Biodiversity of fungi on Vitis vinifera L. revealed by traditional and high-resolution culture-independent approaches

Ruvishika S Jayawardena

This study is unique as it compares traditional and high-resolution culture-independent approaches using the same set of samples to study the saprotrophic fungi on Vitis vinifera. We identified the saprotrophic communities of table grape (Red Globe) and wine grape (Carbanate Gernischet) in China using both traditional and culture-independent techniques. The traditional approach used direct observations based on morphology, single spore isolation and phylogenetic analysis yielding 45 taxa which 19 were commonly detected in both cultivars. The same set of samples were then used for Illumina sequencing which analyzed ITS1 sequence data and detected 226 fungal OTUs, of which 176 and 189 belong to the cultivars Carbanate Gernischet and Red Globe, respectively. There were 139 OTUs shared between the two V. vinifera cultivars and 37 and 50 OTUs were specific to Carbanate Gernischet and Red Globe cultivars respectively. In the Carbanate Gernischet cultivar, Ascomycota accounted for 77% of the OTUs and in Red Globe, almost all sequenced were Ascomycota. The fungal taxa overlap at the genus and species level between the traditional and culture-independent approach was relatively low. In the traditional approach we were able to identify the taxa to species level, while in the culture-independent method we were frequently able to identify the taxa to family or genus level. This is remarkable as we used the same set of samples collected in China for both approaches. We recommend the use of traditional techniques to accurately identify taxa. Culture-independent method can be used to get a better understanding about the organisms that are present in a host in its natural environment. We identified primary and secondary plant pathogens and endophytes in the saprotrophic fungal communities, which support previous observations, that dead plant material in grape vineyards can be the primary sources of disease. Finally, based on present and previous findings, we provide a worldwide checklist of 905 fungal taxa on Vitis species, which includes their mode of life and distribution.

Fungal Diversity (2018) 90:1–84 https://doi.org/10.1007/s13225-018-0398-4 (0123456789().,-volV)(0123456789().,-volV) Biodiversity of fungi on Vitis vinifera L. revealed by traditional and high-resolution culture-independent approaches Ruvishika S. Jayawardena1,2,3 • Witoon Purahong4 • Wei Zhang1,3 • Tesfaye Wubet4,5 • XingHong Li1,3 Mei Liu1,3 • Wensheng Zhao6 • Kevin D. Hyde2 • JianHua Liu1 • Jiye Yan1,3 • Received: 17 November 2017 / Accepted: 26 February 2018 / Published online: 14 March 2018 Ó The Author(s) 2018 Abstract This study is unique as it compares traditional and high-resolution culture-independent approaches using the same set of samples to study the saprotrophic fungi on Vitis vinifera. We identified the saprotrophic communities of table grape (Red Globe) and wine grape (Carbanate Gernischet) in China using both traditional and culture-independent techniques. The traditional approach used direct observations based on morphology, single spore isolation and phylogenetic analysis yielding 45 taxa which 19 were commonly detected in both cultivars. The same set of samples were then used for Illumina sequencing which analyzed ITS1 sequence data and detected 226 fungal OTUs, of which 176 and 189 belong to the cultivars Carbanate Gernischet and Red Globe, respectively. There were 139 OTUs shared between the two V. vinifera cultivars and 37 and 50 OTUs were specific to Carbanate Gernischet and Red Globe cultivars respectively. In the Carbanate Gernischet cultivar, Ascomycota accounted for 77% of the OTUs and in Red Globe, almost all sequenced were Ascomycota. The fungal taxa overlap at the genus and species level between the traditional and culture-independent approach was relatively low. In the traditional approach we were able to identify the taxa to species level, while in the culture-independent method we were frequently able to identify the taxa to family or genus level. This is remarkable as we used the same set of samples collected in China for both approaches. We recommend the use of traditional techniques to accurately identify taxa. Culture-independent method can be used to get a better understanding about the organisms that are present in a host in its natural environment. We identified primary and secondary plant pathogens and endophytes in the saprotrophic fungal communities, which support previous observations, that dead plant material in grape vineyards can be the primary sources of disease. Finally, based on present and previous findings, we provide a worldwide checklist of 905 fungal taxa on Vitis species, which includes their mode of life and distribution. Keywords Checklist Grapevine Mycobiome Next generation sequencing Pathogens Saprotrophs Introduction Vitis (family Vitaceae) is a plant genus that includes the economically important grapes, and thus because of its importance, its pathogens have received a considerable Electronic supplementary material The online version of this article (https://doi.org/10.1007/s13225-018-0398-4) contains supplementary material, which is available to authorized users. Ruvishika S. Jayawardena, Witoon Purahong and Wei Zhang have equally contributed to this study. & Jiye Yan jiyeyan@vip.163.com amount of attention during the past decade (Yan et al. 2015; Chethana et al. 2017). The importance of this fruit is associated with its multiple uses; as a source of nutrition, health and medicinal value, as well as its high economical significance (Dohadwala and Vita 2009; Bokulich et al. 2014). About 90% of cultivated grapes in the world are V. vinifera, which comprises wine, as well as table grapes. This genus comprises 79 accepted species of perennial woody and herbaceous vines. There are thousands of cultivars of V. vinifera that has been grown successfully around the globe (Terral et al. 2009). Species of Vitis are valued for their decorative foliage providing ornamental value for the genus. Their ability to cover walls and arches, as well as providing shade has made them important in domestic cultivation. Extended author information available on the last page of the article 123 2 Numerous diseases of grapes have been identified which reduce the yield and quality of this fruit crop (Úrbez-Torres et al. 2009). Among various pathogens known on grapevine, the damage caused by fungi is significant (ÚrbezTorres 2011). Most studies on fungal pathogens in grape have focused on their pathogenic phase, which relies on direct observation and isolations of fungal pathogens from infected grape material. Fungi that may live within the host tissue are known as endophytes and are considered to cause symptomless infections (Lane and Kirk 2012). Plant pathogenic fungi can survive by changing their biotrophic mode from pathogenic to saprotrophic or at least can remain dormant on the decaying plant materials and become active when suitable conditions for infection exist (Hoppe et al. 2016; Purahong et al. 2018). For example, Botrytis cinerea causing gray mold disease in grape is able to live as a parasite in green tissues and as a saprotroph in dead plant material (Armijo et al. 2016). Unfortunately, our knowledge on saprotrophic fungal community associated with V. vinifera is limited, especially those obtained by high-resolution culture-independent techniques. The percentage of potential fungal pathogens hidden in saprotrophic community is still unclear. Saprotrophs are organisms that derive nourishment from dead or decaying organic matter (Hyde et al. 2007). Saprotrophs are heterotrophic organisms that break down the complex compounds of dead organisms (Deighton 2016). They play an important role as decomposers of dead organic matter in natural ecosystems by releasing enzymes from hyphal tips (Duarte et al. 2006; Bucher et al. 2004). Saprotrophic fungi can be either macrofungi (Agaricus sp., Phallus sp.) (Garcı́a et al. 1998) or microfungi (Aspergillus sp., Dothiorella sp., Mucor sp., Neomassaria sp., Rhizopus sp.) (Vohnı́k et al. 2011; Hyde et al. 2016). Hyde et al. (2007) and Purahong et al. (2018), provided evidence that some plants accommodate large numbers of saprotrophic taxa and that some might be host- or organ-specific. Other than being decomposers, saprotrophs can also provide other eco-system services, such as soil formation, defence against pathogens, as a food source and modification of pollutants (Deighton 2016). Promputtha et al. (2007, 2010) provided evidence that not only fungal pathogens, but also fungal endophytes, can switch lifestyles to saprotrophs. Thus, the study of saprotrophic fungal communities associated with V. vinifera can provide information on strict saprotrophism as well as potential endophytes and pathogens with saprotrophic ability. Fungal species identification has traditionally been based on direct observation, microscope examination, culture dependent isolation and phylogenetic analysis (Cai et al. 2011; Hyde et al. 2010, 2017; Rastogi and Sani 2011; Fadrosh et al. 2014, Tibpromma et al. 2017). Such studies have investigated the microbial ecology of various 123 Fungal Diversity (2018) 90:1–84 environments (Rastogi and Sani 2011). However, it has been recognized that the actual number of microbes in nature, often exceed the number of microbes identified by traditional methods (Fadrosh et al. 2014). Traditional approaches rely on growing the organisms in media, but many of the microbes in the environment may not be cultivatable (Stewart 2012). Artificial medium typically allows growth of only a small fraction of, often fast growing organisms. Therefore, traditional techniques do not provide a total community resolution (Hoppe et al. 2016). During the past decade, microbial research made a shift from phylogenetic analyses to experimental characterization of communities through the use of complex experimental designs (Kozich et al. 2013). This shift focused on relatively inexpensive next-generation sequencing approaches (NGS) and powerful bio-informatics tools to analyse the microbial ecology (Carraro et al. 2011; Rastogi and Sani 2011). High-throughput DNA sequencing allows us to understand the presence of microbes and how their communities are structured in complex ecosystems. Microbiome analysis is a culture-independent technique which requires a low quantity of sample, but with a high sequencing depth. The term microbiome refers to the entire habitat including the microorganisms, their genomes and the surrounding environment. It is characterized by the application of one or combinations of metagenomics, metabonomics, metatranscriptomics and metaproteomics (Marchesi and Ravel 2015). Analysis of the plant microbiome involves linking microbial ecology and the plants biology and functions, and at the same time viewing microorganisms as a reservoir of additional genes and functions for their host (Vandenkoornhuyse et al. 2015). Mycobiome refers to the fungal component in a habitat (Underhill and Iliev 2014). However, these techniques may also have disadvantages. For example, the conditions that we select to do the PCR can give us biased results. Sometimes it is difficult to understand whether the fungi identified by this technique actually exist in the natural system (Mitchell and Zuccaro 2006). Therefore, in order to obtain a better resolution in species identification, richness and distribution patterns of microbes, a combination of both approaches (i.e. traditional and culture-independent) are needed. However, we are aware of no studies that have been conducted using both these approaches. There have been many studies of major pathogens from Vitis using both morphology and phylogeny (Úrbez-Torres et al. 2012, 2013a, b; Dissanayake et al. 2015; Jayawardena et al. 2015, 2016a; Chethana et al. 2017). Even though a number of sexual and asexual fungi have been reported on Vitis species, updated information of the taxa present in this genus is lacking. Only some have good illustrations and gene sequence data. Our knowledge on saprotrophic Fungal Diversity (2018) 90:1–84 fungal communities associated with V. vinifera is limited and data based on high-resolution culture-independent technique is lacking. Besides the percentage of potential fungal pathogens hidden in saprotrophic community is still unknown. In this study, we aim to (i) provide taxonomic information on the saprotrophic microfungi collected from China, Italy, Thailand and Russia, (ii) compare traditional and culture-independent approaches for characterizing the saprotrophic fungal communities associated with two cultivars of V. vinifera in China, (iii) quantify plant pathogens and endophytes hidden in the saprotrophic fungal community and (iv) provide a worldwide checklist for the fungi on Vitis species based on previous and current research. Materials and methods Study site, sampling and isolation of fungi Fungal species associated with Vitis sp. were collected from China (Beijing, Sichuan and Yunnan Province), Italy (Province of Forlı̀-Cesena), Russia (Rostov Region) and Thailand (Chiang Sean) (Tables 1, 2). Shoots, leaves, inflorescences, bark and root samples of Vitis vinifera were used for isolation. The same set of samples from Beijing (Red Globe cultivar) and Yunnan Province (Carbanate Gernischet cultivar) were used for the mycobiome analysis to establish the fungal communities (Fig. 1). The sample sets were randomly split into two subsamples to employ the two approaches at the same time. Specimens were incubated in a moist chamber for 3–7 days at 25 °C, if they did not sporulate. Fungi were isolated by a modified single spore/conidial isolation method (Chomnunti et al. 2014) from the samples. Growth rate, colony characteristics and sexual/asexual morph morphology were determined from cultures grown on potato-dextrose agar (PDA) at 25 °C, under 12 h light/12 h dark. Fungal mycelia and spores were examined by differential interference contrast (DIC) and photographed with an axio Imager Z2 photographic Microscope (Carl Zeiss Microscopy, Germany) (Supplementary Figs. S1a–S1d, S2). Forty conidial measurements were taken for each isolate. All microscopic measurements were recorded with ZeM PRo 2012 software. Representative herbariums are deposited in the herbarium of Mae Fah Luang University, Chiang Rai, Thailand (MFU) and in Kunming, China (KIB). Representative cultures were deposited at Mae Fah Luang Culture Collection (MFLUCC), Beijing Academy of Agriculture and Forestry Sciences, China (JZB) and Kunming Culture Collection (KUMCC). 3 DNA extraction, PCR amplification, sequencing and phylogenetic analysis The methods used are presented in detail in Jayawardena et al. (2018). Culture-independent approach: mycobiome analysis Two cultivars were selected for this analysis; Red Globe being the table grape cultivar and Carbanate Gernischet being the Wine grape cultivar. Samples of Red Globe (RG) were collected from Yanqin District of Beijing while samples of Carbanate Gernischet (CG) were collected from Yunnan Province were used for this analysis. For each cultivar, three representative grapevine plants were sampled. The root, bark, shoot, inflorescence and leaves were homogenized and sub-sampled. For culture-independent technique of fungal communities, total DNA extraction was performed using 1 g of ground specimens using 29 CTAB method. All the DNA samples were quantitated and quality checked with the NanoDrop ND-2000C spectrophotometer (ThermoFisher Scientific, Dreieich, Germany). DNA extracts were then stored at - 20 °C for further analysis. For fungal Illumina sequencing, we targeted the Internal Transcribed Spacer 1 (ITS1) region of ribosomal RNA gene cluster. ITS1 was amplified with the forward primer ITS5-1737 (GGAAGTAAAAGTCGTAACAAGG) and reverse primer ITS2-2043R (GCTCGCTTCTTCATCGATGC) (White et al. 1990). The PCR reaction was performed in a 50 ml volume that contained approximately 10 ng of DNA, ExTaq buffer, 0.2 mM of dNTPs, 0.2 mM of each primer, and 2 units of ExTaq DNA polymerase. The cycling consisted of an initial denaturing at 94 °C for 30 s, followed by 25 cycles of denaturing at 94 °C for 30 s, annealing at 54 °C for 1 min and extension at 72 °C for 2 min, and a final extension at 72 °C for 8 min. All PCR reactions were carried out with PhusionÒ High-Fidelity PCR Master Mix (New England Biolabs Inc. Ipswich, MA, USA). The PCR products were mixed with same volume of 19 loading buffer (contained SYB green) and then operated electrophoresis on 2% agarose gel for quality detection. Only samples with bright main strip between 400–450 bp were chosen for further experiments. The qualified PCR products were mixed in equidensity ratios. Then, mixture PCR products were purified with Qiagen Gel Extraction Kit (Qiagen, Germany) following the manufacture’s protocol. Sequencing libraries were generated using TruSeqÒ DNA PCR-Free Sample Preparation Kit (Illumina, San Diego, CA, USA) following manufacturer’s recommendations and index codes were added. The library quality was 123 4 Table 1 Taxa identified in China, Russia, Italy and Thailand by directly observing specimens 123 Fungal Diversity (2018) 90:1–84 Family Species Country Amorosiaceae Angustimassarina populi Italy Botryosphaeriaceae Botryosphaeria dothidea China, Italy Botryosphaeriaceae Diplodia seriata Italy Botryosphaeriaceae Dothiorella iberica Italy Botryosphaeriaceae Dothiorella sarmentorum China, Italy Botryosphaeriaceae Neofusicoccum italicum Italy Botryosphaeriaceae Neofusicoccum parvum Italy Cantharellales Incertae sedis Minimedusa sp. China Chaetomiaceae Chaetomium globosum Italy Chaetosphaeriaceae Pseudolachnea hispidula Italy Cladosporiaceae Cladosporium cladosporioides China, Italy Cladosporiaceae Cladosporium cucumerinum Italy Diaporthaceae Diaporthe ampelina Italy Diaporthaceae Diaporthe rudis Italy Diaporthaceae Diatrypaceae Diaporthe eres Cryptovalsa ampelina China Italy Didymellaceae Didymella negriana Italy Didymellaceae Didymella pomorum China Didymellaceae Epicoccum nigrum Italy Didymosphaeriaceae Pseudocamarosporium propinquum Italy Glomerellaceae Colletotrichum dematium Russia Glomerellaceae Colletotrichum godetiae Italy Glomerellaceae Colletotrichum hebeiense China Glomerellaceae Colletotrichum siamense Italy Glomerellaceae Colletotrichum viniferum China Glomerellaceae Colletotrichum truncatum China Hypocreaceae Trichoderma atroviride China Hypocreaceae Trichoderma lixii China Hypocreaceae Trichoderma harzianum China Hypocreales genera insertae sedis Alfaria cyperi-esculenti Italy Hypocreales genera insertae sedis Lophiostomataceae Alfaria vitis Lophiostoma macrostomum Italy Italy Massariaceae Neomassaria fabacearum Italy Mucoraceae Actinomucor elegans China Mucoraceae Mucor racemosus China Mucoraceae Mucor circinelloides China Mycosphaerellaceae Pseudocercospora vitis Thailand Peniophoraceae Peniophora sp. China Sporocadaceae Neopestalotiopsis clavispora China Sporocadaceae Neopestalotiopsis vitis China Sporocadaceae Pestalotiopsis chamaeropis Italy Sporocadaceae Pestalotiopsis sp. Italy Sporocadaceae Pseudopestalotiopsis camelliae-sinensis Italy Pleosporaceae Alternaria alternata China, Italy Pleosporaceae Alternaria italic Italy Pleosporaceae Alternaria vitis Pleosporaceae Bipolaris maydis China China Pythiaceae Pythium sp. China Saccotheciaceae Aureobasidium pullulans Italy Schizoparmaceae Coniella vitis China Fungal Diversity (2018) 90:1–84 Table 1 continued 5 Family Species Country Sclerotiniaceae Botrytis cinerea China Sporocadaceae Seimatosporium vitis Italy Stachybotryaceae Albifimbria verrucaria China Stachybotryaceae Albifimbria viridis China Teichosporaceae Floricola viticola Italy Aspergillaceae Aspergillus aculeatus China Aspergillaceae Aspergillus niger China Aspergillaceae Penicillium brevicompactum China Aspergillaceae Penicillium citrinum China Aspergillaceae Penicillium terrigenum China Rhizopodaceae Rhizopus oryzae China Trichocomaceae Talaromyces amestolkiae China Trichocomaceae Talaromyces pinophilus China Trichocomaceae Talaromyces purpureogenus China Xylariaceae Neoanthostomella viticola Italy assessed on the QubitÒ 2.0 Fluorometer (Thermo Scientific) and Agilent Bioanalyzer 2100 system. At last, the library was sequenced on an IlluminaHiSeq2500 platform and 250 bp paired-end reads were generated. Paired-end reads were assigned to samples based on their unique barcode and truncated by cutting off the barcode and primer sequence. Paired-end reads were merged using FLASH (V1.2.7, http://ccb.jhu.edu/software/FLASH/ ) (Magoč and Salzberg 2011). Quality filtering on the raw tags was performed under specific filtering conditions to obtain the high-quality clean tags (Bokulich et al. 2013) according to the QIIME (V1.7.0, http://qiime.org/index. html) quality controlled process (Caporaso et al. 2010). The tags were compared with the reference database (Unite Database, https://unite.ut.ee/) using UCHIME algorithm (UCHIME Algorithm, http://www.drive5.com/usearch/ manual/uchime_algo.html) to detect chimera sequences (Edgar et al. 2011), and then the chimera sequences were removed (Haas et al. 2011). Then the Effective Tags were finally obtained. Sequences analysis was performed by Uparse software (Uparse v7.0.1001, http://drive5.com/ uparse/) (Edgar 2013). Sequences with C 97% similarity were assigned to the same OTUs. Representative sequence for each OTU was screened for further annotation. For each representative sequence, the Unite Database (https://unite. ut.ee/) (Kõljalg et al. 2013) was used to annotate taxonomic information based on Blast algorithm, which was calculated by QIIME software (Version 1.7.0) (http://qiime.org/ scripts/assign_taxonomy.html). In order to study phylogenetic relationship of different OTUs, and the difference of the dominant species in different samples (groups), multiple sequence alignment were conducted using the MUSCLE software (Version 3.8.31, http://www.drive5.com/ muscle/) (Edgar 2004). All OTU abundance information was normalized using a standard of sequence number corresponding to the sample with the least sequences (45, 246 sequences). From the data set, rare OTUs (singletons), which could have potentially originated from sequencing errors (Kunin et al. 2010), were removed. We used a Mantel test based on Bray–Curtis distance measure with 999 permutations to assess the correlation between the whole matrix and a matrix excluding the rare OTUs (Hammer et al. 2001; Hoppe et al. 2016). The results indicated that the removal of rare OTUs from the fungal communities had no effect (RMantel= 1.000, P = 0.002). Subsequent analysis of alpha diversity and community composition were all performed basing on these normalized rare OTUs removal data. The fungal ITS rDNA genes Illumina sequencing data are deposited in the NCBI under the BioProject No PRJNA437133. Statistical analysis Mycobiome analysis All datasets related to fungal OTU richness were tested for normality and equality of variances using the Jarque–Bera test. To assess the coverage of the sequencing depth, individual rarefaction analysis was performed for each sample using the ‘‘diversity’’ function in PAST (Hammer et al. 2001). In this work we used observed fungal OTU richness and Shannon diversity index as the measures for fungal diversity. The difference in fungal OTU richness between the two deadwood species was compared using a two-sample t test in PAST. To visualize the fungal community compositions, we used non-metric multidimensional scaling (NMDS) analysis based on the Bray–Curtis dissimilarity index calculated PAST. Similarity 123 6 Fungal Diversity (2018) 90:1–84 Table 2 Taxa identified from the two grape cultivars and their life modes using the traditional approach Species Family Life Mode References Actinomucor elegans var. meitauzae Mucoraceae Saprotroph Zheng and Liu (2005) Albifimbria viridis Stachybotryaceae Saprotroph Lombard et al. (2016) Albifimbria verrucaria Stachybotryaceae Saprotroph Lombard et al. (2016) Alternaria alternata Pleosporaceae Pathogen, endophyte, saprotroph French (1989), Mulenko et al. (2008), Kakalikova et al. (2009), Gonzalez and Tello (2011) Alternaria vitis Pleosporaceae Pathogen, endophyte, saprotroph Zhang (2003), Zhuang (2005) Aspergillus aculeatus Aspergillaceae Secondary pathogen, saprotroph Jarvis and Traquair (1984) Aspergillus niger Aspergillaceae Secondary pathogen, endophyte, saprotroph Bobev (2009), Casieri et al. (2009), Gonzalez and Tello (2011) Bipolaris maydis Pleosporaceae Saprotroph Manamgoda et al. (2014) Botryosphaeria dothidea Botryosphaeriaceae Pathogen, endophyte, saprotroph Úrbez-Torres et al. 2012, 2013a, b Botrytis cinerea Sclerotiniaceae Pathogen Piqueras et al. (2014), Saito et al. (2016) Cladosporium cladosporioides Cladosporiaceae Pathogen, endophyte, saprotroph Swett et al. (2016) Cladosporium sp. Cladosporiaceae Pathogen, endophyte, saprotroph Swett et al. (2016) Clonostachys rosea Bionectriaceae Pathogen, endophyte, saprotroph Casieri et al. (2009) Colletotrichum hebeiense Glomerellaceae Pathogen Yan et al. (2015) Colletotrichum truncatum Glomerellaceae Pathogen Pan et al. (2016) Colletotrichum viniferum Glomerellaceae Pathogen Peng et al. (2013) Coniella vitis Schizoparmaceae Pathogen Chethana et al. (2017) Diaporthe eres Diaporthaceae Pathogen Bastide et al. (2017) Didymella pomorum Didymellaceae Saprotroph Cook and Dubé (1989) Dothiorella sarmentorum Botryosphaeriaceae Pathogen Carlucci et al. (2015) Epiccocum nigrum Didymellaceae Saprotroph Casieri et al. (2009) Exserohilum rostratum Pleosporaceae Saprotroph Ariyawansa et al. (2015) Fusarium oxysporum Nectriaceae Pathogen Gonzalez and Tello (2011) Fusarium sp. Nectriaceae Pathogen Gonzalez and Tello (2011) Minimedusa sp. Cantharellales incertae sedis Saprotroph Beale and Pitt (1990) Mucor racemosus Mucoraceae Secondary pathogen Gonzalez and Tello (2011) Mucor circinelloides Mucoraceae Secondary pathogen Gonzalez and Tello (2011) Neopestalotiopsis clavispora Sporocadaceae Saprotroph Maharachchikumbura et al. (2015) Neopestalotiopsis vitis Sporocadaceae Pathogen Jayawardena et al. (2015, 2016a, b) Paraphoma chrysanthemicola Pleosporales incertae sedis Saprotroph Hofstetter et al. (2012) Penicillium brevicompactum Aspergillaceae Secondary pathogen Kim et al. (2007) Penicillium citrinum Aspergillaceae Secondary pathogen Kim et al. (2007) Penicillium terrigenum Aspergillaceae Kim et al. (2007) Torrejón (2013) Weber et al. (2004) Peniophora sp. Peniophoraceae Secondary pathogen Saprotroph Phoma medicaginis Didymellaceae Saprotroph 123 Fungal Diversity (2018) 90:1–84 7 Table 2 (continued) Species Family Life Mode References Pythium amasculinum Pythiaceae Pathogen Uzuhashi et al. (2010) Rhizopus oryzae Rhizopodaceae Secondary pathogen Gonzalez and Tello (2011) Septoriella allojunci Dothideomycetes incetae sedis Saprotroph Li et al. (2015) Stagonosporopsis sp. 1 Stagonosporopsis sp.2 Didymellaceae Didymellaceae Saprotroph Saprotroph Hofstetter et al. (2012) Hofstetter et al. (2012) Talaromyces pinophilus Trichocomaceae Saprotroph Yilmaz et al. (2014) Talaromyces purpurogenus Trichocomaceae Saprotroph Yilmaz et al. (2014) Talaromyces amestolkiae Trichocomaceae Saprotroph Yilmaz et al. (2014) Trichoderma atroviride Hypocreaceae Saprotroph Gonzalez and Tello (2011) Trichoderma harzianum Hypocreaceae Saprotroph Gonzalez and Tello (2011) Trichoderma lixii Hypocreaceae Saprotroph Gonzalez and Tello (2011) Percentages (SIMPER) analysis using PAST was used to obtain the identity and relative abundances of the fungal taxa that contributed to 92.92% of the observed pair-wise variation in the fungal community composition due to different V. vinifera cultivars. To accounting for the effect of locations when compared the fungal community compositions of the two grape cultivars which were collected from different locations, we eliminated all location specific fungal OTUs (87 OTUs). We finally retained 139 OTUs for the community composition analysis using NMDS based on the Bray–Curtis dissimilarity. The results from these reduced datasets were highly consistent compared with the total datasets (Supplementary Fig. S3a, b). Potential fungal functional groups were identified using the online Guilds application tool: FUNGuildb (Nguyen et al. 2015). The ITS1 fragments were extracted from both the Sanger sequencing (traditional) and Illumina sequencing datasets using ITS1. The output showed that both datasets have the ITS1 region except culture sequences of the genus Neopestalotiopsis (9 sequences). The sequence similarity based comparison was performed using the cd-hit-est-2d algorithm at 90% similarity level for a genus level comparison. Percent occurrence of a taxon A (%) Occurrence of taxon A ¼ 100 Occurrence of all taxa in one sample Species richness ¼ the number of different species represented in an ecological community Following diversity indices were calculated using the R software for the two cultivars and the habits. (i) Shannon Wiener’s Index (H) ¼ X pi ln pi ; where pi is the frequency of fungal species I occurring on a specific sample (Begon et al. 1993; Wong and Hyde 2001; Wang et al. 2008). (ii) Srensen’s index of similarity (S) ¼ 2c=ða þ bÞ; where a is the total number of species on host A, b is the total number of species on host B and c is the number of species on both host. Similarity is expressed with values between 0 (no similarity) and 1 (absolute similarity) (Wang et al. 2008). Diversity analysis Taxa were recorded as either present or absent from each sample. Occurrence of a fungus was designated based on the presence of a particular fungus on the host samples. Percentage occurrence of a taxon on one sample was calculated using the following formula (Tsui et al. 2001; Yanna and Hyde 2002; Wang et al. 2008): Compiling the checklist The checklist is based on, articles in referred journals, Index to Saccardo’s Sylloge fungorum, Petrak’s Lists, Index of Fungi, graduate student theses, books, and webbased resources such as annual reports on this host and the SMML database (https://nt.ars-grin.gov/fungaldatabases/) 123 8 Fungal Diversity (2018) 90:1–84 Fig. 1 Dead V. vinifera samples at collection sites (latest accessed 14-9-2017). The mode of life, such as pathogen, endophyte or saprotroph is listed. The checklist includes species names, family, life modes, disease name if any and locality. The current name is used according to Index Fungorum (2018) and Wijayawardene et al. (2017) and the classification follows Wijayawardene et al. (2018). Genera and species are listed in alphabetical order. Identification confirmed by molecular data is marked with an asterisk (*). In some cases, the host name given in the original citation was changed to be consistent with current taxonomy. In a few cases, neither the species cited nor a proper synonym was identified and the species name was used as originally cited. 123 Results Species identified from fresh collections based on morphology and phylogeny (traditional method) Fungal saprophytic diversity and community composition of the two grape cultivars: traditional method Examination of decaying leaves, shoots, inflorescence, berries, root and bark of two cultivars of V. vinifera from China yielded 461 collections for the Red Globe variety and 180 collections for Carbanate Gernischet. The Red Globe variety Fungal Diversity (2018) 90:1–84 9 had higher species richness (41) than the Carbanate Gernischet variety (23), however the Shannon diversity was not significantly different (Table 3). The majority of the culturable saprotrophic fungi were ascomycetes. However, there were two species belonging to Agaricomycetes and one species belonging to Oomycota incertae sedis. Thirty genera and 45 taxa were identified based on morphology and phylogenetic sequence data. From the identified isolates, 32.6% were Sordariomycetes, 26.1% Dothideomycetes 19.7% Eurotiomycetes, 6.5% Mucoromycetes, 4.4% Agaricomycetes, 2.2% Leotiomycetes and 2.2% of Oomycota incertae sedis. There were four taxa belonging to Zygomycota incertae sedis, which we were unable to identify. The identified Sordariomycetes belonged to Bionectriaceae (6.7%), Diaporthaceae (6.7%), Glomerellaceae (20%), Hypocreaceae (20%), Nectriaceae (13.3%), Schizoparmaceae (6.7%), Stachybotryaceae (13.3%) and Sporocadaceae (13.3%). Dothideomycete isolates belonged to Botryosphaeriaceae (16.7%), Cladosporiaceae (16.7%), Didymellaceae (33.3%) and Pleosporaceae (33.3%). The rest of the isolates belong to Mucoraceae (6.5%), Peniophoraceae (2.2%), Pythiaceae (2.2%), Rhizopodaceae (2.2%), Sclerotiniaceae (2.2%) and Trichocomaceae (17.4%). Among those 45 taxa, we found 19 species that were common on both cultivars: Actinomucor elegans, Alternaria alternata, Aspergillus niger, A. aculeatus, Cladosporium cladosporioides, Cladosporium sp., Clonostachys rosea, Coniella vitis, Diaporthe eres, Fusarium oxysporum, Mucor racemosus, Penicillium terrigenum, Phoma medicaginis, Rhizopus oryzae, Talaromyces amestolkiae, T. pinophilus, T. purpurogenus and T. harzianum. The Sørensen’s index of similarity of the two grape cultivars was 0.58. We have identified 45 taxa to species level, although in six cases the identification is only to genus level due to lack of enough molecular data. Taxa were identified using both morphology and molecular techniques. Identified species are listed in Tables 1 and 2 (Supplementary Figs. S1a–d, S2). Fungal saprophytic diversity and community composition of the two grape cultivars: cultureindependent technique Bioinformatics processing of the sequence data sets A total of 638,146 quality-filtered fungal ITS reads were obtained after removal of chimeric and the unique tag Table 3 Richness and diversity (mean ± SD, n = 3) of fungi detected in the two Vitis vinifera cultivars RG CG Species richness 41 23 Shannon 2.5433 ± 0.251 2.4743 ± 0.187 (3703 sequences) sequences. After normalizing all data sets to a smallest sequence read (45, 246 sequences) and removing all rare taxa, the final analyse data sets contained 226 fungal OTUs. Phylogenetic trees for the top 20 species in different samples of the two cultivars Carbanate Gernischet and Red Globe of Vitis vinifera are given in Fig. 2. With the high number of sequence reads per sample obtained in this study, the sample-based rarefaction curves almost reached saturation for all samples (Fig. 3a). We used the observed OTU richness and Shannon diversity directly for further analyses. Fungal saprotrophic OTU diversity and distribution in the two cultivars of Vitis vinifera Diverse fungi colonized the debris samples derived from Carbanate Gernischet and Red Globe cultivars. Fungal OTU richness was not significantly different between the two V. vinifera cultivars tested in this study, ranging from 122–137 (127.33 ± 4.84 (mean ± SD); Carbanate Gernischet) and 116–141 (126.33 ± 7.54 (mean ± SD); Red Globe) (t = 0.11, P = 0.916). Shannon diversity also showed a similar trend ranging from 1.98–2.35 (2.16 ± 0.11 (mean ± SD); Carbanate Gernischet) and 1.78–1.98 (1.86 ± 0.06 (mean ± SD); Red Globe) (t = 2.41, P = 0.07). In total we detected 226 fungal OTUs with 176 and 189 belonging to the cultivars Carbanate Gernischet and Red Globe, respectively. There were 139 Fungal OTUs shared between the two V. vinifera cultivars and 37 and 50 OTUs were specific to Carbanate Gernischet and Red Globe cultivars. When we took each replicate into account, we detected only moderate proportion of fungal OTUs shared across different replicates (31–44%, 51 OTUs, Fig. 3b). Distributions of fungal OTUs across replicates for the two cultivars and for each specific cultivar are shown in Fig. 3b–d. Fungal saprophytic community composition: cultureindependent technique The NMDS ordination plot and SIMPER analysis revealed distinct fungal communities in the two cultivars of V. vinifera samples (Table 4 and Supplementary Fig. S3a, b). Overall, fungal community composition of the two cultivars had the overall average dissimilarity of 94.29% (based on Bray–Curtis distance measure) and 30 fungal OTUs mostly responsible for differences in fungal community composition were all together accounting for 94.41% of the overall average dissimilarity (Table 4). The difference in fungal community composition between the two cultivars of V. vinifera was detected across different taxonomic levels (Supplementary Figs. S4, S5). In Carbanate Gernischet, members of Ascomycota were commonly detected accounting for 77% (46% 123 10 Fungal Diversity (2018) 90:1–84 Fig. 2 Phylogenetic tree of top 20 species in different samples of the two cultivars Carbanate Gernischet and Red Globe of Vitis vinifera Sordariomycetes, 19% Eurotiomycetes and 7% Dothideomycetes) of total sequences in this cultivar followed by unidentified phylum (23%; Fungal OTU-7) and Basidiomycota and Zygomycota (less than 0.1%). In Red Globe, almost all sequences were assigned to Ascomycota (97%; 51% Eurotiomycetes, 42% Sordariomycetes, and 3% Dothideomycetes) followed by Basidiomycota (3%; 1% Agaricomycetes and 1% Tremellomycetes) and unidentified phylum (Fungal OTU-7) and Zygomycota were negligible (altogether less than 0.5%). Phylogenetic tree for the abundance at genus level using the top 35 genera detected in the two cultivars are shown in Fig. 4. The difference between the fungal community composition of the two 123 cultivars of V. vinifera were clearly demonstrated at OTU level: Trichothecium roseum OTU-1, Fungal-OTU-7, Aspergillus piperis OTU-5 and Nectriaceae OTU-3 were commonly detected (10–20%) in Carbanate Gernischet, but almost absent in Red Globe (represented by Aspergillus OTU-11, Ilyonectria macrodidyma OTU-4, Aspergillus cibarius OTU-2 and Diaporthaceae OTU-10; 11–19%; Table 4). Using presence/absence data, we found that for both Vitis vinifera cultivars Ascomycota (Carbanate Gernischet = 151 OTUs and Red Globe = 162 OTUs) was the richest OTU phylum followed by unidentified phylum, Basidiomycota (11–14 OTUs) and Zygomycota (2 OTUs). Fungal Diversity (2018) 90:1–84 11 Fig. 3 Rarefaction curves (a), and Venn diagrams show distribution of OTUs across different samples (1–3): (b) in both Carbanate Gernischet (CG) and Red Globe (RG) cultivars, (c) only Carbanate Gernischet and (d) only Red Globe Patterns of the richest OTU classes and orders were similar for both cultivars: Sordariomycetes (Hypocreales (Carbanate Gernischet = 32 OTUs and Red Globe = 39 OTUs), Sordariales (Carbanate Gernischet = 13 OTUs and Red Globe = 13 OTUs), Microascales (Carbanate Gernischet = 10 OTUs and Red Globe = 11 OTUs)], Eurotiomycetes (Eurotiales, Carbanate Gernischet = 41 OTUs and Red Globe = 38 OTUs) and Dothideomycetes (Pleosporales, Carbanate Gernischet = 7 OTUs and Red Globe = 7 OTUs). Comparing and matching of traditional and culture-independent approaches Several commonly detected fungal genera (Aspergillus, Clonostachys and Fusarium) were detected in both approaches. However, there are many highly or frequently detected genera in the mycobiome that were not detected in the traditional method. These include Acrostalagmus, Aureobasidium, Ceratobasidium, Chrysosporium, Ilyonectria, Lasiodiplodia, Microascus, and Trichothecium (Supplementary Table S1). Some frequently isolated fungi, especially the fast growing ones (Rhizopus and Mucor) were not detected in mycobiome analysis. ITS sequences obtained from both traditional and culture-independent methods were compared using the query and cluster cover. This showed that the saprotrophs detected from the two approaches are consistent in most cases. However, in few cases we found inconsistent identifications which have arisen from the lower level of taxonomic assignment in the culture-independent (amplicon sequencing) as compared with traditional approaches. For example, Diaporthe eres and Alternaria identified via the traditional approach were identified as Diaporthaceae and Pleosporaceae in the culture-independent analyses. A mismatch was also found between Albifimbria viridis and Myrothecium sp., which are classified in the same order (Hypocreales). The sexual morph genus Talaromyces was matched with its potential asexual morph (Penicillium). We found that twelve taxa detected from traditional method form a cluster (91–100% similarity) with 25 fungal OTUs from the culture-independent methods (Table 5). We were able to assign 25 OTUs from NGS: 20 OTUs to genus and 5 OTUs (similarity 99–100%) to species level respectively (Table 5). We removed two OTUs as singletons (Botryosphaeria OTU-178 and Ascomycota OTU213) as they were detected only once. However, in the direct matching of ITS sequences, these fungal OTUs showed 97 and 100% similarity to Botryospaeria dothidea and Coniella vitis, respectively. The other fungi that we were able to identify to the species level are Aspergillus niger, Clonostachys rosea, Botrytis cinerea, and Albifimbria viridis. Most of the frequently detected genera in the traditional approach (i.e. with relative abundance higher than 5%; Alternaria, Clonostachys, Fusarium) were also detected in culture-independent approach. Rhizopus sp. and 123 12 Fungal Diversity (2018) 90:1–84 Table 4 Similarity percentages (SIMPER) analysis showing the top 30 fungal OTUs mostly responsible for differences in fungal community composition between Carbanate Gernischet(CG) and Red Globe (RG) cultivars; OA Dissimilarity = overall average dissimilarity Talaromyces sp. were frequently detected in the traditional approach, but exhibited low relative abundances or disappeared in the culture-independent approach. Fungal functional groups identified using traditional and culture-independent approaches Among the 45 identified taxa based on traditional method, 17 are well known pathogens on V. vinifera causing severe yield as well as economic loss to viticulture around the 123 world (Table 2). Six species of secondary pathogens of V. vinifera were also identified in this study. Most of the pathogens tend to survive or overwinter on dead plant material as saprotrophs and act as the primary inoculums once the conditions are favourable (Armijo et al. 2016). In total, 143 fungal OTUs (63% of total fungal OTUs) were successfully assigned for their functions (Supplementary Table S1). We identified six functional groups of fungi associated with dead materials of V. vinifera: saprotrophs, plant pathogens, endophytes, fungal parasites– Fungal Diversity (2018) 90:1–84 13 Fig. 4 Abundance phylogenetic tree at genus level (top 35 genera) in two cultivars [Carbanate Gernischet (CG1-3) and Red Globe (RG1-3)] of Vitis vinifera saprotrophs (mycoparasites–saprotrophs), ectomycorrhizae and animal pathogens. The fungal community was dominated by saprotrophs (102 OTUs) and plant pathogens (22 OTUs), which accounted for 71% and 15% of the function assigned to fungal OTUs in this study. Clonostachys, Lasiodiplodia and Trichothecium, were the most commonly detected plant pathogen genera with relative abundances 1–10%. Botrytis sp., an important fungal pathogen in grape, was also detected with low relative abundance. Endophytes together with endophyte–saprotrophs and endophyte–plant pathogens (9 OTUs) contributed little and most OTUs were detected with low relative abundance, except, Acrostalagmus luteoalbus. All fungal OTUs with their potential functions are listed in Supplementary Table S1. Checklist of fungi on Vitis Nine-hundred and six fungal taxa have been reported on Vitis species and are listed in Table 6, although the actual number of fungal taxa associated with this host is likely much higher. It is not possible to reconfirm all previous reports by re-examining collections to confirm their identities. In many cases no fungarium material is linked to the reports, while examining nearly 900 specimens would be an almost impossible task. Even if it was were possible, it would most likely be futile, since molecular data would be needed to establish correct names. This is extremely difficult based on the presently available techniques and not permitted by many fungaria. Most of the 905 taxa reported from Vitis species do not have sequence data. Therefore, recollecting and sequencing these taxa are essential to establish and accurate species list associated with Vitis species. 123 14 Fungal Diversity (2018) 90:1–84 Table 5 Matching of fungal isolates to the saprotrophic mycobiome of Vitis vinifera Fungal taxon (culture) Albifimbria viridis Alternaria spp. Relative abundance in culture (%) 0.55 28.14 Fungal taxa (mycobiome) Relative abundance in mycobiome (%) Cluster identification (coverage) % Number of OTUs in cluster Myrothecium 0.010 99 (100) 1 Ampelomyces, Phoma, Pleosporaceae OTU, Fungal OTU 0.636 92–100 (95–100) 4 Aspergillus niger 6.01 Aspergillus 3.683 99 (100) 1 Botryospaeria dothidea 0.27 Botryospaeria Remove as singleton 97 (100) 1 Botrytis cinerea 2.73 Botrytis 0.002 100 (100) 1 Clonostachys rosea 2.19 Clonostachys 5.244 99 (100) 1 Coniella vitis 1.09 Ascomycota OTU Remove as singleton 100 (100) 1 Diaporthe eres 1.37 Diaporthaceae OTUs 0.070 92–97 (98–100) 2 Fusarium sp. Penicillum sp. 25.41 0.54 Fusarium, Nectriaceae OTUs Penicillium 5.368 0.203 93–100 (83–87) 91–100 (81–100) 8 3 Talaromyces amestolkiae 5.46 Penicillium 0.001 96 (100) 1 Tricoderma atroviride 4.09 Tricoderma 0.008 97 (99) 1 Discussion Before the advent of molecular data in taxonomy, studies on the fungi on Vitis were based on traditional methodology and have resulted in hundreds of records of fungi from this host genus (Table 6). Most recent studies have been related to pathogens that affect grape yield and production (Úrbez-Torres et al. 2012, 2013a, b; Dissanayake et al. 2015; Liang et al. 2016; Jayawardena et al. 2015, 2016a; Yan et al. 2015; Chethana et al. 2017) and have resulted in well-resolved taxonomy as they have used molecular data. However, studies on saprobes using molecular data and culture-independent techniques have not been used to identify the fungi on Vitis to date. In this study, we therefore provide the first work comparing saprobes on Vitis sp. using both traditional and culture-independent approaches, with well-resolved taxonomic identifications based on molecular analyses. The taxa derived from both approaches are compared as the same samples were used in the study. We have also established the saprotrophic communities associated with both wine and table grapevine cultivars and demonstrate cultivar specific communities for each grapevine cultivar. A checklist of fungi of Vitis is also provided which is an important resource for viticulture. 123 Microfungi collected from China, Italy, Russia and Thailand Sixty-seven saprotrophic taxa from 46 genera were identified in this study (Table 1). Using traditional methodology and analyses of molecular data, we identified two new species, and 41 new host or distribution records for V. vinifera. Taxonomic details, descriptions, photographic plates and phylogenetic analyses are provided in Jayawardena et al. (2018). Some of these genera have a wide distribution. For example, botryosphaerious and Colletotrichum taxa have a wide distribution. These taxa are well-known pathogens and can be spread to other countries undetectable through the exportation of rootstocks. Some genera are only known from one or two countries. This may be due to the lack of data on the fungi associated with this host. Comparisons of traditional and cultureindependent approaches for characterizing the saprotrophic fungal communities associated with two cultivars of Vitis vinifera Most previous studies on fungi on grapevine have relied on traditional approaches (Table 6). Some recent identification of isolated taxa have incorporated analyses of ITS sequence data (Guo et al. 2003; Promputtha et al. 2007), Fungal Diversity (2018) 90:1–84 15 Table 6 Check list of fungi on Vitis sp. (classification follows Wijayawardene et al. 2017, 2018) Species Family Life mode Disease caused Locality References Acremonium acutatum W. Gams* Bionectriaceae P Unknown Korea Oh et al. (2014) A. alternatum Link* Bionectriaceae E China, Greece, Spain Pantidou (1973), Benavides et al. (2013), Dissanayake et al. (2018) Acremonium sp.* Bionectriaceae P, E Argentina, China, Iran, Italy, South Africa, Korea, Spain Gatica et al. (2001), Halleen et al. (2003), Luque et al. (2009), Gonzalez and Tello (2011), Mohammadi and Banihashemi (2012), Mondello et al. (2013), Oh et al. (2014), This study Acrocalymma vagum (D.F. Farr) P.W. Crous & T. Trakunyingcharoen* Acrocalymmaceae U Spain Trakunyingcharoen et al. (2014) Acrospermum viticola Ikata & Hitomi Acrospermaceae U China, Japan, Korea Tai (1979), Cho and Shin (2004), Kobayashi (2007) Acrostalagmus luteoalbus (Link) Zare, W. Gams & Schroers* Actinomucor elegans (Eidam) C.R. Benj. & Hesselt* Plectosphaerellaceae S China This study Mucoraceae S China This study, Jayawardena et al. (2018) Agaricus viticola Schulzer Agaricaceae S Slavonia Saccardo (1878) Albifimbria verrucaria (Alb. & Schwein.) L. Lombard & Crous* Stachybotryaceae S China This study, Jayawardena et al. (2018) A. viridis L. Lombard & Crous* Stachybotryaceae S China This study, Jayawardena et al. (2018) Alfaria cyperi-esculenti Crous, Montaño-Mata & Garcı́a-Jim* Hypocreales genera incertae sedis S Italy This study, Jayawardena et al. (2018) Alfaria vitis Manawasinghe, Camporesi & K.D. Hyde* Hypocreales genera incertae sedis S Italy This study, Jayawardena et al. (2018) Alternaria lternate (Fr.) Keissl.* Pleosporaceae P, E, S Brunei, China, Italy, Poland, Slovakia, Spain, USA Peregrine and Ahmad (1982), French (1987, 1989), Mulenko et al. (2008), Kakalikova et al. (2009), Gonzalez and Tello (2011), Dissanayake et al. (2018), This study, Jayawardena et al. (2018) A. arborescens E.G. Simmons* Pleosporaceae E Spain, Switzerland Casieri et al. (2009), Gonzalez and Tello (2011) A. italica J.F. Li,Camporesi & K.D. Hyde* Pleosporaceae S Italy This study, Jayawardena et al. (2018) A. tenuissima (Kunze) Wiltshire Pleosporaceae E Malawi, Spain Wiehe (1948), Peregrine and Siddiqi (1972), Gonzalez and Tello (2011) ‘Hoja de malvon’ Fruit rot 123 16 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family A. viticola Brunaud Pleosporaceae P Fruit rot China Tai (1979) A. vitis Cavara* Pleosporaceae P, S Leaf blight, Fruit rot Chile, China, El Salvador, Greece, India, Italy, Romania, Russia, Thailand, Turkmenistan Cavara (1888), Makovetz (1933), Stevenson and Wellman (1944), Mujica and Vergara (1945), Nasyrov (1964), Sarbhoy et al. (1971), Pantidou (1973), Giatgong (1980), Bechet and Sapta-Forda (1981), Zhang (2003), Zhuang (2005), This study, Jayawardena et al. (2018) A. viniferae Yong Wang bis, Y.Y. Than, K.D. Hyde & Xing H. Li* Pleosporaceae P On pedicels and rachis China Tao et al. (2014) Alternaria sp.* Pleosporaceae P, E On pedicels and rachis Cuba, France, Italy, Poland, South Africa, Spain, Switzerland, USA Preston (1945), Harvey (1955), Arnold (1986), Cook and Dubé (1989), Larignon and Dubos (1997), Halleen et al. (2003), Mulenko et al. (2008), Casieri et al. (2009), Gonzalez and Tello (2011), Mondello et al. (2013) Amerosporium concinnum Petr. Ascomycota genera incertae sedis P Excoriose and die back Portugal Phillips (2000) Ampelomyces quisqualis Ces. Phaeosphaeriaceae M South Africa Doidge (1950) Ampelomyces sp.* Phaeosphaeriaceae S China This study Amphisphaeria sylvan Sacc. & Speg Amphisphaeriaceae S Italy Farr (1973) A. humuli (Fautrey) Rudakov Amphisphaeriaceae M Ukraine Dudka et al. (2004) Angustimassarina populi Thambug. & K.D. Hyde* Amorosiaceae S Italy This study, Jayawardena et al. (2018) Aplosporella beaumontiana S. Ahmad Aplosporellaceae S India Rajak and Pandey (1985) A. fabiformis (Pass. & Thüm.) Petr. & Syd. Aplosporellaceae P On stem Italy, Pakistan, USA Petrak and Sydow (1927), Anonymous (1960), Ahmad (1969) A. japonicas Ellis & Everh. Aplosporellaceae P On stem China Tai (1979) A. viticola Cooke & Massee Aplosporellaceae P On stem UK Saccardo (1878) Aplosporella sp.* Aplosporellaceae S China This study Apodus sp.* Lasiosphaeriaceae S China This study Arachnomyces sp.* Arachnomycetaceae S China This study Armillaria limonea (G. Stev.) Boesew Physalacriaceae P Root rot New Zealand Gadgil (2005) A. luteobubalina Watling & Kile Physalacriaceae P Root rot Australia Cook and Dubé (1989) 123 Life mode Disease caused Locality References Fungal Diversity (2018) 90:1–84 17 Table 6 (continued) Species Family Life mode Disease caused Locality References A. mellea (Vahl) P. Kumm. Physalacriaceae P Root rot Australia, Greece, Italy, Japan, Scotland, USA Anonymous (1960), Foister (1961), Simmonds (1966), French (1989), Zervakis et al. (1998), Holevas et al. (2000), Kobayashi (2007), Bobev (2009), Prodorutti et al. (2009) A. novae-zelandiae (G. Stev.) Boesew Physalacriaceae P Root rot New Zealand Gadgil (2005) Armillaria sp. Physalacriaceae P Root rot Australia, New Zealand Pennycook (1989), Shivas (1989) Arthrobotrys sp.* Orbiliaceae S Switzerland Casieri et al. (2009) Arthrographis sp.* Eremomycetaceae S China This study Arthrinium arundinis* (Corda) Dyko & B. Sutton Apiosporaceae E Switzerland Casieri et al. (2009) A. phaeospermum (Corda) M.B. Ellis Apiosporaceae E Spain Gonzalez and Tello (2011) A. rasikravindrae Shiv M. Singh, L.S. Yadav, P.N. Singh, Rah. Sharma & S.K. Singh* Apiosporaceae E China Dissanayake et al. (2018) Arthrinium sp. Apiosporaceae U Russia Melnik and Popushoi (1992) Arxiomyces vitis (Fuckel) P.F. Cannon & D. Hawksw. Ceratostomataceae U Europe, Poland von Arx and Mueller (1954), Mulenko et al. (2008) Ascochyta ampelina Sacc. Didymellaceae P Greece, Pakistan, Romania, UK, USA Saccardo (1878), Anonymous (1960), Pantidou (1973), Ahmad et al. (1997), Jones and Baker (2007) Ascorhizoctonia sp.* Pyronemataceae E China Dissanayake et al. (2018) Aspergillus aculeatus Iizuka* Aspergillaceae P, S Bunch rot Canada, China Jarvis and Traquair (1984), This study, Jayawardena et al. (2018) A. carbonarius (Bainier) Thom* Aspergillaceae P Bunch rot South Africa, USA Setati et al. (2015), RooneyLatham et al. (2008) A. cibarius S.B. Hong & Samson* Aspergillaceae S China This study A. flavus Link A. glaucus (L.) Link Aspergillaceae Aspergillaceae P U Italy Dominican Republic Greuter et al. (1991) Ciferri (1929, 1961) A. aponicas Saito* Aspergillaceae E China Dissanayake et al. (2018) A. niger Tiegh.* Aspergillaceae P, E, S Australia, Bulgaria, China, Cyprus, Italy, Japan, Spain, South Africa, Switzerland, USA, Zimbabwe Georghiou and Papadopoulos (1957), Whiteside (1966), Cook and Dubé (1989), Setati et al. (2015), Michailides et al. (2002), Kobayashi (2007), Vitale et al. (2008), Bobev (2009), Casieri et al. (2009), Gonzalez and Tello (2011), Dissanayake et al. (2018), This study, Jayawardena et al. (2018) On leaves Bunch rot Bunch rot, Canker 123 18 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode A. terreus Thom* Aspergillaceae E, S Disease caused Canker Locality References Spain, China Gonzalez and Tello (2011), This study A. tubingensis Mosseray* Aspergillaceae P Spain Garcia-Benavides et al. (2013) A. piperis Samson & Frisvad* Aspergillaceae S China This study A. pseudodeflectus Samson & Mouch.* Aspergillaceae E, S China Dissanayake et al. (2018), This study A. pseudoglaucus Blochwitz* Aspergillaceae E China Dissanayake et al. (2018) A. ustus (Bainier) Thom & Church Aspergillaceae U Italy Greuter et al. (1991) Aspergillus sp.* Aspergillaceae P, E, S China, France, Italy, Korea,South Africa, Spain, Switzerland Larignon and Dubos (2001), Halleen et al. (2003), Casieri et al. (2009), Gonzalez and Tello (2011), Mondello et al. (2013), Oh et al. (2014), Dissanayake et al. (2018), This study Asperisporium minutulum (Sacc.) Deighton Mycosphaerellaceae E USA Schubert and Braun (2005) A. vitiphyllum (Speschnew) Deighton Mycosphaerellaceae E China, Europe, Russia, Uzbekistan Elenkin (1909), Gaponenko (1965), Sutton (1975), Zhuang (2005) Athelia rolfsii (Curzi) C.C. Tu & Kimbr. Atheliaceae P, S Mauritius, New Zealand, Taiwan Aureobasidium pullulans (de Bary) G. Arnaud.* Saccotheciaceae E, S Australia, China, France, Germany, Greece, Italy, South Africa, Spain, Poland, USA Orieux and Felix (1968), Anonymous (1979), Pennycook (1989) Setati et al. (2015), Morgan and Michailides (2004), Mulenko et al. (2008), Gonzalez and Tello (2011), Sanoamuang et al. (2013), Fischer et al. (2016), Dissanayake et al. (2018), This study, Jayawardena et al. (2018) Bunch rot, canker, sour rot Sour rot Aureobasidium sp.* Saccotheciaceae S China This study Bactrodesmium pallidum M.B. Ellis Dothideomycetes genera incertae sedis S Russia Melnik and Popushoi (1992) Bartalinia robillardoides Tassi Sporocadaceae S India Mathur (1979) Beauveria bassiana (Bals.-Criv.) Vuill* Cordycipitaceae P, E Spain Gonzalez and Tello (2011), Garcia-Benavides et al. (2013) Bertia vitis Schulzer Bertiaceae S Croatia, Portugal Schulzer (1870), Unamuno (1941) Bionectria ochroleuca (Schwein.) Schroers & Samuels* Bionectriaceae S Switzerland Casieri et al. (2009) Bipolaris maydis (Y. Nisik. & C. Miyake) Shoemaker* Pleosporaceae S China This study, Jayawardena et al. (2018) 123 U Fungal Diversity (2018) 90:1–84 19 Table 6 (continued) Species Family Life mode B. sorokiniana (Sacc.) Shoemaker* Pleosporaceae Biscogniauxia capnodes (Berk.) Y.M. Ju & J.D. Rogers Disease caused Locality References E China Dissanayake et al. (2018) Boliniaceae S Taiwan Ju and Rogers (1999) B. mediterranea (De Not.) Kuntze Boeremia exigua var. exigua (Desm.) Aveskamp* Boliniaceae S USA Anonymous (1960) Didymellaceae P Black spot Italy Balmas et al. (2005) Botryodiplodia palmarum (Cooke) Petr. & Syd. Botryosphaeriaceae P Canker India Mathur (1979) B. vitis Sousa da Câmara Botryosphaeriaceae P Canker Pakistan, Portugal Sousa da Câmara (1950), Ahmad et al. (1997) Botryodiplodia sp. Botryosphaeriaceae P Canker Argentina, Brazil Mendes et al. (1998), Gatica et al. (2001) Botryosphaeria bondarzewii L. A. Kantsch. Botryosphaeriaceae S Russia, USA Kantschaveli (1928), Nagorny (1930) B. dothidea (Moug. ex Fr.) Ces. & De Not.* Botryosphaeriaceae P, E, S Botryosphaeria die back, Macrophoma rot Argentina, Australia, Brazil, Canda, Chile, China, France, Germany, Iran, Italy, Japan, South Africa, Portugal, Spain, USA, New Zealand, Tunisia, Turkey, Uruguay Milholland (1994), Phillips (1998, 2000), Slippers et al. (2007a, b), Larignon and Dubos (2001), Halleen et al. (2003), van Niekerk et al. (2006), Kobayashi (2007), Luque et al. (2009), Pitt et al. (2010), Qiu et al. (2011), Úrbez-Torres (2011), Úrbez-Torres et al. (2012, 2013a, b), Abreo et al. (2012), Arzanlou et al. (2012), Baskarathevan et al. (2012), Yan et al. (2012), Akgul et al. (2014a), Chebil et al. (2014), Carlucci et al. (2015), Fischer et al. (2016), Dissanayake et al. (2018), This study, Jayawardena et al. (2018) B. vitis Niessl Botryosphaeriaceae P Die back Czech Republic Niessl (1871) Botryosphaeria sp.* Botryosphaeriaceae P, E Botryosphaeria die back, Macrophoma rot Australia, China, Japan, South Africa, Spain Fourie and Halleen (2002), Halleen et al. (2003), Gimenez-Jaime et al. (2006), Kobayashi (2007), Martin and Cobos (2007), Sosnowski et al. (2007), Dissanayake et al. (2018) Botrytis ampelophila Speg. Sclerotiniaceae S Argentina Farr (1973) B. californica S. Saito & C.L. Xiao* Sclerotiniaceae P California, USA Saito et al. (2016) Botrytis bunch rot, Leaf blight 123 20 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Disease caused Locality References B. cinerea Pers.* Sclerotiniaceae P, E, S Botrytis bunch rot, Leaf blight Australia, Brazil, Bulgaria, Chile, China, France, Greece, Germany, Hawai, Italy, Korea, Libya, New Zealand, Pakistan, Poland, Portugal, Scotland, Spain, Switzerland, USA, Zimbabwe Foister (1961), Whiteside (1966), El-Buni and Rattan (1981), Raabe et al. (1981), Lee et al. (1991), Mendes et al. (1998), Holevas et al. (2000), Phillips (2000), Gadgil (2005), Mulenko et al. (2008), Bobev (2009), Casieri et al. (2009), Gao et al. (2009), Gonzalez and Tello (2011), Walker et al. (2011), Fournier et al. (2013), Piqueras et al. (2014), Saito et al. (2016), Dissanayake et al. (2018), Javed et al. (2017), This study, Jayawardena et al. (2018) B. pseudocinerea A.S. Walker, A. Gautier* Sclerotiniaceae P France, Germany, New Zealand, USA Walker et al. (2011), Saito et al. (2016) B. sinoviticola J. Zhang, Y. J. Zhou & G. Q. Li* Sclerotiniaceae P Botrytis bunch rot, Leaf blight Botrytis bunch rot, Leaf blight China Zhou et al. (2014) Botrytis sp.* Sclerotiniaceae P, E, S Chile, China, Italy, Japan, Mexico, USA Mujica and Vergara (1945), Anonymous (1960), Alvarez (1976), Kobayashi (2007), Liu et al. (2016a), Dissanayake et al. (2018), Jayawardena et al. (2018) Briosia ampelophaga Cavara Ascomycota genera incertae sedis P Brown Zonate Spot of Grape/Leaf blotch Japan, Russia, USA Greene (1955), Anonymous (1960), Melnik and Popushoi (1992), Nakagiri et al. (1994), Kobayashi (2007) Cadophora fastigiata Lagerb. & Melin* Ploettnerulaceae P, S Wood pathogen Germany, Switzerland, Casieri et al. (2009), Fischer et al. (2016) C. luteo-olivacea (J.F.H. Beyma) T.C. Harr. & McNew* Ploettnerulaceae P Wood pathogen Germany, Japan, Switzerland, Uruguay Casieri et al. (2009), Abreo et al. (2012), Fischer et al. (2016), Nakaune et al. (2016) C. novi-eboraci R Travadon, DP Lawrence, S RooneyLatham, WD Gubler, PE Rolshausen & K Baumgartner* Ploettnerulaceae P Wood pathogen North America Travadon et al. (2015) C. orientoamericana R Travadon, DP Lawrence, S RooneyLatham, WD Gubler, PE Rolshausen & K Baumgartner* Ploettnerulaceae P Wood pathogen North America Travadon et al. (2015) C. spadicis R Travadon, DP Lawrence, S Rooney-Latham, WD Gubler, PE Rolshausen & K Baumgartner* Ploettnerulaceae P Wood pathogen North America Travadon et al. (2015) 123 Fungal Diversity (2018) 90:1–84 21 Table 6 (continued) Species Family Life mode Disease caused Locality References C. viticola D. Gramaje, L. Mostert & Armengol* Ploettnerulaceae P, S Wood pathogen Spain Crous et al. (2015) Cadophora sp.* Ploettnerulaceae E, S China Dissanayake et al. (2018), This study Calonectria kyotensis Terash. C. macrospora Sacc. & Speg. Nectriaceae P New Zealand Pennycook (1989) Nectriaceae P Italy Saccardo (1878), Farr (1973) Calycella sarmentorum (De Not.) Boud. Helotiaceae S Italy, Portugal Kuntze (1898), Unamuno (1941) Camarosporium viniferum S. Ahmad Camarosporiaceae E Central Asia, Pakistan Ahmad (1969), Koshkelova and Frolov (1973), Ahmad et al. (1997) C. viticola (Cooke & Harkn.) Sacc. Camarosporiaceae E USA Saccardo (1878) Camillea tinctor (Berk.) Læssøe, J.D. Rogers & Whalley Graphostromataceae S USA Hanlin (1963) Campylocarpon fasciculare Schroers, Halleen & Crous* Nectriaceae P Wood canker, Black foot disease Brazil, Italy, South Africa, Turkey Halleen et al. (2003), Abreo et al. (2010), Petit et al. (2011), Correia et al. (2013), Akgul et al. (2014b), ÚrbezTorres et al. (2014), Carlucci et al. (2017), Gonzalez and Chaverri (2017) C. pseudofasciculare Halleen, Schroers & Crous* Nectriaceae P Black foot Brazil, South Africa, Uruguay Abreo et al. (2010, 2012), Petit et al. (2011), Correia et al. (2013), Úrbez-Torres et al. (2014), Gonzalez and Chaverri (2017) Capnodium citri Berk. & Desm. Capnodiaceae P Bunch rot Italy, Greece, Portugal, Spain Pantidou (1973), Greuter et al. (1991), Checa (2004) Capnodium sp. Capnodiaceae P Bunch rot Brazil, Venezuela Cephalosporium sp. Hypocreales incertae sedis P Black measles Greece, Mexico, Greece, USA Urtiaga (1986), Mendes et al. (1998) Chiarappa (1959), Pantidou (1973), Alvarez (1976), Holevas et al. (2000) Ceratobasidium cornigerum (Bourdot) D.P. Rogers Ceratobasidiaceae E Spain Gonzalez and Tello (2011) Ceratobasidium sp.* Ceratobasidiaceae E, S China, Switzerland Casieri et al. (2009), This study Cercospora coryneoides Savul. & Rayss Mycosphaerellaceae P Leaf spot Palestine Savulescu and Rayss (1935) C. fuckelii (Thüm.) Jacz. Mycosphaerellaceae P Leaf spot Asia Chupp (1953) C. judaica Rayss C. roesleri (Catt.) Sacc.* Mycosphaerellaceae Mycosphaerellaceae P P Leaf spot Leaf spot Palestine China, Cyprus, Egypt, France, Scotland Chupp (1953) Chupp (1953), Georghiou and Papadopoulos (1957), Foister (1961), Tai (1979), Soliman et al. (2016) C. sessilis Sorokin Mycosphaerellaceae P Leaf spot Russia Pollack (1987) C. vitiphylla (Speschnew) Barbarin Mycosphaerellaceae P Leaf spot Palestine Savulescu and Rayss (1935) Black foot disease Black foot disease 123 22 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Disease caused Locality References C. zebrina Pass.* Mycosphaerellaceae P Leaf spot Iran Bakhshi et al. (2012) Cercospora sp. Mycosphaerellaceae P Leaf spot Cuba, Hawaii, Mexico, USA Denaree and Runner (1942), Greene (1956), Raabe (1966), Alvarez (1976), Grand (1985), Urtiaga (1986) Chaetomium globosum Kunze ex Fr.* Chaetomiaceae E, S China, Italy, Spain, Switzerland, Casieri et al. (2009), Gonzalez and Tello (2011), Dissanayake et al. (2018), This study, Jayawardena et al. (2018) C. nigricolor L.M. Ames* Chaetomiaceae E India, Switzerland Pande (2008), Casieri et al. (2009) Chaetomium sp.* Chaetomiaceae E, S Spain, Switzerland, China Casieri et al. (2009), Gonzalez and Tello (2011), This study Chaetothyrium javanicum (Zimm.) Boedijn Chaetothyriaceae P China, Taiwan Tai (1979) Chalastospora gossypii (Jacz.) U. Braun & Crous* Cheilymenia theleboloides (Alb. & Schwein.) Boud. Pleosporaceae E USA Crous et al. (2009) Pyronemataceae S Chile Mujica and Vergara (1945) Chrysosporium pilosum Gené, Guarro & Ulfig* Onygenaceae S China This study Chrysosporium sp.* Cladochytrium viticola Prunet Onygenaceae Cladochytriaceae S P Wood China Algeria, Gaul, Tunisia, USA This study Saccardo (1878) Cladosporium aggregatocicatricatum Bensch, Crous & U. Braun* Cladosporiaceae P Fruit rot USA Bensch et al. (2015) C. ampelinum Pass. Cladosporiaceae P Leaf spot Austria, Germany, France, Italy, Portugal Passerini (1872) C. asperulatum Bensch, Crous & U. Braun Cladosporiaceae P Fruit rot USA Bensch et al. (2015) Sooty mold C. autumnale Kübler Cladosporiaceae E Switzerland Dugan et al. (2004) C. baccae Verwoerd & Dippen. Cladosporiaceae P Fruit rot South Africa Braun et al. (2003), Dugan et al. (2004) C. cladosporioides (Fresen.) G.A. de Vries* Cladosporiaceae P, E, S Fruit rot Chile, China, Italy, Japan, Switzerland, USA Briceno and Latorre (2007), Kobayashi (2007), Casieri et al. (2009), Bensch et al. (2015), Swett et al. (2016), Dissanayake et al. (2018), This study, Jayawardena et al.(2018) C. cucumerinum Ellis & Arthur* Cladosporiaceae S Italy This study, Jayawardena et al.(2018) C. fasciculatum Corda Cladosporiaceae Russia, Spain, Uzbekistan Gonzalez Fragoso (1921), Nagorny (1930) C. herbarum (Pers.) Link Cladosporiaceae Australia,Chile, Spain Cook and Dubé (1989), Briceno and Latorre (2007), Gonzalez and Tello (2011) 123 P, E Fruit rot Fungal Diversity (2018) 90:1–84 23 Table 6 (continued) Species Family Life mode Disease caused Locality References C. limoniforme Bensch, Crous & U. Braun* Cladosporiaceae P Fruit rot USA Bensch et al. (2015), Swett et al. (2016) C. longipes Sorokin Cladosporiaceae E Caucasus Dugan et al. (2004) C. macrocarpum Preuss Cladosporiaceae P Fruit rot China Zhang (2003) C. oxysporum Berk. & M.A. Curtis Cladosporiaceae P Fruit rot India Sarbhoy et al. (1971) C. pestis Thüm Cladosporiaceae E Austria Dugan et al. (2004) C. ramotenellum K. Schub., Zalar, Crous & U. Braun* Cladosporiaceae P China, USA Swett et al. (2016), Dissanayake et al. (2018) C. rectoides Bensch, H.D. Shin, Crous & U. Braun* Cladosporiaceae E Korea Bensch et al. (2015) C. roesleri Catt. Cladosporiaceae E Austria, France, Cyprus, Pakistan Georghiou and Papadopoulos (1957), Ahmad (1969), Ahmad et al. (1997) C. silences Crous* Cladosporiaceae P Fruit rot China Dissanayake et al. (2018) C. sphaerospermum Penz.* Cladosporiaceae P, S Fruit rot Switzerland Casieri et al. (2009) C. tenellum K. Schub., Zalar, Crous & U. Braun* Cladosporiaceae P Fruit rot USA Swett et al. (2016), Dissanayake et al. (2018) C. tenuissimum Cooke* Cladosporiaceae P, E Fruit rot China Zhang (2003), Dissanayake et al. (2018) C. uvarum McAlpine Cladosporiaceae S Australia, China Zhang (2003), Dugan et al. (2004) C. viride (Fresen.) Z.Y. Zhang & T. Zhang Cladosporiaceae P Fruit rot China Dugan et al. (2004) C. vitis-frutigeni Herb. Cladosporiaceae E USA Dugan et al. (2004) Cladosporium sp.* Cladosporiaceae P, E, S Fruit rot Chile, China, Italy, Korea, USA, Venezuela Mujica and Vergara (1945), Anonymous (1960), Briceno and Latorre (2008), Mondello et al. (2013), Oh et al. (2014), Dissanayake et al. (2018), This study Clathrospora turkestanica Domashova Pleosporaceae E Central Asia Koshkelova and Frolov (1973) Claviceps sp.* Clavicipitaceae S China This study Clonostachys rosea (Link) Schroers, Samuels, Seifert & W. Gams* Bionectriaceae P, E, S Wood decay, Root rot China, Switzerland Casieri et al. (2009), This study, Jayawardena et al. (2018) Clonostachys sp.* Bionectriaceae P, E, S Wood decay, Root rot China, South Africa Halleen et al. (2003), This study Cochliobolus geniculatus R.R. Nelson Pleosporaceae P Leaf spot Brunei Peregrine and Ahmad (1982) Colletotrichum acutatum J.H. Simmonds* Glomerellaceae P Ripe rot Australia, Japan, New Zealand, USA C. aenigma B.S. Weir & P.R. Johnston* Glomerellaceae P Ripe rot China Miller (1991), Kummuang et al. (1996), Guerber et al. (2003), Kobayashi (2007), Shivas et al. (2016) Yan et al. (2015) C. ampelinum Cavara Glomerellaceae E China, Italy Cavara (1889), Tai (1979) Fruit rot 123 24 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Disease caused Locality References C. clidemia B.S. Weir & P.R. Johnston* Glomerellaceae P Ripe rot USA Weir et al. (2012) C. dematium (Pers.) Grove* Glomerellaceae E, S Russia, South Africa Damm et al. (2009), This study, Jayawardena et al. (2018) C. fioriniae Marcelino & Gouli ex R.G. Shivas & Y.P. Tan* Glomerellaceae P Ripe rot Italy, Portugal Faedda et al. (2011), Damm et al. (2012) C. fructicola Prihastuti, L. Cai & K.D. Hyde* Glomerellaceae P Ripe rot, Leaf spot, Sunken shoot and stem canker China Peng et al. (2013) C. gloeosporioides (Penz.) Penz. & Sacc.* Glomerellaceae P Ripe rot Australia, Barbodos, Brazil, Brunei, China, Cuba, India, Japan, Korea, Mynmar, New Zealnd, South Africa, Taiwan, USA Chandra (1974), Norse (1974), Anonymous (1979), Tai (1979), Peregrine and Ahmad (1982), Urtiaga (1986), Pennycook (1989), Mendes et al. (1998), Cho and Shin (2004), Lubbe et al. (2004), Gadgil (2005), Kobayashi (2007), Thaung (2008c), Weir et al. (2012) C. godetiae Neerg.* Glomerellaceae P, S Ripe rot Italy, UK Baroncelli et al. (2014), Zapparata et al. (2017), This study, Jayawardena et al. (2018) C. hebeiense XH Li, Y Wang, KD Hyde. MMRS* Jayawardena, JY Yan Glomerellaceae P Twig anthracnose, Ripe rot China Yan et al. (2015), This study, Jayawardena et al. (2018) C. nymphaeae (Pass.) Aa* Glomerellaceae P Ripe rot China Liu et al. (2016b) C. siamense Prihastuti, L. Cai & K.D. Hyde* Glomerellaceae P, S Ripe rot Italy, USA Weir et al. (2012), This study, Jayawardena et al. (2018) C. truncatum (Schwein.) Andrus & W.D. Moore* Glomerellaceae P Ripe rot China, India, Italy, Switzerland Farr (1973), Casieri et al. (2009), Sawant et al. (2012), Pan et al. (2016), This study, Jayawardena et al. (2018) C. viniferum L.J. Peng, L. Cai, K.D. Hyde & Zi Y. Ying* Glomerellaceae P, S Ripe rot China Peng et al. (2013), Yan et al. (2015), This study, Jayawardena et al. (2018) Colletotrichum sp. Glomerellaceae P Ripe rot, Wood necrosis Cuba, Mexico, Spain Alvarez (1976), Arnold (1986), Gonzalez and Tello (2011) Collophorina paarla (Damm & Crous) Damm & Crous* Leotiomycetes genera incertae sedis P Wood necrosis Germany Fischer et al. (2016) C. rubra (Damm & Crous) Damm & Crous* Leotiomycetes genera incertae sedis P Wood necrosis Spain Garcia-Benavides et al. (2013) Coniella castaneicola (Ellis & Everh.) B. Sutton Schizoparmaceae P White rot Japan, USA Nag Raj (1993), Kobayashi (2007) 123 Fungal Diversity (2018) 90:1–84 25 Table 6 (continued) Species Family Life mode Disease caused Locality References C. diplodiella (Speg.) Petr. & Syd.* Schizoparmaceae P White rot Africa, Australia, Bulgaria, China, France, Germany, Greece, India, Italy, South Africa Sutton (1969), Pantidou (1973), Mathur (1979), Zhuang (2001), van Niekerk et al. (2004b), Bobev (2009), Chethana et al. (2017) C. diplodiopsis (Crous & Van Niekerk) L.V. Alvarez & Crous* Schizoparmaceae P White rot France, Germany, Italy, South Africa, Switzerland van Niekerk et al. (2004b), Chethana et al. (2017) C. fragariae (Oudem.) B. Sutton Schizoparmaceae P White rot Germany, Japan van Niekerk et al. (2004b), Kobayashi (2007) C. granati (Sacc.) Petr. & Syd.* Schizoparmaceae P White rot Italy van Niekerk et al. (2004b), Chethana et al. (2017) C. petrakii B. Sutton* Schizoparmaceae P, S White rot France, India Nag Raj (1993), Chethana et al. (2017) C. vitis Chethana, Yan, Li & K. D. Hyde* Schizoparmaceae P White rot China Chethana et al. (2017), This study, Jayawardena et al. (2018) Wood necrosis Coniella sp.* Schizoparmaceae P Coniocessia sp.* Coniocessiaceae S India Chethana et al. (2017) China This study Coniochaeta hoffmannii (J.F.H. Beyma) Z.U. Khan, Gené & Guarro* Coniochaetaceae P Germany, Switzerland Casieri et al. (2009), Fischer et al. (2016) Coniolariella sp.* Xylariaceae Coniothecium viticola Cooke & Massee Helotiales incertae sedis S China This study S UK Saccardo (1878) Coniothyrium ampelinum Cooke Coniothyriaceae E USA Cooke (1878) C. berlandieri Viala & Sauv. Coniothyriaceae P Cambodia, USA Anonymous (1960), Litzenberger et al. (1962) C. iranicum Esfand. Coniothyriaceae E Central Asia Koshkelova and Frolov (1973) C. vitivorum Miura Coniothyriaceae E Cophinforma mamane (D.E. Gardner) A.J.L. Phillips & A. Alves* Botryosphaeriaceae P Coprinellus radians (Desm.) Vilgalys, Hopple & Jacq. Johnson* Psathyrellaceae S Corticium appalachiense (Burds. & M.J. Larsen) M.J. Larsen Corticiaceae P, S C. centrifugum (Weinm.) Fr. Corticiaceae P, S Corticium sp. Corticiaceae S Coryneopsis microsticta (Berk. & Broome) Grove Discosiaceae P Corynespora cassiicola (Berk. & M.A. Curtis) C.T. Wei Coryneum viticola Ellis & Everh. Corynesporascaceae P Pseudovalsaceae S Bunch rot Leaf spot China Tai (1979) Brazil Correia et al. (2013) Switzerland Casieri et al. (2009) Wood decay USA Burdsall (1976) Wood decay China Tai (1979) USA Anonymous (1960) Stem lesions Poland, Portugal de Sousa Dias and Lucas (1972), Mulenko et al. (2008) Leaf spot USA Alfieri Jr. et al. (1984, 1994) USA Anonymous (1960) Canker, Die back 123 26 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Crepidotus viticola S. Imai Inocybaceae Cryptocline cinerascens (Bubák) Arx Disease caused Locality References S Japan Petrak (1953) Ascomycota genera incertae sedis E Japan Kobayashi (2007) Cryptococcus sp.* Tremellaceae E, S China Dissanayake et al. (2018), This study Cryptophaeella trematosphaeriicola Frolov Montagnulaceae E Central Asia Koshkelova and Frolov (1973) Cryptosphaeria pullmanensis Glawe* Diatrypaceae P Canker USA Cryptosporella viticola Shear Valsaceae P Fruit rot, Dead arm China, Greece, Korea, USA Trouillas and Gubler (2010), Trouillas et al. (2010), Úrbez-Torres et al. (2012) Hewitt (1951), Tai (1979), Holevas et al. (2000), Cho and Shin (2004) Cryptovalsa ampelina Abbado* Diatrypaceae P Eutypa dieback Australia, Austria, Chile, France, Hungary, Italy, Portugal, South Africa, Spain, USA Unamuno (1941), Petrak (1953), Mostert et al. (2004), Lardner et al. (2005), Sosnowski et al. (2007), Luque et al. (2009), Martin et al. (2009), Trouillas and Gubler (2010), Trouillas et al. (2010, 2011), Diaz et al. (2011), White et al. (2011), Úrbez-Torres et al. (2012), Pitt et al. (2013), Li et al. (2016designated reference specimen), This study, Jayawardena et al. (2018) C. protracta (Pers.) De Not. Diatrypaceae P Eutypa dieback Greece Pantidou (1973) C. rabenhorstii (Nitschke) Sacc.* Diatrypaceae P Eutypa dieback Australia Trouillas et al. (2011), Pitt et al. (2013) Eutypa dieback Cryptovalsa sp.* Diatrypaceae P Curvularia americana Da Cunha, Madrid, Gené & Cano* Pleosporaceae E Curvularia sp.