VOLUME 5 Biology and Taxonomy Table of Contents Preface 1 Cyanogenic Glycosides in Bamboo Plants Grown in Manipur, India ................................................................ 2 The First Report of Flowering and Fruiting Phenomenon of Melocanna baccifera in Nepal........................ 13 Species Relationships in Dendrocalamus Inferred from AFLP Fingerprints .................................................. 27 Flowering gene expression in the life history of two mass-flowered bamboos, Phyllostachys meyeri and Shibataea chinensis (Poaceae: Bambusoideae)............................................................................... 41 Relationships between Phuphanochloa (Bambuseae, Bambusoideae, Poaceae) and its related genera ......... 55 Evaluation of the Polymorphic of Microsatellites Markers in Guadua angustifolia (Poaceae: Bambusoideae) ......................................................................................................................................... 64 Occurrence of filamentous fungi on Brazilian giant bamboo............................................................................. 80 Consideration of the flowering periodicity of Melocanna baccifera through past records and recent flowering with a 48-year interval........................................................................................................... 90 Gregarious flowering of Melocanna baccifera around north east India Extraction of the flowering event by using satellite image data ....................................................................................................... 100 Preface Everyone knows how ecologically, economically and/or traditionally important bamboos are. They can be used as an alternative to wood in a variety of ways. To be able to study any more-advanced research topics or utilization, however, it is necessary to understand the fundamentals on bamboo biology and taxonomy, including systematics. This session is contributing the most basic but the most important part among bamboo researches. It is chaired by De Zhu Li and co-chaired by Sarawood Sungkaew. D.Z. Li is a well-known bamboo taxonomist at Kunming Institute of Botany, Yunnan, who has contributed hundreds of papers for the world of bamboo taxonomy and biology. S. Sungkaew is regarded as a young-blood bamboo taxonomist who has been currently nominated to be a member of BPG (Bamboo Phylogeny Group, http://www.eeob.iastate.edu/research/bamboo/). VIII World Bamboo Congress Proceedings Vol 5-1 Cyanogenic Glycosides in Bamboo Plants Grown in Manipur, India Kananbala Sarangthem, Hoikhokim, Th.Nabakumar Singh and G.A.Shantibala Department of Life Sciences, Manipur University, Canchipur, Manipur,India Abstract Bamboo cultivation is practiced in many tropical countries. In Manipur ,India the fresh succulent bamboo shoot slices, locally called ‘Soibum’ is a highly prized vegetable item. Cyanogenic glycosides are phytotoxins which occur as secondary plant metabolites found in nature. . The cyanogenic glycosides present in bamboo shoots are Taxiphyllin. Taxiphyllin is hydrolysed to glucose and hydroxybenzaldehyde cyanohydrin. This benzaldehyde cyanohydrin then decomposes to hydroxy benzaldehyde and Hydrogen cyanide (HCN). By adequate processing like peeling ,slicing, fermenting, repeated washing, boiling,cooking ,roasting and canning, the cyanogenic glycosides and HCN can be reduced prior to consumption ,thus significantly reducing the potential health risk. Keywords: Cyanogenic glycosides, Bamboo, Manipur Introduction Bamboo is a group of woody perennial evergreen plants in the grass family Poaceae, subfamily Bambusoideae, tribe Bambuseae. Some of its members are giant bamboo , forming by far the largest members of the grass family. Bamboo is the fastest growing woody plant in the world. Their growth rate (4.7inches/day)) is due to a unique rhizome-dependent system, but is highly dependent on local soil and climate conditions. They are of economic and high cultural significance in East Asia and South East Asia where they are used extensively as a building material, in gardens, and as a food source. The shoots (new bamboo culms that come out of the ground) of bamboo (fig.1) are edible. They are used in numerous Asian dishes, and are available in markets in various sliced forms, both fresh and canned version. In Manipur, the fresh succulent bamboo shoots and the fermented preparation of bamboo shoot slices (fig.2), locally called “soibum” is a highly prized vegetable item. The “soibum” (fig.3) is manufactured traditionally by storing thin slices of fresh succulent and soft bamboo shoots in specialised containers/chambers for 2-3 months. The fermented chambers are either made of bamboo planks or roasted earthern pots. The inner surface of bamboo chambers are lined with banana leaves and a thin polythene sheets. There are different localities in Manipur where traditional fermentation of bamboo shoots is in progress (Khongkhang,Bishnupur, Andro,Noneh, Tengnoupal,Churachandpur,Kotha etc.). Bamboo shoots of many species like Bambusa tulda,B. balcooa, Dendrocalamus hamiltonii, Melocanna bambusoides, Arundanaria callosa were used for fermentation purpose. VIII World Bamboo Congress Proceedings Vol 5-2 Bamboo shoots are traditional component of Asian cuisine. Its consumption increase world wide expanding from oriental to western world and a health warning is appropriate as bamboo shoots contain cyanogenic glycosides that break down to produce hydrogen cyanide(HCN) , which can cause both acute and chronic toxicity in humans(Food Standards Australia, New Zealand,2005) . However, the cyanide content is reported to decrease substantially following harvesting. By adequate processing like peeling ,slicing, fermenting and cooking , the cyanogenic glycosides can be reduced prior to consumption ,thus significantly reducing the potential health risk. Cyanogenic glycosides are phytotoxins which occur as secondary plant metabolites in at least 2000 plant species, of which a number of species are used as food in some areas of the world. Cassava and sorghum are especially important staple foods containing cyanogenic glycosides (Conn1979; Nartey 1980; Rosling 1994). There are approximately 25 cyanogenic glycosides known. The major cyanogenic glycosides found in the edible parts of plants being; amygdalin (almonds); dhurrin(sorghum); linamarin& lotaustralin (cassava,lima beans); prunasin(stone fruit);and taxiphyllin(bamboo shoots). The potential toxicity of a cyanogenic plant depends primarily on the potential that its consumption will produce a concentration of HCN that is toxic to exposed animals or humans . Several factors are important in this toxicity: The first aspect is the processing of plant products containing cyanogenic glycosides. When the edible parts of the plants are macerated, the catabolic intracellular enzyme ß-glucosidase can be released, coming into contact with the glycosides. This enzyme hydrolyzes the cyanogenic glycosides to produce hydrogen cyanide and glucose and ketones or benzaldehyde(Harborne1972,1993). The hydrogen cyanide is the major toxic compound causing the toxic effects. The cyanogenic glycosides present in bamboo shoots is Taxiphyllin. Taxiphyllin is hydrolysed to glucose and hydroxybenzaldehyde cyanohydrin. This benzaldehyde cyanohydrin then decomposes to hydroxy benzaldehyde and HCN ( Schwarzmair 1997). Plant products , if not adequately detoxified during the processing or preparation of the food, are toxic because of the release of this preformed hydrogen cyanide. The second aspect is the direct consumption of the cyanogenic plant. Maceration of edible parts of the plants as they are eaten can release ß-glucosidase. The ßglucosidase is then active until the low pH in the stomach deactivates the enzyme. Additionally, it is possible that part of the enzyme fraction can become reactivated in the alkaline environment of the gut. At least part of the potential hydrogen cyanide is released, and may be responsible for all or part of the toxic effect of cyanogenic glycosides in the cases of some foods (WHO,1993). In the intact plant, the enzyme and the glycosides remain separated , but if the plant tissue is damaged both are put in contact and cyanohydric acid is released (Bell 1981;Grunert et al.,1994). Cyanohydric acid is extremely toxic to a wide spectrum of organism, due to its ability of linking with metals( Fe++, Mn++ andCu++) that are functional groups of many enzymes inhibiting the reduction of oxygen in the cytochrome respiratory chain, electron transport in the photosynthesis and the activities of enzymes such as catalase ,oxidaes( Cheeke 1995). The level of cyanogenic glycosides produced is dependent upon the age and variety of the plant, as well as environmental factors(Cooper-Driver & Swain1976;Woodhead&Bernays, 1977). Although there are reports elsewhere of bamboo species containing significant potentially very toxic amounts of cyanogenic glycosides in their shoots, however the available materials does not confirm that some bamboo species do indeed contain very VIII World Bamboo Congress Proceedings Vol 5-3 high level of cyanogenic glycosides in their shoots .There are no clear differences between species and sufficient information to generalised. The present work is undertaken to assess cyanogenic glycosides in fresh and fermented succulent bamboo shoots to stimulate new uses of bamboo shoots in existing markets and to assist developing foods security in food poor areas. Materials and Methods The emerging young fresh succulent bamboo shoots (about 20cm in diameter and 15cm in height) of the species of Bambusa balcooa, B. tulda, Dendrocalamus halmiltonii, Arundinaria callosa, , Bambusa pallida etc., were collected during the growing season(month of May–September 2008) from different districts/localities of Manipur( Churachandpur, Khongkang, Tengnoupal,Phalbung, Kangpokpi and Bashikhong) . Different portions of the fresh succulent bamboo shoots (outer hard sheath, inner soft shoots and other parts of the bamboo plants) were assessed for cyanide content The traditionally fermented samples were collected from different districts/localities in Manipur where traditional fermentation of bamboo shoots is done in large scales (Khongkhang , Andro,Noneh, Tengnoupal,Churachandpur,Kotha etc.). Bamboo shoots of many species like Bambusa tulda, B. balcoa, Dendrocalamus hamiltonii, Melocanna bambusoides, Arundanaria callosa were used for fermentation Estimation of Cyanogenic Glycosides: Cyanogenic glycosides estimation was done using the technique of the picrate-impregnated paper according to Bradbury et al., 1999. Fresh plant material (bamboo shoots) was cut into small thin slices and placed into a small flat bottomed vial. Phosphate buffer (0.5ml of 0.1M at pH7) was added followed by brief crushing the materials with a glass rod. A picrate paper (fig.4) attached to a plastic backing strip was added and the vial immediately closed with a screw stopper. After about 16h at 30o C, the picrate paper was removed and immersed in 5.0ml water for not less than 30 min. The absorbance was measured at510nm and the total cyanide content was determined Results and Discussions The results in table. 1 give the total cyanide content of tip, middle, and base of the outer hard sheath (discarded portion) covering the soft inner tissues and the inner soft bamboo shoots samples taken for consumption as food determined by the picrate method. The results showed an average of 0.02 to 0.17mg/g of HCN in the outer hard sheath and 0.03 to 1.7 mg/g of HCN in the soft portion of the bamboo shoots. The total cyanide levels are highest at the tip and lowest at the base of the soft inner shoot but just the reverse for the hard cover sheath. Table 2 represents the total cyanide content in different portion of the bamboo plants( Melocanna bambusoides and Bambusa pallida). The fleshy fruits of muli- Melocanna bambusoides (fig.5)are eaten raw or cooked –its seeds are also eaten by the people as a substitute for rice.It also content low concentration of HCN(0.01mg/g) which renders it toxic free for consumption. The rhizome ,which is not utilized contain high content of VIII World Bamboo Congress Proceedings Vol 5-4 HCN(0.14mg/g). The acute lethal dose of HCN for human beings is 0.5-3.5 mg/kg body weight, animals is 0.66 to 15mg/kg body weight .Cyanide inhibits the action of cytochrome oxidase, carbonic anhydrase & other enzyme system. It blocks the final step of oxidative phosphorylation and prevents the formation of ATP and its use as energy source.It reduce the oxygen carrying capacity of the blood by combining with the ferric iron atom (Harborne1972,1993) . Bamboo shoots may contain significantly higher levels of HCN, however ,the HCN content is reduced substantially during fermentation processing prior to consumption as in Table 3 . Since HCN are highly volatile ,the loss of HCN during the fermentation processes like peeling,slicing,cutting ,repeated washing(3-4 times) is quite rapid. During cooking/parboiling ,roasting and canning reduces the HCN below the toxic level . Boiling bamboo shoots for 20 min. at 980 C removed nearly 70% of the total HCN content but higher temperature and longer intervals removed progressively up to 96%( Ferreira et al., 1995). Thus it may perhaps not present a problem for consumers. However, due care in preparation remain necessary. VIII World Bamboo Congress Proceedings Vol 5-5 References Bell, E.A.1981.The biochemistry of plants.Academic Press,New York Bradbury,M.G., Egan,S.V.,and Bradbury,J.H.1999.Determination of all forms of cyanogens in cassava roots and cassava products using picrate paper kits. Journal of the Science of food and agriculture, 49, 93-99 Cheeke,P.r.1995.Endogenous toxins and mycotoxins in forage and their effects on livestock.J.Ani.Sci.,73,909918 Conn , E.E. 1979. Cyanogenic glycosides. International review of biochemistry. In Biochemistry and Nutrition 1A, Neuberger, A., & Jukes, T.H. (eds), University Park Press, Baltimore, 27 ,21-43. Cooper-Driver,G.A.;Swain,T.1976. Cyanogenic polymorphism in bracken in relation to hervivore predation .Nature, 260 ,604 Ferriera,V.L.P.; Yotsuyanagi ,K.; and Carvalho, C.R.L.1995. Elimination of cyanogenic compounds from bamboo shoots Dendrocalamus giganteus Munro.Trop.Sci.,35,342-346 Gruhnert,C.:Biehl,B.;Selmar,D.1994.compartmentation of cyanogenic glucosides and their degrading enzymes.Planta,195,36-42 Harborne, J.B. 1972 .Cyanogenic glucosides and their function. In: Phytochemical ecology.Academic Press, London,104-123 Harborne,J.B.1993. Plant toxins and their effects on animals. In: introduction to Ecological Biochemistry. Academic Press,London,71-103 Nartey, F. 1980. Toxicological aspects of cyanogenesis in tropical foodstuffs in Toxicology in the Tropics. Editors R.L. Smith and E.A. Bababumni, Taylor & Francis Ltd, London, 53-73. Rosling,H.1994. Measuring effects in humans of dietary cyanide exposure from cassava.Acta Horticulture,375,271-283 Schwarzmaier,U.1977.Cyanogenesis of Dendrocalamus: taxiphyllin. Phytochemistry .16,1599-1600 Woodhead,S.; Bernays,E.1977.Change in release rates of cyanide in relation to palatability of Sorghum to insects.Nature,270,235-236 World Health Organization (WHO) 1993. Toxicological evaluation of certain food additives and naturally occurring toxicants. WHO Food Additive Series;30. World Health Organization, Geneva. VIII World Bamboo Congress Proceedings Vol 5-6 Table.1: Total cyanide content in bamboo plants determined by Picrate method VIII World Bamboo Congress Proceedings Vol 5-7 Table.2: Total cyanide content in different parts of the bamboo plants determined by Picrate method Table.3: Total cyanide content in fermented bamboo shoot slices (soibum) VIII World Bamboo Congress Proceedings Vol 5-8 VIII World Bamboo Congress Proceedings Vol 5-9 VIII World Bamboo Congress Proceedings Vol 5-10 VIII World Bamboo Congress Proceedings Vol 5-11 VIII World Bamboo Congress Proceedings Vol 5-12 The First Report of Flowering and Fruiting Phenomenon of Melocanna baccifera in Nepal Keshab Shrestha Natural History Museum, Swayambhu, Kathmandu, Nepal Abstract Melocanna baccifera is a bamboo species found in eastern, central and western part of Nepal. Least information is available about this bamboo in Nepal so far. This bamboo showed sporadic flowering for the first time in Nepal in 2007-2008. Flower showed dimorphism, upper part being sterile where as the lower part is fertile bearing numerous pear shaped fruits. This paper deals with the flowering, fruiting phenomenon and ethnobotanical use of this bamboo species in Nepal. Introduction Nepal is a small country in the world occupying about 0.09 percent of the earth’s surface with the area of 147,181 sq.km. Due to topographical variation within a short range starting from 64 m of elevation to the highest altitude of 8,848 m, Nepal is regarded as a high biodiversity zone and possesses 6500 species of higher plants including Bamboo species. Nepal possesses 81 species of bamboo out of 1,573 species worldwide. It comes to be about 24 percent in world’s ratio. In Nepal, bamboo occupies about 62,890 hectares of land. The natural forest hosts 38,000 hectares and rest is agricultural land. The total standing stock has been estimated at 15 million cubic meters with biomass value of 1,060 metric tons. The annual production of bamboo is estimated at 3.01 million cubic of which 2.64 million culms are consumed locally and 0.64 million culms are exported to India (Kesari, 2005). Nepal has 5 genera and 27 species under large bamboo species which are commonly called Bans in local language and come in Bambusae tribe. Small bamboos include 15 genera and 35 species. On the other hand 3 genera and 4 species fall under dwarf bamboo species. Of them, 45 species are indigenous and rest is exotic. Melocanna baccifera is a large bamboo species found in Nepal. Methodology Eastern and Central Nepal were visited in course of regular plant survey from Natural History Museum, likewise a private visit was also arranged to study the fruiting phenomenon. Informations were gathered from the local people. Interviewing with local inhabitants and collection of the samples were done during the flowering and non-flowering seasons. Relevant literatures (Poudyal, 2006, Keshari (2005), Shrestha 1998, 200; Stapleton VIII World Bamboo Congress Proceedings Vol 5-13 1994, Gamble 1896 and Shibata personal communication 2008) were consulted. Help from sketching and photographs were also taken. Other associated plants were also recorded with their local names Result There are altogether five species of Melocanna, but Nepal represents only one described species so far. The author for the first time found this species from east Nepal in 1996. This species is very interesting in terms of culms, rhizomes and fruits, but there is no report of fruiting of this species till 2008. The author found the species in Bahundangi and Sanischare village of Jhapa district in east Nepal in 1996. The culms were found growing along the edge of the paddy field where it formed a line of culms surrounding the agricultural land. The bamboo was erect, smooth without any branches and was cylindrical (Fig. 1). The erect shoot has uniform culms whose diameter was almost 5.0 cm and culm height ranges from 15.0 to 18.3 cm, the culms were green and spiny, occasionally with yellowish-green internodes and white cuticles below the nodes. The culm-wall was thin and non durable. Culm-sheaths were persistent and brittle. Sheath blade was very long and narrow. Half of the culms were without branches. Almost similar sized branches arose from every node. The leaves were large. Flowers: For the first time in Nepal flowers appeared in 2007. The flower started to appear in 2007 and lasted till the summer of 2008. Thereafter large sized fruiting resembling a pear appeared in early 2008. Its fruiting attracted many peoples of that area. Inflorescence: The inflorescence was large compound panicle. Spikelets were acuminate fasciculate and one sided (Fig. 2). There were two types of flowers; one was in fertile stage and the next on sterile nodes in the same culm. The fertile flowers were at the lower nodes whereas sterile were at the upper nodes of the culms. There were several sterile and fertile flowers arising from the same nodes and were hanging down from the nodes (Fig. 3,4). Empty sterile glumes were indefinite, acuminate, and striate. Flowering glumes similar to empty glumes, palea also similar, not keeled. Lodules two and narrow Stamens five to seven Filaments free or irregularly joined Ovary glabrous Style elongated Stigma two to four, short and hairy Fruit caryopsis, very large and pear shaped (Fig 5 ) with long beaked pericarp very thick, Greenish-yellowishwhite skin externally. Small whitish ovules were embedded in a cavity filled with liquid (Fig.6) Ethnobotany: Melocanna baccifera are reported in many parts of Nepal except the far west region. In the eastern Jhapa, Central in Rautahat and Chitwan and Pokhara, Syangja and Palpa districts in the west. VIII World Bamboo Congress Proceedings Vol 5-14 Locally the species is known as Philinge Bans in the eastern and Lahure Bans in the western Nepal. In central Nepal, it does not have any common name. Since the fruiting was not observed but most of the peoples believe that the bamboo has never a big fruit like Melocanna and the fruiting is due to some misfortune. Due to this ignorancy, villagers cut all the culms and throw them away (Fig. 7 ). The fruits are used as game ball for children. Hundreds of people visited this place to see this unique body of fruit (Fig. 8). Children generally cut the fruit and taste the sap inside which they liked most due to its sweet test like that of coconut-fluid. People do not have idea that the shoots are edible, but villagers before fruiting used the culm for basketry, mat, house wall, roof gum or fluid and leaves as fodder. The bamboos were planted nearby their houses or huts and kitchen garden. Other species of bamboo like Dendrocalamus strictus, Bambusa nutans, and Dendrocalamus gigantean were also noticed in central and east Nepal. They are used as hedge to boarder paddy fields and consider ornamental due to its beautiful poles and amphimorph or metamorph nature. Due to its more publicity, media were also attracted to the village and made interesting telecast in television also. Popular newspapers are looking for more information about this bamboo species. The author made clear of the rumors that such phenomena with this bamboo occur once in 7-51 years in other countries like India, Bangladesh, China, Indonesia, Myanmar and Sri Lanka. This was the first observation in Nepal; this bamboo has many values and should be conserved effectively. Table 1. Associate Species around Melocanna baccifera Grove in Pourai Village, Rautahat District 