4 The Genus Cercospora: Biology and Taxonomy Ramesh Chand1, Vineeta Singh2, Prabhat Kumar3, Chhattar Pal4 and P. Chowdappa5 1,2,3,4 Department of Mycology and Plant Pathology, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi-221005, Uttar Pradesh, India 5 Division of Plant Pathology, Indian Institute of Horticultural Research, Bengaluru-560089, India 1. Anamorph The genus Cercospora was erected by Frensious (1863). Etymologically the generic name means a fungus has obclavate (Tail shaped) spores. The species concept and taxonomy of Cercospora are based upon morphological criteria, primarily the dimensions and characteristics of the conidia (length, width, base, and tip) and conidiophores (length, diameter, geniculation, and fasciculation) (Chupp, 1954). In his monograph on the genus Cercospora, Chupp (1954) discussed the reliability of the various characteristics used to distinguish and identify the species. Among the characteristics of conidia, spore width is considered to be the most reliable feature. Indeed, this characteristic is a major criterion used to distinguish C. canescens from leaves of mungbean, and other legumes. In general, other conidial features are less reliable, because they are either influenced to a large extent by environmental conditions (e.g., length) or represented by too few distinctive forms (e.g., features of the conidial tip) to be consistently dependable (Chupp, 1954). Characteristics of the conidiophores are generally less reliable than characteristics of conidia. The length of the conidiophores and the extent of geniculation are influenced by temperature and moisture, and the diameter and the number of conidiophores per fascicle are too variable to be taxonomically decisive. Ibrahim and Elamin (1974) grouped 30 species of Cercospora on the basis of morphological characters of stroma (presence or absence, colourations, and dimensions), conidiophores (the way they borne single or in fascicles, colour, branching, number of septa, and dimensions) and conidia (colour, general shape, diameter of scar, shape of tip and base as well as their dimension). They found 80 % overall similarities between C. arasaemae on Abutilon sp. and C. gossypina on Gossypium hersutum, & 75% overall similarities between C. cucurbitae on Cucumis sativus and C. sesami on Sesamum orientale and 75% overall similarities between C. gompherenae on Gompherena globossa and C. coffeicola on Coffea robusta. Based on reexaminations of type collections, the taxonomic The Genus Biology and Taxonomy 2 status of Cercospora saccharini and C. rhagadioli was the genuine species of Cercospora, that morphologically distinct from C. apii sensu lato could be confirmed, and it could be demonstrated that Cercospora pittospori had been correctly reallocated to Pseudocercospora (Braun and Crous, 2007). Deighton (1967, 1973, 1974, 1976, 1979), made efforts to redesign the various species in the genus. He segregated and reclassified many Cercospora species into other genera, including Cercosporella, Cercosporidium, Paracercospora, Pseudocercospora, Pseudocercosporella, and Pseudocercosporidium, and focused his attention on the morphological aspects associated with the liberation of spores. He emphasized the diagnostic value of the morphology of the mitosporogenous loci and suggested basal scars of the mitospores as criteria for generic separation. When revising Cercosporella, Deighton (1973) emphasized that the method of spore liberation in this genus was completely different from any other except Pseudocercosporidium. In the same work, Deighton (1973) described the mitosporic scars in Cercosporella as conspicuous, thickened, colourless, refractive, and with a minute central papilla covering the pore. Pressure is produced within the mitosporogenous cell and the mature mitospore is liberated with some force, tearing the suture around the base of the mitospore and blowing out the thin membrane covering the central pore of the scar on the mitosporogenous cell. This description does not differ too much from that of the scars in Pseudocercosporidium, described as convex, thickened, highly refractive, and with an umbonate central pore (Deighton 1973). Pons and Sutton (2000) studied the mitosporogenous process in Cercosporella ugandensis using transmission and scanning electron microscopy. An ultra structural basis, in terms of wall layer deposition, is