Gene Reports 16 (2019) 100446 Contents lists available at ScienceDirect Gene Reports journal homepage: www.elsevier.com/locate/genrep Temporal expression of floral proteins interacting with CArG1 region of CsAP3 gene in Crocus sativus L. Asrar H. Wafaia, Amjad M. Husainib, Raies A. Qadria, a b T ⁎ Department of Biotechnology, University of Kashmir, Srinagar, Jammu and Kashmir, India Division of Plant Biotechnology, Sher-e-Kashmir University of Agricultural Sciences and Technology of Kashmir, Shalimar, Srinagar, Jammu and Kashmir, India A R T I C LE I N FO A B S T R A C T Keywords: APETALA3 CArG1 Hysteranthous Iridaceae PISTILLATA Transcriptomics Flowering Saffron Crocus sativus L. (Saffron), a monocot triploid species belonging to the Iridaceae family, is also called golden crop owing to its precious stigmas enriched with flavanoids Crocin, Picocrocin and Safranal. Unlike majority of plants which follow typical ABC model of floral development, deviations from ABC model have been reported in Saffron flowers which could probably be implicated in growth and development of distinct Saffron stigmas. CsAP3 is a critical gene regulating stigma development in Saffron. Its promoter consists of three CArG regions which play pivotal role in the expression of AP3 gene, of which CArG1 is the binding site for activator proteins thus regulating floral growth. Keeping in view the growth regulating characteristics of CArG1, we choose to identify the nuclear factors binding to this region in Saffron. Purified nuclear proteins were allowed to bind synthetic CArG1 sequence and the complex was subjected to protein identification using LCMS. Out of the 5 major protein hits in LCMS, NAC-like protein (NAP) was identified as a conspicuous homeotic protein interacting with CArG1 region of AP3 promoter. Gene expression analysis of CsAP3 and CsNAP at different stages of flower development showed stage-specific expression of both the genes however, no direct correlation between CsAP3 and CsNAP gene expression could be observed, even though both these genes are present in the same pathway and expressed at same time. It is possible that CsNAP may be regulating CsAP3 expression via some other mediators, indirectly which needs further molecular profiling. 1. Introduction Saffron is a triploid, sterile, perennial plant belonging to the family Iridaceae. It is a hysteranthus plant where flowers are formed before leaves. The saffron flower has 6 tepals, 3 stamens and 3 stigmas. The importance of this plant is due to its stigma which is used as a spice and possesses three important compounds, namely, Crocin, Picrocrocin and Safranal which impart color, flavor and fragrance to the spice, respectively (Husaini et al., 2010). This makes its flower intriguing. However, there is only a very limited knowledge available on the molecular mechanism of its development. Some homeotic genes have been identified in saffron, but their role in flower development is yet to be ascertained (Tsaftaris et al., 2005). Deciphering the pathway involved in the regulation of these homeotic genes and the interaction of the nuclear factors governing the expression of these genes shall pave the way for harvesting multiple crops per year with higher yield and better quality. Homeotic genes govern the development and differentiation of organs. Floral homeotic genes, which play active role in the development of the flower, have been classified into a model having five categories, viz., ABCDE classes (Theissen, 2001). A-class genes are involved in the development of sepals and petals, B- class genes regulate the development of petals and stamen, and C– class genes are involved in the development of stamen and stigma (Bowman et al., 1989; Carpenter and Coen, 1990). D- class genes play vital role in the ovule-identity (Colombo et al., 1995), while