marine
drugs
Marine Proteins
and Peptides
Edited by
Se-Kwon Kim
Printed Edition of the Special Issue Published in Marine Drugs
www.mdpi.com/journal/marinedrugs
Marine Proteins and Peptides
Special Issue Editor
Se‐Kwon Kim
MDPI • Basel • Beijing • Wuhan • Barcelona • Belgrade
Special Issue Editor
Se‐Kwon Kim
Korea Maritime and Ocean University
South Korea
Editorial Office
MDPI AG
St. Alban‐Anlage 66
Basel, Switzerland
This edition is a reprint of the Special Issue published online in the open access
journal Marine Drugs (ISSN 1660‐3397) from 2016–2017 (available at:
http://www.mdpi.com/journal/marinedrugs/special_issues/marine_proteins_pepti
des).
For citation purposes, cite each article independently as indicated on the article
page online and as indicated below:
Author; Author. Article title. Journal Name. Year. Article number, page range.
First Edition 2018
ISBN 978‐3‐03842‐646‐2 (Pbk)
ISBN 978‐3‐03842‐647‐9 (PDF)
Articles in this volume are Open Access and distributed under the Creative Commons Attribution
license (CC BY), which allows users to download, copy and build upon published articles even for
commercial purposes, as long as the author and publisher are properly credited, which ensures
maximum dissemination and a wider impact of our publications. The book taken as a whole is
© 2018 MDPI, Basel, Switzerland, distributed under the terms and conditions of the
Creative Commons license CC BY‐NC‐ND (http://creativecommons.org/licenses/by‐nc‐nd/4.0/).
Table of Contents
About the Special Issue Editor ..................................................................................................................... vii
Preface to “Marine Proteins and Peptides” ................................................................................................ ix
Yun Li, Faizan A. Sadiq, Li Fu, Hui Zhu, Minghua Zhong and Muhammad Sohail
Identification of Angiotensin I‐Converting Enzyme Inhibitory Peptides Derived from Enzymatic
Hydrolysates of Razor Clam Sinonovacula constricta
Reprinted from: Mar. Drugs 2016, 14(6), 110; doi: 10.3390/md14060110 ............................................... 1
Didier Zoccola, Alessio Innocenti, Anthony Bertucci, Eric Tambutté, Claudiu T. Supuran and
Sylvie Tambutté
Coral Carbonic Anhydrases: Regulation by Ocean Acidification
Reprinted from: Mar. Drugs 2016, 14(6), 109; doi: 10.3390/md14060109 ............................................... 16
Hui Yang, Shihao Li, Fuhua Li, Kuijie Yu, Fusheng Yang and Jianhai Xiang
Recombinant Expression of a Modified Shrimp Anti‐Lipopolysaccharide Factor Gene in
Pichia pastoris GS115 and Its Characteristic Analysis
Reprinted from: Mar. Drugs 2016, 14(8), 152; doi: 10.3390/md14080152 ............................................... 27
Xin Pan, Yu‐Qin Zhao, Fa‐Yuan Hu, Chang‐Feng Chi and Bin Wang
Anticancer Activity of a Hexapeptide from Skate (Raja porosa) Cartilage Protein Hydrolysate in
HeLa Cells
Reprinted from: Mar. Drugs 2016, 14(8), 153; doi: 10.3390/md14080153 ............................................... 41
M. Azizur Rahman
An Overview of the Medical Applications of Marine Skeletal Matrix Proteins
Reprinted from: Mar. Drugs 2016, 14(9), 167; doi: 10.3390/md14090167 ............................................... 52
Yan Wang, Qinghao Song and Xiao‐Hua Zhang
Marine Microbiological Enzymes: Studies with Multiple Strategies and Prospects
Reprinted from: Mar. Drugs 2016, 14(10), 171; doi: 10.3390/md14100171 ............................................. 61
Liping Sun, Weidan Chang, Qingyu Ma and Yongliang Zhuang
Purification of Antioxidant Peptides by High Resolution Mass Spectrometry from Simulated
Gastrointestinal Digestion Hydrolysates of Alaska Pollock (Theragra chalcogramma) Skin Collagen
Reprinted from: Mar. Drugs 2016, 14(10), 186; doi: 10.3390/md14100186 ............................................. 85
Hanne K. Mæhre, Ida‐Johanne Jensen and Karl‐Erik Eilertsen
Enzymatic Pre‐Treatment Increases the Protein Bioaccessibility and Extractability in Dulse
(Palmaria palmata)
Reprinted from: Mar. Drugs 2016, 14(11), 196; doi: 10.3390/md14110196 ............................................. 99
Wan‐Yin Fang, Rajiv Dahiya, Hua‐Li Qin, Rita Mourya and Sandeep Maharaj
Natural Proline‐Rich Cyclopolypeptides from Marine Organisms: Chemistry, Synthetic
Methodologies and Biological Status
Reprinted from: Mar. Drugs 2016, 14(11), 194; doi: 10.3390/md14110194 ............................................. 109
iii
Ida‐Johanne Jensen and Hanne K. Mæhre
Preclinical and Clinical Studies on Antioxidative, Antihypertensive and Cardioprotective Effect
of Marine Proteins and Peptides—A Review
Reprinted from: Mar. Drugs 2016, 14(11), 211; doi: 10.3390/md14110211 ............................................. 131
Qiu‐Ye Chai, Zhen Yang, Hou‐Wen Lin and Bing‐Nan Han
Alkynyl‐Containing Peptides of Marine Origin: A Review
Reprinted from: Mar. Drugs 2016, 14(11), 216; doi: 10.3390/md14110216 ............................................. 144
Yu‐Qin Zhao, Li Zeng, Zui‐Su Yang, Fang‐Fang Huang, Guo‐Fang Ding and Bin Wang
Anti‐Fatigue Effect by Peptide Fraction from Protein Hydrolysate of Croceine Croaker
(Pseudosciaena crocea) Swim Bladder through Inhibiting the Oxidative Reactions including
DNA Damage
Reprinted from: Mar. Drugs 2016, 14(12), 221; doi: 10.3390/md14120221 ............................................. 162
Bo‐Hye Nam, Ji Young Moon, Eun Hee Park, Hee Jeong Kong, Young‐Ok Kim, Dong‐Gyun Kim,
Woo‐Jin Kim, Chul Min An and Jung‐Kil Seo
Antimicrobial and Antitumor Activities of Novel Peptides Derived from the Lipopolysaccharide‐
and β‐1,3‐Glucan Binding Protein of the Pacific Abalone Haliotis discus hannai
Reprinted from: Mar. Drugs 2016, 14((12), 227; doi: 10.3390/md14120227 ............................................ 180
Akiko Kojima‐Yuasa, Mayu Goto, Eri Yoshikawa, Yuri Morita, Hirotaka Sekiguchi, Keita Sutoh,
Koji Usumi and Isao Matsui‐Yuasa
Protective Effects of Hydrolyzed Nucleoproteins from Salmon Milt against Ethanol‐Induced Liver
Injury in Rats
Reprinted from: Mar. Drugs 2016, 14(12), 232; doi: 10.3390/md14120232 ............................................. 193
Xixi Cai, Jiaping Lin and Shaoyun Wang
Novel Peptide with Specific Calcium‐Binding Capacity from Schizochytrium sp. Protein
Hydrolysates and Calcium Bioavailability in Caco‐2 Cells
Reprinted from: Mar. Drugs 2017, 15(1), 3; doi: 10.3390/md15010003 ................................................... 206
Hafiz Ansar Rasul Suleria, Barney M. Hines, Rama Addepalli, Wei Chen, Paul Masci,
Glenda Gobe and Simone A. Osborne
In vitro Anti‐Thrombotic Activity of Extracts from Blacklip Abalone (Haliotis rubra)
Processing Waste
Reprinted from: Mar. Drugs 2017, 15(1), 8; doi: 10.3390/md15010008 ................................................... 220
Haitao Ding, Qian Zeng, Lili Zhou, Yong Yu and Bo Chen
Biochemical and Structural Insights into a Novel Thermostable β‐1,3‐Galactosidase from
Marinomonas sp. BSi20414
Reprinted from: Mar. Drugs 2017, 15(1), 13; doi: 10.3390/md15010013 ................................................. 237
Ribang Wu, Leilei Chen, Dan Liu, Jiafeng Huang, Jiang Zhang, Xiao Xiao, Ming Lei,
Yuelin Chen and Hailun He
Preparation of Antioxidant Peptides from Salmon Byproducts with Bacterial
Extracellular Proteases
Reprinted from: Mar. Drugs 2017, 15(1), 4; doi: 10.3390/md15010004 ................................................... 252
iv
Hak Jun Kim, Jun Hyuck Lee, Young Baek Hur, Chang Woo Lee, Sun‐Ha Park
and Bon‐Won Koo
Marine Antifreeze Proteins: Structure, Function, and Application to Cryopreservation as a
Potential Cryoprotectant
Reprinted from: Mar. Drugs 2017, 15(2), 27; doi: 10.3390/md15020027 ................................................. 272
Tsun‐Thai Chai, Yew‐Chye Law, Fai‐Chu Wong and Se‐Kwon Kim
Enzyme‐Assisted Discovery of Antioxidant Peptides from Edible Marine Invertebrates: A Review
Reprinted from: Mar. Drugs 2017, 15(2), 42; doi: 10.3390/md15020042 ................................................. 300
Xue‐Rong Li, Chang‐Feng Chi, Li Li and Bin Wang
Purification and Identification of Antioxidant Peptides from Protein Hydrolysate of Scalloped
Hammerhead (Sphyrna lewini) Cartilage
Reprinted from: Mar. Drugs 2017, 15(3), 61; doi: 10.3390/md15030061 ................................................. 327
Ratih Pangestuti and Se‐Kwon Kim
Bioactive Peptide of Marine Origin for the Prevention and Treatment of
Non‐Communicable Diseases
Reprinted from: Mar. Drugs 2017, 15(3), 67; doi: 10.3390/md15030067 ................................................. 343
En‐Qin Xia, Shan‐Shan Zhu, Min‐Jing He, Fei Luo, Cheng‐Zhan Fu and Tang‐Bin Zou
Marine Peptides as Potential Agents for the Management of Type 2
Diabetes Mellitus—A Prospect
Reprinted from: Mar. Drugs 2017, 15(4), 88; doi: 10.3390/md15040088 ................................................. 366
Xixi Cai, Ana Yan, Nanyan Fu and Shaoyun Wang
In Vitro Antioxidant Activities of Enzymatic Hydrolysate from Schizochytrium sp. and Its
Hepatoprotective Effects on Acute Alcohol‐Induced Liver Injury In Vivo
Reprinted from: Mar. Drugs 2017, 15(4), 115; doi: 10.3390/md15040115 ............................................... 382
María Blanco, José Antonio Vázquez, Ricardo I. Pérez‐Martín and Carmen G. Sotelo
Hydrolysates of Fish Skin Collagen: An Opportunity for Valorizing Fish Industry Byproducts
Reprinted from: Mar. Drugs 2017, 15(5), 131; doi: 10.3390/md15050131 ............................................... 395
Jayachandran Venkatesan, Sukumaran Anil, Se‐Kwon Kim and Min Suk Shim
Marine Fish Proteins and Peptides for Cosmeceuticals: A Review
Reprinted from: Mar. Drugs 2017, 15(5), 143; doi: 10.3390/md15050143 ............................................... 410
Carla Zannella, Francesco Mosca, Francesca Mariani, Gianluigi Franci, Veronica Folliero,
Marilena Galdiero, Pietro Giorgio Tiscar and Massimiliano Galdiero
Microbial Diseases of Bivalve Mollusks: Infections, Immunology and Antimicrobial Defense
Reprinted from: Mar. Drugs 2017, 15(6), 182; doi: 10.3390/md15060182 ............................................... 428
v
About the Special Issue Editor
Se‐Kwon Kim, Ph.D., is presently working as a Distinguished Professor in Korea Maritime and Ocean
University and Research advisor of Kolmar Korea Company. He was worked as distinguished Professor
at Department of Marine Bio Convergence Science and Technology and Director of Marine Bioprocess
Research Center (MBPRC) at Pukyong National University, Busan, South Korea.
He received his M.Sc. and Ph.D. degrees from Pukyong National University and conducted his
postdoctoral studies at the Laboratory of Biochemical Engineering, University of Illinois, Urbana‐
Champaign, Illinois, USA. Later, he became a visiting scientist at the Memorial University of
Newfoundland and University of British Colombia in Canada.
Dr. Kim served as president of the ‘Korean Society of Chitin and Chitosan’ in 1986‐1990, and the
‘Korean Society of Marine Biotechnology’ in 2006‐2007. To the credit for his research, he won the best
paper award from the American Oil Chemists’ Society In 2002. Dr. Kim was also the chairman for ‘7th
Asia‐pacific Chitin and Chitosan Symposium’, which was held in South Korea in 2006. He was the chief‐
editor in the ‘Korean Society of Fisheries and Aquatic Science’ during 2008‐2009. In addition, he is the
board member of International Society of Marine Biotechnology Associations (IMBA) and International
Society of Nutraceuticals and Functional Food (ISNFF).
His major research interests are investigation and development of bioactive substances from marine
resources. His immense experience of marine bio‐processing and mass‐production technologies for
marine bio‐industry is the key asset of holding majorly funded Marine Bio projects in Korea. Furthermore,
he expended his research fields up to the development of bioactive materials from marine organisms for
their applications in oriental medicine, cosmeceuticals and nutraceuticals. To this date, he has authored
around 850 research papers, 70 books, and 120 patents.
vii
Preface to “Marine Proteins and Peptides”
In recent years, proteins and peptides from the marine resources have gained much attention in the
field of pharmaceutical, cosmeceutical and nutraceuticals product development owing to the excellent
biological properties. Proteins and peptides from marine sources are considered to be safe and
inexpensive. Protein‐ and peptide‐based drugs have been increasing in recent days to cure various
diseases by serving multiple roles, such as antioxidants, anticancer drugs, antimicrobials, and
anticoagulants. There are different marine sources (macroalgae, fish, shellfish, and bivalves), which
possibly contain specific protein and peptides.
Totally, 27 articles were published in this special issue of “Marine Proteins and Peptides” including
research and review articles which essentially explains about the antioxidant, antithrombic,
neuroprotection, antimicrobial, antitumor, antifatigue, anticancer, angiotensin‐I‐converting enzymes and
calcium binding capacity activities. Excellent reviews have been given on production of enzyme assisted
discovery of marine antioxidative peptides from marine vertebrates, marine antifreeze proteins, alkynyl‐
containing peptides and marine skeletal matrix proteins.
In the applications part of this special issue, marine proteins and peptides and their usage in the
field of cosmeceutical applications, treatment of type‐2 diabetes, non‐communicable diseases, as well as
preclinical and clinical studies on antioxidative, antihypertensive and cardio protective are presented.
To compiling this special issue as a book, we planned to bring the latest technology to produce
bioactive protein and peptides from marine organisms and their detailed mechanisms in terms of
biological activity which lead to produce the several commercial products. Strong understanding the
protein structure and their mechanisms are the ultimate goal to produce highly valuable, scientific and
industrial applicable products. This book cover the recent technology on production and applications in
terms of marine protein and peptides.
Se‐Kwon Kim
Special Issue Editor
ix
marine drugs
Article
Identification of Angiotensin I-Converting Enzyme
Inhibitory Peptides Derived from Enzymatic
Hydrolysates of Razor Clam Sinonovacula constricta
Yun Li 1, *, Faizan A. Sadiq 2 , Li Fu 1 , Hui Zhu 1 , Minghua Zhong 3 and Muhammad Sohail 4
1
2
3
4
*
School of Life Sciences and Food Technology, Hanshan Normal University, Chaozhou 521041, China;
fl1990@163.com (L.F.); gdzhuhui@126.com (H.Z.)
College of Biosystems Engineering and Food Science, Zhejiang University, Hangzhou 310058, China;
faizan_nri@yahoo.co.uk
School of Chemistry and Environmental Engineering, Hanshan Normal University,
Chaozhou 521041, China; zhongmh@hstc.edu.cn
National Institute of Food Science & Technology, University of Agriculture, Faisalabad 38040, Pakistan;
Sohail.nifsat@gmail.com
Correspondence: fgtmyself@163.com; Tel.: +86-768-231-7422
Academic Editor: Se-Kwon Kim
Received: 11 April 2016; Accepted: 30 May 2016; Published: 3 June 2016
Abstract: Angiotensin I-converting enzyme (ACE) inhibitory activity of razor clam hydrolysates
produced using five proteases, namely, pepsin, trypsin, alcalase, flavourzyme and proteases
from Actinomucor elegans T3 was investigated. Flavourzyme hydrolysate showed the highest
level of degree of hydrolysis (DH) (45.87%) followed by A. elegans T3 proteases hydrolysate
(37.84%) and alcalase (30.55%). The A. elegans T3 proteases was observed to be more effective
in generating small peptides with ACE-inhibitory activity. The 3 kDa membrane permeate of
A. elegans T3 proteases hydrolysate showed the highest ACE-inhibitory activity with an IC50 of
0.79 mg/mL. After chromatographic separation by Sephadex G-15 gel filtration and reverse phase-high
performance liquid chromatography, the potent fraction was subjected to MALDI/TOF-TOF MS/MS
for identification. A novel ACE-inhibitory peptide (VQY) was identified exhibiting an IC50 of 9.8 μM.
The inhibitory kinetics investigation by Lineweaver-Burk plots demonstrated that the peptide acts as
a competitive ACE inhibitor. The razor clam hydrolysate obtained by A. elegans T3 proteases could
serve as a source of functional peptides with ACE-inhibitory activity for physiological benefits.
Keywords: ACE-inhibitory peptides; razor clam; enzymatic hydrolysis; Actinomucor elegans proteases;
identification; MALDI/TOF-TOF MS/MS
1. Introduction
Hypertension is one of the major global health issues, owing to its chronic nature, wide prevalence
and linkage with increased mortality and morbidity which affects approximately 16%–37% of the global
population [1]. Long term hypertension is one of the major risk factors and clinical manifestations
of arteriosclerosis, cardiovascular diseases, strokes, heart failures, and chronic renal diseases [2,3].
Angiotensin-converting enzyme (ACE, EC 3.4.15.1) is a key enzyme of renin-angiotensin system
(RAS) which is known as a cascade that controls the regulation of arterial blood pressure and
cardiac output. Angiotensin I is a ten-amino acid peptide produced by the action of rennin on
angiotensinogen. Once angiotensin I is formed, it is converted to angiotensin II through the removal
of two C-terminal residues (His-Leu) by the action of ACE, thus resulting in vasoconstriction,
ultimately leading to the increase in blood pressure [4]. In addition, ACE is also known to catalyze
the degradation of the vasodilator bradykinin into inactive fragments, which leads to the decrease
Mar. Drugs 2016, 14, 110
1
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2016, 14, 110
in vasodilation [5]. Thus, the inhibition of ACE is considered as an effective strategy in designing
pharmaceutical drugs for the treatment of hypertension. Synthetic drugs targeting inhibition of ACE
are normally used for the clinical treatment of hypertension such as captopril, enalapril, and alcacepril.
However, therapies with these drugs are believed to cause side effects including dry cough, renal failure,
skin rashes, and angioneurotic edema [6]. So, there is a dire need to find natural ACE inhibitors with
lower or no side effect in order to development pharmaceuticals and nutraceuticals for the prevention
and remedy of hypertension.
Food protein-derived bioactive peptides are naturally physiologically active peptide fragments
encrypted within the sequence of food proteins, and can be released through enzymatic hydrolysis and
microbial fermentation. Besides providing adequate nutrients, food protein-derived bioactive peptides
possess beneficial pharmacological properties such as antihypertensive, antioxidant, antiproliferative,
and immunomodulatory activities [7]. There is great interest among researchers to unreveal food based
bioactive peptides which are encrypted within food proteins, with a view to develop functional foods
and nutraceuticals. Compared with chemosynthetic drugs, bioactive peptides of food origin are usually
considered safe, effective and economical and thus these are healthier and more natural alternative
to synthetic drugs [8]. Since the discovery of first ACE-inhibitory peptides from snake venome [9],
many ACE-inhibitory peptides have been reported from the protein hydrolysates of foods [10].
Marine fishes, due to phenomenal biodiversity of their habitat and broad spectra of bioactivities,
are relatively untapped and rich sources of proteins of high biological value as compared to land
animals [5]. Thus, fish and sea food are excellent sources of proteins and can be utilized as an ideal
starting material for the production of novel ACE-inhibitory peptides. Enzymatic hydrolysis is a
widely used method to release ACE-inhibitory peptides from marine fish proteins. The effectiveness
of using this method to generate specific peptide fragments with inhibitory activity mainly depends
on the proteolytic enzyme used, hydrolysis conditions and the degree of hydrolysis (DH) achieved.
A variety of enzymes including commercial proteases and proteases of microbial origin have been
reported for the production of ACE-inhibitory peptides from various marine fish proteins. In particular,
a number of novel ACE-inhibitory peptides with good activity have been reported from the enzymatic
hydrolysate of shellfish such as oyster [11,12], shrimp [13], hard clam [14] and cuttlefish muscle [15].
Razor clam (Sinonovacula constricta) is one of the four major economically cultivated shellfish in
China, which has been cultured for hundreds of years [16]. Due to its high nutritional and economical
values, razor clam is a popular shellfish food and has been widely cultivated along east coast of China.
According to 2015 Fisheries Statistical Yearbook of China (2015), the cultured razor clam yield was more
than 786,000 tons in 2014. To date, there is no study aiming to investigate the potential of razor clam to
generate ACE-inhibitory peptides which could be exploited as antihypertensive agents in functional
foods and nutraceuticals. Therefore, the objectives of this work are two folds: first, to evaluate the
ACE-inhibitory activity of the hydrolysates produced with different proteases. Secondly, to purify
and identify the potential ACE-inhibitory peptides from the hydrolysate. Furthermore, the inhibitory
kinetics of the identified peptide based on Lineweaver-Burk plots were also studied.
2. Results and Discussion
2.1. Production of Enzymatic Hydrolysates
2.1.1. Proximate Composition of Razor Clam
The results of the proximate composition of razor clam are shown in Table 1. The average
values for moisture, protein, fat, carbohydrate and ash are 80.32, 13.68, 1.89, 2.13 and 1.93 g/100 g
(fresh weight), respectively. On a dry weight basis, protein was the predominant proximate
composition, occupying 69.51% of the dry weight. The protein content of razor clam determined in
the present study was higher than reported values for protein (9.09–12.75 g/100 g fresh weight) in
Asian hard clam (Meretrix lusoria) [17], Veneridae clams (9.00–12.51 g/100 g fresh weight) [18] and surf
clam (Mactra violacea) (11.9 g/100 g fresh weight) [19]. The value of fat content was consistent with
2
Mar. Drugs 2016, 14, 110
previously reported values for fat content in surf clam (1 g/100 g fresh weight) and Veneridae clams
(1.32–2.4 g/100 g fresh weight). Similarly, the reported carbohydrate content in the current study is in
the range of carbohydrate value that was previously reported in Veneridae clams (1.72–3.61 g/100 g
fresh weight). However, a comparatively higher value for fat content has previously been reported
for Asian hard clam (1.58–6.58 g/100 g fresh weight). The results of proximate analysis indicate that
razor clam is a rich source of nutrients, particularly protein content, and can be used to produce
bioactive peptides.
Table 1. Proximate composition of razor clam.
Composition
Contents (g/100 g Fresh Weight)
Moisture
Protein
Fat
Carbohydrate
Ash
80.32 ˘ 0.53
13.68 ˘ 0.62
1.89 ˘ 0.13
2.13 ˘ 0.31
1.93 ˘ 0.08
2.1.2. Degree of Hydrolysis and ACE-Inhibitory Activity of Hydrolysates by Different Proteases
Enzymatic hydrolysis was performed using pepsin, trypsin, alcalase, flavourzyme and crude
proteases from A. elegans T3. Hydrolysis efficiency was evaluated by measuring degree of hydrolysis
(DH) in the hydrolysates that had been generated by using five different proteases (Figure 1a).
Overall, the hydrolysis of the razor clam proteins was characterized by a high rate of hydrolysis
during the initial 1–2 h; 1 h for pepsin and trypsin hydrolysis, and within 2 h for alcalase, flavourzyme
and crude proteases from A. elegans T3. The rapid increase in DH indicates that a large amount of
peptides were cleaved from proteins and released into hydrolysates at the initial stage. After that,
the hydrolysis entered into stationary phase where no apparent increase in DH was observed
(Figure 1a). These results represent similar hydrolysis curves that are previously reported for the
protein hydrolysates of sardinelle (Sardinella aurita) by-products [20], sole and squid [21], yellow stripe
trevally (Selaroides leptolepis) [22] and catfish (Pangasius sutchi) [23]. The rate of enzymatic cleavage
of peptide bonds is an important factor determining the rate of DH [24]. During the initial phase
of the reaction kinetics, the reaction speed is very fast and thus peptide bonds are easily cleaved
resulting in a large number of soluble peptides in the reaction mixture. These peptides also act as
effective substrate competitors to undigested or partially digested compact proteins in substrate [25].
Decreased hydrolysis reaction rate during the stationary phase can also be attributed to the limited
availability of the substrate, as it is known that the substrate decreases by the reaction time.
Also, decrease in enzymatic activity or partial enzymatic inactivation by the time is an important
reason of slower degree of hydrolysis during the later stages of the reaction [26].
Among the proteases investigated, hydrolysis with flavourzyme showed higher level of DH
during the whole process, reaching a maximum level of 45.87% after 3 h, followed by A. elegans
T3 proteases (37.84%) and alcalase (30.55%), whereas the lower DH values were observed with
pepsin (18.72%) and trypsin (15.67%). The efficiency of proteases in catalyzing the hydrolysis depends
on the nature of the substrate proteins and the specificity of proteases towards these proteins.
Lower DH value obtained upon tryptic hydrolysis is probably due to trypsin’s specificity, as it is
known that trypsin preferentially catalyzes polypeptides on the carboxyl side of basic amino acids
(arginine or lysine). In case of pepsin, the enzyme exhibits preferential cleavage for hydrophobic
residues, preferably cleaves aromatic residues. However, pepsin is unable to hydrolyse the proline
peptide bond efficiently [27]. This may cause resistance to hydrolysis when using pepsin to digest
protein substrate containing high content of proline. Similar inefficiency of pepsin has previously been
reported when the lowest DH was observed in the pepsin hydrolysate among all the proteases used
for barley hordein proteolysis [28].
3
Mar. Drugs 2016, 14, 110
Figure 1. Degree of hydrolysis with proteases during hydrolysis (a) and effect of hydrolysis time on
angiotensin I-converting enzyme (ACE)-inhibitory activity of hydrolysates (b). Different letters indicate
significant differences in the same group (p < 0.05).
To investigate the effect of hydrolysis time on ACE-inhibitory activity, samples were taken
from the hydrolysates at different time intervals and subjected to ACE-inhibitory activity assay at a
concentration of 2 mg peptide/mL (Figure 1b). Among all hydrolysates, the ACE-inhibitory activity
increased with increasing hydrolysis time except for flavourzyme-generated hydrolysates. The highest
ACE inhibition at a level of 94.79% was observed for the hydrolysates of A. elegans T3 proteases after
4 h of hydrolysis. In particular, ACE-inhibitory activity significantly increased during the first stage
of hydrolysis which depicts a fast increase in DH at the beginning and its positive influence on the
generation of ACE-inhibitory peptides (p < 0.05). DH was defined as the percent ration between the
fraction of peptide bonds cleaved to the total number of peptide bonds [29], and it has been widely
used to evaluate hydrolytic progress. The positive correlation between DH value and ACE-inhibitory
activity has been reported in studies on the proteolysis of canola meal [30], cuttlefish muscle [15],
palm kernel cake [31] and bovine collagen [32] proteins. It has been suggested that reaching a certain
level of DH was contributive to release more active peptides from protein precursors [30]. In the
present study, the results of hydrolysis using pepsin, trypsin, alcalase and A. elegans T3 proteases were
in agreement with these studies. The hydrolysate as a result of A. elegans T3 proteases, having higher
4
Mar. Drugs 2016, 14, 110
DH values, showed better ACE-inhibitory activity as well. However, the similar observation was not
found in the case of treatment with flavourzyme hydrolysate, which, despite having the highest DH
value, showed lower inhibitory activity. Flavourzyme is a complex of protease and peptidases having
endoprotease as well as exopeptidase activities. It has been applied to prepare short chain peptides [28]
and lower bitter taste of hydrolysates [33]. Action of peptidases can promote the production of peptides
of small molecular weight. On the other hand, using this enzyme may also cause degradation of active
peptides into shorter inactive peptides or amino acids. Similar inefficiency of using flavourzyme in the
production of ACE-inhibitory peptides was reported for red scorpion fish proteins [34].
2.1.3. Peptide Content and ACE-Inhibitory Activity of Ultra-Filtration Fractions
After 4 h of hydrolysis, the hydrolysates obtained with different proteases were further separated
by ultra-filtration into three molecular weight fractions, <3 kDa, 3–10 kDa and >10 kDa. The peptide
contents and the molecular weight distributions are shown in Figure 2a. The peptide contents of
A. elegans T3 proteases hydrolysate was significantly higher than that of other hydrolysates (p < 0.05),
indicating that more peptides were released from protein precursors. Furthermore, A. elegans proteases
hydrolysate contained larger proportion of the peptides with size below 3 kDa (45.0%) as compared
to the other hydrolysates. These results suggest that A. elegans T3 proteases is more effective in
generating peptides of low molecular weight from razor clam proteins. For flavourzyme hydrolysis,
the higher DH did not lead to the higher content of peptides. This can be explained by the fact
that flavourzyme contain exopeptidases which release more free amino acids. So the DH value for
this enzyme hydrolysate correlates with the content of free amino acids and not with the content
of peptides.
ȱ
Figure 2. Peptide content (a) and IC50 value (b) of fractions from hydrolysates separated by
ultra-filtration. Different letters indicate the mean values are significantly different (p < 0.05).
5
Mar. Drugs 2016, 14, 110
The ACE-inhibitory activity was found to be significantly dependent on peptide fraction molecular
weight (Figure 2b). The <3 kDa peptide fraction showed significantly higher ACE-inhibitory activity
than those of higher molecular weight fractions (3–10 kDa and >10 kDa) for each protease hydrolysate
(p < 0.05). Specifically, the 3–10 kDa fractions from flavourzyme and A. elegans proteases hydrolysates
had significantly (p < 0.05) higher ACE-inhibitory properties in comparison with >10 kDa fractions.
Pepsin, trypsin and alcalase hydrolysates, on the contrary, showed no significant difference in the
activity of fractions (3–10 kDa and >10 kDa). The highest ACE-inhibitory activity (lowest IC50 value)
was found in the <3 kDa fraction of A. elegans T3 proteases hydrolysate, with an IC50 value of
0.79 mg/mL. Molecular weight is an important determinant for the ACE-inhibitory activity of peptides.
It was reported that food protein derived ACE-inhibitory peptides are in the molecular weight range of
below 3 kDa [35]. The weak inhibitory activity of high MW peptides are primarily due to the inability
of the ACE-catalytic site to bind large molecules [36]. Therefore, based on these result, the <3 kDa
fraction of A. elegans T3 proteases hydrolysate was used for further purification and identification of
active peptides.
2.2. Identification of ACE-Inhibitory Peptides
2.2.1. Isolation and Purification of ACE-Inhibitory Peptides
The <3 kDa fraction of A. elegans T3 proteases hydrolysate was separated by Sephadex G-15 gel
filtration chromatography into five major absorbance peaks at 220 nm (Figure 3). Fractions (G1–G5)
associated with the peaks were pooled and lyophilized for ACE-inhibitory activity assay. The fraction
G5 exhibited the highest ACE-inhibitory activity among the collected fractions, with IC50 value of
0.17 mg/mL. Therefore, the fraction G5 was subjected to RP-HPLC for further purification. Eight peaks
(F1–F8) were obtained separately according to the chromatogram (60 min) (Figure 4a). The highest
inhibitory activity was observed in fraction F7, with an IC50 value of 29.3 μg/mL. Fraction F7 was
further purified by the second step of RP-HPLC and fractionated into six major sub-fractions (F7.1–F7.6,
Figure 4b). Most of the ACE-inhibitory activity occurred in fraction F7.5, which inhibited 96.2% of
the ACE activity at the concentration of 30 μg/mL, whereas the inhibitory activities of the other
sub-fractions were below 35%. Thereafter, fraction F7.5 was selected to identify its sequence by
MALDI/TOF-TOF MS/MS.
Fractions
Absorbance 220nm
1.0
G1
G2
G3
G4
G5
.8
IC 50 (mg/mL)
2.15
1.82
Not detected
0.95
0.17
G5
G2
G4
.6
G3
G1
.4
.2
0.0
0
20
40
60
80
Fraction number
Figure 3. Gel filtration chromatography profile of <3 kDa fraction of A. elegans T3 proteases hydrolysate
on Sephadex G-15 column.
6
Mar. Drugs 2016, 14, 110
ȱ
ȱ
Figure 4. Chromatograms of RP-HPLC for the two-step method used to purify and assay the
ACE-inhibitory peptides. (a) First step of RP-HPLC for fraction G5 from the Sephadex G-15 gel filtration;
(b) Second step of RP-HPLC for fraction F7, the ACE-inhibitory activities of factions (F7.1–F7.6) were
determined at a concentration of 30 μg/mL.
2.2.2. Determination of Amino Acids Sequence
The mass spectrum of fraction F7.5 revealed one most intensive signal, indicating a single
positively charged ion ([M + H]+ ) at 409.2 (Figure 5a). Several other signals with moderate intensity
were seen on the spectrum. Tandem mass spectra confirmed that they are not peptides. The molecular
mass of fraction F7.5 was determined to be 408.2 Da, and ion at m/z 409.2 was selected as precursor
ion for TOF-TOF tandem MS analysis. The amino acid sequence was obtained by de novo sequencing
using software from the MS/MS spectrum (Figure 5b). Also, the masses of the singly charged ions
were matched to the single peptide fragment by manual validation. Therefore, the amino sequence of
fraction F7.5 was identified as Val-Gln-Tyr.
7
Mar. Drugs 2016, 14, 110
ȱ
ȱ
Figure 5. De novo sequencing of purified ACE-inhibitory peptide from RP-HPLC. (a) MALDI/TOF-TOF
MS spectrum of the purified peptide; (b) MALDI/TOF-TOF MS/MS spectrum of the ion 409.2 m/z.
2.2.3. IC50 Value and Inhibition Pattern of Val-Gln-Tyr
To determine the IC50 value and ACE inhibition pattern, Val-Gln-Tyr (VQY) was chemically
synthesized with a purity of greater than 98% by solid-phase technique (Chinese peptide Co., Ltd.,
Hangzhou, China). The IC50 value of VQY was estimated by non-linear regression by fitting the
results of ACE-inhibitory activity (assayed at different concentrations of inhibitor, 0.25–100 μM) to
a four-parameter logistic equation (Figure 6). The nonlinear regression coefficient of the equation
(R = 0.977) demonstrates that the actual value of the experimental data corresponds well with the
value predicted by the equation. The IC50 value of VQY was determined as 9.8 μM by solving the
equation. Many potent ACE-inhibitory peptides have been isolated and identified from various
food proteins. Among them, IPP and VPP are well characterized ACE-inhibitory peptides from
8
Mar. Drugs 2016, 14, 110
fermented milk with IC50 values of 5 μM and 9 μM, respectively. The IC50 value of VQY reported
in this study is close to these two peptides and another peptide VLP isolated from freshwater
clam (Corbicula fluminea) with an IC50 value of 3.7 μM [37]. However, the IC50 value of VQY
peptide reported in this study is much lower than YN peptide (51 μM) isolated from the hard clam
Meretrix lusoria [14]. To the best of our knowledge, this peptide (VQY) is a novel peptide derived
from razor clam proteins exhibiting a strong ACE-inhibitory activity. Structure-activity correlation
among ACE-inhibitory peptides shows that their activity is strongly influenced by amino acid
residues of peptide sequence [38,39]. Many studies have shown that potential ACE-inhibitory peptides
exhibit hydrophobic amino acid residues (tryptophan, phenylalanine, tyrosine, or proline) at their
C-terminus while contain branched aliphatic amino acid residues (Val, Ile, Leu) at the N-terminus [40,41].
The peptide VQY is in accordance with this rule, containing valine at the N-terminal and tyrosine at the
C-terminal. Lineweaver-Burk plots of VQY for ACE inhibition showed three lines, representing ACE
reaction performed in the absence and presence of the peptide. The lines intersected at one point on the
vertical axis, which indicates a competitive inhibition pattern (Figure 7). This result suggests that the
peptide (VQY) acts as a competitive inhibitor and razor clam hydrolysate is a potential candidate of
antihypertensive nutraceuticals.
100
y
6.66
90
105.67
1.45
§ x ·
1 ¨
¸
© 10.8 ¹
ACE residual activity (%)
80
70
60
50
40
30
20
10
0
IC50=9.8 PM
.1
1.0
10.0
100.0
ȱ
VQY concentration (PM)
Figure 6. Determination of IC50 value of VQY.
60
Control
2 ȝg/mL
5 ȝg/mL
1/V (L•min/mmol)
50
y=16.61x+6.3778
R²=0.9854
40
30
y=7.487x+6.2648
R²=0.9844
20
y=3.8878x+6.4589
R²=0.9774
10
0
-1
0
-10
1
2
3
1/[S] (L/mmoL)
Figure 7. Lineweaver-Burk plots of VQY inhibition on ACE.
9
4
Mar. Drugs 2016, 14, 110
3. Materials and Methods
3.1. Materials
Samples of razor clams (Sinonovacula constricta) were obtained from local market.
Actinomucor elegans T3 with strong proteolytic activity was isolated from a traditional fermented
soybean product. ACE (EC 3.4.15.1, from rabbit lung), Hippurl-1-histidyl-l-leucine (HHL),
Pepsin (P6887) and Trypsin (T1426) were purchased from Sigma-Aldrich (St. Louis, MO, USA).
Alcalase 2.4 L and Flavourzyme 500 MG were purchased from Novozyme (Bagasvaerd, Denmark).
All other chemicals were also of analytical grade.
3.2. Preparation of Crude Proteases from Actinomucor elegans T3
Production of crude enzyme from Actinomucor elegans T3 was obtained according to the following
method. A. elegans T3 was grown on Potato Dextrose Agar (PDA) at 28 ˝ C for 72 h. Firstly, the inoculum
was prepared by transferring three round blocks (6 mm in diameter), cut from the plate culture, into
100 mL PDB (Potato Dextrose Broth). The culture was allowed to grow at 28 ˝ C for 2 days on a shaking
incubator at 150 rpm. Twenty milliliters of the inoculum was then transferred into 500 mL flasks
containing 180 mL of medium for proteases production. The composition of the medium was as
given (L´1 ): 15 g glucose, 10 g soy protein isolate, 2.5 g yeast extract, 2 g KH2 PO4 , 2 g MgSO4 with
a final pH of 6.0. After inoculation, the medium containing the culture was incubated at 28 ˝ C on
a shaking incubator upheld at 150 rpm for 60 h. The supernatants were collected by centrifugation
(10,000ˆ g, 15 min) at 4 ˝ C and then passed through 0.45 μm filters. The filtrates were lyophilized and
used as crude proteases. The lyophilized filtrates were stored at ´20 ˝ C until use. One unit of proteases
was defined as the amount of enzyme required to bring an increase of 0.01 OD units at 280 nm per
minute at assay conditions and measured as 0.4 M Trichloroacetic acid (TCA) soluble products using
hemoglobin as substrate.
3.3. Enzymatic Hydrolysis
Meat of razor clams was stripped from the shell completely and washed carefully with distilled
water to remove sand. Clean tissues were homogenized with distilled water (two times the volume
of the tissues). The homogenate was heated at 85 ˝ C for 10 min to inactivate endogenous proteases
and then lyophilized. The resulting razor clam powder was kept at ´20 ˝ C until hydrolysis.
Proximate composition of razor clam was determined according to the method of the Association of
Official Analytical Chemists [42].
For hydrolysis with each protease, twenty grams of razor clam powder was mixed with 200 mL
of distilled water in a blender for 2 min. Protease was added to the mixture at the enzyme/substrate
ratio of 3000 U/g. The hydrolysis reactions were conducted under optimal conditions of different
proteases (Table 2). During the hydrolysis, the pH value was kept at the optimal level by adding
1 M HCL or 1 M NaOH. The reaction was stopped by heating the mixture at 90 ˝ C for 10 min followed
by centrifugation at 8000ˆ g for 20 min at 4 ˝ C. Samples from the supernatants were subjected to
peptide content assay. The other collected supernatants were ultra-filtrated sequentially through 3 and
10 kDa molecular weight cutoff membranes (MWCO) (Millipore). The supernatants were first passed
through the membranes with MWCO of 10 kDa. The retentate from 10 kDa membrane was collected
and designated as >10 kDa fraction. The permeate solution collected from 10 kDa membrane was then
filtered through the membrane with MWCO of 3 kDa. Retentate and permeate samples collected from
3 kDa membrane were designated as 3–10 kDa and <3 kDa fractions, respectively. All these collected
fractions were then lyophilized and stored at ´20 ˝ C until further analysis.
10
Mar. Drugs 2016, 14, 110
Table 2. Hydrolysis conditions of proteases.
Protease
Source
Temperature (˝ C)
pH
Pepsin
Trypsin
Alcalase
Flavourzyme
Crude proteases
porcine gastric mucosa
bovine pancreas
Bacillus licheniformis
Aspergillus oryzae
Actinomucor elegans
37
37
40
50
55
2.0
8.0
8.0
6.0
6.0
3.4. Analytical Methods
3.4.1. Angiotensin-Converting Enzyme Inhibition Assay
The ACE-inhibitory activity was measured by HPLC according to the method described by
Cushman and Cheung [43] using HHL as a substrate. The total volume of ACE reaction system was
100 uL consisting of the following components: 50 μL substrate solution (5 mM HHL in 50 mM
HEPES with 300 mM NaCl, pH 8.3), 40 μL test sample and 10 μL ACE (0.1 U/mL). The substrate
solution and sample were mixed and incubated at 37 ˝ C for 5 min in a water bath. Then ACE was
added and incubated at 37 ˝ C for 30 min. The reaction was terminated by adding 250 μL of 1 M
HCl. Hippuric acid (HA) released from ACE reaction was measured by RP-HPLC (Agilent Inc.,
Santa Clara, CA, USA) equipped with C18 column (4.6 ˆ 150 mm, 5 μm, Thermo Scientific, Waltham,
MA, USA) and absorbance detector set at 228 nm. The HHL and HA were eluted using a gradient of 21%
(v/v) acetonitrile containing 0.5% (v/v) trifluoroacetic acid at a flow rate of 1 mL/min. The inhibitory
activity was calculated using the following formula:
I p%q “
A´B
ˆ 100
A
(1)
where I is the percentage of ACE inhibition by sample, A is the concentration of HA of blank test by
using distilled water instead of sample and B is the concentration of HA with sample added. The IC50
value was defined as the concentration of peptide inhibiting 50% of the ACE activity under the assayed
conditions, which was estimated by non-linear regression by fitting data to a four-parameter logistic
curve using SigmaPlot software (version 10.0, SPSS Inc., Chicago, IL, USA).
3.4.2. Degree of Hydrolysis Evaluation
Degree of hydrolysis (DH) was estimated by measuring the content of α-amino groups released
by hydrolysis according to the o-phthaldialdehyde (OPA) method [44]. The content of α-amino groups
was expressed as the concentration of serine corresponding to standard curve. The DH was calculated
using the following equation.
B´A
ˆ 100
(2)
DH p%q “
C´A
A is the content of α-amino group at the beginning of protease hydrolysis, and B is the content of
α-amino group in the supernatant after hydrolysis. C is the content of α-amino group from the razor
clam powder hydrolyzed with 6 M HCl (containing 1% (v/v) phenol) at 110 ˝ C for 12 h in tubes sealed
under nitrogen.
3.4.3. Determination of Peptide Content
The peptide content was determined by the Folin phenol method [45] using synthetic peptide
Tyr-Gly-Gly-Phe-Leu-Arg-Lys-Tyr (with molecular weight of 1003.17 g/mol, Chinese peptide Co. Ltd.,
Hangzhou, China) as standard.
11
Mar. Drugs 2016, 14, 110
3.5. Purification and Identification of ACE-Inhibitory Peptides
3.5.1. Gel Filtration Chromatography
The lyophilized powder of ultra-filtration permeate was dissolved in distilled water at a
concentration of 100 mg/mL. Two milliliter of the solution was loaded onto a Sephadex G-15 column
(1.8 ˆ 60 cm) eluted with distilled water at a flow rate of 0.5 mL/min. Fractions were collected at
5 min intervals and the absorbance was measured at 220 nm. The active fractions were pooled and
lyophilized for further purification.
3.5.2. Reversed-Phase High-Performance Liquid Chromatography
The selected fraction obtained from gel filtration was re-dissolved in ultrapure water at a
concentration of 10 mg/mL. Five hundred microliters was injected into Waters 600 HPLC system
(semi-preparative RP-HPLC, Waters, Milford, MA, USA) equipped with Kromasil C18 column
(10 ˆ 250 mm, 10 μm). Solvent A was 0.1% (v/v) trifluoroacetic acid (TFA) in ultrapure water and solvent
B was 0.1% (v/v) TFA in 80% (v/v) acetonitrile. The elution was 100% solvent A for 5 min, followed by
a linear gradient from 0% to 55% of solvent B in 60 min at a flow rate of 2 mL/min. The absorbance of
eluent was detected with a UV detector at 220 nm. Fractions were collected separately through repeated
chromatography using RP-HPLC and concentrated for ACE-inhibitory activity assay. The fraction with
the highest inhibitory activity was lyophilized and dissolved at 5 mg/mL concentration for the second
step RP-HPLC separation under the similar conditions. Two hundred microliters of the samples was
injected and further separated at a flow rate of 1 mL/min with a linear gradient elution of 25%–40%
solvent B for 30 min. The peak with the most of the inhibitory activity was collected and lyophilized.
3.5.3. Identification of the Amino Acid Sequence by MALDI/TOF-TOF MS/MS
The amino acid sequence of the purified peptide was identified by MALDI–TOF–MS/MS.
Peptide sample (0.5 μL) was mixed with 0.5 μL of a saturated solution of α-cyano-4-hydroxycinnamic
acid in 50% (v/v) acetonitrile containing 0.1% (v/v) TFA. The mixture was spotted on the target plate
and analyzed in ABI 5700 MALDI-TOF/TOF MS/MS (AB Sciex, Framingham, MA, USA) in positive
reflector mode with a mass range from 300 to 1000 m/z. The amino acid sequence of peptide fragments
was determined by de novo sequencing using the software DeNovo Explorer (version4.5, AB Sciex,
Framingham, MA, USA) and confirmed by manual validation.
3.5.4. Determination of ACE-Inhibition Pattern
The inhibition kinetics of the peptide on ACE was investigated using HHL as a substrate.
Lineweaver-Burk plot was used to determine the type of inhibition of the peptide. The ACE reactions
were carried out at various substrate concentrations (0.625, 1.25, 2.5 and 5 mM) in the absence and
presence of two different concentrations of the peptide (2 and 5 μg/mL). Linear interpolation was
plotted with the reciprocal of HHL concentration (1/[S]) as the independent variable and with the
reciprocal of HA production (1/[V]) as the dependent variable [46].
3.6. Statistical Analysis
The results were expressed as mean ˘SD (standard deviation). The statistics analysis was carried
out using SPSS 20.0 (version 20, SPSS Inc., Chicago, IL, USA). Differences among treatments were
determined by one way ANOVA. The p value less than 0.05 was considered as statistically significant.
4. Conclusions
The present study revealed that enzyme hydrolysates of razor clam have good potential for the
production of ACE-inhibitory peptides. Among the proteases tested in this trial, A. elegans T3 proteases
was found to be the most efficient in producing small peptides with the best ACE-inhibitory activity.
12
Mar. Drugs 2016, 14, 110
A novel potent ACE-inhibitory peptide, VQY, with the IC50 value of 9.8 μM, was purified from the
hydrolysate by a series of chromatographic separations and identified by MALDI/TOF-TOF MS/MS.
Lineweaver-Burk plots revealed that the peptide exhibits strong competitive inhibition activity against
ACE. This is the first report of ACE-inhibitory peptides derived from enzymatic hydrolysates of razor
clam. It is highly recommended that the ACE-inhibitory peptides from razor clam hydrolysates be
employed in the development of nutraceuticals and pharmaceuticals for the treatment of hypertension.
Acknowledgments: This work was supported by the Technology Support Project of Hanshan Normal University,
Chaozhou, China (QD20150910).
Author Contributions: Yun Li developed the design and ideas of this work; Yun Li, Hui Zhu, Li Fu and
Minghua Zhong carried out the experiments; Li Fu performed the data analysis; Faizan A. Sadiq and Yun Li
interpreted the results and contributed towards the manuscript preparation and writing; Muhammad Sohail
reviewed the manuscript and provided useful suggestion to improve the manuscript.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Poulter, N.R.; Prabhakaran, D.; Caulfield, M. Hypertension. Lancet 2015, 386, 730–731. [CrossRef]
Lackland, D.T.; Weber, M.A. Global burden of cardiovascular disease and stroke: Hypertension at the core.
Can. J. Cardiol. 2015, 31, 569–571. [CrossRef] [PubMed]
George, B.; Pantelis, S.; Rajiv, A.; Luis, R. Review of blood pressure control rates and outcomes.
J. Am. Soc. Hypertens. 2014, 8, 127–141.
FerrãO, F.M.; Lara, L.S.; Lowe, J. Renin-angiotensin system in the kidney: What is new? World J. Nephrol.
2014, 3, 64–76. [CrossRef] [PubMed]
Cheung, R.C.; Ng, T.B.; Wong, J.H. Marine peptides: Bioactivities and applications. Mar. Drugs 2015,
13, 4006–4043. [CrossRef] [PubMed]
Wu, R.; Wu, C.; Liu, D.; Yang, X.; Huang, J.; Zhang, J.; Liao, B.; He, H.; Li, H. Overview of antioxidant
peptides derived from marine resources: The sources, characteristic, purification, and evaluation methods.
Appl. Biochem. Biotechnol. 2015, 176, 1815–1833. [CrossRef] [PubMed]
Fan, X.; Bai, L.; Zhu, L.; Yang, L.; Zhang, X. Marine algae-derived bioactive peptides for human nutrition
and health. J. Agric. Food Chem. 2014, 62, 9211–9222. [CrossRef] [PubMed]
Bartneck, M.; Heffels, K.H.; Pan, Y.; Bovi, M.; Zwadlo-Klarwasser, G.; Groll, J. Inducing healing-like human
primary macrophage phenotypes by 3D hydrogel coated nanofibres. Biomaterials 2012, 33, 4136–4146.
[CrossRef] [PubMed]
Ferreira, S.H.; Bartelt, D.C.; Greene, L.J. Isolation of bradykinin-potentiating peptides from Bothrops jararaca
venom. Biochemistry 1970, 9, 2583–2593. [CrossRef] [PubMed]
Saadi, S.; Saari, N.; Anwar, F.; Abdul Hamid, A.; Ghazali, H.M. Recent advances in food biopeptides:
Production, biological functionalities and therapeutic applications. Biotechnol. Adv. 2015, 33, 80–116.
[CrossRef] [PubMed]
Shiozaki, K.; Shiozaki, M.; Masuda, J.; Yamauchi, A.; Ohwada, S.; Nakano, T.; Yamaguchi, T.;
Saito, T.; Muramoto, K.; Sato, M. Identification of oyster-derived hypotensive peptide acting as
angiotensin-I-converting enzyme inhibitor. Fish. Sci. 2010, 76, 865–872. [CrossRef]
Wang, J.; Hu, J.; Cui, J.; Bai, X.; Du, Y.; Miyaguchi, Y.; Lin, B. Purification and identification of a ACE inhibitory
peptide from oyster proteins hydrolysate and the antihypertensive effect of hydrolysate in spontaneously
hypertensive rats. Food Chem. 2008, 111, 302–308. [CrossRef] [PubMed]
He, H.L.; Chen, X.L.; Sun, C.Y.; Zhang, Y.Z.; Zhou, B.C. Analysis of novel angiotensin-I-converting enzyme
inhibitory peptides from protease-hydrolyzed marine shrimp Acetes chinensis. J. Pept. Sci. 2006, 12, 726–733.