* Pleosporaceae E Cylindrocarpon destructans (Zinssm.) Scholten* Diatrypaceae P, E Black foot C. lichenicola (C. Massal.) D. Hawksw. Diatrypaceae P C. ntricatea J.D. MacDon. & E.E. Butler* Diatrypaceae P 123 New Zealand Lardner et al. (2005) China Dissanayake et al. (2018) China Dissanayake et al. (2018) Argentina, Canada, France, Iran, Italy, Portugal, Spain, Tasmania, Uruguay Gerlach and Ershad (1970), Grasso (1984), Maluta and Larignon (1991), Rego et al. (2000), Gatica et al. (2001), Seifert et al. (2003), Casieri et al. (2009), Abreo et al. (2010), Gonzalez and Tello (2011) Black foot India Booth (1966) Black foot Australia, Canada, France, Iran, Portugal, Spain, Switzerland, Uruguay, USA Alaniz et al. (2007, 2009), Petit and Gubler (2007), Whitelaw-Weckert et al. (2007), Casieri et al. (2009), Luque et al. (2009), Abreo et al. (2010, 2012), Petit et al. (2011), Mohammadi et al. (2013a) Fungal Diversity (2018) 90:1–84 27 Table 6 (continued) Species Family Life mode Disease caused Locality References Cylindrocarpon sp.* Diatrypaceae P, S Black foot Canda, China, Lebanon, Portugal, South Africa, Spain, Switzerland, Tasmania, USA Halleen et al. (2003), Gimenez-Jaime et al. (2006), Martin and Cobos (2007), Whitelaw-Weckert et al. (2007), Casieri et al. (2009), Choueiri et al. (2009), This study Cylindrocladiella lageniformis Crous, M.J. Wingf. & Alfenas* Nectriaceae P Black foot South Africa, USA Victor et al. (1998), Boesewinkel (1982), Koike et al. (2016) C. parva (P.J. Anderson) Boesew.* Nectriaceae P Black foot New Zealand, South Africa, Spain Van Coller et al. (2005), Gadgil (2005), AgustiBrisach et al. (2012) C. peruviana (Bat., J.L. Bezerra & M.P. Herrera) Boesew.* Nectriaceae P Black foot South Africa, USA Boesewinkel (1982), Koike et al. (2016) C. pseudoparva L. Lombard & Crous* Nectriaceae S New Zealand Boesewinkel (1982) C. viticola Crous & Van Coller* Nectriaceae P Cutting rot of grapevines, Black foot South Africa, USA Hirooka et al. (2013) C. vitis Crous & Thangavel* Nectriaceae P Black foot New Zealand Crous et al. (2017) New Zealand Boesewinkel (1982) Pol2and Mulenko et al. (2008) Spain Gonzalez and Tello (2011), Garcia-Benavides et al. (2013) Cylindrocladiella sp.* Nectriaceae S Cytospora ampelina Sacc. Valsaceae P C. chrysosperma (Pers.) Fr.* Valsaceae E Canker C. cincta Sacc.* Valsaceae P Canker Iran Fotouhifar et al. (2010) C. leucostoma (Pers.) Sacc.* Valsaceae P Canker Iran Fotouhifar et al. (2010) C. vinacea D.P. Lawr., Travadon & Pouzoulet* Valsaceae P Canker USA Lawrence et al. (2017a) C. viticola D.P. Lawr., Travadon & Pouzoulet* Valsaceae P Canker Canada, USA Lawrence et al. (2017a) C. vitis Mont. Valsaceae P Canker Central Asia, Greece, Portugal, USA Montagne (1856), Koshkelova and Frolov (1973), Pantidou (1973), Anonymous (1960), Phillips (2000) Dacrymyces viticola Dacrymycetaceae S USA Saccardo (1878) Dactylellina sp.* Orbiliaceae S China This study Dactylonectria alcacerensis (A. Cabral, Oliveira & Crous)* Nectriaceae P Black foot Portugal, Spain Agusti-Brisach et al. (2016), Carlucci et al. (2017) D. estremocensis (A. Cabral, Nascimento & Crous) L. Lombard & Crous* Nectriaceae P Black foot Portugal Agusti-Brisach et al. (2016), Carlucci et al. (2017) 123 28 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Disease caused Locality References D. macrodidyma (Halleen, Schroers & Crous)* Nectriaceae P, S Black foot Australia, Brazil, Canada, New Zealand, Portugal, Slovenia, South Africa, Switzerland, USA Casieri et al. (2009), Abreo et al. (2010), Santos et al. (2014), Úrbez-Torres et al. (2014), Agusti-Brisach et al. (2016), Carlucci et al. (2017), This study D. novozelandica (A. Cabral & Crous) L. Lombard & Crous* Nectriaceae P Black foot New Zealand, South Africa, USA Úrbez-Torres et al. (2014), Carlucci et al. (2017) D. pauciseptata (Schroers & Crous) L. Lombard & Crous* Nectriaceae P, S Root rot, Black foot Brazil, Canada, New Zealand, Portugal, Slovenia, Spain, Uruguay Abreo et al. (2010), AgustiBrisach et al. (2011), Martin et al. (2011a), Petit et al. (2011), Úrbez-Torres et al. (2014), Santos et al. (2014) D. pinicola L. Lombard & Crous* Nectriaceae P Black foot Portugal Carlucci et al. (2017), D. torresensis (A. Cabral, Rego & Crous) L. Lombard & Crous* Nectriaceae P Black foot Australia, Canada, Italy, New Zealand, Portugal, South Africa, Spain, USA Úrbez-Torres et al. (2014), Agusti-Brisach et al. (2016), Carlucci et al. (2017), Gonzalez and Chaverri (2017) D. vitis (A. Cabral, Rego & Crous) L. Lombard & Crous* Deconica horizontalis (Bull.) Noordel. Nectriaceae P Black foot Portugal Úrbez-Torres et al. (2014), Carlucci et al. (2017) Hymenogastraceae S South Africa Doidge (1950) Dendrophoma sp. Chaetosphaeriaceae S Desarmillaria tabescens (Scop.) R. A. Koch & Aime Devriesia sp.* Physalacriaceae P Teratosphaeriaceae Desmazierella sp. Chorioactidaceae Diaporthe ambigua Nitschke* Diaporthaceae P D. ampelina (Berkeley & M.A. Curtis) R.R. Gomes, C. Glienke & Crous* Diaporthaceae D. mnivore (Delacr.) Udayanga, P.W.Crous & K.D.Hyde* D. australafricana Crous & Van Niekerk* 123 Japan Kobayashi (2007) Japan Kobayashi (2007) S China This study S Pakistan Ahmad et al. (1997) Canker USA, South Africa P, E, S Excoriose, Dead arm, Canker Australia, Bulgaria, China, France, India, Italy, Japan, New Zealand, Poland, South Africa, Spain, Switzerland, Turkey, USA van Niekerk et al. (2005), White et al. (2011), ÚrbezTorres et al. (2013a, b), Lawrence et al. (2015) Phillips (2000), Zhuang (2005), Kobayashi (2007), Casieri et al. (2009), Gonzalez and Tello (2011), Garcia-Benavides et al. (2013), Gomes et al. (2013), Kepley et al. (2015), Lawrence et al. (2015), Du et al. (2016), This study, Jayawardena et al. (2018) Diaporthaceae P Canker South Africa van Niekerk et al. (2005), Udayanga et al. (2011), Gomes et al. (2013) Diaporthaceae P Canker Australia, South Africa, USA van Niekerk et al. (2005), Mostert et al. (2001), Udayanga et al. (2012, 2014), Gomes et al. (2013), Lawrence et al. (2015), Du et al. (2016) Root rot Fungal Diversity (2018) 90:1–84 29 Table 6 (continued) Species Family Life mode Disease caused Locality References D. chamaeropis (Cooke) R.R. Gomes, C. Glienke & Crous Diaporthaceae P Canker USA Lawrence et al. (2015) D. eres Nitschke* Diaporthaceae P, S Canker Bulgaria, China, France, Germany, Italy, Japan, Switzerland, USA Kobayashi (2007), Casieri et al. (2009), Stoykov (2012), Baumgartner et al. (2013), Úrbez-Torres et al. (2013a, b), Lawrence et al. (2015), Cinelli et al. (2016), Fischer et al. (2016), Bastide et al. (2017), This study, Jayawardena et al. (2018) D. foenicula Niessl* Diaporthaceae P Canker South Africa, Portugal, USA Luongo et al. (2011), ÚrbezTorres et al. (2013a, b), Udayanga et al. (2014a, b), Lawrence et al. (2015) D. helianthi Munt.Cvetk., Mihaljc. & M. Petrov* Diaporthaceae P Canker South Africa van Niekerk et al. (2005), Udayanga et al. (2011) D. hongkongensis R.R. Gomes, C. Glienke & Crous* Diaporthaceae P Canker China Dissanayake et al. (2015) D. kyushuensis Kajitani & Kanem. D. longiparaphysata (Uecker & K.C. Kuo) Udayanga & Castl.* Diaporthaceae P Canker Japan Diaporthaceae P Canker Taiwan Kanematsu et al. (2000), Kobayashi (2007) Uecker and Kuo (1992), Udayanga et al. (2011) D. nobilis Sacc. & Speg.* Diaporthaceae P Canker California Lawrence et al. (2015) D. novem M. Santos, Vrandecic & A.J.L. Phillips* Diaporthaceae P Canker California Lawrence et al. (2015) D. perjuncta Niessl Diaporthaceae P Canker Australia, Portugal, South Africa Phillips (1999), Mostert et al. (2001) D. perniciosa Marchal & É.J. Marchal Diaporthaceae P Canker Bulgaria Stoykow and Denchev (2006) D. phaseolorum (Cooke & Ellis) Sacc.* Diaporthaceae P Canker China, Switzerland Casieri et al. (2009), Dissanayake et al. (2015) D. rudis (Fr.) Nitschke* Diaporthaceae P, S Canker Australia, Germany, Italy, Portugal Scheper et al. (2000), ÚrbezTorres et al. (2012), Gomes et al. (2013), Udayanga et al. (2014a, b), Huang et al. (2015), This study, Jayawardena et al. (2018) D. sojae Lehman* Diaporthaceae P Canker China Dissanayake et al. (2015) D. vitimegaspora (K.C. Kuo & L.S. Leu) Rossman & Udayanga* Diaporthaceae P Canker Japan, Thailand, Thaiwan Kuo and Leu (1998), van Niekerk et al. (2005), Udayanga et al. (2011) Diaporthe sp.* Diaporthaceae P Canker Bulgaria, France, Italy, Japan, Portugal, South Africa, Spain Switzerland, USA Kanematsu et al. (2000), Mostert et al. (2001), van Niekerk et al. (2005), Bobev (2009), Casieri et al. (2009), Santos et al. (2010), Luongo et al. (2011), Úrbez-Torres et al. (2013a, b) 123 30 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Disease caused Locality References Diatrype nigerrima Ellis & Everh. Diatrypaceae P Eutypa dieback USA Ellis and Everhart (1904), Cash (1952) D. oregonensis Wehm.) Rappaz* Diatrypaceae P Eutypa dieback USA Trouillas and Gubler (2010), Trouillas et al. (2010), Úrbez-Torres et al. (2013a, b) D. stigma (Hoffm.) Fr.* Diatrypaceae P Eutypa dieback Spain, USA Unamuno (1941), Trouillas et al. (2010), Úrbez-Torres et al. (2013a, b) D. utahensis Rehm Diatrypaceae P Eutypa dieback India Pande (2008) D. whitmanensis J.D. Rogers & Glawe* Diatrypaceae P Eutypa dieback USA Trouillas and Gubler (2010), Trouillas et al. (2010), Úrbez-Torres et al. (2013a, b) Diatrype sp.* Diatrypaceae P Eutypa dieback Australia, USA Trouillas et al. (2010, 2011), Pitt et al. (2013), ÚrbezTorres et al. (2012, 2013a, b) Diatrypella verrucaeformis (Ehrh.) Nitschke* D. vitis Ellis & Everh. Diatrypaceae P Eutypa dieback USA Trouillas and Gubler (2010), Trouillas et al. (2010) Diatrypaceae P Eutypa dieback China, USA Cash (1952), Teng (1996) D. vulgaris Trouillas, W.M. Pitt & Gubler* Diatrypaceae P Eutypa dieback Australia Trouillas et al. (2011), Pitt et al. (2013) Diatrypella sp.* Diatrypaceae P Eutypa dieback USA Dictyosporium elegans Corda Dictyosporiaceae P Canker Portugal Trouillas and Gubler (2010), Trouillas et al. (2010), Úrbez-Torres et al. (2012) de Sousa Dias et al. (1987) D. toruloides (Corda) Guég. Dictyosporiaceae P Canker Russia Melnik and Popushoi (1992) Didymella glomerata (Corda) Q. Chen & L. Cai* Didymellaceae E Spain, Switzerland Casieri et al. (2009), Gonzalez and Tello (2011) D. negriana (Thümen) Q. Chen & L. Cai* Didymellaceae P, S Germany, Italy Chen et al. (2015), This study, Jayawardena et al. (2018) D. pomorum (Thümen) Q. Chen & L. Cai* Didymellaceae S Australia,China Cook and Dubé (1989), This study, Jayawardena et al. (2018) Didymosphaeria bacchans Pass. Didymosphaeriaceae S Italy Greuter et al. (1991) D. sarmenti (Cooke & Harkn.) Berl. & Voglino Didymosphaeriaceae P Japan, Portugal, USA Unamuno (1941), French (1989), Kobayashi (2007) Dinemasporium pleurospora (Sacc.) Shkarupa Chaetosphaeriaceae S Pakistan, Poland Ahmad (1969), Ahmad et al. (1997), Mulenko et al. (2008) Diplodia ampelina Cooke Botryosphaeriaceae P Portugal, USA Cooke (1878), Saccardo and Traverso (1903) 123 Black rot, Canker Shoot lesions Canker Fungal Diversity (2018) 90:1–84 31 Table 6 (continued) Species Family Life mode Disease caused Locality References D. bacchii Pass. & Thüm Botryosphaeriaceae P, S Canker Belgium, Italy, Portugal Cooke (1878) D. corticola A.J.L. Phillips, A. Alves & J. Luque* Botryosphaeriaceae P Canker Italy, Mexico, Spain, USA Carlucci and Frisullo (2009), Úrbez-Torres et al. (2010a, b, c), Pintos et al. (2011), Úrbez-Torres (2011), Carlucci et al. (2015) D. intermedia A.J.L. Phillips, J. Lopes & A. Alves* Botryosphaeriaceae P Canker France Comont et al. (2016) D. mutila (Fr.) Mont.* Botryosphaeriaceae P, E Canker Australia, Canada, France, Hungary, Italy, New Zealand, Portugal, Spain, USA Phillips (1998, 2000), Taylor et al. (2005), Úrbez-Torres et al. (2006), van Niekerk et al. (2006), Martin and Cobos (2007), Baskarathevan et al. (2008, 2012), Pitt et al. (2010), Gonzalez and Tello (2011), Qiu et al. (2011), Úrbez-Torres (2011), Whitelaw-Weckert et al. (2013), Alves et al. (2014), Carlucci et al. (2015) D. nematospora Sacc. Botryosphaeriaceae S Eritrea Castellani and Ciferri (1937) D. seriata (Fr.) Mont.* Botryosphaeriaceae P, E, S Canker Australia, Bulgaria, Canada, Chile, China, France, Germany, Greece, Iran, Italy, Lebanon, New Zealand, Portugal, South Africa, Spain, Switzerland, Tunisia Uruguay, USA Pantidou (1973), CastilloPando et al. (2001), Larignon and Dubos (2001), Halleen et al. (2003), Auger et al. (2004a), Choueiri et al. (2006), van Niekerk et al. (2006), Slippers et al. (2007a, b), Baskarathevan et al. (2008), Epstein (2008), Casieri et al. (2009), Luque et al. (2009), Úrbez-Torres (2011), Yan et al. (2011a, b), Abreo et al. (2012), GarciaBenavides et al. (2013), Mohammadi et al. (2013b), Mondello et al. (2013), Chebil et al. (2014), Fischer et al. (2016), This study, Jayawardena et al. (2018) Diplodia sp.* Botryosphaeriaceae P Canker Belgium, Bulgaria, Cuba, Mexico, South Africa Diplodina vitis Brunaud Gnomoniaceae P Root stock disease Central Asia Greuter et al. (1991), van Niekerk et al. (2004a), Bobev (2009), Casieri et al. (2009) Koshkelova and Frolov (1973) Discohainesia oenotherae (Cooke & Ellis) Nannf. Dermateaceae P Leaf spot USA Anonymous (1960) 123 32 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Disease caused Locality References Discosia artocreas (Todd) Fr. Sporocadaceae P Leaf spot USA Gilman (1932), Maneval (1937), Cooke (1983) D. vitis Schulzer Sporocadaceae P Leaf spot Hungary Nag Raj (1993) Discostroma corticola (Fuckel) Brockmann Sporocadaceae P Cane blight New Zealand Pennycook (1989) Doratomyces stemonitis (Pers.) F.J. Morton & G. Sm. Microascaceae S Argentina, Russia Melnik and Popushoi (1992), Carmaran and Novas (2003) Dothiorella americana Úrbez-Torres, Peduto & Gubler* Botryosphaeriaceae P Die back, Canker USA Úrbez-Torres (2011), ÚrbezTorres et al. (2012) D. iberica A.J.L. Phillips, J. Luque & A. Alves* Botryosphaeriaceae P, S Die back, Canker Australia, Italy, New Zealand, Spain, USA Úrbez-Torres et al. (2007), Baskarathevan et al. (2008, 2012), Úrbez-Torres and Gubler (2009), Qiu et al. (2011), Úrbez-Torres (2011), Pitt et al. (2010), McDonald and Eskalen (2011), Carlucci et al. (2015), Martin and Cobos (2007), This study, Jayawardena et al. (2018) D. neclivora W.M. Pitt & J.R. Úrbez-Torres* Botryosphaeriaceae P Die back, Canker Australia Pitt et al. (2015) D. mnivore B. T. Linaldeddu, A. Deidda & B. Scanu* Botryosphaeriaceae P Die back, Canker Australia Linaldeddu et al. (2016) D. reinformis (Viala & Ravaz) Petr. & Syd Botryosphaeriaceae P, S Die back, Canker Italy, Portugal, South Africa D. sarmentorum (Fr.) A.J.L. Phillips, Alves & Luque* Botryosphaeriaceae P, S Die back, Canker China, Italy, New Zealand, Spain Petrak and Sydow (1927), Doidge (1950), Costa and Camara (1952) Martin and Cobos (2007), Baskarathevan et al. (2012), Carlucci et al. (2015), This study, Jayawardena et al. (2018) D. vidmadera W.M. Pitt, J.R. Úrbez-Torres, Trouillas* Botryosphaeriaceae P Die back, Canker Australia Pitt et al. (2013), Linaldeddu et al. (2016), Lawrence et al. (2017b) D. vinea-gemmae W.M. Pitt & J.R. ÚrbezTorres* Botryosphaeriaceae P Die back, Canker Australia Pitt et al. (2015) D. viticola A.J.L. Phillips & J. Luque Botryosphaeriaceae P, S Die back, Canker Spain Luque et al. (2005) Dothiorella sp.* Botryosphaeriaceae P Die back, Canker Australia, Mexico, USA Úrbez-Torres et al. (2010a, b, c), Pitt et al. (2015), Lawrence et al. (2017b) 123 Fungal Diversity (2018) 90:1–84 33 Table 6 (continued) Species Family Life mode Disease caused Locality References Elsinoe ampelina Shear Elsinoaeceae P Grape antracnose Barbados, Brazil, Bulgaria, Cambodia,Chile,China,Cuba, Haiti, Hong Kong, India, Italy, Jamaica, Kenya, Mauritius, Mexico, Myanmar, New Zealand, Poland, South Africa, Spain, Tanzania, Trinidad and Tobago, Thailand, USA, Venezuela, Zimbabwe Gilman and Archer (1929), Jenkins and Bitancourt (Jenkins and Bitancourt 1940–1963), Mujica and Vergara (1945), Baker and Dale (1951), Riley (1960), Nattrass (1961), Litzenberger et al. (1962), Whiteside (1966), Orieux and Felix (1968), Benjamin and Slot (1969), Dennis (1970), Norse (1974), Alvarez (1976), Tai (1979), Alfieri Jr. et al. (1984), Grand (1985), Arnold (1986), Pennycook (1989), Greuter et al. (1991), Mendes et al. (1998), Lu et al. (2000), Zhuang (2001), Mulenko et al. (2008), Thaung (2008a, b, c), Bobev (2009) Emericella sp.* Aspergillaceae S China This study Endobasidium clandestinum Speschnew Exobasidiaceae P Root rot Uzbekistan Gaponenko (1965) Endoconidioma populi Tsuneda, Hambl. & Currah* Dothideaceae P Necrotic twigs Iran Mirzaei et al. (2015) Epicoccum granulatum Penz. Didymellaceae S USA Shaw (1973) E. nigrum Link* Didymellaceae E, S China, Italy, Spain, Switzerland E. plurivorum (P.R. Johnston) Q. Chen & L. Cai Didymellaceae S New Zealand Phillips (2000), Casieri et al. (2009), Gonzalez and Tello (2011), This study, Jayawardena et al. (2018) Gadgil (2005) Epicoccum sp. Didymellaceae S France Larignon and Dubos (1997), Halleen et al. (2003) Eriocercosporella vitisheterophyllae (Henn.) U. Braun Ascomycota genera incertae sedis P Japan Chupp (1953), Watson (1971) Eriosphaeria oenotria Sacc. & Speg. Trichosphaeriaceae S Italy Farr (1973) Erysiphe necator Schwein. Erysiphaceae P Powdery mildew Australia, Belgium, Bulgaria, Czechoslovakia, Denmark, Finland, France, Germany, Greece, Hungary, India, Ishrael, Italy, Japan, Korea, Netherlands, Peru, Poland, Romania, Russia, Spain, Sweden, Switzerland, Turkey, UK, Yugoslavia Greuter et al. (1991), Nomura et al. (2003), Bolay (2005), Ruszkiewicz-Michalska and Michalski (2005), Amrani and Corio-Costet (2006), Paul and Thakur (2006), Rusanov and Bulgakov (2008), Voytyuk et al. (2009), Park et al. (2010), Bendezu-Euribe and Alvarez (2012) E. tuckeri Berk. Erysiphaceae P Powdery mildew Spain Unamuno (1941) Leaf spot 123 34 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Disease caused Locality References Erythricium salmonicolor (Berk. & Broome) Burds. Corticiaceae P Sour rot Thailand Giatgong (1980) Eucasphaeria capensis Crous* Niessliaceae P Eutypa dieback Germany Fischer et al. (2016) Eutypa lata (Pers.) Tul. & C. Tul.* Diatrypaceae P Eutypa dieback Australia, Brazil, Bulgaria, Europe, France, Germany, Greece, Italy, New Zealand, Serbia, South Africa, Spain, Switzerland, USA Moller et al. (1974), Pennycook (1989), Shivas (1989), Carter (1991), Larignon and Dubos (1997), Mendes et al. (1998), Péros et al. (1999), Holevas et al. (2000), Rolshausen et al. (2004, 2014), Lardner et al. (2005), Sosnowski et al. (2007), Bobev (2009), Luque et al. (2009), Trouillas et al. (2010, 2011), White et al. (2011), ÚrbezTorres et al. (2012), Živkovic et al. (2012), Garcia-Benavides et al. (2013), Travadon and Baumgartner (2015), Mayorquin et al. (2016) E. laevata (Nitschke) Sacc.* Diatrypaceae P Eutypa dieback Canada, USA Rappaz (1987), Rolshausen et al. (2004, 2014) E. ludibunda Sacc. E. leptoplaca (Durieu & Mont.) Rappaz* Diatrypaceae Diatrypaceae P P Eutypa dieback Eutypa dieback USA Spain, South Africa, USA Tiffany and Gilman (1965) Luque et al. (2009), Trouillas and Gubler (2004, 2010), Úrbez-Torres et al. (2012) Eutypa sp.* Diatrypaceae P Eutypa dieback Bulgaria, USA Bobev (2009), Rolshausen et al. (2014) Eutypella aequilinearis (Schwein.) Starbäck Diatrypaceae P Eutypa dieback Japan, USA Rappaz (1987), Kobayashi (2007) E. aulacostroma (Kunze) Berl. Diatrypaceae P Eutypa dieback Taiwan Rappaz (1987) E. citricola Speg.* Diatrypaceae P Eutypa dieback Australia, USA Trouillas et al. (2011), Pitt et al. (2013), Mayorquin et al. (2016) E. fraxinicola (Cooke & Peck) Sacc. Diatrypaceae P Eutypa dieback USA Hanlin (1963) E. leprosa (Pers.) Berl. Diatrypaceae P Eutypa dieback Chile, Spain, Switzerland, USA Rappaz (1987), Diaz et al. (2011) E. microtheca Trouillas, W.M. Pitt & Gubler* Diatrypaceae P Eutypa dieback Australia, Mexico, USA Trouillas et al. (2011), Pitt et al. (2013), PaolinelliAlfonso et al. (2016), Mayorquin et al. (2016) E. vitis (Schwein.) Ellis & Everh.* Diatrypaceae P Eutypa dieback Italy, Pakistan, South Africa, Spain, Uruguay, USA Greuter et al. (1991), Ahmad et al. (1997), Luque et al. (2009), White et al. (2011), Úrbez-Torres et al. (2012), Abreo et al. (2012), Mayorquin et al. (2016) Eutypella sp.* Diatrypaceae P Eutypa dieback USA Trouillas et al. (2010), ÚrbezTorres et al. (2012), Mayorquin et al. (2016) 123 Fungal Diversity (2018) 90:1–84 35 Table 6 (continued) Species Family Life mode Disease caused Locality References Excipula viticola Schwein Dermateaceae P On leaves USA Saccardo (1878) Exosporium sultanae du Plessis Ascomycota genera incertae sedis S South Africa Gorter (1977) Exophiala sp.* Herpotrichiellaceae E China Dissanayake et al. (2018) Exserohilum rostratum (Drechsler) K.J. Leonard & Suggs* Pleosporaceae S China This study, Jayawardena et al. (2018) Floricola viticola (Phukhamsakda, Camporesi & K.D. Hyde) Jaklitsch & Voglmayr* Teichosporaceae S Italy Ariyawansa et al. (2015), This study, Jayawardena et al. (2018) Fomes fomentarius (L.) Fr. Polyporaceae P Esca China Tai (1979) F. igniarius (L.) Fr.* Polyporaceae P Esca France, USA Chiarappa (1959), Cloete et al. (2015) Fomitiporia australiensis M. Fisch., J. Edwards, Cunningt. & Pascoe* Hymenochaetaceae P Esca Australia Fischer et al. (2005), Cloete et al. (2015) F. capensis M. Fisch., M. Cloete, L. Mostert, F. Halleen* Hymenochaetaceae P Esca South Africa Cloete et al. (2014) F. mediterranea M. Fisch.* Hymenochaetaceae P Esca Europe, Germany, Iran, Italy, Spain, Turkey Fischer et al. (2005), Martin and Cobos (2007), Luque et al. (2009), Mohammadi and Banihashemi (2012), Garcia-Benavides et al. (2013), Mondello et al. (2013), Akgul et al. (2015), Cloete et al. (2015) F. polymorpha M. Fisch.* Hymenochaetaceae P Esca USA Cloete et al. (2015) F. punctata (P. Karst.) Murrill* Hymenochaetaceae P Esca Australia, France, Iran, Italy Larignon and Dubos (1997), Pascoe and Cottral (2000), Karimi et al. (2001), Cloete et al. (2015) Fomitiporia sp.* Hymenochaetaceae P Esca Italy, South Africa White et al. (2011), Mondello et al. (2013) Fusarium acuminatum Ellis & Everh.* Nectriaceae P Wilt Spain Garcia-Benavides et al. (2013) F. anthophilum (A. Braun) Wollenw. Nectriaceae P Wilt Brazil Mendes et al. (1998) F. avenaceum (Fr.) Sacc. Nectriaceae P Wilt China, Italy Tai (1979), Greuter et al. (1991) F. equiseti (Corda) Sacc. Nectriaceae P Wilt Brazil Mendes et al. (1998) F. fujikuroi Nirenberg Nectriaceae P Wilt Brazil Mendes et al. (1998) F. oxysporum Schltdl.* Nectriaceae P, E, S Wilt Australia, Brazil, China, South Africa, Spain Gorter (1977), Mendes et al. (1998), Castillo-Pando et al. (2001), Gonzalez and Tello (2011), This study, Jayawardena et al. (2018) F. poae (Peck) Wollenw. Nectriaceae P Wilt USA Shaw (1973) F. proliferatum (Matsush.) Nirenberg* Nectriaceae P, E Wilt China, Spain Gonzalez and Tello (2011), Wang et al. (2015) 123 36 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Disease caused Locality References F. schweinitzii Ellis & Harkn. Nectriaceae P, E Wilt USA Sumstine (1949), Cash (1952) F. solani (Mart.) Sacc.* Nectriaceae P Wilt Brazil, India, Switzerland Sarbhoy and Agarwal (1990), Mendes et al. (1998), Casieri et al. (2009) F. viticola Thüm. Nectriaceae S USA Saccardo (1878) F. volutella Ellis & Everh. Nectriaceae P Wilt USA Cash (1952) Fusarium sp.* Nectriaceae P, S Wilt Australia, China, Germany, Italy, South Africa, Switzerland, Spain, Uruguay Cook and Dubé (1989), O’Donnell et al. (1998), Halleen et al. (2003), Casieri et al. (2009), Luque et al. (2009), Abreo et al. (2010), Mondello et al. (2013), This study, Jayawardena et al. (2018) Fusicladium viticis M.B. Ellis Sympoventuriaceae P Leaf spot China Zhang (2003) Geomyces pannorum (Link) Sigler & J.W. Carmich.* Geomyces sp. Myxotrichaceae E Switzerland Casieri et al. (2009) Myxotrichaceae S China This study Geotrichum candidum Link Dipodascaceae E Japan Kobayashi (2007) Geotrichum sp. Dipodascaceae E Spain Gonzalez and Tello (2011) Gloniopsis praelonga (Schwein.) Underw. & Earle Hysteriaceae S Germany Lotz-Winter et al. (2011) Glonium lineare (Fr.) De Not. Gloniaceae S Rhode Island Goos (2010) G. macrosporium Tracy & Earle Gloniaceae S USA Parris (1959) Glonium sp. Gloniaceae S USA Hanlin (1963) Golovinomyces biocellatus (Ehrenb.) V.P. Heluta Erysiphaceae P India Paul and Thakur (2006) Gonatobotrys flava Bonord. Ceratostomataceae E Poland Mulenko et al. (2008) Gonatobotryum sp. Ascomycota genera incertae sedis E Spain Gonzalez and Tello (2011) Graphium cinerellum Speg. Graphiaceae P Leaf spot Italy Farr (1973) Greeneria uvicola (Berk. & M.A. Curtis) Punith.* Diaporthales genera incertae sedis P Bitter rot Australia, Bulgaria, Brazil, Cuba, India, Poland, South Africa, Taiwan, Thailand, Ukraine, Uruguay, USA Cooke (1878), Simmonds (1966), Gorter (1977), Mathur (1979), Giatgong (1980), Reddy and Reddy (1983), Arnold (1986), Kummuang et al. (1996), Mendes et al. (1998), Castillo-Pando et al. (2001), Farr et al. (2001), Dudka et al. (2004), Longland and Sutton (2008), Mulenko et al. (2008), Bobev (2009), Navarrete et al. (2009), Abreo et al. (2012) 123 Powdery mildew Fungal Diversity (2018) 90:1–84 37 Table 6 (continued) Species Family Life mode Disease caused Locality References Grovesinia moricola (I. Hino) Redhead Sclerotiniaceae P Bunch rot USA Grand (1985) G. pyramidalis M.N. Cline, J.L. Crane & S.D. Cline Sclerotiniaceae P Bunch rot Japan Kobayashi (2007) Gymnascella sp.* Gymnoascaceae S China This study Gyrothrix podosperma (Corda) Rabenh. Ascomycota genera incertae sedis S Pakistan Ahmad et al. (1997) Hansfordia pulvinata (Berk. & M.A. Curtis) S. Hughes Ascomycota genera incertae sedis S Pakistan Ahmad et al. (1997) H. tonduzii (Speg.) Bat. & A.F. Vital Ascomycota genera incertae sedis S Costa Rica Batista and Ciferri (1962) Hansfordia sp.* Ascomycota genera incertae sedis S China This study Hapalopilus rutilans (Pers.) Murrill Polyporaceae S USA Gilbertson et al. (1974) Helicobasidium mompa Nobuj. Tanaka Helicobasidiaceae P Root rot Japan Kobayashi (2007) Helminthosporium decacuminatum Thüm. & Pass. Dothideomycetes genera incertae sedis P Leaf spot Greece, Macedonia Konstantinia-Sulidu (1939), Pantidou (1973) H. siliquosum Berk. & M.A. Curtis Dothideomycetes genera incertae sedis P Twigs and leaf spot USA Anonymous (1960) H. velutinum (Link) Link Dothideomycetes genera incertae sedis S Japan Shirouzu and Harada (2004) Helminthosporium sp. Dothideomycetes genera incertae sedis P USA Anonymous (1960), Alfieri Jr. et al. (1984) Hendersonia cookeana Speg. Ascomycota genera incertae sedis S Italy Spegazzini (1878), Farr (1973) H. corticalis Ellis & Everh. Ascomycota genera incertae sedis S USA Cash (1953) H. sarmentorum Westend. Ascomycota genera incertae sedis P Central Asia, Greece, Italy, Pakistan, Spain, USA Gonzalez Fragoso (1916), Anonymous (1960), Ahmad (1969), Koshkelova and Frolov (1973), Pantidou (1973), Greuter et al. (1991), Ahmad et al. (1997) H. tenuipes McAlpine Ascomycota genera incertae sedis S Greece Pantidou (1973) H. viticola S. Ahmad Ascomycota genera incertae sedis S Greece, Pakistan Ahmad (1969), Pantidou (1973), Ahmad et al. (1997) Leaf spot Twig lesions Herpotrichia sp. Melanommataceae E USA Hanlin (1963) Hormonema viticola F. Laich & Stchigel* Dothioraceae E Malaysia, Spain Crous et al. (2015) Humicola sp*. Chaetomiaceae E, S China, Spain Gonzalez and Tello (2011), This study Hydnum viticola Hydnum sp.* Hydnaceae Hydnaceae S S USA China Saccardo (1878) This study Hyaloceras viticola (Cavara) Died. Sporocadaceae P Italy Saccardo (1878) Fruits 123 38 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Hymenochaetopsis intricata (Lloyd) S.H. He & Jiao Yang Hymenochaetaceae S Hypocrella reineckeana Henn. Clavicipitaceae P Hypoderma commune (Fr.) Duby H. rubi (Pers.) DC. Rhytismataceae Disease caused Locality References Japan Kobayashi (2007) Niue Dingley et al. (1981) S Portugal Unamuno (1941) Leaf spot Rhytismataceae S China Ying-Ren (2012) Hypoxylon hypophlaeum (Berk. & Ravenel) J.H. Mill. Hypoxylaceae S USA Hanlin (1963) H. lateripigmentum J. Fourn., Kuhnert & M. Stadler* Hypoxylaceae E China Dissanayake et al. (2018) H. rubiginosum (Pers.) Fr. Hypoxylaceae S USA Hanlin (1963) Hypoxylon sp.* Hypoxylaceae E China Dissanayake et al. (2018) Hysterium pulicare (Lightf.) Pers. Hysteriaceae S Italy Greuter et al. (1991) H. viticola Cooke & Peck Hysteriaceae S USA Saccardo (1878) Hysterobrevium mori (Schwein.) E. Boehm & C.L. Schoch Hysteriaceae S USA Anonymous (1960), Barr (1990), Tibpromma et al. (2017) Hysterographium flexuosum Maire Pleosporomycetidae genera incertae sedis P, S Stem lesions USA Hanlin (1963) H. viticola (Cooke & Peck) Rehm Pleosporomycetidae genera incertae sedis P, S Stem lesions USA Wolf et al. (1938), Anonymous (1960) H. vulvatum (Schwein.) Rehm Pleosporomycetidae genera incertae sedis P, S Stem lesions USA Parris (1959), Anonymous (1960) Ilyonectria crassa (Wollenw.) A. Cabral & Crous* Nectriaceae P Black foot Uruguay Abreo et al. (2010) I. destructans (Zinssmeister) Rossman, L. Lombard & Crous Nectriaceae P Black foot Argentina, Canada, France, Iran, South Africa, Spain, USA Gerlach and Ershad (1970), Seifert and Axelrood (1998), Gatica et al. (2001), Petit and Gubler (2005), Gonzalez and Tello (2011), Petit et al. (2011) I. europaea A. Cabral, Rego & Crous* Nectriaceae P Black foot Portugal Úrbez-Torres et al. (2014), Agusti-Brisach et al. (2016), Carlucci et al. (2017) I. liriodendri (Halleen, Rego & Crous) Chaverri & C. Salgado* Nectriaceae P Black foot Australia, Canada, France, Portugal, South Africa, Turkey, USA Halleen et al. (2003), Petit et al. (2011), WhitelawWeckert et al. (2013), Úrbez-Torres et al. (2014), Savas et al. (2015), AgustiBrisach et al. (2016) I. lusitanica A. Cabral, Rego & Crous* Nectriaceae P Black foot Portugal Úrbez-Torres et al. (2014), Agusti-Brisach et al. (2016), Carlucci et al. (2017) I. pseudodestructans A. Cabral, Rego & Crous* Nectriaceae P Black foot Portugal Úrbez-Torres et al. (2014), Agusti-Brisach et al. (2016), Carlucci et al. (2017) 123 Fungal Diversity (2018) 90:1–84 39 Table 6 (continued) Species Family Life mode Disease caused Locality References I. robusta (A.A. Hildebr.) A. Cabral & Crous* Nectriaceae P Black foot Brazil, Canada, Portugal Santos et al. (2014), ÚrbezTorres et al. (2014) Ilyonectria sp.* Nectriaceae P, S Black foot Australia, China, Portugal Úrbez-Torres et al. (2014), Parkinson et al. (2017), This study Inocutis jamaicensis (Murrill) A.M. Gottlieb, J.E. Wright & Moncalvo* Hymenochaetaceae P Hoja de malvón and chlorotic leaf roll Argentina, Uruguay Abreo et al. (2012), Rajchenberg and Robledo (2013), Cloete et al. (2015) Irpex lacteus (Fr.) Fr. Phanerochaetaceae E USA Brenckle (1918) I. viticola Phanerochaetaceae S USA Saccardo (1878) Kalmusia variispora (Verkley, Göker & Stielow) Ariyawansa & K.D. Hyde Didymosphaeriaceae P Syria Verkley et al. (2014) Karstenula yaline (Ellis & Everh.) M.E. Barr Didymosphaeriaceae S USA Cash (1954) Kazachstania viticola Zubcova Saccharomycetaceae Kazakhstan Zubkova (1971) Kernia sp.* Microascaceae E, S China Dissanayake et al. (2018), This study Kluyveromyces marxianus (E.C. Hansen) Van der Walt Saccharomycetaceae P Sour rot Poland Mulenko et al. (2008) Kuehneola vitis (E.J. Butler) Syd. & P. Syd. Phragmidiaceae P Rust India Watson (1971), Ragunathan and Ramakrishnan (1973) Lachnella macrochaeta Speg. Niaceae S Italy Farr (1973) L. myceliosa W.B. Cooke Niaceae S France, Germany Batista and Ciferri (1962) L. uvicola (Speg.) W.B. Cooke Niaceae S Argentina Batista and Ciferri (1962) Trunk disease Fermented juice L.viticola Gonz. Frag. Niaceae S Portugal Unamuno (1941) Lachnum virgineum (Batsch) P. Karst. Lachnaceae S Japan Kobayashi (2007) Lasiodiplodia brasiliense M.S.B. Netto, M.W. Marques & A.J.L. Phillips* Botryosphaeriaceae P Canker and die back Brazil Correia et al. (2016b) L. citricola Abdollahzadeh, Javadi & A.J.L. Phillips* Botryosphaeriaceae P Canker and die back Italy Carlucci et al. (2015) L. crassispora T. Burgess & Barber* Botryosphaeriaceae P Canker and die back Brazil, South Africa, USA Úrbez-Torres et al. (2010b), van Niekerk et al. (2010), Correia et al. (2013, 2016b) L. egyptiaca A.M. Ismail, L. Lombard & Crous* Botryosphaeriaceae P Canker and die back Brazil Correia et al. (2016b) L. euphorbicola A.R. Machado & O.L. Pereira* Botryosphaeriaceae P Canker and die back Brazil Correia et al. (2016b) L. hormozganensis Abdollahzadeh, Zare & A.J.L. Phillips* Botryosphaeriaceae P Canker and die back Brazil Correia et al. (2016b) L. jatrophicola A.R. Machado & O.L. Pereira* Botryosphaeriaceae P Canker and die back Brazil Correia et al. (2016b) 123 40 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Disease caused Locality References L. iraniensis Abdollahzadeh, Zare & A.J.L. Phillips* Botryosphaeriaceae P Canker and die back Italy Correia et al. (2016b), Netto et al. (2017) L. laeliocattleyae (Sibilia) A. Alves* Botryosphaeriaceae P Canker and die back Brazil Correia et al. (2016b) L. margaritacea Pavlic, T.I. Burgess & M.J. Wingf.* Botryosphaeriaceae S China This study L. mediterranea Linaldeddu, Deidda & Berraf-Tebbal* Botryosphaeriaceae P Canker and die back USA Linaldeddu et al. (2015), Cruywagen et al.(2017), Netto et al. (2017) L. missouriana ÚrbezTorres, Peduto & Gubler* Botryosphaeriaceae P Canker and die back Brazil, USA Úrbez-Torres et al. (2012), Netto et al. (2014, 2017), Linaldeddu et al. (2015), Trakunyingcharoen et al. (2015), Correia et al. (2016b), Cruywagen et al. (2017), Coutinho et al. (2017) L. parva A.J.L. Phillips, A. Alves & Crous* Botryosphaeriaceae P Canker and die back Brazil Correia et al. (2013) L. plurivora Damm & Crous* Botryosphaeriaceae P Canker and die back Africa, South Africa Damm et al. (2007), Begoude et al. (2010), Doilom et al. (2015), Coutinho et al. (2017) L. pseudotheobromae A.J.L. Phillips, A. Alves & Crous* Botryosphaeriaceae P Canker and die back Brazil, China Correia et al. (2013, 2016b), Dissanayake et al. (2015) L. theobromae (Pat.) Griffon & Maubl.* Botryosphaeriaceae P, E Canker and die back Argentina, Australia, Bolivia, Brazil, China, Egypt, Florida, Iran, Italy, Iraq, Portugal, South Africa, Spain, Turkey, Uganda, USA Alfieri Jr. et al. (1984), ÚrbezTorres et al. (2006), van Niekerk et al. (2006), Pitt et al. (2010), Qiu et al. (2011), Yan et al. (2011b), Mondello et al. (2013), Dissanayake et al. (2018) L. viticola Úrbez-Torres, Peduto & Gubler* Botryosphaeriaceae P Canker and die back USA Úrbez-Torres et al. (2012), Linaldeddu et al. (2015), Comont et al. (2016), Coutinho et al. (2017), Netto et al. (2017) L. vitis Tao Yang & Crous* Botryosphaeriaceae P Canker and die back Italy Yang et al. (2017) Lasiodiplodia sp.* Botryosphaeriaceae P, S, E Canker and die back China, Italy Mondello et al. (2013), Dissanayake et al. (2018), This study Lecanicillium lecanii (Zimm.) Zare & W. Gams Cordycipitaceae E Spain Gonzalez and Tello (2011) Lecanicillium sp.* Cordycipitaceae S China This study Lecanidion atratum (Hedw.) Endl. Patellariaceae S Italy Greuter et al. (1991) Lecythophora hoffmannii (J.F.H. Beyma) W. Gams & McGinnis* Coniochaetaceae E Switzerland Casieri et al. (2009) Lentinus sp.* Polyporaceae S China This study Lenzites betulina (L.) Fr. Polyporaceae S Pakistan Ahmad et al. (1997) 123 Fungal Diversity (2018) 90:1–84 41 Table 6 (continued) Species Family Life mode Disease caused Locality References Black rot Leptodothiorella sp. Botryosphaeriaceae P Russia Melnik and Popushoi (1992) Leptosphaeria ampelina Curzi & Barbaini Leptosphaeriaceae E Italy Crane and Shearer (1991) L. cerlettii Speg. Leptosphaeriaceae S Italy Farr (1973), Crane and Shearer (1991) L. chaetostoma Sacc. Leptosphaeriaceae S Italy Crane and Shearer (1991) L. cirricola Pass. Leptosphaeriaceae S Italy Crane and Shearer (1991) L. gibelliana Pirotta Leptosphaeriaceae S Italy Crane and Shearer (1991) L. ogilviensis (Berk. & Broome) Ces. & De Not. Leptosphaeriaceae S Pakistan Ahmad (1978) L. pampini (Thüm.) Sacc. Leptosphaeriaceae S France, Italy, Portugal Unamuno (1941), Crane and Shearer (1991) L. yalin Sacc. Leptosphaeriaceae S Italy, UK Cannon et al. (1985), Crane and Shearer (1991) L. vagabunda Sacc. L. vinealis Pass. Leptosphaeriaceae Leptosphaeriaceae S S USA Italy Hanlin (1963) Crane and Shearer (1991) L. viticola Fautrey & Roum. Leptosphaeriaceae S France Crane and Shearer (1991) L. vitigena Sacc. Leptosphaeriaceae S Austria Crane and Shearer (1991) L. vitis (Castagne) Pirotta Leptosphaeriaceae S Austria, France Crane and Shearer (1991) Leptosphaeria sp.* Leptosphaeriaceae E, S China, Spain, Switzerland, Venezuela Urtiaga (1986), Casieri et al. (2009), Gonzalez and Tello (2011), This study Leptothyrium passerinii Thüm. Ascomycota genera incertae sedis E China Tai (1979) Leucostoma persoonii (Nitschke) Höhn.* Valsaceae P Canker Germany, Italy, Spain Greuter et al. (1991), Fischer et al. (2016) Libertella blepharis A.L. Sm. Diatrypaceae P, E Trunk disease Bulgaria Bobev (2009) L. viticola Fautrey Diatrypaceae E France Fautrey and Lambotte (1896) Libertella sp. Diatrypaceae P, E Australia, Spain Sosnowski et al. (2007), Gonzalez and Tello (2011) Lophidium nitidum Ellis & Everh. Lophiostomataceae S USA Cash (1953) Lophiostoma caulium (Fr.) Ces. & De Not. Lophiostomataceae E Poland Mulenko et al. (2008) Trunk disease L. elegans (Fabre) Sacc. Lophiostomataceae E Pakistan Ahmad (1969) L. macrostomum (Tode) Ces. & De Not.* Lophiostomataceae E, S Pakistan, Italy Ahmad (1978), Ahmad et al. (1997), This study, Jayawardena et al. (2018) L. pustulatum Ellis & Everh. Lophiostomataceae E USA Cash (1953) L. rhopalosporum Ellis & Everh. Lophiostomataceae E USA Cash (1953) L. scrophulariae Peck Lophiostomataceae E Canada, USA Barr (1992) L. stenostomum Ellis & Everh. L. subcorticale Fuckel Lophiostomataceae E USA Cash (1953) Lophiostomataceae E Italy Saccardo (1878) L. thuemenianum Speg. Lophiostomataceae E Italy Farr (1973) 123 42 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode L. vitigenum (Kaz. Tanaka & Y. Harada) K. Hirayama & Kaz. Tanaka Lophiostomataceae Lophiostoma sp.