provided for mitospore maturation, scar structure and development, and mitospore succession. This implies a quite separate mode of delimitation and liberation in comparison to other fungi in the Cercospora like generic assemblage. Transmission and scanning electron microscopic studies in some fungi belonging in the group, viz. Cercospora beticola, Pseudocercospora musae, and Pseudocercosporidium venezuelanum, have provided evidence of the value of scars as taxonomic criteria for generic separation (Pons et al., 1985; Gonzallez and Pons, 2000). In his monograph of the genus Cercospora Fresen., Chupp (1954) accepted 1,419 species. In total, more than 3,000 species of Cercospora have been described, of which 659 presently are recognized (Crous and Braun, 2003). Generally, species of Cercospora are considered to be host specific (Chupp, 1954) at the level of the plant genus or family; this concept has led to the description of a large number of species. Several Cercospora spp., which are morphologically indistinguishable from Cercospora apii Fresen., were placed in the C. apii complex ( Ellis, 1971). Cross-inoculation studies revealed that isolates in the C. apii complex can infect an extremely wide host range, including Apium graveolens (celery) and Beta vulgaris (sugar beet). In their revision of the genus Cercospora, Crous and Braun (2003) referred 281 morphologically indistinguishable species to the C. apii sensu lato complex. Recent, genetic analyses of Cercospora spp. have relied mainly on DNA sequences of the internal transcribed spacers (ITSs) and the 5.8S ribosomal rRNA gene. These studies have revealed that most species of Cercospora, in particular the members of the C. apii complex, are identical or very closely related (Stewart et al., 1999; Goodwin et al., 2001; Tessmann et al., 2001; Pretorius et al., 2003). Judging from their morphological similarity as well as their proven cross-infectiveness, it is probable that the species in the C. apii complex should be considered synonym Species seen as representative of C. apii sensu lato lack a known teleomorph. Although, the genus Cercospora is a well established anamorph of the genus Mycosphaerella ( Crous et al., 2001; Goodwin et al., 2001), only a few teleomorphs have been elicited via cultural studies (Crous, and Braun, 2003). Phylogenetic analyses of all Cercospora isolates to date have placed them as a well-defined clade in the genus Mycosphaerella. Therefore, if a teleomorph were to be found for C. apii, it should be a species of Mycosphaerella (Crous et al., 2001; Goodwin, 2001; Pretorius et al., 2003 and Stewart, 1999). C. beticola, causal agent of Cercospora leaf spot on B. vulgaris, originally described by Saccardo (1876), and is assumed to have originated in central Europe and the Mediterranean area. C. apii, which causes Cercospora leaf spot on A. graveolens, was described from the region between The Netherlands and Germany (Fresenius, 1863), and is assumed to have originated in Western Europe. C. beticola is seen as part of the C. apii complex (Crous and Braun, 2003; Ellis, 1971). Several studies so far have suggested that C. beticola on sugar beet should be treated as a synonym 3 Leaf Spot Diseases of Annual and Perennial Crops of C. apii (Berger and Hanson, 1963; Johnston and Valleau, 1949; Welles, 1933). Multi gene sequence analysis and amplified fragment length polymorphism (AFLP) analysis, as well as cultural and morphological comparisons, revealed that both celery and sugar beet are hosts to two species of Cercospora, with one of these species infecting both hosts. Although, C. apii and C. beticola are able to cross-infect each other's hosts and are morphologically similar to one another, they still appear to operate as functional species on their respective primary namesake hosts in nature. Several legume hosts are infected by Cercospora species and identified as distinct species based on their host. Till date it is not yet clear whether they are real distinct species. 