Mycol Progress DOI 10.1007/s11557-014-0991-1 ORIGINAL ARTICLE Alternaria capsicicola sp. nov., a new species causing leaf spot of pepper (Capsicum annuum) in Malaysia Abbas Nasehi & Jugah Bin Kadir & Farnaz Abed Ashtiani & Mehdi Nasr-Esfahani & Mui Yun Wong & Siti Khadijah Rambe & Hajar Ghadirian & Farshid Mahmodi & Elham Golkhandan Received: 28 February 2014 / Revised: 7 May 2014 / Accepted: 8 May 2014 # German Mycological Society and Springer-Verlag Berlin Heidelberg 2014 Abstract A new species of Alternaria causing leaf spot of pepper (Capsicum annuum) obtained from the Cameron highlands, Pahang, Malaysia, was determined based on phylogenetic analyses, morphological characteristics, and pathogenicity assays. Phylogenetic analyses of combined dataset of the glyceraldehyde-3-phosphate dehydrogenase (gpd), Alternaria allergen a 1 (Alt a1) and calmodulin genes revealed that the new isolates clustered into a subclade distinct from the closely related Alternaria species A. tomato and A. burnsii. The solitary or short chains of conidia resemble those of A. burnsii. However, conidia with long beaks are morphologically similar to A. tomato. Hence, the pathogenic fungus is proposed as Alternaria capsicicola sp. nov. Pathogenicity assays indicated that A. capsicicola causes leaf spot on pepper. Keywords Morphological characteristics . Phylogenetic analyses . Systematics . Taxonomy A. Nasehi (*) : J. B. Kadir (*) : F. Abed Ashtiani : M. Y. Wong : H. Ghadirian : F. Mahmodi : E. Golkhandan Department of Plant Protection, Faculty of Agriculture, Universiti Putra Malaysia, 43400 UPM, Serdang, Selangor Darul Ehsan, Malaysia e-mail: abbasnasehi@yahoo.com e-mail: kaju@upm.edu.my M. Nasr-Esfahani Isfahan Agricultural and Natural Resources Research Center, Plant Pests and Diseases Research Institute, Isfahan, Iran M. Y. Wong Laboratory of Plantation Crops, Institute of Tropical Agriculture, Universiti Putra Malaysia, 43400 UPM, Serdang, Selangor Darul Ehsan, Malaysia S. K. Rambe Laboratory of Biodiversity and Conservation Institute of Tropical Forestry and Forest Product (INTROP), Universiti Putra Malaysia, 43400 UPM, Serdang, Selangor Darul Ehsan, Malaysia Introduction The genus Alternaria Nees originally was described in 1816 by Nees (Nees von Esenbeck 1816–1817) with A. tenuis Nees as the type member of the genus. Since then more than 1,100 names have been published in Alternaria, and Simmons (2007) accepted nearly 300 taxa. Alternaria species are widely distributed, infecting a broad range of economically important crops. The great majority of Alternaria species are saprobic or have been described as occurring on hosts of little economic importance (Simmons 2007), but some species such as A. alternata (Fr.) Keissl., A. solani Soraurer, and A. brassicae (Berk.) Sacc. are well known as destructive pathogens (Kucharek 1994; Simmons 2007). Morphological characteristics such as color, size, shape of conidia, and sporulation patterns have been used for the identification and classification of Alternaria species (Simmons 1992). However, some of these characters overlap among species and vary depending on the cultural conditions such as temperature and substrate (Simmons and Roberts 1993). In recent years, molecular markers have been widely adopted to identify and characterize Alternaria species (Chou and Wu 2002; de Hoog and Horre 2002; Lawrence et al. 2013, 2014; Pryor and Bigelow 2003; Pryor and Gilbertson 2000; Peever et al. 2004; Woudenberg et al. 2013). Molecular approaches based on sequence dataset of the glyceraldehyde-3phosphate dehydrogenase (gpd), plasma membrane ATPase, Alternaria allergen a 1 (Alt a1), calmodulin and actin gene fragments have robustly defined the monophyly of Alternaria