Molecular biogeography of the Bulbophyllum lobbii Lindl. complex (sect. Sestochilos, Orchidaceae) in Southeast Asia Dissertation for obtaining the Master’s degree in Botany/Plant Biology at the Department of Organismic Biology AG Ecology and Diversity of Plants Paris-Lodron-University of Salzburg Presented by Gerald Hochschartner Bakk. Biol. Salzburg, August 2006 Dedicated to Christine, Christine and Simona Photo at the front page: Bulbophyllum facetum (left) and Bulbophyllum dearei (right) Index of contents Index of contents 1. Introduction 1.1 Paleogeological background 3 5 1.2 Study system 12 1.3 Study questions 20 2. Materials and methods 22 2.1 Plant material 22 2.2 DNA extraction 23 2.3 DNA amplification and sequencing 23 2.4 AFLP fingerprinting 24 2.5 Molecular analyses 26 2.5.1 ITS sequence analyses 2.5.1.1 Phylogenetic reconstructions and molecular dating 26 26 2.5.1.2 Lineages-through-time (LTT) and diversification analyses 28 2.5.1.3 DIVA (dispersal-vicariance analysis) 29 2.5.2 CpDNA sequence analysis 30 2.5.3 AFLP data analysis 32 2.5.4 Partition homogeneity test 33 2.6. Morphological analysis 33 2.7 Documentation 36 3. Results 3.1 Molecular analyses 37 37 3.1.1 Partition homogeneity test 37 3.1.2 Phylogenetic analyses of ITS sequences 37 3.1.3 Lineages-through-time (LTT) plot of ITS data 47 3.1.4 Phylogenetic analyses of cpDNA sequences 48 3.1.5 AFLP analyses 55 3.1.6 Geographical distribution of AFLP clades/species 59 1 Index of contents 3.1.7 Combined ITS/AFLP analysis 63 3.1.8 Dispersal-vicariance analysis (DIVA) 66 3.2 Morphological analysis 4. Discussion 4.1 Monophyly of the Bulbophyllum lobbii complex 70 77 77 4.2 Delimitation of major clades within the Bulbophyllum lobbii complex 4.3 On the role of hybridization within the B. lobbii complex 78 79 4.4 Putative ancestral area and age of the Bulbophyllum lobbii complex 80 4.5 Diversification of the B. lobbii complex, evolutionary processes and historic-biogeographical scenario 81 4.6 Yellow vs. red flower variation within the B. lobbii complex 83 4.7 The species within the B. lobbii complex 83 5. Conclusion 87 6. Abstract 88 7. Literature cited 90 8. Appendix 101 9. Colour plates of the B. lobbii complex and extra-complex species 110 Acknowledgements 124 Curriculum vitae 125 2 Introduction 1. Introduction Oceanic islands such as Hawaii or the Canaries, which have never been connected to any continental landmass provide opportunities for the study of speciation (Darwin, 1859; Carlquist, 1974). For example, recently phylogenetic studies of species which are endemic to such islands, and their relatives allow inferring the geographical origin and routes of colonisation of the island taxa (Takayama et al., 2005). Because oceanic islands are relatively simple systems where both patterns of dispersal and natural selection can be assessed more easily than in continental systems (e.g. small and new habitats force species fast to adaption or extinction due to biotic and abiotic factors), many molecular studies concerning speciation and colonisation of plant organisms of such isolated locations were published recently (e.g. Francisco-Ortega et al., 1996; Takayama et al., 2005). By contrast, there is only very little known about differentiationprocesses of natural plant populations on continental island systems. Continental islands developed recently by rising sea level and, thus, became disconnected from each other and the mainland. Similar to oceanic islands, continental ones can provide insights into colonization and radiation of species. However, continental islands also provide unique systems for studying the effects of past fragmentation provided the level of over-sea dispersal is sufficiently low (Bittkau & Comes, 2005). In this context, the IndoMalay Archipelago (the island system between mainland Indochina and Australia) in Southeast Asia seems to be particularly suited for phylogenetic and phylogeographic surveys. This archipelago is one of the main centres of biodiversity worldwide, likely due to its complex geological and climatic history and ecological diversity, including the presence of large rainforests (Bänfer et al., submitted). The Sunda Islands (mainly Borneo, Sumatra and Java), which are part of the archipelago and lie on a shallow continental shelf (Sundashelf; Fig. 1.3), were periodically connected with each other and the mainland (Indochina) in the recent history (Pliocene and Pleistocene) and, thus, recent fragmentation of populations could have contributed to speciation in this region. While the importance of these intermittent connections/ 3 Introduction fragmentations of the Sunda islands and the mainland of SE Asia to the evolution of the Sundashelf biota has been studied in detail for some animal groups (Heaney, 1986; Schmitt et al., 1995; Ruedi & Fumagalli, 1996; Ruedi, 1996; Karns et al., 2000; Inger & Voris, 2001; Gorog et al., 2004, Lourie et al., 2005) only a few studies concerning plants are available (Ridder-Numan, 1998; Cannon & Manos, 2003; Bänfer submitted). The current distribution of animal species in Southeast Asia, especially in the Indo-Malay Archipelago, is thought to be the result of widespread faunal migration across the Sundashelf during Pleistocene glacial maxima. There is a correlation between the current distribution of mammal species and the boundaries of land areas defined by Pleistocene sea levels (Heaney, 1986; Koopman, 1989), reflecting dispersals over land bridges (Gorog et al., 2004). However, there are also some studies which provide evidence for migrations (from Indochina to Sundashelf and vice versa) in the prePleistocene (Schot, 1998; Ridder-Numan, 1998; Gorog et al., 2004), i.e. at times when also connections between the Sunda Islands and the mainland (Indochina) existed (Hall, 1998; Gorog et al., 2004). In this study, I tested the hypothesis of Pleistocene speciation by focusing on the phylogenetic relationships and divergence times of submontane to montane-rainforest-restricted orchids (Bulbophyllum lobbii complex, c. 11 species) from the Sundashelf region (Peninsula Malaysia, Sumatra, Java, Borneo), the Philippines, Sulawesi and adjacent mainland areas (Thailand, Myanmar), using nuclear rDNA internal transcribed spacer (ITS) sequences, chloroplast (cp) DNA sequences, AFLP (amplified fragment length polymorphism) markers and morphometric analysis. The ITS region has been widely used in phylogenetic studies of angiosperms at the species level (Bortiri et al., 2001; Schultheis, 2001). The substitution rate of cpDNA is generally known to be lower than that of ITS (Wolfe et al., 1987; Small et al., 1998), so that the elucidation of phylogenetic relationships below generic level is often difficult (Gielly & Taberlet, 1994; Sang et al., 1997). However, some intergenic spacer regions of the cpDNA were used successfully for analysing inter- and intraspecific relationships (Taberlet et al., 1991; Gielly and Taberlet, 1994; Fujii et al., 1997; Ohsako and Ohnishi, 2000; Soejima & Nagamasu, 2004). The AFLP technique is 4 Introduction known to resolve phylogenetic relationships between closely related taxa (Vos et al., 1995; Wolfe & Liston, 1998; Mueller & Wolfenbarger, 1999; Ritland & Ritland, 2000; Guo et al., 2005). As the paleogeological history of Southeast Asia is very complex, here I give a brief review, because the spatial and temporal distribution and diversification of species/intraspecific lineages studied might have been influenced by climatic and tectonic events in the area (Avise, 1994; Avise, 2000; Lourie et al., 2005). 1.1 Paleogeological background The tetonic history of Southeast Asia shows that the collision of six major plates (Pacific, Australian, Eurasian, Indian, Indian Ocean and Philippines) resulted in two waves of Australian microplates moving towards the Eurasian plate. The oldest microplates formed most of Southeast Asia and the western part of the Malay Archipelago (up to the Wallace line) approximately 90 million years ago (Mya). The second wave started approximately 15 millions years ago and has recently formed stepping stones between the Australian and Eurasian plates (v. Welzen et al., 2003). Eocene to Oligocene The Peninsula Malaysia and the major islands of Sumatra, Borneo and Java, which lie on the shallow continental Sundashelf, existed as a continental block with Indochina from the early Eocene (approximately 50 Mya) to the late Oligocene (approximately 25 Mya) (Gorog et al., 2004). The Izu-BoninMariana (IBM; see Fig. 1.1) Arc was formed by outpouring of intra-oceanic volcanic rocks (Stern and Bloomer, 1992) caused by the subduction of the Pacific-Northern New Guinea ridge (about 40 Mya). At the same time, the Philippine Sea plate became a recognizable entity and the West Philippine basin, Celebes Sea, and Makassar Strait opened as a single oceanic basin within the Philippine Sea plate. 5 Introduction Mid-Oligocene to Miocene In the mid Oligocene (approximately 30 Mya) the global sea level fell about 250 m below present (Haq et al., 1987; Hutchinson, 1989) and thus very large areas of the Sundashelf were exposed. The climate at that time was probably tropical monsoon (Ridder-Numan, 1998). The north Australian margin came into contact with Sulawesi and the Halmahera Arc about 25 Mya, which resulted in a discontinous land connection between the Halmahera and the Philippine Arcs and Sulawesi (Hall, 1998). Java and Sumatra were submerged from the late Oligocene (about 25 Mya) until the Mid-Miocene (approximately 15 Mya; Gorog, et al., 2004). Early Miocene At about 20 Mya (Fig. 1.1) the deep water passage between the Indian and the Pacific Ocean was closed (Kennett et al., 1985) and central Borneo was uplifted. There was probably always some land in the area of Sulawesi from that time on. Although there was no direct land connection between Sulawesi and both Australia and the Sundashelf probably numerous islands periodically emerged within the broad shallow water zone separating those areas (Hall, 1998). The northern Makassar Strait (Celebes Sea), a deep water area northwest of Sulawesi, remained and formed probably a migration barrier (Wallace line; Fig 1.1) for many plants and animals (Moss & Wilson, 1998). Australia continued moving northward and caused the counter-clock rotation of Borneo. This rotation was accompanied by the counter-clockwise motion of West Sulawesi and the adjacent Sundaland blocks. The northern Peninsula Malaysia rotated clockwise, but remained linked to the southern Peninsula Malaysia and Indochina and thus widened the basins of the Gulf of Thailand. North Sumatra rotated counter-clockwise with south Peninsula Malaysia. There was a period of high sea level of about 220 m above present sea level, and also of warm and moist climate conditions, in the latest part of the early Miocene and the early part of the middle Miocene, which allowed the proliferation of diverse mangroves. Under a mixed warm climate paratropical forests (palms, mangroves and other tropical families) flourished and many species migrations may have occurred (Morley, 1998; RidderNuman, 1998). 6 Introduction Fig.1.1: Postulated distribution of land and sea in SE Asia at 20 Mya. The deep water passage between the Pacific and the Indian Ocean was closed, central Borneo was uplifted and permanent land was in the area of Sulawesi from that time on (Hall 1998). Mid-Miocene to Pliocene At approximately 10 Mya, Southeast Asia had obtained its largely recognizable modern formation. The rotation of Borneo was completed and the collision of the Sulu platform (Sulu pf.; see Fig. 1.2) with the eastern arm of Sulawesi caused the rotation of the eastern and northern arms of Sulawesi to their present position. Between 15 Mya and 5 Mya the area of the emerged Sundashelf was reduced and deep marginal basins in the east were eliminated or reduced in size. More of Borneo emerged and the central mountains along the Kalimantan-Sarawak border (extending into Sabah) widened and were further uplifted. There was already some highland in Sumatra and Sulawesi in the Early Pliocene, i.e. at about 5 Mya (Fig. 1.2., Hall, 1998). While the sea level had dropped up to 220 m below the present sea level in the late Miocene, it rose up again to 140 m above present sea level in the Pliocene (Ridder-Numan, 1998). 7 Introduction There were periods of drier climates from the end of the Middle Miocene to the Late Miocene, and also in the Plio-Pleistocene. At the beginning of the Pliocene a seasonal climate ((semi)arid winter, (semi)humid summer) had developed in Java (Morley, 1998). Fig. 2: Postulated distribution of land and sea in SE Asia at 5 Mya. SE Asia was largely recognizable in its present form. Rotation of Borneo was completed and the collision of the Sulu platform with Sulawesi led to its present position. The mountains of Borneo were extended, and highland was recognizable in Sumatra and Sulawesi (Hall, 1998). IBM Arc = Izu-Bonin-Mariana Arc; Sulu pf. = Sulu platform; C. S. = Celebes Sea. Pleistocene During the Pleistocene interglacial-periods rising sea-levels periodically converted mountains into geographically isolated islands, creating ideal conditions for speciation. Moreover, through lowering of the sea-level during glacials, the islands of the Sundashelf were repeatly connected with the Asian mainland and formed a giant block, enabling biotic migrations from the mainland to the archipelago (Sodhi et al., 2004). At least twice during the period of the last 250000 years, most recently about 17000 years ago, the sea level dropped 120 m (Fig. 1.3) for approximately 15000 years in total 8 Introduction time (Chappell & Shackleton, 1986) exposing an additional land area south and east of the Isthmus of Kra (along the border of Malaysia and Thailand; Fig. 1.3) of 1.53 square km, which resulted in a newly connected area of the Sundashelf (including Sumatra, Java and Borneo) of 3.2 million square km (Voris, 2000). 190000 years ago, the once continuous subcontinental rainforest of SE Asia fragmented due to a glacial drought, expanded afterwards and re-contradicted again during a second drought about 80000 years ago. Rainforest refugia survived in North Sumatra, North Borneo, West Java, Northeast Indochina and Southern India (Fig. 1.3). Rainforest communities on islands such as the Philippines and Sulawesi were probably been entirely eliminated, leaving severely degraded forest or no forest (Brandon-Jones, 1998). Fig. 1.3.: Map of SE Asia at about 80000 years ago, when sea level was 120 m below present. The major Sunda islands (Borneo, Sumatra and Java) were connected via the Peninsula Malaysia with the SE Asian mainland. Putative rainforest refugia in West Java, North Sumatra, North Borneo and Northeast Indochina are indicated (green line). The black line encircles regions in the Philippines and Sulawesi, where rainforest communities were degraded or eliminated. Base map was downloaded and belongs to the Field Museum of Natural History, Chicago, Illinois. (http://fmnh.org/research_collections/zoology/zoo_sites/seamaps/). 9 Introduction About 17000 years ago the Balabac Strait between Borneo and Palawan, which were not connected by land, was reduced to a width of 12 km. At that time a narrow deep ocean trench (Makassar Strait) still separated Sulawesi and Borneo. Until 9500 years ago the major Sunda islands (Borneo, Sumatra, Java) remained connected with the Peninsula Malaysia and Indochina (due to a drop in sealevel about 50 m below today). At this time, the ancient North Sunda River, which had probably provided gallery forest corridors between Sumatra and Borneo, was largely eliminated (Voris, 2000). Borneo and Sumatra were finally separated by the Karimata Straits which formed about 7000 years ago (Moss & Wilson, 1998). The present sea level was attained approximately 6000 years ago (Fairbanks, 1989; Voris, 2000). The climate of Southeast Asia at the time of the last glacial maximum (approximately 17000 years ago) was drier and more seasonal than today (Whitmore, 1981; Morley & Flenley, 1987; Heanny, 1991; Dawson, 1992; Shackleton, 1994; Voris, 2000). Rainforest was likely reduced by drought (as evidenced by plant fossil data, zoological and sedimentological information; Ray & Adams, 2001; Fig. 1.4), but this reduction was not as dramatic as about 80000 years ago, due to the slower decrease in temperature (BrandonJones, 1998; see also Kershaw et al., 2001). Grassland plants, characteristic of savanna or steppe vegetation (Verstappen, 1992, 1997; Morley, 1998, 2000; van der Kaars et al., 2001; Gorog et al., 2004) were predominant in the emergent paleolandscape. It is feasible that tropical rain forests and margrove swamps dominated at least the central southern region of the shelf (Sumatra, Borneo), Sulawesi and on Mindanao/Philippines (Sun et al., 2000; Kershaw et al., 2001; Ray & Adams, 2001; Gorog et al., 2004). Thailand, Peninsula Malaysia as well as some parts of the Philippines (Luzon, Palawan) were covered by monsoon forests and tropical woodland was in the south of Borneo. Furthermore, tropical montane rainforests have existed on Luzon, Mindanao, Borneo, Sulawesi, Sumatra and in Thailand (Ray & Adams, 2001; Fig. 1.4). 10 Introduction Fig. 1.4: Gis-based vegetation map of Eurasia at the Last Glacial Maximum. Tropical rainforests dominated the southern core of the Sundashelf (Sumatra and Borneo), Sulawesi and Mindanao. Thailand, Peninsula Malaysia as well as some parts of the Philippines (Luzon, Palawan) were covered by monsoon forests, whereas tropical woodland existed in the south of Borneo and tropical montane rainforests subsisted on Luzon, Mindanao, Borneo, Sulawesi, Sumatra and in Thailand (Ray & Adams, 2001). 11 Introduction 1.2 Study system Bulbophyllum lobbii Lindl. belongs to section Sestochilos (Breda) Benth. & Hook.f. which is currently under revision by Dr. Jaap Jan Vermeulen (Nationaal Herbarium Nederland, University of Leiden, The Netherlands; personal communication). Most species in this section (c. 40-50 species, distributed from Nepal via Indochina and the Sundashelf to the Philippines and New Guinea, and in China; Seidenfaden, 1990) are large epiphytes with a creeping rhizome and conspicuous pseudobulbs, each of which bears a single leaf (Comber, 1990). Those species with more than one flower have a subumbellate or racemose inflorescence. Furthermore, section Sestochilos differs from other sections of Bulbophyllum (c. 2000 species) by having larger petals (more than half as long as sepals) rather than smaller ones (section Ephippium); moreover, petals are glabrous rather than ciliate (section Hirtula) and the pseudobulbs are distinct rather than indistinct (section Aphanobulbon; Seidenfaden, 1992). Furthermore, the chambers of the pollinia of section Sestochilos are separated by a membrane-like structure, which is distinct from the outside cap. Most flowers of this section have a pleasant scent, but some smell foul. These various smells attract various kinds of flies, the predominant pollinators (Comber, 1990), which transfer the pollinarium (see below) to another flower of likely the same fragance. Interestingly, during pollination male flies aquire chemical components by licking on the floral tissues and biotransform them into female-attracting pheromones (B. cheiri: Nishida et al., 2004). In addition to attraction of pollinators by smell, the lip may also play an essential role. Some authors suggest that quick lip movements, triggered by wind, mimic flies shaking their wings and so attract pollinators (Barth, 1985; Meve & Liede, 1994; Borba & Semir, 1998). Besides the visual attraction, movement of the lip is also very important for pollination. This mechanism is well described for B. macranthum (Ridley, 1890). When a fly lands on the hinged lip of the orchid, the lip moves down so that the fly has to crawl up. It passes the balance point of the lip and, thus, the lip returns to its initial position, pressing the fly against the column/pollinia chambers, whereby the pollinarium is attached to the fly (Teixeira, 2004). The first knowledge of Bulbophyllum lobbii goes back to the year 1827 12 Introduction when Breda described and illustrated one of Kuhl & v.Hasslet’s Javanese plants and referred to it as Sestochilos uniflorum Breda (Breda, 1827). In 1847 Lindley established Bulbophyllum lobbii on the basis of a Javanese collection by William Lobb (Lindley, 1847). Thereby he evidently overlooked Breda’s earlier description of the same species, because he did not use the specific epithet uniflorum. As the name Bulbophyllum uniflorum was and is, respectively, used for another species the name Bulbophyllum lobbii Lindl. has outlived till today. Different authors have added a series of names in synonymy in many publications (Table 1.1). Nowadays the name Bulbophyllum lobbii, which is used in herbaria and in the literature, covers a whole series of plants that might be recognized as separate species. It is also possible that some synonyms used in the literature are based on misidentifications (Seidenfaden, 1997). The current taxonomy of the Bulbophyllum lobbii complex (as inferred from a detailed literature survey as well as personal communications of taxonomic experts (Dr. J. J. Vermeulen, G. Fischer, A. Sieder)) is listed below (Table 1.1). Eleven species (B. cameronense, B. coweniorum, B. dearei, B. facetum, B. lobbii, B. microglossum, B. orectopetalum, B. polystictum, B. siamense, B. smitinandii and B. sumatranum) are assigned to the B. lobbii complex, whereby their phylogenetic relationships among each other and to closely related taxa remain illusive. The distribution and habitats of the various species and of the taxa used as outgroup is summarized in Table 1.2. Within the B. lobbii complex six species are geographically restricted (B. cameronense, B. polystictum and B. microglossum: Cameron Highlands/Peninsula Malaysia; B. facetum: Luzon/Philippines; B. smitinandii: Khao Luang/Thailand, B. sumatranum: Sumatra) and five species are more or less widely distributed (B. coweniorum: Laos, Luzon/Philippines; B. dearei: Philippines, Borneo, Peninsula Malaysia; B. lobbii: Peninsula Malaysia, Borneo, Sumatra, Java, Bali, Philippines, Sulawesi; B. orectopetalum and B. siamense: Assam, Thailand, Myanmar (Burma)). Figure 1.5 shows the distribution of the 11 species belonging to the B. lobbii complex. All species of the B. lobbii complex are restricted to (sub)montane rainforests, growing almost exclusively on trunks and main branches of trees (rarely terrestial on limestone; B. dearei) and require more or less shade and 13 Introduction humidity. All species of the complex as well as of the outgroup taxa are diploid (2n = 2x = 38), except B. patens which is triploid (3x = 57; Lim & Jones; 1981; Lim, 1985). Similar to other members of the Orchidaceae, the cpDNA should be inherited maternally (Trapnell & Hamrick, 2004). Although most taxa within the complex are interfertile but not selfcompatible, and form capsules after artificial crossings (greenhouse experiments; G. Fischer), no evidence of natural hybridisation between the species was found in the literature. 