E class genes are involved in regulation of A, B and C class genes (Ditta et al., 2004; Pelaz et al., 2000). It has been reported that the B-Class genes, AP3 and PI, express in whorl 1, 2 and 3 of saffron flower and play pivotal role in tepal formation (Kalivas et al., 2007). In addition to it, there are certain deviations in the ABC model in saffron where AP3 gene has been shown to express in stigma (Tsaftaris et al., 2010). The expression of CsAP3 has been shown to increase during later stages of flower development (Wafai et al., 2015). APETALLA 3 (AP3) gene is an important B class MADS box gene Abbreviations: CsAP3, Crocus sativus Apetalla 3; CsNAP, NAC-like protein; PI, Pistillata; LCMS, Liquid chromatography–mass spectrometry; EDTA, Ethylenediaminetetraacetic acid; TBE, Tris Borate EDTA; 2,4-D, 2,4-Dichlorophenoxyacetate; 6-BAP, 6-Benzylaminopurine; NAA, 1-Naphthaleneacetate ⁎ Corresponding author. E-mail address: raies@kashmiruniversity.ac.in (R.A. Qadri). https://doi.org/10.1016/j.genrep.2019.100446 Received 21 September 2018; Received in revised form 19 June 2019; Accepted 25 June 2019 Available online 26 June 2019 2452-0144/ © 2019 Elsevier Inc. All rights reserved. Gene Reports 16 (2019) 100446 A.H. Wafai, et al. excised and transferred in 1 mL miliQ water in sterile 1.5 mL eppendorf tube. Protein identification was done using Liquid Chromatography Mass Spectrometry after subjecting the samples to in-gel digestion as per the protocol of Schevchenko et al., (2006) (Cell Biosystems Ltd). The LCMS-MS data was searched for the identity using MASCOT 2.4 as search engine on Proteome discoverer 1.3. The data was searched against both Uniprot Swiss-Prot database (non-redundant database with reviewed proteins) and Uniprot TrEMBL database (database with unreviewed proteins). involved in the development of petals and stamen and regulate many downstream flower development genes (Hill et al., 1998). In combination with PISTILLATA (PI) gene, it regulates its own expression in an auto-regulatory positive loop, the expression of C-class flower development genes and the senescence gene NAP (Puranik et al., 2012). As the involvement of B-class genes is very high in the flower development process in saffron and AP3 gene expression is unusually high in the stigma, AP3 gene is an important candidate for deciphering the flower development pathway of saffron. MADS box transcription factors mostly bind to CArG regions of promoters for regulating the gene expression. The Promoter region of AP3 gene contains 3 CArG regions, CArG1, CArG2 and CArG3, which are involved in the regulation of its expression. CArG1 region is the binding site for the activating factors involved in promoting the expression of AP3 gene (Chen et al., 2000; Joline et al., 1998). PISTILLATA promoter does not possess CArG regions and other regulatory sites govern its activity (Chen et al., 2000). In the present study, we focused on understanding the interaction between nuclear factors with B class gene CsAP3 through its CArG1 promoter region, and studied their expression at different stages of flower development. 2.6. Comparative expression analysis of CsAP3 and CsNAP genes during floral development The expression of CsAP3 and CsNAP was studied in suspension cultures and saffron tissues collected at 3 stages of stigma development viz. Yellow colored stigma, Orange colored stigma, and Scarlet colored Stigma (mature flower). The cells derived from suspension culture served as negative control due to absence of stigmas. 