Monograph
On
Fungal Diseases of Cats and Dogs
A guide for postgraduate students
By
Mohamed K Refai1, Heidy Abou El-Yazeed1, Mounier Abdel-Haleem2,
Atef Hassan3 and Mahmoud El-Hariri1
1
Department of Microbiology, 2Department of Internal Medicine and Infectious Diseases, Faculty of Veterinary
Medicine, Cairo University, Egypt
2016
1
Dedication
Today I am celebrating my 78th birth day and the uploading of my 12th Monograph.
This monograph is dedicated to Prof Ahmed Hosny Mahmoud, Prof. Mahmoud
Emad El-Gendy and Prof Hassan Gharib, the great professors of Medicine and
Infectious Diseases, who impressed me, when I was undergraduate student, 1959, by
their way of teaching and communication with the students.
This Monograph is also dedicated to my friend and classmate Mohamed Saleh,
Prof. Emeritus in the Department of Animal Surgery, who was the first to
establish an evening pet animal clinic in our faculty, more than 35 years ago
Prof. Dr. Mohamed K Refai
Cairo, 21. 4. 2016
2
Refai, M.K. et al. (2016). Monograph on fungal diseases of cats and dogs
A guide for postgraduate students,
https://www.academia.edu/21679188/
http://scholar.cu.edu.eg/?q=hanem/book/
https://www.researchgate.net/publication/293427976
Prof. Dr. Mohamed K Refai
Department of Microbiology, Faculty of Veterinary Medicine, Cairo University, Giza
Prof. Dr. Heidy Abou El-Yazeed
Department of Microbiology, Faculty of Veterinary Medicine, Cairo University, Giza
Prof. Dr. Mounier Abdel-Haleem
Department of Internal Medicine and Infectious Diseases, Faculty of Veterinary Medicine, Cairo University
Prof. Dr. Atef Hassan
Department of Mycology and Mycotoxins, Animal Health Research Institute, Dokki
Ass. Prof. Dr. Mahmoud El-Hariri
Department of Microbiology, Faculty of Veterinary Medicine, Cairo University, Giza
3
stnotnoC
Introduction 5
A. Fungal diseases of cats and dogs caused by dermatophytes
1. Ringworm (Dermatophytosis) in cats and dogs
B. Fungal diseases of cats and dogs caused by yeasts
1. Candidosis in cats and dogs
2. Cryptococcosis in cats and dogs
3. Malassezia dermatitis and otitis cats and dogs
4. Trichosporonosis in dogs and cats
C. Fungal diseases of cats and dogs caused by moulds
1. Aspergillosis
2. Penicilliosis
3. Paecilomycosis
4. Geosmithiosis
5. Scedosporiosis
6. Fusariosis
7. Oxyporosis
8. Acremoniosis
9. Pheohyphomycoses
10. eumycetoma
11. Pythiosis
12. Zygomycosis in cats and dogs
13. Rhinosporidiosis
D. Diseases of cats and dogs caused by algae
E. Diseases of cats and dogs caused by dimorphic fungi
1. Blastomycosis
2. Coccidioidomycosis
3. Histoplasmosis
4. Paracoccidioidomycosis
5. Sporotrichosis
4
Introduction
In ancient Egypt society, cats and dogs held a prominent place in both life and the next world. Tens of
millions of these animals were mummified, and some were placed within a pharaohs’ tombs to rest
forever in the companionship of their kings. Cats, for example, were considered the embodiment of
Bastet, the goddess of joy and of music, in addition to being the protector of women, while the dog
was considered the messenger of the god Anubis, portrayed in ancient Egypt as a man with a dog
head.
Dogs are the earliest domesticated animals (maybe around 10 000 BC in the Near East). They were
used as guardians, helper at hunts, and pets. There is some discussion about the ancestors of the dog,
but it is most probably the wolf (canis lupus), because their social behaviour and anatomy are very
similar. Dogs are attested in Egypt already from the Naqada Period, in paintings on pottery. Bones of
dogs have been found at Merimde (Ancient Egyptian prehistoric settlement).
In the Old Kingdom (about 2686-2181 BC) the greyhound (Egyptian: Tsm - long narrow muzzle,
nearly straight facial profile, long neck and limbs) was very common. From the Middle Kingdom
(about 2025-1700 BC) onwards there is attested a greater variety of dogs (different types of ears, ringtailed, saber-formed tails). Among pharaohs known to own greyhound-type dogs are
Tutankhamen, Amenhotep II, Thutmose III, Queen Hatshepsut, and Cleopatra VII (of
Antony and Cleopatra fame).
http://www.ucl.ac.uk/museums-static/digitalegypt/foodproduction/dog.html
Amazon.com: Egyptian Hand-Made Papyrus Painting - Anubis Dog: Oil Paintings: Oil Paintings.
www.amazon.com, Graffiti on walls of Kom Ombo Temple, Ptolemaic Dynasty, Egypt,35030BCwww.artsjournal.com
5
www.pinterest.com ancient Egyptian gods statues | Anubis Egyptian Dog God Small Statue by Ancient
Treasures AT-
In catacombs south of Cairo, researchers have discovered burial sites filled with huge numbers of
mummified animals — nearly 8 million of them, mostly dogs. The catacombs, at Saqqara, are
dedicated to Anubis, the jackal-headed god of the afterlife.
Archaeologist and Egyptologist Salima Ikram, a professor at the American University in Cairo who
has worked extensively at the site, writes that animal mummification began in ancient Egypt "to allow
beloved pets to go on to the afterlife, to provide food in the afterlife, to act as offerings to a particular
god and because some were seen as physical manifestations of specific gods that the Egyptians
worshipped." Ikram explained that "each [animal] mummy would be a symbol of something a pilgrim
had given as a gift to the god. So nowadays, people go to a church and light a candle. "But the
Egyptians were in for the long haul, so instead of a candle, they would offer a mummy. So clearly,
this means that there were a lot of very religious people out there who were asking Anubis for
intercession and for help for a variety of things." http://www.npr.org/2015/07/04/418079713/
Dog Mummy, 305 B.C.E.-395 C.E. Animal remains, linen, painted. Brooklyn Museum - See more at:
Mummified dog, Taggart School Museum, Assuyt, Middle Egypt ( Flickr) - See more at: http://www.ancientorigins.net/news-history-archaeology/mummifying-millions-canine-catacombs-and-animal-cult-industry-ancient-egypt020386#sthash.ii1OK4Yg.dpuf
The origins of cats (domestic cats) are thought to have come from the African Wild Cat. The breed
was domesticated in ancient Egypt to control vermin which was harming crops and causing diseases.
The cats controlled the rat population which reduced disease and deaths and also allowed a larger
6
supply of food for the poor. This therefore changed the quality of living for the Egyptians and cats
become a sacred creature representing life. They were associated with the goddesses Bastet, Isis and
Pasht. By the time the Egyptian empire fell, cats were revered as master hunters and were worshipped
like gods by all Egyptians including the pharaoh. If an Egyptian killed a cat they were immediately
given the death penalty yet the fear of the all mighty cat itself made this a rare occurrence. The
pharaoh's were mummified and buried with statues of cats. This represented good luck and safe
companionship to the afterlife. Even today archaeologists are finding more and more hieroglyphics,
statues and carvings of cats emphasising there importance in Ancient Egypt. Some cats were even
mummified and their bodies left to lay in tombs and shrines. It was illegal to sell a cat outside of
Egypt as they were such an important asset to their beliefs and society. The history of domesticated
cats started in Egypt where they acclaimed their first home, but like all cats they didn't want to stay in
one place to long!
Cats in the history of ancient Egypt were often identified with Ra. Probably such an honor cats
ancient were awarded due to their eye structure. According to the Book of the Dead, the eyes of Ra
changed depending on the time of day (the eye of Ra can be the sun or the moon). Cats, as we know,
can do this “trick” too - in bright light their pupils constrict, becoming almost invisible slits. It was
believed that during the day the cat eyes absorb the sunlight, and at night, they were giving it back –
obviously the cat eyes night flicker was meant. Cats in ancient Egypt were considered messengers of
Ra also because these animals hate snakes, destroying any settled in their territory. According to
mythology, every night Ra descends into the underworld, where he kills his nemesis - snake Apophis,
and then returns to the water of heavenly Nile (i.e., when the morning comes). Another sacred animal
associated with Ra is the scarab beetle, which is read on the chest or forehead of a shorthair tabby cat
(namely, striped and spotted cats lived in ancient Egypt and inherited this color from the wild
ancestors). Sometimes god Ra in Egypt, killing Apophis acts in the form of a huge red cat (an animal
hating snakes is a cat, and red is the colour of the sun).
http://pets-wiki.com/publ/cats/interesting/cats_in_ancient_egypt/
www.nedmartin.org
actionforearth.weebly.com
The Ancient Egyptians are known of the love that they had for cats. And posted them on the walls
papyrus papers
7
and on
Bastet Cat Goddess holding the flint knife or dagger used in ancient Egypt
Khopwww.landofpyramids.org
Ancient Egyptian Gods: Bast (Bastet) www.ancientegyptonline.co.uk Cats were sacred to Bast, and to harm one was
considered to be a crime against her and so very unlucky. Her priests kept sacred cats in her temple ,
The Egyptian Mau cat is well known in legend and ancient past. It is believed that these cats are
descendants of the sacred cats of Egypt, and their ancestry goes back at least 3,500 years. It is the only
naturally occurring spotted cat, and it bears "M" mark on the forehead, sometimes called the scarab
mark after the symbol the ancient Egyptians considered divine. As highly honoured cats, it was an
offence in ancient times to hurt or kill one of these cats, and many have been found mummified in
tombs. Mau is the Egyptian word for cat.
When a cat died, their human family would go into a deep mourning and shave their eyebrows. The
cat would then be mummified and buried along with provisions such as milk, mice and rats. Cats were
often taken to Bubastis to be buried, but tombs have also been discovered in Giza, Abydos, Denderah
and Beni Hasan. For example, a tomb in Beni Hassan was discovered in 1888 which contained an
estimated 80,000 feline burials. The deceased cat was wrapped in fine linen and taken to be
embalmed. Diodorus recorded that the deceased cat was "treated with cedar oil and such spices as
have the quality of imparting a pleasant odour and of preserving the body for a long time (J Hill 2010.
http://www.ancientegyptonline.co.uk/cat.html).
J Hill 2010 , Source: http://ancientegyptonline.co.uk/cat.html, Sarcophagus for cat mummy ..
factsanddetails.com
8
This Egyptian cat was mummified and offered to a god over 2,000 years agowww.justpetcats.com
Stray animals like cats and dogs are all around the streets of Egypt. We do not have any statistics on
the numbers of strays. The estimated count in greater Cairo is around 35,000 dogs. However, these
numbers cannot be verified.” According to the Egyptian Gazette, there are approximately 5 million
stray animals living on the streets of Egypt.
Stray cats and dogs
In Cairo, as well as in large cities in Egypt, the association between pet animals and humans has been
changed throughout the last few years. The number of owned dogs and cats was dramatically and they
are kept inside houses as common households.
9
Maverick in Egypt Dog Show 2010, www.youtube.com
Granddaughters Farida and Laila Refai with their cats at home
The improved political and economic stability in Egypt affect positively the pet care market.
Consumers are more apt to purchase pet care products from pet shops and hypermarkets with high
availability. As the number of domesticated animals being kept in the country continues increasing,
the numbers of pet breeders, veterinarians and retailers of pet care products are also increasing, and
this has affected consumers’ preference for the quality of food they purchase for their pets.
Shelters for dogs consisting of of cage for sleeping during nighttime and external corridor and a garden for a walk during
the day
11
Pet accessories and foods in shops and supermarkets in Cairo
Private pet clinics in Cairo
Cats and dogs have a very important role in terms of human health and social benefits. In all
cases, whether these pet animals are stray or owned, the close physical contact with such
animals at high-frequency basis facilitates the transmission of pathogens between pets and
human contacts. There are many diseases known to be transmitted from cats and dogs to
human contacts, among them are the fungal diseases, which are the subject of the present
monograph.
11
A. Fungal diseases of cats and dogs caused by dermatophytes
1. Ringworm (Dermatophytosis) in cats and dogs
1.1. Introduction
Dermatophytosis is worldwide the most common and important fungal skin infections of cats
and dogs.
The disease is caused by several dermatophytes with Microsporum canis on the top. but other
dermatophytes are also involved such as Microsporum gypseum, Trichophyton
mentagrophytes, Microsporum persicolor, Trichophyton verrucosum and Trichophyton
quinckeanum.
Microsporum canis has been frequently isolated from apparently healthy cats and dogs, but it is not
considered as part of the normal fungal flora of these animals. Arthrospores of Microsporum canis are
transmitted through contact with sick or subclinically infected animals, mainly cats, but also dogs or
other species, or indirectly through contaminated collars, brushes, toys, environments.
Microsporum canis has been frequently isolated from human cases of tinea capitis and tinea
corporis. The infection may be acquired from infected animals with cutaneous lesions but also
from asymptomatic carriers or from the environment, as asymptomatic M. canis carriers are
considered to be a critical factor in the epidemiology of dermatophytosis in human.
Here are some reports:
El-Bahay and Refai (1973) examined 113 apparently healthy stray cats and dogs in Cairo. The
animals were examined clinically for loss of hairs or any skin lesions and were passed under UV light
of a Wood´s lamp. All animals were free from any lesions and showed no fluorescence under the UV
light. The mycological examination of the samples revealed the isolation of Microsporum canis from
5 samples. They concluded that the animals carried the fungal spores on their coat, without invasion
of the skin or hairs.
Boyanowski et al. (2000) collected samples from 2000 shelter cats from the Pacific western coastal
USA in four different geographical regions to determine the fungal organisms most commonly found
on the hair coat and the prevalence of these organisms. The overall prevalence of dermatophytosis
was 5.5% (11 of 200 cats), with Microsporum canis isolated in 90.9% (10 of 11) of the samples from
positive cats. This was a lower isolation rate or prevalence of dermatophytes than previous studies
conducted on shelter cats in other regions of the USA. Ten of 11 of the cats were lesion free (either
subclinical infection or mechanical carriage).
Mancianti et al. (2003) examined the environments inhabited by 30 symptomatic animals (21 cats
and 9 dogs) infected by M canis by sampling both surfaces and indoor air. The surfaces were
examined by means of contact plates; the air sampling was performed with AIR SAMPLER.
Environmental contamination was detected in all households with cats, while only four out of nine
houses harbouring dogs were found positive. The frequency of isolation in each sampling, and the
results in terms of colony forming units per plate in the different houses appeared to be quite
homogeneous. Heavily infected environments harboured kittens only. Infected owners were observed
in eight households, in all of which at least one infected cat was present. No history of human
dermatophytosis in households harbouring dogs was found. On the basis of these results results,
infected cats appeared to cause substantial environmental contamination, and provoke a substantial
presence of viable airborne fungal elements.
Mancianti et al. (2003) determined the load of M. canis arthrospores in households harbouring
infected pets, in order to evaluate the infectivity of the animals versus the environment. The
12
environments inhabited by 30 symptomatic animals (21 cats and 9 dogs) infected by M canis were
examined by sampling both surfaces and indoor air. The surfaces were examined by means of contact
plates; the air sampling was performed with an AIR SAMPLER. Environmental contamination was
detected in all households with cats, while only four out of nine houses harbouring dogs were found
positive. The frequency of isolation in each sampling, and the results in terms of colony forming units
per plate in the different houses appeared to be quite homogeneous. Heavily infected environments
harboured kittens only. Infected owners were observed in eight households, in all of which at least
one infected cat was present. No history of human dermatophytosis in households harbouring dogs
was found. On the basis of our results, infected cats appear to cause substantial environmental
contamination, and provoke a substantial presence of viable airborne fungal elements. Dogs seem to
be of lower importance in the spread of M canis: they contaminated surfaces, but they never
contaminated the air. The results of this study confirmed the potential leading role of the feline
species in the environmental spread of M canis.
Cafarchia et al. (2006) investigated the relationship between the presence of dermatophytes on the
hair coats of dogs and cats without cutaneous lesions and the occurrence of the disease in their
respective owners. A total of 136 dogs and 248 cats were sampled from January 1999 to January
2005. Seventy-eight animals (22 dogs and 56 cats) belonged to individuals affected by tinea corporis
caused by M. canis and 306 (114 dogs and 192 cats) to individuals without dermatophytosis.
Dermatophytes were isolated from 20.5% of the dogs and 28.2% of the cats. Microsporum canis was
isolated from 36.4% of dogs cohabiting with owners diagnosed with tinea corporis but it was never
isolated from dogs whose owners had no lesions. By contrast, M. canis was isolated from 53.6% of
cats cohabiting with owners diagnosed with tinea corporis and from 14.6% of cats whose owners had
no signs of the disease. These results clearly indicate that both cats and dogs should be considered as
a major source of pathogenic dermatophytes for humans even when they do not present clinical signs
of dermatophytosis.
Frymus et al. (2013) reported that dermatophytosis, usually caused by Microsporum canis, is the
most common fungal infection in cats worldwide, and one of the most important infectious skin
diseases in this species. Many adult cats are asymptomatic carriers. Severe clinical signs are seen
mostly in kittens or immunosuppressed adults. Poor hygiene is a predisposing factor, and the disease
may be endemic in shelters or catteries. Humans may be easily infected and develop a similar skin
disease. Infectious arthrospores produced by dermatophytes may survive in the environment for about
a year. They are transmitted through contact with sick cats or healthy carriers, but also on dust
particles, brushes, clothes and other fomites.
1.2.
Prevalence
The reported prevalence of M canis infection in cats and dogs is highly variable and depends
on geographic region, the population sampled, whether or not culture status is correlated with
diseases and criteria for data collection and reporting.
Among various fungal culture surveys conducted in the USA and Europe over the past 20
years, the prevalence of culture-positive cats has ranged from 4–100%. However, these
numbers can be very misleading and may overestimate actual disease prevalence due to fomite
carriage by cats (Boyanowski et al., 2000, Iorio et al.,2007, Duarte et al., 2010).
in one retrospective study in a shelter comparing screening cultures and post-culture
examinations, data from 5644 cats over a 24 month period revealed 584 culture -positive
(10.3%) cats, with skin lesions being noted at the time of admission in 381/5644 (6.75%)
13
cats.10 However, only 94/5644 cats were both lesional and culture positive (1.6%); the
remaining 490 culture-positive cats were fomite carriers (Verbrugge et al., 2006).
1.3.
Transmission
Transmission of dermatophytosis is dependent on many factors including:
The amount of infective material, frequency of exposure, global health of cats and dogs, and
physiological stress.
Exposure to infective spores via direct animal-to-animal contact is the most common and
important route of transmission and represents the highest risk factor.
Cats and dogs can also be exposed to infective spores via contact with contaminated blankets,
bedding, toys, brushes, lab coats, leather gloves or even external parasites ( Newbury et al.,
2010)
Cats and dogs can also be exposed to infection via airborne transmission of spores (Mancianti
et al., 2003)
1.4.
Incubation period
Incubation period is mostly cited in textbooks as being 2–4 weeks
There is evidence that active infection develops much sooner. Contact between infective
spores and the skin, and concurrent microtrauma are needed for disease development.
1.5.
Pathogenesis
Adherence of Microsporum canis to feline corneocytes
The mechanisms and the kinetics of adherence have been investigated using different in vitro and ex
vivo experimental models, most notably showing the role of a secreted serine protease from
Microsporum canis in fungal adherence to feline corneocytes.
Invasion of keratinised structures
After germination of the arthroconidia, dermatophytes invade keratinised structures that have to be
digested both secreted endoproteases and exoproteases into short peptides and amino acids to be
assimilated. exoproteases, but their precise role in both fungal adherence and skin invasion should be
further explored.
Reports:
Tabart et al (2008) reported on the use of a sophisticated model of reconstructed interfollicular feline
epidermis (RFE), in which both the cornified layer and skin permeability resembled the in vivo
situation. Using this same model, M canis arthro-conidia started to adhere to the RFE within 2 h and
increased in numbers for up to 6 h post-inoculation. Sites were culture-positive and invasion was
documented histologically within 5 days. A study using another experimental model of M
canis infection in cats, found that hairs became infected and lesions developed at inoculation sites
within 7 days post-inoculation.
Baldo et al. (2008) developed a model to study the adherence of M. canis to feline corneocytes
through the use of a reconstructed interfollicular feline epidermis (RFE). In this model, adherence of
arthroconidia to RFE was found to be time-dependent, starting at 2 h post-inoculation and still
increasing at 6 h. Chymostatin, a serine protease inhibitor, inhibited M. canis adherence to RFE by
53%. Moreover, two mAbs against the keratinolytic protease subtilisin 3 (Sub3) inhibited M. canis
14
adherence to RFE by 23%, suggesting that subtilisins, and Sub3 in particular, are involved in the
adherence process.
1.6.
young age (first 2 years of life),
immunosuppression (including immunosuppressive treatment),
other diseases,
nutritional deficits (especially proteins and vitamin A),
high temperature and high humidity
skin trauma resulting from increased moisture,
injury by ectoparasites or scratches due to pruritus,
playing or aggressive behaviour, clipping, etc.
poor hygiene
overcrowding in catteries
.
1.7.
Predsposing factors
Immunity
Naturally occurring ringworm is rarely recurrent, suggesting an effective and long-lasting
immunity.
Reinfections may occur, but require a much greater number of spores, and usually these
subsequent infections are cleared more rapidly.
Humoral and cellular immune response is induced.
o Prominent activation of T helper type 2 (Th2) cells and the corresponding cytokine
profile leads to antibody formation followed by chronic disease,
o Activation of Th1 cells stimulates a cell-mediated response characterised by interferonγ, and interleukins 12 and 2, and leads to recovery.
Such cats are protected against reinfection.
The role of the humoral response in dermatophytosis is unclear, although antibodies could
have a fungistatic effect by means of opsonisation and complement activation.
1.8.
Clinical signs of ringworm
1.8.1. Clinical signs of ringworm in cats
Regular and circular alopecia with hair breakage, desquamation and sometimes an
erythematous margin and central healing. The lesions may be very small, but occasionally
may have a diameter of 4–6 cm. Lesions may be single or multiple, and are localized mostly
on the head (but also on any part of the body, including the distal parts of the legs and the tail.
Young cats, in particular, display lesions localized at the bridge of the nose and then extend to
the temples, the external sides of the pinnae and auricular margins Multiple lesions may
coalesce. Lesions may appear as a papulocrustous dermatitis (‘miliary dermatitis’) affecting
mainly the dorsal trunk. Extensive lesions with secondary bacterial involvement are
sometimes associated with chronic ringworm, particularly in immunosuppressed cats. Such
cats demonstrate atypical, large alopecic areas, erythema, pruritus, exudation and crusts. At
this stage, dermatophytosis may mimic other dermatological conditions. Typical signs may be
still visible at the margins of the lesions.
15
A cat with scaly ringworm, Circular alopecia caused by M canis infection. Tadeusz Frymus
Dermatophytosis lesions on the head. International Cat Care
Dermatophytosis of external sides of the pinnae of a cat. Tadeusz Frymus
Generalized ringworm in a cat. International Cat Care
Moriello (2014) grouped cats with dermatophytosis into 3 groups based on a global health
assessment:
1. Simple infection: This group consists of cats or kittens with confirmed infections that are
otherwise healthy and not under physiological stress. Lesions are obvious but limited in
extent. Provided the cats/kittens remain healthy, and not stressed, and receive appropriate
preventive care, they will respond well to therapy.
2. Complicated infection: This group consists of cats with widespread lesions, inflammatory
lesions, long/ matted hair coats, other illnesses (most notably upper respiratory infections), a
history of prior treatment and/or surrender for ‘resistant dermatophytosis’, as well as semiferal or feral cats. In many cases, clipping of the hair coat reveals the true extent of the lesions.
These cats are more complicated to treat because of the extent of their lesions, handling issues
and/or other health factors. In some cases (eg, geriatric cats, cats with upper respiratory
infection) antifungal therapy must be coordinated with treatment for pre-existing disease.
3. Lesion-free/culture positive: This group consists of cats that are mechanically carrying
spores on their hair coat and/or cats with very early lesions that are not easily seen but mature
enough to be shedding arthrospores. Colony forming units (cfu) on fungal culture, coupled
with a re-examination under both room light (sometimes called ‘white light’) and a Wood’s
lamp, are helpful aids for differentiating fomite carriers (‘dust mops’) from cats with early
lesions. A major risk these cats pose is contamination of the environment, which will
confound fungal culture results; or, if truly infected, they are a source of infection for
susceptible cats.
i. Fomite carrier cats: At the time of admission no lesions were noted and these cats
were Wood’s lamp negative. Upon re-examination, the cats were still lesion-free,
Wood’s lamp negative and culture negative. Typically these cats had fewer than 10
cfu/plate.
ii. Infected cats: At the time of admission, likewise, no lesions were noted and these cats
were Wood’s lamp negative. By the time culture results were available 7–14 days later,
these cats were lesional, Wood’s lamp positive and still culture positive. Lesions were
16
usually small and typically located in, on or near the ears, on the muzzle, between the
digits, on the tail or in the axilla.
Focal lesion of dermatophytosis on an otherwise healthy cat. Dr Rebecca Stuntebeck Generalized
dermatophytosis in a kitten with malnutrition, diarrhea and upper respiratory infection
Moriello (2014) J Feline Med Surg. 2014 May; 16(5):419-431
1.8.2. Clinical signs of ringworm in dogs
Dermatophytosis is seen most often in puppies.
The lesions frequently develop on the face and limbs, although they may occur on any part of
the body.
M. canis infection tends to appear as small circular areas of alopecia. The hairs are typically
broken at the base, giving the appearance of having been shaved. The center of the lesion
usually contains pale skin scales in the early stage, giving it a powdery appearance, and the
edges are generally erythematous. Vesicles and pustules may also be seen.
In later stages, the area is often covered by a crust and the edges swollen. Individual lesions
may coalesce to form large, irregular patches.
T. mentagrophytes and T erinacei cause lesions that tend to be more thickened and
inflammatory than those caused by M. canis
M persicolor typically causes localized or generalized scaling with little erythema and
minimal alopecia.
Other forms of dermatophytosis can include kerions (localized severe inflammation with
swollen, boggy skin oozing pus) and pseudomycetomas.
Onychomycosis may occur concurrently with dermatophytosis.
Ringworm in Dogs, www.homeremedyalmanac.com, Canine ringworm on face of 9 year old Miniature , www.doghealth-handbook.com
17
Pincher Source: Washington State University Dog Ringworm www.dog-health-handbook.com
Dog with Ringworm. This dog contracted ringworm from infected soil www.worldclassgsd.com
www.toapayohvets.com
1.9.
Close-up of Charlie's ringworm sore.
Aetiology
1.9.1. Microsporum canis Bodin, Les champignons parasites de l'homme, 1902.
Synonyms
= Microsporum audouinii Gruby var. canis Bodin in Besnier et al., 1900.
= Sabouraudites canis (Bodin) Langer., 1945.
= Microsporum felineum Mewborn, 1902.
= Microsporum lanosum Sabour., 1907.
18
= Sabouraudites felineus (Mewborn) Ota & Langer., 1923 as '(Fox & Blaxall, 1896)'.
= Sabouraudites lanosus (Sabour.) Ota & Langer., 1923.
= Closterosporia felinea (Mewborn) Grigoraki, 1925.
= Closterosporia lanosa (Sabour.) Grigoraki, 1925.
= Microsporum aurantiacum Conant, M. obesum Conant, M. pseudolanosum Conant, and =M. simiae
Conant, 1941. Conant also considered M. equinum (Delacr. & Bodin) Gueguen
Colonies on Sabouraud's glucose agar are flat, spreading, 55-70 mm diam. after 2 weeks at 25°C, at
first mostly submerged, surface very thin and strongly radiating, with a buff, granular to fluffy area in
the centre where macroconidia are formed; rapidly mutating to produce patches of dense, fluffy,
whitish to pale buff mycelium which eventually grows over the whole colony. Colonies usually have
a bright golden yellow to brownish yellow reverse pigment, but non-pigmented strains may also
occur.
Colonies of Microsporum canis
Dysgonic strains are slow-growing, glabrous, brownish, usually confined to a very small area around
the hair stumps from which they are growing; they are not stable and on sub-culture may give rise to
colonies typical of M. canis.
Growth on Rice Grains: good growth of white aerial mycelium with production of yellow pigment.
Culture of dysgonic strain of M. canis, boiled polished rice grains to stimulate sporulation, Mycology online
Macroconidia most abundant in the centre of the colony, fusiform, variable in size, 35-110 x 12-25
µm, with up to 14 septa and thick (up to 4 µm thick at the centre of the cell), verrucose walls; ends
remaining narrow and relatively thin-walled. Macroconidia borne terminally on short hyphae, usually
at an acute angle along simple hyphae, occasionally on branched hyphae with up to 3 branches,
themselves branched, arising at the apex of one cell. Microconidia rare on Sabouraud's glucose agar,
more abundant on some other media, 3,5-8·5 x 1,5-3,5 µm, smooth-walled, non-septate or rarely 1septate, sessile or on short pedicel, borne along the sides of simple hyphae.
19
Macroconidia of M. canis, Mycobank
Geographical distribution: Africa (Algeria, Angola, Cape Verde Islands, Egypt, French W. Africa,
Sahara, Tunisia, Union of S. Africa); Asia (Ceylon, India, Philippines, Turkey); Australasia &
Oceania (Australia (N.S.W.), New Zealand); Europe, North America, Central America and West
Indies (Costa Rica, Cuba, Guatemala, Mexico, Panama, Puerto Rico); South America (Argentina,
Brazil (south of Pernambuco), Chile, Colombia, Ecuador, Peru, Uruguay, Venezuela).
Reports
Dreisoerner et al. (1964) isolated Microsporum canis fro 17 out of 42 cats in a cattery suffering
fromotitis externa.
Kristensen and Krogh (1981) examined 774 specimens from dogs and 227 specimens from cats
were for ringworm infection. Ninety-six (12.4%) of the samples from dogs and 66 (29.1%) of the
samples from cats were positive by culture. Microsporum canis accounted for all infections in cats
and for 95.8% of the infections in dogs.
Chermette et al. (2008) mentioned that Microsporum canis is largely predominant in cats with over
90% of the feline isolates in most of the surveys conducted worldwide. They described Microsporum
canis infection in a kitten with lesions on the bridge of the nose, the ear margins and the digits. They
also described histological lesion of the dermis in a mycetoma-like M. canis infection in a Persian cat,
where a pyogranulomatous reaction could be seen around PAS-positive vesiculous fungal elements
embedded in an eosinophilic mass. They also reported kerion in a dog due to Microsporum canis and
a case of total alopecia in an extensive dermatophytosis due to Microsporum canis in a Yorkshire
terrier following a corticotherapy.
21
Microsporum canis infection in a kitten with lesions on the bridge of the nose, the ear margins and the digits
(Parasitologie, Ecole Nationale Ve´te´rinaire d’Alfort)
Histological lesion of the dermis in a mycetoma-like M. canis infection in a Persian cat. A pyogranulomatous reaction can be seen around PASpositive vesiculous fungal elements embedded in an eosinophilic mass. Kerion due to Microsporum canis in a dog (Parasitologie, Ecole
Nationale Ve´te´rinaire d’Alfort)
a case of total alopecia in an extensive dermatophytosis due to Microsporum canis in a Yorkshire terrier following a
corticotherapy (Parasitologie, Ecole Nationale Ve´te´rinaire d’Alfort)
Mancianti et al. (2002) examined dermatological specimens from 10.678 animals (7.650 cats and
3.028 dogs) for dermatophytes. All the animals presented clinical signs of ringworm. Two thousandfour hundred fifty-six of the 10.678 (23%) examined animals scored positive for dermatophytes, 566
out of 3.028 canine (18.7%) and 1890 out of 7.650 feline specimens (24.7%). Microsporum canis
constituted 83% and 97% of the isolated dermatophytes respectively in dogs and cats.
21
Cafarchia et al. (2004) examined 424 animals (268 dogs and 156 cats) with skin lesions (alopecia
and peripheral scaling), of which 99 (23.3%) yielded a positive culture (20.5% of the dog samples and
28.2% of the cat samples). Microsporum canis was the most common dermatophyte isolated from
dogs and cats (77.7%). Young dogs and cats, especially those younger than 1 year, showed a
statistically significant higher prevalence of M. canis infection than older animals. No statistically
significant association was found between infection and sex in cats, while male dogs were more
affected by dermatophytes. Among breeds, Yorkshire terriers showed the highest positivity (50%)
caused mainly by M. canis (46.6%), while no differences were noticed for cats. A significantly higher
prevalence of positive samples was registered in summer and in autumn for cats.
Pinter and Štritof (2004) reported on the examination of 3854 dogs with different dermatological
disorders, in the period from 1970 to 2002, in Croatia. Microsporum canis was diagnosed in 840
cases (21.8%). difficult, together with duration of infection and reappearance due to persisting spores.
Iorio et al. (2007) collected 200 hair/skin samples from 2002 to 2004 from two groups of cats
(privately owned and stray cats from a shelter) Thirteen of the 100 privately owned cats (13%) and
100% of the stray cats were positive. Microsporum canis was the most common dermatophyte
isolated in both cat groups.
Yahyaraeyat et al. (2009) isolated dermatophytes from 54 (43.5% of 124 cats in Tehran, Iran. M.
canis constituted 94.7 % of the isolated dermatophytes. The positive cats were between 1-48 months
years old, cats less than I year old significantly suffered from dermatophytosis. Of 292 dogs
examined, 63 yielded dermatophytes (21.5%), of which 88.8% were M. canis.The positive dogs were
between 2 weeks and 11 years old.
MORETTI et al. (2013) mentioned that M. canis is the most frequently isolated dermatophyte
which has its natural reservoir in the cat. This dermatophyte is found in over 90% of fungal infection
in cats. Typical lesions observed in kittens are non-inflammatory alopecic areas, with central
desquamation, which are surrounded by brittle or easy to extract fur. Lesions localize preferentially on
areas that are most in contact with the healthy carrier mother cat while feeding, i.e., face, ears and
legs. Other forms are characterized by small, crusted scaly, sometimes itchy, lesions. Other aspects
are miliary-like dermatitis andring-shaped lesions with inflammation or papules on the periphery and
fur regrowth in the center. Single or multiple cutaneous nodules, firm and painless at palpation, are
usually found on the back and neck. Nodules are in blue or purplish colour, without alopecia or
erythema and may result in "scutula formation. This form of dermatophytosis is mainly found in
Persian cats because of their genetic predisposition to it.
Pseudomycetoma in a Persian cat caused by M. canis, Dr. Federico Leone
22
Dąbrowska et al. (2014) examined samples collected from 8 cats and 7 dogs suspected of ringworm
by direct microscopy and cultured on Sabouraud dextrose agar (SDA). Ringworm was identified in all
specimens. Culture on Sabouraud dextrose agar supplemented with chloramphenicol (0.05 g /l) and
cycloheximide (0.4 g/l), at 30°C for up to 14 days yielded pure cultures of Microsporum canis.
Typical ringworm lesions in a cat’s ears due to Microsporum canis (Photo: W. Dardzińska), macroconidia of Microsporum canis.
Microconidia typically are absent. Macroconidia are fusoid, verrucose, and thick walled. They have a recurved apex and contain 5–15 cells.
Dąbrowska et al. (2014)
Proverbio et al. (2014) conducted a study to determine the prevalence of dermatophytes in stray cats
with and without clinical lesions from different colonies in rural and urban areas of Milan and
surroundings in northern Italy. Stray cats (273) were caught during a trap-neuter-release (TNR)
program conducted in different colonies of northern Italy in both rural and urban areas. Each cat was
examined in dark environment with a Wood’s lamp prior to sample collection. Hair or scales
exhibiting typical fluorescence were removed with a pair of sterile hemostats and cultured. The hair of
all cats was then sampled by Mackenzie modified brush technique regardless of the presence or
absence of skin lesions attributable to dermatophytosis. All the hair samples were subjected to fungal
culture. 15 cats were positive (5.5%). Microsporum canis was the most common dermatophyte
isolated (13/15).
1.9.2. Microsporum gypseum (E. Bodin) Guiart & Grigoraki, Lyon Médical 141:
377 (1928)
≡Trichophyton gypseum E. Bodin, Les champignons parasites de l'homme: 115 (1902)
≡Achorion gypseum (E. Bodin) E. Bodin, Annales de Dermatologie et Syphilis 8: 585 (1907)
≡Sabouraudites gypseus (E. Bodin) M. Ota & Langeron, Annales de Parasitologie Humaine Comparée 1: 328
(1923)
≡Closterosporia gypsea (E. Bodin) Grigoraki, Annales des Sciences Naturelles Botanique 7: 411 (1925)
≡Trichophyton mentagrophytes var. gypseum (E. Bodin) Kamyszek, Med. Weteryn.: 146 (1945)
=Microsporum flavescens Horta, Memórias do Instituto Oswaldo Cruz 3 (2): 301-308 (1912)
=Microsporum scorteum Priestley, Ann. Trop. Med. Parasit.: 113 (1914)
=Microsporum xanthodes Fischer, Dermatol. Wochenschr.: 214-247 (1918)
=Favomicrosporon pinettii Benedek, Mycopathologia et Mycologia Applicata 31 (2): 111 (1967)
On Sabouraud's dextrose agar, colonies are usually flat, spreading, suede-like to granular, with a deep
cream to tawny-buff to pale cinnamon coloured red surface. Many cultures develop a central white
downy umbo (dome) or a fluffy white tuft of mycelium and some also have a narrow white peripheral
boarder. A yellow-brown pigment, often with a central darker brown spot, is usually produced on the
reverse, however a reddish-brown reverse pigment may be present in some strains.
23
M. gypseum colony.mycology online
www.provlab.ab.ca
M. gypseum colonies on Kimmig agar, Rieth
Cultures produce abundant, symmetrical, ellipsoidal, thin-walled, verrucose, 4-6 celled macroconidia.
The terminal or distal ends of most macroconidia are slightly rounded, while the proximal ends (point
of attachment to hyphae) are truncate. Numerous clavate shaped microconidia are also present, but
these are not diagnostic.
Mycobank
labmed.ucsf.edu
24
Reports:
Okoshi and Hasegawa (1957) described the clinical and mycological findings in 3 cases of cats
ringworm caused by Microsporum gypseum. The 3 cats had been born and reared separately in
Tokyo. Lesions occurred on the head, scrotum, paw, and pad; some showed mild scaling with loss of
hair, and others crust formation and inflammation.
Kano et al. (2001) reported a 1- to 2-month-old female cross-breed cat presented with alopecia,
erythema and many crusts on the tail. Microscopic examination of crusts from the tail disclosed
epithelial debris, exudate, mycelium, and arthrospores. Microsporum gypseum was cultured from the
crusts on a Sabouraud glucose agar at 27°C for 1 week.
Mancianti et al. (2002) examined dermatological specimens from 10.678 animals (7.650 cats and
3.028 dogs) for dermatophytes. All the animals presented clinical signs of ringworm. Two thousandfour hundred fifty-six of the 10.678 (23%) examined animals scored positive for dermatophytes, 566
out of 3.028 canine (18.7%) and 1890 out of 7.650 feline specimens (24.7). M. gypseum represented
13%. Microsporum gypseum was mostly recorded from sporting (hunting) breeds. The annual
distribution of the infections in dogs showed a significantly higher incidence for M. gypseum in
summer versus winter and spring.
Andrino et al. (2003) described a case of severe canine onychomycosis. The aetiological agent was
identified as Microsporum gypseum. The incidence of this fungus in this kind of pathology was
discussed, with special attention to the successful treatment with topic enilconazole and systemic
griseofulvin.
Pinter and Štritof (2004) reported on the examination of 3854 dogs with different dermatological
disorders, in the period from 1970 to 2002, in Croatia. Microsporum gypseum was isolated in 38 dogs
(1.0%).
Yahyaraeyat et al. (2009) isolated dermatophytes from 54 (43.5% of 124 cats in Tehran, Iran. M.
gypseum was recovered from 2.6% of the cases. Of 292 dogs examined, 63 yielded dermatophytes
(21.5%), of which 3.7% were M. gypseum.
Madrid et al. (2012) reported an outbreak of canine neonatal dermatophytosis caused by
Microsporum gypseum. Seven puppies with 20 days old-age were submitted to clinical examination,
where five showed regions of alopecia, erythema and scaling in the hindlimb and/or tail.
Dermatophytosis was confirmed by isolation of M. gypseum and topical antifungal therapy was
prescribed to all animals. Two animals had spontaneous clinical cure of the lesions and the others
were treated for 30 days with ketoconazole or miconazole. Fungal cultures were negative after the end
of the treatment
Presence of swelling, erythema and alopecia right hind limb of puppy affected by ringworm
C and macroconidia of Microsporum gypseumolony, Madrid et al. (2012)
25
MORETTI et al. (2013) mentioned that M. gypseum often cause kerion which presents as a deep,
infiltrated inflammatory swelling, with a damp, ulcerated pus exuding surface and is often associated
with secondary bacterial infection. These infections frequently develop on the face and limbs of
hunting and truffle dogs that spend a lot of time outdoors in contact with the ground. Onychomycosis
is very rare in dogs and usually caused by M. gypseum. The nail becomes brittle, loses its shape with
periungual inflammation usually developing.
Kerion in a dog presents as a deep, infiltrated inflammatory swelling, with a damp, ulcerated pus exuding surface caused
by M. gypseum, Onychomycosis in a dog caused by M. gypseum, the nail becomes brittle, loses its shape with periungual
inflammation, MORETTI et al. (2013)
Nardoni et al. (2013) evaluated the occurrence of infection by Microsporum gypseum retrospectively
in dermatological specimens from 15,684 dogs and cats dermatologically diseased from Italy. One
hundred and eighty-five specimens out of 15,684 (1.1%) scored positive for Microsporum gypseum.
Sun et al. (2014) examined four cat favus cases, focusing on clinical presentations and
histopathological features. Physical examination revealed a waxy, yellow scutulum surrounded by
broken hairs adherent to the ears in all cases cases, and yellow favic scutulum with a waxy surface on
the right hind leg of one of the cases. After the scutulum was carefully removed, a figurate ulcerated
base was revealed. Microscopic examination of the waxy crust after it was pretreated with 20%
potassium hydroxide (KOH) revealed many arthroconidia and hyaline hyphae. Wood's light
examination was negative. In all cases the etiologic agent was identified as M. incurvatum based on
its morphological characteristics and sequences of internal transcribed spacers (ITS) of nuclear
ribosomal DNA.
Left:Favus in a kitten showing a waxy, yellow scutulum surrounded by broken hairs adherent to the ear. Middle:yellow
scutula on the external aspect of the right ear, Right:yellow favic scutulum with a waxy surface on the right hind leg , Sun
et al., 2014
The histopathology of the cases elucidated the development of favic lesions. The fungus gained entry
to the skin from the stratum corneum of the epidermis and then invaded horizontally and downward
into hair follicles. The hair shafts within the follicles were also infected. Hyphae then proliferated
very quickly between the stratum corneum and Malpighian layer, forming the main body of scutula.
The hyphae that grew upward between the two tissue layers and became fragmented into
26
arthroconidia. Histological staining revealed alternate horizontal dense and loose zones of fungal
growth.
The scutulum was composed of a thin layer of stratum corneum, main fungal portion, and a destructed, necrotic
lower epidermis. Hair follicles and hairs were invaded by fungal hyphae (100X, PAS stain) (b) Higher magnification
of Fig. 2(a). (c) Horizontal zonations of fungal portion of scutulum (100X, H&E stain). (d) Destruction of lower
epidermis by fungal hyphae (400X, H&E), Sun et al., 2014
Watanabe (2014) reported two cases of dermatophytosis caused by Microsporum gypseum. One
case was a 59-year-old healthy woman who complained of itchy annular erythema on her right
forearm. We isolated Microsporum gypseum from scales on the forearm. The other case was a 73year-old midwife who had developed infiltrated erythema on her face for 6 months. Microsporum
gypseum was isolated from scales of the nose. Both women liked gardening and Microsporum
gypseum was isolated from the garden soil of these women by a hair-baiting technique. The first case
had a cat, a mouse and an owl, and the second had a dog. Hairbrush culture of these pets, however,
was negative. So we concluded both cases were infected with Microsporum gypseum from garden
soil. They isolated Microsporum gypseum from soil collected in Chigasaki city. Of the 7 fungal
cultures from 10 samples, 2 cultures were identified as Microsporum gypseum.
1.9.3. Microsporum persicolor (Sabour.) Guiart & Grigoraki, Lyon Médical 141:
377 (1928)
≡Trichophyton persicolor Sabour., Maladies du Cuir Chevelu 3: 632 (1910) [MB#119354]
≡Ectotrichophyton persicolor (Sabour.) Castell. & Chalm., Manual of Tropical Medicine: 1005 (1919)
≡Sabouraudites persicolor (Sabour.) M. Ota & Langeron, Annales de Parasitol Hum Comp 1: 329 (1923)
≡Closteroaleurosporia persicolor (Sabour.) Grigoraki, Annales des Sciences Naturelles Botanique 7: 412 (1925)
≡Sabouraudites mentagrophytes var. persicolor (Sabour.) M. Ota & Kawats. (1933) [MB#416556]
≡Ctenomyces persicolor (Sabour.) Nann., Repert sistem dei miceti dell' uomo e degli animali 4: 154 (1934)
≡Epidermophyton persicolor (Sabour.) C.W. Dodge, Medical mycology.: 486 (1935)
≡Langeronites persicolor (Sabour.) Ansel (1957)
≡Trichophyton mentagrophytes var. persicolor (Sabour.) Ueckert, Zentralblatt für Bakteriologie und
Parasitenkunde Abteilung 1 176: 127 (1959)
≡Microides persicolor (Sabour.) De Vroey, Annales de la Société Belge de Médecine Tropicale 50 (1): 25 (1970)
27
Mycobank
Reports
Bond et al. (1992) mentioned that Microsporum persicolor, a rare zoophilic dermatophyte, was
isolated from three dogs with skin disease of between three and five years duration. Skin lesions
consisted of scaling with minimal alopecia or erythema. Severe inflammatory changes were not
observed clinically and pruritus was absent or mild. The face was affected in all three cases and more
widespread lesions were found in two. The diagnosis of dermatophytosis was confirmed in each case
by the demonstration of fungal hyphae in the epidermal stratum corneum on examination of skin
biopsies. However, hair shaft invasion was not observed in either skin scrapings or histological
sections. Of the three dogs, one partially improved following repeated courses of treatment, a second
completely recovered with 11 weeks of combined topical and systemic therapy. Response to therapy
could not be assessed in the remaining case.
Pinter and Štritof (2004) reported on the examination of 3854 dogs with different dermatological
disorders, in the period from 1970 to 2002, in Croatia Microsporum persicolor was diagnosed only
twice (0.1%).
Muller et al. (2011) conducted a retrospective study of 16 cases of dermatophytosis due
to Microsporum persicolor in dogs is reported. Hunting dogs were overrepresented (12/16). Skin
lesions were observed on the face in all cases, but also on other locations (limbs, neck). The lesions
included alopecia (15/16), erythema (13/16), scales (14/16), and crusts (13/16). Histopathology was
performed in 10 cases and showed folliculitis and a lichenoid interface dermatitis. Fungal culture was
positive in all cases and clinical resolution was achieved with standard antifungal agents
(enilconazole, ketoconazole, griseofulvin). Two recurrences were observed (new contacts with
rodents).
28
Alopecia, scaling, and crusting on the nose of a fox terrier. Alopecia and generalized erythema on a smooth-haired fox
terrier, Muller et al. (2011
Mycelial filaments without arthrospores in epidermal and follicular keratin. (H & E 800×), Muller
et al. (2011.
1.9.4. Trichophyton mentagrophytes (C.P. Robin) R. Blanch., Traité de
Pathologie Générale 2: 912 (1896)
≡Microsporum mentagrophytes C.P. Robin, Histoire naturelle des végétaux parasites qui croissent sur l'homme et sur les
animaux vivants: 129 (1853)
≡Sporotrichum mentagrophytes (Robin) Sacc., Sylloge Fungorum 4: 100 (1886)
≡Ectotrichophyton mentagrophytes (Robin) Castell. & Chalm., Manual Trop Med (1919)
≡Ctenomyces mentagrophytes (Robin) Langeron & Miloch., Annls Parasit. hum..: (1930)
≡Spiralia mentagrophytes (Robin) Grigoraki, Compt. Rend. Soc. Biol., Paris: 186 (1932)
≡Sabouraudites mentagrophytes (Robin) M. Ota & Kawats. (1933) [MB#450836]
≡Microides mentagrophytes (Robin) De Vroey, Annales Soc Belge de Méd Trop (1970)
=Trichophyton mentagrophytes var. mentagrophytes
29
=Oidium quinckeanum Zopf, Die Pilze in morphol, physiol , boil system Bez : 481 (1890)
=Trichophyton granulosum Sabour., Rev. Gén. Méd. Vét.: 561 (1909)
=Trichophyton asteroides Sabour., Maladies du Cuir Chevelu 3: 347 (1910)
=Trichophyton denticulatum Sabour., Maladies du Cuir Chevelu 3: 374 (1910)
=Trichophyton lacticolor Sabour., Maladies du Cuir Chevelu 3: 362 (1910)
=Trichophyton radians Sabour., Maladies du Cuir Chevelu 3: 374 (1910)
=Trichophyton depressum MacCarthy, Ann. Dermatol. Syph.: 190 (1925)
=Grubyella langeronii E.A. Baudet, Annls Parasitol. Humaine Comp.: 417 (1930)
=Trichophyton papilliosum Lebasque (1933) [MB#253799]
=Trichophyton papillosum Lebasque, Les Champignons des Teignes 72 (1933)
=Trichophyton sarkisovii L.G. Ivanova & I.D. Poljakov, Mikologiya i Fitopatologiya:1983
On Sabouraud's dextrose agar, colonies are generally flat, white to cream in colour, with a powdery to
granular surface. Some cultures show central folding or develop raised central tufts or pleomorphic
suede-like to downy areas. Reverse pigmentation is usually a yellow-brown to reddish-brown colour.
Numerous single-celled microconidia are formed, often in dense clusters. Microconidia are hyaline,
smooth-walled, and are predominantly spherical to subspherical in shape, however occasional clavate
to pyriform forms may occur. Varying numbers of spherical chlamydoconidia, spiral hyphae and
smooth, thin-walled, clavate shaped, multicelled macroconidia may also be present.
3
T. mentagrophytes ww.wikiwand.com
Mycology online
w www.e-ijd.org
Mycobank
Reports
Connole (1968) described a case of ringworm due to Trichophyton mentagrophytes in a dog
31
Chatterjee et al. (1980) reported an association of Trichophyton mentagrophytes and Demodex
canis in a mongrel dog with multiple kerions
BERGMAN et al. (2002) described multiple, dermal and subcutaneous nodules in a young female
Manchester Terrier dog that had a chronic history of superficial dermatophytosis. Skin biopsy
specimens of the nodules revealed granulomatous inflammation in the deep dermis and subcutis with
branching fungal organisms. Cultures of multiple biopsy specimens from the nodules all yielded
Trichophyton mentagrophytes. The lesions in this dog were similar to granulomatous
dermatophytosis, a skin disease that has been reported in Persian cats and one Yorkshire Terrier dog.
Kristensen and Krogh (1981) examined 774 specimens from dogs and 227 specimens from cats
were for ringworm infection. Four dogs (4.2%) were infected with Trichophyton mentagrophytes.
Three fourths of the infections with M. canis were diagnosed during August through
January. Ringworm infections can be diagnosed by direct microscopy of hair and scrapings. Wood's
lamp examination, skin biopsy, and culture. Of these, the latter method is the most reliable.
Mancianti et al. (2002) examined dermatological specimens from 10.678 animals (7.650 cats and
3.028 dogs) for dermatophytes. All the animals presented clinical signs of ringworm. Two thousandfour hundred fifty-six of the 10.678 (23%) examined animals scored positive for dermatophytes, 566
out of 3.028 canine (18.7%) and 1890 out of 7.650 feline specimens (24.7%). T. mentagrophytes
constituted 5.5% and 0.2%. T. mentagrophytes was mostly recorded from sporting (hunting) breeds
Pinter and Štritof (2004) reported on the examination of 3854 dogs with different dermatological
disorders, in the period from 1970 to 2002, in Croatia. Clinical and laboratory examinations of all
skin and hair samples yielded 66 (1.7%) isolates of Trichophyton mentagrophytes. A retrospective
study of trichophytosis due to T. mentagrophytes was performed in order to present different clinical
aspects in dogs. All 66 dogs showed clinical evidence of skin lesions, and four groups with different
symptoms were identified. The majority of dogs 42 (63.6%) with T. mentagrophytes infection had
lesions typical of dermatophyte infection. The remaining 24 dogs (36.4%) were without lesions
typical of dermatophyte appearance. The clinical picture included multifocal to diffuse appearance in
12 dogs (18.2%), severe inflammatory lesions in 10 (15.2%) or granulomatous lesions resembling
pseudomycetoma in 2 dogs (3.0%). Considering the veterinary and public health importance of canine
ringworm, attention was focused on T. mentagrophytes due to variations in clinical appearance which
might make early diagnosis very difficult, together with duration of infection and reappearance due to
persisting spores.
Canine dermatophytosis due to T. mentagrophytes and its cultural appearances. Left: classic crusting, erosive, alopecic
well demarcated lesion on the tip of the nose. Right: Irregular erythematous lesions resemble bacterial hypersensitivity and
bacterial hypersensitivity-like lesions on the dog head. Pinter and Z. Štritof:, 2004
31
Left: Pododermatitis (severe initerdigital edema). Right: Crusting, erosive, alopecic dermatitis with numerous draining
tracts from the dog with generalised T. mentagrophytes infection. Pinter and Z. Štritof:, 2004
Left: Fungal (Trichophyton mentagrophytes) nodules on the muzzle of a dog. The lesion is firm, raised and alopecic.
Right: Painful nodular lesion on the dogs digit caused by long-lasting T. mentagrophytes
infection. Pinter and Z. Štritof:, 2004
Left: T. mentagrophytes culture on Sabouraud dextrose agar makes a colony with a powdery or cottony-flat
surface.Right:The reverse side of T. mentagrophytes colonies is usually brown. Pinter and Z. Štritof:, 2004
Chermette et al. (2008) described cases of ringworm with numerous suppurative lesions due to
Trichophyton mentagrophytes in a hunting dog. Regrowth of hairs was visible on the centre of
lesions situated on the right hip and chronic and extensive dermatophytosis due to a mixed
Microsporum canis and Trichophyton mentagrophytes infection in another dog.
32
Numerous suppurative lesions due to Trichophyton mentagrophytes in a hunting dog. Regrowth of hairs is
visible on the centre of lesions situated on the right hip Facial, Chronic and extensive dermatophytosis due to a
mixed Microsporum canis and Trichophyton mentagrophytes infection in a dog (Parasitologie, Ecole Nationale
Ve´te´rinaire d’Alfort)
Yahyaraeyat et al. (2009) examined 292 dogs with ringworm in Tehran, Iran, of which 63 dogs
yielded dermatophytes (21.5%), of which 88.8% were M. canis and 7.4% were T. mentagrophytes.
Proverbio et al. (2014) conducted a study to determine the prevalence of dermatophytes in stray cats
with and without clinical lesions from different colonies in rural and urban areas of Milan and
surroundings in northern Italy. Stray cats (273) were caught during a trap-neuter-release (TNR)
program conducted in different colonies of northern Italy in both rural and urban areas. Each cat was
examined in dark environment with a Wood’s lamp prior to sample collection. Hair or scales
exhibiting typical fluorescence were removed with a pair of sterile hemostats and cultured. 15 cats
were positive (5.5%). Trichophyton mentagrophytes ftom 2 cases.
1.9.5. Trichophyton rubrum (Castell.) Sabour., British Journal of Dermatology:
389 (1911)
≡Epidermophyton rubrum Castell., Philippine Journal of Science Section B Medical Science 5 (2): 203 (1910)
≡Sabouraudites ruber (Castell.) M. Ota & Langeron, Annal Parasitol Humaine Comparée 1: 328 (1923)
≡Sabouraudiella rubra (Castell.) Boedijn, Mycopathologia et Mycologia Applicata 6 (2): 125 (1953)
=Trichophyton rosacea Sabour. (1894)
=Trichophyton rosaceum Sabour., Trichoph. Hum. F.: 92 (1894)
=Trichophyton megninii R. Blanch., Traité de Pathologie Générale 2: 915 (1895)
=Trichophyton roseum E. Bodin, Les champignons parasites de l'homme: 120 (1902)
=Epidermophyton pernettii Castell., Br. J. Derm. Syph.: 148 (1910)
=Trichophyton circonvolutum Sabour., Maladies du Cuir Chevelu 3: 320 (1910)
=Trichophyton purpureum H. Bang, Ann. Dermatol. Syph.: 238 (1910)
=Trichophyton vinosum Sabour., Maladies du Cuir Chevelu 3: 386 (1910)
=Trichophyton rubidum Priestley, Med. J. Aust.: 474 (1917)
=Trichophyton marginatum Muijs, Ned. Tijdschr. Geneesk.: 2205 (1921)
=Trichophyton pedis M. Ota, Bull. Soc. Pathol. Exot.: 594 (1922)
=Epidermophyton lanoroseum MacCarthy, Ann. Dermatol. Syph.: 53 (1925)
=Epidermophyton plurizoniforme MacCarthy, Ann. Dermatol. Syph.: 37 (1925)
=Trichophyton coccineum Y. Katô, Trans. 6th Congr. Far East Assoc. Trop. Med., Tokyo: 861 (1925)
33
=Trichophyton multicolor O. Magalh. & J.A. Neves, Memórias do Instituto Oswaldo Cruz 20 (2): 271 (1927)
=Trichophyton kagawaense H. Fujii, Jap. J. Dermatol. Urol.: 305-357 (1931)
=Trichophyton pervesi Catanei (1937)
=Trichophyton pervesii Catanei, Archives de l'Institut Pasteur d'Algerie 15: 267 (1937)
=Trichophyton rodhaini Vanbreus. (1949)
=Trichophyton rodhainii Vanbreus., Annales de Parasitologie Humaine Comparée 24: 244 (1949)
=Trichophyton gourvilii var. intermedium Biguet et al., Annls Parasitol. Humaine Comp.: 419
=Trichophyton kuryangei Vanbreus. & S.A. Rosenthal, Annal Parasitol Humaine Comparée 36: 802 (1961)
=Trichophyton rubrum var. nigricans Frágner, Ceská Mykologie 20 (1): 27 (1966)
=Trichophyton fluviomuniense Pereiro, Sabouraudia 6: 315 (1968)
=Trichophyton fischeri J. Kane, Sabouraudia 15: 239 (1977)
=Trichophyton raubitschekii J. Kane, Salkin, Weitzman & Smitka, Mycotaxon 13 (1): 260 (1982)
=Trichophyton kanei Summerb., Mycotaxon 28 (2): 511 (1987)
Colonies appear in various shades of white, yellow, brown, and red. It may also be found in various
textures, being waxy, cottony, or smooth. Two types may be distinguished: T. rubrum downy type
and T. rubrum granular type. On Sabouraud glucose agar, growth is slow to moderately rapid, texture
downy, sometimes powdery. Colour white to pale pink on the surface; reverse typically wine red,
sometimes brown, violet, yellow or even uncoloured. Intermediate strain between the types occur.
Trichophyton rubrum downy type. Cultures are generally white, suede-like to downy with characteristic deep wine-red
reverse pigment.,Life
T rubrum , Rieth
T. rubrum, Seeliger
T. rubrum on DTM
Microscopically, microconidia are numerous to rare, club – shaped to pyriform, may be found solitary
along the hyphae or sometimes in clusters, and are unicellular; and microconidia are frequently
absent; pencil – to cigar – shaped, and are multi - septate.
34
Mycobank
Reports
Kushida snd Watanabe (1975) diagnosed a case of ringworm in a 2-year-old male Dachshund
caused by Trichophyton rubrum. The owner of this dog had tinea pedis probably caused by the same
fungus. The authors believed that this is the first authenticated case of T. rubrum infection in
a dog recorded in Japan, the infection probably having been acquired from man.
Kano et al. (2010) reported an 11-year-old male Yorkshire terrier with pyoderma, alopecia, papules,
and eruptions on the face, dorsal area of the neck and the legs. Although microscopic examination of
skin scrapings from the lesions did not show hyphae or arthroconidia of dermatophytes, white, flat
and powdery colonies developed from the skin samples inoculated onto dermatophyte test medium
(DTM) after 2-week incubation at 24°C. Microscopically, the isolate did not produce macro- or
microconidia. Itraconazole was orally administered at 7 mg/kg once a day. After 3 months of
treatment, the skin lesions were cured and the fungus could not be recovered from the dog's skin. The
subcultured colony of the clinical isolate was white, flat and granular with an elevated center, and
formed a red pigment when grown on SDA at 24°C for 4 weeks Microscopic examination of portions
of the colonies revealed branched hyphae, abundant macro-conidia which were long and slender in
shape, and variably shaped microconidia. The urease test was positive after 7 days, growth on lactose
agar was restricted and the isolate did not perforate hair. Sequence analysis of genomic DNA
extracted from the isolate for detection of CHS1 (chitin synthase gene 1) and ITS1-5.8S-ITS2 was
performed. The PCR products from the samples were sequenced 3 times by the dideoxy chain
35
termination method using an ABI PRISM 310 Genetic Analyzer (Applied Biosystems, Foster City,
CA, USA). The sequences reported in this paper have been deposited in the GenBank database
[accession nos. AB517617 (CHS1) and AB517618 (ITS1-5.8S-ITS2)]. Comparative sequence
analysis within GenBank revealed that the queriedCHS1sequence was 99% identical to both T.
rubrum var. raubitschekii and T. rubrum (GenBank accession no. AB011055 and AB005793,
respectively) and <96% identical to T. mentagrophytes (GenBank accession no.AB005794), and that
the queried ITS1-5.8S-ITS2 sequence was 99% identical to both T. rubrum var. raubitschekii and T.
rubrum (GenBank accession no. AF170470 and AJ270798, respectively) and <96% identical to T.
mentagrophytes (GenBank accession no. AB246678 and AB246679). Therefore, the isolate was
identified as T. rubrum var. raubitschekii by both mycological and molecular analyses.
Left:Pyoderma with alopecia, papules, and eruptions on the face, dorsal area of the neck and the legs of the dog.
Middle:White, flat and granular colony of T. rubrum var. raubitschekii with an elevated center and red pigmentation
when cultured on SDA, Right:Abundant macroconidia are long and slender in shape by microscopic examination when
cultured on SDA, Kano et al. (2010)
Van Rooij et al. (2012) reported a 9-year-old intact male Shar-pei with unresponsive pruritic
dermatitis. The dog had a 5-year history of initial seasonal pruritic skin disease. Well-demarcated
areas of extensive hair loss, hyperpigmentation, scaling and crusting were were present around the
nose, on the legs, on the feet with hyperkeratosis of the pads, on the trunk and tail. Direct microscopic
examination of a diff-quik stained tape strip demonstrated arthroconidia and hyphae. A periodic acidSchiff (PAS) stain of a skin biopsy demonstrated fungal elements within the hair follicles and the
stratum corneum. Skin scrapings were initially inoculated on Sabouraud glucose agar enriched with
2 mg ml−1 actidione and 0.5 mg ml−1 chloramphenicol. Identification was performed on Sabouraud
and diluted Sabouraud glucose agar. The obtained culture was velvety to slightly lanose, white to
cream-coloured with a red-brown verso.Microscopic examination revealed abundant pyriform
microconidia arranged along the hyphae, and in groups.No macroconidia were observed. Growth on
Bromocresol purple medium (BCP) did not change the indicator colour and urease testing was
negative. The isolate was identified as T. rubrum and sequencing of the ITS1–5.8S–ITS2 region was
additionally performed for species confirmation
36
Clinical aspect of a Trichophyton rubrum infection in a dog after treatment with antibiotics, showing multifocal alopecia,
scaling, crusting and hyperpigmentation. Van Rooij et al. (2012)
(a) Colonies of Trichophyton rubrum strain (IHEM 22409) on Sabouraud at 25 °C. (b) Microscopical examination T.
rubrumstrain showing abundant piriform microconidia; Van Rooij et al. (2012)
1.9.6. Trichophyton erinacei (J.M.B. Sm. & Marples) Quaife, Journal of Clinical
Pathology 19: 178 (1966)
≡Trichophyton mentagrophytes var. erinacei J.M.B. Sm. & Marples, Sabouraudia 3 (1): 9 (1963) [MB#353915]
=Trichophyton proliferans M.P. English & Stockdale, Sabouraudia 6: 267 (1968) [MB#340394]
Colonies (SDA) are white, flat, powdery, sometimes downy to fluffy with a brilliant lemon yellow
reverse. Numerous large clavate microconidia are borne on the sides of hyphae. Macroconidia are
smooth-walled, two- to six-celled, clavate, variable in size, and may have terminal appendages.
Macroconidia are much shorter than those seen in T. mentagrophytes.
37
Culture of T. erinacei with brilliant lemon yellow reverse pigment.,
microconidia, mycology online
Trichophyton erinacei www.gla.ac.uk Microconidia and macroconidia www.mycology.adelaide.edu.au
Trichophyton erinacei, Mycobank
Trichophyton erinacei is rarely isolated from dogs with dermatophytosis. It is a zoophilic
dermatophyte transmitted by hedgehogs and, in contrast to other dermatophyte species, is
characterised by a severe suppurative and inflammatory response known as kerion.
Reports
Fairley (2001) reported a retrospective study of the histological features of four cases of canine
Trichophyton erinacei infection. In all four dogs the initial lesions affected the dorsal muzzle and in
two dogs the lesions spread to more distant sites on the body. Clinically, the lesions were
characterized by scaling, crusting and hair loss. Histologically, the main lesions were characterized by
acanthosis, epidermal, ostial and infundibular hyperkeratosis, serocellular crusting, mural folliculitis
and furunculosis. Fungal hyphae were usually sparse and often difficult to see in haematoxylin and
38
eosin stained sections. When visible they were seen in the epidermal, ostial and infundibular scale
and, less frequently, within hair shafts.
Severely affected nasal skin, with epidermal and infundibular acanthosis and hyperkeratinosis with condensed scale
enveloping. Nasal skin, hair follicle. A basophilic hyphae present in the hyperkeratotic scale, Fairley (2001)
Nasal skin, hair follicle, basophilic hyphae breaking up into arthrospores in the cornified scale, Fairley (2001)
Piérard-Franchimont et al. (2008) reported 3 related cases of human dermatophytosis and
1 dog dermatophytosis likely caused by contact with a European hedgehog. Trichophyton erinacei
was isolated from stratum corneum samples. This type of zoophilic dermatophytosis is rare in southeast Belgium and probably in the rest of the country as well.
Kurtdede et al. (2014) reported a 5-year-old male mongrel dog a history of a localised pruritic and
suppurative alopecic lesion on the scrotum. Routine blood tests, peripheral blood smears, multiple
skin scrapings and bacteriological culture did not reveal any abnormalities. However, Trichophyton
erinacei was isolated from the scrapings. The presence of hedgehogs around the daily walking areas
of the dog suggested the possibility of direct or indirect contact of the dog with hedgehogs. Fungicidal
treatment was implemented with oral itraconazole (5 mg/kg once daily) and topical application of
clotrimazole (twice daily) for a month. The scrotal lesion healed completely and hair grew back
within a month. No recurrence occurred during a 4 month follow-up. They stressed that T. erinacei
should be included in the differential diagnosis of suppurative scrotal skin lesions of dogs, which have
come into possible contact with hedgehogs.
Left: A well-circumscribed, painful, circular and suppurative skin lesion on the scrotum with hair loss
Right: Healing of the lesion within 19 days, Kurtdede et al. (2014)
39
1.9.7. Trichophyton terrestre
Reports
Aho et al. (1987) isolated Trichophyton terrestre from twenty of 276 cats examined
(7.2%) in seven catteries. The catteries that gave positive isolations of T. terrestre
were: a) three catteries that bred mainly Persian cats, but also had one or more
outdoor-indoor European shorthair cats, b) one cattery that bred European shorthair
cats and colorpoint Persians, c) one cattery that bred only European shorthairs, d) one
that bred only Persian cats, and e) one cattery that bred four different breeds including
European shorthairs as well as Persian cats. The isolation of T. terrestre was
significantly more often achieved from European shorthairs than from Persian cats,
and from the group of European shorthairs and Persians kept together than from an
other breeds. The hairbrush technique was found to be the most reliable method of
sampling especially when the cats were asymptomatic. None of the 276 cats examined
yielded Microsporum canis. Diluted Sabouraud dextrose agar containing
chloramphenicol and cycloheximide was the medium of choice for the isolation of T.
terrestre. Of the 21 isolates, three produced creamy white, downy colonies, while 18
developed red-pigmented, granular colonies. Microconidia were numerous. They
were 1-celled, cylindric to clavate and were borne singly. Four isolates also produced
smoothwalled, cylindric to cigar-shaped, 2–4–celled macroconidia. Spiral hyphae
were observed. In addition, three isolated produced Arthroderma-type peridial hyphae
but none developed pseudo- or fertile gymnothecia.
Guzman-Chavez et al. (2000) collected two hundred samples from dogs and one
hundred from cats by using the MacKenzie's tooth brush technique. They isolated 67
and 90 keratinophilic strains from cats and dogs samples, respectively. The most
commonly fungi isolated in pure culture in this study were Chrysosporium spp (25%),
followed by Trichophyton terrestre (22%), Microsporum gypseum (5%), M. canis
(4%), as well as mixed cultures like Chrysosporium spp. & M. gypseum (2%) and T.
terrestre & T. mentagrophytes (1%). Keratinophilic fungi were found in higher
numbers in the cat haircoat (67%) than in the dog's (45%) and the same was true with
regard to dermatophytes with 12 isolates out of a 100 samples in cats and 7 Isolates
out of 200 samples from dogs. This may represent a health risk for humans in contact
with a dermatophyte infected cat or dog.
1.9.8. Trichophyton quinckeanum
In 1879, Smith described five human favus cases, two of which may have been
contracted from sick cats. Later in 1957, Von Zezschwitz published a case of cat
favus with scutulum on its right ear. No attempt was made to culture the samples from
these human and feline cases. During the climax of T. quinckeanum endemics in
Europe, which lasted from the 1940s until the 1960s, numerous infected mice
transmitted this pathogen to humans and domestic animals, including cats. Infections
by this fungus can give rise to various clinical presentations; the most well known is
the favic type, commonly called “mouse favus” to describe such infections. Photo
documentation of cat favus caused by T. quinckeanum were presented by Szathmary
and La Touche.
41
1.9.10. Trichophyton tonsurans
Report:
Brilhante et al. (2006) reported a 2-year-old female Doberman Pinscher with
suspected dermatophytosis. The animal showed a rounded lesion of 3 cm in diameter,
patches of scalp hair loss and scaling. The lesion was not inflamed, and it was in the
distal portion of the right femoral region of the leg. Direct microscopic examinations
of the epidermal scales, using 30% KOH, were negative for mites, but showed
hyaline-septated arthroconidiate hyphae suggesting dermatophyte infection. Ectothrix
or endothrix parasitism was not observed in the hair. Cultures of the clinical
specimens, placed on blood agar, Sabouraud dextrose agar, Sabouraud with
chloramphenicol and Mycosel agar, showed a colony which suggested T. tonsurans.
1.9.11. Epidermophyton floccosum
Reports:
STENWIG and TAKSDAL (1984) reported the isolation of E. floccosum from an 8-
year-old Boxer bitch with a small skin lesion on the middle of the left flank. The 5x5
cm lesion was characterized by alopecia. There were no crusts, scaling or erythema in
the central part of the lesion. In the periphery the hairs were easily removed and the
skin was erythematous and crusty. During the previous 3 years the dog had
occasionally shown symptoms of pruritus, dry coat and scaling, but the cause of these
symptoms was not established. During the same period the dog was treated with Bvitamins and thyroxin. It received antibiotics when the skin lesions was observed.
Corticosteroids were given in the same period because the dog had lameness in a hind
leg. A skin scraping was cultivated on Sabouraud dextrose agar (SDA) containing
yeast extract (5 g 1 -~) and 5 /~g chloramphenicol ml -~, on Mycobiotic agar (MBA)
(Difco) containing 5/tg chloramphenicol ml-~ and on blood agar. The SDA and MBA
plates were incubated at 30°C for 3 weeks and examined weekly. The blood agar plate
was incubated aerobically at 37°C overnight. Direct microscopic examination of
samples in 3.6 M KOH revealed septate fungal hyphae. The hyphae were found in
close connection with epithelial cells, but were not found within or in close
connection with the hairs. The diameter of the hyphae was 1.5-2.0/~m. No chains of
arthrospores were observed.
Terreni et al. (1985) isolated Epidermophyton floccosum from a lesion of
dermatophytosis on a dog with hyperadrenocorticism. This report is the first
unequivocally documented case of canine infection due to Epidermophyton
floccosum in the United States.
1.10. Zoonotic hazard
Ringworm is probably the most common zoonosis of cats and dogs and can be spread by
direct contact or by spores in the environment. Microsporum canis is the most common cause
41
of ringworm in cats and dogs and it has been frequently isolated from human cases of
tinea capitis and tinea corporis. The infection may be acquired from infected animals
with cutaneous lesions but also from asymptomatic carriers or from the environment,
as asymptomatic M. canis carriers are considered to be a critical factor in the
epidemiology of dermatophytosis in human. All other dermatophytes isolated from
cats and dogs as M. gypseum, T. mentagrophytrs etc are also of zoonotic importance.
Reports:
Winkler (1970) reported 195 cases of ringworm due to M. canis infection (10 men,
46 women, 70 boys, 69 girls) in SW-Finland during a period of 13 years (1955–1968).
These figures probably represent only part of the total number of cases. The yearly
distribution and seasonal incidence show great variations. The youngest patient was a
5-months-old baby, the oldest a grandfather, 76 of age. The majority of the lesions
were on the glabrous skin. In adults the lesions were most often found on the arms, in
children on the scalp (in 50%) and face. Some of them tended to kerion formation.
Lesions on the scalp were rarely seen in adults (5 cases). Most of the patients acquired
the infection from cats or kittens. There was only one dog in this material. Five cases of
occupational infection — 3 nurses and 2 laboratory technicians — occurred. Reinfection was
seen only once, in a 13-year old boy, infected 1964 and 1967. M. canis was, as the only
species, cultivated from all examined patients and from 36 cats or kittens and from one dog.
Fifteen of twenty-one stray-cats caught in the autumn 1967 in Turku were infected with M.
canis. This fungus was cultivated from dust and soil inside and outside a cellar haunted by
cats.
Katoh et al. (1991) reported a 19-year-old female student who purchased a puppy
from a pet shop four weeks earlier. At the time of her first examination, an annular
edematous erythema with adherent scales and vesicles surrounding its margin was
seen on the left forearm. On direct examination of the vesicles, fungal elements were
detected, and Microsporum canis was isolated. The puppy was a Pomeranian and was
kept in the house at all times. No clinical lesions were seen on the puppy, and the
Wood's lamp test was negative. However, M. canis was isolated from the animal by
the hairbrush method. Symptoms disappeared after the patient was treated topically
with terbinafine cream for three weeks. Although the dog received no treatment
whatsoever, there was no evidence of the disease on the pet. Results of the hairbrush
method performed on the pet two and three weeks later were negative, but, at five
weeks, it was again positive. Human infection with M. canis from an
asymptomatic dog was demonstrated in this case.
Drusin et al. (2000) reported an outbreak of nosocomial ringworm involved five
infants in a neonatal intensive care unit. The index case was a nurse infected with
Microsporum canis by her cat. After standard infection control measures were
initiated, the outbreak was resolved successfully by an interdisciplinary professional
collaboration of physician and veterinary dermatologists and infection control
personnel.
Cafarchia et al. (2006) investigated the relationship between the presence of
dermatophytes on the hair coats of dogs and cats without cutaneous lesions and the
occurrence of the disease in their respective owners. A total of 136 dogs and 248 cats
were sampled from January 1999 to January 2005. Seventy-eight animals
(22 dogs and 56 cats) belonged to individuals affected by tinea corporis caused by M.
canis and 306 (114 dogs and 192 cats) to individuals without dermatophytosis. Age,
42
sex, breed, habitat and season were recorded for each animal and examined as
potential risk factors. Dermatophytes were isolated from 20.5% of the dogs and
28.2% of the cats. Microsporum canis was isolated from 36.4% of dogs cohabiting
with owners diagnosed with tinea corporis but it was never isolated fromdogs whose
owners had no lesions. By contrast, M. canis was isolated from 53.6% of cats
cohabiting with owners diagnosed with tinea corporis and from 14.6% of cats whose
owners had no signs of the disease. These results clearly indicate that both cats
and dogs should be considered as a major source of pathogenic dermatophytes for
humans even when they do not present clinical signs of dermatophytosis.
Iorio et al. (2007) collected 200 hair/skin samples from 2002 to 2004 from two
groups of cats (privately owned and stray cats from a shelter) and 165 samples were
obtained during the same period from persons in whom dermatophyte infection was
highly suspected. The epidemiological data were statistically evaluated. Thirteen of
the 100 privately owned cats (13%) and 100% of the stray cats were positive; of the
165
human
samples
examined
109
(66%)
were
positive
for
dermatophytes. Microsporum canis was the most common dermatophyte isolated in
both cat groups while Trichophyton mentagrophytes was the most common in
humans. Interestingly, a geophylic dermatophyte species (Microsporum gypseum) was
found to be present and associated with clinical signs. Living in the countryside
proved to be a risk factor for dermatophytoses in privately owned cats while in
humans the main risk factor for M. canis was contact with animals followed by young
age.
Chermette et al. (2008) reported 2 cases of ringworm in cats and dogs with
transmission of infection to their owners. In the first case, the cat had lesions on the
nose and front and contamination of the owner on her forearm and in the second
cases the dog had a typical isolated patchy lesion of dermatophytosis on the back of a
dog, and contamination of the owner on her leg. Microsporum canis was isolated
from both animals and their owners a
Ringworm in a cat due to Microsporum canis (lesions on the nose and front) with contamination of the
owner on her forearm), Typical isolated patchy lesion of M. canis dermatophytosis on the back of a
dog, and contamination of the owner (Chermette et al. (2008) Parasitologie, Ecole Nationale
Ve´te´rinaire d’Alfort)
Romano et al. (2009) reported 14 cases of dermatophytosis caused by Microsporum
gypseum, representing 6.8% of all dermatophytic infections reported, in Siena, Italy,
between 2005 and 2006. There were as follows: six cases of tinea corporis, one case
of tinea corporis associated with tinea capitis, one case of tinea corporis associated
with tinea barbae, one kerion on the head, one tinea cruris, one tinea faciei,
one tinea barbae, two onychomycosis. In the three subjects with tinea corporis, the
43
clinical appearance was impetigo-like, psoriasis-like and pityriasis rosea-like
respectively. In six cases, the source of infection was a cat, whereas in the others it
was contact with soil.
Clinical pictures of infections and Microsporum gypseum. (a) Macroscopic appearance of the
colony; (b) microscopic view of M. gypseum: ellipsoidal macroconidia with four to six septa
(Cotton Blue 400×); (c) impetigo-like tinea corporis; (d) onychomycosis; (e) tinea-imbricatalike tinea corporis; (f) kerion, Romano et al. (2009)
Hermoso de Mendoza et al. (2010) described an outbreak of
zoonotic ringworm carried by a litter of stray cats. Four veterinary students, four dogs,
and six cats living in five separate locations were affected. All had direct or indirect
contact with the infected kitten litter. They tried to identify the causal dermatophyte.
Microscopic features of scrapings and hairs treated with 20% KOH strongly
suggested a M. canis etiology, and a diagnosis of ringworm was empirically
supported by successful treatment of humans and animals. Nevertheless, cultures
failed to show the expected morphology.
Kitten facial lesions and dirty poor fur. Infected litter kitten, Hermoso de Mendoza et al. (2010)
44
Annular lesion on dog chest
Annular lesion on human leg, Hermoso de Mendoza et al. (2010)
Kaneko et al. (2011) presented a 52-year-old female patient with multiple annular
erythemas on the trunk and extremities. The patient had a cat with hair loss suggestive
of a fungal infection. Culture of the patient’s scrapings and the hair of the patient’s
cat yielded rapid growth of cottony, pale-yellow, colonies on an agar plate.
Microscopy revealed a lot of spindle-shaped macroconidia identified as M. canis.
Lower limb of the patient with multiple annular erythema, M. canis colony,Macroconidia, Kaneko et
al. (2011)
López et al. (2012) examined 45 samples from cats with and without dermatological
lesions. These samples were collected through skin scraping, hair removal and
Mackenzie brush, respectively. The frequency of dermatophytes isolated in this
preliminary study was 13.3%. There were not statistically significant differences by
source, age, sex, race or dermatological condition. Zoonotic dermatophytes were
found in 2 household cats out of the 21 that had direct contact with children or the
elderly. M. canis was isolated in 83.3% cases.
Frymus et al. (2013) stated that, an infected cat represents a notable zoonotic
hazard. Although individual M. canis-infected cats are certainly capable of
disseminating the infection to human beings in the same household, the cat population
in general is often incriminated as a reservoir of human infection.
Segundo et al. (2004) studied cases ringworm in man animals from January 1994 to
December 2002. A total of 46 clinical cases of M. canis infections were recorded, 26
female and 20 males: tinea capitis 21, tinea corporis 17, tinea pedis five,
onychomycosis two, and only one case with tinea faciei. The 46 cases with positive
culture yield 42 positive samples in KOH. Six out of 461 dogs were KOH positive
(1%) and 23 (4.98%) were culture positive: 21 M. canis, one M. gypseum and one
45
Trichophyton spp. From the 68 samples of cats, eight (11.76%) were positive to KOH
and 26 (38.23%) were positive for M. canis isolates.
1.11. Diagnosis:
1.11.1. Wood’s lamp examination
An inexpensive and simple screening tool for M canis infection.
it is not very sensitive: only about 50% of M canis strains fluoresce and other
dermatophytes do not fluoresce at all.
debris, scale, lint and topical medications (eg, tetracycline) can produce falsepositive results.
Wood’s lamp findings should be confirmed by other methods.
Wood’s lamps. (a) Small compact model (b) model with built-in magnification, Dr Alana Canupp
Ear of a cat with dermatophytosis. Note the limited lesion extent observed in room light (a) versus how,
under Wood’s lamp examination (b), the extent of the lesions is highlighted. Dr Alana Canupp
1.11.2. Direct microscopic examination
It is recommended to pluck hairs for this purpose under Wood’s lamp
illumination, or from the edge of a lesion.
The sample should be cleared with 10–20% potassium hydroxide solution
before examination.
46
direct microscopic examination may give false-positive results, especially if
saprophytic fungal spores are present or debris is interpreted as fungal
elements
sensitivity of this technique is relatively poor and has been assessed as 59%.
higher sensitivity (76%) has been achieved by fluorescence microscopy with
calcafluor white – a special fluorescent stain that binds strongly to structures
containing cellulose and chitin.
1.11.3. Culture on Sabouraud dextrose agar
Part of the samples is embedded into Sabouraud dextrose agar with chloramphenicol
and actidione then incubated at 30oC for 1-4 weeks. Identification characters include
colony texture, pigmentation, growth rate and distinctive morphological structures
such as macroconidia, microconidia, spirals, chlamydospores, etc.
Colonies od dermatopytes on Sabouraud dextrose agar
47
Microscopic features of dermatophytes
1.11.4.
Molecular diagnosis: (Ziółkowska et al., 2015)
a. Polymerase chain reaction (ITS-PCR)
Amplification is carried out on one of the conserved regions of the genome
containing a fragment of the rDNA gene (including parts of 18S and 28S
rDNA, as well as the whole of ITS1, 5,8S rDNA and ITS2).
PCR is conducted using the universal primers
ITS 1: 5′-TCCGTAGGTGAACCTGCGG-3′
ITS4: 5′-TCCTCCGCTTATTGATATGC-3′.
ITS-PCR is carried out in a T Personal thermal cycler (Biometra GmbH,
Goettingen, Germany), with 25 μl of reaction mixture composed of 12.5 μl
Qiagen Taq PCR Master Mix (2.5 U Taq DNA Polymerase, 200 μmol of each
nucleotide and 1.5 mmol l−1 MgCl2) (Qiagen, Hilden, Germany), 10 pmol of
each primer (Genomed S.A, Warsaw, Poland) and 1 μl of DNA template.
The thermal cycler reaction conditions :
initial cycle at 95 °C for 3 min, followed by 30 cycles at 95 °C for 1 min,
50 °C for 1 min and 72 °C for 1 min and then an extension cycle of 72 °C for
10 min.
Electrophoretic separation of PCR products is carried out in 2% agarose in
1xTBE buffer (Tris Borate EDTA buffer) (Sigma-Aldrich, Seelze, Germany).
The gels are documented and analysed in GelDoc 2000 (BIO-RAD, Hercules,
California, USA).
b. Restriction fragment length polymorphism of the ITS region (ITS-RFLP)
Restriction analysis of the PCR product is carried out using four
enzymes, MvaI, HinfI, HhaI and EcoRI (ThermoScientific®, Waltham, USA)
at 37 °C for 60 min in 20 μl of a reaction mixture containing 8 μl PCR
product, 6U endonuclease, 2 μl reaction buffer and 10 μl water (SigmaAldrich).
The digestion products are subjected to electrophoresis in 6% polyacrylamide
gel.
The size of the ITS-RFLP restriction fragments is analysed using BIO-GENE
11.01 software (Vilber-Lourmat, Paris, France).
The ITS size profiles obtained for each of the clinical isolates following
digestion with endonucleases areconverted to a binary matrix.
The similarity between the ITS patterns is calculated using Nei and Li's
algorithm, and strains were grouped by UPGMA on the basis of the DNA
patterns obtained.
48
Computer programs are used in these stages of the analysis: FENAL 1.0 beta
and NTSYS-pc 2.02 g.
i. Determination of ITS sequences
The ITS sequencing reaction is carried out using a BigDye® Terminator Cycle
Sequencing Kit (Life Technologies, Carlsbad, California, USA) and the
primers ITS1 and ITS4.
The PCR mixture (10 μl) contains the following:
2 μl 2.5× concentrated Ready Reaction Premix, 1 μl 5× concentrated BigDye
Sequencing Buffer, 0.25 μl primer at a concentration of 5 pmol (initially
100 pmol), DNA amplicon at a concentration of 50 ng and sterile distilled
water at a final volume of 10 μl.
Two separate reactions are carried out for primers ITS1 and ITS4.
PCR is performed in a T Personal cycler (Biometra GmbH) with the following
conditions:
initial denaturation for 1 min at 96 °C, denaturation for 10 s at 96 °C,
annealing of primers for 5 s at 50 °C and elongation for 4 min 60 °C. The final
three stages, i.e. denaturation, annealing of primers and elongation, are
repeated 25 times.
The PCR product is purified using an ExTerminator kit (A&A Biotechnology,
Gdynia, Poland), and then the DNA sequence was read in a 3500 Genetic
Analyser from Life Technologies, Carlsbad, California, USA.
ii. Phylogenetic analysis of ITS sequences
Taxonomic identification based on ITS sequences is performed using
Nucleotide Archive, available in the databases.
The phylogenetic analysis is based on the ITS sequences of the clinical
isolates and dermatophytes representing known genera and species, taken from
databases.
he ITS nucleotide sequences included in the analysis are compared in pairs
and the degree of similarity is determined using ClustalX software.
A phylogenetic tree is constructed using the maximum likelihood (ML)
method.
Reports:
Brilhante et al. (2006) reported a 2-year-old female Doberman Pinscher with
suspected dermatophytosis. The animal showed a rounded lesion of 3 cm in diameter,
patches of scalp hair loss and scaling. The lesion was not inflamed, and it was in the
distal portion of the right femoral region of the leg. Direct microscopic examinations
of the epidermal scales, using 30% KOH, were negative for mites, but showed
hyaline-septated arthroconidiate hyphae suggesting dermatophyte infection. Ectothrix
or endothrix parasitism was not observed in the hair. Cultures of the clinical
specimens, placed on blood agar, Sabouraud dextrose agar, Sabouraud with
chloramphenicol and Mycosel agar, showed a colony which suggested T. tonsurans.
The PCR assay detected an amplicon of approximately 720 bp. The Sau3A-digested
product consisted of four fragments of 45, 60, 280 and 335 bp. DdeI, RsaI and EcoRI
cut the amplicon regions into two fragments with the following lengths: 120 and 600
49
bp for RsaI; 280 and 440 bp for DdeI; 380 and 330 bp for EcoRI. The results obtained
from the animal strain and from the human strain were similar to the expected
digestion pattern of the ITS sequences for T. tonsurans strains registered in GenBank.
The results obtained from the PCR assay with T. mentagrophytes and with T.
tonsurans strains were similar.
PCR-enzyme restriction patterns in PAGE (6% gel) of a human control strain of T. tonsurans (lanes 4, 6 and 9)
and the T. tonsurans strain obtained from a dog (lanes 3, 5 and 8). A 100 bp ladder was used to estimate the
product sizes (lanes 1 and 7). Lane 2 is a negative (no template) control
Kano et al. (2001) reported a 1- to 2-month-old female cross-breed cat presented
with alopecia, erythema and many crusts on the tail. Microscopic examination of
crusts from the tail disclosed epithelial debris, exudate, mycelium, and
arthrospores. Microsporum gypseum was cultured from the crusts on a Sabouraud
glucose agar at 27°C for 1 week. The isolate of M. gypseum from the cat was
examined by random amplification of polymorphic DNA (RAPD), chitin synthase
1 gene (CHS1) sequence and mating experiments. The RAPD band patterns of the
clinical isolate of M. gypseum was identical to those of tester strains of Arthroderma
gypseum. Nucleotide sequence analysis of the CHS1 gene fragments from the isolate
and a tester strain of A. gypseum showed 100% similarity. The mating experiments on
the clinical isolate of M. gypseum completely agreed with the results from RAPD and
CHS1 gene sequence. The isolate from the cat was confirmed to be A. gypseum (–)
mating type, which was consistent with the result of mycological examination by
molecular analyses
51
RAPD patterns of the tester strains of A. fulvum (VUT-4006 and VUT-4007) A. gypseum (VUT-4004
and VUT-4005), A. incurvatum (VUT-4002 and VUT-4003), and a clinical isolate of M.
gypseum (VUT-99011). Lanes: 1, VUT-4006; 2, VUT-4007; 3, VUT-4004; 4,VUT-4005; 5, VUT96011; 6, VUT-4002; 7, VUT-4003. The genomic DNA samples were amplified with a 21-mer primer
(FM1).
Sharma et al. (2007) developed two microsatellite markers were and used them to
analyse a global set of 101 M. canis strains to reveal patterns of genetic variation and
dispersal. Using a Bayesian and a distance approach for structuring the M. canis
samples, three populations could be distinguished, with evidence of recombination in
one of them (III). This population contained 44 % of the animal isolates and only 9 %
of the human strains. Population I, with strictly clonal reproduction (comprising a
single multilocus genotype), contained 74 % of the global collection of strains from
humans, but only 23 % of the animal strains. From these findings, it was concluded
that population differentiation in M. canis is not allopatric, but rather is due to the
emergence of a (virulent) genotype that has a high potential to infect the human host.
Adaptation of genotypes resulting in a particular clinical manifestation was not
evident. Furthermore, isolates from horses did not show a monophyletic clustering.
Kaneko et al. (2011) verified that the ITS1 sequences of the fungal species isolated
from a patient and his cat were completely identical and coincided with A. otae-4.
They emphasized that, the molecular analysis provided useful information that not
only M. canis was the same pathogen, but also the same fungal strain involved in both
infections. In their study, they used the oligonucleotide primers for ITS1-specific PCR
previously designed by Makimura (Makimura K et al. J Clin Microbiol 1998; 36:
2629–33) were as follows: for 18 SF1, 5′-AGGTTTCCGTAGGTGAACCT-3′; and
for 58 SR1, 5′-TTCGCTGCGTTCTTCATCGA-3′. PCR was performed under the
following conditions: 25 cycles at 94 °C for 1 min, 60 °C for 15 s, and 72 °C for 15 s.
Thermal cycling was terminated by polymerisation at 72 °C for 10 min. The products
were then stained and visualised by UV irradiation. Both strands of the PCR products
were directly sequenced with primers – 18 SF1 and 58 SR1. The ITS1 sequences
of M. canis isolated from the patient and cat were aligned by using the CLUSTAL
W computer program and the GENETYX-MAC 10 software, respectively. We verified
that the ITS1 sequences of these species were completely identical and coincided
with A. otae ITS1 genotype 4. Alignments indicated that the internal transcribed
51
spacer 1 sequences of Microsporum canis isolated from the patient and cat were
completely identical and coincide with Arthroderma otae-4.
Alignments indicating that the internal transcribed spacer 1 sequences of Microsporum canis isolated
from the patient and cat are completely identical and coincide with Arthroderma otae-4. Kaneko et al.
(2011)
Cafarchia et al. (2013) established and evaluated a PCR-based approach employing
genetic markers of nuclear DNA for the specific detection of dermatophytes on such
specimens. Using 183 hair samples, they directly compared the test results of one-step
and nested-PCR assays with those based on conventional microscopy and in vitro
culture techniques (using the latter as the reference method). The one step-PCR was
highly accurate (AUC > 90) for the testing of samples from dogs, but only moderately
accurate (AUC = 78.6) for cats. A nested-PCR was accurate (AUC = 93.6) for
samples from cats, and achieved higher specificity (94.1 and 94.4%) and sensitivity
(100 and 94.9%) for samples from dogs and cats, respectively. In addition, the nestedPCR allowed the differentiation of Microsporum canis from Trichophyton
interdigitale and Microsporum gypseum or Trichophyton terrestre, which was not
possible using the one step-assay. The PCRs evaluated here provide practical tools for
diagnostic applications to support clinicians in initiating prompt and targeted
chemotherapy of dermatophytoses and culture techniques.
52
Results of PCR amplification of ITS + from genomic DNA samples carried out using primers
DMTF18SF1 and DMTF28SR1.Microsporum canis, M. fulvum, M. gypseum, Trichophyton
interdigitale (zoophilic), T.
terrestre (lanes
1–5),
species
ofAlternaria,
Aspergillus,
Cladosporium (lanes 6–8), Chrysosporium(lane 9), Malassezia, Mucor, Penicillium, Rhizopus,
Scopularopsis(lanes 10–14) and no-DNA control (lane 15). Amplicons were sized by comparison with
a 100 bp ladder (Gene Ruler, MBI Fermentas) Cafarchia et al. (2013)
Selected results of the nested-PCR testing of genomic DNAs from hair samples of dogs or cats (lanes
1–10), as well as from M. canis, M. gypseum, T. interdigitale (zoophilic) and T. terrestreand no-DNA
control samples (lanes 11–15, respectively). Amplicons were sized by comparison with a 100 bp ladder
(Gene Ruler, MBI Fermentas). Cafarchia et al. (2013)
da Costa et al. (2013) investigated the genetic variability of M. canis isolates from
different animal species using two microsatellite markers, namely, McGT(13) and
McGT(17). The study included a global set of 102 M. canis strains, including 37
symptomatic cats, 35 asymptomatic cats, 19 human patients with tinea, 9
asymptomatic dogs and 2 symptomatic dogs. A total of 14 genotypes were identified,
and 6 large populations were distinguished. There was no correlation between these
multilocus genotypes and the clinical and epidemiological data, including the source,
symptomatology, clinical picture, breed, age, sex, living conditions and geographic
location. These results demonstrated that the use of microsatellite polymorphisms is a
reliable method for the differentiation of M. canis strains
Dąbrowska et al. (2014) applied a method of extraction of fungal DNA (BrillowskaDabrowska and coworkers (2007) and PCR amplification with pan-dermatophyte
primers for (5’GAAGAAGATTGTCGTTTGCATCGTCTC3’) and panDerm_rev
(5’CTCGAGGTCAAAAGCACGCCAGAG3’) to confirm the presence of
dermatophytes.The time-temperature profile for PCR was; initial denaturation for 3
min at 95°C followed by 45 s at 94°C, 45 s at 54°C or 56°C or 58°C and finally 45 s
at 72°C for a total of 35 cycles. The presence of a specific PCR product of
approximately 366 bp was determined by electrophoresis on a 2% agarose gel
containing ethidium bromide. PCR assay confirmed correct identification of strains as
dermatophytes, i.e. seven representatives of the Trichophyton mentagophytes complex
strains and eight Microsporum canis.
53
Electrophoretic patterns of PCR products with pan-dermatophyte primers and 2xPCR Master Mix Plus High GC (A&A
Biotechnology) at: (A) 54°C, (B) 56°C and (C) 58°C annealing temperature. Lanes 1 and 8: negative control with
water, lines 2 and 3: Microsporum canis, lines 4–7: Trichophyton mentagrophytes, line M: 100–1000 bp Ladder (A&A
Biotechnology, Dąbrowska et al. (2014)
Electrophoretic patterns of PCR with pandermatophyte primers and at 58°C annealing temperature and homemade
PCR mix. Lanes 1 and 8: Trichophyton mentagrophytes, lines 2–7: Microsporum canis, line 9 negative control with
water, line M: 100–1000 bp Ladder (A&A Biotechnology). Dąbrowska et al. (2014)
Ziółkowska et al. (2015) conducted a study on 24 isolates recovered from humans
and various animal species with clinical symptoms of dermatophytosis. The analysis
included phenotypical identification methods and molecular methods: internal
transcribed spacer sequencing and ITS-restriction fragment length polymorphism
(RFLP) with multi-enzyme restriction. ITS sequence analysis identified the isolates to
species - Trichophyton interdigitale, Arthroderma benhamiae and A.
54
vanbreuseghemii, and ITS-RFLP detected six different genotypes. Genotypes I, II and
III characterised strains belonging to A. benhamiae, genotype IV characterised the A.
vanbreuseghemii strain, and genotypes V and VI occurred only within the species T.
interdigitale. Strains isolated from guinea pigs were dominant within genotype I,
while genotype II was found mainly in strains from foxes. Multi-enzyme restriction
analysis of this region enables intraspecific differentiation, which may be useful in
epidemiological research, particularly in determining the source of infections.
1.12. Treatment of ringworm in cats and dogs
In immunocompetent cats, isolated lesions disappear spontaneously after 1–3
months and may not require medication. However, treatment of such cases
will reduce the disease course as well as the risk for other animals and
humans, and contamination of the environment.
Topical treatment is generally less effective in cats compared with humans due
to poor penetration of the medicines through the hair coat, lack of tolerance of
this treatment by many cats and the possible existence of unnoticed small
lesions.
therapeutic measures should include a combination of systemic and topical
treatment, maintained for at least 10 weeks. Generally,
cats should be treated not only until the lesions completely disappear, but until
the dermatophyte can no longer be cultured from the hairs on at least two
sequential brushings 1–3 weeks apart.
1.12.1. Topical therapy
In cats with a limited number of lesions, hairs should be clipped away from
the periphery of lesions incorporating a wide margin. Clipping should be
gentle to avoid spreading the infection due to microtrauma.
Spot treatment of lesions may be of limited efficacy; instead, whole body
shampooing, dipping or rinsing is recommended.
In patients with generalised disease, longhaired cats and for cattery
decontamination, clipping the entire cat is useful to make topical therapy
application easier and to allow for better penetration of the drug.
Topical whole body treatment with a 0.2% enilconazole solution performed
twice weekly. or 2% miconazole with or without 2% chlorhexidine as a twice
weekly body rinse or shampoo.
1.12.2. Systemic therapy
Itraconazole
itraconazole is currently the preferred drug in feline dermatophytosis and is
licensed for this indication
A pulse administration of 5 mg/kg/day for 1 week, every 2 weeks for 6 weeks
has been suggested.
55
three cycles of treatment consisting of 1 week with treatment (5 mg/kg) and 1
week without. Such a treatment schedule (3 x 7 days of dosing) provides
actual coverage of at least 7 weeks.
Terbinafine
An alternative is terbinafine administered orally 30–40 mg/kg once daily.
It seems also suitable for pulse therapy.
Occasional vomiting and intensive facial pruritus has been observed as side
effects.
Ketoconazole
Ketoconazole has been used orally at 2.5–5 mg/kg twice daily.
cats are relatively susceptible to side effects with this drug, which include liver
toxicity, anorexia, vomiting, diarrhoea and suppression of steroid hormone
synthesis.
Ketoconazole is also contraindicated in pregnant animals.
Griseofulvin
It is administered orally for at least 4–6 weeks at 25–50 mg/kg q12–24h.
Griseofulvin is poorly soluble in water and micronised formulation as well as
administration with fatty meals enhance absorption.
Adverse reactions include anorexia, vomiting, diarrhoea and bone marrow
suppression, particularly in Siamese,
The use of griseofulvin is contraindicated in kittens younger than 6 weeks of
age and in pregnant animals as the compound is teratogenic, particularly
during the first weeks of gestation.
Reports:
Angarano and Scott (1987) used Ketoconazole, an antifungal imidazole derivative ,
to treat Tricophyton mentagrophytes infection in a dog. The drug was administered
orally (11 mg/kg of body weight, q 24 h) and continued for 90 days. Though
ketoconazole is not licensed currently for veterinary purposes, it has been used
successfully to treat dermatophyte infections as well as intermediate and deep fungal
diseases in both dogs and cats. In this case, ketoconazole was found to be nontoxic
and less expensive than griseofulvin in the treatment of dermatophytosis.
Carlotti et al. (2010) treated enzootic dermatophytosis in a shelter with
approximately 140 cats according to a protocol combining identification, isolation and
treatment of subclinical carrier and affected animals in accordance with a three-area
system: healthy animals (no lesions and negative cultures), subclinical carrier animals
(no lesions but with positive cultures) and clinically affected animals (lesions and
positive cultures). The cats were examined and inspected under a Wood's lamp and
had samples taken for fungal culture every 2 weeks. Thirty-three per cent of the cats
had a positive fungal culture at the start of the study. Clinically affected animals and
carriers were treated with a 0.2% enilconazole lotion (Imaverol) twice a week and
given itraconazole (Itrafungol) 5 mg/kg SID orally every other week. The
environment was treated once a day with a 1% bleach solution and once a week with a
0.6% enilconazole (Clinafarm) solution. Treated animals were considered cured after
56
two consecutive negative fungal cultures. All cats were cured within 56 days.
Prophylactic measures against dermatophytosis were implemented for new arrivals
consisting of individual quarantine and the systematic taking of fungal cultures. No
relapses were observed based on the fungal cultures taken from the animals and the
environment over the first 10 months.
Nardoni et al. (2013) evaluated the occurrence of infection by Microsporum gypseum
retrospectively in dermatological specimens from 15,684 dogs and cats
dermatologically diseased from Italy. Clinical outcome after treatment with
griseofulvin combined with topical enilconazole was evaluated in 41 dogs and, out of
label, 10 cats. Furthermore, in vitro susceptibility to griseofulvin and enilconazole
was evaluated on 31 clinical isolates of Microsporum gypseum. One hundred and
eighty-five specimens out of 15,684 (1.1%) scored positive for Microsporum gypseum.
The treatment failed to achieve both mycological and clinical cure in 16 dogs (39%)
and four cats (40%), as well as fungal isolates demonstrated a very poor in vitro
sensitivity when tested versus griseofulvin: the MIC value was 150 μg/mL. The ED50
value was calculated at 66 μg/mL. They concluded that blind treatments with
griseofulvin in ringworm due to Microsporum gypseum should be avoided.
et al. (2014) presented three clinical cases of canine dermatophytosis
resolved with topical propolis treatment that involved alopecia and well-demarcated
erythematous lesions. These cases were positively identified by direct observation of
samples from the affected zones with 10% KOH. Each sample was cultured, leading
to the isolation of Microsporum gypseum in one case and Microsporum canis in the
other two cases. The animals’ subsequent treatment included bathing using a
commercial soap with propolis every seven days for 3 to 8 weeks, as well as the use
of a self-prepared propoliscontaining ointment, which was applied to the lesions once
a day for three weeks. From the second week of treatment, all cultures were negative.
At the end of treatment, all cases displayed full recovery of the injuries and hair
growth in these areas. In these clinical cases, treatment with propolis was effective,
supporting the use of propolis as a promising natural alternative with no known
collateral effects.
Sánchez
Sánchez et al. (2014)
57
Sánchez et al. (2014)
Newbury et al. (2015) identified an endemic Microsporum canis dermatophytosis in
a large, open admission, private, no-kill shelter that admitted >1200 cats per year.
Fungal culture (FC) screening revealed that 166/210 (79%) and 38/99 (38%) cats in
the non-public and public area were culture positive, respectively. However, pending
screening FC results, the 99 cats in the public area were treated with once-weekly
lime sulfur rinses and monitored with once-weekly FC. Cats in the non-public area
were not treated. When FC results were available, cats were separated into low-risk (n
= 61) and high-risk (n = 38) groups based upon the presence or absence of skin
lesions. Low-risk cats continued to receive once-weekly topical lime sulfur and
rapidly achieved culture-negative status. High-risk cats were divided into two groups
based upon the number of colony-forming units/plate (low or high). All 38 cats were
treated with twice-weekly lime sulfur and oral terbinafine and within 6-7 weeks only
5/38 cats were still FC-positive. These cats were moved to a separate room.
Dermatophytosis was eradicated within 5 months; eradication was prolonged owing to
reintroduction of disease into the remaining room of cats under treatment from three
kittens returning from foster care. Continued admissions and adoptions were possible
by the institution of intake procedures that specifically included careful Wood's lamp
examination to identify high-risk cats and use of a 'clean break strategy'.
Moriello (2016) evaluated the antifungal efficacy of shampoo formulations of
ketoconazole, miconazole or climbazole and accelerated hydrogen peroxide
wash/rinse against Microsporum canis and Trichophyton species spores. Lime sulfur
(1:16)-treated control, enilconazole (1:100)-treated control, accelerated hydrogen
peroxide (AHP 7%) 1:20 and a 1:10 dilution of shampoo formulations of miconazole
2%, miconazole 2%/chlorhexidine gluconate 2-2.3%, ketoconazole 1%/chlorhexidine
58
2%, climbazole 0.5%/chlorhexidine 3% and sterile water-untreated control were
tested in three experiments. In the first, a suspension of infective spores and hair/scale
fragments was incubated with a 1:10, 1:5 and 1:1 dilution of spores to test solutions
for 10 mins. In the second, toothbrushes containing infected cat hair in the bristles
were soaked and agitated in test solutions for 10 mins, rinsed, dried and then fungal
cultured (n = 12×). In the third, a 3 min contact time combined with an AHP rinse was
tested (n = 10×). Good efficacy was defined as no growth. Water controls grew >300
colony-forming units/plate and all toothbrushes were culture-positive prior to testing.
For the suspension tests, all test products showed good efficacy. Miconazole 2%,
ketoconazole 1% and AHP showed good efficacy after a 10 min contact time. Good
efficacy was achieved with a shorter contact time (3 mins) only if combined by an
AHP rinse. He concluded that lime sulfur and enilconazole continued to show good
efficacy. In countries or situations where these products cannot be used, shampoos
containing ketoconazole, miconazole or climbazole are alternative hair coat
disinfectants with a 10 min contact time or for 3 min, if combined with an AHP rinse.
Nardoni et al. (2015) formulated a herbal mixture composed of chemically defined
essential oils (EOs) of Litsea cubeba (1%), Illicium verum, Foeniculum vulgare, and
Pelargonium graveolens (0.5% each) was formulated and its antifungal activity
assessed against M. canis arthrospores which represent the infective environmental
stage of M. canis. Single compounds present in higher amounts in the mixture were
also separately tested in vitro. Litsea cubeba and P. graveolens EOs were most
effective (minimum inhibitory concentration (MIC) 0.5%), followed by EOs of I.
verum (MIC 2%) and F. vulgare (MIC 2.5%). Minimum fungicidal concentrations
(MFC) values were 0.75% (L. cubeba), 1.5% (P. graveolens), 2.5% (I. verum) and 3%
(F. vulgare). MIC and MFC values of the mixture were 0.25% and 0.5%, respectively.
The daily spray of the mixture (200 μL) directly onto infected hairs inhibited fungal
growth from the fourth day onwards. The compounds present in higher amounts
exhibited variable antimycotic activity, with MIC values ranging from >10%
(limonene) to 0.1% (geranial and neral). Thus, the mixture showed a good antifungal
activity against arthrospores present in infected hairs. These results are promising for
a further application of the mixture as an alternative tool or as an adjuvant in the
environmental control of feline microsporosis.
1.13. Vaccination
Several attempts have been made to develop fungal vaccines for prevention and/or
therapy of dermatophytosis in cats, such as laboratory prepared fungal cell wall
vaccines, an inactivated broad-spectrum dermatophyte vaccine or a liveattenuated
dermatophyte vaccine. None of the investigated vaccines for cats showed sufficient
protection against challenge exposure. A vaccine for prophylaxis of M. canis infection
in cats and dogs is approved in Germany (Rivac Mikroderm, Riemser Arzneimittel
AG, Germany). Another vaccine (Insol® Dermatophyton, Boehringer Ingelheim,
Germany) is licensed for the therapeutic and prophylactic use in cats and dogs in
several European countries
Reports
DeBoer and Moriello (1994) conducted an experimental infection model to assess
induction of specific immunity against Microsporum canis in cats with an M.
59
canis cell wall vaccine preparation. Kittens 8–9 weeks old (n= 12) received five doses
of either vaccine or placebo at biweekly intervals. Specific immunity was monitored
via plasma anti-dermatophyte antibody titers and lymphocyte blastogenesis (LB) to
dermatophyte antigens. After vaccination, cats were challenged with viable M.
canis spores, and lesion development was monitored. Vaccinated cats developed
higher anti-dermatophyte IgG, but not IgM, titers than controls, beginning after the
second dose of vaccine (P < 0.001). During the vaccination period, specific cellular
immunity as measured by LB was absent in control cats, but developed to a limited
degree in vaccinated cats (P < 0.05). After challenge with 105 fungal spores per cat,
both control and vaccinated cats developed active infections. The vaccine appeared to
induce an antibody titer quantitatively similar to that produced by infection, but less
measured cellular immunity than was seen with infection and recovery. These results
suggest that induction of high titers of serum IgG or IgM antibody
against Microsporum canis is not protective against challenge exposure.
DeBoer and Moriello (1995) evaluated a laboratory-prepared killed Microsporum
canis cell-wall vaccine under conditions simulating an accidental infection of a
cattery, by inoculating eight- to nine-week-old cats with the vaccine or with a placebo
control. The vaccinated cats developed high titres of anti-dermatophyte IgG as
measured by an ELISA, and a small cell-mediated response against M canis as
measured by a lymphocyte blastogenesis assay, using a whole fungus extract. After
being inoculated the cats were challenged by the introduction of an infected cat into
the same room. All the vaccinated and control cats became culture-positive for M
canis within four weeks of the introduction of the infected cat. Four of the six control
cats and all the vaccinated cats developed lesions consistent with dermatophytosis
within 16 weeks after exposure to the infected cat.
Pier et al. (1995) used an inactivated, broad-spectrum dermatophyte vaccine to produce an
active immunity in guinea-pigs against Microsporum canis. None of the vaccinates
developed infection from a contact exposure challenge that produced clinical infections in
70% of the unvaccinated controls. Infection with M. canis induced antibody titres (ELISA) and
delayed cutaneous hypersensitivity (DCH) reactions to itself as well as cross-reacting titres to
Trichophyton equinum and T. mentagrophytes and DCH reactions to T. mentagrophytes;
however vaccinated animals developed significantly higher antibody titres and DCH
responses to all of these antigens than did non-vaccinated animals which had been infected
or exposed. Rabbits hyperimmunized with culture filtrate antigens to single dermatophyte
agents (M. canis, M. gypseum, T. equinum, and T. mentagrophytes) developed positive interspecies and inter-generic DCH cross-reactions to a battery of six skin test antigens (M. canis,
M. gypseum, M. equinum, T. equinum, T. mentagrophytes var. mentagrophytes and T.
verrucosum). Guinea-pigs vaccinated with a T. equinum vaccine had increased resistance to
M. canis infection than did non-vaccinated controls. These findings support clinical
observations which suggest establishment of a broad-based immunity in animals following
infection with a single dermatophyte.
Westhoff et al. (2010) investigated the efficacy of an inactivated vaccine for the
treatment of feline dermatophytosis in a placebo-controlled-double-blind multi-centre
GCP study in Europe. Fifty-five client-owned cats with dermatophytosis caused by
Trichophyton mentagrophytes or Microsporum canis, confirmed by fungal culture,
were treated with either three intramuscular injections of vaccine or placebo.
Treatment was applied as three intramuscular injections of vaccine or placebo every
other week. Clinical symptoms were assessed at inclusion, day 14, 28 and 42. The
number of lesions was counted and severity was judged based on a scoring system.
61
Efficacy was evaluated for the reduction of the number of lesions as well as for a
combined assessment of lesion severity x number of lesions. The primary endpoint
was not met for the total population of cats, but was met for cats.
Commercially available vaccines
Insol Dermatophyton inactivated vaccine developed in Boehringer Ingelheim
(Switzerland), it is effective in horse, dog and cat, can be used as treatment of
the disease, improving the clinical outcome. It contains strains of T. verrucosum,
T.mentagrophytes, T. sarkisovii, T. equinum,M. canis,M. canis var. distortum, M.
canis var. obesum, and M. gypseum.
Commercial vaccine Feo-O-Vax MC-K1 developed by Fort Dodge in USA.
It is an inactivated vaccine containing the mycelium of M. canis and an adjuvant.
It produces anti-dermatophyte antibody titres similar to those developed in the
course of the natural infection, with a low CMI. All vaccinated cats developed the
disease after a topical application of M. canis conidia; however, the lesions were
smaller than those in the control animals. The fact that all of the animals
vaccinated had lesions suggests that high titres of antibody against M. canis may
not be enough for protection against the infection.
The inactivated vaccine Dermatovac-IV. It contains an adjuvant and an
optically standardized inactivated suspension of conidia and mycelium of the
fungi M. canis, T. equimun, M. gypseum and T. mentagrophytes
The Ringvac bovis LTF-1301 live vaccine is the most effective and widely
used, marketed by Alpharma, elaborated with the LTF-130 strain of T.
verrucosum, has a characteristic high level of immunogenicity, low virulence and
great stability, has been used effectively in Russia and Norway, administered
intramuscularly, stimulates the appropriate immune response( DHS)
Permavax-Tricho live vaccine is marketed in the Czech Republic by
Bioveta Ivanovice, contains an attenuated strain of T. verrucosum. Triggers a
protective immunity status 28 days after the second inoculation, preventing the
appearance of the clinical disease for 1 year after vaccination.
1.14. Decontamination
key points:
The most important part of disinfection is the so-called ‘hard clean’ – that is,
removal of debris and thorough washing with a detergent until visibly clean.
It is important to rinse the detergent from the surface, as many disinfectants
are inactivated by detergents.
If gross debris and organic material are removed from the target surface,
ready-to-use disinfectants with label claim efficacy against Trichophyton
mentagrophytes are effective.36 it is important to apply these liberally and
allow for an adequate wetting/contact time.
Compounds containing accelerated hydrogen peroxide are recommended as an
alternative to household bleach.
61
Exposed soft materials can be washed in hot or cold water; bleach is optional.
it is important not to overload the washer, and to use the longest wash cycle
possible as agitation removes spores. if concern is high, wash the laundry
twice.
If only one or two animals are involved, it is recommended to do thorough
cleaning once or twice weekly, with removal of cat hair and use of ‘one step’
cleaners on a daily basis in-between these cleanings.
References
1. Abdel-Fattah, A., Refai, M. and El-Gothami, Z. : Tinea capitis in Egypt. Mykosen 10,
189-194 (1967)
2. Abdallah, I.S., Abdel-Gelil, G., Abdel-Hamid, Y. and Refai, M. : Ringworm in
animals in a farm in Assiut. Mykosen 14, 175-178 (1971)
3. Andrino M, Blanco JL, Durán C, Fernández-Barredo S, Cruzado M, García ME.
[Canine onychomycosis produced by Microsporum gypseum. A case report]. Rev
Iberoam Micol. 2003 Dec;20(4):169-71.
4. Angarano DW, Scott DW. Use of ketoconazole in treatment of dermatophytosis in
a dog. J Am Vet Med Assoc. 1987 Jun 1;190(11):1433-4.
5. Baldo A, Tabart J, Vermout S, Mathy A, Collard A, Losson B, et al. Secreted
subtilisins of Microsporum canis are involved in adherence of arthroconidia to feline
corneocytes. J Med Microbiol 2008; 57: 1152–1156.
6. BERGMAN, R. L., L. MEDLEAU, K. HNILICA, E. HOWERTH (2002):
Dermatophyte granulomas caused by Trichophyton mentagrophytes in a dog. Vet.
Dermatol. 13, 49-52.
7. Bond, R., Middleton, D. J., Scarff, D. H. and Lamport, A. I. (1992), Chronic
dermatophytosis due to Microsporum persicolor infection in three dogs. Journal of
Small Animal Practice, 33: 571–576
8. Boyanowski KJ, ihrke PJ, Moriello KA, Kass PH. Isolation of fungal flora from the
hair coats of shelter cats in the Pacific coastal USA. Vet Dermatol 2000; 11: 143–
150.
9. Brilhante, R. S. N., R. A. Cordeiro, J. M. F. Gomes, J. J. C. Sidrim and M. F. G.
Rocha. Canine dermatophytosis caused by an anthropophilic species: molecular and
phenotypical characterization of Trichophyton tonsurans. Journal of Medical
Microbiology (2006), 55, 1583–1586
10. Cafarchia C , Gasser RB, Figueredo LA, Weigl S, Danesi P, Capelli G, Otranto D. An
improved molecular diagnostic assay for canine and feline dermatophytosis. Med
Mycol. 2013 Feb;51(2):136-43.
11. Cafarchia, C., Romito, D., Capelli, G., Guillot, J. and Otranto, D. (2006), Isolation
of Microsporum canis from the hair coat of pet dogs and cats belonging to owners
diagnosed with M. canis tinea corporis. Veterinary Dermatology, 17: 327–331.
12. Cafarchia, C., Romito, D., Sasanelli, M., Lia, R., Capelli, G. and Otranto, D. (2004),
The epidemiology of canine and feline dermatophytoses in southern Italy. Mycoses,
47: 508–513.
13. Carlotti DN , Guinot P, Meissonnier E, Germain PA. Eradication of feline
dermatophytosis in a shelter: a field study. Vet Dermatol. 2010 Jun;21(3):259-66
14. Connole MD. Ringworm due to Trichophyton mentagrophytes in a dog. Aust Vet
J. 1968 Nov;44(11):528.
15. Dąbrowska I , Dworecka-Kaszak B , Brillowska-Dąbrowska A . The use of a one-step
PCR method for the identification of Microsporum canis and Trichophyton
mentagrophytes infection of pets. Acta Biochim Pol. 2014;61(2):375-8.
62
16. da Costa, F. V. A., Farias, M. R., Bier, D., de Andrade, C. P., de Castro, L. A., da
Silva, S. C. and Ferreiro, L. (2013), Genetic variability in Microsporum canis isolated
from cats, dogs and humans in Brazil. Mycoses, 56: 582–588
17. DeBoer D.J., Moriello K.A.Humoral and cellular immune response to Microsporum
canis in naturally occurring feline dermatophytosis, Journal of Medical Veterinary
Mycology, 31, 1993, 121–132.
18. DeBoer DJ, Moriello KA. Development of an experimental model of Microsporum
canis infection in cats. Vet Microbiol 1994; 42: 289–295.
19. DeBoer DJ, Moriello KA. The immune response to Microsporum canis induced by a
fungal cell wall vaccine. Vet Dermatol 1994; 5: 47-55.
20. DeBoer DJ, Moriello KA. Investigations of a killed dermatophyte cell-wall vaccine
against infection with Microsporum canis in cats. Res Vet Sci 1995; 59: 110-3.
21. DeBoer DJ, Moriello AK, Blum JL, Volk LM, Bredahl LK. Safety and immunologic
effects after inoculation of inactivated and combined live-inactivate dermatophytosis
vaccines in cats. Am J Vet Res 2002; 63: 1532-7.
22. Dreisoerner, H., Refai, M. and Rieth, H. : Otitis externa durch Microsporum canis bei
Katzen. Kleintier Prax. 9, 230-234 (1964)
23. Duarte A, Castro I, Pereira da, Fonseca IM, Almeida V, Madeira de, Carvalho LM,
Meireles J, et al.Survey of infectious and parasitic diseases in stray cats at the Lisbon
Metropolitan Area, Portugal. J Feline Med Surg 2010; 12: 441–446. [PubMed]
24. El-Bahy, G. and Refai, M. : Cats and dogs are potential carriers of Microsporum
canis. J. Egypt. Vet. Med. Ass. 28, 63-69 (1973)
25. Fairley RA . The histological lesions of Trichophyton mentagrophytes var erinacei
infection in dogs. Vet Dermatol. 2001 Apr;12(2):119-22.
26. Frymus T, Gruffydd-Jones T, Pennisi MG, Addie D, Belák S, Boucraut-Baralon
C, Egberink H, Hartmann K, Hosie MJ, Lloret A, Lutz H, Marsilio F, Möstl
K,Radford AD, Thiry E, Truyen U, Horzinek MC. Dermatophytosis in cats: ABCD
guidelines on prevention and management. J Feline Med Surg. 2013 Jul;15(7):598604.
27. Fukao M, Kawada A, Aragane Y, Tezuka T, Hiruma M. Tinea corporis due to
Microsporum gypseum in a cat fancier. J Dermatol. 2003 Aug;30(8):637-8.
28. Gräser, Y; De Hoog, S; Summerbell, RC (2006). "Dermatophytes: recognizing
species of clonal fungi.". Medical mycology 44 (3): 199–209.
29. Guzman-Chavez RE, Segundo-Zaragoza C, Cervantes-Olivares RA, Tapia-Perez G.
Presence of keratinophilic fungi with special reference to dermatophytes on the
haircoat of dogs and cats in México and Nezahualcoyotl cities. Rev Latinoam
Microbiol. 2000 Jan-Mar;42(1):41-4.
30. HENRIK STENWIG* AND TORUNN TAKSDAL. Isolation of Epidermophyton
floccosum from a dog in Norway. Journal of Medical and Veterinary Mycology
(1984) 22, 171-172
31. Chatterjee A, Chattopadhyay D, Gupta DN, Chakrabarti A. An unusual association of
Trichophyton mentagrophytes and Demodex canis in a mongrel dog with multiple
kerions. Ann Trop Med Parasitol. 1980 Feb;74(1):101-2.
32. Hermoso de Mendoza M1, Hermoso de Mendoza J, Alonso JM, Rey JM, Sanchez
S, Martin R, Bermejo F, Cortes M, Benitez JM, Garcia WL, Garcia-Sanchez A. A
zoonotic ringworm outbreak caused by a dysgonic strain of Microsporum canis from
stray cats. Rev Iberoam Micol. 2010 Jun 30;27(2):62-5.
33. Iorio R, Cafarchia C, Capelli G, Fasciocco D, Otranto D, Giangaspero A.
Dermatophytoses in cats and humans in central Italy: epidemiological aspects.
Mycoses. 2007 Nov;50(6):491-5.
34. Isabel Martins Madrid, Angelita dos Reis Gomes, Antonella Souza Mattei, Rosema
Santin, Marlete Brum Cleff, Renata Osório Faria, Mário Carlos Araújo
Meireles.CANINE NEONATAL DERMATOPHYTOSIS BY Microsporum
gypseum. Vet. e Zootec. 2012 março; 19(1): 073-078.73
63
35. Kaneko, T., Kaneko, M. and Makimura, K. (2011), Cluster analysis of Microsporum
canis isolated from a patient with tinea corporis and an infected cat based on the
DNA sequences of nuclear ribosomal internal transcribed spacer 1. Mycoses,
54: e867–e869.
36. Kano R, Hirai A, Yoshiike M, Nagata M, et
al Molecular
identification
ofTrichophyton rubrum isolate from a dog by chitin synthase 1 (CHS1) gene
analysis.Med Mycol 2002;40:439-442.
37. Kano R, Nagata M, Suzuki T, Watanabe S, Kamata H, Hasegawa A. Isolation of
Trichophyton rubrum var. raubitschekii from a dog. Med Mycol. 2010
Jun;48(4):653-5
38. Kano R, Yasuda K, Nakamura Y, Hasegawa A. Microsporum gypseum isolated from
a feline case of dermatophytosis. Mycoses 2001;44:338-341.
39. Kaszubiak, A; Klein, S; de Hoog, G.S; Graser, Y (2004). "Population structure and
evolutionary origins of Microsporum canis, M. ferrugineum and
M.audoinii". Infection, Genetics and Evolution 4: 179–
186. doi:10.1016/j.meegid.2003.12.004.
40. Katoh, T., Maruyama, R., Nishioka, K. and Sano, T. (1991), Tinea Corporis Due
to Microsporum canis from an Asymptomatic Dog. The Journal of Dermatology,
18: 356–359.
41. Kurtdede, A. , A.E. Haydardedeoglu2 , H. Alihosseini1 , E.C. Colakoglu,
Dermatophytosis caused by Trichophyton mentagrophytes var. erinacei in a dog: a
case report. Veterinarni Medicina, 59, 2014 (7): 349–351
42. Kushida T. An additional case of canine dermatophytosis caused byTrichophyton
rubrum. Nippon Juigaku Zasshi 1979;41:77-81.
43. Kushida T, Watanabe S. Canine ringworm caused by Trichophyton rubrum; probable
transmission from man to animal. Sabouraudia. 1975 Mar;13 Pt 1:30-2.
44. Mancianti F , Nardoni S, Cecchi S, Corazza M, Taccini F. Dermatophytes isolated
from symptomatic dogs and cats in Tuscany, Italy during a 15-year-period.
Mycopathologia. 2002;156(1):13-8.
45. Mancianti F, Nardoni S, Corazza M, D'Achille P, Ponticelli C. Environmental
detection of Microsporum canis arthrospores in the households of infected cats and
dogs. J Feline Med Surg. 2003 Dec;5(6):323-8.
46. Manoyan MG, Panin AN, Letyagin KP. Effectiveness of microderm vaccine against
dermatophytes in animals. Vet Dermatol 2000; (11 Suppl 1): 59. [31]
47. MORETTI, A., F. AGNETTI, F. MANCIANTI, S. NARDONI, C. RIGHI, I.
MORETTA , Epidemiological, clinical and zoonotic aspects. GIORNALE
ITALIANO DI DERMATOLOGIA E VENEREOLOGIA, Vol. 148 - No. 6,
2013,563-,572
48. Moriello K. Feline dermatophytosis: aspects pertinent to disease management in
single and multiple cat situations. J Feline Med Surg. 2014 May;16(5):419-31.
49. Moriello KA. In vitro efficacy of shampoos containing miconazole, ketoconazole,
climbazole or accelerated hydrogen peroxide against Microsporum canis and
Trichophyton species. J Feline Med Surg. 2016 Jan 25.
50. Moriello KA, DeBoer DJ, Greek J, Kukl K, Fintelman M. The prevalence of
immediate and delayed-type hypersensitivity reactions to Microsporum canisantigens
in cats. J Feline Med Surg 2003; 5: 161–166.
51. Moriello KA, Kunkle G, deboer DJ. Isolation of dermatophytes from the haircoats of
stray cats from selected animal shelters in two different geographic regions in the
United States. Vet Dermatol 1994; 5: 57–62.
52. Muller A, Guaguère E, Degorce-Rubiales F, Bourdoiseau G. Dermatophytosis due
to Microsporum persicolor: A retrospective study of 16 cases. The Canadian
Veterinary Journal. 2011;52(4):385-388.
64
53. Nardoni S , Mugnaini L, Papini R, Fiaschi M, Mancianti F. Canine and feline
dermatophytosis due to Microsporum gypseum: a retrospective study of clinical data
and therapy outcome with griseofulvin. J Mycol Med. 2013 Sep;23(3):164-7.
54. Nardoni S, Tortorano A, Mugnaini L, Profili G, Pistelli L, Giovanelli S, Pisseri
F, Papini R, Mancianti F. Susceptibility of Microsporum canis arthrospores to a
mixture of chemically defined essential oils: a perspective for environmental
decontamination. Z Naturforsch C. 2015;70(1-2):15-24.
55. Newbury S, Blinn MK, Bushby PA, Barker Cox C, Dinnage JD, Griffin B, et
al. Guidelines for standards of care in animal shelters. The Association of Shelter
Veterinarians.http://oacu.od.nih.gov/disaster/ShelterGuide.pdf (2010, accessed
February 26, 2014).
56. Newbury S, Moriello K, Coyner K, Trimmer A, Kunder D. Management of endemic
Microsporum canis dermatophytosis in an open admission shelter: a field study. J
Feline Med Surg. 2015 Apr;17(4):342-7.
57. Okoshi,S. and A Hasegawa -Microsporum gypseum isolated from feline ringworm.
Japanese Journal of Veterinary Science, 1967 - cabdirect.org
58. Pier AC, Hodges AB, Lauze JM, Raisbeck M. Experimental immunity to
Micropsorum canis and cross reactions with other dermatophytes of veterinary
importance. J Med Vet Mycol 1995; 33: 93-7.
59. Piérard-Franchimont C Hermanns JF, Collette C, Piérard GE, Quatresooz P.
Hedgehog ringworm in humans and a dog. Acta Clin Belg. 2008;63(5):322-4..
60. PINTER, LJ., Z. ŠTRITOF: A retrospective study of Trichophyton mentagrophytes
infection in dogs (1970-2002). Vet. Arhiv 74, 251-260, 2004.