14 Introduction Table 1.1: Current taxonomy of the Bulbophyllum lobbii complex. Eleven species are currently recognized and their synonyms are indicated together with their first description and their current status in the taxonomic literature. Taxon name First description Current status (reference) B. cameronense Garay, Hamer & Siegerist Garay et al., 1996 accepted (Garay et al., 1996) B. coweniorum J. J. Verm. & P. O`Byrne Vermeulen & O'Byrne, 2003 accepted (Vermeulen & O'Byrne, 2003) B. dearei (Hort.) Rchb. f. Reichenbach, 1888 accepted (Seidenfaden & Wood, 1992) B. godseffianum Weathers Weathers, 1890 synonym (Vermeulen, 1991) B. goebelianum Kraenzl. Kraenzlin, 1921 synonym (Vermeulen, 1991) B. punctatum Ridl. Ridley et al., 1908 synonym (Vermeulen, 1991) B. reticosum Ridl. Ridley, 1893 synonym (Seidenfaden & Wood, 1992) Sarcopodium dearei Hort. Hort, 1883 synonym (Wood & Cribb, 1994) B. facetum Garay, Hamer & Siegerist Garay et al., 1996 accepted (Garay et al., 1996) B. lobbii Lindl. Lindley, 1847 accepted (Comber, 2001) B. bataanense Ames Ames, 1905 synonym (Vermeulen, 1991) B. claptonense Rolfe Rolfe, 1905 synonym (Vermeulen, 1991) B. henshallii Lindl. Lindley, 1852 synonym (Comber, 1990) B. lobbii Lindl. var. colosseum Hort Hort, 1905 synonym (Vermeulen, 1991) B. lobbii Lindl. var. henshallii (Lindl.) Henfrey Henfrey, 1852 synonym (Vermeulen, 1991) B. lobbii Lindl. var. nettesiae Cogn. Cogniaux, 1901 - Phyllorchis lobbii (Lindl.) Kuntze Kuntze, 1891 synonym (Vermeulen, 1991) Sarcopodium lobbii (Lindl.) Lindl. & Paxt. Lindley, & Paxton, 1850 synonym (Vermeulen, 1991) Sestochilos uniflorum Breda Breda, 1827 synonym (Vermeulen, 1991) Ridley, 1908 accepted (Seidenfaden & Wood, 1992) B. microglossum Ridl. Synonym 15 Introduction B. orectopetalum Garay, Hamer & Siegerist Garay et al., 1992 accepted (Seidenfaden, 1997) B. polystictum Ridl. Ridley, 1909 accepted (Seidenfaden, 1997) B. siamense Rchb. f. Reichenbach, 1867 accepted (Seidenfaden, 1997) B. smitinandii Seidenf. & Thorut Seidenfaden & Thorut., 1996 accepted (Seidenfaden, 1997) B. lobbii Lindl. var. siamense (Rchb. f.) Rchb.f. Reichenbach & Saunders, 1882 synonym (Seidenfaden, 1997) B. sumatranum Garay, Hamer & Siegerist B. lobbii Lindl. var. breviflorum J. J. Sm. Garay et al., 1996 accepted (Garay et al., 1996) Smith, 1908 synonym (Garay et al., 1996) Table 1.2: Distribution and habitats of the Bulbophyllum lobbii complex and related taxa of section Sestochilos used as outgroup (Vermeulen, 1991; Seidenfaden & Wood, 1992; Garay et al., 1996; Seidenfaden, 1997; Vermeulen & O'Byrne, 2003). *personal observation; ** Vermeulen personal communication. Bulbophyllum taxa Distribution Habitat description Peninsula Malaysia Submontane and montane forests on B. lobbii complex B. cameronense trunks and main branches of trees B. coweniorum Laos, Philippines* Intermediate to warm growing epiphyte in submontane and montane forests B. dearei Philippines, Borneo, Peninsula Malaysia Unifoliate epiphyte and occasional lithophyte in submontane and montane forests on bare trunks of large trees or in forests on limestone B. facetum Endemic to Philippines in the montainous On tree trunks in shady locations in region of Luzon submontane and montane forests 16 Introduction B. lobbii B. microglossum Peninsula Malaysia, Borneo, Sumatra, Java, Submontane and montane forests on Bali, Philippines, Sulawesi** trunks and main branches of trees Peninsula Malaysia Submontane and montane forests on trunks and main branches of trees B. orectopetalum Assam, Thailand, Myanmar (Burma), Warm to cool growing epiphyte in submontane and montane forests requiring light shade B. polystictum Peninsula Malaysia Intermediate to warm growing epiphyte in submontane and montane forests that needs a slight winter rest B. siamense Assam, Thailand, Myanmar (Burma) Intermediate to warm growing epiphyte in submontane and montane forests B. smitinandii Endemic to Thailand (foothills of Khao Moderately warm growing epiphyte in Luang, Nakorn Sritammarat) submontane and montane forests which needs half shade B. sumatranum Sumatra Warm to cool growing epiphyte in submontane and montane forests that requires shade, good drainage and high humidity Used outgroup taxa B. affine Lindl. Indian Himalaya, Nepal, Sikim, Bhutan, Evergreen lowland forests Assam, Laos, Thailand, Vietnam, China, Ryukyu 17 Introduction B. emiliorum Ames & Quisumb. Philippines, New Guinea, Papua Guinea On tree trunks in open semi-deciduous forests B. hamatipes J. J. Sm. Endemic to Java On trunks and main branches of isolated trees in grass land B. macranthum Lindl. Burma, Vietnam, Thailand, Peninsula Occasionally in Lower montane forests Malaysia, Sumatra, Java, Bangka, Bali, Borneo, Philippines, New Guinea B. membranifolium Hook. f. B. patens King ex Hook. f. B. piestoglossum J. J. Verm. Peninsula Malaysia, Sumatra, Borneo, Podzolic forests, swampy forests, mixed Philippines montane forests, forest on ultrabasic soil Thailand, Peninsula Malaysia, Borneo, On tree trunks in lowland swamp forests, Sumatra, Bangka, Biliton, Java avoiding detritus Endemic to Philippines Hot to cool growing epiphyte on tree trunks B. hamatipes J. J. Sm. Endemic to Java Warm to cool growing epiphyte B. monanthum (Kuntze) J. J. Sm. Thailand, Vietnam Warm to cool growing epiphyte B. pileatum Lindl. Peninsula Malaysia, Borneo, Sumatra Swamp forests on mature mangrove trees as a miniature sized, hot to warm growing epiphyte B. alsiosum Ames Philippines Warm to cool growing epiphyte 18 Introduction Fig. 1.5: Distribution of species of the Bulbophyllum lobbii complex (see also Table 1.2). Note that all species are restricted to (sub)montane rainforests. Turquoise = B. siamense, B. orectopetalum; dark blue = B. microglossum, B. cameronense, B. polystictum; pink = B. sumatranum; light blue = B. dearei; light green = B. coweniorum; dark green = B. facetum; violet = B. smitinandii; black = B. lobbii sens lat.. Base map adapted from the maps of the University of Texas, Austin, USA (www.lib.utexas.edu/maps/asia.html). 19 Introduction 1.3 Study questions 1) The taxonomic position and the monophyly, respectively, of the Bulbophyllum lobbii complex within the section must be clarified. 2) The temporal and spatial origin of this orchid group should be determined. Answering these two questions is accomplished by the sequencing of the ITS (internal transcribed spacer) region of nuclear ribosomal DNA and the interpretation of the phylogenetic trees (maximum parsimony and maximum likelihood) under the assumptions of a molecular clock. Furthermore, a dispersal-vicariance analysis should help to reconstruct the putative ancestral areas of the B. lobbii complex and the various clades/species, respectively. 3) By means of molecular markers (ITS and cpDNA sequences, AFLPs) and by using morphometric analyses, the relationships between the various clades/species within the B. lobbii complex should be identified. While ITS and cpDNA markers should elucidate the relationships along more or less general lines (relationships between various species and well defined clades, respectively) using maximum parsimony, distance and maximum likelihood analyses, fast evolving DNA-fingerprint-markers (AFLPs) should give deeper insights into more shallow inter- and intraspecific relationships (by the means of distance and principal coordinate analyses) of the B. lobbii complex. The morphological analyses (principal component analyses) should be compared to the molecular data, examining whether the morphological variablility reflects the genetic one. Taking all these data together a relative clear picture of the relationships of species/clades within the B. lobbii complex should be obtained. 4) The onset of diversification of the B. lobbii complex (also that of the various species/clades) and the corresponding important evolutionary processes should be discovered. Additional to the methods (mentioned above), a lineage-through-time plot and statistical tests (e.g. gammastatistic; Pybus & Harvey; 2000) might help to answer 20 Introduction these questions. 5) On the basis of these data a historic-biogeographical scenario for the B. lobbii complex should be reconstructed. 6) The B. lobbii complex comprises plants with red and yellow flowers. With the aid of the methods mentioned above it should be possible to test the hypotheses about a single or multiple origin of either of these phenotypic variants. 7) Although further taxonomic work is certainly necessary, the molecular and morphological data presented here, along with personal observations, should help clarifying how many and which species actually belong to the B. lobbii complex. 21 Material and Methods 2. Materials and methods 2.1 Plant material Most of the examined plants of the Bulbophyllum lobbii complex were collected in Southeast Asia and cultivated in the glasshouses of the Botanical Gardens at Salzburg and Vienna. Some samples were received as silicagel dried leaf material from the Botanical Gardens of Singapore and Leiden. The sources of the samples are detailed in Table 7.1 (appendix) and the sampling localities for each species/accession are shown in Figure 2.1. Fig. 2.1: Sampling localities. See also Table 1 for specific locality information. Base map adapted from online map creation (http://www.aquarius.geomar.de/). = B. lobbii (l); V = B. dearei (d); U = B. siamense (sia); « = B. smitinandii (smi); ¹ = B. facetum (fac), B. coweniorum (cow); ¹ = B. sumatranum (sum); ˆ = B. cameronense (cam), B. microglossum (mic); B. polystictum (pol); ‘ = B. orectopetalum (ore). Accessions of the widespread taxa (B. lobbii and B. dearei) are numbered (identified in Table 7.1). B. facetum, B. coweniorum, 22 Material and Methods B. cameronense, B. microglossum and B. polystictum (5, 5, 4, 4 and 3 accessions, respectively) are mapped with a single symbol without accession numbers. Accessions of B. orectopetalum and B. sumatranum (6 and 7 accesssions, respectively), for which no exact location (only area) information was available, are mapped on their area with a single symbol without numbers. Accessions for which no (B. lobbii (16, 20, 24, 31); B. dearei (5)) or only coarse (B. lobbii (29, 30); “Indonesia”) locality information was available were not mapped. 2.2 DNA extraction Total DNA was extracted from either silica-dried or fresh leaves. Leaf tissue was pulverized to a fine powder in a grinding mill using liquid nitrogen. Because extracts from Bulbophyllum leaves contain high amounts of polysaccharides, prior to DNA extraction the leaf powder was washed using sorbitol extraction buffer (100 mM Tris-HCL pH 8.0, 0.35 M sorbitol, 5 mM EDTA pH 8.0). Total DNA was isolated from a washed leaf pellet using the 2x CTAB (hexadecyltrimethyl ammonium bromide) extraction method (Doyle & Doyle, 1987) and purified using PCI (phenol-chloroform-isoamylalcohol; 25:24:1) and CI (chloroform-isoamylalcohol; 24:1). After precipitation with cooled isopropanol and subsequent centrifugation, the DNA pellet was washed 2 times in 70% ethanol and air-dried for at least 30 min. This was followed by resuspension in TE buffer and incubation at 37 °C for 30 min with RNase. DNA was quantified using a Smart SpecTMPlus photometer (Biorad) and stored at –20°C. 2.3 DNA amplification and sequencing The complete ITS (ITS1, 5.8S rDNA, ITS2) region of nuclear ribosomal DNA and 8 regions of the chloroplast genome were PCR (polymerase chain reaction)-amplified and sequenced. The cpDNA regions included: trnL-F (trnL 5’exon, intron, 3’-exon, intergenic spacer (IGS) and trnF-gene), trnH-psbA (trnH-gene, IGS, psbA-gene), trnD-trnT (trnD-gene, IGS, trnY-gene, IGS, trnE-gene, IGS, trnT-gene), trnD-E (trnD-gene, IGS, trnY-gene, IGS, trnEgene), trnS-trnfM (trnS-gene, IGS, psbZ-gene, IGS, trnG-gene, IGS, trnfMgene), trnL-ndhJ (trnL 3’-exon, IGS, trnF-gene, IGS, ndhJ-gene), rpoB-trnC (rpoB-gene, IGS, trnC-gene), trnT-trnL (trnT-gene, IGS, trnL 5’-exon) and trnS-trnG (trnS-gene, IGS, trnG 5’-exon). The following additional cpDNA 23 Material and Methods regions could not be amplified: trnY-trnT (trnY-gene, IGS, trnE-gene, IGS, trnT-gene), trnS-trnT (trnD-gene, IGS, rpS4-gene, IGS, trnT-gene), trnS-trnL (trnD-gene, IGS, rpS4-gene, IGS, trnT-gene, IGS, trnL 5’-exon), rpL16 Intron (rpL16 3’-exon, intron, rpL16 5’-exon) and rpS16 Intron (rpS16 3’-exon, intron, rpS16 5’-exon) (see Table 7.2 in appendix for primer information). Amplifications were carried out in a volume of 50 µl, containing 1 µl (10-30 ng/µl) of genomic DNA, 5 µl F-Taq polymerase buffer (10x), 8 µl MgCl2 (25 mM), 1 µl BSA (20 mg/ml), 1 µl dNTP mix (10 mM of each dNTP), 1 µl forward primer (10 µM), 1 µl reverse primer (10 µM), 0.25 µl F-Taq polymerase (Fermentas; 5 U/µl) and 7.45 µl purified water (see also Table 7.3). Reactions were carried out in either a GeneAmp®PCR-System 2700 (Applied Biosystems) or a MyCycler (Biorad) and using the programmes described in Table 7.4. PCR products were purified using Cleaning Kit (Promega) and quantified by means of a Universal-Hood II gel-electrophoresis documentation system (Biorad) and a Smart SpecTMPlus photometer (Biorad). For sequencing 500 ng or 150 ng of purified PCR product was dried in an Univapo 150 ECH vacuum centrifuge (Uniequip) and sent, together with 10 pmol or 100 pmol of each sequencing primer to Macrogen (Seoul, Korea) and MWG (Munich, Germany), respectively, for cycle sequencing and the detection of reaction products on automatic sequencers (ABI 3730xl DNA Analyzer and LI-COR 4000 sequencer, respectively). All primers used for amplification and/or sequencing (singly in only forward, or in forward and reverse reactions) are listed in Table 7.2. 2.4 AFLP fingerprinting Because of the low level of nucleotide variability detected at the interspecific level for both, the nuclear and the chloroplast sequences, AFLP analysis was performed for 93 individuals, representing all species of the B. lobbii complex (B. cameronense 4 accessions, B. coweniorum 4, B. dearei 15, B. facetum 6, B. lobbii 31, B. microglossum 4, B. orectopetalum 5, B. polystictum 3, B. siamense 1, B. smitinandii 1 and B. sumatranum 7 accessions) and some outgroup species (Table 7.1). The AFLP procedure followed Gaudeul et al. (2000), to the exception 24 Material and Methods that reaction volumes in the PCRs were reduced by 50%. After the digestionligation reaction (Table 7.6) two steps of amplification followed, a preselective PCR in which primers with 1 base pair (bp) extension (Table 7.7), and a selective PCR (Table 7.8) in which primers with 3 bp extensions (Table 7.5) were used, thereby reducing the number of fragments. The respective PCR programmes used are detailed in Table 7.9. The Pre-PCR product was checked for the presence of a smear of fragments (length from 100 to 1500 bp) by agarose gel electrophoresis. For the selective PCR initially 12 different primer combinations (Table 7.5) with 3 bp extensions were used in a primer-trial with 8 individuals (6 different species which were representative for the complex; B. cameronense 1, B. coweniorum 1, B. dearei 1, B. lobbii 3, B. polystictum 1 and B. siamense 1 accessions). The EcoRI-primers were labelled with fluorescent dyes (Table 7.5). For each individual, 0.6 µl (blue labelled, 6-FAM), 0.9 µl (green labelled, VIC) and 1.2 µl (yellow labelled, NED) selective PCR products were combined with 1 µl mixture composed of formamide, loading buffer and size standard (GenScan ROX 500; Applied Biosystems). This mixture was then denatured at 95 °C for 2 min prior to loading on a 6% polyacrylamide gel. Electrophoresis was run for approximately 4 h on an automated sequencer ABI 377TM (Applied Biosystems) at the Faculty Center Botany of the University of Vienna. Raw data was collected and aligned with the internal size standard using ABI PRISM GENESCAN® version 3.7 analysis software (PE Applied Biosystems). The GeneScan files were imported into GENOGRAPHER version 1.6 (http://hordeum.oscs.montana.edu/ genographer/) for scoring. Fragments in the size range of 60 to 500 bp were scored and the data were exported into PAUP* (version 4.0b5; Swofford 2001) as a presence/absence matrix. Out of the 12 different primer combinations initially tested, EcoRI AGG (VIC)-MseI CTG, EcoRI ATC (6-FAM)-MseI CTA and EcoRI AAC (NED)MseI CTG were selected (because these combinations produced the best scorable and visible fragments) for analysing all individuals (Table 7.5). 25 Material and Methods 2.5 Molecular analyses 2.5.1 ITS sequence analyses 2.5.1.1 Phylogenetic reconstructions and molecular dating The ITS sequence analyses were performed using 53 accessions of the B. lobbii complex (ingroup) together with 12 accessions of the same section (Sestochilos) which were used as an outgroup for the rooting of the trees (Table 7.1). Sequences were assembled using VECTOR NTI (Invitrogen) and then visually improved. The alignment of sequences (including outgroup taxa) was unambiguous and required the introduction of only a few gaps. All analyses were conducted using the entire ITS region (ITS1, 5.8S rDNA, ITS2). The boundaries of the various regions were determined by comparision with the sequence from B. lobbii (GenBank accession number AF521074; van den Berg et al., 2005). Basic molecular characteristics of the ITS sequences were examined using the programme MEGA (Molecular Evolutionary Genetics Analysis) version 3.1 (Kumar, 2004). To assess overall phylogenetic relationships, an unweighted maximum parsimony (MP) analysis was initially performed on the whole dataset using PAUP* (version 4.0b5; Swofford 2001). Heuristic MP searches were performed with the following conditions in effect: 10 replications of random sequence addition, tree bisection-reconnection (TBR) branch swapping (on best trees only), MULTREES on. In these searches, the maximum number of trees saved (MAXTREES) were set to 10000 and gaps (indels) were treated as missing data. To support individual nodes of the tree bootstrap values (Felsenstein, 1985) were estimated from 100 pseudoreplicates, and using the same heuristic search settings. Maximum Likelihood (ML) and ML distance (Neighbour Joining; NJ) analyses under the model determined by MODELTEST 3.7 (Prosada & Crandall, 1998) were also performed with PAUP*. Based on MODELTEST, the best-fitting substitution model was the TIM+G+I “transitional model” (Prosada & Crandall, 1998) which allows base frequencies to vary and assigns different substitution rates to purine and pyrimidine transitions as well as a third rate to all transversions. Furthermore, different rates are permitted at different sites based on a discrete gamma (γ) distribution with four rate categories for the variable sites and with estimated shape parameter. Finally, 26 Material and Methods this model allows for a certain proportion of invariant sites (I). Tree searches under the ML criterion were performed using 10 replicates of random sequence addition and nearest neighbour interchange (NNI) branch swapping. MAXTREES were set to 100. Maximum likelihood bootstrap analysis was conducted using model parameters derived from the original data matrix (100 replicates, 10 random addition sequences, NNI branch swapping, MAXTREES = 100). The NJ-distance analyses (Saitou & Nei, 1987) were conducted also under the ML criterium (with model parameters derived from the original data matrix) and bootstrap values were obtained by running 10000 replicates. The ML tree searches (as mentioned above) were also accomplished with a molecular clock enforced (mce) (see PAUP* option: maximum likelihood settings – miscellaneous). Thus, in order to test whether the ITS dataset follows a “global” (i.e. tree-wide) molecular clock or not, the two log maximum likelihood (logL) scores (obtained i.e. with and without mce) were compared to each other using the tree based likelihood ratio test (LRT) of Felsenstein (1988) which is implemented in MODELTEST 3.7. The test statistic: -2(logLclock – logLno clock) should be distributed as χ2 with (N-2) degrees of freedom, where N is the number of sequences in the tree (Felsenstein, 1988; Sanderson, 1998). After confirming rate-constancy of ITS sequence evolution, the ML-tree with a molecular clock enforced was taken for estimating both the age and the onset of diversification of the B. lobbii complex, as well as for dating various subsequent events in the evolutionary history of the group. As there is neither a fossil record nor an ITS substitution rate available for orchids, three different, previously published ITS substitution rates were used for calibration of the clock: 1.72 x 10-9 subst./site/year (slow clock), 3.94 x 10-9 subst./site/year (moderate clock) and 7.83 x 10-9 subst./site/year (fast clock; see Richardson et al., 2001). In addition the clock was calibrated biogeographically using ITS sequence information of two sister taxa of Bulbophyllum (G. Fischer, unpublished data), one endemic to Reunion (B. variegatum) and the other occuring in Madagascar (B. bathieanum). After confirming rate-constancy of ITS sequence evolution for the whole section (Alcistachys) these two latter species belong to, the clock tree was used to calibrate, to the node of their 27 Material and Methods common ancestor. The node of divergence between the two sister taxa in a clock-enforced ML tree was dated to the emergence of Reunion approximately 1.8 Mya (Gillot et al., 1994), thereby assuming that the island was soon colonized after it breached the surface of the ocean and that colonization of the island corresponded with the speciation of B. varigatum (see also Kimball et al., 2003). This analysis resulted in an ITS mutation rate of 1.297 x 10-9 subst./site/year (G. Fischer, unpublished data). Note, however, that this approach provides maximum age estimates and therefore this latter rate should be considered a minimum rate. 2.5.1.2 Lineages-through-time (LTT) and diversification analyses In lineages-through-time (LTT) plots, the increasing (log) number of lineages of a reconstructed phylogeny (ultrametric tree) is plotted against their absolute time of divergence or the (genetic) distance relative time of each node from the tip of the tree. The nodes were numbered and afterwards a diagram was constructed (X-values = distance from the tip; Y-values = log number of lineages). Node heights (branch lengths) were derived as genetic distances from the clockconstrained phylogenetic (ITS) tree calculated under ML. To further examine if lineage diversification in the B. lobbii complex conforms to a constant-rates birth and death process (null-hypothesis), the programme GAMMASTATISTICS V1.0 (Griebeler, 2004) was used, which performs the γ-statistic test developed by Pybus and Harvey (2000). If the internal nodes of the reconstructed phylogeny are closer to the root (γ < 0) or to the tips (γ > 0) than expected under the pure birth model, the constantrates model is rejected. This method is relatively robust to incomplete taxon sampling and is conservative with respect to extinction (Pybus & Harvey, 2000). Each node height (branch length in terms of genetic distance to the tip) of the calculated ML tree (with mce) was exported to an excel-sheet and then sorted in ascending order according to the distance to the tip. Afterwards the distance-differences of the nodes were calculated and loaded into the programme. 