Botanical Journal of the Linnean Society, 2012, 168, 117–146. With 12 figures
Generic recircumscriptions of Oncidiinae (Orchidaceae:
Cymbidieae) based on maximum likelihood analysis of
combined DNA datasets
KURT M. NEUBIG1,2, WILLIAM MARK WHITTEN1*, NORRIS H. WILLIAMS
MARIO A. BLANCO1,2,3, LORENA ENDARA2, JOHN GORDON BURLEIGH2,
KATIA SILVERA4,5, JOHN C. CUSHMAN5 and MARK W. CHASE FLS6
FLS1,2,
1
Florida Museum of Natural History, University of Florida, PO Box 117800, Gainesville, FL
32611-7800, USA
2
Department of Biology, 220 Bartram Hall, PO Box 118525, University of Florida, Gainesville, FL
32611-8526, USA
3
Jardín Botánico Lankester, Universidad de Costa Rica, Apartado 1031-7050, Cartago, Costa Rica
4
Center for Conservation Biology, 3168 Batchelor Hall, University of California, Riverside, Riverside,
CA 92521, USA
5
Department of Biochemistry/ MS 200, University of Nevada Reno, NV 89557-0014, USA
6
Jodrell Laboratory, Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3DS, UK
Received 18 May 2011; revised 28 August 2011; accepted for publication 27 September 2011
Phylogenetic relationships within the orchid subtribe Oncidiinae sensu Chase were inferred using maximum
likelihood analyses of single and multilocus DNA sequence data sets. Analyses included both nuclear ribosomal
internal transcribed spacer DNA and plastid regions (matK exon, trnH-psbA intergenic spacer and two portions of
ycf1 exon) for 736 individuals representing approximately 590 species plus seven outgroup taxa. Based on the well
resolved and highly supported results, we recognize 61 genera in Oncidiinae. Mimicry of oil-secreting Malpighiaceae and other floral syndromes evolved in parallel across the subtribe, and many clades exhibit extensive
variation in pollination-related traits. Because previous classifications heavily emphasized these floral features,
many genera recognized were not monophyletic. Our classification based on monophyly will facilitate focused
monographs and clarifies the evolution of morphological and biochemical traits of interest within this highly
diverse subtribe. © 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168,
117–146.
ADDITIONAL KEYWORDS: elaiophores – euglossine pollination – hummingbird pollination – matK –
mimicry – Neotropics – oil-collecting bees – nrITS – trnH-psbA – ycf1.
INTRODUCTION
Oncidiinae (Cymbidieae) are one of the most diverse
subtribes of Orchidaceae, with a wide range of floral
and vegetative morphologies. They include the greatest diversity of pollination systems and the widest
range of chromosome numbers known for Orchidaceae (greater than the rest of the orchid family
combined). They also form major components of the
*Corresponding author. E-mail: whitten@flmnh.ufl.edu
Neotropical flora, ranging from sea level to almost
4000 m a.s.l. in the Andes; several species of Brassia
R.Br., Miltoniopsis God.-Leb. and Oncidium Sw. are
important ornamental crops. Oncidiinae are members
of a Neotropical clade that includes Coeliopsidinae,
Maxillariinae, Stanhopeinae and Zygopetalinae; these
five subtribes are each clearly monophyletic and
collectively are sister to Eriopsidinae, although relationships among the five subtribes still lack strong
bootstrap support; for an example, see the molecular
trees presented in Cribb (2009).
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
117
118
K. M. NEUBIG ET AL.
Previous classifications of Oncidiinae were intuitively based mainly on floral morphology and, to a
lesser extent, chromosome number, and all were produced without cladistic methodology (Garay & Stacy,
1974; Dressler, 1993; Senghas, 1997). Recent molecular studies have helped resolve and define Oncidiinae
and circumscribe many genera (Chase & Palmer,
1987; Williams et al., 2001a; Williams, Chase &
Whitten, 2001b; Sandoval-Zapotitla et al., 2010).
Subtribes Ornithocephalinae and Telipogoninae, long
held separate on the basis of their four pollinia
(versus two in Oncidiinae), plus the monopodial Pachyphylliinae (two pollinia), were shown to nest within
Oncidiinae. Dressler (1993) emphasized seed characters, velamen type and number of nodes per pseudobulb in his concepts of Cymbidieae and Maxillarieae.
However, molecular data (van den Berg et al., 2005)
indicated that Cymbidieae (sensu Dressler, 1993) are
likely to be paraphyletic to Maxillarieae, and the two
might be regarded as a single tribe (Cymbidieae sensu
Chase et al., 2003). In the current circumscription,
Oncidiinae include taxa with both two and four pollinia. Largely in accordance with the generic concepts
of Chase (2009b), the subtribe includes 61 genera and
approximately 1600 species. Before molecular phylogenetic studies, subtribal delimitation varied widely,
from the relatively broad concept of Dressler (1993)
to the narrow concepts of Szlachetko (1995), with
the latter splitting out approximately 20 subtribes
based largely on column morphology (including their
complex pollinaria).
Oncidiinae exhibit an enormous diversity in form
and function that makes them attractive subjects for
evolutionary studies. Floral size ranges several orders
in magnitude, and flowers evolved to utilize a diverse
array of pollinators. Floral rewards include nectar,
oils and fragrances, although deceit flowers are the
most common pollination strategy (Chase, 2009b).
Chromosome numbers range from the lowest known
in orchids (2n = 10) to 2n = 168 (Tanaka & Kamemoto,
1984) and genome size spans at least a seven-fold
range (Chase et al., 2005). Vegetatively, plants range
from large, long-lived perennials with pseudobulbs of
1 kg or more to highly reduced twig epiphytes the size
of a thumbnail with rapid life cycles (several months).
Most species are epiphytes, and CAM photosynthesis
is considered to have arisen repeatedly (Silvera et al.,
2009, 2010a, b). Understanding the evolution of this
range of form and function depends upon a reliable
phylogenetic hypothesis of relationships for hundreds
of species. Generic boundaries and relationships
within Oncidiinae have been highly contentious, and
several genera have been viewed as taxa of convenience (non-monophyletic; Garay, 1963). Previous evolutionary studies have been hampered by the choice
of non-monophyletic groups and by a lack of reliable
phylogenetic hypotheses. Our goal is to use combined
plastid and nuclear ribosomal internal transcribed
spacer (nrITS) data to produce a densely-sampled
phylogenetic estimate of relationships within Oncidiinae and to use this to underpin a stable generic
classification (Chase, 2009b) that can be used as a
framework for more focused studies.
POLLINATION
AND FLORAL MIMICRY IN
ONCIDIINAE
Historically, many of the difficulties with generic circumscription in Oncidiinae are probably the result of
homoplasy and mimicry in flower shape and colour.
Generic boundaries have long been contentious in
both the botanical and horticultural communities
(Garay, 1963; Braem, 2010). As in most orchid groups,
generic concepts have traditionally emphasized floral
characters and neglected vegetative ones. In Oncidiinae, floral traits and pollination systems appear to
be especially labile, which has undoubtedly fostered
much of the confusion in generic boundaries and
resulted in many polyphyletic genera. Pollen is never
offered as a reward, and pseudopollen and resin
rewards are unknown in Oncidiinae. Nectar is a
reward for bees, Lepidoptera and hummingbirds, and
is usually presented in a nectariferous spur formed by
the lip or the adnation of lip and column. However,
nectar deceit is common, and the presence of a spur
does not always indicate nectar. Relatively few
species produce a fragrance reward consisting of
monoterpenes, sesquiterpenes and simple aromatics.
These fragrances are collected by male euglossine
bees (Apidae: Euglossini), and they are considered
to serve a role in sexual selection by female euglossines (Bembe, 2004; Eltz, Roubik & Lunau, 2005;
Zimmermann et al., 2009). Most Oncidiinae species
have flowers that either produce an oil reward or
are mimics of oil-producing flowers of Malpighiaceae;
Figure 1 (Reis et al., 2000; Silvera, 2002; Sigrist &
Sazima, 2004; Damon & Cruz-López, 2006; Reis et al.,
2007; Carmona-Díaz & García-Franco, 2009; Vale
et al., 2011). These oil flowers attract a variety of
female bees of various sizes of several different genera
in tribes Centridini, Tapinostapidini and Tetrapediini,
of family Apidae (formerly assigned to a separate
family, Anthophoridae, and still occasionally referred
to as ‘anthophorid’ bees). The female bees collect oil
from specialized glands (elaiophores) on the flowers
and use the oils as provisions and/or waterproofing for
larval cells (Cane et al., 1983; Roubik, 1989; Melo &
Gaglianone, 2005). Numerous species of Oncidiinae
that are putative mimics of malpighs exhibit a suite
of characters that include bright yellow or purple
flowers, elaiophores consisting of epidermal pads on
lateral lobes of the lip or pads of trichomes on the lip
callus and a tabula infrastigmatica (i.e. a fleshy ridge
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
ONCIDIINAE PHYLOGENETICS
119
Figure 1. Various genera of Oncidiinae displaying putative mimicry of yellow Malpighiaceae and/or Calceolaria flowers.
A, Malpighia sp. (model). B, Psychopsiella limminghei (Morren ex Lindl.) Lückel & Braem. C, Grandiphyllum auriculatum
(Vell.) Docha Neto. D, Trichocentrum splendidum (A.Rich. ex Duch.) M.W.Chase & N.H.Williams. E, Trichocentrum cebolleta
(Jacq.) M.W.Chase & N.H.Williams. F, Trichocentrum ascendens (Lindl.) M.W.Chase & N.H.Williams. G, Rossioglossum
ampliatum (Lindl.) M.W.Chase & N.H.Williams. H, Lockhartia lepticaula D.E.Benn. & Christenson. I, Fernandezia
ecuadorensis (Dodson) M.W.Chase. J, Vitekorchis excavata (Lindl.) Romowicz & Szlach. K, Oncidium cultratum Lindl. L,
Oncidium obryzatum Rchb.f. M, Oncidium sp. N, Oncidium sphacelatum Lindl. O, Oncidium heteranthum Poepp. & Endl.
P, Gomesa gardneri (Lindl.) M.W.Chase & N.H.Williams. Q, Gomesa insignis (Rolfe) M.W.Chase & N.H.Williams. R, Gomesa
longipes (Lindl. & Paxt.) M.W.Chase & N.H.Williams. S, Otoglossum harlingii (Stacy) N.H.Williams & M.W.Chase. T,
Otoglossum scansor (Rchb.f.) Carnevali & I.Ramírez. U, Erycina pusilla (L.) N.H.Williams & M.W.Chase. V, Nohawilliamsia
pirarense (Rchb.f.) M.W.Chase & Whitten. W, Zelenkoa onusta (Lindl.) M.W.Chase & N.H.Williams. X, Tolumnia urophylla
(Lodd. ex Lindl.) Braem. Y, Tolumnia quadriloba (C.Schweinf.) Braem. Photographs by W. Mark Whitten.
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
120
K. M. NEUBIG ET AL.
at the base of the column that is grasped by the
mandibles of the bee, freeing their front and middle
legs to collect oil). Many Oncidiinae also possess
prominent elaiophores (Fig. 2F–J): Oncidium cheirophorum Rchb.f., Oncidium sotoanum R.Jiménez &
Hágsater, Trichocentrum cavendishianum (Bateman)
M.W.Chase & N.H.Williams and various species of
Gomesa R.Br. (Stpiczynska, Davies & Gregg, 2007;
Stpiczynska & Davies, 2008; Aliscioni et al., 2009;
Davies & Stpiczynska, 2009; Pansarin, Castro &
Sazima, 2009). Parra-Tabla et al. (2000) reported
that Trichocentrum ascendens (Lindl.) M.W.Chase
& N.H.Williams is pollinated primarily by female
Trigona bees collecting the oily floral secrections for
nest construction. Species with prominent elaiophores
represent legitimate oil reward flowers (Fig. 2F–O).
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
ONCIDIINAE PHYLOGENETICS
121
Figure 2. Oncidiinae displaying various pollination syndromes. Row 1 (A–E) Putative mimics of purple Malpighiaceae.
A, Malpighia glabra L. (model). B, Oncidium sotoanum R.Jiménez & Hágsater. C, Cyrtochilum edwardii (Rchb.f.) Kraenzl.
D, Tolumnia hawkesiana (Moir) Braem. E, Cyrtochilum ioplocon (Rchb.f.) Dalström. Rows 2 and 3 (F–O) Oncidiinae that
secrete oil from localized elaiophores. F, Lockhartia longifolia (Lindl.) Schltr. G, H, Cyrtochilum serratum (Lindl.) Kraenzl.
(arrow denotes elaiophore). I–J, Oncidium cheirophorum Rchb.f. (arrow denotes elaiophore). K, Ornithocephalus cochleariformis C.Schweinf. L. Ornithocephalus dalstroemii (Dodson) Toscano & Dressler. M, Ornithocephalus dressleri
(Toscano) Toscano & Dressler. N, Phymatidium falcifolium Lindl. O, Oncidium sp. (Sigmatostalix clade). Row 4 (P–S)
Putative hummingbird-pollinated species. P, Fernandezia subbiflora Ruiz & Pav. Q, Brassia aurantiaca (Lindl.)
M.W.Chase. R, Brassia andina (Rchb.f.) M.W.Chase. S, Oncidium beyrodtioides M.W.Chase & N.H.Williams. Row 4 (T–U)
Pseudocopulatory species. T, Tolumnia henekenii (R.H.Schomb. ex Lindl.) Nir. U, Trichoceros antennifer Kunth. Row 5
(V–Y) Species pollinated by nectar-foraging insects. V, Trichocentrum longicalcaratum Rolfe. W, Comparettia macroplectron Rchb.f. & Triana. X, Rodriguezia sp. Y, Trichopilia rostrata Rchb.f. Row 5 (Z) Floral fragrance reward flower
pollinated by male euglossine bees. Z, Macroclinium dalstroemii Dodson. Photograph (E) courtesy Guido Deburghgraeve;
all others by W. Mark Whitten.
䉳
Some oil-secreting taxa with relatively small, greenish white flowers (e.g. Ornithocephalus Hook., Phymatidium Lindl.; Fig. 2K–O) attract a subset of oilforaging bees with smaller body sizes and do not
appear to be involved in mimicry. Perhaps a larger
percentage of Oncidiinae possess flowers with similar
malpigh-mimicking colour (bee-ultraviolet-green;
Powell, 2008), morphology and tabula infrastigmatica, although they lack clearly demonstrable
elaiophores. These species represent oil deceit flowers
that lure oil-collecting bees but fail to produce a
legitimate reward (Fig. 1).
The floral morphology of Oncidiinae is probably the
result of a complex mixture of Batesian and Müllerian mimicry (Roy & Widmer, 1999). Using spectral
reflectance analyses, Powell (2008) demonstrated that
many Oncidiinae with yellow flowers closely match
the colour of yellow malpigh flowers [Byrsonima crassifolia (L.) Kunth] and thus satisfy one of the criteria
for Batesian mimicry. By mapping these traits onto
an Oncidiinae phylogenetic tree, he estimated at least
14 independent origins of putative malpigh mimicry
within Oncidiinae. Carmona-Díaz & García-Franco
(2009) demonstrated that the rewardless Trichocentrum cosymbephorum (C.Morren) R.Jiménez &
Carnevali is pollinated by the same oil-collecting
Centris bees that pollinate Malpighia glabra L., and
the orchid has greater reproductive success in the
presence of the malpigh than in isolated clumps.
Further, Sazima & Sazima (1988) showed that some
eglandular Malpighiaceae (lacking sepalar elaiophores) are possible mimics of glandular forms. There
are probably complex mimicry relationships between
Malpighiaceae species, oil-producing Oncidiinae and
oil-deceit Oncidiinae. We also suspect that some Oncidiinae mimic oil-producing Calceolaria L. (Calceolariaceae) because they occur at high elevations where
malpighs are absent or rare and Calceolaria spp. are
common. For example, Otoglossum harlingii (Stacy)
N.H.Williams & M.W.Chase (Fig. 1S) bears a striking
visual similarity to sympatric species of Calceolaria.
This extensive homoplasy in oil flower morphology
has contributed to grossly polyphyletic classifications
of Oncidiinae, especially in clades that contain species
with bright yellow ‘oncidioid’ flowers. Floral morphology, including the detailed structure of the column
(Szlachetko, 1995), is clearly unreliable as the sole
basis for generic circumscription. A robust phylogenetic framework based on molecular data can
help diagnose polyphyletic groups and inform a new
clade-based classification.
MATERIAL AND METHODS
TAXON SAMPLING
Specimens were obtained from wild-collected or cultivated plants (see Supporting information, Appendix S1); most taxon names follow the generic concepts
of Chase (2009b), except for genera we have now
lumped (e.g. Brachtia Rchb.f., Ada Lindl. and Mesospinidium Rchb.f. into Brassia; Pachyphyllum Kunth
and Raycadenco Dodson into Fernandezia Ruiz &
Pav.) or split (Psychopsiella Lückel & Braem from
Psychopsis Raf.). Sampling of Oncidiinae included 736
accessions from a total of 590 ingroup species. We
included seven outgroup taxa from other subtribes
of Cymbidieae (Cameron et al., 1999; Cameron, 2004).
We were unable to obtain DNA of the following
rare, minor genera: Caluera Dodson & Determann
(three species), Centroglossa Barb.Rodr. (five species),
Cypholoron Dodson & Dressler (two species), Dunstervillea Garay (one species), Platyrhiza Barb.Rodr. (one
species), Quekettia Lindl. (five species), Rauhiella
Pabst & Braga (three species), Sanderella Kuntze
(two species), Suarezia Dodson (one species) and
Thysanoglossa Porto & Brade (two species).
EXTRACTION,
AMPLIFICATION AND SEQUENCING
All freshly-collected material was preserved in
silica gel (Chase & Hills, 1991). Genomic DNA was
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
122
K. M. NEUBIG ET AL.
extracted using a modified cetyl trimethylammonium
bromide (CTAB) technique (Doyle & Doyle, 1987),
scaled to a 1-mL volume reaction. Approximately
10 mg of dried tissue were ground in 1 mL of CTAB
2 ¥ buffer and 2 mL of either b-mercaptoethanol or
proteinase-K (25 micrograms/mL; Promega, Inc.).