61. Proverbio, Daniela, Roberta Perego, Eva Spada, Giada Bagnagatti de Giorgi,
Alessandra Della Pepa, and Elisabetta Ferro, “Survey of Dermatophytes in Stray Cats
with and without Skin Lesions in Northern Italy,”Vet. Med. International, 2014.
62. Rieth, H, and Refai, M. : Tiermykosen, Konsequenzen und Verantwortung der
Veterinaer –medizin Blauen Heft 27, 16-23 (1964)
63. Refai, M. : Ueber die Dermatophytenflora in Nordaegypten. Mykosen 10, 61-62
(1967)
64. Rene´ Chermette Æ Laerte Ferreiro Æ Jacques Guillot. Dermatophytoses in Animals,
Mycopathologia (2008) 166:385–405
65. Romano C , Massai L, Gallo A, Fimiani M. Microsporum gypseum infection in the
Siena area in 2005-2006. Mycoses. 2009 Jan;52(1):67-71
66. Scarampella F, Zanna G, Peano A, Fabbri E, Tosti A. Dermoscopic features in
12 cats with dermatophytosis and in 12 cats with self-induced alopecia due to other
causes: an observational descriptive study. Vet Dermatol. 2015 Aug;26(4):282-e63.
67. Segundo C, Martínez A, Arenas R, Fernández R, Cervantes RA. [Superficial
infections caused by Microsporum canis in humans and animals]. Rev Iberoam
Micol. 2004 Mar;21(1):39-41.
68. Sharma, R., S. de Hoog, Wolfgang Presber and Yvonne Gra¨ser (2007). A virulent
genotype of Microsporum canis is responsible for the majority of human infections,
Journal of Medical Microbiology 56,1377-1385
69. Sun PL, Mu CA, Fan CC, Fan YC, Hu JM, Ju YM. Cat favus caused by Microsporum
incurvatum comb. nov.: the clinical and histopathological features and molecular
phylogeny. Med Mycol. 2014 Apr;52(3):276-84.
70. Tabart J, Baldo A, Vermout S, Losson B, Mignon B. Reconstructed interfollicular
feline epidermis as a model for the screening of antifungal drugs
against Microsporum canis. Vet Dermatol 2008; 19: 130–133.
71. Terreni, Anne A. , Walter B. Gregg, Phillip R. Morris & Arthur F. Disalvo
Epidermophyton floccosum infection in a dog from the United States
Sabouraudia 1985; 23: 141-142
65
72. Van Rooij P, Declercq J, Beguin H. Canine dermatophytosis caused by
Trichophyton rubrum: an example of man-to-dog transmission. Mycoses. 2012
Mar;55(2):e15-7
73. Verbrugge M, Moriello K, Newbury S. Correlation of skin lesions and dermatophyte
culture status in cats at the time of admission to a shelter. Vet Dermatol 2006; 17:
213.
74. Yahyaraeyat, H. Shokri, A.R. Khosravi, M. Soltani, A. Erfammanesh and D.
Nikoein. Occurrence of animal dermatophytosis in Tehran, Iran. World J. Zool.
4,200-2004, 2009
75. Yamada C, Hasegawa A, Ono K, et al. Trichophyton rubrum infection in a dog. Jpn J
Med Mycol 1991;32:67-71.
76. Watanabe K. Two cases of dermatophytosis caused by Microsporum gypseum and
isolation of Microsporum gypseum from soil in Chigasaki city. Med Mycol
J. 2014;55(2):J79-83.
77. Westhoff, D.K., M.-C. Kloes, F.X. Orveillon , D. Farnow , K. Elbers and R.S.
Mueller Treatment of Feline Dermatophytosis with an Inactivated Fungal Vaccine
The Open Mycology Journal, 2010, 4: 10-17
78. Ziółkowska G1, Nowakiewicz A, Gnat S, Trościańczyk A, Zięba P, Dziedzic BM.
Molecular identification and classification of Trichophyton mentagrophytes complex
strains isolated from humans and selected animal species. Mycoses. 2015
Mar;58(3):119-26.
79. Zwierzyńska E , Dworecka-Kaszak B. [Mixed dermatophyte infection in a cat]. Wiad
Parazytol. 2001;47(4):639-46.
B.
Fungal diseases of cats and dogs caused by yeasts
1. Candidosis in cats and dogs
1.1.
Introduction
In dogs, Candida spp are ubiquitous saprophytic yeast and widely distributed in the
environment and frequently colonized the skin and mucous membranes (such as the
oral cavity) and genital and gastrointestinal tracts of dogs. They prefer constantly
humid areas, which favour tissue maceration, as occurs in mucous membranes,
mucocutaneous junctions, intertriginous areas, nail substructure inter-fingers areas,
ear canals and the lateral face of the ear and genital tract membrane.
Immunosuppressive states appear to preclude dogs to developing candidosis, such as
iatrogenic
infections
associated
with
wound
dehiscence,
candidial endocarditis following prolonged immunosuppression therapy, and
candidiasis associated with metastatic mast cell tumors. Clinically affected dogs
present with generalized seborrheic dermatitis, alopecia, patchy erythema, and
superficial erosions with histological evidence of mural folliculitis. Dogs with
66
systemic candidosis present with more general symptoms referable to the organs
affected, but peritonitis and chronic cystitis have been reported.
Candida albicans is not a member of the normal skin flora and its presence is always
the expression of a pathologic state and of its intrinsic pathogenicity. Species which
are reported in dogs include:
Cutaneous candidosis
1. Candida parapsilosis: Dale, 1972, Yurayart, 2013
2. C albicans: Moretti, 2004,
3. Candida guilliermondii: Mueller, 2002
4. Candida glabrata: Waurzyniak, 1992
5. Candida sp : KRAL,1960, Lee, 2011
Urinary tract, mainly cystitis
1. Candida albicans: Kano,2002, Jin &Lin , 2005
2. Candida tropicalis: Ozawa et al., 2005,Álvarez-Pérez et al., 2016,
3. Candida parapsilosis: Kano et al.,2002
4. Candida sp: Forward et al.,,2002, Pressler et al.,2003, Enders et al., 2016
Peritonitis
1. Candida albicans: Ong et al., 2009, Bradford et al, 2013, GLIŃSKA et al..
2013, Burgess and Gaunt, 2014
2. Candida tropicalis, Palmer et al, 1982
Oral and gastrointestinal candidosis
1. Candida albicans: Refai ,1986 , Refai et al., 1986 , Mancianti et al., 1992
Milner et al., 1997, Jadhav and Pal, 2006
2. Candida sp : Ochiai.2002, Biegańska et al., 2014
Rhinitis
1. Candida parapsilosis Lamm et al. (2013)
Ocular candidosis
1. Candida albicans: Linek , 2004
2. Candida sp : Enders, 2016
Bronchopulmonary candidosis
1. Candida sp Clercx,1996
Pericarditis
1. Candida albicans Mohri . 2009.
Otitis externa
1. Candida albicans.McKellar, 1990
Systemic (disseminated) candidosis
1. Candida albicans: Ruthe,1978, Ehrensaft, 1979, Holøymoen,1982,
Weber,1985, Heseltine,2003, Kuwamura,2006, Recai et al. 2006. Khosravi et
al., 2009, Matsuda, 2009, Rogers et al., 2009, Skoric et al., 2011
2. Candida glabrata: Schoeniger. 2002,
3. Candida sp: Clercx,1996, Rodríguez,1998, , Brown, 2005, Gershenson,
2011, Rogers, 2011
Healthy dogs
1. Candida albicans: Edelmann et al,2005
2. Candida parapsilosis: Brilhante et al,2014
3. Candida sp Cleff et al,2010, Brito et al, 2009
67
In cats, Candida spp are a common fungus present as a commensals on most mucous
membranes including the mouth, digestive tract and vagina of cats. They also form
part of the normal faecal biotome. They rarely cause primary disease, but can cause
serious disease in immunocompromised or malnourished patients. The lower urinary
tract is the most common site for feline Candida spp infection. Candida spp reported
in cats include:
Urinary tract, mainly cystitis
1. Candida albicans: Fulton et al., Jin &Lin , 2005
2. Candida species: Toll et al.,2003, Pressler et al.,2003,
Ocular candidosis
1. Candida sp Gerding et al., 1994
Oral candidosis
1. Candida albicans: Mancianti, 1992
Rhinitis
1. Candida parapsilosis Lamm et al., 2013
Pyothorax
1. Candida albicans: McCaw, 1984
Gastrointestinal granuloma
1. Candida albicans: Duchaussoy et al., 2015
Disseminated candidosis
1. Candida sp: Gerding et al., 1994
Healthy cats
1. Candida albicans: Edelmann et al,2005
Description of main Candida species reported in dogs
cats and dogs
1.2.
1.2.1.
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Candida albicans (Robin) Berkhout 1923
Synonyms
=Blastomyces albicans Brownlie: 425-431 (1920) [MB#456196]
=Candida biliaria Bat. & J.S. Silveira, Hospital Rio de Janeiro 56 (2): 295 (1959)
=Candida claussenii Lodder & Kreger, The Yeasts: a taxonomic study: 578 (1952)
=Candida desidiosa Cif. & Redaelli, Archiv für Mikrobiologie 6: 65 (1935) [MB#263052]
=Candida genitalis Bat. & J.S. Silveira, Public Instit Micol Unive do Recife 170: 11 (1962)
=Candida intestinalis Bat. & J.S. Silveira, Hospital Rio de Janeiro 56 (2): 293 (1959)
=Candida langeronii Dietrichson, Annales de Parasitol Humaine Comparée 29: 479 (1954)
=Candida mycotoruloidea Redaelli & Cif., Archiv für Mikrobiologie 6: 50 (1935)
=Candida nouvelii Saëz, Bulletin de la Société Mycologique de France 89 (1): 82 (1973)
=Candida truncata Vanbreus., Archives Belge de Derm et Syphil 4: 307-313 (1948)
=Endomyces albicans Okabe, Cblatt Bakteriol, Parasit Infek, Erste Abt: 181-187 (1929)
=Monilia alba Castell. & Chalm., Manual of Tropical Medicine: 1089 (1919) [MB#481761]
=Monilia albicans Plaut (1919) [MB#479429]
68
Morphology
On Sabouraud's dextrose agar colonies are white to cream coloured, smooth, glabrous
and yeast-like in appearance. Microscopic morphology shows spherical to
subspherical budding yeast-like cells or blastoconidia, 2.0-7.0 x 3.0-8.5 um in size.
Rieth
faculty.ccbcmd.edu
Physiological Tests:
Germ Tube test + within 3 hours. Hydrolysis of Urea +,Growth on Cycloheximide
medium +. Growth at 37C +, fermentation: Glucose +; Maltose +, Galactose +/-;
Trehalose+/-, Sucrose (some strains +); Lactose -. Assimilation: Glucose +; Maltose
+; Galactose +; Trehalose +; Sucrose (some negative);D-Xylose +; Soluble Starch +;
D-Mannitol +; D-Glucitol (Delayed), Melezitose +/-; Glycerol +/-; Succinic acid +/-;
L-Arabinose +/-; L-Sorbose +/-; D-Ribose (some positive); Citric acid +/-; DL-Lactic
acid +/-. Potassium nitrate -; Lactose -; Ribito-
1.2.2.
Candida parapsilosis (Ashford) Langeron & Talice,
Annales de Parasitologie Humaine Comparée 10: 54 (1932)
69
≡Monilia parapsilosis Ashford, American Journal of Tropical Medicine 8: 518 (1928) ≡Candida
parapsilosis var. parapsilosis , Annales de Parasitol Huma Comp (1932)
≡Mycocandida parapsilosis (Ashford) C.W. Dodge, Med mycol. 294 (1935)
≡Mycotorula parapsilopsis (Ashford) Cif. & Redaelli (1943)
≡Mycotorula parapsilosis Cif. & Redaelli, Atti dell'Istituto Bot della (1943)
=Torulopsis larvae Kawano et al.
=Monilia onychophila Pollacci & Nann., Archiv Biol.: 25-36 (1926)
=Mycotorula vesica F.C. Harrison, Trans Royal Society of Canada 22: 219 (1928)
=Blastodendrion intestinale var. epidermicum Cif. & Alfons., Zblatt Bakt (1931)
=Blastodendrion globosum Zach, Arch. Dermatol. Syph.: 99 (1933)
=Blastodendrion gracile Zach, Arch. Dermatol. Syph.: 103 (1933)
=Pseudomycoderma vesica (F.C. Harrison) C.W. Dodge, Med mycol. 236 (1935)
=Candida montrocheri M. Morelet, Bull. Soc. Sci. Nat. Arch. Toulon & Var: 6 (1968)
=Brettanomyces petrophilum I. Takeda, Iguchi, Tsuzuki & Nakano, UN: (1972
=Candida osornensis C. Ramírez & A.E. González, Mycopathol 88 (2-3): 88 (1984)
Morphology and physiology
Colonies (YPGA) are cream-coloured to yellowish, glistening and soft, mostly
smooth or partly or entirely wrinkled. Pseudomycelium (RA) are present, mostly
abundant, consisting of branched chains of elongate cells in more or less christmas
tree-like arrangement, lateral branches gradually becoming shorter towards the
hyphal apex. fermentation of glucose +, and assimilation: cellobiose, raffinose,
melebiose, melezitose +, soluble starch, d-xylose +, salicin, arbutin, 5-keto-dgluconate (but may be slowly positive), nitrate, growth at 37À¸C +, d-tryptophan
(N), w/o thiamine +. Physiologically indistinguishable from Candida guilliermondii
(p. 200), C. haemulonii (p. 202), C. pulcherrima (p. 217), C. tropicalis (p. 220) and
some saprobic species
Candida · parapsilosis , ww.mdpi.com, plantpathology86.blogfa.com
1.2.3.
Candida glabrata (H.W. Anderson) S.A. Mey. & Yarrow,
Int J Syst Bacteriol 28: 612 (1978)
71
≡Cryptococcus glabratus H.W. Anderson, Journal of Infectious Diseases 21: 379
(1917) ≡Torulopsis glabrata (H.W. Anderson) Lodder & N.F. de Vries, Mycopathol
1: 102 (1938)
=Torulopsis stercoralis Uden
=Torulopsis glabrata (Anderson) Lodder & de Vries, Mycopath. Mycol. Appl. 1: 98,
1938-1939.
=Cryptococcus glabratus Anderson, J. Infect. Dis. 21: 379, 1917.
Morphology and physiology
Colonies on Glucose Peptone Agar at 25°C: after 3 days cream-coloured, smooth,
dull, regular in shape, spherical, domed.Yeast-like cells are generally ovoid, single or
budding 2·0-4·0 x 3·0-5·5 µm. Dalmau Plate Cultures on Corn Meal Agar: ovoid,
budding cells only. No pseudomycelium (chains of elongated yeast-likecells)
produced.Germ Tube Test: negative. Fermentation of Carbohydrates: Glucose +
Sucrose - Maltose - Lactose - Galactose - Raffinose - Trehalose. Assimilation of
Organic Compounds: Glucose + Sucrose - Maltose - Lactose - Galactose - Raffinose Trehalose +Cellobiose - Inositol - Melezitose - Melibiose - Mannitol - L-Sorbose - DXylose - L-Arabinose - D-Arabinose - D-Ribose - L-Rhamnose - Glycerol v Erythritol
- Ribitol - Galactitol - D-Glucitol - Salicin - DL-Lactic Acid - Succinic Acid
CitricAcid - Soluble Starch -. Assimilation of Inorganic Compounds: Nitrate -.
Ability to split urea: -.
Candida glabrata, yeastcurereview.com, Wikipedia
1.2.4.
Candida tropicalis (Castell.) Berkhout, De
schimmelgeslachten Monilia, Oidium, Oospora en Torula:
44 (1923)
1. Atelosaccharomyces tropicalis (Castell.) Mello, Arq de Higi e Patol Exóti 6: 263 (1918)
2. Candida albicans var. tropicalis (Castell.) Cif., Manuale de Micol Medica 2: 252 (1960)
3. Candida tropicalis var. tropicalis
4. Castellania tropicalis (Castell.) C.W. Dodge, Med mycol .: 258 (1935)
5. Endomyces tropicalis (Castell.) Castell., Centbl. Bakt. ParasitKde, Abt. 1: 236 (1911)
6. Monilia tropicalis (Castell.) Castell. & Chalm., Manual of Tropical Medicine: 1086 (1919)
7. Myceloblastanon tropicale (Castell.) M. Ota, Jap. J. Dermatol. Urol.: 178 (1927)
71
8. Mycotorula tropicalis (Castell.) Cif. & Redaelli, Atti dell'Isti Bota della Univ Lab (1943)
9. Oidium tropicale Castell., Philippine J Sci Sec B Medical Science 5 (2): 202 (1910)
10. Procandida tropicalis (Castell.) E.K. Novák & Zsolt, Acta Bot Acad Sci Hung (1961)
Morphology
Growth in glucose-yeast extract-peptone broth: After 3 days at 25°C, the cells are
spheroidal and short-spheroidal, ellipsoidal, cylindrical, (3.2-8.0) × (4.0-8.8) µm,
single, in pairs, multilateral budding. Growth on glucose-yeast extract-peptone agar:
Aerobic growth is cream, smooth, butyrous, soft, glistening and convex with fringed
border. Dalmau plate culture on corn meal agar: After 7 days at 25°C, pseudohyphae
consist of branched chains of cylindrical cells with blastoconidia formed singly or in
verticals. Septate hyphae are usually present. Formation of ascospores: Ascospores
are not formed.
Candida tropicalis, www.healthandwellbeingnews.com, www.bcrc.firdi.org.tw
1.3.
Reports on candidosis in dogs and cats
1.3.1. Cutaneous candidosis
MUELLER et al. (2002) reported an eight-month-old male neutered Jack Russell
terrier was presented with chronic severe dermatitis in the inguinal area, which had
developed shortly after castration. Impression smears of the affected skin revealed a
small number of yeast organisms, , suspected to be Candida species. Skin biopsies and
cultures were obtained. Histopathologically, a mild mononuclear superficial
dermatitis was present. Epidermal hyperkeratosis was mild, but marked parakeratosis
was noted with focal accumulation of neutrophils and yeast organisms in the stratum
corneum. Yeasts were grown on Sabouraud dextrose agar and identified as Candida
guilliermondii using ID 32C identification strip of Bio-Merieux. The dog was treated
with kwtoconazole at 10 mg/kh twice daily and a shampoo containing chlorhexidine,
miconazole and selenium sulphide daily, and the inguinal area improved dramatically
within 10 days
72
Left: Severe erythema, scaling and crusting in the inguinal area of an eight-month-old male, neutered
Jack Russell terrier, between the prepuce and the scrotum bilaterally, due to Candida guilliermondii,
Right: Yeast organisms found cytologically in the affected inguinal area of the Jack Russell terrier.
Modified Wright stain. x 1000, MUELLER et al. (2002)
Left: Yeast organisms in the stratum corneum of the skin biopsy taken from the affected inguinal area
of the Jack Russell terrier. Haematoxylin and eosin. x 1000, Right: Inguinal area of the Jack Russell
terrier after systemic and topical antifungal treatment, MUELLER et al. (2002)
Moretti et al. (2004) described a clinical case of cutaneous candidiasis in a dog with
dermatological lesions, characterized by persistent alopecia, crusts, ulcers and scales.
Predisposing factors such as the use of corticosteroids, the concomitan presence of an
autoimmune disease (pemphigus foliaceus) and an infection of ehrlichiosis caused by
Ehrlichia canis were observed. Histopathological findings included signs of
orthokeratotic hyperkeratosis, moderate follicular keratosis and light epidermic
acanthosis. The reactive process included an infiltrative superficial dermatitis and a
mural folliculitis with prevalent participation of macrophages and lymphocytes. They
73
indicated that the application of PCR-Restriction Enzyme Analysis (REA) method
on cutaneous specimens, together with other techniques, such as mycologic, cytologic
and histological examinations, allowed them to identify Candida albicans as
aetiological agent in this particular case.
Left:Cytologic examination: macrophages, mononuclear cells and epithelial cells are seen in
association with pseudo-hyphal structures (May-Grunwald Giemsa stain, x40). Right:
Histological finding of the skin: severe fungal colonization of the follicular infundibulum (PAS
stain, x25). Moretti et al. (2004)
Lee et al. (2011) reported one-year-old male Beagle dog with dermatitis, alopecia
and scales. Examination of the affected dog revealed generalized alopecia, patchy
erythema, and superficial erosions with histological evidence of mural folliculitis.
External tests for parasites in scraped skin samples were negative. However, fungal
culture tests and polymerase chain reaction revealed the existence of Candida in the
lesion. These results suggest that cutaneous candidiasis may induce mural folliculitis
and alopecia in dogs.
Left:Histopathological findings of a section of the skin from a dog with alopecia secondary to infection
with Candida. Hematoxylin-eosin stain. ×200, , Right:Gel electrophoresis of DNA amplicons
by Canidida-specific PCR. M, 100-bp DNA ladder; P, positive control; N, negative control; B,
biopsied skin DNA. Lee et al. (2011)
1.3.2. Candida urinary tract infections
Fulton et al. (1992) diagnosed a case of Candida albicans urocystitis secondary to
urethral stricture and administration of antibiotics was diagnosed in a cat by fungal
74
culturing of urine and examination of specimens. Surgical repair of the stricture and
administration of 5-fluorocytosine resulted in resolution of the cystitis. Related
problems included anorexia and severe weight loss, which necessitated enteral
nutritional support, dehydration, renal disease, and nosocomial Pseudomonas
aeruginosa urocystitis.
Kano et al. (2002) identified Candida species in clinical urine samples directly by the
newly developed method of PCR analysis on 25S ribosomal DNA (rDNA).
Two dogs were referred to the Animal Medical Center, Nihon University School of
Veterinary Medicine, Fujisawa, Kanagawa, Japan for the examination of chronic
cystitis. Microscopic examination of urine samples from these dogs revealed yeast
cells. Urine culture on Sabouraud's dextrose agar at 27 o C for 5 days produced white
to cream colored colonies. The isolates were identifical to Candida albicans and C.
parapsilosis by mycological examination, respectively. The nucleotide sequences of
25S ribosomal DNA from these urine isolates showed 99% similarity to those of a
reference strain of Candida albicans or C. parapsilosis. The nucleotide sequences of
25S rDNA obtained directly from urine samples were also identical to C. albicans and
C. parapsilosis, respectively. Confirming the results on the isolates cultured from the
same urine samples. This PCR analysis method could be available for the direct
identification of Candida species in urine samples within 2 days.
Pressler et al. (2003) reviewed records from 20 animals (13 dogs, seven cats) with
Candida urinary tract infections. Six Candida spp. were isolated; Candida albicans
was the most common isolate. Concurrent diseases or non-antifungal drugs
administered within 1 month of isolation included antibiotics (n=16), corticosteroids
(n=6), diabetes mellitus (n=4), non-urogenital neoplasia (n=3), and non-candidal
urogenital disease (n=14). All animals had sources of local or systemic immune
compromise that likely predisposed to infection. Of five animals with resolution of
infection, three did not receive specific antifungal treatment. The authors conclude
that correction of predisposing conditions is likely critical for management of Candida
spp. urinary tract infection.
Toll et al. (2003) reported a 12-year-old spayed female domestic longhair cat with
fungal cystitis (Candida sp). The cat had a history of chronic diabetes mellitus,
hyperadrenocorticism, and bacterial cystitis caused by Escherichia coli. Antifungal
agents (itraconazole and fluconazole) were administered orally without noticeable
effect on the candiduria. Because of the ineffectiveness of these treatments,
intravesicular administration of 1% clotrimazole solution was performed weekly for 3
treatments. Complete resolution of urinary candidiasis was detected after the third
infusion. Intravesicular administration of clotrimazole solution appears to be a safe
and effective treatment of fungal cystitis in cats.
Jin and Lin (2005) studied 35 animals (23 dogs, 12 cats) with fungal urinary tract
infections (UTIs) were retrospectively. Dysuria, hematuria, increased frequency of
micturition, anorexia, depression, and pyrexia were the most common clinical signs
noted. Seven species of fungi were identified in the affected animals. Candida
albicans was the most common isolate. Most animals diagnosed with fungal UTI also
had other concurrent urinary tract or medical problems. Lower urinary tract diseases,
diabetes mellitus, neoplasia, and renal failure were the most common concurrent or
preceding diseases identified. Resolution of fungal UTI occurred in 12 animals that
received specific antifungal treatment.
75
Ozawa et al. (2005) identified an isolate from urine of a dog with cystitis molecularly
as Candida tropicalis and its minimum inhibitory concentration (MIC) was
determined by a microdilution method. The 25S ribosomal DNA sequence analysis
indicated that the clinical isolate was essentially identical to that of C. tropicalis and
distinct from other Candida species. The MIC(50) and the MIC(90) of fluconazole
(FLZ) for the clinical isolate of C. tropicalis was 6.25 and 25 microg/ml, respectively,
indicating that susceptibility of the clinical isolate of C. tropicalis to FLZ was less
than for other strains of C. tropicalis as well as C. albicans. The molecular analysis as
presented in this study assisted the diagnosis of candidiasis by identifying the yeasts
in urine samples within 2 days. The patient dog, a 10-year-old male Shih Tzu dog (7.0
kg) referred for examination of cystitis was successfully treated with itraconazole.
Enders et al. (2016) described the clinical presentation, diagnosis, histologic lesions,
and outcome of endogenous mycotic endophthalmitis secondary to candiduria in a
three-year-old female spayed Dachshund. The dog was being treated for Evans
syndrome for one month prior to being diagnosed with candiduria and fibrinous
uveitis OS. The left eye was enucleated due to secondary glaucoma, and the fungal
urinary tract infection was treated successfully. Uveitis developed in the contralateral
eye with relapse of the urinary tract infection in the following weeks. The right eye
was medically managed until secondary glaucoma developed and was subsequently
enucleated. Histopathology of both eyes showed evidence of endophthalmitis with
intralesional fungal organisms, consistent with Candida spp. Ocular candidiasis is rare
in dogs.
1.3.3.
Candida peritonitis
Ong et al. (2010) reported a 15-week-old Papillon that developed peritonitis
secondary to enterectomy site dehiscence. A pure growth of Candida albicans was
obtained from the abdominal fluid. Surgical repair of the dehiscence was performed
and antifungal therapy instituted with fluconazole postoperatively. A marked
exudative process was noted postoperatively with production of large volumes of
fluid from the abdominal drain. Fresh frozen plasma and pentastarch were provided
for oncotic support. Recovery was complicated by megaesophagus, however, the
patient gradually improved and was discharged 11 days after surgery.
Bradford et al. (2013) described 5 cases of dogs with peritonitis complicated by
Candida spp; 3 dogs with C. albicans, one dog with C. albicans and C. glabrata, and
one dog with C. glabrata only. The 3 dogs with C. albicans peritonitis presented with
duodenal perforation due to NSAID therapy, intestinal resection and anastomosis
following postspay-surgery dehiscence, and intestinal foreign body removal. The 2
dogs with C/ glabrata peritonitis had undergone cholecystectomy due to gall bladder
rupture and dehiscence of intestinal biopsy removal sites following exploratory
laparatomy. In all cases, initial diagnosis of fungal peritonitis was made via cytologic
examination of peritoneal effusions, which revealed marked pyogranulomatous
inflammation with numerous 3-8 μm oval, deeply basophilic yeast organisms with
thin clear capsules noted within phagocytes and extracellularly. In addition, germ tube
formation, hyphae, and pseudohyphae were rarely seen in some of the cases with pure
C. albicans. Identity of the organisms was determined by culture in all cases and
confirmed by PCR in 3 cases.
76
GLIŃSKA et al. (2013) reported a male dog of Pointer breed, 10 years of age. The
clinical examination revealed severe tenderness and a tension in the abdominal walls.
The ultrasound examination detected fluid in the peritoneal cavity. The fluid collected
from the peritoneal cavity displayed typical features of exudative fluid. In the
cytological examination of the fluid, numerous stimulated endothelial cells,
lymphocytes, and neutrophils were found. In the microbiological examination of the
peritoneal fluid, Candida albicans was cultured. On the basis of the clinical signs,
laboratory test results of the peritoneal fluid, and microbiological culture, the
diagnosis of fungal peritonitis was made.
Left: Brownish blood-red fluid collected from the peritoneal cavity of the dog with fungal peritonitis.
Right: Smear of peritoneal fluid sediment. Numerous erythrocytes, neutrophils, and individual
peritoneal cells are visible. H&E staining, magnification 400×. GLIŃSKA et al. (2013)
Smear of peritoneal fluid sediment. Erythrocytes, neutrophils, and individual lymphocytes are visible.
H&E staining, magnification 200×. GLIŃSKA et al. (2013)
Burgess and Gaunt (2014) reported a case of peritonitis in a 9-month-old spayed
female Dachshund, which was subjected to surgical removal of a gossypiboma that
had adhered to the hehunum. During reevaluation, ultrasonography revealed
abdominal fluid accumulation, in which intracellular small, ovoid to large segmentally
constricted, rarely branching or budding structures with thin wall were seen. The
organism was identified as Candida albicans.
77
,budding, thin-walled extracellular structures Burgess and Gaunt (2014)
1.3.4.
Oral candidosis
Refai (1986) reported 9 puppies, 1-3 months old with oral inflammation and white
coating of the whole tongue following treatment with antibiotics. Puppies, which
were not treated with antibiotics showed only inflammation at the edges of the tongue.
Cultures from both cases yielded pure colonies of Candida albicans. All puppies
responded to treatment with nystatin suspension 4 times daily for 12-13 days.
Refai et al. (1986) performed an experimental infection of 6 puppies with Candida
albicans. The puppies were divided into 3 groups, each of two animals. The puppies
in group 1were injected i.m. with 10 mg per kg tetracyclin hydrochloride daily for 5
successive days, then the puppies together with those of group 2 were streaked on
their tongues and cheeks with a pure culture of Candida albicans. The puppies in
group 3 were left untreated as contact control. All animals were kept under
observation for one month. Oral lesions appeared only in group 1 seven days post
infection in the form of glossitis and the tongue was covered with a thick creamy
white pseudomembrane, which was easily removed leaving an inflamed surface.
Candida albicans was reisolated from the oral lesions.
.
extensive white coating of the tongue of 2-month-old puppy, following treatment with
chloramphenicol and tetracyclin, Inflammation of the tongue edges through Candida albicans in a 3month-old puppy, which was not treated with antibiotics
78
Mancianti et al. (1992) examined 35 FIV-seropositive cats and 55 FIV-seronegative
matched cats were examined for yeasts (oropharyngeal swabs) and dermatophytes
(hair brushings). The frequency of isolation of Candida albicans and Cryptococcus
neoformans was significantly higher in the former group. The only dermatophyte
isolated was Microsporum canis. Its prevalence was three times higher among FIVinfected cats than among control animals.
Milner et al. (1997) presented a 3-year-old German shepherd dog with a history of
lifelong episodic diarrhoea. An adverse reaction to food was considered the most
likely cause of the diarrhoea. The dog had received prolonged antibiotic therapy for
most of its life as well as receiving probiotics containing the yeast Saccharomyces
cerevisiae (syn. S. boulardi) for a year before referral. The probiotic was discontinued
2 months before to referral. Examination and culture of faecal samples identified
yeast-like organisms, S. cerevisiae and Candida famata. S. cerevisiae has been
isolated from humans in association with predisposing conditions such as prolonged
sojourns in hospital, immunosuppression, broad-spectrum antibiotic therapy and
prosthetic devices, but is regarded as non-pathogenic in humans and is rarely
associated with disease in animals. C. famata has been isolated from animals, humans
and the environment, but is regarded as a very rare pathogen. No evidence of
immunosuppression was found in the dog. The presence of yeasts in the faecal
isolates and the history of prolonged use of antibiotics and probiotics with a
concurrent adverse reaction to food, suggest that conditions may have occurred within
the bowel that made it possible for the yeasts to colonize parts of it. This has
apparently not been reported before.
Jadhav and Pal (2006) cultured oral swabs from 34 dogs showing symptoms of
stomatitis or gingivitis such as anorexia, halitosis, bleeding within the oral cavity,
dysphagia, ptyalism (salivation) and submandibular lymphadenopathy for isolation of
the causative agent. Candida albicans was isolated from four (11.8%) dogs. The
isolates were sensitive to clotrimazole, fluconazole and amphotericin-B but were
resistant to nystatin. The routine application of Pal's sunflower seed medium and
Narayan stain in microbiological laboratories is highly emphasized. It was
recommended that the role of C. albicans, as the etiologic agent of canine stomatitis,
should be carefully investigated in various clinical related disorders of dogs as well as
in other animals.
Biegańska et al. (2014) reviewed the literature data referring to opportunistic
mycoses in pet dogs and cats suffering from other concurrent diseases, comparable to
human medical disorders with high risk of secondary mycoses. The incidence of
opportunistic mycoses is higher in such individuals, mostly because of their impaired
immunity. The main risk factors are primary and secondary types of
immunodeficiency connected with anti-cancer treatment or neoplastic disease itself.
Moreover, literature data and the results of our investigations show that
Candida yeasts are prevalent among diabetic animals and indicate that these fungi are
the main etiological agents of secondary infections of the oral cavity, GI and
urogenital tracts. Other important conditions possibly favoring the development of
mycoses are concurrent infections of cats with FeLV and FIV viruses. Thus, in all
cases of the mentioned underlying diseases, animals should be carefully monitored by
repeated mycological examination, together with inspection of other parameters. Also,
79
the prophylaxis of opportunistic mycoses should be carefully considered alike other
factors influencing the prognosis and the outcome of primary diseases.
Duchaussoy et al. (2015) reported a 3.5 year-old cat suffering from chronic vomiting.
Abdominal ultrasonography revealed a focal, circumferential thickening of the wall of
the duodenum extending from the pylorus aborally for 3 cm, and an enlarged gastric
lymph node. Cytology of fine-needle aspirates of the intestinal mass and lymph node
revealed an eosinophilic inflammatory infiltrate and numerous extracellular septate
acute angle branching fungal-type hyphae. Occasional hyphae had globose terminal
ends, as well as round to oval blastospores and germ tubes. Candida albicans was
cultured from a surgical biopsy of the duodenal mass. No underlying host
immunodeficiencies were identified. Passage of an abrasive intestinal foreign body
was suspected to have caused intestinal mucosal damage resulting in focal intestinal
candidiasis. The cat was treated with a short course of oral itraconazole and all
clinical signs resolved.
Focal circumferential lesion in the proximal duodenum visualised during the exploratory
laparotomy, Duchaussoy et al. (2015).
Cytological preparation of the duodenal mass, modified Wright–Giemsa stain. Note
the presence of visible hyphae (A) and round to oval blastospores and germ tubes of
2–3 µm (B), Duchaussoy et al. (2015)
81
1.3.5. Ocular candidiosis
Gerding et al. (1994) diagnosed a case of ocular and systemic candidiasis in an
immunosuppressed and diabetic 12-year-old cat that initially was examined because
of polyuria, polydipsia, and urinary tract disease. Bilateral recurrent corneal erosions
and chorioretinitis, urinary tract infections attributable to bacteria or Candida sp, and
renal dysfunction developed during the next 2 months. Examination of corneal
scrapings revealed spherical to oval, budding, yeast-like cells. The cat's condition
progressively deteriorated, and it was euthanatized. Toxoplasmosis was diagnosed by
fecal flotation and from serum titers, and pituitary-dependent hyperadrenocorticism
was detected at postmortem histologic evaluation. Candida budding yeasts and
pseudohyphae with blastospores were detected in the corneas, vitreous bodies, retinas,
CNS, pharynx, trachea, esophagus, kidneys, and urinary bladder at postmortem
examination.
Linek (2004) presented a case of mycotic endophthalmitis in the dog caused by
Candida albicans. The 3-year-old dog had a history of bloody diarrhea 3 months
previously. The dog presented with acute signs of unilateral panuveitis.
Aqueocentesis, vitreocentesis, and routine blood tests were performed but did not
contribute to the diagnosis. The posterior segment could not be visualized because of
flare and fibrin. On day 7 ultrasonography showed retinal separation which
progressed to vitreous compartmentalization and abscessation by day 14. Three weeks
after onset, glaucoma developed and enucleation was performed. Histology revealed
the yeast Candida to be the causative agent. Post-enucleation serum Candida
antibody titer was 1 : 640 (human threshold 1 : 120), as determined by agglutination
test. A relapse of enteric signs 3 months later led to the diagnosis of chronic
lymphocytic enteritis. A hematogenous route of infection was suspected.
Enders et al. (2016) described the clinical presentation, diagnosis, histologic lesions,
and outcome of endogenous mycotic endophthalmitis secondary to candiduria in a
three-year-old female spayed Dachshund. The dog was being treated for Evans
syndrome for one month prior to being diagnosed with candiduria and fibrinous
uveitis OS. The left eye was enucleated due to secondary glaucoma, and the fungal
urinary tract infection was treated successfully. Uveitis developed in the contralateral
eye with relapse of the urinary tract infection in the following weeks. The right eye
was medically managed until secondary glaucoma developed and was subsequently
enucleated. Histopathology of both eyes showed evidence of endophthalmitis with
intralesional fungal organisms, consistent with Candida spp. Ocular candidiasis is rare
in dogs. To the authors' knowledge, this is the first report of endogenous mycotic
endophthalmitis with concurrent candiduria in a dog.
1.3.6.
Candida rhinitis
Lamm et al. (2013) reported a
9-year-old female spayed Domestic Medium
Hair cat with a 2-week history of sneezing, which progressed to swelling over the
nasal planum. The cat had been under veterinary care for inflammatory bowel disease
and had been treated with 1.25 mg/kg prednisolone once a day for approximately 1
year. On physical examination, an approximately 2-3 mm diameter, round polypoid
pink soft-tissue mass was protruding slightly from the right nostril. Through
histologic examination of representative sections from the mass, there was a severe
81
diffuse infiltrate of epithelioid macrophages and neutrophils that surrounded frequent
15-20 µm yeast organisms.It was diagnosed as Granulomatous rhinitis. A Grocott
methenamine silver stain revealed the presence of pseudohyphae in addition to the
previously noted yeast forms. Real-time polymerase chain reaction (PCR) for
Cryptococcus neoformans, Ajellomyces dermatitidis (syn. Blastomyces dermatitidis),
Coccidioides immitis, Ajellomyces capsulatus (syn. Histoplasma capsulatum),
Malassezia spp., and Candida spp. was performed on the paraffin-embedded sample.
The PCR for Candida spp. was positive; the product was then sequenced and was
determined to be consistent with Candida parapsilosis. Following the PCR diagnosis
and prior to treatment of the infection, C. parapsilosis was cultured from a nasal swab.
The infection in the cat in the current report was considered opportunistic and
secondary to immunosuppression, following treatment for the inflammatory bowel
disease.
Left:Fungal rhinitis in a cat due to Candida parapsilosis from a rostral nasal mass, marked
infiltrate of macrophages and neutrophils that surround variably pigmented yeast organisms
(arrows). Hematoxylin and eosin. Right:Yeast and pseudohypheal forms (arrows) are
highlighted with a Grocott methenamine silver Lamm et al. (2013)
1.3.7. Candida pericarditis
Mohri et al. (2009) reported a 5-year-old castrated mongrel dog with anorexia and
vomiting. Laboratory testing revealed immune-mediated hemolytic anemia (IMHA),
and so treatment was initiated with multiple immune-suppressing drugs, achieving
partial remission from IMHA. However, cardiac tamponade due to purulent
pericarditis was identified as a secondary disease. Culture of pericardial fluid yielded
numerous Candida albicans and multidrug-resistant Acinetobacter sp.
Pericardiocentesis was performed, and the condition of the dog improved. However,
the dog died the next day
1.3.8. Bronchopulmonary candidosis
Clercx et al. (1996) reported a seven-year-old, female golden retriever with a
paroxysmal, chronic cough and dyspnea, dysphagia, facial pruritus, anterior uveitis,
and deteriorating general condition. A severe, mixed interstitial and alveolar pattern,
with poorly defined amorphous lesions, was seen on thoracic radiographs. Multiple,
whitish nodules disseminated on the hyperemic respiratory mucosa were noted on
bronchoscopy. Escherichia coli and Aspergillus fumigatus were cultured from the
bronchoalveolar lavage. Granulomatous lesions in numerous organs were identified
82
during necropsy, and Aspergillus fumigatus and Candida spp. were cultured from
lung and kidney tissues. Microscopic granulomatous lesions were compatible with
mycotic infection; however fungal organisms were not observed.
1.3.9. Otitis externa
McKellar et al. (1990) reported otitis externa in a foxhound pack associated with
Candida albicans.
1.3.10. Systemic (disseminated ) candidosis
Ehrensaft et al. (1979) injected 14 dogs
intravenously with 107 Candida
albicans. Seven of these animals were rendered leukopenic with cyclophosphamide.
Both groups cleared organisms from the circulation. Normal dogs remained well and
showed no gross or microscopic evidence of candidiasis at autopsy. In contrast,
leukopenic animals died 1-6 days after receiving C. albicans and demonstrated a
consistent picture of disseminated candidiasis. Features of this model similar to
human infection include regular candiduria but only occasional candidemia despite
severe tissue involvement. The reproducibility of this model system provides a basis
for in vivo investigation of systemic fungal disease in the compromised host.
Holøymoen et al. (1982) reported a case of systemic candidiasis (Candida albicans)
in a 1 1/2 year old dog is reported. Clinically, the first manifestation was enlargement
of a superficial inguinal lymph node. Later several peripheral lymph nodes were
affected and a fistulous opening appeared, communicating with an inflammatory
process in the right humerus. Necropsy revealed gross lesions in the kidneys, pancreas
and multiple lymph nodes. In addition, microscopic lesions were observed in the
myocardium and the bone marrow of the right humerus. The lesions, which contained
large fungal colonies, were mainly granulomatous with numerous multinuclear giant
and epitheloid cells, but necrosis and suppuration were also evident. The site of
invasion is not known. However, a previous perianal and abdominal dermatitis, which
was treated locally with antibiotics and corticoids, could possibly have been a mycotic
infection.
Gerding et al. (1994) diagnosed a case of ocular and systemic candidiasis in an
immunosuppressed and diabetic 12-year-old cat that initially was examined because
of polyuria, polydipsia, and urinary tract disease. Bilateral recurrent corneal erosions
and chorioretinitis, urinary tract infections attributable to bacteria or Candida sp, and
renal dysfunction developed during the next 2 months. Examination of corneal
scrapings revealed spherical to oval, budding, yeast-like cells. The cat's condition
progressively deteriorated, and it was euthanatized. Toxoplasmosis was diagnosed by
fecal flotation and from serum titers, and pituitary-dependent hyperadrenocorticism
was detected at postmortem histologic evaluation. Candida budding yeasts and
pseudohyphae with blastospores were detected in the corneas, vitreous bodies, retinas,
CNS, pharynx, trachea, esophagus, kidneys, and urinary bladder at postmortem
examination.
Clercx et al. (1996) reported a seven-year-old, female golden retriever with a
paroxysmal, chronic cough and dyspnea, dysphagia, facial pruritus, anterior uveitis,
and deteriorating general condition. A severe, mixed interstitial and alveolar pattern,
83
with poorly defined amorphous lesions, was seen on thoracic radiographs. Multiple,
whitish nodules disseminated on the hyperemic respiratory mucosa were noted on
bronchoscopy. Escherichia coli and Aspergillus fumigatus were cultured from the
bronchoalveolar lavage. Granulomatous lesions in numerous organs were identified
during necropsy, and Aspergillus fumigatus and Candida spp. were cultured from
lung and kidney tissues. Microscopic granulomatous lesions were compatible with
mycotic infection; however fungal organisms were not observed.
Rodriguez et al. (1998) described a case of intestinal and systemic candidiasis in a
rottweiler puppy which had been infected with canine parvovirus (cpv). A two-and-ahalf-month-old female rottweiler showed depression, anorexia and lethargy followed
by an acute onset of fever (41°C), watery vomitus and bloody diarrhoea. faecal
haemoagglutination test for cpv was positive. Ten days after the onset of clinical signs
the dog died showing intense dehydration and cachexia. Gross lesions were most
pronounced in the duodenum, jejunum and ileum. Tissues from the gastrointestinal
tract, liver, kidney, spleen, mesenteric lymph nodes, heart, lung, brain and urinary
bladder were stained with haematoxylin and eosin, periodic acid-Schiff (PAS) and
Grocott' s methanamine silver (GMS). Branching septate hyphae and pseudohyphae
with small blastospores invading the epithelial lining and lamina propria extended
irregularly to the submucosa and muscular layers. Numerous granulomas were
observed in the peritoneum surrounding the small intestine, liver, spleen andkidneys.
All PAS- and GMS-positive elements within lesions were unequivocally identified as
Candida species as a strong and uniform reactivity was obtained only with a
heterologously
absorbed
Candida-specific
antibody.
Pyogranulomatous
lymphadenitis, splenitis, hepatitis, nephritis, pneumonia and myocarditis were
characterised by nonencapsulated foci in which centres of necrotic cellular debris
were surrounded by a moderate infiltration of neutrophils, macrophages, lymphocytes
and some multinucleated cells. The central areas of the granulomas contained
numerous PAS- and GMS-positive oval to round blastospores mixed with
pseudohyphae comprising chains of elongated yeast-like cells, or with tubular
septated hyphae growing in a radiating pattern and morphologically identical to the
organisms described in the intestine. Invasion of blood vessels and consequent
development of thrombosing vasculitis were observed frequently.
Small intestine. Necrosis of the mucosa and a focus of granulomatous peritonitis. H&Eand eosin x 25,
Rodriguez et al. (1998)
84
Spleen. Necrosis with mycotic proliferation in a lymphoid follicle. PAS, Rodriguez et al. (1998)
Schoeniger (2002) reported a6-year-old, male German shepherd dog suffering from
diarrhoea, vomiting, weight loss, polyuria and polydypsia, and persistent
leukopenia. Reported pertinent clinicopathological data included a CBC consistent
with pancytopenia characterized by neutropenia, monocytopenia, lymphopenia,
thrombo-cytopenia and anemia, and a bone marrow aspirate revealing marked
myeloid hypoplasia and mild erythroid and megakaryocytic hypoplasia. Per clinical
history, the dog was icteric, had elevated liver enzymes (ALT, ALKP and GGT) and a
prolonged activated partial thromboplastin time (PPT). Gross Findings: The carcass
was emaciated, icteric and had multiple petechiae, ecchymotic and/or effusive
hemorrhages within the subcutis, diaphragm, intercostal muscles, lungs, liver,
mesenteric lymph nodes, kidney, urinary bladder, gastric and intestinal mucosa, and
serosa. The gingival mucosa had multiple ulcers measuring 1.0 x 0.5 cm in greatest
dimension. Pleural and abdominal cavities both contained serosanguinous effusions
admixed with fibrin strands. Fibrinous strands covered serosal surfaces of the
diaphragm, lungs, liver, stomach and intestine and caused adherence between the
diaphragm and liver and between intestinal loops. The liver was diffusely yellowgreen, diffusely enlarged and friable with multiple perivascular necrotic foci which
measured 0.3 cm in greatest dimension and were rimmed by hemorrhage. Mesenteric
lymph nodes were diffusely enlarged, dark-red and bulged on cut surface. Renal
cortices were olive green and papillae had orange discoloration. Kidneys contained
multiple acute and subacute, 0.3 cm in diameter cortical infarcts characterized by
wedge-shaped cortical foci which were either red and slightly raised or tan, slightly
depressed and rimmed by hemorrhage. The bone marrow of femur, humerus, several
vertebrae and ribs was diffusely yellow and fatty. Histopathologic findings: Primary
hepatic lesions were multifocal, periportal and centrilobular necrotizing hepatitis and
necrotizing vasculitis. There were numerous intralesional 4-7 µm pseudohyphae and
3-5 µm blastospores. Necrotic foci with similar intralesional pseudohyphae and
blastospores were present within mesenteric lymph nodes. Renal lesions included
multiple septic cortical infarcts characterized by coagulation and liquefactive necrosis,
hemorrhage, infiltration with viable and degenerated neutrophils and numerous
intralesional small, Gram positive, coccoid bacteria. The hypocellular bone marrow
contained primarily adipose connective tissue and hemosiderin-laden
macrophages. There was marked depletion of myeloid precursor cells and mild
85
depletion of erythroid precursor cells and megakaryocytes. Enterococcus spp. was
isolated from liver, kidney and spleen. Candida (Torulopsis) glabrata was isolated
from liver tissue.
Heseltine et al. (2003) described an 11-year-old spayed female Scottish Terrier with
systemic candidiasis. The diagnosis was made on the basis of results of
microbiologic culture of specimens from urine and venous catheters and histologic
examination of tissues obtained post mortem. Factors that predisposed the dog of this
report to systemic candidiasis included diabetes mellitus, corticosteroid and broadspectrum antimicrobial administration, venous and urinary catheterization, and
administration of nutrition parenterally. The development of pyrexia and leukocytosis
in dogs with risk factors that predispose to Candida species infections warrants
evaluation via microbial culture of specimens from urine and vascular catheters used
in those dogs.
Brown et al. (2005) described a systemic Candida spp. infection in a dog with no
obvious underlying deficiency in host resistance. Cytopathology, histopathology,
transmission electron microscopy, and immune-histochemical staining were used to
determine the etiology of the causative agent.
Kuwamura et al. (2006) reported a 4-year-old male Shiba dog initially presented
with pain of an undetermined origin and hypersensitivity to touch. Seven days later,
the dog developed ataxia, hind-leg weakness and knuckling. The dog died on 20 days
after presentation. Postmortem examination revealed a mass in the body of thoracic
vertebra. Histopathologically, the mass consisted of granulomatous inflammation,
including fungal organisms that were immunohistochemically positive for Candida
albicans. Similar granulomatous lesions were observed in the systemic lymph nodes,
kidneys, pancreas, spleen, prostate gland, thyroid glands and heart. This case was
diagnosed as systemic candidiasis with spondylitis.
Recai et al. (2006) described the clinical course, cultural and pathological findings of
systemic candidiasis in 3 dogs. Pathologically, pyogranulomatous lesions in various
organs were present in all dogs. Blastospores, pseudohyphae, and true hyphae of
Candida albicans were observed with periodic acid Schiff, Gomori’s methenamine
silver, and immunohistochemistry. Administrations of broad-spectrum antibiotics and
corticosteroids and, in one dog, parvoviral infection were thought to be predisposing
factors leading to opportunistic infection. The combined effect of
immunosuppressants and antibiotics might have led to Candida colonization and
dissemination in these dogs
86
Recai et al. (2006)
87
Recai et al. (2006)
Khosravi et al. (2009) reported the mycological and histopathological findings of
experimental disseminated candidiasis in dogs. The dogs were immunosuppressed
by intravenous administration of cyclophosphamide and after 5 days, they were
challenged with 1 × 105 blastospores of C. albicans by intravenous injection. Both
mycological and histopathological examinations were performed for detection of
Candida in various tissues. The results showed that the highest counts of C. albicans
were recovered from the lungs, followed by the kidneys, heart and liver on day 2 after
challenge. The presence of yeast mixed with hyphal forms of C. albicans was
confirmed in all tissues. In most tissues, the yeast cells of Candida were predominant,
whereas hyphal forms, particularly true hyphae, were mostly found in the brain and
eyes.
Left:Colonization of numerous yeast cells along with pseudohyphae in glomerular tufts of
kidney. Right: yeast cells along with pseudohyphae in muscular fibers of the myocardium,
Khosravi et al. (2009)
Numerous true hyphae of C. albicans in retina of the eye, Khosravi et al. (2009)
88
Matsuda et al. (2009) reported a 5-year-old female miniature dachshund presenting
with persistent vomiting and diarrhea. The dog had two concurrent rare pathological
conditions: systemic candidiasis and mesenteric mast cell tumor with multiorgan
metastases. Neoplastic mast cells formed mass in the mesentery of the cecal-colonic
region and were also found in the liver, spleen, kidneys, lungs, adrenal grands,
ovaries, bone marrow and other tissues. The cells had intracytoplasmic granules with
metachromasia and were immunohistochemically positive for c-kit and histamine.
Granulomatous lesions with fungal organisms were present in the heart, lungs,
kidneys, pancreas, subserosal and surrounding adipose tissue of the duodenum,
thyroid glands and mesenteric mass, and phagocytosed organisms were detected in the
liver and bone marrow. Bacteriologically and immunohistochemically, the fungi were
consistent with Candida albicans.
Rogers et al. (2009) identified fungal sepsis was in a 2-year-old dog following
intestinal dehiscence 4 days after abdominal surgery. Septic peritonitis was identified
at admission and evidence of dehiscence at the previous enterotomy site was found
during an exploratory laparotomy. Both Gram-positive cocci and Candida albicans
were cultured from the abdominal cavity. Candida sp. was also subsequently cultured
from a central venous catheter. Euthanasia was performed due to failure to respond to
therapy. Fungal organisms, morphologically consistent with Candida spp., were found
in the lungs and kidney on postmortem histopathologic examination indicating
disseminated candidiasis.
A section of kidney showing PAS-positive oval, 5–6 μm, budding yeast-like cells (blastoconidia) (arrows)
and segmentally constricted pseudohyphae (arrowheads) within the renal papilla. There are multifocal
regions of necrosis (*) (400 × magnification, scale bar=40 μm), Rogers et al. (2009).
Gershenson et al. (2011) presented a 2 yr old spayed female German shepherd with
a chief complaint of acute onset paraparesis and weight loss. At presentation, the dog
was pyrexic, nonambulatory, and had generalized muscle wasting. Neurolocalization
was consistent with a thoracolumbar spinal cord lesion. An abdominal ultrasound was
performed and revealed a focal dilation (4 cm) of the terminal aorta with evidence of
blood stasis consistent with an aortic aneurysm. The dog was euthanized shortly after
admission to the hospital and a post mortem examination was performed. Fungal
organisms were identified in the aortic aneurysm as well as from the thoracic
vertebrae, mesenteric lymph nodes, axillary lymph nodes, spleen, kidneys, liver,
89
lungs, and heart. Although the morphology was consistent with Candida spp.,
immunohistochemistry and PCR could not definitively identify the causative
organism.
Skoric et al. (2011) reported Candida albicans as the aetiological agent of multisystemic infections in dogs. A two year-old female Hovawart dog was presented with
marked alteration in its health condition characterised by weakness, fever, anorexia,
abdominal pain, cachexy and generalized lymphadenopathy. A radiograph of the
abdominal cavity showed several non-specific nodular lesions in the mesentery,
ranging in size up to 10 cm in diameter. At necropsy, extensive enlargement of lymph
nodes and the presence of numerous whitish to grey nodules of different sizes in
several organs were evident. Histopathological examination revealed
pyogranulomatous inflammation characterized by large areas of necrosis surrounded
by neutrophilic granulocytes, macrophages, multinucleated giant cells, and a variable
admixture of lymphocytes and fungi-like organisms in in all affected organs.
Numerous branching hyphae, subsequently identified by mycological cultivation as
Candida albicans, were observed. A periodic acid Schiff (PAS) reaction to prove the
presence of fungi in tissues was positive. Examination of tissue samples of affected
organs using polymerase chain reaction (quantitative Real-Time PCR) and
cultivation was negative for the presence of all members of the Mycobacterium
tuberculosis complex
.
Left:Markedly enlarged mediastinal lymph nodes with necrotic focci on the cut section,
Right: Multiple whitish pyogranulomas in the mesentry and lymph nodes, Skoric et al.
(2011)
91
PAS positive hyphae of C. albicans in central necrosis of the pyogranuloma, Skoric et al.
(2011)
1.4.
Reports on molecular studies of Canida species isolated from
dogs and cats
Edelmann et al. (2005) analyzed Candida albicans isolates from different human and
animal individuals by Ca3 fingerprinting. They obtained no evidence for hostspecific genotypes and for the existence of species-specific lineages, even though a
certain degree of separation between human and animal isolates was found.
Therefore, animals could potentially serve as reservoirs for human Candida infection..
Ca3 fingerprints of Candia albicans isolates. EcoRI-digested genomic DNA from eight animal and
human C. albicans isolates was subjected to Southern blot analysis applying a digoxigenin-labeled Ca3
91
sequence. DNA from C. albicans strain 3153A (13) was included as a molecular weight and band
intensity standard. Edelmann et al. (2005)
Ozawa et al. (2005) identified an isolate from urine of 10-year-old male Shih Tzu dog
(7.0 kg) with cystitis molecularly as Candida tropicalis and determined its minimum
inhibitory concentration (MIC) by a microdilution method. The 25S ribosomal DNA
sequence analysis indicated that the clinical isolate was essentially identical to that of
C. tropicalis and distinct from other Candida species. The MIC(50) and the MIC(90)
of fluconazole (FLZ) for the clinical isolate of C. tropicalis was 6.25 and 25
microg/ml, respectively, indicating that susceptibility of the clinical isolate of C.
tropicalis to FLZ was less than for other strains of C. tropicalis as well as C. albicans.
The molecular analysis as presented in this study assisted the diagnosis
of candidiasis by identifying the yeasts in urine samples within 2 days. The patient
dog, was successfully treated with itraconazole.
Brito et al. (2009) used PCR amplification followed by agarose gel electrophoresis
(PCR-AGE) and the manual method (morphological characteristics, biochemical
profiles and culturing on CHROMagar-Candida) and VITEK 2 automated method to
test a total of 30 fungal strains from dog sources. The strains were obtained from
cases of dermatitis, otitis externa and from the ears, oral mucosa, vaginal mucosa,
prepuce and perianal region of clinically normal dogs. After identification as Candida
yeasts by the manual method, the strains were analyzed using both VITEK and PCRAGE methods. Isolates of C. parapsilosis ATCC 22019, C. krusei ATCC 6258 and C.
albicans ATCC 10231 were included as controls. The universal primers ITS1, ITS3
and ITS4 were used in two independent PCR reactions. Of 30 yeast isolates, 3 isolates
(Saccharomyces cerevisiae, C. rugosa and C. parapsilosis) that were incompletely
identified by the manual method were identified with the PCR-AGE and VITEK
methods. The results revealed a 96.7% and 86.7% concurrent identification between
the PCR-AGE and VITEK methods versus the manual method, respectively. PCRAGE showed a greater level of concordance with the manual method, besides being
faster and more sensitive than the other methods examined, and is therefore indicated
for routine diagnostic testing of Candida spp. strains from veterinary sources.
Brilhante et al. (2014) performed a study to identify strains of the Candida
parapsilosis complex isolated from animals. They used 28 isolates of C. parapsilosis
sensu lato recovered from clinically healthy animals (15 dogs, 10 psittacines
(granivorous/frugivorous birds), two raptors (carnivorous birds) and one
Macrobrachium amazonicum prawn). The strains were characterized phenotypically,
followed by molecular identification of the species through PCR-restriction enzyme
analysis. Molecular identification of the C. parapsilosis strains was performed
according to the protocol defined by Tavanti et al. (2005), using primers S1F (5′GTTGATGCTGTTGGATTGT-3′) and S1R (5′-CAATGCCAAATCTCCCAA-3′) for
amplification of the partial sequence (716 nt) of the gene that encodes the secondary
alcohol dehydrogenase (SADH). The amplified DNA was subsequently digested for
90 min with the BanI enzyme (New England Biolabs). The digestion products were
submitted to electrophoresis on 2 % (w/v) TAE/agarose gel containing ethidium
bromide (0.05 µg ml −1) and were then visualized with a transilluminator. The results
obtained were compared with the digestion patterns of the control strains C.
parapsilosis ATCC 22019, C. orthopsilosis ATCC 96139 and C. metapsilosis ATCC
92
96143. Molecular analysis showed 13 C. parapsilosis sensu stricto, 10 Candida
orthopsilosis and five Candida metapsilosis strains. In vitro resistance to fluconazole
was observed in three strains of C. parapsilosis sensu stricto and two C. metapsilosis.
Classification of isolates using PCR and restriction enzyme analysis. (a) Representative gel confirming
the identity of the strains as part of the C. parapsilosis complex (strains 1–8). (b) Digestion with BanI
allowing species classification: C. parapsilosis sensu stricto, 550–600 and 200 nt (strains 1, 2, 3, 4, 7
and 8); C. metapsilosis, 400 and 200 nt (strains 5 and 6). CN, negative control; M, molecular marker.
Brilhante et al. (2014)
1.5.
Diagnosis of candidosis
Direct microscopic examination of 10-40% KOH preparation or stained films by
Gram, Giemsa, Parker’s ink, calcofluor or methylene blue etc.
Isolation and identification
Samples are inoculated on Kimmig , Sabouraud dextrose , blood , Czapek Dox agar
or chromogenic agar , incubated at 370C and 25oC for 2-3 days.
On Sabouraud dextrose agar, C. albicans develops within 24-48 h raised, creamy,
opaque colonies of 1-2 mm in diameter. After several days of incubation, the colonies
93
show radiating outgrowths penetrating the medium. C. albicans is capable of
producing yeast cells, pseudohyphae, true hyphae and chlamydospores. For germ tube
testing a suspension of the suspected colony is made in 0.5 ml serum, incubated for 24 h at 370C and examined microscopically for the development of germ tubes, which
extend from the cell without septum or constriction. After 72 h at 250C the inoculated
plates are examined for pseudohyphae and chlamydoconidia.
C. albicans colonies Germ tubes
Rice agar
Pseudohyphae, chlamydospores
Fermentation and assimilation of sugars are done by the conventional methods or
by the use of commercial kits
Serological diagnosis of candidosis
Many serological tests using soluble cytoplasmic antigen of Candida albicans cells are
used for detection of antibodies in the serum of patients suspected to be infected with
Candida albicans. Because of the ubiquitous nature of Candida species , these
serologic tests are limited in discriminating between normal and disease levels of
94
antibodies. More specific tests are used for detection of circulating C. albicans surface
antigens and cytoplasmic proteins. Serological tests commonly
1.6.
Antifungal sensitivity and Treatment
Chan and Balish (1978) assessed the effect of Gram-negative sepsis (Escherichia
coli) on the capacity of polymorphonuclear leucocytes (PMN) to phagocytize and kill
Candida albicans. The PMN's from septic dogs phagocytized C. albicans as well as
PMN's from non-septic dogs. The PMN's from septic dogs that phagocytized C.
albicans underwent a spontaneous lysis at a much higher rate than PMN's from nonseptic dogs. A functional difference in PMN's from normal and septic dogs was
indicated.
Ruthe et al. (1978) designed an experimental canine model was designed to evaluate
the effect of granulocyte transfusions on systemic infection with Candida albicans in
the granulocytopenic host. Each of a pair of dogs was rendered granulocytopenic with
a single intravenous (i.v.) dose of cyclophosphamide (50 mg/kg body weight) and
challenged with 10(6) Candida albicans organisms administered i.v. when granulocyte
counts were less than or equal to 500/mm3. Granulocytes procured by leukofiltration
were infused into six experimental dogs 1, 24, 48, and 72 hr after challenge with
Candida. An average of 13 +/- 1.3 X 10(9) granulocytes were administered per
infusion, producing an average 1-hr increment of 588 +/- 146 granulocytes/mm3 over
the pretransfusion granulocyte count. Experimental and control dogs were killed 96 hr
after challenge and organs examined grossly and by quantitative culture techniques to
measure the extent of infection. All animals receiving granulocyte transfusions had
significantly less tissue infection than nontransfused controls (p less than 0.05). It was
concluded that granulocyte transfusions are effective in reducing the severity of
infection by Candida albicans during periods of leukopenia.
Weber et al. (1985) evaluated the activity of ketoconazole in neutropenic dogs with
systemic candidiasis. Five dog pairs were made neutropenic by intravenous
cyclophosphamide (50 mg/kg) and challenged with either 10(6) or 10(7) colonyforming units (CFU) of Candida albicans. Half of the dogs received ketoconazole (10
mg/kg) daily beginning 24 h after challenge. All were killed at 96 h and liver, spleen,
and kidney were cultured. Of four dogs given 10(6) CFU, two untreated dogs had 9 X
10(3) to 1 X 10(5) CFU/g wet tissue, compared to 0 CFU in ketoconazoletreated dogs. With inoculum increased to 10(7) CFU, three untreated dogs had 2 X
10(4) to 3 X 10(5) CFU/g wet tissue, while three ketoconazole dogs had 0-5 X 10(3)
CFU/g wet tissue. The effect of ketoconazole on autologous marrow reconstitution
in dogs with systemic candidiasis was examined by infusing autologous
cryopreserved marrow into four dogs one day after lethal whole body irradiation (800
rad). Once neutropenic, they were challenged with 10(7) CFU of C. albicans.
Two dogs received no ketoconazole and died of disseminated candidiasis, without
marrow reconstitution. Two dogs received ketoconazole for 25 days. Prompt marrow
recovery occurred and they remained healthy. There was no evidence of infection at
death. These studies quantitatively demonstrated the in vivo effectiveness of
ketoconazole in reducing tissue infection with C. albicans in neutropenic dogs.
Fulton et al. (1992) diagnosed a case of Candida albicans urocystitis secondary to
urethral stricture and administration of antibiotics was diagnosed in a cat by fungal
95
culturing of urine and examination of specimens. Surgical repair of the stricture and
administration of 5-fluorocytosine resulted in resolution of the cystitis. Related
problems included anorexia and severe weight loss, which necessitated enteral
nutritional support, dehydration, renal disease, and nosocomial Pseudomonas
aeruginosa urocystitis.
Forward et al. (2002) used intermittent bladder infusion with clotrimazole for
treatment of candiduria in a dog
Ozawa et al. (2005) identified an isolate from urine of 10-year-old male Shih Tzu dog
(7.0 kg) with cystitis molecularly as Candida tropicalis and determined its minimum
inhibitory concentration (MIC) by a microdilution method. The 25S ribosomal DNA
sequence analysis indicated that the clinical isolate was essentially identical to that of
C. tropicalis and distinct from other Candida species. The MIC(50) and the MIC(90)
of fluconazole (FLZ) for the clinical isolate of C. tropicalis was 6.25 and 25
microg/ml, respectively, indicating that susceptibility of the clinical isolate of C.
tropicalis to FLZ was less than for other strains of C. tropicalis as well as C. albicans.
The molecular analysis as presented in this study assisted the diagnosis
of candidiasis by identifying the yeasts in urine samples within 2 days. The patient
dog, was successfully treated with itraconazole.
Cleff et al. (2011) evaluated the in vitro activity of the essential oil extracted from
Origanum vulgare against sixteen Candida species isolates. Standard strains tested
comprised C. albicans (ATCC strains 44858, 4053, 18804 and 3691), C. parapsilosis
(ATCC 22019), C. krusei (ATCC 34135), C. lusitaniae (ATCC 34449) and C.
dubliniensis (ATCC MY646). Six Candida albicans isolates from the vaginal mucous
membrane of female dogs, one isolate from the cutaneous tegument of a dog and one
isolate of a capuchin monkey were tested in parallel. A broth microdilution technique
(CLSI) was used, and the inoculum concentration was adjusted to 5 x 10(6) CFU
mL(-1). The essential oil was obtained by hydro-distillation in a Clevenger apparatus
and analyzed by gas chromatography. Susceptibility was expressed as Minimal
Inhibitory Concentration (MIC) and Minimal Fungicidal Concentration (MFC). All
isolates tested in vitro were sensitive to O. vulgare essential oil. The chromatographic
analysis revealed that the main compounds present in the essential oil were 4terpineol (47.95%), carvacrol (9.42%), thymol (8.42%) and terpineol (7.57%). C.
albicans isolates obtained from animal mucous membranes exhibited MIC and MFC
values of 2.72 μL mL(-1) and 5 μL mL(-1), respectively. MIC and MFC values for C.
albicans standard strains were 2.97 μL mL(-1) and 3.54 μL mL(-1), respectively. The
MIC and MFC for non-albicans species were 2.10 μL mL(-1) and 2.97 μL mL(-1),
respectively. The antifungal activity of O. vulgare essential oil against Candida spp.
observed in vitro suggests its administration may represent an alternative treatment
for candidiasis.
Yurayart et al. (2013) determined and compared the susceptibility levels of yeasts
isolated from dogs with and without seborrheic dermatitis (SD) using the disk
diffusion method (DD) for itraconazole (ITZ), ketoconazole (KTZ), nystatin (NYS),
terbinafine (TERB) and 5-fluorocytosine (5-FC) and the broth microdilution method
(BMD) for ITZ and KTZ. The reliability between the methods was assessed using an
agreement analysis and linear regression. 28 C. parapsilosis isolates were identified
based on physiological characteristics and an approved molecular analysis. Only 46 60% of the tested C. parapsilosis isolates were susceptible to KTZ, TERB and 5-FC,
but ITZ and NYS were effective against all. The frequency of KTZ- and ITZ-resistant
96
C. parapsilosis was 29% and 7%, and the MIC90 values were 1 μg/ml and 0.5-1
μg/ml, respectively. Regarding the agreement analysis 0.2-1% of very major errors
occurred among C. parapsilosis. There were no significant differences in the yeast
resistance rates between dogs with and without SD and a high rate of KTZ resistant
was reported in C. parapsilosis.
Brilhante et al. (2014) performed a study to assess their in vitro antifungal
susceptibility profile and in vitro production of virulence attributes. They used 28
isolates of C. parapsilosis sensu lato recovered from clinically healthy animals (15
dogs, 10 psittacines (granivorous/frugivorous birds), two raptors (carnivorous birds)
and one Macrobrachium amazonicum prawn). The strains were characterized
phenotypically, followed by molecular identification of the species through PCRrestriction enzyme analysis. The susceptibility of the strains to amphotericin B,
itraconazole, voriconazole, fluconazole and caspofungin was assessed through broth
microdilution. The results of the susceptibility tests indicated that the MIC range was
0.125–1 µg ml −1 for AMB, 0.03125–0.5 µg ml −1 for ITC, 0.03125–0.125 µg
ml −1 for VRC, 0.5–16 µg ml −1 for FLC and 0.0625–2 µg ml −1 for CAS. Resistance
to fluconazole was observed against three strains of C. parapsilosis sensu stricto and
two of C. metapsilosis, whilst high MICs (2 µg ml −1) were observed for caspofungin
against one strain of C. parapsilosis sensu stricto and five of C. orthopsilosis.
Álvarez-Pérez et al. (2016) reported multi-azole resistance acquisition by Candida
tropicalis after prolonged antifungal therapy in a dog with urinary candidiasis. Preand post-azole treatment isolates were clonally related and had identical silent
mutations in the ERG11 gene, but the latter displayed increased azole minimum
inhibitory concentrations. A novel frameshift mutation in ERG3 was found in some
isolates recovered after resistance development, so it appears unlikely that this
mutation is responsible for multi-azole resistance.
References
1. Álvarez-Pérez S , García ME , Cutuli MT , Fermín ML , Daza MÁ, Peláez T , Blanco
JL. Acquired multi-azole resistance in Candida tropicalis during persistent urinary
tract infection in a dog. Med Mycol Case Rep. 2016 Feb 2;11:9-12.
2. Biegańska M, Dardzińska W, Dworecka-Kaszak B. Fungal colonization - an
additional risk factor for diseased dogs and cats? Ann Parasitol. 2014;60(3):139-46.
3. Bradford K , Meinkoth J, McKeirnen K, Love B. Candida peritonitis in dogs:
report of 5 cases. Vet Clin Pathol. 2013 Jun;42(2):227-33
4. Brilhante RS , de Jesus Santos Rodrigues T , de Souza Collares Maia CasteloBranco D, Teixeira CE , de Brito Macedo R , Bandeira SP , Pereira de Alencar L
, Monteiro AJ , de Aguiar Cordeiro R , de Jesus Pinheiro Gomes Bandeira T
, Moreira JL , Sidrim JJ , Rocha MF. Antifungal susceptibility and virulence
attributes of animal-derived isolates of Candida parapsilosis complex. J Med
Microbiol. 2014 Nov;63(Pt 11):1568-72
5. Brito EH , Brilhante RS, Cordeiro RA, Sidrim JJ, Fontenelle RO, Melo
LM, Albuquerque ES, Rocha MF. PCR-AGE, automated and manual methods to
identify Candida strains from veterinary sources: a comparative approach. Vet
Microbiol. 2009 Nov 18;139(3-4):318-22
97
6. Brown MR, Thompson CA, Mohamed FM. Systemic candidiasis in an apparently
immunocompetent dog. J Vet Diagn Invest. 2005 May;17(3):272-6.
7. Burgess HJ, Gaunt MC. Pathology in practice. Peritonitis caused by C albicans
infection in a dog.J Am Vet Med Assoc. 2014 Nov 15;245(10):1107-9.
8. Chan CK, Balish E. Postbacterial sepsis and disseminated candidiasis. Can J
Microbiol. 1978 Aug;24(8):904-8.
9. Cleff MB , Meinerz AR, Xavier M, Schuch LF, Schuch LF, Araújo Meireles
MC, Alves Rodrigues MR, de Mello JR. In vitro activity of origanum vulgare
essential oil against candida species. Braz J Microbiol. 2010 Jan;41(1):116-23.
10. Clercx C , McEntee K, Snaps F, Jacquinet E, Coignoul F. Bronchopulmonary and
disseminated granulomatous disease associated with Aspergillus fumigatus and
Candida species infection in a golden retriever. J Am Anim Hosp Assoc. 1996 MarApr;32(2):139-45.
11. Dale JE. Canine dermatosis caused by Candida parapsilosis. Vet Med Small Animal
Clinical 1972; 67: 548-549.
12. Duchaussoy ,A-C., Annie Rose , Jessica J. Talbot , Vanessa R. Barrs.
Gastrointestinal granuloma due to Candida albicans in an immunocompetent cat.
Medical Mycology Case Reports. Volume 10, December 2015, Pages 14–17
13. Edelmann A, Krüger M, Schmid J. Genetic relationship between human and animal
isolates of Candida albicans. J Clin Microbiol. 2005 Dec;43(12):6164-6.
14. Ehrensaft DV, Epstein RB, Sarpel S, Andersen BR. Disseminated candidiasis in
leukopenic dogs. Proc Soc Exp Biol Med. 1979 Jan;160(1):6-10.
15. Enders, A., van der Woerdt, A. and Donovan, T. (2016), Endogenous mycotic
endophthalmitis in a dog with candiduria and Evans syndrome. Veterinary
Ophthalmology. doi: 10.1111/vop.12373
16. Forward ZA, Legendre AM, Khalsa HD. Use of intermittent bladder infusion with
clotrimazole for treatment of candiduria in a dog. J Am Vet Med Assoc. 2002 May
15;220(10):1496-8, 1474-5.
17. Fulton RB Jr , Walker RD. Candida albicans urocystitis in a cat. J Am Vet Med
Assoc. 1992 Feb 15;200(4):524-6.
18. Gerding PA Jr , Morton LD, Dye JA. Ocular and disseminated candidiasis in an
immunosuppressed cat. J Am Vet Med Assoc. 1994 May 15;204(10):1635-8.
19. Gershenson RT , Melidone R, Sutherland-Smith J, Rogers CL. Abdominal aortic
aneurysm associated with systemic fungal infection in a German shepherd dog. J Am
Anim Hosp Assoc. 2011 Jan-Feb;47(1):45-9
20. GLIŃSKA ,K., Marcin JANKOWSK , Krzysztof KUBIAK , Jolanta SPUŻAK ,
Maciej GRZEGORY , Stanisław DZIMIRA. Fungal peritonitis in dog caused by
Candida albicans – a case report and literature overview. Turk J Vet Anim Sci (2013)
37: 482-485
21. Heseltine JC , Panciera DL, Saunders GK. Systemic candidiasis in a dog. J Am Vet
Med Assoc. 2003 Sep 15;223(6):821-4, 810.
22. Holøymoen JI, Bjerkås I, Olberg IH, Mork AV. Disseminated candidiasis
(moniliasis) in a dog. A case report. Nord Vet Med. 1982 Oct;34(10):362-7.
23. Jadhav VJ , Pal M. Canine mycotic stomatitis due to Candida albicans. Rev Iberoam
Micol. 2006 Dec;23(4):233-4.
24. Jin Y , Lin D. Fungal urinary tract infections in the dog and cat: a retrospective study
(2001-2004). J Am Anim Hosp Assoc. 2005 Nov-Dec;41(6):373-81.
25. Kadota, K. Uchida, T. Nagatomo et al., “Granulomatous epididymitis related
to Rhodotorula glutinisinfection in a dog,” Veterinary Pathology, vol. 32, no. 6, pp.
716–718, 1995.
26. Kano R, Hattori Y, Okuzumi K, Miyazaki Y, Yamauchi R, Koie H, Watari
T, Hasegawa A. Detection and identification of the Candida species by 25S ribosomal
DNA analysis in the urine of candidal cystitis. J Vet Med Sci. 2002 Feb;64(2):115-7.
98
27. KRAL F, USCAVAGE JP. Cutaneous candidiasis in a dog. J Am Vet Med
Assoc. 1960 Jun 15;136:612-5.
28. Khosravi, A. R.; Mardjanmehr, H.; Shokri, H.; Naghshineh, R.; Rostamibashman, M.
and Naseri, A. Mycological and histopathological findings of experimental
disseminated candidiasis in dogs. Iranian Journal of Veterinary Research, Shiraz
University, Vol. 10, No. 3, Ser. No. 28, 2009
29. Kuwamura M , Ide M, Yamate J, Shiraishi Y, Kotani T. Systemic candidiasis in a
dog, developing spondylitis. J Vet Med Sci. 2006 Oct;68(10):1117-9.
30. Lamm CG , Grune SC, Estrada MM, McIlwain MB, Leutenegger CM.
Granulomatous rhinitis due to Candida parapsilosis in a cat. J Vet Diagn Invest. 2013
Sep;25(5):596-8.
31. Lee HA , Hong S, Choe O, Kim O. Mural folliculitis and alopecia with cutaneous
candidiasis in a beagle dog. Lab Anim Res. 2011 Mar;27(1):63-5.
32. Lorenzini R, De Bernardis F. Antemortem diagnosis of an apparent case of
feline candidiasis. Mycopathologia. 1986 Jan;93(1):13-4.
33. McCaw D, Franklin R, Fales W, Stockham S, Lattimer J. Pyothorax caused by
Candida albicans in a cat.J Am Vet Med Assoc. 1984 Aug 1;185(3):311-2. No
abstract available.
34. McKellar QA, Rycroft A, Anderson L, Love J. Otitis externa in a foxhound pack
associated with Candida albicans. Vet Rec. 1990 Jul 7;127(1):15-6.
35. Matsuda K, Sakaguchi K, Kobayashi S, Tominaga M, Hirayama K, Kadosawa
T, Taniyama H. Systemic candidiasis and mesenteric mast cell tumor with multiple
metastases in a dog. J Vet Med Sci. 2009 Feb;71(2):229-32.
36. Milner RJ, Picard J, Tustin R. Chronic episodic diarrhoea associated with apparent
intestinal colonisation by the yeasts Saccharomyces cerevisiae and Candida famata in
a German shepherd dog. J S Afr Vet Assoc. 1997 Dec;68(4):147-9.
37. Mohri T, Takashima K, Yamane T, Sato H, Yamane Y. Purulent pericarditis in a
dog administered immune-suppressing drugs. J Vet Med Sci. 2009 May;71(5):66972
38. Moretti A , Posteraro B, Boncio L, Mechelli L, De Gasperis E, Agnetti F, Raspa M.
Diffuse cutaneous candidiasis in a dog. Diagnosis by PCR-REA. Rev Iberoam
Micol. 2004 Sep;21(3):139-42.
39. Mueller, R.S., S. V. BETTENAY,M. SHIPSTONE. Cutaneous candidiasis in a dog
caused by Candida guilliermondii.Vet. Rec. 150, 728-730, 2002
40. Ochiai K, Valentine BA, Altschul M. Intestinal candidiasis in a dog. Vet Rec. 2000
Feb 19;146(8):228-9.
41. Ong, R. K. C., Raisis, A. L. and Swindells, K. L. (2010), Candida albicans peritonitis
in a dog. Journal of Veterinary Emergency and Critical Care, 20: 143–147.
42. Ozawa H, Okabayashi K, Kano R, Watari T, Watanabe S, Hasegawa A.Rapid
identification of Candida tropicalis from canine cystitis.Mycopathologia. 2005
Sep;160(2):159-62.
43. Palmer MA, Bornside GH, Nance FC. Sepsis-induced depression of phagocytosis in
experimental canine peritonitis. Am Surg. 1982 Oct;48(10):520-4.
44. Pressler BM, Vaden SL, Lane IF, Cowgill LD, Dye JA. Candida spp. urinary tract
infections in 13 dogs and seven cats: predisposing factors, treatment, and outcome. J
Am Anim Hosp Assoc. 2003 May-Jun;39(3):263-70.
45. Recai TUNCA , Tolga GÜVENÇ, R›fk› HAZIRO⁄LU , Lale ATASEVEN , Hasan
ÖZEN1 , Nihat TOPLU. Pathological and Immunohistochemical Investigation of
Naturally Occurring Systemic Candida albicans Infection in Dogs. Turk. J. Vet.
Anim. Sci. 30 (2006) 545-551
46. Refai, M. : Zungensoor bei jungen Hunden. Pilzdialog 3, 55 (1986)
47. Refai, M., M. Abdel-Haleem, R. M. Arab and H. M. Youssef. Studies on oral
candidosis in puppies. Vet. Med. J. 34, 2, 73-79, 1986
99
48. Rodriguez, F., Fernandez, A., Espinosa de los Monteros, A., Wohlsein, P., Jensen,
H.E.: Acute disseminated candidiasis in a
puppy associated with parvoviral infection. Vet. Rec., 1998; 142:434-436.
49. Rogers CL , Gibson C, Mitchell SL, Keating JH, Rozanski EA. Disseminated
candidiasis secondary to fungal and bacterial peritonitis in a young dog. J Vet Emerg
Crit Care (San Antonio). 2009 Apr;19(2):193-8.
50. Ruthe RC, Andersen BR, Cunningham BL, Epstein RB. Efficacy of granulocyte
transfusions in the control of systemic candidiasis in the leukopenic host. Blood. 1978
Sep;52(3):493-8.
51. Schoeniger , S. FINAL DIAGNOSIS Candida fungemial, Enterococcus septicemia,
Bone marrow aplasia,
https://www.addl.purdue.edu/newsletters/2002/summer/finaldx.shtml
52. Skoric, M., P. Fictum , I. Slana , P. Kriz , I. Pavlik. A case of systemic mycosis in
a Hovawart dog due to Candida albicans. Veterinarni Medicina, 56, 2011 (5): 260–
264
53. Toll J, Ashe CM, Trepanier LA. Intravesicular administration of clotrimazole for
treatment of candiduria in a cat with diabetes mellitus. J Am Vet Med Assoc. 2003
Oct 15;223(8):1156-8, 1129.
54. Yurayart C , Nuchnoul N, Moolkum P, Jirasuksiri S, Niyomtham W, Chindamporn
A, Kajiwara S, Prapasarakul N. Antifungal agent susceptibilities and interpretation of
Malassezia pachydermatis and Candida parapsilosis isolated from dogs with and
without seborrheic dermatitis skin. Med Mycol. 2013 Oct;51(7):721-30.
55. Waurzyniak BJ, Hoover JP, Clinkenbeard KD, Welsh RD. Dual systemic mycosis
caused by Bipolaris spicifera and Torulopsis glabrata in a dog.Vet Pathol. 1992
Nov;29(6):566-9.
56. Weber MJ, Keppen M, Gawith KE, Epstein RB. Treatment of systemic candidiasis in
neutropenic dogs with ketoconazole. Exp Hematol. 1985 Sep;13(8):791-5.
2. Cryptococcosis in cats and dogs
2.1.
Introduction
Cryptococcosis is the most common systemic fungal disease in cats
worldwide. Infections with Cryptococcus species may also occur in several
other mammalian species, including dogs.
Cryptococcosis in cats and dogs is caused by Cryptococcus neoformans and
Cryptococcus gattii.
The environmental reservoir of C neoformans is usually related to bird
faeces, particularly pigeon droppings. However, this yeast has also been found
in decaying trees, wood and plant debris, waterways and soil, all usually
contaminated with bird excrement.
The epidemiology of clinical disease depends largely on the species of
infecting organism. Cryptococcus neoformans var. grubii (serotype A) and C.
neoformans var. neoformans (serotype D) are globally distributed and infect
predominantly immunocompromised hosts. Cryptococcus gattii (serotypes B
and C) has recently been recognized as a species distinct from C.
neoformans based on molecular and mating type characteristics .
The primary route of infection in cats and dogs is the nasal cavity, although,
more rarely, transmission can also occur via cutaneous inoculation of fungal
forms. The incubation period varies from months to years, with the source of
infection often remaining unknown.
111
2.2.
The most frequent clinical manifestation of cats and dogs cryptococcosis is
associated with the nasal form, but the disease can occur in several other
distinct clinical forms, with involvement of the central nervous system (CNS),
ocular, cutaneous, lymph nodes, and even pulmonary, abdominal and
periarticular connective tissues.3,4 Ocular lesions are a common manifestation
of systemic cryptococcosis (observed in about one-third of clinical cases),
primarily manifesting as multifocal chorioretinitis.
A definitive diagnosis of cryptococcosis can be established using cytological
examination, serology for the detection of antibodies (cryptococcal antigen
latex agglutination test), fungal culture, histopathology and PCR. allows
identification of the implicated species and genotype.
The treatment of cryptococcosis in cats and dogs usually combines surgical
excision of localised granulomas and administration of antifungal azole drugs,
such as fluconazole, itraconazole and ketoconazole. However, cats with CNS
infection and/or systemic disease often need treatment with amphotericin B
plus flucytosine. Therapy should be maintained until at least 2–4 months after
the resolution of clinical signs.. The prognosis for feline cryptococosis is good
to excellent when the disease is diagnosed in the early stages. Nevertheless,
CNS involvement negatively affects prognosis.
Cryptococcosis in cats
In cats, cryptococcosis can be either focal or disseminated, affecting a single organ
system or many.
Can begin insidiously, and may gradually become more severe over
weeks or months.
Fever may be absent, and if present, is often mild.
Other nonspecific signs can include lethargy, anorexia and weight
loss.
Cats with localized infections, including those in the nasal cavity,
do not necessarily have constitutional signs.
The clinical signs
Nasal cryptococcosis
Frequently seen clinical signs include sneezing, snoring or snorting,
dyspnea, nasal deformities and/ or a mucopurulent, serous or serosanguineous nasal discharge.
Polyp-like masses sometimes protrude from one or both nostrils
111
Nasal Cryptoccus infection in a cat. Courtesy Prof Richard Malik
Feline cryptococcosis. left: a cat presenting a nasal masse (red arrow). right: Cytology by fine
needle aspirate of the nasal ...www.intechopen.com
Left: Nasal turbinate: The submucosa contains large numbers of fungal yeasts with a large clear capsule
and a faintly basophilic nucleus. Right: Mucicarmine stain of feline nasal turbinates with Cryptococcus
neoformans: The cell walls stain red and the capsule is clear. Vet.Path.Forum
Cutaneous or subcutaneous swellings and nodules
May be seen on the face, particularly the bridge of the nose, side of
the face, upper lip or nostril.
Some of these lesions may ulcerate. In addition, the submandibular
lymph nodes are often enlarged. With time, infections involving the
nasal cavity can spread to adjacent structures.
Ulcerative or proliferative lesions may develop on the tongue,
gingiva or palate. Extension to the ear can result in otitis media and
vestibular signs.
Cutaneous involvement usually appears as fluctuant or firm papules
and nodules. Some skin lesions may ulcerate, but there is little or no
112
pruritus. Generalized skin disease suggests disseminated
cryptococcosis. Direct inoculation of organisms into the skin can
occasionally cause solitary lesions.
Cat cryptococcosis. multiple foci of ulcerative dermatitis; aspirate from a cutaneous lesion
contains numerous Cryptococcus neoformans yeast organisms surrounded by a nonstaining
capsulewww.vetnext.com
Lower respiratory cryptococcosis
can also occur in cats, although it is less common than upper
respiratory lesions.
Syndromes may include pneumonia, pleuritis and mediastinal
masses.
Lateral thoracic radiograph of a 12-year-old Siamese with pulmonary cryptococcus. There is a
soft tissue mass in the cranial mediastinum as well as in the dorsal portion of the mid thorax
causing ventral and caudal displacement of the tracheal carina. There is also severe
atelectasis of all lung lobes. Right:Post-mortem of a 12-year-oldSiamese with pulmonary
cryptococcus. Prof Allison Zwingenberger
CNS involvement cryptococcosis
Both focal mass lesions (cryptococcomas) and cryptococcoal
meningitis may be seen.
The neurological signs can be mild to severe, with various
presentations such as a change in temperament or behavior,
113
depression, disorientation, vestibular signs (e.g., head tilt,
circling, nystagmus), head pressing, ataxia, paresis or paralysis,
tremors, seizures, abnormal pupillary responses and blindness.
Meningitis may appear as pain over the thoracolumbar spine or
pelvic limbs, but hyperesthesia and nuchal rigidity are
uncommon. Deficits of cranial nerves 5 to 12 are often found.
The CNS is sometimes involved even if there are few or no
obvious neurological signs. In one case, the only sign was
unusual sleepiness.
Granulomatous rhinitis (extends into brain) Caused by cryptococcosis in a cat. quizlet.com
Note the two circumscribed areas in this cat brain that are very gelatinous in appearance. This
gelatinous appearance is typical for Cryptococcus and is due to the mucinous capsule surrounding each
organism. quizlet.com
Left, note the cellularity of the meninges (*) overlying the cerebellum in this case of cryptococcosis.
Right: a higher magnification of the cellular infiltration.which is granulomatous to pyogranulomatous,
quizlet.com.
Ocular cryptococcosis
Chorioretinitis, optic neuritis, panophthalmitis, retinal hemorrhages
and iridocyclitis have been reported. T
114
Small transparent focal retinal detachments with a minimal
inflammatory response may be seen.
Ocular lesions often accompany other syndromes, specially CNS
disease. Some cats can become blind.
Other organs which can also be affected by cryptococcosis
include:
2.3.
the bone (osteomyelitis),
mediastinum,
heart,
thyroid gland,
spleen,
liver
urinary tract.
Cryptococcosis in dogs
Compared to cats, dogs are more prone to develop disseminated
cryptococcosis
Cryptococcus neoformans can affect the eyes and central nervous system
(CNS) and cause optic neuritis, granulomatous chorioretinitis and
meningoencephalitis.
About 50 percent of dogs diagnosed to have lesions in their respiratory tract,
which is often the lungs, and most dogs have a granuloma in more than one
system. Lesions may develop in the nasal cavity.
Cryptococcus neoformans quite often attacks the kidneys, lymph nodes, spleen
and liver of dogs, heart valves, thyroid, adrenal, muscle, pancreas,
gastrointestinal tract, bone, myocardium, and prostate.
When Cryptococcosis cause lesions in dogs, they can be different from the
kind of granuloma mass jelly made by many organisms (often with very little
inflammation).
Cryptococosis lesions in dogs usually consists of an aggregate of
encapsulated organisms covered by reticular connective tissue.
The average age of infected dogs is 3.5 years and, unlike cats, there is no
gender predisposition.
Overrepresented dog breeds include American Cocker Spaniels and Labrador
Retrievers in North America, and Doberman Pinschers and Great Danes in
Australia.
Cryptococcosis affects the same four organ systems as with cats, but the CNS
and eyes are more commonly involved in dogs than in cats. The clinical signs
are similar to those found in cats except that fever (103-105° F) is seen more
often in affected dogs (25% of cases).
Clinical signs
o Frequently affected sites in the dog include both the respiratory
tract and CNS.
115
o Signs primarily of upper respiratory tract involvement have been
documented in some dogs, especially those infected with C. gattii;
however,
o Concurrent involvement of the lower respiratory tract or CNS is
common in this species.
Disseminated cryptococcosis is reported to be more common in
dogs than cats.abnormal pupillary responses and blindness.
Meningitis may appear as pain over the thoracolumbar spine or
pelvic limbs, but hyperesthesia and nuchal rigidity are uncommon.
Deficits of cranial nerves 5 to 12 are often found.
The CNS is sometimes involved even if there are few or no
obvious neurological signs..
Ocular lesions reported cases are
chorioretinitis,
optic neuritis,
panophthalmitis,
retinal hemorrhages and
iridocyclitis
small transparent focal retinal detachments with a minimal
inflammatory response. Ocular lesions often accompany other
syndromes, especially CNS disease. Some dogs can become
blind.
Cutaneous involvement
Usually appears as fluctuant or firm papules and nodules.
Some skin lesions may ulcerate, but there is little or no pruritus.
Generalized skin disease suggests disseminated cryptococcosis.
Direct inoculation of organisms into the skin can occasionally
cause solitary lesions.
Other organs which can also be affected.including
2.4.
the bone (osteomyelitis),
mediastinum,
heart,
thyroid gland,
spleen,
liver and
urinary tract
Reported cases.
Sutton (1981) described the main features of Cryptococcus neoformans infection in 6
dogs, all of which were of large breed, were central nervous system involvement in
all cases and diversity of the initial presenting signs. The respiratory tract was affected
116
in one case, but the bronchopneumonia did not appear to be of cryptococcal origin.
Immunosuppressive factors and other diseases which are believed to increase the
susceptibility of man and animals to cryptococcal infection did not appear to be of
importance in these cases.
Medleau et al. (1985) diagnosed cutaneous cryptococcosis in 3 cats. No other organ
involvement was found. One cat has remained healthy after surgical excision of the
cryptococcal skin lesion. One cat was euthanatized after diagnosis. The third cat was
treated successfully with a 5-month course of ketoconazole.
Malik et al. (1992) evaluated 29 cats with naturally occurring cryptococcosis prior to
commencing oral fluconazole therapy (25–100 mg every 12 h). Affected cats ranged
from 2 to 15 years-of-age. Male cats (19; 66%) and Siamese cats (5; 21%) appeared to
be over-represented in comparison to the hospital's cat population. Mycotic rhinitis
was observed in 24 (83%) of the cases, although nasal cavity involvement was subtle
in four animals. Disease of the skin and subcutaneous tissues was present in 15 cases
(52%) and amongst these the nasal plane (seven cats) and bridge of the nose (seven
cats) were most commonly involved. Primary infection of the central nervous system
was not encountered, although one cat developed meningoencephalitis and optic
neuritis as a sequel to longstanding nasal cavity disease. Antibodies against the feline
immunodeficiency virus (FIV) were detected in eight cats (28%), and these cats
tended to have advanced and/or disseminated disease. There was a tendency for cats
to develop cryptococcosis during the Australian summer. Organisms were cultured
from 27 cases. Cryptococcus neoformans var. neoformans was isolated from 21 cats,
while Cryptococcus gattii was identified in the remaining six. The response to oral
fluconazole was excellent in this series, which included many cats with advanced,
longstanding or disseminated disease. The fungal infection resolved in all but one
advanced case which died after only 4 days of therapy. A dose of 50 mg per cat, given
every 12 h, produced a consistently good response without side effects. Lower doses
were effective in some cases, while 100 mg every 12 h was required to control the
infection in one cat. Serum fluconazole levels obtained during chronic dosing (50 ±
18 mg l−1, mean ± SD; 50 mg per cat every 12 h) were highly variable (range 15–80
mg l−1). Concurrent FIV infection did not impart an unfavourable prognosis, although
affected cats often required prolonged courses of therapy.
Malik et al. (1995) analysed the clinical and mycological findings in 20 consecutive
cases of cryptococcosis evaluated between 1981 and 1995 retrospectively. Typically,
young adult dogs (median age 2 years) of either sex were affected. Dobermann
Pinschers and Great Danes were significantly over-represented in relation to other
breeds and crossbred dogs, and there was no trend for cryptococcosis to be acquired at
a particular time of year. Cryptococcus neoformans was cultured from 18 dogs, with
16 isolates further characterized. Of these, C. neoformans var. neoformans was
isolated from 12 cases, while the remaining four strains were C. gattii. Dogs with C.
gattii infections resided in rural (two cases) or suburban (two cases) environments.
Ten dogs were presented as a result of infection of structures inside, adjacent to, or
contiguous with the nasal cavity. Seven dogs were presented primarily for signs of
central nervous system disease, of which at least three also had cryptococcal
rhinosinusitis. One dog had cryptococcal pneumonia and also possible mycotic
rhinitis, another had disseminated disease with lymph node and skin involvement,
117
while the last dog was presented for vomiting referable to cryptococcal mesenteric
lymphadenitis. Treatment consisting of surgery and/or antifungal drug therapy was
successful in the majority of animals in which it was attempted, including two of three
cases with meningo-encephalitis.
Medleau et al. (1995) used Itraconazole in 35 cats with cryptococcosis. Treatment
response was determined by comparing clinical signs before, during, and after
treatment. It could not be evaluated in 7 cats because they died during treatment from
causes unrelated to cryptococcosis. Of the remaining 28 cats, treatment response was
classified as success in 16 cats (57%), as improvement in 8 cats (29%), and as a
failure in 4 (14%). The failures were due to death or euthanasia from drug toxicity (1
cat), progressive fungal disease (2 cats), and relapse 1 year after treatment (1 cat). The
cats that improved did not undergo a 1 -year posttreatment evaluation because they
were lost to follow-up (3 cats), died or were euthanatized for other reasons (4 cats), or
had a noncompliant owner (1 cat). For the 16 cats in which treatment was successful,
the median itraconazole dose was 13.8 mg/kg body weight daily (range, 10.9 to 26.7
mg/kg/d), and the median duration of treatment was 8.5 months (range, 4 to 16
months). Five of these cats had previously been treated unsuccessfully with
ketoconazole.
Gerds-Grogan and Dayrell-Hart (1997) reported 19 cats with cryptococcosis at
the Veterinary Hospital of the University of Pennsylvania between April 1986 and
May 1995. Compared to other studies, these 19 cases showed increased neurological
and ophthalmological involvement. Males were affected more often than females.
Season and environment appeared to influence time of onset or presentation to the
hospital. Clinical pathology did not show typical changes. It is possible that the
organism was present frequently in the urine but was mistaken for fat droplets.
Treatment with ketoconazole was unrewarding in cases with central nervous system
(CNS) involvement.
Jacobs et al. (1997 evaluated the relationship between treatment outcome and
location of cryptococcal infection, gender, magnitude of pretreatment, cryptococcal
antigen titers, results of feline leukemia virus (FeLV) and feline immunodeficiency
virus (FIV) serology, and serial changes in antigen titers during and after treatment in
a prospective and nonrandomized study of 35 cats with cryptococcosis. A commercial
cryptococcal latex agglutination kit (CALAS; Meridian Diagnostic Inc, Cincinnati,
OH) was used to detect cryptococcal antigen in sera. All cats were treated with
itraconazole (Sporanox; Janssen Pharmaceutica Inc, Titusville, NJ). Pretreatment
mean log titers for serum cryptococcal antigen were not influenced by location of the
infection. Treatment outcome was not influenced by gender, location of the infection,
or magnitude of pretreatment serum antigen titer. Treatment outcome was influenced
by FeLV and FIV status; cats seropositive for FeLV or FIV had a higher likelihood
oftreatment failure (P = .008). The cryptococcal antigen titers of cats successfully
treated decreased with significant linearity over time during treatment (r = -.64, P <
.000001), whereas the corresponding titers for cats not treated successfully did not
decrease with significant linearity (r = -.03, P > .9). For cats in which treatment was
successful, antigen titers decreased significantly from pretreatment values by 1.3
orders of magnitude at 2 months after initiation of treatment. By 10 months after
initiating treatment, log titers decreased by at least 2 orders of magnitude in all cats
successfully treated, and 9 of 16 cats had undetectable titers. In contrast, in 5 of 6 cats
118
in which treatment failed, antigen titers were unchanged or increased in magnitude
even after at least 6 months of treatment.
Malik et al. (1997) collected nasal washings from a random source of dogs and cats,
concentrated them by centrifugation and plated then onto bird seed agar containing
antibiotics. Cryptococcus neoformans var. neoformans was isolated from eight of 56
dogs (14%) and three of 45 cats (7%). More than 100 colonies of C. neoformans were
present on the plates from seven of the 11 positive animals. Absence of cryptococcal
antigen in the serum of these animals, and failure to demonstrate yeast-like organisms
or significant pathology in nasal biopsies, suggested that the nasal cavity of these
animals was not infected by C. neoformans but rather that blastoconidia and/or
basidiospores were carried asymptomatically.
BArrs et al. (2000) presented a 12-year-old, FIV-positive, domestic longhair cat with
a history of sneezing and coughing during the previous seven months. On thoracic
radiographs, a prominent bronchial pattern and three focal, opacified nodules were
seen. Cytology of bronchoalveolar lavage fluid demonstrated spherical, capsulate,
narrow-necked, budding yeasts within macrophages. Culture of the fluid yielded a
heavy growth of Cryptococcus neoformans var neoformans. The serum latex
cryptococcal antigen agglutination test titre was 158. The cat was treated with
itraconazole and the cough resolved over a 5-month period but then recurred. Repeat
thoracic radiographs showed resolution of the pulmonary nodules but a persistent
bronchial pattern. Adult nematodes and ova with morphology characteristic
of Capillaria aerophila were seen in bronchoalveolar lavage fluid and no yeasts were
cultured from the fluid. The cryptococcal titre was zero. The lungworm infection was
treated successfully with abamectin and the cough resolved. Immunosuppression
related to FIV infection may have predisposed this cat to sequential respiratory tract
infections.
Beatty et al (2000) presented 3 cats with cryptococcosis. In two cats, Cryptococcus
neoformans var neoformans was isolated from the tympanic bulla. In the remaining
cat, otitis media/interna was considered to be secondary to occlusion of the auditory
tube by a nasopharyngeal granuloma associated with a Cryptococcus gattii infection.
This report emphasises the importance of maintaining an index of suspicion for a
fungal aetiology in cats with signs of otitis media/interna, particularly in countries
with a high prevalence of cryptococcosis. The presence of C neoformans may be
overlooked with potentially fatal consequences where only standard methods for
bacterial isolation are used to examine samples obtained from the middle ear
Honsho et al. (2003) reported a male Boxer dog aged 2 years and 11 months with a
history of a gastrointestinal disorder of two months duration, with apathy, hyporexia,
progressive weight loss and visual deficit. Ataxia and vocalization were observed
during hospitalization. The animal had been treated previously with antibiotics and
immunosuppressive doses of corticoids to control chronic inflammatory bowel
disease. The dog died five days later. Gross and microscopic observations indicated
systemic cryptococcosis. The alimentary tract, eyes, brain, kidneys, pancreas and
lymph nodes were involved. Ophthalmic examination revealed a reduced response to
light, intraocular pressure of 3 mmHg for both eyes, discrete episcleral congestion
with moderate conjunctival hyperemia, and discrete corneal edema. Mild rubeosis
119
iridis and the presence of a white color granuloma measuring approximately 1mm in
diameter were also observed in the iris of the right eye. In the posterior segment there
was diffuse vitreal exudation in the right eye, as well as peripapillary hemorrhage,
retinal elevation in various areas suggestive of granulomatous chorioretinitis, and the
presence of small pigmented nodules scattered in the tapetal transition of the left eye.
Necroscopic examination showed that the gastric mucosa had countless ulcers with
raised borders ranging in diameter from 2 to 5mm, and that the mucosa of the small
intestine had ulcers as large as 1 cm in size. The rectal mucosa presented countless
nodules about 1.5cm in diameter with bloody content. The mesentery was thickened
and all mesenteric lymph nodes were enlarged. The pancreas was also enlarged. The
liver was dark brown in color with a rugose aspect and granulated upon palpation.
Several other whitish nodules were detected in the kidney - 0.5-1.0cm in diameter and brain (1-3mm in diameter). Examination of the thoracic cavity showed pulmonary
hepatization and in the heart a whitish region about 2cm in diameter in the right
ventricle epicardium and infiltrating to the myocardium. Fragments of these organs
were collected and fixed in 10% formalin and later processed for histology by paraffin
embedding.
Histopathological examination of the kidneys showed thickening of the Bowman
capsules with edema, glomerular degeneration and a mild mononuclear inflammatory
infiltrate. The lungs were emphysematous, with thickening of the alveolar walls
which were infiltrated by large numbers of encapsulated microorganisms, many of
them of small size and with a budding aspect, characteristic of C. neoformans. These
features were clearly demonstrated by PAS staining and GMS. Other organs such as
intestine, liver, stomach, pancreas, lymph nodes, brain, cerebellum and spinal cord
presented the same type of lesion, i.e., the massive presence of fungi and a slight
mononuclear infiltrate. In the intestine there was necrosis and the presence of large
amounts of fungi. Fungi were also observed free in the intestinal lumen due to
desquamation of the luminal epithelium.
Organs of a dog with cryptococcosis. A) Fundus tapetal with discrete pigmented spots,
papilloma, vitreous exudation and granulomatous lesions. B) Mesenteric lymph node
showing a necrosis area. Honsho et al. (2003)
111
C) Kidney with several small whitish areas D) Heart showing whitish area in the right
ventricule. Honsho et al. (2003)
E) Microscopic appearance of kidney necrotic area with small round microorganisms. F)
Microscopic appearance of intestine showing necrotic area in the epithelium with small
round microorganisms. Honsho et al. (2003)
G) Brain showing C. neoformans cells H) Meninge showing C. neoformans cells,
Honsho et al.
(2003)
Lester et al. (2004) determined clinical and pathologic findings associated with an
outbreak of cryptococcosis in an unusual geographic location (British Columbia,
Canada) in 20 cats, and 15 dogs. A presumptive diagnosis of cryptococcosis was
made on the basis of serologic, histopathologic, or cytologic findings, and a definitive
diagnosis was made on the basis of culture or immunohistochemical staining. No
breed or sex predilections were detected in affected dogs or cats. Eleven cats had
neurologic signs, 7 had skin lesions, and 5 had respiratory tract signs. None of 17 cats
tested serologically for FeLV yielded positive results; 1 of 17 cats yielded positive
results for FIV (western blot). Nine of 15 dogs had neurologic signs, 2 had periorbital
swellings, and only 3 had respiratory tract signs initially. Microbiologic culture in 15
cases yielded 2 isolates of Cryptococcus neoformans var grubii(serotype A) and 13
isolates of C gattii (serotype B); all organisms were susceptible to amphotericin B and
ketoconazole. Serologic testing had sensitivity of 92% and specificity of 98%.It was
concluded that serologic titers were beneficial in identifying infection in animals with
111
nonspecific signs, but routine serum biochemical or hematologic parameters were of
little value in diagnosis. Most animals had nonspecific CNS signs and represented a
diagnostic challenge. Animals that travel to or live in this region and have nonspecific
malaise or unusual neurologic signs should be evaluated for cryptococcosis.
Duncan et al. (2005a) evaluated deep and superficial nasal fungal cultures of 280
dogs and 94 cats. They identified four (4.3%) cats and three (1.1%) dogs with C.
gattii serotype B in their nasal cavity. Serum samples collected from 266 dogs and 84
cats identified six (7.1%) cats and two (0.8%) dogs with a positive cryptococcal
antigen titer. Overall cats were 4.4 times more likely than dogs to be positive on one
or both tests. Identification of sub-clinical infection and nasal colonization is an
important step in the characterization of the outbreak of clinical cryptococcosis on
Vancouver Island.
Duncan et al. (2005b) reported the follow-up data on a cohort of seven cats and
five dogs identified in a previous study as sub-clinically infected with Cryptococcus
spp. or colonized by C. gattii. Two cats progressed to clinical disease within four to
six months of initial detection of antigenemia and nasal cavity colonization. The ten
other animals remained asymptomatic but many were repeatedly positive on
cryptococcal antigen testing or nasal fungal culture suggesting protracted infection or
colonization. The results indicate that asymptomatically infected animals may clear
the organism, remain sub-clinically infected or progress to clinical disease. Factors
influencing the transition from exposure to disease require further investigation.
Duncan et al. (2006a) mentioned that, Cryptococcus gattii has emerged since 1999
as an important pathogen of humans and animals in southwestern British Columbia.
Historically thought to be restricted to the tropics and subtropics, C. gattii has posed
new diagnostic and treatment challenges to veterinary practitioners working within
the recently identified endemic region. Clinical reports of canine and feline
cryptococcosis caused by C. gattii diagnosed between January 1999 and December
2003 were included in this case series. The most common manifestations of disease
were respiratory and central nervous system signs. Multivariate survival analysis
revealed that the only significant predictor of mortality was the presence of central
nervous system signs upon presentation or during therapy. Case fatality rates in both
species were high. Further investigation into effective treatment regime is warranted.
Duncan et al. (2006b) conducted a study to determine the risk factors associated with
Cryptococcus gattii infection in dogs and cats residing on Vancouver Island in British
Columbia, Canada. In this study. 20 dogs and 29 cats with C gattii infection and
matched controls were involved. Dogs and cats with a confirmed or probable
diagnosis of cryptococcosis resulting from infection with C gattii were enrolled by
veterinarians, and owners completed a questionnaire designed to obtain information
pertaining to potential risk factors for the disease. Owners of matched control animals
were also interviewed. Odds ratios and 95% confidence intervals or paired t tests were
calculated to determine significant associations. Animals were enrolled during 2
noncontiguous periods in August 2001 to February 2002 (8 dogs and 9 cats enrolled)
and May to December 2003 (12 dogs and 20 cats enrolled). Risk factors significantly
associated with development of cryptococcosis included residing within 10 km of a
logging site or other area of commercial soil disturbance, above-average level of
112
activity of the animal, travelling of the animal on Vancouver Island, hunting by the
animal, and owners hiking or visiting a botanic garden. Results indicated
that dogs and cats that were active or that lived near a site of commercial
environmental disturbance had a significantly increased risk of developing C
gattii infection. Veterinarians should communicate these risks to owners in context
because cryptococcosis was an uncommon disease in this population.
Duncan et al. (2006c) collected. nasal swabs and serum samples
from dogs and cats residing within the Coastal Douglas Fir biogeoclimatic zone on
Vancouver Island, where clinical cases have been reported. Deep and superficial nasal
fungal cultures of 280 dogs and 94 cats identified four (4.3%) cats and three
(1.1%) dogs with C. gattii serotype B in their nasal cavity. Serum samples collected
from 266 dogs and 84 cats identified six (7.1%) cats and two (0.8%) dogs with a
positive cryptococcal antigen titer. Overall cats were 4.4 times more likely
than dogs to be positive on one or both tests. Identification of sub-clinical
infection and nasal colonization was an important step in the characterization of the
outbreak of clinical cryptococcosis on Vancouver Island.
Kano et al. (2008) reported a case of systemic infection caused by Cryptococcus
albidus in a cat. The patient had a history of paralysis of the hind legs and had been
treated with prednisone for 1 month. Microscopic examination of a fine needle biopsy
specimen from a right popliteal lymph node showed granulomatous inflammation
with many encapsulated yeast cells. Moreover, microscopic examination of Indian ink
preparations of the cerebrospinal fluid revealed encapsulated ovoid yeast cells. Thus
this case was diagnosed to be cryptococcosis. However, the cat died after treatment
for three days with voriconazole. Isolates recovered from samples of the
cerebrospinal fluid, liver and spleen were identified as C. albidus by molecular
analysis, as well as through morphologic and biochemical studies. Therefore, this case
indicates that C. albidus should be considered as a potential feline pathogen.
Chapman and Kirk (2008) diagnosed a cryptococcal urinary tract infection (UTI)
in a male domestic shorthaired cat presented for evaluation of stranguria and
pollakiuria The (UTI) was diagnosed cytologically and via fungal culture. No
evidence of systemic involvement was found. Chronic renal failure was a concurrent
disease in this cat. Treatment consisted of oral fluconazole. Clinical signs resolved
after 2 weeks of therapy, and fluconazole was discontinued after 6 months when
negative urine culture results indicated resolution of the infection. This case
demonstrated that correct identification of cryptococcal UTI allowed for
administration of therapy that can be associated with resolution of clinical signs.
Bowles et al. (2009) presented two young, large-breed female dogs with an acute
onset of sneezing and nasal discharge. One patient had concurrent epistaxis and facial
deformity. Decreased airflow was noted through the left nostril in Case 1, while Case
2 showed facial deformity. Nasal radiographs from Case 1 showed a soft tissue
opacity in the left nasal cavity and frontal sinus. Rhinoscopy revealed roughened,
erythematous nasal turbinates in both patients, and a mass in the left caudal nasal
cavity of Case 1. Cryptococcus spp. were demonstrated histopathologically on a nasal
biopsy. Tissue culture and serum antigen titres were positive for Cryptococcus spp.
The diagnosis was chronic rhinitis secondary to Cryptococcus gattii infection in Case
1, and Cryptococcu neoformans infection in Case 2.
113
Byrnes et al. (2009) isolated Cryptococcus gattii from a 1.5-year-old dog with
systemic cryptococcosis in Oregon. The dog had no link to Vancouver Island or
British Columbia, Canada. The 2 isolates were both the VGIIa Vancouver Island
major genotype. Findings are consistent with expansion of the Vancouver Island
outbreak onto the mainland Pacific Northwest region of the United States.
McGill et al. (2009) conducted a retrospective study of cryptococcosis in domestic
animals residing in Western Australia over an 11-year-period (from 1995 to 2006) by
searching the data base of Murdoch University Veterinary Teaching hospital and the
largest private clinical pathology laboratory in Perth. Cryptococcosis was identified in
155 animals: 72 cats, 57 dogs, 20 horses, three alpacas, two ferrets and a sheep. There
was no seasonal trend apparent from the dates of diagnosis. Taking into account the
commonness of accessions to Murdoch University, cats were five to six times more
likely to develop this disease than dogs, and three times more likely than horses, while
horses were almost twice as likely as dogs to become infected. Amongst the feline
cohort, Ragdoll and Birman breeds were over-represented, while in dogs several
pedigree breeds were similarly overrepresented. Dogs and horses tended to develop
disease at an early age (one to five years), while cats were presented over a much
wider range of ages. In cats and dogs the upper respiratory tract was the most
common primary site of infection, while horses and alpacas tended to have lower
respiratory involvement. The most striking finding of the study was the high
frequency with which C. gattii was identified, with infections attributable to this
species comprising 5/9 cats, 11/22 dogs, 9/9 horses and 1/1 alpaca, where appropriate
testing was conducted. Preliminary molecular genotyping suggested that most of
the C. gattii infections in domestic animals (9/9 cases) were of the VGII genotype.
This contrasts the situation on the eastern seaboard of Australia, where disease
attributable to C. gattii is less common and mainly due to the VGI genotype. C.
gattii therefore appears to be an important cause of cryptococcosis in Western
Australia.
Poth et al. (2010) described an uncommon case of cryptococcosis in an apparently
immunocompetent cat caused by Cryptococcus magnus. An amputation of the
complete left foreleg and excision of the ipsilateral cervical lymph node were
performed in a young-adult male Domestic Shorthair cat due to suspicion of a tumor.
Granulomatous dermatitis, panniculitis, myositis, and lymphadenitis were diagnosed
histologically. Intralesional, numerous round-to-ovoid yeast cells showing no capsule
were detected within macrophages using special staining methods. The tissue material
cultured on Sabouraud's glucose agar at 26°C yielded abundant growth of yeast
colonies. Morphological, physiological, and molecular analyses of the yeasts
demonstrated that the fungus was C. magnus. Response to treatment with fluconazole
was fast and effective, and one year after the end of the therapy no further clinical
signs of infection were observed.
Trivedi et al. (2010) reviewed medical records of cats and dogs with cryptococcosis.
Information collected included geographic location, species, signalment, and tissues
or organs involved. Cryptococcosis was confirmed via serology, cytology, histology,
or microbial culture, and molecular typing was performed. Odds ratios and 95%
114
confidence intervals were calculated to determine significant associations among
variables. Other comparisons were evaluated via χ2 or unpaired t tests. American
Cocker Spaniels were overrepresented, compared with other dog breeds. Serum
cryptococcal antigen test results were positive in 51 of 53 cats and 15 of 18 dogs
tested. Cryptococcus gattii was more commonly detected in cats (7/9 for which
species identification was performed), and Cryptococcus neoformans was more
commonly detected in dogs (6/8). Six of 7 C gattii isolates from cats were molecular
type VGIII. Distribution of involved tissues was different between cats and dogs in
California and between populations of the present study and those of the previously
reported Australian study. They concluded that strains of Cryptococcus spp appeared
to have host specificity in dogs and cats. Differences in lesion distribution between
geographic locations may reflect strain differences or referral bias. Antigen assays
alone may not be sufficient for diagnosis of cryptococcosis in cats and dogs
Trivedi et al. (2011) wrote a review in which they drew attention to literature
relating to epidemiology, CNS involvement and advanced diagnostic imaging to
update clinicians regarding research findings relevant to clinical practice. They
mentioned mentioned that Cryptococcosis, principally caused by Cryptococcus
neoformans and Cryptococcus gattii, is the most common systemic mycosis of cats
worldwide. Cats may be infected following inhalation of spores from the
environment, with the nasal cavity suspected as being the initial site of colonization
and subsequent infection. Other sites of infection in cats are the skin, lungs, lymph
nodes, central nervous system (CNS), eyes and, occasionally, periarticular connective
tissue. Cryptococcosis can be diagnosed using serology (antigen testing), cytologic
examination of smears, histopathology or culture. Treatment of localized disease is
generally successful using azole antifungal drugs; however, cats with CNS
involvement or disseminated disease require additional treatment with amphotericin
B, with or without flucytosine. The prognosis is variable, depending on host and
pathogen factors. Some cats require long-term (>1 year) treatment or indefinite
therapy. Cats of any breed, gender and age may be affected. Retroviral status does not
appear to be a risk factor for developing cryptococcosis and indoor cats are not
protected from disease. Feline cryptococcosis occurs worldwide, but is most
frequently reported in Australia, western Canada and the western United States.
Species and molecular type vary in different geographical regions and may affect
clinical presentation and antifungal susceptibility patterns. Serologic tests that detect
cryptococcal antigen in serum are sensitive and specific, but false negatives can occur
in cats with localized disease. Long-term drug therapy can be expensive and has the
potential for toxicity. The extent to which the pathogenicity and antifungal
susceptibility is affected by molecular type is currently under study.
Cardoso et al. (2013) described a case of a nasal granuloma in a cat due to C. gattii.
The confirmation of the specie Cryptococcus gattii and its molecular type were
performed using the PCR-RFLP molecular techniques. The isolated strain was
identified as C. gattii type VGII and was susceptible to all antifungal drugs tested.
The characterization and molecular investigation of this microorganism are relevant
because they could help better understand the epidemiology of the infection and to
guide us to treat properly the disease.
115
Pennisi et al. (2013) mentioned that Cryptococcosis is worldwide the most common
systemic fungal disease in cats; it is caused by the Cryptococcus neoformans–
Cryptococcus gattii species complex, which includes eight genotypes and some
subtypes (strains) with varying geographical distribution, pathogenicity and
antimicrobial susceptibility. Cats acquire the infection from a contaminated
environment. The prognosis is favourable in most cases, provided a diagnosis is
obtained sufficiently early and prolonged treatment is maintained. Basidiospores are
the infectious propagules of Cryptococcus species as they penetrate the respiratory
system and induce primary infection. Asymptomatic colonisation of the respiratory
tract is more common than clinical disease. Avian guanos, particularly pigeon
droppings, offer favourable conditions for the reproduction of C neoformans.
Both Cryptococcus species are associated with decaying vegetation. Cryptococcosis
caused by C neoformans or C gattii is indistinguishable clinically. The disease can
present in nasal, central nervous system (which can derive from the nasal form or
occur independently), cutaneous and systemic forms. An easy and reliable test for
cryptococcosis diagnosis is antigen detection in body fluids. Only isolation and
polymerase chain reaction allow identification of the species genotype. Amphotericin
B, ketoconazole, fluconazole and itraconazole have all been used to treat cats.
Surgical excision of any nodules in the skin, nasal or oral mucosa assists recovery.
Continued treatment is recommended until the antigen test is negative. Efficient
preventive measures have not been demonstrated. Vaccines are not available.
Danesi et al. (2014) sampled cats from 162 urban and rural feral cat colonies over 3
years. Of 766 cats from which nasal swabs were obtained, Cryptococcus spp. were
recovered from 95 (12.6%), including 37 C. magnus (4.8%), 16 C. albidus (2.0%),
15 C. carnescens (1.9%), 12 C. neoformans (1.6%), as well as C. oeirensis (n = 3), C.
victoriae (n = 3), C.
albidosimilis (n = 2),Filobasidium
globisporum (n = 2), C.
adeliensis (n = 1), C. flavescens(n = 1), C. dimnae (n = 1), C. saitoi (n = 1), and C.
wieringae (n = 1) with prevalence <1%. Thirteen Cryptococcus species were
identified by polymerase chain reaction and sequencing of internal transcribed spacer
amplicons. Statistical analysis did not identify any predisposing factors that
contributed to nasal colonization (eg, sex, age, season, or habitat). Results suggest that
asymptomatic feral cats may carry C. neoformans and other Cryptococcus species in
their sinonasal cavity. Genotyping of the specific cryptococcal isolates provides a
better understanding of the epidemiology of these yeasts.
O’BRIEN et al. (2004) carried ou a retrospective study of 155 cats and 40 dogs
diagnosed with cryptococcosis between 1981 and 2001. Age, sex, breed, clinical
findings, feline immunodeficiency virus and feline leukaemia virus status (in cats),
species of Cryptococcus causing disease and region of domicile were recorded.
Associations between variables were tested. Male and female cats were affected
equally. Age ranged from 1 to 16 years, with a preponderance of cats aged between 2
and 3 years. Siamese, Himalayan and Ragdoll breeds were over-represented. Rural
cats were more frequently infected with Cryptococcus gattii. Retroviral infection was
not identified as a predisposing condition and was not correlated with either species
of Cryptococcus or physical findings. Most cats had signs of nasal cavity infection,
which was typically localised for a substantial period before invasion of adjacent
structures or dissemination. Male and female dogs were affected equally. A marked
preponderance of young, large breed dogs was noted. Border Collies, Boxers,
Dalmatians, Dobermann Pinschers, Great Danes and German Shepherds were over116
represented.Cryptococcus species involved was not affected by place of domicile.
Although nasal cavity involvement was important, the canine cohort had a greater
propensity to develop secondary central nervous system involvement and
disseminated disease than feline cases. There were no clinical findings in either cats
or dogs which could be reliably used to distinguish disease caused by Cryptococcus
neoformans variety grubii
from
disease
caused by Cryptococcus
gattii.
Both Cryptococcus species appear to be primary pathogens of cats and dogs, with the
upper respiratory tract presumed to be the predominant primary site of inoculation in
most but not all cases.
Livet et al. (2015) reported an indoor 9-year-old castrated male domestic cat with a 4
month history of increased upper airway noise. Computed tomography revealed a
nasopharyngeal polypoid mass, which was removed endoscopically with basket
forceps. Histopathology was compatible with a polypoid granulomatous pharyngitis
with Cryptococcus-like organisms. This was supported by a positive serum latex
cryptococcal antigen agglutination test (LCAT). Minimal inflammation of the nasal
tissue was noted on histopathology, with no evidence of fungus. Following
endoscopic removal of the mass, the patient was treated with systemic antifungal
medication (itraconazole). One year after diagnosis, the LCAT titer was negative and
the cat remained free of clinical signs. Relevance and novel information. This case
report emphasized the importance of considering Cryptococcus species as a potential
etiology in cats presented with signs of nasopharyngeal obstruction with an isolated
nasopharyngeal polypoid mass, even if kept indoors.
(a) Transverse postcontrast computed tomography (CT) image of the nasopharynx showing the
rim-enhancing polypoid mass completely occupying the nasopharyngeal lumen (black
arrowheads). (b) Sagittal reformatted postcontrast CT image showing the rim-enhancing polypoid
mass completely occupying the nasopharyngeal lumen (white arrowheads). (c) Three-dimensional
(3D) CT image in a rostrocaudal (antegrade) direction showing the polypoid mass. (d) 3D CT
image in a caudorostral (retrograde) direction showing the polypoid mass protruding slightly
beyond the caudal margin of the soft palate, Livet et al. (2015)
117
Nasopharyngoscopy in a cat with a nasopharyngeal polypoid mass. (a) Note the well-defined
appearance of the mass completely filling the nasopharynx prior to withdrawal. (b) A grasping
basket passed through the channel of the endoscope is advanced cranial to the mass. (c) The
basket is opened and then pulled caudally in order to grasp the entire mass. (d) Severely inflamed
nasal choanae are visible following mass removal, Livet et al. (2015)
Histopathology of the polypoid granulomatous pharyngitis. (a) Gomori methenamine silver stain.
The polypoid mass contains numerous yeast measuring 4–8 μm in diameter. (b) Periodic acid–
Schiff stain. The yeast are surrounded by a clear zone corresponding to the capsule. Narrowbased budding, highly suggestive of Cryptococcus, is present, Livet et al. (2015)
Meng et al. (2015) reported a 7-year-old spayed domestic longhair cat from Perth,
Western Australia, with left-sided head tilt, dysphonia, head shaking, inappetence and
weight loss. A polypoid lesion had previously been removed from the external ear
canal. Otitis media with extension into the external ear canal was suspected and
investigated using video-otoscopy and computed tomography examination. Invasive
disease with extension from the middle ear to the base of the skull, and intracranial
extension into the caudal fossa and cranial cervical vertebral canal was detected.
Cytology of external ear canal exudate showed capsulated budding yeasts
andCryptococcus gattii VGII was cultured. Treatment with amphotericin B infusions
118
and oral fluconazole was prescribed, with nutritional support via oesophagostomy
tube. The cat clinically recovered 12 months after treatment commenced.
(a) The medial portion of the left external ear canal is filled with strongly and homogeneously
contrast-enhancing soft tissue attenuating material (1). The ear canal lining is moderately contrast
enhancing (compared with the right). The left tympanic bulla is filled with mildly and
homogeneously contrast-enhancing material (3). Similar moderately enhancing material is seen
extending ventromedially from the left bulla tympanica. A rim of strong contrast enhancement
outlines this region (2). (b) The material seen ventromedial to the tympanic bulla continues
caudally and forms a 1.6 cm (width) × 1.3 cm (height) × 2.5 cm (length) soft tissue structure, poorly
enhancing centrally but strongly enhancing peripherally (1). This mass (*) distorts local tissue
architecture such that the nasopharyngeal lumen is narrowed >50%, and the hyoid bones are
displaced laterally. Additionally, at this level, there is a rim of contrast enhancement seen in the
ventral aspect of the left temporal lobe of the cerebrum (2). (c) At the level of the caudal aspect of
the left tympanic bulla, the soft tissue lesion can still be seen ventromedial to the bulla (1).
Additionally, there is a rim of contrast enhancement outlining a hypoattenuating area in the left
lateral cerebellum (2). There is poorly contrast-enhancing soft tissue attenuating material in the
caudal fossa that is displacing the brainstem dorsally and to the right (3). Additionally, there is
strong meningeal contrast enhancement in this region. (d) The poorly contrast-enhancing material
in the cranial cavity can be followed further caudally, to the level of the atlas. This image, at the
level of the foramen magnum, demonstrates abnormal tissue (arrow) displacing and compressing
the cervical spinal cord (*) dorsally and to the right. (e) Bone window computed tomography image
at the most caudal aspect of the bulla. Note the discontinuity of the temporal bone (black arrows),
indicative of bony lysis, Meng et al. (2015)
Video-otoscopic photograph of the left tympanic membrane, which appears to have been breached
by abnormal inflammatory tissue (arrows), which extends into the tympanic bulla
119
Pimenta et al. (2015) reported a clinical case of blepharitis due to Cryptococcus
neoformans yeasts in a 2-year-old stray cat from northern Portugal (Vila Real)
without concurrent naso-ocular signs. Ophthalmological examination revealed
mucopurulent discharge from an open wound in the right upper and lower lids. Slitlamp biomicroscopy showed a normal anterior segment, and intraocular pressure was
within the normal reference interval. No fundoscopic alterations were detected in
either eye by direct and indirect ophthalmoscopic examination. Cytological
examination of an appositional smear showed numerous polymorphic neutrophils and
macrophages,
together
with
spherical
yeast
cells
compatible
with Cryptococcus species. Molecular analysis by means of PCR and restriction
fragment length polymorphism identified C neoformans genotype VNI. The cat was
treated with itraconazole, and amoxicillin and clavulanic acid, combined with a
commercial ear ointment and an imidacloprid/moxidectin spot-on application for
bilateral parasitic otitis caused by Otodectes cynotis. One month after treatment, the
clinical signs were completely resolved. Localised cutaneous lesions, as in the present
case, probably result from contamination of cat-scratch injuries with viable
encapsulated yeasts.
Mucopurulent discharge from an open wound in the right upper and lower lids, after treatment,
Pimenta et al. (2015)
Appositional smear showing numerous polymorphic neutrophils and spherical yeast cells with a
prominent unstained capsule compatible with Cryptococcusspecies (Diff-Quik; scale bar = 20 µm)
Microscopical examination of fungal culture: cells of encapsulated yeasts compatible
with Cryptococcus species (Hiss staining; scale bar = 20 µm), Pimenta et al. (2015)
121
2.5.
Aetiology of cryptococcosis in cats and dogs
2.4.1. Cryptococcus neoformans (San Felice) Vuillemin, 1901
Synonyms:
1.
2.
3.
4.
Saccharomyces neoformans San Felice, Annali Ig. Sperim.: 241 (1895)
Torula neoformans (San Felice) J.D. Weis, Journal of Medical Research 7 (1902)
Blastomyces neoformans (Vuill.) Arzt, Archiv Dermatolo und Syphilis 145: 311 (1924)
Debaryomyces neoformans (San Felice) Redaelli, Cif. & Giordano, Boll. Sez. Ital. Soc. Int.