in the ascomycete family Pleosporaceae (Lawrence et al. 2013). To determine the taxonomic status of Alternaria species, both morphological and molecular phylogenetic analyses are complementary in modern fungal systematics (Lawrence et al. 2014; Woudenberg et al. 2013). To identify the fungus responsible for the pepper leaf spot disease, the new isolates were compared with other Alternaria Mycol Progress species reported previously based on molecular and morphological characteristics, and the isolates did not fit any known species of this genus. Therefore, we propose a new species, Alternaria capsicicola Nasehi, Kadir & Abed-Ashtiani, to accommodate these isolates. Pathogenicity assays indicated that A. capsicicola causes leaf spot on pepper. Materials and methods Isolates Diseased leaf samples of pepper (Capsicum annuum) were collected from greenhouses in the Cameron highlands, Pahang, Malaysia, in June 2011. A single conidium was isolated from necrotic tissue fragments under a stereomicroscope and transferred to potato dextrose agar (PDA). Two new isolates of the fungus (UPM AP1 and UPM AP2) were studied further. The isolates were deposited in the Culture Collection of University Putra Malaysia (UPM AP), Selangor, Malaysia. DNA extraction, PCR amplification and sequencing Total genomic DNA was extracted from the new isolates using the 3 % SDS method as described by Gonzalez-Mendoza et al. (2010). A NanoDrop ND-1000 spectrophotometer (LMS, Tokyo, Japan) was used to check the quality and concentration of the genomic DNA. The genes used to characterize the isolates were: a portion of gpd amplified with primers gpd1 and gpd2 (Berbee et al. 1999); Alt a1 amplified with primers Alt-a1-for and Alt-a1-rev (Hong et al. 2005); calmodulin amplified with primers CALDF1 and CALDR1 (Lawrence et al. 2013) (Table 1). PCR products were purified using Gene JETTM commercial PCR Purification Kit (Fermentas, Axon Scientific, Malaysia) and sequenced using commercial sequencing service provider (First Base Laboratories, Selangor, Malaysia). Sequence alignment and phylogenetic analyses DNA sequences of each isolate were refined using BioEdit sequence Alignment Editor (Hall 1999), in which the Table 1 The three primer pairs used for PCR sequences obtained from reverse primers were transformed to the reverse complement orientation and aligned with the sequences obtained from forward primers to obtain consensus sequences. BLASTn alignment was conducted to identify and analyze homologous sequences with those of Alternaria species deposited in GenBank database by Pryor and Bigelow (2003), Hong et al. (2005), Pryor et al. (2009), and Lawrence et al. (2012, 2013). To analyze the relationships of the new isolates to known Alternaria species, the 2 sequences from this study and 31 sequences in section Alternaria, and one (1) representative sequence (A. alternantherae) in section Alternantherae as the closest section to section Alternaria (Lawrence et al. 2013; TreeBASE study S12384; Table 2) were initially aligned using the Clustal W Multiple alignment (Thompson et al. 1994), checked visually, and improved manually where necessary. Sequence alignments were submitted to TreeBASE under accession number S15639. Phylogenetic analyses of combined dataset of the gpd, Alt a1 and calmodulin genes using the parsimony optimality criterion were performed in PAUP* 4.0b10 (Swofford 2002). Gaps were treated as missing data. Maximum parsimony (MP) analyses were conducted by heuristic searches consisting of 1,000 stepwise random addition replicates and branch swapping by the tree-bisection-reconnection algorithm. For each MP analysis, 1,000 bootstrap replicates using a heuristic search with simple sequence addition