2.7. Establishment of suspension cultures 2. Methods The CArG1 sequence was derived from Crocus sativus after amplification of promoter region using primers derived from Arabidopsis thaliana specific to CArG1(GenBank ID: KF268029). The double stranded CArG1 domain (CArG1- GTAATTAAAAAAATCAGTTTACATA AATGGAAAATTTATCACTTAGTTTT) was custom synthesized by (Merck Biosciences Ltd.) and then lyophilized. The lyophilized CArG1 fragments were dissolved in TE buffer making final concentration to 2 μg/μL and was stored at -20 °C until use. Fresh corms were collected from the field and sterilized as described earlier (Parray et al., 2012). The sterilized corms were put in a petridish and the central portion (8 mm × 8 mm) of each was cut using a fresh scalpel. Murashige and Skoog (MS) medium with sucrose (3%), 2,4-D (1.5 mg/L), 6-BAP (1.5 mg/L) and NAA (0.5 mg/L), with addition of agar (0.8%) in solid while none for suspension was prepared. pH was adjusted to 5.6, autoclaved and poured into sterilized conical flasks. For callus cultures, the explants were gently pushed into solid media so that 1/4th of each explant gets embedded in the media. The flasks were incubated at 22 °C with 16/8 h photoperiod for 45–60 days. The calli growing on the MS agar media were cut into smaller pieces in sterilized petridish and subcultured into the liquid MS media. The culture flasks were incubated in shaking incubator at 22 °C at 200 rpm with 16/8 h photoperiod for 15 days. After 15 days, 5 mL culture medium was added to fresh 45 mL MS medium and incubated at 22 °C at 200 rpm with 16/ 8 h photoperiod for another 10–12 days, and RNA isolated from these cells in the late log phase/stationary phase of cell cycle. The process was repeated in order to prevent cell growth inhibition due to nutrient deprivation and toxin accumulation. Fig. 1 depicts formation of suspension cells from callus culture. 2.3. Isolation of nuclear proteins from flower 2.8. RNA isolation The nuclear protein was isolated from the mature whole flower using plant nuclear protein isolation kit (Sigma Aldrich, USA) following manufacturers protocol. All the steps were carried at 4 °C. The RNA was extracted from all the samples using Trizol Reagent (Sigma Aldrich, USA) as per the manufacturer's instructions. The RNA was quantified using nano drop and stored at -80 °C. The cDNA was prepared by cDNA synthesis kit (Novagen). 3 μg of total RNA was taken and added to a solution containing 0.5 μg RNAi (RNAse inhibitor), 0.5 μL Oligo dT and the final volume was taken to 12.5 μL with miliQ water. The tube was placed in thermal cycler and configured with 1 cycle of 70 °C for 10 min and 4 °C for 1 min. The contents were added to the working mixture containing 4 μL 5X buffer, 2 μL 1 M DTT, 1 μL dNTPs and 0.5 μL reverse transcriptase making total volume of 20 μL. The tube was placed in thermal cycler and configured with 1 cycle of 25 °C for 10 min, 37 °C for 1 h and 4 °C till the tube was removed. The tube containing cDNA was stored at -20 °C for further use. 2.1. Sample collection The samples were collected from Pampore region of Kashmir (Lat 33o.99′, Log 74o.92′) at different intervals. The 3 stages of flower maturation based upon stigma development viz. Yellow, Orange and Scarlet were collected from August to November. The samples were submerged in Liquid Nitrogen and stored at -80 °C until use. 2.2. Oligo-synthesized CArG1 domain 2.4. Electrophoretic Mobility Shift Assay The interaction of CArG1 region with pure nuclear protein was studied by Electrophoretic Mobility Shift Assay (EMSA) kit (Invitrogen), (Hellman and Fried, 2007). Six reaction mixtures were prepared which included a) 2 μg DNA of CArG1; b) 2 μg DNA of CArG1 plus 10 μg of pure nuclear protein; c) 10 μg of pure nuclear protein; d) 2 μg scrambled DNA; e) 2 μg scrambled DNA plus 10 μg of pure nuclear protein; and f) 10 μg of pure nuclear protein. The reaction was carried as per the manufacturer's instruction manual (Invitrogen). All the 6 samples were run on 5% native PAGE using Tris borate EDTA (TBE) buffer at 150 V for 3 h at 4 °C. The gel was stained by SYBR Green solution and the DNA