Phytotaxa 130 (1): 1–13 (2013) www.mapress.com / phytotaxa / Copyright © 2013 Magnolia Press Article ISSN 1179-3155 (print edition) PHYTOTAXA ISSN 1179-3163 (online edition) http://dx.doi.org/10.11646/phytotaxa.130.1.1 Pinellia hunanensis (Araceae), a new species supported by morphometric analysis and DNA barcoding YU-JING LIU 1 , STEVEN G. NEWMASTER 2 * , XIAN-JIN WU 3 , YUE LIU 1 , SUBRAMANYAM RAGUPATHY2, TIMOTHY MOTLEY1,4 & CHUN-LIN LONG1,3,5* 1 College of Life and Environmental Sciences, Minzu University of China, Beijing 100081, China. E-mail: jing_yuzhouniao@126.com; lziqilziqi@yahoo.com.cn 2 Centre for Biodiversity Genomics and Biodiversity Institute of Ontario Herbarium, University of Guelph, Guelph, Ontario, Canada. *Corresponding author, E-mail: snewmast@uoguelph.ca; ragu@uoguelph.ca 3 Key Laboratory of Hunan Province for Study and Utilization of Ethnic Medicinal Plant Resources, Huaihua University, Hunan 418000, China. E-mail:hhuxianjin@163.com 4 Department of Biological Sciences, Old Dominion University, Norfolk, Virginia 23529-0266, USA. E-mail:tmotley@odu.edu 5 Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201, China. *Corresponding author, E-mail: long@mail.kib.ac.cn, chunlinlong@hotmail.com Abstract Pinellia hunanensis, a new species from China, is described and illustrated. A key for the identification of all Pinellia species in China, Korea and Japan is included. A detrended correspondence analysis identified 6 groups of taxa including the new species. From the 20 samples, analyzing 38 morphological characters. A discriminant function analysis was used to rigorously test the classification of specimens provided in the cluster analysis. DNA barcoding provided phylogenetic support using NJ and Bayesian methods to distinguish all six taxa including the putative new species. This study provides preliminary evidence of morphometric variation within and among species of Pinellia, which allows further development of hypothesis concerning species boundaries. Discussions concerning medicinal product substitution within the genus Pinellia are presented in the context of conservation initiatives of species in China. Introduction The genus Pinellia, established by Tenore (1839) in honor of Giovanni V. Pinelli (1535–1601), belongs to the subfamily Aroideae in the family Araceae. Pinellia is a small genus with only nine species, distributed through China, Korea and Japan (Mayo et al. 1997, Zhu et al. 2007). China has the highest species diversity of Pinellia species, with eight species (Bogner & Li 2010, Li 1979, P’ei 1935, Zhu et al. 2007). One species, P. tripartita (Blume) Schott (1856: 5) is limited to Japan and Hong Kong (Ohwi 1984). Among eight known Pinellia species occurring in China, only one species, P. ternata (Thunb.) Ten. ex Breitenbach (1879: 687) is widely distributed in the whole distribution range of the genus extending from China to Korea, southern and central Japan. Within China, the genus is absent from the North to Northwest (not present in Inner Mongolia, Qinghai, Xinjiang and Xizang) and confined to the East and Southeast. It has its greatest diversity in Eastern China (Figure 1). All species in the genus grow in humid environment. Most species like warm but not hot environment. Our recent botanical expeditions in Zhongfang County, Hunan, Central China, were conducted in May and middle July from 2009 to 2011. Specimens of a Pinellia species had been collected. The morphological characteristics suggested our Pinellia specimen was probably an undescribed species. After examining all Pinellia specimens at PE and KUN, and studying all literatures on Pinellia, we confirmed it represented a new species. Accepted by Samuli Lehtonen: 12 Aug. 2013; published: 10 Sept. 2013 1 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. FIGURE 1. Sketch map of East Asia, indicating distribution of Pinellia. This paper describes and illustrates Pinellia hunanensis C. L. Long & X. J. Wu, a new species from western Hunan, Central China. Morphological traits were compared for all nine Pinellia species in the world using morphometric analyses. A molecular classification is provided using DNA barcodes for the six most closely related taxa. A list of representative specimens examined and a morphological key to all 10 species (including the newly described one) occurring in the world are provided. Materials and methods Plant materials:—We gathered 24 plant samples from 5 species, namely, P. peltata P’ei (1935: 1), P. polyphylla Hu (1984: 713), P. cordata Brown (1903: 173), P. fujianensis Li & Zhu (2007: 512), P. ternata and sp. nov. (i.e. Pinellia hunanensis). Pinellia hunanensis was collected from 5 populations along cliffs in forested valleys in Zhongfang County, Huaihua City, Hunan Province, Central China, during flowering (MayJune) and fruiting (July-August). Tubers from all individuals are cultivated at Minzu University of China (MUC), and voucher specimens and deposited at MUC and KUN (Herbarium, Kunming Institute of Botany, Chinese Academy of Sciences) for further observation. Other species (P. peltata, P. polyphylla, P. cordata, P. fujianensis, and P. ternata) were selected to study their phylogenic relations because they are similar morphologically or biogeographically. Species sampled in this study with their source localities, and herbarium voucher number are listed in Table 1. 