was performed to assess statistical support for branch stability. Bayesian analyses were performed using the best-fit model of nucleotide evolution (GTR+G), which was determined for these data by the likelihood ratio test using MrModeltest v.2.3 (Nylander 2004). Bayesian analyses were performed in MrBayes v.3.2.2 (Ronquist and Huelsenbeck 2003) with specification nst = 6; rates = gamma, and analyses were sampled every 100th generation, and run 300,000 generations for the combined dataset to reach the standard deviation of split frequencies <0.01. The first 75,000 generations were discarded as the burn-in. Stemphylium callistephi served as the out-group taxon based on results from previous studies (Pryor and Gilbertson 2000; Pryor and Bigelow 2003; Hong et al. 2005; Lawrence et al. 2012, 2013, 2014). Concordance between datasets was evaluated with the Partition-Homogeneity Test (PHT) implemented in PAUP* 4.0b10 (Swofford 2002). Target gene Primer Primer DNA sequence (5′–3′) Size (bp) Reference gpd gpd1 gpd2 Alt-al-for Alt-a1-rev CALDF1 CALDR1 CAACGGCTTCGGTCGCATTG GCCAAGCAGTTGGTTGTG ATGCAGTTCACCACCATCGC ACGAGGGTGAYGTAGGCGTC AGCAAGTCTCCGAGTTCAAGG CTTCTGCATCATCAYCTGGACG ∼580 Berbee et al. 1999 ∼450 Hong et al. 2005 566–763 Lawrence et al. 2013 Alt a1 Calmodulin Mycol Progress Table 2 Species used for phylogenetic analyses Groupa Section Alternaria Section Alternantherae Stemphylium Speciesb Sourcec Accession Nos.d gpd Alt a1 Calmodulin Alternaria alternata A. angustiovoidea A. arborescens A. burnsii A. cerealis A. citriarbusti A. citrimacularis A. colombiana A. destruens A. dumosa A. gaisen A. gossypina A. grisea A. grossulariae EGS 34-016 EGS 36-172 EGS 39-128 CBS 107.38 EGS 43-072 SH-MIL-8s BC2-RLR-17s BMP 2337 EGS 46-069 EGS 45-007 BMP 0243 CBS 104.32 CBS 107.36 CBS 100.23 AY278808 JQ646315 AY278810 JQ646305 JQ646321 JQ646322 JQ646323 JQ646325 AY278812 AY562410 JQ646317 JQ646312 JQ646310 JQ646311 AY563301 JQ646398 AY563303 JQ646388 JQ646405 JQ646406 JQ646407 JQ646409 JQ646402 AY563305 JQ646400 JQ646395 JQ646393 JQ646394 JQ646208 JQ646203 JQ646214 JQ646194 JQ646217 JQ646218 JQ646219 JQ646221 JQ646207 JQ646211 JQ646205 JQ646202 JQ646200 JQ646201 A. herbiphorbicola A. iridis A. limoniasperae A. lini A. longipes A. malvae A. maritima A. nelumbii A. perangusta A. postmessia A. resedae A. rhadina A. tangelonis A. tenuissima A. tomato A. toxicogenica A. turkisafria A. capsicicola EGS 40-140 CBS 101.26 EGS 45-100 CBS 106.34 EGS 30-033 CBS 447.86 CBS 126.60 EGS 12-135 BMP 2336 EGS 39-189 CBS 175.80 CBS 595.93 EV-MIL-2s EGS 34-015 CBS 114.35 PR 320 EGS 44-159 UPM AP1 JQ646326 JQ646313 AY562411 JQ646308 AY278811 JQ646314 JQ646307 JQ646318 JQ646319 JQ646328 JQ646324 JQ646316 JQ646309 AY278809 JQ646306 JQ646327 JQ646320 KJ508064 JQ646410 JQ646396 AY563306 JQ646391 AY563304 JQ646397 JQ646390 JQ646401 JQ646403 JQ646412 JQ646408 JQ646399 JQ646392 AY563302 JQ646389 JQ646411 JQ646404 KJ508068 JQ646222 JQ646210 JQ646213 JQ646197 JQ646198 JQ646212 JQ646196 JQ646206 JQ646215 JQ646224 JQ646220 JQ646204 JQ646199 JQ646209 JQ646195 JQ646223 JQ646216 KJ508066 A. capsicicola A. alternantherae Stemphylium callistephi UPM AP2 EGS 52-039 EEB 1055 KJ508065 JN383477 AY278822 KJ508069 JN383511 AY563276 KJ508067 JQ646226 JQ646103 a Genetic groups of Alternaria reported by Lawrence et al. (2013) b Alternaria capsicicola isolates used in this study (shown in bold) c Sources: BMP BM Pryor, School of Plant Sciences, University of Arizona, Tucson, Arizona 85721; EEB EE Butler, Department of Plant Pathology, University of California, Davis, California 95616; EGS EG Simmons, Mycological Services, Crawfordsville, Indiana 47933; CBS Centraalbureau voor Schimmelcultures, Royal Netherlands Academy of Arts and