28 Material and Methods 2.5.1.3 DIVA (dispersal-vicariance analysis) The programme DIVA (version 1.1; Ronquist, 1996) was used for the examination of the ancestral area(s) of the B. lobbii complex. This method is based on a three dimensional cost matrix derived from a simple biogeographic model, which assumes that the current distribution of species (taxa) and their ancestor can be described by unit areas (the whole distribution area is splitted in smaller, but distinct areas and these are called unit areas; e.g. Luzon, Mindanao, Palawan, Borneo, Sumatra, Java/Bali, Sulawesi, Peninsula Malaysia and the region north of the Isthmus of Kra are the unit areas of the study region in the first analysis). Four assumptions are made: (i) speciation by vicariance (no costs); (ii) allopatric speciation (no costs); (iii) dispersal (costs per unit area +1); (iv) extinction (costs per unit area –1). For the reconstruction of ancestral areas a simplified phylogenetic tree of the ITS dataset was used to reflect relationships among the major clades and subclades identified within the complex (see Results, Figs. 3.12, 3.13). The 0/1 data matrix, which was used for the DIVA analysis, is shown in Table 2.1, whereby 0 and 1 refer to the absence and presence of (sub)clades in predefined biogeographical regions, respectively. A 0 0 0 0 0 0 1 0 0 B 0 0 0 0 0 0 0 1 0 C 1 0 0 0 0 0 0 0 0 D 1 0 0 0 0 0 0 0 0 E1 1 0 0 1 1 1 0 1 0 E2 1 0 0 0 0 0 0 1 1 E3 1 1 0 1 0 0 0 1 0 E4 0 0 1 1 1 0 0 1 0 of Kra Above Isthmus Malaysia Peninsula Sulawesi Sumatra Borneo Palawan Luzon (Sub)clades Mindanao Distribution Java/Bali Table 2.1: Data matrix containing all clades and subclades used for DIVA analysis In a second DIVA analysis, Luzon, Mindanao and Palawan were combined to one area (Philippines) and the subclades E1 – E4 were reduced to a single 29 Material and Methods clade, E. According to suggestions by Ronquist (1996) and Oberprieler (2005), this clade was coded according to its likely ancestral distribution and not being distributed in all areas where descendants occur presently. Because of the basal position of a Bornean lineage (phylogenetic evidence) and the high genetic/subclade diversity within clade E on Borneo (circumstantial evidence), this area was chosen as the ancestral area of clade E. In addition, this second DIVA analysis was performed with and without using B. emiliorum as an outgroup. This resulting data matrix is shown in Table 2.2. Table 2.2: Data matrix containing all clades (A-E) with B. emiliorum used as outgroup. Thailand Peninsula Malaysia Sulawesi Java/Bali Sumatra Borneo Clades Philippines Distribution A 0 0 0 0 1 0 0 B 0 0 0 0 0 1 0 C 1 0 0 0 0 0 0 D 1 0 0 0 0 0 0 E 0 1 0 0 0 0 0 Outgroup 1 0 0 0 0 0 0 2.5.2 CpDNA sequence analysis Five distantly related accessions of the B. lobbii complex (as evidenced by ITS) were initially chosen for a pilot screen using the regions trnH-psbA, trnDtrnE, trnS-trnfM, trnL-trnF and rpoB-trnC. The three other successfully amplified regions were not sequenced due to their expected lower variability (Shaw et al., 2005). The regions trnD-trnE and trnH-psbA were finally chosen for a full screen because (i) the trnS-trnfM region showed the lowest variability (Table 2.3); (ii) paralogous sequences of the trnL-trnF region emerged in various Madagassian Bulbophyllum species, posing difficulties for phylogenetic reconstruction (G. Fischer, unpublished data); and (iii) the sequencing reaction of the rpoB-trnC region was successfully done for only 30 Material and Methods one of the five individuals examined. Table 2.3: Variability of four cpDNA regions. Data were obtained by examining 5 different accessions of the B. lobbii complex for each marker. Length Variable Number Length of Marker (bp) sites of indels indels (bp) trnD-trnE 440 4 2 9&2 trnS-trnfM 900 3 2 1 trnH-psbA 800 8 2 7&6 trnL-trnF 940 11 1 5 The full analyses were performed on 32 accessions of the B. lobbii complex (ingroup) together with 4 outgroup accessions for the trnH-psbA region and 31 accessions of the B. lobbii complex together with 5 outgroup accessions for the trnD-trnE region (Table 7.1). B. emiliorum was taken for the rooting of the trees. The sequences of each region were aligned and MP, ML, and distance (NJ) analyses were performed for each dataset separately and also for the combined dataset (31 accessions of the B. lobbii complex and 4 outgroup accessions). The selected models determined by MODELTEST for the NJ and ML analyses were TIM for the trnD-trnE dataset, F81+I+G for the trnHpsbA dataset and GTR+I+G for the combined dataset. The settings of the MP, ML, and distance (NJ) analyses for the cpDNA dataset analyses are summarised in Table 2.4. Characteristics of the cpDNA sequences were examined using MEGA. 31 Material and Methods Table 2.4: Settings for the phylogenetic analyses of the cpDNA datasets. Note that the same settings were applied to the ITS dataset. Type of analysis/settings Neighbour Maximum Parsimony Bootstrap (MP) (MP) likelihood (ML) Bootstrap (ML) Joining Bootstrap (NJ) (NJ) distance Heuristic Heuristic search; 10 randomadditionsequence; TBR; MAXTREES 10000 Maximum Heuristic search; search; Heuristic search; Modeltest 10 random- Modeltest parameter; addition- parameter; 10 random- sequence; 10 random- addition- TBR; addition- sequence; NNI; MAXTREES sequence; NNI; MAXTREES 10000; MAXTREES 100 100; 100 replicates Modeltest Modeltest parameter; parameter 10000 replicates 100 replicates Gaps were defined as missing data; all characters were weighted equally 2.5.3 AFLP data analysis 81 accessions (11 species) of the B. lobbii complex (ingroup) and 12 accessions (9 species) of the same section (Sestochilos) were used as outgroup for the analyses. Genetic distances of all AFLP samples were calculated using the complementary value of Nei and Li’s (1979) similarity coefficient: D = 1 – SC = 1 – [2nxy/(nx + ny)] as implemented in PAUP*. D represents the genetic distance, SC the similarity coefficient, nxy the number of fragments shared between two samples (x,y), and nx and ny are the number of fragments of sample x and y, respectively. PAUP* was used to construct a NJ tree of the Nei-Li distance matrix (with B. hamatipes used for rooting) and bootstrap analysis was performed using 10000 replicates. In addition, a PCO (principal coordinates analysis) was performed on the 0/1 matrix using Euclidian distances and PCO scores of all AFLP phenotypes were plotted in two dimensions using the PAST software package (version 1.40; Hammer et al., 2001). 32 Material and Methods 2.5.4 Partition homogeneity test The partition homogeneity test (Farris et al., 1994), implemented in PAUP*, is commonly used to test whether two different molecular datasets of the same set of taxa contain a similar phylogenetic information or not. First, the programme calculates the most parsimonious tree for each dataset (partition) and adds up the number of steps for each tree (original tree). Then, the two datasets are intermixed randomly and the sum of the steps of the most parsimonious tree for each partition is calculated again. The latter (randomization) step is carried out up to 500 times. As a result, these randomizations and calculations provide a distribution of the number of steps for trees as expected under the null hypothesis (data homogeneity). Now, the step number of the original tree is compared to the distribution to find out if this value falls within a one-tailed 5% rejection region or not. Thus, if less than 5% (P < 0.05) of the randomized trees have as many or fewer steps than the original tree, then the phylogenetic signal of the two different molecular marker datasets is significantly different and the datasets should not be combined (Felsenstein, 2004). In the present study, the partition homogeneity test was performed for the two cpDNA data sets (trnH-psbA; trnD-trnE), for ITS and trnH-psbA, for ITS and trnD-trnE, for ITS and cpDNA data combined (AD) and for ITS and the AFLP data. 2.6. Morphological analysis All specimens used in the morphological (multivariate-morphometric) analysis are presently cultivated in the glasshouse of the Botanical Garden Salzburg. For each plant, in general, a few flowers (depending on how many were available), at least two pseudobulbs and at least one leaf were conserved in “Kew solution” (53 % ethanol, 5 % formaldehyde and 5 % glycerol). For some plants, however, only flowers were available. Conversely, for some plants which did not flower during the time of study only vegetative characters could be measured. Furthermore, photographs were taken of all flowering plants measured. Most accessions used in the molecular analyses were included in the morphological study, with few exceptions (because only silica-gel dried 33 Material and Methods leaves were available). Almost all flower characters selected for analysis were kindly suggested by Dr. J. J. Vermeulen (personal communication). The remaining floral and vegetative traits were chosen by the author given, at least in part, their likely taxonomic relevance. The initial character matrix was constructed from 25 floral characters (including 4 categorical ones and 5 ratios) plus 10 vegetative characters (including one categorical trait and two ratios; see Table 2.5). Measurements were made with a ruler and slide gauge. The floral measurements were mostly made on one flower, one pseudobulb and one leaf (measures of more than one flower, pseudobulb or leaf were averaged). Vegetative characters of 76 accessions could be measured, and both vegetative and floral measurements were collected from 53 accessions. Although 17 plants of the latter set could not be scored for all characters (typically PLE - RAC characters were lacking), the 53 accessions representing all identified (sub)clades of the complex, except clade A, and all species of the B. lobbii complex (except B. smitinandii) plus several outgroup species. Prior to the multivariate analysis (see below), all quantitative characters measured were tested for normal distribution using both ShapiroWilk test and χ2 test as implemented in PAST. Those traits deviating from the normality assumption were either log-transformed or arcsine transformed (only ratios) before analysis. For two deviating ratios (RAL, RAC), which could not be arcsine transformed (i.e. with values larger than one), no transformation was conducted. Finally, 24 characters (17 floral plus 7 vegetative ones) were used for analysis. Morphological variation within and among taxa/clades was assessed using multivariate morphometric methods (principal component analysis (PCA)) based on the trait correlation matrix as implemented in the PAST programme package. 34 Material and Methods Table 2.5: Characters used for morphometric analysis. Morphological characters Code floral 1. Peduncle length (mm) PLE 2. Number of peduncle bracts (units) NPB 3. Length of the longest peduncle bract (mm) LPB 4. Distance between inflorescence - upper peduncle bract (mm) PPB 5. Length of floral bract (mm) LFB 6. Length of basal internode (mm) LBI 7. Length of median sepal (mm) LMS 8. Width of median sepal (mm) WMS 9. Mean length of lateral sepals (mm) LLS 10. Mean width of lateral sepals (mm) WLS 11. Mean length of petals (mm) LEP 12. Mean width of petals (mm) MWP 13. Length of lip (mm) LOL 14. Width of lip (mm) WOL 15. Length of column (m) LOC 16. Width of column (mm) WOC 17. Nectar mark (present (1) vs. absent (0)) NEM 18. Blooming time (January (1) to December (12)) BLT 19. Flower color (yellow (0) vs. red (1)) FLC 20. Scent (foul (0) vs. pleasant (1)) SCE 21. Ratio median sepal (width/length) RMS 22. Ratio lateral sepals (width/length) RLS 23. Ratio petals (width/length) RAP 24. Ratio lip (width/length) RAL 25. Ratio column (width/length) RAC vegetative 26. Height of pseudobulbs (mm) HOP 27. Length of next to last pseudobulb (mm) LOP 28. Width of next to last pseudobulb (mm) WOP 29. Length of leaf of next to last pseudobulb (mm) LLF 30. Width of leaf of next to last pseudobulb (mm) WLF 31. Surface of pseudobulbs (plain (0) vs. rough (1)) SPB 32. Distance between last and next to last pseudobulb (mm) ADP 33. Length of rhizome segment (mm) LRS 34. Mean ratio pseudobulbs [(length/width1+length/width2)/2] RPB 35. Ratio leaves (length/width) RLE 35 Material and Methods 2.7 Documentation All DNA sequences obtained in this study will be deposited in GenBank. Complete ITS, trnH-psbA and trnD-trnE data matrices are available electronically on request from the author. Herbarium specimens were only prepared if enough Kew-conserved samples were in stock. The vouchers of the plants (herbarium specimens and/or in “Kew solution”) are deposited either at the University of Salzburg, Austria (analysed fresh material) or at the University of Leiden, The Netherlands (silica-gel dried samples). 36 Results 3. Results 3.1 Molecular analyses 3.1.1 Partition homogeneity test According to the various partition homogeneity tests conducted (Table 3.1), the ITS dataset could not be combined with any of the cpDNA datasets (Pvalues from 0.002 to 0.004). Despite a low P-value of 0.036 for the AD dataset (trnH-psbA and trnE-trnD combined), indicating a marginally significant difference in phylogenetic signal, phylogenetic analyses were performed with both cpDNA datasets combined, which might be justifiable because the cpDNA genome essentially behaves as a single (nonrecombining) locus. By contrast, the ITS and AFLP datasets could be analysed together because of a P-value of 0.552. Table 3.1: Results of the partition homogeneity tests. Combined datasets P-values* ITS/trnH-psbA 0.002 ITS/trnD-trnE 0.004 ITS/trnD-trnE-trnH-psbA 0.002 trnD-trnE/trnH-psbA 0.036 ITS/AFLP 0.552 * Significance level 0.05 3.1.2 Phylogenetic analyses of ITS sequences Characteristics and variation of the ITS sequences (ITS-1, 5.8S rDNA, ITS-2) are summarized in Tables 3.2, 3.3 and 3.4. The ITS-1 region within the B. lobbii complex varied from 327 to 331 bp in length and, thus, was much longer than both, the 5.8S rDNA region and the ITS-2 region, which varied from 159 to 162 bp and from 156 to 157 bp, respectively. The fully aligned ITS-region consisted of 646 positions and included 8 gaps. Four gaps were found in ITS-1, two in the 5.8S rDNA and two in the ITS-2 region. Including the outgroup accessions into the alignment, the total number of gaps increased to 9 due to an additional gap in the ITS-2 region. The number of parsimony-informative sites within the B. lobbii complex were 41 (ITS-1 = 11; 5.8S rDNA = 12; ITS-2 = 18) of 60 variable sites altogether. Of the remaining 37 Results 19 positions, which were singleton sites, 13 were found in the ITS-1, four in 5.8S rDNA and two in the ITS-2 region. When the accessions of the outgroup were taken into account, 24 sites (of 49 variable sites) were potentially parsimony-informative in ITS-1, 14 (of 20 variable sites) in the 5.8S gene and 23 (of 26 variable sites) in ITS-2, i.e. in total 61 (of 95 variable sites). Since many intraspecific accessions of the B. lobbii complex had identical ITS sequences, 17 redundant sequences were pruned before analysing pairwise nucleotide sequence differences (Table 3.2). Within the B. lobbii complex the pairwise sequence difference of the whole ITS region ranged from 0.2 to 2.9 % with a mean value of 1.4 %. Between the B. lobbii complex and the outgroup, the divergence value of pairwise comparisions ranged from 1.4 to 4.9 % (mean value 2.5 %), among which the distances to B. patens were the lowest, with values ranging from 1.4 to 3.2 % (mean value 1.9 %), and those to B. alsiosum the highest, with values ranging from 3.9 to 4.9 % (mean value 4.4 %). As two distinct clades were identified within the outgroup, hereafter called outgroup 1 (B. emiliorum and close relatives) and outgroup 2 (B. alsiosum and B. hamatipes), pairwise sequence differences between the complex and these outgroups were also calculated separately (see Table 3.2). Table 3.2: Characteristics and variation of the ITS nrDNA region in the Bulbophyllum lobbii complex and taking into account more closely and distantly related (outgroup) accessions (outgroup 1 and 2, respectively). Genetic distances were calculated using the Kimura-2 algorithm. Taxa/sequence characteristics ITS-1 5.8S rDNA ITS-2 Total region Length of range (bp) 327 - 331 159 - 162 156 - 157 642 - 646 Number of gaps 4 2 2 8 GC content (mean %) 57 62.6 55.2 57.9 Ratio of transitions/transversions 6.7 2.2 1.3 2.3 Constant sites* 305 143 137 585 Variable sites* 24 16 20 60 Parsimony-informative sites 11 12 18 41 Singleton sites 13 4 2 19 Length of range (bp) 326 - 331 159 - 162 153 - 157 641 - 646 Number of gaps 4 2 3 9 Within B. lobbii complex B. lobbii + outgroups (aligned) 38 Results GC content (mean %) 56.9 62.7 55.2 57.9 Ratio of transitions/transversions 5.4 2.3 1.5 2.6 Constant sites* 282 140 131 553 Variable sites* 49 20 26 95 Parsimony-informative sites 24 14 23 61 Singleton sites 25 6 3 34 Mean percentage pairwise sequence divergence (range)** Within B. lobbii 0.9 (0.0 - 2.2) 1.3 (0.0 - 2.6) 2.5 (0.0 - 4.1) 1.4 (0.2 - 2.9) Between B. lobbii + outgroup 1 2.4 (0.3 - 4.5) 1.5 (0.6 - 3.2) 3.7 (2 - 5.5) Between B. lobbii + outgroup 2 5 (2.8 - 5.8) 2.5 (1.4 - 4.7) 2.2 (1.3 -3.2) 4.7 (2.7 - 7.1) 4.2 (3.7 - 4.9) Between B.lobbii + both outgroups 3.2 (0.3 - 5.8) 1.7 (0.6 - 3.2) 3.9 (2 - 7.1) 2.5 (1.4 - 4.9) *Calculations were made after considering gaps as missing data **Multiple intraspecific accessions with identical sequences were excluded from calculations Between the major ITS clades identified within the B. lobbii complex (see below, Figs. 3.1 and 3.2) the mean divergence value of pairwise comparisions ranged from 1.4 % (between clades E and D) to 2.7 % (between clades A and B; Table 3.3). The highest mean percentage divergence was found within clade A with a value of 1.4 %. The mean percentage divergence between the various clades within the B. lobbii complex and outgroup1 (B. emiliorum and close relatives) varied from 2.1 to 3.2 %, and with respect to outgroup 2 (B. alsiosum and B. hamatipes) from 3.8 to 4.3 % (Table 3.3). Table 3.3: Mean percentage pairwise ITS sequence divergence (SE) between and within clades. CladeA CladeB CladeC CladeD CladeE Outgroup1 Outgroup2 Both outgroups CladeA 1.4 (0.4) CladeB 2.7 (0.6) 0.2 (0.1) CladeC 2.3 (0.5) 2.1 (0.5) 0.6 (0.2) CladeD 2.3 (0.5) 1.5 (0.5) 1.2 (0.4) 0.2 (0.1) CladeE 2.5 (0.5) 1.9 (0.5) 1.6 (0.4) 1.4 (0.4) 0.9 (0.2) Outgroup1 3.2 (0.6) 2.8 (0.6) 2.2 (0.5) 2.1 (0.4) 2.4 (0.5) 1.4 (0.3) Outgroup2 4.3 (0.8) 4.3 (0.8) 4.1 (0.7) 3.8 (0.7) 4.3 (0.7) 3.8 (0.7) 1.2 (0.3) - - Both outgroups 3.5 (0.6) 3.2 (0.6) 2.8 (0.5) 2.5 (0.4) 3.0 (0.5) 2.5 (0.4) Within the species-rich clade E, among-subclade sequence divergence ranged from 0.7 % (between subclades E3 and E1) to 1.4 % (between 39 Results subclades E4 and E2), and the highest within-subclade divergence was observed within subclade E2 with 0.8 % (Table 3.4). Table 3.4: Mean percentage pairwise sequence divergence (SE) between and within the subclades of clade E. SubcladeE1 SubcladeE2 SubcladeE3 SubcladeE4 SubcladeE1 0.2 (0.1) SubcladeE2 1.0 (0.3) 0.8 (0.2) SubcladeE3 0.7 (0.3) 0.9 (0.3) 0.3 (0.1) SubcladeE4 1.2 (0.4) 1.4 (0.4) 1.2 (0.4) 0.5 (0.2) The maximum parsimony (MP) analysis of the whole 646 character matrix (B. lobbii complex plus outgroups; 65 accessions) with gaps scored as missing data resulted in 10000 equally parsimonious trees (Maxtrees = 10000) of 151 steps with a consistency index (CI) of 0.695 (excluding uninformative characters) and a retention index (RI) of 0.856 (Table 3.5). One of the most parsimonious trees with the highest -log L value (settings in PAUP*: tree scores – maximum likelihood; 1893.78315) is shown in Figure 3.1. Table 3.5: Results of the maximum parsimony analyses. TL = treelength in steps; N = number of shortest trees; CI = consistency index; RI = retention index; HI = homoplasy index. Maximum parsimony analysis Marker TL N CI RI HI ITS 151 10000 0.695 0.856 0.305 trnH-psbA 41 10000 0.854 0.765 0.146 trnD-trnE 31 11 0.968 0.976 0.032 trnH-psbA/trnD-trnE 81 10000 0.704 0.780 0.296 40 Results Fig. 3.1: ITS MP tree of the B. lobbii complex and 12 extra-complex individuals (marked by asterisks). Within the complex five major clades (A-E) are identified, with clade E mainly comprising four subclades (E1-E4). The tree shown had the highest -logL score 41 Results (1893.78315) and was rooted by B. hamatipes. Numbers above branches indicate MP bootstrap values (> 50 %) from 100 replicates (heuristic search, 10 random sequence additions). Accession numbers (in brackets) are identified in Table 7.1. AF521074 is a B. lobbii ITS sequence downloaded from GenBank. Note that B. facetum, B. coweniorum and B. sumatranum (marked red) have red flowers. The ML-distance analysis (based on the TIM+I+G model) resulted in a tree, which was topologically most similar to the MP tree (Fig. 3.1), but had almost always lower bootstrap support values for both the monophyly of the B. lobbii complex and its various (sub)clades (not shown). Maximum likelihood (ML) searches under the best fit model (TIM+I+G), and without a molecular clock enforced, resulted in a single tree with a log L of -1902.6852 (Fig. 3.2). The topology of this tree is almost identical with that of the MP tree (Fig. 3.1). One hundred equally likely ML trees (setting MAXTREES = 100), each with a log L of –1868.7782, were obtained after the search with a molecular clock enforced. One of the clockenforced trees is shown in Figure 3.3, with ML bootstrap values shown above branches. Rate constancy of ITS sequence evolution was confirmed after comparing the log L scores of the ML clock enforced/non-clock trees (2Δ = χ2 = 67.814, P-value = 0.317; Table 3.6). Table 3.6: Results of the maximum likelihood analyses. M = used model according to Modeltest; γ = gamma distribution (shape parameter); SWC = -log L score with a molecular clock enforced; SWOC = -log L score without a molecular clock enforced; R = ratio (2 x difference); P = P-value. Maximum likelihood analysis M Γ ITS TIM+I+G 0.9705 trnH-psbA F81+I+G 1.0135 - trnD-trnE TIM equal rates for all sites 1.1206 Marker trnH-psbA/trnD-trnE GTR+I+G SWC SWOC R P 67.814 0.317 1521.1619 - - - 801.7705 - - - 2413.305 - - 1868.7782 1902.6852 Both the MP and the non-clock ML tree (Figs. 3.1, 3.2) strongly supported the monophyly of the B. lobbii complex (BV MP = 90 %; ML = 100 %), which was sister to outgroup 1 (MP = 91 %; ML = 90 %), comprising B. affine, B. emiliorum, B. patens, and B. pileatum. Surprisingly, two outgroup accessions (B. piestoglossum, B. monanthum) were found within the B. lobbii complex: 42 Results B. piestoglossum clustered together with B. coweniorum and formed a well supported clade, C (MP = 100 %; ML = 100 %), whereas B. monanthum clustered together with B. polystictum and B. lobbii (plus AF521074) in subclade E1, which is weakly supported by the ML analysis only (ML = 70 %). Interestingly, all three accessions of B. lobbii from Sulawesi formed a strongly supported clade, A (MP/ML = 100 %). Furthermore, two clades within the complex, each containing accessions of just one species, were well supported: clade D of B. facetum sampled from Luzon/Philippines (MP = 100 %; ML = 80 %) and clade B of B. microglossum with accessions originating from the Cameron Highlands (Penang/Peninsula Malaysia; MP/ML = 100 %). The species-rich clade E, and also three of its four subclades (E1, E2, E3), were not supported (MP/ML < 50 %), whereas subclade E4, containing B. sumatranum and various accessions of B. lobbii from the Cameron Highlands/Peninsula Malaysia, Sabah/Borneo, Palawan/Philippines and Sumatra received strong support, at least, by the MP analysis (MP = 88 %). Notably, there were also B. lobbii accessions present in clade E (all subclades except E2) as well as in clade A (see above), suggesting that “B. lobbii” is a highly poly-/or paraphyletic taxon and/or conferring a wrong taxonomy (see Discussion). Otherwise, almost all intraspecific accessions of the complex clustered together, to the exception of those of B. polystictum, which nonetheless grouped in the same subclade (E1). 