2 • Phytotaxa 130 (1) © 2013 Magnolia Press LIU ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. TABLE 1. Specimens of Pinellia used in this study. Herbarium Voucher # Species Locality Origin Yujing Liu, P1(KUN) Yujing Liu, P2(KUN) Yujing Liu, P3(KUN) Yujing Liu, P4(KUN) Yujing Liu, P10(KUN) Yujing Liu, P6(KUN) Yujing Liu, P21(KUN) Yujing Liu, P68(KUN) Yujing Liu, P90(KUN) Yujing Liu, P91(KUN) YujingLiu, P108(KUN) Yujing Liu, P5(KUN) Yujing Liu, P38(KUN) Yujing Liu, P39(KUN) Yujing Liu, P40(KUN) Yujing Liu, P41(KUN) Yujing Liu, P1(MUC) Yujing Liu, P43(MUC) Yujing Liu, P44(MUC) Yujing Liu, P45(MUC) Yujing Liu, P46(MUC) Yujing Liu, P67(KUN) Yujing Liu, P68(KUN) YujingLiu, P107(KUN) P. polyphylla P. polyphylla P. polyphylla P. peltata P. peltata P. peltata P. fujianensis P. fujianensis P. fujianensis P. fujianensis P. fujianensis P. ternata P. ternata P. ternata P. ternata P. ternata P. hunanensis P. hunanensis P. hunanensis P. hunanensis P. hunanensis P. cordata P. cordata P. cordata KIB, China KIB, China KIB, China KIB, China KIB, China KIB, China KIB, China KIB, China KIB, China KIB, China KIB, China KIB, China KIB, China KIB, China KIB, China KIB, China Hunan, China Hunan, China Hunan, China Hunan, China Hunan, China KIB, China KIB, China KIB, China W C C W C C C W W C C W W W W W W W W W W W C C KIB: Kunming Institute of Botany, MUC: Minzu University of China, W: wild, C: cultivated. Morphometric analyses:—38 morphological variables (Table 2) were measured and recorded from 20 specimens noted above. A matrix of 18 specimens and 38 morphological characters were used in a multivariate analysis. Canonical ordination was used to detect groups of specimens and to estimate the contribution of each variable to the ordination. Unimodal, indirect ordination Detrended Correspondence Analysis (DCA) was used to explore variation in species scores in this study. A cluster analysis was used to classify the specimens, as it is better in representing distances among similar specimens, whereas DCA is better in representing distances among groups of specimens (Sneath & Sokal 1973). Cluster analysis was performed with NTSYS (Rohlf & Corti 2000). A distance matrix was generated using an arithmetic average (UPGMA) clustering algorithm and standardized data based on average taxonomic distance subjected to the unweighted pair-group method. A discriminant function analysis (Base 1999) was used to rigorously test the classification of specimens provided in the cluster analysis. The object of DFA is to predict multivariate responses that best discriminate subjects among different groups (Ramsey & Schafer 2012). A total of 38 morphological characters for each of the 20 specimens were used as input for a DFA. The 20 specimens used as input for a DFA were each coded as belonging to one group as designated a priori groups which 1) determined if the classification was accurate, 2) provided discriminant functions for the classification of the taxa and, 3) indicated if there are important morphological characters for each of the canonical discriminate functions. PINELLIA HUNANENSIS SP. NOV. Phytotaxa 130 (1) © 2013 Magnolia Press • 3 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. TABLE 2. Diagnostic characters for separating Pinellia ternata from Pinellia hunanensis. Characters Pinellia hunanensis Pinellia ternata Subterranean part tuber tuber Tuber shape subglobose-globose subglobose-globose Tuber diameter (cm) 1–2.5 2–3 Leaf number 1 1–5 Petiole length (cm) 10–30 10–40 Petiole color green/red/purple green/red/purple Bulbil location petiole petiole and blade Leaf shape trifoliate trifoliate Leaf blade length (cm) 8–30 10–20 Leaf blade width (cm) <10 <10 Vein number 5–9 6–9 Peduncle longer than petiole same/greater than petiole Spathe constriction straight-slightly constricted slightly constricted Spathe length (cm) 5–7 5–7 Tube (shape) subglobose-cylindrical cylindrical Limb (shape) variable elliptic/oblong Limb size (cm) 4–5.5×1.5–3 3–51.2–3 Spathe shape erect-slightly incurved erect-slightly incurved Spadix length (cm) 8–15 10–20 Female zone (cm) 1.5–2 2–3 Pistil length (mm) 2–2.2 2–2.2 Ovary (shape) ellipsoid-ovoid/oblong ovoid/oblong Ovary diameter (mm) 1.3–1.5 0.8–1.2 Style absent attenuate Stigma (shape) disciform-hemispheric disciform Stigma diameter (mm) 0.16–0.2 0.2 Sterile zone length (mm) 1–1.5 3–4 Male zone (cm) >10 4–10 Thecae ellipsoid-elongate elongate Appendix (shape) erect-outcurved erect Appendix (color) green/yellow/violet green/violet Appendix length (cm) 7.8–15 7.8–10 Berries (color) yellow green/white yellow green/white Berries (shape) ovoid-oblong oviod Berry diameter (mm) 3–4 2–3 Seed diameter (mm) 1.6–3 0.5–1.5 Flowering time April–July May–July Fruiting time May–September May–September 4 • Phytotaxa 130 (1) © 2013 Magnolia Press LIU ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. DNA barcoding:—We used two plastid regions (matK and rbcL) as recommended by the CBOL Plant Working Group (Hollingsworth et al. 2009). Total DNA was isolated from silica gel-dried leaves. Genomic DNA was isolated using Plant Genomic kit (Tiangen Co., Ltd, China). The DNA products were then visualized by electrophoresis on an SYBR Green I stained 0.6% agarose gel with 1.5 kb DNA ladder (Ding Guo Co., Ltd, China) to evaluate the quality. Amplification of DNA regions was performed using PCR. DNA was amplified by PCR performed in 25µL volumes containing 10×buffer (2.5µL), dNTP (0.375µL), each primer (10mM, 0.5µL) (Synthesized by BGI. Co.), Mg2+ (1.5µL), five units of Taq polymerase (Fermentas, 0.3µL), temple (0.75µL) and ddH2O (18.575µL). The resultant PCR products were separated by electrophoresis through 2.0% (w/v) agarose gel in TAE buffer at 120V for ~30min, stained with SYBR Green I, transilluminated under ultraviolet light and then photographed in Quantity One software. If multiple bands were detected, an additional electrophoresis was performed to excise and analyze them separately (Table 3). The length of PCR products were evaluated by comparison with a molecular weight 100bp marker. Amplified products were sequenced in both directions with the primers used for amplification to ensure high accuracy of data scoring. We believe that a high percentage of bidirectional reads will be critical for a successful plant barcoding system, given the generally low amount of variation that separates many plant species, and the increased danger of misassignment due to sequencing error that can be anticipated with incomplete bidirectional reads (Fazekas et al. 2008, Kress & Erickson 2007). Purifying and sequencing were completed by Invitrogen Co., Ltd. We submitted nucleotide sequences of 6 species in our study to GenBank (Table 4). The bidirectional sequences were first manually adjusted in Chromos (Version 1.62) and assembled in DNAMAN (Version 6) and then aligned using ClustalX program (Version 1.83). Two phylogenetic analyses were utilized; neighbor-joining (NJ) and Bayesian inference. NJ tree method was used to exhibit the molecular identification results and test the monophyly of species. We entered sequences into MEGA4.0 for construction of the NJ phylogenetic trees. Bootstrap (1000 replications) analysis was performed to estimate the confidence of the topology of the consensus tree (Ren et al. 2010), pairwise K2P (Kimura 2-parameter) distances for matK and rbcL were calculated in MEGA to evaluate intraspecific and interspecific divergence among species of Pinellia. The data were then analyzed using Bayesian inference, with a best-fit model (HKY) selected model of sequence evolution for the two genes (i.e., matK and rbcL). A binary model (Lset coding=variable) was applied to the coded gaps. Bayesian runs were performed with MrBayes (version 3.1), using one cold and three heated Markov chain Monte Carlo (MCMC) chains run for 5×106 cycles, sampling trees every 100 generations, and with a default temperature parameter value of 0.2. Bayesian runs were started from independent random starting trees and repeated at least twice (Cusimano et al. 2011, Mansion et al. 2008). TABLE 3. PCR primers and profiles. Region Name of primer Primer sequence 5’-3’ Reference matK 390f CGATCTATTCATTCAATATTTC Cuénoud et al. 2002 1326r TCTAGCACACGAAAGTCGAAGT Cuénoud et al. 2002 PA-r GTTATGCATGAACGTAATGCTC Sang et al. 1997 TH-f CGCGCATGGTGGATTCACAATCC Tate 2002 trnH-psbA rbcL Region R-F ATGTCACCACAAACAGAAACT Terachi et al. 1987 R-R TCGCATGTACCTGCAGTAGC Fay et al. 1997 PCR profile Initial Denaturation temp./time Denaturation temp./time Annealing temp./time Extension temp./time Final extension temp./time No.of cycles matK 94°/4min 94°/1min 48°/30s 72°/1min 72°/7min 35 trnH-psbA 94°/5min 94°/1min 55°/1min 72°/1.5min 72°/7min 35 rbcL 95°/2min 94°/1min 55°/30s 72°/1min 72°/7min 34 PINELLIA HUNANENSIS SP. NOV. Phytotaxa 130 (1) © 2013 Magnolia Press • 5 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. TABLE 4. PCR product size, variation and accession number of studied samples. A hyphen (-) indicates that sequencing of the PCR product failed. Specimen matK, length (bp) Accession number rbcL length (bp) Accession number trnH-psbA length (bp) Accession number P. polyphylla 812 JF828125 758 JF828106 543 JF828145 P. polyphylla 806 JF828126 738 JF828107 - - P. polyphylla 804 JF828127 718 JF828108 - - P. peltata 822 JX123072 685 JX123069 759 JX123085 P. peltata 810 JF828128 719 JF828109 - - P. peltata 809 