident by the appearance of head rot in sunflower. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 65 Chapter 4: Head rot of sunflowers caused by ascospores of Sclerotinia minor _________________________________________________________________________ On a continental scale this is even more apparent throughout sunflower growing regions of Australia. The distributions of S. minor and S. sclerotiorum in Australia are shown in Figures 4.2 and 4.3 respectively. The distribution shown in Figure 4.3 represents areas where head rot of sunflower and white rots of other hosts caused by S. sclerotiorum occur. This corresponds to regions where conditions are suitable for apothecial production. Figure 4.2 Approximate distribution of S. minor on sunflower and other crops in Australia. Figure 4.3 Approximate distribution of S. sclerotiorum on sunflower and other crops in Australia. This indicates areas where S. sclerotiorum probably produces apothecia in Australia. Unlike S. sclerotiorum which causes both head and basal stem rots, S. minor has never been recorded as causing head rot of sunflower anywhere in the world (Masirevic and Gulya _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 66 Chapter 4: Head rot of sunflowers caused by ascospores of Sclerotinia minor _________________________________________________________________________ 1992). Although apothecial production by carpogenic germination of sclerotia of S. minor has been described by Jagger (1920), Keay (1939), Drayton (1943), Hawthorne (1973), Hartill (1976), and in this thesis, the perfect stage has never been observed in the field in Australia (Porter et al. 1994; Porter and Clarke 1992; Sedun and Brown 1986). Apothecia of S. minor have been seen in New Zealand (Hawthorne 1976) and the United States (Adams 1987). Balfe (1935) attempted to raise apothecia of Australian isolates of S. minor but in his experiments only apothecial stipes developed. The only record of disease resulting from S. minor ascospore infection is by Jarvis and Hawthorne (1972) who suggested that epidemics in lettuce were caused by S. minor ascospores, but this suggestion was later withdrawn (Hawthorne 1974). The objectives of this study were to determine if Australian isolates of S. minor induced to produce apothecia and hence ascospores, have the capacity to infect sunflower capitula and cause head rot of sunflower in the same way as S. sclerotiorum. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 67 Chapter 4: Head rot of sunflowers caused by ascospores of Sclerotinia minor _________________________________________________________________________ 4.2 MATERIALS AND METHODS 4.2.1 Fungal Material S. minor isolate UQ 2567 was collected from the roots of a wilted sunflower plant at Blackville NSW and S. sclerotiorum isolate UQ 1293-2 was collected from the roots of a wilted sunflower growing at Toowoomba QLD. The sclerotia were removed from sunflower tissue, immersed in 4% sodium hypochlorite and 70% ethanol for 2 minutes before being rinsed in sterile distilled water and blotted dry on sterile filter paper, and then plated onto V8 agar plates and grown in the dark at room temperature. Advancing mycelia were subcultured after 2-3 days, and 2 days later hyphal tips were transferred to fresh V8 agar media. 4.2.2 Identification of Isolates Isolate UQ 2567 was identified as S. minor by the presence of small sclerotia (1-2 mm) in the field. Isolate UQ 1293-2 was identified by the presence of large sclerotia (4-8 mm) in the field. The identifications were confirmed using RFLP probes pME106, pME147, pME163, pME230, pME241, pME283 pME285 and pMF2 as discussed in Chapter 2. 4.2.3 Carpogenic Germination Carpogenic germination of sclerotia of both isolates of S. minor and S. sclerotiorum were induced using methods similar to that of Hawthorne (1973; 1976) as outlined in Chapter 2, Section 2.2. The apothecia were collected and ascospores released into sterile distilled water. 4.2.4 Inoculation Protocol The sunflower lines used were the commercial hybrid cultivar Hysun 36 (Pacific Seeds Pty Ltd.) and the inbred lines RD5 (Pacific Seeds Pty Ltd.) and SCLW4-91-3-3-3. The latter _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 68 Chapter 4: Head rot of sunflowers caused by ascospores of Sclerotinia minor _________________________________________________________________________ line was the product of a recurrent phenotypic selection program to develop resistance to Sclerotinia wilt caused by S. minor. It has been found to have good resistance to head rot caused by S. sclerotiorum in Argentina (Goulter 1996). The 21 plants were inoculated between reproductive stages R5-R6 (Schneiter and Miller 1981) by spraying 2 ml of a 5000 spores/ml ascospore suspension (Pereyra et al. 1992) directly onto the floral face of capitulum by means of a hand trigger spray bottle from a distance of 10-15 cm. The sunflower heads were covered with moistened plastic bags for 72 hours as described by Pierre and Regnault (1982). The S. minor isolate was inoculated onto all three lines. S. sclerotiorum was inoculated onto Hysun 36 as a positive control. Symptom development was then observed in the plants over 4 weeks. The experiment was repeated using the same ascospore concentrations and inoculation methods as for the first experiment except that 16 Hysun 36 plants were inoculated with S. minor and 16 Hysun 36 plants were inoculated with S. sclerotiorum. The plants were assessed 4 weeks later for symptoms and signs of the infection. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 69 Chapter 4: Head rot of sunflowers caused by ascospores of Sclerotinia minor _________________________________________________________________________ 4.3 RESULTS Within 2 weeks of inoculation the watersoaked lesions which are characteristic of S. sclerotiorum head rots formed on the dorsal side of the sunflower inoculated with S. sclerotiorum or S. minor. White fluffy mycelium could also be seen on the floral face in a small number of cases with both species. After one month the sunflower heads were split to check for sclerotial development. Small sclerotia (0.5 mm- 2 mm) were recovered from the sunflower heads inoculated with S. minor (Figure 4.4), while large sclerotia (4 mm-13 mm) developed on heads inoculated with S. sclerotiorum (Table 4.1). The sclerotia were recovered from the pith tissue as well as the tissue surrounding the individual seeds. Both S. minor and S. sclerotiorum infected and caused head rot in the cultivars Hysun 36, RD5 and SCLW4-91-1-3-3-3. Table 4.1 Size of sclerotia recovered and number of sunflower plants from which the sclerotia were recovered after inoculation of sunflower lines. S. minor Hysun 36 Small Sclerotiaa 11d/12e Sunflower Lines RD5 Small Sclerotia 4/5 SCLW4-91-1-3-3-3 Small Sclerotia 1/4 S. sclerotiorum Large Sclerotiab 4/4 Large Sclerotia -c Large Sclerotia - Small sclerotia = 0.5 –2 mm Large sclerotia = 4 –13 mm c - Indicates was not tested against these lines d Number of plants with sclerotia e Number of plants inoculated a b In the second experiment sclerotia recovered from sunflower heads were the same size as those from which the apothecia were raised (Table 4.2). All of the sixteen sunflower plants inoculated with S. sclerotiorum showed successful colonization. Sclerotia of the size corresponding to S. sclerotiorum were recovered from 15 of these heads. From the remaining sunflower head, symptoms were indicative of head rot caused by S. sclerotiorum such as the formation of a large watersoaked lesion and mycelium was present internally but sclerotia were absent. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 70 Chapter 4: Head rot of sunflowers caused by ascospores of Sclerotinia minor _________________________________________________________________________ Figure 4.4 S. minor causing head rot of sunflower. Note the presence of small black sclerotia in the pith tissue. Small sclerotia, typical of S. minor, were recovered from ten of the sixteen sunflower heads (62.5% incidence) inoculated with ascospores of this fungus. Accidental inoculation of one flower with both S. minor and S. sclerotiorum, resulted in only large sclerotia typical of S. sclerotiorum infection. Table 4.2 Incidence of infection and sclerotial recovery as well as sclerotial sizes recovered from inoculation of 16 sunflower plants with ascospores of S. minor and S. sclerotiorum. S. minor S. sclerotiorum Incidence of Symptoms 62.5 % 100 % Sclerotial Incidence 62.5 % 93.8 % Sclerotial Size Smalla Large a There was one example of a sunflower inoculated with both S. sclerotiorum and S. minor that contained large sclerotia. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 71 Chapter 4: Head rot of sunflowers caused by ascospores of Sclerotinia minor _________________________________________________________________________ 4.4 DISCUSSION Isolates of S. minor produced apothecia readily in culture, under the same conditions as S. sclerotiorum and S. trifoliorum (Chapter 3). However, induction of apothecial production of S. minor is more difficult than S. sclerotiorum (Hawthorne 1976). It was shown in Chapter 3 that the Australian isolates of S. minor are homothallic as are S. sclerotiorum (Huang and Kozub 1991b; Kohli et al. 1992). The carpogenic germination indicates that Australian isolates of S. minor have the potential for sexual reproduction, however there are no records of apothecia from the field, indicating that either S. minor apothecia are overlooked or that this type of germination is rare. In contrast, S. minor has been observed producing apothecia readily in field crops in New Zealand (Hawthorne 1976). S. minor and S. sclerotiorum have similar geographic distributions in Australia (Figures 4.2 and 4.3), yet carpogenic germination is only observed in the field for S. sclerotiorum. Soil temperature is likely to play a role in carpogenic germination. Apothecia of S. sclerotiorum have been reported to develop over a wide range of temperatures between 4oC (Smith and Boland 1989) and 20 oC (Kosasih and Willetts 1975b). Whereas S. minor produce stipes over a narrower range of soil temperatures (11oC - 17oC), with the optimal at 15oC (Hawthorne 1973; 1976). The soil temperatures when wilt usually occurs in Australia are generally between 20oC and 25oC (Porter and Clarke 1992), which are inhibitory for carpogenic germination (Hawthorne 1976) of S. minor but not for S. sclerotiorum. Soil moisture will also play a role in this stage as moist conditions have been previously found to be critical for apothecial formation (Abawi and Grogan 1975; Henson and Valleau 1940). Some areas in Tasmania, Victoria and New South Wales have climatic conditions similar to those in New Zealand, which may be suitable for apothecial production of S. minor. However, these regions have a predominantly winter rainfall, which does not favour the cultivation of sunflower. It is therefore unlikely that ascospores of S. minor will cause head rot of sunflower, even if they are produced in these regions. This does not preclude however, the possibility that ascospores of S. minor could cause infections on other hosts. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 72 Chapter 4: Head rot of sunflowers caused by ascospores of Sclerotinia minor _________________________________________________________________________ The influence of soil temperature on carpogenic germination has consequences in the seasonal production of apothecia. In New Zealand production of apothecia of S. minor is limited to spring (Hawthorne 1976), whereas in the UK apothecia of S. minor form predominantly in the autumn (Keay 1939). A similar pattern was observed for S. trifoliorum (Henson and Valleau 1940; Kreitlow 1949; Williams and Western 1965b), but not for S. sclerotiorum which produces apothecia unrestrained by seasonality (Coe 1949; Henderson 1962; Palti 1963). If apothecial production by S. minor is spring limited, then S. minor head rot in Australian sunflower crops is unlikely. Most sunflower crops in Australia are grown in Queensland and northern New South Wales, and are planted in late spring or early summer and harvested by autumn or early winter and thus miss the window of temperatures and moisture required for apothecial production in S. minor. The results show that S. minor has the potential to cause head rot of sunflower in Australia following inoculation with ascospores. The symptoms such as water soaked lesions on the dorsal face of the sunflower flower, mycelium inside the head and sclerotial formation were similar to those produced by S. sclerotiorum except that sclerotia were much smaller. Sclerotia recovered after inoculation were of similar size to sclerotia used to produce the inoculum. On close examination, the possibility of confusing head rot caused by S. minor with that caused by S. sclerotiorum is unlikely because of the obvious differences in sclerotia. However, external symptoms are very similar. Sclerotial diameters are the most obvious distinguishing feature between these two species. S. minor produced very small sclerotia, 0.5 - 2 mm which matches the sizes recorded by Jagger (1920), Letham (1978), Wong(1979) and Kohn (1979a), whereas sclerotia of S. sclerotiorum were much larger (4-13 mm) matching what is usually of the order 2-20 mm for S. sclerotiorum (Kohn 1979a; Letham et al. 1978; Wong 1979). Tariq et al. (1985) however, have indicated a larger overlap for S. minor (1-3 mm) and S. sclerotiorum (1-9.5 mm). S. sclerotiorum was shown to be slightly more successful in colonization of the sunflower heads than S. minor as it colonized all of the heads that were artificially inoculated as compared to a 67% infection rate with S. minor. This result may indicate that S. sclerotiorum is more aggressive than S. minor in causing head rot as assessed by this assay, but this may not correlate with aggressiveness in basal stem rot. Additional evidence for increased aggressiveness of S. sclerotiorum on sunflower heads came from the _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 73 Chapter 4: Head rot of sunflowers caused by ascospores of Sclerotinia minor _________________________________________________________________________ dominance of S. sclerotiorum on the single sunflower head that was co-inoculated with both S. sclerotiorum and S. minor. In other comparative studies S. sclerotiorum has been found to be more aggressive than S. minor (Riddle et al. 1991; Sedun and Brown 1984) but the converse has also been found (Imolehin et al. 1980; Phipps and Porter 1982; Sedun and Brown 1989). The effect of aggressiveness depends largely on the individual isolates and the competitive effects of different genotypes (Maltby and Mihail 1997). The S. minor isolate was able to infect all three lines of sunflower, thus displaying aggressiveness without any obvious race specification for this particular isolate and host line combination. Clarke (1982) was also unable to demonstrate racial structure in S. minor on sunflowers. Further research involving a large number of isolates and a larger range of host lines may reveal races in S. minor although this is unlikely. The formation of apothecia illustrates the potential for S. minor to cause head rot on sunflower. The lack of this infection in the field can most probably be the result of a lack of synchrony between the susceptible sunflower flowering stage and conditions necessary for carpogenic germination of S. minor. Suitable conditions most likely exist for carpogenic germination of S. minor in Australia. It is possible that apothecia of S. minor develop infrequently in the field in Australia, and rare aerial infections may also occur, that are not observed. However, close examination of sunflower head rot in the field around eastern Australia during the course of this study revealed only the presence of large sclerotia belonging to S. sclerotiorum. This indicates that individuals are not necessarily specific for the mode of infection. Asexual reproduction of sclerotia and movement through the soil, machinery, irrigation, flooding is efficient whilst the aerial mode of infection is physiologically more expensive as well as requiring more specific conditions. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 74 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ Chapter 5: Aggressiveness among isolates of Sclerotinia sclerotiorum from sunflower 5.1 INTRODUCTION 5.1.1 Pathogenicity testing Variation between and within species of organisms can be expressed in many phenotypic and genotypic forms. One form of variation of particular relevance in plant pathology is that of pathogenicity. Pathogenicity determines the amount of disease that develops as it incorporates both virulence and aggressiveness (Keane and Kerr 1997). Pathogenesis involves host/parasite interaction of which virulence, aggressiveness and host specificity are all features. The association between pathogenic variation and underlying genetic variation has not always been obvious. Pathotype variation within genotypes has been identified e.g. Phytophthora infestans (Goodwin et al. 1995), Rhynchosporium secalis (Goodwin et al. 1992) and Magnaporthe grisea (Levy et al. 1993; Levy et al. 1991). Integrated disease management using a population approach is likely to be more fruitful in the future as knowledge of genotypic and pathogenic variation becomes more widespread. Knowledge of population structure enables effective gene deployment against identified genotypes, while understanding population genetics can allow prediction of the likelihood of the occurrence of new genotypes. Knowledge of pathogen variation is essential to enable breeding for resistance to plant pathogens to be carried out effectively so as to ensure durability of any incorporated resistance, whether it be bred traditionally (host selection) or artificially (recombinant gene technology). Most screening programs are carried out in glasshouses or nurseries under the assumption that the pathogen isolate used is representative of the field populations, often without any prior knowledge of aggressiveness. Host specificity defines a species of pathogen by the particular host species it can colonize. Attempts to use host specificity testing to separate the Sclerotinia species have not been successful. This is because the host ranges of both S. sclerotiorum and S. minor are extremely wide and overlap significantly (Cappellini 1960; Held and Haenseler 1953; Jellis et al. 1990; Keay 1939; Pratt et al. 1988; Pratt and Rowe 1995). However, S. trifoliorum is _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 75 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ the only Sclerotinia species with a limited host range as suggested by its specific binomial, implying a smaller range than is evident in the other species. Host specificity has also been studied within species of Sclerotinia, but little evidence has been found for physiological specialization (Ekins 1993; Pratt and Rowe 1995; Price and Colhoun 1975b). 5.1.1.1 Virulence Testing Virulence is defined by Agrios (1988) as “the degree of pathogenicity of a given pathogen”, whereas Keane (1997) and Day (1974) defined virulence of the pathogen as the ability to infect cultivar genes conferring qualitative resistance. This definition is usually applied when comparing races by the use of a differential set of genotypes, each containing one or more resistance genes. Virulence testing has long been carried out in conjunction with resistance screening as researchers have long sought a convenient quick, cheap, accurate method to detect resistant plant genotypes. However with the Sclerotinia species there have been consistent failures to differentiate any races and consequently failures to produce a set of differential cultivars in any of the host species. This is despite numerous attempts to screen for differences in virulence against a range of host cultivars (Pratt and Rowe 1991; Pratt and Rowe 1995; Scott 1984). Without a proper set of differential hosts it would be difficult to qualify the differing pathogenicities as virulence, and as such, most of the attempts to differentiate races in Sclerotinia species may be better described as assessments of differing aggressive abilities of isolates. 5.1.1.2 Aggressiveness Testing Aggressiveness aims to separate fungal isolates into different pathogenic strains by comparing their aggressiveness on a single genotypic host. Isolates that are more aggressive are able to invade and colonize host tissue more rapidly (Keane and Brown 1997). Aggressiveness is defined as “quantity of disease induced by a pathogenic strain on a susceptible host” (Andrivon 1993). Research to date has focused on either using aggressiveness to separate the three Sclerotinia species as specific identities or to separate a single species into many strains. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 76 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ Separating the species of S. sclerotiorum and S. minor on the basis of aggressiveness is similar to separation of the species using host specificity as criteria. Research on the separation of S. sclerotiorum and S. trifoliorum on the basis of their aggressive tendencies has been conducted (Pratt et al. 1988; Pratt and Rowe 1991; Pratt and Rowe 1995) and combined with host specificity testing but still failed to separate the two species (Morrall et al. 1972). S. sclerotiorum has been found to be more aggressive than S. minor by some researchers (Riddle et al. 1991; Sedun and Brown 1984) but less aggressive by other workers (Phipps and Porter 1982; Sedun and Brown 1989). Aggressiveness is more specific to individual isolates than the species to which they belong. Cappellini (1960) concluded that strains of differing aggressiveness existed within S. trifoliorum, by comparing the aggressiveness of isolates on a single host. Differences in aggressiveness among isolates of S. sclerotiorum (Morgan 1952) were found to be positively correlated with growth in vitro. Aggressiveness testing of S. sclerotiorum isolates on a range of hosts by Price (1975a; 1975b) resulted in different rankings for each host. After concluding that physiological specialization was not responsible, Price (1975a; 1975b) conceded that there may be genetic differences amongst the isolates. Significant differences amongst isolate aggressiveness for both S. sclerotiorum and S. minor are not usually found (Pratt and Rowe 1995; Sedun and Brown 1989). During a search for hypovirulent isolates of S. minor, Melzer and Boland (1996) found a „continuum‟ of aggressiveness, with hypovirulence at one extreme of this when they analysed mean lesion measurements. Similarly, Riddle et al. (1991) found a spread of S. sclerotiorum isolates right across their aggressiveness scales (that is: weakly, moderately or highly aggressive) with significant differences detected between only a few isolates. Of the ten isolates of S. sclerotiorum, Marciano et al. (1983) tested, only a highly aggressive and non-aggressive isolate were significantly different. Changes in aggressive abilities (decreasing and even increasing) of isolates during culturing has also been noticed by Pratt and Rowe (1995). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 77 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ S. trifoliorum, a bipolar heterothallic fungus, is the only species where correlation between the pathogenicity of ascospores from the same apothecia have been tested. The pathogenicity and virulence of single ascospore isolates of S. trifoliorum were first tested by Kreitlow (1949) who found slight differences in aggressiveness between isolates, but was unable to distinguish differences between ascospore cultures from the same apothecia. However, in later work Kreitlow (1951) was able to separate single ascospore isolates of S. trifoliorum from the same and different apothecia into high or low aggressiveness. Ascospores from the same apothecium were also found to have varying levels of aggressiveness by Morrall et al. (1972) but they concluded that distinction of strains was impossible. The dimorphic spores of S. trifoliorum were found by Uhm and Fujii (1983a) to have no correlation with aggressive abilities. Differing levels of aggressive abilities within individual apothecia would suggest variability within aggressiveness of this fungus. Aggressiveness testing of S. sclerotiorum on sunflower has involved measurement of lesion development on the stems (Sedun and Brown 1989). Sedun and Brown (1989) showed that the hyphae of S. sclerotiorum was within 2 mm of lesion fronts. This is convincing evidence that lesion length is a direct measurement of fungal aggressiveness. Inoculation techniques have involved attaching infested grains or agar to the base of the stem at or below the soil line (Bazzalo et al. 1991; Bazzalo et al. 1985; Clarke 1982; Dueck and Campbell 1978; Iliescu et al. 1992; Sedun and Brown 1989; Skoric and Rajcan 1992) as well as along the stem (Castano et al. 1993; Orellana 1975). Some techniques involved the penetration of the stem to aid infection (Acimovic 1992; Iliescu et al. 1992; Pawlowski and Hawn 1964; Skoric and Rajcan 1992). Sclerotia have been placed against the root in soil (Castano et al. 1993; Sedun and Brown 1989). Differences in inoculation techniques and inoculum (mycelia, sclerotia or ascospores) and tissue (organ) and age of the plant can affect aggressiveness, together with the environment. Aggressiveness may also vary between penetration and extension phases of infection (Thuault and Tourvieille 1988). To compound this, the resistance mechanism may be independent for each mode of infection (Vear and Tourvieille 1984). In this Chapter, 120 isolates of S. sclerotiorum collected from sunflower were analysed for differences in aggressiveness. Lesion lengths from three isolates from the same plant were _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 78 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ grouped together to determine if a consistent level of aggressiveness could be measured. The primary aim of this experiment was to distinguish between aggressive abilities of many isolates of the same fungal species (S. sclerotiorum) on a single genotype of sunflower (Helianthus annuus cv. Hysun 36). The aggressiveness of isolates from the same plant was also assessed. The separation of aggressiveness into pathogenic groups such as races, is unlikely in S. sclerotiorum and was not tested in this experiment, but separation into genotypic groups is possible. The phenotypic character of aggressiveness was analysed for correlation to other characteristics such as genotypes including Mycelial Compatibility Groups (MCGs) and Restriction Fragment Length Polymorphisms (RFLPs) (as identified in Chapter 6) and more specifically to location and mode of infection from which the isolates were collected. Measurement of lesion length as a measure of aggressiveness is a quantitative characteristic and thus amenable to statistical analysis. Reviews of research involving quantitative statistical procedures utilized in plant pathology have concluded that statistical procedures have been widely misused (Gilligan 1986; Johnson and Berger 1982). Several analytical procedures were therefore compared. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 79 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ 5.2 MATERIALS AND METHODS 5.2.1 Fungal Material One hundred and twenty isolates of S. sclerotiorum were collected from diseased sunflower heads and basal stem rots in two locations: Gatton, and Wyreema, in south east Queensland (Table 5.1). Three sclerotia were obtained from each infected plant. The sclerotia were removed from sunflower tissue, immersed in 4% sodium hypochlorite and 70% ethanol for 2 minutes before being rinsed in sterile distilled water and blotted dry on sterile filter paper and then plated out onto V8 agar and grown in the dark at room temperature. Advancing mycelia were subcultured after 2 - 3 days and subsequently hyphal tipped and transferred to fresh V8 agar media. Cultures of the isolates were then stored under liquid nitrogen to maintain aggressiveness for the pathogenicity testing since S. sclerotiorum has been found to lose pathogenicity during culturing (Mancl and Shein 1982; Price and Colhoun 1975a). The isolates were restored from liquid nitrogen onto V8 agar media and freshly subcultured from the growing edge of the colony. 5.2.2 Plant Material Seeds of the sunflower hybrid cultivar Hysun 36 (Pacific Seeds Pty Ltd, Toowoomba, Australia) were sown in 6 cm pots in University of California soil mix. Plants were grown in a glasshouse at temperatures of 20-35 oC for four weeks until at growth stage V6 to V8 (Schneiter and Miller 1981). This which is equivalent to establishment phase 1.4 to 1.5 (Siddiqui et al. 1975) which is recommended by Sedun and Brown (1989) for inoculation studies. The plants were then transferred to a controlled environment facility set at 25 oC and 70 % relative humidity, with 12 hour day/night cycles under daylight fluorescent tubes, at which stage they were inoculated. The inoculation experiment was repeated one week later on a second batch of plants to minimize any seasonal effects. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 80 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ Table 5.1 List of the isolates of S. sclerotiorum, the location and type of infection from which the isolates were collected and used in this study. Isolate a UQ 1261 UQ 1262 UQ 1263 UQ 1264 UQ 1325 UQ 1326 UQ 1327 UQ 1328 UQ 1329 UQ 1330 UQ 1333 UQ 1334 UQ 1336 UQ 1337 UQ 1342 UQ 1343 UQ 1344 UQ 1346 UQ 1347 UQ 1348 UQ 1271 UQ 1272 UQ 1274 UQ 1275 UQ 1276 UQ 1277 UQ 1278 UQ 1279 UQ 1280 UQ 1281 UQ 1283 UQ 1284 UQ 1285 UQ 1286 UQ 1287 UQ 1289 UQ 1290 UQ 1291 UQ 1292 UQ 1293 Location Wyreema Wyreema Wyreema Wyreema Wyreema Wyreema Wyreema Wyreema Wyreema Wyreema Wyreema Wyreema Wyreema Wyreema Wyreema Wyreema Wyreema Wyreema Wyreema Wyreema Gatton Gatton Gatton Gatton Gatton Gatton Gatton Gatton Gatton Gatton Gatton Gatton Gatton Gatton Gatton Gatton Gatton Gatton Gatton Gatton Infection Head Rot Head Rot Head Rot Head Rot Head Rot Head Rot Head Rot Head Rot Head Rot Head Rot Basal Stem Rot Basal Stem Rot Basal Stem Rot Basal Stem Rot Basal Stem Rot Basal Stem Rot Basal Stem Rot Basal Stem Rot Basal Stem Rot Basal Stem Rot Head Rot Head Rot Head Rot Head Rot Head Rot Head Rot Head Rot Head Rot Head Rot Head Rot Basal Stem Rot Basal Stem Rot Basal Stem Rot Basal Stem Rot Basal Stem Rot Basal Stem Rot Basal Stem Rot Basal Stem Rot Basal Stem Rot Basal Stem Rot a All of these isolates have a suffix to indicate three isolates were collected from each plant e.g. UQ 1261-1, UQ 1261-2 and UQ 1261-3 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 81 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ 5.2.3 Inoculation Procedure Three mm mycelial plugs were cut from the growing edge of the colony after 2 days growth on V8 agar, and were placed against the stem of the sunflower plant equidistant between the first and second internodes, with the mycelium facing the stem. The stem and mycelial plug were wrapped in Parafilm for 48 hours to preserve humidity, following the method of Price and Colhoun (1975b). The lesions were then measured daily for 2 days starting 72 hours post inoculation. The plants were arranged in a completely randomized design, with four replicate plants per isolate. 5.2.4 Statistical Analysis The lesion lengths were measured three days (Day 1) and four days (Day 2) post inoculation, and the rate of lesion extension was calculated from the difference between the two measurements (i.e. Day 2 - Day 1). Day 1 was the first day that the majority of the lesions were evident. A one way analysis of variance (ANOVA) was used to compare the lesion length for isolates on Day 1 and Day 2 and the rate of lesion expansion between Days 1 and 2 for each experiment. The controls were not included in any of this analysis as all of the controls survived without symptoms and inclusion of zero lesion measurements would cause a change to the variance as indicated by Pratt and Rowe (1995). Two way ANOVAs were carried out comparing the two experiments for Day 1 and Day 2, and for the difference between the days. Multiple comparison tests were conducted following significant differences from the variance ratio (F) within ANOVAs. The multiple comparison tests compared were: Fisher‟s Protected Least Significance Difference (FLSD or PSD), Scheffe Significance Difference (SSD), Student Newman Keuls (SNK), Duncan‟s Multiple Range Test (DMRT) and Tukey Significance Difference (TSD or HSD). Direct comparison of isolate aggressiveness was explored with FLSD. ANOVA was carried out using Microsoft Excel, Statistica (Statsoft Inc.) and Minitab (Minitab Inc.). Multiple Comparison tests were carried out using Statistica. Rank ordering was carried out using Microsoft Excel and SigmaPlot (Jandel Scientific). Linear regression was carried out using Microsoft Excel and Statistica. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 82 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ 5.3 RESULTS Lesions formed and progressed rapidly up and down the sunflower stem as shown in Figures 5.1 and 5.2. Lesion length measurements for all replicate and mean lesion lengths of the 120 isolates for both experiments over two days are listed in Appendix 1. Mean lesion lengths of same plant isolates are listed in Appendix 2. Figure 5.1 Sunflower plant inoculated with S. sclerotiorum isolate UQ 1346-2. Note the Parafilm at the centre of the stem from which the lesion spread. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 83 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ Figure 5.2 Lesion on a sunflower stem following inoculation with a mycelial plug of S. sclerotiorum. The lesion is displaying both bleached girdling and water soaking around the inoculation point. The tissue damage is obvious by the breakage of the stem at the point of weakness. 5.3.1 Analysis of Isolate Pathogenicity Testing Lesion lengths were measured on Day 1 and Day 2 and the rate of lesion extension calculated from the difference between the two measurements. These results were compared between replicate experiments to determine which measurements were most reproducible for comparison of aggressiveness of isolates. Over the two repeat inoculation experiments, lesion lengths of all isolates varied between 0 and 85 mm for Day 1 and 0 and 153 mm for Day 2, with the rate of extension between Day 1 and Day 2 varying from 0 to 117 mm. Analysis of variance comparing the results for the two inoculation experiments are shown in Table 5.2. The differences in lesion length on Day 1 between the two experiments were not significant, whereas Day 2 measurements and the rate of lesion extension were significantly different (P<0.05). This demonstrated a lack of repeatability at this stage of the disease development. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 84 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ Table 5.2 ANOVA between inoculation experiments for both Day 1, Day 2 and rate of lesion extension. Source of SS Variation Day 1 18.98 Day 2 11921.55 Rate 12862.70 df MS F P-value F crit 1 1 1 18.98 11921.55 12862.70 0.06 11.38 39.38 0.805 0.001 0.000 3.85 3.85 3.85 5.3.2 Comparison of Multiple Range Tests to Assess Significant Differences Between Aggressiveness Multiple range tests were compared to select the best statistical method to separate aggressiveness of the isolates. Day 1 assessments were shown by ANOVA in Section 5.3.1 as the most reproducible interval for assessing aggressiveness. Consequently, comparison of multiple range tests has been conducted on Day 1 lesion lengths for experiments 1 and 2. For the 120 S. sclerotiorum isolates, the following multiple comparison tests were conducted: SSD, HSD, SNK, DMRT and FLSD, after analysis of variance between isolates. Statistically significant differences (P<0.05) between individual isolates and same plant isolates were found by HSD, SNK, DMRT and FLSD, but not SSD (Table 5.3). The multiple comparison tests vary enormously in their results from SSD where no significant interactions were found, to DMRT and LSD where every isolate demonstrated significant differences from at least one other isolate. For each multiple comparison test used, the trend of significantly different interactions for individual isolates reflected the frequency for same plant isolates. The multiple comparison tests formed a similar increasing scale of the number of significant differences in aggressiveness detected between isolates for both experiments, in the following order: SSD<HSD<SNK<DMRT<FLSD. