Azarian J. Agric. VOL (4) ISSUE 5, 2017: 176-184 Azarian Journal of Agriculture www.azarianjournals.ir Research article Azarian Journals ISSN:2383-4420 Morphological and phylogenetic analyses of Uromyces Gagea on Gajea lutea in Iran Vahid Roumi*, Mohammad Reza Azamparsa Article Info Accepted: 3 Aug. 2017 Keywords: Gajea lutea, ITS, rust, Teliospore, Recombination ABSTRACT Typical rust symptoms were observed on leaves of Gajea lutea plants collected from wheat fields in Maragheh, Northwest of Iran, in May 2017. Black, circular to elongated or diamond-shaped telial pustules 1-3 mm long were found on both sides of the leaves. Under light microscope, stalked, one- celled teliospores 22.5-37.5×17.5-22.5 μm were observed. The ITS region of DNA was amplified from teliospores and sequenced. Based on classical and molecular analyses, we report Uromyces Gagea from Iran. INTRODUCTION1 R Rusts are among the most economically important diseases of cereal crops worldwide. The members of the former order Uredinales are commonly known as rust fungi because of having characteristic rusty, reddish-brown colour of their spore clusters that appear on pustules. (Alexopoulos et al. 1996, Voegele et al. 2009). Taxonomy of these fungi has changed recently and they have been placed in Pucciniales (Basidiomycota, Pucciniomycotina, Pucciniomycetes) (Matheny et al. 2007, Aime et al. 2007). Uromyces (Pucciniaceae) is the second largestgenus of rust fungi with about 600 species. It has characteristic stalked, one-celled teliospores. The fungus may be heteroecious or autoecious which generally cause rust disease on legumes, barley and a wide range of weeds as alternate host (Maier et al. 2003). Gagea lutea (L.) Ker Gawl. (Yellow Star of Bethlehem) is a spring short-lived plant in Liliaceae Family, which is widely distributed from Western Europe to eastern Asia, Georgia, Northern Department of Plant Protection, Faculty of Agriculture, University of Maragheh, Maragheh, Iran. P. O. Box: 55163-553. *Email: vroumi@maragheh.ac.ir  176 Iran and Afghanistan. It needs moist and shady habitats and found near cultivated fields and orchards under a canopy of shrubs (Zarrei et al. 2007). Ershad (2009) has listed three different rust fungi on Gagea sp. including Puccinia pachyderma Wettst. from Haraz, Kakan (Jorstad 1960, ViennotBourgin et. al. 1970), Uromyces acutatus Fuckel from Soltanabad (Magnus 1899) and U. muscari (Duby) Graves from Kuhe Khami (Ershad & Abbasi 1992). The rust Uromyces gageae have been reported on Gagea lutea from England and Ireland (Evans et al, 2006, Look 2015). In this study, the fungus causing rust on Gagea lutea was studied using classical and molecular methods. MATERIALS AND METHODS Plant Material During a survey, Gajea lutea plants showing typical rust symptoms were observed on wheat fields around Maragheh, northwest of Iran, in May 2017. Dried infected plants were preserved in herbarium of Department of Plant Pathology, University of Maragheh, Maragheh, Iran. Light Microscopy Fifty teliosporers were studied under a light microscope (Olympus, CH-2) at 1000× magnification. To avoid contamination risk, teliospores were removed with a needle and placed in a drop of lactophenol on a microscope slide. Images were captured using Dino-Lite and the Roumi and Azamparsa length, width of teliospores and pedicels as well as teliospore wall thickness were measured using an ocular micrometer (Verma 2001). A slide was sealed with nail polish and preserved as a voucher. DNA Extraction, PCR and Sequencing DNA was extracted from the teliospore by CTAB extraction method (Clarke 2009). The ITS15.8S-ITS2 regions of the rDNA were amplified by polymerase chain reaction (PCR) using ITS4 (5’TCCTCCGCTTATT GATATGC-3) and ITS1F (5′CTTGGTCATTTAGAGGAAGTAA 3′) universal primers (de la Cerda et al. 2007; Gardes and Bruns 1993; White