JX123089 719 JX123083 - - P. fujianensis 808 JX123084 717 JX123075 - - P. fujianensis 816 JX123062 716 JX123071 - - P. fujianensis 810 JF828129 719 JF828110 -(320bp? JX123082 P. fujianensis 813 JX123063 719 JX123081 -(183bp) - P. fujianensis 815 JX123078 714 JX123077 586 JX123080 P. ternata 806 JX123079 707 JX123064 640 JF828148 P. ternata 781 JF828130 716 JX123070 547 JF828147 P. ternata 785 JX123073 741 JX123066 554 JF828146 P. ternata 806 JX123086 744 JX123074 672 JX129927 P. ternata 746 JX123065 721 JX123068 504 JX123090 P. hunanensis - - 721 JX123067 - - P. hunanensis 743 JX123088 734 JX123076 640 JX123087 Results and discussion The morphometric analysis revealed considerable variation among the 5 known taxa and the new species. A discriminant function analysis (DFA) used 38 quantitative characters to classify heterogeneity in 20 specimens into what is currently considered 5 known taxa of Pinellia and the new species (Pinellia hunanensis): P. peltata, P. polyphylla, P. cordata, P. fujianensis, P. ternata. The canonical correlation from the discriminant functions is the ratio of the between groups sums of squares to the total sums of squares. Thus, the first discriminant function is responsible for 61.4% of the between group differences (variability in the discriminant scores). The second function is responsible for the remaining 38.6% of the between group variance. Wilk’s Lambda was used to test the hypothesis that there are no difference in variance (p<0.001) between the groups of taxa which represent different species (Base 1999). There were significant differences (p0.008) for first two canonical functions. 100% of the groups (representing 5 known and the new species) were correctly classified using the DFA into 6 distinct groups of taxa including Pinellia hunanensis. The ordination analyses utilized DCA in the separation of 6 taxa of Pinellia (including Pinellia hunanensis) from the 20 specimens that were analyzed. This provided a measure of the important morphological variables in the classification. A DCA was used to classify the 20 specimens into distinct groups representing 5 known and one new species. High eigenvalues for the X-axis (0.349) and the Y-axis (0.222) indicated that the gradient axes were of considerable length and justified the use of DCA. The X-axis (axis 1) is strongly correlated with 16 characters; these include Bulbil location, Vein number, Peduncle, Spathe constriction, Tube (shape), Spathe shape, Female zone (cm), Ovary diameter (mm), Style, Stigma (shape), Stigma diameter (mm), Sterile zone length (mm), Male zone (cm), Appendix (shape), Berry diameter (mm), Seed diameter (mm) (Table 3, Fig. 4). The Y-axis (axis 2) is strongly correlated with 11 characters; Subterranean part, Tuber shape, Bulbil location, Tube (shape), Limb size (cm), Pistil length (mm), Ovary (shape), Style, Stigma (shape), Thecae, Flowering time (Table 3, Fig. 4). 6 • Phytotaxa 130 (1) © 2013 Magnolia Press LIU ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. TABLE 5. DCA analysis of 38 quantitative variables (taxonomic characters) for 24 specimens (classification of 6 Pinellia species). Pearson correlations indicate the characters significant to the classification (** = p value < 0.01, * = p value < 0.05). DCA1 DCA2 Characters Pearson Correlation Sig. (2-tailed) Pearson Correlation Sig. (2-tailed) Subterranean part -0.346 0.135 -0.707** 0 Tuber shape 0.185 0.436 -0.534* 0.015 Tuber diameter (cm) 0.154 0.726 0.183 0.274 Leaf number 0.385 0.082 0.217 0.583 Petiole length (cm) -0.091 0.704 0.285 0.224 Petiole color 0.43 0.059 0.031 0.896 Bulbil location -0.505* 0.023 0.566** 0.009 Leaf shape 0.392 0.087 0.342 0.14 Leaf blade length (cm) -0.28 0.232 0.1 0.676 Leaf blade width (cm) -0.269 0.251 0.286 0.221 Vein number -0.592** 0.006 0.164 0.488 Peduncle 0.928** 0 -0.114 0.633 Spathe constriction -0.867** 0 0.186 0.432 Spathe length (cm) 0.185 0.464 -0.022 0.931 Tube (shape) 0.614** 0.004 0.519* 0.019 Limb (shape) 0.371 0.411 0.427 0.239 Limb size (cm) 0.615 0.058 -0.684* 0.029 Spathe shape 0.686** 0.001 -0.096 0.687 Spadix length (cm) 0.142 0.551 -0.436 0.055 Female zone (cm) 0.797** 0 -0.263 0.263 Pistil length (mm) -0.336 0.148 0.825** 0 Ovary (shape) 0.305 0.191 0.755** 0 Ovary diameter (mm) 0.62** 0.004 0.261 0.266 Style 0.669** 0.001 0.483* 0.031 Stigma (shape) 0.451* 0.046 -0.715** 0 Stigma diameter (mm) -0.778** 0 -0.233 0.323 Sterile zone length (mm) -0.768** 0 -0.365 0.114 Male zone (cm) 0.475* 0.034 0.027 0.91 Thecae 0.005 0.983 0.64** 0.002 Appendix (shape) -0.559* 0.01 -0.124 0.601 Appendix (color) 0.138 0.561 0.38 0.099 Appendix length (cm) -0.035 0.883 0.197 0.406 Berries (color) 0.393 0.087 -0.182 0.443 Berries (shape) 0.347 0.134 0.079 0.739 Berry diameter (mm) 0.795** 0 0.029 0.904 Seed diameter (mm) 0.88** 0 -0.128 0.59 Flowering time in wild 0.255 0.277 0.56* 0.01 Fruiting time in wild -0.054 0.821 0.389 0.09 PINELLIA HUNANENSIS