Tsai, J.S.; Pan, C.B.S. ACE-inhibitory peptides identified from the muscle protein hydrolysate of hard clam
(Meretrix lusoria). Process Biochem. 2008, 43, 743–747. [CrossRef]
Balti, R.; Nedjar-Arroume, N.; Adje, E.Y.; Guillochon, D.; Nasri, M. Analysis of novel angiotensin I-converting
enzyme inhibitory peptides from enzymatic hydrolysates of cuttlefish (Sepia officinalis) muscle proteins.
J. Agric. Food Chem. 2010, 58, 3840–3846. [CrossRef] [PubMed]
13
Mar. Drugs 2016, 14, 110
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
Feng, B.; Dong, L.; Niu, D.; Meng, S.; Zhang, B.; Liu, D.; Hu, S.; Li, J. Identification of immune genes of the
Agamaki clam (Sinonovacula constricta) by sequencing and bioinformatic analysis of ests. Mar. Biotechnol. 2010,
12, 282–291. [CrossRef] [PubMed]
Karnjanapratum, S.; Benjakul, S.; Kishimura, H.; Tsai, Y.H. Chemical compositions and nutritional value
of Asian hard clam (Meretrix lusoria) from the coast of Andaman Sea. Food Chem. 2013, 141, 4138–4145.
[CrossRef] [PubMed]
Yoon, H.; An, Y.K.; Choi, S.D.; Kim, J. Proximate composition in the muscle and viscera of five Veneridae
clams (bivalvia) from southern coast of Korea. Korean J. Matacol. 2008, 24, 67–72.
Laxmilatha, P. Proximate composition of the surf clam Mactra violacea (Gmelin 1791). Indian J. Fish. 2009,
56, 147–150.
Bougatef, A.; Nedjar-Arroume, N.; Ravallec-Plé, R.; Leroy, Y.; Guillochon, D.; Barkia, A.; Nasri, M.
Angiotensin I-converting enzyme (ACE) inhibitory activities of sardinelle (Sardinella aurita) by-products
protein hydrolysates obtained by treatment with microbial and visceral fish serine proteases. Food Chem.
2008, 111, 350–356. [CrossRef] [PubMed]
Giménez, B.; Alemán, A.; Montero, P.; Gómez-Guillén, M. Antioxidant and functional properties of gelatin
hydrolysates obtained from skin of sole and squid. Food Chem. 2009, 114, 976–983. [CrossRef]
Klompong, V.; Benjakul, S.; Kantachote, D.; Shahidi, F. Antioxidative activity and functional properties of
protein hydrolysate of yellow stripe trevally (Selaroides leptolepis) as influenced by the degree of hydrolysis
and enzyme type. Food Chem. 2007, 102, 1317–1327. [CrossRef]
Mahmoodani, F.; Ghassem, M.; Babji, A.S.; Yusop, S.M.; Khosrokhavar, R. ACE inhibitory activity of
pangasius catfish (Pangasius sutchi) skin and bone gelatin hydrolysate. J. Food Sci. Technol. 2014, 51, 1847–1856.
[CrossRef] [PubMed]
Benjakul, S.; Morrissey, M.T. Protein hydrolysates from pacific whiting solid wastes. J. Agric. Food Chem.
1997, 45, 3423–3430. [CrossRef]
Nguyen, H.T.M.; Sylla, K.S.B.; Randriamahatody, Z.; Donnay-Moreno, C.; Moreau, J.; Tran, L.T.;
Bergé, J.P. Enzymatic hydrolysis of yellowfin tuna (Thunnus albacares) by-products using protamex protease.
Food Technol. Biotechnol. 2011, 49, 48–55.
Guerard, F.; Guimas, L.; Binet, A. Production of tuna waste hydrolysates by a commercial neutral protease
preparation. J. Mol. Catal. B Enzym. 2002, 19, 489–498. [CrossRef]
Hausch, F.; Shan, L.; Santiago, N.A.; Gray, G.M.; Khosla, C. Intestinal digestive resistance of
immunodominant gliadin peptides. Am. J. Physiol. Gastrointest. Liver Physiol. 2002, 283, 996–1003. [CrossRef]
[PubMed]
Bamdad, F.; Wu, J.P.; Chen, L.Y. Effects of enzymatic hydrolysis on molecular structure and antioxidant
activity of barley hordein. J. Cereal Sci. 2011, 54, 20–28. [CrossRef]
Adler-Nissen, J. Limited enzymic degradation of proteins: A new approach in the industrial application of
hydrolases. J. Chem. Technol. Biotechnol. 1982, 32, 138–156. [CrossRef]
Wu, J.P.; Aluko, R.E.; Muir, A.D. Production of angiotensin I-converting enzyme inhibitory peptides from
defatted canola meal. Bioresour. Technol. 2009, 100, 5283–5287. [CrossRef] [PubMed]
Zarei, M.; Forghani, B.; Ebrahimpour, A.; Abdul-Hamid, A.; Anwar, F.; Saari, N. In vitro and in vivo
antihypertensive activity of palm kernel cake protein hydrolysates: Sequencing and characterization of
potent bioactive peptides. Ind. Crop. Prod. 2015, 76, 112–120. [CrossRef]
Zhang, Y.; Olsen, K.; Grossi, A.; Otte, J. Effect of pretreatment on enzymatic hydrolysis of bovine collagen
and formation of ACE-inhibitory peptides. Food Chem. 2013, 141, 2343–2354. [CrossRef] [PubMed]
Cheung, I.W.Y.; Li-Chan, E.C.Y. Application of taste sensing system for characterisation of enzymatic
hydrolysates from shrimp processing by-products. Food Chem. 2014, 145, 1076–1085. [CrossRef] [PubMed]
Aissaoui, N.; Abidi, F.; Marzouki, M.N. ACE inhibitory and antioxidant activities of red scorpionfish
(Scorpaena notata) protein hydrolysates. J. Food Sci. Technol. Mysore 2015, 52, 7092–7102. [CrossRef]
Hernandez-Ledesma, B.; Contreras, M.D.; Recio, I. Antihypertensive peptides: Production, bioavailability
and incorporation into foods. Adv. Colloid Interface Sci. 2011, 165, 23–35. [CrossRef] [PubMed]
Ramanathan, N.; Schwager, S.L.U.; Sturrock, E.D.; Acharya, K.R. Crystal structure of the human
angiotensin-converting enzyme-lisinopril complex. Nature 2003, 421, 551–554.
14
Mar. Drugs 2016, 14, 110
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
Tsai, J.S.; Lin, T.C.; Chen, J.L.; Pan, B.S. The inhibitory effects of freshwater clam (Corbicula fluminea, Muller)
muscle protein hydrolysates on angiotensin I converting enzyme. Process Biochem. 2006, 41, 2276–2281.
[CrossRef]
Cristina, M.; Maria, D.M.Y.; Justo, P.; Hassan, L.; Julio, G.C.; Manuel, A.; Francisco, M.; Javier, V.
Purification of an ACE inhibitory peptide after hydrolysis of sunflower (Helianthus annuus L.) protein
isolates. J. Agric. Food Chem. 2004, 52, 1928–1932.
Wu, J.; Ding, X. Hypotensive and physiological effect of angiotensin converting enzyme inhibitory peptides
derived from soy protein on spontaneously hypertensive rats. J. Agric. Food Chem. 2001, 49, 501–506.
[CrossRef] [PubMed]
Wu, J.; Aluko, R.E.; Shuryo, N. Structural requirements of angiotensin I-converting enzyme inhibitory
peptides: Quantitative structure-activity relationship study of di- and tripeptides. J. Agric. Food Chem. 2006,
54, 732–738. [CrossRef] [PubMed]
Rohrbach, M.S.; Williams, E.B.; Rolstad, R.A. Purification and substrate specificity of bovine
angiotensin-converting enzyme. J. Biol. Chem. 1981, 256, 225–230. [PubMed]
Helrich, K. Official Methods of Analysis of the AOAC, 14th ed.; Association of Official Analytical Chemists:
Washington, DC, USA, 1990.
Cushman, D.W.; Cheung, H.S. Spectrophotometric assay and properties of the angiotensin I-converting
enzyme of rabbit lung. Biochem. Pharmacol. 1971, 20, 1637–1648. [CrossRef]
Nielsen, P.M.; Petersen, D.; Dambmann, C. Improved method for determining food protein degree of
hydrolysis. J. Food Sci. 2001, 66, 642–646. [CrossRef]
Lowry, O.H.; Rosebrough, N.J.; Farr, A.L.; Randall, R.J. Protein measurement with the Folin phenol reagent.
J. Biol. Chem. 1951, 193, 265–275. [PubMed]
Rao, S.Q.; Ju, T.; Sun, J.; Su, Y.J.; Xu, R.R.; Yang, Y.J. Purification and characterization of angiotensin
I-converting enzyme inhibitory peptides from enzymatic hydrolysate of hen egg white lysozyme.
Food Res. Int. 2012, 46, 127–134. [CrossRef]
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
15
marine drugs
Article
Coral Carbonic Anhydrases: Regulation by
Ocean Acidification
Didier Zoccola 1,2 , Alessio Innocenti 3 , Anthony Bertucci 1,† , Eric Tambutté 1,2 ,
Claudiu T. Supuran 3, * and Sylvie Tambutté 1,2, *
1
2
3
*
†
Marine Biology Department, Centre Scientifique de Monaco, 8 Quai Antoine 1˝ , 98 000 Monaco, Monaco;
zoccola@centrescientifique.mc (D.Z.); anthony.bertucci@u-bordeaux.fr (A.B.);
etambutté@centrescientifique.mc (E.T.)
Laboratoire International Associé 647 BIOSENSIB, Centre Scientifique de Monaco-Centre National de la
Recherche Scientifique, 8 Quai Antoine 1˝ , 98 000 Monaco, Monaco
Neurofarba Department, University of Florence, Via Ugo Schiff 6, Polo Scientifico, Sesto Fiorentino,
50019 Firenze, Italy; alessio.innocenti@unifi.it
Correspondence: claudiu.supuran@unifi.it (C.T.S.); stambutte@centrescientifique.mc (S.T.);
Tel.: +39-055-4573729 (C.T.S); +377-97-77-44-70 (S.T.)
Present address: University of Bordeaux, UMR EPOC CNRS 5805, 33400 Talence, France
Academic Editor: Se-Kwon Kim
Received: 30 March 2016; Accepted: 30 May 2016; Published: 3 June 2016
Abstract: Global change is a major threat to the oceans, as it implies temperature increase and
acidification. Ocean acidification (OA) involving decreasing pH and changes in seawater carbonate
chemistry challenges the capacity of corals to form their skeletons. Despite the large number of
studies that have investigated how rates of calcification respond to ocean acidification scenarios,
comparatively few studies tackle how ocean acidification impacts the physiological mechanisms
that drive calcification itself. The aim of our paper was to determine how the carbonic anhydrases,
which play a major role in calcification, are potentially regulated by ocean acidification. For this
we measured the effect of pH on enzyme activity of two carbonic anhydrase isoforms that have
been previously characterized in the scleractinian coral Stylophora pistillata. In addition we looked at
gene expression of these enzymes in vivo. For both isoforms, our results show (1) a change in gene
expression under OA (2) an effect of OA and temperature on carbonic anhydrase activity. We suggest
that temperature increase could counterbalance the effect of OA on enzyme activity. Finally we point
out that caution must, thus, be taken when interpreting transcriptomic data on carbonic anhydrases
in ocean acidification and temperature stress experiments, as the effect of these stressors on the
physiological function of CA will depend both on gene expression and enzyme activity.
Keywords: coral; calcification; ocean acidification; carbonic anhydrase; gene expression;
enzyme activity; temperature; pH
1. Introduction
Anthropogenic greenhouse gas emissions have increased since the pre-industrial era, which has
led to an increase in atmospheric concentrations of carbon dioxide (CO2 ), methane, and nitrous oxide.
Their effects are extremely likely to have been the dominant cause of the observed warming since the
mid-20th century (IPCC, 2014) [1]. In addition to atmospheric and oceanic warming, the subsequent
uptake of additional CO2 by the oceans causes ocean acidification (OA), which results in pH decrease
and changes in seawater carbonate chemistry. Earth system models project a global increase in ocean
acidification for all representative concentration pathway (RCP) scenarios by the end of the 21st century,
with a slow recovery after mid-century under RCP2.6 (IPCC, 2014) [1]. The decrease in surface ocean
Mar. Drugs 2016, 14, 109
16
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2016, 14, 109
pH is in the range of 0.06 to 0.07 (15% to 17% increase in acidity) for RCP2.6, 0.14 to 0.15 (38% to 41%) for
RCP4.5, 0.20 to 0.21 (58% to 62%) for RCP6.0, and 0.30 to 0.32 (100% to 109%) for RCP8.5 (IPCC, 2014) [1].
Ocean acidification by decreasing pH and changing carbonate chemistry challenges marine organisms,
especially those that form calcareous shells and skeletons, such as scleractinian corals, the major
contributors to the structural foundation of coral-reef ecosystems. Meta-analysis of data obtained from
laboratory and field-based studies indicate declines in coral calcification of 15%–22% at levels of OA
predicted to occur under a business-as-usual scenario of CO2 emissions by the end of the century [2]
(note that this scenario predicts a pCO2 of 800 ppm by the end of the century which corresponds to the
prediction of scenario RCP6.0 in the report of IPCC 2014). Despite the high number of studies that have
investigated how rates of calcification are affected by ocean acidification scenarios, comparatively few
studies tackle how ocean acidification impacts the physiological mechanisms that drive calcification
itself. Carbonic anhydrases (CAs, EC 4.2.1.1) play a major role in the physiology of coral calcification [3].
These enzymes catalyze the interconversion of CO2 to bicarbonate ions and protons according to the
following reaction: CO2 + H2 O Ø HCO3 ´ + H+ . Even if the reaction of CO2 hydration/HCO3 ´
dehydration occurs spontaneously at reasonable rates in the absence of catalysts, their presence can
speed up the reaction up to 107 times (hydration reaction occurs at a rate of 0.15 s´1 in water, whereas
the rate for the most active human CA, hCAII is about 1.4 ˆ 106 s´1 ). In corals, several CAs have been
identified at the molecular level in different coral species and the phylogenetic tree reveals three main
clusters, the cytosolic and mitochondrial proteins, the membrane-bound or secreted proteins, and the
carbonic anhydrase-related proteins [3]. These enzymes play major roles in two essential processes of
coral physiology: they are involved in carbon supply for calcification as well as in carbon concentrating
mechanisms for symbiont photosynthesis. However, the full molecular sequence together with the
tissular localization have only been obtained for two isoforms of the coral Stylophora pistillata [3,4].
Both of these isoforms, STPCA and STPCA2, have been localized in the coral-calcifying cells, named
calicoblastic cells. These cells also transport ions (calcium and bicarbonate) [5–7], regulate pH at the
site of calcification [8], and synthesize organic matrix molecules which are then incorporated in the
skeleton [9]. In the process of calcification two roles have been attributed to the two CA isoforms in S.
pistillata: (1) STPCA catalyzes the interconversion between the different inorganic forms of dissolved
inorganic carbon at the site of calcification [3,9,10]; (2) STPCA2 is an intracellular enzyme which is
then found as an organic matrix protein incorporated in the skeleton [11–13]. As is the case for other
enzymes, carbonic anhydrases are sensitive to environmental conditions and the pH dependency of the
activity of bovine CA is well described [14,15]. Contrarily to mammals, to our knowledge, there are no
data in corals concerning the dependency of the activity of carbonic anhydrase isoforms as a function of
pH. The aim of our paper was, thus, to determine how the carbonic anhydrases characterized in corals
are regulated by ocean acidification. For this we measured, in vitro, the kinetic constant (kcat) and
the catalytic efficiency (kcat/Km where Km is the Michaelis-Menten constant) which both reflect the
enzyme activity of STPCA and STPCA2 under a range of pH from 6 up to 9.5. In addition, we looked
at gene expression of these enzymes in vivo, in corals maintained under conditions of CO2 -driven
seawater acidification from pH 8 down to values of pH 7.2. This range of seawater pH has proved
informative in several previous investigations that sought to identify clear patterns of physiological
responses in corals under seawater acidification.
2. Results and Discussion
2.1. pH Dependency of Coral Carbonic Anhydrases
The pH dependency of CAs is primarily due to the protonation state of Zn-bound water at the
active site. The curve describing the pH dependency of mammalian CAs activity for hydration of CO2
is typically sigmoidal with a plateau obtained for alkaline values, a decrease in enzyme activity with
decreasing pH, and a plateau for the most acidic values [14,15]. As can be seen on Figure 1, the catalytic
efficiency (kcat/Km) of human CAII (hCAII) and two coral CAs, STPCA and STPCA2, shows a
17
Mar. Drugs 2016, 14, 109
sigmoidal curve with a similar IC50 around 7.9. The linear part of the curve of enzyme activity vs. pH is
obtained in the same range of pH for the three enzymes (between 7 and 8.9). STPCA is the membrane
bound/secreted isoform localized in the calcifying cells and this enzyme is supposed to play a key
role by modifying the kinetics of CO2 /HCO3 ´ hydration reactions at the site of calcification [3,10,16].
The linear part of the curve for STPCA fits within the physiological range of this enzyme as pH at the
site of calcification varies during diurnal cycles [17,18]. For STPCA2, which has been localized in the
cytosol of calcifying cells, the linear part of the curve fits within the physiological pH value which
remains almost constant at a pH of 7.4 during the diurnal cycle [18].
Figure 1. Catalytic efficiency (rate constant kcat/Km) for CO2 hydration of carbonic anhydrase isoforms
as a function of pH for (A) human CA II (hCAII); (B) coral STPCA; and (C) coral STPCA2. Decrease in
catalytic efficiency for the coral CAs due to an increase in acidification between pH 8.36 to 7.93 for
STPCA and between pH 7.38 to 7.19 for STPCA2 is highlighted in grey.
18
Mar. Drugs 2016, 14, 109
2.2. pH Dependency of Coral Carbonic Anhydrases: Effect of Ocean Acidification
Mechanistic studies on the response of corals to ocean acidification rely on physiological [8,17,18]
and transcriptomic data [19–24]. It has been shown that the expression of several proteins changes
under ocean acidification, some of them being upregulated, whereas others are downregulated.
Moya et al. [21] have observed that in coral larvae, the expression of an Acropora millepora
membrane/bound CA orthologous to STPCA is decreased under short-term exposure to moderate
acidification (pH 7.96 and 7.86). Vidal-Dupiol et al. [24] observed that genes coding for CAs
(with significant similarities with proteins that were previously shown to be involved in Stylophora
pistillata calcification) were upregulated at moderate pH values of 7.8 and 7.4, but downregulated at the
extreme level of pH 7.2 for the adult coral P. damicornis during a three-week exposure. Rocker et al. [23]
showed that there was no change in genes coding for CAs for the adult coral A. millepora after
14 days of exposure to a pH of 7.57 (these CAs are not orthologous neither to STPCA nor to STPCA2).
Hoadley et al. [25] have reported that there is no effect on gene expression of extra- and intra-cellular
CAs (respectively, orthologous to STPCA and STPCA2) for two adult corals P. damicornis and
A. millepora after 24 days of exposure to pH 7.90 and 7.83. Such discrepancies in the results have been
attributed to species differences and/or stage-specific responses and/or experimental conditions.
In the present study we focused on the coral Stylophora pistillata for which many physiological and
molecular data related to calcification are available [10]. We measured the expression of genes coding
for two isoforms of carbonic anhydrases, STPCA and STPCA2 (Figure 2) after one-year exposure of
adult colonies to a pH of 7.2. These samples were part of a larger experiment in which we measured
calcification rates and other physiological parameters linked to calcification. We have shown that
calcification decreases under acidification, whereas photosynthesis and symbiont density were not
affected [17]. Our present results clearly show that the effect of OA on the expression of genes
coding for CAs is different when considering STPCA or STPCA2 with 3.85-fold and only 1.64-fold
under-expression, respectively.
The range of physiological values that enzymes face within the coral when external
seawater pH decreases from 8.0 to 7.2 is different for these two enzymes. At the site of
calcification, STPCA, the membrane bound/secreted isoform, faces a decrease of 0.43 pH units
(from 8.36 to 7.93, [17]). Within this range of pH, the activity of STPCA (kcat/Km) decreases of
25% (Figure 1). In the cells, STPCA2 faces a change in pH of only 0.19 (from 7.38 to 7.19, [8]) while its
activity (kcat/Km) decreases of 18% (Figure 1). Thus, under acidification there is, at the same time,
both an under-expression of the two isoforms of CAs and an inhibition of their activity (see schematic
representation Figure 3). The results that we obtained during this experiment show that calcification is
affected (rates of calcification measured by the buoyant weight technique decreased by about 20% at
pH 7.2 compared to pH 8) with more porous skeletons under acidification [17]. We have shown that
the decrease in pH at the site of calcification and inside the cells, together with a decrease in organic
matrix proteins content, can explain such a pattern [17]. The results of the present study clearly show
that CAs are affected by acidification. This enzymatic response could, thus, be another parameter
which explains that calcification is affected under acidification, as suggested in Venn et al. [8].
19
Mar. Drugs 2016, 14, 109
Figure 2. Relative gene expression of STPCA and STPCA2 by qPCR in Stylophora pistillata.
Gene expression is relative to RPL22 expression, as well as RPL40A or RPLP0 (36B4) expression.
Gene expression was measured in control sea water (pH 8.1 light grey) or after one-year exposure to
a pH of 7.2 (dark grey). Errors bars represent standard error of the mean. * One-way ANOVA with
p < 0.05.
Figure 3. Schematic representation of the impact of ocean acidification on STPCA and STPCA2.
Under seawater acidification, the intracellular pH decreases together with the pH at the site of
calcification [8,16]. In the present study we have shown that under these conditions the expression of
the transcripts coding for the intracellular CA isoform, STPCA2, and the membrane-bound/secreted
isoform STPCA, decreases by, respectively, 39% and 74%, and their activity decreases, respectively,
by 18% and 25%. This decrease of both gene expression and enzyme activity will affect the CO2 /HCO3 ´
hydration and can explain that there will be less bicarbonate (and ultimately carbonate) available for
the calcification process (calcification is decreased by 20% under these conditions).
20
Mar. Drugs 2016, 14, 109
2.3. pH and Temperature Dependency of Coral Carbonic Anhydrases
In this study we looked at ocean acidification, one of the side effects of the increase in
atmospheric CO2 . Another one is global warming of the oceans [26]. As for pH, different scenarios of
temperature increase have been proposed (IPCC, 2014) [1], depending on greenhouse gas emissions,
with RCP2.6 being representative of a scenario that aims to keep global warming likely below 2 ˝ C
above pre-industrial temperatures. Since in the future ocean corals will face the combined effect of
temperature increase and pH decrease, we have, thus, looked at the activity of STPCA and STPCA2
when these two stressors are combined. As can be seen on Figure 4, for a given pH, CA activity
(kcat/Km) increases with increasing temperature which is usually observed for enzymes when
they work in their physiological temperature range. However, what is noteworthy is that for a
combined increase in temperature and decrease in pH, there is an opposite effect on CA activity
(kcat/Km) suggesting that the effect of one of these stressors can counterbalance the effect of the other.
For example, the catalytic constant (kcat) of STPCA at the site of calcification is similar at control pH and
control temperature (25 ˝ C and pH 8.36) as at increased acidification and increased temperature (28 ˝ C
and pH 7.93, Table 1) since the decrease in CA activity when pH decreases is counterbalanced by the
increase in CA activity when temperature increases. The same effect is observed for STPCA2 where the
catalytic constant is even slightly higher under acidification, combined with increased temperature than
in control conditions (Table 1). There are only four studies that have looked at the combined effect of
temperature increase and pH decrease on gene expression of CAs. Two carbonic anhydrase transcripts
were down regulated in the coral A. aspera after a 14 day exposure at pH 7.9 and 35.2 ˝ C (compared to
control at pH 8.1 and 31 ˝ C; [22]), two CAs transcripts were upregulated in the coral A. millepora
after a 21 day exposure at pH 7.98 and 30.83 ˝ C compared to control at pH 8.15 and 28.07 ˝ C [23],
six CA transcripts were downregulated in A. millepora after a five week exposure to pH of 7.85 and
7.68, with respective temperatures of 26 ˝ C and 28 ˝ C compared to control conditions at pH 8.02 and
24 ˝ C [20]. Finally, another study, on A. millepora and P. damicornis CAs orthologous to S. pistillata
STPCA and STPCA2, was performed during a 24-day exposure to pH 7.83, 7.9, and 8.07 (control) at
two different temperatures (control 26.5 ˝ C and 31.5˝ ). It was observed that gene expression was only
affected for the intracellular isoform of A. millepora under a temperature increase [25]. The different
trends in gene expression in these four studies can be explained, for example, by a difference in
the experimental protocols (different pH/temperature values, different time of exposure), or by a
difference in the CA isoforms that were measured (however, molecular data on CAs are not available
for all these studies). Regardless of the trend in gene expression, our results show that changes in
CA activity with increasing temperature/decreasing pH can modulate the effect of the stressors on
gene expression. Studies dealing only with the effect of temperature show that CA gene expression
is downregulated when temperature increases [27–30], but in light of our results, we suggest that
this could be, at least in part, counterbalanced by an increase in enzyme activity. However, it is not
possible to determine quantitatively how respectively gene expression and enzymatic activity affect
the physiological function of the enzyme.
Table 1. Catalytic activity (kcat) of coral carbonic anhydrase isoforms at different temperatures and pH.
The values of kcat for a decrease in pH observed at the site of calcification and inside the calcifying
cells (when seawater pH is decreased from control to 7.19) is highlighted in green boxes for STPCA
and in red boxes for STPCA2.
STPCAȱ
STPCA2ȱ
pHȱ
25ȱ°Cȱ
28ȱ°C
25ȱ°C
28ȱ°Cȱ
8.36ȱ
3.943ȱ×ȱ106ȱsƺ1ȱ
4.929ȱ×ȱ106ȱsƺ1ȱ
3.200ȱ×ȱ106ȱsƺ1ȱ
4.309ȱ×ȱ106ȱsƺ1ȱ
7.93ȱ
2.965ȱ×ȱ106ȱsƺ1ȱ
3.766ȱ×ȱ106ȱsƺ1ȱ
2.410ȱ×ȱ106ȱsƺ11ȱ
3.286ȱ×ȱ106ȱsƺ1ȱ
7.38ȱ
1.856ȱ×ȱ106ȱsƺ1ȱ
2.401ȱ×ȱ106ȱsƺ1ȱ
1.494ȱ×ȱ106ȱsƺ1ȱ
2.098ȱ×ȱ106ȱsƺ1ȱ
7.19ȱ
1.530ȱ×ȱ106ȱsƺ1ȱ
1.981ȱ×ȱ106ȱsƺ1ȱ
1.221ȱ×ȱ106ȱsƺ1ȱ
1.737ȱ×ȱ106ȱsƺ1ȱ
21
Mar. Drugs 2016, 14, 109
Figure 4. Catalytic efficiency (rate constant, kcat/Km) for CO2 hydration activity of carbonic anhydrase
isoforms as a function of pH at different temperatures (A) human CA II (hCAII) (B) coral STPCA,
and (C) coral STPCA2. pH variation is measured at 23 ˝ C ( green), 25 ˝ C ( orange), 28 ˝ C ( blue),
and 31 ˝ C ( red).
22
Mar. Drugs 2016, 14, 109
3. Material and Methods
Biological material and treatments—Colonies of the tropical coral Stylophora pistillata were exposed
to one-year seawater acidification as described previously [8,17]. Briefly corals were kept in aquaria
supplied with Mediterranean seawater (exchange rate 70%/h) at a salinity of 38, temperature 25 C
and irradiance of 170 μmol photons m´2 ¨s´1 on a 12 h/12 h photoperiod provided by HQI-10,000K
metal halide lamps (BLV Nepturion, Steinhöring, Germany). Carbonate chemistry was manipulated
by bubbling with CO2 to reduce pH to the target values of pH 7.2. Control treatment was pH 8.1.
Values of carbonate chemistry parameters are those measured in Tambutté et al. [17].
CA activity—An Applied Photophysics stopped-flow instrument has been used for assaying the
CA-catalyzed CO2 hydration activity [14]. Assay was performed on recombinant human and coral
CAs (hCAII, STPCA, STPCA2, [4,31–33]). Phenol red (at a concentration of 0.2 mM) was used as
indicator, working at the maximum absorbance of 557 nm, with 10 mM TRIS at ten different pH
levels (6.0; 6.2; 6.5; 6.8; 7.0; 7.4; 8.2; 8.5; 9.0; 9.6), and 20 mM Na2 SO4 or 20 mM NaCl (for maintaining
constant the ionic strength), following the CA-catalyzed CO2 hydration reaction for a period of 10–100 s.
The CO2 concentrations ranged from 1.7 to 17 mM for the determination of the kinetic parameters
and inhibition constants. For each inhibitor at least six traces of the initial 5%–10% of the reaction
have been used for determining the initial velocity. The uncatalyzed rates were determined in the
same manner and subtracted from the total observed rates. Stock solutions of inhibitor (1 mM) were
prepared in distilled-deionized water with 10%–20% (v/v) DMSO (which is not inhibitory at these
concentrations) and dilutions up to 0.01 nM were done thereafter with distilled-deionized water.
Inhibitor and enzyme solutions were preincubated together for 15 min at room temperature prior to
assay, in order to allow for the formation of the E–I complex. The inhibition constants were obtained
by non-linear least-squares methods using PRISM 3, from Lineweaver-Burk plots, as reported earlier,
and represent the mean from at least three different determinations.
The temperature was controlled by an automatic thermostat, with a precision of ˘0.2 ˝ C.
The solution of substrate and enzyme were thermostated at the required temperatures for 30 min
before assay, and the same temperatures have been applied to the spectrophotometric cell where the
reaction occurred.
Real-Time PCR experiments—Total RNAs extraction and cDNA synthesis were performed
as described previously [34]. Briefly, cDNAs were synthesized using the Superscript® III kit
(Invitrogen, Courtaboeuf, France). The experiment was repeated three times on clonal individuals.
For each biological replicate, real-time PCR was then performed in technical triplicate with
cDNAs diluted at a final concentration of 2 ng/μL and using the Express SYBR® greenER™
SuperMix with premixed ROX (Invitrogen, Courtaboeuf, France) in ABI 7300 Real-Time PCR
System (Applied Biosystems, Courtaboeuf, France). Primers used (STPCA, STPCA2,) are from [35]
and control gene 36B4 from [34]. We used two other control genes, ribosomal protein L22 (L22
Forward: 51 -TGATGTGTCCATTGATCGTC-31 and L22 Reverse 51 -CATAGGTAGCTTGTGCAGATG-31 )
and L40A genes (L40A Forward: 51 -CGACTGAGG GGAGGAGCCAA-31 and L40A Reverse
51 -CTCATTTGGACACTCCCTT-31 ). Relative expressions were calculated using Biogazelle qbase + 2.6™
(Gent, Belgium). Results are presented as mean ˘ SEM. Data were checked for normality using a
Kolmogorov–Smirnov test with Lilliefors correction and log-transformed, if required. One-way ANOVA
was used to test the effect of pH on STPCA and STPCA2. Differences were considered significant for
p-values < 0.05. Statistics were performed using Statistica 10 (Statsoft, Tulsa, OK, USA).
4. Conclusions
Our results on the response of carbonic anhydrases to ocean acidification in the coral
Stylophora pistillata show that these enzymes are affected by ocean acidification via an effect on
both gene expression and enzyme activity. Our results also clearly show that temperature increase
affects CA activity and we suggest that this could counterbalance the effect of acidification. Finally, we
point out that caution must, thus, be taken when interpreting transcriptomic data on CAs in ocean
23
Mar. Drugs 2016, 14, 109
acidification and temperature stress experiments as the effect of these stressors on the physiological
function of CAs will depend both on gene expression and enzyme activity.
Acknowledgments: We thank Dominique Desgré for assistance with coral culture, Natacha Segonds and
Nathalie Techer for assistance with maintenance of OA experiments. We thank Alexander Venn and Philippe Ganot
for fruitful discussions. We thank two anonymous reviewers for their constructive comments. This work was
funded by the Government of the Principality of Monaco.
Author Contributions: C.T.S., S.T. and D.Z. conceived and designed the experiments; A.B., A.I., E.T. and D.Z.
performed the experiments; A.B., C.T.S., S.T. and D.Z. analyzed the data; A.B., C.T.S., S.T. and D.Z. wrote the paper.
Conflicts of Interest: The authors declare no conflict of interest.
Abbreviations
CA
STPCA
STPCA2
OA
Carbonic Anhydrase
Stylophora pistillata carbonic anhydrase (ACA53457)
Stylophora pistillata carbonic anhydrase (ACE95141)
Ocean Acidification
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
IPCC, 2014: Climate Change 2014: Synthesis Report. Contribution of Working Groups i, ii and iii to the Fifth
Assessment Report of the Intergovernmental Panel on Climate Change; Intergovernmental Panel on Climate
Change (IPCC): Geneva, Switzerland, 2014; p. 151.
Chan, N.C.S.; Connolly, S.R. Sensitivity of coral calcification to ocean acidification: A meta-analysis.
Glob. Chang. Biol. 2013, 19, 282–290. [CrossRef] [PubMed]
Bertucci, A.; Moya, A.; Tambutté, S.; Allemand, D.; Supuran, C.T.; Zoccola, D. Carbonic anhydrases in
anthozoan corals—A review. Bioorg. Med. Chem. 2013, 21, 1437–1450. [CrossRef] [PubMed]
Moya, A.; Tambutté, S.; Bertucci, A.; Tambutté, E.; Lotto, S.; Vullo, D.; Supuran, C.T.; Allemand, D.; Zoccola, D.
Carbonic anhydrase in the scleractinian coral Stylophora pistillata: Characterization, localization, and role in
biomineralization. J. Biol. Chem. 2008, 283, 25475–25484. [CrossRef] [PubMed]
Zoccola, D.; Ganot, P.; Bertucci, A.; Caminiti-Segonds, N.; Techer, N.; Voolstra, C.R.; Aranda, M.; Tambutté, E.;
Allemand, D.; Casey, J.R.; et al. Bicarbonate transporters in corals point towards a key step in the evolution
of cnidarian calcification. Sci. Rep. 2015, 5, 9983. [CrossRef] [PubMed]
Zoccola, D.; Tambutté, É.; Kulhanek, E.; Puverel, S.; Scimeca, J.-C.; Allemand, D.; Tambutté, S.
Molecular cloning and localization of a PMCA P-type calcium ATPase from the coral Stylophora pistillata.
Biochim. Biophys. Acta 2004, 1663, 117–126. [CrossRef] [PubMed]
Zoccola, D.; Tambutté, É.; Sénegas-Balas, F.; Michiels, J.-F.; Failla, J.-P.; Jaubert, J.; Allemand, D. Cloning
of a calcium channel A1 subunit from the reef-building coral, Stylophora pistillata. Gene 1999, 227, 157–167.
[CrossRef]
Venn, A.A.; Tambutté, E.; Holcomb, M.; Laurent, J.; Allemand, D.; Tambutté, S. Impact of seawater
acidification on pH at the tissue-skeleton interface and calcification in reef corals. PNAS 2013, 110, 1634–1639.
[CrossRef] [PubMed]
Allemand, D.; Tambutté, É.; Zoccola, D.; Tambutté, S. Coral calcification, cells to reefs. In Coral Reefs:
An Ecosystem in Transition; Dubinsky, Z., Stambler, N., Eds.; Springer: Dordrecht, The Netherlands, 2011;
Volume 3, pp. 119–150.
Tambutté, S.; Holcomb, M.; Ferrier-Pagès, C.; Reynaud, S.; Tambutté, E.; Zoccola, D.; Allemand, D. Coral
biomineralization: From the gene to the environment. J. Exp. Mar. Biol. Ecol. 2011, 408, 58–78. [CrossRef]
Drake, J.L.; Mass, T.; Haramaty, L.; Zelzion, E.; Bhattacharya, D.; Falkowski, P.G. Proteomic analysis of
skeletal organic matrix from the stony coral Stylophora pistillata. Proc. Natl. Acad. Sci. USA 2013, 110,
3788–3793. [CrossRef] [PubMed]
Mass, T.; Drake, J.L.; Peters, E.C.; Jiang, W.; Falkowski, P.G. Immunolocalization of skeletal matrix proteins
in tissue and mineral of the coral Stylophora pistillata. Proc. Natl. Acad. Sci. USA 2014, 111, 12728–12733.
[CrossRef] [PubMed]
24
Mar. Drugs 2016, 14, 109
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
Ramos-Silva, P.; Kaandorp, J.; Herbst, F.; Plasseraud, L.; Alcaraz, G.; Stern, C.; Corneillat, M.; Guichard, N.;
Durlet, C.; Luquet, G.; et al. The skeleton of the staghorn coral Acropora millepora: Molecular and structural
characterization. PLoS ONE 2014, 9, e97454.
Khalifah, R.G.; Edsall, J.T. Carbon dioxide hydration activity of carbonic anhydrase: Kinetics of alkylated
anhydrases B and C from humans (metalloenzymes-isoenzymes-active sites-mechanism). Proc. Natl. Acad.
Sci. USA 1972, 69, 172–176. [CrossRef] [PubMed]
Lindskog, S.; Coleman, J.E. The catalytic mechanism of carbonic anhydrase. Proc. Natl. Acad. Sci. USA 1973,
70, 2505–2508. [CrossRef] [PubMed]
Allemand, D.; Ferrier-Pages, C.; Furla, P.; Houlbreque, F.; Puverel, S.; Reynaud, S.; Tambutté, E.; Tambutté, S.;
Zoccola, D. Biomineralisation in reef-building corals: From molecular mechanisms to environmental control.
C. R. Palevol 2004, 3, 453–467. [CrossRef]
Tambutté, E.; Venn, A.A.; Holcomb, M.; Segonds, N.; Techer, N.; Zoccola, D.; Allemand, D.; Tambutté, S.
Morphological plasticity of the coral skeleton under CO2 -driven seawater acidification. Nat. Commun. 2015,
6, 7368. [CrossRef] [PubMed]
Venn, A.A.; Tambutté, E.; Holcomb, M.; Allemand, D.; Tambutté, S. Live tissue imaging shows reef corals
elevate pH under their calcifying tissue relative to seawater. PLoS ONE 2011, 6, e20013. [CrossRef] [PubMed]
Kaniewska, P.; Campbell, P.R.; Kline, D.I.; Rodriguez-Lanetty, M.; Miller, D.J.; Dove, S.; Hoegh-Guldberg, O.
Major cellular and physiological impacts of ocean acidification on a reef building coral. PLoS ONE 2012, 7,
e34659. [CrossRef] [PubMed]
Kaniewska, P.; Chan, C.K.; Kline, D.; Ling, E.Y.; Rosic, N.; Edwards, D.; Hoegh-Guldberg, O.; Dove, S.
Transcriptomic changes in coral holobionts provide insights into physiological challenges of future climate
and ocean change. PLoS ONE 2015, 10, e0139223. [CrossRef] [PubMed]
Moya, A.; Huisman, L.; Ball, E.E.; Hayward, D.C.; Grasso, L.C.; Chua, C.M.; Woo, H.N.; Gattuso, J.P.;
ForêT, S.; Miller, D.J. Whole transcriptome analysis of the coral Acropora millepora reveals complex responses
to CO2 -driven acidification during the initiation of calcification. Mol. Ecol. 2012, 21, 2440–2454. [CrossRef]
[PubMed]
Ogawa, D.; Bobeszko, T.; Ainsworth, T.; Leggat, W. The combined effects of temperature and CO2 lead to
altered gene expression in Acropora aspera. Coral Reefs 2013, 32, 895–907. [CrossRef]
Rocker, M.M.; Noonan, S.; Humphrey, C.; Moya, A.; Willis, B.L.; Bay, L.K. Expression of calcification
and metabolism-related genes in response to elevated pCO2 and temperature in the reef-building coral
Acropora millepora. Mar. Genom. 2015, 24, 313–318. [CrossRef] [PubMed]
Vidal-Dupiol, J.; Zoccola, D.; Tambutté, E.; Grunau, C.; Cosseau, C.; Smith, K.M.; Freitag, M.; Dheilly, N.M.;
Allemand, D.; Tambutté, S. Genes related to ion-transport and energy production are upregulated in response
to CO2 -driven pH decrease in corals: New insights from transcriptome analysis. PLoS ONE 2013, 8, e58652.
Hoadley, K.D.; Pettay, D.T.; Grottoli, A.G.; Cai, W.J.; Melman, T.F.; Schoepf, V.; Hu, X.; Li, Q.; Xu, H.; Wang, Y.;
et al. Physiological response to elevated temperature and pCO2 varies across four pacific coral species:
Understanding the unique host + symbiont response. Sci. Rep. 2015, 5, 18371. [CrossRef] [PubMed]
Hoegh-Guldberg, O.; Mumby, P.-J.; Hooten, A.J.; Steneck, R.S.; Greenfield, P.; Gomez, E.; Harvell, C.D.;
Sale, P.F.; Edwards, A.J.; Caldeira, K.; et al. Coral reefs under rapid climate change and ocean acidification.
Science 2007, 318, 1737–1742. [CrossRef] [PubMed]
Barshis, D.J.; Ladner, J.T.; Oliver, T.A.; Seneca, F.O.; Traylor-Knowles, N.; Palumbi, S.R. Genomic basis for
coral resilience to climate change. Proc. Natl. Acad. Sci. USA 2013, 110, 1387–1392. [CrossRef] [PubMed]
Edge, S.E.; Morgan, M.B.; Gleason, D.F.; Snell, T.W. Development of a coral cDNA array to examine gene
expression profiles in Montastraea faveolata exposed to environmental stress. Mar. Pollut. Bull. 2005, 51,
507–523. [CrossRef] [PubMed]
Kenkel, C.D.; Meyer, E.; Matz, M.V. Gene expression under chronic heat stress in populations of the mustard
hill coral (Porites astreoides) from different thermal environments. Mol. Ecol. 2013, 22, 4322–4334. [CrossRef]
[PubMed]
Maor-Landaw, K.; Karako-Lampert, S.; Waldman Ben-Asher, H.; Goffredo, S.; Falini, G.; Dubinsky, Z.;
Levy, O. Gene expression profiles during short-term heat stress in the red sea coral Stylophora pistillata.
Glob. Chang. Biol. 2014, 20, 3026–3035. [CrossRef] [PubMed]
25
Mar. Drugs 2016, 14, 109
31.
32.
33.
34.
35.
Bertucci, A.; Innocenti, A.; Scozzafava, A.; Tambutté, S.; Zoccola, D.; Supuran, C.T. Carbonic anhydrase
inhibitors. Inhibition studies with anions and sulfonamides of a new cytosolic enzyme from the scleractinian
coral Stylophora pistillata. Bioorg. Med. Chem. Lett. 2011, 21, 710–714. [PubMed]
Bertucci, A.; Innocenti, A.; Zoccola, D.; Scozzafava, A.; Allemand, D.; Tambutté, S.; Supuran, C.T. Carbonic
anhydrase inhibitors: Inhibition studies of a coral secretory isoform with inorganic anions. Bioorg. Med.
Chem. Lett. 2009, 19, 650–653. [CrossRef] [PubMed]
Bertucci, A.; Innocenti, A.; Zoccola, D.; Scozzafava, A.; Tambutté, S.; Supuran, C.T. Carbonic anhydrase
inhibitors. Inhibition studies of a coral secretory isoform by sulfonamides. Bioorg. Med. Chem. 2009, 17,
5054–5058. [PubMed]
Moya, A.; Tambutté, S.; Beranger, G.; Gaume, B.; Scimeca, J.C.; Allemand, D.; Zoccola, D. Cloning and use
of a coral 36B4 gene to study the differential expression of coral genes between light and dark conditions.
Mar. Biotechnol. (N.Y.) 2008, 10, 653–663. [CrossRef] [PubMed]
Bertucci, A.; Tambutté, S.; Supuran, C.T.; Allemand, D.; Zoccola, D. A new coral carbonic anhydrase in
Stylophora pistillata. Mar. Biotechnol. (N.Y.) 2011, 13, 992–1002. [CrossRef] [PubMed]
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
26
marine drugs
Article
Recombinant Expression of a Modified
Shrimp Anti-Lipopolysaccharide Factor Gene in
Pichia pastoris GS115 and Its Characteristic Analysis
Hui Yang 1,2 , Shihao Li 1,3 , Fuhua Li 1,3, *, Kuijie Yu 1 , Fusheng Yang 4 and Jianhai Xiang 1
1
2
3
4
*
Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences,
Qingdao 266071, China; victor1900@163.com (H.Y.); lishihao@qdio.ac.cn (S.L.); shihao235@163.com (K.Y.);
jhxiang@qdio.ac.cn (J.X.)
University of Chinese Academy of Sciences, Beijing 100049, China
Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for
Marine Science and Technology, Qingdao 266071, China
Hangzhou Xiaoshan Donghai Aquaculture Company Limited, Hangzhou 311200, China;
xiaoshanji2005@163.com
Correspondence: fhli@qdio.ac.cn; Tel.: +86-532-8289-8836; Fax: +86-532-8289-8578
Academic Editor: Se-Kwon Kim
Received: 28 April 2016; Accepted: 25 July 2016; Published: 9 August 2016
Abstract: Anti-lipopolysaccharide factors (ALFs) with a LPS-binding domain (LBD) are considered
to have broad spectrum antimicrobial activities and certain antiviral properties in crustaceans.
FcALF2 was one isoform of ALFs isolated from the Chinese shrimp Fenneropenaeus chinensis.
Our previous study showed that a modified LBD domain (named LBDv) of FcALF2 exhibited
a highly enhanced antimicrobial activity. In the present study, a modified FcALF2 gene (mFcALF2),
in which the LBD was substituted by LBDv, was designed and synthesized. This gene was
successfully expressed in yeast Pichia pastoris GS115 eukaryotic expression system, and the
characteristics of the recombinant protein mFcALF2 were analyzed. mFcALF2 exhibited apparent
antibacterial activities against Gram-negative bacteria, including Escherichia coli, Vibrio alginolyticus,
Vibrio harveyi, and Vibrio parahaemolyticus, and Gram-positive bacteria, including Bacillus licheniformis
and Staphylococcus epidermidis. In addition, mFcALF2 could reduce the propagation of white spot
syndrome virus (WSSV) in vivo by pre-incubation with virus. The present study paves the way for
developing antimicrobial drugs in aquaculture.
Keywords: anti-lipopolysaccharide factors; recombinant protein; antibacterial activity; antiviral activity
1. Introduction
Antimicrobial peptides (AMPs), isolated from a variety of different living organisms,
have received more and more attention for their contribution to host defense [1,2]. They are considered
to be an essential part of the innate immune system since they possess a broad spectrum of antimicrobial
activities against bacteria, fungi, some virus, and provide protection against microbial invasion [3,4].
Extensive researches have demonstrated that these AMPs could act not only as direct antimicrobial
agents, but also as important regulators of the innate immune system [5–7]. AMPs exhibit microbicidal
activity mostly by targeting the membrane of microorganisms to destroy their cell membrane [8–10].
AMPs could also eliminate bacteria by stimulating the non-inflammatory host immune responses,
and inhibiting the cellular process, such as DNA replication, protein biosynthesis and folding or
impairment of protein functions [11]. Therefore, AMPs are regarded as potential alternatives to
conventional antibiotics since AMPs could hardly lead to bacterial resistance.
Mar. Drugs 2016, 14, 152
27
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2016, 14, 152
Anti-lipopolysaccharide factors (ALFs) isolated from crustaceans are regarded as important
components of the innate immune system [12]. Multiple isoforms of ALFs exhibited different
antimicrobial activities against Gram-positive or Gram-negative bacteria, and antiviral activity [13–15].
The LPS-binding domain (LBD) of ALFs was regarded as the functional domain for their antibacterial
and antiviral activities [16,17]. The synthetic LBD peptides exhibited antibacterial and antiviral activity
with high-efficiency [18,19]. Hence, ALFs could be a potential option to replace the conventional
antibiotics in aquaculture.
In our previous studies, seven isoforms of ALF were identified from the Chinese shrimp
Fenneropenaeus chinensis [20,21]. The transcriptional level of one isoform of ALF named FcALF2
showed about 35-fold up-regulation when shrimp was at the acute infection stage of white spot
syndrome virus (WSSV) compared with that at the latent infection stage [20]. The expression of
FcALF2 was significantly up-regulated when the shrimp was injected with Micrococcus lysodeikticus or
Vibrio anguillarum, and the synthesized peptide of LBD from FcALF2 possessed strong antibacterial
activity and significant inhibition activity against WSSV [22]. Nowadays, more and more researches
have focused on the rational design of AMPs [23–25]. In our previous study, we modified the LBD of
FcALF2 by using lysine to substitute some non-ionized polar amino acids. The modified LBD peptide
(LBDv) exhibited stronger antibacterial activities and broader antimicrobial spectrum than the original
LBD peptide [22,26]. Since the cost for chemical synthesis of peptides is too expensive to be used
in aquaculture, recombinant expressions should be a more practical way to obtain the proteins with
bioactivity at large scale.
Yeast Pichia pastoris expression system has become a highly successful system for the large
expression of heterologous genes [27]. In the present study, we synthesized the nucleotide sequence of
a modified FcALF2 (mFcALF2) gene, in which the original LBD sequence of FcALF2 was substituted
by LBDv, and expressed mFcALF2 in the yeast P. pastoris GS115 expression system successfully.
The recombinant mFcALF2 protein showed certain antimicrobial and antiviral activities. These data
showed that a modified gene of AMPs could be expressed in P. pastoris, which will pave the way for
developing antimicrobial drugs in aquaculture.
2. Results
2.1. Expression, Purification and Detection of mFcALF2 Protein
We designed the amino acid sequence of mFcALF2 (shown in Figure 1) in which the original LBD
of FcALF2 was replaced by LBDv. Then we reversely translated the amino acid sequence into nucleotide
sequence, and optimized the codon usage according to the codon bias for the yeast, and synthesized
the nucleotide sequences of mFcALF2.
The protein expression vector pPIC9K containing a signal peptide of α-Factor with 85 amino
acids was utilized in the present study (Figure 1A). The mFcALF2 gene was comprised of 342 bp,
with the restriction enzyme sites EcoRI (GAATTC) and Not I (GCGGCCGC) at the opposite ends of
the sequence respectively. The mFcALF2 protein contained a 6ˆ His-tag (112–117 aa) (Figure 1B).
The deduced molecular mass of mFcALF2 was 13.79 kDa and its theoretical isoelectric point was 8.61.
Multiple sequences alignment (Figure 1C) among mFcALF2, FcALF2 and LBDv revealed that only the
LBD of FcALF2 was replaced, and the mFcALF2 gene was successfully synthesized.
The recombinant plasmid was constructed using the EcoRI and Not I restriction enzyme.
The recombinant plasmid was linearized and transformed into P. pastoris GS115 competent cell by
electroporation. After transformation, the transformants were grown on MD plates. Some colonies
were selected randomly and identified by PCR reaction with 5’AOX1 and 3’AOX1. Four positive
colonies were picked and cultured for small-scale expression trials. Then we selected a positive
transformant for large-scale production. The culture supernatant was analyzed by 15% SDS-PAGE
and one major protein band with the molecular weight of about 15 kDa was detected (Figure 2).
After Ni2+ -chelating chromatography purification, the recombinant mFcALF2 protein was detected
28
Mar. Drugs 2016, 14, 152
by HRP-conjugated anti His-Tag mouse monoclonal antibody, which showed that the recombinant
protein was the target protein (Figure 2). Using the constructed recombination system, about 1.2 mg
recombinant mFcALF2 protein could be obtained from 1000 mL crude extract. The molecular mass of
purified mFcALF2 protein was determined using matrix-assisted laser desorption ionization mode
(MALDI/TOF) mass spectrometry, and the molecular weight of the purified mFcALF2 protein was
about 13781.8320 Da (Figure 3). All these data indicated that the purified recombinant protein was
mFcALF2 protein.
ȱ
Figure 1. The nucleotide sequence and its deduced amino acid sequence of the modified
anti-lipopolysaccharide factor isoform 2 from Fenneropenaeus chinensis (FcALF2) gene (mFcALF2).
(A) Schematic representation of the vector pPIC9K-mFcALF2; (B) The LBD region of mFcALF2 is shown
in bold and the stop codon is indicated by an asterisk. The restriction enzyme sites are underlined.
The 6ˆ His-tag is shown in box; (C) Multiple sequence alignment among mFcALF2, FcALF2 and LBDv.
29
Mar. Drugs 2016, 14, 152
Figure 2. Detection of the recombinant mFcALF2 protein. (A) SDS-PAGE analyses of the recombinant
mFcALF2 protein. Lane M in A and B represent molecular mass standards. Lane 1 shows the
concentrated protein in supernatant secreted in GS115. Lane 2 shows the purified mFcALF2 protein;
(B) Western blot analysis of the recombinant protein by anti-His tag antibody.