et al. 1990). Amplification reactions and thermal cycling conditions were same as those described by Roumi and Sharzei (2017). The PCR product was purified using a PCR purification kit (Bioneer, South Korea) and directly sequenced in both directions using an automated ABI3730XL sequencer (Applied Biosystems) (Macrogen, South Korea). The nucleotide sequences were edited with BioEdit software (Hall 1999) assembled by ContigExpress programme included in the VectorNTI package (Invitrogen, USA) and the contig was compared with the DNA sequences available in GenBank database. Phylogenetic analysis Consensus sequences were compared against GenBank database using MegaBLAST. Based on the BLASTn results, sequences with highest Figure 1. Rust symptoms on Gagea lutea plants. Circular to elongated or diamond-shaped pustules 1-3 mm long were found on both sides of the leaves. 177 Vol 4 Issue (5):176-184 identities were selected and downloaded in FASTA format. The sequences were aligned by the multiple sequence alignment program Clustal W (Larkin et al. 2007), embedded in MEGA v.7 software (Kumar et al. 2016). The sequences were trimmed to same length sequences as the reference sequences (Uromyces gagea, U. muscari). Phylogenetic analyses were conducted in MEGA7 by the maximum likelihood method. Gaps were treated as missing data. The best nucleotide substitution model was estimated and general timereversible model assuming gamma distribution with invariant sites (GTR+G+I) (Nei and Kumar 2000) which had the lowest BIC (Bayesian Information Criterion) and AICc (Akaike Information Criterion, corrected) values was chosen. Bootstrap analysis using 1000 replications was performed to evaluate strength of tree topologies (Felsenstein 1985). The nucleotide sequence of Puccinia dichondrae isolate SRG (Accession no. FN298146) was used as out-group. Recombination analysis Recombination events among corresponding sequences downloaded from GenBank were estimated using Recombination Detection Program pack (RDP4) (Martin et al. 2015) including RDP, GENECONV, BOOTSCAN, MAXCHI, CHIMERA, SISCAN, 3SEQ, and LARD. Secondary scan was enabled for BOOTSCAN and SISCAN programs. Highest acceptable P- value was 0.05. Only those recombination signals predicted by at least two of these methods were regarded as valid. Trees of regions derived from Figure 2. Light brown, globose, ovoid, obovoid and ellipsoid teliospores of Uromyces sp. (X 400) captured by Dino Lite. Scale bar = 25 µm. Roumi and Azamparsa Vol 4 Issue (5):176-184 10 20 30 40 50 60 70 80 90 100 ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| KY996750.1 Uromyces gageae TGCAGA-TTC AGTGA-TCAT CGAATCTTTG AACGCATCTT GCGCCTTTTG GTATTCCAAA AGGCACACCT GTTTGAGTGT CATGAAACCC T-CTCACAGA KY996747.1 Uromyces gageae ......-... .....-.... .......... .......... .......... .......... .......... .......... .......... .-........ KY996749.1 Uromyces gageae KY996748.1 Uromyces gageae HQ317552.1 Uromyces muscari Uromyces sp. ......-... .....-.... ........C. .......... .......... .......... .......... .......... .......... .-........ ......-... .....A.... .......... .......... .......... .......... .......... .......... .......... .-........ ......A... .....A.... .......... .......... .......... .......... .......... .......... .......... .-....TTA. ......A... .....A.... .......... .......... .......... .......... .......... .......... .......... .-......A. 110 120 130 140 150 160 170 180 190 200 ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| KY996750.1 Uromyces gageae ATAATTTTTG TT-------- AATTATTTTA GTGGATGTTG AGTGTT-GCT GT-AATTA-- -GCTCACTTT AAATATATAA GTCACTTTT- -CATATAAGT KY996747.1 Uromyces gageae .......... ..-------- .......... .......... ......-... ..-.....-- -......... .......... .........- -......... KY996749.1 Uromyces gageae KY996748.1 Uromyces gageae HQ317552.1 Uromyces muscari Uromyces sp. .......... ..