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. Ficus semicordata (Kanyu) Morus macroura (Kimbu) Zingiber Anthocephalus chinensis (Kadam) Zizyphus mauritiana (Bayer) Bauhinia variegata (Koiralo) Syzygium cumini (Jamun) Piper longum (Pipla) Solanum surrattense (Kantakari) Cissampelos pareira (Jaluko) Musa paradisiaca (Kera) Ageratum conyzoides (Gande) Amaranthus spinosus (Lunde kanda) Shorea robusta (Sal) Dioscorea bulbifera Colebrookea oppositifolia (Gittha) Thysanolaena maxima (Amliso) Ficus racemosa (Dumri) Tinospora sinensis (Gurjo) Annona squamata (Saripha) Dalbergia sisso (Sisau) Eupatorium odoratum (Tite hawi) VIII World Bamboo Congress Proceedings 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. Moringa oleifera (Sahijan) Bombax ceiba Caesalpinia dicapeta (Arile kanda) Mimosa pudica (Lajwanti) Ricinus communis (Ander) Cynodon dactylon (Dubo) Stellaria monosperma (Jethi madhu) Bambusa nutans (Mal bans) Dendrocalamus strictus (Lathi bans) Dendrocalamus hookeri (Bhalu bans) Bambusa multiplex Schleichera oleosa (Kusum) Prunus persica (Aru) Anogeissus latifolia (Bhanjhi) Litchi chinensis (Litchi) Perilla frutescens (Silam) Lagerstoemia parviflora (Botdhaiyaro) Cannabis sativa (Bhang) Persicaria pentagyna (Pire) Polygonum hidropiper Diplazium esculentum (Pani nyuro) Vol 5-15 Ethnic people of the area in Pourai Village: Tamang, Thing, Bhote, Bamjang (Fig. 9), Jimba, Pakhin, Gurung, Magar, Yonzon, Majhi, Gongaba, Thokar, Syanba, Kami, Damai, Danuwar, Rai, Shrestha Others: Mainali, Nyoupane (Brahmins) and Chhetri. Occupation: Agriculture and forestry. Conclusion Flowering in Melocanna beccifera occurs after a period of 30-40 years, but the propagation of this bamboo is as easy as other species. Seeds if available propagates easily and from propagates this species can easily be proliferated even in Kathmandu. The fruits very easily fall down on ground even by a gentle breeze or wind and germinate quickly. Large pear shaped fruiting makes the bamboo very attractive, the villagers in Nepal have no idea about the importance of this species and believe on misfortune when the plant blossom. They also destroyed all the calms after flowering and fruiting due to ignorancy. Fruits and young shoots are eaten in Bangladesh and India. Culms are strongly used to different purposes including paper making and scaffolding. This plant if used under sustainable way may help to reduce poverty to some extent. This plant adds beautifying orchard, control erosion and help to bring prosperity in the society. Conservation education has been felt essential so to conserve bamboos like Melocanna species in Nepal. Acknowledgement The author is thankful to the Natural History Museum, Tribhuvan University for all the necessary permission for this study. Thanks are due to the local and media peoples of that area for encouragement and remarks on the conservation of the bamboo. Last but not the least thank is due to Mr. Bhaiya Khanal, Associate Professor for his constant help in the field and reading this manuscript. VIII World Bamboo Congress Proceedings Vol 5-16 Reference Anonymous 2008, Samacharpatra daily newspaper. May 10 --------------------1998. Distribution of Bamboos in India. Bamboo and Rattan Genetic Resources in Certain Asian Countries. Edited by Vivekananda, K., A.N. Rao and V. Ramanatha Rao. IPGRI, INBAR, Malaysia.Pp 46-61. Gamble, J. S. 1896: The Bambusae of British India, Annals of the Royal Botanic Garden, Calcutta, Micro Methods Limited, Johnson Reprint Corporation. Keshari, V.P. 2005 Bamboo: From Poor Man’s Timber to Green Gold. Hamro Kalpana Brikshya (15) (164): 1014, Department of Forest, Kathmandu, Nepal. Poudyal, P.P. (2006): Bamboos of Sikkim (India), Bhutan and Nepal. New Hira Books Enterprises, Nepal. Seethalakshi, K.K and M.S. Muktesh Kumar1998Bamboos of India a compendium. Bamboo Information centre-India, Kerala Forest Research Institute, Peechi and International Network for Bamboo and Rattan, Beijing, Endogen and New Delhi Shibata S. 2008. Personnel communication by email. Shrestha, K. 1998. Distribution and Status of Bamboos in Nepal. Bamboo Workshop and Conference, Integrated Plant Genetic Research International, Beijing, RP. China www2.bioversityinternational.org/publications/Web_version/572/ch29.htm Shrestha, K. (2008): Bamboo and Environment (In Nepali); Hamro Sampada Ed. S.K. Basnet. P.p. 175-177. Stapleton, C. (1994): Bamboos of Nepal. Royal Botanic Garden, Kew, Richmond, Survey. TW9 3AE, England, U.K. VIII World Bamboo Congress Proceedings Vol 5-17 Fig.1.Melocanna baccifera in the paddy field VIII World Bamboo Congress Proceedings Vol 5-18 Fig.2. Flowering spikelet VIII World Bamboo Congress Proceedings Vol 5-19 Fig.3 Empty glume VIII World Bamboo Congress Proceedings Vol 5-20 Fig. 4 Sterile flowers VIII World Bamboo Congress Proceedings Vol 5-21 Fig.5. Fruits and flowers together VIII World Bamboo Congress Proceedings Vol 5-22 Fig. 6. Ovule in the cavity VIII World Bamboo Congress Proceedings Vol 5-23 Fig.7. Removing culm with fruits by the villagers VIII World Bamboo Congress Proceedings Vol 5-24 Fig.8. Villagers play with the fruits and flowers VIII World Bamboo Congress Proceedings Vol 5-25 Fig. 9. Melocanna culm in basketary and cage in the village VIII World Bamboo Congress Proceedings Vol 5-26 Species Relationships in Dendrocalamus Inferred from AFLP Fingerprints S. Pattanaik* and J.B. Hall** *Scientist, Rain Forest Research Institute (ICFRE), Jorhat, India. **Director, Postgraduate Studies, School of the Environment & Natural Resources, Bangor University, United Kingdom. Abstract Species of Dendrocalamus are characterized by their sympodial rhizomes and large sized dense clumps. The genus contains over fifty species from tropical and subtropical region of the old world, many of which are economically exploited by rural communities in south and southeast Asia. The original description of the genus was based on the type species Dendrocalamus strictus, which was subsequently expanded to include pericarp characters that were used to distinguish between Dendrocalamus and Bambusa (Munro 1868; Bentham 1883; Gamble 1896). While at present it is taxonomically convenient for Dendrocalamus to be recognized in a broad sense (its species being distinguished by the presence of single-keeled prophylls throughout the inflorescence Stapleton 1991), the limits between Bambusa and Dendrocalamus are not satisfactorily defined. In the present study amplified fragment length polymorphism markers (AFLPs) were used to investigate phylogenetic relationships among ten included Dendrocalamus and five out group species. Neighbour-Joining and Maximum parsimony analyses of AFLP dataset suggested the current circumscription of Dendrocalamus to be polyphyletic. Further, the analyses did not find support for the various earlier infrageneric classifications within Dendrocalamus. The implications of the findings are discussed. Introduction Dendrocalamus is a woody bamboo genus placed in the subtribe Bambusinae and tribe Bambuseae (Ohrnberger 1999). Species referred to the genus are characterized by their sympodial rhizomes and large sized dense clumps. The genus contains over fifty species, naturally distributed in the tropical and subtropical region of the old world, many of which are economically exploited by the communities in south and southeast Asia. The original description of the genus was based on the type species D. strictus. The description was expanded subsequently to include pericarp characters, which were used to distinguish between Dendrocalamus and Bambusa (Munro 1868, Bentham 1883, Gamble 1896). While at present it is taxonomically convenient for Dendrocalamus to be recognized in a broad sense, the limits between Bambusa and Dendrocalamus are not satisfactorily defined thus creating confusion in their systematic classification. And lack of sound taxonomy is acting as hindrance in the scientific conservation and management of the woody bamboos belonging to this genus. VIII World Bamboo Congress Proceedings Vol 5-27 Since Dendrocalamus was separated from Bambusa by Nees von Esenbeck in 1834, over 70 species names have been assigned to the genus although Ohrnberger (1999) retains only 51 of these. Most of the species that have not been maintained by Ohrnberger have been reduced to synonymy or to infraspecific rank. A few are transferred to, or sunk into, other genera: Ampelocalamus (subtribe Thamnocalaminae); Gigantochloa and Pseudoxytenanthera (Bambusinae). Various infrageneric classifications of Dendrocalamus have been adopted by Chinese botanists. Hsueh and Li (1988) proposed the first infrageneric classification of Dendrocalamus by recognizing two subgenera and five sections, limiting the assignments to only those species reported from China. Ohrnberger (1999) assigned species only to sections Dendrocalamus, Bambusoidetes, Sinocalamus and Draconicalamus. Out of the 51 taxa recognized by Ohrnberger, 22 were assigned to particular sections while 29 taxa were unplaced. A more recent taxonomic revision of Chinese Dendrocalamus (Li and Stapleton 2006) retains the subgenera proposed by Hsueh and Li (1988) but disregards sectional assignments, merging sections Dendrocalamus and Bambusoidetes as subgenus Dendrocalamus, and sections Sinocalamus and Draconicalamus as subgenus Sinocalamus. Li and Stapleton (2006) transferred 11 taxa previously referred to subgenus Sinocalamus to subgenus Dendrocalamus. The major problem faced in the infrageneric classification of Dendrocalamus is the paucity of published morphological character information for many of the species. Twenty seven species do not appear to have been referred to any subgenus or section under any of the proposed schemes. Bamboos have always been a taxonomically challenging group of plants because, while the classification of flowering plants depends largely on the characteristics of reproductive organs, flowering is rare in many bamboo species. Some bamboo species flower at intervals as long as 120 years and for some there is no report of flowering to date. Because of apparent paucity of morphological characters in bamboos, taxonomists have long sought different sources of taxonomically informative data. The availability of molecular data in the final decade of the twentieth century enabled taxonomists to review phylogenetic concepts of the Poaceae more objectively. Initially DNA products viz., isozymes and secondary compounds like phenolics were used in exploring relationships among taxa (Chou and Hwang 1985), species identification (Alam et al. 1997) and assessment of infraspecific polymorphism (Biswas 1998). In a study involving five Dendrocalamus taxa, Arthrostylidium naibunensis W.C. Lin and Chimonobambusa quadrangularis Makino, a Dendrocalamus cluster could be differentiated from the other two genera using phenolic compounds and isozyme patterns of esterase and peroxidase. Within Dendrocalamus two clusters were recognized: Dendrocalamus asper associated with D. giganteus, while D. latiflorus associated with its variety D. latiflorus var. mei-nung. However, Dendrocalamus strictus was distant from these two clusters. Later on, variation in DNA itself was the subject of investigations. The more pertinent studies involving named Dendrocalamus taxa are those of Loh et al. (2000) and Sun et al. (2005) but these studies entailed only limited sampling of the genus. In the first, two Dendrocalamus taxa were sampled, with D. brandisii clustering with taxa from Bambusa, and D. giganteus appearing genetically distant from all other taxa included. In the second study three Dendrocalamus taxa were sampled. These three taxa did not form a separate clade but clustered within Bambusa, which was split into two distinct clades. D. membranaceus showed close affinity to D. strictus and both were placed within one Bambusa clade, whereas D. latiflorus was associated with the other Bambusa clade. The study reported wide genetic variation within Dendrocalamus and raised questions about its monophyly. VIII World Bamboo Congress Proceedings Vol 5-28 These earlier molecular studies included limited samples from Dendrocalamus and did not throw much light on the infrageneric relationships within the genus. In the present investigation there was wider provision within Dendrocalamus with ten putative taxa, and five outgroup taxa from the subtribe Bambusinae. Amplified fragment length polymorphism (AFLP) markers were used to (i) test the monophyly of Dendrocalamus, and (ii) assess the molecular support for various infrageneric assignments proposed in Dendrocalamus. Materials and Methods Site Description Genetic material was collected from the bambuseta of five botanical gardens in India: Forest Research Institute, Dehra Dun; National Botanical Garden of Botanical Survey of India, Howrah; State Forest Research Institute, Chessa; ICAR research complex for northeastern hill region, Basar; Rain Forest Research Institute, Jorhat. The genetic material of the monotypic African bamboo Oxytenanthera abyssinica was available as the result of previous research work in Bangor, UK (Inada 2004). Genetic Material Leaves were collected from ten Dendrocalamus and five outgroup taxa from subtribe Bambusinae. The leaves were dried using silica gel as per the procedure of Chase and Hills (1991) and then transported from the field sites in India to the laboratory at CAZS - Natural Resources, Bangor University, for DNA extraction and analysis. Six of the Dendrocalamus taxa (D. strictus, D. hamiltonii, D. membranaceus, D. brandisii, D. sikkimensis, D. asper) represented subgenus Dendrocalamus and two other taxa (D. giganteus and D. calostachyus) represented subgenus Sinocalamus, in the infrageneric classification of Dendrocalamus by Li and Stapleton (2006). No information was available regarding the infrageneric assignment of D. sahnii and D. somdevai. The outgroup taxa were from the genera Bambusa, Melocalamus, Oxytenanthera, Dinochloa and Thyrsostachys, all of which belong, like Dendrocalamus, to subtribe Bambusinae as recognized by Ohrnberger (1999). DNA Extraction DNA was extracted from 50 mg of dried leaf tissue using a modified CTAB protocol of Doyle and Doyle (Doyle and Doyle 1990). The DNA extractions were checked for quality by running a 1% agarose mini-gel (run at 50 V for 30 minutes) in TBE buffer (1 X) containing 0.5 μg/ml ethidium bromide. The genomic DNA was visualized and photographed under a ultra-violet light source. Quantitation of genomic DNA was done using the fluorescent dye Pico green in the Fluostar Galaxy Fluorometer. Generation of AFLP Markers The AFLP assay was performed following the protocol of Vos et al. (1995), adapted for the Beckman Coulter Sequencer. The process was carried out in four steps. In the first step, two restriction enzymes EcoRI and MseI (Tru9I) were used to digest the genomic DNA of the samples. In the second step, double stranded adapters VIII World Bamboo Congress Proceedings Vol 5-29 complementary to the cut ends (overhangs) produced by enzymes EcoRI and MseI were ligated to the cut DNA fragments. In the third step, a PCR (pre-selective PCR) was performed with universal primers E00 and M00. The thermocycler conditions included 30 cycles consisting of 30 seconds denaturation at 94°C, 60 seconds annealing at 56°C, 60 seconds extension at 72°C and finally 600 seconds extension at 72°C. In the fourth step, a second PCR (selective PCR) was done with selective primers, each with three nucleotide extensions (E00+3; M00+3). The selective primer E00+3 was end-labelled with fluorescent dye D4 instead of the radioactive labelling described in the original protocol of Vos et al. (1995). The thermocycler conditions included 13 touchdown cycles to avoid amplifying non-specific sequences (30 seconds denaturation at 94°C, 30 seconds annealing at 65°C which was then reduced by 0.7°C per cycle, 60 seconds extension at 72°C), 23 normal cycles (30 seconds denaturation at 94°C, 30 seconds annealing at 56°C, 60 seconds extension at 72°C) and 420 seconds final extension at 72°C. A primer screening experiment was done to select five primer sets, which were then used to amplify AFLP markers from the fifteen taxa included in the present investigation. A negative control (without template DNA) was run in each batch of PCRs to confirm that no contamination had occurred. The reproducibility of AFLP peaks was checked by repeating the whole process a number of times. Separation and Scoring of AFLP Markers The selective PCR products were separated through capillary gel electrophoresis in the CEQ 8000 Genetic Analysis System (Beckman Coulter, Inc.) and analysed with the fragment analysis software. During fragment analysis the separated fragments were sized with the use of internal size standards (PA400). Following this, the sized fragments were subjected to an AFLP binning analysis that converted the AFLP peak profiles into binary matrix. The presence of a peak was scored 1 and its absence scored 0. Peaks of size ranging from 60 bp to 400 bp were scored. Data Analysis Phenetic Analysis The binary matrix (470 Ҳ 15) of multilocus peak patterns generated by the scoring software in CEQ 8000 was converted to a matrix of pairwise distances between OTUs expressed as Jaccard’s (Jaccard 1908) distance coefficient using the software package NTSYSpc 2.11X (Rohlf 2000). Jaccard’s distance coefficient was derived as DJ = 1 – [a / (n - d)], where: n, total sample size (a + b + c + d). a, number of peaks common to both taxa b, number of peaks for the first taxon c, number of peaks for the second taxon d, number of peaks absent from both taxa VIII World Bamboo Congress Proceedings Vol 5-30 Cluster analysis was carried out using the neighbour-joining (NJ) algorithm of Saitou and Nei (Saitou and Nei 1987) in NTSYSpc 2.11X (Rohlf 2000). The generated tree was rooted using the outgroup option, taking Oxytenanthera abyssinica as the outgroup taxon. The statistical support for the internal branches was assessed by performing a bootstrap analysis with 1000 replicates in the software package FREETREE (Pavlicek et al. 1999). A Mantel test was performed to test how well the phenogram represented the inter-OTU distances, following the procedure described by Koopman et al. (2001). Phylogenetic analysis Cladistic analysis of the AFLP dataset (470 Ҳ 15) was performed under maximum parsimony criterion with PAUP 4.0b10 (Swofford 2002). The large number of includedtaxa (>12) ruled out an exhaustive search. So, heuristic search was used to identify the most parsimonious tree. Heuristic search was performed with the following criteria -1000 replicates, random additions of sequence, tree-bisection-reconnection (TBR) branch swapping, character optimizations using accelerated transformation (Perrie and Brownsey 2005). Output trees were rooted using the outgroup option with Oxytenanthera abyssinica as the outgroup taxon. Statistical support for internal branches was assessed using the bootstrap analysis (Felsenstein 1985) in PAUP 4.0b10 with following criteria – 1000 replicates, heuristic search and a 50% confidence level. Results The five AFLP primer sets used in the present investigation generated 609 marker loci, out of which 99.2 % (604) loci were polymorphic and only 0.8 % (5) loci were monomorphic across the 15 OTUs. The dataset also contained 134 (22.0 %) loci where only one peak was detected. The number of AFLP marker loci generated by the individual primer sets varied from 101 to 133 with a mean of 121.8. The genetic distance estimates based on Jaccard’s measure varied from 0.47 to 0.92 (Table 1). Although referred to the Bambusinae, the monotypic African bamboo Oxytenanthera abyssinica shared very few peaks with other taxa included in the study and was found genetically distant from them (distance ranged from 0.77 to 0.92). However, even within Dendrocalamus there was wide genetic variation. Dendrocalamus strictus appeared isolated with a minimum distance of 0.77 (from D. somdevai) and a maximum distance of 0.85 (from D. asper). Among the outgroups included in the present investigation Bambusa balcooa was found to be the closest to Dendrocalamus sensu lato with a mean distance of 0.60. Cluster analysis with the neighbour-joining algorithm resulted in a single tree (Figure 1) with high co-phenetic correlation coefficient (r = 0.971). A well-supported (85% bootstrap support) major cluster was recovered containing all Dendrocalamus taxa (except D. strictus) with Melocalamus compactiflorus as sister lineage. D. strictus was recovered near the root of the tree distant from the major cluster containing other Dendrocalamus. Three clusters could be recognized within the major cluster that had varying degree (above 50%) of bootstrap support. Cluster 1 (partially supported with bootstrap support of 93%) consisted of Dendrocalamus membranaceus, D. somdevai and D. brandisii. Cluster 2 (89% bootstrap support) consisted of Dendrocalamus sikkimensis, Bambusa balcooa and D. hamiltonii. Cluster 3 consisted of D. giganteus and D. asper. VIII World Bamboo Congress Proceedings Vol 5-31 Table 1 Half-matrix of pairwise Jaccard’s distance coefficients between 15 operational taxonomic units. Rows are labelled with taxon name (D. = Dendrocalamus). Columns are labelled with accession code only. Operational taxonomic units (S3) D. membranaceus (S4) D. somdevai (S9) D. brandisii (S10) D. giganteus (S11) D. sikkimensis (S15) D. sahnii (S30) D. calostachyus (S13) Dinochloa (S14) Thyrsostachys (S23) Bambusa (S27) Melocalamus (S52) D. strictus (S6) D. asper (31) D. hamiltonii (S32) Oxytenanthera S3 0 0.51 0.55 0.66 0.68 0.61 0.63 0.66 0.69 0.65 0.69 0.79 0.70 0.65 0.83 VIII World Bamboo Congress Proceedings S4 S9 S10 S11 S15 S30 S13 S14 S23 S27 S52 S6 31 S32 0 0.55 0.65 0.59 0.56 0.60 0.63 0.68 0.59 0.67 0.77 0.69 0.54 0.83 0 0.60 0.59 0.57 0.53 0.61 0.70 0.57 0.68 0.84 0.59 0.58 0.82 0 0.64 0.58 0.57 0.69 0.75 0.61 0.66 0.84 0.62 0.62 0.83 0 0.56 0.57 0.64 0.74 0.51 0.67 0.85 0.65 0.52 0.82 0 0.55 0.62 0.73 0.54 0.63 0.84 0.64 0.53 0.81 0 0.58 0.71 0.54 0.63 0.82 0.63 0.55 0.80 0 0.73 0.63 0.70 0.82 0.73 0.66 0.84 0 0.74 0.73 0.83 0.76 0.72 0.84 0 0.66 0.87 0.66 0.47 0.83 0 0.85 0.71 0.68 0.83 0 0.85 0.83 0.92 0 0.60 0.82 0 0.77 0 Vol 5-32 However, the relative relationship among these three clusters was not clear due to polytomy. Further, the affinity of D. sahnii, D. calostachyus and Dinochloa macclellandii remained unresolved. Maximum parsimony analysis of the AFLP dataset (consisting of 470 characters out of which 460 were parsimony informative) with heuristic search yielded two equally parsimonious trees [Figure 2(a) and (b)], giving two alternate but equally likely hypotheses of evolutionary relationships among the OTUs. Each tree was 1468 steps (character state changes) long with consistency index (CI) = 0.320, retention index (RI) = 0.298 and rescaled consistency index (RC) = 0.095. The two most parsimonious trees were congruent for most