* Locality References E Japan Hirayama and Tanaka (2011) Lophiostomataceae E, S China Dissanayake et al. (2018), This study Lophiotrema eburnoides Kaz. Tanaka, A. Hashim. & K. Hiray.* Lophiotremataceae S Japan Liu et al. (2015) L. vitigenum Kaz. Tanaka & Y. Harada Lophiotremataceae S Japan Tanaka and Harada (2003), Kobayashi (2007) Loranitschkia viticola Lar.N. Vassiljeva Nitschkiaceae S China, Kunashir Island, Russia Vasilyeva (1990), Vasilyeva et al. (2009, 2010) Macrophoma farlowiana (Viala & Sauv.) Tassi Botryosphaeriaceae P Macrophoma rot USA Anonymous (1960), Greene (1966) M. flaccida (Viala & Ravaz) Cavara Botryosphaeriaceae P Macrophoma rot Bulgaria, France, Greece, India, Italy, Portugal Mathur (1979), Phillips and Lucas (1997), Phillips (2000), Bobev (2009) M. longispora (I. Miyake) Hara Botryosphaeriaceae P Macrophoma rot USA Anonymous (1960) M. peckiana Dearn. & House Botryosphaeriaceae P Macrophoma rot USA Anonymous (1960) M. reniformis (Viala & Ravaz) Cavara Botryosphaeriaceae P Macrophoma rot Italy, USA Anonymous (1960), Phillips and Lucas (1997) M. rimiseda (Sacc.) Berl. & Voglino Botryosphaeriaceae P Macrophoma rot Greece, Morocco, Turkey Watson (1971), Pantidou (1973) M. sicula Scalia Botryosphaeriaceae P Macrophoma rot Central Asia, Italy Koshkelova and Frolov (1973), Greuter et al. (1991) Macrophoma sp. Botryosphaeriaceae P Macrophoma rot India, USA Mathur (1979), Alfieri Jr. et al. (1984) Macrophomina phaseolina (Tassi) Goid. Botryosphaeriaceae P, E Charcoal rot Australia, Hawaii, India, Malawi, South Africa, Spain, Peregrine and Siddiqi (1972), Marais (1979), Raabe et al. (1981), Gonzalez and Tello (2011) Macrosporium vitis (Cavara) Cavara Pleosporaceae E Chile Mujica and Vergara (1945) Macrosporium sp. Pleosporaceae E Bulgaria, Greece, South Africa Alexopoulos (1940), Doidge (1950), Bobev (2009) Marssonina viticola (I. Miyake) F.L. Tai Drepanopezizaceae E China, Japan, Taiwan Sawada (1959), Watson (1971), Tai (1979), Kobayashi (2007) Marasmius sp.* Marasmiaceae S China This study Massariella viticola Frolov Amphisphaeriaceae S Central Asia Koshkelova and Frolov (1973) Massarina corticola (Fuckel) L. Holm* Massarinaceae S Switzerland Casieri et al. (2009) Merismodes bresadolae (Grélet) Singer Niaceae E Italy Farr (1973) Meliola vitis Hansf. Meliolaceae E India, Uganda Hansford (1947), Patil and Mahamulkar (1999) Metarhizium sp.* Clavicipitaceae S China This study Metasphaeria social (Sacc.) Sacc. Dothioraceae S Italy Greuter et al. (1991) 123 Disease caused Fungal Diversity (2018) 90:1–84 43 Table 6 (continued) Species Family Life mode Metschnikowia pulcherrima Pitt & M.W. Mill. Metschnikowiaceae M. viticola G. Péter, Tornai-Leh., M. Suzuki & Dlauch* Disease caused Locality References E USA Batra (1973) Metschnikowiaceae E Hungary Peter et al. (2005) Microascus brevicaulis S.P. Abbott* Helotiales genera incertae sedis E China Dissanayake et al. (2018) Microascus sp. Helotiales genera incertae sedis S China This study Microdochium bolleyi (R. Sprague) de Hoog & Herm. Nijh.* Microdochiaceae E Switzerland Casieri et al. (2009) Microdochium sp.* Microdochiaceae S China This study Microdiplodia microsporella (Sacc.) Allesch. Ascomycota genera incertae sedis P Poland Mulenko et al. (2008) M. vineae (Pass. & Beltrani) Tassi Ascomycota genera incertae sedis S Italy Tassi (1902), Greuter et al. (1991) Micropera ampelina Sacc. & Fairm. Ascomycota genera incertae sedis S USA Anonymous (1960) Microthyrium microscopicum Desm. Microthyriaceae S Portugal Unamuno (1941) Minimedusa sp.* Cantharellales incertae sedis S China This study, Jayawardena et al. (2018) Moeszia cylindroides Bubák Nectriaceae S Japan Tubaki (1958) Mollisia cinerea (Batsch) P. Karst. Mollisiaceae S USA Hanlin (1963) M. melaleuca (Fr.) Sacc. M. pullata (W.R. Gerard) Dennis Mollisiaceae Mollisiaceae S S USA USA Hanlin (1963) Dennis (1964) Monilinia fructicola (G. Winter) Honey* Sclerotiniaceae P Canada, Japan, New Zealand, USA Preston (1945), Pennycook (1989), Kobayashi (2007), Hrustic et al. (2015) M. fructigena (Pers.) Pers. Sclerotiniaceae S China Tai (1979) M. laxa (Aderh. & Ruhland) Honey Sclerotiniaceae S New Zealand Pennycook (1989) Monochaetia ampelophila Speg. Xylariomycitidae genera insertae sedis E Argentina Guba (1961), Nag Raj (1993) M. uniseta (Tracy & Earle) Sacc. & D. Sacc. Xylariomycitidae genera insertae sedis E USA Nag Raj (1993) Monochaetinula ampelophila (Speg.) Nag Raj Ascomycota genera incertae sedis E Argentina Nag Raj (1993) M. terminaliae (Bat. & J.L. Bezerra) Muthumary, Abbas & B. Sutton Ascomycota genera incertae sedis E India Muthumary et al. (1986) Monodictys antiqua (Corda) S. Hughes Dothideomycetes genera incertae sedis S Portugal de Sousa Dias and Lucas (1972) Trunk disease Brown rot 123 44 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Mortierella hyalina (Harz) W. Gams* Mortierellaceae Mortierella sp.* Locality References S Switzerland Casieri et al. (2009) Mortierellaceae E, S China Dissanayake et al. (2018), This study Mucor circinelloides Tiegh.* Mucoraceae S China, Switzerland M. hiemalis Wehmer* Mucoraceae E, S Spain, Switzerland Casieri et al. (2009), This study, Jayawardena et al. (2018) Casieri et al. (2009), Gonzalez and Tello (2011) M. moelleri (Vuill.) Lendn.* Mucoraceae S Switzerland Casieri et al. (2009) M. plumbeus Bonord.* Mucoraceae S Switzerland Casieri et al. (2009) M. racemosus Fresen.* Mucoraceae E, S China, Spain, Switzerland Casieri et al. (2009), Gonzalez and Tello (2011), This study, Jayawardena et al. (2018) Mucor sp. Mucoraceae E Greece, Spain, USA Pantidou (1973), Shaw (1973), Gonzalez and Tello (2011) Mycosphaerella cuboniana (D. Sacc.) Tomilin Mycosphaerellaceae P Greece Pantidou (1973) M. graminicola (Fuckel) J. Schröt* Mycosphaerellaceae E China Dissanayake et al. (2018) M. manganottiana (C. Massal.) Tomilin Mycosphaerellaceae P Leaf spot Greece Pantidou (1973) M. vitis (Fuckel) J. Schröt. Mycosphaerellaceae P Leaf spot Japan, Poland, Russia Watson (1971), Kobayashi (2007), Mulenko et al. (2008) Mycosphaerella sp.* Mycosphaerellaceae E China, USA, Venezuela Stevenson and Wellman (1944), Dissanayake et al. (2018) Myrothecium sp.* Stachybotryaceae P, S China, USA Alfieri Jr. et al. (1984), This study Myxosporium viticola Dearn. & House Ascomycota genera incertae sedis S USA Anonymous (1960) Nectria cinnabarina (Tode) Fr. Nectriaceae S USA Seifert (1985), Anonymous (1960), Shaw (1973) N. ramulariae (Wollenw.) E. Müll.* Nectriaceae P, E Spain, Switzerland Casieri et al. (2009), Gonzalez and Tello (2011) Nectria sp. Nectriaceae S Korea, Mexico Alvarez (1976), Cho and Shin (2004) Nemania serpens (Pers.) Gray Xylariaceae E Spain Gonzalez and Tello (2011) Neoanthostomella viticola Daranagama, Camporesi & K. D. Hyde* Xylariaceae S Italy Daranagama et al. (2016), This study, Jayawardena et al. (2018) Neofusicoccum algeriense BerrafTebbal & A.J.L. Phillips* Botryosphaeriaceae P Algeria Berraf-Tebbal et al. (2014), Nogueira et al. (2016) 123 Disease caused Leaf spot Leaf spot Canker, die back Fungal Diversity (2018) 90:1–84 45 Table 6 (continued) Species Family Life mode Disease caused Locality References N. australe (Slippers, Crous & M.J. Wingf.) Crous, Slippers & A.J.L. Phillips* Botryosphaeriaceae P Canker, die back Algeria, Australia, Chile, Italy, Mexico, New Zealand, South Africa, Spain, Uruguay, USA van Niekerk et al. (2004a, b, 2006), Luque et al. (2005), Phillips et al. (2005), Taylor et al. (2005), Úrbez-Torres et al. (2006), Cunnington et al. (2007), Baskarathevan et al. (2008), Úrbez-Torres (2011), Martin et al. (2011b), Sessa et al. (2016) N. cordaticola Pavlic, Slippers & M.J. Wingf.* Botryosphaeriaceae P Canker, die back Italy Sakalidis et al. (2013) N.italicum Dissan. & K.D. Hyde* Botryosphaeriaceae S Italy Marin-Felix et al. (2017) N. kwambonambiense Pavlic, Slippers & M.J. Wingf.* Botryosphaeriaceae P Canker, die back Uruguay Sessa et al. (2016) N. luteum (Pennycook & Samuels) Crous, Slippers & A.J.L. Phillips* Botryosphaeriaceae P Botryosphaeria die back Australia, Germany, Italy, New Zealand, Portugal, South Africa, Spain, Tunisia, Uruguay, USA Pennycook (1989), van Niekerk et al. (2004a, b), Luque et al. (2005, 2009), Úrbez-Torres et al. (2007), Baskarathevan et al. (2008), Abreo et al. (2012), Fischer et al. (2016) N. macroclavatum (T.I. Burgess, Barber & G.E. Hardy) T.I. Burgess, Barber & G.E. Hardy Botryosphaeriaceae P Canker, die back New Zealand Billones et al. (2010), ÚrbezTorres (2011) N. mangiferae (Syd. & P. Syd.) Crous, Slippers & A.J.L. Phillips* Botryosphaeriaceae P Canker, die back China Dissanayake et al. (2015) N. mediterraneum Crous, M.J. Wingf. & A.J.L. Phillips* Botryosphaeriaceae P Canker, die back Algeria, Spain, USA Úrbez-Torres et al. (2010a, b, c), Berraf-Tebbal et al. (2014) N. occulatum Sakalidis & T.I. Burgess* Botryosphaeriaceae P Canker, die back Australia Sakalidis et al. (2013) N. parvum (Pennycook & Samuels) Crous, Slippers & A.J.L. Phillips* Botryosphaeriaceae P, E, S Botryosphaeria die back Australia, Italy, Brazil, Canada, Chile, China, France, New Zealand, Portugal, South Africa, Spain, Switzerland, Uruguay, USA Phillips et al. (2002, 2005), van Niekerk et al. (2004a, b, 2006), Luque et al. (2005, 2009), ÚrbezTorres et al. (2006), Cunnington et al. (2007), Baskarathevan et al. (2008), Casieri et al. (2009), Gonzalez and Tello (2011), Abreo et al. (2012), Correia et al. (2013), Mondello et al. (2013), Sakalidis et al. (2013), Wu et al. (2015), This study, Jayawardena et al. (2018) 123 46 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Disease caused Locality References N. ribis (Slippers, Crous & M.J. Wingf.) Crous, Slippers & A.J.L. Phillips Botryosphaeriaceae P Botryosphaeria die back, Macrophoma rot Australia, Italy, South Africa, Tanzania, Pakistan, Portugal, USA Anonymous (1960), Ebbels and Allen (1979), Milholland (1994), Ahmad et al. (1997), Phillips (2000), Halleen et al. (2003), van Niekerk et al. (2006) N. stellenboschiana Tao Yang & Crous* Botryosphaeriaceae P Canker, die back South Africa Yang et al. (2017) N. viticlavatum (Van Niekerk & Crous) Crous, Slippers & A.J.L. Phillips Botryosphaeriaceae P Canker, die back South Africa Burgess et al. (2005), Farr et al. (2005), Luque et al. (2005), Phillips et al. (2005), van Niekerk et al. (2006) N. vitifusiforme (Van Niekerk & Crous) Crous, Slippers & A.J.L. Phillips Botryosphaeriaceae P Botryosphaeria die back Italy, Mexico, South Africa, Spain, USA van Niekerk et al. (2004a, b), Burgess et al. (2005), Luque et al. (2009), CandolfiArballo et al. (2010), ÚrbezTorres (2011), Mondello et al. (2013) Neomassaria fabacearum Mapook, Camporesi & K.D. Hyde* Massariaceae S Italy This study, Jayawardena et al. (2018) Neonectria candida (Ehrenb.) Rossman, L. Lombard & Crous* N. coccinea (Pers.) Rossman & Samuels Nectriaceae S Spain, Switzerland Casieri et al. (2009), Gonzalez and Tello (2011) Nectriaceae S USA Anonymous (1960) N. fuckeliana (C. Booth) Castl. & Rossman* Nectriaceae P, E Canada, Spain, Switzerland Casieri et al. (2009), Gonzalez and Tello (2011), Petit et al. (2011) N. macrodidyma Halleen, Schroers & Crous* Nectriaceae S Switzerland Casieri et al. (2009) N. microconidia J. Luo, P. Zhao & W.Y. Zhuang* Nectriaceae S Japan Hirooka et al. (2013) N. obtusispora (Cooke & Harkn.) Rossman, L. Lombard & Crous Nectriaceae P Black-foot disease Italy, USA Scheck et al. (1998a, b), Greuter et al. (1991) Neopestalotiopsis asiatica (Maharachch. & K.D. Hyde) Maharachch., K.D. Hyde & Crous* Sporocadaceae P Leaf stripe France Maharachchikumbura et al. (2016) N. clavispora (G.F. Atk.) Maharachch., K.D. Hyde & Crous* Sporocadaceae S China This study, Jayawardena et al. (2018) N. javaensis Maharachch., K.D. Hyde & Crous* Sporocadaceae E France Maharachchikumbura et al. (2016) N. vitis Jayawardena, Maharachch., Yan, Li & Hyde* Sporocadaceae P, S Fruit rot, trunck disease, leaf spot China Jayawardena et al. (2016a, b) Neopestalotiopsis sp.* Sporocadaceae P Leaf spot China, France, India Jayawardena et al. (2015), Maharachchikumbura et al. (2014, 2016) Neoplaconema sp.* Ascomycota genera incertae sedis P Switzerland Casieri et al. (2009) 123 Fungal Diversity (2018) 90:1–84 47 Table 6 (continued) Species Family Life mode Disease caused Locality References Neoscytalidium dimidiatum (Penz.) Crous & Slippers* Botryosphaeriaceae P Wood canker, die back Brazil, India, Iraq, USA, Wangikar et al. (1969), Sarbhoy et al. (1971), Mathur (1979), Al-Saadoon et al. (2012), Rolshausen et al. (2013), Correia et al. (2016a) Neurospora sp.* Sordariaceae S China This study Nigrospora oryzae (Berk. & Broome) Petch* Sordariomycetes genera incertae sedis E China, Spain Gonzalez and Tello (2011), Dissanayake et al. (2018) N. sphaerica (Sacc.) E.W. Mason* Sordariomycetes genera incertae sedis E China Dissanayake et al. (2018) Nodulisporium sp. Xylariaceae E Spain Gonzalez and Tello (2011) Oidiodendron sp.* Myxotrichaceae E China Dissanayake et al. (2018) Ophiocordyceps sp.* Ophiocordycipitaceae S China This study Ophiostoma piceae (Münch) Syd. & P. Syd.* Ophiostomataceae E Spain, Switzerland Casieri et al. (2009), Gonzalez and Tello (2011) O. quercus (Georgev.) Nannf.* Ophiostomataceae E Switzerland Casieri et al. (2009) O. subalpinum Ohtaka & Masuya* Ophiostomataceae E Switzerland Casieri et al. (2009) Ophiostoma sp.* Ostreichnion curtisii (Duby) M.L. Lohman Ophiostomataceae Hysteriaceae E S Switzerland USA Casieri et al. (2009) Hanlin (1963) Ostreola viticola R. Rao & Modak Mytilinidiaceae S India Pande (2008) Paecilomyces sp. Thermoascaceae P Root stock South Africa Halleen et al. (2003) Papiliotrema laurentii (Kuff.) X.Z. Liu, F.Y. Bai, M. Groenew. & Boekhout Tremellaceae P Melting decay USA Morgan and Michailides (2004) Papulospora sp.* Sordariomycetes genera incertae sedis S China This study Pareutypella sulcata Y.M. Ju & J.D. Rogers Sordariomycetes genera incertae sedis S Taiwan Ju and Rogers (1995) Passalora dissiliens (Duby) U. Braun & Crous Mycosphaerellaceae P Leaf spot Australia, Bulgaria, China, Egypt, France, Iran, India. Israel, Japan, South Africa, Pakistan, Palestine, Poland, Portugal, Yemen Crous and Braun (2003), Guo and Liu (2003), Zhuang (2005), Kobayashi (2007), Bobev (2009), Mouchacca (2009) P. fulva (Cooke) U. Braun & Crous* Mycosphaerellaceae P Leaf spot Switzerland Casieri et al. (2009) P. heterosporella U. Braun & Crous Mycosphaerellaceae P Leaf spot Israel, USA Crous and Braun (2003) P. vitis (M.S. Patil & Sawant) Poonam Srivast. Mycosphaerellaceae P Leaf spot India Crous and Braun (2003), Kamal (2010) P. vitis-piadezkii U. Braun & Crous Mycosphaerellaceae P Leaf spot China Crous and Braun (2003), Guo and Liu (2003) 123 48 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Disease caused Locality References P. vitis-ripariae (U. Braun) U. Braun & Crous Mycosphaerellaceae P Leaf spot USA Crous and Braun (2003) Patellaria atrata (Hedw.) Fr. Patellariaceae S Central Asia Koshkelova and Frolov (1973) P. lantanae R. Rao Patellariaceae S India Pande (2008) P. viticola Pers. Patellariaceae S Spain Unamuno (1941) Paraphoma chrysanthemicola (Hollós) Gruyter, Aveskamp & Verkley* Phaeosphaeriaceae S China This study, Jayawardena et al. (2018) Penicillium adametzioides S. Abe Aspergillaceae E, S Japan Kobayashi (2007) P. astrolabium R. Serra & S.W. Peterson* Aspergillaceae S Portugal Serra and Peterson (2007) P. aurantiogriseum Dierckx Aspergillaceae P South Africa Gorter (1977) P. brevicompactum Dierckx* Aspergillaceae S China This study, Jayawardena et al. (2018) P. chrysogenum Thom* Aspergillaceae S China This study P. citrinum Thom* Aspergillaceae S China This study, Jayawardena et al. (2018) P. digitatum (Pers.) Sacc.* Aspergillaceae E China Dissanayake et al. (2018) Fruit rot P. elongatum Dierckx Aspergillaceae P Fruit rot South Africa Gorter (1977) P. expansum Link Aspergillaceae P Fruit rot Bulgaria, South Africa, USA Gorter (1977), Bobev (2009) P. funiculosum Thom Aspergillaceae S Cyprus Georghiou and Papadopoulos (1957) P. italicum Wehmer Aspergillaceae P Greece Pantidou (1973) P. neocrassum R. Serra & S.W. Peterson* Aspergillaceae S Portugal Serra and Peterson (2007) P. olsonii Bainier & Sartory* P. rolfsii Thom Aspergillaceae E Portugal Serra and Peterson (2007) Aspergillaceae E USA Shaw (1973) Aspergillaceae S Japan Kobayashi (2007) P. sclerotigenum W. Yamam. Fruit rot P. sumatraense Svilv.* Aspergillaceae P Iran Mahdian and Zafari (2017) P. terrigenum Houbraken, Frisvad & Samson* Aspergillaceae S China This study, Jayawardena et al. (2018) P. toxicarium I. Miyake* Aspergillaceae P, E Spain Garcia-Benavides et al. (2013) P. variabile Sopp Aspergillaceae S Penicillium sp.* Aspergillaceae P, E, S 123 Fruit rot Fruit rot USA Shaw (1973) Australia, Chile, China, Cuba, France, Italy, Japan, Korea, South Africa, Spain, Switzerland, USA French (1989), Castillo-Pando et al. (2001), Fourie and Halleen (2002), Casieri et al. (2009), Gonzalez and Tello (2011), Mondello et al. (2013), Oh et al. (2014), Dissanayake et al. (2018), This study Fungal Diversity (2018) 90:1–84 49 Table 6 (continued) Species Family Life mode Peniophora albomarginata (Schwein.) Massee Peniophoraceae P. viticola (Schwein.) Höhn. & Litsch. Disease caused Locality References S USA Hanlin (1966) Peniophoraceae S USA Hanlin (1966) Peniophora sp.* Peniophoraceae S China Penzigomyces dissolvens (Hol.-Jech., Mercado & J. Mena) J. Mena* Ascomycota genera incertae sedis S Cuba This study, Jayawardena et al. (2018) Mena-Portales et al. (2000) Perenniporia tenuis (Schwein.) Ryvarden P. unita (Pers.) Murrill Polyporaceae S Greece Polyporaceae S USA Periconia byssoides Pers. Periconiaceae E Argentina, USA Grand (1985), Carmaran and Novas (2003) P. igniaria E.W. Mason & M.B. Ellis Periconiaceae E Spain Gonzalez and Tello (2011) Pestalotiopsis biciliata Maharachch., K.D. Hyde & Crous* Sporocadaceae P France Maharachchikumbura et al. (2016) P. chamaeropis Maharachch., K.D. Hyde & Crous* Sporocadaceae S Italy This study, Jayawardena et al. (2018) P. funerea (Desm.) Steyaert Sporocadaceae P Leaf spot Japan Kobayashi (2007) P. mangiferae (Henn.) Steyaert Sporocadaceae P Leaf spot Myanmar Thaung (2008c) P. menezesiana (Bres. & Torrend) Bissett* Sporocadaceae P Fruit rot Australia, China, Greece, India, Japan, Madeira Islands, USA Mundkur and Thirumalachar (1946), Alfieri Jr. et al. (1984, Nag Raj (1993), Sergeeva et al. (2005) P. quadriciliata (Bubák & Dearn.) Bissett Sporocadaceae P Leaf spot Canada Nag Raj (1993) P. trachicarpicola Y.M. Zhang & K.D. Hyde* Sporocadaceae P Fruit rot, trunck disease China Jayawardena et al. (2015) P. uvicola (Speg.) Bissett* Sporocadaceae P Fruit rot Australia, China, India, Italy, Japan, Korea, USA Simmonds (1966), Tai (1979), Nag Raj (1988, 1993), Cho and Shin (2004), Sergeeva et al. (2005), Kobayashi (2007), Ge et al. (2009), Maharachchikumbura et al. (2011), Úrbez-Torres et al. (2012) Pestalotiopsis sp.* Sporocadaceae P, E, S Fruit rot Australia, Cuba, Italy, Japan, Korea, South Africa, USA Urtiaga (1986), Halleen et al. (2003), Castillo-Pando et al. (2001), Úrbez-Torres et al. (2012), This study Leaf stripe, defoliated shoots Kotlaba (1997), Zervakis et al. (1998) Hanlin (1966) 123 50 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Disease caused Locality References Phaeoacremonium aleophilum W. Gams, Crous, M.J. Wingf. & Mugnai* Togniniaceae P, E Esca Algeria, Argentina, Austria, Australia, France, Italy, Iran, Serbia, South Africa, Spain, Turkey, Uruguay, USA, Yugoslavia Larignon and Dubos (1997), Pascoe and Cottral (2000), Gatica et al. (2001), Lardner et al. (2005), Whiting et al. (2005), Mostert et al. (2006), Sosnowski et al. (2007), Luque et al. (2009), Berraf-Tebbal et al. (2011), Gonzalez and Tello (2011), Abreo et al. (2012), Mohammadi and Banihashemi (2012), Garcia-Benavides et al. (2013), Mohammadi et al. (2013a), Úrbez-Torres et al. (2013a, b) P. alvesii L. Mostert, Summerb. & Crous* Togniniaceae P Esca South Africa, Turkey Essakhi et al. (2008), White et al. (2011) P. amstelodamense L. Mostert, Summerb. & Crous Togniniaceae P Esca Netherland Arzanlou et al. (2014) P. angustius W. Gams, Crous & M.J. Wingf. Togniniaceae P Esca France, Portugal, USA Chicau et al. (2000), Whiting et al. (2005) P. argentinense L. Mostert, W. Gams & Crous* Togniniaceae P Esca Argentina Arzanlou et al. (2014) P. armeniacum A.B. Graham, P.R. Johnst. & B. Weir* Togniniaceae P Esca New Zealand Graham et al. (2009), Arzanlou et al. (2014), Úrbez-Torres et al. (2014) P. australiense L. Mostert, Summerb. & Crous* Togniniaceae P Esca Australia, Uruguay Mostert et al. (2006), Graham et al. (2009), Abreo et al. (2012), Arzanlou et al. (2014), Úrbez-Torres et al. (2014) P. austroafricanum L. Mostert, W. Gams & Crous* Togniniaceae P Esca South Africa Berraf-Tebbal et al. (2011), Úrbez-Torres et al. (2014) P. canadense J.R. ÚrbezTorres, P. Haag & D.T. O’Gorman* Togniniaceae P Esca Canada Úrbez-Torres et al. (2014) P. chlamydospora (W. Gams, Crous, M.J. Wingf. & Mugnai) Crous & W. Gams* Togniniaceae P Esca Australia, Chile, France, Italy, Portugal, South Africa, USA Larignon and Dubos (1997), Dupont et al. (1998), Scheck et al. (1998b), Chicau et al. (2000), Pascoe and Cottral (2000), Auger et al. (2004b), Lardner et al. (2005), Santos et al. (2006) P. cinereum Gramaje, Mohammadi, Banihashemi, Armengol & L. Mostert* Togniniaceae P Esca Iran Gramaje et al. (2009), Mohammadi and Banihashemi (2012), Mohammadi et al. (2013a), Úrbez-Torres et al. (2014), Sami et al. (2014) P. fraxinopennsylvanicum (T.E. Hinds) D. Gramaje, L. Mostert & Crous* Togniniaceae P Esca Canada, Croatia, Germany, Hungary, Iran, South Africa, Spain, USA Eskalen et al. (2005), Fischer et al. (2016) 123 Fungal Diversity (2018) 90:1–84 51 Table 6 (continued) Species Family Life mode Disease caused Locality References P. globosum A.B. Graham, P.R. Johnst. & B. Weir* Togniniaceae P Esca New Zealand Graham et al. (2009), Arzanlou et al. (2014), Úrbez-Torres et al. (2014) P. griseorubrum L. Mostert, Summerb. & Crous* Togniniaceae P Esca Italy Essakhi et al. (2008), Gramaje et al. (2009), Berraf-Tebbal et al. (2011) P. hispanicum Gramaje, Armengol & L. Mostert* Togniniaceae P Esca Algeria, Iran, Spain Martin et al. (2011a), ÚrbezTorres et al. (2014) P. hungaricum Essakhi, Mugnai, Surico & Crous* Togniniaceae P Esca Hungary Essakhi et al. (2008), BerrafTebbal et al. (2011), Arzanlou et al. (2014), Úrbez-Torres et al. (2014), P. inflatipes W. Gams, Crous & M.J. Wingf.* Togniniaceae P, E Esca Chile, Iran, Italy, Spain, USA, Scheck et al. (1998a, b), Mugnai et al. (1999), Whiting et al. (2005), Mostert et al. (2006), Gonzalez and Tello (2011), Mohammadi and Banihashemi (2012) P. iranianum L. Mostert, Gräfenhan, W. Gams & Crous* Togniniaceae P Esca Canada, Iran, Italy, South Africa, Spain Mostert et al. (2006), Essakhi et al. (2008), Gramaje et al. (2009), White et al. (2011), Mohammadi et al. (2013a), Sami et al. (2014), ÚrbezTorres et al. (2014) P. italicum A. Carlucci & M.L. Raimondo* Togniniaceae P Esca Italy Raimondo et al. (2014) P. krajdenii L. Mostert, Summerb. & Crous* Togniniaceae P Esca Canada, Europe, South Africa, Spain Mostert et al. (2006), Gramaje et al. (2011), Úrbez-Torres et al. (2014) P. minimum (Tul. & C. Tul.) D. Gramaje, L. Mostert & Crous* Togniniaceae P Esca Argentina, Austria, Australia, Brazil, Canada, Chile, France, Germany, Greece, Hungary, Iran, Israel, Italy, Mexico, South Africa, Uruguay, USA, Yugoslavia Mostert et al. (2006), ÚrbezTorres et al. (2012, 2014), Baloyi et al. (2013), Whitelaw-Weckert et al. (2013) P. mortoniae Crous & W. Gams* Togniniaceae P Esca Iran, New Zealand Whiting et al. (2005), Mohammadi and Banihashemi (2012) P. occidentale A.B. Graham, P.R. Johnst. & B. Weir* Togniniaceae P Esca New Zealand Graham et al. (2009), Arzanlou et al. (2014), Úrbez-Torres et al. (2014) P. parasiticum (Ajello, Georg & C.J.K. Wang) W. Gams, Crous & M.J. Wingf.* P. roseum (J.R.) Úrb.Torr., P. Haag & O’Gorman* Togniniaceae P Esca Algeria, Argentina, Australia, Brazil, Chile, Iran, Peru, South Africa Gatica et al. (2001), Dupont et al. (2002), Berraf-Tebbal et al. (2011) Togniniaceae P Esca Canada da Silva et al. (2017) P. rubrigenum W. Gams, Crous & M.J. Wingf.* Togniniaceae P Esca Argentina, Chile, Croatia, France, Iran, New Zealand, South Africa, USA Dupont et al. (2000), Kubatova et al. (2004), Essakhi et al. (2008), Sami et al. (2014) 123 52 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Disease caused Locality References P. scolyti L. Mostert, Summerb. & Crous* Togniniaceae P Esca France, Italy, South Africa, Spain, Turkey Essakhi et al. (2008), Gramaje et al. (2008), Ozben et al. (2012), Úrbez-Torres et al. (2014) P. sicilianum Essakhi, Mugnai, Surico & Crous* Togniniaceae P Esca Italy, South Africa, Spain Essakhi et al. (2008), White et al. (2011), Arzanlou et al. (2014), Úrbez-Torres et al. (2014), Gramaje et al. (2009) P. subulatum L. Mostert, Summerb. & Crous* Togniniaceae P Esca South Africa Mostert et al. (2006), BerrafTebbal et al. (2011) P. tuscanicum Essakhi, Mugnai, Surico & Crous* Togniniaceae P Esca Spain Garcia-Benavides et al. (2013) P. venezuelense L. Mostert, Summerb. & Crous* Togniniaceae P Esca Algeria, South Africa Mostert et al. (2006), BerrafTebbal et al. (2011) P. viticola J. Dupont* Togniniaceae P Esca France, Germany, Spain Luque et al. (2009), ÚrbezTorres et al. (2014), Fischer et al. (2016) Phaeoacremonium sp.* Togniniaceae P, S Esca Argentina, China, Iran, South Africa, Spain Gatica et al. (2001), Fourie and Halleen (2002), Halleen et al. (2003), Gramaje et al. (2009), White et al. (2011), Mohammadi and Banihashemi (2012), This study Phaeomoniella chlamydospora (W. Gams, Crous, M.J. Wingf. & Mugnai) Crous & W. Gams* Phaeomoniellaceae P, E Esca Argentina, Australia, Brazil, Bulgaria, Chile, Europe, France, Iran, Italy, New Zealand, Slovakia, South Africa, Spain, Switzerland, Turkey, Uruguay, USA Larignon and Dubos (1997), Crous and Gams (2000), Karimi et al. (2001), Cunnington (2003), Halleen et al. (2003), Whiting et al. (2005), Kakalikova et al. (2009), Bobev (2009), Casieri et al. (2009), Luque et al. (2009), Smetham et al. (2010), Gonzalez and Tello (2011), Correia et al. (2013), Garcia-Benavides et al. (2013), Mohammadi et al. (2013a), Diaz and Latorre (2014), Akgul et al. (2015) Phaeotrichoconis crotalariae (M.A. Salam & P.N. Rao) Subram.* Ascomycota genera incertae sedis E Brazil Bezerra and De Lima (2012) Phakopsora ampelopsidis Dietel & P. Syd. Phakopsoraceae P Rust Hong Kong, Korea, India, Taiwan, Thailand Mundkur (1943), Sawada (1943), Lu et al. (2000), Cho and Shin (2004), Lorsuwan et al. (1984) P. cronartiiformis Dietel Phakopsoraceae P Rust India Mundkur (1943), Padwick (1946), Watson (1971), Sarbhoy and Agarwal (1990) 123 Fungal Diversity (2018) 90:1–84 53 Table 6 (continued) Species Family Life mode Disease caused Locality References P. euvitis Y. Ono Phakopsoraceae P Rust Bangladesh, Brazil, China, Indonesia, Jamaica, Japan, Malaysia, North Korea, Philipines, Thailand, Thaiwan, USA Teodoro (1937), Giatgong (1980), Ono (2000), Chatasiri and Ono (2008) P. meliosmae-myrianthae (Henn. & Shirai) Y. Ono* Phakopsoraceae P Rust Japan, Thaiwan Pota et al. (2015), Ono (2016) P. montana Y. Ono & Chatasiri* Phakopsoraceae P Rust Japan Pota et al. (2015), Ono (2016) P. uva Buriticá & J.F. Hennen* Phakopsoraceae P Rust Colombia, Costa rica, Cuba, Guatemala, Mexico, USA, Venezuela Buritica and Pardo Cardona (1996), Pardo Cardona (1998), Buritica (1999), Salazar-Yepes et al. (2002) P. vitis P. Syd. Phakopsoraceae P Rust Colombia, Costa Rica, Dominican Republic, Ecuador, Guatemala, Indonesia, Japan, Russia, Taiwan, Trinidad and Tobago, USA, Venezuela Arthur (1918), Chardon and toro (1930), Jackson (1931), Kern et al. (1934), Baker and Dale (1951), Berndt (2004) Phakopsora sp. Phakopsoraceae P Rust Costa rica Berndt (2004) Phanerochaete viticola (Schwein.) Parmasto Phanerochaetaceae E Rust USA Burdsall (1985) Phellinidium noxium (Corner) Bondartseva & S. Herrera Hymenochaetaceae P Esca Taiwan Ann et al. (2002) Phellinus igniarius (L.) Quél. Hymenochaetaceae P Esca Bulgaria Bobev (2009) P. resupinatus M. Fisch., M. Cloete, L. Mostert & F. Halleen* Hymenochaetaceae P Esca Nambia, South Africa Cloete et al. (2016) Phellinus sp.* Hymenochaetaceae P Esca Argentina, Australia, South Africa, USA Gatica et al. (2001), Lardner et al. (2005), Sosnowski et al. (2007), White et al. (2011) Phialophora sp. Phialosimplex sp.* Herpotrichiellaceae Trichocomaceae E E, S Spain China Gonzalez and Tello (2011) Dissanayake et al. (2018), This study Phoma confluens Welw. & Curr. Didymellaceae OP Leaves and stem lesions Central Asia Koshkelova and Frolov (1973) P. herbarum Westend.* Didymellaceae OP Leaves and stem lesions China Dissanayake et al. (2018) P. lenticularia Cavara Didymellaceae S Italy Cavara (1888) P. medicaginis Malbr. & Roum.* Didymellaceae S China This study, Jayawardena et al. (2018) P. reniformis Viala & Ravaz Didymellaceae OP Leaves and stem lesions China, Portugal Phillips and Lucas (1997), Zhuang (2005) P. vitis Bonord. Didymellaceae OP Leaves and stem lesions Australia, Greece, India, Italy, USA, Pantidou (1973), Mathur (1979), French (1989), Shivas (1989), Greuter et al. (1991) Phoma sp.* Didymellaceae P, E, S Leaves and stem lesions China, Italy, Spain, Switzerland Casieri et al. (2009), Gonzalez and Tello (2011), Mondello et al. (2013), Dissanayake et al. (2018), This study 123 54 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Disease caused Locality References Phyllosticta ampelicida (Engelm.) Aa* Phyllostictaceae P, S Black rot All over the world Larter and Martyn (1943), Mujica and Oehrens (1967), Alvarez (1976), Mendes et al. (1998), Dudka et al. (2004), Kobayashi (2007), Slippers et al. (2007a, b), Goos (2010), Wicht et al. (2012) P. ampelophila Politis Phyllostictaceae P Black rot Greece Pantidou (1973) P. badamii (Cooke) Phyllostictaceae P Black rot UK, Ukraine Watson (1971), Dudka et al. (2004) P. microspila Pass. Phyllostictaceae P Black rot Italy Watson (1971) P. muscadinii (Luttr.) Wulandari Phyllostictaceae P Black rot USA Hanlin (1963), Alfieri Jr. et al. (1984, Kummuang et al. (1996) P. pilispora Speschnew Phyllostictaceae P Black rot China, Japan, Ukraine, Uzbekistan Gaponenko (1965), Tai (1979), Kobayashi (2007), Dudka et al. (2004) P. spermoides Peck Phyllostictaceae P Black rot China, USA Anonymous (1960), French (1987, 1989), Bai (2000) P. turmalis Ellis & Everh. Phyllostictaceae P Black rot USA Cash (1953) P. vitis-rotundifoliae N. Zhou & L. Cai* Phyllostictaceae P Black rot USA Zhou et al. (2015) Phytophthora cactorum (Lebert & Cohn) J. Schröt. P. cambivora (Petri) Buisman Peronosporaceae P Root rot South Africaa Oudemans and Coffey (1991), Erwin and Ribeiro (1996) Peronosporaceae P Root rot South Africa Oudemans and Coffey (1991) P. cinnamomi Rands* Peronosporaceae P Root rot Australia, New Zealand, South Africa P. citricola Sawada Peronosporaceae P Root rot New Zealand Gorter (1977), Marais (1980), Pennycook (1989), Shivas (1989), Oudemans and Coffey (1991), Erwin and Ribeiro (1996), Gadgil (2005), Blair et al. (2008), Langrell et al. (2011) Pennycook (1989), Erwin and Ribeiro (1996), Gadgil (2005) P. cryptogea Pethybr. & Laff.* Peronosporaceae P Root rot South Africa Mills et al. (1991), Erwin and Ribeiro (1996), Martin et al. (2014) P. drechsleri Tucker Peronosporaceae P Root rot Korea Cho and Shin (2004) P. megasperma Drechsler Peronosporaceae P Root rot Australia, USA Shivas (1989), Forster and Coffey (1993) P. nicotianae Breda de Haan Peronosporaceae P Root rot India, South Africa Erwin and Ribeiro (1996) P. niederhauseri Z.G. Abad & J.A. Abad* Peronosporaceae P Root rot South Africa Abad et al. (2014) Phytophthora sp.* Peronosporaceae P Root rot Australia, Chili, Mexico, USA Mujica and Oehrens (1967), Alvarez (1976), French (1989), Castillo-Pando et al. (2001), Brasier et al. (2003) Pilidium concavum (Desm.) Höhn. Chaetomellaceae P Excoriose and cane blight Portugal Phillips (2000) 123 Fungal Diversity (2018) 90:1–84 55 Table 6 (continued) Species Family Life mode Disease caused Locality References P. lythri (Desm.) Rossman Chaetomellaceae P Excoriose and cane blight USA Greene (1963) Pionnotes biasolettiana (Corda) Sacc. Nectriaceae E Japan Kobayashi (2007) Plagiostoma devexum (Desm.) Fuckel* Gnomoniaceae E Europe, USA Sogonov et al. (2008) Plasmopara viticola (Berk. & M.A. Curtis) Berl. & De Toni Peronosporaceae P All over the world Doidge (1950), Riley (1960), Whiteside (1966), Dennis (1970), Stevenson (1975), Gorter (1977), Giatgong (1980), Simonyan (1981), Mendes et al. (1998), McKirdy et al. (1999), Dudka et al. (2004), Voglmayr et al. (2004), Gadgil (2005), GarciaBlazquez et al. (2006), Mulenko et al. (2008), Thaung (2008b), Bobev (2009) Pleospora herbarum (Pers.) Rabenh. Pleosporaceae E Chile, Libya, Pakistan Mujica and Oehrens (1967), El-Buni and Rattan (1981), Ahmad et al. (1997) P. penicillus Fuckel P. phaeocomoides (Sacc.) G. Winter Pleosporaceae Pleosporaceae S S Portugal, Spain USA Checa (2004) Hanlin (1963) P. vitis Catt. Pleosporaceae E Central Asia, Greece, Italy, Spain Unamuno (1941), Koshkelova and Frolov (1973), Pantidou (1973), Shoemaker (1992) P. vitis-viniferae Frolov Pleosporaceae E Central Asia, Russia Koshkelova and Frolov (1973), Shoemaker (1992) Downey mildew P. vulgaris Niessl Pleosporaceae E Central Asia Koshkelova and Frolov (1973) Pleospora sp. Pleosporaceae E Portugal Phillips (2000) Pleurophoma sp. Lentitheciaceae P Excoriose and cane blight Portugal Phillips (2000) Pleurostoma richardsiae (Nannfeldt) Réblová & Jaklitsch* Pleurostomataceae P Trunk disease Italy, South Africa, Spain White et al. (2011), Carlucci et al. (2015), Pintos Varela et al. (2016) Pleurotus ostreatus (Jacq.) P. Kumm. Pleurotaceae P Wood rot USA Vail et al. (1995) Preussia africana Arenal, Platas & Peláez* P. intermedia (Auersw.) S. Ahmad Sporormiaceae S Spain Garcia-Benavides et al. (2013) Sporormiaceae E Spain Gonzalez and Tello (2011) Pseudallescheria sp.* Microascaceae S China This study Pseudocamarosporium propinquum (Sacc.) Wijayaw., Camporesi & K.D. Hyde* Didymospharaceae S Italy This study, Jayawardena et al. (2018) P. brachypus (Ellis & Everh.) X.J. Liu & Y.L. Guo Mycosphaerellaceae P Leaf spot USA Alfieri Jr. et al. (1984 P. daspurensis (A.K. Kar & M. Manda) Mycosphaerellaceae P Leaf spot India Sarbhoy et al. (1971) 123 56 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Disease caused Locality References Pseudocercospora riachueli (Speg.) Deighton Mycosphaerellaceae P Leaf spot India, Thailand Kamal (2010), Phengsintham et al. (2013) P. vitis (Lév.) Speg.* Mycosphaerellaceae P Leaf spot Australia, Barbados, Brazil, Bulgaria, China, France, Hungary, India, Iowa, Iran, Italy, Japan, Korea, Mauritius, Myanmar, Pakistan, Poland, South Africa, South Korea, Taiwan, Tanzania, Thailand, USA, Zimbabwe Gilman and Archer (1929), Wiehe (1948), Riley (1960), Vasudeva (1963), Whiteside (1966), Norse (1974), Deighton (1976), Gorter (1977), Giatgong (1980), Thaung (1984), Pons and Sutton (1988), Cook and Dubé (1989), Hsieh and Goh (1990), Ahmad et al. (1997), Roux et al. (1997), Kim and Shin (1998), Liu and Guo (1998), Mendes et al. (1998), Zhuang (2001), Dugan et al. (2004), Kobayashi (2007), Mulenko et al. (2008), Bobev (2009), Kamal (2010), Sultan et al. (2011), Pirnia et al. (2012), Liang et al. (2016), This study, Jayawardena et al. (2018) Pseudogymnoascus pannorum (Link) Minnis & D.L. Lindner* Pseudolachnea hispidula (Schrad.) B. Sutton* Myxotrichaceae S Switzerland Casieri et al. (2009) Chaetosphaeriaceae S Italy This study, Jayawardena et al. (2018) Pseudopestalotiopsis camelliae-sinensis F. Liu & L. Cai* Sporocadaceae S Italy This study, Jayawardena et al. (2018) Pseudopezicula tetraspora Korf, R.C. Pearson & W.Y. Zhuang Drepanopezizaceae P Angular leaf scorch USA Pearson et al. (1988) P. tracheiphila (Müll.Thurg.) Korf & W.Y. Zhuang) Drepanopezizaceae P Angular leaf scorch Australia, France, Germany, Hungary, Jordan, Moldova, Romania, Switzerland, Tunisia, Turkey, Ukraine, Yugoslavia Korf et al. (1986) Psiloglonium clavisporum (Seaver) E. Boehm, C.L. Schoch & Spatafora Hysteriaceae S USA Hanlin (1963) Punctulariopsis cremeoalbida (M.J. Larsen & Nakasone) Ghobad-Nejhad Punctulariaceae S USA Larsen and Nakasone (1984) Pyrenochaeta sp.* Cucurbitariaceae E China Dissanayake et al. (2018) Pyrenophora phaeocomes (Rebent.) Fr. Pleosporaceae E Portugal Unamuno (1941) P. phaeocomoides (Berk. & Broome) Sacc. Pleosporaceae E France, Portugal Unamuno (1941), Shoemaker (1992) 123 Fungal Diversity (2018) 90:1–84 57 Table 6 (continued) Species Family Life mode Pyrigemmula aurantiaca D. Magyar & R. Shoemaker* Chaetosphaeriaceae E, S Pythium acanthicum Drechsler* Pythiaceae P P. amasculinum Y.N. Yu* P. aphanidermatum (Edson) Fitzp. Pythiaceae S Pythiaceae P Disease caused Locality References Hungary Magyar et al. (2011) Australia, South Africa Shivas (1989), McLeod et al. (2009) China This study Root rot Australia, South Africa Cook and Dubé (1989) Root rot P. coloratum Vaartaja* Pythiaceae P Root rot South Africa McLeod et al. (2009) P. cryptoirregulare Garzón, Yánez & G.W. Moorman* Pythiaceae P Root rot South Africa McLeod et al. (2009) P. debaryanum R. Hesse Pythiaceae P Root rot Chile, India Mujica and Vergara (1945) P. echinulatum V.D. Matthews* Pythiaceae P Root rot South Africa McLeod et al. (2009) P. helicoides Drechsler* Pythiaceae P Root rot South Africa McLeod et al. (2009) P. heterothallicum W.A. Campb. & F.F. Hendrix* Pythiaceae P Root rot South Africa McLeod et al. (2009) P. irregulare Buisman* Pythiaceae P Root rot Asutralia, South Africa Cook and Dubé (1989), Shivas (1989), McLeod et al. (2009) P. kunmingense Y.N. Yu* Pythiaceae P Root rot South Africa McLeod et al. (2009) P. mamillatum Meurs* Pythiaceae P Root rot Australia, South Africa Shivas (1989), McLeod et al. (2009) P. parasiticum S. Rajagop. & K. Ramakr. Pythiaceae P Root rot South Africa Gorter (1977) P. paroecandrum Drechsler* Pythiaceae P Root rot South Africa McLeod et al. (2009) P. periilum Drechsler* Pythiaceae P Root rot South Africa McLeod et al. (2009) P. perplexum H. Kouyeas & Theoh* Pythiaceae P Root rot South Africa McLeod et al. (2009) P. pyrilobum Vaartaja* Pythiaceae P Root rot South Africa McLeod et al. (2009) P. recalcitrans Belbahri & E. Moralejo* Pythiaceae P Root rot South Africa Moralejo et al. (2008) P. rostratifingens De Cock & Lévesque* Pythiaceae P Root rot South Africa McLeod et al. (2009) P. rostratum E.J. Butler Pythiaceae P Root rot Australia Cook and Dubé (1989) P. spinosum Sawada* Pythiaceae P Root rot Australia, South Africa Shivas (1989), McLeod et al. (2009) P. splendens Hans Braun Pythiaceae P Root rot Malaysia Liu (1977) P. sylvaticum W.A. Campb. & F.F. Hendrix P. torulosum Coker & P. Patt.