Microbiol.: 24 (1937)
5. Lipomyces neoformans (San Felice) Cif., Manuale de Micologica Medica 2: 214 (1960)
6. Torulopsis neoformans var. sheppei A. Giord. [MB#456608]
7. Cryptococcus hominis Vuill., Revue Générale des Sci. Pures et Appl, 12: 735 (1901)
8. Torula histolytica J.L. Stoddart & Cutler, Studies from the Rockefeller Institute for Medical
Research (1916)
9. Cryptococcus hominis var. hondurianus Castell., J.Trop, Med. Hyg. 36: 297-321 (1933)
10. Cryptococcus meningitidis C.W. Dodge, Medical mycology.: 333 (1935)
11. Cryptococcus neoformans var. grubii Franzot et al., J. Clin. Microbiol. 37: 839 (1999)
Morphology Colonies of Cryptococcus neoformans are fast growing, soft, glistening
to dull, smooth, usually mucoid, and cream to slightly pink or yellowish brown in
color. The growth rate is somewhat slower than Candida and usually takes 48 to 72 h.
It grows well at 25°C as well as 37°C. Ability to grow at 37°C is one of the features
that differentiates Cryptococcus neoformans from other Cryptococcus spp. However,
temperature-sensitive mutants that fail to grow at 37°C in vitro may also be observed .
At 39-40°C, the growth of Cryptococcus neoformans starts to slow down.
Micromorphology On cornmeal tween 80 agar, Cryptococcus neoformans produces
round, budding yeast cells. No true hyphae are visible. Pseudohyphae are usually
absent or rudimentary. The capsule is best visible in India ink preparations. The
thickness of the capsule is both strain-related and varies depending on the
environmental conditions. Upon growth in 1% peptone solution, production of
capsule is enhanced.
2.4.1. Cryptococcus gattii (Vanbreusghem & Takashio) Kwon-Chung &
Boekhout, Taxon 51 (4): 806 (2002)
Synonyms:
1. Cryptococcus neoformans var. gattii Vanbreuseghem& Takashio, Annal. de la Soci. Belge de
Méd.Trop. 50 (6): 701 (1970)
2. Cryptococcus neoformans var. gattii Vanbreuseghem & Takashio ex De Vroey & Gatti, Mycoses 32
(12): 675 (1989)
3. Cryptococcus bacillisporus Kwon-Chung & J.E. Benn., Intern.J.Syste. Bacteriol.28: 618 (1978)
4.Cryptococcus neoformans var. shanghaiensis W.Q. Liao et al., Chinese Med. J.: 287 (1983)
121
2.5. Diagnosis of cryptococcosis
Direct microscopic examination of India ink preparation
Preliminary diagnosis of cryptococcal infection is made by direct microscopic
examination of india ink preparations of samples.
Isolation and identification
Definitive diagnosis is confirmed by the culture of specimens, often the cerebrospinal
fluid (CSF) or blood, and sometimes in respiratory secretions. Cryptococcus
neoformans and C. gattii grow well at 37oC. On Sabouraud dextrose agar colonies
appear soft, creamy, opaque in 3-5 days, then colonies become mucoid and creamy to
tan.
Cryptococcus colonies on Sabouraud's dextrose agar
Cryptococcus colonies are brown on bird seed agar, modified tobacco and Eucalyptus
leave extract agar as well as on Pal׳s medium. Other yeasts develop white to creamy
colonies. On canavanine glycine bromthymol blue (CGB) medium, Cryptococcus
neoformans develop non-coloured colonies and , while C. gattii develops blue
colonies.
122
Colonies on bird seed agar
C. gattii (left) colonies of C.
neoformans (right)
Biochemical identification
Cryptococcus neoformans and C. gattii do not ferment sugars, but assimilate several
sugars such as glucose, galactose, sucrose, maltose and inositol, but not lactose or
nitrate and hydrolyses urea.
Serotyping of Cryptococcus neoformans and C. gattii
To determine the antigenic formulas of Cryptococcus species, equal volumes of factor
serum and heat-killed cell suspension are mixed on a glass slide and rotated for 5 min,
and then the results of agglutination are observed. The formation of aggregates within
5 min is considered positive. Smaller clumps are recorded as weakly positive. PSS is
used for a negative control.
Iatron serotyping kit can be used to serotype isolates of Cryptococcus neoformans.
Molecular typing
Numerous molecular techniques have been applied to subtype C. neoformans and C.
gattii strains, only three methods were proved to produce comparable results: PCR
Fingerprinting, AFLP, and MLST. M13 PCR Fingerprinting and URA5 RFLP:
123
Serological diagnosis of cryptococcosis
Cryptococcal antigen from cerebrospinal fluid is the best test for diagnosis of
cryptococcal meningitis in terms of sensitivity. Rapid diagnostic methods to detect
cryptococcal antigen by latex agglutination test, lateral flow immunochromatographic
assay (LFA), or enzyme immunoassay (EIA).
This qualitative and semi quantitative test detects capsular polysaccharide antigens
of Cryptococcus neoformans in serum and cerebrospinal fluid. It utilizes latex
particles coated with anticryptococcal globulin. This latex reacts with the
cryptococcal polysaccharide antigen, causing a visible agglutination.
Positive latex test
Negative latex test
2.6. Treatment
Itraconazole is the drug of choice for treating cryptococcosis. This should be
given with a fatty meal to enhance absorption of the drug.
Fluconazole if there is CNS involvement.
Surgical removal of the lesions in the nasal cavity.
Supportive care such as a feeding tube if necessary.
References
1. BARRS, V., MARTIN, P., NICOLL, R., BEATTY, J. and MALIK, R. (2000),
Pulmonary cryptococcosis and Capillaria aerophila infection in an FIV-positive cat.
Australian Veterinary Journal, 78: 154–158.
2. Beatty , J A , V R Barrs, G R Swinney, P A Martin, R Malik . Peripheral Vestibular
Disease Associated with Cryptococcosis in Three Cats. Journal of Feline Medicine &
SurgeryVolume 2, Issue 1, March 2000, Pages 29–34
3. Chapman, Tara L and Simon E. Kirk (2008) An Isolated Cryptococcal Urinary Tract
Infection in a Cat. Journal of the American Animal Hospital Association:
September/October 2008, Vol. 44, No. 5, pp. 262-265.
4. Danesi P , Furnari C , Granato A , Schivo A , Otranto D , Capelli G , Cafarchia C,
Molecular identity and prevalence of Cryptococcus spp. nasal carriage in
asymptomatic feral cats in Italy. Med Mycol. 2014 Oct;52(7):667-73. doi:
10.1093/mmy/myu030. Epub 2014 Jul 31.
124
5. Duncan C , Stephen C, Lester S, Bartlett KH. Follow-up study of dogs and cats with
asymptomatic Cryptococcus gattii infection or nasal colonization. Med Mycol. 2005
Nov;43(7):663-6.
6. Duncan C , Stephen C, Lester S, Bartlett KH. Sub-clinical infection and
asymptomatic carriage of Cryptococcus gattii in dogs and cats during an outbreak of
cryptococcosis. Med Mycol. 2005 Sep;43(6):511-6.
7. Duncan CG, Stephen C, Campbell J. Evaluation of risk factors for Cryptococcus
gattii infection in dogs and cats. J Am Vet Med Assoc. 2006 Feb 1;228(3):377-82.
8. Duncan C , Stephen C, Campbell J. Clinical characteristics and predictors of mortality
for Cryptococcus gattii infection in dogs and cats of southwestern British Columbia.
Can Vet J. 2006 Oct;47(10):993-8.
9. Honsho, C.S., Mine, S.Y., Oriá, A.P., Benato, N., Camacho, A.A., Alessi, A.C., &
Laus, J.L.. (2003). Generalized systemic cryptococcosis in a dog after
immunosuppressive corticotherapy. Arquivo Brasileiro de Medicina Veterinária e
Zootecnia, 55(2), 155-159.
10. Gerds-Grogan S , Dayrell-Hart B. Feline cryptococcosis: a retrospective
evaluation.Journal of the American Animal Hospital Association [1997, 33(2):118122]
11. Jacobs , Gilbert J., Linda Medleau, Clay Calvert, and John Brown . Cryptococcal
Infection in Cats: Factors Influencing Treatment Outcome, and Results of Sequential
Serum Antigen Titers in 35 Cats. . J Vet Intern Med 1997, 111,1-4
12. Kano R , Kitagawat M, Oota S, Oosumi T, Murakami Y, Tokuriki M, Hasegawa A.
First case of feline systemic Cryptococcus albidus infection. Med Mycol. 2008
Feb;46(1):75-7.
13. Lester , S. J. , Natalie J. Kowalewich, Karen H. Bartlett, Mark
B. Krockenberger, Theyne M. Fairfax, Richard Malik, Clinicopathologic features of
an unusual outbreak of cryptococcosis in dogs, cats, ferrets, and a bird: 38 cases
(January to July 2003). J Am Vet Med Assoc 2004;225:1716–1722
14. Livet, V., Javard, R., Alexander, K., Girard, C. and Dunn, M., 2015. Cryptococcal
nasopharyngeal polypoid mass in a cat. Journal of Feline Medicine and Surgery Open
Reports, 1(2), p.205511691559723
15. McGill S , Malik R, Saul N, Beetson S, Secombe C, Robertson I, Irwin P.
Cryptococcosis in domestic animals in Western Australia: a retrospective study from
1995-2006. Med Mycol. 2009;47(6):625-39. doi: 10.1080/13693780802512519.
16. Malik, R. Otogenic meningoencephalomyelitis due toCryptococcus gattii (VGII)
infection in a cat from Western Australia/ Journal of Feline Medicine and Surgery
Open Reports January-June 2015 vol. 1 no. 12055116915585022
17. Malik R, Wigney DI, Muir DB, Gregory DJ, Love DN. Cryptococcosis in cats:
clinical and mycological assessment of 29 cases and evaluation of treatment using
orally administered fluconazole. J Med Vet Mycol. 1992;30(2):133-44.
18. Malik R, Dill‐Macky E, Martin P, Wigney DI, Muir DB, Love DN. Cryptococcosis in
dogs: a retrospective study of 20 consecutive cases. J Med Vet Mycol. 1995;33:291–
297.
19. Malik,R., D.I. Wigney, D.B. Muir, D.J. Gregory and D.N. Love. Cryptococcosis in
cats: clinical and mycological assessment of 29 cases and evaluation of treatment
using orally administered fluconazole. J Med Vet Mycol. 1992;30(2):133-44.
20. Malik R , Dill-Macky E, Martin P, Wigney DI, Muir DB, Love DN.
Cryptococcosis in dogs: a retrospective study of 20 consecutive cases. J Med Vet
Mycol. 1995 Sep-Oct;33(5):291-7.
21. Malik R , Wigney DI, Muir DB, Love DN. Asymptomatic carriage
of Cryptococcus neoformans in the nasal cavity of dogs and cats. J Med Vet
Mycol. 1997 Jan-Feb;35(1):27-31.
22. Medleau L, Hall EJ, Goldschmidt MH, Irby N. Cutaneous cryptococcosis in three
cats. J Am Vet Med Assoc. 1985 Jul 15;187(2):169-70.
125
23. Medleau, L., Jacobs, G. J. and Marks, M. A. (1995), Itraconazole for the Treatment of
Cryptococcosis in Cats. Journal of Veterinary Internal Medicine, 9: 39–42.
24. O’BRIEN , C. R., M. B. KROCKENBERGER*, D. I. WIGNEY*, P. MARTIN* &
R. MALIK$. Retrospective study of feline and canine cryptococcosis in Australia
from 1981 to 2001: 195 cases. Medical Mycology October 2004, 42, 449/460
25. Pennisi MG , Hartmann K, Lloret A, Ferrer L, Addie D, Belák S, BoucrautBaralon C, Egberink H, Frymus T, Gruffydd-Jones T, Hosie MJ, Lutz
H, Marsilio F, Möstl K, Radford AD, Thiry E, Truyen U, Horzinek MC.
Cryptococcosis in cats: ABCD guidelines on prevention and management.J Feline
Med Surg. 2013 Jul;15(7):611-8. doi: 10.1177/1098612X13489224.
26. Pimenta , Paulo, Sofia Alves-Pimenta, João Barros, Maria J Pereira, Luís Maltez, A
Paula Maduro, Luís Cardoso,and Ana C Coelho. Blepharitis due to Cryptococcus
neoformans in a cat from northern PortugalJournal of Feline Medicine and Surgery
Open Reports July-December 2015 1: 2055116915593963, first published on July 6,
2015 doi:10.1177/2055116915593963
27. Poth T , Seibold M, Werckenthin C, Hermanns W. First report of
a Cryptococcus magnus infection in a cat. Med Mycol. 2010 Nov;48(7):1000-4. doi:
10.3109/13693786.2010.489584
28. Sutton, R. H. (1981), CRYPTOCOCCOSIS IN DOGS: A REPORT ON 6 CASES.
Australian Veterinary Journal, 57: 558–564.
29. Sameer R. Trivedi; Jane E. Sykes; Matthew S. Cannon; Erik
R. Wisner; Wieland Meyer ;Beverly K. Sturges; Peter J. Dickinson; Lynelle
R. Johnson, Clinical features and epidemiology of cryptococcosis in cats and dogs in
California: 93 cases (1988–2010). J Amer Vety Med Ass1, 2011,239,. 3, 357-369.
30. Trivedi SR , Malik R, Meyer W, Sykes JE. Feline cryptococcosis: impact of current
research on clinical management. J Feline Med Surg. 2011 Mar;13(3):163-72.
3. Malassezia dermatitis and otitis cats and dogs
3.1.
Introduction
Malassezia yeasts belong to normal cutaneous or mucosal microbiota of many
warm-blooded vertebrates. They are recognized as opportunistic pathogens
that play a significant role in the development of different human and animal
diseases such as otitis externa or seborrheic dermatitis.
Malassezia dermatitis and otitis occurs most commonly in animals with
allergies,
endocrinopathies
(hypothyroidism,
Cushing’s
disease),
immunosuppressive diseases and other skin diseases.
The genus Malassezia comprises 14 species, of which 13 Malassezia species
show an absolute requirement for long fatty acid chains. These “lipiddependent” yeasts are therefore seldom isolated in the laboratory unless
specific nutrients are provided in the medium. The species M.
pachydermatis is the only lipophilic yeast that may be isolated in regular
media like Sabouraud dextrose agar.
The most common causative organism is Malassezia pachydermatis. It is
normal to find a small number of these organisms on cats, dogs and even
people. However, overpopulation is common when the normal skin barrier is
compromised.
126
Dogs of any age, breed, or gender can be affected by yeast dermatitis.
Predisposing skin factors for Malassezia include warmth, moisture, increased
humidity, exaggerated skin folds, obesity and inflamed skin or ears.
Commonly affected breeds include West Highland White Terriers, Basset
Hounds, Cocker Spaniels, Springer Spaniels, and Chinese Shar Peis.
Although less common than in dogs, yeast dermatitis can occur in cats,
especially in Persian cats or cats with underlying internal disease.
Malassezia is not considered to be contagious to other animals or people;
however there are very rare reports of immunocompromised humans being at
greater risk of infection.
3.2.
Commonly affected breeds
o
o
o
o
o
o
o
o
West Highland white terrier,
dachshund, English setter,
basset hound,
American cocker spaniel,
Chinese Shar Peis.
Persian cats
springer spaniel, and
German shepherd.
West Highland white terriers are predisposed to Malassezia dermatitis (Service de
Parasitologei, ENVA)
127
Left:The skin of a basset hounds represents a very favourable biotope for the development
of Malassezia yeasts (Service de Parasitologei, ENVA), Right:The skin of Devon Rex cat
represents a favourable biotope for the development of Malassezia yeasts. In this breed,
high members of malassezia yeasts were detected in different anatomic sites, including
axilla, groin, ventral neck and nail folds (Service de Parasitologei, ENVA)
3.3.
Clinical Signs
Moderate to intense pruritus, which may be only partially responsive to
corticosteroids and antibiotics.
Affected animals typically have an offensive odour( yeasty or rancid).
Dermatitis is manifested either as a generalized or localized dermatitis (lesions
involving the ear, muzzle, interdigital areas, nail fold, ventral neck, medial thigh,
axilla, perianal region, and intertriginous areas).
Areas of the body commonly affected in dogs include the feet, nails, underside
of the neck, axillae, abdomen, legs and under the tail.
In cats, yeast infections can involve the chin or face, nails, or occasionally
elsewhere on the body.
Skin lesions are not specific for Malassezia dermatitis and reflect the existing
seborrhea and pruritus. Lesions may be:
o erythematous,
o scaly (yellow to slate gray with or without plaques),
o greasy or dry,
o crusty,
o hyperpigmented,
o lichenified,
o saliva-stained and alopecic
128
Left:The hind limb of an adult Shih Tzu Malassezia dermatitis secondary to demodicosis and
hypothyroidism Right: The ventral neck of a West Highland white terrier with Malassezia
dermatitis secondary to atopy, ADAM et al. (2002)
Left: axilla of a 6-month-old basset hound with Malassezia dermatitis and pyoderma.Right:
ventral abdomen of an adult male hound dog with Malassezia dermatitis, ADAM et al.
(2002)
Dermatitis of a cat associated with M. pachydermatis (arrow). .R. Batra et al. (2005)
129
Left fore foot of a seborrhoeic Devon Rex cat. Black, greasy material is tightly adhered to the
medial aspect of the claw of digit I, Right fore foot of a seborrhoeic Devon Rex cat. Black, greasy
material is adherent to the skin of the palmar aspect of the interdigital skin. Ahman et al.(2007)
Left: Alopecia and seborrheic dermatitis on the face of a cat, Right: Erythematous and
seborroeic lesions on the ears of a cat, Tresamol et al., 2012
Left: Erythema, crusts, and alopecia on the abdomen of a 6-year-old neutered female short-haired cat
with Malassezia overgrowth Middle: the same cat after the application of a 2% miconazole/2%
chlorhexidine shampoo (Malaseb®, Dechra) at 3 days interval for 4 weeks. Right:Brown and greasy
material observed in the nail folds of a cat (with Malassezia overgrowth. Crosaz et al. (2013)
Left:
Ear showing obvious signs of Malassezia Pachydermtitis, clearly inflammed and showing a
131
crusty cove, www.bassetsrus.co.uk, Right: Otitis externa caused by Malassezia. Katerina
Varjonen and Ross Bond , 2009
3.4.
Predisposing factors:
Skin microenvironmental factors favourable for yeast overgrowth include
excessive sebum production, diminished sebum quality, moisture
accumulation, a disrupted epidermal surface, and concurrent dermatoses.
Diseases that cause cutaneous inflammation and altered sebum production and
quality
o allergies (atopy, food allergy, flea allergy, and contact allergy),
o keratinization disorders (seborrhea),
o bacterial skin diseases,
o endocrinopathies (hyperadrenocorticism,
o hypothyroidism, diabetes mellitus4 ),
o metabolic diseases (zinc-responsive dermatosis and superficial
necrolytic dermatitis),
o cutaneous or internal neoplasia.
3.5.
Aetiology:
3.5.1.
Historical:
Eichstedt in 1846: was the first to note the fungal nature of the aetiology of
Pityriasis versicolor.
Robin 1853: identified it as Microsporon furfur
Baillon1889: created a new genus Malassezia and replaced the name
Microsporon furfur by Malassezia furfur
Rivolta 1873: placed the organism within the genus Cryptococcus
Malassez 1874: described spherical and oval “spores” in scaly lesions of the
scalp and named them Saccharomyces ovalis and Saccharomyces sphaericus
Sabouraud 1904: established a new genus Pityrosporum for the above
mentioned species.
Aldo Castellani and Albert J. Chalmers 1913: introduced the name
Pityrosporum ovale
Albert J. Chalmers 1925: managed to isolate the organism in culture
Weidman 1925:
was first to use the
name Pityrosporum
pachydermatis (Greek for "thick-skin") for a yeast isolated from an Indian
rhinoceros (Rhinocerosus unicornis) with severe exfoliative dermatis.
Panja 1927: recognized similarities between Malassezia and Pityrosporum
and he suggested a single genus for these yeasts
Dodge 1935: proposed the name Malassezia pachydermatis for the yeast
isoalated by Weidman
Morris A. Gordon 1951: isolated from PV lesions and healthy skin the doublecontour, globose cells that he named Pityrosporum orbiculare.
Gustafsson 1955: was the first, who associated the yeast with canine otitis
externa in and gave it the names Pityrosporum canis
131
Gordon 1951: described a new species and named it Pityrosporum orbiculare
Lodder and Kerger-van-Rij 1952: accepted the Genus Pityrosporum of
Sabouraud and listed 3 species of Pityrosporum, P. ovale, P. pachydermatis
and P. orbiculare
Lodder and Kerger-van-Rij 1984: in the third edition of “The Yeasts”, a single
generic name was proposed for these yeasts and Malassezia was accepted.
The International Commission on the Taxonomy of Fungi 1986 approved the
genus Malassezia
3.5.2. Currently recognized species of the genus Malassezia
1. Malassezia furfur (Robin) Baillon (1889)
2. Malassezia pachydermatis (Weidman) Dodge (1925)
3. Malassezia sympodialis Simmons & Guého (1990)
4. Malassezia globosa Midgley, Guého & Guillot (1996)
5. Malassezia obtusa Midgley, Guillot & Guého (1996)
6. Malassezia slooffiae Guillot, Midgley & Guého (1996)
7. Malassezia restricta Guého, Guillot & Midgley (1996)
8. Malassezia dermatis Sugita, Takashima, Nishikawa & Shinoda (2002)
9. Malassezia japonica Sugita, Takashima, Kodama, Tsuboi & Nishikawa (2003)
10. Malassezia nana Hirai, Kano, Makimura, Yamaguchi & Hasegawa (2004)
11. Malassezia yamatoensis Sugita, Tajima, Takashima, Amaya, Saito, Tsuboi & Nishikawa
(2004)
12. Malassezia caprae Cabañes & Boekhout (2007)
13. Malassezia equina Cabañes & Boekhout (2007)
14. Malassezia cuniculi Cabañes , Vega &Castellá (2011).
3.5.3.
Malssezia species isolated from cats and dogs
3.5.3.1.
M. pachydermatis,
M. pachydermatis is a lipophilic species,
M. pachydermatis able to grow without supplementation of long-chain fatty
acids or their esters.
All isolates grow well at 37 C,
M. pachydermatis occurs rarely on humans, although it has been found to
cause septic epidemics, usually in neonates receiving intravenous lipid
supplementation.
M. pachydermatis is well-known as a normal cutaneous inhabitant of
numerous warm-blooded animals.
Seborrhoeic dermatitis and otitis associated with this lipophilic yeast are now
commonly recognized, especially in dogs.
3.5.3.2.
M. sympodialis
M. sympodialis is characterized by a strong b-glucosidase activity and growth
at 37oC,
Poor growth with cremophor EL as a lipid supplement.
M. sympodialis cells are small and ovoid.
132
M. sympodialis is commonly isolated from healthy as well as diseased skin.
M. sympodialis is often present in skin lesions
M. sympodialis has also been isolated from healthy feline skin
Its role as a pathogen has not yet been elucidated.
3.5.3.3.
M. slooffiae does not grow with cremophor.
M. slooffiae is regularly isolated from human skin and is mostly found in association
with M. sympodialis or M. globosa.
M. slooffiae may be a weak human pathogen, and seems better adapted to animals,
especially pigs.
3.5.3.4.
M. slooffiae
M. obtusa
M. obtusa resembles M. furfur morphologically
M. obtusa does not grow at 37 C,
M. obtusa cannot utilize any of the five lipids used in the tests.
M. obtusa darkens esculin medium.
M. obtusa is a rare species that was known only from healthy human skin.
M. obtusa was recently isolated from goats, horses and dogs.
3.5.3.5.
M. furfur
M. furfur is the cause of pityriasis versicolor in man
M. furfur is morphologically heterogeneous with globose, oval or cylindrical
yeast cells.
M. furfur can be identified by its ability to grow at 37 °C, strong catalase
activity, absence or a very weak β-glucosidase activity, and equal growth in
the presence of cremophor EL (=castor oil) and Tweens 20, 40, 60, 80 as sole
lipid sources
3.5.4. Characteristics of Malassezia species
)
Salient characteristics of Malassezia species (R. Batra et al. / FEMS Yeast Research 5 (2005) 1101–1113
133
3.5.5. Malassezia pachydermatis (Weidman) C.W. Dodge, Medical
mycology. Fungous diseases of men and other mammals: 370
(1935)
Synonyms:
≡Torulopsis pachydermatis (Weidman) Krassiln.
≡Pityrosporum pachydermatis Weidman, Rep. Lab. Mus. Comp. Path. Zool. Soc. Philad.: 36 (1925)
≡Cryptococcus pachydermatis (Weidman) Nann., Repert sist dei miceti 4: 345 (1934)
=Pityrosporum rhinocerosum Sabour.
=Pityrosporum canis Gustafson, Otitis externa in the Dog, Stockholm: 46 (1955)
Cultural characteristics
The growth patterns of Malassezia pachydermatis shows poor growth on Blood Agar
and DTM after 72 h at 37 "C, but grows well on SDA, YM and modified malt extract
agar after 48 h at 37 "C. On the surface of plates two colony forms are observed: (a)
white-creamy, matt, smooth, moist colonies, 0.5-1 mm in diameter (35 strains); and
(b) dark creamy, dry, fragile (hard to suspend) colonies,0.2-0.8 mm in diameter. Both
types of colonies firmly adhere to the agar surface and assume a dark-brownish colour
with age. On BA, a poor growth of pin-point sized colonies is observed after 3-4 days.
These colonies are non-haemolytic, but the agar around them shows a dark
discolouration.
134
Malassezia pachydermatis, colonies on SDA (left, ww.scienceopen.com) and on Potato dextrose
agar (right, www.pf.chiba-u.ac.jp), supplemented with chloramphenical at 25℃ for 14 days, Culture
was obtained from the outer ear of a dog.
Primary isolation plate composed of modified Dixon's agar inoculated with a swab from the claw
fold of the fore foot of a seborrhoeic Devon Rex cat. Two colony types of M. pachydermatis are
represented; large, domed, entire yellow colonies (above letter A) and smaller, buff-coloured,
domed or umbonate colonies (above letter B). The smaller yellow colonies are examples of M.
slooffiae (above letter C). Ahman et al. (2007)
Malassezia pachydermatiswww.pfdb.net (Y. Nishiyam)
135
www.studyblue.com
Malassezia pachydermatis round cells
rod-shaped elongated cells, Kiss et al. 1996
M. pachydermatis. C,d,e, Nomarski’s and SEM micrographs showing ovoid to short cylindrical yeast cells with
a broad budding site; (e), showing the helicoidal structure of the cell wall; (f), details of Cr EL and Tween 40
utilization showing secondary growth within the inhibitory areas, E. Guého-Kellermann et al., 2010
Biochemical characteristics:
None of the carbohydrates is fermented. After 48 h glucose is assimilated by all
strains, mannitol and sorbitol assimilation is variable. All strains assimilate peptone
but none assimilate (NH4)2S04K, N0 3 or ethanol. Urease test on Christensen's agar
rapidly gives a positive result, within 24 h at 37 "C. Indole is negative, catalase
variable, lecithinase activity on eggyolk positive strong peroxidase activity and
negative coagulase (either on a slide or in a tube)
3.5.6. Reports on Malassezia pachydermatis in cats and dogs
Baxter (1976) investigated the frequency of Malassezia pachydermatis within the
non-otitic external ear canals of dogs and cats and an assessment of the abundance of
the yeast made by microscopic and cultural techniques. It was present in varying
136
amounts in 49% of clean dog ears and 23% of clean cat ears. Microscopically, 14% of
the ears were found to contain the yeast in large numbers. A further 3 % of ears
examined showed excessive cerumen production and all these contained the yeast.
The prevalence of M. pachydermatis in non-otitic ears of both dogs and cats was
similar to that previously reported in otitic ears.
Gedek et al. (1979) assessed the bacterial and mycotic flora in 158 ears of dogs with
otitis externa and in 101 ears of healthy control dogs. Malassezia pachydermatis
occurred in 57 per cent of ears with otitis externa and in 17 per cent of clinically
healthy ears. Staphylococci and Pseudomonas aeruginosa were the predominant
bacteria in otitic ears, micrococci and Bacillus spp were the most frequent isolates
from clinically healthy ears. Malassezia pachydermatis mainly chronic cases of otitis
externa. A combination preparation, containing miconazole, polymyzin B and
prednisolone, was highly effective in controlling the clinical signs of otitis externa
and eliminating flora from the affected ears. The data presented suggest that yeasts,
and especially Malassezia pachydermatis, may be significant pathogens in otitis
externa and that antimycotic treatment is an essential part of the treatment of otitis
externa in dogs.
Dufait (1983) was the first one to report Malassezia yeasts as a cause of generalized
dermatitis in dogs. He described a series of 50 dogs with pruritic dermatitis from
which the yeasts could be readily recovered by cytology or culture and which
responded to antifungal therapy. Skin lesions consisted of erythema and
hyperpigmentation that most often affected the ventral abdomen, although the face,
feet and perineal regions were also commonly affected.
Gabal (1988) conducted a study on the mechanism of infection and the
characterization of Malassezia pachydermatis in connection with canine otitis
externa. The ability of this yeast to grow uninhibited in intimate contact with the
diversity of other microbial isolants of the canine aural canal was demonstrated.
Canine cerumen seemed to promote the growth of this yeast. Although the source of
infection is still obscure, M. pachydermatis managed to survive in soil and dust at
different temperatures for four weeks. Among the commonly used diagnostic media,
Sabouraud's dextrose agar was shown to be the most supportive for the growth of this
yeast.
Plant et al. (1992) evaluated the prevalence of cutaneous Malassezia spp in a semi
quantitative fashion at 3 sites on 98 dogs examined because of various dermatoses.
Thirty (10.2%) of the sites and 19 (19.4%) of the dogs had Malassezia spp amounts
higher than that found on grossly normal skin. The prevalence of higher than normal
amounts did not correlate significantly with sample site, sex, or age. The factors
associated with an increased prevalence of increased Malassezia spp counts
were seborrheic dermatitis, recent antibiotic treatment, and breed.
Bond et al. (1994) compared the Malassezia pachydermatis populations of the axilla
and groin of 12 normal and 12 atopic dogs using tape-strips and contact plates. When
assessed by either method, the mean density of yeasts in the groin of the atopic dogs
was significantly greater (P<0.05) than that of the normal dogs, suggesting that the
cutaneous microenvironment of the groin region of the atopic dogs favoured
colonisation by this yeast. Differences between the counts from the axilla were not
significant. The frequency of isolation of yeasts from both dogs and sites was
137
significantly higher (P<0.05 and P<0.001, respectively) in the atopic group. There
was a very highly significant correlation (P<0.001) between the tape-strip counts and
contact plate counts in the atopic group only. This study suggests that isolation of
numerous M pachydermatis colonies from the axilla and groin of dogs using contact
plates is indicative of elevated skin surface populations. The simplicity of the contact
plate method makes it suitable for the routine quantitative culture of cutaneous M
pachydermatis populations in dogs with dermatological disease.
Bond et al. (1995) sub-cultured 244 Malassezia colonies which had been isolated
from a colony of Beagle dogs using modified Dixon's agar on Sabouraud's dextrose
agar to determine their lipid dependence, 30 showed poor growth resembling M.
furfur, whereas the remainder were typical of M. pachydermatis. Eight of the 10 poor
growing isolates selected for further study formed colonies typical of M.
pachydermatis after five passages on Sabouraud's dextrose agar at 4 d intervals and
two continued to show poor growth. Nine isolates had enzyme profiles identical to
those of typical M. pachydermatis isolates, and one resembled M. furfur. However,
seven of the poor growing isolates which were karyotyped had patterns typical of M.
pachydermatis. Poor growing isolates and their non-lipid-dependent 'revertants' had
identical restriction fragment length polymorphism patterns and poly(GT)
hybridization profiles. These observations show that some M. pachydermatis isolates
grow poorly when sub-cultured onto Sabouraud's dextrose agar and may be
incorrectly identified as M. furfur if further studies are not performed.
Bond et al. (1995) studied the skin and mucosal carriage of Malassezia
pachydermatis in 20 healthy pet dogs of various breeds and in 20 kennelled beagles.
Using swabs, anal carriage was detected in 10 pet dogs and 11 beagles and the nose,
mouth, prepuce and vulva were shown to be infrequently colonised. M
pachydermatis was isolated from the external ear canal of 11 beagles and two pet
dogs; both the population sizes and frequency of isolation were significantly (P<0·05)
greater in the beagles. The yeast was infrequently isolated from the axilla and groin in
low numbers using contact plates and detergent scrub samples but was often cultured
from the lower lip and the dorsal interdigital spaces; isolation frequencies and
population sizes in the two groups of dogs were not significantly different. These
results demonstrate that the anus, external ear canal and lip and interdigital skin of
healthy dogs are frequently colonised by M pachydermatis.
Åkerstedt, J. and I. Vollset (1996) reviewed the clinical manifestation, aetiology,
diagnosis and treatment of disease conditions in dogs caused by M. pachydermatis.
They mentioned that a review of the diseases caused by Malassezia
pachydermatis has led to the conclusion that the yeast is an opportunistic pathogen
that depends on predisposing host factors and different immune suppressive
mechanisms for clinical manifestation. Until recently, the role of M. pachydermatis in
seborrhoeic dermatitis and otitis externa in dogs has been largely unrecognized.
Bond et al. (1996) investigated the carriage of Malassezia yeasts was investigated in
17 cats in two colonies using a lipid-supplemented culture medium. Malassezia
pachydermatis was isolated from one cat. Lipid-dependent Malassezia yeasts with
electrophoretic karyotypes consistent with M. sympodialis were isolated from all six
cats in one group and from one of 11 in the second group. To our knowledge, this is
the first report of the isolation of lipid-dependent yeasts from cats.
138
Kennis et al. (1996) performed a study to define the extent to which Malassezia
organisms can be recovered from the skin of clinically normal dogs and to assess
differences in organism recovery related to anatomic sampling site and to method of
collection. The number of Malassezia pachydermatis organisms were determined in
fungal cultures of samples obtained from the skin of 19 clinically normal dogs, using
an adhesive tape method to obtain samples from 10 sites/dog. Additionally, 3 methods
(direct impression, swabbing technique, and superficial skin scraping) that are
commonly used for obtaining samples for cytologic examination were evaluated.
Malassezia organisms were found in low numbers as part of the microflora of the skin
of clinically normal dogs. Number of organisms differed significantly for various
anatomic locations (chin, highest number; inguinal and axillary regions, lowest
number). Malassezia organisms were identified more frequently by use of adhesive
tape and fungal culturing than by the methods used for cytologic examination.
However, comparing methods used for obtaining samples for cytologic examination
with each other, marked differences were not detected in our ability to recover yeast
organisms among the 3 techniques.
Kiss et al. (1996) studied the morphological, cultural and biochemical characteristics
of 80 M. pachydermatis strains isolated from cases of canine otitis externa.
Microscopically, the strains could be subdivided into two phenotypes. All M.
pachydermatis strains grew well on Sabouraud glucose, yeast morphology and
modified malt extract agar, but formed two distinct colony types. All strains were
characterized by no fermentation. Assimilation of glucose, mannitol (42 strains),
sorbitol (40 strains) and peptone was observed, but no ethanol assimilation. Urease
and catalase tests were positive, while indole and acetoin production was not detected.
All strains showed proteinase, caseinase, lecithinase and peroxidase positivity but to
varying extents. Esterase activity was observed for all Malassezia strains when using
Tween 20, 40 and 60, whereas Tween 80 was hydrolysed by only 42 strains. No
coagulase or haemagglutinating activities were detected. When compared for satellite
phenomenon and vitamin requirements, some Malassezia strains could not grow in
the absence of nicotinic acid but grew well in the presence of staphylococci. In
susceptibility tests, all strains showed the highest susceptibility to ketoconazole. On
the basis of the biochemical differences, M. pachydermatis seems to be a
heterogeneous species and can be divided into two groups.
Bernardo et al. (1998) examined 130 dogs of different breeds and with different
clinical forms of external otitis were mycologically and bacteriologically. Forty six
of those dogs showed abnormal cerumen with a high yeasts contamination. These
yeasts belong to four species: Malassezia pachydermatis (80.4). The most affected
dogs were a pendulous ears breeding (65,7%) and males (86,8%). Some dogs had
other cutaneous disorders (seborrhoeic dermatitis, pemphigus). In vitro tests, using
seven different antifungal drugs were systematically performed. All strains revealed
to be 5-fluorocytosine-resistant and 32% of them were also resistant to nystatin. One
M. pachydermatis isolated was resistant to all of the tested antifungal drugs
Morris (1999) stated that dermatitis and otitis caused by the yeast Malassezia
pachydermatis is common in dogs, but unusual in cats. These conditions are
extremely pruritic and may occur in conjunction with concurrent or predisposing
diseases such as allergic dermatitis or endocrinopathy.
139
Oliveira et al. (2001) evaluated the frequency of Malassezia pachydermatis infection
and other infectious agents in dogs with external otitis and with healthy auditory
tubes. Samples from the auditory tube of 102 dogs with otitis and from 32 healthy
dogs were submitted to direct microscopic examination and cultured in blood agar and
Sabouraud dextrose agar with chloramphenicol and cycloheximide. Direct
examination showed more than ten cells of M. pachydermatis in 52.0% of the samples
from dogs with otitis, but in only 21.8% of the healthy auditory tube samples. M.
pachydermatis was isolated in 37.5% of the samples from dogs with healthy auditory
tube and 76.5% (p<0.01) of the samples from dogs with otitis. There was an
association between M. pachydermatis and Staphylococcus aureus (p<0.01), but not
with Pseudomonas aeruginosa (p>0.05). Infection by M. pachydermatiswas prevalent
in the following breeds: Cocker Spainel, German Shepherd and Brazilian Fila. No
differences were found in frequency of the infection in relation to age, sex and ear
anatomy of the dogs. Otomycosis were predominantly ceruminous and
erythematous. M. pachydermatis was the most frequent agent in external otitis.
Crespo et al. (2002) studied the lipophilic microbiota of the external ear canals of 332
animals (264 dogs and 68 cats), with and without otitis externa, over an 11-year
period from 1988 to 1999. Malassezia pachydermatis was isolated from 62.2% and
50% of dogs with and without otitis externa, respectively, and from 41.2% and 17.6%
of cats with and without otitis externa, respectively. In the group of animals studied
for lipid-dependent species, these yeasts were isolated from 4.5% of dogs with otitis
externa and from 23.1% and 8.9% of cats with and without otitis externa,
respectively. M. sympodialis and M. furfur were isolated from cats and M. furfur and
M. obtusa from dogs. Our findings show that lipid-dependent Malassezia species may
contribute to the etiology of otitis externa in dogs and cats.
Prado et al. (2004) examined 19 dogs with unilateral or bilateral corneal ulcers and
60 healthy dogs for the presence of Malassezia pachydermatis . A total of 158
clinical specimens from both the groups were obtained from the conjunctival sac of
each eye by a calibrated platinum loop. The samples were placed on Dixon and blood
agar, incubated at 35 °C, and examined daily for 15 days. Then, the strains were
subcultured on Sabouraud agar. Of 22 clinical specimens collected from the eyes with
corneal ulcers, five cultures (23%) were positive for M. pachydermatis. Of 16 samples
collected from the contralateral healthy eye, cultures were positive in three samples
(19%). Three animals had unilateral corneal ulcer and positive cultures for M.
pachydermatis in both the eyes. Two dogs had unilateral corneal ulcer and positive
cultures for M. pachydermatis in the same eye. However, from the 120 samples of 60
healthy dogs, only four clinical specimens (3%) had positive cultures for M.
pachydermatis. The findings of M. pachydermatis, in a considerable percentage of
clinical specimens from dogs with corneal ulcer, suggest its possible role at least as an
aggravating factor in the pathophysiology of this disease.
Cafarchia et al. (2005) mentioned that out of the 413 isolates obtained from animals
with and without otitis, 403 (97.6%) were identified as M. pachydermatis and 10
(2.4%) as M. globosa. A statistical evaluation of the occurrence of Malassezia yeasts
in dogs and cats revealed that predisposing factors for Malassezia infections are
sampling period for cats, and type of ear for dogs. The largest population of
Malassezia yeasts was detected in animals with otitis, suggesting a role in the
occurrence of lesions.
141
Ahman et al. (2007) investigated skin and anal mucosal carriage of Malassezia spp.
yeasts in 21 healthy Devon Rex cats (DRC) and in 9 seborrhoeic DRC using swabs
and contact plates. M. pachydermatis was isolated from 26 cats and lipiddependent Malassezia spp. isolates were recovered from the claw fold of 5 healthy
and 3 seborrhoeic DRC. The frequencies of isolation and population sizes of M.
pachydermatis in the axillae, left groin and claw fold in seborrhoeic DRC
significantly exceeded (P<0.05) those of healthy animals. The frequencies of isolation
and population sizes of M. pachydermatis in the axillae and groin in both groups of
DRC, and the frequencies of isolation and population sizes of M. pachydermatis in the
claw fold of the seborrhoeic DRC, exceeded those of healthy Domestic short-haired
cats. Using polymerase chain reaction – restriction enzyme analyses (PCR-REA)
based on amplification of the large subunit rRNA gene, all eight lipid-dependent
isolates had profiles that were indistinguishable from that of M. slooffiae CBS 7956.
These data indicate that DRC are frequently colonized by M. pachydermatis and that
the claw folds may also be colonized by M. slooffiae.
Ahman et al. (2007) described Two distinct M. pachydermatis colony morphologies,
i.e., ‘type A’ colonies were large, domed, entire yellow colonies, often surrounded by
precipitates in the medium, that grew well when sub-cultured on Sabouraud's dextrose
agar as opposed to ‘type B’ colonies which were smaller, buff-coloured, domed or
umbonate with precipitates, which grew quite poorly but could be maintained on
Sabouraud's dextrose agar
Dizotti and Coutinho (2007) studied 45 cats, 20 with and 25 without otitis externa
(OE). Cerumen or secretion from external ear canal samples was cultured on
modified Mycosel agar and sterile olive oil was added to the surface of the medium
before specimen seeding. The isolates were analysed for macro- and
micromorphology and identified by catalase tests and on the basis of growth on
Tween 20, 40, 60 and 80. Malassezia spp. were isolated from 15 out of 20 (75%)
animals with otitis and from 7 out of 25 (28%) cats without OE; the difference
between the two groups was statistically significant (P ≤ 0.05). Malassezia
pachydermatis and M. sympodialis were isolated from 60% (12/20) and 40% (8/20)
of cats with otitis, respectively, with no significant difference in the frequency of
isolation between the two species. In the microflora of the healthy ear canal M.
pachydermatis was significantly more common (6/25, 24%) than M. sympodialis
(1/25, 4%).
Ahman and Bergström (2009) investigated cutaneous carriage of Malassezia
species yeast in 32 Sphynx cats, and in 10 domestic shorthair (DSH) cats. Samples
for mycological culture were taken using contact plates and swabs at seven sites in
each cat (left and right axillae and groin, left ear, claw fold on left front paw and the
interdigital palmar web of the left front paw). Malassezia species were isolated from
26/32 Sphynx cats (81%) and from 0/10 DSH control cats. In five cases Malassezia
species yeasts were isolated at a single site, in the remaining 21 Sphynx cats at
multiple sites. A total of 73 Malassezia species isolates were identified, of which 68
were Malassezia pachydermatis and five were lipid-dependent Malassezia. Five out
of the 32 Sphynx had greasy seborrhoea, and all seborrhoeic cats had M
pachydermatis isolated from their skin, at multiple sites. None of the 32 Sphynx had
Malassezia species isolated from the ears. The difference in population sizes between
Sphynx and DSH cats was significant (P<or=0.05) for the axillae, groins and claw
141
fold. The difference in frequency of isolation was significant (P<or=0.05) for the
axillae and right groin. The level of cutaneous carriage of Malassezia species in
Sphynx was similar to that previously reported for Devon Rex cats (DRC) The poor
recovery of Malassezia species from ears in both Sphynx and DRC, has clinical
implications for dermatological sampling in these breeds.
Čonková et al. (2011) performed a study to evaluate the prevalence of
yeast Malassezia pachydermatis in dogs from Slovakia in relation to different
predisposition factors (sex, age, body localisation, hair type, and season). Samples of
ear swabs (58) and dermal swabs (131) from 147 dogs with clinical symptoms of
suspected yeast dermatitis and/or otitis, were examined between June 2005 to June
2007. Relatively higher prevalence of M. pachydermatis was found in samples taken
from males (45.2%) than in females (35.2%), and in geriatric dogs (63.6%) than in
young (42.5%) or adult (38.5%) dogs. Malassezia pachydermatis was isolated more
often from ear swabs (44.8%) than from skin swabs (38.9%). Prevalence of M.
pachydermatis was significantly higher (p < 0.05) in samples from the trunk area
(60.3%) than in samples from other skin areas. Significantly higher prevalence was
found in samples from long-haired (51.5%) and short-haired (45.9%) dogs compared
to smooth-haired (21.4%) dogs. The prevalence was relatively higher in the samples
taken in autumn (52.6%), than the other seasons: spring (36.1%), summer (27.3%),
winter (45.7%); those differences were not significant. Malassezia pachydermatis is
one of the most frequent yeasts isolated in dogs. Knowledge of factors predisposing to
development of infection is valuable attribute of the correct diagnostic approach and
case management.
Petrov and Mihaylov (2007) investigated 48 swab samples from dogs with otitis
externa by means of parallel cultivation on blood agar and Sabouraud dextrose agar,
supplemented with chloramphenicol and cycloheximide. Thirty four
plasmocoagulase-positive Staphylococcus spp., 12 M. pachydermatis, 7 Streptococcus
spp., 4 Escherichia coli, 4 Proteus mirabilis, and 3 Pseudomonas aeruginosa strains
were isolated. Association between: M. pachydermatis and Staphylococcus spp. (in 9
samples), M. pachydermatis and Streptococcus spp. (2 samples) and M.
pachydermatis and Escherichia coli, (in one sample) were determined. There were not
coinfections of M. pachydermatis with either Pseudomonas aeruginosa or Proteus
mirabilis.
Eidi et al. (2011) examined 62 healthy and 90 diseased privately owned dogs with
otitis externa (n = 66) or skin lesions (n = 24) localized on only 1 anatomical site were
Samples were collected from 8 anatomical sites (i.e. scalp, periorbital, perioral, back,
trunk, groin, interdigital, and external ear canal) using sterile cotton swabs moistened
with sterile saline solution (0.9% NaCl) for the external ear canal, and scraping with a
scalpel for other body sites. The most commonly isolated species in the diseased
group with culture-positive results was M. pachydermatis (55.2%).
Hernández-Escareño (2012) collected samples from 125 dogs from the external
canal of the left and right ear (n=250 ears), of which 180 were positive to Malassezia
pachydermatis, representing 72% (180/250) and 70 negatives or 28% (70/250).
Parameters considered for this study were: kind of ear, length of hair and size of the
animal. Samples were taken using sterile cotton swaps. Samples were cultured in
potato dextrose agar media with cycloheximide and chloramphenicol.
Crosaz et al. (2013) observed six cases of generalized dermatitis associated
with Malassezia overgrowth in cats presented to the Veterinary College of Alfort,
142
France. Elevated numbers of yeasts were observed in lesional skin by cytology and
culture. Skin lesions occurred on the face, ventral neck, abdomen and ear canals and
were characterized by some degree of alopecia, erythema and crusting. In most cases,
pruritus was intense. Contact plates filled with modified Dixon's medium were
applied on lesional skin. Plates were incubated at 32 °C for 5 days. Malassezia yeasts
were identified by microscopic examination of the cells and by physiological tests.
For all the cases, positive subculture on Sabouraud dextrose agar confirmed that the
colonies belonged to the non lipid-dependent species M. pachydermatis.
3.5.7. Reports on lipid-dependant Malassezia species in cats and
dogs
culture medium. Malassezia pachydermatis was isolated from one cat. Fifteen of the
20 lipid-dependent isolates (one to three isolates from each of the seven affected cats)
were karyotyped. All had profiles that were consistent with that of the type culture of
M. sympodialis CBS 7222 and with those of 30 M. sympodialis isolates from humans.
Seven bands of approximate sizes 1.62, 1"47, 1-29, 0"96, 0"76, 0-65 and 0"59 Mbp
were resolved. The second largest band stained with twice the predicted intensity
when measured using scanning densitometry, suggesting that this band represented
two unresolved chromosomes of similar size. The single M. pachydermatis isolate
was karyotyped and found to have the typical six-band profile of this species which
was consistent with that of the type culture of M. pachydermatis CBS 1879 Fifteen of
the 20 lipid-dependent isolates (one to three)
Bond et al. (1996) investigated the carriage of Malassezia yeasts was investigated in
17 cats in two colonies using a lipid-supplemented culture medium. Malassezia
pachydermatis was isolated from one cat. Lipid-dependent Malassezia yeasts with
electrophoretic karyotypes consistent with M. sympodialis were isolated from all six
cats in one group and from one of 11 in the second group. To our knowledge, this is
the first report of the isolation of lipid-dependent yeasts from cats.
Raabe et al. (1998) isolated 47 wild-type isolates of the genus Malassezia from dog
and cat specimens by means of a simple differentiating system recently published.
The purpose was to determine whether any of the other seven Malassezia spp. apart
from M. pachydermatis occur in carnivores. Of the 47 isolates, three had been
obtained from cats (ear 2, skin 1) and 44 from dogs (ear 37, skin 3, faeces 2, claw and
paw 2). After primary isolation, they were subcultured on Dixon agar and then
purified and differentiated by means of assimilation of Cremophor EL, splitting of
esculin, growth on lipid-free medium and formation of tryptophandependent pigments
and fluorochromes. Thus, a total of 100 strains could be obtained from the 47 primary
isolates. Referring to the source material, M. pachydermatis was found in 83%, M.
furfur in 45% and M. sympodialis in 75%. More than 80% of cultures were mixed,
comprising two or all three species; a single species was isolated in only nine cases.
This shows that animals are not colonized by M. pachydermatis alone, as has been
thought until now, but in nearly all cases by mixed cultures. Thus, (domestic) animals
could well be a reservoir for other Malassezia species such as M. furfur and M.
143
sympodialis. Surprisingly, Malassezia yeasts were also isolated from dog faeces,
indicating that they apparently pass through the gastrointestinal tract.
Crespo et al. (1999) isolated Malassezia furfur during a survey of the occurrence
of Malassezia species in the external ear canals of cats without otitis externa.
CRESPO et al. (2000) reported otitis externa associated with the lipid-dependent
species M. sympodialis in two cats. Case 1. A 10-year-old female Persian cat
presented with acute otitis externa in the right ear. The animal had pruritus and an
excessive aural discharge. On otoscopic examination, a generalized erythema was
seen, and the external meatus was full of flaky black wax. Case 2. A 14-year-old
female Angora cat presented with a chronic otitis externa in the left ear with pruritus.
The external ear canal was full of brownish wax, and erythema was seen on otoscopic
examination. Smears from the external ear canals of the two cats stained with Gram
and Diff-Quick stains revealed the presence of numerous Malassezia cells, more than
10 organisms per high-power field. Hyphae were not seen. Buds were formed on a
narrow base, which differed from the monopolar budding on a broad base typical of
M. pachydermatis. No bacteria were detected in any case. Cultures on Sabouraud
glucose agar (SGA), SGA supplemented with olive oil (10 ml/liter), Leeming’s
medium blood agar and MacConkey agar. Cultures on SGA supplemented with olive
oil and Leeming’s medium yielded numerous yeast colonies at 5 days of incubation.
Two different types of colonies were isolated on SGA supplemented with olive oil:
one type was yellow with a creamy texture, and the other was white with an oily
texture. On Leeming’s medium, all colonies were white with a soft texture. Cultures
on SGA were negative at 14 days of incubation. Bacteriological culture was negative
at 3 days of incubation (case 2). These lipid-dependent yeasts were identified as M.
sympodialis.
CRESPO et al. (2002) studied the lipophilic microbiota of the external ear canals of
332 animals (264 dogs and 68 cats), with and without otitis externa, over an 11-year
period from 1988 to 1999. Malassezia pachydermatis was isolated from 62 2% and
50% of dogs with and without otitis externa, respectively, and from 41 2% and 17 6%
of cats with and without otitis externa, respectively. In the group of animals studied
for lipiddependent species, these yeasts were isolated from 4 5% of dogs with otitis
externa and from 23 1% and 8 9% of cats with and without otitis externa,
respectively. M. sympodialis and M. furfur were isolated from cats and M. furfur and
M. obtusa from dogs. Our Žndings show that lipid-dependent Malassezia species may
contribute to the etiology of otitis externa in dogs and cats
Hirai et al. (2004) isolated 5 isolates of a novel species of the yeast genus Malassezia
from animals in Japan and Brazil. Phylogenetic trees based on the D1/D2 domains of
the large-subunit (26S) rDNA sequences and nucleotide sequences of the internal
transcribed spacer 1 region showed that the isolates were conspecific and belonged to
the genus Malassezia. They were related closely to Malassezia dermatis and
Malassezia sympodialis, but were clearly distinct from these two species and the
other six species of Malassezia that have been reported, indicating that they should be
classified as a novel species, Malassezia nana sp. nov. Morphologically and
physiologically, M. nana resembles M. dermatis and M. sympodialis, but can be
distinguished from these species by its inability to use Cremophor EL (Sigma) as the
144
sole lipid source and to hydrolyse aesculin. The type strain of M. nana is NUSV
1003T (=CBS 9557T =JCM 12085T ).
Cafarchia et al. (2005) mentioned that out of the 413 isolates obtained from animals
with and without otitis, 403 (97.6%) were identified as M. pachydermatis and 10
(2.4%) as M. globosa. A statistical evaluation of the occurrence of Malassezia yeasts
in dogs and cats revealed that predisposing factors for Malassezia infections are
sampling period for cats, and type of ear for dogs. The largest population of
Malassezia yeasts was detected in animals with otitis, suggesting a role in the
occurrence of lesions.
Dizotti and Coutinho (2007) studied 45 cats, 20 with and 25 without otitis externa
(OE). Cerumen or secretion from external ear canal samples was cultured on
modified Mycosel agar and sterile olive oil was added to the surface of the medium
before specimen seeding. The isolates were analysed for macro- and
micromorphology and identified by catalase tests and on the basis of growth on
Tween 20, 40, 60 and 80. Malassezia spp. were isolated from 15 out of 20 (75%)
animals with otitis and from 7 out of 25 (28%) cats without OE; the difference
between the two groups was statistically significant (P ≤ 0.05). Malassezia
pachydermatis and M. sympodialis were isolated from 60% (12/20) and 40% (8/20)
of cats with otitis, respectively, with no significant difference in the frequency of
isolation between the two species. In the microflora of the healthy ear canal M.
pachydermatis was significantly more common (6/25, 24%) than M. sympodialis
(1/25, 4%). The investigation confirmed that M. sympodialis can also act as an
aetiological agent of feline OE,
Behaviour of M. sympodialis in response to Tween 20 (below), 40,60 and 80 clockwise direction),
DIZOTTI and COUTINHO (2007)
Perrins et al. (2007) used a polymerase chain reaction-restriction enzyme analysis
(PCR-REA) method that differentiated the 11 species of Malassezia spp was used to
identify the lipid-dependent isolates that were obtained from two cats with diabetes
mellitus, two cats with hyperthyroidism and one cat with multicentric lymphoma. Six
isolates had PCR-REA patterns that were indistinguishable from M. slooffiae CBS
7956 and three matched M. nana CBS 9557.
Perrins et al. (2007) described field isolates of M. nana recovered from cats. On
primary isolation they formed small yellow colonies composed of small ovoid cells.
These isolates failed to grow on Sabouraud's dextrose agar at 32°C. Two isolates
showed profuse growth on modified Dixon's agar at 37°C whereas the other grew
145
poorly at this temperature. They were catalase-positive, failed to hydrolyse aesculin,
did not assimilate Cremophor EL but grew well in the presence of Tweens 40, 60 and
80. None of the isolates assimilated Tween 20, although each showed a ring of slight
growth some distance away from the well, resembling the inhibitory effects of high
Tween 20 concentrations described for M. sympodialis. The type culture CBS 9557
showed the same phenotype as the field isolates, as described previously , although
growth at 37°C was quite poor and a ring of distant growth was noted around the well
inoculated with Tween 20.
Growth around wells inoculated with Tweens (clockwise from top right: Tween 20, 40, 60, 80)
and Cremophor EL (centre) of a field isolate of Malassezia nana obtained from the left ear of a
hyperthyroid cat incorporated into Sabouraud's dextrose agar, Perrins et al. (2007)
Eidi et al. (2011) examined 62 healthy and 90 diseased privately owned dogs with
otitis externa (n = 66) or skin lesions (n = 24) localized on only 1 anatomical site were
Samples were collected from 8 anatomical sites (i.e. scalp, periorbital, perioral, back,
trunk, groin, interdigital, and external ear canal) using sterile cotton swabs moistened
with sterile saline solution (0.9% NaCl) for the external ear canal, and scraping with a
scalpel for other body sites. The most commonly isolated species in the diseased
group with culture-positive results was M. pachydermatis (55.2%), followed by M.
sympodialis (25.9%), M. furfur (10.3%), M. obtusa (5.2%), M. globosa (1.7%), and
M. restricta (1.7%), and in the healthy group with culture-positive results, the most
commonly isolated species was M. pachydermatis (58.8%), followed by M.
sympodialis (35.3%) and M. obtusa (5.9%). A total of 75 strains from 6 Malassezia
species isolated from both groups and their species were detected with a frequency
rate as follows: M. pachydermatis (56%), M. sympodialis (28%), M. furfur (8%), M.
obtusa (5.4%), M. globosa (1.3%), and M. restricta (1.3%).
3.6.
Diagnosis
3.6.1. Direct microscopic examination
o Cotton swab smears, skin scrapings, direct impression smears, and
acetate tape impressions are all routinely used to identify M.
pachydermatis cytologically.
146
o Smears are fixed then stained with a modified Wright’s stain or ink
o The tape is not fixed, stained with a modified Wright’s stain or ink
o The stained tape Is then applied to a glass slide with the adhesive side
down.
o The slide is examined under oil immersion, looking for unipolar
budding yeast that are described as peanut-, footprint-, or bottle-shaped
organisms
Diff-Quick stain of a smear from an ear swab of a dog with otitis externa showing the typical
monopolar budding on a broad base of M. pachydermatis.R. Batra et al. (2005)
Gram-stained smear from otic swab showing the presence of numerous M.sympodialis cells
3.6.2.
Histopathologic examination
o histopathologic examination has a low sensitivity in detecting
Malassezia species, because the yeast are removed from the skin
surface during processing.
o histopathology may sometimes show the yeasts on the surface of the
epidermis and in the infundibula, particularly in PAS stained sections
(although they are occasionally visible on HE stained sections).
147
Large number of Malassezia yeasts detected on the epidermis of a cat The sample was stained with
Periodic Acid–Schiff. Bar=10 μm (Pathology Department, Ecole Nationale Vétérinaire d'Alfort), .
Crosaz et al. (2013)
3.6.3. . Isolation on Sabouroud Dextrose Agar, with and without lipid
supplementation
o Colonies are sub-cultured in modified Dixon’s agar for identification at the
species level.
o The morphological identification criteria used to identify Malassezia spp.
are the cell shape, size, and the budding pattern.
o Lipid-dependent species are identified by the Tween assimilation method
(i.e. 20, 40, 60, 80).
o Catalase reaction, tryptophan, cremophor assimilation tests and esculin
splitting were used as additional tests to differentiate the species.
M. pachydermatis. (a) Convex colonies with an entire margin; (b) ovoid Gram stained yeasts in dog ear
cerumen (picture by the courtesy of Guillot);
148
Malassezia globosa. (A) Medium-sized, lighter in color, friable and crenated flat colonies
with a pointed button center (Leeming and Notman medium, 34℃, 14 days).
Malassezia restrica. (A) Small-sized, circular, umbonate, entire, dull colonies (Leeming and Notman
medium, 34℃, 14 days). (B) Small, spherical or oval cells with buds on a relatively narrow base
(Parker Quink-KOH stain, ×1,000). Data from the article of Ahn (Korean J Med Mycol 1998
Malassezia dermatis. (A) Large-sized, circular, smooth colonies (Leeming and Notman medium, 34℃,
14 days). (B) Spherical, oval, or ellipsoidal vegetative cells with monopolar budding (Parker QuinkKOH stain, ×1,000). Data from the article of Lim et al. (Korean J Dermatol 2007
M. nana cultured on agar at 32oC for 1 week, Cells of M. nana, small ovoid to globose with a narrow
end and monomorphic budding. Hirai et al.,
149
3.6.4. Molecular diagnosis
Molecular techniques
Molecular techniques may be preferable to these generally time-consuming
phenotypic methods since they may lack the ability to reliably discriminate between
the newly-described species and lipid-dependent isolates from animals.
Polymerase chain reaction (PCR) and restriction endonuclease analyses
(REA) which usually involve amplification and subsequent restriction of
portions of the highly variable ribosomal RNA gene are potentially applicable
for routine laboratory use
Specific molecular methods have also been developed for the identification of
Malassezia isolates, such as
o pulsed-field gel electrophoresis (PFGE),
o random amplification of polymorphic DNA (RAPD),
o DNA sequence analysis,
o restriction analysis of PCR amplicons of ribosomal sequences,
o amplified fragment length polymorphism (AFLP),
o denaturing gradient gel electrophoresis (DGGE), and
o terminal fragment length polymorphism (tFLP)
Of the molecular methods, PFGE and DGGE have met with limited success
due to the need for specialized equipment and training.
AFLP has been successfully applied to the identification of Malassezia isolates
and yields highly-specific genotypic information about each strain.
The detailed ‘‘fingerprint’’ achieved from careful AFLP analysis has revealed
multiple genetic subgroups in each Malassezia species, and may lead to the
differentiation of clinically-important subgroups or even new species.
The new method, named terminal fragment length polymorphism (tFLP), can
be used on non-invasively acquired swab samples. This method uses only
three primer sets, and therefore minimizes the potential bias related to
amplification efficiency. It is sensitive enough to detect Malassezia with as
few as 100 cells per sample, either as spiked directly onto the swab to control
the extraction procedure, or from samples collected from 1 cm2 of skin
surface sample using a swab.
Reports
Huan et al. (1998) reported an outbreak of Malassezia pachydermatis in an Intensive
Care Nursery, eight patients with bloodstream infections, two with urinary tract
infections, one with meningitis, and four with asymptomatic colonization. In a pointprevalence survey, 9 additional infants, 1 health care worker, and 12 of the health care
workers' pet dogs had positive cultures for M. pachydermatis. The isolates from all
case patients, the 9 additional colonized infants, 1 health care worker, and 3 of the 12
dogs had identical patterns of restriction-fragment–length polymorphisms. In this
outbreak, it was likely that M. pachydermatis was introduced into the intensive care
151
nursery on health care workers' hands after being colonized from pet dogs at home.
The organism persisted in the nursery through patient-to-patient transmission.
Pulsed-Field Gel Electrophoretic Patterns with Restriction EnzymeHae III in M. pachydermatis Isolates from
Infants in the Intensive Care Nursery and Health Care Workers' Dogs. Huan et al. (1998)
Aizawa et al. (1999) carried out molecular investigations of 16 strains, conventionally
identified to be Malassezia pachydermatis, isolated from dogs in Japan was by
random amplification of polymorphic DNA (RAPD) and chitin synthase 2 (CHS2)
gene sequence analyses. The RAPD band patterns of 13 clinical isolates were
identical to that of standard strain of M. pachydermatis (CBS-1879). The other three
clinical isolates were different from the standard strain of M. pachydermatis in RAPD
patterns, and two of the three isolates were identical. About 620 bp genomic DNA
fragments of the CHS2 gene were amplified from the same 16 clinical isolates of M.
pachydermatis by polymerase chain reaction (PCR) and sequenced. The phylogenetic
analysis of the nucleotide sequences of CHS2 gene fragments of the 16 clinical
isolates revealed that the 13 strains were genetically very close to the standard strain
of M. pachydermatis and the other two isolates were genetically close to the standard
strain of M. furfur rather than M. pachydermatis. The remaining one isolate was
phylogenetically distinct from all the seven Malassezia species reported so far.
Aizawa et al. (2001) carried out molecular investigation of 110 clinical isolates of
non-lipid-dependent Malassezia pachydermatis from dogs and cats by random
amplification of polymorphic DNA (RAPD) and chitin synthase 2 (CHS2) gene
sequence analyses. The RAPD analysis indicated that the clinical isolates of M.
pachydermatis constituted four distinct genetic types (A, B, C and D). Moreover, the
results from CHS2 gene analysis completely agreed with those from the RAPD
analyses. The clinical isolates of M. pachydermatis were obtained from normal
external ears, lesions of atopic dermatitis, flea allergic dermatitis, otitis externa,
pyoderma and seborrheic dermatitidis in dogs and cats. Type A consisted of 93
clinical isolates as well as the ex-neotype strain of M. pachydermatis. The isolates of
type A M. pachydermatis originated from lesions of all kinds of diseases. They were
predominant on dog and cat skin. The other types, B, C, and D were isolated mainly
from otitis externa.
151
Chen et al. (2002) performed a study with the aim of this study was to compare IgE
responses to separated proteins of M. pachydermatis in 28 atopic dogs with
Malassezia dermatitis and 22 clinically normal dogs using Western immunoblotting.
Six different detection systems were evaluated in order to assess sensitivity and
eliminate nonspecific binding and cross-reactivity. The protocol yielding the best
results utilized a monoclonal mouse antidog IgE, an alkaline phosphatase conjugated
goat antimouse IgG which had been passed through a canine IgG column 3 times, a
chemiluminescent substrate and a digital imaging system. Proteins of 45, 52, 56 and
63 kDa were recognized by more than 50% of the atopic dog sera and thus
represented major allergens. Only a minority of normal dogs showed faint IgE
binding to these proteins. The results indicate that the majority of atopic dogs
with Malassezia dermatitis have a greater IgE response than normal dogs, suggesting
an IgE-mediated immune response may be clinically important in the pathogenesis of
the disease.
Coomassie Brilliant Blue stained M. pachydermatis extracts on a 10% separating polyacrylamide gel.
Lane 1: molecular weight markers; lane 2: Malassezia extract., Chen et al. (2002)
152
IgE-binding proteins in extracts of M. pachydermatis detected by immunoblotting with dog sera from 2
groups: (a) normal dogs; and (b) atopic dogs with Malassezia dermatitis. The images of blots were
captured by a digital imaging station and printed out directly from the computer. The numbers along the
bottom signify the strips probed with individual dog sera. The molecular weight markers on the left are
200, 116, 97, 66, 45, 31 and 21.5 kDa., Chen et al. (2002)
Hirai et al. (2004) isolated 5 isolates of a novel species of the yeast genus Malassezia
from animals in Japan and Brazil. Phylogenetic trees based on the D1/D2 domains of
the large-subunit (26S) rDNA sequences and nucleotide sequences of the internal
transcribed spacer 1 region showed that the isolates were conspecific and belonged to
the genus Malassezia. They were related closely to Malassezia dermatis and
Malassezia sympodialis, but were clearly distinct from these two species and the
other six species of Malassezia that have been reported, indicating that they should be
classified as a novel species, Malassezia nana sp. nov. Morphologically and
physiologically, M. nana resembles M. dermatis and M. sympodialis, but can be
distinguished from these species by its inability to use Cremophor EL (Sigma) as the
sole lipid source and to hydrolyse aesculin. The type strain of M. nana is NUSV
1003T (=CBS 9557T =JCM 12085T ).
Ahman et al. (2007) mentioned that lipid-dependent Malassezia spp. isolates were
recovered from the claw fold of 5 healthy and 3 seborrhoeic DRC cats. Using
polymerase chain reaction – restriction enzyme analyses (PCR-REA) based on
153
amplification of the large subunit rRNA gene, all eight lipid-dependent isolates had
profiles that were indistinguishable from that of M. slooffiae CBS 7956.
Restriction enzyme patterns obtained by MspI digestion of an amplicon of the large subunit rRNA gene
of M. slooffiae CBS 7956 and field isolates of Malassezia spp. obtained from cats. Tracks 1 and 11,
molecular weight marker (base pairs); 2, M. slooffiae CBS 7956; tracks 3–10, field isolates of M.
slooffiae from Devon Rex cats. Ahman et al. (2007)
Perrins et al. (2007) used a polymerase chain reaction-restriction enzyme analysis
(PCR-REA) method that differentiated the 11 species of Malassezia spp was used to
identify the lipid-dependent isolates that were obtained from two cats with diabetes
mellitus, two cats with hyperthyroidism and one cat with multicentric lymphoma. Six
isolates had PCR-REA patterns that were indistinguishable from M. slooffiae CBS
7956 and three matched M. nana CBS 9557. An amplicon of approximately 600 base
pairs (bp) was obtained from each of field isolates of lipid-dependent Malassezia spp.
and from each of the 11 CBS-derived cultures. Agarose gel electrophoresis of the
restriction digests using the three enzyme system produced distinct restriction patterns
for each of the 11 CBS cultures examined. The four new species (M. dermatis, M.
nana, M. japonica, and M. yamatoensis) could be differentiated from each other and
from the seven previously reported species using the combination of the three
restriction enzymes
154
155
Restriction patterns obtained by (a) BanI, (b) HaeII, and (c) MspI digestion of an amplicon of the
large subunit rRNA gene of 11 species of Malassezia. Tracks 1 and 8, molecular weight marker
(base pairs); 2, M. furfur CBS 1878; 3, M. globosa CBS 7966; 4,M. obtusa CBS 7876; 5, M.
restricta CBS 7877; 6, M. slooffiae CBS 7956; 7, M. sympodialis CBS 7222; 9, M. dermatis CBS
9169; 10,M. japonica CBS 9432; 11, M. nana CBS 9557; 12, M. yamatoensisCBS 9725; 13, M.
pachydermatis CBS 1879. Perrins et al. (2007)
Kobayashi
et al. (2011) performed molecular characterization of isolates
of Malassezia pachydermatis from healthy dog skin and from dogs with atopic
dermatitis using internal spacer 1 (IGS1) region analyses, and their phospholipase A2
activity and pH growth profiles were then characterized in vitro. The percentage of
isolates from healthy dogs that had the following IGS1 subtypes (isotype, %) were as
follows: 1A, 6%; 1B, 27%; 1C, 11%; 2A, 6%; 2B, 6%; 3A, 11%; 3C, 3%; and 3D,
24%. In contrast, 9% of isolates from dogs with atopic dermatitis were isotype IB and
91% were isotype 3D, indicating that isolates of subtype 3D were the most prevalent
in dogs with atopic dermatitis. Production of phospholipase A2 was statistically
higher in isolates of subtype 3D than in the other subtypes. The subtype 3D isolates
showed enhanced growth on alkaline medium compared with non-3D subtype
isolates. The main clinical sign of canine Malassezia dermatitis is waxy exudates on
the skin, which predispose the patient to development of a yeast overgrowth of the
subtype 3D. Increased phospholipase A2 production may be involved in the
inflammatory process associated with Malassezia dermatitis.
Hernández-Escareño (2012) collected samples from 125 dogs from the external
canal of the left and right ear (n=250 ears), of which 180 were positive to Malassezia
pachydermatis, representing 72% (180/250) and 70 negatives or 28% (70/250).
Parameters considered for this study were: kind of ear, length of hair and size of the
animal. Samples were taken using sterile cotton swaps. Samples were cultured in
potato dextrose agar media with cycloheximide and chloramphenicol. PCR tests
amplifying regions D1 and D2, coding for LSU rRNA were also performed and were
compared with the reference strain CBS 1879NT of M. pachydermatis. Amplified
product yielded a 600 bp product characteristic for Malassezia. Most predominant dog
breeds for external otitis were Cocker Spaniel, French Poodle and Criolla. In Mexico,
as well as in the state of Nuevo Leon, no documented evidence exists about the
presence of this yeast in dogs with external otitis. The objective was to analyze dogs
with this pathology and to inform the presence of M. pachydermatis by means of
culture and amplification of D1 and D2 regions of gen 26S rRNA.
156
Hernández-Escareño (2012)
3.7. Allergenic role of the
Malassezia pachydermatis
The lipophilic but not lipodependent yeast Malassezia pachydermatis is a component
of the normal cutaneous flora of the dog. Around 50 % of healthy dogs are carriers
(external ear canal, skin - anal area, lips and extremities, haircoat).
The response of the host to the yeast includes non-specific defense mechanisms
(phagocytosis by neutrophils) as well as cell-mediated specific defense mechanisms.
Local delayed hypersensitivity responses and/or innate immune mechanisms
(transferrin limiting microbial access to iron) play an important role.
Malassezia produce many enzymes (including lipases and proteases) which can
contribute to cutaneous inflammation through proteolysis, lipolysis (which alters the
lipid cutaneous fi lm), changes of cutaneous pH, eicosanoid release and complement
activation.
Malassezia pachydermatis could play an allergenic role in regard to a type 1
(immediate) hypersensitivity. Skin-testing with a Malassezia extract may show
immediate hypersensitivity reactions.
Recently, the functionality of anti Malassezia IgE has been demonstrated through
passive transfer using the Prausnitz-Küstner technique.
Some major allergens of Malassezia pachydermatis have been identified: proteins
with 45, 52, 56 and 63 kDa molecular weight.
The delayed hypersensitivity response is less well known. Patch-testing (epicutaneous
tests) has been evaluated recently and may be a good tool to explore delayed
hypersensitivity caused by the yeast.
Reports:
157
Bond et al. (1998) reported that the in vitro proliferative responses of peripheral blood
mononuclear cells from seven healthy basset hounds exposed to Malassezia
pachydermatis antigen (500 micrograms/ml) exceeded (P < 0.05) those of seborrhoeic
basset hounds with high populations of M pachydermatis and eight Irish setters with
gluten-sensitive enteropathy. The stimulation indices in the latter two groups and in
eight healthy beagles were comparable. The stimulation indices of the four groups after
exposure to phytohaemaglutinin did not differ significantly. The serum titres of M
pachydermatis-specific IgG and IgA measured by enzyme-linked immunosorbent
assays (ELISA) in 21 seborrhoeic basset hounds and 11 affected dogs of various
breeds exceeded those of 14 healthy basset hounds and eight healthy beagles (P < 0.01
for IgG, P < 0.05 for IgA). Total serum IgA concentrations measured by ELISA in the
affected dogs were not lower than those of healthy dogs.
Morris et al. (1998) investigated the potential allergenic role of the Malassezia
pachydermatis in 5 clinically normal nonatopic dogs, 10 atopic dogs with cytologic
evidence of Malassezia dermatitis, and 12 atopic dogs without cytologic evidence
of Malassezia dermatitis.. A crude yeast extract was produced by disrupting the cell
wall of M pachydermatis. The crude extract and 8 of its fractions, which were
generated by fractionation in a high-performance liquid chromatography column, were
injected along with 46 commercial allergens for intradermal allergy testing of normal
and atopic sample populations. Significant difference between atopic populations was
evaluated, using a threshold concentration of crude yeast extract that failed to induce
wheal-and-flare responses in normal nonatopic dogs. Atopic dogs with cytologic
evidence of Malassezia dermatitis had significantly greater wheal-and-flare reactions
to intradermal injection of crude extract of M pachydermatis than did atopic dogs
without cytologic evidence of Malassezia dermatitis.
Nuttall and Halliwell (2001) compared the serum IgG and IgE response
to Malassezia in
atopic
dogs
with
and
without
clinical
evidence
of Malassezia dermatitis and/or otitis, nonatopic dogs with clinical evidence
of Malassezia dermatitis and/or otitis and healthy dogs. Cytology was used to diagnose
clinically significant Malassezia dermatitis and otitis. Contact plate cultures confirmed
the validity of this technique. Reproducible enzyme-linked immunosorbant assays
for Malassezia-specific IgG and IgE in canine serum were established. Atopic dogs
had significantly higher serum IgG and IgE levels than either healthy dogs or
nonatopic dogs with clinical evidence of Malassezia dermatitis and/or otitis. There was
no significant difference in IgG and IgE levels between atopic dogs with and without
clinical evidence of Malassezia dermatitis and/or otitis
Bond et al. (2002) tested atopic dogs intradermally tested using extracts prepared from
M pachydermatis. The group comprised four entire males, five neutered males, two
entire females and seven neutered females aged between one and 11 years (median
four years). These dogs were diagnosed as having atopic disease based on a relapsing
or persistent history of pruritic dermatitis affecting the face, ears, feet and/or ventrum
which did not completely resolve following antimicrobial and antiparastic therapy, and
fulfilment of the criteria of Willemse (1986. Skin lesions of varying severity were
present, comprising erythema and the consequences of self-trauma. Concurrent or
previous Malassezia otitis externa was diagnosed in nine dogs, Malassezia dermatitis
in nine dogs, and six dogs had both otitis and dermatitis. These disorders were
diagnosed on the basis of suggestive clinical signs (greasy, erythematous, otitis externa
158
or dermatitis), cytological evidence of high M. pachydermatis populations, and a
clinical response to topical antifungal therapy. Ear populations were assessed
cytologically by microscopical examination of Diff-Quik-stained specimens made by
smearing ear wax on glass slides. Skin populations were assessed by microscopical
examination of tape-strip specimens stained with Diff-Quik. Populations were
considered high when the yeast was readily detected in multiple high-powered fields.
Dogs were sedated for intradermal testing using medetomidine (Domitor; Pfizer)
injected intravenously or intramuscularly at 10 rig/kg. Hair was clipped from the
lateral thorax, injection sites marked using a felt-tipped pen, and 0-05 ml of test or
control solution was injected intradermally. Histamine phosphate (1:100,000) and
sterile 0 5 per cent phenol saline served as positive and negative controls, respe
Bond et al. (2002)
Chen et al. (2002) performed a study aiming to compare IgE responses to separated
proteins of M. pachydermatis in 28 atopic dogs with Malassezia dermatitis and 22
clinically normal dogs using Western immunoblotting. Six different detection systems
were evaluated in order to assess sensitivity and eliminate nonspecific binding and
cross-reactivity. The protocol yielding the best results utilized a monoclonal mouse
anti-dog IgE, an alkaline phosphatase conjugated goat anti-mouse IgG which had
been passed through a canine IgG column 3 times, a chemiluminescent substrate and a
digital imaging system. Proteins of 45, 52, 56 and 63 kDa were recognized by more
than 50% of the atopic dog sera and thus represented major allergens. Only a minority
of normal dogs showed faint IgE binding to these proteins. The results indicate that
the majority of atopic dogs with Malassezia dermatitis have a greater IgE response
than normal dogs, suggesting an IgE-mediated immune response may be clinically
important in the pathogenesis of the disease.
Bond et al. (2004) evaluated the effects of the daily application for 7 days of
suspensions of Malassezia pachydermatis to normal canine skin in 10 beagle dogs.
159
Four out of six dogs challenged without occlusion developed transient lesions
generally characterized clinically by mild erythema with papules and histologically by
mild epidermal hyperplasia and a superficial perivascular dermatitis. Saline-treated
control sites showed no clinical signs. In four dogs challenged with occlusion, skin
lesions occurred at both yeast and saline-treated sites; erythema and papules were
more severe at the yeast-treated sites in three dogs. Occlusion induced more persistent
lesions, which resolved within 24 days. Population densities of the yeast were highest
at day 8 and declined rapidly following cessation of application. Peripheral blood
mononuclear cell proliferation indices following M. pachydermatis exposure in vitro
and serum concentrations of M. pachydermatis-specific IgG antibodies did not vary
significantly during the study. Delayed (24 h) intradermal test reactivity to M.
pachydermatis antigens developed in all eight dogs with clinical signs following yeast
exposure. This study suggests that the resistance of healthy canine skin to infection by
M. pachydermatis is mediated by local delayed hypersensitivity responses and, or
innate epidermal immune mechanisms.
Skin biopsy specimen from the reactive patch test site of dog 1, a basset hound
with Malassezia dermatitis. There are moderate periadnexal and perivascular inflammatory cell
infiltrates with predominance of neutrophils (Haematoxylin and eosin, bar = 30 microns). Inset:
numbers of CD3+ lymphocytes are also significantly increased (immunoperoxidase) Bond et al.
(2004)
Bond et al. (2006) evaluated the effects of the patch test application of Malassezia
pachydermatis extracts to normal canine skin in eight healthy beagle dogs. Antigens
(4 and 0.4 mg/ml) and saline controls were applied for 48 h using filter paper discs in
Finn chambers. At the first test, two dogs showed patch test reactivity 20 min and 24
h after patch removal. Four out of six dogs that did not react to the first patch test
showed reactivity when re-tested on day 8. Two remaining dogs were patch tested for
a third time on day 15, after 7 days of cutaneous challenge with suspensions of M.
pachydermatis cells, but failed to display reactivity. Positive patch test reactions were
characterized histologically by mild epidermal hyperplasia, superficial dermal oedema
and mild to moderate perivascular, periadnexal and interstitial infiltrates of
neutrophils and CD3+ lymphocytes. Four dogs showed delayed intradermal test
reactivity to M. pachydermatis antigens but intradermal and patch test reactivity did
not correlate. This study indicates that patch test reactivity to M. pachydermatis
161
antigen occurs in some healthy dogs exposed to the yeast, or may develop after a short
period of antigen exposure.
Patch test reactivity to Malassezia pachydermatis antigens in a healthy beagle dog (dog 5, week 2)
20 min after removal of patches applied for 48 h. Reading from left to right and top to bottom, no
reactivity is present at sites exposed to the saline control (sites 1, 4 and 7). There is a moderate
(grade + + +) reaction to antigen at site 6 (tape-stripped, 4 mg/ml) and weak (grade +) reactions at
sites 2 (scarified, 0.4 mg/ml), 3 (scarified, 4 mg/ml) and 8 (no treatment, 0.4 mg/ml), Bond et al.
(2006)
Skin biopsy specimen from a dog (dog 5, wessek 2) with a moderate (grade + + +) reaction to a 48
h patch test with aMalassezia pachydermatis antigen. The specimen was obtained 1 h after patch
removal. There is mild, irregular epidermal hyperplasia, spongiosis, superficial dermal oedema
and an interstitial dermal infiltrate composed of neutrophils with smaller numbers of eosinophils,
lymphocytes, plasma cells and macrophages (Haematoxylin and eosin, bar = 50 µm). The inset
shows a higher power field of the inflammatory cell infiltrate (Haematoxylin and eosin, bar = 10
µm). Bond et al. (2006)
161
Skin biopsy specimen from a dog (dog 5, week 2) with a moderate (grade + + +) reaction to a 48 h
patch test with aMalassezia pachydermatis antigen. Many of the dermal inflammatory cells are
CD3+ T-cells (arrows). The asterisk indicates a sebaceous gland. (EnVision™ polymeric two-step
labelling method, Gill's haematoxylin counterstain, bar = 25 um). Bond et al. (2006)
Bond (2013) reviewed the role of fungi in the pathogenesis of human and canine
atopic dermatitis (AD)/ He emphasized similarities and differences, where known,
between the two host species. He mentioned that Malassezia spp. yeasts predominate
amongst the resident skin mycobiota of both hosts and these yeasts may proliferate
and trigger clinically relevant immediate hypersensitivity responses, although dogs
are colonized by Malassezia pachydermatis whereas humans are not.
Glatz et al. (2015) mentioned that Malassezia spp. produces a variety of
immunogenic proteins that elicit the production of specific IgE antibodies and may
induce the release of pro-inflammatory cytokines. In addition, Malassezia spp.
induces auto-reactive T cells that cross-react between fungal proteins and their human
counterparts. These mechanisms contribute to skin inflammation in atopic dermatitis
and therefore influence the course of this disorder. Finally, we discuss the possible
benefit of an anti-Malassezia spp. treatment in patients with atopic dermatitis.
3.8. Treatment
Predisposing factors that can lead to yeast overgrowth should be removed
Failure to treat concurrent problems may result in partial treatment success,
treatment failure, or a relapse of Malassezia dermatitis.
To treat generalized Malassezia dermatitis, use topical agents alone or in
combination with systemic antifungals.
Prophylactic use of topical agents (shampoos, dips, creams, lotions) at least
twice a week to prevent recurrence is beneficial in relapsing cases once the active
infection is eliminated.
Use degreasing antiseborrheic agents (Benzoyl peroxide, benzoyl peroxide
with sulfur, 1%selenium sulfide, and tar shampoos) before applying the topical
antifungal to enhance the effectiveness of the antifungal agent.
Use antiseborrheic agents (sulfur, salicylic acid, and 1% selenium sulfide)
Use antifungal agents (Ketoconazole, miconazole, clotrimazole, and
chlorhexidine)
162
Antifungal shampoos (ketoconazole, miconazole, 3% or 4% chlorhexidine,
miconazole-chlorhexidine combination, or ketoconazole-chlorhexidine combination)
are applied to the coat and skin and left on for 10 to 15 minutes before rinsing.
Several new shampoos containing boric and acetic acid acidify the cutaneous
microenvironment, making the skin less favorable to yeast growth.
A solution of equal parts of white vinegar and water is an inexpensive
acidifying topical agent with residual activity. It is applied to the skin and left to dry.
Systemic antifungal therapy ((ketoconazole, itraconazole, and fluconazole) in
severe cases of Malassezia dermatitis or when topical therapy is unsuccessful, has
shown efficacy against Malassezia species.
o
ketoconazole is the most common one used to treat Malassezia
dermatitis. The dosage is 5 to 10 mg/kg orally once a day (or divided twice
daily) for 30 days. Dosages of 5 to 10 mg/kg daily for 10 days followed by
alternate-day therapy at the same dose for another 10 days have been reported
to be successful.
o
Ketoconazole
is excreted through sebum and eccrine glands,
has immunomodulatory and anti-inflammatory effects,
is better absorbed in an acidic environment and when taken
with food.
can alter the metabolism of some drugs, because it inhibits
cytochrome P-450 enzymes.
is contraindicated in pregnant bitches and in patients with liver
dysfunction,
Adverse effects include anorexia, nausea, vomiting, diarrhea,
elevated serum liver enzyme activities, icterus, pruritus, and a
reversible lightening of the haircoat
Reports:
Uchida et al. (1992) experimentally inoculated 8 beagles intraotally with Malassezia
pachydermatis to induce acute otitis externa. Three or 4 days after the inoculation, the
animals showed the symptoms of otitis externa. All ear canals were erythematous and
the dogs were shaking their heads. A large number of M. pachydermatis was noticed
in exudate taken from every ear canal. Clinical signs of otitis externa were reduced
after treatment with 0.1 ml (per canal) of 1% pimaricin suspension twice a day for 3
days. The amount of exudate decreased gradually and 12 of the 16 ear swabs
examined, thereafter, were found to be negative for M. pachydermatis within 10 days.
No side effects were observed in all the treated cases. These results suggested that M.
pachydermatis could induce the canine otitis externa, and that pimaricin is effective
agent for M. pachydermatis infection in ear canals.
Gupta et al.(2000) reported MICs ranging from 0.03 to 0.25 μg/mL. for ketoconazole
Hammer et al.(2000) reported the lowest MICs with ketoconazole,
Nakamura et al.(2000) tested seven Malassezia species and all were susceptible to
itraconazole; however, M. pachydermatis exhibited the highest MIC range among the
species evaluated.
163
Nègre et al. (2009), in a recent evidence-based review of the treatment of Malassezia
dermatitis in dogs concluded that there was good evidence for the twice-weekly use of
a 2% miconazole/2% chlorhexidine shampoo. The authors concluded that there was
fair evidence for the use of oral ketoconazole (10 mg/kg, once daily) and oral
itraconazole (5 mg/kg, once daily) for 3 weeks. Itraconazole might be preferred to
ketoconazole because it is better tolerated.
Pistelli et al. (2012) investigated the antifungal activity and the chemical
composition of essential oils (EOs) from some Mediterranean autochthonous plants
were investigated against Malassezia pachydermatis. Minimum inhibitory
concentrations (MICs) of Anthemis nobilis, Citrus limon, Citrus paradisi, Illicium
verum, Lavandula hybrida, Mentha piperita, Ocimum basilicum, Origanum vulgare,
Origanum majorana, Rosmarinus officinalis, Salvia sclarea, Thymus serpillum were
assessed by microdilution test; minimum fungicidal activity (MFC) was also
determined. O. vulgare, T. serpillum and O. basilicum showed the lowest MIC and
MFC values (0.8%) followed by C. limon and M. piperita (1%). EOs from the tested
plants showed variable degrees of anti-malassezia activity, putatively related to their
chemical composition. The effectiveness, manageability and pleasant organoleptic
properties of O. vulgare, T. serpillum, O. basilicum, C. limon and M. piperita EOs
make them advisable as promising new natural antifungal drugs in the management of
M. pachydermatis otitis in dog.
Figueredo et al. (2013) performed a study aims evaluate the in vitro antifungal
susceptibility of M. pachydermatis strains, in both their planktonic and sessile forms,
to fluconazole, miconazole, ketoconazole, itraconazole, posaconazole, terbinafine and
voriconazole using the XTT assay and Clinical and Laboratory Standards Institute
(CLSI) microdilution method. The minimum inhibitory concentration (MIC) values
recorded for each drug were significantly higher for sessile cells relative to planktonic
cells to the extent that ≥ 90% of M. pachydermatis strains in their sessile form were
classified as resistant to all antifungal agents tested. Data suggest that M.
pachydermatis biofilm formation is associated with antifungal resistance, paving the
way towards investigating drug resistance mechanisms in Malassezia spp.
Weiler et al. (2013) studied the sensitivity to antifungal drugs of two groups of M.
pachydermatis isolates taken from dogs and cats at the Cellular and Molecular
Biology Laboratory of the Paulista University (UNIP, São Paulo, Brazil). Group 1
(G1) was comprised of 40 isolates recovered from the ear canals of animals with otitis
externa; group 2 (G2) was comprised of 40 isolates recovered from the ear canals of
healthy animals. Isolate identification was confirmed by randomly amplified
polymorphic DNA using the Mpa-F (CTGCCATACGGATGCGCAAG) and 58S-R
(TTCGCTGCGTTCTTCATCGA) primers (Sugita et al., 2003). Stock solutions of
antifungal agents were obtained from the dilution of each antifungal drug in dimethyl
sulfo-xide or sterile distilled water for fluconazole. The drugs were serially diluted in
RPMI 1640 broth (GIBCOTM) to obtain the following final concentrations:
ketoconazole (16 μg/mL-0.007 μg/mL) (Janssen Beerse), itraconazole (16 μg/mL0.007 μg/mL) (Janssen Beerse), clotrimazole (64 μg/mL-0.125 μg/mL) (Bayer),
voriconazole (16μg/mL-0.007 μg/mL) (Pfizer), miconazole (64 μg/mL-0.125 μg/mL)
(Labware), nystatin (64 μg/mL- 0.125 μg/mL) (Bristol-Myers), amphotericin B
(16 μg/mL-0.007 μg/mL) (Bristol-Myers) and fluconazole (64 μg/mL-0.125μg/mL)
(Pfizer). Inocula were obtained from 48-h pure Dixon agar cultures and consisted of
164
microorganism suspensions in sterile saline (0.85%) plus Triton X-100 (0.05%)
(Merck), whose turbidity was adjusted to 0.5 on the McFarland scale. Inocula were
diluted 1:50 in sterile distilled water and then at 1:20 in RPMI 1640 broth. For each
isolate, microdilution plates containing 10 μLof antifungals in RPMI 1640 diluted in
different concentrations were inoculated with 10 μLof the standardized ino-cula. As
positive control, the standardized inocula were cultured alone; the negative control
was the antifungal alone diluted in RPMI 1640 broth. Culture plates were incubated at
37 °C for 48 h. Minimum inhibitory concentrations (MICs) were recorded following
the M27-A3 protocol (CLSI, 2007). All tests were performed in duplicate. The MannWhitney test was used to compare the two groups of isolates to determine whether
they had similar susceptibility patterns to the antifungal agents tested.
The lowest MICs were observed with ketoconazole, itraconazole and voriconazole.
Voriconazole showed the smallest variations of MICs with the MICs for G1 isolates
ranging from 0.01-0.25μg/mL, while the MICs for G2 isolates ranged from 0.01 to
0.125 μg/mL.
Cafarchia et al. (2014) evaluated the efficacy of a killer decapeptide (KP) in
vitro and in vivo. Sixteen dogs with naturally occurring M. pachydermatis otitis
externa were enrolled, and the in vitro fungicidal activity of KP was evaluated using
yeasts recovered from these animals. The therapeutic activity was evaluated in four
groups of four animals each. The dogs were topically treated with KP (150 μl, 2
mg/ml) three times per week (group A) or every day (group B), treated with a
scramble peptide every day (group C), or left untreated (group D). Assessment of
clinical signs (pruritus, erythema, and lichenification and/or hyperpigmentation),
expressed as mean of the total clinical index score (mTCIS), the population size of M.
pachydermatis at the cytological examination (mean number of yeast cells at 40×
magnification [mYC]), and culture testing (mean number of log10CFU/swab
[mCFU]), were conducted daily from the first day of treatment (T0) until two
consecutive negative cultures (mCFU ≤ 2). KP showed an in vitro fungicidal effect
against M. pachydermatis isolates, with an MFC90value of 1 μg/ml. The mTCIS, mYC
and mCFU were negative only in animals in group B after T8. Daily administration of
KP for 8 days was safe and effective in controlling both clinical signs and the
population size of M. pachydermatis causing otitis externa, thus offering an
alternative to the currently available therapeutic or prophylactic protocols for
recurrent cases of Malassezia otitis in dogs. This study compared the susceptibility
of M. pachydermatis isolates from sick (G1) and healthy (G2) animals to azole and
polyene antifungals using the M27-A3 protocol. Isolates from G1 animals were less
sensitive to amphotericin B, nystatin, fluconazole, clotrimazole and miconazole.
3.9. Zoonotic potential Malassezia pachydermatis
It was identified recently in a human intensive care nursery. The yeast was thought to
have been transmitted to 15 infants from the contaminated hands of dog-owning
healthcare workers.
Reports:
Huan et al. (1998) reported an outbreak of Malassezia pachydermatis in an Intensive
Care Nursery, eight patients with bloodstream infections, two with urinary tract
165
infections, one with meningitis, and four with asymptomatic colonization. In a pointprevalence survey, 9 additional infants, 1 health care worker, and 12 of the health care
workers' pet dogs had positive cultures for M. pachydermatis. The isolates from all
case patients, the 9 additional colonized infants, 1 health care worker, and 3 of the 12
dogs had identical patterns of restriction-fragment–length polymorphisms. In this
outbreak, it was likely that M. pachydermatis was introduced into the intensive care
nursery on health care workers' hands after being colonized from pet dogs at home.
The organism persisted in the nursery through patient-to-patient transmission.
Fan et al. (2006) isolated Malassezia pachydermatis from the facial granuloma of a
healthy woman and her dog's skin scrapings and cerumen. The yeast identity was
established by standard methods and scanning electron microscopy. A skin biopsy
specimen showed chronic inflammatory granuloma, numerous purple-red round or
ovoid spores in the superficial necrotic tissue, and sparse red spores in the dermis. The
skin lesions healed after oral fluconazole and cryotherapy.
Patient before and after treatment. A, A verrucous plaque on the right side of the face and a
hemispheroid nodule on the left ala nasi. B, After treatment, hypopigmented scar on the right
side of the face. Fan et al. (2006)
Left:Secretion smear showing numerous Gram-positive, yeastlike polymorphous spores
(Gram stain; original magnification ×1000).Right:Biopsy specimen showing purple-red
round or ovoid spores in the superficial necrotic tissue (periodic acid–Schiff stain;
original magnification ×1000). Fan et al. (2006)
Hernández-Escareño (2012) collected samples from 125 dogs from the external
canal of the left and right ear (n=250 ears), of which 180 were positive to Malassezia
pachydermatis, representing 72% (180/250) and 70 negatives or 28% (70/250).
Parameters considered for this study were: kind of ear, length of hair and size of the
animal. Samples were taken using sterile cotton swaps. Samples were cultured in
potato dextrose agar media with cycloheximide and chloramphenicol. PCR tests
166
amplifying regions D1 and D2, coding for LSU rRNA were also performed and were
compared with the reference strain CBS 1879NT of M. pachydermatis. Amplified
product yielded a 600 bp product characteristic for Malassezia. Most predominant dog
breeds for external otitis were Cocker Spaniel, French Poodle and Criolla. In Mexico,
as well as in the state of Nuevo Leon, no documented evidence exists about the
presence of this yeast in dogs with external otitis. The objective was to analyze dogs
with this pathology and to inform the presence of M. pachydermatis by means of
culture and amplification of D1 and D2 regions of gen 26S rRNA.
References
1. ADAM P. PATTERSON, and LINDA A. FRANK. How to diagnose and treat
Malassezia dermatitis in dogs. AUGUST 2002 Veterinary Medicine. 612-622
2. Ahman SE , Bergström KE. Cutaneous carriage of Malassezia species in healthy
and seborrhoeic Sphynx cats and a comparison to carriage in Devon Rex cats. J
Feline Med Surg. 2009 Dec;11(12):970-6
3. Aizawa T, Kano R, Nakamura Y, Watanabe S, Hasegawa A. The genetic diversity of
clinical isolates of Malassezia pachydermatis from dogs and cats. Med Mycol. 2001
Aug;39(4):329-34.
4. Aizawa ,T. , Rui Kano, Yuka Nakamura , Shinichi Watanabeb, Atsuhiko Hasegawa.
Molecular heterogeneity in clinical isolates of Malassezia pachydermatis from dogs.
Veterinary Microbiology. Volume 70, Issues 1–2, October 1999, Pages 67–7
5. Åkerstedt, J. , I. Vollset, Malassezia pachydermatis with special referenceto canine
skin disease. British Veterinary Journal, 152, 3, May 1996, 269–281
6. Baillon H (1889) Traité de botanique médicale cryptogamique. Octave Doin, Paris,
pp 234–235
7. Biegańska,M., Weronika Dardzińska, Bożena Dworecka-Kaszak. Fungal
colonization – an additional risk factor for diseased dogs and cats? Annals of
Parasitology 2014, 60(3), 139–146
8. Bond, R., Collin, N. S. and Lloyd, D. H. (1994), Use of contact plates for the
quantitative culture of Malassezia pachydermatis from canine skin. Journal of Small
Animal Practice, 35: 68–72.
9. Bond, R., Saijonmaa-Koulumies, L. E. M. and Lloyd, D. H. (1995), Population sizes
and frequency of Malassezia pachydermatis at skin and mucosal sites on healthy
dogs. Journal of Small Animal Practice, 36: 147–150.
10. Bond R, Anthony RM. Characterization of markedly lipid-dependent Malassezia
pachydermatis isolates from healthy dogs. J Appl Bacteriol. 1995 May;78(5):537-42.
11. Bond, R. , R.M. Anthony , M. Dodd & D.H. Lloyd . Isolation of Malassezia
sympodialis from feline skin. Journal of Medical and Veterinary Mycology, 34,2,
1996
12. Bond R , Elwood CM, Littler RM, Pinter L, Lloyd DH. Humoral and cell-mediated
responses to Malassezia pachydermatis in healthy dogs and dogs with Malassezia
dermatitis. Vet Rec. 1998 Oct 3;143(14):381-4.
13. Bond, R., A. Hendricks, E. A. Ferguson, et al. Intradermal test reactivity to
Malassezia pachydermatis in atopic dogs. Veterinary Record 2002 150: 448-449
14. Bond R , Habibah A, Patterson-Kane JC, Lloyd DH. Patch test responses to
Malassezia pachydermatis in healthy dogs. Med Mycol. 2006 Mar;44(2):175-84.
15. Bond R, Patterson-Kane JC, Perrins N, Lloyd DH. Patch test responses to Malassezia
pachydermatis in healthy basset hounds and in basset hounds with Malassezia
dermatitis. Med Mycol. 2006 Aug;44(5):419-27.
167
16. Batra, R., Teun Boekhout, Eveline Gue´ho, F. Javier Caban˜es , Thomas L. Dawson
Jr. e , Aditya K. Gupta. Malassezia Baillon, emerging clinical yeasts, FEMS Yeast
Research 5 (2005) 1101–1113
17. BAXTER, M. (1976), The association of Pityrosporum pachydermatis with the
normal external ear canal of dogs and cats. Journal of Small Animal Practice,
17: 231–234.
18. Bernardo , Fernando Manuel , Hermínia Marina Martins and Maria Lígia Martins .
A survey of mycotic otitis externa of dogs in Lisbon. Rev Iberoam Micol 1998; 15:
163-165
19. Bond R , Anthony RM, Dodd M, Lloyd DH. Isolation of Malassezia sympodialis
from feline skin. J Med Vet Mycol. 1996 Mar-Apr;34(2):145-7.
20. BOND, R., J. C. PATTERSON-KANE$ & D. H. LLOYD. Clinical, histopathological
and immunological effects of exposure of canine skin to Malassezia pachydermatis.
Medical Mycology April 2004, 42, 165/175
21. Cafarchia C , Gallo S, Capelli G, Otranto D. Occurrence and population size of
Malassezia spp. in the external ear canal of dogs and cats both healthy and with otitis.
Mycopathologia. 2005 Sep;160(2):143-9.
22. Cafarchia C, Immediato D, Paola GD, Magliani W, Ciociola T, Conti S, Otranto
D, Polonelli. In vitro and in vivo activity of a killer peptide against Malassezia
pachydermatis causing otitis in dogs. Med Mycol. 2014 May;52(4):350-5.
23. Cannon PF (1986) International Commission on the taxonomy of fungi (ICTF): name
changes in fungi of microbiological, industrial and medical importance. Microbiol Sci
3:285–287
24. Chen, T.-A., Halliwell, R. E. W., Pemberton, A. D. and Hill, P. B. (2002),
Identification of major allergens of Malassezia pachydermatis in dogs with atopic
dermatitis and Malassezia overgrowth. Veterinary Dermatology, 13: 141–150.
25. Čonková ,E.,
Edina Sesztáková , Ľubomír Páleník , Peter Smrčo , Ján
Bílek.Prevalence of Malassezia pachydermatis in dogs with suspected Malassezia
dermatitis or otitis in Slovakia. Acta Vet. Brno 2011, 80: 249-254
26. CRESPO, M. J., M. L. ABARCA, AND F. J. CABAN˜ES Otitis externa associated
with Malassezia sympodialis in two cats. JOURNAL OF CLINICAL
MICROBIOLOGY,0095-1137/00/$04.0010Mar. 2000, p. 1263–1266 Vol. 38, No. 3
27. Crespo MJ , Abarca ML, Cabañes FJ. Occurrence of Malassezia spp. in the external
ear canals of dogs and cats with and without otitis externa. Med Mycol. 2002
Apr;40(2):115-21.
28. Crosaz, O.,, Audrey Legras , Federico Vilaplana-Grosso , Julien Debeaupuits , René
Chermette ,Blaise Hubert , Jacques Guillot . Generalized dermatitis associated
with Malassezia overgrowth in cats: A report of six cases in France. Medical
Mycology Case Reports, 2, 2013, 59–62
29. Crosaz,O, A. Legras, B. Hubert, et al.Malassezia yeasts in cats: from normal
cutaneous carriage to pathogenic overgrowth, Mycoses, 55 (Suppl. 4) (2012), p. 91
30. DIZOTTI, C. E. and S. D. A. COUTINHO. ISOLATION OF MALASSEZIA
PACHYDERMATIS AND M. SYMPODIALIS FROM THE EXTERNAL EAR
CANAL OF CATS WITH AND WITHOUT OTITIS EXTERNA. Acta Veterinaria
Hungarica 55 (4), pp. 471–477 (2007)
31. Dufait,R., Pityrosporum canis as the cause of canine chronic dermatitis
Veterinary Medicine and Small Animal Clinician, 78 (1983), pp. 1055–1057
32. Eichstedt E (1846) was the first to use the name Malassezia as for the aetiology of
Pityriasis versicolor. Froriep Neue Notiz Natur Heilk 39:270
33. EIDI,S., Ali Reza KHOSRAVI , Shahram JAMSHIDI, A comparison of different
kinds of Malassezia species in healthy dogs and dogs with otitis externa and skin
lesions. Turk. J. Vet. Anim. Sci. 2011; 35(5): 345-350
34. Fan , Yi-Ming; Wen-Ming Huang; Shun-Fan Li; Guo-Feng Wu, MM; Kuan Lai,
MM; Rong-Yi Chen, MM Granulomatous skin infection caused by Malassezia
pachydermatis in a dog owner Arch Dermatol. 2006;142(9):1181-1184
168
35. Figueredo, L.A. , Claudia Cafarchia & Domenico Otranto. Antifungal
susceptibility of Malassezia pachydermatis biofilm. Medical Mycology, Volume
51, Issue 8, 2013
36. Fraser G (1961) Pityrosporum pachydermatis Weidman of canine origin. Trans Br
Mycol Soc 44:441–448 26.
37. Gabal, M. A. ,Preliminary studies on the mechanism of infection and characterization
of Malassezia pachydermatis in association with canine otitis externa*
Mycopathologia 104:93-98 (1988)
38. Gaitanis , G., Aristea Velegraki, Peter Mayser and Ioannis Bassukas. Skin diseases
associated with Malassezia yeasts: Facts and controversies. Clinics in Dermatology
(2013) 31, 455–463.
39. Gedek B, Brutzel K, Gerlach R, Netzer F, Rocken H, Unger H, Symoens J. The role
of Pityrosporum pachydermatis in otitis externa of dogs: evaluation of a treatment
with miconazole. Vet Rec. 1979 Feb 17;104(7):138-40.
40. Glatz. M. , Philipp P. Bosshard, Wolfram Hoetzenecker and Peter SchmidGrendelmeier. The Role of Malassezia spp. in Atopic Dermatitis. J. Clin. Med. 2015,
4, 1217-1228;
41. Gordon MA (1951) The lipophilic mycoflora of the skin. I. In vitro culture of
Pityrosporum orbiculare n. sp. Mycologia 43:524–535
42. Guého-Kellermann, E. and Teun Boekhout. Isolation, Identification and Biodiversity
of Malassezia Yeasts, In T. Boekhout et al. (eds.), Malassezia and the Skin 17, DOI:
10.1007/978-3-642-03616-3_2, © Springer Verlag Berlin Heidelberg 2010
43. Guého-Kellermann,E., Teun Boekhout and Dominik Begerow. Biodiversity,
Phylogeny and Ultrastructure.
44. Gustafson BA (1955) Otitis externa in the dog. A bacteriological and experimental
study. Thesis. Royal Veterinary College Sweden, Stockholm 25.
45. Hernández-Escareño, J.J., Carlos Francisco Sandoval-Coronado , José Antonio
Salinas-Meléndez , Víctor Manuel Riojas-Valdez , Francisco Picón-Rubio ,
Guillermo Dávalos-Aranda and Juan Manuel Sánchez-Yañez. Malassezia
pachydermatis in dogs with external otitis from Monterrey, Nuevo León, México.
African Journal of Microbiology Research Vol. 6(10), pp. 2443-2448, 16 March,
2012
46. Hirai,A., Rui Kano, Koichi Makimura, Eduardo Robson Duarte, Ju´ nia Soares
Hamdan, Marc-Andre´ Lachance, Hideyo Yamaguchi and Atsuhiko Hasegawa.
Malassezia nana sp. nov., a novel lipid-dependent yeast species isolated from
animals. International Journal of Systematic and Evolutionary Microbiology (2004),
54, 623–627
47. Huan J. Chang, Hilary L. Miller, Nancy Watkins, R.NMatthew J. Arduino, David A.
Ashford, Gillian Midgley, Sonia M. Aguero, Roshini Pinto-Powell, C. Fordham von
Reyn, William Edwards, Michael M. McNeil, William R. Jarvis, and Ruth Pruitt. An
Epidemic of Malassezia pachydermatis in an Intensive Care Nursery Associated with
Colonization of Health Care Workers' Pet Dogs. N Engl J Med 1998; 338:706-711
48. Kennis RA , Rosser EJ Jr, Olivier NB, Walker RW. Quantity and distribution of
Malassezia organisms on the skin of clinically normal dogs. J Am Vet Med
Assoc. 1996 Apr 1;208(7):1048-51.
49. Kiss, G., Radványi, S. and Szigeti, G. (1996), Characteristics of Malassezia
pachydermatis strains isolated from canine otitis externa. Mycoses, 39: 313–321
50. Khosravi, A.R., S. Eidi, T. Ziglari and M. Bayat. Malassezia Species isolated from
healthy and affected small animals, ear and skin. World Journal of Zoology 3 (2): 7780, 2008
51. Kobayashi, T., Kano, R., Nagata, M., Hasegawa, A. and Kamata, H. (2011),
Genotyping ofMalassezia pachydermatis isolates from canine healthy skin and atopic
dermatitis by internal spacer 1 (IGS1) region analysis. Veterinary Dermatology,
22: 401–405.
169
52. Lodder J, Kerger-van-Rij NJW (1952) Genus 3 Pityrosporum Sabouraud. In: The
Yeasts, a taxonomic study, 1st edn. North-Holland, Amsterdam, pp 440–445 27.
53. Malassez L (1874) Note sur le champignon du pityriasis simple. Arch Physiol 1:451–
459
54. Mason, K.V. , A.G. Evans Dermatitis associated with Malassezia pachydermatis in
11 dogs. Journal of the American Animal Hospital Association, 27 (1991), pp. 13–20
55. Mauldin EA , Morris DO, Goldschmidt MH. Retrospective study: the presence of
Malassezia in feline skin biopsies. A clinicopathological study. Vet Dermatol. 2002
Feb;13(1):7-13.
56. Morris DO , Olivier NB , Rosser E. Type-1 hypersensitivity reactions to Malassezia
pachydermatis extracts in atopic dogs. American Journal of Veterinary
Research [1998, 59(7):836-841]
57. Morris, D.O. Malassezia Dermatitis and Otitis. Veterinary Clinics of North America:
Small Animal Practice, 29, 6, November 1999, 1303–1310
58. Nobre Márcia de Oliveira, Castro Ângela Pötter de, Nascente Patrícia da Silva,
Ferreiro Laerte, Meireles Mario Carlos A.. OCCURRENCY OF MALASSEZIA
PACHYDERMATIS AND OTHER INFECTIOUS AGENTS AS CAUSE OF
EXTERNAL OTITIS IN DOGS FROM RIO GRANDE DO SUL STATE, BRAZIL
(1996/1997). Braz. J. Microbiol. [Internet]. 2001 Oct [cited 2016 Feb 26] ; 32(3 ):
245-249.
59. Nuttall, T. J. and Halliwell, R. E. W. (2001), Serum antibodies to Malassezia yeasts
in canine atopic dermatitis. Veterinary Dermatology, 12: 327–332.
60. Ordeix L, Galeotti F, Scarampella F, Dedola C, Bardagí M, Romano E, Fondati A.
Malassezia spp. overgrowth in allergic cats. Vet Dermatol. 2007 Oct;18(5):316-23.
61. Panja G (1927) The Malassezia of the skin, their cultivation, morphology and species.
Trans 7th Cong Far Eastern Ass Trop Med 2:442–455
62. Perrins N, Gaudiano F, Bond R. Carriage of Malassezia spp. yeasts in cats with
diabetes mellitus, hyperthyroidism and neoplasia. Med Mycol. 2007 Sep;45(6):541-6.
63. Petrov, V., G. Mihaylov. MALASSEZIA PACHYDERMATIS − ETIOLOGY AND
CLINICAL FINDINGS IN CANINE EXTERNAL OTITIS – THERAPEUTIC
APPROACHES. Trakia Journal of Sciences, Vol. 6, Suppl. 1, pp 123-126, 2008
64. Plant JD , Rosenkrantz WS , Griffin CE Factors associated with and prevalence of
high Malassezia pachydermatis numbers on dog skin.Journal of the American
Veterinary Medical Association [1992, 201(6):879-882]
65. Pistelli, Luisa, Francesca Mancianti, Alessandra Bertoli, Pier Luigi Cioni, Michele
Leonardi, Francesca Pisseri, Linda Mugnaini and Simona Nardoni, Antimycotic
Activity of Some Aromatic Plants Essential Oils Against Canine Isolates of
Malassezia pachydermatis: An in vitro Assay. The Open Mycology Journal, 2012, 6,
1766. Prado, M.R, E.H.S Brito, M.D Girão, A.J Monteiro, J.J.C Sidrim, M.F.G Rocha.
Higher incidence of Malassezia pachydermatis in the eyes of dogs with corneal ulcer
than in healthy dogs. Veterinary Microbiology. Volume 100, Issues 1–2, 20 May
2004, Pages 115–120
67. Raabe,P. , P. Mayser and R. WeiB. Demonstration of Malassezia furfur and M.
sympodialis together with M. pachydermatis in veterinary specimens. MYCOSES 41,
493-500 (1998)
68. Robin C (1853) Histoire naturelle des végétaux parasites qui croissent sur l’homme et
les animaux vivants. Baillière, Paris
69. Sabouraud R (1904) Maladies du cuir chevelu. II. Les maladies desquamatives.
Masson & Cie, Paris
70. Slooff WC (1970) Genus 6 Pityrosporum Sabouraud. In: Lodder J (ed) The Yeasts, a
taxonomic study, 2nd edn. North-Holland, Amsterdam, pp 1167–1186
71. Takashi Sugita , Teun Boekhout, Aristea Velegraki, Jacques Guillot, Suzana Hađina,
F. Javier Cabañes. Epidemiology of Malassezia-Related Skin Diseases, In A.
171
Velegraki, P. Mayzer, E. Guého, T. Boekhout (Eds.), Malassezia and the skin (1st
ed), Springer, Berlin (2010), pp. 65–119
72. Tresamol, P. V., K. Vinodkumar2,M.G. Saranya3 and S. Ajithkumar,
MALASSEZIAL DERMATITIS IN A CAT-A CASE. REPORT. J. Vet. Anim.Sci.
2012. 43 : 81-82
73. Velegraki A, Cafarchia C, Gaitanis G, Iatta R, Boekhout T (2015) Malassezia
infections in humans and animals: pathophysiology, detection, and treatment. PLoS
Pathog 11(1): e1004523. doi:10.1371/journal.ppat.1004523
74. UCHIDA , Y., Manami MIZUTANI, Takuya KUBO, Tetsuya
NAKADE, Kanjuro OTOMO. Otitis External Induced with Malassezia
pachydermatis in Dogs and the Efficacy of Pimaricin. Journal of Veterinary Medical
Science Vol. 54 (1992) No. 4 P 611-614
75. Yarrow D, Ahearn D (1984) Genus Malassezia Baillon. In: Kreger-van Rij NJW (ed)
The Yeasts, a taxonomic study, 3rd edn. Elsevier Science, Amsterdam, pp 882–885
76. Weidman FD (1925) Exfoliative dermatitis in the Indian rhinoceros (Rhinoceros
unicornis), with description of a new species: Pityrosporum pachydermatis. In: Fox H
(ed) Rep Lab Museum Comp Pathol Zoo Soc Philadelphia, Philadelphia, pp 36–43
23. Dodge CW (1935) Medical mycology. Fungous diseases of men and other
mammals. Mosby, St Louis 24.
77. WEILER, Caroline Borges et al . Susceptibility variation of Malassezia
pachydermatis to antifungal agents according to isolate source. Braz. J.
Microbiol., São Paulo , v. 44, n. 1, p. 175-178, 2013 .
4. Trichosporonosis in dogs and cats
Doster et al. (1987) diagnosed an infection with Trichosporon spp in 2 cats. In one
cat, infection consisted of a granulomatous dermatitis and was concurrent with
disseminated lymphoblastic lymphosarcoma. In another cat, urinary cystitis caused by
T beigelii was diagnosed.
Jairam and Das (2005) reported a .case of trichosporonosis in an 8-month-old
German Shepherd . Red, erythematous, alopecic patches with powdery deposits were
observed. A skin scraping sample was collected for fungal culture. Direct microscopic
examination (10% KOH mount) was inconclusive. No evidence of dermatophyte
infection or ectoparasitic infestation was observed. Bilobed yeast cells with true
mycelium, some fragmenting into arthrospores of rectangular shape, were observed at
various microscopic fields. Skin scrapings with hair were seeded onto Sabouraud'spotato dextrose agar with or without cycloheximide and chloramphenicol and
incubated at 250°C for 4 days. Growth of yeast-like, dull white colonies showing
budding yeast cells after 4 days was observed. The isolate was non-fermentative and
urease-positive. The development of mycelia with arthrospores was observed by 2 to
3 weeks. The isolate was identified as Trichosporon spp.
171
References
Doster, A R. E D Erickson and F W Chandler.Trichosporonosis in two cats. JOURNAL OF
THE AMERICAN VETERINARY MEDICAL ASSOCIATION190(9):1184-6 · JUNE
1987
Jairam, R.; Das, A. M. Cutaneous trichosporonosis (white piedra) in a dog. Journal of
Bombay Veterinary College 2005 Vol. 13 No. 1/2 pp. 114-115
C.Fungal diseases of cats and dogs caused by moulds
1. Aspergillosis in dogs and cats
1.1.
Introduction
Aspergillosis is an infection caused by the Aspergillus fungus, which is commonly
found in the environment. There are two types of Aspergillus infection, nasal and
disseminated. Both types can occur in cats and dogs, but they occur more frequently
in dogs. Young adult dogs with a long head and nose (known
as dolichocephalic breeds= A long head, usually very narrow like a greyhound) and
dogs with a medium length head and nose (known as mesatcephalic breeds) are also
more susceptible to the nasal form of aspergillosis. The disseminated version of the
disease seems to be more common in German Shepherds. No particular breed in cats
is more prone than another, Persians show a slightly higher incidence.
German Shepherd, www.dogchannel.com,Greyhound dog, at, animaltheory.blogspot.com
172
www.pinterest.com .Persian c
1.2.
Aspergillosis in dogs
1.2.1.
Sinonasal aspergillosis
Sinonasal aspergillosis occurs in apparently immunocompetent dogs
Sinonasal aspergillosis is caused predominantly by Aspergillus fumigatus ,
although infection can occur with other species including Aspergillus
flavus, Aspergillus niger, and Aspergillus nidulans.
Sinonasal aspergillosis occurs mostly in young to middle aged, with a mean
age of 4.4 years (range = 1.5 to 8 years).
Sinonasal aspergillosis is associated with uni- or bilateral profuse purulent to
mucopurulent nasal discharge, facial discomfort, depigmentation or ulceration
of the nares, sneezing, epistaxis, decreased appetite, lethargy, stertor, stridor,
and open-mouth breathing. Ocular discharge and exophthalmos may be seen,
and, destruction of the cribriform plate may result in signs of forebrain
dysfunction
Sinonasal aspergillosis leads mostly to marked destruction of turbinate bones
and mucosa. In severe cases, destruction of the frontal bones with invasion
into the periorbital soft tissues and penetration through the cribriform plate
into the central nervous system may occur.
www.pethealthnetworkwww.germanshepherds.comwww.springerrescue.org www.njmoldinspection
173
VCA Animal Hospitals
www.njmoldinspection.com
Nasal aspergillosis due to A. fumigatus Nasal infection by Aspergillus terreus.Dr. R. Mallik, Sydney,
Australia
front of a dog’s nose (the nasal planum) showing some blood-tinged creamy discharge from the
patient’s right nostril and ulceration, http://www.willows.uk.net/specialist-services/pet-healthinformation/soft-tissue/aspergillosis-fungal-rhinitis
A computed tomography (CT) image of a cross section of a dog’s nose. The right side (seen on the left
in the picture) has a fine lace-like appearance representing the scrolls of bone (turbinates) that are
normally present. The arrow is pointing to the left side of the nasal cavity which has suffered from
destruction of these turbinates and accumulation of discharge that appears the same shade of grey as
the soft tissues of the dog’s head. These changes are strongly suggestive of fungal rhinitis
(aspergillosis) and would be very difficult to identify on normal X-rays. CT images such as this are
always displayed as if the head was facing you and therefore the animal’s left appears on the right of
the
image.
http://www.willows.uk.net/specialist-services/pet-health-information/softtissue/aspergillosis-fungal-rhinitis
174
1.2.2.
Disseminated spergillosis
Disseminated aspergillosis is relatively rare in dogs compared with the
sinonasal form.
Infection occur mostly through the respiratory tract with subsequent
hematogenous spread to other sites, including intervertebral disks, kidneys,
and irises as well as other organs, muscles, and long bones.
Aspergillus terreus and Aspergillus deflectus are the predominant
Many affected dogs have underlying immunocompromise, such as diabetes
mellitus or bacterial infections, or are receiving immunosuppressive
medications, such as glucocorticoids or chemotherapeutics.
Genetic factors may also play a role, as German shepherds are substantially
predisposed to this disease.
Clinical signs of disseminated disease depend on the organ systems
involved,
Nonspecific signs such as anorexia, lethargy, and fever are common
Diskospondylitis is commonly noted, associated with vertebral pain,
paraparesis, paraplegia, or lameness.
Disseminated aspergillosis due to A. terreus, Saggital section of kidney ,Saggital section of
the vertebral column Dr. Michael Day, University of Bristol
Higher magnification showing marked granulomatous inflammation with giant cell formation
(arrowhead) surrounding septate fungal hyphae and bulbous spore-like structures (arrow)m Grocott's
methenamine silver-stained section demonstrating prominent fungal hyphae and terminal
conidiophores (arrows).. Dr. Michael Day, Bristol Univ
175
(A) Right sagittal section of sternum; the first sternebra is on the left. The second and third
sternebrae are collapsed, and areas of bony proliferation obscure the joint space. An area of
necrotizing osteomyelitis partially separates the two sternebrae (arrow). Bar, 1 cm. (B) Left sagittal
section of thoracic vertebrae; the cranial end is to the right. The intervertebral disk at T9-T10 is
missing (arrow). The end plates are eroded, and a wedge-shaped piece of tissue compresses the spinal
cord dorsally. Bar, 1 cm. (C) Sagittal section of left kidney. Small white areas are scattered throughout
the cortex and medulla (black arrow). The pelvis is dilated, and the renal crest is ulcerated. Areas of
hemorrhage (white arrow) are visible in the cortex. Bar, 1 cm. (D) Photomicrograph of second
sternebra showing areas of inflammation () and surrounding fibrous tissue invading and replacing the
marrow cavity. Bar, 250 m. (E) Higher magnification of sternebra showing marked granulomatous
inflammation with giant cell formation (arrowhead) surrounding septate fungal hyphae and bulbous
spore-like structures (arrow). Bar, 25m. (F) Grocott’s methenamine silver-stained section of sternebra
taken from same area as previous image, demonstrating prominent fungal hyphae and terminal
conidiophores (arrows). Bar, 25 m, Canine Disseminated Aspergillosis jcm.asm.org
(A) Lateral radiograph of the thorax. There is lysis of the first four sternebrae and marked shortening
of the second and third sternebrae, which have irregular margins and loss of the end plates (arrow).
(B) Lateral radiograph of the thoracic vertebral column. There is end plate lysis of the 9th (T9) and
10th (T10) thoracic vertebrae that is centered on the intervertebral space (arrow), with spondylosis
176
deformans ventrally. There is also narrowing, end plate sclerosis, and spondylosis deformans between
the seventh (T7) and eighth (T8) vertebrae (arrowhead) Canine Disseminated Aspergillosis
jcm.asm.org.
1.2.3.
Other forms of aspergillosis in dogs
Bronchopulmonary aspergillosis
Aspergillosis of the CNS
Aspergillosis of the ears (otomycosis)
Aspergillosis of the eye (oculomycosis)
1.3.
Aspergillosis in cats
Aspergillosis in cats is a sporadic mycosis that leads to a usually chronic, only
rarely acute disease that mainly affects the nasal cavity and sinuses.
Aspergillus spp. infections are commonly associated with predisposing local
or systemic factors. Local disease can spread and involve the central nervous
system or the lungs. Some Aspergillus spp. can also disseminate, causing
systemic infections.
Aspergillosis is rare in cats, but considered an emerging infection in e.g.
Australia.
There are two clinical forms of aspergillosis in cats, the sinonasal
(characterized by signs of chronic nasal infection) and the newly emerging
more invasive sinoorbital form (characterized by signs of orbital and
surrounding tissue invasion).
feline aspergillosis has been described in North America, the United Kingdom,
Switzerland, Germany, Japan, and Italy.
No age or sex predisposition has been detected.
A predisposition was found in brachycephalic breeds, especially Persian and
Himalayan cats.
Aspergillosis occurs in two main forms in cats:
1.3.1.
Sinonasal aspergillosis (SNA)
o SNA is characterized by more local signs of chronic nasal infection,
such as sneezing, uni- or bilateral serous to mucopurulent nasal
discharge, and sometimes epistaxis. Sterterous breathing, granuloma
formation, soft tissue masses protruding from the narines, and bone
lysis are less frequent abnormalities.
1.3.2.
Sinoorbital aspergillosis (SOA).
o SOA is the more invasive form.
o SOA probably represents an extension of SNA to orbital and
subcutaneous tissues,
177
o SOA is caused by invasive Aspergillus spp.
o Most cats with SOA have a history of nasal discharge, and nasal
lesions have been identified at necropsy as well as lysis of the orbital
lamina using imaging techniques.
o SOA is characterized by signs of orbital and surrounding tissue
invasion, including
unilateral exophtalmus,
third eyelid prolapse,
conjunctival hyperaemia, and
keratitis
ulceration of the hard palate
extension and destruction of the nasal cavity
CNS can be involved leading to neurological signs, peripheral
vestibular signs, and blindness, and regional lymphadenopathy
and fever can occur.
Exophthalmos of the left eye in a cat with a left retrobulbar fungal granuloma (sino-orbital
aspergillosis). There is prolapse of the third eyelid. A partial lateral tarsorrhaphy was performed to
prevent exposure keratitis Right exophthalmos, third eyelid prolapse and oedema and swelling of the
right side of the face in a cat with a right retrobulbar and paranasal fungal granuloma (courtesy of
Vanessa Barrs, University Veterinary Teaching Hospital, Sydney, Australia).
Ventral expansion of retrobulbar fungal granulomas causes a mass effect in the pteryoplatine fossa as
seen in this cat with a right retrobulbar fungal granuloma (arrow) (courtesy of Vanessa Barrs,
University Veterinary Teaching Hospital, Sydney, Australia).
Thoracic radiographs (latero-lateral view) of a cat with pulmonary aspergillosis, diagnosed at necropsy
(courtesy of Katrin Hartmann, Medizinische Kleintierklinik, Ludwig-Maximilians-Universität
München, Germany).
178
1.4.
Aspergillus fumigatus (Khan et al., 1984, Kulendra et al., 2010, AdamamaMoraitou et al. (2011 and Ferreira et al., 2011)
Aspergillus terreus (Wood et al. 1978, Kabay et al., 1985, Day et al., 1985
and 1986. Day and Penhale, 1988 and 1991, Dallman et al., 1992, Bruchim et
al, 2006, Elad et al., 2008 and Schultz et al., 2008).
Aspergillus niger (Kim et al. 2003).
Aspergillus deflectus Robinson (2000), Schultz et al. (2008),
Aspergillus ochraceus (Ghibaudo and Peano, 2010)
Aspergillus alabamensis Burrough et al. (2012
Aspergillus versicolor Zhang et al (2012).
Aspergillus felis Barrs et al. (2013)
1.5.
Aspergillus species isolated from dogs
Aspergillus species isolated from cats
Aspergillus fumigatus (Barachetti et al., 2009, Giordano et al., 2010, Hazell
et al., 2011, Barrs et al., 2014 , Barrs and Talbot, 2014).
Aspergillus niger (Barrs and Talbot 2014),
Aspergillus wyomingensis (Kano et al., 2008),
Aspergillus udagawae (Kano et al.,2008 and Kano et al., 2013),
Aspergillus viridinutans (Kano et al. (2013) and
Aspergillus fischeri (Kano et al., 2015)
Aspergillus felis Barrs et al. (2013)
1.6.
Description of commonly isolated Aspergillus species
from dogs and cats
1.6.1.
Aspergillus fumigatus Fresenius, 1863.
Colony diam (7 d): CYA25: 21-67 mm; MEA25: 25-69 mm; YES25: 48-74 mm;
OA25: 34-62 mm, CYA37: 60-75 mm, CREA: poor growth, no or very weak acid
production. Colour: greyish turquoise or dark turquoise to dark green to dull green.
Reverse colour (CYA): creamy, yellow to orange. Colony texture: velutinous, st.
floccose. Conidial head: columnar. Conidiation: abundant, rarely less abundant. Stipe:
50-350 × 3.5-10 μm. Vesicle diam, shape: 10-26 μm, pyriform to subclavate,
sometimes subglobose, but rarely globose. Conidia length, shape, surface texture: 23.5(-6) μm, globose to ellipsoidal, smooth to finely rough
179
Aspergillus fumigatus, Mycoba
1.6.2.
Aspergillus terreus Thom, (1918)
Colonies on potato dextrose agar at 25°C are beige to buff to cinnamon. Reverse is
yellow and yellow soluble pigments are frequently present. Moderate to rapid growth
rate. Colonies become finely granular with conidial production. Hyphae are septate
and hyaline. Conidial heads are biseriate (containing metula that support phialides)
and columnar (conidia form in long columns from the upper portion of the vesicle).
Conidiophores are smooth-walled and hyaline, 70 to 300µm long, terminating in
mostly globose vesicles. Conidia are small (2-2.5 µm), globose, and smooth. Globose,
sessile, hyaline accessory conidia (2-6 µm) frequently produced on submerged
hyphae.
Aspergillus terreus mycology.adelaide.edu.au
181
www.mold.ph
Mycobank
1.6.3.
S. S. Tzean and J. L. Chen
Aspergillus niger van Tieghem 1867
On Czapek dox agar, colonies consist of a compact white or yellow basal felt covered
by a dense layer of dark-brown to black conidial heads. Conidial heads are large (up
to 3 mm x 15-20 um in diameter), globose, dark brown, becoming radiate and tending
to split into several loose columns with age. Conidiophores are smooth-walled,
hyaline or turning dark towards the vesicle. Conidial heads are biseriate with the
phialides borne on brown, often septate metulae. Conidia are globose to subglobose
(3.5-5.0 um in diameter), dark brown to black and rough-walled.
181
Varga et al., 2011
1.6.4.