part of the trees but differed with the placement of Dendrocalamus calostachyus. Strict consensus of the parsimonious trees resulted in a polytomy (Figure 3). Three clades were recovered that were identical to the clusters in Neighbour-Joining tree. Because of polytomy the relationship among these three clades was not clear. Bootstrap analysis with 1000 bootstrap replicates showed partial support for the three clades. Only part of clade 1, part of clade 2 and clade 3 had above 50% bootstrap support. Discussion Neither the phenetic nor the phylogenetic approach adopted in the present investigation supported the monophyly of Dendrocalamus as currently circumscribed. The placement of Bambusa balcooa and Dendrocalamus strictus in the cladogram (Figure 3) and the placement of Bambusa balcooa, Dendrocalamus strictus and Dinochloa macclellandii in the phenogram (Figure 1), suggested otherwise. Bambusa balcooa, instead of forming a separate lineage, was recovered in a clade/cluster shared with Dendrocalamus hamiltonii and D. sikkimensis. This supports the findings of Stapleton (1994a) who had reported the closeness of Bambusa balcooa to Dendrocalamus species on morphological grounds, stressing similarity in the profuse aerial roots at the culm nodes, the large rhizomatous branch bases and the culm wax. Further similarities between Bambusa balcooa and Dendrocalamus hamiltonii can be found in the reproductive parts with both species having 3 stigmas each. Dinochloa macclellandii whose affinity was unresolved in the neighbour-joining phenogram (Figure 1), was recovered as a sister lineage to the clades containing Dendrocalamus in the most parsimonious trees (Figures 2a and b). The placement of Dendrocalamus strictus near the root of the tree away from rest of the Dendrocalamus sensu lato was not entirely unexpected considering the findings of Chou and Hwang (1985), who had reported the isolation of D. strictus from other Dendrocalamus taxa based on studies involving isozymes and phenolics. Morphologically, the isolation of D. strictus could be explained by presence of inflorescence comprising of fascicular pseudospikelets (2.2–2.5 cm in diam.) on each node of flowering branches, distinguishing them from other species included in the study (Yang et al. 2008). Ecologically also, D. strictus is very distinct from the other Dendrocalamus taxa included in the present investigation. Dendrocalamus strictus naturally occurs in dry deciduous open forests, receiving as little as 750 mm annual rainfall and exposed to low relative humidity. The other Dendrocalamus taxa included in the present investigation are confined to moister areas (moist deciduous to wet evergreen forests), with an annual rainfall in excess of 1500 mm. There was congruence between neighbour-joining cluster analysis and the maximum parsimony analysis as far as three monophyletic clusters/clades were concerned. The first of congruent groups consisted of VIII World Bamboo Congress Proceedings Vol 5-33 Dendrocalamus membranaceus, D. somdevai and D. brandisii. The second congruent group consisted of Bambusa balcooa, Dendrocalamus hamiltonii and D. sikkimensis. The third congruent group consisted of Dendrocalamus giganteus and D. asper. The placement of Dinochloa macclellandii differed in the two analyses. The affinity of Dendrocalamus sahnii and D. calostachyus were inconclusive in both the analyses. The three monophyletic clusters/clades did not agree to the sectional assignments within Dendrocalamus sensu lato circumscribed by Hsueh and Li (1988), Ohrnberger (1999), and Li & Stapleton (2006). Bambusinae as circumscribed by Ohrnberger (1999) is an Old World tropical subtribe with its centre of diversity in southeast Asia. It contains seventeen genera, the relationships among which are not fully understood. In the present investigation Bambusa balcooa was placed within Dendrocalamus sensu lato supporting the closeness, or even inseparability of these two genera. Melocalamus and Thyrsostachys were recovered as sister lineages to Dendrocalamus and Bambusa. Watanabe et al. (1994), the first to study phylogenetic relationships among Asian bamboos using restriction fragment length polymorphism of chloroplast DNA, recovered a clade representing subtribe Bambusinae sensu Ohrnberger (1999), containing Bambusa, Dendrocalamus, Gigantochloa and Thyrsostachys. Internally, however, Watanabe’s clade was poorly resolved in terms of relationships among Bambusa, Gigantochloa and Dendrocalamus, suggesting close relationships among these genera. Thyrsostachys had emerged as a sister lineage to the other genera included in Watanabe’s study. The study of Loh et al. (2000) and Ramanayake et al. (2007), using AFLPs and RAPDs respectively, also indicated a close relationship between Bambusa and Gigantochloa. The combined evidence from these earlier molecular studies and the present investigation suggest that taxa belonging to Bambusa, Dendrocalamus and Gigantochloa form a close complex but are relatively distant from Melocalamus, Thyrsostachys and Oxytenanthera. The phylogenetic trees generated in the present study are plausible hypotheses for relationships within Dendrocalamus, but need validation from other evidences. The low statistical support for some of the clusters/clades might improve with inclusion of more informative characters, which could be generated by using more selective primer sets. The study confirms that the current taxonomic treatment of Dendrocalamus is unsatisfactory and needs revision. A broader study encompassing a wider selection of taxa from Bambusa, Dendrocalamus and Gigantochloa, and inclusion of evidence from multiple data source (including AFLP and sequencing of fast evolving genes) might be expected to produce a robust phylogenetic tree for this suite of closely related taxa. Acknowledgements The first author acknowledges the financial help in the form of Commonwealth Scholarship from the Commonwealth Scholarships Commission, United Kingdom. Also, the help received from friends and colleagues at FRI, Dehra Dun; RFRI, Jorhat; SFRI, Itanagar; ICAR Research Complex for NEH region, Basar;.Central National Herbarium, BSI, Kolkata is gratefully acknowledged. VIII World Bamboo Congress Proceedings Vol 5-34 References Alam, M.K.; Sarker, R.H.; Hassan, M.A. 1997. Chemotaxonomic studies in peroxidase isozyme of bamboos from Bangladesh. Bangladesh Journal of Botany, 26, 99-105. Bentham, G. 1883. Gramineae. In Bentham, G.; Hooker, J.D. ed., Genera Plantarum, III, Reeve, London. pp. 1094-1215. Biswas, S. 1998. Contribution to the isozyme studies on Indian bamboo, Dendrocalamus strictus (Roxb.) Nees with emphasis on diversity evaluation. Annals of Forestry, 5, 168-172. Chase, M.W.; Hills, H.H. 1991. Silica gel: an ideal material for field preservation of leaf samples for DNA studies. Taxon, 40, 215-220. Chou, C.H.; Hwang, Y.H. 1985. A biochemical aspect of phylogenetic study of Bambusaceae in Taiwan. III. The genera Arthrostylidium, Chimonobambusa and Dendrocalamus. Botanical Bulletin of Academia Sinica, 26, 155-170. Doyle, J.J.; Doyle, J.L. 1990. Isolation of plant DNA from fresh tissue. Focus, 12, 13-15. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39, 783-791. Gamble, J.S. 1896. The Bambuseae of British India. Annals of the Royal Botanic Garden, Calcutta, 7, 1-133. Hsueh, C.; Li, D.Z. 1988. A study on the genus Dendrocalamus Nees from China. Journal of Bamboo Research, 7, 1-19. Inada, T. 2004. African bamboos: an appraisal with special reference to Oxytenanthera abyssinica, the savanna bamboo. Ph.D. thesis, School of Agricultural and Forest Sciences, University of Wales, Bangor. 274 pp. Jaccard, P. 1908. Nouvelles recherches sur la distribution florale. Bulletin de la Société Vaudense des Sciences Naturelles, 44, 223-270. Koopman, W.J.M.; Zevenberger, M.J.; Van Den Berg, R.G. 2001. Species relationships in Lactuca s.l. (Lactuceae, Asteraceae) inferred from AFLP fingerprints. American Journal of Botany, 88, 1881– 1887. Li, D.Z.; Stapleton, C. 2006. Dendrocalamus. In Flora of China, 22, 39-46. http://www.efloras.org Loh, J.P.; Kiew, R.; Set, O.; Gan, L.H.; Gan, Y.Y. 2000. A study of genetic variation and relationships within the bamboo subtribe Bambusinae using amplified fragment length polymorphism. Annals of Botany, 85, 607-612. Munro, W. 1868. A monograph of Bambusaceae, including descriptions of all the species. Transactions of the Linnean Society of London, 26, 1-157. Ohrnberger, D. 1999. The bamboos of the World: annotated nomenclature and literature of the species and the higher and lower taxa. Elsevier, Amsterdam. 585 pp. Pavlicek, A.; Hrda, S.; Flegr, J. 1999. FreeTree: freeware programme for construction of phylogenetic trees on the basis of distance data and bootstrap/jackknife analysis of tree robustness. Application in the RAPD analysis of the genus Frenkelia. Folia Biologica, 45, 97-99. Perrie, L.R. and Brownsey. 2005. Genetic variation is not concordant with morphological variation in the fern Asplenium hookerianum sensu lato (Aspleniaceae). American Journal of Botany, 92, 1559-1564. Rohlf, F.J. 2000. NTSYSpc: numerical taxonomy and multivariate analysis system, version 2.11X. Applied Biostatistics, New York. Saitou, N.; Nei, M. 1987. The neighbour-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4, 406-425. Stapleton, C.M.A. 1991. A morphological investigation of some Himalayan bamboos with an enumeration of taxa in Nepal and Bhutan. Ph.D. thesis, University of Aberdeen. VIII World Bamboo Congress Proceedings Vol 5-35 Stapleton, C.M.A. 1994. The bamboos of Nepal and Bhutan. Part I. Edinburgh Journal of Botany, 51, 1-32. Sun, Y.; Xia, N.; Lin, R. 2005. Phylogenetic analysis of Bambusa (Poaceae: Bambusoideae) based on internal transcribed spacer sequences of nuclear ribosomal DNA. Biochemical Genetics, 43, 603-512. Swofford, D.L. 2002. PAUP*: phylogenetic analysis using parsimony (*and other methods), version 4.0b10. Sinauer, Sunderland. Vos, P. ; Hogers, R. ; Bleeker, M. ; Reijans, M. ; Van de Lee T. ; Hornes, M. ; Frijters, A. ; Pot, J.; Peleman, J. ; Kupier, M. ; Zabeau, M. 1995. AFLP: a new technique for DNA finger printing. Nucleic Acids Research, 23, 4407-4414. Watanabe, M.; Ito, M.; Kurita, S. 1994. Chloroplast DNA phylogeny of Asian bamboos (Bambusoideae, Poaceae) and its systematic implication. Journal of Plant Research, 107, 253-261. Yang, H.Q.; Yang, J.B.; Peng, Z.H.; Gao, J.; Yang, Y.M.; Peng, S.; and Li, D.Z. 2008. A molecular phylogenetic and fruit evolution analysis of the major groups of the paleotropical woody bamboos (Gramineae: Bambusoideae) based on nuclear ITS, GBSSI and plastid trnL-F DNA sequences. Molecular Phylogenetics and Evolution, 48, 809-824. VIII World Bamboo Congress Proceedings Vol 5-36 Figure 1. Neighbour-joining phenogram showing phenetic relationships among the 15 sampled taxa from Dendrocalamus and the subtribe Bambusinae. Numbers at the nodes indicate bootstrap (%) support for the respective clusters. Bar scale indicates additive distance between pairs of taxa. VIII World Bamboo Congress Proceedings Vol 5-37 (a) VIII World Bamboo Congress Proceedings Vol 5-38 (b) Figure 2a & b. Phylograms depicting two equally parsimonious trees resulting from the maximum parsimony analysis of a character matrix of 470 AFLP markers. Each tree has a length of 1468 steps, CI = 0.320, RI = 0.298, RC = 0.095. Values above segments indicate character state changes (gains/losses of AFLP bands) supporting respective nodes. Accession codes are indicated within brackets. The horizontal bars below trees represent 10 character state changes. VIII World Bamboo Congress Proceedings Vol 5-39 Figure 3. Cladogram depicting strict consensus of the two parsimonious trees obtained in the maximum parsimony analysis of a character matrix of 470 AFLP markers. Length =1480 steps (character state changes), CI = 0.317, RI = 0.289, RC = 0.092. Values above segments indicate bootstrap support for the respective nodes. Bootstrap support for nodes with less than 50% support and which collapse under the 50% majority rule tree is not shown. Accession codes are indicated within brackets. Clades conforming to the clusters of neighbour-joining analysis are indicated. VIII World Bamboo Congress Proceedings Vol 5-40 Flowering gene expression in the life history of two mass-flowered bamboos, Phyllostachys meyeri and Shibataea chinensis (Poaceae: Bambusoideae) Yoko Hisamoto a, b , and Mikio Kobayashi a, b a United Graduate School of Agricultural Science, Tokyo University of Agriculture and Technology, Fuchu, Tokyo, Japan b Department of Forest Science, Faculty of Agriculture, Utsunomiya University, Mine-machi, Utsunomiya, Japan Abstract A total of 4 copies of the flowering promoting gene FLOWERING LOCUS T (FT) homolog PmFT were cloned and sequenced, and 2 fragment copies of the flowering repressing gene CENTRORADIALIS (CEN) homolog PmCEN were amplified. The average identities of amino acid sequences among the copies of PmFT and PmCEN were 97% and 95%, respectively. The orthologous regions were used with a real-time RT PCR method for gene expression analyses in stages of the life history of Phyllostachys meyeri McClure and Shibataea chinensis Nakai, with emphasis on their mass flowering behaviors. Both genes were expressed during the reproductive phase and in sterile leaves in the vegetative phase, whereas PmCEN alone was expressed in seedlings and juvenile clones. PmFT expression was strongest in leaves of the flowering culm. Relatively weak expression of both gene homologs in S. chinensis—ScFT and ScCEN— was detected during the reproductive phase; the expression of ScFT was highest in mature leaves. Only ScFT was detected at a low level in the vegetative phase after flowering. The expression of FT homologs in the vegetative phase in both bamboo species suggested that sporadic flowering would occur in the following year(s). The highest expression level of FT homologs were detected in the flowering culms in both bamboo species, suggesting that the same molecular mechanism of flowering promoting genes discovered in model plants might underlie the mass flowering process of the bamboo plants. Introduction Many bamboos have a life history trait of monocarpic mass flowering and death (Janzen 1976), suggesting that cross-breeding to produce a new genetic cultivar would be difficult in bamboos. If the molecular mechanism of bamboo flowering could be clarified and genetic modification made feasible, bamboo propagation technology might be fundamentally reformed. A number of genes that control flowering time have been isolated and characterized in Arabidopsis (Komeda 2004). Corbesier et al. (2007) discovered that the FLOWERING LOCUS T (FT) gene is a candidate for encoding florigen and that the FT protein moves from an induced leaf to the shoot apex and causes flowering. On the other hand, TERMINAL FLOWER 1 (TFL1)/CENTRORADIALIS (CEN) acts as a flowering repressing gene to VIII World Bamboo Congress Proceedings Vol 5-41 delay the flowering time and alters the inflorescence architecture in Arabidopsis (Alvares et al. 1992) and in Antirrhinum (Bradley et al. 1996). Rice TFL1/CEN orthologs, RCN1 and RCN2, delay transition into flowering and alter panicle morphology (Nakagawa et al. 2002). We have investigated the relationships between various flowering behaviors in the genus Phyllostachys and have examined the nucleotide sequence variation in the FT homolog PmFT (Hisamoto and Kobayashi 2007). In the present study, we first cloned 4 copies of PmFT and amplified 2 fragment copies of the CEN homolog PmCEN from Phyllostachys meyeri McClure. Then, we analyzed their expression patterns in the life history, including mass flowering and death and the recovery of a grove of P. meyeri, as well as in mass-flowering Shibataea chinensis Nakai. Materials and Methods Plant Materials Phyllostachys meyeri and Shibataea chinensis were cultivated in the Fuji Bamboo Garden, Japan. The life histories of P. meyeri and S. chinensis are summarized in Figure 1. P. meyeri bloomed in high synchrony with determinate inflorescences of the capitate type (Figure 1; LF, IF), and then the culms died. Two months after the mass flowering, slender, short regenerated culms emerged and bear indeterminate inflorescences of the lax type (Figure 1; LR, IR), whereas the flowered culms died. Caryopses matured in June and seedlings emerged in July 2004 (Figure 1; SS). One year after the mass flowering, several slender vegetative culms emerged (Figure 1; LS). The juvenile clumps formed a clone with monopodial rhizomes in 2007 (Figure 1; LJ). S. chinensis bore young inflorescences in February 2008 (Figure 1; LY, IY). The grove was in full bloom with green leaves in March (Figure 1; LM, IM). This stage was considered to correspond with the mass-flowering stage in P. meyeri. Flowering terminated around April 20. All the inflorescences withered, but did not bear any caryopses. Even after flowering, the flowered culms remained verdant with green foliage leaves (Figure 1; LW), and bore new leaf buds on the axils. We collected samples of P. meyeri and S. chinensis in various stages of flowering as follows: in P. meyeri, leaves (LF) and inflorescences (IF) of the mass-flowered culms, inflorescences (IR) and leaves (LR) of the regenerated culms in flower, leaves (LS) of the regenerated sterile culms, leaves of the juvenile clumps (LJ), and young stems of the seedlings (SS); in S. chinensis, leaves (LY) and inflorescences (IY) in the young stage, leaves (LM) and inflorescences (IM) in the mature stage, and leaves (LW) remaining after flowering. Isolation and Sequencing of FT and CEN Homologs from Phyllostachys meyeri Genomic DNA was isolated from the leaves of Phyllostachys meyeri by the modified CTAB method (Hasebe and Iwatsuki 1990). Full-length PmFT and partial PmCEN sequences were amplified using the primer pairs shown in Table 1. VIII World Bamboo Congress Proceedings Vol 5-42 Table 1 Primer pairs used for PCR amplification Primer name Derivation Position Sequence of primer (5 -3 ) Designed for PmFT_5end 1 21 ATGGTCGGCGGGGACAGGGAT cloning and sequencing PmFT (AB240578) PmFT_3end 897 919 TCACCAGGGGTACATCCTTCTTC PmCEN_F 211 231 GGTCATGAGCTCTACCCATCA rice FDR2 (AF159882) PmCEN_R 592 610 GCCTCCTGGCTGCAGTCTC 185 371 GGACATTTTACACACTCGTGAT real-time RT-PCR FT_F (intron: 202 PmFT1 4 (AB240578; 366) 418 562 AB498760 AB498762) CAGTGACCAGCCAGTGTAGATA FT_R (intron: 429 551) 71 193 PmCEN1 2 CEN_F CGGTCTTTCTTCACATTGGTTA (intron: 89 189) (AB498763; AB498764) CEN_R 371 391 AGCATCTGTTGTCCCAGGTAT rice GAPDH mRNA GAPDH_F GCTACCCAGAAGACTGTT 244 261 (AF546879) GAPDH_R 371 391 GTGCTGCTAGGAATGATGTTGA Each PCR reaction was performed in a volume of 25 μl containing 1 ng of the template DNA, 1.25 U Takara LA Taq, 20 pmol of each primer, 2 × GC buffer II, and 0.25 mM dNTP (Takara). Amplification was performed in a GeneAmp PCR system 9700 programmed for the following sequence of steps: (A) initial denaturation of 1 s at 95°C; (B) 14 cycles of 15 s at 95°C and 12 min at 68.5°C; (C) 8 cycles of 15 s at 95°C followed by 12 min at 68.5°C, wherein the time for each successive cycle increased by 5 s; and (D) post-elongation for 10 min at 72°C. The PCR products were subcloned into pSTBlue-1 (Novagen) and sequenced using the BigDye Terminator v. 3.1 Cycle Sequencing Kit (Applied Biosystems). Analysis of Gene Expression Total RNA was extracted from the samples using the RNA Plant Mini Kit (Qiagen) and treated with DNase according to the manufacturer’s protocol. First-strand cDNA was synthesized from 3 μg of the total RNA by SuperScript III reverse transcriptase (Invitrogen) with an oligo (dT)20 primer and dNTP mixture according to the manufacturer’s instructions. We performed real-time PCR for a volume of 25 μl containing 1×, 10–1×, or 10–2× cDNA, 10 pmol of each primer, and 2×QuantiTect SYBR Green PCR Master Mix using the QuantiTect SYBR Green RT-PCR Kit (Qiagen). We used the same gene-specific primers for both Phyllostachys meyeri and Shibataea chinensis, and we employed rice GAPDH gene primers as the control (Table 1). Amplification was performed in a 7500 Real Time PCR System (Applied Biosystems) programmed for an initial denaturation of 15 min at 95°C, followed by 41 cycles of 15 s at 94°C, 30 s at 56°C, and 35 s at 72°C. The final cycle was 15 s at 95°C, 1 min at 60°C, and 15 s at 95°C for a dissociating stage to check the specificity of the PCR amplification. All experiments were repeated at least 3 times. VIII World Bamboo Congress Proceedings Vol 5-43 Results Cloning of FT and CEN Homologs in Phyllostachys meyeri In a preliminary study, we identified full-length PmFT based on the rice RFT1 gene (AB240578; Hisamoto et al. 2008), and we detected 4 copies of PmFT by a Southern blot analysis and determined complete sequences of 2 copies. In the present study, we cloned a total of 4 genomic copies among 28 clones of PCR products amplified using primer pairs designed from the 5'- and 3'-end sequences of PmFT (Figure 2a). The 4 copies, PmFT1 to PmFT4, were composed of 4 exons and 3 introns. Exon 1 of PmFT2 was 204 bp in length including a 3 bpinsertion, whereas those of the other copies were 201 bp.In all the copies, the lengths of exons 2, 3, and 4 were 61 bp, 41 bp, and 233 bp, respectively. The lengths of the introns were 165–169 bp, 123–162 bp, and 91 bp in introns 1, 2, and 3, respectively. Four-bp and 36-bp insertions were found in introns 1 and 2 of PmFT4. The nucleotide sequence identities among the 4 copies were 92–98%. We obtained two partial PmCEN sequences, PmCEN1 and PmCEN2, which were amplified using primer pairs designed from the rice FDR2 gene (Figure 2b). The sequences started from the nucleotide corresponding to the 232nd nucleotide of FDR2 mRNA and were composed of 4 exons and 3 introns. Exon 1 of PmCEN1 was 88 bp in length including a 3-bp insertion, whereas exon 1 of PmCEN2 was 85 bp in length. In both copies, the lengths of exons 2, 3, and 4 was 62 bp, 42 bp, and 213 bp, respectively. The lengths of the introns were 101 or 105 bp, 106 or 190 bp, and 95 bp in introns 1, 2, and 3, respectively. A total of 84 bp of insertions was found in intron 2 of PmCEN1. The nucleotide sequence identity between the 2 copies was 80%. We aligned the putative amino acid sequences of the 4 copies of PmFT and the 2 copies of PmCEN with FT and TFL1 in Arabidopsis, and the homologs in rice and poplar (Figure 3). Amino acid sequence identity among the 4 copies was 96–98%, whereas the identities between PmFT and the other FT proteins were low: 71% in Arabidopsis, 82% in poplar, and 88% in rice. The amino acid sequence identity between the 2 copies of PmCEN was 95%, but the amino acid identities between PmCEN and the other TFL1/CEN proteins were low: 75% in Arabidopsis, 81% in poplar, and 86% in rice. Expression Patterns of FT and CEN Homologs in Two Bamboo Species As shown above, the nucleotide and amino acid sequences were highly