* Pythiaceae P Root rot South Africa Gorter (1977) Pythiaceae P Root rot South Africa McLeod et al. (2009) P. ultimum Trow Pythiaceae P Root rot Australia, New Zealand, South Africa Cook and Dubé (1989), Shivas (1989), Gadgil (2005) P. vanterpoolii V. Kouyeas & H. Kouyeas* Pythiaceae P Root rot South Africa McLeod et al. (2009) 123 58 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Disease caused Locality References P. vexans de Bary Pythiaceae P Root rot Malaysia Liu (1977) P. viola Chesters & Hickman* Pythiaceae P Root rot South Africa McLeod et al. (2009) Pythium sp.* Pythiaceae P, S Root rot Australia, China, USA Alfieri Jr. et al. (1984, French (1989), Castillo-Pando et al. (2001), This study Ramularia khandalensis Patw. & A.K. Pande Mycosphaerellaceae P, E Leaf spot India Sarbhoy et al. (1971) R. mali Videira & Crous* Mycosphaerellaceae P, E Leaf spot Iran Bakhshii and Arzanlou (2017) R. vitis (Richon) U. Braun Mycosphaerellaceae P, E Leaf spot Armenia, Australia, Caucasus, Europe, France Braun (1998) Rhabdospora ampelina (Thüm.) Sacc. Dothideomycetes genera incertae sedis P Stem, leaf spot Japan Kobayashi (2007) R. labruscae Gonz. Frag. Dothideomycetes genera incertae sedis P Stem, leaf spot Spain Gonzalez Fragoso (1917) R. mueggenburgii (Pirotta) Sacc. Dothideomycetes genera incertae sedis P Stem, leaf spot Poland Mulenko et al. (2008) R. vitis Koshk. & Frolov Dothideomycetes genera incertae sedis P Stem, leaf spot Central Asia Koshkelova and Frolov (1973) Rhinocladiella atrovirens Nannf. Herpotrichiellaceae E Spain Gonzalez and Tello (2011) Rhizoctonia solani J.G. Kühn Ceratobasidiaceae P, E Root rot South Africa, Spain, USA Marais (1979), Alfieri Jr. et al. (1984, Halleen et al. (2003), Gonzalez and Tello (2011) Rhizoctonia sp.* Ceratobasidiaceae P, E Root rot Australia, Chili, Mexico, Switerzland Mujica and Vergara (1945), Alvarez (1976), CastilloPando et al. (2001), Casieri et al. (2009) Rhizopus arrhizus A. Fisch. Rhizopodaceae P, E Bunch rot USA French (1987, 1989) R. oryzae Went & Prins. Geerl.* Rhizopodaceae S China This study, Jayawardena et al. (2018) R. stolonifer (Ehrenb.) Vuill.* Rhizopodaceae P, E Bunch rot Australia, Cuba, Japan, SouthAfrica, Spain, Switzerland Gorter (1977), Urtiaga (1986), Cook and Dubé (1989), Witbooi et al. (2000), Kobayashi (2007), Casieri et al. (2009), Gonzalez and Tello (2011) Rhizopus sp.* Rhizopodaceae P, E Bunch rot France, Italy, Switzerland Castillo-Pando et al. (2001), Casieri et al. (2009), Mondello et al. (2013) Rhodosporidium sp.* Sporidiobolales genera incertae sedis Sporidiobolales genera incertae sedis S China This study S China This study Robillarda vitis Prill. & Delacr. Sporocadaceae E France Nag Raj (1993) Roesleria pallida (Pers.) Sacc. Roesleriaceae P Japan Kobayashi (2007) Rhodotorula sp.* 123 Root rot Fungal Diversity (2018) 90:1–84 59 Table 6 (continued) Species Family Life mode Disease caused Locality References R. subterranea (Weinm.) Redhead* Roesleriaceae P Root rot Italy, USA Kepley et al. (2015) Rosellinia akulovii L.E. Petrini Xylariaceae S France Petrini (2013) R. amblystoma Berl. & F. Sacc. Xylariaceae S Portugal Unamuno (1941) R. aquila (Fr.) De Not. Xylariaceae S R. necatrix Berl. ex Prill. Xylariaceae P France Petrini (1992) Bulgaria, France, Greece, Italy, Japan, Mexico, Ukraine Poland Alvarez (1976), Greuter et al. (1991), Holevas et al. (2000), Dudka et al. (2004), Kobayashi (2007), Bobev (2009), Petrini (2013) Mulenko et al. (2008) R. rosarum Niessl Xylariaceae S Sarocladium strictum (W. Gams) Summerb. Hypocreales genera incertae sedis E Spain Gonzalez and Tello (2011) Schizophyllum commune Fr. Schizothyriaceae P White rot on already dead parts of grapevine trunks Greece Zervakis et al. (1998) Schizothyrium pomi (Mont.) Arx, Schizothyriaceae P White rot on already dead parts of grapevine trunks Japan, USA Anonymous (1960), Kobayashi (2007) Sclerostagonospora sp. Phaeosphaeriaceae P Portugal Phillips (2000) Sclerotinia sclerotiorum (Lib.) de Bary* Sclerotiniaceae P, E Excoriose and cane blight Shoot blight Australia, Chile, Greece, Japan, Mexico, New Zealand, Spain, Switzerland, USA French (1989), Shivas (1989), Latorre and Guerrero (2001), Casieri et al. (2009), Gonzalez and Tello (2011), Ferrada et al. (2014) Sclerotium echinatum Fuckel Sclerotiniaceae P Shoot blight Poland Mulenko et al. (2008) S. rolfsii Sacc. Sclerotiniaceae P Shoot blight Japan, USA French (1987, 1989), Kobayashi (2007) Sclerotium sp. Sclerotiniaceae P Shoot blight Thailand Giatgong (1980) Scolicotrichum vitiphyllum (Speschnew) Karak. & Vassiljevsky Ascomycota genera incertae sedis P Shoot blight Central Asia Koshkelova and Frolov (1973) Scopulariopsis sp.* Microascaceae S China This study Scytinostroma alutum Lanq. Lachnocladiaceae P, S Root rot France Boidin and Lanquetin (1987) Seimatosporium botan Sat. Hatak. & Y. Harada* Sporocadaceae P Trunk disease Chile Diaz et al. (2012) S. hysterioides (Fuckel) Brockmann* Sporocadaceae P Trunk disease Australia, England, France, Greece, Germany, Italy Nag Raj (1993), Sergeeva et al. (2005) S. lichenicola (Corda) Shoemaker & E. Müll. Sporocadaceae P Trunk disease Australia Cook and Dubé (1989), Shivas (1989) S. lonicerae (Cooke) Shoemaker Sporocadaceae P Trunk disease Australia Shivas (1989) White root rot 123 60 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Disease caused Locality References S. parasiticum (Dearn. & House) Shoemaker Sporocadaceae P Trunk disease Germany, Pakistan Sutton (1980), Ahmad et al. (1997) S. vitis P. Xiao, Camporesi & K.D. Hyde* Sporocadaceae P, S Trunk disease Hungary, Italy Senanayake et al. (2015), Váczy (2017), This study, Jayawardena et al. (2018) Seiridium cupressi (Guba) Boesew. Selenophoma sp. Sporocadaceae P Trunk disease China Teng (1996) Saccotheciaceae E Spain Gonzalez and Tello (2011) Septobasidium tanakae (Miyabe) Boedijn & B.A. Steinm. Septobasidiaceae P Japan Kobayashi (2007) Septoria ampelina Berk. & M.A. Curtis Mycosphaerellaceae P Leaf spot Bulgaria, Italy, Mexico, Romania, Ukraine Radulescu et al. (1973), Alvarez (1976), Greuter et al. (1991), Vanev et al. (1997), Dudka et al. (2004), Bobev (2009) S. badhamii Berk. & Broome Mycosphaerellaceae P Leaf spot Japan, Romania, UK Watson (1971), Radulescu et al. (1973), Kobayashi (2007) S. melanopsis Pat. Mycosphaerellaceae P Leaf spot Brazil, Italy, Kenya, Tunisia, UK Nattrass (1961), Watson (1971) S. vitis Schulzer Mycosphaerellaceae P Leaf spot Australia Priest (2006) S. vineae Pass. Mycosphaerellaceae S Romania Watson (1971), Radulescu et al. (1973) Septoriella allojunci W.J. Li, Camporesi, D.J. Bhat & K.D. Hyde* Phaeosphaeriaceae S China This study, Jayawardena et al. (2018) Simplicillium sp.* Cordycipitaceae S China This study Sordaria fimicola (Roberge ex Desm.) Ces. & De Not.* Sordariaceae S Switzerland Casieri et al. (2009) Sordaria sp. Sordariaceae E Spain Gonzalez and Tello (2011) Spencermartinsia plurivora Abdollahz., Javadi & A.J.L. Phillips* Botryosphaeriaceae P Canker/die back Australia, Spain Pitt et al. (2015) S. viticola (A.J.L. Phillips & J. Luque) A.J.L. Phillips, A. Alves & Crous* Botryosphaeriaceae P Canker/die back Australia, France, South Africa, Spain, USA Luque et al. (2005), ÚrbezTorres et al. (2007), de Wet et al. (2009), Qiu et al. (2011), Úrbez-Torres (2011), Diaz et al. (2013), Pitt et al. (2013, 2015), Li et al. (2014), Carlucci et al. (2015), Pavlic-Zupanc et al. (2015), Valencia et al. (2015), Comont et al. (2016), Coutinho et al. (2017), Lawrence et al. (2017b) S. westrale W.M. Pitt, J.R. Úrbez-Torres & Trouillas* Botryosphaeriaceae P Canker/die back Australia Pitt et al. (2015) Spencermartinsia sp. Botryosphaeriaceae P Canker/die back Spain Gonzalez and Tello (2011) Sphaeropsis ampelos (Schwein.) Cooke Botryosphaeriaceae P Canker/die back China Teng (1996) 123 Fungal Diversity (2018) 90:1–84 61 Table 6 (continued) Species Family Life mode Disease caused Locality References S. peckiana Thüm. Botryosphaeriaceae P Canker/die back Italy Greuter et al. (1991) S. porosa (Van Niekerk & Crous) A.J.L. Phillips & A. Alves Botryosphaeriaceae P Canker/die back South Africa van Niekerk et al. (2004a, b, 2006), Phillips et al. (2005), Luque et al. (2005), de Wet et al. (2009), Úrbez-Torres (2011) Sphaeropsis sp. Botryosphaeriaceae P Canker/die back Greece Holevas et al. (2000) Spiromastix sp.* Spiromastigaceae S China This study Spiromyces sp.* Kickxellaceae S China This study Sporoschisma ampullula Sacc. Chaetosphaeriaceae S Yugoslavia Nag Raj and Kendrick (1975) Sporocadus rhododendri (Schwein.) M. Morelet* Amphisphaeriaceae P Cane lesions Australia Sergeeva et al. (2005) Stagonospora bulgarica Vanev Phaeosphaeriaceae P Leaf spot Bulgaria Vanev et al. (1997) Stachybotrys sp.* Stachybotryaceae S China This study Stemphylium viticola Pass. Pleosporaceae E Poland Mulenko et al. (2008) Stemphylium sp. Pleosporaceae E Spain Gonzalez and Tello (2011) Stereum hirsutum (Willd.) Pers.* Stereaceae P Bulgaria, France, Greece, Spain Larignon and Dubos (1997), Zervakis et al. (1998), Bobev (2009), Luque et al. (2009), Cloete et al. (2015) Esca Stereum sp. Stereaceae P Esca USA French (1989) Stigmina esfandiarii Petr. Mycosphaerellaceae P Leaf spot Iran, Pakistan Esfandiari and Petrak (1950), Khan and Kamal (1974) Strickeria sylvana (Sacc. & Speg.) Cooke Sporocadaceae S Poland Mulenko et al. (2008) S. trabicola (Fuckel) G. Winter Sporocadaceae S Central Asia Koshkelova and Frolov (1973) Stromatoneurospora sp.* Xylariales genera incertae sedis S China This study Talaromyces amestolkiae N. Yilmaz, Houbraken, Frisvad & Samson* Trichocomaceae S China This study, Jayawardena et al. (2018) T. pinophilus (Hedgc.) Samson, N. Yilmaz, Frisvad & Seifert* Trichocomaceae S China This study, Jayawardena et al. (2018) T. purpureogenum Stoll* Trichocomaceae S China Talaromyces sp.* Trichocomaceae S China This study, Jayawardena et al. (2018) This study, Jayawardena et al. (2018) Terana coerulea (Lam.) Kuntze Phanerochaetaceae P Wood decay USA Campbell et al. (1950), Hanlin (1966) Tetracoccosporium sp. Ascomycota genera incertae sedis Ceratobasidiaceae P Root stock disease South Africa Halleen et al. (2003) China Tai (1979) Thanatephorus cucumeris (A.B. Frank) Donk S 123 62 Fungal Diversity (2018) 90:1–84 Table 6 (continued) Species Family Life mode Thaxteriella pezizula (Berk. & M.A. Curtis) Petr. Tubeufiaceae S Thelonectria olida (Wollenw.) P. Chaverri & Salgado Nectriaceae P Thielavia sp. Tilletiopsis minor Nyland* Chaetomiaceae Exobasidiomycetidae incertae sedis T. washingtonensis Nyland Disease caused Locality References USA Hanlin (1963) Uruguay Abreo et al. (2012) S S China British Colombia, Canada This study Urquhart et al. (1997) Exobasidiomycetidae incertae sedis S Japan Urquhart et al. (1997) Tomentella atramentaria Rostr. Thelephoraceae S Spain Hernandez (2004) T. bryophila (Pers.) M.J. Larsen Thelephoraceae S Spain Hernandez (2004) Black foot disease Tomentella sp.* Thelephoraceae E China Dissanayake et al. (2018) Torula viticola Allesch. Torulaceae E USA Saccardo (1878) Torula sp. Torulaceae E Spain Gonzalez and Tello (2011) Toxicocladosporium sp.* Cladosporiaceae E China Dissanayake et al. (2018) Trametes zonata (Nees) Pilát Polyporaceae S New Zealand Cunningham (1965) Trichocladium asperum Harz* Chaetomiaceae E, S Russia, Switzerland Melnik and Popushoi (1992), Casieri et al. (2009) Trichoderma atroviride P. Karst.* Hypocreaceae S China This study, Jayawardena et al. (2018) T. aureoviride Rifai Hypocreaceae E Spain Gonzalez and Tello (2011) T. koningii Oudem. Hypocreaceae S Russia Melnik and Popushoi (1992) T. harzianum Rifai* Hypocreaceae E, S China, Spain Gonzalez and Tello (2011), This study, Jayawardena et al. (2018) T. lixii (Pat.) P. Chaverri* Hypocreaceae S China This study, Jayawardena et al. (2018) T. parapiluliferum (B.S. Lu, Druzhin. & Samuels) Jaklitsch & Voglmayr* Hypocreaceae S Switzerland Casieri et al. (2009) Trichoderma sp.* Hypocreaceae E South Africa, Spain, Switzerland Fourie and Halleen (2002), Casieri et al. (2009), Gonzalez and Tello (2011) Trichothecium roseum (Pers.) Link* Hypocreales genera incertae sedis P Australia, China, Greece, India, Japan, Korea Alexopoulos (1940), Tai (1979), Shivas (1989), Sharma and Agarwal (1997), Kobayashi (2007), Oh et al. (2014), This study Trullula melanochlora (Desm.) Höhn. Leotiomycetes genera incertae sedis P France, Portugal Phillips (2000) Truncatella angustata (Pers.) S. Hughes* Sporocadaceae P, E France, Iran, Portugal, Spain, Switzerland Nag Raj (1993), Casieri et al. (2009), Gonzalez and Tello (2011), Arzanlou et al. (2013), Maharachchikumbura et al. (2016) 123 Berry rot Fungal Diversity (2018) 90:1–84 63 Table 6 (continued) Species Family Life mode T. pitospora (M.E.A. Costa & Sousa da Câmara) Bissett Sporocadaceae Typhula viticola (Peck) Berthier Disease caused Locality References P Portugal Nag Raj (1993) Typhulaceae S USA Berthier (1976) Ulocladium sp. Pleosporaceae E South Africa, Spain Umbelopsis isabellina (Oudem.) W. Gams* Mucoraceae S Switzerland Halleen et al. (2003), Gonzalez and Tello (2011) Casieri et al. (2009) Valsaria insitiva (Tode) Ces. & De Not. Valsariaceae P Portugal, Spain Phillips (2000), Unamuno (1941) Verticillium ahlia Kleb.* Plectosphaerellaceae P China, Japan, USA French (1989), Kobayashi (2007), Zhang et al. (2009) Verticillium sp. Plectosphaerellaceae P Mexico Alvarez (1976) Verpa bohemica (Krombh.) J. Schröt* Morchellaceae E Switzerland Casieri et al. (2009) Volutella sp.* Nectriaceae S China This study Xeromyces bisporus L.R. Fraser* Aspergillaceae S Australia Pettersson et al. (2011) Xerotus viticola Berk. & M.A. Curtis Polyporaceae S USA Berkeley (1872) Xylaria arbuscula Sacc. Xylariaceae S Taiwan Ju and Rogers (1999) Xylaria hypoxylon (L.) Grev. Xylariaceae E Spain Gonzalez and Tello (2011) Xylaria sp.* Xylariaceae S China This study Zetiasplozna thuemenii (Speg.) Nag Raj Sporocadaceae S Italy Nag Raj (1993) Life mode—P pathogen, E endophyte, S saprotroph, M mycoparasitic on powdery mildew fungi, OP opportunisitic pathogen and U unknown *Identification is confirmed by molecular data in the studies. The records are taken from the literatures and thus may not be correct and the same taxon could be listed more than once. It would be necessary to re -examine all collections if available to confirm their identities. Even the molecular data may be needed to establish their correct names but this was shown not to be accurate (Ko et al. 2011). The most recent studies on fungal pathogens of grapevine have incorporated multigene analysis to accurately resolve taxa (Dissanayake et al. 2015; Jayawardena et al. 2015; Yan et al. 2015; Chethana et al. 2017). Most previous studies did not address the total community of fungi on Vitis vinifera. Pancher et al. (2012) carried out an extensive study on endophytes on this host, showing that how various anthropic and nonanthropic factors shape microbial communities. There have been extensive studies on the disease causing agents with more than 150 taxa known to cause various diseases of grapevine. For example, Colletotrichum species cause grape ripe rot of Vitis vinifera worldwide (Jayawardena et al. 2016b). There have however, been no investigation on the saprobes of grapevines using molecular identification and there has been no study using mycobiome analysis to reveal saprotrophic communities. The study of saprotrophs is important, as they not only decay dead leaves and branches, thus beneficial recyclers, but they may also become pathogens when conditions are suitable. This study therefore fills this void by establishing the saprotrophic fungi on Vitis vinifera using both traditional and culture-independent approaches. In this study we did not obtain similar results from the two methods. In the traditional method, 45 species belonging to 30 genera were identified (Table 2), while in culture-independent method 226 OTUs’ and 72 genera were identified. Even though we isolated directly from the fruiting bodies, some fungi were not able to grow on media. Several single spore isolations were unsuccessful. This may be due to the availability of nutrient content, pH, temperature, and presence of inhibitors and the time of incubation. The number of isolates obtained was less than the actual fungal community and can be misinterpreted (Hugenholtz et al. 1998). These conditions make it difficult to accurately identify and 123 64 document the vast number of unrecognized taxa (Lücking and Moncada 2017). For example, in this study the total identified taxa from the traditional method were 45. Therefore, to overcome the constraints of traditional methods, culture-independent techniques are proposed as an alternative technique (Hoppe et al. 2016). The aim of environmental sequence nomenclature is to place names of species of fungi that would otherwise be left undescribed (Lücking and Moncada 2017). These techniques can provide sequence reads almost 1000 times more than the traditional DNA sequencing methods (Lücking and Moncada 2017). Lücking and Moncada (2017) showed that a formally recognized unnamed lichenicolous basidiomycete can be considered as a new genus, with seven new species, although there is no physical type specimens are available. These authors also suggested that this would allow the recognition of thousands of species of voucher less taxa detected through environmental sequencing techniques. However, there are several constrains to NGS methods. DNA may not be recovered from all genotypes and the results of NGS can be biased towards the most abundant organisms at the time of sampling (Ward et al. 1990). The reason for this is that the relative abundance (Fig. 5) of microbial species in a natural habitat is rarely equal. Usually, with a few species being predominant among a larger group of common species makes it difficult to identify the species that are actually present. NGS are mainly based on analysis of ITS regions (Schoch et al. 2012). However, due to the high variability of ITS regions (ITS1 and ITS2), reliable sequence alignments are difficult to obtain for some fungal taxa. Therefore, this method is not reliable for species level identification. The identification levels are usually reported at the genus level or Fig. 5 Relative abundance of the top 10% phylum from different samples of the cultivars Carbanate Gernischet and Red Globe of Vitis vinifera 123 Fungal Diversity (2018) 90:1–84 even higher taxonomic levels, such as family or order (Purahong et al. 2018). Another constraint of NGS is that the correspondence of OTU with species can be unreliable. OTUs are defined based on the similarity threshold, usually with a 97% (Sneath and Sokal 1973). However, some species have genes that are 97% similar, which will result in merged OTUs containing multiple species. In the same way, a single species may have paralogs that are \ 97% similar, causing the species to be split across two or more species. Some identified clusters, even when a majority, may be false, due to the artifacts including reading errors and chimeras (Sneath and Sokal 1973). Assessing species richness and diversity of a microbial community using culture-independent method (rarefaction curves), suggests that OTUs are observations of organisms with ‘negligible error’. Also, it suggests that the number of reads correlates well with the total number of individuals present in the community. However, if the majority of OTUs are experimental artifacts, the traditional species richness estimations cannot be applied. The measures between sample variations will tend to reflect differences in artifact frequencies rather than biological differences (Sokal and Sneath 1963). Artifacts can be occurred due to several reasons. PCR amplification steps can be affected by preferentially/differentially that can hinder the detection of some genotypes when analysing bulk DNA extracts from a substrate (Kanagawa 2003). Primer mismatches, a lower rate of primer hybridization, occurrence of heteroduplexes and chimeric amplicons can generate additional signals that do not correspond to the genotypes in the same samples (Suzuki and Giovannoni 1996; Kanagawa 2003). Also, the Fungal Diversity (2018) 90:1–84 analysis of fungal rRNA genes limits identification to the genus or family level (Anderson and Cairney 2004). Dissanayake et al. (2018) in her study using paired-end Illumina sequencing with 55, 822 high quality sequences per endophyte sample (saturated rarefaction curves for all samples) revealed 59 OTUs (the majority containing genera level identification) that were similar to genera revealed by the traditional method (28 species). Traditional versus culture-independent methods: can matching of these two approaches enable us to identify correct fungal taxonomic information at genus and species levels? In this study, taxa (OTUs) of Aspergillus, Botrytis, Cladosporium, Clonostachys, Fusarium, Penicillium, Phoma and Talaromyces were identified using both traditional and culture-independent approaches. Some fast growing fungi may be dominant in the culture plates, even though in the natural habitat they may be minorities. Many hyphomycetes tend to grow faster than the other groups of fungi. So, they may suppress the growth of other important, dominant fungi. The fast growing fungi (hyphomycetes) identified in the traditional method such as Mucor and Rhizopus were not recognized in the culture-independent method. The majority of the genera identified in the traditional method are phytopathogens, while in the culture-independent method the majority are saprotrophs. In the traditional method using both morphological and molecular approaches, we were able to identify many taxa to species level, although in six cases the identification is only up to the genus level due to lack of data. We have generated a phytogenetic tree for the genus Colletotrichum using the strains identified in the traditional approach as well as the OTU identified in the culture-independent method. OTU-234, was identified as Glomerellaceae sp. in the culture-independent approach. The blastn result of OTU-234 in NCBI shows 100% similarity to many strains of C. gloeosporioides. Two-hundred and fifteen basepairs of OTU-234 were used in the alignment (Supplementary Fig. S6). In the phylogenetic tree constructed using the ex-type strains of gloeosporioides complex and the truncatum complex, OTU-234 cluster within the truncatum complex, closely to C. curcumae (Supplementary Fig. S7). This example also provides evidence that the NGS sequences is not reliable to identify an organism to the species level. However, in the culture-independent technique we were able to identify 90 out of 226 OTUs to species level, and the rest were identified to genera or family level. These may not be correctly identified as in general NGS fungal taxa identification may be only accurate to the genus level (Purahong et al. 2018), which suggests that the sequence data from the cultureindependent approach is inadequate to accurately identify species. The overlap between the two methods in identifying the taxa to the species level is negligible. 65 Matching between the traditional and culture-independent data allows us to have a better understanding concerning the functional information of the fungal OTUs resulting from culture-independent methods. Next generation sequencing often results in sequences that are associated with taxa, which have not been reported in previous studies (Tejesvi et al. 2010; Ko et al. 2011; Taylor et al. 2016). However, as most of these OTUs are identified to genus or family level, it makes it difficult to relate whether these are actually correctly identified and whether the use of this method is important. In the preparation of the checklist of fungi on Vitis species, the authors had to eliminate most of the taxa that were identified using NGS, as those data can be unreliable. In our study, we compared the sequence similarity between the two cultivars using a 90% similarity of ITS1 sequence data, followed by a manual BLAST based identification of the respective OTUs. We considered the ITS similarity at 98–99% as the same species (Garnica et al. 2016; Jeewon and Hyde 2016). In this criterion, identification of genera can be bias/difficult as some of the data in databases have mistakes or they may be inaccurate. The increase of the ITS similarity to 99–100% can give us better and reliable identification of the species. However, ITS sequence data alone will not be able to identify the complexes genera such as Colletotrichum and Diaporthe to their species level. For a better resolution of these genera protein coding gene regions are required. Can direct matching between traditional and culture-independent methods help to identify the rare taxa? Our results show that some singletons, which were usually removed as artifacts or errors of the NGS may actually be real OTUs. In this study, we found two OTUs (Botryospaeria OTU-178 and Ascomycota OTU-213) as singletons and removed them from the analysis. However, with direct matching, we found that these OTUs are Botryospaeria dothidea and Coniella vitis. Therefore, we can assume that not all the singletons are artifacts and matching between traditional and culture-independent methods can help to identify the real rare taxa in the fungal community. Potential effect of grape cultivars (table grape (Red Globe) and wine grape (Carbanate Gernischet) on fungal saprotrophic community composition and richness Another aspect of this study was to study whether there is any difference in the fungal communities based on cultivars. In the present study, traditional and culture-independent approaches allows the identification of potential roles of the saprotrophs in the two grapevine cultivars. In this study we identified more than 10 main and important 123 66 fungal pathogens of grapevine using both methods. With the evaluation of both community composition and community diversity we were able to identify that the fungal communities of the two grape cultivars appear to be different. Alternaria vitis, Albifrimbria viridis, Bipolaris maydis, Botryosphaeria dothidea, Botrytis cinerea, Colletotrichum hebeinse, C. truncatum, C. viniferum, Didymella pomorum, Dothiorella sarmentorum, Epiccocum nigrum, Fusarium sp., Mucor circinelloides, Paraphoma chrysanthemicola, Neopestalotiopsis clavispora, Stagonosporopsis sp.1, Minimedusa sp., Peniophora sp., Penicillium brevicompactum and P. citrinum were recorded only from Red Globe cultivar while Albifimbria verrucaria, Neopestalotiopsis vitis, Pythium amasculinum, Stagonosporopsis sp.2, Trichoderma lixii and Septoriella allojunci were recorded from Carbanate Gernischet cultivar in the traditional method. In the culture-independent approach, Acremonium chrysogenum (OTU-195), Apodus sp. (OTU-235), Ascomycota (OTU-80, 99, 182, 222, 253), Aspergillus sp. (OTU-116, 199), Candida mucifera (OTU227), Cylindrocarpon sp. (OTU-171), Dactylellina phymatopaga (OTU-58), Davidiella tassiana (OTU-86), Deroxomyces sp. (OTU-225), Fungal (OTU-245, 254), Fusarium cf. dimerum (OTU-162), Helotiales (OTU-91), Hypocreales (OTU-65), Kernia nitida (OTU-184), Kernia pachypleura (OTU-211), Lecanicilium dimorphum (OTU101), Lentinus squarrosulus (OTU-249), Lophiostoma sp. (OTU-142), Microascales (OTU-138), Metarhizium pinghaense (OTU-210), Myceliophthora fergusii (OTU-198), Myrothecium sp. (OTU-238), Nectriaceae (OTU-97, 194), Papulospora equi (OTU-148), Phialosimplex caninus (OTU-187), Psathyrellaceae (OTU-145), Pseudallescheria angusta (OTU-183), Pyronemataceae (OTU-237), Remersonia sp. (OTU 108), Sordariomycetes (OTU-128), Sordariales (OTU-196, 200, 214), Xylaria sp. (OTU-159) were found only in association with the Red Globe cultivar while Acremonium sp. (OTU-188), Apllosporella yalgorensis (OTU-85), Arachnomyces kanei (OTU-170), Aspergillus melleus (OTU-143), Aspergillus wentii (OTU-175), Cadophora luteo-olivaceae (OTU-146), Ceratobasidiaceae (OTU-219), Chaetomium carinthiacum (OTU-177), Chysisporium lobatum (OTU-150), Cladosporium grevilleae (OTU-121), Dothideomycetes (OTU-140), Eurotiales (OTU-76), Fungal (OTU-82, 104, 165), Gymnascella aurantiaca (OTU-151), Hansfodia sp. (OTU-232), Hypocreales (OTU-49, 92, 202), Lasiophaeriaceae (OTU189), Leptosphaeria sp. (OTU-205), Magnoporthaceae (OTU- 141, 149), Microascales (OTU-114), Microascus sp. (OTU-185), Microdochium sp. (OTU-225), Nectriaceae (OTU-218), Penicillium ilerdanum (OTU-163), Penicillium neocrassum (OTU-168), Podospora communis (OTU190), Scopulariopsis sp. (OTU-164), Sordariales (OTU133), Spiromastix princeps (OTU-139), Thielavia basicola 123 Fungal Diversity (2018) 90:1–84 (OTU-155), Trichomaceae (OTU-156, 166) were recorded on from Carbanate Gernischet cultivar. The difference of the two fungal communities can be due to the geographic variation of the cultivars. This can be a result from the interactions with specific V. vinifera varieties and its soil and climatic conditions (Bokulich et al. 2014). Red Globe cultivar was collected in Beijing, which is a region in North of China and Carbanate Gernischet cultivar was collected from Yunnan which is in the southern part of the country. The difference between the fungal communities in regions may be a function of a neutral process, where these different communities established by chance and lack of species dispersal allows these communities to persist (Martiny et al. 2006). This difference can also be due to the Baas Becking hypothesis, which states that there is no limit to the range of species but that selection sorts these species and defines community composition and diversity in any one area (Hanson et al. 2012). Climate can also co-relates with differences in fungal communities in China, as one moves North up in China, the climate becomes increasingly cold and dry so the pattern of lower fungal species richness in the northern most regions hints that selection might have a role in determining these patterns. Plant pathogens and endophytes in the saprotrophic fungal community Species richness and distribution patterns of saprotrophic fungi in a vineyard can provide important insights into the roles of each fungal group for the stability and functioning of its respective ecosystem (Kubartova et al. 2012). However, knowledge of saprotrophic fungi associated with grapevine is very much limited. In this study, we identified 17 primary and six species of secondary pathogens of grapevine as saprobes using the traditional method, while 27 OTUs were identified as both primary and secondary pathogens from dead material of Vitis vinifera in the culture-independent method. Species of Alternaria are responsible in causing berry rots, raisin molds and rots as well as pedicel and rachis diseases (Barbe and Hewitt 1965; Gonzalez and Tello 2011; Tao et al. 2014, Ariyawansa et al. 2015) and also considered as wound and secondary invaders. Alternaria alternata and A. vitis were isolated in this study. Aspergillus is a causal agent of berry rots as well as a wound and secondary invader (Hewitt 2015). In our study A. aculeatus and A. niger were recorded using the traditional method, while A. aculeatus was also recorded from culture-independent method. Botryosphaerious taxa are well-known to be associated with grapevine canker and die back (ÚrbezTorres et al. 2012, 2013a, b). In our study we identified Botryosphaeria dothidea and Dothiorella sarmentorum as Fungal Diversity (2018) 90:1–84 saprotrophs using traditional methodology. Lasiodiplodia was recorded in the culture-independent method. Botrytis is another genus that we obtained in both traditional and independent approaches. Botrytis cinerea is a pathogen of grapevine causing Botrytis bunch rot and blight all over the world (Fournier et al. 2013; Hyde et al. 2014; Javed et al. 2017). Cladosporium was also recorded in both approaches. Species of this genus cause minor foliage diseases of grapevine, as well as bunch rots (Bensch et al. 2015). Clonostachys is another genus recorded in both approaches. Clonostachys rosea is known to cause root rot of grapevine in Switzerland (Casieri et al. 2009). Colletotrichum hebeiense, C. truncatum and C. viniferum were recorded in the traditional method. Species of this genus cause grape ripe rot affecting the quality and production of grapevine (Yan et al. 2015). Diaporthe eres is another pathogen of grapevine causing die back (Lawrence et al. 2015; Baumgartner et al. 2013; Cinelli et al. 2016; Fischer et al. 2016; Bastide et al. 2017), which was recorded via the traditional methodology as well as via the culture-independent approach. Species of Fusarium cause wilt disease of grapevine (Castillo-Pando et al. 2001; Gonzalez and Tello 2011). This genus was recorded in both approaches. Neopestalotiopsis vitis recorded from traditional method is a pathogen causing fruit rot, die back and leaf spots of grapevine (Jayawardena et al. 2015, 2016a). Coniella vitis is a pathogen causing white rot of grapes, identified using traditional methods (Chethana et al. 2017). Species of Penicillium are wound and secondary pathogens of grapevines causing bunch rot (Kim et al. 2007). Rhizopus oryzae is another wound and secondary pathogen causing bunch rots of grapevines (Hewitt 2015). Several genera were identified only in the culture-independent method. Aplosporella is known to cause lesions on grapevine stems in China (Tai 1979). Claviceps is known to be a pathogen on grasses and cereals, but has not been recorded as a pathogen of grapevine (Mey et al. 2002). Therefore, this study provides the first record of this genus on V. vinifera. Cylindrocarpon species are known to cause the black foot disease of grapevine (Abreo et al. 2010, 2012; Mohammadi et al. 2013a, b). Devriesia is a facultative pathogen, but there are no records of this species on V. vinifera (Seifert et al. 2004). Therefore, this study provides the first record of this genus on V. vinifera. Species of Leptosphaeria has been reported as endophytes and saprotrophs of grapevine (Crane and Shearer 1991). However, some species of this genus can be pathogenic to some economically important crops (Fitt et al. 2006). Monographella is a known leaf pathogen on rice, barley, maize and wheat (Daamen et al. 1991; Hock et al. 1992; Tatagiba et al. 2015). However, there are no records of species of this genus associated with grapevine. Therefore, this study provides the first record of Monographella 67 associated with grapevine. Species of Phaeoacremonium are causal agents of Esca disease around the world (Garcia-Benavides et al. 2013). Species of Trichothecium are known to cause berry rot of grapevine, but this is not considered as a major pathogen on grapevine (Oh et al. 2014). Even though genus Volutella is a facultative pathogen causing leaf spot and cankers (Henricot et al. 2000; Shi and Hsiang 2014), there is no record of this genus occurring on grapevine. Therefore, this study provides the first record of Volutella associated with V. vinifera as a saprotroph. Among the 45 identified saprotrophic taxa, 17 are well known pathogens of Vitis vinifera causing severe yield as well as economic losses to viticulture worldwide (Table 2). Six secondary pathogens of were also identified in this study. Most of the pathogens tend to survive or overwinter on dead plant material as saprotrophs and act as the primary inoculums once the conditions are favourable (Armijo et al. 2016). Many studies have shown that most pathogenic fungi can survive unsuitable conditions, such as cold during the winter, by changing their life mode to saprotrophs, and become active pathogens again once the conditions are suitable. Therefore, dead plant materials are the potential primary inocula for plant pathogens in vineyards. In order to avoid this problem, vineyards must be kept clean. If there are any dead grapevines they must be removed and if possible should be burned. This will reduce the pathogenic fungi from year to year. Checklist of fungi on Vitis Nine-hundred and five micro- and macro- fungal taxa reported on Vitis species are listed in this study. This is an updated worldwide checklist of fungi on Vitis. These taxa are distributed in 156 families and 343 genera. For each species, family, life mode, diseases caused and the known locality as well as references are provided. Acknowledgements This work was financially supported by Beijing Talent Programm for Jiye Yan, CARS-29 and JNKYT201605. Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://crea tivecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. References Abad ZG, Abad JA, Cacciola SO, Pane A, Faedda R, Moralejo E, Perez-Sierra A, Abad-Campos P, Alvarez-Bernaola LA, Bakonyi J, Jozsa A, Herrero ML, Burgess TI, Cunnington JH, Smith IW, Balci Y, Blomquist C, Henricot B, Denton G, Spies C, McLeod 123 68 A, Belbahri L, Cooke D, Kageyama K, Uematsu S, Kurbetli I, Degirmenci K (2014) Phytophthora niederhauserii sp. nov., a polyphagous species associated with ornamentals, fruit trees and native plants in 13 countries. Mycologia 106:431–447 Abreo E, Martinez S, Bettucci L, Lupo S (2010) Morphological and molecular characterization of Campylocarpon and Cylindrocarpon spp. associated with black foot disease of grapevines in Uruguay. Australas Plant Pathol 39:446–452 Abreo E, Lupo S, Bettucci L (2012) Fungal community of grapevine trunk diseases: a continuum of symptoms? Sydowia 64:1–12 Agusti-Brisach C, Pérez-Sierra A, Garcı́a-Figueres F, Montón C, Armengol J (2011) First report of dampingoff caused by Cylindrocarpon pauciseptatum on Pinus radiata in Spain. Plant Dis 95:874 Agusti-Brisach C, Alaniz S, Gramaje D, Perez-Sierra A, Armengol J (2012) First report of Cylindrocladiella parva and Cylindrocladiella peruviana associated with black-foot disease of grapevine in Spain. Plant Dis 96:1381 Agusti-Brisach C, Cabral A, Gonzalez-Dominguez E, Perez-Sierra A, Leon M, Abad-Campos P, Garcia-Jimenez J, Oliveira H, Armengol J (2016) Characterization of Cylindrodendrum, Dactylonectria and Ilyonectria isolates associated with loquat decline in Spain, with description of Cylindrodendrum alicantinum sp. nov. Eur J Plant Pathol 145:103–118 Ahmad S (1969) Fungi of West Pakistan. Biol Soc Pak Monogr 5(Suppl. 