-------- .......... .......... ......-... ..-.....-- -......... .......... .........- -......... .......... ..-------- .......... .......... ......-... ..-.....-- -......... .......... .........- -......... ..C.....GT .CTTG-AACA .GA..G.... .......... ......-... T.-TG...-- -......... ........C. ..T......T T..A..G... .........A ..-------- .G........ ......T... ......-... ..-.....-- -......... ....T..... .........- -..A....T. 210 220 230 240 250 260 270 280 290 300 ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| KY996750.1 Uromyces gageae TGGATTGACT TGG---TGTA ATAATTTTAT C--ATCACAT CAAGGAAAGT AGC--AGTAC TTGCCATCTT ---TCTTGA- --AAGGAG-- GCTCCTAAAA KY996747.1 Uromyces gageae .......... ...---.... .......... .--....... .......... ...--.A... .......... ---......- --......-- .......... KY996749.1 Uromyces gageae KY996748.1 Uromyces gageae HQ317552.1 Uromyces muscari Uromyces sp. .......... ...---.... .......... .--....... .......... ...--.A... .......... ---......- --......-- .......... .......... ...---.... .......... .--....... .......... ...--.A... .......... ---......- --......-- .......... .......... ...---.... .......... .--....... .......... ...--.A... .......... ---G---A.- --..AAG.-- A..T...... .......... ...---.... .......... .--....... .......... ...--.A... .......... ---.T..A.- --......-- A....C.... 310 KY996750.1 Uromyces gageae 320 330 340 350 360 370 380 390 ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ATGTTC--AT -----ATAA- -----TTTTT AAGACCTCAA ATCAGGTGGG ACTACCCGCT GAACTTAAGC ATATCAATAA GCGGAGGAAA KY996749.1 Uromyces gageae ......--.. -----....- -----..... .......... .......... .......... .......... .......... .......... KY996748.1 Uromyces gageae ......--.. -----....- -----..... .......... .......... .......... .......... .......... .........- KY996747.1 Uromyces gageae HQ317552.1 Uromyces muscari Uromyces sp. ......--.. -----....- -----..... .......... .......... .......... .......... .......... .......... .ACCCA---- -ATTA..T.- -----..A.. .......... .......... .......... .......... .......... .......... CCCCCA---- ----T..C.- -----..... .......... .......... ......T... .......... .......... ........CT Figure 3. The multiple alignment of the studied sequence and those were reported on Gagea sp. available in GenBank using ClustalW program. major and minor parents were calculated using different methods including UPGMA, neighbor joining, maximum likelihood and Bayesian in the default settings. RESULTS Symptoms and Occurrence of the Disease Typical rust pustules covered by black teliospores were observed on Gagea lutea plants. Circular to elongated or diamond-shaped pustules 1-3 mm long were found on both sides of the leaves (Figure 1). Micrometry Under light microscope, light brown, stalked, one- celled teliospores 22.5-37.5×17.5-22.5 μm were observed (Figure 2). They had a variety of shapes including globose, ovoid, obovoid and ellipsoid. Average thickness of teliospore wall was 2.5 μm. Pedicels were hyaline 5-12.5× 2.5-5 μm. Sequence analyses The amplification of ITS rDNA region resulted in 720bp assembled contig which was deposited into the Genbank under accession number MF773581. The multiple alignment of studied sequence with six most similar sequences is shown in Figure 3. The evolutionary history was reconstructed by using the Maximum Likelihood method based on the GTR+G+I model. The tree 178 with the highest log likelihood (-6016.3774) is shown in Figure 4. Results showed that the studied rust fungus and four U. gagea isolates (Accession No. KY996750, KY996749, KY996747 and KY996748) reported from China clustered together. Recombination The results showed U. gagea is a recombinant, which have arisen from U. beticola (Figures 5- 6). Sequences with evidence of the same recombination event were including Puccinia coronata