43 Results Fig. 3.2: ITS ML tree of the B. lobbii complex and 12 extra-complex individuals of the same section (marked by asterisks). The tree was rooted by B.hamatipes. Numbers above branches indicate ML bootstrap values (> 50 %) from 100 replicates (heuristic search, 10 random sequence additions). Accession numbers (in brackets) are identified in Table 7.1. 44 Results AF521074 is a B. lobbii ITS sequence downloaded from GenBank. Note that B. facetum, B. coweniorum and B. sumatranum (marked red) have red flowers. In the ML clock tree (Fig. 3.3) the monophyly of the B. lobbii complex was less supported (BV 70 %), but all other major clades within the complex were at least equally supported as in the ML non-clock tree. However, subclades E2 and E4 received only weak support (BV 70 and 60 %, respectively). Importantly, clade E was well supported by a bootstrap value of 80 %. After confirming rate-constancy of ITS sequence evolution (see above), times of divergence were first inferred from a biogeographically calibrated ITS mutation rate for Bulbophyllum (see Material and Methods, 2.5.1). Accordingly, the origin of the B. lobbii complex (node A in Fig. 3.3) was dated to approximately 10.8 million years ago (Mya), and the onset of first diversification (node B) to about 8.6 Mya. At this latter time, three lineages arose that gave rise to clades A, B and a third lineage, the latter of which then further diversified into clades C, D and E about 6.9 Mya (onset of second diversification; node C). While clades A, B, C, and D consist of only one to two species and are distributed in restricted areas (A: Sulawesi; B: Cameron Highlands/Peninsula Malaysia; C and D: Luzon/Philippines), clade E started diversifying about 4.5 My ago (onset of third diversification; node D), and thereby became very species-rich (seven of the 11 current species) and widespread (Luzon, Mindanao, Palawan, Borneo, Sumatra, Bali, Peninsula Malaysia, Thailand and Myanmar). Using the three alternative substitution rates (Richardson et al., 2001), the origin of the B. lobbii complex (node A) was approximately 1.8 Mya (fast clock), 3.6 Mya (moderate clock) and 8.2 Mya (slow clock), respectively. The age of node B (onset of first diversification) ranged from 1.4 to 1.6 Mya, of node C (onset of second diversification) from 1.1 to 5.2 Mya and of node D (onset of third diversification) from 0.7 to 3.4 Mya. However, regardless of which clock was used, the origin of well recognized species within clade E (i.e. B. dearei, B. sumatranum, B. smitinandii, B. orectopetalum, B.siamense, B. cameronense, B. polystictum) likely took place at the Plio-/Pleistocene boundary or well within the Pleistocene. Furthermore, all clocks, except the fast one, showed that certain geographically restricted lineages arose with high probability in pre45 Results Pleistocene times such as B. microglossum/Cameron Highlands (clade B), B. lobbii/Sulawesi (clade A), B. facetum/Luzon (clade D), and probably also B. coweniorum/Luzon (clade C). Fig. 3.3: Clock constrained maximum likelihood (ML) tree for the B. lobbii complex and outgroups based on ITS sequences and estimated under the TIM+I+G model of sequence 46 Results evolution. The tree was rooted by B. hamatipes (1). Numbers above branches indicate ML bootstrap values (> 50 %) from 100 replicates (heuristic search, 10 random sequence additions). Bullets and letters (A-D) indicate relevant branching events (nodes). The scales represent the time scale in Mya under four different ITS substitution rates (see text). Accession numbers (in brackets) are identified in Table 7.1. Locations of the accessions are also provided. Note that B. facetum, B. coweniorum and B. sumatranum (marked red) have red flowers. 3.1.3 Lineages-through-time (LTT) plot of ITS data The LTT plot (Fig. 3.4) was generated using the node height information of the clock enforced ML tree (Fig. 3.3), with a focus on the diversification of the B. lobbii complex. The nodes of all lineages (as close as a genetic distance of 0.0005 to the tip of the tree) were taken into account. The nodes of accessions coinciding with the tip were not included because this would lead to a strong increase in the number of lineages towards the present and, thus, would falsely suggest a recent rapid increase in lineage number, albeit without diversification. According to the gammastatistic test of Pybus and Harvey (2000) the diversification of the complex as reconstructed above is compatible with a pure birth model (with birth > 0, and death = 0) or a constant rates birth-death model (with birth > 0, and death > 0) as the γ-value was -0.805 and, thus, well within the 95 % acceptance range of the test statistic (-1.96 < γ < 1.96 for pure birth; -1.645 < γ for constant rates birthdeath). The coloured dots (see also coloured nodes in clock enforced ML tree) show the relative time (in terms of genetic distance) of the origin node of the B. lobbii complex (at 0.01613, red dot) and of its three major nodes of diversification (first onset at 0.01120, orange dot; second onset at 0.00898, green dot; third onset at 0.00587, yellow dot), as measured from the tip of the tree. 47 Results LTT-plot of B. lobbii lineages 10 Number of lineages 100 1 0,018 0,016 0,014 0,012 0,01 0,008 0,006 0,004 0,002 0 Genetic Distance Fig. 3.4: Lineages-through-time (LTT) plot of all B. lobbii lineages (based on genetic distances > 0.0005) surveyed for ITS variation. The y-axis is the logarithm of the cumulative number of lineages and the x-axis represents the genetic distance of relevant nodes from the tip of a clock constrained phylogenetic (ITS) tree calculated under ML (see Fig. 3.3). Red dot = origin of the B. lobbii complex; orange dot = onset of 1st diversification; green dot = onset of 2nd diversification; yellow dot = onset of 3rd diversification. Note that coloured dots correspond to coloured nodes in the clock enforced ML tree (Fig. 3.3). 3.1.4 Phylogenetic analyses of cpDNA sequences Characteristics and variation of both the trnH-psbA and the trnD-trnE sequences (and their combined alignment) in the B. lobbii complex (32, 31 and 31 accessions, respectively) and outgroup accessions (B. emiliorum, B. affine and B. piestoglossum) are summarized in Table 3.7. Within the B. lobbii complex the length of the trnH-psbA region varied from 797 to 894 bp and that of the trnD-trnE region from 361 to 426 bp. Six gaps were found within trnH-psbA and 16 within trnD-trnE. Combinig the two regions (for all in total 31 B. lobbii accessions), their length varied from 1148 to 1174 bp and 12 gaps were found. Taking the outgroup accessions into the alignment, the number of gaps increased to 17, but only for the combined trnH-psbA+trnDtrnE (AD) region (35 accessions). For the ingroup, only 7 parsimonyinformative sites were found within trnH-psbA (of 32 variable sites), 10 within trnD-trnE (of 24 variable sites) and 25 within AD (of 51 variable sites). When 48 Results the accessions of the outgroup were taken into account, 17 sites (of 34 variable sites) were potentially parsimony-informative in trnH-psbA, 14 (of 30 variable sites) in trnD-trnE, and 31 (of 58 variable sites) in AD. As for the ITS dataset, all intraspecifically redundant cpDNA sequences were pruned for the calculation of pairwise nucleotide sequence differences. Within the whole dataset (in- and outgroup accessions) the pairwise sequence difference of the AD region ranged from 0.0 to 1.7 % with a mean value of 0.7 %, that of the trnH-psbA region from 0.1 to 0.8 % (mean value 0.7 %) and that of the trnD-trnE region from 0.0 to 2.9 % (mean value 1.0 %). Table 3.7: Characteristics and variation of the cpDNA sequences in the Bulbophyllum lobbii complex and taking into account 4 to 5 outgroup accessions (B. emiliorum (1), B. affine (1), B. affine (2), B. piestoglossum (1); plus B. affine (3) indicated with a and b, respectively). Genetic distances were calculated using the Kimura-2 algorithm. trnH-psbAa trnE-trnDb Combineda Length of range (bp) 797 - 894 361 - 426 1148 - 1174 Number of gaps 6 16 12 GC content (mean %) 35.5 36.7 35.4 Ratio of transitions/transversions 0.7 0.6 0.8 Constant sites* 772 399 1117 Variable sites* 32 29 51 Parsimony-informative sites 7 10 25 Singleton sites 25 19 26 Length of range (bp) 797 - 894 358 - 426 1096 - 1188 Number of gaps 6 16 17 GC content (mean %) 35.5 36.7 35.4 Ratio of transitions/transversions 0.7 0.6 0.8 Constant sites* 765 398 1110 Variable sites* 34 30 58 Parsimony-informative sites 17 14 31 Singleton sites 17 16 27 Taxa/sequence characteristics Within the B. lobbii complex B. lobbii + outgroups (aligned) Mean percentage pairwise sequence divergence (range)** Whole dataset 0.7 (0.1 - 1.8) 1.0 (0.0 - 2.9) 0.7 (0.0 - 1.7) Within B. lobbii 0.4 (0.0 - 1.4) 0.7 (0.0 - 2.9) 0.6 (0.0 - 1.5) Between B. lobbii + outgroup 1.0 (0.0 - 1.8) 0.8 (0.0 - 2.9) 1.1 (0.2 - 1.7) *Calculations were made after considering gaps as missing data 49 Results **Multiple intraspecific accessions with identical sequences were excluded from calculations As summarized in Table 3.5 the analysis of the trnH-psbA matrix (908 characters) resulted in 10000 equally parsimonious trees (Maxtrees = 10000) of 41 steps with a CI of 0.854 and a RI of 0.765. The data matrix of the trnDtrnE region consisted of 449 characters, and 11 equally parsimonious trees of 31 steps were found (CI = 0.968 ; RI = 0.976). Finally, for the 1287 character matrix of the combined dataset (AD) the MP search resulted in 10000 equally parsimonious trees (MAXTREES = 10000) of 81 steps with a CI of 0.704 and a RI of 0.780. The heuristic ML searches under the best fit sequence evolution models (Table 3.6), recovered a single tree (log L = 1521.16194) for the trnH-psbA dataset, a single tree (log L = -801.77052) for the trnD-trnE dataset and a single tree (log L = -2413.30496) for the AD dataset. The resolution of all MP- and ML trees of the various datasets was very poor, and this also holds true for the respective NJ-ML distance trees (not shown). Despite the partition homogeneity test result, which indicates marginal significance for the AD dataset (Table 3.1), only the results of this combined dataset are described and discussed below. The ML trees of the trnH-psbA (Fig. 3.5) and trnD-trnE (Fig. 3.6) datasets are nonetheless shown, and should only give insight into the different tree topologies recovered by the two cpDNA regions (analysed separately). 50 Results Fig. 3.5: ML tree of 36 accessions of the B. lobbii complex and four extra-complex individuals (marked by asterisks) obtained from the trnH-psbA cpDNA dataset. The tree was rooted with B. emiliorum. Numbers above branches indicate ML-, and below branches MP- bootstrap values (> 50 %) from 100 replicates (heuristic search, 10 random sequence additions). B. monanthum was not analysed because no material of this species was available at the time of the cpDNA study. Accession numbers (in brackets) are identified in Table 7.1. 51 Results Fig. 3.6: ML tree from 36 accessions of the B. lobbii complex and five extra-complex individuals (marked by asterisks) obtained from the trnD-trnE dataset. The tree was rooted with B. emiliorum. Numbers above branches indicate ML-, and below branches MPbootstrap values (> 50 %) from 100 replicates (heuristic search, 10 random sequence additions). B. monanthum was not analysed because no material of this species was available at the time of the cpDNA study. Accession numbers (in brackets) are identified in Table 7.1. 52 Results The ML tree of the combined dataset is shown in Figure 3.7. While B. affine (1) was found grouping together with B. lobbii (11) within a cluster comprising four B. dearei accessions (1, 2, 4, 5) plus B. lobbii (1) and B. microglossum (BV ML/MP < 50 %), and thus within the ingroup, which is supported by 100 % MP and ML bootstrap values, B. affine (2) clustered together with B. dearei (3) near the root (MP = 63 %) and therefore close to B. emiliorum, which was taken as outgroup (only this accession was taken for rooting the tree). Otherwise, the two accessions of B. coweniorum formed an ingroup-clade, which was supported by 92 % MP and 90 % ML BV, respectively, though without showing close affinities to B. piestoglossum (compare e.g. ITS clock tree in Fig. 3.3). Nonetheless the latter species, again, turned out as a member of the ingroup. One clade including five B. lobbii accessions (2, 3, 5, 6, 12; MP = 58 %; ML = 70 %) was identified, a topology, however, which is not congruent with the ITS dataset. Unfortunately B. monanthum was not included in any of the cpDNA analyses, because no material of this species was available at the time of the cpDNA study. 53 Results Fig. 3.7: Combined cpDNA ML tree from 35 accessions of the B. lobbii complex and four extra-complex individuals (marked by asterisks). The tree was rooted by B. emiliorum. Numbers above branches indicate ML-, and below branches MP-bootstrap values (> 50 %) from 100 replicates (heuristic search, 10 random sequence additions). B. monanthum was not analysed because no material of this species was available at the time of the cpDNA study. Accession numbers (in brackets) are identified in Table 7.1. 54 Results In summary, in all three trees B. affine (1) was found within the ingroup, the two B. coweniorum accessions formed a well supported clade, B. dearei (3) and B. affine (2) clustered together close to B. emiliorum (1) and the B. lobbii accessions (2, 3, 5, 6, 12) formed also a group which was more or less supported. 3.1.5 AFLP analyses A total number of 259 fragments were generated using the three primer combinations EcoRI ATC (6-FAM)-MseI CTA, EcoRI AGG (VIC)-MseI CTG, and EcoRI AAC (NED)-MseI CTG with 124, 78, 57 fragments per combination, respectively (average 86.3; SD 34.3). 252 of these 259 markers were polymorphic across the whole dataset of 93 accessions, and 7 markers (2.7 %) were monomorphic. All 93 individuals surveyed were characterized by a different AFLP profile. However, three accessions (B. alsiosum (1), B. pileatum (1) and B. lobbii (21)) had to be subsequently removed from the dataset because of far too long branches in a preliminary NJ tree topology, likely reflecting methodological artefacts. The resulting NJ tree, which consists of 90 distinct phenotypes, is shown in Figure 3.8. Although more accessions were analyzed for the AFLP fingerprints than for ITS sequencing, the delimitation of clades in the AFLP tree was largely congruent with that recovered by the ITS data. However, the monophyly of the B. lobbii complex was not supported, and also the relationships among the AFLP clades remaind unresolved. Nevertheless, the bootstrap values of clades A, B, C, D and E1 were similar to those of the corresponding clades in the ITS tree (BV 96 %, 97 %, 98 %, 100 % and 71 %, respectively). There was no support, however, for (sub)clades E, E2, E3 and E4. In contrast to the ITS tree topology, clade D formed a subclade of E, and subclade E2 was no longer member of clade E, but formed an independent, but not supported clade. The two extra-complex species B. monanthum (1) and B. piestoglossum (1), which in the ITS tree surprisingly were found within the B. lobbii complex (in clade E1 and C, respectively), were now placed together with B. smitinandii (1) in a basal position of the AFLP tree (Fig. 3.8). Moreover, B. lobbii (12) clustered in clade E1 (rather than E4), and B. lobbii (33) in E2 (rather than E3). All B. affine accessions (1, 55 Results 2, 3) grouped together (at the base) and B. dearei (3) clustered within the B. lobbii complex, next to conspecific accessions (within E3, similar to ITS). These two observations stand in marked contrast to the combined cpDNA tree topology (Fig. 3.7). The principal co-ordinates (PCO) analyses of squared Euclidian distances between 90 AFLP phenotypes of the B. lobbii complex (80 accessions) plus outgroups (10; Fig. 3.9 and 3.10) largely supported the clades suggested by the NJ-tree (Fig. 3.8). The accessions of clades A, B, C, D, E2 and E3 formed more or less distinctive groups in the two-dimensional plot of coordinates 1 vs. 2 (Fig. 3.9), while the distinct grouping of clades E1 and E4 became evident after plotting coordinates 2 vs. 3 (Fig. 3.10). 56 Results Fig 3.8: Relationships among 80 individuals of the B. lobbii complex and 10 extra-complex individuals of the same section (Sestochilos; marked by small asterisks) based on NJ analysis of AFLP variation and Nei & Li (1979) genetic distances. The tree was rooted by B. hamatipes (1). Numbers above branches indicate bootstrap values (> 50 %) from 10000 replicates. Accession numbers (in brackets) are identified in Table 7.1. The big asterisks indicate accessions whose position in the AFLP tree conflicts with their position in the ITS 57 Results trees (Figs. 3.1-3). Sampling localities of the B. lobbii and B. dearei accessions are added after the species name. The localities of all other species/accessions largely correspond to their distribution area, except for B. orectopetalum and B. siamense (accessions only available from Thailand and Myanmar, respectively). The overall distribution of the clades is indicated in the right-hand panel. Note that B. facetum, B. coweniorum and B. sumatranum (marked red) have red flowers. 0,3 0,2 Coordinate 2 0,1 0 -0,1 -0,2 -0,2 -0,1 0 Coordinate 1 0,1 0,2 0,3 Fig. 3.9: PCO analysis of 90 AFLP phenotypes of the B. lobbii complex (80 accessions) and outgroups (10), with the separation of most clades achieved by plotting coordinates 1 vs. 2. Turquoise triangles = clade A; violet circles = clade B; light green diamonds = clade C; green crosses = clade D; red crosses = clade E1; blue squares = clade E2; dark blue stars = clade E3; pink squares = clade E4; black dots = outgroups (1 + 2); olive oval = B. monanthum; dark brown bar = B. piestoglossum; light brown line = B. smitinandii. 58 Results 0,2 0,1 Coordinate 3 0 -0,1 -0,2 -0,2 -0,1 0 Coordinate 2 0,1 0,2 0,3 Fig. 3.9: PCO of 90 AFLP phenotypes of the B. lobbii complex (80 accessions) and outgroups (10), with the separation of especially clades E1 and E4 achieved by plotting coordinates 2 vs. 3. Turquoise triangles = clade A; violet circles = clade B; light green diamonds = clade C; green crosses = clade D; red crosses = clade E1; blue squares = clade E2; dark blue stars = clade E3; pink squares = clade E4; black dots = outgroups (1 + 2); olive oval = B. monanthum; dark brown bar = B. piestoglossum; light brown line = B. smitinandii. 