1):1–110 Ahmad S (1978) Ascomycetes of Pakistan, Part II. Biol Soc Pak Monogr 8:1–144 Ahmad S, Iqbal SH, Khalid AN (1997) Fungi of Pakistan. Sultan Ahmad Mycological Society of Pakistan, Lahore Akgul DS, Savas NG, Eskalen A (2014a) First report of wood canker caused by Botryosphaeria dothidea, Diplodia seriata, Neofusicoccum parvum, and Lasiodiplodia theobromae on grapevine in Turkey. Plant Dis 98:568 Akgul DS, Savas NG, Onder S, Ozben S, Kaymak S (2014b) First report of Campylocarpon fasciculare causing black foot disease of grapevine in Turkey. Plant Dis 98:1277 Akgul DS, Gungor Savas N, Teker T, Keykubat B, Mayorquin JS, Eskalen A (2015) Fungal trunk pathogens of Sultana seedless vineyards in Aegean region of Turkey. Phytopathol Mediterr 54:380–393 Alaniz S, Leon M, Vicent A, Garcia-Jimenez J, Abad-Campos P, Armengol J (2007) Characterization of Cylindrocarpon species associated with black foot disease of grapevine in Spain. Plant Dis 91:1187–1193 Alaniz S, Armengol J, Leon M, Garcia-Jimenez J, Abad-Campos P (2009) Analysis of genetic and virulence diversity of Cylindrocarpon liriodendra and C. macrodidymum associated with black foot disease of grapevine. Mycol Res 113:16–23 Alexopoulos CJ (1940) Some fungi from Greece. Mycologia 32:336–358 Alfieri Jr SA, Langdon KR, Wehlburg C, Kimbrough JW (1984) Index of plant diseases in Florida (revised). Florida Department of Agriculture and Consumer Services, Division of Plant Industry Bulletin, vol 11, pp 1–389 Alfieri SA Jr, Langdon KR, Kimbrough JW, El-Gholl NE, Wehlburg C (1994) Diseases and disorders of plants in Florida. Florida Department of Agriculture and Consumer Services, Tallahassee Al-Saadoon AH, Ameen MKM, Hameed MA, Al-Badran A, Ali Z (2012) First report of grapevine dieback caused by Lasiodiplodia theobromae and Neoscytalidium dimidiatum in Basrah, Southern Iraq. Afr J Biotechnol 11:16165–16171 Alvarez MG (1976) Primer catalogo de enfermedades de plantas Mexicanas. Fitofilo 71:1–169 Alves A, Linaldeddu BT, Deidda A, Scanu B, Phillips AJL (2014) The complex of Diplodia species associated with Fraxinus and 123 Fungal Diversity (2018) 90:1–84 some other woody hosts in Italy and Portugal. Fungal Divers 67:143–156 Amrani L, Corio-Costet M-F (2006) A single nucleotide polymorphism in the ß-tubulin gene distinguishing two genotypes of Erysiphe necator expressing different symptoms on grapevine. Plant Pathol 55:505–512 Anderson IC, Cairney JW (2004) Diversity and ecology of soil fungal communities: increased understanding through the application of molecular techniques. Environ microbiol 6:769–779 Ann PJ, Chang T-T, Ko W-H (2002) Phellinus noxius brown root rot of fruit and ornamental trees in Taiwan. Plant Dis 86:820–826 Anonymous (1960) Index of plant diseases in the United States. U.S.D.A. Agricultural Handbook 165:1–531 Anonymous (1979) List of plant diseases in Taiwan. The Plant Protection Society of The Republic of China, Taichung Ariyawansa HA, Thambugala KM, Manamgoda DS, Jayawardena R, Camporesi E, Boonmee S, Wanasinghe DN, Phookamsak R, Hongsanan S, Singtripop C, Chukeatirote E (2015) Towards a natural classification and backbone tree for Pleosporaceae. Fungal Divers 71:85–139 Armijo G, Schlechter R, Agurto M, Muñoz D, Nuñez C, ArceJohnson P (2016) Grapevine pathogenic microorganisms: understanding infection strategies and host response scenarios. Front Plant Sci 7:382 Arnold GRW (1986) Lista de Hongos Fitopatogenos de Cuba. Ministerio de Cultura Editorial Cientifico-Tecnica, Habana Arthur JC (1918) Uredinales of Guatemala based on collections by E.W.D. Holway. I. Introduction. Coleosporiaceae and Uredinaceae. Am J Bot 5:325–336 Arzanlou M, Moshari S, Bakhshi M, Khodaie S (2012) Botryosphaeria dothidea associated with grapevine decline disease in Iran. Australas Plant Dis Notes 7:197–200 Arzanlou M, Narmani A, Moshari S, Khodaei S, Babai-Ahari A (2013) Truncatella angustata associated with grapevine trunk disease in Northern Iran. Arch Phytopathol Pflanzenschutz 46:1168–1181 Arzanlou M, Narmani A, Khodaei S, Moshari S (2014) Pome and stone fruit trees as possible resevoir hosts for Phaeoacremonium spp., the causal agents of grapevine esca disease, in Iran. Arch Phytopathol Pflanzenschutz 47:717–727 Auger J, Esterio M, Ricke G, Perez I (2004a) Black dead arm and basal canker of Vitis vinifera cv. red globe cause by Botryosphaeria obtuse in Chile. Plant Dis 88:1286 Auger J, Esterio M, Perez I, Gubler WD, Eskalen A (2004b) First report of Phaeomoniella chlamydospora on Vitis vinifera and French American hybrids in Chile. Plant Dis 88:1285 Bai J-K (ed) (2000) Flora Fungorum Sinicorum. Sphaeropsidales, Phoma, Phyllosticta, vol 15. Science Press, Beijing Baker RED, Dale WT (1951) Fungi of Trinidad and Tobago. Mycol Pap 33:1–123 Bakhshi M, Arzanlou M (2017) Multigene phylogeny reveals a new species and novel records and hosts in the genus Ramularia from Iran. Mycol Progr 16:703–712 Bakhshi M, Arzanlou M, Babai-Ahari A (2012) Comprehensive check list of Cercosporoid fungi from Iran. Plant Pathol Quar 2:44–55 Balmas V, Scherm B, Ghignone S, Salem AOM, Cacciola SO, Migheli Q (2005) Characterisation of Phoma tracheiphila by RAPD-PCR, microsatellite-primed PCR and ITS rDNA sequencing and development of specific primers for in planta PCR detection. Eur J Plant Pathol 111:235–247 Baloyi MA, Halleen F, Mostert L, Eskalen A (2013) First report of Togninia minima perithecia on esca- and Petri-diseased grapevines in South Africa. Plant Dis 97:1247 Barbe GD, Hewitt WB (1965) Principal fungus in summer bunch rot of grapes. Phytopathology 55:815 Fungal Diversity (2018) 90:1–84 Baroncelli R, Sreenivasaprasad S, Lane CR, Thon MR, Sukno SA (2014) First report of Colletotrichum acutatum sensu lato (Colletotrichum godetiae) causing anthracnose on grapevine (Vitis vinifera) in the United Kingdom. New Dis Rep 29:26 Barr ME (1990) Some dictyosporous genera and species of Pleosporales in North America. N Y Bot Gard 62:1–92 Barr ME (1992) Notes on the Lophiostomataceae (Pleosporales). Mycotaxon 45:191–221 Baskarathevan J, Jaspers MV, Jones EE, Ridgway HJ (2008) Distribution of Botryosphaeria species causing grapevine dieback and decline in New Zealand vineyards. NZ Plant Protect 61:392 Baskarathevan J, Jaspers MV, Ridgway HJ, Eirian JE (2012) Incidence and distribution of Botryosphaeriaceous species in New Zealand vineyards. Eur J Plant Pathol 132:549–560 Bastide F, Serandat I, Gombert J, Laurent E, Morel E, Kolopp J, Guillermin PL, Hamon B, Simoneau P, Berruyer R, Poupard P (2017) Characterization of fungal pathogens (Diaporthe angelicae and D. eres) responsible for umbel browning and stem necrosis on carrot in France. Plant Pathol 66:239–253 Batista AC, Ciferri R (1962) The Chaetothyriales. Sydowia 3:1–129 Batra LR (1973) Nematosporaceae (Hemiascomycetidae): taxonomy, pathogenicity, distribution, and vector relationships. U.S.D.A. Agric Res Serv Tech Bull 1469:1–71 Baumgartner K, Fujiyoshia PT, Travadon R, Castlebury LA, Wilcox WF, Rolshausen PE (2013) Characterization of species of Diaporthe from wood cankers of grape in eastern North American vineyards. Plant Dis 97:912–920 Beale RE, Pitt D (1990) Biological and integrated control of Fusarium basal rot of Narcissus using Minimedusa polyspora and other micro-organisms. Plant Pathol 39:477–488 Bechet M, Sapta-Forda A (1981) Investigation on the growth, development and control of Alternaria vitis Cav., the pathogen of alternariosis of grapevine. Romania Univ’ersitatea BabesBloya, pp 147–156 Begon M, Harper JL, Townsend CR (1993) Ecology: Individuals, Population and Communities, 3rd edn. Blackwell Science, Boston Begoude AD, Slippers B, Wingfeld MJ, Roux J (2010) Botryosphaeriaceae associated with Terminalia catappa in Cameroon, South Africa and Madagascar. Mycol Progr 9:101–123 Benavides PG, Zamorano PM, Ocete CA, Maistrello L, Ocete R (2013) Biodiversity of pathogenic wood fungi isolated from Xylotrechus arvicola (Olivier) galleries in vine shoots. OENO One 47:73–81 Bendezu-Euribe MV, Alvarez LA (2012) The perfect stage of powdery mildew of grapevine caused by Erysiphe necator found in Peru. Plant Dis 96:768 Benjamin CR, Slot A (1969) Fungi of Haiti. Sydowia 23:125–163 Bensch K, Groenewald JZ, Braun U, Dijksterhuis J, de Jesús Y-MM, Crous PW (2015) Common but different: the expanding realm of Cladosporium. Stud Mycol 82:23–74 Berkeley MJ (1872) Notices of North American fungi. Grevillea 1:33–39 Berndt R (2004) A checklist of Costa Rican rust fungi. In: Agerer R, Piepenbring M, Blanz P (eds) Frontiers in Basidiomycete Mycology. IHW-Verlag, Berlin Berraf-Tebbal A, Bouznad Z, Santos JM, Coelho MA, Peros J-P, Phillips AJL (2011) Phaeoacremonium species associated with Eutypa dieback and esca of grapevines in Algeria. Phytopathol Mediterr 50:S86–S97 Berraf-Tebbal A, Guereiro MA, Phillips AJL (2014) Phylogeny of Neofusicoccum species associated with grapevine trunk disease in Algeria, with decription of Neofusicoccum algeriense sp. nov. Phytopathol Mediterr 53:416–427 69 Berthier J (1976) Monographie des Typhula, Pistillaria et des genres voisins. Bull Soc Linn Lyon 45:1–213 Bezerra JL, De Lima TEF (2012) Phaeotrichoconis crotalariae, endophytic on Vitis labrusca, in Brazil. Mycotaxon 120:291–294 Billones RG, Ridgway HJ, Jones EE, Jaspers MV (2010) First report of Neofusicoccum macroclavatum as a canker pathogen of grapevine in New Zealand. Plant Dis 94:1504 Blair JE, Coffey MD, Park SY, Geiser DM, Kang S (2008) A multilocus phylogeny for Phytophthora utilizing markers derived from complete genome sequences. Fungal Genet Biol 45:266–277 Bobev S (2009) Reference guide for the diseases of cultivated plants. http://nt.ars-grin.gov/fungaldatabases Boesewinkel HJ (1982) A list of 142 new plant disease recordings from New Zealand and short notes on three diseases. Australas Plant Pathol 11:40–43 Boidin J, Lanquetin P (1987) Le genre Scytinostroma Donk (basidiomycetes, Lachnocladiaceae). Biblioth Mycol 114:1–130 Bokulich NA, Subramanian S, Faith JJ, Gevers D, Gordon JI, Knight R, Mills DA, Caporaso JG (2013) Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nat Methods 10:57–59 Bokulich NA, Thorngate JH, Richardson PM, Millis DA (2014) Microbial biogeography of wine grapes is conditioned by cultivar, vintage and climate. Proc Natl Acad Sci 111:E139– E148 Bolay A (2005) Powdery mildews of Switzerland (Erysiphaceae). Cryptogr Helv 20:1–176 Booth C (1966) The genus Cylindrocarpon. Mycol Pap 104:1–56 Brasier CM, Sanchez-Hernandez E, Kirk SA (2003) Phytophthora inundata sp. nov., a part heterothallic pathogen of trees and shrubs in wet or flooded soils. Mycol Res 107:477–484 Braun U (1998) A monograph of Cercosporella, Ramularia and allied genera (Phytopathogenic Hyphomycetes), vol 2. IHW-Verlag, Eching, p 337 Braun U, Crous PW, Dugan F, Groenewald JE, De Hoog GS (2003) Phylogeny and taxonomy of Cladosporium-like hyphomycetes, including Davidiella gen. nov., the teleomorph of Cladosporium s. str. Mycol Prog 2:3–18 Brenckle JF (1918) North Dakota fungi—II. Mycologia 10:199–221 Briceno EX, Latorre BA (2007) Outbreaks of Cladosporium rot associated with delayed harvest wine grapes in Chile. Plant Dis 91:1060 Briceno EX, Latorre BA (2008) Characterization of Cladosporium rot in grapevines, a problem of growing importance in Chile. Plant Dis 92:1635–1642 Bucher VVC, Hyde KD, Pointing SB, Reddy CA (2004) Production of wood decay enzymes, mass loss and lignin solubilization in wood by marine ascomycetes and their anamorphs. Fungal Divers 15:1–14 Burdsall HH Jr (1976) A new species of Laeticorticium (Aphyllophorales, Corticiaceae) from the southern Appalachians. J Elisha Mitchell Sci Soc 91:243–245 Burdsall HH Jr (1985) A contribution to the taxonomy of the genus Phanerochaete. Mycol Mem 10:1–165 Burgess TI, Barber PA, Hardy J (2005) Bothryosphaeria spp. associated with Eucalyptus in Western Australia including description of Fusicoccum macroclavatum sp. nov. Australas Plant Pathol 34:557–567 Buritica P (1999) La familia Phakopsoraceae en el neotropico III, generos: Batistopsora y Phakopsora. Rev Acad Colomb Cienc 23:271–305 Buritica P, Pardo Cardona VM (1996) Flora Uredineana Colombiana. Rev Acad Colomb Cienc 20:183–236 Cai L, Udayanga D, Manamgoda DS, Maharachchikumbura SSN, McKenzie EHC, Guo LD, Liu XZ, Bahkali A, Hyde KD (2011) 123 70 The need to carry out re-inventory of plant pathogenic fungi. Trop Plant Pathol 36:205–213 Campbell WA, Miller JH, Thompson GE (1950) Notes on some wood-decaying fungi of Georgia. Plant Dis Rep 34:128–134 Candolfi-Arballo O, Valenzuela-Solano C, Gubler WD, HernándezMartı́nez R (2010) Botryosphaeriaceae species associated with grapevine decline in Mexico. Phytopathol Mediterr 49:105–106 Cannon PF, Hawksworth DL, Sherwood-Pike MA (1985) The British ascomycotina: An annotated checklist. Commonwealth Mycological Institute, Kew, Surrey Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, Fierer N, Peña AG, Goodrich JK, Gordon JI, Huttley GA (2010) QIIME allows analysis of high-throughput community sequencing data. Nat Methods 7:335–336 Carlucci A, Frisullo S (2009) First report of Diplodia corticola on grapevine in Italy. J Plant Pathol 91:231–240 Carlucci A, Cibelli F, Lops F, Raimondo ML (2015) Characterization of Botryosphaeriaceae species as causal agents of trunk disease on Grapevines. Plant Dis 99:1678–1688 Carlucci A, Lops F, Mostert L, Halleen F, Raimondo ML (2017) Occurrence fungi causing black foot on young grapevines and nursery rootstock plants in Italy. Phytopathol Mediterr 56:10–39 Carmaran CC, Novas MV (2003) A review of spegazzini taxa of Periconia and Sporocybe after over 115 years. Fungal Divers 14:67–76 Carraro L, Maifreni M, Bartolomeoli I, Martino ME, Novelli E, Frigo F, Marino M, Cardazzo B (2011) Comparison of culturedependent and -independent methods for bacterial community monitoring during Montasio cheese manufacturing. Res Microbiol 162:231–239 Carter MV (1991) The status of Eutypa lata as a pathogen. Phytopathol Pap 32:1–59 Cash EK (1952) A record of the fungi named by J.B. Ellis (Part 1). U.S.D.A. Spec Publ 2:1–165 Cash EK (1953) A record of the fungi named by J.B. Ellis (Part 2). U.S.D.A. Spec Publ 2:167–345 Cash EK (1954) A record of the fungi named by J.B. Ellis (Part 3). U.S.D.A. Spec Publ 2:347–518 Casieri L, Hofstetter V, Viret O, Gindro K (2009) Fungal communities living in the wood of different cultivars of young Vitis vinifera plants. Phytopathol Mediterr 48:73–83 Castellani E, Ciferri R (1937) Prodromus Mycoflorae Africae Orientalis Italicae. Istituto Agricolo Coloniale Italiano, Firenze Castillo-Pando M, Somers A, Green CD, Priest M, Sriskathades M (2001) Fungi associated with dieback of Semillon grapevines in the Hunter Valley of New South Wales. Australas Plant Pathol 30:59–63 Cavara F (1888) Intorno al disseccamento dei grappoli della vite. Atti dell’Istituto Botanico della Università e Laboratorio Crittogamico di Pavia 1:293–324 Cavara F (1889) I Funghi Parassiti delle Piante Coltivate ed Utili Essicati, Delineati e Descriti: 21 Chandra S (1974) Some new leaf-spot diseases from Allahabad (India). Nova Hedwig 47:35–102 Chardon CE, Toro RA (1930) Mycological explorations of Colombia. J Dept Agric Porto Rico 14:195–369 Chatasiri S, Ono Y (2008) Phylogeny and taxonomy of the Asian grapevine leaf rust fungus, Phakopsora euvitis, and its allies (Uredinales). Mycoscience 49:66–74 Chebil S, Fersi R, Yakoub A, Chenenaoui S, Chattaoui M, Melki I, Zemni H, Rhouma A, Durante G, Zacchi E, Mliki A (2014) First report of Botryosphaeria dothidea, Diplodia seriata, and Neofusicoccum luteum associated with canker and dieback of grapevines in Tunisia. Plant Dis 98:420 Checa J (2004) Dictyosporic Dothideales. Flora Mycol Iber 6:1–162 123 Fungal Diversity (2018) 90:1–84 Chen Q, Jiang JR, Zhang GZ, Cai L, Crous PW (2015) Resolving the Phoma enigma. Stud Mycol 82:137–217 Chethana KWT, Zhou Y, Zhang W, Liu M, Xing QK, Li XH, Yan JY (2017) Coniella vitis sp. nov. is the common pathogen of white rot in Chinese vineyards. Plant Dis 101:2123–2136 Chiarappa L (1959) Wood decay of the grapevine and its relationship with black measles disease. Phytopathology 49:510–519 Chicau G, Aboim-Inglez M, Cabral S, Cabral JPS (2000) Phaeoacremonium chlamydosporum and Phaeoacremonium angustius associated with esca and grapevine decline in Vinho Verde grapevines in northwest Portugal. Phytopathol Mediterr 39:80–86 Cho WD, Shin HD (eds) (2004) List of plant diseases in Korea, 4th edn. Korean Society of Plant Pathology, Suwon Chomnunti P, Hongsanan S, Aguirre-Hudson B, Tian Q, Peršoh D, Dhami MK, Alias AS, Xu J-C, Liu X-Z, Stadler M, Hyde KD (2014) The sooty moulds. Fungal Divers 66:1–36 Choueiri E, Jreijiri F, Chlela P, Louvet G, Lecomte P (2006) Occurrence of grapevine decline and first report of black dead arm associated with Botryosphaeria obtusa in Lebanon. Plant Dis 90:115 Choueiri E, Jreijiri F, El Amil R, Chlela P, Bugaret Y, Liminana JM, Mayet V, Lecomte P (2009) First report of black foot disease associated with Cylindrocarpon sp. in Lebanon. J Plant Pathol 91:231–240 Chupp C (1953) Monograph of the fungus genus Cercospora. Author, Ithaca Ciferri R (1929) Micoflora Domingensis. Lista de los hongos hasta la fecha indicados en Santo Domingo. Publ Estac Estac Agron Moca Ser B Bot 14:1–260 Ciferri R (1961) Mycoflora Domingensis Integrata. Quaderno 19:1539 Cinelli T, Mondello V, Marchi G, Burruano S, Alves A, Mugnai L (2016) First report of Diaporthe eres associated with cane blight of grapevine (Vitis vinifera) in Italy. Plant Dis 100:532 Cloete M, Fischer M, Mostert L, Halleen F (2014) A novel Fomitiporia species associated with esca on grapevine in South Africa. Mycol Prog 13:303–311 Cloete M, Fischer M, Mostert L, Halleen F (2015) Hymenochaetales associated with esca-related wood rots on grapevine with a special emphasis on the status of esca in South African vineyards. Phytopathol Mediterr 54:299–312 Cloete M, Fischer M, Du Plessis IL, Mostert L, Halleen F (2016) A new species of Phellinus sensu stricto associated with esca on grapevine in South Africa. Mycol Prog 15:25 Comont G, Mayet V, Corio-Costet MF (2016) First report of Lasiodiplodia viticola, Spencermartinsia viticola and Diplodia intermedia associated with Vitis vinifera grapevine decline in French vineyards. Plant Dis 100:2328 Cook RP, Dubé AJ (1989) Host–pathogen index of plant diseases in South Australia. South Australian Department of Agriculture, Adelaide Cooke MC (1878) Ravenel’s American fungi. Grevillea 6:129–146 Cooke WB (1983) The 1979 Oklahoma foray. Mycologia 75:752–755 Correia KC, Camara MPS, Barbosa MAG, Sales R, Agusti-Brisach C, Gramaje D, Leon M, Garcia-Jimenez J, Abad-Campos P, Armengol J, Michereff SJ (2013) Fungal trunk pathogens associated with table grape decline in Northeastern Brazil. Phytopathol Mediterr 52:380–387 Correia KC, Silva MA, Netto MSB, Vieira WAS, Camara MPS, Michereff SJ (2016a) First report of grapevine dieback caused by Neoscytalidium hyalinum in Brazil. Plant Dis 100:213 Correia KC, Silva MA, de Morais Jr MA, Armengol J, Phillips AJL, Camara MPS, Michereff SJ (2016b) Phylogeny, distribution and pathogenicity of Lasiodiplodia species associated with dieback Fungal Diversity (2018) 90:1–84 of table grape in the main Brazilian exporting region. Plant Pathol 65:92–103 Costa MEA, Camara MS (1952) Species Aliquae Mycologicae Lusitaniae. Portugaliae Acta Biol Ser A 3:294–307 Coutinho IBL, Freire FCO, Lima CS, Lima JS, Goncalves FJT, Machado AR, Silva AMS, Cardoso JE (2017) Diversity of genus Lasiodiplodia associated with perennial tropical fruit plants in northeastern Brazil. Plant Pathol 66:90–104 Crane JL, Shearer CA (1991) A nomenclator of Leptosphaeria V. Cesati & G. DeNotaris. Ill Nat Hist Surv Biol Notes 34:1–355 Crous PW, Braun U (2003) Mycosphaerella and its anamorphs: 1. Names published in Cercospora and Passalora. Centraalbureau voor Schimmelcultures, Utrecht Crous PW, Gams W (2000) Phaeomoniella chlamydospora gen. et comb. nov., a causal organism of Petri grapevine decline and esca. Phytopathol Mediterr 39:112–118 Crous PW, Braun U, Wingfield MJ, Wood AR, Shin HD, Summerell BA, Alfenas AC, Cumagun CJR, Groenewald JZ (2009) Phylogeny and taxonomy of obscure genera of microfungi. Persoonia 22:139–161 Crous PW, Wingfield MJ, Guarro J, Hernandez-Restrepo M, Sutton DA, Acharya K, Barber PA, Boekhout T, Dimitrov RA, Duenas M, Dutta AK, Gene J, Gouliamova DE, Groenewald M, Lombard L, Morozova OV, Sarkar J, Smith MTh, Stchigel AM, Wiederhold NP, Alexandrova AV, Antelmi I, Armengol J, Barnes I, Cano-Lira JF, Castaneda-Ruiz RF, Contu M, PrR Courtecuisse, da Silveira AL, Decock CA, de Goes A, Edathodu J, Ercole E (2015) Fungal Planet description sheets: 320–370. Persoonia 34:167–266 Crous PW, Wingfield MJ, Burgess TI, St J Hardy GE, Barber PA, Alvarado P, Barnes CW, Buchanan PK, Heykoop M, Moreno G, Thangavel R, van der Spuy S, Barili A, Barrett S, Cacciola SO, Cano-Lira JF, Crane C, Decock C, Gilbertoni TB, Guarro J, Guevara-Suarez M, Hubka V, Kolarik M, Lira CRS, Ordonez ME, Padamsee M, Ryvarden L, Soares AM, Stchigel AM, Sutton DA, Vizzini A, Weir BS, Acharya K, Aloi F (2017) Fungal Planet description sheets: 558–624. Persoonia 38:240–384 Cruywagen EM, Slippers B, Roux J, Wingfield MJ (2017) Phylogenetic species recognition and hybridisation in Lasiodiplodia: a case study on species from baobabs. Fungal Biol 121:420–436 Cunningham GH (1965) Polyporaceae of New Zealand. Bull N Z Dept Ind Res 164:1–304 Cunnington J (2003) Pathogenic fungi on introduced plants in Victoria. A host list and literature guide for their identification. Department of Primary Industries, Victoria Cunnington JH, Priest MJ, Powney RA, Cother NJ (2007) Diversity of Botryosphaeria species on horticultural plants in Victoria and New South Wales. Australas Plant Pathol 36:157–159 da Silva MA, Correia KC, Barbosa MAG, Camara MPS, Gramaje D, Michereff SJ (2017) Characterization of Phaeoacremonium isolates associated with petri disease of table grape in Northeastern Brazil, with description of Phaeoacremonium nordesticola sp. nov. Eur J Plant Pathol 149:695–709 Daamen RA, Langerak CJ, Stol W (1991) Surveys of cereal diseases and pests in the Netherlands 3. Monographella nivalis and Fusarium spp. in winter wheat fields and seed lots. Neth J Plant Pathol 97:105–114 Damm U, Crous PW, Fourie PH (2007) Botryosphaeriaceae as potential pathogens of Prunus species in South Africa, with descriptions of Diplodia africana and Lasiodiplodia plurivora sp. nov. Mycologia 99:664–680 Damm U, Woudenberg JHC, Cannon PF, Crous PW (2009) Colletotrichum species with curved conidia from herbaceous hosts. Fungal Divers 39:45–87 71 Damm U, Cannon PF, Woudenberg JHC, Crous PW (2012) The Colletotrichum acutatum species complex. Stud Mycol 73:37–113 Daranagama DA, Camporesi E, Jeewon R, Liu XZ, Stadler M, Lumyong S, Hyde KD (2016) Taxonomic rearrangement of Anthostomella (Xylariaceae) based on a multigene phylogeny and morphology. Cryptogam Mycol 37:509–538 de Sousa Dias MR, Lucas MT (1972) Fungi Lusitaniae XXIII. Agron. Lusit 33:173–184 de Sousa Dias MR, Lucas MT, Lopes MC (1987) Fungi Lusitaniae XXX. Agron Lusit 42:179–188 de Wet J, Slippers B, Preisig O, Wingfield BD, Tsopelas P, Wingfield MJ (2009) Molecular and morphological characterization of Dothiorella casuarinae sp. nov. and other Botryosphaeriaceae with diplodia-like conidia. Mycologia 101:503–511 Deighton FC (1976) Studies on Cercospora and allied genera. VI. Pseudocercospora Speg., Pantospora Cif. and Cercoseptoria Petr. Mycol Pap 140:1–168 Deighton J (2016) Fungi in ecosystem processes, vol 31. CRC Press, Boca Raton Denaree JB, Runner GA (1942) Control of grape diseases and insects in Eastern United States. Diseases principally of Amaerican bunch grapes. US Dept Agr Farm Bull 1893:1–28 Dennis RWG (1964) Remarks on the genus Hymenoscyphus S.F. Gray, with observations on sundry species referred by Saccardo and others to the genera Helotium Pezizella or Phialea. Persoonia 3:29–80 Dennis RWG (1970) Kew Bulletin Additional Series III. Fungus flora of Venezuela and adjacent countries. Verlag von J Cramer, Weinheim Diaz GA, Latorre BA (2014) Infection caused by Phaeomoniella chlamydospora associated with esca-like symptoms in grapevine in Chile. Plant Dis 98:351–360 Diaz GA, Prehn D, Latorre BA (2011) First report of Cryptovalsa ampelina and Eutypella leprosa associated with grapevine trunk diseases in Chile. Plant Dis 95:490 Diaz GA, Elfar K, Latorre BA (2012) First report of Seimatosporium botan associated with trunk disease of grapevine (Vitis vinifera) in Chile. Plant Dis 96:1696 Diaz G, Auger J, Besoain X, Bordeu E, Latorre BA (2013) Prevalence and pathogenicity of fungi associated with grapevine trunk diseases in Chilean vineyards. Cien Inv Agr 40:327–339 Dingley JM, Fullerton RA, McKenzie EHC (1981) Survey of agricultural pests and diseases. Technical Report, vol 2. Records of fungi, bacteria, algae, and angiosperms pathogenic on Plants in Cook Islands, Fiji, Kiribati, Niue, Tonga, Tuvalu, and Western Samoa. F.A.O., Rome Dissanayake AJ, Zhang W, Mei L, Chukeatirote E, Yan JY, Li XH, Hyde KD (2015) Lasiodiplodia pseudotheobromae causes pedicel and peduncle discolouration of grapes in China. Australas Plant Pathol 10:21 Dissanayake AJ, Purahong W, Wubet T, Hyde KD, Wei Z, Xu HY, Zhang GJ, Yuan FC, Liu M, Xing Q, Li XH, Yan JY (2018) Direct comparison of culture dependent and cultire independent molecular approaches reveal the diversity of fungal endophytic communities in stems of grapevine (Vitis vinifera). Fungal Divers (Under review) Dohadwala MM, Vita JA (2009) Grapes and Cardiovascular Disease. J Nutr 139:1788S–1793S Doidge EM (1950) The South African fungi and lichens to the end of (1945). Bothalia 5:1–1094 Doilom MW, Shuttleworth LA, Roux J, Chukeatirote E, Hyde KD (2015) Botryosphaeriaceae associated with Tectona grandis (teak) in northern Thailand. Phytotaxa 233:1–26 123 72 Du Z, Fan X-L, Hyde KD, Yang Q, Liang Y-M, Tian C-M (2016) Phylogeny and morphology reveal two new species of Diaporthe form Betula spp. in China. Phytotaxa 269:090–102 Duarte S, Pascoal C, Cássio F, Bärlocher F (2006) Aquatic hyphomycete diversity and identity affect leaf litter decomposition in microcosms. Oecologia 147:658–666 Dudka IO, Heluta VP, Tykhonenko YY, Andrianova TV, Hayova VP, Prydiuk MP, Dzhagan VV, Isikov VP (2004) Fungi of the Crimean Peninsula. M.G. Kholodny Institute of Botany, National Academy of Sciences of Ukraine, Kiev Dugan FM, Schubert K, Braun U (2004) Check-list of Cladosporium names. Schlechtendalia 11:1–103 Dupont J, Laloui W, Roquebert MF (1998) Partial ribosomal DNA sequences show an important divergence between Phaeoacremonium species isolated from Vitis vinifera. Mycol Res 102:631–637 Dupont J, Laloui W, Magnin S, Larignon P, Roquebert M-F (2000) Phaeoacremonium viticola, a new species associated with Esca disease of grapevine in France. Mycologia 92:499–504 Dupont J, Magnin S, Cesari C, Gatica M (2002) ITS and b-tubulin markers help delineate Phaeoacremonium species, and the occurrence of P. parasiticum in grapevine disease in Argentina. Mycol Res 106:1143–1150 Ebbels DL, Allen DJ (1979) A supplementary and annotated list of plant diseases, pathogens and associated fungi in Tanzania. Phytopathol Pap 22:1–89 Edgar RC (2004) Muscle: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics 5:113 Edgar RC (2013) UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nat Methods 10:996–998 Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R (2011) UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 27:2194–2200 El-Buni AM, Rattan SS (1981) Check list of Libyan Fungi. Al Faateh University, Fac Sci, Dept. Bot, Tripoli Elenkin AA (1909) Title unknown. Bolezni Rast 4:68 Ellis JB, Everhart BM (1904) New species of fungi from various localities. J Mycol 10:167–170 Epstein L (2008) Botryosphaeria-related dieback and control investigated in noncoastal California grapevines. Calif Agric 62:161–166 Erwin DC, Ribeiro OK (1996) Phytophthora diseases worldwide. APS Press, St. Paul Esfandiari E, Petrak F (1950) Pilze aus Iran. Sydowia 4:11–38 Eskalen A, Rooney-Latham S, Gubler WD (2005) First report of perithecia of Phaeoacremonium viticola on grapevine (Vitis vinifera) and ash tree (Fraxinus latifolia) in California. Plant Dis 89:686–686 Essakhi S, Mugnai L, Crous PW, Groenewald JZ, Surico G (2008) Molecular and phenotypic characterisation of novel Phaeoacremonium species isolated from esca diseased grapevines. Persoonia 21:119–134 Fadrosh DW, Ma B, Gajer P, Sengamalay N, Ott S, Brotman RM, Ravel J (2014) An improved dual-indexing approach for multiplexed 16S rRNA gene sequencing on the Illumina MiSeq platform. Microbiome 2:6 Faedda R, Agosteo GE, Schena L, Mosca S, Frisullo S, di San Magnano, Lio G, Cacciola SO (2011) Colletotrichum clavatum sp. nov. identified as the causal agent of olive anthracnose in Italy. Phytopathol Mediterr 50:283–302 Farr ML (1973) An annotated list of Spegazzini’s fungus taxa, Vol. 1. Biblioth Mycol 35:1–823 Farr DF, Castlebury LA, Rossman AY, Erincik O (2001) Greeneria uvicola, cause of bitter rot of grapes, belongs in the Diaporthales. Sydowia 53:185–199 123 Fungal Diversity (2018) 90:1–84 Farr DF, Elliott M, Rossman AY, Edmonds RL (2005) Fusicoccum arbuti sp. nov. causing cankers on Pacific madrone in western North America with notes on Fusicoccum dimidiatum, the correct name for Scytalidium dimidiatum and Nattrassia mangiferae. Mycologia 97:730–741 Fautrey F, Lambotte JBE (1896) Espèces nouvelles ou rares de la Côte d’Or. Revue Mycologique Toulouse. 18:68–71 Ferrada EE, Diaz GA, Zoffoli JP, Latorre BA (2014) First report of blossom blight caused by Sclerotinia sclerotiorum on Japanese plum, nectarine, and sweet cherry orchards in Chile. Plant Dis 98:695 Fischer M, Edwards J, Cunnington JH, Pascoe IG (2005) Basidiomycetous pathogens on grapevine: a new species from Australia—Fomitiporia australiensis. Mycotaxon 92:85–96 Fischer M, Schneider P, Kraus C, Molnar M, Dubois C, D’Aguiar D, Haag N (2016) Grapevine trunk disease in German viticulture: occurence of lesser known fungi and first report of Phaeoacremonium viticola and P. fraxinopennsylvanicum. Vitis 55:145–156 Fitt BD, Brun H, Barbetti MJ, Rimmer SR (2006) World-wide importance of phoma stem canker (Leptosphaeria maculans and L. biglobosa) on oilseed rape (Brassica napus). In: Fitt BDL, Evans N, Howlett BJ, Cooke BM (eds) Sustainable strategies for managing Brassica napus (oilseed rape) resistance to Leptosphaeria maculans (phoma stem canker). Springer, Dordrecht, pp 3–15 Foister CE (1961) The economic plant diseases of Scotland. Techn Bull Dept Agric Fish Scotland 1:1–210 Forster H, Coffey MD (1993) Molecular taxonomy of Phytophthora megasperma based on mitochondrial and nuclear DNA polymorphisms. Mycol Res 97:1101–1112 Fotouhifar K-B, Hedjaroude G-A, Leuchtmann A (2010) ITS rDNA phylogeny of Iranian strains of Cytospora and associated teleomorphs. Mycologia 102:1369–1382 Fourie PH, Halleen F (2002) Investigation on the occurence of Phaeomoniella chlamydospora in canes of rootstock mother vines. Australas Plant Pathol 31:425–426 Fournier E, Gladieux P, Giraud T (2013) The ‘Dr Jekyll and Mr Hyde fungus’: noble rot versus gray mold symptoms of Botrytis cinerea on grapes. Evol Applic 6:960–969 French AM (1987) California plant disease host index. Part 1: fruit and nuts. California Department of Food Agriculture, Sacramento French AM (1989) California plant disease host index. California Department of Food Agriculture, Sacramento Gadgil PD (2005) Fungi on trees and shrubs in New Zealand. In: Fungi of New Zealand, vol 4. Fungal Diversity Press, Hong Kong Gao Z-M, Li Y-M, Li X-L, Zhang Z-H, Yiny J-F (2009) Comparison of the biological characteristics of Botrytis cinerea isolates from different hosts. Mycosystema 28:370–377 Gaponenko NI (1965) Survey of the fungi of Bukhara. Akad Sa Uzbekh Garcı́a B, López L, Velázquez M, Pérez-Moreno J (1998) Mycorrhizal and saprotrophic macrofungi in declining sacred-fir stands. Micol Neotrop Apl 11:9–21 Garcia-Benavides P, Martin Zamorano P, Ocete Perez CA, Maistrello L, Ocete Rubio R (2013) Biodiversity of pathogenic wood fungi isolated from Xylotrechus arvicola (Olivier) galleries in vine shoots. J Int Sci Vigne Vin 47:73–81 Garcia-Blazquez G, Constantinescu O, Telleria MT, Martin MP (2006) Preliminary checklist of Albuginales and Peronosporales (Chromista) reported from the Iberian Peninsula and Balearic Islands. Mycotaxon 98:185–188 Garnica S, Riess K, Schön ME, Oberwinkler F, Setaro SD (2016) Divergence times and phylogenetic patterns of Sebacinales, a Fungal Diversity (2018) 90:1–84 highly diverse and widespread fungal lineage. PLoS ONE 11:e0149531 Gatica M, Cesari C, Magnin S, Dupont J (2001) Phaeoacremonium species and Phaeomoniella chlamydospora in vines showing ‘‘hoja de malvon’’ and young vine decline symptoms in Argentina. Phytopathol Mediterr 40:S317–S324 Ge Q, Chen Y, Xu T (2009) Flora Fungorum Sinicorum. Pestalotiopsis, vol 38. Science Press, Beijing, p 235 Georghiou GP, Papadopoulos C (1957) A second list of Cyprus fungi. Government of Cyprus, Department of Agriculture, Nicosia Gerlach W, Ershad D (1970) Beitrag zur Kenntnis der Fusarium und Cylindrocarpon-Arten in Iran. Nova Hedwig 20:725–784 Giatgong P (1980) Host index of plant diseases in Thailand, 2nd edn. Mycology Branch, Plant Pathology and Microbiology Division, Department of Agriculture and Cooperatives, Bangkok Gilbertson RL, Martin KJ, Lindsey JP (1974) Annotated check list and host index for Arizona wood-rotting fungi. Univ Arizona Agric Exp Sta Techn Bull 209:1–48 Gilman JC (1932) First supplementary list of parasitic fungi from Iowa. Iowa State Coll J Sci 6:357–365 Gilman JC, Archer WA (1929) The Fungi of Iowa Parasitic on Plants. Iowa State Coll J Sci 3:299–507 Gimenez-Jaime A, Aroca A, Raposo R, Garcia-Jimenez J, Armengol J (2006) Occurrence of fungal pathogens associated with grapevine nurseries and the decline of young vines in Spain. J Phytopathol 154:598–602 Gomes RR, Glienke C, Videira SIR, Lombard L, Groenewald JZ, Crous PW (2013) Diaporthe: a genus of endophytic, saprobic and plant pathogenic fungi. Persoonia 31:1–41 Gonzalez CD, Chaverri P (2017) Corinectria, a new genus to accommodate Neonectria fuckeliana and C. constricta sp. nov. from Pinus radiata in Chile. Mycol Prog 16(11–12):1015–1027 Gonzalez Fragoso R (1916) Bosquejo de una Florula Hispalense de Micromicetos. Trab Mus Nac Ci Nat Ser Bot 10:1–221 Gonzalez Fragoso R (1917) Fungi novi vel minus cognitarum horti botanici matritense. Trab Mus Nac Ci Nat Ser Bot 12:1–99 Gonzalez Fragoso R (1921) Algunos Demaciaceos de la Flora espanola. Bol Real Soc Esp Hist Nat 21:93–99 Gonzalez V, Tello ML (2011) The endophytic mycota associated with Vitis vinifera in central Spain. Fungal Diver 47:29–42 Goos RD (2010) The Mycota of Rhode Island: a checklist of the fungi recorded in Rhode Island (including lichens and myxomycetes). R I Nat Hist Surv 4:222 Gorter GJMA (1977) Index of plant pathogens and the diseases they cause in cultivated plants in South Africa. Republic South Africa Dept Agric Techn Serv. Pl Protect Res Inst Sci Bull 392:1–177 Graham AB, Johnston PR, Weir BS (2009) Three new Phaeoacremonium species on grapevines in New Zealand. Australas Plant Pathol 38:505–513 Gramaje D, Alaniz S, Perez Sierra A, Abad-Campos P, GarciaJimenez J, Armengol J (2008) First report of Phaeoacremonium scolyti causing petri disease of grapevine in spain. Plant Dis 92:836 Gramaje D, Armengol J, Mohammadi H, Banihashemi Z, Mostert L (2009) Novel Phaeoacremonium species associated with petri disease and esca of grapevine in Iran and Spain. Mycologia 101:920–929 Gramaje D, Aguilar MI, Armengol J (2011) First report of Phaeoacremonium krajdenii causing petri disease of grapevine in Spain. Plant Dis 95:615 Grand LF (ed) (1985) North Carolina Plant Disease Index. North Carolina Agric Res Serv Techn Bull 240:1–157 Grasso S (1984) Infezioni di Fusarium oxysporum e di Cylindrocarpon destructans associate a una moria di giovani piante di vite in Sicilia. Inf Fitopatol 1:59–63 73 Greene HC (1955) Notes on Wisconsin parasitic fungi. XXI. Trans. Wisconsin Acad Sci 44:29–43 Greene HC (1956) Notes on Wisconsin parasitic fungi. XXII. Trans. Wisconsin Acad Sci 45:177–191 Greene HC (1963) Notes on Wisconsin parasitic fungi. XXIX. Trans Wisconsin Acad Sci 52:229–253 Greene HC (1966) Notes on Wisconsin parasitic fungi. XXXII. Trans Wisconsin Acad Sci 55:147–166 Greuter W, Poelt J, Raimondo FM (1991) A checklist of Sicillian fungi. Bocconea 2:222 Guba EF (1961) Monograph of Monochaetia and Pestalotia. Harvard University Press, Cambridge Guerber JC, Liu B, Correll JC, Johnston PR (2003) Characterization of diversity in Colletotrichum acutatum sensu lato by sequence analysis of two gene introns, mtDNA and intron RFLPs, and mating compatibility. Mycologia 95:872–895 Guo Y-L, Liu X-J (eds) (2003) Flora Fungorum Sinicorum. Mycovellosiella, Passalora, Phaeoramularia, vol. 20 Science Press, Beijing Guo LD, Huang GR, Wang Y, He WH, Zheng WH, Hyde KD (2003) Molecular identification of white morphotype strains of endophytic fungi from Pinus tabulaeformis. Mycol Res 107:680–688 Haas BJ, Gevers D, Earl AM, Feldgarden M, Ward DV, Giannoukos G, Ciulla D, Tabbaa D, Highlander SK, Sodergren E, Methé B (2011) Chimeric 