2. Chemotaxonomy of Cercospora Chemotaxonomy is the use of chemicals for identifying or classifying organisms like filamentous fungi (Hall, 1969, 1973). Chemotaxonomy is traditionally based on classification of qualitative or quantitative data of fatty acids, proteins, carbohydrates, or secondary metabolites, but has sometimes been defined so broadly that it also includes DNA sequence data used in phylogeny. It is not possible to use secondary metabolite profiles in phylogeny, because the individual metabolites have a limited distribution throughout the fungal kingdom. However, this is the particular quality that makes secondary metabolites so useful in classification and identification (Frisvad et al., 2008). Cercosporin is a non-host-specific, polyketide toxin produced as secondary metabolites by many species of plant pathogens belonging to the genus Cercospora. Production of the toxin cercosporin has been associated with parasitism and the development of disease in host plants. It is light-activated perylenequinone phytotoxin (Assante et al., 1977; Daub 1982; Upchurch et al. 1991; Daub and Ehrenshaft, 2000). Cercosporin was isolated first time from the soybean pathogen C. kikuchii in 1957 (Kuyama and Tamura, 1957). It is not a universal pathogenicity factor because it is not produced by all species (Assante et al., 1977; Fajola, 1978; Jenns et al. 1989; Dunkle and Levy, 2000). Fajola (1978) concluded that cercosporin production is associated with "true" Cercospora species and suggested that those species that do not produce cercosporin may belong to other, related genera. However, the ability to produce cercosporin is often specific to strains or isolates (Jenns et al., 1989; Wang et al., 1998; Dunkle and Levy, 2000), and is influenced by various environmental and nutritional conditions (Jenns et al. 1989). These inconsistencies preclude definitive application of cercosporin production to taxonomy. 2.1. Cercospora Canescens The Cercospora canescens was described by Ellis and Martin (1882) with slight stroma, and sometimes dense fascicle. Conidiophores mostly straight, geniculate, ( 0- 2), multi-septate, branched , pale to medium dark brown, fairly uniform in colour and width usually with medium to large, conidial scar at the sub-truncate tip, size 3-6.5 x 20- 250 µm or rarely much longer. Conidia are acicular hyaline, base acute with a black rim like structure, tip straight and variously curved, septate 1- 35, size 2.5- 5 (rarely 6) x 30- 3000 µm. 3. Teleomorph Chupp (1954) proposed a broad concept for the genus Cercospora, simply recording if hila were thickened or not, and if conidia were pigmented, single or in chains. As very little was known about the sexual states and relationships of cercosporoid fungi, Chupp chose a more practical approach by retaining all these taxa in Cercospora. Subsequent workers such as Deighton (1973, 1976, 1979, 1987, 1990) and Braun (1995, 1998) divided the Cercospora-complex into smaller, more morphologically similar units based on a combination of characters including conidiomatal structure (sporodochia, synnemata), mycelium (presence or absence of superficial mycelium and texture thereof), conidiophores (arrangement, branching, pigmentation and ornamentation), conidiogenous cells (placement, proliferation and scar type) and conidia (formation, shape, septation, ornamentation, pigmentation and catenulation). Identification of Mycosphaerella spp. based on morphology is known to be difficult. This is because these fungi tend to produce very small fruiting structures with highly conserved morphology, and they are host-specific pathogens that grow poorly in culture. Traditionally, morphological characters of the teleomorph and anamorph have been used in species delimitation (Crous and Corlett, 1998). A The Genus Biology and Taxonomy 4 single morphological species does not always reflect a single phylogenetic unit (Taylor et al., 2000). Within Mycosphaerella, teleomorph morphology is conserved and the anamorph morphology provides additional characteristics to discriminate between taxa (Crous et al., 2000). Yet the collective teleomorph and anamorph morphology is often not congruent with phylogenetic data. Thus, recent phylogenetic studies have led to the recognition of several species complexes within Mycosphaerella (Crous et al. 2001, 2004, Braun et al. 2003). The Mycosphaerella complex accommodated several thousand species, very few are known from culture. Largely due to the lack of cultures, the first DNA phylogeny paper on Mycosphaerella was published by Stewart et al. (1999). Based on ITS phylogenetic data, subsequent workers (Goodwin et al., 2001) concluded that Mycosphaerella was monophyletic. Analysis of recent molecular data revealed Mycosphaerella to be poly- and paraphyletic