Figure 3. Molecular weight analysis of the recombinant mFcALF2 protein by MALDI/TOF
(matrix-assisted laser desorption ionization mode) mass spectrometry.
2.2. Binding Assay of mFcALF2 to Bacteria
To detect the characteristic of recombinant mFcALF2 protein, we tested its binding activities to
different Gram-negative and Gram-positive bacteria according to the method described previously [28].
The detected bacteria included Escherichia coli, Vibrio alginolyticus, Bacillus licheniformis and
Staphylococcus epidermidis. The data revealed that the recombinant mFcALF2 protein could bind to the
tested bacteria including E. coli, V. alginolyticus, B. licheniformis and S. epidermidis (Figure 4).
30
Mar. Drugs 2016, 14, 152
ȱ
Figure 4. Binding activity analysis of recombinant mFcALF2 to bacteria. Star (*) indicates significant
differences (p < 0.05) between the treated and untreated groups of different bacteria. The data are
analyzed based on ANOVA with post hoc.
2.3. Observation on the Morphology of Bacterial Cells after Incubation with mFcALF2
The morphology of different bacteria including E. coli, V. alginolyticus and S. epidermidis after
incubation with mFcALF2 were observed under scanning electron microscopy (SEM). The bacteria
without any treatment displayed a smooth surface, with no apparent cellular debris. After incubation
with mFcALF2 for 1 h, E. coli and V. alginolyticus exhibited remarkable changes on their surface,
and S. epidermidis showed some leakage of the cytoplasm on their surface (Figure 5).
Figure 5. Morphology of bacteria after treatments by recombinant mFcALF2. The 108 cfu/mL different
bacteria are incubated with 32 μM LBDv peptide for 2 h. The bacteria treated with same concentration
pGFP peptide are used as negative control. Bar scale is 1 μM.
31
Mar. Drugs 2016, 14, 152
2.4. The Antibacterial Activity of Recombinant mFcALF2 Protein
The minimal growth inhibition concentration (MIC) assay and inhibition zone test were used
to measure the antimicrobial activity of the purified mFcALF2 protein. The MICs to V. alginolyticus,
Vibrio harveyi, Vibrio parahaemolyticus, B. licheniformis and S. epidermidis were 8–16 μM, while that to
E. coli was 4–8 μM (Table 1). Obvious inhibition zone of recombinant mFcALF2 to E. coli, V. alginolyticus,
B. licheniformis and S. epidermidis was detected (Figure 6).
ȱ
Figure 6. Inhibition zones of recombinant mFcALF2 to different bacteria: (A) E. coli; (B) V. anguillarum;
(C) B. licheniformis; and (D) S. epidermidis. “Blank” represents blank group with nothing added.
“PBS” represents control group with only PBS. “pGFP” represents negative control with synthetic pGFP
peptide. “LBDv” represents positive control with synthetic LBDv peptide. mFcALF2 represents the
recombinant protein. Twenty microliters of 32 μM protein/peptide solution is added to the center of
filter paper.
Table 1. Minimal inhibitory concentration (MIC) of mFcALF2 to different bacteria.
mFcALF2 MIC a (µM)
Microorganisms
Gram negative bacteria:
8–16
4–8
8–16
8–16
Vibrio alginolyticus
Escherichia coli
Vibrio harveyi
Vibrio parahaemolyticus
Gram positive bacteria:
8–16
8–16
Bacillus licheniformis
Staphylococcus epidermidis
a
MIC, minimal inhibitory concentration.
2.5. The Hemolytic Activities of mFcALF2
The hemolytic activity of mFcALF2 was checked on sheep blood agar plates. No obvious hemolytic
activity was observed for mFcALF2 (Figure 7).
32
Mar. Drugs 2016, 14, 152
Figure 7. Hemolytic phenotypes of mFcALF2 on sheep blood agar. The same amount of PBS buffer
(pH 7.4) and 0.2% Triton X-100 were used as negative and positive controls, respectively. The 60 μL
purified mFcALF2 protein (32 μM) was added into the Oxford cup.
2.6. Inhibition of WSSV Replication by mFcALF2 in Litopenaeus vannamei
Litopenaeus vannamei were used as the experimental animals for WSSV infection. The antiviral
activity of recombinant mFcALF2 protein was detected according to the method described
previously [18,22,29]. Four groups including “Blank”, “PBS + WSSV”, “pGFP + WSSV”,
and “mFcALF2 + WSSV” were set. The WSSV copy numbers in the pleopods of shrimp from different
groups at 24 h and 36 h after injection were shown in Figure 8. The WSSV copies per ng pleopods
DNA in “mFcALF2 + WSSV” group was markedly lower than those in group “PBS+WSSV” and
“pGFP + WSSV” at 24 h and 36 h after WSSV injection.
ȱ
Figure 8. Detection of viral loads in L. vannamei after injection of WSSV incubated with recombinant
mFcALF2. Data represent the means ˘ S.E. Lowercase letters (a, b, c, d and e) represent significant
difference among treatments at p < 0.05. Three replicate experiments are performed. The data were
analyzed based on ANOVA with post hoc.
33
Mar. Drugs 2016, 14, 152
3. Discussion
Currently, more than 1000 AMPs have been isolated or predicted by computational programs and
divided into different subgroups [9,11,30]. Although some synthetic AMPs show certain activities,
the high cost of synthetic peptides have driven the exploration of mass production by microbial
expression systems, including prokaryotic and eukaryotic expression, through biotechnological
approach [31]. The development of different heterologous expression systems exhibits many
advantages, and one advantage is the mass production at low cost [32]. The prokaryotic expression
system, such as E. coli system, is not usually used for the production of AMPs, especially for those
with high inhibition activity to bacteria [28,33]. For yeast P. pastoris expression system, the recombinant
proteins without toxicity to yeast can be effectively expressed and secreted into the medium under the
direction of a signal peptide that is fused to the exogenous protein at the N-terminus [34]. With the
development of synthetic biology approach, it has become reality to produce the recombinant proteins
of the synthetic genes with high biological activity [35]. In the present study, the protein expression
vector pPIC9K contained a strong and inducible promoter, and the α-Factor signal peptide for
processing the fusion proteins was used to drive the expression of the synthetic gene encoding
the mFcALF2 protein in P. pastoris GS115.
The recombinant mFcALF2 protein exhibited apparent antimicrobial activity to the detected
Gram-positive and Gram-negative bacteria by binding to the bacteria. Strongly cationic peptides can
potentially bind to negatively charged lipids on the outer leaflets of the bacterial membranes [36].
The cationic AMPs could bind to lipopolysaccharides (LPS) of Gram-negative bacteria and lipoteichoic
acids (LTA) of Gram-positive bacteria [36,37]. Thus, we speculated the mFcALF2 protein with a
highly cationic region could bind to both Gram-positive and Gram-positive bacteria, mostly the
same as other cationic AMPs. Though some ALF isoforms have high affinities to LPS or LTA [38],
whether the binding mechanisms are the same as cationic AMPs needs further investigation. In the
present study, mFcALF2 has been proven to destroy the bacterial cell membrane, and lead to the
leakage of the cytoplasm from bacteria. This is very similar to that of the reported ALF isoforms
without any modification [39] and other AMPs [40]. Different from the traditional antibiotics, which
have specific molecular targets, mFcALF2 might function by binding to the cell membrane of the
bacteria through physical process, which is similar to that for other AMPs [41]. mFcALF2 showed
some typical characteristic of AMPs. In our previous study, we found that 80% of Sf9 cells and Cherax
quadricarinatus hemocytes could survive from the treatment with up to 16 μM synthetic peptide of
LBDv [26]. Because the highly cationic region of mFcALF2 is responsible for cytotoxicity, it is reasonable
to speculate the recombinant mFcALF2 protein would show little cytotoxicity at a concentration below
16 μM. Absence of hemolytic activity of mFcALF2 protein indicated that mFcALF2 might have a
potential application in aquaculture in the future.
The purified mFcALF2 protein exhibited inhibition activity to both Gram-positive and Gram-negative
bacteria, but the specific antibacterial activities to different bacteria were different. Compared with
the recombinant protein FcALF5 from Fenneropenaeus chinensis and the recombinant protein of ALF4
from Portunus trituberculatus which were expressed in E. coli system [42,43], mFcALF2 showed a
higher inhibition activity against E. coli. Although the recombinant protein of an ALF isoform from
Macrobrachium rosenbergii expressed in the Saccharomyces cerevisiae showed an inhibition activity to E. coli
and other bacteria, the MIC value was higher than that of mFcALF2 [28]. Therefore, we suggested that
the GS115/pPIC9K-mFcALF2 vector and the P. pastoris expression system are suitable for a large-scale
production of mFcALF2 with high activity.
WSSV was the most dangerous virus to shrimp aquaculture throughout the world [44].
Different ALFs isoforms exhibited certain inhibition activity against WSSV [19,45]. In our previous
studies, the designed LBD analogous peptide showed strong antiviral activity when incubating with
WSSV [18,22]. In the present study, the recombinant mFcALF2 protein also showed high inhibition
activity to WSSV. This may provide a new strategy for the control of WSSV disease in aquaculture.
34
Mar. Drugs 2016, 14, 152
4. Materials and Methods
4.1. Synthesis of the Modified Sequence of FcLAF2 (mFcALF2)
We designed the mFcALF2 gene in which the nucleotide sequence encoding the original LBD of
FcALF2 was replaced by the nucleotide sequence encoding LBDv. During designing the new gene,
the codon adaptation index (CAI) was used to measure the codon bias patterns by comparing those
codons used in the translated sequence with the patterns of codon usage of yeast, using the Rare
Codon Analysis Tool (http://www.genscript.com/cgi-bin/tools/rare_codon_analysis). A 6ˆ His-tag
and two restriction enzyme sites (EcoR I and Not I) were added. Then the optimized modified gene
sequence named mFcALF2 was synthesized by Sangon Biotech Company (Shanghai, China).
4.2. Construction of the Expression Plasmid, Transformation and Selection of Recombinant Clones
The mFcALF2 gene was cloned into pUC57 vector. Then the plasmid was digested with
the restriction enzymes and cloned into EcoR I/Not I sites of the P. pastoris expression vector
pPIC9K (Invitrogen, Waltham, MA, USA), downstream of the α-factor secretion sequence and the
Glu-Ala-Glu-Ala repeat sequence. The recombinant plasmid was transferred into Escherichia coli
DH5α for its massive production. The sequence of the recombinant plasmid was confirmed by
nucleotide sequencing.
P. pastoris GS115 was grown at 30 ˝ C overnight, 280 rpm in YPD medium (1% yeast extract,
2% tryptone, 2% glucose). Then the yeast cells were harvested, washed twice with ice-cold sterile water
and resuspended in 1 M sorbitol. The purified pPIC9K-mFcALF2 was linearized by Sac I and 10 μg of
plasmid was transformed into P. pastoris competent cell by electroporation following the manufacturer’s
instructions (Gene PulserXcell, Bio-Rad, Hercules, CA, USA). One milliliter of 1 M sorbitol precooled
on ice was added into the cuvette immediately. The cells were then spread on MD plates containing
0.5 mg/mL G418 (1.34% YNB, 4 ˆ 10´5 % biotin, 2% dextrose, and 2% agar). The plates were incubated
at 30 ˝ C and checked daily until positive colonies were observed. The positive colonies were identified
by PCR reaction with the specific primer 5’AOX1 (5’-GACTGGTTCCAATTGACAAGC-3’) and 3’AOX1
(5’-GCAAATGGCATTCTGACATCC-3’).
4.3. Production and Purification of the Recombinant Protein
Single clone were grown overnight in 9 mL YPD medium at 30 ˝ C for 24 h and then used to
inoculate 35 mL of BMGY medium including 1% yeast extract, 2% tryptone, 100 mM potassium
phosphate (pH 6.0), 1.34% YNB (yeast nitrogen base with ammonium sulfate without amino acid),
4 ˆ 10´5 biotin, and 1% glycerol, for 48 h. Then the cells were harvested by centrifugation at 10,000 rpm
for 5 min at room temperature and resuspended in 35 mL BMMY medium including 1% yeast extract,
2% tryptone, 100 mM potassium phosphate (pH 6.0), 1.34% YNB, 4 ˆ 10´5 biotin, and 0.5% methanol
with a concentration of 1.2 ˆ 109 cfu/mL. To induce the expression of mFcALF2, 100% methanol
was added every 24 h to a final concentration of 0.5%. After 72 h, the supernatant was collected and
analyzed by Dot Blot using the mouse anti-His tag monoclonal antibody to detect the expression
of mFcALF2. The clone that expressed the highest amount of recombinant protein was selected for
further large-scale production.
The culture medium system was amplified to 1 L, and the condition of the culture was the same
as above. After cultured for 72 h, the entire medium was harvested by centrifugation at 10,000 rpm
for 5 min and the supernatant was concentrated by PEG20,000. Then the concentrated product
was purified by affinity chromatography using Ni-IDA-Sepharose CL-6B column (GE Healthcare,
Uppsala, Sweden). The samples were loaded slowly at the rate of 0.5 mL/min and then the column
was washed with washing buffer (20 mM Tris-HCl, 20 mM imidazole, 0.15 M NaCl) at the rate of
1.0 mL/min until the absorbance at 280 nm reached 0. Then the column was eluted with an elution
buffer (20 mM Tris-HCl, 250 mM imidazole, 0.15 M NaCl). The purified protein was dialyzed in PBS
(137 mmol/L NaCl, 2.7 mmol/L KCl, 10 mmol/L Na2 HPO4 , 1.8 mmol/L KH2 PO4 , pH 7.4) for 12 h.
35
Mar. Drugs 2016, 14, 152
Concentration of the mFcALF2 protein was tested by the Bradford method using Bradford Assay kit
(TianGen, Beijing, China).
4.4. Western Blot Detection and Mass Spectrometry Analysis
The purified protein mFcALF2 was separated by 15% sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) and visualized with Coomassie brilliant blue R250. Western-blot analysis
was also used to detect the expression of mFcALF2 protein. After SDS-PAGE, mFcALF2 protein
was transferred onto polyvinylidenefluoride (PVDF) membrane (Millipore, Temecula, CA, USA) and
blocked with 5% nonfat milk in Tris-buffered saline (TBS) (10 mM Tris-HCl, 150 mM NaCl, pH 7.4) with
0.05% Tween-20 for 2 h at room temperature. Then it was incubated with HRP-conjugated anti His-Tag
mouse monoclonal antibody overnight (1/1000 diluted in TBS). After the membrane was washed with
TBST (TBS buffer with 0.05% Tween-20), the signal was detected using enhanced chemiluminescence
detection assay kit (Tiangen, Beijing, China). The molecular mass of the purified mFcALF2 protein was
determined using matrix-assisted laser desorption ionization mode (MALDI/TOF) mass spectrometry.
The MALDI-TOF mass spectrometry was acquired in linear mode using a AB SCIEX MALDI-TOF/TOF
5800 System (ABSciex, Framingham, MA, USA) in positive reflector mode (10 kV) with a matrix of
CHCA (Sigma, St. Louis, MO, USA). Two thousand laser shots were accumulated for each spectrum.
MS data were calibrated by external calibration using the 5800 Mass Standards. Mass accuracy
of MALDI/TOF mass spectra, after external calibration, resulted in approximately 100 ppm.
Data were aquired and analyzed with 4000 Series Explorer Software V3.5 (Applied Biosystems,
Waltham, MA, USA).
4.5. Bacteria Binding Assay
The binding of mFcALF2 to four species of bacteria, including E. coli, V. alginolyticus,
B. licheniformis and S. epidermidis, was examined by indirected ELISA according to the method described
previously [28]. The freshly cultured bacteria were collected and washed with PBS three times.
Then the bacteria were resuspended by coating buffer (Na2 CO3 1.59 g/L, NaHCO3 2.93 g/L, pH 9.6) to
108 cfu/mL. A 96-well plate was coated with 100 μL of bacteria suspension at 4 ˝ C overnight. Then the
wells were washed and blocked with 5% nonfat milk in Tris-buffered saline (TBS) buffer at 37 ˝ C
for 2 h. After three washes with TBS, 100 μL of mFcALF2 (32 μM) were added and incubated at
37 ˝ C for 2 h. The wells were washed three times, and 100 μL HRP-conjugated anti-His Tag mouse
monoclonal antibody (1/2000 diluted in TBS) was added. After incubation at 37 ˝ C for 2 h and washing
as described above, the reactivity was measured using 100 μL soluble TMB substrate solution (TianGen,
Beijing, China). The absorbance was measured at 405 nm. The assay was performed in triplicates in
three independent experiments.
4.6. Scanning Electron Microscopy (SEM) Detection
The morphology of E. coli, V. alginolyticus and S. epidermidis after incubation with 32 μM mFcALF2
was observed under scanning electron microscopy (SEM). Firstly, mid-logarithmic phase cultures of
bacteria were harvested by centrifugation at 1000ˆ g for 10 min and resuspended in PBS at 108 cfu/mL.
Cells were incubated with 32 μM mFcALF2 for 1 h. The bacteria cells treated with the same amount
of pGFP peptide were used as control. The collected cells were subsequently fixed in 2.5% (v/v)
glutaraldehyde in 0.1 M phosphate buffer (pH 7.4) for 1 h and dehydrated with a graded ethanol series.
After critical-point drying and gold coating, the samples were visualized by Hitachi S-3400N Scanning
Electron Microscope (Hitachi High-Technologies, Tokyo, Japan).
4.7. Antimicrobial Activity Assays
The antimicrobial activity of the purified mFcALF2 protein was exhibited by inhibition zone test
and MIC assay against Gram-positive and Gram-negative bacteria. The MIC and inhibition zone test
were performed according to the method described previously [18]. Briefly, the bacterial strains were
36
Mar. Drugs 2016, 14, 152
grown in medium up to 1 ˆ 108 cfu/mL. Then 2 μL of the bacterial cultures, 15 μL of 1/2-fold serially
diluted mFcALF2 (320 μM–10 μM) in PBS (pH 7.4) and 133 μL of fresh medium were added into each
well of the sterile 96-well plate, so that the bacterial cultures were diluted to 1 ˆ 106 cfu/mL and the
recombinant mFcALF2 were diluted 1/2-fold serially to the concentrations of 32 μM–1 μM in a final
volume of 150 μL. Then the 96-well plates were incubated at the corresponding temperature for another
6 to 8 h. Absorbance at 600 nm for Gram-positive bacteria or 560 nm for Gram-negative bacteria
was determined using a precision micro-plate reader (TECAN infinite M200 PRO, Salzburg, Austria).
The assay was performed in triplicates in three independent experiments. The MICs were defined
as the lowest concentration of the compounds to inhibit the growth of microorganisms based on the
spectroscopic absorbance readings. The bacteria strains used in this study included four Gram-negative
bacteria, including E. coli, V. harveyi, V. parahaemolyticus and V. alginolyticus, and two Gram-positive
bacteria including B. licheniformis and S. epidermidis.
Two Gram-negative bacteria E. coli and V. alginolyticus, and two Gram-positive bacteria
B. licheniformis and S. epidermidis were used for inhibition zone test. The overnight culture of bacteria
was diluted 100 times and 200 μL of culture were spread on the solid LB medium uniformly. Sterile filter
paper with a diameter of 5 mm was put on the surface of the solid medium. Twenty mircoliters of
32 μM recombinant protein solution was added to the center of filter paper. Moreover, 20 μL PBS and
20 μL 32 μM pGFP peptide solution were used as negative control, and 20 μL of 32 μM LBDv peptide
solution was used as a positive control. The plates were cultured at 37 ˝ C or 28 ˝ C for 24 h.
4.8. The Hemolytic Activity Test of mFcALF2
The hemolytic activities of mFcALF2 with a concentration of 32 μM, were evaluated as
previously described [46,47]. The hemolytic activity tests were checked on sheep blood agar plates
(Qingdao Hope Bio. Technology Co., Ltd., Qingdao, China). The 60 μL purified mFcALF2 protein
(32 μM) was added into the Oxford cup (a stainless cylinder, outer diameter 7.1 ˘ 0.1 mm, inner
diameter 6.0 ˘ 0.1 mm and height 10 ˘ 0.1 mm), which was placed on the surface of the agar. The same
volume of PBS buffer (pH 7.4) and 0.2% Triton X-100 were used as a negative and a positive control
separately. Then the plates were incubated at 30 ˝ C for 6 to 8 h, and the hemolytic halos were measured.
4.9. Detection on the Antiviral Activity of mFcALF2
In order to test the antiviral activity of mFcALF2, WSSV particles pre-incubated with the mFcALF2
protein were injected into L. vannamei and the WSSV copy number in the pleopods was tested by
realtime PCR. The specific procedure for WSSV extraction from pathologically infected shrimp were
the same as described previously [48]. L. vannamei with body weight of 1.2 ˘ 0.3 g were used as the
experimental animals for WSSV infection. The experiment was divided into four groups and named as
Blank, PBS + WSSV, pGFP + WSSV, and mFcALF2 + WSSV. WSSV was incubated with 32 μM pGFP or
mFcALF2 peptides solutions for 2 h at room temperature, respectively. For Blank group, shrimp were
only injected with PBS. For PBS + WSSV group, each shrimp was injected with 10 μL (5000 copies)
WSSV after incubation with PBS for 2 h at room temperature. For the other groups (pGFP + WSSV
and mFcALF2 + WSSV), each shrimp was injected with 10 μL (5000 copies) WSSV solutions after
incubation with the corresponding peptides. At 24 h and 36h after WSSV injection, 12 shrimp were
collected from each group and three individuals were put together as one sample to extract DNA using
the Plant Genomic DNA Kit (Tiangen, Beijing, China) for quantifying the copy numbers of WSSV.
The method for quantify WSSV copy number was described as previous research [49].
4.10. Statistical Analyses
The statistical analyses were carried out with SPSS 17.0 software (SPSS Inc., Chicago, IL, USA).
Data were analyzed with analyses of variance (ANOVA) and Duncan’s Multiple Comparisons.
Differences between treatments and controls were considered significant at p < 0.05.
37
Mar. Drugs 2016, 14, 152
5. Conclusions
In conclusion, we have successfully obtained the recombinant protein of a synthesized gene
mFcALF2 through the yeast P. pastoris expression system. The mFcALF2 protein exhibited high
antimicrobial and antiviral activity, which could be potentially used in aquaculture in the future.
These data will pave the way for developing antimicrobial drugs in aquaculture.
Acknowledgments: This work was financially supported by China Agriculture Research system-47 (CARS-47),
General Program of National Natural Science Foundation of China (31272683) to Fuhua Li, the Major State Basic
Research Development Program of China (973 program) (2012CB114403), and the Scientific and Technological
Innovation Project Financially Supported by Qingdao National Laboratory for Marine Science and Technology
(No.2015ASKJ02). This work was also supported by the Hangzhou Qianjiang Distinguished Expert Program.
We would like to thank Wei Liu from Institute of Oceanology, CAS for his help in preparing the samples for
scanning electronic microscopy detection.
Author Contributions: F.L. and J.X. initiated the project. F.L. and S.L. designed and supervised the experimental
work, which was performed by H.Y. and S.L. K.Y. and F.Y. cultured the experimental animals. H.Y. and S.L.
performed data analysis. H.Y., F.L. and S.L. were in charge of writing and checking the manuscript. All the authors
read and approved the final manuscript.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Merrifield, R.; Juvvadi, P.; Andreu, D.; Ubach, J.; Boman, A.; Boman, H.G. Retro and retroenantio analogs of
cecropin-melittin hybrids. Proc. Natl. Acad. Sci. USA 1995, 92, 3449–3453. [CrossRef] [PubMed]
Zasloff, M. Antimicrobial peptides of multicellular organisms. Nature 2002, 415, 389–395. [CrossRef]
[PubMed]
Boman, H.G. Peptide antibiotics and their role in innate immunity. Annu. Rev. Immunol. 1995, 13, 61–92.
[CrossRef] [PubMed]
Nicolas, P. Multifunctional host defense peptides: Intracellular-targeting antimicrobial peptides. FEBS J.
2009, 276, 6483–6496. [CrossRef] [PubMed]
Boman, H.G. Antibacterial peptides: Basic facts and emerging concepts. J. Int. Med. 2003, 254, 197–215.
[CrossRef]
Hancock, R.E.; Sahl, H.G. Antimicrobial and host-defense peptides as new anti-infective therapeutic
strategies. Nat. Biotechnol. 2006, 24, 1551–1557. [CrossRef] [PubMed]
Zasloff, M. Antibiotic peptides as mediators of innate immunity. Curr. Opin. Immunol. 1992, 4, 3–7. [CrossRef]
Ahmad, A.; Yadav, S.P.; Asthana, N.; Mitra, K.; Srivastava, S.P.; Ghosh, J.K. Utilization of an amphipathic
leucine zipper sequence to design antibacterial peptides with simultaneous modulation of toxic activity
against human red blood cells. J. Biol. Chem. 2006, 281, 22029–22038. [CrossRef] [PubMed]
Brogden, K.A. Antimicrobial peptides: Pore formers or metabolic inhibitors in bacteria? Nat. Rev. Microbiol.
2005, 3, 238–250. [CrossRef] [PubMed]
Anne Pereira, H. Novel therapies based on cationic antimicrobial peptides. Curr. Pharm. Biotechnol. 2006, 7,
229–234. [CrossRef] [PubMed]
Strempel, N.; Strehmel, J.; Overhage, J. Potential Application of Antimicrobial Peptides in the Treatment of
Bacterial Biofilm Infections. Curr. Pharm. Des. 2015, 21, 67–84. [CrossRef] [PubMed]
Tanaka, S.; Nakamura, T.; Morita, T.; Iwanaga, S. Limulus Anti-Lps Factor—An Anticoagulant Which Inhibits
the Endotoxin-Mediated Activation of Limulus Coagulation System. Biochem. Biophys. Res. Commun. 1982,
105, 717–723. [CrossRef]
Chia, T.J.; Wu, Y.C.; Chen, J.Y.; Chi, S.C. Antimicrobial peptides (AMP) with antiviral activity against fish
nodavirus. Fish Shellfish Immunol. 2010, 28, 434–439. [CrossRef] [PubMed]
Krepstakies, M.; Lucifora, J.; Nagel, C.H.; Zeisel, M.B.; Holstermann, B.; Hohenberg, H.; Kowalski, I.;
Gutsmann, T.; Baumert, T.F.; Brandenburg, K.; et al. A new class of synthetic peptide inhibitors blocks
attachment and entry of human pathogenic viruses. J. Infect. Dis. 2012, 205, 1654–1664. [CrossRef] [PubMed]
Nagoshi, H.; Inagawa, H.; Morii, K.; Harada, H.; Kohchi, C.; Nishizawa, T.; Taniguchi, Y.; Uenobe, M.;
Honda, T.; Kondoh, M.; et al. Cloning and characterization of a LPS-regulatory gene having an LPS binding
domain in kuruma prawn Marsupenaeus japonicus. Mol. Immunol. 2006, 43, 2061–2069. [CrossRef] [PubMed]
38
Mar. Drugs 2016, 14, 152
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
Hoess, A.; Watson, S.; Siber, G.R.; Liddington, R. Crystal structure of an endotoxin-neutralizing protein from
the horseshoe crab, Limulus anti-LPS factor, at 1.5 A resolution. EMBO J. 1993, 12, 3351–3356. [PubMed]
Supungul, P.; Klinbunga, S.; Pichyangkura, R.; Hirono, I.; Aoki, T.; Tassanakajon, A. Antimicrobial peptides
discovered in the black tiger shrimp Penaeus monodon using the EST approach. Dis. Aquat. Organ. 2004, 61,
123–135. [CrossRef] [PubMed]
Guo, S.Y.; Li, S.H.; Li, F.H.; Zhang, X.J.; Xiang, J.H. Modification of a synthetic LPS-binding domain of
anti-lipopolysaccharide factor from shrimp reveals strong structure-activity relationship in their antimicrobial
characteristics. Dev. Comp. Immunol. 2014, 45, 227–232. [CrossRef] [PubMed]
Tharntada, S.; Ponprateep, S.; Somboonwiwat, K.; Liu, H.P.; Soderhall, I.; Soderhall, K.; Tassanakajon, A.
Role of anti-lipopolysaccharide factor from the black tiger shrimp, Penaeus monodon, in protection from white
spot syndrome virus infection. J. Gen. Virol. 2009, 90, 1491–1498. [CrossRef] [PubMed]
Li, S.H.; Zhang, X.J.; Sun, Z.; Li, F.H.; Xiang, J.H. Transcriptome Analysis on Chinese Shrimp
Fenneropenaeus chinensis during WSSV Acute Infection. PLoS ONE 2013, 8, e58627. [CrossRef] [PubMed]
Liu, F.S.; Liu, Y.C.; Li, F.H.; Dong, B.; Xiang, J.H. Molecular cloning and expression profile of putative
antilipopolysaccharide factor in Chinese shrimp (Fenneropenaeus chinensis). Mar. Biotechnol. 2005, 7, 600–608.
[CrossRef] [PubMed]
Li, S.H.; Guo, S.Y.; Li, F.H.; Xiang, J.H. Characterization and function analysis of an anti-lipopolysaccharide
factor (ALF) from the Chinese shrimp Fenneropenaeus chinensis. Dev. Comp. Immunol. 2014, 46, 349–355.
[CrossRef] [PubMed]
Javadpour, M.M.; Juban, M.M.; Lo, W.-C.J.; Bishop, S.M.; Alberty, J.B.; Cowell, S.M.; Becker, C.L.;
McLaughlin, M.L. De novo antimicrobial peptides with low mammalian cell toxicity. J. Biol. Chem. 1996, 39,
3107–3113. [CrossRef] [PubMed]
Maloy, W.L.; Kari, U.P. Structure-activity studies on magainins and other host defense peptides. Biopolymers
1995, 37, 105–122. [CrossRef] [PubMed]
Mangoni, M.L.; Shai, Y. Short native antimicrobial peptides and engineered ultrashort lipopeptides:
Similarities and differences in cell specificities and modes of action. Cell Mol. Life Sci. 2011, 68, 2267–2280.
[CrossRef] [PubMed]
Yang, H.; Li, S.H.; Li, F.H.; Xiang, J.H. Structure and bioactivity of a modified peptide derived from
the LPS-binding domain of an anti-lipopolysaccharide factor (ALF) of Shrimp. Mar. Drugs 2016, 14, 96.
[CrossRef] [PubMed]
Cregg, J.M.; Cereghino, J.L.; Shi, J.; Higgins, D.R. Recombinant protein expression in Pichia pastoris.
Mol. Biotechnol. 2000, 16, 23–52. [CrossRef]
Liu, C.C.; Chung, C.P.; Lin, C.Y.; Sung, H.H. Function of an anti-lipopolysaccharide factor (ALF) isoform
isolated from the hemocytes of the giant freshwater prawn Macrobrachium rosenbergii in protecting against
bacterial infection. J. Invertebr. Pathol. 2014, 116, 1–7. [CrossRef] [PubMed]
Li, S.H.; Guo, S.Y.; Li, F.H.; Xiang, J.H. Functional diversity of anti-lipopolysaccharide factor isoforms in
shrimp and their characters related to antiviral activity. Mar. Drugs 2015, 13, 2602–2616. [CrossRef] [PubMed]
Hancock, R.E. Peptide antibiotics. Lancet 1997, 349, 418–422. [CrossRef]
Otero-González, A.J.; Magalhães, B.S.; Garcia-Villarino, M.; López-Abarrategui, C.; Sousa, D.A.; Dias, S.C.;
Franco, O.L. Antimicrobial peptides from marine invertebrates as a new frontier for microbial infection
control. FASEB. J. 2010, 24, 1320–1334. [CrossRef] [PubMed]
Arbulu, S.; Jiménez, J.J.; Gútiez, L.; Cintas, L.M.; Herranz, C.; Hernández, P.E. Cloning and expression of
synthetic genes encoding the broad antimicrobial spectrum bacteriocins SRCAM 602, OR-7, E-760, and
L-1077, by recombinant Pichia pastoris. Biomed. Res. Int. 2015, 2015, e767183. [CrossRef] [PubMed]
Ponprateep, S.; Somboonwiwat, K.; Tassanakajon, A. Recombinant anti-lipopolysaccharide factor isoform 3
and the prevention of vibriosis in the black tiger shrimp, Penaeus monodon. Aquaculture 2009, 289, 219–224.
[CrossRef]
Cereghino, J.L.; Cregg, J.M. Heterologous protein expression in the methylotrophic yeast Pichia pastoris.
Microbiol. Lett. 2000, 24, 45–66.
Jiménez, J.J.; Borrero, J.; Gútiez, L.; Arbulu, S.; Herranz, C.; Cintas, L.M.; Hernández, P.E. Use of synthetic
genes for cloning, production and functional expression of the bacteriocins enterocin A and bacteriocin
E 50-52 by Pichia pastoris and Kluyveromyces lactis. Mol. Biotechnol. 2014, 56, 571–583. [CrossRef] [PubMed]
39
Mar. Drugs 2016, 14, 152
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
Malanovic, N.; Lohner, K. Gram-positive bacterial cell envelopes: The impact on the activity of antimicrobial
peptides. Biochim. Biophys. Acta (BBA) Biomembr. 2015, 1858, 936–946. [CrossRef] [PubMed]
Devine, D.A.; Hancock, R.E. Cationic peptides: Distribution and mechanisms of resistance. Curr. Pharm. Des.
2002, 8, 703–714. [CrossRef] [PubMed]
Somboonwiwat, K.; Bachère, E.; Rimphanitchayakit, V.; Tassanakajon, A. Localization of anti-lipopolysaccharide
factor (ALFPm3) in tissues of the black tiger shrimp, Penaeus monodon, and characterization of its binding
properties. Dev. Comp. Immunol. 2008, 32, 1170–1176. [CrossRef] [PubMed]
Jaree, P.; Tassanakajon, A.; Somboonwiwat, K. Effect of the anti-lipopolysaccharide factor isoform 3 (ALFPm3)
from Penaeus monodon on Vibrio harveyi cells. Dev. Comp. Immunol. 2012, 38, 554–560. [CrossRef] [PubMed]
Zhang, L.; Yang, D.; Wang, Q.; Yuan, Z.; Wu, H.; Pei, D.; Cong, M.; Li, F.; Ji, C.; Zhao, J. A defensin from clam
Venerupis philippinarum: Molecular characterization, localization, antibacterial activity, and mechanism of
action. Dev. Comp. Immunol. 2015, 51, 29–38. [CrossRef] [PubMed]
Wang, Y.; Chen, J.; Zheng, X.; Yang, X.; Ma, P.; Cai, Y.; Zhang, B.; Chen, Y. Design of novel analogues of short
antimicrobial peptide anoplin with improved antimicrobial activity. J. Pept. Sci. 2014, 20, 945–951. [CrossRef]
[PubMed]
Liu, Y.; Cui, Z.; Li, X.; Song, C.; Li, Q.; Wang, S. A new anti-lipopolysaccharide factor isoform (PtALF4)
from the swimming crab Portunus trituberculatus exhibited structural and functional diversity of ALFs.
Fish Shellfish Immunol. 2012, 32, 724–731. [CrossRef] [PubMed]
Yang, H.; Li, S.H.; Li, F.H.; Lv, X.J.; Xiang, J.H. Recombinant expression and functional analysis of
an isoform of anti-lipopolysaccharide factors (FcALF5) from Chinese shrimp Fenneropenaeus chinensis.
Dev. Comp. Immunol. 2015, 53, 47–54. [CrossRef] [PubMed]
Lo, C.F.; Ho, C.H.; Chen, C.H.; Liu, K.F.; Chiu, Y.L.; Yeh, P.Y.; Peng, S.E.; Hsu, H.C.; Liu, H.C.;
Chang, C.F.; et al. Detection and tissue tropism of white spot syndrome baculovirus (WSBV) in captured
brooders of Penaeus monodon with a special emphasis on reproductive organs. Dis. Aquat. Organ. 1997, 30,
53–72. [CrossRef]
Liu, H.P.; Jiravanichpaisal, P.; Soderhall, I.; Cerenius, L.; Soderhall, K. Antilipopolysaccharide factor interferes
with white spot syndrome virus replication in vitro and in vivo in the crayfish Pacifastacus leniusculus. J. Virol.
2006, 80, 10365–10371. [CrossRef] [PubMed]
Liu, F.; Liu, G.X.; Li, F.H. Characterization of two pathogenic Photobacterium strains isolated from
Exopalaemon carinicauda causing mortality of shrimp. Aquaculture 2016, 464, 129–135. [CrossRef]
Bicca, F.C.; Fleck, L.C.; Ayub, M.Z. Production of biosurfactant by hydrocarbon degrading Rhodococcus ruber
and Rhodococcus erythropolis. Rev. Microbiol. 1999, 30, 231–236. [CrossRef]
Sun, Y.M.; Li, F.H.; Chi, Y.H.; Xiang, J.H. Enhanced resistance of marine shrimp Exopalamon carincauda
Holthuis to WSSV by injecting live VP28-recombinant bacteria. Acta Oceanol. Sin. 2013, 32, 52–58. [CrossRef]
Sun, Y.M.; Li, F.H.; Xiang, J.H. Analysis on the dynamic changes of the amount of WSSV in Chinese shrimp
Fenneropenaeus chinensis during infection. Aquaculture 2013, 376, 124–132. [CrossRef]
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
40
marine drugs
Article
Anticancer Activity of a Hexapeptide from Skate
(Raja porosa) Cartilage Protein Hydrolysate in
HeLa Cells
Xin Pan, Yu-Qin Zhao *, Fa-Yuan Hu, Chang-Feng Chi and Bin Wang *
School of Food and Pharmacy, Zhejiang Ocean University, 1st Haidanan Road, Changzhi Island,
Lincheng, Zhoushan 316022, China; Uniquepan2015@163.com (X.P.); moonriveryue@163.com (F.-Y.H.);
chichangfeng@hotmail.com (C.-F.C.)
* Correspondence: zhaoy@hotmail.com (Y.-Q.Z.); wangbin4159@hotmail.com (B.W.);
Tel.: +86-580-255-5085 (Y.-Q.Z. & B.W.); Fax: +86-580-255-4781 (Y.-Q.Z. & B.W.)
Academic Editor: Se-Kwon Kim
Received: 30 June 2016; Accepted: 8 August 2016; Published: 16 August 2016
Abstract: In this study, the hexapeptide Phe-Ile-Met-Gly-Pro-Tyr (FIMGPY), which has a molecular
weight of 726.9 Da, was separated from skate (Raja porosa) cartilage protein hydrolysate using
ultrafiltration and chromatographic methods, and its anticancer activity was evaluated in HeLa
cells. Methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay indicated that FIMGPY exhibited
high, dose-dependent anti-proliferation activities in HeLa cells with an IC50 of 4.81 mg/mL.
Acridine orange/ethidium bromide (AO/EB) fluorescence staining and flow cytometry methods
confirmed that FIMGPY could inhibit HeLa cell proliferation by inducing apoptosis. Western blot
assay revealed that the Bax/Bcl-2 ratio and relative intensity of caspase-3 in HeLa cells treated with
7-mg/mL FIMGPY were 2.63 and 1.83, respectively, significantly higher than those of the blank
control (p < 0.01). Thus, FIMGPY could induce apoptosis by upregulating the Bax/Bcl-2 ratio and
caspase-3 activation. Using a DNA ladder method further confirmed that the anti-proliferation
activity of FIMGPY was attributable to its role in inducing apoptosis. These results suggest that
FIMGPY from skate cartilage protein hydrolysate may have applications as functional foods and
nutraceuticals for the treatment and prevention of cancer.
Keywords: skate (Raja porosa); cartilage; peptide; anticancer activity; apoptosis
1. Introduction
Cancer is one of the single most important causes of death in humans, inducing approximately
8.2 million deaths or 14.6% of all human deaths in 2012 [1]. Currently, chemotherapy is the most
common method used to eliminate cancer cells, prevent cancer recurrence, control cancer by
slowing cell growth, and reduce symptoms [2]. However, healthy cells may be damaged by the
many side effects of anticancer drugs, and resistance to anticancer drugs has been observed [3].
Therefore, substantial attention is being paid to identifying anticancer drugs with high efficiency and
low toxicity from natural sources [4].
Bioactive peptides, which consist of 2–20 amino acid residues, are inactive in the sequence of their
parent proteins and can be released by enzymatic hydrolysis either during gastrointestinal digestion
in the body or during food processing. To date, some peptides with anticancer and antioxidant
activities have been purified from various protein hydrolysates [5]. (Leu-Ala-Asn-Ala-Lys) LANAK,
which has a MW of 515.29 Da and is from oyster protein hydrolysates, was shown to initiate cancer
cell death by inhibiting cancer cell growth, increasing DNA damage and apoptosis in the HT-29
colon cancer cell line, and displaying strong antioxidant potential as a 2,2-diphenyl-1-picrylhydrazyl
Mar. Drugs 2016, 14, 153
41
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2016, 14, 153
radical (DPPH•) scavenger [1]. (Gln-Pro-Lys) QPK, which was isolated from a sepia ink protein
hydrolysate, could significantly inhibit the proliferation of DU-145, PC-3, and LNCaP cells in a
time- and dose-dependent manner. This peptide induced apoptosis by decreasing the expression
of the anti-apoptotic protein Bcl-2 and increasing the expression of the apoptotic protein Bax [6].
Tyr-Ala-Leu-Arg-Ala-His (YALRAH), which has a MW of 670.77 Da and is from half-fin anchovy
(Setipinna taty) hydrolysates, exhibited strong anti-proliferation effects on human prostate cancer
PC-3 cells, with an IC50 of 11.1 μM [7]. Arg-Gln-Ser-His-Phe-Ala-Asn-Ala-Gln-Pro (RQSHFANAQP),
which has a MW of 1155 Da and is from chickpea protein hydrolysates, showed significant
dose-dependent activities in hydroxyl radical (HO•)-(EC50 2.03 μM), DPPH•-(EC50 3.15 μM) and
2,2′ -azino-bis-3-ethylbenzothiazoline-6-sulfonic acid radical (ABTS+ •)-(EC50 2.31 μM) scavenging
assays. Additionally, cell viability assays showed high anti-proliferative activities on the breast
cancer cells MCF-7 and MDA-MB-231, with IC50 values of 2.38 and 1.50 μmol/mL, respectively.
Furthermore, the key tumor suppressor protein (p53) level was shown to increase with increasing
RQSHFANAQP concentrations by enzyme-linked immunosorbent assay (ELISA) [8]. WPP, which has
a MW of 398.44 Da and is isolated from blood clam (Tegillarca granosa), showed significant
antioxidant activities against DPPH•, HO•, O2− •, and ABTS+ • with EC50 values of 1.388, 0.406, 0.536,
and 2.75 mg/mL, respectively. Furthermore, this peptide exhibited strong, dose-dependent cytotoxicity
toward PC-3, DU-145, H-1299, and HeLa cell lines and significantly changed the morphologies of
PC-3 cells [2]. Previous research indicated that food-derived peptides could have the potential to
prevent and treat diseases associated with reactive oxygen species (ROS), specifically cancers [9].
Therefore, consuming antioxidant peptides could dramatically reduce organismal ROS levels and
contribute substantially to maintaining health and preventing ROS-associated diseases, especially
cancers [10–12].
Cartilaginous fishes (Chondrichthyes) are a commercially important species. During processing,
large quantities of cartilage are discarded as waste because of their low economic value.
In our previous studies, three antioxidant hexapeptides—Phe-Ile-Met-Gly-Pro-Tyr (FIMGPY),
Gly-Pro-Ala-Gly-Asp-Tyr (GPAGDY) and Ile-Val-Ala-Gly-Pro-Gln (IVAGPQ)—were isolated from
skate (Raja porosa) cartilage protein hydrolysates [13], and FIMGPY exhibited good scavenging
activities on (DPPH•)-(EC50 3.5768 M), (HO•)-(EC50 4.1821 M), (O2− •)-(EC50 3.1181 M) and
(ABTS+ •)-(EC50 1.4307 M), respectively. In addition, FIMGPY showed the higher anti-proliferation
activity in HeLa cells than those of GPAGDY and IVAGPQ. Therefore, the objective of the present
study was to investigate the anticancer activities and molecular mechanisms of FIMGPY in HeLa cells.
2. Results and Discussion
2.1. Proliferation Inhibition of HeLa Cell Lines
Cell proliferation is a physiological process that occurs in almost all tissues and under many
circumstances. Under normal conditions, the balance between proliferation and programmed cell
death, which usually occurs via apoptosis, is maintained by regulating both processes to ensure the
integrity of tissues and organs. However, uncontrolled cell division can induce tissue proliferation
and even cancer [14]. Therefore, the inhibition of cell proliferation is thought to be an effective
method for tumor therapy. In this study, the HeLa cell line was used to measure the proliferation
inhibition rate of FIMGPY. The peptide was evaluated in mouse embryo fibroblast NIH3T3 cells
under the same experimental conditions to determine its cytotoxic effect on normal cells. As shown in
Figure 1, FIMGPY showed strong, dose-dependent cytotoxicity against HeLa cell lines, with an IC50
of 4.81 mg/mL for 24 h. The IC50 value of FIMGPY in HeLa cells was lower than those of GPAGDY
(4.86 mg/mL) and IVAGPQ (6.26 mg/mL), which are also from skate cartilage protein hydrolysates.
The results indicate that FIMGPY exerted higher cytotoxic activity against HeLa cells under identical
conditions than the other two peptides. The proliferation-inhibition rate of FIMGPY in NIH3T3 cells
(IC50 4.81 mg/mL for 24 h) was also far below than that in HeLa cells (data not shown), suggesting
42
Mar. Drugs 2016, 14, 153
that FIMGPY has almost no cytotoxic effects on normal cells. Therefore, that FIMGPY is cell selective,
destroying tumor cells rather than normal cells.
Figure 1. Proliferation inhibition of HeLa cell lines treated by FIMGPY for 24 h. All data are presented
as the mean ± standard deviation (SD) of three experiments. a–f Values with same letters indicate no
significant difference for each group of samples at the same concentration (p > 0.05).
The composition of cell membrane bilayers and the distribution of phospholipids determine
cell selectivity and cell susceptibility to lysis. The amount of phosphatidylserine (PS) located in the
outer leaflets of cancer cell membranes is 3–7 times that found in the inner leaflets of normal cell
membranes [15]. FIMGPY is composed of the hydrophobic amino acids Phe (F), Ile (I), Met (M),
and Pro (P), which could lead to increased interactions between FIMGPY and the outer leaflets of
tumor cell membrane bilayers, which have high phospholipid contents. These increased interactions
may explain FIMGPY’s cell selectivity.
2.2. Morphological Observations by Acridine Orange/Ethidium Bromide (AO/EB) Staining
Apoptosis is a process of programmed cell death characterized by biochemical and morphological
processes and plays a crucial role in developing and maintaining the health of the body by eliminating
old, unnecessary and unhealthy cells [16]. During different stages of apoptosis, some characteristic
cell morphologies include blebbing, shrinkage, nuclear fragmentation, chromatin condensation,
poly-nucleosomal DNA fragmentation, global mRNA decay, and the fragmentation of cells into
apoptotic bodies [17]. Therefore, fluorescence microscopy and AO/EB staining methods were
employed to observe the cell changes to distinguish between apoptotic and normal cells, and determine
the effects of external factors on cancer cells [6].
As shown in Figure 2, HeLa cells showed significant, morphological, apoptotic changes
after treatment with 0-, 3-, 5-, and 7-mg/mL FIMGPY for 24 h. Green, yellow/green and
reddish/orange staining of the cells indicate viable, early apoptotic, and late apoptotic cells,
respectively. The yellow/green staining in Figure 2(A-2,A-3) shows HeLa cells that was at an
early stage of apoptosis. Typical apoptotic changes, such as condensed chromatin, cytoplasmic
blebs, and fragmented nuclei, were also observed in the HeLa cells after exposure to 3- and
5-mg/mL FIMGPY for 24 h. In Figure 2(A-4), additional features—i.e., orange necrotic cell apoptotic
bodies—were observed, indicating that the HeLa cells were in the final stages of apoptosis after
exposure to 7-mg/mL FIMGPY for 24 h. The AO/EB staining results revealed that the morphological
features of the apoptotic HeLa cells were dose dependent, similar to previous AO/EB staining
results obtained for DU-145 and PC-3 cells treated with QPK from cuttlefish ink [6], PC-3 cells
treated with Arg-Ala-Ala-Leu-Ala-Val-Val-Leu-Gly-Arg-Gly-Gly-Pro-Pro (RAALAVVLGRGGPR) and
Arg-Asp-Gly-Asp-Ser-Cys-Arg-Gly-Gly-Gly-Pro-Val (RDGDSCRGGGPV) from Bullacta exarata [18],
and PC-3 cells treated with Trp-Pro-Pro (WPP) from blood clam [2].
43
Mar. Drugs 2016, 14, 153
ȱ
Figure 2. Morphological observation with AO/EB staining at 400× actual magnification. HeLa cells
were treated with FIMGPY at (A-1) 0, (A-2) 3, (A-3) 5, and (A-4) 7 mg/mL for 24 h. (A-1) Cell indicated
by the arrow indicates viable cell; (A-2 and A-3) Cells indicated by the arrow indicates early apoptotic
cells; (A-4) Cell indicated by the arrow indicates late apoptotic cell. Each experiment was performed in
triplicate and generated similar morphological features.
2.3. Cell Apoptotic Rate Detected by Flow Cytometry
In normal cells, PS distributes only on the inner side of the cytomembrane and transfers to
the outer side of the cytomembrane during early cell apoptosis. Therefore, Annexin V can bind to
PS that is expressed on the outer layer of the cytomembrane and is used to identify cells entering
apoptosis [19]. Propidium iodide (PI) is used as a DNA stain for flow cytometry to evaluate cell
viability or DNA content via cell cycle analysis and to differentiate necrotic, apoptotic, and normal
cells [20]. Thus, Annexin V-fluorescein isothiocyanate (FITC)/PI can identify distinct cell stages and
quantitatively illustrate the apoptotic process [21].
The percentages of Annexin V-stained HeLa cells treated with FIMGPY at concentrations ranging
from 3 to 7 mg/mL are depicted in Figure 3. The percentage of Annexin V-stained HeLa cells was 4.54%
for the control. After 24 h of exposure to FIMGPY, the apoptosis percentages increased to 8.64 ± 0.31,
11.72 ± 0.57 and 19.25 ± 0.76% for concentrations of 3, 5, and 7 mg/mL, respectively. Compared with
the control, the apoptotic effect on the HeLa cells markedly increased as the FIMGPY concentration
increased. Therefore, FIMGPY displayed a high capacity to induce apoptosis in HeLa cells.
Figure 3. Cont.
44
Mar. Drugs 2016, 14, 153
Figure 3. Flow cytometry analysis of HeLa cells by double-labeling with Annexin-V and PI. Quadrants:
lower left-live, cells; upper left, necrotic cells; lower right, early apoptotic cells; upper right,
late apoptotic cells. The percentages of early apoptotic cells were (A-1) 4.54% in the blank control cells;
(A-2) 8.64% in the 3-mg/mL FIMGPY-treated cells; (A-3) 11.72% in the 5-mg/mL FIMGPY-treated cells;
and (A-4) 19.25% in the 7-mg/mL FIMGPY-treated cells. All data are presented as the mean ± standard
deviation (SD) of three experiments.
2.4. Western Blotting Results for Bcl-2, Bax, and Caspase-3 in FIMGPY-Treated HeLa Cells
The flow cytometry assay indicated that the apoptosis rate increased in HeLa cells as the FIMGPY
concentration increased. Apoptosis is a highly regulated and controlled process that confers advantages
during an organism’s life cycle. Therefore, the initiation of apoptosis is precisely regulated by activation
mechanisms involving specific factors; for example, caspases and Fas receptors promote apoptosis,
whereas some members of the Bcl-2 family of proteins inhibit apoptosis [22]. To further confirm the
effects of FIMGPY in HeLa cells and explain the reasons for the observed apoptosis, western blot assay
was performed to investigate anti- and pro-apoptosis protein expression levels in treated HeLa cells.
Two distinct pathways (intrinsic and extrinsic) can lead to the activation of apoptosis.