var. avena and Uromyces erythronii. UPGMA tree of regions derived from major parent (1-569 and 649-720) (Figure 6) resulted in same topology as original tree. UPGMA tree of ignoring recombination was the same (Data not shown). UPGMA tree of regions derived from minor parent (570-648) showed dramatic change in toplogy of original tree (Figure 7). As a result the studied fungus placed next to Puccinia coronata var. avena in a separate clade. Fastnj, NJ and ML of nonrecombinant regions did not change the topology and position of the fungus (Data not shown). DISCUSSION Studied Uromyces sp. is phylogenetically divergent from the other taxa deposited in GenBank so far. Meanwhile, formed a sister clade with Uromyces gagea isolates. Surprisingly, based on a Blastn search of GenBank, the closest hits Roumi and Azamparsa Vol 4 Issue (5):176-184 Figure 4. Phylogenetic trees constructed by Maximum Likelihood method from ITS1-5.8S rDNA-ITS2 regions of the Uromyces sp. described in the present study (in bold) and those of related species from GenBank. The bootstrap values are shown next to the branches. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. using the ITS sequence were Puccinia striiformis isolates PST-01 (92 % identities over 99% query coverage) (GenBank accession number KY354584) followed by 17 different isolates of P. striiformis. Blastn search was repeated against Uromyces (taxid:5263) and we found 90 % identities over 100% query coverage with Uromyces aemulus isolate HSZ0345 (accession number AF511081.1). The situation led us to perform recombination 179 detection tests and we found out that the Uromyces sp. is a recombinant and several fungi including P. striiformis had trace evidence of recombination. In identification keys for Uromyces species, the species are separated by the shape and ornamentation of the teliospores, aecia, aeciospores, presence or absence of the uredinial phase, and host species. The Uromyces gageae Roumi and Azamparsa Vol 4 Issue (5):176-184 DQ460722.1 Puccinia persistens isolate HSZ0984 18S KY678771.1 Uromyces beticola isolate Ub7 small sub KR230396.1 Puccinia triticina isolate abc3 18S rib KY678771.1 Uromyces beticola isolate Ub7 small sub GQ457303.1 Puccinia brachypodii isolate HSZ0975 18 Muscari AY956560.1 Puccinia pseudostriiformis voucher IRAN Muscari DQ417408.1 Puccinia striiformis f. sp. hordei stra GU382671.1 Puccinia striiformis f. sp. tritici vou Unknown AY956563.1 Aecidium sp. IRAN 11487 F 18S ribosomal KY678771.1 Uromyces beticola isolate Ub7 small sub HQ317552.1 Uromyces muscari strain DAOM 75626 5.8S KY678771.1 Uromyces beticola isolate Ub7 small sub Muscari KY678771.1 Uromyces beticola isolate Ub7 small sub Gagea KY678771.1 Uromyces beticola isolate Ub7 small sub KY996750.1 Uromyces gageae isolate R2I4-4 5.8S rib KY996749.1 Uromyces gageae isolate R2I4-3 5.8S rib KY996747.1 Uromyces gageae isolate R2I4-1 5.8S rib KY996748.1 Uromyces gageae isolate R2I4-2 5.8S rib AF511081.1 Uromyces aemulus isolate HSZ0345 18S ri Unknown AF511085.1 Uromyces scillarum isolate 3465 18S rib KY678771.1 Uromyces beticola isolate Ub7 small sub AY302495.1 Uromyces scillarum 18S ribosomal RNA ge KY678771.1 Uromyces beticola isolate Ub7 small sub AF511084.1 Uromyces reichertii isolate 6421 18S ri KY678771.1 Uromyces beticola isolate Ub7 small sub LC203758.1 Uromyces durus genes for 18S rRNA ITS1 KY678771.1 Uromyces beticola isolate Ub7 small sub LC203755.1 Uromyces erythronii genes for 18S rRNA KY678771.1 Uromyces beticola isolate Ub7 small sub HM057148.1 Uromyces dactylidis strain DAOM 216236 KY678771.1 Uromyces beticola isolate Ub7 small sub FJ468413.1 Uromyces viciae-fabae isolate 33 18S ri FJ468419.1 Uromyces viciae-fabae isolate 41 18S ri FJ468399.1 Uromyces viciae-fabae isolate 5 18S rib AB085192.1 Uromyces fabae genes for 18S rRNA ITS1 AB115662.1 Uromyces viciae-fabae