Some total DNAs were then cleaned with QIAquick
PCR (Qiagen) purification columns to remove inhibitory secondary compounds. Amplifications were performed using an Eppendorf Mastercycler EP Gradient
S thermocycler and Sigma brand reagents in 25-mL
volumes with reaction components for ITS: 0.5–1.0 mL
of template DNA (approximately 10–100 ng), 11 mL of
water, 6.5 mL of 5 M betaine, 2.5 mL of 10 ¥ buffer,
3 mL of MgCl2 (25 mM), 0.5 mL of 10 mM dNTPs,
0.5 mL each of 10 mM primers and 0.5 units of Taq
DNA polymerase. For the plastid regions, the reaction
components used were: 0.5–1.0 mL of template DNA
(approximately 10–100 ng), 16–18 mL of water, 2.5 mL
of 10 ¥ buffer, 2–3 mL of MgCl2 (25 mM), 0.5 mL of
10 mM dNTPs, 0.5 mL each of 10 mM primers and 0.5
units (0.2 mL) of Taq polymerase.
The thermocycler programmes used to amplify each
region comprised:
nrITS (ITS 1 + 5.8S rDNA+ ITS 2): This region was
amplified with a touchdown protocol using the parameters 94 °C for 2 min; 15 ¥ (94 °C for 1 min; 76 °C for
1 min, reducing 1 °C per cycle; 72 °C for 1 min);
21 ¥ (94 °C for 1 min; 59 °C for 1 min; 72 °C for
1 min); 72 °C for 3 min with the primers 17SE and
26SE sensu Sun et al. (1994). Betaine was added to
eliminate secondary structure typical of the ribosomal
DNA, so that active ITS copies would predominate in
the PCR product. Except for nrITS, all other regions
sequenced are plastid regions.
matK-trnK: This region includes the entire matK
gene and the flanking 3′trnK spacer and is approximately 1800 bp in length. This region was amplified
with the parameters 94 °C for 3 min; 33 ¥ (94 °C for
45 s; 60 °C for 45 s; 72 °C for 2 min); 72 °C for 3 min,
with primers -19F (Molvray, Kores & Chase, 2000)
and trnK2R (Johnson & Soltis, 1994). Internal
sequencing primers were matK intF (TGAGCGAACACATTTCTATGG) and matK intR (ATAAGGTTGAAACCAAAAGTG). Some samples were amplified
using the primers 56F and 1520R (Whitten, Williams
& Chase, 2000) that yielded a shorter, although
almost complete, sequence of the matK exon (missing
the 3′ spacer).
psaB: This region was amplified with the parameters 94 °C for 3 min; 33 ¥ (94 °C for 30 s; 55 °C for
30 s; 72 °C for 2 min); 72 °C for 4 min, using the
primers NY159 and NY160 sensu Cameron (2004).
rbcL: This region was amplified with the same
parameters as for psaB but with primers NY35 and
NY149 from Cameron (2004).
trnH-psbA: This region was amplified with the
parameters 94 °C for 3 min; 33 ¥ (94 °C for 1 min;
58 °C for 1 min; 72 °C for 1 min 20 s); 72 °C for 6 min,
with the primers F and R sensu Xu et al. (2000).
ycf1: We sequenced two noncontiguous portions of
ycf1 (Neubig et al., 2009) including approximately
1200 bp from the 5′ end and approximately 1500 bp
from the 3′ end. Both were amplified using a ‘touchdown’ protocol with the parameters 94 °C for 3 min;
8 ¥ (94 °C for 30 s; 60–51 °C for 1 min; 72 °C for
3 min); 30 ¥ (94 °C for 30 s; 50 °C for 1 min; 72 °C for
3 min); 72 °C for 3 min. Primers for the 5′ portion are
1F (ATGATTTTTAAATCTTTTCTACTAG) and 1200R
(TTGTGACATTTCATTGCGTAAAGCCTT). Primers
for the 3′ portion are 3720F (TACGTATGTAATGAACGAATGG) and 5500R (GCTGTTATTGGCATCAAACCAATAGCG). Additional internal sequencing primers
are intF (GATCTGGACCAATGCACATATT) and intR
(TTTGATTGGGATGATCCAAGG).
PCR products were cleaned with Microclean™ (The
Gel Company) in accordance with manufacturer’s
instructions. Purified PCR products were then cyclesequenced using the parameters 96 °C for 10 s;
25 ¥ (96 °C for 10 s; 50 °C for 5 s; 60 °C for 4 min).
The cycle sequencing mix consisted of 3 mL of water,
1 mL of fluorescent Big Dye dideoxy terminator, 2 mL
of Better Buffer™ (The Gel Company), 1 mL of template and 0.5 mL of primer. Cycle sequencing products
were cleaned using ExoSAP™ (USB Corporation) in
accordance with the manufacturer’s instructions.
Purified cycle sequencing products were directly
sequenced on an ABI 377, 3100 or 3130 automated
sequencer accordance with the manufacturer’s
instructions (Applied Biosystems). Electropherograms
were edited and assembled using SEQUENCHER,
version 4.9 (GeneCodes). All sequences were
deposited in GenBank (see Supporting information,
Appendix S1).
DATA
ANALYSIS
We constructed two data matrices. The first included
seven DNA regions (nrITS, trnH-psbA, 3′ycf1, 5′ycf1,
matK, rbcL and psbA) for 122 taxa. This smaller
restricted data set included several relatively conserved plastid genes (rbcL, psbA) with the goal of
providing increased resolution and support for the
deeper nodes of the tree. The outgroup for this data set
was Eulophia graminea Lindl. The second matrix
included five DNA regions (nrITS, trnH-psbA, 5′ycf1,
3′ycf1 and matK) for 736 taxa. Outgroup taxa were
Eriopsis biloba Lindl., Eulophia graminea, Cyrtidiorchis stumpflei (Garay) Rauschert, a species of
Rudolfiella Hoehne, Stanhopea jenishiana F.Kramer
ex Rchb.f., and Stanhopea tigrina Bateman ex Lindl.
The trnH-psbA matrix contained many gaps of dubious
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
ONCIDIINAE PHYLOGENETICS
alignment, and we excluded 1259 positions out of 2027
aligned positions (62%). Data matrices are available
from W. Mark Whitten (whitten@flmnh.ufl.edu) and
at: ftp://ftp.flmnh.ufl.edu/Public/oncids/
Maximum likelihood (ML) phylogenetic analyses
were performed on both data sets using RaxML,
version 7.0.4 (Stamatakis, 2006). For each data set,
we ran analyses that included: (1) only ITS; (2) only
the plastid loci; and (3) all loci. All ML analyses
used the general time-reversible (GTR; Tavare,
1986) model of evolution with among-site rate variation modeled using the ‘CAT’ discrete rate categories
option. For analyses of the plastid loci and all loci,
we further partitioned the ML model based on DNA
region. Specifically, we estimated substitution model
parameters for each region and for region-specific
branch lengths. To find the optimal tree for each
data set, we performed five runs of the ML heuristic
searches and 200 nonparametric bootstrap replicates
to assess clade support in the tree (Felsenstein,
1985).
RESULTS
SEVEN-LOCUS
DATA SET
(FIGS 3, 4)
Both the plastid and the nrITS trees recover the same
major clades, although there are some differences in
the topology along the spines of the trees. Based on
visual inspection of the trees, there appears to be
nuclear versus plastid conflict in the relationships
of Psychopsis, Psychopsiella and Trichopilia Lindl.
Psychopsis and Psychopsiella are strongly supported
as sister in the nrITS tree, although Psychopsis is
strongly supported as sister to Psychopsiella and
Trichopilia in the plastid tree. Vitekorchis Romowicz
& Szlach. is isolated in both nuclear and plastid tree.
It is weakly supported as sister to Oncidium + all
remaining taxa in the plastid tree but is unresolved
at a deeper node in nrITS trees. Tolumnia
Raf. is strongly supported as sister to Erycina
Lindl. + Rhynchostele Rchb.f. in nrITS results,
although plastid data place Tolumnia as a wellsupported member of a derived clade (including
Nohawilliamsia M.W.Chase & Whitten to Comparettia Poepp. & Endl.). The combined plastid + nrITS
seven-region analysis (122 taxa; Fig. 4) is largely consistent with the analysis of the larger five-locus data
(736 taxa; Figs 5–12), although the addition of rbcL
and psbA data provide slightly more support for the
spine of the tree.
FIVE-LOCUS
DATA SET
(FIGS 5–12)
Many species are represented by two or more
samples. In most cases, multiple accessions of a single
species form a group (e.g. most Erycina; Fig. 10). In a
123
few cases, samples from putatively the same species
do not fall together (e.g. Erycina pusilla (L.) N.H.Williams & M.W.Chase, Fig. 10; Cyrtochilum cimiciferum
(Rchb.f.) Dalström, Fig. 9). Some of these may be
the result of errors in determinations but, usually,
these represent taxonomically confusing groups with
poorly-defined species boundaries.
DISCUSSION
We recognize 61 clades in this tree (Figs 5–12) at
generic level (Table 1). All of the clades that we recognize at generic level are strongly supported, and
there is also strong support for almost all suprageneric nodes in the tree. Monotypic genera include
Zelenkoa M.W.Chase & N.H.Williams, Notyliopsis
P.Ortiz and Nohawilliamsia (Fig. 11). These taxa
form a poorly supported grade that is sister to Tolumnia and the twig epiphyte clade (all taxa in
Fig. 12). Other genera with weak support for generic
topology include Schunkea Senghas, Trizeuxis Lindl.,
Seegeriella Senghas and Warmingia Rchb.f. Genera
are discussed in order of appearance in the cladogram
(Figs 5–12). More detailed information for each genus
is provided in Chase (2009b).
Psychopsis Raf. (five spp.; Fig. 5) ranges from
Costa Rica south through the Andes to Peru. Chase
(2005) lumped the monotypic Psychopsiella into Psychopsis on the basis of their sister relationship in
unpublished nrITS trees to avoid creation of a monotypic genus, although analysis of the combined data
sets place Psychopsiella sister to Trichopilia Lindl.
Chromosome numbers also differ: 2n = 38 for Psychopsis (Dodson, 1957) versus 2n = 56 for Psychopsiella and Trichopilia (Charanasri & Kamemoto,
1975). Both Psychopsiella and Psychopsis have yellow
and brown flowers with a tabula infrastigmatica, suggestive of oil-reward flowers, although Dodson (2003)
reported pollination of Psychopsis by Heliconius butterflies but his observations have not been replicated.
Psychopsiella Lückel & Braem (one sp.; Figs 1B,
5) is monotypic and vegetatively resembles a dwarf
Psychopsis, although it lacks the elongate dorsal sepal
and petals of the latter. It is restricted to Brazil and
has been reported from Venezuela, near Caracas,
although this may have been an escape from cultivation. It shares a chromosome number of 2n = 56 with
its sister, Trichopilia.
Trichopilia Lindl. (approximately 26 spp.;
Figs 2Y, 5) is largely characterized by having a lip
that enfolds and is fused basally to the column, in
some species forming a deep tubular structure suggestive of nectar reward or deceit, although Dodson
(1962) reported pollination of one species by
fragrance-collecting male euglossine bees. Some
species of Cattleya Lindl. and Sobralia Ruiz & Pav.
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
124
K. M. NEUBIG ET AL.
A) Plastid
53
94
*
94
* *
* 74
64
98
70
92
50
*
*
85
*
*
99
59
99
*
80
99
89
94
*
92
93
98
*
62
**
*
52
*
76
93 *
92
60
*
60
98
99
90
84
80
*
70
94
59
*96
*
99
76
*
96
*
80
86
*
82
89
98
*
98
*
*
*
*77*
*
* *
60 *
*
98 *
81
68
*
*
* 66
*
*
98 *
*
**
98 *
*
*
W1696 Comparettia heterophylla
W2688 Comparettia falcata
W0869 Comparettia langkastii
H8339 Comparettia bennettii
N422 Comparettia barkeri
N414 Comparettia schaeferi
N041 Ionopsis minutiflora
W0881 Ionopsis minutiflora
W2346 Ionopsis utricularioides
N632 Pterostemma antioquiense
W2734 Pterostemma benzingii
N542 Warmingia zamorana
RLD6349 Macroclinium sp
W0961 Notylia ecuadorensis
N438 Macradenia rubescens
N415 Sutrina garayi
W0830 Polyotidium huebneri
C129 Trizeuxis falcata
W1615 Rodriguezia batemanii
W0287 Leochilus leiboldii
W0663 Leochilus inconspicuus
C017 Leochilus carinatus
C088 Leochilus leochilinus
N312 Tolumnia compressicaulis
W3358 Tolumnia gundlachii
C655 Tolumnia calochila
W1622 Plectrophora cultrifolia
W0662 Zelenkoa onusta
W2674 Notyliopsis beatricis
C026 Capanemia superflua
W0898 Solenidium portillae
W3637 Nohawilliamsia pirarense
C036 Gomesa planifolia
C151 Gomesa gomezoides
W2988 Gomesa radicans
W3535 Gomesa flexuosa
C058 Gomesa eleutherosepala
W3001 Gomesa lietzii
N089 Erycina cristagalli
W2520 Erycina glossomystax
C052 Erycina hyalinobulbon
C019 Rhynchostele bictoniensis
C652 Rhynchostele londesboroughiana
N091 Systeloglossum acuminatum
N336 Oliveriana brevilabia
W3262 Cischweinfia dasyandra
N548 Brassia horichii
W1644 Brassia elegantula
W2679 Brassia andina
W0083 Brassia arcuigera
N004 Aspasia lunata
W0091 Miltonia regnelii
W2966 Miltonia phymatochila
N017 Cyrtochilum serratum
W1553 Cyrtochilum myanthum
W1715 Caucaea phalaenopsis
W99252 Miltoniopsis roezlii
C119 Cyrtochiloides ochmatochila
B2856 Otoglossum globuliferum
W2723 Otoglossum coronarium
W0905 Otoglossum harlingii
C053 Oncidium harryanum
C054 Oncidium strictum
W1565 Oncidium epidendroides
W1662 Oncidium densiflorum
W1670 Oncidium peruvianoides
N287 Oncidium morganii
N625 Oncidium lehmanniana
N178 Oncidium aff obryzatum
W2343 Oncidium obryzatum
N268 Oncidium hyphaematicum
W2676 Oncidium andradianum
C142 Oncidium toachicum
C031 Oncidium reichenheimii
N115 Oncidium ghiesbreghtianum
N235 Oncidium altissimum
W1735 Oncidium heteranthum
W2518 Oncidium abortivum
W2694 Vitekorchis excavatus
W2375 Ornithocephalus bicornis
W2593 Ornithocephalus dressleri
W2374 Ornithocephalus suarezii
W0513 Hintonella mexicana
W0887 Eloyella thienii
W2949 Chytroglossa marileoniae
N429 Zygostates alleniana
W2929 Zygostates apiculata
N530 Phymatidium falcifolium
W0745 Fernandezia tica
W2524 Fernandezia crystallina
W1701 Fernandezia ionanthera
W3285 Fernandezia ecuadorensis
N560 Telipogon bombiformis
N643 Telipogon barbozae
N440 Telipogon vargasii
W0868 Telipogon hystrix
W2692 Telipogon obovatus
W2353 Trichoceros antennifer
W2690 Hofmeisterella eumicroscopica
B2558 Lockhartia micrantha
W1704 Lockhartia bennettii
N093 Cuitlauzina egertonii
C169 Cuitlauzina pendula
W3558 Cuitlauzina candida
C003 Rossioglossum ampliatum
N096 Rossioglossum oerstedii
C007 Rossioglossum schlieperianum
C013 Trichocentrum tigrinum
W1776 Trichocentrum lindenii
W3518 Trichocentrum stipitatum
C156 Saundersia paniculata
W0824 Grandiphyllum divaricatum
W0825 Grandiphyllum auricula
C074 Trichopilia sanguinolenta
W1643 Trichopilia sanguinolenta
C079 Trichopilia brevis
C150 Trichopilia subulata
W2396 Trichopilia fragrans
W3561 Psychopsiella limminghei
C034 Psychopsis sanderae
N052 Psychopsis papilio
W1618 Rudolfiella sp.
B) nrITS
* *
**
*
76
78
66
*
*
60
82
54
94
98
98
88
*
68
56
*
98
* * 58
*
84
95
99
93
73
57 78
87
99
*
98
*
54
*
96
*
74
69
81 90
96
84
98
82
98
93
99
78
* *
*
87
99
*
94
81
98
87 71
*
*
82
80
57
95
89
*
80
78
62
80
85
68
*
*
56
88
96
78
99
98
*
96
93
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
ONCIDIINAE PHYLOGENETICS
125
Figure 3. Comparison of maximum likelihood bootstrap (BS) consensus trees resulting from analyses of the separate
[(A) plastid versus (B) nuclear ribosomal internal transcribed spacer (nrITS)] data sets for the seven-region data set for
122 taxa. Asterisks indicate 100% BS support.
䉳
have similar gullet flowers, and they also are visited
by nectar-seeking euglossine bees. Vegetatively,
plants of Trichopilia are similar to Psychopsis and
Psychopsiella. We include Helcia Lindl., Leucohyle
Klotzch and Neoescobaria Garay, which are embedded
within Trichopilia. These differ primarily in the lack
of lip/column fusion and have previously been recognized as members of Trichopilia.
Rossioglossum (Schltr.) Garay & G.C.Kenn.
(ten spp.; Fig. 5), as circumscribed here, includes
Ticoglossum Lucas Rodr. ex Halb. and Chelyorchis
Dressler & N.H.Williams. This genus also includes
considerable floral diversity, suggestive of pollination
by a variety of bees, although pollination data are
mostly lacking. Rossioglossum ampliatum (Lindl.)
M.W.Chase & N.H.Williams (Fig. 1G) has numerous
bright yellow (bee-ultraviolet-green; Powell, 2008)
Oncidium-like flowers that are malpigh mimics,
whereas other Rossioglossum [e.g. R. insleayi (Baker
ex Lindl.) Garay & G.C.Kenn. and Rossioglossum
grande (Lindl.) Garay & G.C.Kenn.] bear relatively
few, large flowers barred with yellow and brown. All
species share vegetative similarities of rounded,
ancipitous pseudobulbs topped by a pair of leathery
leaves. Van der Pijl & Dodson (1966) reported
pollination of R. grande by Centris bees. Their
floral features, particularly the presence of a tabula
infrastigmatica,
indicates
oil-bee
pollination,
although their floral absorbance has not been investigated. Recognition of Chelyorchis, as a result of its
floral distinctiveness within this clade, would result
in a paraphyletic Rossioglossum. The genus ranges
mostly from Mexico to Central America, with Chelyorchis pardoi Carnevali & G.A.Romero extending
further south to Trinidad and Tobago, Colombia
and Venezuela (Fernandez-Concha et al., 2009).
This species currently lacks a combination in
Rossioglossum.