3.1.6 Geographical distribution of AFLP clades/species The distribution and species composition of the various clades recovered in the AFLP survey is summarized in Table 3.8 and graphically shown in Figure 3.11. Inferred distribution ranges, where species are known to occur but which were not sampled are also considered and marked by asterisks. All species assembled in clade A were B. lobbii from Sulawesi. The distribution of clade B, in which only B. microglossum was found, is restricted to the Cameron Highlands (Peninsula Malaysia). Clades C and D consisted of B. coweniorum and B. facetum, respectively, and all occur in Luzon (Philippines). B. coweniorum, however, is also reported from Laos* (Vermeulen & O’Byrne, 2003), but unfortunately no accession from there was 59 Results available for the present analyses. Clade E is widespread over the whole region. Subclade E1, comprised of B. polystictum and numerous B. lobbii accessions (2, 3, 5, 6, 12, 18, 20, 22, 23, 24, 25, 27, 30), is distributed in Bali (B. lobbii (5, 18, 23)), probably Java* (no accession available), Sumatra (B. lobbii (12)), the Cameron Highlands/Peninsula Malaysia (B. polystictum, B. lobbii (22, 25)), Gunung Ledang/Peninsula Malaysia (B. lobbii (27)), Borneo (B. lobbii (3)) and Luzon (B. lobbii (2)). Subclade E2 contained B. cameronense, B. orectopetalum, B. siamense and a single B. lobbii (33) individual, whereby B. cameronense is likely sister to the latter three. This clade is found in Assam, Myanmar and Thailand (B. orectopetalum and B. siamense; note that B. siamense from Assam/Thailand was not available, and that B. orectopetalum was not sampled in Assam/Myanmar; compare Table 1.3), Cameron Highlands/Peninsula Malaysia (B. cameronense) and Luzon (B. lobbii (33)). Clade E3 (without the nested clade D), which consisted of B. dearei and B. lobbii (1, 4, 10, 11), occurs on Tioman Island/Peninsula Malaysia (B.dearei (3, 9)), Sumatra (B. lobbii (4)), Sarawak/Borneo (B. dearei (4, 14) and B. lobbii (10, 11)), Mindanao/Philippines (B. dearei (1, 2, 6, 7, 8, 11, 12, 13)) and Luzon (B. lobbii (1)). B. sumatranum and B. lobbii (7, 8, 13, 14, 16, 19, 26, 28, 29) belonged to clade E4, which is distributed in the Cameron Highlands/Peninsula Malaysia (B. lobbii (8, 19)), Sabah/Borneo (B. lobbii (13, 14), Kalimantan/Borneo (B. lobbii (26)) Palawan/Philippines (B. lobbii (B. lobbii (7)) and Sumatra (only B. sumatranum and B. lobbii (28)). In summary, seven to nine more or less distinct genetic units/taxa are recognizable that show restricted distribution ranges (see also Table 3.8). Four of those units correspond to clades, i.e. B. lobbii (clade A: Sulawesi), B. microglossum (clade B: Cameron Highlands), B. coweniorum (clade C: Luzon, probably Laos), B. facetum (clade D: Luzon), whereas one additional restricted taxon occur in each of three of four seemingly widespread subclades of E, i.e. B. polystictum (subclade E1: Cameron Highlands), B. cameronense (subclade E2: Cameron Highlands), and B. sumatranum (subclade E4: Sumatra). To those could be added even B. orectopetalum and B. siamense (subclade E2), both of which are confined to the area north of the Isthmus of Kra. 60 Results Table 3.8: Distribution and species composition of the clades. While clades A, B, C and D consist of only one species, each confined to a restricted area, the widespread clade E comprises seven species. Inferred distribution areas (i.e. where species are known to occur but were not sampled) are marked by asterisks. Superscripts are used to assign species to areas for subclades E1-E4. Geogrophically restricted endemics are underlined. Clade Species Distribution A “B. lobbii“ Sulawesi B B. microglossum Peninsula Malaysia (Cameron Highlands) C B. coweniorum Luzon, Laos* D B. facetum Luzon E B. lobbii, B. polystictum, B. siamense, B. dearei B. orectopetalum, B. cameronense, B. sumatranum E1 B. lobbiia, B. polystictumb Peninsula Highlands, Malaysiaa,b (Cameron Ledang), Borneoa, Luzona, Sumatraa, Javaa*, Balia E2 B. lobbiia, B. orectopetalumb, Assamb,c*, Myanmarb,c, Thailandb,c, B. siamensec, B. cameronensed Peninsula Malaysiad Highlands), Luzon E3 a b B. lobbii , B. dearei Peninsula Island), (Cameron a Malaysiab b Mindanao , (Tioman Borneoa,b, Luzona, Sumatraa E4 B. lobbiia, B. sumatranumb Peninsula Malaysiaa (Cameron a,b Highlands), Sumatra , Borneoa, Philippines (Palawan)a 61 Results Fig. 3.11: Distribution of the various AFLP clades and restricted species (B. sumatranum, B. cameronense and B. polystictum) of subclades E1, E2 and E4. Yellow = clade A; dark blue = clade B; light green = clade C; dark green = clade D; red = clade E1; turquoise = clade E2; light blue = clade E3; violet = clade E4. ▲ = B. polystictum (clade E1) and B. cameronense (clade E2); ¹ = B. sumatranum (clade E4). Base map adapted from the maps of the University of Texas, Austin, USA (www.lib.utexas.edu/maps/asia.html). 62 Results 3.1.7 Combined ITS/AFLP analysis Based on the high P-value (0.552) of the homogeneity test for the ITS and AFLP data, heuristic MP searches were performed (10 replications of random sequence addition; TBR branch swapping, MULTREES on; MAXTREES = 10000; gaps scored as missing data). Bootstap values were obtaind by running 10000 replicates. The ITS/AFLP dataset consisted of 920 positions of which 308 were potentially parsimony-informative (350 variable sites). The MP analysis of the whole character matrix (B. lobbii complex (51 accessions) and 11 extracomplex individuals) resulted in 12 equally parsimonious trees of 2000 steps (CI = 0.180; RI = 0.527; HI = 0.820). One of the most parsimonious trees is shown in Figure 3.12. Notwithstanding the exceptionally high homoplasy index, the monophyly of the B. lobbii complex was supported by 78 % bootstrap value and the delimitation of the clades was largely congruent with both the ITS and AFLP trees (Figs. 3.1-3 (ITS) and 3.8 (AFLPs)). Clade A (B. lobbii/Sulawesi; BV 100 %) formed a well supported clade at the basis of the complex, followed by clade C (BV < 50 %), consisting of B. piestoglossum and B. coweniorum. Although also weakly supported (< 50 %), the remaining accessions formed two likely sister lineages, one comprising clades E1 (BV 81 %) and E2 (not supported), and the other clade B (B. microglossum/Cameron Highlands; BV 100 %) and B. monanthum (both in a basal position), as well as E3 (BV 62 %) and E4 (not supported) plus D (B. facetum/Luzon; BV 100 %). In contrast to the AFLP tree (Fig. 3.8), B. smitinandii and B. piestoglossum were now placed into clades E2 and C, respectively, as suggested by ITS, whereas the enigmatic B. monanthum was now found close to clade B rather than nested within E1 (see ITS trees, Figs. 3.1-3). Similar to the AFLP tree, however, nothing can be inferred from this topology (with confidence) with respect to the phylogenetic relationships between these (sub)clades. As a consequence, this combined ITS/AFLP dataset will not be discussed in any further detail. 63 Results Fig. 3.12: ITS/AFLP MP tree of 51 accessions of the B. lobbii complex and 11 extra-complex individuals (marked by asterisks). The tree was rooted by B.hamatipes. Numbers above branches indicate MP bootstrap values (> 50 %) from 100 replicates (heuristic search, 10 random sequence additions). Accession numbers (in brackets) are identified in Table 7.1. Locations are added after species name. Note that B. facetum, B. coweniorum and B. sumatranum (marked red) have red flowers. Cameron H: = Cameron Highlands. 64 Results As stated above, the delimination of clades was largely congruent between the ITS and AFLP datasets (and also the ITS/AFLP dataset). One major exeption involed (the two extra-complex species) B. piestoglossum and B. monanthum, as well as B. smitinandii, all of which were found close to the outgroup in the AFLP tree (Fig. 3.8), but clearly intermingled with accessions from the B. lobbii complex (ingroup) in the ITS tree (Fig. 3.3). However, the arrangement of the clades (i.e. the tree topology) was incongruent between the ITS and AFLP datasets as shown in a simplified form in Figures 3.13 and 3.14, respectively. While in the ITS tree (Fig. 3.3) the clades were ordered ((A, B), (C, D), (E4, (E2, (E1, E3)))), the order of the clades in the AFLP tree (Fig. 3.8) was (B, (E2, (C, (A, (E1, (E4, E3)))))) with clade D nested within clade E3 (not shown). Thus, neither the monophyly of clade E nor the successive branchings of clades A/B vs. C/D from near the base of the tree were recovered by the AFLP tree. As there was only weak bootstrap support for internal branches within the AFLP tree, the ITS tree topology was considered the more likely one and used for the subsequent dispersal-vicariance analysis. Fig. 3.13: Simplified tree of the clock constrained ITS dataset. 65 Results Fig. 3.14: Simplified tree of the AFLP dataset. 3.1.8 Dispersal-vicariance analysis (DIVA) The first DIVA analysis, whith subclades E1-E4 included, produced no clear results concerning ancestral areas of separate clades as well as the entire B. lobbii complex. This was due to the fact that these subclades were coded according to all their current distribution areas (and not according to their likely ancestral distributions). The simplified unrooted ITS tree, which was the basis of the first DIVA analysis, together with the 9 a priori defined distribution areas of (sub)clades (A-J) and the ancestral ranges inferred for each node are summarized in Figure 3.15. At least 9 dispersal events between areas were necessary for the reconstruction of ancestral areas of all interior nodes as well as the node subtending the whole complex. Moreover, for several nodes, there were far too numerous equally alternative or probable ancestral ranges recovered, and for the basalmost node (7), the reconstructions postulated a relatively widespread ancestor of the complex distributed across the entire study area. The results of the second analysis, based on a simplified ITS tree rooted with B. emiliorum, are shown in Figure 3.16. In this analysis (i) the number of a priori defined areas were reduced to seven (A-G) by subsuming subclades into a single clade E, and (ii) the latter was coded according to its 66 Results likely ancestral distribution (i.e. Borneo). Borneo was chosen because of (i) the basal position of a Bornean lineage (B. lobbii (11)) within clade E (phylogenetic evidence) and (ii) a high genetic/subclade diversity within clade E in that area (circumstantial evidence). Now the reconstruction of ancestral areas of all clades and the whole complex required only (at least) one dispersal event, the number of alternative solutions were reduced, and Borneo, Peninsula Malaysia, Sulawesi and, potentially, the Philippines were postulated as ancestral areas for the basalmost node (4) of the B. lobbii complex. 67 Results Fig. 3.15: Simplified ITS tree, representing the various clades, used for DIVA analysis. Ancestral areas of each node are listed left below the tree. Note that at least 9 dispersal events were necessary for the reconstruction of ancestral areas of both all interior nodes as well as the node subtending the whole B. lobbii complex. Note that the reconstructions postulated a widespread ancestor of the complex distributed across the entire study area 68 Results (node 7). Fig. 3.16: Simplified ITS tree, representing the clades A to E and one outgroup-taxon (B. emiliorum), used for the DIVA analysis. Ancestral areas of each node are listed left below the tree. Borneo was postulated for the ancestral area of clade E (see text). At least one dispersal event was necessary for the reconstruction of ancestral areas. Note that Borneo, Peninsula Malaysia, Sulawesi and, potentially, the Philippines were postulated as ancestral 69 Results areas of the whole B. lobbii complex (node 4; two alternative solutions). 3.2 Morphological analysis As the two tests used for assessing normality produced differing results for 8 characters (nos. 3, 4, 9, 22, 30, 32-34; Table 3.9), PCAs were preliminarily conducted on separate data matrices with deviant traits transformed according to either the Shapiro-Wilk or the Chi2 test (Table 3.9). The results, however, were essentially similar (not shown). Thus, any character, which deviated from normal distribution according to just one test, was transformed. The ratio characters RAL (24) and RAC (25) were not (arcsin) transformed due to values larger than one. Eleven characters that were scored for only few accessions were not included and, thus, 24 characters (17 floral characters; 7 vegetative characters) were finally used in the analysis (shaded grey in Table 3.9). Table 3.9: Transformation (TF) of morphological data. Examination of the data for normal distribution was performed using Shapiro-Wilk and Chi2 tests. Any character that deviated from the assumption of a normal distribution in either test was transformed (except RAL and RAC; see text). Grey shaded characters were used for the final analysis. See Table 2.5 for character description. ND = normal distribution. Shapiro-Wilk test Type Char. floral Chi-square-test Code W-value p-value ND TF Chi2 p-value ND TF 1. PLE 0.849 1.04E-04 no log 19.154 1.50E-05 no log 2. NPB 0.835 5.86E-05 no log 19.835 8.10E-06 no log 3. LPB 0.942 4.29E-02 no log 1.9231 1.66E-01 yes - 4. PPB 0.942 4.28E-02 no log 1.5128 2.19E-01 yes - 5. LFB 0.962 2.06E-01 yes - 0.89744 3.43E-01 yes - 6. LBI 0.902 2.47E-03 no log 6.2308 1.26E-02 no log 7. LMS 0.982 7.68E-01 yes - 3.1538 7.57E-02 yes - 8. WMS 0.925 1.21E-02 no log 8.2821 4.00E-03 no log 9. LLS 0.961 1.48E-01 yes - 11.974 5.39E-04 no log 10. WLS 0.956 1.27E-01 yes - 1.9231 1.66E-01 yes - 11. LEP 0.978 6.19E-01 yes - 0.0769 7.82E-01 yes - 12. MWP 0.873 4.07E-04 no log 8.4872 3.58E-03 no log 13. LOL 0.953 1.07E-01 yes - 3.5641 5.90E-02 yes - 14. WOL 0.905 3.00E-03 no log 9.5128 2.04E-03 no log 15. LOC 0.809 1.28E-05 no log 29.205 6.50E-08 no log 16. WOC 0.887 9.74E-04 no log 6.2208 1.26E-02 no log 70 Results 17. NEM - - - - - - - - 18. BLT - - - - - - - - 19. FLC - - - - - - - - 20. SCE - - - - - - - - 21. RMS 0.930 1.80E-02 yes - 2.333 1.27E-01 yes - 22. RLS 0.917 7.09E-03 no arcsin 2.9487 8.59E-02 yes - 23. RAP 0.932 2.05E-02 no arcsin 4.7949 2.85E-02 no arcsin 24. RAL 0.719 2.64E-07 no - 10.128 1.46E-03 no nt 25. RAC 0.734 2.31E-08 no - 18.615 1.60E-05 no nt vegetative 26. HOP 0.983 7.93E-01 yes - 0.69231 4.05E-01 yes - 27. LOP 0.976 5.47E-01 yes - 1.5128 2.19E-01 yes - 28. WOP 0.967 3.06E-01 yes - 0.69231 4.05E-01 yes - 29. LLF 0.986 9.19E-01 yes - 0.076923 7.82E-01 yes - 30. WLF 0.960 1.76E-01 yes - 6.0256 31. SPB - - - 32. ADP 0.895 2.46E-03 no log 2.667 1.02E-01 yes - 33. LRS 0.900 6.01E-03 no log 2.25 1.34E-01 yes - 34. RPB 0.932 2.11E-02 no arcsin 0.69231 4.05E-01 yes - 35. RLE 0.979 6.78E-01 yes - 1.5128 - - - 1.41E-02 no - - 2.19E-01 yes log - Altogether 53 accessions were analysed using these 24 characters. These accessions represented all (sub)clades/species of the B. lobbii complex (except clade A and B. smitinandii) with 48 samples and one individual each of the outgroup species B. piestoglossum, B. monanthum, B. emiliorum, B. affine and B.hamatipes. The first two PCA factors accounted for 42.1 % and 14.1 % of the total variance, respectively. PC1 had the highest loadings (> |0.2|) for PLE (1), LMS (7), LLS (9), WLS (10), LOP (11), MWP (12), LOL (13), WOC (16), HOB (26), LOP (27), WOP (28) and LLF (29) and all of them were negative. The highest loadings (> |0.2|) of PC2 were found for PLE (1), MWP (12), WOC (16), RLS (22), RAP (23), RAL (24), RAC (25) and WOP (28) (Table 3.10). 71 Results Table 3.10: Character coefficients (loadings) for the first two principal components of the B. lobbii complex and outgroup accessions. No. Character PC1 PC2 No. Character PC1 PC2 1. PLE -0.2347 0.2847 21. RMS 0.1269 -0.1653 6. LBI 0.1264 0.06758 22. RLS 0.1171 -0.3816 7. LMS -0.3188 0.1325 23. RAP 0.128 -0.3186 8. WMS -0.0565 -0.02257 24. RAL 0.03924 -0.3641 9. LLS -0.2589 0.0412 25. RAC 0.1022 0.3635 10. WLS -0.3108 -0.1939 26. HOP -0.2449 -0.006407 11. LEP -0.3297 0.1632 27. LOP -0.2419 -0.1766 12. MWP -0.2174 -0.2584 28. WOP -0.2458 -0.2284 13. LOL -0.2996 0.09354 29. LLF -0.2712 0.02037 14. WOL -0.1455 -0.1136 30. WLF -0.03965 -0.01522 15. LOC -0.1895 0.03492 34. RPB 0.01768 -0.1597 16. WOC -0.2089 -0.287 35. RLE 0.03783 -0.0983 PCA analyses were performed plotting components 1 (c1) vs. 2 (c2) and marking either (sub)clades (defined according to the AFLP analysis; Fig. 3.17) or species (3.18). Additional to the results I want to give some further information based on either (i) characters (Table 3.9) which were not included in the analyses or (ii) personal observations because this could probably give deeper insights into the morphological variability of the complex (especially of the various B. lobbii accessions) and likely support the results of the PCA analyses. As no living plant material of B. lobbii from Sulawesi (clade A) was available they could not be included in the morphological analysis. B. affine was subsequently excluded from the analysis because it fell out of range of the current two-dimensional plot in a preliminary analysis. The extra-complex taxa B. emiliorum and B. hamatipes (brown bars) as well as B. piestoglossum and B. monanthum (dark blue stars), were well distinct of all other species/clades because of their relatively small flowers and their high RAC value. Within the B. lobbii complex, the accessions of each (sub)clade (B: 5; C: 2; D: 4; E1: 11; E2: 12; E3: 9; E4: 7) hardly cluster together and there is almost no distinct grouping recognizable except for clade B (B. 72 Results microglossum), clade D (B. facetum) and subclade E1 (mostly B. lobbii and B. polystictum; Fig. 3.17). In Figure 3.18 the grouping of species appears more evident, albeit to the exception of “B. lobbii” and B. dearei, with the former encompassing almost the total morphological variance of the entire complex, to the exception of B. cameronense, B. siamense and B. microglossum. B. microglossum (clade B; black dots), which had very small flowers and very long internodes between the pseudobulbs, was well distinct in both the morphological and the molecular analysis. B. coweniorum (clade C; violet circles) was found within clade E close to most accessions of subclade E4 (Fig. 3.17). B. facetum (clade D; green crosses) was morphological quite variable and two accessions (B. facetum (1, 2)) were situated within clade E. Both B. coweniorum and B. facetum as well as B. sumatranum of subclade E4 (pink squares; Fig. 3.17) have large flowers with wide petals, relative short peduncles, red lips and a foul scent. Accessions of subclade E1 (blue squares; Fig. 3.17) have very long peduncles and also large flowers. B. lobbii (2) from Luzon has the longest peduncle of all analysed accessions. B. lobbii (24) was found close to clade E4. This accession from the Cameron Highlands (Peninsula Malaysia) differed from the other plants found in clade E1 by having at least a shorter peduncle. Within subclade E2 (red crosses; Fig. 3.17), B. cameronense was well separated from B. orectopetalum and B. lobbii (33) by PC2, having a RAL lower to or equal to one. This ratio was larger in all other accessions of this clade. B.lobbii (33) was found in clade E3 in the ITS tree and was at the basis of clade E2 in the AFLP tree. Morphologically it is very similar to B. orectopetalum, but differs in the form of the lip. B. siamense from Myanmar, which had larger flowers than all other accessions of this clade, was found at the margin of clade E1 (Fig. 3.17). In subclade E3 (olive ovals; Fig. 3.17), almost all B. dearei accessions (except B. dearei (3)) cluster together. B. dearei (3) from Tioman Island (Peninsula Malaysia) and B. lobbii (4) from Sumatra were found near the B. orectopetalum accessions. B. dearei (3) was much smaller than all other B. dearei found on Borneo and Mindanao and it cannot be excluded that this sample is of hybrid origin involving B. affine based on the cpDNA evidence. 73 Results B. lobbii (4) was not part of clade E3 in the ITS tree, but was found at the basis of clade E3 in the AFLP tree. Although the form of the flower of B. lobbii (4) was very similar to B. dearei, it differed in size (smaller), colour (not the typical yellow) and the lip (yellow nectar mark). B. lobbii (1) from Luzon was found close to clade E4. This accession was only found in this clade in the AFLP tree, where it was situated close to B. lobbii (4). However, based on Figure 3.17, B. lobbii (1) and B. lobbii (4) are fairly distant. In fact, B. lobbii (1) differed in the colour of the peduncle which was red, which otherwise was seldom found within the B. lobbii complex. Within subclade E4 (pink squares; Fig. 3.17) all accessions (except B. lobbii (7)) cluster together. B. lobbii (7) from Palawan had a longer peduncle and larger flowers than all other plants in clade E4 and, thus, was found close to B. dearei from Mindanao (clade E3). B. lobbii (32) from Mindanao and B. lobbii (31), which were not included in the molecular analysis, were found close to the B. orectopetalum accessions of clade E2. Both accessions had small flowers, were yellow and, interestingly, B. lobbii (32) smelt foul. 4 pie1 3 emi2 ham1 mon1 2 Component 2 lob2 1 dea3 lob7 0 lob24 mic1 -1 sia1 lob32 lob1 l33 lob31 -2 -6 -5 -4 -3 -2 -1 0 1 Component 1 lob4 2 3 4 5 6 7 74 Results Fig. 3.17: PCA analysis of 53 accessions representing 49 of the B. lobbii complex and four outgroup individuals. Separation of the clades by component 1 vs. 2; black dots = clade B; violet circles = clade C; green crosses = clade D; blue squares = clade E1; red crosses = E2; olive ovals = clade E3; pink squares = E4; light brown line = B. lobbii (31, 32) which were not included in the molecular analyses; brown bars = outgroup; dark blue stars = B. monanthum, B. piestoglossum which were in no clade in the AFLP analysis; lob = B. lobbii; l33 = B. lobbii (33); mic = B. microglossum; dea = B. dearei; sia = B. siamense; pie = B. piestoglossum; mon = B. monanthum; emi = B. emiliorum; ham = B. hamatipes; accession numbers are identified in Table 7.1. 4 B. piestoglossum B. emiliorum 3 B. hamatipes 2 B. dearei B. polystictum lob2 B. monanthum B. cameronense B. lobbii Component 2 1 dea3 0 lob7 B. coweniorum B. microglossum lob32 -1 B. sumatranum B. siamense lob33 lob31 -2 lob4 B. orectopetalum B. facetum -6 -5 -4 -3 -2 -1 0 1 Component 1 2 3 4 5 6 7 Fig. 3.18: PCA analysis of 53 accessions representing 49 of the B. lobbii complex and four outgroup individuals. I suppose B. dearei (3) is a hybrid as it contains a B. affine cpDNA. As a consequence this wide morphological variance of B. dearei should be considered with caution. Separation of species by component 1 vs. 2; conspecific accessions (>= 3) are connected by convex hulls; black dots = B. microglossum; violet circles = B. coweniorum; green crosses = B. facetum; blue squares = B. polystictum; red crosses = B. cameronense; green diamonds = B. orectopetalum; olive ovals = B. dearei (dea); pink squares = B. sumatranum; turquoise triangles = B. lobbii (lob); light brown line = B. siamense; brown barrs = outgroup; dark blue stars = B. monanthum, B. piestoglossum which were in no clade in the AFLP analysis. 75 Results Perhaps most importantly, while most species within the B. lobbii complex could be well separated by morphology (Fig. 3.18), B. lobbii (s. lat.) showed a wide range of morphological variation and, thus, could be found close to all species except B. microglossum B. siamense and B. cameronense in the two-dimensional PCA plot. 76 Discussion 4. Discussion 4.1 Monophyly of the Bulbophyllum lobbii complex The ITS sequence data show that the B. lobbii complex largely forms a strongly supported (MP = 90 %; ML = 100 %) monophyletic group within section Sestochilos (Figs. 3.1, 3.2), with two exceptions. Thus, two additional species of the same section (B. piestoglossum and B. monanthum), originally rendered outgroups (Table 7.1), were placed into this complex by the ITS and (tentatively) the AFLP trees (Figs. 3.1-3 and 3.8, respectively), which was very surprising due to the different morphology of these two taxa (Figs. 3.17, 3.18). Evidently this implies that these species should be considered members of the complex. Based on ITS, the complex is sister to a well supported clade (MP = 91 %; ML = 90 %) comprising B. affine, B. emiliorum, B. patens, B. macranthum, and B. pileatum (outgroup 1). Taking these two groups together, they also form a monophyletic clade (MP/ML = 100 %). The AFLP data show a similar picture but could not support the monophyly of the B. lobbii complex (Fig. 3.8). The combined cpDNA dataset (Fig. 3.7) does not fully support the monophyly of the B. lobbii complex either, but the relevant clade (MP = 96 %; ML = 100 %) nonetheless contains most of the accessions of this complex (B. monanthum was not included in these cpDNA analyses because no material was available at the time of the cpDNA study). While one accession of B. affine (1) was found within the complex (next to B. lobbii (11)/B.dearei), one accession of the B. lobbii complex (B. dearei (3)) was placed outside this clade next to another accesssion of B. affine (2) close to the root (Fig. 3.7). As both these deviant accessions (B. affine (1) and B. dearei (3)) cluster according to expectation in both the ITS and AFLP trees (Figs. 3.1 – 3; Fig. 3.8) it is feasible that the most probable evolutionary process accounting for this cpDNA/nuclear incongruency is transfer (or capture) of cpDNA mediated by (introgressive) hybridization, with B. lobbii (11)/B. dearei and B. affine (2) acting as the maternal (‘donor’) parents, respectively. Thus, irrespective of these deviations, I suggest that monophyly of the B. lobbii complex (including B. piestoglossum and B. monanthum), as shown by both ITS and AFLPs, is most likely. Nonetheless to completely ensure the monophyly of the group, more accessions, particularly of the outgroup 1 around B. affine, which comprises approximately 20 species (Dr. 77 Discussion J. J. Vermeulen, personal communication), should be sequenced and analysed. This work is currently underway. 