The intrinsic or mitochondrial apoptosis is crucially regulated by the interplay/balance between the
pro- and anti-apoptotic Bcl-2 family members. Consequently, the Bcl-2 family proteins play a pivotal
role in determining whether a cell will live or die [23,24]. Members of the Bcl-2 family, such as Bax,
Bak, Bad, and Bcl-Xs, possess pro-apoptotic characteristics, whereas other members, such as Bcl-2,
Bcl-XL, Bcl-W, Bfl-1, and Mcl-1, act as anti-apoptotic regulators. The apoptosis-inducing effect is more
dependent on the balance between Bcl-2 and Bax than on Bcl-2 alone. Typically, the ratio of Bcl-2
and Bax protein expression is used as an index for apoptosis [6]. In this experiment, the levels of
pro-apoptotic Bax and anti-apoptotic Bcl-2 proteins were measured by Western blot analysis in the
presence of different doses of FIMGPY (0, 3, 5, and 7 mg/mL). As shown in Figure 4, a remarkable
upregulation of Bax protein levels and a decrease in the Bcl-2 protein levels were observed as the
FIMGPY concentration increased (Figure 4A), eventually leading to an increase in the Bax/Bcl-2 ratio
in FIMGPY-treated HeLa cells (Figure 4B). The Bax/Bcl-2 ratio in HeLa cells treated with 7-mg/mL
FIMGPY was 2.63, which was significantly higher than that of the blank control (p < 0.01). The result
indicated that FIMGPY could promote apoptosis in HeLa cells by upregulating the Bax/Bcl-2 ratio.
45
Mar. Drugs 2016, 14, 153
Figure 4. Expression of the apoptosis-associated proteins Bax and Bcl-2 in HeLa cells treated with
FIMGPY for 24 h. (A) Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) patterns
for Bax and Bcl-2 and (B) the Bax/Bcl-2 ratio. * p < 0.05 and ** p< 0.01 vs. control.
Caspases are the executioners of apoptosis and are divided into the following two types
according to their functions in apoptosis: (1) initiator (apical) caspases and (2) effector (executioner)
caspases [25,26]. Initiator caspases (e.g., caspase-2, 8, 9, and 10) cleave inactive pro-forms of effector
caspases, thereby activating them; effector caspases (e.g., caspase-3, 6, 7), in turn, cleave other protein
substrates within the cell to trigger apoptosis. Among them, caspase-3 interacts with caspase-8 and
caspase-9 in apoptosis, and plays a central role in the execution phase of apoptosis [22,27]. Figure 5A
shows that FIMGPY noticeably upregulated caspase-3 levels in HeLa cells and that its relative intensity
increased from 0.72 to 1.83 when the peptide concentration ranged from 0 to 7 mg/mL. The relative
intensity of caspase-3 at 8 mg/mL was significantly higher than that of the blank control (p < 0.01)
(Figure 5B). Slee, Adrain, and Martin reported that caspase-3 is the primary executioner caspase in
apoptotic death and is necessary for the cytochrome c/dATP-inducible cleavage of fodrin, gelsolin,
and U1 small nuclear ribonucleoprotein and DNA fragmentation factor 45/inhibitor of caspase-activated
DNase [28]. Caspase-3 is also essential for apoptosis-associated chromatin margination,
DNA fragmentation, and nuclear collapse in this system. Therefore, based on the activation of caspase-3,
the FIMGPY-induced apoptosis of HeLa cells seemed to be related to the mitochondria-mediated
pathway. Therefore, the apoptotic signal will be amplified step by step and the apoptotic process
promoted as the caspase-3 level increases.
Figure 5. Caspase-3 expression in HeLa cells treated with FIMGPY for 24 h. (A) SDS-PAGE pattern of
caspase-3 and (B) the relative intensity of caspase-3. * p < 0.05 and ** p < 0.01 vs. control.
46
Mar. Drugs 2016, 14, 153
2.5. DNA Ladder Analysis
The degradation of nuclear DNA into nucleosomal units is one of the hallmarks of apoptotic
cell death. During this process, chromatin DNA is cleaved into inter-nucleosomal fragments, which
will show a ladder pattern in agarose gel electrophoresis; thus, apoptosis can be detected via a DNA
laddering assay [29,30]. As shown in Figure 6, the DNA bands from the control group of HeLa cells
remained intact, whereas DNA ladder patterns were observed for the HeLa cells treated with different
concentrations of FIMGPY for 24 h. DNA fragmentation also increased as the FIMGPY concentration
increased. These results indicated that FIMGPY could induce apoptosis in HeLa cells and that the
number of apoptotic cells increases as the FIMGPY concentration increases. This finding is in good
agreement with the AO/EB staining, flow cytometry, and Western blotting analysis results.
Figure 6. DNA fragmentation assay of HeLa cells treated with different concentrations of FIMGPY for
24 h. (A) Blank control; (B) 3 mg/mL; (C) 5 mg/mL; (D) 7 mg/mL, and the MV 2000 marker.
2.6. Discussion
The structural properties can provide effective guides for evaluating food proteins as potential
precursors of bioactive peptides, and design the rational enzymolysis technology to prepare the
bioactive peptides from various food-resources proteins [13]. At present, there is still a shortage of
solid evidence to clarify the relationship between structural properties of peptides and their anticancer
property. However, hydrophobicity, molecular size, amino acid composition, and sequence are deemed
to play an essential role in bioactivity of peptides [31,32]. Molecular size ranged from 0.5 to 3 kDa has
been supposed to be a key factor affecting the bioactivity of oxidant activity of protein hydrolysates
and peptides [33]. CPe-III (RQSHFANAQP) with a MW of 1155 Da showed high inhibition activity on
MCF-7 and MDA-MB-231 cells with EC50 of 2.38 and 1.50 μM. QPK with a MW of W 387.4 Da could
significantly inhibit the proliferation of DU-145, PC-3, and LNCaP cells in a time- and dose-dependent
manner [6]. Therefore, the anticancer activity of FIMGPY might be due to its small molecules
(MW 726.9 Da).
In addition, hydrophobic properties could play an important role in their anticancer activities.
For example, hydrophobic peptide fractions separated from anchovy sauce have been shown to
exhibit cancer-chemopreventive effects in human lymphoma cells (U937) by inducing apoptosis in
cancer cells; Ala (A) and Phe (F) were supposed to be the key factors underlying this activity [34,35].
Hydrophobic Ala (A) and Leu (L) residues in the peptide YALPAH were confirmed to be important for
this peptide’s anti-proliferative activities in PC-3 cells [7]. Chi et al. reported that the hydrophobic
47
Mar. Drugs 2016, 14, 153
residues Trp (W) and Pro (P) in WPP play a vital role in its proliferation-inhibition ability in PC-3
cell lines. Therefore, Phe (F), Ile (I), Met (M), Pro (P), and Tyr (Y) in the sequence of FIMGPY should
contribute to its high anticancer activities [2].
3. Experimental Section
3.1. Chemicals and Reagents
Skates (R. porosa) were purchased from Nanzhen market in Zhoushan City, China. NIH3T3 and
HeLa cell lines were purchased from the China Cell Bank of the Institute of Biochemistry and Cell
Biology in Shanghai, China. Methylthiazolyldiphenyl-tetrazolium bromide (MTT) and Annexin V-FITC
Apoptosis Detection Kits were purchased from Sigma-Aldrich Trading Co., Ltd. (Shanghai, China).
All other chemicals and reagents were of analytical grade and were obtained from Sinopharm Chemical
Reagent Co., Ltd. (Shanghai, China).
3.2. Preparation of Hexapeptide FIMGPY
The hexapeptide FIMGPY, which has a molecular weight of 726.9 Da, was separated from skate
(Raja porosa) cartilage protein hydrolysate according to the method of Pan et al. [13].
3.3. Anti-Tumor Activity
3.3.1. Anti-Proliferative Activity
Anti-proliferative activity was evaluated in vitro by MTT assay using the method of Chi et al.
and expressed as IC50 values (defined as the concentration of peptide that caused 50% cell death) [2].
Briefly, cells were seeded at a density of 1 × 104 cells per well in a 96-well plate for 24 h at 37 ◦ C in
a 5% CO2 incubator. Then, the cells were treated with FIMGPY at final concentrations of 3, 4, 5, 6, 7,
and 8 mg/mL. Untreated cells were used as a negative control. The cell proliferation-inhibition rate (%)
was calculated as follows:
Inhibition rate (%) = [(Acontrol − Atreated )/(Acontrol − Ablank )] × 100%
3.3.2. Morphological Study with Fluorescence Microscopy
Apoptosis morphology was evaluated using AO/EB fluorescence staining [6]. Briefly, HeLa cells
were seeded in a six-well plate (1 × 105 cells/well) and incubated overnight before treatment.
Then, the cells were exposed to FIMGPY at concentrations of 3, 5, and 7 mg/mL for 24 h. Untreated cells
served as the negative control. After the designated time, 25 μL of 100-μg/mL AO/EB dye mixture in
PBS (pH 7.4) was added to the FIMGPY-treated cells. After staining, the cells were immediately
visualized and imaged under a fluorescence microscope (Leica DM 3000, Leica Microsystems,
Wetzlar, Germany). Each image was collected with excitation at 488 nm and emission at 520 nm.
3.3.3. Flow Cytometry Analysis
The apoptosis rate was quantitatively detected with an Annexin V-FITC/PI double-staining assay
using a FACS Calibur flow cytometer (Becton Dickinson, New York, NY, USA) [2]. Annexin-V binding
was performed using an Annexin-V-FITC kit as described by Sigma-Aldrich Trading Co., Ltd.
(Shanghai, China). Briefly, HeLa cells were seeded at a density of 1 × 105 cells/well in six-well
plates for 24 h and then treated with FIMGPY at concentrations of 3, 5, and 7 mg/mL for 24 h.
Then, 1 × 105 cells were collected by centrifugation at 9000× g for 5 min at 4 ◦ C, rinsed twice with cold
PBS (pH 7.0), gently re-suspended in 400 μL of binding buffer, and incubated with 5 μL of Annexin
V-FITC for 15 min and 5 μL of PI (100 μg/mL) for 5 min in the dark. Finally, the cells were analyzed
with a flow cytometer. Data analysis was performed with BD FACStation Software (Becton Dickinson,
48
Mar. Drugs 2016, 14, 153
New York, NY, USA). Apoptosis was quantitatively confirmed by analyzing the percentage of early
apoptotic cells using Annexin-V-FITC/PI double staining.
3.3.4. Western Blot Analysis
Western blot analysis was conducted according to the method of Huang et al. [6]. HeLa cells were
seeded at a density of 1 × 105 cells/well in six-well plates for 24 h and then treated with FIMGPY at
concentrations of 3, 5, and 7 mg/mL for 24 h; cell culture medium was used as the negative control.
Then, 1 × 105 cells were collected by centrifugation at 9000× g for 5 min at 4 ◦ C and rinsed twice
with cold PBS (pH 7.2). The cells from the six-well plates were treated with 200 μL of lysis buffer
containing phenylmethanesulfonyl fluoride for 30 min. Subsequently, the treated cells were centrifuged
for 5 min at 12,000× g, and the protein in the supernatant was measured by bicinchoninic acid (BCA)
assay and separated by SDS-PAGE. After SDS-PAGE, proteins were transferred to a polyvinylidene
difluoride (PVDF) membrane, and the membrane was blocked with 10% non-immune serum
for 2 h and then incubated with primary antibody (Cell Signaling, rabbit monoclonal antibody,
1:1000) overnight at 4 ◦ C. After washing three times with Tris-buffered saline with 0.1% Tween-20
(TBST) buffer, the membrane was incubated with the secondary antibody (goat-anti-rabbit horseradish
peroxidase [HRP]-conjugated 1:3000) at room temperature for 2 h and subsequently washed with TBST.
The intensity of the specific immunoreactive bands was detected by enhanced chemiluminescence
(ECL), quantified by densitometry and expressed as a ratio to β-actin.
3.3.5. DNA Ladder Analysis
HeLa cells were seeded at a density of 1 × 105 cells/well in six-well plates for 24 h and then
treated with FIMGPY at concentrations of 3, 5, and 7 mg/mL for 24 h; cell culture medium was
used as the negative control. The cells were collected by centrifugation at 9000× g for 5 min at 4 ◦ C,
rinsed twice with cold PBS (pH 7.2), and treated with 500 μL of lysis buffer at 50 ◦ C. After 12 h, an equal
volume of phenol-chloroform-isoamyl alcohol was added, and the solution was mixed gently and
centrifuged at 12,000× g for 10 min. Then, the aqueous phase was transferred to new Eppendorf tubes.
An equal volume of cold chloroform-isoamyl alcohol was added to the tubes and mixed gently by
inversion. The aqueous phase was once again transferred to new Eppendorf tubes, treated with 60 μL
of ammonium acetate (10 M) and 600 μL of absolute ethanol, and then stored at −20 ◦ C. After 12 h,
the solution was centrifuged at 12,000× g for 10 min, and the precipitate was collected and air-dried
for 30 min. Then, the dried DNA was dissolved in 40 μL of Tris-ethylenediaminetetraacetic acid
(EDTA) (TE) buffer (pH 7.4) and electrophoresed on a 1.0% agarose gel. The gel was examined and
photographed with an ultraviolet gel documentation system (iNTAS, Goettingen, Germany).
3.4. Statistical Analysis
The results are presented as the mean ± SD (n = 3). An ANOVA test using SPSS 19.0
(Statistical Program for Social Sciences, SPSS Corporation, Chicago, IL, USA) was used to analyze
the experimental data. Significant differences were determined using Duncan’s multiple-range test
(p < 0.05 and 0.01).
4. Conclusions
In this study, the anticancer activities of the skate (R. porosa) cartilage protein hydrolysate
peptide FIMGPY were evaluated in HeLa cells. FIMGPY displayed high anti-proliferation activities
in HeLa cells, inducing apoptosis by upregulating the Bax/Bcl-2 ratio and caspase-3 activation.
Thus, FIMGPY has great potential as an anti-carcinogen in the food and pharmaceutical industries.
However, studies on the structure-activity relationship of bioactive peptides and in vivo studies on
this peptide’s anticancer activities remain to be performed.
49
Mar. Drugs 2016, 14, 153
Acknowledgments: This work was funded by the Public Projects of Zhejiang Province (2014C33034) and the
International S & T Cooperation Program of China (2012DFA30600).
Author Contributions: Bin Wang and Yu-Qin Zhao conceived and designed the experiments. Fa-Yuan Hu,
Xin Pan and Bin Wang performed the experiments. Xin Pan, Chang-Feng Chi and Bin Wang analyzed the data.
Bin Wang contributed the reagents/materials/analytical tools and wrote the paper.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
Umayaparvathi, S.; Meenakshi, S.; Vimalraj, V.; Arumugam, M.; Sivagami, G.; Balasubramanian, T.
Antioxidant activity and anticancer effect of bioactive peptide from enzymatic hydrolysate of oyster
(Saccostrea cucullata). Biomed. Prev. Nutr. 2014, 4, 343–353. [CrossRef]
Chi, C.F.; Hu, F.Y.; Wang, B.; Li, T.; Ding, G.F. Antioxidant and anticancer peptides from protein hydrolysate
of blood clam (Tegillarca granosa) muscle. J. Funct. Foods 2015, 15, 301–313. [CrossRef]
Taddia, L.; D’Arca, D.; Ferrari, S.; Marraccini, C.; Severi, L.; Ponterini, G.; Assaraf, Y.G.; Marverti, G.;
Costi, M.P. Inside the biochemical pathways of thymidylate synthase perturbed by anticancer drugs:
Novel strategies to overcome cancer chemoresistance. Drug Resist. Update 2015, 23, 20–54. [CrossRef]
[PubMed]
Zhu, C.Z.; Zhang, W.G.; Zhou, G.H.; Xu, X.L.; Kang, Z.L.; Yin, Y. Isolation and identification of antioxidant
peptides from Jinhua ham. J. Agric. Food Chem. 2013, 61, 1265–1271. [CrossRef] [PubMed]
De Castro, R.J.S.; Sato, H.H. Biologically active peptides: Processes for their generation, purification and
identification and applications as natural additives in the food and pharmaceutical industries. Food Res. Int.
2015, 74, 185–198. [CrossRef]
Huang, F.; Yang, Z.; Yu, D.; Wang, J.; Li, R.; Ding, G. Sepia ink oligopeptide induces apoptosis in prostate
cancer cell lines via caspase-3 activation and elevation of Bax/Bcl-2 ratio. Mar. Drugs 2012, 10, 2153–2165.
[CrossRef] [PubMed]
Song, R.; Wei, R.; Luo, H.; Yang, Z. Isolation and identification of an antiproliferative peptide derived from
heated products of peptic hydrolysates of half-fin anchovy (Setipinna taty). J. Funct. Foods 2014, 10, 104–111.
[CrossRef]
Xue, Z.; Wen, H.; Zhai, L.; Yu, Y.; Li, Y.; Yu, W.; Cheng, A.; Wang, C.; Kou, X. Antioxidant activity and
anti-proliferative effect of a bioactive peptide from chickpea (Cicer arietinum L.). Food Res. Int. 2015, 77, 75–81.
[CrossRef]
Wattanasiritham, L.; Theerakulkait, C.; Wickramasekara, S.; Maier, C.S.; Stevens, J.F. Isolation and
identification of antioxidant peptides from enzymatically hydrolyzed rice bran protein. Food Chem. 2016,
192, 156–162. [CrossRef] [PubMed]
Memarpoor-Yazdi, M.; Asoodeh, A.; Chamani, J. A novel antioxidant and antimicrobial peptide from hen
egg white lysozyme hydrolysates. J. Funct. Foods 2012, 4, 278–286. [CrossRef]
Wang, B.; Gong, Y.; Li, Z.; Yu, D.; Chi, C.; Ma, J. Isolation and characterisation of five novel antioxidant
peptides from ethanol-soluble proteins hydrolysate of spotless smoothhound (Mustelus griseus) muscle.
J. Funct. Foods 2014, 6, 176–185. [CrossRef]
Wang, S.; Mateos, R.; Goya, L.; Amigo-Benavent, M.; Sarriá, B.; Bravo, L. A phenolic extract from grape
by-products and its main hydroxybenzoic acids protect Caco-2 cells against pro-oxidant induced toxicity.
Food Chem. Toxicol. 2016, 88, 65–74. [CrossRef] [PubMed]
Pan, X.; Zhao, Y.; Hu, F.; Wang, B. Preparation and identification of antioxidant peptides from protein
hydrolysate of skate (Raja porosa) cartilage. J. Funct. Foods 2016, 25, 220–230. [CrossRef]
Ibrahim, B.; Sowemimo, A.; Spies, L.; Koekomoer, T.; van de Venter, M.; Odukoya, O.A. Antiproliferative
and apoptosis inducing activity of Markhamia tomentosa leaf extract on HeLa cells. J. Ethnopharmacol. 2013,
149, 745–749. [CrossRef] [PubMed]
Leuschner, C.; Hansel, W. Membrane disrupting lytic peptides for cancer treatments. Curr. Pharm. Des. 2004,
10, 2299–2310. [CrossRef] [PubMed]
Lee, S.; Ryu, B.; Je, J.; Kim, S. Diethylaminoethyl chitosan induces apoptosis in HeLa cells via activation of
caspase-3 and p53 expression. Carbohydr. Polym. 2011, 84, 571–578. [CrossRef]
50
Mar. Drugs 2016, 14, 153
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
Degterev, A.; Yuan, J. Expansion and evolution of cell death programmes. Nat. Rev. Mol. Cell Biol. 2008, 9,
378–390. [CrossRef] [PubMed]
Ma, J.; Huang, F.; Lin, H.; Wang, X. Isolation and purification of a peptide from Bullacta exarata and its
impaction of apoptosis on prostate cancer cell. Mar. Drugs 2013, 11, 266–273. [CrossRef]
Vermes, I.; Haanen, C.; Steffens-Nakken, H.; Reutelingsperger, C. A novel assay for apoptosis.
Flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein
labelled Annexin V. J. Immunol. Methods 1995, 184, 39–51. [CrossRef]
Lecoeur, H. Nuclear apoptosis detection by flow cytometry: Influence of endogenous endonucleases.
Exp. Cell Res. 2002, 277, 1–14. [CrossRef] [PubMed]
Chen, J.; Zhao, Y.; Tao, X.; Zhang, M.; Sun, A. Protective effect of blueberry anthocyanins in a CCL4-induced
liver cell model. LWT Food Sci. Technol. 2015, 60, 1105–1112. [CrossRef]
Morales-Cano, D.; Calviño, E.; Rubio, V.; Herráez, A.; Sancho, P.; Tejedor, M.C.; Diez, J.C. Apoptosis induced
by paclitaxel via Bcl-2, Bax and caspases 3 and 9 activation in NB4 human leukaemia cells is not modulated
by ERK inhibition. Exp. Toxicol. Pathol. 2013, 65, 1101–1108. [CrossRef] [PubMed]
Czabotar, P.E.; Lessene, G.; Strasser, A.; Adams, J.M. Control of apoptosis by the BCL-2 protein family:
Implications for physiology and therapy. Nat. Rev. Mol. Cell Biol. 2014, 15, 49–63. [CrossRef] [PubMed]
Nys, K.; Agostinis, P. Bcl-2 family members: Essential players in skin cancer. Cancer Lett. 2012, 320, 1–13.
[CrossRef] [PubMed]
Kumar, S. Caspase function in programmed cell death. Cell Death Differ. 2007, 14, 32–43. [CrossRef] [PubMed]
Brentnall, M.; Rodriguez-Menocal, L.; De Guevara, R.L.; Cepero, E.; Boise, L.H. Caspase-9, caspase-3 and
caspase-7 have distinct roles during intrinsic apoptosis. BMC Cell Biol. 2013, 14, 32. [CrossRef] [PubMed]
Porter, A.G.; Jänicke, R.U. Emerging roles of caspase-3 in apoptosis. Cell Death Differ. 1999, 6, 99–104.
[CrossRef] [PubMed]
Slee, E.A.; Adrain, C.; Martin, S.J. Executioner caspase-3, -6, and -7 perform distinct, non-redundant roles
during the demolition phase of apoptosis. J. Biol. Chem. 2001, 276, 7320–7326. [CrossRef] [PubMed]
Wyllie, A.H. Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease
activation. Nature 1980, 284, 555–556. [CrossRef] [PubMed]
Vethakanraj, H.S.; Babu, T.A.; Sudarsanan, G.B.; Duraisamy, P.K.; Kumar, S.A. Targeting ceramide metabolic
pathway induces apoptosis in human breast cancer cell lines. Biochem. Biophys. Res. Commun. 2015, 464,
833–839. [CrossRef] [PubMed]
Chi, C.F.; Hu, F.Y.; Wang, B.; Li, Z.R.; Luo, H.Y. Influence of amino acid compositions and peptide profiles
on antioxidant capacities of two protein hydrolysates from skipjack tuna (Katsuwonus pelamis) dark muscle.
Mar. Drugs 2015, 13, 2580–2601. [CrossRef] [PubMed]
Harnedy, P.A.; FitzGerald, R.J. Bioactive peptides from marine processing waste and shellfish: A review.
J. Funct. Foods 2012, 4, 6–24. [CrossRef]
Sila, A.; Bougatef, A. Antioxidant peptides from marine by-products: Isolation, identification and application
in food systems. A review. J. Funct. Foods 2016, 21, 10–26. [CrossRef]
Lee, Y.G.; Kim, J.Y.; Lee, K.W.; Kim, K.H.; Lee, H.J. Peptides from anchovy sauce induce apoptosis in a
human lymphoma cell (U937) through the increase of caspase-3 and -8 activities. Ann. N. Y. Acad. Sci. 2003,
1010, 399–404. [CrossRef] [PubMed]
Lee, Y.G.; Lee, K.W.; Kim, J.Y.; Kim, K.H.; Lee, H.J. Induction of apoptosis in a human lymphoma cell line by
hydrophobic peptide fraction separated from anchovy sauce. Biofactors 2004, 21, 63–67. [CrossRef] [PubMed]
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
51
marine drugs
Review
An Overview of the Medical Applications of Marine
Skeletal Matrix Proteins
M. Azizur Rahman 1,2
1
2
Department of Chemical & Physical Sciences, University of Toronto Mississauga,
Mississauga, ON L5L 1C6, Canada; mazizur.rahman@utoronto.ca or azizurr142@gmail.com;
Tel.: +1-647-892-4221
HiGarden Inc., Markham, ON L3R 3W4, Canada
Academic Editor: Se-Kwon Kim
Received: 9 May 2016; Accepted: 7 September 2016; Published: 12 September 2016
Abstract: In recent years, the medicinal potential of marine organisms has attracted increasing
attention. This is due to their immense diversity and adaptation to unique ecological niches that has
led to vast physiological and biochemical diversification. Among these organisms, marine calcifiers
are an abundant source of novel proteins and chemical entities that can be used for drug discovery.
Studies of the skeletal organic matrix proteins of marine calcifiers have focused on biomedical
applications such as the identification of growth inducing proteins that can be used for bone
regeneration, for example, 2/4 bone morphogenic proteins (BMP). Although a few reports on the
functions of proteins derived from marine calcifiers can be found in the literature, marine calcifiers
themselves remain an untapped source of proteins for the development of innovative pharmaceuticals.
Following an overview of the current knowledge of skeletal organic matrix proteins from marine
calcifiers, this review will focus on various aspects of marine skeletal protein research including
sources, biosynthesis, structures, and possible strategies for chemical or physical modification.
Special attention will be given to potential medical applications and recent discoveries of skeletal
proteins and polysaccharides with biologically appealing characteristics. In addition, I will introduce
an effective protocol for sample preparation and protein purification that includes isolation technology
for biopolymers (of both soluble and insoluble organic matrices) from coralline algae. These algae
are a widespread but poorly studied group of shallow marine calcifiers that have great potential for
marine drug discovery.
Keywords: biomineralization; coralline algae; chitin; collagen; marine calcifiers; marine skeletal
proteins; proteomics
1. Introduction
Skeletal proteins and polysaccharides in marine organisms are present as complex mixtures
within organic matrices. The organic matrices of marine calcifiers, for example, are a potentially
untapped source of skeletal proteins [1–6]. Organic matrices have the advantage of being naturally
produced, retaining the native, functional conformation of the original proteins. Moreover, a significant
number of calcifying marine invertebrates produce polysaccharides within their extracellular
matrices and connective tissues [7,8] that have molecular structures and functions similar to human
versions [1,6]. Polysaccharides derived from marine invertebrate extracellular matrices encompass an
enormous variety of structures and should be considered as an extraordinary source of biochemical
diversity. However, they remain largely under-exploited with respect their potential in medical
applications [9,10]. Macromolecules derived from marine calcifiers that hold promise for biomedical
applications include a broad range of protein and sugar (carbohydrates and lectins) molecules that
participate in signaling, development, regeneration, and metabolism.
Mar. Drugs 2016, 14, 167
52
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2016, 14, 167
It is has been hypothesized that marine skeletal proteins that function in biomineral growth,
maintenance, and repair could facilitate tissue engineering. For example, some of these proteins with
human physiological activity can help accelerate lab-based bone morphogenesis and increase bone
volumes with efficacies equivalent to currently used recombinant proteins [1]. Proteins with potential
for bone repair and drug discovery, extracted either from naturally occurring skeletal organic matrices
or derived from cultivated tissues, can be identified and isolated using chromatography, cell assays and
proteomic methods [1,9,11]. Proteomics is a high-throughput analytical method for rapidly identifying
known or unknown proteins in complex mixtures [5]. If purification methods can be established
for skeletal proteins derived from calcifying marine organisms, researchers in the emerging fields of
proteomics and medicinal chemistry could utilize these methods for subsequent drug discovery and,
as a more specific example, bone repair. Currently, primary sequences of different skeletal proteins
from marine organisms are available in public databases, and this information can be used to infer the
biological function and origin of individual proteins and provide clues related to the mechanisms of
formation of any skeleton.
Pharmaceutical industries now accept the world’s oceans as a major frontier for medical research.
The emergence of this relatively new area of scientific exploration has been of enormous interest to the
popular and scientific press, and several review publications have appeared on the topic [1,9,11]. In the
review presented here, we focus on recent progress in the discovery and production of new marine
skeletal proteins and polysaccharides of pharmaceutical interest. We also introduce a new technique for
purifying compounds derived from the skeletal organic matrices of coralline algae that will be useful
for proteomic analysis and purifying biopolymers such as chitin and collagen. Overall, this review
demonstrates the existence of unique biomineralization-related skeletal proteins in marine calcifiers
that hold promise for drug development, and moreover, provides the first description of proteinaceous
components in coralline red algae.
2. Applications and Modification Strategies of Marine Skeletal Proteins for Drug Discovery
Marine calcifiers (shallow, mid-shelf, and deep sea) are widespread in oceans globally. However,
due to the lack of effective extraction/analytical methods, the applications of these potential resources
for drugs are comparatively fewer than for other marine organisms. Recently, we perceived protein
induced crystallization [2,7,8,12,13], which showed potential crystal design and growth that could help
medicinal chemistry in drug design. Our primary chemical proteomic results from soft coral revealed
a number of molecules with high concentrations [5,14]. In addition, some proteins extracted from soft
corals are homologous with many human proteins, making them useful due to their similarity [15,16].
The information with respect to the close homology of soft coral and human proteins provides us
functional and evolutionary clues on the structure and functions of their sequences. These homologous
proteins could lead to possible drug discovery and form a potential resource for biotechnological
research. It is our hope that further sequence studies of these materials will contribute to a better
understanding of structural proteins in soft corals. Bioassay-directed fractionation of octocoral
Cespitularia hypotentaculata, which has a novel endoskeleton, yielded the diterpene cespitularin
A–D, the norditerpene cespitularin E and three other diterpenes, cespitularin F–H [17]. Two new
dolabellane-type diterpenoids and the known diterpene clavenone [18] were isolated from a octocoral
Clavularia species [19]. A saponin compound was isolated from the octocoral Lobophytum spp.,
which was collected from Hainan Island, China.
Among the marine calcifiers, very few scleractinian corals were investigated. In a recent review,
the authors discussed the potential of scleractinian coral, which has therapeutic characteristics,
including anti-inflammatory properties, anticancer properties, bone repair, and neurological benefits [6].
Research on the scleractinian coral Montipora spp. from the republic of Korea (South Korea)
found three diacetylenes (1, 4, 6). One of these was a potent cytotoxin with respect to a range
of tumor cell lines [20]. The authors tested the extracted compounds against a panel of human
cancer cell lines and the structures have been interpreted on the basis of spectroscopic evidence.
53
Mar. Drugs 2016, 14, 167
These three compounds showed a structural activity profile to similar to those previously reported [21].
The results showed that the compound 6 with b-hydroxy ketone functionality has strong cytotoxic
properties and Methyl montiporate C (1) was active only against a skin cancer cell line, while
compound 4 was moderately active. Extracts from the calcifying octocorals Pseudopterogorgia elizabethae
(which contains pseudopterosins) and Eunicea fusca (which contains fucoside-A) can be used in
the cosmetic industry [22]. Similarly, coral (endoskeletons and exoskeletons) and coralline algal
skeletons could be used for cosmetics as both contain a high concentration of organic matrix
components [7,13,23].
In recent years, numerous applications have been proposed for chitosan-based delivery
devices [24–26], however, most of these were unrelated to marine calcifiers. Chitosan is a copolymer of
β-(1-4)-linked 2-acetamido-2-deoxy-D-glucopyranose and 2-amino-2-deoxy-D-glucopyranose, obtained by
deacethylation of the naturally occurring chitin. Chitin was firstly extracted from the exoskeleton of
marine organisms, mainly crabs and shrimps, as described by Burrows [27]. This polymer has also
recently been extracted from coralline algae [7], which opened the doors for possible applications
of these biomaterials using a group of marine calcifers which are found in shallow water and are
easy-to-collect, abundant and widespread. The major applications of chitosan are for biomaterials,
pharmaceuticals, foodstuff treatment (e.g., flocculation, clarification, etc., due to its efficient interaction
with other polyelectrolytes), cosmetics, metal ion sequestration, and agriculture [28–31]. Development of
chitosan chemistry has relevant biomedical applications, particularly in the field of drug delivery [32].
While chitin is insoluble in most common solvents, chitosan can be readily turned into fibers as
well as films, or triggered in a variety of micromorphologies from its acidic aqueous solutions.
Protein-polysaccharides play an important role in biomedical and pharmaceutical applications.
However, at times the properties of such biomaterials do not meet the needs for exact applications.
As a result, approaches that chemically or physically modify their structure and, thus, physical-chemical
properties are increasingly gaining interest [33,34]. With respect to the polysaccharides’ chitin and
chitosan, it is possible to target the reaction using sulfur trioxide-pyridine at two sites or at only
one specific site, following different pathways of synthesis [35]. Great efforts have thus focused
on the progress of efficient modification reactions in well-controlled conditions under tolerable
temperatures [35]. For example, modification reactions of water-soluble chitin can be conducted
in aqueous solutions or in organic solvents in an engorged state under mild conditions, and selective
N-acetylation [35]. Some significant chemical reactions of acylation, alkylation, Schiff base formation
and reductive N-alkylation, carboxyalkylation, N-phthaloylation are well described [35].
3. A Promising Future for Marine Calcifiers in Drug Discovery
Marine resources such as coral, mollusk and coralline algae could be a major source of medicines
over the next decades. It is estimated that marine ecosystems, such as those found in coral reefs or at
a deep sea level have greater biological diversity than those of tropical rain forests. However, as with
tropical rain forests, coral reefs represent considerable untouched potential in the science of medicine.
At present, marine calcifier collection and drug appraisal occurs successfully. However, there is
no question that these resources are inadequate and it is possible that collectable marine organisms will
be almost completely explored within the next 20 years. There is still a doubt as to where scientists will
turn in order to ensure a continuing flow of new medicines. The solution is difficult, however drugs
can now be developed using many methods such as computer-aided design, combinatorial synthesis
and proteomics. The chemical multiplicity of marine ecosystems, from simple to complex peptide
and protein extraction, draws us in the direction of the discovery of new marine natural products in
various therapeutic areas such as cancer, inflammation, microbial infections, and various other deadly
diseases [36]. Cancer is the biggest challenge of the current century, and marine calcifying organisms
show new promise in fighting against this and other dangerous diseases.
54
Mar. Drugs 2016, 14, 167
4. A Novel Approach to Isolation, Purification and Characterization of Marine Skeletal Proteins
Isolation and purification of skeletal proteins from marine calcifiers are complex because of
the potential for contamination of the soft tissues and the high sensitivity of organic matrices to
handling. However, successfully purified skeletal proteins from several groups of marine calcifiers
have recently emerged [4,5,14,22,23,37]. The overview concerning marine skeletal proteins presented
above allows us to understand some newly developed techniques [5,12,14–16,23,38–40] as well as
useful methods for isolating and purifying skeletal proteins and proteomic analysis. Among marine
calcifiers, we recently investigated coralline red algae, which has specific biological characteristics [7]
and contains high concentrations of soluble organic matrix (SOM) and insoluble organic matrix (IOM)
fractions. High concentrations of both chitin and collagen biopolymers are present in SOM and IOM
(Figure 1). Coralline algal concentrations of SOM (0.9%) and IOM (4.5%) are significantly higher
than those of other skeletal marine calcifiers such as octocorals, with SOM and IOM concentrations
of 0.03% and 0.05%, respectively [5,13,15]. The highly concentrated biopolymers present in skeletal
organic matrices open up the possibility for future drug development, because these two polymers are
frequently utilized in drug design [24,29–31,41–46].
Figure 1. Identification of chitin and collagen in algal skeletal protein-polysaccharides complexes.
Structural comparison of FTIR spectra between organic matrix fractions (soluble organic matrix (SOM)
and insoluble organic matrix (IOM)) and bulk skeletal powder. Graphs for SOM, IOM fractions and
bulk skeletal powder are indicated. Different colored boxes in the spectra indicate involvement of
molecules in SOM and IOM fractions in forming skeletal structure in coralline algal calcification system.
(Reproduced from Scientific Reports, Rahman and Halfar 2014 [7]).
Detailed geochemical studies of coralline algae [47–51] provide a broad spectrum of
environmental and structural background information. However, there is a lack of information on
the protein-polysaccharide complex in the coralline algal skeleton, which plays a key role in the
regulation of biocalcification [7] and may contain prospective biomaterials for drug development.
Hence, we have developed a useful technique from sample preparation to protein isolation for
the Sub-Arctic coralline alga Clathromorphum compactum (Figure 2, see Ref. [7] for details) using
recently developed analytical approaches for other marine calcifiers (Figure 2, References [5,12,23]).
We characterized the SOM-polysaccharide complex from its CaCO3 skeleton, which is involved in
the biocalcification process. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
55
Mar. Drugs 2016, 14, 167
analysis [52] of the preparations [5,14,23] showed two bands of proteins with molecular masses of
250-kDa and 30-kDa (Figure 3A, lane 1 and 2). The protein with molecular masses of 30-kDa was
by far the most abundant protein, whereas the 250 kDa protein band was weak and somewhat
faint (Figure 3A, lane 2). Periodic acid-Schiff (PAS) staining was used to identify chitin associated
glycoproteins. Interestingly, the 250-kDa protein was identified with high abundance as the only
glycoprotein contained in the skeleton (Figure 3B, lane 1 and 2), even though it only appeared as
a weak band in Coomassie Brilliant Blue (CBB) staining solution (Figure 3A). Chitin is the main
component of the protein-polysaccharide complex of cell walls [7,53,54]), which is also composed of
glycoprotein [55]. Protein-polysaccharide complexes are also present in coralline algal cell structures [7].
Therefore, detection of a strong glycosylation protein in coralline algal skeletons reveals the presence
of highly abundant chitin. The chitin found in coralline alga has been recognized to be involved in the
calcification process [7] and this polymer is considered highly useful for drug design [24,29–31,41–46].
Our observations therefore strongly suggest that the skeletal matrix proteins in coralline alga are not
only a structural protein but also have potential for drug development.
Figure 2. Model of general strategy for analyzing protein-polysaccharides complex from skeletal
organic matrix of marine calcifiers.
56
Mar. Drugs 2016, 14, 167
Figure 3. Electrophoretic analysis of skeletal matrix proteins extracted from the coralline red alga
C. compactum. (A) SDS-PAGE fractionation with Coomassie Brilliant Blue (CBB) staining after
purification of the skeletal proteins. Lane 1 and 2 indicate purified skeletal proteins. Arrows indicate
protein bands; (B) SDS-PAGE gel with Periodic Acid-Schiff (PAS) staining to identify glycoprotein in
skeletal matrix proteins of C. compactum. Lane 1 and 2, a strong abundant chitin associated glycoprotein
was identified (indicated by arrow) by periodic Acid-Schiff staining. An eluate (derived from 5 g of
algal skeleton) was run on 12% polyacrylamide gel M, protein marker. The Precision Plus SDS-PAGE
standard (Bio-Rad) was used as protein marker for electrophoresis.
5. Conclusions
In this brief review, recent advances in applications of protein-polysaccharides of marine calcifiers
in the medical and pharmaceutical fields have been discussed. The results demonstrate the potential
for marine calcifiers to generate new drugs. Understanding the proteinaceous components of marine
calcifiers is an important step toward advancing the science of marine medicinal chemistry. Among the
different sources of polysaccharides, algal polysaccharides such as chitin and collagen could play an
important role in future development of tissue engineering, bone regeneration, and much more. In light
of these emerging findings, in the near future established techniques may also be potentially useful
for isolating skeletal proteins from similar marine calcifiers for drug discovery. As a discovery-driven
science, the techniques discussed here allow researcher to identify candidate proteins for drug
discovery and identify unknowns without missing unanticipated interactions. These techniques
can be employed to dramatically improve the range of applications within the field of marine drug
discovery. Since the marine realm consists of diverse ecosystems and matrices in which these proteins
reside, the development of effective methods for accessing proteins will be a continuing challenge in
future years.
Acknowledgments: The author thanks Jochen Halfar for providing coralline samples. The author also thanks
Steven Short for providing electrophoresis apparatus.
Conflicts of Interest: The author declares no conflict of interest.
References
1.
2.
Green, D.W.; Padula, M.P.; Santos, J.; Chou, J.; Milthorpe, B.; Ben-Nissan, B. A therapeutic potential for
marine skeletal proteins in bone regeneration. Mar. Drugs 2013, 11, 1203–1220. [CrossRef] [PubMed]
Rahman, M.A.; Fujimura, H.; Shinjo, R.; Oomori, T. Extracellular matrix protein in calcified endoskeleton:
A potential additive for crystal growth and design. J. Cryst. Growth 2011, 324, 177–183. [CrossRef]
57
Mar. Drugs 2016, 14, 167
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
Rahman, M.A.; Isa, Y.; Uehara, T. Proteins of calcified endoskeleton: Ii partial amino acid sequences
of endoskeletal proteins and the characterization of proteinaceous organic matrix of spicules from the
alcyonarian, synularia polydactyla. Proteomics 2005, 5, 885–893. [CrossRef] [PubMed]
Drake, J.L.; Mass, T.; Haramaty, L.; Zelzion, E.; Bhattacharya, D.; Falkowski, P.G. Proteomic analysis of
skeletal organic matrix from the stony coral stylophora pistillata. Proc. Natl. Acad. Sci. USA 2013, 110,
3788–3793. [CrossRef] [PubMed]
Rahman, M.A.; Karl, K.; Nonaka, M.; Fujimura, H.; Shinjo, R.; Oomori, T.; Worheide, G. Characterization of
the proteinaceous skeletal organic matrix from the precious coral Corallium konojoi. Proteomics 2014, 14,
2600–2606. [CrossRef] [PubMed]
Cooper, E.L.; Hirabayashi, K.; Strychar, K.B.; Sammarco, P.W. Corals and their potential applications to
integrative medicine. Evid. Based Complement. Altern. Med. 2014, 2014, 184959. [CrossRef] [PubMed]
Rahman, M.A.; Halfar, J. First evidence of chitin in calcified coralline algae: New insights into the calcification
process of clathromorphum compactum. Sci. Rep. 2014, 4, 6162. [CrossRef] [PubMed]
Rahman, M.A.; Oomori, T. In vitro regulation of CaCO3 crystal growth by the highly acidic proteins of
calcitic sclerites in soft coral, Sinularia polydactyla. Connect. Tissue Res. 2009, 50, 285–293. [CrossRef] [PubMed]
Laurienzo, P. Marine polysaccharides in pharmaceutical applications: An overview. Mar. Drugs 2010, 8,
2435–2465. [CrossRef] [PubMed]
Senni, K.; Pereira, J.; Gueniche, F.; Delbarre-Ladrat, C.; Sinquin, C.; Ratiskol, J.; Godeau, G.; Fischer, A.M.;
Helley, D.; Colliec-Jouault, S. Marine polysaccharides: A source of bioactive molecules for cell therapy and
tissue engineering. Mar. Drugs 2011, 9, 1664–1681. [CrossRef] [PubMed]
Rahman, M.A. The medicinal potential of promising marine organisms: A review. Blue Biotechnol. J. 2012,
1, 318–333.
Rahman, M.A.; Oomori, T. Analysis of protein-induced calcium carbonate crystals in soft coral by near-field
IR microspectroscopy. Anal. Sci. 2009, 25, 153–155. [CrossRef] [PubMed]
Rahman, M.A.; Oomori, T. Structure, crystallization and mineral composition of sclerites in the
alcyonarian coral. J. Cryst. Growth 2008, 310, 3528–3534. [CrossRef]
Rahman, M.A.; Shinjo, R.; Oomori, T.; Worheide, G. Analysis of the proteinaceous components of the organic
matrix of calcitic sclerites from the soft coral Sinularia sp. PLoS ONE 2013, 8, e58781. [CrossRef]
Rahman, M.A.; Isa, Y. Characterization of proteins from the matrix of spicules from the alcyonarian,
Lobophytum crassum. J. Exp. Mar. Biol. Ecol. 2005, 321, 71–82. [CrossRef]
Rahman, M.A.; Isa, Y.; Uehara, T. Studies on two closely related species of octocorallians: Biochemical and
molecular characteristics of the organic matrices of endoskeletal sclerites. Mar. Biotechnol. 2006, 8, 415–424.
[CrossRef] [PubMed]
Duh, C.Y.; Chien, S.C.; Song, P.Y.; Wang, S.K.; El-Gamal, A.A.H.; Dai, C.F. New cadinene sesquiterpenoids
from the formosan soft coral xenia puerto-galerae. J. Nat. Prod. 2002, 65, 1853–1856. [CrossRef] [PubMed]
Mori, K.; Iguchi, K.; Yamada, N.; Yamada, Y.; Inouye, Y. Bioactive marine diterpenoids from Japanese soft
coral of Clavularia sp. Chem. Pharm. Bull. 1988, 36, 2840–2852. [CrossRef] [PubMed]
Iguchi, K.; Sawai, H.; Nishimura, H.; Fujita, M.; Yamori, T. New dolabellane-type diterpenoids from the
Okinawan soft coral of the genus Clavularia. Bull. Chem. Soc. Jpn. 2002, 75, 131–136. [CrossRef]
Alam, N.; Hong, J.K.; Lee, C.O.; Choi, J.S.; Im, K.S.; Jung, J.H. Additional cytotoxic diacetylenes from the
stony coral Montipora sp. Chem. Pharm. Bull. 2002, 50, 661–662. [CrossRef] [PubMed]
Alam, N.; Bae, B.H.; Hong, J.; Lee, C.O.; Im, K.S.; Jung, J.H. Cytotoxic diacetylenes from the stony coral
Montipora species. J. Nat. Prod. 2001, 64, 1059–1063. [CrossRef] [PubMed]
Roussis, V.; Wu, Z.D.; Fenical, W.; Strobel, S.A.; Vanduyne, G.D.; Clardy, J. New antiinflammatory
pseudopterosins from the marine octocoral pseudopterogorgia-elisabethae. J. Org. Chem. 1990, 55, 4916–4922.
[CrossRef]
Rahman, M.A.; Oomori, T.; Worheide, G. Calcite formation in soft coral sclerites is determined by a single
reactive extracellular protein. J. Biol. Chem. 2011, 286, 31638–31649. [CrossRef] [PubMed]
Zhang, J.; Xia, W.; Liu, P.; Cheng, Q.; Tahirou, T.; Gu, W.; Li, B. Chitosan modification and
pharmaceutical/biomedical applications. Mar. Drugs 2010, 8, 1962–1987. [CrossRef] [PubMed]
Hejazi, R.; Amiji, M. Chitosan-based gastrointestinal delivery systems. J. Control. Release 2003, 89, 151–165.
[CrossRef]
58
Mar. Drugs 2016, 14, 167
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
Illum, L.; Jabbal-Gill, I.; Hinchcliffe, M.; Fisher, A.N.; Davis, S.S. Chitosan as a novel nasal delivery system
for vaccines. Adv. Drug. Deliv. Rev. 2001, 51, 81–96. [CrossRef]
Burrows, F.; Louime, C.; Abazinge, M.; Onokpise, O. Extraction and evaluation of chitin from crub
exoskeleton as a seed fungicide and plant growth enhancer. Am. Eurasian J. Agric. Environ. Sci. 2007,
2, 103–111.
Rinaudo, M. Chitin and chitosan: Properties and application. Prog. Polym. Sci. 2006, 31, 603–632. [CrossRef]
Da Sacco, L.; Masotti, A. Chitin and chitosan as multipurpose natural polymers for groundwater arsenic
removal and as 203 delivery in tumor therapy. Mar. Drugs 2010, 8, 1518–1525. [CrossRef] [PubMed]
Aam, B.B.; Heggset, E.B.; Norberg, A.L.; Sorlie, M.; Varum, K.M.; Eijsink, V.G. Production of
chitooligosaccharides and their potential applications in medicine. Mar. Drugs 2010, 8, 1482–1517. [CrossRef]
[PubMed]
Khoushab, F.; Yamabhai, M. Chitin research revisited. Mar. Drugs 2010, 8, 1988–2012. [CrossRef] [PubMed]
Kumar, M.N.; Muzzarelli, R.A.; Muzzarelli, C.; Sashiwa, H.; Domb, A.J. Chitosan chemistry and
pharmaceutical perspectives. Chem. Rev. 2004, 104, 6017–6084. [CrossRef] [PubMed]
Holte, O.; Onsoyen, E.; Myrvold, R.; Karlsen, J. Sustained release of water-soluble drug from directly
compressed alginate tablets. Eur. J. Pharm. Sci. 2003, 20, 403–407. [CrossRef] [PubMed]
Tonnesen, H.H.; Karlsen, J. Alginate in drug delivery systems. Drug Dev. Ind. Pharm. 2002, 28, 621–630.
[CrossRef] [PubMed]
Kurita, K. Chitin and chitosan: Functional biopolymers from marine crustaceans. Mar. Biotechnol. 2006,
8, 203–226. [CrossRef] [PubMed]
Rawat, D.S.; Joshi, M.C.; Joshi, P.; Atheaya, H. Marine peptides and related compounds in clinical trial.
Anticancer Agents Med. Chem. 2006, 6, 33–40. [CrossRef] [PubMed]
Mann, K.; Poustka, A.J.; Mann, M. In-depth, high-accuracy proteomics of sea urchin tooth organic matrix.
Proteome Sci. 2008, 6, 33. [CrossRef] [PubMed]
Cusack, M.; Freer, A. Biomineralization: Elemental and organic influence in carbonate systems. Chem. Rev.
2008, 108, 4433–4454. [CrossRef] [PubMed]
Debreuil, J.; Tambutte, E.; Zoccola, D.; Deleury, E.; Guigonis, J.M.; Samson, M.; Allemand, D.; Tambutte, S.
Molecular cloning and characterization of first organic matrix protein from sclerites of red coral,
Corallium rubrum. J. Biol. Chem. 2012, 287, 19367–19376. [CrossRef] [PubMed]
Rahman, M.A.; Oomori, T.; Uehara, T. Carbonic anhydrase in calcified endoskeleton: Novel activity in
biocalcification in alcyonarian. Mar. Biotechnol. 2008, 10, 31–38. [CrossRef] [PubMed]
Ruiz-Herrera, J.; San-Blas, G. Chitin synthesis as target for antifungal drugs. Curr. Drug Targets Infect. Disord.
2003, 3, 77–91. [CrossRef] [PubMed]
Chaudhary, P.M.; Tupe, S.G.; Deshpande, M.V. Chitin synthase inhibitors as antifungal agents. Mini Rev.
Med. Chem. 2013, 13, 222–236. [CrossRef] [PubMed]
Reese, T.A.; Liang, H.E.; Tager, A.M.; Luster, A.D.; van Rooijen, N.; Voehringer, D.; Locksley, R.M.
Chitin induces accumulation in tissue of innate immune cells associated with allergy. Nature 2007, 447, 92–96.
[CrossRef] [PubMed]
Natali, I.; Tempesti, P.; Carretti, E.; Potenza, M.; Sansoni, S.; Baglioni, P.; Dei, L. Aragonite crystals grown
on bones by reaction of CO2 with nanostructured Ca(OH)2 in the presence of collagen. Implications in
archaeology and paleontology. Langmuir 2014, 30, 660–668. [CrossRef] [PubMed]
Addad, S.; Exposito, J.Y.; Faye, C.; Ricard-Blum, S.; Lethias, C. Isolation, characterization and biological
evaluation of jellyfish collagen for use in biomedical applications. Mar. Drugs 2011, 9, 967–983. [CrossRef]
[PubMed]
Yang, T.L. Chitin-based materials in tissue engineering: Applications in soft tissue and epithelial organ. Int. J.
Mol. Sci. 2011, 12, 1936–1963. [CrossRef] [PubMed]
Halfar, J.; Adey, W.H.; Kronz, A.; Hetzinger, S.; Edinger, E.; Fitzhugh, W.W. Arctic sea-ice decline archived by
multicentury annual-resolution record from crustose coralline algal proxy. Proc. Natl. Acad. Sci. USA 2013,
110, 19737–19741. [CrossRef] [PubMed]
Adey, W.H.; Halfar, J.; Williams, B. The coralline genus clathromorphum foslie emend. Adey: Biological,
physiological, and ecological factors controlling carbonate production in an arctic-subarctic climate archive.
Smithson. Contrib. Mar. Sci. 2013, 40, 1–41. [CrossRef]
59
Mar. Drugs 2016, 14, 167
49.
50.
51.
52.
53.
54.
55.
Ries, J.B.; Anderson, M.A.; Hill, R.T. Seawater Mg/Ca controls polymorph mineralogy of microbial caco3:
A potential proxy for calcite-aragonite seas in precambrian time. Geobiology 2008, 6, 106–119. [CrossRef]
[PubMed]
Ries, J.B.; Cohen, A.L.; McCorkle, D.C. Marine calcifiers exhibit mixed responses to CO2 -induced
ocean acidification. Geology 2009, 37, 1131–1134. [CrossRef]
Halfar, J.; Zack, T.; Kronz, A.; Zachos, J.C. Growth and high-resolution paleoenvironmental signals of
rhodoliths (coralline red algae): A new biogenic archive. J. Geophys. Res. 2000, 105, 22107–22116. [CrossRef]
Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature
1970, 227, 680–685. [CrossRef] [PubMed]
Banks, I.R.; Specht, C.A.; Donlin, M.J.; Gerik, K.J.; Levitz, S.M.; Lodge, J.K. A chitin synthase and its regulator
protein are critical for chitosan production and growth of the fungal pathogen cryptococcus neoformans.