Cuitlauzina Lex. (ten spp.; Fig. 5), as circumscribed here, includes Dignathe Lindl., Osmoglossum
(Schltr.) Schltr. and Palumbina Rchb.f and ranges
from Mexico to Panama in Central America. Because
floral morphology is so divergent within this genus,
the close relationships between Cuitlauzina s.s.,
Palumbina, Dignathe and Osmoglossum were previously unsuspected. All four genera were segregated by
various workers from Odontoglossum. Cuitlauzina
pendula Lex. has a tabula infrastigmatica, although
its pollinator is unknown; its colour (white or pink)
makes it unlikely to be an oil-bee flower. Despite
their gross floral disparity, they share a prominent
clinandrial hood and similar pollinarium morphology
(Sosa et al., 2001).
Grandiphyllum Docha Neto (ten spp.; Figs 1C,
5) (‘Brazilian mule-ears’) is restricted to Brazil and
northern Argentina, and the species were formerly
placed as members of two sections of Oncidium. They
have large leathery leaves and floral morphology
typical of Oncidium with an oil-bearing callus or
dense pad of trichomes and a tabula infrastigmatica,
although they lack the complex tubularized pollinarium stipe (Chase, 1986b) typical of Oncidium s.s.,
Grandiphyllum and Saundersia Rchb.f. could be
lumped into Trichocentrum, although doing so would
create a genus that is even more difficult to diagnose
morphologically.
Saundersia Rchb.f. (two spp.; Fig. 5) is restricted
to Brazil. These small plants have relatively leathery
‘mule-ear’ leaves and small flowers borne in a dense
pendent raceme with a short column that lacks a
tabula infrastigmatica. The roots, ovary and sepals
bear dense indumentum, a feature unique within this
clade and rare in the entire subtribe (but found in
some species of Ornithocephalus, which is not closely
related; Fig. 6).
Trichocentrum Poepp. & Endl. (70 spp.; Figs 1D,
E, F, 2V, 5), as broadly circumscribed by Chase
(2009b), also includes Lophiaris Raf. (‘mule-ear’
oncidiums), Cohniella Pfitzer (‘rat-tail’ oncidiums)
and Lophiarella Szlach., Mytnik & Romowicz [Trichocentrum microchilum (Bateman ex Lindl.) M.W.Chase
& N.H.Williams and Trichocentrum pumilum (Lindl.)
M.W.Chase & N.H.Williams]. This clade also includes
great floral diversity but the species are linked by
vegetative succulence. The leaves are thick and leathery and, in one clade, the leaves are terete (‘rat-tail’
oncidiums). Most species have yellow to brown
flowers that are either true oil- or resin-rewarding
species: Trichocentrum stipitatum (Lindl. ex Benth.)
M.W.Chase & N.H.Williams, visited by Centris and
Paratetrapedia bees (Silvera, 2002); T. ascendens
(Lindl.) M.W.Chase & N.H.Williams, pollinated by
Trigona and Centris (Parra-Tabla et al., 2000), and
some are oil deceit-flowers. Species of Trichocentrum
s.s. typically have a spur (Fig. 2V), although nectar
has never been observed. At least one species, Trichocentrum tigrinum Linden & Rchb.f., has a strong
fragrance and attracts fragrance-collecting male
euglossines (van der Pijl & Dodson, 1966). Most Trichocentrum s.s. with spurs might be deceit flowers,
attracting nectar-foraging euglossine or other longtongued bees. Chromosome number varies greatly
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
126
K. M. NEUBIG ET AL.
62
90
W1696 Comparettia heterophylla
W2688 Comparettia falcata
W0869 Comparettia langkastii
H8339 Comparettia bennettii
N422 Comparettia barkeri
N414 Comparettia schaeferi
N041 Ionopsis minutiflora
54
W0881 Ionopsis minutiflora
W2346 Ionopsis utricularioides
N632 Pterostemma antioquiense
W2734 Pterostemma benzingii
80
RLD6349 Macroclinium sp
W0961 Notylia ecuadorensis
94
N542 Warmingia zamorana
N438 Macradenia rubescens
C129 Trizeuxis falcata
W1615 Rodriguezia batemanii
N415 Sutrina garayi
W0830 Polyotidium huebneri
67
C017 Leochilus carinatus
C088 Leochilus leochilinus
W0287 Leochilus leiboldii
W0663 Leochilus inconspicuus
W1622 Plectrophora cultrifolia
50
C655 Tolumnia calochila
W3358 Tolumnia gundlachii
N312 Tolumnia compressicaulis
50
W0662 Zelenkoa onusta
W2674 Notyliopsis beatricis
W3637 Nohawilliamsia pirarense
89
C026 Capanemia superflua
W0898 Solenidium portillae
C036 Gomesa planifolia
94
C151 Gomesa gomezoides
W2988 Gomesa radicans
W3535 Gomesa flexuosa
C058 Gomesa eleutherosepala
W3001 Gomesa lietzii
N089 Erycina cristagalli
W2520 Erycina glossomystax
C052 Erycina hyalinobulbon
C019 Rhynchostele bictoniensis
C652 Rhynchostele londesboroughiana
N548 Brassia horichii
76
W1644 Brassia elegantula
74
W2679 Brassia andina
W0083 Brassia arcuigera
N091 Systeloglossum acuminatum
84
N336 Oliveriana brevilabia
W3262 Cischweinfia dasyandra
N004 Aspasia lunata
W0091 Miltonia regnelii
W2966 Miltonia phymatochila
N017 Cyrtochilum serratum
92
W1553 Cyrtochilum myanthum
W1715 Caucaea phalaenopsis
W99252 Miltoniopsis roezlii
C119 Cyrtochiloides ochmatochila
B2856 Otoglossum globuliferum
86 90
W2723 Otoglossum coronarium
W0905 Otoglossum harlingii
C053 Oncidium harryanum
C054 Oncidium strictum
W1565 Oncidium epidendroides
84
W1662 Oncidium densiflorum
W1670 Oncidium peruvianoides
92
N178 Oncidium aff obryzatum
W2343 Oncidium obryzatum
N287 Oncidium morganii
94
N625 Oncidium lehmanniana
N268 Oncidium hyphaematicum
W2676 Oncidium andradianum
C142 Oncidium toachicum
84
C031 Oncidium reichenheimii
N115 Oncidium ghiesbreghtianum
N235 Oncidium altissimum
W1735 Oncidium heteranthum
W2518 Oncidium abortivum
W2694 Vitekorchis excavatus
W2375 Ornithocephalus bicornis
W2593 Ornithocephalus dressleri
78
W2374 Ornithocephalus suarezii
W0513 Hintonella mexicana
W0887 Eloyella thienii
W2949 Chytroglossa marileoniae
N429 Zygostates alleniana
W2929 Zygostates apiculata
N530 Phymatidium falcifolium
63
W0745 Fernandezia tica
W1701 Fernandezia ionanthera
W2524 Fernandezia crystallina
W3285 Fernandezia ecuadorensis
N560 Telipogon bombiformis
52
N643 Telipogon barbozae
N440 Telipogon vargasii
W0868 Telipogon hystrix
W2692 Telipogon obovatus
W2353 Trichoceros antennifer
W2690 Hofmeisterella eumicroscopica
B2558 Lockhartia micrantha
W1704 Lockhartia bennettii
C003 Rossioglossum ampliatum
N096 Rossioglossum oerstedii
C007 Rossioglossum schlieperianum
C169 Cuitlauzina pendula
N093 Cuitlauzina egertonii
W3558 Cuitlauzina candida
C013 Trichocentrum tigrinum
W1776 Trichocentrum lindenii
W3518 Trichocentrum stipitatum
C156 Saundersia paniculata
W0824 Grandiphyllum divaricatum
W0825 Grandiphyllum auricula
C074 Trichopilia sanguinolenta
W1643 Trichopilia sanguinolenta
C079 Trichopilia brevis
C150 Trichopilia subulata
W2396 Trichopilia fragrans
C034 Psychopsis sanderae
N052 Psychopsis papilio
W3561 Psychopsiella limminghei
W1618 Rudolfiella sp.
*
*
*
*
*
*
*
*
*
* **
*
*
*
*
*
*
*
*
* *
* * *
*
*
* *
*
*
*
**
*
*
*
* **
*
*
*
*
*
*
* *
*
88
*
94
*
*
*
* 88
*
*
60
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
* **
*
*
*
*
*
*
*
* = 95-100% bootstrap support
0.005 substitutions/site
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
127
ONCIDIINAE PHYLOGENETICS
Figure 4. Single maximum likelihood tree resulting from analysis of the combined [plastid + nuclear ribosomal internal
transcribed spacer (nrITS)] seven-region data set for 122 taxa. Asterisks indicate 100% bootstrap support (BS); values
above lines are BS percentages.
䉳
to Fig. 6
Fig. 5
to Fig. 6
B1803 Lockhartia aff. grandibracteata
B2559 Lockhartia grandibractea
B2558 Lockhartia micrantha
B2574 Lockhartia serra
B2488 Lockhartia aff. chocoensis
B2653 Lockhartia parthenglossa
B2567 Lockhartia acuta
B2286 Lockhartia hercodonta
B2572 Lockhartia obtusata
B2563 Lockhartia oerstedii
B2667 Lockhartia verrucosa
B2554 Lockhartia bennettii
W1704 Lockhartia bennettii
B2570 Lockhartia aff. parthenocomos
N350 Trichocentrum undulatum
W3252 Trichocentrum carthaginense
N447 Trichocentrum lindenii
W1776 Trichocentrum lindenii
N446 Trichocentrum x teaboanum
W0916 Trichocentrum sp.
N445 Trichocentrum oerstedii
N444 Trichocentrum cosymbephorum
Lophiaris (in part)
W0915 Trichocentrum cosymbephorum
C080 Trichocentrum bicallosum
W3553 Trichocentrum margalefii
N443 Trichocentrum straminium
N026 Trichocentrum lanceanum
W3229 Trichocentrum nanum
W0282 Trichocentrum morenoi
Lophiarella
W3554 Trichocentrum pumilum
N033 Trichocentrum pfavii
W2663 Trichocentrum cymbiglossum
C082 Trichocentrum panduratum
Trichocentrum s.s.
C013 Trichocentrum tigrinum
W0886 Trichocentrum pulchrum
W1695 Trichocentrum longicalcaratum
C025 Trichocentrum flavovirens
Lophiaris (in part)
N031 Trichocentrum splendidum
N025 Trichocentrum stipitatum
W3518 Trichocentrum stipitatum
W3602 Trichocentrum cepula
Cohniella
W3619 Trichocentrum cepula
C090 Trichocentrum jonesianum
C156 Saundersia paniculata
W0825 Grandiphyllum auriculum
W3567 Grandiphyllum auriculum
Oncidium
N285 Grandiphyllum hians
sect.
Oncidium
C048 Grandiphyllum hians
Paucituberculata sect. Pulvinatum
W0823 Grandiphyllum pulvinatum
W0824 Grandiphyllum divaricatum
W0826 Grandiphyllum robustissimum
C018 Cuitlauzina pulchella
Osmoglossum
N141 Cuitlauzina pulchella
N093 Cuitlauzina egertonii
C169 Cuitlauzina pendula
Cuitlauzina s.s.
W3545 Cuitlauzina pendula
C148 Cuitlauzina candida
Palumbina
W3558 Cuitlauzina candida
C003 Rossioglossum ampliatum
Chelyorchis
N024 Rossioglossum ampliatum
C075 Rossioglossum krameri
Ticoglossum
N096 Rossioglossum oerstedii
C007 Rossioglossum schlieperianum
Rossioglossum s.s.
N187 Rossioglossum insleayi
N034 Trichopilia turialvae
W2947 Trichopilia turialvae
W2396 Trichopilia fragrans
C001 Trichopilia suavis
W2957 Trichopilia leucoxantha
C150 Trichopilia subulata
Leucohyle
W1892 Trichopilia subulata
C399 Trichopilia laxa
C074 Trichopilia sanguinolenta
W1643 Trichopilia sanguinolenta
Helcia
C079 Trichopilia brevis
Neoescobaria
W0867 Psychopsiella limminghei
W3561 Psychopsiella limminghei
Psychopsis s.l.
C034 Psychopsis sanderae
N052 Psychopsis papilio
C267 Stanhopea tigrina
W3297 Stanhopea jenischiana
DT297 Cyrtidiorchis stumpflei
W1618 Rudolfiella sp
W0129 Zygopetalum maxillare
Outgroups
W0472 Eriopsis biloba
W3609 Eulophia graminea
*
73
67
94
87
*
68
*
*
*
*
61
*
81
84
53
59
65
*
73
*
80
*
65
85
*
*
*
**
* *
*
*
*
*
**
*
*
*
94
*
*
59
*
*
**
* *
*
*
* *
*
*
*
* *
* * *
*
*
*
71
75
87
*
84
73
*
*
0.001 substitutions/site
Figure 5. Portion (outgroups to Lockhartia) of single maximum likelihood tree resulting from analysis of the combined
five-region data set for 736 individuals. The tree on the right side of the figure displays bootstrap (BS) support > 50%;
asterisks indicate 95–100% BS support. Generic segregates that we do not recognize and have lumped are indicated in
the trees to the right of the accepted names.
within this clade, forming a continuum from
2n = 24–72 that does not correlate well with subclades. Chase & Olmstead (1988) hypothesized that
the range of numbers is the result of chromosomal
condensation and does not involve polyploidy. Some
reports (Braem, 1993; Christenson, 1999; FernandezConcha et al., 2010) have favoured a narrow circumscription of Trichocentrum (restricted to those species
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
128
K. M. NEUBIG ET AL.
to Fig. 7
Fig. 6
to Fig. 5
74
91
66
60
*
84
74
*
*
*
*
*
* *
* *
*
*
67
Stellilabium
to Fig. 7
N560 Telipogon bombiformis
N576 Telipogon ampliflorus
N556 Telipogon chiriquensis
B2984 Telipogon glicensteinii
N579 Telipogon sp.
N557 Telipogon panamensis
N587 Telipogon personatus
N561 Telipogon maduroi
N583 Telipogon monticola
N553 Telipogon caulescens
N692 Telipogon caulescens
N578 Telipogon biolleyi
N585 Telipogon sp.
N559 Telipogon medusae
N554 Teliopgon griesbeckii
N582 Telipogon griesbeckii
N584 Telipogon olmosii
N589 Telipogon sp.
N586 Telipogon parvulus
W0140 Telipogon parvulus
N558 Telipogon butcheri
N643 Telipogon barbozae
N645 Telipogon monteverdensis
N644 Telipogon bullpenensis
N344 Telipogon acicularis
W2155 Telipogon smaragdinus
W2531 Telipogon sp.
W2703 Telipogon sp.
C123 Telipogon pogonostalix
W0868 Telipogon hystrix
N440 Telipogon vargasii
N442 Telipogon nervosus
N694 Telipogon klotzscheanus
N413 Telipogon pulcher
W2413 Telipogon sp.
N577 Telipogon ariasii
N588 Telipogon sp.
B2982 Telipogon urceolatus
W2412 Telipogon hartwegii
W2692 Telipogon obovatus
B2977 Telipogon venustus
W0882 Trichoceros antennifer
W2353 Trichoceros antennifer
C138 Trichoceros parviflorus
N286 Trichoceros muralis
DT340 Trichoceros antennifer
W0883 Trichoceros muralis
DT375 Trichoceros sp.
C112 Hofmeisterella eumicroscopica
W2690 Hofmeisterella eumicroscopica
W2592 Ornithocephalus dalstroemii
W2693 Ornithocephalus dalstroemii
B2980 Ornithocephalus dalstroemii
Sphyrastylis
N309 Ornithocephalus ecuadorensis
N337 Ornithocephalus dalstroemii
B2979 Ornithocephalus escobarianus
W2593 Ornithocephalus dressleri
W2375 Ornithocephalus bicornis
W3264 Ornithocephalus bicornis
W3242 Ornithocephalus cochleariformis
B2545 Ornithocephalus inflexus
N426 Ornithocephalus iridifolius
W2370 Ornithocephalus kruegeri
W2376 Ornithocephalus polyodon
N428 Ornithocephalus myrticola
W2369 Ornithocephalus suarezii
W2374 Ornithocephalus suarezii
N290 Hintonella mexicana
W0513 Hintonella mexicana
W0887 Eloyella thienii
GG135 Chytroglossa aurata
W2949 Chytroglossa marileoniae
N437 Zygostates obliqua
W2929 Zygostates apiculata
N429 Zygostates alleniana
N430 Zygostates lunata
W2792 Zygostates pellucida
Dipteranthus
C103 Zygostates grandiflora
N530 Phymatidium falcifolium
W0860 Phymatidium falcifolium
C113 Fernandezia sp.
W2537 Fernandezia cuencae
DT359 Fernandezia sp.
W0880 Fernandezia sp.
Pachyphyllum (in part)
W2403 Fernandezia sp.
W2524 Fernandezia crystallina
W0879 Fernandezia hartwegii
W2313 Fernandezia sp.
H7178 Fernandezia sp.
DT366 Fernandezia ionanthera
W1701 Fernandezia ionanthera
W1700 Fernandezia sanguinea
Pachyphyllum (in part)
DT350 Fernandezia breviconnata
N568 Fernandezia tica
W0745 Fernandezia tica
C217 Fernandezia sp.
W3285 Fernandezia ecuadorensis
Raycadenco
63
84
79
94
76
*
54
*
*
*
*
94
**
*
*
*
*
*
89
**
* **
* *
*
*
*
**
*
*
*
*
**
*
*
*
*
52
*
85
*
94
56
65
84
*
88
*
** *
**
*
*
73
*
*
to Fig. 5
0.001 substitutions/site
Figure 6. Continuation (Fernandezia to Telipogon) of single maximum likelihood tree resulting from analysis of the
combined five-region data set for 736 individuals. The tree on the right side of the figure displays bootstrap (BS) support
> 50%; asterisks indicate 95–100% BS support. Generic segregates that we do not recognize and have lumped are
indicated in the trees to the right of the accepted names.
with a spur) and recognition of Lophiaris and
Cohniella. These generic segregates are monophyletic
with respect to our molecular data if one species of
Lophiarella (T. pumilum) is included in Lophiaris,
although Lophiarella should also include Trichocentrum flavovirens (L.O.Williams) M.W.Chase &
N.H.Williams and T. splendidum (A.Rich. ex Duch.)
M.W.Chase & N.H.Williams if it is to be monophyl-
etic. Chase (2009b) argued for lumping all these into
a broader Trichocentrum on the basis of pollinarium
and vegetative characters (Sandoval-Zapotitla & Terrazas, 2001), which also avoids recognition of a large
number of genera.