was visualized in gel doc (Thermo Fischer) under UV wavelength at 300 nm. 2.9. Reverse transcription PCR and real-time PCR of CsAP3 and CsNAP genes The semi-quantitative gene expression from suspension cells and 3 stages of flower development was carried out by Reverse Transcription PCR using the primers CsAP3-F (5’-TTGGATGAGTCGTTGAGGCT TGT-3′) and CsAP3-R (5’-AGGTAGCAAATTAAGT AGGAAAG-3′) for CsAP3 gene; CsNAP-F (5’-GAGATCGGGGTATTGGAAGG-3′) and CsNAP- 2.5. Identification and characterization of proteins The EMSA gel showing the shift was taken and the shifted band was 2 Gene Reports 16 (2019) 100446 A.H. Wafai, et al. Fig. 1. Development of Suspension Culture. Central portion (8 mm × 8 mm) of the sterilized corms were put in a petridish and grown on media with hormone concentration of a) 1.5 mg/L 2,4-D, 1.5 mg/L 6-BAP and 0.5 mg/L NAA; b) Hormone concentrations 3.5 mg/L 2,4-D, 0.5 mg/L 6-BAP and 1.5 mg/L NAA showed retarded callus development. Suspension Culture developed from callus in suspension MS media containing 1.5 mg/L 2,4-D, 1.5 mg/L 6-BAP and 0.5 mg/L NAA after c) 7 days post inoculation; d) 14 days post inoculation; e) 25 days post inoculation f) Saffron Cells observed under light microscope after 14 days from inoculation at 40× magnification. Fig. 2. a) Graphical representation of CArG boxes in AP3 promoter region specifying their role in flower development. b) Gel showing integrity of synthesized dsCArG1 sequence. 45 s, final extension of 72 °C for 2 mins. Product size was verified by agarose gel electrophoresis using 1.5% agarose gel (Sigma Aldrich, USA). PCR product was visualized by ethidium bromide staining. The real-time PCR was performed with Light Cycler real-time PCR instrument (Applied Biosystems) in 96 well plates in triplicates using SYBR Green master mix (Fermentas). Same primers used for semi- R (5’-ATCGAATTCCAGCAAACCAG-3′) for CsNAP gene and CsTUB-F (5’-TGATTTCCAACTCGACCAGTGTC-3′) and CsTUB-R (5′- ATACTCAT CACCCTC GTCACCATC-3′) for tubulin gene (Gene Bank accession number NM125665) as previously described (Wafai et al., 2015). The reaction was carried out with initial denaturation at 94 °C for 5 min followed by 25 cycles of 94 °C for 1 min, 56 °C for 1 min and 72 °C for 3 Gene Reports 16 (2019) 100446 A.H. Wafai, et al. Fig. 3. EMSA gel showing interaction of nuclear protein extracted from Crocus sativus L with a) CArG1 sequence; b) Control sequences (Scrambled DNA). Fig. 4. LCMS/MS plot of the protein complex (CArG1 binding factors) from Crocus sativus. Table 1 Major protein hits in LCMS/MS based identification of CArG1 binding factors from Crocus sativus. 1. 2. 3. 4. 5. Protein MW (Da) pI (pH) PLGS Score Peptides Theoretical Peptides Protein ID NAC-like NADH Maturase-like Ribulose-1,5-bisphosphate Carotenoid 31,873 29,272 62,901 49,168 57,103 5.3115 8.9883 9.7354 6.3325 6.6299 83.2178 59.8124 40.2523 24.8125 24.5308 4 5 8 2 6 18 21 39 39 35 1306 1033 75 1399 69 quantitative analysis were also used for real time expression analysis. Tubulin gene was used as reference gene and mature flower stage was used as positive control. Advanced relative quantification was done by 2-∆∆CT method (Livak and Schmittgen, 2001). stigma growth (Fig. 2a). To identify its binding partners, we synthesized double stranded fragment of DNA constituting CArG1 region of AP3 promoter and studied its interaction with nuclear proteins derived from Saffron flowers using Electrophoretic Mobility Shift Assay (EMSA) as described in methods. The quality and integrity of CArG1 was checked on a 5% PAGE (Fig. 2b) which showed a single band and no traces of degradation. As shown in Fig. 3, we observed a major retardation in mobility of CArG1 sequence by nuclear proteins (Fig. 3a) compared to control sequence (Fig. 3b, scrambled DNA sequence, negative control) which does not show any interaction with the saffron nuclear protein. 