Molecular phylogeny and dating of Asteliaceae (Asparagales): Astelia s.l. evolution provides insight into the Oligocene history of New Zealand

Sterling Keeley

ABSTRACT Lagenophora (Astereae, Asteraceae) has 14 species in New Zealand, Australia, Asia, southern South America, Gough Island and Tristan da Cunha. Phylogenetic relationships in Lagenophora were inferred using nuclear and plastid DNA regions. Reconstruction of spatio-temporal evolution was estimated using parsimony, Bayesian inference and likelihood methods, a Bayesian relaxed molecular clock and ancestral area and habitat reconstructions. Our results support a narrow taxonomic concept of Lagenophora including only a core group of species with one clade diversifying in New Zealand and another in South America. The split between the New Zealand and South American Lagenophora dates from 11.2 Mya [6.1–17.4 95% highest posterior density (HPD)]. The inferred ancestral habitats were openings in beech forest and subalpine tussockland. The biogeographical analyses infer a complex ancestral area for Lagenophora involving New Zealand and southern South America. Thus, the estimated divergence times and biogeographical reconstructions provide circumstantial evidence that Antarctica may have served as a corridor for migration until the expansion of the continental ice during the late Cenozoic. The extant distribution of Lagenophora reflects a complex history that could also have involved direct long-distance dispersal across southern oceans.

The Asteraceae (sunflowers and daisies) are the most diverse family of flowering plants. Despite their prominent role in extant terrestrial ecosystems, the early evolutionary history of this family remains poorly understood. Here we report the discovery of a number of fossil pollen grains preserved in dinosaur-bearing deposits from the Late Cretaceous of Antarctica that drastically pushes back the timing of assumed origin of the family. Reliably dated to ∼76–66 Mya, these specimens are about 20 million years older than previously known records for the Asteraceae. Using a phylogenetic approach, we interpreted these fossil specimens as members of an extinct early diverging clade of the family, associated with subfamily Barnadesioideae. Based on a molecular phylogenetic tree calibrated using fossils, including the ones reported here, we estimated that the most recent common ancestor of the family lived at least 80 Mya in Gondwana, well before the thermal and biogeographical isolation of Antarctica. Most of the early diverging lineages of the family originated in a narrow time interval after the K/P boundary, 60–50 Mya, coinciding with a pronounced climatic warming during the Late Paleocene and Early Eocene, and the scene of a dramatic rise in flowering plant diversity. Our age estimates reduce earlier discrepancies between the age of the fossil record and previous molecular estimates for the origin of the family, bearing important implications in the evolution of flowering plants in general.

A tree based on DNA sequences from the ITS region of rDNA of New Zealand members of the tribe Gnaphalieae is presented. The tree supports recognition of the genus Anaphalioides. The closest relatives of this genus are other New Zealand gnaphalioid genera: Leucogenes, Raoulia, Ewartia, and species currently assigned to Helichrysum. The tree suggests that there were at least four dispersal events to New Zealand of ancestors to the present gnaphalioid flora. The tree provides information on the relationships of other New Zealand genera in the Gnaphalieae: that Ewartiothamnus (Ewartia sinclairii) is not a sister genus to Ewartia, that Leucogenes is not a sister genus to Leontopodium, and that the New Zealand whipcord Helichrysum species do not belong in Ozothamnus.

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution and sharing with colleagues. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier’s archiving and manuscript policies are encouraged to visit: http://www.elsevier.com/copyright Author's personal copy Molecular Phylogenetics and Evolution 65 (2012) 102–115 Contents lists available at SciVerse ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev Molecular phylogeny and dating of Asteliaceae (Asparagales): Astelia s.l. evolution provides insight into the Oligocene history of New Zealand Joanne L. Birch a,⇑, Sterling C. Keeley a, Clifford W. Morden a,b a b University of Hawai‘i at Mānoa, Department of Botany, 3190 Maile Way, Honolulu, HI 96822, United States University of Hawai‘i at Mānoa, Pacific Co-Operative Studies Unit, 3190 Maile Way, Honolulu, HI 96822, United States a r t i c l e i n f o Article history: Received 4 January 2012 Revised 21 May 2012 Accepted 25 May 2012 Available online 1 June 2012 Keywords: Astelia Asteliaceae Collospermum Gondwana Long-distance dispersal Molecular dating a b s t r a c t Asteliaceae (4 genera, 36 species) are found on both continents and island archipelagos in the southern hemisphere and across the Pacific. The circumscription of Asteliaceae and intrageneric relationships are poorly understood. We generated a phylogeny including all genera and 99% of the species using DNA sequence data from chloroplast (trnL, psbA–trnH, rps16, and petL–psbE) and nuclear (NIA-i3) regions. Relaxed clock methods were applied to infer the age of the family and the timing of cladogenic events. Generic delimitations change as a result of this study. Collospermum is nested within Astelia and is recognized here only at the subgeneric level. Further, Astelia subgenera Astelia, Asteliopsis, and Tricella are paraphyletic and to achieve monophyly their recircumscriptions are proposed. Despite the presence of Asteliaceae taxa on multiple Gondwanan landmasses and proposed Cretaceous origins for the family, radiation of genera was during the Tertiary. The largest and oldest genus, Astelia s.l. (including Collospermum), radiated around the Eocene/Oligocene boundary (ca. 34.2 million years ago (Ma)). Astelia s.l. subgenera diverged from the Oligocene/Miocene boundary onwards (<24.0 Ma). These dates suggest that current distributions are most likely to be the result of long-distance dispersal. Alpine taxa in New Zealand and Australia radiated during the Late Miocene/Pliocene. These results are congruent with Astelia micro- and macro-fossil data and suggest that Astelia s.l. either persisted in New Zealand during the proposed Oligocene marine transgression or dispersed from Australia after the subsequent expansion of terrestrial habitat. Ó 2012 Elsevier Inc. All rights reserved. 1. Introduction Asteliaceae currently contains 4 genera and 36 species that are perennial, rhizomatous herbs with linear, alternate leaves. Leaves, inflorescences, and flowers typically bear distinctive silvery-white branched hairs that are otherwise rare in Asparagales. Despite its relatively small size, the family is remarkable for its morphological variation. Milligania has dry capsular fruit, in contrast to the fleshy fruit of Astelia, Collospermum, and Neoastelia. Collospermum, Milligania, and some Astelia species have trilocular ovaries, other Astelia species have unilocular ovaries, and Neoastelia has 3–7 locular ovaries. Skottsberg (including 1934b) suggested that, for Asteliaceae, bisexual flowers, capsular fruit, and simple hairs, as observed in Milligania, are plesiomorphic. Breeding systems also vary; Milligania and Neoastelia species are all hermaphroditic, producing bisexual flowers, Astelia and Collospermum species are typically ⇑ Corresponding author. Present address: Royal Botanic Gardens Melbourne, Private Bag 2000, Birdwood Avenue, South Yarra, VIC 3141, Australia. Fax: +61 392522413. E-mail address: Joanne.Birch@rbg.vic.gov.au (J.L. Birch). 1055-7903/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ympev.2012.05.031 dioecious, producing unisexual flowers, and one Astelia species is gynodioecious. Distributions of Asteliaceae taxa span Austral and Pacific regions. The center of generic diversity is in Australia with three of the four genera found there, while species diversity is greatest in New Zealand. Astelia (26 species) is the largest and most widely distributed of the four genera with species in Australia, New Zealand, and South America, the Mascarene Islands in the Indian Ocean, and seven archipelagos in the Pacific. Astelia species occupy a wide variety of habitats including coastal and lowland forests, low elevation swamps, alpine fellfields, and high elevation bogs. Collospermum (four species) is found as an epiphyte in New Zealand lowland forests and in Fiji, Vanuatu, and Samoa in lowland and tropical montane cloud forests. Milligania (five species) is endemic to Tasmania, where it occupies habitats ranging from lowland riparian valleys to alpine fellfields. The monotypic genus Neoastelia is a terrestrial herb that is restricted to temperate rainforests in northeastern New South Wales. Generic circumscription within Asteliaceae remains poorly understood. The most controversial aspect is the segregation of Author's personal copy J.L. Birch et al. / Molecular Phylogenetics and Evolution 65 (2012) 102–115 Collospermum from Astelia by Skottsberg (1934b). He recognized the former as distinct based on its simple lateral racemes, dimorphism of staminate and pistillate plants, basifixed anthers, long style papillae, and mucilaginous seed hairs, which differ from the predominantly paniculate lateral racemes, versatile anthers, and poorly developed mucilaginous seed hairs of Astelia. Within Astelia, Skottsberg (1934b) recognized three subgenera (Astelia, Asteliopsis, and Tricella) based on degree of tepal fusion, ovary division, and seed shape. Within these subgenera, he recognized seven sections (Astelia, Desmoneuron, Isoneuron, Micrastelia, Palaeastelia, Periastelia, and Tricella) based on leaf venation, pistillode size, seed surface features, and extent of funicle development. Moore (1980) considered that a re-evaluation of the circumscription of Astelia and Collospermum was warranted due to the production of viable progeny from intergeneric crosses. Further, the inclusion of Milligania in the family has been challenged as this placement was poorly supported in a cladistic analysis of morphological and molecular data (Rudall et al., 1998). It has been considered as ‘‘a divergent outlier’’ in the family. Conversely, Bayer et al. (1998) questioned the separation of Astelia, Collospermum, and Neoastelia into distinct genera. Maciunas et al. (2011) identified a sister relationship for Neoastelia/Milligania and Collospermum/Astelia clades in a cladistic study of morphological data. However, intrageneric relationships remain largely unresolved as only the sister relationship of Astelia and Collospermum received bootstrap support greater than 50%. In short almost nothing is clear about the relationships among genera within the family or of their individual boundaries. Asteliaceae (Asparagales) has been considered an ‘‘Austral’’ floristic element, as defined by its presence on the eastern Gondwanan landmasses, Australia, New Zealand, and South America (Fleming, 1975; Fosberg, 1948). This hypothesis is supported by age estimates for the family’s stem and crown lineages at 102 and 92 million years (Ma), respectively (Janssen and Bremer, 2004) and by the estimate for the divergence of Milligania from remaining astelioid genera at 79 Ma (Wikström et al., 2001). Neither study sampled Asteliaceae comprehensively. Therefore, these estimates can only be taken as a first approximation. The estimated age of the family dictates that the most likely explanation for its current distribution is vicariance, following the path of the separating continents. Later movements across the Pacific no doubt involved long-distance overwater dispersal, but little is known about the pathways of such dispersal events. Fossil records document the presence of Asteliaceae since the mid-Tertiary. The earliest fossil record is that of Astelia pollen from Southland, New Zealand in deposits dated to the mid-Oligocene (Couper, 1960). Macrofossils, including leaf cuticle bearing trichomes, also document the presence of Astelia in Central Otago, New Zealand in the late Miocene (Maciunas et al., 2011; Mildenhall and Pocknall, 1989; Pole, 2007). Astelia is not recorded in the Australian fossil record until either the Late Pliocene (MacPhail et al., 1993) or the Quaternary (MacPhail et al., 1994). A single fossil pollen grain, which may belong to Asteliaceae, is recorded from deposits dated as Oligocene to Pliocene from West Point Island in the Falkland Islands. This fossil pollen datum, considered either as ‘‘Astelia-type’’ (Birnie and Roberts, 1986) or ‘‘Monosulcites sp. A.’’ (MacPhail and Cantrill, 2006), may indicate a Tertiary presence of Astelia in South America. This study reconstructed the Asteliaceae molecular phylogeny with comprehensive taxonomic and geographic sampling based on chloroplast and nuclear DNA sequence data. The phylogeny was used to establish monophyletic groups, referable to genera, to date the divergence times of major Asteliaceae clades, and to compare these divergence dates with the timing of major events in the geologic history of the southern hemisphere. 103 2. Methods 2.1. Taxon sampling Forty-six Asteliaceae taxa, including all Astelia taxa (26 species, 4 subspecies, and 7 morphotypes), all Collospermum species (4), the single Neoastelia species, and 4 of the 5 Milligania species were included in this study. Taxa sampled and their distributions are provided in Table 1. Voucher specimen data are provided in Appendix 1. Multiple representatives of Astelia menziesiana, A. nervosa, and A. graminea were included as there is considerable morphological diversity within these species that has resulted in morphotypes being informally recognized (Courtney pers. commo., Moore, 1966; Skottsberg, 1934a, 1934b; Wagner et al., 1999). Outgroup taxa were selected from the Amaryllidaceae, Hypoxidaceae, and Xanthorrhoeaceae in the Asparagales. 2.2. DNA extraction, amplification, and sequencing Total genomic DNA was extracted from fresh and silica preserved samples using Qiagen DNeasy Plant Mini Kits and from herbarium specimens using QIAamp DNA stool minikit (Qiagen, Valencia, California, USA) according to the manufacturer’s protocols scaled down for the smaller volume of leaf material. Sequence data were generated from four chloroplast regions (trnL intron, petL–psbE, psbA–trnH, and rps16–trnK intergenic spacers) (Shaw et al., 2005, 2007) and one nuclear marker (the third intron in the nitrate reductase gene, NIA-i3) (Howarth and Baum, 2002). The primers and protocols used for amplification are provided in Table 2. Astelia-specific primers were constructed for amplification of the petL–psbE (psbE2) and rps16–trnK (rps16.2) regions based on preliminary data obtained using standard primers for each region (Shaw et al., 2005, 2007). Cloned product was amplified using the manufacturer’s M13 primers (Promega, Madison, Wisconsin). PCR amplification of 25 ll reaction volumes included: 2.5 ll of 10 Bioline (NH4) reaction buffer, 2.50 mM of each dNTP, 1.5 mM of Bioline MgCl2, 1.0 mM of each primer, 3.0–5.0 units/ 1.0 ll of Taq DNA polymerase, and 10–100 ng of template DNA. Biolase Red Taq DNA polymerase (Bioline USA Inc, Boston, Massachusetts, USA) was used for amplification of the trnL, psbA–trnH, and NIA-i3 regions and Biolase Accuzyme Taq polymerase was used for amplification of the petL–psbE and rps16–trnK regions. PCR amplifications were carried out on an MJ Research DNA Engine Dyad PTC 220 Thermocycler (MJ Research Inc., Waltham, Massachusetts, USA). Reaction products were cleaned with 2 units of Exonuclease I and 0.4 units of Shrimp Alkaline Phosphatase per 1.0 ll of DNA (USB, Santa Clara, California, USA) prior to sequencing. Bidirectional sequence data were generated for chloroplast markers directly from amplified product using a 10 dilution of the original amplification primers. All regions were sequenced for all taxa with the exception of the petL–psbE region for Hypoxidia sp. (Hypoxidaceae), for which sequence could not be obtained. NIA-i3 sequence data were obtained for a total of 33 Asteliaceae taxa including Neoastelia, all Milligania, and all taxa in Astelia subg. Asteliopsis and Astelia sect. Periastelia (Figs. 1 and 2). These data were obtained indirectly from cloned product for 12 taxa (A. australiana, A. graminea, A. graminea ‘‘Dun,’’ A. grandis, A. menziesiana ‘‘fallax,’’ A. menziesiana ‘‘veratroides,’’ A. nervosa ‘‘bronze,’’ A. nervosa ‘‘silver’’, A. nervosa ‘‘north,’’ A. nivicola var. moriceae, Astelia petriei, and A. skottsbergii) for which high quality data could not be obtained through direct sequencing of amplified products. Cloning was conducted with the pGEM-T Easy Vector System as per the manufacturer’s protocols (Promega, Madison, Wisconsin, USA). At least five and Author's personal copy 104 J.L. Birch et al. / Molecular Phylogenetics and Evolution 65 (2012) 102–115 Table 1 Summary of current Astelia and Collospermum taxonomy (Skottsberg, 1934a, 1934b; Moore, 1966; Wagner et al., 1999) and the geographic distributions of taxa. Genus/subgenus Section Species/subspecies/morphotype Geographic distribution Asteliaceae Astelia Banks & Soland. ex R. Br. Astelia Palaeastelia A. hemichrysa (Lam.) Kunth Mascarene Islands: Reunion Asteliella A. A. A. A. A. A. A. A. A. Desmoneuron Astelia Banks & Soland. ex R. Br. Asteliopsis Isoneuron Micrastelia Periastelia Astelia Banks & Soland. ex R. Br. Tricella alpina R. Br. var. alpina alpina var. novae hollandiae Skottsb. linearis Hook. f. var. linearis linearis var. novae zelandiae Skottsb. papuana Skottsb. subulata (Hook. f.) Cheeseman nadeaudii Drake & F. Br. solandri A. Cunn. trinervia Kirk. A. banksii A. Cunn. A. A. A. A. A. A. A. A. A. A. Australia: Tasmania Australia: NSW, Victoria New Zealand: South, Stewart, Auckland New Zealand: North, South Papua New Guinea New Zealand: South, Stewart, Auckland, Campbell Society Islands: Tahiti New Zealand: North, South New Zealand: North, South New Zealand: North neocaledonica Schltr. pumila (G. Forst.) Gaudich. argyrocoma A. Heller ex Skottsb. menziesiana Sm. ‘‘fallax’’ menziesiana Sm. ‘‘forbesii’’ menziesiana Sm. ‘‘menziesiana’’ menziesiana Sm. ‘‘veratroides’’ waialealae Wawra rapensis Skottsb. tovii F. Br. New Caledonia Argentina, Chile, Falkland Islands Hawai‘i: Kaua‘i Hawai‘i: Maui, Moloka‘i Hawai‘i: Maui, Moloka‘i, Lāna‘i Hawai‘i: Hawai‘i Hawai‘i: O‘ahu, Kaua‘i Hawai‘i: Kaua‘i Austral Islands: Rapa Marquesas Islands: Ua Pou, Nuku Hiva A. australiana (J. H. Willis) L. B. Moore Australia: Victoria A. chathamica (Skottsb.) L. B. Moore A. fragrans Colenso A. graminea L. B. Moore A. graminea ‘‘Dun’’ A. grandis Hook. f. ex Kirk A. nivicola Cockayne ex Cheeseman var. nivicola A. nivicola var. moriceae L. B. Moore A. nervosa Hook. f. A. nervosa Hook. f. ‘‘bronze’’ A. nervosa Hook. f. ‘‘north’’ A. nervosa Hook. f. ‘‘Stokes’’ A. petriei Cockayne A. psychrocharis F. Muell. A. skottsbergii L. B. Moore New New New New New New Collospermum Skottsb. C. hastatum (Colenso) Skottsb. C. microspermum (Colenso) Skottsb. C. montanum (Seem.) Skottsb. New Zealand: North, South New Zealand: North Fiji: Viti Levu, Vanua Levu, Kandavu. Vanuatu: Espiritu Santo, Tanna, Aneityum Samoa: Upolu, Savaii Milligania J. D. Hook. M. densiflora J. D. Hook. M. johnstonii F. Muell. ex Benth. M. lindoniana Rodway ex Curtis M. stylosa (F. Muell. ex J. D. Hook.) F. Muell. ex Benth. Australia: Australia: Australia: Australia: Neoastelia J. Williams N. spectablis J. Williams Australia: New South Wales Hypoxis hirsuta (L.) Coville Hypoxis hygrometrica Labill. subsp. hygrometrica Curculigo capitulata (Lour.) Kuntze Hypoxidia sp. Crinum asiaticum L Bulbinella hookeri (Hook.) Cheeseman Dianella sandwicensis Hook. & Arnott South eastern Canada and eastern United States Australia: New South Wales Tricella C. samoense Skottsb. Outgroups Hypoxidaceae Hypoxidaceae Hypoxidaceae Amaryllidaceae Xanthorrhoeaceae Xanthorrhoeaceae up to seven replicates per taxon with cloned products were sequenced, with the exception of A. menziesiana ‘‘veratroides,’’ A. nervosa ‘‘bronze’’ and A. nivicola var. moriceae, for which only three, two, and two replicates were obtained, respectively. NIA-i3 sequence data could not be obtained for taxa in Astelia subg. Astelia or Collospermum (Figs. 1 and 2). Sequence data from the NIA-i3 region was extremely variable and, therefore, difficult to align between distantly related clades. Therefore, it was considered Zealand: Zealand: Zealand: Zealand: Zealand: Zealand: Chatham North, South, Stewart South South North, South South New Zealand: South New Zealand: North, South, Stewart New Zealand: North, South New Zealand: North New Zealand: South New Zealand: South Australia: New South Wales New Zealand: South Tasmania Tasmania Tasmania Tasmania Asia Seychelles Southeast Asia New Zealand Hawai‘i inappropriate for resolution of families and sequence data were not generated for outgroup taxa. Sequence data were generated using an ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (PE Biosystems, Foster City, CA) at the Advanced Studies in Genomics, Proteomics, and Bioinformatics facility at the University of Hawai‘i at Mānoa. Sequence fragments were edited in Sequencher 4.9 (Gene Codes Corporation, Ann Arbor, Michigan, USA) and manually aligned in Author's personal copy J.L. Birch et al. / Molecular Phylogenetics and Evolution 65 (2012) 102–115 105 Table 2 Genomic regions, primers, and protocols used for amplification and sequencing. Region Primer name Sequence (50 –30 ) Reference Amplification protocol Chloroplast trnL trnL50 UAAF (TabC) GGGGATAGAGGGACTTGAAC Taberlet et al. (1991) 94 °C (2 min), 35 (94 °C (2 min), 54 °C (1 min), 72 °C (2 min + 7 s/cycle)), 72 °C (7 min) psbA–trnH 3 trnL psbA CGAAATCGGTAGACGCTACG GTTATGCATGAACGTAATGCTC Sang et al. (1997) 95 °C (7 min), 35 (95 °C (30 s), 57 °C (30 s), 72 °C (1 min)), 72 °C (10 min) rps16–trnK trnH(GUG)F rps16x2F2 CGCGCATGGTGGATTCACAATCC CGCTCAACCTACAGGAACT Tate and Simpson (2003) Shaw et al. (2007) petL–psbE trnK(UUU)x1 rps16.2 petL TTAAAAGCCGAGTACTCTACC CGCTCAACCTACAGGAACT AGTAGAAAACCGAAATAACTAGTTA Designed for this study Shaw et al. (2007) psbE psbE2F TATCGAATACTGGTAATAATATCAGC AAGTGTGAATTAATGGGTTGGG Designed for this study NIA-i3F AARTAYTGGTGYTGGTGYTTYTGGTC Howarth and Baum (2002) 95 °C (2 min), 35 (95 °C (1 min), 63 °C (1.5 min 0.4 °C/cycle), 72 °C (2 min)), 72 °C (10 min) NIA-i3R GAACCARCARTTGTTCATCATDCC M13F GTTTTCCCAGTCACGAC pGEM-T easy vector protocols (Promega, Madison, Wisconsin) 94 °C (2 min), 35 (94 °C (2 min), 54 °C (1 min), 72 °C (2 min + 7s/cycle)), 72 °C (7 min). M13R CAGGAAACAGGTATGAC 0 Nuclear NIA-i3 UAA R (TabD) 80 °C (5 min), 35 (95 °C, (1 min), 54 °C (1 min), 72 °C (2 min)), 72 °C (4 min) 95 °C (7 min), 35 (95 °C (30 s), 56 °C (1 min), 68 °C (2 min)), 72 °C(7 min) Cloned insert Sequence Alignment Editor (Rambaut, 1996). For the NIA-i3 region extensive sequence variation made unambiguous alignment difficult. Alignment of this region was achieved by completing an initial alignment in MUSCLE (Edgar, 2004) of sequence data for taxa within clades, with assignment within clades identified from a preliminary reference phylogeny based on a maximum parsimony search of the chloroplast dataset. A second alignment step was completed to align sequence data for taxa among clades and was also completed in MUSCLE (Edgar, 2004). 