Lockhartia Hook. (35 spp.; Figs 1H, 2F, 5) has
confused orchidologists for decades and has been
placed in a number of suprageneric taxa. The genus
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
129
ONCIDIINAE PHYLOGENETICS
to Fig. 8
to Fig. 8
Fig. 7
C089 Oncidium wydleri
N235 Oncidium altissimum
N240 Oncidium baueri
N242 Oncidium volvox
N238 Oncidium reichenbachii
W3464 Oncidium panamense
W3243 Oncidium polycladium
W2797 Oncidium dichromaticum
N030 Oncidium sphacelatum
N237 Oncidium isthmi
W1773 Oncidium isthmii
N241 Oncidium ensatum
N499 Oncidium leucochilum
W2961 Oncidium leucochilum
C030 Oncidium leucochilum
N239 Oncidium maculatum
W1779 Oncidium lindleyi
N642 Oncidium sp.
W0516 Oncidium incurvum
W2919 Oncidium incurvum
N500 Oncidium leleui
B2976 Oncidium imitans
C135 Oncidium warscewiczii
N640 Oncidium storkii
N637 Oncidium exalatum
W2622 Oncidium exauriculatum
N088 Oncidium bracteatum
N186 Oncidium schroderianum
W0309 Oncidium schroederianum Miltonioides (in part)
C041 Oncidium hastilabium
N158 Oncidium cariniferum
Miltonioides (in part)
N208 Oncidium hastatum
C656 Oncidium endocharis
N634 Oncidium endocharis
C016 Oncidium oliganthum
C173 Oncidium reflexum
W0660 Oncidium durangense
W0895 Oncidium unguiculatum
C099 Oncidium gheisbreghtianum
Mexicoa
W3440 Oncidium ghiesbreghtianum
N115 Oncidium ghiesbreghtianum
N636 Oncidium iricolor
Vitekorchis (in part)
W2903 Oncidium iricolor
N220 Oncidium oblongatum
C031 Oncidium reichenheimii
N142 Oncidium reichenheimii
Miltonioides (in part)
C046 Oncidium laeve
C047 Oncidium stenoglossum
H7292 Oncidium dactyliferum
W1691 Oncidium dactyliferum
N097 Oncidium cheirophorum
N502 Oncidium cheirophorum
N027 Oncidium sotoanum
N212 Oncidium aloisii
W2676 Oncidium andradianum
C121 Oncidium pardothyrsus
N263 Oncidium estradae
W2331 Oncidium cf. abruptum
W0517 Oncidium hyphaematicum
W2507 Oncidium hyphaematicum
N268 Oncidium hyphaematicum
C073 Oncidium fuscatum
Chamaelorchis
N261 Oncidium fuscatum
W0725 Oncidium anthocrene
C004 Oncidium powellii
W1731 Oncidium sp.
C142 Oncidium toachicum
C020 Oncidium retusum
W2427 Oncidium retusum
W2446 Oncidium retusum
N547 Oncidium aff. echinops
W2539 Oncidium sp.
W1656 Oncidium echinops
W2518 Oncidium echinops
W2711 Oncidium echinops
Heteranthocidium
W2426 Oncidium ariasii
(in part)
W1679 Oncidium heterodactylum
W1734 Oncidium heterodactylum
W1735 Oncidium heteranthum
W1727 Oncidium cultratum
W2420 Oncidium lancifolium
N218 Oncidium retusum
W1736 Oncidium heterodactylum
N635 Vitekorchis excavatus
W2694 Vitekorchis excavatus
Vitekorchis s.s.
DT373 Vitekorchis excavatus
W2428 Vitekorchis lucasianus
*
67
*
77
*
*
*
87
53
*
92
87
*
89
*
88
*
**
**
*
*
*
*
79
*
**
*
*
91
52
76
86
54
*
70
80
* *
*
*
*
*
*
86
93
*
70
66
*
73
93
*
*
*
84
**
**
*
** *
*
**
* **
*
*
55
86
*
92
*
to Fig. 6
to Fig. 6
0.001 substitutions/site
Figure 7. Continuation (Vitekorchis to Oncidium) of single maximum likelihood tree resulting from analysis of the
combined five-region data set for 736 individuals. The tree on the right side of the figure displays bootstrap (BS) support
> 50%; asterisks indicate 95–100% BS support. Generic segregates that we do not recognize and have lumped are
indicated in the trees to the right of the accepted names.
ranges throughout much of the Neotropics. The
flowers are mostly bright yellow and bear oilsecreting trichomes, similar to many Oncidiinae,
although they lack a tabula infrastigmatica. The pol-
linaria have elongate caudicles that partially replace
a stipe (similar to Pachyphyllum Kunth), and all but
one species have a ‘braided’ vegetative habit with
pseudomonopodial stems lacking pseudobulbs and
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
130
K. M. NEUBIG ET AL.
to Fig. 9
to Fig. 9
B2529 Oncidium hallii
W1565 Oncidium epidendroides
N295 Oncidium epidendroides
N190 Oncidium epidendroides
N152 Oncidium tripudians
N156 Oncidium spectatissimum
N149 Oncidium nobile
N132 Oncidium alexandrae
N164 Oncidium alexandrae
C1488 Oncidium luteopurpureum
N140 Oncidium aff. epidendroides
N215 Oncidium hauensteinii
N223 Oncidium sceptrum
W1766 Oncidium luteopurpureum
W1551 Oncidium lehmannii
N327 Oncidium lehmannii
W1767 Oncidium lehmannii
N136 Oncidium armatum
N176 Oncidium armatum
W1723 Oncidium kegekjani
N122 Oncidium hallii
N216 Oncidium cristatum
N117 Oncidium blandum
C060 Oncidium cirrhosum
N150 Oncidium cirrhosum
N157 Oncidium reversoides
Odontoglossum
N217 Oncidium mirandum
C1357 Oncidium lindleyoides
N081 Oncidium crocidipterum
N135 Oncidium cinnamomeum
N145 Oncidium constrictum
N214 Oncidium gloriosum
W1765 Oncidium odoratum
C661 Oncidium nevadense
N104 Oncidium nevadense
C062 Oncidium wallisii
C1490 Oncidium rhynchanthum
N329 Oncidium portilloides
N198 Oncidium aspidorhinum
N328 Oncidium aspidorhinum
N175 Oncidium tenuoides
W1722 Oncidium tenuoides
W2391 Oncidium tenuoides
N213 Oncidium crinitum
N130 Oncidium portmannii
N139 Oncidium portmannii
W1612 Oncidium portmannii
C054 Oncidium strictum
Symphyglossum
W1638 Oncidium strictum
N323 Oncidium praestanoides
N155 Oncidium velleum
N173 Oncidium wyattianum
C053 Oncidium harryanum
N131 Oncidium harryanum
N079 Oncidium roseoides
N116 Oncidium vulcanicum
N305 Oncidium vulcanicum
W1680 Oncidium roseoides
Cochlioda
C065 Oncidium noezlianum
W1662 Oncidium densiflorum
W2455 Oncidium beyrodtioides
W0877 Oncidium peruvianoides
W1670 Oncidium peruvianoides
Solenidiopsis
W1798 Oncidium tigroides
W2392 Oncidium tigroides
C172 Oncidium multistellare
N129 Oncidium digitoides
N191 Oncidium astranthum
Collare-stuartense
N602 Oncidium manuelariasii
N599 Oncidium tenuifolium
Odontoglossum (in part)
N448 Oncidium povedanum
N165 Oncidium chrysomorphum
W1671 Oncidium chrysomorphum
W1676 Oncidium cf schmidtianum
W2421 Oncidium cf schmidtianum
N335 Oncidium trinasutum
N178 Oncidium sp.
N294 Oncidium tipuloides
W2505 Oncidium boothianum
W2506 Oncidium boothianum
Vitekorchis (in part)
W2447 Oncidium boothianum
W1732 Oncidium boothianum
N552 Oncidium zelenkoanum
N639 Oncidium obryzatoides
Vitekorchis (in part)
W2343 Oncidium obryzatum
N287 Oncidium morganii
W1631 Oncidium sp.
W1632 Oncidium minaxoides
N303 Oncidium sp.
W1577 Oncidium brevicornis
N432 Oncidium ibis
N434 Oncidium aristulliferum
N431 Oncidium cuculligerum
W1633 Oncidium gramineum
W2706 Oncidium gramineum
N292 Oncidium gramineum
Sigmatostalix
W2328 Oncidium weinmannianum
N435 Oncidium buchtienoides
C056 Oncidium poikilostalix
W1627 Oncidium sp.
W3520 Oncidium poikilostalix
N161 Oncidium unguiculoides
W2583 Oncidium auriculatoides
W1624 Oncidium oxyceras
W2340 Oncidium picturatissimum
N621 Oncidium sp.
N625 Oncidium lehmannianum
Fig. 8
to Fig. 7
0.001 substitutions/site
*
81
76
69
70
91
*
70
93
59
62
72 65
58
*
*
**
90
80
*
78
57
78
63
*
*
*
*
*
* *
*
*
*
**
*
*
* *
*
* *
53
51
*
85
94
59
*
60
77
93
52
75
*
77
86
78
93
93
62
69
**
73
90
*
94
**
* *
**
*
67
* *
* *
*
**
*
91
*
78
*
*
*
*
*
*
to Fig. 7
Figure 8. Continuation (Oncidium) of single maximum likelihood tree resulting from analysis of the combined five-region
data set for 736 individuals. The tree on the right side of the figure displays bootstrap (BS) support > 50%; asterisks
indicate 95–100% BS support. Generic segregates that we do not recognize and have lumped are indicated in the trees
to the right of the accepted names.
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
131
ONCIDIINAE PHYLOGENETICS
to Fig. 10
to Fig. 10
H7586 Cyrtochilum cumandae
W2908 Cyrtochilum gargantua
DT311 Cyrtochilum cordatum
N118 Cyrtochilum halteratum
W1650 Cyrtochilum trifurcatum
H7245 Cyrtochilum trifurcatum
N017 Cyrtochilum serratum
W3563 Cyrtochilum trilingue
C032 Cyrtochilum serratum
N206 Cyrtochilum macranthum
N076 Cyrtochilum ioplocon
N128 Cyrtochilum ioplocon
C063 Cyrtochilum revolutum
W3565 Cyrtochilum villenaorum
W1545 Cyrtochilum ramosissimum
C120 Cyrtochilum pardinum
N137 Cyrtochilum pardinum
C665 Cyrtochilum pardinum
N339 Cyrtochilum angustatum
C140 Cyrtochilum angustatum
N184 Cyrtochilum sp.
N433 Cyrtochilum graminoides
W1661 Cyrtochilum gracile
W2454 Cyrtochilum gracile
N144 Cyrtochilum fractum
W1553 Cyrtochilum myanthum
N527 Cyrtochilum hoeijeri
W0788 Cyrtochilum hoeijeri
N601 Cyrtochilum longipes
W1678 Cyrtochilum viminale
N539 Cyrtochilum fidicularium
W2352 Cyrtochilum funis
C663 Cyrtochilum edwardii
W3556 Cyrtochilum edwardii
N018 Cyrtochilum flexuosum
N536 Cyrtochilum cf. porrigens
W3599 Cyrtochilum macasense
N293 Cyrtochilum cimiciferum
N299 Cyrtochilum tricostatum
N304 Cyrtochilum tricostatum
W1559 Cyrtochilum tricostatum
W1560 Cyrtochilum cocciferum
W3550 Cyrtochilum cocciferum
H7239 Cyrtochilum midas
C008 Cyrtochilum cimiciferum
DT370 Cyrtochilum ovatilabium
W1682 Cyrtochilum cimiciferum
W0822 Cyrtochilum meirax
W2686 Cyrtochilum meirax
N106 Cyrtochilum murinum
W0878 Cyrtochilum murinum
C654 Cyrtochilum murinum
W2727 Cyrtochilum flexuosum
N418 Cyrtochilum aurantiacum
N419 Cyrtochilum caespitosum
N053 Cyrtochilum rhodoneurum
N540 Cyrtochilum ornatum
W1667 Cyrtochilum ornatum
DT337 Cyrtochilum aureum
W2354 Cyrtochilum aureum
N138 Cyrtochilum aff. aureum
N163 Cyrtochilum loxense
N421 Caucaea radiata
W2448 Caucaea radiata
W0897 Caucaea rhodosticta
N143 Caucaea kennedyi
W1716 Caucaea cucullata
N179 Caucaea cucullata
C022 Caucaea phalenopsis
W1715 Caucaea phalaenopsis
W1659 Caucaea nubigena
W1683 Caucaea andigena
N569 Miltoniopsis vexillaria
W0896 Miltoniopsis bismarkii
W2722 Miltoniopsis bismarkii
C1320 Miltoniopsis vexillaria
C014 Miltoniopsis warscewiczii
W99252 Miltoniopsis roezlii
N174 Miltoniopsis phalaneopsis
C119 Cyrtochiloides ochmatochila
C653 Cyrtochiloides cardiochila
C136 Cyrtochiloides panduriformis
N593 Cyrtochiloides riopalenqueana
C059 Otoglossum globuliferum
W3174 Otoglossum scansor
N550 Otoglossum globuliferum
B2856 Otoglossum globuliferum
W3155 Otoglossum globuliferum
H8090 Otoglossum sp.
W2723 Otoglossum coronarium
DT356 Otoglossum sp.
C061 Otoglossum chiriquense
W0905 Otoglossum harlingii
Fig. 9
to Fig. 8
90
81
89
*
*
56
*
*
*
*
*
*
*
85
79
68
87
69
Dasyglossum +
Trigonochilum
in various
combinations
*
51
51
90
*
62
*
65
*
*
*
69
89
68
*
70
64
*
*
*
*
Rusbyella
Neodryas
Buesiella
Siederella
*
* *
* *
*
**
*
86
*
58
79
*
*
61
61
58
92
*
77
*
58
*
* *
*
**
*
*
*
70
Brevilongium
*
86
76
Otoglossum s.s.
** *
*
Ecuadorella,
Brevilongium (in part)
0.001 substitutions/site
79
to Fig. 8
Figure 9. Continuation (Otoglossum to Cyrtochilum) of single maximum likelihood tree resulting from analysis of the
combined five-region data set for 736 individuals. The tree on the right side of the figure displays bootstrap (BS) support
> 50%; asterisks indicate 95–100% BS support. Generic segregates that we do not recognize and have lumped are
indicated in the trees to the right of the accepted names.
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
132
K. M. NEUBIG ET AL.
to Fig. 11
to Fig. 11
Fig. 10
**
73
to Fig. 9
0.001 substitutions/site
91
* *
*
*
*
*
*
*
*
**
*
*
*
* * *
*
*
* *
*
*
*
*
**
* *
**
*
*
*
*
*
*
*
*
*
*
*
*
* * **
* *
*
*
*
**
*
*
81
Amparoa
Mesoglossum
W2512 Erycina glossomystax
W2515 Erycina glossomystax
W2520 Erycina glossomystax
N099 Erycina pumilio
W2341 Erycina pumilio
C042 Erycina pusilla
W0872 Erycina zamorensis
W1771 Erycina pusilla
N089 Erycina cristagalli
Stacyella
W0530 Erycina cristagalli
C052 Erycina hyalinobulbon
W0512 Erycina hyalinobulbon
Erycina s.s.
C1350 Erycina echinata
W0511 Erycina echinata
W1685 Brassia sp.
W2695 Brassia ocanensis
N537 Brassia sp.
N549 Brassia sp.
Ada (in part)
W1644 Brassia elegantula
W0085 Brassia sp.
W0093 Brassia aurantiaca
W1837 Brassia pozoi
N300 Brassia garayana
W1666 Brassia garayana
N541 Brassia sp.
Mesospinidium
W1663 Brassia sp.
W0084 Brassia panamensis
N548 Brassia horichii
N528 Brassia allenii
Ada (in part)
H8089 Brassia sp.
W3415 Brassia forgetiana
W3287 Brassia villosa
W0082 Brassia signata
W0086 Brassia aurorae
Brassia s.s.
W0083 Brassia arcuigera
N006 Brassia caudata
N010 Brassia jipijapensis
N009 Brassia gireoudiana
C213 Brassia andina
Brachtia
W2679 Brassia andina
N003 Aspasia epidendroides
W0092 Aspasia principissa
N004 Aspasia lunata
N264 Aspasia silvana
N529 Cischweinfia suarezii
N535 Cischweinfia sp.
N524 Cischweinfia popowiana
W3607 Cischweinfia popowiana
W2458 Cischweinfia sp.
N036 Cischweinfia dasyandra
W3262 Cischweinfia dasyandra
W0876 Cischweinfia colombiana
N016 Cischweinfia pusilla
W3300 Cischweinfia pusilla
W2824 Cischweinfia platychila
W2461 Cischweinfia pygmaea
N336 Oliveriana brevilabia
N534 Oliveriana ecuadorensis
N653 Oliveriana sp.
C134 Systeloglossum bennettii
N091 Systeloglossum acuminatum
C027 Miltonia candida
Anneliesia
W0091 Miltonia regnelii
N022 Miltonia flavescens
C208 Miltonia phymatochila
Phymatochilum
W2966 Miltonia phymatochila
*
58
Psygmorchis
N121 Rhynchostele cordata
W3551 Rhynchostele cordata
N134 Rhynchostele maculata
N205 Rhynchostele madrensis
N207 Rhynchostele candidula
N126 Rhynchostele rossii
N189 Rhynchostele ehrenbergii
N127 Rhynchostele cervantesii
N204 Rhynchostele galeottiana
C918 Rhynchostele beloglossa
N036a Rhynchostele beloglossa
N119 Rhynchostele stellata
N120 Rhynchostele pygmaea
N177 Rhynchostele majalis
C019 Rhynchostele bictoniensis
N203 Rhynchostele uroskinneri
C652 Rhynchostele londesboroughiana
89
71
92
68
72
84
78
91
66
92
82
85
67
93
to Fig. 9
Figure 10. Continuation (Miltonia to Rhynchostele) of single maximum likelihood tree resulting from analysis of the
combined five-region data set for 736 individuals. The tree on the right side of the figure displays bootstrap (BS) support
> 50%; asterisks indicate 95–100% BS support. Generic segregates that we do not recognize and have lumped are
indicated in the trees to the right of the accepted names.
tightly overlapping, unifacial, non-articulate leaves.
The capsules have apical dehiscence instead of
lateral. These unusual features led some workers to
place Lockhartia in a separate subtribe, Lockhartiinae Schltr., although the molecular data strongly
support its position within Oncidiinae. The unusual
vegetative features are best explained as paedomor-
phic traits common to many seedlings of Oncidiinae
(Chase, 1986b). One species (Lockhartia genegeorgei
D.E.Benn. & Christenson) has prominent pseudobulbs with articulated, bifacial leaves; the lack of paedomorphic traits in this species led Senghas (2001) to
describe a new genus, Neobennettia Senghas. We
were unable to obtain a DNA sample of this taxon
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
ONCIDIINAE PHYLOGENETICS
to Fig. 12
to Fig. 12
Fig. 11
to Fig. 10
N373 Tolumnia tetrapetala
N386 Tolumnia sp.