4.2 Delimitation of major clades within the Bulbophyllum lobbii complex All 11 species of the B. lobbii complex, as currently placed into this group by taxonomists (Seidenfaden & Wood, 1992; Garay et al., 1996; Seidenfaden, 1997; Comber, 2001; Vermeulen & O’Byrne, 2003), plus B. piestoglossum and B. monanthum (see above), are found in a monophyletic clade as suggested by the ITS and the AFLP datasets. Overall, phylogenetic analyses of both marker systems (ITS, AFLPs) provide initial evidence of the existence of five well-supported clades (A-E) comprising this group. In particular, the ITS tree topologies (Figs. 3.1-3) suggest a near simultaneous origin of two basal clades (A and B) and a third clade that subsequently diversified into the remaining clades (C-E). While clades A to D are species-poor and geographically largely restricted, clade E is species-rich and apparently widespread. All B. lobbii accessions of clade A are restricted to Sulawesi (unfortunately not included in the morphological analyses, because no material was available). Clade B comprises the morphologically well delimitated B. microglossum (Figs. 3.1-3; 3.17, 3.18) which is only known from the Cameron Highlands (Peninsula Malaysia). The species B. piestoglossum and B. coweniorum of clade C, and B. facetum of clade D, are mainly distributed in Luzon (Philippines). B. coweniorum, however, was also reported from Laos (Vermeulen & O’Byrne, 2003), but unfortunately no such accession was available for analyses. Within clade E only ITS allows delimitating four subclades (E1 – E4), comprising up to seven species (B. dearei, B. cameronense, B. polystictum, B. orectopetalum, B. siamense, B. smitinandii, and B. lobbii) but phylogenetic relationships among the subclades remain poorly resolved. In contrast to ITS, the AFLP tree (Fig. 3.8) shows that (i) clade E is not monophyletic (subclade E2 close to the basis of the complex), (ii) clade D (B. facetum) is nested within clade E3 mainly composed of B. dearei (rendering the latter species paraphyletic with respect to the former), and (iii) three taxa (B. smitinandii, B. monanthum and B. 78 Discussion piestoglossum), found within (sub)clades E2, E1 and C, respectively, in the ITS trees (Figs. 3.1-3) are located at the basis of the complex. This basal position is likely reflected by the morphological analyses (B. monanthum and B. piestoglossum close to outgroup taxa; B. smitinandii not analysed; Figs. 3.17, 3.18) whereby an artefactual basal clustering in the NJ-AFLP tree cannot be ruled out. However, ITS is still the most likely topology, given 80 % bootstrap value of a monophyletic clade E (excluding clade D) in the clockenforced ML tree (Fig. 3.3). 4.3 On the role of hybridization within the B. lobbii complex While the gammastatistic test of Pybus and Harvey (2000) suggests a constant birth and death or a pure birth model of diversification for the B. lobbii complex (based on all lineages of the complex), the low level of ITS variation (0.9 %) within clade E nonetheless provides evidence for a recent radiation, a phenomenon which was also reported in several other plant genera (e.g. Chenuil & McKey, 1996; Zhang et al., 2001), and one from the Southeast Asia/Sundashelf region (Macaranga: Blattner et al., 2001). There are at least two mutually non-exclusive hypotheses which could explain this low level of ITS variability within clade E. The low genetic differentiation of the currently widespread clade E (across the entire study area except Sulawesi) could be either the result of relatively recent range expansion followed by fragmentation and associated high morphological diversification, or could be due to recent interbreeding/hybridization of previously isolated and well differentiated genetic entities. In fact, most plants within the B. lobbii complex can interbreed and form seed capsules (B. lobbii/B. facetum; B. lobbii/B. sumatranum; B. lobbii/B. dearei; B. siamense/B. coweniorum; B. sumatranum/B. dearei; B. facetum/B.dearei; unpublished greenhouse experiments, G. Fischer). However, the AFLP tree (Fig. 3.8) mostly groups intraspecific accessions of species of ITS clade E according to taxonomy (B. dearei, B. cameronense, B. sumatranum), except B. polystictum (intermingled with B. lobbii in subclade E1) and the enigmatic B. lobbii (discussed later). For other species, including those outside clade E, that are (potentially) sympatric with congeners (e.g. B. microglossum with B. cameronense and B. polystictum/B. lobbii in the Cameron Highlands; B. 79 Discussion sumatranum and B. lobbii on Sumatra; B. dearei and B. lobbii on Borneo; B. orectopetalum and B. siamense in the region north of the Isthmus of Kra; B. facetum and B. coweniorum in Luzon) it needs to be emphasized that the AFLPs were also able to delimitate species – leaving little room for pervasive hybridization within the complex, except for the two deviant instances of likely cpDNA capture discussed above. Otherwise, the fairly low level of phylogenetic structure revealed by cpDNA is more likely the result of insufficient sequence variation and/or incomplete lineage sorting rather than hybridization. Because of the highly variable flower morphology is feasible that prezygotic isolation mechanisms, such as different pollinator behaviour, may probably exist between many (sympatric) species within the complex. However, for examining in detail whether interspecific hybridization was involved in the low genetic differentiation within the B. lobbii complex (especially clade E), more extensive population-level sampling and a broader survey of both nuclear and cytoplasmic markers would be necessary. At least based on the present analyses it appears that the expansion/fragmentation scenario is more plausible than a scenario of pervasive hybridization. 4.4 Putative ancestral area and age of the Bulbophyllum lobbii complex According to the second DIVA analysis (with subclades E1-E4 reduced to clade E; Luzon, Mindanao and Palawan combined to one area (Philippines); clades coded according to their likely ancestral distribution; and outgroup taxon B. emiliorum; Fig. 3.16), Borneo, Peninsula Malaysia, Sulawesi and potentially the Philippines comprise the ancestral area of the B. lobbii complex, and at least one dispersal event was necessary for this reconstruction. However, both the Philippines and Sulawesi were never connected to the Sundashelf and, thus, at least two independent dispersal events are likely, i.e. from Borneo/Peninsula Malaysia to Sulawesi and to the Philippines, respectively. Based on the ITS clock-enforced tree (Fig. 3.3), the two distinct lineages occurring on the Philippines (clades C and D) are younger than those of Sulawesi (“B. lobbii”; clade A) and Peninsula Malaysia/Cameron Highlands (B. microglossum; clade B). Thus, the 80 Discussion Philippines can safely be excluded as an ancestral area. The remaining areas are therefore Borneo, Peninsula Malaysia and Sulawesi. As there was only one lineage/species found on Sulawesi (i.e. “B. lobbii” (9, 15, 17)), I suggest that the ancestral area of the B. lobbii complex should be Borneo and Peninsula Malaysia which were connected by land during the late Miocene/early Pliocene (see below). For calibrating the ultrametric ITS tree (Fig. 3.3), four different substitution rates (fast, moderate, slow and very slow) were used. The “Bulbophylum rate” (very slow), which was inferred from a biogeographical event, is without much doubt too slow, because this rate, if valid, would be the slowest reported for plants in the literature, except that for Winteraceae (for rates see Richardson et al., 2001). By contrast, the fast rate from Robinsonia might be too fast, because this rate is the highest for ITS found in plants. Thus, the most likely rate for the B. lobbii complex should lie between the moderate and the slow rate. 4.5 Diversification of the B. lobbii complex, evolutionary processes and historic-biogeographical scenario Based on the above rate assumption, the origin of the B. lobbii complex was between 3.6 and 8.2 Mya (see Fig. 3.3). Furthermore, the ages of origin of all major clades are inconsistent with Pleistocene events. Rather, clades B and A appear to have originated between 2.8 and 6.5 Mya and likely arose from, respectively, the fragmentation of a widespread, most likely BorneoPeninsula Malaysia region – ancestor in the west (Peninsula Malaysia/Cameron Highlands: B. microglossum); and a dispersal event across the Makassar Strait (“Wallace’s line”) to the east (Sulawesi: B. lobbii (9, 15, 17)). This dispersal event is not surprising, because in contrast to the situation observed in animals, this sea barrier appears to be rather unimportant for most plants (Dransfield, 1981; George, 1981; Moss, 1998). Especially, the montane flora of Sulawesi is similar to that of Borneo (Balgooy, 1987; Whitten et al., 1987; Moss & Wilson, 1998). This may be, because plants – in general – are considered good oversea dispersers (Briggs, 1987). The fragmentation, which led to the origin of clade B, could probably have taken place in the Pliocene, due to the rise in sea level to up 81 Discussion to 140 m above present sea level (Ridder-Numan, 1998). Also the estimated ages of clades C, D and E appear to be fairly ancient (2.3 – 5.2 Mya) with clades C and D presumably arising independently following dispersal events, to Luzon (Philippines), probably across the Sulu/Celebes Seas, which formed deep water barriers from the Eocene onwards (Hall, 1998). Implicitly, the origin of B. coweniorum/B. piestoglossum and B. facetum would be a result of oversea dispersals, at least based on the ITS evidence (Fig. 3.3). By contrast, the putative Sundashelf ancestor of clade E, which may have originated in Borneo/Philippines (node 3; Fig. 3.16), started diversifying approximately 1.5 – 3.4 Mya, and gave rise to several species that clearly evolved at the Plio-/Pleistocene boundary or well within the (Late) Pleistocene. During glacials, the extent of rainforest habitats was probably severely restricted to mountainous regions on the exposed Sundashelf due to arid climatic conditions (Brandon-Jones, 1998; but see Kershaw et al., 2001). Opportunities for rainforest expansion were likely (re-)established when the climate improved during interglacials, but at those times the Sundashelf was fragmented due to a rise in sea level! Thus, the rainforest was perhaps permanently disjunct or insular in distribution (Fig. 1.3) and has mainly dispersed across sea barriers (Brandon-Jones, 1998). Several authors (e.g. Kershaw et al., 2001), however, also content that despite the generally drier climate during glacials, the exposure of land/continental shelf likely resulted in a net increase in the area of rainforest rather than a reduction (see also Fig. 1.4). As the species of the B. lobbii complex are restricted to (sub)montane rainforests and probably poor dispersers (due to their symbiosis with fungi which are probably absent in new habitats; Dressler, 1981), the once widespread ancestor of clade E likely followed the repeated range expansion/contraction cycles of the rainforests. In fact, it is feasible that in times of glacial periods, when area of rainforest likely increased (see above), the range of the common ancestor of clade E also expanded, perhaps facilitated by the giant riverine systems supporting gallery forests (see Voris, 2000; Gorog et al., 2004). If correct, interglacial island formation and continental vicariance events would have mainly led to speciation due to geographic isolation, whereby a widespread, B. lobbii-like (polymorphic) ancestor of clade E would have very recently given rise to numerous 82 Discussion locally/regionally restricted derivatives, such as B. polystictum, B. cameronense, B. sumatranum, B. orectopetalum and B. siamense (see p. 60). More detailed hypotheses concerning the Pleistocene history of clade E, however, must await a robust molecular phylogeography for this group in general, and still difficult and widespread taxa (B. lobbii, B. dearei) in particular, ideally at a high level of spatial and temporal resolution. 4.6 Yellow vs. red flower variation within the B. lobbii complex Within the B. lobbii complex there are species with redish flowers (B. facetum/clade D, B. coweniorum/clade C and B. sumatranum/within subclade E4) and yellowish flowers (all other species). Within subclade E4 all red B. sumatranum plants are placed within a cluster of yellow B. lobbii plants (in both the ITS and AFLP trees; Figs. 3.3, 3.8). Thus, the redish flower morph could have originated from the yellowish flower morph at least three times, i.e. in clades C and D, and within subclade E4. If correct, such parallel evolution of red flowers could reflect adaptation to various enviroments and/or pollinators, although, testing this hypothesis requires a more fully resolved internal tree topology (in both ITS and AFLPs) and a detailed character mapping approach using, e.g., MACLADE 4 (Madison & Madison, 2003). While redish flowering plants are always associated with a foully scent, the yellowish flowering plants usually smell fruit-like. However, one yellow flowering B. lobbii (32) from the Philippines, which unfortunately was analysed only morphologically, had a foully scent as well. Further studies are needed to provide deeper insights into how far the evolution of flower scent and colour are associated within the B. lobbii complex. 4.7 The species within the B. lobbii complex As mentioned in the introduction (1.2 study system) the name “B. lobbii“ covers a whole series of plants (in herbaria and the literature) that based on the present ITS/AFLP analyses perhaps should be assigned to different species. Furthermore, as seen in the morphometric analyses B. lobbii is morphologically very variable, being present in clade A and all subclades of clade E. In the discussion below, which is based on the molecular data 83 Discussion (mostly AFLP for subclades of E; ITS for all other clades), the morphological analysis and personal observations, I will try to give some information, which might be useful for further taxonomical work. Clade A consists of B. lobbii accessions which are restricted to Sulawesi. Dr. J. J. Vermeulen (personal communication) suggests that this could be regarded a new species (B. hyalosemoides), and all molecular data support this view. Unfortunately, no such accessions were available for morphometric analysis. The species within clades B, C and D are very well distinguishable according to the molecular and (largely) the morphological data and, thus, the following species names should be retained: B. microglossum (clade B), B. coweniorum (clade C) and B. facetum (clade D). All morphologically analysed accessions of B. polystictum and B. lobbii within AFLP subclade E1 (Fig. 3.8) also broadly cluster together in the PCA (Fig. 3.17) by having very long peduncles and large flowers. Furthermore, they look very similar (in shape of sepals and petals) to that one from the collection of Lobb, which was described by Lindley (1847). As the three accessions of B. polystictum are interspersed within this subclade (Fig. 3.18), I do not agree with Ridley (1909) and Seidenfaden (1997) that this taxon should be recognized as a separate species. Thus, I suggest that all plants within subclade E1 should be called B. lobbii (B. lobbii s. str.; distribution: Java/Bali, Peninsula Malaysia, Borneo and Luzon). However, I do agree with Seidenfaden (1997) that B. lobbii is absent from Thailand and I am quite sure (based on personal communication with G. Fischer) that B. lobbii is not present north of the Isthmus of Kra. Four species could be found within AFLP subclade E2 (B. siamense, B. orectopetalum, B. cameronense and “B. lobbii”). The distribution of B. siamense and B. orectopetalum is probably restricted to the area north of the Isthums of Kra (i.e. to Assam, Thailand, Myanmar). The analysed material of B. siamense had much larger flowers and longer peduncles (see distinct grouping of this species in Fig. 3.18) than the B. orectopetalum accessions, while the shape of the flowers of these two species are similar. I agree with Garay et al. (1992) and Seidenfaden (1997) that B. siamense should be split in B. siamense and B. orectopetalum. The B. lobbii (33) accession from 84 Discussion Luzon grouped next to B. orectopetalum in the morphological analysis (Fig. 3.17) and next at the base of the B. siamense/B. orectopetalum cluster in the AFLP analysis, albeit with little support (53 %). This accession might be ascribed to B. orectopetalum although it is genetically distinct. By contrast, the molecular (AFLP and ITS) and the morphological (PCA) data show that B. cameronense is a well distinct species which should be retained. In the AFLP tree (Fig. 3.8), subclade E3 consists of three species (B. dearei, “B. lobbii” and B. facetum), but mostly of B. dearei, and with B. facetum (clade D) nested within the latter. B. dearei is a well recognizable species and, therefore, this name should be retained. The different groupings of B. facetum (forming a separate clade in the ITS tree, Fig. 3.3) is difficult to explain but there can also be no doubt that this species forms a distinct genetic entity (the different grouping could be explained by, e.g., differential lineage sorting of ITS vs. AFLP markers although this is fairly speculative). Although the B. lobbii accessions (1, 4) from Luzon and Sumatra within subclade E3 were found to be similar tho B. facetum and B. orectopetalum (Figs. 3.17, 3.18), respectively, nonetheless differ genetically from these species and also differ morphologically in flower shape and colour from B. dearei and in flower shape from B. lobbii s. str. (see above). These “B. lobbii” accessions (1, 4) can only be named “B. lobbii s. lat.” at this time. Finally, subclade E4 includes B. sumatranum and “B. lobbii“. B. sumatranum is well discernable (ITS and especially AFLP evidence), and should be referred to as a distinct species (despite morphological overlap with, e.g. B. coweniorum, B. facetum and B. dearei in the PCA; Fig. 3.18) The numerous B. lobbii (7, 16, 19) accessions from Palawan and the Cameron Highlands within this subclade differ in scent, flower shape and colour from B. sumatranum and, therefore can only be named “B. lobbii s. lat.”. Note that within the taxonomically highly problematic subclades E3 and E4 there are fairly well delimitated tip clusters comprising B. dearei/B. facetum and B. sumatranum, respectively, that appear to have evolved locally (Mindanao, Borneo, Tioman Island/Luzon; Sumatra) from an ancestral “B. lobbii-like” stock (still widespread) – a process which renders the latter ‘taxon’ highly paraphyletic with respect to these latter taxa. In fact, it appears from the molecular analyses that “B. lobbii” is a paraphyletic base group (see 85 Discussion Kadereit et al., 1997) of the entire clade E and most of its constituent taxa (probably except B. facetum). According to the above suggestions, the B. lobbii complex consists of 13 mostly well defined species (B. hyalosemoides ined., B. microglossum, B. coweniorum, B. piestoglossum, B. facetum, B. lobbii, B. siamense, B. orectopetalum, B. cameronense, B. dearei, B. sumatranum, B. smitinandii and B. monanthum). At present time, however, it is hardly possible to present a satisfactory reply to taxonomical questions and further taxonomic and molecular work should be done. 86 Conclusion 5. Conclusion The results of this study show a strong influence of the recent (Plio/Pleistocene) history of the Indo-Malay Archipelago on the evolution of the B. lobbii complex. Especially periodical fragmentation and reconnection of the Sundashelf islands (to each other and to the adjacent mainland) due to the rising and falling of sea level, respectively, have triggered diversification and speciation. But also oversea dispersal and continental mainland vicariance likely played a fundamental role in the evolutionary history of this plant group. Thus, the first onset of diversification of the B. lobbii complex took place in the Late Miocene or Pliocene, when the range of a putative widespread (Borneo/Peninsula Malaysia) ancestor was fragmented due to rising sea level leading to clade B in the Cameron Highlands/Peninsula Malaysia. At about the same time, clade A originated after a dispersal event to Sulawesi, which was never connected to the Sundashelf. The putative ancestor persisted in the Sundashelf region and gave rise to (i) two clades (C and D) after independently colonizing Luzon/Philippines (also never connected to the Sundashelf) in the Pliocene, and (ii) finally subclades E1-E4 during the Pleistocene. The ancestor of these subclades likely expanded its range at times of continuous land connection during glacials (as the net area of rainforests increased, despite generally drier conditions) and gave rise to several species most likely in times of inter-glaciation when the Sundashelf became fragmented due to rising sea levels. However, diversification and speciation may have also been triggered when rainforests (also on the mainland) were reduced to refuges during the dry glacials. The putative ancestor of clade E, however, likely persisted (“B. lobbii” s. lat.) all the time, and thus forms today a paraphyletic base group, as can be inferred from the molecular data. It appears, that palaeogeographical circumstances allowed this base group to evolve at a faster rate than earlier-evolving basal lineages (A-D) that remained geographically restricted and species-poor at the margins of the Sundashelf region (i.e. Sulawesi, Luzon/Philippines, Cameron Highlands/Peninsula Malaysia). In this context, the B. lobbii complex is a good study system to illustrate the impact of historical contingency on differential rates of plant diversification and speciation in the Indo-Malayian Archipelago. 