Eukaryot. Cell 2005, 4, 1902–1912. [CrossRef] [PubMed]
Sendbusch, P.V. Cell Walls of Algae. Available online: https://s10.lite.msu.edu/res/msu/botonl/b_online/
e26/26d.htm (accessed on 8 September 2016).
Lipke, P.N.; Ovalle, R. Cell wall architecture in yeast: New structure and new challenges. J. Bacteriol. 1998,
180, 3735–3740. [PubMed]
© 2016 by the author. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
60
marine drugs
Review
Marine Microbiological Enzymes: Studies with
Multiple Strategies and Prospects
Yan Wang, Qinghao Song and Xiao-Hua Zhang *
College of Marine Life Sciences, Ocean University of China, Qingdao 266003, China;
wangy12@ouc.edu.cn (Y.W.); 016080910050@sjtu.edu.cn (Q.S.)
* Correspondence: xhzhang@ouc.edu.cn; Tel./Fax: +86-532-82032767
Academic Editor: Se-Kwon Kim
Received: 12 July 2016; Accepted: 14 September 2016; Published: 22 September 2016
Abstract: Marine microorganisms produce a series of promising enzymes that have been widely
used or are potentially valuable for our daily life. Both classic and newly developed biochemistry
technologies have been broadly used to study marine and terrestrial microbiological enzymes.
In this brief review, we provide a research update and prospects regarding regulatory mechanisms
and related strategies of acyl-homoserine lactones (AHL) lactonase, which is an important but
largely unexplored enzyme. We also detail the status and catalytic mechanism of the main types of
polysaccharide-degrading enzymes that broadly exist among marine microorganisms but have been
poorly explored. In order to facilitate understanding, the regulatory and synthetic biology strategies
of terrestrial microorganisms are also mentioned in comparison. We anticipate that this review will
provide an outline of multiple strategies for promising marine microbial enzymes and open new
avenues for the exploration, engineering and application of various enzymes.
Keywords: AHL lactonase; polysaccharide-degrading enzymes; marine microorganism
1. Introduction
Microorganisms produce series of enzymes [1–3]. Given the complicated diversity and ease of
large-scale fermentation, microorganisms are widely used in the exploration of enzyme resources.
In recent decades, bacteria and fungi from the terrestrial environment have served as the most
important and best-studied sources for promising industrial enzymes and secondary metabolites.
Recent technological developments have made it easier to utilize marine resources, especially from
the deep sea [4,5]. The ocean occupies greater than 70% of total surface of the earth, thus serving as
a habitat for numerous microorganisms with vast diversity. The special environmental conditions,
involving low temperature, low light, high pressure and high salinity, give marine residents multiple
novel characteristic features, which have been attracting increasing attention from marine biologists.
Correspondingly, these organisms also produce various novel enzymes and secondary metabolites,
some of which have already been used as food additives and potential drugs [6–8]. For example,
various PKS (polyketide synthase) and NRPS (non-ribosomal peptide synthetase) enzymes responsible
for producing secondary metabolites have been identified in marine bacteria, particularly Streptomyces,
and fungi in recent years [9–12]. However, compared to terrestrial resources, marine microbial
resources, e.g., amylase and alginate lyase, are largely unexplored, although this pool of marine
resources is huge. Moreover, the regulatory mechanisms of promising genes and signaling pathway
cascades of marine microorganisms are also largely unknown.
In this review, we provide a brief description of two types of promising marine enzymes:
acyl-homoserine lactones (AHL) lactonase and polysaccharide-degrading enzymes. We will present
the recent research progress regarding these enzymes and discuss potential strategies for further
Mar. Drugs 2016, 14, 171
61
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2016, 14, 171
studies. Using well-studied terrestrial microorganisms as references, we hope to open new avenues of
exploration, engineering and regulatory mechanisms of marine enzymes.
2. AHL Lactonase
2.1. Introduction
Quorum sensing is a population-dependent reaction for microorganisms that occurs via the
up/down-regulation of downstream gene expression [13]. The process is also essential for biofilm
formation and the secretion of virulence factors, especially in pathogenic bacteria, and causes a series of
bacterial diseases [14]. Correspondingly, quorum-quenching technology is an environmentally friendly
strategy for disease control [15,16]. AHL lactonase, which degrades molecular N-acyl homoserine
lactone (AHL) signals, is one of the two types of enzymes involved in quorum quenching (Figure 1).
AHL lactonase can open the lactonic ring, and the ring-open molecule is ineffective and cannot
reorganize downstream receptor proteins. Several AHL lactonases have been isolated and well-studied
in recent years (Table 1). The first reported and well-studied AHL lactonase is AiiA, which inhibits the
pathogenic bacterium Erwinia carotovora and other plant-related pathogenic bacteria with considerably
high activities [17,18]. AiiA is one type of metalloprotein that contains the highly conserved amino
acid sequence HXDH-H-D, which serves as a zinc-binding site [17,18]. The conserved sequence is also
present in a series of AHL lactonase family members and is essential for normal protein activity [19].
Previous studies revealed that the combination of a yeast strain overexpressing AiiA and the pathogenic
bacterium Aeromonas hydrophila significantly decreased the death rate of cultivated carp [20,21].
In addition, AiiA, AiiB, AttM, AhlD, QsdA, AiiM and AidH were cloned and characterized from soil
Bacillus, Agrobacterium, Arthrobacter, Rhodococcus, Microbacterium and Ochrobactrum, respectively [22–28].
All of these AHL lactonases were from terrestrial bacteria (Figure 2).
Table 1. Properties of well-studied acyl-homoserine lactones (AHL) lactonase.
QQ Enzyme
Length (aa)
Predictable Domains
Signal Peptide
Host Organisms
Origin
Structure
References
AiiA
AiiB
AttM
QsdA
AidH
GKL
MomL
QsdH
231aa
276aa
295aa
323aa
279aa
330aa
293aa
968aa
Beta-lactamase family (15–216)
Beta-lactamase family (42–259)
Beta-lactamase family (78–282)
Phosphotriesterase family (11–322)
Alpha/beta hydrolase (25–147)
Phosphotriesterase family (16–329)
Beta-lactamase family (72–277)
AcrB/AcrD/AcrF family (182–964)
No signal
No signal
1–17
No signal
No signal
No signal
1–21
1–23
Bacillus
Agrobacterium
Agrobacterium
Rhodococcus
Ochrobactrum
Geobacillus
Muricauda
Pseudoalteromonas
terrestrial
terrestrial
terrestrial
terrestrial
terrestrial
terrestrial
oceanic
oceanic
3DHB
unknown
unknown
unknown
unknown
unknown
unknown
unknown
[18]
[22]
[25]
[24]
[27,28]
[26]
[29]
[30]
Figure 1. Catalytic mechanism of quorum quenching enzymes.
62
Mar. Drugs 2016, 14, 171
Figure 2. Distribution of AHL lactonase (left), amylase (middle) and alginate lyase (right).
Calculation method of the percentage: The reported enzymes were bioinformatic analyzed and
classified based on different species source.
2.2. Marine Resources of AHL Lactonase and Research Methods
Only a few types of AHL lactonases have been discovered from marine environments.
QsdH, which was discovered from marine Pseudoalteromonas, is not a single protein but combines
with a special transporter of small molecules that belongs to the resistance-nodulation-cell
division (RND) superfamily [30]. It is promising to exploit the quorum-quenching enzymes from
relatively unknown marine environments. Several new methods have been studied for quorum
quenching enzymes exploration. Recently, our group developed a novel high-throughput strategy
for identifying bacterial strains with quorum-quenching activity [31]. This method (A136 liquid
X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside) assay) is based on the measurement of
residual AHL molecules after the reaction (Figure 3). Compared with previous strategies, the main
improvement of the A136 liquid X-gal assay involves the detection of β-galactosidase activity in a
rapid and quantitative manner. Although the ONPG assay (2-nitrophenyl β-D-galactopyranoside) is
a broadly approved strategy to measure β-galactosidase activity, the complex process of the ONPG
assay causes low throughput and relatively poor efficiency [31]. However, the A136 liquid X-gal
assay can be performed in a 96-well plate layout with one-step detection of enzymatic activity in a
high-throughput manner. With the A136 liquid X-gal assay, 25 quorum-quenching bacterial strains
belonging to different species were identified from hundreds of candidate marine bacterial strains.
Additionally, with this method, several genera with quorum quenching activity, such as Flaviramulus,
Muricauda and Rhodobacter, were identified [31].
63
Mar. Drugs 2016, 14, 171
ȱ
Figure 3. Schematic diagram of high-throughput method for identifying quorum quenching bacteria.
The Gram-negative strain Muricauda olearia Th120, which was isolated from Paralichthys olivaceus,
exhibits high-level quorum-quenching activity. Sequencing and bioinformatic results demonstrate that
the genome contains a gene encoding AHL lactonase named MomL. MomL consists of 294 amino acids
with a molecular weight of approximately 38.4 KDa [29]. MomL belongs to the metallo-β-lactamase
family, and the homolog exhibits a 24.5% similarity with AiiA. In addition to containing the
conserved ion-binding site HXDH-H-D, MomL possesses two additional novel characteristic features:
(1) the protein possesses one special signal peptide consisting of 21 amino acids at the N-terminus
of the sequence that presumably facilitate the protein secretory ability; (2) The highest amino
acid identity compared with other terrestrial homologs is only approximately 20%. Using the
pTWIN1 vector, MomL protein was heterologously-expressed and purified, and the expected
approximately 30 KDa band was observed in SDS-PAGE (SDS-polyacrylamide gel electrophoresis).
LC-MS (liquid chromatography-mass spectrometry) results demonstrated that MomL degrades C6 or
C12-HSL to linear products by hydrolyzing lactonic rings. In vitro enzyme assays indicated that MomL
possesses high activity and broad substrate selectivity. Kinetic results indicated MomL had 10-fold
increased C6-HSL (C6-homoserine lactones) degrading activity compared with AiiA protein [29].
Moreover, using several developed and promising technologies, we performed the following
assays using MomL. First, we performed directed evolution of MomL (Figure 4). Although this
strategy is not broadly used to engineer marine microbial enzymes, the strategy has been widely used
in terrestrial microorganisms. Using directed evolution, Yi Tang’s group at the University of California
Los Angeles enhanced the activity of LovD up to 11-fold, which is an acyltransferase that converts
64
Mar. Drugs 2016, 14, 171
the inactive secondary metabolite monacolin J acid into the cholesterol-lowering lovastatin [32].
Regarding the directed mutation strategy, the first step involves constructing a random mutation
gene pool of the target protein. To maintain the activity of the mutated protein, the mutation rate was
controlled by adjusting the error-prone PCR and sequential error-prone PCR protocols. A mutation
rate of 1 to 3 mutated points in every 100 amino acids was suitable for an ideal gene pool [32].
Several screening strategies could be used for positive mutation selection of different proteins with
improved activity. These strategies can be easily used for MomL engineering when combined with the
high-throughput selection method described above.
ȱ
Figure 4. Schematic diagram of directed evolution assay. (A1V means alanine was replaced by valine).
Another novel research area for marine microbial enzymes involves gene regulation and signaling
cascade pathways. Regulatory studies may aid in the exploration of silencing functional genes
and identifying positive regulatory elements of target genes. After identifying positive regulatory
genes, another important strategy involves synthetic biology. Through the construction of vectors
overexpressing positive regulatory genes, the transcriptional level of the target gene is upregulated,
and enzymatic expression is increased. The study of synthetic biology and related research in marine
microorganisms is also a relatively new area compared with terrestrial microorganisms. Instead of
reviewing marine bacteria, we use soil bacteria as references. Lysobacter, a genus of Gram-negative
gliding bacteria, has emerged as a novel group of biocontrol agents [33]. Additionally, these species
are a new bacterial source of bioactive natural products [34,35]. Liangcheng Du’s laboratory at the
University of Nebraska-Lincoln developed a simple method to identify target transformants based
on yellow to black color change as a selection marker [36]. Using this special overexpression vector,
these researchers constructed various vectors that overexpressed a positive regulator gene identified
65
Mar. Drugs 2016, 14, 171
in the WAP-8294A biosynthetic gene cluster that acted as a potent anti-MRSA (Methicillin-resistant
Staphylococcus aureus) antibiotic [37], and another regulator gene from the HSAF (Heat Stable Antifungal
Factor) biosynthetic gene cluster that acted as an antifungal compound with a novel mode of
action [38,39]. The enzymes that produced both WAP-8294A2 and HSAF were upregulated in the strain
with overexpressed TonB-dependent receptor, and the production of WAP-8294A and HSAF increased
by 2-fold and 7-fold, respectively, compared with the wild type. This work represents a successful
metabolic engineering technique in a terrestrial microorganism that can also be used to manipulate
unexplored marine bacteria enzyme sources.
Signal molecules regulate the transcriptional level of multiple genes, which serves as
an additional strategy for exploring functional genes, especially for discovery of silenced gene clusters.
This strategy is also relatively newly developed for marine microorganisms compared with soil
studies. Recently, with Lysobacter, researchers identified a small molecule metabolite (LeDSF3) that
regulates the biosynthesis of HSAF [40]. The addition of LeDSF3 in L. enzymogenes cultures increases
HSAF biosynthetic gene transcription and HSAF yield. Additionally, the researchers identified the
signaling cascade pathway. LeDSF3-regulated HSAF transcription and production are dependent
on the two-component regulatory system, RpfC/RpfG (histidine kinase sensor/response regulator).
Moreover, the global regulator cAMP receptor-like protein, which is a product of the clp gene, is
another essential element in this signaling cascade pathway [40]. In addition to LeDSF3, AHL,
indole, diffusible signal factor (DSF), yellow pigments and several other small molecules regulate the
transcription of enzyme-encoding genes (Figure 5) [41–46]. We have used these strategies to identify
the signal cascade of MomL, and the experiment is ongoing with promising progress.
ȱ
Figure 5. The list of well-known signal molecules.
66
Mar. Drugs 2016, 14, 171
2.3. Prospects for AHL Lactonase
Quorum quenching strategy is attracting increased attentions. AHL lactonase, as one kind of
quorum quenching enzyme, can be applied in a range of industries. For instance, it can be used in
biological control and aquaculture fields to inhibit the toxicities of pathogenic bacterium. It can be
used as antistaling agents of fruits and vegetables during long-distance transport. Also, this novel
quorum quenching enzyme will be widely applied in antifouling fields to inhibit the formation of
bacterial biofilm. Marine-derived AHL lactonase is under highly undeveloped state. Through the
updated techniques and methods mentioned above, it is believed that more enzyme resources will be
exploited for various applications.
3. Amylase
3.1. Introduction
Starch, an important component of the human diet, is one of the main energy storage
forms of commercial crops, such as wheat, rice, corn, potatoes and cassava. Based on structure,
starches are categorized as amylose and amylopectin. Amylose is linked by a α-1,4 glucosidic
bond, whereas amylopectin is linked by a α-1,6 branch bond as well as a α-1,4 linked bond [47].
Currently, acid-catalyzed hydrolysis and enzyme-catalyzed hydrolysis are the main methods of
amylo-degradation. Compared with acid-catalyzed hydrolysis, enzyme-catalyzed hydrolysis exhibits
considerable advantages, such as substrate specificity and low-energy consumption. Here we listed
the properties of well-studied and representative alpha-amylases (Table 2).
67
Stain
UniProtKB
Molecular
Mass (kDa)
Signal Peptide
(aa)
Temperature
Optimum (◦ C)
49
35
50
Thermostabiliy
Luteimonas abyssi
NM
Bacillus licheniformis
Q208A7
55
29
90
Bacillus amyloliquefaciens
Alteromonas haloplanctis
A23
Bacillus sp. strain
KSM-K38
P00692
54.8
31
60
34%, 50 ◦ C,
20 min
Clear halos,
◦
100 C, 120 min
NM
P29957
50
24
25
6%, 25 ◦ C
68
20%, 50 ◦ C,
30 min
71%, 50 ◦ C,
30 min
NM
25%, 80 ◦ C,
10 min
18%, 55 ◦ C,
30 min
37%, 60 ◦ C,
2 h (−Ca),
78%, 60 ◦ C,
2 h (+Ca)
pH
Optimum
pH Stability
Specific Activity
with Soluble
Starch (U/mg)
9
>50%, 6–11,
50 ◦ C, 1 h
8881 a
[48]
NM
NM
NM
[49]
NM
NM
NM
[50]
7
NM
NM
Q93I48
55
21
55–60
alkaliphilic bacterium N10
Q6WUB6
61
31
50
8.0–9.5
Bacillus sp. XAL601
Q45643
225
31
70
Bacillus sp.
O82839
53
31
55
Nocardiopsis sp. 7326
NM
55
NM
35
Bacillus sp. strain GM8901
NM
97
NM
60
Bacillus sp. NRRL B-3881
NM
NM
NM
50
50%, 55 ◦ C
9.2
4
9.5
9.0
8.0–8.5
8.0
11–12
Bacillus acidicola
J9PQD2
62
no signal
60
50%, 90 ◦ C,
10 min
Lipomyces kononenkoae
Q01117
76
28
70
0, 70 ◦ C, 10 min
4.5–5.0
Alicyclobacillus
acidocaldarius
C8WUR2
160
23
75
NM
3
Bacillus sp. Ferdowsicous
P86331
53
NM
70
Bacillus acidocaldarius
NM
68
NM
75
Aspergillus penicillioides
Talaromyces pinophilus 1–95
NM
NM
42
58
NM
NM
80
55
Thermococcus sp. HJ21
B4X9V8
51.4
NM
95
Malbranchea cinnamomea
K9L8F3
60.3
21
65
75%, 75 ◦ C,
45 min
50%, 60 ◦ C, 5
days
60%, 100 ◦ C
<45 ◦ C, 1 h
50%, 90 ◦ C, 5 h,
40%, 30%;
100 ◦ C; 2 h, 3 h
50%, 60 ◦ C,
41.1 min
>80%, 6–11,
40 ◦ C, 30 min
>80%, 8.5–11,
50 ◦ C, 10 min
NM
>50%, 6–9,
40 ◦ C, 30 min
>60%, 7–9,
4 ◦ C, 24 h
Reference
[51]
a
[52]
7826 a
[53]
57.3 a
[54]
5009 a
[55]
548 a
[56]
>85%, 6–13,
50 ◦ C, 1 h
157.5 a
[57]
>50%,
7.0–10.5
100%, 4, 12 h,
100%, 3, 1 h
>70%, 3–8,
1h
3485 a
[58]
1166 a
[59]
258 a
[60]
NM
16.9 b
[61]
267
a
[62]
257
b
[63]
4221
9
4–5
>75%, 3.5–6,
60 min
Stable below
4.5
>80%, 7–10
5–9.5, 24 h
118.42 a
673.08 a
[64]
[65]
5
5–9
8.3 a
[66]
6.5
>90%, 5–10,
30 min
514.6 a
[67]
4.5
3.5
Mar. Drugs 2016, 14, 171
Table 2. Properties of well-studied alpha-amylases.
Stain
UniProtKB
Molecular
Mass (kDa)
Signal Peptide
(aa)
Temperature
Optimum (◦ C)
Aspergillus niveus
NM
60
NM
65
Thermoactinomyces vulgaris
Bacillus sp. AAH-31
G8ZE61
S6BGD1
40.6
91
NM
28
50
70
Paecilomyces variotii
NM
75
NM
60
Pseudoalteromonas arctica
GS230
Bacillus sp. YX-1
NM
A9YDD9
55
56
24
31
30
40–50
Thermostabiliy
50%, 70 ◦ C, 20
m
50%, 50 ◦ C, 2 h
<60 ◦ C
50%, 60 ◦ C,
53 min
49%, 30 ◦ C,
150 min
60%, 60
◦ C,
1h
Specific Activity
with Soluble
Starch (U/mg)
69
pH
Optimum
pH Stability
6
4–7, 24 h
168 a
[68]
6–7
8.5
127,100.33 b
16.7 a
[69]
[70]
612.5 a
[71]
7
4–9
6.4–10.3
>70%, 5–8, 1
h
>60%, 7–8.5,
1h
>80%, 4.5–11,
1h
50%, 6, 4.5 h,
50%, 7, 7.5 h
NM
90 a
[75]
6–7
>98%, 5–9.5
483 a
[76]
6
7.5
4133 a
22.32 a
[77]
[78]
77.2 b
[79]
6352 b
[80]
6.5
5–9, 24 h
6–9.5
23%, 3, 1 h,
26%, 10, 1 h
>80%, 4.5–8,
1h
5–6.5
772.7 a
[81]
4
7.5
5
Reference
25.5
a
[72]
607
b
[73]
450
a
[74]
Geobacillus thermoleovorans
NM
26
NM
100
Fusicoccum sp. BCC4124
Q0Z8K1
50
no signal
70
Bacillus subtilis KCC103
A8VWC5
53
33
65–70
Bacillus subtilis AX20
Halothermothrix orenii
NM
Q8GPL8
149
60
NM
23
55
65
Bacillus stearothermophilus
NM
64
NM
50
Thermus filiformis Ork A2
NM
60
NM
95
Bacillus subtilis
Clostridium perfringens
NCTC 8679
Escherichia coli (strain K12)
Bacillus subtilis
NM
48
NM
50
50%, 100 ◦ C,
3.6 h
95%, 50 ◦ C, 1 h
50%, 70 ◦ C,
7 min
50 ◦ C, 30 min
37–75 ◦ C
92%, 100 ◦ C, 1
h
50%, 95 ◦ C,
19 min
70%, 60 ◦ C, 1 h
NM
76
NM
30
NM
6.5
NM
NM
[82]
P25718
P00691
75.7
67
17
27
NM
NM
NM
NM
8
8.5
NM
NM
NM
NM
[83]
[84]
a
8
7
5.5–6
Enzyme activity are measured by DNS method; b Enzyme activity are measured by the colored starch-I2 complex method; NM means not mention in the essays.
Mar. Drugs 2016, 14, 171
Table 2. Cont.
Mar. Drugs 2016, 14, 171
3.2. Marine Resources of Amylase and Related Catalytic Mechanisms
Currently, heat-stable α-amylases have been well studied and applied in a series of industrial fields.
As the development of industry, the demand for cold-active amylase is attracting increasingly attention.
Different from terrestrial resources of amylase, many of the marine resources of amylase has high
activity in low temperature as over 75% of the ocean is in 0–6 ◦ C. Therefore, the marine environment is
an ideal area to find cold-active amylase. In Table 2, we can clearly find that the optimum temperature
of α-amylase from Alteromonas haloplanctis A23, isolated from Antarctica, is 25 ◦ C and it has high activity
in low temperature. In deep sea sediment of Prydz Bay, Antarctic, a cold-adapted α-amylase from
Nocardiopsis sp. 7326 was identified. It can retain 38% of its highest activity at 0 ◦ C. Recently, our group
found a novel alkalophilic α-amylase LaaA which has the highest specific activity reported. The specific
activity reached highly to 8881 U/mg. it was cloned from deep-sea bacterium Luteimonas abyssi XH031T
which isolated from the sediment of the South Pacific Gyre with low temperature. It even maintained
38% residual activity at 10 ◦ C [48].
Given the convenience of genetic and molecular biological manipulation, prokaryotes are the
most important resource for α-amylase exploration (Figure 2). Previous studies demonstrated that
α-amylase consists of three domains: A, B and C [85]. Domain A, which includes active site residues
and is directly related to catalytic reaction, forms the core portion of α-amylase. Domains B and C
are related to substrate specificity and active site stability [86]. Thermostability is one of the most
valuable characteristic features of amylase. Studies have demonstrated that protein thermostability
is mainly influenced by hydrogen bonding, hydrophobic interaction, electrostatic interactions and
packing [87]. Through studies of α-amylases from Bacillus, two stages of thermo-inactivation have
been revealed: the partial unfolded state, which is a reversible step, and the fully unfolded state,
which is an irreversible step. With increasing temperatures, the enzyme reaches the partial unfolded
state first. When the temperature reaches a certain level, the enzyme is fully unfolded and totally
inactive [88]. It is hypothesized that the irreversible inactivation is due to covalent modifications of
polypeptide chains or that a higher energy barrier is required during the folding process [86].
To date, most of the well-studied α-amylases contain a conserved calcium site, which is potentially
related to enzyme stability and activity [89]. The conserved calcium site is located far away from
the active site; thus, this site does not participate in the catalytic reaction but plays an important
structural role in enzyme stability and activity [86]. The conserved calcium ion interacts with four
amino acid residues, and three of them are strictly conserved in both structure and sequence [90].
Asn104, Asp200 and His235 are three conserved sites in Bacillus licheniformis α-amylase (BLA) [91].
Mischa et al. [90] first equivocally elucidated the mechanism of calcium-activating α-amylase, and
this group identified a large region that contains 21 disordered residues. The disordered to ordered
transition that occurs in this region is mediated by calcium, which leads to the formation of one wall of
the cleft containing the extended substrate binding site [90]. If this region is disrupted by two extra
residues (Glu-Gly), the conformation of calcium binding is also modified, and thermal stability is
subsequently decreased [92].
Great efforts have been made during recent decades through site-directed mutagenesis and
directed evolution to improve the properties of promising α-amylases, such as catalytic activity,
oxidation resistance, pH tolerance, and temperature tolerance. Directed evolution mainly applies to
the enzymes with biochemical and structural properties that remain poorly understood. Site-directed
mutagenesis is based on thorough research of enzymatic properties. Using homologous sequence
alignment or information regarding tertiary structure, enzymes can be purposefully modified.
For example, to improve the thermal stability of α-amylase from Bacillus megaterium WHO (BMW),
researchers compared BMW-amylase with the most similar protein (Halothermothrix orenii α-amylase,
67%) through bioinformatic methods and modified the protein using site-specific mutagenesis.
The thermal stability was dramatically improved by H58I mutation, which corresponds to Ile50
in H. orenii α-amylase [93].
70
Mar. Drugs 2016, 14, 171
The deletion of residues is an effective method to improve thermostability. Studies demonstrated
that BLA and BAA (Bacillus amyloliquefaciens α-amylase) are highly similar in structure, but a significant
difference in thermostability was noted. The sequence alignment of BAA and BLA demonstrated
the absence of two amino acids, 209E and 210G, in BLA compared with BAA. Then, the mutant
strain BAA-△EG (209E and 210G were mutated) was constructed. The results demonstrated that
the maximal thermostability was increased by ten degrees compared with the wild type BAA [92].
Similar studies by Mamdouh et al. [94] reported that the amylase of Bacillus stearothermophilus US100
has an additional loop compared with the model of BLA. The deletion of two residues (Ile214 and
Gly215) increased thermostability and reduced calcium requirements. Further studies revealed that the
stability of the loop affects the thermostability. The additional loop (containing residues Gly213, Ile214
and Gly215) along with the neighboring residues Arg212 and Lys216 play a critical role in stabilizing
the structure of α-amylase and the calcium-binding site of calcium I. The structure was stabilized via
the interaction between Lys216 and Phe194 and Asp238. Moreover, the stability of Lys216 is directly
related to the stability of the GIG loop [95]. Hydrogen bonding and salt bridges have the important
function of maintaining the stability of α-amylase at low pH [96–98]. The stability of mutants at low
pH was particularly increased by H275D, H293D and H310D mutations. Histidine (His) is a basic
amino acid with positive charges, whereas aspartic acid (Asp) is an acidic amino acid with negative
charges. The survey demonstrates that Asp can stabilize the structure of α-amylase by interacting with
hydrogen bonding and salt bridges under acidic conditions [99]. Salt bridges are also related by the
high thermal stability of BLA [97]. The lysine residues (Lys88, Lys253 and Lys385) interact with each
other to form a stable salt bridge [97]. It is proposed that the interaction between two residues with
similar charges enhances protein stability. Karimeh et al. [100] found that P407H mutations improved
the thermal stability of BAA. Regarding mutated BAA, His407 is located in calcium III, which forms
a His-His pair with the neighboring amino acid His406.
3.3. Prospects for Amylase
α-amylase is widely applied in food, fermentation and detergent industries. Furthermore, in the
medical field, α-amylase can be used as drug targets for treating diabetes, obesity and high cholesterol,
etc. As the increasing demand of different special properties of α-amylase in the industry and research
fields, the complex marine environments provide the possibility of finding various of α-amylases.
The study of marine resources of amylase is becoming increasingly popular. Besides, protein
engineering is an efficient method to improve the properties of α-amylase and plays an increasingly
important role in the research of α-amylase.
4. Alginate Lyase
4.1. Introduction
Algin is a linear complex copolymer composed of mannuronate acid (M) and guluronic acid (G)
that was originally extracted from the mesenchyme of kelp, gulfweed, and seaweed (Figure 6).
Alginate lyase degradation products include oligosaccharides, which exhibit various bioactivities, such
as antibiosis, anti-cancer, anti-tumor and promoting plant growth. Theses characteristic features allow
these proteins to have broad application prospects in medical and agricultural fields. The methods
of algin degradation include acid hydrolysis, chemical oxidation and enzymolysis, among which
enzymolysis has great potential usage given its high specificity and reaction efficiency.
Alginate lyase is a type of enzyme that specifically degrades algin and is primarily found in
microorganisms, animals and plants. Most bacterial alginate lyases are from Gamma-proteobacteria
(Figure 2). Alginate lyases derived from microorganisms are more stable and exhibit increased
activity compared with those obtained from plants and animals. Various types of classification have
been reported, including those based on the specificity of the degradation substrate. In addition,
algin enzymes can be classified as a mannuronate acid lyase, which exclusively degrades the M section,
71
Mar. Drugs 2016, 14, 171
or a guluronic acid lyase, which exclusively degrades the G section (Figure 6). At present, most of the
well-studied alginate lyases exhibit M section-degrading activity, whereas a small proportion degrades
both M and G sections (Figure 6) [101].
ȱ
Figure 6. Structure of algin and the mode of action of alginate lyase.
4.2. Marine Resources of Alginate Lyase and Catalytic Mechanisms
Given the special environment and promising potential, marine alginate lyase studies have
become common in the last several decades. Tseng and colleagues isolated two types of alginate lyases
from Vibrio sp. AL-9 in 1992. One type breaks the α-1,4 glycosidic bond of guluronic acid, whereas the
other type breaks the β-1,4 glycosidic bond of mannuronate acid [102]. Moreover, this group also
identified an alginate lyase that degrades guluronic acid in Vibrio sp. AL-128 [103]. The alginate lyase
isolated from Vibrio sp. QY101 by Song et al. [104] exhibited obvious activity for both mannuronate acid
and guluronic acid. For the first time, this group reported that the 9-amino acid region (YXRESLREM)
appears not only in guluronic acid lyase but also in mannuronate acid lyase [105]. Takeshita et al.
identified one novel alginate lyase from a Vibrio species isolated from the intestinal tract of red
snapper [106]. The special alginate lyase retains 45% of catalytic activity under heat shock conditions
of 100 ◦ C. Moreover, activity is also retained after treatment with 3% SDS in 25 ◦ C for 30 min [106].
In 2009, Liu et al. [107] constructed the recombinant plasmid pINA1317-Y1CWP110 with alginate
lyase (AlyVI) isolated from Vibrio sp. QY101 as the target gene. This enzyme has considerable catalytic
degradation activity if expressed in Yarrowia lipolytica. Moreover, this enzyme degrades mannuronate
acid, guluronic acid, and alginate and produces a series of oligos with different lengths [107].
Alginate lyase was expressed in Saccharomycetes for the first time, and different oligosaccharide lengths
were produced. In the bacterial strain Pseudoalteromonas atlantica AR06, some research groups used
homologous recombination technology to fuse green fluorescent protein (GFP) to the C-terminus of
alginate lyase AlyA, demonstrating that the bacterial strain has normal degradation activity and is
72
Mar. Drugs 2016, 14, 171
able to release fluorescence. As a visible gene expression tool, GFP is convenient for biochemical
and catalytic studies of alginate lyase. Recently, several additional alginate lyases have been well
studied. Liu et al. [108] reported for the first time that the extracellular alginate lyase-like protein from
Pseudomonas fluorescens exhibits high degradation activity for alginate. Dong and other scientists
performed a study on bacteria isolated from the Arctic marine seaweed that produces alginate
lyase [109]. In total, 65 bacterial strains were isolated from the kelp specimen, 21 of which exhibited
alginate lyase activity. Among these isolates, 11 bacterial strains exhibited an optimum temperature
between 20 ◦ C and 30 ◦ C, which indicates that the extracellular lyases are cryophilic enzymes [109].
Moreover, the bacterial strains Psychrobacter, Winogradskyella, Psychromonas and Polaribacter produce
alginate lyase. We have recently focused our studies on Luteimonas abyssi sp. nov., which was isolated
from the abyssal sediment under the circulating area of the South Pacific Ocean. Given that the strain
lives in low-temperature environments and possesses alginate lyase activity, we hypothesize that
alginate lyase is a cold-adaptive enzyme.
Previous studies identified different degradation products of alginate lyase under different pH
conditions. For example, vAL-1 from PL-14 exhibits glucuronic acid degradation activity. In addition,
this enzyme also degrades algin under alkaline conditions [110]. The purified alginate lyase Smlt1473
from S. maltophilia inducing exhibits hyaluronic acid degradation activity at a pH of 5, guluronic acid
degradation activity at a pH of 7 and alginate degradation activity at a pH of 9 [111].
Secondly, according to the similarity of amino acid sequence, alginate lyases may be classified into
the PL-5, PL-7 and PL-15 families. In the PL-5 family [112], 41 alginate lyases have been identified to
date, all of which are from microorganisms. In addition, 86 alginate lyases have been discovered in the
PL-7 family, including 84 from bacteria and only 2 from eukaryotic cells. The PL-15 family currently
has 11 alginate lyases, and all of them are from bacteria. Thus, most of the identified alginate lyases
have been identified in bacteria.
Thirdly, alginate lyases can be divided into three categories based on molecular weight [113]:
20 to 35 kD, approximately 40 kD and approximately 60 kD. The first type of enzyme (20 to 35 kD)
exhibits a variety of substrate specificity. Given that the alginate lyases with a molecular weight
of approximately 40 kD have degradation activity specific to the M section [114] and most of them
contain the common conserved sequence NNHSYW, it is inferred that this sequence is related to
the M section-degradation activity. The homologous sequence YFKAGXYXQ of the C-terminus is
another characteristic feature of small alginate lyases [101]. However, this same sequence was recently
identified in AlyPI lyase, which is a member of the 60-kD family [115]. By comparing the homology
of abalone alginate lyases (HdAly) with members of the PL-14 family, such as turban shell SP2 and
chlorella virus CL2, Sayo Yamamoto et al. [116] reported that Arg92, Lys95, Arg110, Arg119, and Lys19
are particularly highly conservative amino acid residues. Utilizing site-specific mutagenesis technology,
it was discovered that Lys95 mutations cause complete enzymatic inactivation, whereas Arg92, Arg110
and Arg119 mutations lead to reductions in activity greater than 65%, thus suggesting that the Arg92
to Arg119 region is closely related to HdAly activity [116].
To date, all of the alginate degradation enzymes have been classified as lyases, and no
hydrolytic enzymes have been reported [117]. Alginate lyases catalyze the degradation of alginate via
a β-elimination mechanism by breaking α-1,4 glycosidic bonds and yielding oligosaccharides with
an unsaturated double bond at the non-reducing end. A portion of the reaction in which alginate lyase
is cleaved can be induced by a specific substrate. For example, Matsushima et al. [118,119] reported
that alyA gene transcription in Pseudoalteromonasatlantica AR06 is induced by alginate in basic medium.
4.3. Prospects for Alginate Lyase
Alginate lyases can be utilized in multiple industrial and medical areas. Alginate lyase can be used
for developing new methods of tissue regeneration. For example, stem cell cultivation needs alginate
hydrogel as a biological support. However, mammals cannot produce alginate lyase, and thus, alginate
hydrogel cannot be easily degraded. Theoretically, alginate lyase provides a viable way to solve this
73
Mar. Drugs 2016, 14, 171
problem [120]. Alginate lyase can also improve the drug susceptibility of biofilms, working as quorum
sensing inhibitors [121]. Moreover, it has an inhibitory effect on the pathogens of pulmonary cystic
fibrosis. Pediococcus sp. Ab1, which has alginate lyase activity, can be used as a probiotic to improve
the intestinal microflora and nutritional status of abalone during their cultivation [122].
5. Chitinase
5.1. Introduction
Chitin is an N-acetyl-glucosamine homopolymer linked by a β-1,4-glucosidic bond [123] that
is structurally identical to cellulose, except that the hydroxyl group in cellulose at C2 is replaced by
an acetamide group [124]. Chitin is a particularly rich and important nutrient and energy source for
maintaining the ecosystems of marine environments. The majority of chitin originates from marine
ecosystems, and chitinolytic marine bacteria play a critical role in recycling chitinous materials, such as
exoskeletons of crustaceans and insects. Moreover, chitinolytic marine bacteria are also important to
maintain the balance of marine ecosystem. The biofunction of chitin mainly involves its degradation
product oligochitosan, which is capable of resisting fungus, tumors, plant diseases, and related pests.
Oligochitosan also alters the body’s immunological function. Compared with traditional chemical
approach, oligochitosan production by biological methods is milder and more environmentally friendly.
Thus, chintinase studies have drawn increased attention during recent decades.
5.2. Marine Resources of Chitinase and Catalytic Mechanisms
Currently, chitinases have been identified in a series of marine organisms, such as Alteromonas sp.
O7, V. parahaemolyticus [125], Salinivibrio costicola [126] and Microbulbifer degradans [127]. Chitinase is
responsible for hydrolyzing the β-1,4-glycosidic bond of different types of chitin. Based on catalytic
domain similarities, chitinase can be divided into two families: 18 and 19. Family 18 includes chitinases
from bacteria, fungi, viruses, animals and some plants, whereas family 19 includes chitinases from
most plants and special bacteria, such as chitinase C (ChiC) identified from Streptomyces griseus [128].
The chitinases of the two families, which potentially evolved from different ancestors, possess different
catalytic mechanisms [129]. The catalytic domain of the GH18 family has a typical triosephosphate
isomerase (TIM) structure that forms an inner barrel with 8 α-helixes surrounded by an outer barrel
of 8 β-sheets. Whereas the catalytic domain of the GH19 family has a high proportion of α-helixes,
and its structure is similar to chitosanase and lysozyme. GH18 contains 3 groups (ChiA/ChiB/ChiC),
which are classified according to amino acid sequence differences in the catalytic domain. ChiA and
ChiB hydrolyze chitin chains towards opposite direction, whereas ChiC is an endochitinase [130].
Most chitinases from marine microorganisms belong to family 18 [131,132]. Comparing with chitinases
isolated from terrestrial bacteria, marine chitinase exhibit better pH and salinity tolerance, which may
represent promise for some special applications. Wang et al. [133] isolated marine Bacillus cereus that
express two chitinases with optimum pH, optimum temperature, pH stability, and thermal stability
values of 9, 50 ◦ C, 3 to 11, 50 ◦ C and 5, 40 ◦ C, 3 to 11, 60 ◦ C, respectively. These enzymes retain 61%,
60%, 73%, and 100% as well as 60%, 60%, 71%, and 96% of their original activity in the presence
of 2% Tween 20, 2% Tween 40, 2% Triton X-100, and 1 mM SDS, respectively [133]. The marine
psychrophilic bacterium isolated by Stefanidi et al. from a sample raised from a depth of 1200 meters in
the northern Pacific Ocean, secretes several chitinases in response to chitin induction. These chitinase
genes encode a protein of 550 amino acids. The optimum pH and temperature of this chitinase are
5.0 and 28 ◦ C, respectively. There are two crucial residues, Trp275 and Trp397, in the catalytic domain
of the chitinase [134]. A chitinase directed mutagenesis study by Suginta et al. [134] revealed that Gly
and Phe instead of Trp275 and Trp397, respectively, heavily altered the selection of β substrate isomers.
The Trp275 mutation alters the chitinase’s kinetics characteristic features by increasing the catalytic
constants (kcat ) and the specificity (kcat /KM ) of all substrates 5- to 10-fold. In contrast, the Trp397
74
Mar. Drugs 2016, 14, 171
mutation decreases the strength of binding between chitinase and substrate and the rate of soluble
substrate degradation.
5.3. Prospects for Chitinase
The degradation of chitin into oligosaccharides has promise that may be useful in
numerous biological functions, such as antimicrobial activity and antitumor activity [135]. At
present, chitooligosaccharides are mainly produced through chemical reactions in industry.
This process has many drawbacks, such as the production of a series of unexpected short
strain oligosaccharides. Moreover, chemical reactions can easily cause serious environmental
pollution. Comparatively, biological degradation using chitinase has many advantages, such as
being environmentally friendly, inexpensive and repeatable. Because of these advantages, the use of
chitinase to hydrolyze chitin has drawn increasing attention during recent years.
6. Cellulase
6.1. Introduction
Cellulases are multi-component enzymes that can be divided into three components based
on catalytic function, including endoglucanase (endo-1,4-β-D-glucanase, EC3.2.1.4), exoglucanase
(exo-1,4-β-D-glucanase, EC3.2.1.91), and cellobiase (β-1,4-glucosidase, EC3.2.1.21). Cellulases exhibit
great potential in various applications, including papermaking, detergents, bioenergy and effluent
treatment. Previous studies were limited to terrestrial-derived cellulases. As research on marine
microbes and their enzymes advance, it was discovered that enzymes secreted by marine microbes
possess several characteristic features, such as pressure tolerance, alkali resistance, cold resistance and
heat resistance. As a result, marine cellulase resources have drawn increasing attention [136,137].
6.2. Marine Resources of Cellulase and Catalytic Mechanisms
Thermophiles and cryophiles are two main types of marine microbes in the research of
cellulose. For example, Rhodothermus marinus and Thermotoga neapolitana are well characterized.
Extreme thermophile cellulose is composed of several domains. The cellulose and hemi-cellulase
domains are catalytic domains that are linked by several cellulose binding domains (CBDs) [138].
Rhodothermus marinus express a type of cellulose with an optimal temperature that is greater than
90 ◦ C. Bioinformatics and three-dimensional structure comparisons suggest that the aromatic amino
acid cluster exposed on the surface of the protein is responsible for its thermophile activity [139].
Hakamada and coworkers [140] analyzed the structures of thermophile cellulose and alkali cellulose
and revealed that three lysines located at 137, 179 and 194 are responsible for heat resistance.
Moreover, they also demonstrated that increases in arginine, histidine and glutamine residues
and decreases in aspartate and lysine residues are also related with alkali cellulose stability.
Pseudoalteromonas sp. is another species gaining considerable attention. The optimal temperature of its
cellulose, which ranges from 45 to 60 ◦ C, is lower than that of other microbial celluloses. Lee and his
partner [141] isolated a type of marine bacteria Bacillus subtilis. The optimal temperature of its cellulose
is 50 ◦ C, and the optimum reaction pH is 6.5. Alfredsson reported on the marine bacteria Rhodothermus
marinus isolated from alkaline underwater hot springs in Iceland. The optimum growth conditions of
the enzyme are 65 ◦ C, pH 7.0 and 2% NaCl [142]. Trivedi [143] reported on Bacillus flexus from alga
that produces alkaline cellulose. The molecular mass of the cellulose is 97 kDa, and good stability is
noted at pH ranges of 9.0 to 12.0. Moreover, approximately 70% of activity is maintained in 15% NaCl.
Fellerand and his co-workers [51] isolated the psychrophilic filamentous bacterium near the Zhongshan
Station and the Great Wall Station. This species produces cellulase and decomposes cellulase at
0 or 5 ◦ C, thus maintaining proliferation at low temperatures [51]. Recently, Fang [144] identified
a β-glucosidase gene named bgl1A from a marine microbial metagenomic library by functional
screening. This gene permitted tolerance of high glucose concentrations. The protein BgllA was
identified as a member of the glycoside hydrolase 1 family. The recombinant β-glucosidase Bgl1A
75
Mar. Drugs 2016, 14, 171
exhibited a high level of stability in the presence of various cations and high concentrations of NaCl.
The protein was activated by glucose with low concentrations. The enzymatic activity of Bgl1A was
gradually inhibited by increasing concentrations of glucose, but 50% of the original value remained
even in up to 1000 mM glucose.
6.3. Prospects for Cellulase
Cellulases from marine microorganisms exhibit activities under extreme conditions, such as
high salt, high pressure, pH and high/low temperature. Thus, microorganisms abundant in the
unique marine environment provide an important material base for exploiting new source of cellulases.
For example, alkaline cellulose is used in the detergent industry. Moreover, alkaline celluloses exhibit
more advantages in the disposal of sewage from spinning, papermaking, pickling and sauce production.
Moreover, laundry processes require cellulases with the properties of alkali resistance, heat resistance
and insensitivity to surfactants to simultaneously cut losses in detergent processing, storing and
transiting. With the rapid development of the seaweed industry, there is an enormous demand
for cellulases used in algae wall solutions and degradation of algae processing wastes. With the
development of biotechnologies, especially bioinformatics and metagenomics, we believe that more
cellulases with important functions that were previously unable to be discovered will be exploited in
the future.
7. Conclusions
Marine microorganisms contain a series of novel and studied enzymes. However, due to
limitations of exploration, a large proportion of these organisms have not been identified. This review
presents several classic methods for enzyme transcriptional regulation and engineering, which can
be used in marine microbial enzyme exploration. Additionally, this review describes the mechanism
and current status of several polysaccharide-degrading enzymes. Hopefully, these novel strategies
and well-studied catalytic mechanisms can serve as a reference for identifying novel enzymes from
marine environments.
Acknowledgments: This work was supported by projects from the National Natural Science Foundation of China
(No. 41276141, 41506160 and 31571970).
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
Antranikian, G.; Vorgias, C.E.; Bertoldo, C. Extreme environments as a resource for microorganisms and
novel biocatalysts. Adv. Biochem. Eng. Biotechnol. 2005, 96, 219–262. [PubMed]
Bhattacharya, A.; Pletschke, B.I. Review of the enzymatic machinery of Halothermothrix orenii with special
reference to industrial applications. Enzyme Microb. Technol. 2014, 55, 159–169. [CrossRef] [PubMed]
Liu, X.; Huang, Z.; Zhang, X.; Shao, Z.; Liu, Z. Cloning, expression and characterization of a novel cold-active
and halophilic xylanase from Zunongwangia profunda. Extremophiles 2014, 18, 441–450. [CrossRef] [PubMed]
Jaiganesh, R.; Sampath Kumar, N.S. Marine bacterial sources of bioactive compounds. Adv. Food Nutr. Res.
2012, 65, 389–408. [PubMed]
Zotchev, S.B. Marine actinomycetes as an emerging resource for the drug development pipelines. J. Biotechnol.
2012, 158, 168–175. [CrossRef] [PubMed]
Lee, J.S.; Kim, Y.S.; Park, S.; Kim, J.; Kang, S.J.; Lee, M.H.; Ryu, S.; Choi, J.M.; Oh, T.K.; Yoon, J.H.
Exceptional production of both prodigiosin and cycloprodigiosin as major metabolic constituents by a
novel marine bacterium, Zooshikella rubidus S1-1. Appl. Environ. Microbiol. 2011, 77, 4967–4973. [CrossRef]
[PubMed]
Martins, A.; Vieira, H.; Gaspar, H.; Santos, S. Marketed marine natural products in the pharmaceutical and
cosmeceutical industries: Tips for success. Mar. Drugs 2014, 12, 1066–1101. [CrossRef] [PubMed]
Rahman, H.; Austin, B.; Mitchell, W.J.; Morris, P.C.; Jamieson, D.J.; Adams, D.R.; Spragg, A.M.; Schweizer, M.
Novel anti-infective compounds from marine bacteria. Mar. Drugs 2010, 8, 498–518. [CrossRef] [PubMed]
76
Mar. Drugs 2016, 14, 171
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
Abdelmohsen, U.R.; Yang, C.; Horn, H.; Hajjar, D.; Ravasi, T.; Hentschel, U. Actinomycetes from Red Sea
sponges: Sources for chemical and phylogenetic diversity. Mar. Drugs 2014, 12, 2771–2789. [CrossRef]
[PubMed]
Komaki, H.; Ichikawa, N.; Hosoyama, A.; Fujita, N.; Igarashi, Y. Draft genome sequence of marine-derived
streptomyces sp. TP-A0873, a producer of a pyrrolizidine alkaloid bohemamine. Genome Announc. 2015, 3.
[CrossRef] [PubMed]
Zhou, K.; Zhang, X.; Zhang, F.; Li, Z. Phylogenetically diverse cultivable fungal community and polyketide
synthase (PKS), non-ribosomal peptide synthase (NRPS) genes associated with the South China Sea sponges.
Microb. Ecol. 2011, 62, 644–654. [CrossRef] [PubMed]
Zhu, P.; Zheng, Y.; You, Y.; Yan, X.; Shao, J. Molecular phylogeny and modular structure of hybrid NRPS/PKS
gene fragment of Pseudoalteromonas sp. NJ6-3-2 isolated from marine sponge Hymeniacidon perleve.
J. Microbiol. Biotechnol. 2009, 19, 229–237. [PubMed]
Bassler, B.L. Cell-to-cell communication in bacteria: A chemical discourse. Harvey Lect. 2004, 100, 123–142.
[PubMed]
Miyamoto, C.M.; Meighen, E.A. Involvement of LuxR, a quorum sensing regulator in Vibrio harveyi, in the
promotion of metabolic genes: argA, purM, lysE and rluA. Biochim. Biophys. Acta 2006, 1759, 296–307.
[CrossRef] [PubMed]
Choudhary, S.; Schmidt-Dannert, C. Applications of quorum sensing in biotechnology. Appl. Microbiol. Biotechnol.
2010, 86, 1267–1279. [CrossRef] [PubMed]
Mangwani, N.; Dash, H.R.; Chauhan, A.; Das, S. Bacterial quorum sensing: Functional features and potential
applications in biotechnology. J. Mol. Microbiol. Biotechnol. 2012, 22, 215–227. [CrossRef] [PubMed]
Liu, D.; Momb, J.; Thomas, P.W.; Moulin, A.; Petsko, G.A.; Fast, W.; Ringe, D. Mechanism of the
quorum-quenching lactonase (AiiA) from Bacillus thuringiensis. 1. Product-bound structures. Biochemistry
2008, 47, 7706–7714. [CrossRef] [PubMed]
Momb, J.; Wang, C.; Liu, D.; Thomas, P.W.; Petsko, G.A.; Guo, H.; Ringe, D.; Fast, W. Mechanism of the
quorum-quenching lactonase (AiiA) from Bacillus thuringiensis. 2. Substrate modeling and active site
mutations. Biochemistry 2008, 47, 7715–7725. [CrossRef] [PubMed]
Thomas, P.W.; Stone, E.M.; Costello, A.L.; Tierney, D.L.; Fast, W. The quorum-quenching lactonase from
Bacillus thuringiensis is a metalloprotein. Biochemistry 2005, 44, 7559–7569. [CrossRef] [PubMed]
Cao, Y.; He, S.; Zhou, Z.; Zhang, M.; Mao, W.; Zhang, H.; Yao, B. Orally administered thermostable N-acyl
homoserine lactonase from Bacillus sp. strain AI96 attenuates Aeromonas hydrophila infection in zebrafish.
Appl. Environ. Microbiol. 2012, 78, 1899–1908. [CrossRef] [PubMed]
Chen, R.; Zhou, Z.; Cao, Y.; Bai, Y.; Yao, B. High yield expression of an AHL-lactonase from Bacillus sp. B546
in Pichia pastoris and its application to reduce Aeromonas hydrophila mortality in aquaculture. Microb. Cell Fact.