genes for 18S rRN AB085194.1 Uromyces fabae genes for 18S rRNA ITS1 AB085193.1 Uromyces fabae genes for 18S rRNA ITS1 KM667950.1 Uromyces dactylidis voucher PRC:692 18S KY678771.1 Uromyces beticola isolate Ub7 small sub KM667956.1 Uromyces sp. 2014A 18S ribosomal RNA ge KY678771.1 Uromyces beticola isolate Ub7 small sub KM667957.1 Uromyces sp. 2014B 18S ribosomal RNA ge KY678771.1 Uromyces beticola isolate Ub7 small sub KM667955.1 Uromyces dactylidis var. poae voucher P KY678771.1 Uromyces beticola isolate Ub7 small sub KM667953.1 Uromyces dactylidis var. poae voucher P KY678771.1 Uromyces beticola isolate Ub7 small sub KM667958.1 Uromyces sp. 2014C 18S ribosomal RNA ge KY678771.1 Uromyces beticola isolate Ub7 small sub AY187086.1 Uromyces hordeinus strain 120 internal KY678770.1 Uromyces beticola isolate Ub4 small sub JQ777001.1 Uromyces transversalis clone ATLIX11 1 Figure 5. Graphical demonstration of recombination events in studied sequences. The results of RDP4 analysis showed U. gagea is a recombinant, which have arisen from U. beticola. 180 Roumi and Azamparsa Vol 4 Issue (5):176-184 Figure 6. UPGMA of regions derived from major parent (positions 1-569 and 649-720). The sequence used to infer unknown parent is green highlighted. 181 Roumi and Azamparsa Figure 7. UPGMA tree of regions derived from minor parent (positions 570-648). 182 Vol 4 Issue (5):176-184 Roumi and Azamparsa fungus has been reported on Gagea lutea in UK and Ireland (Evans et al, 2006), which has teliospore size of 26-40x18-28μm. Several different fungi have been reported on Gagea sp. from Iran (Ershad and Abbasi 1992), but molecular and phylogenetic analyses grouped this isolate together with U. gagea isolates. Furthermore, the teliospore size of our isolate ranged from 22.5-37.5×17.5-22.5 μm which is close to those of U. gagea and could be considered as within species variation. Taken together morphological studies and phylogenetic analysis of ITS sequence, we concluded that the fungal species causing rust on G. lutea is U. gagea. The rust fungi from Iran are poorly characterized by molecular approaches and additional sequence data are needed to further elucidation of the phylogeny of rust fungi in Iran. REFERENCES Aime M.C. Matheny P.B. Henk D.A. Frieders E.M. Nilsson R.H. Piepenbring M. McLaughlin D.J. Szabo L.J. Begerow D. Sampaio J.P. Bauer R. Weiß M. Oberwinkler F. Hibbett D.S. (2007) An overview of the higher-level classification of Pucciniomycotina based on combined analyses of nuclear large and small subunit rDNA sequences. Mycologia, 98: 896–905. Alexopoulos C.J. Mims C.W. Blackwell M. (1996) Introductory mycology. Wiley, New York. Baxter J. W. (1955) Species of Puccinia on Salvia in Europe, Asia, and Africa. Mycologia, 47(2): 225-232. Clarke J. D. (2009). Cetyltrimethyl Ammonium Bromide (CTAB) DNA Miniprep for Plant DNA Isolation. Cold Spring Harbor Protocols, doi:10.1101/pdb. prot5177. Cummins, G.B. (1971) The rust fungi of cereals and grasses. Springer, Berlin, 570 pp. De la Cerda K.A. Douhan G.W. Wong F.P. (2007) Discovery and characterization of Waitea circinata var. circinata affecting annual bluegrass from the western United States. Plant Diseases, 91: 791-797. Ershad D. (1995) Fungi of Iran. 2nd Ed. Agricultural Research. Education and Extension Organization, Publication No. 10, Tehran, 874+14 pp. Ershad D. Abbasi M. (1992) Studies in the rust fungi of Iran. Iran. J. Plant Path. 28: 51-73. Esfandiari E. (1948) Troisième liste des fungi ramassés en Iran. Entomologie et Phytopathologie Appliquees, 8: 1–15. Evans S. Henrici A. Ing B. (2006). "The Red Data List of Threatened British Fungi: Preliminary Assessment. “Unpublished report. British Mycological Society. Manchester. URL: http://www.britmycolsoc.org.uk/mycology/co nservation/red-data-list/. 