2.3. Phylogenetic analyses Missing sequence was coded as ambiguous (N) if data for a region were not available or were incomplete. For taxa for which the NIA-i3 region was sequenced via cloning, the duplicate copies were combined using Sequencher 4.9 (Gene Codes Corporation, Ann Arbor, Michigan, USA) to form a consensus sequence. The sites that differed were coded using standard ambiguous base calls (Nomenclature Committee of the International Union of Biochemistry, 1985). Each marker was assessed for its contribution to phylogenetic resolution individually, in combination with other markers from the same genome (chloroplast), and as a combined dataset (chloroplast and nuclear). The incongruence length difference (ILD) test (Farris et al., 1995) implemented as the Partition Homogeneity Test in PAUP 4.0b10 (Swofford, 2002) was used to test compatibility of data partitions. Constant uninformative characters were excluded prior to the ILD test to reduce overestimation of incongruence (Cunningham, 1997; Lee, 2001). Fifty partition homogeneity replicates were performed based on the heuristic searches with 20 random taxon-addition sequences, tree bisection–reconstruction (TBR), and the MulTrees option on, swapping a maximum of 1000 trees to completion. Maximum parsimony (MP) analyses were performed in PAUP 4.0b10 (Swofford, 2002) on individual, combined chloroplast, and combined chloroplast and nuclear datasets. Parsimony heuristic searches were conducted using a two-step process. The first step included 1000 random taxon-addition sequence replicates using tree bisection–reconstruction (TBR) holding 10 trees per replicate, the second step used as the starting trees those obtained from the first step and completed 1000 random taxon-addition sequence replicates using tree bisection–reconstruction (TBR) with the MulTrees option on and swapping to completion for a maximum of 100,000 trees. Bootstrap analyses under the MP criterion were based on heuristic searches with 1000 bootstrap replicates each with 25 random taxon-addition sequences, tree bisection– reconstruction (TBR), and swapping to completion on all minimal length trees. Tree reconstruction using the maximum likelihood (ML) criterion was performed in RAxML (Zwickl, 2006). The best-fit models of molecular evolution and model parameters for separate and combined datasets (excluding gap characters) were determined using the corrected Akaike Information Criterion implemented in jModelTest (Guindon and Gascuel, 2003; Posada, 2008). Given that the bestfit models identified in jModelTest were not available in RAxML, the closest model available, GTR + C, was used. ML reconstructions were conducted on individual and combined datasets as documented for MP analyses. All free model parameters were estimated by RAxML. Nonparametric bootstrap values were calculated using the rapid bootstrap algorithm with 1000 replicates. Tree reconstruction using Bayesian inference (BI) criteria was conducted in MrBayes v3.1.2 (Huelsenbeck and Ronquist, 2001). Again, given that the bestfit models identified in jModelTest were not available in MrBayes, the closest model, GTR + C, was used. Six data partitions were specified for Bayesian searches with all parameters free to vary across each of the data partitions. Bayesian analyses were performed using Markov Chain Monte Carlo (MCMC) sampling with two replicates containing four chains (one hot and three cold chains) each with the heating temperature set to 0.10. Five million generations were completed with sampling every 1250 generations. A burn-in period of 1260 generations was estimated by calculating the average standard deviation of split frequencies and confirmed by plotting log likelihood values versus generation time to determine the point at which log likelihood values became stable. All trees generated during the burn-in period were discarded from each run and the remaining trees were combined to construct a 50% majority-rule consensus tree that was visualized in MEGA 4.2 (Tamura et al., 2007). Bayesian posterior probabilities were calculated to estimate internal branch support of phylogenetic reconstructions. The Shimodaira–Hasegawa (SH) test was applied in PAUP 4.0b10 (Swofford, 2002) to test the hypothesis that Astelia pumila is sister to Astelia subg. Asteliopsis. Constraint trees were generated Author's personal copy 106 J.L. Birch et al. / Molecular Phylogenetics and Evolution 65 (2012) 102–115 (B) A. menziesiana "fallax" A. menziesiana "menziesiana" A. menziesiana "veratroides" A. rapensis Subg. Asteliopsis sect. Periastelia A. argyrocoma A. waialealae A. menziesiana "forbesii" 66/- A. menziesiana "veratroides" A. tovii A. argyrocoma A. menziesiana "fallax" A. chathamica 63/ 66 A. fragrans 65/76 A. nivicola var. nivicola A. nervosa “silver” A. rapensis A. nervosa "north" A. grandis A. tovii A. graminea A. australiana 73/92 A. waialealae A. banksii Subg. Asteliopsis sect. Isoneuron A. neocaledonica A. australiana - / 100 89/97 93 73/92 A. nadeaudii A. solandri A. chathamica Subg. Astelia sect. Desmoneuron A. trinervia A. fragrans A. petriei A. skottsbergii A. graminea "Dun" A. nivicola var. moriceae 96/97 A. nervosa "Stokes" 65/65 A. graminea 0.97 A. graminea "Dun" A. grandis A. psychrocharis -/89 74/- Subg. Asteliopsis sect. Periastelia A. menziesiana "menziesiana" 1.00 A. nervosa "bronze" A. menziesiana "forbesii" 0.99 1.00 Milligania johnstonii A. nivicola var. moriceae Milligania densiflora Milligania 87/ - Milligania lindoniana 83/100 90 Neoastelia spectabilis Subg. Tricella A. nivicola var. nivicola Milligania stylosa Neoastelia -/0.99 -/89/94 A. nervosa “silver” A. nervosa "bronze” A. nervosa "Stokes" 1.00 A. nervosa "north" 1.00 A. petriei A. psychrocharis A. skottsbergii 99/86 98/100 1.00 1.00 74/71 Collospermum montanum 0.99 Collospermum samoense Collospermum Collospermum hastatum Collospermum microspermum 98/100 80/92 1.00 100/100 -/- 99/100 0.98 1.00 A. banksii Subg. Asteliopsis sect. Isoneuron 1.00 A. neocaledonica 64/73 A. nadeaudii 0.98 A. solandri Subg. Astelia sect. Desmoneuron A. trinervia A. pumila 1.00 Subg. Asteliopsis sect. Micrastelia A. linearis var. linearis 67/71 A. linearis var. novae- zelandiae 0.99 A. subulata -/66 A. alpina var. novae-hollandiae 0.89 -/68 100/100 1.00 0.93 -/67 100/100 - 1.00 A. alpina var. alpina A. alpina nov. var. A. hemichrysa 1 100/100 99/99 0.96 100/100 1.00 1.00 99/100 Milligania densiflora 1.00 Milligania johnstonii 99/100 Milligania lindoniana 1.00 100/100 1.00 Subg. Astelia sect. Palaeastelia Milligania Milligania stylosa Neoastelia spectabilis 100/100 Subg. Astelia sect. Astelia A. papuana Neoastelia Curculigo capitulata Hypoxidia sp. Hypoxidaceae 1.00 100/100 1.00 -/79 - (A) Hypoxis hirsuta Hypoxis hygrometrica Bulbinella hookeri Xanthorrhoeaceae Dianella sandwicensis Crinum asiaticum Amaryllidaceae Fig. 1. Bayesian inference 50% consensus topology based on (A) the chloroplast dataset and (B) the nuclear dataset. Numbers above branches are bootstrap values (maximum parsimony/maximum likelihood) and those below branches are Bayesian posterior probabilities. Bootstrap values >65% and posterior probabilities >0.90 are shown. Taxonomic treatment is that of Skottsberg (1934a). Author's personal copy 107 J.L. Birch et al. / Molecular Phylogenetics and Evolution 65 (2012) 102–115 A. waialealae (B) A. tovii A. rapensis A. menziesiana "fallax" Sect. Periastelia A. menziesiana "menziesiana" A. menziesiana "forbesii" A. menziesiana "veratroides" A. argyrocoma A. nervosa "north" A. nervosa "bronze" A. nervosa “silver” A. argyrocoma Subg. Tricella A. australiana A. chathamica A. fragrans A. graminea A. menziesiana "veratroides" Sect. Tricella A. graminea "Dun" A. grandis A. petriei A. menziesiana "fallax" 97/99 A. skottsbergii -/- A. nivicola var. moriceae 1.00 A. nervosa "Stokes" A. menziesiana "forbesii" Sect. Periastelia 1.00 A. psychrocharis A. menziesiana "menziesiana" A. nivicola var. nivicola Collospermum montanum Collospermum samoense Subg. Collospermum Collospermum hastatum A. rapensis Collospermum microspermum A. banksii A. tovii Sect. Isoneuron A. neocaledonica Subg. Asteliopsis A. nadeaudii Sect. Desmoneuron A. solandri A. waialealae A. trinervia Incertae sedis Sect. Micrastelia A. pumila A. linearis var. linearis - / 63 A. linearis var. novae-zelandiae A. nervosa “silver” A. subulata Sect. Astelia A. alpina var. novae-hollandiae - / 67 Subg. Astelia A. papuana 0.99 1.00 A. alpina nov. var. A. alpina var. alpina A. nervosa "bronze" A. nervosa "north" Sect. Palaeastelia A. hemichrysa Milligania densiflora Milligania johnstonii Milligania lindoniana Subg. Tricella s.l. A. australiana Milligania Milligania stylosa A. chathamica 97/100 Neoastelia spectabilis Hypoxidia sp. Curculigo capitulata 1.00 Hypoxidaceae Hypoxis hygrometrica Hypoxis hirsuta Bulbinella hookeri Dianella sandwicensis A. fragrans Xanthorrhoeaceae -/- A. graminea Amaryllidaceae 0.99 A. graminea "Dun" Crinum asiaticum 0.2 A. grandis Sect. Tricella A. petriei A. skottsbergii 90/93 1.00 A. nivicola var. moriceae -/- A. nervosa "Stokes" 0.90 A. psychrocharis A. nivicola var. nivicola 78/75 0.99 98/100 100/84 1.00 Collospermum montanum Collospermum samoense Subg. Collospermum 1.00 Collospermum hastatum Collospermum microspermum 99/100 1.00 81/90 98/100 1.00 100/100 -/80 99/99 0.99 1.00 1.00 A. banksii Sect. Isoneuron A. neocaledonica Subg. Asteliopsis s.s. A. nadeaudii A. solandri Sect. Desmoneuron A. trinervia A. pumila 1.00 Sect. Micrastelia Incertae sedis A. linearis var. linearis 66/ 65 A. linearis var. novae-zelandiae 0.99 A. subulata -/ 65 A. alpina var. novae-hollandiae 0.91 100/91 -/ - 0.96 0.95 Subg. Astelia s.s. A. alpina nov. var. 100/100 A. alpina var. alpina 1.00 A. hemichrysa 100/100 100/100 1.00 100/100 1.00 100/100 Milligania densiflora 1.00 Milligania johnstonii 1.00 100/92 1.00 Milligania lindoniana 1.00 1.00 Sect. Palaeastelia Milligania Milligania stylosa Neoaselia spectabilis 100/100 100/100 Sect. Astelia A. papuana Neoastelia Curculigo capitulata Hypoxidia sp. Hypoxidaceae 100/100 1.00 Hypoxis hirsuta Hypoxis hygrometrica Bulbinella hookeri Dianella sandwicensis Crinum asiaticum (A) Xanthorrhoeaceae Amaryllidaceae Fig. 2. Bayesian inference 50% consensus topology based on the combined (chloroplast and nuclear) dataset. Numbers above branches are bootstrap values (maximum parsimony/maximum likelihood) and those below branches are Bayesian posterior probabilities. Bootstrap values >65% and posterior probabilities >0.90 are shown. Inset is the phylogram of the Bayesian inference 50% consensus tree. Taxonomy reflects revisions proposed in the text. Author's personal copy 108 J.L. Birch et al. / Molecular Phylogenetics and Evolution 65 (2012) 102–115 in MacClade 4.07 (Maddison and Maddison, 2003) in which all relationships were unresolved with the exception of that at the node being tested. The constraint tree was compared with the optimal ML tree estimated by RAxML. Likelihood scores of the optimal and the constraint trees were generated with resampling-estimated log-likelihood (RELL) optimization on. Hypotheses were rejected if the log-likelihood score of the alternate tree topologies were significantly different (P-values <0.05) to that of the optimal ML tree. 2.4. Divergence time estimation The hypothesis of molecular clock-like evolution was tested using the likelihood ratio test (LRT) in PAUP 4.0b10 (Swofford, 2002) based on each individual marker, the chloroplast regions, and the combined chloroplast and nuclear datasets with a molecular clock enforced and unenforced. LRT resulted in P-values <0.05 for all tests (excluding that for the trnL region), indicating that a clock-like rate of evolution is not supported. Therefore, relaxed-clock methods were applied for determination of timing of cladogenesis. Two relaxed-clock