2010, 9, 39. [CrossRef] [PubMed]
Carlier, A.; Uroz, S.; Smadja, B.; Fray, R.; Latour, X.; Dessaux, Y.; Faure, D. The Ti plasmid of
Agrobacterium tumefaciens harbors an attM-paralogous gene, aiiB, also encoding N-Acyl homoserine lactonase
activity. Appl. Environ. Microbiol. 2003, 69, 4989–4893. [CrossRef] [PubMed]
Park, S.Y.; Lee, S.J.; Oh, T.K.; Oh, J.W.; Koo, B.T.; Yum, D.Y.; Lee, J.K. AhlD, an N-acylhomoserine lactonase in
Arthrobacter sp., and predicted homologues in other bacteria. Microbiology 2003, 149, 1541–1550. [CrossRef]
[PubMed]
Uroz, S.; Oger, P.M.; Chapelle, E.; Adeline, M.T.; Faure, D.; Dessaux, Y. A Rhodococcus qsdA-encoded enzyme
defines a novel class of large-spectrum quorum-quenching lactonases. Appl. Environ. Microbiol. 2008, 74,
1357–1366. [CrossRef] [PubMed]
Wang, W.Z.; Morohoshi, T.; Ikenoya, M.; Someya, N.; Ikeda, T. AiiM, a novel class of N-acylhomoserine
lactonase from the leaf-associated bacterium Microbacterium testaceum. Appl. Environ. Microbiol. 2010, 76,
2524–2530. [CrossRef] [PubMed]
Zhang, H.B.; Wang, L.H.; Zhang, L.H. Genetic control of quorum-sensing signal turnover in
Agrobacterium tumefaciens. Proc. Natl. Acad. Sci. USA 2002, 99, 4638–4643. [CrossRef] [PubMed]
Gao, A.; Mei, G.Y.; Liu, S.; Wang, P.; Tang, Q.; Liu, Y.P.; Wen, H.; An, X.M.; Zhang, L.Q.; Yan, X.X.; et al.
High-resolution structures of AidH complexes provide insights into a novel catalytic mechanism for N-acyl
homoserine lactonase. Acta Crystallogr. D Biol. Crystallogr. 2013, 69, 82–91. [CrossRef] [PubMed]
77
Mar. Drugs 2016, 14, 171
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
Mei, G.Y.; Yan, X.X.; Turak, A.; Luo, Z.Q.; Zhang, L.Q. AidH, an alpha/beta-hydrolase fold family member
from an Ochrobactrum sp. strain, is a novel N-acylhomoserine lactonase. Appl. Environ. Microbiol. 2010, 76,
4933–4942. [CrossRef] [PubMed]
Tang, K.; Su, Y.; Brackman, G.; Cui, F.; Zhang, Y.; Shi, X.; Coenye, T.; Zhang, X.H. MomL, a novel
marine-derived N-acyl homoserine lactonase from Muricauda olearia. Appl. Environ. Microbiol. 2015,
81, 774–782. [CrossRef] [PubMed]
Huang, W.; Lin, Y.; Yi, S.; Liu, P.; Shen, J.; Shao, Z.; Liu, Z. QsdH, a novel AHL lactonase in the RND-type inner
membrane of marine Pseudoalteromonas byunsanensis strain 1A01261. PLoS ONE 2012, 7, e46587. [CrossRef]
[PubMed]
Tang, K.; Zhang, Y.; Yu, M.; Shi, X.; Coenye, T.; Bossier, P.; Zhang, X.H. Evaluation of a new high-throughput
method for identifying quorum quenching bacteria. Sci. Rep. 2013, 3, 2935. [CrossRef] [PubMed]
Gao, X.; Xie, X.; Pashkov, I.; Sawaya, M.R.; Laidman, J.; Zhang, W.; Cacho, R.; Yeates, T.O.; Tang, Y. Directed
evolution and structural characterization of a simvastatin synthase. Chem. Biol. 2009, 16, 1064–1074.
[CrossRef] [PubMed]
Sullivan, R.F.; Holtman, M.A.; Zylstra, G.J.; White, J.F.; Kobayashi, D.Y. Taxonomic positioning of
two biological control agents for plant diseases as Lysobacter enzymogenes based on phylogenetic analysis
of 16S rDNA, fatty acid composition and phenotypic characteristics. J. Appl. Microbiol. 2003, 94, 1079–1086.
[CrossRef] [PubMed]
Wang, Y.; Qian, G.; Li, Y.; Wright, S.; Shen, Y.; Liu, F.; Du, L. Biosynthetic mechanism for sunscreens of the
biocontrol agent Lysobacter enzymogenes. PLoS ONE 2013, 8, e66633. [CrossRef] [PubMed]
Xie, Y.; Wright, S.; Shen, Y.; Du, L. Bioactive natural products from Lysobacter. Nat. Prod. Rep. 2012, 29,
1277–1287. [CrossRef] [PubMed]
Wang, Y.; Qian, G.; Liu, F.; Li, Y.Z.; Shen, Y.; Du, L. Facile method for site-specific gene integration in
Lysobacter enzymogenes for yield improvement of the anti-MRSA antibiotics WAP-8294A and the antifungal
antibiotic HSAF. ACS Synth. Biol. 2013, 2, 670–678. [CrossRef] [PubMed]
Zhang, W.; Li, Y.; Qian, G.; Wang, Y.; Chen, H.; Li, Y.Z.; Liu, F.; Shen, Y.; Du, L. Identification and
characterization of the anti-methicillin-resistant Staphylococcus aureus WAP-8294A2 biosynthetic gene cluster
from Lysobacter enzymogenes OH11. Antimicrob. Agents Chemother. 2011, 55, 5581–5589. [CrossRef] [PubMed]
Lou, L.; Qian, G.; Xie, Y.; Hang, J.; Chen, H.; Zaleta-Rivera, K.; Li, Y.; Shen, Y.; Dussault, P.H.; Liu, F.; et al.
Biosynthesis of HSAF, a tetramic acid-containing macrolactam from Lysobacter enzymogenes. J. Am. Chem. Soc.
2011, 133, 643–645. [CrossRef] [PubMed]
Yu, F.; Zaleta-Rivera, K.; Zhu, X.; Huffman, J.; Millet, J.C.; Harris, S.D.; Yuen, G.; Li, X.C.; Du, L. Structure and
biosynthesis of heat-stable antifungal factor (HSAF), a broad-spectrum antimycotic with a novel mode of
action. Antimicrob. Agents Chemother. 2007, 51, 64–72. [CrossRef] [PubMed]
Han, Y.; Wang, Y.; Tombosa, S.; Wright, S.; Huffman, J.; Yuen, G.; Qian, G.; Liu, F.; Shen, Y.; Du, L.
Identification of a small molecule signaling factor that regulates the biosynthesis of the antifungal polycyclic
tetramate macrolactam HSAF in Lysobacter enzymogenes. Appl. Microbiol. Biotechnol. 2015, 99, 801–811.
[CrossRef] [PubMed]
Di Cagno, R.; De Angelis, M.; Calasso, M.; Gobbetti, M. Proteomics of the bacterial cross-talk by quorum
sensing. J. Proteom. 2011, 74, 19–34. [CrossRef] [PubMed]
Dong, Y.H.; Zhang, L.H. Quorum sensing and quorum-quenching enzymes. J. Microbiol. 2005, 43, 101–109.
[PubMed]
Martino, P.D.; Fursy, R.; Bret, L.; Sundararaju, B.; Phillips, R.S. Indole can act as an extracellular signal to
regulate biofilm formation of Escherichia coli and other indole-producing bacteria. Can. J. Microbiol. 2003, 49,
443–449. [CrossRef] [PubMed]
Meiser, P.; Bode, H.B.; Muller, R. The unique DKxanthene secondary metabolite family from the
myxobacterium Myxococcus xanthus is required for developmental sporulation. Proc. Natl. Acad. Sci. USA
2006, 103, 19128–19133. [CrossRef] [PubMed]
Poplawsky, A.R.; Walters, D.M.; Rouviere, P.E.; Chun, W. A gene for a dioxygenase-like protein determines
the production of the DF signal in Xanthomonas campestris pv. campestris. Mol. Plant. Pathol. 2005, 6, 653–657.
[CrossRef] [PubMed]
Stevens, A.M.; Queneau, Y.; Soulere, L.; von Bodman, S.; Doutheau, A. Mechanisms and synthetic modulators
of AHL-dependent gene regulation. Chem. Rev. 2011, 111, 4–27. [CrossRef] [PubMed]
78
Mar. Drugs 2016, 14, 171
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
Guzman-Maldonado, H.; Paredes-Lopez, O. Amylolytic enzymes and products derived from starch:
A review. Crit. Rev. Food Sci. Nutr. 1995, 35, 373–403. [CrossRef] [PubMed]
Song, Q.; Wang, Y.; Yin, C.; Zhang, X.H. LaaA, a novel high-active alkalophilic alpha-amylase from deep-sea
bacterium Luteimonas abyssi XH031(T). Enzyme Microb. Technol. 2016, 90, 83–92. [CrossRef] [PubMed]
Sibakov, M.; Palva, I. Isolation and the 5′ -end nucleotide sequence of Bacillus licheniformis alpha-amylase
gene. Eur. J. Biochem. 1984, 145, 567–572. [CrossRef] [PubMed]
Takkinen, K.; Pettersson, R.F.; Kalkkinen, N.; Palva, I.; Soderlund, H.; Kaariainen, L. Amino acid sequence
of alpha-amylase from Bacillus amyloliquefaciens deduced from the nucleotide sequence of the cloned gene.
J. Biol. Chem. 1983, 258, 1007–1013. [PubMed]
Feller, G.; Payan, F.; Theys, F.; Qian, M.; Haser, R.; Gerday, C. Stability and structural analysis of
alpha-amylase from the antarctic psychrophile Alteromonas haloplanctis A23. Eur. J. Biochem. 1994, 222,
441–447. [CrossRef] [PubMed]
Hagihara, H.; Igarashi, K.; Hayashi, Y.; Endo, K.; Ikawa-Kitayama, K.; Ozaki, K.; Kawai, S.; Ito, S.
Novel alpha-amylase that is highly resistant to chelating reagents and chemical oxidants from the alkaliphilic
Bacillus isolate KSM-K38. Appl. Environ. Microb. 2001, 67, 1744–1750. [CrossRef] [PubMed]
Wang, N.; Zhang, Y.; Wang, Q.; Liu, J.; Wang, H.; Xue, Y.; Ma, Y. Gene cloning and characterization of
a novel alpha-amylase from alkaliphilic Alkalimonas amylolytica. Biotechnol. J. 2006, 1, 1258–1265. [CrossRef]
[PubMed]
Lee, S.P.; Morikawa, M.; Takagi, M.; Imanaka, T. Cloning of the aapT gene and characterization of its
product, alpha-amylase-pullulanase (AapT), from thermophilic and alkaliphilic Bacillus sp. strain XAL601.
Appl. Environ. Microbiol. 1994, 60, 3764–3773. [PubMed]
Igarashi, K.; Hatada, Y.; Hagihara, H.; Saeki, K.; Takaiwa, M.; Uemura, T.; Ara, K.; Ozaki, K.; Kawai, S.;
Kobayashi, T.; et al. Enzymatic properties of a novel liquefying alpha-amylase from an alkaliphilic Bacillus
isolate and entire nucleotide and amino acid sequences. Appl. Environ. Microbiol. 1998, 64, 3282–3289.
[PubMed]
Zhang, J.W.; Zeng, R.Y. Purification and characterization of a cold-adapted alpha-amylase produced by
Nocardiopsis sp. 7326 isolated from Prydz Bay, Antarctic. Mar. Biotechnol. 2008, 10, 75–82. [CrossRef]
[PubMed]
Kim, T.U.; Gu, B.G.; Jeong, J.Y.; Byun, S.M.; Shin, Y.C. Purification and characterization of
a maltotetraose- forming alkaline (alpha)-amylase from an alkalophilic Bacillus Strain, GM8901.
Appl. Environ. Microbiol. 1995, 61, 3105–3112. [PubMed]
Boyer, E.W.; Ingle, M.B. Extracellular alkaline amylase from a Bacillus species. J. Bacteriol. 1972, 110, 992–1000.
[PubMed]
Sharma, A.; Satyanarayana, T. Cloning and expression of acidstable, high maltose-forming, Ca2+ -independent
alpha-amylase from an acidophile Bacillus acidicola and its applicability in starch hydrolysis. Extremophiles
2012, 16, 515–522. [CrossRef] [PubMed]
Prieto, J.A.; Bort, B.R.; Martinez, J.; Randezgil, F.; Buesa, C.; Sanz, P. Purification and characterization of a new
alpha-amylase of intermediate thermal-stability from the yeast Lipomyces kononenkoae. Biochem. Cell Biol.
1995, 73, 41–49. [CrossRef] [PubMed]
Schwermann, B.; Pfau, K.; Liliensiek, B.; Schleyer, M.; Fischer, T.; Bakker, E.P. Purification, properties
and structural aspects of a thermoacidophilic alpha-amylase from Alicyclobacillus acidocaldarius atcc 27009.
Insight into acidostability of proteins. Eur. J. Biochem. 1994, 226, 981–991. [CrossRef] [PubMed]
Asoodeh, A.; Chamani, J.; Lagzian, M. A novel thermostable, acidophilic alpha-amylase from a new
thermophilic “Bacillus sp. Ferdowsicous” isolated from Ferdows hot mineral spring in Iran: Purification and
biochemical characterization. Int. J. Biol. Macromol. 2010, 46, 289–297. [PubMed]
Buonocore, V.; Caporale, C.; De Rosa, M.; Gambacorta, A. Stable, inducible thermoacidophilic alpha-amylase
from Bacillus acidocaldarius. J. Bacteriol. 1976, 128, 515–521. [PubMed]
Ali, I.; Akbar, A.; Anwar, M.; Prasongsuk, S.; Lotrakul, P.; Punnapayak, H. Purification and characterization
of a polyextremophilic alpha-amylase from an obligate halophilic Aspergillus penicillioides isolate and its
potential for souse with detergents. Biomed. Res. Int. 2015. [CrossRef] [PubMed]
Xian, L.; Wang, F.; Luo, X.; Feng, Y.L.; Feng, J.X. Purification and characterization of a highly efficient
calcium-independent alpha-amylase from Talaromyces pinophilus 1-95. PLoS ONE 2015, 10, e0121531.
[CrossRef] [PubMed]
79
Mar. Drugs 2016, 14, 171
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
Wang, S.; Lu, Z.; Lu, M.; Qin, S.; Liu, H.; Deng, X.; Lin, Q.; Chen, J. Identification of archaeon-producing
hyperthermophilic alpha-amylase and characterization of the alpha-amylase. Appl. Microbiol. Biotechnol.
2008, 80, 605–614. [CrossRef] [PubMed]
Han, P.; Zhou, P.; Hu, S.Q.; Yang, S.Q.; Yan, Q.J.; Jiang, Z.Q. A novel multifunctional alpha-amylase from the
thermophilic fungus Malbranchea cinnamomea: Biochemical characterization and three-dimensional structure.
Appl. Biochem. Biotechnol. 2013, 170, 420–435. [CrossRef] [PubMed]
Silva, T.M.; Damasio, A.R.; Maller, A.; Michelin, M.; Squina, F.M.; Jorge, J.A.; Polizeli Mde, L.
Purification, partial characterization, and covalent immobilization-stabilization of an extracellular
alpha-amylase from Aspergillus niveus. Folia Microbiol. 2013, 58, 495–502. [CrossRef] [PubMed]
El-Sayed, A.K.; Abou Dobara, M.I.; El-Fallal, A.A.; Omar, N.F. Purification, sequencing, and biochemical
characterization of a novel calcium-independent alpha-amylase AmyTVE from Thermoactinomyces vulgaris.
Appl. Biochem. Biotechnol. 2013, 170, 483–497. [CrossRef] [PubMed]
Kim, D.H.; Morimoto, N.; Saburi, W.; Mukai, A.; Imoto, K.; Takehana, T.; Koike, S.; Mori, H.; Matsui, H.
Purification and characterization of a liquefying alpha-amylase from alkalophilic thermophilic Bacillus sp.
AAH-31. Biosci. Biotechnol. Biochem. 2012, 76, 1378–1383. [CrossRef] [PubMed]
Michelin, M.; Silva, T.M.; Benassi, V.M.; Peixoto-Nogueira, S.C.; Moraes, L.A.; Leao, J.M.; Jorge, J.A.;
Terenzi, H.F.; Polizeli Mde, L. Purification and characterization of a thermostable alpha-amylase produced
by the fungus Paecilomyces variotii. Carbohydr. Res. 2010, 345, 2348–2353. [CrossRef] [PubMed]
Lu, M.; Wang, S.; Fang, Y.; Li, H.; Liu, S.; Liu, H. Cloning, expression, purification, and characterization of
cold-adapted alpha-amylase from Pseudoalteromonas arctica GS230. Protein J. 2010, 29, 591–597. [CrossRef]
[PubMed]
Liu, X.D.; Xu, Y. A novel raw starch digesting alpha-amylase from a newly isolated Bacillus sp. YX-1:
Purification and characterization. Bioresour. Technol. 2008, 99, 4315–4320. [CrossRef] [PubMed]
Uma Maheswar Rao, J.L.; Satyanarayana, T. Purification and characterization of a hyperthermostable and
high maltogenic alpha-amylase of an extreme thermophile Geobacillus thermoleovorans. Appl. Biochem. Biotechnol.
2007, 142, 179–193. [CrossRef] [PubMed]
Champreda, V.;
Kanokratana, P.;
Sriprang, R.;
Tanapongpipat, S.;
Eurwilaichitr, L.
Purification, biochemical characterization, and gene cloning of a new extracellular thermotolerant
and glucose tolerant maltooligosaccharide-forming alpha-amylase from an endophytic ascomycete
Fusicoccum sp. BCC4124. Biosci. Biotechnol. Biochem. 2007, 71, 2010–2020. [CrossRef] [PubMed]
Nagarajan, D.R.; Rajagopalan, G.; Krishnan, C. Purification and characterization of a maltooligosaccharideforming alpha-amylase from a new Bacillus subtilis KCC103. Appl. Microbiol. Biotechnol. 2006, 73, 591–597.
[CrossRef] [PubMed]
Najafi, M.F.; Deobagkar, D.; Deobagkar, D. Purification and characterization of an extracellular alpha-amylase
from Bacillus subtilis AX20. Protein Expr. Purif. 2005, 41, 349–354. [CrossRef] [PubMed]
Mijts, B.N.; Patel, B.K. Cloning, sequencing and expression of an alpha-amylase gene, amyA, from the
thermophilic halophile Halothermothrix orenii and purification and biochemical characterization of the
recombinant enzyme. Microbiology 2002, 148, 2343–2349. [CrossRef] [PubMed]
Chakraborty, K.; Bhattacharyya, B.K.; Sen, S.K. Purification and characterization of a thermostable
alpha-amylase from Bacillus stearothermophilus. Folia Microbiol. 2000, 45, 207–210. [CrossRef]
Egas, M.C.; da Costa, M.S.; Cowan, D.A.; Pires, E.M. Extracellular alpha-amylase from Thermus filiformis Ork
A2: Purification and biochemical characterization. Extremophiles 1998, 2, 23–32. [CrossRef] [PubMed]
Marco, J.L.; Bataus, L.A.; Valencia, F.F.; Ulhoa, C.J.; Astolfi-Filho, S.; Felix, C.R. Purification
and characterization of a truncated Bacillus subtilis alpha-amylase produced by Escherichia coli.
Appl. Microbiol. Biotechnol. 1996, 44, 746–752. [PubMed]
Shih, N.J.; Labbe, R.G. Purification and characterization of an extracellular alpha-amylase from
Clostridium perfringens type A. Appl. Environ. Microbiol. 1995, 61, 1776–1779. [PubMed]
Spiess, C.; Happersberger, H.P.; Glocker, M.O.; Spiess, E.; Rippe, K.; Ehrmann, M.
Biochemical characterization and mass spectrometric disulfide bond mapping of periplasmic alpha-amylase
MalS of Escherichia coli. J. Biol. Chem. 1997, 272, 22125–22133. [CrossRef] [PubMed]
Mantsala, P.; Zalkin, H. Membrane-bound and soluble extracellular alpha-amylase from Bacillus subtilis.
J. Biol. Chem. 1979, 254, 8540–8547. [PubMed]
80
Mar. Drugs 2016, 14, 171
85.
86.
87.
88.
89.
90.
91.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
Buisson, G.; Duee, E.; Haser, R.; Payan, F. Three dimensional structure of porcine pancreatic alpha-amylase
at 2.9 Å resolution. Role of calcium in structure and activity. EMBO J. 1987, 6, 3909–3916. [PubMed]
Nielsen, J.E.; Borchert, T.V. Protein engineering of bacterial α-amylases. Biochim. Biophys. Acta 2000, 1543,
253–274. [CrossRef]
Tang, S.Y.; Le, Q.T.; Shim, J.H.; Yang, S.J.; Auh, J.H.; Park, C.; Park, K.H. Enhancing thermostability of
maltogenic amylase from Bacillus thermoalkalophilus ET2 by DNA shuffling. FEBS J. 2006, 273, 3335–3345.
[CrossRef] [PubMed]
Tomazic, S.J.; Klibanov, A.M. Mechanisms of irreversible thermal inactivation of Bacillus alpha-amylases.
J. Biol. Chem. 1988, 263, 3086–3091. [PubMed]
Vallee, B.L.; Stein, E.A.; Sumerwell, W.N.; Fischer, E.H. Metal content of alpha-amylases of various origins.
J. Biol. Chem. 1959, 234, 2901–2905. [PubMed]
Machius, M.; Declerck, N.; Huber, R.; Wiegand, G. Activation of Bacillus licheniformis alpha-amylase through
a disorder-order transition of the substrate-binding site mediated by a calcium–sodium–calcium metal triad.
Structure 1998, 6, 281–292. [CrossRef]
Machius, M.; Wiegand, G.; Huber, R. Crystal structure of calcium-depleted Bacillus licheniformis
alpha-amylase at 2.2 Å resolution. J. Mol. Biol. 1995, 246, 545–559. [CrossRef] [PubMed]
Li, L.; Yang, J.; Li, J.; Long, L.; Xiao, Y.; Tian, X.; Wang, F.; Zhang, S. Role of two amino acid residues’ insertion
on thermal stability of thermophilic alpha-amylase AMY121 from a deep sea bacterium Bacillus sp. SCSIO
15121. Bioprocess Biosyst. Eng. 2014, 38, 871–879. [CrossRef] [PubMed]
Ghollasi, M.; Khajeh, K.; Naderi-Manesh, H.; Ghasemi, A. Engineering of a Bacillus alpha-amylase with
improved thermostability and calcium independency. Appl. Biochem. Biotechnol. 2010, 162, 444–459.
[CrossRef] [PubMed]
Ben Ali, M.; Khemakhem, B.; Robert, X.; Haser, R.; Bejar, S. Thermostability enhancement and change in
starch hydrolysis profile of the maltohexaose-forming amylase of Bacillus stearothermophilus US100 strain.
Biochem. J. 2006, 394, 51–56. [CrossRef] [PubMed]
Khemakhem, B.; Ben Ali, M.; Aghajari, N.; Juy, M.; Haser, R.; Bejar, S. The importance of an extra loop in the
B-domain of an alpha-amylase from B. stearothermophilus US100. Biochem. Biophys. Res. Commun. 2009, 385,
78–83. [CrossRef] [PubMed]
Binter, A.; Staunig, N.; Jelesarov, I.; Lohner, K.; Palfey, B.A.; Deller, S.; Gruber, K.; Macheroux, P. A single
intersubunit salt bridge affects oligomerization and catalytic activity in a bacterial quinone reductase. FEBS J.
2009, 276, 5263–5274. [CrossRef] [PubMed]
Liu, Y.H.; Lu, F.P.; Li, Y.; Wang, J.L.; Gao, C. Acid stabilization of Bacillus licheniformis alpha amylase through
introduction of mutations. Appl. Microbiol. Biotechnol. 2008, 80, 795–803. [CrossRef] [PubMed]
Yang, G.; Bai, A.; Gao, L.; Zhang, Z.; Zheng, B.; Feng, Y. Glu88 in the non-catalytic domain of acylpeptide
hydrolase plays dual roles: Charge neutralization for enzymatic activity and formation of salt bridge for
thermodynamic stability. Biochim. Biophys. Acta 2009, 1794, 94–102. [CrossRef] [PubMed]
Yang, H.; Liu, L.; Shin, H.D.; Chen, R.R.; Li, J.; Du, G.; Chen, J. Structure-based engineering of histidine
residues in the catalytic domain of alpha-amylase from Bacillus subtilis for improved protein stability and
catalytic efficiency under acidic conditions. J. Biotechnol. 2013, 164, 59–66. [CrossRef] [PubMed]
Haghani, K.; Khajeh, K.; Naderi-Manesh, H.; Ranjbar, B. Evidence regarding the hypothesis that the
histidine-histidine contact pairs may affect protein stability. Int. J. Biol. Macromol. 2012, 50, 1040–1047.
[CrossRef] [PubMed]
Wong, T.Y.; Preston, L.A.; Schiller, N.L. ALGINATE LYASE: Review of major sources and enzyme
characteristics, structure-function analysis, biological roles, and applications. Annu. Rev. Microbiol. 2000, 54,
289–340. [CrossRef] [PubMed]
Tseng, C.-H.; Yamaguchi, K.; Kitamikado, M. Two types of alginate lyase from a marine bacterium Vibrio sp.
Al-9. Nippon Suisan Gakkaishi 1992, 58, 743–749. [CrossRef]
Tseng, C.-H.; Yamaguchi, K.; Kitamikado, M. Isolation and some properties of alginate lyase from a marine
bacterium Vibrio sp. Al-128. Nippon Suisan Gakkaishi 1992, 58, 533–538. [CrossRef]
Song, Y.; Yu, W.G.; Han, F.; Han, W.J.; Li, J.B. Purification and characterization of aginate lyase from marine
bacterium Vibrio sp. QY101. Acta Biochim. Biophys. Sin. 2003, 35, 473–477. [PubMed]
81
Mar. Drugs 2016, 14, 171
105. Han, F.; Gong, Q.H.; Song, K.; Li, J.B.; Yu, W.G. Cloning, sequence analysis and expression of gene alyVI
encoding alginate lyase from marine bacterium Vibrio sp. QY101. DNA Seq. 2004, 15, 344–350. [CrossRef]
[PubMed]
106. Takeshita, S.; Sato, N.; Igarashi, M.; Muramatsu, T. A highly denaturant-durable alginate Lyase from a marine
bacterium: Purification and properties. Biosci. Biotechnol. Biochem. 1993, 57, 1125–1128. [CrossRef] [PubMed]
107. Liu, G.; Yue, L.; Chi, Z.; Yu, W.; Madzak, C. The surface display of the alginate lyase on the cells of
Yarrowia lipolytica for hydrolysis of alginate. Mar. Biotechnol. 2009, 11, 619–626. [CrossRef] [PubMed]
108. Li, L.; Jiang, X.; Guan, H.; Wang, P.; Guo, H. Three alginate lyases from marine bacterium
Pseudomonas fluorescens HZJ216: Purification and characterization. Appl. Biochem. Biotechnol. 2011, 164,
305–317. [CrossRef] [PubMed]
109. Dong, S.; Yang, J.; Zhang, X.Y.; Shi, M.; Song, X.Y.; Chen, X.L.; Zhang, Y.Z. Cultivable alginate lyase-excreting
bacteria associated with the Arctic brown alga Laminaria. Mar. Drugs 2012, 10, 2481–2491. [CrossRef]
[PubMed]
110. Rahman, M.M.; Inoue, A.; Tanaka, H.; Ojima, T. cDNA cloning of an alginate lyase from a marine gastropod
Aplysia kurodai and assessment of catalytically important residues of this enzyme. Biochimie 2011, 93,
1720–1730. [CrossRef] [PubMed]
111. MacDonald, L.C.; Berger, B.W. A polysaccharide lyase from Stenotrophomonas maltophilia with a unique,
pH-regulated substrate specificity. J. Biol. Chem. 2014, 289, 312–325. [CrossRef] [PubMed]
112. Kobayashi, T.; Uchimura, K.; Miyazaki, M.; Nogi, Y.; Horikoshi, K. A new high-alkaline alginate lyase from
a deep-sea bacterium Agarivorans sp. Extremophiles 2009, 13, 121–129. [CrossRef] [PubMed]
113. Miyake, O.; Ochiai, A.; Hashimoto, W.; Murata, K. Origin and diversity of alginate lyases of families PL-5
and -7 in Sphingomonas sp. strain A1. J. Bacteriol. 2004, 186, 2891–2896. [CrossRef] [PubMed]
114. Osawa, T.; Matsubara, Y.; Muramatsu, T.; Kimura, M.; Kakuta, Y. Crystal structure of the alginate
(poly alpha-L-guluronate) lyase from Corynebacterium sp. at 1.2 Å resolution. J. Mol. Biol. 2005, 345,
1111–1118. [CrossRef] [PubMed]
115. Duan, G.; Han, F.; Yu, W. Cloning, sequence analysis, and expression of gene alyPI encoding an alginate
lyase from marine bacterium Pseudoalteromonas sp. CY24. Can. J. Microbiol. 2009, 55, 1113–1118. [CrossRef]
[PubMed]
116. Yamamoto, S.; Sahara, T.; Sato, D.; Kawasaki, K.; Ohgiya, S.; Inoue, A.; Ojima, T. Catalytically important
amino-acid residues of abalone alginate lyase HdAly assessed by site-directed mutagenesis.
Enzyme Microb. Technol. 2008, 43, 396–402. [CrossRef]
117. Zhu, B.; Yin, H. Alginate lyase: Review of major sources and classification, properties, structure-function
analysis and applications. Bioengineered 2015, 6, 125–131. [CrossRef] [PubMed]
118. Matsushima, R.; Danno, H.; Uchida, M.; Ishihara, K.; Suzuki, T.; Kaneniwa, M.; Ohtsubo, Y.;
Nagata, Y.; Tsuda, M. Analysis of extracellular alginate lyase and its gene from a marine bacterial strain,
Pseudoalteromonas atlantica AR06. Appl. Microbiol. Biotechnol. 2010, 86, 567–576. [CrossRef] [PubMed]
119. Matsushima, R.; Watanabe, R.; Tsuda, M.; Suzuki, T. Analysis of extracellular alginate lyase (alyA) expression
and its regulatory region in a marine bacterial strain, Pseudoalteromonas atlantica AR06, using a gfp gene
reporter system. Mar. Biotechnol. 2013, 15, 349–356. [CrossRef] [PubMed]
120. Ashton, R.S.; Banerjee, A.; Punyani, S.; Schaffer, D.V.; Kane, R.S. Scaffolds based on degradable alginate
hydrogels and poly(lactide-co-glycolide) microspheres for stem cell culture. Biomaterials 2007, 28, 5518–5525.
[CrossRef] [PubMed]
121. Hoiby, N.; Bjarnsholt, T.; Givskov, M.; Molin, S.; Ciofu, O. Antibiotic resistance of bacterial biofilms. Int. J.
Antimicrob. Agents 2010, 35, 322–332. [CrossRef] [PubMed]
122. Iehata, S.; Inagaki, T.; Okunishi, S.; Nakano, M.; Tanaka, R.; Maeda, H. Improved gut environment of abalone
Haliotis gigantea through Pediococcus sp Ab1 treatment. Aquaculture 2010, 305, 59–65. [CrossRef]
123. Younes, I.; Rinaudo, M. Chitin and chitosan preparation from marine sources. Structure, properties and
applications. Mar. Drugs 2015, 13, 1133–1174. [CrossRef] [PubMed]
124. Wang, S.; Shao, B.; Fu, H.; Rao, P. Isolation of a thermostable legume chitinase and study on the antifungal
activity. Appl. Microbiol. Biotechnol. 2009, 85, 313–321. [CrossRef] [PubMed]
125. Hirono, I.; Yamashita, M.; Aoki, T. Note: Molecular cloning of chitinase genes from Vibrio anguillarum and
V. parahaemolyticus. J. Appl. Microbiol. 1998, 84, 1175–1178. [CrossRef] [PubMed]
82
Mar. Drugs 2016, 14, 171
126. Aunpad, R.; Panbangred, W. Cloning and characterization of the constitutively expressed chitinase C gene
from a marine bacterium, Salinivibrio costicola strain 5SM-1. J. Biosci. Bioeng. 2003, 96, 529–536. [CrossRef]
127. Howard, M.B.; Ekborg, N.A.; Taylor, L.E.; Weiner, R.M.; Hutcheson, S.W. Genomic analysis and initial
characterization of the chitinolytic system of Microbulbifer degradans strain 2-40. J. Bacteriol. 2003, 185,
3352–3360. [CrossRef] [PubMed]
128. Tsujibo, H.; Kubota, T.; Yamamoto, M.; Miyamoto, K.; Inamori, Y. Characterization of chitinase genes from
an alkaliphilic actinomycete, Nocardiopsis prasina OPC-131. Appl. Environ. Microbiol. 2003, 69, 894–900.
[CrossRef] [PubMed]
129. Fukamizo, T. Chitinolytic enzymes: Catalysis, substrate binding, and their application. Curr. Protein Pept. Sci.
2000, 1, 105–124. [CrossRef] [PubMed]
130. Horn, S.J.; Sorbotten, A.; Synstad, B.; Sikorski, P.; Sorlie, M.; Varum, K.M.; Eijsink, V.G. Endo/exo mechanism
and processivity of family 18 chitinases produced by Serratia marcescens. FEBS J. 2006, 273, 491–503.
[CrossRef] [PubMed]
131. Han, Y.; Yang, B.; Zhang, F.; Miao, X.; Li, Z. Characterization of antifungal chitinase from marine
Streptomyces sp. DA11 associated with South China Sea sponge Craniella australiensis. Mar. Biotechnol.
2009, 11, 132–140. [CrossRef] [PubMed]
132. Stefanidi, E.; Vorgias, C.E. Molecular analysis of the gene encoding a new chitinase from the marine
psychrophilic bacterium Moritella marina and biochemical characterization of the recombinant enzyme.
Extremophiles 2008, 12, 541–552. [CrossRef] [PubMed]
133. Wang, S.L.; Liang, T.W.; Lin, B.S.; Wang, C.L.; Wu, P.C.; Liu, J.R. Purification and characterization of chitinase
from a new species strain Pseudomonas sp. TKU008. J. Microbiol. Biotechnol. 2010, 20, 1001–1005. [PubMed]
134. Suginta, W.; Songsiriritthigul, C.; Kobdaj, A.; Opassiri, R.; Svasti, J. Mutations of Trp275 and Trp397 altered
the binding selectivity of Vibrio carchariae chitinase A. Biochim. Biophys. Acta 2007, 1770, 1151–1160. [CrossRef]
[PubMed]
135. De Assis, C.F.; Costa, L.S.; Melo-Silveira, R.F.; Oliveira, R.M.; Pagnoncelli, M.G.; Rocha, H.A.;
De Macedo, G.R.; Santos, E.S. Chitooligosaccharides antagonize the cytotoxic effect of glucosamine. World J.
Microbiol. Biotechnol. 2012, 28, 1097–1105. [CrossRef] [PubMed]
136. Chi, Z.; Zhang, T.; Liu, G.; Li, J.; Wang, X. Production, characterization and gene cloning of the extracellular
enzymes from the marine-derived yeasts and their potential applications. Biotechnol. Adv. 2009, 27, 236–255.
[CrossRef] [PubMed]
137. Mba Medie, F.; Davies, G.J.; Drancourt, M.; Henrissat, B. Genome analyses highlight the different biological
roles of cellulases. Nat. Rev. Microbiol. 2012, 10, 227–234. [CrossRef] [PubMed]
138. Gibbs, M.D.; Reeves, R.A.; Farrington, G.K.; Anderson, P.; Williams, D.P.; Bergquist, P.L. Multidomain and
multifunctional glycosyl hydrolases from the extreme thermophile Caldicellulosiruptor isolate Tok7B.1.
Curr. Microbiol. 2000, 40, 333–340. [CrossRef] [PubMed]
139. Bronnenmeier, K.; Kern, A.; Liebl, W.; Staudenbauer, W.L. Purification of Thermotoga maritima enzymes for
the degradation of cellulosic materials. Appl. Environ. Microbiol. 1995, 61, 1399–1407. [PubMed]
140. Hakamada, Y.; Koike, K.; Yoshimatsu, T.; Mori, H.; Kobayashi, T.; Ito, S. Thermostable alkaline cellulase from
an alkaliphilic isolate, Bacillus sp. KSM-S237. Extremophiles 1997, 1, 151–156. [CrossRef] [PubMed]
141. Lee, B.-H.; Kim, B.-K.; Lee, Y.-J.; Chung, C.-H.; Lee, J.-W. Industrial scale of optimization for the production
of carboxymethyl cellulase from rice bran by a marine bacterium, Bacillus subtilis subsp. subtilis A-53.
Enzyme Microb. Technol. 2010, 46, 38–42. [CrossRef]
142. Alfredsson, G.A.; Kristjansson, J.K.; Hjorleifsdottir, S.; Stetter, K.O. Rhodothermus marinus, gen. nov., sp. nov.,
a thermophilic, halophilic bacterium from submarine hot springs in iceland. J. Gen. Microbiol. 1988, 134,
299–306. [CrossRef]
83
Mar. Drugs 2016, 14, 171
143. Trivedi, N.; Gupta, V.; Kumar, M.; Kumari, P.; Reddy, C.R.K.; Jha, B. An alkali-halotolerant cellulase from
Bacillus flexus isolated from green seaweed Ulva lactuca. Carbohydr. Polym. 2011, 83, 891–897. [CrossRef]
144. Fang, Z.; Fang, W.; Liu, J.; Hong, Y.; Peng, H.; Zhang, X.; Sun, B.; Xiao, Y. Cloning and
characterization of a beta-glucosidase from marine microbial metagenome with excellent glucose tolerance.
J. Microbiol. Biotechnol. 2010, 20, 1351–1358. [CrossRef] [PubMed]
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
84
marine drugs
Article
Purification of Antioxidant Peptides by High
Resolution Mass Spectrometry from Simulated
Gastrointestinal Digestion Hydrolysates of Alaska
Pollock (Theragra chalcogramma) Skin Collagen
Liping Sun, Weidan Chang, Qingyu Ma and Yongliang Zhuang *
Yunnan Institute of Food Safety, Kunming University of Science and Technology, No. 727 South Jingming Road,
Kunming 650500, Yunnan, China; kmlpsun@163.com (L.S.); changweidan08023@163.com (W.C.);
maqingyu0323@163.com (Q.M.)
* Correspondence: ylzhuang@kmust.edu.cn; Tel./Fax: +86-871-6592-0216
Academic Editor: Se-Kwon Kim
Received: 14 July 2016; Accepted: 26 September 2016; Published: 17 October 2016
Abstract: In this study, the stable collagen hydrolysate was prepared by alcalase hydrolysis and twice
simulated gastrointestinal digestion from Alaska pollock skin. The characteristics of hydrolysates
and antioxidant activities in vitro, including 2,2′ -azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)
radical (ABTS•+ ) scavenging activity, ferric-reducing antioxidant power (FRAP) and hydroxyl radical
(OH·) scavenging activity, were determined. After twice simulated gastrointestinal digestion of
skin collagen (SGI-2), the degree of hydrolysis (DH) reached 26.17%. The main molecular weight
fractions of SGI-2 were 1026.26 and 640.53 Da, accounting for 59.49% and 18.34%, respectively.
Amino acid composition analysis showed that SGI-2 had high content of total hydrophobic amino acid
(307.98/1000). With the simulated gastrointestinal digestion progressing, the antioxidant activities
increased significantly (p < 0.05). SGI-2 was further purified by gel filtration chromatography, ion
exchange chromatography and high performance liquid chromatography, and the A1a3c–p fraction
with high hydroxyl radical scavenging activity (IC50 = 7.63 μg/mL) was obtained. The molecular
weights and amino acid sequences of key peptides of A1a3c–p were analyzed using high resolution
mass spectrometry (LC-ESI-LTQ-Orbitrap-MS) combined with de novo software and UniProt of
MaxQuant software. Four peptides were identified from A1a3c–p , including YGCC (444.1137 Da) and
DSSCSG (554.1642 Da) identified by de novo software and NNAEYYK (900.3978 Da) and PAGNVR
(612.3344 Da) identified by UniProt of MaxQuant software. The molecular weights and amino acid
sequences of four peptides were in accordance with the features of antioxidant peptides. The results
indicated that different peptides were identified by different data analysis software according to
spectrometry mass data. Considering the complexity of LC-ESI-LTQ-Orbitrap-MS, it was necessary
to use the different methods to identify the key peptides from protein hydrolysates.
Keywords: Alaska pollock skin collagen; simulated gastrointestinal digestions; antioxidant peptide;
peptide purification; de novo software; UniProt of MaxQuant
1. Introduction
Reactive oxygen species (ROS) and free radicals are very unstable and react rapidly with lipids and
proteins in the body, generating damage in the biological system, such as DNA, protein and membrane
lipid, if the human body cannot control their formation or eliminate them [1]. Therefore, it is important
to inhibit oxidation reactions and the formation of free radicals in the living body. In recent years,
some peptides have been found to possess antioxidant activity [2,3]. Collagen is rich in hydrophobic
amino acids, and the abundance of these amino acids favors higher affinity to oil and better emulsifying
Mar. Drugs 2016, 14, 186
85
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2016, 14, 186
ability. Therefore, collagen is expected to provide natural antioxidant peptides and exert higher
antioxidant effects than other proteins. In addition, collagen peptides have good biocompatibility,
good penetrability and cause no irritation to the body [4]. Researchers have reported the characteristic
and antioxidant activity of different collagen resources, especially from aquatic animals, such as sea
jumbo squid skin [5], jellyfish umbrella [2], smooth hound protein [6], sea cucumber [7], pacific hake [8]
and tilapia skin [3].
The structure of bioactive peptides may be changed when they are digested, absorbed and
transferred in gastrointestinal tract [9]. It is expected that bioactive peptides would not be further
digested in the gastrointestinal tract and thereby ensure its stability after digestion. The stable
peptides should ideally be isolated and identified in vivo. However, in vivo studies are costly and
time-consuming, are rather complicated to perform. As an alternative to in vivo studies, a simple,
rapid, and inexpensive in vitro simulated gastric and intestinal digestive method has been established
to isolate bioactive peptides. In this method, the prior hydrolysis with the endopeptidases would
increase the stability and bioavailability of the bioactive peptide in vivo. In the previous studies, it has
been shown that gastrointestinal enzyme digestion results in more potent peptides compared with
other enzymatic digestions [10].
Alaska pollock (Theragra chalcogramma) is one of the commercially important fish species in China,
but a large number of scraps containing fish skin, head and bones are left in the processing of fillet
production. It has been reported that 70% of the dry matter of fish skin is collagen. Some studies
reported the characteristics of collagen and bioactivities of collagen peptides from Alaska pollock skin.
Yan et al. [11] reported the characterization of collagen from the skin of Alaska pollock. Hou et al. [12]
studied the immunomodulatory activity of Alaska pollock hydrolysates and the active peptide was
identified. Byun and Kim [13] purified the key peptide from Alaska Pollock skin with angiotensin
I converting enzyme inhibitory activity. Jia et al. [14] studied the enzymatic hydrolysates of Alaska
Pollock skin with antioxidant activity.
In this study, twice simulated gastrointestinal (GI) digestion was used to prepare
hydrolysates from the collagen of Alaska Pollock skin, in order to obtain the stable antioxidant
peptides. The antioxidant activity of the hydrolysates was evaluated in vitro. The bioactive
fraction from hydrolysates with the highest antioxidant activity was separated by gel filtration
chromatography, ion exchange chromatography and high performance liquid chromatography.
Furthermore, two methods, including de novo analysis software and UniProt of MaxQuant software,
were used to identify the key peptides from protein hydrolysates.
2. Results and Discussion
2.1. Analyses, DH, Molecular Weight (MW) and Amino Acid Composition of Hydrolysates
In this study, Alaska Pollock skin collagen was hydrolysed by alcalase to obtain its hydrolysates
(ASCH). Two successive simulated GI digestions of ASCH were conducted in order to get the stable
collagen hydrolysates. The DHs of collagen hydrolysates were studied at different stages, including
the first simulated gastric digestion (SG-1), the first simulated intestinal digestion (SGI-1), the second
simulated gastric digestion (SG-2) and the second simulated intestinal digestion (SGI-2). As shown
in Figure 1, the DH of ASCH was 13.17%. It increased from 16.92% (SG-1) to 22.65% (SGI-1) at the
first simulated GI digestion. It was similar to the study of You et al. which indicated that more
peptide bonds were broken using pancreatin digestion than using pepsin digestion [15]. In the second
simulated GI digestion, the increase of DH was significant (p < 0.05) at the stage of SG-2 (25.47%), but it
was not significant between the SG-2 and SGI-2 stage (26.17%) (p > 0.05). It might be because the DH
became basically stable as the second simulated intestinal digestion was processed.
86
Mar. Drugs 2016, 14, 186
Figure 1. The hydrolysis degree changes of different stages of digestion from skin collagen of Alaska
pollock ASCH: alcalase hydrolysates; SG-1: the first simulated gastric digestion; SGI-1: the first
simulated intestinal digestion; SG-2: the second simulated gastric digestion; SGI-2: the second
simulated intestinal digestion. Different letters indicated significant differences (p < 0.05).
Furthermore, the molecular weight distributions of the different stages of digestion from skin
collagen of Alaska pollock were shown in Table 1. The main molecular weight fractions of ASCH,
SGI-1 and SGI-2 were 3198.76 (66.82%), 1552.34 (74.66%) and 1026.26 Da (59.49%), respectively. With the
increasing of DH, the molecular weight of the hydrolysates significantly decreased. As shown in
Table 1, the MW distribution of SGI-2 was 1026.26, 640.53, 284.97 and 96.58 Da. Based on the peak area,
they accounted for 59.49, 18.34, 16.60 and 4.56%, respectively.
Table 1. Molecular weight distributions of three stages of hydrolysates.
Hydrolysates
ASCH
SGI-1
SGI-2
Num
MW (Da)
Content (%) *
MW (Da)
Content (%)
MW (Da)
Content (%)
1
2
3
4
3198.76
2245.49
647.39
199.63
66.82
16.45
8.09
8.08
1552.34
976.83
505.59
180.09
74.66
18.04
5.08
2.15
1026.26
640.53
284.97
96.58
59.49
18.34
16.60
4.56
* the percentage of the peak area.
The amino acid compositions of the different stages of digestion were showed in Table 2.
The compositions of three stages were similar and they were rich in Gly, Glu, Pro, Asp, and Arg.
The result was similar to that of other fish skin hydrolysates [4,5] and in accordance with the
characteristics of collagen hydrolysates. In this study, the total hydrophobic amino acid (THAA)
contents of three hydrolysates were high, showing 315.11, 302.22 and 307.98 per 1000 residues,
respectively. High content of hydrophobic amino acids could increase the solubility in lipids and
therefore enhance the antioxidative activity of hydrolysates [4].
Table 2. Amino acid compositions of three stages of hydrolysates (No. of residues per 1000 residues).
Amino Acids
ASCH
SGI-1
SGI-2
Asp
Thr
Ser
Glu
Gly
Ala
54.19
25.56
64.78
75.24
314.42
109.31
56.37
26.43
64.81
76.53
325.46
107.95
56.81
27.37
62.17
76.38
319.66
105.06
* THAA: total hydrophobic amino acid.
87
Mar. Drugs 2016, 14, 186
Table 2. Cont.
Amino Acids
ASCH
SGI-1
SGI-2
Cys
Val
Met
Ile
Leu
Tyr
Phe
Lys
NH3
His
Arg
Pro
THAA*
Total
31.80
17.90
15.01
11.82
22.25
3.40
13.04
27.95
57.51
8.83
53.01
93.99
315.11
1000
19.17
19.44
14.53
12.49
22.71
3.77
12.81
28.70
54.29
8.87
52.55
93.13
302.22
1000
23.18
20.56
14.39
13.42
23.58
4.90
13.89
30.59
69.71
9.17
35.25
93.90
307.98
1000
* THAA: total hydrophobic amino acid.
2.2. Analyses of Antioxidant Activities
Since there is no single antioxidant standard method to test for antioxidant capacity, it is
recommended to use different methods for investigating the different mechanisms of antioxidant
capacity [16]. In order to evaluate the antioxidant activity of collagen hydrolysates, the pHs was
adjusted to about 7.0 in this study. As shown in Figure 2, the ABTS•+ scavenging activity, FRAP and
OH· scavenging activity were measured.
The ABTS assay is often used to evaluate the ability of antioxidants to scavenge free radicals. After
simulated GI digestion, the ABTS•+ scavenging activity obviously increased (Figure 2a). The ABTS•+
scavenging activity was 39.79% in the SGI-1 stage and 59.17% in the SGI-2 stage at the concentrations
of 0.5 mg/mL. The FRAP assay is based on the ability of antioxidants to reduce Fe3+ to Fe2+ in
the presence of 1,3,5-tri(2-pyridyl)-2,4,6-triazine (TPTZ). As shown in Figure 2b, with the simulated
gastrointestinal digestion progressing, FRAP of the hydrolysates increased significantly (p < 0.05).
At the dose of 10 mg/mL, the activities of SGI-1 and SGI-2 were 129.42 and 209.27 μmol/L FeSO4 ,
respectively. Hydroxyl radical is the most reactive radical, which has been demonstrated to be a highly
damaging species in free radical pathology, attacking almost every molecule in living cells. As shown
in Figure 2c, the simulated GI digestion significantly increased the OH· scavenging activity (p < 0.05).
Indeed, the OH· scavenging activity of ASCH was 15.53% at the concentration of 2 mg/mL, and the
activities of SGI-1 and SGI-2 were 34.77 and 59.11%, respectively. The increase of scavenging activity
of the pancreatin digestion process was higher than the pepsin digestion.
Figure 2. Cont.
88
Mar. Drugs 2016, 14, 186
Figure 2. The antioxidant acitivties of different stages of digestion of skin collagen of Alaska pollock.
(a): ABTS•+ scavenging activity (at 0.5 mg/mL); (b): FRAP (at 10 mg/mL); (c): OH· scavenging activity
(at 2 mg/mL). Different letters indicated significant differences (p < 0.05).
2.3. Purification of the Antioxidant Peptides from SGI-2
The removal of OH· is probably one of the most effective defenses of a living body against various
diseases [17]. Based on this reason, the OH· scavenging activity was selected as the indicator of
purification of antioxidant peptides in the study.
The SGI-2 solution was purified by a Sephadex G-25 gel filtration column, and four fractions
were obtained, noting A–D respectively (Figure 3a). Four fractions were collected, concentrated and
the OH· scavenging activities were determined. Results showed that fraction A had the highest OH·
scavenging activity among the four fractions, with the IC50 value being 0.26 mg/mL (Figure 3b).
Ion-exchange chromatography was a method of separation according to the substance with
a different acid-base property and polarity. SP Sephadex C-25 was one of the strong cation
exchangers with a main functional group of sulfopropyl and it was widely used in separating bioactive
peptides [18]. The fraction A collected from Sephadex G-25 was further separated by the SP Sephadex
C-25 column and five fractions were obtained, noting A1 , A2 , A3 , A4 and A5 , respectively (Figure 4a).
The OH· scavenging activities of these five fractions were shown in Figure 4b; fraction A1 had the
highest OH· scavenging activity with the IC50 value being 81.15 μg/mL. Thus, the fraction A1 was
selected for next separation.
89
Mar. Drugs 2016, 14, 186
ȱ
Figure 3. Sephadex G-25 gel chromatography (a) and the IC50 value (mg/mL) of each fraction was
measured by OH· scavenging activities (b). Different letters indicate significant differences (p < 0.05).
Figure 4. Elution profile of fraction A separated by SP Sephadex C-25 chromatography (a) and the IC50
value (μg/mL) of the OH· scavenging activities of each fraction (b). Different letters indicate significant
differences (p < 0.05).
Sephadex G-15 was used to remove NaCl from the eluate of SP Sephadex C-25 in the fraction A1 .
As shown in Figure 5, four fractions (A1a , A1b , A1c , and A1d ) were obtained and their OH· scavenging
activities were measured. The OH· scavenging activity of the fraction A1a was the highest compared
with the other three fractions, and the IC50 value was 73.52 μg/mL.
Figure 5. Elution profile of fraction A1 separated by Sephadex G-15 chromatography (a) and the IC50
value (μg/mL) of the OH· scavenging activities of each fraction (b). Different letters indicate significant
differences (p < 0.05).
The fraction A1a was further isolated by a Shim-pack GIS C18 preparative column with a liner
gradient of acetonitrile containing 0.1% trifluoroacetic acid (TFA) from 5% to 30% in 30 min. The elution
profile was shown in Figure 6. A total of 12 peaks were obtained and named as A1a1 –A1a12 , respectively.
90
Mar. Drugs 2016, 14, 186
Each peak was collected, concentrated and it’s OH· scavenging activities were measured. The result
showed that A1a3 had the highest antioxidant activity and the IC50 value of A1a3 was 31.72 μg/mL.
Figure 6. Chromatography of A1a separated by a Shim-pack GIS C18. Liner gradient was 5%–30%
acetonitrile containing 0.1% TFA from 0 to 30 min.
