Article (refereed) Hernandez, G.; Buonamici, A.; Walker, K.; Vendramin, G. G.; Navarro, C.; Cavers, S.. 2008 Isolation and characterization of microsatellite markers for Cedrela odorata L. (Meliaceae), a high value neotropical tree. Conservation Genetics, 9, 2. 457-459. doi:10.1007/s10592-007-9334-y Copyright: Springer Verlag 2008 This version available at http://nora.nerc.ac.uk/2649/ NERC has developed NORA to enable users to access research outputs wholly or partially funded by NERC. Copyright and other rights for material on this site are retained by the authors and/or other rights owners. Users should read the terms and conditions of use of this material at http://nora.nerc.ac.uk/policies.html#access This document is the author’s final manuscript version of the journal article, incorporating any revisions agreed during the peer review process. Some differences between this and the publisher’s version remain. You are advised to consult the publisher’s version if you wish to cite from this article. The original publication is available at www.springerlink.com Contact CEH NORA team at nora@ceh.ac.uk 1 Isolation and characterization of microsatellite markers for Cedrela odorata L. 2 (Meliaceae), a high value neotropical tree. 3 4 Running title (45 chars): Microsatellites for Cedrela odorata 5 6 Hernandez G1,2, Buonamici A3, Walker K2, Vendramin GG3, Navarro C1 and Cavers S2,* 7 8 1 9 Rica Centro Agrónomico Tropical de Investigación y Enseñanza, Cartago, Turrialba 7170, Costa 10 11 2 12 Midlothian EH26 0QB, Scotland, UK NERC Centre for Ecology and Hydrology, CEH Edinburgh, Bush Estate, Penicuik, 13 14 3 15 (Florence), Italy. Plant Genetics Institute, Consiglio Nazionale delle Ricerche (CNR), 50019 Sesto Fiorentino 16 17 * 18 Hydrology Edinburgh, Bush Estate, Penicuik, Midlothian EH26 0QB, Scotland, UK. Tel. +44 19 131 445 4343, Fax. +44 131 445 3943, Email scav@ceh.ac.uk To whom correspondence should be addressed: Dr S Cavers, Centre for Ecology and 20 21 Keywords (5): Cedrela odorata, Cedar, Meliaceae, microsatellites 1 1 Abstract (82 words) 2 We describe 9 primers for amplification of microsatellite loci for the Neotropical tree Cedrela 3 odorata L. (Meliaceae). Loci were isolated from an enriched library derived from a single 4 DNA sample from a tree in Costa Rica. Levels of polymorphism were determined using 5 samples from a large progeny trial. Across loci, the number of alleles ranged from 14 to 30. 6 Observed heterozygosity levels ranged from 0.61 to 0.88. No linkage disequilibria were 7 detected although some departures from HWE were found, probably due to a Wahlund effect. 2 1 Cedrela odorata (Meliaceae), known as Cedro Amargo or Spanish Cedar, is a high-value 2 species of the Mahogany family, widely distributed in the neotropics (Holdridge et al. 1997). 3 Internationally valued for its high quality wood, C. odorata has been used for construction, 4 furniture and boat building amongst other things (Cordero and Boshier 2003). As a result, 5 heavy selective logging has severely reduced wild populations, to the point that the species is 6 now threatened at a provenance level (Patiño 1997). 7 8 Previous studies have assessed genetic structure using AFLP and universal chloroplast DNA 9 markers (Cavers et al 2003a,b) and quantitative traits (Navarro et al. 2005), thoroughly 10 describing genetic variation in the species at a landscape scale in Mesoamerica. Now, 11 attention is turning to restoration efforts and best practice for sourcing seed. A major progeny 12 trial is now underway in Costa Rica to examine the effects of landscape context on progeny 13 fitness, as recent studies have shown that alteration of the forest surrounding seed trees 14 changes gene flow patterns (e.g. Rocha and Aguilar, 2001), with potentially significant 15 consequences for inbreeding rates in progeny arrays. To enable analysis of mating system 16 variation in these progeny arrays, a set of microsatellites were isolated for C. odorata. Loci 17 were optimised for PCR and screened for polymorphism using 487 individuals in 68 families, 18 from 12 populations distributed across Mesoamerica. 