16S rRNA sequence formation and detection in Sanger and 454-pyrosequenced PCR amplicons. Genome Res 21:494–504 Halleen F, Crous PW, Petrini O (2003) Fungi associated with healthy grapevine cuttings in nurseries, with special reference to pathogens involved in the decline of young vines. Australas Plant Pathol 32:47–52 Hammer Ø, Harper DAT, Ryan PD (2001) PAST: paleontological statistics software package for education and data analysis. Palaeontol Electron 4:1–9 Hanlin RT (1963) A revision of the Ascomycetes of Georgia. Georgia Agric Exp Sta Mimeo Ser ns 175:1–65 Hanlin RT (1966) Host index to the Basidiomycetes of Georgia. Georgia Agric Exp Sta Mimeo Ser ns 260:1–30 Hansford CG (1947) New or interesting tropical fungi—I. Proc Linn Soc London 158:28–50 Hanson CA, Fuhrman JA, Horner-Devine MC, Martiny JBH (2012) Beyond biogeographic patterns:processes shaping the microbial landscape. Nat RevMicrobiol 10:497–506 Harvey JM (1955) A method of forecasting decay in California storage grapes. Phytopathology 45:229–232 Henricot B, Pérez Sierra A, Prior C (2000) A new blight disease on Buxus in the UK caused by the fungus Cylindrocladium. Plant Pathol 49:805–805 Hernandez JC (2004) Bases Corologicas de Flora Micologica Iberica. Adiciones y numeros 2179–2238. Cuad Trab Fl Micol Iber 20:1–94 Hewitt WB (1951) Grape dead-arm control. Plant Dis Rep 35:142–143 Hewitt WB (2015) Miscellaneous berry rots and raisin molds. In: Gubler WD, Uyemoto JK (eds) Compendium of grape diseases, disorders and pests (Wilcox WF. American phytopathological society, USA, pp 22–24 Hirayama K, Tanaka K (2011) Taxonomic revision of Lophiostoma and Lophiotrema based on reevaluation of morphological characters and molecular analyses. Mycoscience 52:401–412 Hirooka Y, Rossman AY, Zhuang W-Y, Salgado-Salazar C, Chaverri P (2013) Species delimitation for Neonectria coccinea group including the causal agents of beech bark disease in Asia, Europe, and North America. Mycosystema 32:485–517 123 74 Hock J, Dittrich U, Renfro BL, Kranz J (1992) Sequential development of pathogens in the maize tarspot disease complex. Mycopathologia 117:157–161 Hofstetter V, Buyck B, Croll D, Viret O, Couloux A, Gindro K (2012) What if esca disease of grapevine were not a fungal disease? Fungal Divers 54:51–67 Holevas CD, Chitzanidis A, Pappas AC, Tzamos EC, Elena K, Psallidas PG, Alivizatos AS, Panagopoulos CG, Kyriakopoulou PE, Bem FP, Lazscaris DN (2000) Disease agents of cultivated plants observed in Greece from 1981 to 1990. Benaki Phytopathol Inst Kiphissia Athens 19:1–96 Hoppe B, Purahong W, Wubet T, Kahl T, Bauhus J, Arnstadt T, Hofrichter M, Buscot F, Krüger D (2016) Linking molecular deadwood-inhabiting fungal diversity and community dynamics to ecosystem functions and processes in Central European forests. Fungal Divers 77:367–379 Hrustic J, Delibasic G, Stankovic I, Grahovac M, Krstic B, Bulajic A, Tanovic B (2015) Monilinia spp. causing brown rot of stone fruit in Serbia. Plant Dis 99:709–717 Hsieh W-H, Goh T-K (1990) Cercospora and similar fungi from Taiwan. Maw Chang Book, Taipei Huang F, Udayanga D, Wang X, Hou X, Mei X, Fu Y, Hyde KD, Li H (2015) Endophytic Diaporthe associated with Citrus: a phylogenetic reassessment with seven new species from China. Fungal Biol 119:331–347 Hugenholtz P, Goebel BM, Pace NR (1998) Impact of cultureindependent studies on the 23 emerging phylogenetic view of bacterial diversity. J Bacteriol 180:4765–4774 Hyde KD, Bussaban B, Paulus B, Crous PW, Lee S, Mckenzie EH, Photita W, Lumyong S (2007) Diversity of saprobic microfungi. Biodivers Conserv 16:7–35 Hyde Kevin D, Abd-Elsalam Kamel, Cai Lei (2010) Morphology: still essential in a molecular world. Mycotaxon 114:439–451 Hyde KD, Nilsson RH, Alias SA, Ariyawansa HA, Blair JE, Cai L, de Cock AWAM, Dissanayake AJ, Glockling SL, Goonasekara ID, Gorczak M, Hahn M, Jayawardena RS, van Kan JAL, Laurence MH, Lévesque CA, Li XH, Liu JK, Maharachchikumbura SSN, Manamgoda DS, Martin FN, McKenzie EHC, McTaggart AR, Mortimer PE, Nair PVR, Pawłowska J, Rintoul TL, Shivas RG, Spies CFJ, Summerell BA, Taylor PWJ, Terhem RB, Udayanga D, Vaghefi N, Walther G, Wilk M, Wrzosek M, Xu JC, Yan JY, Zhou N (2014) One stop shop: backbones trees for important phytopathogenic genera: I. Fungal Divers 67:21–125 Hyde KD, Hongsanan S, Jeewon R, Bhat DJ, McKenzie EHC, Jones EBG, Phookamsak R, Ariyawansa HA, Boonmee S, Zhao Q, Abdel-Aziz FA, Abdel-Wahab MA, Banmai S, Chomnunti P, Cui BK, Daranagama DA, Das K, Dayarathne MC, de Silva NI, Dissanayake AJ, Doilom M, Ekanayaka AH, Gibertoni TB, Góes-Neto A, Huang SK, Jayasiri SC, Jayawardena RS, Konta S, Lee HB, Li WJ, Lin CG, Liu JK, Lu YZ, Luo ZL, Manawasinghe IS, Manimohan P, Mapook A, Niskanen T, Norphanphoun C, Papizadeh M, Perera RH, Phukhamsakda C, Richter C, de Santiago ALCMA, Drechsler-Santos ER, Senanayake IC, Tanaka K, Tennakoon TMDS, Thambugala KM, Tian Q, Tibpromma S, Thongbai B, Vizzini A, Wanasinghe DN, Wijayawardene NN, Wu HX, Yang J, Zeng XY, Zhang H, Zhang JF, Bulgakov TS, Camporesi E, Bahkali AH, Amoozegar AM, Araujo-Neta LS, Ammirati JF, Baghela A, Bhatt RP, Bojantchev S, Buyck B, da Silva GA, de Lima CLF, de Oliveira RJV, de Souza CAF, Dai YC, Dima B, Duong TT, Ercole E, Mafalda-Freire F, Ghosh A, Hashimoto A, Kamolhan S, Kang JC, Karunarathna SC, Kirk PM, Kytövuori I, Lantieri A, Liimatainen K, Liu ZY, Liu XZ, Lücking R, Medardi G, Mortimer PE, Nguyen TTT, Promputtha I, Raj KNA, Reck MA, Lumyong S, Shahzadeh-Fazeli SA, Stadler M, Soudi MR, Su HY, Takahashi T, Tangthirasunun N, Uniyal P, Wang Y, Wen 123 Fungal Diversity (2018) 90:1–84 TC, Xu JC, Zhang ZK, Zhao YC, Zhou JZ, Zhu L (2016) Fungal diversity notes 367–490: taxonomic and phylogenetic contributions to fungal taxa. Fungal Divers 80:1–270 Hyde KD, Norphanphoun C, Abreu VP, Bazzicalupo A, Chethana KT, Clericuzio M, Dayarathne MC, Dissanayake AJ, Ekanayaka AH, He MQ, Hongsanan S, Huang SK, Jayasiri SC, Jayawardena RS, Karunarathna A, Konta S, Kušan I, Lee H, Li J, Lin CG, Liu NG, Lu YZ, Luo ZL, Manawasinghe IS, Mapook A, Perera RH, Phookamsak R, Phukhamsakda C, Siedlecki I, Soares AM, Tennakoon D, Tian Q, Tibpromma S, Wanasinghe DN, Xiao YP, Yang J, Zeng XY, Abdel-Aziz FA, Li WJ, Senanayake IC, Shang QJ, Daranagama DA, de Silva NI, Thambugala KM, AbdelWahab MA, Bahkali AH, Berbee ML, Boonmee S, Bhat DJ, Bulgakov TS, Buyck B, Camporesi E, Castañeda-Ruiz RF, Chomnunti P, Doilom M, Dovana F, Gibertoni TB, Jadan M, Jeewon R, Jones EBG, Kang JC, Karunarathna SC, Lim YW, Liu JK, Liu ZY, Plautz HL Jr, Lumyong S, Maharachchikumbura SSN, Matočec N, McKenzie EHC, MeŠić A, Miller D, Pawlowska J, Pereira OL, Promputtha I, Romero AI, Ryvarden L, Su HY, Suetrong S, Tkalčec Z, Vizzini A, Wen TC, Wisitrassameewong K, Wrzosek M, Xu JC, Zhao Q, Zhao RL, Mortimer P (2017) Fungal diversity notes 603–708: taxonomic and phylogenetic notes on genera and species. Fungal Divers 87:1–235 Index Fungorum (2018) http://www.indexfungorum.org/names/ names.asp Jackson HS (1931) The rusts of South America based on the Holway collections—V. Mycologia 23:463–503 Jarvis WR, Traquair JA (1984) Bunch rot of grapes caused by Aspergillus aculeatus. Plant Dis 68:718–719 Javed S, Javaid A, Anwar W, Majeed RA, Akhtar R, Naqvi SF (2017) First Report of Botrytis Bunch Rot of Grapes Caused by Botrytis cinerea in Pakistan. Plant Dis 101:1036 Jayawardena RS, Zhang W, Liu M, Maharachchikumbura SSN, Zhou Y, Huang J-B, Nilthong S, Wang Z-Y, Li XH, Yan JY, Hyde KD (2015) Identification and characterization of Pestalotiopsis-like fungi related to grapevine diseases in China. Fungal Biol 119:348–361 Jayawardena RS, Liu M, Maharachchikumbura SS, Zhang W, Xing Q, Hyde KD, Nilthong S, Li X, Yan J (2016a) Neopestalotiopsis vitis sp. nov. causing grapevine leaf spot in China. Phytotaxa 258:63–74 Jayawardena RS, Hyde KD, Damm U, Cai L, Liu M, Li XH, Zhang W, Zhao WS, Yan JY (2016b) Notes on currently accepted species of Colletotrichum. Mycosphere 7:1192–1260 Jayawardena RS, Hyde KD, Chethana KWT, Daranagama DA, Dissanayake AJ, Goonasekara ID, Manawasinghe IS, Mapook A, Jayasiri SC, Karunarathne A, Li C-G, Phukhamsakda C, Senanayake IC, Wanasinghe DN, Camporesi E, Bulgakov TS, Li XH, Liu M, Zhang W, Yan JY (2018) Mycosphere Notes 102–168: saprotrophic fungi on Vitis in China, Italy, Russia and Thailand. Mycosphere 9:1–114 Jeewon R, Hyde KD (2016) Establishing species boundaries and new taxa among fungi: recommendations to resolve taxonomic ambiguities. Mycosphere 7:1669–1677 Jenkins AE, Bitancourt AA (1940–1963) Myrangiales Selecti Exsiccati. Nos. 1–550. Exsiccati set Jones DR, Baker RH (2007) Introductions of non-native plant pathogens into Great Britain, (1970–2004). Plant Pathol 56:891–910 Ju Y-M, Rogers JD (1995) Pareutypella gen. nov. for two longostiolate pyrenomycetes from Taiwan. Mycologia 87:891–895 Ju Y-M, Rogers JD (1999) The Xylariaceae of Taiwan (excluding Anthostomella). Mycotaxon 73:343–440 Fungal Diversity (2018) 90:1–84 Kakalikova L, Jankura E, Srobarova A (2009) First report of Alternaria bunch rot of grapevines in Slovakia. Australas Plant Pathol 4:68–69 Kamal (2010) Cercosporoid fungi of India. Bishen Singh Mahendra Pal Singh, Dehra Dun, p 351 Kanagawa T (2003) Bias and artifacts in multitemplate polymerase chain reaction (PCR). J Biosci Bioengin 96:317–323 Kanematsu S, Minaka N, Kobayashi T, Kudo A, Ohtsu Y (2000) Molecular phylogenetic analysis of Ribosomal DNA internal transcribed spacer regions and comparison of fertility in Phomopsis isolates from fruit trees. J Gen Plant Pathol 66:191–201 Kantschaveli LA (1928) New species of fungi from Georgia. Bolezni Rastenij 17:81–94 Karimi MR, Mahmoodi B, Kazemiyan M (2001) First report of esca of grapevine in Iran. Phytopathol Mediterr 40:S481 Kepley JB, Reeves FB, Jacobi WR, Adams GC (2015) Species associated with Cytospora canker on Populus tremuloides. Mycotaxon 130:783–805 Kern FD, Thurston HW Jr, Whetzel HH (1934) Uredinales. Monogr Univ Puerto Rico B 2:262–303 Khan S, Kamal M (1974) Additions to the parasitic fungi of West Pakistan—III. Mycopathol Mycol Appl 52:29–43 Kim J-D, Shin HD (1998) Taxonomic studies on Cercospora and allied genera in Korea (I). Korean J Mycol 26:327–341 Kim WK, Sang HK, Woo SK, Park MS, Paul NC, Yu SH (2007) Six species of Penicillium associated with blue mold of grape. Mycobiology 35:180–185 Ko TWK, Stephenson SL, Bahkali AH, Hyde KD (2011) From morphology to molecular biology: can we use sequence data to identify fungal endophytes? Fungal Divers 50:113 Kobayashi T (2007) Index of fungi inhabiting woody plants in Japan. Host, distribution and literature. Zenkoku-Noson-Kyoiku Kyokai Publishing, Tokyo Koike ST, Bettiga LJ, Nguyen TT, Gubler WD (2016) First report of Cylindrocladiella lageniformis and C. peruviana as grapevine pathogens in California. Plant Dis 100:1783–1784 Kõljalg U, Nilsson RH, Abarenkov K, Tedersoo L, Taylor AF, Bahram M, Bates ST, Bruns TD, Bengtsson-Palme J, Callaghan TM, Douglas B (2013) Towards a unified paradigm for sequence-based identification of fungi. Mol Ecol 22:5271–5277 Konstantinia-Sulidu A (1939) Parasitische Pilze Mazedoniens. Hedwig 78:284–298 Korf RP, Pearson RC, Zhuang WY, Dubos B (1986) Pseudopezicula (Helotiales, Peziculoideae), a new discomycete genus for pathogens causing an angular leaf scorch of grapes (‘‘Rotbrenner’’). Mycotaxon 26:457–471 Koshkelova EN, Frolov IP (1973) Microflora of Kopet-Dag lowland and Central Karakum (micromycetes). Ylym, Ashkhabad Kotlaba F (1997) Some uncommon or rare polypores (Polyporales s.l.) collected on uncommon hosts. Czech Mycol 50:133–142 Kozich JJ, Westcott SL, Baxter NT, Highlander SK (2013) Schloss PD: development of a dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform. Appl Environ Microbiol 79:5112–5120 Kubatova A, Kolarik M, Pazoutova S (2004) Phaeoacremonium rubrigenum-Hyphomycete associated with bark beetles found in Czechia. Folia Microbiol 49:99–104 Kubartova A, Ottosson E, Dahlberg A, Stenlid J (2012) Patterns of fungal communities among and within decaying logs, revealed by 454sequencing. Mol Ecol 21:4514–4532 Kummuang N, Smith BJ, Diehl SV, Graves CH Jr (1996) Muscadine grape berry rot diseases in Mississippi: disease identification and incidence. Plant Dis 80:238–243 75 Kunin V, Engelbrektson A, Ochman H, Hugenholtz P (2010) Wrinkles in the rare biosphere: pyrosequencing errors can lead to artificial inflation of diversity estimates. Environ Microbiol 12:118–123 Kuntze O (1898) Revisio generum plantarum: vascularium omnium atque cellularium multarum secundum leges nomeclaturae internationales cum enumeratione plantarum exoticarum in itinere mundi collectarum. A. Felix 3:1–576 Kuo K-C, Leu L-S (1998) Phomopsis vitimegaspora: a new pathogenic Phomopsis from vines. Mycotaxon 66:497–499 Lane C, Kirk P (2012) Introduction to fungal plant pathogens. CAB International, Cambridge, pp 1–6 Langrell SRH, Morel O, Robin C (2011) Touchdown nested multiplex PCR detection of Phytophthora cinnamomi and P. cambivora from French and English chestnut grove soils. Fungal Biol 115:672–682 Lardner R, Stummer BE, Sosnowski MR, Scott ES (2005) Molecular identification and detection of Eutypa lata in grapevine. Mycol Res 109:799–808 Larignon P, Dubos B (1997) Fungi associated with esca disease in grapevine. Eur J Plant Pathol 103:147–157 Larignon P, Dubos B (2001) The villainy of black dead arm. Wines Vines 82:86–89 Larsen MJ, Nakasone KK (1984) Additional new taxa of Laeticorticium (Aphyllophorales, Corticiaceae). Mycologia 76:528–532 Larter LNH, Martyn EB (1943) A preliminary list of plant diseases in Jamaica. Mycol Pap 8:1–16 Latorre BA, Guerrero MJ (2001) First report of shoot blight of grapevine caused by Sclerotinia sclerotiorum in Chile. Plant Dis 85:1122 Lawrence DP, Travadon R, Baumgartner K (2015) Diversity of Diaporthe species associated with wood cankers of fruit and nut crops in northern California. Mycologia 107:926–940 Lawrence DP, Travadon R, Pouzoulet J, Rolshausen PE, Wilcox WF, Baumgartner K (2017a) Characterization of Cytospora isolates from wood cankers of declining grapevine in North America, with the descriptions of two new Cytospora species. Plant Pathol 66:713–725 Lawrence DP, Peduto Hand F, Gubler WD, Trouillas FP (2017b) Botryosphaeriaceae species associated with dieback and canker disease of bay laurel in northern California with the description of Dothiorella californica sp. nov. Fungal Biol 121:347–360 Lee Y-H, Cho W-D, Kim WK, Jin K-S, Lee E-J (1991) Report on host-unrecorded diseases identified from economical crops in Korea. Res Rep Rural Developm Admin 33:15–19 Li W, Liu J, Bhat DJ, Camporesi E, Xu J, Hyde KD (2014) Introducing the novel species, Dothiorella symphoricarposicola, snowberry in Italy. Cryptog Mycol 35:257–270 Li GJ, Hyde KD, Zhao RN, Hongsanan S, Abdel-Aziz FA, AbdelWahab MA, Alvarado P, Alves-Silva G, Ammirati JF, Ariyawansa HA, Baghela A, Bahkali AH, Beug M, Bhat DJ, Bojantchev D, Boonpratuang T, Bulgakov TS, Camporesi E, Boro MC, Ceska O, Chakraborty D, Chen JJ, Chethana KWT, Chomnunti P, Consiglio G, Cui BK, Dai DQ, Dai YC, Daranagama DA, Das K, Dayarathne MC, Crop ED, De Oliveira RJV, de Souza CAF, de Souza JI, Dentinger BTM, Dissanayake AJ, Doilom M, Drechsler-Santos ER, Ghobad-Nejhad M, Gilmore SP, Góes-Neto A, Gorczak M, Haitjema GH, Hapuarachchi KK, Hashimoto A, He MQ, Henske JK, Hirayama K, Iribarren MJ, Jayasiri SC, Jayawardena RS, Jeon SJ, Jerónimo GH, Jesus AL, Jones EBG, Kang JC, Karunarathna SC, Kirk PM, Konta S, Kuhnert E, Langer E, Lee HS, Lee HB, Li WJ, Li XH, Liimatainen K, Lima DX, Lin CG, Liu JK, Liu XZ, Liu ZY, Luangsa-ard JJ, Lücking R, Lumbsch HT, Lumyong S, Leaño EM, Marano AV, Matsumura M, McKenzie EHC, Mongkolsamrit S, Mortimer PE, Nguyen TTT, Niskanen T, 123 76 Norphanphoun C, O’Malley MA, Parnmen S, Pawłowska J, Perera RH, Phookamsak R, Phukhamsakda C, Pires-Zottarelli CLA, Raspé O, Reck MA, Rocha SCO, de Santiago ALCMA, Senanayake IC, Setti L, Shang QJ, Singh SK, Sir EB, Solomon KV, Song J, Srikitikulchai P, Stadler M, Suetrong S, Takahashi H, Takahashi T, Tanaka K, Tang LP, Thambugala KM, Thanakitpipattana D, Theodorou MK, Thongbai B, Thummarukcharoen T, Tian Q, Tibpromma S, Verbeken A, Vizzini A, Vlasák J, Voigt K, Wanasinghe DN, Wang Y, Weerakoon G, Wen HA, Wen TC, Wijayawardene NN, Wongkanoun S, Wrzosek M, Xiao YP, Xu JC, Yan JY, Yang J, Yang SD, Hu Y, Zhang JF, Zhao J, Zhou LW, Peršoh D, Phillips AJL, Maharachchikumbura SSN (2016) Fungal divers notes 253–366: taxonomic and phylogenetic contributions to fungal taxa. Fungal Divers 78:1–237 Li WJ, Bhat DJ, Camporesi E, Tian Q, Wijayawardene NN, Dai DQ, Phookamsak R, Chomnunti P, Bahkali AH, Hyde KD (2015) New asexual morph taxa in Phaeosphaeriaceae. Mycosphere 6:681–708 Liang C, Jayawardena RS, Zhang W, Wang X, Liu M, Liu L, Zang C, Xu X, Hyde KD, Yan J, Li X, Zhao K (2016) Identification and characterization of Pseudocercospora species causing grapevine leaf spot in China. J Phytopathol 164:75–85 Linaldeddu BT, Deidda A, Scanu B, Franceschini A, Serra S, BerrafTebbal A, Zouaoui Boutiti M, Ben Jamaa ML, Philips AJL (2015) Diversity of Botryosphaeriaceae species associated with grapevine and other woody hosts in Italy, Algeria and Tunisia, with descriptions of Lasiodiplodia exigua and Lasiodiplodia mediterranea sp. nov. Fungal Divers 71:201–214 Linaldeddu BT, Deidda A, Scanu B, Franceschini A, Alves A, Abdollahzadeh J, Phillips AJL (2016) Phylogeny, morphology and pathogenicity of Botryosphaeriaceae, Diatrypaceae and Gnomoniaceae associated with branch diseases of hazelnut in Sardinia (Italy). Eur J Plant Pathol 146:259–279 Litzenberger SC, Farr ML, Lip HT (1962) A preliminary list of Cambodian plant diseases. Div Agric Nat Res, USAID Minist Agric Phnom-Penh, Cambodia Liu PSW (1977) A supplement to a host list of plant diseases in Sabah, Malaysia. Phytopathol Pap 21:1–49 Liu X-J, Guo Y-L (eds) (1998) Flora Fungorum Sinicorum. Pseudocercospora, vol 9. Science Press, Beijing Liu JK, Hyde KD, Jones EBG, Ariyawansa HA, Bhat DJ, Boonmee S, Maharachchikumbura S, McKenzie EHC, Phookamsak R, Phukhamsakda C, Shenoy BD, Abdel-Wahab MA, Buyck B, Chen J, Chethana KWT, Singtripop C, Dai DQ, Dai YC, Daranagama DA, Dissanayake AJ, Doliom M, D’souza MJ, Fan XL, Goonasekara ID, Hirayama K, Hongsanan S, Jayasiri SC, Jayawardena RS, Karunarathna SC, Li WJ, Mapook A, Norphanphoun C, Pang KL, Perera RH, Peršoh D, Pinruan U, Senanayake IC, Somrithipol S, Suetrong S, Tanaka K, Thambugala KM, Tian Q, Tibpromma S, Udayanga D, Wijayawardena NN, Wanasinghe D, Wisitrassameewong K, Abdel-Aziz FA, Adamčı́k S, Bahkali AH, Boonyuen N, Bulgakov T, Callac P, Chomnunti P, Greiner K, Hashimoto A, Hofstetter V, Kang JC, Lewis D, Li XH, Liu XX, Liu ZY, Matumura M, Mortimer PE, Rambold G, Randrianjohany E, Sato G, Sri-Indrasutdhi V, Tian CM, Verbeken A, von Brackel W, Wang Y, Wen TC, Xu JC, Yan JY, Zhao RL, Camporesi E (2015) Fungal diversity notes 1–110: taxonomic and phylogenetic contributions to fungal species. Fungal Divers 72:1–197 Liu QL, Li GQ, Li JQ, Chen SF (2016a) Botrytis eucalypti, a novel species isolated from diseased Eucalyptus seedlings in South China. Mycol Progr 15:1057–1079 Liu M, Zhang W, Zhou Y, Liu Y, Yan JY, Li XH, Jayawardena RS, Hyde KD (2016b) First report of twig anthracnose on grapevine 123 Fungal Diversity (2018) 90:1–84 caused by Colletotrichum nymphaeae in China. Plant Dis 100:2530 Lombard L, Houbraken J, Decock C, Samson RA, Meijer M, Réblová M, Groenewald JZ, Crous PW (2016) Generic hyper-diversity in Stachybotriaceae. Persoonia 36:156 Longland JM, Sutton TB (2008) Factors affecting the infection of fruit of Vitis vinifera by the bitter rot pathogen Greeneria uvicola. Phytopathology 98:580–584 Lorsuwan C, Tontyaporn S, Visarathanonth N, Manoch L, Kakishima M (1984) Materials for the rust flora in Thailand I. Trans Mycol Soc Jpn 25:57–65 Lotz-Winter H, Hofmann T, Kirschner R, Kursawe M, Trampe T, Piepenbring M (2011) Fungi in the Botanical Garden of the University of Frankfurt. Z Mykol 77:89–122 Lu B, Hyde KD, Ho WH, Tsui KM, Taylor JE, Wong KM, Yanna, Zhou D (2000) Checklist of Hong Kong Fungi. Fungal Diversity Press, Hong Kong Lubbe CM, Denman S, Cannon PF, Groenewald JZ, Lamprecht SC, Crous PW (2004) Characterization of Colletotrichum species associated with diseases of Proteaceae. Mycologia 96:1268–1279 Lücking R, Moncada B (2017) Dismantling Marchandiomphalina into Agonimia (Verrucariaceae) and Lawreymyces gen. nov. (Corticiaceae): setting a precedent to the formal recognition of thousands of voucherless fungi based on type sequences. Fungal Divers 84:119–138 Luongo L, Santori A, Riccioni L, Belisario A (2011) Phomopsis sp. associated with post-harvest fruit rot of kiwifruit in Italy. J Plant Pathol 93:205–209 Luque J, Martos S, Phillips AJL (2005) Botryosphaeria viticola sp. nov. on grapevines: a new species with a Dothiorella anamorph. Mycologia 97:1111–1121 Luque J, Martos S, Aroca A, Raposo R, Garcia-Figueres F (2009) Symptoms and fungi associated with declining mature grapevine plants in northeast Spain. J Plant Pathol 91:381–390 Magoč T, Salzberg SL (2011) FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics 27:2957–2963 Magyar D, Shoemaker RA, Bobvos J, Crous PW, Groenewald JZ (2011) Pyrigemmula, a novel hyphomycete genus on grapevine and tree bark. Mycol Progr 10:307–314 Maharachchikumbura SSN, Guo LD, Chukeatirote E, Bahkali AH, Hyde KD (2011) Pestalotiopsis—morpholgy, phylogeny, biochemsitry and diversity. Fungal Divers 50:167–187 Maharachchikumbura SSN, Crous PW, Groenewald JZ, Xu J, Hyde KD (2014) Pestalotiopsis revisited. Stud Mycol 79:121–186 Maharachchikumbura SN, Hyde KD, Jones EBG, McKenzie EHC, Huang SK, Abdel-Wahab MA, Daranagama DA, Dayarathne M, D’souza MJ, Goonasekara ID, Hongsanan S, Jayawardena RS, Kirk PM, Konta S, Liu JK, Liu Z-Y, Norphanphoun C, Pang KL, Perera RH, Senanayake IC, Shang Q, Shenoy BD, Xiao Y, Bahkali AH, Kang J, Somrothipol S, Suetrong S, Wen T, Xu J (2015) Towards a natural classification and backbone tree for Sordariomycetes. Fungal Divers 72:199 Maharachchikumbura SSN, Larigon P, Hyde KD, Al-Sadi AM, Liu Z (2016) Characteriztion of Neopestalotiopsis, Pestalotiopsis and Truncatella species associated with grapevine trunk disease in France. Phytopathol Mediterr 55:380–390 Mahdian S, Zafari D (2017) First report of table grape blue mold caused by Penicillium sumatrense in Iran. Plant Dis 101:244 Makovetz S (1933) Contributions to the mycoflora of the Ukraine. Bull Jard Bot Kieff 16:71–87 Maluta D-R, Larignon P (1991) Pied-noir: mieux vaut prévenir. Viticulture 11:71–72 Fungal Diversity (2018) 90:1–84 Manamgoda DS, Rossman AY, Castlebury LA, Crous PW, Madrid H, Chukeatirote E, Hyde KD (2014) The genus Bipolaris. Stud Mycol 79:221–288 Maneval WE (1937) A list of the Missouri Fungi; with special reference to plant pathogens and wood-destroying species. Univ Missouri Stud Sci Ser 12:1–150 Marais PG (1979) Fungi associated with root rot in vineyards in the Western Cape. Phytophylactica 11:65–68 Marais PG (1980) Fungi associated with decline and death of nursery grapevines in the Western Cape. Phytophylactica 12:9–13 Marchesi JR, Ravel J (2015) The vocabulary of microbiome research: a proposal. Microbiome 3:31 Marin-Felix Y, Groenewald JZ, Cai L, Chen Q, Marincowitz S, Barnes I, Bensch K, Braun U, Camporesi E, Damm U, de Beer ZW, Dissanayake A, Edwards J, Giraldo A, Hernández-Restrepo M, Hyde KD, Jayawardena RS, Lombard L, Luangsa-ard J, McTaggart AR, Rossman AY, Sandoval-Denis M, Shen M, Shivas RG, Tan YP, van der Linde EJ, Wingfield MJ, Wood AR, Zhang JQ, Zhang Y, Crous PW (2017) Genera of phytopathogenic fungi: GOPHY 1. Stud Mycol 86:99–216 Martin MT, Cobos R (2007) Identification of fungi associated with grapevine decline in Castilla y Leon (Spain). Phytopathol Mediterr 46:18–25 Martin MT, Martin L, de-Francisco MT, Cobos R (2009) First report of Lasiodiplodia theobromae and Cryptovalsa ampelina associated with grapevine decline from Castilla y Leon, Spain. Plant Dis 93:545 Martin MT, Martin L, Cuesta MJ, Garcia-Benavides P (2011a) First report of Cylindrocarpon pauciseptatum associated with grapevine decline from Castilla y Leon, Spain. Plant Dis 95:361 Martin MT, Martin L, Cuesta MJ (2011b) First report of Neofusicoccum mediterraneum and N. austral causing decay in Vitis vinifera in Castilla y Leon, Spain. Plant Dis 95:876 Martin FN, Blair JE, Coffey MD (2014) A combined mitochondrial and nuclear multilocus phylogeny of the genus Phytophthora. Fungal Genet Biol 66:19–32 Martiny JBH, Bohannan BJM, Brown JH, Colwell RK, Fuhrman JA, Green JL, Horner-Devine MC, Kane M, Krumins JA, Kuske CR, Morin PJ, Naeem S, Ovreås L, Reysenbach AL, Smith VH, Staley JT (2006) Microbial biogeography: putting microorganisms on the map. Nat Rev Microbiol 4:102–112 Mathur RS (1979) The Coelomycetes of India. Bishen Singh Mahendra Pal Singh, Delhi Mayorquin JS, Wang DH, Twizeyimana M, Eskalen A (2016) Identification, distribution, and pathogenicity of Diatrypaceae and Botryosphaeriaceae associated with citrus branch canker in the Southern California desert. Plant Dis 100:2402–2413 McDonald V, Eskalen A (2011) Botrysphaeriaceae species associated with avacado branch cankers in California. Plant Dis 95:1465–1473 McKirdy SJ, Riley IT, Cameron IJ (1999) First report of grapevine downy mildew (Plasmopara viticola) in commercial viticulture in Western Australia. Plant Dis 83:301 McLeod A, Botha WJ, Meitz JC, Spies CFJ, Tewoldemedhin YT, Mostert L (2009) Morphological and phylogenetic analyses of Pythium species in South Africa. Mycol Res 113:933–951 Melnik VA, Popushoi IS (1992) Imperfect fungi on species of trees and shrubs (U.S.S.R.). Unknown journal or publisher Mena-Portales J, Delgado-Rodriguez G, Heredia-Abarca G (2000) New combinations for species of Sporidesmium s.l. Bol Soc Micol Madrid 25:265–269 Mendes MAS, da Silva VL, Dianese JC, Ferreira M, Santos CD, Gomes NE, Urben A, Castro C (1998) Fungos em Plantas no Brasil. Embrapa-SPI/Embrapa-Cenargen, Brasilia Mey G, Oeser B, Lebrun MH, Tudzynski P (2002) The biotrophic, non-appressorium-forming grass pathogen Claviceps purpurea 77 needs a Fus3/Pmk1 homologous mitogen-activated protein kinase for colonization of rye ovarian tissue. Mol Plant Microbe Interact 15:303–312 Michailides TJ, Peacock W, Christensen P, Morgan DP, Felts D (2002) First report of Aspergillus vine canker of table grapes caused by Aspergillus niger. Plant Dis 86:75 Milholland RD (1994) Macrophoma rot. In: Pearson RC, Goheen AC (eds) Compendium of grape diseases. APS Press, St Paul Miller JW (1991) Bureau of Plant Pathology. Tri-ol Tech Rep Div Pl Ind Florida 30:2–4 Mills SD, Foerster H, Coffey MD (1991) Taxonomic structure of Phytophthora cryptogea and P. drechsleri based on isozyme and mitochondrial DNA analyses. Mycol Res 95:31–48 Mirzaei S, Nahvi MJ, Khaledi E, Abdollahzadeh J, Amini J, Abrinbana M (2015) Molecular and morphological characterization of Endoconidioma populi from Kurdistan province, Iran. Mycol Iran 2:127–133 Mitchell JI, Zuccaro A (2006) Sequences, the environment and fungi. Mycologist 20:62–74 Mohammadi H, Banihashemi Z (2012) First report of Phaeoacremonium inflatipes and Phaeoacremonium mortoniae associated with grapevine Petri disease in Iran. J Agric Sci Technol 14:1405–1414 Mohammadi H, Banihashemi Z, Gramaje D, Armengol J (2013a) Fungal pathogens associated with grapevine trunk diseases in Iran. J Agric Sci Technol 15:137–150 Mohammadi H, Gramaje D, Banihashemi Z, Armengol J (2013b) Characterization of Diplodia seriata and Neofusicoccum parvum associated with grapevine decline in Iran. J Agric Sci Technol 15:603–616 Moller WJ, Kasimatis AN, Kissler JJ (1974) A dying arm disease of grape in California. Plant Dis Rep 58:869–871 Mondello V, Lo Piccolo S, Conigliaro G, Alfonzo A, Torta L, Burruano S (2013) First report of Neofusicoccum vitifusiforme and presence of the Botryosphaeriaceae species associated with Botryosphaeria dieback of grapevine in Sicily (Italy). Phytopathol Mediterr 52:388–396 Montagne JFC (1856) Sylloge generum specierumque plantarum cryptogamarum, vol 1. J. B. Bailliere, Paris, pp. 1–498 Moralejo E, Clemente A, Descals E, Belbahri L, Calmin G, Lefort F, Spies CFJ, McLeod A (2008) Pythium recalcitrans sp. nov. revealed by multigene phylogenetic analysis. Mycologia 100:310–319 Morgan DP, Michailides TJ (2004) First report of melting decay of ‘Red Globe’ grapes in California. Plant Dis 88:1047 Mostert L, Crous PW, Kang JC, Phillips AJL (2001) Species of Phomopsis and a Libertella sp. occurring on grapevines with specific reference to South Africa: morphological, cultural, molecular and pathological characterization. Mycologia 93:146–167 Mostert L, Halleen F, Creaser ML, Crous PW (2004) Cryptovalsa ampelina, a forgotten shoot and cane pathogen of grapevines. Australas Plant Pathol 33:295–299 Mostert L, Halleen F, Fourie P, Crous PW (2006) A review of Phaeoacremonium species involved in Petri disease and esca of grapevines. Phytopathol Mediterr 45:12–29 Mouchacca J (2009) Novel fungal taxa from the arid Middle East introduced prior to the year 1940. II. Anamorphic fungi: hypomycetes. Cryptog Mycol 30:199–222 Mugnai L, Graniti A, Surico G (1999) Esca (black measles) and brown wood-streaking: two old and elusive diseases of grapevines. Plant Dis 83:404–418 Mujica F, Oehrens B (1967) Segunda addenda a flora fungosa Chilena. Boletin Tecnico 27:1–78 123 78 Mujica F, Vergara C (1945) Flora fungosa Chilena. Indice preliminar de los huespedes de los hongos chilenos y sus referencias bibliograficas. Imprenta Stanley Mulenko W, Majewski T, Ruszkiewicz-Michalska M (2008) A preliminary checklist of micromycetes in Poland, vol 9. W. Szafer Institute of Botany, Polish Academy of Sciences, p 752 Mundkur BB (1943) Indian species of Phakopsora and Bubakia. Mycologia 35:538–545 Mundkur BB, Thirumalachar MJ (1946) Revisions of and additions to Indian fungi. I. Mycol Pap 16:1–27 Muthumary J, Qaiser AS, Sutton BC (1986) Reassessment of Monochaetia terminaliae. Trans Br Mycol Soc 87:103–108 Nag Raj TR (1988) Redisposals and redescriptions in the Monochaetia-Seiridium, Pestalotia-Pestalotiopsis complexes. VIII. On the status of Monochaetia camelliae, M. osyridella and Pestalotia gaurae. Mycotaxon 32:121–132 Nag Raj TR (1993) Coelomycetous anamorphs with appendagebearing conidia. Mycologue Publications, Waterloo, pp 1–1101 Nag Raj TR, Kendrick B (1975) A monograph of Chalara and allied genera. Wilfrid Laurier University Press, Ontario Nagorny P (1930) Die pilsflora der Kaukasischen Weinreve. Trav Jard Bot Tiflis Ser II 5:1–201 Nakagiri A, Tadayoshi ITO, Hatamoto M (1994) Brown zonate spot of grape caused by Briosia ampelophaga. Jpn J Phytopathol 60:608–612 Nakaune R, Tatsuki M, Matsumoto H, Ikoma Y (2016) First report of a new postharvest disease of grape caused by Cadophora luteoolivacea. J Gen Plant Pathol 82:116–119 Nasyrov O (1964) Some species of fungi Imperfecti, new for Turkmenistan in the valley of the middle Ama-Darya. Akad Nauk Turkmen SSR Iav Ser Biol Nauk 3:1–116 Nattrass RM (1961) Host lists of Kenya fungi and bacteria. Mycol Pap 81:1–46 Navarrete F, Abreo E, Bettucci L, Martinez S, Lupo S (2009) First report of Greeneria uvicola as cause of grapevine dead-arm dieback in Uruguay. Australas Plant Dis Notes 4:117–119 Netto MSB, Assuncao IP, Lima GSA, Marques MW, Lima WG, Monteiro JHA, Michereff SJ, Phillips AJL, Camara MPS, de Queiroz Balbino V (2014) Species of Lasiodiplodia associated with papaya stem-end rot in Brazil. Fungal Divers 67:127–141 Netto MSB, Lima WG, Correia KC, Da Silva CFB, Thon M, Martins RB, Miller RNG, Michereff SJ, Camara MPS (2017) Analysis of phylogeny, distribution, and pathogenicity of Botryosphaeriaceae species associated with gummosis of Anacardium in Brazil, with a new species of Lasiodiplodia. Fungal Biol 121:437–451 Nguyen NH, Song Z, Bates ST, Branco S, Tedersoo L, Menke J, Schilling JS, Kennedy PG (2015) FUNGuild: an open annotation tool for parsing fungal community datasets by ecological guild. Fungal Ecol 20:241–248 Niessl G (1871) Beiträge zur Kenntniss der Pilze. Beschreibung neuer und wenig bekannter Pilze. Verhandlungen des Naturforschenden Vereines in Brünn 10:153–217 Nogueira AF Jr, Fischer IH, Braganca CAD, Massola NS Jr, Amorim L (2016) Identification of Botryosphaeriaceae species that cause stylar-end rot of guavas and characterisation of the disease monocycle. Eur J Plant Pathol 144:271–287 Nomura Y, Takamatsu S, Fujioka K (2003) Teleomorph of Erysiphe necator var. necator on Vitis vinifera and Ampelopsis brevipedunculata var. heterophylla (Vitaceae) newly found in Japan. Mycoscience 44:157–158 Norse D (1974) Plant diseases in Barbados. Phytopathol Pap 18:1–38 O’Donnell K, Cigelnik E, Nirenberg HI (1998) Molecular systematics and phylogeography of the Gibberella fujikuroi species complex. Mycologia 90:465–493 123 Fungal Diversity (2018) 90:1–84 Oh S-Y, Nam K-W, Yoon D-H (2014) Identification of Acremonium acutatum and Trichothecium roseum isolated from grape with white stain symptom in Korea. Mycobiology 42:269–273 Ono Y (2000) Taxonomy of the Phakopsora ampelopsidis species complex on vitaceous hosts in Asia includes a new species, P. euvitis. Mycologia 92:154–173 Ono Y (2016) Mixed infections of grapevine leaf rusts Phakopsora meliosmae-myrianthae and P. montana in Japan. J Gen Plant Pathol 82:149–153 Orieux L, Felix S (1968) List of plant diseases in Mauritius. Phytopathol Pap 7:1–48 Oudemans P, Coffey MD (1991) Isozyme comparison within and among worldwide sources of three morphologically distinct species of Phytophthora. Mycol Res 95:19–30 Ozben S, Demirci F, Degirmenci K, Uzunok S (2012) First report of Cylindrocarpon macrodidymum associated with black foot diseases of Grapevine in Turkey. Plant Dis 96:762 Padwick GW (1946) Notes on Indian fungi. IV. Mycol Pap 17:1–12 Pan FY, Huang Y, Lin L, Zhou YM, Wei RF, Guo WF, Yin L, Lu J (2016) First report of Colletotrichum capsici causing grape ripe rot in Guangxi, China. Plant Dis 100:2531 Pancher M, Ceol M, Corneo PE, Longa CMO, Yousaf S, Pertot I, Campisano A (2012) Fungal endophytic communities in grapevines (Vitis vinifera L.) respond to crop management. Appl Environ Microbiol 78:4308–4317 Pande A (2008) Ascomycetes of Peninsular India. Scientific Publishers (India), Jodhpur Pantidou ME (1973) Fungus–host index for Greece. Benaki Phytopathological Institute, Kiphissia, Athens Paolinelli-Alfonso M, Villalobos-Escobedo JM, Rolshausen P, Herrera-Estrella A, Galindo-Sánchez C, López-Hernández JF, Hernandez-Martinez R (2016) Global transcriptional analysis suggests Lasiodiplodia theobromae pathogenicity factors involved in modulation of grapevine defensive response. BMC Genomics 17:615 Pardo Cardona VM (1998) Distribucion de las especies colombianas de Uredinales segun los grupos taxonomicos de sus hospederos. Rev Fac Nal Agr Medellin 51:285–319 Park M-J, Choi Y-J, Hong S-B, Shin H-D (2010) Genetic variability and mycohost association of Ampelomyces quisqualis isolates inferred from phylogenetic analyses of ITS rDNA and actin gene sequences. Fungal Biol 114:235–247 Parkinson LE, Shivas RG, Dann EK (2017) Pathogenicity of Nectriaceous fungi on avocado in Australia. Phytopathology 107:1479–1485 Parris GK (1959) A revised host index of Mississippi plant diseases. Miss State Univ Bot Dept Misc Publ 1:1–146 Pascoe I, Cottral E (2000) Developments in grapevine trunk diseases research in Australia. Phytopathol Mediterr 39:68–75 Passerini (1872) Erb Critt Ital Ser 2:595 Patil MS, Mahamulkar SH (1999) Studies on Meliolaceae of India IV. Indian Phytopathol 52:245–253 Paul YS, Thakur VK (2006) Indian Erysiphaceae. Scientific Publishers (India), Jodhpur Pavlic-Zupanc D, Piskur B, Slippers B, Wingfield MJ, Jurc D (2015) Molecular and morphological characterization of Dothiorella species associated with dieback of Ostrya carpinifolia in Slovenia and Italy. Phytopathol Mediterr 54:222–231 Pearson RC, Smith FD, Dubos B (1988) Angular leaf scorch, a new disease of grapevines in North America caused by Pseudopezicula tetraspora. Plant Dis 72:796–800 Peng L-J, Sun T, Yang Y-L, Cai L, Hyde KD, Bahkali AH, Liu Z-Y (2013) Colletotrichum species on grape in Guizhou and Yunnan provinces, China. Mycoscience 54:29–41 Pennycook SR (1989) Plant diseases recorded in New Zealand, vols 1–3. Plant Diseases Division, DSIR, Auckland Fungal Diversity (2018) 90:1–84 Peregrine WTH, Ahmad KB (1982) Brunei: a first annotated list of plant diseases and associated organisms. Phytopathol Pap 27:1–87 Peregrine WTH, Siddiqi MA (1972) A revised and annotated list of plant diseases in Malawi. Phytopathol Pap 16:1–51 Péros JP, Jamaux-Despréaux I, Berger G, Gerba D (1999) The potential importance of diversity in Eutypa lata and cocolonising fungi in explaining variation in development of grapevine dieback. Mycol Res 103:1385–1390 Peter G, Tornai-Lehoczki J, Suzuki M, Dlauchy D (2005) Metschnikowia viticola sp. nov., a new yeast species from grape. Antonie van Leeuwenhoek Suppl 87:155–160 Petit E, Gubler WD (2005) Characterization of Cylindrocarpon species, the cause of black foot disease of grapevine in California. Plant Dis 89:1051–1059 Petit E, Gubler WD (2007) First report of Cylindrocarpon liriodendri causing black foot disease of grapevine in California. Plant Dis 91:1060 Petit E, Barriault E, Baumgartner K, Wilcox WF, Rolshausen PE (2011) Cylindrocarpon species associated with black-foot of grapevine in northeastern United States and southeastern Canada. Am J Enol Vitic 62:177–183 Petrak F (1953) Ein Beitrag zur Pilzflora Floridas. Sydowia 7:103–116 Petrak F, Sydow H (1927) Die Gattungen der Pyrenomyzeten, Sphaeropsideen und Melanconieen. 