methods were applied to investigate the effect of rate evolution models and associated assumptions on divergence date estimation in Asteliaceae. The first, the penalized likelihood (PL) method was applied in r8s (Sanderson, 2002). This method uses a parametric model and incorporates an optimality criterion that introduces a penalty for rapid rate change between adjacent sites. Divergence time estimates were calculated using the phylogeny inferred from the ML search of the combined chloroplast and nuclear data sets. The optimality criterion was estimated using the cross-validation method in r8s (Sanderson, 2004). Rate variation among sites was modeled using the gamma distribution with a shape parameter value of 0.4070 as estimated by jModelTest (Posada, 2008). Multiple starts using different initial starting conditions were used to assess convergence on the global, rather than local, optimum. Ninety-five percent confidence limits for divergence times were calculated in the following way: One hundred bootstrap alignment replicates were generated in Seqgen 1.3.2 (Powell and Vander Kloet, 1997) and branch length was estimated for all replicates based on the optimal ML topology in PAUP 4.0b10 (Swofford, 2002). Node ages were estimated for all replicates in r8s and from these 95% confidence intervals were calculated in Microsoft Excel. The second method for estimation of divergence time uses Bayesian Markov chain Monte Carlo analyses applying a relaxed molecular clock with uncorrelated rates with a log-normal distribution (UCLN). This method was applied in BEAST ver. 1.6.1 (Drummond and Rambaut, 2007). A Yule speciation tree prior, which assumes a constant rate of speciation per lineage, was specified. As the most appropriate model selected for the combined chloroplast and nuclear dataset by jModelTest (Posada, 2008) (Table 3) was not available in BEAST the next closest model, GTR + C, was applied. All parameters were estimated in BEAST. Two independent MCMC analyses of 10 million generations were performed with sampling every 1000 generations. One thousand trees generated during the burn-in period were discarded from each run and the remaining trees were combined using LogCombiner ver. 1.6.1. Parameters were checked using Tracer ver. 1.6.1. An effective sample size of >150 was obtained for all estimated parameters, to ensure parameter space was sampled sufficiently for valid parameter estimation (Drummond and Rambaut, 2007). In PL analyses the divergence of Asteliaceae from the Hypoxidaceae was fixed at 79 Ma (stem lineage) and in Bayesian analyses Asteliaceae (crown lineage) was given a normal prior constrained with a mean of 79.0 Ma (SD ± 6 Ma) based on divergence time estimates of Wikström et al. (2001). The fossil record, including microfossils (Couper, 1960) and macrofossils (Mildenhall and Pocknall, 1989; Pole, 2007), documents the presence of Astelia pollen in New Zealand during the Oligocene. Based on these fossil records a date of 26 million years was used as a minimum constraint for the clade containing all Astelia and Collospermum taxa. An alternative placement at the node of Astelia subg. Astelia sect. Astelia, based on the affiliation of the recently described macrofossil Astelia antiquua Maciunas et al. (2011) was considered, however, support for the affiliation of this macrofossil is undermined by lack of resolution in the phylogeny. Therefore a more conservative placement at the node representing the most recent common ancestor for Astelia and Collospermum was used. In PL analyses a minimum age constraint of 26.0 Ma was applied to the crown node of the clade containing all Astelia and Collospermum taxa. In Bayesian (UCLN) analyses a prior of 26.0 Ma was applied to the crown node of the clade containing all Astelia and Collospermum taxa with a log-normal distribution (mean = 1, standard deviation = 1.5, offset = 25.0) representing a hard lower bound of 25.0 Ma and a soft upper bound (95% HPD: 25.1–36.8 Ma). 3. Results 3.1. Sequence characteristics and tree topologies The number of aligned characters, percent missing data, number of gap characters for each of the five regions and for all datasets, and tree statistics for parsimony and best-fit models of molecular evolution are presented in Table 3. Thirty-three unambiguously aligned indels were also identified in the chloroplast sequences and were treated as separate characters for phylogeny reconstruction when the datasets were combined. Of these, nine (27.3%) were informative for Hypoxidaceae, 20 (60.6%) were informative for Asteliaceae, and 4 (12.1%) were shared across multiple Table 3 Summary of individual and combined matrix partition statistics, maximum parsimony tree statistics, and models of sequence evolution for individual and combined datasets as selected using the corrected AIC criterion in jModeltest (Posada, 2008). a b Marker trnL psbA–trnH rps16–trnK petL–psbE Chloroplast NIA-i3 Combined Number of terminals Number of aligned characters Missing data (%) Number of trees (MPa) Tree length (MPa) Number of PICsb CI RI RCI Number of gap characters Model of evolution 53 634 0.40 7470 165 53 0.89 0.90 0.80 5 HKY + C 53 711 0.10 9470 161 52 0.80 0.81 0.64 2 TVM + I + C 53 885 2.20 9980 556 181 0.84 0.88 0.74 9 TVM + C 52 1182 3.00 2517 491 142 0.90 0.92 0.83 17 TVM + C 53 3412 1.60 9990 1275 457 0.85 0.89 0.75 33 TPM1uf + C 33 786 14.50 10,000 489 221 0.91 0.94 0.85 n/a TrN + C 53 4198 10.60 10,000 1726 649 0.86 0.90 0.78 33 TIM1 + I + C Maximum parsimony searches. Parsimony informative characters. Author's personal copy J.L. Birch et al. / Molecular Phylogenetics and Evolution 65 (2012) 102–115 non-monophyletic clades or were autapomorphic. Of the twenty Asteliaceae indels, four (12.1%) were present in all Asteliaceae, two (6.1%) were present in all Milligania taxa, one (3.0%) was shared by M. densifolia and M. johnstonii, one (3.0%) was present in the clade containing Milligania and Neoastelia, three (9.1%) were present in all Astelia s.l. taxa, five (15.2%) and three (9.1%) were informative at the subgeneric and sectional ranks, respectively, and one (12.5%) was present in all A. nervosa taxa. ILD tests, comparing length differences between paired regions, indicated that all chloroplast DNA regions were congruent (P > 0.05) with the exception of psbA–trnH when paired with other regions (P = 0.01–0.03). The psbA–trnH region contained an 8-bp microinversion that appeared to contribute to this incongruence. No incongruence (P > 0.05) was detected in paired ILD tests for psbA–trnH with any other region when this motif was excluded. Therefore, it was excluded from all datasets and congruent regions were concatenated for subsequent analyses. Tree topologies inferred from parsimony, maximum likelihood, and Bayesian searches of the combined dataset were strongly congruent identifying nine well-supported major clades. The Bayesian inference 50% consensus topology based on the chloroplast dataset (Fig. 1A), the nuclear dataset (Fig. 1B), and the combined chloroplast and nuclear datasets (Fig. 2A and B) are presented. Individual chloroplast markers showed limited resolution and are not shown, but are mentioned in the text if supported clades differed from those obtained in searches based on the chloroplast and combined datasets. 3.2. Phylogenetic relationships within Asteliaceae Astelia is paraphyletic in all searches based on all datasets as Collospermum is always nested within it (Figs. 1 and 2). The clade containing all Astelia and Collospermum taxa, referred to here as Astelia s.l., is monophyletic. Milligania was monophyletic and Neoastelia was sister to Milligania in all searches based on the chloroplast and combined datasets (Figs. 1 and 2). None of the Astelia s.l. subgenera Astelia, Asteliopsis, or Tricella (Skottsberg, 1934b) were recovered as monophyletic in searches based on the chloroplast and combined datasets (Fig. 1). Within Astelia s.l. the four clades that correspond to recircumscribed subgenera will be discussed (and are referred to by their revised subgeneric names). The first clade, subg. Astelia s.s. (Fig. 2), includes all sections previously placed in subg. Astelia (sections Astelia and Palaeastelia), with the exception of section Desmoneuron. The second major clade, Asteliopsis s.s. includes section Isoneuron (previously included in subg. Asteliopsis), and subgenus Astelia sect. Desmoneuron. The sister relationship of sect. Micrastelia and subg. Asteliopsis s.s. received strong support in BI searches. However, this relationship received weak support in MP and ML searches of the chloroplast and combined chloroplast and nuclear datasets (Figs. 1 and 2). In ML searches sect. Micrastelia was frequently recovered as sister to the clade containing subg. Tricella, subg. Asteliopsis sect. Periastelia, and Collospermum (topology not shown). Log-likelihood support for the latter placement was significantly different (P < 0.01) to that of the former placement in a Shimodaira–Hasegawa test. All species previously placed in Collospermum form a clade, recognized here as subg. Collospermum. That clade is sister to a clade referred to as subg. Tricella s.l., a well supported clade containing all taxa from subg. Tricella as well as taxa in subg. Asteliopsis sect. Periastelia (Fig. 2). Relationships within subg. Tricella s.l. are poorly resolved and differ among MP, ML, and BI searches. 3.3. Dating estimates The divergence time estimates calculated using penalized likelihood (PL) and Bayesian (BI) methods are presented in Table 4. The chronogram derived from the BI analysis is presented in 109 Fig. 3. Divergence date estimates obtained from PL and BI analyses were congruent, with the PL estimates within the BI 95% highest posterior densities (HPD) for all clades with the exception of subg. Tricella s.l., which diverged 0.1 Ma earlier than that interval. In both PL and BI analyses the most recent common ancestor (MRCA) of Astelia s.l. diverged at the Eocene/Oligocene boundary (Table 4; 33.4–34.2 Ma). The divergence of the clade containing Astelia s.l. subg. Asteliopsis s.s., sect. Micrastelia, subg. Tricella s.l., and subg. Collospermum and the subg. Astelia s.s. clade occurred during the Early Oligocene (Table 4; 29.1–30.4 Ma). The MRCA of the clade containing Astelia s.l. subg. Asteliopsis s.s. and sect. Micrastelia also diverged around the Oligocene/Miocene boundary (Table 4; 21.6– 24.0Ma). The MRCA of Neoastelia and Milligania, and Astelia s.l. subg. Astelia s.s., diverged during the Miocene (7.6–21.3 Ma). Milligania and Astelia subgenera Collospermum and Tricella s.l. radiated during the Late Miocene/Early Pliocene (3.9–9.6 Ma). 