Mycobank
Aspergillus deflectus Fennell & Raper, Mycologia 47: 82 (1955)
Colonies on Czapek's agar growing restrictedly, attaining a diameter of 1.5 to 2.0
cm. in 10 days to 2 weeks at room temperature (24-26°C), very compact,
consisting of a close-felted, tough, basal mycelium, slightly zonate, somewhat
radially furrowed; margins abrupt near congo pink from admixture of vegetative
mycelium; conidial structures abundantly produced; central colony area mouse
gray to deep mouse gray; exudate fairly abundant but not conspicuous, clear,
embedded in the mycelial mass as small droplets; reverse and agar in dull orangered shades near terra cotta, becoming brown in age; odor fairly pronounced,
moldy. Conidial heads evenly distributed, typically broadly columnar and mostly
25 to 30 µm in diameter but in some strains tending to be radiate, borne on short
conidiophores from the aerial felt; conidiophores sinuous, mostly 40 to 50 µm
long in some strains but up to 125 µm in others, 2.5 to 3.5 µm in diameter, smooth
walled, reddish brown with pigmentation extending into the vesicles and
sterigmata; vesicles rounded, flask shaped, 5.5 to 6.5 µm in diameter,
182
characteristically borne at, or nearly at, right angles to the main axes of the
conidiophores, bearing sterigmata on the uppermost surfaces only; sterigmata in
two series, primaries 4.5 to 5.5 µm by 2.8 to 3.3 µm, secondaries 4.5 to 5.5 µm by
1.8 to 2.2 µm, occasionally abortive and failing to produce conidia; conidia
globose to subglobose 3.0 to 3.5 µm, with variable ornamentation, ranging from
almost smooth when young to irregularly roughened at maturity.
Mycobank
1.6.5.
Aspergillus ochraceus K. Wilh., (1877)
Colony diameters on Czapek’s Agar 3.0-3.5 cm in 10 days at 25°C, wrinkled; conidial
heads spherical, or splitting into compact divergent columns, cream color, pinkish
buff or near dark olive-buff; mycelium white, inconspicuously floccose to floccose;
exudate uncolored; reverse dull yellow brown to victoria lake; soluble pigment, pale
capucine buff ; stipes 360-1390 × 4.0-16.0 μm, pale yellow to light yellow brown,
slightly to coarsely roughened; vesicles spherical to subspherical, 8.8-46.0 μm in
diameter. Aspergilla biseriate, metulae covering the entire surface of the vesicle, 4.833.3 × 2.4-10.3 μm; phialides 5.6-143.0 × 1.8-4.8 μm. Conidia spherical to
subspherical, smooth to irregular rough, 2.0-3.8 . Sclerotia produced by the same
isolate, purple, up 1000 μm in diameter. Colony diameters on Malt Extract Agar 5.05.5 cm in 10 days at 25°C, more or less floccose; conidial heads globose or splitting
into a few columns, near antimony yellow to ochraceous-buff; mycelium white,
reverse dull yellow brown to pale auburn.
183
lookfordiagnosis.com Show.wnmu.edu1155 × 1148 www.drthrasher.org Mold Library
S. S. Tzean and J. L. Chen
1.6.6.
Mycobank
Aspergillus alabamensis Balajee, Baddley, Frisvad & Samson, sp.
nov.
Colonies on Czapek yeast extract and MEA are yellowish-brown to cinnamon-brown,
often consisting of a dense felt of conidiophores but also showing floccose growth.
Conidial heads are densely columnar. Conidial heads are long, columnar, 30 to 50 μm
in diameter, and 150 to 500 μm or more in length at maturity; conidiophores are
biseriate, smooth, colorless, and 100 to 250 μm by 4.5 to 6.0 μm. Vesicles are
subglobose and 10 to 16 μm in diameter. Phialides are 5.0 to 7.0 μm by 2.0 to 2.5 μm.
Metulae are closely packed and 5.5 to 7.5 μm by 1.5 to 2.0 μm. Conidia are globose to
slightly elliptical, smooth, and 1.8 to 2.4 μm in diameter.
184
Aspergillus alabamensis sp. nov. UAB 20T. Shown are colonies on MEA after 7 days at
25°C on CYA (a) and on MEA (b), conidial heads (c and d) , Balajee et al.,2009
1.6.7.
Aspergillus versicolor (Vuill.) Tirab., (1908)
Colonies on CYA 16-25 mm diam, plane or lightly sulcate, low to moderately deep,
dense; mycelium white to buff or orange; conidial heads sparse to quite densely packed,
greyish green; pink to wine red exudate sometimes produced; reverse orange or reddish
brown. Colonies on MEA 12-25 mm diam, low, plane, and dense, usually velutinous;
mycelium white to buff; conidial heads numerous, radiate, dull or grey green; reverse
yellow brown to orange brown. Colonies on G25N 10-18 mm diam, plane or umbonate,
dense, of white, buff or yellow mycelium; reverse pale, yellow brown or orange brown.
No growth at 5°C. Usually no growth at 37°C, occasionally colonies up to 10 mm diam
formed.
Conidiophores borne from surface or aerial hyphae, stipes 300-600µm long, with heavy
yellow walls, vesicles variable, the largest nearly spherical, 12-16µm diam, fertile over
the upper half to two-thirds, the smallest scarcely swollen at all and fertile only at the tips,
bearing closely packed metulae and phialides, both 5-8µm long; conidia mostly spherical,
very small, 2.0-2.5µm diam, with walls finely to distinctly roughened or spinose, borne in
radiate heads.
185
Jurjevic Z, Peterson SW, Horn BW - IMA Fungus (2012)
Aspergillus versicolor, www.tamagawa.ac.jp
1.6.8.
Aspergillus wyomingensis
A. Nováková, Dudová & Hubka, Fungal
Diversity 64: 270 (2014)
Colonies on CYA in 52–58 mm in diam at 25 °C in 7 days, velutinous, wrinkled,
yellowish white with poor sporulation on the colony margin (pale yellow green)
after 14 days, no exudate or soluble pigment production, reverse pale yellow.
Colonies at 37 °C 65–70 mm, floccose to lanose, wrinkled, yellowish white (No.
92), reverse pale yellow. Colonies on MEA 43–44 mm, floccose, plane, yellowish
white, no exudate, soluble pigment present after 14 days—brilliant greenish yellow
to vivid greenish yellow, reverse light yellow with moderate yellow parts, brilliant
greenish yellow to vivid greenish yellow. Colonies on YES (60−)68−70 mm in
diam, velutine to floccose, wrinkled, yellowish white, no exudate, no soluble
pigment, reverse strong yellow (No. 84) to deep yellow). Colonies on CZA 38–42
mm in diam, plane, whitish yellow. Colonies on CREA 46–50 mm in diam, poor
mycelial growth, acid production strong or only under the colony. Ehrlich test
negative. Only some isolates were able to grow restrictedly (up to 16 mm) at 45 °C,
all grew at 42 °C. Conidial heads columnar. Conidiophores arising from aerial
hyphae, smooth, up to 275.0×(3−)4−6.5(−7) μm, nodding heads occasionally
present. Conidial heads uniseriate, vesicles subglobose to globose, pigmented,
11−19(−24) μm, two-thirds covered by ampuliform phialides. Conidia subglobose,
delicately rough, 1.7−2.8(−3.3) μm, light green in mass. Heterothallic species; the
ascomata visible after 3 weeks of incubation on OA at 25, 30 and less abundant at
37 °C, mature ascospores present after 4–5 weeks. Cleistothecia white, globose or
subglobose 180−500(−600) μm in diameter, covered by a dense felt of white
hyphae; asci eight-spored, globose to subglobose 10–12×10–11 μm; ascospores
lenticular, spore bodies (3.2−)3.6−5 μmin longer axis, equatorial crests absent or are
very low and difficultly distinguishable by light microscopy, shallow equatorial
186
furrow is present, short ribs, rough tubercles and echines are present on the convex
surface and clearly visible using light microscopy, a part of ascospores lack
ornamentation as well as equatorial crests and furrow.
Aspergillus wyomingensis, Mycobank
1.6.9.
Aspergillus udagawae (Kano et al.,2008)
A. udagawae, a heterothallic fungus, has an anamorph that is morphologically
indistinguishable from Aspergillus fumigatus. Because of the similarity in their
conidial morphology, clinical isolates of N. udagawae are frequently identified as A.
fumigatus on phenotypic characteristics alone. Growth of the A. udagawae strains is
considerably slower than A. fumigatus at temperatures between 30°-37°C. While A,
fumigatus grows at 55°C but fails to grow at l0°C, A. udagawae fails to grow at the
temperatures >42°C but formed colony at 10°C.
187
A. udagawae clinical strains M29, M31, M34, and F41. (C to F) Growth characteristics on
Czapek-Dox agar after 5 days at 37°C., Sugui et al., 2014
1.6.10.
Aspergillus viridinutans Ducker & Thrower, Australian Journal of
Botany 2 (3): 355 (1954)
Colonies on Czapek's agar attaining a diameter of 3.5 to 4.0 cm. in 14 days at
25°C, with centers raised, thinning in a marginal region about 1 cm. wide which is
white flecked with green; conidial heads limited in number, in shades near sage
green to pois green; reverse colorless or with the green shades showing through
the thin white margins; no odor; no exudate. Colonies on malt agar reaching cm.
in diameter in 14 days at 25°C, with surface velvety, slightly zonate, in colors near
Niagara green, from abundant conidial heads except in a narrow white margin;
reverse yellowish green to light brownish olive. Conidial heads mostly columnar,
up to 50 µm by 30 µm when borne from the substratum, narrower when borne on
branches from aerial hyphae; conidiophores arising from the substrate 50 µm or
more in length, from trailing hyphae 20 to 35 µm, 3.3 to 4.4 µm in diameter,
sinuous, thin walled, smooth and often septate; vesicles flask shaped to
subglobose, 7.5 to 12 µm (average 9 µm) in width but ranging up to 15 µm wide,
usually set at an angle on the conidiophore to present a "nodding" appearance but
with upright heads often seen; sterigmata in a single series, borne on the
uppermost surface of the vesicle only, comparatively few in number, 5.5 to 7.5
µm by 2.0 to 2.5 µm; conidia globose, described as smooth but delicately
roughened, pale green, 2.0 to 2.8 µm.
188
.
Aspergillus viridinutans. A-B. Colonies 7 d 25 °C. A. CYA. B. MEA. C-F. Conidiophores. Samson et
al., 2007
1.6.11.
Aspergillus fischeri
Wehmer, Centralbl. Bakteriol., 2 Abth.: 390
(1907)
Colonies on Czapek's solution agar growing rapidly at room temperature (25±°C) and
at 37°C, attaining diameters of to 6 cm. in 2 weeks; at the lower temperature
characterized by abundant cleistothecia, with limited conidial heads in pale blue-green
shades; at 37°C typically producing fewer cleistothecia and abundant conidial heads
in shades near deep olive-gray borne from the substrate and from a thin aerial
mycelium; no exudate; reverse colorless to flesh colored. Conidial heads columnar but
with some spore chains divergent and with terminal areas somewhat expanded, up to
150 µm in length by 20 to 35 µm in diameter; conidiophores variable in length, in
some strains exceeding 1 mm., in others mostly 300 to 500 µm by 4.0 to 7.0 µm in
diameter; vesicles usually flask shaped, mostly 12 to 18 µm in diameter, faintly to
definitely colored in gray-green shades, bearing sterigmata over the upper one-half to
three-fourths; sterigmata in a single series, crowded, usually in pale to dull greenish
shades, 5.5 to 7.0 µm by 2.0 to 2.5 µm; conidia typically subglobose but in different
strains ranging from nearly globose to elliptical, delicately roughened, faintly
pigmented, 2.0 to 2.5 µm in diameter when globose and up to 3.0 µm in long axis
when elliptical. Cleistothecia borne singly or in small clusters within a loose hyphal
envelope, typically globose, commonly up to 400 µm in diameter, with walls thin,
fragile, consisting of 2 to 3 layers of irregularly flattened cells; asci maturing rap-idly
and filling the cleistothecium within a few days, eight-spored, 8 to 10 µm by 10 to 12
µm breaking down quickly; ascospores biconvex, uncolored, usually 7.0 by 4.0 µm
consisting of a central body 5.0 by 4.0 µm with two ruffled equatorial bands about 1.0
189
µm wide and convex surfaces bearing anastomosing ridges, which may also approach
1.0 µm
Aspergillus fischeri Mycota
1.6.13. Aspergillus felis Barrs, van Doorn, Varga & Samson, sp.
nov.
Colonies grow rapidly on CYA agar attaining a diameter of 5.0 to 5.5 cm in 7 days at
25°C and on MEA reach 5.5 cm in diameter in 7 days at 25°C. On CYA the colony
texture is mostly floccose; colonies are usually white and often sporulate poorly. On
MEA colonies are more or less velvety with abundant greenish sporulation occurring
after 5 to 7 days. In reverse, colonies are cream to light green. Conidiophores are
uniseriate with greenish stipes and subclavate, “nodding” heads. Vesicles are
subclavate with a diameter of 15–16.5 µm. Conidia are green, globose to subglobose,
finely roughened and 1.5–2.5 µm in dimensions. Cleistothecia are white to creamish,
100–230 µm. Asci are globose, 8-spored, 12–16 µm in diameter. Ascospores are
lenticular with two prominent equatorial crests and with short echinulate convex
surfaces 5.0–7.0×3.5–5.0 µm
191
Aspergillus felis. Colonies growing 7 days at 25°C on CYA (A) and MEA (B); Conidiophores
and conidia(D, E ) Barrs et al., 2013
1.7.
1.7.1.
Diagnosis:
Serology. Tests that can detect serum antibodies
against Aspergillus species include Agar gel immunodiffusion
(AGID), complement fixation, and ELISA techniques.
1.7.2.
Agar gel immunodiffusion (AGID),
It is used for detection of antibodies to A. fumigatus, A. niger, and A. flavus.
It is widely available through veterinary diagnostic laboratories
It is probably the most commonly performed fungal serologic test at this time.
Its sensitivity is only 67% in dogs with sinonasal aspergillosis
1.7.3.
Imaging studies.
Radiographs and CT may reveal lesions associated with diskospondylitis
(collapsed disk spaces, proliferative bony changes adjacent to the
intervertebral disk spaces, sclerosis) or lysis and destruction of long bones.
Ultrasonography may reveal changes in affected organs
Radiographs of the nasal cavity and frontal sinus can be diagnostically useful.,
The patient must be anesthetized during the radiographic examination to
permit proper positioning
191
Lateral, ventrodorsal (both open- and closed-mouth) and rostrocaudal views
should be obtained.
Common radiographic changes associated with aspergillosis are areas of
increased radiolucency, which suggest turbinate destruction.
Opacification of the nasal cavities and frontal sinuses may also be noted.
The diagnostic sensitivity of radiography is limited by superimposition of
bony structures and the complexity of the nasal turbinates.
Magnetic resonance imaging (MRI) and computed tomography (CT) are
superior
1.7.4.
Rhinoscopy and sinuscopy.
Rhinoscopy allows visualization of the nasal cavity and guided collection of
biopsy samples a
It is routinely performed after imaging studies.
The nasopharynx can be viewed by using a small retroflexed endoscope or a
dental mirror with a rigid endoscope.
Biopsy samples can be collected through the endoscope or by adjacent
placement of a rigid device.
1.7.5.
Cytology and histology.
can provide direct evidence of fungal hyphae
have high sensitivity
findings include mucosal ulceration and inflammation, with a predominance of
lymphocytes and plasma cells.
Cytologic identification of Aspergillus species in urine, blood, synovial fluid,
lymph node, bone or intervertebral disk material etc.
1.7.6.
Isolation of fungi.
Most Aspergillus sp. grow relatively rapidly (typically within 48 hr) and on
most microbiology media including both mycological media such as
Sabouraud’s agar and blood agars used for general bacteriological
culture.Identification of cultures of most species Aspergillus is generally
straightforward by colony and microscopic morphology.
1.7.7.
Molecuar identification of aspergilli
Sequencing of genes, such as actin, calmodulin, ITS, rodlet A (rodA) and/or βtubulin (βtub), has been used to distinguish A. fumigatus from related species.
Multilocus sequence typing can alternatively be used for the identification of
those related species, which is a strategy that also involves sequencing of
several gene fragments. A few other techniques, such as random amplified
polymorphic DNA, restriction fragment length polymorphisms and a new
proposed microsphere-based Luminex assay, may enable molecular
identification of A. fumigatus without sequencing.
1.8.
Treatment
Topical antifungals.
192
1.9.
o Topical antifungal medications are regarded as the treatment of choice
if the cribriform plate is intact.
o enilconazole and clotrimazole are more effective in the treatment of
sinonasal aspergillosis than oral antifungal agents are.
o The topical azoles have poor solubility and minimal intestinal
absorption and are fungicidal (rather than fungistatic) at higher
concentrations.
o enilconazole instillation twice a day for one or two weeks. Or
o one infusion via both nares of either clotrimazole or enilconazole,
under general anesthesia.
o topical clotrimazole was shown to resolve clinical disease in 65% of
dogs after one treatment and in 87% of dogs after two treatments.
o topical enilconazole in dogs resolved 57% of clinical disease after one
treatment and 94% after one to three treatments.
Systemic antifungals.
o systemic therapy is recommended in case of fungal invasion of
extranasal structures.
o Several azole drugs have been used to treat dogs with sinonasal
aspergillosis, but the success rates are moderate at best.
o Successful treatment of a dog with sinonasal aspergillosis was
reported using itraconazole alone
o Anorexia, vomiting, and hepatotoxicosis have been reported with
long-term use of azoles
Reports on aspergillosis in dogs:
1.9.1.
Nasal aspergillosis
Khan et al. (1984) considered ELISA to be a less reliable method than counter
immune electrophoresis for the diagnosis of nasal aspergillosis in the dog. Falsepositive or false-negative results were recorded for anti-A. fumigatus IgG in nine
animals with aspergillosis and in 27 disease-free dogs although this problem could be
reduced with careful selection of antigen.
Mortellaro et al. (1989) reported 29 cases of nasal aspergillosis out of 150 dogs with
nasal discharge in dogs based on cultural, serologic, radiologic, endoscopic and
histopathologic studies. In all of the 29 cases the thermotolerant, rhinotropic
Aspergillus fumigatus was cultured from the nasal lesions. The fungal infection
mostly occurred in male German shephard dogs, the most common breed of
companion dogs, living in apartments.
Codner et al. (1993) evaluated computed tomography as a non-invasive technique
for the diagnosis of chronic nasal disease in dogs. Computed tomographic images,
radiographs, and histopathologic findings were compared in 11 dogs with chronic
nasal disease. Definitive diagnosis was made following traumatic nasal flush,
exploratory surgery, or necropsy. The study included 8 dogs with intranasal tumors,
2 dogs with bacterial rhinitis (Pasteurella sp), and 1dog with mycotic rhinitis
(Aspergillus sp). Computed tomography was superior to radiography in defining the
extent of the disease process and in differentiating infectious rhinitis from nasal
193
neoplasms. It defined lesions in the palate, nasopharyngeal meatus, maxillary sinus,
caudal ethmoturbinates, and periorbital tissues that were difficult to demonstrate by
use of conventional radiography. Tumors appeared as space-occupying lesions that
obliterated the turbinates, caused deviation of the nasal septum, and eroded bone.
Rhinitis appeared as a cavitating lesion that spared the paranasal sinuses, thickened
and distorted the turbinates, and widened the meatus.
Saunders et al. (2003a) reviewed computed tomographic (CT) studies of
80 dogs with chronic nasal disease (nasal neoplasia (n = 19), nasal aspergillosis (n =
46), nonspecific rhinitis (n = 11), and foreign body rhinitis (n = 4)) retrospectively by
two independent observers. Each observer filled out a custom-designed list to record
his or her interpretation of the CT signs and selected a diagnosis. Accuracy,
sensitivity, specificity, positive predictive value (PPV), and negative predictive value
(NPV) were calculated for the diagnosis of each disease. The agreement between
observers was evaluated. The CT signs corresponded to those previously described in
the literature. CT had an accuracy greater than 90% for each observer in all disease
processes. The sensitivity, specificity, PPV, and NPV were greater than 80% in
all dogs with the exception of the PPV of foreign body rhinitis (80% for observer A
and 44% for observer B). There was a substantial, to almost perfect, agreement
between the two observers regarding the CT signs and diagnosis. This study indicated
a high accuracy of CT for diagnosis of dogs with chronic nasal disease. The
differentiation between nasal aspergillosisrestricted to the nasal passages and foreign
body rhinitis may be difficult when the foreign body is not visible.
Transverse CT images of the nasal cavities from four dogs. Classification of the process as mass-like
for nasal neoplasia (A), cavitated-like for nasal aspergillosis (B), nondestructive for nonspecific rhinitis
(C) and, when a foreign body could be visualized as foreign body rhinitis (D) permitted acorrect
194
diagnosis to be made in 93-95% of the dogs. (A) Eleven-year-old Bobtail with a nasal adenocarcinoma
(window width (WW) = 3500, window level (WL) = 500). Both nasal cavities are completely tilled
with a soft tissue density. Some deformed turbinates are visible (arrowheads), There is also lysis of the
palatine bone (arrow). (B) Five-year-old Golden Retriever with nasal aspergillosis (WW = 3500, WL =
500). Severe turbinate destruction creates an increased air space in the left nasal cavity (asterisk). There
is also mucosal thickening (arrowheads). (C) Four-year-old German Shepherd Dog with a diagnosis of
nonspecific rhinitis (WW = 3500, WL = 500). There is a severe bilateral fluid/epithelial edema (arrow).
The integrity of the turbinates is conserved. (D) Eight-year-old Poodle with a foreign body rhinitis
(WW = 150, WL = 50). The foreign body (arrow) was a grass awn. Saunders et al. (2003a)
Transverse CT images (window width = 3500; window level = 500) showing the similarity of CT
features in nasal aspergillosis and foreign body rhinitis. (A) Six-month-old Cairn Terrier with foreign
body rhinitis. There is unilateral turbinate destruction and mucosal thickening (arrowheads) in the right
nasal cavity. The foreign body (small plant part) could not be visualized. (B) Six-year-old Teckel with
nasal aspergillosis. There is bilateral turbinate destruction (asterisk) and mucosal thickening
(arrowheads). Saunders et al. (2003a)
Saunders et al. (2003b) performed a study to compare the radiographic and
computed tomographic (CT) findings and to evaluate the sensitivity of radiography
and CT for diagnosis of nasal aspergillosis in dogs, the radiographic and CT studies
of 48 dogs with chronic nasal disease were reviewed separately. The radiographic and
CT findings were recorded, and a diagnosis was made. The results obtained in
the dogs with nasal aspergillosis (n = 25) were used. Based on definite aspergillosis as
diagnosis, CT had a sensitivity of 88% and radiography of 72%. Considering definite
and probable aspergillosis as equivalent, CT had a sensitivity of 92% and radiography
of 84%. The sensitivity was higher in dogs with lesions affecting the entire nasal
cavity and frontal sinus on at least one side (n = 20) with a sensitivity of 100% for CT
and 90-95% for radiography than in dogs with lesions restricted to the nasal cavities
(n = 5) where CT had a sensitivity of 60-80% and radiography of 0-40%. CT was
superior to radiography for evaluation of the nasal cavities (mucosal thickening along
the nasal bones, surrounding bone hyperostosis/lysis), frontal sinuses (mucosal
thickening along the frontal bone, fluid/soft tissue, frontal bone hyperostosis/lysis),
and differentiation between a cavitated-like or a mass-like process. This study
suggests that CT is more sensitive than radiography for diagnosis of
nasal aspergillosis in the dog because of a better demonstration of some changes
suggestive of nasal aspergillosis. A diagnosis of a nasal aspergillosis restricted to the
nasal cavities or associated with an FB is challenging, even with the use of CT.
195
Radiographic and CT examinations of the nasal cavities of a 5-year-old Labrador retriever. A) DV
(intra-oral) projection showing an area of lucency (asterisk) extending from the canine tooth to the
maxillary recess in the left nasal cavity. Multiple metallic foreign bodies (FB) are visible as well as
fragments of the right canine tooth. The radiographic diagnosis was probable FB rhinitis. B) Transverse
CT image (window width (WW) = 3500, window level (WL) = 500) at the level of the rostra1 aspect of
the third premolary tooth. There is a complete turbinate destruction (asterisk) in the left nahal cavity.
The mucosa is thickened (arrowheads) along this destructive area. One rounded metallic FB is visible
in the right nasal cavity against the vomer hone (arrow). C) Transverse CT image (WW = 3500, WL =
500) at the level of the maxillary recesses. There is a rounded metallic FB (arrow) located in the left
nasal cavity at the level of orbital lamina of the maxillary recess and surrounded by abnormal soft
tissue. CT diagnosis was definite nasal aspergillosis associated with an intranasal FB. Saunders et al.
(2003b)
196
Radiographic and CT examinations of the nasal cavities of a 3-year-old Bull Terrier. A) DV (intra-oral)
radiographic projection. There is an increased opacity in the rostral third (arrows) and an increased
lucency (arrowheads) in the middle third on the left nasal cavity. The radiographic diagnosis was
probable nasal aspergillosis. B) Transverse CT image (window width [WW] = 3,500, window level
[WL] = 500) at the level of the first premolar. There is abnormal fluid/soft tissue, thickening of the
mucosa, and areas of turbinate destruction (difficult to quantify) in the left nasal cavity. A small
amount of abnormal soft tissue is present in the right nasal cavity. C) Transverse CT image (WW =
3,500, WL = 500) at the level of the third premolar. There is turbinate destruction and thickening of the
mucosa along the nasal cavity and resting turbinates. A CT diagnosis of probable nasal aspergillosis
was made. Saunders et al. (2003b)
Saunders et al. (2004) conducted a study to determine radiographic, magnetic
resonance imaging (MRI), computed tomography (CT), and rhinoscopic features of
nasal aspergillosis in 15 client-owned dogs. All dogs had clinical signs of chronic
nasal disease; the diagnosis of nasal aspergillosis was made on the basis of positive
results for at least 2 diagnostic tests (serology, cytology, histology, or fungal culture)
and detection of typical intrasinusal and intranasal fungal colonies and turbinate
destruction via rhinoscopy. Radiography, MRI, and CT were performed under general
anesthesia. Rhinoscopy was repeated to evaluate lesions and initiate treatment.
Findings of radiography, MRI, CT, and rhinoscopy were compared. MRI and CT
revealed lesions suggestive of nasal aspergillosis more frequently than did
radiography. Computed tomography was the best technique for detection of cortical
bone lesions; the nature of abnormal soft tissue, however, could not be identified.
Magnetic resonance imaging allowed evaluation of lesions of the frontal bone and
was especially useful for differentiating between a thickened mucosa and secretions
or fungal colonies; however, fungal colonies could not be differentiated from
secretions. Rhinoscopy allowed identification of the nature of intranasal and
197
intrasinusal soft tissue but was not as useful as CT and MRI for defining the extent of
lesions and provided no information regarding bone lesions.
Peeters et al. (2005) used histochemistry and immunohistochemistry to characterize
the phenotype and distribution of leucocytes in the distal nasal mucosa of
15 dogs with nasal aspergillosis. The most consistent histopathological finding was a
severe, predominantly lymphoplasmacytic, inflammatory infiltration of the lamina
propria. Fungal hyphae were not observed to invade the mucosa but were found at the
mucosal surface and within material collected from the nasal cavity. The main
immunohistochemical findings were (1) a predominance of IgG(+) plasma cells over
IgA(+) and IgM(+) plasma cells, (2) significant numbers of macrophages and
dendritic cells expressing MHC class II molecules, (3) macrophages and neutrophils
expressing L1 antigen and (4) a mixture of CD4(+) and CD8(+) T cells. These
findings were consistent with a dominant Th1-regulated cell-mediated immune
response. The nature of the inflammatory infiltrate and the lack of invasiveness of the
mucosa by the fungus, together with the clinical course of the disease and the
apparent immunocompetence of the affected dogs, suggest that canine
nasal aspergillosis resembles the chronic erosive non-invasive fungal sinusitis
described in human patients.
Peeters et al. (2005)
Benitah (2006) reported that chronic nasal discharge is a common clinical sign of
disease in dogs. Canine sinonasal aspergillosis is a relatively common disease in dogs.
The three hallmarks of canine nasal aspergillosis are a profuse mucoid to
hemorrhagic chronic nasal discharge that may alternate with periods of epistaxis,
ulceration of the external nares with crusting, and pain or discomfort in the facial
region. Diagnostic imaging (preferably computed tomography, CT) of the nasal cavity
and paranasal sinuses is an important component of the evaluation of dogs with signs
of nasal disease. Rhinoscopy is an important part of both the diagnosis and the
therapy
for
nasal aspergillosis.
Therapeutic
recommendations
for
198
sinonasalaspergillosis have included surgery and the use of several systemic and
topical antifungal drugs.
Claeys et al, (2006) evaluated the effectiveness of rhinotomy and surgical debridement
associated with topical administration of 2 per cent enilconazole and oral itraconazole
in dogs with severe or recurrent sinonasal aspergillosis. A standard rhinotomy was
performed on seven dogs. In the initial study, the bone flap was left attached cranially
and replaced at the end of the procedure. In the main study group, the bone flap was
discarded. Nasal passages were debrided and irrigated with enilconazole solution for
one hour. Oral itraconazole was administered to four dogs for one month
postoperatively. Follow-up rhinoscopy was performed in all dogs. All three dogs in
the initial study had recurrence of the disease and two dogs had a second surgery to
remove the flap. The main study group included four dogs in which the flap was
initially removed, and the two dogs from the initial study that required a second
surgery. At follow-up rhinoscopy, five dogs were free of aspergillus but had bacterial
or inflammatory rhinitis and one dog had a small aspergilloma but was subsequently
asymptomatic. Telephone follow-up revealed that four dogs were asymptomatic, one
dog had intermittent sneezing and serous nasal discharge, and one dog had
intermittent epistaxis.
Intraoperative
the
nasal cavities
view of
Intraoperative view of the nasal cavities and frontal sinuses after removal of the bone flap and before
debridement. Note the heavy fungal plaques in the left frontal sinus. Claeys et al, (2006)
De Lorenzi et al. (2006) compared the efficacy and diagnostic value of four different
sample collection techniques for cytological identification of nasal aspergillosispenicilliosis in dogs. Fifteen dogs with a history of persistent nasal discharge and
clinical and radiographic findings suggestive of aspergillosis were evaluated using
four different cytological sampling techniques. These were a direct smear from the
nasal discharge, blind swab collection under general anaesthesia, brushing from
suspect lesions under direct endoscopic visualisation and a squash technique of
mucosal biopsies from suspect lesions obtained under direct endoscopic visualisation.
199
Direct smear collection and blind swab collection detected fungal hyphae in 13.3 and
20 per cent of examined cases, respectively; brush samples detected fungal hyphae in
93.3 per cent and fungal spores in the 45 per cent of examined cases and squash
samples detected fungal hyphae in 100 per cent and fungal spores in 36 per cent of
examined cases. This study confirmed the high accuracy of cytology samples in the
diagnosis of nasal aspergillosis-penicilliosis when collected under direct endoscopic
visualisation and showed the poor value of samples that were collected by blind
swabs or prepared from samples of nasal discharge.
Squash preparation from an endonasal biopsy (case 5). Note the large (4 to 6 mm in diameter), dark
blue septate hyphae with parallel sides that branch dichotomously at a 45º angle. Giemsa, _650
Squash preparation from an endonasal biopsy (case 11). Conidial heads are only rarely seen in
cytological samples from fungal rhinitis. Aspergillus fumigatus conidial heads can be seen here.
Giemsa, _1000, De Lorenzi et al. (2006)
Johnson et al. (2006) reviewed medical records of 46 dogs with nasal aspergillosis
for information on computed tomographic findings; rhinoscopic findings, including
whether fungal plaques were seen in the nasal cavity; results of frontal sinus
trephination and sinuscopy, including whether fungal plaques were seen in the frontal
sinus; and results of histologic examination of biopsy specimens. In 38 (83%) dogs,
fungal plaques were seen in the nasal cavity during rhinoscopy, whereas in the
remaining 8 (17%), fungal plaques were not seen in the nasal cavity but were seen in
the frontal sinus. Duration of clinical signs, proportions of dogs in which the referring
veterinarian had performed a nasal examination prior to referral, proportions
of dogs with computed tomographic evidence of nasal cavity cavitation or sinus
involvement, and proportions of dogs with rhinoscopic evidence of destructive rhinitis
were not significantly different between dogs with nasal fungal plaques and dogs with
fungal plaques only in the frontal sinus. Results confirm that frontal sinus
involvement is common in dogs with nasal aspergillosis and suggest that frontal sinus
trephination and sinuscopy may aid in the diagnosis of aspergillosis in dogs,
particularly dogs with rhinoscopic evidence of destructive rhinitis and computed
tomographic evidence of sinus involvement that lack detectable fungal plaques in the
nasal cavity
Peeters and Clercx (2007) stated that sinonasal aspergillosis is a frequent cause of
nasal discharge that occurs in otherwise healthy, young to middle-aged dogs. A local
immune dysfunction is suspected in affected animals, and the role of increased
interleukin-10 mRNA expression in the nasal mucosa of affected dogs is currently
211
under investigation. Despite recent advances in imaging techniques, the "gold
standard" for diagnosing the disease is direct visualization of fungal plaques during
endoscopy or observation of fungal elements on cytology or histopathologic
examination. Treatment can be challenging; however, the use of topical enilconazole
or clotrimazole through noninvasive techniques has increased the success of treatment
and decreased the morbidity and duration of hospitalization.
Pomrantz et al. (2007) carried out a study to compare the sensitivity and specificity
of serologic evaluation and fungal culture of tissue for diagnosis of
nasal aspergillosis in 58 dogs with nasal discharge and 26 healthy dogs. Dogs with
nasal discharge were anesthetized and underwent computed tomography and
rhinoscopy; nasal tissues were collected for histologic examination and fungal culture.
Sera were assessed for antibodies against Aspergillus spp (healthy dog sera were used
as negative control specimens). Nasal aspergillosis was diagnosed in dogs that had at
least 2 of the following findings: computed tomographic characteristics consistent
with aspergillosis, fungal plaques detected during rhinoscopy, and histologically
detectable fungal hyphae in nasal tissue. Histologic characteristics of malignancy
were diagnostic for neoplasia. Without evidence of neoplasia or fungal disease, nonfungal rhinitis was diagnosed. Among the 58 dogs, 21 had nasal aspergillosis, 25 had
non-fungal rhinitis, and 12 had nasal neoplasia. Fourteen aspergillosis-affected
dogs and 1 dog with non-fungal rhinitis had serum antibodies against Aspergillus spp.
Fungal culture results were positive for Aspergillus spp only for
17 dogs with aspergillosis. With regard to aspergillosis diagnosis, sensitivity,
specificity, and positive and negative predictive values were 67%, 98%, 93%, and
84%, respectively, for serum anti-Aspergillus antibody determination and 81%,
100%, 100%, and 90%, respectively, for fungal culture. Results suggest that
seropositivity for Aspergillus spp and identification of Aspergillus spp in cultures of
nasal tissue are highly suggestive of nasal aspergillosis in dogs; however, negative
test results do not rule out nasal aspergillosis.
Schuller and Clercx (2007) evaluated long-term outcomes (mean 38+/-17 months)
in 27 dogs with sinonasal aspergillosis after successful medical treatment using
intranasal infusions of 1% or 2% enilconazole (1%, n=15; 2%, n=12). Long-term
outcomes with both treatment protocols were good, with half of the dogs being
asymptomatic throughout the follow-up period. The remaining dogs showed mild
clinical signs compatible with chronic rhinitis/sinusitis. These clinical signs were
interpreted as chronic lymphoplasmacytic rhinitis/sinusitis and episodes of bacterial
rather than fungal infection. Three dogs had confirmed reinfection or relapse 2 to 36
months after clinical resolution.
Meler et al. (2008) conducted a retrospective study to determine the percentage of
cases for which the etiology was determined in hospital population. Medical records
from 80 dogs met the criteria of inclusion in the study. Non-specific rhinitis was
identified in 23.7% of cases. Other diagnoses were neoplasia (15.0%), fungal
infection (nasal aspergillosis) (8.7%), cleft palate (8.7%), periodontal disease (4.0%),
parasites (1.3%), foreign body (1.3%), and primary bacterial disease (1.3%). A
definitive diagnosis could not be established in 36.3% of cases. Dogs with neoplastic
and mycotic diseases often presented with severe radiographic and rhinoscopic
lesions. Despite a systematic approach, numerous cases went undiagnosed. The use of
211
advanced imaging should increase our ability to obtain an etiologic diagnosis in
canine nasal disease.
Dorsoventral intraoral radiograph of a dog with nasal adenocarcinoma. This intraoral nasal radiograph
shows a unilateral, localized, increased density associated with the disappearance of the ethmoid
turbinate pattern in the caudal portion of the right nasal cavity. The dog presented for a unilateral rightsided mucopurulent nasal discharge. Nasal adenocarcinoma was confirmed by biopsy Meler et al.
(2008)
Left:Endoscopic examination of a dog with nasal aspergillosis. Endoscopic view of the caudal portion
of the ventral meatus of the nasal cavity of a dog with nasal aspergillosis. Greyish plaques
characteristic of aspergillosis are visible. Note the erosion of the mucous membranes and the atrophy of
nasal conchae.Right: Photomicrograph of the nasal mucosa of a dog with lymphoplasmacytic rhinitis.
Endoscopic biopsies of this dog showed marked lymphocytic (black arrowhead) and plasmacytic
(black arrow) infiltration of the nasal mucosa. No other etiology could be found in this dog to explain
the chronic bilateral rhinitis. The dog was diagnosed with lymphoplasmacytic rhinitis. HematoxylinEosin-Safran. Bar = 20 μm. Meler et al. (2008)
212
Computed tomography of a dog with nasal adenocarcinoma. A caudal transverse view shows a soft
tissue density invading the left nasal cavity. The nasal septum is eroded and invasion of the ventral
portion of the left orbit through the frontal bone and nasopharyngeal area is observed (white arrow). A
biopsy confirmed the presence of a nasal adenocarcinoma. Meler et al. (2008)
213
Day (2009) stated that canine sino-nasal aspergillosis (SNA) is characterized by the
formation of a superficial mucosal fungal plaque within the nasal cavity and/or frontal
sinus of systemically healthy dogs. The most common causative agent is Aspergillus
fumigatus. The fungus does not invade beneath the level of mucosal epithelium but
incites a severe chronic inflammatory response that leads to local destruction of nasal
bone. These clinicopathological features are equivalent to those of human chronic
erosive non-invasive fungal sinusitis. The clinical diagnosis of canine SNA relies on
multiple modalities but local instillation of anti-fungal agents is an effective therapy
with high cure-rate. Recent studies have investigated the immunopathogenesis of
canine SNA. The mucosal inflammatory infiltrate involves a mixture of CD4+ and
CD8+ T lymphocytes, IgG+ plasma cells and activated macrophages and dendritic
cells expressing class II molecules of the major histocompatibility complex. There is
active recruitment of blood monocytes and neutrophils. Real-time quantitative reverse
transcriptase polymerase chain reaction (qRT-PCR) analysis of mucosal tissue
samples has revealed up-regulation of Th1 (IL-12, IL-18 and IFN-gamma), Th17related (IL-23) and pro-inflammatory (IL-6, TNF-alpha) cytokine mRNA with
evidence of expression of genes encoding monocyte chemoattractant proteins 1-4.
Additionally, there is significant transcription of the IL-10 gene consistent with local
immunosuppression that prevents secondary immune-mediated sequelae whilst
permitting chronicity of the infection. The source of this IL-10 may be a T regulatory
population or a Th1 population that switches phenotype during the course of disease.
This understanding of the immunopathogenesis of canine SNA establishes this
disorder as a valuable model for the equivalent human pathology.
Skull radiograph of a dog with sino-nasal aspergillosis showing destructive bony lesions (photograph
courtesy Day
(2009) ,Alasdair Hotston Moore, University of Bristol).
214
Magnetic resonance imaging of the frontal sinuses of a dog with sino-nasal aspergillosis showing the
presence of a fungal plaque overlying the mucosal surface. Rhinoscopic image of upper respiratory
tract mucosa of a dog with sino-nasal aspergillosis. A ‘fluffy’ white fungal plaque is readily observed
overlying the mucosal surface (photograph: Day (2009) Alasdair Hotston Moore, Univ of Bristol).
Biopsy taken from a fungal plaque in the right frontal sinus of a 4-year-old, male Jack Russell Terrier
with sino-nasal aspergillosis. A mycelial mat overlies a central zone of necrosis, haemorrhage and
fibrinocellular exudation, and deep to this is a bed of fibrovascular granulation tissue. Biopsy taken
from a fungal plaque in a dog with sino-nasal aspergillosis. Grocott hexamine silver, Day (2009)
Alasdair Hotston Moore, University of Bristol
Trephination of the frontal sinuses of a dog with sino-nasal aspergillosis. Note the fungal debris in the
larger trephine hole, Instillation of clotrimazole into the frontal sinuses of a dog with sino-nasal
aspergillosis. The dog is anaesthetized and placed in sternal recumbency. The two large syringes have
been used to inject infusate into the sinuses via the rigid catheters. The two Foley catheters at the base
of the image exit the nares. These Foley catheters have inflated balloons that occlude the nares and
minimize leakage of infusate cranially. Day (2009) Alasdair Hotston Moore, Univ of Bristol
215
Greci et al. (2009) diagnosed 3 dogs (a 7-year-old female German shepherd, a 3-yearold male Rottweiler and a 6-year-old male German shepherd) with aspergillosis that
developed sinonasal tumors several months after successful treatment with topical
clotrimazole solution. Chronic rhinosinusitis was also detected in all cases prior to
diagnosis of sinonasal tumors. The inflammatory response to Aspergillus,
clotrimazole treatment, and chronic inflammation after treatment were discussed as
possible neoplastic promoting factors.
Presence of blood, edema of the mucosa and mucosal blebs at the opening of the left frontal sinus.
Endoscopic findings at 30 months post treatment (case 3): presence of a whitish vascularized new
growth of tissue occluding the left nasal cavity. Greci et al. (2009)
Ferreira et al. (2011) reported an 18-months old, male, Rottweiler breed dog with
purulent nasal discharge, variably bloody, and sneezing of approximately 6 months
duration. During this period, the dog was treated with various antibiotics with no
success and lost 10 kg of corporal mass. The alterations found in the physical exam
were bilateral sanguine-purulent nasal discharge, depigmentation of nose and
paranasal region, as well as subnutrition. The dog was anesthetized and sinus and
chest x-rays were performed (latero-lateral and ventrodorsal positions). In the
radiographic analysis, it was verified the lessening of radiolucency on the left nostril,
indicating the destruction of the nasal concha. The chest radiographies did not show
alterations. A rhinoscopy was carried out showing destruction in the endoturbinate,
purulent discharge and presence of a dark color mass in the frontal sinus, which was
collected for histopathological and microbiological culture exams. Histopathologic
examination revealed the presence of hyaline, branching septate hyphae, consistent
with Aspergillus spp. and inflammatory cells. Culture identified Aspergillus
fumigatus. Bacteriological culture was negative. Antibodies to Aspergillus fumigatus
were detected by counter electrosyneresis. The haemogram showed lymphocytosis
and monocytosis. The dog was treated with itraconazole (5 mg/kg of body weight,
orally, twice a day for 30 days). After this period, nasal discharge decreased and a
good repigmentation was observed with the dog showing improvement of his appetite
and energy level. Discussion: The presence of antibodies to Aspergillus spp. does not
always confirm canine nasal aspergillosis. Serological tests can yield 5% to 15% false
positive results in dogs. Therefore, it is necessary to perform complementary exams
such as radiography, rhinoscopy, histopathology and fungal culture in order to
confirm the diagnosis. For many years, aspergillosis was considered as an incurable
216
chronic rhinitis characterized by the turbinate destruction, nasal discharge and
intermittent epistaxis.
18-months old, male, Rottweiler breed dog with purulent nasal discharge, depigmentation of nose and
skin. histopathological picture of a dark color mass in the frontal sinus revealing the presence of
Aspergillus hyphae and inflammatory cells., Ferreira et al. (2011) www.ufrgs.br
Burrow et al. (2012) performed a study with the objective to assess whether the
frontal sinuses in dogs with aspergillosis and of breeds typically affected by this
condition were deeper at a more caudal location. CT scans of the head performed at
the Small Animal Teaching Hospital, University of Liverpool, between April 2007
and March 2009 for dogs diagnosed with aspergillosis (group 1) and
unaffected dogs of similar breeds (group 2) were selected for study. Sinus depth was
measured at four standardised locations from reconstructed images of these CT scans.
Data were compared for differences in sinus depth between groups and between
landmarks. No significant difference was found between measurements within
individual dogs or for each of the various landmarks between groups. Difference in
depth of the sinuses between landmarks was significant (P<0.001). Sinus depth was
significantly greater at the more caudal landmarks and was shallowest at the
previously recommended landmark for sinus entry. In 54 per cent of dogs, the frontal
sinus depth measured less than or equal to 2 cm at one or more of the landmarks.
Sinus entry at the deepest point will reduce the risk of accidentally damaging
underlying structures. This may be approximately 1 cm caudal, in breeds of dog that
typically develop aspergillosis, to a previously suggested landmark
Sharman and Mansfield (2012) in a review on sinonasal aspergillosis mentioned
that it is an uncommon, yet debilitating and often frustrating condition to treat
in dogs despite years of research evaluating pathogenesis, diagnosis and treatment.
The disease is most commonly caused by non-invasive fungal infection, thought to be
secondary to altered innate and/or adaptive immune responses. Attempts to confirm
this have however failed. A variety of conflicting opinions regarding the diagnosis
and treatment of sinonasal aspergillosis exist. Often the use of a particular treatment
protocol is based upon personal or regional preference. Evaluation of the veterinary
literature demonstrates that the evidence base in support of individual treatment
recommendations is weak. A number of recent publications have helped to expand the
current knowledge base and therefore our understanding of important practicalities for
both diagnostic options and treatment protocols. The following review examines the
current evidence for the pathogenesis of sinonasal aspergillosis in dogs, as well as the
various diagnostic options. The available evidence for frequently utilised -therapeutic
options and their likely outcomes is also explored.
217
Mucopurulent nasal discharge and nasal depigmentation in a dog receiving treatment for sinonasal,
www.researchgate.net, Open mouth, ventrodorsal projection of the left and right nasal cavities showing
a patchy increase in opacity within the mid to caudal left and right nasal cavities, Sharman and
Mansfield (2012).
Destruction of the nasal turbinates identified on computed tomography (CT) of the nasal cavity.Marked
hyperostosis of the frontal bone associated with severe involvement of the right frontal sinus, as
identified using computed tomography (CT). Image courtesy of Murdoch University Veterinary
Hospital, Western Australia, Sharman and Mansfield (2012).onlinelibrary.wiley.com
218
Severe nasal turbinate destruction and fungal plaques within the nasal cavity of a dog affected by
sinonasal aspergillosis. Image courtesy of Associate Professor Vanessa Barrs, University of Sydney
Veterinary Teaching Hospital, New South Wales, Australia, Sharman and Mansfield
(2012).onlinelibrary.wiley.com
1.9.2.
Bronchopulmonary aspergillosis:
Kim et al. (2003) presented a 6-month-old male golden retriever with fever, bloodywatery diarrhea and mild cough. Parvovirus and Isospora canis infection was
confirmed and successfully treated. Two weeks later, the dog had severe cough and
mucopurulent nasal discharge. Aspergillus niger was cultured from endotracheal
washings on blood agar at 37 degrees C. Treatment with itraconazole for about 10
weeks resolved the clinical signs.
Kulendra et al. (2010) presented a two-year-old female German shepherd dog with
chronic cough and haemoptysis. Thoracic radiographs revealed a thin-walled cavitary
lesion within a consolidated left cranial lung lobe. Bronchoalveolar lavage confirmed
a concurrent bacterial infection; however, despite antibiotic and anthelmintic therapy
the clinical signs failed to resolve. A left cranial lung lobectomy was performed.
Histopathology and fungal culture confirmed the presence of Aspergillus fumigatus.
The necrotic cavity had features compatible with a bronchial origin, possibly a form
of cystic bronchiectasis, arising either as a congenital anomaly or acquired secondary
to infection. Surgery provided resolution of clinical signs for just over a year before
the dog deteriorated again and was subsequently euthanised. Necropsy was declined
by the owners. This case report presents a unique presentation in which the
predominant clinical sign was coughing due to pulmonary involvement. Aspergillus
fumigatus was isolated from the left cranial lung lobe.
219
Right lateral thoracic radiograph. A thin-walled cavitary lesion outlined by the white arrows
can be seen within a consolidated left crania lung lobe. Kulendra et al. (2010)
Transverse CT image of the thorax. Thin walled cavitary lesion in the left cranial lung lobe.
The outline of the cavitary lesion (white arrows), a fluid gas interface within the cavitary lesion and
adjacent consolidated lung are visible. Kulendra et al. (2010)
211
Low power magnification ×40. Groccot stained tissue reveals numerous fungal hyphae lining
the inside of the cavitary lesion. Kulendra et al. (2010)
Adamama-Moraitou et al. (2011) described a 3 yr old intact female Hellenic
shepherd dog with depression, partial anorexia, fever, and a mild productive cough of
2 m duration. Thoracic radiographs showed increased opacity of all of the left lung
lobes. Upon bronchoscopy, a sanguineous, purulent discharge was detected in the
tracheal lumen with hyperplastic tissue narrowing the left main stem bronchus.
Cultures were positive for bacteria (Bacillus spp. and Clostridium spp.) but negative
for fungi. Due to the severity of the lesions, a complete left lung pneumonectomy was
performed. Histopathological examination of the excised lung tissues revealed a
severe granulomatous bronchopneumonia with numerous alveolar macrophages
laden with structures stained positively by periodic acid-Schiff and Grocott stain that
had morphology consistent with fungi. PCR and sequencing of internal transcribed
spacer regions 1 and 2 from genetic material extracted from paraffin-embedded
pulmonary tissue confirmed the presence of Aspergillus fumigatus. Itraconazole was
administrated for 5.5 mo and the dog was clinically normal 26 mo after surgery.
Trempala and Herold (2013) described a case of pulmonary aspergillosis in a
previously healthy dog that manifested as a spontaneous pneumothorax. A 3-year-old
neutered male mixed-breed dog was presented with inappetence and respiratory
distress. Thoracic radiography revealed a right-sided pneumothorax. Following
stabilization, thoracic computed tomography found 1 large and many small
pulmonary blebs in the right caudal lung lobe. The dog underwent a right lateral
thoracotomy, identifying numerous emphysematous regions in the right middle lung
lobe, and a right middle lung lobectomy was performed. Histopathologic examination
of the resected lung lobe revealed severe, diffuse bronchopneumonia with necrotizing
pleuritis and the presence of fungal organisms strongly suggestive of Aspergillus sp.
Surgical removal of the affected lung lobe and continued medical treatment with
itraconazole resolved the dog's clinical signs.
211
Thoracic CT images of a dog with spontaneous pneumothorax secondary to pulmonary aspergillosis
showing variously sized pulmonary bullae in right middle lung lobe Trempala and Herold (2013)
Hematoxylin and eosin stain (50× magnification) of resected lung tissue from a dog with pulmonary
aspergillosis showing septate and branching fungal hyphae consistent with Aspergillus sp Trempala
and Herold (2013) www.researchgate.net
1.9.3.
Disseminated aspergillosis:
Wood et al. (1978) reported a dog with disseminated Aspergillus terreus infection.
The dog died after a protracted course of hospitalization. Treatment with
amphotericin B methyl ester was without effect. The causative organism was found in
bone, myocardium, spleen, kidneys, liver, thymus, lymph nodes, and both eyes.
Treatment with antimicrobials and corticosteroids prior to hospitalization may have
contributed to dissemination of the fungus.
Richardson et al. (1982) detected Aspergillus fumigatus precipitins in dog sera by
counter immune electrophoresis (CIE). The procedure gave results within 90 minutes
compared with 72 to 96 hours required in agar-gel double diffusion. Culture-filtrate
antigens from two-week-old cultures of A fumigatus and two-day-old mycelial
antigens produced the strongest reactions in CIE tests and the former antigen also
revealed high titres in tests with serum from seven of 14 dogs with A fumigatus
precipitins. Serum from these 14 dogs also reacted in CIE tests with a number of
Penicillium species antigens.
212
Day et al. (1985) reported eight cases of disseminated canine aspergillosis (A.
terreus) in German Shepherd dogs. Immunoglobulin determination revealed
depression of serum IgA (cases 1 and 5) and IgM (case 2) levels and elevated levels
of IgG in all cases. Total complement activity (CH50) and complement components
tests, (C3, C4) were present in normal amounts in all cases. Using agar gel diffusion,
serum antibody to A. terreus was found in only one case and aspergillus antigenaemia
in two of the remainder. Lectin transformation of lymphocytes in two dogs was found
to be depressed relative to normal controls in case 1 and initially in case 2. Two dogs
failed to respond to the intradermal injection of A. terreus antigen.
Kabay et al. (1985) diagnosed disseminated Aspergillus terreus infection in 10
previously healthy adult dogs--nine German shepherds and one dalmatian. The
disease was characterized by the presence of multiple granulomas and infarcts in a
wide range of organs. The kidney, spleen, and skeletal system were most commonly
and severely affected. Fungal hyphae were demonstrated in large numbers within
granulomas and thrombi, and A. terreus was readily isolated by culture. This
disseminated mycosis appears unique; in this series of cases there was no apparent
predisposing factor, portal of entry, or primary focus for dissemination of the
infection.
Day et al. (1986) reported clinical and pathological findings from a series of 12 cases
of disseminated aspergillosis (A. terreus) in 11 German Shepherd dogs and one
Dalmatian referred to Murdoch University Veterinary Hospital (MUVH) over the
period 1980 to 1984. A preliminary study of humoral and cell mediated immune
components and complement levels revealed no consistent abnormality in
9 dogs tested apart from raised IgG levels. Serum IgA levels were depressed in 30%
of cases. Serial data from one extensively monitored case is presented. The unusual
epidemiological and pathogenetic features of the disease were discussed.
Jang et al. (1986) presented 4 of disseminated aspergillosis caused by Aspergillus
deflectus in German Shepherds. Three of the cases, which involved multiple organs,
terminated in euthanasia. One case, with bony involvement of the limbs and skull,
lived. The unique morphological characteristic of the conidial head resembling a briar
pipe led to the identification of A. deflectus.
Day and Penhale (1988) studied aspects of humoral immunity in 17 dogs with
disseminated aspergillosis (16 cases Aspergillus terreus, 1 case Aspergillus
flavipes). Alldogs had markedly raised serum IgG levels by single radial
immunodiffusion (range 1500-6000 mg dl-1). Despite this, serum antibody to A.
terreus was demonstrated in only 7/16 cases by agar gel diffusion, 9/16 cases by
counter immunoelectrophoresis, 10/16 by ELISA and 11/16 by an indirect
immunofluorescence assay. Serum antibody was also detected in 2/5 clinically normal
relatives of 2 cases, indicating previous exposure or subclinical infection.
Day and Penhale (1991) conducted an immunohistochemical study of 25 lesions
from 7 dogs with disseminated aspergillosis (Aspergillus terreus). All had multiple
fungal granulomas in many viscera, with centres of necrotic tissue and hyphal
elements surrounded by a mixed infiltrate of predominantly mononuclear cells.
Within these lesions, hyphae coated with immunoglobulin (IgG, IgM, IgA) and
complement (C3, C4) were identified, together with peri-lesional mononuclear cells
that reacted with antisera directed towards either IgG, IgM, IgA or a T lymphocyte
213
marker (MUII). A conspicuous feature was the prominent hyphal fluorescence seen
with IgA and C3 antisera. The IgA reagent also marked large numbers of
mononuclear cells both around lesions and scattered throughout interstitial tissue,
suggesting an abnormality of IgA production or regulation as a factor predisposing to
this condition.
Dallman et al. (1992) treated a German shepherd dog initially for signs of urinary
tract infection; subsequently, signs of spinal pain and neurologic deficits developed.
Fungal hyphae were found in the urine sediment, and spinal radiography revealed
changes in the vertebrae and intervertebral disks at the levels of T3 to T8, T12 to
T13, L3-4, and L5-6, consistent with diskospondylitis. Fungal cultures of urine and
specimens from spinal lesions yielded Aspergillus terreus. Itraconazole (5 mg/kg of
body weight, PO, q 24 h) was used to treat this infection, and locomotion improved.
Sudden death occurred 4 weeks after treatment was initiated; this was attributed to
exsanguination associated with a weakened renal artery. This dog was raised in
Florida and resided in central Virginia. The disseminated aspergillosis found in
this dog was not limited to the hot arid climates that some reports suggest are
optimal conditions for growth.
Pastor et al. (1993) diagnosed systemic aspergillosis in a two-and-a-half-year-old
spayed German shepherd dog which had suffered an acute attack of paralysis of the
pelvic limbs. The neurological deficits were attributed to the destruction of the
seventh vertebral body and the intervertebral disc, with protrusion of necrotic material
into the vertebral canal and compression of the spinal cord at this level.
Microscopically, fungal invasion and destruction of the body of T-7 was observed and
Aspergillus species were identified. Fungal granulomas were also found in the liver,
lung, spleen and mesenteric lymph nodes.
Robinson et al. (2002) reported a 4-year-old, entire female, German Shepherd Dog
with a 3-month history of right foreleg lameness that partially responded to
nonsteroidal anti-inflammatory and antimicrobial therapy. The bitch lost weight, was
polydipsic and had reduced exercise tolerance. On referral, the animal was in poor
condition, pyrexic and exhibited moderate pain on full extension of the right shoulder.
The bitch was lymphopaenic, hyperfibrinogenaemic, hyperglobulinaemic, mildly
azotaemic, mildly proteinuric and isosthenuric. Branching fungal hyphae were present
in the urine. On radiography, the thorax contained a large ventral mediastinal mass
and the humeral head had extensive areas of radiolucency. An aspirate from the right
humeroscapular joint exhibited branched fungal hyphae and numerous neutrophils
and macrophages. A diagnosis of disseminated mycosis was made and euthanasia was
performed. At necropsy, numerous caseating granulomas were present, especially in
the kidneys, adrenal glands, heart and lymph nodes. Extensive osteomyelitis involved
the head of the right humerus, the sternebrae and the fifth intervertebral disc. Fungal
hyphae were detected in sections of granulomas in all affected organs and a diagnosis
of disseminated fungal granulomatosis was made. Aspergillus deflectus was readily
isolated from affected lymph nodes, but confirming its identity as A deflectus using
standard procedures proved difficult. The identity of the fungus was finally confirmed
by sequencing part of the 185 rRNA of the isolate.
Bruchim et al. (2006) described two cases of German shepherd dogs with a history
of anorexia and weakness. Case 1 suffered from neurological deficits, paraparesis and
lumbar pain whereas case 2 suffered from unilateral uveitis and exophthalmus.
Both dogs were treated symptomatically, but deteriorated progressively despite
214
therapy
and
were
therefore
euthanised.
Necropsy
revealed
disseminated aspergillosis, and numerous organs had multiple, miliary, white-yellow
foci. Microscopically, these were identified as granulomas, containing fungal hyphae.
Affected tissue included brain, heart, kidneys, spleen, lymph nodes and bones (case
2). Aspergillus terreus was isolated from different organs and from urine culture.
They suggested that disseminated aspergillosis should be considered as a differential
diagnosis in German shepherd dogs presenting with ocular disease, neurological
deficits, spinal column pain, urinary system disorders, and radiographic evidence of
skeletal and/or respiratory pathology.
Aspergillus terreus golden-brown colony and compactly columnar heads , (a) Right lateral
view of the thoracolumbar vertebrate of discospondylitis at L1-L2. Bone destruction and
proliferation. (b) Anteroposterior view of a left elbow. Osteomeyelitis, note the bone
proliferation and reaction Bruchim et al. (2006)
Elad et al. (2008) isolated Aspergillus terreus from the organs of a German Shepherd
puppy removed from the bitch by cesarean intervention. In the following days, the
bitch developed signs of canine disseminated aspergillosis and was euthanized. The
fungus was isolated from a necrotic lesion in the uterus and other organs. To the best
of our knowledge, this is the first report of the transuterine transmission of A. terreus
during a case of canine disseminated aspergillosis.
215
Uterine lesions. (a) External aspect, (b) External aspect — detailed view — note perforation of left
lesion. (c) Internal aspect, (d) Internal aspect — detailed view of lesion. Elad et al. (2008)
Grocott's modification of Gomori's methenamine silver stain of uterine lesions. (a) Massive fungal
(dark brown elements) invasion (bar = 200 µm). (b) Hyphae and large number of globose aleuriospores
Elad et al. (2008)
Schultz et al. (2008) reviewed. medical records for signalment, clinical features, and
results
of
clinicopathologic
testing
and
diagnostic
imaging
of
systemic aspergillosis in 30 dogs. Diagnosis was confirmed by culture of Aspergillus
terreus (n = 13), Aspergillus deflectus (n = 11), or other Aspergillus spp. (n = 6).
German Shepherd dogs and female dogs were overrepresented (odds ratio [OR] 43,
95% confidence interval [CI] 20-91, P < .0001, and OR 2.9, 95% CI 1.2-6.7, P= .02),
respectively, with 20 of the 30 dogs being German Shepherd dogs and 77% (23 of 30)
of the dogs being female. The median age was 4.5 years (range 2-8 years). Anemia,
leukocytosis, hyperglobulinemia, azotemia, hypercalcemia, and hypoalbuminemia
were present in 8, 21, 12, 9, 8, and 6 dogs, respectively. Diskospondylitis,
osteomyelitis and thoracic lymphadenomegaly were present in 16, 10, and 5 dogs,
respectively. Sonographic findings were enlarged hypoechoic lymph nodes (n = 12),
mottled and irregular kidneys with or without masses (n = 12), pyelectasia, and an
aggregate of echogenic material in the renal pelvis (n = 9). Thirteen dogs were treated
with antifungal drugs, with survival times ranging from 0 to 25 months after
diagnosis. It was concluded that systemic aspergillosis typically involves young to
middle-age female German Shepherd dogs, and there are characteristic abdominal
ultrasound findings with the disease process. Infection with A. deflectus was as
216
common as A. terreus, and in rare cases, long-term survival was associated with
antifungal therapy.
Lateral radiograph of the lumbar spine from a German Shepherd dog with systemic aspergillosis,
showing the typical radiographic appearance of Aspergillus spp. diskospondylitis. There is irregular
lysis with surrounding sclerosis of the end plates of the 6th and 7th lumbar vertebrae. Spondylosis
deformans is also present on the ventral aspect of the affected vertebrae. Schultz et al. (2008)
Bone survey lateral radiographs from a German Shepherd dog with systemic aspergillosis. (A) An
aggressive mixed productive and destructive lesion is present involving the proximal aspect of the body
of one of the superimposed scapula. There is also periosteal production and increased medullary
opacity of the proximal diaphysis of the caudally positioned humerus. (B) An aggressive mixed
productive and destructive lesion is present in the medullary cavity of the femur. In addition, there is an
extensive mixed smooth to palisading periosteal reaction along the femoral diaphysis. The
histologic diagnosis was granulomatous osteomyelitis.. Schultz et al. (2008)
217
Transverse ultrasound image of the left kidney from a 4- year-old female spayed German Shepherd dog
with systemic aspergillosis. There is moderate pyelectasia and proximal ureteral dilation. The renal
pelvis is filled with an aggregate of echogenic debris (white arrow) and the papilla is blunted. The renal
architecture is also distorted and mottled. The histologic diagnosis was fungal pyelonephritis with renal
parenchymal granulomas. Schultz et al. (2008)
MR images of the brain and brainstem from a German Shepherd dog with systemic aspergillosis. The
dog’s left is to the right of the transverse images. (A) Transverse FLAIR image of the brain and
brainstem reveals asymmetric hyperintensity in the left hippocampus (large white arrow) and meninges
(small white arrows). (B) Transverse contrast enhanced T1-weighted image of the brain and brainstem
revealing contrast enhancing lesions in the brainstem (large white arrow) and meninges (small white
arrows). The plaque-like appearance of the ventral contrast enhancing meningeal lesion is caused by
the image being acquired in the plane of a sulcus. (C) Sagittal contrast enhanced T1-weighted image of
the cerebrum, cerebellum, and brainstem demonstrating multifocal contrast enhancing lesions
involving the meninges (white arrows). The lesions appear deep in the brain parenchyma because the
image plane was acquired in plane with the falx cerebri. The histologic diagnosis was fungal
meningoencephalitis. Schultz et al. (2008)
Burrough et al. (2012) reported a case of disseminated disease in an English
springer spaniel from which Aspergillus alabamensis was recovered by culture and
identified by molecular means suggesting a potential role for this agent as a primary
pathogen of dogs. A 5-year-old, spayed female, was presented to the Lloyd Veterinary
Medical Center of the Iowa State University College of Veterinary Medicine with a 7
days history of vomiting, inappetence, and lethargy. Abdominal radiographs revealed
mild generalized hepatomegaly and mild abdominal effusion. Cytology of the
effusion revealed 96% neutrophils, and the remaining cells were macrophages and
monocytes and a diagnosis of purulent abdominal exudation with associated fungal
218
hyphae was achieved. At necropsy, there was approximately 400 ml of red-brown
effusion in each of the pleural and peritoneal cavities, and approximately 200 ml of a
similar effusion within the pericardial space. The liver was diffusely pale and there
were numerous multifocal to coalescing raised, tan, pinpoint to 0.3 cm diameter foci
along the serosal surface, extending into the cut surface, and throughout the
parenchyma. Similar foci were noted in the wall of the gallbladder, along the serosal
surface of the stomach, throughout the walls of the heart, within the visceral pleura,
and along both the pleural and peritoneal surfaces of the diaphragm. Both kidneys had
widely scattered and variably sized pale foci similar to other organs, and there were
multiple areas of infarction, most often at the poles. The pancreas was diffusely
thickened with multifocal areas of hemorrhage, there were numerous raised black
splenic nodules that extended into the cut surface, and there was marked bilateral
atrophy of the masseter and temporalis muscles. Histologic evaluation revealed
disseminated pyogranulomas in the lung, pleura, heart, thyroid, esophagus,
diaphragm, liver, gallbladder, stomach, spleen, small intestine, mesenteric lymph
nodes, pancreas, kidney, and adrenal gland. Pyogranulomas often contained numerous
moniliform hyphae and fewer short, septate, 4.5–5 μm wide hyphae with parallel
walls and occasional laterally branching globose structures consistent with accessory
conidia (aleuriospores). Severe segmental necrotizing vasculitis was also identified in
the kidney, pancreas, and stomach wall often with evidence of vascular rupture and
associated fungal elements of similar morphology to those described in the
pyogranulomas.
Liver and gallbladder of dog. There are numerous multifocal to coalescing, raised, tan, pinpoint to
0.3 cm diameter foci scattered throughout the hepatic parenchyma and within the thickened and
congested gallbladder. Macroscopic colonial morphology of the isolated A. alabamensis on potato
flakes agar after 16 days of growth at 25 °C revealing the presence of yellow diffusing pigment. (For
interpretation of the references to color in this figure legend, the reader is referred to the web version of
this article.) Burrough et al. (2012)
219
Pancreas of dog. (A) Photomicrograph from the center of a pyogranuloma revealing
numerous fungal elements including many cross and tangential sections of short, septate,
4.5–5 μm wide hyphae with parallel walls. Grocott's methenamine silver. Bar=20 μm. (B)
Photomicrograph demonstrating a septate fungal hypha with a laterally branching accessory
conidium (aleuriospore) (arrow). Grocott's methenamine silver.. Burrough et al. (2012)
Walker et al. (2012) presented an intact bitch with a history of mating with severe
lameness and a vulvar discharge. A mixed lytic, proliferative tibial lesion and open
pyometra were diagnosed. Bone biopsy and uterine culture revealed
disseminated aspergillosis. This is the first report of Aspergillus pyometra with
dissemination following mating in the dog.
Zhang et al (2012) .reported a case of disseminated A. versicolor infection
presenting as diskospondylitis, osteomyelitis, and pyelonephritis. The diagnosis was
made based on clinical, radiographic, and pathological findings. The etiologic agent
was identified by fungal culture and internal transcribed spacer (ITS) ribosomal DNA
(rDNA) sequencing. This is the first description of canine aspergillosis caused by A.
versicolor.
(A) Lateral radiograph of the thorax. There is lysis of the first four sternebrae and marked
shortening of the second and third sternebrae, which have irregular margins and loss of the
end plates (arrow). (B) Lateral radiograph of the thoracic vertebral column. There is end plate
lysis of the 9th (T9) and 10th (T10) thoracic vertebrae that is centered on the intervertebral
space (arrow), with spondylosis deformans ventrally. There is also narrowing, end plate
sclerosis, and spondylosis deformans between the seventh (T7) and eighth (T8) vertebrae
(arrowhead). Zhang et al (2012)
221
(A) Right sagittal section of sternum; the first sternebra is on the left. The second and third
sternebrae are collapsed, and areas of bony proliferation obscure the joint space. An area of
necrotizing osteomyelitis partially separates the two sternebrae (arrow (B) Left sagittal section
of thoracic vertebrae; the cranial end is to the right. The intervertebral disk at T9-T10 is
missing (arrow). The end plates are eroded, and a wedge-shaped piece of tissue compresses
the spinal cord dorsally. Zhang et al (2012).
(C) Sagittal section of left kidney. Small white areas are scattered throughout the cortex and
medulla (black arrow). The pelvis is dilated, and the renal crest is ulcerated. Areas of
hemorrhage (white arrow) are visible in the cortex. Bar, 1 cm. (D) Photomicrograph of second
sternebra showing areas of inflammation (*) and surrounding fibrous tissue invading and
replacing the marrow cavity. Zhang et al (2012)
(E) Higher magnification of sternebra showing marked granulomatous inflammation with
giant cell formation (arrowhead) surrounding septate fungal hyphae and bulbous spore-like
structures (arrow). Bar, 25 μm. (F) Grocott's methenamine silver-stained section of sternebra
taken from same area as previous image, demonstrating prominent fungal hyphae and terminal
conidiophores (arrows). Zhang et al (2012)
221
Macroscopic colonial morphology of the A. versicolor isolate. The culture was incubated at room
temperature for 10 days. The surface of the fungal colonies is white to light tan (left), and the reverse
side is yellow to brown (right). (B) Lactophenol blue staining reveals brush-like and radiate conidial
heads with round vesicles, biseriate phialides (arrow), and spherical conidia in short chains . Zhang et
al (2012)
Barrs et al. (2013) described A. felis (neosartorya-morph) isolated from three host
species with invasive aspergillosis including a human patient with chronic invasive
pulmonary aspergillosis, domestic cats with invasive fungal rhinosinusitis and a dog
with disseminated invasive aspergillosis. Disease in all host species was often
refractory to aggressive antifungal therapeutic regimens. Four other human isolates
previously reported as A. viridinutans were identified as A. felis on comparative
sequence analysis of the partial β-tubulin and/or calmodulin genes.
1.9.4.
Aspergillosis of the CNS
Taylor et al. (2015) reviewed archived records from 6 institutions to identify cases
with MRI of CNS aspergillosis confirmed with serum galactomannan enzyme
immunoassay (EIA) testing, culture, or supported by histopathology. Signalment,
clinical, MRI, clinicopathologic, histopathologic, and microbiologic findings were
recorded and evaluated. Aspergillosis of the CNS was identified in 7 dogs from 3
institutions. The median age was 3 years and six were German Shepherd dogs.
Five dogs had signs of vestibular dysfunction as a component of multifocal
neurological abnormalities. The MRI findings ranged from normal to abnormal,
including hemorrhagic infarction and mass lesions. They document that
CNS aspergillosis in dogs, particularly German Shepherd dogs, can be suspected
based on neurologic signs, whether MRI findings are normal or abnormal.
Confirmatory testing with galactomannan EIA, urine, cerebrospinal fluid (CSF) or
tissue culture should be performed in cases where aspergillosis is a differential
diagnosis.
222
MRI images from dog 1. T2-weighted (A), precontrast T1-FLAIR (B), fat-saturated postcontrast T1FLAIR (C), T2*-weighted (D), Taylor et al. (2015)
(A) Dorsal aspect of brain of Dog 1 with irregular raised plaques within the leptomeninges overlying
the left temporal and parietal lobes (arrow). (B) Ventral aspect of brain of Dog 1 with irregular raised
plaques overlying the ventral brainstem (arrow). Taylor et al. (2015)
223
Left: Hematoxylin and Eosin (H&E) 1009 magnification stained intralesional hyphae (arrowhead) in
the granulomatous lesions of the neuropil. Right: Grocott’s Methenamine Silver (GMS) 409
magnification stained intralesional hyphae in granulomatous lesion of the forebrain. Taylor et al.
(2015)
1.9.5. Aspergillosis of the ears (otomycosis)
Coyner (2010) described the clinical findings, clinicopathology and treatment of
otomycosis caused by Aspergillus spp. in an atopic dog affected by chronic unilateral
purulent otitis externa unresponsive to topical and oral antibiotics and antifungal
treatments. Cytology of otic exudate revealed neutrophils and septate fungal hyphae,
and otic culture grew Aspergillus spp. and no bacteria. Treatments included allergenspecific immunotherapy, topical and oral antifungal therapy and anti-inflammatory
steroid therapy. Final resolution occurred after treatment of the underlying
hypersensitivity disorder, administration of topical ketoconazole and debridement of
infectious ear exudate. Otomycosis due to filamentous fungi may, as in humans, occur
in dogs with ear canals compromised by pre-existing allergic or bacterial otitis, and
possibly previous antibiotic therapy. Antifungal medications provided clinical
improvement, but the key to successful treatment was the restoration of the normal
physiology of the external auditory canal.
Ghibaudo and Peano (2010) reported a 4-year-old male mixed breed dog with pain
and discomfort of the left ear that began 3 weeks prior to examination. Except for the
clinical signs associated with the ear, there were no other complaints. The ear had not
responded to several topical antibiotic and anti-inflammatory therapies and
cytological examination of otic exudate obtained by a swab from the affected ear
revealed numerous fungal hyphae and inflammatory cells (neutrophils and
macrophages). Bacteria or other fungi were not seen. The dog was anaesthetized and
an otoendoscopic examination was performed in both ears before and after ear
flushing. The left horizontal canal showed a whitish lesion mixed with abundant
ceruminous debris near the tympanic membrane. No foreign bodies were detected, the
tympanic membrane was intact and no signs of otitis media were present upon
endoscopic, radiological and cytological examination (performed through
myringotomy). Swabs from both ears submitted for bacterial and mycological culture
for 4 days at 25 C, cultures on Sabouraud ⁄ gentamicin ⁄ chloramphenicol ⁄ dextrose
agar demonstrated numerous fungal colonies with restricted growth in the left ear;
these were initially yellowish orange then yellowish-brown. Microscopic examination
revealed hyphae and conidial head, typical Aspergillus ochraceus.
224
Left ear of the dog. Mild erythema (arrow) and ceruminous discharge (C) are present near the entrance
(E) of the external ear canal Video-oto-endoscopy (Storz 2,7-mm-diameter 30 endoscope) of the
affected ear. Whitish lesion mixed with abundant ceruminous debris (arrows) filling the horizontal part
of the external ear canal. , onlinelibrary.wiley.com
Cytology of otic exudate from the affected ear showing fungal hyphae, (arrows) degenerate neutrophils
(N) and macrophages (M). Modified Wright-Giemsa stain; ·40)., Microscopical preparation. Fungal
colonies showing erect unbranched structures (conidiophores) (black arrows) with apical vesicles
(white arrows) bearing conidiogenous cells (phialides) (red arrows) that cover the entire surface.
(Lactophenol cotton blue stain; ・40).
onlinelibrary.wiley.com
1.9.6.
Aspergillosis of the eye (oculomycosis)
Pal and Mehrotra (1986) studied the occurrence and aetiological significance of
Aspergillus fumigatus have been studied in 93 animals with various
ophthalmological problems. Eye swabs collected from 26 dogs were investigated
mycologically for the presence of A. fumigatus. The pathogen was isolated in pure
and heavy growth from the swabs from two dogs. The fungus was also demonstrated
directly in clinical material by the potassium hydroxide technique. The organism was
not isolated in pure culture from the conjunctival swabs of 11 apparently healthy
Many other saprophytic fungi were recovered in mixed cultures but were considered
to be contaminants. The clinical signs and diagnostic criteria of oculomycosis have
been discussed.
1.9.7.
discospondylitis
225
Butterworth et al. (1995) diagnosed multiple discospondylitis in a four-year-old,
neutered female German shepherd dog which had suffered intermittent pain of the
axial skeleton for 10 months, which was followed by the sudden onset of paraplegia
associated with the rupture of an affected disc. After surgical and medical
management the dog began to improve but then deteriorated as a result of a
pathological fracture of the fifth lumbar vertebra. A histological examination revealed
fungal hyphae at the sites affected radiographically and they were identified by
immunohistochemistry as Aspergillus species. No fungal hyphae were identified in
other tissues. This is the first report of canine mycotic discospondylitis in the United
Kingdom.
Dallman et al. (1992) treated a German shepherd dog initially for signs of urinary
tract infection; subsequently, signs of spinal pain and neurologic deficits developed.
Fungal hyphae were found in the urine sediment, and spinal radiography revealed
changes in the vertebrae and intervertebral disks at the levels of T3 to T8, T12 to
T13, L3-4, and L5-6, consistent with diskospondylitis. Fungal cultures of urine and
specimens from spinal lesions yielded Aspergillus terreus. Itraconazole (5 mg/kg of
body weight, PO, q 24 h) was used to treat this infection, and locomotion improved.
Sudden death occurred 4 weeks after treatment was initiated; this was attributed to
exsanguination associated with a weakened renal artery. This dog was raised in
Florida and resided in central Virginia.
1.9.8. Aspergillosis in the genital tract
Siemieniuch et al. (2009) reported aspergillosis in the dog genital tract with hyphae
present in semen. Amoxycillin with clavulonate (Synulox 500mg were administered
twice daily orally. Itraconazole was used as an antimycological agent (Orungal,
100mg, twice daily) every other week. In 8th week of therapy no Aspergillus spp.
growth was noted, yet slight Penicillium growth was observed. After 12 weeks of
treatment, no fungus growth was present. Neither spores or hyphae were seen in the
microscopic examination. Three months after the termination of the therapy, the dog
mated with two females. In one case, unifetal pregnancy was diagnosed by ultrasound
examination on day 42 after mating. Due to purulent discharge on day 45 after
mating, the owner decided to terminate the pregnancy. In the other case, severe
pyometra appeared 12 days after the second mating and the owner decided to put the
female to sleep. The pathogen eradication from the ejaculates may be treated as a
serious success, yet the lack of litters after mating calls for an explanation and
consequences of Aspergillus spp. infection need to be considered.
226
Siemieniuch et al. (2009), www.researchgate.net
1.10. Molecular studies of aspergillosis in dogs
Mercier et al. (2014) performed a study to identify the presence of non-synonymous
sino-nasal aspergillosis (SNA) in the coding regions of the TLR2, 4 and 9 genes
in dogs suffering from SNA, and (2) to investigate the SNP genotypes in dogs with
SNA compared with a control population. Direct sequencing of nine dogs of various
breeds with SNA revealed two non-synonymous SNPs in the coding region of TLR2,
eight in TLR4 and four in TLR9. These non-synonymous SNPs were further
evaluated in a case-control study of affected Golden Retrievers, Labrador Retrievers,
Rottweilers and Beaucerons. Genotyping was performed using a combination of
allele-specific primers and hydrolysis probe assays in 31dogs with SNA and 31
controls. No significant difference in minor allele frequency was identified between
these groups, for all studied SNPs, in any of the four breeds.They concluded that,
these findings do not support a role for non-synonymous SNPs in the TLR 2, 4 and 9
coding regions in the pathogenesis of canine SNA, but do not exclude a role for innate
immunity in the pathogenesis of the disease.
Talbot et al. (2014) carried out a study to determine the molecular identities of fungal
species causing sino-nasal aspergillosis (SNA).
in dogs. Genomic DNA was
extracted from 91 fungal isolates from 90dogs diagnosed with SNA in Australia, the
USA and Belgium, and the ITS1-5.8S-ITS2 ribosomal DNA and partial β-tubulin
regions were sequenced. Eighty-eight of 91 (96.7%) isolates were identified as A.
fumigatus and 3/91 (3.3%) belonged to Aspergillus section Nigri spp. (Aspergillus
tubingensis: 2/91; Aspergillus uvarum: 1/91). These findings confirm that A.
fumigatus is the most common aetiological agent of canine SNA. This is the first
report to document a pathogenic role for A. tubingensis and A. uvarum in dogs.
1.11. Treatment of aspergillosis in dogs
227
Sharp and Sullivan (1989) treated 15 dogs with nasal aspergillosis with
ketoconazole (5 mg/kg of body weight, q 12 h, PO) for 2 to 18 weeks.
Four dogs whose conditions deteriorated during treatment received ketoconazole for
less than the prescribed 6 weeks. Six months or more later, only 47% of the dogs were
determined to be disease-free, on the basis of no fungal growth on culture. It was
concluded that ketoconazole at this dosage is a useful treatment for canine
nasal aspergillosis, but is no more effective than thiabendazole.
Pavletic and Clark (1991) treated 5 dogs with nasal aspergillosis by surgical
exposure and delayed closure of the nasal cavity and involved frontal sinus. Diseased
tissue was excised, and 10% povidone-iodine solution was applied three times daily
with cotton-tipped applicators. Skin wounds were closed at weeks 6 through 8. In
one dog, the frontal sinus was partially obliterated with a temporalis muscle flap
before skin closure. At months 6 through 34, all dogs were clinically free
of aspergillosis. Open treatment has potential clinical application as a primary
approach to nasal aspergillosis or for cases that are unresponsive to previous medical
management.
Dallman et al. (1992) treated a German shepherd dog initially for signs of urinary
tract infection; subsequently, signs of spinal pain and neurologic deficits developed.
Fungal hyphae were found in the urine sediment, and spinal radiography revealed
changes in the vertebrae and intervertebral disks at the levels of T3 to T8, T12 to
T13, L3-4, and L5-6, consistent with diskospondylitis. Fungal cultures of urine and
specimens from spinal lesions yielded Aspergillus terreus. Itraconazole (5 mg/kg of
body weight, PO, q 24 h) was used to treat this infection, and locomotion improved.
Sudden death occurred 4 weeks after treatment was initiated; this was attributed to
exsanguination associated with a weakened renal artery. This dog was raised in
Florida and resided in central Virginia.
Sharp et al. (1993) treated 24 dogs with nasal aspergillosis were treated with (10
mg/kg bid for 7-14 days) administered topically through tubes surgically implanted
into the nasal chambers. Aspergillosis was eliminated in 19 dogs over a median
follow-up period of 18 months. Another dog died, but at necropsy there was no
evidence of causative fungus. Two of the four dogs that were not cured had infection
of periorbital soft tissues. An additional seven dogs received 6 weeks ketoconazole (5
mg/kg bid PO) and enilconazole therapy topically. Six of these dogs were diseasefree over a median follow-up period of 35 months. The seventh dog responded to
repeated treatment with enilconazole. Twenty-six of the 29 dogs (90%) without
extranasal aspergillosis were cured.
Kelly et al. (1995) treated 4 dogs with disseminated aspergillosis caused by
Aspergillus terreus were treated with oral itraconazole for 190 to 1095 days.
Infection was eliminated in 1 dog. Two dogs were treated for 1000 and 1095 days but
were eventually euthanased 572 and 485 days after treatment was stopped. At
necropsy both dogs had widespread aspergillosis. The fourth dog was euthanased for
other reasons after 190 days of treatment when it was showing a good clinical
response although there was radiographic evidence that the disease was progressing.
Zonderland et al. (2002) conducted a study to determine effectiveness of infusion of
1 and 2% enilconazole for treatment of nasal and sinusal aspergillosis, respectively,
228
in 26 client-owned dogs with aspergillosis. All dogs had typical clinical signs of
aspergillosis and rhinoscopically visible intrasinusal or intranasal fungal plaques
associated with turbinate destruction. During rhinoscopy, affected nasal cavities and
frontal sinuses were debrided meticulously. Nineteen dogs (group A) were treated
with 1% enilconazole by use of a modified noninvasive infusion procedure. Seven
dogs (group B) were treated with 2% enilconazole via catheters that were placed via
endoscopic guidance into the frontal sinuses. All dogs underwent follow-up
rhinoscopy for determination of further treatment until cure was established. Age,
disease duration, clinical score, and rhinoscopic score were similar for both groups
before treatment. In group A, 17 of 19 dogs were cured; 9, 6, and 2 dogs were cured
after 1, 2, or 3 treatments, respectively. The remaining 2 dogs were euthanatized
before the end of the treatment protocol. In group B, all dogs were cured; 6 dogs and
1 dog were cured after 1 or 2 treatments, respectively. Only minor adverse effects
such as nasal discharge, epistaxis, and sneezing developed. After extensive
rhinoscopic debridement, 1 and 2% enilconazole infused into the nasal cavities and
the frontal sinuses, respectively, were effective for treatment of aspergillosis in dogs.
Intrasinusal administration via endoscopically placed catheters appeared to require
fewer infusions for success. Follow-up rhinoscopy is strongly advised.
Intranasal infusion of enilconazole for treatment of sinonasal aspergillosis in dogs
avmajournals.avma.org
Moore (2003) treated 3 dogs with mycotic rhinitis were treated with a proprietary
wound dressing product intended to produce a sustained release of povidone-iodine.
All of the dogs had been refractory to other treatments. One dog had extensive soft
tissue involvement, including extension into the orbital tissues, and another had
evidence of involvement of the supporting bones of the nose. In all cases, the affected
nasal cavity and/or frontal sinus was exposed via a dorsal approach and partial
turbinectomy was performed. The wound dressing was applied and retained with a
'tie-over' dressing. The dressing was replaced every 48 to 72 hours until all exposed
tissue was covered by healthy granulation tissue, at which time the rhinotomy was
closed by soft tissue reconstruction. There was no evidence of recurrence of the
fungal infection at follow-up times of up to 20 months postsurgery.
229
At day 3 the open sinorhinotomy is shown with the skin edges sutured to the bone margins and suture
loops placed to retain the dressing, Povidone-iodine dressing has been packed into the sinorhinotomy to
cover all the exposed surfaces, At 21 days postoperatively the surfaces are all covered with healthy
granulation tissue. (Shown immediately before preparation for closure)
Schochet and Lappin (2005) diagnosed A two-year-old, female spayed Australian
cattle dog with nasal aspergillosis. The dog was treated topically with clotrimazole.
Clinical signs recurred two months later and the clotrimazole treatment was repeated
and 5 mg/kg itraconazole twice daily was added to it. The recommended dose of
itraconazole for nasal aspergillosis is 5 mg/kg twice daily administered orally. The
dog's symptoms completely resolved, but it developed an adverse febrile reaction to
the Itraconazole. The Itraconazole was discontinued and the dog remained
asymptomatic for four years. The dog then developed mucopurulent discharge from
the right nostril and was diagnosed as having recurrent nasal aspergillosis.
Itraconazole at 5 mg/kg twice daily was prescribed, which again induced a fever.
When the itraconazole was decreased to 5 mg/kg once daily there were no fever
episodes, but the nasal discharge was not completely resolved. The dog was then
treated with topical clotrimazole Infusion, and maintained on 5 mg/kg itraconazole
daily.
Sissener et al. (2006) evaluated the effect of short duration 1 per cent clotrimazole
flush when combined with 1 per cent clotrimazole cream instilled into the frontal
sinuses for the treatment of nasal aspergillosis in 14 dogs.with clinical, radiological,
serological and rhinoscopic findings consistent with nasal aspergillosis. Dogs were
treated by frontal sinus trephination and a short, five-minute flushing of 1 per cent
topical clotrimazole solution followed by a 1 per cent clotrimazole cream instilled as a
depot agent. Twelve of the 14 dogs (86 per cent) responded well to treatment and
either had no clinical signs after treatment or had signs consistent with mild rhinitis
during a minimum follow-up period of six months. Only one dog required multiple
treatments. Treatment was well tolerated by all patients, with minimal complications.
Billen et al. (2010) evaluated the effect of 1% bifonazole cream in the treatment of
canine sino-nasal aspergillosis (SNA). The cream was instilled through
perendoscopically placed catheters into the frontal sinuses and was used either as
single therapy after debridement (DC) or as adjunctive therapy after 2% enilconazole
infusion (DEC). Twelve dogs were treated initially with DEC: 7 and 3 of
these dogs were free of disease after 1 and 2 procedures, respectively, while
2 dogs were cured after DC was used as a second procedure. Five dogs were treated
231
with DC only: in 3 dogs with moderate disease, cure was obtained after a single
procedure while, in 2 debilitated patients, cure could not be confirmed. Topical
administration of 1% bifonazole cream appears as an effective therapy in SNA, either
as an adjunctive therapy to enilconazole infusion or as sole therapy in moderately
affected patients.
Sharman et al. (2012) treated 9 client-owned dogs diagnosed with mycotic
rhinosinusitis between March 2008 and December 2009 with either clotrimazole
(1% in polyethylene glycol) or enilconazole (10% solution), after imaging and
rhinoscopic assessment. Both frontal sinuses were trephined, debrided and flushed
with saline. Infusion was administered via frontal sinuses with dogs in sternal
recumbency and computed tomography (CT) performed 5 minutes after completion.
Distribution was scored 1 to 4 at the canine tooth, premolar 4, cribriform plate and
frontal sinus on both sides, for a maximum score of 32. Distribution of antifungal
agents to all regions of the nasal cavity and frontal sinuses was achievable, but varied
considerably. Retention was poor in 10 of 18 regions assessed.
Talbot et al. (2015) assessed the susceptibilities of isolates collected between 1988
and 2014 from 46 dogs and 4 cats to itraconazole, posaconazole, voriconazole,
fluconazole and ketoconazole using Sensititre Yeast One microdilution trays; and to
enilconazole and clotrimazole, following the CLSI M38-A2 standard. For the majority
of isolates MICs were high for ketoconazole, low for enilconazole and clotrimazole,
and less than established epidemiological cut-off values for itraconazole,
posaconazole and voriconazole. One canine isolate from 1992 had multiazole
resistance and on Cyp51A gene sequencing a mutation associated with azole
resistance (F46Y) was detected. There is no evidence of emerging azole resistance
among A. fumigatus isolates from dogs and cats and topical azole therapy should be
effective against most isolates.
Corrigan et al. (2016) performed a study to determine the safety and efficacy of
posaconazole for the treatment of naturally occurring disseminated Aspergillus
infections in dogs. Posaconazole was administered to 10 dogs at dosage of 5 mg/kg
PO q12h. The treatment response for dogs with disseminated disease while receiving
posaconazole was defined as clinical remission (n = 4) and clinical improvement (n =
6). There was a high rate of relapse during treatment or after cessation of treatment in
both groups, and most dogs died or were euthanized due to progressive disease.
Excluding 1 dog concurrently treated with terbinafine that remains alive 5 years after
diagnosis, the mean survival time for dogs was 241 days (range 44-516 days). Three
other dogs lived >1 year after starting treatment. No clinically relevant adverse events
or increases in serum liver enzyme activity occurred during treatment with
posaconazole.
1.12. Reports on aspergillosis in cats
Hamilton et al. (2000) reported a case of nasal, frontal sinus, and orbital aspergillosis in
a cat . Diagnostics for exophthalmos and therapy for retrobulbar abscesses were discussed.
Whitney et al. (2005) reported four cats with fungal rhinitis. Serological testing was
not useful in two cats tested. The cats in this study were treated with oral itraconazole
therapy. When itraconazole therapy was discontinued prematurely, clinical signs
recurred. Hepatotoxicosis is a possible sequel to itraconazole therapy.
231
Kano et al. (2008) reported for the first time A. udagawae, a previously recognised but rare
opportunistic pathogen causing fatal orbital aspergillosis in a cat. Identification of this isolate
was secured by comparative sequence based analyses of the ITS and the beta tubulin region.
Antifungal susceptibility testing results revealed that this isolate had high in vitro MIC to
amphotericin B (AMB) that correlated with in vivo failure of therapy with AMB.
Barachetti et al. (2009) reported a 12-year-old, 4 kg, castrated male Persian cat with
a 2-month history of sneezing and bilateral mucopurulent nasal discharge.
Rhinoscopically acquired nasal biopsies at this time revealed bilateral
lymphoplasmacytic rhinitis. A tapering dose of oral prednisone caused the complete
remission of the clinical signs, but 2 months after discontinuation of the therapy, the
rhinitis recurred and the OD became exophthalmic. Computed tomography showed a
soft tissue mass in both sides of the nasal cavity, both frontal sinuses, the right orbit,
and to a lesser extent the left orbit. A fine needle aspirate of the right orbit revealed
pyogranulomatous inflammation and Aspergillus spp. hyphae. Repeat nasal biopsy
demonstrated multi-focal necrosis and a mixed inflammatory cell process which now
included macrophages and scattered septate fungal hyphae. A few days later
the cat became bilaterally blind and a contrast enhancing lesion involving the optic
chiasm was found on magnetic resonance imaging. Despite a poor prognosis, therapy
consisted of exenteration of the right orbit and trephination of both frontal sinuses
before the planned initiation of medical antifungal therapy. Unfortunately, the cat died
of cardiac arrest intraoperatively. Aspergillus fumigatus was cultured from both
orbits at necropsy. Orbital aspergillosis has been rarely reported in cats and its
relationship with lymphoplasmacytic rhinitis is unclear. In this patient
lymphoplasmacytic rhinitis or previous antibiotic/corticosteroid therapy may have
allowed secondary fungal invasion of the nasal mucosa and subsequently both orbits
and the brain. Alternatively, Aspergillus infection may have preceded the
lymphoplasmacytic rhinitis.
Furrow and Gromen (2009) examined 2 cats (13 and 11 years old) to determine the
cause of nasal discharge of varying duration (4 days and 5 months, respectively).
Computed tomography revealed marked turbinate destruction and soft tissue densities
in the nasal passages. Histologic examination of nasal specimens revealed chronic
active inflammation and branching fungal hyphae consistent with Aspergillus spp.
Fungal culture of nasal specimens resulted in growth of Aspergillus spp. Testing
yielded negative results for antibodies against Aspergillus spp.Both cats were
anesthetized and treated with a 1-hour intranasal infusion of clotrimazole. Recovery
from the procedure was uncomplicated, and both cats had complete resolution of
clinical signs.
Karnik et al. (2009) reported the computed tomographic (CT) findings of fungal
rhinitis/sinusitis in cats. The CT images of 10 cats ranging in age from 7 to 13 years
were examined. The mean age was 10.8 years and all were neutered males.
Nasal aspergillosis was diagnosed in five cats, cryptococcosis in three cats,
hyalohyphomycosis in one cat, and trichosporonosis in one cat. Bilateral disease was
present in eight cats, seven had abnormal soft tissue attenuation in two-thirds of the
nasal cavity, and six had turbinate lysis. Seven cats had also lysis of the hard palate,
nasal septum, or frontal bone. One cat had lysis of the cribriform plate. Five of the
nine cats whose lymph nodes were imaged had lymph node enlargement. There was
contrast medium enhancement in the nasal cavity in all cats, with either a primarily
peripheral rim or heterogeneous pattern. There appears to be an overlap of clinical
232
signs, age, and CT features of cats with nasal neoplasia and those with fungal rhinitis/
sinusitis.
Labelle et al. (2009) reported an 8-year-old male castrated Domestic Shorthaired cat with a 1-week history of blepharospasm and mucoid ocular discharge.
Examination revealed ulcerative keratitis with stromal loss, stromal infiltrate,
corneal edema, perilimbal vascularization and miosis. Cytology of the cornea revealed
multiple dichotomously branching, septate fungal hyphae and severe, predominantly
neutrophilic inflammation. PCR of the cytology samples confirmed the presence of
Aspergillus flavus while fungal and bacterial cultures were negative. Treatment with
topical 1% voriconazole solution was successful in resolving the keratomycosis.
OS at initial presentation. Note ulceration of the cornea with loss of approximately 50% of the corneal
stroma and a necrotic focus in the axial cornea, diffuse corneal edema, white/yellow stromal infiltrate
and mid to deep stromal vascular invasion of the cornea. OS cornea after 11 days of topical antifungal
therapy. Note the progression of the vascularization. Labelle et al. (2009)
Corneal cytology demonstrating suppurative inflammation and fungal hyphae. OS cornea after 29 days of treatment.
Note the clear peripheral cornea and remodeling of the axial cornea. At this time the cat was visual and comfortable.
Labelle et al. (2009)
Giordano et al. (2010) described a cat diagnosed with sinonasal
orbital Aspergillus fumigatus infection using advanced imaging, histopathology and
culture.
Smith and Hoffman (2010) diagnosed feline orbital aspergillosis in three cats with
exophthalmos, significant dorso-temporal globe deviation and pronounced resistance
to retropulsion. Advanced imaging was performed in all three cases to evaluate the
extent of disease as well as to obtain guided orbital biopsies in two cases. Surgical
intervention in the form of a lateral orbitotomy was pursued in the first case with the
other two cases treated with enucleation or medical management alone. The available
published reports concerning sino-orbital aspergillosis are reviewed. Oral therapy
with a novel triazole, voriconazole, was instituted in two cases. Although
voriconazole was apparently effective against the fungal organisms, it is also resulted
in adverse reactions.
233
Hazell et al. (2011) reported a 7-year-old, spayed female Domestic Longhair cat with
a 6-week history of coughing. Thoracic radiography revealed a pleural effusion.
Thoracic ultrasound revealed a pleural effusion and a focal lung mass. The cat
underwent exploratory thoracotomy and a total left pneumonectomy was performed.
Histopathology and cultures revealed fungal pneumonia and pyothorax caused by
Aspergillus fumigatus. Abdominal ultrasound, repeat thoracic radiography, urinalysis
with culture, and retroviral screening failed to detect evidence of systemic disease.
The cat's poorly regulated diabetes mellitus is suspected to be the predisposing factor
allowing a fungal pulmonary infection to become established. At 18 months after
surgery the cat was still disease-free. To our knowledge this is the first reported case
of successful treatment of pulmonary aspergillosis in the cat.
Barrs et al. (2012) documented the aetiology, clinicopathological findings and
treatment outcomes in 23 cats (1.5-13 years of age) with sinonasal (SNA, n=6) or
sino-orbital (SOA, n=17) aspergillosis. Cases recruited retrospectively and
prospectively were included if fungal hyphae were identified on cytological or
histological examination and the fungal pathogen was identified by PCR and DNA
sequencing (ITS1 or ITS1-5.8S-ITS2 regions, rDNA gene cluster). Fungal culture was
positive in 22/23 cases. In cases of SNA, the fungal pathogen was Aspergillus
fumigatus (n=4), Neosartorya fischeri or A. lentulus (n=1) or a non-speciated
Neosartorya spp. (n=1). In all cases of SOA (n=17), the fungal pathogen was
identified as Neosartorya spp. Nine cats had brachycephalic conformation. Cats with
SNA were more likely to be infected with A. fumigatus and had a better prognosis
than cats with SOA.
Eye and orbital cavity of a cat with sino-orbital aspergillosis. Top: a. Exophthalmos, b. mass in the left
pterygopalatine fossa and c. ulceration of the hard palate. Bottom left: Cleistothecia (small spherical
structures) at the colony junction in paired cultures of Neosartorya spp. isolates from two cases
(inset). Neosartorya spp. ascospores with roughened side walls and two axial crests. Scanning electron
micrograph (Zeiss EVO LS15). Scale bar = 2 μm. Bottom right: Periodic acid-Schiff-stained section of
frontal sinus epithelium from a cat with invasive sino-orbital aspergillosis. Fungal hyphae are present
deep within the sinus epithelium, demonstrating the invasive nature of this mycosis. Scale bar = 60 μm.
Barrs et al. (2012)
234
Barrs et al. (2013) described A. felis (neosartorya-morph) isolated from three host
species with invasive aspergillosis including a human patient with chronic invasive
pulmonary aspergillosis, domestic cats with invasive fungal rhinosinusitis and a dog
with disseminated invasive aspergillosis. Disease in all host species was often
refractory to aggressive antifungal therapeutic regimens. Four other human isolates
previously reported as A. viridinutans were identified as A. felis on comparative
sequence analysis of the partial β-tubulin and/or calmodulin genes.
Cat with sino-orbital aspergillosis (invasive fungal rhinosinusitis) caused by A. felis with
exophthalmia and prolapse of the nictitating membrane (third eyelid) associated with a retrobulbar
fungal granuloma (A).Coronal CT scan soft-tissue post-contrast view showing retrobulbar fungal
granuloma occupying the inferior aspect of the orbit with involvement of the adjacent paranasal
subcutaneous tissues (B). Barrs et al. (2013)
Tissue invasion by fungal hyphae in a cat with SOA.Hematoxin & Eosin- (A) and Grocott- (B) stained
section of nasal mucosa and turbinates demonstrating granulomatous rhinitis (A) and submucosal
invasion by septate branching fungal hyphae (B). Barrs et al. (2013)
Kano et al. (2013) reported two cases of feline orbital aspergillosis, one caused by
A. udagawae and the other by A. viridinutans. Case was treated with a high dosage of
itraconazole, and in case A. viridinutans infection was associated with sarcoma.
Identification of the etiologic agents of these cases was confirmed by comparative
analyses of the sequences of β-tubulin-encoding genes. With the spread of nonfumigatus aspergillosis, increasing emphasis should be placed on molecular
identification of the infecting Aspergillus species and the use of in vitro drug
susceptibility tests to ensure the selection of appropriate antibiotics.
235
The progressive protrusion of the left third eyelid and eyeball of case 1, Computed tomography (CT)
image of Case 1 with contrast demonstrating a soft tissue mass lesion with nonhomogeneous
enhancement in the left orbit. Kano et al. (2013)
Histopathologic examination of the mass from the left orbit of Case 1 revealed granulomatous
inflammation with many branching hyphal filaments (PAS stain)., Impression smear of the biopsy
specimen of the mass from the left eye orbit of Case 2 revealed many branching hyphal filaments (PAS
stain). Kano et al. (2013)
Veterinary hospital in Oxfordshire (2013) reported a 13-year old female Burmilla
cat with a history of left-side unilateral nasal discharge. Rhinoscopy revealed
mucopurulent discharge on the left side but was otherwise unremarkable. Aspiration
of the swelling over the left frontal sinus produced pus and this abscess was lanced
and flushed. The frontal sinus was trephined and the sinus and nasal cavity flushed
with saline. Cytology of the material flushed from the frontal sinus and nasal cavity
revealed fungal hyphae consistent with Aspergillus species and culture of this
material yielded growth of a fungus which was morphologically similar to
Aspergillus candidus. The cat was then started on oral itraconazole (Itrafungol,
Janssen) 10 mg/kg p.o. SID. The abscess over the rostral frontal sinus did not heal and
a second abscess appeared over the nasal bone just dorsal to the nose. The left nasal
cavity and sinus were full of pus and debris and there was severe bone erosion from
the nasal cavity into the rostromedial orbit through which pus was protruding. There
was also severe bone erosion rostrally through the nasal bone and less severe bone
erosion dorsally over the rostral part of the frontal sinus, these sites of bone erosion
being at the location of the two subcutaneous abscesses.
236
www.aspergillus.org.ukNasal, sinus and orbital aspergillosis in a cat. Nose- severe bone erosion
rostrally through the nasal bone
Whitney et al. (2013) evaluated serum GM measurement as a non-invasive diagnostic
test for URT aspergillosis in cats. A one-stage, immunoenzymatic sandwich ELISA
was used to detect serum GM in 4 groups of cats; Group 1 (URT aspergillosis) confirmed URT aspergillosis (n=13, sinonasal aspergillosis (SNA) n=6 and sinoorbital aspergillosis (SOA) n=7), Group 2 (URT other) - other URT diseases (n=15),
Group 3 (β-lactam) - cats treated with β-lactam antibiotics for non-respiratory tract
disease (n=14), Group 4a - healthy young cats (≤ 1 y of age, n=28), Group 4b healthy adult cats (>1 y of age, n=16). One cat with SNA and two cats with SOA
caused by an Aspergillus fumigatus-mimetic species, tested positive for serum GM.
For a cut-off optical density index of 1.5, the overall sensitivity and specificity of the
assay was 23% and 78% respectively. False positive results occurred in 29% of cats in
Group 3 and 32% of cats in Group 4a. Specificity increased to 90% when Groups 3
and 4a were excluded from the analysis. Overall, serum GM measurement has a poor
sensitivity but is a moderately specific, non-invasive screening test to rule out
infection in patients with suspected feline upper respiratory tract aspergillosis.
Barrs et al. (2014) reported feline upper respiratory tract aspergillosis (URTA) as two
distinct anatomical forms, namely, sino-nasal aspergillosis (SNA) and sino-orbital
aspergillosis (SOA). Computed tomography was used to investigate the route of
fungal infection and extension in 16 cases (SNA n = 7, SOA n = 9) where the infecting
isolate had been identified by molecular testing. All cases had nasal cavity
involvement except for one cat with SNA that had unilateral frontal sinus changes.
There was a strong association between the infecting species and anatomic form
(P = 0.005). A. fumigatus infections remained within the sino-nasal cavity, while
cryptic species infections were associated with orbital and paranasal soft-tissue
involvement and with orbital lysis. Cryptic species were further associated with a
mass in the nasal cavity, paranasal sinuses or nasopharynx. Orbital masses showed
heterogeneous contrast enhancement, with central coalescing hypoattenuating foci
and peripheral rim enhancement. Severe, cavitated turbinate lysis, typical of canine
SNA, was present only in cats with SNA. These findings support the hypothesis that
the nasal cavity is the portal of entry for fungal spores in feline URTA and that the
route of extension to involve the orbit is via direct naso-orbital communication from
237
bone lysis. Additionally, a pathogenic role for A. wyomingensis and a sinolith in
a cat with A. udagawae infection were reported for the first time.
Barrs et al. (2014)
Barrs and Talbot (2014) mentioned that feline aspergillosis includes
sinonasal aspergillosis (SNA), sino-orbital aspergillosis (SOA), other focal invasive
forms, and disseminated disease. SOA is an invasive mycosis that is being
increasingly recognized, and is most commonly caused by a recently discovered
pathogen Aspergillus felis. SNA can be invasive or noninvasive and is most
commonly caused by Aspergillus fumigatus and Aspergillus niger. Molecular
methods are required to correctly identify the fungi that cause SNA and SOA. SNA
has a favorable prognosis with treatment, whereas the prognosis for SOA remains
poor.
238
Barrs and Talbot (2014)
Kano et al. (2015) considered feline upper respiratory tract infection due to
Aspergillus spp. is considered an emerging disease, with the number of reported
cases continuing to rise. They repored the first case of feline
sinonasal aspergillosis caused by Aspergillus fischeri in Japan. The patient
presented after 2 months of progressive facial deformity around the nose and nasal
discharge. The isolate from this case was susceptible to itraconazole (ITZ),
voriconazole and micafungin, but was resistant to amphotericine B. However, the
infected cat died approximately 1 month after referral, despite treatment for 12 days
ITZ administered orally at 10 mg/kg.
Pus discharge and an ulcer were observed on the mass on the left side of the bridge of the nose.
et al. (2015)
239
Kano
The left panel shows a computed tomographic (CT) image after administration of a contrast agent at
the level of the canine teeth. The animal’s right nasal cavity (R) is occupied by a large mass (*) that
lacks contrast enhancement. The right panel shows a reconstructed image from multiple CT images of
the head; the right side of the nasal bone is largely destroyed. Kano et al. (2015)
Histopathologic examination of the mass from the right nasal cavity of the case revealed chronic
purulent inflammation with many branching hyphal filaments (HE stain). Kano et al. (2015)
References
1. Adamama-Moraitou KK , Pardali D, Day MJ, Denning DW, Papazoglou
L, Papastefanou A, Rallis TS. Aspergillus fumigatus Bronchopneumonia in a
Hellenic Shepherd Dog. J Am Anim Hosp Assoc. 2011 Mar-Apr;47(2):e13-8.
2. Barachetti L, Mortellaro CM, Di Giancamillo M, Giudice C, Martino P, Travetti
O, Miller PE. Bilateral orbital and nasal aspergillosis in a cat. Vet Ophthalmol. 2009
May-Jun;12(3):176-82.
241
3. Barrs VR, Halliday C, Martin P et al. Sinonasal and sino-orbital aspergillosis in 23
cats: aetiology, clinicopathological features and treatment outcomes. Vet J 2012;
191(1): 58–64.
4. Barrs VR, Halliday C, Martin P, Wilson B, Krockenberger M, Gunew M, Bennett
S, Koehlmeyer E, Thompson A, Fliegner R, Hocking A, Sleiman S, O'Brien C,Beatty
JA. Sinonasal and sino-orbital aspergillosis in 23 cats: aetiology, clinicopathological
features and treatment outcomes. Vet J. 2012 Jan;191(1):58-64.
5. Barrs VR , van Doorn TM, Houbraken J, Kidd SE, Martin P, Pinheiro
MD, Richardson M, Varga J, Samson RA. Aspergillus felis sp. nov., an emerging
agent of invasive aspergillosis in humans, cats, and dogs. PLoS One. 2013 Jun
14;8(6):e64871.
6. Barrs VR, Talbot JJ. Feline aspergillosis. Vet Clin North Am Small Anim Pract. 2014
Jan;44(1):51-73.
7. Barrs VR, Beatty JA, Dhand NK, Talbot JJ, Bell E, Abraham LA, Chapman
P, Bennett S, van Doorn T, Makara M. Computed tomographic features of feline
sino-nasal and sino-orbital aspergillosis. Vet J. 2014 Aug;201(2):215-22.
8. Benitah N. Canine nasal aspergillosis. Clin Tech Small Anim Pract. 2006
Aug;21(3):162.
9. Billen F , Guieu LV, Bernaerts F, Mercier E, Lavoué R, Tual C, Peeters D, Clercx C.
Efficacy of intrasinusal administration of bifonazole cream alone or in combination
with enilconazole irrigation in canine sino-nasal aspergillosis: 17 cases. Can Vet
J. 2010 Feb;51(2):164-8.
10. Bruchim Y, Elad D, Klainbart S. Disseminated aspergillosis in two dogs in Israel.
Mycoses. 2006 Mar;49(2):130-3.
11. Burrough E , Deitz K , Kinyon J , Andreasen C , Frana T , Sutton D , Thompson E , Fu
J , Wickes B , Hostetter J . Disseminated aspergillosis in a dog due to Aspergillus
alabamensis. Med Mycol Case Rep. 2012 Mar 1;1(1):1-4.
12. Burrow R , McCarroll D, Baker M, Darby P, McConnell F, Cripps P. Frontal sinus
depth at four landmarks in breeds of dog typically affected by sinonasal aspergillosis.
Vet Rec. 2012 Jan 7;170(1):20.
13. Butterworth SJ, Barr FJ, Pearson GR, Day MJ. Multiple discospondylitis associated
with Aspergillus species infection in a dog. Vet Rec. 1995 Jan 14;136(2):38-41.
14. Claeys S , Lefebvre JB, Schuller S, Hamaide A, Clercx C. Surgical treatment of
canine nasal aspergillosis by rhinotomy combined with enilconazole infusion and oral
itraconazole. J Small Anim Pract. 2006 Jun;47(6):320-4.
15. Codner EC, Lurus AG, Miller JB, Gavin PR, Gallina A, Barbee DD. Comparison of
computed tomography with radiography as a noninvasive diagnostic technique for
chronic nasal disease in dogs. J Am Vet Med Assoc. 1993 Apr 1;202(7):1106-10.
16. Corrigan VK, Legendre AM, Wheat LJ, Mullis R, Johnson B, Bemis DA, Cepero
L.Treatment of Disseminated Aspergillosis with Posaconazole in 10 Dogs. J Vet
Intern Med. 2016 Jan;30(1):167-73.
17. Coyner K . Otomycosis due to Aspergillus spp. in a dog: case report and literature
review. Vet Dermatol. 2010 Dec;21(6):613-8.
18. Dallman MJ, Dew TL, Tobias L, Doss R. Disseminated aspergillosis in a dog with
diskospondylitis and neurologic deficits. J Am Vet Med Assoc. 1992 Feb
15;200(4):511-3.
19. Day MJ . Canine sino-nasal aspergillosis: parallels with human disease.Med
Mycol. 2009;47 Suppl 1:S315-23.
20. Day MJ, Penhale WJ. An immunohistochemical study of canine
disseminated aspergillosis. Aust Vet J. 1991 Dec;68(12):383-6.
21. Day MJ, Eger CE, Shaw SE, Penhale WJ. Immunologic study of
systemic aspergillosis in German shepherd dogs. Vet Immunol Immunopathol. 1985
Aug;9(4):335-47.
241
22. Day MJ, Penhale WJ, Eger CE, Shaw SE, Kabay MJ, Robinson WF, Huxtable
CR, Mills JN, Wyburn RS. Disseminated aspergillosis in dogs. Aust Vet J. 1986
Feb;63(2):55-9.
23. De Lorenzi D, Bonfanti U, Masserdotti C, Caldin M, Furlanello T. Diagnosis of
canine nasal aspergillosis by cytological examination: a comparison of four different
collection techniques. J Small Anim Pract. 2006 Jun;47(6):316-9.
24. Elad D , Lahav D, Blum S. Transuterine transmission of Aspergillus terreus in a case
of disseminated canine aspergillosis. Med Mycol. 2008 Mar;46(2):175-8.
25. Ferreira, RR , Laerte Ferreiro , Andréia Spanamberg , David Driemeier , Mauro Luis
da Silva Machado , Simone Passos Bianchi , Diva Schmidt3 & Jacques Guillot.
Canine Sinonasal Aspergillosis. Acta Scientiae Veterinariae, 2011. 39(4): 1009
26. Furrow E, Groman RP. Intranasal infusion of clotrimazole for the treatment of
nasal aspergillosis in two cats. J Am Vet Med Assoc. 2009 Nov 15;235(10):1188-93.
27. Ghibaudo, G and Peano A. Chronic monolateral otomycosis in a dog caused by
Aspergillus ochraceus. Veterinary Dermatology, 21, 522–526,2010
28. Greci V , Stefanello D, Di Giancamillo M, Mortellaro CM. Sinonasal tumor in
3 dogs after successful topical treatment for frontal sinus aspergillosis. Can Vet
J. 2009 Nov;50(11):1191-4.
29. Giordano C, Gianella P, Bo S, Vercelli A, Giudice C, Della Santa D, Tortorano
AM, Peruccio C, Peano A. Invasive mould infections of the naso-orbital region of
cats: a case involving Aspergillus fumigatus and an aetiological review. J Feline Med
Surg. 2010 Sep;12(9):714-23.
30. Hamilton HL, Whitley RD, McLaughlin SA. Exophthalmos secondary
to aspergillosis in a cat. J Am Anim Hosp Assoc. 2000 Jul-Aug;36(4):343-7.
31. Hartmann K , Lloret A, Pennisi MG, Ferrer L, Addie D, Belák S, Boucraut-Baralon
C, Egberink H, Frymus T, Gruffydd-Jones T, Hosie MJ, Lutz H, Marsilio F, Möstl
K, Radford AD, Thiry E, Truyen U, Horzinek MC. Aspergillosis in cats: ABCD
guidelines on prevention and management. J Feline Med Surg. 2013 Jul;15(7):60510.
32. Hazell KL, Swift IM, Sullivan N. Successful treatment of pulmonary aspergillosis in
a cat.Aust Vet J. 2011 Mar;89(3):101-4.
33. Jang SS, Dorr TE, Biberstein EL, Wong A. Aspergillus deflectus infection in
four dogs. J Med Vet Mycol. 1986 Apr;24(2):95-104.
34. Johnson LR, Drazenovich TL, Herrera MA, Wisner ER. Results of rhinoscopy alone
or in conjunction with sinuscopy in dogs with aspergillosis: 46 cases (2001-2004). J
Am Vet Med Assoc. 2006 Mar 1;228(5):738-42.
35. Kabay MJ, Robinson WF, Huxtable CR, McAleer R. The pathology of disseminated
Aspergillus terreus infection in dogs. Vet Pathol. 1985 Nov;22(6):540-7.
36. Kano R, Itamoto K, Okuda M, Inokuma H, Hasegawa A, Balajee SA. Isolation of
Aspergillus udagawae from a fatal case of feline orbital aspergillosis. Mycoses. 2008
Jul;51(4):360-1.
37. Kano R, Shibahashi A, Fujino Y, Sakai H, Mori T, Tsujimoto H, Yanai T, Hasegawa
A. Two cases of feline orbital aspergillosis due to Aspergillus udagawae and A.
viridinutans. J Vet Med Sci. 2013 Jan 31;75(1):7-10.
38. Kano R, Takahashi T, Hayakawa T, Yamaya Y, Hasegawa A, Kamata H. The first
case of feline sinonasal aspergillosis due to Aspergillus fischeri in Japan. J Vet Med
Sci. 2015 Sep;77(9):1183-5.
39. Karnik K, Reichle JK, Fischetti AJ, Goggin JM. Computed tomographic findings of
fungal rhinitis and sinusitis in cats. Vet Radiol Ultrasound. 2009 Jan-Feb;50(1):65-8.
40. Kelly SE , Shaw SE, Clark WT. Long-term survival of four dogs with disseminated
Aspergillus terreus infection treated with itraconazole. Aust Vet J. 1995
Aug;72(8):311-3.
41. Khan ZU, Richardson MD, Warnock DW, Lane JG. Evaluation of an enzyme-linked
immunosorbent assay (ELISA) for the diagnosis of Aspergillus fumigatus intranasal
infection of the dog. Sabouraudia. 1984;22(3):251-4.
242
42. Kim SH, Yong HC, Yoon JH, Youn HY, Yoshioka N, Kano R, Hasegawa A.
Aspergillus niger pulmonary infection in a dog. J Vet Med Sci. 2003
Oct;65(10):1139-40
43. Kulendra E, Halfacree Z, Goggs R, Dennis S, Summers B, Lamb CR, Brockman D.
Cavitary pulmonary lesion associated with Aspergillus fumigatus infection in a
German shepherd dog. J Small Anim Pract. 2010 May;51(5):271-4.
44. Labelle AL, Hamor RE, Barger AM, Maddox CW, Breaux CB. Aspergillus flavus
keratomycosis in a cat treated with topical 1% voriconazole solution. Vet
Ophthalmol. 2009 Jan-Feb;12(1):48-52.
45. Meler E , Dunn M, Lecuyer M. A retrospective study of canine persistent nasal
disease: 80 cases (1998-2003). Can Vet J. 2008 Jan;49(1):71-6.
46. Mercier E, Peters IR, Farnir F, Lavoué R, Day M, Clercx C, Peeters D. Assessment of
Toll-like receptor 2, 4 and 9 SNP genotypes in canine sino-nasal aspergillosis. BMC
Vet Res. 2014 Aug 16;10:187.
47. Moore AH. Use of topical povidone-iodine dressings in the management of mycotic
rhinitis in three dogs. J Small Anim Pract. 2003 Jul;44(7):326-9.
48. Mortellaro CM, Franca PD, Caretta G. Aspergillus fumigatus, the causative agent
of infection of the frontal sinuses and nasal chambers of the dog. Mycoses. 1989
Jul;32(7):327-35
49. Ossent P. Systemic aspergillosis and mucormycosis in 23 cats. Vet Rec. 1987 Apr
4;120(14):330-3.
50. Pal M, Mehrotra BS. Studies on the association of Aspergillus fumigatus with ocular
infections in animals. Vet Rec 1986 Jan 11;118(2):42-4
51. Pastor J, Pumarola M, Cuenca R, Lavin S. Systemic aspergillosis in a dog. Vet
Rec. 1993 Apr 17;132(16):412-3.
52. Pavletic MM, Clark GN. Open nasal cavity and frontal sinus treatment of chronic
canine aspergillosis. Vet Surg. 1991 Jan-Feb;20(1):43-8.
53. Peeters D, Clercx C. Update on canine sinonasal aspergillosis. Vet Clin North Am
Small Anim Pract. 2007 Sep;37(5):901-16, vi.
54. Peeters D , Day MJ, Clercx C. An immunohistochemical study of canine
nasal aspergillosis.J Comp Pathol 2005;132:283-288.
55. Pomrantz JS , Johnson LR, Nelson RW, Wisner ER. Comparison of serologic
evaluation via agar gel immunodiffusion and fungal culture of tissue for diagnosis of
nasal aspergillosis in dogs. J Am Vet Med Assoc. 2007 May 1;230(9):1319-23.
56. Richardson MD, Warnock DW, Bovey SE, Lane JG. Rapid serological diagnosis of
Aspergillus fumigatus infection of the frontal sinuses and nasal chambers of thedog.
Res Vet Sci. 1982 Sep;33(2):167-9.
57. Robinson WF, Connole MD, King TJ, Pitt JI, Moss SM. Systemic mycosis due to
Aspergillus deflectus in a dog. Aust Vet J. 2000 Sep;78(9):600-2.
58. Saunders JH, van Bree H, Gielen I, de Rooster H. Diagnostic value of computed
tomography in dogs with chronic nasal disease. Vet Radiol Ultrasound. 2003a JulAug;44(4):409-13.
59. Saunders JH, van Bree H. Comparison of radiography and computed tomography for
the diagnosis of canine nasal aspergillosis. Vet Radiol Ultrasound. 2003b JulAug;44(4):414-9.
60. Saunders JH , Clercx C, Snaps FR, Sullivan M, Duchateau L, van Bree
HJ, Dondelinger RE. Radiographic, magnetic resonance imaging, computed
tomographic, and rhinoscopic features of nasal aspergillosis in dogs. J Am Vet Med
Assoc. 2004 Dec 1;225(11):1703-12.
61. Schochet RA, Lappin MR. Delayed recurrence of nasal aspergillosis in a dog. J Small
Anim Pract. 2005 Jan;46(1):27-30.
62. Schuller S, Clercx C. Long-term outcomes in dogs with sinonasal aspergillosis treated
with intranasal infusions of enilconazole. J Am Anim Hosp Assoc. 2007 JanFeb;43(1):33-8.
243
63. Schultz RM , Johnson EG, Wisner ER, Brown NA, Byrne BA, Sykes JE.
Clinicopathologic and diagnostic imaging characteristics of systemic aspergillosis in
30 dogs. J Vet Intern Med. 2008 Jul-Aug;22(4):851-9.
64. Sharman MJ , Mansfield CS. Sinonasal aspergillosis in dogs: a review. J Small Anim
Pract. 2012 Aug;53(8):434-44.
65. Sharman M , Lenard Z, Hosgood G, Mansfield C. Clotrimazole and enilconazole
distribution within the frontal sinuses and nasal cavity of nine dogs with sinonasal
aspergillosis. J Small Anim Pract. 2012 Mar;53(3):161-7.
66. Sharp NJ, Sullivan M. Use of ketoconazole in the treatment of canine
nasal aspergillosis. J Am Vet Med Assoc. 1989 Mar 15;194(6):782-6.
67. Sharp NJ, Sullivan M, Harvey CE, Webb T. Treatment of canine
nasal aspergillosis with enilconazole. J Vet Intern Med. 1993 Jan-Feb;7(1):40-3.
68. Siemieniuch MJ, Skarzynski DJ, Kozdrowski R. Aspergillosis of a dog genital tractCase report. Anim Reprod Sci. 2009 May;112(1-2):164-71.
69. Sissener TR, Bacon NJ, Friend E, Anderson DM, White RA. Combined clotrimazole
irrigation and depot therapy for canine nasal aspergillosis. J Small Anim Pract. 2006
Jun;47(6):312-5.
70. Smith LN, Hoffman SB. A case series of unilateral orbital aspergillosis in three cats
and treatment with voriconazole. Vet Ophthalmol. 2010 May;13(3):190-203.
71. Talbot JJ , Johnson LR , Martin P , Beatty JA , Sutton DA , Billen F , Halliday CL
, Gibson JS , Kidd S , Steiner JM , Ujvari B , Barrs VR . What causes canine sinonasal aspergillosis? A molecular approach to species identification. Vet J. 2014
Apr;200(1):17-21.
72. Talbot JJ, Kidd SE, Martin P, Beatty JA, Barrs VR. Azole resistance in canine and
feline isolates of Aspergillus fumigatus. Comp Immunol Microbiol Infect Dis. 2015
Oct;42:37-41.
73. Taylor AR , Young BD , Levine GJ , Eden K , Corapi W , Rossmeisl JH Jr , Levine JM
. Clinical Features and Magnetic Resonance Imaging Findings in 7 Dogs with Central
Nervous SystemAspergillosis. J Vet Intern Med. 2015 Nov-Dec;29(6):1556-63.
74. Trempala CL , Herold LV. Spontaneous pneumothorax associated with Aspergillus
bronchopneumonia in a dog. J Vet Emerg Crit Care (San Antonio). 2013 NovDec;23(6):624-30.
75. Walker JT , Frazho JK, Randell SC. A novel case of canine
disseminated aspergillosis following mating. Can Vet J. 2012 Feb;53(2):190-2.
76. Whitney BL, Broussard J, Stefanacci JD. Four cats with fungal rhinitis. J Feline Med
Surg. 2005 Feb;7(1):53-8.
77. Whitney J, Beatty JA, Martin P, Dhand NK, Briscoe K, Barrs VR. Evaluation of
serum galactomannan detection for diagnosis of feline upper respiratory
tract aspergillosis. Vet Microbiol. 2013 Feb 22;162(1):180-5.
78. Wood GL, Hirsh DC, Selcer RR, Rinaldi MG, Boorman GA.
Disseminated aspergillosis in a dog. J Am Vet Med Assoc. 1978 Mar 15;172(6):7047.
79. Zhang S , Corapi W, Quist E, Griffin S, Zhang M. Aspergillus versicolor, a new
causative agent of canine disseminated aspergillosis. J Clin Microbiol. 2012
Jan;50(1):187-91.
2. Penicilliosis in cats and dogs
2.1. Introduction
244
Infections with Penicillium spp are rare in domestic animals. In dogs, infections of the nasal
cavity, lungs, lymph nodes, and bones have been reported. Nasal disease is most common and
behaves similar to nasal aspergillosis. In cats, the fungus has been isolated from the nasal
cavity, orbital cellulitis and sinusitis, and lungs. It has also been reported to cause systemic
disease in captive toucanets (P griseofulvum) and bamboo rats (P marneffei) in southeast
Asia. Penicillium spp are widely distributed in nature and are found in soils, grains, and
various foods and feeds (Joseph Taboada, 2014, http://www.merckvetmanual.com).
2.2. Clinical Findings and Lesions
Dogs with nasal penicilliosis have chronic sneezing and an acute to chronic nasal
discharge that varies from intermittent hemorrhagic to intermittent or continuous
mucoid or mucopurulent. Radiographic findings include areas of turbinate destruction
with increased radiolucency. Grossly, the nasal mucosa has foci of necrosis and
ulceration; microscopically, fungal hyphae may form a thick mat over an intact
mucosa adjacent to these foci. Systemic disease often affects long bones, resulting in
lameness.
2.3. Reported causes of penicilliosis in cats and dogs
P. species (Harvey, 1994), Whitney et al., 2005, Soonthornsit et al., 2013)
P. purpurogenum (Zanatta et al., 2006)
P. marneffei (Chaiwun et al., 2011)
P. canis (Langlois et al., 2014)
2.4. Aetiology
2.4.1. Penicillium canis S. W. Peterson, Journal of Clinical
Microbiology 52 (7): 2450 (2014)
Colonies on CYA attain diameters of 6 to 7 mm after 7 days of incubation at 25°C,
are white, and form a 2-mm-high cushion of loose vegetative hyphae. Sporulation is
sparse and basal, with no exudate, soluble pigments, sclerotia, or ascomata. The
reverse is yellowish near chamois in color. Colonies on MEA attain diameters of 7 to
8 mm after 7 days of incubation at 25°C, are white, and form a 2- to 3-mm raised
cushion of largely vegetative hyphae. Sporulation is sparse, with no exudate or
soluble pigments and no sclerotia or ascomata, and the reverse is a pale drab. Colonies
on MGA incubated for 7 days at 25°C attain diameters of 5 to 6 mm, form a 2- to 3mm raised cushion, and sporulated heavily in a greenish gray color with no exudate,
soluble pigments, sclerotia, or ascomata. The colony reverse is not visible on this
medium. There is no growth on CYA at 5°C; at 37°C, small, white, 2- to 3-mmdiameter colonies are formed after 7 days. Colonies grown at 25°C on CYA—5%
NaCl or CYA–20% sucrose are 2 or 5 mm in diameter, respectively. Conidiophores
are simple, arising from basal and aerial hyphae, smooth walled, hyaline, 5 to 25 by
1.5 to 2.5 μm, nonvesiculate, bearing an apical whorl of two to five ampuliform
phialides 5 to 7 (uncommonly, up to 10) by 2 to 3 μm with a 1- to 2-μm collula,
bearing ovoid, smooth-walled conidia 4 to 5 by 2 to 3 μm.
245
P. canis NRRL 62798. (A) Seven-day-old colonies grown on CYA at 25°C. (B) Seven-day-old
colonies grown on MGA at 25°C. (C) Typical conidiophore with two apical phialides. (D)
Characteristic elongate-ovoid, smooth-walled conidia. Bar = 10 μm for panels C and D
2.4.2. Penicillium marneffei Segretain, Capponi & Sureau, Bulletin de la Société
Mycologique de France 75: 416 (1959)
Colonies (CzA, 30°C) flat, sparse, compact, greenish to purplish, on MEA exuding an
orange or red pigment into the medium; primary cultures often canary yellow due to
sterile aerial mycelium. At 37°C colonies restricted, whitish, yeast-like.