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 85 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ Table 5.3 Number of significant differences in aggressiveness detected between individual isolates and between same plant isolates, and the number of significant interactions between those individual isolates and same plant isolates using different multiple comparison tests Source of Variation Isolates Exp 1 Isolates Exp 2 Interactions Exp 1 Interactions Exp 2 SSD 0 0 0 0 HSD 80 40 274 76 SNK 95 43 313 87 DMRT 120 120 1121 814 FLSD 120 120 2291 1640 Same plant isolates Exp 1 Same plant isolates Exp 2 Interactions Exp 1 Interactions Exp 2 0 0 0 0 12 9 27 8 12 9 29 8 40 40 164 128 40 40 252 225 To visualize the difference that the different multiple comparison methods can produce, all the multiple comparison procedures compared are displayed in Figure 5.3 A, B, C, D and E for Experiment 1 Day 1 results. Isolates have been displayed on the basis of whether or not their lesion length differs significantly from that of the most aggressive isolate UQ 1276-3. 8 0 7 0 6 0 5 0 MeanLesionLegth(cm) 4 0 3 0 2 0 1 0 11132327850---2 11122288777---11 111322477745---213 11113323482608----213 111222869030---3 11112222968933----3 111122339644342----3 111122227786980----111 11112322899300----13 111323472266--11112233962257----1 11112323727498----11 11113323428936----1111 1113238446---12 1111222289779----1333 11112323849564----1112 111132222686673----331 111132238744946----3 111222878346---3 1111223288475579----31 11113323284697----13 1111323372587----2111 1112327970---21 11113333444826----221 1111223387460----11 111122229688394----111 111123227266894----31 111232777---33 111132324686----231 111122239784648----113 111123238272475----1 1111223376228457----11 1276-3 0 S i g n i f i c a n t l y d i f f e r e n t N o t s i g n i f i c a n t l y d i f f e r e n t I s o l a t e s Figure 5.3 A. Fisher‟s Protected Least Significant Difference (FLSD) _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 86 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ 8 0 7 0 6 0 5 0 4 0 MeanLsionLegth(cm) 3 0 2 0 1 0 I s o l a t e s 111133222780857----2 11122387477---2 11112233774546----32 111232828080---3 111222696303---3 11112222899634----33 11123394432--111122227786980---1113228903---3 1111322349722066---1112236925--11113322227797---11133342489--1111323288634---1113224986---23 111122327748965----33 111232964---23 1111232282687639----3 11132374446---3 111222878346---3 1111223288475579----3 1113322869---3 11112333742578----2 111323777---2 111132334944082----22 1113227866--1111332246903---111223882949--11112222676784----33 111322767---33 1111332248766----2 11122398448---3 111123238272475---111223672485--11237267--3 0 S i g n i f i c a n t l y d i f f e r e n t N o t s i g n i f i c a n t l y d i f f e r e n t Figure 5.3 B. Duncan‟s Multiple Range Test (DMRT) 8 0 7 0 6 0 5 0 4 0 MeanLsionLegth(cm) 3 0 2 0 1 0 I s o l a t e s 11133227805---2 111122238874777----2 11122377445---3 11132382608---23 1111222268963003----3 1112229893---3 11122369443---3 1111232274788290---1112326803--111122329947026----3 1113222696--111333222579--11112233774289---1113234836--1111233284946----23 1112228779---33 11132248965--11112332628467----323 11122368394--1111322247876434----3 111222888655---33 111323472796--11112332847975----3 111333287---2 1112327970---2 11113333444826----22 1112237860--11112322649839---111232827498---3 1112226674---3 111123237647----332 1113228766--111122338942487----3 11122387245--111223672485--11237267--3 0 S i g n i f i c a n t l y d i f f e r e n t N o t s i g n i f i c a n t l y d i f f e r e n t I s o l a t e s Figure 5.3 C Student Newman Keuls (SNK) 8 0 7 0 6 0 5 0 4 0 3 0 2 0 1 0 0 S i g n i f i c a n t l y d i f f e r e n t N o t s i g n i f i c a n t l y d i f f e r e n t Figure 5.3 D Tukey Significance Difference (HSD) _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 87 111133222780857----2 11122387477---112 11112233774546----3112 111232828080---3 111222696303---3 11112222899634----33 11123394432--111122227786980----111 1113228903---13 1111322349722066---1112236925---1 11113322227797----1 11133342489---111 1111323288634----111 1113224986---231 111122327748965----3311 111232964---123 1111232282687639----31 11132374446---3 111222878346---3 1111223288475579----31 1113322869---13 11112333742578----121 111323777---12 111132334944082----2121 1113227866---11 1111332246903----11 111223882949---1 11112222676784----313 111322767---33 1111332248766----121 11122398448---13 111123238272475----1 111223672485---1 11237267--31 MeanLesionLegth(cm) Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ 8 0 7 0 6 0 5 0 MeanLsionLegth(cm) 4 0 3 0 2 0 1 0 11133227805---2 111122238874777----2 11112233774546----32 1111322228868003----3 11122299603---3 11122289634---33 11123394432--111122227786980---11112322899300----3 111123327426626---111132332922579---1112327478--11133224893--111332864--1111232294876----323 111132224789695----3 11112332628467----323 11123268349--111232748463---3 111222788465---3 1111322348727596----3 11112332847975----3 111133322787----2 11112333944078----222 1113234726--1112338460--11122269839--111132222876948----3 1111223276747----33 111132324686----23 11122278964---3 111332428874--11123272654--1111323227275876----3 0 I s o l a t e s S i g n i f i c a n t l y d i f f e r e n t N o t s i g n i f i c a n t l y d i f f e r e n t Figure 5.3 E Scheffe Significance Difference (SSD) Figure 5.3 The isolates with aggressiveness significantly different from and not significantly different from the most aggressive isolate UQ 1276-3 in Experiment 1 Day 1 for each multiple comparison test. A: Fisher‟s Protected Least Significant Difference (FLSD), B: Duncan‟s Multiple Range Test (DMRT), C: Student Newman Keuls (SNK), D: Tukey Significance Difference (HSD), E: Scheffe Significance Difference (SSD). 5.3.3 Aggressiveness of Isolates As a quantitative measure of aggressiveness, lesion length measurements of all 120 isolates showed significant differences for both inoculation experiments, and on both assessment days (Table 5.4). Multiple comparison tests were used to compare different methods for separating the isolates. Differences in F values between the two experiments also highlights a general trend between the two experiments which was that the lesions developed faster in Experiment 1. Table 5.4 ANOVA between isolates for both experiments for Day 1, Day 2 and rate of lesion extension. Source of Variation Exp 1 Day 1 Exp 1 Day 2 Exp 2 Day 1 Exp 2 Day 2 Exp 1 Rate Exp 2 Rate SS df MS F P-value F crit 96856 370679 63331 169955 102600 40448 119 119 119 119 119 119 813.9 3115.0 532.2 1428.2 862.2 339.9 4.23 4.76 2.75 2.26 3.44 1.54 3.5E-26 1.4E-30 1.8E-13 3.3E-09 1.9E-19 1.3E-03 1.27 1.27 1.27 1.27 1.27 1.27 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 88 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ Rank ordering of the isolates for Experiment 1 Day 1 (Figure 5.4) shows isolates forming a smooth increasing curve (r=0.96). A similar curve also results if the isolates from Experiment 2 Day 1 are rank ordered (Figure 5.5) (r=0.97). However, if the same rank order for Experiment 1 Day 1 is used to rank the isolates for Experiment 2 Day 1 (Figure 5.6), the uniformity displayed in Figures 5.4 and 5.5 is lost (r=0.30). Comparing Figures 5.4 and 5.6 displays the lack of consistency between the experiments with measured aggressiveness of the isolates varying greatly between the experiments. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 89 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ 8 0 7 0 6 0 5 0 4 0 3 0 Mean Lesion Length (cm) 2 0 1 0 1328-1275-1330-222 1287-1277-1287-211 1274-1347-1275-1344-1231 1336-1280-1328-233 1280-1263-1290-233 1263-1291-1281-223 1293-1264-1293-332 1343-1342-1278-331 1279-1280-1261-112 1330-1283-1292-123 1290-1342-1276-222 1326-1262-1292-312 1325-1329-1327-333 1271-1348-1277-112 1329-1283-1343-111 1336-1281-1334-121 1346-1281-1291-213 1271-1346-1279-313 1285-1334-1292-121 1261-1287-1326-332 1263-1334-1289-132 1274-1283-1346-333 1274-1285-1286-223 1285-1279-1347-321 1333-1326-1289-1347-3133 1275-1333-1328-121 1337-1271-1337-122 1290-1343-1348-122 1342-1336-1272-131 1286-1330-1344-133 1261-1293-1289-111 1284-1329-1278-223 1262-1264-1277-213 1337-1272-1262-333 1344-1286-1333-221 1276-1284-1291-131 1348-1284-1327-312 1272-1264-1325-222 1278-1327-1325-211 1276-3 0 I s o l a t e s Figure 5.4 Rank ordered mean lesion length Experiment 1 Day 1. (r=0.96 at P=0.05). (ANOVA F=1402.24 with P=2.46E-67.) 8 0 7 0 6 0 5 0 4 0 3 0 Mean Lesion Length (cm) 2 0 1 0 11133342038---212 111223882578---223 11123384707---113 1111322248888936----1322 111222776594---113 11123279960---333 111222868111---211 111232826063---122 111222868610---123 11123384537---332 11132247779---122 111222877945---112 111222696114---312 1113234624---331 11123287461---223 111322497832---333 11123384269---323 111333244978---222 11132246820---122 111222699302---313 11133322937---131 111222687495---123 1111323227475168----1121 111222796223---221 111332248625---111 11133342037---322 111222789832---231 111222789670---132 111323282745---313 111222877164---322 111232947366---133 11122377814---323 1113334274---312 11133249661---112 1112227772---113 111223784442---332 11123296172---331 111233922358---221 1112338333---121 1326-3 0 I s o l a t e s Figure 5.5 Rank ordered mean lesion length Experiment 2 Day 1. (r=0.97 at P=0.05). (ANOVA F=1689.03 and P=9.11 E-72). 8 0 7 0 6 0 5 0 4 0 3 0 2 0 0 1 0 I s o l a t e s Figure 5.6 Mean lesion length Experiment 2 Day 1 rank ordered as for Experiment 1 Day 1. (r=0.30 at P=0.05)( ANOVA, F=11.71, P=0.0009). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 90 111133222780857----2222 11122387477---112 11122377445---131 11132382608---233 111222869030---233 111222698311---223 111222969343---332 111332447328---331 111222786901---112 11132298023---132 111223974062---222 111322296622---321 111333222597---333 11123274718---112 111323284933---111 1113238614---121 111322489611---213 111232747169---313 11123289542---121 111223682176---332 11123268349---132 111223784436---333 111222788456---223 111223874597---321 111133232843697----3133 11123372538---121 1113237717---122 111233944038---122 11133247262---131 1112338460---133 111222698139---111 111232827498---223 11122266724---213 11132276722---333 1113324836---212 111222798614---113 111332428874---321 111232726254---222 111233722857---211 1276-3 Mean Lesion Length (cm) Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ To visually demonstrate some of the significant differences in aggressiveness revealed between the isolates a few representative figures have been included i.e. of the most aggressive and least aggressive isolates. The most aggressive isolate (UQ 1276-3) in Experiment 1 and all the isolates significantly different in aggressiveness are shown in Figure 5.3. Every isolate caused lesions on sunflower stems except UQ 1328-2, UQ 1328-3, UQ 1330-2 and UQ 1285-2. The two least aggressive isolates in Experiment 1 (UQ 1328-2 and UQ 1330-2), had zero lesion growth, and are significantly different from most isolates, using FLSD (Figure 5.7). 8 0 7 0 6 0 5 0 MeanLesionLegth(cm) 4 0 3 0 2 0 1 0 11133227805---2 11122288777---11 111123237474475----1231 111123328280680----32 111122229669033----3 111122229869343----33 111133224477289----11 11112232688003----11 111122329947026----3 11112323629265----1 11113322227797----1 111133322448983----1111 1111332384466----112 1111222289779----1333 11112323849564----1112 111132222686673----331 111132238744946----3 111222878346---3 1111223288475579----31 11113323284697----13 1111323372587----2111 1111322379470----212 11113332447286----121 1111323284606----11 1111222389829349----11 11112222676784----313 111123237647----332 1111232287966----111 1111323248288474----31 111132222767548---111332227756---113 0 S i g n i f i c a n t l y d i f f e r e n t N o t s i g n i f i c a n t l y d i f f e r e n t I s o l a t e s Figure 5.7 Isolates significantly different from the least aggressive isolate UQ 1328-2 in Experiment 1 Day 1, FLSD (P=0.05). Aggressiveness was not specific for location or initial mode of infection where the isolate was collected (i.e. head rot or basal stem rot) (Table 5.5). Isolates that were collected from head rots originated from ascospore infection and thus apothecial germination from sclerotia are capable of causing infections from mycelium directly on stem tissue, without prior wounding. Neither of the locations from which the isolates were collected in combination with either mode of infection, were significantly different. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 91 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ Table 5.5 ANOVA between isolates for location and mode of infection (head rot or basal stem rot). Source of Variation Location Location Mode of infection Mode of infection Location using heads Location using heads Location using basal stem rots Location using basal stem rots Modes at Gatton Modes at Gatton Modes at Wyreema Modes at Wyreema Experiment Exp 1 Day 1 Exp 2 Day 1 Exp 1 Day 1 Exp 2 Day 1 Exp 1 Day 1 Exp 2 Day 1 Exp 1 Day 1 Exp 2 Day 1 Exp 1 Day 1 Exp 2 Day 1 Exp 1 Day 1 Exp 2 Day 1 SS 196.4 0.1 9.4 120.0 209.1 432.0 28.7 410.8 45.1 799.3 5.7 163.3 df 1 1 1 1 1 1 1 1 1 1 1 1 MS 196.4 0.1 9.4 120.0 209.1 432.0 28.7 410.8 45.1 799.3 5.7 163.3 F 0.57 0.00 0.03 0.43 0.49 1.56 0.11 1.48 0.12 2.83 0.02 0.60 P-value F crit 0.45 3.86 0.98 3.86 0.87 3.86 0.51 3.86 0.49 3.88 0.21 3.88 0.74 3.88 0.23 3.88 0.73 3.88 0.09 3.88 0.90 3.88 0.44 3.88 5.3.4 Aggressiveness of Same Plant Isolates Isolates that were collected from the same plant (e.g.. UQ 1261-1, UQ 1261-2 and UQ 1261-3), were grouped together, as they most likely represent identical isolations of the same infection unit, despite differences in aggressiveness between the individual isolates in the previous section (Section 5.3.3). Significant differences were also evident between isolates at both inoculation experiments and days (Table 5.6). The results are similar to those in Table 5.4 indicating that there are isolates which can be regarded as having different aggressiveness to other isolates. However, despite what appears to be significant differences between the same plant isolates, the large standard deviations (Figure 5.8) indicate that the majority of same plant isolates are not actually significantly different. The lack of repeatability of the experiments as outlined in Section 3.3, indicates the unsuitability of assuming isolates obtained from the same plant exhibit the same level of aggressiveness. Rank ordering of the mean lesion lengths of all isolates from the same plant for Experiment 1 Day 1 (r=0.97) and Experiment 2 Day 1 (r=0.98) both produced straight lines. However, correlation is lost if both experiments use the same rank ordering (r=0.47). This result is very similar to that obtained for individual isolates. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 92 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ Table 5.6 ANOVA between isolates from different plants for both experiments and days. Source of Variation Exp 1 Day 1 Exp 1 Day 2 Exp 2 Day 1 Exp 2 Day 2 SS df MS F P-value F crit 40820.6 159455.0 27295.4 67837.8 39 39 39 39 1046.7 4088.6 699.9 1739.4 3.67 4.03 2.91 2.32 1.4E-11 2.9E-13 5.3E-08 2.3E-05 1.43 1.43 1.43 1.43 Lesion measurements for the between experiments analysis of same plant isolates are identical to those created for the individual isolates, producing the same ANOVA results (Table 5.2). This again demonstrates that Day 1 was the best day for analysis, whilst the rate of lesion expansion between the two days had more differences between experiments. Replicates of the isolates show non-significant differences when grouped into the same plant isolates (P<0.7). Significant differences were found between same plant isolates. However, there was a large amount of overlap between the significant differences of most of the same plant isolates. Thus preventing the separation of same plant isolates into discrete groups of differing aggressiveness. There were significant differences between isolates collected off the same plant e.g. UQ 1276 (Table 5.7) and UQ 1291 (Table 5.8), but only in Experiment 1. This result is very similar to the significant differences found among individual isolates which were continuous and prevent discrete separation. Table 5.7 ANOVA between same plant isolates of UQ 1276 for both experiments. Source of Variation Exp 1 Day 1 Exp 2 Day 1 SS df MS F P-value F crit 5104.7 27.2 2 2 2552.3 13.6 29.75 0.14 0.0001 0.8728 4.26 4.26 Table 5.8 ANOVA between same plant isolates of UQ 1291 for both experiments. Source of Variation Exp 1 Day 1 Exp 2 Day 1 SS df MS F P-value F crit 2114.7 873.5 2 2 1057.3 436.7 8.20 3.33 0.0094 0.0830 4.26 4.26 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 93 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ 1 0 0 8 0 6 0 MeanLesionLegth(cm) 4 0 2 0 112328870 113276850 1122997304 112334628 1123234796 11232746 1132324895 112364987 1132287648 1123782647 5 0 S a m e P l a n t I s o l a t e s M e a n L e s i o n L e n g t h Figure 5.8. Mean lesion lengths with standard deviation for 120 isolates grouped into 40 same plant isolates from Experiment 1 Day 1. 5.3.5 Aggressiveness of Genotypes The 120 isolates were separated into 13 genotypic groups identified using mycelial compatibility groups (Chapter 6). Aggressiveness between these genotypes was compared for both experiments and both days (Table 5.9). Although there were large differences between the genotypes, the large standard deviations (Figure 5.9) indicate that the majority _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 94 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ of genotypes are not significantly different. The three isolates of UQ 1291 in Section 5.3.4 (Table 5.8) was an example of two different genotypes affecting the same plant. If genotypes were specific for aggressiveness the differences would be apparent, unless the genotypes had similar levels of aggressiveness. For example the differences were not significant between UQ 1291-1 and, -3 and UQ 1291-2. The lack of repeatability of the experiments as outlined in Section 5.3.3, indicates the unsuitability of using genotypes to separate aggressiveness. Other genotypic groupings identified by single and multicopy RFLPs and RAPDs (Chapter 6) were also compared to, but were found not to be consistent with aggressiveness. Table 5.9 ANOVA between genotypes groups as based on results in Chapter 6 for both experiments and days. Source of Variation Exp 1 Day 1 Exp 2 Day 1 Exp 1 Day 2 Exp 2 Day 2 SS df MS F P-value F crit 20447.68 11574.77 73279.47 28528.29 12 12 12 12 1703.97 964.56 6106.62 2377.36 5.47 3.71 5.35 3.01 9.24E-09 2.28E-05 1.6E-08 0.000443 1.78 1.78 1.78 1.78 1 0 0 8 0 6 0 MeanLsionLegth(cm) 4 0 2 0 0 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3 G e n o t y p e s M e a n L e s i o n L e n g t h Figure 5.9 Mean lesion lengths with standard deviation for 120 isolates from Experiment 1 Day 1 grouped into 13 genotypes as based on MCGs (Chapter 6). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 95 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ 5.4 DISCUSSION Inoculations were carried out using standardized procedures to remove as many sources of variation that could not be attributable to differences amongst the isolates. Plants of Hysun 36, very similar in height and stem diameter, and of the same age, were inoculated to minimize host effects. The importance of testing against the host at the growth stage at which it is normally attacked has been noted in other host pathogen interactions (Ballinger and Salisbury 1996). The inoculations were also carried out at identical times for all experiments to minimize any effects the age of the sunflower plant may have on the experiments (Bazzalo et al. 1985; Pierre and Regnault 1982). The environmental conditions were optimized for the development of the pathogen. Altering the conditions to those less suitable for the pathogen may allow better discrimination between isolates, but it may also apply pressure to different components of the infection process. Light, temperature and moisture conditions were carefully controlled throughout all experiments. The cultures were of the same age and stored under liquid nitrogen to ensure viability. The reduction of time taken to inoculate and assessment of lesion development would also be advantageous for minimizing errors (Scott 1984), however the sample size prevented any further reduction in these times. 5.4.1 Pathogenicity Testing Methods The rate of lesion development increases as the disease develops. Previous research (Ekins 1993) found that the rate of lesion advancement of S. sclerotiorum on sunflower stems was increasingly rapid 5 days after inoculation. The results from this pathogenicity test indicate that assessment is more reliable and precise 3 days (Day 1) after inoculation than after 4 days (Day 2), or than the rate (Day 2 - Day 1) of lesion development. Measurement of lesion length after 2-3 days does not directly measure the time difference between inoculation and the first appearance of the symptom. However, this latter parameter has previously been regarded as unreliable for inoculated stems as a measure of pathogenicity (Ekins 1993; Sedun and Brown 1989). Days of assessment may produce different aggressiveness reflecting certain infection phases of the pathogen (Thuault and Tourvieille 1988). The consistency of the lesion length measurements may make it suitable for resistance screening, as well as aggressiveness screening of Sclerotinia isolates. Lesion _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 96 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ length has been used by Bazzalo et al. (1991), Sedun and Brown (1989) and Ekins (1993) as a reliable characteristic for pathogenicity testing. It has also been used on other plants such as peanuts (Arachis hypogaea) (Brenneman et al. 1988; Melouk et al. 1992), canola (Brassica napus L.) (Errampalli and Kohn 1995), and Brassica spp. (Sedun and Brown 1989). Screening of aggressiveness between isolates would be best conducted prior to use in resistance screening to ensure that hypovirulent isolates were not used in resistance screening. The use of multiple isolates would also be beneficial for resistance screening programs not only to ensure aggressive isolates are tested but also to screen against other genotypic traits of the pathogen, as the resistance mechanism may be independent for each mode of infection (Vear and Tourvieille 1984). 5.4.2 Statistical Methods The range of statistical differences between lesion lengths for different isolates depends on the multiple comparison method used. The number of isolates whose mean lesion length was significantly different decreased for the multiple comparison methods in the following order FLSD>DMRT>SNK>HSD>SSD. Chew (1976) and Madden et al. (1982) also found the same order of statistical methods. Caution should therefore be taken in the choice of a multiple comparison test when comparing this type of data as it has a significant effect on the outcome of the results. FLSD was chosen to compare the aggressive levels amongst S. sclerotiorum isolates as recommended by Carmer and Swanson (1973) and Madden et al. (1982), to protect against both Type I and Type II errors. A Type I error occurs when the hypothesis is rejected when it is true, whilst a Type II error is acceptance of a false hypothesis. Multiple comparison methods test for significance, by ensuring the difference between any two means has to be more than the calculated critical value. Most multiple comparison tests reduce the possibility of type I errors, i.e. they become less sensitive by increasing the difference required for means to be significantly different from each other depending on the number of means in the experiment. Madden et al. (1982) and Gilligan (1986) both agree that to reduce type I error, such as having to avoid weak differences then use SSD, SNK and HSD. To pick real differences (i.e. type II error is more serious), Madden et al. (1982) recommend: FLSD and DMRT but preferably not LSD, SSD, HSD and SNK. SSD and HSD are too conservative (Carmer and Swanson 1973; Gilligan 1986; Swallow 1984). SSD are more useful for comparisons between means with unequal _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 97 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ replications and unequal groups of means and is best used for making comparisons suggested by the data, when the omission of a type I error would have devastating consequences (Gilligan 1986). Multiple comparison tests used for separating aggressiveness in Sclerotinia species include DMRT (Brenneman et al. 1988; Pratt et al. 1988; Pratt and Rowe 1995; Sedun and Brown 1989), LSD (Mancl and Shein 1982) and SSD (Errampalli and Kohn 1995). In both experiments reported here SSD did not separate any of the isolates, HSD and SNK produced conservative results and tended to group all isolates together, whilst DMRT and FLSD separated the isolates. If the data here are analysed using SSD tests it can be concluded that none of the isolates are significantly different and thus there are no differing levels of aggressiveness in Sclerotinia. However, if any other method besides SSD, e.g. HSD, SNK, DMRT or FLSD is used, then there are significant differences between isolates. Detection of the errors most likely to influence the experiment are important. The use of a conservative, a non-conservative and an intermediate method would provide the researcher with valuable insight into the significance of trends already detected in the data. 5.4.3 Aggressiveness of Isolates Significant differences were found amongst aggressiveness of the isolates. Rank ordering of aggressive abilities of the isolates revealed uniform increasing differences with good regression, which indicates that isolates are not uniform in their aggressiveness. The steep slopes at both extremes of the rank orders for individual isolates (Figure 5.4 and Figure 5.5) indicates that only a few isolates are either highly aggressive or slightly aggressive most likely representative of a normal distribution. The appearance of some highly aggressive isolates or isolates of low aggressive abilities, could skew the results of research relying heavily on a small number of isolates e.g. Marciano et al. (1983). The sigmoidal curve immediately suggests the separation of aggressive abilities into three groups: highly, moderately and slightly aggressive. However, using significance testing (FLSD) the most and least aggressive isolates are significantly similar to a larger range of isolates eliminating a definite cut off point between aggressiveness levels (most obvious between _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 98 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ Figure 5.3 and Figure 5.7). Large overlaps exist over isolates that could otherwise be regarded as significant differences. Moreover, since non-significant differences exist over a wide range and are completely different for every isolate, then distinct aggressive groups cannot be separated. The region of non-significant differences increases with every other multiple comparison test from DMRT, SNK and HSD until SSD where all isolates belong to one very large group of the same aggressiveness. There is however insufficient evidence for the separation of isolates into distinct aggressive groups and the large overlap in aggressiveness combined with the differences in aggressiveness indicates that aggressiveness in S. sclerotiorum would be more appropriately described as a „continuum‟ of aggressiveness as suggested by Melzer and Boland (1996) and Morrall et al. (1972). The lack of significant differences amongst isolates of S. sclerotiorum agrees with previous work (Maltby and Mihail 1997; Price and Colhoun 1975b; Sedun and Brown 1989). The large overlaps of significant differences in aggressiveness found in this study is similar to the results of Riddle et al. (1991), who found a spread of S. sclerotiorum isolates in large overlapping groups across their aggressive scales (scored as weakly, moderately or highly aggressive), and significant differences between only a few isolates. Moreover differences between all of the aggressive scales were not significant. Repetition of the present experiment did reveal a lack of repeatability in aggressive abilities between the isolates, as has been found by others (Riddle et al. 1991). Furthermore, consistency of aggressiveness did not exist even for those isolates that were tentatively described as highly aggressive after the first experiment. This inconsistency as demonstrated in Figure 5.6, prevents separation into highly, moderate and weakly aggressive abilities. This was evident although the experiments were conducted only a week apart. The fact that rank ordering in Experiments 1 and 2 differed may imply that environmental effects are too great and cannot be controlled sufficiently to produce a consistent result for any isolate. The lack of correlation between experiments due to changes in aggressiveness (some isolates increased in aggressiveness and some decreased in aggressiveness) was also described by Pratt and Rowe (1995). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 99 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ Pratt et al. (1988) and (Errampalli and Kohn 1995) found significant differences in aggressiveness between isolates but were unable to replicate results between experiments. Researchers who have found differences have not provided the results of repeat experiments (Cappellini 1960; Keay 1939; Mancl and Shein 1982). Pratt and Rowe (1995) and Brenneman et al. (1988) found repeatable differences between isolates but usually only when working with a small number of isolates which may have been from the extremes of the continuum in aggressiveness. Grouping isolates into same plant isolates also found some significant differences in aggressiveness which showed an increasing scale of aggressiveness with a good regression for each rank ordered experiment. However grouping of the isolates from the same plant also suffered from a lack of correlation between the experiments. As was the case with individual isolates, there were also large overlaps between statistical significance of same plant isolates that initially appeared to be different. No association was observed between genotypic groups and aggressiveness and so it should be concluded that aggressiveness as tested by this method is not likely to be specific for genotypes. The majority of research that has found correlation between pathogenic variation and genetic variation has involved fungi with obvious racial structure (Goodwin et al. 1992; Goodwin et al. 1995; Levy et al. 1991). The averaging effect of same plant isolates meant isolates with high and low aggressive abilities were less apparent. This indicates that hypovirulence in this study is more likely to be a result of culturing and mycoparasites, than pathogenic differences. The most consistent feature of the repeated experiments was the appearance of isolates that have very low and almost non-aggressive abilities (UQ 1328-2 and UQ 1330-2). These isolates produced sclerotia sporadically in culture. Other isolates of low aggressive abilities were also present, such as UQ 1287-2 and UQ 1287-1, both of which were not significantly different from UQ 1328-2 and UQ 1330-2 in both experiments. There is too much overlap between the isolates to separate them into different pathogenic groupings. However some isolates may consistently express low levels of aggressiveness and hypovirulence may be a possible feature in Sclerotinia isolates (Errampalli and Kohn 1995; Pratt and Rowe 1995). The _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 100 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ reasons for these characteristics may however, be as simple as loss of aggressive abilities during culture storage (Mancl and Shein 1982; Morgan 1952; Pratt and Rowe 1995) and mycoparasite-induced hypovirulence (Held 1955; Mancl and Shein 1982; Melzer and Boland 1996). There were no apparent differences either in rank ordering or significance testing between individual isolates or same plant isolates obtained from different modes of infection (head or basal stem rots) either together or separately from one or both locations. Isolates that were collected from head rots originated from ascospore infection and thus apothecial germination from sclerotia are capable of causing infections from mycelium directly on stem tissue, without prior wounding. These ascospore derived isolates were no more or less aggressive than those originally derived from mycelially germinated sclerotia directly infecting roots and stems. Thus it appears that physiological specialization within S. sclerotiorum for a mode of infection is unlikely, and that S. sclerotiorum isolates are opportunistic in their mode of infection (and thus reproduction), depending rather, on environmental conditions. There were no significant differences in aggressiveness levels for the different locations (Gatton or Wyreema), indicating that differences in aggressiveness were widely distributed among these subpopulations (i.e. fields). The subpopulations were not specializing for aggressiveness and are more likely to be part of the same population. This is true when comparing all individual and same plant isolates collected from the one location as well as when the different modes of infection are compared between location only. The question of the effect of hypovirulence on the aggressiveness of the isolates needs to be resolved, and should follow on from the work of Melzer (1996). Competition between S. sclerotiorum and Trichoderma species could also be researched, in addition to interaction between these two fungi in culture and on plants. Research has begun on competition between genotypes of S. sclerotiorum (Maltby and Mihail 1997). Pathogenicity testing of the isolates across different hosts may indicate whether other crops will be useful as rotation crops. The idea that an isolate is related to the host in which it was collected from is not a new one, and due to the ubiquitous distribution and additional _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 101 Chapter 5: Aggressiveness among isolates of S. sclerotiorum from sunflower _________________________________________________________________________ saprophytic potential of the fungus, it is probably unlikely. Ekins (1993) showed that aggressiveness was not correlated to the host from which an isolate was collected. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 102 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ Chapter 6: Population Genetics of Sclerotinia sclerotiorum attacking sunflower in Australia 6.1 INTRODUCTION 6.1.1 Genetic Diversity Plant pathogen populations are continually evolving and adapting to changes in the environment. The adaptation of pathogens to changes in host populations is most apparent in agricultural systems where host monocultures place strong selection pressures on pathogens (McDonald 1997). Disease control measures should be aimed at the population as a whole rather than individual isolates. The differences in aggressiveness of individual isolates of S. sclerotiorum as discussed in Chapter 5 illustrates the need for a population approach to prevent a criterion such as aggressiveness evaluated from a single isolate being assumed to be representative of the entire population. Genetic diversity provides an indication of a pathogens ability to evolve and thus gives an indication of the effectiveness of potential control measures (McDonald and McDermott 1993). Genetic diversity can involve both gene diversity and genotypic diversity. Gene diversity calculated from allele frequencies may be derived from single copy RFLP probes. Gene diversity can provide indirect measures of population differentiation, genetic drift, gene flow and amount of sexual recombination. Single copy RFLP probes detect alleles at a locus and in addition can be combined to form multilocus haplotypes for detection of genotypes. Genotypic diversity describes the frequency and distribution of discreet genotypes and can be estimated from different genetic markers such as multicopy RFLPs and RAPDs that identify genotypes. Apart from genotypic markers there are also phenotypic markers. Mycelial incompatibility is one phenotypic marker and is identified by the inability of two isolates to fuse and form one colony. The converse compatibility, is the ability of two isolates to form a single colony. All isolates that are compatible with one another belong to the same mycelial compatibility group (MCG). All isolates belonging to the same MCG are also supposed to _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 103 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ be compatible with all other members of the same MCG. Failure for all members of an MCG to be equally compatible has been coined “nontransitivity” in S. sclerotiorum (Cubeta et al. 1997). Mycelial compatibility probably involves hyphal anastomosis and is not followed by hyphal lysis. This may be one component of vegetative compatibility (Kohn et al. 1990). However, Ford et al. (1995) were able to produce heterokaryons from auxotrophic cultures of S. sclerotiorum but found no direct correlation between VCGs and MCGs. Incompatible mycelial interactions have been observed between different species of Sclerotinia (Loveless 1951; Tariq et al. 1985; Wong and Willetts 1975b). After the realization that such mycelial interactions were indicative of the genetic distance between isolates (Wong and Willetts 1975b), intraspecific variation has been explored in S. sclerotiorum (Ford et al. 1995; Kohn et al. 1990; Kohn et al. 1991; Maltby and Mihail 1994), S. minor (Melzer and Boland 1996; Patterson and Grogan 1984b) and S. trifoliorum (Rehnstrom and Free 1993). MCGs are thought to be controlled by alleles at several loci (Kohn et al. 1991). Rehnstrom and Free (1993) indicated that incompatibility in S. trifoliorum was controlled by at least three genes. 6.1.1.1 Distribution of Genetic Diversity Within Populations Studies on population genetics of plant pathogen populations require sound sampling methods. Determining the distribution of genetic diversity within populations during a pilot study is necessary to design an effective full scale sampling system. Initially, a pilot sample should be undertaken to determine the smallest unit of genetic diversity. This prevents unnecessary resampling of the same isolate and also ensures that many genotypes are not missed if multiple genotypes occur within a sample unit e.g. a single fruiting body, a lesion (McDonald and Martinez 1990) or a plant (Milgroom et al. 1991). McDonald et al. (1995) and McDonald (1997) give examples of hierarchical sampling strategies useful for pilot studies in foliar and soilborne fungi respectively. Much of the work on genetic diversity studies in plant pathogens has involved collecting a few isolates from different states or countries, whilst providing some information on genetic diversity on a country or worldwide scale; these collections may not be representative of diversity at each location and are not suitable for population genetic studies. Chen et al. (1996) identified 617 genotypes from 673 isolates of Mycosphaerella graminicola from a single field. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 104 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ 6.1.1.2 Distribution of Genetic Diversity Between Populations Once pilot studies have determined the smallest unit of genetic diversity, then hierarchical sampling can be carried out on a larger scale. This may include fields in a district, districts within a state, between states and even countries. Comparisons of genetic diversity between different populations can also determine whether migration (gene flow) or genetic drift are occurring. Measures of differences can be either direct following the movement of genotypes, or indirect tracking changes in allele frequencies. Genetic similarity between separated populations indicates a recent separation or that gene flow is occurring between such populations; depending on the level of similarity the populations could even be described as a single population. This was shown to be the case for populations of M. graminicola collected in different areas of the United States, where gene diversity in the areas was very similar, but no identical genotypes were common (Boeger et al. 1993). On a worldwide scale the genetic diversity of M. graminicola was found to be similar indicating gene flow around the planet (McDonald et al. 1995). Thus the definition of a population may be more complicated than simply describing all individuals within a field. Keller et al. (1997b) also found high gene diversity in all fields and wheat cultivars of Phaeosphaeria nodorum which were sampled in Switzerland, indicating a single population despite the lack of common genotypes. When the Swiss populations were compared to those in the United States there was also little evidence for subdivision of the populations, despite the lack of direct measures i.e. common genotypes (Keller et al. 1997a). 6.1.1.2.1 Temporal Differences Populations have been compared over time, usually to determine if successive crops are affected by successive waves of pathogen genotypes, or the same resident population. Chen et al. (1994) found that populations of M. graminicola were not subdivided into subpopulations either over the course of a season or over several years despite the lack of common genotypes over the years which is indicative of an outbreeding sexual population. However, Kohli et al. (1995), by using genotypic data on the sexual and inbreeding _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 105 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ S. sclerotiorum in Canada, found common genotypes carrying over between years, indicating a mixture of resident and immigrant ascospores. Temporal changes in the pathogen population are influenced by the control measures in use on a local scale (such as resistant cultivars), but are also heavily dependent on the mode of dispersal and thus the different reproductive strategies of the pathogen. The course of a disease and recolonization depends on the ability of the pathogen to cause disease as well as survival structures such as sclerotia, and the production of asexual conidia or sexual spores such as ascospores. 6.1.2 Production and Maintenance of Diversity The reproductive strategy of an organism will have an impact on its population biology. Population structures in micro-organisms usually lie between clonality and panmixia (random mating). The presence of sexual structures usually indicates an organism that will reproduce sexually. However, the organism may reproduce via inbreeding homothallic sexual means, instead of heterothallic outbreeding methods. Sexual reproduction involves meiosis, recombination and independent assortment and thus increases genotypic diversity and random association of alleles. Burdon et al. (1985a) found greater genotypic diversity amongst sexual populations of Puccinia graminis f. sp. tritici than amongst asexual populations. Asexual reproduction results in genetically identical offspring resulting in a clonal population structure (Milgroom 1996). However the definition of clonality in microorganisms has changed from genetically identical individuals to genetically similar individuals derived from common ancestors without recombination (Errampalli and Kohn 1995; Maynard Smith 1995). Recovery of the same genotype in plant pathogens has been used as evidence of clonal structure (Goodwin et al. 1994; Kohli et al. 1992; Levy et al. 1991). Demonstration of a clonal structure requires proof of deviation from random assortment along with the exclusion of other causes that may make the population appear as panmictic. These include drift, selection, population mixture (sampling problem), epidemic population structure and epistatic fitness (Maynard Smith et al. 1993; Milgroom 1996). There are several characteristics which may indicate a clonal population: (1) absence of recombinant genotypes (Maynard Smith et al. 1993), (2) absence of fertile sexual structures with the exception of strict inbreeding (Milgroom 1996), (3) the frequent recovery of common genotypes in different geographic locations (Kohn 1995), (4) repeated temporal _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 106 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ recovery of common genotypes (Kohn 1995), (5) correlation between independent markers, i.e. neutral genetic markers and phenotypic markers (Kohn 1995; Milgroom 1996; Taylor et al. 1999), (6) high linkage disequilibrium (Milgroom 1996), (7) significant multilocus association (Milgroom 1996), and/or (8) low genotypic diversity compared to gene diversity (McDonald 1997; Milgroom 1996). In order to draw meaningful conclusions from indirect measures such as gametic disequilibrium, clonal correction of data is important to remove bias from the sample by not including resampling of the same genotype. Initial studies of two populations of M. graminicola collected under different sampling regimes (Boeger et al. 1993) revealed one population to be at equilibrium whilst the other population showed significant disequilibrium until clonally corrected to allow for over-sampling error (McDonald et al. 1995). Similarly, clonal correction of S. sclerotiorum populations meant that the percentage of corrected significant associations between pairs of fragments in linkage disequilibrium tests dropped from 77.5% to 29.3% (Kohli and Kohn 1998). 6.1.3 Sclerotinia sclerotiorum S. sclerotiorum is a homothallic sexually reproducing fungus (Chapter 3) which has been described as engaging in clonal reproduction (Kohli et al. 1995; Kohli et al. 1992; Kohn et al. 1991). The predominant means of reproduction of S. sclerotiorum in sunflower is via the asexual formation of sclerotia, in contrast to most host species where most reproduction is conducted through sexual ascospores. Initial studies on the sexual stage of S. sclerotiorum showed a lack of recombination when sibling ascospores of field collected apothecia were studied (Kohli et al. 1995; Kohli et al. 1992; Kohn et al. 1991). Subsequent studies have indicated that outcrossing can occur in apothecia (Kohli and Kohn 1998; Kohn 1995). Indirect measures of random association of loci (Kohli and Kohn 1998) and the formation of heterokaryons (Ford et al. 1992; Ford et al. 1995) also indicate that recombination is involved in population structure of S. sclerotiorum. Evidence for clonality in S. sclerotiorum has come from the formation of MCGs and the correlation with a relatively frequent recovery of genotypes from a single multicopy retrotransposon _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 107 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ fingerprinting RFLP probe (pLK44.20) (Cubeta et al. 1997; Errampalli and Kohn 1995). The fingerprinting probe was recently used to detect random association amongst alleles, with the individual fragments treated as individual loci (Kohli and Kohn 1998). Additional evidence for clonality in S. sclerotiorum is demonstrated by the fact that all members of the same genotype share the same large mitochondrial rRNA gene RFLP fragments (Kohn et al. 1991) and the presence or absence of a group IC intron from small mt rRNA gene (Carbone et al. 1995). Various studies have been conducted which have shown no correlation between genotypes and different markers such as mitochondrial haplotypes (Kohli and Kohn 1996) and aggressiveness (Errampalli and Kohn 1995) (Chapter 5) in S. sclerotiorum. With clonal reproduction, all independent characters would be expected to be associated (Kohn et al. 1991). However, more recent research has indicated that MCGs or VCGs are not necessarily clonal (Kohli et al. 1992). Correlation between MCGs and the fingerprinting probe (pLK44.20) have been shown but this is not consistent in all studies (Cubeta et al. 1997; Kohli et al. 1992; Kohn 1995). In an outbreeding population, recombination would probably increase the number of MCGs (Kohli et al. 1992). The recent detection of random association amongst alleles indicates recombination could be producing new genotypes (Kohli and Kohn 1998). Initial studies indicated that genetic diversity was present in populations of S. sclerotiorum attacking sunflower in Australia (Ekins et al. 1994a). The aims of this project were threefold: (1) to determine the best method for detecting genotypic diversity, (2) to determine the distribution of genetic diversity within and between populations and (3) to determine if the genetic diversity is produced by recombination or maintained through clonal reproduction. The first aim was conducted using single copy RFLP markers, while genotypic diversity was examined by comparing molecular markers, such as single and multicopy RFLPs and RAPDs, to the phenotypic marker, MCG. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 108 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ The distribution of genetic diversity within and between populations of S. sclerotiorum was examined on a hierarchical basis. The distribution within populations was examined at the level of mycelia within sclerotia, sclerotia within plants, and plants within a field. Genetic diversity between populations was examined at the level of fields at a location, and fields around Australia. Comparisons of genetic diversity between years (temporal effect) and genetic differences attributable to mode of infection were also made. The genotypic diversity within Australia was compared to that found in North America. The third aim of this study was to examine the roles of clonal reproduction and recombination in the genetic diversity of S. sclerotiorum. The level of clonal reproduction was assessed by examining the distribution of genotypes over different geographic locations and time. Effects of recombination on genetic diversity were studied by examination of possible correlations between independent markers; the level of gametic disequilibrium; and assessment if significant multilocus associations were present. Gametic disequilibrium estimates the association between alleles at pairs of loci, whilst multilocus association provides an overall estimate of the association of alleles by comparing observed and expected variances in the number of heterozygous loci between pairs of gametes. Finally, the level of genotypic diversity relative to gene diversity was assessed. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 109 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ 6.2 MATERIALS AND METHODS 6.2.1 Isolate Collection 6.2.1.1 Distribution of Genetic Diversity Within Populations 6.2.1.1.1 Diversity Within Sclerotia To determine if multiple genotypes occur within single sclerotia, 40 isolates of S. sclerotiorum were obtained from ten single sclerotia each collected from a different sunflower plant with Sclerotinia head rot at the Pioneer Seeds breeding site, at Wyreema near Toowoomba. The single sclerotia were induced for mycelial germination and hyphal tipped in four sectors to test for the appearance of multiple genotypes within a single sclerotium. These 40 isolates were tested for genotypic differences using the multicopy probe pLK44.20. 6.2.1.1.2 Diversity Within Plants To determine the diversity within plants, three single sclerotial isolates were collected from twenty sunflower plants from two sunflower fields in south east Queensland in 1994. The first field was on the Pacific Seeds Research Farm at Gatton, and the second field was the Pioneer Seeds breeding site at Wyreema. Ten sunflower plants with head rot and ten sunflower plants with basal stem rot were sampled at each location. 6.2.1.1.3 Diversity Within Fields To determine the diversity within a field, S. sclerotiorum isolates were collected using a hierarchical sampling scheme from the two sunflower fields at Gatton and Wyreema, described above. Three sclerotia were randomly collected from ten separate sunflower plants, giving a total of 120 isolates. All three isolates from each plant were given the same UQ accession number unique from isolates collected from any other plant, and each isolate _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 110 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ from the same plant was given an additional suffix number of 1, 2 or 3 at the end of the accession number. For example, three isolates collected from the same plant may be labeled as UQ 1330-1, UQ 1330-2 and UQ 1330-3. To identify all three isolates collected from the same plant only the UQ prefix and the first four digit number is used (in this case UQ 1330). These isolates were also used for aggressiveness testing (Chapter 5) and are listed in Table 5.1. 6.2.1.2 Distribution of Genetic Diversity Between Populations 6.2.1.2.1 Diversity Between Fields For comparisons of fields around Australia, ten isolates were collected from each of nine fields as this generally represented all of the infected plants within each field. Collections for the Australian sunflower population were carried out from head or basal stem rots in Queensland (QLD) and New South Wales (NSW). Ten single sclerotial isolates were collected from each field infested with head rots at Evenslea (QLD), Warwick (QLD), Moree (NSW), Garah (NSW), Croppa Creek (NSW) and with basal stem rot at Clifton (QLD), Allora (QLD), Yalloroi (NSW), and Gurley (NSW), giving a total of 90 isolates. These isolates were screened against single copy RFLPs and one of the multicopy RFLPs to detect genotypes. 6.2.1.2.2 Temporal Differences Collections were also made from the same two sunflower sites at Gatton and Wyreema 2 years after the initial collections. Both fields had been sown to the non-host sorghum in the intervening year. The subsequent sampling strategies involved collection of a single isolate from each plant. Ten sunflower plants displaying head or basal stem rots were collected at both locations giving 40 isolates per year. Sample correction of the initial populations enabled comparisons between years. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 111 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ 6.2.1.2.3 Diversity Between Modes of Infection To compare genetic differences between the two modes of infection 130 isolates were collected from head rot of sunflower and 120 isolates were collected from basal stem rot of sunflower. These 250 isolates collected from fields around Australia in 1994 and 1996 were also used for examining genetic diversity (Section 6.2.1.2.1). 6.2.1.3 Detecting Genotypic Diversity The 120 isolates collected hierarchically from two fields in south east Queensland in 1994, as described in Section 6.2.1.1.3 were also used for comparing markers for their ability to determine genotypic diversity. The markers compared were mycelial compatibility groups (MCGs), random amplified polymorphic DNAs (RAPDs), single and multicopy restriction fragment length polymorphisms (RFLPs). 6.2.1.4 Production and Maintenance of Genetic Diversity To test for the roles of clonal reproduction and recombination for creating and maintaining genetic diversity in S. sclerotiorum, the 120 isolates obtained from the two sunflower fields in south east Queensland in 1994, were used in conjunction with the 40 isolates obtained from the same location in 1996 and the additional 90 isolates collected from around Australia in 1996. 6.2.2 Genetic Markers 6.2.2.1 Mycelial Compatibility Groups For MCG analysis all isolates were paired at least twice on Modified Patterson's Media (MPM), based on the method of Kohn et al. (1990). Isolates paired with themselves acted as positive controls for the compatible interaction. MPM contains: 0.68g KH2PO4; 0.50g _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 112 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ MgSO4.7H2O; 0.15g KCl; 0.50g yeast extract (Difco Laboratories, Michigan, USA); 1.00g NH4NO3; 18.40g D-glucose; 15.00g agar; 0.20 ml trace element solution; and 6 drops of red food colouring (McCormick Foods, Australia Pty. Ltd., Victoria, Australia) per litre. The trace element solution was derived from Vogel (1964) it contained in 95 ml of distilled water: 5g citric acid.1H2O; 5g ZnSO4.7H2O; 1g Fe(NH4)2(SO4)2.6H2O; 0.25g CuSO4.5H2O; 0.05g MnSO4.1H2O; 0.05g H3BO3; 0.05g Na2MoO4.2H2O, and 1 ml chloroform. Further pairings were carried out using the same conditions as Kohn (1990) with the exception that the food colouring was replaced with Queen red food colouring (124) (Queen Fine Foods Pty. Ltd., Queensland, Australia) at 12 drops per litre. The plates were assessed after 7 days for the presence of an interaction zone indicating incompatibility. Incompatible strains formed a red barrage zone between the two colonies while the hyphae of compatible strains freely intermingled with no accumulation of red food colouring. Isolates were considered to belong to the same MCG when compatible with each other and show incompatibility with members of different MCGs. 6.2.2.2 DNA Extraction DNA was extracted for all isolates as specified in Chapter 2, Section 2.2.3. 6.2.2.3 Random Amplified Polymorphic DNAs (RAPDs) For Random Amplified Polymorphic DNAs (RAPDs) analysis the polymerase chain reaction (PCR) was carried out with 25 l reaction mixtures consisting of: 6l distilled H20, 4 l of MgCl2 (25 mM), 4l dNTPs (200 m) (Biotech International Ltd., WA, Australia), 2.5 l of 10 X Buffer (Biotech International Ltd., WA, Australia), 1.5 l Primer (Operon Technologies Inc. Alamda, CA, USA), 2 l of the fungal DNA (12 ng/l) , and 5 l Tth DNA polymerase (0.32 units/l) (Biotech International Ltd., WA, Australia). A MJ Research PTC-100 Thermal Cycler was used for PCR with an initial denaturation stage of 5 minutes at 94oC, before 39 cycles of 1 minute at 94oC, 1 minute at 37oC, and 2 minutes at 72oC, with a final 7 minute extension step at 72oC. DNA from all of the isolates were amplified using the following eighteen primers (Operon Technologies Inc. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 113 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ Alamda, CA, USA), OPA01 (CAGGCCCTTC), OPE01 (CCCAAGGTCC), OPE19 (ACGGCGTATG), OPH03 (AGACGTCCAC) OPH04 (GGAAGTCGCC), OPH08 (GAAACACCCC), OPH11 (CTTCCGCAGT), OPH12 (ACGCGCATGT), OPH15 (AATGGCGCAG), OPH19 (CTGACCAGCC), OPW02 (ACCCCGCCAA), OPW04 (CAGAAGCGGA), OPW06 (AGGCCCGATG), OPW07 (CTGGACGTCA), OPW10 (TCGCATCCCT), OPV06 (ACGCCCAGGT), OPT01 (GGGCCACTCA), and OPT20 (GACCAATGCC). The resulting PCR products were electrophoresed on 1.5% agarose gels at 6 V/cm for 8 hours. Isolates were grouped into the same genotype using RAPDs if they had identical banding patterns for all of the primers. 6.2.2.4 Restriction Fragment Length Polymorphisms (RFLPs) All Southern blotting, creation of single and multicopy probes and hybridizations were carried out as in Chapter 2, Sections 2.2.4 and 2.2.5. Probes used for single copy RFLP analysis were pME012, pME036, pME062, pME082, pME106, pME147, pME163, pME230, pME241, pME283 and pME285. Multicopy RFLP probes used were pME017, pME041, pME103, pME176 and pLK44.20. 6.2.3 Data Analysis 6.2.3.1 Detecting Genotypic Diversity Different restriction fragment length polymorphisms detected by single copy probes were regarded as alleles at individual loci. Clonal correction of isolates was also carried out using a fingerprinting probe (pLK44.20) as some genotypes were over represented around Australia. Genotypic diversity was estimated using the formula Gˆ    f x / N  1 N x 0 x 2  where N is the sample size and x is the number of genotypes observed x times in the sample (Stoddart and Taylor 1988). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 114 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ The Shannon index (Hutcheson 1970) was also used to compare diversities for the markers. D=-pIlnpI where pI is the frequency of the ith genotype. Shannon‟s index of diversity can be normalized D‟=D/ln N to allow for differences in population sizes (Groth and Roelfs 1987). 6.2.3.2 Comparing Genotypic Diversity The variance of genotypic diversity can be calculated using the formula K 4   Var (Gˆ )  G 2  G 2  pi3  1 where G is population genotypic diversity, K is the number N i 1   of genotypes in the sample, and pi is the frequency of the ith genotype in the sample (Stoddart and Taylor 1988). The measures of genotypic diversity can be compared between populations using a t-test for significant differences. t  Gˆ 1 Gˆ 2  N1 N 2 Var (Gˆ 1 ) Var (Gˆ 2 )  ( N1 ) 2 (N 2 )2 where Ĝ1 and Ĝ 2 were the observed genotypic diversities in populations 1 and 2 with sample sizes of N1 and N2 respectively. The degrees of freedom are N1 + N2-2 (Chen et al. 1994). The probability of sharing the same DNA fingerprinting patterns for multicopy RFLPs and RAPDs was estimated as qn in which q was the mean frequency of individual fragments in the population and n was the average number of fragments per isolate (Jeffreys et al. 1985). The probability of two isolates sharing the same multilocus haplotype from single copy RFLPs was estimated using the formula P   Jil as in (Keller et al. 1997a), where Ji is n l 1 Nei‟s measure of genetic identity (Nei 1973). Ji   xik2 Where xik is the frequency of the k kth allele in the ith subpopulation (Nei 1973). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 115 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ To compare DNA fingerprints and multilocus haplotypes for their ability to differentiate genotypes, a most common haplotype and DNA fingerprint were created and compared  n  using the formula P    cl  (Keller et al. 1997a), where c is the most common allele at  l 1  2 each of n loci. 6.2.3.3 Comparing Gene Diversities Significance testing for differences in allele frequencies was done using a contingency 2   test as in (Workman and Niswander 1970)  2  N   2pj / p j for k alleles at a single k j l locus, p j is the mean frequency of the jth allele and  2pj is the variance of the jth allele. Nei‟s gene diversity h (Nei 1973) was calculated using the formula h  1   xi2 in which k i 1 xi refers to the frequency of the ith allele and k to the number of alleles at each locus. 6.2.3.4 Distribution of Genetic Diversity Nei‟s measure of genetic identity is given by I  J XY J X JY where JX, JY and JXY are the randomly chosen genes in populations X and Y respectively, such that j X   xi2 and means of jX, jY and jXY over all loci. Where jX and jY are the probabilities of identities of two j y   y i2 . The probability of identity of a gene from population X and a gene from population Y is j XY   xi yi . Nei‟s measure of genetic distance was given by D    dj n in which dj is the value of n j 1 –ln Ij. Where I is the genetic identity at the jth locus and n is the number of loci examined (Nei 1972). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 116 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ Population subdivision (GST) was calculated from gene diversity between subpopulations (DST) and gene diversity in the total population (HT) as given by G ST  DST H T . Gene diversity between subpopulations is given by the difference in gene diversity between the total population and within the subpopulations (HS) DST  H T  H S (Nei 1973). Gene flow between populations (Nm) was calculated by substituting Nei‟s Gst for Fst in    1 . Wright‟s model of gene flow (Wright 1951) using a corrected version for haploids as in (Boeger et al. 1993) Nm  1 2 1 Gst 6.2.3.5 Production and Maintenance of Genetic Diversity Gametic disequilibrium was calculated using Dij  pij  pi p j where p ij was the observed gametic frequency and p i and p j were the observed frequencies of alleles i and j respectively for any two loci. Significance testing of gametic disequilibrium among pairs of loci was carried out with Markov chain algorithm of Fisher‟s exact test (Raymond and Rousset 1995a) using the program GENEPOP (Raymond and Rousset 1995b). The exact probability was also corrected for a „table wide‟ 5% level as in (Carlier et al. 1996) by the Bonferroni sequential test (Rice 1988). Each pair of alleles at two loci were also tested for significance of gametic disequilibrium using the chi-square statistic of Weir (1996) as in nDˆ uv2 2 x  (Chen and McDonald 1996). uv ~ ~ ~ ~ where D̂uv is the maximum Pu (1  Pu ) Pv (1  Pv ) estimate for the coefficient of disequilibrium between alleles u and v. The allele frequencies ~ ~ of u and v were Pu and Pv respectively, n is the number of individuals in the population. Estimation of multilocus structure was carried out using the equations (Brown et al. 1980)  K2  m 2  pi2 [1   pi2 ] where p i is the frequency of the ith allele, with the expected with the program POPGENE. The observed variance of the distribution of m loci, h i variance j   h 2j i j (Brown et al. 1980). A direct comparison of the observed j _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 117 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ and expected variances is directly proportional to the number of loci  k2   2  h j   h j   m j  j  Multilocus structure is measured using the equation X (2)  s K 2 s K2  m(2)  h   h   1 j    2 j s k2 (Brown et al. 1980). The upper 95% confidence limit for L   h j   h 2j  2 var s K2 H 0 is true    1 2  The variance is var s K2 H 0 is true   h j  7 h 2j  12 h 3j  6 h 4j  2  h j   h 2j where is n 2 (Brown et al. 1980). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 118 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ 6.3 RESULTS 6.3.1 Detecting Genetic Diversity The populations compared during this study, along with number of genotypes identified using RFLP probe pLK44.20, the total number of isolates, genotypic diversity, genotypic diversity as a percentage of maximum are summarized in Table 6.1. Table 6.1 Total number of isolates (N), total number of genotypes, genotypic diversity (G) and genotypic diversity of maximum (G/N) of all populations, using multicopy probe pLK44.20. Population Total Number of Isolates (N) Gatton Head 1994 30 Gatton Root 1994 30 Wyreema Head 1994 30 Wyreema Root 1994 30 Gatton Head 1996 10 Gatton Root 1996 10 Wyreema Head 1996 10 Wyreema Root 1996 10 Head Rots 1994 60 Basal Stem Rots 1994 60 Head Rots 1996 20 Basal Stem Rots 1996 20 Gatton 1994 60 Wyreema 1994 60 Gatton 1996 20 Wyreema 1996 20 Clifton 10 Allora 10 Evenslea 10 Yallori 10 Gurley 10 Moree 10 Moree 10 Moree 10 Clifton 10 Gatton and Wyreema 1994 120 Gatton and Wyreema 1996 40 Gatton 1994 and 1996 80 Wyreema 1994 and 1996 80 Head rots all 130 Root rots all 120 Queensland 1994 40 Queensland 1994 and 1996 200 New South Wales 50 Australia 1996 90 Australia 1994 and 1996 250 Total Number of Genotypesa 7 4 8 7 6 9 7 7 14 10 13 16 10 11 13 10 10 9 6 6 8 8 9 7 8 18 22 20 20 34 38 23 44 26 55 57 Genotypic Diversity (G) 5.55 2.94 7.14 5.29 4.17 8.33 5.55 6.25 8.69 6.04 9.09 14.29 5.26 7.96 7.14 13.11 10 8.33 5 4.55 6.25 6.25 8.33 5.55 7.14 8.50 15.38 7.14 13.12 11.74 14.16 14.29 14.97 8.99 15.87 10 Genotypic Diversity of Maximum (G/N) 18.5% (55.5%)b 9.8% (29.4%) 23.8% (71.4%) 17.6% (52.9%) 41.7% 83.3% 55.5% 62.5% 14.5 % (43.5%) 10.1% (30.2%) 45.45% 71.43% 8.77% 13.27% 8.92% 16.39% 100% 83.3% 50% 45.6% 62.5% 62.5% 83.3% 55.5% 71.4% 7.1% (21.3%) 38.5% 8.9% (17.9%) 16.4% (32.8%) 9.0% (13.0%) 11.8% (17.7%) 35.73% 7.5% (12.5%) 18.0% 12.2% 3.5% (5.6%) _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 119 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ a Number of genotypes using multicopy probe pLK44.20 only. b The number in brackets indicates if the genotypes are corrected for the sampling strategy i.e. only one isolate per plant. 6.3.1.1 Mycelial Compatibility Groups (MCGs) There were a possible 7260 pairings among the 120 isolates (including self pairings). All interactions were paired at least twice and in most cases interactions were carried out six times. All same plant isolate interactions and any ambiguous interactions were carried out at least twenty times per interaction. This gave an overall number of 58 320 pairings. The data have been condensed to show only a compatible or incompatible result for each interaction (Appendix 4). An example of a compatible and an incompatible interaction is shown in Figure 6.1. For each interaction the reaction between two colonies were scored as follows: 1. Compatible, with both colonies freely intermingling 2. Incompatible, with a very wide (1 cm) but very faint band 3. Incompatible, faint band 4. Incompatible, very wide (1 cm) band of fluffy white aerial mycelium 5. Incompatible, fluffy white aerial mycelium, faint band on reverse 6. Incompatible, fluffy white aerial mycelium, distinctive red line on reverse 7. Incompatible, thin red line visible on both sides 8. Incompatible, obvious red line on both sides but fluffy aerial mycelium as well 9. Incompatible, obvious red line on both sides of the plate The MCG study divided the 120 isolates into 13 groups. The largest MCG contained 38 isolates from 13 different plants (Figure 6.2). The second largest MCG had 19 isolates from 7 different plants. The remaining large MCG had 15 isolates from 5 plants. All other MCGs were found in either one or two plants represented by three or six isolates. The three largest MCGs together contained over half of the isolates i.e. 72 isolates from a total of 120 isolates, these being collected from 24 plants out of a total of 40. Common genotypes were found on head rots and basal stem rots at the same location. Common genotypes were also found on head rots and basal stem rots at both locations. Isolates collected from the same _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 120 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ plant were of the same MCG in all but one plant. Only the three UQ 1291 isolates collected from the same plant belonged to more than one MCG. Interactions producing scores of 2, 3, 4 and 5 were sometimes found to be inconsistent. Some isolates showed incompatible reactions with isolates which otherwise showed compatible interactions to other members of the same MCG. This nontransitivity of MCGs was with isolates UQ 1330 and UQ 1336, when paired with UQ 1261, UQ 1293 and UQ 1348. Figure 6.1 Mycelial compatibility demonstrating and incompatible interaction with barrage zone (Left) and a compatible interaction (Right). 4 0 3 5 3 0 2 5 Numberofislate 2 0 1 5 1 0 5 0 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3 M y c e l i a l C o m p a t i b i l i t y G r o u p s Figure 6.2 Number of isolates observed in each mycelial compatibility group of 120 S. sclerotiorum isolates collected to study distribution of genetic diversity within populations. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 121 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ 6.3.1.2 Random Amplified Polymorphic DNAs (RAPDs) From the 18 primers screened, 168 bands were scored and 35 polymorphisms were apparent with fragment sizes between 400 bp and 1800 bp. An example of a RAPD gel (where polymorphisms can be seen between different isolates) is shown in Figure 6.3. The number of bands produced varied from 4 to 15 for each primer, and the number of polymorphisms varied from zero to five per primer. The accumulative number of genotypes that were detected increased as the number of primers increased until twelve primers had been screened after which further primers provided no further resolution of genotypes. RAPD analysis separated the 120 isolates collected in 1994 into 18 different genotypes. Only two plants had isolates of more than one genotype, the three UQ 1291 isolates (a basal stem rot from Wyreema) and the three UQ 1278 isolates (a head rot from Wyreema). The largest group contained six plants representative of 17 isolates. There were six examples of RAPD genotypes being represented by only one plant and one example of a single isolate belonging to a unique genotype (UQ 1278-2). Genotypes were found that contained isolates from head and basal stem rots at both Gatton and Wyreema. Other genotypes appeared to Carry Over Control Lane UQ 1327-1 UQ 1327-2 UQ 1327-3 UQ 1328-1 UQ 1328-2 UQ 1328-3 UQ 1329-1 UQ 1329-2 UQ 1329-3 UQ 1330-1 UQ 1330-2 UQ 1330-3 UQ 1333-1 UQ 1333-2 UQ 1333-3 UQ 1334-1 UQ 1334-2 UQ 1334-3 UQ 1336-1 UQ 1336-2 UQ 1336-3 UQ 1337-1 UQ 1337-2 UQ 1337-3 UQ 1342-1 UQ 1342-2 UQ 1343-3 be specific for location or mode of infection. Figure 6.3 A RAPD gel showing polymorphisms (presence or absence of bands) in isolates of S. sclerotiorum collected to study distribution of genetic diversity within populations detected with primer OPW04. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 122 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ 6.3.1.3 Restriction Fragment Length Polymorphisms (RFLPs) DNA was extracted and screened for internal priming sites for 299 probes using enzymes BamHI and HindIII, 236 probes were then screened against screening blots, of which 113 were single copy probes, 27 multicopy probes and 53 doublecopy probes. Of the probes 38% (73) were polymorphic and 62% (120) were monomorphic. The eleven polymorphic single copy probes chosen for population screening were pME012, pME036, pME062, pME082, pME106, pME147, pME163, pME230, pME241, pME283 and pME285. The multicopy probes were pME017, pME041, pME176, pME103 and pLK44.20. All the single copy probes were also combined to create a single haplotype for each isolate. An example of a single copy RFLP is shown in Figure 6.4 and a multicopy RFLP in Figure 6.5. 9 kb UQ 1277-3 UQ 1277-2 UQ 1277-1 UQ 1276-3 UQ 1276-2 UQ 1276-1 UQ 1275-3 UQ 1275-2 UQ 1275-1 UQ 1274-3 UQ 1274-2 UQ 1274-1 UQ 1272-3 UQ 1272-2 UQ 1272-1 UQ 1271-3 UQ 1271-2 UQ 1271-1 UQ 1264-3 UQ 1264-2 UQ 1264-1 UQ 1263-3 UQ 1263-2 UQ 1263-1 UQ 1262-3 UQ 1262-2 UQ 1262-1 UQ 1261-3 UQ 1261-2 UQ 1261-1 6 kb Figure 6.4 Southern hybridization of BamHI digested DNA from 30 S. sclerotiorum isolates. Plasmid probe pME032 hybridized to one RFLP locus with two alleles. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 123 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ 12 kb 5.0 kb 4.4 kb 3.5 kb 3.0 kb UQ 2658 UQ 2659 UQ 2660 UQ 2661 UQ 2663 UQ 2664 UQ 2665 UQ 2668 UQ 2669 UQ 2670 UQ 2671 UQ 2672 UQ 2673 UQ 2674 UQ 2675 UQ 2676 UQ 2677 UQ 2678 UQ 2680 UQ 2681 UQ 2686 UQ 2687 UQ 2690 UQ 2691 UQ 2692 UQ 2695 0.5 kb Figure 6.5 Southern hybridization of BamHI digested DNA from S. sclerotiorum isolates hybridized to plasmid probe pME017. Although a high degree of similarity was found between the markers, direct correspondence was not found between any two markers. The different markers separated the isolates into similar genotypic groupings (Table 6.2). There are differences between the isolates and differences within a single plant. The multicopy RFLP probes showed different groupings of isolates, pME041 was found to have a much better congruence with MCGs than any other probe followed by pME176, the multicopy haplotype (constructed from single copy probes), pME013, pLK44.20, pME017 and RAPDs. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 124 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ Table 6.2 The number of additional genotypes identified in each mycelial compatibility group (MCG) by alternative molecular markers from 120 isolates collected from Gatton and Wyreema in 1994. Number of additional genotypes identified in each MCG by different markers MCG 1 2 3 4 5 6 7 8 9 10 11 12 13 pME041 pME176 pME103 pME017 pLK44.20 RAPD 1 - 1 1 1 1 1 1 - 8 1 1 2 - 1 2 1 1 - 2 2 1 1 - Genotypic diversity (Stoddart and Taylor 1988) and Shannon‟s index of diversity (Hutcheson 1970) were used to calculate the diversity within the population, in order to compare the different markers (Table 6.3). Both measures of genotypic diversity were similar, indicating that individually the markers detected similar levels of diversity. Genotypic diversity was lowest when MCGs were used as a marker, but the lowest Shannon Index was obtained with pME103. The greatest measure of genotypic diversity and Shannon index was obtained by pME01as it identified the largest number of genotypes. Table 6.3 Number of genotypes, number of isolates in the largest genotype, genotypic diversity (G), genotypic diversity of maximum (G/N), Shannon‟s index of diversity (D) and Shannon‟s index of diversity population size corrected (D) of MCGs, multicopy RFLPs, single copy RFLPs (haplotype) and RAPDs for 120 isolates. Marker MCGs pME041 pME176 pME103 Haplotype pLK44.20 RAPDs pME017 Number of genotypes 13 14 15 13 16 18 18 24 Number of isolates in largest genotype 38 38 32 35 38 32 17 19 Similarity of all isolates to MCGs 97.5 % 92.5 % 87.5 % 85% 85% 75 % 75 % G G/N 6.31 6.52 7.89 6.93 8.10 8.50 11.9 13.14 5.3 % 5.4 % 6.6 % 5.8 % 6.8 % 7.1 % 9.9 % 10.9 % D D 2.18 2.25 2.38 2.36 2.14 2.52 2.66 2.84 0.456 0.469 0.498 0.492 0.447 0.526 0.555 0.592 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 125 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ A direct comparison between haplotype and pLK44.20, revealed 18 isolates from 120 isolates with more than one genotype per haplotype which is what one would expect if the fingerprinting probe detected more variation than all the single copy probes combined, but there were also 12 isolates of more than one haplotype per genotype. Comparing haplotypes to pLK44.20 in the Australian population of 290 isolates there are even more differences, clonal correction of the data would mean a loss of 14 haplotypes. So there are fingerprints within haplotypes but there are also haplotypes within genotypes. Despite these differences in identifying genotypes, pLK44.20 was used for genotypic identification to compare Australian isolates to North American populations. The different markers detected different numbers of genotypes, with the phenotypic marker MCGs and pME103 revealing the least number of genotypes. As more genotypes are detected (depending on the marker used), the underlying genetic variation within the phenotype (MCG) is revealed. Another method for comparing molecular markers is to calculate the probability of any two individuals having the same fragments (alleles) and using that for comparing markers (Table 6.4). For the probe pLK44.20 the probability was 8.4 x 10-6 but if all possible 53 fragments (only 35 fragments were found in these samples) are included the probability decreases to 2.8 x 10-7. All of the multicopy probes and RAPDs obtained probabilities of 1.5 x 10-5 or lower, with the lowest probability value of 1.0 x 10-7 obtained for probe pME041. The probability of obtaining shared multilocus haplotypes was higher than multicopy probes 1.2 x 10-3, but the expected frequency of the most common multilocus haplotype was 2.4 x 10-5 which was lower than the multicopy probe pLK44.20. The higher the probability or the expected frequency of the most common fingerprint or haplotype is not correlated to the number of genotypes detected by each marker. The combination of all the multicopy markers created during this research meant the probability of shared fingerprints increased to 7.3 x 10-22 and the expected frequency increased to 2.2 x 10-32. With the inclusion of all multicopy and single copy RFLP probes and RAPD markers the expected frequency of the theoretical most common fingerprint was 2.3 x 10-42. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 126 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ Table 6.4 The probability of any two individual isolates having the same fragments and the expected frequency of the theoretical most common fingerprint for each marker used. Marker Number of Number of Probability of Probability of Expected frequency genotypes polymorphisms shared shared of the theoretical detected fingerprints multilocus most common haplotypes fingerprint Haplotype 16 25 1.2 x 10-3 2.4 x 10-5 -6 pLK44.20 18 35 8.4 x 10 2.4 x 10-3 -7 pME041 14 40 1.0 x 10 1.1 x 10-10 -5 pME176 15 29 5.0 x 10 1.7 x 10-6 -6 pME103 13 35 2.7 x 10 4.1 x 10-9 -5 pME017 24 32 1.5 x 10 2.7 x 10-8 -5 RAPD 18 34 1.7 x 10 1.8 x 10-3 -22 All pME markers 26 136 7.3 x 10 2.2 x 10-32 All markers 36 230 2.3 x 10-42 6.3.2 Distribution of Genetic Diversity 6.3.2.1 Frequent Recovery of Genotypes The probe pLK44.20 with BamHI digested DNA was used to check for common genotypes. This probe/enzyme combination has previously been used for screening isolates in Canada (Kohli et al. 1995; Kohli et al. 1992) and USA (Cubeta et al. 1997). Common genotypes were recovered from both locations (Gatton and Wyreema) and from both modes of infection. The small amount of genotypic variation found within individual plants indicated that microgeographic sampling was not warranted. In subsequent sampling ten plants were collected from each sunflower field in Queensland and New South Wales. In most fields this represented all of the infections evident in the field, indicating the very low incidence of Sclerotinia diseases during the sampling years. From a total of 290 isolates of S. sclerotiorum collected from sunflower around Australia 58 different genotypes were identified. From the 250 isolates used for population genetic analysis 57 genotypes were recovered. The 120 isolates collected from 40 plants within two fields (Gatton and Wyreema) contained only 18 genotypes using the pLK44.20 fingerprinting probe. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 127 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ The most common genotype identified in Australia was recovered at every sunflower field sampled in Australia. This genotype was also recovered over several years at the same location. It occurred 79 times i.e. 27.3 % of the population over both years or 27/130 i.e. 20.7 % of the 1996 Australian population, while the second most common genotype occurred 33 times i.e. 11.4 % of the population over both years, 9/130 i.e. 6.9 % of the 1996 Australian population (Figure 6.6). The three most common genotypes comprised 42.8 % of the population over both years but only 27.7 % of the 1996 Australian population. However, 28 of the genotypes were sampled only once (48.3 % of the genotypes), but these only represent 9.7 % of the total number of isolates. 1 0 0 9 0 8 0 7 0 6 0 NumberofIslate 5 0 4 0 3 0 2 0 1 0 0 0 1 0 2 0 3 0 4 0 5 0 6 0 G e n o t y p e s Figure 6.6 Histogram of the number of isolates for each genotype detected in both the 1994 and the 1996 Australian population using RFLP probe pLK44.20. 6.3.3 Distribution of Genetic Diversity Within Populations 6.3.3.1 Diversity Within Sclerotia Forty isolates from ten separate sclerotia, i.e. four hyphal tips from each sclerotium, were tested for genotypic differences using multicopy RFLP probes and single copy probes. No genotypic differences were found within any of the ten sclerotia. Only five genotypes were identified from the 40 isolates and ten sclerotia. This sampling strategy was found to _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 128 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ produce an over representation of the same genotype in most cases. In subsequent sampling strategies only a single isolate per sclerotia was isolated since all tested sclerotia consisted of a single genotype. 6.3.3.2 Diversity Within Plants The 120 isolates collected from 40 plants showed a low genotypic diversity between the single sclerotial isolates collected from each plant. The different markers produced differing amounts of detection of genotypic differences within the same plant isolates. Mycelial compatibility groups identified UQ 1291 (a basal stem rot from Wyreema) as the only plant that had more than one different MCG amongst the isolates, i.e. two MCGs, UQ 1291-1 and UQ 1291-3 were identical and different from UQ 1291-2. There were no differences among the three isolates for each of the other 39 plants. Most of multicopy probes pME041, pME176, pME103, pLK44.20 and haplotype also identified UQ 1291 as the only example of multiple genotypes occupying the same plant. However, another RFLP multicopy probe pME017 found two different examples of multiple infection in addition to UQ 1291, namely UQ 1277 (a head rot, Wyreema) and UQ1293 from a basal stem rot at Wyreema. Isolate UQ 1277 was composed of three different genotypes as detected with the RFLP probe pME017. RAPDs also identified different genotypes among the UQ 1291 isolates and additionally UQ 1278 from another plant (a head rot from Wyreema). The separation of UQ 1278 into several genotypes using RAPD primers was in agreement with initial genotypic separation using pLK44.20, but this could not be repeated using the same probe (pLK44.20) on different blots of the same isolates. This sampling strategy of three isolates per plant was found to produce in most cases an over-representation of the same genotype. In subsequent sampling strategies only a single sclerotial isolate per plant was cultured. 6.3.3.3 Diversity Within Fields In the fields at Gatton and Wyreema there were examples of the same genotypes causing head and basal stem rots. From 60 isolates representing 20 plants at Gatton and Wyreema there were ten and 11 genotypes respectively. The same genotype predominated in both fields at Gatton and Wyreema, and was represented by 21 and 11 isolates respectively. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 129 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ Three isolates collected from each plant over represented the genotypes and only a single isolate per plant was used for subsequent analysis. 6.3.4 Distribution of Genetic Diversity Between Populations Allele frequencies for all loci from the single copy probes, and all comparisons of gene diversity, genetic identity, genetic distance, population differentiation and gene flow parameter for all loci can be found in Appendix 3. Nei‟s measure of gene diversity for each subpopulation (Hi), gene diversity in the total population (HT), gene diversity within subpopulations (HS), average gene diversity between subpopulations (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for all 11 RFLP loci in Australian S. sclerotiorum populations collected from sunflower is summarized for each comparison. The low values of population differentiation (Gst) (5% or less) and genetic distance (D) (less than 4 %) indicate that most of the gene diversity is found within the subpopulation and there is little gene diversity between populations, thus indicating low levels of population subdivision. 6.3.4.1 Diversity Between Fields Comparison of the locations Gatton and Wyreema for one season (1994) and for both years combined (1994 and 1996) using population differentiation (Gst) and Nei‟s measure of genetic identity (I) indicated only small differences in loci between the locations, and less when the years were combined (Table 6.5). Slightly more gene diversity was observed within the locations than between locations. Average gene diversity (Dst) and genetic distance (D) between the locations was low also indicating the populations are unlikely to be different. Genotypic diversities (G) for Gatton and Wyreema were low, with significant differences between the genotypic diversities in 1994 only. Direct observation of common genotypes revealed three genotypes out of 18 (16.7 %) occurred in both locations in 1994 and 7/36 (19.4%) genotypes occurred in both locations and years. Allele frequencies were significantly different for 5/11 loci for uncorrected data, but after clonal correction only two loci in 1994 were still significant. However, the two locations had a 33.3 % overlap in the genotypes recovered. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 130 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ Table 6.5 Nei‟s measure of gene diversity for each subpopulation (Hi), gene diversity in the total population (HT), gene diversity within subpopulations (HS), average gene diversity between subpopulations (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for all 11 RFLP loci in two fields at Gatton (A) and Wyreema (B) in 1994 and 1996. Population Hi Hi A B HT HS DST I D GST Nm 1994 Uncorrected Clonally Corrected 0.43 0.41 0.42 0.38 0.44 0.42 0.43 0.40 0.02 0.02 0.99 0.93 0.05 0.07 0.03 0.05 15 9 1994 and 1996 Uncorrected Clonally Corrected 0.44 0.40 0.43 0.40 0.44 0.41 0.43 0.40 0.01 0.01 0.96 0.97 0.04 0.03 0.03 0.02 18 21 6.3.4.2 Diversity Between States in Australia Comparison of Queensland and New South Wales showed extremely low population differentiation using population differentiation (Gst) and Nei‟s measure of genetic identity (I) (Table 6.6). Average gene diversity between the states was also low, gene diversity within each population is at the same level as between the populations. Genotypic diversities were not significantly different from each other, nor were allele frequencies. Direct observation of genotypes revealed 24.6 % of genotypes were common to both states. A large number of individuals are required to maintain this low level of substructuring Nm=148 uncorrected. Table 6.6 Nei‟s measure of gene diversity for each subpopulation (Hi), gene diversity in the total population (HT), gene diversity within subpopulations (HS), average gene diversity between subpopulations (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for all 11 RFLP loci in Australian populations of S. sclerotiorum collected from sunflower in Queensland (QLD) (A) and New South Wales (NSW) (B). Population A QLD and B NSW Uncorrected Clonally Corrected Hi Hi A B 0.45 0.41 0.45 0.42 HT HS DST I D GST Nm 0.45 0.42 0.45 0.42 0.00 0.00 1.00 1.00 0.01 0.01 0.00 0.00 148 134 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 131 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ 6.3.4.3 Diversity Between Modes of Infection Individuals isolated from the different modes of infection were also found to belong to the same population, with no significant subdivision using population differentiation (Gst) and Nei‟s measure of genetic identity (I) (Table 6.7) . Nei‟s gene diversities were also similar, suggesting that the two modes of infection do not represent different populations. Genotypic diversity for both head rots and basal stem rots were not significantly different, despite a large proportion of genotypes sampled as common to both modes of infection i.e. 15/34 genotypes (44.1%). Genotypes were repeatedly recovered over several years between 1994 and 1996 (27.3 %). Only one locus showed significant differences between the allele frequencies for uncorrected data and none for clonally corrected. Table 6.7 Nei‟s measure of gene diversity for each subpopulation (Hi), gene diversity in the total population (HT), gene diversity within subpopulations (HS), average gene diversity between subpopulations (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for all 11 RFLP loci in Australian populations of S. sclerotiorum collected from head rot (A) and basal stem rot (B) of sunflower. Population A Head Rot and B Basal Stem Rot Uncorrected Clonally Corrected Hi Hi A B 0.45 0.41 0.45 0.42 HT HS DST I D GST Nm 0.45 0.42 0.45 0.41 0.00 0.00 0.99 0.99 0.01 0.01 0.01 0.01 73 67 6.3.4.4 Temporal Differences Low population differentiation values were obtained when comparing both years 1994 and 1996 for both uncorrected and clonally corrected data (Table 6.8). Gene diversity between the years was extremely low and thus the years do not appear to be separate from each other. All measures indicate that the populations sampled in 1994 and 1996 had the same genetic structure. However, genotypic diversities were significantly different from each other despite the recovery of a third of the genotypes in both years. Two of the 11 loci showed significant differences in allele frequencies for uncorrected data only. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 132 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ Table 6.8 Nei‟s measure of gene diversity for each subpopulation (Hi), gene diversity in the total population (HT), gene diversity within subpopulations (HS), average gene diversity between subpopulations (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for all 11 RFLP loci in Australian populations of S. sclerotiorum collected from sunflower in 1994 (A) and 1996 (B). Population A 1994 and B 1996 Uncorrected Clonally Corrected Hi Hi A B 0.44 0.40 0.44 0.42 HT HS DST I D GST Nm 0.45 0.41 0.44 0.41 0.01 0.00 0.98 0.99 0.02 0.01 0.01 0.01 40 64 Indirect measures of gametic disequilibrium were also conducted for each year (Tables 6.9 and 6.10) and summarized with Bonferroni correction in Table 6.11. For the individual loci in 1994 uncorrected had 47/55 loci significant (85.5%) [54.5%] ([] indicates Bonferroni‟s correction), and once clonally corrected no loci had significant gametic disequilibrium 4/55 loci (7.3%) [0%]. The 1996 Gatton and Wyreema population had uncorrected 28/45 significant loci (62.2%)[35.6%], and clonal correction using pLK44.20 reduced this to 11/45 loci (24.4%) [4.4%]. Comparing gametic disequilibrium allele by allele over several years gave similar results. Uncorrected 1994 populations had 219/282 (77.7%) [39.0 %] significant (p<0.05) linkage disequilibria, whilst 1996 populations had 113/236 (47.9%) [13.1 %]. Clonal correction also reduced the number of significant allele by allele interactions so that virtually all were at linkage equilibrium i.e. 1994 clonally corrected using pLK44.20 achieved only 42/282 significant tests (14.9%) [0.0 %] and 1996 54/236 (22.9 %) [2.5 %]. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 133 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ Table 6.9 Measures of gametic disequilibrium among pairs of RFLP loci in 120 Sclerotinia isolates collected in 1994 at Gatton and Wyreema. pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 pME012 pME082 4/4 *** 0/4 NS 0/8 2/8 NS NS 4/4 4/4 NS ** 4/4 0/4 NS NS 0/6 4/6 NS * 0/4 0/4 NS NS 0/4 0/4 NS NS 4/4 0/4 NS NS 0/4 0/4 NS NS 0/4 0/4 NS NS pME106 6/8 *** 8/8 *** 2/8 NS 0/8 NS 2/12 NS 0/8 NS 0/8 NS 0/8 NS 2/8 * 0/8 NS pME147 4/4 *** 4/4 *** 6/8 *** 0/4 NS 4/6 NS 4/4 NS 0/4 NS 0/4 NS 0/4 NS 0/4 NS pME230 4/4 *** 4/4 *** 6/8 *** 4/4 *** 0/6 NS 0/4 NS 0/4 NS 4/4 * 0/4 NS 0/4 NS pME241 4/6 *** 6/6 *** 7/12 *** 4/6 *** 4/6 * 0/6 NS 2/6 NS 0/6 NS 0/6 NS 0/6 NS pME283 4/4 * 4/4 ** 2/8 * 4/4 ** 0/4 NS 4/6 NS 0/4 NS 0/4 NS 0/4 NS 0/4 NS pME285 4/4 * 4/4 * 4/8 * 4/4 *** 4/4 * 6/6 *** 4/4 ** 0/4 NS 0/4 NS 0/4 NS pME163 4/4 *** 4/4 *** 8/8 *** 4/4 *** 4/4 *** 4/6 ** 4/4 NS 0/4 NS 0/4 NS 0/4 NS pME036 4/4 ** 4/4 *** 6/8 *** 4/4 *** 4/4 *** 4/6 *** 4/4 * 0/4 NS 4/4 *** pME062 0/4 NS 4/4 *** 6/8 *** 4/4 *** 0/4 NS 4/6 *** 0/4 NS 4/4 ** 4/4 * 4/4 ** 0/4 NS Uncorrected results above diagonal, clonally corrected below diagonal. The number of significant (P<0.05) 2 square tests between individual alleles at different RFLP loci per the total number of tests. The significance of association between all alleles at the two loci as tested by 2 is also shown. NS not significant P>0.05, * Significant P<0.05, ** P<0.01, *** P<0.001 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 134 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ Table 6.10 Measures of gametic disequilibrium among pairs of RFLP loci in 40 Sclerotinia isolates collected in 1996 at Gatton and Wyreema. pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 pME012 pME082 0/4 NS 0/4 NS 0/8 2/8 NS * 4/4 0/4 * NS 4/4 4/4 *** NS 0/6 4/6 NS ** 0/4 4/4 0/4 0/4 NS NS 4/4 0/4 ** NS 0/4 0/4 NS * 0/4 0/4 NS NS pME106 2/8 * 4/8 *** 0/8 NS 2/8 NS 2/12 * 0/8 0/8 NS 0/8 NS 2/8 NS 2/8 NS pME147 4/4 *** 4/4 *** 4/8 *** 0/4 NS 0/6 NS 0/4 0/4 NS 0/4 NS 4/4 * 0/4 NS pME230 4/4 *** 4/4 *** 4/8 ** 4/4 ** 2/6 NS 0/4 0/4 NS 4/4 *** 0/4 NS 0/4 NS pME241 2/6 NS 4/6 *** 5/12 *** 4/6 ** 4/6 *** 0/6 2/6 NS 0/6 NS 4/6 ** 0/6 NS pME283 0/4 0/4 0/8 0/4 0/4 0/6 - 0/4 0/4 0/4 0/4 - pME285 0/4 NS 4/4 NS 0/8 NS 0/4 NS 0/4 NS 4/6 ** 0/4 - 0/4 NS 0/4 NS 0/4 NS pME163 4/4 *** 4/4 ** 2/8 * 4/4 * 4/4 *** 4/6 ** 0/4 0/4 NS 4/4 * 0/4 NS pME036 0/4 NS 4/4 *** 4/8 *** 4/4 *** 4/4 ** 4/6 *** 0/4 0/4 NS 4/4 *** pME062 0/4 NS 0/4 NS 2/8 * 4/4 ** 0/4 NS 0/6 NS 0/4 0/4 NS 0/4 NS 0/4 NS 0/4 NS Uncorrected results above diagonal, clonally corrected below diagonal. The number of significant (P<0.05) 2 square tests between individual alleles at different RFLP loci per the total number of tests. The significance of association between all alleles at the two loci as tested by 2 is also shown. NS not significant P>0.05, * Significant P<0.05, ** P<0.01, *** P<0.001 Table 6.11 Summary of significant loci with gametic disequilibrium and Bonferroni correction for temporal populations 1994 and 1996 at Gatton and Wyreema (P<0.05). Population Pairwise loci 1994 uncorrected 1994 clonally corrected 1996 uncorrected 1996 clonally corrected Allele by Allele 1994 uncorrected 1994 clonally corrected 1996 uncorrected 1996 clonally corrected Number of Loci significant combinations gametic (Nc) disequilibrium 55 55 45 45 282 282 236 236 85.5 % 7.3 % 62.2 % 24.4 % 77.7 % 14.9 % 47.9 % 22.9 % Significant Significant 5% / Nc after Bonferroni correction 0.00091 54.5 % 0.00091 0.0 % 0.0011 35.6 % 0.0011 4.5 % 0.00018 39.0 % 0.00018 0.0 % 0.00021 13.1 % 0.00021 2.5 % _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 135 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ 6.3.5 Production and Maintenance of Diversity 6.3.5.1 Gametic Disequilibrium Weir‟s measure of gametic disequilibrium (Weir 1996) for the 1996 Australian population was calculated for uncorrected and clonally corrected populations (Table 6.12). All comparisons and Bonferroni‟s correction are summarized in Table 6.13. For the 55 pairwise comparisons among loci in the 1996 Australian population 43 loci (78.2%) [63.6%] ([] indicates Bonferroni‟s correction) were in gametic disequilibrium. However, after clonal correction using the fingerprinting probe pLK44.20 only 26 loci (47.3%) [23.6%] were in gametic disequilibrium. The majority of loci were therefore in gametic equilibrium once clonal bias was removed. Allele by allele comparisons were significant in 202 of 282 comparisons (71.6%)[46.1%] of the whole population. Clonal correction found 109 of 282 (38.6%) [13.5%] of allele by allele comparisons were in gametic disequilibrium, i.e. most are in gametic equilibrium. Weir‟s measure of gametic disequilibrium (Weir 1996) was calculated for uncorrected and clonally corrected for the 1994 and 1996 Australian population (Table 6.14) and comparisons are summarized in Table 6.15. For the 55 pairwise comparisons among loci in the 1994 and 1996 Australian population 50 loci (90.1%) [76.4%] were in gametic disequilibrium (5% level). However, after clonal correction only 22 loci (40.0%) [14.5%] were in gametic disequilibrium. Allele by allele comparisons were significant in 230 of 282 comparisons (81.6%)[59.6%] of the whole population. Clonal correction found 96 of 282 (34.0%) [9.2%] of allele by allele comparisons were in gametic disequilibrium, i.e. most are in gametic equilibrium. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 136 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ Table 6.12 Measures of gametic disequilibrium among pairs of RFLP loci for 1996 Australian populations of S. sclerotiorum. pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 pME012 pME082 4/4 *** 4/4 *** 2/8 2/8 ** *** 4/4 4/4 *** *** 4/4 4/4 *** *** 0/6 4/6 NS ** 4/4 4/4 ** ** 0/4 0/4 NS NS 4/4 4/4 *** *** 0/4 4/4 NS * 0/4 0/4 NS NS pME106 6/8 *** 6/8 *** 0/8 * 0/8 NS 3/12 ** 0/8 NS 2/8 NS 2/8 NS 8/8 *** 2/8 ** pME147 4/4 *** 4/4 *** 6/8 *** 4/4 ** 0/6 NS 4/4 *** 0/4 NS 4/4 ** 0/4 NS 0/4 NS pME230 4/4 *** 4/4 *** 4/8 *** 4/4 *** 0/6 NS 0/4 NS 4/4 * 4/4 *** 4/4 * 0/4 NS pME241 6/6 *** 4/6 *** 8/12 *** 6/6 *** 6/6 *** 0/6 NS 2/6 NS 0/6 NS 6/6 *** 0/6 NS pME283 4/4 * 4/4 *** 2/8 ** 4/4 *** 0/4 NS 2/6 NS 4/4 NS 0/4 NS 0/4 NS 0/4 NS pME285 4/4 NS 4/4 * 4/8 *** 0/4 NS 0/4 NS 6/6 *** 4/4 *** 4/4 * 0/4 NS 0/4 NS pME163 4/4 *** 4/4 *** 4/4 *** 4/4 *** 4/4 *** 4/6 *** 4/4 * 0/4 NS 4/4 *** 0/4 NS pME036 4/4 * 4/4 *** 8/8 *** 4/4 *** 4/4 *** 6/6 *** 4/4 * 0/4 NS 4/4 *** pME062 0/4 NS 4/4 ** 6/8 *** 4/4 *** 0/4 NS 4/6 * 0/4 NS 0/4 NS 0/4 NS 4/4 *** 0/4 NS Uncorrected results above diagonal, clonally corrected below diagonal. The number of significant (P<0.05) 2 square tests between individual alleles at different RFLP loci per the total number of tests. The significance of association between all alleles at the two loci as tested by 2 is also shown. NS not significant P>0.05, * Significant P<0.05, ** P<0.01, *** P<0.001 Table 6.13 Summary of significant loci with gametic disequilibrium and Bonferroni correction for 1996 Australian populations of S. sclerotiorum (P<0.05). Australian Population Pairwise loci Uncorrected Clonally corrected Allele by Allele Uncorrected Clonally corrected Number of combinations (Nc) Loci significant gametic disequilibrium 55 55 282 282 78.2 % 47.3 % 71.6 % 38.6 % Significant Significant 5% / Nc after Bonferroni correction 0.00091 63.6 % 0.00091 23.6 % 0.00017 46.1 % 0.00017 13.5 % _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 137 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ Table 6.14 Measures of gametic disequilibrium among pairs of RFLP loci for 1994 and 1996 Australian populations of S. sclerotiorum. pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 pME012 pME082 4/4 *** 4/4 ** 2/8 2/8 NS ** 4/4 4/4 *** *** 4/4 4/4 *** ** 0/6 4/6 NS ** 0/4 4/4 * ** 0/4 0/4 NS NS 4/4 4/4 *** ** 0/4 4/4 NS NS 0/4 0/4 NS NS pME106 6/8 *** 8/8 *** 0/8 * 0/8 NS 2/12 NS 0/8 NS 0/8 NS 2/8 NS 6/8 *** 2/8 * pME147 4/4 *** 4/4 *** 8/8 *** 4/4 * 0/6 NS 4/4 *** 0/4 NS 4/4 * 0/4 NS 4/4 * pME230 4/4 *** 4/4 *** 6/8 *** 4/4 *** 0/6 NS 0/4 NS 0/4 NS 4/4 *** 4/4 NS 0/4 NS pME241 6/6 *** 4/6 *** 8/12 *** 6/6 *** 6/6 *** 0/6 NS 2/6 * 0/6 NS 6/6 *** 0/6 NS pME283 4/4 *** 4/4 *** 4/8 *** 4/4 *** 4/4 * 4/6 ** 0/4 NS 0/4 NS 0/4 NS 0/4 NS pME285 4/4 ** 4/4 *** 6/8 *** 4/4 *** 0/4 NS 6/6 *** 4/4 *** 0/4 NS 0/4 NS 0/4 NS pME163 4/4 *** 4/4 *** 4/8 *** 4/4 *** 4/4 *** 4/6 *** 4/4 ** 0/4 NS 4/4 ** 0/4 NS pME036 4/4 *** 4/4 *** 6/8 *** 4/4 *** 4/4 *** 6/6 *** 4/4 ** 0/4 NS 4/4 *** pME062 0/4 NS 4/4 *** 4/8 *** 4/4 *** 0/4 NS 4/6 *** 4/4 * 4/4 * 4/4 * 4/4 *** 4/4 NS Uncorrected results above diagonal, clonally corrected below diagonal. The number of significant (P<0.05) 2 square tests between individual alleles at different RFLP loci per the total number of tests. The significance of association between all alleles at the two loci as tested by 2 is also shown. NS not significant P>0.05, * Significant P<0.05, ** P<0.01, *** P<0.001 Table 6.15 Summary of significant loci with gametic disequilibrium and Bonferroni correction for 1994 and 1996 Australian populations of S. sclerotiorum (P<0.05). Australian Population Pairwise loci Uncorrected Clonally corrected Allele by Allele Uncorrected Clonally corrected Number of combinations (Nc) 55 55 282 282 Loci significant gametic disequilibrium 90.1 % 40.0 % 81.6 % 34.0 % Significant Significant after 5% / Nc Bonferroni correction 0.00091 76.4 % 0.00091 14.5 % 0.00017 59.6 % 0.00017 9.2 % 6.3.5.2 Multilocus Associations The multilocus associations among RFLP loci in S. sclerotiorum populations as based on the method of Brown (1980), uncorrected and clonally corrected ,are summarized in Table 6.16. The observed variance (Sk2) in all cases exceeded the expected moment (variance (2)) indicating independence of loci. However, statistically significant increases in _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 138 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ multilocus associations (observed variance (Sk2)) exceeding the upper 95% confidence level (L) were found in all populations indicating that allele distributions among loci were not independent. Thus the sample was significantly different from random mating (i.e. only values significantly different from zero indicate that recombination is rare). Measures of multilocus association (X(2)) were much lower in the clonally corrected samples. Uncorrected data indicates a fall in multilocus association from 1994 to 1996. Conversely in the clonally corrected data there is an increase in multilocus association from 1994 to 1996. Table 6.16 Multilocus associations among 11 RFLP loci in Australian populations of S. sclerotiorum. Population Uncorrected 1994 1996 1994 & 1996 Australian 1996 Australian 1994 and 1996 Queensland New South Wales Head Rots Basal Stem Rots Head and Basal Stem Rots Clonally Corrected 1994 1996 1994 & 1996 Combined Years Australian 1996 Australian 1994 and 1996 Queensland New South Wales Head and Basal Stem Rots ma nb hc (2)d Le Sk2 f X(2)g 11 11 11 11 11 11 11 11 11 11 120 40 160 130 250 200 50 80 80 250 0.44 0.44 0.44 0.46 0.45 0.45 0.45 0.45 0.45 0.45 2.48 2.42 2.48 2.55 2.52 2.51 2.53 2.53 2.50 2.52 3.08 3.43 3.00 3.14 2.94 2.98 3.48 3.11 3.10 2.94 7.55 6.03 7.00 6.78 7.04 6.89 7.98 6.95 7.46 7.04 2.05 1.49 1.82 1.66 1.80 1.74 2.15 1.75 1.99 1.80 11 11 11 11 11 11 11 11 11 18 22 40 34 55 57 45 26 55 0.40 0.42 0.41 0.40 0.40 0.41 0.41 0.42 0.41 2.43 2.41 2.44 2.40 2.48 2.49 2.48 2.55 2.51 3.96 3.78 3.46 3.50 3.38 3.37 3.46 3.87 3.42 4.54 4.85 4.40 3.92 4.93 4.12 4.16 5.11 4.03 0.87 1.01 0.81 0.63 0.99 0.66 0.68 1.01 0.60 a m= # RFLP loci (polymorphic loci only) n = # of isolates sampled c h = mean single locus diversity d (2) = expected central moment e L= upper 95% confident limit f 2 Sk = observed variance of the number of heterozygous comparisons g X(2)=measures of multilocus structure or measures of intensity of multilocus association b 6.3.5.3 Comparison of Genotypic Diversity and Gene Diversity Genotypic diversity was detected using mycelial compatibility groups, RAPDs and multicopy RFLPs in addition to the combination of single copy RFLPs to create a _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 139 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ multilocus haplotype. Single copy RFLP probes were also used for detecting gene diversity. The populations compared during this study, along with the genotypic diversity from genotypes identified using RFLP probe pLK44.20, genotypic diversity as a percentage of maximum and Nei‟s gene diversity for uncorrected and clonally corrected populations are summarised in Table 6.17. Table 6.17 Total number of genotypes, total number of isolates (N), genotypic diversity (G), genotypic diversity of maximum (G/N) and Nei‟s gene diversity (h) of all populations, using multicopy probe pLK44.20. Population Gatton Head 1994 Gatton Root 1994 Wyreema Head 1994 Wyreema Root 1994 Gatton Head 1996 Gatton Root 1996 Wyreema Head 1996 Wyreema Root 1996 Head Rots 1994 Basal Stem Rots 1994 Head Rots 1996 Basal Stem Rots 1996 Gatton 1994 Wyreema 1994 Gatton 1996 Wyreema 1996 Clifton Allora Evenslea Yallori Gurley Moree Moree Moree Clifton Gatton and Wyreema 1994 Gatton and Wyreema 1996 Gatton 1994 and 1996 Wyreema 1994 and 1996 Head rots all Root rots all Queensland 1994 Queensland 1994 and 1996 New South Wales Australia 1996 Australia 1994 and 1996 a Genotypic Diversity (G) Genotypic Diversity of Maximum (G/N) 5.55 2.94 7.14 5.29 4.17 8.33 5.55 6.25 8.69 6.04 9.09 14.29 5.26 7.96 7.14 13.11 10 8.33 5 4.55 6.25 6.25 8.33 5.55 7.14 8.50 15.38 7.14 13.12 11.74 14.16 14.29 14.97 8.99 15.87 10 18.5% (55.5%)b 9.8% (29.4%) 23.8% (71.4%) 17.6% (52.9%) 41.7% 83.3% 55.5% 62.5% 14.5 % (43.5%) 10.1% (30.2%) 45.45% 71.43% 8.77% 13.27% 8.92% 16.39% 100% 83.3% 50% 45.6% 62.5% 62.5% 83.3% 55.5% 71.4% 7.1% (21.3%) 38.5% 8.9% (17.9%) 16.4% (32.8%) 9.0% (13.0%) 11.8% (17.7%) 35.73% 7.5% (12.5%) 18.0% 12.2% 3.5% (5.6%) Nei‟s Gene Nei‟s Gene Diversity (h) Diversity (h) Uncorrected Data Clonally corrected 0.45 0.42 0.37 0.39 0.37 0.36 0.43 0.44 0.43 0.42 0.42 0.41 0.36 0.32 0.39 0.40 0.43 0.39 0.42 0.44 0.43 0.39 0.44 0.43 0.43 0.41 0.42 0.38 0.44 0.41 0.39 0.39 0.34 0.34 0.44 0.44 0.44 0.46 0.44 0.44 0.42 0.40 0.45 0.42 0.44 0.44 0.44 0.39 0.43 0.42 0.44 0.40 0.44 0.42 0.44 0.40 0.43 0.40 0.45 0.41 0.45 0.42 0.45 0.42 0.45 0.41 0.45 0.42 0.46 0.40 0.45 0.40 Number of genotypes using multicopy probe pLK44.20 only. The number in brackets indicates if the genotypes are corrected for the sampling strategy i.e. only one isolate per plant. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 140 b Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ Genotypic diversity in the 1994 Gatton and Wyreema populations, when compared between different markers was low, ranging from 5.3% to 11.0%. Allowing for the replicate sampling of the same plant (plant correction) genotypic diversity of individual plant corrected populations ranged from 29.4% to 100% (i.e. every one of the isolates was unique). All populations without redundant sampling have genotypic diversity above 40% of maximum. Genotypic diversity for the Australian population was low. The Wyreema population appeared to be a more genotypically diverse population than that from Gatton over both years. Both stem and head rots appear to be equally variable. In the temporal study the head rots appeared to lose genotypic diversity whilst the basal stem rot gained genotypic diversity between sampling years. Nei's genetic diversity was constant for the populations with the entire Australian population having a diversity of 0.45. These gene diversities are high, despite the problems involved in comparing gene diversities such as using different sampling techniques, different probes and different numbers of loci screened. Only polymorphic probes were used to screen the loci, so a gene diversity higher than the true value is expected. Gene diversity in these populations are high, but genotypic diversity is not high in the same populations. However, correction of the data for sampling strategy greatly increased the individual population genotypic diversity. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 141 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ 6.4 DISCUSSION 6.4.1 Distribution of Genetic Diversity Within Populations 6.4.1.1 Diversity Within Single Sclerotia Multiple genotypes were not discovered within the sclerotia from the ten sclerotia examined. This result suggests that sclerotia are most likely composed of intermingling hyphae from the same genotype. Results from same plants indicates that a sample size of ten isolates could miss any possible multiple genotypic sclerotia, but this is unlikely. However, ascospores from the same homothallic apothecia may result in a dual infection of a sunflower plant. 6.4.1.2 Diversity Within Plants Most of the plants were infected with a single genotype. This indicates that a rot on a plant is most likely the result of a single ascospore or sclerotial infection but it may also result from a multiple infection event of several ascospores or sclerotia of the same genotype. Three isolates from a basal stem rot on one plant were composed of two MCGs. Thus at least two sclerotia of differing genotypes infected the roots of this plant. RFLP multicopy probe pME017 found another basal stem rot composed of two different genotypes. In addition, RAPD data indicated that UQ 1278, from a sunflower head rot, was composed of different genotypes and thus likely a result of concurrent infection by ascospores of different genotypes. Only one plant was identified by MCGs to be colonized by more than one genotype from 40 plants (representing 2.5% of these sampled). This is substantially lower than 15% (Maltby and Mihail 1994) and 17% of plants recorded on canola in USA (Maltby and Mihail 1997). Dry conditions in Australia limit apothecial production and the short 2-3 day window for ascospore infection of sunflower capitula means diversity within sunflower plants in Australia will be lower than in North American canola plants. North American canola plants have a 14-20 day window of infection due to the longer flowering times and are therefore more likely to be exposed to ascospores from different possible _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 142 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ origins. The frequency of infection (3-6%) of canola plants in Canada by S. sclerotiorum (Maltby and Mihail 1997), was substantially higher than infection (<0.1%) of sunflower plants in fields sampled in Australia during this study. Whilst competitive differences in virulence and fungal reproduction were ruled out as affecting concurrent infection, temporal and spatial infection did affect competition (Maltby and Mihail 1997). This also shows that a single lesion of infection is usually the smallest unit of genetic diversity. This contrasts with work on other fungi such as M. graminicola where 25% of lesions contained different genotypes, and most lesions on the same leaf were of different genotypes (McDonald and Martinez 1990). Keller et al. (1997a) also found multiple genotypes within lesions of Phaeosphaeria nodorum. 6.4.1.3 Distribution of Genetic Diversity Between Populations The majority of gene diversity in Australian populations of S. sclerotiorum is found within subpopulations, thus indicating low levels of population subdivision. Thus S. sclerotiorum isolates attacking sunflower in Australia appear to belong to one large population. Quarantine restrictions on the movement of soil, plant debris or other material likely to harbour plant pathogens into Australia and the geographic isolation of the continent may have resulted in creation of an „island effect‟. Genetic drift in the isolated local populations may result in different allele frequencies and thus population division from overseas populations. Future research using single copy probes created in this research on overseas populations would reveal indirect measures of population subdivision in the global population. Genetic diversity between worldwide populations could be determined. All genotypes identified using pLK44.20 in Australia were different from those in Canada and USA, indicating that there is no direct evidence of gene flow with North America. Indirect measures of gene diversity between Australian and overseas populations using single copy probes should be carried out in the future to determine if fixation of some alleles and loss of other alleles has occurred as a result of the founder effect. However, indirect measures of gene flow do not allow for large scale migration events (Keller et al. 1997a). Given the movement of sclerotia in seed, the possibility of introduction into Australia of a large _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 143 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ founding population is possible, unless the fungus arrived via ascospores, given their fragility this is rather unlikely. The presence of asexual (clonal) components of this fungus and unique Australian genotypes would indicate that the Australian population has had time for significant population subdivision from the global population. This could indicate possible recombination in Australia increasing genotypic diversity. However the lack of direct observation of identical genotypes in Australia and Canada and USA may also be the result of insufficient sampling. Increased genotyping of isolates may reveal genotypes common to these countries. On a continental scale, the formation of one large population in Australia is evidenced by common genotypes sampled from most sites, and indirect measures such as very low population subdivision. Gene flow estimates also are quite high ranging from nine individuals to the maximum of 2000, averaging 134 over Queensland and New South Wales. This is higher than the estimate of gene flow of 12 individuals in M. graminicola between different states in USA (Boeger et al. 1993). Gene flow is likely to be caused by either movement of sclerotia, in seed, machinery, flooding, irrigation or by ascospore dispersal. Both sclerotia and ascospores which could easily travel (or be transported) the tens or hundreds of kilometres between fields creating one large population. Ascospores have been shown to travel at least 150m (Williams and Stelfox 1979) and up to 400m (BenYephet and Bitton 1985) but atmospheric conditions such as thunderstorms could easily allow greater distances. All methods identified some identical genotypes from both head and basal stem rots. This indicated that genotypes were not specialized for forming apothecia and subsequent head rot as opposed to myceliogenic germination giving rise to basal stem rot. Comparisons of modes of infection during one season found little evidence for subdivision using both gene diversities and genotypic diversities in addition to the direct observation of genotypes in both head and basal stem rots. Modes of infection over two years shows even less evidence for any subdivision. Differences in modes of infection were studied, as ascospore showers were expected to bring in new genotypes. Basal stem rot however, originates from direct infection by sclerotia produced in previous years. Ascospores too, may originate from apothecia of those sclerotia in the same soil, so isolates may be representative of previous _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 144 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ years infections. The longevity of sclerotia in the soil means that the soil is acting as a reservoir of genetic diversity. Gene diversity in the total population is very similar to gene diversity within subpopulations as is genotypic diversity. Genotypic content is also very similar indicating that mode of infection is not under genotypic control. No evidence for population subdivision based on modes of infection was found in Australia. Kohli et al. (1995), comparing genotype frequencies between petal and stem lesions on canola in Canada caused by S. sclerotiorum, found no difference in one district but differences in another district. Their was little evidence for population subdivision (both direct and indirect measures) between locations. The differences between locations became less apparent as sample size increased. There were significant differences in allele frequencies and genotypic diversities despite the occurrence of 30% of common genotypes in both Gatton and Wyreema in 1994. A third of the genotypes were common when comparing these two locations over two years 1994 and 1996, but there were significant differences in allele frequencies at several loci for the uncorrected data only. The overlap of genotypes in these fields is similar to results found in Canada (Kohli et al. 1995; Kohn et al. 1991). Increasing the geographic separation to between states increases the population sizes and population subdivision decreases. There appears to be no basis for the isolates in both states to be regarded as separate populations, because genotypic diversities were not significantly different from each other and almost a third of genotypes were common to both states. Indirect measures of population subdivision should be carried out in future using single copy probes created in this study to determine if populations in Australia and overseas are discrete. Direct observations of identified genotypes conducted in this study found no overlap between Australia, Canada and USA, suggesting that subdivision between these countries is likely. 6.4.2 Contributions of sexual/asexual components The population of S. sclerotiorum attacking sunflower in Australia has components indicating both clonal and random mating. A substantial asexual component for S. sclerotiorum was expected simply because sclerotial production is the main reproductive _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 145 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ mode of the fungus. This could explain why sexual reproduction (recombination) is obscured in this fungus. Frequent recovery of common genotypes, both spatially and temporally suggest a clonal mechanism in reproduction. Different probes most likely screening different loci give similar patterns, suggesting genetic similarity. Gametic disequilibrium is present in uncorrected samples, supporting clonality. However after clonal correction gametic equilibrium is prevalent with little association between loci. Multilocus associations indicate independence amongst loci suggesting a random mating population but allele distributions among loci were not independent suggesting a clonal structure. Genotypic diversity was low but increased with clonal correction compared to a high gene diversity, indicating that a random mating population is unlikely. 6.4.2.1 Presence of Sexual Structures S. sclerotiorum is a fungus which predominantly forms sclerotia but can reproduce by homothallic sexual means forming apothecia (Chapter 3). Sclerotial reproduction gives it a propensity towards asexual characteristics. The presence of a sexual stage suggests that sexual crossing and recombination may be occurring, but strict homothallism would reduce this. Homothallic reproduction does not mean that outbreeding cannot occur (Kohli et al. 1992). Recombination has not been shown from screening of sibling ascospores of field collected apothecia (Kohli et al. 1995; Kohli et al. 1992; Kohn et al. 1991). However, the possibility of finding recombinant types has been suggested by the appearance of large numbers of infrequent genotypes and common novel clones (Kohli et al. 1995). The possibility of detecting recombinant genotypes has been forthcoming with the indication of outcrossing in apothecia (Kohli and Kohn 1998; Kohn 1995) and formation of heterokaryons (Ford et al. 1992). Recombination can ensure new mutations are assorted into different combinations which may produce increased fitness and speed up the spread of these mutations through a population. Sexual populations may evolve faster as a consequence (Goodwin et al. 1995; Kohn 1995). Other options for recombination such as somatic recombination (parasexuality) which may be indistinguishable from rare recombination may also be available to the fungus as has been suggested in other fungi e.g. Puccinia graminis f. sp. tritici (Burdon et al. 1982) and Phytophthora infestans (Goodwin et al. 1994). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 146 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ 6.4.2.2 Frequent Recovery of Genotypes Particular genotypes were frequently recovered from different locations in Australia. Half of the genotypes in Australia were sampled only once, representing less than ten percent of the total number of isolates collected. This indicates a small proportion of the population is composed from sexual outcrossing methods. The three most common genotypes represent almost half of the isolates over both years suggesting a large clonal fraction in the population. However, this dropped to almost a quarter during the 1996 Australian collection of isolates, indicating almost half of the frequent recovery was due to the sampling method. The most common genotype represented a quarter of the 1994 population, and a fifth of the 1996 Australian population. The “great excess” of a particular genotype has been regarded as evidence of clonal reproduction in microorganisms (Tibayrenc et al. 1991). However, random association (recombination of the most common alleles at each locus) must be disproved before common genotypic recovery can be seen as clonality (Maynard Smith et al. 1993). The frequent recovery of common genotypes from around Australia can also indicate a clonal population may be present in Australia. The S. sclerotiorum sunflower population in Australia is most likely the result of a founder effect on an island continent. Population subdivision does not appear to be present in the Australian sunflower S. sclerotiorum population. Thus Australia may contain one large population of S. sclerotiorum. The same genotypes are frequently recovered within countries, but not between countries and continents. Cubeta et al. (1997) found no similarity between S. sclerotiorum populations from Canada, North Carolina and Louisiana. The present research found no Australian genotypes of S. sclerotiorum identical to genotypes of S. sclerotiorum recovered from canola in Canada (Kohli et al. 1995; Kohli et al. 1992) and cabbage in USA (Cubeta et al. 1997). The differences between Australian and overseas populations would indicate that the worldwide population does not behave clonally. Scoring of fragment sizes using fingerprinting probes such as pLK44.20 between different laboratories may result in classification of different genotypes based on identification of a single fragment, along with _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 147 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ the possibility of loss or gain of fragments creating genotypic variability in a retrotransposon fingerprinting probe (Kohli and Kohn 1998). 6.4.2.3 Repeated Temporal Recovery of Common Genotypes Gametic disequilibrium is only apparent in the uncorrected samples of 1994 but after sample correction both 1994 and 1996 temporal populations showed the majority of isolates were at gametic equilibrium for both individual loci and alleles at each locus. Clonal correction of both temporal populations reduced this to extremely low levels at individual loci and low levels for alleles at the loci. This provides evidence for the populations even over several years as random mating populations. However, direct observation of the same genotypes present at the same locations over several years suggests clonal reproduction. Alternatively recovery of the same genotype in a basal stem rot of sunflower from a previous head or basal stem rot, is the result of mycelial germination of sclerotia only. The recovery of the same genotype in subsequent head rots has followed a sexual event (carpogenic germination of sclerotia) from previous years sclerotia. At Gatton and Wyreema there was one genotype causing basal stem and head rots in 1994, which also caused both infections in 1996. There was also one example at Gatton of an isolate from a head rot in 1994 that was only isolated from a basal stem rot in 1996. Temporal changes in populations between 1994 and 1996 revealed very little difference in genetic structure between the years, suggesting little temporal subdivision. Genotypic structure did change, even though a third of the genotypes were present over both years. The estimate of the average number of individuals migrating between populations each generation also indicates a lack of subdivision. Stability in populations over years and seasons has also been found in other fungi but not with common genotypes (Chen et al. 1994). 6.4.2.4 Correlation Between Independent Markers Anastomosis can occur between genetically different isolates and if they are compatible heterokaryotic mycelium results. If a heterokaryon cannot be formed they are incompatible. Therefore members of the same vegetative compatibility group (VCG) can form heterokaryons. Sexual compatibility is the formation of a heterokaryon between two homokaryotic strains, whereas vegetative compatibility is successful hyphal fusion (i.e. not _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 148 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ followed by hyphal lysis) (Julian et al. 1996). Mycelial incompatibility has been suggested as one of several events associated with vegetative incompatibility (Kohn et al. 1990; Kohn et al. 1991). However, direct comparisons between MCGs and VCGs in S. sclerotiorum has revealed no direct correlation (Ford et al. 1995). Mycelial compatibility has been used to detect variation at the species level of Sclerotinia (Loveless 1951; Wong and Willetts 1975b). Mycelial interactions have also provided insight into intraspecific variation within S. sclerotiorum. Tariq (1985) studying mycelial compatibility in Sclerotinia suggested that mycelial compatibility may be useful for detecting clonality in fungal populations. In this study from 120 isolates from 40 sunflower plants only 13 MCGs were found. Initial studies of S. sclerotiorum on sunflower revealed five MCGs from seven isolates (Ekins et al. 1994b). This also appears to be less than found by other researchers working on S. sclerotiorum who have reported 28 MCGs from 35 isolates from various host species (Kohn et al. 1990), 32 MCGs from 63 isolates of canola (Kohn et al. 1991), 36 MCGs from 66 isolates of canola (Kohli et al. 1992), 90 MCGs from 80 canola plants (Maltby and Mihail 1994), four MCGs from six isolates from various host species (Ford et al. 1995), 84 isolates gave 41 MCGs from cabbages in North Carolina and 16 isolates from cabbages in Louisiana gave three MCGs (Cubeta et al. 1997). In S. minor 3 MCGs were recovered from 14 isolates from sunflower (Ekins et al. 1994b) and 28 MCGs were formed from 57 isolates (Patterson and Grogan 1984b). For the heterothallic S. trifoliorum seven MCGs were recovered from 15 single spore cultures (Rehnstrom and Free 1993). This would suggest that in Australia there is lower diversity in sunflower populations of S. sclerotiorum. However, research by Maltby et al. (1994) indicates that high diversity within a canola plant is due to the possibility of a large number of ascospore infections. The presence of cool and moist environmental conditions present in North America conducive to apothecial production, together with the longer susceptible flowering times of canola would suggest that increased diversity especially within the one plant may be due to increased ascospores numbers and a longer window of infection, and not necessarily from a population with higher genotypic diversity or competitiveness. The present research showed a breakdown of transitivity of MCGs where if one isolate belongs to an MCG then all other isolates of the same MCG must be compatible. This _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 149 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ “nontransitivity” of mycelial compatibility has also been found by others (Cubeta et al. 1997; Loveless 1951). Mycelial compatibility groups can produce phenotypic data at a low cost but can be extremely laborious when assessing a large number of isolates. Mycelial interactions at times gave ambiguous results and required repetition for validation of results. Particular interaction types 2, 3, 4 and 5 usually required repetition until more distinct reactions were obtained i.e. interaction type 1 or 9. Variation in incompatibility reactions have also been found by other workers (Cubeta et al. 1997; Kohn et al. 1990; Tariq et al. 1985). Ambiguous compatibility results are most likely the effects of contaminants such as Trichoderma (Kohli et al. 1992), nutrient depletion, or staling compounds (Tariq et al. 1985). Interactions with Trichoderma viride have resulted in selfed oospores produced by the otherwise heterothallic Phytophthora spp. (Brasier 1971; Reeves and Jackson 1972). It has been hypothesised that MCGs prevent movement between colonies of hypovirulence associated with dsRNA (Melzer and Boland 1996). Hypovirulence has been observed in Sclerotinia spp. (Boland 1992; Li et al. 1994; Melzer and Boland 1996). Hypovirulence in S. minor could be transmitted to isolates of different MCGs but not to all isolates of the same MCG (Melzer and Boland 1996) but, in planta hypovirulence transmission was restricted within MCGs (Melzer and Boland 1996). VCGs and MCGs can be useful for identifying clones of predominantly asexual fungi (Koenig et al. 1997), but examples of isolates of VCGs not being the same clone are found in Fusarium oxysporum (Appel and Gordon 1996; Koenig et al. 1997). By contrast, Tantaoui et al. (1996) found that all members of a single clonal lineage in F. oxysporum belonged to a single VCG and had identical RAPDs and mtDNA profiles but showed differences when assessed by a transposable element probe. The single copy and multicopy RFLP profiles were shown in the present experiments to be stable through homothallic sexual reproduction of S. sclerotiorum in the laboratory after all eight sibling ascospore derived cultures (UQ 808) had identical genotypes to the parental culture (Chapter 3). These probes can be used in future studies to screen other populations around the world to determine the centre of origin, which should theoretically contain the greater amount of diversity. Related to the centre of origin is determining the subsequent migration of the fungus around the globe. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 150 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ If each fragment of a multicopy RFLP probe or RAPD profile is assumed to represent a different locus then all fragments displayed by each genotype should be associated with every other genotype. Tibayrenc et al. (1993) stated “a tell-tale sign of clonal propagation is the association between unrelated polymorphic markers, an especially striking instance of linkage disequilibrium”. One of the simplest ways to test for differences from random mating is associations between neutral genetic markers and phenotypes (Milgroom 1996). “If reproduction is by clonal, asexual or homothallic inbred sexual then all independent characters would remain associated” (Kohn et al. 1991). The different groupings obtained from each phenotypic and genotypic marker reveal a high degree of similarity between the markers, so strict clonality is not an issue here, but the high degree of genetic similarity may suggest something closer to clones encompassing genetic variation within lineages (Maynard Smith et al. 1993). Other evidence for clonality in S. sclerotiorum has relied on correspondence between MCGs and the fingerprinting probe pLK44.20 (Errampalli and Kohn 1995; Kohn et al. 1991), additional correspondence between the fingerprinting probe and mitochondrial rRNA gene (Kohn et al. 1991), and the presence or absence of a group IC intron (Carbone et al. 1995). Evidence against strict clonality has been emerging with less correspondence between pectic zymograms and aggressiveness of the isolates (Errampalli and Kohn 1995). There have also been divergences between pLK44.20 and MCGs with cases of an MCG having multiple fingerprints (Kohli et al. 1992) and additional examples of isolates with the same fingerprint belonging to different MCGs (Cubeta et al. 1997; Kohli and Kohn 1998). The present research showed examples of multiple fingerprints and thus genetic differences within a single MCG. However, comparisons between pLK44.20 the fingerprinting probe and the haplotype produced many examples of multiple genotypes per haplotype and multiple haplotypes per genotype. Despite this, the similarity between the different probes indicates some restricted variation and there must be structure and order to genomes especially if they are to recombine. The probes identified different combinations of isolates clustered in each genotype. Some isolates were common in their groupings between the different markers but gross _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 151 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ differences were also present when assessed by other markers. Despite the apparent similarity, no two markers gave exactly the same genotypic structure. Markers such as pME017 detected differences within groupings other markers (such as MCGs) detected as phenotypes. Results for the multicopy RFLP probes varied; pME041 was found to have a much better congruence with MCGs than other probes followed by pME176, then the haplotype, followed by pME013 and the fingerprinting probe pLK44.20, which has been regarded as having direct correlation with MCGs (Kohli et al. 1992; Kohn et al. 1991). Results in the present study show genotypic differences within the MCGs and fingerprinting groups identified by pLK44.20. This supports the results of Cubeta et al. (1997). The proportion of polymorphic probes is a crude method of comparing genetic variation. In the present study 38% of all RFLPs were polymorphic. This contrasts with Schleier et al. (1997) who found only one polymorphism amongst ten strains of S. sclerotiorum and therefore concluded that RFLPs occur “rather rarely”. The proportion of polymorphic probes in plant pathogenic fungi depends heavily on the method for creating probes as well as the fungus in question, as such polymorphism has varied from 8% (Kurdyla et al. 1995) to 81% (Rosewich et al. 1998). 6.4.2.5 Gametic Disequilibrium The entire uncorrected sample of the Australian population is at gametic disequilibrium for both individual loci and alleles at pairwise loci comparisons. However, clonal correction of the population showed the majority of both loci and alleles per loci comparisons to be at gametic equilibrium. This indicates that random association is present in most of the comparisons. Significant gametic disequilibrium was found in large and small samples in conjunction with subdivision analysis these samples should not be regarded as separate subpopulations. Thus, significant association is unlikely to be due to mixtures of subdivided populations (Maynard Smith et al. 1993). All isolates at Gatton and Wyreema populations were at gametic disequilibrium, but clonal correction reduced the population size and the degree of gametic disequilibrium. Smaller sample sizes (i.e. individual fields) could not, be compared as departures from gametic equilibrium are difficult to detect with small sample sizes (Keller et al. 1997b). These findings are similar to those of Kohli and _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 152 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ Kohn (1998) who found significant gametic disequilibrium in the majority of pairwise associations between fingerprint fragments in their entire sample of S. sclerotiorum, but gametic equilibrium after clonal correction. The random association present indicates that genetic exchange and recombination may be occurring in populations of S. sclerotiorum. Carbone et al. (1999) using phylogenetic studies also found evidence for recombination amongst clonal lineages in S. sclerotiorum. Gametic disequilibrium in a population is also possible to result from founder effect (Maynard Smith et al. 1993; Milgroom 1996). The Australian population of S. sclerotiorum is most probably not endemic but has been introduced from overseas. Further comparisons with overseas populations may confirm the centre of origin as North America as suggested by Reichert (1958), and may identify possible migration patterns. Genetic drift combined with low potential recombination in S. sclerotiorum, could inhibit the population from reaching gametic equilibrium. 6.4.2.6 Multilocus Association The Multilocus association observed variance indicated independence of loci, suggesting gametic equilibrium. However, statistically significant increases in multilocus associations were found in all populations indicating that allele distributions among loci were not independent. Thus these populations would appear to be in gametic disequilibrium. Multilocus association analysis of the Australian populations of S. sclerotiorum indicated that the associations were not random. Clonal correction of the data reduced any spurious results indicating associations purely from over representation of the same genotype. Clonal correction of the data still showed significant association between loci, thus removing the possibility of epidemic clonality overshadowing a recombinant population. This result was similar to those obtained by Maynard Smith et al. (1993) who found significant association in a large population, but after correcting for duplication of genotypes the association was found to be random. Kohli et al. (1998) found significant association in all the populations of S. sclerotiorum after clonal correction and proposed that this was evidence for a clonal population structure. In contrast, statistically significant increases in multilocus associations were not found in any populations of M. graminicola indicating that allele distributions among loci were independent. This, in addition to low measures of multilocus _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 153 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ association, was found to be indicative of a random mating population (Chen and McDonald 1996). The present research found no correlation between multilocus associations and mode of infection. Isolates causing root rot and forming sclerotia (a totally asexual phase) are more likely to have a multilocus association than head rot caused by ascospores (a sexual phase). Both modes of infection showed significant association, strengthening the case for clonality, as the sexual stage did not show a random association. This suggests that recombination is unlikely. The genotypic diversities of isolates in the “modes of infection” groups were not significantly different from each other, indicating that either myceliogenic or carpogenic germination of sclerotia and the diseases caused do not result in the epidemic clonality. 6.4.2.7 Comparison of Genotypic Diversity and Gene Diversity Recombination increases genetic diversity and random association between alleles at different loci. By not affecting allele frequencies at each locus, gene diversity is not affected by recombination, whilst genotypic diversity which relies on combinations of alleles at multiple loci, is increased. Thus for similar gene diversities, sexual populations usually have higher genotypic diversities than asexual populations (Milgroom 1996). Additionally, clonal populations have less allelic and genotypic diversity than sexual populations (Milgroom 1996). Genotypic diversity was also used to calculate diversity within the population using the method of Stoddart and Taylor (1988). Direct comparisons of S. sclerotiorum to other fungi cannot be conducted because of different probes were used (Chen and McDonald 1996). Despite this, genotypic diversity in S. sclerotiorum appears to be medium to low. The individual populations had a large range of genotypic diversity depending on the population and sampling strategy. The entire sample population had a maximum genotypic diversity of 3.5% uncorrected and 5.6% sample corrected. The individual populations with only one isolate per plant have genotypic diversities of 30% - 100% so the populations appear to be more like a sexual population, but they are not as consistently high as other _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 154 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ studies have indicated. However, the Australian S. sclerotiorum population has slightly higher genotypic diversities than the Canadian populations which had a genotypic diversity of 1.1% overall and ranged from 10.3% - 29.5% for individual populations (Kohli and Kohn 1998). Nei‟s genetic diversity was constant for the individual populations with the entire Australian population. Direct comparisons of gene diversities between fungi is difficult as differences can result from using different sampling techniques, probes and numbers of loci screened (Rosewich et al. 1998). Only polymorphic probes were used to screen the loci in the Australian S. sclerotiorum populations, so a gene diversity higher than normal is expected. Despite the limitations, gene diversity in these populations is high. This level of gene diversity compares closely to the gene diversity from Phaeosphaeria nodorum a fungus for which no evidence for clonal reproduction has been found (McDonald et al. 1994). Analysis of Colletotrichum graminicola (Ces) G. W. Wils., an asexual fungus which is thought to have clonal lineages, using only polymorphic probes showed a lower gene diversity and very low genotypic diversity (Rosewich et al. 1998). Mycosphaerella graminicola is a predominantly sexually reproducing fungus with high gene diversities and genotypic diversities (Chen et al. 1994; Chen and McDonald 1996). Mycosphaerella fijiensis Morelet is another fungus with a sexual stage involved in most of the disease development, and it displays (Carlier et al. 1996) high gene diversity and extremely high levels of genotypic diversity but this study suffers from a biased sampling strategy. The high level of gene diversity in the Australian S. sclerotiorum population does not support the theory of founder effect, but only if it was found to be high in comparison to the source population. In order to examine populations for founder effects research must involve comparisons of overseas populations using the same markers, looking for fixation of alleles and loss of uncommon alleles. The presence of high gene diversity associated with low genotypic diversity in this study indicates that outcrossing and recombination is rare or absent in the Australian population of S. sclerotiorum. However correction for sampling strategy increased genotypic diversity and gene diversity was exaggerated with the use of polymorphic probes. If gene diversity is as low as genotypic diversity there would be less evidence for clonal reproduction. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 155 Chapter 6: Population genetics of S. sclerotiorum attacking sunflower in Australia _________________________________________________________________________ Genetic uniformity was found in the populations between years for allele frequencies and genotypes recovered. Basal stem rot however, is from sclerotia of previous years. Ascospores too, may originate from apothecia of those sclerotia in the same soil, so they may be resamples of previous years infections. The longevity of sclerotia in the soil means that the soil is acting as a reservoir of genetic diversity. Between the years, the fields at Gatton and Wyreema were both sown to a non-host, sorghum. Uniformity of genotypes across the field over several years has been demonstrated by other researchers to be due to production of spores external to the field (Chen et al. 1994). A substantial asexual component for S. sclerotiorum was expected simply because sclerotial production is the main reproductive mode of the fungus. This could explain why sexual reproduction (recombination) is obscured in this fungus. The population of S. sclerotiorum attacking sunflower in Australia has components indicating both clonal and random mating. Frequent recovery of common genotypes both spatially and temporally suggest a clonal mechanism in reproduction. Common patterns at different loci, using several probes give similar patterns suggesting genetic similarity. Gametic disequilibrium is present in uncorrected samples, supporting clonality. However after clonal correction, gametic equilibrium is prevalent with little association between loci. Multilocus associations indicated independence amongst loci, suggesting a random mating population but allele distributions among loci were not independent, suggesting clonal structure. Genotypic diversity was low but increased with clonal correction, when compared to a high gene diversity this indicated that a random mating population was unlikely. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 156 Chapter 7: General Discussion _________________________________________________________________________ Chapter 7: General Discussion This research has enabled differentiation of all three economically important species of Sclerotinia: S. sclerotiorum, S. minor and S. trifoliorum. Differences in fragment sizes in RFLPs separated all species. Sclerotial sizes were useful for separating S. minor from S. sclerotiorum and S. trifoliorum. Dimorphic ascospores were used as a characteristic feature of the bipolar heterothallic fungus S. trifoliorum (Uhm and Fujii 1983a). However, ascospore dimorphism was also found, but not consistently, within S. minor and S. sclerotiorum. Both S. minor and S. sclerotiorum were found to be self fertile in cultures derived from all ascospores in single asci, thus sexual reproduction in these species is homothallic. However, the rare dimorphism observed in ascospores of S. minor and S. sclerotiorum suggest that rare outbreeding events may occur, if these two traits are as closely linked as they are in S. trifoliorum. Propagation of these fungi are predominantly by production of sclerotia which increases the asexual component of reproduction. S. trifoliorum has the most obvious mechanism for outbreeding but it is thought to have the narrowest host range of all three species. S. minor is a fungus that attacks the roots and lower stems of sunflower in the same fashion as S. sclerotiorum. In addition S. sclerotiorum causes head rot of sunflower from ascospore production. The production of apothecia of S. minor in the laboratory provided the opportunity to demonstrate that these ascospores can also produce head rot of sunflower. Heterothallism in S. minor has been suggested to be the province of individual isolates (Patterson and Grogan 1984a). Direct and indirect measure of genotypes and alleles were carried out using single and multicopy RFLPs and RAPDs and a phenotypic trait (MCGs) as well as aggressiveness testing to find evidence of outbreeding in S. sclerotiorum. Future research could involve studying similar mechanisms in S. minor in Australia. The use of single copy RFLP probes created during this study could also be used to directly observe any recombinants in S. sclerotiorum. These probes could also be used for studying the population genetics of S. minor. The lack of cultivar selection for resistance genes amongst any of the S. sclerotiorum hosts indicates that the selection pressure from the host is not likely to account for the prevalence of the large number of genotypes in Australia. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 157 Chapter 7: General Discussion _________________________________________________________________________ Pathogenicity testing using stem lesion expansion on sunflower revealed differing aggressive abilities of isolates of S. sclerotiorum. However, the differences in aggressive abilities of isolates were continuous and lacked reproducibility between experiments. Isolates that had low aggressive abilities were identified. These isolates were most likely to have lost this aggressiveness in culture from contamination with Trichoderma, or from subculturing. There was no correlation between the aggressive abilities of isolates and genotype groups which were identified using the phenotypic trait MCG or neutral markers such as RAPDs, multicopy RFLPs nor RFLP haplotypes. The lack of correlation between genotypes and aggressiveness indicates that genetic differences are not dependent on aggressiveness, as it was identified by this pathogenicity test. Genotypes were identified using the above mentioned molecular methods. There was no perfect correlation between the different methods in grouping isolates, as one would expect between strictly asexual organisms. However, the similarity between the different markers does indicate genetic similarities are apparent within the genotypic groups. Direct observation of genotypes revealed that as well as aggressiveness, mode of infection and geographical regions were not specific for the genotypes. There was only one example of a plant that was infected by more than one genotype. Because sclerotia were only composed of a single genotype then individual sunflower plants were regarded as the smallest detectable unit of variation. Common genotypes were also recovered at the same location over several years. The same genotypes were recovered from all locations sampled around Australia indicating a large amount of gene flow around the sunflower growing regions of Australia. Australia is thus most likely represented by one large relatively homogenous population. Perhaps the Northern Territory and Western Australia which are separated by deserts from the Eastern states might harbour independent populations. Due to the ubiquitous nature of S. sclerotiorum with regards to its large host range, this one large population covering sunflowers would also be the same population of S. sclerotiorum affecting other host crops. Previous research (Ekins 1993) found that isolates were no more aggressive on the host from which they were obtained than on other hosts. Genotypes identified in Australia were found to be different from those recovered in North America using the same molecular markers (Cubeta et al. 1997; Kohli et al. 1995; Kohli et _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 158 Chapter 7: General Discussion _________________________________________________________________________ al. 1992). This means gene flow between Australia and North America is not frequent. Indirect measures of gene flow between continents could not be made at this time. Future research of genotypes from other countries would give a much better idea of the global spread of S. sclerotiorum. Indirect measures of gene flow between isolates within Australia found that large numbers of individuals migrate between regions and thus there was no population subdivision present. Gametic disequilibrium is significant in uncorrected samples, but once corrected for oversampling of identical genotypes then gametic equilibrium is significant in most cases. A clonal population structure cannot be assumed because proof of deviation from random assortment could not be proven. The presence of evidence for both random mating and clonality indicates that this fungus has components of both in its reproduction and that S. sclerotiorum lies between panmixia and clonality. The most convincing evidence for recombination is the recovery of recombinant genotypes, however recombinants were not found during this research. Indirect measures of recombination have also been recorded for S. sclerotiorum in Canada (Kohli and Kohn 1998). Homothallic sexual reproduction and mass production of asexual mycelial sclerotia would suggest an organism that would appear to be strictly asexual. However even homothallism within asci produced in a laboratory does not indicate that outbreeding cannot occur. Indeed outcrossing within apothecia of S. sclerotiorum has been observed (Kohli and Kohn 1998; Kohn 1995). Indirect evidence suggests recombination is a component of reproduction in S. sclerotiorum. The presence of MCGs and the formation of heterokaryons (Ford et al. 1992; Ford et al. 1995) does not rule out parasexuality as a possible method for generating genetic variability. A sexual fungus has the ability to recombine genes into new combinations to rapidly overcome host resistance. Asexual fungi will tend to evolve more slowly and any host resistance should be more durable. However a clonally reproducing organism that is successful will spread more rapidly through the host population. Apart from the initial founder effect that must have occurred with the first introduction of S. sclerotiorum into Australia, annual population bottlenecks are unlikely because of its wide host range, and survival of sclerotia in the soil which can provide next, as well as this, years apothecia. There is a possibility that the founder effect on initial introduction may explain gametic disequilibrium in the population. The frequency of introductions also _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 159 Chapter 7: General Discussion _________________________________________________________________________ cannot be predicted. If ascospores travel across the oceans as has been shown for Mycosphaerella musicola Leach. (Stover 1962) and basidiospores of Puccinia graminis f. sp. tritici (Burdon et al. 1982), then frequent introductions could be possible. The presence of unique genotypes in Australia compared to North America possibly indicates: undersampling which would be revealed by intensive worldwide sampling; a problem with reproductive ability of band scoring between laboratories; or that the Australian population has evolved separately since introduction. Australia is an island continent separated from other large land masses by vast oceans, and most pathogens of crop species were believed to be imported with their host at some stage. Initially the long distances travelled by the sailing ships acted as effective quarantine barriers, but the advent of steam and diesel engines increased the rate of spread. The main factors influencing the genetics of pathogen populations in Australia was the migration that occurred perhaps only once and any subsequent population bottleneck it underwent. The presence of large numbers of genotypes would indicate either multiple introductions or one large highly variable introduction. Intercontinental spread of ascospores in air masses is unlikely, because the thin walled, hyaline ascospores are likely to be susceptible to damage from dessication or ultra violet radiation. Breeding for resistance to S. sclerotiorum may be difficult due to the genetic diversity in S. sclerotiorum revealed by the present study. It would be desirable to incorporate several transgenes to confer resistance to Sclerotinia. The most functional control strategy would be pyramiding resistance genes. Because of the distribution of genotypes around Australia and the potential for long range dissemination via ascospores and sclerotia in seed and machinery, the deployment of individual genes is unlikely to be effective. Quarantine restrictions between different areas are also unlikely to be effective due to the widespread distribution of genotypes. Crop rotation with non-hosts such as cereals is likely to be continued to prevent the build up of inoculum. However, the durability of sclerotia in the soil and the ability to be moved between regions means eradication is almost impossible. The population genetics and more specifically the reproductive mechanisms, of S. sclerotiorum has far reaching implications for its use as a biological control agent where it would appear to be unnecessarily hazardous. The use of S. sclerotiorum as a _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 160 Chapter 7: General Discussion _________________________________________________________________________ controllable mycoherbicide relies on selection or creation of non-sclerotial mutants (Miller et al. 1989). There is potential for erosion of this mutation from outcrossing which has been indicated in S. sclerotiorum (Kohli and Kohn 1998; Kohn 1995). Reverse mutations that can override any mutation process created in the laboratory are also possibilities in the field. In conclusion, this research has identified S. sclerotiorum, S. minor and S. trifoliorum as distinct species. Australian isolates of both S. sclerotiorum and S. minor have been shown to be homothallic fungi. The genetics of the population of S. sclerotiorum which attacks sunflower in Australia has also been explored using phenotypic and genotypic markers. The Australian population is one large population distinct from populations overseas, with both sexual and asexual components in its reproduction. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 161 Bibliography _________________________________________________________________________ Bibliography Abawi, G. S. and Grogan, R. G. 1975. Source of primary inoculum and effects of temperature and moisture on infection of beans by Whetzelinia Sclerotium. Phytopathology. 65:300-309. Abawi, G. S. and Grogan, R. G. 1979. Epidemiology of diseases caused by Sclerotinia species. Phytopathology. 69:899-903. Abawi, G. S., Polach, F. J., and Molin, W. T. 1975. Infection of bean by ascospores of Whetzelinia sclerotiorum. Phytopathology. 65:673-678. Acimovic, M. 1988. Sunflower diseases mapping in Europe and some countries outside Europe in the period 1984-1986. Helia. 11:41-49. Acimovic, M. 1992. Sunflower inoculation by some parasitic fungi. 13th International Sunflower Conference, Italy. pp. p712-716. Adams, P. B. 1975. Factors affecting survival of Sclerotinia sclerotiorum in soil. Plant Disease Reporter. 59:599-603. Adams, P. B. 1987. Effects of soil temperature, moisture, and depth on survival and activity of Sclerotinia minor, Sclerotium cepivorum, and Sporidesmium sclerotivorum. Plant Disease. 71:170-174. Adams, P. B. 1989. Comparison of antagonists of Sclerotinia species. Phytopathology. 79:1345-1347. Adams, P. B. and Ayers, W. A. 1981. Sporidesmium sclerotivorum: distribution and function in natural biological control of sclerotial fungi. Phytopathology. 71:90-93. Adams, P. B. and Ayers, W. A. 1983. Histological and physiological aspects of infection of sclerotia of two Sclerotinia species by two mycoparasites. Phytopathology. 73:1072-1076. Agrios, G. N. 1988. Plant Pathology. 3 ed. San Diego: Academic Press, Inc. Akem, C. N. and Melouk, H. A. 1987. Colonization of sclerotia of Sclerotinia minor by a potential biocontrol agent, Penicillium citrinum. Peanut Science. 14:66-70. Anderson, J. B. and Kohn, L. M. 1995. Clonality in soilborne, plant-pathogenic fungi. Annual Review of Phytopathology. 33:369-391. Anderson, J. B. and Kohn, L. M. 1998. Genotyping, gene genealogies and genomics bring fungal population genetics above ground. Trends in Ecology and Evolution. 13:444-449. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 162 Bibliography _________________________________________________________________________ Andrivon, D. 1993. Nomenclature for pathogenicity and virulence: the need for precision. Phytopathology. 83:889-890. Appel, D. J. and Gordon, T. R. 1996. Relationships among pathogenic and nonpathogenic isolates of Fusarium oxysporum based on the partial sequence of the intergenic spacer region of the ribosomal DNA. Molecular Plant Microbe Interactions. 9:125-138. Arseniuk, E. and Macewicz, J. 1994. Scanning electron microscopy of apothecia of Sclerotinia trifoliorum Erikss. and related species. Journal of Phytopathology. 141:267-274. Baard, S. W. and Los, O. 1989. Two newly reported diseases of peas in South Africa. Phytophylactica. 21:307-309. Balfe, I. G. 1935. An account of sclerote-forming fungi causing diseases in Matthiola, Primula and Delphinium in Victoria. II Scleroinia minor on Primula. Proceedings Royal Society of Victoria. 47:369-386. Ballinger, D. J. and Salisbury, P. A. 1996. Seedling and adult plant evaluation of race variability in Leptosphaeria maculans on Brassica species in Australia. Australian Journal of Experimental Agriculture. 36:485-488. Baral, H. O. 1989. Contributions to the taxonomy of Discomycetes: I. Zeitschrift Fuer Mykologie. 55:119-130. Barasubiye, T., Parent, J. G., Hamelin, R. C., Laberge, S., Richard, C., and Dostaler, D. 1995. Discrimination between alfalfa and potato isolates of Verticillium albo-atrum using RAPD markers. Mycological Research. 99:1507-1512. Bazzalo, M. E., Dimarco, P., Martinez, F., and Daleo, G. R. 1991. Indicators of resistance of sunflower plant to basal stalk rot (Sclerotinia sclerotiorum): Symptomatological, biochemical, anatomical, and morphological characters of the host. Euphytica. 57:195-205. Bazzalo, M. E., Heber, E. M., Del Pero Martinez, M. A., and Caso, O. H. 1985. Phenolic compounds in stems of sunflower plants inoculated with Sclerotinia sclerotiorum and their inhibitory effects on the fungus. Journal of Phytopathology. 112:322-332. Ben-Yephet, Y. and Bitton, S. 1985. Use of a selective medium to study the dispersal of ascospores of Sclerotinia sclerotiorum. Phytoparasitica. 13:33-40. Beute, M. K., Porter, D. M., and Hadley, B. A. 1975. Sclerotinia blight of peanut in North Carolina and Virginia and its chemical control. Plant Disease Reporter. 59:697-701. Bjorling, K. 1952. Über die entwicklungsgeschichte, variabilität und pathogenität von Sclerotinia trifoliorum Erikss. Journal of Phytopathology. 18:129-156. Boeger, J. M., Chen, R. S., and McDonald, B. A. 1993. Gene flow between geographic populations of Mycosphaerella graminicola (Anamorph Septoria tritici) detected with restriction fragment length polymorphism markers. Phytopathology. 83:1148-1154. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 163 Bibliography _________________________________________________________________________ Boland, G. J. 1992. Hypovirulence and double-stranded RNA in Sclerotinia sclerotiorum. Canadian Journal of Plant Pathology. 14:10-17. Boland, G. J. and Hall, R. 1994. Index of plant hosts of Sclerotinia sclerotiorum. Canadian Journal of Plant Pathology. 16:93-108. Boland, G. J. and Inglis, G. D. 1988. Antagonism of white mold (Sclerotinia sclerotiorum) of bean by fungi from bean and rapeseed flowers. Canadian Journal of Botany. 67:1775-1781. Brasier, C. M. 1971. Induction of sexual reproduction in single A2 isolates of Phytophthora species by Trichoderma viride. Nature New Biology. 231:283. Brenneman, T. B. 1987. Control of sclerotinia blight of peanut: sensitivity and resistance of Sclerotinia minor to Vinclozolin, Iprodione, Dicloran, and PCNB. Plant Disease. 71:87-90. Brenneman, T. B., Phipps, P. M., and Stipes, R. J. 1987. Sclerotinia blight of peanut: relationship between in vitro resistance and field efficacy of dicarboximide fungicides. Phytopathology. 77:1029-1031. Brenneman, T. B., Phipps, P. M., and Stipes, R. J. 1988. A rapid method for evaluating genotype resistance, fungicide activity, and isolate pathogenicity of Sclerotinia minor in peanut. Peanut Science. 15:104-107. Brown, A. H. D., Feldman, M. W., and Nevo, E. 1980. Multilocus structure of natural populations of Hordeum spontaneum. Genetics. 96:523-536. Brown, J. K. and Simpson, C. G. 1994. Genetic analysis of DNA fingerprints and virulences in Erysiphe graminis f. sp. hordei. Current Genetics. 26:172-178. Brown, J. K. M. and Wolfe, M. S. 1990. Structure and evolution of a population of Erysiphe graminis f. sp. hordei. Plant Pathology. 39:376-390. Buchwald, N. F. and Neergaard, P. 1976. Proposal to conserve Sclerotinia Fckl: with S. sclerotiorum (Lib.) de Bary as type species. Taxon. 25:199-200. Buller, A. H. R. 1941. The diploid cell and the diploidisation process in plants and animals, with special reference to the higher fungi. Botanical Review. 7:335-431. Burdon, J. J. 1993. The structure of pathogen populations in natural plant communities. Annual Review of Phytopathology. 31:305-323. Burdon, J. J. and Jarosz, A. M. 1992. Temporal variation in the racial structure of flax rust (Melampsora lini) populations growing on natural strands of wild flax (Linum marginale): local versus metapopulation dynamics. Plant Pathology. 41:165-179. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 164 Bibliography _________________________________________________________________________ Burdon, J. J., Marshall, D. R., Luig, N. H., and Gow, D. J. S. 1982. Isozyme studies on the origin and evolution of Puccinia graminis f. sp. tritici in Australia. Australian Journal of Biological Science. 35:231-238. Burdon, J. J. and Roberts, J. K. 1995. The population genetic structure of the rust fungus Melampsora lini as revealed by pathogenicity, isozyme and RFLP markers. Plant Pathology. 44:270-278. Burdon, J. J. and Roelfs, A. P. 1985a. The effect of sexual and asexual reproduction on the isozyme structure of populations of Puccinia graminis. Phytopathology. 75:1068-1073. Burdon, J. J. and Roelfs, A. P. 1985b. Isozyme and virulence variation in asexually reproducing populations of Puccinia graminis and Puccinia recondita on wheat. Phytopathology. 75:907-913. Burgess, D. R. and Hepworth, G. 1996. Examination of sclerotial germination in Sclerotinia minor with an in vitro model. Canadian Journal of Botany. 74:450-455. Burgess, D. R., Porter, I. J., and Parbery, D. G. 1995. Relationship between sunflower development and the onset of stem rot induced by Sclerotinia minor. Australian Journal of Experimental Agriculture. 35:87-92. Callahan, F. E. and Rowe, D. E. 1991. Use of a host-pathogen interaction system to test whether oxalic acid is the sole pathogenic determinant in the exudate of Sclerotinia trifoliorum. Phytopathology. 81:1546-1550. Cappellini, R. A. 1960. Field inoculations of forage legumes and temperature studies with isolates of Sclerotinia trifoliorum and Sclerotinia sclerotiorum. Plant Disease Reporter. 44:862-864. Carbone, I., Anderson, J. B., and Kohn, L. K. 1999. Patterns of descent in clonal lineages and their multilocus fingerprints are resolved with combined gene genealogies. Evolution. 53:11-21. Carbone, I., Anderson, J. B., and Kohn, L. M. 1995. A group-I intron in the mitochondrial small subunit ribosomal RNA gene of Sclerotinia sclerotiorum. Current Genetics. 27:166-176. Carbone, I. and Kohn, L. M. 1993. Ribosomal DNA sequence divergence within internal transcribed spacer 1 of the Sclerotiniaceae. Mycologia. 85:415-427. Carlier, J., Lebrun, M. H., Zapater, M. F., Dubois, C., and Mourichon, X. 1996. Genetic structure of the global population of banana black leaf streak fungus, Mycosphaerella fijiensis. Molecular Ecology. 5:499-510. Carmer, S. G. and Swanson, M. R. 1973. An evaluation of ten pairwise multiple comparison procedures by Monte Carlo methods. Journal of the American Statistics Association. 68:66-74. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 165 Bibliography _________________________________________________________________________ Carr, A. J. H. 1954. Variation in the homothallic fungus Sclerotinia trifoliorum. Proceedings of the 8th International Botanical Congress, Paris, France. pp. 72-74. Castano, F., Vear, F., and Tourvieille de Labrouhe, D. 1993. Resistance of sunflower inbred lines to various forms of attack by Sclerotinia sclerotiorum and relations with some morphological characters. Euphytica. 68:85-98. Chambers, A. Y. 1993. Control of stem rot of rapeseed with foliar fungicides. Phytopathology. 83:465 (Abstract). Chen, R. S., Boeger, J. M., and McDonald, B. A. 1994. Genetic stability in a population of plant pathogenic fungus over time. Molecular Ecology. 3:209-218. Chen, R. S. and McDonald, B. A. 1996. Sexual reproduction plays a major role in the genetic structure of populations of the fungus Mycosphaerella graminicola. Genetics. 142:1119-1127. Chew, V. 1976. Comparing treatment means: a compendium. HortScience. 11:348-357. Clarke, R. G. 1982. Evaluation of the reaction of sunflower cultivators to Sclerotinia stem rot (Sclerotinia minor), and time of infection on yield. Department of Agricultural Research. Project Series No. 142:1-12. Clarke, R. G., Porter, I. J., and Woodroofe, M. 1992. Effect of sowing date on the incidence of sclerotinia stem rot (Sclerotinia minor) and yield of sunflowers. Proceedings of the Australian Sunflower Association 9th Workshop, Yeppon, Australia. pp. 69-71. Clarke, R. G., Porter, I. J., and Woodroofe, M. 1993. Effect of sowing date on the incidence of Sclerotinia stem rot caused by Sclerotinia minor and yield of a long- and a short-season sunflower cultivar. Australasian Plant Pathology. 22:8-13. Close, R. C., Moar, N. T., Tomlinson, A. I., and Lowe, A. D. 1978. Aerial dispersal of biological material from Australia to New Zealand. International Journal of Biometeorology. 22:1-19. Coe, D. M. 1949. Observations on apothecial productions by Sclerotinia sclerotiorum and Sclerotinia trifoliorum. California Department of Agriculture Bulletin. 38:115-121. Creelman, D. W. 1965. Summary of the prevalence of plant diseases in Canada in 1964. Canadian Plant Disease Survey. 45:37-83. Cruickshank, R. H. 1983. Distinction between Sclerotinia species by their pectic zymograms. Transactions British Mycological Society. 80:117-119. Cubeta, M. A., Cody, B. R., Kohli, Y., and Kohn, L. M. 1997. Clonality in Sclerotinia sclerotiorum on infected cabbage in Eastern North Carolina. Phytopathology. 87:10001004. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 166 Bibliography _________________________________________________________________________ Dann, E. K., Meuwly, P., Metraux, J. P., and Deverall, B. J. 1996. The effect of pathogen inoculation or chemical treatment on activities of chitinase and beta-1,3-glucanase and accumulation of salicylic acid in leaves of green bean, Phaseolus vulgaris. Physiological and Molecular Plant Pathology. 49:307-319. Day, P. R. 1974. Genetics of host-parasite interaction. Edited by A. Kelman and L. Sequeira. 1 ed. San Francisco: W. H. Freeman and Company. De Bary, A. 1884. Comparative morphology and biology of the fungi mycetozoa and bacteria. Oxford. Dennis, R. W. G. 1956. A revision of the British Helotiaceae in the herbarium of the Royal Botanic Gardens, Kew, with notes on related European species. Mycological Papers. 62:144-161. Dennis, R. W. G. 1974. Whetzelinia Korf & Dumont, a superfluous name. Kew Bulletin. 29:89-91. Dickman, M. B. and Chet, I. 1998. Biodegradation of oxalic acid: A potential new approach to biological control. Soil Biology and Biochemistry. 30:1195-1197. Drayton, F. L. 1934. The sexual mechanism of Sclerotinia gladioli. Mycologia. 26:46-72. Drayton, F. L. 1937. The perfect stage of Botrytis convoluta. Mycologia. 29:305-318. Drayton, F. L. and Groves, J. W. 1943. A new Sclerotinia causing a destructive disease of bulbs and legumes. Mycologia. 35:517-527. Drenth, A., Whisson, S. C., Maclean, D. J., Irwin, J. A. G., Obst, N. R., and Ryley, M. J. 1996. The evolution of races of Phytophthora sojae in Australia. Phytopathology. 86:163-169. Dueck, J. and Campbell, S. J. 1978. Resistance to Sclerotinia sclerotiorum (Lib.) de Bary in sunflower. Proceedings of the 8th International Sunflower Conference, Minnesota, USA. pp. 305-310. Dumont, K. P. and Korf, R. P. 1971. Sclerotiniaceae I. Generic nomenclature. Mycologia. 63:157-168. Ekins, M. G. 1993. Genetic Diversity in Sclerotinia spp. Identified Through Molecular Markers and Host Range Studies. Honours 1, Botany Department, University of Queensland, Brisbane. Ekins, M. G., Aitken, E. A. B., and Goulter, K. C. 1994a. Genetic Diversity in Sclerotinia species attacking sunflower. Proceedings of the Australian Sunflower Association 10th Workshop, Gold Coast, Queensland, Australia. pp. 66-69. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 167 Bibliography _________________________________________________________________________ Ekins, M. G., Goulter, K. C., and Aitken, E. A. B. 1994b. Genetic diversity in Sclerotinia species. Proceedings of the 7th International Symposium on Molecular Plant-Microbe Interactions, Edinburgh, Scotland. pp. 426. Errampalli, D., Baker, T. L., and Kohn, L. M. 1994. Comparison of carpogenic and ascospore germination among different clones of Sclerotinia sclerotiorum. Phytopathology. 84:1149. Errampalli, D. and Kohn, L. M. 1995. Comparison of pectic zymograms produced by different clones of Sclerotinia sclerotiorum in culture. Phytopathology. 85:292-298. Favaron, F., Castiglioni, C., D'Ovidio, R., and Alghisi, P. 1997. Polygalacturonase inhibiting proteins from Allium porrum L. and their role in plant tissue against fungal endopolygalacturonases. Physiological and Molecular Plant Pathology. 50:403-417. Flor, H. H. 1956. The complementary genic systems in flax and flax rust. Advances in Genetics. 8:29-54. Ford, E. J., Casquilho, H. E., Miller, R. V., and Sands, D. C. 1992. First report of heterokaryon in Sclerotinia sclerotiorum. Phytopathology. 82:1082. Abstract. Ford, E. J., Gray, H., Miller, R. V., and Sands, D. C. 1993. Regulation of heterokaryon formation and nuclear fusion in the homothallic fungus, Sclerotinia sclerotiorum. Proceedings of the 17th Fungal Genetics Conference, Pacific Grove, United States. pp. 63. Ford, E. J., Miller, R. V., Gray, H., and Sherwood, J. E. 1995. Heterokaryon formation and vegetative compatibility in Sclerotinia sclerotiorum. Mycological Research. 99:241-247. Foster, L. M., Kozak, K. R., Loftus, M. G., Stevens, J. J., and Ross, I. K. 1993. The polymerase chain reaction and its application to filamentous fungi. Mycological Research. 97:769-781. Fraissinet-Tachet, L., Reymond-Cotton, P., and Fevre, M. 1995. Characterization of a multigene family encoding an endopolygalacturonase in Sclerotinia sclerotiorum. Current Genetics. 29:96-99. Free, S. J., Rice, P. W., and Metzenberg, R. L. 1979. Arrangement of the genes coding for ribosomal ribonucleic acids in Neurospora crassa. Journal of Bacteriology. 137:1219-1226. Fuckel, L. 1870. Symbolae mycologicae, Beiträge zur Kenntniss der Rheinischen Pilze. Jahrb. Nassau. Ver. Naturkd. 23-24. Fujii, H. and Uhm, J. Y. 1988. Sclerotinia trifoliorum, cause of rots of trifoliorum spp. Advances in Plant Pathology. 6:233-240. Gabrielson, R. L., Anderson, W. C., and Nyvall, R. F. 1973. Control of Sclerotinia sclerotiorum in cabbage seed fields with application of benomyl and ground application of cyanamide. Plant Disease Reporter. 57:164-166. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 168 Bibliography _________________________________________________________________________ Geiser, D. M., Arnold, M. L., and Timberlake, W. E. 1994. Sexual origins of British Aspergillus nidulans isolates. Proceedings of the National Academy of Sciences USA. 91:2349-2352. Gibbs, A. 1986. Microbial Invasions. In Ecology of Biological Invasions, edited by R. H. Groves and J. J. Burdon. Canberra: Cambridge University Press. Gilligan, C. A. 1986. Use and misuse of the analysis of variance in plant pathology. Advances in Plant Pathology. 5:225-261. Godoy, G., Steadman, J. R., Dickman, M. B., and Dam, R. 1990. Use of mutants to demonstrate the role of oxalic acid in pathogenicity of Sclerotinia sclerotiorum on Phaseolus vulgaris. Physiological and Molecular Plant Pathology. 37:179-191. Goodwin, P. H. and Annis, S. L. 1991. Rapid identification of genetic variation and pathotype of Leptosphaeria maculans by random amplified polymorphic DNA assay. Applied and Environmental Microbiology. 57:2482-2486. Goodwin, S. B. 1997. The population genetics of Phytophthora. Phytopathology. 87:462-472. Goodwin, S. B., Allard, R. W., Hardy, S. A., and Webster, R. K. 1992. Hierarchical structure of pathogenic variation among Rhynchosporium secalis populations in Idaho and Oregon. Canadian Journal of Botany. 70:810-817. Goodwin, S. B., Cohen, B. A., and Fry., W. E. 1994. Panglobal distribution of single clonal lineage of the Irish potato famine fungus. Proceedings National Academy of Sciences USA. 91:11591-11595. Goodwin, S. B., Saghai Maroof, M. A., Allard, R. W., and Webster, R. K. 1993. Isozyme variation within and among populations of Rhynchosporium secalis in Europe, Australia and the United States. Mycological Research. 97:49-58. Goodwin, S. B., Sujkowski, L. S., and Fry., W. E. 1995. Rapid evolution of pathogenicity within clonal lineages of the potato late blight disease fungus. Phytopathology. 85:669-676. Goulter, K. C. 1996. Resistance in sunflower to Sclerotinia minor, Botany Department, University of New England, Armidale. Graf, F. and Schumacher, T. 1995. Sclerotinia glacialis sp. nov., from the alpine zone of Switzerland. Mycological Research. 99:113-117. Grogan, R. G. 1979. Sclerotinia species: Summary and comments on needed research. Phytopathology. 69:908-910. Groth, J. V. and Roelfs, A. P. 1987. The concept and measurement of phenotypic diversity in Puccinia graminis on wheat. Phytopathology. 77:1395-1399. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 169 Bibliography _________________________________________________________________________ Gulya, T. J. 1985. Evaluation of sunflower germplasm for resistance to sclerotinia stalk rot and race 3 downy mildew. Proceedings of the 11th International Sunflower Conference, Argentina. pp. 349-353. Gulya, T. J., Vick, B. A., and Nelson, B. D. 1989. Sclerotinia head rot of sunflower in North Dakota 1986 incidence, effect on yield and oil components, and sources of resistance. Plant Disease. 73:504-507. Gulya, T. J., Woods, D. M., Bell, R., and Mancl, M. K. 1991. Diseases of sunflower in California. Plant Disease. 75:572-574. Hancock, J. G. 1966. Degradation of pectic substances associated with pathogenesis by Sclerotinia sclerotiorum in sunflower and tomato stems. Phytopathology. 56:975-979. Harrison, S. J., Marcus, J. P., Goulter, K. C., Green, J. L., Maclean, D. J., and Manners, J. M. 1997. An antimicrobial peptide from the Australian native Hardenbergia violacea provides the first functionally characterised member of a subfamily of plant defensins. Australian Journal of Plant Physiology. 24:571-578. Hartill, W. F. T. and Underhill, A. P. 1976. "Puffing" in Sclerotinia sclerotiorum and S. minor. New Zealand Journal of Botany. 14:355-358. Hawthorne, B. T. 1973. Production of apothecia of Sclerotinia minor. New Zealand Journal of Agricultural Research. 16:559-560. Hawthorne, B. T. 1974. Sclerotinia minor on lettuce: effect of plant growth on susceptibility to infection. New Zealand Journal of Agricultural Research. 17:387-392. Hawthorne, B. T. 1976. Observation on the development of apothecia of Sclerotinia minor Jagg, in the field. New Zealand Journal Agricultural Research. 19:383-386. Held, V. M. 1955. Physiological differences between a normal and a degenerative strain of Sclerotinia trifoliorum. Phytopathology. 45:39-42. Held, V. M. and Haenseler, C. M. 1953. Cross-inoculations with New Jersey isolates of S. sclerotiorum, S. minor, and S. trifoliorum. Plant Disease Reporter. 37:515-517. Henderson, R. M. 1962. Some aspects of the life cycle of the plant pathogen Sclerotinia sclerotiorum in western Australia. Journal of the Royal Society of Western Australia. 45:133-135. Henning, A. A. and Franca Neto, J. B. 1985. Control of Sclerotinia sclerotiorum (Lib.) De Bary and Alternaria spp. in sunflower seeds. Proceedings of 11th International Sunflower Conference, Argentina. pp. 375-377. Henson, L. 1935. Apothecium production in Sclerotinia trifoliorum and S. sclerotiorum. Phytopathology. 25:19-20. (Abstract). _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 170 Bibliography _________________________________________________________________________ Henson, L. and Valleau, W. D. 1940. The production of apothecia of Sclerotinia sclerotiorum and S. trifoliorum in culture. Phytopathology. 30:869-873. Herd, G. W. and Phillips, A. J. L. 1988. Control of seed-borne Sclerotinia sclerotiorum by fungicidal treatment of sunflower seed. Plant Pathology. 37:202-205. Holley, R. C. and Nelson, B. D. 1986. Effect of plant population and inoculum density on incidence of Sclerotinia wilt of sunflower. Phytopathology. 76: 71-74. Holst-Jensen, A. and Schumacher, T. 1994. Sclerotiniaceous species on Rubus chamaemorus: morphoanatomical and RFLP studies. Mycological Research. 98:923-930. Honey, E. E. 1928. The monilioid species of Sclerotinia. Mycologia. 20:127-157. Huang, H. C. 1977. Importance of Coniothyrium minitans in survival of sclerotia of Sclerotinia sclerotiorum in wilted sunflower. Canadian Journal of Botany. 