87 Abstract 6. Abstract Recently, it has been suggested that the distribution and evolution of plants and animals in Southeast-Asia may owe much more to the last one or two million years than the preceding 30 million years. In context, there has been a resurgence of debate among zoologists on whether increased aridification during Pleistocene glacial periods and/or postglacial vicariance caused by rising sea levels triggered the radiation of rain forest taxa especially in the western part of the Malay Archipelago. Here, I test the hypothesis of Pleistocene speciation by focusing on the phylogenetic relationships and divergence times of submontane to montane-rainforest-restricted orchids (Bulbophyllum lobbii complex, c. 12 species) from the Sundashelf region (Peninsula Malaysia, Sumatra, Java, Borneo), the Philippines, Sulawesi and adjacent mainland areas (Thailand, Myanmar), using nuclear rDNA internal transcribed spacer (ITS), chloroplast (cp) DNA sequences, AFLP markers and morphological analyses. Phylogenetic analyses of both marker systems provide initial evidence of the monophyly of the complex and the existence of five well-supported clades (A–E). ITS tree topologies suggest a near simultaneous origin of (i) two basal clades (A: B. hyalosemoides/Sulawesi; B: B. microglossum/ Peninsula Malaysia-Cameron Highlands); and (ii) three clades comprising the crown group, two of which are also species-poor and geographically largely restricted (C: B. coweniorum/Philippines-Luzon, Laos (?), B. piestoglossum/Philippines-Luzon; D: B. facetum/Philippines-Luzon), while the third clade (E) is species-rich and widespread. Within this latter clade both ITS and AFLPs allow delimitating four subclades (and up to seven species), but phylogenetic relationships remain poorly resolved. Based on ITS clock estimates, it is argued that the origins of all five major clades are inconsistent with Pleistocene events. Rather, clades B and A appear to have originated approximately 2.8 to 6.5 Mya, and likely arose from, respectively, (i) the fragmentation of a widespread - most likely BorneoPeninsula Malaysia region – ancestor in the west (Peninsula Malaysia); and (ii) a dispersal event across the Makassar Strait (“Wallace’s line”) to the east to Sulawesi. Also, the estimated ages of clades C-E appear to be fairly ancient (approximately 2.3 - 5.2 Mya), with clades C and D presumably 88 Abstract arising independently, following dispersal events to the north (Philippines), i.e. across the Sulu/Celebes Seas, which formed deep water barriers from the Eocene onwards. By contrast, the putative Sunda-region ancestor of clade E started diversifying approximately 1.5 to 3.4 Mya, and gave rise to several species that clearly evolved in the (Late) Pleistocene. In sum, four of the five major clades identified represent narrow paleorelicts (A–D) that became isolated in the Late Miocene to Pliocene when Southeast Asia still experienced a perhumid climate and tropical rain forest was widespread. In contrast, while also having originated in the Late Miocene to Pliocene, clade E experienced a radiation. I posit that this species proliferation could reflect vicariant events in the Sundashelf region (viz rainforest fragmentation), likely triggered by the deterioration of global climatic conditions in the early to mid Pliocene followed by a marked increase in aridification (≤ 2.5 Mya), especially during glacials. However, it appears equally likely that much of the most recent diversification and speciation events surrounding clade E also result – at least in the Sundashelf region – from inter-glacial island formation due to rising sea levels. Thus, barring high levels of oversea dispersal (which appears to be unlikely for this orchid group), the high level of genetic similarity observed among geographically restricted and disjunct species of clade E would reflect common ancestry from a widespread, polymorphic “B. lobbii-like” population/species that likely expanded its range at times of continous land connection, i.e. during glacials (!) when the net area of rainforests increased – as recently suggested by palaeogeographers – and despite generally drier conditions. Taken together, the present study illustrates that plant evolution in the Indo-Malay Archipelago proceeded at different rates at different times, likely dependent on historical/palaeogeographical circumstances. 89 Literature 7. Literature cited Ames O (1905) Orchidaceae (Ames) 1, 96. Avise J C (1994) Molecular Markers, Natural History and Evolution. Chapman & Hall, New York. Avise J C (2000) Phylogeography: The History and Formation of Species. Harvard University Press, Cambridge, Massachusetts. Baldwin BG (1992) Phylogenetic utility of the internal transcribed spacers of nuclear ribosomal DNA in plants: An example from the Compositae. Molecular Phylogenetics and Evolution, 1, 3-16. Balgooy M M J (1987) A plant biogeographical analysis of Sulawesi. In: Biogeographical Evolution of the Malay archipelago (ed Whitemore T C), pp. 79-85, Clarendon Press, Oxford Monographs on Biogeography 4. Barth F G (1985) Insects and Flowers: The Biology of a Partnership. Princeton University Press, Princeton. Beaman J H (2001) Orchids of Sarawak. Natural History Publications, Borneo and The Royal Botanic Gardens, Kew. Beaman J. H. (2001) Orchids of Sarawak. Natural History Publications, Borneo and The Royal Botanic Gardens, Kew. Bittkau C and Comes H P (2005) Evolutionary processes in a continental island system: Molecular phylogeography of the Aegean Nigella arvensis alliance (Ranunculaceae) inferred from chloroplast DNA polymorphism. Molecular Ecology, 14 (13), 4065-4083. Blattner F R, Weising K, Bänfer G, Maschwitz U, Fiala B (2001) Molecular analysis of phylogenetic relationships among myrmecophytic Macaranga species (Euphorbiaceae). Molecular Phylogenetics and Evolution, 19, 331344. Borba E L, Semir J (1998) Wind-assisted fly pollination in three Bulbophyllum (Orchidaceae) species occurring in the Brazilian campos rupestres. Lindleyana, 13, 203-218. Bortiri E, Oh S, Jiang J, Baggett S, Ganger A, Weeks C, Buckingham M, Potter D, Parfitt D E (2001) Phylogeny and systematics of the genus Prunus L. (Rosaceae) as determined by sequence analysis of ITS and the chloroplast trnL-trnF spacer DNA. Systematic Botany, 26, 797-807. Brandon-Jones D (1998) Pre-glacial Bornean primate impoverishment and Wallace’s line. In: Biogeography and Geological Evolution of SE Asia (eds Hall R, Holloway D), pp. 393-404. Blackbuys Publishers, Leiden, The Netherlands. Briggs J C (1987) Biogeography and Plate Tectonics. Developments in Palaeontology and Stratigraphy 10. Elsevier, Amsterdam. 90 Literature Cannon C H, Manos P S (2003) Phylogeography of the Southeast Asian stone oaks (Lithocarpus). Journal of Biogeography, 30, 211-226. Carlquist S (1974) Island Biology. Columbia University Press, New York. Chappell J, Shackleton N J (1986) Oxygen isotopes and sea level. Nature 324, 137-140. Chenuil A, McKey D B (1996) Molecular phylogenetic study of a myrmecophyte symbiosis: did Leonardoxa/ant associations diversify via cospeciation? Molecular Phylogenetics and Evolution, 6, 270-286. Cogneaux C A (1901) Orquidea. Rio de Janeiro, ORA 513, after Lit 322, B. lobbii var. Nattesiae Cogn. in Cog., Dict. Icon. Orch. t. 1. Comber J B (1990) Orchids of Java. The Royal Botanic Gardens, Kew. Comber J B (2001) Orchids of Sumatra. The Royal Botanic Gardens, Kew. Cootes J (2001) The Orchids of the Philippines. Timber Press, Portland, Oregon, USA. Darwin C (1859) The Origin of Species. John Murray, London, UK. Dawson A G (1992) Ice Age Earth, Late Quaternary Geology and Climate. Routledge Physical Enviroment series 293. Routledge, London & New York. de Padua Teixeira S, Borba E L, Semir J (2004) Lip anatomy and its implications for the pollination mechanisms of Bulbophyllum species (Orchidaceae). Annals of Botany, 93, 499-505. Demesure B, Sodzi N, Petit RJ (1995) A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Molecular Ecology, 4, 129-131. Depres L, Gielly L, Redoutet B, Taberlet P (2002) Using AFLP to resolve phylogenetic relationships in a morphologically diversified plant species complex when nuclear and chloroplast sequences fail to reveal variability. Molecular Phylogenetics and Evolution, 27, 185-196. Doyle J J, Doyle J S (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin, 9, 11-15. Dransfield J (1981) Palms and Wallace’s line. In: Wallace’s Line and Plate Tectonics (ed Whitemore T C), pp. 43-56. Clarendon Press, Oxford Monographs on Biogeography 1. Dressler R L (1981) The Orchids Natural History and Classification. Harvard University Press, Cambridge, USA. Fairbanks R G (1989) A 17,000-year glacio-eustatic sea level record. Influence of glacial melting rates on the Younger Dryas event and deep ocean circulation. Nature 342, 637-642. 91 Literature Farris JS, Källersjö M, Kluge AG, Bult C (1994) Testing significance of incongruence. Cladistics, 10, 315-319. Felsenstein J (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39, 783-791. Felsenstein J (1988) Phylogenies from molecular sequences: inference and reliability. Annual Review of Genetics, 22, 521-565. Felsenstein J (2004) Inferring Phylogenies. Sinauer Associates, Inc, Sunderland, Massachusetts. Francisco-Ortega F, Jansen R K, Santos-Guerra A (1996) Chloroplast DNA evidence of colonization, adaptive radiation, and hybridization in the evolution of the Macaronesian flora. Proceedings of the National Academy of Science of the USA, 93, 4085-4090. Fujii N, Ueda K, Watano Y, Shimizu T (1997) Intraspecific sequence variation of chloroplast DNA in Pedicularis chamisonis Steven (Scrophulariaceae) and geographic structuring of Japanese “alpine” plants. Journal of Plant Research, 110, 195-207. Garay L A, Hamer F, Siegerist E (1996) Inquilina Orchidacea II. Lindleyana. 11 (4): 226. Garay L A, Hamer F, Siegerist E (1996) Inquilina Orchidacea II. Lindleyana 11 (4), 227. Garay L A, Hamer F, Siegerist E (1996) Inquilina Orchidacea II. Lindleyana 11 (4), 230. Garay L A, Hamer F, Siegerist E (1992) Beiträge zu kultivierten Bulbophyllum - Arten. Die Orchidee, 43 (3), 139 - 142. Gaudeul M, Taberlet P, Till-Bottraud I (2000) Genetic diversity in an endangered alpine plant, Eryngium alpinum L. (Apiaceae), inferred from amplified fragment length polymorphism markers. Molecular Ecology, 9, 1625–1637. George W (1981) Geological history of the region of Wallace’s line. In: Wallace’s line and plate tectonics (ed Whitemore T C), pp. 3-8. Clarendon Press, Oxford Monographs on Biogeography 1. Gielly L, Taberlet P (1994) The use of chloroplast DNA to resolve plant phylogenies: noncoding versus rbcL sequences. Molecular Biology and Evolution, 11, 769-777. Gillot P Y, Lefevre J C, Nativel P E (1994) Model for the structual evolution of the volcanues of Réunion Island. Earth and Planetary Science letters, 122 (34), 291-302. Gorog A J, Sinaga M H, Engstrom M D (2004) Vicariance or dispersal? Historical biogeography of three Sunda shelf murine rodents (Maxomys 92 Literature surifer, Leopoldamys sabanus and Maxomys whiteheadi). Biological Journal of the Linnean Society 81, 91-109. Griebeler EM (2004) Gammastatistic V 1.0. Institut für Zoologie, Abteilung Ökologie, Johannes Gutenberg-Universität Mainz, Germany (aivailable from http://www.perdix.biologie.unimainz.de/people/evi/download/gammastatistic). Guo Y-P, Saukel J, Mittermayr R, Ehrendorfer F (2005) AFLP analyses demonstrate genetic divergence, hybridization, and multiple polyploidization in the evolution of Achillea (Asteraceae-Anthemideae). New Phytologist, 166 (1), 273-290. Hall R (1998) The plate tectonics of Cenozoic SE Asia and the distribution of land and sea. In: Biogeography and Geological Evolution of SE Asia (eds Hall R, Holloway J D), pp. 99-131. Blackbuys Publishers, Leiden, The Netherlands. Hamilton MB (1999) Four primer pairs for the amplification of chloroplast intergenic regions with intraspecific variation. Molecular Ecology, 8, 521-523. Hammer Ø, Harper DAT, Ryan PD (2001) PAST: Paleontological statistics software package for education and data analysis. Palaeontologia Electronica, 4 (http://palaeo-electronica.org/2001_1/past/issue1_01.htm). Haq B U, Hardenbol J, Vail P R (1987) Chronology of fluctuating sea levels since the Triassic. Science 235, 1156-1167. Heaney L R (1986) Biogeography of mammals in SE Asia: estimates of rates of colonization, extinction and speciation. Biological Journal of the Linnean Society, 28, 127-165. Heaney L R (1985) Zoogeographic evidence for the middle and late Pleistocene land bridges to Philippine Islands. In: Modern Quaternary Research in South-East Asia (eds Bartstra G, Casparie W A), pp. 127-143. A. A. Balkema, Rotterdam. Henfrey (1852) Bulbophyllum lobbii Lindl. var. henshallii (Lindl.) Henfrey. Gard. Mag. Bot., 3, 269. Hort (1883) Sarcopodium dearei Hort. The Gardeners’ Chronicle 2 (20), 108. Hort (1905) Bulbophyllum lobbii Lindl. var. colosseum Hort. The Gardeners’ Chronicle 3 (38), 184. Hughes J B, Round P D, Woodruff D S (2003) The Indochinese-Sundaic faunal transition at the Isthmus of Kra: An analysis of resident forest bird species distributions. Journal of Biogeography, 30, 569-580. Inger R F, Voris H K (2001) The biogeographical relations of frogs and snakes of Sundaland. Journal of Biogeography, 28, 863-891. Kadereit J W, Scharzbach A E, Jork K B (1997) The phylogeny of Papaver s. 93 Literature l. (Papaveraceae): polyphyly or monophyly? Plant Systematics and Evolution, 204, 75-98. Kadereit JW, Griebeler EM, Comes HP (2004) Quaternary diversification in European alpine plants: pattern and process. Proceedings of the Royal Society of London, 359, 265-274. Karns D R, O’Bannon A, Voris H K, Weigt L A (2000) Biogeographical implications of mitochondrial DNA variation in the Bockadam Snake (Cerberus rynchops, Serpentes: Homalopsinae) in Southeast Asia. Journal of Biogeography, 27, 391-402. Kennett J P, Keller G, Srinivasan M S (1985) Miocene planctonic foraminiferal biogeography and palaeographic development of the IndoPacific region. In: The Miocene Ocean: Paleoceanography and Biogeography (ed Kennet J P). Geological Society of America Memoir 163, 197-236. Kershaw A P, Penny D, van der Kaars S, Anshari G, Thamotherampillai A (2001) Vegetation and climate in lowland Southeast Asia at the Last Glacial Maximum. In: Faunal and Floral Migration and Evolution in SE AsiaAustralasia (eds Davidson I, Metcalf I, Morwod M, Smith J M B), pp. 227-236. A. A. Balkema, Rotterdam. Kimball R T, Crawford D J, Smith E B (2003) Evolutionary processes in the genus Coreocarpus: insights from molecular phylogenetics. Evolution, 57, 52-61. Koopman K F (1989) Distributional patterns of Indo-Malayan bats (Mammalia: Chiroptera). American Museum Novitates, 2942, 1-20. Kraenzlin F W L, Kraenzlin C F (1921) Orchidaceae novae. Repert. Spec. Nov. Regni Veg. XVII, 385. Kumar S, Tamura K & Nei M (2004) MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Briefings in Bioinformatics, 5, 150-163. Kuntze C E O (1891) Phyllorchis lobbii (Lindl.) Kuntze. Revisio Generum Plantarum Pars II, 677. Lim K Y (1985) The chromosomes of Orchids at Kew – 1 – Bulbophyllum. American Orchid Society Bulletin, 54 (2), 190-193. Lim K Y, Jones K (1981) The chromosomes of Orchids VI Bulbophyllum. Kew Bulletin, 37 (2), 217-219. Lindley J & Paxton J (1850) Sacropodium lobbii (Lindl.) Lindl. & Paxt.. Paxton's Floral Garden 1, 155. Lindley J (1852) Bulbophyllum henshallii Lindl.. The Gardeners’ Chronicle, 1852, 422. Lindley J. (1847) Bulbophyllum lobbii Lindl.. Edward's Botanical Register 33, 94 Literature sub. T. 29. Lourie S A, Green D M, Vincent A C J (2005) Dispersal, habitat differences, and comparative phylogeography of Southeast Asian seahorses (Syngnathidae: Hippocampus). Molecular Ecology, 14, 1073-1094. Maddison D R, Maddison W P (2003) McClade 4. Sinauer Associates, Inc., Sunderland, Massachusetts, USA (http://www.sinauer.com). Meve U, Liede S (1994) Floral biology and pollination in stapeliads – new results and a literature review. Plant Systematics and Evolution, 192, 99-116. Morley R J (1998) Palynological evidence tor Tertiary plant dispersal in the SE Asian region in relation to plate tectonics and climate. In: Biogeography and Geological Evolution of SE Asia (eds Hall R, Holloway J D), pp. 211-234. Blackbuys Publishers, Leiden, The Netherlands. Morley R J (2000) Origin and Evolution of Tropical Rain Forests. John Wiley and Sons, Chichester. Morley R J, Flenley J R (1987) Late Cenozoic vegetational and environmental changes in the Malay archipelago. In: Biogeographical Evolution of the Malay Archipelago (ed Whitemore T C), pp. 50-59. Clarendon Press, Oxford. Moss S J, Wilson M J (1998) Tertiary evolution of Sulawesi-Borneo: implications for biogeography. In: Biogeography and Geological Evolution of SE Asia (eds Hall R, Holloway J D), pp. 133-164. Blackbuys Publishers, Leiden, The Netherlands. Mueller U G, Wolfenbarger L L (1999) AFLP genotyping and fingerprinting. Trends in Ecology and Evolution, 14, 389-394. Nei M, Li WH (1979) Mathematical model for studying genetic variation in terms of restriction endonucleases. Proceedings of the National Academy of Sciences, USA, 76, 5269-5273. Oberprieler C (2005) Temporal and spatial diversification of CircumMediterranean Compositae-Anthemideae. Taxon, 54 (4), 951-966. Ohsako T, Ohnishi O (2000) Intra- and interspecific phylogeny of wild Fagopyrum (Polygonaceae) species based on nucleotide sequences of noncoding regions in chloroplast DNA. American Journal of Botany, 87, 573582. Ohsako T, Ohnishi O (2001) Nucleotide sequence variation of the chloroplast trnK/matK region in two wild Fagopyrum (Polygonaceae) species, F. leptopodum and F. statice. Genes and Genetic Systems, 76, 39-46. Oxelman B, Lidén M, Berglund D (1997) Chloroplast rps16 intron phylogeny of the tribe Sileneae (Caryophyllaceae). Plant Systematics and Evolution, 206, 393-410. 95 Literature Posada D, Crandall KA (1998) Modeltest: testing the model of DNA substitution. Bioinformatics, 14, 817-818. Pybus OG, Harvey PH (2000) Testing macro-evolutionary models using incomplete molecular phylogenies. Proceedings of the Royal Society of London, 267, 2267-2272. Ray N, Adams J M (2001) A GIS-based vegetation map of the world at the last glacial maximum (25,000-15,000 BP). Internet Archaeology, 11 (http://intarch.ac.uk/journal/issue11/rayadams_toc.html). Reichenbach H G (1867) Bulbophyllum siamense Rchb. f.. The Gardeners’ Chronicle, 572. Reichenbach H G, Saunders (1882) Bulbophyllum lobbii Lindl. var. siamense (Rchb. f.) Rchb. f.. Ref. Bot. 2: 116. Reichenbach, H. G. (1888) Orchideae describuntur. Flora 71 (10), 156. Richards P W (1996) The Tropical Rain Forest: An Ecological Study, 2nd Edition, Cambridge University Press, Cambridge. Richardson JE, Pennington TR, Pennington TD, Hollingsworth PM (2001) Rapid diversification of a species-rich genus of neotropical rain forest trees. Science, 293, 2242-2245. Ridder-Numan J (1998) Historical biogeography of Spatholobus (Leguminosae-Papilionoideae) and allies in SE Asia. In: Biogeography and Geological Evolution of SE Asia (eds Hall R, Holloway J D), pp. 259-277. Blackbuys Publishers, Leiden, The Netherlands. Ridley H N (1908) On a collection of plants from Gunong Tahan, Pahang. Journal Linnean Society Botanica 38, 324 - 326. Ridley H N (1909) The flora of the Telom and Batang Padang Valleys. J. Fed. Malay States Museum 4, 65. Ridley H N, Straits J, Branch R (1908) Bulbophyllum punctatum Ridl.. Asiaic Society. 1, 130. Ridley H N. (1890) On the method of fertilization in Bulbophyllum macranthum and allied orchids. Annals of Botany, 4, 327-336. Ridley H N (1893) An enumeration of all Orchideae hitherto recorded from Borneo. Journal Linnean Society Botanica, 31, 273. Ritland C, Ritland K (2000) DNA-fragment markers in plants. In: Molecular Methods in Ecology (ed Baker A J), pp. 208-234, Blackwell Science, Oxford, UK. Rolfe (1905) Bulbophyllum claptonense Rolfe. Orchid Review, 13, 198. Ronquist F (1996) DIVA version 1.1 Computer programme and manual 96 Literature available by FTP ftp.systbot.uu.se). servers from Uppsala University (ftp.uu.se or Ruedi M (1996) Phylogenetic evolution and biogeography of Southeast Asian shrews (genus Crocidura: Soricidae). Biological Journal of the Linnean Society, 61, 197-219. Ruedi M, Fumagalli L (1996) Genetic structure of Gymnures (genus Hylomys: Erinaceidae) on continental islands of Southeast Asia: historical effects of fragmentation. Journal of Zoological Systematics and Evolutionary Research, 34, 153-162. Saitou N, Nei M (1987) The neighbour-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4, 406425. Sanderson M J (1998) Estimating rate and time in molecular phylogenies: beyond the molecular clock? In: Molecular Systematics of Plants II: DNA Sequencing (eds Soltis D E, Soltis P S, Doyle J J), pp. 242-264. Kluwer, Dordrecht. Sang T, Crawford DJ, Stuessy TF (1997) Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany, 84, 1753-1765. Schmitt L H, Kitchener D J, How R A (1995) A genetic perspective of mammalian variation and evolution in the Indonesian archipelago: Biogeographic correlates in the fruit bat genus Cynopterus. Evolution, 49, 399-412. Schot A M (1998) Biogeography of Aporosa (Euphorbiaceae): Testing a phylogenetic hypothesis using geology and distribution patterns. In: Biogeography and Geological Evolution of SE Asia (eds Hall R, Holoway J D), pp. 279-290. Blackbuys Publishers, Leiden, The Netherlands. Schultheis L M (2001) Systematics of Downingia (Campanulaceae) based on molecular sequence data: Implication for floral and chromosome evolution. Systematic Botany, 26, 603-621. Seidenfaden G (1996) A remarkable new Bulbophyllum, sect. Sestochilos (Orchidaceae) from Thailand. Nordic Journal of Botany 16 (3), 287. Seidenfaden G (1990) Orchid Genera in Thailand VIII: Bulbophyllum Thou.. Bishen Singh Mahendra Pal Singh, Dehra Dun, India. Seidenfaden G (1997) Contributions to the Orchid Flora of Thailand XIII. Olsen & Olsen, Fredensborg. Seidenfaden G, Wood J J (1992) Orchids of Peninsular Malaysia and Singapore. Olsen & Olsen, Fredensborg. Shackleton N J (1994) The climate system in the recent geological past. In: Paleoclimates and their Modelling (eds Allen J R L, Hoskins B J, Sellwood B 97 Literature W, Spicer R A, Valdes P J), pp. 1-5. Chapman & Hall, London. Shaw J, Lickey EB, Beck JT, Farmer SB, Liu W, Miller J, Siripun KC, Winder CT, Schilling EE, Small RL (2005) The tortoise and the hare II: Relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. American Journal of Botany, 92, 142-166. Small RL, Ryburn JA, Cronn RC, Seelanan T, Wendel JF (1998) The tortoise and the hare: Choosing between noncoding plastome and nuclear Adh sequences for phylogenetic reconstruction in a recently diverged plant group. American Journal of Botany, 90, 1301-1315. Smith J J (1908) Bulbophyllum lobbii Lindl. var. brefiflorum J. J. Sm.. Bull. Dep. Agr. Ind. Neerl. 