3. Results 3.1. Interaction between CArG1 region of CsAP3 promoter and nuclear proteins CArG boxes play a critical role in regulation of the homeotic gene expression. CArG1 sequence which preferably binds activator proteins plays important role in the promoting AP3 gene expression and thus 4 Gene Reports 16 (2019) 100446 A.H. Wafai, et al. Fig. 5. Comparative gene expression profile of CsAP3 and CsNAP genes in Saffron stigmas. (a) Semi-quantitative RT-PCR (b) qPCR (c) Heat Map representation of Quantitative expression levels (d) String analysis of NAP protein. expression, reaching maximum in the orange stigma while it decreased in the mature scarlet stigma. In contrast, CsNAP was expressed in scarlet stigma alone while little or no expression was detected in yellow or orange stigmas which points towards its role in the senescence process (Fig. 5b, c). The String analysis shows that NAP and AP3 proteins do not show any direct interaction, even though, both the proteins were present in the same pathway and expressed at the same time (Fig. 5d). 3.2. Protein identification using Liquid Chromatography Mass Spectrometry (LCMS-MS) The nuclear proteins-CArG1 complex was extracted from the gel and sent to protein identification by LCMS-MS followed by correlation of the spectra with the entries in the Swiss-Prot using Mascot search engine tool. The LCMS-MS data revealed 5 hits and the most relevant hit involved in flower development pathway was a NAC-Like protein (Fig. 4, Table 1). 4. Discussion 3.3. Expression analysis of CsAP3 & CsNAP genes during stigma development Flower is the most important part of a saffron plant which bears an economically important part which is a scarlet colored stigma. The genes involved in flower development are regulated by many factors either directly, indirectly, individually or in association with other factors (Irish, 2010). In this study we aimed at identifying specific transcription factors that might have been responsible for regulating the flower development by virtue of having a stage specific DNA-Transcription factor interaction. We selected the promoter domain CArG1 of a B-Class floral developmental homeotic gene CsAP3, which plays an important role in the development of flower and expresses unusually high in saffron stigma. On the basis of the Electrophoretic Mobility Shift Assay and LCMS/ MS based protein identification, we observed that CsNAP protein showed positive interaction with the CArG1 region of CsAP3 promoter. There were other hits too, but they play role in vegetative growth and have no role in the flower development pathway (Table 1). NAP is a We previously showed that CsAP3 gene expression in saffron bud (Wafai et al., 2015) increased in the later stages of flower development (bud with orange stigma and mature flower). CsNAP gene too expressed in the mature flower predominantly, and very little expression was observed during the initiation of bud after breaking of dormancy. Here, we analyzed CsAP3 and CsNAP expression in developing saffron stigmas in order to analyze their role in stigma maturation. While CsAP3 showed increase in expression with maturation of stigmas, CsNAP was expressed in mature stigmas only (Fig. 5a,b). The relative quantification of CsAP3 gene and CsNAP was studied in developing saffron stigmas by Real Time PCR. The expression level of CsAP3 gene analyzed by real-time PCR is represented by a heat map (Fig. 5c). There was no expression of CsAP3 gene in the suspension culture cells (negative control). Yellow stage stigmas showed feeble 5 Gene Reports 16 (2019) 100446 A.H. Wafai, et al. Institute of Temperate Horticulture (CITH), Rangreth, Srinagar for extended research support. transcription factor activated during the later stages of flower development and is responsible