SP. NOV. Phytotaxa 130 (1) © 2013 Magnolia Press • 7 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. The DCA ordination of the first two canonical functions identifies a distinct cluster of five specimens that represent the new species, Pinellia hunanensis, in the proximity of the respective allied species (Fig. 4). Intraspecific variation among the samples of the new species is within the natural range of variation for the 6 species of Pinellia in the ordination (Fig. 4). This study provides preliminary evidence of morphometric variation within and among species of Pinellia, which allows further development of hypotheses concerning species limits. DNA barcoding provides additional support for Pinellia hunanensis with clear differentiation among the six species of Pinellia. Interspecific sequence variation identified considerable barcode variation among all of the samples. The K2P interspecific distances for matK among the five known species of Pinellia was 0.022; Pinellia hunanensis had a K2P interspecific distance of 0.026 with the closest morphological species, P. ternata. The K2P interspecific distance for rbcL among the five known species of Pinellia was 0.008; Pinellia hunanensis had a K2P interspecific distance of 0.016 with that of P. ternata. The intraspecific K2P distance was <0.001 for both matK and rbcL within all species including Pinellia hunanensis. A neighbor-joining tree and Bayesian analysis of the DNA barcodes provides strong support for Pinellia hunanensis. The Barcode of Life Data System (BOLD) identifies clusters of barcodes using a neighborjoining (NJ) tree that makes use of an average Kimura-2-parameter model (Kimura 1980). In our analysis, the support from the rbcL NJ tree is congruent with that of the matK NJ tree. The combined data sets produce a single resolved (100%) tree that strongly supports recognition of Pinellia hunanensis (Fig. 5) (Cabrera et al. 2008; Mansion et al. 2008; Newmaster & Ragupathy 2010). This tree revealed barcode clusters for the six Pinellia species and identified considerable interspecific variation between P. hunanensis and P. ternata. The new species clearly formed one clade (100% bootstrap support) (Fig. 5), with the morphologically most similar species, P. ternata placed in a different clade; although morphologically similar, these two taxa are not sister species. P. hunanensis appears to be more closely related to P. fujianensis than it is to P. ternata as it has considerable divergence from P. ternata, P. polyphylla and P. peltata. It is important to consider this new rare species for conservation of biological diversity given that it is easily confused with a common species widely used as a traditional Chinese medicine of economic and cultural importance adopted by the Chinese pharmacopoeia in 2010 (The Editorial Committee of Pharmacopoeia of the People's Republic of China 2010). The processed tuber of P. ternata, known as Ban Xia, is one of the most important herbs in Chinese medicine to reduce lung congestion, vomiting, morning sickness, cough, influenza, pain, swelling (inflammation) and as a birth control (The Editorial Committee of Pharmacopoeia of the People's Republic of China 2010). The unprocessed tuber is only used externally in traditional Chinese medicine. In recent years, it has become very popular in both Japan and China to use P. ternata as an adjuvant therapy in treating bronchus, chronic hepatitis, breast cancer and diabetes. Product substitution is a serious problem within Pinellia herbal products as species of lower potency such as, P. fujianensis, P. polyphylla, P. peltata and P. cordata are often used as substitutes for the desirable P. ternata (Wei & Peng 2003). This is because the identification of P. ternata products and those from morphologically similar species are impossible to differentiate when they are young, as there are no inflorescences. Over harvesting for medicinal use of rare species such as P. hunanensis is possible since it would be very difficult to differentiate even mature plants of P. hunanensis from that of P. ternata. It would be desirable to have a molecular tool such as DNA barcoding to differentiate species of Pinellia used commercial herbal products to support highly quality products and the conservation of rare species. Key to the species of Pinellia (modified from Zhu et al., 2007) 1. Ͷ 2. Ͷ 3. 8 • Leaf blade entire ........................................................................................................................................................... 2 Leaf blade compound, trifoliolate or pedate................................................................................................................. 6 Leaf blade not peltate.................................................................................................................................................... 