The fraction A1a3 was isolated by HPLC on the semi-preparative C18 column using a liner
gradient of acetonitrile containing 0.1% TFA from 5% to 25% in 30 min. Seven fractions were collected
and designated as A1a3a –A1a3g in turn respectively (Figure 7). After the OH· scavenging activities
of seven fractions were determined, we found that A1a3c had the highest OH· scavenging activity,
and the IC50 value of A1a3c was 14.36 μg/mL. The most active A1a3c faction was isolated again by
the semi-preparative C18 column using a different liner gradient of acetonitrile containing 0.1% TFA
from 5% to 20% in 30 min. The main peak A1a3c–p with high antioxidant activity was collected
and concentrated (Figure 8). The IC50 value of OH· scavenging activity of the A1a3c–p fraction
was 7.63 μg/mL.
ȱ
Figure 7. Chromatography of A1a3 separated by C18 semi-preparing HPLC. The liner gradient
was 5%–25% acetonitrile containing 0.1% TFA from 0 to 30 min.
91
Mar. Drugs 2016, 14, 186
ȱ
Figure 8. Chromatography of A1a3c separated by C18 semi-preparing HPLC. The liner gradient
was 5%–20% acetonitrile containing 0.1% TFA from 0 to 30 min.
2.4. Identification of Purified Peptide
The antioxidant activity of peptides is connected with their molecular weights, amino acid
compositions, amino acid sequences and so on [19]. In this study, the fraction A1a3c–p was
analyzed by high resolution mass spectrometry combined with two methods, including de novo
software and MaxQuant software. As shown in Figure 9, two peptides were obtained by de novo
software. The peptide sequences were Try–Gly–Cys–Cys (YGCC) and Asp–Ser–Ser–Cys–Ser–Gly
(DSSCSG), and their molecular weight was 444.1137 and 554.1642 Da, respectively. The data
was scanned in the “fish collagen” database by UniProt of MaxQuant software. Two peptides,
Asn-Asn-Ala-Gln-Tyr-Tyr-Lys (NNAEYYK) and Pro-Ala-Gly-Asn-Val-Arg (PAGNVR), were identified,
and their molecular weight was 900.3978 and 612.3344 Da, respectively. The amino acids at the
C-terminus of two peptides were K and R, which conformed to the fracture characters of simulated
gastric and intestinal digestions.
ȱ
Figure 9. MS/MS spectrum analysis of the active peptides. (a): DSSCSG; (b): YGCC.
Generally, there is no direct relationship between antioxidant activity and molecular weight.
However, the previous study indicated that the peptides with smaller molecular weights have stronger
antioxidant activities, more resistant to the gastrointestinal digestion and easier to cross the intestinal
92
Mar. Drugs 2016, 14, 186
barrier to exert biological activities than larger peptides [20]. Antioxidative peptides usually contain
2–20 amino acids with molecular weights below 3000 Da [5]. In this study, the amino acid numbers
of four peptides identified from Alaska pollock skin collagen were 4, 6, 7, and 6 and the molecular
weight was lower 1000 Da. The amino acid number and molecular weight was in accordance with the
feature of antioxidant peptide. Our study was similar to the peptides purified from walnut [21] and
loach protein hydrolysates [15].
Moreover, compositions and the specific position of amino acids in the peptide may play an
important role in its antioxidant activities. High content of hydrophobic amino acids, especially at the
N- or C-terminus of peptides, could enhance the activities of antioxidative peptides by interacting with
lipid molecules and donating protons into radicals to scavenge radicals [22]. Moreover, polar/charged
amino acids such as Arg at the C-terminus position also contribute to the antioxidant activity [23].
Our results were similar to these previous reports, and hydrophobic amino acids or arginine existed in
the terminus of four peptides.
Some studies have reported that peptide sequences containing Tyr show strong antioxidant
activity, especially when the presence of Tyr was at terminals of the peptide sequence. The antioxidant
activity of Tyr may be explained by the special capability of phenolic groups to serve as hydrogen
donors, which is one mechanism of inhibiting the radical-mediated peroxidizing chain reaction [24].
YGCC obtained from this study had a Tyrat N-terminus, and this might be one of the reasons why
YGCC showed higher radical scavenging activity. In addition, NNAEYYK had two Tyr, which could
effectively increase its antioxidant activity. Previous studies show that Cys is hydrophobic in nature
and can interact directly with free radicals by donating the sulfur hydrogen, so the presence of Cys is
one of the reasons for the good antioxidant activity of the isolated peptide [25]. Li et al. considered
that Cys residue at the C-terminus or next to the C-terminus plays an important role in antioxidative
activities [26]. It was similar to our study and YGCC and DSSCSG contained Cys, YGCC in particular
had two Cys at the C-terminus, which might improve its antioxidant activity. Acidic amino acids, such
as Asn and Gln, play important roles in the chelation of metal ions by their side chains, which may
inhibit the formation of the hydroxyl radical [27]. Rajapakse et al. reported that the presence of Asp
seemed to play a vital role, irrespective of its position, as observed in several antioxidative peptide
sequences [28]. It was similar to our results. DSSCSG and NNAEYYK had Asp and Asn at the
N-terminus, respectively.
The fraction A1a3c–p was analyzed using high resolution mass spectrometry, and the key peptides
obtained by de novo and MaxQuant software were different. Therefore, to adequately identify the
key peptides from protein hydrolysates fractions, it was necessary to use different methods to analyze
mass data. A further study about the quantitative analysis of key peptides will be carried out.
3. Materials and Methods
3.1. Materials
Collagen of Alaska pollock skin was prepared by the previous methods. Alcalase was
purchase from Genencor International Co. (Wuxi, China); Pepsin, pancreatin, 2,2′ -azino-bis
(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and 2,4,6-Tris(2-pyridyl)-S-triazine (TPTZ) were
purchased from Sigma Chemical Co., (St. Louis, MO, USA). Sephadex G-25, Sephadex G-15 and
SP Sephadex C-25 were purchased from GE Healthcare (Fairfield, CT, USA). Acetonitrile (HPLC grade)
was purchased from Merck KGaA (Darmstadt, Germany). All other reagents used in this study were
analytical grade.
3.2. Preparation of Skin Collagen Hydrolysates of Alaska Pollock
The Alaska pollock skin collagen was mixed with distilled water at a concentration of 1% (w/v).
The mixture was adjusted to pH 9.0 by 1 M NaOH solution and then hydrolyzed using Alcalase (E/S:
5/100, w/w) at 55 ◦ C for 2 h. Alcalase were inactivated in boiling water for 10 min and centrifuged
93
Mar. Drugs 2016, 14, 186
at 5000 rpm for 20 min. The supernatants (ASCH) were collected and then lyophilized. ASCH was
hydrolyzed by the simulated GI digestion [15,29]. A total of 2 g ASCH was dissolved in 150 mL
distilled water and adjusted to pH 2.5 with 6 M HCl. Then, pepsin was added at a ratio of enzyme
to substrate of 1:35 (w/w). After the mixture was incubated at 37 ◦ C for 1 h with shaking (SG-1),
sodium cholate (0.2 mM) and SG-1 (1:1, v/v) were mixed. The pH was adjusted to 7.5 using 2 M
NaOH. Then, pancreatin was added at a ratio of enzyme to substrate of 1:25 (w/w). The mixture
was incubated at 37 ◦ C for 2 h with shaking and then inactivated in boiling water for 15 min and
centrifuged at 5000 rpm for 20 min. The supernatants (SGI-1) were desalinized and then lyophilized.
The second simulated gastric and intestinal digestions were conducted using the same method with
the above processes and SG-2 and SGI-2 were obtained.
3.3. Determination of Characteristics of Hydrolysates
3.3.1. Determination of the Degree of Hydrolysis (DH)
The contents of free amino (–NH2 ) and protein (N) were evaluated according to the ninhydrin
colorimetric method and kjeldah method, respectively. DH was calculated as follows [30]:
DH =
h(mmol/g)
M (µmol/mL)
× 100% = [ 1
− M0 (mmol/g)] ÷ htot (mmol/g) × 100%
htot (mmol/g)
N (mg/mL)
(1)
where h is the number of broken peptide bonds per gram protein; htot is the total number of peptide
bonds per gram original protein (the htot of collagen was 8.41 mmol per gram protein); M1 is the
content of –NH2 in hydrolysate; M0 is the content of –NH2 in original protein; N is the content of
protein in hydrolysate.
3.3.2. Molecular Weight (MW) Distribution
The molecular weight distribution of the different hydrolysates was measured using a
high-performance liquid chromatography (HPLC) system (1260 series, Agilent Scientific, Santa Clara,
CA, USA) with a TSK gel 3000 PWXL column (30 mm i.d. × 7.8 mm, Tosoh, Tokyo, Japan) [17].
The mobile phases were acetonitrile-water (1:1, v/v) in the presence of 0.1% (v/v) trifluoroacetic acid,
and the flow rate was 0.6 mL/min. The process was monitored at 220 nm at 30 ◦ C. A calibration curve
of molecular weight was prepared according to the following standards: cytochrome C (12,500 Da),
insulin (5734 Da), vitamin B12 (1355 Da), hippuryl-histydilleucine (429.5 Da), and glutathione (309.5 Da).
The logarithm of molecular weight (MW) and the retention time (tR) were in a linear relationship and
the formula was calculated as lg MW = −0.284tR + 7.310 (R2 = 0.9922, p < 0.01).
3.3.3. Amino Acid Composition
The different hydrolysates were hydrolyzed under reduced pressure with 6 mol/L HCl at 110 ◦ C
for 22 h and the amino acid compositions were analyzed on a Hitachi amino acid analyzer 835-50
(Hitachi, Tokyo, Japan).
3.4. Antioxidative Activity Assay
3.4.1. ABTS•+ Scavenging Activity Assay
ABTS•+ scavenging activities were determined as described by previous method with a slight
modification [31]. A total of 5 mL of 7 mM ABTS and 88 μL of 40 mM potassium persulfate was mixed
to prepare ABTS•+ stock solution. The mixture was left in the dark at room temperature for 12 h.
The ABTS•+ stock solution was diluted with PBS (2 mM, pH 7.4) to an absorbance of 0.70 ± 0.02 at
734 nm. Then, 0.5 mL of samples were mixed with 4 mL ABTS•+ stock solution. The mixture was
94
Mar. Drugs 2016, 14, 186
shaken for 10 s and left in the 30 ◦ C water bath for 6 min. The absorbance was measured at 734 nm.
The capability of ABTS•+ scavenging was calculated according to the following equation.
Radical scavenging activity (%) =
Ac − ( As − Acs )
× 100
Ac
(2)
where Ac was 0.5 mL ethanol + 4.0 mL ABTS•+ solution; As was 0.5 mL sample + 4.0 mL ABTS•+
solution; Acs was 0.5 mL sample + 4.0 mL ethanol.
3.4.2. FRAP Assay
FRAP was determined according to the method of Alemania et al. [32] with a slight modification.
A total of 300 mM acetic acid buffer solution (pH 3.6) was mixed with 10 mM TPTZ and 20 mM
FeCl3 ·6H2 O according to the rate of 10:1:1. Then the mixture was left in a 37 ◦ C water bath to prepare
the FRAP solution. The mixture of 150 μL samples and 4.5 mL FRAP solution was reacted at 37 ◦ C
for 10 min and then determined the absorbance at 593 nm. A total of 150 μL of distilled water was
used instead of samples solution as a control. The absorbance of different concentrations of FeSO4
solution (0–500 μmol/mL) were determined at 593 nm. The FRAP of samples were expressed as equal
to μmol/mL FeSO4 .
3.4.3. OH· Scavenging Activity Assay
Hydroxyl radical (OH·) scavenging activity was determined by the previous method with slight
modification [33]. Briefly, after 1 mL of samples mixed with 0.3 mL of FeSO4 (8 mM), 1 mL of salicylic
acid (3 mM) and 0.25 mL of H2 O2 (20 mM), the mixture was incubated at 37 ◦ C for 30 min. The reaction
mixture was cooled by flowing water to room temperature. Then, 0.45 mL distilled water was added
into the mixture to make the end volume 3.0 mL. The mixture was centrifuged at 3000 rpm for 10 min.
The absorbance of supernatant was measured at 510 nm, and 1 mL of the solvent solution was used
instead of the sample solution as a control. The capability of scavenging the hydroxyl radical was
calculated according to following equation:
Radical scavenging activity (%) =
A0 − ( A1 − A2 )
× 100
A0
(3)
where A0 was the absorbance of the control without a sample, A1 was the absorbance with a
sample, and A2 was the absorbance of the reagent blank. The IC50 value was defined as an effective
concentration that is required to scavenge 50% of radical activity.
3.5. Purification of Antioxidant Peptides
The SGI-2 was dissolved in distilled water and preliminarily separated by a Sephadex G-25 gel
filtration column (Φ 2.6 cm × 30 cm). The SGI-2 was eluted at a flow rate of 0.5 mL/min and collected
every 6 min. Then, the eluted solution was monitored at 220 nm. The peptide fraction showing the
highest OH· scavenging activity was collected and concentrated.
The peptide fraction with the highest OH· scavenging activity was loaded onto a SP Sephadex
C-25 of cationic exchange column (Φ 1.6 cm × 80 cm), which was previously equilibrated with a
0.02 M sodium acetate buffer (pH 4.0). The peptide fraction was eluted with a linear gradient of NaCl
concentration from 0 to 1.0 M in the same buffer at a flow rate of 0.8 mL/min and monitored at 220 nm.
The elution solution was collected at 6 min intervals and then concentrated. The OH· scavenging
activity of isolated fractions was determined.
The peptide fraction with the highest OH· scavenging activity obtained from SP Sephadex C-25
was dissolved and further separated and desalinated by the Sephadex G-15 gel filtration column
(Φ 2.6 cm × 30 cm). The peptide fraction was eluted at a flow rate of 0.5 mL/min and collected every
6 min. The solution was monitored at 220 nm. The OH· scavenging activity of isolated fractions
was determined.
95
Mar. Drugs 2016, 14, 186
The highest active faction after Sephadex G-15 was further purified by preparative high
performance liquid on a Shim-pack GIS C18 preparative column (Φ 20 mm × 250 mm, Shimadzu,
Kyoto, Japan). The mobile phase A was water, and mobile phase B was acetonitrile containing 0.1%
TFA. The column was eluted by a linear gradient of 5% B to 30% B in 30 min. The flow rate was
10.0 mL/min, and detection wavelength was 220 nm. The above steps were repeated several times
until the different eluted fractions were able to measure the OH· scavenging activity and purify further.
The same fractions were pooled and concentrated to remove acetonitrile and TFA.
The fraction with the highest OH· scavenging activity was passed through a Zorbax
semi-preparative SB-C18 column (Φ 9.4 mm × 250 mm, Agilent Scientific, Santa Clara, CA, USA)
by Agilent HPLC 1260 system (Agilent Scientific, Santa Clara, CA, USA). The fraction was eluted
using a linear gradient of 5% to 25% acetonitrile containing 0.1% TFA (0 to 30 min) at a flow rate of
2.0 mL/min [3]. The column temperature was controlled at 35 ◦ C and the detection wavelength was
220 nm. The fraction showing the high antioxidant activities was concentrated to remove acetonitrile
and TFA and lyophilized.
3.6. Analysis and Identification of Purified Peptide
3.6.1. Assay of High Resolution Mass Spectrometry (LC-ESI-LTQ-Orbitrap-MS)
Purified peptides were eluted from Q Exactive Focus (Thermo Fisher, Tewksbury, MA, USA)
with a Hypersil Gold C18 chromatographic column (1.9 μm, Φ 2.1 mm × 100 mm) at a flow rate of
0.2 mL/min. The mobile phase A was acetonitrile containing 0.1% formic acid, and mobile phase
B was water with 0.1% formic acid. The column was equilibrated for 1 min at 5% A and eluted as
the following flow gradient: 1–2.5 min, 5.0%–10.0% A; 2.5–12.5 min, 10.0%–25.0% A; 12.5–20 min,
25.0%–52.5% A; 20–22 min, 52.5%–95.0% A; 22–24 min, 95.0%–5.0% A; 24–30 min, 5.0% A. The mass
spectrogram was scanned in the positive ion mode. The instrument was set up as follows: scanning
mode, Full MS-ddMS2; resolution, Full MS 35000, ddMS2 17500; scan range: 120~1800 m/z; stepped CE:
10 eV, 20 eV, 30 eV; AGC target: 1 × 105 .
3.6.2. Identification of the Key Peptides
The molecular weights and amino acid sequences of purified peptides were identified by
two software methods: (1) De novo analysis software. The peptide was automatically selected for
fragmentation. The molecular weight and amino acid sequence of the MS date was processed using
de novo software. Peptide identifications were accepted if they could be established at greater than 85%
probability; (2) UniProt of MaxQuant software. Peptides identification was achieved by comparing
mass data against the UniProt data using MaxQuant Server (version 1.5.3.28) [34]. The “fishcollagen”
database was downloaded from http://www.uniprot.org/. The parameters of database searches
were as follows: variable oxidation of methionins, and tolerance of the ions at 5 ppm for parents and
0.5 Da for fragments [35]. No enzyme or static modification was set for database searching. No missed
cleavage was allowed.
3.7. Statistical Analysis
All results obtained were expressed as means ± standard deviation and analyzed by the SPSS
19.0 statistical software (Armonk, NY, USA). Data were analyzed using one-way analysis of variance
(ANOVA). p < 0.05 indicated statistical significance.
4. Conclusions
In this study, the stable collagen hydrolysate of Alaska pollock skin was prepared by
successive simulated gastrointestinal digestion. The DHs, molecular weight distributions, amino acid
compositions and antioxidant activities in vitro were evaluated. With the simulated gastrointestinal
digestions, The DHs and antioxidant activities increased obviously. An antioxidant fraction (A1a3c–p )
was purified by gel filtration chromatography, ion exchange chromatography and high performance
liquid chromatography, and the IC50 value of hydroxyl radical scavenging activity was 7.63 μg/mL.
96
Mar. Drugs 2016, 14, 186
Furthermore, four key peptides of A1a3c–p , including YGCC, DSSCSG, NNAEYYK and PAGNVR,
were analyzed by high resolution mass spectrometry combined with de novo software and UniProt of
MaxQuant software. This paper could provide some help for the application of fish skin collagen and
the identification of key peptides from protein hydrolysates.
Acknowledgments: This work was financially supported by National Grants of China (31360381).
Author Contributions: The authors contributions were as follows: Liping Sun, Weidan Chuang: performing of
the experiments, analysis and interpretation of data, drafting of manuscript; Qingyu Ma: collection of
reagents/materials/analysis tools; Yongliang Zhuang: study concept and design, providing guidance on revising
the manuscript.
Conflicts of Interest: The authors declare that there are no conflict of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Wattanasiritham, L.; Theerakulkait, C.; Wickramasekara, S.; Maier, C.; Stevens, J.F. Isolation and identification
of antioxidant peptides from enzymatically hydrolyzed rice bran protein. Food Chem. 2016, 192, 156–162.
[CrossRef] [PubMed]
Zhuang, Y.; Sun, L.; Zhao, X.; Wang, J.; Hou, H.; Li, B. Antioxidant and melanogenesis inhibitory activities of
collagen peptide from jellyfish (Rhopilemaesculentum). J. Sci. Food Agric. 2009, 89, 1722–1727. [CrossRef]
Zhang, Y.F.; Duan, X.; Zhuang, Y.L. Purification and characterization of novel antioxidant peptides from
enzymatic hydrolysates of tilapia (Oreochromis niloticus) skin gelatin. Peptides 2012, 38, 13–22. [CrossRef]
[PubMed]
Zhuang, Y.L.; Sun, L.P.; Zhao, X.; Hou, H.; Li, B.F. Investigation of gelatin polypeptides of jellyfish
(Rhopilema esculentum) for their antioxidant activity in vitro. Food Technol. Biotechnol. 2010, 48, 222–228.
Mendis, E.; Rajapakse, N.; Byun, H.G.; Kim, S.K. Investigation of jumbo squid (Dosidicus gigas) skin gelatin
peptides for their in vitro antioxidant effects. Life Sci. 2005, 17, 2166–2178. [CrossRef] [PubMed]
Bougatef, A.; Hajji, M.; Balti, R.; Lassoued, I.; Triki-Ellouz, Y.; Nasri, M. Antioxidant and free
radical-scavenging activities of smooth hound (Mustelus mustelus) muscle protein hydrolysates obtained by
gastrointestinal proteases. Food Chem. 2009, 114, 1198–1205. [CrossRef]
Zhou, X.; Wang, C.; Jiang, A. Antioxiant peptides isolated from sea cucumber Stichopus Japonicus. Eur. Food
Res. Technol. 2012, 234, 441–447. [CrossRef]
Cheung, I.W.Y.; Cheung, L.K.Y.; Tan, N.Y.; Li-Chan, E.C.Y. The role of molecular size in antioxidant activity
of peptide fractions from Pacific hake (Merluccius productus) hydrolysates. Food Chem. 2012, 134, 1297–1306.
[CrossRef] [PubMed]
Minekus, M.; Alminger, M.; Alvito, P.; Balance, S.; Bohn, T.; Bourlieu, C.; Carrière, F.; Boutrou, R.;
Corredig, M.; Dupont, D.; et al. A standardised static in vitro digestion method suitable for food—An
international consensus. Food Funct. 2014, 5, 1113–1124. [CrossRef] [PubMed]
Samaranayaka, A.G.; Kitts, D.D.; Li-Chan, E.C. Antioxidative and angiotensin-I-converting enzyme
inhibitory potential of a Pacific Hake (Merluccius productus) fish protein hydrolysate subjected to simulated
gastrointestinal digestion and Caco-2 cell permeation. J. Agric. Food Chem. 2010, 58, 1535–1542. [CrossRef]
[PubMed]
Yan, M.; Li, B.; Zhao, X.; Yi, J. Physicochemical properties of gelatin gels from walleye pollock (Theragra
chalcogramma) skin cross-linked by gallic acid and rutin. Food Hydrocol. 2011, 25, 907–914. [CrossRef]
Hou, H.; Fan, Y.; Wang, S.; Si, L.; Li, B. Immunomodulatory activity of Alaska Pollock hydrolysates obtained
by glutamic acid biosensor-Artificial neural network and the identification of its active central fragmen.
J. Funct. Foods 2016, 24, 37–47. [CrossRef]
Byun, H.G.; Kim, S.K. Purification and characterization of angiotensin I converting enzyme (ACE) inhibitory
peptides from Alaska pollock (Theragra chalcogramma) skin. Process Biochem. 2001, 36, 1155–1162. [CrossRef]
Jia, J.; Zhou, Y.; Lu, J.; Chen, A.; Li, Y.; Zheng, G. Enzymatic hydrolysis of Alaska Pollock
(Theragra chalcogramma) skin and antioxidant activity of the resulting hydrolysate. J. Sci. Food Agric. 2010, 90,
635–640. [PubMed]
You, L.; Zhao, M.; Regenstein, J.M. Changes in the antioxidant activity of loach (Misgurnus anguillicaudatus)
protein hydrolysates during a simulated gastrointestinal digestion. Food Chem. 2010, 120, 810–816. [CrossRef]
97
Mar. Drugs 2016, 14, 186
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
Sun, L.; Bai, X.; Zhuang, Y. Effect of different cooking methods on total phenolic contents and antioxidant
activities of four Boletus mushrooms. J. Food Sci. Technol. 2014, 51, 3362–3368. [CrossRef] [PubMed]
Zhuang, Y.; Zhao, X.; Li, B. Optimization of antioxidant activity by response surface methodology in
hydrolysates of jellyfish (Rhopilema esculentum) umbrella collagen. J. Zhejiang Univ. Sci. B 2009, 10, 572–579.
[CrossRef] [PubMed]
Hou, H.; Fan, Y.; Li, B. Purification and identification of immunomodulating peptides from enzymatic
hydrolysates of Alaska pollock frame. Food Chem. 2012, 134, 821–828. [CrossRef] [PubMed]
Song, R.; Wei, R.B.; Ruan, G.Q. Isolation and identification of antioxidative peptides from peptic hydrolysates
of half-fin anchovy (Setipinna taty). LWT Food Sci. Technol. 2015, 60, 221–229. [CrossRef]
Nimalaratne, C.; Bandara, N.; Wu, J. Purification and characterization of antioxidant peptides from
enzymatically hydrolyzed chicken egg white. Food Chem. 2015, 188, 467–472. [CrossRef] [PubMed]
Chen, N.; Yang, H.; Sun, Y. Purification and identification of antioxidant peptides from walnut
(Juglans regia L.) protein hydrolysates. Peptides 2012, 38, 344–349. [CrossRef] [PubMed]
Hong, J.; Chen, T.T.; Hu, P. Purification and characterization of an antioxidant peptide (GSQ) from Chinese
leek (Allium tuberosum Rottler) seeds. J. Funct. Foods 2014, 10, 144–153. [CrossRef]
Li, Y.W.; Li, B. Characterization of structure-antioxidant activity relationship of peptides in free radical
systems using QSAR models: Key sequence positions and their amino acid properties. J. Theor. Biol. 2013,
318, 29–43. [CrossRef] [PubMed]
Fan, J.; He, J.; Zhuang, Y.; Sun, L. Purification and Identification of Antioxidant Peptides from Enzymatic
Hydrolysates of Tilapia (Oreochromis niloticus) Frame Protein. Molecules 2012, 17, 12836–12850. [CrossRef]
[PubMed]
Kumar, N.S.S.; Nazeer, R.A.; Jaiganesh, R. Purification and biochemical characterization of antioxidant
peptide from horse mackerel (Magalaspis cordyla) viscera protein. Peptides 2011, 32, 1496–1501. [CrossRef]
[PubMed]
Li, Y.W.; Li, B.; He, J. Structure–activity relationship study of antioxidative peptides by QSAR modeling:
The amino acid next to C-terminus affects the activity. J. Pept. Sci. 2011, 17, 454–462. [CrossRef] [PubMed]
Zhang, J.H.; Zhang, H.; Wang, L.; Guo, X.N.; Wang, X.G.; Yao, H.Y. Isolation and identification of
antioxidative peptides from rice endosperm protein enzymatic hydrolysate by consecutive chromatography
and MALDI-TOF/TOF MS/MS. Food Chem. 2010, 119, 226–234. [CrossRef]
Rajapakse, N.; Mendis, E.; Byun, H.G.; Kim, S.K. Purification and in vitro antioxidative effects of giant squid
muscle peptides on free radical-mediated oxidative systems. J. Nutr. Biochem. 2005, 16, 562–569. [CrossRef]
[PubMed]
Liang, Q.; Wang, L.; He, Y.; Wang, Z.; Xu, J.; Ma, H. Hydrolysis kinetics and antioxidant activity of collagen
under simulated gastrointestinal digestion. J. Funct. Food 2014, 11, 493–499. [CrossRef]
Hou, H.; Li, B.; Zhao, X.; Zhang, Z.; Li, P. Optimization of enzymatic hydrolysis of Alaska pollock frame for
preparing protein hydrolysates with low-bitterness. LWT Food Sci. Technol. 2011, 44, 421–428. [CrossRef]
Ma, Y.; Xiong, Y.L.; Zhai, J. Fractionation and evaluation of radical scavenging peptides from in vitro digests
of buckwheat protein. Food Chem. 2010, 118, 582–588. [CrossRef] [PubMed]
Aleman, A.; Gimenez, B.; Perez-Santin, E. Contribution of Leu and Hyp residues to antioxidant and
ACE-inhibitory activities of peptide sequences isolated from squid gelatin hydrolysate. Food Chem. 2011, 125,
334–341. [CrossRef]
Guo, Z.; Liu, H.X.; Ji, X. Hydroxyl radicals scavenging activity of N-substituted chitosan and quaternized
chitosan. Bioorg. Med. Chem. Lett. 2006, 16, 6348–6350. [CrossRef] [PubMed]
MaxQuant Server (version 1.5.3.28). Available online: http://www.coxdocs.org/doku.php?id=maxquant:
common:download_and_installation (accessed on 12 October 2016).
Orsini Delgado, M.C.; Nardo, A.; Pavlovic, M.; Rogniaux, H.; Añón, M.; Tironi, V.A. Identification and
characterization of antioxidant peptides obtained by gastrointestinal digestion of amaranth proteins.
Food Chem. 2016, 197, 1160–1167. [CrossRef] [PubMed]
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
98
marine drugs
Article
Enzymatic Pre-Treatment Increases the Protein
Bioaccessibility and Extractability in Dulse
(Palmaria palmata)
Hanne K. Mæhre *, Ida-Johanne Jensen and Karl-Erik Eilertsen
Faculty of Biosciences, Fisheries and Economics, Norwegian College of Fishery Science,
UIT The Arctic University of Norway, N-9037 Tromsø, Norway; ida-johanne.jensen@uit.no (I.-J.J.);
karl-erik.eilertsen@uit.no (K.-E.E.)
* Correspondence: hanne.maehre@uit.no; Tel: +47-776-46793
Academic Editor: Se-Kwon Kim
Received: 21 September 2016; Accepted: 21 October 2016; Published: 26 October 2016
Abstract: Several common protein extraction protocols have been applied on seaweeds, but extraction
yields have been limited. The aims of this study were to further develop and optimize existing
extraction protocols and to examine the effect of enzymatic pre-treatment on bioaccessibility and
extractability of seaweed proteins. Enzymatic pre-treatment of seaweed samples resulted in a
three-fold increase in amino acids available for extraction. Combining enzymatic pre-treatment
with alkaline extraction resulted in a 1.6-fold increase in the protein extraction yield compared to a
standard alkaline extraction protocol. A simulated in vitro gastrointestinal digestion model showed
that enzymatic pre-treatment of seaweed increased the amount of amino acids available for intestinal
absorption 3.2-fold. In conclusion, enzymatic pre-treatment of seaweeds is effective for increasing the
amount of amino acids available for utilization and may thus be an effective means for increasing the
utilization potential of seaweed proteins. However, both the enzymatic pre-treatment protocol and
the protein extraction protocol need further optimization in order to obtain optimal cost-benefit and
results from the in vitro gastrointestinal digestion model need to be confirmed in clinical models.
Keywords: Palmaria palmata; amino acids; protein; extraction; bioaccessibility; enzymatic treatment;
gastrointestinal digestion
1. Introduction
Along with the expected world population growth in the coming decades, there will be a general
increased demand for food, and particularly for proteins. Around 70% of the Earth is covered by water,
but despite this, only 6.5% of the current global food protein consumption origins from the ocean,
the main sources being fish and shellfish [1]. Besides fish and shellfish, there are many other marine
species that could serve as valuable protein sources and among these are seaweeds. Seaweeds have
long been a part of the diet in East Asia, but are not frequently used in other regions. The global
production of seaweeds was around 25 million tons in 2012, of which 95% came from aquaculture with
China and Indonesia as the main contributors [2]. In order to ensure a stable delivery of raw materials
for industrial or nutritional purposes, cultivation is considered necessary.
Being plants, seaweeds are primary producers of macronutrients, such as carbohydrates,
lipids and proteins. Elements like carbon, nitrogen and phosphorus are efficiently taken up from
the environment into the cells and enzymatically converted to macronutrients, which are further
used for growth or maintenance or stored intracellularly [3]. A large part of seaweed protein is thus
situated intracellularly, in forms of newly formed amino acids or proteins, along with a wide range
of enzymes. In order to optimize the commercial utilization of seaweed proteins, degrading the cell
Mar. Drugs 2016, 14, 196
99
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2016, 14, 196
wall and liberating the intracellular proteins is of great importance. Seaweed cells are, like other plant
cells and unlike animal cells, surrounded by a rigid cell wall functioning mainly as structural support
and protection. The main constituents of the cell walls are complex polysaccharides, but also some
proteins are embedded in it [4]. The cell wall polysaccharides are considered indigestible for humans,
as the human gastrointestinal system does not contain the enzymes necessary for hydrolyzing the
(1-4)-β-D-glycosidic bonds within them. In addition, they make ionic interactions with the attached
proteins, hindering efficient extraction of these [5]. The protein bioaccessibility and extractability of
seaweeds are thus lower than that of proteins of animal origin.
In a previous study [6], it was shown that several seaweed species are rich in proteins of good
quality and thus that they could be utilized as protein sources in food and feed, or as ingredients
in such [6]. Among the species in the mentioned paper, Palmaria palmata was found to be the best
candidate for utilization in food and feed [6], and was thus chosen as a model species for this study.
However, cultivation of this species has been shown to face some challenges when economic viability
is concerned, and prior to commercial utilization of this species, these challenges have to be solved.
For protein extraction, several protocols have been developed, exploring the effects of osmotic
shock, mechanical grinding, ultrasonic and enzymatic degradation of the cell walls [7,8]. The extraction
yields have generally been low and also varied between studies, indicating that there is potential for
optimization of these protocols. Concerning bioaccessibility, evaluated as the amount of amino acids
available for absorption after gastrointestinal digestion, the literature is scarcer.
The aims of this study were thus to further develop and optimize existing extraction protocols
and to examine the effect of enzymatic pre-treatment on bioaccessibility and extractability of
P. palmata proteins.
2. Results
The amino acid composition and protein content in untreated, homogenized and enzymatically
treated Palmaria palmata is shown in Table 1. In the untreated samples, both total amino acid (TAA)
content and the relative proportion of essential amino acids (EAA) were within the same ranges
as previously described [6,9,10]. The amount of available TAA increased significantly both after
homogenization and after enzymatic treatment with the polysaccharidases xylanase and cellulose,
1.7-fold and three-fold, respectively. Enzymatic treatment also increased the amount of available amino
acids significantly compared to homogenization alone. However, there were no significant differences
between the different enzyme concentrations.
Table 1. Amino acid composition in raw (A), homogenized (B) and enzymatically treated
Palmaria palmata (C–E). The enzymes used were xylanase and cellulose in concentrations of 10 (C), 50 (D)
and 100 (E) U·g−1 ·alga. Values are given as mean ± SD (n = 5) and in mg·AA·g−1 ·DW. Different letters
indicate significant differences (p < 0.05) between treatments.
A.
Raw
Material
B.
C.
D.
E.
After
Homogenization
After Enzyme
Pre-Treatment
(10 U)
After Enzyme
Pre-Treatment
(50 U)
After Enzyme
Pre-Treatment
(100 U)
30.4 ± 2.6 c
42.9 ± 4.0 c
14.7 ± 1.3 c
30.0 ± 3.2 c
53.2 ± 6.0 c
31.4 ± 2.4 c
33.7 ± 2.1 c
8.7 ± 0.5 c
27.1 ± 2.2 c
38.5 ± 2.5 c
13.2 ± 0.8 c
26.8 ± 2.7 c
47.1 ± 4.8 c
28.4 ± 1.6 c
29.5 ± 3.4 c
7.9 ± 0.8 c
Essential Amino Acids (EAA)
Threonine
Valine
Methionine
Isoleucine
Leucine
Phenylalanine
Lysine
Histidine
8.9 ± 0.7 a
12.4 ± 0.9 a
4.0 ± 0.4 a
8.2 ± 0.7 a
14.3 ± 1.8 a
8.7 ± 0.6 a
11.0 ± 2.0 a
2.6 ± 0.5 a
16.8 ± 3.3 b
22.6 ± 3.6 b
9.0 ± 1.7 b
15.8 ± 3.0 b
27.7 ± 4.7 b
16.6 ± 2.9 b
19.5 ± 3.6 b
4.7 ± 0.7 b
100
25.7 ± 2.9 c
36.9 ± 5.0 c
13.1 ± 2.2 b,c
26.2 ± 4.1 c
46.1 ± 6.3 c
26.5 ± 3.0 c
28.8 ± 4.3 c
7.0 ± 0.8 c
Mar. Drugs 2016, 14, 196
Table 1. Cont.
A.
Raw
Material
B.
C.
D.
E.
After
Homogenization
After Enzyme
Pre-Treatment
(10 U)
After Enzyme
Pre-Treatment
(50 U)
After Enzyme
Pre-Treatment
(100 U)
Non-Essential Amino Acids (NEAA)
Aspartic acid *
Serine
Glutamic acid *
Proline
Glycine
Alanine
Cysteine
Tyrosine
Arginine
21.9 ± 1.2 a
10.5 ± 0.8 a
20.4 ± 1.8 a
9.1 ± 0.4 a
12.1 ± 0.8 a
16.4 ± 1.4 a
1.4 ± 0.4 a
6.9 ± 0.9 a
11.5 ± 1.1 a
32.1 ± 5.5 a
20.5 ± 3.9 b
27.7 ± 5.6 a
14.0 ± 3.1 a
20.7 ± 3.9 b
28.7 ± 5.2 b
3.0 ± 0.8 a
13.3 ± 2.8 a
22.5 ± 4.4 b
50.9 ± 6.2 b
31.8 ± 4.3 c
43.1 ± 5.3 b
23.8 ± 2.2 b
32.4 ± 3.3 c
44.7 ± 7.0 c
4.4 ± 1.7 b
23.6 ± 3.2 a,b
34.7 ± 4.9 c
59.2 ± 5.7 b
37.7 ± 3.9 c
50.3 ± 5.2 b
27.7 ± 3.8 b
37.6 ± 3.5 c
50.5 ± 5.1 c
7.1 ± 1.2 b
29.2 ± 2.7 b
41.6 ± 2.3 c
52.8 ± 4.4 b
33.2 ± 3.0 c
44.1 ± 3.1 b
25.3 ± 2.4 b
34.6 ± 2.0 c
43.7 ± 3.1 c
7.1 ± 1.4 b
26.2 ± 2.7 b
35.8 ± 3.6 c
Sum
180.5 ± 12.3 a
312.0 ± 54.2 b
495.2 ± 59.5 c
586.1 ± 53.5 c
521.2 ± 40.7 c
Relative amount EAA (%)
38.9 ± 0.6
a
42.6 ± 0.9
b
42.5 ± 1.2
b
41.8 ± 0.3
b
41.9 ± 0.5 b
* Aspartic acid and glutamic acid represent the sums of aspartic acid + asparagine and glutamic acid + glutamine,
respectively, as asparagine and glutamine are present in their acidic forms after acidic hydrolysis. Tryptophan is
lacking due to destruction during acidic hydrolysi.
In Figure 1, it is shown that the amount of each essential amino acid in raw and enzymatically
treated (50 U xylanase and cellulose g−1 ·alga) P. palmata proteins, is equal to or higher than the
corresponding amount in the reference protein defined by FAO/WHO/UNU [11].
Figure 1. Essential amino acids composition (mg·EAA·g−1 protein) in raw and enzymatically treated
Palmaria palmata relative to the reference protein set by WHO/FAO/UNU. The values are given as
mean ± SD (n = 5) and in percent of the reference protein. Tryptophan is lacking due to destruction
during acidic hydrolysis.
The results of the protein extraction experiment are shown in Table 2. Here, it is seen that alkaline
extraction, either alone or in combination with 3.5% saline, was more efficient than 3.5% saline alone
and ethanol in extracting alga proteins. Extraction at 60 ◦ C seemed to increase the extraction efficiency
compared to extraction at 23 ◦ C, however, this effect was significant only for 0.05 M NaOH, 0.1 M
NaOH and 0.1 M NaOH in 3.5% saline. Alkaline extraction following enzymatic pre-treatment
increased the protein extraction yield significantly compared to all other extraction solvents and on
both temperatures.
Following a simulated in vitro gastrointestinal digestion of raw and enzymatically treated
P. palmata, the amount of amino acids available for absorption were significantly (p < 0.05) higher in all
101
Mar. Drugs 2016, 14, 196
of the treated samples than in the raw sample (Figure 2). There were no significant differences between
the different enzyme concentrations.
Table 2. Total amino acids and extraction yield in extracts of Palmaria palmata using solutions as
described in Table 3, along with alkaline extraction following enzymatic pre-treatment (50 U·g−1 ·alga).
Values are reported as mean ± SD (n = 5) and in mg·AA·g−1 ·DW for total amino acids and in percent of
raw material DW for extraction yields. Different small letters indicate significant differences (p < 0.05)
between extractions at 23 ◦ C, while different capital letters indicate significant differences (p < 0.05)
between extractions at 60 ◦ C. * indicate significant differences (p < 0.05) between 23 ◦ C and 60 ◦ C using
the same extraction solvent.
Extraction Temperature
23 ◦ C
60 ◦ C
Solvent
Amount Extracted
Amino Acids
(mg·g−1 ·DW)
Extraction
Yield (%)
Amount Extracted
Amino Acids
(mg·g−1 ·DW)
0.01 M NaOH
55.8 ± 10.2 b
17.9
59.9 ± 7.2 B
19.2
B
0.05 M NaOH
b,c
25.8
118.1 ± 25.2 B,C, *
37.9
39.1
A
80.6 ± 9.5
Extraction
Yield (%)
C
0.1 M NaOH
90.1 ± 7.9 c
28.9
122.0 ± 10.5 C, *
D
3.5% NaCl
18.3 ± 4.7 a
5.9
26.6 ± 7.0 A
8.5
E
70% Ethanol
23.5 ± 4.6 a
7.5
27.3 ± 4.6 A
8.8
F
0.1 M NaOH in 3.5% NaCl
58.8 ± 13.3 b
18.8
114.6 ± 19.2 C, *
36.7
G
0.1 M NaOH following
enzymatic pre-treatment
409.2 ± 46.0 d
69.8
442.8 ± 86.5 D
75.6
Figure 2. Total amino acids (AA) liberated in the mouth, stomach and intestinal fluids during
gastrointestinal (GI) digestion of raw and enzymatically treated Palmaria palmata. Values are reported as
mean ± SD (n = 5) and in mg·AA·g−1 ·DW of the source material. Different letters indicate significant
differences (p < 0.05) between treatments, within each GI phase.
3. Discussion
Plant cells, including seaweeds, are surrounded by a rigid cell wall comprised of complex
polysaccharides, with small amounts of proteins embedded in it [4]. Being primary producers of
macronutrients, the algal cells contain large amounts of various enzymes involved in the conversion
of absorbed elements to macronutrients. In addition, newly formed amino acids and proteins are
stored intracellularly [3]. Extraction and subsequent utilization of these depend on disruption of
the cell wall. In this study, cell wall disruption was performed using mechanical force, namely by
102
Mar. Drugs 2016, 14, 196
Ultra Turrax homogenization, and enzymatic degradation. Cellulose is present in most plant cell
walls. However, in red algae, the class in which P. palmata belong, xylans has been shown to make
up a large proportion of the extracellular matrix, along with cellulose [12]. Thus, it was decided to
use a combination of enzymes directed towards both of these polysaccharides for the experiments in
this study.
Ensuring an adequate intake of EAA is necessary and when examining efficient protocols for
increasing the amino acids available for hydrolysis it is important that the composition of EAA is not
negatively altered. Previously [10], it has been shown that P. palmata proteins fulfill the demands of a
complete protein, as defined by FAO/WHO/UNU [11]. This study confirmed the previous findings
regarding protein quality (Figure 1) and the enzymatic treatment did not alter the EAA composition.
Most common protein extraction protocols are based on the principle that cells burst due to osmotic
shock when exposed to hypotonic conditions, and involve exposing the tissue to water or weak buffer
solutions. This is a valid principle and an efficient procedure when extracting proteins of animal origin.
In plants, however, the cell wall complicates protein extraction procedures. Plant cells hold a defense
mechanism against osmotic variations, a mechanism in which intracellular vacuoles containing fluid of
high ionic strength are central. When exposed to hypotonic solutions, water or buffer will flow into the
vacuole, increasing its size and pushing the other cell organelles towards the cell wall. The intracellular
pressure will thus increase, but the cell wall will prevent the cell from bursting [13]. Previous studies
have shown that protein extraction protocols based solely on the osmotic shock principle are not
very efficient for the extraction of seaweed proteins [5,14]. Several extraction protocols aiming at
destruction of the cell wall, either by applying mechanical force or by enzymatic treatment, has been
developed in order to overcome this problem [5,7,8]. The extraction yields have, however, been limited
in most protocols.
In this study, several common extraction protocols were examined and modified in order
to increase the protein extraction yield. It is well-known that the solubility of different proteins
depends on the solvent used and in a previous paper it was shown that heat treatment increased
the bioaccessibility of dulse proteins [10]. The extraction variables chosen were thus two extraction
temperatures (23 ◦ C and 60 ◦ C), along with different types and concentrations of extraction solvents
based on the solubility properties of different proteins. The solvents used were water, sodium
hydroxide, sodium chloride and ethanol, along with combinations of these. Alkaline extraction
following enzymatic pre-treatment was also included.
The extraction yields ranged from around 5% using 3.5% saline as extraction solvent at room
temperature to 40% using 0.1 M NaOH as solvent at 60 ◦ C (Table 2). Applying polysaccharidases for
enzymatic destruction of the cell wall was shown to be more efficient than mechanical degradation,
as extraction of the pre-treated alga resulted in an extraction yield of 75% at 60 ◦ C, a 1.63-fold increase
compared to the water-alkaline protocol (Table 2). This yield is markedly higher than reported in other
studies using enzymatic degradation of the cell wall [5,8]. It is, however, difficult to compare results
from different studies directly due to differences in the methods of protein determination, along with
type and concentration of polysaccharidases used.
After enzymatic treatment, the algae samples were subjected to a simulated in vitro
gastrointestinal model (Figure 2) in order to investigate the effect of enzymatic treatment on the
bioaccessibility of seaweed proteins. The liberation of amino acids into the digesta increased during
the digestion process both for the raw samples and the samples exposed for enzymatic treatment.
At the end of the process, simulating the end of the small intestine, the liberation of TAA was around
2.5–3.2 times higher in the enzymatically treated samples than in the raw samples. This increase
corresponds well with the increased amount of amino acids available for digestion as a result of the
enzymatic treatment as seen in Table 1 and indicates that GI digestion did not contribute to a further
increase. The fact that the GI digestion was not more efficient in liberating amino acids from the
enzymatically treated algae compared to the raw samples may indicate that the increased amount of
amino acids released during the enzymatic treatment was not released as intact proteins, but rather as
103
Mar. Drugs 2016, 14, 196
smaller peptides or free amino acids. As some of the intracellular proteins are non-specific hydrolytic
enzymes normally participating in the cellular protein turnover, it is likely to believe that these
may have contributed to a partial degradation of the intracellular proteins prior to the GI digestion.
Around 4%–17% of the intracellular amino acids have also been shown not to be protein bound [3].
To sum up the findings in this study, it was shown that enzymatic pre-treatment of P. palmata
increased the protein bioaccessibility and extractability, mainly by increasing the amount of amino
acids available for hydrolysis. These results indicate that enzymatic pre-treatment of algae may increase
the utilization potential of seaweed proteins. However, both the enzymatic pre-treatment protocol and
the protein extraction protocol need to be optimized further in order to obtain optimal cost–benefit
and results from the in vitro gastrointestinal digestion model need to be confirmed in clinical studies.
4. Experimental Section
4.1. Raw Material
Dehydrated Palmaria palmata was purchased from “Fremtidens mat” (Oslo, Norway). The seaweed
was harvested at the south coast of Iceland. Following harvest, the seaweed was flushed with seawater
and dehydrated at 40 ◦ C for 24 h using electrical fans driven by geothermal energy. The dried seaweed
was thereafter packed in airtight bags, before transport to Norway. Seaweed samples were cut into
pieces of 0.5 cm × 0.5 cm prior to treatments. All chemical used in these experiments were of analytical
grade and purchased from Sigma Chemical Co. (St. Louis, MO, USA) unless otherwise stated.
4.2. Water Content
Water content was determined using a modified version of AOAC method 950.46B [15].
Approximately 0.5 g of seaweed sample (n = 5), was dried at 105 ◦ C until constant weight. Water content
was determined gravimetrically. The water contents were only used for calculation of dry matter in
the different fractions and results are thus presented as supplementary material (Table S1).
4.3. Protein Extraction
Protein extraction was performed according to Barbarino and Lourenço [7], with some
modifications (Figure 3). In short, approximately 100 mg of milled seaweed samples were dissolved in
8 mL distilled water, homogenized using an Ultra Turrax T8 basic homogenizer (IKA Werke GmbH,
Staufen, Germany) and incubated for 24 h at either 23 ◦ C or 60 ◦ C. The samples were centrifuged at
4000× g at 4 ◦ C for 15 min. The supernatant was removed and the pellet was re-dissolved in 8 mL of
the different solvents described in Table 3 and incubated for 24 h at 23 ◦ C or 60 ◦ C. The samples were
exposed to constant shaking during both incubations. Samples were then centrifuged at 4000× g at
4 ◦ C for 15 min. The two supernatants were combined and the final extracts were subjected to amino
acid analysis.
Table 3. Overview of the types and concentrations of the different extraction solvents used in this
study, along with the types of extracted protein relevant for each solvent.
Extract
Extraction Solvent
Type of Extracted Protein
All
A
B
C
D
E
F
G
Water
0.01 M NaOH
0.05 M NaOH
0.1 M NaOH
3.5% NaCl
70% Ethanol
0.1 M NaOH in 3.5% NaCl
Enzymes + 0.1 M NaOH
Albumins
Glutelins
Glutelins
Glutelins
Globulins
Prolamines
Combination
Combination
104
Mar. Drugs 2016, 14, 196
Algaȱrawȱmaterialȱ(SampleȱA,ȱTableȱ1)ȱ
+ȱ
ȱȱȱȱȱȱȱȱ H2Oȱ
ȱ
ȱ
Homogenizationȱ(UltraȱTurrax,ȱ20,000ȱrpm,ȱ30ȱs)ȱ
ȱ
Incubationȱ(24ȱh,ȱ23ȱorȱ60ȱ°C,ȱconstantȱshaking)ȱ
ȱ
Centrifugationȱ(20ȱmin,ȱ4ȱ°C,ȱ4000×ȱg)ȱ
ȱ
ȱ
Pelletȱ ȱ
ȱ
ȱ
Supernatantȱ ȱ
ȱ
ȱ
ȱ
ȱ
ȱ
ȱ
ȱ
ȱ
ȱ
ȱȱȱȱȱȱȱȱȱȱȱ ȱ
ȱ
ȱ
ȱ
ȱ
ȱȱȱȱȱȱȱȱȱȱ
ȱ
ȱ
ȱ
ȱ
ȱ
ȱȱȱȱȱȱȱȱȱȱȱȱAAAȱȱȱȱȱȱȱ
ȱȱȱȱȱ
ȱ
ȱ
Extractionȱȱ
(SampleȱB,ȱTableȱ1)ȱ solutionsȱ(A–F,ȱTableȱ3)ȱ
ȱȱȱȱȱȱȱȱȱȱȱȱȱ
ȱ
ȱ
ȱ
ȱ
ȱ
ȱ
ȱ
ȱ
ȱ
ȱȱȱȱIncubationȱ(24ȱh,ȱ23ȱorȱ60ȱ°C,ȱconstantȱshaking)ȱ
ȱ
ȱ
ȱ
ȱ
ȱ
Centrifugationȱ(20ȱmin,ȱ4ȱ°C,ȱ4ȱ000×ȱg)ȱ
ȱ
ȱ
Pelletȱ ȱ
ȱ
ȱ
Supernatantȱ ȱ
ȱ
ȱ
ȱ
ȱ
ȱ
AAAȱ(SamplesȱA–F,ȱTableȱ2)ȱ
Figure 3. Flowchart of protein extraction and sample collections. AAA: amino acid analysis.
4.4. Enzymatic Pre-Treatment
Enzymatic pre-treatment was performed according to Harnedy and FitzGerald [8], with some
modifications (Figure 4). Approximately one gram of seaweed was dissolved in 28 mL of 0.05 M sodium
acetate buffer (pH 5.0), homogenized for 30 s using an Ultra Turrax T25 and incubated for 30 min at
40 ◦ C under constant shaking. Enzyme solutions containing 10, 50 or 100 U xylanase and cellulase
(both from Trichoderma longibrachiatum) in 2 mL sodium acetate buffer was added and incubation
continued for 18 h at 40◦ C under constant agitation. Thereafter, the samples were centrifuged at
4000× g at 4 ◦ C for 15 min, before separating supernatants and pellets. Pellets were subjected to amino
acid analysis, in vitro gastrointestinal digestion and alkaline protein extraction. Algae samples without
enzymes and buffer samples with enzymes were used as controls.
For alkaline extraction following enzymatic pre-treatment, pellets were re-dissolved in 8 mL 0.1 M
NaOH, incubated for 24 h either at 23 ◦ C or 60 ◦ C with constant shaking and centrifuged at 4000× g at
4 ◦ C for 15 min. Supernatants and pellets were separated and supernatants were subjected to amino
acid analysis.