Sciences, Uppsalalaan 8,3584 CT Utrecht, the Netherlands; UPM University of Putra Malaysia d GenBank accession numbers of the gpd, Alt a1 and calmodulin gene sequences of each isolate used in this study Morphological characteristics The isolates were cultivated at three-point inoculations on potato dextrose agar (PDA), potato carrot agar (PCA) and V8-agar media at 25 °C for 5–7 days under alternating light and dark (Simmons 2007). Cultural and conidial morphology was examined after 7 days. Fifty mature conidia and conidiophores mounted in a drop of lactic acid were examined, Mycol Progress measured, and photographed using a Nikon Eclipse E200 microscope (Nikon, Japan) at ×100 or ×200 magnification. Pathogenicity assay Pathogenicity tests were conducted by spraying healthy 30day-old pepper plants of Malaysian cultivar BBS010 to runoff (approx. 10 ml/plant) with a spore suspension containing 1×105 conidia mL−1 of 10-day-old cultures of representative isolate UPM AP1. Sterile distilled water was sprayed onto the leaves of pepper plants which served as negative controls. Four plants per each treatment and four replicates were used for each treatment. All plants were initially covered with polythene bags in a greenhouse at 25±2 °C for 48 h. Then, the polythene bags were removed and the plants were kept in the same greenhouse under natural daylight conditions. The pathogen was re-isolated and compared with the original isolate. Fourteen days after inoculation, disease incidence and disease severity index (DSI) of inoculated plants were calculated. A five-grade disease severity scale (0: no lesions; 1:1 to 25 %; 2:>25 to 50 %; 3:>50 to 75 %; 4:>75 to 100 %; 5:100 % lesioned area of the leaf) was used to assign a severity grade to each leaf. The disease severity index (DSI) based on disease severity grade was calculated as follows: DSI = Σ [(grade × leaves number in each grade)/(5 × total leaves number)] × 100. The experiment was performed twice. Results Sequence analyses PCR amplification of genomic DNA produced PCR products in size 574, 472, and 568 bp from the gpd, Alt a1 and calmodulin genes, respectively. BLASTn queries based on the gpd and calmodulin genes indicated that isolates of A. capsicicola had a high sequence similarity of 99 %, and the Alt a1 gene had relatively low similarities of 96 and 97 % to A. burnsii Uppal, Patel & Kamat and A. tomato (Cooke) L.R. Jones, respectively. The partition homogeneity test (PHT) of the combined gpd, Alt a1 and calmodulin alignment conducted in PAUP resulted in a P value of 0.001. Therefore, datasets of the gpd, Alt a1 and calmodulin genes were combined. The final sequence alignment of the combined datasets comprising 35 taxa (including two isolates of A. capsicicola, 32 Alternaria reference sequences and S. callistephi as the out–group taxon) had 1,867 characters, of which 1,371 characters were constant, 363 were parsimony uninformative and 133 characters were parsimony informative. MP analyses of the combined dataset yielded 4 equally most parsimonious trees [Tree length (TL) = 619, Consistency Index (CI) = 0.879, Retention Index (RI) = 0.872, Homoplasy index (HI) = 0.121 and Rescaled Consistency Index (RC) = 0.767], one of which is shown (Fig. 1). Alternaria was comprised of two sections, Alternaria and Alternantherae, with Stemphylium callistephi as the sister taxon. Isolates of A. capsicicola were 100 % identical in the three genes sequenced and clustered in a subclade in section Alternaria based on sequence analyses of the combined dataset. In these analyses, isolates of A. capsicicola were clearly separated from the subclade comprised of two closely related Alternaria species, A. burnsii and A. tomato, supported with a strong bootstrap and