3 Leaf blade peltate, ovate or oblong.................................................................................................................. P. peltata Petiole lacking bulbils................................................................................................................................................... 4 Phytotaxa 130 (1) © 2013 Magnolia Press LIU ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. Ͷ Petiole or base of leaf blade bearing bulbils ................................................................................................................. 5 4. Leaf blade deltoid-ovate or broadly ovate, base deeply cordate, 6–33×4–22cm ........................................................... ................................................................................................................................................................... P. polyphylla Ͷ Leaf blade ovate or oblong, base obtuse or shallowly cordate, 5–19 × 1.5–6 cm .......................................................... ............................................................................................................................. P. integrifolia Brown (1889: t. 1875) 5. Tuber globose; leaf blade sagittate-oblong, cordate-ovate, base deeply cordate; bulbils present at the base of the petiole and at the base of the leaf blade ...............................................................................................................P. cordata Ͷ Rhizome cylindrical; leaf blade widely sagittate; bulbils at the base of the petiole..................................P. fujianensis 6. Leaf trifoliolate or pedate with 5 leaflets...................................................................................................................... 7 Ͷ Leaf blade always pedate, leaflets 6–11; bulbils absent ............................................P. pedatisecta Schott (1857: 341) 7. Leaf blade only deeply tripartite, anterior lobe broadly ovate or ovate-oblong, sessile; bulbils absent...... P. tripartita Ͷ Leaf blade trisect, sometimes pedate with only 5 leaflets, leaflets oblong or lanceolate ............................................. 8 8. Petiole lacking bulbils, bulbils emerging only from the tuber; lateral leaflets usually bifid.......................................... ....................................................................................................................P. yaoluopingensis Liu & Guo (1986: 223) Ͷ Bulbils present at petiole below middle, or both at lower part of petiole and at the base of the leaf blade ................. 9 9. Inflorescence with peduncle longer than petioles, 25–35 cm long..................................................................P. ternata Ͷ Inflorescence with peduncle much longer than petioles, 45–55 cm long................................................. P. hunanensis Pinellia hunanensis C. L. Long & X. J. Wu, sp. nov. (Figs. 2, 3) Pinellia hunanensis differs from Pinellia ternata (Thunb.) Ten. ex Breitenb. in having very tall inflorescence, and long appendix. Type:—CHINA. Hunan Province: Zhongfang County, Tongwan, cliff in moist forest in the valley, elev. 650 m, 6 July 2009, Long Chun-lin 113 (holotype: KUN!, isotype MUC!). Perennial aroid herb, 20 cm tall. Tuber globose, 1.5–3 cm in diameter. With one leaf, 18–22 cm long, with a green, unspotted petiole and nearly absent sheath. Bulbil at lower portion of petiole, 0.8–1.1 cm in diam. Leaf blades trisect or pentasect, leaflets with obvious petioles; central leaflet lanceolate, 16–20 cm long, 4–5.5 cm wide, upper side green, lower side silver-white, margin crisp; primary lateral veins of the leaf blade pinnate, forming a submarginal collective vein, 1 distinct marginal vein present, higher order venation reticulate; two lateral leaflets smaller, oblique at base. Young leaves simply cordate, 5–6 cm long, 3–4 cm wide. Inflorescence solitary, appearing with leaves, 45–55 cm long; peduncle green, much taller than petiole. Spathe persistent, 5–7.5 cm long, 0.4–0.7 cm in diameter, slightly constricted between tube and blade; tube 2–2.5 cm long, 0.4–0.5 cm in diameter, convolute, ellipsoid, almost closed inside by a transverse septum; limb of spathe oblong, fornicate, green, 3.5–5.5 cm long, much longer than tube. Spadix 12–15 cm long, longer than spathe, female zone 2–3 cm long, adnate to spathe, separated from the male zone by the spathe septum, and by the short, free, naked portion of spadix axis (0.9–1.4 cm long); male zone 1–1.5 com long, cylindric. Appendix smooth, erect or slight curve, elongate-linear, long-exserted from spathe, 8–12 cm long. Flowers unisexual, perigone absent. Male flowers 2-androus, stamens united congenitally in pairs, short, laterally compressed; anthers sessile, connective slender, thecae ellipsoid, 2-celled, dehiscing by apical slit; pollen extruded in amorphous mass, inaperturate, spherical, small, white. Female flowers with ovary ovoid-oblong, 