4. Discussion 4.1. Phylogenetic relationships within Asteliaceae Asteliaceae is supported as monophyletic in these analyses. However, the limited taxonomic sampling of closely related Astelioid families precludes definitive determination of the monophyly of Asteliaceae. Within Asteliaceae, Astelia s.l. is sister to a Milligania/Neoastelia clade. Milligania and Neoastelia are strongly supported as sister (Figs. 1 and 2). Milligania was considered to be divergent from other Asteliaceae genera due to its semi-inferior ovary and dry fruit (Rudall, 2003), which differ from the superior ovaries and fleshy fruit of all other genera. However, ovary position has been recognized as homoplasious for Asparagales (Rudall, 2003) and lability in fruit type is also documented across the monocotyledons (Givnish et al., 2006). While these characters are synapomorphic for Asteliaceae genera (data not shown) these characters are not informative for determining generic relationships. Milligania is monophyletic in all reconstructions. A sister relationship of Milligania and Neoastelia was also identified by Maciunas et al. (2011) in a phylogenetic study based on morphological data. A broadly circumscribed Astelia s.l., including Collospermum, is monophyletic. Astelia s.l. taxa are dioecious or gynodioecious with flowers that have a pistillode or pistil with a single short or poorly defined style, a 3-lobed stigma, and fleshy unilocular or trilocular fruit. The inclusion of Collospermum within Astelia s.l. is consistent with the close evolutionary relationship recognized for these genera in previous studies. Successful crosses were achieved between A. nervosa C. hastatum, A. nervosa C. microspermum, and A. banksii C. hastatum (Moore, 1980) and as a result Moore (1980, p. 37) stated that the segregation of Collospermum should be reconsidered. Multiple New Zealand Astelia s.s. and Collospermum species share a chromosome number of n = 35 (Wheeler, 1966). There are differences, as previously noted, and here we recognize Collospermum at the subgeneric rank within Astelia s.l.. Synapomorphies recognized for Collospermum (Skottsberg, 1934b) remain valid for subg. Collospermum. These include peltate branched hairs (in contrast to the hairs of Astelia that are attached to the leaf surface by a basal stalk), basifixed anthers (in contrast to the versatile anthers of Astelia), and mucilaginous funicular hairs that adhere closely to the seeds (in contrast to the mucilaginous funicular hairs that surround but do not adhere to Astelia seeds). The two Pacific Collospermum taxa, C. montanum from Fiji and Vanuatu and C. samoense from Samoa, are sister taxa. The relationships of the New Zealand taxa, C. hastatum and C. microspermum, to each other and to the Pacific Collospermum taxa are unresolved in these analyses. Author's personal copy 110 J.L. Birch et al. / Molecular Phylogenetics and Evolution 65 (2012) 102–115 Table 4 Divergence date estimates for Astelia s.l. clades based on analyses of the combined dataset. PL analyses conducted in r8s with the astelioid ingroup fixed at 79 Ma (SD = 6.0 Ma) (Wikström et al., 2001) and a minimum age of 26 Ma for Astelia s.l. Bayesian UCLN analyses conducted in BEAST with the Asteliaceae stem lineage assigned a prior with a normal distribution (l = 79.0 Ma, SD = 6.0 Ma, 95% HPD 69.1–88.9 Ma) (Wikström et al., 2001) and the Astelia s.l. stem lineage assigned a prior with a log-normal distribution (l = 1.0, SD = 1.5, offset = 25.0, 25.0 Ma hard lower bound, soft lower bound at 1, 95% HPD 25.1–36.8 Ma). Taxon/clade name Asteliaceae Neoastelia Milligania Astelia s.l. Subg. Astelia s.s. Subg. Asteliopsis s.s./sect. Micrastelia Subg. Asteliopsis s.s./sect. Micrastelia/subg. Collospermum/subg. Tricella s.l. Subg. Collospermum/subg. Tricella s.l. Subg. Collospermum Subg. Tricella s.l. Sect. Periastelia a b Date estimatesa (million years (Ma)) Penalized likelihood (PL) Bayesian (UCLN) 69.4b (65.2–71.2) 16.5 (14.2–17.4) 3.9 (3.1–4.6) 33.4 (28.9–34.4) 7.6 (5.8–8.1) 21.6 (18.4–22.4) 29.1 (24.9–30.0) 12.1 (9.8–12.9) 4.0 (2.6–4.7) 4.3 (3.3–4.3) 2.5 (1.8–2.7) 55.4 (36.0–76.0) 21.3 (8.2–37.7) 8.9 (2.6–17.5) 34.2 (26.0–49.1) 12.6 (3.8–24.1) 24.0 (14.0–36.5) 30.4 (19.2–44.6) 16.9 (7.6–27.5) 7.6 (1.8–14.7) 9.6 (4.4–16.1) 3.9 (1.5–6.9) Asteliaceae (stem lineage) constrained to 79 Ma (as per Wikström et al., 2001). Node age fixed. Our results show that taxonomic recircumscription is also required to achieve monophyly of infrageneric taxa within Astelia s.l.. Subgenus Astelia s.l. includes sections Palaeastelia and Asteliella, but excludes sect. Desmoneuron. Skottsberg (1934b) considered a unilocular ovary to be synapomorphic for subg. Astelia, therefore he included section Desmoneuron in it. However, these results indicate an alternate placement of section Desmoneuron in subgenus Asteliopsis. Subgenus Astelia is supported by two synapomorphies: yellow staminate flowers and seeds possessing a long, curved funicle. Ovary division is homoplasious in Astelia s.l., as it is across Asparagales (Rudall, 2003), with multiple transitions from the plesiomorphic trilocular to a unilocular state. A monophyletic subgenus Asteliopsis s.s. is recognized that includes sections Isoneuron, and subg. Astelia sect. Desmoneuron, but excludes sect. Periastelia. As recognized, synapomorphies for subg. Asteliopsis s.s. include inflorescences with long, lateral subpanicles (5.7–13.3 cm), staminate and pistillate flowers with a short perianth tube (0.2–1.1 mm), fruits containing numerous (on average 12–14) seeds, each with a thickened, ribbed funicle. The relationships of section Micrastelia are poorly resolved. Therefore the subgeneric placement of section Micrastelia is not possible and the section remains unplaced (incertae sedis). While sect. Micrastelia is well-supported as sister to subgenus Asteliopsis s.s. in MP and BA analyses, an alternate placement, sister to the clade containing Collospermum and subg. Tricella (including sect. Periastelia) is frequently recovered in ML analyses. Section Micrastelia contains a single taxon, A. pumila, which is a dominant component of Astelia moorland in Patagonia and the only Asteliaceae taxon found in South America. It is morphologically divergent from taxa in subg. Asteliopsis s.s. and is the only cushion forming taxon in a clade that otherwise contains epiphytic and terrestrial taxa found primarily in the understory in lowland to montane forests. The alternate placement indicated by ML analyses is only slightly more meaningful in light of morphology as A. pumila is morphologically quite different from taxa in that clade. However, it does share seed characters, including an oblong seed, smooth seed surface, and a short, truncate funicle with taxa in subg. Tricella s.l. Further data are required to confidently determine the placement of sect. Micrastelia. For Astelia s.l., small, mat or cushion forming species are found in multiple, widely spaced clades. Therefore, it is clear that multiple transitions from the plesiomorphic large, open-clustered habit to a small, mat or cushion forming state have occurred. The relationship of Collospermum and subgenus Tricella s.l. as sister taxa is supported by morphological data. These taxa share long tepal fusion in staminate and pistillate flowers and staminate flowers with an obpyriform pistillode. Growth on a terrestrial substrate is plesiomorphic in Astelia s.l. and a transition to ephiphytic growth has occurred multiple times during Astelia s.l. evolution including a single transition in the ancestral Collospermum lineage. Evolutionary relationships indicate that a monophyletic subgenus Tricella s.l. includes subg. Asteliopsis sect. Periastelia. Subgenus Tricella s.l. is morphologically well defined including taxa that have orange fruit and large fusiform seeds (>2.0 mm) with a short funicle. Within subgenus Tricella s.l. section Periastelia, which includes taxa from the Austral, Hawaiian, and Marquesas Islands, is monophyletic. All section Periastelia taxa have small (<0.5 mm) flowers with a short perianth tube (0.3–0.7 mm), short anthers (0.4– 1.1 mm), and large, elliptic–fusiform seeds (2.0–3.0 mm). Relationships among the remaining taxa in subg. Tricella s.l. remain poorly understood. However, all taxa in section Tricella have flowers of intermediate (0.4–7.0 mm) size with a long perianth tube (0.8– 4.0 mm), and large, ovoid–oblong seeds (>3.0 mm). 4.2. Molecular dating and historical biogeography Results indicate that Asteliaceae crown group radiated during the late Palaeocene (BA) (Fig. 3) or early Cretaceous (PL). The mean date for divergence of Asteliaceae at ca. 55.4 Ma as estimated using Bayesian inference is more recent than estimates for the family from previous studies (Janssen and Bremer, 2004; Wikström et al., 2001). This reflects, in part, topological differences in those studies, in which Asteliaceae diverge early in the astelioid clade, precluding direct comparison of these divergence dates. The Asteliaceae phylogeny presented here achieves comprehensive taxonomic sampling and relationships are generally well supported, providing a robust phylogeny for estimation of divergence dates for the family. Correct assignment of fossils for calibration of chronograms is essential for accurate date estimates (Near and Sanderson, 2004). The fossil data used in this study are the earliest unequivocally determined Astelia s.l. micro and macrofossils records and are from well characterized fossil deposits (Bannister et al., 2012; Couper, 1960; Maciunas et al., 2011; Mildenhall and Pocknall, 1989; Pole, 2007). The placement of the fossil at the Astelia s.l. crown node reflects the presence of Astelia synapomorphies including stomata with elongate-triangular subsidiary cells, unsculptured epidermal cells (Maciunas et al., 2011), and spinulose pollen grains (Cranwell, 1952). This represents a conservative placement that reflects the affiliation of these fossil data based on morphological characters as identified by Maciunas et al. (2011), rather than reflecting the more tentative relationships Author's personal copy 111 J.L. Birch et al. / Molecular Phylogenetics and Evolution 65 (2012) 102–115 A. menziesiana "fallax" A. menziesiana "menziesiana" A. menziesiana "forbesii" A. tovii NPAC/ EPAC A. waialealae A. rapensis A. menziesiana "veratroides" A. argyrocoma A. fragrans A. chathamica A. nervosa “silver” NZ Subg. Tricella s.l. A. nervosa "bronze" A. nervosa "north" A. australiana AUS A. petriei A. graminea A. skottsbergii A. grandis NZ A. nivicoa var. nivicola A. nervosa "Stokes" A. nivicola var. moriceae A. psychrocharis A. graminea "Dun" Collospermum montanum AUS NZ WPAC Collospermum samoense Collospermum hastatum Collospermum microspermum A. neocaledonica A. banksii A. nadeaudii c A. solandri A. trinervia A. pumila Subg. Collospermum NZ WPAC NZ NCAL Subg. Asteliopsis s.s. NZ SAM Incertae sedis A. linearis var. novae-zelandiae A. subulata NZ A. linearis var. linearis b A. alpina var. novae-hollandiae A. papuana A. alpina var. alpina AUS/ PNG Subg. Astelia s.s. A. alpina nov. var. A. hemichrysa a MASC Milligania johnstonii Milligania densiflora Milligania stylosa AUS Milligania Milligania lindoniana Neoastelia spectabilis Neoastelia Curculigo capitulata Hypoxidia sp. Hypoxis hirsuta Hypoxidaceae Hypoxis hygrometrica Creta Paleo 65 .0 54.8 Eo 33.7 Oligo 23.8 Mio Pl P 5.3 1.8 Fig. 3. Asteliaceae chronogram with divergence dates estimated for Asteliaceae crown node constrained at 92 Ma (±10 Ma) using Bayesian inference conducted in BEAST. Constraints applied at points: (a) the divergence of Asteliaceae (stem lineage), (b) the MRCA of Asteliaceae (crown group), and (c) the MRCA of Astelia s.l. (crown group). Bars indicate 95% height probability densities, dashed lines delimit the Oligocene. Geographic distributions are shown in the bar on the right: AUS = Australia, NCAL = New Caledonia, NZ = New Zealand, SAM = South America, WPAC = Fijian, Samoan, and Vanuatuan Islands, EPAC = Austral, Marquesas, and Society Islands, NPAC = Hawaiian Islands. Geological time scale is shown at the bottom: Cret = Cretaceous, Paleo = Palaeocene, Eo = Eocene, Oligo = Oligocene, Mio = Miocene, Pl = Pliocene, and P = Pleistocene. Geologic times are as per Berggren et al. (1995). Author's personal copy 112 J.L. Birch et al. / Molecular Phylogenetics and Evolution 65 (2012) 102–115 determined from their incompletely resolved phylogeny. In this study, the availability and incorporation of this internal fossil calibration allows correction for rate variation across the tree, potentially increasing accuracy of date estimates over previous studies that were calibrated at a single node. For divergence estimates based on Bayesian methods, calibration dates were drawn from probabilistic distributions and a hard (minimum) bound and a soft (maximum) bound was assigned to