Bayesian posterior probability (BPP) support (100 %/1.0). Taxonomy Alternaria capsicicola A. Nasehi, J. Kadir & F. AbedAshtiani, sp. nov. (Fig. 2) MycoBank: MB 807962 Etymology: The specific epithet refers to the genus of the host plant (Capsicum annuum L.) The developing colony at 5 days on PCA is ca. 55 mm diam. and produced 3 pairs of concentric rings of growth and sporulation (Fig. 2d). The 7- to 10-day-old colony covers the substrate in a 75-mm-diam plate is light olive, with medium olive zones. Mycelium superficial and little aerial hyphae in the center, composed of branched, septate, light olive, 0.7– 7.5 μm wide. Conidiophores simple, erect or bent, few branched, light olive, smooth, septate (1–11), rounded and scarred at the apex, measuring 17.5–225.0×2.5–3.7 μm (Fig. 2g, j). Fully developed conidia ovoid or ellipsoid, olive brown, tapering almost abruptly into short beaks or filiform beaks of uniform diameter, borne solitary or in short chains of 2–6 on the host and PCA (Fig. 2g–i), with 3–7 transverse septa and one longitudinal or oblique septum in 1–4 of the transverse segments, constricted at transverse septa, bodies up to 35–60×7.5–15 μm, the beaks 2.5–87.5×2 μm, with often few septa (Fig. 2l–o), conidial wall inconspicuously punctulate (Fig. 2k). Holotype: cultures of UPM AP1 and UPM AP2 deposited in University of Putra Malaysia (UPM) Fungi Herbarium. The isolates were derived from leaf spots of pepper (Capsicum annuum), Cameron highlands, Malaysia. Pathogenicity Symptoms of leaf spot were observed in all of the inoculated pepper plants 14 days after inoculation (Fig. 2a, b). The disease incidence was 100 % in the inoculated plants, and the disease severity of the leaves was 47 %. No symptoms were observed in the control plants (Fig. 2c). The symptoms on the inoculated plants were similar to those observed in the greenhouses in the Cameron highlands, Pahang, Malaysia. Mycol Progress Fig. 1 One of four most parsimonious trees generated from maximum parsimony analysis of combined dataset of the gpd, Alt a1, and calmodulin gene sequences. Number in front of slash represents parsimony bootstrap values from 1,000 replicates, and number after slash represents Bayesian posterior probabilities. Scale bar indicates the number of nucleotide substitutions The pathogen was re-isolated and was found to be identical to the original isolate. A. capsicicola has a close relationship with two Alternaria species (A. burnsii and A. tomato) in section Alternaria, and was phylogenetically distinct based on sequence analyses of combined dataset of the gpd, Alt a1, and calmodulin gene sequences. Additionally, A. capsicicola can be clearly differentiated from A. burnsii and A. tomato by conidial morphology (Simmons 2007). The solitary or short chains of conidia resemble those of A. burnsii. However, conidial shape and long beaks of A. capsicicola are morphologically similar to A. tomato. Fully developed conidia of A. capsicicola are ovoid or ellipsoid, tapering almost abruptly into short beaks or filiform beaks of uniform diameter with 3–7 transverse septa and one longitudinal or oblique septum in 1–4 of the transverse segments, constricted at transverse septa. However, Discussion Phylogenetic results from combined dataset of the gpd, Alt a1 and calmodulin gene sequences produced topologies that were in accord with a previous study (Lawrence et al. 2013). Alternaria alternantherae from section Alternantherae was clustered into a distinct clade from section Alternaria. These two sections of Alternaria have the closest phylogenetic relationships to each other than the other sections of Alternaria (Lawrence et al. 2013). Phylogenetic analyses revealed that Mycol Progress Mycol Progress