Microscopy. Hyphae in part spirally twisted. Conidiophores creeping or fasciculate,
70-150 x 2.5-3.0 µm; penicilli generally biverticillate but also irregularly
monoverticillate or more complex. Metulae 7-11 µm long, in whorls of 3-5. Phialides
in whorls of 4-7, ampulliform to acerose, 6-10 x 2.5-3.0 µm. Conidia smooth-walled,
ellipsoidal, 2.5-4.0 x 2-3 µm, often with prominent scars, borne in short, disordered
chains.
Penicillium marneffei en.wikipedia.org , citeseerx.ist.psu.edu
246
Mycobank
2.4.3. Penicillium purpurogenum Stoll sensu Raper & Thom, A manual of the
Penicillia: 563-633 (1945)
Colonies on Czapek's solution agar (Col. Pl. X) growing rather restrictedly, attaining a
diameter of 1.5 to 2.5 cm, in 12 to 14 days at room temperature (fig. 162A and E),
sometimes definitely wrinkled, zonate or azonate, consisting of a yellow to orange-red
mycelial felt bearing abundant conidial structures, or of massed conidial heads arising
from aerial hyphae or directly from the substratum and superficially appearing
velvety, or in some strains tending to become floccose with growing margin white or
yellowish from an admixture of encrusted sterile hyphae; usually heavily sporing in
central and sub-central areas, in deep yellow-green shades near lily green through
deep slate green to dull greenish black (Ridgway, Pl. XLVII); exudate usually limited
but in some strains fairly abundant, in orange-red shades; odor indistinct or slightly
moldy; reverse in deep red to dark reddish purple shades, often approximating ox
blood red (R., Pl. I), with surrounding agar similarly colored in somewhat lighter
shades; conidiophores arising from the substratum and measuring up to 100 to 150
µm in length by 2.5 to 3.0 or 3.5 µm in diameter, or as branches from aerial hyphae
and much shorter, about 40 to 50 µm, smooth-walled; penicilli typically biverticillate
and symmetrical (fig. 162C and D), compact, usually consisting of a single verticil of
5 to 7 or 8 metulae, each terminating in a compact cluster of 4 to 6 parallel sterigmata
bearing short conidial chains; metulae 10 to 14 µm by 2.5 to 3.0 µm; sterigmata
mostly 10 to 12 µm by 2.0 to 2.5 µm, lanceolate in form, characteristically tapered;
conidia elliptical to sub-globose in some strains, sometimes more or less apiculate,
mostly 3.0 to 3.5 µm by 2.5 to 3.0 µm with walls typically heavy and irregularly
roughened, sometimes showing distinct transverse bands, but in some strains almost
smooth.
247
Penicillium purpurogenum microbialcellfactories.biomedcentral.com , www.drthrasher.org
2.5. Diagnosis
Diagnosis is based on fungal culture, character of the lesions, presence of fungal
hyphae, and a positive agar-gel double-diffusion test. Cultural isolation of
a Penicillium sp must be accompanied by demonstration of tissue invasion by the
fungus for confirmation. In tissues, P marneffei closely resemble the yeast phase
of Histoplasma capsulatum.
2.6. Treatment
Very little has been reported concerning treatment of penicilliosis. Surgical
turbinectomy with curettage has been combined with flushing of the nasal cavity with
1% tincture of iodine or povidone-iodine (10:1) and oral thiabendazole. Fluconazole,
2.5–5 mg/kg/day for 2 mo, has been used to successfully treat some dogs with nasal
penicilliosis.
2.7. Reports:
Harvey (1994) treated 47 dogs with nasal aspergillosis or penicilliosis with
thiabendazole (20 mg/kg orally for 6 weeks). Nasal turbinectomy was performed on
26 of the dogs. Six months or more later, 43% of the dogs were clinically normal or
considerably improved; results were better in dogs not treated surgically. It was
concluded that thiabendazole at a dosage of 20 mg/kg is not an effective treatment for
nasal aspergillosis or penicilliosis in dogs.
Whitney et al. (2005) mentioned that fungal rhinitis is uncommon in the cat and cases
of nasal aspergillosis and penicilliosis have been rarely reported. Signs of fungal
rhinitis include epistaxis, sneezing, mucopurulent nasal discharge and exophthalmous.
Brachycephalic feline breeds seem to be at increased risk for development of nasal
aspergillosis and penicilliosis. Computed tomography (CT) imaging and rhinoscopy
are useful in assessing the extent of the disease and in obtaining diagnostic samples.
Fungal culture may lead to false negative or positive results and must be used in
conjunction with other diagnostic tests. Serological testing was not useful in two cats
tested. The cats in this study were treated with oral itraconazole therapy. When
itraconazole therapy was discontinued prematurely, clinical signs recurred.
Hepatotoxicosis is a possible sequel to itraconazole therapy.
248
Zanatta et al. (2006) reported a 4-year-old female German shepherd dog (GSD) with
forelimb instability and back pain. Clinical examination showed hyperthermia,
generalized lymphadenomegaly and kyphosis. Radiological findings of the spine
revealed areas of discospondilitis involving thoracic and lumbar vertebrae.
Microscopic observations of fine needle aspiration biopsies (FNAB) of lymph-nodes
showed regular, septate, branching fungal hyphae. Itraconazole therapy was started
but the subject died six days later. Disseminated necrotic areas were detected in
enlarged lymph-nodes, liver and spleen. Vertebral granulomas within lytic areas in
T10-T11 and L2-L3, were observed. Cultures inoculated with samples obtained from
lymph-node FNAB and bioptic material from necropsied organs revealed the presence
of pure cultures of Penicillium, subsequently identified as P. purpurogenum. Apart
from female GSD's suspected predisposition to disseminated mycoses described in
literature, no other predisposing factors were ascertained in this case.
(A) Radiographic examination of the spine. Area of discospondylitis involving T10–T11. The
intervertebral disc space between T10–T11 is poorly defined. Diffuse periosteal reactions. (B)
Radiographic examination of the spine. Area of discospondilitis involving L2 and L3. Litic area in the
intervertebral disc, with irregular and sclerotic margins. Ventral periosteal reaction with poor defined
margins. Zanatta et al. (2006)
249
(A) Cytological examination of a prescapular lymph node. Granulomatous process with the presence
of regular branching septate hyphae. (May-Grünwald Giemsa, ×100). (B) Histological examination of a
prescapular lymph node. Granulomatous chronic reaction characterized by numerous giant
multinucleated cells and encapsulating fibrosis. Diffuse branching septate hyphae at the periphery of
the necrotic foci (PAS×400). (A) Conidiophore of Penicillum purpurogenum. Differential interference
contrast (×1200). (B) Conidiophore of P. purpurogenum. Scanning electron microscopy. Zanatta et
al. (2006)
Chaiwun et al. (2011) found that approximately 13% of nasal swabs from dogs in
Chiang Mai, Thailand were positive for P. marneffei when tested by two different
PCR methods, but culture results were negative. Sequencing the products from both
PCR reactions showed 100% identity with P. marneffei, whereas no other known
fungi shared both sequences. These results suggest that dogs might be an animal
reservoir for P. marneffei in northern Thailand. This observation should be confirmed
by additional studies.
Soonthornsit et al. (2013) reported a 5-year-old, female neutered Persian cat with
clinical signs of dysuria, haematuria and partial urethral obstruction that had
manifested over several months. The animal also had hyperkalaemia and severe
azotaemia at the time of presentation. Urinalysis showed haematuria, pyuria and the
presence of several transitional cells. In addition, ultrasonography demonstrated an
extraluminal mass between the neck of urinary bladder and the colon. Fine-needle
aspiration of the mass revealed a fungal form with branching and septate hyphae.
Consequently, itraconazole treatment was prescribed and clinical signs of
improvement were seen after 7 days. However, 1 month later, the cat died of acute
anaemia. Necropsy revealed the presence of extraluminal multifocal fungal granuloma
at the neck of the urinary bladder, and contracted kidneys. Histopathological analysis
of the fungal granuloma was found to be composed of branching, septate hyphal fungi
together with inflammatory cells. Subsequent fungal culture and identification
revealed this to be a species of Penicillium.
Langlois et al. (2014) isolated an unknown species of Penicillium from a bone lesion
in a young dog with osteomyelitis of the right ilium. Extensive diagnostic evaluation
did not reveal evidence of dissemination. Resolution of lameness and clinical stability
251
of disease were achieved with intravenous phospholipid-complexed amphotericin B
initially, followed by long-term combination therapy with terbinafine and
ketoconazole. A detailed morphological and molecular characterization of the mold
was undertaken. Sequence analysis of the internal transcribed spacer revealed the
isolate to be closely related to Penicillium menonorum and Penicillium pimiteouiense.
Additional sequence analysis of β-tubulin, calmodulin, minichromosome maintenance
factor, DNA-dependent RNA polymerase, and pre-rRNA processing protein revealed
the isolate to be a novel species; the name Penicillium canis sp. nov. is proposed.
Morphologically, smooth, ovoid conidia, a greenish gray colony color, slow growth
on all media, and a failure to form ascomata distinguish this species from closely
related Penicillium species.
Ventrodorsal projections of the pelvis at presentation (A) and 3 months later (B). There is extensive
mixed periosteal proliferation and permeative lysis along the right ilial body and wing in the initial
radiograph, which are smoother and less severe in the subsequent image. Langlois et al. (2014)
251
Photomicrographs of sections from the bone biopsy specimen. (A) Hematoxylin-and-eosin staining;
magnification, ×40. Bone segments were surrounded by marked granulomatous inflammation and
small regions of necrosis. Intrahistiocytic and extracellular nonpigmented fungal organisms were
documented throughout the section. Small numbers of lymphocytes, plasma cells, and neutrophils were
also present throughout the section. (B) Periodic acid-Schiff staining; magnification, ×40. Note the
large number of organisms within the cytoplasm of macrophages and free throughout the section.
Intracellular and extracellular fungal organisms were nonpigmented and septate (3 to 4 μm in diameter
by 10 to 20 μm in length) and exhibited occasional dichotomous branching. There were also round, 5-
252
to 7-μm-diameter fungal structures that likely represent cross sections of conidia. Langlois et al.
(2014)
References:
1. Beth L Whitney, John Broussard2 , Joseph D Stefanacci. CASE REPORT Four cats
with fungal rhinitis. Journal of Feline Medicine and Surgery (2005) 7, 53e58
2. Chaiwun,B, Nongnuch Vanittanakom, Yupa Jiviriyawat, Suvichai Rojanasthien, Paul
Thorner. Investigation of dogs as a reservoir of Penicillium marneffei in northern
Thailand. Int. J. Inect. Dis. 2011Volume 15, Issue 4, Pages e236–e23
3. Harvey CE. Nasal aspergillosis and penicilliosis in dogs: results of treatment with
thiabendazole. J Am Vet Med Assoc. 1984 Jan 1;184(1):48-50.
4. Langlois DK, Sutton DA, Swenson CL, Bailey CJ, Wiederhold NP, Nelson
NC, Thompson EH, Wickes BL, French S, Fu J, Vilar-Saavedra P, Peterson SW.
Clinical, morphological, and molecular characterization of Penicillium canis sp. nov.,
isolated from a dog with osteomyelitis. J Clin Microbiol. 2014 Jul;52(7):2447-53.
5. Soonthornsit J, Banlunara W, Niyomthum W, Pusoonthornthum R. Penicillium
species-induced granuloma in a cat resulting in chronic lower urinary tract disease. J
Feline Med Surg. 2013 Dec;15(12):1154-9.
6. Zanatta R, Miniscalco B, Guarro J, Gené J, Capucchio MT, Gallo MG, Mikulicich
B, Peano A. A case of disseminated mycosis in a German shepherd dog due to
Penicillium purpurogenum. Med Mycol. 2006 Feb;44(1):93-7.
3. Paecilomycosis in cats and dogs
3.1.
Introduction
Paecilomycosis is a rare disease primarily of dogs, horses, reptiles, and humans.
Clinical manifestations in veterinary patients vary but include disseminated disease
and diskospondylitis, particularly in dogs: pneumonia in dogs, horses, and reptiles;
keratitis in horses; and miscellaneous local infections. It is important to have an
appropriate index of suspicion because the diagnosis can be difficult, particularly in
localized disease where it is difficult to determine whether a positive culture
represents an etiology or a contamination with an environmental saprophyte. Spinal
radiographs, transtracheal washes, histopathology, and fungal culture have proven to
be valuable diagnostic tools. The prognosis for paecilomycosis is poor, although some
treatment success has been reported, and success rates could improve if additional
information were available regarding fungal species occurring in veterinary patients
and drugs to which these fungi are susceptible (Foley et al., 2002)
Paecilomyces spp. infections have been rarely reported in dogs,4–9 cats, and
other animals. Paecilomyces variotii and Paecilomyces lilacinus are
responsible for most human and animal hyalohyphomycosis infections.
Wound contamination is the most common mode of entry of P. variotii
organisms in humans and disseminated disease may develop via spread from
the primary skin inoculation site to various tissues.
253
The majority of reported cases of canine paecilomycosis were disseminated,
presenting with diskospondylitis, prostatitis, cystitis, rhinitis and/or
dermatitis/cellulitis.
3.2. Aetiology
3.2.1. Paecilomyces variotii Bainier, Bulletin de la Société
Mycologique de France 23: 27 (1907)
254
≡Penicillium variotii (Bainier) Sacc., Sylloge Fungorum 22: 1273 (1913) [MB#212281]
=Penicillium aureocinnamomeum Biourge, La Cellule 33: 213 (1923)
Colonies growing very rapidly, 5-8 cm in diameter after 10 days, appearing powdery
or granular with abundant sporulation, occasionally loosely funiculose or fasciculate,
or with an overgrowth of white to buff-colored aerial mycelium; soon developing dull
olive shades, from ecru olive to light yellow olive (Ridgway Pl. XXX), dark olivebuff (XL), or greyish olive (XLVI). Reverse colorless, or in yellow, dull greenish,
drab or orange shades; in age nearly black in some strains. Exudate produced as small,
colorless droplets. Odor indistinct. Mycelium smooth- walled, hyaline, 1.8-15.0 µm
wide. Conidiophores arising as upright branches from hyphal ropes or aerial
mycelium, 25-170 µm long, 3.0-7.5 µm wide, smooth-walled, hyaline, cylindrical or
tapering toward the apex, usually with several stages of irregular branching; branches
6-22 µm long, frequently bearing secondary branches. Conidiophores and their
branches terminating with a group of 1-6 adpressed or divergent phialides. Phialides
variable in size and shape, 9-32 x 2.5-6.0 µm, cylindrical to ellipsoidal in the lower
part, usually narrowing abruptly into a long, cylindrical neck 1-2 µm wide. Conidia
subhyaline to olivaceous, smooth-walled, ellipsoidal to cylindrical or clavate, often
truncate at the base, highly variable in size, 3.4-11.8 x 1.8-6.1 µm, produced in long,
strongly divergent chains
Paecilomyces variotii, Mycobank
3.2.2.Paecilomyces lilacinus (Thom) Samson, Studies in
Mycology 6: 58 (1974)
255
≡Penicillium lilacinum Thom, Bull. Bur. Anim. Ind. U.S. Dep. Agric.: 73 (1910)
≡Purpureocillium lilacinum (Thom) Luangsa-ard, Houbraken, Hywel-Jones & Samson, FEMS
Microbiology Letters 321: 144 (2011)
=Penicillium amethystinum Wehmer
=Spicaria rubidopurpurea Aoki, Bull. Imp. Seri cult. Exp. Sta. Japan: 419-441 (1941)
www1a.biotec.or.thorganicsoiltechnology.com
Paecilomyces lilacinus Mycobank
3.3.
Reports:
Littman and Goldschmidt (1987) reported disseminated paecilomycosis in an adult
dog without underlying immunosuppressive disease. During the 3-month illness
(before euthanasia), the dog had ulcerative granulomatous inguinal lymphadenitis,
fever, anorexia, dyspnea, generalized lymphadenopathy, retinochoroiditis, and
seizures. Fungal organisms isolated from inguinal and prescapular lymph nodes
before the dog was euthanatized were identified histologically.Paecilomyces variotii
was isolated from the prescapular lymph node specimen. Paecilomyces variotii may
be more pathogenic (once it has gained bodily entry) than previously thought.
256
Nakagawa et al. (1996) reported a 5-year-old dog with a remarkable edematous
swelling of the left hock, lameness and local cellulitis. Paecillomyces sp. was
isolated from ulcerative lesion of the hock joint and mediastinum. At autopsy severe
effusive pleuritis was shown and numerous necrotizing and granulomatous lesions
with fungal elements were seen in the liver, pancreas, kidney and mediastinal lymph
nodes.
García et al. (2000) described a case of canine mycoses initially diagnosed by clinical
signs and enzyme-linked immunosorbent assay anti-fungal test, and later confirmed
by the isolation of Paecilomyces sp. during the post-mortem examination. The fungus
was isolated from lesions in the kidneys, mitral valve, abdominal aorta and vertebral
discs.
X-ray latero-lateral observation in the thoracic region; discospondylitis, Intervertebral discs with small cavities and
grey-brown colour.
García et al. (2000)
Kidney with nodular lesion. Mitral valve with friable and yellow nodule
García et al. (2000)
Abdominal aorta with irregularities in the endothelium and mixed thrombi adhered to its Surface, Intervertebral
discs: multifocal areas of necrosis with slight mononuclear inflammatory infiltrates and branching fungal hyphae
(haematoxylin and eosin stain, _400). García et al. (2000)
257
Kidney; irregular foci of necrosis with polymorphonuclear inflammatory infiltrates, macrophages and abundant
branching fungal hyphae (haematoxylin and eosin stain, _200). Nodule in mitral valve; eosinophilic and acellular
formation, almost completely constituted by foci of branching fungal hyphae (haematoxylin and eosin stain, _400)
García et al. (2000).
Booth et al. (2001) described disseminated mycosis caused by Paecilomyces varioti
in a female German shepherd dog presented with chronic forelimb lameness.
Radiographs of the swollen carpal joint revealed geographic lysis of the radial
epiphysis. Diagnosis was based on cytological demonstration of fungal hyphae and
chlamydiospores, as well as fungal culture of fluid obtained by arthrocentesis.
Temporary remission was characterised by markedly improved clinical signs and
laboratory parameters, following treatment with ketoconazole. The dog was
euthanased 9 months after the initial diagnosis, following the diagnosis of multifocal
discospondylitis.
Quance-Fitch et al. (2002) reported a 7-year-old, 28-kg spayed female mixed-breed
dog with discospondylitis, spondylosis, hilar lymphadenopathy and moderate
thoracolumbar spondylosis. Abdominal ultrasound revealed hepatosplenomegaly with
echogenicity changes and diffuse abdominal lymphadenopathy. Fine-needle aspirate
of spleen confirmed the presence of pyogranulomatous inflammation and numerous
fungal elements, Fine-needle aspirate of lymph node showing pyogranulomatous
inflammation showed also periodic acid-Schiff (PAS)-positive fungal elements.
Direct smear of pleural fluid from a dog. Wright-Giemsa, Sediment smear of pleural fluid from a dog.
Wright- Giemsa, Quance-Fitch et al. (2002)
258
Fine-needle aspirate of spleen from a dog with disseminated Pacilomyces infection. Pyogranulomatous
inflammation and numerous fungal elements are seen. Wright-Giemsa, Fine-needle aspirate of lymph
node showing pyogranulomatous inflammation and periodic acid-Schiff (PAS)-positive fungal elements.
PAS, Quance-Fitch et al. (2002)
Rosser (2003) presented a cat presented with a 2-year history of a recurrent, softtissue swelling of the left metacarpal region. The mass was excised and submitted for
aerobic and anaerobic bacterial culture, fungal culture, and histopathological
examination. Cultures revealed the organism Paecilomyces lilacinus, and
histopathological examination showed a nodular mycotic granuloma. Itraconazole (10
mg/kg body weight, per os [PO], q 24 hours) was administered and continued for a
total of 60 days, with a swelling of the upper lip occurring 3 months after the initial
presentation. Subsequent surgical excisions and debridements along with treatment
with itraconazole (20 mg/kg body weight, PO, q 24 hours) for a total of 4 months
were curative.
Holahan et al. (2008) reported a 4-year-old spayed female mixed breed dog with
vomiting, lethargy and anorexia of 2 weeks duration. Abdominal radiographs and
ultrasonography showed hepatosplenomegaly. Cytological evaluation of ultrasoundguided fine needle aspirates of the liver and spleen revealed fungal organisms and
pyogranulomatous inflammation; fungal culture documented Paecilomyces variotii
infection. The dog received antifungal therapy and supportive care. Multiple firm
plaque-like skin lesions, predominantly involving the inguinal region, developed 18
days after initial presentation and were diagnosed histopathologically as calcinosis
cutis. While generalized calcinosis cutis has been reported in three dogs with
blastomycosis and one dog with leptospirosis, the association with disseminated
Paecilomyces spp. infection is novel.
Modified Wright stain of splenic aspirate showing rare fungal organisms with a clear cell wall and
occasional hyphal forms (arrow). Inguinal calcinosis cutis lesions (caudal ventrum and right dorsalmedial thigh), Holahan et al. (2008)
259
Skin section displaying regions of stromal mineralization (black arrows), and surface extrusion of
mineralized debris. The overlying epidermis transitions from regions of irregular hyperplasia to
ulceration. Haematoxylin and eosin. Holahan et al. (2008)
Pawloski et al. (2010) reported a 6-year-old, spayed female domestic shorthair cat
with an intermittent cough and wheezing of 3 to 4 months' duration. Thoracic
radiography revealed atelectasis of the right middle and caudal lung lobes with
hyperinflation of the accessory lobe, consistent with bronchial obstruction.
Bronchoscopy confirmed a narrowing of the right mainstem bronchial lumen;
however, positive-pressure ventilation resulted in a severe pneumothorax. A lateral
thoracotomy and right caudal lung lobectomy resulted in complete resolution of the
pneumothorax and respiratory signs. Histopathology and culture of the lung
revealed Paecilomyces lilacinus. The cat was placed on itraconazole therapy for 6
months. Since dismissal from the hospital, the cat has not exhibited clinical evidence
of wheezing, coughing, or dyspnea and is neurologically normal.
Tappin et al. (2012) reported a six-year-old female entire German shepherd dog with
polyuria, polydipsia and lethargy. Investigations revealed a mild azotaemia and
abdominal ultrasound revealed marked bilateral dilation of the renal pelves with
echogenic material and proximal left hydroureter. Urine cytological examination and
aspirates from the right renal pelvis revealed mats of fungal hyphae consistent with
fungal bezoar formation. Fungal cultures revealed a profuse growth
of Paecilomyces variotii. Initial treatment with oral itraconazole was unsuccessful,
leading to bilateral nephrotomies to remove the fungal material. Postoperatively
the Paecilomyces infection persisted despite continued itraconazole therapy.
Treatment was commenced with amphotericin B, leading to resolution of the dog's
clinical signs.
261
Ultrasound image of the right renal pelvis (white arrows) revealing a well-defined echogenic mass
(yellow arrows), Cytological examination of urine sample revealing branching fungal hyphae. Wrights
Giemsa stain, A fungal granuloma within the left renal pelvis at nephrotomy, Tappin et al. (2012)
References
1. Booth MJ, van der Lugt JJ, van Heerden A, Picard JA. Temporary remission of
disseminated paecilomycosis in a German shepherd dog treated with ketoconazole. J
S Afr Vet Assoc. 2001 Jun;72(2):99-104
2. Foley et al. (2002) reviewed 14 cases of paecilomycosis in a tertiary care veterinary
hospital and all reports of the disease in the veterinary literature.
3. García ME, Caballero J, Toni P, Garcia I, Martinez de Merlo E, Rollan E, Gonzalez
M, Blanco JL. Disseminated mycoses in a dog by Paecilomyces sp. J Vet Med A
Physiol Pathol Clin Med. 2000 May;47(4):243-9.
4. Holahan ML, Loft KE, Swenson CL, Martinez-Ruzafa I. Generalized calcinosis cutis
associated with disseminated paecilomycosis in a dog. Vet Dermatol. 2008
Dec;19(6):368-72.
5. Littman MP, Goldschmidt MH. Systemic paecilomycosis in a dog. J Am Vet Med
Assoc. 1987 Aug 15;191(4):445-7.
6. Nakagawa Y, Mochizuki R, Iwasaki K, Ohmura-Tsutsui M, Fujiwara K, Mori
T, Hasegawa A, Sawa K. A canine case of profound granulomatosis due to
Paecillomyces fungus. J Vet Med Sci. 1996 Feb;58(2):157-9.
7. Pawloski DR, Brunker JD, Singh K, Sutton DA. Pulmonary Paecilomyces lilacinus
Infection in a Cat. J Am Anim Hosp Assoc. 2010 May-Jun;46(3):197-202.
8. Quance-Fitch FJ, Schachter S, Christopher MM. Pleural effusion in a dog with
discospondylitis. Vet Clin Pathol. 2002;31(2):69-71.
9. Rosser EJ Jr. Cutaneous paecilomycosis in a cat. J Am Anim Hosp Assoc. 2003 NovDec;39(6):543-6.
10. Tappin SW, Ferrandis I, Jakovljevic S, Villiers E, White RA. Successful treatment of
bilateral Paecilomyces pyelonephritis in a German shepherd dog. J Small Anim
Pract. 2012 Nov;53(11):657-60.
4. Scedosporiosis in cats and dogs
4.1.
Introduction
Scedosporium apiospermum, an anamorphs of Pseudallescheria boydii, is a eutrophic
filamentous fungus commonly isolated from soil, vegetation, polluted water, and
animal faeces in temperate climates. It is now recognized as an emerging agent of
severe fungal infections in immunosuppressed human patients. In humans, S.
apiospermum has been classically implicated in subcutaneous infections and in
261
asymptomatic pulmonary colonization, whereas systemic infections are more
frequently observed in patients with an impaired immune system.
Infections caused by fungi belonging to the Scedosporium/Pseudallescheria complex
(SPCF) in dogs are restricted to a small number of cases including localised infections
involving the skin, upper respiratory tract and eyes and disseminated disease.
4.2.
Aetiology
4.2.1. Scedosporium apiospermum (Sacc.) Sacc. ex Castell. &
Chalm., Manual of Tropical Medicine: 1122 (1919)
≡Monosporium apiospermum Sacc., Annales Mycologici 9 (3): 254 (1911)
≡Aleurisma apiospermum (Sacc.) Maire, Bull. Soc. Pathol. Exot.: 290 (1921)
=Actinomyces albus Tarozzi, Archivio Sci. Med.: 535-632 (1909)
=Monosporium sclerotiale Pepere, Soc. Cult. Sci. Med. Nat. Cagl.: 543 (1914)
=Dendrostilbella boydii Shear, Mycologia 14 (5): 242 (1922)
=Glenospora clapieri Catanei, Bull. Soc. Pathol. Exot.: 502 (1927)
=Indiella americana Delamare & Gatti, Compt. Rend. Hebd. Séances Acad. Sci., Sér. D: 1264 (1929)
=Acremonium suis Bakai, Bolezni Svinei, Kiev: 198 (1967)
=Polycytella hominis C.K. Campb., Journal of Medical and Veterinary Mycology 25 (5): 302 (1987)
Colonies are fast growing, greyish-white, suede-like to downy with a greyish-black
reverse. Numerous single-celled, pale-brown, broadly clavate to ovoid conidia, 4-9 x
6-10 mm, rounded above with truncate bases are observed. Conidia are borne singly
or in small groups on elongate, simple or branched conidiophores or laterally on
hyphae. Conidial development can be described as annellidic, although the
annellations (ring-like scars left at the apex of an annellide after conidial secession)
are extremely difficult to see.
Scedosporium apiospermum http://www.mycology.adelaide.edu.au/
4.2.2. Scedosporium prolificans (Hennebert & B.G. Desai) E. Guého &
de Hoog, Journal de Mycologie Medicale 1: 8 (1991)
262
≡Lomentospora prolificans Hennebert & B.G. Desai, Mycotaxon 1 (1): 47 (1974)
=Scedosporium inflatum Malloch & Salkin, Mycotaxon 21: 249 (1984)
Colonies (OA, 30°C) expanding, flat, moist with depressed, cobweb-like aerial
mycelium, olivaceous grey to blackish. Conidiogenous cells locally aggregated in
small brushes, flask-shaped, often bearing a long, inconspicuously annellated zone.
Darker and more inflated conidia may arise alongside hyphae. Conidia smoothwalled, aggregating in dense, slimy heads, soon becoming rather thick-walled and
olivaceous brown, 3-7 x 2-5 µm.
Mycobank
4.3.
Reports:
Cabañes et al. (1998) presented a 10-month-old male American Staffordshire terrier
with a 6-month history of a mucopurulent bilateral nasal discharge. The dog had not
responded to antibiotics. A follow-up X ray revealed a mixed pattern of osteolysis and
increased radiodensity confined to the nasal cavity. Histologic sections of the biopsy
specimens revealed the presence of granules containing numerous septate hyphae that
were hyaline to pale brown and smooth, one-celled, subspherical-to-elongate conidia
that were hyaline to brownish green, and bacteria. Cultures yielded numerous colonies
belonging to Scedosporium apiospermum. Susceptibility tests were performed on the
isolated strain. The isolate was sensitive to ketoconazole, intermediate to
clotrimazole, and resistant to amphotericin B, 5-fluorocytosine, fluconazole, and
itraconazole. The dog was treated with oral ketoconazole. During the treatment a
general improvement in the lesions was observed. To our knowledge, S. apiospermum
has not been implicated previously as an etiologic agent of nasal disease in dogs. This
report provides its first description as such.
263
Intraoral radiograph showing lysis of the vomer bone (arrow) and increased radiodensity confined to
the nasal cavity, which is more pronounced on the right side (asterisks). The turbinate pattern is less
apparent than in normal dogs on both sides (black areas in the nasal cavity). Detail of a Grocottmethenamine-silver-stained section of a tissue biopsy sample showing a granule containing hyphal and
conidial elements. Bar = 10 μm. Cabañes et al. (1998)
Pure culture of S. apiospermum growing on an SGA plate supplemented with chloramphenicol and
inoculated with material from a biopsy after 8 days of incubation at 37°C. Conidiogenesis of S.
apiospermum. Note the conidia situated terminally on annellides without swollen bases. Phase-contrast
microscopy was used. Bar = 10 μm. Cabañes et al. (1998)
Hugnet et al. (2009) presented a 6-year-old, 30-kg, female German Shepherd Dog
with a severe rear limb motor disorder and a medical history of acute onset of fever.
Routine hematology indicated neutrophilia. Spinal survey radiographs were consistent
with osteomyelitis and discospondylitis. Because of the poor clinical prognosis and
the painful nature of the lesions, the dog was euthanized at the owners' request. At
necropsy, T13-L1 vertebrae had large areas of necrosis within the vertebral bodies.
Histopathological findings were consistent with chronic, severe, fungal osteomyelitis
and discospondylitis. Polymerase chain reaction identified Scedosporium
apiospermum, a eutrophic filamentous fungus now recognized as an emerging agent
of severe infections in immunosuppressed human patients.
264
Lateral spinal survey radiograph. Notice the areas of osteolysis and osteoproliferation involving the
T13 and L1 vertebrae (arrow). The radiographic changes are consistent with discospondylitis and
vertebral osteomyelitis. Bar = 3 cm. The T13 and L1 vertebrae, dissected at necropsy, contain large
foci of necrosis within the vertebral bodies (arrows). The contour of both vertebrae are uneven, and
there is destruction of the intervertebral disk (arrowhead). The spinal cord appears normal. Hugnet et
al. (2009)
Pyogranulomatous inflammation of the bone marrow with a focus of central necrosis. Note the severe
osteolysis of the bone trabeculae. Hematoxylin and eosin. Bar = 40 μm, Pyogranulomatous infiltrate
with thin, septate, branching hyphae and large encapsulated spores. Periodic acid–Schiff stain. Bar = 10
μm. Hugnet et al. (2009)
Ethidium bromide-stained, agarose, polymerase chain reaction (PCR) gel. Lane 1: positive
amplification of Scedosporium apiospermum DNA from paraffin-embedded sample; lane 2: PCR
positive control (DNA from Aspergillus fumigatus strain CBS 144–89); lane 3: PCR negative control
(distilled water substituted for DNA template); lane 4: 1-kb molecular marker. Hugnet et al.
(2009)
265
Elad et al. (2010) presented a case of disseminated pseudallescheriasis in a German
Shepherd bitch. Bones (ilium, a rib and phalanges), joints (elbow and acetabulum)
and the surrounding tissues were the principal organs affected. In addition,
Pseudallescheria boydii was isolated, in lower numbers, from the eye, kidney, lymph
nodes draining the affected regions and urine. The dog was euthanized. P. boydii was
identified by morphologic characteristics and molecular techniques (beta tubulin
sequence). In addition, an ITS nucleotide sequence analysis showed that this strain
differed from another isolate identified as Scedosporium apiospermum that had
caused a disseminated infection in another German Shepherd. The importance of the
molecular characterization of fungi belonging to the Pseudallescheria/Scedosporium
complex, isolated from animals was stressed in light of the ongoing attempts to
recharacterize these fungi.
Iliac region. (a) Radiography — note extensive bone destruction. (b) Necrotic purulent material around
the Ilium. Elad et al. (2010)
Foci of fungal infection. (a) Rib (arrows indicate lesions). (b) Kidney.
266
Elad et al. (2010)
Fungal aggregate in bone tissue (PAS stain).
Elad et al. (2010)
Leperlier et al. (2010) reported a 3-year-old neutered male Bengal cat with severe
fungal rhinosinusitis. A diagnosis was obtained after computer tomography imaging,
histopathological examination and fungal culture. The mold Scedosporium
apiospermum was identified as the aetiological agent. Aggressive surgical
debridement combined with topical and systemic antifungal therapy was performed.
Unfortunately, the treatment resulted only in a partial remission of signs.
Haynes et al. (2012) described disseminated Scedosporium prolificans infection in a
1-year-old female spayed German Shepherd dog. Clinical signs were predominantly
associated with fungal pyelonephritis and the organism was cultured from the urine.
The dog was treated with itraconazole and later, terbinafine was added. Subsequent
antifungal susceptibility testing of the isolate showed it to be resistant to all available
antifungal drugs. The dog was euthanased because of acute abdominal haemorrhage
and associated clinical deterioration. Postmortem examination revealed extensive
pyogranulomas containing fungal organisms in the renal parenchyma, myocardium,
bone marrow, skeletal muscle, liver, lung, spleen, multiple lymph nodes and pancreas.
267
Heart from the 1-year-old female spayed German Shepherd dog at postmortem examination showing
multiple cream-coloured nodules (arrows) on the epicardial surface. Haynes et al. (2012)
Photomicrograph of the renal cortex from the 1-year-old female spayed German Shepherd dog showing
a pyogranuloma containing septate fungal hyphae (arrows) (¥100, PAS). Photomicrograph of
myocardium from the 1-year-old female spayed German Shepherd dog showing myocardial fibres
disrupted by large numbers of neutrophils and macrophages (¥20, H&E). Haynes et al. (2012)
Newton et al (2012) reported a 6-year-old male castrated Norfolk Terrier dog with a
21-day history of an increasingly painful eye. Examination revealed marked
blepharospasm and purulent ocular discharge associated with an ulcerative keratitis.
There was panstromal corneal opacity with raised gray to white lesions. Corneal
cytology demonstrated branching septate fungal hyphae identified by polymerase
chain reaction as Scedosporium apiospermum. Treatment with topical 1%
voriconazole solution was successful in resolving the keratomycosis.
Corneal cytology. Fungal hyphae and a few neutrophils are
visible. Modified Wright stain. ·100 objective.
Taylor et al. (2014) reported a case of disseminated scedosporiosis due
to Scedosporium prolificans in a Labrador retriever dog that was receiving
immunosuppressive drug therapy for treatment of immune-mediated haemolytic
anaemia. Despite cessation of immunosuppressive medications and an initial response
to aggressive treatment with voriconazole and terbinafine the dog developed
268
progressive disease with neurological signs necessitating euthanasia six months from
diagnosis.
Taylor et al. (2014)
Nevile et al. (2015) diagnosed and treated 5 cases of canine keratomycosis. Clinical
presentations varied between dogs. Predisposing factors were identified in 4 of 5
cases. Diagnostic modalities utilized were corneal cytology and fungal culture.
Corneal cytology confirmed the presence of fungal organisms in all five cases. A 7month-old male Australian Shepherd presented for corneal ulceration OD. The
referring veterinarian had removed a small vegetable matter foreign body from the
right cornea 4 days previously and prescribed fusidic acid 1% ointment four times
daily and 0.3% gentamycin sulfate four times daily. On examination, OD had marked
blepharospasm, moderate perilimbal hyperemia, and an axial superficial stromal
corneal ulceration with several axial corneal opacities surrounding it. Corneal
cytology was performed as described above and numerous fungal hyphae were seen.
A corneal swab was submitted for fungal culture. Treatment was commenced with
topical 1% itraconazole ointment (Stenlake Compounding Chemist) six times daily
and oral carprofen 2 mg/kg daily. Topical 0.3% gentamycin sulfate was continued
four times daily. Scedosporium apiospermum was cultured 6 days after sample
collection. Treatment was continued for 34 days at which time the corneal ulcer had
healed and the axial corneal opacities had resolved.
References:
1. Cabañes FJ, Roura X, García F, Domingo M, Abarca ML, Pastor J. Nasal granuloma
caused by Scedosporium apiospermum in a dog. J Clin Microbiol. 1998
Sep;36(9):2755-8.
2. Elad D, Perl S, Yamin G, Blum S, David D. Disseminated pseudallescheriosis in a
dog. Med Mycol. 2010 Jun;48(4):635-8..
3. Haynes
SM, Hodge
PJ, Tyrrell
D, Abraham
LA.
Disseminated Scedosporium prolificans infection in a German Shepherd dog. Aust
Vet J. 2012 Jan-Feb;90(1-2):34-8.
4. Hugnet C, Marrou B, Dally C, Guillot J. Osteomyelitis and discospondylitis due to
Scedosporium apiospermum in a dog. J Vet Diagn Invest. 2009 Jan;21(1):120-3.
5. Leperlier D, Vallefuoco R, Laloy E, Debeaupuits J, De Fornel Thibaud
P, Crespeau FL, Guillot J. Fungal rhinosinusitis caused by Scedosporium
apiospermum in a cat. J Feline Med Surg. 2010 Dec;12(12):967-71.
6. Nevile JC, Hurn SD, Turner
Ophthalmol. 2015 Sep 24.
AG.
269
Keratomycosis
in
five dogs.Vet
7. Newton EJ. Scedosporium apiospermum keratomycosis in a dog. Vet
Ophthalmol. 2012 Nov;15(6):417-20.
8. Taylor
A, Talbot
J, Bennett
P, Martin
P, Makara
M, Barrs
VR.
Disseminated Scedosporium prolificans infection in a Labrador retriever with
immune mediated haemolytic anaemia. Med Mycol Case Rep. 2014 Nov 4;6:66-9.
5. Fusariosis in cats and dogs
Evans et al. (2004) described a 2-year-old, spayed, female German Shepherd Dog
with meningoencephalitis secondary to infection with Fusarium spp.
Meningoencephalitis in dogs secondary to a species of Fusarium has not been
previously reported. The diagnosis was made based on the histopathologic
examination of brain tissues postmortem and special immunohistochemical stains
specific for Fusarium solani. The clinical signs in this dog were indicative of
multifocal brain disease and included seizures and a paradoxical vestibular syndrome.
The clinical findings, diagnostic and histopathologic test results, and the comparative
characterizations of other disseminated fungal diseases, especially aspergillosis, are
described.
1. Transverse contrast-enhanced CT image of the brain at the level of the dorsum sellae showing
multiple, diffusely coalescing areas of contrast enhancement centered in the left hippocampus,
with ventrolateral and medioventral extension into the adjacent internal capsule and rostral
midbrain, respectively. There is extensive white matter edema in the left cerebral hemisphere
collapsing the left lateral ventricle and deviating the falx cerebri to the right of midline. R, right; L,
left.2. fungal granuloma from the cerebral cortex showing multiple, short, septate hyphae with
dichotomous branching, 3.Positive immunohistochemistry reaction using an indirect PAP
technique with heterologously absorbed anti-Fusarium antibodies.17 Harris' hematoxylin
counterstain. Bar = 25 µm. Evans et al. (2004)
Kano et al. (2011) described the isolation of Fusarium sporotrichioides from a canine
cutaneous ulceration. A 2-year-old male Beagle dog weighing 8.6 kg, with a history
of immune-mediated hemolytic anemia (IMHA), had been treated with prednisone for
9 months. Physical examination revealed cutaneous ulceration on the left foreleg.
Histopathological examination of skin samples from the ulcerative area revealed
many branching hyphae surrounding neutrophils. Since itraconazole (ITZ) is
recommended for miscellaneous fungal infections, the dog was treated with ITZ.
However, the ulcerative lesions did not improve and after 3 weeks of treatment the
dog died due to renal failure. No autopsy was performed. Since the isolate recovered
from the biopsy specimen was identified as Fusarium species by morphological
characteristics, the animal was diagnosed as having had an infection caused by this
mould. The dog's prior prednisone treatment may have played a role in establishing
the fungal infection. Comparative sequence analyses of the ITS regions of the clinical
271
isolate with those in GenBank showed that it was 100% identical to F.
sporotrichioides and less than 96% similar to ITS of other Fusarium species. Based on
these findings, F. sporotrichioides was established as the etiologic agent of the canine
infection, a situation that has not been previously reported in dogs, as well as humans.
(a) Cutaneous ulceration on the left foreleg. (b) Microscopic examination of a biopsy specimen
from the cutaneous lesion disclosed numerous branching hyphae around neutrophils in the dermis.
Black bar indicates 15 µm long.
Kano et al. (2011) isolated a strain of Fusarium solani from a dog showing many
cutaneous and submucosal nodules and pyogranulomatous kidney lesions. Clinical
isolates from this systemic infection were identified using microscopic examination
and confirmed by molecular analysis.
Namitome et al. (2011) reported an 8-year-old male Golden Retriever with lameness
and claw abnormality in the second digit of the left forelimb. Radiography revealed
osteomyelitis in the distal phalanx bone of the affected limb. Microscopic
examination of the claw revealed numerous hyphae in the claw matrix. Fungal DNA
fragments coding the ribosomal internal transcribed spacer region (ITS) were detected
from the claw matrix as well as fungal colonies of the clinical isolates by PCR.
Nucleotide sequencing revealed that the amplicons shared > 99% homology with
Fusarium sp. Therapy including oral itraconazole resulted in regrowth of a new claw,
in which no hyphae were detected. To the authors' knowledge, this is the first case
report of canine onychomycosis in which Fusarium sp. was isolated from the affected
claw.
References
1. Evans J, Levesque D, de Lahunta A, Jensen HE. Intracranial fusariosis: a novel cause
of fungal meningoencephalitis in a dog. Vet Pathol. 2004 Sep;41(5):510-4.
2. Kano R, Okayama T, Hamamoto M, Nagata T, Ohno K, Tsujimoto H, Nakayama
H, Doi K, Fujiwara K, Hasegawa A. Isolation of Fusarium solani from a dog:
identification by molecular analysis. Med Mycol. 2002 Aug;40(4):435-7.
3. Kano R, Maruyama H, Kubota M, Hasegawa A, Kamata H. Chronic ulcerative
dermatitis caused by Fusarium sporotrichioides. Med Mycol. 2011 Apr;49(3):303-5.
4. Namitome K, Kano R, Sekiguchi M, Iwasaki T, Kaneshima T, Nishifuji K. Isolation
of Fusarium sp. from a claw of a dog with onychomycosis. J Vet Med Sci. 2011
Jul;73(7):965-9.
6. Pheohyphomycoses in cats and dogs
271
6.1.
Introduction
Phaeohyphomycoses in dogs and cats are rare opportunistic fungal infections caused
by numerous genera of fungal moulds that characteristically produce melaninpigmented ‘dematiaceous’ (dark-coloured) hyphal elements in tissues and in culture.
These fungi are widespread in the environment and are found in soil, wood and
decomposing plant debris and are usually inoculated into the host by direct trauma
from a wood splinter, via bite wounds, or by contamination of an existing open
wound. Most infections with dematiaceous fungi cause subcutaneous nodules and/or
tracts that contain purulent exudates. In some cases the infection disseminates or
involves the central nervous system (CNS).
The number of reports of infections is increasing in humans and animals, often
associated with immunosuppressive treatment or an immunosuppressive condition.
Cytological examination of exudates usually reveal pyogranulomatous inflammation
that may contain fungal hyphae. Fungal culture is usually recommended to diagnose
this disease.
Treatment involves surgical excision in cases of localised skin disease followed by
systemic antifungal therapy, with itraconazole as the agent of first choice. Relapses
after treatment are common. Itraconazole and other systemic antifungal agents have
been used to treat systemic or neurological cases, but the response is unpredictable.
The prognosis is guarded to poor in cats with multiple lesions and systemic or
neurological involvement. Combination therapy with terbinafine and an azole antifungal drug appears to be effective in dogs.
6.2.
Phaeohyphomycoses reported in dogs and cats
Dogs
1. Cerebral phaeohyphomycosis: (Dillehay et al., 1987, Migaki et al., 1987,
Bentley et al., 2011, Giri et al, 2011)
2. Systemic phaeohyphomycosis: (Schroeder et al., 1994, Añor et al., 2001,
Singh et al., 2006)
3. Cutaneous phaeohyphomycosis: (Herráez et al., 2001, Swift et al., 2006)
4. Pulmonary phaeohyphomycosis (Sutton et al., 2008)
5. Osteomyelitis (Lomax et al., 1986)
Cats
1. Cutaneous/ subcutaneous phaeohyphomycosis: (Muller et al., 1975, Haschek
and Kasali, 1977, Bostock et al., 1982, Sousa et al., 1984, Dhein et al. ,
1988, VanSteenhouse et al., 1988, Kettlewell et al., 1989, Roosje et al.,
1993, Outerbridge et al., 1995, Fuchs et al., 1997, McKay et al.,2001,
Abramo et al.,2002)
2. Nasal: (Bostock et al., 1982, Dhein et al., 1988, McKay et al., 2001)
3. Cerebral phaeohyphomycosis : (Shinwari et al., 1985, Dillehay et al.,1987,
Bouljihad et al., 2002, Mariani et al., 2002)
4. Systemic phaeohyphomycosis: (Elies et al., 2003)
5. Pulmonary phaeohyphomycosis: ( Evans et al., 2011)
6. Ocular (Miller et al., 1983)
272
7. Renal (.Reed et al., 1974)
6.3.
Dematiaceous fungi recorded as causes of
phaeohyphomycoses in dogs
1. Alternaria infectoria, Dedola et al. (2010)
2. Bipolaris sp., Giri et al. ( 2011)
3. Cladophialophora sp., Bentley et al. (2011)
4. Cladophialophora bantianum, Dillehay et al. (1987), Añor et al. (2001
5. Curvularia sp, Herráez et al. (2001)
6. Curvularia lunata, Swift et al. (2006)
7. Ochroconis gallopavum, Singh et al. (2006)
8. Phialemonium obovatum , Lomax et al. (1986)
9. Xylohypha bantiana. Schroeder et al. (1994)
6.4.
Dematiaceous fungi recorded as causes of
phaeohyphomycoses in cats
1. Alternaria alternate, Dhein et al. (1988, Outerbridge et al. (1995), McKay
et al. (2001)
2. Alternaria infectoria, Roosje et al. (1993)
3. Cladosporium sp, Sousa et al. (1984), Mariani et al. (2002)
4. Cladosporium bantianum, Shinwari et al. (1985), Dillehay et al. (1987),
Abramo et al. (2002), Bouljihad et al. (2002), Elies et al. (2003), Evans et al.
(2011)
5. Drechslera spicifera, Muller et al. (1975), Maeda et al. (2008)
6. Exophiala spinifera, Kettlewell et al. (1989)
7. Exophiala jeanselmei, Bostock et al. (1982), Pukay and Dion (1984)
8. Fonsecaea pedrosoi, Fondati et al. (2001)
9. Moniliella suaveolens, McKenzie et al. (1984)
10. Phialophora gougerotii , Haschek and Kasali (1977)
11. Phialophora verrucosa, Pukay and Dion (1984), Beccati et al. (2005)
12. Scolecobasidium humicola, VanSteenhouse et al. (1988)
13. Staphylotrichum coccosporum, Fuchs et al. (1997).
14. Stemphylium sp , Sousa et al. (1984)
15. Ulocladium species, Knights et al. (2008)
6.5.
Description of demattiaceous fungi recorded as causes of
phaeohyphomycoses in dogs and cats
6.5.1. Alternaria alternata (Fr.) Keissl. (1912)
Synonyms: Alternaria tenuis Nees 1917
Macrosporium fasciculatum Cooke & Ellis (1817),
Torula alternata Fr. (1832),Alternaria fasciculata Jones & Grout (1897),
Alternaria rugosa McAlpine (1896)
273
Alternaria species grow rapidly producing flat, downy to woolly colonies, covered by
grayish, short, aerial hyphae. The surface is greyish white at the beginning which later
darkens and becomes greenish black or olive brown with a light border.
Microscopically, the fungus develops septate, brown hyphae. Conidiophores are also
septate and brown in colour, occasionally producing a zigzag appearance. They bear
simple or branched large conidia, which have both transverse and longitudinal
septations (muriform conidia). They are dark in colour, elongated and found in chains.
The conidia may be observed singly or in acropetal chains and may produce germ
tubes. They are ovoid to obclavate, darkly pigmented, muriform, smooth or
roughened. The end of the conidium nearest the conidiophore is round while it tapers
towards the apex.
6.5.2. Bipolaris spicifera (Bainier) Subram., (1971)
Synonyms: Brachycladium spiciferum Bainier, (1908)
Brachysporium spiciferum (Bainier) Corbetta, (1963)
Curvularia spicifera (Bainier) Boedijn, (1909)
Dendryphion spiciferum (Bainier) Sacc. & Traverso,(1910)
Drechslera spicifera (Bainier) Arx, (1970)
Helminthosporium spiciferum (Bainier) Nicot, (1953)
Colonies on potato dextrose agar at 25°C are initially white, soon becoming gray to
black with a black reverse. Rapid growth. Texture is woolly tocottony. Hyphae are
septate and dark. Conidiophores may be up to 150 μm in length, are sympodial,
geniculate, simple or branched, bearing conidia through pores or openings
(poroconidia). Conidia have 2 to 5 transverse distosepta or pseudosepta (septa that do
not extend to the cell wall with cells inclosed within sacs) and 3 to 6 cells. They
measure approximately 14-40 x 6-11 μm. A flattened hilum or point of attachment is
seen on the basal cell. Conidia germinate from both poles (bipolar).
274
6.5.3. Cladophialophora bantiana de Hoog, Kwon-Chung &
McGinnis, (1995)
Synonyms: Torula bantiana Sacc., in Saccardo, (1912)
Cladosporium bantianum (Sacc.) Borelli, (1960)
Xylohypha bantiana (Sacc.) McGinnis, Borelli, Padhye & Ajello, (1986)
Cladosporium trichoides Emmons Binford, Thompson & Gorham, (1952)
Cladosporium bantianum (Sacc.) Borelli, (1960)
Cladosporium trichoides var. chlamydosporum Kwon-Chung, (1978)
In culture, the colony is black with a velvety texture or dark grey in colour, depending
on the type of agar medium it is grown on. It grows slowly under temperatures
ranging from 14-42 °C with optimal growth around 30 °C. It can be distinguished
from other species of the genus Cladophialophora by the presence of urease activity.
Microscopically, the fungus produces predominantly hyphal growth both in vivo and
in vitro, that consists of dark coloured largely unbranched, wavy chains of conidia,
individually 5–10 μm in length. The dark colour is due to the presence of the dark
pigment melanin.
275
6.5.4. Curvularia lunata (Wakker) Boedijn, 127 (1933)
Synonyms: Acrothecium lunatum Wakker, (1898)]
Helminthosporium curvulum Sacc., (1916)
Helmisporium curvulum Sacc. (1916)
Curvularia produces rapidly growing, woolly colonies on potato dextrose agar at
25°C. From the front, the color of the colony is white to pinkish gray initially and
turns to olive brown or black as the colony matures. From the reverse, it is dark brown
to black. Curvularia produces septate, brown hyphae, brown conidiophores, which are
simple or branched and are bent at the points where the conidia originate. The conidia
are straight or pyriform, brown, multiseptate with transverse septa, and have dark
basal protuberant hila. The central cell is typically darker and enlarged compared to
the end cellsin and usually gives the conidium a curved appearance.
6.5.5.
Exophiala jeanselmei (Langeron) McGinnis & A.A.
Padhye (1977)
Synonyms: Torula jeanselmei Langeron, (1928)
Pullularia jeanselmei (Langeron) Dodge, (1935)
Phialophora jeanselmei (Langeron) Emmons (1945)
Exophiala jeanselmei var. jeanselmei (1977)
Colonies are initially smooth, greenish-grey to black, mucoid and yeast-like,
becoming raised and developing tufts of aerial mycelium with age, often becoming
dome-shaped and suede-like in texture. Reverse is olivaceousblack. Numerous
ellipsoidal, yeast-like, budding cells are usually present, especially in young cultures.
Scattered amongst these yeast-like cells are larger, inflated, subglobose to broadly
ellipsoidal cells (germinating cells) which give rise to short torulose hyphae that
gradually change into unswollen hyphae. Conidia are formed on lateral pegs either
arising apically or laterally at right or acute angles from essentially undifferentiated
hyphae or from strongly inflated detached conidia. Conidiogenous pegs are 1-3 μm
long, slightly tapering and imperceptibly annellate. Conidia are hyaline, smooth, thinwalled, broadly ellipsoidal, 3.2-4.4 x 1.2-2.2 μm, and with inconspicuous basal scars.
Cultures grow at 37C but not at 40C.
276
6.5.6. Exophiala spinifera (H.S. Nielsen & Conant) McGinnis (1977)
Synonyms: Phialophora spinifera (1968)
Rhinocladiella spinifera (H.S. Nielsen & Conant) de Hoog, (1977)
6.5.7.
Fonsecaea pedrosoi (Brumpt) Negroni (1936)
Synonyms: Hormodendrum pedrosoi Brumpt, (1922)
Acrotheca pedrosoi (Brumpt) Fonseca & Leão (1923)
Trichosporum pedrosoi (Brumpt) Brumpt (1927)
Trichosporum pedrosianum (Brumpt) M. Ota (1927)
Gomphinaria pedrosoi (Brumpt) C.W. Dodge (1935)
Hormodendroides pedrosoi (Brumpt) M. Moore & F.P. Almeida (1936)
Phialophora pedrosoi (Brumpt) Redaelli & Cif: 592 (1941)
Carrionia pedrosoi (Brumpt) Bric.-Irag (1942)
Rhinocladiella pedrosoi (Brumpt) Schol-Schwarz (1968)
Hormodendrum algeriense Montpell (1927)
Hormodendrum rossicum Jacz. & Merlin (1929)
Hormodendrum compactum Carrion (1935)
Phialoconidiophora guggenheimia M. Moore & F.P. Almeida (1936)
Fonsecaea compactum (Carrion) Carrion (1940)
277
Fonsecaea pedrosoi var. communis Carrion (1940)
Rhinocladiella compacta Carrion ex de Hoog, (1977)
Colonies are slow growing, flat to heaped and folded, suede-like to downy, olivaceous
to black with black reverse. Conidiogenous cells pale olivaceous, arranged in loosely
branched systems, with prominent denticles. Conidia pale olivaceous, clavate to
ellipsoidal, in short chains, subhyaline, smooth and thinwalled, 3.5-5 x 1.5-2 μm. F.
monophora on average has slightly longer conidial chains and slightly shorter
denticles than F. pedrosoi. All strains grow at 37C but not at 40C.
6.5.8.
Ochroconis gallopava (W.B. Cooke) de Hoog (1983)
Synonyms: Diplorhinotrichum gallopavum W.B. Cooke (1964)
Dactylaria gallopava (W.B. Cooke) G.C. Bhatt & W.B. Kendr. (1968)
Dactylaria constricta var. gallopava (W.B. Cooke) Salkin & Dixon, (1987)
Colonies are smooth to suede-like, dry, flat, tobacco-brown to brownish-black with a
dark brown diffusible pigment. Hyphae are brown with relatively thick walls.
Conidiophores are mostly cylindrical to acicular, sometimes poorly differentiated,
bearing a few conidia at the tip. Conidia are two-celled, subhyaline to pale brown,
smooth-walled to verrucose, cylindrical to clavate, constricted at the septum, 11-18 x
2.5-4.5 μm in size, with the apical cell wider than the basal cell. A remnant of a
denticle may also be seen at the conidial base. Optimum growth at 35C, tolerant to
40C.
278
6.5.9.
Phialemonium obovatum W. Gams & McGinnis (1983)
Colonies (PDA) spreading, flat, smooth, pale ochraceous or greenish. Microscopy.
Conidia produced from lateral, non-septate outgrowths of creeping hyphae or from
terminal, elongate phialides up to 15 µm in length. Conidia hyaline, smooth- and thinwalled, obovoidal, 3.5-6.0 x 1.5 µm, aggregating in slimy heads. Pale brown
chlamydospores present in old cultures.
6.5.10.Phialophora verrucosa Medlar (1915)
Synonyms: Phialophora calyciformis G. Sm. (1962)
Cadophora richardsiae Nannf (1934)
Cadophora brunnescens R.W. Davidson (1935)
Phialophora richardsiae (Nannf.) Conant (1937)
Cadophora richardsiae Nannf (1934)
Cadophora brunnescens R.W. Davidson (1935)
Phialophora calyciformis G. Sm (1962)
Pleurostomophora richardsiae (Nannf.) Mostert, Gams & Crous, (2004)
Colonies of Phialophora grow moderately slowly and attain a diameter of 2 3 cm
following an incubation of 7 days at 25°C. The texture is wooly to velvety and may be
heaped and granular in some strains. From the front, the color is initially white and
later becomes dark grey-green, brown or black. From the reverse, it is iron grey to
black. Microscopically, members of the genus Phialophora produce clusters of singlecelled conidia in basipetal succession from characteristic flask-shaped or cylindrical
phialides which have distinctive collarettes. Conidia are hyaline to olivaceous brown,
smoothwalled, ovoid to cylindrical or allantoid, and usually aggregate in slimy heads
at the apices of the phialides, which may be solitary, or in a brush-like arrangement.
279
6.5.11.Stemphylium macrosporoideum (Berk.) Sacc., (1881)
Synonyms: Epochnium macrosporoideum Berk., (1838)
Acrospeira macrosporoidea (Berk.) Wiltshire, (1838)
Hyphelia castaneae Wallr., (1833)
Hyphelia castanea Wallr., (1833)
Colonies of Stemphylium grow rapidly, they are velvety to cottony in texture, gray,
brown, or brownish-black in colour. Reverse is black. Microscopically, the fungus
develops septate hyphae, which are pale brown to brown in colour. Conidiophores are
black, may be simple or branched, bear a number of vesicular swellings or nodes.
Conidiogenous cells are terminally located and percurrent (the proliferation which
grows through the tip of the conidiogenous cell). Conidia (12-20 x 15-30 μm) are
solitary, light brown to black in color, and rough- or smooth-walled. They are oblong
or subspherical, rounded at the tips and have transverse and vertical septations
(=muriform conidia) with a typical constriction at the central septum. They have
thickened scars at their base
6.6. Reports on Phaeohyphomycoses in dogs and cats
6.6.1. Reports on Phaeohyphomycoses in dogs
Lomax et al. (1986) identified Phialemonium obovatum as the cause of osteomyelitis
in a German shepherd dog. Histologic examination of the biopsied material from the
281
left tibia revealed septate, irregularly branched hyphae, swollen cells, and ovate-tospherical cells divided by a transverse septum. The majority of the fungal elements
were hyaline, but a few had lightly pigmented cell walls that had a greenish yellow
tint. The presence of melanin in the cell walls of the hyphae and especially in their
septa was verified by the use of the Fontana-Masson silver stain. P. obovatum formed
moist, off-white-to-ochraceous, spreading colonies with a characteristic green
pigment on their reverse side. The pigment was more prominent in cultures grown at
37 degrees C than in those grown at 25 degrees C. The isolate also grew at 40 degrees
C. The dog isolate produced characteristic adelophialides without conspicuous
collarettes and also basal septa from the creeping vegetative hyphae growing on the
surface of the medium. The numerous obovate phialoconidia were smooth and onecelled.
1. Lateral view of left tibia and femur. There is soft-tissue swelling, irregular periosteal proliferation,
lysis of cortical bone, and increased medullary density in the mid-shaft region of the tibia. The distal
metaphysis of the femur has periosteal proliferation and increased medullary density.2. Lateral view of
the left radius and ulna showing overlying soft-tissue swelling and periosteal proliferation on both the
radius and ulna. The mid-shaft region of the radius also has corticalysis and increased medullary
density. Lomax et al. (1986)
281
3. Scattered and loosely aggregated hyphae of P. obovatum in a section of the tibial, 4.Budding
yeastlike cells and pseudohyphae in the necrotic center of a granuloma. Arrows, Spherical-to-oval
fungal cells, stained with Gomori methenamine silver, with a single, thin septation. Magnification,
x700. Lomax et al. (1986)
5. Pleomorphic fungal elements of P. obovatum, stained with Gomori methenamine silver, in a tibial
abscess. Magnification, x700. Inset: Replicate section shows positive staining of some elements for
melanin with the Fontana-Masson silver procedure. Magnification,x700. Lomax et al. (1986)
6. Colony of P. obovatum on Sabouraud dextrose agar after 2 weeks at 25°C.7. Photomicrograph
showing an adelophialide and conidia of P. obovatum. Lactophenol cotton blue; magnification,
Lomax et al. (1986)
282
Dillehay et al. (1987) reported Cerebral phaeohyphomycosis in two dogs. Case 1. A
4-month-old female pit bulldog had a 3 day history of seizures and a temperature of
105.0 F. The dog had not received any vaccinations and had been healthy. Because of
neurologic abnormalities, it was euthanized. Case 2. A 6-month-old, male Dachshund
mixed breed dog had a 3 week history of neck stiffness and pain upon manipulation. It
had not received vaccinations. Treatment with antibiotics and steroids resulted in
temporary clinical improvement. Cervical radiographs were normal. Analysis of
Cerebrospinal fluid showed white blood cells, 26,4OO/cu mm; protein, 298 mg/dl;
and glucose, 80 mg/dl. Cultures of cerebrospinal fluid were negative. The dog had
several grand ma1 seizures and was euthanized. At necropsy, gross lesions were seen
only in the brain. Meninges were diffusely opaque, congested and multifocally
adherent to the cerebrum. Case 1 had a discrete, focal, green-brown lesion, 1.0-1.5 cm
in diameter, in the right thalamus. Case 2 had a well circumscribed, red-green malacic
lesion, 0.5-1 cm in diameter, on the dorsal surface of the right parietal lobe and
multifocal, discrete to coalescing, green-brown foci varying in diameter from 0.1 to
0.5 cm in both white and gray matter of the dorsolateral area of the frontal lobe .
Microscopically, lesions varied from abscesses, some of which were encapsulated by
thick fibrous tissue, to less discrete and often coalescing foci of pyogranulomatous
inflammation. Within epithelioid and multinucleated giant cells, and extracellularly,
were moderate numbers of septate, pigmented hyphae 3-6 pm in width. Hyphae were
light brown to basophilic in hematoxylin and eosin (HE)-stained sections and had
parallel contoured walls with occasional branching. Hyphae were also within blood
vessels, some of which were thrombosed. Both animals had multifocal suppurative
meningitis. Phaeohyphomycotic lesions were not present in extraneural sites. C.
bantianum was grown in culture.
Abscess containing pigmented hyphae, cerebrum, dog (Case 2). HE. Bar = 20 pm.. C.
bantianurn grown in culture, branching hyphae with conidia. Lactophenol cotton-blue stain.
Bar = 20 pm.
Migaki et al. (1987) diagnosed cerebral phaeohyphomycosis in a 9-year-old spayed
dog that had a series of epileptic convulsions a day before death. About 6 weeks
before her death, she had been treated for severe demodectic mange. During this
period, persistent leukopenia, lymphocytopenia, and thrombocytopenia were found by
blood analyses. At necropsy, multiple large pyogranulomatous lesions were found in
the cerebrum and meninges. Dematiaceous fungi with brown, branching, septate
hyphae and budding yeasts were found within tissue cells and in the necrotic areas.
Schroeder et al. (1994) presented an 8-year-old, Maltese-cross bitch with chronic
neck and back pain and an acute onset of circling, hyperaesthesia and constant crying.
Clinical examination revealed temporal muscle atrophy, an abnormal hanging reflex,
cervical rigidity and severe hepatomegaly. Ultrasonography of the liver showed
283
several disseminated, poorly demarcated, hypoechoic areas which on fine needle
aspirates, contained large numbers of pigmented fungal hyphae. Cerebrospinal fluid
examination revealed fungal hyphae and numerous Ehrlichia canis morulae. A
diagnosis of systemic phaeohyphomycosis secondary to ehrlichiosis was proposed.
Treatment was unsuccessful and the dog was euthanased. At necropsy, multiple
yellowish-green to black, necro-granulomatous foci were found throughout the liver
parenchyma and similar foci were present in the spleen, renal cortices and adrenal
glands. Irregular, multifocal, grey to black foci of malacia were present in both the
grey and the white matter of the brain. On histopathological examination pigmented
fungal hyphae were demonstrated in the liver, spleen, kidneys, portal lymph node and
adrenals, as well as in the brain. Cultures of various organs yielded a fungal organism
identified as Xylohypha bantiana.
Añor et al. (2001) reported an 8-year-old 18-kg castrated male Chow Chow dog
generalized cachexia, abdominal distension, hepatomegaly, and a full, distended
urinary bladder. On neurologic examination the dog was obtunded and severely
tetraparetic. Based on the neurologic findings a multifocal central nervous system
disorder affecting mainly the left cerebrum and the spinal cord at the level of the right
cervical intumescence was suspected. Abdominal ultrasound demonstrated moderate
hepatomegaly, small adrenal glands, corticomedullary rim sign involving the kidneys
bilaterally, and urinary bladder sediment consistent with chronic cystitis. Magnetic
resonance imaging (MRI) of the brain was done. Additional T1transverse images
were acquired. On the PW and T2W images, a large, irregularly shaped region of
increased signal intensity, affecting mainly the white matter of the left parietal and
temporal lobes of the cerebrum, was observed. The right lateral ventricle appeared
dilated.
Examination of a smear preparation from the biopsy sample revealed numerous pig
mented fungal hyphae. The sample was hypercellular,with numerous macrophages,
some neutrophils, reactive gemistocytic astrocytes, and large multinucleated giant
cells. Histopathology of the biopsy sample revealed multifocal areas of malacia with
dense aggregates of macrophages, and perivascular infiltrates of lymphocytes and
plasma cells. Fungal hyphae, 7–9 _m wide, pigmented light brown to green, and
septate were seen. A presumptive diagnosis of a phaeohyphomycosis due to
Cladophialophora bantiana was made.
(a) T2-weighted transverse image of the brain of a dog with systemic phaeohyphomycosis. Note the irregular area of increased
signal intensity in cerebral white matter extending from the falx to the left parietal and temporal lobes of the cerebrum. The large
area of increased signal intensity in these lobes corresponds to the location of the fungal granuloma. A pronounced right shift of
structures toward the midline is present, as well as a compression of the left lateral ventricle. Bar _ 12 mm. (b) Precontrast T1weighted (T1W) transverse magnetic resonance image illustrating the same large, irregular area of decreased signal intensity,
causing right deviation of the falx cerebri and loss of volume of the left lateral ventricle. Bar _ 12 mm. (c) Postcontrast T1W
transverse magnetic resonance image illustrating the large hypointense, irregular lesion, which is nonuniformly
contrastenhancing. Bar _ 12 mm. Añor
et al. (2001)
284
Large numbers of macrophages and multinucleated cells are observed. Fungal hyphae are branching,
pigmented, and septate structures. Hematoxylin and eosin stain. Bar _ 14 _m., fungal granuloma with
central necrosis. , fungal granuloma demonstrating the inner rim of viable fungal hyphae. Gomori
methenamine silver stain.Bar _ 20 _m. Añor et al. (2001).
Herráez et al. (2001) reported a 2-year-old female Boxer dog with a history of skin
lesions that started 1 month after being given oral glucocorticoids for a neurologic
problem. Clinically, the animal had focal areas of alopecia with papules and nodules
often with ulceration overlain by crusts. Lesions were most common on the dorsum
and the lateral aspects of the trunk and extremities. Histologic evaluation revealed
pigmented fungal organisms within the lumina of hair follicles and throughout the
dermis and subcutis. These organisms were associated with a multinodular,
pyogranulomatous luminal folliculitis/furunculosis, dermatitis, and panniculitis.
Curvularia sp. was isolated from the cutaneous lesions. The histologic identification
of dematiaceous fungal organisms in the hair follicles may explain
how phaeohyphomycosis can occur without history of a penetrating injury.
1.Skin; dog. Granulomatous lesion in the deep dermis. Central aggregate of brown, pleomorphic
hyphae surrounded by epithelioid-like macrophages, multinucleated giant cells, and lymphocytes. HE.
Bar = 70 µm. 2. Skin; dog. Dematiaceous fungus within the keratin of follicular infundibulum. HE. Bar
= 20 µm, Herráez et al. (2001)
3.Skin; dog. Pyogranulomatous perifolliculitis. Numerous fungi are present in the follicular
infundibulum. A septate hypha is present in the wall of the outer sheath (arrowhead). Notice the brown
fungus near the hair follicle, with a dilatation similar to a chlamydospore. The organisms varied from
dark brown to devoid of pigment (arrow). HE. Bar = 40 µm.4.Skin; dog. Intrafollicular fungi stained
285
black. Staining is limited to the cell walls of hyphae. The etiologic agent is pleomorphic, with dilated
structures similar to chlamydospores (arrowhead). Fontana–Masson. Bar = 30 µm, Herráez et al.
(2001)
Singh et al. (2006) presented a 5-year-old Shetland Sheepdog with a history of
weakness, ataxia, anemia, thrombocytopenia, and occasional seizures. The dog had
been treated for 6 months with prednisone for inflammatory bowel disease. A positive
titer for Ehrlichia canis was detected 6 months before referral. The initial physical
examination revealed a weak, laterally recumbent dog with pale mucous membranes.
Neurologic examination revealed multiple neurologic deficits. A complete blood cell
count (CBC) revealed normochromic, normocytic, nonregenerative anemia;
lymphopenia; thrombocytopenia; and neutrophilic and monocytic leukocytosis.
Urinalysis revealed proteinuria, with a specific gravity of 1.045. The dog was
unresponsive to treatment and died. At necropsy, there was severe serofibrinous
peritonitis and pleuritis, with randomly scattered dark brown necrotic foci present in
multiple organs, including liver, spleen, kidney, and pancreatic lymph node.
Histologically, there were extensive regions of parenchymal necrosis surrounded by
neutrophils admixed with epithelioid macrophages, lymphocytes, and pigmented
fungal organisms. Numerous brown, 2 to 6 microm in diameter, septate, branching
hyphae, subsequently identified as Ochroconis gallopavum (formerly Dactylaria
constricta var. gallopava), were observed.
Swift et al. (2006) reported a 7-year-old castrated male Whippet that developed
deep ulcerative skin lesions whilst receiving immunosuppressive doses of
prednisolone and cyclosporine for the treatment of immune-mediated haemolytic
anaemia. The lesions were determined to be a phaeohyphomycosis, caused by
Curvularia lunata. The dog was treated with a combination of systemic antifungals
and weaning off immunosuppressants and made a complete recovery. To the authors'
knowledge, this is the first case report of the successful treatment of disseminated
cutaneous phaeohyphomycosis in a dog.
The distal limbs of a 7-year-old castrated male Whippet presenting with skin lesions 16 days after
initiation of immunosuppressive therapy for immune-mediated haemolytic anaemia. Similar
lesions were present on all four limbs, the neck, face and trunk. Swift et al. (2006)
286
Histopathological section of skin biopsies taken from skin affected by phaeohyphomycosis,
stained with haemotoxylin and eosin, demonstrating pyogranulomatous reaction, with fungal
hyphae visible (arrows) within the tissue. b. A similar section of skin as in (a), stained with
Gomori’s methenamine silver stain, showing the fungal elements within the tissue. . Swift et al.
(2006)
a.
Plantar surface of right foot, day 60. A draining sinus is present under the third digit. Bone could
be seen protruding from this lesion. Radiograph of right foot, day 60, demonstrating severe lysis
of the distal second phalanx and proximal third phalanx of the third digit. A pathological
fracture/luxation is present at this joint. Swift et al. (2006)
287
Photograph taken during toe amputation. Black fungal pigmentation in subcutaneous tissue can
be seen along the incision line (arrow). a and b. Photographs of healed lesions of distal limbs, day
190. The extent of previous lesions can be clearly seen. Swift et al. (2006)
Sutton et al. (2008) reported Phialemonium curvatum, as a new agent of
pulmonary phaeohyphomycosis in a Standard Poodle dog.In vitro susceptibility
data, for both human and animal isolates, suggests resistance to amphotericin B and
susceptibility to the triazole agents itraconazole, voriconazole, and posaconazole.
Potato flakes agar plate, 8 weeks at 25°C, showing area of slide culture preparation on the right,
and an undisturbed colony on the left. Salmon to brownish-yellow, moist, raised sporodochial
areas are seen throughout the culture. Sutton et al. (2008)
Microscopic morphology of a young, immature sporodochium after 7 days growth at 25°C on
potato flakes agar. Figure depicts short adelophialides (reduced phialides lacking a basal septum),
black arrow, as well as longer phialides delimited by basal septa as seen in Acremonium species,
Sutton et al. (2008)
Dedola et al. (2010) reported a 4-year-old, ovariohysterectomized, English springer
spaniel on immunosuppressive therapy for 3 months receiving 1.3 mg/kg
288
prednisolone and 2.6 mg/kg ciclosporin, both administered orally twice daily.
Physical examination revealed hepatomegaly and multiple, purulent, crusting, erosive
to ulcerative lesions over different body areas. Onychorrhexis had occurred on one
digit and the underlying corium had blackened. There were two proliferative and one
plaque-like lesions in the mouth. Thick walled fungal hyphae were detected in
impression smears from all skin lesions and staining with periodic acid-Schiff's stain
confirmed the presence of multiple fungal hyphae and spores in all biopsies
examined. Fungal culture isolated a heavy, pure growth of an Alternaria sp. which
was identified as A. infectoria by sequencing the internal transcribed spacer 1 region
of the rRNA gene. The animal's condition prevented detailed investigation of the oral
lesions. Withdrawal of the ciclosporin and reduction of the prednisolone dosage
resulted in spontaneous resolution of the skin lesions within 40 days. Further gradual
decrements in the prednisolone dosage to zero were carried out without recurrence of
the immune-mediated haemolytic anaemia. After 12 months, there has been no
recurrence of either the skin lesions or the anaemia. To the authors' knowledge, this is
the first reported case of A. infectoria infection in a dog.
The largest skin lesion, covered with crust and draining a small amount of purulent exudate, The left
forefoot showing a number of erosive and crusty lesions and, on the fourth digit, onychorrhexis and
blackening of the corium (arrow), Nasal lesion 40 days after initial presentation. Dedola et al., 2010
Cytology from the ulcer on the thigh showing thick walled fungal hyphae surrounded by degenerate
neutrophils with intracellular cocci visible in some of them. Modified Wright ⁄ Giemsa stain,
magnification ・ 1000., Histopathology from the lesion on the lateral left thigh.Note the extensive
ulceration and the diffuse inflammatory infiltrate extending from the dermis down into the sub-dermal
fat layer. Haematoxylin and eosin stain, magnification ・ 40. Bar = 100 lm., Histopathology from the
ulcerated lesion on the lateral left thigh. Note the presence of many fungal hyphae and sporulating
body-like forms in the section. Periodic acid–Schiff stain, magnification ・ 400. Bar = 20 lm. . Dedola
et al., 2010
Bentley et al. (2011) reported a 12-month-old castrated male Boxer with signs of
acute, progressive intracranial disease. Cytologic and histologic findings were
consistent with an intracranial fungal granuloma in the right cerebral hemisphere.
Fungal culture yielded a Cladophialophora sp. The granuloma was surgically
debulked to remove infected brain tissue and the avascular purulent core.
Postoperatively, the patient was treated with fluconazole (2.3 mg/kg [1 mg/lb], PO, q
12 h) for 4 months, followed by voriconazole (3.4 mg/kg [1.5 mg/lb], PO, q 12 h) for
a further 10 months. The outcome was considered excellent on the basis of resolution
289
of neurologic signs and a lack of evidence of recurrence of the granuloma during
magnetic resonance imaging and CSF analysis 8 months after surgery. Magnetic
resonance imaging and CSF analysis 9 weeks after administration of antifungal
medications was discontinued (16 months after surgery) confirmed resolution.
Giri et al. ( 2011) reported a case of Bipolaris infection in a dog with granulomatous
meningoencephalitis, nephritis, and vasculitis. The clinical and histological
features resembled those of the more common aspergillosis, thus warranting
confirmation by molecular methods. Polymerase chain reaction and sequence analysis
identified Bipolaris from the brain lesion, indicating its involvement in the disease. To
the authors' knowledge, this is the first reported case of meningoencephalitis caused
by this fungus in a domestic animal.
1. Cerebrum; dog. Focally extensive rarefaction in the neuropil has progressed to cavitation
(arrowheads) in the cerebral gray matter. HE.2. Cerebrum; dog. Multiple discrete angiocentric
granulomas focally replace cerebral parenchyma. HE.3. Cerebrum; dog. Leptomeninges are
expanded by edema and numerous leukocytes. A meningeal vessel has mural infiltration by
numerous macrophages, lymphocytes, plasma cells, and rare multinucleated giant cells
(arrowhead). HE.4. Cerebrum; dog. Higher magnification of the vessel wall in Fig. 3. Numerous
inflammatory cells include a multinucleated giant cell with cytoplasmic fungal hyphae (arrowhead).
HE.5. Cerebrum; dog. Fungal hyphae (arrowheads) are in the inflammatory exudate in a vessel
wall. Grocott’s methenamine silv. 6.Agarose gel electrophoresis of polymerase chain reaction–
amplified fungal rDNA: ITS3 and ITS4. Lane 1, 1 Kb DNA ladder (numbers on the left are in
kilobases); lane 2, test sample; lane 3, positive control (Candida albicans); lane 4, kidney from an
age-matched dog with no history of fungal infection; lane 5, no template control. Giri et al.
( 2011)
6.6.2. Reports on Phaeohyphomycoses in cats
291
Muller et al. (1975) reported a slowly evolving subcutaneous mycosis in a 10-yearold domestic shorthair cat caused by Drechslera spicifera, the imperfect state of
ascomycete Cochliobolus spicifer. The cat had circular, nodular, granulomatous
lesions over its sternum. Scattered individual and small groups of septate hyphae and
chlamydospores were found in histologic sections. Many of the hyphae also had
bizarre dilatations. Most of the fungal elements were hyaline; a few, however, were
dematiacious. Because the fungus was not organized into granules in tissue, the
disease could not be classified as a mycetoma. The preferred name for infections of
this type was phaeohyphomycosis.
Haschek and Kasali (1977) described a case of severe focal granulomatous
dermatitis in a 10-year-old neutered male domestic short-haired cat due to a
dematiaceous fungus, Phialophora gougerotii . The infection was believed to be
secondary to squamous cell carcinoma of the nasal septum.
Bostock et al. (1982) reported a rapidly growing subcutaneous nodule excised from
the nose of an 8-year-old domestic shorthair cat. It was found to be a fungal
granuloma caused by Exophiala jeanselmei.
McKenzie et al. (1984) isolated Moniliella suaveolens in pure culture from
histologically typical phaeohyphomycotic granulomas containing dematiaceous fungi
in two cats. One cat had several slow-growing black lesions up to 2 cm in diameter in
the abdominal subcutis. These lesions recurred after surgical excision was attempted.
The second cat had a single black subcutaneous 0.5 X 1.5-cm lesion near one
dewclaw. This lesion was successfully removed surgically without recurrence. M.
suaveolens has not been isolated previously from lesions in animals including man.
Pukay and Dion (1984) treated 2 cats with phaeohyphomycosis, one infected with
Phialophora verrucosa and the other with Exophiala jeanselmei, with ketaconazole
alone and in combination with 5-fluorocytosine after recurrence of the infections
following surgical excision. The drugs were given orally at various doses and for
various lengths of time, but were ineffective. Hepatocellular damage occurred in one
cat.
Subcutaneous nodule caused by Exophialajeanselmei.Cells of E. jeanselmei inside a giant cell.
H & E. X250. Pukay and Dion (1984)
291
Sousa et al. (1984) reported subcutaneous phaeohyphomycosis caused
Stemphylium sp and Cladosporium sp in a cat.
by
Shinwari et al. (1985) reported a cat with cerebral phaeohyphomycosis associated
with Cladosporium bantianum.
Dillehay et al. (1987) reported Cerebral phaeohyphomycosis in a 6-year-old male
castrated Persian cat had a 3 week history of intermittent ataxia, lethargy, and
occasional episodes of circling to the left with right-sided hemiparesis. Antibiotics
and steroids resulted in temporary improvement. Chest and cranial radiographs were
normal. Electroencephalograms suggested encephalitis involving the left frontal lobe.
During anesthesia to obtain cerebrospinal fluid, the cat died. At necropsy, gross
lesions were seen only in the brain. Microscopically, lesions varied from abscesses,
some of which were encapsulated by thick fibrous tissue, to less discrete and often
coalescing foci of pyogranulomatous inflammation. Within epithelioid and
multinucleated giant cells, and extracellularly, were moderate numbers of septate,
pigmented hyphae 3-6 pm in width. Hyphae were light brown to basophilic in
hematoxylin and eosin (HE)-stained sections and had parallel contoured walls with
occasional branching. Hyphae were also within blood vessels, some of which were
thrombosed. There was multifocal suppurative meningitis and diffuse
pyogranulomatous ependymitis with hyphae in the lateral ventricles.
Phaeohyphomycotic lesions were not present in extraneural sites. C. bantianum was
grown in culture
Cerebral Phaeohyphomycosis a cat, brain with midline shift (edema) and extensive pigmented
lesion in left frontal cortex. brown septate hyphae, 1-3 pm in width, and conidiophores
bearing long, branched chains o fconidia 2.5 x 5-7 pm of C. bantianum, , Dillehay et al.
(1987) vet.sagepub.com
Dhein et al. (1988) diagnosed phaeohyphomycosis caused by Alternaria alternata in
a 6-year-old cat. A lesion in the nose resulted in enlargement of the dorsum of the
nose. Similar appearing lesions had been removed from the dorsum of the nose 1 and
4 years earlier. The lesion recurred 3 months after surgical excision and irregular
administration of ketoconazole. A second cytoreductive operation followed by 5
months' treatment with ketoconazole resolved the infection. Nasal trauma occurring at
8 months and at 5 years before initial examination may have predisposed the cat to
development of the Alternaria infection.
292
VanSteenhouse et al. (1988) isolated Scolecobasidium humicola from
granulomatous lesions on the tail and foot of a cat. The paw lesion, of 2 years
duration, had recurred after surgical debridement and antibiotic therapy. In tissue
sections of the biopsy, S. humicola was observed in the form of broad, septate,
dematiaceous hyphal elements and thick-walled, chlamydoconidium-like cells. The
cat was successfully treated with ketoconazole and has since shown no signs of
recurrence. This is the first record of S. humicola being an etiologic agent
of phaeohyphomycosis in a mammalian host.
Kettlewell et al. (1989) isolated Exophiala spinifera from a cutaneous lesion on the
paw of a male domestic shorthair cat and from the nasal exudate and abscess contents
from a female domestic shorthair cat. Treatment with ketoconazole (10 mg kg-1
daily) resulted in improvement in the first cat but unfortunately this animal was
subsequently lost to follow-up. The second cat was treated initially by the same
regimen without apparent benefit. The dose of ketoconazole was subsequently
increased but finally had to be discontinued when the cat developed signs of
hepatotoxicity. At this stage treatment with flucytosine (150 mg kg-1 daily) was
commenced. The cat improved and cultures of nasal exudate performed 8 and 16
weeks after initiation of 5-fluorocytosine therapy were negative for E. spinifera.
However, the condition recurred with granulomatous tissue appearing in each nostril
and abscess formation with subsequent rupture occurring on the bridge of the nose
when therapy was withdrawn. These two cases constituted the first report of E.
spinifera infection in animals and of this fungal infection in Australia.
Roosje et al. (1993) reported the first case of phaeohyphomycosis in a cat caused by
Alternaria infectoria, which was isolated from several cutaneous nodules. The cat
was treated with itraconazole .
Outerbridge et al. (1995) reported a 10-year-old, neutered male domestic shorthair
with a small cutaneous nodule (approximately 5 mm diameter) on the inner aspect of
the left pinna, near the lateral margin. The nodule was smooth, dark red-purple,
turgid, and non-painful on palpation. The only other physical abnormalities noted
were mild gingivitis, moderate dental tartar, and absence of the left upper canine tooth
and several incisor teeth. Aspiration of the pinnal mass yielded a small amount of
serosanguinous fluid. Cytological examination of air-dried preparations stained with
May-Griinwald-Giemsa revealed inflammatory cells (predominantly degenerate
neutrophils, monocytes, and macrophages, with occasional multinucleated giant cells
and plasma cells) and fungal organisms. Fungal hyphae predominated and were
irregular, septate, branched, and approximately 2 to 4 pm wide; fungal cells were
round, thick-walled, and ranged from 15 to 30 pm in diameter. Some of the fungal
organisms were present within macrophages. Cytological diagnosis was
pyogranulomatous inflammation due to fungal infection of unknown identity with
pathological hemorrhage. Most of the fungal organisms were brown to black on
staining with Fontana-Masson The organism's identity was later confirmed as
Alternaria alternata, when the isolate sporulated lightly on tap water agar after 4 wk.
Fuchs et al. (1997) reported a 5.5-year-old, male, feline leucosis virus-positive cat that
developed a concurrent dermatophytosis due to Microsporum canis and a subcutaneous
infection due to Staphylotrichum coccosporum. St. coccosporum caused mycetoma-like
lesions. The fungal elements revealed features like those seen in phaeohyphomycosis. Until
now St. coccosporum has been described to be non-pathogenic. The pathogenicity of St.
coccosporum was corroborated by experimental infection.
293
Granuloma in the subcutis containing clusters of fungal elements Fuchs et al. (1997)
Budding spore, endospores, pseudohypha and septate hypha of Staphylotrichum
coccosporum,
Fuchs et al. (1997)
Fondati et al. (2001) reported the first report of a case of
feline phaeohyphomycosis due to Fonsecaea pedrosoi in a cat. The lesion was
confined to the skin and appeared as a firm swelling on the bridge of the nose.
Diagnosis was based on histological examination of a cutaneous biopsy and fungal
culture of a tissue sample on Sabouraud's dextrose agar. Further diagnostic tests failed
to reveal an underlying immunosuppression. Two treatment cycles with itraconazole,
at the oral dose of 5 mg kg-1 given twice daily, induced complete clinical remission,
but relapses occurred.
Feline phaeohyphomycosis due to Fonsecaea pedrosoi. Swelling on the bridge of the nose. Photo reproduced from A Practical
Guide to Dermatology, © 1999 Merial.
294
Histopathology. Numerous, slightly brown-pigmented, periodic acid Schiff (PAS)-positive fungal elements (PAS 400).
Histopathology. Brown-pigmented, thick-walled yeastlike fungal cells (arrowhead) and irregularly septate hyphae (arrow)
surrounded by macrophages, neutrophils, plasma cells and lymphocytes (H&E 400).
A velvety, olive green fungal colony of Fonsecaea pedrosoi cultured on Sabouraud’s dextrose agar.
Slide culture of Fonsecaea pedrosoi. Conidial structures ‘Rhinocladiella type’ bearing two rows of conidia, (a) one playing the
role of conidiogenuos cell and (b) one conidial structure ‘Cladosporium type’. Phialides ‘Phialophora type’ are shown in (c).
Slide culture of Fonsecaea pedrosoi. Flask-shaped phialide of Phialophora type (arrow).
McKay et al. (2001) presented a 10-year-old male domestic shorthaired cat with a
chronic, slowly enlarging subcutaneous mass on the right side of its nose. The cat had
been treated medically with various drugs. Oral itraconazole had been the most
effective in reducing the size of the mass, but had caused hepatotoxicity and had to be
withdrawn. The mass was finally removed surgically, and a diagnosis of
granulomatous cellulitis caused by Alternaria alternata (phaeohyphomycosis) was
established, based on histopathology and fungal isolation. There has been no
recurrence of the lesion after 21 months and the cat remains clinically well at the time
of writing.
Cat at the tlme of presentatlon to ENT Referrals (Aprlll999), Cat three months after surgery (colour
variation la an exposure artefact)
295
Sectlon of nasal subcutaneous tissue showing dlffuse macrophage accumulation and a single lymphold
aggregate (arrow). Haematoxylln & eosln (H&E) X 140, Variably shed fungal hyphae have a surrounding
capsule and globular expansions along their length (arrows). Grocott-Gomorl X S60
Abramo et al. (2002) described a case of feline cutaneous phaeohyphomycosis due
to Cladophyalophora bantiana. The cat was presented with breathing difficulty and a
swollen, ulcerated nodule on the dorsal nose and left nostril. Histological examination
of the nodule revealed a cystic granulomatous dermatitis characterised by neutrophils,
macrophages and giant cells. Pigmented, yeast-like fungus cells and hyphal elements
were easily identified in haematoxylin-eosin stained tissue sections.
Cladophyalophora bantiana was isolated from a tissue specimen. This organism,
primarily known to cause cerebral infection in humans and cats, only rarely causes
cutaneous infection. Despite anti-fungal chemotherapy two relapses occurred. The cat
was feline immunodeficiency virus- and feline leukemia virus-negative and even if
the owner was unaware of trauma, the hypothesis of wound contamination is the most
likely.
Bouljihad et al. (2002) necropsied a 6-month-old, castrated male domestic cat with
progressive neurological signs of 2-3 weeks duration. Macroscopic findings were
restricted to the brain and included irregularly shaped, well-delineated but
unencapsulated areas of intense black pigmentation involving the rostral portion of
both cerebral hemispheres. Microscopically, numerous brown, oblong, segmented
branching hyphae and conidial-like structures and extensive pyogranulomatous
inflammation were identified throughout the cerebral lesion and in adjacent blood
vessels. Hyphae and oval conidia were best demonstrated with either Gomori
methenamine silver or periodic acid-Schiff stain. Fungal infection in the brain of this
cat was unrelated to any concurrent immunodeficiency syndrome or
immunosuppressive treatment. This report deals with a case of
cerebral phaeohyphomycosis from which a different species of dematiaceous fungus,
Cladophialophora bantiana, was isolated and identified.
Mariani et al. (2002) presented two domestic shorthair cats presented for clinical
signs related to multifocal central nervous system dysfunction. Both cats had signs of
vestibular system involvement and anisocoria, and one had generalized seizure
activity. Cerebrospinal fluid analysis revealed a neutrophilic pleocytosis with protein
elevation in one cat and pyogranulomatous inflammation in the second.
Electroencephalography and brain-stem auditory-evoked potentials in the first cat
confirmed cerebral cortical and brain-stem involvement. Euthanasia was performed in
both cats, and postmortem diagnoses of phaeohyphomycosis secondary to
Cladosporium spp. were made based on histopathology and fungal culture in
both cats.
296
Elies et al. (2003) reported a case of fatal systemic mycosis in a 9-year-old cat.
Diagnosis of phaeohyphomycosis was made by histology. Morphological and
molecular identification of the fungus isolated from the lesions yielded the species
Cladophialophora bantiana. The lesions were widespread, distributed without the
involvement of central nervous system. The origin of systemic manifestation is still
unknown and no evidence of immunosuppression was found. It is the first feline case
of C. bantiana infection reported in Europe.
Cytological aspect of abdominal fluid: non-degenerate neutrophils mixed with some macrophages. A single
pigmented fungal hyphae is visible within a macrophage. MGG, 1 cm ¼ 13 lm. Abdominal cavity at necropsy: all
serosal surfaces are covered by a black granular substance. Necrotic foci are scattered throughout the liver.
Liver: high power view showing numerous pigmented and septate hyphae in a necrotic area. HES, 1 cm ¼ 19 lm
Beccati et al. (2005) reported a case of phaeohyphomycosis caused by Phialophora
verrucosa as the first European case in a cat
Knights et al. (2008) reported a case of phaeohyphomycosis caused by Ulocladium
species in a cat.
Maeda et al. (2008) demonstrated black nodule measuring 1 cm in diameter in the
base of nail of an 8-year-old Japanese domestic male cat. Histological examination of
the excised nodule revealed a granulomatous lesion extending from the epidermis to
adjacent bone. The lesion consisted of diffuse infiltration of macrophages with
epithelioid cells and multinucleated giant cells. These macrophages contained a few to
numerous yeast-like brown pigmented fungus cells with a spherical shape and dark
297
thick wall. The PCR amplification with universal primers of the 28S ribosomal RNA
gene yielded a 628-bp fragment and the direct sequence confirmed that the diagnosis
of the lesion was phaeohyphomycosis caused by the pathogenic dematiaceous fungus,
Exophiala jeanselmei.
Miller (2010) investigated IDEXX Laboratories database of cases submitted from the
UK between March 2005 and February 2008 (36 months) for feline nodular
granulomatous skin disease associated with fungal infection. Cytological and/or
histological slides were reviewed and the diagnosis was based on the microscopic
pattern of the inflammatory response and morphology of the causative organism.
Aetiological
diagnoses
were
hyalohyphomycosis
(64
of
77
cases), phaeohyphomycosis (five of 77 cases) and dermatophytic pseudomycetoma
(eight of 77 cases). All cases of hyalohyphomycosis were suspected to be alternariosis
based on common features including anatomical distribution of lesions (48 of 64 cases
involved the nostril and bridge of nose, face and ears), pattern of histological changes,
morphology of the causative organism and results of fungal culture (Alternaria three
of 16 and 'saprophyte' nine of 16 cases). Cases of phaeohyphomycosis were
demographically and histologically similar to those of alternariosis, except the
causative organisms were deeply pigmented brown and had a variety of morphologies
that were different from Alternaria. Dermatophytic pseudomycetomas had a
characteristic histological pattern including the presence of fungal microcolonies or
grains within the tissue. These occurred most often on the trunk (five of eight cases)
and four of eight cases were in Persian cats. These findings indicate that alternariosis
is by far the most common nodular fungal skin disease of cats in the UK.
Photomicrograph: Cytology of hyalohyphomycosis. Neutrophils (N) and macrophages (M) containing
pleomorphic fungal hyphae (^) are mixed with small numbers of erythrocytes. Wright–Giemsa stain.
Bar = 20 lm.Photomicrograph: Histology of hyalohyphomycosis. Numerous macrophages contain
nonpigmented fungal organisms showing filamentous and spherical forms (^). Small numbers of
neutrophils (N) are also present. H&E. Bar = 30 lm. Miller (2010)
298
Photomicrograph: Histology of phaeohyphomycosis. Numerous macrophages and giant cells contain
pigmented fungal organisms showing filamentous and spherical forms (^). Small numbers of
neutrophils (N) are also present. H&E. Bar = 30 lm. Photomicrograph: Histology of dermatophytic
pseudomycetoma. A fungal microcolony (^) embedded in Splendore-Hoeppli reaction is surrounded by
giant cells (G) with neutrophils (N) and macrophages (M) in the periphery. H&E. Bar = 60 lm. Miller
(2010)
Evans et al. (2011) reported a 12-year-old cat with a history of insulin-dependent
diabetes mellitus with a pulmonary granuloma caused by Cladophialophora
bantiana. Thoracic radiographs revealed consolidation of the right caudal lung lobe
and cytology confirmed the presence of mycotic pneumonia. Results of clinical
investigations showed no evidence of extra-pulmonary infection. A thoracotomy and
lung lobe resection was performed. Histological examination of the mass revealed
black pigmented fungal hyphae and pyogranulomatous inflammation. Cultures
inoculated with portions of these tissues yielded a dark walled fungus consistent with
an etiologic agent of phaeohyphomycosis and DNA sequencing confirmed the
presence of Cladophialophora bantiana. The cat was treated with itraconazole for 4
weeks post-operatively and then with posaconazole for 7 months but was euthanized
13 months after initial diagnosis due to a hepatocellular carcinoma. On post-mortem
examination there was no evidence of recurrent fungal infection. This is the first
report of localized pulmonary C. bantiana infection in a cat.
299
Resected lung lobe with black pigmented edges. Evans et al. (2011)
References:
5. Abramo F, Bastelli F, Nardoni S, Mancianti F. Feline
cutaneous phaeohyphomycosis due to Cladophyalophora bantiana. J Feline Med
Surg. 2002 Sep;4(3):157-63.
6. Añor S, Sturges BK, Lafranco L, Jang SS, Higgins RJ, Koblik PD,LeCouteur RA. Sy
stemic phaeohyphomycosis (Cladophialophora bantiana) in a dog: clinical diagnosis
with stereotactic computed tomographic-guided brain biopsy. J Vet Intern
Med 15:257–261, 2001
7. Beccati M, Vercelli A, Peano A, Gallo MG. Phaeohyphomycosis by Phialophora
verrucosa: first European case in a cat. Vet Rec. 2005 Jul 16;157(3):93-4.
8. Bentley RT, Faissler D, Sutherland-Smith J. Successful management of an
intracranial phaeohyphomycotic fungal granuloma in a dog.J Am Vet Med
Assoc. 2011 Aug 15;239(4):480-5.
9. Bostock DE, Coloe PJ, Castellani A. Phaeohyphomycosis caused by Exophiala
jeanselmei in a domestic cat. J Comp Pathol. 1982 Jul;92(3):479.
10. Bouljihad M Lindeman CJ, Hayden DW. Pyogranulomatous meningoencephalitis
associated with dematiaceous fungal (Cladophialophora bantiana) infection in a
domestic cat. J Vet Diagn Invest. 2002 Jan;14(1):70-2.
11. . Dedola C, Stuart AP, Ridyard AE, Else RW, van den Broek AH, Choi JS, de Hoog
GS, Thoday KL. 2010. Cutaneous Alternaria infectoria infection in a dog in
association with therapeutic immunosuppression
12. Dhein CR, Leathers CW, Padhye AA, Ajello L. Phaeohyphomycosis caused by
Alternaria alternata in a cat. J Am Vet Med Assoc. 1988 Nov 1;193(9):1101-3.
13. Dillehay DL, Ribas JL, Newton JC Jr, Kwapien RP. Cerebral Phaeohyphomycosis in
Two Dogs and a Cat Vet. Pathol. 24:192-194 (1987)
14. Elies L, Balandraud V, Boulouha L, Crespeau F, Guillot J. Fatal
systemic phaeohyphomycosis in a cat due to Cladophialophora bantiana. J Vet Med A
Physiol Pathol Clin Med. 2003 Feb;50(1):50-3.
15. Evans J, Levesque D, de Lahunta A, Jensen HE. Intracranial fusariosis: a novel cause
of fungal meningoencephalitis in a dog. Vet Pathol. 2004 Sep;41(5):510-4.
311
16. Evans N, Gunew M, Marshall R, Martin P, Barrs V. Focal pulmonary granuloma
caused by Cladophialophora bantiana in a domestic short haired cat. Med
Mycol. 2011 Feb;49(2):194-7
17. Fondati A, Gallo MG, Romano E, Fondevila D. A case of
feline phaeohyphomycosis due to Fonsecaea pedrosoi. Vet Dermatol. 2001
Oct;12(5):297-301.
18. Fuchs A, Breuer R, Axman H, Zuckermann A, Kuttin ES. Subcutaneous mycosis in a
cat due to Staphylotrichum coccosporum. Mycoses. 1996 Sep-Oct;39(9-10):381-5.
19. Giri DK, Sims WP, Sura R, Cooper JJ, Gavrilov BK, Mansell J. Cerebral and
renal phaeohyphomycosis in a dog infected with Bipolaris species. Vet Pathol. 2011
May;48(3):754-7.
20. Haschek WM, Kasali OB. A case of cutaneous feline phaeohyphomycosis caused by
Phialophora gougerotti. Cornell Vet. 1977 Oct;67(4):467-71.
21. Herráez P, Rees C, Dunstan R. Invasive phaeohyphomycosis caused by Curvularia
species in a dog. Vet Pathol. 2001 Jul;38(4):456-9.
22. Kettlewell P, McGinnis MR, Wilkinson GT. Phaeohyphomycosis caused by
Exophiala spinifera in two cats. J Med Vet Mycol. 1989;27(4):257-64.
23. Knights CB, Lee K, Rycroft AN, Patterson-Kane JC, Baines SJ.
Phaeohyphomycosis caused by Ulocladium species in a cat. Vet Rec. 2008 Mar
29;162(13):415-6.
24. Lomax LG, Cole JR, Padhye AA, Ajello L, Chandler FW, Smith BR.
Osteolytic phaeohyphomycosis in a German shepherd dog caused by Phialemonium
obovatum. J Clin Microbiol. 1986 May;23(5):987-91.
25. McKay JS, Cox CL, Foster AP. Cutaneous alternariosis in a cat. J Small Anim
26.
Pract. 2001 Feb;42(2):75-8.
Maeda H, Shibuya H, Yamaguchi Y, Miyoshi T, Irie M, Sato T. Feline
digital phaeohyphomycosis due to Exophiala jeanselmei. J Vet Med Sci. 2008
Dec;70(12):1395-7.
27. Mariani CL, Platt SR, Scase TJ, Howerth EW, Chrisman CL, Clemmons RM.
Cerebral phaeohyphomycosis caused by Cladosporium spp. in two domestic
shorthair cats. J Am Anim Hosp Assoc. 2002 May-Jun;38(3):225-30.
28. McKenzie RA, Connole MD, McGinnis MR, Lepelaar R.
Subcutaneous phaeohyphomycosis caused by Moniliella suaveolens in two cats. Vet
Pathol. 1984 Nov;21(6):582-6.
29. Migaki G, Casey HW, Bayles WB. Cerebral phaeohyphomycosis in a dog. J Am Vet
Med Assoc. 1987 Oct 15;191(8):997-8.
30. Miller RI. Nodular granulomatous fungal skin diseases of cats in the United
Kingdom: a retrospective review. Vet Dermatol. 2010 Apr;21(2):130-5.
31. Miller DM, Blue JL, Winston SM. 1983. Keratomycosis caused by Cladosporium sp
in a cat. J. Am. Vet. Med. Assoc. 182:1121–1122.
32. Muller GH, Kaplan W, Ajello L, Padhye AA. Phaeohyphomycosis caused by
Drechslera spicifera in a cat. J Am Vet Med Assoc. 1975 Jan 15;166(2):150-4.
33. Outerbridge CA, Myers SL, Summerbell RC. Phaeohyphomycosis in a cat. Can Vet
J. 1995 Oct;36(10):629-30.
34. Pukay BP, Dion WM. Feline phaeohyphomycosis: treatment with ketaconazole and
5-fluorocytosine. Can Vet J. 1984 Mar;25(3):130-4.
311
35. .Reed C, Fox JG, Campbell LH. 1974. Leukaemia in a cat with concurrent
Cladosporium infection. J. Small Anim. Pract. 15:55– 62.
36. Roosje PJ, de Hoog GS, Koeman JP, Willemse T. Phaeohyphomycosis in a cat
caused by Alternaria infectoria E. G. Simmons. Mycoses. 1993 Nov-Dec;36(1112):451-4.
37. Schroeder H, Jardine JE, Davis V. Systemic phaeohyphomycosis caused by
Xylohypha bantiana in a dog. J S Afr Vet Assoc. 1994 Dec;65(4):175-8.
38. Shinwari MW, Thomas AD, Orr JS. Feline cerebral phaeohyphomycosis associated
with Cladosporium bantianum. Aust Vet J. 1985 Nov;62(11):383-4.
39. Singh K, Flood J, Welsh RD, Wyckoff JH, Snider TA, Sutton DA. Fatal
systemic phaeohyphomycosis caused by Ochroconis gallopavum in a dog (Canis
familaris). Vet Pathol. 2006 Nov;43(6):988-92.
40. Sousa CA, Ihrke PJ, Culbertson R. Subcutaneous phaeohyphomycosis (Stemphylium
sp and Cladosporium sp infections) in a cat. J Am Vet Med Assoc. 1984 Sep
15;185(6):673-5.
41. Sutton DA, Wickes BL, Thompson EH, Rinaldi MG, Roland RM, Libal MC, Russell
K, Gordon S. Pulmonary Phialemonium curvatum phaeohyphomycosis in a Standard
Poodle dog. Med Mycol. 2008 Jun;46(4):355-9.
42. Swift IM, Griffin A, Shipstone MA. Successful treatment of disseminated
cutaneous phaeohyphomycosis in a dog. Aust Vet J. 2006 Dec;84(12):431-5.
43. VanSteenhouse JL, Padhye AA, Ajello L. Subcutaneous phaeohyphomycosis caused
by Scolecobasidium humicola in a cat. Mycopathologia. 1988 May;102(2):123-7.
7. Eumycetoma in cats and dogs
Eumycetoma is a rare form of fungal infection in humans and animals as well. The
lesions are characterized by tumefaction, draining sinuses and the presence of grains,
which are composed of fungal hyphae, differentiating this disease from
actinomycetoma, where the grains are made of filamentous bacteria.
Eumycetoma is rare in dogs. It was reported in the United States, Korea, Australia,
India, South Africa, Israel and France. The pathogens are diverse, including
Curvularia geniculata, C. lunata, Scedosporium apiospermum, Aspergillus terreus,
Madurella mycetomatis and Cladophialophora bantiana.
Reports:
Allison et al. (1989) diagnosed an abdominal eumycotic mycetoma caused by
Pseudallescheria boydii in a 3-year-old male Siberian Husky. The dog was examined
because of weight loss and signs of depression. Initially, pyrexia was the only clinical
finding. Antibiotic and corticosteroid treatment was ineffective. Two weeks later, the
dog's appetite had decreased, it had vomited a few times, and the caudal portion of the
abdomen was sensitive to palpation. Hematologic and serum biochemical
abnormalities consisted of anemia, leukocytosis, hypoglycemia, hypoalbuminemia,
hyperglobulinemia, and high alkaline phosphatase activity. One week later, the dog's
condition continued to worsen, and testicular swelling was observed. The dog was
castrated. Microscopic examination of specimens obtained at surgery revealed
pyogranulomatous periorchitis with mycetoma granules. Ketoconazole treatment was
312
initiated and continued until the dog died one month later. Necropsy revealed
multifocal duodenal ulcers, with transmural pyogranulomatous enteritis, pancreatitis,
and peritonitis. This case is unique because the etiologic agent apparently entered via
the intestinal tract rather than by contamination of an external wound.
Elad et al. (1991) cultured Curvularia lunata from black granules found in
granulomatous tumefactions excised from the subcutis of a three year old Medium
Schnauzer dog. Draining sinuses were present in some of the tumefactions.
Accordingly the diagnosis of eumycotic mycetoma was made. This diagnosis was
confirmed by histopathological examination. During the four years following the first
surgical intervention, several more similar tumefactions were excised on three
different occasions. The dog died of chronic renal failure at the age of 8 years. There
was no bone involvement or visceral diffusion of the fungus. The granules were
examined by scanning electron microscopy. Immunoglobulins in the dog's serum,
assessed by a qualitative test, proved to be equal to immunoglobulins in the serum of
a control dog. Precipitating antibodies against C. lunata were not found. The dog was
treated for 150 days with itraconazole. In spite of good initial results, recurrence of
the fungal lesions were observed after the treatment's interruption. Further treatment
with itraconazole for 45 days proved ineffective. No side effects of the drug were
observed.
Lambrechts et al. (1991) removed a uterine stump granuloma surgically from a
sterilized bitch. Histopathology and fungal culture revealed Madurella mycetomatis
eumycetoma. Infection may have occurred through a cesarean wound dehiscence.
Long-term fluconazole therapy was instituted but failed to arrest and eliminate the
infection.
Guillot et al. (2004) reported a case of eumycetoma due to Cladophialophora
bantiana in a 3-year-old male Siberian Husky. The dog presented a tumefaction on
the thorax and deformity of the second and third subjacent ribs, which were surgically
removed. Macroscopic black granules were visible on the ribs, and direct microscopic
examination revealed their fungal origin. Cultures yielded pure colonies of C.
bantiana. The identification of the causative agent was confirmed after amplification
and sequence analysis of fungal internal transcribed spacers 1 and 2 and 5.8S
ribosomal DNA regions. Surgery and antifungal treatment with oral itraconazole
associated with flucytosine allowed apparent cure after a 10-month follow-up.
Envenomation with pine processionary caterpillars (Thaumetopoea pityocampa) and
subsequently intensive corticotherapy were considered as possible predisposing
factors. This is, to the best of our knowledge, the first case in which C. bantiana is
identified as the causative agent of eumycetoma.
313
(Top left) One of the two ribs surgically removed. Note the deformity of the bone and the presence of
numerous black grains. (Top right) Direct examination of one grain in Amann lactophenol. Brown
septate hyphae with vesicles, toruloid filaments, and swollen granular thick-walled and budding cells
are visible. (Bottom left) Hematoxylin and eosin stain showing a fungal grain in histological section of
the bone. Fungal hyphae growing toward the periphery of the black grain and vesicles are clearly seen.
(Bottom right) Microscopic aspect of C. bantiana. Lateral and terminal conidiophores of various sizes.
Unicellular long chains of smooth, lemon-shaped conidia are produced. Guillot et al. (2004)
Rajeev et al. (2006) described a phaeohyphomycotic condition of the skin caused by
Fonsecaea pedrosoi is described in a dog. The dog had lesions on the ventral
abdomen. Tissue sections stained with Grocott-Gomori methenamine silver stain
showed hyphae characteristic of dematiaceous fungi. Macro and microscopic features
of colonies grown on Sabouraud dextrose agar were identical with that of Fonsecaea
pedrosoi.
314
A, dog presented with lesions on the ventral abdomen. B, tissue sections showing the presence of
hyphae Grocott-Gomori methenamine silver stain. 400X. C, fungal colonies growing on Sabouraud
dextrose agar. D, lactophenol cotton blue stain of the fungal isolate. 400X Rajeev et al. (2006)
Sun et al. (2013) reported a 5-year-old castrated male Maltese with multiple
subcutaneous nodules measuring ca. 1–2 cm with draining fistulae on the abdomen.
Small black grains were drained from the fistulae. Medical history of the Maltese
showed that he had received surgeries for an intestinal foreign body obstruction in
2007 and an umbilical hernia and castration in 2009. The diagnosis of eumycetoma
was made. The patient received liquid nitrogen cryotherapy every week and oral
antifungal of itraconazole 5 mg kg). The nodules persisted after 3 weeks of treatment.
The grains were collected by a sterile swab and subjected for microscopic
examination and culturing.The grains were composed of a dense mat of septate
brown hyphae and chlamydospores by microscopy. The oral itraconazole of the same
dosage was continued for another 4 months. Due to persistence of the lesions, surgical
excision of the abdominal lesion was performed under general anaesthesia. During the
operation, bouts of soft tissue mixed with small black grains emerged multifocally
from the subcutis. The culture yielded Cladophialophora bantiana
The grain was composed of a dense mat of septate pigmented, hyphae and chlamydospores, Bouts
of soft tissue mixed with small black grains emerged from the subcutis of the abdominal wall during
operation, Sun et al. (2013)
315
septate hyphae and large chlamydospores arranged in an arcuate manner with PAS stain (400・). The
grains taken out from the abdominal wall were black, fragile and rough-surfaced by stereoscopym Sun
et al. (2013)
The fungus had ovoid conidia with an inconspicuous scar in coherent chains born terminally or
laterally from vegetative hyphae (400・). Sun et al. (2013)
Zambelli and Griffiths (2015) described a 6-year-old neutered male feline
immunodeficiency-positive cat with repeated abdominal and thoracic effusions. The
cat was diagnosed with and treated for lymphosarcoma but remission was short-lived
and, on re-evaluation, a fungal peritoneal exudate was noted. Cytology of the
organisms is described and the culture elucidated Cladosporium carrionii, an
important cause of chromoblastomycosis. Treatment with itraconazole was
unsuccessful in this case.
References:
1. Allison N, McDonald RK, Guist SR, Bentinck-Smith J. Eumycotic mycetoma caused by
Pseudallescheria boydii in a dog. J Am Vet Med Assoc. 1989 Mar 15;194(6):797-9.
2. Elad D, Orgad U, Yakobson B, Perl S, Golomb P, Trainin R, Tsur I, Shenkler S, Bor A.
Eumycetoma caused by Curvularia lunata in a dog. Mycopathologia. 1991
Nov;116(2):113-8.
3. Guillot J, Garcia-Hermoso D, Degorce F, Deville M, Calvié C, Dickelé G, Delisle
F, Chermette R. Eumycetoma caused by Cladophialophora bantiana in a dog. J Clin
Microbiol. 2004 Oct;42(10):4901-3.
4. Lambrechts N, Collett MG, Henton M. Black grain eumycetoma (Madurella
mycetomatis) in the abdominal cavity of a dog. J Med Vet Mycol. 1991;29(3):211-4.
5.
Rajeev S, Clifton G, Watson C, Miller D. Fonsecaea pedrosoi skin infection in a dog. J
Vet Diagn Invest. 2008 May;20(3):379-81.
316
6. Sun PL, Peng PC, Wu PH, Chiang YL, Ju YM, Chang CC, Wang PC. Canine
eumycetoma caused by Cladophialophora bantiana in a Maltese: case report and literature
review. Mycoses. 2013 May;56(3):376-81.
7. Zambelli
AB, Griffiths
CA.
South
African
report
of
first
case
of chromoblastomycosis caused by Cladosporium (syn Cladophialophora) carrionii
infection in a cat with feline immunodeficiency virus and lymphosarcoma. J Feline Med
Surg. 2015 Apr;17(4):375-80.
8. Pythiosis in cats and dogs
Pythiosis is a chronic pyogranulomatous infection of the gastrointestinal tract or skin
caused by Pythium insidiosum. Pythium insidiosum is an oomycete pathogenic to
mammals. The infection occurs mainly in tropical and subtropical areas, particularly
in horses, dogs and humans. Infection is acquired through small wounds via contact
with water that contains motile zoospores or other propagules (zoospores or hyphae).
The disease has been described since 1884. Depending on the site of entry, infection
can lead to different forms of pythiosis i.e. a cutaneous, vascular, ocular,
gastrointestinal and a systemic form, which is rarely seen. The infection is not
contagious; no animal-animal or animal-human transmission has been reported so far.
Therapy includes radical surgery, antifungal drugs, immunotherapy or a combination
of these therapies. The prevention to contract the disease in endemic areas is difficult.
Avoiding stagnant waters could be of help, although the presence of P. insidiosum on
grass and soil in enzootic areas renders this practice useless (Gaastra et al., 2010)
a.
i.
Forms of reported pythiosis
Gastrointestinal pythiosis: (Miller,1985, Fischer et al., 1994,
Helman and Oliver, 1999, Graham et al.,2000, Liljebjelke et al., 2002,
Mendoza et al., 2005, Rakich et al., 2005, Berryessa et al., 2008, Pereira et
al.,2010, Hummel et al., 2011, Connolly et al., 2012, Fernandes et al., 2012,
Martins et al., 2012, Schmiedt et al., 2012, Pereira et al., 2013, Aeffner et
al., 2015)
ii.
Cutaneous/Subcutaneous pythiosis: (Bentinck-Smith et al.,1989,
Howerth et al.,1989, Dykstra et al., 1999, Hensel et al., 2003, Thieman et
al.,2011, Martins et al., 2012, Oldenhoff et al., 2014)
iii.
b.
Prostatic pythiosis: (Jaeger et al., 2002, Liljebjelke et al., 2002)
Aetiology
Pythium insidiosum De Cock, L. Mendoza, A.A. Padhye, Ajello & Kaufman,
Journal of Clinical Microbiology 25 (2): 345 (1987)
Synonym:
=Hyphomyces destruens C.H. Bridges & C.W. Emmons, Journal of the American
Veterinary Medical Association 138 (11): 588 (1961)
317
Classification
Chromista, Oomycota, Oomycetes, Pythiales, Pythiaceae, Pythium
Description
Cultures (CMA) expanding, white, flat, submerged. Hyphae 4-6 ?m wide, irregularly
branched (branches 2.5-4.0 ?m diam), sparsely septate in wider hyphae, locally
disarticulating. Club-shaped appressoria present. Zoosporangia undifferentiated,
filamentous, with two lateral flagella. Sexual organs (Oogonia) intercalary,
subspherical, 23-30 ?m wide. Antheridia produced from adjacent hyphae, clavate,
terminally up to 10 ?m wide.Optimal development at 35°C, maximum growth
temperature 45°C.
Culture of P. insidiosum. Mycology online Colony of P. insidiosum (4 days old) on SGA
(A to C) Zoospore production inside the zoosporangium at time intervals of 3 min. (D to F)
Rapid release of zoospores. dailyparasite.blogspot.com .
c.
Reports
Miller (1985) studied 63 cases of canine gastrointestinal phycomycosis, of which 60
were determined to have pythiosis and 3 to have entomophthoromycosis. In pythiosis,
male, large-breed dogs less than or equal to 3 years old were most commonly
affected. Clinical signs usually included vomiting and weight loss and these were
associated with lesions of the stomach and small intestine. Histologically, the
causative organisms were found in necrotic regions of diffuse or discrete granulomas
in the submucosa or muscularis mucosae. Entomophthoromycosis was diagnosed by
finding wide eosinophilic sleeves intimately surrounding thin-walled hyphae. Less
than 5% of the dogs were alive 3 months following diagnosis.
Bentinck-Smith et al. (1989) isolated Pythium insidiosum from the subcutaneous
tissue of a 1-year-old tan crossbreed dog and from the intestinal tract of an 18-monthold Samoyed male. Gomori's methenamine silver stain was superior to hematoxylin
and eosin in demonstrating the organism in tissue sections. The agent was identified
318
as P. insidiosum by zoospore formation in an aqueous yeast extract solution
containing grass blades. Exoantigens produced in culture were shown to be identical
to known P. insidiosum antigens by microimmunodiffusion.
Howerth et al. (1989) reexamined a 2-year-old, female, walker hound because a nonhealing cutaneous lesion on the left lateral thorax was nonresponsive to antibiotic
therapy. The lesion, which was 15 cm in diameter and had a central draining tract, had
been progressive for 1 month. A 4-cm-long elliptical. sional biopsy was obtained from
the lesion. A portion of, biopsy was fixed in 10% buffered formalin for
histopathology and a portion was frozen for fungal culture. The case was diagnosed as
subcutaneous pythiosis
subcutaneous pythiosis in a dog, Howerth et al. (1989)
Fischer et al. (1994) examined formalin-fixed tissue samples from 11 dogs with
gastrointestinal pythiosis. The average age of the dogs was 2.5 years, 8 of 11 were
female, and several large and small breeds were represented. Clinical histories were
typified by chronic anorexia, weight loss, vomiting, and diarrhea. The tissue samples
were collected during exploratory celiotomy or necropsy and were identified by the
submittors as masses or neoplasms of the gastrointestinal tract or associated tissues.
Microscopic examination of hematoxylin and eosin (HE)- stained tissue sections
revealed severe multifocal pyogranulomatous inflammation in the mucosa,
submucosa, and/or both. The diagnosis was confirmed by an indirect
immunoperoxidase technique specific for Pythium. Rabbit serum containing primary
319
antibody specific to Pythium antigen was applied to formalin-fixed tissue sections,
which were subsequently stained using an avidin-biotin immunoperoxidase technique
and examined microscopically. Negative controls with no primary antibody were run
with all samples. Follow-up investigation of these dogs revealed that all had died
within 2 months of the onset of clinical signs.
Pyogranulomatous inflammation in the small intestine of a dog with gastrointestinal pythiosis
Branching hyphae of Pythium insidiosum within the center of a pyogranuloma in the small intestine of
a dog with gastrointestinal pythiosis. Grocott’s methenamine silver, HE counterstain Fischer et al.
(1994)
Dykstra et al. (1999) retrieved information regarding signalment, duration of clinical
signs, history of swimming, results of CBC and serum biochemical analyses, biopsy
findings and mycological results, together with treatments and outcome from the
medical records of 15 dogs with a diagnosis of pythiosis made between 1985 and
1995 at the Colleges of Veterinary Medicine, North Carolina State University and the
University of Florida. Most of the dogs were young (median age 22 months) and
represented larger breeds (> 20 kg). Lesions were characteristically chronic, ulcerated,
and nodular with multiple draining tracts on the limbs, thoracic wall or perineal
regions. The median duration of these lesions was 3 months with a range of 2 weeks-6
months. Seven dogs had a history of swimming. Peripheral eosinophilia was observed
in 14 of the dogs. Cytological evaluation of discharge, aspirates, or impression smears
made from biopsy specimens revealed hyphae in five of 11 dogs (45%).
Histopathological evaluation using the Gomori Methenamine-Silver (GMS) stain was
the most useful test for providing presumptive evidence of cutaneous pythiosis.
Immunotherapy or antifungal therapy using either amphotericin B, liposomal nystatin,
itraconazole, or ketoconazole were all unsuccessful. The only dog to survive
underwent amputation of the affected limb; thus, the prognosis for
cutaneous pythiosis in the dog is poor.
311
Lesion on the medial aspect of the surface of the left pelvic limb of dog c2. The lesion was
erythematous, with multiple sites of serum exudation. Thoracic lesion from dog c1, showing the larger
mass with an ulcerated surface on the right cranioventral thorax. The scar from the previous surgery is
visible (arrow). Dykstra et al. (1999)
Gomori Methenamine-Silver (GMS) stained section of haired canine skin showing numerous hyphae in
skin (note hair follicle in upper right). Size bar near follicle equals 10 mm; 330_. Dykstra et al.
(1999)
Helman and Oliver (1999) diagnosed enteric pythiosis in nine dogs in Oklahoma.
Eight dogs had anorexia and weight loss. Two of these dogs had diarrhea; two dogs
exhibited vomiting and diarrhea; and one dog had vomiting. One dog presented with
dysphagia. Seven dogs had either a palpable or radiographically visible abdominal
mass. These seven dogs had localized regions of mucosal ulceration and thickened
gastric or intestinal walls with some involvement of the adjacent mesentery or
omentum. Two dogs had enlarged regional mesenteric lymph nodes. One dog that
presented with dysphagia had an oropharyngeal mass involving the larynx and cranial
esophagus. Microscopically, there was transmural chronic sclerosing and
granulomatous to pyogranulomatous inflammation with arteritis. Pythium spp. were
identified in all specimens by immunohistochemistry.
Willard and Radlinsky (1999) performed a retrospective study to determine whether
endoscopic examination of the choanae resulted in diagnosis of various diseases in 91
dogs and 27 cats with signs of respiratory tract disease. Medical records were
reviewed for endoscopy findings and results of examination of biopsy or cytologic
specimens. 34 animals had neoplasia in the choanal region; in 26 animals, diagnosis
was confirmed by evaluation of specimens obtained by endoscopy. Five dogs with
neoplasia had an erroneous diagnosis of rhinitis made on the basis of evaluation of
specimens obtained by endoscopy. Six dogs and 2 cats had foreign objects in the
choanae; 7 foreign objects were removed endoscopically, whereas 1 required nasal
flushing. Results of endoscopy and biopsy of the choanae provided diagnosis of
cryptococcosis and aspergillosis, but did not aid in the diagnosis of pythiosis or nasal
mites.
Graham et al. (2000) reported the ultrasonographic features of nine dogs with
gastrointestinal pythiosis. The stomach, duodenum, jejunum or colon were affected.
All dogs had thickening of the gastrointestinal wall and areas with obliteration of the
normal layered appearance. In one dog an eccentric mass was found arising from the
serosal surface of the wall of the colon with mild diffuse wall thickening. Regional
311
lymph node enlargement was seen in seven of the nine dogs. One dog had invasion of
the pancreas and signs compatible with extrahepatic biliary obstruction. When
compared to previous reports of gastrointestinal neoplasia, the features of wall
thickening, loss of layering and regional lymphadenopathy are not considered specific
for gastrointestinal pythiosis. Histological examination of tissue specimens is required
for diagnosis.
Sagittal plane image of the body of the stomach of dog five. There IS mild thickening of the stomach
wall (6 mm) which is uniformly hypoechoic. Graham et al. (2000)
Sagittal plane image of the body of the stomach of dog nine. The stomach wall is moderately thickened
(+ = 15.5 mm) and the normal layers are obliterated. Transverse image of the distal descending colon
of dog six. The wall of the colon is moderately thickened, measuring 10 mm in places. In this area, the
layers are blurred but still visible. Graham et al. (2000)
312
Transverse image of the distal descending colon of dog two. An eccentric mixed echogenic mass
(arrows) is seen arising from the wall of the colon. The wall of the colon is mildly thickened with intact
albeit blurred layers except in the area from which the mass arises. Sagittal plane image of the py,oric
antmm of the stomach of dog four. The wall is circumferentially moderately to severely thickened,
ranging from 9.8 mm to 18,4 mm in thickness in this image, The layers are obliterated. Graham et al.
(2000)
Sagittal plane image of the descending duodenum and pancreas of dog four. The pancreas is enlarged,
hypoechoic and irregularly marginated (arrows). The peripancreatic fat is hyperechoic, Transverse
image of the descending duodenum and common bile duct of dog four obtained using an intercostal
approach. The wall of the duodenum is moderately thickened (+ = 9 mni) and no layers are visible. The
common bile duct is dilated (X = 12 mm). Graham et al. (2000).
Jaeger et al. (2002) reported a case of prostatic pythiosis in a dog with a wellencapsulated mass, which was adhered dorsally to an approximately 8-cm area of the
colon but did not involve the adjacent urinary tract. The colon showed multifocal
granulomas, separated by layers of fibrous connective tissue, which expanded and
replaced a focally extensive area of the wall of the colon. The inflammatory process
did not extend to the mucosal surface. Deep to this area, the chronic inflammatory
process was contiguous with the prostatic mass. The granulomas presented
intralesional hyphae of the oomycete Pythium insidiosum. The hyphal structures were
irregularly branching, non-septate, non-parallel walls and often have smudgy,
indistinct outlines in histologic preparations.
313
Prostatic mass; dog. The well-encapsulated mass was adhered dorsally to an approximately 8-cm area
of the colon but did not involve the adjacent urinary tract (left). Bar _ 1 cm. Colon; multifocal
granulomas (arrows), separated by layers of fibrous connective tissue, expand and replace a focally
extensive area of the wall of the colon. Note that the inflammatory process does not extend to the
mucosal surface. Deep to this area, the chronic inflammatory process is contiguous with the prostatic
mass. Hematoxylin and eosin staining. Bar _ 1.5 mm, Jaeger et al. (2002)
Detail of one of the granulomas, with intralesional hyphae of the oomycete Pythium insidiosum. The
hyphal structures have irregularly branching, nonseptate, nonparallel walls and often have smudgy,
indistinct outlines in histologic preparations. Gomori’s methenamine silver staining. Bar _ 40 _m.
Histologic section demonstrating granulomatous prostatitis with multinucleated giant cells (Langhans’
type). Hematoxylin and eosin staining. Bar _ 50 _m. Jaeger et al. (2002)
Liljebjelke et al. (2002) reported a 4-year-old castrated male Irish Setter with
prostatomegaly and chronic progressive tenesmus of 8 months’ duration. One week
before presentation to the NCSU-VTH, stranguria and hematuria were noted in
addition to tenesmus. Abdominal radiographs and abdominal ultrasonography before
referral identified an enlarged prostate (8 by 8 by 15 cm) in the pelvic canal extending
into the abdominal cavity. Multiple areas of spondylosis of the caudal thoracic and
lumbar spine also were present. On abdominal ultrasonography, the prostatic capsule
was thickened, and multiple cavitations were observed within the prostate gland
without evidence of mineralization. Fine-needle aspirates of the prostate gland
obtained under ultrasound guidance showed chronic suppurative inflammation,
including moderate numbers of degenerate neutrophils and necrosis with numerous
non-septate fungal hyphae present. Cytologic samples stained with Gomori’s
methenamine silver (GMS) were positive for fungal elements. Portions of resected
prostatic tissue were submitted for fungal culture and histopathology.The final
diagnosis was intestinal pythiosis.
Hensel et al. (2003) reported a 4-year-old Labrador Retriever with
2 ulcerative
nodular cutaneous lesions. One lesion was located on the medial aspect of the right
carpus; the other was located on the medial aspect of the left tarsus. The dog had
spent its entire life in the southeastern part of the United States and approximately
half of its time outdoors with free access to a nearby lake. Histologic examination of
314
full-thickness wedge biopsy specimens from both lesions revealed severe, multifocal,
puruloeosinophilic to pyogranulomatous deep dermatitis with intralesional
filamentous structures, fibroplasia, and neovascularization. Examination of sections
stained with Gomori methenamine silver stain revealed a moderate number of wide,
bulbous, irregularly septate, branching hyphae. Results of an immunodiffusion test
and an ELISA for anti-Pythium insidiosum antibodies were positive. Amputation was
eliminated as a treatment option because lesions involved 2 limbs. Long-term
systemic antifungal treatment was also rejected because of the cost, lack of
therapeutic effect in many cases, and potential for adverse effects. The dog was
treated with 2 doses of an anti-P insidiosum vaccine administered 2 weeks apart. One
month later, the lesions were nearly completely healed, and values obtained via the
immunodiffusion test and ELISA had decreased. Results of the immunodiffusion test
and ELISA were negative 1 year later, and the dog had not had any recurrences.