conserved among the 4 copies of PmFT, as well as the 2 copies of PmCEN. We carried out gene expression analyses of all the copies of PmFT and PmCEN in the life history of Phyllostachys meyeri and the flowering process of Shibataea chinensis by realtime RT-PCR using primers specific for each gene and normalized by reference to the GAPDH gene (Figure 4). In P. meyeri, PmFT was strongly expressed in the leaves of mass-flowered culms and regenerated culms in flower, while it was weakly expressed in their inflorescences (Figure 4a). In particular, the level of expression was almost 45 times higher in the leaves than in the inflorescence of mass-flowered culms. Expression of PmFT was not detected in seedlings or juvenile plants, but it was detected in regenerated sterile culms even though they did not flower. On the other hand, the expression of PmCEN was stronger in the inflorescences than in the leaves. The expression level in seedlings was 15 times as high as that in the inflorescences of regenerated flowered culms. Expression was also detected in regenerated sterile culms and juvenile plants. For a detailed VIII World Bamboo Congress Proceedings Vol 5-44 investigation of the mass-flowered stage, we analyzed the expression levels in mass-flowered S. chinensis from young to withered stages. Similar to PmFT, the expression level of the FT homolog, ScFT was higher in leaves than in inflorescences (Figure 4b), in which the expression level increased as the inflorescences matured. ScFT was weakly expressed in the withered leaves remaining after flowering. On the other hand, expression of the TFL1/CEN homolog ScCEN was highest in mature inflorescences. Its second highest expression was in leaves of the young stage, followed by leaves in the mature stage. ScCEN expression was not detected in the leaves remaining after flowering. Discussion We amplified PmFT and PmCEN using primers designed for rice FT and CEN homologs (Table 1). The FT and TFL1 genes belong to the same gene family, and exert opposing effects on flowering time. These effects have been related to the presence of critical amino acid residues: tyrosine at position 85 and glutamine at position 140 in FT; and histidine at position 88 and aspartic acid at position 144 in TFL1 (Hanzawa et al. 2005, Ahn et al. 2006). The amino acid residues in PmFT and PmCEN copies match these amino acid residues, except that PmFT4 has glutamic acid at position 140 (Figure 3). High homology was detected in amino acid sequences rather than in nucleotide sequences among the 4 copies of PmFT and between the 2 copies of PmCEN (Figures 2 and 3), suggesting that these copies were functionally homologous in Phyllostachys meyeri. Therefore, we designed primers for expression analysis at positions conserved in the 4 copies of PmFT as well as between the 2 copies of PmCEN (Table 1; Figure 2, arrows). In addition, the position of the critical tyrosine at 85 was included in the forward primer of PmFT to avoid confusion between PmFT and PmCEN. In Arabidopsis, activation of FT transcription in leaf vascular tissue induces flowering (Corbesier et al. 2007). They provided evidence that FT does not activate an intermediate messenger in leaves and concluded that the FT protein acts as a long-distance signal that induces Arabidopsis flowering. Tamaki et al. (2007) also reported that a protein encoded by a rice FT ortholog, Hd3a, moves from the leaf to the shoot apical meristem and induces flowering, and suggested that the Hd3a protein may be the rice florigen. In the present study, the highest expressions of PmFT and ScFT were detected in leaves rather than inflorescences, suggesting that these two bamboo FT homologs have roles similar to their genes in Arabidopsis and rice. However, expression of PmFT continued in regenerated sterile culms, and ScFT expression continued in withered leaves remaining after their full-bloom stage. We have investigated the regeneration process of bamboo clumps every year, and confirmed that P. meyeri exhibited sporadic flowering for 4 years from 2004 to 2008 and that S. chinensis extensively flowered this year and the culms did not die (data not shown). Thus, we suggest that the PmFT expression in regenerated culms indicates sporadic flowering after monocarpic mass-flowering in P. meyeri, while the ScFT expression in withered leaves shows not monocarpic but polycarpic mass flowering in S. chinensis. From this result, if the expression of FT homolog is analyzed in a sterile clump, it might be possible to predict whether the clump will bloom or not. The recessive mutants of TFL1 produced determinate rather than indeterminate inflorescences in Arabidopsis (Alvarez et al. 1992) and Antirrhinum (Bradley et al. 1996); it was proposed that the TFL1/CEN gene product supports the activity of an inhibitor of flower initiation. Overexpression of the rice TFL1/CEN homologs, RCN1and RCN2, caused a delay in the flowering transition and altered the panicle morphology (Nakagawa et al. VIII World Bamboo Congress Proceedings Vol 5-45 2002). RCN1 expression was observed in all the tissues of leaves, roots, flowers, vegetative meristems, and reproductive meristems. RCN2 expression was also detected in all the tissues, but its level was higher in vegetative and reproductive meristems than in other tissues. In the present study, expression of PmCEN and ScCEN was detected in all tissues, except for withered leaves of S. chinensis (Figure 4). In the reproductive phase, PmCEN expression was strongest in the inflorescences of regenerated flowering culms, followed by inflorescences of mass-flowered culms in P. meyeri. The ScCEN expression level was highest in mature inflorescences, and it was lower in young inflorescences in Shibataea chinensis. We have investigated the inflorescence architecture of these two bamboos: in P. meyeri, determinate inflorescences are borne in massflowered culms, whereas indeterminate inflorescences are borne in regenerated culms in flower (data not shown). S. chinensis bears indeterminate inflorescences (Hisamoto et al. 2009). The sufficient expected amount of ScCEN expression in the inflorescences suggested that this gene promotes indeterminate inflorescence architecture. In the seedlings and juvenile clumps, only PmCEN was detected and strongly expressed. This result suggests that not only introduction of PmFT but also inhibition of PmCEN is necessary in order to force sterile bamboos to flower. Recently, several flowering genes were isolated from woody plants, such as poplar FT/TFL1 homologs (Igasaki et al. 2008), grapevine FT/TFL1 homologs (Carmona et al. 2007), rubber tree LEAFY homolog (Dornelas et al. 2005), citrus FT homolog (Endo et al. 2005), citrus LEAFY homologs (Pillitteri et al. 2004), and apple LEAFY homologs (Wada et al. 2002). The apple FT homolog was strongly expressed and forced flowers to occur ectopically (Wada’s personal communication). These studies aim to develop new breeding technologies for the acceleration of flowering by genetic modification, because woody plants have a very long juvenile phase that is an obstacle in their breeding. Woody bamboos constitute important resources that are used as foods and materials for building construction or crafts without any emissions. They also have a very long vegetative phase and exhibit monocarpic mass flowering and death (Janzen 1976). Therefore, it is important to elucidate the molecular mechanisms of flowering in woody bamboos to develop a new technology for controlling their sexual reproduction. Thus, we now intend to exploit a new vector system to induce such a FT gene. Acknowledgments We greatly appreciate Mr. Harutsugu Kashiwagi of the Fuji Bamboo Garden for providing us various information on bamboo flowering and the materials. This work was partly supported by Grant-in-Aid for Exploratory Research no.18658062, Scientific Research (B) no.21380089 from the Ministry of Education, Culture, Sports, Science and Technology and Specific Research Assistance B from the Asahi Glass Foundation. Hisamoto, Y. was partly supported by a Grant-in-Aid for JSPS Fellows no. 20.7324. VIII World Bamboo Congress Proceedings Vol 5-46 References Ahn, J.H.; Miller, D.; Winter, V.J.; Banfield, M.J.; Lee, J.H.; Yoo, S.Y.; Henz, S.R.; Brady, R.L.; Weigel, D. 2006. A divergent external loop confers antagonistic activity on floral regulators FT and TFL1. The EMBO Journal, 25, 605-614. Alvares, J.; Guli, C.L.; Yu, X, -H.; Smyth, D.R. 1992. Terminal flower: A gene affecting inflorescence development in Arabidopsis thaliana. Plant Journal, 2, 103-116. Bradley, D.; Carpenter, R.; Copsey, L.; Vincent, C.; Rothstein, S.; Coen, E. 1996. Control of inflorescence architecture in Antirrhinum. Nature, 379, 791-797. Carmona, M.J.; Calonje, M.; Martínez-Zapater, J.M. 2007. The FT/TFL1 gene family in grapevine. Plant Molecular Biology, 63, 637-650. Corbesier, L.; Vincent, C.; Jang, S.; Fornara, F.; Fan, Q.; Searle, I.; Giakountis, A.; Farrona, S.; Gissot, L.; Turnbull, C.; Coupland, G. 2007. FT protein movement contributes to long-distance signaling in floral induction of Arabidopsis. Science, 316, 1030-1033. Dornelas, M.C.; Rodriguez, A.P.M. 2005. The rubber tree (Hevea brasiliensis Muell. Arg.) homologue of the LEAFY/FLORICAULA gene in preferentially expressed in both male and female floral meristems. Journal of Experimental Botany, 56, 1965-1974. Endo, T.; Shimada, T.; Fujii, H.; Kobayashi, Y.; Araki, T.; Omura, M. 2005. Ectopic expression of an FT homolog from Citrus confers an early flowering phenotype on trifoliate orange (Poncirus trifoliata L. Raf.). Transgenic Research, 14, 703-712. Hanzawa, Y.; Money, T.; Bradley, D. 2005. A single amino acid converts a repressor to an activator of flowering. Proceedings of the National Academy of Sciences of the United States of America, 102, 7748-7753. Hasebe, M.; Iwatsuki, K. 1990. Adiantum capillus-veneris chloroplast DNA clone bank as useful heterologous probes in the systematics of the leptosporangiate ferns. American Fern Journal, 80, 20-25. Hisamoto, Y.; Kashiwagi, H.; Kobayashi, M. 2008. Use of flowering gene FLOWERING LOCUS T (FT) homologs in the phylogenetic analysis of bambusoid and early diverging grasses. Journal of Plant Research, 121, 451-461. Hisamoto, Y.; Kashiwagi, H.; Kobayashi, M. 2009. Mass flowering and flower morphology of Shibataea chinensis Nakai (Poaceae: Bambusoideae) cultivated in the Fuji Bamboo Garden, Japan. Journal of Japanese Botany, 84, in press. Hisamoto, Y.; Kobayashi, M. 2007. Comparison of nucleotide sequences of fragments from rice FLOWERING LOCUS T (RFT1) homologs in Phyllostachys (Bambusoideae, Poaceae) with particular reference to flowering behaviour. Kew Bulletin, 62, 463-473. Igasaki, T.; Watanabe, Y.; Nishiguchi, M.; Kotoda, N. 2008. The FLOWERING LOCUS T/TERMINAL FLOWER 1 family in Lombardy poplar. Plant Cell Physiology, 49, 291-300. Janzen, D.H. 1976. Why bamboos wait so long to flower. Annual Review of Ecology and Systematics, 7, 347391. Komeda, Y. 2004. Genetic regulation of time to flower in Arabidopsis thaliana. Annual Review of Plant Biology, 55, 521-535. Nakagawa, M.; Shimamoto, K.; Kyozuka, J. 2002. Overexpression of RCN1 and RCN2, rice TERMINAL FLOWER 1/CENTRORADIALIS homologs, confers delay of phase transition and altered panicle morphology in rice. The Plant Journal, 29, 743-750. Pillitteri, L.J.; Lovatt, C.J.; Walling, L.L. 2004. Isolation and characterization of LEAFY and APETALA1 homologues from Citrus sinensis L. Osbeck ‘Washington’. Journal of the American Society for Horticultural Science, 129, 846-856. VIII World Bamboo Congress Proceedings Vol 5-47 Tamaki, S.; Matsuo, S.; Wong, H.L.; Yokoi, S.; Shimamoto, K. 2007. Hd3a protein is a mobile flowering signal in rice. Science, 316, 1033-1036. Wada, M.; Cao, Q.; Kotoda, N.; Soejime, J.; Masuda, T. 2002. Apple has two orthologues of FLORICAULA/LEAFY involved in flowering. Plant Molecular Biology, 49, 567-577. VIII World Bamboo Congress Proceedings Vol 5-48 Figure 1 Combined diagram of the life histories of Phyllostachys meyeri (yellow region) and Shibataea chinensis (blue region). Each symbol shown on the photograph corresponds to Figure 4: in P. meyeri, leaves (LF) and inflorescences (IF) of mass-flowered culms, leaves (LR) and inflorescences (IR) of regenerated culms in flower, leaves (LS) of sterile regenerated culms, leaves of juvenile clumps (LJ), and young stems of the seedlings (SS); in S. chinensis, leaves (LY) and inflorescences (IY) in the young stage, leaves (LM) and inflorescences (IM) in the mature stage, and leaves (LW) remaining after flowering. VIII World Bamboo Congress Proceedings Vol 5-49 VIII World Bamboo Congress Proceedings Vol 5-50 Figure 2 Alignment of nucleotide sequences between (a) 4 copies of PmFT and (b) 2 copies of PmCEN. A dot indicates a nucleotide identical to the PmFT1 sequence. An insertion/deletion is shown with a dash and a stop codon with an asterisk. Black and gray arrowheads indicate the start and end of introns, respectively. Arrows show the positions of primers designed for gene expression analysis; the positions correspond with Table 1. VIII World Bamboo Congress Proceedings Vol 5-51 * * Figure 3 Alignment of the putative amino acid sequences of 4 copies of PmFT and partial sequences of 2 copies of PmCEN with FT (AB027504) and TFL1 (U77674) in Arabidopsis; RFT1 (AB062676) and Hd3a (AB433508) for FT homologs and FDR1 (AF159883) and FDR2 (AF159882) for CEN homologs in Oryza sativa; and PnFT1 (AB369069) and PnTFL1 (AB369067) in poplar. Amino acids in black and gray are identical and similar, respectively. A dash indicates gaps introduced to maximize the alignment among sequences. In PmCEN1 and 2, amino acid residues from 1 to 51 have not been determined yet. Arrowheads indicate the positions of introns. Asterisks indicate amino acids that are critical to the definition of proteins in the FT and TFL1 families. VIII World Bamboo Congress Proceedings Vol 5-52 a 100 PmFT PmCEN Relative expresion 10 1 0.1 0.01 IF LF IR reproductive phase VIII World Bamboo Congress Proceedings LR LS SS LJ vegetative phase Vol 5-53 b 10 ScFT ScCEN Rerative expression 1 0.1 0.01 0.001 IY LY reproductive phase IM LM LW vegetative phase Figure 4 Expression of FT and CEN homologs in various organs of (a) Phyllostachys meyeri and (b) Shibataea chinensis in different stages of flowering. Expression levels were measured by real-time RT-PCR and normalized by reference to the GAPDH gene. a: IF, LF, inflorescences and leaves of mass flowered culms; IR, LR, inflorescences and leaves of regenerated culms in flower; LS, leaves of sterile regenerated culms; SS, young stems of seedlings; LJ, leaves of juvenile plants in P. meyeri. b: IY, LY, young inflorescences and leaves accompanying them; IM, LM, mature inflorescences and leaves; LW, leaves remaining after flowering in S. chinensis. VIII World Bamboo Congress Proceedings Vol 5-54 Relationships between Phuphanochloa (Bambuseae, Bambusoideae, Poaceae) and its related genera Sarawood Sungkaew1, Atchara Teerawatananon2,3, and Trevor Hodkinson3 1 Department of Forest Biology, Faculty of Forestry, Kasetsart University, Bangkok, Thailand. Thailand Natural History Museum, National Science Museum, Techno polis, Pathum Thani, Thailand. 3 Department of Botany, School of Natural Sciences, Trinity College Dublin, University of Dublin, Ireland. 2 Abstract Morphological and molecular relationships between a newly established bamboo genus Phuphanochloa and it related genera are discussed. Morphologically, Phuphanochloa is superficially similar to several bamboo genera e.g. Bambusa, Bonia, Dendrocalamus, Gigantochloa, and Thyrsostachys. It is, however, somewhat vegetatively similar to either Gigantochloa or Thyrsosstachys, particularly on the basis of the culm-sheath. In contrast, it is more reproductively similar to Bambusa in having distinct and disarticulating rachilla of the spikelet. However, the peculiar syndrome in breaking up of the spikelets at maturity is the best character to set Phuphanochloa apart from Bambusa. Phylogenetic analysis based on combined five plastid DNA regions; trnL intron, trnL-F intergenic spacer, atpB-rbcL intergenic spacer, rps16 intron, and matK, showed that Phuphanochloa is, with high support, sister to the group consisting of eight Bambusa species representing all its four subgenera; subg. Bambusa (B. malingensis), subg. Dendrocalamopsis (B. oldhamii and B. beecheyana), subg. Leleba (B. tuldoides, B. pachinensis, and B. dolichomerithalla), and subg. Lingnania (B. emeiensis and B. chungii). According to morphology and molecular results, Phuphanochloa can not be included in any of these subgenera. These eight species of Bambusa can not be treated as members of Phuphanochloa either. This is because there are some conflicts between morphology and molecular on Bambusa. And also, the generic delimitation of such large genus is systematically problematic. There is therefore, Phuphanochloa is best regarded as a distinct genus being closely related to Bambusa sensu lato. Keywords: Bambuseae, Morphological and molecular relationships, Phuphanochloa Introduction Phuphanochloa Sungkaew & Teerawat. is a bamboo genus newly established (Sungkaew et al. 2008). It is apparently a monotypic genus, consisted of a single species, P. speciosa Sungkaew & Teerawat. The type locality of this genus is Phu Phan National Park, in Sakon Nakhon Province, north-eastern Thailand where the generic name was named after. Formerly, Phuphanochloa was only known from its type locality. After more investigations were carried out, it is found that Phuphanochloa also occurs in Loei Province, north-eastern Thailand, especially in Phu Kradung National Park. Sungkaew et al. 2008 reported that Phuphanochloa looked VIII World Bamboo Congress Proceedings Vol 5-55 morphologically similar to other four bamboo genera namely Bambusa, Bonia, Dendrocalamus, and Gigantochloa. This study is a step-forward for a better understanding on Phuphanochloa. More information from another ally, Thyrsostachys, which is also superficially similar to Phuphanochloa, was added. The greater sample size of related genera, especially Bambusa, Dendrocalamus and Gigantochloa, for molecular analysis was conducted. The aim of this study is primarily to study morphology and molecular relationships between Phuphanochloa and its allies. It also aims to discuss the status of this genus. Materials and Methods Morphological relationship A comparison on morphological characters between Phuphanochloa and its allies based on former study (Sungkaew et al. 2008) and more information from this study were compiled. Herbarium specimens of some species of these allies from the Forest Herbarium (BKF) and the Faculty of Forestry, Kasetsart University Herbarium were examined. Molecular relationship Using DNA sequences, the relationships of Phuphanochloa in comparison with its related genera was investigated. Single and combined genes of five plastid DNA regions, trnL intron, trnL-F intergenic spacer, atpB-rbcL intergenic spacer, rps16 intron, and matK, were phylogenetically analyzed. Combined analysis of plastid DNA regions are often useful for improving phylogenetic resolution and support (Reeves et al. 2001). These five regions have shown to be useful for phylogenetic study of grasses and bamboos for both lower and higher taxonomic ranks (Sungkaew et al. 2009). Twenty-nine bamboo species of the subtribe Bambusinae sensu Soderstrom and Ellis (1987) and Sungkaew (2008) were sampled (Table 1) as the ingroup. Three species of the subtribe Melocanninae according to Ohrnberger (1999) were selected to be the outgroup because they lie outside the ingroup species which are the members of the core Bambusinae (Sungkaew et al. 2009). DNA extractions and relevant processes, including DNA sequencing which performed on an ABI PrismTM 310 Genetic Analyzer (Applied Biosystems), were carried out in Trevor’s Molecular Laboratory in the Department of Botany, School of Natural Sciences, Trinity College Dublin, University of Dublin, Dublin 2, Ireland (all molecular protocols see Sungkaew et al. 2009). Successful DNA sequences were edited and assembled using AutoAssembler Software, version 2.1. The sequences were then imported to PAUP 4.0* Beta 2 (Swofford 1998) for alignment. Sequences were aligned by eye. Gaps were scored as additional binary characters (scoring gaps of identical size and position only). The resulting sequences were subjected to maximum parsimony analysis using the heuristic search options in PAUP 4.0* Beta 2 (Swofford 1998). Searches included 1,000 replicates of random stepwise addition saving no more than 100 trees for tree bisection reconstruction (TBR) branch swapping per replicate. Bootstrapping included 1,000 replicates and the same heuristic search settings as the individual searches except that simple addition sequence was used instead of random stepwise addition. VIII World Bamboo Congress Proceedings Vol 5-56 Table 1 Taxa and vouchers of all sequences Taxon Bambusinae Bambusa bambos (L.) Voss Bambusa beecheyana Munro Bambusa chungii McClure Bambusa dolichomerithalla Hayata Bambusa malingensis McClure Bambusa oldhamii Munro Bambusa oliveriana Gamble Bambusa pachinensis Hayata Bambusa tulda Roxburgh Bambusa tuldoides Munro Dendrocalamus asper (J.H. Schultes) Backer ex K.Heyne Dendrocalamus asper (J.H. Schultes) Backer ex K.Heyne Dendrocalamus brandisii (Munro) Kurz Dendrocalamus copelandii (Gamble ex Brandis) N.H.Xia & Stapleton Dendrocalamus dumosus (Ridley) Holttum Dendrocalamus giganteus Munro Dendrocalamus hamiltonii Nees & Arnott ex Munro Dendrocalamus khoonmengii Sungkaew, A. Teerawatananon & Hodk. Dendrocalamus latiflorus Munro Dendrocalamus membranaceus Munro Dendrocalamus pendulus Ridley Dendrocalamus sinicus Chia & J.L. Sun Dendrocalamus strictus (Roxburgh) Nees Gigantochloa albociliata Munro Gigantochloa atroviolacea Widjaja Gigantochloa ligulata Gamble Gigantochloa scortechinii Gamble Bambusa emeiensis L.C.Chia & H.L.Fung Phuphanochloa speciosa Sungkaew & Teerawat. Thyrsostachys siamensis Gamble Melocanninae Cephalostachyum pergracile Munro Pseudostachyum polymorphum Munro Schizostachyum zollingeri Steudel Voucher/Herbarium Source SS&AT 030704-16/THNHM&KUFF Stapleton 1313/KEW Stapleton 1320/KEW Stapleton 1343/KEW Stapleton 1332/KEW SS&AT 111/THNHM&KUFF Stapleton 1321/KEW Stapleton 1333/KEW Stapleton 1328/KEW Stapleton 1327/KEW Thailand USA1, cultivated USA1, cultivated USA1, cultivated USA1, cultivated Thailand, cultivated USA1, cultivated USA1, cultivated USA1, cultivated USA1, cultivated BAM12 Malaysia, cultivated SS&AT 110704-1/THNHM&KUFF SS&AT 260903-8/THNHM&KUFF Thailand, cultivated Thailand SS&AT 20/THNHM&KUFF&TCD SS&AT 389/THNHM&KUFF&TCD BAM452 Thailand Thailand Malaysia, cultivated SS&AT 787/THNHM&KUFF Thailand SS&AT 257/THNHM&KUFF&TCD SS&AT 113/THNHM&KUFF SS&AT 020704-4/THNHM&KUFF SS&AT 231/THNHM&KUFF SS&AT 127/THNHM&KUFF SS&AT 718/THNHM&KUFF SD 1436/KEW Stapleton 1311/KEW SS&AT 090704-4/THNHM&KUFF SS&AT 309/THNHM&KUFF SS&AT 624/THNHM&KUFF SS&AT 191/THNHM&KUFF&TCD SS&AT 020704-3/THNHM&KUFF Thailand Thailand, cultivated Thailand Thailand Thailand, cultivated Thailand Thailand USA1, cultivated Thailand Singapore, cultivated China, cultivated Thailand Thailand SD 1435/KEW SS&AT 176/THNHM&KUFF SS&AT 090704-1/THNHM&KUFF Thailand Thailand Thailand Remarks; Abbreviations are as follows; KEW, Kew herbarium, England; KUFF, Herbarium of Faculty of Forestry, Kasetsart University, Bangkok, Thailand; THNHM, Thailand Natural History Museum, National Science Museum, Techno Polis, Pathum Thani, Thailand; TCD, Herbium, School of Botany, Trinity College, Dublin, Ireland; SS, S. Sungkaew; AT, A. Teerawatananon; SD, S. Dransfield. 