19 20 DNA was extracted from silica-gel-dried leaf material (DNeasy Plant mini kit, QIAGEN) 21 from a single adult tree of C. odorata from Costa Rica. A microsatellite library enriched for 22 di- (AG, GT, AT, GC) and trinucleotide (CAA, ATT, GCC) repeats was constructed 23 following Edwards et al. (1996). The enriched DNA was cloned into pGEM-T vector and 24 transformed into JM109 cells. A total of 200 clones were sequenced with an Amersham 3 1 MegaBACE 1000 automated sequencer using DYEnamic ET Terminator Sequencing Kit 2 (Amersham Biosciences). 3 4 Screening for polymorphism and optimisation of PCR conditions was carried out using leaf 5 material from families from different, widely-separated provenances (Tulum and Xpujil, 6 Mexico; Cedros, Honduras; Hojancha, Costa Rica) to maximise the potential for detection of 7 polymorphism. All microsatellites were amplified using 25.0 ul PCR reactions consisting of 8 the following: 2.0 ul template DNA, 15.4 ul H2O, 2.0 ul primers, 2.5 ul 10X buffer, 0.5 ul 9 dNTPs, 0.4 ul BSA, 0.2 ul Taq DNA polymerase (New England Biolabs). Reactions were run 10 on a Hybaid MBS thermocycler to the following protocol: 1 min at 94 °C, then 30 cycles of 11 60 s at 94 °C, 60 s at 55 °C, 60 s at 72 °C and finally 5 min at 72 °C. Optimal PCR reaction 12 conditions for each of the polymorphic pairs were determined by testing a range of annealing 13 temperatures (55.0 -70.3 °C) and different template DNA concentrations (1:5, 1:10, 1:20 and 14 1:1). In all cases the forward primer was labelled with either IRD 700 or 800 fluorescent label 15 (MWG Biotech). PCR products were then separated on 6% polyacrylamide gel (25 cm), and 16 visualized using a LI-COR 4200 IR2 automated genotyper. PCR products were run out 17 alongside a microSTEP DNA size standard (Microzone Limited) and fragment sizes were 18 scored using SAGA™ software. Numbers of alleles were calculated, and observed and 19 expected heterozygosity, exclusion probability (Cervus v3.0, Marshall et al 1998) and null 20 allele rate were estimated (Microchecker v2.2.3, van Oosterhout et al. 2004). Tests for Hardy- 21 Weinberg equilibrium (HWE) and linkage disequilibrium, corrected for multiple comparisons 22 and considering 1 individual per family, were carried out using Genepop v3.3 (Raymond & 23 Rousset 1995). Results for effective numbers of alleles (NA), observed (HO) and expected 24 heterozygosity (HE) are reported (Table 1) for the collection as a whole and for a single 25 population (Tikal) to demonstrate the within-population utility of the markers. 4 1 2 In 80% of the sequences a microsatellite motif was detected. However, about 130 sequences 3 were discarded because of unfavourable properties for primer design. In 30 cases primers 4 were designed, using PRIMER 3 software (Rozen & Skalestky 2000). Of these, 9 gave clear, 5 interpretable band patterns and were polymorphic (Table 1). The numbers of alleles per locus 6 ranged from 14 to 30 with levels of observed heterozygosity from 0.61 to 0.88. Null alleles 7 were detected at rates of >0.05 at ced41, ced61a, ced65 and ced131. In all cases, these are 8 most likely due to scoring errors due to stuttering, as indicated by low frequencies of 9 heterozygote genotypes with size differences of a single repeat unit (van Oosterhout et al. 10 2004). Across the whole dataset, only loci ced2 and ced44 showed no departure from HWE. 11 For some loci, this was contributed to by the presence of null alleles (highest null allele 12 frequency estimated at locus ced61a with 18.1%, Table 1), but most probably reflects a 13 heterozygote deficiency due to combination of samples from several, widely-distributed 14 populations (Wahlund effect). No linkage disequilibria between loci (P > 0.05) were 15 observed, suggesting that these loci should be valuable markers for population genetics and 16 parentage analysis for Cedrela odorata. 