Mendoza et al. (2003) evaluated the immunotherapeutic properties of a new Pythium
insidiosum-vaccine formulation (PIV) in 6 dogs with proven pythiosis from different
enzootic areas in the United States. Dogs with chronic disease (greater than two
months) did not responded to immunotherapy. The finding of eosinophils, mast cells,
IgE and precipitin IgG during pythiosis suggested that a T helper 2 (Th2) subset is in
place during this disease.
Mendoza et al. (2005) reported an 11-months-old mixed Terrier male originally from
Venezuela with signs of depression, anorexia, vomiting and diarrhea. The illness had
begun 1 month earlier. Despite antibiotic chemotherapy and vitamins, the disease
progressed. Radiological exams showed involvement of the small intestine.
Histopathological studies of tissue samples taken during surgical intervention
revealed eosinophilic areas in the center of which, abundant eosinophils, histiocytes
and giant cells were observed. Silver stained cross-sections of the small intestine
showed slender sparsely septate hyphae within the necrotic areas. Attempts to isolate
the etiologic agent in pure culture were fruitless. The dog died without a definitive
diagnosis. Fixed tissue samples of the small intestine were later investigated using
specific fluorescent antibodies for pythiosis and molecular tools. These exams
indicated that the hyphae in the infected tissues belong to Pythium insidiosum.
Rakich et al. (2005) reported 2 young adult male Domestic Shorthair cats living in
the southeastern United States with a palpable abdominal mass in each animal.
Exploratory laparotomy revealed a large extraluminal mass involving the ileum and
mesentery with adjacent mesenteric lymphadenopathy in cat No. 1 and an abscessed
mass in the distal duodenum in cat No. 2. Mass resection and intestinal anastomosis
were performed in both cats. Histologic evaluation indicated that the intestinal lesions
involved primarily the outer smooth muscle layer and serosa and consisted of
eosinophilic granulomatous inflammation with multifocal areas of necrosis. In
Gomori methenamine silver-stained sections, broad (2.5-7.5 microm), occasionally
branching, infrequently septate hyphae were observed within areas of necrosis. A
diagnosis of Pythium insidiosum infection was confirmed in both cats by immunoblot
serology and by immunoperoxidase staining of tissue sections using a P. insidiosumspecific polyclonal antibody. Cat No. 1 was clinically normal for 4 months after
surgery but then died unexpectedly from an unknown cause. Cat No. 2 has been
clinically normal for at least 9 months after surgery and appears to be cured on the
basis of follow-up enzyme-linked immunosorbent assay serology.
315
Intestinal mass; cat No. 1. A, small intestine with an inflammatory mass that extends from the serosal
surface. The mucosa, submucosa, and inner muscular layer of the tunica muscularis are normal. HE. B,
a focus of eosinophilic inflammation surrounds necrotic debris and hyphal ‘‘ghosts.’’ HE. Bar 5 25
mm. Rakich et al. (2005)
Intestinal mass; cat No. 1. A, hyphae within areas of necrosis are contorted, have nearly parallel walls,
measure 2.5–7.5 mm in diameter, are occasionally branching, and have rare septa. GMS. Bar 5 15 mm.
B, cat No. 2, numerous hyphae are present with the wall of a medium-sized artery. GMS. Bar 5 25 mm.
Rakich et al. (2005)
Intestinal mass; cat No. 1 A and cat No. 2 B. Hyphae of Pythium insidiosum are well delineated with
the immunohistochemical stain. Numerous hyphae are present within the wall of an artery (B). Avidin–
biotin–peroxidase method with polyclonal anti–P. insidiosum antibody. Mayer hematoxylin
counterstain. Bar 5 25 mm. Intestinal mass; cat No. 1 A and cat No. 2 B. Hyphae of Pythium
insidiosum are well delineated with the immunohistochemical stain. Numerous hyphae are present
within the wall of an artery (B). Avidin–biotin–peroxidase method with polyclonal anti–P. insidiosum
antibody. Mayer hematoxylin counterstain. Bar 5 25 mm. Rakich et al. (2005)
316
Immunoblot analysis demonstrating the ability of serum from cat No. 1 as well as from a healthy cat to
recognize antigens of Pythium insidosum (P. in), a canine pathogenic Lagenidium species (L. sp.),
Basidiobolus ranarum (Bas), and Conidiobolus coronatus (Con). Markers on left indicate molecular
weight in kilodaltons. Rakich et al. (2005)
Berryessa et al. (2008) conducted a study to describe the clinicopathologic and
epidemiologic findings associated with GI pythiosis in 10 dogs from California.
Dogs were initially identified on the basis of supportive clinical findings and routine
histology. Pythiosis was confirmed in each dog with at least one of the following:
immunoblot
serology,
enzyme-linked
immunosorbent
assay
serology,
immunohistochemistry, and culture followed by species-specific polymerase chain
reaction, rRNA gene sequencing, or both. Between September 2003 and December
2006, GI pythiosis was confirmed in 1 dog from central California and 9 dogs that
lived within a 30-mile radius of Davis, CA. Seven of 8 dogs for which environmental
data were available had frequent access to flooded rice fields or other water sources.
Esophageal lesions were present in 2 of 10 dogs. Common laboratory findings
included eosinophilia (7/9), hypoalbuminemia (9/9), and hyperglobulinemia (8/9).
Median survival time was 26.5 days (range, 0-122 days), and the disease was
ultimately fatal in all 10 dogs.
Esophagram showing an esophageal mass and resultant stricture in a dog with esophageal pythiosis.
317
Esophagus. Gross photograph of transverse section. There is severe, circumferential, mural thickening
with subsequent narrowing of the esophageal lumen. The mucosal surface is ulcerated, Berryessa et
al. (2008)
Pereira et al. (2010) reported a case of concurrent cutaneous and
gastrointestinal pythiosis in an 18-month-old female Labrador. This dog had an
ulcerative cutaneous lesion on the right thoracic region for 12 months that was
unresponsive to itraconazole and terbinafine therapy. Two months prior to death and
concurrent with the cutaneous lesion, the dog became anorexic with frequent vomiting
and bloody stools. At necropsy, a cutaneous lesion that extended subcutaneously into
the intercostal muscles was observed. Additionally, the large intestine contained two
lesions that caused luminal narrowing. Organs were collected, routinely processed and
stained using hematoxylin and eosin and Gomori methenamine silver. Histological
examination of the lesions in the large intestine and on the skin revealed areas of
necrosis surrounded by a pyogranulomatous infiltrate. Occasionally, black, septate,
branching hyphae were detected following staining with Gomori methenamine silver.
The diagnosis of pythiosis was confirmed using immunohistochemical methods. This
report describes the occurrence of concomitant gastrointestinal and cutaneous lesions
in a dog and highlights the therapeutic difficulties encountered with this disease
Cutaneous pythiosis in Labrador. It was observed a well delimited, ulcerated, alopecic area in right
lateral thoracic region, Intestinal pythiosis in Labrador. It was observed two masses in intestine wall
(arrows), Intestinal pythiosis in Labrador. Hyphae strongly immunomarked. Immunohistochemical
procedure using polyclonal antibody anti-Pythium insidiosum. Bar = 50 µm Pereira et al. (2010)
Hummel et al. (2011) described a case of canine gastrointestinal pythiosis in which
lesions were resolved through the administration of itraconazole, terbinafine, and the
agricultural fungicide mefenoxam. No substantial adverse effects occurred in
association with administration of the latter compound. Additional studies are needed
to evaluate the pharmacokinetics of mefenoxam and to further assess its tolerability
and potential efficacy for the treatment of pythiosis in dogs.
(A) Granuloma formation with extensive inflammatory infiltration of tunica muscularis in the
duodenum (hematoxylin and eosin stain, original magnification × 200). (B) Hyphae with non-parallel
walls that lack septation and exhibit infrequent branching (Gomori methenamine silver stain, original
magnification × 600), Hummel et al. (2011)
318
Thieman et al. (2011) reported a 4-year-old spayed female Boxer with a cutaneous
mass of approximately 10 cm in diameter located on the dorsum. The mass had been
present for 6 weeks and was increasing in size. Computed tomography of the
abdomen and the mass were performed and revealed a contrast-enhancing soft tissue
mass of the dorsum and enlarged intra-abdominal lymph nodes. The dog underwent
surgical excision of the cutaneous mass, including 5-cm skin margins and deep
margins of 2 fascial planes. The mass was completely excised on the basis of results
of histologic examination of surgical margins. The dog received itraconazole and
terbinafine by mouth for 3 months following surgery. Recheck examination at 20
months postoperatively showed no signs of recurrence of pythiosis at the surgical site.
Connolly et al. (2012) reported a 4-year-old male neutered Labrador Retriever with
severe gastrointestinal signs and multifocal pyogranulomatous gastritis, enteritis, and
lymphadenitis with intralesional hyphae and multifocal pyogranulomatous pneumonia
with intralesional yeast. Based on cytologic evaluation, histologic examination with
special stains, and immunohistochemical analysis of tissues collected antemortem or
at necropsy, dual infections with Pythium insidiosum and Blastomyces dermatitidis
were detected and are reported for the first time.
Fine-needle aspirate of a gastric lymph node from a dog, showing parallel-walled, negative-staining
hyphae consistent with Pythium insidiosum or Lagenidium spp. Modified Wright–Giemsa, 920
objective. Markedly thickened ventral wall of the duodenum found at necropsy of a dog with
pyogranulomatous enteritis. Connolly et al. (2012)
319
Histologic sections of duodenum from a dog with pyogranulomatous enteritis. (A) Note a granuloma
with many neutrophils, few macrophages, and low numbers of multinucleated giant cells. H&E, 940
objective. (B) Rare nonstaining hyphal structures with blunt rounded ends (arrow) are present. H&E,
9100 objective. (C) Silver staining highlights more hyphal structures. Gomori methenamine silver, 960
objective. (D) Hyphae are immunoreactive for anti-Pythium insidiosum antibody. Avidin-biotin
immunoperoxidase, 960 objective. Connolly et al. (2012)
Histologic section of lung from a dog with pyogranulomatous pneumonia. 9100 objective. Note yeast
structures consistent with Blastomyces dermatitidis in sections stained with H&E (A) and periodic
acid-Schiff (B). (C) Organisms are immunoreactive for anti-Blastomyces dermatitidis antibody.
Alkaline phosphatase red and hematoxylin, Connolly et al. (2012)
Fernandes et al. (2012) described the symptoms, pathological changes and diagnosis
methods of gastric pythiosis in a three-year-old female German shepherd with
vomiting and recurrent diarrhea of 30 days of duration. A palpable mass in the
abdomen filling the left epigastric region was identified in the clinical examination.
Simple and contrasted radiological examination and ultrasound of abdominal cavity
were performed. The animal was referred for exploratory laparotomy for the removal
of the mass. The extent of the mass prevented from the excision and the animal was
euthanized. Samples of the tumor mass were collected and sent for morphological
study and immunohistochemistry. The changes observed in imaging studies were
consistent with gastric pythiosis. In cytology and histopathology, non-septate hyphae
were identified, and in immunohistochemistry a strong positivity of anti-Pythium
antibodies was observed, confirming the diagnosis of pythiosis.
Martins et al. (2012) reported 9 cases of pythiosis in dogs. The aetiology in all cases
was confirmed by immunohistochemistry. Data related to the clinical course and
outcome and localization of the lesions were obtained from pathology reports.
Affected dogs had gastrointestinal and/or cutaneous lesions with either or both of a
granulomatous/pyogranulomatous or necrotizing eosinophilic inflammatory reaction.
The number of intralesional hyphae, the distribution of hyphae, the presence of
angioinvasion and the nature of the local inflammatory reactions were associated with
the different types of lesions observed.
321
Schmiedt et al. (2012) examined a 1.5-year-old mixed-breed dog because of a 1-
month history of anorexia, vomiting, diarrhea, and weight loss. The dog was very thin
on physical examination. Results of all diagnostic tests were within reference limits
except intestinal thickening and lymphadenopathy were identified on abdominal
ultrasound examination. During exploratory laparotomy, thickening at the ileocecalcolic junction and within the transverse colon and mesenteric lymphadenopathy were
identified, and the ileocecal-colic junction was resected. Histopathologic evaluation of
the ileocecal-colic junction and full-thickness biopsy specimens from other sites as
well as results of a serum ELISA were diagnostic for gastrointestinal Pythium
insidiosum infection. Pythiosis was initially treated medically with administration of
itraconazole and terbinafine by mouth, but the colonic lesion was progressive with
this regimen. Two months after diagnosis, a subtotal colectomy was performed;
marginal excision (0.6 cm) was obtained at the aboral margin. The dog was treated
with 3 doses of a pythiosis vaccine beginning approximately 2 weeks after surgery
and was continued on itraconazole and terbinafine for 5 months. Parenteral and
enteral nutrition as well as considerable general supportive care were required
postoperatively. Six months after treatment, the dog had a normal serum ELISA titer.
Two years after treatment, the dog had returned to preoperative weight and was
clinically normal.
Pereira et al. (2013) described a 2.5-year-old male beagle initially showed sporadic
vomiting episodes, and this symptom became more frequent 5 months after the onset
of clinical signs. Celiotomy procedure found thickness of the stomach wall extending
to the pylorus and duodenum. A biopsy was performed, and the diagnosis
of pythiosis was made by mycological, histopathological analyses and molecular
identification. Therapy was based on an association of terbinafine plus itraconazole
during 12 months and immunotherapy for 2.5 months. The healing of the dog reported
here allows us to propose the use of immunotherapy associated with antifungal
therapy to treat canine gastrointestinal pythiosis. However, additional studies should
be performed on a larger number of patients to establish a standard treatment protocol
for canine pythiosis.
Ultrasonography of gastrointestinal pythiosis in a beagle dog. Left image examination before starting
the dog’s treatment. Notice the stomach wall thicknesses (1.6 cm). Right image examination performed
4 months after ending the treatment. Observe the thickness difference between the stomach wall with
normal standard (0.4 cm) (right image) and altered stomach wall (left image), Pereira et al. (2013)
321
Gastrointestinal pythiosis in a beagle dog. Exploratory laparotomy demonstrating an intense thickening
of the wall of the pyloric region of the stomach. Immunohistochemistry assay was performed using a
polyclonal anti-P. insidiosum antibody, and the immunostained P. insidiosum hyphae were strongly
distinguished, Pereira et al. (2013)
Oldenhoff et al. (2014) reported the clinicopathological findings associated with
cutaneous pythiosis in two dogs from a Northern temperate climate zone. The first
dog was a 3-year-old intact male Chesapeake Bay retriever with an ulcerated softtissue swelling over the left eye. The second dog was a 4-year-old spayed female
German shepherd dog with a soft-tissue swelling overlying the right hock.
Both dogs lived in northern latitudes (between 43 and 45°N) and neither had travelled
outside of Wisconsin or Michigan's upper peninsula, USA. Histopathological
examination and culture of affected tissues on specialized media, serology for antiP. insidiosum antibodies, P. insidiosum-specific PCR and ribosomal RNA gene
sequencing were carried out. Histopathological examination revealed
pyogranulomatous and eosinophilic inflammation associated with wide, poorly
septate hyphae.
Image of case 1 dog pretreatment, showing soft-tissue
inflammation over left side of face. Oldenhoff et al. (2014)
322
Histopathology showing pyogranulomatous and eosinophilic inflammation with rare hyphae.
Haematoxylin and eosin stain. Histopathology showing broad hyphae with rare septa and rare short
branching. Gomori methenamine silver stain. Oldenhoff et al. (2014)
Aeffner et al. (2015) reported a 7-year-old spayed female Labrador Reyriever with a
mass in the jejunum as revealed by abdominal ultrasonography. Resection and
anastomosis were performed and the resected segment showed a thickening of the
wall with diminished non-occluded lumen. The case was diagnosed as
intestinal pythiosis.
A:Portion of the jejunum of a dog,B: Cross section of the jejunum showing severe thickening of the
wall, expanded mucosa and white multiple focci,
Aeffner et al. (2015)
References
1. Aeffner F, Hall MJ, Pressler BM, Townsend KL, Papenfuss TL. Pathology in
practice. Intestinal pythiosis in a dog. J Am Vet Med Assoc. 2015 Mar
1;246(5):511-3.
2. Bentinck-Smith J, Padhye AA, Maslin WR, Hamilton C, McDonald RK, Woody BJ.
Canine pythiosis--isolation and identification of Pythium insidiosum. J Vet Diagn
Invest. 1989 Oct;1(4):295-8.
3. Berryessa NA, Marks SL, Pesavento PA, Krasnansky T, Yoshimoto SK, Johnson
EG, Grooters AM. Gastrointestinal pythiosis in 10 dogs from California. J Vet Intern
Med. 2008 Jul-Aug;22(4):1065-9.
4. Connolly SL, Frank C, Thompson CA, Van Alstine WG, Gelb H, Heng
HG, Klosterman E, Kiupel M, Grooters AM. Dual infection with Pythium insidiosum
and Blastomyces dermatitidis in a dog. Vet Clin Pathol. 2012 Sep;41(3):419-23.
5. Dykstra MJ, Sharp NJ, Olivry T, Hillier A, Murphy KM, Kaufman L, Kunkle
GA, Pucheu-Haston C. A description of cutaneous-subcutaneous pythiosis in
fifteen dogs. Med Mycol. 1999 Dec;37(6):427-33.
323
6. Fernandes CP, Giordani C, Grecco FB, V Sallis ES, R Stainki D, Gaspar LF, Garcez
Ribeiro CL, Nobre MO. Gastric pythiosis in a dog. Rev Iberoam Micol. 2012 OctDec;29(4):235-7.
7. Fischer JR, Pace LW, Turk JR, Kreeger JM, Miller MA, Gosser HS.
Gastrointestinal pythiosis in Missouri dogs: eleven cases. J Vet Diagn Invest. 1994
Jul;6(3):380-2.
8. Gaastra W, Lipman LJ, De Cock AW, Exel TK, Pegge RB, Scheurwater J, Vilela
R, Mendoza L. Pythium insidiosum: an overview. Vet Microbiol. 2010 Nov
20;146(1-2):1-16.
9. Graham JP, Newell SM, Roberts GD, Lester NV. Ultrasonographic features of canine
gastrointestinal pythiosis. Vet Radiol Ultrasound. 2000 May-Jun;41(3):273-7.
10. Helman RG, Oliver J 3rd. Pythiosis of the digestive tract in dogs from Oklahoma. J
Am Anim Hosp Assoc. 1999 Mar-Apr;35(2):111-4.
11. Hensel P, Greene CE, Medleau L, Latimer KS, Mendoza L. Immunotherapy for
treatment of multicentric cutaneous pythiosis in a dog. J Am Vet Med Assoc. 2003
Jul 15;223(2):215-8, 197.
12. Hummel J, Grooters A, Davidson G, Jennings S, Nicklas J, Birkenheuer A.
Successful management of gastrointestinal pythiosis in a dog using itraconazole,
terbinafine, and mefenoxam. Med Mycol. 2011 Jul;49(5):539-42.
13. Willard MD, Radlinsky MA. Endoscopic examination of the choanae in dogs and
cats: 118 cases (1988-1998). J Am Vet Med Assoc. 1999 Nov 1;215(9):1301-5.
14. Howerth EW, Brown CC, Crowder C. Subcutaneous pythiosis in a dog. J Vet Diagn
Invest. 1989 Jan;1(1):81-3.
15. Jaeger GH, Rotstein DS, Law JM. Prostatic pythiosis in a dog. J Vet Intern
Med. 2002 Sep-Oct;16(5):598-602.
16. Liljebjelke KA, Abramson C, Brockus C, Greene CE. Duodenal obstruction caused
by infection with Pythium insidiosum in a 12-week-old puppy. J Am Vet Med
Assoc. 2002 Apr 15;220(8):1188-91, 1162.
17. Martins TB, Kommers GD, Trost ME, Inkelmann MA, Fighera RA, Schild AL. A
comparative study of the histopathology and immunohistochemistry of pythiosis in
horses, dogs and cattle. J Comp Pathol. 2012 Feb-Apr;146(2-3):122-31.
18. Mendoza L, Arias M, Colmenarez V, Perazzo Y. Intestinal canine pythiosis in
Venezuela confirmed by serological and sequencing analysis. Mycopathologia. 2005
Feb;159(2):219-22.
19. Mendoza L, Mandy W, Glass R. An improved Pythium insidiosum-vaccine
formulation
with
enhanced
immunotherapeutic
properties
in
horses
and dogs with pythiosis. Vaccine. 2003 Jun 20;21(21-22):2797-804.
20. Miller RI. Gastrointestinal phycomycosis in 63 dogs. J Am Vet Med Assoc. 1985
Mar 1;186(5):473-8.
21. Oldenhoff
W, Grooters
A, Pinkerton
ME, Knorr
J, Trepanier
L.
Cutaneous pythiosis in two dogs from Wisconsin, USA. Vet Dermatol. 2014
Feb;25(1):52-e21.
22. Pereira DI, Schild AL, Motta MA, Fighera RA, Sallis ES, Marcolongo-Pereira C.
Cutaneous and gastrointestinal pythiosis in a dog in Brazil. Vet Res Commun. 2010
Mar;34(3):301-6.
23. Pereira DI, Botton SA, Azevedo MI, Motta MA, Lobo RR, Soares MP, Fonseca
AO, Jesus FP, Alves SH, Santurio JM. Canine gastrointestinal pythiosis treatment by
combined antifungal and immunotherapy and review of published studies.
Mycopathologia. 2013 Oct;176(3-4):309-15.
24. Rakich PM, Grooters AM, Tang KN. Gastrointestinal pythiosis in two cats. J Vet
Diagn Invest. 2005 May;17(3):262-9.
25. Schmiedt CW, Stratton-Phelps M, Torres BT, Bell D, Uhl EW, Zimmerman
S, Epstein J, Cornell KK. Treatment of intestinal pythiosis in a dog with a
combination of marginal excision, chemotherapy, and immunotherapy. J Am Vet
Med Assoc. 2012 Aug 1;241(3):358-63.
324
26. Thieman KM, Kirkby KA, Flynn-Lurie A, Grooters AM, Bacon NJ. Diagnosis and
treatment of truncal cutaneous pythiosis in a dog. J Am Vet Med Assoc. 2011 Nov
1;239(9):1232-5.
9. Zygomycosis in cats and dogs
Basidiobolus ranarum is a saprophytic fungus in the environment that also is a part of
the endogenous microflora in the gastrointestinal tract of several vertebrates. These
organisms may penetrate skin or muscosa of humans and other animals, causing
granulomatous inflammation.
Reports:
Ravisse et al. (1978) mentioned that the pathologic examination of the brain of a pet
cat, suspected of rabies, showed lesions of mucormycosis. The causal fungus, Mucor
(Rhizomucor) pusillus was isolated and identified. The authors describe the lesions
produced, the experimental pathogenicity for the rabbit and the morphologic and
physiologic characteristics of the isolate.
Greene et al. (2002) reported 2 dogs infected with B. ranarum with prolonged or
repeated exposure to water or soil in their environment. One dog had progressive
subcutaneous infection of all the limbs, and the other dog had recurrent coughing and
dyspnea caused by tracheobronchitis. In both dogs, secondary bacterial infection of
the lesions was evident. Treatment of the dog with subcutaneous infection involved
cutaneous dressings and sequential use of enrofloxacin and itraconazole; however,
this resulted in suspected liver damage without clinical improvement. Subsequent
treatment with potassium iodide and a lipid formulation of amphotericin B was also
unsuccessful, and the dog was euthanatized. The other dog was treated alternately
with enrofloxacin and itraconazole. When the clinical signs and infection returned,
combination treatment with both drugs was more effective; however, the dog
developed liver damage. Subsequent treatment with enrofloxacin on an intermittent
basis controlled the dog's coughing during a 3-year period.
Denzoin-Vulcano et al. (2005) reported a case of abdominal zygomycosis in a
Doberman bitch. Clinical signs consisted of urinary incontinence and hard abdominal
masses detected by palpation. The masses were surgically removed by exploratory
laparatomy and had a tumoral-like appearance. A granulomatous reaction containing
coarse and non septate hyphae was the main histological finding. Direct microscopic
examination revealed the presence of fungal structures. On Sabouraud honey agar the
fungus developed fluffy, greyish white colonies that were identified as Absidia
corymbifera on the basis of their macro and microscopic morphology
Nielsen et al. (2005) isolated Cokeromyces recurvatus, a zygomycete from the
peritoneal fluid of a cat with jejunal perforation secondary to intestinal
lymphosarcoma. This organism has not been recovered previously from a veterinary
patient. The tissue form of C. recurvatus is morphologically similar to those of
Coccidioides immitis and Paracoccidioides brasiliensis and may be misdiagnosed as 1
of these organisms on the basis of cytologic or histopathologic specimens, particularly
in geographic regions where these organisms are not endemic.
325
Photomicrograph of a direct smear of fluid obtained by means of abdominocentesis in a cat with fungal
peritonitis. An extracellular, round to oval structure approximately 100 mm in width with a thick,
double wall and basophilic interior [arrow] can be seen. The organism is surrounded by nondegenerate
neutrophils. Wright–Giemsa stain; bar 5 10 mm. Photomicrograph of the liver at necropsy. Surface of
the Glissons’ capsule [arrowhead] is covered with a thick membrane of necrotic cellular debris and
degenerate neutrophils admixed with several yeast-like organisms [arrows]. The organisms are 30–60
mm in diameter with 1-mm-thick eosinophilic wall surrounding amphophilic internal contents
containing variably sized, clear, round vacuoles. Hepatocellular degeneration, hemorrhage and biliary
stasis is evident in the subcapsular hepatic parenchyma. HE stain; bar 5 60 mm. Nielsen et al. (2005)
Photomicrograph of the microscopic features of Cokeromyces recurvatus when grown on PDA for 8
days at 25 C. Both asexual forms (the sporangiophore terminating in a fertile vesicle [long arrow]
giving rise to the recurving sporangiole stalks [short arrow] and sporangioles containing
sporangiospores) and the sexual zygospores [arrowhead] are shown. Lactophenol cotton blue stain; bar
5 10 mm Photomicrograph of the yeast form of Cokeromyces recurvatus grown on brain heart infusion
agar with 5% sheep blood at 37 C for 2 days, demonstrating multiple buds resembling a ‘‘Mariner’s
wheel.’’ Lactophenol cotton blue stain; bar 5 10 mm Nielsen et al. (2005)
Wray et al. (2008) reported a 14-year-old neutered female domestic shorthair cat with
a non-painful subcutaneous swelling of the nasal dorsum at the site of a scratch injury.
Cytological evaluation demonstrated a granulomatous reaction and many variably
shaped organisms consistent with yeasts/fungi. Subsequent biopsy and culture yielded
a pure growth of a Mucor species. The cat was treated with the second-generation
triazole antifungal agent posaconazole for 5 months. Complete resolution was seen
with no recurrence 12 months after discontinuing treatment.
326
Snyder et al. (2010) described tracheobronchial zygomycosis in a cat with acute
dyspnea. Radiographic, ultrasonographic, and computed tomography imaging allowed
identification of tracheobronchial masses, with intraluminal and peribronchial
involvement. Surgical removal was impossible and antifungal chemotherapy was
ineffective.
Initial ventrodorsal (A) and right lateral (B) thoracic radiographs of the patient. On the VD view,
arrows demonstrate M2 just cranial to the heart. The more caudal two arrows indicate the location of
M3. On the lateral view, a soft tissue opacity is observed in the thoracic trachea (M1) outlined by gas
opacity on its cranial and caudal borders. M2 is observed just caudal and ventral to M1, and M3 is
demonstrated by the most caudal arrow. Snyder et al. (2010)
Computed tomography image of the affected lung. The intratracheal mass partially occludes the trachea
and extends into the surrounding paratracheal tissue (arrow). Ultrasound image of the affected right
caudal lung. There was consolidation of the right lung (right arrow), consistent with hepatized lung.
An irregular hyperechoic infiltrate/mass surrounded a cross section of the central hypoechoic right
caudal bronchus (left arrow). This bronchus was dilated and contained hypoechoic fluid/infiltrate.
Snyder et al. (2010)
Cunha et al. (2011) reported a 7-month-old female Persian cat with gastrointestinal
(GI) necrosis and perforation caused by Rhizomucor species. Unfortunately, the cat
327
died of bacterial peritonitis and sepsis before a definitive diagnosis, based on
histopathology and fungal culture, was achieved.
Grau-Roma et al. (2014) described gastrointestinal eosinophilic sclerosing
fibroplasia (FGESF) in a 9- month-old male Persian cat presented with a history of
marked acute haematemesis. A mass (10 cm diameter) was detected within the
pylorus and proximal duodenum and this was not surgically accessible. On necropsy
examination the duodenal wall was seen to be markedly thickened with extensive
mucosal ulceration. Microscopically, there were haphazardly oriented trabecular
bands of dense eosinophilic collagen, separated by wide, clear areas containing
variable numbers of fibroblasts, eosinophils, mast cells, neutrophils, macrophages,
lymphocytes and plasma cells. Numerous pleomorphic, non-parallel walled, sparsely
septate hyphae, characteristic of phycomycetes, were present within the collagen
matrix. Colonies of gram-positive and gram-negative rods were also present within
the lesion.
Grau-Roma et al. (2014)
References:
1. Cunha SC, Aguero C, Damico CB, Corgozinho KB, Souza HJ, Pimenta AL, Marassi
CD. Duodenal perforation caused by Rhizomucor species in a cat. J Feline Med
Surg. 2011 Mar;13(3):205-7.
2. Denzoin-Vulcano L, Fogel F, Tapias MO, Schettino A, Zaror L, Guarro-Artigas J.
[Abdominal zygomycosis in a bitch due to Absidia corymbifera]. Rev Iberoam
Micol. 2005 Jun;22(2):122-4.
3. Grau-Roma L, Galindo-Cardiel I, Isidoro-Ayza M, Fernandez M, Majó N. A case of
feline gastrointestinal eosinophilic sclerosing fibroplasia associated with
phycomycetes. J Comp Pathol. 2014 Nov;151(4):318-21.
4. Greene CE, Brockus CW, Currin MP, Jones CJ. Infection with Basidiobolus ranarum
in two dogs. J Am Vet Med Assoc. 2002 Aug 15;221(4):528-32, 500.
328
5. Nielsen C, Sutton DA, Matise I, Kirchhof N, Libal MC. Isolation of Cokeromyces
recurvatus, initially misidentified as Coccidioides immitis, from peritoneal fluid in a
cat with jejunal perforation. J Vet Diagn Invest. 2005 Jul;17(4):372-8.
6. Ravisse P, Fromentin H, Destombes P, Mariat F. [Cerebral mucormycosis in the
cat caused by Mucor pusillus]. Sabouraudia. 1978 Dec;16(4):291-8
7. Snyder
KD, Spaulding
K, Edwards
J.
Imaging
diagnosis-tracheobronchial zygomycosis in a cat. Vet Radiol Ultrasound. 2010 NovDec;51(6):617-20.
8. Wray JD, Sparkes AH, Johnson EM. Infection of the subcutis of the nose in a cat
caused by Mucor species: successful treatment using posaconazole. J Feline Med
Surg. 2008 Oct;10(5):523-7.
9.Rhinosporidiosis in cats and dogs
Rhinosporidiosis is caused by Rhinosporidium seeberi, an organism that was previously
classified as a fungus but has been regrouped into the class Mesomycetozoa (family
Rhinosporideacae). This class consists of several parasitic and saprophytic organisms,
most of which infect fish and amphibians; only R. seeberi infects mammals.
Rhinosporidiosis is endemic to India and Sri Lanka, although cases have been reported
in Africa, the Americas, and Europe. Rhinosporidiosis is predominantly a human disease;
however, it has been documented in many other species, including cats, dogs, cattle, and
waterfowl. Equine cases are infrequent but have been reported from South Africa
(Zschokke, 1913), the United States (Myers et al., 1964), South America (Londero et al.,
1977, and in the United Kingdom (Leeming et al., 2007).
a.
Aetiology
Rhinosporidium seeberi (Wernicke) Seeber, B. Aires (1912)
≡Coccidium seeberi Wernicke, Trat. Parasitol.: 62 (1903)
=Rhinosporidium kinealyi Minchin & Fantham, Quart. J. Microscop. Sci.: 521 (1905)
=Rhinosporidium equi Zschokke, Schweiz. Arch. Tierheilk.: 641 (1913)
=Rhinosporidium ayyari Allen & Dave, Indian Med. Gaz.: 376-395 (1936)
b.
Description in vivo:
The fungus penetrates the mucosal epithelium. Spherical, 6-10 ?m wide cysts are
formed in subepithelial tissue, prevalently in the nasal mucosa. The sporangia grow
out to about 100 ?m diam; the up to 5 ?m thick wall has a chitinous outer layer and a
cellulosic inner layer. After repeated nuclear division, cleavage of the cytoplasm
occurs and the spherule swells to 250 ?m diam. Several thousands of spherical
endospores 7-9 ?m diam, each containing multiple, indistinct, spherical bodies, are
liberated through a rupture in the wall at a pre-formed thinner wall region. Liberated
spores are encapsulated in mucoid, granular material and remain in the epithelium.
They are surrounded by tissue, and the cycle is repeated. Massive growth of the
fungus leads to the formation of large, friable, polyp-like structures. The polyps may
329
become polymorphous and pedunculated, and develop from pink to finally deep red.
At close examination, the spherules can be seen macroscopically as whitish spots.
c.
Differential diagnosis:
The sporangia stain with mucicarmine, unlike the spherules of Coccidioides immitis.
The disease is chronic, and usually painless. The infrequent cases of infection of
trachea and bronchus may be fatal due to obstruction of air passage. Dissemination is
extremely rare
d.
Reports on Rhinosporidiosis in dogs
Allison et al. (1986) diagnosed nasal rhinosporidiosis in 2 dogs. Cytologic criteria for
diagnosis were the presence of 5- to 10-microns endospores and 50- to 1,000-microns
sporangia. These findings made it easy to differentiate rhinosporidiosis from the more
common nasal mycoses such as cryptococcosis. Treatment is principally surgical, but medical
management can be performed if the lesion is inoperable or recurs despite multiple surgeries.
Dapsone is one drug that has been used in such patients.
Easley et al. (1986) diagnosed rhinosporidiosis in six dogs from the southeastern
United States. All six dogs had unilateral nasal polyps with multiple small white
sporangia visible beneath the surface. Microscopically, the polyps consisted of
organisms and fibrovascular tissue with a surface of columnar or squamous
epithelium. Juvenile sporangia were unilamellar, 15-75 microns in diameter,
nucleated, and accounted for about 65% of sporangia seen. Approximately 5% of the
sporangia were in intermediate stages of maturation, were bilamellar, 100-150
microns in diameter, and contained immature endospores. Mature sporangia
comprised about 30% of the total, were usually unilamellar, 100-400 microns in
diameter, and contained a mixture of immature and mature endospores. The inner
layer of the wall of the intermediate sporangia and the single wall of the mature
sporangia were argyrophilic and carminophilic. Ultrastructurally, the earliest stage
contained a nucleus and many ribosomes, lipid droplets, and phagolysosomes.
Maturing sporangia contained discrete membrane-bound, round clevage products.
These structures subsequently matured to spores, each of which had a wall and
contained a nucleus and many lipid droplets. The organism from one dog was cultured
and grown in vitro for 7 months and is the first successful cultivation of
Rhinosporidium seeberi.
Nasal polyp at surgery. Miliary white foci on surface are sporangia of Rhinosporidiutii seeberi. Nasal
exudate containing neutrophils. Epithelial cells and spores of Rhinosporidium seeberi. Internal
“spherules” are evident in one spore (arrow). Bar = 10 Hm. Diff- Quick. Easley et al. (1986)
331
Nasal polyp containing many organisms in different stages of maturation. Bar = 200 pm. HE. Juvenile
stages of Rhinosporidiutn seeherr. Bar = 40 pm. HE. Easley et al. (1986)
Nucleated (N) juvenile stage before sporulation. Bar = 3 pm. Portion of a juvenile sporangium after
sporulation has begun. Lipid droplets (L) and cleavage products (arrows) are abundant. Bar = 4.5 pm.
Easley et al. (1986)
331
Intermediate stage of sporangial maturation with thick bilaminar wall and multiple punctate granules.
Thick, Later stage of sporangial maturation. Spores are discrete and wall is thick and bilaminar. Bar =
30 pm. HE., Electron micrograph, sporangium similar to that in Fig. 8. Note discrete spores (arrow)
with internal lipid and Mature sporangium with mature spores (arrow) in the center and less mature
spores toward the periphery. inner layer of wall (arrow). Bar = 30 pm. HE. bilarninar wall of
sporangium. Bar = 4.5 pm. Bar = 40 prn. HE Easley et al. (1986)
332
Electron micrograph, mature sporangium similar to Fig. 10. Nuclei, nucleoli, and lipid bodies are
evident. Bar = 5 rm., Electron micrograph of mature spores. Nucleus (N). lipid (L). Bar = 1.5 rm.
Easley et al. (1986)
In vitro subculture, 2 months post-inoculation. Two sporangia (arrow) enveloped in a focal aggregate
of proliferating tissue culture cells (arrowhead). Bar = 120 pm. Easley et al. (1986)
Jimenez et al. (1986) reported a one-year-old male Collie dog from Northeast
Arkansas with rhinosporidiosis presenting as an intranasal polypoid mass.
Caniatti et al. (1998) described four cases of canine rhinosporidiosis which occurred
in Italy in 1994 and 1995. Four dogs with a history of exposure to the muddy
environment of rice fields, developed respiratory signs. Rhinoscopy revealed nasal
polypoid lesions with a characteristic gross appearance due to the presence of
multiple, tiny, white-yellowish spots representing sporangia filled with spores. In
cytological samples obtained by brushing, many spores were present in an
inflammatory background. Histologically, the polyps consisted of fibrovascular tissue
embedding sporangia in different developmental stages, and free spores which elicited
a severe pyogranulomatous inflammation. All the dogs were treated surgically and the
333
condition did not recur in two cases during a year's follow-up and in the other two
cases during two years.
Meier et al. (2006) reported an 8-year-old, intact, male Labrador Retriever with a 2month history of severe sneezing episodes that resulted in epistaxis and bilateral
sanguineous discharge. Rhinoscopy revealed a small polypoid mass, and specimens
were obtained for histopathology. Microscopic examination of formalin-fixed tissue
specimens revealed organisms consistent with Rhinosporidium seeberi. The mass
was surgically excised and impression smears were made for cytology examination.
Smears revealed high numbers of endospores, typical of those previously described
for R seeberi. In addition, numerous smaller structures, presumed to be immature
endospores, were noted. The immature endospores were morphologically distinct
from mature endospores and have not been described previously. Recognition of
immature forms of Rhinosporidium may help prevent misidentification of the
organism or misdiagnosis of a dual infection.
Histologic section of a nasal mass biopsy from a dog with rhinosporidiosis. (Top) Note the mature
sporangium of Rhinosporidium seeberi containing both mature and immature endospores (arrowhead).
An intermediate sporangium with only immature endospores is present at the lower left (white arrow).
Both mature and intermediate sporangia lack an organized nucleus. Several juvenile sporangia
containing central nuclei surrounded by abundant faintly basophilic, fibrillar material are seen (black
arrow). H&E, bar5100 lm. (Bottom) Large numbers of mature endospores (arrows) free within the
connective tissue stroma are surrounded by an intense pyogranulomatous inflammatory cell infiltrate.
Several juvenile sporangia are present peripherally. H&E, Meier et al. (2006)
Impression smear of a nasal mass from a dog with rhinosporidiosis. A large sporangium contains, and
is surrounded by, hundreds of variably sized endospores. Wright’s-Giemsa. Impression smear of a
nasal mass from a dog with rhinosporidiosis. A large sporangium contains, and is surrounded by,
hundreds of variably sized endospores. Wright’s-Giemsa. Impression smear from a dog with
rhinosporidiosis. Two epithelial cells and 3 stages of developing endospores are shown. A single,
mature, eosinophilic endospore is seen in the center. A group of smaller, immature endospores is at the
334
top of the image (arrows). Also seen are 2 intermediate spores (arrowheads). Wright’s-Giemsa. Meier
et al. (2006)
Immature endospores, approximately 2–4 lm in diameter and lightly basophilic, contain a relatively
large pink-purple area thought to be nuclear material (arrows) as well as 1–2 smaller, dark-purple
structures (arrowheads). Wright’s-Giemsa. Mature endospores of Rhinosporidium. When the spores are
well spread out, they appear eosinophilic with a thick cell wall (arrows) and are surrounded by a
variably-sized, clear halo (arrowheads). Numerous eosinophilic globular structures can be seen within
some mature endospores. Wright’s-Giemsa. Meier et al. (2006)
Miller and Baylis (2009) reported a case of rhinosporidiosis in a dog native to the
UK.
Hill et al. (1010) reported Nasal rhinosporidiosis in two dogs , 4 and 7 years of age.
Physical examinations in both cases were within acceptable limits except for the
presence of a single mass in the left nasal passage in the first case and left-sided nasal
discharge in the second case. Rhinoscopy was used to visualize the nasal masses, and
in both cases a single mass was surgically removed. Impression smears and
histopathology submitted from each mass revealed lymphoplasmacytic and
neutrophilic inflammation with spores typical of Rhinosporidium seeberi. These are
the first reported cases of nasal rhinosporidiosis in two dogs native to the Upper
Mississippi River Valley area with no travel history outside the region.
e.
Reports on Rhinosporidiosis in cats
Moisan and Baker (2001) examined a polypoid nasal mass from an adult cat
histologically and demonstrated the presence of sporangia and sporangiospores
consistent with Rhinosporidium seeberi. Inflammatory infiltrates were moderate and
pyogranulomatous to lymphohistiocytic and were associated with hyperplasia of the
transitional nasal epithelium. Apparently, this is the first reported case
of rhinosporidiosis in a cat.
335
Nasal submucosa; feline rhinosporidiosis. Pyogranulomatous to lymphohistiocytic rhinitis with
multifocal immature sporangia of Rhinosporidium seeberi. HE. Bar 5 50 mm. Nasal mucosa; feline
rhinosporidiosis. Pyogranulomatous to lymphohistiocytic and hyperplastic rhinitis with a mature
sporangium. Note the mature and immature sporangiospores and prominent fistula. HE. Bar 5 50 mm.
Moisan and Baker (2001)
Wallin et al. (2001) diagnosed rhinosporidiosis in a domestic shorthair cat from a
suburb of Washington DC, USA. The clinical presentation of protracted sneezing and
epistaxis was associated with a polypoid lesion in the right nostril. Light microscopic
examination revealed a polypoid lesion with numerous sporangia containing maturing
endospores. Free endospores were present in the stroma of the polyp and lumen of the
nasal cavity. Transmission electron microscopy revealed ultrastructural features
typical of Rhinosporidium seeberi. The case was followed clinically for a total of 70
months and there were five attempts at surgical excision. This is the first reported case
of rhinosporidiosis in a domestic cat.
Nasal polyp of cat with maturing R. seeberi sporangia beneath intact nasal epithelium. Note fragments
of sporangial walls (arrow). H&E stain, bar ˆ 40 m m. Nasal polyp of cat showing mature R. seeberi
sporangium with nipple-like projection into lumen of nasal cavity and released mature endospores in
lumen of nasal cavity. Note the zonary distribution of maturing endospores within the sporangium.
H&E stain, bar ˆ 20 m m. Wallin et al. (2001)
Brenseke et al. (2010) reported a 10-year-old, neutered, male Domestic Shorthair cat
with labored breathing, anorexia, and weight loss of several months duration. External
336
examination revealed distortion of the bridge of the nose and pink fleshy polyps
protruding from each nostril. The cat was euthanized and submitted for postmortem
examination. In addition to the external findings, the nasal cavity had extensive bone
and cartilage loss and contained a tan firm mass in the caudal region of the nasal
cavity near the cribriform plate. On histologic examination, the mass was a nasal
adenocarcinoma, and the polyps were composed of hyperplastic nasal epithelium and
submucosal stroma that contained sporangia consistent with Rhinosporidium seeberi.
Sagittal section of the head. Polyps caused by Rhinosporidium seeberi are present in the nares (arrow),
and an adenocarcinoma is located in the caudal region of the nasal cavity (asterisk).Adenocarcinoma
from the caudal region of nasal cavity. Neoplastic epithelial cells form tubular and tubulopapillary
structures, which are supported by a thick collagenous stroma. Many lymphocytes and plasma cells are
present beneath the mucosa. Hematoxylin and eosin. Bar = 50 μm. Brenseke et al. (2010)
Nasal polyp; feline rhinosporidiosis. Pyogranulo-matous and hyperplastic rhinitis with mature and
immature sporangia. Note the release of endospores from mature sporangium into the nasal cavity.
Hematoxylin and eosin. Bar = 50 μm. Brenseke et al. (2010)
References:
1. Allison N, Willard MD, Bentinck-Smith J, Davis K. Nasal rhinosporidiosis in
two dogs. J Am Vet Med Assoc. 1986 Apr 15;188(8):869-71.
2. Brenseke
BM, Saunders
GK.
Concurrent
nasal
adenocarcinoma
and rhinosporidiosis in a cat. J Vet Diagn Invest. 2010 Jan;22(1):155-7.
337
3. Caniatti M, Roccabianca P, Scanziani E, Finazzi M, Mortellaro CM, Romussi
S, Mandelli G. Nasal rhinosporidiosis in dogs: four cases from Europe and a review
of the literature. Vet Rec. 1998 Mar 28;142(13):334-8.
4. Easley JR, Meuten DJ, Levy MG, Dykstra MJ, Breitschwerdt EB, Holzinger
EA, Cattley RC. Nasal rhinosporidiosis in the dog. Vet Pathol. 1986 Jan;23(1):50-6.
5. Hill SA, Sharkey LC, Hardy RM, Wilke VL, Smith MA, Anderson GM.
Nasal rhinosporidiosis in two dogs native to the upper Mississippi river valley region.
J Am Anim Hosp Assoc. 2010 Mar-Apr;46(2):127-31.
6. Jimenez JF, Cornelius JB, Gloster ES. Canine rhinosporidiosis in Arkansas. Lab
Anim Sci. 1986 Feb;36(1):54-5.
7. Meier WA, Meinkoth JH, Brunker J, Cunningham D, Bahr RJ. Cytologic
identification of immature endospores in a dog with rhinosporidiosis. Vet Clin
Pathol. 2006 Sep;35(3):348-52.
8. Miller RI, Baylis R. Rhinosporidiosis in a dog native to the UK. Vet Rec. 2009 Feb
14;164(7):210.
9. Moisan PG, Baker SV. Rhinosporidiosis in a cat. J Vet Diagn Invest. 2001
Jul;13(4):352-4.
10. Wallin LL, Coleman GD, Froeling J, Parker GA. Rhinosporidiosis in a domestic cat.
Med Mycol. 2001 Feb;39(1):139-41.
10. Pneumocystosis in cats and dogs
10.1. Introduction
Pneumocystosis is a severe pneumonia in immunodepressed man and a wide
variety of mammalian host species, including laboratory animals, wild
animals, zoo animals and domestic animals caused mainly by Pneumocystis
carinii
Only a few cases of P. carinii pneumonia have been reported in dogs and cats,
and most commonly among young animals.
Pneumocystis carinii is an extracellular opportunistic pathogen of the lung
with an uncertain taxonomic status. It was classified initially as a protozoan,
but more recent DNA and RNA-based investigations relate it to a fungus.
As a clinical disease, it often has had a fatal outcome.
a.
Diagnosis
The only part of the life cycle of the organism that is known is that involving
the mammalian lung, in which 2 main developmental stages can be identified:
the trophozoite and the cyst. Cysts may be found with up to 8 intracystic
bodies (trophozoites) or be found ruptured and empty.
Diagnosis of PCP is difficult due to the absence of any specific alterations in
hematological or biochemical parameters or in thoracic radiography. Although
serological methods have offered valuable information in epidemiological
studies, they are not reliable for diagnosing PCP due to a possible underlying
immunodeficiency. Recently, circulating P. carinii DNA has been identified
during acute PCP, but the diagnostic usefulness of this finding has not been
established.
338
Definitive diagnosis of P. carinii is based upon direct visualization of the
causative organism from respiratory fluids or biopsy specimens. Several
histochemical stains are useful, and diagnostic immunohistochemical kits are
available. When using immunohistochemistry it is notable that host speciesspecific antigenic variation has been demonstrated in P. carinii. The
development of polymerase chain reaction (PCR) techniques has given a new
diagnostic alternative for identification of the organism.
b. Aetiology
Pneumocystis carinii P. Delanoë & Delanoë, Compt. Rend. Hebd.
Séances Acad. Sci., Sér. D: 660 (1912)
Pneumocystis carinii is classified in Eukaryota; Fungi; Dikarya; Ascomycota;
Taphrinomycotina; Pneumocystidomycetes; Pneumocystidaceae; Pneumocysti s
One of the major problems in Pneumocystis research is the absence of an in vitro
culture system. Although many researchers have attempted to propagate the organism,
both with and without feeder cells, the prolonged propagation of Pneumocystis is still
not possible, nor the production of clonally derived stocks. Consequently, many
fundamental aspects of the organism remain unknown, including its life-cycle. To
date, all information on the life-cycle has come from studies using electron
microscopy. Two distinct morphological forms have been identified: the single
nucleated, thin-walled trophic form, and the cystic form which possesses a thick cell
wall containing up to eight intracystic bodies. Another morphological form, termed
the procyst, has been observed which has a range of morphological features and is
thought to develop from the trophic form, with thickening of the cell wall and an
increase in the number of nuclei.
c.
Reports
Copland (1974) described one confirmed case and three clinically diagnosed cases
of canine pneumocystis pneumonia in pedigreed Miniature Dachshunds. The main
clinical sign were respiratory embarrasasment, loss of weight with out loss of appetite,
normal temperature and low exercise tolerance. Two cases were fatal and post
mortem findings of one revealed generalized red hepatisation in the lungs with
marked interstitial pneumonitis and eosinophilic honeycombmasses of P. carinii in
the alveoli. The general pathology was similar to that described for human
pneumocystic pneumonia.
Botha
and
van
Rensburg
(1979)
reported
pneumonia caused
by Pneumocystis carinii in two unrelated Miniature Dachshunds is reported. The
clinical findings, gross- and histopathology and some diagnostic transmission and
scanning electron microscopic features of the condition are described.
Although pneumocystosis has been reported from a human and a domestic goat in the
Republic of South Africa, these are probably the first reported cases of the canine
disease in this country.
339
McCully et al. (1979) reported a case of pneumocytosis of an eight month old
Dachschund from the Cape Province. Clinically it was an afebrile disease with signs
limited primarily to the lower respiratory tract. The report consists of a short history,
the histopathologic findings, evidence of the electron microscopic confirmation of the
diagnosis and a brief discussion. It is believed to represent the first case of
canine pneumocystosis in the Republic of South Africa.
Settnes and Hasselager (1984) examined lungs from 106 normal dogs and 75
normal cats for Pneumocystis carinii by microscopy of toluidine blue O stained
imprints. Pneumocysts were demonstrated in 1 dog and 3 cats. It is suggested that
these animals may constitute a part of the natural reservoir for this parasite.
Shiota et al. (1990) administered corticosteroids to produce Pneumocystis
carinii infection in cats. Six of 10 cats, injected intramuscularly for 97-141 days with
2 mg/cat twice weekly of betamethasone sodium phosphate, developed a light
infection with P. carinii. Six of 7 cats, injected intramuscularly for 11-168 days with
10-25 mg/cat weekly of prednisolone acetate, also developed a light infection with
P. carinii. There was no significant difference in the infection rate between the sexes
and ages of the cats. Using Giemsa staining and Gomori's methenamine silver nitrate
stain, P. carinii organisms were indistinguishable morphologically from human and
rat P. carinii. The cysts and trophozoites were usually present singly or in small
groups, and they always were adhering to the periphery of alveoli. The inflammatory
changes were inconspicuous except for the fact that alveolar macrophages often were
seen. Corticosteroid-treated cats should be useful in the study of experimental
P. carinii infection. This is the first reported case of experimentally induced
P. carinii infection in cats.
Lobetti et ai. (1996) reviewed Pneumocystis carinii and presented four cases in the
miniature dachshund with hyperpnoea, tachypnoea and exercise intolerance. There
were also clinical signs suggestive of immune incompetence in all the dogs. P
carinii pneumonia was diagnosed in all four cases on transtracheal aspirate cytology.
Immunological studies showed low globulin levels on serum electrophoresis,
decreased lymphoblast transformation response (in the two cases that were tested) and
a deficiency of immunoglobulins A, G and M. Light and electron microscopy as well
as anti-canine immunoglobulin G immunoperoxidase staining studies were performed
on one case which had died because of the disease. From these four cases, it appears
that P carinii pneumonia in the miniature dachshund may be the result of an
immunodeficiency. It does not, however, appear to be a classic primary severe
combined immunodeficiency syndrome as the dogs appeared to respond to treatment,
did not show growth failure and did not manifest overwhelming commensurate
bacterial infections.
Sukura et al. (1996) reported a Cavalier Ring Charles Spaniel (1.5 years, male) with
respiratory signs unresponsive to therapy. The dog had suffered many problems
during its first year, including tibial fracture, a large abscess in the stifle region,
gastroenteritis, and erosive inflammation in the mouth and tongue. Erosive lesions
were detected also at the beginning of the respiratory disease. Therapy with
antibiotics (amoxicillin clavulanic acid, tetracycline, cephalexin) produced no
response. Some relief, especially at night, was obtained with low-dose corticosteroids
(2.5 mg prednisolone/ day for 1 month). The dog was afebrile and dyspneic with
increased abdominal effort in respiration. Cyanosis became evident after slight
exercise. Lung auscultation revealed respiratory crackles and wheezes. A soft murmur
341
was auscultated on the left and right thorax. In thoracic radiographs diffuse interstitial
and peribronchial densities were seen throughout the lungs, giving the impression of a
reticular structure with micronodule formations. Chronic alveolar densities could be
seen in all parts of the lungs. Bronchoalveolar lavage (BAL) specimen showed
clusters of cysts of P. carinii and polymorphonuclear leucocytes; stained with MayGrünwald-Giemsa and by commercial monoclonal antibody kit (CMo). Lung sections
stained with HE and specific monoclonal antibody (DMo) with a peroxidase
technique showed dark brown P. carinii cyst and trophozoite stages filling alveolar
spaces.. Transmission electron microscopy. demonstrated SMo-antibody localized on
electronlucent layer of cyst (C) pellicle. Diagnosis was confirmed by PCR using
specific primers.
1. (A) Right lateral and (B) ventrodorsal thoracic radiographs from the dog. Diffuse symmetrical
mixed pulmonary radiodensities and reticulonodular pattern visible. Sukura et al. (1996)
2. Bronchoalveolar lavage (BAL) specimen containing clusters of cysts of P. carinii (arrowheads) and
polymorphonuclear leucocytes; stained with May-Grünwald-Giemsa. 3. Clusters of trophozoites and
cysts showing a bright apple-green staining pattern; BAL specimen stained by commercial monoclonal
antibody kit (CMo).4. Lung section containing foamy, eosinophilic exudate in alveolar spaces;
paraffin-embedded section stained with HE.5. Dark brown P. carinii cyst and trophozoite stages filling
341
alveolar spaces; paraffin-embedded section stained with specific monoclonal antibody (DMo) with a
peroxidase technique Sukura et al. (1996)
Alveolar lumens filled with P. carinii organisms. Polymorphic trophozoites (T) seen in close contact with alveolar
surface, cysts (C) easy to recognize due to thicker and more rigid pellicle. Transmission electron microscopy.
Bar = 5 μm. Ultrastructurally, SMo-antibody localized on electronlucent layer of cyst (C) pellicle. Trophozoites
(T) free of gold particles. Immunoelectron microscopy, 15-nm gold particles. Bar = 1 μm. Sukura et al.
(1996)
Agarose gel electrophoresis of lung homogenate subjected to PCR. Lane marked M to the left, 100 bp
marker; lane 1, positive control (P. carinii DNA from human autopsy material); lanes 2-4 amplified
DNA from dog lung homogenate (6, 1 and 0.1 μl of the purified DNA, respectively); lane 5, negative
control (water). Sukura et al. (1996)
Yuezhong and Baoping (1996) infected 14 mice trapped in or near houses
with Pneumocystis carinii and the establishment of pneumonia was helped by
injecting with cortisone acetate for 6 weeks. Then 16 cats were infected with
P. carinii by injection of lung homogenate from the mice which contained from 1.3 x
10(5) to 2.6 x 10(5) P. carinii cysts. The infection resulted in severe cough and
tachypnea in Cats 1-8 injected with cortisone acetate, and a subclinical infection
in Cats 9-16. In Cats 1-8, the main pathological finding was typical
P. carinii pneumonia, but there only was slight swelling of the lungs in Cats 9-16.
Kirberger and Lobetti (1998) reviewed the thoracic radiographic changes
of Pneumocystis carinii in 7 miniature Dachshunds. The dogs were 7-12 months old
and presented with polypnea, exercise intolerance and clinical signs suggestive of
immune-incompetence. P. carinii pneumonia was diagnosed in all the dogs using
transtracheal aspirate cytology and confirmed at postmortem in 3 dogs that died.
Radiographically, diffuse pulmonary changes were present and varied from a mild
interstitial and bronchial pattern to an alveolar pattern. Radiographic evidence of cor
342
pulmonale was present in 1 dog. The most severe radiographic changes were seen in 2
of the dogs that died.
Dorsoventral and right lateral thoracic radiographs of dog 3,which recovered. Moderate diffuse
interstitial and peribronchial opacification with less involvement of the cranioventral lung lobes are
present. Some faint air bronchogram formation is evident. On the dorsoventral view there is a mildly
enlarged pulmonary artery segment and right ventricularenlargement, The vertebral heart size is 10.5.
Dorsoventral and right lateral thoracic radiographs of dog 4, which died. Severe diffuse interstitial and
mild peribronchial opacification are present. Thin fissure lines are visible on the dorsoventral view. The
vertebral heart size is 9.8. Dorsoventral and left lateral thoracic radiographs of dog 7, which died. On
the lateral view diffuse interstitial opacification in the caudal lobes with an alveolar pattern in the
middle lobes is present. Moderate alveolar pattern results in border effacement of the cardiac silhouette
in the dorsoventrdl view. The vertebral heart size is 10.5.
Cabañes et al. (2000) presented a 14-month-old male Yorkshire terrier with a history
of chronic non-productive cough and acute dyspnea. A follow-up radiograph revealed
a diffuse, bilaterally interstitial-alveolar lung disease with presence of air
bronchograms. The dog died 5 h after admission with severe dyspnea. Histological
sections
of
the
necropsy
specimens
revealed
the
presence
of
characteristic Pneumocystis carinii cysts within alveolar spaces. A diagnosis of P.
carinii pneumonia (PCP) was made on the basis of these results. To our knowledge,
PCP has not been described in a Yorkshire terrier dog.
343
Pneumocystis carinii cyst (dark structures) and trophozoite (light structures) stages . lling alveolar
spaces, stained with Grocottmethenamine- silver. Cabañes et al. (2000)
Transmission elect ron micrograph of Pneumocystis carinii trophozoites (T) free in the alveolar lumen
and inside macrophages (arrowheads) (a) displaying numerous, thin, dendritic . lopodia or tubular
extensions (b). Bar¾(a) 3 mm, (b)¾0·3 mm. Cabañes et al. (2000)
Hagiwara et al. (2001) diagnosed Pneumocystis carinii pneumonia by postmortem
examination of a one-year-old Cavalier King Charles Spaniel with four-week history
of dyspnea. Cytologic and histologic examination of lung tissues revealed numerous
P. carinii trophozoites and cysts, and P. carinii specific DNA was detected by
polymerase chain reaction. The dog showed hypogammagloblinemia and extremely
low levels of serum IgG. It was considered that P. carinii pneumonia in this case was
associated with an immunodeficient condition which has already been reported in
Miniature Dachshunds.
344
Lobetti (2000) reported 7 miniature dachshunds, all under the age of 1 year, with
polypnea,
tachypnea,
and
exercise
intolerance
as
a
result
of
Pneumocystis carinii pneumonia, which was diagnosed on transtracheal aspirate
cytology. In all of the dogs, historical and clinical signs were suggestive of immune
incompetence. Immunological studies undertaken were leukogram parameters, serum
immunoglobulin fraction quantification, lymphocyte transformation assay. CD3 and
CD79a lymphocyte markers on lymphoid tissue, and anti-canine immunoglobulin G
immunoperoxidase
staining.
The
immunological
studies
showed
hypogammaglobulinemia, deficiency of serum immunoglobulins A, G, and M,
decreased lymphocyte transformation response to phytohemagglutinin and pokeweed
mitogens and absence of B lymphocytes with presence of T lymphocytes in the
lymphoid tissue stained with CD3 and CD79a lymphocyte markers. The preceding
findings suggest that P. carinii pneumonia occurring in the miniature dachshund is a
result of both a T- and B-cell deficiency. This presentation is not the classic primary
severe combined immunodeficiency syndrome but rather combined variable
immunodeficiency, which has been well documented in humans but never in the dog.
1. a, A normal and b, an affected dog lymph node stained with the CD3 lymphocyte marker showing
the presence of T lymphocytes in both. Lobetti (2000)
345
2. a, A normal and b, an affected dog lymph node stained with the CD79a lymphocyte marker showing
the presence of B lymphocytes in the normal lymph node and absence of B lymphocytes in the affected
dog. Lobetti (2000)
References
1. Botha WS, van Rensburg IB. Pneumocystosis: a chronic respiratory distress
syndrome in the dog. J S Afr Vet Assoc. 1979 Sep;50(3):173-9.
2. Cabañes FJ, Roura X, Majó N, Bragulat MR, Domingo M.
Pneumocystis carinii pneumonia in a Yorkshire terrier dog. Med Mycol. 2000
Dec;38(6):451-3.
3. Copland, J. W. (1974), CANINE PNEUMONIA CAUSED BY PNEUMOCYSTIS
CARINII. Australian Veterinary Journal, 50: 515–518. doi: 10.1111/j.17510813.1974.tb14058.x
4. Hagiwara Y, Fujiwara S, Takai H, Ohno K, Masuda K, Furuta T, Nakayama H, Doi
K, Tsujimoto H. Pneumocystis carinii pneumonia in a Cavalier King Charles Spaniel.
J Vet Med Sci. 2001 Mar;63(3):349-51.
5. Kirberger RM, Lobetti RG. Radiographic aspects
of Pneumocystis carinii pneumonia in the miniature Dachshund. Vet Radiol
Ultrasound. 1998 Jul-Aug;39(4):313-7.
6. Lobetti R, Common variable immunodeficiency in miniature dachshunds affected
with Pneumonocystis carinii pneumonia. J Vet Diagn Invest. 2000 Jan;12(1):39-45.
7. Lobetti RG, Leisewitz AL, Spencer JA. Pneumocystis carinii in the miniature
dachshund: case report and literature review. J Small Anim Pract. 1996
Jun;37(6):280-5.
8. McCully RM, Lloyd J, Kuys D, Schneider DJ. Canine pneumocystis pneumonia. J S
Afr Vet Assoc. 1979 Sep;50(3):207-9.
9. Shiota T, Shimada Y, Kurimoto H, Oikawa H. Pneumocystis carinii infection in
corticosteroid-treated cats. J Parasitol. 1990 Jun;76(3):441-5.
10. Settnes OP, Hasselager E. Occurrence of Pneumocystis carinii Delanoë & Delanoë,
1912 in dogs and cats in Denmark. Nord Vet Med. 1984 May-Jun;36(5-6):179-81.
11. Sukura A, Saari S, Järvinen AK, Olsson M, Kärkkäinen M, Ilvesniemi T.
Pneumocystis carinii pneumonia in dogs--a diagnostic challenge. J Vet Diagn
Invest. 1996 Jan;8(1):124-30.
12. Yuezhong Y, Li Z, Baoping T. Pneumonia in cats caused by Pneumocystis
carinii purified from mouse lungs. Vet Parasitol. 1996 Jan;61(1-2):171-5.
11.
Lagenidiosis in cats and dogs
Lagenidiosis is life-threatening infections in mammals and birds caused by memebers
of the genus Lagenidium belonging to the Oomycota. Oomycetes are found in both
fresh and salt water as well as in terrestrial environments. They produce flagellated,
actively motile spores (zoospores) that are pathogenic to many crop plants and fishes.
The majority of species in the genus Lagenidium are parasites of algae, fungi,
nematodes, crustaceans, and insect larvae.
Two species of this genus have been isolated from dogs with skin lesions. Clinical
signs are similar to those associated with cutaneous pythiosis. A number of infected
dogs have had frequent exposure to lakes or ponds. Affected dogs have one or
multiple skin or tissue lesions on the legs, mammary region, or trunk which look like
as firm nodules or as ulcerated, thickened areas with numerous draining tracts.
346
Lagenidium giganteum forma caninum infection causes severe cutaneous and disseminated
disease in dogs..
Pythiosis, lagenidiosis, and zygomycosis share similar clinical and histologic
characteristics, making them difficult to distinguish from one another; however,
distinguishing between these pathogens is important because of differences in
epidemiology, choice and duration of therapy, and prognosis.
Aggressive surgical resection of infected tissues is the treatment of choice for
lagenidiosis. In animals with lesions limited to a single limb, amputation is
recommended. Because response to medical therapy is poor, dogs infected with the
more aggressive pathogen have a grave prognosis. In dogs infected with the less
aggressive species, surgery may be curative. As with pythiosis, medical therapy for
lagenidiosis is usually ineffective.
Lagenidium giganteum forma caninum infection causes severe cutaneous and disseminated
disease in dogs. Currently, diagnosis requires culture and rRNA gene sequencing.
Currently, diagnosis requires culture and rRNA gene sequencing.
Lagenidium giganteum Couch, Mycologia 27: 376 (1935)
Morphologic features of isolates of Lagenidium giganteum mosquito control agent and L.
giganteum mould from mammals. Panel A shows henotypic features in culture of the mammalian
pathogen (ATCCMYA-4933, type strain) wwwnc.cdc.gov
Reports
Grooters et al. (2003) isolated an oomycotic pathogen in the genus Lagenidium from
tissues obtained from 6 dogs with progressive cutaneous disease. Initial clinical
findings in 5 dogs included multifocal cutaneous lesions, subcutaneous lesions, or
both associated with regional lymphadenopathy: the 6th dog initially was presented
for evaluation of mandibular lymphadenopathy. Cutaneous lesions were ulcerated,
exudative regions (often with necrosis and draining tracts) or multiple firm dermal or
347
subcutaneous nodules. Two dogs subsequently developed haemoabdomen from great
vessel rupture and died acutely. Four dogs were euthanized because of progression of
subcutaneous lesions or lymphadenopathy. On postmortem examination, regional
granulomatous lymphadenitis was found in all 6 dogs, great vessel invasion in 3 dogs,
pulmonary lesions in 2 dogs. ureteral obstruction in 1 dog, mediastinal lymphadenitis
in 1 dog, and hilar lymphadenitis with invasion of the distal esophagus and trachea in
1 dog. Histologically, lesions were similar to those associated with pythiosis and
zygomycosis and were characterized by severe eosinophilic granulomatous
inflammation (often with numerous large multinucleated giant cells) centered around
broad (7-25 micro), infrequently septate hyphae. Immunoblot analysis of the serologic
response of 4 dogs to a soluble mycelial extract of Lagenidium giganteum indicated
that each dog's serum recognized at least 10 different antigens of L. giganteum.
Culture of infected tissues yielded rapid growth of colorless to white submerged
colonies. Microscopically, mature hyphae in culture were broad (25-40 micro),
segmented, and occasionally branching and produced motile laterally biflagellate
zoospores in water culture. This report is the 1st description of infection caused by an
oomycete other than Pythium insidiosum in any mammalian species.
Immunoblot analysis demonstrating the ability of serum from dogs 3, 4, and 5 to recognize antigens of
Pythium insidiosum (P. in), the canine pathogenic Lagenidium species isolated from dog 1 (L. sp),
Lagenidium giganteum (L. gig), Lagenidium myophilum (L. myo), Basidiobolus ranarum (Bas), and
Conidiobolus coronatus (Con). Markers on left indicate molecular weight in kilodaltons, Grooters
et al. (2003)
Gross photograph of the tracheal bifurcation of dog 4. There is a mass (arrows) surrounding the left
mainstem bronchus and invading the adjacent pulmonary parenchyma. Histologically, this mass was
characterized by eosinophilic granulomatous inflammation with intralesional hyphae. Tr, trachea. Bar 5
2 cm., Gross photograph of a large, raised, ulcerated and exudative cutaneous lesion on the ventral
abdomen of dog 5. Histologic examination of this lesion revealed severe ulcerative granulomatous
dermatitis with intralesional hyphae. Bar 5 2 cm. Grooters et al. (2003)
348
Photomicrograph of a cutaneous lesion on the hind limb of dog 1, showing severe multifocal to
coalescing pyogranulomatous inflammation of the dermis and subcutis. Hematoxylin and eosin stain.
Bar 5 200 m., Photomicrographs showing Lagenidium sp. hyphae in tissue. (A) Extracellular hyphae
with visible cell wall (arrows) within infected lung tissue from dog 6; (B) intracellular hyphae within
giant cell (arrow) in infected lymph node from dog 5. Hematoxylin and eosin stain. Bar 5 20 m.
Grooters et al. (2003)
Photomicrographs of tissue sections stained with Gomori’s methenamine silver. (A) Broad, thickwalled, irregularly septate hyphae associated with granulomatous vasculitis in a lymph node from dog
6; (B) numerous hyphae of varying diameter (some of which have a round or bulbous appearance) in an
infected lymph node from dog 5. Bar 5 20 m. Grooters et al. (2003)
Hartfield et al. (2014) conducted a study to develop and evaluate an ELISA for
quantitation of anti-L. giganteum f. caninum IgG in canine serum. Sera were
evaluated from 22 dogs infected with L. giganteum f. caninum, 12 dogs infected with
Paralagenidium karlingii, 18 dogs infected with Pythium insidiosum, 26 dogs with
nonoomycotic fungal infections or other cutaneous or systemic diseases, and 10
healthy dogs. Antigen was prepared from a soluble mycelial extract of L. giganteum f.
caninum. Optimal antigen and antibody concentrations were determined by
349
checkerboard titration. Results were expressed as percent positivity (PP) relative to a
strongly positive control serum. Medians and ranges for PP for each group were: L.
giganteum f. caninum (73.9%, 27.9-108.9%), P. karlingii (55.0%, 21.0-90.6%), P.
insidiosum (31.3%, 15.8-87.5%), nonoomycotic fungal infection or other cutaneous or
systemic diseases (19.2%, 3.2-61.0%), and healthy dogs(9.9%, 7.6-24.6%). Using a
PP cutoff value of 40%, sensitivity and specificity (with 95% CI) of the ELISA for
detecting L. giganteum f. caninum infection in clinically affected dogs were 90.9%
(72.2-97.5%) and 73.2% (60.4-83.0%), respectively. Specificity in dogs infected with
P. karlingii was 41.7% (19.3-68.1%) and with P. insidiosum was 66.7% (43.8-83.7%).
It was concluded that quantitation of anti-L. giganteum f. caninum antibodies for
detection of this infection in dogs has moderately high sensitivity but poor specificity,
the latter because of substantial cross-reactivity with anti-P. karlingii and anti-P.
insidiosum antibodies.
Vilela et al. (2015) conducted a phylogenetic study of 21 mammalian Lagenidium
isolates; they found that 11 cannot be differentiated from L. giganteum strains that the
US Environmental Protection Agency approved for biological control of mosquitoes;
these strains were later unregistered and are no longer available. L. giganteum strains
pathogenic to mammals formed a strongly supported clade with the biological control
isolates, and both types experimentally infected mosquito larvae. However, the strains
from mammals grew well at 25°C and 37°C, whereas the biological control strains
developed normally at 25°C but poorly at higher temperatures. The emergence of
heat-tolerant strains of L. giganteum pathogenic to lower animals and humans is of
environmental and public health concern.
Mendoza et al. (2016) studied 21 Lagenidium strains isolated from dogs and a human
available in their collection. Molecular phylogenetic studies and phenotypic
characteristics were used to characterize the strains. They reported the finding of three
novel species, herein designated as Lagenidium ajelloi, sp. nov., Lagenidium albertoi
sp. nov, and Lagenidium vilelae sp. nov. Their morphological and growth features are
also presented.
References
1. Grooters AM, Hodgin EC, Bauer RW, Detrisac CJ, Znajda NR, Thomas RC.
Clinicopathologic findings associated with Lagenidium sp. infection in 6 dogs: initial
description of an emerging oomycosis. J Vet Intern Med. 2003 Sep-Oct;17(5):637-46.
2. Hartfield JN, Grooters AM, Waite KJ. Development and evaluation of an ELISA for
the quantitation of anti-Lagenidium giganteum forma caninum antibodies in dogs. J
Vet Intern Med. 2014 Sep-Oct;28(5):1479-84.
3. Mendoza L, Taylor JW, Walker ED, Vilela R. Description of three novel Lagenidium
(Oomycota) species causing infection in mammals. Rev Iberoam Micol. 2016 Feb 25.
4. Vilela R, Taylor JW, Walker ED, Mendoza L. Lagenidium giganteum pathogenicity
in mammals. Emerg Infect Dis. 2015 Feb;21(2):290-7..
12.
Oxyporosis in cats and dogs
The filamentous basidiomycetous fungus, Oxyporus corticola, has not previously
been reported in the human or veterinary medical literature. Only 2 papers were found
concerning dogs. The first was published by Brochus et al. (2009) on disseminated
351
Oxyporus corticola infection in a German shepherd dog and the second byMiller et al.
(2012), who described the isolation of the fungus Oxyporus corticola from multiple
lymphocutaneous tissues of a Beagle dog.
Aetiology
Oxyporus corticola (Fr.) Ryvarden, Persoonia 7 (1): 19 (1972
≡Polyporus corticola Fr., Systema Mycologicum 1: 385 (1821)
≡Polyporus polystictus Pers., Mycologia Europaea 2: 111 (1825)
≡Polyporus reticulatus var. corticola (Fr.) P. Kumm., Der Führer in die Pilzkunde: 59 (1871)
≡Physisporus corticola (Fr.) Gillet, Les Hyménomycètes ou Description de tous les Champignons qui
Croissent en France: 696 (1878)
≡Poria corticola (Fr.) Cooke, Grevillea 14 (72): 113 (1886)
≡Muciporus corticola (Fr.) Juel, Kungl. Svenska Vetenskapsakad. Handl.: 23 (1897)
≡Coriolus corticola (Fr.) Pat., Essai taxonomique sur les familles et les genres des Hyménomycètes: 94
(1900)
≡Chaetoporus corticola (Fr.) Bondartsev & Singer, Annales Mycologici 39 (1): 51 (1941)
≡Rigidoporus corticola (Fr.) Pouzar, Folia Geobotanica et Phytotaxonomica 1 (4): 368 (1966)
=Polyporus salviae Berk. & M.A. Curtis, Grevillea 1 (4): 54 (1872)
=Polyporus rostafinskii P. Karst., Bidrag till Kännedom av Finlands Natur och Folk 25: 274 (1876)
=Physisporus tener Har. & P. Karst., Revue Mycologique Toulouse 12: 128 (1890)
=Poria separans Murrill, Mycologia 12 (6): 305 (1920)
=Polyporus separans Murrill, Mycologia 12 (6): 305 (1920)
=Poria vicina Bres., Mycologia 17 (2): 76 (1925)
=Poria pearsonii Pilát, Transactions of the British Mycological Society 19 (3): 195 (1935)
Oyxporus corticola is a white-rot decay fungus of woody angiosperms and
gymnosperms and is widely distributed in North America and Europe. It is
characterized by resupinate or effuse-reflexed, soft and leathery fruiting bodies with a
cream to light brown pore surface. The hyphae are simple, septate with thin to
thickened walls, bearing short, clavate basidia on each of which are formed four,
ovoid to broadly ellipsoid spores, 5–9×3.5–4.5 µm. Two kinds of cylindrical cystidia
are present, i.e., one is apically encrusted with hyaline crystals and the other contains
a refractive substance.
Reports:
Brockus et al. (2009) reported a 6-year-old female spayed German shepherd with a
painful boney mass on the right distal tibia that had caused the animal to limp for 4
weeks. On physical examination, right hind limb lameness was present with a
palpable painful right tibia mass. Mild generalized lymphadenopathy also was noted.
Medications and supplements that had been used included carprofen, (Rimadyl,
Pfizer, Inc., Exton, PA), glucosamine, chondroitin, brewer's yeast, cod liver oil, and
multivitamins. A proliferative mass was observed on the distal right tibia on
radiographs but thoracic radiographs were within healthy parameters. Chorioretinal
lesions of unknown cause were observed on retinal examination. A fine needle
aspirate (FNA) and a biopsy specimen of the right tibial lesion were submitted for
study. Macrophages with phagocytosed branching, septate hyphae with nearly parallel
sides were observed in the FNA and fungal hyphae were also noted in the biopsy
specimen. Initially, this was interpreted as probable aspergillosis. Infrequent fungal
hyphae were also present on a prescapular lymph node FNA indicating a disseminated
infection. Rapid growth of a white, filamentous, unidentified fungus occurred in the
351
aerobic bacterial cultures at 35°C and on the fungal cultures at both 25 and 35°C, but
no bacterial growth was detected. The isolate was initially identified as a
basidiomycetous fungus, and subsequently confirmed as Oxyporus corticola by
sequencing .
An aggressive mixed productive and proliferative lesion is present in the mid/distal-tibia region (A). A
smoother appearance but proliferation remained after 6 months of treatment. Productive changes have
progressed distally (B). Brockus et al. (2009)
Cytological photomicrograph of a cytocentrifuge fine needle aspirate specimen of the tibial lesion from
the dog. Branching, septate, fungal hyphae with parallel walls were initially thought to be compatible
with an Aspergillus species (Wright's stain)., Photomicrograph of the adrenal gland illustrating fungal
hyphae disseminated throughout the gland (Gomori methenamine silver staining). Brockus et al.
(2009)
Miller et al. (2012) described the isolation of the fungus Oxyporus corticola from
multiple lymphocutaneous tissues of a Beagle dog. Until recently, this fungus had not
been reported in the human or veterinary medical literature as a cause of animal
disease. A single previous report also involved infection in a German Shepherd Dog,
352
a breed with reported increased susceptibility to disseminated fungal infection and
dysfunctional immune response. Isolates were non-sporulating and required molecular
identification methods for prompt differentiation from other fungal pathogens. Risk
factors for infection with O. corticola are unknown.
Oxyporus corticola isolate lacking aerial mycelia when grown on blood agar incubated at 35°C (7
days). Oxyporus corticola isolate on inhibitory mold agar incubated at 30°C (31 days) Miller et al.
(2012)
Microscopic appearance of Oxyporus corticola isolate from inhibitory mold agar incubated at 30°C (31
days) showing a rare spore-like structure. Lactophenol cotton blue. Bar = 37 µm Miller et al. (2012)
353
Hematoxylin and eosin–stained histopathology slide of lymph node biopsy showing macrophage with
associated hyphal elements (arrows). Bar = 112 µm Miller et al. (2012)
References:
1. Brockus CW, Myers RK, Crandell JM, Sutton DA, Wickes BL, Nakasone KK.
Disseminated Oxyporus corticola infection in a German shepherd dog. Med
Mycol. 2009 Dec;47(8):862-8.
2. Miller SA, Roth-Johnson L, Kania SA, Bemis DA. Isolation and sequence-based
identification of Oxyporus corticola from a dog with generalized lymphadenopathy. J
Vet Diagn Invest. 2012 Jan;24(1):178-81.
13.
Acremoniosis
Simpson et al. (1993) examined a 4-year-old female German Shepherd dog to
determine the cause of ataxia, progressive head tilt, anorexia, lethargy, and weight
loss of 3 weeks' duration. A vestibular syndrome, generalized lymphadenopathy,
bilateral uveitis, and chorioretinitis with complete detachment of the left retina were
detected. Abnormal clinicopathologic findings were isosthenuria and
hyperglobulinemia. The non-functional left eye was enucleated and fungal organisms
resembling Aspergillus spp were identified on histologic examination. Microbial
culture of a urine sample yielded Acremonium sp, which was initially considered a
contaminant. The dog was considered to have systemic aspergillosis and was treated
354
with itraconazole for 7 months, until it was euthanatized because of persistent
vomiting and anorexia. Postmortem examination revealed multisystemic
pyogranulomatous and necrotizing inflammation of the myocardium, pericardium,
liver, and kidneys; and granulomatous splenitis, lymphadenitis, retinitis, endometritis,
and meningoencephalitis. Fungal culture of affected organs yielded Acremonium sp.
These findings indicated that Acremonium spp can be pathogenic and should not be
ignored when cultured.
Reference:
1. Simpson KW, Khan KN, Podell M, Johnson SE, Wilkie DA. Systemic mycosis
caused by Acremonium sp in a dog. J Am Vet Med Assoc. 1993 Nov
1;203(9):1296-9.
14.
Geosmithiosis in cats and dogs
The genus Geosmithia currently contains numerous species formerly classified
as Penicillium. Geosmithia argillacea (Stolk, H.C. Evans & T. Nilsson) , was
originally described as a new thermotolerant Penicillium species by Stolk et al. who
isolated the type strain from a high-temperature mine waste tip in 1969 21. In 1979
Pitt erected the genus Geosmithia to distinguish isolates previously known
as Penicillium spp. but which formed conidia borne as cylinders from cylindrical,
rough-walled phialides lacking narrow necks, as in Penicillium and Paecilomyces, and
that produced conidia that were not typically some shade of green.
Report:
Grant et al. (2009) reported a systemic mycosis in a German Shepherd dog caused by
Geosmithia argillacea. Although this etiologic agent microscopically resembles a
Penicillium species, and is histopathologically compatible with members of the genus
Aspergillus, morphologic features and molecular characterization clearly separate it
from these genera. This appears to be the first report of disseminated disease by this
species in humans or animals. In vitro antifungal susceptibility testing suggests
resistance to amphotericin B and voriconazole and susceptibility to caspofungin,
itraconazole, and posaconazole.
355
GMS stain, eye, (bar equals 50 microns). Multiple septate hyphae invading the anterior lens capsule
and lens cortical material. GMS stain, sternebra, (bar equals 10 microns). Multiple septate hyphae with
bulbous endings are dispersed throughout. Grant et al. (2009)
The kidney is irregular and red with multifocal, large, white-tan, granular nodules most prominent
along the renal pelvis. There is a wedge shaped pale area extending from the cortex to the medulla
consistent with an infarct. H&E, kidney (bar equals 25 microns). The centers of granulomas are
necrotic and contain poorly staining septate, dichotomous branching fungal hyphae (arrowheads) with
bulbous endings. Grant et al. (2009)
Macroscopic morphology of Geosmithia argillacea on malt extract agar. (A) 16 days at 23°C. (B) 8
days at 35°C.
356
Microscopic morphology of Geosmithia argillacea demonstrating branching stipes, monoverticillate
and asymmetric biverticillate penicilli, cylindrical and appressed phialides, and smooth, hyaline,
cuniform to ellipsoidal conidia borne in long, columnar chains. Roughened stipes, metulae, and
phialides are a distinctive microscopic feature of this species (bar equals 10 microns), Grant et al.
(2009)
Reference
1.
Grant DC, Sutton DA, Sandberg CA, Tyler RD Jr, Thompson EH, Romanelli
AM, Wickes BL. Disseminated Geosmithia argillacea infection in a German shepherd
dog. Med. Mycol. 47:221–226
D. Diseases in cats and dogs caused by diphasic fungi
1. Blastomycosis in cats and dogs
1.1.
Introduction
Blastomycosis is a systemic fungal infection caused by the dimorphic
fungus Blastomyces dermatitidis, which has a relatively wide distribution in North
America, including the Mississippi, Missouri, and Ohio river valleys; the Middle
Atlantic states; southern Saskatchewan; Manitoba; Quebec; and Ontario.
Blastomycosis is most commonly diagnosed in 2- to 4-year-old intact male largebreed dogs living in endemic regions, as they have a greater tendency to roam and to
sniff and dig in the soil, resulting in greater exposure to the organism. Sporting dogs
and hound breeds are predisposed, most likely because of increased exposure to highrisk areas during hunting. Residence near a river or lake and access to recently
excavated sites have been demonstrated to increase the risk of infection. Most cases of
357
canine blastomycosis are diagnosed in late summer or early fall (Harasen and
Randall 1986; Rudmann et al.,1992;. Arceneaux et al., 1998;.Kerl 2003;
Baumgardner et al., 1995; Baumgardner et al., 2005;Brömel and
Sykes, 2005;Legendre, 2006).
Infection most commonly occurs after inhaling spores from contaminated soil. At
normal canine body temperature, the organism transforms to a yeast that can infect the
lungs and spread systemically. Although infection almost always begins in the lungs
before being disseminated through hematogenous or lymphatic routes to other body
tissues, lung lesions occasionally resolve by the time infection in other sites becomes
apparent. The most common sites of clinically apparent infection in dogs include the
lungs, lymph nodes, eyes, skin, and bone. Subclinical or spontaneously resolving
infection is uncommon.
1.2.
Aetiology:
Blastomyces dermatitidis GILCHRIST et STOCKES 1898
Synonyms: Oidium dermatitidis RICKETTS 1901Cryptococcus gilchrisii VUILLEMIN 1902Zymonema gilchrisii BEUREMANN et GOUGEGOT 1901
Glenospora gammeli POLACCI et NANNIZZI 1927Blastomycoides tulanensis CASTELLANI 1928Monosporium tulanensis AGOSTIN 1932
Perfect stage: Ajellomyces dermatitidis McDONOUGH et LEWIS 1968
B. dermatitidis is a thermically dimorphic fungus which is assumed to be a soil
saprophyte in nature. It grows at room temperature as mould, developing glabrous,
tan, non-conidiating colonies, or colonies with fluffy white mycelium. The colonies
mature in 2 weeks and may attain dark brown colour on age. Microscopically, the
mycelium consists of hyaline and septate hyphae which bear delicate conidiophores
that carry on their tips round, oval or pear-shaped conidia. The fungus readily
converts to the yeast phase when plated on blood agar and incubated at 37 C. The
yeast colonies are wrinkled and folded, glabrous and tan or creamy in colour.
Microscopically, the yeast cells are characterized by broad-based buds.
B. dermatitidis colony at 25oC oval or pear-shaped conidia
358
broad-based buds intissues
1.3.
Diagnosis
1.3.1. Clinical signs
Nonspecific signs of illness, including anorexia, weight loss, and lethargy, are
common, and fever
Involvement of the Lung pathology results in exercise intolerance, cough,
tachypnea, cyanosis, or respiratory distress.
Enlargement of one or more peripheral lymph nodes
endophthalmitis, chorioretinitis, optic neuritis, serous or granulomatous retinal
detachment, hyalitis and Panophthalmitis may also develop
Dermatologic manifestations such as granulomatous proliferative mass-like
lesions and ulcerated skin lesions draining serosanguineous or purulent fluid
are most common, involving the nasal planum, face, and nail beds.
Lameness may occur as a result of bone infections of the distal limbs.
Symptoms resulting from involvement of internal organs like prostate,
kidneys, testes, joints, nasal passages, and brain. straightforward.
1.3.2. Thoracic radiography
Diffuse miliary to nodular interstitial and bronchointerstitial pulmonary
changes are most common Less often, lung lobe consolidation or a solitary
mass within the lung parenchyma is identified
1.3.3. Direct microscopic examination
The diagnosis of blastomycosis can usually be confirmed by demonstration of
the characteristic broad based budding organisms in exudates or aspirates from
dermal lesions and fine-needle aspirates from enlarged, infected lymph nodes,
transtracheal aspiration, bronchoalveolar lavage, and transthoracic lung
aspiration, cerebrospinal fluid and vitreal aspirates and subretinal aspirates
from infected eyes etc by KOH prep, cytology, or histology. Thick-walled
spherical yeast cells, 8-30 microns may be detected in sputum,aspirates from
cutaneous lesions or biopsy material, when examined directly by the
microscope. The yeast cells have broad-based buds and the cytoplasm usually
shrinks away from the wall.
359
Cutaneous scrapings
pus
1.3.4. Serological tests
The agar gel immunodiffusion test for antibodies against
the Blastomyces A antigen is the most commonly used serologic test
Radioimmunoassay tests to detect serum antibodies against the WI-01
antigen
Enzyme immunoassay test to detect B. dermatitidis antigen in urine
ELISA
PCR tests are used as supportive evidence to complete a clinical
picture rather than as a sole method of diagnosis.
1.3.5. Histopathology
B. dermatitidis in tissue appears as yeasts, 8 to 15 μm in diameter, have thick
refractile cell walls, and may show a single, broad-based bud. The thick refractile
cell wall of this organism gives the appearance of a space between the fungal cell
contents and the surrounding tissue when hematoxylin and eosin (H&E) stain is
used. Inside the cell wall, the multiple nuclei of the yeast stain with hematoxylin.
The contour of the yeast is best highlighted by staining the cell wall with fungal
silver stains such as GMS or periodic acid-Schiff (PAS) stain. The inflammatory
reaction accompanying the yeasts is primarily granulomatous with various degrees
of neutrophilic infiltrate.
Lung biopsy,Gomory stain skin biopsy, PAS stain Broad-based budding cells Granuloma with
suppuration
1.3.6. Isolation of the organism
Suspected material is plated on Sabouraud agar and blood agar and incubated
at 25 and 37 C , respectively. Growth is quite slow and may need 2 months or
more.
1.4.
Treatment
1.4.1. Amphotericin B, The desoxycholate form of amphotericin B is most
commonly administered as an intravenous infusion in doses of dose
(0.5 mg/kg) diluted in 5% dextrose in water solution or 2.5% dextrose
in 0.45% saline solution (500 ml for dogs < 20 kg; 1,000 ml for dogs >
361
20 kg).It may be administered during the initial treatment of dogs with
severe or rapidly progressive blastomycosis to improve the rate of
recovery.
1.4.2. Itraconazole is the azole most often recommended for treating dogs
with blastomycosis since it is as effective as amphotericin B but is
associated with fewer adverse effects and can be administered orally at
a dose of 5 mg/kg orally twice a day for five days, followed by 5
mg/kg once daily, or divided twice daily, for the remainder of the
treatment period.
1.4.3. Fluconazole (2.5 to 5 mg/kg orally or intravenously twice a day)
1.4.4. Voriconazole (5 to 10 mg/kg orally or intravenously twice a day)
1.5.
PROGNOSIS
Most dogs with brain involvement will die
Dogs with severe diffuse pulmonary blastomycosis often deteriorate
during the first two or three days of treatment
1.6. Reports
1.6.1. Reports on blastomycosis in dogs
Clinical
1. Pulmonary blastomycosis (McGuire et al, 2002, Crews et al., 2008a, Crews et al.,
2008b, McMillan and Taylor, 2008, Reed et al., 2010))
2. Nasal blastomycosis (Wehner et al., 2008, Parker et al., 2013)
3. Ocular blastomycosis (Hendrix et al., 2004, Baron et al, 2011))
4. Cardiovascular lesions (Schmiedt et al., 2006
5. Central nervous system blastomycosis (Lipitz et al., 2010. Hecht et al,.
2011, Bentley et al., 2013)
6. Blastomycotic osteomyelitis/arthritis (Harasen, 2007, Whelen, 2008,
Oshin et al., 2009, Woods et al.,2013)
7. Blastomycotic prostatitis (Totten et al, 2011)
8. Blastomycotic mastitis (Ditmyer and Craig, 2011)
9. Systemic blastomycosis with neurologic involvement (Gaunt et al., 2009
Diagnosis
1. Radiographic examination (Crews et al., 2008a, Oshin et al., 2009, Hecht et al,.
2011)
2. Enzyme-linked immunosorbent assay (Bono et al., 1995, Fisher et al., 1995,
Fisher et al., 1997, Wakamoto et al., 1997a, Wakamoto et al., 1997b, Shurley et
al., 2005, Sestero and Scalarone, 2006, Gaunt et al., 2009, Boyd et al., 2013,
Mondada et al., 2014, Mourning et al., 2015)
3. Enzyme immunoassay (EIA) (Spector et al., 2008, Foy et al., 2014))
4. Agar gel immunodiffusion (AGID (Spector et al., 2008, Mourning et al.,
2015)
5. Histological examination (Crews et al., 2008b, Gaunt et al., 2009,
6. PCR assay (Bialek et al., 2003
7. Molecular typing (Anderson et al., 2013)
Treatment
361
1. Itraconazole (Hendrix et al., 2004, Finn et al., 2007, Crews et al., 2008b,
Spector et al., 2008, Wehner et al., 2008, Whelen, 2008, Mazepa et al., 2011,
Totten et al, 2011, Parker et al., 2013)
2. Fluconazole (Mazepa et al., 2011, Totten et al, 2011)
3. Amphotericin B (Finn et al., 2007, Oshin et al., 2009)
4. Vaccine (Wüthrich et al., 2011)
Zoonotic aspects (MacDonald et al., 2006, Herrmann et al., 2011, Anderson et al., 2013
Risk factors of canine blastomycosis (Chen et al., 2008
Bono et al. (1995) prepared a Blastomyces dermatitidis (dog isolate T-58) yeast
phase lysate antigen, which was then concentrated and separated by Rotofor
preparative isoelectric focusing cell (Bio-Rad). The pH values of the fractions were
determined and equilibrated to pH 7.2 and then analysed by enzyme-linked
immunosorbent assay using horseradish peroxidase enzyme system against serum
specimens from dogs with blastomycosis, histoplasmosis, aspergillosis, and
coccidioidomycosis. The results showed a peak absorbance at pH 3.89-4.31 (fractions
4 and 5) with the blastomycosis serum specimens. This was a single sharp peak while
the
rest
of
the
fractions
were
lower.
In
contrast
the
sera
from dogs with histoplasmosis showed a peak absorbance at pH 5.54-5.97 (fractions 9
and 10), while the other mycoses showed patterns that did not resemble the
blastomycosis or histoplasmosis specimens. Serum specimens from dogs with
blastomycosis being treated with itraconazole were also assayed (pre-treatment and 1,
2, 3, and 12 months post-treatment sera). The characteristic peak for blastomycosis
was observed and a decrease in the peak was seen as the treatment progressed.
Fractions 3-12 were also used to detect delayed dermal hypersensitivity in
hyperimmunized hairless guinea-pigs. Fraction 5 (pH 4.31) elicited the optimal
response in B. dermatitidis-immunized animals, while no cross-reactivity was
observed in guinea-pigs sensitized with Histoplasma capsulatum killed cells.
Fisher et al. (1995) prepared Blastomyces dermatitidis yeast lysate antigen (T-58,
dog isolate) fractions using the Rotofor preparative isoelectric focusing (IEF) cell
(Bio-Rad) and compared them with B. dermatitidis yeast lysate and filtrate reagents
with respect to the detection of antibodies in sera from dogs with
blastomycosis, histoplasmosis, coccidioidomycosis, cryptococcosis and aspergillosis.
A horseradish peroxidase enzyme immunoassay with Turbo TMB substrate was
used in the study. One particular IEF fraction (pH 4.3) was optimal in the assay, and it
exhibited greater sensitivity (100%) and specificity (93%) than the lysate or filtrate
preparations. The highest degree of cross-reactivity was encountered with
the histoplasmosis and coccidioidomycosis specimens and considerably less with the
cryptococcosis and aspergillosis sera. Studies are in progress to purify further the
optimal IEF fraction.
Fisher et al. (1997) analyzed fractions of a Blastomyces dermatitidis yeast lysate
antigen for the presence of glycoproteins that may lead to cross-reactivity in
immunoassays for the diagnosis of blastomycosis. Five major glycoproteins were
apparent, two of which showed cross-reactivity when used in Western blots with sera
obtained from dogs with histoplasmosis and coccidioidomycosis. These five
glycoproteins were characterized for linkage to the proteins using N-glycosidase F
(NGF) and for their lectin binding properties. The cross-reactive 235- and 160-kDa
362
glycoproteins were found to possess mainly O-linked, high-mannose-type
carbohydrates, and periodate-mediated oxidation of these molecules eliminated crossreactivity observed with heterologous sera. Thus, the periodate-treated IEF antigens
described here may be useful in solid-phase enzyme immunoassays for the diagnosis
of blastomycosis.
Wakamoto et al. (1997a) prepared yeast-phase lysate antigens from 10 different
isolates of Blastomyces dermatitidis. Comparative studies were performed using the
lysate antigens in an enzyme-linked immunosorbent assay (ELISA) for the detection
of antibodies in sera from dogs with blastomycosis andhistoplasmosis. In order to
evaluate the ability of the lysate reagents to elicit delayed dermal hypersensitivity
(DTH) responses, the lysates were compared as skin-testing antigens in hairless
guinea pigs that were previously sensitized with B. dermatitidis or Histoplasma
capsulatum killed whole yeast cells. All ten of the lysate reagents were able to detect
antibody with the ELISA in the serum specimens from dogs with blastomycosis
(absorbance values ranged from 0.184 to 0.272; mean value 0.235). In contrast, when
the lysates were assayed against sera from dogs withhistoplasmosis, the absorbance
values ranged from 0.053 to 0.151, with a mean value of 0.092. All ten lysate antigens
were able to elicit a DTH response in the B. dermatitidis-immunized animals (mean
axes of induration values ranged from 7.0 to 14.4 mm; mean value 8.6 mm). On the
other hand, only minimal reactivity was evidenced in the guinea pigs immunized with
H. capsulatum (mean axes of induration values ranged from 0.8 to 2.9 mm; mean
value 1.8 mm).
Wakamoto et al. (1997b) performed comparative evaluations to assess the stability,
sensitivity and specificity of eight lots of yeast lysate antigen prepared from a
Blastomyces dermatitidis dog isolate (T-58). These antigens were prepared during the
period from 1989 to 1995. The lysates were used in an ELISA for the detection of
antibodies in serum specimens from dogs with blastomycosis and histoplasmosis. In
order to evaluate the ability of the lysates to elicit delayed dermal hypersensitivity
(DTH) responses, they were compared as skin-testing antigens in guinea pigs that
were previously sensitized with B. dermatitidis or Histoplasma capsulatum killed
whole yeast cells. All 8 of the lots of antigen detected antibody in the sera from
dogs with blastomycosis (absorbance values ranged from 0.432 to 0.543; mean value
of 0.508). The absorbance values ranged from 0.283 to 0.439 (mean value of 0.326)
when the lysates were assayed against sera from dogs with histoplasmosis. All of the
antigens were able to elicit a DTH response in B. dermatitidis immunized animals
(mean axes of induration values ranged from 10.5 mm to 12.5 mm; mean value of
11.6 mm). In contrast, only minimal cross-reactivity was evidenced in the guinea pigs
immunized with H. capsulatum (mean axes of induration values ranged from 0 to 4.5
mm; mean value of induration of 1.7 mm).
Bateman (2002) diagnosed systemic blastomycosis in a 5-year-old German shepherd
histologically at necropsy. Diagnosis and treatment were difficult due to unusual
neurological symptoms, the absence of abnormalities on diagnostic tests, and the
advanced stage of the disease at presentation.
McGuire et al. (2002) presented an 8-year-old, male castrated golden retriever with
cough and increased respiratory effort. Radiographs revealed an alveolar pattern in the
right caudal lung lobe and an opacity at the carina suspected to be enlarged
tracheobronchial lymph nodes. The disease progressed to involve the right middle
lung lobe. Cytopathology of a fine-needle aspirate and bronchoalveolar lavage fluid
363
were non-diagnostic. Surgical removal of the right caudal lung lobe and biopsy of the
perihilar lymph nodes revealed pulmonary thromboembolism and reactive lymph
nodes. The dog died several days postoperatively, and necropsy revealed diffuse
pulmonary thromboembolism. Additionally, Blastomyces dermatitis organisms were
identified in a pyogranulomatous mass surrounding the trachea near the carina.
Bialek et al. (2003) developed a Blastomyces dermatitidis nested PCR assay
targeting the gene encoding the Wisconsin 1 (WI-1) adhesin and compared it with a
nested PCR targeting the 18S rRNA gene (rDNA) of members of the family
ONYGENACEAE. They examined 73 paraffin-embedded tissue samples obtained
from nine dogs which died of blastomycosis and nine dogs which succumbed to
lymphosarcoma according to autopsy findings; amplifiable canine DNA was extracted
from 25 and 33 specimens from the two groups, respectively. The B. dermatitidis
PCR amplified DNA from 8 of 13 tissue samples in which yeast cells were detected
by microscopy. Sequencing revealed that all PCR products were homologous to the B.
dermatitidis WI-1 adhesin gene. No PCR product was amplified from 12
microscopically negative biopsy specimens from dogs with blastomycosis or from 33
biopsy specimens from dogs with lymphosarcoma. The 18S rDNA PCR amplified
DNA from 10 and 9 tissue samples taken from dogs which died of blastomycosis and
lymphosarcoma, respectively. Only six products were identified as being identical to
B. dermatitidis 18S rDNA; they were exclusively obtained from specimens positive
by the B. dermatitidis nested PCR. For specificity testing, 20 human biopsy
specimens proven to have histoplasmosis were examined, and a specific H.
capsulatum product was amplified by the 18S rDNA PCR from all specimens,
whereas no product was obtained from any of the 20 samples by the B. dermatitidis
PCR assay. In conclusion, the PCR targeting a gene encoding the unique WI-1
adhesin was proved to be as sensitive as but more specific than the PCR targeting the
18S rDNA for detection of B. dermatitidis in canine tissue.
Hendrix et al. (2004) performed a retrospective study to compare prevalence of
organisms and histologic changes in eyes from 36 dogs with endophthalmitis associated
with blastomycosis that were either untreated or undergoing treatment with itraconazole.
Signalment, results of ophthalmic examination, and duration of treatment with itraconazole
were extracted from medical records. Histologic sections from eyes were examined for
prevalence and viability (ie, budding) of fungal organisms. A scoring system was devised to
assess the degree of inflammation. Clinically, all eyes were blind and had signs of severe
endophthalmitis. Histologically, the type and degree of inflammation and prevalence of
Blastomyces dermatitidis were not significantly different between dogs treated with
itraconazole and untreated dogs or among groups of dogs treated for different time periods (4
to 14, 15 to 28, or 29 to 72 days). Replication of the organisms in vascular tissues as well as
avascular spaces in the eyes was similar in treated and untreated dogs. Lens rupture was seen
in 12 of 29 (41%) eyes.
Shurley et al. (2005) used a competitive binding inhibition enzyme linked
immunosorbent assay (ELISA) to detect Blastomyces dermatitidis antigens in urine
specimens from dogs with blastomycosis. Sera from rabbits immunized with B.
dermatitidis killed whole yeast cells were used as the primary antibody in the
competitive ELISA. This initial study was performed to determine if B. dermatitidis
antigen detection was possible and to test the efficacy of the rabbit sera as a primary
antibody. An indirect ELISA was also performed to compare antigen detection in
urine to antibody detection in the sera of the infected dogs. The results indicate 100%
(36/36 specimens) detection of both antigen and antibody. Cross reactivity with
364
Histoplasma capsulatum, as well as non-specific binding with the normal urine
specimens, was observed with the competitive binding inhibition ELISA.
MacDonald et al. (2006) investigated a cluster of blastomycosis in 8 humans and
4 dogs in a rural North Carolina community. Delayed diagnosis, difficulty isolating
Blastomyces dermatitidis in nature, and lack of a sensitive and specific test to assess
exposure make outbreaks of this disease difficult to study
Schmiedt et al. (2006) identified dogs with cardiovascular lesions caused
by blastomycosis from retrospective evaluation of medical records. Five dogs had de
novo infections and 3 had recurrences of previously treated infections. Harsh labored
breathing, lethargy, and anorexia were the most common historic complaints.
Three dogs had syncope. Physical examination and clinicopathologic data were
typical of blastomycosis and included dyspnea, increased lung sounds, and lethargy.
In addition, 3 dogs had heart murmurs and 1 had a third-degree atrioventricular block.
Four dogs had myocarditis and 2 had pericarditis or epicarditis. Two dogs had cardiac
signs attributed to extracardiac compression by fungal granulomas and clinical signs
were relieved by treatment. Half of the remaining 6 dogs were euthanized; 2 of these
were not treated. Of the remaining 3 dogs, 1 dog died acutely while sleeping; the
second died intraoperatively during an attempt to place an epicardial pacemaker; and
the third had Blastomyces-induced endocarditis and died of heart failure.
Right parasternal long axis echocardiographic image from a dog with a granuloma within the
interventricular septum due to Blastomyces dermatitidis infection. Asterisk indicates the focal
thickening of the interventricular septum at the level of the lesion. LA, left atrium; LV, left ventricle;
RA, right atrium. Schmiedt et al. (2006)
365
Postmortem specimen from the same dog. The left ventricle is opened and the interventricular septal
granuloma is indicated by the arrow Schmiedt et al. (2006)
Sestero and Scalarone (2006) carrrried out a study to compare the efficacy of eight
Blastomyces dermatitidis yeast phase lysate antigens (T-58: dog, Tennessee; T-27:
polar bear, Tennessee; ERC-2: dog, Wisconsin; B5894: human, Minnesota; SOIL:
soil, Canada; B5896: human, Minnesota; 48089: human, Zaire; 48938: bat, India) in
the detection of the immunoglobulins IgG and IgM in serum specimens from canines
with blastomycosis. An indirect enzyme-linked immunosorbent assay (ELISA,
peroxidase system) was used to analyze sera collected during four different intervals
post-infection. The yeast lysate antigen 48938 was a reactive antigen for the detection
of both IgG (mean absorbance value range: 1.198-2.934) and IgM (mean absorbance
value range: 0.505-0.845). For the same sera, antigen T-27 was also effective in the
detection of IgG (mean absorbance value range: 0.904-3.356) and antigen 48089 was
useful for the detection of IgM (mean absorbance value range: 0.377-0.554). The
yeast lysate antigen B5894 proved to be a poor antigen for the detection of both IgG
and IgM (mean absorbance value ranges: 0.310-0.744 for IgG, 0.025-0.069 for IgM).
Inherent variations in yeast lysate antigens such as these may be utilized to develop
improved immunoassay procedures for the specific detection of IgG or IgM in cases
of blastomycosis.
Crews et al. (2007) performed a retrospective study to determine blood ionized
calcium
(iCa)
and
serum
total
calcium
(tCa)
concentrations
in dogs with blastomycosis and to evaluate whether serum tCa concentration,
albumin-adjusted serum calcium concentration (AdjCa-Alb), and total proteinadjusted serum calcium concentration (AdjCa-TP) accurately predict iCa status. The
study covered 38 client-owned dogs with a cytologic diagnosis of blastomycosis.
Dogs were classified as hypocalcemic, normocalcemic, or hypercalcemic on the basis
of blood iCa concentration, serum tCa concentration, AdjCa-Alb, and AdjCa-TP;
classification on the basis of serum tCa concentration, AdjCa-Alb, and AdjCa-TP was
366
compared with blood iCa concentration. Except for 2 hypercalcemic dogs,
all dogs had blood iCa concentrations within the reference interval. Use of serum tCa
concentration overestimated hypocalcemia in 57.9% (22/38) of dogs and
underestimated hypercalcemia in 1 dog. Use of AdjCa-Alb correctly reclassified
all dogsas normocalcemic that were classified as hypocalcemic on the basis of serum
tCa concentration, but failed to predict hypercalcemia in 1 dog. Use of AdjCa-TP
correctly reclassified all but 2 dogs as normocalcemic that were classified as
hypocalcemic on the basis of serum tCa concentration, and failed to predict
hypercalcemia in 1 dog. No correlation was found between blood iCa concentration
and serum concentrations of tCa, total protein, and albumin; AdjCa-Alb; or AdjCaTP. It was concluded that high blood iCa concentration was uncommon
in dogs with blastomycosis. Hypoalbuminemia contributed to a low serum tCa
concentration despite a blood iCa concentration within reference limits. The use of
serum tCa concentration, AdjCa-Alb, and AdjCa-TP may fail to identify a small
number of dogs with high blood iCa concentrations.
Finn et al. (2007) carried out a retrospective study to evaluate the success of the use
of systemic corticosteroids and antifungal medications in the treatment of dogs with
ocular lesions associated with systemic blastomycosis. Medical records of
25 dogs diagnosed with blastomycosis, via either cytology or histopathology, at the
Purdue University Veterinary Teaching Hospital between 1 January 2000 and 1
January 2005, were reviewed. Data collected from the medical records included
signalment, presence and progression of ocular lesions, antifungal drugs administered,
oral and topical corticosteroid administration, length of follow-up, response to
treatment, and visual outcome. Of the 25 cases reviewed, 12 dogs (19 eyes) with
follow-up information were found to have lesions consistent with
ocular blastomycosis. Length of follow-up in the 12 cases ranged from 1 month to 31
months with a mean of 9 months. Antifungal therapy for all cases consisted of oral
itraconazole (5 mg/kg every 24 h) initially. In seven cases, the antifungal drug
administered was changed from itraconazole to oral fluconazole. Two of these also
received intravenous amphotericin B, and two received additional treatment with
itraconazole. All 12 dogs also received oral prednisone. The dose of oral prednisone
utilized ranged from 0.2 mg/kg/day to 1.4 mg/kg/day with a mean of 0.7 mg/kg/day;
the duration of oral prednisone administration ranged from 2 weeks to 8.5 months
with a mean of 3 months. Topical prednisolone was a component of the treatment of
16 of the 19 eyes. Duration of topical prednisolone treatment ranged from 1 month to
30 months with a mean of 5 months. Lesions not located in the eyes exhibited a
positive response to treatment in 11 (92%) of the 12 dogs. Overall, 14/19 (74%)
affected eyes were visual at the time of their final recheck. All eyes with mild or
moderate lesions and 5/10 (50%) severely affected eyes were visual at their last
recorded recheck examination. The administration of systemic corticosteroids did not
appear to adversely affect the survival rate and might have played a role in
preservation of vision in a majority of dogs in this group with ocular blastomycosis.
367
Fundus photograph from a 5-year-old, neutered male Boxer diagnosed with blastomycosis. Lung, bone
and skin lesions were present in addition to the fundic lesion depicted here. (a) At presentation a
subretinal granuloma and associated serous retinal detachment affecting approximately 30% of the
fundus. (b) After 2 weeks of treatment with systemic itraconazole and systemic prednisone the retinal
detachment has flattened and the granuloma has decreased in size. (c) After an additional 6 weeks of
therapy the granuloma has further decreased in size and the lesion is becoming a chorioretinal scar.
Finn et al. (2007)
Harasen (2007) described a lytic lesion in the distal region of the ulna of a 2-year-old
spayed female boxer boxer presented with a 3-week history of right front lameness. The
owner had noticed a firm swelling on the lateral aspect of the distal part of the antebrachium, just proximal to the radiocarpal joint. Radiographs of the limb showed an oval
area of bone lysis in the distal part of the ulna approximately 5 cm long by 2 cm wide . The
lesion was surgically curetted and samples from it submitted for histopathologic analysis.
The remaining defect was filled with a combination of autogenous cancellous bone from the
proximal part of the ipsilateral humerus and a silica-based synthetic particulate bone
substitute. The histopathologic diagnosis on the curetted material was pyogranulomatous
osteomyelitis due to Blastomyces dermatitidis. The owner declined treatment options and
the dog was euthanized.
368
A lytic lesion in the distal region of the ulna of a 2-year-old boxer caused
by Blastomycosis osteomyelitis. Postoperative view of the lesion after surgical curettage and packing
with autogenous cancellous and synthetic graft material. Harasen (2007)
Chen et al. (2008) investigated environmental and host risk factors of canine
blastomycosis in Knox County, Tennessee, USA. Data on 78 cases and 146 randomly
selected controls were extracted from the medical database at the University of
Tennessee Veterinary Teaching Hospital for the period 1977-1999. Home addresses
of cases and controls were geocoded and linked to environmental risk factor data
using a Geographic Information System (GIS) software. Multiple logistic regression
analysis was performed to identify environmental and host factors associated with risk
of canine blastomycosis. Important risk factors in the study area were sex, breed, age,
and proximity to water whereas, soil type, pH, and organic matter content had no
significant associations with blastomycosis risk in this study area. Males were 2.7
times (OR =2.7; 95% CI =1.3, 5.3) more likely to have blastomycosis than females.
Blastomycosis risk was also higher in working (OR =4.6; 95% CI =1.5, 14.0) and
sporting dogs (OR =6.2; 95% CI =2.4, 16.0) than other breeds. Disease risk was
highest in 2-4-year-old dogs (OR =11.6; 95% CI =4.6, 29.1) and increased among
dogs living near water bodies. Blastomycosis control strategies need to be designed
with knowledge of the important risk factors in effect at the geographic location of
interest.
Crews et al. (2008a) carried out a retrospective to identify radiographic patterns in
125 dogs with pulmonary blastomycosis and radiographic factors associated with
369
outcome. Medical records were reviewed, and for each lung lobe, the primary
radiographic pattern and percentage of lobar involvement at the time of initial
examination were recorded. 79 dogs survived, 38 died, and 8 were euthanized without
treatment. The initial radiographic pattern was variable and not significantly
associated with outcome. Mean half-time for radiographic resolution of pulmonary
infiltrates was 41.4 days for all patterns except masses, for which mean half-time to
resolution was 90.8 days. Transient radiographic worsening was seen in 20 of 87
(23%) dogs but was not associated with a poor prognosis. Pulmonary bullae were seen
in 20 (16%) dogs, most often in association with an alveolar pattern. Accuracy of
using percentage of right caudal lung lobe involvement (<or= 20% vs > 20%) to
predict outcome was 74.4%; accuracy of using number of affected lobes (< 4 vs >or=
4) to predict outcome was 65.8%. Results suggested that a non-uniform distribution of
pulmonary infiltrates was equally as likely as a diffuse nodular interstitial pattern
in dogs with pulmonary blastomycosis. On the basis of half-time for resolution of
pulmonary infiltrates, follow-up radiography should be performed no more often than
every 4 to 6 weeks in clinically stable patients. Transient radiographic worsening that
occurred during the initial weeks of treatment was not associated with a poorer
prognosis.
Crews et al. (2008b) carried out a retrospective study to compare results of the most
common diagnostic tests for pulmonary blastomycosis in dogs, identify factors
associated with outcome, and determine response to various antifungal treatment
protocols on125 dogs with pulmonary blastomycosis. Medical records were reviewed,
and information was obtained regarding diagnostic methods, results of routine
laboratory testing, and radiographic response to antifungal treatment.
79 dogs survived, 38 died, and 8 were euthanized. Transthoracic fine-needle
aspiration and transtracheal lavage were the most common diagnostic methods.
Results of an agar gel immunodiffusion test for antibodies against Blastomyces
dermatitidis were negative in 12 of 24 (50%) dogs. Only 3 of 94 (3.2%) dogs in which
cytologic or histologic examination or bacterial culture of pulmonary samples were
performed had any evidence of concurrent bacterial infection. The half-time for
radiographic resolution of pulmonary infiltrates did not vary significantly with
antifungal treatment, and use of a loading dosage of itraconazole was not associated
with significant improvements in outcome or time to disease resolution.Dogs that died
had a higher number of band neutrophils at initial examination, compared with those
that survived.
McMillan and Taylor (2008) performed a retrospective study which identified B.
dermatitidis organisms in 76% of samples when transtracheal aspiration was performed in 17
non-sedated dogs with pulmonary blastomycosis.
Spector et al. (2008) used an enzyme immunoassay (EIA) for detection of
Blastomyces dermatitidis galactomannan antigen in body fluids has been used for
rapid diagnosis of blastomycosis in dogs. Serum and urine samples from 46 dogs
with confirmed blastomycosis were tested for Blastomyces antigen and serum was
tested for anti-Blastomyces antibodies. The sensitivity for the detection of antigen in
urine was 93.5% and it was 87.0% in serum. The sensitivity of antibody detection by
agar gel immunodiffusion (AGID) was 17.4% and it was 76.1% by EIA. Antigen and
antibody decreased during itraconazole treatment.
Wehner et al. (2008) examined a 2-year-old 38.9-kg (85.58-lb) sexually intact male
German Shepherd Dog because of a 4-month history of severe nasal swelling and
371
nasal mucosa congestion. The signs were slowly progressive. Physical examination
revealed that the dorsal aspect of the dog's nose was swollen and hard. Mucous
membranes in both nostrils were hyperemic and edematous. Diagnostic investigation
revealed severe nasal osteolysis and pyogranulomatous rhinitis and
nasopharyngitis attributable to blastomycosis. Oral administration of itraconazole
was initiated (5 mg/kg [2.27 mg/lb], q 12 h for 5 days and then q 24 h). After a
treatment period of 3 months, the nose had regained its normal appearance. After 5
months of treatment, the Blastomyces infection was eliminated as confirmed by
results of rhinoscopy and biopsy specimen examination. No relapse was evident
within 1 year after discontinuation of treatment.
Whelen (2008) suggested a protocol for treatment of canine blastomycotic
osteomyelitis as follows: itraconazole 5 mg/kg BW, PO, q12h for at least 1–2 wk (or
until the animal shows signs of feeling better), then a maintenance dose of 5 mg/kg
BW, PO, q24h for a minimum of another 90 d. Some animals will be fine with a
shorter course of treatment, but some need a significantly longer period on the
medication. He found that osteomyelitis responded very well to the treatment.
Gaunt et al. (2009) presented a 6-year-old spayed female, golden retriever from
Kenora, Ontario for progressive neurologic dysfunction. Clinical examination
suggested brainstem disease. Blastomycosis was diagnosed based on fine-needle
aspiration cytology of a normal sized lymph node of the swollen mandibular region
and a positive blastomycosis urine antigen test. On gross examination, a suppurative
exudate was present in and around the pituitary gland and an approximately 1.0 cm in
diameter focus of caseous necrosis was noted in the dorsolateral aspect of the left
caudal lung lobe. Histological examination of the left caudal lung lobe revealed
multiple, variably sized (0.1 to 0.5 mm), coalescing nodules comprised of an
inflammatory infiltrate and intralesional yeast organisms, as described in the
cerebrum. Inflammation and identical yeast organisms were identified on
histopathological examination of the pituitary gland and retropharyngeal lymph node.
The histopathological diagnosis was systemic blastomycosis. The previously
submitted urine blastomyces antigen enzyme-linked immunosorbent assay (ELISA)
test result was available 1 wk later, with a strong positive result. Blastomyces
dermatitidis was isolated from material cultured from the pituitary gland. The case
was diagnosed as systemic blastomycosis with neurologic involvement.
Oshin et al. (2009) presented a 4-year-old, spayed female, mixed-breed dog suffering
from chronic left hind-limb lameness. Lytic lesions were observed in the left patella
on radiographs of the stifle. A biopsy of the patella led to a histopathological
diagnosis of blastomycosis. Surgical debridement followed by a 90-day course of
itraconazole and physical rehabilitation resolved the clinical signs and stopped the
progression of radiographic lesions. Blastomycosis should be considered as a
differential diagnosis for stifle joint lameness with lytic lesions in the patella.
Varani et al. (2009) obtained two swabs each from the nares of 110 asymptomatic,
physically normal dogs from a veterinary practice in Eagle River, WI, USA, an area
highly endemic for blastomycosis. Four of the tested dogs had past histories
of blastomycosis. Samples were placed on yeast extract phosphate (Smith's) media at
20 degrees C but growth of Blastomyces dermatitidis was not observed on any of the
220 cultures. One dog developed cytologically confirmed B. dermatitidis one month
following culture of its samples, 6 died of other illnesses, while
91/103 dogs completing follow-up have remained asymptomatic for three years. They
371
did not observe nasal colonization by B. dermatitidis in this population of dogs with
potential for sniffing and digging in an environment highly endemic for this fungus.
Lipitz et al. (2010) reported the clinical and magnetic resonance imaging features of
central nervous system blastomycosis in 4 dogs.
(A) T2-weighted transverse magnetic resonance image from dog 1. There were hyperintense lesions in
the right temporal-piriform lobes (arrow) and the right temporalis muscle (arrowhead). (B) Transverse
T1-weighted image. The cerebral lesion is hypointense to grey matter and the muscle lesion is
isointense to normal muscle. (C) Transverse T1-weighted postcontrast image. Note the strong,
homogenous contrast enhancement in the right cerebral and temporal muscle lesions (arrows) and
meningeal enhancement (arrowhead). The hyperintensity on T2- weighted images (A) is larger than the
area contrast enhancing, suggesting perilesional edema. Lipitz et al. (2010)
T1-weighted postcontrast sagittal magnetic resonance image from dog 2. Lesions in the nasal cavity
and frontal cortex enhance strongly and homogenously with an area of ring enhancement (arrow).
Lipitz et al. (2010)
(A) T2-weighted transverse magnetic resonance image from dog 3 at the level of the occipital cortex.
Marked edema is present in the white matter of the left occipital cortex; the edema obscures the
occipital mass lesion. (B) T1-weighted postcontrast sagittal image. Note the uniform enhancement of
372
the lesion in the frontal cortex with an area of ring enhancement. Diffuse enhancement in the occipital
cortex (arrow) and meningeal enhancements (arrowhead) are present. Lipitz et al. (2010)
T1-weighted sagittal postcontrast image from dog 3 acquired 1 year after original magnetic resonance
imaging examination The previously described frontal and occipital lobe lesions have resolved and no
enhancement is present in the brain. Lipitz et al. (2010)
(A) T2-weighted fat saturation sagittal image from dog 4. The mass in the spinal cord over the C5-6
intervertebral disc space is hypointense centrally with a hyperintense rim (arrow). Note the perilesional
edema cranial and caudal to the mass (arrowheads). (B) Sagittal T1-weighted postcontrast image. There
is strong, uniform contrast enhancement of the mass. Lipitz et al. (2010)
373
Sagittal T2-weighted image from dog 4 acquired 20 months after original magnetic resonance imaging
examination. The mass in the spinal cord over the C5-6 intervertebral disc space is reduced in size and
there is resolution of perilesional edema. Lipitz et al. (2010)
Reed et al. (2010) reported a case of granulomatous pneumonia, prostatitis and uveitis
with intralesional yeasts consistent with Blastomyces in a 7-year-old sexually intact
male German Short-haired Pointer.
374
Reed et al. (2010)
Baron et al. (2011) reported a case that illustrated the clinical, MRI and
histopathologic findings in a dog with invasion of a retrobulbar blastomycotic
lesion into the calvarium. A 5-year-old intact female Weimaraner was referred for a 2month history of change in behavior and recent onset of visual deficits. Magnetic
resonance imaging (MRI) examination revealed a large (5.8 × 2.0 × 2.5 cm) mass
extending from the left orbit through a circular defect in the left cranioventral aspect
of the calvarium caudally to the level of the pituitary fossa and interthalamic
adhesion. The mass was heterogeneously iso- to hypointense on T2-W images,
slightly hypointense on T1-W images, did not attenuate on fluid attenuated inversion
recovery (FLAIR) images, and did not show evidence of susceptibility artifact on
T2*-W gradient recalled echo (GRE) images. Vasogenic edema and associated mass
effect were noted. The mass showed strong homogeneous contrast enhancement with
well-defined margins and had thickening of the adjacent meninges (dural tail sign).
Based on MRI findings a malignant neoplastic process was considered most likely
and the patient was placed on oral prednisone to decrease peri-tumoral inflammation.
The dog initially improved but was euthanized 3 weeks later for worsening clinical
signs. Histopathologic assessment of the mass revealed marked pyogranulomatous
optic
neuritis
with
intralesional
fungal
yeasts
consistent
with blastomycosis (Blastomyces dermatitidis).
375
Transverse pre- (a–c) and postcontrast (d–f) images of the brain and orbit. The retro-bulbar mass with
intracranial extension is heterogeneously iso- to hypointense to brain parenchyma on T2-W images (a:
TR = 5230 ms, TE 98 ms) and slightly hypointense on T1-W images (b: TR = 387 ms, TE = 15 ms).
There is no evidence of attenuation of any portion of the mass on fluid attenuated inversion recovery
(FLAIR) images (c: TR = 8000 ms, TE = 87 ms, TI = 2300 ms). Rightward shift of the falx cerebri and
T2 hyperintensity to brain parenchyma bordering the mass is consistent with mass effect and edema.
On post contrast transverse T1-W images (a: TR = 746; TE = 15), sagittal T1-W images (b: TR = 635,
TE = 15) and dorsal T1-W images with fat saturation (a: TR = 500, TE = 15) there is strong
homogeneous contrast enhancement of the mass with well-defined margins. Baron et al. (2011)
376
Photograph and photomicrographs of necropsy specimen. (a) Photograph of dissected left eye, optic
nerve and brain (oriented with globe to the right) demonstrating mass effect of inflammatory infiltrate
along the optic nerve. (b) Photomicrograph of inflammatory infiltrate (asterisks) compressing and
infiltrating meninges (arrows) and frontal portion of cerebrum. Hematoxylin and eosin stain. (c)
Photomicrograph of retro-bulbar tissue demonstrating separation and entrapment of nerves (arrows) by
inflammatory infiltrates and necrosis (asterisks). Hematoxylin and eosin stain. (d) Photomicrograph of
retro-bulbar tissue with multiple Blastomyces dermatitidis organisms (yeast) exhibiting narrow-based
budding. Gomori methenamine silver stain. Baron et al. (2011)
Baumgardner et al. (2011) studied over 18 years 219 dogs with blastomycosis from
a single veterinary practice in Northern Wisconsin. The 202 Vilas County dog
addresses were compared to 200 random-number selected addresses from the practice
registry. Street addresses were geocoded and mapped using ArcGIS, including ratio of
cases/random addresses to construct a control chart. Stepwise and linear regression
was used to model case counts by season and by 6 month warm (April-September)
and cold periods, using lagged local weather data. The geographic distribution of
cases was found to be similar regardless of season and time period, and no season
exceeded control chart limits. Seasonal distribution of cases was; winter (n = 53,
24%), spring (39, 18%), summer (79, 36%), fall (48, 22%), p = 0.002. When cases
were considered by 6-month warm/cold periods, 67% of variation is explained by the
total precipitation which occurred two periods prior, and lower average temperature,
but higher maximum temperature one period prior (p = 0.000). Weather parameters
along with fixed and variable environmental factors likely determine the occurrence
of B. dermatitidis, perhaps as part of a 'grow and tolerate change' model.
Ditmyer and Craig (2011) described three cases in which mammary tissue samples
were submitted to the Department of Pathobiology, University of Tennessee, College
of Veterinary Medicine with clinical suspicion of neoplasia or postpartum bacterial
mastitis. Pyogranulomatous to granulomatous mastitis and dermatitis with
intralesional yeast consistent with Blastomyces dermatitidis were diagnosed. Two of
377
the three dogs also had lymph node and pulmonary involvement. Mycotic mastitis due
to Blastomyces dermatitidis is rarely reported and blastomycosis should be considered
in the differential diagnosis of dogs with mammary lesions from endemic areas.
Hecht et al. (2011) carried out a study to describe clinical and imaging findings
in dogs with intracranial blastomycosis (Blastomyces dermatiditis). The radiology
database was searched retrospectively for patients with a diagnosis of
intracranial blastomycosis which had computed tomography performed as part of their
diagnostic work-up. Medical records and imaging studies were reviewed.
Five dogs met the inclusion criteria. Major presenting complaints were stertor/nasal
discharge (n=2), exophthalmos (n=1), and seizures (n=2). Clinical and laboratory
findings were variable. Computed tomographic examination revealed a single
contrast-enhancing intra-axial mass (n=1), a nasal mass disrupting the cribriform plate
(n=3), and an intracranial mass extending into the orbit and nasal cavity (n=1).
Findings in intracranial blastomycosis in dogs were variable, and the disease may
mimic other inflammatory disorders or neoplasia.
Herrmann et al. (2011) carried out a retrospective cross-sectional survey to compare
the temporal and spatial distribution of cases of blastomycosis among humans and
dogs in Illinois from 2001 through 2007. For each year, human population data were
obtained from the US Census Bureau, and the total number of dogs was estimated by
use of a human population-based formula. Data regarding infections with
Blastomyces dermatitidis in humans were accessed from the Illinois Department of
Public Health. Data regarding B dermatitidis infections in dogs were acquired through
a survey of a random sample of the 747 veterinary medical practices in Illinois.
Statistical analyses of human and canine data were performed by use of t tests,
ANOVA, odds ratio assessment, and regression modeling. Estimated annual incidence
of human cases of blastomycosis in Illinois increased from 3.8 to 10.7 cases/1 million
persons/y from 2001 through 2007. Analysis of data from 221 veterinary practices
revealed that the mean estimated annual incidence of canine cases of blastomycosis
was 8.3 times the mean estimated annual incidence of human cases, with a similar
pattern of change and regional distributions. Thirty-eight counties reported either
human or canine cases but not both. In conclusion, the estimated annual incidence of
blastomycosis in humans and dogs in Illinois increased during the period of interest.
Veterinarians, physicians, and public health agencies should be encouraged to
communicate with each other regarding diagnoses of blastomycosis in either species
to facilitate early diagnosis and treatment.
Mazepa et al. (2011) performed a study to compare incidence of clinical remission
and death; treatment duration; total drug cost; incidence of relapse; and incidence of
increased ALT activities in dogs with blastomycosis treated with fluconazole or
itraconazole. One hundred and forty-four dogs with systemic blastomycosis treated
with itraconazole or fluconazole from 1998 to 2008 were included in the study.
Retrospective case review. Information obtained included signalment, body weight,
clinical signs, drug regimen, treatment duration, time to clinical remission, and
laboratory results. Neither treatment efficacy between fluconazole (75% remission)
and itraconazole (90% remission) nor relapse rate (18% for itraconazole, 22% for
fluconazole) was significantly different (P = .13, .75, respectively). Treatment
duration was significantly longer for fluconazole (median 183 days) than for
itraconazole (138 days; P = .001). Costs for fluconazole (median $1,223) were
significantly less than for itraconazole ($3,717; P < .001). Incidence of increased ALT
activities was not significantly different between groups (17% [3/18] for fluconazole,
378
26% [6/23] for itraconazole; P = .71). It was concluded that fluconazole was
associated with survival to clinical remission in 75% of dogs with blastomycosis.