and Mycosphaerella should be restricted to taxa linked to Ramularia anamorphs (Crous, 2009). Most of these studies have been based on comparisons of sequences for the ITS regions of the ribosomal DNA operon. Given the important data that have emerged from them, it is well recognized that greater phylogenetic resolution will be required for future taxonomic studies on Mycosphaerella species. Comparisons of DNA sequence data have emerged as the most reliable technique to identify Mycosphaerella spp. The majority of studies employing DNA sequence data for species identification have relied on sequence data from the Internal Transcribed Spacer (ITS) region of the ribosomal RNA operon (Crous et al., 1999, 2001, 2004, Hunter et al. 2006). Although comparisons of gene sequences for this region have been useful, the resolution provided by this region is not uniformly adequate to discriminate between individuals of a species complex or to effectively detect cryptic species (Crous et al., 2004). Thus, recent studies have shown the importance of employing Multilocus Sequence Typing (MLST) to effectively identify cryptic fungal species and to study species concepts (Taylor and Fischer, 2003). 3.1. Analysis o f ITS Sequences The consensus primers ITS1 and ITS4 were used to amplify a region of the rRNA gene repeat unit, which includes two non-coding regions designated as ITS1 and ITS2 and the 5.8s rRNA gene. All the isolates amplified a single band of about 550 bp, except for the two isolates from mungbean B4-96 and B6-20. These two isolates showed a length variation in this region, in which isolate B4-96 showed a single band of higher molecular weight of around 600 bp, whereas isolate B6-20 showed two bands: one of 550 bp and other of 600 bp. Similar length variation in the ITS region has been observed for yeast strains belonging to different species. The ITS region was digested with 10 different tetra (TaqI, Sau3A, HaeIII, AluI), and hexa (EcoR Sma BamHI, Hind ,Pst S a d ) base pair cutter restriction endonucleases. Of these 10 different enzymes AluI and EcoRI. The tested, 5 had restriction sites on ITS region, namely TaqI, Sau3A, Hae five enzymes which had restriction sites in the ITS region revealed polymorphism in two isolates of mungbean B4-96 and B6-20, collected from Varanasi. With the enzyme AluI, isolate B4-96 showed two digestion products of around 275 bp and 300 bp, but these two digested products were not present in isolate B6-20, although this isolate also has the 600 bp ITS region similar to the isolate B4-96. Differences in banding patterns were also observed when the ITS regions of isolates B4-96 and B6-20 were digested with HaeIII with no common digestion products from the 600 bp ITS region which is present in both. These results indicate that the two 600 bp. ITS regions B4- 96 and B6-20 are different from each other. AluI could also detect variation in the restriction site of another isolate of mungbeam from Varanasi B3-96, as one digested product of size around 400 bp was missing in this isolate. The dendrogram constructed based on similarity coefficients also indicates that the two isolates B4-96 and B6-20, which showed different banding patterns in ITS amplification and restriction digestion patterns are dissimilar from each other although both of them are from same host plant and same geographical location (Joshi et al., 2006). 3.2. Development o f a Species-Specific Diagnostic Assay The CAL gene was found to be very effective for separating the Cercospora species (Groenewald et al., 2005) therefore; this area was targeted for the development of a species-specific diagnostic test. Primers CercoCal-F (5'CGCGAGGCAGAGCTAACGA3') and CercoCal-R 5 Leaf Spot Diseases of Annual and Perennial Crops (5'GTGAGGAATTCGGGGAAATC3') designed from regions of the CAL gene and are conserved for the Cercospora spp. Amplification of above primers functions as a positive control. Three internal primers [CercoCal-beta (5'GCCCACCCTCTGCGAATGTA3'), CercoCal-apii (5'GACCACCCTCTGCAACTGCG3'), and CercoCal-sp (5'GCCCACTTTCTGTGACTGCA3'), each specific for one of the three Cercospora species (C. apii, C. beticola and Cercospora sp.) have also been used. Strains of C. beticola, C. apii, the undescribed Cercospora sp., and 13 other species of Cercospora were screened with these primers. The primers CercoCal-beta, CercoCalapii and CercoCal-sp are specific for C. beticola, C. apii and Cercospora sp., respectively. 