N351 Tolumnia pulchella
N376 Tolumnia triquetra
N514 Tolumnia gauntlettii
N234 Tolumnia prionochila
N314 Tolumnia prionochila
N232 Tolumnia urophylla
N608 Tolumnia haitiensis
W0995 Tolumnia quadriloba
N049 Tolumnia henekenii
N233 Tolumnia guianensis
N272 Tolumnia guianensis
W2839 Tolumnia lemoniana
N312 Tolumnia compressicaulis
N318 Tolumnia arizajuliana
N712 Tolumnia guibertiana
N310 Tolumnia sylvestris
N395 Tolumnia leiboldii
N348 Tolumnia caymanensis
N406 Tolumnia sasseri
N274 Tolumnia scandens
N409 Tolumnia hawkesiana
W0991 Tolumnia variegata
W0981 Tolumnia aff. variegata
W3358 Tolumnia gundlachii
C655 Tolumnia calochila
N269 Tolumnia calochila
N050 Tolumnia tuerckheimii
C067 Zelenkoa onusta
W0662 Zelenkoa onusta
W2674 Notyliopsis beatricis
N638 Nohawilliamsia pirarense
W0898 Solenidium portillae
W2460 Solenidium portillae
N523 Solenidium lunatum
C026 Capanemia superflua
N671 Gomesa montana
N681 Gomesa sp.
N672 Gomesa warmingii
N699 Gomesa spiloptera
N682 Gomesa hydrophila
N683 Gomesa barbaceniae
C660 Gomesa warmingii
N702 Gomesa warmingii
N688 Gomesa sp.
N441 Gomesa viperina
C098 Gomesa flexuosa
N662 Gomesa flexuosa
W1778 Gomesa flexuosa
W3535 Gomesa flexuosa
C037 Gomesa macronyx
N678 Gomesa welteri
N704 Gomesa varicosa
W3611 Gomesa varicosa
C038 Gomesa ranifera
N698 Gomesa hookeri
W2988 Gomesa radicans
N341 Gomesa concolor
W3544 Gomesa concolor
C210 Gomesa dasytyle
N701 Gomesa forbesii
W3610 Gomesa forbesii
W3620 Gomesa gardneri
C076 Gomesa imperatorismaximiliani
N669 Gomesa praetexta
N676 Gomesa crispa
N710 Gomesa recurva
C036 Gomesa planifolia
N706 Gomesa sessilis
W3534 Gomesa sp.
N665 Gomesa chrysostoma
C151 Gomesa gomezoides
N705 Gomesa glaziovii
N708 Gomesa handroi
C058 Gomesa eleutherosepala
N684 Gomesa amicta
N686 Gomesa kautskyi
N685 Gomesa sarcodes
N667 Gomesa cornigera
N697 Gomesa sp.
W3559 Gomesa widgrenii
W3560 Gomesa silvana
W3001 Gomesa lietzei
N661 Gomesa echinata
C006 Gomesa pubes
N522 Gomesa venusta
GG154 Gomesa colorata
C137 Gomesa ciliata
N703 Gomesa barbata
N687 Gomesa macropetala
N604 Gomesa longipes
N680 Gomesa longipes
N666 Gomesa cogniauxiana
N668 Gomesa gracilis
133
Olgasis
**
*
*
*
* *
* *
90
61
79
Hispaniella
93
*
86
94
Braasiella
*
* **
*
57
91
92
92
88
*
87
Antillanorchis
*
Gudrunia
*
**
90
75
77 65
54
77
Coppensia
*
63
*
78
*
Rhinocerotidium
Coppensia
Menezesiella
Ornithophora
Carenidium (in part)
*
**
*
*
*
*
**
*
*
*
*
*
* *
*
*
*
93
69
56
Brasilidium
88
67
89
Rodrigueziella (in part)
Rodrigueziella (in part)
Rodrigueziopsis
84
76
Baptistonia
*
74
88
**
* *
*
Campaccia
Carriella
Alatiglossum
Kleberiella
Neoruschia
Nitidocidium
**
* *
64
0.001 substitutions/site
*
to Fig. 10
Figure 11. Continuation (Gomesa to Tolumnia) of single maximum likelihood tree resulting from analysis of the
combined five-region data set for 736 individuals. The tree on the right side of the figure displays bootstrap (BS) support
> 50%; asterisks indicate 95–100% BS support. Generic segregates that we do not recognize and have lumped are
indicated in the trees to the right of the accepted names.
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
134
K. M. NEUBIG ET AL.
Fig. 12
to Fig. 11
DT427 Notylia sp.
N424 Notylia buchtienii
B2972 Notylia pittieri
W1530 Notylia sp.
W0961 Notylia ecuadorensis
C012 Notylia barkeri
N570 Notylia sp.
W2823 Notylia albida
N265 Notylia barkeri
W1544 Notylia sp.
W2509 Macroclinium dalestromii
W3005 Macroclinium aurorae
RLD6349 Macroclinium lineare
C024 Macroclinium bicolor
N425 Macroclinium robustum
N192 Warmingia eugenii
N542 Warmingia zamorana
C028 Warmingia eugenii
N438 Macradenia rubescens
N654 Macradenia tridentata
C166 Macradenia brassavolae
N416 Seegeriella pinifolia
C129 Trizeuxis falcata
W3351 Trizeuxis falcata
N417 Schunkea vierlingii
W0475 Rodriguezia delcastilloi
W0476 Rodriguezia satipoana
W1616 Rodriguezia sp.
W1615 Rodriguezia batemanii
N384 Rodriguezia arevaloi
C039 Rodriguezia lanceolata
N320 Rodriguezia venusta
W0889 Rodriguezia chasei
W0919 Rodriguezia pulchra
W2342 Rodriguezia lehmannii
W1775 Rodriguezia leeana
N415 Sutrina garayi
Polyotidium
W0830 Polyotidium huebneri
W1694 Comparettia tungurahuae
W2691 Comparettia tungurahuae
N302 Comparettia jamiesonii
W0873 Comparettia hirtzii
W1696 Comparettia heterophylla
N533 Comparettia luerae
N297 Comparettia aff. gentryi
W1689 Comparettia sp.
N623 Comparettia sp.
Scelochilus
W0918 Comparettia ottonis
H8381 Comparettia portillae
N420 Comparettia corydaloides
N616 Comparettia corydaloides
N619 Comparettia sp.
N620 Comparettia sp.
N651 Comparettia sp.
N617 Comparettia sp.
W0869 Comparettia langkastii
N083 Comparettia speciosa
W2688 Comparettia falcata
Comparettia s.s.
N084 Comparettia falcata
C110 Comparettia macroplectron
W3425 Comparettia macroplectron
H8339 Comparettia bennettii
Stigmatorthos
N622 Comparettia bennettii
N422 Comparettia barkeri
Diadenium,
W0871 Comparettia micrantha
Chaenanthe
N414 Comparettia schaeferi
Pfitzeria
N041 Ionopsis minutiflora
W2371 Ionopsis minutiflora
Konantzia
W0881 Ionopsis minutiflora
N037 Ionopsis satyrioides
N352 Ionopsis satyrioides
Ionopsis s.s.
C043 Ionopsis utricularioides
W2346 Ionopsis utricularioides
N632 Pterostemma antioquiense
Hirtzia
W2734 Pterostemma benzingii
N051 Leochilus leiboldii
Papperitzia
W0287 Leochilus leiboldii
W0318 Leochilus inconspicuus
Hybochilus (in part)
W0663 Leochilus inconspicuus
N398 Leochilus labiatus
C017 Leochilus carinatus
W3363 Leochilus tricuspidatus
C083 Leochilus oncidioides
C088 Leochilus leochilinus
Goniochilus
N439 Plectrophora sp.
W1621 Plectrophora triquetra
N531 Plectrophora alata
W1622 Plectrophora cultrifolia
0.001 substitutions/site
52
54
*
*
*
*
** *
**
* *
*
*
*
71
57
69
81
*
79
*
67
83
**
*
52
89
*
*
* *
78
79
*
*
*
**
* * *
*
* *
*
* *
*
*
*
**
*
*
*
*
*
*
**
* *
*
**
*
*
*
54
69
58
93
58
82
to Fig. 11
Figure 12. Continuation (Plectrophora to Notylia) of single maximum likelihood tree resulting from analysis of the
combined five-region data set for 736 individuals. The tree on the right side of the figure displays bootstrap (BS) support
> 50%; asterisks indicate 95–100% BS support. Generic segregates that we do not recognize and have lumped are
indicated in the trees to the right of the accepted names.
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
ONCIDIINAE PHYLOGENETICS
Table 1. Genera of Oncidiinae recognized in the present
study
Genera recognized in this paper
Figure number
(of Fig. 5–12) where
genus occurs in tree
Aspasia Lindl.
Brassia R.Br.
Caluera Dodson & Determann
Capanemia Barb.Rodr.
Caucaea Schltr.
Chytroglossa Rchb.f.
Cischweinfia Dressler & N.H.Williams
Comparettia Poepp. & Endl.
Cuitlauzina La Llave & Lex.
Cyrtochiloides N.H. Williams & M.W.Chase
Cyrtochilum Kunth
Eloyella P.Ortiz
Erycina Lindl.
Fernandezia Lindl.
Gomesa R.Br.
Grandiphyllum Docha Neto
Hintonella Ames
Hofmeisterella Rchb.f.
Ionopsis Kunth
Leochilus Knowles & Westc.
Lockhartia Hook.
Macradenia R.Br.
Macroclinium Barb.Rodr.
Miltonia Lindl.
Miltoniopsis God.-Leb.
Nohawilliamsia M.W.Chase & Whitten
Notylia Lindl.
Notyliopsis P.Ortiz
Oliveriana Rchb.f.
Oncidium Sw.
Ornithocephalus Hook.
Otoglossum (Schltr.) Garay & Dunst.
Phymatidium Lindl.
Platyrhiza Barb.Rodr.
Plectrophora H.Focke
Polyotidium Garay
Psychopsiella Lückel & Braem
Psychopsis Raf.
Pterostemma Kraenzl.
Rauhiella Pabst & Braga
Rhynchostele Rchb.f.
Rodriguezia Ruiz & Pav.
Rossioglossum (Schltr.) Garay & G.C.Kenn.
Saundersia Rchb.f.
Schunkea Senghas
Seegeriella Senghas
Solenidium Lindl.
Suarezia Dodson
Sutrina Lindl.
Systeloglossum Schltr.
Telipogon Kunth
Thysanoglossa Porto & Brade
Tolumnia Raf.
Trichocentrum Poepp. & Endl.
Trichoceros Kunth
Trichopilia Lindl.
Trizeuxis Lindl.
Vitekorchis Romowicz & Szlach.
Warmingia Rchb.f.
Zelenkoa M.W. Chase & N.H.Williams
Zygostates Lindl.
10
10
Not
11
9
6
10
12
5
9
9
6
10
6
11
5
6
6
12
12
5
12
12
10
9
11
12
11
10
7,8
6
9
6
Not
12
12
5
5
12
Not
10
12
5
5
12
12
11
Not
Not
10
6
Not
11
5
6
5
12
7
12
11
6
sampled
sampled
sampled
sampled
sampled
sampled
135
for inclusion in our analyses, although we feel its
segregation into a monotypic genus is unwarranted.
It may be a natural intergeneric hybrid between
Lockhartia (probably Lockhartia lepticaula D.E.Benn.
& Christenson) and a species of Oncidium or Vitekorchis; the elongate, nonbifid pollinarium stipe of
L. genegeorgei is very different from that of other
Lockhartia spp.
The following seven genera include taxa formerly
placed in the monopopodial subtribes Pachyphyllinae
(pollinia with two long stipes/caudicles) and Ornithocephalinae (four pollinia).
Fernandezia Lindl. (approximately 50 spp.;
Figs 1I, 2P, 6) has recently been re-circumscribed to
include both Pachyphyllum and Raycadenco (Chase
& Whitten, 2011). The monotypic Raycadenco has
yellow and brown flowers with a tabula infrastigmatica typical of many oil-bee pollinated species of
Oncidium, although the plants are monopodial (and
therefore lack pseudobulbs), a habit shared with
others in this clade. Raycadenco is sister to Fernandezia and Pachyphyllum. These latter two genera
were previously distinguished on the basis of flower
size and colour. Pachyphyllum has tiny white or
yellow flowers for which pollinators are unknown,
whereas Fernandezia s.s. has larger flowers that are
bright red or orange and are hummingbird pollinated.
The two genera are not reciprocally monophyletic in
our trees, lending support to our decision to lump
them into Fernandezia. Given the rampant parallelism in floral morphology and, in particular, the frequent occurrence of oil-bee flowers in Oncidiinae, it
makes no sense to keep Raycadenco just because it
has oil-bee flowers when we disregard different pollination syndromes in other genera (e.g. Cyrtochilum
Kunth, Gomesa R.Br., Oncidium, etc.).
The genera that we sampled comprising the former
Ornithocephalinae are monophyletic in our trees,
although several are represented by only a single
sample (Figs 2K–N, 6): Phymatidium Lindl. (ten
spp.), Zygostates Lindl. (20 spp.), Chytroglossa
Rchb.f. (three spp.), Eloyella P.Ortiz (seven spp.),
Hintonella Ames (one sp.) and Ornithocephalus
Hook. (50 spp.). These genera possess tiny green to
white or yellow flowers that secrete oil via labellar
elaiophores and are pollinated by smaller genera of
oil-collecting bees (Buchmann, 1987). Toscano de
Brito & Dressler (2000) transferred all species of
Sphyrastylis Schltr. into Ornithocephalus, and Dipteranthus Barb. Rodr. is not separable from Zygostates
(Chase, 2009b). Genera of the former Ornithocephalinae not sampled in our study include Centroglossa
Barb.Rodr. (five spp.), Caluera Dodson & Determann (three spp.), Rauhiella Pabst & Braga (three
spp.), Platyrhiza Barb.Rodr. (one sp.) and Thysanoglossa Porto & Brade (two spp.). An unpub-
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
136
K. M. NEUBIG ET AL.
lished analysis of nrITS data (Toscano de Brito, pers.
comm.) shows that Centroglossa is embedded within
Zygostates, and thus these two should be merged. His
results also confirm the monophyly and inclusion in
this clade of the other four genera. Although we do
not recognize Centroglossa in this treatment, several
of the species still need to be transferred to
Zygostates.
Hofmeisterella Rchb.f. (one sp.; Fig. 6), Trichoceros Kunth (nine spp.; Figs 2U, 6) and Telipogon
Kunth (170 spp.; Fig. 6) include species formerly
placed in subtribe Telipogoninae on the basis of four
pollinia (versus two in Oncidiinae) and pseudocopulatory flowers with furry columns and lip calli that
are pollinated by male tachinid flies. Within this
clade, monotypic Hofmeisterella is sister to Trichoceros (high elevation species with thick, succulent
leaves and pseudobulbs) and Telipogon (intermediate
to high elevation species with thin leaves with
reduced or absent pseudobulbs). Previous molecular
studies of this clade showed that Stellilabium Schltr.
is biphyletic and embedded within Telipogon. One
Central American clade of Stellilabium is sister to a
Central American clade of Telipogon, and these are
embedded in a South American grade (Williams,
Whitten & Dressler, 2005).
Vitekorchis Romowicz & Szlach. (six spp.;
Figs 1J, 7) is an Andean genus that is sister to
Oncidium in our trees but without strong bootstrap
support. The floral similarity to Oncidium and chromosome counts of 2n = 56 are evidence supporting
their lumping into Oncidium but, without stronger
molecular support, we prefer to maintain generic
status for this clade at present. Their most distinguishing features are relatively large, sharply ridged
pseudobulbs with numerous subtending leaves,
massive inflorescences and small stipes relative to the
pollinia. Our circumscription of Vitekorchis differs
greatly from that of Szlachetko. His circumscription
includes several species that should be retained in
Oncidium (Oncidium boothianum Rchb.f., Oncidium
iricolor Rchb.f., Oncidium obryzatum Rchb.f.)
Oncidium Sw. (520 spp.; Figs 1K–O, 2I, J, O, S, 7,
8), as circumscribed broadly here, includes many previously recognized genera, including Odontoglossum
Kunth, Sigmatostalix Rchb.f., Cochlioda Lindl., Symphyglossum Schltr., Mexicoa Garay, Miltonioides
Brieger & Lückel and Solenidiopsis Senghas, and a
number of recent, minor segregates such as Chamaeleorchis Senghas & Lückel, Collare-stuartense
Senghas & Bockemühl and Heteranthocidium Szlach.,
Mytnik & Romowicz. With this broad circumscription,
it is the largest genus of the subtribe. Oncidium
species range from Mexico and Florida through the
Caribbean, Central America south to Bolivia and
Peru, with only one species in Brazil (Oncidium
baueri Lindl.). There are many chromosome counts of
2n = 56 (Tanaka & Kamemoto, 1984).
The circumscription of Oncidium has been highly
contentious, especially among horticulturalists. For
many years, the angle of attachment of the lip to
column was used to distinguish Oncidium from Miltonia Lindl. and Odontoglossum Kunth, although
such angles form a continuum and use of this singlecharacter to define genera resulted in highly artificial
classifications, as shown by Dressler & Williams
(1975). Oncidium is perhaps the best example of our
contention that floral morphology must be foregone in
Oncidiinae as a basis for generic characters. Floral
traits in Oncidiinae are highly plastic and reflect
evolutionary shifts in pollinators. The traditional
emphasis on floral features has resulted in many
polyphyletic genera. Almost 50 years ago, Garay
(1963) admitted the artificiality of many generic
boundaries within Oncidiinae: ‘To the taxonomist as
well as the horticulturalist, it appears to be a serious
and unpleasant thought to unite all these genera with
Oncidium, although this course seems to be inevitable, since the information gained from experiments
in hybridization and from cytological studies strongly
points in that direction’. We feel that it is better to use
vegetative features in combination with a few floral
traits to define broader genera. The molecular analyses demonstrate the high levels of homoplasy in
pollinator-related traits. Most members of Oncidium
s.s. are characterized by flowers adapted for pollination by relatively large oil-collecting bees (e.g.
Centris), and many species possess prominent elaiophores on the side lobes of the lip together with a
tabula infrastigmatica (Fig. 2I, J). Cochlioda and
Symphyglossum represent adaptations for hummingbird pollination, with bright red/pink/purple tubular
flowers (Fig. 2S). The lumping of Sigmatostalix within
Oncidium seems initially inappropriate, although the
vegetative habit of the two taxa differs only in size,
and the flowers of Sigmatostalix are diminutive relative to most Oncidium species (Fig. 2O), reflecting
adaptations to different groups of smaller oilcollecting bees. Although many of the traditionally
recognized segregate genera are monophyletic in our
trees (e.g. Sigmatostalix, one clade of Odontoglossum), they are embedded within a larger clade of
Oncidium species with diverse floral morphologies
and pollination systems. Recognition of these segregate genera would require creation of many new
genera to maintain monophyly, and these new genera
would be difficult to diagnose using floral or vegetative traits.