for senescence by promoting Abscisic Aldehyde Oxidase 3 (AAO3) which is involved in promoting Chlorophyll degradation (Sablowski and Meyerowitz, 1998; Yang et al., 2014). Expression profile of CsNAP gene was generated at different stages of stigma development for getting a clearer picture of its expression across development pathway. We observed that the expression of CsNAP gene, a senescence promoting gene, was highest during the mature stigmas, however, there was a moderate expression of CsNAP gene during earlier stages of stigma development. Since we previously showed that there is no expression of CsAP3 gene during initiation of vegetative bud therefore the expression of CsNAP gene at this specific stage may not be due to activation of CsAP3-CsPI heterodimer but some other factor(s) may be directly or indirectly involved in activation of CsNAP gene (Wafai et al., 2015). Hence, there must be some other stimuli which enhance the expression of CsNAP gene during initiation of vegetative bud. NAC like transcription factors have been found to regulate biotic as well as abiotic stress responses in plants (Nuruzzaman et al., 2013). Stress has been found to be associated with breaking of dormancy and initiation of vegetative bud in plants (Cooke et al., 2012). During the breaking of dormancy and initiation of vegetative bud in saffron, the stress level on the plant is high which in turn may enhance the expression of CsNAP gene. However, after the development of complete bud, the stress due to different factors reduces and hence the expression of CsNAP gene also declines considerably. We previously observed the expression of CsAP3 gene began in the bud with yellow stigma. At this stage the tepal and stamen development in the bud is active and apocarotenoid synthesis is in the initial stage. Here, the orange colored stigmas showed highest expression of CsAP3 gene among all developmental stages of flower. At this stage, the development of tepals and stamen is at its peak which results due to the very high expression of CsAP3 gene. In the suspension culture cells there was no expression of CsAP3 gene which is attributed to the fact that floral development pathway is absent in the suspension culture cells. CsNAP transcription factor showed highest expression in mature stigmas and lowest at initial stages. The expression profile of CsAP3 showed a reciprocal pattern, however, we could not observe any corelation between expression of CsNAP and CsAP3 genes. The string analysis of NAP protein showed that the NAP and AP3 proteins occur in same pathway and express at same time, but there is no direct interaction between the NAP and AP3 protein (Fig. 5d). References Bowman, J.L., Smyth, D.R., Meyerowitz, E.M., 1989. Genes directing flower development in Arabidopsis. Plant Cell 1, 37–52. Carpenter, R., Coen, E.S., 1990. Floral homeotic mutations produced by transposonmutagenesis in Antirrhinum majus. Genes Dev. 4, 1483–1493. Chen, X.M., Riechmann, J.L., Jia, D.X., Meyerowitz, E.M., 2000. Minimal regions in the Arabidopsis PISTILLATA promoter responsive to the APETALA3/PISTILLATA feedback control do not contain a CArG box. Plant Reprod. 13, 85–94. Colombo, L., Franken, J., Koetje, E., Van Went, J., Dons, H.J., Angenent, G.C., Van Tunen, A.J., 1995. The petunia MADS box gene FBP11 determines ovule identity. Plant Cell 7, 1859–1868. Cooke, J.E., Eriksson, M.E., Junttila, O., 2012. The dynamic nature of bud dormancy in trees: environmental control and molecular mechanisms. Plant Cell Environ. 35 (10), 1707–1728. Ditta, G., Pinyopich, A., Robles, P., Pelaz, S., Yanofsky, M.F., 2004. The SEP4 gene of Arabidopsis thaliana functions in floral organ and meristem identity. Curr. Biol. 14, 1935–1940. Hellman, L.M., Fried, M.G., 2007. Electrophoretic mobility shift assay (EMSA) for detecting protein-nucleic acid interactions. Nat. Protoc. 