1-locular; ovule 1, orthotropous, 2–2.5 mm long, 1.2–1.5 mm in diam., funicle very short; placentation basal, stylar region attenuate, stigma small, hemispheric. Paratype:—CHINA. Hunan Province: Zhongfang Xian, Tongwan, on cliff within a moist forest in the valley, 670 m, 24 July 2009, Long 179 (KUN!). In the same valley on June 25 2011 at different altitudes: 580 m, Long 829 (KUN!); 640 m, 834 (KUN!); 650 m, 836 (KUN!). Phenology:—Pinellia hunanensis starts to grow leaves in late April or early May, flowers in June-July, and fruits from mid-July to August. After August, the whole plant will get withered. Etymology:—Named after Hunan Province where it was firstly discovered. Habitat and distribution:—The new species was only found in Zhongfang County, western Hunan, Central China. It is restricted to wet cliffs in moist forests and is morphologically similar to Pinellia ternata, which does not grow on cliffs. There are subtle diagnostic characters that can be used to distinguish Pinellia hunanensis from P. ternata, such as the presence of only one leaf; a tall inflorescences up to 55 cm long, PINELLIA HUNANENSIS SP. NOV. Phytotaxa 130 (1) © 2013 Magnolia Press • 9 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. which is 2–3 times longer than petiole; long spadix axis; erect and very long appendix; three leaflets with a crisp, lanceolate margin; one large, central leaflet with two small lateral leaflets that are oblique at base (Fig. 3, Table 2). FIGURE 2. Pinellia hunanensis—A: habit; B: juvenile plant; C: leaf; D: inflorescence; E: spadix; F: infructescence; G: pistil; H: fruit; I: seed (Drawn after the holotype by Yitao Liu). 10 • Phytotaxa 130 (1) © 2013 Magnolia Press LIU ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. FIGURE 3. Habitats of Pinellia hunanensis (Photographed by Chunlin Long). FIGURE 4. A classification tree of combined rbcL and matK data using neighbor-joining (NJ) and Bayesian of phylogenetic methods. PINELLIA HUNANENSIS SP. NOV. Phytotaxa 130 (1) © 2013 Magnolia Press • 11 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. FIGURE 5. Scatter plot of the first two axes from a detrended correspondence analysis (DCA) for 38 quantitative morphological variables (taxonomic characters) of 24 specimens (classification of 6 Pinellia species). The new species Pinellia hunanensis is circled, including its respective intraspecific variation. Acknowledgements The authors are grateful to Ying Tan and Xueyi Sui for helping with the bioinformatics tools used in this study. Mr. Yitao Liu, our artist, helped to draw the beautiful illustration. This research was supported by the State Administration of Traditional Chinese Medicine of China (Cai-She 2011-76), the Hunan Provincial Department of Science & Technology of China (2012SK2008), the Ministry of Education of China through its 111 and 985 projects (B08044, MUC 985), the National Natural Science Foundation of China (31070288 & 31161140345), the Japan Society for the Promotion of Science (JSPS/AP/109080), the Ministry of Science and Technology of China (2008FY110400 & 2012FY110300), Canadian Foundation for Innovation (SGNCFI12948) and Genome Canada through the Ontario Genomics Institute (SGN-047741). References Base, S. (1999) 10.0 User’s Guide. SPSS Inc. Chicago, IL. Bogner, J. & Li, H. (2010) Pinellia. Flora of China 23: 5–39. Breitenbach, W. (1879) Die Blütheneinrichtung von Arum ternatum Thnbg. Botanische Zeitung (Berlin) 37: 687–693. Brown, N.E. (1889) Plate 1875. Pinellia integrifolia. In: Hooker, J.D. (ed.) Icones Plantarum; or Figures, with brief Descriptive Characters and Remarks of New or Rare Plants. London: Longman, Rees, Orme, Brown, Green & Longman, etc. Brown, N.E. (1903) 153. Aroideœ. Journal of the Linnean Society, Botany 36: 173–188. Cabrera, L.I., Salazar, G.A., Chase, M.W., Mayo, S.J., Bogner, J. & Dávila, P. (2008) Phylogenetic relationships of aroids and duckweeds (Araceae) inferred from coding and noncoding plastid DNA. American Journal of Botany 95: 1153–1165. http://dx.doi.org/10.3732/ajb.0800073 Cuénoud P., Savolainen, V., Chatrou, L.W., Powell, M., Grayer, R.J., & Chase, M.W. (2002) Molecular phylogenetics of Caryophyllales based on nuclear 18S rDNA and plastid rbcL, atpB, and matK DNA sequences. American Journal of Botany 89: 132–144. Cusimano, N., Bogner, J., Mayo, S.J., Boyce, B.C., Wong, S.Y., Hesse, M., Hetterscheid, W.L.A., Keating, R.C. & French, J.C. (2011) Relationships within the Araceae: comparison of morphological patterns with molecular phylogenies. American Journal of Botany 98: 654–668. http://dx.doi.org/10.3732/ajb.1000158 The Editorial Committee of Pharmacopoeia of the People's Republic of China (2010) Pharmacopoeia of the People's Republic of China (Vol. 1). China Medical Science and Technology Press, Beijing. Fay, M.F., Swensen, S.M. & Chase, M.W. (1997) Taxonomic affinities of Medusagyne oppositifolia (Medusagynaceae). Kew 12 • Phytotaxa 