A few species of Oncidium (e.g. Oncidium echinops
Königer, Oncidium heteranthum Poepp. & Endl.;
Fig. 7) produce branched inflorescences with terminal
normal flowers on the branches, although the proxi-
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
ONCIDIINAE PHYLOGENETICS
mal flowers are abortive and sterile, consisting of
only a cluster of yellow tepals that function as osmophores (W. M. Whitten, pers. observ.). In other species
(Oncidium pentadactylon Lindl.), abortive flowers
are terminal, with all other proximal flowers being
normal. Szlachetko, Mytnik-Ejsmont & Romowicz
(2006) described Heteranthocidium to accommodate
these species, although their genus is not monophyletic in our trees. Moreover, several of the 15 species
they placed in the genus do not possess dimorphic
flowers and are widely scattered in our trees (e.g.
Oncidium boothianum, Oncidium exalatum Hágsater,
Oncidium fuscans Rchb.f., Oncidium pollardii Dodson
& Hágsater). All heteranthous species sampled here
form a clade of 16 accessions (Oncidium retusum
Lindl. to Oncidium heterodactylum Kraenzl., Fig. 7),
although not all the species in this clade bear dimorphic flowers consistently (O. retusum, Oncidium
cultratum Lindl., Oncidium lancifolium Lindl. ex
Benth.). Species delimitation is difficult within this
clade, and there appears to have been multiple loss or
gains of the heteranthous trait, coupled with its
erratic phenotypic expression.
Otoglossum (Schltr.) Garay & Dunst. (15 spp.;
Fig. 1S, T, 9) was originally regarded as a subgenus of
Odontoglossum by Schlechter, although the floral
characters agree most closely with Oncidium. Distribution is primarily Andean, extending north to Costa
Rica, with one species on tepuis of the Guyanan
shield. It was probably their large, bright reddish
brown flowers and occurrence at higher elevations
that caused them to be placed in Odontoglossum. As
broadly circumscribed here, Otoglossum includes
Oncidium sections Serpentia (Kraenzl.) Garay,
Brevilongium Christenson and Ecuadorella Dodson &
G.A.Romero. Before molecular data, a close relationship between Otoglossum s.s and Oncidium section
Serpentia was totally unsuspected. Otoglossum s.s.
bear many-flowered inflorescences arising laterally
from pseudobulbs widely spaced on woody rhizomes
(Jenny, 2010), whereas Oncidium section Serpentia
exhibits a unique vining habit (many meters long)
that was interpreted by Christenson (2006) as an
indeterminate inflorescence that periodically produces flowering plantlets at the nodes. We regard
these elongate, vining structures as stems, not inflorescences, making their habit that same as in Otoglossum s.s. The molecular data strongly support
Oncidium section Serpentia and Otoglossum s.s. as
sister taxa, and together they are sister to Otoglossum harlingii (Stacy) N.H.Williams & M.W.Chase, an
unusual former Oncidium with an odd upright habit
with long internodes and dichotomously forking
woody rhizomes. Dodson & Romero created the monotypic genus Ecuadorella for this taxon. The inclusion
of all these clades in Otoglossum reveals elongate
137
rhizomes as a local synapomorphy for the genus (this
trait occurs elsewhere in Oncidiinae, e.g. some species
of Cyrtochilum, to which Otoglossum is close).
Cyrtochiloides N.H.Williams & M.W.Chase (four
spp.; Figs 1J, 9) flowers have typical Oncidium-like
morphology and were considered members of
Oncidium until molecular data revealed their distinctiveness (Williams et al., 2001b). Florally, they are
only divergent from Oncidium in their pollinaria with
smaller stipes, larger pollinia and well developed,
stalked caudicles. The generic names alludes to the
vegetative similarity of the plants to Cyrtochilum;
both have ovoid pseudobulbs rounded in cross-section
(not angled) with two to six leaf-bearing subtending
sheaths.
Miltoniopsis God.-Leb. (six spp.; Fig. 9) was split
from Miltonia, and the name reflects their similar
floral shapes. The species of Miltoniopsis are distributed from Central America, Venezuela south to Peru,
although they are absent from Brazil, whereas Miltonia spp. are predominately Brazilian (and all are
non-Andean). The flowers have broad, flat lips, and at
least one species is reported to be pollinated by nightflying ptiloglossine bees (Ptiloglossa ducalis; Dodson,
1965), rather than by oil-collecting anthophorid bees.
Caucaea Schltr. (five to 20 spp.; Fig. 9) was previously known as the Oncidium cucullatum Lindl.
group, a set of poorly defined, high-elevation Andean
species with showy flowers. Their phylogenetic distance from Oncidium and their relationships to
the small-flowered, monotypic Caucaea radiata
(Lindl.) Mansf. were unsuspected until molecular
data revealed their close relationship (Williams et al.,
2001b), and they were lumped into Caucaea. Despite
the floral similarity to Oncidium, they are not closelyrelated. Caucaea is sister to Cyrtochilum, a relationship that was unexpected on the basis of gross floral
shape. The two genera do share subtle traits, including pseudobulbs that are rounded (not strongly
ancipitous or two-sided) and pollinaria with relatively
short stipes and large caudicles. Both genera also
occur in cool, high-elevation Andean cloud forests.
Cyrtochilum Kunth (120 spp.; Figs 2C, E, G, H, 9)
is restricted to the high Andes of Colombia and Venezuela south to Peru, with a single species, Cyrtochilum meirax (Rchb.f.) Dalström, occurring in the
Caribbean (Dalström, 2001). Many species have
long (3–4 m), vining inflorescences and large showy
flowers (some with prominent elaiophores; Fig. 2G,
H), although a few species have diminutive plants
and flowers. Vegetatively, Cyrtochilum are distinguished by dull pseudobulbs that are round or ovoid
in cross section with two to four apical leaves and two
to six leaf-bearing sheaths and relatively thick roots;
in contrast, Oncidium spp. have glossy, ancipitous
(two-edged) pseudobulbs and thin roots (Dalström,
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
138
K. M. NEUBIG ET AL.
2001). Dalström (2001) and Chase (2009b) discussed
the tangled taxonomic history of the genus. Previous
workers relied almost exclusively on floral traits,
resulting in confusion with concepts of Odontoglossum and Oncidium. Lindley, in a series of transfers
over a period of years (1837–1842) in Sertum Orchidaceum, eventually sank both Odontoglossum and
Cyrtochilum into Oncidium, and Kraenzlin resurrected the genus in 1922. Dasyglossum Königer
& Schildhauer and Trigonochilum Königer &
Schildhauer were created to accommodate some of the
smaller flowered Cyrtochilum spp., although the
authors repeatedly transferred taxa between the two
genera because they could not decide where they fit
on the basis of floral morphology. Senghas (1997)
transferred all Dasyglossum into Trigonochilum
because he could not reliably distinguish them.
Neither genus is monophyletic in our DNA trees.
Similarly, Buesiella C.Schweinf., Neodryas Rchb.f.,
Rusbyella Rolfe ex Rusby and Siederella Mytnik,
Górniak & Romowicz are simply diminutive and/or
brightly coloured taxa embedded within Cyrtochilum
(Dalström, 2001), probably reflecting a shift in pollinators, although there are few observations of
pollination.
Miltonia Lindl. (ten spp.; Fig. 10) occurs in Argentina, Brazil, Paraguay and Venezuela and is sister to
a clade that includes Systeloglossum Schltr., Oliveriana Rchb.f., Cischweinfia Dressler & N.H.Williams,
Aspasia Lindl. and Brassia. Some Miltonia species
(e.g. Miltonia regnellii Rchb.f and Miltonia spectabilis
Lindl.) have a short column and a broad, flat lip with
a simple, reduced callus, although the floral morphology varies a great deal among the species. Miltonia
clowesii (Lindl.) Lindl. has typical Oncidium-like oilbee flowers, whereas Miltonia candida Lindl. and
Miltonia russelliana (Lindl.) Lindl. have the lip partly
or completely encircling the column, giving them the
appearance of a Cischweinfia (suggestive of pollination by nectar-foraging bees). They also have the
clinandrial and column arms found in many species of
Cischweinfia (see below). Miltonia flavescens (Lindl.)
Lindl. on the other hand resembles a species of
Brassia in its floral traits, with a similar bilobed lip
callus forming a nectar-cavity like chamber on the
lip base and elongate, spidery tepals. The abovementioned species with the author combination
‘(Lindl.) Lindl.’ are the result of Lindley considering
these to be species of Cyrtochilum or Odontoglossum
when he first described them, again an indication of
the floral diversity present in a small set of species
that forms a clade in our analyses. Like M. clowesii,
M. phymatochila (Lindl.) N.H.Williams & M.W.Chase
also has typical oncidioid oil-bee flowers with a large
complex callus and tabula infrastigmatica. The latter
species was transferred from Oncidium to Miltonia by
Williams et al. (2001b) and subsequently transferred
to a monotypic genus, Phymatochilum Christenson
(Christenson, 2005), who cited it as an aberrant
member of Miltonia (a virtual ‘round peg in a square
hole’; E. A. Christenson, pers. comm.) but, in our view,
it is no more or less aberrant than the other species
with unusual floral traits found in Miltonia.
Sister to Miltonia is a clade of the following three
genera with relatively small flowers that have a
prominent clinandrial hood on the column and
strongly ancipitous pseudobulbs:
Systeloglossum Schltr. (five spp.; Fig. 10) has
small, yellow–green or brownish–purple flowers with
a prominent column foot and a simple hinged lip;
pollination is presumably by nectar-foraging insects.
Szlachetko (2006) created the monotypic Diadeniopsis
Szlach. for Systeloglossum bennetii (Garay) Dressler
& N.H.Williams. His emphasis on and interpretation
of gynostemial structure mistakenly placed it in the
twig epiphyte clade as a relative of Comparettia.
Oliveriana Rchb.f. (six spp.; Fig. 10) is a highelevation, Andean genus with relatively flat, open
flowers, and Chase (2009b) suggested the flowers are
pollinated by hummingbirds on the basis of pollinarium morphology (two, widely spaced pollinia with
a wedge-shaped viscidium and a bilobed stigma,
which are otherwise features found in hummingbirdpollinated species of Oncidiinae). Plants are scandent,
in contrast to the mostly caespitose habit of other
genera in this clade.
Cischweinfia Dressler & N.H.Williams (11 spp.;
Fig. 10) grows in middle-elevation forests (up to
1500 m) from Costa Rica to Bolivia. Flowers have a
tubular lip enfolding the column and are reportedly
pollinated by nectar-seeking euglossine bees (Williams, 1982). Cischweinfia pygmaea (Pupulin, J.Valle
& G.Merino) M.W.Chase has diminutive plants with
small flowers and a simple lip. It was originally
described as an Ada, although the molecular data
from this study clarified its generic placement (Chase
& Whitten, 2011).
Aspasia Lindl. (seven spp.; Fig. 10) ranges from
Central America, northern South America and the
Andes to coastal Brazil. It is vegetatively similar to
Brassia, although the flowers have a flat lip partially
adnate to a relatively long column and bent at a right
angle, forming a false nectary. Several species are
pollinated by euglossine bees, although there may be
a mixture of nectar deceit and fragrance reward
involved, depending upon the species (Zimmerman &
Aide, 1987). Aspasia represents the only known occurrence of fragrance-reward male euglossine pollination
in this clade (Miltonia to Brassia, Fig. 10).
Brassia R.Br. (74 spp.; Figs 2Q, R, 10) includes
Brachtia, Ada and Mesospinidium. Chase (2009b)
treated these separately but indicated this to be
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
ONCIDIINAE PHYLOGENETICS
unsatisfactory. These genera have been difficult to
separate on the basis of floral and vegetative characters. Brachtia (seven spp., Andean) is sister to
Brassia s.s. (c. 35 spp., Mexico through Central
America, Caribbean, to tropical South America). The
two genera are vegetatively similar and basic pollinarium and floral structures are similar. They share
a simple lip with a pair of small basal keels. They
differ mainly in the relative size of the flowers and
floral bracts; Brachtia (Fig. 2R) has relatively small
flowers with large bracts partially enclosing the
flowers. These two genera are sister to Ada (approximately 35 spp.) and Mesospinidium (approximately
seven spp.), both ranging from Central America south
through the Andes to Bolivia. Ada was originally
monotypic and composed of a single hummingbirdpollinated species with bright orange to red flowers
(Fig. 2Q), although Williams (1972) realized that it
was morphologically similar to a clade of Brassia (the
‘glumaceous’ brassias). He transferred this group into
Ada, greatly enlarging the genus. Ada is not monophyletic, with Ada allenii (L.O.Williams ex C.Schweinf.) N.H.Williams sister to Mesospinidium and
remaining Ada. Florally, Mesospinidium are small
versions of Ada. Given the shared suite of floral
morphologies and habits and aberrant phylogenetic
position of Ada allenii, lumping them all into Brassia
seems the simplest solution.
The sister relationship between the following two
morphologically divergent genera was unsuspected
prior to molecular studies. These genera are remarkably different in size, habit and floral morphology.
Erycina Lindl. (ten spp.; Figs 1U, 10), as broadly
defined by Williams et al. (2001a), includes Psygmorchis Dodson & Dressler and monotypic Stacyella
Szlach. [= Erycina crista-galli (Rchb.f.) N.H.Williams
& M.W.Chase]. All three genera have bright yellow oil
reward/deceit flowers (Pérez-Hérnandez et al., 2011)
and were at one time considered members of
Oncidium. Although these three genera could be
maintained, we favour lumping them to emphasize
their similar floral morphology and modified habit
(absence of an apical leaf on pseudobulbs, if pseudobulbs are present).
Rhynchostele Rchb.f. (13 spp.; Fig. 10), as circumscribed here is primarily Mexican and includes
Amparoa Schltr. and Mesoglossum Halb.; Cymbiglossum Halb. and Lemboglossum Halb. are later synonyms of Rhynchostele. Lumping of these genera is
also supported by anatomical similarities (Rojas Leal,
1993). Most of these species were treated as members
of Odontoglossum until split out by Halbinger, first as
Cymbiglossum and later as Lemboglossum. Morphological analyses by Soto, Salazar & Rojas Leal (1993)
revealed a close relationship between these species
and the much reduced Rhynchostele pygmaea Rchb.f.
139
They transferred all these taxa into Rhynchostele, a
move that is supported by our molecular data.
Gomesa R.Br. (125 spp.; Figs 1P–R, 11) as circumscribed here is relatively broad and includes at least
23 other generic concepts (Chase et al., 2009a; Chase,
2009b) with a great diversity of floral morphology and
size. Gomesa has a centre of distribution in Brazil,
especially the Mata Atlântica, where these species
largely replace Oncidium (the genus in which most of
them were once included), although it extends to
northern Argentina and Amazonian Peru. Almost all
species have fused lateral sepals, a trait that makes
them easy to recognize despite their floral diversity.
By contrast, Oncidium is largely absent from Brazil
(O. baueri is the sole representative), and their lateral
sepals are usually free. The two genera rarely
produce hybrids in horticulture. Based on the enormous floral diversity within Gomesa, Brazilian and
French workers have proposed a number of segregates (Docha Neto, Baptista & Campacci, 2006),
although several of these are not monophyletic
(e.g. Alatiglossum Baptista, Carenidium Baptista,
Coppensia Dumort.). Several recent segregates are
monotypic: Campaccia venusta (Drapiez) Baptista,
P.A.Harding & V.P.Castro; Hardingia paranaensis
(Kraenzl.) Docha Neto & Baptista (not included in our
analyses); and Nitidocidium gracile (Lindl.) F.Barros
& V.T.Rodriguez. To make matters worse, Szlachetko
and colleagues also segregated a number of genera
from this same set of species, often using the same
type species but including different sets of species
than the Brazilian workers (e.g. Concocidium Romowicz & Szlach. and Carenidium, both based on
Oncidium concolor Hook.). Also, Szlachetko (2006)
segregated three species of Oncidium as the genus
Rhinocerotidium Szlach. (Oncidium longicornu
Mutel, Oncidium macronyx Rchb.f and Oncidium rhinoceros Rchb.f.; most workers lump these into a single
species). He based the genus mostly upon the large,
horn-like lip callus, although the callus is perhaps the
most variable floral feature within Oncidiinae. These
species are closely related to G. varicosa (Lindl.)
M.W.Chase & N.H.Williams, a species with a
relatively large lip and small callus.
Capanemia Barb. Rodr. (seven spp.; Fig. 11) is
represented in our analyses by only a single species,
Capanemia superflua (Rchb.f.) Garay that is sister to
Solenidium Lindl. Recent studies have reduced the
number of species in the genus, although molecular
data are needed to confirm whether the seven recognized species form a monophyletic group (Buzatto,
Singer & van den Berg, 2010; Buzatto et al., 2011).
The genus is centred in south-eastern Brazil, extending to Argentina and Uruguay. Florally, the genus is
similar to unrelated Leochilus Knowles & Westc.,
although most species do not produce nectar, except
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
140
K. M. NEUBIG ET AL.
C. therezae Barb. Rodr. (Buzatto et al., 2011). Singer
& Cocucci (1999) reported visits by halictid bees and
vespid wasps. Sanderella also falls here (C. van den
Berg, pers. comm.). Morphologically, Sanderella is
similar to Capanemia (the oldest name) and should
probably be combined with it. The exact status of
Sanderella cannot be determined until it and more
species of Capanemia are sampled.
Solenidium Lindl. (three spp.; Fig. 11) is an Amazonian genus similar florally to its sister, Capanemia,
bearing small flowers with prominent column wings
and an upturned tip of the anther cap; more detailed
studies of both may support their combination.
Nohawilliamsia M.W.Chase & Whitten (one sp.;
Figs 1V, 11) was created to accommodate a single odd
species with no close or clear relatives based on
our analyses thus far. It was formerly known as
Oncidium pirarense Rchb.f. (synonym Oncidium
orthostates Ridl.) from southern Venezuela, Guyana,
Suriname and Brazil (Whitten, 2009; Chase, 2009a;
Chase et al., 2009a). Although the flowers are similar
to many yellow species of Oncidium, they lack a
tabula infrastigmatica. The leaves have a minutely
dentate margin, and plantlets (keikis) are produced
on old inflorescences and on top of old pseudobulbs;
all these traits are unusual within Oncidiinae.
Notyliopsis P.Ortiz (one sp.; Fig. 11) from the wet
Colombian Chocó has diminutive flowers that superficially resemble those of Notylia Lindl., although the
pseudobulbs are reminiscent of Zelenkoa.