Although dogs receiving fluconazole were treated longer, drug costs were one-third
those of itraconazole. Hepatotoxicosis, as estimated by increases in serum ALT
activity, could be observed with similar incidence for both drugs.
Totten et al. (2011) performed a retrospective case study of eight dogs diagnosed
with prostatic or testicular B. dermatitidis infection. Signalment, clinical
presentation, diagnostic procedures, and treatment options were evaluated. Review of
medical records of dogs diagnosed with blastomycosis at the University of Illinois
Veterinary Teaching Hospital from 1992 to 2005 yielded four dogs with prostatic
blastomycosis (PB) and four dogs with testicular blastomycosis (TB). Three of the
four dogs with PB and all four dogs with TB had evidence of urogenital disease.
Three dogs with PB had an elevated body temperature and all had systemic disease.
All dogs with TB had a normal body temperature, and three had systemic disease and
one had clinical signs limited to testicular disease. Cytology or histopathology was
used to diagnose PB or TB. Treatment included itraconazole or fluconazole with or
without nonsteroidal anti-inflammatory drugs. PB and TB are infrequently recognized
and may be under diagnosed due to failure to specifically evaluate these tissues. PB or
TB should be considered in the evaluation and staging of male dogs with
blastomycosis. Male dogs with urogenital signs should be evaluated via prostatic or
testicular cytology or histopathology since proper identification and management of
PB or TB may improve overall treatment success.
Wüthrich et al. (2011) studied the safety, toxicity, and immunogenicity of a
genetically engineered live-attenuated strain of B. dermatitidis lacking the major
virulence factor BAD-1, which successfully vaccinated against lethal experimental
infection in mice, in dogs, using 25 beagles at a teaching laboratory and 78 foxhounds
in a field trial. In the beagles, escalating doses of live vaccine ranging from 2 × 10⁴ to
2 × 10⁷ yeast cells given subcutaneously were safe and did not disseminate to the lung
or induce systemic illness, but a dose of < 2 × 10⁶ yeast cells induced less fever and
local inflammation. A vaccine dose of 10⁵ yeast cells was also well tolerated in
vaccinated
foxhounds
who
had
never
had blastomycosis;
however,
vaccinated dogs with prior infection had more local reactions at the vaccine site. The
draining lymph node cells and peripheral blood lymphocytes from
vaccinated dogs demonstrated gamma interferon (IFN-γ), tumor necrosis factor alpha
(TNF-α), and granulocyte-macrophage colony-stimulating factor (GM-CSF)
specifically in response to stimulation with Blastomyces antigens. Thus, the liveattenuated vaccine against blastomycosis studied here proved safe, well tolerated, and
immunogenic in dogs and merits further studies of vaccine efficacy.
Anderson et al. (2013) used veterinary and human isolates matched with
epidemiological case data from the same geographic area and time period to
determine: (i) if differences in genetic diversity and structure exist between clinical
veterinary and human isolates of B. dermatitidis and (ii) if comparable epidemiologic
features differ among veterinary and human blastomycosiscases. Genetic typing of
301 clinical B. dermatitidis isolates produced 196 haplotypes (59 unique to veterinary
379
isolates, 134 unique to human isolates, and 3 shared between canine and human
isolates). Private allelic richness was higher in veterinary (median 2.27) compared to
human isolates (median 1.14) (p = 0.005). Concordant with previous studies, two
distinct genetic groups were identified among all isolates. Genetic group assignment
was different between human and veterinary isolates (p < 0.001), with more
veterinary isolates assigned to Group 2. The mean age of dogs diagnosed
with blastomycosis was 6 years. Thirty cases were in male dogs (52%) and 24 were
females (41%). The breed of dog was able to be retrieved in 38 of 58 cases with 19
(50%) being sporting breeds. Three of four felines infected with blastomycosis were
domestic shorthair males between ages 6-12, and presented with disseminated disease.
The other was a lynx with pulmonary disease. The equine isolate was from an 11year-old male Halflinger with disseminated disease. Disseminated disease was
reported more often in veterinary (62%) than human cases (19%) (p < 0.001). It was
concluded that isolates from all hosts clustered largely into previously identified
genetic groups, with 3 haplotypes being shared between human and canine isolates
confirming that B. dermatitidis isolates capable of infecting both species occur in
nature. Allelic diversity measures trended higher in veterinary samples, with a higher
number of total alleles and private alleles.
Bentley et al. (2013) performed a retrospective study to determine whether other MRI
characteristics of CNS blastomycosis may also occur. Medical records of the Purdue
University Veterinary Teaching Hospital were searched and four dogs met inclusion
criteria. Magnetic resonance imaging characteristics included periventricular edema,
periventricular and meningeal contrast enhancement, and ventriculomegaly.
Periventricular lesions most commonly involved the rostral horn of the lateral
ventricles and the third ventricle. Increased meningeal contrast enhancement involved
the cerebrum, thalamus, sella turcica, and brainstem. Findings indicated that, in
addition to mass lesions, MRI characteristics of periventricular hyperintensity,
contrast enhancement, and ventriculomegaly may also occur in dogs with
CNS blastomycosis.
381
Transverse T2-weighted (A) and fluid attenuation inversion recovery (B–E) magnetic resonance
images of four dogs with central nervous system blastomycosis. Images are at the level of the
diencephalon (Case 1;A), the occipital lobes (Case 2; B), the level of the diencephalon and the rostral
midbrain (Case 3; C and D, respectively) and the frontal lobe (Case 4; E). With respect to normal
cerebrospinal fluid, the signal from the lumen of the third ventricle is T2-hypointense; a T2hypointense structure is also seen in the region of the choroid plexus of the right lateral ventricle (A).
With respect to normal periventricular gray and white matter as appropriate, periventricular
hyperintensity is present surrounding the lateral ventricles (A, C) and in both occipital lobes
immediately caudal to the lateral ventricles (B), the third ventricle (A), the caudal part of the caudate
nuclei and the diencephalon immediately rostral to the third ventricle (C), the corpus callosum (A, C,
and D), the rostral occipital lobe, and the midbrain ventral to the mesencephalic aqueduct (D), and
encircling the rostral horns of the lateral ventricles (E). Note that the 4th ventricle (B), mesencephalic
381
aqueduct (D), and one right lateral ventricle (E) cannot be well distinguished due to collapse, or
displacement of cerebrospinal fluid by abnormal fluid or tissue. There is relative sparing of
parenchyma besides the periventricular lesions. The subarachnoid space is difficult to visualize around
much of the cerebral hemispheres. Bentley et al. (2013)
Transverse postcontrast T1-weighted magnetic resonance images at the level of the rostral horn of the
lateral ventricle in four dogs with central nervous system blastomycosis (A, B, C, D; Cases 1–4,
respectively). Ependymal or periventricular parenchymal contrast enhancement is present in the ventral
portion of the rostral horn in seven of the eight lateral ventricles. A lateral ventricle is completely (A)
or mostly (D) effaced by contrast enhancing material in two dogs. Segmental enhancement of the
meninges is also variably present across the four cases; note the lack of parenchymal enhancement.
Bentley et al. (2013)
382
A section of the brain (A) and matching, slightly more rostral postcontrast T1-weighted transverse
magnetic resonance image (B) from a 3-year-old male neutered Golden Retriever dog with central
nervous system blastomycosis (Case 1) at the level of the diencephalon. The ventral portion of the third
ventricle is occluded (A, B). The choroid plexus of the right lateral ventricle, and its extension into the
dorsal third ventricle, is irregularly thickened (A, B). The ventral portion of the third ventricle is filled
with contrast enhancing material and there is also contrast enhancement in the region of the sella
turcica, the ventral meninges of the thalamus and segmental enhancement of the meninges of the
cerebral cortex (B). Bentley et al. (2013)
383
Transverse magnetic resonance images at the level of the C1 vertebra of a dog with central nervous
system blastomycosis (Case 4). T2-weighted (A), fluid attenuation inversion recovery (B), T1weighted (C), and T1-weighted postcontrast (D) images. Compared to normal gray and white matter
respectively, the gray matter and the dorsal funiculus are indistinctly T2-hyperintense (A, B). The
outline of the central canal is difficult to visualize (B, C). There is severe, circumferential contrast
enhancement of the ependyma or adjacent parenchyma but not the meninges (D). Bentley et al. (2013)
Boyd et al. (2013) performed a study to evaluate the diagnostic sensitivity of
Blastomyces dermatitidis yeast lysate antigens with respect to antibody detection
in dogs with blastomycosis. Lysate antigens were prepared from B. dermatitidis
isolates T-58 and T-66 (dogs, Tennessee) and WI-R and WI-J (dogs, Wisconsin).
Based on results obtained from a preliminary comparative study, five combinations of
these isolates and one individual isolate were tested against 92 serum specimens
from dogs with culture-proven or histologically-confirmed blastomycosis, using the
indirect enzyme-linked immunosorbent assay (ELISA). Mean absorbance values
obtained from the sera ranged from 0.905 with the individual T-58 antigen to 1.760
using an antigen combination (T-58 + T-66 + WI-R). All of the 6 antigenic
preparations were able to detect antibody in the serum specimens, but the antigen
combinations detected antibody to a higher degree than the individual antigen. The
study provided evidence that combinations of the yeast lysate reagents were more
efficacious for antibody detection in dog sera.
Parker et al. (2013) described a case of localized oronasal blastomycosis mimicking
oral neoplasia. Long-term therapy with itraconazole resulted in clinical cure.
384
Sagittal MRI images of the lesions affecting the hard and soft palates, nasal passages, and dorsal nose
using an ultrashort T1, Fat Saturated, MPR, VIBE sequence in pre (A) and post (B) IV contrast for
maximal spatial resolution. Notice the extent of the infiltration as depicted by the hyperintense contrast
enhancement throughout the oral, pharyngeal, dorsal nasal, nasal, and mandibular lymph node tissues.
Parker et al. (2013)
Transverse MRI images at the level of the maxillary carnassial (108 and 208) teeth. On T2W (A) the
nasal and palate tissues are hyperintense to normal muscle and thickened. There is hyperintense
thickened nasal mucosa. In the precontrast T1W image (B), the thickened tissues are isointense to
normal soft tissues and the nasal mucosa is hypointense. All the affected nasal and palate tissues
contrast enhance (C: Post Contrast T1W) demonstrating the extensive infiltrative process. On all
images the dorsal left nasal bone is disrupted, along with a portion of the hard palate Parker et al.
(2013)
Woods et al. (2013) presented a 6-month-old male castrated Labrador retriever for
coughing and forelimb lameness. Blastomyces dermatitidis was identified in cytology
of sputum and synovial fluid. Repeat arthrocentesis 7 months later revealed resolution
of septic arthritis.
385
Lateral (left) and dorsopalmar (right) radiographs of the right carpus, which identify increased soft
tissue opacity confined to the carpal joint capsule. Bony structures are unremarkable.Carpal intraarticular blastomycosis in a Labrador retriever. Woods et al. (2013)
Foy et al. (2014) monitored 21 dogs with newly diagnosed blastomycosis until
clinical remission (Treatment Phase), and 27 dogs over 1 year from the time of
antifungal discontinuation or until clinical relapse (After Treatment Phase) monthly,
with a complete history, physical exam, chest radiographs, and ocular exam. Urine
and serum Blastomyces antigen concentrations were measured at each visit using a
quantitative enzyme immunoassay. At enrollment in the Treatment Phase,
Blastomyces antigen was positive in all 21 urine samples (100% sensitivity; 95% CI
85-100%), and in 18 of 20 serum samples (90% sensitivity; 95% CI 70-97%). At 24 months of treatment, urine antigen was more sensitive for clinically detectable
disease (82%; CI 60-94%) than serum antigen (18%; CI 6-41%). The sensitivity of the
urine test for clinical relapse was 71% (CI 36-92%), with close to 100% specificity
(CI 84-100%) during after treatment surveillance in this population. It was concluded
that urine Blastomyces antigen testing had high sensitivity for active disease at the
time of diagnosis and during treatment, and moderate sensitivity but high specificity
for clinical relapse. Urine testing should be useful at the time of diagnosis, when
treatment discontinuation is being considered, and anytime there is poor clinical
response or suspicion of relapse.
Mondada et al. (2014) conducted a study to compare the reactivity of two B.
dermatitidis yeast lysate antigens prepared from dog isolates (ERC-2, Wisconsin; T58, Tennessee) and two lysate antigens prepared from human isolates (B5931 and
B5896,
Minnesota)
against
48
serum
specimens
from dogs with
confirmed blastomycosis using the indirect enzyme-linked immunosorbent assay
(ELISA). Secondarily, we used three different ELISA substrates (Ultra TMB: A,
SureBlue: B, and SureBlue Reserve: C) to compare the effectiveness of each
substrate. Mean absorbance values ranged from 0.446 (B) to 0.651 (C) for the B5931
antigen and from 0.393 (B) to 0.540 (C) for the ERC-2 antigen in Trial 1. In Trial 2,
the absorbance values ranged from 0.628 (B) to 0.909 (A) for the B5896 antigen and
from 0.828 (B) to 1.375 (C) for the T-58 antigen. In Trial 1, the lysate antigen
prepared from the human isolate B5931 exhibited the highest absorbance value and in
Trial 2 the lysate prepared from the dog isolate T-58 was the most reactive. The
overall results thus indicated that the T-58 lysate was the optimal reagent when used
to detect antibody with the Sure-Blue Reserve substrate. Our laboratory is continuing
to study B. dermatitidis antigen and substrate combinations for the reliable
immunodiagnosis of blastomycosis in humans and animals.
Mourning et al. (2015) performed a study to evaluate the sensitivity and specificity
of an enzyme immunoassay (EIA) for antibodies to a recombinant Blastomyces
adhesin-1
repeat
antigen
(rBAD-1)
to
aid
in
the
diagnosis
of blastomycosis in dogs and compare the findings with results from other tests used
for this purpose using serum and urine samples from 70 dogs with and
without blastomycosis. Samples were collected from dogs with blastomycosis (n =
21), histoplasmosis (8), or non-fungal pulmonary disease (21) and from healthy
control dogs living in a blastomycosis-endemic area (20). Serum was tested for
antibodies against Blastomyces dermatitidis with the rBAD-1 antibody EIA and an Aantigen antibody agar gel immunodiffusion (AGID) assay. Serum and urine were
386
tested for B dermatitidis antigen with a quantitative EIA. Sensitivity of the
quantitative antigen EIA was 100% in serum and urine samples
from dogs with blastomycosis, with specificity of 95% in urine samples
from dogs with nonfungal pulmonary disease and 100% in urine samples from
healthy dogs. Sensitivity of the rBAD-1 antibody EIA (95%) was significantly greater
than that of the A-antigen antibody AGID assay (65%). Specificity of the antibody
EIA was 88% in dogs with histoplasmosis, 95% in healthy dogs, and 100%
in dogs with nonfungal pulmonary disease.
1.6.2. Reports on blastomycosis in cats
Nasisse et al. (1985) examined a domestic shorthair cat because of dyspnea. It was found to
have ophthalmoscopic and radiographic changes suggestive of systemic mycosis. The cat died
despite antifungal therapy. Histologic examination revealed Blastomyces dermatitidis in the
eyes, brain, lungs, stomach, liver, kidneys, spleen, pancreas, and adrenal glands. The
pathologic changes were similar, but more widespread than those typically seen with
canineblastomycosis.
Breider et al. (1988) reviewed medical records of 5 cats with blastomycosis at the
University of Tennessee Veterinary Teaching Hospital from 1979 to 1986. Clinical signs
of blastomycosis varied depending on the organ(s) affected, but respiratory tract disease was
most common, followed by CNS signs and ocular problems. A definitive diagnosis was made
by identification of characteristic fungal organisms in biopsy or necropsy specimens.
Two cats treated with amphotericin B did not respond to treatment and died or were
euthanatized. The lungs, brain, eyes, and lymph nodes commonly were affected, but one cat
had only cutaneous and regional lymph node involvement. The respiratory tract appeared to
be a common primary site of infection, with dissemination to other organ systems. The typical
host response was a pyogranulomatous cellular infiltrate with numerous fungal organisms
evident.
Meschter and Heiber (1989) diagnosed blastomycosis in a cat from lower New
York State by cytologic examination of aspirates from lymph nodes. This represents a
novel geographic distribution of this disease
Gilor et al. (2006) conducted a retrospective study to evaluate clinical and laboratory
findings, treatment, and clinical outcome in 8 cats with blastomycosis. Medical records of the
University of Illinois Veterinary Teaching Hospital were searched for cases
of blastomycosis in cats diagnosed via cytologic or histopathologic findings. Clinical and
laboratory findings, treatment, and clinical outcome were determined. Radiographs were
reviewed for the 8 cases. All cats were systemically ill. Respiratory tract signs and dermal
lesions were most commonly observed. All cats had radiographic evidence of respiratory tract
disease. Seven of the 8 cats had ill-defined soft-tissue opacities (nodules or masses) or
alveolar consolidation of the lungs. Antemortem diagnosis was achieved cytologically in 6 of
the 8 cats, and 3 were successfully treated and survived.
Blondin et al. (2007) investigated an outbreak of blastomycosis among five urban,
indoor cats diagnosed at three veterinary clinics March 3-July 13, 2005, in suburban
Chicago, Illinois, by owner interviews, site visits, environmental cultures for B.
dermatitidis, GIS analysis, and analysis of local weather data. There were no
environmental exposures common to the five cats that lived a median of 300 m from
nearest body of water, in homes on a loam soil. Closest and farthest case home sites
were 3.4 and 26.1 km, respectively. All cats were confined indoors except one cat that
387
averaged 15 min/week in his backyard and was exposed to excavation. B. dermatitidis
was not isolated from any of 60 environmental samples. The annualized incidence
rate March through July 2005 among 6,761 cats in these practices was 178/100,000,
compared to none in the previous 4 years, and 0.14/100,000 cat visits from a
nationwide animal hospital registry. Precipitation January through June 2005 was 9.30
versus period mean of 14.05 +/- 1.69 inches the previous 4 years (P = 0.01).
Circumstantial evidence suggests acquisition of B. dermatitidis from the home site
environment in five cats. Relative drought may have contributed to an apparent
outbreak of blastomycosis in this urban locale.
Smith et al. (2007) examined an 8-year-old domestic shorthair cat because of signs of
depression, circling, and visual deficits. The cat had no cutaneous lesions, and results of an
ophthalmologic examination and thoracic radiography were within reference limits.
Computed tomography of the brain revealed a mass lesion involving the right parietal,
temporal, and occipital lobes; the mass was in broad-based contact with the skull and
smoothly marginated and had strong homogenous enhancement after contrast agent
administration. During craniectomy, samples of the mass were collected for cytologic and
histopathologic evaluations and microbial culture. A diagnosis of Blastomyces dermatitidisassociated meningoencephalitis with secondary pyogranulomatous inflammation was made.
Amphotericin B (0.25 mg/kg [0.11 mg/lb], IV) was administered on alternate days
(cumulative dose, 1.75 mg/kg [0.8 mg/lb]). To minimize the risk of nephrotoxicosis,
assessments of serum biochemical variables (urea nitrogen and creatinine concentrations) and
urinalyses were performed at intervals. The third dose of amphotericin B was postponed 48
hours because the cat became azotemic. The cat subsequently received fluconazole (10 mg/kg
[4.5 mg/lb], PO, q 12 h) for 5.5 months. Six months after discontinuation of that treatment,
the cat appeared healthy and had no signs of relapse.
Stern et al. (2011) reported a 9 yr old domestic shorthair cat with cutaneous and
pulmonic blastomycosis. Severe persistent ionized hypercalcemia and excess
circulating concentration of calcitriol were documented in association
with blastomycosis. Ionized hypercalcemia resolved when the granulomatous lesions
of blastomycosis resolved and the calcitriol levels decreased.
References
1. Arceneaux KA, Taboada J, Hosgood G. Blastomycosis in dogs: 115 cases (19801995). J Am Vet Med Assoc 1998;213(5):658-664.
2. Anderson JL, Sloss BL, Meece JK. Clinical and molecular epidemiology of
veterinary blastomycosis in Wisconsin. BMC Vet Res. 2013 Apr 22;9:84
3. Baron ML, Hecht S, Westermeyer HD, Mankin JM, Novak JM, Donnell RL.
Intracranial extension of retrobulbar blastomycosis (Blastomyces dermatitidis) in a
dog. Vet Ophthalmol. 2011 Mar;14(2):137-41.
4. Bateman BS. Disseminated blastomycosis in a German shepherd dog. Can Vet
J. 2002 Jul;43(7):550-2.
5. Baumgardner DJ, Paretsky DP, Yopp AC. The epidemiology of blastomycosis in
dogs: north central Wisconsin, USA. J Med Vet Mycol 1995;33(3):171-176.
6. Baumgardner DJ, Steber D, Glazier R, et al. Geographic information system analysis
of blastomycosis in northern Wisconsin, USA: waterways and soil.Med
Mycol 2005;43(2):117-125.
7. Baumgardner DJ, Paretsky DP, Baeseman ZJ, Schreiber A. Effects of season and
weather on blastomycosis in dogs: Northern Wisconsin, USA. Med Mycol. 2011
Jan;49(1):49-55.
8. Bentley RT, Reese MJ, Heng HG, Lin TL, Shimonohara N, Fauber A. Ependymal
and periventricular magnetic resonance imaging changes in four dogs with central
nervous systemblastomycosis. Vet Radiol Ultrasound. 2013 Sep-Oct;54(5):489-96.
388
9. Bialek R, Cirera AC, Herrmann T, Aepinus C, Shearn-Bochsler VI, Legendre AM.
Nested PCR assays for detection of Blastomyces dermatitidis DNA in paraffinembedded canine tissue. J Clin Microbiol. 2003 Jan;41(1):205-8.
10. Blondin N, Baumgardner DJ, Moore GE, Glickman LT. Blastomycosis in indoor cats:
suburban Chicago, Illinois, USA. Mycopathologia. 2007 Feb;163(2):59-66.
11. Bono JL, Legendre AM, Scalarone GM. Detection of antibodies and delayed
hypersensitivity with Rotofor preparative IEF fractions of Blastomyces dermatitidis
yeast phase lysate antigen. J Med Vet Mycol. 1995 Jul-Aug;33(4):209-14.
12. Boyd AR, Vandyke JL, Scalarone GM. Blastomyces dermatitidis Yeast Lysate
Antigen Combinations: Antibody Detection in Dogs with Blastomycosis. Vet Med
Int. 2013;2013:940126.
13. Breider MA, Walker TL, Legendre AM, VanEe RT. Blastomycosis in cats: five cases
(1979-1986). J Am Vet Med Assoc. 1988 Sep 1;193(5):570-2.
14. Brömel C, Sykes JE. Epidemiology, diagnosis, and treatment of blastomycosis
in dogs and cats. Clin Tech Small Anim Pract. 2005 Nov;20(4):233-9.
15. Brooks DE, Legendre AM, Gum GG, et al. The treatment of ocular blastomycosis
with systemically administered itraconazole. Prog Vet Comp Ophthalmol 1991;4:263268.
16. Chen T, Legendre AM, Bass C, Mays SE, Odoi A. A case-control study of sporadic
canine blastomycosis in Tennessee, USA. Med Mycol. 2008 Dec;46(8):843-52
17. Crews LJ, Sharkey LC, Feeney DA, Jessen CR, Ruska T. Evaluation of total and
ionized calcium status in dogs with blastomycosis: 38 cases (1997-2006). J Am Vet
Med Assoc. 2007 Nov 15;231(10):1545-9.
18. Crews LJ, Feeney DA, Jessen CR, Newman AB. Radiographic findings in dogs with
pulmonary blastomycosis: 125 cases (1989-2006). J Am Vet Med Assoc. 2008 a. Jan
15;232(2):215-21.
19. Crews LJ, Feeney DA, Jessen CR, Newman AB, Sharkey LC. Utility of diagnostic
tests for and medical treatment of pulmonary blastomycosis in dogs: 125 cases (19892006). J Am Vet Med Assoc. 2008 Jan 15;232(2):222-7
20. Ditmyer H, Craig L. Mycotic mastitis in three dogs due to Blastomyces dermatitidis.
J Am Anim Hosp Assoc. 2011 Sep-Oct;47(5):356-8.
21. Finn MJ, Stiles J, Krohne SG. Visual outcome in a group of dogs with
ocular blastomycosis treated with systemic antifungals and systemic corticosteroids.
Vet Ophthalmol. 2007 Sep-Oct;10(5):299-303.
22. Fisher MA, Bono JL, Abuodeh RO, Legendre AM, Scalarone GM. Sensitivity and
specificity of an isoelectric focusing fraction of Blastomyces dermatitidis yeast lysate
antigen for the detection of canine blastomycosis. Mycoses. 1995 May-Jun;38(56):177-82.
23. Fisher MA, Legendre AM, Scalarone GM. Immunological and chemical
characterization of glycoproteins in IEF fractions of Blastomyces dermatitidis yeast
lysate antigen. Mycoses. 1997 Sep;40(3-4):83-90.
24. Foy DS, Trepanier LA, Kirsch EJ, Wheat LJ. Serum and urine Blastomyces antigen
concentrations as markers of clinical remission in dogs treated for
systemic blastomycosis. J Vet Intern Med. 2014 Mar-Apr;28(2):305-10.
25. Gaunt MC, Taylor SM, Kerr ME. Central nervous system blastomycosis in a dog.
Can Vet J. 2009 Sep;50(9):959-62.
26. Gilor C, Graves TK, Barger AM, O'Dell-Anderson K. Clinical aspects of natural
infection with Blastomyces dermatitidis in cats: 8 cases (1991-2005). J Am Vet Med
Assoc. 2006 Jul 1;229(1):96-9.
27. Harasen G. Blastomycosis as a cause of lameness. Can Vet J. 2007 Dec;48(12):12912.
28. Hecht S, Adams WH, Smith JR, Thomas WB. Clinical and imaging findings in
five dogs with intracranial blastomycosis (Blastomyces dermatiditis). J Am Anim
Hosp Assoc. 2011 Jul-Aug;47(4):241-9.
389
29. Hendrix DV, Rohrbach BW, Bochsler PN, English RV. Comparison of histologic
lesions of endophthalmitis induced by Blastomyces dermatitidis in untreated and
treated dogs: 36 cases (1986-2001). J Am Vet Med Assoc. 2004 Apr 15;224(8):131722.
30. Herrmann JA, Kostiuk SL, Dworkin MS, Johnson YJ. Temporal and spatial
distribution of blastomycosis cases among humans and dogs in Illinois (2001-2007), J
Am Vet Med Assoc. 2011 Aug 1;239(3):335-43.
31. Kerl ME. Update on canine and feline fungal diseases. Vet Clin North Am Small
Anim Pract 2003;33(4):721-747.
32. Legendre AM. Blastomycosis. In: Greene CE, ed. Infectious diseases of the dog
and cat. 3rd ed. St. Louis, Mo: Saunders, 2006;569-576.
33. Lipitz L, Rylander H, Forrest LJ, Foy DS. Clinical and magnetic resonance imaging
features of central nervous system blastomycosis in 4 dogs. J Vet Intern Med. 2010
Nov-Dec;24(6):1509-14.
34. Lloret A, Hartmann K, Pennisi MG, Ferrer L, Addie D, Belák S, Boucraut-Baralon
C, Egberink H, Frymus T, Gruffydd-Jones T, Hosie MJ, Lutz H, Marsilio F, Möstl
K, Radford AD, Thiry E, Truyen U, Horzinek MC. Rare systemic mycoses
in cats: blastomycosis, histoplasmosis and coccidioidomycosis: ABCD guidelines on
prevention and management. J Feline Med Surg. 2013 Jul;15(7):624-7
35. Mazepa AS, Trepanier LA, Foy DS. Retrospective comparison of the efficacy of
fluconazole or itraconazole for the treatment of systemicblastomycosis in dogs. J Vet
Intern Med. 2011 May-Jun;25(3):440-5.
36. MacDonald PD, Langley RL, Gerkin SR, Torok MR, MacCormack JN. Human and
canine pulmonary blastomycosis, North Carolina, 2001-2002. Emerg Infect Dis. 2006
Aug;12(8):1242-4.
37. McGuire NC, Vitsky A, Daly CM, Behr MJ. Pulmonary thromboembolism associated
with Blastomyces dermatitidis in a dog. J Am Anim Hosp Assoc. 2002 SepOct;38(5):425-30.
38. McMillan CJ, Taylor SM. Transtracheal aspiration in the diagnosis of
pulmonary blastomycosis (17 cases: 2000-2005). Can Vet J. 2008 Jan;49(1):53-5.
39. Meschter C, Heiber K. Blastomycosis in a cat in lower New York State. Cornell
Vet. 1989 Jul;79(3):259-62.
40. Mondada K, Fullmer J, Hungerford E, Novack K, Vickers K, Scalarone G.
Blastomyces
dermatitidis:
Antibody
Detection
in
Sera
from Dogs with Blastomycosis with Yeast Lysate Antigens Produced from Human
and Dog Isolates. Vet Med Int. 2014;2014:376725
41. Mourning AC, Patterson EE, Kirsch EJ, Renschler JS, Wolf LA, Paris JK, Durkin
MM, Wheat LJ. Evaluation of an enzyme immunoassay for antibodies to a
recombinant Blastomyces adhesin-1 repeat antigen as an aid in the diagnosis
of blastomycosis in dogs. J Am Vet Med Assoc. 2015 Nov 15;247(10):1133-8.
42. Nasisse MP, van Ee RT, Wright B. Ocular changes in a cat with
disseminated blastomycosis. J Am Vet Med Assoc. 1985 Sep 15;187(6):629-31.
43. Oshin A, Griffon D, Lemberger K, Naughton J, Barger A. Patellar blastomycosis in a
dog. J Am Anim Hosp Assoc. 2009 Sep-Oct;45(5):239-44.
44. Parker K, Snead E, Anthony J, Silver T. Oronasal blastomycosis in a golden retriever.
Can Vet J. 2013 Aug;54(8):748-52.
45. Reed LT, Balog KA, Boes KM, Messick JB, Miller MA. Pathology in practice.
Granulomatous pneumonia, prostatitis and uveitis with intralesional yeasts consistent
with Blastomyces. J Am Vet Med Assoc. 2010 Feb 15;236(4):411-3
46. Rudmann DG, Coolman BR, Perez CM, et al. Evaluation of risk factors for
blastomycosis in dogs: 857 cases (1980-1990). J Am Vet Med
Assoc1992;201(11):1754-1759.
391
47. Schmiedt C, Kellum H, Legendre AM, Gompf RE, Bright JM, Houle CD, Schutten
M, Stepien R. Cardiovascular involvement in 8 dogs with blastomyces dermatitidis
infection. J Vet Intern Med. 2006 Nov-Dec;20(6):1351-4.
48. Sestero CM, Scalarone GM. Detection of IgG and IgM in sera from canines
with blastomycosis using eight blastomyces dermatitidis yeast phase lysate antigens.
Mycopathologia. 2006 Jul;162(1):33-7.
49. Shurley JF, Legendre AM, Scalarone GM. Blastomyces dermatitidis antigen
detection in urine specimens from dogs with blastomycosis using a competitive
binding inhibition ELISA. Mycopathologia. 2005 Sep;160(2):137-42.
50. Smith JR, Legendre AM, Thomas WB, LeBlanc CJ, Lamkin C, Avenell JS, Wall
JS, Hecht S. Cerebral Blastomyces dermatitidis infection in a cat. J Am Vet Med
Assoc. 2007 Oct 15;231(8):1210-4.
51. Stern
JA, Chew
DJ, Schissler
JR, Green
EM.
Cutaneous
and
systemic blastomycosis, hypercalcemia, and excess synthesis of calcitriol in a
domestic shorthair cat. J Am Anim Hosp Assoc. 2011 Nov-Dec;47(6):e116-20.
52. Spector D, Legendre AM, Wheat J, Bemis D, Rohrbach B, Taboada J, Durkin M.
Antigen and antibody testing for the diagnosis of blastomycosis in dogs. J Vet Intern
Med. 2008 Jul-Aug;22(4):839-43.
53. Totten AK, Ridgway MD, Sauberli DS. Blastomyces dermatitidis prostatic and
testicular infection in eight dogs (1992-2005). J Am Anim Hosp Assoc. 2011 NovDec;47(6):413-8.
54. Varani N, Baumgardner DJ, Czuprynski CJ, Paretsky DP. Attempted isolation of
Blastomyces dermatitidis from the nares of dogs: Northern Wisconsin, USA. Med
Mycol. 2009 Nov;47(7):780-2..
55. Wakamoto A, Abuodeh RO, Scalarone GM. Comparative studies on the detection of
antibodies and delayed hypersensitivity responses with 10 Blastomyces dermatitidis
lysate antigens. Mycoses. 1997a, Oct;40(5-6):147-52.
56. Wakamoto A, Fryer BM, Fisher MA, Johnson TJ, Lundgren DK, Knickerbocker
JD, Rounds SL, Scalarone GM. Detection of antibodies and delayed dermal
hypersensitivity with different lots of Blastomyces dermatitidis yeast lysate antigen:
stability and specificity evaluations. Mycoses. 1997b, Nov;40(7-8):303-8.
57. Wehner A, Crochik S, Howerth EW, Koenig A. Diagnosis and treatment of
blastomycosis affecting the nose and nasopharynx of a dog. J Am Vet Med
Assoc. 2008 Oct 1;233(7):1112-6.
58. Whelen J. Treatment of canine blastomycotic osteomyelitis. Can Vet J. 2008
Mar;49(3):217
59. Woods KS, Barry M, Richardson D. Carpal intra-articular blastomycosis in a
Labrador retriever. Can Vet J. 2013 Feb;54(2):167-70.
60. Wüthrich M, Krajaejun T, Shearn-Bochsler V, Bass C, Filutowicz HI, Legendre
AM, Klein BS. Safety, tolerability, and immunogenicity of a recombinant, genetically
engineered, live-attenuated vaccine against canine blastomycosis. Clin Vaccine
Immunol. 2011 May;18(5):783-9.
2. Coccidioidomycosis in cats and dogs
2.1.
Introduction
Coccidioidomycosis is a respiratory fungal infection with occasional systemic
dissemination. The disseminated coccidioidomycosis is considered a multifaceted
disease. In medicine, disseminated coccidioidomycosis is included within a group of
infectious diseases that have been referred as the great imitators. In many cases,
391
malignancies are included in the presumptive diagnosis. In veterinary medicine,
disseminated coccidioidomycosis is common in dogs. Nonetheless, despite of being a
diagnostic dilemma, disseminated coccidioidomycosis is underestimated and
frequently not included into differentials, even in endemic zones (Ramírez-Romero
et al., 2016).
Coccidioidomycosis or Valley Fever (VF) is an emerging soil-borne fungal zoonosis
affecting humans and animals. Most non-human cases of VF are found in dogs, which
we hypothesize may serve as sentinels for estimating the human exposure risk
(Gautam et al., 2013).
The dimorphic fungi Coccidioides immitis and Coccidioides posadasii are the
causative agents of coccidioidomycosis. Dogs and cats residing in and visiting
endemic areas are at risk of exposure to infectious arthrospores. The primary
infection is pulmonary and frequently results in chronic cough. Disseminated
disease is common and causes cutaneous, osseous, cardiac, ocular, nervous
system, or other organ disease. Radiographic changes include a variable
degree of interstitial pulmonary infiltration, hilar lymphadenopathy, and
osseous lesions. Serological titers support the diagnosis, but definitive
diagnosis relies on identification of Coccidioides in cytological or tissue
samples. Coccidioidomycosis should be considered in any dog or cat that has
been potentially exposed during the previous 3 years and is presented with
chronic illness, respiratory signs, lameness, lymphadenopathy, nonhealing
cutaneous lesions, or neurological, ocular, or cardiac abnormalities
(Graupmann-Kuzma et al., 2008).
Coccidioides spp. appear capable of infecting all mammals and at least some
reptiles. Development of disease as a result of infection is speciesdependent. Dogs seem to have a susceptibility similar to that of humans, with
subclinical infections, mild-to-severe primary pulmonary disease, and
disseminated disease. Whereas central nervous system disease in humans is
typically meningitis, brain disease in dogs and cats takes the form of
granulomatous parenchymal masses. Osteomyelitis is the most common form
of disseminated disease in the dog, while skin lesions predominate in the cat.
Orally administered azole antifungal agents are the backbone of therapy in
animals as they are in humans (Shubitz, 2007).
Clinical coccidioidomycosis is quite common in the dog; though less
frequently recognized in the cat, disease is often severe at the time of
diagnosis. Diagnosis can be a challenge because serology, while specific, is
not very sensitive and quantitative titration of antibodies does not correlate
entirely with clinical disease in dogs. Radiographs, serum biochemistry tests
and complete blood counts are beneficial additions to the database when
establishing a diagnosis; cytology, histopathology, and culture are definitive
when available. Advanced imaging can detect central nervous system and
subtle skeletal lesions. Disease can occur in most organs of the body and may
prove a diagnostic challenge requiring several modalities. (Shubitz and Dial,
2005).
Greyhounds seem particularly susceptible to VF, perhaps due to their
normally low white blood cell count. Natural immunity plays a part in
determining which dogs contract VF (a new arrival to the area is more
susceptible than a dog that grew up there). Valley Fever is a disease that can
be obscure and may progress before the owner sees sufficient reason to visit a
392
veterinarian. Some dogs display no specific signs, especially early on,
appearing to be not as well, eating inconsistently, or losing weight. Despite the
name, half of dogs with VF have normal temperatures at presentation. They
may, however, run fluctuating fevers at home and have times of appearing not
as well, interspersed with times of lethargy, and inevitably go on to develop
more specific signs, if their condition is undiagnosed and untreated. The most
common signs are poor appetite, weight loss, lameness, bone pain, spinal pain,
and coughing. In the early (primary) form, the fungus infects the lungs, then
moves on to infect the bones (secondary form). Lungs and bones are affected
in most cases; other systems that can be affected are the central nervous
system (CNS), eyes, and, less commonly, the heart or skin. The coughing
stage is seldom seen in greyhounds; most cases present with bone involvement
or nonspecific illness and weight loss. Other dogs tend to present with equal
proportions of the lung versus the bone form. Of particular concern with
greyhounds is that, on radiographs, VF bone lesions resemble osteosarcoma.
Lesions can be either osteoproliferative or osteolytic, so it is important to
obtain an antibody titer to C. immitis. In fact, a titer should be obtained for any
greyhound from Arizona that is sick for any reason. Ketoconazole is the first
line of treatment. It is used at a dose of 5 mg/kg BW, q12h, with food.
Minimum treatment time is 1 y, unless there is only lung involvement, in
which case it is 6 mo. Treatment is continued until titers are negative and
radiographs are clear, if bone has been involved (Rubensohn and Stack,
2003).
Little published information is available to guide therapy for canine and feline
patients with Coccidioides infections involving the central nervous system (CNS).
2.2.
Aetiology
Coccidioides immitis RIXFORD et
GILCHRIST 1896
Synonyms:
Posadasia esferiformis CANTON 1898
Blastomycoides immitis CASTELLANI 1928
Pseudococcidioides mazzai DA FONSECA 1928
Geotrichum immite AGOSTINI 1932
Coccidioides esferiformis MOORE 1932
Glenospora metaeuropea CASTELLANI 1933
Glenospora louisianoideum CASTELLANI 1933
Trichosporon proteolyticum NEGRONI et DE VILLAFANE 1938
Perfect stage: unknown
C. immitis is a thermically dimorphic fungus that grows in nature, soil, or in the
laboratory at room temperature as a mould and in tissues or in the laboratory at 37C as
a yeast. The mould phase grows at first as moist, glabrous and grayish colonies that
rapidly develop abundant, floccose, aerial mycelium. The mycelium is initially white,
but usually becomes tan to brown with age. Microscopically, the fungus develops thin
and septate hyphae that produce side branches that are much more thicker and have
numerous septations. Thick-walled arthroconidia are produced in these side-branches.
The arthroconidia alternate with thin-walled empty cells.
393
The arthroconida are barrel-shaped, 2.5-4 by 3-6 um and are released by
fragmentation of the mycelium. The arthroconidia are highly resistant to desiccation,
temperature extremes and deprivation of nutrients and may remain viable for years. In
the tissues the arthroconidium develops into spherules within a few hours or days.
They become more rounded as they transform and enlarge. At maturity the spherules
are 30-60 um in diameter, with a thick and prominent cell wall. Endospores are
formed inside the spherules which are 2-5 um in diameter and may reach to hundreds
in one spherule. At maturation the spherule ruptures and the endospores are released,
which in turn develop into spherules.
C. immitis at 25oC
arthroconidia
spherule
2.3. Diagnosis
2.3.1. Direct microscopic examination:
Spherules can be detected in sputum, pus, exudate and biopsy material, either in fresh
or stained preparation by methods of Papanicolaou or Gomori's methenamine silver
staining. These stains can demonstrate spherules and surrounding inflammation.
A spherule in a direct film
2.3.2. Isolation and identification:
Material to be examined is plated on Sabouraud's dextrose agar and incubated at
room temperature and on brain-heart dextrose agar and incubated at high carbon
dioxide concentration at 37 C. Growth of the mould phase is rather rapid and the
colony matures within 2 weeks. Confirmation requires the conversion into yeast phase
by subculturing the mould on brain-heart or blood agar and incubating at 37 C.
394
Colonies of C. immitis and arthroconidia
2.3.3. Serology :
Complement-Fixation is excellent for coccidioidomycosis because it is quantitative.
However, these antibodies cross-react with some other fungi (Blastomyces and
Histoplasma). The C-F test is also a PROGNOSTIC test. If the titer keeps rising, then
the patient is responding poorly and the course may be fatal. If the C-F titer is
dropping then the prognosis for that patient is favorable. A titer of greater than 1:128
usually indicates extensive dissemination. Life-long immunity usually follows
infection with C. immitis. Detection of antibodies to Coccidioides can be an important
diagnostic tool. Today, IgM and IgG are generally measured using EIA and/or
immunodiffusion; however, some laboratories continue to use tube precipitin to
measure IgM and complement fixation to measure IgG antibodies. False-negative
serology has been seen in up to 38% of patients with hematogenous infection and
46% of fatal cases. Detection of antigens in the urine using EIA has been shown in
71% of patients with coccidioidomycosis but shows cross-reaction in 10% of patients
with other endemic mycoses
2.3.4. Histopathology
Spherules of various sizes (10 to 100 μm) with multiple endospores (2 to 5 μm) are
characteristic of coccidioidomycosis and can be seen with routine H&E staining.The
walls of some of the spherules may appear to be ruptured, and the endospores spill
into surrounding tissues. The inflammatory reaction to endospores is predominantly
neutrophilic, while reaction to spherules is granulomatous.
395
Skin biopsy
Lung biopsy, Gomory st., , H&E st. granulomatous reaction FA stain
2.3.5. Skin test:
The intradermal injection of 0.1 ml of coccidioidin, which is a 6-10 weeks culture
filtrate, evokes in infected individual a positive delayed hypersensitivity reaction
larger than 5 mm in diameter after 24-96 hours. The test may be negative at the onset
of infection or in case of dissemination.
2.4.
Treatment
Disease is often self-limiting, but if chronic respiratory signs or multisystemic disease
are present, longterm antifungal therapy is needed; with disseminated infection,
treatment of at least 6–12 mo is typical. Fluconazole (2.5–10 mg/kg/day) is the most
commonly used drug to treat disseminated or chronic respiratory infections.
Ketoconazole (10–30 mg/kg/day) and itraconazole (10 mg/kg/day) are also commonly
used to treat dogs with coccidioidomycosis but are more expensive and have a higher
incidence of adverse effects. Amphotericin B may be the most effective antifungal
drug, but it is highly nephrotoxic. It may be indicated in animals that either do not
improve or are unable to tolerate the azole antifungals.
2.5.
Reports on coccidioidomycosis
2.5.1. Reports on coccidioidomycosis in dogs
Wolf (1979) diagnosed primary cutaneous coccidioidomycosis in a dog and a cat
examined because of lymphangitis and lymphadenitis associated with skin wounds.
This benign and self-limiting form of disease was distinguished from the skin lesions
associated with systemic coccidioidomycosis by means of historic, physical, and
serologic criteria established in human medicine.
Angell et al. (1987) examined 33 dogs with ocular lesions. Serologic and/or histologic
evaluation confirmed the diagnoses of coccidioidomycosis. Histologic evaluation of
the eye revealed a primary posterior segment disease, such as chorioretinitis or retinal
separation, with an extension into the anterior segment of the eye.
Hawkins and DeNicola (1990) performed analysis of tracheal wash and
bronchoalveolar lavage fluid in 9 dogs that had mycotic infections with pulmonary
involvement. Characteristic organisms were identified in tracheal wash fluid in 3 of
7 dogs with blastomycosis. Organisms were identified in bronchoalveolar lavage fluid in 5 of
7 dogs with blastomycosis and in one dog with histoplasmosis. Organisms were not found in
either fluid in one dog withcoccidioidomycosis. These procedures should be considered
396
for dogs with suspected mycotic infections that involve the lungs and that cannot be
diagnosed by less invasive means
Plotnick et al. (1997) reported a 13-month-old, female Labrador retriever which
developed draining tracts in the right hind limb, 3 weeks after traveling to Arizona,.
Primary cutaneous coccidioidomycosis was diagnosed. Initial treatment with
itraconazole resulted in exacerbation of clinical signs. Histopathology was suggestive
of a cutaneous drug eruption. Discontinuation of the itraconazole caused resolution of
the drug eruption. Successful treatment of the fungal infection was achieved using
ketoconazole.
Burtch et al. (1998) diagnosed granulomatous meningitis attributable to Coccidioides
immitis on postmortem examination in a 4-year-old Border Collie. Clinical signs
included CNS disease, aspiration pneumonia secondary to a megaesophagus, and
otitis externa. Central nervous system signs included central vestibular and cranial
nerve dysfunction. Cerebellar and medullary infiltrates seen on histologic examination
affected cranial nerves VIII, IX, and X. Despite extensive diagnostics, diagnosis was
not made antemortem. Analysis of CSF suggested suppurative meningitis, but
bacteriologic culture results were negative. Coccidioides endospores were identified
on reexamination of brain tissue. The clinical course of disease and rate of
Coccidioides immitis infection is variable. Causative agents of granulomatous or
inflammatory CNS disease may include fungal infection more often than is currently
suspected.
Wanke et al. (1999) described an outbreak of coccidioidomycosis that involved three
individuals and eight of their dogs, who had engaged in a successful hunt for ninebanded armadillos (Dasypus novemcinctus) in the environs of Oeiras, a community in
Brazil's north eastern state of Piauí. Diagnosis was based on clinical, serological and
cultural findings. Four of 24 soil samples collected in and around the burrow of an
armadillo yielded cultures of Coccidioides immitis, thus establishing the endemicity
of that mould in the state of Piauí. A literature review revealed that C. immitis, aside
from that state, is endemic in three other Brazilian states--Bahia, Ceará and
Maranhão. These four contiguous states have semi-arid regions where climatic
conditions and their flora are similar to those that exist in C. immitis's endemic
regions in North, Central and South America.
Shubitz et al. (2001) reported a 4-year-old castrated male mixed-breed dog with a history
of coccidioidomycosis with abdominal and pleural effusion. Results of radiography,
ultrasonography, cytologic evaluation of thoracic fluid, and serologic testing supported a
diagnosis of constrictive pericarditis secondary to infection with Coccidioides immitis.
Aggressive treatment for presumptive coccidioidomycosis was begun, but the dog's condition
continued to deteriorate, and the dog was euthanatized. At necropsy, the pericardium was
thicker than normal and fibrotic and adhered to the epicardium. Microscopically, the
pericardium and 1 section of epicardium contained lymphoplasmacytic infiltrates with a few
macrophages and neutrophils. Coccidioides immitis was cultured from pericardial fluid. A
search of records from the Arizona Veterinary Diagnostic Laboratory for 1988 through 1998
revealed that of 46 dogs in which a diagnosis of coccidioidomycosis was confirmed at
necropsy, 13 had involvement of the heart or pericardium.
Jeroski (2003) evaluated an 11-year-old, spayed female Alaskan malamute with a
history of coccidioidal osteomyelitis for inappetance and lethargy. Findings included
generalized lymphadenopathy, pale mucous membranes, tachycardia, and labored
breathing. Laboratory findings and radiographic imaging were consistent with
397
generalized lymphoma and disseminated coccidioidomycosis. Treatment consisted of
antibiotics, chemotherapeutic agents, and antifungals
Johnson et al. (2003) conducted a etrospective case series study to determine clinical,
clinicopathologic, and radiographic abnormalities in dogs with coccidioidomycosis.
Clinical information and results of clinicopathologic testing were obtained from
medical records. Thoracic radiographs were reviewed to characterize abnormalities.
Dogs ranged from 1 to 10 years old at the time of diagnosis, with 12 dogs being
between 1 and 3 years old. Historical complaints included cough, lameness, signs of
head or neck pain, and difficulty breathing. Mild anemia, neutrophilia, and
monocytosis were common. All dogs had hypoalbuminemia, and 8 of 15 had
hyperglobulinemia. Thoracic radiographs of 19 dogs were reviewed. Pulmonary
infiltrates were seen in 13dogs, with an interstitial pattern of infiltration being most
common. Hilar lymphadenopathy was seen radiographically in 10 dogs. Serum from
20 dogswas tested for antibodies against Coccidioides immitis. One dog was positive
for IgM antibodies, 5 were positive for IgM and IgG antibodies, and 14 were positive
for IgG antibodies. Quantitative IgG titers measured in 14 dogs ranged from 1:2 to
1:128 (median and mode, 1:32). In 6 dogs, histologic examination of biopsy samples
revealed fungal spherules ranging from 8 to 70 microm in diameter. Results suggested
that in dogs, coccidioidomycosis may be associated with a wide spectrum of
nonspecific respiratory and musculoskeletal abnormalities.
Rubensohn and Stack (2003) described a 2-year-old, spayed, female greyhound
named Cabby for a postadoption examination on March 9, 2002. She originated in
Arizona and had been adopted via the Greyhound Rescue Society. On presentation,
Cabby was bright, alert, and responsive. The right submandibular lymph node was
enlarged (diameter 2 cm), the right external ear was inflamed, and the nail bed of the
left front 2nd digit was infected. She was placed on cephalexin (Novo-Lexin,
Novopharm, Toronto, Ontario), 250 mg, PO, q12h for 2 wk and then reexamined; the
lymph node had reduced in size (diameter 1.25 cm) and the nail bed infection and ear
were healed. On July 13, 2002, Cabby was presented limping on the left hind leg and
with a fever of 39.5°C. The clinical examination was unremarkable and she was
administered meloxicam (Metacam, Boehringer Ingelheim (Canada), Burlington,
Ontario), 0.1 mg/kg bodyweight (BW), PO, q24h. On August 6, 2002, Cabby was
checked again. Her left hind limb lameness was worse and she was again febrile
(40.5°C), with persistent drainage from the peri-anal fistula. The pyogranulomatous
discharge from the fistula contained spherules of Coccidiodes immitis. Results from
the CBC count showed a monocytosis (1.730 × 109 cells/L; reference range, 0.000 to
0.980 × 109/L) and a basophilia (0.111 × 109 cells/L; reference range, 0 to 0.100 ×
109/L). Results of the blood biochemical analysis revealed a severe hyperproteinemia
(86 g/L; reference range, 54 to 71 g/L) due to an exaggerated hyperglobinemia (62
g/L; reference range, 20 to 40 g/L). The systemic fungal panel was positive for
antibodies to Coccidiodes (+1:16). The pelvic radiographs showed granulomatous
osteomyelitis. Cabby was administered ketoconozole, 5 mg/kg BW, PO, q12h. She
was also placed on a diet of canned puppy food (Medi-Cal Development, Veterinary
Medical Diets, Guelph, Ontario) to augment her diet, as ketoconozole can act as an
appetite suppressant. Cabby responded well to treatment; her temperature was lower
(39.2°C), and she was bright and eating well.
Butkiewicz et al. (2005) performed community-based longitudinal and crosssectional studies to evaluate potential risk factors for Coccidioides infection
398
among 104 healthy 4- to 6-month-old puppies (longitudinal study) and 381 4- to 18month-old dogs with unknown serostatus (cross-sectional study) living in a region in
which the organism is endemic (Pima and Maricopa counties, Arizona). Dogs in the
longitudinal study were tested 3 times at 6-month intervals for anticoccidioidal
antibodies; dogs in the cross-sectional study were tested only once. Owners of
all dogs completed a questionnaire on potential environmental exposures. In the
longitudinal study, the relative risk of infection for dogs that were outdoors during the
day was 4.9 times the risk for dogs that were kept indoors. Seropositive dogs in the
cross-sectional study were 6.2 times as likely to have access to > 1 acre to roam as
were seronegative dogs. Logistic regression analysis indicated that the odds of
infection increased with age (odds ratio [OR], 1.1), amount of roaming space (OR,
2.4), and walking in the desert (OR, 2.2). Walking on sidewalks had a protective
effect (OR, 0.4). Results suggested that in regions in which the organism is
endemic, dogs that spend more time outdoors or have more land in which to roam are
at greater risk of infection with Coccidioides spp.
Heinritz et al. (2005) carried out a retrospective study to determine the history,
clinicopathologic findings, and results of surgery for effusive-constrictive pericarditis
associated with Coccidioides immitis infection in 17 client-owned dogs that
underwent a subtotal pericardectomy and epicardial excision. Hospital records from
May 1999 to June 2003 were reviewed. Data collected included history,
clinicopathologic findings, treatments, and outcome. Follow-up information was
obtained via recheck examination and by use of standardized telephone interviews
with referring veterinarians and owners. All dogs were of large breeds, and most were
male (mean age, 4.66 years). Ten dogs had no prior history of C. immitis infection,
and 7dogs had chronic infection with C. immitis. Having a chronic C. immitis
infection reduced the odds of survival, compared with no previous infection.
All dogs had clinical signs of right-sided heart failure. All dogs had serum titers
(range, 1:8 to 1:256) for antibodies against C. immitis prior to surgery, and titers were
not significantly associated with outcome. Predominant echocardiographic findings
were thickened pericardium, reduced right ventricular filling, and pleural or
pericardial effusion. All dogs underwent a subtotal pericardectomy and epicardial
excision and had fibrosing pyogranulomatous pericarditis in biopsy specimens
obtained during surgery. The perioperative mortality rate was 23.5%, and the 2-year
postdischarge survival rate was 82%. Surgical treatment via subtotal pericardectomy
and epicardial excision was successful at relieving right-sided heart failure
in dogs with effusive-constrictive pericarditis secondary to C. immitis infection, but
long-term treatment with antifungal agents may still be required.
Shubitz et al. (2005) conducted community-based longitudinal and cross-sectional
studies to determine the incidence of Coccidioides infection among 124 healthy 4- to
6-month-old seronegative puppies (longitudinal study) and 381 4- to 18-monthold dogs with unknown serostatus (cross-sectional study) residing in a region in
which the organism is endemic (Pima and Maricopa counties, Arizona) and estimate
the rate of clinical illness. Dogs in the longitudinal study were tested at 6-month
intervals for at least 1 year for anticoccidioidal antibodies. Dogs that became ill were
evaluated for coccidioidomycosis. Dogs in the cross-sectional study were tested for
anticoccidioidal antibodies once, and clinical abnormalities were recorded. 28 of the
104 (27%) dogs that completed the longitudinal study developed anticoccidioidal
antibodies. Thirty-two of the 381 (8%) dogs in the cross-sectional study had
anticoccidioidal antibodies. Five seropositive dogs in the longitudinal study and 13
399
seropositive dogs in the cross-sectional study had clinical signs of disease. The
remaining seropositive dogs were otherwise healthy and were classified as
subclinically infected. Survival analysis indicated that the cumulative probability of
infection by 2 years of age was 28%, and the cumulative probability of clinical
infection by 2 years of age was 6%. Titers for clinically and subclinically
infected dogs overlapped. Results suggested that young dogs living in the study area
had a high likelihood of becoming infected with Coccidioides spp, but few developed
clinical illness. Serologic testing alone was insufficient for a diagnosis of clinical
disease because of the overlap in titers between clinically and subclinically
infected dogs.
Crabtree et al. (2008) carried out a study to determine the relationship of hilar
lymphadenopathy tococcidioidomycosis titers for dogs in an endemic area. Thoracic
radiographs of 131 dogs from an endemic area were reviewed for evidence of hilar
lymphadenopathy. These results were compared with serology results. There was a
significant association between hilar lymphadenopathy and a positive serology result
(P < 0.001). With hilar lymphadenopathy as a predictor of a positive titer result,
sensitivity was 28.0%, specificity was 91.5%, the positive predictive value was
43.8%; and the negative predictive value was 84.4%. There was no association
between the titer result and gender, age, or weight. The radiographic finding of hilar
lymphadenopathy appears to be a useful indicator of coccidioidomycosis infection in
an endemic population of dogs supporting the treatment of patients
for coccidioidomycosis when hilar lymphadenopathy is present and before obtaining
serology results.
Ajithdoss et al. (2011) described atypical cases of coccidioidomycosis in 2 dogs
presented as heart base masses. An echocardiogram performed in one of the two
dogs revealed a large mass at the base of the heart and a computed tomography scan
showed that the mass compressed the bronchi, left atrium, aorta and pulmonary
arteries. A firm, white or pale yellow mass was found at the base of the heart at
necropsy examination in both cases. Microscopical examination of the masses
revealed severe, chronic, locally extensive granulomatous or pyogranulomatous
inflammation with intralesional spherules consistent with Coccidioides spp. The
diagnosis was further confirmed by immunohistochemistry and in-situ hybridization.
Coccidioides spp. have been reported to cause pericarditis in dogs, but this is the first
description of coccidioidomycosis mimicking a heart-based tumour in dogs.
411
Ajithdoss et al. (2011)
Shubitz et al. (2011) characterized the lymphocytic infiltration by studying archived
formalin-fixed, paraffin-embedded tissues (subcutis, pericardium/heart, lung, bone,
and synovium) from 18 dogs with coccidioidomycosis with immunohistochemistry
for CD3 and CD79a. In nearly all lesions, T lymphocytes were more numerous than B
lymphocytes and were distributed throughout the lesion with concentration in the
periphery of granulomas, whereas B lymphocytes were mostly confined to the
periphery of granulomas. The predominance of T lymphocytes in lesions of
canine coccidioidomycosis was independent of the tissue evaluated, the number of
intralesional organisms, and the nature or severity of the inflammatory response.
1. Synovium; dog No. 8. T lymphocytes are denser in the periphery of granulomas but scattered
throughout the inflamed tissue. Anti-CD3 immunohistochemistry with diaminobenzidine as chromogen
and hematoxylin counterstain. 2. Synovium; dog No. 8. B lymphocytes are mostly confined to the
411
periphery of this granuloma. Neutrophils surround the spherule in the center of the granuloma. AntiCD79a immunohistochemistry with diaminobenzidine as chromogen and hematoxylin counterstain.
Lung; dog No. 11. The large granuloma has central coalescing foci of necrosis and is demarcated from
adjacent lung by a band of macrophages and fibroblasts. T lymphocytes are most numerous at the
periphery of the granulomas. Anti-CD3 immunohistochemistry with diaminobenzidine as chromogen
and hematoxylin counterstain. 4. Lung; dog No. 3. This consolidated pulmonary lesion has dense,
diffuse T-lymphocytic infiltration with little organization and no distinct borders. The lesion also
contains numerous macrophages and neutrophils, with few scattered spherules. Anti-CD3
immunohistochemistry with diaminobenzidine as chromogen and hematoxylin counterstain. Shubitz
et al. (2011)
Kirsch et al. (2012) evaluated antigen detection as method for rapid diagnosis
of coccidioidomycosis in 60 cases diagnosed based on detection of anti-Coccidioides
antibodies at titers of 1:16 or more in serum. Controls included dogs with presumed
histoplasmosis or blastomycosis, other fungal infections, or non-fungal diseases and
healthy dogs. Urine and serum specimens were tested using an enzyme immunoassay
for Coccidioides galactomannan antigen. Antibody testing was performed at
commercial veterinary reference laboratories. Antigen was detected in urine or serum
of 12 of 60 (20.0%), urine only in 2 of 57 (3.5%), and serum only in 11 of 58
(19.0%) dogs with coccidioidomycosis. Antigen was detected in the urine of 3 of 43
(7.0%) and serum of 1 of 37 (2.7%) dogs with histoplasmosis or blastomycosis but
not in 13 dogs with other fungal infections (serum, 9; urine, 13), 41 dogswith nonfungal diseases (urine, 41; serum, 18), or healthy dogs (serum, 21; urine, 21).
Detection
of
antigen
was
an
insensitive
method
for
diagnosis
of coccidioidomycosis in dogs in which the diagnosis was based primarily upon
detection of antibodies at titers of 1:16 or higher, and the highest sensitivity was in
serum.
Gautam et al. (2013) performed a study is to use the spatial and temporal distribution
and clusters of dogs seropositive for VF to define the geographic area in Texas where
VF is endemic, and thus presents a higher risk of exposure to humans. The included
specimens were seropositive dogs tested at a major diagnostic laboratory between
1999 and 2009. Data were aggregated by zip code and smoothed by empirical
Bayesian estimation to develop an isopleth map of VF seropositive rates using
kriging. Clusters of seropositive dogs were identified using the spatial scan test. Both
the isopleth map and the scan test identified an area with a high rate of VFseropositive dogs in the western and southwestern parts of Texas (relative risk = 31).
This location overlapped an area that was previously identified as a potential endemic
region based on human surveys. Together, these data suggest that dogs may serve as
sentinels for estimating the risk of human exposure to VF.
Shubitz et al. (2013) treated 12 dogs with coccidioidal pneumonia that had been
present for an average of three months with 250 mg (5-15 kg) or 500 mg (> 15-30 kg)
twice daily for 60 days. Nine dogs completed the course of treatment and
seven dogs had improvement in disease based on radiographs, clinicopathological
parameters, physical examination findings, and subjective assessment by owners;
three dogs had resolution or near resolution of disease. Based on this small study,
NikZ shows efficacy to treat naturally acquired coccidioidomycosis and merits further
development for trials in humans.
Luna-Isaac et al. (2014) identified the predominant Coccidioides species in Mexico,
infered their current geographical distribution and explored the correlation between
412
species and clinical presentation. They collected 154 strains, which were cultured,
inactivated, and processed for DNA extraction. Nine microsatellite loci, the Ag2/PRA
gene and Umeyama Region were amplified from each isolate. To infer the current
geographical distribution of Coccidioides spp. and to establish a correlation between
genotype and clinical presentation, they evaluated genetic population structure under
the following grouping criteria: putative origin and clinical presentation records.
Microsatellite analysis showed that 82% of the isolates corresponded to C. posadasii
and 18% were C. immitis. The species identification results obtained using Umeyama
region, Ag2/PRA, and microsatellites of five of the isolates were inconsistent with the
data collected for the remaining isolates. C. posadasii strains were found primarily in
the northeastern region and C. immitis in the northwestern region. However, there
was no relationship between clinical presentation and Coccidioides species. The
molecular markers used in this study proved to have a high power of resolution to
identify the Coccidioides species recovered in culture. While C. posadasii was found
to be the most abundant species in Mexico, more detailed clinical records are needed
in order to obtain more accurate information about the infections in specific
geographical locations.
Haplotype distribution based on the combination of U region andAg2/PRA gene by region
for Coccidioides posadasii. NW, northwest; NE, northeast; CEN, central. Haplotype distribution based
on the combination of U region andAg2/PRA gene by regions for Coccidioides immitis. NW,
northwest; NE, northeast; CEN, central. Luna-Isaac et al. (2014)
Bentley et al. (2015) carried out a cross-sectional retrospective study to describe
magnetic resonance imaging (MRI) features and outcome for a group of dogs and cats
with solitary CNS Coccidiodes granulomas. Nine canine and two feline cases met
inclusion criteria; four diagnosed and treated with surgery and fluconazole and seven
diagnosed by serology or cytology and treated medically. Three cases had left
Coccidioides endemic areas long before developing neurological disease. The MRI
lesions shared many features with neoplastic masses. The extra-axial granulomas
often had a lack of a distinct border between the mass and neural parenchyma. Four
cases were extra-axial and seven were intra-axial, but distinguishing between extraaxial and intra-axial locations was sometimes challenging. The surgical cases had
good outcomes and histology allowed definitive diagnosis. Medically managed
patients also had generally good outcomes, with resolution of clinical signs in most
cases. Findings indicated that distinction between neoplasia and focal Coccidioides
granulomas based on MRI features is likely to be imprecise. Demonstration of the
organism by cytology or histology is required for definitive diagnosis.
413
Coccidioides granuloma, caudal frontal lobe of a cat (cat 1). Transverse T1-weighted postcontrast (A)
and T2-weighted (B) magnetic resonance images, surgical hematoxylin and eosin histology (C), dorsal
T1-weighted postcontrast (D) and matching 5-day postoperative (E) images. The lesion is markedly
contrast enhancing and extra-axial. The border between the contrast-enhancing mass and adjacent brain
varies from regular and sharply defined to irregular and indistinct (A and D) and dural tails are present.
Perilesional T2-hyperintensity (B) is severe and extends to the corona radiata. In (C), note a
pyogranulomatous reaction consisting of epithelioid macrophages, multinucleated cells and neutrophils
surrounding a cluster of spherules with double-refractile walls; and a spherule (inset) with doublerefractile walls and endospores. Postoperative imaging revealed complete excision of the contrastenhancing mass and resolution of mass effect (E); mild-moderate postoperative contrast enhancement
is present in the temporalis muscle and surrounding the foam placed into the craniectomy defect
Bentley et al. (2015)
414
Cervical spinal Coccidioides granuloma in a dog (dog 1). Dorsal T1-weighted postcontrast image (A),
consecutive transverse T1-weighted fat saturation postcontrast images at the level of C6 (B and C), and
parasagittal T2-weighted image (D). In (A), the lesion appears most likely intradural extramedullary,
with an apparently broad-based contact with dura mater. However, in (B and C), the lesion appears to
involve spinal cord tissue itself; much of the contrast-enhancing area appears intramedullary. The final
interpretation was an intramedullary lesion with difficult differentiation from an intraduralextramedullary lesion; an intramedullary mass was present surgically. In (A–C), the lesion is markedly
contrast-enhancing, and the border with the spinal cord tissue is irregular and varies between distinct
and indistinct. In (D), the lesion (arrow) is hypointense to normal gray matter; note the extensive
perilesional T2-hyperintensity both cranial and caudal. Bentley et al. (2015)
415
Lumbar spinal Coccidioides granuloma in a dog (dog 2). Transverse T2-weighted image at the level of
L2 (A) and sagittal T1-weighted postcontrast image with transverse image inset (B). On MRI, this
lesion was considered either intradural extramedullary or intramedullary but very superficial. T2weighted images indicated a T2-hypointense lesion that was intramedullary; however postcontrast T1weighted images mainly supported an intradural-extramedullary lesion. Note that lesion borders are
sharply defined in (B), but are less exact in the inset. Surgical HE histology (C): multiple coalescing
nodules of foamy macrophages surrounded by neutrophils and lymphocytes were observed, sometimes
centered on large, spheroid organisms with a double refractile wall and clusters of neutrophils. The
mass had appeared superficial to the pia mater surgically, and no spinal cord tissue was observed in the
biopsy samples histologically. Bentley et al. (2015)
Intracranial Coccidioides granulomas in four dogs, transverse T1-weighted postcontrast magnetic
resonance images. Note that none of the lesions have a sharply defined border between the contrastenhancing granuloma and the adjacent brain tissue; the border varies between distinct and indistinct (A,
B, and D) or completely indistinct (C). The granulomas in (A and B) were both considered most likely
416
extra-axial, however the granuloma in (A) was also considered likely to be invading the adjacent
brainstem and cerebellar tissue. The granulomas in (C and D) were both overall considered intra-axial;
however, the distinction between intra-axial and extra-axial was incomplete, with certain images more
suggestive of an extra-axial lesion (inset, D). Note also the enhancement of the neighboring meninges
in (D). Bentley et al. (2015)
Grayzel et al. (2016) identified 41 dogs seen at the Veterinary Medical Teaching
Hospital at the University of California, Davis, between 2005 and 2013
with coccidioidomycosis together with a control population of 79 dogs. Owners were
surveyed about potential risk factors including younger age, digging behaviour, and
travel to Arizona or the California central valley. Risk factors were analysed using
logistic regression analysis. Outcomes were used to generate a risk map
for coccidioidomycosis in California. There was a significant correlation between the
reported rate of coccidioidomycosis in humans and the risk map for
canine coccidioidomycosis in California, supporting the idea of dogs as sentinels for
emerging geographic areas for coccidioidomycosis in humans.
Spatial distribution of the relative predicted probability of coccidioidomycosis in dogs (a) and of the
human incidence rate during 2012 (b). Categories were selected using the natural breaks or Jenks
optimization method (Jenks, 1967) implemented in ArcGIS10.2, Grayzel et al. (2016)
Ramírez-Romero et al. (2016) described three cases of granulomatous inflammation
caused by Coccidioides spp. which were masquerading malignancies in dogs (0.39
%). The presumptive diagnoses in these cases were osteosarcoma, lymphoma and
neurofibroma, respectively. A PCR assay employing tissues in paraffin blocks
resulted positive for C. posadasii in one of these cases.
417
Dog with suspicion of neurofibroma. There is one spherule with thick and refractile cell wall. The
endospores contained within are ill defined. The inflammatory reaction is composed by epithelioid
macrophages and lymphocytes; the proliferation of fibrous connective tissue is prominent.
H&E bar 10 µm. The inset depicts the special stain with three organisms in a pyogranulomatous
reaction in case 2. GMS. Ramírez-Romero et al. (2016)
418
PCR amplification from two paraffin-embedded tissues. Lane M, DNA molecular weight marker, lane
N, negative control. Lane 1, sample case 2 and lane 2, sample case 3 with an amplicon of 634 pb. The
result corresponds to C. posadasii, Ramírez-Romero et al. (2016)
2.5.2. Reports on coccidioidomycosis in cats
Angell et al. (1985) performed enucleation of the right eye on a 12-year-old male
Persian cat when therapy for uveitis failed. Histologic examination of the anterior and
posterior chambers and the vitreous led to a diagnosis of endophthalmitis caused by
Coccidioides immitis infection. The primary focus of infection was not determined.
Latex particle agglutination, agar gel immunodiffusion, and complement fixation gave
negative results for Coccidioides immitis antibody.
Greene and Troy (1995) diagnosed coccidioidomycosis in 48 cats. Forty-one cases
were identified within a period of 3 years. Coccidioides immitis was revealed by
cytological or histopathological examinations, or culture in 70% of cats. The
remaining 30% of cases were diagnosed by appropriate clinical signs, radiographic
lesions, and serological test results. The average age of affected cats was 6.2 years
with a median age of 5.0 years. Fifty-four percent (n = 26) were female and 46% (n =
22) were male. Domestic shorthaired and longhaired breeds comprised 89% (n = 41)
of affected cats. Sixty-seven percent of cases were diagnosed during the 6-month
period of December through May. Cats infected with C immitis were presented for
evaluation of dermatologic (56%), respiratory (25%), musculoskeletal (19%), and
neurological or ophthalmologic signs (19%). Fever, inappetence, and weight loss
were present in 44% of the cats. Duration of clinical signs before diagnosis was less
than 4 weeks in 85% (n = 42) of cats, with an average of 3.8 weeks and a median of 2
weeks. Agar gel immunodiffusion tests were positive in all 39 cats tested at sometime
during the course of their disease. Hyperproteinemia (greater than 7.9 g/dL) was
present in 52% (10/23) of cases. The majority of cats (n = 39) were negative for feline
leukemia virus. Antibodies to feline immunodeficiency virus were absent in the
19 cats tested. Ketoconazole was the most common antifungal agent used to
treatcats with coccidioidomycosis. Duration of treatment ranged from less than 1
week to 43 months. Thirty-two cats are currently asymptomatic, with or without
treatment. Eleven cats died or were euthanized. Greene and Troy (1995)
[A) Histopathology of a lymph node showing a granulomatous reaction and the Cimmiris organism
(Silver stain; original magnification 1000 x). [B) Cytology of a draining skin lesion depicting Cimmifis
organism [H&E stain: original magnification 400 X). Greene and Troy (1995)
419
Lateral thoracic radiograph in a cat with respiratory distress.Note the marked hilar
lymphadenopathy.Anteroposterior view of the distal humerus in a cat withan osteoproductive lesion
due to coccidioidomycosis. Greene and Troy (1995)
Foureman et al. (2005) reported a 6-year-old 5.5-kg female spayed domestic shorthaired cat from Tucson, AZ, with a ˜5-day history of progressive pelvic limb
weakness. Magnetic resonance image (MRI, T1 weighted image with gadolinium
contrast) showed contrast-enhancing lesion in the spinal cord at the level of the 3rd
and 4th thoracic vertebrae. Histopathology of mass removed from the spinal cord of
showed the prominent fungal spherule on a background of neutrophils and The case
was diagnosed as Spinal cord granuloma due to Coccidioides immitis.
Magnetic resonance image (MRI, T1 weighted image with gadolinium contrast) showing contrastenhancing lesion in the spinal cord at the level of the 3rd and 4th thoracic vertebrae (0.5 T Signa MRI
unit).Histopathology of mass removed from the spinal cord of this cat. Note the prominent fungal
spherule on a background of neutrophils and macrophages. Foureman et al. (2005) Abstract
Gaidici and Saubolle (2009) reported an unusual case of coccidioidomycosis in the
arm of a 37-year-old veterinary technical assistant complaining of an initial right
thumb swelling without pulmonary symptoms. The patient had been bitten on the
hand by skinny, stray cat she was examining at an animal clinic approximately 2
weeks previously. The bite wound at first formed only a small eschar but then
411
progressed to increased erythema, swelling, and tenderness. The cat had died shortly
after having bitten the patient. A necropsy was performed, and splenic masses were
evaluated by histopathology as numerous “pyogranulomas” with massive numbers of
spherules present. The final diagnosis was multifocal granulomatous splenitis and
disseminated disease, with Coccidioides spp. as the etiologic organisms. The patient
responded to fluconazole therapy and remained asymptomatic at 2 months after
cessation of therapy.
References:
1. Ajithdoss DK, Trainor KE, Snyder KD, Bridges CH, Langohr IM, Kiupel M, Porter
BF. Coccidioidomycosis presenting as a heart base mass in two dogs. J Comp
Pathol. 2011 Aug-Oct;145(2-3):132-7.
2. Angell JA, Merideth RE, Shively JN, Sigler RL. Ocular lesions associated
with coccidioidomycosis in dogs: 35 cases (1980-1985). J Am Vet Med Assoc. 1987
May 15;190(10):1319-22.
3. Bentley RT, Heng HG, Thompson C, Lee CS, Kroll RA, Roy ME, Marini L, Heo
J, Wigle WL. MAGNETIC RESONANCE IMAGING FEATURES AND
OUTCOME FOR SOLITARY CENTRAL NERVOUS SYSTEM COCCIDIOIDES
GRANULOMAS IN 11 DOGS AND CATS. Vet Radiol Ultrasound. 2015 SepOct;56(5):520-30.
4. Burtch M. Granulomatous meningitis caused by Coccidioides immitis in a dog. J Am
Vet Med Assoc. 1998 Mar 15;212(6):827-9.
5. Butkiewicz CD, Shubitz LE, Dial SM. Risk factors associated with Coccidioides
infection in dogs. J Am Vet Med Assoc. 2005 Jun 1;226(11):1851-4.
6. Crabtree AC, Keith DG, Diamond HL. Relationship between radiographic hilar
lymphadenopathy and serologic titers for Coccidioides sp. in dogs in an endemic
region. Vet Radiol Ultrasound. 2008 Nov-Dec;49(6):501-3.
7. Foureman P, Longshore R, Plummer SB. Spinal cord granuloma due to Coccidioides
immitis in a cat. J Vet Intern Med. 2005 May-Jun;19(3):373-6.
8. Gaidici A, Saubolle MA. Transmission of coccidioidomycosis to a human via a cat
bite. J Clin Microbiol. 2009 Feb;47(2):505-6.
9. Grayzel SE, Martínez-López B, Sykes JE. Risk Factors and Spatial Distribution of
Canine Coccidioidomycosis in California, 2005-2013. Transbound Emerg Dis. 2016
Jan 22.
10. Gautam R, Srinath I, Clavijo A, Szonyi B, Bani-Yaghoub M, Park S, Ivanek R.
Identifying areas of high risk of human exposure to coccidioidomycosis in Texas
using serology data from dogs. Zoonoses Public Health. 2013 Mar;60(2):174-81.
11. Graupmann-Kuzma A, Valentine BA, Shubitz LF, Dial SM, Watrous B, Tornquist SJ.
Coccidioidomycosis in dogs and cats: a review. J Am Anim Hosp Assoc. 2008 SepOct;44(5):226-35.
12. Greene RT, Troy GC. Coccidioidomycosis in 48 cats: a retrospective study (19841993) J Vet Intern Med. 1995 Mar-Apr;9(2):86-91.
13. Hawkins EC, DeNicola DB. Cytologic analysis of tracheal wash specimens and
bronchoalveolar lavage fluid in the diagnosis of mycotic infections in dogs. J Am Vet
Med Assoc. 1990 Jul 1;197(1):79-83.
14. Heinritz CK, Gilson SD, Soderstrom MJ, Robertson TA, Gorman SC, Boston RC.
Subtotal pericardectomy and epicardial excision for treatment of coccidioidomycosisinduced effusive-constrictive pericarditis in dogs: 17 cases (1999-2003). J Am Vet
Med Assoc. 2005 Aug 1;227(3):435-40.
15. Jeroski A. Multicentric lymphoma and disseminated coccidioidomycosis in a dog.
Can Vet J. 2003 Jan;44(1):62-4.
411
16. Johnson LR, Herrgesell EJ, Davidson AP, Pappagianis D. Clinical, clinicopathologic,
and radiographic findings in dogs with coccidioidomycosis: 24 cases (1995-2000). J
Am Vet Med Assoc. 2003 Feb 15;222(4):461-6.
17. Kirsch EJ, Greene RT, Prahl A, Rubin SI, Sykes JE, Durkin MM, Wheat LJ.
Evaluation of Coccidioides antigen detection in dogs with coccidioidomycosis. Clin
Vaccine Immunol. 2012 Mar;19(3):343-5.
18. Luna-Isaac
JA, Muñiz-Salazar
R, Baptista-Rosas
RC, Enríquez-Paredes
LM, Castañón-Olivares
LR, Contreras-Pérez
C, Bazán-Mora
E, González
GM,González-Martínez MR. Genetic analysis of the endemic fungal pathogens
Coccidioides posadasii and Coccidioides immitis in Mexico. Med Mycol. 2014
Feb;52(2):156-66.
19. Plotnick
AN, Boshoven
EW, Rosychuk
RA.
Primary
cutaneous coccidioidomycosis and subsequent drug eruption to itraconazole in a dog.
J Am Anim Hosp Assoc. 1997 Mar-Apr;33(2):139-43.
20. Ramírez-Romero R, Silva-Pérez RA, Lara-Arias J, Ramírez-Hernández C, MarinoMartínez IA, Barbosa-Quintana Á, López-Mayagoitia A. Coccidioidomycosis in
Biopsies with Presumptive Diagnosis of Malignancy in Dogs: Report of Three Cases
and Comparative Discussion of Published Reports. Mycopathologia. 2016 Feb;181(12):151-7.
21. Robinson Y. Case history. Skeletal coccidiodidomycosis in a collie dog. Can Vet
J. 1978 Oct;19(10):272-6.
22. Rubensohn M, Stack S. Coccidiomycosis in a dog. Can Vet J. 2003 Feb;44(2):15960.
23. Shubitz LF. Comparative aspects of coccidioidomycosis in animals and humans. Ann
N Y Acad Sci. 2007 Sep;1111:395-403.
24. Shubitz LF, Dial SM. Coccidioidomycosis: a diagnostic challenge. Clin Tech Small
Anim Pract. 2005 Nov;20(4):220-6.
25. Shubitz LE, Butkiewicz CD, Dial SM, Lindan CP. Incidence of coccidioides infection
among dogs residing in a region in which the organism is endemic. J Am Vet Med
Assoc. 2005 Jun 1;226(11):1846-50.
26. Shubitz LF, Dial SM, Galgiani JN. T-lymphocyte predominance in lesions of
canine coccidioidomycosis. Vet Pathol. 2011 Sep;48(5):1008-11.
27. Shubitz LF, Matz ME, Noon TH, Reggiardo CC, Bradley GA. Constrictive
pericarditis secondary to Coccidioides immitis infection in a dog. J Am Vet Med
Assoc. 2001 Feb 15;218(4):537-40, 526.
28. Shubitz LF, Roy ME, Nix DE, Galgiani JN. Efficacy of Nikkomycin Z for
respiratory coccidioidomycosis in naturally infected dogs. Med Mycol. 2013
Oct;51(7):747-54.
29. Wanke B, Lazera M, Monteiro PC, Lima FC, Leal MJ, Ferreira Filho PL, Kaufman
L, Pinner
RW, Ajello
L.
Investigation
of
an
outbreak
of
endemic coccidioidomycosis in Brazil's northeastern state of Piauí with a review of
the occurrence and distribution of Coccidioides immitis in three other Brazilian
states. Mycopathologia. 1999 Nov;148(2):57-67.
30. Wolf AM. Primary cutaneous coccidioidomycosis in a dog and a cat. J Am Vet Med
Assoc. 1979 Mar 1;174(5):504-6.
3. Histoplasmosis in cats and dogs
3.1.
Introduction:
412
Histoplasmosis is the most commonly diagnosed major systemic mycosis
in dogs and the second most commonly reported fungal infection in cats.
The causative organism, Histoplasma capsulatum, is endemic in 31 of
the 48 contiguous US states and has a worldwide distribution.
Histoplasma organisms enter the body via inhalation or, possibly,
ingestion. They are phagocytized by macrophages and can be
disseminated via the bloodstream or lymphatic system to the
reticuloendothelial and gastrointestinal (GI) systems and, sometimes, the
bones, skin, eyes, or brain. Clinical signs are often nonspecific, including
lethargy, weight loss, and inappetence, although respiratory or GI signs
may help localize the infection. Definitive diagnosis requires
identification of H. capsulatum on cytology or histopathology. However,
antigen testing may be useful in animals in the future. Itraconazole is the
treatment of choice. The prognosis is fair for animals with
pulmonary histoplasmosis and guarded to poor for those with GI or
disseminated disease (Lin Blache, 2011).
Histoplasmosis is distributed in tropical, subtropical and temperate zones
of the world. The disease is one of the imported mycoses in Japan. To
date, although more than 30 human and one canine case
of histoplasmosis have been reported in Japan, some including that of the
canine might have been infected domestically, since the patients have no
history of going abroad. The pathogen of histoplasmosis is thus believed
to be present in our country (Sano et al., 2001).
The lesions of histoplasmosis in dogs in Japan differ from those
in dogs in North America. Affected dogs in Japan have had multiple
granulomatous or ulcerated foci in skin or gingiva and have not had
pulmonary or gastrointestinal lesions. (Ueda et al., 2003).
Histoplastnosis is caused by the dimorphic fungus Histoplasma
capsulatum which grows intracellularly as a yeast form with an affinity
for cells of the monocyte macrophage system. The disease in animals and
man varies from a benign local infection of the respiratory tract to a fatal
generalised disease with extensive dissemination of the organism,
especially in immunocompromised patients. The majority of infections
are asymptomatic or mild. Human and dog appear to be the species most
susceptible to clinical histoplasmosis.
In Australia a small number of human cases of clinical histoplasmosis
have been reported and skin test surveys have shown a low prevalence of
human Although there have been two suspected cases of histoplasmosis
reported in animals in Australia, both in dogs, neither case could be
confirmed by culture or immunohistocheniistry.
In dogs it is usually a disease of the pulmonary, gastrointestinal or
lymphoreticular system. Infection occurs by inhalation of the spores from
the mycelial (hyphal) form of the fungus which naturally grows in soil,
particularly soil enriched with the guano of bats and birds.' There is also
evidence of primary gastrointestinal infection in dogs without detectable
pulmonary manifestations.
413
3.2.
Clinical signs (Guptill and Gingerich, 2008)
The clinical signs seen in dogs and cats with histoplasmosis vary depending on which
form of infection has taken root.
3.2.1. Pulmonary histoplasmosis
Acute pulmonary histoplasmosis in dogs and cats is thought to be uncommon. In
dogs, this form is characterized by a rapid onset of dyspnea and cyanosis. Dogs with
chronic pulmonary histoplasmosis are presented for evaluation of a mild, chronic
cough and a history of weight loss and inappetance. Coughing may be due to partial
airway obstruction secondary to hilar lymphadenopathy. Most affected cats have
disseminated disease, and, even with evidence of pulmonary involvement, they
seldom cough. Other clinical signs of respiratory tract involvement include dyspnea
and tachypnea.
3.2.2. Canine disseminated histoplasmosis
Acute disseminated histoplasmosis affects multiple organs, with a history of illness of
only a few days' duration in experimental animals. Gastrointestinal involvement was
reported in 28 of 36 (78%) dogs with chronic disseminated histoplasmosis. Large
bowel diarrhea, characterized by hematochezia, mucus, and tenesmus, is
common. With disease progression into the small intestine, diarrhea may become
watery and voluminous, and protein-losing enteropathy may occur. In addition to
gastrointestinal signs, common nonspecific clinical signs of chronic disseminated
histoplasmosis in dogs include weight loss, inappetence, and fever of unknown origin
that is nonresponsive to antibiotic therapy. Abnormal lung sounds, with or without
accompanying cough or dyspnea, are noted in fewer than 50% of dogs with
disseminated histoplasmosis. Infiltration of the organism into other organs, including
the liver, spleen, and bone marrow, may result in hepatomegaly, splenomegaly, or
pallor associated with anemia. Less commonly reported clinical findings of canine
disseminated histoplasmosis include:
Vomiting
Peripheral lymphadenopathy
Polyarthropathy or fungal osteomyelitis
Ulcerated dermal nodules, sores on footpads, or draining abscesses
Neurologic signs, including seizures and vertical nystagmus
Oral lesions, including gingival nodules and lingual erosions
Conjunctivitis, chorioretinitis, retinal detachment, or optic neuritis
Icterus
Pleural and peritoneal effusion
3.2.3. Feline disseminated histoplasmosis
Clinical signs of feline disseminated histoplasmosis are often chronic and nonspecific.
Weight loss, pale mucous membranes, lethargy, pyrexia, anorexia, and dehydration
were the predominant findings cats with disseminated histoplasmosis. Granulomatous
chorioretinitis occurs, possibly because of H. capsulatum in the choroid and retina.
Additional ocular involvement may include retinal hemorrhage, optic neuritis, and
fungal granulomas. About one-third of affected cats may have lymphadenopathy,
splenomegaly, or hepatomegaly, occasionally accompanied by icterus. In contrast to
414
dogs, primary intestinal histoplasmosis is unusual in cats; in one cat, this form of
histoplasmosis caused vomiting and watery diarrhea with hematochezia. Cutaneous
lesions, infrequently reported, are nodular or ulcerated and may exude
serosanguineous fluid. Neurologic signs also occur. Rare clinical findings include
nasal polyps and oral and lingual ulceration.
3.3.
Aetiology
Histoplasma capsulatum Darling 1906
Synonyms:
Cryptococcus capsulatus Castellani et Chalmers, 1910Posadasia capsulate Moore 1934Histoplasma pyriforma Dodge 1935
Perfect stage: Emmonsiella capsulate KWON-CHUNG 1972
On Sabouraud dextrose agar, at temperature below 35C, the fungus is slow growing,
usually requiring 2-6 weeks. The growth initially appears moist and waxy, then aerial
mycelium develops , which is gray to white in colour and turns to buff or dark with
age. Microscopically, the hyphae are small, hyaline and septate. They bear both
micro- and macroconidia. The microconidia are small, round, sessile or stalked, 2-6
microns in diameter. The macroconidia, which are diagnostic, are round to pearshaped, 8-14 microns in diameter, tuberculate and born on narrow conidiophores. In
tissues, the fungus exists in the form of small, round or oval yeast-like cells, 1-4
microns in diameter. They are intracellular, often filling the cytoplasm of
mononuclear and occasionally polymorphonuclear cells.
H. capsulatum at 25oC
3.4.
tuberculate macroconida
intracellular yeast cells
Diagnosis
3.4.1. Direct microscopic examination:
Pus, discharges and biopsy material are examined after Giemsa staining. The yeast
cells are found within monocytes or macrophages. Cells are ovoid,with the bud at the
smaller end, with cell wall as a halo of unstained material. In equine histoplasmosis,
microscopical examination of Giemsa-stained smear from the pus reveals the presence
of double-contoured , spherical, oval to pear-shaped yeast cells, 2.5-3.5 by 3-4
microns with granular cytoplasm.
415
A liver aspirate from a cat. Three dark-purple hepatocytes are seen among multiple macrophages,
some of which contain yeast (arrows). Several yeast are noted free in the background (arrowheads) of
erythrocytes and a small amount of finely granular protein (Diff-Quik, 60X), A lung aspirate from a
cat. Multiple foamy activated macrophages are noted, including a single giant cell on the far left. One
macrophage contains several yeast (arrow). Several yeast are noted in the background (arrowheads)
of erythrocytes and a small amount of finely granular protein. Also note the morphologically normal
respiratory epithelial cells with their tufts of apical cilia to the right of the micrometer (Diff-Quik,
60X). (Guptill and Gingerich, 2008)
A lymph node aspirate from a cat. A single large macrophage is densely packed with yeast (arrow),
and numerous yeast organisms are free in the background. Note the clear area surrounding the yeast,
caused by shrinkage that occurs during fixation. Numerous small lymphocytes and a few bare nuclei
are also present (Diff-Quik, 100X).A canine peripheral blood smear demonstrating two segmented
neutrophils that contain several budding yeast (modified Wright's stain, 100X). A rectal scraping from a
dog. A mixture of individualized epithelial cells and macrophages are seen in a moderately heavy
background of mixed bacteria. Yeast are seen within macrophages (arrow) and are free in the
background (arrowhead) (Diff-Quik, 100X). (Guptill and Gingerich, 2008)
3.4.2. Isolation and identification:
Samples are cultured on blood agar, brain heart infusion agar and Sabouraud agar and
incubated both at room temperature and at 37 C. The fungus grows slowly at room
temperature and may need a period of 6-12 weeks. Plates incubated at 37 should be
examined for the growth of yeast colonies. Microscopically, the tuberculate
macroconidia is characteristic for H. capsulatum, but similar structure is formed by
Sepedonium which is not diphasic fungus. The yeast phase is differentiated from
Paracoccidioides because of the lack of the mariner's wheel and from Blastomyces,
which form broad-based budding cell. Conversion from mould to yeast phase and vice
versa is diagnostic.
3.4.3. Serology
416
The EIA (antigen), a radioimmunoassay for histoplasma polysaccharide antigen, has
been developed. This is a proprietary test so the evaluation of the results have been
questioned. Urine testing, which detects antigens to H. capsulatum, is the most
sensitive test for disseminated histoplasmosis. It is also used to monitor antigens
levels during treatment. It is however less useful in chronic histoplasmosis
3.4.4. Histopathology
Histoplasma capsulatum var. capsulatum in tissue is an oval 2- to 4-μm yeast that
may show narrow-based buds. With H&E stain, the basophilic yeast cytoplasm is
separated from the surrounding tissue by a clear zone corresponding to the cell wall.
The cell wall is highlighted with GMS and PAS stains. Because the yeasts are initially
ingested by macrophages, they appear to be clustered. African histoplasmosis shows
similar clustering inside phagocytic cells (particularly large multinucleated giant
cells), but the yeasts are larger (8 to 15 μm in diameter) than with H. capsulatum and
may be pigmented.
3.5.
Reports:
3.5.1. Reports on histoplasmosis in dogs:
Silva-Ribeiro et al. (1987) mentioned that 7 of 73 mongrel dogs in Rio de Janeiro
gave positive results in skin tests with a polysaccharide mycelial antigen from
Histoplasma capsulatum. Five of the positive reactors were necropsied and four of
them had disseminated histoplasmosis proved by histopathology and culture. Four
healthy puppies exposed for 10 min to soil at the site of a known outbreak
of histoplasmosis developed symptoms and died 7-14 days after exposure with
fulminant histoplasmosis. These experiments show the value of dogs as
epidemiological indicator of histoplasmosis and as experimental models for the
disease.
Clinkenbeard et al. (1988a) diagnosed disseminated histoplasmosis in a 10-yearold dog that had chronic diarrhea, weight loss, fever, and anemia. The diagnosis was
based on detection of Histoplasma organisms in circulating neutrophils, monocytes,
and eosinophils. The dog had severe histoplasmal fungemia, which may have been
caused by treatment with prednisolone.
Clinkenbeard et al. (1988b) reported diarrhea, intestinal blood loss, anemia, and
lethargy
as
predominant
clinical
findings
in
12 dogs with
disseminated histoplasmosis. Young dogs were affected most commonly, with
6 dogs being 1 to 3 years old. A diagnosis of disseminated histoplasmosis was
established on the basis of histologic or cytologic detection of Histoplasma organisms
in intestinal or rectal mucosa in 7 dogs, in circulating leukocytes in 5 dogs, in bone
marrow in 3 dogs, and in multiple tissues at necropsy in 1 dog (4 dogs had
Histoplasma organisms detected in greater than 1 site). Anemia was detected in
10 dogs (PCV less than 20% in 3 dogs), and the anemia was inadequately
regenerative or nonregenerative in 7. Hypoalbuminemia was detected in 9 dogs, and
serum albumin concentrations were low (less than 1.0 g/dl) in 4 of the 9 dogs. Of
417
5 dogs treated with ketoconazole, 2 were in remission for greater than or equal to 1
year. Corticosteroid therapy may have exacerbated the disease in 4 dogs. Histoplasma
infection of multiple organs was detected in 5 necropsied dogs.
Davies and Colbert (1990) reported highly symptomatic pulmonary histoplasmosis
with diffuse infiltrates occurring simultaneously in a man and a dog
Kowalewich et al. (1993) identified Histoplasma capsulatum organisms by cytologic
evaluation in the thoracic and abdominal effusions of a 5-year-old sexually intact
male Cocker Spaniel that was referred because of anorexia and lethargy. Treatment
with amphotericin B and ketoconazole was instituted. The dog developed
respiratory arrest, a complication of the disseminated disease, and died. Necropsy
findings included pleural effusion, hepatomegaly, and enlarged tracheobronchial,
hilar, mediastinal, and mesenteric lymph nodes. Granulomas containing periodic acidSchiff (PAS)-positive yeast-like organisms identified as H capsulatum were seen in
the lungs, liver, and lymph nodes. The lymphatic vessels were dilated, and fibrosis of
the portal and periportal regions of the liver was noticed. Identification of
Histoplasma organisms by cytologic examination of pleural and abdominal effusions
is a rare laboratory finding and can provide a minimally invasive and inexpensive
definitive diagnosis of histoplasmosis.
Mackie et al. (1997) described what they believed to be the first confirmed case of
histoplasmosis in a non-human animal in Australia. In August 1995 a formalin-fixed
skin biopsy was collected from the foot of a 10-year-old male Rotnveiler-Doberman
cross dog from Gordonvale, south of Cairns. The dog had a 12- month history of
multiple dermal nodules up to 2.5 cm diameter, some of which were ulcerated. The
lesions had failed to resolve despite several extended courses of treatment with a
number of antibiotics. The dog had also suffered moderate weight loss and
intermittent diarrhoea. The dog had never travelled out of Australia. The owner kept
chickens in his backyard but the dog had not had access to other specific avian
habitats or to bat caves. Histologically there was a severe pyogranulomatous deep
dermatitis with infiltration of much of the superficial dermis and to a lesser extent the
deep dermis by macrophages and smaller numbers of neutrophils. Within the
inflammatory reaction there were numerous round to oval yeasts with frequent narrow
based buds, most of which appeared to be within macrophages. The organisms were
approximately 2 to 4 pm in diameter and consisted of a spherical, lightly basophilic
central body surrounded by a clear halo. The cell wall was selectively stained using
Gomori's methcnaniine-silver method. Replicate sections of skin were examined by
direct imrnunofluorcscence staining using conjugates prepared at the Centers for
Disease Control. The yeasts stained using the conjugate for H capsulatum but failed to
stain using the conjugates for Cryptococcus neoformans.'' Serum collected from the
dog in January 1996 was found to contain the histoplasmosis diagnostic M precipitin
when tested by the immunodiffusion test (Irnm?', Immuno-Mycologics Inc, Norman,
OK, The skin lesions on this dog resolved completely following a 6-month course of
treatment with ketaconazole at 20 mg/kg/day. The dog also gained weight and appears
to be now in good health, 8 months after treatment ceased.
Kagawa et al. (1998) reported an 8-year-old, female mongrel dog with
granulomatous lesions in the skull skin and gingiva of the left mandible. The lesions
were macroscopically seen as grayish white papular granulomas, and microscopically
consisted to numerous swollen macrophages and a few neutrophils without fibro418
caseous necrosis. Macrophages contained many small oval or round-shaped yeast-like
cells and a few rod-shaped organisms indicating a narrow based budding in their
cytoplasm. The yeast-like cells were 2-5 microns (average 3.5 microns) in diameter,
and appeared as a central, spherical, lightly basophilic body surrounded by a clear
zone or "halo". The cell wall and central body were stained by the periodic acid-Shiff,
Grocott's methenamine silver impregnation, or Gridley fungus method.
Immunohistochemically, yeast-like cells were positive to anti-histoplasma yeast
antibody, and rod-shaped organisms were positive to anti-histoplasma mycelial
antibody.
Schulman et al. (1999) carried out a study to examine use of corticosteroids in
treating 16 dogs with airway obstruction secondary to hilar lymphadenopathy caused
by chronic histoplasmosis. Records for dogs with airway obstruction examined from
January 1979 through December 1997 were reviewed. Dogs were included in the
study if they had hilar lymphadenopathy documented radiographically and
bronchoscopically, had serum antibodies against Histoplasma capsulatum, and did
not have organisms in any cytologic or histologic samples. Dogs were assigned to
groups on the basis of treatment given (5dogs, corticosteroids only; 5 dogs,
corticosteroids and antifungal medication; 6 dogs, antifungal medication only).
Clinical signs resolved in < 1 week in dogs treated only with corticosteroids.
In dogs treated with corticosteroids and an antifungal medication, improvement was
evident in a mean of 2.6 weeks. In 5 of 6 dogs treated with only an antifungal
medication, clinical signs resolved in a mean of 8.8 weeks. Dogs receiving
corticosteroids did not develop active or disseminated histoplasmosis.
Muniz et al. (2001) characterized 13 environmental, 7 animal, and 28 clinical H.
capsulatum isolates by using a PCR-based random amplified polymorphic DNA
(RAPD) assay. DNA fingerprinting of these soil, animal, and clinical specimens was
performed with four primers (1253, 1281, D-9355, and D-10513) and generated
amplicons with considerable polymorphism. Although all of the isolates exhibited
more than 80% genetic relatedness, they could be clustered into four to six genotypes
for each primer. The RAPD profiles of H. capsulatum isolated from Rio de Janeiro
State could be distinguished from those of the U.S. strains included in this study
(Downs, G222B, G-186B, and FLS1) by showing less than 70% similarity to each
primer. The genetic polymorphisms between H. capsulatum strains isolated from
animals and soil obtained in the same geographic areas were 100% similar, suggesting
that an environmental microniche could be acting as a source of infection for animals
and the local human population.
419
Representative RAPD profiles of H. capsulatum isolates from Rio de Janeiro State, Brazil (A and C),
and U.S. strains in classes 1, 2, 3, and 4 (B and D) with primers 1253 and 1281, respectively. Lanes M,
DNA molecular size marker (Roche Biochemicals). The values on the left are molecular sizes in
kilobases. Muniz et al. (2001)
Representative RAPD profiles of H. capsulatum isolates from Rio de Janeiro State, Brazil (A and C),
and U.S. strains in classes 1, 2, 3, and 4 (B and D) with primers D-9355 and D-10513, respectively.
Lanes M: DNA molecular size marker (Roche Biochemicals). The values on the left are molecular
sizes in kilobases. Muniz et al. (2001)
Sano et al. (2001) examined skin biopsies from two dogs in Tokyo and Kumamoto,
and found fungal elements 1-2 or 2-4 microEm in diameter in the macrophages. The
homology of DNA sequences for the ITS rRNA gene were correspondent to
Ajellomyces capsulatus at a rate of more than 97.4%. Therefore, the two dogs were
diagnosed as having been infected with Histoplasma capsulatum which is the
anamorph of A. capsulatus. Since the dogs had no history of having been outside
Japan and had not been brought from an endemic area, they might have been infected
domestically. Further epidemiological surveys on canine histoplasmosis may be able
to estimate autochthonous human cases in Japan.
Ueda et al. (2003) introduced a polymerase chain reaction (PCR) diagnosis of
canine histoplasmosis and the characteristic of disease in Japan. The surgically
removed skin ulcerate samples from a 5-years-old female Shiba-inu native to Japan
421
without traveling out of the country were evaluated. Tissue samples had many yeastlike organisms in the macrophages. DNA was extracted from paraffin-embedded
tissue samples. A nested PCR technique was applied. The detected sequence of the
internal transcribed spacer of ribosomal RNA gene had 99.7% in homology with
Ajellomyces capsulatus (the teleomorph of Histoplasma capsulatum). Clinical
manifestations, historical background of equine epizootic lymphangitis in Japan, and a
human autochthonous case ofhistoplasmosis farciminosi indicated that this dog might
have been infected with H. capsulatum var. farciminosum as a heteroecism.
Ueda et al. (2003)
Nishifuji et al. (2005) reported a 5-year-old male Siberian husky bred outdoor in
Tokyo with a interdigital granulomatous lesions in the left hind limb. The dog had no
apparent pulmonary or gastrointestinal involvement. Histopathological analysis of
the skin lesions demonstrated yeast-like organisms predominantly within
macrophages. Sequence analysis of fungal ribosome RNA gene isolated from a
paraffin sample revealed a 100% homology with the teleomorph of Histoplasma
capsulatum. The present case may support the concept of primary cutaneous
canine histoplasmosis as an endemic phenotype recognized in Japan.
Swelling, multiple draining as well as interdigital granulomatouschanges in the left hindlimb.
Nishifuji et al. (2005)
421
Histopathological findings of the granulomatous skin lesions. Tissue sections were stained by Periodic
acid-Schiff (a) and Gomori’s methenamide silver (b) stains. Note spherical fungal cells (arrowheads)
found in macrophages. Bar indicates 100 lm. Nishifuji et al. (2005)
Murata et al. (2007) diagnosed a recent of canine histoplasmosis of disseminated
infection accompanied by carcinoma in Japan, by clinical characteristics,
histopathological examination, chest radiographs, ocular fundoscopy and
molecular biological data. The clinical manifestations were not limited to cutaneous
symptoms but were referable to disseminated infection, similar to human
autochthonous cases. The partial sequences of the internal transcribed spacer (ITS1/2)
regions of the ribosomal DNA genes of this and other Japanese canine histoplasmosis
strains were 99-100% identical to the sequence AB211551 derived from a human
isolate in Thailand, and showed a close relationship to the sequences derived from
Japanese autochthonous systemic and cutaneous human cases. The phylogenetic
analysis of 97 sequences of the ITS1/2 region disclosed six genotypes. The genotypes
derived from Japanese autochthonous human and dog cases belonged to the cluster
consisting of Histoplasma capsulatum var. capsulatum and H. capsulatum var.
farciminosum sequences, indicating that these varieties might cause not only
cutaneous but also systemic histoplasmosis, regardless of their host species.
Pus stamps of Case 1 stained with Giemsa solution showing macrophages containing small yeast cells,
1–4 µm in diameter (arrows); ×400. Murata et al. (2007)
422
Multiple skin ulcers of various sizes and with purulent exudates appeared on the left front paw of Case
2 (a and b). Murata et al. (2007)
Histopathological observation of the skin biopsy sample of Case 2 showed macrophages in the
granulomatous tissue containing yeast-like cells, 1–4 µm in diameter (arrows): (a) hematoxylin-eosin
(HE); (b) periodic acid Schiff (PAS); ×400. Murata et al. (2007)
The right ocular fundus (a and b) observed by indirect othalmoscopy indicated retinochoroiditis with
granules in Case 2 (arrows). Murata et al. (2007)
423
A chest x-ray showed multiple foci 3 days before death (a), and abundant rice-sized nodules in the
lungs found upon postmortem examination (b) in Case 2. Murata et al. (2007)
PAS-positive yeast-like cells (arrows) in the neoplastic tissue in the lung (a), spleen (b), liver (c and d)
in Case 2, ×400. Murata et al. (2007)
424
Detection limit of nested PCR for the ITS1/2 region of H. capsulatum using DNA from pus 9. M,
marker; 1, DNA from pus; 2, fungal DNA at 2.5 ng; 3, 250 fg; 4, 25 fg; 5, 2.5 fg; and 6, negative
control. Murata et al. (2007)
Tyre et al. (2007) presented a young dog with a history of chronic diarrhea, anorexia,
and weight loss. Histoplasma capsulatum was suspected, based on cytologic
examination of lymph node aspirates and peritoneal fluid, and confirmed by fungal
culture.
Wright-Giemsa stained cytologic sample of a peritoneal
intracytoplasmic Histoplasma capsulatumorganisms. Bar = 10 μm.
425
fluid
macrophage
containing
Clemans et al. (2011) reported a 4-year-old spayed female Golden Retriever was with
an acute edema and erythema in the left hind limb and an inguinal mass, and a 5year-old female Jack Russell Terrier (dog 2) with a recurring retro-peritoneal mass.
Diagnostic imaging in dog 1 revealed abnormal tissue surrounding the larger vessels
and ureters and complete occlusion of the left limb veins. Surgery resulted in
incomplete removal of the mass. Histologic examination revealed fibrosing
pyogranulomatous inflammation. Results of a Histoplasma antigen test were positive,
and reanalysis of the tissues revealed yeast cells indicative of Histoplasma
capsulatum. Histologic examination in dog 2 revealed fibrosing pyogranulomatous
inflammation. The mass recurred 8 months later; exploratory abdominal surgery at
that time resulted in substantial hemorrhage from the adhered caudal aorta. Histologic
examination of tissue sections from the second surgery revealed yeast cells consistent
with Blastomyces dermatitidis. Both dogs had temporary improvement after surgery.
Full clinical resolution required treatment for fungal disease. Dog 1 was treated with
itraconazole, then fluconazole (total treatment time, 23 weeks). Dog 2 was treated
with fluconazole for 36 weeks.
Cordeiro et al. (2011) investigated the serologic evidence of H. capsulatum in dogs,
considering that these animals can act as sentinels for histoplasmosis. A total of 224
serum samples from dogs were tested for antibodies against H. capsulatum through
immunodiffusion. A total of 128 (57.14%) samples were positive for leishmaniasis
by indirect immunofluorescence assay and four (1.78%) samples were positive for
antibodies against H. capsulatum. Immunological evidence of the co-existence
of histoplasmosis and leishmaniasis indogs living in urban areas was observed.
Diagnosis and clinical management of these diseases in endemic areas should be
improved by veterinarians.
Cordeiro et al. (2011)
Gilor et al. (2011) diagnosed disseminated histoplasmosis and disseminated
intravascular coagulopathy in a 7 mo old, female spayed mixed-breed dog. The dog
improved transiently with supportive care, but deteriorated shortly after initiation of
antifungal therapy. The dog was subsequently euthanized. At necropsy, marked
granulomatous vasculitis was identified in all affected organs. The tunicae and
laminae of the arteries and arterioles were obscured by epithelioid macrophages and
multinucleated giant cells admixed with necrotic material. Intracytoplasmic yeast
were present within some of these macrophages. To the authors' knowledge, this is the
first reported case of granulomatous vasculitis associated with Histoplasma
capsulatum in a dog.
Pratt et al. (2012) reported a dog with disseminated histoplasmosis. the dogs did not
originate from, or had traveled to, typical regions endemic for histoplasmosis. The
diagnosis was established from histopathology and either polymerase chain
reaction (PCR), cytology and culture. The dog was euthanized without treatment.
426
Schumacher et al. (2013) reported a 12-year-old intact male Miniature Schnauzer
dog with intestinal histoplasmosis. Chronic diarrhea was unresponsive to empirical
treatment. A laparotomy was performed, and formalin-fixed biopsies of duodenum,
jejunum, and colon were subjected histologic examination, that revealed a severe,
diffuse, granulomatous enteritis and colitis with intralesional yeast and hyphal forms.
Grocott methenamine silver stains revealed short, aseptate hyphae co-mingled with 28 µm, oval to round yeast organisms consistent with Histoplasma capsulatum. The
atypical presentation of both yeast and hyphal forms prompted identification of the
organism. Direct sequencing of a polymerase chain reaction product from paraffinembedded intestinal samples confirmed the presence of Ajellomyces capsulatus with
a homology over 99% to several sequences in GenBank. Ajellomyces capsulatus is
the holomorphic name for H. capsulatum. Therefore, the mycelial form of a
dimorphic fungus such as H. capsulatum can coexist with yeast cells within lesions
of histoplasmosis. Following diagnosis, the dog was treated with itraconazole for 6
months and has improved.
Dog, colon. A, the lamina propria of the colon is infiltrated by marked numbers of inflammatory cells
that separate and regionally efface colonic glands. The inflammation regionally extends deep into the
submucosa (arrows demarcate mucosa from submucosa). Hematoxylin and eosin (HE) stain. Bar = 100
µm. B, numerous intralesional yeast organisms accompany the inflammatory cells (arrows). The
organisms have a spherical or crescentic yeast body surrounded by a 2–8 µm, clear capsule. HE stain.
Bar = 20 µm. Schumacher et al. (2013)
Dog, colon. A, most regions contained aggregates and clusters of yeasts occasionally accompanied by
elongated, segmented, hyphal-type structures (arrowheads). Grocott methenamine silver (GMS) stain.
Bar = 20 µm. B, occasionally, the organisms exhibited branching (arrowhead) and narrow-based
budding (arrow). GMS stain. Bar = 25 µm. Schumacher et al. (2013)
427
Evolutionary relationship to other known Histoplasma/Ajellomyces species. The evolutionary history of
the isolated sequence and few other closely related sequences was inferred using the maximum
parsimony method. Numbers adjacent to the nodes are bootstrap values ≥70%. Phylogenetic analyses
were conducted in MEGA5.14 GenBank accession numbers of the sequences are given in parentheses
next to the sequence names. Schumacher et al. (2013)
Reginato et al. (2014) presented a 7-year-old intact male mixed dog with canine
neurological histoplasmosis . Abnormal clinical signs consisted of non-ambulatory
paraparesis, hind limbs hypertonia and severe thoracolumbar pain. Magnetic
resonance imaging demonstrated an isointense in T1 and T2 WI epidural lesion, with
good contrast enhancement, extending from T-10 to T-13. Laminectomy was carried
out to remove the epidural mass. Histological examination revealed a
pyogranulomatous lesion characterized by numerous macrophages containing yeastlike Grocott and PAS-positive bodies. Immunohistochemistry and PCR performed on
formalin-fixed paraffin-embedded tissue confirmed Histoplasma capsulatum as the
causative agent. H. capsulatum has a worldwide distribution in temperate and
subtropical climates but its presence as an autochthonous fungus in Europe is now
recognized. To the authors' knowledge this is the first report of
canine histoplasmosis in Italy with lesion confined to the central nervous system.
Reginato et al. (2014)
Cunningham et al. (2015) conducted a study to evaluate the sensitivity and
specificity of an antigen enzyme immunoassay (EIA) on urine samples for the
diagnosis of histoplasmosis in dogs. This retrospective medical records review
included canine cases with urine samples submitted for Histoplasma EIA antigen
assay between 2007 and 2011 from three veterinary institutions. Cases for which
urine samples were submitted for Histoplasma antigen testing were reviewed and
compared to the gold standard of finding Histoplasma organisms or an alternative
diagnosis on cytology or histopathology. Sensitivity, specificity, negative predictive
428
value, positive predictive value, and the kappa coefficient and associated confidence
interval were calculated for the EIA-based Histoplasma antigen assay. Sixty cases met
the inclusion criteria. Seventeen cases were considered true positives based on
identification of the organism, and 41 cases were considered true negatives with an
alternative definitive diagnosis. Two cases were considered false negatives, and there
were no false positives. Sensitivity was 89.47% and the negative predictive value was
95.35%. Specificity and the positive predictive value were both 100%. The kappa
coefficient was 0.9207 (95% confidence interval, 0.8131-1). The Histoplasma antigen
EIA test demonstrated high specificity and sensitivity for the diagnosis
of histoplasmosis in dogs.
3.5.2. Reports on histoplasmosis in cats:
Gwin et al. (1980) reported a cat with disseminated histoplasmosis and multifocal
inflammatory lesions in the posterior segment of the eyes. Histologic examination revealed
lesions of active choroiditis (cat) in association with numerous Histoplasma capsulatum.
Percy (1981) reported a 12-year-old, castrated male cat with a history of respiratory disease
developed bilateral endophthalmitis, retinal detachment, and granulomatous choroiditis, and
unilateral glaucoma. Other lesions included granulomatous optic neuritis, myositis involving
extraocular muscles, and focal retinitis. Light and electron microscopy showed many
intracellular organisms, interpreted to be Histoplasma. Granulomatous inflammatory lesions
and organisms were present in lung, liver, lymphoid tissues, and adrenals.
Kabli et al. (1986) reported 17 cases of histoplasmosis involving 2 dogs and 15 cats
in the Upper Rio Grande Valley of El Paso since 1978. The diagnosis, based on
clinical signs and radiographic findings, was confirmed by one or more of the
following laboratory procedures: demonstration of intracellular Histoplasma
capsulatum yeast cells in tissue, positive serology, or isolation of H. capsulatum from
various organs of necropsied animals. H. capsulatum was isolated also from a bat
cave and soil in the vicinity of some of the houses where the affected animals had
resided. Skin-tests of 97 persons for histoplasmosis indicated a 14% positive
prevalance in this locale.
Clinkenbeard et al. (1987) mentioned that anemia, weight loss, lethargy, fever,
anorexia, and interstitial lung disease were the predominant clinical findings in 12
cats with disseminated histoplasmosis. Some cats were examined because of
dysfunction or lesions of bone, eyes, or skin. In most cases, the clinical signs were
observed by the owner for 4 weeks or less before seeking veterinary care. Young cats
were most commonly affected, with 7 of the 12 cats less than or equal to 1 year old.
Identification of Histoplasma organisms in bone marrow aspirates was used to
confirm the diagnosis of histoplasmosis in 11 of the 12 cats. Histoplasma infection of
multiple organs was found at necropsy. In this study, disseminated histoplasmosis had
a higher prevalence in cats than in dogs at the same veterinary medical teaching
hospital. Feline disseminated histoplasmosis was not associated with FeLV infection.
Treatment was attempted in 7 of the 12 cats.
Wolf (1987) reported disseminated Histoplasma capsulatum infection in 7cats with
osseous lesions as the primary manifestation. The major clinical signs in these cats were
related to the bony lesions and included lameness, bone pain, and soft tissue swelling of limbs
and joints. Other clinical and pathologic findings were similar to previously reported forms of
disseminated histoplasmosis in the cat. The radiographic appearance of the lesions was
429
predominantly osteolytic; periosteal and endosteal new bone production was present in some
cases. Infection occurred primarily in bones of the appendicular skeleton with a predilection
for sites below the elbow and stifle joints.
Anterior-posterior radiographof the carpus from cat 4 demonstrating soft tissue swelling and osteolysis
of the carpal bones with collapse ofthejoint spaces. There is punctate osteolysis of the distal radius and
severe osteolysis of the proximal metacarpal bones with associated periosteal reaction. Anteriorposterior radiograph of the carpus from cat 5 demonstrating irregular osteolysis of the distal radius and
ulna and the distal metacarpal bones. Periosteal new bone production is present on Wolf (1987)
Lateral radiograph of the tarsus from cat 2 illustrating osteolysis of the tibia, tarsus, and proximal
metatarsal bones with collapse of the joint spaces and periosteal new bone production. Lateral
radiograph of the scapulae from cat 5 demonstrating "punched out," lytic areas on the proximal dorsal
border seen in two cats. Lateral radiograph of the elbow from cat 5 illustrating patchy osteolysis
interspersed in a more productive pattern of periosteal and endosteal bone reaction in the proximal
radius and ulna and the distal humerus. Wolf (1987)
Hodges et al. (1994) treated 8 cats with histoplasmosis with itraconazole at 5 mg/kg per
dose PO bid. There were multiple sites of infection, and 2 of the catshad hypercalcemia that
431
was attributed to the histoplasmosis. All 8 cats were eventually cured, but 2 cats experienced
recurrences of disease after completion of therapy, requiring 2 to 3 additional months of
itraconazole. There were no clinically relevant adverse effects during treatment. Although a
limited number of cats were treated.
Johnson et al. (2004) described infection with histoplasmosis in two indoor cats from
central California, an area not considered to be endemic for the disease. Systemic mycotic
infections should be considered as differential diagnoses in any cat with compatible clinical
signs, regardless of travel history or residence, especially if the cat is presented within a
recognized endemic region.
Vinayak et al. (2007) examined a 7-year-old domestic shorthair cat with a 2-month history
of decreased appetite and weight loss because of paraparesis of 1 week's duration that had
progressed to paraplegia 3 days earlier. Neurologic examination revealed normo- to
hyperreflexia and absence of deep pain sensation in the hind limbs and thoracolumbar spinal
hyperesthesia. Neuro-anatomically, the lesion was located within the T3 through L3 spinal
cord segments. Biochemical analysis and cytologic examination of CSF revealed no
abnormalities. Radiography revealed narrowing of the T11-12 intervertebral disk space and
intervertebral foramen suggestive of intervertebral disk disease. Myelography revealed an
extradural mass centered at the T12-13 intervertebral disk space with extension over the
dorsal surfaces of T11-13 and L1 vertebral bodies. A right-sided hemilaminectomy was
performed over the T11-12, T12-13, and T13-L1 intervertebral disk spaces, and a spaceoccupying mass was revealed. Aerobic bacterial culture of samples of the mass yielded
growth of a yeast organism after a 10-day incubation period; histologically, Histoplasma
capsulatum was identified. Treatment with itraconazole was initiated. Nineteen days after
surgery, superficial pain sensation and voluntary motor function were evident in both hind
limbs. After approximately 3.5 months, the cat was ambulatory with sling assistance and had
regained some ability to urinate voluntarily.
Kobayashi et al. (2009) carried out cytological, histopathological and
immunohistochemical examinations on a presumed 10-year-old Japanese cat showing
vomiting and emaciation. On cytologic examination of the mass of the upper
abdominal cavity, many yeast-like organisms were detected in the macrophages. At
necropsy, the upper part of colon was markedly dilated with a thickened wall. The
lung did not show significant changes. Histologically, severe necrotic and
granulomatous lesions were observed in the colon. In the colonic lesion, the
cytoplasm of the macrophages contained yeast-like organisms with irregularly shaped
dots, and the cell walls of these organisms were stained black by Grocott-Gomori
methenamine-silver stain. Immunohistochemically, they were found to be positive for
anti-histoplasma yeast antibody. This is the first report of feline histoplasmosis in
Japan.
Mavropoulou et al. (2010) presented disseminated histoplasmosis in a cat with a
history of vomiting, decreased appetite and weight loss. Abnormal findings were poor
body condition, pale mucous membranes, dehydration and a palpable abdominal
mass. Abdominal ultrasound showed lymph node enlargement, a mass of uncertain
origin, thickening of the muscularis layer of the small bowel, focal thickening of the
ileum with loss of layering and free peritoneal fluid. Cytology revealed a
piogranulomatous infiltrate and numerous macrophages containing oval or round
yeast-like cells 2 to 5 microm diameter with a central, spherical, lightly basophilic
body surrounded by a clear halo, compatible with Histoplasma capsulatum, within
the cytoplasm. Post-mortem examination revealed cavity effusions, granulomatous
nodules in lungs, intestine and omentum, thickened intestinal walls and intestinal
431
perforation. Staining with Grocott and immunohistochemistry (IHC) revealed
numerous organisms within the granulomatous reaction. H. capsulatum has a
worldwide distribution in temperate and subtropical climates. To the author's
knowledge, this is the first report of feline histoplasmosis in Europe.
Ultrasound examination of the abdomen of the cat with disseminated histoplasmosis (a–c). Focal
thickening of a jejunal loop with loss of layering (a). Mesenteric hypoechoic, heterogeneous rounded
mass (b) Mavropoulou et al. (2010)
Radiographic examination of the thorax of the cat with disseminated histoplasmosis. No pulmonary
parenchyma abnormalities were obvious at the time of the examination. Enlargement of the retrosternal
lymph node can be seen on the lateral view (arrow), as a soft tissue opacity dorsal to the cramial
stomebrae. Mavropoulou et al. (2010)
(a) Fine-needle aspirate from the abdominal mass in a cat with disseminated histoplasmosis. There are
numerous intracellular bodies within macrophages. Note the central, spherical, lightly basophilic body
surrounded by a clear halo. Diff-Quick, (b) Fine-needle aspirate from the abdominal mass in a cat with
disseminated histoplasmosis. Intracellular bodies stain positive with periodic acid Schiff stain (PAS)
Mavropoulou et al. (2010)
432
Grocott staining of same mass. Note the clusters of small, black organisms in unstained macrophages,
Anti-H. capsulatum immunohistochemistry. Notice the numerous positive-staining fungal bodies
scattered within the abdominal mass Mavropoulou et al. (2010)
Tamulevicus et al. (2011) reported a 4 yr old, spayed female domestic shorthair with
a 2 mo history of weight loss, anorexia, and diarrhea. Skin fragility was noted on
presentation and a large skin tear measuring 5 cm × 5 cm was obvious over the dorsal
cervical region. The patient was previously treated with short-term prednisone that
was discontinued 6 wk before presentation. Initial diagnostics (complete blood count
and biochemistry) did not indicate an endocrine disorder, the most common cause of
acquired feline skin fragility. Necropsy revealed diffuse histoplasmosis (most
significantly affecting the skin), epidermal atrophy, dermal collagen separation, and
infiltration in the dermis and subcutis by inflammatory cells containing yeast
organisms consistent with Histoplasma spp. Infiltrative fungal infection should be
considered as a potential cause of acquired feline skin fragility.
Aulakh et al. (2012) reported 22 cases of feline histoplasmosis seen at the VirginiaMaryland Regional College of Veterinary Medicine Teaching Hospital between 1986
and 2009. The median age of affected cats was 9 yr (mean, 8.8 yr). Female domestic
shorthairs were more commonly affected. The clinical presentation of most cases was
nonspecific. The most common presenting complaints included weakness,
lymphadenopathy, weight loss, and anorexia. Less frequent clinical signs included
vomiting, diarrhea, blindness, and lameness. Less than half of the cats had clinical
evidence of pulmonary disease on admission. Anemia and hypoalbuminemia were
common laboratory abnormalities. An interstitial pattern was the most common
radiographic pattern observed with pulmonary disease. Diagnosis was based on
identification of the organism on cytology or histopathology. Fifteen of the
22 cats were treated, and itraconazole was the most common antifungal agent
prescribed. Median duration of the antifungal treatment was 5 mo for cats that
survived to discharge. Overall survival at time of discharge for cats in this study was
55%.
Cook et al. (2012) carried out retrospective study to compare results of a urine
antigen assay with standard diagnostic methods incats with clinical signs suggestive
of histoplasmosis. Antigenuria was detected in 17/18 cats with a histopathologic or
cytopathologic diagnosis ofhistoplasmosis. This preliminary evaluation of the
Histoplasma urine antigen test suggests it may be a useful aid in diagnosing this
disease in cats.
433
Brilhante et al. (2012) described clinical and epidemiological aspects of three cases
of feline histoplasmosis and compared them to previously described cases. A detailed
mycological identification and antifungal susceptibility profile of each isolate are
presented. Secondarily, a serological survey for anti-Histoplasma antibodies was
performed with domestic and wild cats. Diseased animals presented nodular to
ulcerated skin lesions and respiratory disorders as main clinical signs. H. capsulatum
var. capsulatum was isolated and the strains showed to be susceptible to antifungal
drugs
Reinhart et al. (2012) performed a study to compare the outcomes
of cats with histoplasmosis treated with fluconazole to those treated with
itraconazole, and to evaluate possible sources of exposure for affected cats. Medical
records from feline patients with confirmed histoplasmosis (n = 32) at Kansas State
University were systematically reviewed and follow-up was performed by owner
telephone interview. Cats treated with fluconazole (n = 17) had similar mortality and
recrudescence rates when compared with cats treated with itraconazole (n = 13). Thus,
fluconazole may be a viable alternative therapy for the treatment of
feline histoplasmosis. Eleven cats were housed strictly indoors and possible sources of
exposure reported for these cats included potted plants (5/11) and unfinished
basements (6/11).
Taylor et al. (2012) presented a case of feline disseminated histoplasmosis in a 10 yr
old domestic longhair with a 2.5 mo history of recurrent hematuria. Abdominal
ultrasound examination demonstrated a thickened urinary bladder, abdominal
lymphadenopathy, and a thickened and rounded spleen. Cytologic examination of
fine-needle aspirate samples revealed Histoplasma capsulatum organisms in the
urinary bladder wall and spleen. The cat was treated with itraconazole (10 mg/kg per
os q 24 hr for 2.5 wk). The cat was euthanized after 19 days of treatment because of
lack of improvement.
Arunmozhi et al. (2013) examined one isolate and five formalin-fixed paraffinembedded (FFPE) tissue samples received from six of 15 suspected cases
of histoplasmosis in cats residing in areas not known to be endemic for H.
capsulatum. Polymerase chain reaction (PCR) amplification and sequence analysis of
the rDNA ITS-2 region confirmed the diagnosis of H. capsulatum. Results of
molecular analysis indicated that the H. capsulatum recovered from the cats were
most closely related to the North American-1 clade, but clustered separately outside
this clade, suggesting that the H. capsulatum infecting the animals may represent a
separate clade or phylogenetic species. This study also demonstrated the utility of
obtaining valuable molecular subtype data directly from archived FFPE tissue blocks,
particularly when a fungus culture was not performed or is otherwise unavailable.
Fischer et al. (2013) reported a 6-year-old male castrated outdoor cat with a history
of skin lesions evolving over 1 month and consisting of multiple papules and nodules
on the head and neck. General examination was unremarkable. Cytological
examination of the ulcerated nodules revealed a pyogranulomatous infiltrate, with
numerous macrophages containing oval yeast-like cells, 2-5 μm in size, with a central,
lightly basophilic core surrounded by a clear halo. A tentative diagnosis of fungal
infection was made, and skin biopsy specimens were taken. Histological
examination confirmed the cytology findings, and Grocott staining showed numerous
organisms suggestive of Histoplasma within macrophages. Thoracic radiographs,
abdominal ultrasound and routine laboratory testing were unremarkable. Fungal
434
culture of a nodule was negative. PCR of total DNA extracted from the infected tissue
and subsequent sequencing confirmed the diagnosis of H. capsulatum var.
capsulatum. Surgical excision of the other nodules was performed, and the cat was
treated with oral itraconazole 5 mg/kg once daily; 12 weeks after initial consultation,
no lesions were visible. No recurrence was observed during an 8 month follow-up
period.
Pretreatment picture of the lesions. Note the large ulcerated nodule on the right eyelid and several
erosive–ulcerative papules on the chin. Fischer et al. (2013)
Dermal pyogranulomatous inflammation, with large numbers of Histoplasma within macrophages.
Haematoxylin and eosin staining. After surgical excision of several nodules and systemic therapy with
itraconazole (5 mg/kg) for 6 weeks, lesions resolved. Fischer et al. (2013)
Atiee et al. (2014) performed a retrospective review of splenic ultrasound images
from 15 cats confirmed to have histoplasmosis by splenic aspirates. Size, echotexture,
echogenicity, margin appearance, presence of nodules, and the overall shape of the
spleen were reported in each case. Splenomegaly was documented in all cases
(15/15) and a hypoechoic appearance of the spleen was documented in 14/15 of cases.
The spleen was diffusely and uniformly affected in 14/15 (six homogenous and eight
with a subtle mottled appearance) and had discrete nodules in 1/15 cats.
435
Ultrasound image of feline a spleen with Histoplasma capsulatum found on aspiration. Transverse
plane of the head of the spleen showing rounded borders, with the width measurement made adjacent to
splenic vein on the mesenteric side. Ultrasound image of feline spleen with Histoplasma capsulatum
found on aspiration. Comparison between the echogenicity of the liver and the spleen depicting the
hypoechoic appearance Atiee et al. (2014)
Ultrasound image of feline spleen with Histoplasma capsulatum found on aspiration. Enlarged body of
the spleen with homogenous echotexture and rounded, bulging borders on the mesenteric surface.
Ultrasound image of feline spleen with Histoplasma capsulatum found on aspiration. This is an
enlarged spleen showing a subtly mottled appearance. There is peritoneal fluid adjacent to the spleen
(arrowhead). Atiee et al. (2014)
References
1. Arunmozhi Balajee S, Hurst SF, Chang LS, Miles M, Beeler E, Hale C, Kasuga
T, Benedict K, Chiller T, Lindsley MD. Multilocus sequence typing of Histoplasma
capsulatum in formalin-fixed paraffin-embedded tissues from catsliving in nonendemic regions reveals a new phylogenetic clade. Med Mycol. 2013 May;51(4):34551.
2. Atiee G, Kvitko-White H, Spaulding K, Johnson M. Ultrasonographic appearance
of histoplasmosis identified in the spleen in 15 cats. Vet Radiol Ultrasound. 2014
May-Jun;55(3):310-4.