the Astelia s.l. fossil calibration, which allowed uncertainty to be incorporated into fossil date assignment (Ho, 2007; Yang and Rannala, 2006). The recent diverence dates for Asteliaceae taxa estimated in this study are based on a well resolved phylogeny constrained with well characterized Astelia s.l. fossil data. This study provides a temporal framework for the evolution of Asteliaceae genera for the first time. Astelia s.l. is the oldest genus in the family, estimated to have radiated close to the Eocene/Oligocene boundary. Within Astelia s.l. the clade containing Astelia s.l. subg. Asteliopsis s.s., Collospermum, and Tricella s.l. is also dated to the Eocene (Fig. 3 and Table 4). A Late Eocene/Early Oligocene origin for Astelia s.l. is consistent with the single report of a New Zealand fossil from the Eocene (MacPhail et al., 1993, Mildenhall pers. comm.) the documentation for which has been lost (Mildenhall pers. comm.). In contrast, radiation of the clade including the Australian endemic genera Neoastelia and Milligania occurred more recently during the Miocene with the divergence of Neoastelia at ca. 21.3 Ma and the radiation of the Milligania crown group at ca. 8.9 Ma (Table 4). Relationships predicted by a Gondwanan vicariant scenario reflect the sequence and timing of fragmentation of the Gondwanan continent. Therefore, a vicariant scenario predicts that extant Australian taxa will be sister to extant South American taxa in a clade sister to a clade containing extant New Zealand taxa. Additionally, a variance scenario requires that the divergence of New Zealand taxa/clades must predate the divergence of New Zealand from the Gondwanan landmass, which occurred around 80 Ma and that the divergence of Australian and South American clades/taxa must predate the separation of Australia from Antarctica, which was completed approximately 30 Ma (Coleman, 1980). The divergence of Astelia s.l. (a clade dominated in numbers by extant New Zealand taxa) from the Neoastelia/Milligania clade, (containing exclusively Australian extant taxa) is dated between the late Cretaceous and the late Palaeocene. This node, accompanied by very wide 95% HPD intervals in the Bayesian analysis (36.0–76.0 Ma), spans the divergence of New Zealand from the Gondwanan landmass. Therefore, a Gondwanan history for diversification of Asteliaceae genera cannot be ruled out. However, within Astelia s.l., neither branching sequence, nor date estimates are consistent with the predictions of a Gondwanan vicariant scenario. The radiation of Astelia s.l. from ca. 34.2 Ma, places all subsequent cladogenesis events well after the separation of New Zealand from Gondwana. Additionally, neither extant taxa from Australia nor from New Zealand are present in monophyletic clades. While it is recognized that divergence date estimates that are calibrated with fossil data, such as these, provide minimum date estimates, based on current data, the mean dates for the divergence of New Zealand, Australian, and South American clades/taxa would have to fall outside the 95% HPD values to be congruent with predictions based on vicariance scenarios. We consider that evolution within Astelia s.l. is more likely to be the result of long-distance dispersal. Date estimates for divergence of the basal Astelia s.l. nodes are relevant to the ongoing debate regarding the persistence of faunal and floral taxa in New Zealand during the Oligocene. New Zealand was a low lying land mass during this time and land area was significantly reduced as a result of extensive marine transgression between 23 and 27 Ma (Cooper and Cooper, 1995; Fleming, 1975). Astelia s.l. radiated from ca. 34.2 Ma onwards. Subsequently, the clade containing subgenera Collospermum and Tricella s.l. diverged from its sister clade containing subg. Asteliopsis and sect. Micrastelia, at ca. 30 Ma. Astelia s.l. subgenera Asteliopsis s.s. and Tricella s.l. are both dominated by extant New Zealand taxa. If cladogenesis at the basal Astelia s.l. nodes occurred in New Zealand, as is suggested by the distributions of extant taxa, these divergence dates imply that Astelia s.l. was present in New Zealand during the Oligocene. The presence of Astelia s.l. in New Zealand as early as the Oligocene is also supported by Astelia micro- and macrofossil records, which have been identified in Early Miocene to the Late Oligocene deposits from Southland, New Zealand (Maciunas et al., 2011; Mildenhall and Pocknall, 1989; Pole, 2007; Raine et al., 2008). The fossil record suggests that Astelia was found in sub-tropical to warmtemperate forest that was differentiated into canopy and understory strata (Maciunas et al., 2011; Mildenhall and Pocknall, 1989) in New Zealand during this time. In combination, fossil and molecular dating data suggest that Astelia s.l. was present in New Zealand during the period of the proposed Oligocene drowning making it one of only a few lineages for which data are consistent with such a scenario (Allwood et al., 2010; Knapp et al., 2007; Trewick and Morgan-Richards, 2005). An alternate scenario, that Astelia s.l. was present in Australia during the Early Oligocene and dispersed from there to New Zealand during the Late Oligocene/Miocene boundary, is also possible. While this scenario cannot be ruled out, it is considered less likely based on both these dating and fossil data. The divergence of the South American taxon, A. pumila, from an otherwise predominantly New Zealand clade is dated to ca. 24.0 Ma. This estimate indicates that Astelia s.l. may have been present in South America from as early as the Oligocene. This is congruent with a South American Liliales pollen datum in strata dated between the Oligocene to the Early Pliocene (in maximum age limits) and between the middle Miocene to the Early Pliocene (in best-fit estimates) (MacPhail and Cantrill, 2006). However, there is disagreement as to whether this record is of Asteliaceae. Birnie and Roberts (1986) determined it to be Astelia-type pollen, whereas MacPhail and Cantrill (2006) determined it only as ‘‘Monosulcites sp. A’’. Therefore, congruence of these results with palynological data awaits accurate determination of this pollen grain. The presence of Astelia pumila in South America is considered to be the result of long-distance dispersal from a New Zealand origin. A stepping-stone long-distance dispersal pathway from New Zealand to South American via Antarctica would have been available for long-distance dispersal during the Oligocene as coastal forests were present in Antarctica until the Miocene when cooling and extensive ice development eliminated coastal vegetation (Truswell, 1990). Multiple dispersals between New Zealand and Australia are inferred for Astelia s.l. as Australian taxa are widely separated in Astelia subgenera Astelia s.s. and Tricella s.l. In subgenus Astelia s.s. Australian taxa are basal and New Zealand taxa are in a nested clade suggesting a long-distance dispersal event from Australia to New Zealand. In contrast, in subgenus Tricella s.l. Australian taxa are nested in subg. Tricella sect. Tricella, which otherwise contains only New Zealand taxa, suggesting at least one long-distance dispersal from New Zealand to Australia. Both subgenera, Astelia s.s. and Tricella s.l., radiated during the Miocene (Fig. 3 and Table 4) and both are dominated by taxa from subalpine/alpine habitats. Despite its relatively recent origin, subg. Tricella s.l. contains more than half of the New Zealand Astelia s.l. taxa. The radiation of these clades coincides with the increasing availability of high elevation habitat in Australia and New Zealand as a result of climatic cooling and tectonic activity during the Miocene (Galloway and Kemp, 1981; Smith, 1982). High mountains were largely absent from Author's personal copy J.L. Birch et al. / Molecular Phylogenetics and Evolution 65 (2012) 102–115 southeastern Australia until the Middle to Upper Miocene (Galloway and Kemp, 1981; Smith, 1982) (although Ollier (1986) suggests the Kosciusko uplift may have occurred earlier). Tectonic activity commenced in New Zealand with the Kaikoura Orogeny in the Miocene (from 15 Ma) and reached a peak during the Pliocene (Ollier, 1986; Winkworth et al., 2005). The recent radiation of these taxa in New Zealand may have been facilitated by the availability of cool-temperate habitats as a result of the Pliocene mountain building in New Zealand. A recent origin and rapid radiation has also been proposed for other New Zealand alpine plant taxa (Lockhart et al., 2001; Meudt and Simpson, 2006; Wagstaff and Garnock-Jones, 1998; Winkworth et al., 2005). Milligania and Neoastelia are endemic to Tasmania and New South Wales, respectively. These genera are associated with wetter climates and habitats that typically provide good conditions for fossil preservation. However, neither genus is documented in the pollen record. The Australasian fossil record is sparse in many areas, particularly for monocotyledons (Herendeen and Crane, 1995). Additionally, neither genus is widespread in contemporary habitats. Rather, they typically have restricted distributions within which they are locally common. In light of the divergence dates estimated for these taxa, their absence in the pollen record may indicate similarly restricted distributions in the past. If contemporary habitats of extant taxa are indicative of historical habitats of ancestral taxa, suitable habitat would have been available during the time periods estimated for these radiations. Neoastelia spectabilis, is currently found in cool-temperate Nothofagus rainforest in northern New South Wales (Williams, 1987). Moist, closed rainforest vegetation dominated by Nothofagus persisted in southeastern Australia until the Middle Miocene (Nott and Owen, 1992). Extant Milligania species are now found on alluvial soils adjacent to lakes, on riparian cliffs in temperate rainforest, in cushion plant-dominated moorlands, and as part of alpine bog vegetation in southern and western Tasmania. In Tasmania lowland rainforests were present as early as the Early Oligocene (Hill, 2004) and a well-developed subalpine and alpine vegetation was present from the early Miocene (Hill and Gibson, 1989). 5. Conclusions This study, providing date estimates based on the Asteliaceae phylogeny with near complete taxonomic representation, is important for understanding southern hemisphere biogeography. We provide the first phylogeny resolving the relationships of Asteliaceae taxa and use this phylogeny to investigate the historical biogeography of the family. Although it is found across Australia, New Zealand, and South America, the genus Astelia s.l. is not Gondwanan. Its crown radiation diversified at the Eocene/Oligocene boundary and subgenera radiated during the Oligocene onwards. The timing of Astelia s.l. evolution presented here, alongside Astelia micro- and macro-fossil data, implies that Astelia s.l. was present in New Zealand during the Oligocene. Astelia s.l. is one of only a few taxa for which such a scenario is inferred. These results suggest that a portion of the New Zealand flora may be the result of an earlier phase of long-distance dispersal than has not previously been recognized. Molecular dating of additional putatively early Gondwanan lineages is necessary to identify other lineages that have undergone long-distance dispersal during the Eocene or Oligocene to more comprehensively understand the evolutionary history of the New Zealand flora. Acknowledgments The authors thank the following individuals and organizations for their support of this research. Access and collection permits 113 and field assistance were provided by the Arthur Rylah Institute for Environmental Research (Victoria, Australia), Auckland Regional Council (New Zealand), Department of Conservation (New Zealand), Department of Environment and Climate Change (New South Wales, Australia), Department of Land and Natural Resources (Hawai‘i, United States of America), Department of Primary Industries and Water (Tasmania, Australia), Department of Sustainability and Environment (Victoria, Australia), Hawai‘i Volcanoes National Park National Park (Ha(Hawai‘i, United States of America), Haleakala wai‘i, United States of America), O‘ahu Army Natural Resources (Hawai‘i, United States of America), O‘ahu Plant Extinction Program (Hawai‘i, United States of America), Maui Land and Pineapple (Hawai‘i, United States of America), The Nature Conservancy (Hawai‘i, United States of America). Silica-preserved material was kindly provided for inclusion of taxa in the phylogeny by Australian National Botanical Garden, Missouri Botanical Garden, Otari Native Botanic Garden, and individuals J.