1. Die phaeosporen Sphaeropsideen und die Gattung Macrophoma. Repert Spec Nov Regni Veg 42:1–551 Petrini LE (1992) Rosellinia species of the temperate zones. Sydowia 44:169–281 Petrini LE (2013) Rosellinia—a world monograph. Biblioth Mycol 205:410 Pettersson OV, Leong SL, Lantz H, Rice T, Dijksterhuis J, Houbraken J, Samson RA, Schnurer J (2011) Phylogeny and intraspecific variation of the extreme xerophile, Xeromyces bisporus. Fungal Biol 115:1100–1111 Phengsintham P, Braun U, McKenzie EHC, Chukeatirote E, Cai L, Hyde KD (2013) Monograph of Cercosporoid fungi from Thailand. Plant Pathol Q 3:67–138 Phillips AJL (1998) Botryosphaeria dothidea and other fungi associated with excoriose and dieback of grapevines in Portugal. J Phytopathol 146:327–332 Phillips AJL (1999) The relationship between Diaporthe perjuncta and Phomopsis viticola on grapevines. Mycologia 91:1001–1007 Phillips AJL (2000) Excoriose, cane blight and related diseases of grapevines: a taxonomic review of the pathogens. Phytopathol Mediterr 39:341–356 Phillips AJL, Lucas MT (1997) The taxonomic status of Macrophoma flaccid and Macrophoma reniformis and their relationship to Botryosphaeria dothidea. Sydowia 49:150–159 Phillips AJL, Fonseca F, Povoa V, Castilho R, Nolasco G (2002) A reassessement of the anamorphic fungus Fusicoccum luteum and description of its teleomorph Botryosphaeria lutea sp. nov. Sydowia 54:59–77 Phillips A, Alves A, Correia A, Luque J (2005) Two new species of Botryosphaeria with brown, 1-septate ascospores and Dothiorella anamorphs. Mycologia 97:513–529 Pintos Varela C, Redondo Fernandez V, Aguin Casal O, Ferreiroa Martinez V, Mansilla Vazquez JP (2016) First report of Pleurostoma richardsiae causing grapevine trunk disease in Spain. Plant Dis 100:2168 Pintos VC, Redondo Fernandez V, Aguin Casal O, Mansilla Vazuez JP (2011) First report of cankers and dieback caused by Neofusicoccum mediterraneum and Diplodia corticola on Grapevine in Spain. Plant Dis 95:1315 79 Piqueras CM, Herrera D, Latorre BA (2014) First report of high boscalid resistance in Botrytis cinerea associated with the H272L mutation in grapevine in Chile. Plant Dis 98:1441 Pirnia M, Zare R, Zamanizadeh HR, Khodaparast A (2012) New records of cercosporoid hyphomycetes from Iran. Mycotaxon 120:157–169 Pitt WM, Huang R, Steel CC, Savocchia S (2010) Identification, distribution and current taxonomy of Botryosphaeriaceae species associated with grapevine decline in New South Wales and South Australia. Aust J Grape Wine Res 16:258–271 Pitt WM, Úrbez-Torres JR, Trouillas FP (2013) Dothiorella vidmadera, a novel species from grapevines in Australia and notes on Spencermartinsia. Fungal Divers 61:209–219 Pitt WM, Úrbez-Torres JR, Trouillas FP (2015) Dothiorella and Spencermartinsia, new species and records from grapevines in Australia. Australas Plant Pathol 44:43–56 Pollack FG (1987) An annotated compilation of Cercospora names. Mycol Mem 12:1–212 Pons N, Sutton BC (1988) Cercospora and similar fungi on yams (Dioscorea species). Mycol Pap 160:1–78 Pota S, Chatasiri S, Unartngam J, Yamaoka Y, Hosaka K, Ono Y (2015) Taxonomic identity of a Phakopsora fungus causing the grapevine leaf rust disease in Southeast Asia and Australasia. Mycoscience 56:198–204 Preston DA (1945) Host index of Oklahoma plant diseases. Oklahoma Agric Coll Agric Exp Sta Techn Bull T 21:1–168 Priest MJ (2006) Fungi of Australia: Septoria. ABRS/CSIRO Publishing, Canberra/Melbourne Prodorutti D, De Luca F, Michelon L, Pertot I (2009) Susceptibility to Armillaria mellea root rot in grapevine rootstocks commonly grafted onto Teroldego Rotaliano. Phytopathol Mediterr 48:285–290 Promputtha I, Lumyong S, Dhanasekaran V, McKenzie EHC, Hyde KD, Jeewon R (2007) A phylogenetic evaluation of whether endophytes become saprotrophs at host senescence. Microb Ecol 53:579–590 Promputtha I, Hyde KD, McKenzie EH, Peberdy JF, Lumyong S (2010) Can leaf degrading enzymes provide evidence that endophytic fungi becoming saprobes? Fungal Divers 41:89–99 Purahong W, Wubet T, Krüger D, Buscot F (2018) Molecular evidence strongly supports deadwood-inhabiting fungi exhibiting unexpected tree species preferences in temperate forests. ISME J 12:article 289 Qiu Y, Steel CC, Ash GJ, Savocchia S (2011) Survey of Botryosphaeriaceae associated with grapevine decline in the Hunter Valley and Mudgee grape growing regions of New South Wales. Australas Plant Pathol 40:1–11 Raabe RD (1966) Check list of plant diseases previously unreported in Hawaii. Plant Dis Rep 50:411–414 Raabe RD, Conners IL, Martinez AP (1981) Checklist of plant diseases in Hawaii. College of Tropical Agriculture and Human Resources, University of Hawaii. Information Text Series No. 22. Hawaii Inst Trop Agric Human Resources Radulescu E, Negru A, Docea E (1973) Septoriozele din Romania. Ed Acad Rep Soc Romania Bucarest Ragunathan AN, Ramakrishnan K (1973) Rust fungi of Madras State. VII. Kuehneola, Hamaspora, Phragmotelium, Phragmidium, Diorchidium, Ravenelia, Hapalophragmium and Nyssopsora. Mysore J Agric Sci 7:73–86 Raimondo ML, Lops F, Carlucci A (2014) Phaeoacremonium italicum sp. nov., associated with esca of grapevine in southern Italy. Mycologia 106:1119–1126 Rajak RC, Pandey AK (1985) Fungi from Jabalpur-II. Indian J Mycol Plant Pathol 15:186–194 Rajchenberg M, Robledo G (2013) Pathogenic polypores in Argentina. For Pathol 43:171–184 123 80 Rappaz F (1987) Taxonomy and nomenclature of the octosporous Diatrypaceae. Mycol Helv 2:285–648 Rastogi G, Sani RK (2011) Molecular techniques to assess microbial community structure, function, and dynamics in the environment. In: Microbes and microbial technology, Springer, New York, pp29–57 Reddy MS, Reddy KRC (1983) Greeneria fruit rot—an endemic disease of grape in India. Indian Phytopathol 36:110–114 Rego C, Oliveira H, Carvalho A, Phillips A (2000) Involvement of Phaeoacremonium spp. and Cylindrocarpon destructans with grapevine decline in Portugal. Phytopathol Mediterr 39:76–79 Riley EA (1960) A revised list of plant diseases in Tanganyika Territory. Mycol Pap 75:1–42 Rolshausen PE, Trouillas F, Gubler WD (2004) Identification of Eutypa lata by PCR-RFLP. Plant Dis 88:925–929 Rolshausen PE, Akgul DS, Perez R, Eskalen A, Gispert C (2013) First report of wood canker caused by Neoscytalidium dimidiatum on grapevine in California. Plant Dis 97:1511 Rolshausen PE, Baumgartner K, Travadon R, Pouzoulet J, Fujiyoshi P, Wilcox WF (2014) Identification of Eutypa spp. causing Eutypa dieback of grapvine in Eastern North America. Plant Dis 98:483–491 Rooney-Latham S, Janousek CN, Eskalen A, Gubler WD (2008) First report of Aspergillus carbonarius causing Sour rot of table grapes (Vitis vinifera) in California. Plant Dis 92:651 Roux J, Wingfield MJ, Morris MJ (1997) Botryosphaeria dothidea, a pathogen of Acacia mearnsii in South Africa. S Afr J Sci 93:xii Rusanov VA, Bulgakov TS (2008) Powdery mildew fungi of Rostov region. Mikol Fitopatol 42:314–322 Ruszkiewicz-Michalska M, Michalski M (2005) Phytopathogenic micromycetes in central Poland. I. Peronosporales and Erysiphales. Acta Mycol 40:223–250 Saccardo PA (1878) Fungi Veneti novi vel critici vel mycologiae Venetae addendi. Ser VII Michelia 1:133–221 Saccardo P, Traverso G (1903) Contribuzione alla flora micologica della Sardegna. Ann Myc 1:427–444 Saito S, Margosan D, Michailides TJ, Xiao CL (2016) Botrytis californica, a new cryptic species in the B. cinerea species complex causing gray mold in blueberries and table grapes. Mycologia 108:330–343 Sakalidis ML, Slippers B, Wingfield BD, St J Hardy GE, Burgess TI (2013) The challenge of understanding the origin, pathways and extent of fungal invasions: global populations of the Neofusicoccum parvum—N. ribis species complex. Div Distrib 19:873–883 Salazar-Yepes M, Buritica P, Cadena-Gomez G (2002) Implicaciones de los estudios sobre biodiversidad de los Uredinales (Royas) en la region cafetera colombiana. Cenicafe 53:219–238 Sami S, Mohammadi H, Heydarnejad J (2014) Phaeoacremonium species associated with necrotic wood of pome fruit trees in Iran. J Plant Pathol 96:487–495 Sanoamuang N, Jitjak W, Rodtong S, Whalley AJS (2013) Gelatinomyces siamensis gen. sp. nov. (Ascomycota, Leotiomycetes, incertae sedis) on bamboo in Thailand. IMA Fungus 4:71–87 Santos C, Fragoeiro S, Valentim H, Phillips A (2006) Phenotypic characterisation of Phaeoacremonium and Phaeomoniella strains isolated from grapevines: enzyme production and virulence of extra-cellular filtrate on grapevine calluses. Sci Horti 107:123–130 Santos JM, Correia VG, Phillips AJL (2010) Primers for mating-type diagnosis in Diaporthe and Phomopsis: their use in teleomorph induction in vitro and biological species definition. Fungal Biol 114:255–270 Santos R, Blume E, Muniz M, Harakawa R, Garrido R, Rego C (2014) Characterization of Campylocarpon pseudofasciculare 123 Fungal Diversity (2018) 90:1–84 associated with black foot of grapevine in southern Brazil. Phytopathol Mediterr 53:06–415 Sarbhoy AK, Agarwal DK (1990) Descriptions of tropical plant pathogenic fungi. Set 1 to 10. Malhotra Publ. House, New Delhi Sarbhoy AK, Lal G, Varshney JL (1971) Fungi of India (1967–71). Navyug Traders, New Delhi Savas NG, Akgul DS, Albaz EA (2015) First report of Ilyonectria liriodendra associated with black foot disease of grapevine in Turkey. Plant Dis 99:1855 Savulescu T, Rayss T (1935) The species of Cercospora parasitic on Vine leaves in Palestine. Rev Pathol Veg 22:3 Sawada K (1943) Descriptive catalogue of the Formosan fungi. Part IX. Rep Dept Agric Govt Res Inst Formosa 86:1–178 Sawada K (1959) Descriptive catalogue of Taiwan (Formosan) fungi. XI. Spec Publ Coll Agric Natl Taiwan Univ 8:1–268 Sawant IS, Narkar SP, Shetty DS, Upadhyay A, Sawant SD (2012) First report of Colletotrichum capsici causing anthracnose on grapes in Maharashtra, India. New Dis Rep 25:2 Scheck HJ, Vasquez SJ, Gubler WD (1998a) First report of black-foot disease, caused by Cylindroncarpon obtusisporum, of grapevine in California. Plant Dis 82:448 Scheck HJ, Vasquez SJ, Fogle D, Gubler WD (1998b) Grape growers report losses to black-foot and grapevine decline. Calif Agric 52:19–23 Scheper RWA, Crane DC, Whisson DL, Scott ES (2000) The Diaporthe teleomorph of Phomopsis taxon 1 on grapevine. Mycol Res 104:226–231 Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad Sci USA 109:6241–6246 Schubert K, Braun U (2005) Taxonomic revision of the genus Cladosporium s.l. 4. Species reallocated to Asperisporium, Dischloridium, Fusicladium, Passalora, Pseudoasperisporum and Stenella. Fungal Divers 20:187–208 Schulzer S (1870) Mykologische Beiträge. Verhandlungen der Zoologisch-Botanischen Gesellschaft Wien 20:635–658 Seifert KA (1985) A monograph of Stilbella and some allied Hyphomycetes. Stud Mycol 27:1–234 Seifert KA, Axelrood PE (1998) Cylindrocarpon destructans var. destructans. Can J Plant Pathol 20:115–117 Seifert KA, McMullen CR, Yee D, Reeleder RD, Dobinson KF (2003) Molecular differentiation and detection of ginsengadapted isolates of the root rot fungus Cylindrocarpon destructans. Phytopathology 93:1533–1542 Seifert KA, Nickerson NL, Corlett M, Jackson ED, Louis-Seize G, Davies RJ (2004) Devriesia, a new hyphomycete genus to accommodate heat-resistant, Cladosporium-like fungi. Can J Bot 82:914–926 Senanayake IC, Maharachchikumbura SS, Hyde KD, Bhat JD, Jones EG, McKenzie EH, Dai DQ, Daranagama DA, Dayarathne MC, Goonasekara ID, Konta S, Li WJ, Shang QJ, Stadler M, Wijayawardene NN, Xiao YP, Norphanphoun C, Li Q, Liu XZ, Bahkali AH, Kang JC, Wang Y, Wen TC, Wendt L, Xu JC, Camporesi E (2015) Towards unraveling relationships in Xylariomycetidae (Sordariomycetes). Fungal Divers 73:73–144 Sergeeva V, Priest M, Nair NG (2005) Preliminary studies on Pestalotiopsis species from southern hemisphere conifers in Australasia and South Africa. Australas Plant Pathol 34:255–258 Serra R, Peterson SW (2007) Penicillium astrolabium and Penicillium neocrassum, two new species isolated from grapes and their phylogenetic placement in the P. olsonii and P. brevicompactum clade. Mycologia 99:78–87 Sessa L, Abreo E, Bettucci L, Lupo S (2016) Botryosphaeriaceae species associated with wood diseases of stone and pome fruits Fungal Diversity (2018) 90:1–84 trees: symptoms and virulence across different hosts in Uruguay. Eur J Plant Pathol 146:519–530 Setati ME, Jacobson D, Bauer FF (2015) Sequence-based analysis of the Vitis vinifera L. cv Cabernet Sauvignon grape must mycobiome in three South African vineyards employing distinct agronomic systems. Front microbial 6:article1358 Sharma HC, Agarwal DK (1997) A new anthracnose diseae of grape vine (Vitis vinifera) in India. Indian Phytopathol 50:150 Shaw CG (1973) Host fungus index for the Pacific Northwest—I. Hosts. Wash State Univ Agric Exp Sta Bull 765:1–121 Shi F, Hsiang T (2014) First Report of Pseudonectria buxi causing Volutella Blight on Boxwood (Buxus sp.) in Beijing, China. Plant Dis 98:1282–1282 Shirouzu T, Harada Y (2004) Notes on species of Helminthosporium and its allied genera in Japan. Mycoscience 45:17–23 Shivas RG (1989) Fungal and bacterial diseases of plants in Western Australia. J R Soc West Australia 72:1–62 Shivas RG, Tan YP, Edwards J, Dinh Q, Maxwell A, Andjic V, Liberato JR, Anderson C, Beasley DR, Bransgrove K, Coates LM, Cowan K, Daniel R, Dean JR, Lomavatu MF, MercadoEscueta D, Mitchell RW, Thangavel R, Tran-Nguyen LTT, Weir BS (2016) Colletotrichum species in Australia. Australas Plant Pathol 45:447–464 Shoemaker RA (1992) Catalogue of Pleospora names and types 1. Alphabetically in hard copy and diskette 2. Sortable Data Base on Diskette (available from the author or herb. BPI). Unknown journal or publisher Simmonds JH (1966) Host index of plant diseases in Queensland. Queensland Department of Primary Industries, Brisbane Simonyan SA (1981) Mycoflora of Botanical Gardens and Arboreta in Armenia. Hayka Slippers B, Smit WA, Crous PW, Coutinho TA, Wingfield BD, Wingfield MJ (2007) Taxonomy, phylogeny and identification of Botryosphaeriaceae associated with pome and stone fruit trees in South Africa and other regions of the world. Plant Pathol 56:128–139 Smetham GM, Ades PK, Peros J-P, Ford R (2010) Genetic structure of the grapevine fungal pathogen Phaeomoniella chlamydospora in southeastern Australia and southern France. Plant Pathol 59:736–744 Sneath PH, Sokal RR (1973) Numerical taxonomy. The principles and practice of numerical classification. Freeman WH, San Francisco Sogonov MV, Castlebury LA, Rossman AY, Mejia LC, White JF (2008) Leaf-inhabiting genera of the Gnomoniaceae, Diaporthales. Stud Mycol 62:1–79 Soliman EA, Abdel-Azeem AM, Salem FM, Nafady NA, Mehesien MT, Ahmed AIS, Ibrahem ME, Abdel-Azeem MA, Hassan SS (2016) A taxonomic analysis of fungi collected and described from Egypt up to (1931). Stud Fungi 1:11–33 Sokal RR, Sneath PH (1963) Principles of numerical taxonomy. San Francisco, p 359 Sosnowski MR, Lardner R, WicksTJ Scott ES (2007) The influence of grapevine cultivar and isolate of Eutypa lata on wood and foliar symptoms. Plant Dis 91:924–931 Sousa da Câmara M (1950) Catalogus Fungorum Juresi (Serra do Gerês) ad Mycofloram Lusitanicam. Agron Lusit 12:89–122 Spegazzini (1878) Riv Viticolt Enolog Conegliano 2:727 Stevenson JA (1975) Fungi of Puerto Rico and the American Virgin Islands. Contr Reed Herb 23:743 Stevenson JA, Wellman FL (1944) A preliminary account of the plant diseases of El Salvador. J Wash Acad Sci 34:259–268 Stewart EJ (2012) Growing unculturable bacteria. J Bacteriol 194:4151–4160 Stoykov DY (2012) Diaporthales. Fungi Bulga 8:319 Stoykow DY, Denchev CM (2006) Current knowledge of Diaporthales (Ascomycota) in Bulgaria. Mycol Balcan 3:179–185 81 Sultan A, Johnston PR, Park D, Robertson AW (2011) Two new pathogenic ascomycetes in Guignardia and Rosenscheldiella on New Zealand’s pygmy mistletoes (Korthalsella: Viscaceae). Stud Mycol 68:237–247 Sumstine DR (1949) The Albert Commons collection of fungi in the herbarium of the Academy of Natural Sciences in Philadelphia. Mycologia 41:11–23 Sutton BC (1969) Type studies of Coniella, Anthasthoopa, and Cyclodomella. Can J Bot 47:603–608 Sutton BC (1975) Coelomycetes. V. Coryneum. Mycol Pap 138:1–224 Sutton BC (1980) The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, Surrey Suzuki MT, Giovannoni SJ (1996) Bias caused by template annealing in the amplification of mixtures of 16S rRNA genes by PCR. Appl Environ Microbiol 62:625–630 Swett CL, Bourret T, Gubler WD (2016) Characterizing the brown spot pathosystem in late-harvest table grapes (Vitis vinifera L.) in the California Central Valley. Plant Dis 100:2204–2210 Tai FL (1979) Sylloge Fungorum Sinicorum. Sci Press, Acad Sin Peking, pp1527 Tanaka K, Harada Y (2003) Pleosporales in Japan (2): the genus Lophiotrema. Mycoscience 44:115–121 Tao WC, Zhang W, Yan JY, Hyde KD, McKenzie EH, Li XH, Wang Y (2014) A new Alternaria species from grapevine in China. Mycol Prog 13:999 Tassi F (1902) I generi Phyllosticta Pers., Phoma Fr., Macrophoma (Sacc.) Berl. & Voglino e i loro generi analoghi, giusta la legge d’analogia. Bollettino del Laboratorio de Orto Botanico Reale Universita Siena 5:1–76 Tatagiba SD, DaMatta FM, Rodrigues FÁ (2015) Leaf gas exchange and chlorophyll a fluorescence imaging of rice leaves infected with Monographella albescens. Phytopathology 105:180–188 Taylor A, St J Hardy GE, Wood P, Burgess T (2005) Identification and pathogenicity of Botryosphaeria species associated with grapevine decline in Western Australia. Australas Plant Pathol 34:187–195 Taylor DL, Walters WA, Lennon NJ, Bochicchio J, Krohn A, Caporaso JG, Pennanen T (2016) Accurate estimation of fungal diversity and abundance through improved lineage-specific primers optimized for Illumina amplicon sequencing. Appl Environ Microbiol 82:7217–7226 Tejesvi MV, Ruotsalainen AL, Markkola AM, Pirttilä AM (2010) Root endophytes along a primary succession gradient in northern Finland. Fungal Divers 41:125–134 Teng SC (1996) Fungi of China. Mycotaxon Ltd, Ithaca Teodoro NG (1937) An Enumeration of Philippine Fungi. Tech Bull Dept Agric Comm Manila 4:1–585 Terral JF, Tabard E, Bouby L, Ivorra S, Pastor T, Figueiral I, Picq S, Chevance JB, Jung C, Fabre L, Tardy C (2009) Evolution and history of grapevine (Vitis vinifera) under domestication: new morphometric perspectives to understand seed domestication syndrome and reveal origins of ancient European cultivars. Ann Bot 105:443–455 Thaung MM (1984) Some fungi of Cercospora complex from Burma. Mycotaxon 19:425–452 Thaung MM (2008a) Pathologic and taxonomic analysis of leaf spot and tar spot diseases in a tropical dry to wet monsoon ecosystem of lowland Burma. Australas Plant Pathol 37:180–197 Thaung MM (2008b) Report: some noteworthy fungi of Burma. Australas Mycol 27:111–116 Thaung MM (2008c) Biodiversity survey of coelomycetes in Burma. Australas Mycol 27:74–110 Tibpromma S, Hyde KD, Jeewon R, Maharachchikumbura SSN, Liu JK, Bhat DJ, Jones EBG, McKenzie EHC, Camporesi E, 123 82 Bulgakov TS, Doilom M, ALCMA Santiago, Das K, Manimohan P, Gibertoni TB, Lim YW, Ekanayaka AH, Thongbai B, Lee HB, Yang JB, Kirk PM, Sysouphanthong P, Singh SK, Boonmee S, Dong W, Raj KNA, Latha KPD, Phookamsak R, Phukhamsakda C, Konta S, Jayasiri SC, Norphanphoun C, Tennakoon DS, Li J, Dayarathne MC, Perera RH, Xiao Y, Wanasinghe DN, Senanayake IC, Goonasekara ID, de Silva NI, Mapook A, Jayawardena RS, Dissanayake AJ, Manawasinghe IS, Chethana KWT, Luo ZL, Hapuarachchi KK, Baghela A, Soares AM, Vizzini A, Meiras-Ottoni A, Mešić A, Dutta AK, de Souza CAF, Richter C, Lin CG, Chakrabarty D, Daranagama DA, Lima DX, Chakraborty D, Ercole E, Wu F, Simonini G, Vasquez G, da Silva GA, Plautz Jr. HL, Ariyawansa HA, Lee H, Kušan I, Song J, Sun J, Karmakar J, Hu K, Semwal KC, Thambugala KM, Voigt K, Acharya K, Rajeshkumar KC, Ryvarden L, Jadan M, Hosen MI, Mikšı́k M, Samarakoon MC, Wijayawardene NN, Kim NM, Matočec N, Singh PN, Tian Q, Bhatt RP, de Oliveira RJV, Tulloss RE, Aamir S, Kaewchai S, Marathe SD, Khan S, Hongsanan S, Adhikari S, Mehmood T, Bandyopadhyay TK, Svetasheva TY, Nguyen TTT, Antonı́n V, Li WJ, Wang Y, Indoliya Y, Tkalčec Z, Elgorban AM, Bahkali AH, Tang AMC, Su HY, Zhang H, Promputtha I, Luangsa-ard J, Xu J, Yan JY, JiChuan Y, Stadler M, Mortimer PE, Chomnunti P, Zhao Q, Phillips AJL, Nontachaiyapoom S, Wen TC, Karunarathna SC (2017) Fungal diversity notes 491–602: taxonomic and phylogenetic contributions to fungal taxa. Fungal Divers 83:1–261 Tiffany LH, Gilman JC (1965) Iowa Ascomycetes IV. Diatrypaceae. Iowa State Coll J Sci 40:121–161 Torrejón M (2013) Fungi of Cyprus: new data on micro-and macrofungi. Acta Mycol 48:207–218 Trakunyingcharoen T, Lombard L, Groenewald JZ, Cheewangkoon R, Toanun C, Alfenas AC, Crous PW (2014) Mycoparasitic species of Sphaerellopsis, and allied lichenicolous and other genera. IMA Fungus 5:391–414 Trakunyingcharoen T, Lombard L, Groenewald JZ, Cheewangkoon R, To-anun C, Crous PW (2015) Caulicolous Botryosphaeriales from Thailand. Persoonia 34:87–99 Travadon R, Baumgartner K (2015) Molecular polymorphism and phenotypic diversity in the eutypa dieback pathogen Eutypa lata. Phytopathology 105:255–264 Travadon R, Lawrence PD, Rooney-Latham S, Gubler WD, Wilcox WF, Rolshausen PE, Baumgartner K (2015) Cadophora species associated with wood-decay of grapevine in North America. Fungal Biol 119:53–66 Trouillas F, Gubler WD (2004) Identification and characterization of Eutypa leptoplaca, a new pathogen of grapevine in Northern California. Mycol Res 108:1195–1204 Trouillas FP, Gubler WD (2010) Pathogenicity of Diatrypaceae species in grapevines in California. Plant Dis 94:867–872 Trouillas FP, Úrbez-Torres JR, Gubler WD (2010) Diversity of diatrypaceous fungi associated with grapevine canker diseases in California. Mycologia 102:319–336 Trouillas FP, Pitt WM, Sosnowski MR, Huang R, Peduto F, Loschiavo A, Savocchia S, Scott ES (2011) Taxonomy and DNA phylogeny of Diatrypaceae associated with Vitis vinifera and other woody plants in Australia. Fungal Divers 49:203–223 Tsui CKM, Hyde KD, Hodgkiss IJ (2001) Colonization patterns of wood-inhabiting fungi on baits in Hong Kong rivers, with reference to the effects of organic pollution. Antonie Van Leeuwenhoek J Microb 79:33–38 Tubaki K (1958) Studies on the Japanese Hyphomycetes. V J Hattori Bot Lab 20:142–244 Udayanga D, Liu X, McKenzie EHC, Chukeatirote E, Bahkali AHA, Hyde KD (2011) The genus Phomopsis: biology, applications, species concepts and names of common phytopathogens. Fungal Divers 50:189–225 123 Fungal Diversity (2018) 90:1–84 Udayanga D, Liu X-Z, Crous PW, McKenzie EHC, Chukeatirote E, Hyde KD (2012) A multi-locus phylogenetic evaluation of Diaporthe (Phomopsis). Fungal Divers 56:157–171 Udayanga D, Castlebury LA, Rossman AY, Chukeatirote E, Hyde KD (2014a) Insights into the genus Diaporthe: phylogenetic species delimitation in the D. eres species complex. Fungal Divers 67:203–229 Udayanga D, Castlebury LA, Rossman AY, Hyde KD (2014b) Species limits in Diaporthe: molecular re-assessment of D. citri, D. cytosporella, D. foeniculina and D. rudis. Persoonia 32:83–101 Uecker FA, Kuo K-C (1992) A new Phomopsis with long paraphyses. Mycotaxon 44:425–433 Unamuno PLM (1941) Enumeracion y distribucion geografica de los ascomicetos de la Peninsula Iberica y de las Islas Baleares. Mem Real Acad Ci Exact Madrid 8:1–403 Underhill DM, Iliev ID (2014) The mycobiota: interactions between commensal fungi and the host immune system. Nat Rev Immunol 14:405–416 Úrbez-Torres JR (2011) The status of Botryosphaeriaceae species infecting grapevines. Phytopathol Mediterr 50:5–45 Úrbez-Torres JR, Gubler WD (2009) Pathogenicity of Botryosphaeriaceae species isolated from grapevine cankers in California. Plant Dis 93:584–592 Úrbez-Torres JR, Leavitt GM, Voegel TM, Gubler WD (2006) Identification and distribution of Botryosphaeria spp. associated with grapevine cankers in California. Plant Dis 90:1490–1503 Úrbez-Torres JR, Gubler WD, Luque J (2007) First report of Botryosphaeria iberica and B. viticola associated with grapevine decline in California. Plant Dis 91:772 Úrbez-Torres JR, Battany M, Bettiga LJ, Gispert C, McGourty G, Roncoroni J, Smith RJ, Verdegaal P, Gubler WD (2010a) Botryosphaeriaceae species spore-trapping studies in California vineyards. Plant Dis 94:717–724 Úrbez-Torres JR, Peduto F, Gubler WD (2010b) First report of grapevine cankers caused by Lasiodiplodia crassispora and Neofusicoccum mediterraneum in California. Plant Dis 94:785 Úrbez-Torres JR, Peduto F, Rooney-Latham S, Gubler WD (2010c) First report of Diplodia corticola causing grapevine (Vitis vinifera) cankers and trunk cankers and dieback of canyon live oak (Quercus chrysolepis) in California. Plant Dis 94:785 Úrbez-Torres JR, Peduto F, Striegler RK, Urrea-Romero KE, Rupe JC, Cartwright RD, Gubler WD (2012) Characterization of fungal pathogens associated with grapevine trunk diseases in Arkansas and Missouri. Fungal Divers 52:169–189 Úrbez-Torres JR, Peduto F, Vossen PM, Krueger WH, Gubler WD (2013a) Olive twig and branch dieback: etiology, incidence, and distribution in California. Plant Dis 97:231–244 Úrbez-Torres JR, Peduto F, Smith RJ, Gubler WD (2013b) Phomopsis dieback: a grapevine trunk disease caused by Phomopsis viticola in California. Plant Dis 97:1571–1579 Úrbez-Torres JR, Haag P, Bowen P, O’Gorman DT (2014) Grapevine trunk diseases in British Columbia: incidence and characterization of the fungal pathogens associated with black foot disease of Grapevine. Plant Dis 98:456–468 Úrbez-Torres JR, Adams P, Kamas J, Gubler WD (2009) Identification, incidence, and pathogenicity of fungal species associated with grapevine dieback in Texas. Am J Enol Vitic 60:497–507 Urquhart EJ, Sun LJ, Punja ZK (1997) Identification of species of Tilletiopsis using random amplified polymorphic DNA analysis. Can J Plant Pathol 19:380–389 Urtiaga R (1986) Indice de enfermedades en plantas de Venezuela y Cuba. Impresos en Impresos Nuevo Siglo. S.R.L., Barquisimeto, Venezuela Fungal Diversity (2018) 90:1–84 Uzuhashi S, Tojo M, Kakishima M (2010) Phylogeny of the genus Pythium and description of new genera. Mycoscience 51:337–365 Váczy KZ (2017) First report of Seimatosporium vitis associated with grapevine trunk disease symptoms in Hungary. Plant Dis 101:253 Vail ME, Gubler WD, Adaskaveg JE (1995) First report of Pleurotus ostreatus causing a wood rot of grapevines in California vineyards. Plant Dis 79:1187 Valencia D, Torres C, Camps R, López E, Celis-Diez JL, Besoain X (2015) Dissemination of Botryosphaeriaceae conidia in vineyards in the semiarid Mediterranean climate of the Valparaı́so Region of Chile. Phytopathol Mediterr 54:394 Van Coller GJ, Denman S, Groenewald JZ, Lamprecht SC, Crous PW (2005) Characterisation and pathogenicity of Cylindrocladiella spp. associated with root and cutting rot symptoms of grapevines in nurseries. Australas Plant Pathol 34:489–498 Van Niekerk JM, Crous PW, Groenewald JZ, Fourie PH, Halleen F (2004a) DNA phylogeny, morphology and pathogenicity of Botryosphaeria species on grapevines. Mycologia 96:781–798 Van Niekerk JM, Groenewald JZ, Verkley GJM, Fourie PH, Wingfeld MJ, Crous PW (2004b) Systematic reappraisal of Coniella and Pilidiella, with specific reference to species ocurring on Eucalyptus and Vitis in South Africa. Mycol Res 108:283–303 Van Niekerk JM, Groenewald JZ, Farr DF, Fourie PH, Halleen F, Crous PW (2005) Reassessment of Phomopsis species on grapevines. Australas Plant Pathol 34:27–39 Van Niekerk JM, Fourie PH, Halleen F, Crous PW (2006) Botryosphaeria spp. as grapevine trunk disease pathogens. Phytopathol Mediterr 45:S43–S54 Van Niekerk JM, Bester W, Halleen F, Crous PW, Fourie PH (2010) First report of Lasiodiplodia crassispora as a pathogen of grapevine trunks in South Africa. Plant Dis 94:1063 Vandenkoornhuyse P, Quaiser A, Duhamel M, Le Van A, Dufresne A (2015) The importance of the microbiome of the plant holobiont. New Phytol 206:1196–1206 Vanev SG, Sameva EF, Bakalova GG (1997) Order Sphaeropsidales. Fungi Bulga 3:1–335 Vasilyeva LN (1990) New pyrenomycetous species from Kunashir. Mikol Fitopatol 24:207–210 Vasilyeva L, Li Y, Stephenson S (2009) Some pyrenomycetous fungi new to China. Mycotaxon 109:415–428 Vasilyeva L, Chernyshev A, Stephenson SL (2010) Pyrenomycetes of the Russian Far East 4: Family Nitschkiaceae (Coronophorales, Ascomycota). Mycologia 102:233–247 Vasudeva RS (1963) Indian Cercosporae. Indian Council of Agricultural Research, New Delhi Verkley GJM, Dukik K, Renfurm R, Goker M, Stielow JB (2014) Novel genera and species of coniothyrium-like fungi in Montagnulaceae (Ascomycota). Persoonia 32:25–51 Victor D, Crous PW, Janse BJH, Van Zyl WH, Wingfield MJ, Alfenas AC (1998) Systematic appraisal of species complexes within Cylindrocladiella. Mycol Res 102:273–279 Vitale A, Castello I, Polizzi G (2008) First report of Aspergillus vine canker on table grapes caused by Aspergillus niger in Europe. Plant Dis 92:1471 Voglmayr H, Riethmuller A, Goker M, Weiss MJ, Oberwinkler F (2004) Phylogenetic relationships of Plasmopara, Bremia and other genera of downy mildew pathogens with pyriform haustoria based on Bayesian analysis of partial LSU rDNA sequence data. Mycol Res 108:1011–1024 Vohnı́k M, Burdı́ková Z, Vyhnal A, Koukol O (2011) Interactions between testate amoebae and saprotrophic microfungi in a Scots pine litter microcosm. Microb Ecol 61:660–668 von Arx JA, Mueller E (1954) Die Gattungen der amerosporen Pyrenomyceten. Beitr Kryptogamenfl Schweiz 11:1–434 83 Voytyuk SO, Heluta VP, Wasser SP, Nevo E, Takamatsu S, Volz PA (2009) Biodiversity of the Powdery Mildew Fungi (Erysiphales, Ascomycota) of Israel: biodiversity of cyanoprocaryotes, algae and fungi of Israel, vol 7. Koeltz Scientific Books, Königstein Walker A-S, Gautier A, Confais J, Martinho D, Viaud M, Le Pecheur P, Dupont J, Fournier E (2011) Botrytis pseudocinerea, a new cryptic species causing gray mold in French vineyards in sympatry with Botrytis cinerea. Phytopathology 101:1433–1445 Wang HK, Hyde KD, Soytong K, Lin FC (2008) Fungal diversity on fallen leaves of Ficus in northern Thailand. J Zhejiang Univ Sci B 9:835–841 Wang Y, Wang CW, Gao L (2015) First report of Fusarium proliferatum causing fruit rot on grape (Vitis vinifera) in China. Plant Dis 99:1180 Wangikar PD, Raut JG, Gopalkrishna N (1969) Drying of grape vines caused by Hendersonula toruloidea. Indian Phytopathol 22:403–404 Ward DM, Weller R, Bateson MM (1990) 16S rRNA sequences reveal numerous uncultured microorganisms in a natural community. Nature 345:63–65 Watson AJ (1971) Foreign bacterial and fungus diseases of food, forage, and fiber crops. U.S.D.A. Agricultural Research Service, Washington DC Weber RW, Stenger E, Meffert A, Matthias HAHN (2004) Brefeldin A production by Phoma medicaginis in dead pre-colonized plant tissue: a strategy for habitat conquest? Mycol Res 108:662–671 Weir BS, Johnston PR, Damm U (2012) The Colletotrichum gloeosporioides species complex. Stud Mycol 73:115–180 White TJ, Bruns T, Lee S, Taylor JW (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR protocols: a guide to methods and applications. Academic, New York, pp 315–322 White C-L, Halleen F, Fischer M, Mostert L (2011) Characterisation of the fungi associated with esca diseased grapevines in South Africa. Phytopathol Mediterr 50:204–223 Whitelaw-Weckert MA, Nair NG, Lamont R, Alonso M, Priest MJ, Huang R (2007) Root infection of Vitis vinifera by Cylindrocarpon liriodendra in Australia. Australas Plant Pathol 36:403–406 Whitelaw-Weckert MA, Rahman L, Appleby LM, Hall A, Clark AC, Waite H, Hardie WJ (2013) Co-infection by Botryosphaeriaceae and Ilyonectria spp. fungi during propagation causes decline of young grafted grapevines. Pl Pathol 62:1226–1237 Whiteside JO (1966) A revised list of plant diseases in Rhodesia. Kirkia 5:87–196 Whiting E, Cunha MG, Gubler WD (2005) Phaeomoniella chlamydospora and Phaeoacremonium species distinguished through cultural characters and ribosomal DNA sequence analysis. Mycotaxon 92:351–360 Wicht B, Petrini O, Jermini M, Gessler C, Broggini GAL (2012) Molecular, proteomic and morphological characterization of the ascomycete Guignardia bidwellii, agent of grape black rot: a polyphasic approach to fungal identification. Mycologia 104:1036–1045 Wiehe PO (1948) The plant diseases and fungi recorded from Mauritius. Mycol Pap 24:1–39 Wijayawardene NN, Hyde KD, Rajeshkumar KC, Hawksworth DL, Madrid H, Kirk PM, Braun U, Singh RV, Crous PW, Kukwa M, Lücking R, Kurtzman CP, Yurkov A, Haelewaters D, Aptroot A, Lumbsch HT, Timdal E, Ertz D, Etayo J, Phillips AJL, Groenewald JZ, Papizadeh M, Selbmann L, Dayarathne MC, Weerakoon G, Jones EBG, Suetrong S, Tian Q, Castañeda-Ruiz RF, Bahkali AH, Pang K-L, Tanaka K, Dai DQ, Sakayaroj J, Hujslová M, Lombard L, Shenoy BD, Suija A, Maharachchikumbura SSN, Thambugala KM, Wanasinghe DN, 123 84 Fungal Diversity (2018) 90:1–84 Sharma BO, Gaikwad S, Pandit G, Zucconi L, Onofri S, Egidi E, Raja HA, Kodsueb R, Cáceres MES, Pérez-Ortega S, Fiuza PO, Monteiro JS, Vasilyeva LN, Shivas RG, Prieto M, Wedin M, Olariaga I, Lateef AA, Agrawal Y, Fazeli SAS, Amoozegar MA, Zhao GZ, Pfliegler WP, Sharma G, Oset M, Abdel-Wahab MA, Takamatsu S, Bensch K, de Silva NI, De Kesel A, Karunarathna A, Boonmee S, Pfister DH, Lu Y-Z, Luo Z-L, Boonyuen N, Daranagama DA, Senanayake IC, Jayasiri SC, Samarakoon MC, Zeng X-Y, Doilom M, Quijada L, Rampadarath S, Heredia G, Dissanayake AJ, Jayawardena RS, Perera RH, Tang L-Z, Phukhamsakda C, Hernández-Restrepo M, Ma X, Tibpromma S, Gusmao LFP, Weerahewa D, Karunarathna SC (2017) Notes for genera: Ascomycota. Fungal Divers 86:1–594 Wijayawardene NN, Hyde KD, Divakar PK, Rajeshkumar KC, Weerahewa D, Delgado G, Wang Y, Fu L (2018) Notes for genera update—Ascomycota: 6616–6821. Mycosphere 9:115–140 Witbooi WR, Taylor MA, Fourie JF (2000) In vitro studies on the effect of harvest maturity, relative humidity, wetness period and cold-storage temperature, on the infection potential of Aspergillus niger and Rhizopus stolonifer on Thompson Seedless table grapes. Decid Fruit Grower 50:S1–S14 Wolf FA, Garren KH, Miller JK (1938) Fungi of the Duke Forest and their relation to forest pathology. Bull School For Duke Univ 2:1–122 Wong MKM, Hyde KD (2001) Diversity of fungi on six species of Gramineae and one species of Cyperaceae in Hong Kong. Mycol Res 105:1485–1491 Wu DD, Fu G, Hu FY, Ye YF, Mou HF, Qin LL, Jiang N (2015) First report of Neofusicoccum parvum causing panicle blight and leaf spot on Vitis heyneana in China. Plant Dis 99:417 Yan J-Y, Peng Y-L, Xie Y, Li X-H, Yao S-W, Tang M-L, Wang Z-Y (2011a) First report of grapevine trunk disease caused by Botryosphaeria obtusa in China. Plant Dis 95:616 Yan J-Y, Li X-H, Kong FF, Wang Z-Y, Gong L-Z, He H-P (2011b) Occurrence of grapevine trunk disease caused by Botryosphaeria rhodina in China. Plant Dis 95:219 Yan J, Xie Y, Yao S-W, Wang Z, Li X (2012) Characterization of Botryosphaeria dothidea, the casual agent of grapevine canker in China. Australas Plant Pathol 41:351–357 Yan J-Y, Jayawardena MMRS, Goonasekara ID, Wang Y, Zhang W, Liu M, Huang J-B, Wang Z-Y, Shang J-J, Peng Y-L, Bahkali A, Hyde KD, Li X-H (2015) Diverse species of Colletotrichum associated with grapevine anthracnose in China. Fungal Divers 71:233–246 Yang T, Groenewald JZ, Cheewangkoon R, Jami F, Abdollahzadeh J, Lombard L, Crous PW (2017) Families, genera, and species of Botryosphaeriales. Fungal Biol 121:322–346 Yanna Ho WHH, Hyde KD (2002) Fungal succession on fronds of Phoenix hanceana in Hong Kong. Fungal Divers 10:185–211 Yilmaz N, Visagie CM, Houbraken J, Frisvad JC, Samson RA (2014) Polyphasic taxonomy of the genus Talaromyces. Stud in Mycol 78:175–341 Ying-Ren L (2012) Flora Fungorum Sinicorum: Rhytismatales, vol 40. Science Press, Beijing Zapparata A, Da Lio D, Sarrocco S, Vannacci G, Baroncelli R (2017) First report of Colletotrichum godetiae causing grape (Vitis vinifera) berry rot in Italy. Plant Dis 101:1051–1052 Zervakis G, Dimou D, Balis C (1998) A check-list of the Greek macrofungi including hosts and biogeographic distribution: I. Basidiomycotina. Mycotaxon 66:273–336 Zhang TY (2003) Flora Fungorum Sinicorum. Alternaria, vol 16. Science Press, Beijing Zhang L, Zhang GL, Qian X, Li GY (2009) First report of verticillium wilt of grapevine (Vitis vinifera) caused by Verticillium dahlia in China. Plant Dis 93:841 Zheng RY, Liu XY (2005) Actinomucor elegans var. meitauzae, the correct name for A. taiwanensis and Mucor meitauzae (Mucorales, Zygomycota). Nova Hedwig 80:419–432 Zhou YJ, Zhang J, Wang XD, Yang L, Jiang DH, Li GQ, Hsiang T, Zhuang WY (2014) Morphological and phylogenetic identification of Botrytis sinoviticola, a novel cryptic species causing gray mold disease of table grapes (Vitis vinifera) in China. Mycologia 106:43–56 Zhou N, Chen Q, Carroll G, Zhang N, Shivas RG,Cai L (2015) Polyphasic characterization of four new plant pathogenic Phyllosticta species from China, Japan, and the United States. Fung Biol 119:433–446 Zhuang W-Y (ed) (2001) Higher fungi of Tropical China. Mycotaxon Ltd, Ithaca Zhuang W-Y (ed) (2005) Fungi of northwestern China. Mycotaxon Ltd, Ithaca Živkovi_c S, Vasi_c T, And̄elković S, Jevremovi_c D, Trkulja V (2012) Identification and characterization of Eutypa lata on grapevine in Serbia. Plant Dis 96:913–913 Zubkova RD (1971) Genus novum Saccharomycetacearum e Kazachstania. Botanicheskie Materialy Gerbariga Instituta Botaniki Akademii Nauk Kazakh. SSR 7:53–56 Affiliations Ruvishika S. Jayawardena1,2,3 • Witoon Purahong4 • Wei Zhang1,3 • Tesfaye Wubet4,5 • XingHong Li1,3 Mei Liu1,3 • Wensheng Zhao6 • Kevin D. Hyde2 • JianHua Liu1 • Jiye Yan1,3 • 1 Institute of Plant and Environment Protection, Beijing Academy of Agriculture and Forestry Sciences, Beijing 100097, People’s Republic of China 4 Department of Soil Ecology, UFZ-Helmholtz Centre for Environmental Research, Theodor-Lieser-Str. 4, 06120 Halle (Saale), Germany 2 Centre of Excellence in Fungal Research, Mae Fah Luang University, Chiang Rai 57100, Thailand 5 German Centre for Integrative Biodiversity Research (iDiv) Halle-Jena-Leipzig, Leipzig, Germany 3 Beijing Key Laboratory of Environment Friendly Management on Fruit Diseases and Pests in North China, Beijing 100097, People’s Republic of China 6 College of Agricultural and Biotechnology, China Agricultural University, Beijing 100193, People’s Republic of China 123

Log In

Biodiversity of fungi on Vitis vinifera L. revealed by traditional and high-resolution culture-independent approaches

Biodiversity of fungi on Vitis vinifera L. revealed by traditional and high-resolution culture-independent approaches

Related Papers

RELATED PAPERS