Alternaria capsicicola causing leaf spot on leaves of inoculated pepper (a, b) and control plant without symptoms inoculated with sterile distilled water (c); colonies on PCA (d), V-8 juice agar (e) and PDA (f); sporulation on PCA (g, h) and on infected leaves of pepper as original host plant (i); conidiophores (j); ornamentation of conidial wall (k); conidia (l–o). Scale bars 20 μm ƒFig. 2 A. burnsii produces beakless conidia on Cuminum cyminum L. the original host plant and PCA, smaller conidia (30–50× 9–13 μm), and 5–8 transverse septa and one longitudinal or oblique septum in 1–5 of the transverse segments on PCA (Simmons 2007). Alternaria burnsii has only been reported on members of the family Apiaceae, including Cuminum cyminum (Rao 1969; Richardson 1990; Simmons 2007; Uppal et al. 1938), Bunium persicum (Mondal et al. 2002) and Apium graveolens (Zhang 2003; Zhuang 2005). Conidial bodies of A. tomato are larger than those of A. capsicicola, especially in width (39–65×13–22 μm), and have more transverse (6–9) and longitudinal (1–2) septa, and longer beaks (60–105 μm) on PCA (Simmons 2007). In this species, there is no evidence of conidium chain formation in examined field material. Alternaria tomato was first reported from Lycopersicon esculentum Mill. (Farr and Rossman 2014; Simmons 2007). Several other Alternaria species have been isolated from pepper, including A. alternata (Bobev 2009; Cho and Shin 2004; Mendes et al. 1998; Tai 1979), A. brassicae (Mendes et al. 1998), A. solani (Cho and Shin 2004; Mendes et al. 1998; Yu 2001; Zhang 2003), A. capsici E.G. Simmons (Simmons 2007), A. dauci (J.G. Kühn) J.W. Groves & Skolko (Tai 1979), A. longipes (Ellis & Everh.) E.W. Mason (Bremer 1945), A. porri (Ellis) Cif. (Bobev 2009) and A. tenuissima (Nees) Wiltshire (Cho and Shin 2004; Li et al. 2011; Yu 2001). Among these species, A. alternata and A. solani are the most identified Alternaria species on pepper (Farr and Rossman 2014). Pathogenicity assays indicate that A. capsicicola produced leaf spots on leaves of pepper (Capsicum annuum cv. BBS010), therefore this species is considered as a foliar pathogen of pepper. Acknowledgments We are grateful to the Malaysian Agricultural Research and Development Institute (MARDI) for collaboration in this study. We acknowledge laboratory assistants and coworkers in plant protection department of University Putra Malaysia (UPM) for valuable field trip arrangements and assistance during field samplings. References Berbee ML, Pirseyedi M, Hubbard S (1999) Cochliobolus phylogenetics and the origin of known, highly virulent pathogens, inferred from ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences. Mycologia 91:964–977 Bobev S (2009) Reference guide for the diseases of cultivated plants. Unknown journal or publisher Bremer H (1945) On pod spots in peppers. Phytopathology 35:283–287 Cho WD, Shin HD (2004) List of plant diseases in Korea (4th edn). Korean Society of Plant Pathology, Seoul, Republic of Korea Chou HH, Wu WS (2002) Phylogenetic analysis of internal transcribed spacer regions of the genus Alternaria, and the significance of filament-beaked conidia. Mycol Res 106:164–169 de Hoog GS, Horre R (2002) Molecular taxonomy of the Alternaria and Ulocladium species from humans and their identification in the routine laboratory. Mycoses 45:259–276 Farr DF, Rossman AY (2014) Fungal databases, systematic mycology and microbiology laboratory. ARS, USDA. Retrieved January 12, from http://nt.ars-grin.gov/fungaldatabases/ Gonzalez-Mendoza D, Argumedo-Delira R, Morales-Trejo A, PulidoHerrera A, Cervantes-Diaz L, Grimaldo-Juarez O, Alarcon A (2010) A rapid method for isolation of total DNA from pathogenic filamentous plant fungi. Genet