-Y. Meyer, T. Motley, D. Strasberg, and A. Whistler. Herbarium specimens were provided to the Joseph F. Rock Herbarium by the following herbaria: Auckland War Memorial Museum (AK), Herbarium Pacificum (BISH), Allan Herbarium (CHR), Harvard University (GH), Kew Royal Botanic Gardens (K), National Herbarium of Victoria (MEL), Missouri Botanical Garden (MO), Herbier National de Paris (P), United States National Herbarium (US), and Museum of New Zealand Te Papa Tongarewa (WELT). Funding for field work and sequencing was provided by the American Society of Plant Taxonomists, Explorers Club, National Science Foundation DDIG (DEB-0910402), Sigma-Xi, University of Hawai‘i Foundation and multiple affiliates of the University of Hawai‘i at Mānoa (UHM) including the Botany Department, Ecology, Evolution, and Conservation Biology Program, Graduate Division, Graduate Student Organization, and the Office of Community and Alumni Relations. This manuscript benefitted from comments of A. Sherwood, D. Lorence, and R. Cowie and two anonymous reviewers. Appendix A. Voucher specimen information (collector, collection number, collection location, collection date, herbarium) for taxa and GenBank accession numbers for DNA sequence data (trnL, psbA-trnH, 3’rps16-trnK, petL-psbE, NIA-i3) used in phylogenetic analysis. Missing data for a given region is listed as ‘‘-’’. A. alpina R. Br. var. alpina – Birch (JLB373), Australia, Tasmania, Mt. Field National Park, 8 Jan 2008 (BISH), JX182500, JX182553, JX182606, JX182659,-. A. alpina var. novae-hollandiae Skottsb. – Birch (JLB351), Australia, Victoria, Alpine National Park, 20 Dec 2008 (BISH), JX182501, JX182554, JX182607, JX182660,-. A. alpina nov. var. – Birch and Buchannan (JLB387), Australia, Tasmania, Southwest National Park, Mt. Eliza Plateau, 13 Jan 2009 (BISH), JX182502, JX182555, JX182608, JX182661,-. Astelia argyrocoma A. Heller ex Skottsb. – Birch, Lorence, and Wood (JLB137), Kauai, Awaawapuhi Trail, 12 Jun 2007 (BISH), JX182503, JX182556, JX182609, JX182662, JX182711. A. australiana (J. H. Willis) L. B. Moore – Birch and Downe, (JLB342), Australia, Victoria, Yarra State Park, 16 Dec 2008 (BISH), JX182504, JX182557, JX182610, JX182663, JX182712. A. banksii A. Cunn. – Birch (JLB228), New Zealand, Auckland, Waitakere Ranges, Piha Beach, 16 Dec 2007 (BISH), JX182505, JX182558, JX182611, JX182664, JX182713. A. chathamica (Skottsb.) L. B. Moore – Birch (JLB399) (cultivated), New Zealand, Waikanae Beach, 9 Jul 2011 (BISH), JX182506, JX182559, JX182612, JX182665, JX182714. A. fragrans Colenso – Birch and Brown (JLB243), New Zealand, Kahurangi National Park, Heaphy Track, 2 Jan 2008 (BISH), JX182507, JX182560, JX182613, JX182666, JX182715. A. graminea L. B. Moore – Birch, Courtney, and Gaskill (JLB257), New Zealand, Kahurangi National Park, Mt. Author's personal copy 114 J.L. Birch et al. / Molecular Phylogenetics and Evolution 65 (2012) 102–115 Arthur, 15 Jan 2008 (BISH), JX182508, JX182561, JX182614, JX182667, JX182716. A. graminea L. B. Moore ‘‘Dun’’ – Birch (JLB271), New Zealand, Mt. Richmond Forest Park, Dun Saddle, Maungatapu Track, 18 Jan 2008 (BISH), JX182509, JX182562, JX182615, JX182668, JX182717. A. grandis Hook. f. ex Kirk – Birch (JLB223), New Zealand, Hamilton, Puketaha Gully, 14 Dec 2007 (BISH), JX182510, JX182563, JX182616, JX182669, JX182718. A. hemichrysa (Lam.) Kunth – D. Strasberg (LR488), Mascarene Islands, Reunion Island, Col Bellevue, 15 Aug 2007 (REU), JX182511, JX182564, JX182617, JX182670,-. A. linearis Hook. f. var. linearis – Birch and Michel (JLB276), New Zealand, Southland, Longwood Range, Bald Hill, 22 Jan 2008 (BISH), JX182512, JX182565, JX182618, JX182671,-. A. linearis var. novae–zelandiae Skottsb. – Birch (JLB273), New Zealand, Paparoa Range, Croesus track, 19 Jan 2008 (BISH), JX182513, JX182566, JX182619, JX182672,-. A. menziesiana Sm. ‘‘fallax’’ – Birch and Bartlett (JLB157), Maui, Puu Kukui Watershed Preserve, 31 Aug 2007 (BISH), JX182514, JX182567, JX182620, JX182673, JX182719. A. menziesiana Sm. ‘‘forbesii’’ – Welton s.n., Maui, Haleakala National Park, 18 Mar 2009 (BISH), JX182515, JX182568, JX182621, JX182674, JX182720. A. menziesiana Sm. ‘‘menziesiana’’ – Birch and Gulizia (JLB107), Hawaii, Hilo Forest Reserve, Huumulu Trail, 10 Sept 2006 (BISH), JX182516, JX182569, JX182622, JX182675, JX182721. A. menziesiana Sm. ‘‘veratroides’’ – Birch (JLB058), Oahu, Mt Kaala, 21 Jun 2006 (BISH), JX182518, JX182571, JX182624, JX182677, JX182723. A. nadeaudii Drake & F. Br. – Yves-Meyer s.n., Society Islands, Tahiti, Mt. Aorai, 14 Dec 2006 (BISH), JX182519, JX182572, JX182625, JX182678, JX182724. A. neocaledonica Schltr. – Munzinger 595 and McPherson, New Caledonia, Province du Nord, 31 Mar 2001 (MO), JX182520, JX182573, JX182626, JX182679, JX182725. A. nervosa Hook. f. ‘‘silver’’ – Birch (JLB260), New Zealand, Kahurangi National Park, Mt. Arthur, 16 Jan 2008 (BISH), JX182522, JX182575, JX182628, JX182681, JX182727. A. nervosa Hook. f. ‘‘bronze’’ – Birch, Courtney, and Gaskill (JLB263), New Zealand, Kahurangi National Park, Mt. Arthur, 15 Jan 2008 (BISH), JX182522, JX182575, JX182628, JX182681, JX182727. A. nervosa Hook. f. ‘‘north’’ – Birch and Birch (JLB245), New Zealand, Tararua Forest Park, Mt. Holdsworth, 12 Jan 2008 (BISH), JX182524, JX182577, JX182630, JX182683, JX182729. A. nervosa Hook. f. ‘‘Stokes’’ – Birch and Little (JLB251), New Zealand, Marlborough Land District, Marlborough Sounds, Mt. Stokes, 14 Jan 2007 (BISH), JX182523, JX182576, JX182629, JX182682, JX182728. A. nivicola Cockayne ex Cheeseman var. nivicola – Birch, Courtney, and Gaskill (JLB256), New Zealand, Kahurangi National Park, Mt. Arthur, 15 Jan 2008 (BISH), JX182521, JX182574, JX182627, JX182680, JX182726. A. nivicola var. moriceae L. B. Moore – Birch and Brown (JLB233), New Zealand, Kahurangi National Park, Perry Saddle, 30 Dec 2007 (BISH), JX182517, JX182570, JX182623, JX182676, JX182722. A. papuana Skottsb. – Rudall 71 Papua New Guinea, 20 Mar 1999 (K), JX182526, JX182579, JX182632, JX182685,-. A. petriei Cockayne – Birch, Courtney, and Gaskill (JLB254), New Zealand, Kahurangi National Park, Mt. Arthur, 15 Jan 2008 (BISH), JX182527, JX182580, JX182633, JX182686, JX182731. A. psychrocharis F. Muell. – Birch and Beehag (JLB362), Australia, New South Wales, Kosciuszko National Park, Kosciuszko summit trail, 30 Dec 2008 (BISH), JX182528, JX182581, JX182634, JX182687, JX182732. A. pumila (G. Forst.) Gaudich. – Goodall (RNG2248), Argentina, Tierra del Fuego, 14 Nov 1969 (US), JX182529, JX182582, JX182635, JX182688,-. A. rapensis Skottsb. – Motley and Fenstemacher 2722, Austral Islands, Rapa Iti (NY), JX182530, JX182583, JX182636, JX182689, JX182733. A. skottsbergii L. B. Moore – Birch (JLB261), New Zealand, Kahurangi National Park, Mt. Arthur, 16 Jan 2008 (BISH), JX182531, JX182584, JX182637, JX182690, JX182734. A. solandri A. Cunn. – Birch and Birch (JLB250), New Zealand, Tararua Forest Park, Mt. Holdsworth, 12 Jan 2008 (BISH), JX182532, JX182585, JX182638, JX182691, JX182735. A. subulata (Hook. f.) Cheeseman – Birch and Blythal (JLB301), New Zealand, Rakiura National Park, Mt. Anglem, 26 Jan 2008 (BISH), JX182533, JX182586, JX182639, JX182692,-. A. tovii F. Br. – Wood (KRW10803), Marquesas Islands, Ua Pou, 2 Jul 2004 (PTBG), JX182534, JX182587, JX182640, JX182693, JX182736. A. trinervia Kirk – Birch and Brown (JLB242), New Zealand, Kahurangi National Park, Heaphy Track, 31 Dec 2007 (BISH), JX182535, JX182588, JX182641, JX182694, JX182737. A. waialealae Wawra – Perlman (SP20093), Hawaii, Kawai, Alakai Swamp, 27 Jul 2006 (PTBG), JX182536, JX182589, JX182642, JX182695, JX182738. Collospermum hastatum (Colenso) Skottsb. – JLB s.n. (cultivated), New Zealand, Waikanae Beach, 22 Jul 2007 (BISH), JX182538, JX182591, JX182644, JX182697,-. C. microspermum (Colenso) Skottsb. – Birch and Birch (JLB244), New Zealand, Tararua Forest Park, Mt. Holdsworth, 12 Jan 2008 (BISH), JX182539, JX182592, JX182645, JX182698,-. C. montanum (Seem.) Skottsb. – Cahation 2816, Vanuatu, Espiritu Santo, 17 Aug 1985 (BISH), JX182540, JX182593, JX182646, JX182699,-. C. samoense Skottsb. – Whistler (AW 12035), Samoan Islands, Upolu, 15 Oct 2008 (stored at HAW), JX182541, JX182594, JX182647, JX182700,-. Milligania densiflora J. D. Hook. – Birch and Jordan (JLB374), Australia, Tasmania, Mt. Hartz National Park, 8 Jan 2009 (BISH), JX182548, JX182601, JX182654, JX182706, JX182739. M. johnstonii F. Muell. ex Benth. – Croft 10119 and Richardson (cultivated), Australia, Tasmania, Southwest National Park, 17 Feb 1989 (CBG), JX182559, JX182602, JX182655, JX182707, JX182740. M. lindoniana Rodway ex Curtis – Birch (JLB371), Australia, Tasmania, Mt. Field National Park, 8 Jan 2009 (BISH), JX182550, JX182603, JX182656, JX182708, JX182741. M. stylosa (F. Muell. ex J. D. Hook.) F. Muell. ex Benth. – Birch (JLB 384), Australia, Tasmania, Mt. Field National Park, 12 Jan 2009 (BISH), JX182551, JX182604, JX182657, JX182709, JX182742. Neoastelia spectabilis J. Williams – Birch and Dwyer (JLB367), Australia, New South Wales, New England National Park, 4 Jan 2009 (BISH), JX182552, JX182605, JX182658, JX182710, JX182743. Bulbinella hookeri (Hook.) Cheeseman – Birch (JLB253), New Zealand, Marlborough Land District, Marlborough Sounds, Mt. Stokes, 14 Jan 2007 (BISH), JX182537, JX182590, JX182643, JX182696,-. Crinum asiaticum L. – Birch (JLB398) (cultivated), Hawaii, University of Hawaii at Manoa, East–West Road, 27 Apr 2011 (BISH), JX182542, JX182595, JX182648, JX182701,-. Curculigo Gaertn. capitulata (Lour.) Kuntze – Steele 1081 (cultivated), Missouri, University of Missouri Columbia, 29 Sep 2009 (UMO), JX182543, JX182596, JX182649, JX182702,-. Dianella sandwicensis Hook. & Arnott – Birch (JLB173), Hawaii, Kauai, Na Pali Kona Forest Reserve, 9 Sept 2007 (BISH), JX182544, JX182597, JX182650, JX182703,-. Hypoxidia F. Friedmann sp. – Chase (MW, 17,387), (K), Sri Lanka, Kitulgala, 14 Jan 2003 (BISH), JX182547, JX182600, JX182653,-,-. Hypoxis hirsuta (L.) Colville – Gibson s.n., Texas, Smithville, Stengl (Lost Pines) Biology Station, 13 Apr 2009 (BISH), JX182545, JX182598, JX182651, JX182704,-. H. hygrometrica Labill subsp. hygrometrica – Birch (JLB364), Australia, New South Wales, Tumut-Cooma Road, 1 Jan 2009 (BISH), JX182546, JX182599, JX182652, JX182705,-. References Allwood, J., Gleeson, D., Mayer, G., Daniels, S., Beggs, J.R., Buckley, T.R., 2010. Support for vicariant origins of the New Zealand Onychophora. J. Biogeogr. 37, 669–681. Bannister, J.M., Conran, J.G., Lee, D.E., 2012. Lauraceae from rainforest surrounding an early Miocene maar lake, Otago, southern New Zealand. Rev. Palaeobot. Palynol. 178, 13–34. Bayer, C., Appel, O., Rudall, P.J., 1998. Asteliaceae. In: Kubitzki, K., Huber, H. (Eds.), Flowering Plants, Monocotyledons: Lilianae (Except Orchidaceae). SpringerVerlag, Berlin, Germany, pp. 141–145. Berggren, W.A., Kent, D.V., Swisher, C.C.I., Aubry, M.