183 Vol 4 Issue (5):176-184 Felsenstein J. (1985) Confidence limits on phylogenies: An approach using the bootstrap. Evolution, 39: 783-791. Gardes M. Bruns T.D. (1993) ITS primers with enhanced specificity for Basidiomycetes Application to the identification of mycorrhizae and rusts. Mol. Ecol. 2: 113-118. Gjaerum H.B. (1986) Rust fungi (Uredinales) from Iran and Afghanistan. Sydowia, 39: 68-100. Hall T.A. (1999) BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95-98. Holliday P. (1980) Fungus Diseases of Tropical Crops. Cambridge University Press. Cambridge, UK. Jorstad, I. 1960. Iranian plants collected by Per Wendelbo in 1959, II Uredinales and some other parasitic fungi. Arbok for Universitetet i Bergen. Matematisk-naturvitenskapelig Serie, 11: 1–33. Khabiri E. (1952) Contribution à la mycoflore de l Iran. Première liste. Revue de Mycologie, 17: 154–157. Kumar S. Stecher G. Tamura K. (2016) MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Molecular Biology and Evolution, 33(7):1870-4. Larkin M.A. Blackshields G. Brown N.P. Chenna R. McGettigan P.A. McWilliam H. Valentin F. Wallace I.M. Wilm A. Lopez R. Thompson J.D. Gibson T.J. Higgins D.G. (2007) ClustalW and ClustalX version 2. Bioinformatics, 23(21): 2947-2948. Look W. (2015) Lost and Found Fungi Factsheet. Vankya ornithogali. URL: http://fungi.myspecies.info/taxonomy/term/68 49/descriptions Magnus P. (1899) J. Bornmüller, Iter Persicoturcicum 1892/93. Fungi, Pars II. Ein Beitrag zur Kenntnis der Pilze des Orients. Verh. K. K. Zool.-Bot. Gesellsch. Wien 49: 87–103. Maier W. Begerow D. Weiß M. Oberwinkler F. (2003) Phylogeny of the rust fungi: an approach using nuclear large subunit ribosomal DNA sequences. Canadian Journal of Botany, 81: 12–23. Martin D.P. Murrell B. Golden M. Khoosal A. Muhire B. (2015) RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evolution, 1: vev003 Matheny P.B. Gossman J.A. Zalar P. Arun Kumar T.K. Hibbett D.S. (2007) Resolving the phylogenetic position of the Wallemiomycetes: an enigmatic major lineage of Basidiomycota. Canadian Journal of Botany, 84: 1794–1805. Moaven E. Abbasi M. Soleimani M.J. Moussavi M. (2005) A report on the rust fungi of Hamedan Province (Iran). Rostaniha, 6: 31–45 (in Persian) & 9–16 (in English). Roumi and Azamparsa Nei M. and Kumar S. (2000). Molecular Evolution and Phylogenetics. Oxford University Press, New York. Petrak F. (1939) Fungi in K.H. Rechinger: Ergebnisse einer botanischen Reise nach dem Iran, 1937. Annalen des Naturhistorischen Museums in Wien, 50: 414–521. Roumi V. Sharzei A. (2017) First report of Ceratocephalus falcatus smut caused byUrocystis eranthidis. Azarian Journal of Agriculture, 4: 24-28. Verma G. P. (2001) Techniques Used in Histology. Chapter 1 in: Fundamentals of Histology, New Age International (P) Limited, Publishers. Viennot-Bourgin G. Scharif G. Eskandari F. (1969) Nouvelle contribution à la connaissance des micromycetes parasites en Iran. Entomologie et Phytopathologie Appliquees, 28: 3–26. Viennot-Bourgin G. Alé-Agha N. Ershad D. (1970) Les champignons parasites de l Iran. (Nouvelle) contribution). Annales de phytopathologie, 2(4): 689–734. 184 Vol 4 Issue (5):176-184 Voegele R. T. Matthias H. Kurt M. (2009) The Uredinales: Cytology, Biochemistry, and Molecular Biology. The Mycota, 5. Plant relationships / Vol. ed.: H. B. Deising. Berlin: Springer, 2009, 2. ed., pp. 69-98. White T.J. Bruns T. Lee S. Taylor J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis A. Gelfand D.H. Sninsky J.J. White T.J. (eds.) PCR Protocols: A guide to Methods and Applications. Academic Press. pp. 315-322. Wilson M. Henderson D.M. (1966) British rust Fungi. Cambridge University Press, Cambridge, 384 pp. Zarrei M. Zarre S. Wilkin P. W. Rix M. (2007) Systematic revision of the genus Gagea Salisb. (Liliaceae) in Iran. Botanical Journal of the Linnean Society, 154: 559–588. griculture and trade acti