2 (8), 1849–1861. Hill, T.A., Day, C.D., Zondlo, S.C., Thackeray, A., Irish, V.F., 1998. Discrete spatial and temporal cis-acting elements regulate transcription of the Arabidopsis floral homeotic gene APETALA3. Development 125, 1711–1721. Husaini, Amjad Masood, Kamili, Azra N., Wani, M.H., Teixeira da Silva, J.A., Bhat, G.N., 2010. Sustainable Saffron (Crocus sativus) production: technological and policy interventions for Kashmir. Funct. Plant Sci. Biotechnol. 4 (2), 116-12. Irish, V.F., 2010. The flowering of Arabidopsis flower development. Plant J. 61 (6), 1014–1028. Joline, J. Tilly, Allen, David W., Jack, Thomas, 1998. The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects. Development 125, 1647–1657. Kalivas, A., Pasentsis, K., Polidoros, A.N., Tsaftaris, A.S., 2007. Heterotopic expression of B-class floral homeotic genes PISTILLATA/GLOBOSA supports a modified model for crocus (Crocus sativus L.) flower formation. DNA Seq. 18 (2), 120–130. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2 (−Delta Delta C (T)) method. Methods 25 (4), 402–408. Nuruzzaman, M., Sharoni, A.M., Kikuchi, S., 2013. Roles of NAC transcription factors in the regulation of biotic and abiotic stress responses in plants. Front. Microbiol. 4, 248. Parray, Javid A., Kamili, Azra N., Hamid, Rehana, Husaini, Amjad M., 2012. In vitro cormlet production of saffron (Crocus sativus L. Kashmirianus) and their flowering response under greenhouse. GM Crops & Food 3 (4), 289–295. Pelaz, S., Ditta, G.S., Baumann, E., Wisman, E., Yanofsky, M.F., 2000. B and C floral organ identity functions require SEPALLATA MADS-box genes. Nature 405, 200–203. Puranik, S., Sahu, P.P., Srivastava, P.S., Prasad, M., 2012. NAC proteins: regulation and role in stress tolerance. Trends Plant Sci. 17, 369–381. Sablowski, R.W.M., Meyerowitz, E.M., 1998. A homolog of NO APICAL MERISTEM is an immediate target of the floral homeotic genes APETALA3/PISTILLATA. Cell 92, 93–103. Schevchenko, A., Tomas, H., Havlis, J., Olsen, J.V., Mann, M., 2006. In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nat. Protoc. 1 (6), 2856–2860. Theissen, G., 2001. Development of floral organ identity: stories from the MADS house. Curr. Opin. Plant Biol. 4, 75–85. Tsaftaris, A.S., Pasentsis, K., Polidoros, A.N., 2005. Isolation of a differentially spliced Ctype flower specific AG-like MADS-box gene from Crocus (Crocus sativus) and characterization of its expression. Biol. Plant. 49, 499–504. Tsaftaris, A.S., Apostolos, K., Konstantinos, P., Anagnostis, A., 2010. Expression analysis of flower MADS-box genes in saffron crocus (Crocus sativus L.) supports a modified ABCDE model. Funct. Plant Sci. Biotechnol. 4, 38–44. Wafai, A.H., Bukhari, S., Mokhdomi, T.A., Amin, A., Wani, Z., Hussaini, A., Mir, J.I., Qadri, R.A., 2015. Comparative expression analysis of senescence gene CsNAP and Bclass floral development gene CsAP3 during different stages of flower development in saffron (Crocus sativus L.). Physiol. Mol. Biol. Plants 21 (3), 459–463. Yang, J., Worley, E., Udvardi, M., 2014. A NAP-AAO3 regulatory module promotes chlorophyll degradation via ABA biosynthesis in Arabidopsis leaves. Plant Cell 26, 4862–4874. 5. Conclusion Although, CsNAP protein binds to the CArG1 region of CsAP3 promoter, it is possible that CsNAP might be regulating CsAP3 expression indirectly via some other mediators/ mechanism by modulating CArG1 promoter behavior. On the basis of our study, we hypothesize that CsNAP gene may have negative effect on expression of CsAP3 gene which requires further studies to ascertain the mechanism of stigma development in Saffron crop. Declaration of Competing Interest All the authors declare no potential conflict of interests. Acknowledgments The authors acknowledge Dr. Javaid Iqbal Mir, Scientist, Central 6