1 California, United States of America 2 Bambusetum, Rimba Ilmu Botanic Garden, University of Malaya, Kuala Lumpur, Malaysia; specimen collected by K.M. Wong VIII World Bamboo Congress Proceedings Vol 5-57 Results Morphological relationship A morphological character of Phuphanochloa in comparison to its allies based on former study (Sungkaew et al. 2008) together with more information from this study were compiled and is presented in Table 2. Molecular relationship The justification to combine datasets in the analyses in this study was based on an examination of groupings (and support for these) found in the single-gene analyses (data not shown). No major and well supported incongruences were found between the results from single gene region analyses and it was deemed appropriate to combine datasets. The aligned metrix of the combined five plastid DNA regions (trnL intron, trnL-F intergenic spacer, atpB-rbcL intergenic spacer, rps16 intron, and matK) was 4,243 bp long. 13 characters were excluded and of the remaining 4,230 characters, 4,153 were constant, 29 were variable but parsimony-uninformative, and 48 were parsimony informative. The tree search using maximum parsimony found three equally most parsimonious trees, of 81 steps. CI and RI were 0.97 and 0.98 respectively. One of the three equally most parsimonious trees is shown as a phylogram with bootstrap values and strict consensus information in Figure 1. Bootstrap (BS) percentages (≥50%BS) are described as low (50–74%), moderate (75–84%), and high (85–100%). Phuphanochloa is sister to the group consisting of Bambusa species; B. emeiensis, B. oldhamii, B. malingensis, B. tuldoides, B. pachinensis, B. dolichomerithalla, B. chungii, and B. beecheyana with high bootstrap support (85%BS, Figure 1). These eight Bambusa species is highly supported as a monophyletic group (83%BS). Within this Bambusa group, more groupings are found. B. pachinensis is sister to B. dolichomerithalla and B. chungii is sister to B. beecheyana, both with low bootstrap support of 63% and 65% respectively. A subgroup comprising five species; B. tuldoides, B. pachinensis, B. dolichomerithalla, B. chungii, and B. beecheyana, was formed but collapsed in the strict consensus analysis. Thyrsostachys groups with some species of other two genera with high support (85%BS); Gigantochloa (G. ligulata and G. albociliata) and Bambusa (B. tulda and B. bambos). Dendrocalamus species bunch together with some representatives from other two genera with high support (100%BS); Bambusa (B. oliveriana) and Gigantochloa (G. scortechinii and G. atroviolacea). Two representatives of D. asper group with two species of Gigantochloa, G. scortechinii and G. atroviolacea, with low support (63%BS). In addition, these two Gigantochloa species are grouped together with low support (64%BS). VIII World Bamboo Congress Proceedings Vol 5-58 Table 2 Comparative table of habit and morphological characters between Bambusa, Bonia, Dendrocalamus, Gigantochloa and Phuphanochloa Characters Bambusa Bonia Dendrocalamus Gigantochloa Phuphanochloa Thyrsostachys* Habit usually erect scrambling Usually erect usually erect usually erect usually erect Branch number at mid-culm branch complement several Single Several several several several Culm-sheath auricles; oral setae/ Culm-sheath blade usually conspicuous; always present/ usually erect usually conspicuous, occasionally inconspicuous or small; usually present, occasionally absent/ erect to deflexed conspicuous, but often small to absent; present or absent/ erect to deflexed usually absent or small; usually absent, occasionally present/ erect to deflexed usually absent or small; always absent/ spreading to deflexed, never erect usually absent or small; usually absent/ erect, occasionally deflexed Number of glumes per spikelet 0–3 0–2 (1–)2–4(–9) 1–5 1–4 1–3(–4) Number of fertile florets per spikelet 2–13 3–9 1–8 (1–)2–5 7–9 1–3 Rachilla internodes distinct and disarticulating distinct and disarticulating obscure and not disarticulating obscure and not disarticulating distinct and disarticulating obscure and not disarticulating Stigma typically (1–)3, plumose typically 3, plumose typically 1(–3), plumose typically 1, plumose typically 3, slightly plumose typically 1–3, plumose Filaments typically free typically free typically free always fused into a firm tube typically free typically free Breaking up at maturity of spikelets either break up above the glume(s) or between the florets unknown usually break up above the glume(s) usually break up above the glume(s) usually break up in one of two ways (both of which are usually present on any single individual); either above the glume(s) or above the lowest floret usually break up above the glume(s) * results from this study, otherwise from Sungkaew et al. 2008 VIII World Bamboo Congress Proceedings Vol 5-59 1 Gig_atroviolacea 64 Gig_scortechinii 1 63 Den_asper_BAM1 Den_asper_SS&AT110704-1 3 Bam_oliveriana Den_brandisii 1 Den_copelandii 3 Den_dumosus Den_giganteus 2 Den_hamiltonii 2 Den_latiflorus 6 100 Den_membranaceus Den_pendulus 1 Den_sinicus 1 Den_khoonmengii Den_strictus 1 Bam_beecheyana 1 65 Bam_chungii 1 1 Bam_dolichomerithalla 63 Bam_pachinensis 2 Bam_tuldoides 2 83 Bam_malingensis 2 85 Bam_oldhamii Bam_emeiensis 4 22 100 Phuphanochloa speciosa Bam_bambos 1 Bam_tulda 2 85 8 100 5 Gig_albociliata 1 Gig_ligulata Thy_siamensis 4 3 Cep_pergracile Sch_zollingeri Pse_polymorphum 1 change Figure 1. One of three equally most parsimonious trees shown as a phylogram obtained from comparative sequence analysis of combined trnL-F, atpB-rbcL, rps16 and matK sequence data. Values above branches represent the number of steps supporting each branch. Values below branches represent the percentages of bootstrap supporting each branch. Arrow head represents node not supported by strict consensus. Bam=Bambusa; Cep=Cephalostachyum; Den=Dendrocalamus; Gig=Gigantochloa; Pse=Pseudostachyum; Sch=Schizostachyum; Thy=Thyrsostachys. VIII World Bamboo Congress Proceedings Vol 5-60 Discussion Morphological relationship On the basis of morphology, Phuphanochloa may superficially be similar to several bamboo genera namely Bambusa, Bonia, Dendrocalamus, Gigantochloa, and Thyrsostachys. Vegetatively, it looks somewhat similar to either Gigantochloa or Thyrsosstachys, especially on the basis of the culm-sheath detail (see Table 2). Contrarily, it is more reproductively similar to Bambusa in having distinct and disarticulating rachilla of the spikelet. However, Phuphanochloa has the spikelets that usually break up at maturity in one of two ways (both of which are usually present on any single individual); either the spikelet totally breaks up above the glume(s) leaving only the elongated rachilla internode (0.5–2 cm long), or it breaks up above the glume(s) and above the lowest floret leaving the upper part of the elongated rachilla internode (to 0.5 cm long) along with the glume(s) and intact lowest floret. This syndrome is not the case in Bambusa (Sungkaew et al. 2008). In addition, while Bambusa has 1–3 distinctly plumose stigmas but there are usually three, and they are only slightly plumose in Phuphanochloa. Molecular relationship The results from the combined analysis of five plastid DNA regions (Figure 1) showed that the sister relationship between Phuphanochloa and a group comprising eight Bambusa species (B. emeiensis, B. oldhamii, B. malingensis, B. tuldoides, B. pachinensis, B. dolichomerithalla, B. chungii, and B. beecheyana) is highly supported (85%BS). This is congruent with the previous molecular study using a multi-gene region phylogenetic analysis (also using five plastid DNA regions, trnL intron, trnL-F intergenic spacer, atpB-rbcL intergenic spacer, rps16 intron, and matK gene region; Sungkaew et al. 2009). These eight species of Bambusa group together with high bootstrap support of 83%. They represent all the four subgenera of Bambusa according to Xia et al. (2006). Bambusa malingensis represents subg. Bambusa; B. oldhamii and B. beecheyana represent subg. Dendrocalamopsis; B. tuldoides, B. pachinensis, and B. dolichomerithalla (treated under B. multiplex (Loureiro) Raeuschel ex Schultes & J. H. Schultes var. multiplex by Xia et al. (2006)) represent subg. Leleba; and B. emeiensis and B. chungii represent subg. Lingnania. This would suggest that Phuphanochloa can not be included in any of these four subgenera of Bambusa because of the high support of their sister relationship (85%BS) and the high support of a clade consisting of these eight Bambusa species (83%BS). Xia et al. (2006) divided Bambusa into four subgenera relying greatly on the culm-sheath. Base on this manner, Phuphanochloa would look similar to those of subg. Lingnania as they share a common character in having narrow culm-sheath blade. However, there is no evident from our molecular results to support this hypothesis. There are some conflicts between morphology and molecular information. Some representatives from these four subgenera did not group together systematically. Some of them from different subgenera mis-grouped together, even though with low support, e.g. B. beecheyana of subg. Dendrocalamopsis groups with B. chungii of subg. Lingnania. Moreover, B. bambos, the type species of Bambusa which must taxonomically be regarded as a member of subg. Bambusa, did not group with Bambusa malingensis. It groups with B. tulda, a member of subg. Leleba, and some species of other genera, Gigantochloa and Thyrsostachys (85%BS). This would suggest that the generic delimitation of Bambusa is still unclear. The taxonomy of Bambusa is in a state of flux, it is a VIII World Bamboo Congress Proceedings Vol 5-61 large genus with over 100 poorly understood species (Ohrnberger 1999; Xia et al. 2006). Incongruence between the morphological classification and phylogenetic study on this genus has been previously revealed by Sun et al. (2005). If ones think that the status of Phuphanochloa may be uncertain. There are two possible scenarios to cope with this problem. Firstly, Phuphanochloa may be simply regarded as a new subgenus of Bambusa. Secondly, some species of Bambusa particularly those eight species (Figure 1) should be transferred to be new members of the distinct genus Phuphanochloa. However, these two ways will not be systematically reasonable until the generic delimitation of Bambusa would be clarified. Thus, the best way to do now is to keep Phuphanochloa as a distinct genus being closely related to Bambusa sensu lato. This idea is now excepted by the BPG (Bamboo Phylogeny Group; personal communication). Generic delimitations of other two genera, Dendrocalamus and Gigantochloa, are also unclear. Dendrocalamus is not strictly monophyletic because a species of Bambusa represented by B. oliveriana, and two species of Gigantochloa, G. scortechinii and G. atroviolacea, were embedded in the strongly supported Dendrocalamus group (100%BS). The misplacement of these taxa was greatly discussed in Sungkaew et al., (submitted) and it requires further investigations. Acknowledgements We thank several people who helped or provided us with the plant material used in this study: Drs. Soejatmi Dransfield, Wang Hong, Wong Khoon Meng, Ruth Kiew, Duangchai Sookchaloem, and Chris M.A. Stapleton. This work was supported by: the TRF/BIOTEC Special Program for Biodiversity Research and Training grant T_147003; a Trinity College Dublin, Eire, Postgraduate Studentship and the Trinity College Postgraduate Travel Reimbursement Fund; and the Faculty of Forestry, Kasetsart University, Bangkok, Thailand. VIII World Bamboo Congress Proceedings Vol 5-62 References Ohrnberger, D. 1999. The bamboos of the world: annotated nomenclature and literature of the species and the higher and lower taxa. Elsevier Science, Amsterdam. Reeves, G.; Chase, M.W.; Goldblatt, P.; Rudall, P.; Fay, M.F.; Cox, A.V.; Lejeune, B.; Sousa-Chies, T. 2001. Molecular systematics of Iridaceae: evidence from four plastid DNA regions. American Journal of Botany, 88, 2074–2087. Soderstrom, T.R.; Ellis, R.P. 1987. The position of bamboo genera and allies in a system of grass classification. In: Soderstrom, T. R.; Hilu, K.W.; Campbell, C.S.; Barkworth, M.E. ed, Grass systematics and evolution. Smithsonian Institution Press, Washington, D.C. pp. 225–238. Sun, Y.; Xia, N.H.; Lin, R. 2005. Phylogenetic analysis of Bambusa (Poaceae: Bambusoideae) based on Internal Transcribed Spacer sequences of nuclear ribosomal DNA. Biochem Genet, 43, 603–612. Sungkaew, S. 2008. Taxonomy and systematics of Dendrocalamus (Bambuseae; Poaceae). Ph.D. thesis, University of Dublin, Trinity College, Dublin. Sungkaew, S.; Stapleton, C.M.A.; Salamin, N.; Hodkinson, T.R. 2009. Non-monophyly of the woody bamboos (Bambuseae; Poaceae): a multi-gene region phylogenetic analysis of Bambusoideae s.s. Journal of Plant Research, 122, 95–108. Sungkaew, S.; Teerawatananon, A.;. Parnell, J.A.N; Stapleton, C.M.A.; Hodkinson, T.R. 2008. Phuphanochloa, a new bamboo genus (Poaceae: Bambusoideae) from Thailand. Kew Bulletin, 63, 669–673. Swofford, D.L. 1998. Phylogenetic analysis using Parsimony (PAUP) version 4.0. Sinauer Associates, Sunderland. Xia, N.H.; Chia, L.C.; Li, D.Z.; Stapleton, C.M.A. 2006. Bambusa Schreber. In Wu, Z-Y.; Raven, P.H. ed, Flora of China, Vol. 22. Science Press, Beijing & Missouri Botanical Garden, St. Louis. pp. 9–38. VIII World Bamboo Congress Proceedings Vol 5-63 Evaluation of the Polymorphic of Microsatellites Markers in Guadua angustifolia (Poaceae: Bambusoideae) Lorena Torres¹, Diana Carolina Lopez², Juan Diego Palacio², Myriam Cristina Duque4, Carlos Andrés Pérez Galindo³, Iván Andrés González Vargas¹, Heiber Cárdenas Henao¹ 1. Universidad del Valle, Grupo de Eco genética 2. Laboratorio de Biología Molecular Instituto de Investigación de Recursos Biológicos Alexander Von Humboldt 3. Universidad Santiago de Cali 4. Centro Internacional de Agricultura Tropical Abstract Guadua angustifolia, one of the world's 20 best bamboos known for their physical and mechanical properties and wide use in the construction industry. It has been used intensively in Colombia reducing native populations to a few hectares. So far, the only strategy for the conservation of genetic and phenotypic variability of the species, although unknown, is the existence of the Germplasm Bank of Bambusoideae located in the Botanical Garden Juan María Céspedes, Tuluá - Valle del Cauca, with accessions from 16 provinces of Colombia. In this study 26 microsatellite markers were designed and evaluated in 46 accessions of G. angustifolia to assess the molecular genetic variability of the accessions in the bank and get a new molecular tool enable to conduct population analysis, micro- evolutionary and taxonomic studies. Amplification of 10 loci was obtained, two showed a pattern of bands with multilocus of genetic origin; in addition, the amplification of 14 loci in Bambusa and between seven or eight loci was reported in other species of Guadua . The eight loci standardized in G. angustifolia displayed values of PIC (Polymorphism Index Content) between 0, 3981 and 0, 8517, and probabilities of identity between 0, 0334 and 0, 4134 being medium and highly polymorphic. Therefore, these microsatellites are very good tools to carry out population analyses, taxonomic and microevolutionary studies in G. angustifolia and possibly in other species of the genus Guadua and Bambusa, knowledge that will contribute in the creation and implementation of strategies of conservation and sustainable use of the same ones, specially of the Guadua in Colombia. Introduction Guadua angustifolia (Karl Sigismund Kunth 1822), American bamboo, is considered one of the 20 best in the world for their excellent physical and mechanical properties, their large size and its wide use in the construction industry (Villegas et al. 2003). In America is distributed from northern Mexico to northeastern Argentina (Young & Judd 1992, Londoño 1991). In Colombia, extends by three mountain ranges from north to south, at VIII World Bamboo Congress Proceedings Vol 5-64 elevations between 500 and 1 500 meters above sea level, dominating the inter-Andean valleys, where they form large associations called "Guaduales" (Londoño 1990). Due to the continued use of this resource and the extensive colonization of human settlements, few hectares of natural G. angustifolia are left in our country (approximately 31 000 ha) (Castaño & Moreno 2004; Villegas et al.2003; Cruz 1994). Therefore it is important the development and implementation of conservation strategies for this species. However, the required prior biological knowledge for its development such as the dynamics of their populations, their genetic diversity, taxonomy and evolution (Frankhan et al.2002), which is lacking today (McNeely 1995; Stapleton & Ramanathan 1995; Bystriakova et al. 2003, 2004). In 1987 the Bambusoideae Germplasm Bank at the Botanical Garden Juan María Céspedes was established, owned by the Institute for the Research and Preservation of Cultural and Natural Heritage of Valle del Cauca (INCIVA), with the aim of preserving bamboos and deepening their knowledge. This has accessions of G. angustifolia from 16 provinces of Colombia (Londoño 1991, Marulanda et al. 2002), thus conserve a high variability of the species, which is convenient topic of study in order to continue conserving G. angustifolia using this strategy. Molecular markers are tools that have allowed to estimate the genetic variability in many species, characterize varieties in germplasm banks, select cultivars, estimated population dynamics and to carry out taxonomic, ecological and evolutionary studies in diverse organisms (Parker et al. 1998, Bachmann 1994, Chasan 1991). In order to obtain basic knowledge for the development of conservation strategies, it is useful to implement them in G. angustifolia. Microsatellites are short DNA sequences of no more than six bases repeated in tandem (Goldstein & Schlötterer 1999), have codominant inheritance, are neutral and highly polymorphic, thus allowing each individual genotype and conduct allocation of parental (Parker et al. 1998, Chambers & MacAvoy 2000), characteristics that facilitate to conduct specific ecological, evolutionary and taxonomy studies, such as estimating the effective size, genetic diversity and structure of populations, allowing to characterize varieties or cultivars identification and selection, identification of breeding systems, gene flow, migration and introgression (Ouborg et al. 1999; Frankhan et al. 2002, Chambers & MacAvoy 2000, Barrera 1996). The use of these molecular markers has not yet been reported for any species of the genus Guadua, so its implementation is relevant. In this study, the polymorphic information content of 26 microsatellite systems was evaluated in 46 accessions of G. angustifolia from the Germplasm Bank of Bambusoideae. Then will be useful in population analysis, and in taxonomic and micro evolutionary studies, knowledge that will help in the creation and implementation of strategies for conservation and sustainable use of Guadua. Methodology The study was conducted at the Laboratory of Molecular Biology of the Alexander Von Humboldt (IAvH) Institute located in the facilities of the International Center for tropical Agriculture (CIAT). VIII World Bamboo Congress Proceedings Vol 5-65 The Germ Bank and Sampling The Germplasm Bank of Bambusoideae is located in the district of Mateguadua, Municipality of Tuluá (Valle del Cauca), approximately 800 meters away from the administrative headquarters of the Botanical Garden Juan María Céspedes owned by the INCIVA. It has an area of about 2 500 m2. It has climatic conditions characteristic of tropical dry forest with an altitudinal location between 950 to 1 100 meters (Londoño 1990). Young leaves were collected in good condition from 45 accessions of G. angustifolia from different departments of Colombia and one accession from Costa Rica, 14 accessions of different species of the genus Bambusa, and thee of Guadua (Table 1). The leaf tissue was placed in paper bags that were stored immediately in plastic jars filled with silica gel with cobalt indicator. The leaves collected were finely macerated in liquid nitrogen. The mash was kept at -80 ° C until DNA extraction. DNA Extration and quantification The DNA was extracted with the Micro extration DNA protocol of Dellaporta (1983) with modifications for rice and with a later mofication for G. angustifolia by Potosí et al. (2006). The evaluation of the DNA was performed by electrophoresis in horizontal agarose gels at 0.8% stained with ethidium bromide, at 48 volts for 30 minutes, adding 2 ul of DNA. It was visualized on a UV transilluminator ( Fotodyne Inc). Quantification was carried out in a TECAN spectrophotometer multifunctional Genius, Austria, 260 nm and by agarose gels comparison with DNA Lamda. Primer microsatellite design DNA from one individual was used as a source of genomic clones and was used to prepare and enrich GATA tetranucleotide markers in G. angustifolia. Genomic DNA was used as starting material- then Psh A1/Hae III double restriction/ligation to linker M28/M29p. M28 5’ CTCTTGCTTGAATTCGGACTA M29p 5’ pTAGTCCGAATTCAAGCAAGAGCACA), Linker-ligated DNA was denatured and hybridized to biotinylated microsatellite 5’ biotin GATA6 (50C), Dynal M270 beads and amplification with M28 primer. Eco RI digestion and ligation into de-phosphorylated Eco RI treated pUC19 followed by electroporation into E. coli DH10B. Colony screening was used 5’ 32P- GATA6 50C in 5XSSPE washes in 5XSSPE 50C. A set of 24 positive GATA clones were sequenced and 26 primer pairs were tested. Sequences were obtained by amplifying an aliquot of frozen bacterial culture from positive hybridizing 32-P GATA6 colonies using the M13 forward (F) and reverse (R) primers. The amplification reactions were treated with Exonuclease I and alkaline phosphatase to remove excess primer and unincorporated deoxynucleotide triphosphates. After heat deactivation, approximately 10 ng of PCR product was sequenced using M13 forward and/or reverse primers with Applied Biosystems Big Dye