130 (1) © 2013 Magnolia Press LIU ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. Bulletin 52: 111–120. Fazekas, A.J., Burgess, K.S., Kesanakurti, P.R., Graham, S.W., Newmaster, S.G., Husband, B.C., Percy, D.M., Hajibabaei, M. & Barrett, S.C.H. (2008) Multiple multilocus DNA barcodes from the plastid genome discriminate plant species equally well. PLoS ONE 3: e2802. http://dx.doi.org/10.1371/journal.pone.0002802 Hollingsworth, P.M., Forrest, L.L., Spouge, J.L., Hajibabaei, M., Ratnasingham, S., van der Bank, M., Chase, M.W., Cowan, R.S., Erickson, D.L., Fazekas, A.J., Graham, S.W., James, K.E., Kim, K.J., Kress, W.J., Schneider, H., van AlphenStahl, J., Barrett, S.C., van den Berg, C., Bogarin, D., Burgess, K.S., Cameron, K.M., Carine, M., Chacón, J., Clark, A., Clarkson, J.J., Conrad, F., Devey, D.S., Ford, C.S., Hedderson, T.A., Hollingsworth, M.L., Husband, B.C., Kelly, L.J., Kesanakurti, P.R., Kim, J.S., Kim, Y.D., Lahaye, R., Lee, H.L., Long, D.G., Madriñán, S., Maurin, O., Meusnier, I., Newmaster, S.G., Park, C.W., Percy, D.M., Petersen, G., Richardson, J.E., Salazar, G.A., Savolainen, V., Seberg, O., Wilkinson, M.J., Yi, D.K. & Little, D.P. (2009) A DNA barcode for land plants. Proceedings of the National Academy of Sciences 106: 12794– 12797. http://dx.doi.org/10.1073/pnas.0906757106 Hu, S.-L. (1984) Pinellia polyphylla. Acta Pharmaceutica Sinica 19: 712–714. Kimura, M. (1980) A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16: 111–120. Kress, W.J. & Erickson, D.L. (2007) A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region. PLoS ONE 2: e508. http://dx.doi.org/10.1371/journal.pone.0000508 Li, H. (1979) Flora Reipublicae Popularis Sinicae (Vol 13). Science Press, Beijing, 242 pp. Li, H. & Zhu, G.H. (2007) A synopsis and a new species of the E Asian genus Pinellia. Willdenowia 37: 503–522. Liu, X. & Guo, X. (1986) A new species of Pinellia from Anhui province. Acta Botanica Yunnanica 8: 223–224. Mansion, G., Rosenbaum, G., Schoenenberger, N., Bacchetta, G., Rossello, J.A. & Conti, E. (2008) Phylogenetic analysis informed by geological history supports multiple, sequential invasions of the Mediterranean Basin by the angiosperm family Araceae. Systematic Biology 57: 269–285. http://dx.doi.org/10.1080/10635150802044029 Mayo, S.J., Bogner, J. & Boyce, P.C. (1997) The genera of Araceae. Royal Botanic Gardens, Kew, 370 pp. Newmaster, S.G. & Ragupathy, S. (2010) Ethnobotany genomics-discovery and innovation in a new era of exploratory research. Journal of Ethnobiology and Ethnomedicine 6:2. http://dx.doi.org/10.1186/1746-4269-6-2 Ohwi, J. (1984) Flora of Japan. Washington, DC, Smithsonian Institution. P’ei, C. (1935) Notes on Pinellia of China. Contributions from the Biological Laboratory of the Science Society of China 10: 1– 3. Ramsey, F.L. & Schafer, D.W. (2012) The statistical sleuth: a course in methods of data analysis: Brooks/Cole Publishing Company. Ren, B.Q., Xiang, X.G. & Chen, Z.D. (2010) Species identification of Alnus (Betulaceae) using nrDNA and cpDNA genetic markers. Molecular Ecology Resources 10: 594-605. http://dx.doi.org/10.1111/j.1755-0998.2009.02815.x Rohlf, F.J. & Corti, M. (2000) Use of two-block partial least-squares to study covariation in shape. Systematic Biology 49: 740– 753. http://dx.doi.org/10.1080/106351500750049806 Sang, T., Crawford, D.J., Stuessy , T.F. (1997) Chloroplast DNA phylogeny, reticulate evolution and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84: 1120–1136. Schott, H.W. (1856) Synopsis Aroidearum : complectens enumerationem systematicam generum et specierum hujus ordinis. I 5. Schott, H. (1857) Aroideen-Skizzen. Oesterreichisches Botanisches Wochenblatt. Gemeinnütziges Organ für Botanik und Botaniker, Gärtner, Oekonomen, Forstmänner, Aerzte, Apotheker und Techniker. 43: 341–342. Sneath, P.H. & Sokal, R.R. (1973) Numerical taxonomy: The principles and practice of numerical classification. W.H. Freeman and Company, USA, San Francisco, 573 pp. Tate, J.A. (2002) Systematics and evolution of Tarasa (Malvaceae): an enigmatic Andean polyploid genus. Ph.D. dissertation. The University of Texas at Austin. Tenore, M. (1839) Pinellia tripartita (Blume) Schott. Atti della Reale Accademia delle Scienze: Sezione della Societa Reale Borbonica 4: 69. Terachi, T., Ogihara, Y. & Tsunewaki, K. (1987) The molecular basis of genetic diversity among cytoplasms of Triticum and Aegilops. VI. Complete nucleotide sequences of the rbcL genes encoding H- and L-type Rubisco large subunits in common wheat and Ae. crassa 4x. Japanese Journal of Genetics 62: 375–387. Wei, S. & Peng, Z. (2003) Survey of Pinellia ternata and its adulterants. Journal of Chinese Medicinal Materials 26: 828–832. Zhu, G., Li, H. & Li, R. (2007) A synopsis and a new species of the E Asian genus Pinellia (Araceae). Willdenowia 37: 503– 522. PINELLIA HUNANENSIS SP. NOV. View publication stats Phytotaxa 130 (1) © 2013 Magnolia Press • 13