3.3. AFLP Analysis Genetic differences between isolates of the different clades also were confirmed using AFLP analysis. Banding patterns obtained with the EcoRI-A [FAM]/MseI-CT and EcoRI-AT [JOE]/ MseI-C primer combinations. The number and sizes of the polymorphic bands obtained for isolates of the Cercospora sp., using the EcoRI-A [FAM] /M seICT primer combination, showed major differences with the profiles obtained for the other two species. Although isolates from the C. apii and C. beticola clades are more similar to each other than to the Cercospora sp., several bands are specific to each of the species, as seen using the EcoRI-A [FAM] /MseI-CT and EcoRIAT [JOE]/MseI-C primer combinations . The primer combination EcoRI-AG [NED]/ MseI-C also was tested on isolates from the three Cercospora spp. and the banding patterns obtained showed results similar to those obtained with the other two primer combination (Vos et al., 1995). 3.4. Phylogenetic Analysis The combined alignment of ITS (internal transcribed spacer), ACT (actin), EF (elongation factor 1-a), CAL (calmodulin), and HIS (Histone3) data sets was done in Phylogenetic Analysis Using Parsimony (PAUP) v4.0b10. Three distinct and well supported clades were obtained. The first clade contained isolates of the new Cercospora sp. from Apium spp. (100% bootstrap support), the second clade contained only Cercospora isolates from B. vulgaris (91% bootstrap support), and the third clade contained Cercospora isolates from both B. vulgaris and Apium spp. (100% bootstrap support) (Hillis and Bull, 1993). All the isolates from the third clade were isolated in Europe. The ITS and ACT data sets showed no variation among the isolates from the second and the third clade and no significant variation could be observed between the isolates of these two clades with the EF and HIST data sets. The amount of variation observed within the CAL region of the C. beticola and C. apii isolates (96% similarity) was significant and placed these species into two distinct phylogenetic clades, each with a high bootstrap support in the combined analysis (Page, 1996; Farris et al., 1994). A combined approaches using cultural characteristics (growth rates and temperature thresholds). Amplified fragment length polymorphism (AFLP) as well as multilocus sequence typing (MLST) analyses using part of the ITS region, actin gene (ACT), translation elongation factor 1-a gene (EF1-a), calmodulin gene (CAL) and histon H3 gene (HIS) represent the most reliable way to characterize and identify species within the C. apii complex (Groenewald et al., 2005). This combined approach was also successfully employed to delineate a novel Cercospora species, originally identified as C. appi, causing Cercospora leaf spot on celery. This species was formally described as C. apiicola. Although very few differences in colony morphology between these three species were observed, meaningful difference were found in growth rate, temperature threshold and CAL sequences of C. beticola, C.apii and C. apiicola, illustrating that they should be considered as functional species (Groenewald et al. 2005, 2006). Species-species primers from polymorphic areas within the calmodulin gene are now available as diagnostic tools to easily distinguish among these three species. Angular leaf spot of Phaseolus vulgaris is a serious disease caused by Phaeoisariopsis griseola, in which two major gene pools occur, namely Andean and Middle-American. A new combination is therefore proposed in the genus Pseudocercospora, a name to be conserved over Phaeoisariopsis and Stigmina. Sequence analysis of the SSU region of nrDNA revealed the genus Phaeoisariopsis to be indistinguishable from other hyphomycete anamorph genera associated with Mycosphaerella, namely Pseudocercospora and Stigmina. The Genus Biology and Taxonomy 6 Further comparisons by means of morphology, cultural characteristics, and DNA sequence analysis of the ITS, calmodulin, and actin gene regions delineated two groups within P. griseola, which are recognised as two formae, namely f. griseola and f. mesoamericana (Crous et al., 2006a).The causal organism associated with the grey leaf spot of maize is Cercospora zeaemaydis. Two potential sibling species have been recognized as Groups I and II. The DNA sequences for the internal transcribed spacers (ITS1 & ITS2), the 5.8S rRNA gene, elongation factor 1-a, histone H3, actin and calmodulin gene regions suggest that Groups I and II are two distinct species. A PCR-based test that distinguishes the two species was developed using speciesspecific primers designed from the histone H3 gene (Crous et al., 2006b). Vila et al. (2005) studied the genetic variability of Spanish isolates of Pseudocercospora cladosporioides causing Cercospora leaf spot of olives using DNA sequence data from the ITS region, as well as two protein-coding genes, actin and calmodulin. Phylogenetic data obtained support P. cladosporioides as closely related to other Pseudocercospora species that cluster within Mycosphaerella. Spanish isolates were clustered in two clades, isolates from Catalonia were different from those collected in Andalusia. Several phylogenetic studies based on sequences of MAT genes and other housekeeping gene sequences suggest that MAT genes evolved rapidly (Whitfield et al., 1993; Waalwijk et al., 2002). Although the MAT genes vary substantially between distinct species, these genes appear to be highly conserved within species. Studies have showed that phylogenetic trees that were constructed with matting type sequences resolved the relationship between plant pathogens that remained unresolved in trees constructed with ITS sequences alone (Goodwin et al., 2003; O'Donnell et al., 2004). It has therefore been assumed that the MAT genes can be used as excellent molecular tool for phylogenetic analyses of closely related and for species identification. Phylogenetic analyses using matting type sequences are not only powerful tools for determination of relationships between pathogens, but also may prove to be an important method in identifying the relationship of economically valuable species. As most housekeeping genes sequenced thus far are sufficient to distinguish between closely related Cercospora species that belong to the C. apii complex (Groenewald et al., 2006), these species were used in phylogenetic analyses using the MAT-1-1 and MAT1-2 sequences to get an indication whether the MAT genes can provide sufficient resolution at species level. References ! # ! ) ) ) ) * 2 , 2 , 2 + ,- $' # . ! ( ! # ! ! 53 /00(/01 / 3# ! +! ! 4 5 6+-(5 3# ! +! ! 4 5 % 6+-(5 ! 1 ! # - %00 9 ) " ! $ %&'(%& 2 ! #- * ! *. 7 . ! ! ! ( 8 " ! 26: //( % 9 8 : + * . /& 9 # - %00 7 ; ! ! #1 ) ! 76: /%'( /'% #> : ) ! ! 45 0 ( % #) 2 %00' ! " . #8 :? 8 8 ! #8 : ? # ! ! ! ! 50 &/ (&$ %00' # ! ! ; # " "! # 6 9 *. ! - 7 8 # ) 2 ! @ > + + ! 38: (%& # ! : %000 7 # " 2 2 '( 1 = ! ! 2 (-< ! ! . 7 %00$" ! // 1 ( - @ 8 : %00& ; ! : 7 Leaf Spot Diseases of Annual and Perennial Crops #- > : * A #- " " * " ) , 1% * " , 9 $ , " * ! 9 # ' 9 * 9 * * 9 9 * * < 9 * 5 9 : 9 9 . : ! > # 8 ) # ! ; ! . ! . 8 > ) ' + ) 7 2 %001 7 112 %' (%&0 @ !< # 8 ! ! ( 8 " ! 88: '$/(' 94 0 $( 0% ! . 7 C 1$' ) 9 56 # ! 0 B" . # .! %000 ! 90 &1$(& 0 * +! ! ) " 137 ( / # # ! ; # 566 1 ! 133 ($% $ 140 ( $1 # , # & # 67 ; # ! 55 $'( ' # ! ! 72: ' 0(' & ( . 65 ! . ! " 112 (10 # * 93 01 ( 0 8 : ? %00$ " ; . 38 &$ (& 0 66 # .# ! ! ! ! @ %000 7 , " * 2 %00 ! ! ) 2 ! # @ 2 8 # # 144 (/$ # ! 6 13 / ( $& > 8 ! 2> 9 C ( B ! 1 10 ' /('%0 & 7 8 ) 5 ! 9 " < ! ; ! %000 . # 104 /0 ( / 8 ) - 8 C< > +: . : @ %00' ! (! " ! 269 ( % 8 ) * < ! * ? 5 %00 # ! ! ! " ! 91 $&1($/1 " " * # ! 8 8 :? ) 2 # - %00$ + " . ! ! 98 % /(%/1 8 8 :? # - %00/ * ; 8 ! # ! ! 95 / ( / ) . 35 %1/('0& + $ ; ! + ' , ; ! ) 7 !) " 100 %/'(%/ + * ) :: ' " ! ! ! ) 42 1%( % + )* #: %00$ ( ! ! ! , ! . ! ! 55 & ( $ 6" 9 , , & A . ! ! 52 & ( &$ ! : , * " , 2 1 "! # ! ! 79 % '(% : , 5 -* & ! ! ! # ! !39 $'( 0 3, D : : # 8 , %00$ . ! ! 4 90 /$&(/$1 > ! 7 7 / << 7 ! 6 . : 79: / %/(/ %$ BE* > 7: * > + < 7 %00& " 8 ! . ! ! 8 9 9 ) 41 $00($%' # * $ ! ! ) 12 '/ ('/1 # ! 8 55 %1$( #8 :? ) 2 %00' # ! ! '0/ # ) %000 ! 104 /0 ( /0$ # ) ! : 1/ 2 " 7 ) ! ! 85: &0/(& $ @ @ # ! The Genus # @ " 7 ! 1 $ 9 5 . . : # ! ! " * A 7 ! :- 9 %00' 9 '/ F'/$ :- : " *: > < > 7 5 ) . ! ! A * 8 $%(% 103 & F E ! + "" * *: > 8 2 - < * ! 8 :? 7 5 5 # + ) / 9 # ! - 8 C< :: > '' 7 ; < 8 + < ) , %00 , * " ! , . C B 5 8 %00& . 7 + * , - * " + : %00% 6 " # ! 6: << > 3 " %000 # ! ! " #- ! 31: % ('% 57: % &0(% &/ ! # . ! 109: 11 (111 9 C # : # : > 23 &&0 ( && & # - %00/ A ? B " , " , @ 93 '%'(''& ! ! : ( & C 8 9 9 7 Biology and Taxonomy 8 4 6 9 # : ) @ 35 % (%1$ 5 / ( $$ /(% 1 ) # 12 ? " (