V3.1 and ABI3730 . VIII World Bamboo Congress Proceedings Vol 5-66 Table 1. Accessions studied from the Bambusoideae Germplasm Bank of the Botanical Garden Juan María Céspedes. Accesion Code Species Morphological Variants Provinces XL 375 XL 345 XL 542 JA 1006 XL 343 JA 1003 Bicolor 43 Bambusa vulgaris JA 1004 Bambusa vulgaris(M2) XL 233 XL 282 XL 124 XL 214 XL 281 XL 291 Bambusa bambos XL 303 JA 1026 Guadua weberbaueri Guadua angustifolia Guadua angustifolia Guadua superba Guadua amplexifolia Guadua angustifolia Guadua amplexifolia Guadua angustifolia Bambusa vulgaris Guadua amplexifolia Bambusa vulgaris Guadua angustifolia Guadua paniculata Guadua angustifolia Guadua glauca Guadua angustifolia Guadua angustifolia Bambusa bambos Guadua angustifolia Guadua angustifolia Guadua weberbaueri Cebolla Cebolla Cauca, Mercaderes Santander, Floridablanca Amazonas, Leticia Sucre Santander, Puente Nacional Córdoba, Montería Valle del Cauca, Tuluá XL 115 Guadua angustifolia Cebolla XL 206 Bicolor42 XL 109 XL 1012 Guadua paniculata Guaduaangus (Costa Rica) JA 1028 XL 91 JA 1031 XL 235 JA 1023 XL 344 XL 208 Bambusa vulgaris (M1) JA 1042 Guadua angustifolia Guadua angustifolia Guadua uncinata Guadua angustifolia Guadua paniculata Cebolla Bicolor Macana Bicolor Bitata Sucre, Sincelejo Vulgaris Macana Cebolla Macana Nariño, Ricaute Meta, Serranía de Matupa Valle del Cauca, Tulua Putumayo, Mocoa Meta, Acacia Meta, Serranía de la Macarena Macana Macana Meta, Cumaral Huila, Aipe Nigra Cebolla Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua uncinata Bambusa vulgaris Guadua angustifolia VIII World Bamboo Congress Proceedings Caquetá, Belén de los Andaquíes Putumayo, Puerto Caicedo Valle del Cauca, Tuluá Caquetá, Morelia Antioquia, Venecia Costa Rica Cebolla Cebolla Cebolla Cebolla Cebolla Macana Vulgaris Cebolla Cundinamarca, Guaduas Huila, San Agustín Caldas, Florencia Nariño, Ricaute Valle del Cauca, El Cairo Santander, Curiti Putumayo, Puerto Caicedo Risaralda, Santa Rosa Vol 5-67 JA 1049 JA 1041 JA 1038 JA 1039_2 JA 1046_1 XL 144 JA 1038_1 JA 1047_1 JA 1048 JA 1035_ 1 JA 1045 JA 1040 JA 1056 JA 1055 JA 1051_2 JA 1052_1 JA 1056B JA 1058 JA 1057 JA 1059_1 JA 1060_1 JA 1061 JA 1062_2 JA 1063 JA 1064 Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua glauca Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Guadua angustifolia Cebolla Macana Macana Cebolla Macana Macana Macana Macana Castilla Castilla Cebolla Cebolla Cebolla Macana Macana Macana Castilla Cebolla Cebolla Bicolor Cebolla Bicolor Cotuda Bicolor Valle del Cauca, Tuluá Risaralda, Pereira Valle del Cauca, Sevilla Valle del Cauca, Sevilla Valle del Cauca, Rio Frio Caquetá, Florencia Valle del Cauca, Sevilla Valle del Cauca, Buga Valle del Cauca, Tulua Valle del Cauca, El Cerrito Quindío, Barcelona Valle del Cauca, B/lagrande Valle del Cauca, Cali Valle del Cauca, Jamundí Valle del Cauca, Jamundí Valle del Cauca, Jamundí Valle del Cauca, Cali Quindío, Quimbaya Quindío, La Tebaida Valle del Cauca, Alcalá Valle del Cauca, Tuluá Valle del Cauca, Restrepo Valle del Cauca,Vijes Valle del Cauca, Restrepo Valle del Cauca, Buga JA= J. Adarve; XL= X. Londoño; ns= whitout number VIII World Bamboo Congress Proceedings Vol 5-68 Amplification of microsatellite regions Initially, 26 microsatellites designed were tested for G. angustifolia by PCR in the accessions of this species. They were subsequently tested in other species of Bambusa and Guadua genus. Each reaction mixture contained 35ng/ul DNA, 10 mM Tris pH 9, 50mM KCl, 2mM MgCl2, 0.1mm of each dNTP, 0.072μM of each primer and 3U Taq polymerase (CIAT Biotechnology Unit) to a final volume of reaction 25 μl. We used a thermal cycler PTC-100 Programmable Thermal Controller, MJ Research, Inc, following the program: 94 ° C for 1 minute (94 ° C for 30 seconds, 54 ° C for 45 seconds, 72 ° C for 45 seconds) 35 times, 72 per 10 minutes, 4 ° C for five minutes, with temperature-specific banding of G. angustifolia optimized for each locus, which works for the other species of the genus Bambusa and Guadua (Table 2). The reaction product was assessed on agarose gels 1.5%, stained with ethidium bromide, loading 8 μl of the product together with 2 ml of buffer blue juice. The identification of each allele per locus was performed by electrophoresis in vertical polyacrylamide gels prepared in 4% TBE 0.5X. A PCR product was added a solution of formamide (0.05% Bromophenol blue and xilencianol, in 95% formamide, 20 mM EDTA) in a 1 ml of solution per 5 ml of PCR product is denatured and a 94 ° C for 5 minutes before serving. The amount of product added to the gel varied with their concentration. The electrophoretic separation was performed at 120W, with an initial flow of 1,800 to 2,000 V with an optimum temperature of 50 ° C. Separation After about an hour apart, the gel was fixed, dyed with silver nitrate and revealed according to the method of Bassam et al. (1991). The reading of each gel was conducted on a white light transilluminator, counting the bands with higher resolution. Data analysis From the profiles obtained in the polyacrylamide gels, alleles of each locus were visually based on their molecular size (bp) using as reference the known values of the markers 10bp and 25 bp (Invitrogen Corp., Carlsbad, California ). Later, the genotypes were described by generating a matrix of presence / absence (binary) of alleles for each microsatellite. It was counted the number of alleles identified per locus (A) and their frequencies were estimated using the respective SunOS 5.9 platform SAS version 9.1.3. At each locus, we calculated the allelic richness (A-1), the homocigosity (ho) and heterozygosity (Ho) observed, the unbiased expected heterozygosity of Nei (1978), H e = n(1 − according to Botstein et al.(1980), PIC = 1 − ( ∑p 2 ) / n − 1 , the polymorphic information index (PIC) ∑ pi ) − ∑ n 2 i =1 i n −1 ∑2p n i =1 j =i +1 2 i 2 p j where, pi was the frequency of the i allele and pj is the frequency of the j allele. The probability of identity (I) defined as the ability of two individuals at random from the population within a given locus have the same genotype by locus (Paetkau et al. 1995) was estimated as I = ∑ pi + ∑ 4 n −1 ∑ (2 p p n ) 2 and the combined probability of identity (Ic) as I c = ∏ I k , where k represents the locus, and indicates, for all microsatellite used, if are good descriptors of i =1 j =i +1 i j the diversity in the germplasm bank. VIII World Bamboo Congress Proceedings Vol 5-69 Table 2.Standardized microsatellites in different species of Guadua and Bambusa genus with temperature of anneling of G. angustifolia Locus Bam 1- 14 Bam 1- 15 Bam 11- 2 Bam 1-11 Bam 1-17 Bam 1-22 Bam 1-3 Bam 1-5 Bam 1-6 Bam 16-2 Bam 17- 2 Bam 1-8 Bam 2-1 Bam 2-11 Bam 2-13 Bam 2-2 Bam 2-3 Bam 2-5 Bam 2-6 Bam 2-7 Bam 2-8 Bam 4-2 Bam 9-2 T. anneling in G. angustifolia(°C) 54 54 54 54 54 54 54 54 54 54 54 54 50 54 54 54 48 48 50 54 45 54 54 Size (Pb) in G. angustifolia 230 180 120 280 250 280 150 180 250 200 250 250 250 150 250 500 180 250 180 500 200 250 180 Note: The sequences of the primers (5'-3 ') and type of repetition is not included in this table because they have not yet been published and are the property of the entities funding the project. VIII World Bamboo Congress Proceedings Vol 5-70 Results and Discussion Amplification of the microsatellites regions Of the 26 microsatellites evaluated were able to standardize in G.angustifolia 10 loci in G. superba, G. amplexifolia and G. weberbaueri 7 loci, in G. paniculata, G. glauca and G. uncinata 8 loci, in B. vulgaris 18 loci and in B. Bambos 12 loci (Table 3). The amplification in agarose gels ranged between 150 and 500 bp and in the acrylamide gels were distinguished alleles between 101 and 500 bp (Figures 1 and 2). Figure 1. Microsatellites Amplification. A. Amplification of locus Bam 2-13 in G. angustifolia (1-3, 6-11) and B. vulgaris (4, 5). B. Bam 1-11 in G. angustifolia (1-18) and B. vulgaris (3). VIII World Bamboo Congress Proceedings Vol 5-71 Table 3. Optimally standardized microsatellites in each species of Bambusa and Guadua genus. G. G. G. G. G. G. G. B. B. angustifolia superba amplexifolia paniculata glauca uncinata weberbaueri bambos vulgaris Bam 2-1 X X X X Bam 2-13 X X X X X X X X X Bam 2-5 X X X X X X Bam 2-2 X X X X X X X X X Bam 2-3 X X X X X X X X X Bam 2-6 X X X Bam 1-11 X X X X X X X X X Bam 2-7 X X X X X X X Bam 2-11 X X X X X X X X X Bam 2-8 X Bam 114 X Bam 115 X X Bam 112 X Bam 1-17 X X Bam 1-22 X X Bam 1-3 X Bam 1-5 X Bam 1-6 X X Bam 16-2 X Bam 172 X X Bam 1-8 X X Total 10 7 7 8 8 8 7 12 18 Especie VIII World Bamboo Congress Proceedings Vol 5-72 The amplification of microsatellite regions in species of the same genus has been reported in plants such as cassava (Roa et. Al. 2000), in forest trees (Dayananda et al. 1997), and apparently is very common in the grasses. Indeed, within the subfamily Bambusoideae, Nayak & Rout (2005) also succeeded in amplifying 18 microsatellite regions in different species of the genus Bambusa. Marulanda et al. (2007) tested Single Sequences Repeats (SSR) in rice and sugarcane in different species of the Guadua genus, obtaining successful amplification of 37 of these sequences, which indicates the great genetic proximity between the genus in this family, as reported Ishii & McCouch (2000), Kresovich et al. (1995) and Zhao & Kochert (1992), who have identified sequences of rice capable of amplifying in different species of maize and bamboo. Figure 2. Viewing acrylamide gels at 4% for the identification of alleles of the loci A. Bam 2-13 and B. Bam 2-11 (Bambusa: 1, 2, 3) VIII World Bamboo Congress Proceedings Vol 5-73 This high conservation of microsatellite loci within the family Poaceae promotes the study of genetic variability in species where these markers have not been developed yet, since it would be possible to use these SSR sequences that have been evaluated, such as those obtained in this study , instead of making the whole process of design libraries, saving time and money. In turn, this would permit obtaining the knowledge of the genetic diversity in those species for which this area is unknown, as in the case of most bamboos. As a result, it is recommended to evaluate this new set of microsatellites in other species of the subfamily Bambusoideae. Regarding the loci Bam 2-8 and Bam 2-11, although amplified in all species of Guadua and Bambusa they presented a profile of bands in acrylamide gels similar to those with a multilocus gene origin (Avise 1994). However, only the locus Bam 2-11 were achieved analyzable, consistent, and reproducible, bands in all the accessions studied (Figure 3). Nevertheless, it is recommended a further analysis of its primers design. Figure 3. Perfil de bandas obtenidas con el locus Bam 2-11 en geles de acrilamida al 4%. VIII World Bamboo Congress Proceedings Vol 5-74 Evaluation of microsatellites With the eight loci amplified in 46 accessions of G. angustifolia, 69 alleles were found in total, with an average of 8625 ± 3662 alleles per locus, ranging between 5 and 14 alleles and allelic richness averaged 7625 ± 3662 (Table 4). Three null alleles were obtained in the loci Bam 2-6, Bam 2-2 and Bam 2-7, one in each locus, respectively. With the Bam 2-11 locus, profiles were obtained in acrylamide from 5 to 9 bands per individual, with 20 alleles in the 46 accessions of G. angustifolia. On average, there were more heterozygotes than homozygotes in the eight loci. In the locus Bam 1-11, heterozygous individuals are not distinguished, while in the locus Bam 2-1, the majorities were it (Table 4). The polymorphic information content (PIC) has been widely used as a descriptor of the degree of information that provides a site of the genome. PIC values above 0.5 indicate highly polymorphic loci, such as the loci 2-1 Bam, Bam 2-5, Bam 2-7, Bam 2-6 and Bam 1-11; informational medium values between those with 0.25 and 0.5, as were the loci Bam 2-13, Bam 2-2 and Bam 2-3 and informative little lower than the value 0.25. According to this descriptor, no loci were monomorphic for the 46 accessions of G. angustifolia and the most informative locus was Bam 2-6 with a PIC value of 0.8517 (Figure 4). However, this index came from studies in human genetics and the purpose of assessing the likelihood of being able to deduct from the genotype of an offspring, of which their parents had received a particular feature. Because of this, when wild populations are being studied in the absence or individuals without knowing their parents, this index is not the most desirable, also implies the absence of recombination. VIII World Bamboo Congress Proceedings Vol 5-75 Table 4. Descriptive estimators of genetic diversity obtained for 8 microsatellite systems evaluated in the accessions of G. angustifolia. Locus T anneling High- Frecuency alleles PIC value Probability A A-1 ho Ho he He Allele (bp) Frecuency Identity (I) 50 232 0.2283±0.0619 0.8511 0.1082 14 13 0.0435 0.9565 0.1349 0.8843 Bam 2-13 54 228 0.7609±0.0629 0.3981 0.4134 11 10 0.5870 0.4130 0.5896 0.4196 Bam 2-5 48 254 0.2174±0.0608 0.6750 0.1269 13 12 0.4130 0.5870 0.2966 0.7191 Bam 2-2 54 500 0.6848±0.0685 0.4672 0.2871 5 4 0.6957 0.3043 0.5017 0.5094 Bam 2-3 48 166 0.7609±0.0629 0.3860 0.3730 6 5 0.6304 0.3696 0.5951 0.4139 Bam 2-6 50 152 0.1196±0.0478 0.8517 0.0334 9 8 0.8696 0.1304 0.1385 0.8807 Bam 1-11 54 437 0.6304±0.0712 0.5043 0.2480 6 5 10,000 0.0000 0.4518 0.5604 Bam 2-7 429 0.3913±0.0720 0.6294 0.1566 5 4 0.6522 0.3478 0.3103 0.7051 Total 69 61 Average 8.625±3.662 7.625±3.662 0.611±0.290 0.389±0.290 0.377±0.185 0.6356±0.1894 Bam 2-1 54 Number of alleles per locus (A), allelic richness (A-1); observed homocigosity (ho), observed heterozygosity (Ho); expected homocigosity (I) Nei unbiased heterozygosity (He), polymorphic information content (PIC); probability of identity (I). VIII World Bamboo Congress Proceedings Vol 5-76 Figure 4. Comparison of the polymorphic information content (PIC) and probability of identity (I) obtained with eight loci in 46 accessions of G. angustifolia The probability of identity (I) may be a better estimate of the degree of information of the genome of a site obtained by the SSR in populations, because it indicates how high is the probability of finding two individuals at random in the same locus in particular, and therefore that is so discriminating that site. Furthermore, it is not based on any postulate, but rather more a probability. Among lower the values of I are the most informative sites studied using microsatellites. According to this index, the locus Bam 2-6 is the most informative (0.0334), followed by Bam 2-1 (0.1082), and the least informative loci is Bam 2-13 (0.4134) (Figure 10). In turn, the combined probability of identity, evaluate how good is the set of all microsatellites for the diversity analysis, in this case, Ic was 7.882x10-07, indicating that the eight loci analyzed for 46 accessions G. angustifolia are sufficiently informative to study the genetic diversity in this bank. Acknowledgments The Institute for Research and Preservation of Cultural and Natural Heritage of Valle del Cauca, INCIVA, to The University Santiago de Cali and the Center for Research in Basic Sciences, Environmental and Technological Development of the Universidad Santiago de Cali (CICB), by funding this research. The Laboratory of Molecular Biology and Tissue Collection of the Research Institute of Biological Resources Alexander Von Humbodt IAvH-by funding and technical support during the investigation. A Miryam Cristina Duque for his selfless assistance in conducting statistical analysis and interpretation of them and Dora Jhoana Rios for his help in the standardization and analysis of microsatellites. References Avise, J.C. 1994. Molecular markers, natural history & evolution. New York, Chapman & Hall. 511p. Bachmann, K. 1994. Tansley Review No. 63: molecular markers in plant ecology. New Phytologist, 126 (3): 403-418. Barrera, E. 1996.Obtencion de frecuencias microsatélites en frijol (Genero Phaseolus). Tesis de pregrado. CaliColombia, Universidad del Valle, Facultad de Ciencias. 103p. Bassam, B.J.; Caetano. G & Gresshorff , P.M.. 1991. Fast and sensitive silver staining of dna in polyacrilamide gels. Analitical Biochemistry 190: 80-83. Botstein, D.; White R.L.; Skolnick, M and Davis R.W. 1980. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 32:314-331. Bystriakova, N; Kapos, V; Stapleton, C. & Lysenko, I. 2003. Bambú Biodiversity. UNEP-WCMC/INBAR. Bystriakova, N; Kapos, V & Lysenko, I. 2004. Bambú Biodiversity. UNEP-WCMC/INBAR. Castaño, F & Moreno R. D. 2004. Guadua para todos, cultivo y aprovechamiento. Bogotá, Panamericana Formas e Impresos S.A. 187p. Chambers, G. K. &. Macavoy, E.S. 2000. Microsatellites: consensus and controversy. Comparative Biochemistry and Physiology 126: 455–476. Chasan, R. 1991. Molecular biology and ecology: a marriage of more than convenience. The Plant Cell, 3 (11):1143-1145. Cruz, I. A. 1994. La Guadua: Nuestro Bambú. Armenia, Fudegraf. 293p Dayanandan, S, K; Bawa, S & Kesseli, R. 1997. Conservation of Microsatellites Among Tropical Trees (Leguminosae). American Journal of Botany 84 (12):1658-1663 Frankhan, R; Ballou, J.D. & Briscoe, D.A. 2002. Introduction to Conservation Genetics. United Kingdom, Cambridge University Press. 617p Goldstein, D.B &. Schlötterer, C. 1999. Microsatellites: evolution and applications. Oxford University Press, New York. 350p. Ishii, T & McCouch, S.R. 2000. Microsatellites and microsynteny in the chloroplast genomes of Oryza and eight other Gramineae species. Theor Appl Genet 100:1257-1266 Kresovich, S; Szewc-Mcfadden, A.K; Blick, S & McFerson, J.R. 1995. Abundance and characterization of simple sequence repeats (SSRs) isolated from a size-fractionated genomic library of Brassica napus L. (rapseed). Theor. Appl. Genet. 91:206-211. Londoño, X. 1990. Aspectos sobre la distribución y la ecología de los bambúes de Colombia (Poaceae: Bambuoideae). Caldasia 16 (77): 139-153. Londoño, X. 1991. Estudio botánico, ecológico, silvicultural y económico-industrial de las Bambuoideae de Colombia. Cespedesia 16-17(59):51-78. Marulanda, M.L; Márquez, P & Londoño, X. 2002. AFLP analysis of Guadua angustifolia (Poaceae: Bambuoideae) in Colombia with emphasis on the Coffe Region. The Journal of the American Bambú Society 16(1): 32-42. Marulanda. M. L; López, A. M. & Claroz, J.L. 2007. Analyzing the genetic diversity of Guadua spp. in Colombia using rice and sugarcane microsatellites. Crop Breeding and Applied Biotechnoloy 7: 4351. Mcneely, J.A. 1995. Bambú, biodiversity and conservation in Asia en: PROCEEDINGS OF THE VTH INTERNATIONAL BAMBÚ WORKSHOP AND THE IV INTERNATIONAL BAMBÚ CONGRESS. 19 – 22 junio 1995. Ubud, Bali, Indonesia. International Network for Bambú and Rattan, Environmental Bambú Foundation, International Plant Genetic Resources Institute, International Development Research Centre. Vol. 2: 23-44 VIII World Bamboo Congress Proceedings Vol 5-78 Nayak, S & Rout, R.2005. Isolation and characterization of microsatellites in Bambusa arundinacea and cross species amplification in other bamboos. Plant Breeding 124: 599-602. Nei, M. 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89: 583-590. Ouborg, N.J; Piquot, Y & Van Groenendael, J. M. 1999. Population Genetics, Molecular Markers and the Study of Dispersal in Plants. The Journal of Ecology, 87(4): 551-568. Parker, P.G; Snow, A.A; Schug, M.D; Booton, G.C &. Fuerst, P.A. 1998. What molecules can tell us about populations: choosing and using a molecular marker. Ecology, 79 (2): 361-382. Potosí, C. T; Vallejo, F. A & Palacio-Mejía, J. D. 2006. Estimación mediante RAPD´s de la diversidad genética en guadua en el departamento del Cauca, Colombia. Acta Agronómica 55(2): 43-47. Paetkau, D & Strobeck, C.1994. Microsatellite analysis of genetic variation in black bear populations. Molecular Ecology 3:489–495. Roa, A. C; Chavarriaga-Aguirre, P; Duque, M. C; Maya, M. M; Bonierbale, M. W; Iglesias, C & Tohme, J. 2000. Cross-Species Amplification of Cassava (Manihot esculenta) (Euphorbiaceae) Microsatellites: Allelic Polymorphism and Degree of Relationship. American Journal of Botany,87(11):1647-1655. Stapleton, C.M.V & Ramanatha RAO, V. 1995. Progress and Prospects in Genetic Diversity. Studies on Bambú and its conservation en: PROCEEDINGS OF THE VTH INTERNATIONAL BAMBÚ WORKSHOP AND THE IV INTERNATIONAL BAMBÚ CONGRESS. 19 – 22 junio 1995. Ubud, Bali, Indonesia. International Network for Bambú and Rattan, Environmental Bambú Foundation, International Plant Genetic Resources Institute, International Development Research Centre. Vol. 2: 23-44 Villegas, M; Villegas, B; Villegas, L & Londoño, X. 2003. Guadua: arquitectura y diseño. Colombia, Villegas editores. 