Mol Res 9:162–166 Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98 Hong SG, Cramer RA, Lawrence CB, Pryor BM (2005) Alt a1 allergen homologs from Alternaria and related taxa: analysis of phylogenetic content and secondary structure. Fungal Genet Biol 42:119–129 Kucharek T (1994) Alternaria diseases of crucifers. Florida Cooperative Extension Service, Fact sheet. University of Florida, Gainesville p 34 Lawrence DP, Park MS, Pryor BM (2012) Nimbya and Embellisia revisited, with nov. comb. for Alternaria celosiae and A. perpunctulata. Mycol Prog 11:799–815 Lawrence DP, Gannibal PB, Peever TL, Pryor BM (2013) The sections of Alternaria: formalizing species-groups concepts. Mycologia 105: 530–546 Lawrence DP, Gannibal PB, Dugan FM, Pryor BM (2014) Characterization of Alternaria isolates from the infectoria speciesgroup and a new taxon from Arrhenatherum, Pseudoalternaria arrhenatheria sp. nov. Mycol Prog 13:257–276 Li Y, Zhang D, Xu W, Wu Z, Guo M, Cao A (2011) Alternaria tenuissima causing leaf spot and fruit rot on pepper (Capsicum annuum): first report in China. New Dis Rep 24:3 Mendes MAS, da Silva VL, Dianese JC, Ferreira MASV, Santos CEN, Gomez Neto E, Urben AF, Castro C (1998) Fungos em plants no Brasil. Embrapa-SPI/Embrapa-Cenargen, Brasilia, p 555 Mondal KK, Rana SS, Sood P, Singh Y (2002) Kalazira: a new host for Alternaria burnsii. Indian Phytopathol 55:532 Nees von Esenbeck CG (1816–1817) Das System der Pilze und Schwämme. Stahelsche, Würzburg Nylander JAA (2004) MrModeltest v2. Program distributed by the author. Evolutionary Biology Centre, Uppsala University, Uppsala Peever TL, Su G, Carpenter-Boggs L, Timmer LW (2004) Molecular systematics of citrus-associated Alternaria species. Mycologia 96: 119–134 Pryor BM, Bigelow DM (2003) Molecular characterization of Embellisia and Nimbya species and their relationship to Alternaria, Ulocladium and Stemphylium. Mycologia 95:1141–1154 Pryor BM, Gilbertson RL (2000) Molecular phylogenetic relationships amongst Alternaria species and related fungi based upon analysis of nuclear ITS and mtSSU rDNA sequences. Mycol Res 104:1312– 1321 Pryor BM, Creamer R, Shoemaker RA, McLain-Romero J, Hambleton S (2009) Undifilum, a new genus of endophytic Embellisia oxytropis and Helminthosporium bornmuelleri on legumes. Botany 87:178– 194 Rao VG (1969) The genus Alternaria - from India. Nova Hedwigia 17: 219–258 Richardson MJ (1990) An annotated list of seed-borne diseases, 4th edn. International Seed Testing Association, Zurich Ronquist F, Huelsenbeck JP (2003) MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–1574 Mycol Progress Simmons EG (1992) Alternaria taxonomy: current status, viewpoint, challenge. In: Chelkowski J, Visconti A (eds) Alternaria: biology, plant diseases and metabolites. Elsevier, Amsterdam, pp 9–107 Simmons EG (2007) Alternaria. An identification manual. CBS Biodivers Ser 6:1–775 Simmons EG, Roberts RG (1993) Alternaria themes and variations (73). Mycotaxon 48:109–140 Swofford DL (2002) PAUP*: phylogenetic analysis using parsimony (* and other methods), version 4.0b 10. Sinauer, Sunderland Tai FL (1979) Sylloge fungorum sinicorum. Science Press, Peking Thompson JD, Higgins DG, Gibson TJ (1994) Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680 Uppal BN, Patel MK, Kamat MN (1938) Alternaria blight of cumin. Indian J Agric Sci 8:49–62 Woudenberg JHC, Groenewald JZ, Binder M, Crous PW (2013) Alternaria redefined. Stud Mycol 75:171–212 Yu SH (2001) Korean species of Alternaria and Stemphylium. National Institute of Agricultural Science and Technology, Suwon Zhang TY (2003) Flora Fungorum Sinicorum. Vol. 16. Alternaria. Science Press, Beijing Zhuang WY (ed) (2005) Fungi of northwestern China. Mycotaxon, Ithaca