15, 18. Sodhi N S, Koh L P, Brook B W, Ng P L (2004) Southeast Asian biodiversity: An impending disaster. Trends in Ecology and Evolution 19, 654-660. Soejima A, Nagamasu H (2004) Phylogenetic analysis of Asian Symplocos (Symplocaceae) based on nuclear and chloroplast DNA sequences. Journal of Plant Research, 117, 199-207. Stern R J, Bloomer S H (1992) Subduction zone infancy: Examples from the Eocene Izu-Bonin-Mariana and Jurassic California arcs. Bulletin of the Geological Society of America 104, 1621-1636. Sun X, Li X, Luo Y, Chen X (2000) The vegetation and climate at the last glaciation on the emerged continental shelf of the South China Sea. Palaeogeography, Palaeoclimatology, Palaeoecology 160, 301-316. Sun Y, Skinner DZ, Liang GH, Hulbert SH (1994) Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theoretical and Applied Genetics, 89, 26-32. Swofford DL (2001) PAUP*: Phylogenetic analysis using parsimony (*and other methods), Version 4.0b10. Sinauer Associates, Sunderland MA. Taberlet P, Gielly L, Pautou G, Bouvet J (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology, 17, 1105-1109. Takayama K, Ohi-Toma T, Kudoh H, Kato H (2005) Origin and diversification of Hibiscus glaber, species endemic to the oceanic Bonin Islands, revealed by chloroplast DNA polymorphism. Molecular Ecology, 14, 1059-1071. Takhtajan A, Ohi-Toma T, Kudoh H, Kato H (1987) Flowering plant origin and dispersal: The cradle of the angiosperms revisited. In: Evolution of the Malay Archipelago (ed Whitmore T C), pp. 26-31, Clarendon Press, Oxford Monographs on Biogeography 4. Tate JA, Simpson BB (2003) Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Systematic Botany, 28, 723-737. 98 Literature Templeton AR (1998) Nested clade analyses of phylogeographic data: Testing hypotheses about gene flow and population history. Molecular Ecology, 7, 381-398. Trapnell D W, Hamrick J L (2004) Partitioning nuclear and chloroplast variation at multiple spatial scales in the neotropical epiphytic orchid, Laelia rubescens. Molecular Ecology, 13, 2655-2666. Van Breda J G S (1827) Sestochilos uniflorum Breda. Gen. Spec. Orchid. Asclep. t. 3 Van den Berg C, Goldman DH, Freudenstein JV, Pridgeon AM, Cameron KM, Chase MW (2005) An overview of the phylogenetic relationships within Epidendroideae inferred from multiple DNA regions and recircumscription of Epidendreae and Arethuseae (Orchidaceae). American Journal of Botany, 92, 613-624. Van der Kaars S, Penny D, Tibby J, Fluin J, Dam R A C, Suparan P (2001) Late Quaternary palaeoecology, palynology and palaeolimnology of a tropical lowland swamp: Rawa Danau, West-Java, Indonesia. Palaeogeography, Palaeoclimatology, Palaeoecology 171, 185-212. Van Welzen P. C. (2003) Historical biogeography of Southeast Asia and the West Pacific, or the generality of unrooted area networks as historical biographic hypotheses. Journal of Biogeography, 30, 181-192. Vermeulen J J, O'Byrne P (2003) New species and new records of Southeast Asian Bulbophyllum (Orchidaceae). Garden Bulletin Singapore 55, 125-162. Vermeulen J J (1991) Orchids of Borneo, Volume 2. Bulbophyllum. The Royal Botanical Garden, Kew. Verstappen H T (1992) Climatic change and geomorphology in south and south-east Asia. Geo-Eco-Trop 16, 101-147. Verstappen H T (1997) The effect of climatic change on south-east Asia geomorphology. Journal of Quaternary Science 12, 413-418. Vijverberg K, Bachmann K (1999) Molecular evolution of a tandemly repeated trnF(GAA) gene in the chloroplast genomes of Microseris (Asteraceae) and the use of structural mutations in phylogenetic analyses. Molecular Biology and Evolution, 16, 1329-1340. Voris H K (2000) Maps of Pleistocene sea levels in Southeast Asia: shorelines, river systems and time durations. Journal of Biogeography 27, 1153-1167. Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M, Fritjers A, Pot J, Peleman J, Kuiper M, Zabeau M (1995) AFLP: a new technique for DNA fingerprinting. Nucleic Acids Research, 23, 4407-4414. Weathers W J (1890) Bulbophyllum godseffianum Weathers. Gard. Mag. Bot., 540, London. 99 Literature Whitmore T C (1981) Paleoclimate and vegetation history. In: Wallace’s Line and Plate Tectonics (ed Whitmore T C), pp. 36-42. Clarendon Press, Oxford. Wolfe A D, Liston A (1998) Contributions of PCR-based methods to plant systematics and evolutionary biology. Molecular Systematics of Plants II (eds Soltis D E, Soltis P S, Doyle J J). Boston, Dordrecht. London: Kluwer Academic Publishers, 43-57. Wolfe K H, Lie W-H, Sharp P M (1987) Rates of nucleotide substitution vary greatly among plant mitochondrial, chloroplast, and nuclear DNAs. Proceedings of the National Academy of Science, USA, 84, 9054-9058. Zang L B, Comes H P, Kadereit J W (2001) Phylogeny and Quaternary history of the European montane/alpine endemic Soldanella (Primulaceae) based on ITS and AFLP variation. American Journal of Botany, 88, 23312345. 100 Appendix 8. Appendix Table 8.1: In general, material used for molecular (ITS; cpDNA: trnH-psbA, trnE-trnD; AFLP) and morphological (Morph) analysis was collected and determined by G. Fischer. Living plants were cultivated in the glasshouses of the Botanical Gardens in Salzburg and Vienna; herbarium specimens and/or Kew-conserved samples (vouchers) are stored at the University of Salzburg. Accessions marked by an asterisk were obtained only as silica dried leaves by Dr. J. J. Vermeulen, who collected and determined the species (vouchers in the Botanical Garden in Leiden, The Netherlands). Thus these accessions could not be included in the morphometric analysis. Accessions/species marked by a superscript (a) are shown in chapter 9 (colour plates of B. lobbii complex and extra-complex species). Taxon Locality Voucher ITS no. trnH- trnE- psbA trnD AFLP Morph B. cameronense Garay, Hamer & Siegerist Peninsula Malaysia; Cameron Highlands OR 90/99 + + + + + Peninsula Malaysia; Cameron Highlands OR 64/99 + - - + + 3 Peninsula Malaysia; Cameron Highlands OR 132/99 + - - + - 4 Peninsula Malaysia; Cameron Highlands OR 92/99 - - - + + Philippines; Luzon; Nueva Vizcaya OR 241/98 + + + + + 2 Philippines; Luzon; Nueva Vizcaya OR 219/98 + + + + - 3 Philippines; Luzon; Nueva Vizcaya OR 222/98 - - - + - 4 Philippines; Luzon; Nueva Vizcaya OR 32/05 - - - + - 5 Philippines, Luzon; Nueva Vizcaya OR 294/98 - - - Philippines; Mindanao; Agusan del Sur OR 136/98 + + + + + 2 Philippines; Mindanao; Bukidnon OR 227/98 + + + + + 3 Peninsula Malaysia; Tioman Island OR 606/98 + + + + + 4* Borneo; Sarawak; Gunung Serapi 932551 + + + + - 5 No locality information available SBG713 + + + + - 6 Philippines; Mindanao; Bukidnon OR 12 /98 + - - + + 7 Philippines; Mindanao; Bukidnon OR 165/98 + - - + + 8 Philippines; Mindanao; Bukidnon OR 243/98 + - - + - 9* Peninsula Malaysia; Tioman Island SBG740 + - - + - 10 Philippines; Mindanao; Bukidnon OR 398/98 - - - + + 11 Philippines; Mindanao; Bukidnon OR 397/98 - - - + + 12 Philippines; Mindanao; Agusan del Sur OR 146/98 - - - + - 13 Philippines; Mindanao; Bukidnon OR 166/98 - - - + - 14* Borneo; Sarawak; Gunung Mulu NP 980433 - - - + - 15 Philippines; Mindanao; Bukidnon OR 176/98 - - - + - 1 2 a B. coweniorum J.J. Vermeulen & P. O'Byrne 1 a + B. dearei Reichb.f. 1 a B. facetum Garay, Hamer & Siegerist 101 Appendix Philippines; Luzon; Nueva Vizcaya OR 215/98 + + + + + Philippines; Luzon; Nueva Vizcaya OR 16/98 + - - + + 3 Philippines; Luzon OR 223/99 + - - + + 4 Philippines; Luzon; Nueva Vizcaya OR 228/98 + - - + + 5 Philippines; Luzon; Nueva Vizcaya OR 218/98 + - - + + 6 Philippines; Luzon; OR 619/99 - - - + - 1 2 a B. lobbii Lindl. 1 a Philippines; Luzon; Zambales OR 390/98 + + + + + 2 a Philippines; Luzon OR 211/03 + + + + + 3 Indonesia; Borneo OR 292/99 + + + + + 4 Indonesia; Sumatra; Sinabung Volcano OR 620/99 + + + + + 5 Indonesia, Bali OR 337/99 + + + + + 6 Indonesia; Sumatra; Padang OR 126/05 + + + + + Philippines; Palawan OR 61/05 + + + + + 8 Peninsula Malaysia; Cameron Highlands OR 28/99 + + + + + 9* Indonesia; Sulawesi; Pendolo Divide SBG5059 + + + + - 10* Borneo; Sarawak; G. Penrissen 970761 + + + + - 11* Borneo; Sarawak; Kelabit Highlands 980107 + + + + - 12 Indonesia; Sumatra; Solok OR 317/03 + + + + - 13* Borneo; Sabah; Upper Matang River + + + + - 14* Borneo; Sabah; Road to Kinabalu SBGO 3796 SBGO 4758 SBGO 5728 + + + + - + + + + - 7 a 15* a Indonesia; Sulawesi; Poso District 16 No locality information available OR 160/05 + + + + - 17* Indonesia; Sulawesi; Kpg. Doda SBGO 4903 + + - + - 18 Indonesia; Bali OR 377/99 + - - + + 19 Peninsula Malaysia; Cameron Highlands OR 21/99 + - - + + 20 No locality information available OR 145/05 + - - + + 21 Philippines; Palawan OR 152/05 + - - + - 22 Peninsula Malaysia; Cameron Highlands OR 100/99 - - - + + Indonesia; Bali OR 452/99 - - - + + 24 No locality information available OR 86/05 - - - + + 25 Peninsula Malaysia; Cameron Highlands OR 602/99 - - - + + 26* Borneo; Kalimantan; Apo Kayan 913488 - - - + - 27* Peninsula Malaysia; Gunung Ledang 960117 - - - + - 28 Indonesia; Sumatra OR 107/01 - - - + - 29* Indonesia - - - + - 30* Indonesia SBGO 1818 SBGO 1840 - - - + - 31 No locality information available OR 202 - - - - + 32 Philippines, Mindanao OR 485/03 - - - - + Philippines; Luzon OR 22/05 + - - + + 23 33 a a B. microglossum Ridl. a 102 Appendix 1 Peninsula Malaysia; Cameron Highlands OR 161/99 + + + + + 2 Peninsula Malaysia; Cameron Highlands OR 160/99 + - - + + 3 Peninsula Malaysia; Cameron Highlands OR 163/99 - - - + - 4 Peninsula Malaysia; Cameron Highlands OR 537/99 - - - + - B. orectopetalum Garay, Hamer & Siegerist 1 Thailand OR 283/99 + + + + + 2 Thailand OR 294/99 + - - + + Thailand OR 18/01 - - - + + 4 Thailand OR 204/03 - - - + + 5 Thailand OR 546/98 - - - + + 6 Thailand OR 337/98 - - - Peninsula Malaysia; Cameron Highlands OR 169/99 + + + + - Peninsula Malaysia; Cameron Highlands OR 603/99 + - - + + Peninsula Malaysia; Cameron Highlands OR 599/99 - - - + + OR 237/01 + + + + + HBV 3601 + + + + - Indonesia; Sumatra OR 276/99 + + + + + 2 Indonesia; Sumatra OR 269/99 + - - + + 3 Indonesia; Sumatra OR 148/05 + - - + + 4 Indonesia; Sumatra OR 156/05 - - - + + 5 Indonesia; Sumatra OR 150/05 - - - + - 6 Indonesia; Sumatra OR 154/05 - - - + - 7 Indonesia; Sumatra OR 158/05 - - - + - No locality information available OR 209/99 + + + + - 2 Myanmar; Shan; north of Aungban OR 228/01 + + + + - 3 Nepal OR 488/03 - - + + + Philippines; Luzon; Nueva Vizcaya OR 277/98 - - - + - OR 342/98 + + + + + Philippines; Mindanao; Surigaro del Norte OR312/98 + - - + - OR 442/03 + - - + - OR 281/98 + - - 3 a + B. polystictum Ridl. 1 2 3 a B. siamense Reichb.f. 1 a Myanmar; Shan; north of Aungban a B. smitinandii Seidenf. & Thorut 1 Thailand B. sumatranum Garay, Hamer & Siegerist 1 a Outgroups: B. affine Lindl. 1 a B. alsiosum Ames 1 a B. emiliorum Ames & Quisumb. 1 2 No locality information available a B. hamatipes J. J. Sm. 1 Java B. macranthum Lindl. 1 a Philppines; Luzon, Nueva Ecicha - 103 Appendix B. membranifolium Hook.f. 1 Peninsula Malaysia; Cameron Highlands OR 575/98 + - - + - OR 144/05 + - - + + OR 541/99 + - - + - OR 103/98 + + + + + 960106 + - - + - a B. monanthum (Kuntze) J.J. Sm. 1 No locality information available B. patens King ex Hk. f. 1 Peninsula Malaysia; Pulau Redang B. piestoglossum J.J. Vermeulen 1 a Philippines; Luzon; Bicol B. pileatum Lindl. 1* No locality information available 104 Appendix Table 8.2: Primers used for ITS and cpDNA amplification and sequencing (grey). Marker Primername Direction Sequence Literature nrDNA ITS AB 102R reverse TAGAATTCCCCGGTTCGCTCGCCGTTAC AB 101F forward ACGAATTCATGGTCCGGTGAAGTGTTCG ITS4 reverse TCCTCCGCTTATTGATATGC ITS5 forward GGAAGTAAAAGTCGTAACAAGG TAB C reverse CGAAATCGGTAGACGCTACG TAB F forward ATTTGAACTGGTGACACGAG trnHGUG reverse CGCGCATGGTGGATTCACAATCC Tate et al., 2003 psbA forward GTTATGCATGAACGTAATGCTC Sang et al., 1997 reverse ACCAATTGAACTACAATCCC forward CTACCACTGAGTTAAAAGGG reverse ACCAATTGAACTACAATCCC Demesure et al., trnEUUC forward AGGACATCTCTCTTTCAAGGAG 1995 UGA reverse GAGAGAGAGGGATTCGAACC trnfM forward CATAACCTTGAGGTCACGGG TabE reverse GGTTCAAGTCCCTCTATCCC Taberlet et al., 1991 ndhJ forward ATGCCTGAAAGTTGGATAGG Vijberg et al., 1999 rpoB reverse C(GT)ACAA(CT)CC(CT)AATTG forward CACCC(AG)GATT(CT)GAACTGGGG TabA reverse CATTACAAATGCGATGCTCT TabB forward TCTACCGATTTCGCCATATC trnSGCU reverse TTTTACCACTAAACTATACCCGC trnG2S forward GAGAGAGAGGGATTCGAACC trnYGUA reverse CCGAGCTGGATTTGAACCA trnTGGU forward CTACCACTGAGTTAAAAGGG trnSGGA reverse TTACCGAGGGTTCGAATCCCTC UGU trnT forward AGGTTAGAGCATCGCATTTG trnSGGA reverse TTACCGAGGGTTCGAATCCCTC TabB forward TCTACCGATTTCGCCATATC Sun et al., 1994 Baldwin et al.,1992 cpDNA trnL-trnF trnH-psbA trnD-trnT trnD-trnE trnS-trnfM trnL-ndhJ rpoB-trnC trnD trnS-trnG trnY-trnT trnS-trnT trnS-trnL F trnTGGU trnD GUC F trnS CAU trnC trnT-trnL GUC GCA CCCTTCATTCTTCCTCTACTATGTTG Taberlet et al., 1991 Ohsako et al., 2000 Taberlet et al., 1991 Hamilton, 1999 Demesure et al., 1995 Shaw et al., 2005 Taberlet et al., 1991 rpL16- rpL16R1516 reverse Intron rpL16F71 forward GCTATGCTTAGTGTGTGACTCGTT rpS16- rps16R reverse AACATC(AT)ATTGCAA(GC)GATTCGATA Oxelman et al., Intron rps16F forward AAACGATGTGGTA(AG)AAAGCAA 1997 Small et al., 1998 105 Appendix Table 8.3: Mastermix for cpDNA and ITS amplification Reagent Volume in µl Purified water 7.45 F-Taq polymerase buffer (10x) 5 MgCl2 (25 mM) 8 BSA (20 mg/ml) 1 dNTP mix (10 mM of each dNTP) 1 Primer 1 (10 µM) 1 Primer 2 (10 µM) 1 F-Taq polymerase (Fermentas; 5 U/µl) 0.25 Table 8.4: PCR-programmes for amplification of ITS and cpDNA regions. Temperature Region Cycle (°C) Time 1 94 2 min 94 1 min 50 1 min 72 2 min 1 72 7 min 1 94 3 min 94 30 sec ndhj, trnS-trnfM, 30 55 30 sec trnH-psbA 72 1 min 40 sec 1 72 7 min 1 96 5 min 96 1 min 57 2 min 72 3 min 1 72 7 min 1 94 5 min 94 45 sec 58 30 sec 72 1 min 72 5 min ITS trnL-trnF, rpoB-trnC, trnS-trnG trnD-trnE, trnT-trnL 35 trnL- 30 25 1 106 Appendix Table 8.5: Primers used in the primer-trial for AFLP analysis. Primers coloured, according to their fluorescence, were finally used for analysis. Labelling Primer 1 Primer sequence 1 Primer 2 Primer sequence 2 EcoRI GACTGCGTACCAATTC MseI GATGAGTCCTGAGTAA MseIx M-C Preselective PCR EcoRIx E-A Selective PCR Blue (6- FAM) Yellow (NED) EcoRIxxx E-ACG M-CAT E-ACT M-CAG E-ATC M-CTA E-ACA M-CAC E-AAC M-CTT E-AAC MseIxxx M-CTG E-AAC M-CAG E-ACC M-CAT E-AAG M-CTG Green E-AGG M-CAA (VIC) E-ACG M-CTT E-AGG M-CTG Table 8.6: Restriction-digestion reaction mix using 5.5 µl (500 ng) DNA. Reagent Volume in µl Purified water 0.405 T4 DNA ligase buffer (10x) 1.1 NaCl (500 mM) 1.1 BSA (1 mg/ml) 0.55 MseI restriction endonuclease (50 U/µl) 0.02 EcoRI restriction endonuclease (40 U/µl) 0.125 T4 DNA ligase (5 U/µl) 0.2 MseI adapter pair (10 µM) 1 EcoRI adapter pair (10 µM) 1 107 Appendix Table 8.7: Pre-selective PCR for 1.5 µl Restriction-digestion solution (10 x diluted). Reagent Volume in µl Purified water 7.45 AmpliTaq polymerase buffer (10x) 1.25 MgCl2 (25 mM) 0.75 dNTP mix (10 mM of each dNTP) 1 EcoRI primer (E.A; 10 µM) 0.25 MseI primer (M.C; 10 µM) 0.25 AmpliTaq polymerase 0.05 (Applied Biosystems; 10 U/µl) Table 8.8: Selective PCR for 1.5 µl pre-selective PCR product (10 x diluted). Reagent Volume in µl Purified water 5.95 AmpliTaqGold polymerase buffer (10x) 1.25 MgCl2 (25 mM) 1.25 dNTP mix (10 mM of each dNTP) 1 BSA (1mg/ml) 0.1 EcoRI primer (E.AXX; 10 µM) 0.1 MseI primer (M.CXX; 10 µM) 0.25 AmpliTaqGold polymerase 0.1 (Applied Biosystems; 10 U/µl) 108 Appendix Table 8.9: PCR programmes used for (pre-)selective fragment amplification in the AFLP analysis. Preselective Cycle Temperature (°C) Time 1 72 2 min 94 30 sec 56 30 sec 72 1 min 1 72 10 min 1 95 10 min 94 30 sec 65 - 56 decrease by 0.7 1 min 72 1 min 94 30 sec 56 1 min 72 1 min 72 10 min 30 13 Selective 23 1 109 Pictures of the B. lobbii complex and extra-complex species 9. Colour plates of the B. lobbii complex and extracomplex species Fig. 9.1: Bulbophyllum lobbii (15), Sulawesi; Bulbophyllum hyalosemoides ined. (clade A). Picture taken by Dr. J. J. Vermeulen Fig. 9.2: Bulbophyllum microglossum, Cameron Highlands/Peninsula Malaysia (clade B). 110 Pictures of the B. lobbii complex and extra-complex species Fig. 9.3: Bulbophyllum coweniorum (1), Luzon/Philippines (clade C). Fig. 9.4: Bulbophyllum coweniorum, Luzon/Philippines (clade C). 111 Pictures of the B. lobbii complex and extra-complex species Fig. 9.5: Bulbophyllum facetum (2), Luzon/Philippines (clade D). Fig. 9.6: Bulbophyllum polystictum (3), Cameron Highlands/Malaysia (subclade E1). 112 Pictures of the B. lobbii complex and extra-complex species Fig. 9.7: Bulbophyllum polystictum, Cameron Highlands/Malaysia (subclade E1). Fig. 9.8: Bulbophyllum lobbii (2), Luzon/Philippines (subclade E1). 113 Pictures of the B. lobbii complex and extra-complex species Fig. 9.9: Bulbophyllum lobbii (23), Bali (subclade E1). Fig. 9.10: Bulbophyllum lobbii, Borneo (subclade E1). 114 Pictures of the B. lobbii complex and extra-complex species Fig. 9.11: Bulbophyllum orectopetalum (3), Thailand (subclade E2). Fig. 9.12: Bulbophyllum cameronense (2), Cameron Highlands/Malaysia (subclade E2). 115 Pictures of the B. lobbii complex and extra-complex species Fig. 9.13: Bulbophyllum siamense (subclade E2). Picture taken by A. Sieder. Fig. 9.14: Bulbophyllum lobbii (33), Luzon/Philippines (subclade E2). 116 Pictures of the B. lobbii complex and extra-complex species Fig. 9.15: Bulbophyllum dearei (1), Mindanao/Philippines (subclade E3). Fig. 9.16: Bulbophyllum dearei (1), Mindanao/Philippines (subclade E3). 117 Pictures of the B. lobbii complex and extra-complex species Fig. 9.17: Bulbophyllum lobbii (1), Luzon/Philippines (subclade E3). Fig. 9.18: Bulbophyllum sumatranum (1), Sumatra (subclade E4). 118 Pictures of the B. lobbii complex and extra-complex species Fig. 9.19: Bulbophyllum sumatranum, Sumatra (subclade E4). Fig. 9.20: Bulbophyllum lobbii (7), Palawan/Philippines (subclade E4). 119 Pictures of the B. lobbii complex and extra-complex species Fig. 9.21: Bulbophyllum smitinandii, Thailand. Picture taken by Suitee. Fig. 9.22: Bulbophyllum piestoglossum (1), Luzon/Philippines (extra-complex). 120 Pictures of the B. lobbii complex and extra-complex species Fig. 9.23: Bulbophyllum monanthum (extra-complex). Fig. 9.24: Bulbophyllum emiliorum (2), Mindanao/Philippines (extra-complex). 121 Pictures of the B. lobbii complex and extra-complex species Fig. 9.25: Bulbophyllum affine ((1); extra-complex). Fig. 9.26: Bulbophyllum macranthum (1), Luzon/Philippines (extra-complex). 122 Pictures of the B. lobbii complex and extra-complex species Fig. 9.27: Bulbophyllum alsiosum (extra-complex). Picture taken by A. Sieder. 123 Acknoledgements Acknowledgements I would like to thank all the people supporting me in writing my master thesis, especially: Prof. Dr. Hans Peter Comes (supervisor), Department of Organismic Biology, Study Group Ecology and Biodiversity of Plants, University of Salzburg, Austria. Mag. Gunter Fischer (for the possibility to ask all kinds of questions), Department of Organismic Biology, Study Group Ecology and Biodiversity of Plants, University of Salzburg, Austria. Labor of Prof. Dr. Tod F. Stuessy, especially Dr. Peter Schönswetter and Prof Dr. Rose Samuel (for helping in AFLP-fingerprint technique), Department of Sytematic and Evolutionary Botany, University of Vienna, Austria. Dr. Jaap Jan Vermeulen (for supporting silica dried leaf material and aiding in morphological analysis), Nationaal Herbarium Nederland, Universit of Leiden, The Netherlands. Anton Sieder (for searching in literature and supporting some plants), Botanical Garden, University of Vienna, Austria. Elisabeth Egger (for attendance of the plants), Botanical Garden, University of Salzburg, Austria. Mag. Birgit Fuchs and Mag. Cornelia Moser (for helping in the lab), Department of Organismic Biology, Study Group Ecology and Biodiversity of Plants, University of Salzburg, Austria. 124 Curriculum vitae Curriculum vitae Curriculum Vitae Gerald Hochschartner Weyerstrasse 15 4810 Gmunden Austria Tel.: +43 650 8615198 E-mail: gerald.hochschartner@sbg.ac.at Personal Information Date of birth: Place of birth: Nationality: Marital status: Children: April 11, 1974 Gmunden, Austria Austrian Single None Education 1989 – 1993 1995 – 1999 2000 – 2004 Since February 2004 Since April 2005 Electrician apprenticeship at Steyrermühl Papier AG, Steyrermühl, Austria; Final exam in February 1993 Commercial School (part-time) in Vöcklabruck, Austria; Diploma in June 1999 Studies in Genetics and Molecular Biology at the University of Salzburg, Austria; Bachelor degree in Biology (Bakk. Biol) in February 2004 Student of Genetics/Biotechnology and Botany/Plant Biology at the University of Salzburg, Austria Master thesis on molecular biogeography of the Bulbophyllum lobbii-complex (Sect. Sestochilos, Orchidaceae) in Southeast-Asia; Supervisor Prof. H. P. Comes 125 Curriculum vitae Previous Activities 1993 1993 – 1994 1994 – 1995 1995 1996 1997 – 1999 2000 Summer 2001, 2003, 2004 Military Service, Austria Assistant at the paper factory in Steyrermühl Electrician for B.C. Industry Montage at Jenbacher Werke, Jenbach Electrician for Dorner & Mayer at the petroleum factory OMV, Vienna Electrician at Ebner Productronic, Gmunden Electrician at Ing. Pesendorfer Engineering, Gmunden Electrician at Ing. Rauch Industrial Engineering, Gmunden Electrician for Johann Schmid Ges.M.B.H. & Co. KG at various companies in Bad Vöslau, Vienna and Lenzing Additional scientific experience August 2002 October 2005 Practical training at the hospital Elisabetinnen (Department for molecular biology), Linz Short term mission to the University of Vienna for AFLP-analysis Conferences 2005 Participation at XVII International Botanical Congress, Vienna, Austria Additional qualifications and Interests Languages Computer skills Sports Other interests German (mother tongue), English (fluent) and French (Basic knowledge) Basic knowledge in C and Python Hiking, Mountain climbing (also in winter with skis), Mountain biking, skiing, running, swimming, soccer Reading, travelling, art and culture 126