208p. Young, S.M. & Judd, W. S. 1992. Systematics of the Guadua angustifolia Complex (Poaceae: Bambuoideae). Annals of the Missouri Botanical Garden, 79 (4): 737-769. Zhao, X & Kochert, G. 1992. Characterization and genetic mapping of a short, highly repeated, interspersed DNA sequence from rice (Oryza sativa L.). Molecular & general genetics 231(3):353-9. VIII World Bamboo Congress Proceedings Vol 5-79 Occurrence of filamentous fungi on Brazilian giant bamboo 1 Rodolfo Gomes da Silva; 1 Antonio Ludovico Beraldo; 2 Milena Binatti Ferreira; 2 Rafaella Costa Bonugli-Santos; 2 Lara Durães Sette 1 – School of Agricultural Engineering – FEAGRI/UNICAMP 2 – Division of Microbial Resources- CPQBA/UNICAMP Abstract Bamboo has many economical and environmental advantages compared with other materials commonly employed in construction. However, bamboo is handicapped by the low natural durability of the most of species. According to optimal environmental conditions, several insects or fungi decay bamboo. The aim of this research was to identify taxonomically some filamentous fungi that decay bamboo in contact with the soil. Fungi were collected from samples of bamboo strips expose to outdoor conditions. Isolated fungi were taxonomically characterized based on morphological and genetic (Amplified Ribosomal DNA Restriction Analysis-ARDRA) approaches. Ten isolates of filamentous fungi were obtained. Data derived from ARDRA analyses showed the presence of seven different taxonomic groups (ribotypes). Based on microscopic and macroscopic analysis, fungi were identified as belonging to cellulolytic genera: Arthrinium, Fusarium, Acremonium-like and Trichoderma, and an unidentified isolate. As there was no fungal mycelial growth of green in samples of bamboo, Trichoderma sp. may have been originated from the proper soil. In addition, the fungus that was evaluated separately showed morphological characteristics similar to those of basidiomycete (Basydiomycota). Introduction In global terms, 40% of energy consumption and carbon emission in the world are caused by construction (Ferraz 2008). This situation is exacerbated by the use of native timber for building. According to Kageyama (1987), the deforestation of tropical rainforest may cause the extinction of entire species. The market preference by certain tropical woods because of its high quality, provoke its intensive use and became a serious problem, especially at Sao Paulo State, Brazil. The solution to this problem involves the use of materials less harmful to the environment than that conventional ones. The possibility of applying bamboo, therefore, appears as an alternative to the tropical wood. However, bamboo applications are hampered by the low natural durability of the most of specie. Decay caused by physical, chemical and biological agents associate bamboo as a low quality material, creating the false idea that bamboo should be employed only in the scarcity of most appropriate materials. VIII World Bamboo Congress Proceedings Vol 5-80 Fungi were considered plants for a long time. Unlike plants, fungi are heterotroph and do not have clorophyll or other photosynthetic pigment. Their cell walls are composed by chitin, cellulose does not, unless some aquatic fungi. Fungi can decompose dead matter (saprotrophic) or obtain its nutrients from living organisms (parasitic), preferring simple carbohydrates, but may also use more complex sources, as starch and cellulose (Burton & Engelkirk 2005). Basidiomycetes fungi are the most responsible by decay materials composed by lignin and cellulose. This group is represented by mushroons, puffballs and bracket fungi, most of them known for its economic importance, provoking plant diseases, or acting as decomposers of organic matter and for its culinary potential. However, representatives of others fungi groups, such as ascomycetes are able to colonize and degrade lignocelullosic material (Sette et al. 2008). According to Highley (1999), “fungus damage to wood may be concerned to three general causes: lack of suitable protective measures when wood storing, improper seasoning, storing, or handling of the raw material produced from the log and failure to take ordinary simple precautions in using the final product”. From the 1980’s, many studies on the degradation of wood by fungi were performed. Auer et al. (1988) associated the monoculture of eucalyptus and the high incidence of fungi. Wood has great potential as building material since it is well applied to buildings and since they were well designed, constructed properly and adequately maintained. However, any of these aspects is often overlooked at the construction, allowing the attack of the decay agents, such insects and fungi (Nunes et al. 2000). The objective of this research was to identify taxonomically some fungi that decay bamboo in contact to the soil. In a next step, intends to inoculate these fungi on bamboo, seeking to evaluate the effectiveness of some treatments applied to bamboo strips. Materials and Methods Figure 1 shows the flowchart of the steps undertaken during the development of this research. VIII World Bamboo Congress Proceedings Vol 5-81 Figure 1 - Flowchart for the implementation of isolation and identification of fungi associated with bamboo. Strips of 15 cm x 3 cm x 3 cm were obtained from a 5 years old culm of giant bamboo (Dendrocalamus giganteus Munro) Strips were exposed to an oxisol type, simulating the decay by wet soil fungi, allowing the colonization of several species (Figure 2). VIII World Bamboo Congress Proceedings Vol 5-82 Figure 2 – Aspect of bamboo strip after 15 days of exposition. After 15 days of exposure, strips were numbered and delivered to Division of Microbial Resources (CPQBA/UNICAMP) for filamentous fungi isolating and identifying. A visual inspection of the bamboo strips indicated the development of several fungi (Figure 3), wich were readily separated by the morphological characteristics of the colonies. Bamboo strips were washed with sterile distilled water to remove the soil and to isolate only the fungi associated with bamboo. Filamentous fungi were plated by swab technique on culture media MA2 (Malt Extract Agar 2%) and SDA (Sabouraud Dextrose Agar) added 300 mg/L riphampicin, antibiotic to prevent bacteria proliferation. The plates were incubated at laboratory temperature (28 ± 1 °C) for 15 days. Isolation of colonies was conducted daily and pure cultures were obtained after serial transfers on MA2 medium (Figure 4). VIII World Bamboo Congress Proceedings Vol 5-83 Figure 3 – Fungi spores (dark spots) and mycelia (white areas) infesting bamboo. Figure 4 – Culture of bamboo-derived fungus grown in Petri dish. VIII World Bamboo Congress Proceedings Vol 5-84 The colonies were observed by stereoscope to the fungi identification. Microscope slides were prepared by scrubbing technique, stained with lactophenol cotton blue and visualized in optical microscope. These observations, using the morphological criteria determined by the literature, allowed the preliminary identification of some genera. The identification of species requires molecular techniques (sequencing and phylogenetic analyses) and additional macro and microscopic analyses. Isolates were subjected to ARDRA analyses (Amplified Ribosomal DNA Restriction Analysis) to identify possible different taxonomic groups. Filamentous fungi were cultured on MA2 medium and after culture growth, genomic DNA extraction was performed according to Raeder & Broda (1985). The 28S rRNA D1/D2 region of the filamentous fungi were amplified from genomic DNA by Polymerase Chain Reaction (PCR) using the following set of primers, NL-1m (5’ GCA TAT CAA TAA GCG GAG GAA AAG 3’) and NL-4m (5’ GGT CCG TGT TTC AAG ACG 3’). PCRs were performed according to Sette et al. (2006). PCR products were digested using the restriction enzymes MspI, HhaI, HaeIII and AluI (GE Healthcare). Restriction reactions were carried out in 2h at 37 °C and the electrophoresis were performed on a 2.5% agarose gel, with a 100-bp DNA ladder, for 2.5h at 230 V. In addition to the filamentous fungi that have developed in bamboo, it was obtained a fungus fruit body, probably a basidiomycete, from one sample of decayed bamboo. Results and Discussion From two bamboo samples, ten isolates of filamentous fungi were identified, based on microscopic and macroscopic analysis, as belonging to the genera: Arthrinium (F1, F2, F4, F8, F9 e F10), Fusarium (F3), Acremonium-like (F5) and Trichoderma (F6), and an unidentified isolate (F7) (Table 1). In addition, the fungus that was evaluated separately from a decayed bamboo (F11) showed morphological characteristics similar to those of basidiomycete (Basydiomycota), a well known lignocelullolytic degraded group of fungi. Table 1 - Data from the morphological characterization and genetic fingerprinting. Isolates F1 F2 F4 F8 F9 F10 F3 F5 F6 F7 F11 HaeIII A A A A A A B A C D A MspI A A B A B A C B D E F HhaI A A A A A A B C D E F AluI A A A A A A B C C D C Ribotypes 1 1 1A 1 1A 1 2 3 4 5 6 Morphologic id. Arthrinium sp. Arthrinium sp. Arthrinium sp. Arthrinium sp. Arthrinium sp. Arthrinium sp. Fusarium sp. Acremonium-like Trichoderma sp NI* NI* NI * Non identified. VIII World Bamboo Congress Proceedings Vol 5-85 According to Morakotkam et al. (2007), Arthrinium (Xylariales) are a dominant genus in bamboos. Representatives of this genus and its telemorph (Apiospora) have been reported as fungi associated with bamboo from New Zealand and Japan (Morakotkam et al. 2007). The genus Fusarium (Hypocreales) were also reported as fungal associated with bamboo plants (Hino & Katumoto 1961; Morakotkam et al. 2007). Arthrinium and Fusarium are soil-inhabiting fungi that could be found in decomposing plant material. Both are cellulolytic, but this activity for Arthrinium is rarely reported. Fusarium and its anamorph Giberella have been isolated from many plants and cause some plant diseases (Rubini et al. 2005). There are no data in the consulted literature concerning Acremonium (anamorphic fungi) and Trichoderma (Hypocreales) derived from bamboo samples. As there was no fungal mycelial growth of green in samples of bamboo in the present study, Trichoderma sp. (F6) may have been obtained from the proper soil where the bamboo was removed. It is worth to mention that representatives of Trichoderma and Acremonium are very common in soil and are also able to produce cellulolytic enzymes, which are responsible for cellulose degradation (Nakari-Setälä & Petillä 1995; Stemberg 2004; Ikeda et al. 2007). Some of isolated fungi showed morphological features very similar and to verify the genetic diversity (polymorphism) of them ARDRA analyses were carried out (Figure 5 and Figure 6). The band pattern (ribotype) generated by enzymatic digestion allowed the differentiation of taxonomic groups previously obtained by conventional taxonomy. Seven different ribotypes were obtained: ribotype 1, 1A, 2, 3, 4, 5 and 6 (Table 1). VIII World Bamboo Congress Proceedings Vol 5-86 P 1 2 4 8 9 10 3 5 6 7 11 X P HaeIII P 1 2 4 8 9 10 3 5 6 7 11 X P MspI Figure 5 – Restriction profile from the eleven isolateds after digestion with the HaeIII and MspI enzymes. The numbering at the top of the figure represents the fungi order of application on the agarose gel. P = Standard molecular weight (1kb). X = Sample to be disregarded because it is not part of this project. P 1 2 4 8 9 10 3 5 6 7 11 X P HhaI P 1 2 4 8 9 10 3 5 6 7 11 X P AluI Figure 6 – Restriction profile from the eleven isolateds after digestion with the HhaI and AluI enzymes. The numbering at the top of the figure represents the fungi order of application on the agarose gel. P = Standard molecular weight (1kb). X = Sample to be disregarded because it is not part of this project. VIII World Bamboo Congress Proceedings Vol 5-87 Ribotypes 1 and 1A showed little difference in the restriction profile when MspI enzyme was used. As both isolates showed morphological (macroscopical and microscopical) characteristics similar to the genus Arthrinium, the polymorphism may not be representative or may indicate strains of different species. On the other isolates, the results of ARDRA corroborated the morphological analysis, since the fungi showed different restriction profiles and were classified morphologically as belonging to different genera. The isolated fungi unidentified by conventional taxonomy (F7 and F11) showed morphological characteristics and restriction profile different from the others, suggesting that it should belong to different filamentous fungi genera. Aiming at a more accurate identification of different ribotypes obtained in this work, as well as the identification of ribotypes F7 and F11 (not identified by conventional taxonomy), further studies of sequencing and comparative analysis should be performed. Conclusions Although a definitive taxonomic assignment of the fungi isolated and characterized in this study was not always possible, these data present an emerging view of filamentous fungi from Brazilian bamboo samples, since, to our knowledge, there were no previous reports on fungi isolated from bamboo in Brazil. Based on the literature, the genera Arthrinium and Fusarium have been reported as fungi associated with bamboo in other countries. However, it is important to highlight that it is the first report concerning Acremonium from bamboo samples. The occurrence of cellulolytic fungi in bamboo was expected, since these fungi are able to use the bamboo cellulose as carbon source. The filamentous fungi isolated in the present study will be deposited in the Brazilian Collection of Environmental and Industrial Microorganisms (CBMAI) for further research on effectiveness of some treatments applied to bamboo strips against these cellulolytic filamentous fungi. VIII World Bamboo Congress Proceedings Vol 5-88 References Auer, C.G.; Krugner, T.L.; Barrichelo, L.E.G. Fungos termófilos em pilhas de cavacos de Eucalyptus spp. com auto-aquecimento. Instituto de Pesquisas e Estudos Florestais, Piracicaba, n. 38, p. 28-32, abr. 1988. Disponível em: <http://www.ipef.br/publicacoes/scientia/nr38/cap04.pdf>. Acesso em 14 jul.2008. Burton, G.R.W.; Engelkirk, P.G. Microbiologia para as ciências da saúde. Rio de Janeiro: Guanabara Koogan, 2005. Ferraz, M. Uma casa para o semi-árido. Ciência Hoje, Rio de Janeiro, v. 42, n. 249, p. 50-51, jun. 2008. Highley, T.L. Biodeterioration of wood. In: United States Department of Agriculture. Wood handbook: wood as an engineering material. Madison, WI: United States Department of Agriculture Forest Service, Forest Products Laboratory, 1999. p. 13.1 – 13.16. Hino, I.; Katumoto, K. Icones Fungorum Bambusicolorum Japonicorum. The Fuji bamboo garden, Gotenba, Japan, 1961. Ikeda, Y.; Hayashi, H.; Okuda, N.; Park, E.Y. Efficient Cellulase Production by the Filamentous Fungus Acremonium.cellulolyticus. Biotechnol. Prog v. 23, p. 333-338, .2007 Kageyama, P.Y. Conservação “in situ” de recursos genéticos de plantas. Instituto de Pesquisas e Estudos Florestais, Piracicaba, n. 35, p. 7 – 37, abr. 1987. Morakotkarn, D.; Kawasaki, H.; Seki, T. Molecular diversityof bamboo-associated fungi isolated from Japan. FEMS Microbiol Lett, v. 266, p. 10–19, 2007. Nakari-Setälä, T.; Penttilä, M. Production of Trichoderma reesei cellulases on glucose-containing media. Applied and Environmental Microbiology. v. 61, p. 3650–3655, 1995. Nunes, L.; Nobre, T.; Saporiti, M. Degradação e reabilitação de estruturas de madeira. Importância da acção de térmitas subterrâneas. In: Encontro Nacional sobre Conservação e Reabilitação de Estruturas, 2000. Laboratório Nacional de Engenharia Civil, Lisboa, p. 167-175. Raeder, J.; Broda, P. Rapid preparation of DNA from filamentous fungi. Letters in Applied Microbiology, v.1, p. 7-20, 1985. Rubini, M.R.; Silva-Ribeiro, R.T.; Pomella, A.W.V.; Maki, C.S.; Araujo, W.L.; Santos, D.R.; Azevedo, J.L. Diversity of endophytic fungal community of cacao (Theobroma cacao L.) and biological control of Crinipellis perniciosa, causal agent of Witches’ broom disease. Int J Biol Sci v.1, p. 24–33, 2005. Sette, L.D.; Passarini, M.R.Z.; Delarmelina, C.; Salati, F.; Duarte, M.C.T. Molecular characterization and antimicrobial activity of endophytic fungi from coffee plants. World J. Microbiol. Biotechnol., 22, 1185-1195, 2006. Sette, L.D.; de Oliveira, V.M.; Rodrigues, M.F.A. Microbial lignocellulolytic enzymes: Industrial applications and future perspectives. Microbiology Australia, v.99, p. 18-20, 2008. Sternberg, D. A method for increasing cellulase production by Trichoderma viride. Biotechnology and Bioengineering, v. 18, p. 1751-1760, 2004. VIII World Bamboo Congress Proceedings Vol 5-89 Consideration of the flowering periodicity of Melocanna baccifera through past records and recent flowering with a 48-year interval Shozo Shibata Field Science Education and Research Center, Kyoto University, Japan Abstract The gregarious flowering of Melocanna baccifera has been recorded in its native area mainly since 2003 and this period of dynamic flowering is now coming to an end. For over 100 years, the flowering periodicity of the species has been estimated by many researchers as being in the vicinity of 30 – 45 years. However, local information from the author’s detailed interviews with farmers in the Mizoram area of northeast India indicates that a more accurate estimation is 48-year. Based on this estimation, the author and his colleagues conducted important ecological research on the flowering and fruiting process in this area, while flowering information for 2008 was obtained from Taiwan and that for 2009 from Japan. These two data sets present accurate records of the last fruiting year, and flowering occurred as expected in the 48th year after seeding. This outcome suggests that understanding the true flowering periodicity of bamboo requires the monitoring of seedling with accurate fruiting data in addition to vegetative information. Introduction For more than 100 years, bamboo researchers have been interested in estimating the flowering periodicity of bamboo (cf. Seifriz 1923; Raizada & Chatterjii 1956; McClure 1966; Janzen 1976). Although bamboo flowering is gregarious and synchronized in many cases, its prediction is exceptionally hard work because of the very long flowering periodicity involved. This also means that it is difficult for a single researcher to carry out observation of bamboo flowering and confirm its periodicity. Bamboo flowering is mainly classified into the two types of gregarious and sporadic flowering. Many cases of sporadic flowering are seen, but, its exact definition is not clear. Some such flowering occurs in small-scale vegetation and is even seen in parts of the culm. Although the relationship between the flowering periodicity and simultaneousness remains unclear, it is currently considered that gregarious flowering with periodicity usually occurs simultaneously. In the past many triggers for flowering have been discussed, including drought, burning, trimming, disease (Hori 1911), transplant and injury (Seifriz 1923). However, at present, the flowering for these reasons is regarded as a different physiological occurrence from the gregarious and simultaneous phenomenon brought about by the biological clock. VIII World Bamboo Congress Proceedings Vol 5-90 Gregarious flowering of bamboo results in the death of the parent population, and this occurrence has long been recognized as continuing for several years as whole in tropical areas. In Japan, the flowering of Phyllostachys bambusoides was reported in around 1970, and continued for about ten years (Kasahara 1971). Similarly, the recent flowering of Sasa veitchii var. hirsuta recorded near Kyoto city continued over a period of four years (Abe & Shibata 2007). Melocanna baccifera is a species that has extensive past flowering records. The form of its characteristic fruit and the culm neck are worth noticing, and the first taxonomical records of this species also refer to these points naturally (Roxburgh 1814). Its flowering periodicity has been estimated many times, but, as the distinction between sporadic flowering and gregarious or extensive flowering was insufficient, these estimations can be considered capricious. The reason for this problem is a lack of surveys on flowering vegetation from seedling stage. M. baccifera flowered gregariously in 2005 – 2008 in its native region, with the flowering area reaching up to several tens of thousands of square kilometers. Ecological research in this native area by the author and his colleagues revealed that sporadic flowering occurs one year before and after gregarious flowering, and that the area covered by gregarious flowering moves from the northeast to the southwest over a period of several years. This has also been noted in Bangladesh by Alam (2008). In relation to the recent flowering, some flowering records derived from fruits taken from native areas during the last flowering are being collected. These examples include cases reported from Japan and Taiwan, where seedlings are maintained in a pure condition without being mixed with other seedlings. These plants clearly flowered in the 48th year after seeding. Referring to these examples, the author use this paper to consider the relevant points in order to gain an accurate understanding of M. baccifera, and in turn, its flowering periodicity, and re-inspects the past flowering records of this species. Flowering records of M. baccifera seedlings with a 48-year interval In Japan the flowering of M. baccifera was observed in May, 2009. The plantation in question is derived from a seeding brought in 1961 by Koichiro Ueda, who was performing a bamboo resource survey, from what is now Bangladesh (former East Pakistan) (Ueda 1968) to the former Shirahama Experimental Station of the Field Science Education and Research Center at Kyoto University. In those days Ueda was the only Japanese person to have visited East Pakistan, so it is clear that the flowering periodicity of the species is 48 years, at least, for the genealogy he brought into Japan. In Taiwan, flowering was recorded in 2008. Lu (2009) reported that the flowering plantations in question were derived from two seedlings introduced from a group of 58 from USA through USDA, which collected fruits in Puerto Rico from a fruiting plantation in 1960 after the flowering of 1959. This flowering record also supports the estimation that the species flowers every 48 years. Flowering records of M. baccifera in the past reports There are many bamboo flowering records in the world, but it is thought that the reports recorded by observers themselves are rare, especially for tropical bamboo species. In the case of M. baccifera, the first record by VIII World Bamboo Congress Proceedings Vol 5-91 Roxburgh (1814) and even that of Staff (1904) noting the detail of the fruit shape and inflorescence were not observed directly in the native flowering area. Most past records are simply general descriptions formulated by referring to lots of information from native areas. Although the accuracy of these data resources is uncertain, in Mizoram, India, records provided by the state government indicate gregarious flowering in 1815, 1863, 1911 and 1958 – 1959. In this information supplied on the website of International Network of Bamboo and Rattan (http://www.bambootech.org/), the oldest flowering record is from 1815. This information is not enough to rely on because the records it is based on are unknown, and the recorded year is similar to that of the first notification of this species. However, there is still the possibility of pinpointing this flowering occurrence from the record of Brandis referred to by Blatter (1929), which reported flowering at Chittagong, Bangladesh, in 1811 without consideration of whether it was gregarious flowering or not (Table 1). Below, the author introduces past flowering records according to information from the Mizoram state government based on the supposition of a 48-year flowering interval. The next flowering records after those of 1815 are based on Munro (1868), who recorded flowering in 1864 – 1865 in Arracan. Riviere & Riviere (1878) also recorded flowering for similar years in present-day Bangladesh and reported a scarcity of bamboo timber resulting from the death of bamboo forest following the flowering. Staff (1904) noted that the flowering area covered about 6,000 square miles. All flowering records from the 19th century after Munro referred to his records (Gamble 1896; Brandis 1899). For subsequent flowering, we see an occurrence in 1901 – 1902 in the Chittagong area of what is now Bangladesh from reporting on fruit and inflorescence by Staff (1904). Although this flowering does not fit the 48-year interval, it is estimated that the area it covered was relatively large. The next gregarious flowering, thought to have occurred in 1911, can be understood from the reporting of Troup (1921) in Chittagong and the Arakan mountains as referred to by Blatter (1929, 1930a, 1930b) (Table 1), followed by the reports of Parry (1931) in Assam, India