17 18 References 19 Cavers S, Navarro C, Lowe AJ (2003)a A combination of molecular markers identifies 20 evolutionarily significant units in Cedrela odorata L. (Meliaceae) in Costa Rica. Conserv 21 Genet 4:571-580 22 Cavers S, Navarro C, Lowe AJ (2003)b Chloroplast DNA phylogeography reveals 23 colonization history of a Neotropical tree, Cedrela odorata L. (Meliaceae) in Mesoamerica. 24 Molec Ecol 12:1451-1460 5 1 Cordero J, Boshier DH (2003) Árboles de Centroamérica: un manual para extesionistas. 2 Oxford Forestry Institute, UK. CATIE, Turrialba, CR. 3 Holdridge LR, Poveda LJ, Jiménez Q (1997) Árboles de Costa Rica. San José, CR. Centro 4 Científico Tropical. v. 1, p. 269 5 Marshall TC, Slate J, Kruuk LEB, Pemberton JM (1998) Statistical confidence for likelihood- 6 based paternity inference in natural populations. Molec Ecol 7: 639–655 7 Navarro C, Cavers S, Pappinen A, Tigerstedt P, Lowe AJ, Merilä J (2005) Contrasting 8 Quantitative Traits and Neutral Genetic Markers for Genetic Resource Assessment of 9 Mesoamerican Cedrela odorata. Silvae Genet 54(6): 281-292 10 Patiño F (1997) Genetic resources of Swietenia and Cedrela in the Neotropics. United 11 Nations Food and Agriculture Organization. Rome, Italy. 12 Raymond M, Rousset F (1995) genepop (Version 1.2): Population genetics software for exact 13 tests and ecumenicism. J Hered 86: 248–249 14 Rocha OJ, Aguilar G (2001). Variaton in the breeding behaviour of the dry forest tree 15 Enterolobium cyclocarpum (Guanacaste) in Costa Rica. Am J Bot 88: 1600-1606 16 Rozen S, Skaletsky H (2000) Primer3 on the WWW for general users and for biologist 17 programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: 18 Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365-386 19 Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004) Micro-Checker : software 20 for identifying and correcting genotyping errors in microsatellite data. Molec Ecol Notes 4: 21 535-538 6 1 Acknowledgements 2 This work was part of the project SEEDSOURCE, funded by the EC under FP6 INCO 3 (contract 003708). Library development, cloning and sequencing was done by CNR and 4 optimisation at CEH by GH during his M.Sc., sponsored by CATIE and Ministerio de Ciencia 5 y Tecnología. 7 Table 1. Primer sequences, characterisation and basic descriptive statistics of 9 microsatellite markers isolated from Cedrela odorata. Locus Array Primer Sequences (5' - 3') Ced2 (GA)20 F:TTTGCTTTGAGAAACCTTGT* R:AACTTTCGAATTGGTTAAGG F:CAAAGACCAAGATTTGATGC* R:ACTATGGGTGGCACAACTAC F:TCATTCTTGGATCCTGCTAT* R:GTGGGAAAGATTGTGAAGAA F:ACTCCATTAACTGCCATGAA* R:ATTTTCATTCCCTTTTAGCC F:GATCTCACCCACTTGAAAAA* R:GCTCATATTTGAGAGGCATT F:CAATCAAACCAAAAATGGAT* R:GCAAATTAACCAGAAAAACG F:GAGTGAGAAGAAGAATCGTGATAGC* R:GAGGTTCGATCAGGTCTTGG F:ATTTTCATTCCCTTTTAGCC* R:TTATCATCTCCCTCACTCCA F:CTCGTAATAATCCCATTCCA* R:GGAGATATTTTTGGGGTTTT Allele Size / bp T (°C) 130-170 55 N NA HO HE Pr (Ex1) Pr (Ex2) Null rate 400 19 0.850 0.882 0.614 0.762 0.017 (63) (12) (0.841) (0.842) Ced18 (GA)23 130-150 55 403 19 0.797 0.844 0.545 0.708 0.029 (69) (16) (0.826) (0.875) Ced41 (TC)18 120-160 55.5 451 21 0.745 0.910 0.693 0.819 0.100 (72) (12) (0.792) (0.839) Ced44 (TG)14(AG)17 180-240 55.5 456 30 0.882 0.931 0.755 0.860 0.028 (74) (17) (0.959) (0.920) Ced54 (GA)15(AG)6G(GA)5 120-160 55 408 28 0.843 0.936 0.772 0.871 0.053 (70) (21) (0.886) (0.931) Ced61a (TG)10 240-270 55.5 428 14 0.605 0.868 0.581 0.737 0.181 (71) (10) (0.535) (0.843) Ced65 (GA)7(CA)14 160-200 55.5 468 17 0.618 0.802 0.456 0.632 0.136 (76) (12) (0.605) (0.798) Ced95 (CT)17(AC)13 190-250 55 389 28 0.918 0.829 0.715 0.834 0.043 (63) (18) (0.905) (0.913) Ced131 (CT)16 80-120 55 419 14 0.745 0.829 0.507 0.677 0.053 (66) (10) (0.773) (0.823) Total cumulative exclusion probabilities 0.999 0.999 * Indicates fluorescently labelled primer. Abbreviations are: number of individuals (N), number of alleles (NA), observed (HO) and expected (HE) heterozygosities and exclusion probability Pr(Ex - for first parent 1 and second parent 2). Values in brackets for N, NA, HO, HE are single-population estimates from the population Tikal. 8 GenBank Accession no. EF413962 EF413963 EF413964 EF413965 EF413966 EF413967 EF413968 EF413969 EF413970