Zelenkoa M.W.Chase & N.H.Williams (one sp.;
Figs 1W, 11) was long considered an oddity when it
was included in Oncidium (often in its own monotypic
section), although molecular data revealed its distinctiveness. Like Nohawilliamsia, it has bright yellow
flowers that lack a tabula infrastigmatica. Often epiphytic on cacti in dry coastal forests of Ecuador and
Peru, the plants have mottled ovoid pseudobulbs that
resemble those of Notyliopsis, which is also a member
of this grade relative to Tolumnia and other twig
epiphytes.
Tolumnia Raf. (40 spp.; Figs 1X, Y, 2D, 11) has
long been recognized as a distinct group (‘equitant’
oncidiums) based on their psygmoid fan of succulent
leaves and usual absence of pseudobulbs. There is
extensive polyploidy within the genus (Braem, 1986),
resulting in some conflict between nuclear and plastid
phylogenetic trees (N. Williams, unpubl. data). Most
species have oil-bee flowers that do not secrete oil;
pollination by Centris bees is reported for several
species (Nierenberg, 1972; Ackerman, MeléndezAckerman & Salguero Faria, 1997; Vale et al., 2011).
Tolumnia henekenii (R.H.Schomb. ex Lindl.) Nir has a
furry, insect-like lip and is reportedly pseudocopulatory (Dod, 1976). Braem and Garay have published or
resurrected several (often monotypic) segregates
based on floral oddities; these include Olgasis Raf.,
Antillanorchis (Wright ex Griesb.) Garay, Hispaniella
Braem, Jamaiciella Braem, Braasiella Braem, Lückel
& Russmann and Gudrunia Braem. Recognition of all
these segregates would require at least a dozen
genera to be carved from Tolumnia to maintain monophyly. We feel this is unwarranted. Tolumnia is sister
to all others in the remainder of the tree (twig epiphytes), although this relationship is only weakly
supported. In contrast to most twig epiphytes, Tolumnia spp. occur on the larger axes of trees and live for
many years, rather than being restricted to terminal
twigs with extremely rapid life cycles, although they
also have seeds with pronounced hooks or knob-like
extensions (Chase, 1988).
THE
TWIG EPIPHYTES
The clade comprising the remainder of the tree (Plectrophora H.Focke to Notylia; Fig. 12) has been informally referred to as the ‘twig epiphyte’ clade. Chase
(1988) first discussed the morphological and lifehistory features that unite these taxa. Twig epiphytes
often grow on the smallest branches (ⱕ 2.5 cm) in
exposed, high-light zones, have rapid life cycles (often
reaching maturity in one season), produce hooks or
projections on the seed testa (most likely for attachment to small twigs and rapid uptake of water) and
exhibit psygmoid (paedomorphic) habits and velamen
(root epidermis) cells much longer than wide with
evenly spaced secondary thickenings. Not all taxa in
this clade are extreme twig epiphytes restricted to
terminal twig habitats, although the majority display
many of these features. Twig epiphytes occur in other
clades of Oncidiinae (e.g. Erycina; Fig. 10), and in
other subtribes (e.g. Dendrophylax porrectus (Rchb.f.)
Carlsward & Whitten, Angraecinae). None of the
genera of the twig epiphyte clade (all genera in
Fig. 12) is known to secrete oil or mimic oil flowers.
Instead, they attract either nectar-seeking animals or
are pollinated by fragrance-collecting male euglossine
bees. Suarezia Dodson (one sp.) was not sampled,
although it is presumed to be a member of this clade
on the basis of its morphology.
Plectrophora H.Focke (nine spp.; Fig. 12) is a
genus of diminutive plants with relatively large
flowers with a funnel-shaped lip and a sepaline spur
without nectar horns. The presence of nectar has not
been confirmed, although the flowers are probably
pollinated by long-tongued insects seeking nectar.
Leochilus Knowles & Westc. (12 spp.; Fig. 12) is
a genus of true twig epiphytes, occurring only on
small branches and twigs. The small flowers of most
species have a simple lip with a shallow nectar cavity
at the base. Chase (1986a) reported pollination of two
species by nectar-foraging, short-tongued Stelopolybia
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
ONCIDIINAE PHYLOGENETICS
wasps and Lasioglossum bees. Three other monotypic
genera are now included in Leochilus on the basis of
their position in phylogenetic studies: Goniochilus
Chase, Hybochilus Schltr. and Papperitzia Rchb.f.
The floral structure of the first two is similar to that
of the other species of Leochilus, although that of
Papperitzia is highly divergent. Despite this, the
single species of Papperitzia was originally included
in Leochilus.
Pterostemma Kraenzl. (two spp.; Fig. 12) is a
genus of diminutive, extreme Andean twig epiphytes
with tiny flowers that are probably bee-pollinated.
Their habits are monopodial tufted plants or psymoid
fans 1–2 cm in size. The flowers have a dorsal anther
with long stipe and long, forward-sweeping column
arms. Both sequence data and morphology confirmed
a close relationship of Hirtzia Dodson to Pterostemma,
so the two were lumped (Chase, Williams & Whitten,
2009b).
Ionopsis Kunth (three spp.; Fig. 12) ranges widely
throughout the Neotropics. The white to pink flowers
have a simple lip with a short sepalar spur without
any obvious reward and are probably pollinated by
nectar-seeking bees.
Comparettia Poepp. & Endl. (60 spp.; Figs 2W,
12) is broadly circumscribed here to include all
species with sepalar nectar spur(s) furnished by a
horn or pair of horns on the column base that secrete
nectar. Generic segregates lumped here include Diadenium Poepp. & Endl., Chaenanthe Lindl., Scelochilus Klotzsch, Neokoehleria Schltr., Scelochiloides
Dodson & M.W.Chase, Stigmatorthos M.W.Chase &
D.E.Bennett, Pfitzeria Senghas and Scelochilopsis
Dodson & M.W.Chase. As more species in this clade
were discovered in recent years, generic limits
became more obscure, and the amalgamation of all
taxa with nectar horns into a single genus appears to
be the best solution. Scelochilus does not appear to be
monophyletic. There is variation in vegetative habit
within this clade from psygmoid fans to caespitose
plants with bifacial leaves and pseudobulbs. Some
species can begin flowering as juvenile psygmoid
plants before transformation into adult plants with
pseudobulbs, and damage can cause a reversal to
psygmoid seedling habit. Pollination by hummingbirds (Amazalia sp., Chlorostilbon maugaeus) is
documented for Comparettia falcata (Dodson, 1965;
Salguero-Faria & Ackerman, 1999). Pollination by
butterflies and long-tongued bees appears likely for
some taxa.
Polyotidium Garay (one sp.; Fig. 12) is reported
only from Ecuador, Venezuela, Brazil and the Orinoco
drainage of Colombia. The 5 mm, fleshy bright orange
flowers have a simple lip and a dorsal anther, suggestive of hummingbird pollination. Its phylogenetic
position is unresolved within a strongly supported
141
terminal clade that includes Rodriguezia Ruiz & Pav.,
Macroclinium Barb. Rodr. and Notylia.
Sutrina Lindl. (two spp.; Fig. 12) consists of
poorly known species from Amazonian Peru and
Bolivia. The yellow–green flowers have simple, linear
tepals and lip that do not open widely, forming a
tube-like structure. Nothing is known of pollination,
although morphology suggests pollination by nectarforaging insects.
Rodriguezia Ruiz & Pav. (48 spp.; Figs 2X, 12)
ranges from Mexico south to Argentina, with one
species (Rodriguezia lanceolata Ruiz & Pav.) found
on many islands in the Caribbean. The flowers are
relatively large, brightly coloured and showy for
members of the twig epiphyte clade. The lip is often
relatively large and flat, and the lateral sepals are
fused along one or both lateral margins to form a
curved nectar spur. A projection from the column
base secretes nectar into this spur. Reported pollinators include hummingbirds, butterflies and nectarforaging bees (Dodson, 1965). There are two strongly
supported clades within Rodriguezia, and Chase
(2009b) noted the non-monophyletic placement of
Rodriguezia decora Rchb.f. in nrITS trees published
in Genera Orchidacearum. This unusual Brazilian
species was not included our sampling, although it
may warrant generic status. It has long, wiry rhizomes between sympodia and lacks the spur found
in other species.
Schunkea Senghas (one sp.; Fig. 12) is known
only from south-eastern Brazil; the small cream
flowers have an open lip and an unusual pair of
downward-pointing arms on the column apex.
Nothing is known of pollination. Its placement within
this clade is unresolved, and Chase (2009b) hypothesized that it might be related to the monotypic
Suarezia from eastern Ecuador. The latter was not
included in our sampling.
Trizeuxis Lindl. (one sp.; Fig. 12) is wide ranging
from Costa Rica south to Peru and also in eastern
Brazil. Its flowers are perhaps the smallest of any
Oncidiinae, only 2–3 mm across, yet they are outcrossing and often found growing on twigs of cultivated
Citrus L and Psidium L. Pollinators are unknown,
although presumed to be small nectar-foraging
insects.
Seegeriella Senghas (two spp.; Fig. 12) is
restricted to Argentina and Brazil. Like Trizeuxis,
the yellow–green flowers are diminutive with a
simple lip and sepals that do not open widely. Pollinators are presumed to be nectar-seeking insects.
The remaining four genera are all pollinated by
fragrance-collecting male euglossine bees, and all but
Warmingia Rchb.f. have a narrow, slit-like stigma,
pollinaria with a button-like viscidium and a long,
narrow stipe and pollinia that are dorsiventrally
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
142
K. M. NEUBIG ET AL.
flattened and thin to match the opening of the
slit-like stigmatic cavity. The narrow pollinia and
stigmatic slit probably act to reduce self-pollination.
When first removed by a bee, the pollinia are too
wide to fit easily into the stigmatic slit, and the
stigma is too narrow (W. M. Whitten, pers. observ.).
The stigma widens after pollinarium removal. Several
minutes to hours of drying are required to shrink the
pollinia before they will slip into the stigma, during
which time the bee is likely to have flown to another
plant.
Macradenia R.Br. (ten spp.; Fig. 12) ranges from
Mexico south throughout most of lowland South
America. The pendent, unbranched inflorescence
bears numerous flowers that attract fragrancecollecting male euglossine bees. The anther is terminal and beaked, and the column and lip are twisted,
giving the flower a distinct asymmetry unique within
Oncidiinae. This asymmetry may be related to pollinarium deposition on the side of the head or eye of
the bee.
Warmingia Rchb.f. (three spp.; Fig. 12) has an
oddly disjunct distribution, including Costa Rica,
southern Ecuador and Brazil. Pollination has not
been reported, although their floral fragrance is
similar to some Macroclinium and is produced abundantly during the morning, suggestive of pollination
by male euglossine bees.
Macroclinium Barb. Rodr. (40 spp.; Figs 2Z, 12)
ranges throughout much of the Neotropics from
Mexico south to Peru and Brazil. The plants are
diminutive extreme twig epiphytes, and are often
found on cultivated Citrus and Psidium. The flowers
are similar in morphology and function to its sister
genus Notylia, although the two differ in inflorescence
and vegetative habit. Macroclinium species are often
monopodial, with small psygmoid fans generally
lacking pseudobulbs. The inflorescence is pendent,
pseudo-umbellate, with clusters of numerous delicate
flowers with narrow sepals, petals and lip. Despite
their small size, the fragrant flowers attract relatively
large male euglossine bees. Pollinaria are deposited
on the face (frons) of the bee during fragrance collection (Dodson, 1967).
Notylia Lindl. (60 spp.; Fig. 12) also range
throughout much of the Neotropics, similar to its
sister, Macroclinium. In contrast to the paedomorphic
fans of Macroclinium, plants of Notylia mature to
bear a pseudobulb and relatively large conduplicate
leaves. The flowers are similar to those of Macroclinium, although they are presented evenly spaced
on a pendent, usually unbranched raceme. Pollination
is also by fragrance-collecting male euglossine bees,
with pollinarium deposition on the labrum or frons of
the bee (Warford, 1992; Singer & Koehler, 2003;
Pérez-Hérnandez et al., 2011).
CONCLUSION
The present study presents well supported and highly
resolved phylogenetic hypotheses of relationships of all
major clades within Oncidiinae based on dense taxon
sampling. The deeper topology of this tree strongly
reflects the emphasis on plastid data. Additional
nuclear data sets such as Xdh (Górniak, Paun &
Chase, 2010) would be useful to increase support for
the topology and improve resolution of the spine of the
tree. Our translation of this tree into a generic classification results in the first classification of Oncidiinae
in which the genera are demonstrably monophyletic.
Comparison of our trees with previous classifications
reveals that most of the taxonomic disputes involve
clades that contain large numbers of species with
yellow ‘oncidioid’ floral morphology. We hypothesize
that widespread mimicry involving Malpighiaceae,
Oncidiinae and perhaps Calceolaria (Calceolariaceae)
has resulted in extensive homoplasy in gross floral
features within Oncidiinae. Previous noncladistic classifications of Oncidiinae were largely based on floral
characters, and the homoplasy in oil flower-related
floral traits resulted in non-monophyletic generic concepts. Clades with other pollination syndromes (e.g.
nectar reward/deceit or male euglossine fragrance
rewards) generally display fewer taxonomic disagreements. The generic scheme presented here paves the
way for monographic work and studies of character
evolution. Orchid taxonomists may still disagree on
which clades to recognize at generic level (e.g. within
Trichocentrum s.l.), although the phylogenetic hypotheses from the present study will be useful for framing
such debates.
ACKNOWLEDGEMENTS
The authors thank the herbaria of the Pontificia
Universidad Católica de Quito (QCA), the Universidad de Panamá (PMA), the Universidad de Costa
Rica (USJ), the Ministerio del Ambiente of Ecuador,
and the Autoridad Nacional del Ambiente of Panama
for facilitating our research and issuing collecting and
CITES permits. We are especially grateful to the
Portilla family and their staff at Ecuagenera Ltd.
(Ecuador), Andrés Maduro and staff at Finca Dracula
(Panama), Jardín Botánico Lankester (Costa Rica),
Marie Selby Botanical Gardens (Sarasota, FL, USA),
Atlanta Botanical Garden (Atlanta, GA, USA), Steve
Beckendorf (Berkeley, CA, USA), Harry and Andy
Phillips (Encinitas, CA, USA) and Günter Gerlach
(Munich Botanical Garden, Munich, Germany) for
allowing us generous access to their orchid collections. Delsy Trujillo contributed Peruvian specimens.
Samantha Koehler, Universidade Federal de São
Paulo, SP, Brazil and Aparacida de Faria, Univer-
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
ONCIDIINAE PHYLOGENETICS
sidade Estadual de Maringá, PR, Brazil contributed
data for Brazilian taxa. Robert L. Dressler and
Calaway H. Dodson helped to initiate this project
and provided access to specimens, taxonomic advice
and assistance with field work. Stig Dalström provided invaluable determinations of many specimens
and stimulating discussions. Kent Perkins (FLAS)
provided specimen curation and image databasing.
DNA sequencing was performed by the ICBR core
facility at University of Florida. This work was
supported by NSF grants DEB-9815821 to N.H.W.,
DEB-9509071 to W.M.W., DEB-0234064 to N.H.W.
and W.M.W., and IOB-0543659 to J.C.C., N.H.W. and
W.M.W., by grants from the American Orchid Society
Fund for Education and Research, the Florida
Museum of Natural History, and the Royal Botanic
Gardens, Kew. Additional funding was provided by
Furniss Foundation graduate student fellowships
from the American Orchid Society to M. A. Blanco
and L. Endara and by a RBG Kew Latin American
Research Fellowship to M. A. Blanco (to study specimens in European herbaria).
REFERENCES
Ackerman JD, Meléndez-Ackerman EJ, Salguero Faria
J. 1997. Variation in pollinator abundance and selection on
fragrance phenotypes in an epiphytic orchid. American
Journal of Botany 84: 1383–1390.
Aliscioni SS, Torretta JP, Bello ME, Galati BG. 2009.
Elaiophores in Gomesa bifolia (Sims) MW Chase & NH
Williams (Oncidiinae: Cymbidieae: Orchidaceae): structure
and oil secretion. Annals of Botany 104: 1141–1149.
Bembe B. 2004. Functional morphology in male euglossine
bees and their ability to spray fragrances (Hymenoptera,
Apidae, Euglossini). Apidologie 35: 283–291.
van den Berg C, Goldman DH, Freudenstein JV, Pridgeon AM, Cameron KM, Chase MW. 2005. An overview
of the phylogenetic relationships within Epidendroideae
inferred from multiple DNA regions and recircumscription
of Epidendreae and Arethuseae (Orchidaceae). American
Journal of Botany 92: 613–624.
Braem G. 1986. The taxonomy of plants formerly referred to
Oncidium section Oncidium (Orchidaceae) in the Caribbean
islands. PhD dissertation, University of Newcastle Upon
Tyne.
Braem G. 1993. Studies in the Oncidiinae, discussion of some
taxonomic problems with description of Gudrunia Braem,
gen. nov., and the reinstatement of the genus Lophiaris
Rafinesque. Schlecteriana 4: 8–29.
Braem G. 2010. Comments on plant taxonomy with special
reference to Orchidaceae and monospecific genera. Richardiana 10: 101–117.
Buchmann SL. 1987. The ecology of oil flowers and their
bees. Annual Review of Ecology and Systematics 18: 343–
396.
Buzatto CR, Davies KL, Singer RB, dos Santos RP. 2011.
143
A comparative survey of floral characters in Capanemia
Barb. Rodr. (Orchidaceae:Oncidiinae). Annals of Botany doi:
10.1093/aob/mcr241.
Buzatto CR, Singer RB, Romero-González GA, van den
Berg C. 2011. Typifications and new synonymies in Capanemia (Orchidaceae: Oncidiinae). Novon 21: 28–33.
Buzatto CR, Singer RB, van den Berg C. 2010. O gênero
Capanemia Barb. Rodr. (Oncidiinae: Orchidaceae) na Região
Sul do Brasil. Revista Brasileira de Biociências 8: 309–
323.
Cameron KM. 2004. Utility of plastid psaB gene sequences
for investigating intrafamilial relationships within Orchidaceae. Molecular Phylogenetics and Evolution 31: 1157–
1180.
Cameron KM, Chase MW, Whitten WM, Kores PJ,
Jarrell DC, Albert VA, Yukawa T, Hills HG, Goldman
DH. 1999. A phylogenetic analysis of the Orchidaceae: evidence from rbcL nucleotide sequences. American Journal of
Botany 86: 208–224.
Cane JH, Eickwort GC, Wesley FR, Spielholz J. 1983.