3. Aulakh HK, Aulakh KS, Troy GC. Feline histoplasmosis: a retrospective study of 22
cases (1986-2009). J Am Anim Hosp Assoc. 2012 May-Jun;48(3):182-7
4. Brilhante RS, Coelho CG, Sidrim JJ, de Lima RA, Ribeiro JF, de Cordeiro
RA, Castelo-Branco Dde S, Gomes JM, Simões-Mattos L, Mattos MR, Beserra
HE,Nogueira GC, Pinheiro Ade Q, Rocha MF. Feline histoplasmosis in Brazil:
clinical and laboratory aspects and a comparative approach of published reports.
Mycopathologia. 2012 Mar;173(2-3):193-7.
5. Clemans JM, Deitz KL, Riedesel EA, Yaeger MJ, Legendre AM. Retroperitoneal
pyogranulomatous and fibrosing inflammation secondary to fungal infections in
two dogs. Am Vet Med Assoc. 2011 Jan 15;238(2):213-9
6. Clinkenbeard KD, Cowell RL, Tyler RD. Disseminated histoplasmosis in cats: 12
cases (1981-1986). Am Vet Med Assoc. 1987 Jun 1;190(11):1445-8.
436
7. Clinkenbeard KD, Cowell RL, Tyler RD. Identification of Histoplasma organisms in
circulating eosinophils of a dog. J Am Vet Med Assoc. 1988a Jan 15;192(2):217-8.
8. Clinkenbeard KD, Cowell RL, Tyler RD. Disseminated histoplasmosis in dogs: 12
cases (1981-1986). J Am Vet Med Assoc. 1988b Dec 1;193(11):1443-7.
9. Cook AK, Cunningham LY, Cowell AK, Wheat LJ. Clinical evaluation of urine
Histoplasma
capsulatum
antigen
measurement
in cats with
suspected
disseminatedhistoplasmosis. J Feline Med Surg. 2012 Aug;14(8):512-5.
10. Cordeiro RA, Coelho CG, Brilhante RS, Sidrim JJ, Castelo-Branco DS, Moura
FB, Rocha FA, Rocha MF. Serological evidence of Histoplasma capsulatum infection
among dogs with leishmaniasis in Brazil. Acta Trop. 2011 Aug;119(2-3):203-5.
11. Cunningham L, Cook A, Hanzlicek A, Harkin K, Wheat J, Goad C, Kirsch E.
Sensitivity and Specificity of Histoplasma Antigen Detection by Enzyme
Immunoassay. J Am Anim Hosp Assoc. 2015 Sep-Oct;51(5):306-10.
12. Davies SF, Colbert RL. Concurrent human and canine histoplasmosis from cutting
decayed wood. Ann Intern Med. 1990 Aug 1;113(3):252-3.
13. Fischer NM, Favrot C, Monod M, Grest P, Rech K, Wilhelm S. A case in Europe of
feline histoplasmosis apparently limited to the skin. Vet Dermatol. 2013
Dec;24(6):635-8, e158.
14. Gilor C, Ridgway MD, Singh K. DIC and granulomatous vasculitis in a dog with
disseminated histoplasmosis. J Am Anim Hosp Assoc. 2011 May-Jun;47(3):e26-30.
15. Guptill, L. and Gingerich, K. (2008). Canine and feline histoplasmosis: A review of a
widespread fungus. http://veterinarymedicine.dvm360.com/canine-and-felinehistoplasmosis
16. Gwin RM, Makley TA Jr, Wyman M, Werling K. Multifocal ocular histoplasmosis in
a dog and cat. J Am Vet Med Assoc. 1980 Apr 1;176(7):638-42.
17. Hodges RD, Legendre AM, Adams LG, Willard MD, Pitts RP, Monce K, Needels
CC, Ward H. Itraconazole for the treatment of histoplasmosis in cats. J Vet Intern
Med. 1994 Nov-Dec;8(6):409-13.
18. Johnson LR, Fry MM, Anez KL, Proctor BM, Jang SS. Histoplasmosis infection in
two cats from California. J Am Anim Hosp Assoc. 2004 Mar-Apr;40(2):165-9.
19. Kabli S, Koschmann JR, Robertstad GW, Lawrence J, Ajello L, Redetzke K.
Endemic canine and feline histoplasmosis in El Paso, Texas. J Med Vet Mycol. 1986
Feb;24(1):41-50.
20. Kagawa Y, Aoki S, Iwatomi T, Yamaguchi M, Momiyama N, Hirayama
K, Taniyama H. Histoplasmosis in the skin and gingiva in a dog. J Vet Med Sci. 1998
Jul;60(7):863-5.
21. Kowalewich N, Hawkins EC, Skowronek AJ, Clemo FA. Identification of
Histoplasma capsulatum organisms in the pleural and peritoneal effusions of a
dog. Am Vet Med Assoc. 1993 Feb 1;202(3):423-6.
22. Kobayashi R, Tanaka F, Asai A, Kagawa Y, Ikeda T, Shirota K. First case report
of histoplasmosis in a cat in Japan. J Vet Med Sci. 2009 Dec;71(12):1669-72.
23. Krohne SG. Canine systemic fungal infections. Vet Clin North Am Small Anim
Pract. 2000 Sep;30(5):1063-90.
24. Lin Blache J, Ryan K, Arceneaux K. Histoplasmosis. Compend Contin Educ
Vet. 2011 Mar;33(3):E1-10; quiz E11.
25. Mackie JT, Kaufman L, Ellis D. Confirmed histoplasmosis in an Australian dog. Aust
Vet J. 1997 May;75(5):362-3.
26. Mavropoulou A, Grandi G, Calvi L, Passeri B, Volta A, Kramer LH, Quintavalla C.
Disseminated histoplasmosis in a cat in Europe. J Small Anim Pract. 2010
Mar;51(3):176-80.
27. Muniz MM, Pizzini CV, Peralta JM, Reiss E, Zancopé-Oliveira RM. Genetic
diversity of Histoplasma capsulatum strains isolated from soil, animals, and clinical
specimens in Rio de Janeiro State, Brazil, by a PCR-based random amplified
polymorphic DNA assay. J Clin Microbiol. 2001 Dec;39(12):4487-94.
437
28. Murata Y, Sano A, Ueda Y, Inomata T, Takayama A, Poonwan N, Nanthawan
M, Mikami Y, Miyaji M, Nishimura K, Kamei K. Molecular epidemiology of
canine histoplasmosis in Japan. Med Mycol. 2007 May;45(3):233-47.
29. Nishifuji K, Ueda Y, Sano A, Kadoya M, Kamei K, Sekiguchi M, Nishimura
K, Iwasaki T. Interdigital involvement in a case of primary cutaneous
canine histoplasmosis in Japan. J Vet Med A Physiol Pathol Clin Med. 2005
Nov;52(9):478-80.
30. Percy DH. Feline histoplasmosis with ocular involvement. Vet Pathol. 1981
Mar;18(2):163-9.
31. Pratt CL, Sellon RK, Spencer ES, Johnson TW, Righter DJ. Systemic mycosis in
three dogs from nonendemic regions. J Am Anim Hosp Assoc. 2012 NovDec;48(6):411-6.
32. Reginato A, Giannuzzi P, Ricciardi M, De Simone A, Sanguinetti M, Porcellato
I, Mandara MT. Extradural spinal cord lesion in a dog: first case study of canine
neurological histoplasmosis in Italy. Vet Microbiol. 2014 Jun 4;170(3-4):451-5.
33. Reinhart JM, KuKanich KS, Jackson T, Harkin KR. Feline histoplasmosis:
fluconazole therapy and identification of potential sources of Histoplasma species
exposure. J Feline Med Surg. 2012 Dec;14(12):841-8.
34. Sano A, Ueda Y, Inomata T, Tamura M, Ikeda T, Kamei K, Kiuchi A, Mikami
Y, Nishimura K, Miyaji M. [Two cases of canine histoplasmosis in Japan]. Nihon
Ishinkin Gakkai Zasshi. 2001;42(4):229-35.
35. Schulman RL, McKiernan BC, Schaeffer DJ. Use of corticosteroids for
treating dogs with airway obstruction secondary to hilar lymphadenopathy caused by
chronic histoplasmosis: 16 cases (1979-1997). J Am Vet Med Assoc. 1999 May
1;214(9):1345-8.
36. Schumacher LL, Love BC, Ferrell M, DeSilva U, Fernando R, Ritchey JW. Canine
intestinal histoplasmosis containing hyphal forms. J Vet Diagn Invest. 2013
Mar;25(2):304-7.
37. Silva-Ribeiro
VL, Ferreira-da-Cruz
MF, Wanke
B, Galvão-Castro
B.
Canine histoplasmosis in Rio de Janeiro: natural and experimental infections. J Med
Vet Mycol. 1987 Oct;25(5):319-22.
38. Tamulevicus
AM, Harkin
K, Janardhan
K, Debey
BM.
Disseminated histoplasmosis accompanied by cutaneous fragility in a cat. J Am Anim
Hosp Assoc. 2011 May-Jun;47(3):e36-41.
39. Taylor AR, Barr JW, Hokamp JA, Johnson MC, Young BD. Cytologic diagnosis of
disseminated histoplasmosis in the wall of the urinary bladder of a cat. Am Anim
Hosp Assoc. 2012 May-Jun;48(3):203-8.
40. Tyre E, Eisenbart D, Foley P, Burton S. Histoplasmosis in a dog from New
Brunswick. Can Vet J. 2007 Jul;48(7):734-6.
41. Ueda Y, Sano A, Tamura M, Inomata T, Kamei K, Yokoyama K, Kishi F, Ito
J, Mikami Y, Miyaji M, Nishimura K. Diagnosis of histoplasmosis by detection of the
internal transcribed spacer region of fungal rRNA gene from a paraffin-embedded
skin sample from a dog in Japan. Vet Microbiol. 2003 Jul 17;94(3):219-24.
42. Vinayak A, Kerwin SC, Pool RR. Treatment of thoracolumbar spinal cord
compression associated with Histoplasma capsulatum infection in a cat. J Am Vet
Med Assoc. 2007 Apr 1;230(7):1018-23.
43. Wolf AM. Histoplasma capsulatum osteomyelitis in the cat. J Vet Intern Med. 1987
Oct-Dec;1(4):158-62.
438
4. Paracoccidioidomycosis (PCM)
4.1.
Introduction (Martinez,2015)
Paracoccidioidomycosis is an endemic fungal disease acquired
exclusively in Latin American countries, and that presents a greater
prevalence in South America. Its etiological agent is the dimorphic
fungus Paracoccidioides brasiliensis, which causes an infection that may
progress to systemic granulomatous disease with tegumentary and visceral
disease. P. lutzii is another species recently identified within the
genus Paracoccidioides, whose endemic area involves the Midwest and
North regions of Brazil. The characteristics of the disease caused by P.
lutzii are still poorly known.
Paracoccidioides brasiliensis is soil saprophyte, which has a transitory
and short saprophyte phase and its survival is related to the ability to
infect the host.
Natural infection with P. brasiliensis occurs in men and animals and is
acquired by the respiratory route after inhalation of fungal conidia
suspended in air.
Transmission of the disease through the skin or the mucosa is unlikely due
to the low number of fungal propagules inoculated subcutaneously in small
traumas. A case of accidental percutaneous inoculation in the laboratory
only caused a local granulomatous reaction. There is no evidence of
human transmission of paracoccidioidomycosis.
Paracoccidioidomycosis disease manifests as two main clinical forms that
are epidemiologically distinct.
o The acute/subacute form commonly affects children and young
adults who tend to show more disseminated lesions.
o The chronic form of the disease is more common among adult men
who present lesions usually involving the oral mucosa, the airways
and the lungs.
Autochthonous cases of paracoccidioidomycosis are limited to the
American continent, approximately between 23°N and 35° S, i.e., from
Mexico to Argentina. About 80% of the cases reported occurred in Brazil,
and most of the remaining ones occurred in Venezuela, Colombia and
Argentina. Autochthonous human paracoccidioidomycosis has not been
reported in some countries such as Chile, Guyana, Surinam, French
Guyana, Belize and Nicaragua.
Paracoccidioidomycosis in non-endemic countries: At least 60 cases of
paracoccidioidomycosis have been reported and diagnosed in countries
outside Latin America. The cases were observed in the United States of
America, Canada, Spain and other European countries, the Middle East,
Japan and Africa. All 60 cases were considered to be imported
paracoccidioidomycosis since the patients had reported visiting or working
in South or Central American countries. Some of them had left the
endemic area already presenting clinical manifestations of the mycosis, but
439
most of them had shown lesions after at least five years of permanence in
non-endemic countries. These cases are indicators of endemic sites of the
mycosis.
The skin test with the intradermal application of P. brasiliensis antigens is
used to assess delayed hypersensitivity and is the method most frequently
used to detect asymptomatic infection with the fungus. There are
limitations to the interpretation of skin test results and to the comparison of
studies. Different P. brasiliensis antigens lead to different rates of
reactivity. There is also evidence of cross-reactivity when the skin test is
applied to people infected with Histoplasma capsulatum, although
infection with both fungi should be considered.
The search for anti-P. brasiliensis antibodies in population samples has
also demonstrated the presence of paracoccidioidomycosis-infection
o The disease and particularly P. brasiliensis infection have been
demonstrated in different species of domestic and wild animals. An
armadillo species (Dasypus novemcinctus) is more associated with the ecoepidemiology of paracoccidioidomycosis, being frequently infected or
showing histopathological changes suggestive of disease caused by P.
brasiliensis. Armadillos dig and produce aerosols with soil particles and
are probably infected by inhaling fungal conidia in suspension in the air, as
is the case in humans.
o Regarding domestic animals, paracoccidioidomycosis was confirmed by
isolation of the fungus and/or histopathological examination in two dogs
from the Brazilian Southeast which showed lymphadenomegaly. Dogs are
susceptible to experimental infection,
o There is some evidence that dogs can be naturally infected by
Paracoccidioides brasiliensis in endemic areas of paracoccidioidomycosis
o Infection by Paracoccidioides. brasiliensis in canines has been
investigated in different Brazilian regions, demonstrating significant
positivity possibly due to the habit of these animals to sniff and dig the
soil, contributing to understanding the fungal transmission, ecology and
epidemiology.
o Serological surveys or skin tests with P. brasiliensis antigens have
revealed the existence of paracoccidioidomycosis-infection in cats, dogs,
chickens, pigs, cattle, horses, sheep, goats, rabbits and in monkeys and in
other free or captive wild animals. Dogs living in the rural area have a
higher rate of infection than dogs living in the urban area.
4.2.
Aetiology
Paracoccidioides brasiliensis (SPLENDORE) ALMEIDA 1930)
Synonyms: Zymonema brasiliense SPLENDORE 1912
Zymonema histosporocellularis ALMEIDA 1914
Coccidioides brasiliensis ALMEIDA 1929
Coccidioides histosporocellularis FONSECA 1932
Paracoccidioides cerebriformis MOORE 1935
Paracoccidioides tenuis MOORE 1935
Lutziomyces histosporocellularis FONSECA FILHO 1939
441
Blastomyces brasiliensis CONANT et HOMMEL 1941
Aleurisma brasiliensis AROEIRA et BOGLIORI 1951
Perfect stage: unknown
Paracoccidioides brasiliensis is the cause of paracoccidioidomycosis (South
American blastomycosis). Paracoccidioides brasiliensis is a thermically dimorphic
fungus. The mould phase grows slowly and matures within 3-4 weeks. The colonies
vary from glabrous, leathery, brownish, flat ones with a tuft of aerial mycelium to
wrinkled, folded, floccose to velvety, white, beige to pink forms. Microscopically, the
hyphae are hyaline and septate and may be sterile or carry few terminal conidia. All
cultures produce intercalary chlamydospores.. The mould phase is easily converted to
yeast phase when subcultered and incubated at 37 C. The yeast phase grows slowly,
producing wrinkled, folded, glabrous and whitish colonies. Microscopically, the yeast
cells are 2-30 microns in diameter, thin-walled, oval or irregular in shape and produce
multiple, thin-necked, round buds which develop from all areas of the mother cell.
P. brasiliensis at 25oC
4.3.
terminal conidia
multiple-budding yeast cells
Reports of Paracoccidioidomycosis
4.3.1. Reports of Paracoccidioidomycosis in dogs
Ono et al. (2001) analyzed sera from 305 dogs by enzyme-linked immunosorbent
assay (ELISA) to determine presence of the antibody anti-gp43, which reacts to a
specific antigen of Paracoccidioides brasiliensis. The dogs were divided into three
groups according to their origin: urban dogs (animals with little or no contact with
rural areas); suburban dogs (from the urban outskirts); and rural dogs. There was a
significant difference between groups (P < 0.05). Rural dogs reacted positively in
89.5% of cases, followed by suburban (48.8%) and urban dogs (14.8%). There were
no differences between male and female dogs. In an attempt to verify the feasibility of
skin testing with gp43 to determine sensitization against P. brasiliensis in dogs,
suburban (n = 61) and rural (n = 21) dogs were tested, showing positivity of 13.1 and
38.1%, respectively. Six dogs that had higher ELISA titers and also showed strong
reactions in skin testing were killed in an attempt to isolate P. brasiliensis. The fungus
was not detected by culture or histopathological analysis in these dogs, suggesting
that dogs have a natural resistance or that they encounter an inoculum level that is
insufficient to cause disease. These results indicate that ELISA and skin testing can be
441
useful in the epidemiological study of paracoccidioidomycosis in dogsand that
encounter with the fungus in nature is a frequent event.
(A) Site of intradermal skin test with gp43 in a dog immunized with P. brasiliensis. (B) DTH
after skin test showing in•ammatory in.ltrates with mononuclear and polymorphonuclear leukocytes.
Ono et al. (2001)
Ono et al. (2003) evaluated the susceptibility of dogs to experimental infection
by paracoccidioidomycosis. Puppies were inoculated with Paracoccidioides
brasiliensis by an intravenous route and two out of four died 1 week postinoculation,
showing, at histopathological analysis, granulomas in the lungs, spleen and liver. P.
brasiliensis was isolated from these organs. The animals that survived the infection
showed a strong reaction when skin was tested with gp43, a specific antigen of P.
brasiliensis. These animals were killed at 1 and 5 months after infection, and no
lesions, macroscopic or microscopic, were observed in the lungs, spleen or liver;
442
furthermore no P. brasiliensis culture was obtained from these organs. These results
suggested that dogs can develop paracoccidioidomycosis and reinforces the
importance of this animal as a sensitive indicator of P. brasiliensis in the environment.
Lung (1), spleen (2) and liver (3) from a puppy infected experimentally with Paracoccidioides
brasiliensis. Tissues were stained with hematoxylin and eosin (a) and with Grocott (b). The lung shows
more extensive lesions, with several granulomas and a high number of fungus cells. The spleen and
liver show sporadic granulomas with lower number of fungus cells (200_/). Ono et al. (2003)
443
a, Skin test with P. brasiliensis -specific gp43 antigen in a puppy infected with P. brasiliensis. b,
Perivascular inflammatory infiltrate with mononuclear and polymorphonuclear leukocytes (H.E.)
(200_/). Ono et al. (2003)
Eisele et al. (2004) performed a study to evaluate the immune response of
young dogs experimentally infected with Paracoccidioides brasiliensis. Six dogs were
infected intravenously with P. brasiliensis and one control dog was inoculated with
sterile saline. The infected animals were sacrificed in groups of two at 1, 6 and 12
months after infection. During the experimental period, the immune responses of
the dogs to the fungus were followed by ELISA (IgM and IgG), by the
immunodiffusion test and by the skin test with gp43. After killing the dogs, samples
from several organs were submitted to histopathological analysis (H&E and Grocott
stains) but the fungus was not observed in any tissue. Attempts to isolate the fungus
from these tissue samples were also unsuccessful. All infected dogs, except one,
reacted positively to the immunodiffusion and skin tests. All infected dogs showed a
humoral immune response to the gp43 antigen detected by ELISA. The IgM and IgG
444
response peaked by the first and second month, respectively. It was concluded that
young dogs appear to be resistant to the development of paracoccidioidomycosis.
Ricci et al. (2004) presented the case of a female adult Doberman that developed
cervical lymphadenomegaly. Histopathological examination of a cervical biopsy
specimen revealed active PCM, with an epithelioid, granulomatous inflammation
containing numerous yeast-like, multiple budding fungal forms. The diagnosis of
PCM was confirmed by immunohistochemistry using a specific antibody anti-gp43
and by nested PCR using primers for the amplification of the gp43 gene region. This
is the first report of PCM disease occurring in a dog, an animal that has been shown to
play an important role in the natural history of North American blastomycosis.
PCR. Lane 1, 100-bp molecular-weight marker; lane 2, template-free DNA, lane 3, negative control (H.
capsulatum); lane 4, P. brasiliensis gp43 amplicom (195 bp) from a human biopsy; lane 5, P.
brasiliensis gp43 amplicom (196 bp) from the canine biopsy. Ricci et al. (2004)
445
Silveira et al. (2006) carried out a study to detect antibodies against Paracoccidioides
brasiliensis in dogs seropositive and seronegative for leishmaniasis. Sera from
836 dogs (449 positive and 387 negative to leishmaniasis) were analysed by ELISA
and the immunodiffusion test using gp43 and exoantigen, respectively. The analysis
of the 836 serum samples by ELISA and the immunodiffusion test showed a positivity
of 67.8 % and 7.3%, respectively, for P. brasiliensis infection. The dogs positive to
leishmaniasis showed a higher reactivity to gp43 (79.9%) and exoantigen (12.7%)
than the negative ones (54.0% and 1.0%, respectively). The higher reactivity to P.
brasiliensis antigens may be due to cross-reactivity or a co-infection of dogs by
Leishmania and P. brasiliensis. The lower correlation (0.187) observed between
reactivity to gp43 and Leishmania antigen reinforces the latter hypothesis.
Theodoro et al. (2008) determined the sequences of the PRP8 intein from P.
brasiliensis isolates to be belonging to the three described genetic groups and two
unidentified isolates and analyzed in order to check their functionality and usefulness
for species identification. All the isolates presented a full-length intein, although the
Endonuclease domain seemed to be inactive due to substitutions in the second
essential aspartic acid residue. Phylogenetic analysis by Maximum-Parsimony,
Maximum Likelihood, and Bayesian analysis clearly separated the isolates from the
three species and revealed a significant difference between the Pb01 isolate and the
remaining ones. The Pb01 isolate did not belong to any of the groups previously
described since it presented a high divergence level compared to the three different
genetic groups, corroborating some previous studies that suggested this isolate as a
new species of Paracoccidioides.
Bianchini et al. (2009) carried out a study to evaluate the activation of the dog
alternative complement pathway by P. brasiliensis. Initially, the ability of erythrocytes
of guinea pig, rabbit, sheep, chicken and swine to activate the dog alternative pathway
was evaluated. The guinea pig erythrocytes showed the greatest capacity to activate
dog alternative pathway. The alternative (AH50) hemolytic activity was evaluated in
27 serum samples from healthy dogs and the mean values were 87.2 AH50/ml. No
significant differences were observed in relation to sex and age. The alternative
pathway activation by P. brasiliensis was higher in serum samples from
adult dogs when compared to puppies and aged dogs (p ≤ 0.05). This is the first report
of dog alternative complement pathway activation by P. brasiliensis and suggests that
it may play a protective role in canineparacoccidioidomycosis.
Fontana et al. (2010) performed a survey to evaluate canine infection with P.
brasiliensis in 149 urban and 126 rural dogs using ELISA and intradermal tests
with the gp43 antigen of P. brasiliensis in Uberaba, Minas Gerais state of Brazil.
Forty-one out of 149 urban dogs were euthanatized and had their lungs, liver and
spleen removed. One slice from each viscera was processed for histopathological
examination and the remaining was homogenized and then cultivated on mycobiotic
agar at room temperature and Fava-Netto medium at 35 degrees C and observed for
12 weeks. Of urban dogs, 75 (50.3%) were small adult females, 56 (36%) were strays,
while 93 (64%) had been donated to the municipal zoonosis control center. Nine
(6.2%) had a positive intradermal test without statistical differences regarding gender,
race, nutritional status or origin. No colonies with microscopic or morphology
appearances resembling P. brasiliensis were isolated, nor granulomatous process or
fungal structures were observed from histopathological examination. Eighty (53.6%)
of the urban dogs presented seroreactivity, without statistical differences regarding
gender, race, nutritional state, origin, or positive intradermal test. Of 126 rural dogs,
446
102 (80.5%) presented antibodies against gp43 antigen, and this was statistically
significant in relation to the reactivity detected in urban dogs (P = 0.0001).
Thus, dogs are commonly infected with P. brasiliensis, but they probably present
natural resistance to develop paracoccidioidomycosis.
de Farias et al. (2011) reported the second case of naturally acquired PCM in a 6year-old female dog that presented emaciation, lymphadenomegaly, and
hepatosplenomegaly. Biochemical and pulmonary radiographic evaluation did not
reveal any abnormalities. PCM was diagnosed by clinical findings, culturing,
immunohistochemistry, and histopathology of popliteal lymph node. The fungus was
recovered from popliteal lymph node, and the molecular analysis showed respective
sequencing similarities of 99 and 100% for 803 nucleotides of the Gp43 gene and 592
nucleotides from the ITS-5.8S region of Paracoccidioides brasiliensis.
Immunohistochemistry revealed severe lymphadenitis and presented numerous yeasts,
which reacted against the gp43 antibody. Histopathology revealed a severe
granulomatous lymphadenitis associated with numerous single or multiple budding
yeasts. After diagnosis, the dog was successfully treated with itraconazol for 2 years.
Generalized lymphadenomegaly in a six-year-old female Doberman. a Submandibular lymph
node; bprescapular lymph node; c inguinal lymph node; d popliteal lymph node, de Farias et al.
(2011)
447
a Histological fragment of popliteal lymph node stained with hematoxylin and eosin showing oval
structures(40×). b Histological fragment of popliteal lymph node stained with periodic Acid-Schiff
showing the same poorly stained oval structure surround by neutrophils, macrophages and giant cells
(100×), de Farias et al. (2011)
Yeasts of P. brasiliensis stained through an antibody directed against the protein Gp43 in
immunohistochemical section of popliteal lymph node (40×—a, 100×—b) de Farias et al. (2011)
Microscopy showing many globous yeast cells stained by lactophenol cotton blue smear (40×) de
Farias et al. (2011)
Teles et al. (2016) investigated infection by P. brasiliensis in dogs from Southern
Brazil. Indirect ELISA was used to detect antibodies against P. brasiliensis gp43. One
hundred and ninety-six stray and semi-domiciled dogs from the municipalities of
Pelotas and Capão do Leão, Rio Grande do Sul were included in this study. P.
brasiliensis infection was detected in 58 animals (29.6 %) with no significant
difference for gender, age and breed. Seropositive animals were detected in all
448
neighborhoods in the city of Pelotas as well as in the neighboring municipality Capão
do Leão. The detection of antibodies against gp43 in dogs suggests the presence and
wide distribution of the fungus in Pelotas and Capão do Leão, warning for the
possibility of PCM disease in dogs as well as in humans from this region.
4.3.2. Reports of Paracoccidioidomycosis in cats
Gonzalez et al. (2010) reported a male Persian cat with persistent fever, anorexia,
weakness, hypopyon, nystagmus, and intention tremors. The hemogram showed
severe neutropenia and laboratory analysis on cerebrospinal fluid (CSF) smears
revealed abundant yeast cells compatible with Paracoccidioides brasiliensis.
Urinalysis demonstrated persistent funguria and an increased urine protein-tocreatinine ratio (UPC) in addition to mild azotemia. Long-term therapy with oral
fluconazole was effective in controlling the nervous system signs. Funguria was
resolved with subcutaneous administration of diluted amphotericin B in a large
volume of saline solution for a period of 12 weeks during the second year after initial
diagnosis. Throughout 5 years of treatment, no adverse effects were observed and
tolerance to the drugs was normal. Due to development of progressive uremic
syndrome the animal was euthanased.
Oliveira et al. (2013) carried out a study was to evaluate infection of cats by
Paracoccidioides brasiliensis. Serum samples of 136 cats from rural (n = 86) and
urban areas (n = 50) were analyzed by indirect ELISA and immunodiffusion test
using P. brasiliensis gp43 and exoantigen as antigens, respectively, and an overall
reactivity of 31.6 % was observed by ELISA although no reactivity was detected by
immunodiffusion. The positivity observed in animals living in rural areas (48.8 %)
with free access to soil was significantly higher (P < 0.0001) than among urban
animals (2 %) with limited access to soil, although no significant difference was
observed in relation to age or sex. The high rates of positivity observed in cats from
rural areas suggest that not diagnosed cases of this mycosis may be occurring
in cats living in endemic areas for human paracoccidioidomycosis. This is the first
report showing serological evidence of P. brasiliensis infection in cats.
References:
1. Bianchini AA, Petroni TF, Fedatto PF, Bianchini RR, Venancio EJ, Itano EN, Ono
MA. Activation of the alternative complement pathway in canine normal serum by
Paracoccidioides brasiliensis. Braz J Microbiol. 2009 Apr;40(2):234-7
2. de Farias MR, Condas LA, Ribeiro MG, Bosco Sde M, Muro MD, Werner
J, Theodoro RC, Bagagli E, Marques SA, Franco M. Paracoccidioidomycosis in a
dog: case report of generalized lymphadenomegaly. Mycopathologia. 2011
3. Eisele RC, Juliani LC, Belitardo DR, Itano EN, Estevão D, Bracarense AP, Camargo
ZP, Ono MA. Immune response in dogs experimentally infected with
Paracoccidioides brasiliensis. Med Mycol. 2004 Dec;42(6):549-53.
4. Fontana FF, dos Santos CT, Esteves FM, Rocha A, Fernandes GF, do Amaral
CC, Domingues MA, De Camargo ZP, Silva-Vergara ML. Seroepidemiological
survey of paracoccidioidomycosis infection among urban and rural dogs from
Uberaba, Minas Gerais, Brazil. Mycopathologia. 2010 Mar;169(3):159-65.
449
5. Gonzalez JF, Montiel NA, Maass RL. First report on the diagnosis and treatment of
encephalic and urinary paracoccidioidomycosis in a cat. J Feline Med Surg. 2010
Aug;12(8):659-62.
6. MARTINEZ, R. EPIDEMIOLOGY OF PARACOCCIDIOIDOMYCOSIS. Rev. Inst.
Med. trop. S. Paulo ,57, 19,11-20 , 2015
7. Oliveira GG, Belitardo DR, Balarin MR, Freire RL, Camargo ZP, Ono MA.
Serological survey of paracoccidioidomycosis in cats. Mycopathologia. 2013
Oct;176(3-4):299-302.
8. Ono MA, Bracarense AP, Morais HS, Trapp SM, Belitardo DR, Camargo ZP.
Canine paracoccidioidomycosis: a seroepidemiologic study. Med Mycol. 2001
Jun;39(3):277-82.
9. Ono
MA, Kishima
MO, Itano
EN, Bracarense
AP, Camargo
ZP.
Experimental paracoccidioidomycosis in dogs. Med Mycol. 2003 Jun;41(3):265-8.
10. Ricci G, Mota FT, Wakamatsu A, Serafim RC, Borra RC, Franco M.
Canine paracoccidioidomycosis. Med Mycol. 2004 Aug;42(4):379-83.
11. Silveira LH , Domingos IH, Kouchi K, Itano EN, Silva EA, Landgraf VO, Werneck
SM, Camargo ZP, Ono MA. Serological detection of antibodies against
Paracoccidioides brasiliensis in dogs with leishmaniasis. Mycopathologia. 2006
Nov;162(5):325-9.
12. Teles AJ, Klafke GB, Cabana ÂL, Albano AP, Xavier MO, Meireles MC.
Author information. Serological Investigation into Paracoccidioides brasiliensis
Infection in Dogs from Southern Rio Grande do Sul, Brazil. Mycopathologia. 2016
Apr;181(3-4):323-8.
13. Theodoro RC, Bagagli E, Oliveira C. Phylogenetic analysis of PRP8 intein in
Paracoccidioides brasiliensis species complex. Fungal Genet Biol. 2008
Sep;45(9):1284-91.
5. Sporotrichosis
5.1.
Introduction
Sporotrichosis is a mycotic infectious disease that is generally acquired by traumatic
inoculation of contaminated materials especially from plant debris or through bites
and scratches from diseased animals, such as domestic cats. It affects the skin,
lymphatic system, and other organs in the warm-blooded host. Etiological agents are
embedded in the plant-associated order Ophiostomatales. With essential differences
between possible outbreak sources and ecological niche, host-environment
interactions are classic determinants of risk factors for disease
acquisition. Sporotrichosis outbreaks with zoonotic transmission, such as those that
are ongoing in southern and southeastern Brazil, have highlighted the threat of crossspecies pathogen transmission. Sporothrix brasiliensis has emerged as a human threat
owing to the intimate contact pattern between diseased cats and humans in endemic
areas. Montenegro et al. (2014)
Feline sporotrichosis, which is caused by species of the Sporothrix schenckii
complex, is endemic to Rio de Janeiro, Brazil. More than 4000 cases of the disease
were diagnosed at Fundação Oswaldo Cruz, Brazil, between 1998 and
2012. Sporotrichosis in cats has been reported in several countries, but nowhere has
an outbreak of animal sporotrichosis been as large as that seen in Brazil. The clinical
451
manifestations of the disease range from an isolated skin lesion that can progress to
multiple skin lesions and even fatal systemic involvement. Nodules and ulcers are the
most common types of lesions, and respiratory signs and mucosa involvement are
frequent. The definitive diagnosis depends on isolation of the etiologic agent in
culture. Cytology, histopathology, and serology are useful tools for preliminary
diagnosis. Severe pyogranulomatous inflammatory infiltrate, high fungal load, and
extension of lesions to mucosa, cartilage, and bone in the nose of cats are indicative of
an agent of high virulence in this endemic region. Itraconazole is the drug of choice,
while, in refractory cases, amphotericin B or potassium iodide might be alternative
treatments; however, recurrence after discharge may occur. Sporotrichosis persists as
a neglected disease in Rio de Janeiro, and the treatment of cats remains a challenging
and long-term endeavor (Gremião et al., 2015)
Sporotrichosis is a subcutaneous mycosis with worldwide distribution, especially in
tropical and subtropical areas.
Sporotrichosis is an acute or chronic subcutaneous mycosis of humans and
other mammals, especially cats, caused by pathogenic species of Sporothrix
schenckii complex revealed by gene sequencing:
1.
2.
3.
4.
5.
6.
Sporothrix albicans
Sporothrix brasiliensis
Sporothrix globosa
Sporothrix luriei
Sporothrix mexicana
Sporothrix schenckii
Molecular studies have demonstrated a high level of intraspecific
variability. Components of the S. schenckii cell wall that act as adhesins
and immunogenic inducers, such as a 70-kDa glycoprotein, are apparently
specific to this fungus. The main glycan peptidorhamnomannan cell wall
component is the only O-linked glycan structure known in S. schenckii. It
contains an α-mannobiose core followed by one α-glucuronic acid unit,
which may be mono- or di-rhamnosylated. The oligomeric structure of
glucosamine-6-P synthase has led to a significant advance in the
development of antifungals targeted to the enzyme's catalytic domain in S.
schenckii. López-Romero et al. (2011)
Sporotrichosis, caused by the Sporothrix schenckii fungal complex, is a
zoonotic mycosis distributed worldwide.
Sporothrix propagules present on soil and plant debris may be traumatically
inoculated into the cutaneous/ subcutaneous tissues of the warm-blooded host. An
alternative route involves direct animal-animal and animal-human transmissions
through deep scratches and bites of diseased cats.
Zoonotic transmission is described with cats being the main animal species involved.
The occurrence of severe feline sporotrichosis with high fungal levels demonstrates
451
the susceptibility of cats to this disease and the importance of studying its
pathogenesis.
Over the last decades, large epidemics of sporotrichosis occurred in Brazil due
to zoonotic transmission, and cats were pointed out as key susceptible hosts.
The diagnosis solely rests on the isolation of Sporothrix schenckii in culture.
On pathologic examination, causative organisms are rarely seen. Staining with
fluorescent-labeled antibodies may aid in visualizing the cigar-shaped yeast
forms;
Topical therapy is not effective. Potassium iodide is an effective treatment
for sporotrichosis, but this agent has not been subjected to specific treatment
trials comparing its efficacy against azoles or allylamine alternatives.
Itraconazole is generally safe and well tolerated, and the relapse rate is low.
Terbinafine could be another therapeutic alternative to treat the disease
5.2.
Aetiology
5.2.1. Sporothrix schenckii HEKTOEN et PERKINS 190
Synonyms :
Sporotrichum schenckii MATRUCHOT1910
Sprotrichum beurmannii MATRUCHOT et RAMOND 1905
Sporotrichum asteroids SPLENDORE 1909
Perfect stage: Ceratocystis stenocera
S. schenckii is a thermically dimorphic fungus. On Sabouraud dextrose agar at 25 C
colonies develop in 3-5 days, at first blackish and shiny but become fuzzy with age as
aerial hyphae are produced. Initially, the colony is moist, glabrous and yeast-like , but
becomes tough, wrinkled and folded in time. Microscopically, thin, branching, septate
hyphae and small, 3-5 microns, conidia are seen. The conidia are delicately attached
to the distal tapering ends of slender conidiophores. The conidia are arranged in
flower-like clusters. At 37 oC, on media containing high concentration of sugars the
organism grows in the yeast phase. Conversion to the yeast phase requires 3-5 days.
The yeast colony is pasty and grayish Microscopically, the yeast cells are variable in
shape, but often fusiform, 1-3 by 3-10 microns, with multiple buds. The elongated
yeast cells, resembling cigars with buds, are characteristic.
S.
schenckii at 25oC
flower-like clusters of conidia cigar-shaped yeast cells in tissues
452
5.2.2. Sporothrix brasiliensis Marimon, Gené, Cano & Guarro,
Journal of Clinical Microbiology 45 (10): 3203 (2007)
Colonies on PDA attain a diameter of 15 to 38 mm after 21 days of incubation at
30°C. Conidiogenous cells are usually terminal or intercalary on more or less
differentiated conidiophores, slightly swollen, and produce conidia sympodially on a
few denticles. Sympodial conidia are usually hyaline to subhyaline, obovoidal, and 2
to 6 μm long by 1 to 4 μm wide. Sessile conidia are brown to dark brown, thick
walled, globose to subglobose, and 2.5 to 5 μm long by 2 to 3 μm wide. The
maximum growth temperature is 37°C (5 to 10 mm in diameter after 21 days). The
fungus does not grow at 40°C and is unable to assimilate sucrose and raffinose.
Morphology of the sessile conidia of the S. schenckii species complex. (A) S. brasiliensis CBS 120339
(clade I). (B and C) S. schenckii (clade II) and FMR 8608 (clade IIa) (B) and FMR 8677 (clade IIb)
(C). (D) S. globosa CBS 120340 (clade III). (E) S. mexicana CBS 120341 (clade IV). Bars, 10 μm.
5.3. Reports
5.3.1. Dogs
Aetiology
Sporothrix schenckii, Bernstein et al. (2007, Cafarchia et al. (2007), dos
Santos et al. (2007), de Miranda et al. (2009), Madrid et al. (2011),
Miranda et al. (2011), Madrid et al. (2012)
Sporothrix brasiliensis, Guterres et al. (2014)
Clinical
Cutaneous sporotrichosis, Schubach et al. (2006), Bernstein et al. (2007,
dos Santos et al. (2007), de Miranda et al. (2009), Madrid et al. (2012)
Lymphocutaneous sporotrichosis, Cafarchia et al. (2007), Crothers et al.
(2009)
Disseminated sporotrichosis.Crothers et al. (2009), Madrid et al. (2012)
osteoarticular sporotrichosis, Goad and Goad (1986)
453
Nasal sporotrichosis, Shany (2000), Cafarchia et al. (2007), Whittemore et
al. (2007)
claw bed sporotrichosis, Sykes et al. (2001)
Treatment
ketoconazole, Goad and Goad (1986), Cafarchia et al. (2007), Crothers et
al. (2009)
itraconazole, Shany (2000), Sykes et al. (2001), Bernstein et al. (2007,
Whittemore et al. (2007), Crothers et al. (2009), Guterres et al. (2014)
(1-3) β-glucan along with itraconazole , Guterres et al. (2014)
5.3.2. Cats
Aetiology
Sporothrix schenckii , Kovarik et al. (2008), Schubach et al. (2008), Crothers
et al. (2009), Reis et al. (2009), Weingart et al. (2010), Fernandes et al.
(2011), Gremião et al. (2011, Borges et al. (2013), dos Santos et al. (2013,
Rodrigues et al. (2013, Pereira et al. (2014), Teixeira et al. (2014)
S. brasiliensis Rodrigues et al. (2013, Montenegro et al. (2014), Pereira et al.
(2014), Teixeira et al. (2014), Kano et al. (2015), Brilhante et al. (2016)
Zoonotic aspects
Kovarik et al. (2008), Reis et al. (2009), Cordeiro et al. (20,11), Rees
and Swartzberg (2011), Borges et al. (2013)
Clinical
Cutaneous, Schubach et al. (2008), Crothers et al. (2009), Gremião et al.
(2011, Chaves et al. (2013), dos Santos et al. (2013, Gremião et al. (2015)
cutaneous-lymphatic Crothers et al. (2009), Madrid et al. (2010)
Nasal, Gremião et al. (2015)
Claws, Borges et al. (2013)
disseminated sporotrichosis. Crothers et al. (2009), Pohlman et al. (2014)
chronic parapreputial wound. Weingart et al. (2010)
Supp granuloma, Miranda et al. (2013
Diagnosis
Cytological and mycological , dos Santos et al. (2013, Gremião et al. (2015),
Jessica et al. (2015), de Souza et al. (2016), Miranda et al. (2016)
ELISA Fernandes et al. (2011)
Molecular , Rodrigues et al. (2013, Montenegro et al. (2014), Teixeira et al.
(2014), Kano et al. (2015), Kano et al. (2015)
Treatment
intralesional amphotericin, Gremião et al. (2011
itraconazole, Hirano et al. (2006), Madrid et al. (2010), Pereira et al. (2010) ,
Weingart et al. (2010), Cordeiro et al. (2011), Gremião et al. (2011, Brilhante
et al. (2016) , de Souza et al. (2016)
454
ketoconazole, Crothers et al. (2009), Pereira et al. (2010), Brilhante et al.
(2016)
fluconazole (one cat), Crothers et al. (2009), Brilhante et al. (2016)
5.4. Reports on sporotrichosis in dogs:
Goad and Goad (1986) diagnosed a case of osteoarticular sporotrichosis in a dog
referred for evaluation of hind limb lameness. There was radiographic evidence of
osteopenia of the fourth tarsal and proximal aspects of the metatarsal bones. The
diagnosis was based on histologic findings and results of physical examination,
radiography, fungal culturing, and serologic tests. The dog was treated successfully
with Goad and Goad (1986) diagnosed a case of osteoarticular sporotrichosis for
3 1/2 month
Shany (2000) diagnosed an unusual ulcerated masses protruding from both nostrils
of a 3-year-old terrier histologically as sporotrichosis, and regressed with iodide
therapy. Cryptococcus neoformans was recovered from new lesions that appeared
near the dog's eye and on the extremities. All lesions regressed with itraconazole
therapy.
Sykes et al. (2001) diagnosed sporotrichosis in a 2-year-old male Golden Retriever
that was allowed to roam free on the owner's Christmas tree farm in Minnesota.
Clinical signs had been evident for 1 month and included swelling of the claw bed of
the third digit on the left forelimb and a fluctuant nodular lesion in the area of the left
carpus. Few organisms were seen in affected tissues, and diagnosis was confirmed on
the basis of results of fungal culture. The condition responded to treatment with
itraconazole.
Schubach et al. (2006) described a sporotichosis epidemic involving fortyfour dogs in the Metropolitan area of Rio de Janeiro. Solitary skin lesions were noted
in 18 dogs(40.9%), 2-4 such lesions were observed in 17 animals (38.6%), and nine
(20.5%) animals had five or more lesions. Twenty-five (56.8%) animals had single
ulcerated skin lesions on the nose and nine (20.5%) showed nasal mucosal
involvement (three of which also has a skin lesion). Respiratory symptoms were
observed in 17 (38.6%) dogs and were found to be the most common extracutaneous
signs of infection. Anemia, leukocytosis with neutrophilia, hypoalbuminemia and
hyperglobulinemia were the most frequent hematological abnormalities.
Histopathological analysis of skin biopsies in most cases revealed granulomatous
reactions characterized by histiocytic hyperplasia and neutrophil infiltration. Yeastlike cells were observed in seven (16.7%) of 42 dogs examined histologically. During
the study, eight (18.2%) animals were lost to follow-up and three (6.8%) were
submitted to euthanasia. Of the remaining 33 dogs, five (15.2%) presented
spontaneous regression of the lesions, 26 (78.8%) were cured after treatment, and two
(6%) continue to be treated. The present cases indicate that
many dogs with sporotrichosis respond well to treatment and in a few dogs, the
disease may be self-limiting.
455
Photograph of a dog with multiple skin lesions on the hind limbs, on the flank and on the head,
Schubach et al. (2006)
Photograph of a dog with skin ulcers on the nose and destruction of the nostrils, Photograph of a dog
with nodular lymphangitis on the hind limbs. Schubach et al. (2006)
Bernstein et al. (2007) reported a 1-year-old male Foxhound/Walker Hound mix with
a 6-week history of progressive, multifocal, ulcerative and draining, wellcircumscribed lesions in a generalized distribution. Prior to referral, a presumptive
diagnosis was made of sterile pyogranulomatous disease; immunosuppressive therapy
was instituted but resulted in clinical deterioration. At presentation, the dog had
marked neutropenia (1100 neutrophils/microL), and a mild toxic left shift (400
bands/microL). Cytologic findings in the exudates from a draining skin lesion
included high numbers of markedly degenerate neutrophils (about 95% of nucleated
cells) as well as low numbers of macrophages, small mature lymphocytes, and
eosinophils. Low numbers of intracellular (within neutrophils and macrophages) and
extracellular, pleomorphic, cigar-to-ovoid shaped organisms ( approximately 3x9
microm) consistent with Sporothrix were observed. Histopathologic examination of a
skin biopsy showed marked, chronic, active, ulcerative, pyogranulomatous dermatitis
and panniculitis, with intralesional yeast consistent with Sporothrix sp. The etiologic
agent was confirmed as Sporothrix schenckii by macerated tissue fungal culture. The
patient was treated with itraconazole, enrofloxacin, and clindamycin, with clinical
resolution occurring over a 3-month period.
456
The patient at initial presentation with multifocal ulcerative lesions on face, flank, and limbs (A) and
with diffuse ulceration of pinnae (B). Bernstein et al. (2007)
Cytologic preparation of draining exudate from a cutaneous lesion, with marked pyogranulomatous
inflammation, Sporothrix organisms, and bacterial cocci. Wright’s., Histopathologic section of a skin
biopsy with pyogranulomatous dermatitis and Sporothrix organisms. (Upper) H&E; (Lower) Gomori
methenamine silver. Bernstein et al. (2007)
Cafarchia et al. (2007) reported a case of lymphocutaneous and
nasal sporotrichosis in a hunting dog with a three month history of non-healing skin
lesions. Cytological examination of nasal discharge and of the material collected from
ulcerated skin surfaces showed a few cigar-shaped organisms within macrophages.
Fungal cultures of nasal and ulcerated skin swabs yielded colonies of S. schenckii.
The dog received oral itraconazole but died of unrelated causes. Necropsic
examination was not performed.
dos Santos et al. (2007) reported 74 dogs from the State of Rio de Janeiro with
ulcerated cutaneous lesions. Sporothrix schenckii was isolated from 41 dogs and
Leishmania
(Viannia)
braziliensis
was
isolated
from
33
animals.
Most dogs with sporotrichosis were from the municipality of Rio de Janeiro (53.7%)
and presented ulcerated cutaneous lesions on the head (68.3%). Laboratory
alterations in these animals included anemia (58.5%), hypoalbuminemia (83%) and
hyperglobulinemia (75.6%). Histopathology revealed the predominance of a chronic
457
granulomatous inflammatory infiltrate (70.7%), and yeast-like structures were
detected in 17% of the histopathological exams and in 32% of the cytological exams.
Three of 41 dogs with sporotrichosis were seropositive by IIF for leishmaniosis and 2
of 20 animals tested within this group had a positive leishmanin skin test. Similarly,
most of the 33 dogs with leishmaniosis were from the municipality of Rio de Janeiro
(69.7%) and had ulcerated cutaneous lesions on the head (84.8%). Laboratory
alterations in these animals included anemia (66.7%), hypoalbuminemia (100%) and
hyperglobulinemia (91%). Histopathology showed the predominance of a chronic
granulomatous inflammatory infiltrate (63.6%) and amastigote forms were detected in
30.3% of the histopathological exams and in 31.8% of the 22 cytological exams
performed. About 72.7% of the dogs were seropositive by IIF and five of seven
animals had a positive skin test. Due to the clinical similarities, histopathological and
nonspecific laboratory results similarities, the serological and skin tests for
leishmaniosis positive in dogs with sporotrichosis, and the overlapping endemic areas
in Rio de Janeiro, the differential diagnosis between the two diseases requires the
demonstration of their respective etiological agents.
Whittemore et al. (2007) reported the diagnosis and treatment of intranasal
sporotrichosis in a dog presented for a loss of smell, sneezing, and nasal congestion.
Following 6 months of itraconazole treatment, a computed tomography scan showed a
complete resolution of previously identified abnormalities.
Sequential transverse CT section of the rostral nasal cavity of a dog with chronic nasal obstruction
upon initial presentation. A large soft tissue density mass (asterisk*) can be seen filling the dorsal
meatus bilaterally. Focal osteolysis of the right side of the nasal bone is indicated by the white arrow.
Endotracheal tube diameter = 10 mm, Sequential transverse CT section of the rostral nasal cavity of a
dog with chronic nasal obstruction upon initial presentation. A large soft tissue density mass (asterisk*)
can be seen filling the dorsal meatus bilaterally. Focal osteolysis of the right side of the nasal bone is
indicated by the white arrow. Endotracheal tube diameter = 10 mm, Whittemore et al. (2007)
458
Repeat sequential transverse CT sections of the rostral nasal cavity of a dog with chronic nasal
obstruction after 8 mo of itraconazole therapy (9 mo after initial presentation). The previously
identified turbinate thickening and osteolysis of the right side of the nasal bone have completely
resolved. Endotracheal tube diameter = 10 mm, Whittemore et al. (2007)
Schubach et al. (2008) diagnosed sporotrichosis in64 dogs, in the period 1998 to
2004 in the Evandro Chagas Clinical Research Institute. Of them, 85% were reported
to have had contact with cats with sporotrichosis. Canine sporotrichosis presented as a
self-limited mycosis.
de Miranda et al. (2009) reported the histopathological findings of 86 skin lesions
of dogs with sporotrichosis from Rio de Janeiro. Suppurative granulomatous
inflammation was the predominant finding and was observed in 76 (88.37%) cases.
Plasma cells surrounding the suppurative granulomas were detected in 68 (89.5%)
cases and an inflammatory infiltrate at the periphery of these granulomatous lesions
was observed in 63 (82.9%). Fungus-specific staining revealed yeast cells compatible
with Sporothrix schenckii in 36 cases. These fungal elements were only detected in
lesions characterized by suppurative granulomatous inflammation. Thus, specific
staining of serial sections is recommended in the case of dogs with skin lesions whose
histopathological presentation is consistent with sporotrichosis. However, due to the
generally small number of yeast cells in lesions, the hypothesis
of sporotrichosis should not be ruled out even if the result is negative, especially in
epidemic areas where correlation with epidemiological data is particularly useful.
Well organized granulomas. HE stain. 20× , Granuloma presenting neutrophils inside (arrows) and an
outer zone of plasma cells (arrow heads). HE stain. 20× de Miranda et al. (2009)
459
Poorly delimited granuloma with predominance of macrophages. HE stain. 20×, Perifollicular
plasmacellular infiltrate. HE stain. 20× de Miranda et al. (2009)
Round (Arrows) and cigar-shaped yeast cells (Arrows heads) presenting single buds with a narrow base
(Dashed arrows). Grocott. 100× de Miranda et al. (2009)
Crothers et al. (2009) examined cases of sporotrichosis in 4 dogs between 1987 and
2007 at the University of California, Davis - Veterinary Medical Teaching Hospital,
retrospectively evaluated with regard to the historical, clinical, diagnostic and
treatment findings. One dog was diagnosed with the localized cutaneous form
of sporotrichosis, 2 with the cutaneous-lymphatic form, and one with the
disseminated. One dog did not have skin lesions at the time of diagnosis. The most
common mode of diagnosis was demonstration of S. schenckii on histopathological
evaluation of tissue. Treatments received included itraconazole (one dog),
ketoconazole (three dogs). The prognosis for successful treatment was good in all
cases.
461
Fore leg of dog with sporotrichosis, case 17. Multifocal areas of ulceration and exudation are visible on
the skin over the dorso-lateral surface of the right carpus. Picture courtesy of Drs Denerolle, White,
Taylor and Vandenabeele
Miranda et al. (2010) compares pyogranulomatous lesions from
80 dogs with sporotrichosis and 26 dogs with American tegumentary leishmaniasis
(ATL) microscopically in order to identify features that would support the diagnostic
suspicion and direct the subsequent search for the aetiological agent of either
infection. Odds ratios and their respective 95% confidence intervals were calculated
in order to evaluate the impact of the microscopical findings on the diagnosis of either
disease. Lesions with well-formed granulomata were 14 times more likely to be due
to sporotrichosis than ATL. Marked neutrophil infiltration into granulomata was
12.26 times more likely to be associated with sporotrichosis when compared with
lesions having mild neutrophilic infiltration. Absence of lymphocytes and
macrophages in the peripheral infiltrate was associated with a 9.71 and 4.93 higher
chance, respectively, of being sporotrichosis rather than ATL compared with lesions
where these cells were present. Lesions with a perivascular, perifollicular and
interstitial peripheral inflammatory infiltrate were 5.48 times more likely to be due
to sporotrichosis than ATL when compared with lesions with a diffuse peripheral
infiltrate. Histopathological analysis may therefore contribute to the diagnosis
of sporotrichosis or ATL skin lesions in dogs since this method permits the
identification of features that direct the diagnostic suspicion, thus facilitating the
search for the aetiological agent in histological sections, permitting the precise request
of subsequent tests and thereby reducing costs and time taken to achieve a definitive
diagnosis and the initiation of appropriate therapy.
461
Miranda et al. (2010)
Madrid et al. (2011) studied the presence of melanin and cell wall thickness of
clinical isolates of Sporothrix schenckii obtained from cats, dogs and humans as
compared to reference strains using transmission electron microscopy. They detected
differences regarding presence of the melanin among the clinical isolates of S.
schenckii and a correlation between presence of melanin and cell wall thickness.
TEM images of S. schenckii cells with (a) and without (b) melanin granules. Scale bar: 1μm
Madrid
et al. (2011)
Miranda et al. (2011) performed a study with the aim to apply
immunohistochemistry (IHC) for the diagnosis of canine sporotrichosis and to
compare this method with the Grocott's silver stain (GSS) and periodic acid Schiff
462
(PAS) techniques. Eighty-seven dogs with sporotrichosis (group 1) and 35 with
American tegumentary leishmaniosis (ATL) (group 2) were studied. The fungus was
detected in group 1 by GSS, PAS and IHC. IHC was also applied to group 2 to
evaluate the occurrence of cross-reactions. PAS, GSS and IHC detected yeast cells in
19.5%, 43.7% and 65.5% of the group 1 cases, respectively. The detection of
intracellular antigens of Sporothrix schenckii by IHC increased the sensitivity of the
histological diagnosis to 80.5%. No positive reaction was observed in ATL lesions.
The results suggest that IHC may be indicated for the diagnosis
of sporotrichosis because of its higher diagnostic sensitivity.
Miranda et al. (2011)
Madrid et al. (2012) described the epidemiological and laboratory characteristics of
103 clinical cases of sporotrichosis diagnosed over a 10-year period in southern
Brazil. The 92 cats and 11 dogs from eight municipalities in Rio Grande do Sul State
developed especially the disseminated cutaneous and fixed cutaneous forms of the
disease. Respiratory signs such as sneezing, serous nasal discharge and dyspnea were
found in about 57% of the animals. The detection of Sporothrix schenckii in different
clinical samples showed highest isolation in testicles (46.6%), oral cavity (45.2%) and
conjunctival mucosa (38.1%). A differentiated histological pattern was found between
the fixed cutaneous and disseminated cutaneous (DC) manifestations of the disease;
well-organized granulomas of nodular distribution and various fungal structures
prevailed in the DC form in cats. Melanin detection in S. schenckii cells by the
Fontana-Masson technique was positive in 45.4% of the samples. The study revealed
that the State of Rio Grande do Sul is an endemic sporotrichosis area and
demonstrated the possibility of involvement of other pathways in the infection and
spread of the disease. In addition, it emphasized the importance of laboratory tests for
mycosis confirmation, especially in dogs that develop clinical manifestations without
the presence of cutaneous lesions.
463
Sporothrix schenckii positively reactive yeasts for the presence of melanin by Fontana–Masson stain
(400×) Madrid et al. (2012)
Guterres et al. (2014) reported, for the first time, the use of (1-3) β-glucan along with
itraconazole in the treatment of a canine with sporotrichosis caused by Sporothrix
brasiliensis. The animal had ulcerated and crusted lesions, especially on the nasal
planum. Clinical samples were collected for a complete blood count, cytological
analysis of the lesion, and fungal culture. Based on the results of the laboratory
examination, and after the fungal culture, antibiotic therapy and treatment with
itraconazole were initiated. Two additional fungal cultures were performed, which
were positive. After 7 months of the animal treatment with itraconazole, the S.
brasiliensis culture was still positive, so that the itraconazole was associated with (13) β-glucan. After four weekly applications of glucan, the complete elimination of the
fungus was observed based on the fungal culture negative results. The results show,
therefore, that (1-3) β-glucan with itraconazole promoted the case resolution, and it
may be considered a promising alternative for the treatment of sporotrichosis in cases
of resistance to conventional therapy.
Patient upon arrival for clinical examination, showing destruction of the nasal planum with secondary
contamination, Patient after the treatment with itraconazole along with (1–3) β-glucan,
Guterres et al. (2014)
Jessica et al.(2015) The present study included 244 cats from the metropolitan region
of Rio de Janeiro, mostly males in reproductive age with three or more lesions in nonadjacent anatomical places. To evaluate the inter-observer reliability, two different
observers performed the microscopic examination of the slides blindly. Test
sensitivity was 84.9%. The values of positive predictive value, negative predictive
value, positive likelihood ratio, negative likelihood ratio and accuracy were 86.0,
24.4, 2.02, 0.26 and 82.8%, respectively. The reliability between the two observers
was considered substantial. They concluded that the cytopathological examination is a
sensitive, rapid and practical method to be used in feline sporotrichosis diagnosis in
outbreaks of this mycosis.
464
5.5. Reports of sporotrichosis in cats
Hirano et al. (2006) excised surgically a feline granulomatous lesion and performed
histopathological, mycological and molecular examinations. As a result, it was
diagnosed as sporotrichosis, which was the second recorded case of a cat so afflicted
in Japan. After the operation, they recognized another nodule on the lymph node.
Histopathological examination was therefore performed, but no fungi were detected.
To prevent recurrence, the cat was administered an antimycotic drug, itraconazole. As
a result, no recurrence was found.
Kovarik et al. (2008) conducted a study
to identify various aspects of
sporotrichosis in the endemic area of Abancay, Peru, namely (i) the overall prevalence
of sporotrichosis in the cat population, (ii) the most common site where the fungus
can be isolated from these cats, and (iii) whether cats without identifiable skin lesions
may be carriers of the fungus in the oral mucosa, nasal mucosa, or nails. One
household cat in each of 85 neighborhoods within the endemic area of Abancay, Peru
was randomly selected. Oral and nasal swabs, as well as nail clippings were taken
from 84 of the cats. In addition, samples from skin lesions that were suspected to be
due to sporotrichosis were collected from cats or members of families that owned the
pets. Cultures inoculated with two nasal swabs and one set of nail clippings from two
different cats yielded Sporothrix schenckii, the identity of which were confirmed by
rDNA sequencing. The overall prevalence of Sporothrix schenckii colonization was
2.38% (95% CI 0.41-9.14) in this cat population. None of the skin lesion samples
from the cats and only one such sample from a family member were positive for
Sporothrix schenckii in culture. These results suggest a role for domestic cats as a
possible reservoir for sporotrichosis infection in Abancay.
Schubach et al. (2008) diagnosed sporotrichosis in 1503 cats in the period 1998 to
2004, in the Evandro Chagas Clinical Research Institute. Feline sporotrichosis varied
from subclinical infection to severe systemic disease with haematogenous
dissemination of Sporothrix schenckii. The zoonotic potential of cats was
demonstrated by the isolation of S. schenckii from skin lesion fragments, and from
material collected from their nasal and oral cavities.
Crothers et al. (2009) examined 14 cases of sporotrichosis in cats between 1987 and
2007 at the University of California, Davis - Veterinary Medical Teaching Hospital,
retrospectively evaluated with regard to the historical, clinical, diagnostic and
treatment findings. Four cases were diagnosed with the localized cutaneous form
of sporotrichosis, 4 cases with the cutaneous-lymphatic form, and 6 with the
disseminated form. One cat did not have skin lesions at the time of diagnosis. The
most common mode of diagnosis was demonstration of S. schenckii on
histopathological evaluation of tissue. In contrast with most previously
described sporotrichosis infections in cats, few to no fungal organisms were seen in
histopathological samples (haematoxylin and eosin and special stains) in five of the
14 cats. Treatments received included itraconazole (12 cats), ketoconazole,
fluconazole (one cat), sodium iodide (one cat) and potassium iodide (one cat). The
prognosis for successful treatment was good in all cases. Fluconazole was successful
465
in inducing resolution of the cutaneous lesions and controlling the infection in one cat
with disseminated sporotrichosis.
Skin sections of cat (Case 14) with Sporothrix schenckii. Multifocal to coalescing nodular
inflammation predominantly within the deep dermis with haematoxylin and eosin stain (H&E), bar 600
(a). Pyogranulomatous inflammation present with variable numbers of neutrophils, histiocytes,
lymphocytes, multinucleated giant cells, with fewer numbers of mast cells, eosinophils and plasma
cells with H&E,
S. schenckii
organisms with an outer rim, a clear halo and an inner dense core seen in a horse (case 22) with H&E,
Face of cat with sporotrichosis, case 14. Focal ulcerative lesion with a central crust is present on the
dorsal muzzle. Day 0 (a). The lesions have a reduced to mild adherent crust with scar tissue on the
dorsal muzzle. Day 60 (b).
Reis et al. (2009) conducted a study to demonstrate the zoonotic character of an
epidemic of sporotrichosis in Rio de Janeiro, Brazil, in which cases of human
infection were related to exposure to cats, using molecular methodology to
characterize 19 human and 25 animal S. schenckii isolates from the epidemic, as well
as two control strains. To analyse the isolates, the random amplified polymorphic
DNA (RAPD) technique was performed using three different primers, together with
DNA fingerprinting using the minisatellite derived from the wild-type phage M13
core-sequence. The analyses generated amplicons with considerable polymorphism.
Although isolates exhibited high levels of genetic relatedness, they could be clustered
into 5-10 genotypes. The RAPD profiles of epidemic S. schenckii isolates could be
distinguished from that of the United States isolate, displaying 20% similarity to each
primer and 60% when amplified with the M13 primer. DNA fingerprinting of S.
schenckii isolated from the nails (42.8%) and the oral cavities (66%) of cats were
identical to related human samples, suggesting that there is a common infection
source for animals and humans in this epidemic. It is clear that cats acted as a vehicle
for dissemination of S. schenckii.
Madrid et al. (2010) studied clinical cases of feline sporotrichosis, originating in the
Pelotas region and diagnosed at the Laboratory of Infectious Diseases (UFPel), in the
period from 2002 to 2006. The animals were evaluated according to the clinical forms
466
of the mycosis, time of lesion appearance, severity of the clinical diagnosis and
evolution of cutaneous lesions throughout the treatment period. Mycological analyses,
carried out through direct examination, cultivation of tissue samples and exudates of
feline lesions all confirmed the diagnosis of sporotrichosis in the 15 animals under
study. The cutaneous dissemination form was observed in 10 animals, of which
three showed prostration, anorexia and dehydration. The zoonosis occurred in 20% of
case studies, and the pet owners and one attendant at a veterinary clinic were infected,
developing the fixed and disseminated cutaneous forms. The treatment of mycosis
was carried out with itraconazole, 10 mg kg(-1), once a day, on 12 animals. The cure
of the clinical symptoms was observed on 50% of the felines. This study demonstrates
a good clinical response of felines with sporotrichosis, when they were treated
itraconazole and calls the attention for the incidence of human sporotrichosis on
people related to the veterinary activity as well as for pet owners.
Ulcers regression in the first twenty days of treatment with itraconazole. Madrid et al. (2010)
Evolution of the cutaneous lesions in three months of the antifungal therapy. Madrid et al. (2010)
Pereira et al. (2010) compared the effectiveness and safety of treatment with
ketoconazole and itraconazole in 773 sporotrichosis-infected cats over a four-year
period (2002 to 2005). Five hundred and ninety-eight cats received oral ketoconazole
and 175 received oral itraconazole. Treatment was successful in 238 (30.8 per
cent) cats, of which 171 (28.6 per cent) of 598 received 13.5 to 27.0 mg/kg/day
ketoconazole and 67 (38.3 per cent) of 175 received 8.3 to 27.7 mg/kg/day
itraconazole. Adverse effects were reported in 306 (39.6 per cent) of the cats, 105
(13.6 per cent) died and 430 (55.6 per cent) dropped out of treatment or were still
under treatment at the time of data analysis.
Weingart et al. (2010) reported a four-year-old male castrated Domestic Shorthair
Cat imported from North America with a chronic parapreputial wound. Cytological
467
and mycological examination revealed a sporotrichosis caused by Sporothrix
schenckii Clinical signs, diagnostics, as well as therapy and course of the disease
were described. Treatment with itraconazole was successful.
Cordeiro et al. (2011) presented simultaneous occurrence of sporotrichosis in three
members of the same family by scratches from an infected domestic cat. Two patients
developed the lymphocutaneous form and one only developed the fixed cutaneous
form. Two patients were successfully treated with saturated solution of potassium
iodide; however, the third case reported side effects and had his therapy substituted
for itraconazole, with resolution of his lesions.
Papules and pustules above the lip and the molar area, presence of round yeasts with a pale centre
and reinforced colouration on the periphery showing budding surrounded by lymphohystiocitic
infiltrate Cordeiro et al. (2011)
Mother of the index case with erythematous plaque on the right forearm, Father of the index case
with nodular ulcerated lesions along the lymphatic channels of the forearm, Cordeiro et al. (2011)
Fernandes et al. (2011) performed a study to standardize an ELISA for the diagnosis
of feline sporotrichosis. They proposed an ELISA test for the diagnosis of
cat sporotrichosis , which detected S. schenckii-specific antibodies in feline sera. Two
different kinds of antigens were used: "SsCBF", a specific molecule from S. schenckii
that consists of a Con A-binding fraction derived from a peptido-rhamnomannan
component of the cell wall, and a S. schenckii crude exoantigen preparation. The
ELISA was developed, optimized, and evaluated using sera from 30 cats with
proven sporotrichosis (by culture isolation); 22 sera from healthy feral cats from a
zoonosis center were used as negative controls. SsCBF showed 90% sensitivity and
96% specificity in ELISA; while crude exoantigens demonstrated 96% sensitivity and
98% specificity. The ELISA assay described here would be a valuable screening tool
for the detection of specific S. schenckii antibodies in cats with sporotrichosis. The
468
assay is inexpensive, quick to perform, easy to interpret, and permits the diagnosis of
feline sporotrichosis.
Gremião et al. (2011) performed a study to describe the use of intralesional
amphotericin B in localised lesions for the treatment of 26 cats from Rio de Janeiro,
Brazil, with sporotrichosis refractory to oral itraconazole. The 26 cats in this study
were diagnosed with sporotrichosis, confirmed by isolation of Sporothrix schenckii,
and presented residual localised skin lesions refractory to treatment with oral
itraconazole for a minimum period of 8 weeks. The animals received weekly
applications of intralesional amphotericin B in conjunction with oral itraconazole. In
cases of owner unavailability, a maximum of 2 weeks between the infiltrations was
accepted. Twenty-two (84.6%) of the 26 treated cats achieved clinical remission, 16
(72.7%) of which were cured, and in the remaining six (27.3%) the lesions recurred at
the same site. Lack of clinical response was observed in one animal and three owners
abandoned treatment.
Administration of intralesional amphotericin B in an ulcer on the left tarsal region. Scar tissue on the
left tarsal region after intralesional amphotericin B therapy and oral itraconazole. Gremião et al. (2011)
Ulcer on the bridge of the nose after six months of itraconazole therapy. Scar tissue on bridge of the
nose at 2 months after clinical cure using intralesional amphotericin B therapy and oral itraconazole.
Gremião et al. (2011)
Rees and Swartzberg (2011) reported a case of cat-associated sporotrichosis in an
adult
female
in
California.
A
retrospectively
diagnosed
cutaneous sporotrichosis infection in the patient's cat and the unusual site of the
primary lesion in the patient contributed to delayed diagnosis and treatment.
Borges et al. (2013) conducted a study was to determine the occurrence
of sporotrichosis in domestic cats and in wild or exotic felines in captivity through the
isolation of Sporothrix spp. from claw impressions in a culture medium. The samples
469
included 132 felines, of which 120 (91.0 %) were domestic cats, 11 (8.3 %) were wild
felines, and one (0.7 %) was an exotic felid. Twenty-one (17.5 %) were outdoor cats.
Of the total, 89 (67.4 %) had contact with other animals of the same species. It was
possible to isolate Sporothrix schenckii from the claws of one (0.7 %) of the felids
probed; this animal exhibited generalised sporotrichosis and had infected a female
veterinarian.
Siamese cat, female, 4 years old, positive to sporotrichosis with a large ulcer, haemorragic crusts and
alopecia in the head—Female veterinarian positive to sporotrichosis with an ulcerated nodular lesion
presenting purulent secretion on her right forearm—Dermatology Service (FMVZ-USP). GRAPHIC
PROGRAM: ADOBE PHOTOSHOP CS6), Borges et al. (2013)
Chaves et al. (2013) described the epidemiological, clinical and mycological aspects
of feline sporotrichosis cases attending the Laboratory of Clinical Research on
Dermatozoonosis in Domestic Animals - Evandro Chagas Clinical Research Institute
(LAPCLIN-DERMZOO/IPEC/FIOCRUZ), from 1998 to 2005. It was possible to get
in contact with 147 (19.2%) cat owners. One hundred and thirteen (76.9%) cats were
male, 117 (79.6%) had no defined race and 87 (59.2%) were sexually intact. The age
ranged from 72 to 216 months (median = 108 months). Nineteen cats were reassessed:
eleven (57.8%) were male, thirteen (36.8%) were breed and fifteen (47.3%) castrated.
Fourteen (52.6%) animals lived at home and did not roamed the streets. Seven
(36.8%) had normal clinical findings and negative mycological examination. Twelve
(63.1%) cats had skin lesions compatible with sporotrichosis. Thirty-one (21%, n =
147) cats disappeared after abandoning treatment, 36 (24.5%, n = 147) were alive and
80 (54.4%, n = 147) had died. Causes of death informed by the owners
were: sporotrichosis in 35 (43.7%, n = 80), accidental death in 27 (33.7%, n = 80) and
other diseases in 18 (22.5%, n = 80). Withdrawal of treatment occurred mainly at the
time of clinical improvement and may represent a serious obstacle to the control
of sporotrichosis.
dos Santos et al. (2013) reported a 7-year-old Siamese cat with three ulcerated
cutaneous nodules in the lumbosacral region in Rio de Janeiro, Brazil.
Histopathological analysis showed that the lesions consisted of polyhedral and
spindle-shaped voluminous mononuclear cells with loose chromatin and clearly
visible nucleoli, few giant cells, and foci of coagulative and caseous necrosis -findings suggestive of a vaccine-induced sarcoma. No significant mitotic rate,
cytological atypias or asteroid bodies were observed. Special histopathological
staining with periodic acid-Schiff and Grocott's silver stain demonstrated the presence
471
of small yeast cells characterized by simple and narrow-base budding compatible with
Sporothrix schenckii. Mycological culture grew S schenckii. Cytopathology was
negative for yeast cells. These atypical clinical and histopathological signs support the
importance of histopathological analysis with special staining techniques, in addition
to mycological culture in the diagnosis of feline sporotrichosis.
Miranda et al. (2013) described the histopathology and fungal load of the lesions in
different clinical presentations of feline sporotrichosis. Cats with sporotrichosis were
separated into groups L1, L2 and L3 (lesions in one, two and three or more locations,
respectively) and subjected to skin biopsies for histopathology. Eighty-six cats were
included in the study. Lesions were suppurative granulomatous in 84 cases and poorly
formed granulomas were predominant. The well-formed granulomas were associated
with group L1. The high fungal load was predominant in group L3 and in poorly
formed granuloma cases and did not occur in well-formed granulomas cases. The
good general condition was associated with low fungal load. These findings suggested
that the fungal load control in animals with more localized lesions and well-organized
response was linked with the improvement in the outcome of infected cats.
Rodrigues et al. (2013) conducted a survey among symptomatic cats in order to
understand the eco-epidemiology of feline sporotrichosis and its role in
human sporotrichosis. Prevalence and phylogenetic relationships among feline
Sporothrix species were investigated by reconstructing their phylogenetic origin using
the calmodulin (CAL) and the translation elongation factor-1 alpha (EF1α) loci in
strains originated from Rio de Janeiro (RJ, n = 15), Rio Grande do Sul (RS, n = 10),
Paraná (PR, n = 4), São Paulo (SP, n =3) and Minas Gerais (MG, n = 1). The results
showed that S. brasiliensis is highly prevalent among cats (96.9%)
with sporotrichosis, while S. schenckii was identified only once. The genotype of
Sporothrix from cats was found identical to S. brasiliensis from human sources
confirming that the disease is transmitted by cats. Sporothrix brasiliensis presented
low genetic diversity compared to its sister taxon S. schenckii. No evidence of
recombination in S. brasiliensis was found by split decomposition or PHI-test
analysis, suggesting that S. brasiliensis is a clonal species. Strains recovered in states
SP, MG and PR share the genotype of the RJ outbreak, different from the RS clone.
The occurrence of separate genotypes among strains indicated that the Brazilian S.
brasiliensis epidemic has at least two distinct sources. We suggest that cats represent a
major host and the main source of cat and human S. brasiliensis infections in Brazil.
471
Clinical aspects of feline sporotrichosis in Brazil. Cats presenting ulcerated cutaneous lesions in the
cephalic region. (A) and (B) felines from Rio de Janeiro; (C) and (D) felines from Paraná, Rodrigues
et al. (2013)
Montenegro et al. (2014) described the recent emergence of feline sporotrichosis in
the metropolitan region of São Paulo, Brazil, with an overwhelming occurrence of S.
brasiliensis as the etiological agent. A phylogenetic and a haplotype approach were
used to investigate the origin of this epidemic and the impact of feline transmission on
genetic diversity. During the last 3-year period, 163 cases of
feline sporotrichosis were reported in São Paulo with proven S. brasiliensis culture.
The haplotype diversity of feline S. brasiliensis isolates revealed the expansion of a
clonal population with low genetic diversity. Haplotype analysis confirmed that
isolates from São Paulo shared the haplotype originated in the long-lasting outbreak
of cat-transmitted sporotrichosis in Rio de Janeiro, which differed from the haplotype
circulating in the Rio Grande do Sul epidemic. The fast spread of sporotrichosis in a
short period of time highlights the potential for outbreaks and suggests that the
mycosis may affect an urban population with a high concentration of susceptible
felines. The feline sporotrichosis epidemic shows no signs of slowing, and this
epidemiological pattern may require specific public health strategies to control future
outbreaks.
472
Clinical aspects of feline sporotrichosis. (A) Wet, ulcerated skin lesions, often particularly
concentrated in the cephalic region. (B) Weight loss during the evolution of the disease.
Montenegro et al. (2014)
Genotyping of feline sporotrichosis isolates by PCR-RFLP. Representative profiles of 16 samples
are shown. Positive controls: Sporothrix brasiliensis (CBS 120339), S. schenckii (CBS 359.36), S.
globosa (CBS 120340). The amplicons were sized by comparison with bands of known size in the 100bp DNA Step Ladder (Promega). Montenegro et al. (2014)
Pereira et al. (2014) reviewed the medical records of 2,301 feline
sporotrichosis cases. The numbers reported in this study represent only those
feline cases diagnosed at IPEC/FIOCRUZ, a reference center for the diagnosis and
treatment of fungal diseases, thus accounting for the probable majority of cases.
However, other public and private institutions located in the same region also
perform sporotrichosis diagnosis but were not included in this study. All feline
isolates were morphologically identified as S. schenckii at the time of diagnosis.
For 15 of the isolates, it was possible to characterize the species by
reconstructing their phylogenetic origin using the calmodulin locus, which resulted
in Sporothrix brasiliensis in all cases. Currently, determining the scale of feline
473
epizootic sporotrichosis is very difficult because reporting of this disease is not
required. It is believed that sporotrichosis control can be achieved through basic
educational measures that emphasize the responsible ownership of animals,
programs to limit feline reproduction and effective action on the part of
governmental institutions responsible for public health. Furthermore, updating the
number of feline cases diagnosed at Lapclin-Dermzoo/IPEC/FIOCRUZ alerts health
professionals, researchers and sanitary authorities to the difficulties related to
sporotrichosis control.
Pohlman et al. (2014) reported case of disseminated pyogranulomatous
inflammation with intralesional Sporothrix organisms in a 4.5-year-old spayed
female domestic shorthair cat with numerous crusted, ulcerated and fistulated lesions
on the dorsum. Ventrum. Head, tail and limbs.
Pohlman et al. (2014)
Teixeira et al. (2014) conducted a comparative genomic study to explore the
presence of virulence factors in S. schenckii and S. brasiliensis; to compare S.
brasiliensis, which is cat-transmitted and infects both humans and cats with S.
schenckii, mainly a human pathogen and to compare these two species to other human
pathogens (Onygenales) with similar thermo-dimorphic behavior and to other plantassociated Sordariomycetes. The genomes of S. schenckii and S. brasiliensis were
pyrosequenced to 17x and 20x coverage comprising a total of 32.3 Mb and 33.2 Mb,
respectively. Pair-wise genome alignments revealed that the two species are highly
syntenic showing 97.5% average sequence identity. Phylogenomic analysis revealed
that both species diverged about 3.8-4.9 MYA suggesting a recent event of speciation.
Transposable elements comprise respectively 0.34% and 0.62% of the S. schenckii
474
and S. brasiliensis genomes and expansions of Gypsy-like elements was observed
reflecting the accumulation of repetitive elements in the S. brasiliensis genome.
Mitochondrial genomic comparisons showed the presence of group-I intron encoding
homing endonucleases (HE's) exclusively in S. brasiliensis. Analysis of protein family
expansions and contractions in the Sporothrix lineage revealed expansion of LysM
domain-containing proteins, small GTPases, PKS type1 and leucin-rich proteins. In
contrast, a lack of polysaccharide lyase genes that are associated with decay of plants
was observed when compared to other Sordariomycetes and dimorphic fungal
pathogens, suggesting evolutionary adaptations from a plant pathogenic or saprobic to
an animal pathogenic life style. Comparative genomic data suggested a unique
ecological shift in the Sporothrix lineage from plant-association to mammalian
parasitism, which contributes to the understanding of how environmental interactions
may shape fungal virulence. Moreover, the striking differences found in comparison
with other dimorphic fungi revealed that dimorphism in these close relatives of plantassociated Sordariomycetes is a case of convergent evolution, stressing the
importance of this morphogenetic change in fungal pathogenesis.
Gremião et al. (2015) mentioned that feline sporotrichosis, which is caused by
species of the Sporothrix schenckii complex, is endemic to Rio de Janeiro, Brazil.
More than 4000 cases of the disease were diagnosed at Fundação Oswaldo Cruz,
Brazil, between 1998 and 2012. Sporotrichosis in cats has been reported in several
countries, but nowhere has an outbreak of animal sporotrichosis been as large as that
seen in Brazil. The clinical manifestations of the disease range from an isolated skin
lesion that can progress to multiple skin lesions and even fatal systemic involvement.
Nodules and ulcers are the most common types of lesions, and respiratory signs and
mucosa involvement are frequent. The definitive diagnosis depends on isolation of the
etiologic agent in culture. Cytology, histopathology, and serology are useful tools for
preliminary diagnosis. Severe pyogranulomatous inflammatory infiltrate, high fungal
load, and extension of lesions to mucosa, cartilage, and bone in the nose of cats are
indicative of an agent of high virulence in this endemic region. Itraconazole is the
drug of choice, while, in refractory cases, amphotericin B or potassium iodide might
be alternative treatments; however, recurrence after discharge may
occur. Sporotrichosis persists as a neglected disease in Rio de Janeiro, and the
treatment of cats remains a challenging and long-term endeavor.
Feline sporotrichosis: lesions located on the face. Feline sporotrichosis: ulcer on the bridge of the nose.
Gremião et al. (2015)
475
Histological alterations in the nose of cats with sporotrichosis. Cats receiving no treatment. (A) Severe
pyogranulomatous rhinitis showing lyses of osseous tissue and several yeast-like forms within
macrophages; periodic acid Schiff (PAS), bar = 0.15 mm. (B) Severe pyogranulomatous osteomyelitis
showing several yeast-like forms of Sporothrix within macrophages in the bone marrow; PAS, bar =
0.15 mm. Gremião et al. (2015)
(C) Mucosa of vestibule showing several yeast-like forms within macrophages or extracellular invasion
and causing necrosis of hyaline cartilage; PAS, bar = 0.04 mm. (D, E) Cats refractory to treatment with
itraconazole. (D) Severe pyogranulomatous rhinitis showing unilateral thickening of the mucosa of the
vestibule and several yeast-like forms; PAS, bar = 0.15 mm. Gremião et al. (2015)
(E) Several cigar-shaped or round to oval yeast-like forms and a hypha (arrow) in the mucosa of the
vestibule; Grocott methenamine silver, bar = 0.01 mm. (F) Cat with no previous history of treatment
for sporotrichosis. Osteomyelitis showing cigar-shaped or round to oval yeast-like forms that were
located extracellularly or within an osteoclast (arrow) and macrophages; PAS, bar = 0.01 mm.
Gremião et al. (2015)
Jessica et al. (2015) conducted a study to evaluate the accuracy and reliability of
cytopathological examination in the diagnosis of feline sporotrichosis. The present
study included 244 cats from the metropolitan region of Rio de Janeiro, mostly males
in reproductive age with three or more lesions in non-adjacent anatomical places. To
evaluate the inter-observer reliability, two different observers performed the
476
microscopic examination of the slides blindly. Test sensitivity was 84.9%. The values
of positive predictive value, negative predictive value, positive likelihood ratio,
negative likelihood ratio and accuracy were 86.0, 24.4, 2.02, 0.26 and 82.8%,
respectively. The reliability between the two observers was considered substantial. \it
was concluded that the cytopathological examination is a sensitive, rapid and practical
method to be used in feline sporotrichosis diagnosis.
Kano et al. (2015) reported molecular epidemiological data on the aetiologic agents
of feline sporotrichosis in Malaysia epidemiology of Sporothrix schenckii isolates
from cats with sporotrichosis in Malaysia. They characterised 18 clinical isolates from
cats in Malaysia based on molecular properties, including sequence analyses of the
calmodulin gene and the rDNA ITS region and selective PCR of mating type (MAT)
loci. In this study, isolates from feline sporotrichosis were identified as a S. schenckii
sensu stricto by sequence analyses of the calmodulin gene and the internal transcribed
spacer (ITS) region. Notably, phylogenetic analysis of the ITS confirmed assignment
to clinical clade D (and not C) of S. schenckii sensu stricto. Therefore, clinical clade
D of S. schenckii sensu stricto appeared to be the prevailing source of feline
sporotrichosis in Malaysia. The ratio of MAT1-1-1:MAT1-2-1 in these Malaysian
isolates was found to be 1 : 0. This result suggested that a clonal strain of S. schenckii
is the prevailing causative agent of feline sporotrichosis in Malaysia.
Sanchotene et al. (2015) conducted an epidemiological surveillance in endemic
areas of feline sporotrichosis in the southern region of Rio Grande do Sul state, Brazil.
Over the last 5-year period the number of feline sporotrichosis in Rio Grande
increased from 0.75 new cases per month in 2010 to 3.33 cases per month in 2014.
The wide geographic distribution of diagnosed cases highlights the dynamics of
Sporothrix transmission across urban areas with high population density. Molecular
identification down to species level by PCR-RFLP of cat-transmitted Sporothrix
revealed the emergence of the clonal offshoot S. brasiliensis during feline outbreaks;
this scenario is similar to the epidemics taking place in the metropolitan areas of Rio
de Janeiro and São Paulo.
Brilhante et al. (2016) evaluated the in vitro activity of amphotericin B, caspofungin,
itraconazole, voriconazole, fluconazole, and ketoconazole against cat isolates of S.
brasiliensis. The susceptibility tests were performed through broth microdilution
(M38-A2). The results showed the relevant activity of itraconazole, amphotericin B,
and ketoconazole against S. brasiliensis, with the following MIC ranges: 0.125-2,
0.125-4 and 0.0312-2 μg/ml, respectively. Caspofungin was moderately effective,
displaying higher variation in MIC values (0.25-64 μg/ml). Voriconazole (2-64
μg/ml) and fluconazole (62.5-500 μg/ml) showed low activity against S. brasiliensis
strains. This study contributed to the characterization of the in vitro antifungal
susceptibility of strains of S. brasiliensis recovered from cats withsporotrichosis,
which have recently been considered the main source of human infections.
de Souza et al. (2016) evaluated the efficacy of cryosurgery in association with
itraconazole for the treatment of feline sporotrichosis and compared the length of
treatment protocol with others reported in the literature. Cats naturally infected with
fungi of the Sporothrix schenckii complex were evaluated. Diagnosis was confirmed
by cytology and fungal culture. Prior to the cryosurgical procedure, every animal was
receiving itraconazole 10 mg/kg/day PO, for different time periods. The same
protocol was maintained until 4 weeks after complete healing of the lesions. Eleven of
13 cats were considered clinically cured. The treatment duration ranged from 14-64
477
weeks (median 32 weeks). The combination of cryosurgery and itraconazole was
effective in treating cases of feline sporotrichosis and decreased the treatment length
compared with protocols using only medication.
Miranda et al. (2016) described the leukocytes profile in blood of cats
with sporotrichosis by flow cytometry and its correlation with histopathology and
fungal load. The cats with sporotrichosis were separated into groups L1, L2, and L3
(lesions at one, two, and three or more noncontiguous skin locations, respectively)
and were classified as good, fair, or poor general conditions. The highest percentage
of CD4+ cells was associated to L1 (P = .04) and to good general condition (P = .03).
The percentage of CD8+ cells was greater in L2 and L3 (P = .01). CD8(low)
expression occurred in 20 animals with sporotrichosis, mainly in L3 (P = .01) and was
not observed in healthy controls. This expression was related to macrophage
granulomas (P = .01) and predominated in cases with high fungal load. Altogether,
the results indicated that control over feline sporotrichosis, with maintenance of a
good general condition, fixed lesions, well-organized response and lower fungal load,
is associated with increased CD4+ cells percentages. In contrast, a poor general
condition, disseminated lesions and high fungal load were related to increased CD8+
cell percentages and increased expression of CD8(low). As conclusion these results
point to an important role of the CD4:CD8 balance in determining the clinical
outcome in feline sporotrichosis.
References
1. Bernstein JA, Cook HE, Gill AF, Ryan KA, Sirninger J. Cytologic diagnosis of
generalized cutaneous sporotrichosis in a hunting hound.Vet Clin Pathol. 2007
Mar;36(1):94-6.
2. Borges TS, Rossi CN, Fedullo JD, Taborda CP, Larsson CE. Isolation of Sporothrix
schenckii from the claws of domestic cats (indoor and outdoor) and in captivity in
São Paulo (Brazil). Mycopathologia. 2013 Aug;176(1-2):129-37.
3. Brilhante RS, Rodrigues AM, Sidrim JJ, Rocha MF, Pereira SA, Gremião
ID, Schubach TM, de Camargo ZP. In vitro susceptibility of antifungal drugs against
Sporothrix brasiliensis recovered from cats with sporotrichosis in Brazil. Med
Mycol. 2016 Mar 1;54(3):275-9
4. Cafarchia C, Sasanelli M, Lia RP, de Caprariis D, Guillot J, Otranto D.
Lymphocutaneous and nasal sporotrichosis in a dog from southern Italy: case report.
Mycopathologia. 2007 Feb;163(2):75-9.
5. Chaves AR, de Campos MP, Barros MB, do Carmo CN, Gremião ID, Pereira
SA, Schubach TM. Treatment abandonment in feline sporotrichosis - study of 147
cases. Zoonoses Public Health. 2013 Mar;60(2):149-53.
6. Cordeiro FN, Bruno CB, Paula CD, Motta Jde O. Familial occurrence of
zoonotic sporotrichosis. An Bras Dermatol. 2011 Jul-Aug;86(4 Suppl 1):S121-4.
7. Crothers SL, White SD, Ihrke PJ, Affolter VK. Sporotrichosis: a retrospective
evaluation of 23 cases seen in northern California (1987-2007). Vet Dermatol. 2009
Aug;20(4):249-59.
8. dos Santos IB, Schubach TM, Leme LR, Okamoto T, Figueiredo FB, Pereira
SA, Quintella LP, de F Madeira M, dos S Coelho F, Reis R, de O Schubach A.
Sporotrichosis: the main differential diagnosis with tegumentary leishmaniosis
in dogs from Rio de Janeiro, Brazil. Vet Parasitol. 2007 Jan 19;143(1):1-6
9. dos Santos IB, Quintella LP, de Miranda LH, de Sousa Trotte MN, Schubach
TM, Tortelly R. Atypical feline sporotrichosis resembling vaccine-induced sarcoma:
clinical and histopathological aspects. J Feline Med Surg. 2013 Jun;15(6):517-9.
478
10. de Souza CP, Lucas R, Ramadinha RH, Pires TB. Cryosurgery in association with
itraconazole for the treatment of feline sporotrichosis. J Feline Med Surg. 2016
Feb;18(2):137-43.
11. Fernandes GF, Lopes-Bezerra LM, Bernardes-Engemann AR, Schubach TM, Dias
MA, Pereira SA, de Camargo ZP. Serodiagnosis of sporotrichosis infection in cats by
enzyme-linked immunosorbent assay using a specific antigen, SsCBF, and crude
exoantigens. Vet Microbiol. 2011 Jan 27;147(3-4):445-9.
12. Gremião I, Schubach T, Pereira S, Rodrigues A, Honse C, Barros M. Treatment of
refractory feline sporotrichosis with a combination of intralesional amphotericin B
and oral itraconazole. Aust Vet J. 2011 Sep;89(9):346-51
13. Gremião ID, Menezes RC, Schubach TM, Figueiredo AB, Cavalcanti MC, Pereira
SA. Feline sporotrichosis: epidemiological and clinical aspects. Med Mycol. 2015
Jan;53(1):15-21.
14. Guterres KA, de Matos CB, Osório Lda G, Schuch ID, Cleff MB. The use of (1-3) βglucan along with itraconazole against canine refractory sporotrichosis.
Mycopathologia. 2014 Apr;177(3-4):217-21.
15. Goad DL, Goad ME. Osteoarticular sporotrichosis in a dog. J Am Vet Med
Assoc. 1986 Nov 15;189(10):1326-8.
16. Hirano M, Watanabe K, Murakami M, Kano R, Yanai T, Yamazoe K, Fukata
T, Kudo T. A case of feline sporotrichosis. J Vet Med Sci. 2006 Mar;68(3):283-4.
17. Jessica N, Sonia RL, Rodrigo C, Isabella DF, Tânia MP, Jeferson C, Anna
BF, Sandro A. Diagnostic accuracy assessment of cytopathological examination of
feline sporotrichosis. Med Mycol. 2015 Nov;53(8):880-4.
18. Kano R, Okubo M, Siew HH, Kamata H, Hasegawa A. Molecular typing of
Sporothrix schenckii isolates from cats in Malaysia. Mycoses. 2015 Apr;58(4):220-4.
19. Kovarik CL, Neyra E, Bustamante B. Evaluation of cats as the source of
endemic sporotrichosis in Peru. Med Mycol. 2008 Feb;46(1):53-6.
20. Lloret A, Hartmann K, Pennisi MG, Ferrer L, Addie D, Belák S, Boucraut-Baralon
C, Egberink H, Frymus T, Gruffydd-Jones T, Hosie MJ, Lutz H, Marsilio F, Möstl
K, Radford AD, Thiry E, Truyen U, Horzinek MC. Sporotrichosis in cats: ABCD
guidelines on prevention and management. J Feline Med Surg. 2013 Jul;15(7):61923.
21. López-Romero E, Reyes-Montes Mdel R, Pérez-Torres A, Ruiz-Baca E, VillagómezCastro JC, Mora-Montes HM, Flores-Carreón A, Toriello C. Sporothrix schenckii
complex and sporotrichosis, an emerging health problem. Future Microbiol. 2011
Jan;6(1):85-102.
22. Madrid IM, Mattei AS, Soares MP, de Oliveira Nobre M, Meireles MC.
Ultrastructural study of the mycelial phase of clinical isolates of Sporothrix schenckii
obtained from feline, canine and human cases of sporotrichosis. Braz J
Microbiol. 2011 Jul;42(3):1147-50.
23. Madrid IM, Mattei AS, Fernandes CG, Nobre Mde O, Meireles MC. Epidemiological
findings and laboratory evaluation of sporotrichosis: a description of 103 cases in cats
and dogs in southern Brazil. Mycopathologia. 2012 Apr;173(4):265-73.
24. Madrid IM, Mattei A, Martins A, Nobre M, Meireles M. Feline sporotrichosis in the
southern region of rio grande do sul, Brazil: clinical, zoonotic and therapeutic aspects.
Zoonoses Public Health. 2010 Mar;57(2):151-4.
25. Miranda LH, Quintella LP, dos Santos IB, Menezes RC, Figueiredo FB, Gremião
ID, Okamoto T, de Oliveira RV, Pereira SA, Tortelly R, Schubach TM.
Histopathology of canine sporotrichosis: a morphological study of 86 cases from Rio
de Janeiro (2001-2007). Mycopathologia. 2009 Aug;168(2):79-87.
26. Miranda LH, Quintella LP, Santos IB, Oliveira RV, Menezes RC, Figueiredo
FB, Schubach TM. Comparative histopathological study of sporotrichosis and
American tegumentary leishmaniasis in dogs from Rio de Janeiro. J Comp
Pathol. 2010 Jul;143(1):1-7.
479
27. Miranda LH, Quintella LP, Menezes RC, dos Santos IB, Oliveira RV, Figueiredo
FB, Lopes-Bezerra LM, Schubach TM. Evaluation of immunohistochemistry for the
diagnosis of sporotrichosis in dogs. Vet J. 2011 Dec;190(3):408-11.
28. Miranda LH, Santiago Mde A, Schubach TM, Morgado FN, Pereira SA, Oliveira Rde
V, Conceição-Silva F. Severe feline sporotrichosis associated with an increased
population of CD8low cells and a decrease in CD4+ cells. Med Mycol. 2016 Jan
1;54(1):29-39
29. Miranda LH, Conceição-Silva F, Quintella LP, Kuraiem BP, Pereira SA, Schubach
TM. Feline sporotrichosis: histopathological profile of cutaneous lesions and their
correlation with clinical presentation. Comp Immunol Microbiol Infect Dis. 2013
Jul;36(4):425-32.
30. Montenegro H, Rodrigues AM, Dias MA, da Silva EA, Bernardi F, de Camargo ZP.
Feline sporotrichosis due to Sporothrix brasiliensis: an emerging animal infection in
São Paulo, Brazil. BMC Vet Res. 2014 Nov 19;10:269.
31. Pereira SA, Gremião ID, Kitada AA, Boechat JS, Viana PG, Schubach TM. The
epidemiological scenario of feline sporotrichosis in Rio de Janeiro, State of Rio de
Janeiro, Brazil. Rev Soc Bras Med Trop. 2014 May-Jun;47(3):392-3.
32. Pereira SA, Passos SR, Silva JN, Gremião ID, Figueiredo FB, Teixeira JL, Monteiro
PC, Schubach TM. Response to azolic antifungal agents for treating
feline sporotrichosis. Vet Rec. 2010 Mar 6;166(10):290-4.
33. Pohlman LM, Bagladi-Swanson MS, Torres-Irizarry MS. Pathology in practice.
Disseminated pyogranulomatous inflammation with intralesional Sporothrix
organisms in a cat. J Am Vet Med Assoc. 2014 Jul 15;245(2):187-9.
34. Rees RK, Swartzberg JE. Feline-transmitted sporotrichosis: A case study from
California. Dermatol Online J. 2011 Jun 15;17(6):2.
35. Reis RS, Almeida-Paes R, Muniz Mde M, Tavares PM, Monteiro PC, Schubach
TM, Gutierrez-Galhardo MC, Zancopé-Oliveira RM. Molecular characterisation of
Sporothrix
schenckii
isolates
from
humans
and cats involved
in
the sporotrichosisepidemic in Rio de Janeiro, Brazil. Mem Inst Oswaldo Cruz. 2009
Aug;104(5):769-74.
36. Rodrigues AM, de Melo Teixeira M, de Hoog GS, Schubach TM, Pereira
SA, Fernandes GF, Bezerra LM, Felipe MS, de Camargo ZP. Phylogenetic analysis
reveals a high prevalence of Sporothrix brasiliensis in feline sporotrichosis outbreaks.
PLoS Negl Trop Dis. 2013 Jun 20;7(6):e2281.
37. Sanchotene KO, Madrid IM, Klafke GB, Bergamashi M, Della Terra PP, Rodrigues
AM, de Camargo ZP, Xavier MO. Sporothrix brasiliensis outbreaks and the rapid
emergence of feline sporotrichosis. Mycoses. 2015 Nov;58(11):652-8.
38. Schechtman RC. Sporotrichosis: Part II. Skinmed. 2010 Sep-Oct;8(5):275-80.
39. Schubach TM, Schubach A, Okamoto T, Barros MB, Figueiredo FB, Cuzzi T, Pereira
SA, Dos Santos IB, Almeida Paes Rd, Paes Leme LR, Wanke B.
Canine sporotrichosis in Rio de Janeiro, Brazil: clinical presentation, laboratory
diagnosis and therapeutic response in 44 cases (1998-2003). Med Mycol. 2006
Feb;44(1):87-92.
40. Schubach A, Barros MB, Wanke B. Epidemic sporotrichosis. Curr Opin Infect
Dis. 2008 Apr;21(2):129-33.
41. Shany M. A mixed fungal infection in a dog: sporotrichosis and cryptococcosis. Can
Vet J. 2000 Oct;41(10):799-800.
42. Sykes JE, Torres SM, Armstrong PJ, Lindeman CJ. Itraconazole for treatment
of sporotrichosis in a dog residing on a Christmas tree farm. J Am Vet Med
Assoc. 2001 May 1;218(9):1440-3, 1421.
43. Teixeira MM, de Almeida LG, Kubitschek-Barreira P, Alves FL, Kioshima
ES, Abadio AK, Fernandes L, Derengowski LS, Ferreira KS, Souza RC, Ruiz JC, de
Andrade NC, Paes HC, Nicola AM, Albuquerque P, Gerber AL, Martins
VP, Peconick LD, Neto AV, Chaucanez CB, Silva PA, Cunha OL, de Oliveira
FF, dos Santos TC, Barros AL, Soares MA, de Oliveira LM, Marini MM, Villalobos481
Duno H, Cunha MM, de Hoog S, da Silveira JF, Henrissat B, Niño-Vega
GA, Cisalpino PS, Mora-Montes HM, Almeida SR, Stajich JE, Lopes-Bezerra
LM, Vasconcelos AT, Felipe MS. Comparative genomics of the major fungal agents
of human and animal Sporotrichosis: Sporothrix schenckii and Sporothrix
brasiliensis. BMC Genomics. 2014 Oct 29;15:943.
44. Weingart C, Lübke-Becker A, Kohn B. Sporothrix schenckii infection in a cat. Berl
Munch Tierarztl Wochenschr. 2010 Mar-Apr;123(3-4):125-9.
45. Whittemore JC, Webb CB. Successful treatment of nasal sporotrichosis in a dog. Can
Vet J. 2007 Apr;48(4):411-4.
E. Diseases in cats and dogs caused by algae
1. Protothecosis in cats and dogs
The genus Prototheca entails species of achlorophyllous, unicellular, saprophytic,
aerobic algae closely related to Chlorella spp. These algae are ubiquitous in the
environment and may be isolated from fresh and marine water, soil, mud, tree sap,
and sewage. Five species of Prototheca are currently recognized, including P.
blaschkeae, P. stagnora, P. ulmea, P. wickerhami, and P. zopfii ; a sixth species, P.
cutis, was recently proposed based on genetically distinct isolates from a human
patient with skin disease. Of these, P. wickerhami and P. zopfii are recognized as
pathogenic to humans, cattle, and dogs. Human cases have largely been reported from
Canine cases of protothecosis are uncommon but are increasingly recognized
worldwide.
In contrast to the human disease, canine protothecosis typically involves a broadly
disseminated infection, particularly involving the colon, nervous system, and eyes, as
well as the heart, kidneys, skeletal muscle, and liver. Frequent involvement of the
colon makes colitis (with or without hematochezia) a common presenting complaint;
other common presenting complaints include neurologic disease, blindness, and less
frequently, polyuria and polydipsia.
The clinical form of the protothecosis in animals is most commonly observed in
countries with a warm and moist climate, only a few reports describing cases of this
infection in cooler areas of the word exist. In the case of large bowel infection
in dogs, organisms colonise the lamina propria and submucosa causing severe
necrotizing ulcerative or haemorrhagic enterocolitis.
Aetiology
Prototheca zopfii W. Krüger, Hedwigia 33: 264 (1894)
481
Prototheca grows easily on glucose containing media and is typically grown on
Sabouraud's agar, but it will not grow on media that contain cycloheximide. The
colonies appear yeast-like and are smooth, moist, and white to cream in colour.
Prototheca are unicellular organisms that are typically round to oval and 8-16 um in
diameter, though they can range from 3 to 30 um depending on the species and the
degree of maturation. The organisms reproduce by a mother cell undergoing internal
cleavage. This results in the internal accumulation of smaller endospores surrounded
by the wall (or theca) of the mother cell. The mother cell then bursts, releasing the
endospores and the cycle is repeated. The endospores are 4 to 5 um in diameter and
can number from two to 50. These endospores give Prototheca its characteristic "cart
wheel" appearance of a round structure with internal septations. The larger forms can
have very thick walls. They are basophilic and have been reported to be Gram
positive, though in this case the theca are Gram negative and the endospores Gram.
PAS staining highlights the starch granules which are occasionally present.
www.prototheca.com
Reports
Buyukmihci et al. (1975) reported an 8 1/2-year-old Collie dog with chronic diarrhea
as well as sudden blindness and leukokoria of the right eye. An organism
morphologically similar to Prototheca sp was recovered from the subretinal fluid and
was found at necropsy in the eyes, gastrointestinal tract, lungs, lymph nodes, kidneys,
heart, abdominal fat, and omentum.
Imes et al. (1977) reported on the clinical history and pathological lesions of a dog
suffering from disseminated protothecosis due to Prototheca zopfi. Clinically, the
dog was presented with bilateral conjunctivitis followed by blindness, deafness and
posterior paresis. Pathological lesions were most severe in the eyes and consisted of
subacute panophthalmitis with secondary posterior subcapsular cataract, posterior
synechia, retinal detachment and microscopic evidence of glaucoma. The kidney,
liver, brain, spleen and lungs were also affected. This is believed to be the first
published account ofprotothecosis in mammals other than man in Africa. A review of
the literature is included.
Tyler et al. (1980) identified a case of progressive neurologic disease in a 4-year-old
mixed-breed spayed bitch. Prototheca organisms were identified by histopathology,
culture, and electron microscopy. Specific fluorescent antibody procedures revealed
two species--Prototheca wickerhamii and Prototheca zopfii. Organisms and
482
pyogranulomatous lesions were found in the brain, spinal cord, right eye, kidneys, and
heart.
Cook et al. (1984) euthanatized a 3-year-old Collie bitch, suffering from
disseminated protothecosis, two weeks after the onset of blindness and deafness.
The hearing deficit had been localized by clinical signs, brain stem auditory evoked
responses, and impedance audiometry. Protothecosis was diagnosed by cytologic and
histologic examinations. The organism was identified as Prototheca zopfii .
Organisms and granulomatous lesions were found in kidney, heart, liver, skeletal
muscle, thyroid gland, colon, bronchial lymph node, brain, and cochlea.
Font and Hook (1984) described a case of disseminated protothecosis, due to
Prototheca wickerhamii in a two-year-old female dog with a nine-month history of
hemorrhagic colitis and diarrhea. Shortly thereafter, the dog developed "acute
blindness" of the left eye. Euthanasia was done after medical therapy failed to control
the disease. Histologically, the eye had multiple microabscesses and necrotic foci
containing myriad protothecal organisms under the detached retina. Numerous
organisms also were present in the mucosa and walls of the colon. The identification
of P. wickerhamii was confirmed by the histologic appearance and
immunofluorescent studies. The ultrastructural features of P. wickerhamii also were
studied.
Gaunt et al. (1984) reported a disseminated protothecosis in a dog with forelimb
lameness, bilateral retinal detachment, and hemorrhagic diarrhea. Necropsy
demonstrated multifocal lesions in the skeletal musculature, myocardium, liver,
thyroid glands, kidneys, eyes, and brain. Microscopically, the lesions contained
numerous organisms and minimal cellular infiltrates. The morphologic and cultural
characteristics of the organisms were similar to prototheca. The organisms in tissue
sections reacted positively for Prototheca zopfii, using an indirect fluorescent
antibody technique.
Moore et al. (1985) diagnosed systemic protothecosis in a 7-year-old dog that had
only ocular manifestations. During the 3-month course of disease, a variety of drugs
was administered, including amphotericin B, gentamicin, and ketoconazole. The
ocular signs initially abated, but subsequently worsened during this period. The dog
was found dead 3 months after initial examination, and systemic protothecosis was
confirmed at necropsy.
Thomas and Preston (1990) described a case of generalised protothecosis in a
Collie dog. A long-standing history of severe colitis was the major clinical sign.
Dissemination to many organs was confirmed histologically. Possible pathogenesis is
discussed along with a review of the literature. The possibility of a breed disposition
in Collie dogs is discussed. The organisms are ubiquitous in the environment and
generalised disease suggests the possibility of immune competence.
Ginel et al. (1997) infected a dog systemically with Prototheca wickerhamii but
showed only cutaneous protothecosis. The lesions appeared progressively and
consisted of non-pruritic scrotal swelling and ulceration, cutaneous nodules, crusty
ulcerative lesions over the trunk and serous rhinitis. The diagnosis was based on skin
biopsy findings and specific culture. Microscopic examination revealed a diffuse
pyogranulomatous dermatitis and numerous protothecal organisms of different sizes
within the cytoplasm of phagocytic cells. Treatment with oral ketoconazole for six
months resolved all the clinical signs except the scrotal granuloma which, although it
483
was significantly reduced, had to be removed surgically. However, after five months
the condition returned.
Pérez et al. (1997) evaluated the distribution of the cellular inflammatory infiltrate
associated with cutaneous canine protothecosis (Prototheca wickerhamii) by
consecutive biopsies taken before, during and after treatment. Antibodies specific to
canine immunoglobulins (IgG, IgM, IgA), human CD3 antigen (pan T-lymphocyte
marker) and human myeloid/ histiocyte antigen (macrophage/neutrophil marker) were
used. Before treatment, cellular infiltrate was very scanty in the inflamed areas, but it
increased during the treatment, whereas the number of protothecal organisms
decreased. Statistical analysis revealed an inverse relation between the number of
protothecal organisms and the number of infiltrating macrophage/neutrophils (P <
0.004), T lymphocytes (P < 0.001), and cells containing immunoglobulin G (P <
0.001), M (P < 0.001) and A (P < 0.001) at different stages of the disease. These
findings suggest either that protothecal organisms inhibit the migration or
proliferation of cellular inflammatory infiltrate or that only dead protothecal
organisms induce an effective local immune response.
Schultze et al. (1998) reported 2 cases of sudden onset of blindness associated with
ocular protothecosis in dogs . Both were adult, spayed female, mixed-breeddogs that
lacked the usual clinical signs of systemic infection with Prototheca species. Physical
abnormalities at the time of presentation were limited to the affected eyes which had
serous discharge, hyperemic conjunctiva, and aqueous flare. The pupillary light
reflexes were slow, and the menace reflexes were absent. Both dogs had glaucoma.
Results of complete blood counts and serologic titres for antibodies to Blastomyces
dermatitidis
and
Histoplasma
capsulatum
were
within
reference
intervals. Protothecosis was diagnosed by cytologic analysis of vitreous humor and
was confirmed at necropsy. These two cases were unusual because of their presenting
signs and prolonged course of disease progression.
Hollingsworth (2000) mentioned that canine protothecosis remains a difficult
condition to manage. The paucity of clinical cases hinders the development of
successful treatment strategies. The clinical signs associated with the disease are
nonspecific, and the course is so insidious that, by the time a definitive diagnosis is
reached, the organism has often disseminated throughout the body. At this point, the
condition is beyond treatment, and death occurs owing to failure of any number of
organ systems, including the gastrointestinal, cardiovascular, renal, and central
nervous systems. It is of some encouragement that the few patients that have
undergone aggressive early treatment have survived longer than patients presenting
late in the disease course. Nevertheless, the outlook for any dog with protothecosis is
grave, and it remains to be determined whether early diagnosis can truly provide a
better long-term prognosis. By including protothecosis as a consideration
for dogs initially brought in with a history of chronic diarrhea or acute blindness and
with a subsequent finding of exudative retinal separation, early diagnosis is possible.
This recognition potentially affords the opportunity for an immune status work-up and
intervention with increasingly better treatment options.
Hosaka and Hosaka (2004) reported a 10-year-old spayed mongrel dog with
repeated intercurrent hematochezia and anal bleeding. The dog was vigorous and had
a normal appetite, and the fecal test showed no abnormal signs. Despite treatment
primarily with sulfasalazine, the condition did not improve and unilateral blindness
developed. A Prototheca zopfii infection was identified by further examination with
484
bowel culture on Sabouraud's agar without cyclohexane and antibiotics. Subsequent to
a vision loss in the other eye, the dog died showing signs of neurological disorder.
Pressler et al. (2005) reviewed records of 13 dogs with systemic infection with
Prototheca sp. from 3 veterinary teaching hospitals. Acute renal failure secondary to
disseminated infection with Prototheca zopfii was diagnosed in 2 dogs. In 1 dog,
acute renal failure developed during administration of immunosuppressive drugs for
treatment of anterior uveitis. During diagnostic evaluation of this dog, Prototheca sp.
organisms were noted in urine sediment and renal biopsy specimens. In the 2nd dog,
acute renal failure was diagnosed after treatment for bacterial cystitis. After diagnosis
of protothecosis, organisms were successfully isolated by aerobic urine culture.
Both dogs with acute renal failure did not respond to conventional medical therapy. In
total, Prototheca sp. was noted in urine sediment in 4 of 8 dogs and successfully
cultured from urine in 5 of 7 dogs. Four of 5dogs had organisms noted in the kidneys
on histopathologic examination. In all dogs, the species identified was P zopfii.
Sensitivity testing of 3 isolates revealed wide differences in in vitro drug resistance.
Examination and culture of urine is recommended as a practical method for diagnosis
of systemic infection with Prototheca sp.
Renal tissue from a dog with acute renal failure secondary to disseminated protothecosis. There is
multifocal inflammatory cell infiltration throughout the interstitium, and disruption of a glomerulus by
large numbers of organisms (arrowhead). Hematoxylin and eosin stain, 1003. Prototheca sp. in a
cytospin urine sediment preparation from a dog with systemic protothecosis. Diff-Quik stain, 6003. Bar
5 10 mm.
Tsuji et al. (2006) identified the isolate from a canine disseminated protothecosis to
be Prototheca wickerhamii by its morphological and biochemical characteristics. The
isolate was grouped into a cluster identical to the type strain of P. wickerhamii, ATCC
16529(T) in phylogenetic trees based on the small subunit (SSU) and the 5' end of the
large subunit (LSU) ribosomal DNA (rDNA); the cluster was close to that including
the other Prototheca species. However, the strains of P. wickerhamii, SAG 263-11 and
Pore 1283 belonged to a cluster different from the other isolates of Prototheca species
and closely related to those of Auxenochorella species. Therefore, P. wickerhamii
could be divided into two distinct genetic groups, one group close to the other
Prototheca spp. including a standard strain of P. wickerhamii, and another group
consisting of isolates previously reported to be close to the Auxenochorella species.
Stenner et al. (2007) diagnosed systemic protothecosis in 17 Australian dogs .
There was a preponderance of young-adult (median 4 years), medium- to largebreed dogs. Females (12/17 cases) and Boxer dogs (7 cases, including 6 purebreds
and one Boxer cross) were over-represented. Sixteen of 17 dogs died, with a median
survival of four months. A disproportionate number of cases were from coastal
Queensland. In most patients, first signs were referable to colitis (11/17 cases), which
485
varied in severity, and was often present for many months before other symptoms
developed. Subsequent to dissemination, signs were mostly ocular (12 cases) and/or
neurologic (8 cases). Two dogs had signs due to bony lesions. Once dissemination
was evident, death or euthanasia transpired quickly. Prototheca organisms had a
tropism for the eye, central nervous system (CNS), bone, kidneys and myocardium,
tissues with a good blood supply. Microscopic examination and culture of urine (5
cases), cerebrospinal fluid (CSF;1 case), rectal scrapings (4 cases), aspirates or
biopsies of eyes (5 cases) and histology of colonic biopsies (6 cases) as well as skin
and lymph nodes (2 cases) helped secure a diagnosis. Of the cases where culture was
successful, P wickerhamii was isolated from two patients, while P zopfii was isolated
from five. P zopfii infections had a more aggressive course. Treatment was not
attempted in most cases. Combination therapy with amphotericin B and itraconazole
proved effective in two cases, although in one of these treatment should have been for
a longer duration. One surviving dog is currently still receiving
itraconazole. Protothecosis should be considered in all dogs with refractory colitis,
especially in female Boxers.
(a) Hematogenous algal osteomyelitis affecting the femoral diaphysis in a dog (case 1) with
disseminated protothecosis. Note the irregular periosteal new bone formation. (b) A similar lesion is
present in the femur of a different patient (case 5), although the periosteal new bone is much smoother
in appearance. (c) Microradiography of the femur (ex vivo) obtained from case 5 at necropsy. Note that
the higher resolution of this imaging reveals there is lysis as well as periosteal new bone formation in
the osteomyelitis lesion in the diaphysis Stenner et al. (2007)
DiffQuik stain of urine sediment showing more detailed morphology of Prototheca organisms
from case 5. The oval shape of organisms is characteristic of Prototheca zopfii. Original
486
magnification×330, DiffQuik stained smear of a rectal scraping from a dog (case 5) with protothecal
proctitis. Note the Prototheca organisms against a background of faecal bacteria. Again, the
morphology is consistent with Prototheca zopfii. Stenner et al. (2007)
Morphological appearance of Prototheca organisms in sections of the colonic wall. The sections
show the mild mixed inflammatory infiltrate in the lamina propria consisting of plasma cells,
neutrophils and macrophages. Interspersed amongst the inflammation are moderate numbers of
large oval organisms. Although organisms are easily discernible in H&E stained sections (a), they
are better visualised in PAS (b) and methenamine silver stained (c) sections. The organism
morphology in these photomicrographs is consistent with aPrototheca zopfii infection Stenner et
al. (2007)
Granulomatous colitis and arteritis due to Prototheca zopfii. A thrombus is evident in the lumen of an
artery on the serosal portion of the the colonic wall (a). Organisms can be seen invading the artery (b),
although they are easier to visualize in (c) because of the higher magnification and the periodic acid
Schiff (PAS) stain Appearance of Prototheca zopfii organisms in a wet preparation of urine (from case
5) at high power (Original magnification×660). Stenner et al. (2007)
Salvadori et al. (2008) reported a case of central nervous system protothecosis in a
three-year-old male Maremma sheepdog with a two month history of diarrhoea
associated with progressive tetraparesis, depression and right circling. Stupor, severe
proprioceptive deficits, bilateral decreased thoracic limb flexor reflexes and bilateral
deficit of the menace reaction were detected on neurological examination and a multifocal neurological localisation was suspected. Histopathological evaluation revealed
multi-focal granulomatous foci in the thalamus, hippocampus and caudal brainstem
containing numerous oval-rounded organisms with a thick, periodic acid-Schiffpositive and Gomori's methenamine silver-positive cell wall, a basophilic cytoplasm
and one nucleus. Scattered sporangia containing two to four endospores were also
observed. Morphological features were consistent with Prototheca species.
Ultrastructurally, numerous degenerated algae were present within macrophages
mainly lacking nuclei and cytoplasmic organelles. Generally, protothecosis in dogs is
characterised by systemic signs because of a multi-organ involvement, and
haemorrhagic colitis or ophthalmologic signs are the most frequent presenting signs.
However, protothecosis should be added, also in Europe, to the list of the differential
diagnoses in adult dogs with a multi-focal neurological localisation even in absence of
other clinical signs.
487
Transverse section through thalamus, hippocampus and temporal cortex: bilateral multifocal malacic
foci are present in the thalamus Salvadori et al. (2008)
Thalamus. Granulomatous foci composed of numerous macrophages, lymphocytes and plasma cells
with a perivascular pattern are evident in the grey matter. Spongiosis with axonal degeneration and
myelin ballooning is also present (asterisks) (H&E, 3125). Inset: Area of malacic change of the white
matter (H&E, 3500) Thalamus. Numerous algae with a periodic acid-Schiff (PAS)-positive, 1 mm
thick cell wall are evident. Scattered sporangia containing two to four endospores with well evident
nuclei are also present (arrows) (PAS, 3125) Salvadori et al. (2008)
488
Ribeiro et al. (2009) reported enteric protothecosis caused by Prototheca zopfii in an
eight-year-old male mixed breed dog with a history of chronic bloody diarrhea, loss of
appetite and weight loss. Algae were isolated from rectal scrapings in defibrinated
sheep blood agar and dextrose Sabouraud agar. Cytological evaluation showed the
presence of globular and cylindrical organisms with a defined capsule and variable
number of endospores, characteristic of the genus Prototheca, in the rectum of the
animal. Scanning electron microscopy of P. zopfii strains at different development
stages confirmed the diagnosis of algal infection. Molecular identification using a
conserved 18S rDNA gene sequence determined that the strain belonged to genotype
2. This report describes success on treatment of canine protothecosis, diagnosed based
on clinical, cytological, microbiological, scanning electron microscopy and
genotypical findings
Ribeiro et al. (2009)
Sapierzyński et al. (2009) eported the intestinal form of protothecosis in 1.5-year-old,
male, mongrel dog with chronic hemorrhagic diarrhoea. History revealed that the dog
spent some time in the countryside and afterwards diarrhoea with fresh blood
appeared. The results of morphological and biochemical blood analysis were normal
and stool examination did not reveal the presence of parasites. Treatment with antiinflammatory doses of prednisone, metronidazole and enrofloxacin followed by
sulphasalazine resulted in a short period of improvement, but was followed by deep
deterioration of animal status. Because of the relapse diagnostic laparotomy was
performed and tissue samples of the colon and jejunum were obtained for
histopathology. On the basis of the clinical signs, exploratory laparotomy findings and
histopathology the diagnosis of canine intestinal prototecosis was made and medical
treatment was recommended.
Gupta et al. (2011) reported a 6-year-old spayed female Boxer dog with a 3-week
history of ataxia, walking sideways, crossing over of limbs, and dragging her hind
feet. She had a repair of her left cranial cruciate ligament approximately 4 months
previously with uneventful recovery. Neurologic examination revealed severe ataxia,
worse on the left side, and a left head tilt. No abnormalities were observed on
computed tomographic scan of the brain. Magnetic resonance imaging of the brain
revealed a lesion involving approximately 50% of the left side of the pons and
medulla and extending dorsally to the 4th ventricle. Histologic section of brain in the
region of the hippocampus showed multifocal perivascular cuffs composed of
aggregates of numerous lymphocytes, plasma cells, and small numbers of histiocytes.
And algal organisms with characteristic radially arranged multiple wedge-shaped
endospores.
489
Histologic section of brain in the region of the hippocampus. (A) Note multifocal perivascular cuffs composed of aggregates
of numerous lymphocytes, plasma cells, and small numbers of histiocytes. H&E. Inset: Inflammatory cells in a perivascular
cuff. H&E, bar = 20 mm. (B) Note algal organisms with characteristic radially arranged multiple wedge-shaped endospores.
Gomori’s methanamine silver.
Lane et al. (2012) evaluated a 5-year-old female spayed Shetland Sheepdog Mix dog
for a history of seizure activity, progressive hind limb ataxia, polyuria, and polydipsia
and no history of gastrointestinal signs. Physical examination findings included
conscious proprioceptive deficits, ataxia, and anterior uveitis along with a
hypermature cataract in the right eye. Results of a CBC, serum biochemical profile,
urinalysis, and computed tomography scan of the brain were unremarkable.
Cerebrospinal fluid (CSF) analysis revealed marked eosinophilic pleocytosis and rare
organisms consistent with Prototheca spp within neutrophils and macrophages. On
postmortem histologic examination, mononuclear inflammation and numerous
intralesional algal organisms, similar to those seen on the cytologic preparation of
CSF, were found in the brain, eyes, kidneys, and heart. Abnormalities were not
detected on gross and histologic examination of the gastrointestinal tract. Cultures of
CSF and subdural/olfactory bulb, but not intestinal tract, yielded growth of Prototheca
spp, and PCR analysis and DNA sequencing confirmed the organism as Prototheca
zopfii genotype 2. We have reported a rare case of disseminated protothecosis that
was diagnosed by evaluation of CSF in a dog presented with neurologic signs and no
overt enteric disease. Protothecosis should be considered as a rare cause of seizures,
even in the absence of obvious enteric signs, and should be included in the differential
diagnosis of eosinophilic pleocytosis.
491
Cytocentrifuged preparation of cerebrospinal fluid from a dog with protothecosis. (A) Marked
eosinophilic pleocytosis; note the large granular lymphocyte with numerous azurophilic granules
(arrow). (B) Several oval to kidney-bean shaped basophilic and granular Prototheca organisms with
thin non-staining casings (arrows). (C) Empty casings (theca) in the cytoplasm of a large mononuclear
cell (arrows). (D) Numerous GMS-positive organisms. (A-C) Modified Wright–Giemsa, (D) Gomori’s
methenamine silver (GMS), bars = 10 lm. Lane et al. (2012)
2. (A) Histologic section of brain through lateral ventricle (asterisk). Note increased cellularity of the
ependymal lining of the lateral ventricle (arrow). H&E. (B) Same section as (A); note the numerous
GMS-positive Prototheca organisms in the ependymal lining of the lateral ventricle (asterisk).
491
Gomori’s methenamine silver (GMS). (C) Histologic section of the right eye. The choroid is markedly
expanded with a pocket of inflammation (arrow); the sclera (asterisk) provides orientation. H&E. (D)
Same section as (C) showing increased magnification of the inflammatory pocket in the choroid; note
numerous GMS-positive organisms. Gomori’s methenamine silver. Lane et al. (2012)
Vince et al. (2014) reported a case of a disseminated algal infection in a young
rough-coated collie dog with progressive neurologic deficits, blindness, and
hemorrhagic diarrhea. Prototheca zopfii organisms were cultured from feces, urine,
and blood. At necropsy, granulomas containing typical organisms were identified
within the proximal colon, heart, kidneys, and eyes.
Rectal scraping cytology, modified Wright’s stain, 600× magnification. Prototheca organisms (arrows)
are round to oval, measuring 2 to 30 μm and have a granular, basophilic cytoplasm with clear cell wall.
Note also the large numbers of bacteria and degenerate neutrophils in the background.
Heart, cut section of apex. At all levels of the myocardium there are numerous poorly defined pale tanwhite nodules.
492
Colon and rectum, mucosal surface. There is segmental dark discoloration of the colonic wall,
throughout which are multiple poorly defined white-tan nodules. Some green discoloration is present as
a result of both local hemorrhage and autolysis.
Posterior chamber of the eye, H&E stain, 600× magnification. Within the posterior uvea and anterior
chamber are numerous 8 to 12 μm diameter round-oval algal sporangia, with thick hyaline cell walls
and 1, 2 or 4 endospores; 1 of these sporangia has a typical “Maltese cross” appearance
for Prototheca spp. These sporangia are surrounded by large numbers of neutrophils.
References:
1. Buyukmihci N, Rubin LF, DePaoli A. Protothecosis with ocular involvement in a
dog. J Am Vet Med Assoc. 1975 Jul 15;167(2):158-61.
2. Cook JR Jr, Tyler DE, Coulter DB, Chandler FW.
Disseminated protothecosis causing acute blindness and deafness in a dog. J Am Vet
Med Assoc. 1984 May 15;184(10):1266-72.
3. Font RL, Hook SR. Metastatic protothecal retinitis in a dog. Electron microscopic
observations. Vet Pathol. 1984 Jan;21(1):61-6.
4. Gaunt SD, McGrath RK, Cox HU. Disseminated protothecosis in a dog. J Am Vet
Med Assoc. 1984 Oct 15;185(8):906-7.
493
5. Ginel PJ, Pérez J, Molleda JM, Lucena R, Mozos E. Cutaneous protothecosis in a
dog. Vet Rec. 1997 Jun 21;140(25):651-3.
6. Gupta A, Gumber S, Bauer RW, Royal AB. What is your diagnosis? Cerebrospinal
fluid from a dog. Eosinophilic pleocytosis due to protothecosis. Vet Clin Pathol. 2011
Mar;40(1):105-6.
7. Hollingsworth SR. Canine protothecosis. Vet Clin North Am Small Anim Pract. 2000
Sep;30(5):1091-101.
8. Hosaka S, Hosaka M. A case report of canine protothecosis. J Vet Med Sci. 2004
May;66(5):593-7
9. Imes GD, Lloyd JC, Brightman MP. Disseminated prothothecosis in a dog.
Onderstepoort J Vet Res. 1977 Mar;44(1):1-6.
10. Lane LV, Meinkoth JH, Brunker J, Smith SK 2nd, Snider TA, Thomas J, Bradway
D, Love BC. Disseminated protothecosis diagnosed by evaluation of CSF in a dog.
Vet Clin Pathol. 2012 Mar;41(1):147-52.
11. Moore FM, Schmidt GM, Desai D, Chandler FW. Unsuccessful treatment of
disseminated protothecosis in a dog. J Am Vet Med Assoc. 1985 Apr 1;186(7):705-8.
12. Pérez J, Ginel PJ, Lucena R, Hervás J, Mozos E. Canine cutaneous protothecosis: an
immunohistochemical analysis of the inflammatory cellular infiltrate. J Comp
Pathol. 1997 Jul;117(1):83-9.
13. Pressler BM, Gookin JL, Sykes JE, Wolf AM, Vaden SL. Urinary tract
manifestations of protothecosis in dogs. J Vet Intern Med. 2005 Jan-Feb;19(1):1159.
14. Ribeiro MG, Rodrigues de Farias M, Roesler U, Roth K, Rodigheri SM, Ostrowsky
MA, Salerno T, Siqueira AK, Fernandes MC. Phenotypic and genotypic
characterization of Prototheca zopfii in a dog with enteric signs.
15. Salvadori C, Gandini G, Ballarini A, Cantile C. Protothecal granulomatous
meningoencephalitis in a dog. J Small Anim Pract. 2008 Oct;49(10):531-5.
16. Sapierzyński R, Jaworska O. Protothecosis as a cause of chronic diarrhoea in a dog.
Res Vet Sci. 2009 Dec;87(3):479-81.
17. Schultze AE, Ring RD, Morgan RV, Patton CS. Clinical, cytologic and
histopathologic manifestations of protothecosis in two dogs. Vet
Ophthalmol. 1998;1(4):239-243.
18. Stenner VJ, Mackay B, King T, Barrs VR, Irwin P, Abraham L, Swift N, Langer
N, Bernays M, Hampson E, Martin P, Krockenberger MB, Bosward K, Latter
M,Malik R. Protothecosis in 17 Australian dogs and a review of the canine literature.
Med Mycol. 2007 May;45(3):249-66.
19. Thomas JB, Preston N. Generalised protothecosis in a collie dog. Aust Vet J. 1990
Jan;67(1):25-7.
20. Tsuji H, Kano R, Hirai A, Murakami M, Yanai T, Namihira Y, Chiba J, Hasegawa A.
An isolate of Prototheca wickerhamii from systemic canine protothecosis. ] Vet
Microbiol. 2006 Dec 20;118(3-4):305-11.
21. Tyler DE, Lorenz MD, Blue JL, Munnell JF, Chandler FW.
Disseminated protothecosis with central nervous system involvement in a dog. J Am
Vet Med Assoc. 1980 May 15;176(10 Pt 1):987-93.
22. Vince AR, Pinard C, Ogilvie AT, Tan EO, Abrams-Ogg AC. Protothecosis in a
dog. Can Vet J. 2014 Oct;55(10):950-4.
494