55:289-295. Huang, H. C. 1978. Biological control of sclerotinia wilt of sunflower by hyperparasites. Proceedings of the 8th International Sunflower Conference, Minnesota, USA. pp. 311-319. Huang, H. C. and Dedio, W. 1982. Registration of CM 497 and CM 526 sunflower parental lines. Crop Science. 22:166. Huang, H. C. and Dorrell, D. G. 1978. Screening sunflower seedlings for resistance to toxic metabolites produced by Sclerotinia sclerotiorum. Canadian Journal of Plant Science. 58:1107-1110. Huang, H. C. and Dueck, J. 1980. Wilt of sunflower from infection by mycelialgerminating sclerotia of Sclerotinia sclerotiorum. Canadian Journal of Plant Pathology. 2:47-52. Huang, H. C. and Hoes, J. A. 1980. Importance of plant spacing and sclerotial position to development of Sclerotinia wilt of sunflower. Plant Disease. 64:81-84. Huang, H. C. and Kozub, G. C. 1989. A simple method for production of apothecia from sclerotia of S. sclerotiorum. Plant Protection Bulletin. 31:333-345. Huang, H. C. and Kozub, G. C. 1991a. Monocropping to sunflower and decline of sclerotinia wilt. Botanical Bulletin Academia Sinica. 32:163-170. Huang, H. C. and Kozub, G. C. 1991b. Temperature requirements for carpogenic germination of sclerotia of Sclerotinia sclerotiorum isolates of different geographic origin. Botanical Bulletin Academia Sinica. 32:279-286. Huang, H. C. and Kozub, G. C. 1993. Survival of mycelia of Sclerotinia sclerotiorum in infected stems of dry bean, sunflower, and canola. Phytopathology. 83:937-940. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 171 Bibliography _________________________________________________________________________ Hubbard, J. C., Subbarao, K. V., and Koike, S. T. 1997. Development and significance of dicarboximide resistance in Sclerotinia minor isolates from commercial lettuce fields in California. Plant Disease. 81:148-153. Hutcheson, K. 1970. A test for comparing diversities based on the Shannon formula. Journal of Theoretical Biology. 29:151-154. Iliescu, H., Ionita, A., and Jinga, V. 1988. Aspecte din ecologia ciupercilor Sclerotinia sclerotiorum Lib de By. si Sclerotinia minor Jagger, parazite pe floareasoarelui in Romania. Analele Institutului de Cercetari pentru Protectia Plantelor. 21:29-44. Iliescu, H., Ionita, A., Jinga, V., Csep, N., and Iordache, E. 1992. Studies referring to methods of sunflower artificial inoculation with some pathogens. Proceedings of the 13th International Sunflower Conference, Italy. pp. 750-755. Imolehin, E. D. and Grogan, R. G. 1980. Factors affecting survival of sclerotia, and effects of inoculum density, relative position, and distance of sclerotia from the host on infection of lettuce by Sclerotinia minor. Phytopathology. 70:1162-1167. Imolehin, E. D., Grogan, R. G., and Duniway, J. M. 1980. Effect of temperature and moisture tension on growth, sclerotial production, germination and infection by Sclerotinia minor. Phytopathology. 70:1153-1157. Jagger, I. C. 1920. Sclerotinia minor, n. sp: the cause of decay of lettuce, celery, and other crops. Journal of Agricultural Research. 20:331-333. Jarvis, W. R. and Hawthorne, B. T. 1972. Sclerotinia minor on lettuce: progress of an epidemic. Annals Applied Biology. 70:207-214. Jayachandran, M., Willetts, H. J., and Bullock, S. 1987. Light and scanning electron microscope observations on apothecial development of Sclerotinia sclerotiorum, S. trifoliorum and S. minor. Transactions British Mycological Society. 589:167-178. Jeffreys, A. J., Wilson, V., and Thein, S. L. 1985. Individual-specific „fingerprints‟ of human DNA. Nature. 316:76-79. Jellis, G. J., Smith, D. B., and Scott, E. S. 1990. Identification of Sclerotinia spp. on Vicia faba. Mycological Research. 94:407-409. Johnson, S. B. and Berger, R. D. 1982. On the status of statistics in phytopathology. Phytopathology. 72:1014-1015. Jones, D. 1974. Fungicidal effects of the fumigant dazomet on sclerotia of Sclerotinia sclerotiorum in soil. Transactions British Mycological Society. 63:249-254. Jones, D. 1976. Infection of plant tissue by Sclerotinia sclerotiorum: a scanning electron microscope study. Micron. 7:275-279. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 172 Bibliography _________________________________________________________________________ Jones, D. and Gray, E. G. 1973. Factors affecting germination of sclerotia of Sclerotinia sclerotiorum from peas. Transactions British Mycological Society. 60:495-500. Julian, M. C., Debets, F., and Keijer, J. 1996. Independence of sexual and vegetative incompatibility mechanisms of Thanatephorus cucumeris (Rhizoctonia solani) anastomosis group 1. Phytopathology. 86:566-574. Keane, P. J. and Brown, J. F. 1997. Disease management: resistant cultivars. In Plant Pathogens and Plant Diseases, edited by J. F. Brown and H. J. Ogle. Armidale: Rockvale Publications. Keane, P. J. and Kerr, A. 1997. Factors affecting disease development. In Plant Pathogens and Plant Diseases., edited by J. F. Brown and H. J. Ogle. Armidale: Rockvale Publications. Keane, P. J. and Merriman, P. R. 1982. Biological control of Sclerotinia sclerotiorum on aerial parts of plants by the hyperparasite Coniothyrium minitans. Transactions British Mycological Society. 78:521-529. Keay, M. A. 1939. A study of certain species of the genus Sclerotinia. Annals of Applied Biology. 16:227-247. Keller, S. M., McDermott, J. M., Pettway, R. E., Wolfe, M. S., and McDonald, B. A. 1997a. Gene flow and sexual reproduction in the wheat glume blotch pathogen Phaeosphaeria nodorum (Anamorph Stagonospora nodorum). Phytopathology. 87:353-358. Keller, S. M., Wolfe, M. S., McDermott, J. M., and McDonald, B. A. 1997b. High genetic similarity among populations of Phaeosphaeria nodorum across wheat cultivars and regions of Switzerland. Phytopathology. 87:1134-1139. Koenig, R. L., Ploetz, R. C., and Kistler, H. C. 1997. Fusarium oxysporum f. sp. cubense consists of a small number of divergent and globally distributed clonal lineages. Phytopathology. 87:915-923. Kohli, Y., Brunner, L. J., Yoell, H., Milgroom, M. G., Anderson, J. B., Morrall, R. A. A., and Kohn, L. M. 1995. Clonal dispersal and spatial mixing in populations of the plant pathogenic fungus, Sclerotinia sclerotiorum. Molecular Ecology. 4:69-77. Kohli, Y. and Kohn, L. M. 1996. Mitochondrial haplotypes in populations of the plantinfecting fungus Sclerotinia sclerotiorum: wide distribution in agriculture, local distribution in the wild. Molecular Ecology. 5:773-783. Kohli, Y. and Kohn, L. M. 1998. Random association among alleles in clonal populations of Sclerotinia sclerotiorum. Fungal Genetics and Biology. 23:139-149. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 173 Bibliography _________________________________________________________________________ Kohli, Y., Morrall, R. A. A., Anderson, J. B., and Kohn, L. M. 1992. Local and TransCanadian clonal distribution of Sclerotinia sclerotiorum on canola. Phytopathology. 82:875-880. Kohn. 1979a. Delimitation of the economically important plant pathogenic Sclerotinia species. Phytopathology. 69:881-886. Kohn, L. M. 1979b. A monographic revision of the genus Sclerotinia. Mycotaxon. 9:365-444. Kohn, L. M. 1995. The clonal dynamic in wild and agricultural plant pathogen populations. Canadian Journal of Botany. 73:S1231-S1240. Kohn, L. M., Carbone, I., and Anderson, J. B. 1990. Mycelial interactions in Sclerotinia sclerotiorum. Experimental Mycology. 14:255-267. Kohn, L. M., Petsche, D. M., Bailey, S. R., Novak, L. A., and Anderson, J. B. 1988. Restriction fragment length polymorphisms in nuclear and mitochondrial DNA of Sclerotinia species. Phytopathology. 78:1047-1051. Kohn, L. M., Stasovski, E., Carbone, I., Royer, J., and Anderson, J. B. 1991. Mycelial incompatibility and molecular markers identify genetic variability in field populations of Sclerotinia sclerotiorum. Phytopathology. 81:480-485. Kondo, N., Kodama, F., Ozaki, M., and Akai, J. 1988. Occurrence and control of Sclerotinia head rot of sunflower in Hokkaido. Annals Phytopathological Society Japan. 54:198-203. Korf, R. P. and Dumont, K. P. 1972. Whetzelinia, a new generic name for Sclerotinia sclerotiorum and S. tuberosa. Mycologia. 64:248-251. Kosasih, B. D. and Willetts, H. J. 1975a. Ontogenetic and histochemical studies of the apothecium of Sclerotinia sclerotiorum. Annals of Botany. 39:185-191. Kosasih, B. D. and Willetts, H. J. 1975b. Types of abnormal apothecia produced by Sclerotinia sclerotiorum. Mycologia. 67:89-97. Kreitlow, K. W. 1949. Sclerotinia trifoliorum a pathogen of Phytopathology. 39:158-166. Ladino clover. Kreitlow, K. W. 1951. Infection studies with dried grain inoculum of Sclerotinia trifoliorum. Phytopathology. 41:553-558. Kreitlow, K. W. and Sprague, V. G. 1951. Effect of temperature on growth and pathogenicity of Sclerotinia trifoliorum. Phytopathology. 41:752-757. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 174 Bibliography _________________________________________________________________________ Kurdyla, T. M., Guthrie, P. A. I., McDonald, B. A., and Appel, D. N. 1995. RFLPs in mitochondrial and nuclear DNA indicate low levels of genetic diversity in the oak wilt pathogen Ceratocystis fagacearum. Current Genetics. 27:373-378. Lane, S. A. and Sproston, T. 1955. Apothecial production in Sclerotinia trifoliorum Erik. Phytopathology. 45:185. (Abstract). Leslie, J. F. 1993. Fungal vegetative compatibility. Annual Review of Phytopathology. 31:127-150. Letham, D. B., Huett, D. O., and Trimboli, D. S. 1976. Biology and control of Sclerotinia sclerotiorum in cauliflower and tomato crops in coastal New South Wales. Plant Disease Reporter. 60:286-289. Letham, D. B., Huett, D. O., and Trimboli, D. S. 1978. The control of Sclerotinia rot. Agricultural Gazette N.S.W. June:31-32. LeTourneau, D. L. 1984. Inhibition of sclerotium formation by Sclerotinia sclerotiorum with fluorophenylalanine. Transactions British Mycological Society. 82:156-159. Leung, H., Nelson, R. J., and Leach, J. E. 1993. Population structure of plant pathogenic fungi and bacteria. Advances in Plant Pathology. 10:157-205. Levy, M., Correa-Victoria, F. J., Zeigler, R. S., Xu, S., and Hamer, J. E. 1993. Genetic diversity of the rice blast fungus in a disease nursery in Colombia. Phytopathology. 83:1427-1433. Levy, M., Romano, J., Marchetti, M. A., and Hamer, J. E. 1991. DNA fingerprinting with a dispersed repeated sequence resolves pathotype diversity in the rice blast fungus. The Plant Cell. 3:95-102. Li, X., Melouk, H. A., Damicone, J. P., and Jackson, K. E. 1994. Occurrence of hypovirulence in Sclerotinia minor in Oklahoma. Phytopathology. 84:1063. Abstract. Libert, M. A. 1837. Pl. Crypt. Arduennae, Fasc. IV, No. 326. . Lithourgidis, A. S., Tzavella-Klonari, K., and Roupakias, D. G. 1989. Methods of inoculation of Faba bean plants with Sclerotinia sclerotiorum. Journal of Phytopathology. 127:123-128. Liu, Y. C., Cortesi, P., Double, M. L., MacDonald, W. L., and Milgroom, M. G. 1996. Diversity and multilocus genetic structure in populations of Cryphonectria parasitica. Phytopathology. 86:1344-1351. Loveless, A. R. 1951. The confirmation of the variety fabae Keay of Sclerotinia trifoliorum Eriksson. Annals of Applied Biology. 38:252-275. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 175 Bibliography _________________________________________________________________________ Lumsden, R. D. 1976. Pectolytic enzymes of Sclerotinia sclerotiorum and their localization in infected bean. Canadian Journal of Botany. 54:2630-2641. Lumsden, R. D. 1979. Histology and physiology of pathogenesis in plant diseases caused by Sclerotinia species. Phytopathology. 69:890-896. Lumsden, R. D. and Dow, R. L. 1973. Histopathology of Sclerotinia sclerotiorum infection of bean. Phytopathology. 63:708-715. Lumsden, R. D. and Wergin, W. P. 1980. Scanning-electron microscopy of infection of bean by species of Sclerotinia. Mycologia. 72:1200-1209. Lynch, M. 1988. Estimation of relatedness by DNA fingerprinting. Molecular Biological Evolution. 5:584-599. Lynch, M. 1990. The similarity index and DNA fingerprinting. Molecular Biological Evolution. 7:478-484. Lynch, M. and Gabriel, W. 1990. Mutation load and the survival of small populations. Evolution. 44:1725-1737. Lynch, M. and Milligan, B. G. 1994. Analysis of population genetic structure with RAPD markers. Molecular Ecology. 3:91-99. Madden, L. V., Knoke, J. K., and Louie, R. 1982. Considerations for the use of multiple comparison procedures in phytopathological investigations. Phytopathology. 72:1015-1017. Magro, P., Marciano, P., and Di Lenna, P. 1988. Enzymatic oxalate decarboxylation in isolates of Sclerotinia sclerotiorum. FEMS Microbiology Letters. 49:49-52. Maltby, A. D. and Mihail, J. D. 1994. Infection of canola by multiple genotypes of Sclerotinia sclerotiorum in central Missouri. Phytopathology. 84:1101. Maltby, A. D. and Mihail, J. D. 1997. Competition among Sclerotinia sclerotiorum genotypes within canola stems. Canadian Journal of Botany. 75:462-468. Mancl, M. K. and Shein, S. E. 1982. Field inoculation of sunflower for Sclerotinia sclerotiorum basal stalk rot and virulence of isolates from various hosts. Proceedings of 10th International Sunflower Conference, Surfers Paradise, Australia. pp. 167-169. Marciano, P., Di Lenna, P., and Magro, P. 1983. Oxalic acid, cell wall-degrading enzymes and pH in pathogenesis and their significance in the virulence of two Sclerotinia sclerotiorum isolates on sunflower. Physiological Plant Pathology. 22:339-345. Marcus, J. P., Goulter, K. C., Green, J. L., Harrison, S. J., and Manners, J. M. 1997. Purification, characterisation and cDNA cloning of an antimicrobial peptide from Macadamia integrifolia. European Journal of Biochemistry. 244:743-749. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 176 Bibliography _________________________________________________________________________ Martel, M. B., Letoublon, R., and Fevre, M. 1998. Purification and characterization of two endopolygalacturonases secreted during the early stages of the saprophytic growth of Sclerotinia sclerotiorum. FEMS Microbiology Letters. 158:133-138. Masirevic, S. and Gulya, T. J. 1992. Sclerotinia and Phomopsis - two devastating sunflower pathogens. Field Crops Research. 30:271-300. Maxwell, D. P. and Lumsden, R. D. 1970. Oxalic acid production by Sclerotinia sclerotiorum in infected bean and in culture. Phytopathology. 60:1395-1398. Maynard Smith, J. 1995. How clonal are bacteria? 52nd Symposium of the Society of General Microbiology, University of Leicester. pp. 348. Maynard Smith, J., Smith, N. H., O'Rourke, M., and Spratt, B. G. 1993. How clonal are bacteria? Proceedings National Academy of Sciences USA. 90:4384-4388. McDermott, J. M., Brandle, U., Dulty, F., Haemmerli, U. A., Keller, S., Muller, K. E., and Wolfe, M. S. 1994. Genetic variation in powdery mildew of barley: development of RAPD, SCAR, and VNTR markers. Phytopathology. 84:1316-1321. McDermott, J. M., McDonald, B. A., Allard, R. W., and Webster, R. K. 1989. Genetic variability for pathogenicity, isozyme, ribosomal DNA and colony color variants in populations of Rhynchosporium secalis. Genetics. 122:561-565. McDonald, B. A. 1997. The population genetics of fungi: tools and techniques. Phytopathology. 87:448-453. McDonald, B. A. and Martinez, J. P. 1990. DNA restriction fragment length polymorphisms among Mycosphaerella graminicola (Anamorph Septoria tritici) isolates collected from a single wheat field. Phytopathology. 80:1368-1373. McDonald, B. A. and Martinez, J. P. 1991. DNA fingerprinting of the plant pathogenic fungus Mycosphaerella graminicola (Anamorph Septoria tritici). Experimental Mycology. 15:146-158. McDonald, B. A. and McDermott, J. M. 1993. Population genetics of plant pathogenic fungi. BioScience. 43:311-319. McDonald, B. A., McDermott, J. M., Goodwin, S. B., and Allard, R. W. 1989. The population biology of host-pathogen interactions. Annual Review of Phytopathology. 27:77-94. McDonald, B. A., Miles, J., Nelson, L. R., and Pettway, R. E. 1994. Genetic variability in nuclear DNA in field populations of Stagonospora nodorum. Phytopathology. 84:250-255. McDonald, B. A., Pettway, R. E., Chen, R. S., Boeger, J. M., and Martinez, J. P. 1995. The population genetics of Septoria tritici (teleomorph Mycosphaerella graminicola). Canadian Journal of Botany. 73:S292-S301. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 177 Bibliography _________________________________________________________________________ McQuilken, M. P., Budge, S. P., and Whipps, J. M. 1997. Biological control of Sclerotinia sclerotiorum by film coating Coniothyrium minitans on to sunflower seed and sclerotia. Plant Pathology. 46:919-929. Meier, F. C., Stevenson, J. A., and Charles, V. K. 1933. Spores in the upper air. Phytopathology. 23:23. Meijer, G., Megnegneau, B., and Linders, E. G. A. 1994. Variability for isozyme, vegetative compatibility and RAPD markers in natural populations of Phomopsis subordinaria. Mycological Research. 98:267-276. Melouk, H. A., Akem, C. N., and Bowen, C. 1992. A detached shoot technique to evaluate the reaction of peanut genotypes to Sclerotinia minor. Peanut Science. 19:58-62. Melzer, M. S. and Boland, G. J. 1996. Transmissible hypovirulence in Sclerotinia minor. Canadian Journal of Plant Pathology. 18:19-28. Melzer, M. S., Smith, E. A., and Boland, G. J. 1997. Index of plant hosts of Sclerotinia minor. Canadian Journal of Plant Pathology. 19:272-280. Merriman, P. R. 1976. Survival of sclerotia of Sclerotinia sclerotiorum in soil. Soil Biology and Biochemistry. 8:385-389. Merriman, P. R. and Heathcote, R. 1979. Screening of sunflower seed for Sclerotinia spp. Australian Plant Pathology Society. 7:43. Miclaus, D., Sin, G., Damian, V., and Guran, M. 1988. Presence and spread of Sclerotinia sclerotiorum (Lib.) de Bary on seeds of various cereal and industrial crops. Analele Institutului de Cercetari pentru Cereale si Plante Technice Fundulea. 56:169-188. Milgroom, M. G. 1995. Population biology of the chestnut blight fungus Cryphonectria parasitica. Canadian Journal of Botany. 73:S311-S319. Milgroom, M. G. 1996. Recombination and the multilocus structure of fungal populations. Annual Review of Phytopathology. 34:457-477. Milgroom, M. G., Lipari, S. E., and Powell, W. A. 1992. DNA fingerprinting and analysis of population structure in the chestnut blight fungus, Cryphonectria parasitica. Genetics. 131:297-306. Milgroom, M. G., MacDonald, W. L., and Double, M. L. 1991. Spatial pattern analysis of vegetative compatibility groups in the chestnut blight fungus, Cryphonectria parasitica. Canadian Journal of Botany. 69:1407-1413. Miller, R. V., Ford, E. J., and Sands, D. C. 1989. A nonsclerotial pathogenic mutant of Sclerotinia sclerotiorum. Canadian Journal of Microbiology. 35:517-520. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 178 Bibliography _________________________________________________________________________ Mitchell, S. J., Budge, S. P., Whipps, J., M., Fenlon, J. S., and Archer, S. A. 1995. Effect of Coniothyrium minitans on sclerotial survival and apothecial production of Sclerotinia sclerotiorum in field-grown oilseed rape. Plant Pathology. 44: 883-896. Mitchell, S. J. and Wheeler, B. E. J. 1990. Factors affecting the production of apothecia and longevity of sclerotia of Sclerotinia sclerotiorum. Plant Pathology. 39:70-76. Moore, W. D. 1949. Flooding as a means of destroying the sclerotia of Sclerotinia sclerotiorum. Phytopathology. 39:920-927. Morgan, O. D. 1952. Correlation of the growth rate of 23 Sclerotinia isolates in vitro with rate of infectivity in five hosts at five different temperatures. Phytopathology. 42:471 (Abstract). Morrall, R. A. A. 1993. Rationalizing the control of sclerotinia stem rot of spring canola with benomyl in Western Canada. Proceedings of 6th Congress on Plant Pathology, Montreal, Canada. pp. 14. Morrall, R. A. A., Duczek, L. J., and Sheard, J. W. 1972. Variations and correlations within and between morphology, pathogenicity, and pectolytic activity in Sclerotinia from Saskatchewan. Canadian Journal Botany. 50:767-786. Morrall, R. A. A. and Dueck, J. 1982. Epidemiology of sclerotinia stem rot of rapeseed in Saskatchewan. Canadian Journal of Plant Pathology. 4:161-168. Muller, H. J. 1964. The relation of recombination to mutational advance. Mutation Research. 1:2-9. Murillio, I., Cavallarin, L., and San-Segundo, B. 1998. The development of a rapid PCR assay for detection of Fusarium moniliforme. European Journal of Plant Pathology. 104:301-311. Natti, J. J. 1971. Epidemiology and control of bean white mold. Phytopathology. 61:669-674. Nei, M. 1972. Genetic distance between populations. American Naturalist. 106:283-292. Nei, M. 1973. Analysis of gene diversity in subdivided populations. Proceedings of the National Academy of Sciences USA. 70:3321-3323. Nei, M., Maruyama, T., and Chakraborty, R. 1975. The bottleneck effect and genetic variability in populations. Evolution. 29:1-10. Noyes, R. D. and Hancock, J. G. 1981. Role of oxalic acid in the Sclerotinia wilt of sunflower. Physiological Plant Pathology. 18:123-132. Orellana, R. G. 1975. Photoperiod influence on the susceptibility of sunflower to sclerotinia stalk rot. Phytopathology. 65:1293-1298. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 179 Bibliography _________________________________________________________________________ Palti, J. 1963. Sclerotinia sclerotiorum in Israel. Phytopathologia Mediterranea. 2:60-64. Patterson, C. L. and Grogan, R. G. 1984a. Evidence for heterothallism in some isolates of Sclerotinia minor. Phytopathology. 74:835 (Abstract). Patterson, C. L. and Grogan, R. G. 1984b. Hyphal interactions among single sclerotial isolates of Sclerotinia minor. Phytopathology. 74:834 (Abstract). Patterson, C. L. and Grogan, R. G. 1985. Differences in epidemiology and control of lettuce drop caused by Sclerotinia minor and S. sclerotiorum. Plant Disease. 69:766-770. Pawlowski, S. H. and Hawn, E. J. 1964. Host-parasite relationships in sunflower wilt incited by Sclerotinia sclerotiorum as determined by the twin technique. Phytopathology. 54:33-35. Peever, T. L. and Milgroom, M. G. 1994. Genetic structure of Pyrenophora teres populations determined with random amplified polymorphic DNA markers. Canadian Journal of Botany. 72:915-923. Pereyra, V. R., Sala, C. A., and Bazzalo, C. A. 1992. A comparison between Argentine and French sunflower hybrid varieties for their resistance to head rot caused by Sclerotinia sclerotiorum (Lib.) de Bary. Proceedings of 13th International Sunflower Conference, Italy. pp. 1199-1204. Petersen, G. R., Russo, G. M., and Van Etten, J. L. 1982. Identification of major proteins in sclerotia of Sclerotinia minor and Sclerotinia trifoliorum. Experimental Mycology. 6:268-273. Phillips, A. J. L. 1986. Factors affecting the parasitic activity of Gliocladium virens on sclerotia of Sclerotinia sclerotiorum and a note on its host range. Journal of Phytopathology. 116:212-220. Phillips, A. J. L. 1989. Fungi associated with sclerotia of Sclerotinia sclerotiorum in South Africa and their effects on the pathogen. Phytophylactica. 21:135-139. Phillips, A. J. L. 1990. The effects of soil solarization on sclerotial populations of Sclerotinia sclerotiorum. Plant Pathology. 39:38-43. Phillips, A. J. L. 1992. Some common weed species as alternative hosts for Sclerotinia sclerotiorum. Phytophylactica. 24:207-210. Phipps, P. M. and Porter, D. M. 1982. Sclerotinia blight of soybean caused by Sclerotinia minor and Sclerotinia sclerotiorum. Plant Disease. 66:163-165. Phipps, P. M. and Porter, D. M. 1993. Evaluation of Trichoderma harzianum (TH-88) for biological control of Sclerotinia blight of peanut. Biological and Cultural Tests. 4:40. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 180 Bibliography _________________________________________________________________________ Pierre, J. G. and Regnault, Y. 1982. Methods of studying the reaction of some cultivars and wild species of sunflower to infection by Sclerotinia sclerotiorum. Proceedings of 10th International Sunflower Conference, Surfers Paradise, Australia. pp. 165-167. Pipe, N. D., Buck, K. W., and Brasier, C. M. 1995. Molecular relationships between Ophiostoma ulmi and the NAN and EAN races of O. novo-ulmi determined by RAPD markers. Mycological Research. 99:653-658. Porter, D. M. and Phipps, P. M. 1985a. Effects of three fungicides on mycelial growth, sclerotium production, and development of fungicide-tolerant isolates of Sclerotinia minor. Plant Disease. 69:143-146. Porter, D. M. and Phipps, P. M. 1985b. Tolerance of Sclerotinia minor to procymidone and cross tolerance to other dicarboximide fungicides and dicloran. Peanut Science. 12:41-45. Porter, I., Clarke, R., and Woodroofe, M. 1994. Successful strategies to control Sclerotinia stem rot of sunflowers. Proceedings of the Australian Sunflower Association 10th Workshop, Gold Coast, Australia. pp. 70-74. Porter, I. J. and Clarke, R. G. 1992. Sclerotinia stem rot of sunflowers: the disease in perspective. Proceedings of the Australian Sunflower Association 9th Workshop, Yeppon, Australia. pp. 64-68. Pratt, R. G. 1992. Sclerotinia. In Methods for research on soilborne phytopathogenic fungi, edited by L. L. Singleton, J. D. Mihail and C. M. Rush. St. Paul, Minn.: APS Press. Pratt, R. G., Dabney, S. M., and Mays, D. A. 1988. New forage legume hosts of Sclerotinia trifoliorum and S. sclerotiorum in the southeastern United States. Plant Disease. 72:593596. Pratt, R. G. and Rowe, D. E. 1991. Differential responses of alfalfa genotypes to stem inoculations with Sclerotinia sclerotiorum and S. trifoliorum. Plant Disease. 75:188-191. Pratt, R. G. and Rowe, D. E. 1995. Comparative pathogenicity of isolates of Sclerotinia trifoliorum and S. sclerotiorum on alfalfa cultivars. Plant Disease. 79:474-477. Price, K. and Colhoun, J. 1975a. Pathogenicity of isolates of Sclerotinia sclerotiorum (Lib.) de Bary to several hosts. Journal of Phytopathology. 83:232-238. Price, K. and Colhoun, J. 1975b. A study of variability of isolates of Sclerotinia sclerotiorum (Lib.) de Bary from different hosts. Journal of Phytopathology. 83:159-166. Prior, G. D. and Owen, J. H. 1964. Pathological anatomy of Sclerotinia trifoliorum on clover and alfalfa. Phytopathology. 54:784-787. Purdy, L. H. 1955. A broader concept of the species Sclerotinia sclerotiorum based on variability. Phytopathology. 45:421-427. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 181 Bibliography _________________________________________________________________________ Putt, E. D. 1958. Note on differences in susceptibility to sclerotinia wilt in sunflowers. Canadian Journal of Plant Science. 38:380-381. Raina, K., Jackson, N., and Chandlee, J. M. 1997. Detection of genetic variation in Sclerotinia homoeocarpa isolates using RAPD analysis. Mycological Research. 101:585-590. Ramsey, G. B. 1924. Sclerotinia intermedia n. sp. A cause of decay of salsify and carrots. Phytopathology. 14:323-327. Ramsey, G. B. 1925. Sclerotinia species causing decay of vegetables under transit and market conditions. Journal of Agricultural Research. 31:597-631. Rao, A. G. 1995. Antimicrobial peptides. Molecular Plant-Microbe Interactions. 8:6-13. Raymond, M. and Rousset, F. 1995a. An exact test for population differentiation. Evolution. 49:1280-1283. Raymond, M. and Rousset, F. 1995b. GENEPOP (Version 1.2): Population genetics software for exact tests and Ecumenicism. Journal of Heredity. 86:248-249. Reeves, R. J. and Jackson, R. M. 1972. Induction of Phytophthora cinnamomi oospores in soil by Trichoderma viride. Transactions British Mycological Society. 59:156-159. Regente, M. C., Oliva, C. R., Feldman, M. L., Castagnaro, A. P., and L., D. l. C. 1997. A sunflower leaf antifungal peptide active against Sclerotinia sclerotiorum. Physiologia Plantarum. 100:178-182. Rehnstrom, A. L. and Free, S. J. 1993. A simple method for the mating of Sclerotinia trifoliorum. Experimental Mycology. 17:236-239. Reichert, I. 1958. Fungi and plant diseases in relation to biogeography. Transactions of the New York Academy of Sciences. 20:333-339. Reymond-Cotton, P., Fraissinet-Tachet, L., and Fevre, M. 1996. Expression of the Sclerotinia sclerotiorum polygalacturonase pg1 gene: Possible involvement of CREA in glucose catabolite repression. Current Genetics. 30:240-245. Rice, W. R. 1988. Analyzing tables of statistical tests. Evolution. 43:223-225. Riddle, G. E., Burpee, L. L., and Boland, G. J. 1991. Virulence of Sclerotinia sclerotiorum and S. minor on dandelion (Taraxacum officinale). Weed Science. 39:109-118. Rosewich, U. L., Pettway, R. E., McDonald, B. A., Duncan, R. R., and Frederiksen, R. A. 1998. Genetic structure and temporal dynamics of a Colletotrichum graminicola population in a sorghum disease nursery. Phytopathology. 88:1087-1093. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 182 Bibliography _________________________________________________________________________ Sackston, W. E. 1956. Observations and speculations on rust (Puccinia helianthi Schw.) and some other diseases of sunflowers in Chile. Plant Disease Reporter. 40:744-747. Sackston, W. E. 1957. Diseases of sunflowers in Uruguay. Plant Disease Reporter. 41: 885-889. Sackston, W. E. 1992. Managing the major sunflower diseases: from cultural practices to breeding for resistance. Proceedings of the13th International Sunflower Conference. pp. 667-699. Saito, I. 1973. Initiation and development of apothecial stipe primordia in sclerotia of Sclerotinia sclerotiorum. Transactions Mycological Society Japan. 14:343-351. Saito, I. 1997. Sclerotinia nivalis, sp. nov., the pathogen of snow mold of herbaceous dicots in northern Japan. Mycoscience. 38:227-236. Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual. 2nd Edition ed. 3 vols. Cold Spring Harbor: Cold Spring Harbor Laboratory Press. Scheffer, R. P. 1997. The Nature of Disease in Plants. Cambridge: Cambridge University Press. Schesser, K., Luder, A., and Henson, J. M. 1991. Use of polymerase chain reaction to detect the take-all fungus, Gaeumannomyces graminis, in infected wheat plants. Applied and Environmental Microbiology. 57:553-556. Schleier, S., Voigt, K., and Wostemeyer, J. 1997. RAPD-based molecular diagnosis of mixed fungal infections on oilseed rape (Brassica napus): evidence for genus- and speciesspecific sequences in the fungal genomes. Journal of Phytopathology. 145:81-87. Schneiter, A. A. and Miller, J. F. 1981. Description of sunflower growth stages. Crop Science. 21:901-903. Scott, S. W. 1984. Clover rot. Botanical Review. 50:492-504. Sedun, F. S. and Brown, J. F. 1984. Development of stem lesions as an index of resistance in sunflower to Sclerotinia diseases. Proceedings of the Australian Sunflower Association 5th Workshop, Emerald, Australia. pp. 102-105. Sedun, F. S. and Brown, J. F. 1986. Reducing losses caused by Sclerotinia diseases. Proceedings of the 6th Australian Sunflower Association Workshop, Gunnedah. pp. 12-15. Sedun, F. S. and Brown, J. F. 1989. Comparison of three methods to assess resistance in sunflower to basal stem rot caused by Sclerotinia sclerotiorum and S. minor. Plant Disease. 73:52-55. Sedun, F. S., Seguin-Swartz, G., and Rakow, G. F. W. 1989. Genetic variation in reaction to Sclerotinia stem rot in Brassica species. Canadian Journal of Plant Science. 69:229-232. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 183 Bibliography _________________________________________________________________________ Siddiqui, M. Q., Brown, J. F., and Allen, S. J. 1975. Growth stages of sunflower and intensity indices for white blister and rust. Plant Disease Reporter. 59:7-11. Skoric, D. and Rajcan, I. 1992. Breeding for Sclerotinia tolerance in sunflower. Proceedings of the 13th International Sunflower Conference, Italy. pp. 1257-1262. Slatter, J. S. 1992. Sunflower planting strategies to minimise disease losses. Proceedings of the Australian Sunflower Association 9th Workshop, Yeppon, Queensland. pp. 86-93. Smith, E. A. and Boland, G. J. 1989. A reliable method for the production and maintenance of germinated sclerotia of Sclerotinia sclerotiorum. Canadian Journal of Plant Pathology. 11:45-48. Smith, F. D., Phipps, P. M., and Stipes, R. J. 1991. Agar plate, soil plate, and field evaluation of Fluazinam and other fungicides for control of Sclerotinia minor on peanut. Plant Disease. 75:1138-1143. Smith, F. D., Phipps, P. M., Stipes, R. J., and Brenneman, T. B. 1995. Significance of insensitivity of Sclerotinia minor to iprodione in control of Sclerotinia blight of peanut. Plant Disease. 79:517-523. Spalding, D. H. and Reeder, W. F. 1974. Postharvest control of Sclerotinia rot of snap bean pods with heated and unheated chemical dips. Plant Disease Reporter. 59:59-62. Sproston, T. and Pease, D. C. 1957. Influence of thermoperiods on production of the sexual stage of the fungus Sclerotinia trifoliorum Erik. Transactions New York Academy Sciences. 20:199-204. Steadman, J. R. 1979. Control of plant diseases caused by Sclerotinia species. Phytopathology. 69:904-907. Stoddart, J. A. and Taylor, J. F. 1988. Genotypic diversity: estimation and prediction in samples. Genetics. 118:705-711. Stover, R. H. 1962. Intercontinental spread of the banana leaf spot (Mycosphaerella musicola Leach). Tropical Agriculture (Trinidad). 39:327-328. Stovold, G. E. and Moore, K. J. 1972. Diseases. Agricultural Gazette NSW.:262-264. Svrcek, M. 1988. New or less known Discomycetes: XVIII. Ceska Mykologie. 42:137-148. Swallow, W. H. 1984. Those overworked and oft-misused mean separation procedures Duncan‟s, LSD etc. Plant Disease. 68:919-921. Tantaoui, A., Ouinten, M., Geiger, J. P., and Fernandez, D. 1996. Characterization of a single clonal lineage of Fusarium oxysporum f. sp. albedinis causing bayiud disease of date palm in Morocco. Phytopathology. 86:787-792. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 184 Bibliography _________________________________________________________________________ Tariq, V. N., Gutteridge, C. S., and Jeffries, P. 1985. Comparative studies of cultural and biochemical characteristics used for distinguishing species within Sclerotinia. Transactions British Mycological Society. 84:381-397. Tariq, V.-N. and Jeffries, P. 1984. Appressorium formation by Sclerotinia sclerotiorum: scanning electron microscopy. Transactions British Mycological Society. 82:645-651. Taylor, J. W., Geiser, D. M., Burt, A., and Koufopanou, V. 1999. The evolutionary biology and population genetics underlying fungal strain typing. Clinical Microbiology Reviews. 12:126-146. Terras, F. R. G., Schoofs, H. M. E., De Bolle, M. F. C., Van Leuven, F., Rees, S. B., Vanderleyden, J., Cammue, B. P. A., and Broekaert, W. F. 1992. Analysis of two novel classes of plant antifungal proteins from radish (Raphanus sativis L.) seeds. The Journal of Biological Chemistry. 267:15301-15309. Thuault, M. C. and Tourvieille, D. 1988. Study of the pathogenic power of eight Sclerotinia isolates belonging to the species S. sclerotiorum, S. minor and S. trifoliorum on sunflower. Information Techniques CETIOM. 103:21-27. Tibayrenc, M., Kjellberg, F., Arnaud, J., Oury, B., Breniere, S. F., Darde, M. L., and Ayala, F. J. 1991. Are eukaryotic microorganisms clonal or sexual? A population genetics vantage. Proceedings National Academy Sciences USA. 88:5129-5133. Tibayrenc, M., Neubauer, K., Barnabe, C., Guerrini, F., Skarecky, D., and Ayala, F. J. 1993. Genetic characterization of six parasitic protozoa: parity between random primer DNA typing and multilocus enzyme electrophoresis. Proceedings National Academy of Sciences. 90:1335-1339. Uhm, J. Y. and Fujii, H. 1982. Sclerotinia sclerotiorum. Annual Phytopathological Society Japan. 48:85. (Abstract). Uhm, J. Y. and Fujii, H. 1983a. Ascospore dimorphism in Sclerotinia trifoliorum and cultural characters of strains from different-sized spores. Phytopathology. 73:565-569. Uhm, J. Y. and Fujii, H. 1983b. Heterothallism and mating type mutation in Sclerotinia trifoliorum. Phytopathology. 73:569-572. Vandervort, N. W. and Kucharek, T. A. 1994. Environmental factors affecting carpogenic germination of sclerotia of Sclerotinia sclerotiorum from Florida. Phytopathology. 84:1071. (Abstract). Vear, F. and Tourvieille, D. L. 1984. Recurrent selection for resistance to Sclerotinia sclerotiorum in sunflowers using artificial infections. Agronomie. 4:789-794. Vogel, H. J. 1964. Distribution of lysine pathways among fungi: Evolutionary implications. American Naturalist. 98:435-446. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 185 Bibliography _________________________________________________________________________ Wakefield, E. M. 1924. On the names Sclerotinia sclerotiorum (Lib.) Massee, and S. libertiana Fuckel. Phytopathology. 14:126-127. Waksman, G. 1988. Molecular cloning of genes expressed specifically during induction of cell wall degrading enzymes from Sclerotinia sclerotiorum and preliminary identification of fungal beta-galactosidase encoding gene by expression in Escherichia coli. Current Genetics. 14:91-93. Waksman, G. 1989. Molecular cloning of a beta-glucosidase-encoding gene from Sclerotinia sclerotiorum by expression in Escherichia coli. Current Genetics. 15:295-297. Warmington, C. 1981. Sunflowers in Australia. Toowoomba, Australia: Pacific Seeds. Weir, B. S. 1996. Genetic Data Analysis II. Massachusetts: Sinauer Associates, Inc. Welsh, J. and McClelland, M. 1990. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Research. 18:7213-7218. Whetzel, H. H. 1945. A synopsis of the genera and species of the Sclerotinaceae, a family of stromatic inoperculate discomycetes. Mycologia. 37:648-666. Whipps, J. and Gerlagh, M. 1992. Biology of Coniothyrium minitans and its potential for use in disease biocontrol. Mycological Research. 96:897-907. Willets, H. J. and Wong, A. L. 1971. Ontogenetic diversity of sclerotia of Sclerotinia sclerotiorum and related species. Transactions British Mycological Society. 57:515-524. Willetts, H. J. and Wong, J. A.-L. 1980. The biology of Sclerotinia sclerotiorum, S. trifoliorum, and S. minor with emphasis on specific nomenclature. The Botanical Review. 46:101-165. Williams, G. H. and Western, J. H. 1965a. The biology of Sclerotinia trifoliorum Erikss., other species of sclerotium-forming fungi. II. The survival of sclerotia in soil. Annals of Applied Biology. 56:261-268. Williams, G. H. and Western, J. H. 1965b. The biology of Sclerotinia trifoliorum Erikss., other species of sclerotium-forming fungi. I. Apothecium formation from sclerotia. Annals of Applied Biology. 56:253-260. Williams, J. G. K., Kubelik, A. R., Rafalski, J. A., Livak, K. J., and Tingey, S. V. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research. 18:6531-6535. Williams, J. R. and Stelfox, D. 1979. Dispersal of ascospores of Sclerotinia sclerotiorum in relation to sclerotinia stem rot of rapeseed. Plant Disease Reporter. 63:395-399. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 186 Bibliography _________________________________________________________________________ Wong, A. L. and Willetts, H. J. 1973. Electrophoretic studies of soluble proteins and enzymes of Sclerotinia species. Transactions British Mycological Society. 61:167-178. Wong, A. L. and Willetts, H. J. 1975a. Electrophoretic studies of Australasian, North America and European isolates of Sclerotinia sclerotiorum and related species. Journal of General Microbiology. 90:355-359. Wong, A. L. and Willetts, H. J. 1975b. A taxonomic study of Sclerotinia sclerotiorum and related species: mycelial interactions. Journal of General Microbiology. 88:339-344. Wong, A. L. and Willetts, H. J. 1979. Cytology of Sclerotinia sclerotiorum and related species. Journal of General Microbiology. 112:29-34. Wong, J. A. L. 1979. Lettuce drop or Sclerotinia drop. Journal of Agriculture, Tasmania. 50:107-108. Workman, P. L. and Niswander, J. D. 1970. Population studies on Southwestern Indian tribes, II. Local genetic differentiation in the Papago. American Journal of Human Genetics. 22:24-29. Wright, S. 1951. The genetical structure of populations. Annals of Eugenetics. 15:323-354. Wu, W. S. 1991. Control of Sclerotinia rot of sunflower and chrysanthemum. Plant protection Bulletin (Taipei). 33:45-55. Wymore, L. A. and Lorbeer, J. W. 1987. Effect of cold treatment and drying on mycelial germination by sclerotia of Sclerotinia minor. Phytopathology. 77:851-855. Zazzerini, A. and Tosi, L. 1985. Antagonistic activity of fungi isolated from sclerotia of Sclerotinia sclerotiorum. Plant Pathology. 34:415-421. Zolan, M. E. and Pukkila, P. J. 1986. Inheritance of DNA methylation in Coprinus cinereus. Molecular and Cellular Biology. 6:195-200. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 187 Appendix 1 _________________________________________________________________________ Appendix 1 Lesion length measurements (mm) and means for all isolates for both experiments and both days. Isolate 1261-1 1261-2 1261-3 1262-1 1262-2 1262-3 1263-1 1263-2 1263-3 1264-1 1264-2 1264-3 1271-1 1271-2 1271-3 1272-1 1272-2 1272-3 1274-1 1274-2 1274-3 1275-1 1275-2 1275-3 1276-1 1276-2 1276-3 1277-1 1277-2 1277-3 1278-1 1278-2 1278-3 1279-1 1279-2 1279-3 1280-1 1280-2 1280-3 1281-1 1281-2 1281-3 1283-1 1283-2 1283-3 1284-1 1284-2 1284-3 1285-1 1285-2 1285-3 1286-1 1286-2 1286-3 1287-1 1287-2 1287-3 A 30 50 30 12 41 42 26 23 12 63 47 17 40 49 28 47 58 61 7 47 27 66 15 17 46 32 68 18 17 22 27 53 33 19 21 37 15 20 12 47 18 32 35 25 35 35 51 52 56 55 45 38 31 25 3 3 57 Exp 1 Day 1 B C D 80 32 30 20 8 17 27 33 48 30 24 43 53 56 35 48 42 60 32 35 50 15 33 11 13 25 31 49 25 50 84 80 49 18 19 32 18 31 25 44 39 30 33 32 40 60 17 43 32 62 80 44 36 48 10 25 14 44 24 34 49 41 28 21 22 49 3 7 6 12 5 30 64 45 54 33 21 17 66 87 84 15 9 8 19 47 31 33 71 61 17 29 15 78 68 77 42 48 60 21 40 11 36 57 40 50 17 30 30 19 27 34 15 11 27 12 17 27 34 22 51 9 48 34 10 8 37 25 22 18 13 42 35 38 40 68 65 60 33 44 50 41 60 60 30 11 40 37 20 40 54 26 27 55 37 40 85 36 55 60 34 32 6 22 14 6 15 15 27 30 27 mean 43 23.75 34.5 27.25 46.25 48 35.75 20.5 20.25 46.75 65 21.5 28.5 40.5 33.25 41.75 58 47.25 14 37.25 36.25 39.5 7.75 16 52.25 25.75 76.25 12.5 28.5 46.75 22 69 45.75 22.75 38.5 33.5 22.75 20 17 32.5 31.5 21 29.75 24.5 37 57 44.5 53.25 34.25 38 38 42.5 51.75 37.75 11.25 9.75 35.25 A 72 50 41 13 97 87 48 39 18 90 75 17 60 100 45 100 81 121 8 68 73 88 18 18 85 36 106 28 21 36 32 78 46 19 22 50 21 52 13 77 19 38 56 44 90 60 105 73 71 84 92 93 41 39 7 3 94 Exp 1 Day 2 B C D 130 72 67 50 8 39 40 64 110 66 55 90 93 87 69 72 66 105 50 45 91 16 35 11 18 37 45 62 57 64 135 147 105 30 20 41 20 33 41 75 57 45 38 36 63 127 32 78 86 92 130 61 72 85 15 28 14 51 45 44 52 56 53 22 48 73 5 7 7 15 5 61 98 88 71 58 30 29 121 153 124 17 30 11 33 98 65 78 124 104 19 43 15 135 117 132 63 75 93 43 58 11 56 93 68 98 18 32 36 26 56 72 29 13 28 14 20 48 66 52 72 21 67 45 10 9 47 26 22 26 13 49 52 58 56 117 123 120 88 92 80 95 106 95 39 13 48 51 20 78 84 58 55 85 72 40 137 65 110 97 81 56 9 40 19 10 15 17 40 52 72 mean 85.25 36.75 63.75 56 86.5 82.5 58.5 25.25 29.5 68.25 115.5 27 38.5 69.25 45.5 84.25 97.25 84.75 16.25 52 58.5 57.75 9.25 24.75 85.5 38.25 126 21.5 54.25 85.5 27.25 115.5 69.25 32.75 59.75 49.5 34.75 41.5 18.75 60.75 44.75 25.5 37.75 33 64 105 91.25 92.25 42.75 58.25 72.25 72.5 88.25 68.25 18.75 11.25 64.5 A 43 17 40 51 40 42 32 26 37 43 21 12 68 68 38 35 29 32 15 46 25 36 50 38 44 46 45 28 26 31 60 80 32 25 30 15 23 27 17 20 17 37 56 19 52 43 12 58 35 7 15 33 30 20 7 15 30 Exp 2 Day 1 B C D 21 12 25 43 17 29 31 23 27 64 36 57 48 11 40 23 35 27 45 54 23 25 19 35 24 32 46 20 30 53 37 41 24 28 31 23 22 27 30 43 33 36 40 30 20 30 65 65 25 30 67 24 40 33 24 46 32 51 50 30 82 27 63 21 12 20 7 52 11 27 31 50 58 32 31 39 34 57 42 53 39 75 60 26 44 21 22 53 25 81 39 27 24 15 37 30 24 73 50 34 13 20 31 30 22 27 25 27 23 30 27 17 53 41 21 34 36 13 53 15 22 28 33 36 55 47 68 44 50 16 21 29 38 17 55 72 16 38 31 26 58 72 16 56 14 76 31 11 24 0 31 29 34 34 22 16 9 27 20 30 33 47 17 29 13 14 9 9 66 35 34 mean 25.25 26.5 30.25 52 34.75 31.75 38.5 26.25 34.75 36.5 30.75 23.5 36.75 45 32 48.75 37.75 32.25 29.25 44.25 49.25 22.25 30 36.5 41.25 44 44.75 47.25 28.25 47.5 37.5 40.5 44.75 23 28.25 23.5 25.75 34.5 27 25.25 25 43.75 54.5 21.25 40.5 42.25 31.75 50.5 39 10.5 27.25 26.25 21.5 32.5 16.5 11.75 41.25 Exp 2 Day 2 A B C D 87 24 14 43 18 71 17 55 52 40 25 38 85 102 70 68 42 95 12 70 62 40 40 55 55 47 62 33 27 25 19 38 55 24 38 68 49 23 30 68 23 83 54 28 30 47 52 45 73 30 52 38 118 60 37 42 62 46 30 22 71 41 75 92 38 27 39 102 52 28 69 65 16 43 61 65 65 73 66 35 29 140 28 90 52 24 15 20 61 8 60 13 57 29 63 95 65 69 42 45 80 57 41 68 72 50 108 50 37 130 105 43 42 82 22 47 53 70 45 101 85 42 32 30 125 16 47 52 40 102 108 65 47 52 13 21 36 32 67 25 15 35 61 30 30 60 65 56 29 22 102 81 17 22 51 50 42 16 82 15 19 24 35 37 48 51 67 80 95 97 55 92 19 17 23 29 76 47 18 87 55 120 17 81 13 38 26 111 95 102 22 91 35 17 143 62 8 11 52 2 15 51 40 71 47 34 27 18 35 10 46 22 20 53 36 66 8 17 35 13 15 15 12 9 57 118 70 43 mean 42 40.25 38.75 81.25 54.75 49.25 49.25 27.25 46.25 42.5 47 43.5 48.25 64.25 40 69.75 51.5 53.5 46.25 59.75 71.75 27.75 35.5 61 55.25 61.5 70 78.75 48.25 67.25 47.25 60 78.75 33.25 40 35.25 52.75 58.5 35 38.75 28.75 61.5 84.75 22 57 68.25 47 77.5 64.25 18.25 44.25 31.5 28.25 43.75 18.25 12.75 72 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 188 Appendix 1 _________________________________________________________________________ Lesion length measurements (mm) and means for all isolates for both experiments and both days (continued). Isolate 1289-1 1289-2 1289-3 1290-1 1290-2 1290-3 1291-1 1291-2 1291-3 1292-1 1292-2 1292-3 1293-1 1293-2 1293-3 1325-1 1325-2 1325-3 1326-1 1326-2 1326-3 1327-1 1327-2 1327-3 1328-1 1328-2 1328-3 1329-1 1329-2 1329-3 1330-1 1330-2 1330-3 1333-1 1333-2 1333-3 1334-1 1334-2 1334-3 1336-1 1336-2 1336-3 1337-1 1337-2 1337-3 1342-1 1342-2 1342-3 1343-1 1343-2 1343-3 1344-1 1344-2 1344-3 1346-1 1346-2 1346-3 1347-1 1347-2 1347-3 1348-1 1348-2 1348-3 A 70 31 21 46 46 30 40 19 35 44 31 29 43 11 14 57 63 11 58 30 32 77 47 40 52 1 24 25 67 11 53 0 33 44 54 54 24 28 30 23 14 26 30 40 32 61 20 45 39 34 27 8 33 50 34 45 22 47 11 36 22 41 59 Exp 1 Day 1 B C D 46 15 45 55 31 26 24 47 64 15 46 56 29 14 12 25 19 7 43 77 51 14 35 15 28 33 31 45 13 35 24 20 34 16 19 36 60 15 57 4 20 51 20 27 23 90 51 89 87 46 40 57 21 20 44 37 15 37 31 40 12 22 37 77 70 75 47 57 70 18 35 18 1 32 75 0 0 2 11 8 25 7 38 46 16 47 52 27 40 33 12 16 15 3 0 0 42 40 55 62 45 47 42 22 40 28 51 22 26 27 47 43 48 18 20 45 49 52 33 13 25 12 15 46 57 37 17 45 68 27 44 51 47 52 56 57 25 22 31 19 32 18 16 8 22 22 35 32 52 45 26 20 13 22 24 10 68 27 68 40 38 42 21 22 58 40 18 23 17 70 36 61 13 31 13 15 16 30 51 40 29 43 20 62 35 25 45 63 50 mean 44 35.75 39 40.75 25.25 20.25 52.75 20.75 31.75 34.25 27.25 25 43.75 21.5 21 71.75 59 27.25 38.5 34.5 25.75 74.75 55.25 27.75 40 0.75 17 29 45.5 27.75 24 0.75 42.5 49.5 39.5 38.75 31 34.25 36 30.25 16.5 41.5 40 40.5 46.75 41.25 25.5 21.75 29.5 40.75 21.5 16 49 42.5 33.75 31.5 36.25 38 13.75 39.25 28.5 40.75 54.25 A 140 47 22 98 84 43 94 26 63 77 70 51 62 11 37 130 103 11 88 62 40 145 121 78 81 1 32 25 132 15 82 0 57 110 92 90 56 87 51 35 15 39 37 70 70 115 47 88 48 53 35 10 150 80 100 52 25 82 15 50 32 85 138 Exp 1 Day 2 B C D 116 24 72 118 63 32 33 90 100 15 102 94 56 18 16 42 25 20 85 124 80 14 40 17 63 60 45 60 28 39 40 55 40 19 19 40 115 47 82 7 30 112 34 40 32 157 105 145 121 85 65 79 45 25 45 75 20 61 60 85 29 31 67 116 135 115 67 117 125 20 87 40 1 50 140 0 0 3 12 14 39 7 75 97 21 72 91 30 89 62 12 17 35 3 0 0 77 86 90 113 76 68 104 25 74 62 94 61 35 54 62 96 91 24 20 74 78 56 55 37 40 12 31 62 100 67 34 46 134 42 90 111 117 82 117 90 52 28 62 90 40 18 19 14 31 42 40 60 77 64 33 26 21 28 30 14 114 64 128 114 74 85 33 32 70 74 37 64 21 121 62 86 16 47 14 18 27 39 100 60 38 57 27 88 57 68 45 113 96 mean 88 65 61.25 77.25 43.5 32.5 95.75 24.25 57.75 51 51.25 32.25 76.5 40 35.75 134.25 93.5 40 57 67 41.75 127.75 107.5 56.25 68 1 24.25 51 79 49 36.5 0.75 77.5 91.75 73.75 76.75 51.75 74.5 55.75 45.75 24.5 67 62.75 78.25 96.5 71.25 59.75 34.75 40.25 63.5 28.75 20.5 114 88.25 58.75 56.75 57.25 57.75 18.5 62.25 38.5 74.5 98 A 32 30 13 54 36 21 19 31 54 35 34 25 23 75 14 38 35 55 35 18 52 29 28 50 72 0 0 40 33 31 35 0 41 96 54 32 32 51 31 45 31 23 41 60 52 36 46 57 0 50 35 38 42 37 48 33 43 20 29 21 19 35 9 Exp 2 Day 1 B C D 13 36 35 27 53 36 24 20 23 22 49 18 46 50 34 28 27 22 39 35 31 47 53 54 30 58 62 49 29 51 33 33 51 26 37 53 49 52 54 47 40 49 60 35 20 27 29 53 68 69 43 48 50 18 15 53 51 40 20 25 76 70 50 30 40 45 54 52 27 40 33 45 64 49 29 7 3 0 19 10 14 22 35 46 11 45 43 24 33 42 16 8 16 0 0 0 42 35 42 41 30 64 50 51 80 48 27 37 33 22 39 40 42 51 47 65 38 46 57 37 39 31 27 27 16 28 58 36 49 9 19 24 40 35 81 67 32 20 25 63 65 31 34 60 9 13 11 41 54 15 22 22 30 18 43 38 26 40 22 26 35 26 30 58 48 70 18 27 38 56 41 48 24 20 20 54 33 21 12 20 23 24 17 20 30 50 50 40 29 mean 29 36.5 20 35.75 41.5 24.5 31 46.25 51 41 37.75 35.25 44.5 52.75 32.25 36.75 53.75 42.75 38.5 25.75 62 36 40.25 42 53.5 2.5 10.75 35.75 33 32.5 18.75 0 40 57.75 58.75 36 31.5 46 45.25 46.25 32 23.5 46 28 52 38.75 49.75 45.5 8.25 40 27.25 34.25 32.5 31 46 37 44.5 28 34 18.5 20.75 33.75 32 Exp 2 Day 2 A B C D 96 34 69 35 63 50 111 71 13 36 38 45 102 51 61 20 80 76 72 55 22 35 80 22 30 80 54 80 44 60 85 90 80 38 115 101 45 70 50 80 34 63 33 79 29 47 70 65 30 70 95 55 127 86 67 68 14 82 40 42 49 28 44 98 67 97 79 47 60 50 67 18 60 24 85 52 20 75 20 36 83 106 105 75 31 35 45 67 28 89 52 27 55 51 35 67 125 86 70 40 0 8 3 0 0 20 18 16 73 47 35 82 73 11 97 46 49 38 55 68 54 16 8 16 0 0 3 0 75 68 46 44 132 74 40 92 96 76 89 120 65 65 43 82 42 41 22 44 92 61 60 82 64 55 90 73 76 91 87 62 38 71 63 45 38 33 19 30 41 90 63 50 104 12 53 25 82 42 55 112 52 120 47 20 73 35 87 95 106 40 35 80 12 10 13 11 145 52 70 17 36 32 22 49 40 18 73 40 55 42 46 24 37 37 44 45 55 30 65 50 53 86 23 36 44 60 75 66 22 66 40 22 50 25 58 35 35 43 14 33 31 24 24 19 56 42 72 92 11 79 85 53 mean 58.5 73.75 33 58.5 70.75 39.75 61 69.75 83.5 61.25 52.25 52.75 62.5 87 44.5 54.75 72.5 48.75 55.25 37.75 92.25 44.5 49 52 80.25 2.75 13.5 59.25 56.75 52.5 23.5 0.75 58.25 84.5 95.25 63.75 37.25 73.75 70.5 79 54.25 30 61 48.5 72.75 59.75 72.5 65.25 11.5 71 34.75 42.75 41.75 40.75 50 49.5 61.25 37.5 42 31.25 24.5 65.5 57 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 189 Appendix 2 _________________________________________________________________________ Appendix 2 Mean lesion length measurements (mm) for same plant isolates for both experiments and both days. Same Plant Isolate 1261 1262 1263 1264 1271 1272 1274 1275 1276 1277 1278 1279 1280 1281 1283 1284 1285 1286 1287 1289 1290 1291 1292 1293 1325 1326 1327 1328 1329 1330 1333 1334 1336 1337 1342 1343 1344 1346 1347 1348 Exp 1 Day 1 33.75 40.50 25.50 44.42 34.08 49.00 29.17 21.08 51.42 29.25 45.58 31.58 19.92 28.33 30.42 51.58 36.75 44.00 18.75 39.58 28.75 35.08 28.83 28.75 52.67 32.92 52.58 19.25 34.08 22.42 42.58 33.75 29.42 42.42 29.50 30.58 35.83 33.83 30.33 41.17 Exp 1 Day 2 61.92 75.00 37.75 70.25 51.08 88.75 42.25 30.58 83.25 53.75 70.67 47.33 31.67 43.67 44.92 96.17 57.75 76.33 31.50 71.42 51.08 59.25 44.83 50.75 89.25 55.25 97.17 31.08 59.67 38.25 80.75 60.67 45.75 79.17 55.25 44.17 74.25 57.58 46.17 70.33 Exp 2 Day 1 27.33 39.50 33.17 30.25 37.92 39.58 40.92 29.58 43.33 41.00 40.92 24.92 29.08 31.33 38.75 41.50 25.58 26.75 23.17 28.50 33.92 42.75 38.00 43.17 44.42 42.08 39.42 22.25 33.75 19.58 50.83 40.92 33.92 42.00 44.67 25.17 32.58 42.50 26.83 28.83 Exp 2 Day 2 40.33 61.75 40.83 44.33 50.83 58.25 59.25 41.42 62.25 64.75 62.00 36.17 48.75 43.00 54.58 64.25 42.25 34.50 34.33 55.08 56.33 71.42 55.42 64.92 58.67 61.75 48.50 32.17 56.17 27.50 81.17 60.50 54.42 60.75 65.83 39.08 41.75 53.58 36.92 49.00 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 190 Appendix 3 _________________________________________________________________________ Appendix 3 Allele frequencies at 11 RFLP loci in S. sclerotiorum collections comparing Gatton and Wyreema in 1994. Significant 2 test for differences in allele frequencies and significant differences at P<0.05. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 4 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Gatton (n=60) 0.50 0.50 0.45 0.55 0.00 0.30 0.40 0.30 0.40 0.60 0.60 0.40 0.35 0.60 0.05 0.00 1.00 0.75 0.25 0.50 0.50 0.45 0.55 0.15 0.85 Wyreema (n=60) 0.47 0.53 0.33 0.67 0.10 0.20 0.28 0.42 0.33 0.67 0.78 0.22 0.77 0.23 0.00 0.10 0.90 0.60 0.40 0.73 0.27 0.48 0.52 0.15 0.85 2 0.13 Total 0.48 0.52 0.39 0.61 0.05 0.25 0.34 0.36 0.37 0.63 0.69 0.31 0.56 0.42 0.03 0.05 0.95 0.68 0.33 0.62 0.38 0.47 0.53 0.15 0.85 1.71 9.54*a 0.57 4.73* 22.00* 6.32* 3.08 6.91* 0.13 0 *a indicates significant differences Nei‟s measure of gene diversity for each location (Hi), gene diversity in the total population (HT), gene diversity within locations (HS), average gene diversity between locations (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for 11 RFLP loci in populations of S. sclerotiorum collected from sunflower causing head rot and basal stem rot in Gatton and Wyreema 1994. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 All loci Gatton (Hi) Wyreema (Hi) 0.50 0.50 0.50 0.44 0.66 0.70 0.48 0.44 0.48 0.34 0.52 0.36 0.00 0.18 0.38 0.48 0.50 0.39 0.50 0.50 0.26 0.26 0.43 0.42 HT 0.50 0.48 0.69 0.46 0.43 0.51 0.10 0.44 0.47 0.50 0.26 0.44 HS 0.50 0.47 0.68 0.46 0.41 0.44 0.09 0.43 0.45 0.50 0.26 0.42 DST 0.00 0.01 0.01 0.00 0.02 0.08 0.01 0.01 0.03 0.00 0.00 0.01 I 1.00 0.98 0.93 0.99 0.95 0.73 0.99 0.97 0.91 1.00 1.00 0.99 D 0.00 0.03 0.07 0.01 0.05 0.27 0.01 0.04 0.09 0.00 0.00 0.05 GST 0.00 0.01 0.02 0.00 0.04 0.15 0.05 0.03 0.06 0.00 0.00 0.03 Nm 449 35 29 104 12 3 9 19 8 447 2000 15 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 191 Appendix 3 _________________________________________________________________________ Allele frequencies at 11 RFLP loci in clonally corrected S. sclerotiorum collections comparing Gatton and Wyreema in 1994. Significant 2 test for differences in allele frequencies and significant differences at P<0.05. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 Gatton (n=10) Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 4 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Wyreema (n=11) 0.45 0.55 0.27 0.73 0.09 0.27 0.27 0.36 0.27 0.73 0.91 0.09 0.82 0.18 0.00 0.09 0.91 0.45 0.55 0.82 0.18 0.55 0.45 0.18 0.82 0.60 0.40 0.30 0.70 0.00 0.20 0.20 0.60 0.20 0.80 0.60 0.40 0.60 0.30 0.10 0.00 1.00 0.60 0.40 0.40 0.60 0.30 0.70 0.20 0.80 2 Total 0.53 0.47 0.28 0.71 0.05 0.24 0.24 0.47 0.24 0.76 0.76 0.24 0.71 0.24 0.05 0.05 0.95 0.53 0.48 0.62 0.38 0.43 0.57 0.19 0.81 0.44 0.02 1.76 0.15 2.76 1.76 0.96 0.44 3.88*a 1.29 0.01 *a indicates significant differences Nei‟s measure of gene diversity for each location (Hi), gene diversity in the total population (HT), gene diversity within locations (HS), average gene diversity between locations (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for 11 RFLP loci in clonally corrected populations of S. sclerotiorum collected from sunflower causing head rot and basal stem rot in Gatton and Wyreema 1994. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 All loci Gatton (Hi) 0.48 0.42 0.56 0.32 0.48 0.54 0.00 0.48 0.48 0.42 0.32 0.41 Wyreema (Hi) 0.50 0.40 0.71 0.40 0.17 0.30 0.17 0.50 0.30 0.50 0.30 0.38 HT HS DST I D GST Nm 0.50 0.41 0.65 0.36 0.37 0.44 0.09 0.50 0.48 0.49 0.31 0.42 0.49 0.41 0.64 0.36 0.33 0.42 0.08 0.49 0.39 0.46 0.31 0.40 0.01 0.00 0.02 0.00 0.05 0.02 0.00 0.01 0.09 0.03 0.00 0.02 0.96 1.00 0.92 0.99 0.88 0.96 1.00 0.96 0.72 0.89 1.00 0.93 0.04 0.01 0.03 0.01 0.12 0.04 0.01 0.04 0.29 0.11 0.00 0.07 0.02 0.00 0.03 0.01 0.13 0.04 0.05 0.02 0.18 0.06 0.00 0.05 23 549 17 68 3 12 10 23 2 8 934 9 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 192 Appendix 3 _________________________________________________________________________ Allele frequencies at 11 RFLP loci in S. sclerotiorum collections comparing Gatton and Wyreema in 1994 and 1996. Significant 2 test for differences in allele frequencies and significant differences at P<0.05. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 Gatton (n=80) Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 4 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 0.45 0.55 0.45 0.55 0.01 0.29 0.40 0.30 0.41 0.59 0.63 0.38 0.40 0.54 0.06 0.00 1.00 0.71 0.29 0.55 0.45 0.45 0.55 0.16 0.84 Wyreema (n=80) 0.53 0.48 0.30 0.70 0.19 0.16 0.23 0.43 0.26 0.74 0.73 0.28 0.75 0.23 0.03 0.08 0.93 0.61 0.39 0.71 0.29 0.45 0.55 0.24 0.76 2 Total 0.49 0.51 0.38 0.63 0.10 0.23 0.31 0.36 0.34 0.66 0.68 0.33 0.58 0.38 0.04 0.04 0.96 0.66 0.34 0.63 0.37 0.45 0.55 0.20 0.80 0.90 3.84 20.67*a 4.03* 1.82 20.05* 6.23* 1.79 4.54* 0 1.41 *a indicates significant differences Nei‟s measure of gene diversity for each location (Hi), gene diversity in the total population (HT), gene diversity within locations (HS), average gene diversity between locations (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for 11 RFLP loci in populations of S. sclerotiorum collected from sunflower causing head rot and basal stem rot in Gatton and Wyreema 1994 and 1996. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 All loci Gatton (Hi) 0.50 0.50 0.67 0.48 0.47 0.55 0.00 0.41 0.50 0.50 0.27 0.44 Wyreema (Hi) 0.50 0.42 0.71 0.39 0.40 0.39 0.14 0.47 0.41 0.50 0.36 0.43 HT HS DST I D GST Nm 0.50 0.47 0.71 0.45 0.44 0.52 0.07 0.45 0.47 0.50 0.32 0.44 0.47 0.46 0.69 0.44 0.43 0.47 0.07 0.44 0.45 0.50 0.32 0.43 0.00 0.01 0.02 0.01 0.01 0.06 0.00 0.01 0.01 0.00 0.00 0.01 0.99 0.96 0.85 0.96 0.98 0.80 1.00 0.98 0.96 1.00 0.99 0.96 0.01 0.04 0.15 0.04 0.02 0.20 0.00 0.02 0.05 0.00 0.01 0.04 0.01 0.02 0.03 0.03 0.01 0.11 0.04 0.01 0.03 0.00 0.01 0.03 83 20 15 19 43 4 12 44 17 2000 56 18 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 193 Appendix 3 _________________________________________________________________________ Allele frequencies at 11 RFLP loci in clonally corrected S. sclerotiorum collections comparing Gatton and Wyreema in 1994 and 1996. Significant 2 test for differences in allele frequencies and significant differences at P<0.05. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 Gatton (n=21) Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 4 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Wyreema (n=20) 0.55 0.45 0.25 0.75 0.20 0.20 0.15 0.45 0.20 0.80 0.80 0.20 0.75 0.20 0.05 0.05 0.95 0.50 0.50 0.80 0.20 0.50 0.50 0.30 0.70 0.47 0.53 0.24 0.76 0.05 0.24 0.14 0.57 0.19 0.81 0.62 0.38 0.76 0.14 0.09 0.00 1.00 0.48 0.52 0.52 0.48 0.24 0.77 0.24 0.76 2 Total 0.51 0.49 0.24 0.76 0.12 0.22 0.15 0.51 0.20 0.80 0.71 0.29 0.76 0.17 0.07 0.02 0.98 0.49 0.51 0.66 0.34 0.37 0.63 0.27 0.73 0.22 0.00 2.32 0.01 1.62 0.48 1.08 0.02 3.48 3.03 0.20 Nei‟s measure of gene diversity for each location (Hi), gene diversity in the total population (HT), gene diversity within locations (HS), average gene diversity between locations (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for 11 RFLP loci in clonally corrected populations of S. sclerotiorum collected from sunflower causing head rot and basal stem rot in Gatton and Wyreema 1994 and 1996. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 All loci Gatton (Hi) 0.50 0.36 0.59 0.31 0.47 0.39 0.00 0.50 0.50 0.36 0.36 0.40 Wyreema (Hi) 0.50 0.38 0.70 0.32 0.32 0.40 0.10 0.50 0.32 0.50 0.42 0.40 HT HS DST I D GST Nm 0.50 0.37 0.65 0.31 0.41 0.40 0.05 0.50 0.45 0.47 0.39 0.41 0.50 0.37 0.64 0.31 0.40 0.39 0.05 0.50 0.41 0.43 0.39 0.40 0.00 0.00 0.01 0.00 0.02 0.00 0.00 0.00 0.04 0.03 0.02 0.01 1.00 1.00 0.95 1.00 0.95 1.00 1.00 1.00 0.88 0.89 1.00 0.97 0.01 0.00 0.05 0.00 0.05 0.00 0.00 0.00 0.12 0.11 0.00 0.03 0.01 0.00 0.02 0.00 0.04 0.00 0.03 0.00 0.09 0.07 0.01 0.02 91 2000 33 2000 12 144 19 881 5 6 102 21 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 194 Appendix 3 _________________________________________________________________________ Allele frequencies at 11 RFLP loci in S. sclerotiorum collections comparing QLD and NSW in 1996. Significant 2 test for differences in allele frequencies and significant differences at P<0.05. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 4 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 QLD (n=40) 0.50 0.50 0.35 0.65 0.20 0.12 0.20 0.48 0.33 0.68 0.60 0.40 0.70 0.20 0.10 0.13 0.87 0.60 0.40 0.68 0.32 0.35 0.65 0.25 0.75 NSW (n=50) 0.48 0.52 0.42 0.58 0.16 0.16 0.34 0.34 0.40 0.60 0.68 0.32 0.60 0.32 0.08 0.10 0.90 0.60 0.40 0.72 0.28 0.52 0.48 0.16 0.84 2 0.04 Total 0.49 0.51 0.39 0.61 0.18 0.14 0.28 0.40 0.37 0.63 0.64 0.36 0.64 0.27 0.09 0.11 0.89 0.60 0.40 0.70 0.30 0.44 0.56 0.20 0.80 0.46 2.97 0.54 0.62 1.65 0.14 0.00 0.21 2.60 1.13 Nei‟s measure of gene diversity for each state (Hi), gene diversity in the total population (HT), gene diversity within states (HS), average gene diversity between states (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for 11 RFLP loci in populations of S. sclerotiorum collected from sunflower causing head rot and basal stem rot in QLD and NSW 1996. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 All loci QLD (Hi) 0.50 0.46 0.68 0.44 0.48 0.46 0.22 0.48 0.44 0.46 0.38 0.45 NSW (Hi) 0.50 0.49 0.72 0.48 0.44 0.53 0.18 0.48 0.40 0.50 0.27 0.45 HT 0.50 0.47 0.71 0.46 0.46 0.50 0.20 0.48 0.42 0.49 0.33 0.46 HS 0.50 0.47 0.70 0.46 0.46 0.50 0.20 0.48 0.42 0.48 0.32 0.45 DST 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 I 1.00 1.00 0.94 0.99 0.99 0.98 1.00 1.00 1.00 0.95 0.99 0.99 D 0.00 0.01 0.07 0.01 0.01 0.02 0.00 0.00 0.00 0.05 0.01 0.02 GST 0.00 0.01 0.01 0.01 0.01 0.01 0.00 0.00 0.00 0.03 0.01 0.01 Nm 1249 96 34 82 71 40 319 2000 208 17 40 56 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 195 Appendix 3 _________________________________________________________________________ Allele frequencies at 11 RFLP loci in clonally corrected S. sclerotiorum collections comparing small QLD and NSW in 1996. Significant 2 test for differences in allele frequencies and significant differences at P<0.05. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 4 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 QLD (n=24) 0.63 0.38 0.25 0.75 0.21 0.13 0.08 0.58 0.21 0.79 0.50 0.50 0.79 0.08 0.13 0.13 0.87 0.50 0.50 0.58 0.42 0.25 0.75 0.29 0.71 NSW (n=26) 0.56 0.42 0.23 0.77 0.27 0.19 0.12 0.42 0.19 0.81 0.65 0.35 0.81 0.08 0.12 0.15 0.85 0.42 0.58 0.69 0.31 0.35 0.65 0.27 0.73 2 0.12 Total 0.60 0.40 0.24 0.76 0.24 0.16 0.10 0.50 0.20 0.80 0.58 0.42 0.80 0.08 0.12 0.14 0.86 0.46 0.54 0.64 0.36 0.30 0.70 0.28 0.72 0.02 1.32 0.02 1.21 0.02 0.09 0.30 0.64 0.55 0.03 Nei‟s measure of gene diversity for each state (Hi), gene diversity in the total population (HT), gene diversity within states (HS), average gene diversity between states (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for 11 RFLP loci in clonally corrected populations of S. sclerotiorum collected from sunflower causing head rot and basal stem rot in QLD and NSW 1996. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 All loci QLD (Hi) 0.47 0.38 0.59 0.33 0.50 0.35 0.22 0.50 0.49 0.38 0.41 0.42 NSW (Hi) 0.49 0.36 0.70 0.31 0.45 0.33 0.26 0.49 0.43 0.46 0.39 0.42 HT 0.48 0.37 0.65 0.32 0.49 0.34 0.24 0.50 0.46 0.42 0.43 0.42 HS 0.48 0.37 0.65 0.32 0.48 0.34 0.24 0.49 0.46 0.41 0.40 0.42 DST 0.00 0.00 0.01 0.00 0.01 0.00 0.00 0.00 0.01 0.00 0.03 0.00 I 1.00 1.00 0.97 1.00 0.96 1.00 1.00 0.99 0.98 0.99 1.00 1.00 D 0.00 0.00 0.04 0.00 0.04 0.00 0.00 0.01 0.02 0.01 0.00 0.01 GST 0.00 0.00 0.01 0.00 0.02 0.00 0.00 0.01 0.01 0.01 0.00 0.08 Nm 207 987 37 1247 20 1739 287 83 38 45 801 64 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 196 Appendix 3 _________________________________________________________________________ Allele frequencies at 11 RFLP loci in S. sclerotiorum collections made at Gatton and Wyreema in 1994 and 1996 comparing years. Significant 2 test for differences in allele frequencies and significant differences at P<0.05. Locus pME012 1994 season (n=120) 0.48 0.53 0.39 0.61 0.05 0.25 0.34 0.36 0.37 0.63 0.69 0.31 0.56 0.42 0.03 0.05 0.95 0.67 0.33 0.62 0.38 0.47 0.53 0.15 0.85 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 4 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 1996 season (n=40) 0.50 0.50 0.33 0.67 0.25 0.15 0.23 0.37 0.25 0.75 0.63 0.37 0.63 0.27 0.10 0.00 1.00 0.63 0.37 0.67 0.33 0.40 0.60 0.35 0.65 Total 0.49 0.51 0.38 0.63 0.10 0.23 0.31 0.36 0.34 0.66 0.68 0.32 0.58 0.38 0.04 0.04 0.96 0.66 0.34 0.63 0.37 0.45 0.55 0.20 0.80 2 0.03 0.57 14.66*a 1.83 0.61 5.67 2.08 0.34 0.44 0.54 7.50* *a indicates significant differences Nei‟s measure of gene diversity for each year (Hi), gene diversity in the total population (HT), gene diversity within years (HS), average gene diversity between years (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for 11 RFLP loci in populations of S. sclerotiorum collected from sunflower in 1994 and 1996. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 All loci 1994 (Hi) 0.50 0.48 0.69 0.46 0.43 0.51 0.10 0.44 0.47 0.50 0.26 0.44 1996 (Hi) 0.50 0.44 0.72 0.38 0.47 0.52 0.00 0.47 0.44 0.48 0.46 0.44 HT HS DST I D GST Nm 0.50 0.46 0.72 0.43 0.45 0.53 0.05 0.46 0.46 0.49 0.38 0.45 0.50 0.46 0.71 0.42 0.45 0.52 0.05 0.45 0.46 0.49 0.36 0.44 0.00 0.00 0.02 0.01 0.00 0.01 0.00 0.00 0.00 0.00 0.02 0.01 1.00 0.99 0.90 0.98 0.99 0.97 1.00 1.00 1.00 0.99 0.95 0.98 0.00 0.01 0.10 0.02 0.01 0.03 0.00 0.00 0.01 0.01 0.01 0.02 0.00 0.00 0.02 0.02 0.00 0.01 0.03 0.00 0.00 0.00 0.05 0.01 1799 103 22 31 101 34 19 181 134 110 9 40 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 197 Appendix 3 _________________________________________________________________________ Allele frequencies at 11 RFLP loci in clonally corrected S. sclerotiorum collections made at Gatton and Wyreema in 1994 and 1996 comparing years. Significant 2 test for differences in allele frequencies and significant differences at P<0.05. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 4 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 1994 (n=18) 0.56 0.44 0.22 0.78 0.06 0.28 0.17 0.50 0.17 0.83 0.78 0.22 0.78 0.17 0.06 0.06 0.94 0.44 0.56 0.61 0.39 0.39 0.61 0.22 0.78 1996 (n=22) 0.45 0.55 0.27 0.73 0.18 0.18 0.14 0.50 0.23 0.77 0.68 0.32 0.73 0.18 0.09 0.00 1.00 0.50 0.50 0.73 0.27 0.36 0.64 0.32 0.68 2 0.40 Total 0.50 0.50 0.25 0.75 0.13 0.22 0.15 0.50 0.20 0.80 0.73 0.27 0.75 0.17 0.08 0.02 0.98 0.48 0.52 0.678 0.32 0.38 0.62 0.28 0.72 0.14 1.73 0.23 0.46 0.21 1.25 0.12 0.61 0.03 0.46 Nei‟s measure of gene diversity for each year (Hi), gene diversity in the total population (HT), gene diversity within years (HS), average gene diversity between years (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for 11 RFLP loci in clonally corrected populations of S. sclerotiorum collected from sunflower in 1994 and 1996 comparing years. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 All loci 1994 (Hi) 0.49 0.34 0.64 0.28 0.35 0.36 0.10 0.49 0.48 0.48 0.35 0.40 1996 (Hi) 0.50 0.40 0.67 0.35 0.44 0.43 0.00 0.50 0.40 0.46 0.43 0.42 HT 0.50 0.37 0.66 0.32 0.39 0.40 0.05 0.50 0.44 0.47 0.40 0.41 HS 0.49 0.37 0.65 0.31 0.39 0.40 0.05 0.50 0.44 0.47 0.39 0.41 DST 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.00 I 0.98 1.00 0.96 1.00 1.00 1.00 1.00 1.00 0.98 1.00 0.99 0.99 D 0.02 0.00 0.04 0.00 0.01 0.00 0.00 0.01 0.02 0.00 0.01 0.01 GST 0.01 0.00 0.01 0.01 0.01 0.00 0.03 0.00 0.02 0.00 0.01 0.01 Nm 48 146 50 86 42 197 17 161 32 736 42 64 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 198 Appendix 3 _________________________________________________________________________ Allele frequencies at 11 RFLP loci in S. sclerotiorum collections comparing mode of infection (head rot and basal stem rot) in total Australian population in 1994 and 1996. Significant 2 test for differences in allele frequencies and significant differences at P<0.05. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 4 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Head (n=130) 0.42 0.58 0.38 0.62 0.10 0.22 0.32 0.35 0.35 0.65 0.72 0.28 0.62 0.31 0.07 0.07 0.93 0.61 0.39 0.72 0.28 0.45 0.55 0.23 0.77 Basal Stem rot (n=120) 0.56 0.44 0.38 0.6 2 0.16 0.17 0.28 0.40 0.34 0.66 0.61 0.39 0.58 0.38 0.05 0.06 0.94 0.68 0.32 0.58 0.42 0.44 0.56 0.17 0.83 2 Total 0.49 0.51 0.38 0.62 0.13 0.20 0.30 0.37 0.35 0.65 0.66 034 0.60 0.34 0.06 0.06 0.94 0.64 0.36 0.66 0.34 0.45 0.55 0.20 0.80 4.57 0.01 3.51 0.04 3.21 1.46 0.12 1.23 5.40*a 0.04 1.60 *a indicates significant differences Nei‟s measure of gene diversity for each mode of infection (Hi), gene diversity in the total population (HT), gene diversity within mode of infection (HS), average gene diversity between modes of infection (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for 11 RFLP loci in populations of S. sclerotiorum collected from sunflower causing head rot and basal stem rot in Australia in 1994 and 1996. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 All loci Head Rot (Hi) 0.49 0.47 0.71 0.46 0.41 0.51 0.13 0.48 0.40 0.50 0.36 0.45 Basal Stem Rot (Hi) 0.49 0.48 0.71 0.45 0.48 0.52 0.11 0.44 0.49 0.49 0.28 0.45 HT HS DST I D GST Nm 0.50 0.47 0.71 0.45 0.45 0.52 0.12 0.46 0.45 0.49 0.32 0.45 0.49 0.47 0.71 0.45 0.44 0.52 0.12 0.46 0.44 0.50 0.32 0.52 0.01 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.96 1.00 0.98 1.00 0.98 0.99 1.00 0.99 0.97 1.00 1.00 1.00 0.04 0.00 0.02 0.00 0.02 0.01 0.00 0.01 0.03 0.00 0.00 0.01 0.02 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.02 0.00 0.01 0.01 27 2000 129 2000 39 144 1005 101 23 2000 77 73 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 199 Appendix 3 _________________________________________________________________________ Allele frequencies at 11 RFLP loci in clonally corrected S. sclerotiorum collections comparing mode of infection (head rot and basal stem rot) in total Australian population in 1994 and 1996. significant 2 test for differences in allele frequencies and significant differences at P<0.05. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 Head (n=34) Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 4 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 3 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Basal Stem Rot (n=37) 0.59 0.41 0.24 0.76 0.27 0.16 0.08 0.49 0.19 0.81 0.62 0.38 0.84 0.11 0.05 0.11 0.90 0.46 0.54 0.62 0.38 0.30 0.70 0.32 0.68 0.56 0.44 0.18 0.82 0.12 0.32 0.18 0.44 0.15 0.85 0.68 0.32 0.74 0.09 0.18 0.09 0.91 0.44 0.56 0.73 0.26 0.35 0.65 0.30 0.70 2 Total 0.58 0.42 0.21 0.79 0.20 0.24 0.10 0.46 0.17 0.83 0.65 0.35 0.79 0.10 0.11 0.10 0.90 0.45 0.55 0.68 0.32 0.32 0.68 0.31 0.69 0.09 0.47 4.34 0.22 0.23 2.66 0.08 0.02 1.05 0.25 0.08 Nei‟s measure of gene diversity for each mode of infection (Hi), gene diversity in the total population (HT), gene diversity within mode of infection (HS), average gene diversity between modes of infection (DST), genetic identity (I), genetic distance (D), population differentiation (GST) and gene flow parameter (Nm) for 11 RFLP loci in clonally corrected populations of S. sclerotiorum collected from sunflower causing head rot and basal stem rot in Australia. Locus pME012 pME082 pME106 pME147 pME230 pME241 pME283 pME285 pME163 pME036 pME062 All loci Head Rot (Hi) 0.49 0.29 0.67 0.25 0.44 0.42 0.16 0.49 0.39 0.46 0.42 0.41 Basal Stem Rot (Hi) 0.48 0.37 0.66 0.31 0.47 0.20 0.19 0.50 0.47 0.42 0.44 0.42 HT HS DST I D GST Nm 0.49 0.33 0.68 0.28 0.46 0.36 0.18 0.50 0.44 0.44 0.43 0.42 0.49 0.33 0.67 0.28 0.45 0.35 0.18 0.50 0.43 0.44 0.42 0.41 0.00 0.00 0.01 0.00 0.00 0.01 0.00 0.00 0.01 0.00 0.00 0.00 1.00 1.00 0.92 1.00 1.00 0.99 1.00 1.00 0.98 1.00 1.00 0.99 0.00 0.01 0.08 0.02 0.01 0.01 0.00 0.00 0.02 0.01 0.00 0.01 0.00 0.01 0.02 0.00 0.00 0.02 0.00 0.00 0.01 0.00 0.00 0.01 381 74 25 157 151 27 448 1480 33 141 468 67 _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 200 Appendix 4 _________________________________________________________________________ Appendix 4 Summary of Mycelial Compatibility Interactions. For each interaction the reaction between two colonies were scored as follows: 1. Compatible, with both colonies freely intermingling 2. Incompatible, with a very wide (1 cm) but very faint band 3. Incompatible, faint band 4. Incompatible, very wide (1 cm) band of fluffy white aerial mycelium 5. Incompatible, fluffy white aerial mycelium, faint band on reverse 6. Incompatible, fluffy white aerial mycelium, distinctive red line on reverse 7. Incompatible, thin red line visible on both sides 8. Incompatible, obvious red line on both sides but fluffy aerial mycelium as well 9. Incompatible, obvious red line on both sides of the plate The table is presented as a fold out table on the next page comparing the interactions between all 120 isolates. _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 201 Appendix 4 _________________________________________________________________________ _________________________________________________________________________ Merrick Ekins Genetic Diversity in Sclerotinia species 202