and Hossain (1962) in the former East Pakistan as referred to by Janzen (1976) (Table 2). Camus (1913) did not mention this flowering despite publishing in the same year. Concerning Mizoram, India there are two mentions of the flowering in 1911 by Rokhuma (1988) and in 1911 – 1912 by Thanchuanga (2004). On the other hand Janzen (1976) did not refer to the three intimate records of Blatter (1929, 1930a, 1930b). As a result it seems that there was gregarious flowering around 1911 from Bangladesh to Myanmar through northeast India. There are many records of the last gregarious flowering from the latter half of the 1950s to the beginning of the 1960s. I has already been mentioned that Ueda also came across this flowering in Bangladesh in 1961 as the first Japanese person there (Ueda 1968). Janzen (1976) referred to two records: the flowering in 1960 at Mizoram, and that in 1958 – 1959 at Chittagong (Table 2). In Mizoram, Rokhuma (1988) recorded flowering in 1958 – 1959, and Thanchuanga (2004) in 1959 – 1960. In addition to these, there is another flowering report for 1957 – 1960 by Rain Forest Research Institute of Jorhat in Assam (2003). Alam (2008) noted that gregarious flowering in the Chittagong area of Bangladesh occurred in 1960 – 1961 after a period of sporadic flowering from 1952 to 1958 or 1959 and that this occurrence covered an estimated area of 1,000 square miles. Although many flowering reports exist, they are inadequate for detailed consideration of flowering periodicity because they lack important information such as whether the flowering of all vegetation was seen or not. VIII World Bamboo Congress Proceedings Vol 5-92 Specifically, many flowering records for M. baccifera do not offer enough information to allow estimation of the true flowering periodicity. In addition to this, we need to understand the flowering phenology by which the species flowers at the end of the year and fruiting is seen in the following year. This means that the recorded year in past records is that of fruiting rather than that of fruiting. In the temperate zone, however, the timing of flowering tends to be delayed, and the flowering year becomes the same as the fruiting year. There are also many flowering records for M. baccifera outside the 48-year interval for flowering. This kind of flowering was recorded in 1801, 1849, 1889, 1892 and 1900 – 1902 by Staff (1904). As shown in Table 1 Blatter (1929) also noted flowering in 1889, 1892, 1900 – 1902 and 1904 – 1905. In addition to these records Nath (1968) reported flowering in 1967 at Manipur, India, and Alam (2008) reported an instance in 1901 – 1905 in Chittagong, Bangladesh. However, it is not possible to ascertain whether the flowering in these records is gregarious or otherwise. Flowering reports of M. baccifera outside its native area M. baccifera has been recognized as a useful resource of bamboo timber and food, which has prompted planting around the world outside its native area. Instances of planting are especially high in regions that neighbor the native area, such as India and Nepal. One flowering report from Blatter (1929) comes from the records of the botanic garden in Kolkata. This kind of reporting is found for many places. McClure (1966) reported the flowering and fruiting of plantation in Jamaica and Puerto Rico in 1957 and 1958 (a flowering record that matches the 48-year interval) as well as flowering in Honolulu in 1948 and 1949. Furthermore, flowering in 1990 in northern Queensland, Australia (Poudyal 2006) and in 2003 at a Sri Lanka plantation introduced in 1910 (possibly introduced with fruit) (Ramanayale & Weerawardene 2003) are recorded. Past discussion on the flowering periodicity of M. baccifera Since the end of the 19th century, many estimations concerning the flowering periodicity of M. baccifera have been suggested. However, the quantity of records available has been insufficient except for those after the last flowering around 1960. The first reference to flowering periodicity is thought to have been made by Kurz in 1876 (Gamble 1896). This estimation was based on flowering records for Arakan (Staff 1904) and was 30 years. Brandis (1899) also referred to the observation of Gamble. Staff referred to Kurz’s estimation but also noted that the information was insufficient for full discussion. Blatter (1929) introduced two estimations of 30 years from Kurz (1876) and 45 years from Troup (1921). Blatter (1930a) also pointed out that regular flowering periodicity is difficult to find when the interval of all flowering records over a broad area are dealt with on the same level, and induced the need to distinguish the “extensive flowering” and “gregarious flowering”. He also noted that the periodicity estimated only from “gregarious flowering” is around 50 years. On the other hand McClure (1966) made reference only to past estimations and the introduction of a gardener’s estimation in Jamaica of an approximately 60-year periodicity. Godesberg (1969) proposed an estimation of 45 years. Janzen (1976) referred to the flowering records of the species from two areas in India and one area in presentday Bangladesh (Table 2). His discussion offered no definite estimate of the flowering interval in these three areas and as a result it was impossible to estimate flowering periodicity as a species. He indicated some VIII World Bamboo Congress Proceedings Vol 5-93 estimated periodicity as 7 – 10 years, 26 – 30 years, 27 years, 31 – 33 years, 42 – 49 years, 47 – 49 years and 46 – 51 years by the simple calculation. In recent years there are some estimations such as 40 – 45 years by Seethalakshmi et. al (1996), and 48 – 50 years as well as 40 – 47 years by Banik (1998) based on records from Mizoram, India and from northeastern Bangladesh, respectively. In addition, Rao et. al (1998) noted three periodicities of 30 – 35 years, 45 – 48 years and 60 – 65 years. On the other hand Alam (2008) estimated the flowering periodicity in Chittagong Hill Tracts, Bangladesh as 50±5 years. As outlined above, the flowering periodicity of M. baccifera was previously estimated as between 30 and 45 years. In more recent years, other periodicity estimations of around 50 and 60 years have been presented. However, no exact estimation matching the 48-year periodicity referred to here is found. Discussion – Requirements for understanding the true flowering periodicity of bamboo The flowering periodicity of bamboo differs by species, and seems to have a shorter tendency for those mentioned tropical area. On the other hand the periodicity in temperate bamboo species longer and in Japan is commonly said to be either 60 or 120 years. In this country, there have been ongoing trials to identify the true bamboo flowering periodicity of bamboo since the 19th century, and two flowering records have been obtained for Phyllostachys pubescens with a 67-year interval after seeding (Watanabe et. al 1982; Shibata 2002). The flowering periodicity of M. baccifera has recently prompted detailed discussion, e.g., Alam (2008). However, as past flowering records for the species do not seem to be based on first-person observation at flowering sites, it is difficult to conclude that the reporters understood the true ecological process of flowering in detail. According to the author and his colleagues’ ecological research at Sairang in India’s Mizoram area, sporadic flowerings on a small scale has been observed one year before and after gregarious flowering. If we look at this three-year flowering phenomenon on the same level, while the overall flowering area moves from the northeast to the southwest, the overall flowering period can be understood as 8 – 10 years. The flowering of bamboo is observed on various scales. In the case of M. baccifera, this scale is very large. In its vegetation area, non-flowering bamboo groves (called Mauhawk in Mizoram) and shifted-flowering bamboo groves may be mixed in with gregarious flowering bamboo vegetation. These groves should not be confused with the three-year flowering period that including gregarious flowering in the second year as mentioned above. It is clear that this kind of confusion will hinder the process of understanding bamboo’s actual flowering periodicity. It is important to pinpoint the real year of gregarious flowering year by omitting the small-scale flowering that takes place before and after it and extracting the true flowering periodicity and flowering year. The area of gregarious flowering for M. baccifera is unique. The phenomenon transits over a period of four yearscovering an area of more than 10,000 square kilometers annually in the whole of the native area. This is a dramatic vegetation change that can be seen from space. It is clear and relevant that the factor behind this phenomenon is slash-and-burning agriculture implemented by farmers. VIII World Bamboo Congress Proceedings Vol 5-94 Conclusion The results obtained from research in Mizoram, India show that the flowering of this species clearly occurs every 48 years on a large scale. However, the transition of the flowering area over a period of several years – referred to as “the flowering wave” (Alam 2008) – skews information that would enable identification of the true flowering periodicity. To obtain the true vakue, it is necessary to carry out detailed ecological research at the flowering sites. The estimation of a 48-year flowering periodicity for M. baccifera was supported by ecological research in Mizoram, India and by flowering records from Japan and Taiwan on 2008 and 2009. To confirm the true flowering periodicity of bamboo, the growth of bamboo plantations needs to be accurately monitored from the seedling stage to the flowering stage. This research was supported by Grant-in-aid for scientific research (A) from Japan’s MEXT (No. 17255007; representative: Shibata). VIII World Bamboo Congress Proceedings Vol 5-95 References Abe Y. and Shibata S. 2007. Observation of sporadic flowering in dwarf bamboo, Sasa veitchii Rehder var. hirsuta - Flower and seed production habits. Bamboo J, 24, 12-16 (in Japanese with English abstract) Alam M. K. 2008. Recent flowering of Muli bamboo (Melocanna baccifera) in Chittagong Hill Tracts and Rat Infestation: Eco-environmental aspects. USAID Task no. 388-c-00-03-00050-00 Banik R. L. 1998. Reproductive biology and flowering populations with diversities in muli bamboo, Melocanna baccifera (Roxb.) Kurz. Bangladesh Journal of Forest Science, 27(1), 1-15 Blatter E. 1929. The flowering of Bamboos. Part I. J. Bombay Nat. Hist. Soc., 33, 899-921 Blatter E. 1930a. The flowering of Bamboos. Part II. J. Bombay Nat. Hist. Soc., 34, 135-141 Blatter E. 1930b. The flowering of Bamboos. Part III. J. Bombay Nat. Hist. Soc., 34,447-467 Brandis D. 1899. Biological notes on Indian bamboos. Indian Forester, 25(1), 1-25 Camus E. G. 1913. Les Bambusees: Monographie, Biologie, Culture, Principaux Usages. Chatterjii D. 1960. Bamboo fruits. J Bombay Nat Hist. Soc, 57. 451-453 Gamble J. S. 1896. Bambuseae of British India (Annals of RBG, Calcutta 7) Godesberg A. L. B. 1969. Bamboo. CIBA Review 1969/3. Basel, Switzerland, pp2-39 Hori S. 1911. Factor in bamboo flowering. Reports of Agricultural Station, Japan, 38 (in Japanese) Hossain K. M. I. 1962. Bamboos of East Pakistan with particular reference to muli bamboo and its flowering. Pakistan J. For., 12, 194-201 Janzen D. H. 1976. Why bamboos wait so long to flower. Ann Rev Ecol Syst, 7. 347-392 Kasahara K. 1971. Bamboo flowering. Iden, 25(8), 83-90 (in Japanese) Kurz S. 1876. Bamboo and its use. Indian Forester, 1, 219-235 Lu J. 2009. Flowering, Fruiting and recovery by seedling of Melocanna baccifera. Bamboo J. 26 (in Japanese) McClure F. A. 1966. The Bamboos. Harvard Univ. Press Munro C. 1868. A monograph of the Bambusaceae (Transaction of the Linnean Society No. 26) Nath G. M. 1968. Flowering of Muli bamboos (Melocanna bambusoides). Indian Forester, 94, 346 Parry N. E. 1931. On the flowering of bamboos. J. Bombay Nat Hist Soc, 1099-1101 Poudyal P. P. 2006. Bamboos of Sikkim (India), Bhutan and Nepal Rain Forest Research Institute, Jorhat, Assam 2003. Selected facts about bamboo flowering in the northeast India. Raizada M. B. and Chatterjii R. N. 1956. World distribution of bamboos with special reference to the Indian species and their more important uses. Indian Forest Leaflet, 151 (Botany) Ramanayake S. M. S. D., Weerawardene T. E. 2003. Flowering in a bamboo, Melocanna baccifera (Bambusoideae: Poaceae). Botanical Journal of the Linnean Society, 143, 287-291 Rao A. N., Rao V. R.and Williams J. T. 1998. Priority species of bamboo and rattan. IPGRI & INBAR Riviere E. A. and Riviere M. C. 1878. Le Bambous: vegetation, culture, multiplication en Europe et en Algerie, et generalement dans tout le basin mediterreneen. Rokhuma C. 1988. Tam do pawl in evenge a tih? Aizawl Roxburgh W. 1814. Hortus Bengalensis, a catalogue of plants growing in the honourable East India Company’s botanic garden at Calcutta, Serampore Seethalakshmi K. K., Muktesh Kumar M. S., Sarojam N., and Sankara P. K. 1996. Status of information on bamboos occurring in India. Proceedings of National Seminar on Bamboo, 41-56 Seifriz W. 1923. Observation of the causes of gregarious flowering in plants. Am. J. of Botany, 10, 93-112 VIII World Bamboo Congress Proceedings Vol 5-96 Shibata S. 2002. Flowering of Phyllostachys pubescens Mazel ex Houzeau Lehaie in the sixty-seventh year, and germination of caryopsis produced at Kamigamo, Kyoto University Forests, Japan. In Bamboo for sustainable Development, 345-365 Staff O. 1904. On the fruit of Melocanna bambusoides Trin., an endospermless, viviparous, genus of Bambuseae. Transaction of the Linnean Society of London (2nd Ser) Botany, 6, 401-425 Thanchuanga C. 2004. Bamboo flowering in Mizoram. Magazine of the American Bamboo Society, 25(1-3) Troup R. S. 1921. The silviculture of Indian trees. 3. Oxford University Press London Ueda K. 1968. Bamboo Material. In Utilization of Bamboo Resource in South-east Asia to Promotion of Bamboo Pulp Industry. Japan Agency of Resources Vol. 19 (in Japanese) Watanabe M., Ueda K., Manabe I. and Akai T. 1982. Flowering, seedling, germination, and flowering periodicity of Phyllostachys pubescens. J Jpn. For. Soc., 64(3), 107-111 http://www.bambootech.org/ National Mission on Bamboo Applications, India 2009/02/20 VIII World Bamboo Congress Proceedings Vol 5-97 Table 1. Flowering records of Melocanna baccifera in Blatter(1929) Flowering year Reporter Flowering area Flowering type and remarks 1811 Brandis Chittagong ? 1863 – 1866 Gamble Chittagong, Arakan. Gregarious flowering Bot.G.Calcutta ? 1889 Gamble Garo and Khasia Hills Gregarious flowering 1892 Troup Assam Gregarious flowering 1900 & 1902 Troup Garo and Khasia Hills Gregarious flowering 1901 & 1902 Troup Chittagong, Arakan Flowering in limited area 1904 & 1905 Troup Chittagong, Arakan Flowering in limited area 1908 – 1912 Troup Chittagong Extension of flowering area 1909 – 1910 H. de L. Calcutta Bot. G. (cultivated) 1910 – 1913 Troup Arakan Extension of flowering area in 1912-1913 to the eastearn area of Yoma 1910 – 1911 Troup Silhet (Assam) Gregarious floweirng 1911 – 1912 Troup Garo Hills, Cachar, Sylhet, Gregarious flowering Lushai Hills (Assam) 1912 – 1913 Troup Bamonpokri plantation(Kurseong) 1915 – 1916 Troup Arakan VIII World Bamboo Congress Proceedings ? Gregarious flowering Vol 5-98 Table 2. Flowering records of Melocanna baccifera in Janzen(1976) (Figures in parentheses represent the year after the last recorded flowering) Flowering area Flowering year and related reports on flowering periodicity Mizo Hills, Assam 1863 – 66, 1892 – 93(26 – 30), 1900 – 02(7 – 10), 1933(31 – 33), 1960(27) from Chatterjii(1960) Lushai Hills, Assam 1864, 1911 – 12(47 – 48) Chittagong, East Pakistan 1863 – 66, 1908 – 12(42 – 49), 1958 – 59(46 – 51) from Hossain(1962) VIII World Bamboo Congress Proceedings from Parry.(1931) Vol 5-99 Gregarious flowering of Melocanna baccifera around north east India Extraction of the flowering event by using satellite image data Murata Hiroshi*, Hasegawa Hisashi, Kanzaki Mamoru, Shibata Shozo Kyoto University, Japan Abstract For the identification and mapping of the gregarious flowering area of Melocanna baccifera, the most common bamboo species ranged from Myanmar to Bangladesh, an object-based land cover classification was conducted for a QuickBird image covering 1.5km2. The segmentation of the image well corresponded with the actual land cover, and the bamboo flowering area was successfully extracted. The method is expected to be applicable to the low resolution satellite images covering the larger spatial scales, and to enable the visualization of the geographical sequential flowering pattern of the bamboo from east to west in its distribution range. Keywords: bamboo flowering, Melocanna baccifera, remote sensing, QuickBird, object-based classification, Mizoram, Introduction Melocannna.baccifera is distributed in North east India, Myanmar, and Bangladesh (Alam 1995). From past study, it flowered in 1765, 1815, 1863, 1911, and 1959 in Mizoram State, showing 48 years interval. As predicted from the interval, M. baccifera flowered in 2006 to 2007 around Aizawl, the capital of Mizoram state. Flowering started from November 2006, and bamboo clumps died and defoliation started from January 2007. In February seeds were grown up on the bamboo and seeds fallen in May 2007. Then seed emerged in rainy season started from June 2007. In Mizoram, the shifting cultivation is most common cropping system until now. The quick regeneration from the rhizome after the slush-and-burn cropping preferred M. baccifera and the bamboo has increased with expanding shifting-cultivation. Mizoram state has an area of 21,081km2 and half of it is covered by bamboo forest of which M. baccifera stands account for 90% area (Report on Bamboo Resources Inventory). The death of M. baccifera after gregarious flowering, therefore, had catastrophic impact on the agriculture, local vegetation and human society. In past flowering events, rats consumed bamboo seeds and increased explosively, then, they shifted their food source to agricultural products, mainly rice. Therefore serious famine has been repeated in 48 years cycle. In 2008, the serious decrease of rice production was also reported. VIII World Bamboo Congress Proceedings Vol 5-100 The bamboo ranged from Myanmar to Bangladesh and actually flowering started from eastern part of their distribution range and flowering area moved to west. The last flowering event started probably from 2005 in the eastern part such as Myanmar and flowering in Bangladesh confirmed in 2009. Even though it is clear that this flowering event occurred in vast area, probably several tens of thousands km2, exact flowering range in each year has not yet been clarified and flowering wave from east to west also has not yet been visualized. Accurate identification of geographical range of flowering event during successive gregarious flowering of M. baccifera is quite important to understanding the ecology of M. baccifera and making counter measure for the catastrophic damage to the society and local people. We challenge the problem using remote-sensing technique. Our ultimate purpose is to clarify the flowering sequence of the bamboo in geographical scale. In this paper, we report the methodology to identify the flowering area in satellite images. Research site This study focused on Mamit in Mizoram, India (Fig.1) where we have continuously monitored the flowering and regeneration process of the bamboo. Main form of agriculture in research site is shifting-cultivation called as ‘Jhum’ in local and most of fallow stands consists of M. baccifera. Around Mamit, flowering started in 2008. Satellite image analysis In order to extract flowering area of M.baccifera, land cover classification map was made from satellite image taken by QuickBird satellite (Digital Globe). The image covered 1.5km2 and was taken on January 25, 2009 (Fig.2) when inflorescence was made already and most bamboo leaves turned brown and easily distinguished by the other vegetation or non-flowered bamboo stand. Resolution of QuickBird is 2.5m (multispectral) or 0.6m (panchromatic) and it enables the precise mapping of flowering area. For image analysis, ENVI 4.5 and IDL 6.0 (ITT Visual Information Solutions) were used. Object-based classification method was carried out for mapping ground cover. In the object-based classification, DN (digital number) of pixels and shade pattern were analyzed. In addition to these data, size of object and pattern of texture are considered in classification. An extension tool of ENVI 4.5, Feature extraction was used for the classification. Result and discussion Fig. 3 is classification map obtained by the object-based classification of the area shown by Fig. 2. In the study site, fallow lands of various ages make a patch mosaic pattern. Such a small scale mosaic pattern was successfully visualized by the segmentation map. The segmentation map was then subjected to supervised classification based on ground truth data. In Fig. 4, the extracted flowering area of M. baccifera obtained by the classification was shown. VIII World Bamboo Congress Proceedings Vol 5-101 Thus the use of high resolution satellite image can successfully identify the flowering area of the bamboo successfully. The object-based classification method was quite powerful for our purpose. However to identify the flowering area of each year in a successive flowering event in large spatial scale ranging from Myanmar to Bangladesh, low resolution images taken with high frequency and covered large area must be used. The current results using QuickBird image will be utilized for the development and validation of the analyses using low resolution images. Acknowledgement This research was supported by Grant-in-aid for scientific research (A) of Ministry of Education, Culture, Sports, Science and Technology, Japan (No. 17255007, representative: Shibata). Reference Alam.M.K. 1995. Melocanna baccifera (Roxb.) Kurz. In Plant Resources of South-East Asia, No. 7, Bamboos, edited by Dransfield.S and Widjaja.E.A, PROSEA Network Office, Bogor, Indnesia, pp.126-129. Environment & Forest Department. 2002. Report on Bamboo Resources Inventory of Aizawl, Champhai, Darlawn, Kawrthanh, Kolasib, Mamit, N. Vanlaiphai and Thenzawl Forest Divisions. Aizawl, India. VIII World Bamboo Congress Proceedings Vol 5-102 Fig. 1. Maps showing the research site in Mizoram, India. VIII World Bamboo Congress Proceedings Vol 5-103 0.2km Fig. 2. QuickBird image of Mamit study site. VIII World Bamboo Congress Proceedings Vol 5-104 0.2km Fig. 3. Image segmentation in study area. Lines are borders of segmented objects. VIII World Bamboo Congress Proceedings Vol 5-105 0.2km Fig.4 Extracrted bamboo flowering area VIII World Bamboo Congress Proceedings View publication stats Vol 5-106