-P., 1995. A revised Cenozoic geochronology and chronostratigraphy. In: Berggren, W.A., Kent, D.V., Aubry, M.-P., Hardenbol, J. (Eds.), Geochronology Time Scales and Global Stratigraphic Correlation, SEPM Special Publication, pp. 129–212. Author's personal copy J.L. Birch et al. / Molecular Phylogenetics and Evolution 65 (2012) 102–115 Birnie, J.F., Roberts, D.E., 1986. Evidence of tertiary forest in the Falkland Islands (Islas Malvinas). Palaeogeogr. Palaeoclimatol. Palaeoecol. 55, 45–53. Coleman, P.J., 1980. Plate tectonics background to biogeographic development in the southwest Pacific over the last 100 million years. Palaeogeogr. Palaeoclimatol. Palaeoecol. 31, 105–121. Cooper, A., Cooper, R.A., 1995. The Oligocene bottleneck and New Zealand biota: genetic record of a past environmental crisis. Proc. Roy. Soc. Lond. B. Biol. Sci. 261, 293–302. Couper, R.A., 1960. New Zealand Mesozoic and Cainozoic plant microfossils. N.Z. G.S. Pal. Bull. 49, 1–87. Cranwell, L.M., 1952. New Zealand Pollen Studies: the Monocotyledons A Comparative Account. Bulletin of the Auckland Institute and Museum 3. Cunningham, C.W., 1997. Can three incongruence tests predict when data should be combined? Mol. Biol. Evol. 14, 733–740. Drummond, A.J., Rambaut, A., 2007. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol. Biol. 7, 214. Edgar, R.C., 2004. Muscle: multiple sequence alignment with high accuracy and high throughput. Nucl. Acids Res. 32, 1792–1797. Farris, J.S., Kallersjo, M., Kluge, A.G., Bult, C., 1995. Constructing a significance test for incongruence. Syst. Bot. 44, 570–572. Fleming, C.A., 1975. The geological history of New Zealand and its biota. Biogeogr. Ecol. New Zealand 27, 1–86. Fosberg, F.R., 1948. Derivation of the flora of the Hawaiian Islands. In: Zimmerman, E.C. (Ed.), Insects of Hawai‘i: A Manual of the Insects of the Hawaiian Islands, Including an Enumeration of the Species and Notes on their Origin, Distribution, Hosts, Parasites, etc. University Press of Hawai‘i, Honolulu, pp. 107–119. Galloway, R.W., Kemp, E.M., 1981. Late Cainozoic environments in Australia. In: Keast, A. (Ed.), Ecological Biogeography of Australia. Dr. W. Junk bv Publishers, The Hague, The Netherlands, pp. 53–80. Givnish, T.J., Pires, J.C., Graham, S.W., McPherson, M.A., Prince, L.M., Patterson, T.B., Rai, H.S., Roalson, E.H., Evans, T.M., Hahn, W.J., Millam, K.C., Meerow, A.W., Molvray, M., Kores, P.J., O’Brien, H.E., Hall, J.C., Kress, W.J., Sytsma, K.J., 2006. Phylogenetic relationships of monocots based on the highly informative plastid gene ndhF: evidence for widespread concerted convergence. In: Travis, J.T. (Ed.), Monocots: Comparative Biology and Evolution (Excluding Poales). Rancho Santa Ana Botanic Garden, Claremont, California, pp. 28–51. Guindon, S., Gascuel, O., 2003. A simple, fast and accurate method to estimate large phylogenies by maximum-likelihood. Syst. Bot. 52, 696–704. Herendeen, P.S., Crane, P.R., 1995. The fossil history of the monocotyledons. In: Rudall, P.J., Cribb, P.J., Cutler, D.F., Humphries, C.J. (Eds.), Monocotyledons: Systematics and Evolution. Royal Botanic Gardens, Kew, London, pp. 1–21. Hill, R.S., 2004. Origins of the southeastern Australian vegetation. Philos. Trans. Roy. Soc. Lond. B. Biol. Sci. 359, 1537–1549. Hill, R.S., Gibson, N., 1989. Macrofossil evidence for the evolution of the alpine and subalpine vegetation of Tasmania. In: Barlow, B.A. (Ed.), Flora and Fauna of Alpine Australasia: Ages and Origins. Commonwealth Scientific and Industrial Research Organization, Canberra, pp. 205–217. Ho, S.Y.W., 2007. Calibrating molecular estimates of substitution rates and divergence times in birds. J. Avian Biol. 38, 409–414. Howarth, D.G., Baum, D.A., 2002. Phylogenetic utility of a nuclear intron from nitrate reductase for the study of closely related plant species. Mol. Phylogenet. Evol. 23, 525–528. Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 17, 754–755. Janssen, T., Bremer, K., 2004. The age of major monocot groups inferred from 800+ rbcL sequences. Bot. J. Linn. Soc. 146, 385–398. Knapp, M., Mudaliar, R., Havell, D., Wagstaff, S.J., Lockhart, P.J., 2007. The drowning of New Zealand and the problem of Agathis. Syst. Bot. 56, 862–870. Lee, M.S.Y., 2001. Uninformative characters and apparent conflict between molecules and morphology. Mol. Biol. Evol. 18, 676–680. Lockhart, P.J., McLenachan, P.A., Havell, D., Glenny, D., Huson, D., Jensen, U., 2001. Phylogeny, radiation, and transoceanic dispersal of New Zealand alpine buttercups: molecular evidence under split decomposition. Ann. Mol. Bot. Gard. 88, 458–477. Maciunas, E., Conran, J.G., Bannister, J.M., Paull, R., Lee, D.E., 2011. Micene Astelia (Asparagales: Asteliaceae) macrofossils from southern New Zealand. Aust. Syst. Bot. 24, 19–31. MacPhail, M.K., Alley, N.F., Truswell, E.M., Sluiter, I.R.K., 1994. Early Tertiary vegetation: evidence from spores and pollen. In: Hill, R.S. (Ed.), History of the Australian Vegetation: Cretaceous to Recent. Cambridge University Press, Cambridge, pp. 182–262. MacPhail, M.K., Cantrill, D.J., 2006. Age and implications of the Forest Bed, Falkland Islands, southwest Atlantic Ocean: evidence from fossil pollen and spores. Palaeogeogr. Palaeoclimatol. Palaeoecol. 240, 602–629. MacPhail, M.K., Jordan, G.J., Hill, R.S., 1993. Key periods in the evolution of the flora and vegetation in western Tasmania I. the Early–Middle Pleistocene. Aust. J. Bot. 41, 673–707. Maddison, D.R., Maddison, W.P., 2003. MacClade 4: Analysis of Phylogeny and Character Evolution. Sinauer Associates, Sunderland, Massachusetts, USA. Meudt, H., Simpson, B.B., 2006. The biogeography of the austral, subalpine genus Ourisia (Plantaginaceae) based on molecular phylogenetic evidence. South American origin and dispersal to New Zealand and Tasmania. Biol. J. Linn. Soc. Lond. 87, 479–513. Mildenhall, D.C., Pocknall, D.T., 1989. New Zealand geological survey. N.Z. G.S. Pal. Bull. 59, 128. Moore, L.B., 1966. Australasian asteliads (Liliaceae). N.Z. J. Bot. 4, 201–240. 115 Moore, L.B., 1980. Hybrid asteliads (Liliaceae). N.Z. J. Bot. 18, 37–42. Near, T.J., Sanderson, M.J., 2004. Assessing the quality of molecular divergence time estimates by fossil calibrations and fossil-based model selection. Philos. Trans. Roy. Soc. B 359, 1477–1483. Nomenclature Committee of the International Union of Biochemistry, 1985. Nomenclature for incompletely specified bases in nucleic acid sequences. Eur. J. Biochem. 150, 1–5. Nott, J.F., Owen, J.A.K., 1992. An Oligocene palynoflora from the middle Shoalhaven catchment New South Wales and the Tertiary evolution of flora and climate in the southeast Australian highlands. Palaeogeogr. Palaeoclimatol. Palaeoecol. 95, 135–151. Ollier, C.D., 1986. The origin of alpine landforms in Australasia. In: Barlow, B.A. (Ed.), Flora and Fauna of Alpine Australasia. CSIRO, Melbourne, Australia, pp. 3–26. Pole, M., 2007. Monocot macrofossils from the Miocene of southern New Zealand. Palaeontol. Electron. 10, 15A. Posada, D., 2008. JModelTest: phylogenetic model averaging. Mol. Biol. Evol. 25, 1253–1256. Powell, E.A., Vander Kloet, S.P., 1997. Foliar venation characteristics of Vaccinium sect. Macropelma and sect. Myrtillus (Ericaceae): a comparative analysis. Can. J. Bot. 75, 2015–2025. Raine, J. I., Mildenhall, D.C., Kennedy, E.M., 2008. New Zealand Fossil Spores and Pollen: An Illustrated Catalogue. Version 1, GNS Science, Lower Hutt. Rambaut, A.E., 1996. Se–Al: Sequence Alignment Editor. University of Oxford, Oxford, England. <http://evolve.zoo.ox.ac.uk/software/Se-Al>. Rudall, P.J., 2003. Unique floral structures and iterative evolutionary themes in Asparagales; insights from a morphological cladistic analysis. Bot. Rev. 68, 488– 509. Rudall, P.J., Chase, M.W., Cutler, D.F., Rusby, J., de Bruijn, A.Y., 1998. Anatomical and molecular systematics of Asteliaceae and Hypoxidaceae. Bot. J. Linn. Soc. 127, 1–42. Sanderson, M.J., 2002. Estimating absolute rates of molecular evolution and divergence times: a penalized likelihood approach. Mol. Biol. Evol. 10, 101–109. Sanderson, M.J., 2004. A nonparametric approach to estimating divergence times in the absence of rate constancy. Mol. Biol. Evol. 14, 1218–1231. Sang, T., Drawford, D.J., Stuessy, T.F., 1997. Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). Am. J. Bot. 84, 1120– 1136. Shaw, J., Lickey, E.B., Beck, J.T., Farmer, S.B., Liu, W., Miller, J., Siripun, K.C., Winder, C.T., Schilling, E.E., Small, R.L., 2005. The tortoise and hare II: relative utility of 21 noncoding chloroplast DNA sequences. Am. J. Bot. 92, 142–166. Shaw, J., Lickey, E.B., Schilling, E.E., Small, R.L., 2007. Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. Am. J. Bot. 94, 275–288. Skottsberg, C., 1934a. Astelia and Pipturus of Hawai‘i. Bernice P. Bishop Mus. bull. 117, 3–39. Skottsberg, C., 1934b. Studies in the genus Astelia Banks et Solander. Kungl. Svenska vetenskapssakademiens handlingar 14. Smith, J.M.B. (Ed.), 1982. A History of Australasian Vegetation. McGraw-Hill, Sydney, Australia. Swofford, D.L., 2002. PAUP: Phylogenetic Analysis Using Parsimony (and Other Methods). Taberlet, P., Gielly, L., Pautou, G., Bouvet, J., 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 17, 1105–1109. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA). Mol. Biol. Evol. 24, 1596–1599. Tate, J.A., Simpson, B.B., 2003. Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Syst. Bot. 28, 723–737. Trewick, S.A., Morgan-Richards, M., 2005. After the deluge: mitochondrial DNA indicates Miocene radiation and Pliocene adaptation of tree and giant weta (Orthoptera: Anostostomatidae). J. Biogeogr. 32, 295–309. Truswell, E.M., 1990. Cretaceous and Tertiary vegetation in Antarctica: a palynological perspective. In: Taylor, T.N., Taylor, E.B. (Eds.), Antarctic Paleobiology: Its Role in the Reconstruction of Gondwana. Springer-Verlag, New York, NY, pp. 71–88. Wagner, W.L., Herbst, D.R., Sohmer, S.H., 1999. Manual of the Flowering Plants of Hawai‘i. University of Hawai‘i Press, Bishop Museum Press, Honolulu, Hawai‘i. Wagstaff, S.J., Garnock-Jones, P.J., 1998. Evolution and biogeography of the Hebe complex (Scrophulariaceae) inferred from ITS sequence. N.Z. J. Bot. 36, 425–437. Wheeler, J.M., 1966. Cytotaxonomy of the large asteliads (Liliaceae) of the North Island of New Zealand. N.Z. J. Bot. 4, 95–113. Wikström, N., Savolainen, V., Chase, M.W., 2001. Evolution of the angiosperms: calibrating the family tree. Proc. Roy. Soc. Lond. B. Biol. Sci. 268, 2211–2220. Williams, J.B., 1987. Neoastelia. In: George, A.S. (Ed.), Flora of Australia; Hydatellaceae to Liliaceae. Australia Government Publishing Service, Canberra, Australia, pp. 493. Winkworth, R.C., Wagstaff, S.J., Glenny, D., Lockhart, P.J., 2005. Evolution of the New Zealand mountain flora: origins, diversification and dispersal. Org. Divers. Evol. 5, 237–247. Yang, Z., Rannala, B., 2006. Bayesian estimation of species divergence times under a molecular clock using multiple fossil calibrations with soft bounds. Mol. Biol. Evol. 23, 212–226. Zwickl, D.J., 2006. Genetic Algorithm Approaches for the Phylogenetic Analysis of Large Biological Sequence Datasets under the Maximum Likelihood Criterion. The University of Texas at Austin, Austin, Texas. <http://www.bio.utexas.edu/ faculty/antisense/garli/Garli.html>.

RELATED PAPERS

RELATED TOPICS

Log In

Molecular phylogeny and dating of Asteliaceae (Asparagales): Astelia s.l. evolution provides insight into the Oligocene history of New Zealand

Molecular phylogeny and dating of Asteliaceae (Asparagales): Astelia s.l. evolution provides insight into the Oligocene history of New Zealand

Related Papers

RELATED PAPERS

RELATED TOPICS