Foraging, grooming and mate-seeking behaviors of Macropis
nuda (Hymenoptera, Melittidae) and use of Lysimachia
ciliata (Primulaceae) oils in larval provisions and cell
linings. American Midland Naturalist 110: 257–264.
Carmona-Díaz G, García-Franco JG. 2009. Reproductive
success in the Mexican rewardless Oncidium cosymbephorum (Orchidaceae) facilitated by the oil-rewarding Malpighia glabra (Malpighiaceae). Plant Ecology 203: 253–261.
Charanasri U, Kamemoto H. 1975. Additional chromosome
numbers in Oncidium and allied genera. American Orchid
Society Bulletin 44: 686–691.
Chase MW. 1986a. Pollination biology of two sympatric,
synchonously flowering species of Leochilus in Costa Rica.
Lindleyana 1: 141–147.
Chase MW. 1986b. A reappraisal of the oncidioid orchids.
Systematic Botany 11: 477–491.
Chase MW. 1988. Obligate twig epiphytes: a distinct subset
of Neotropical orchidaceous epiphytes. Selbyana 10: 24–30.
Chase MW. 2005. Psychopsis limminghei. Curtis’s Botanical
Magazine 22: 53–55.
Chase MW. 2009a. A new name for the single species of
Nohawilliamsia and corrections in Gomesa (Orchidaceae).
Phytotaxa 1: 57–59.
Chase MW. 2009b. Subtribe Oncidiinae. In: Pridgeon AM,
Chase MW, Cribb PJ, Rasmussen FN, eds. Genera Orchidacearum, Vol. 5. Epidendroideae (part two). Oxford: Oxford
University Press, 211–394.
Chase MW, Cameron KM, Barrett RL, Freudenstein JV.
2003. DNA data and Orchidaceae systematics: a new phylogenetic classification. In: Dixon KW, Kell SP, Barrett RL,
Cribb PJ, eds. Orchid conservation. Kota Kinabalu: Natural
History Publications, 69–89.
Chase MW, Hanson L, Albert VA, Whitten WM, Williams
NH. 2005. Life history evolution and genome size in subtribe
Oncidiinae (Orchidaceae). Annals of Botany 95: 191–199.
Chase MW, Hills HH. 1991. Silica gel: an ideal material for
field preservation of leaf samples for DNA studies. Taxon 40:
215–220.
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
144
K. M. NEUBIG ET AL.
Chase MW, Olmstead RG. 1988. Isozyme number in subtribe Oncidiinae (Orchidaceae) – an evaluation of polyploidy. American Journal of Botany 75: 1080–1085.
Chase MW, Palmer JD. 1987. Chloroplast DNA systematics
of the subtribe Oncidiinae (Orchidaceae). American Journal
of Botany 74: 728–728.
Chase MW, Whitten WM. 2011. Further taxonomic transfers
in Oncidiinae (Orchidaceae). Phytotaxa 20: 26–32.
Chase MW, Williams NH, de Faria AD, Neubig KM,
Amaral MDCE, Whitten WM. 2009a. Floral convergence
in Oncidiinae (Cymbidieae; Orchidaceae): an expanded
concept of Gomesa and a new genus Nohawilliamsia.
Annals of Botany 104: 387–402.
Chase MW, Williams NH, Whitten WM. 2009b. Oncidiinae
nomenclature: generic changes in Genera Orchidacearum,
Vol. 5. Orchids 78: 228–238.
Christenson EA. 1999. The return of Cohniella (Orchidaceae: Oncidiinae). Lindleyana 14: 176–177.
Christenson EA. 2005. Phymatochilum, un nouveau genre
monotypique du Brésil (Orchidaceae: Oncidiinae). Richardiana 5: 194–196.
Christenson EA. 2006. Brevilongium, un nouveau genre
néotropical (Orchidaceae: Oncidiinae). Richardiana 6:
45–49.
Cribb PJ. 2009. Tribe Cymbidieae. In: Pridgeon AM, Chase
MW, Cribb PJ, Rasmussen FN, eds. Genera Orchidacearum,
Vol. 5. Epidendroideae (part two). Oxford: Oxford University
Press, 3–11.
Dalström S. 2001. A synopsis of the genus Cyrtochilum
(Orchidaceae: Oncidiinae): taxonomic reevaluation and new
combinations. Lindleyana 16: 56–80.
Damon AA, Cruz-López L. 2006. Fragrance in relation to
pollination of Oncidium sphacelatum and Trichocentrum
oerstedii (Orchidaceae) in the Soconusco region of Chiapas,
Mexico. Selbyana 27: 186–194.
Davies KL, Stpiczynska M. 2009. Comparative histology of
floral elaiophores in the orchids Rudolfiella picta (Schltr.)
Hoehne (Maxillariinae sensu lato) and Oncidium ornithorhynchum HBK (Oncidiinae sensu lato). Annals of Botany
104: 221–234.
Docha Neto A, Baptista DH, Campacci MA. 2006. Novos
generos baseadas nos Oncidium brasileiros. Coletâna de
Orquideas Brasileiras 3: 20–95.
Dod DD. 1976. Oncidium henekenii – bee orchid pollinated by
bee. American Orchid Society Bulletin 45: 792–794.
Dodson CH. 1957. Chromosome number in Oncidium and
allied genera. American Orchid Society Bulletin 26: 323–
330.
Dodson CH. 1962. The importance of pollination in the
evolution of the orchids of tropical America. American
Orchid Society Bulletin 31: 525–534 641–649,731–735.
Dodson CH. 1965. Agentes de polinización y su influencia
sobre la evolución de la familia Orquidacea. Universidad
Nacional de la Amazonía Peruana, Instituto General de
Investigación.
Dodson CH. 1967. Studies in orchid pollination: the
genus Notylia. American Orchid Society Bulletin 36:
209–214.
Dodson CH. 2003. Native ecuadorian orchids, Vol. 5.
Sarasota: The Dodson Trust.
Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure
for small quantities of fresh leaf tissue. Phytochemical
Bulletin, Botanical Society of America 19: 11–15.
Dressler RL. 1993. Phylogeny and classification of the orchid
family. Portland, OR: Dioscorides Press.
Dressler RL, Williams NH. 1975. El Complejo Oncidoglossum Confusum. Orquídea (México) 4: 332–352.
Eltz T, Roubik D, Lunau K. 2005. Experience-dependent
choices ensure species-specific fragrance accumulation in
male orchid bees. Behavioral Ecology and Sociobiology 59:
149–156.
Felsenstein J. 1985. Confidence limits on phylogenies – an
approach using the bootstrap. Evolution 39: 783–791.
Fernandez-Concha GC, de Stefano RD, RomeroGonzález GA, Balam R, Cetzal W, Tapia-Munoz JL,
Ramirez IM. 2009. A reappraisal of the turtle-orchids,
genus Chelyorchis (Oncidiinae: Orchidaceae): molecular,
phylogenetic, and morphometric approaches. Journal of the
Torrey Botanical Society 136: 164–185.
Fernandez-Concha GC, Ix WRC, Narvaez R, RomeroGonzález GA. 2010. A synopsis of Cohniella (Orchidaceae,
Oncidiinae). Brittonia 62: 153–177.
Garay LA. 1963. Oliveriana and its position in the Oncidieae.
American Orchid Society Bulletin 32: 19–24.
Garay LA, Stacy JE. 1974. Synopsis of the genus Oncidium.
Bradea 1: 393–429.
Górniak M, Paun O, Chase MW. 2010. Phylogenetic relationships within Orchidaceae based on a low-copy nuclear
coding gene, Xdh: congruence with organellar and nuclear
ribosomal DNA results. Molecular Phylogenetics and
Evolution 56: 784–795.
Jenny R. 2010. Otoglossum, una revisión taxonómica.
Orquideologia 27: 63–90.
Johnson LA, Soltis DE. 1994. matK DNA sequences and
phylogenetic reconstruction in Saxifragaceae s.st. Systematic Botany 19: 143–156.
Melo GAR, Gaglianone MC. 2005. Females of Tapinotaspoides, a genus in the oil-collecting bee tribe Tapinotaspidini, collect secretions from non-floral trichomes
(Hymenoptera, Apidae). Revista Brasileira De Entomologia
49: 167–168.
Molvray M, Kores PJ, Chase MW. 2000. Polyphyly of
mycoheterotrophic orchids and functional influences of
floral and molecular characters. In: Wilson KL, Morrison
DA, eds. Monocots: systematics and evolution. Collingswood:
CSIRO Publishing, 441–448.
Neubig KM, Whitten WM, Carlsward BS, Blanco MA,
Endara L, Williams NH, Moore M. 2009. Phylogenetic
utility of ycf1 in orchids: a plastid gene more variable than
matK. Plant Systematics and Evolution 277: 75–84.
Nierenberg L. 1972. The mechanism of the maintenance of
the species integrity in sympatrically occurring equitant
oncidiums in the Caribbean. American Orchid Society Bulletin 41: 873–881.
Pansarin LM, Castro MD, Sazima M. 2009. Osmophore
and elaiophores of Grobya amherstiae (Catasetinae, Orchi-
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
ONCIDIINAE PHYLOGENETICS
daceae) and their relation to pollination. Botanical Journal
of the Linnean Society 159: 408–415.
Parra-Tabla V, Vargas CF, Magana-Rueda S, Navarro J.
2000. Female and male pollination success of Oncidium
ascendens Lindey (Orchidaceae) in two contrasting habitat
patches: forest vs agricultural field. Biological Conservation
94: 335–340.
Pérez-Hérnandez H, Damon A, Valle-Mora J, SánchesGuillen D. 2011. Orchid polllination: specialization in
chance? Botanical Journal of the Linnean Society 165: 251–
266.
van der Pijl L, Dodson CH. 1966. Orchid flowers: their
pollination and evolution. Coral Gables, FL: University of
Miami Press.
Powell MP. 2008. Evolutionary ecology of Neotropical
orchids, with an emphasis on Oncidiinae. PhD dissertation,
University of Reading.
Reis MG, de Faria AD, Bittrich V, Amaral MDE, Marsaioli AJ. 2000. The chemistry of flower rewards –
Oncidium (Orchidaceae). Journal of the Brazilian Chemical
Society 11: 600–608.
Reis MG, de Faria AD, dos Santos IA, Amaral MDE,
Marsaioli AJ. 2007. Byrsonic acid – the clue to floral
mimicry involving oil-producing flowers and oil-collecting
bees. Journal of Chemical Ecology 33: 1421–1429.
Rojas Leal A. 1993. Anatomía foliar comparada de Lemboglossum (Orchidaceae: Oncidiinae) y generos relacionados.
Biólogo thesis, Universidad Nacional Autonoma de Mexico.
Roubik DW. 1989. Ecology and natural history of tropical
bees. New York, NY: Cambridge University Press.
Roy BA, Widmer A. 1999. Floral mimicry: a fascinating yet
poorly understood phenomenon. Trends in Plant Science 4:
325–330.
Salguero-Faria JA, Ackerman JD. 1999. A nectar reward:
is more better? Biotropica 31: 303–311.
Sandoval-Zapotitla E, García-Cruz J, Terrazas T,
Villasenor JL. 2010. Phylogenetic relationships of the
subtribe Oncidiinae (Orchidaceae) inferred from structural
and DNA sequences (matK, ITS): a combined approach.
Revista Mexicana De Biodiversidad 81: 263–279.
Sandoval-Zapotitla E, Terrazas T. 2001. Leaf anatomy of
16 taxa of the Trichocentrum clade (Orchidaceae: Oncidiinae). Lindleyana 16: 81–93.
Sazima M, Sazima I. 1988. Oil-gathering bees visit flowers of
eglandular morphs of the oil-producing Malpighiaceae.
Botanica Acta 102: 106–111.
Senghas K. 1997. Rudolf schlecter’s die orchideen, band i/c,
33-36. Berlin: Paul Parey.
Senghas K. 2001. Neobennettia, eine neue Gattung aus den
peruanischen Anden – mit einem Uberblick zur Gattung
Lockhartia. Journal für den Orchideenfreund 8: 354–364.
Sigrist MR, Sazima M. 2004. Pollination and reproductive
biology of twelve species of neotropical Malpighiaceae:
stigma morphology and its implications for the breeding
system. Annals of Botany 94: 33–41.
Silvera K. 2002. Adaptive radiation of oil-reward compounds
among neotropical orchid species (Oncidiinae). MS Thesis,
University of Florida.
145
Silvera K, Neubig KM, Whitten WM, Williams NH,
Winter K, Cushman JC. 2010a. Evolution along the crassulacean acid metabolism continuum. Functional Plant
Biology 37: 995–1010.
Silvera K, Santiago LS, Cushman JC, Winter K. 2010b.
The incidence of crassulacean acid metabolism in Orchidaceae derived from carbon isotope ratios: a checklist of the
flora of Panama and Costa Rica. Botanical Journal of the
Linnean Society 163: 194–222.
Silvera K, Santiago LS, Cushman JC, Winter K. 2009.
Crassulacean acid metabolism and epiphytism linked to
adaptive radiations in the Orchidaceae. Plant Physiology
149: 1838–1847.
Singer RB, Cocucci AA. 1999. Pollination mechanisms in
four sympatric southern Brazilian Epidendroideae orchids.
Lindleyana 14: 47–56.
Singer RB, Koehler S. 2003. Notes on the pollination of
Notylia nemorosa (Orchidaceae): do pollinators necessarily
promote cross-pollination? Journal of Plant Research 116:
19–25.
Sosa V, Chase MW, Salazar GE, Whitten WM, Williams
NH. 2001. Phylogenetic position of Dignathe (Orchidaceae:
Oncidiinae): evidence from nuclear ITS ribosomal DNA
sequences. Lindleyana 16: 94–101.
Soto M, Salazar GA, Rojas Leal A. 1993. Nomenclatural
changes in Rhynchostele, Mesoglossum, and Lemboglossum
(Orchidaceae, Oncidiinae). Orquídea (México) 13: 145–152.
Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihoodbased phylogenetic analyses with thousands of taxa and
mixed models. Bioinformatics 22: 2688–2690.
Stpiczynska M, Davies KL. 2008. Elaiophore structure and
oil secretion in flowers of Oncidium trulliferum Lindl. and
Ornithophora radicans (Rchb.f.) Garay & Pabst (Oncidiinae
: Orchidaceae). Annals of Botany 101: 375–384.
Stpiczynska M, Davies KL, Gregg A. 2007. Elaiophore
diversity in three contrasting members of Oncidiinae
(Orchidaceae). Botanical Journal of the Linnean Society
155: 135–148.
Sun Y, Skinner DZ, Liang GH, Hulbert SH. 1994. Phylogenetic analysis of Sorghum and related taxa using internal
transcribed spacers of nuclear ribosomal DNA. Theoretical
and Applied Genetics 89: 26–32.
Szlachetko DL. 1995. Systema orchidalium, fragmenta floristica et geobotanica. Supplementum 3. Kraków: W. Szafer
Institute of Botany, Polish Academy of Sciences.
Szlachetko DL. 2006. Genera et species orchidalium. 11.
Oncidieae. Polish Botanical Journal 51: 39–41.
Szlachetko DL, Mytnik-Ejsmont J, Romowicz A. 2006.
Genera et species orchidalium. 14. Oncidieae. Polish Botanical Journal 51: 53–55.
Tanaka R, Kamemoto H. 1984. Chromosomes in orchids:
counting and numbers. In: Arditti J, ed. Orchid biology:
reviews and perspectives, III. Ithaca, NY: Cornell University
Press, 324–410.
Tavare S. 1986. Some probabilistic and statistical problems
in the analysis of DNA sequences. Lectures on Mathematics
in the Life Sciences 17: 56–86.
Toscano de Brito ALV, Dressler RL. 2000. New combina-
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
146
K. M. NEUBIG ET AL.
tions in Ornithocephalus (Ornithocephalinae: Orchidaceae)
and description of a new species from Mesoamerica. Lindleyana 15: 252–256.
Vale A, Navarro L, Rojas D, Álvarez JC. 2011. Breeding
system and pollination by mimicry of the orchid Tolumnia
guibertiana in Western Cuba. Plant Species Biology 26:
163–173.
Warford N. 1992. Pollination biology: the reciprocal agreement between Notylia and Euglossa viridissima. American
Orchid Society Bulletin 61: 885–889.
Whitten MW, Williams NH, Chase MW. 2000. Subtribal
and generic relationships of Maxillarieae (Orchidaceae)
with emphasis on Stanhopeinae: combined molecular evidence. American Journal of Botany 87: 1842–1856.
Whitten WM. 2009. Nohawilliamsia: a new genus honors
Norris H. Williams, PhD. Orchids 78: 552–555.
Williams NH. 1972. A reconsideration of Ada and the
glumaceous
brassias
(Orchidaceae).
Brittonia
24:
93–110.
Williams NH. 1982. The biology of orchids and euglossine bees. In: Arditti J, ed. Orchid biology: reviews and
perspectives II. Ithaca, NY: Cornell University Press, 119–
171.
Williams NH, Chase MW, Fulcher T, Whitten WM. 2001a.
Molecular systematics of the Oncidiinae based on evidence
from four DNA sequence regions: expanded circumscriptions
of Cyrtochilum, Erycina, Otoglossum, and Trichocentrum
and a new genus (Orchidaceae). Lindleyana 16: 113–
139.
Williams NH, Chase MW, Whitten WM. 2001b. Phylogenetic positions of Miltoniopsis, Caucaea, a new genus,
Cyrtochiloides, and Oncidium phymatochilum (Orchidaceae:
Oncidiinae). Lindleyana 16: 272–285.
Williams NH, Whitten WM, Dressler RL. 2005. Molecular
systematics of Telipogon (Orchidaceae: Oncidiinae) and its
allies: nuclear and plastid DNA sequence data. Lankesteriana 5: 163–184.
Xu DH, Abe J, Sakai M, Kanazawa A, Shimamoto Y.
2000. Sequence variation of non-coding regions of chloroplast DNA of soybean and related wild species and its
implications for the evolution of different chloroplast
haplotypes. Theoretical and Applied Genetics 101: 724–
732.
Zimmerman JK, Aide TM. 1987. Patterns of flower and
fruit production in the orchid Aspasia principissa Rchb.f.
American Journal of Botany 74: 661–661.
Zimmermann Y, Roubik DW, Quezada-Euan JJG,
Paxton RJ, Eltz T. 2009. Single mating in orchid bees
(Euglossa, Apinae): implications for mate choice and social
evolution. Insectes Sociaux 56: 241–249.
SUPPORTING INFORMATION
Additional Supporting Information may be found in the online version of this article:
Appendix S1. List of voucher specimens and GenBank numbers. The DNA numbers correspond to individuals
sequenced in Figs 3–12.
Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials
supplied by the authors. Any queries (other than missing material) should be directed to the corresponding
author for the article.
© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146
Lorena Endara
Mario Blanco