105
Mar. Drugs 2016, 14, 196
Alga raw material
+
Na-acetate buffer, pH 5.0
+
Cellulase + Xylanase
Incubation (24 h, 40 °C, constant shaking)
Centrifugation (20 min, 4 °C, 4000× g)
Pellet
Supernatant
+
GI digestion 0.1 M NaOH AAA (Samples C, D and E, Table 1)
Incubation (24 h, 23 or 60 °C, constant shaking)
Centrifugation (20 min, 4 °C, 4000× g)
Pellet
Supernatant
AAA (Sample G, Table 2)
Figure 4. Flowchart of enzymatic pre-treatment and sample collections. GI: gastrointestinal,
AAA: amino acid analysis.
4.5. In Vitro Gastrointestinal Digestion
Raw seaweed and seaweed after enzymatic pre-treatment were subjected to a simulated in vitro
gastrointestinal digestion model as described by Versantvoort et al. [16], with the modifications
described by Maehre et al. [10]. Approximately 0.5 g of the seaweed samples were mixed with 6 mL of
a solution mimicking salivary fluid (pH 6.80 ± 0.02) and homogenized with an Ultra Turrax T25 for
30 s, followed by incubation at 37 ◦ C for 5 min under constant rotation. After centrifugation at 2750× g
for 3 min, a 2 mL sample from the supernatant was collected and to the rest of the digesta, 12 mL of a
solution mimicking gastric fluid (pH 1.30 ± 0.01) was added. The mixture was incubated at 37 ◦ C for
120 min under constant rotation and the sampling procedure was repeated. Then, 12 mL of a solution
mimicking duodenal fluid (pH 8.10 ± 0.02), 6 mL of bile solution (pH 8.22 ± 0.02) and 2 mL of 1 M
NaHCO3 was added and another 120-min incubation at equal conditions was applied, followed by
collection of a final 2 mL sample. For inactivation of the enzymes, all of the GI samples were kept at
90 ◦ C for 5 min and then put on ice. Samples without seaweed were subjected to the same procedure
and used for adjustment of amino acid contribution from the digestive enzymes.
4.6. Amino Acid Analysis
Raw and homogenized seaweed samples, along with pellets from enzymatic pre-treatment and
supernatant samples from the different experiments were subjected to analysis of total amino acids
(TAA). Sample preparations were similar to those described previously [10]. Approximately 200 mg of
106
Mar. Drugs 2016, 14, 196
raw seaweed samples and pellets after enzymatic pre-treatment were dissolved in 0.7 mL distilled
water, 0.5 mL 20 mM norleucine (internal standard) and 1.2 mL of 12 M hydrochloric acid (HCl).
Samples were flushed in N2 -gas for 15 s and hydrolyzed at 110 ◦ C for 24 h, according to Moore and
Stein [17]. Aliquots of 0.1 mL of the hydrolyzed samples were evaporated under N2 and re-dissolved
in 1 mL lithium citrate buffer, pH 2.2. For the liquid samples (supernatants from all experiments and
digesta from the GI model), 0.05 mL 20 mM norleucine and 0.55 mL 12 M HCl were added to 0.5 mL
sample, before flushing with N2 and hydrolysis as described above. After hydrolysis, 0.1 mL sample
was evaporated and re-dissolved in 0.5 mL lithium citrate buffer, pH 2.2.
All amino acid samples were analyzed chromatographically and identified as described
previously [18] using a Biochrom 30 amino acid analyzer (Biochrom Co., Cambridge, UK).
Tryptophan is destroyed during acidic hydrolysis and is thus not included in the results.
4.7. Statistics
Statistical analysis was performed using SPSS 23 (SPSS Inc., Chicago, IL, USA). Tests of normality
(Shapiro–Wilk’s test) and homogeneity of variance (Levene’s test) returned normal distribution
with unequal variance for all chemical variables. Thus, one-way analysis of variance (ANOVA)
was performed, followed by the Dunnett’s T3 post hoc test for evaluation of statistics. Means were
considered significantly different at p < 0.05.
Supplementary Materials: The following are available online at www.mdpi.com/1660-3397/14/11/196/s1.
Table S1: Water content of raw, homogenized and enzyme-treated Palmaria palmata. Values are presented as
mean ± SD (n = 5) and in g·kg−1 ·alga.
Acknowledgments: This work was supported by the Publication Fund of UIT The Arctic University of Norway.
Author Contributions: H.K.M. has contributed to planning the experiments, conducted analytical work and
been the main author of the manuscript; I.-J.J. has contributed to planning the experiments, conducted analytical
work, and contributed to discussions and preparation of the manuscript; K.-E.E. has contributed to planning the
experiments, and contributed to discussions and preparation of the manuscript.
Conflicts of Interest: None of the authors report any conflicts of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
Béné, C.; Barange, M.; Subasinghe, R.; Pinstrup-Andersen, P.; Merino, G.; Hemre, G.I.; Williams, M.
Feeding 9 billion by 2050-Putting fish back on the menu. Food Secur. 2015, 7, 261–274. [CrossRef]
Food and Agricultural Organization (FAO). The State of World Fisheries and Aquaculture 2014—Opportunities
and Challenges; Food and Agricultural Organization of the United Nations: Rome, Italy, 2014; p. 223.
Hurd, C.L.; Harrison, P.J.; Bischof, K.; Lobban, C.S. Nutrients. In Seaweed Ecology and Physiology; Hurd, C.L.,
Harrison, P.J., Bischof, K., Lobban, C.S., Eds.; Cambridge University Press: Cambridge, UK, 2014; pp. 238–293.
Kloareg, B.; Quatrano, R.S. Structure of the cell walls of marine algae and ecophysiological functions of the
matrix polysaccharides. Oceanogr. Mar. Biol. 1988, 26, 259–315.
Joubert, Y.; Fleurence, J. Simultaneous extraction of proteins and DNA by an enzymatic treatment of the cell
wall of Palmaria palmata (Rhodophyta). J. Appl. Phycol. 2008, 20, 55–61. [CrossRef]
Maehre, H.K.; Malde, M.K.; Eilertsen, K.E.; Elvevoll, E.O. Characterization of protein, lipid and mineral
contents in common Norwegian seaweeds and evaluation of their potential as food and feed. J. Sci. Food Agric.
2014, 94, 3281–3290. [CrossRef] [PubMed]
Barbarino, E.; Lourenço, S.O. An evaluation of methods for extraction and quantification of protein from
marine macro- and microalgae. J. Appl. Phycol. 2005, 17, 447–460. [CrossRef]
Harnedy, P.A.; FitzGerald, R.J. Extraction of protein from the macroalga Palmaria palmata. LWT Food
Sci. Technol. 2013, 51, 375–382. [CrossRef]
Galland-Irmouli, A.V.; Fleurence, J.; Lamghari, R.; Lucon, M.; Rouxel, C.; Barbaroux, O.; Bronowicki, J.P.;
Villaume, C.; Gueant, J.L. Nutritional value of proteins from edible seaweed Palmaria palmata (Dulse).
J. Nutr. Biochem. 1999, 10, 353–359. [CrossRef]
107
Mar. Drugs 2016, 14, 196
10.
11.
12.
13.
14.
15.
16.
17.
18.
Maehre, H.K.; Edvinsen, G.K.; Eilertsen, K.E.; Elvevoll, E.O. Heat treatment increases the protein
bioaccessibility in the red seaweed dulse (Palmaria palmata), but not in the brown seaweed winged kelp
(Alaria esculenta). J. Appl. Phycol. 2016, 28, 581–590. [CrossRef]
Food and Agriculture Organization (FAO); World Health Organization (WHO); United Nations University
(UNU). Protein and Amino Acid Requirements in Human Nutrition: Report of a Joint FAO/WHO/UNU Expert
Consultation; World Health Organization: Geneva, Switzerland, 2007; p. 265.
Popper, Z.A.; Michel, G.; Herve, C.; Domozych, D.S.; Willats, W.G.T.; Tuohy, M.G.; Kloareg, B.; Stengel, D.B.
Evolution and diversity of plant cell walls: From algae to flowering plants. Annu. Rev. Plant Biol. 2011, 62,
567–588. [CrossRef] [PubMed]
Karsten, U. Seaweed acclimation to salinity and desiccation stress. In Seaweed Biology: Novel Insights into
Ecophysiology, Ecology and Utilization; Wiencke, C., Bischof, K., Eds.; Springer: Heidelberg, Germany, 2012;
pp. 87–107.
Fleurence, J.; LeCoeur, C.; Mabeau, S.; Maurice, M.; Landrein, A. Comparison of different extractive
procedures for proteins from the edible seaweeds Ulva rigida and Ulva rotundata. J. Appl. Phycol. 1995,
7, 577–582. [CrossRef]
Horwitz, W. Official Methods of Analysis of AOAC International;
AOAC International:
Gaithersburg, MD, USA, 2004.
Versantvoort, C.H.M.; Oomen, A.G.; Van de Kamp, E.; Rompelberg, C.J.M. Sips AJAM Applicability of an
in vitro digestion model in assessing the bioaccessibility of mycotoxins from food. Food Chem. Toxicol. 2005,
43, 31–40. [CrossRef] [PubMed]
Moore, S.; Stein, W.H. Chromatographic determination of amino acids by the use of automatic recording
system. Methods Enzymol. 1963, 6, 819–831.
Maehre, H.K.; Hamre, K.; Elvevoll, E.O. Nutrient evaluation of rotifers and zooplankton: Feed for marine
fish larvae. Aquac. Nutr. 2013, 19, 301–311. [CrossRef]
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
108
marine drugs
Review
Natural Proline-Rich Cyclopolypeptides from Marine
Organisms: Chemistry, Synthetic Methodologies and
Biological Status
Wan-Yin Fang 1,† , Rajiv Dahiya 2, *,† , Hua-Li Qin 1, *, Rita Mourya 3 and Sandeep Maharaj 2
1
2
3
*
†
School of Chemistry, Chemical Engineering and Life Science, Wuhan University of Technology,
Wuhan 430070, China; wanyinfang@whut.edu.cn
Laboratory of Peptide Research and Development, School of Pharmacy, Faculty of Medical Sciences,
The University of the West Indies, Saint Augustine, Trinidad and Tobago, West Indies;
Sandeep.Maharaj@sta.uwi.edu
School of Pharmacy, College of Medicine and Health Sciences, University of Gondar, Gondar 196, Ethiopia;
ritz_pharma@yahoo.co.in
Correspondence: Rajiv.Dahiya@sta.uwi.edu (R.D.); qinhuali@whut.edu.cn (H.-L.Q.);
Tel.: +1868-493-5655 (R.D.); +86-27-8774-9379 (H.-L.Q.)
These authors contribute equally to this work.
Academic Editor: Se-Kwon Kim
Received: 11 September 2016; Accepted: 15 October 2016; Published: 26 October 2016
Abstract: Peptides have gained increased interest as therapeutics during recent years. More than
60 peptide drugs have reached the market for the benefit of patients and several hundreds of
novel therapeutic peptides are in preclinical and clinical development. The key contributor to this
success is the potent and specific, yet safe, mode of action of peptides. Among the wide range of
biologically-active peptides, naturally-occurring marine-derived cyclopolypeptides exhibit a broad
range of unusual and potent pharmacological activities. Because of their size and complexity,
proline-rich cyclic peptides (PRCPs) occupy a crucial chemical space in drug discovery that may
provide useful scaffolds for modulating more challenging biological targets, such as protein-protein
interactions and allosteric binding sites. Diverse pharmacological activities of natural cyclic peptides
from marine sponges, tunicates and cyanobacteria have encouraged efforts to develop cyclic peptides
with well-known synthetic methods, including solid-phase and solution-phase techniques of peptide
synthesis. The present review highlights the natural resources, unique structural features and the
most relevant biological properties of proline-rich peptides of marine-origin, focusing on the potential
therapeutic role that the PRCPs may play as a promising source of new peptide-based novel drugs.
Keywords: proline-rich cyclic peptide; marine sponge; marine tunicate; peptide synthesis;
stereochemistry; lipophilicity parameter; pharmacological activity
1. Introduction
An interesting class of marine cyclic peptides is represented by the proline-rich compounds
usually containing more than six or seven amino acid residues. The role of proline in these molecules
has been linked to the control of the conformation of the molecule in solution because of the restricted
φ of proline. The proline-rich cyclic peptides (PRCPs) are formed by linking one end of the peptide
and the other with an amide bond or other chemically-stable bonds. Some of them are used in the
clinic, e.g., gramicidin S and tyrocidine with bactericidal activity, while others are in clinical trials,
e.g., dehydrodidemnin B, and most of them originate from natural resources. Although the literature
is enriched with reports concerned with marine-derived linear proline-rich bioactive peptides [1–5],
e.g., dolastatin 15, kurahyne B, jahanyne, cemadotin, koshikamide A1 , etc., PRCPs from marine
Mar. Drugs 2016, 14, 194
109
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2016, 14, 194
resources are becoming popular and attracting the attention of scientists nowadays, due to their unique
structural features and a wide range of the biological properties, like cytotoxicity [6], antibacterial
activity [7], antifungal activity [8], immunosuppressive activity [9], anti-inflammatory activity [10],
anti-HIV activity [11], repellent (antifouling) activity [12], antitubercular activity [13] and antiviral
activity [14], associated with them. PRCPs include a large and heterogeneous group of small to
large-sized oligopeptides characterized by the presence of proline units often constituting peculiar
sequences, which confers them a typical structure that determines the various biological functions
endowed by these molecules. As several features make PRCPs attractive lead compounds for drug
development, as well as nice tools for biochemical research, scientists are focusing and giving diverse
efforts to develop biologically-active proline-rich cyclic peptide compounds.
1.1. Natural Resources
Various natural sources of PRCPs include marine sponges, ascidians, different genera of
cyanobacteria and higher plants. One of the potent resources is sessile aquatic animals, i.e., sponges like
Kenyan sponge Callyspongia abnormis [15], Dominican sponge Eurypon laughlini [16], Indonesian sponge
Callyspongia aerizusa [17], sponge Ircinia sp. [18], Jamaican sponge Stylissa caribica [19], Yongxing
Island sponge Reniochalina stalagmitis [20], Vanuatu sponge Axinella carteri [21], Korean sponge
Clathria gombawuiensis [22], Fijian sponge Stylotella aurantium [23], Papua New Guinea sponge
Stylissa massa [24], South China sponge Phakella fusca [25], Lithistid sponge Scleritoderma nodosum [26],
Borneo sponge Pseudaxinyssa sp. [27], Philippines sponge Myriastra clavosa [28], Papua New Guinea
sponge Stylotella sp. [29], Comoros sponge Axinella cf. carteri [30], Okinawan sponge Hymeniacidon sp. [31],
Indo-Pacific sponges Phakellia costata and Stylotella aurantium [32], Indonesian sponge Stylissa sp. [33],
Red sea sponge Stylissa carteri [34], Western Pacific Ocean sponge Hymeniacidon sp. [35], Puerto Rican
sponge Prosuberites laughlini [36], Micronesian sponge Cribrochalina olemda [37], Indonesian sponge
Sidonops microspinosa [38], Palau sponge Axinella sp. [39], etc. The structures of various proline-rich
cyclopolypeptides from marine sponges are compiled in Figure 1.
Other sources of proline-rich cyclooligopeptides are marine tunicates, like compound
ascidian Didemnum molle [40], Ishigaki Island sea slug Pleurobranchus forskalii [41], Fijian ascidian
Eudistoma sp. [42], Caribbean tunicate Trididemnum solidum [43], unidentified Brazilian ascidian
(family Didemnidae) [44], Mediterranean ascidian Aplidium albicans [45], cyanobacteria like Papua
New Guinea cyanobacterium Lyngbya semiplena [46], Red Sea cyanobacterium Moorea producens [47],
Florida Everglades cyanobacterium Lyngbya sp. [48], Northern Wisconsin cyanobacterium
Trichormus sp. UIC 10339 [49], toxic cyanobacterium Nostoc sp. 152 [50], Kenyan cyanobacterium
Lyngbya majuscule [51], mollusks like Papua New Guinea mollusk (sea hare) Dolabella auricularia [52] and
alga like Indonesian red alga (Rhodophyta) Ceratodictyon spongiosum containing the symbiotic sponge
Sigmadocia symbiotica [10]. Structures of diverse proline-rich cyclopeptides from marine tunicates and
cyanobacteria are tabulated in Figure 2. Besides this, proline-containing cyclooligopeptides are also
obtained from roots, stems, barks, seeds, fruit peels of higher plants, as well as from bacteria and
fungi [53–66].
Purification procedures of PRCPs isolated from sea animals, like ascidians, sponges and mollusk,
usually include initial extraction with methanol (MeOH), partitions of these extracts with organic
solvents of increasing polarities to render diverse organic fractions and chromatographic steps on
silica and Sephadex LH-20 columns, as well as the use of reversed phase C18 HPLC for the final
purification [67].
110
Mar. Drugs 2016, 14, 194
trans
trans
O
O
H
N
O
O
NH
O
N
H
N
O
cis
NH
N
NH
O
N
O
trans
O
N
NH
NH
NH
N
NH
O
O
O
N
NH
trans
NH
NH
O
O
NH
NH
O
NH
O
O
Reniochalistatin A
trans
NH
trans
O
O
O
NH
trans
N
O
N
H
O
O
N
O
O
O
N
NH
NH
cis
O
NH
N
HO
O
O
O
N
O
O
OH
Carteritin A
NH
cis
OH
O
NH
NH
HO
O
N
HO
O
NH
O
NH
NH
O
NH
NH
N
O
N
trans
Stylissamide X
OH
O
N
HO
O
NH
N
O
Reniochalistatin E
O
NH
O
trans
O
NH2
O
trans
N
H
N
O
O
OH
O
O
HO
Carteritin B
Stylopeptide 2
OH
H O
N
O
O
O
O
N
N
NH
NH
O
N
NH
N
H
O
H
N
O
HN
NH
O
O
N
O
N
Phakellistatin 1
Phakellistatin 7
cis
trans
O
trans
H
N
O
O
NH
O
NH
O
O
N
O
NH
trans
O
O
N
N
NH
trans
N
NH
O
O
trans
cis
N
cis
O
NH
O
NH
Phakellistatin 17
Phakellistatin 18
O
O
NH
O
O
H
N
O
N
O
O
NH
O
O
Phakellistatin 15
N
N
NH
NH
N
NH
O
O
HN
O
HO
NH
NH
O
NH
O
N
NH
O
NH
N
O
O
O
NH
NH
OH
NH
O
NH
NH
H
N
O
N
NH O
N
HN
NH
OH
O
O
O
O
NH
N
O
N
O
N
O
N
HO O
HN
O
NH
O
Malaysiatin
trans
O
O
NH
O
NH
NH
O
O
O
N
O
N
O
H2N
HN
O
H
N
O
O
O
N
NH
NH
O
O
O
HO
OH
Axinastatin 4
Axinastatin 5
Figure 1. Cont.
111
Stylissatin A
ȱ
Mar. Drugs 2016, 14, 194
O
N
O
O
O
O
NH
O
N
NH
O
N
NH
NH
NH
trans
NH
N
OH
NH
O
O
O
O
N
H
O
O
O
OH
H
N
NH
O
NH
NH
NH
O
Axinellin A
N
O
O
O
trans
Axinellin B
Axinellin C
N
HO
O
O
NH
O
O
H
N
O
N
O
O
NH
O
NH
cis
NH
NH
NH
O
O
NH
O
O
NH
N
NH
O
cis
NH
NH
N
HN
NH
N
O
N
O
NH
O
trans
O OH
NH
N
O
trans
O
N
N
O
HN
trans
O
NH
NH2
NH
N
N
HO
N
O
O
O
O
O
cis
NH
O
Wainunamide
O
Hymenistatin 1
cis
H
N
H
N
NH
O
trans
trans
O
N
O
N
N
O
cis
O
O
NH
O
Euryjanicin A
NH
O
NH
OH
N
NH
N
O
HO
HN
O
O
NH
O
NH
O
O
NH
NH
O
O
N
O
NH
O
O
cis
O
O
O
O
NH
N
O
O
O
O
N
cis
cis
NH
O
NH
N
O
N
O
NH
HN
trans
NH
NH
cis
trans
NH
cis
Euryjanicin D
N
NH
N
NH
O
O
Euryjanicin C
O
NH
N
O
cis
O
Euryjanicin B
O
OH
NH
cis
NH
N
H
O
O
O
O
N
H
O
NH2
O
N
NH
cis
O
OH
Dominicin
Euryjanicin E
Euryjanicin F
O
cis
O
NH
NH
NH
cis
N
O
H
NH
O
O
NH
O
H
H
H
N
O
cis
H
N
O
Euryjanicin G
O
NH
NH
N
NH
N
O
O
HO
O
NH
NH
O
Shearamide A
O
N
O
O
N
H
O
Callyaerin A
Figure 1. Proline-rich cyclic peptides (PRCPs) from marine sponges.
112
O
NH
H
NH
NH
O
N
O
O OH
H
O
H
N
O
N
HN
NH
NH
O
O
H
H
N
O
N
NH
O
H2N
H
O
ȱ
Mar. Drugs 2016, 14, 194
O
O
O
N
O
O
O
O
N
N
HO
NH
NH
O
O
(CH 2 ) 10
N
O
O
O
N
N
N
NH
(CH 2 ) 10
O
O
NH
NH
O
HN
NH
NH
S
O
S
NH
O
O
N
NH
O
O
Eudistoamide A
NH
NH
O
O
O
Eudistoamide B
H
N
O
NH
O
O
O
N
S
N
O
N
N
N
O
NH
NH
O
O
O
O
OH
NH
NH
O
O
Wewakazole
O
HO
S
NH
O
O
S
O
N
N
N
O
O
O
O
N
NH
N
S
O
NH
N
O
O
NH
N
N
O
O
N
S
N
H
O
Cycloforskamide
S
O O
H
N
NH
O
N
O
H
N
NH
NH
O
NH
NH
O
N
O
H
O
O
NH
NH
O
N
NH O
O
S
N
O
NH
NH
O
NH
H O
N
O
N
O
N
O
O
O
O
O
O
N
NH
Wewakpeptin A
S
H
NH
O
O
Wewakazole B
O
N
H
O
O
O
N
O
N
N
O
O
HN
O
NH
O
H
N
HN
O
Mollamide
Patellin 3
Patellin 4
O
O
O
N
NH
H
N
O
O
NH
N
O
O
N
O
N
O
O
NH
N
O
NH
NH
O
O
O
HN
OH
N
O
H
NH
HO
NH
NH
S
Patellin 6
O
N
O
O
O
N
N
O
N
O
O
O
O
N
NH
O
NH
N
H
O
HN
O
O
O
N
H
O
O
O
O
O
N
N
O
N
O
N
O
N
O
N
O
NH
O
O
NH
N
Wewakpeptin C
H
Wewakpeptin D
Figure 2. PRCPs from marine ascidians (tunicates) and cyanobacteria.
113
O
O
H
Wewakpeptin B
OH
O
Trichormamide A
O
O
N
N
N
N
H O
O
HO
O
O
O OH
O
O
Patellin 5
O
NH
O O
NH
N
S
O
NH
O
H
H NH
O
O
NH
NH
H H
O
NH
NH
ȱ
Mar. Drugs 2016, 14, 194
1.2. Stability and Comparison with Linear Peptides
Linear peptides that contain less than 10 amino acid residues are especially flexible in solution.
Once the length of linear peptides extends to between 10 and 20 amino acid residues, random linear
peptide sequences can begin to obtain secondary structures, including α-helices, turns and β-strands.
These secondary structures impose constraints that reduce the free energy of linear peptides and
limit their conformations to those that may be more biologically active. The constraints imposed by
cyclization force cyclic peptides to adopt a limited number of molecular conformations in solution.
Generally, if cyclization limits conformations to those required for optimum receptor binding, these
cyclic peptides would be more useful compared with their linear counterparts that can adopt more
conformations, which are not useful for receptor binding. Cyclization has been shown to increase
the propensity for β-turn formation in peptides, which is of vital utility since β-turns are often found
in native proteins. Although peptide cyclization generally induces structural constraints, the site of
cyclization within the sequence can affect the binding affinity of cyclic peptides.
In the case of proline, which is a proteinogenic amino acid with a secondary amine that does not
follow along with the typical Ramachandran plot, the ψ and φ angles about the peptide bond have
fewer allowable degrees of rotation due to the ring formation connected to the beta carbon. As a result,
it is often found in “turns” of peptides/proteins, as its free entropy (∆S) is not as comparatively large
as other amino acids, and thus, in a folded form vs. unfolded form, the change in entropy is less.
Furthermore, proline is rarely found in α and β structures, as it would reduce the stability of such
structures, because its side chain α-N can only form one hydrogen bond.
Further, the hydroxylation of proline by prolyl hydroxylase and other additions of
electron-withdrawing substituents, such as fluorine, increases the conformational stability of collagen
significantly. Hence, the hydroxylation of proline is a critical biochemical process for maintaining the
connective tissue of higher organisms. Polypeptide chains containing proline lack the flexibility of other
peptides, because the proline ring has only one available angle for backbone rotation. Rotation occurs
around the angles φ, ψ and ω [68,69].
The cyclization of linear peptide sequences can create constrained geometries that can alter the
specificity of cyclic peptides to different isoforms or subtypes of targeted receptors. Peptides can be
cyclized in order to reduce the overall numbers of interchanging conformers in the hope of limiting
them to those selective for the desired receptors while avoiding degradation by not forming conformers
susceptible to interacting with proteolytic enzymes [70].
In general, cyclization often increases the stability of peptides [71,72], which can prolong their
biological activity. This prolonged activity may even be the result of additional resistance to enzymatic
degradation by exoproteases that preferentially cleave near the N- or C-termini of peptide sequences.
In particular, cyclization can create peptides with the ability to penetrate tumors in order to enhance
the potency of anticancer drugs [73]. Cyclic peptides can potentially obtain desirable constrained
geometries that are responsible for increasing their binding affinity, specificity or stability compared
with their linear counterparts. Cyclic peptides are of considerable interest as potential protein ligands
and might be more cell permeable than their linear counterparts due to their reduced conformational
flexibility. However, it is important to note that cyclization does not necessarily lead to improvements
in all of these properties, e.g., linear peptides can contain sequences that can support rigid structures
without the need for cyclization [74].
2. Chemistry
2.1. Structural Features
The distinctive cyclic structure of proline’s side chain gives proline an exceptional conformational
rigidity compared to other amino acids, which affects the rate of peptide bond formation between
proline and other amino acids. The exceptional conformational rigidity of proline affects the secondary
structure of proteins near a proline residue and may account for proline’s higher prevalence in the
proteins of thermophilic organisms. Proline acts as a structural disruptor in the middle of regular
114
Mar. Drugs 2016, 14, 194
secondary structure elements, such as alpha helices and beta sheets; however, proline is commonly
found as the first residue of an alpha helix and also in the edge strands of beta sheets. Multiple prolines
and hydroxyprolines in a row can create a polyproline helix, the predominant secondary structure in
collagen [75].
The number of proline units in a cyclic peptide structure varies from one to five (Table 1).
In addition to normal hydrophobic amino acids, marine organism-derived cyclopolypeptides rich in
proline units contain modified and unusual amino acid moieties and other rings, like hydroxyproline
(Hyp), (Z)-2,3-diaminoacrylic acid (DAA), thiazoline (Tzn), thiazole (Tzl), oxazole, methyloxazoline,
reverse prenylated ethers, i.e., serine and threonine carrying a dimethylallyl ether group,
para-hydroxystyrylamide (pHSA), pyroglutamic acid (pyroGlu), 3a-hydroxypyrrolo[2,3-b]indoline
(Hpi), the 12-hydroxy-tetradecanoyl moiety, 2-(1-amino-2-p-hydroxyphenylethane)-4-(4-carboxy2,4-dimethyl-2Z,4E-propadiene)-thiazole (ACT), O-methyl-N-sulfo-D-serine, keto-allo-isoleucine,
methyloxazoline, β-methoxyaspartic acid, β-aminodecanoic acid, 2,2-dimethyl-3-hydroxy-7-octynoic
acid (Dhoya), β-amino acid 3-amino-2-methylbutanoic acid (Maba) and 2-Hydroxy-isovaleric
acid (Hiva), O-prenyltyrosine (Ptyr) (2S,3R,5R)-3-amino-2,5-dihydroxy-8-phenyloctanoic acid
(Ahoa), dolaphenvaline (Pval) and dolamethylleucine (Admpa), N-acetyl-N-methylleucine
(Aml), E- and Z-dehydrobutyrines (Dhb), a homophenylalanine (homophe), (2S,3R)-β-hydroxyp-bromophenylalanine and N,O-dimethyl tyrosine, hydroxyisovaleric acid (Hiv) (Figure 3).
O
O
O
O
O
2-hydroxy-isovaleric acid
(Hiva)
O
N
2,2-dimethyl-3-hydroxy7-octynoic acid (Dhoya)
N
N-methylvaline
(MeVal)
N-methylalanine
(MeAla)
O
O
HN
O
dolaphenylvaline
(Pval)
O
N
H
O
N
H
dolamethylleucine
(Admpa)
N
H
O
reverse prenylated ethers
(Ser and Thr)
O
HO
N
O
N
O
N
N
O
S
S
N
H
OH
thiazoline
(Tzn)
thiazole
(Tzl)
hydroxyproline
(Hyp)
H
3a-hydroxypyrrolo[2,3-b]indoline
(Hpi)
O
HO
HO
OH
NH
N
CH3
NH
O
O
N-acetyl-N-methylleucine
(Aml)
homophenylalanine
(homophe)
HO
CH3
polyhydroxy amino acid
(AThmU)
Figure 3. Modified amino acid moieties/heterocyclic rings present in marine-derived PRCPs.
115
ȱ
Mar. Drugs 2016, 14, 194
Table 1. Proline-rich cyclopolypeptides from marine resources.
Year
Cyclic Peptide
Molecular Formula
1981
1988
1991
1992
1992
1993
1993
1993
1993
1993
1993
1994
1994
1994
1994
1995
1996
1996
1996
1996
1996
1996
1996
1996
1996
1998
1998
1999
1999
2000
2000
2000
2001
2003
2004
2004
2005
2005
2005
2005
2007
2007
2008
2008
2008
2009
2009
2009
2009
2009
2010
2011
2011
2012
2013
2013
2013
2013
2013
2014
2014
2016
Didemnin B [43]
Aplidine [45]
Axinastatin 1 [6]
Malaysiatin [27]
Polydiscamide A [7]
Axinastatin 4 [76]
Cyclooligopeptide [77]
Hymenamide B [31]
Hymenamide C [8]
Hymenamide D [8]
Hymenamide E [8]
Mollamide [40]
Schizotrin A [78]
Axinastatin 2 [39]
Axinastatin 3 [39]
Stylopeptide 1 [79]
Patellin 3 [80]
Patellin 4 [80]
Patellin 5 [80]
Patellin 6 [80]
Hymenamide F [81]
Agardhipeptin B [82]
Kapakahine A [37]
Kapakahine C [37]
Kapakahine D [37]
Axinellin A [21]
Shearamide A [83]
Prenylagaramide B [84]
Nostophycin [50]
trans,trans-ceratospongamide [10]
Tamandarine A [44]
Tamandarine B [44]
Microspinosamide [38]
Myriastramide C [28]
Scleritodermin A [26]
Cyclonellin [85]
Wewakpeptin A [46]
Wewakpeptin B [46]
Wewakpeptin C [46]
Wewakpeptin D [46]
Pahayokolide A [48]
Pahayokolide B [48]
Polydiscamide B [18]
Polydiscamide C [18]
Polydiscamide D [18]
Euryjanicin A [36]
Euryjanicin C [14]
Euryjanicin D [14]
Eudistomide A [42]
Eudistomide B [42]
Anacyclamide A10 [86]
Duanbanhuain A [87]
Duanbanhuain B [87]
Mollamide F [12]
Stylissatin A [24]
Euryjanicin E [88]
Euryjanicin F [88]
Gombamide A [22]
Cycloforskamide [41]
Trichormamide A [49]
Reniochalistatin A [20]
Carteritin B [34]
C57 H89 N7 O15
C57 H87 N7 O15
C38 H56 N8 O8
C38 H56 N8 O8
C76 H109 BrN19 O20 SNa
C42 H62 N8 O8
C24 H32 N4 O5
C43 H56 N8 O10
C43 H54 N8 O9
C38 H55 N7 O10
C45 H55 N7 O10
C42 H61 N7 O7 S
C72 H107 N13 O21
C39 H58 N8 O8
C40 H61 N8 O8
C40 H61 N7 O8
C48 H78 N8 O9 S
C47 H76 N8 O9 S
C49 H72 N8 O9 S
C50 H74 N8 O9 S
C35 H60 N10 O7 S
C57 H69 N11 O8
C58 H72 N10 O9
C58 H72 N10 O10
C58 H72 N10 O10
C42 H56 N8 O9
C47 H63 N9 O9
C49 H68 N8 O10
C46 H64 N8 O10
C41 H49 N7 O6 S
C54 H87 N7 O14
C53 H82 N7 O14
C75 H109 BrN18 O22 S
C42 H53 N9 O7 S
C42 H54 N7 O10 SNa
C45 H62 N12 O12
C52 H85 N7 O11
C52 H89 N7 O11
C54 H81 N7 O11
C54 H85 N7 O11
C72 H105 N13 O20
C63 H90 N12 O18
C75 H110 BrN18 O21 S
C74 H107 BrN18 O21 S
C73 H105 BrN18 O21 S
C44 H58 N8 O8
C40 H61 N7 O8
C44 H59 N7 O8
C37 H61 N5 O8 S2
C37 H63 N5 O8 S2
C49 H72 N12 O14
C43 H58 N8 O11
C45 H57 N9 O10
C33 H46 N6 O5 S
C49 H63 N7 O8
C44 H60 N8 O8
C49 H63 N7 O7
C38 H45 N7 O8 S2
C54 H86 N12 O11 S3
C58 H93 N11 O15
C37 H62 N8 O8
C46 H57 N7 O11
116
No. of Proline Units
Composition
two
cyclodepsipeptide
cyclodepsipeptide
cycloheptapeptide
cycloheptapeptide
cyclodepsipeptide
cycloheptapeptide
cyclotetrapeptide
cycloheptapeptide
cycloheptapeptide
cycloheptapeptide
cycloheptapeptide
cycloheptapeptide
cycloundecapeptide
cycloheptapeptide
cycloheptapeptide
cycloheptapeptide
cyclooctapeptide
cyclooctapeptide
cyclooctapeptide
cyclooctapeptide
cycloheptapeptide
cyclooctapeptide
cyclooctapeptide
cyclooctapeptide
cyclooctapeptide
cycloheptapeptide
cyclooctapeptide
cycloheptapeptide
cycloheptapeptide
cycloheptapeptide
cyclodepsipeptide
cyclodepsipeptide
cyclodepsipeptide
cyclooctapeptide
cyclodepsipeptide
cyclooctapeptide
cyclodepsipeptide
cyclodepsipeptide
cyclodepsipeptide
cyclodepsipeptide
cycloundecapeptide
cycloundecapeptide
cyclodepsipeptide
cyclodepsipeptide
cyclodepsipeptide
cycloheptapeptide
cycloheptapeptide
cycloheptapeptide
cyclolipopeptide
cyclolipopeptide
cyclodecapeptide
cyclooctapeptide
cyclooctapeptide
cyclohexapeptide
cycloheptapeptide
cycloheptapeptide
cycloheptapeptide
cyclothiohexapeptide
cyclododecapeptide
cycloundecapeptide
cycloheptapeptide
cycloheptapeptide
Mar. Drugs 2016, 14, 194
Table 1. Cont.
Year
Cyclic Peptide
Molecular Formula
1990
1993
1993
1993
1994
1994
1994
1995
1996
1998
2000
2000
2001
2001
2001
2002
2002
2002
2002
2002
2003
2003
2003
2005
2006
2009
2010
2010
2010
2010
2010
2012
2013
2014
2016
2016
2016
2016
2016
Hymenistatin 1 [35]
Phakellistatin 1 [32]
Hymenamide A [31]
Phakellistatin 2 [89]
Axinastatin 5 [30]
Hymenamide G [90]
Hymenamide H [90]
Phakellistatin 11 [91]
Waiakeamide [12]
Axinellin B [21]
Haligramide A [92]
Haligramide B [92]
Haliclonamide A [93]
Haliclonamide B [93]
Wainunuamide [23]
Axinellin C [94]
Dolastatin 16 [52]
Haliclonamide C [95]
Haliclonamide D [95]
Haliclonamide E [95]
Myriastramide A [28]
Myriastramide B [28]
Wewakazole [96]
Dominicin [16]
Stylisin 1 [19]
Euryjanicin B [14]
Phakellistatin 15 [25]
Phakellistatin 17 [25]
Phakellistatin 18 [25]
Callyaerin B [13]
Callyaerin C [13]
Stylissamide X [33]
Euryjanicin G [88]
Reniochalistatins E [20]
Carteritin A [34]
Stylissatin B [97]
Stylissatin C [97]
Stylissatin D [97]
Wewakazole B [47]
C47 H72 N8 O9
C45 H61 N7 O8
C46 H61 N11 O7
C45 H61 N7 O8
C47 H72 N8 O9
C47 H72 N8 O9
C47 H69 N9 O9
C53 H67 N9 O9
C37 H49 N7 O8 S3
C50 H67 N9 O9
C37 H49 N7 O6 S3
C37 H49 N7 O7 S3
C45 H60 N8 O9
C40 H52 N8 O9
C38 H51 N9 O7
C50 H67 N9 O9
C47 H70 N6 O10
C45 H60 N8 O10
C40 H54 N8 O10
C45 H62 N8 O10
C45 H58 N8 O9
C45 H57 ClN8 O9
C59 H72 N12 O12
C43 H72 N8 O9
C45 H61 N7 O8
C36 H51 N7 O8
C48 H71 N9 O9
C49 H73 N9 O8
C45 H61 N7 O8
C65 H108 N12 O14
C70 H105 N13 O16
C51 H69 N9 O9
C48 H59 N7 O7
C49 H73 N9 O8
C44 H57 N7 O10
C38 H51 N9 O7
C39 H55 N7 O9
C40 H57 N7 O9
C58 H70 N12 O12
1968
2004
2006
2008
2010
2010
2010
Antamanide [98]
Callynormine A [15]
Stylisin 2 [19]
Stylopeptide 2 [29]
Callyaerin A [13]
Callyaerin E [13]
Callyaerin H [13]
2008
Callyaerin G [99]
a
No. of Proline Units
Composition
three
cyclooctapeptide
cycloheptapeptide
cycloheptapeptide
cycloheptapeptide
cyclooctapeptide
cyclooctapeptide
cyclooctapeptide
cyclooctapeptide
cyclohexapeptide
cyclooctapeptide
cyclohexapeptide
cyclohexapeptide
cyclooctapeptide
cyclooctapeptide
cycloheptapeptide
cyclooctapeptide
cyclodepsipeptide
cyclooctapeptide
cyclooctapeptide
cyclooctapeptide
cyclooctapeptide
cyclooctapeptide
cyclododecapeptide
cyclooctapeptide
cycloheptapeptide
cycloheptapeptide
cyclooctapeptide
cyclooctapeptide
cycloheptapeptide
cyclooctapeptide b
cycloheptapeptide c
cyclooctapeptide
cyclooctapeptide
cyclooctapeptide
cycloheptapeptide
cycloheptapeptide
cycloheptapeptide
cycloheptapeptide
cyclododecapeptide
C64 H78 N10 O10
C61 H93 N11 O13
C44 H57 N7 O8
C63 H84 N10 O12
C69 H108 N14 O14
C66 H94 N12 O13
C54 H81 N11 O10
four
cyclodecapeptide
cycloheptapeptide b
cycloheptapeptide
cyclodecapeptide
cyclooctapeptide c
cycloheptapeptide c
cycloheptapeptide a
C69 H91 N13 O12
five
cycloheptapeptide c
b
c
With dipeptide, tripeptide and tetrapeptide side chains.
Callynormine A represents a new class of heterodetic cyclic peptides possessing an α-amidoβ-aminoacrylamide cyclization functionality. Hyp forms part of the composition of cyclic endiamino
peptides like callynormine A [15] and callyaerin A–D. The unusual non-proteinogenic (Z)-DAA moiety
is characteristic of the callyaerin series of peptides callyaerins A–M, which links the cyclic peptide part
of the callyaerins with a linear peptide side chain [13]. Indo-Pacific ascidian Didemnum molle is found
to be rich in thiazole-, oxazole- and thiazoline-containing peptides, like mollamide, which share the
peculiar reverse prenylated ethers of serine and threonine amino acids [40].
Furthermore, unusual amino acid residues like pHSA and pyroGlu were found to be part of
the structure of cyclothiopeptide gombamide A, which possess moderate inhibitory activity against
117
Mar. Drugs 2016, 14, 194
Na+ /K+ -ATPase [22]. Further, thiazoline-based proline containing doubly-prenylated cyclopeptides
like trunkamide A contain reverse prenylated ethers of serine and threonine together in their
composition. Heterocyclic amino acids like histidine and tryptophan also form part of the structures of
proline-rich cyclic peptides, such as wainunuamide, phakellistatin 15, 17 and stylissatin B [23,25,97].
Moreover, cytotoxic phakellistatin 3 and isophakellistatin 3 represent a new class of proline-rich
cycloheptapeptides containing an unusual amino acid unit “Hpi” that apparently derived from
a photooxidation product of tryptophan [100].
Moreover, five-residue cystine-linked cyclic peptides like eudistomides A, B are flanked by
a C-terminal methyl ester and a 12-oxo- or 12-hydroxy-tetradecanoyl moiety [42]. The structure of
proline containing cytotoxic peptide scleritodermin A incorporates a novel conjugated thiazole moiety
2-(1-amino-2-p-hydroxyphenylethane)-4-(4-carboxy-2,4-dimethyl-2Z,4E-propadiene)-thiazole (ACT)
and unusual amino acids O-methyl-N-sulfo-D-serine, keto-allo-isoleucine [26]. The proline unit may be
part of a cyclic peptide and/or may be part of a side chain, e.g., scleritodermin A, didemnin B, C and
plitidepsin [26,43,45], or may be part of a linear peptide, e.g., dolastatin 15 and koshikamide A1 [1,5].
The methyloxazoline ring is the part of the composition of cyclohexapeptides ceratospongamides [10].
In addition, trichormamide A contains β-amino acid residue viz. β-aminodecanoic acid, in addition to
two D-amino acid residues (D-Tyr and D-Leu) [49]. The wewakpeptins, proline-rich cyclic depsipeptides
contain unusual moieties, like “Dhoya”, “Maba” and “Hiva” [46], and prenylagaramides B and C
contain a rare “Ptyr” unit. Moreover, nostophycin bears a novel β-amino acid moiety “Ahoa” in
its structure [50]. Macrocyclic depsipeptides, homodolastatin 16 and dolastatin 16 contain the new
and unusual amino acid units “Pval” and “Admpa” [51,52]. Besides this, structural features for
pahayokolides A and B include a pendant N-acetyl-N-methylleucine, both E- and Z-dehydrobutyrines,
a homophenylalanine and an unusual polyhydroxy amino acid [48]. Oxazole and methyloxazole rings
were found to be part of the structures of cyclopolypeptides myriastramides A–C and haliclonamide
A [28,93], whereas N,O-dimethyl tyrosine and “Hiv” moieties were found in the structures of cytotoxic
depsipeptides, tamandarins A and B [44]. The presence of two dimethylallyl threonines (or one
threonine and one serine) side chains and one thiazoline ring in the backbone of the patellins is
the most important feature of these compounds termed as “cyanobactins”, which have sparked
attention due to their interesting bioactivities and for their potential to be prospective candidates in
the development of drugs [101,102].
2.2. Stereochemical Aspects
Structurally, proline is the only unusual amino acid with a secondary amino group based on
a pyrrolidine, which forms a ring structure with rigid conformation and a secondary amine compared
to the other twenty natural amino acids. This significantly reduces the structural flexibility of the
polypeptide chain, and the nitrogen in the pyrrolidine ring cannot participate in hydrogen bonding
with other residues [103]. Many biologically-important cyclic peptide sequences and natural products
contain multiple proline residues. As seen previously for peptide bonds, the proline amide bond can
also exist in trans or cis conformations (Figure 4). Peptide bonds to proline, and to other N-substituted
amino acids, are able to populate both the cis and trans isomers. Most peptide bonds overwhelmingly
adopt the trans isomer (typically 99.9% under unstrained conditions), because the amide hydrogen
(trans isomer) offers less steric repulsion to the preceding Cα atom than does the following Cα atom
(cis isomer). By contrast, the cis and trans isomers of the X-Pro peptide bond (where X represents
any amino acid) both experience steric clashes with the neighboring substitution and are nearly
equal energetically. Hence, the fraction of X-Pro peptide bonds in the cis isomer under unstrained
conditions ranges from 10% to 40%; the fraction depends slightly on the preceding amino acid,
with aromatic residues favoring the cis isomer slightly. Proline cis-trans isomerization plays a key role
in the rate-determining steps of protein folding [104]. Furthermore, proline cis-trans isomerization
controls autoinhibition of a signaling protein [105].
118
Mar. Drugs 2016, 14, 194
ȱ
Figure 4. The two possible conformations for the proline peptide bond.
Although the trans amide bond is more common, the occurrence of cis geometry is more frequent
for the proline peptide bond than for other amino acids. The frequency of the cis proline peptide
bond is higher in cyclic peptides than in linear peptides. As per a statistical study performed on the
Cambridge Structural Database, 57.4% of proline residues present in cyclic peptides were in the cis
conformation as compared to only 5.6% in acyclic peptides [106]. The reason for this high proportion
of cis proline in cyclopeptides is due to the conformational restrictions during the cyclisation step.
The geometry of the proline amide can be determined on the basis of the difference in 13 C chemical
shifts between Cβ and Cγ signals (∆δβγ = δβ − δγ). A small 13 C chemical shift difference indicates
that the proline peptide bond is trans, while a large 13 C chemical shift difference indicates a cis
proline residue. The change in conformation of a cyclopolypeptide from “trans” to “cis” can result
in loss of activity [10], e.g., the trans, trans-isomer of cyclic heptapeptide ceratospongamide showed
potent inhibition of sPLA2 expression in a cell-based model for anti-inflammation, whereas the cis,
cis-isomer was inactive (Figure 5). The distribution of the peptide bond angle omega for peptidyl-prolyl
bonds in proteins shows significant peaks at 180◦ (trans peptide bond) and 0◦ (cis peptide bond).
Investigations on “peptidyl-prolyl bonds and secondary structure” showed that trans petidyl-prolyl
bonds are distributed in all types of secondary structure, whereas cis peptidyl is found primarily in
bends and turns, suggesting a specific structural role for this type of bonding.
ȱ
Figure 5. Different conformers of cyclopolypeptide ceratospongamide.
Most amino acids occur in two possible optical isomers, called D and L (Figure 6). The L-amino
acids represent the vast majority of amino acids found in proteins. L-proline is a natural non-essential
amino acid, and D-proline is an unnatural amino acid, with one basic and one acidic center each.
In proline, only the L-stereoisomer is involved in the synthesis of mammalian peptides/proteins.
119
Mar. Drugs 2016, 14, 194
O
O
H
H
OH
HO
NH
NH
L-proline
H
N
H
COOH
L-proline
D-proline
-H+
N
H
+H+
COO
Planar transition state
H
N
H
D-proline
COOH
ȱ
Figure 6. General structures of L- and D-proline and their isomerization via proline racemase.
The racemization of L-proline to D-proline proceeds through a planar transition state, where the
tetrahedral α-carbon becomes trigonal as a proton leaves the L-proline. The transition-state analog
for this step is pyrrolidin-2-ide-2-carboxylate (2− ). The absolute configuration of proline residue
can be determined by Marfey’s method using reagent 1-fluoro-2,4-dinitrophenyl-5-L-alanineamide
(FDAA) [107]. The absolute configuration of amino proline was determined by comparing the
retention time with the standard FDAA-derivatized amino acids, e.g., the structure of cyclooctapeptide
reniochalistatin E contains three L-proline units with trans conformation [20] whereas the structure
of cycloheptapeptide euryjanicin E contains three L-proline units with cis conformation [88].
Further, a novel cyclic tetrapeptide isolated from a Pseudomonas sp. (strain IM-1) associated with
the marine sponge Ircinia muscarum was found to contain two proline units, one with L-configuration
and the other with D-configuration [77].
2.3. Steric and Lipophilicity Parameters
In order to describe the intermolecular forces of drug receptor interaction, as well as the transport
and distribution of drugs in a quantitative manner, various steric and lipophilicity parameters,
like molar refractivity (MR20 ), molar volume (MV20 ), parachor (Pr ), index of refraction (n20 ),
surface tension (γ20 ), density (d20 ), polarizability (α), etc., need to be calculated for natural cyclic
peptides. Diverse parameters were calculated for proline-rich cyclopolypeptides of marine origin using
ACD/ChemSketch software (Version 2.0, Toronto, ON, Canada) (Table S1, Supplementary Materials).
2.4. Synthetic Methodologies
Many proline-rich cyclic peptides were synthesized successfully by various research groups
employing different techniques of peptide synthesis. The literature is enriched with reports explaining
the synthesis of euryjanicin A [108], delavayin C [109], cherimolacyclopeptide G [110], psammosilenin
A [111], hymenamide E [112], stylisin 1 [113], stylisin 2 [114], hymenistatin and yunnanin F [115],
pseudostellarin B [116], segetalin E [117], rolloamide B [118] and pseudostellarin G [119] using
the solution-phase method utilizing different carbodiimides as coupling agents, TEA/NMM as the
base and the synthesis of euryjanicin B [120], mollamide [121], met-cherimolacyclopeptide B [122],
axinellin A [123], phakellistatin 7 [124], phakellistatin 12 [125], petriellin A [126], hymenamide
C [127], gombamide A [128] and scleritodermin A [129] by the solid-phase method of peptide
synthesis. Solid-phase peptide synthesis (SPPS) results in high yields of pure products and works
more quickly than classical synthesis, i.e., liquid-phase peptide synthesis (LPPS). Through the
replacement of a complicated isolation procedure for each intermediate product with a simple
washing procedure, much time is saved using SPPS. In addition, SPPS has proven possible to increase
the yield in each individual step to 99.5% or better, which cannot be attained using conventional
synthetic approaches. However, solution phase synthesis continues to be especially valuable for
large-scale manufacturing and for specialized laboratory applications [130,131]. Moreover, in some
cases, a mixed solid-phase/solution synthesis strategy is employed to accomplish total synthesis of the
120
Mar. Drugs 2016, 14, 194
cyclopolypeptide [132], e.g., during the total synthesis of the naturally-occurring proline-rich cyclic
octapeptide stylissamide X, the linear octapeptide was assembled first by standard Fmoc solid-phase
peptide synthesis (SPPS), and cyclization was carried out subsequently by the solution method.
Total synthesis can also be achieved via a convergent native chemical ligation-oxidation strategy [133],
e.g., polydiscamides B–D, or utilizing diethyl phosphorocyanidate/BOP-Cl chemistry [134],
e.g., axinastatins 2 and 3.
3. Biological Status
L -proline itself is an osmoprotectant and is used in many pharmaceutical and biotechnological
applications, whereas the proline analogue cis-4-hydroxy-L-proline has been clinically evaluated
as an anticancer drug. Although proline-rich cyclopolypeptides of marine origin are associated
with a number of bioactivities, including anti-cancer, anti-tuberculosis, anti-inflammatory, anti-viral,
immunosuppressive and anti-fungal activities, still the majority of them were found to exhibit cell
growth inhibitory activity [135,136]. Various pharmacological activities associated marine-derived
proline-rich cyclopeptides along with susceptible cell line/organism with minimum inhibitory
concentration are compiled in Table 2.
Table 2. Marine-derived proline-rich cyclopeptides with diverse bioactivities.
PRCPs
Resource
Axinastatin 1 [6]
Polydiscamide A [7]
Pharmacological Activity
Susceptibility
MIC Value
marine sponge
Cytotoxicity against PS leukemia cell line
0.21 µg/mL
marine sponge
Antiproliferative activity against human lung cancer A549 cell
line; antibacterial activity against Bacillus subtilis
0.7 µg/mL;
3.1 µg/mL
Hymenamide E [8]
marine sponge
Antifungal activity against pathogenic Cryptococcus neoformans
133 µg/mL
trans,transCeratospongamide [10]
marine red alga
Inhibition of sPLA2 expression in a cell-based model
for anti-inflammation
0.0013 µg/mL
Mollamide F [12]
marine tunicate
Anti-HIV activity in cytoprotective cell-based assay and
HIV integrase inhibition assay
0.0016 and
0.0031 µg/mL
Callyaerin A [13]
marine sponge
Anti-TB activity against M. tuberculosis, inhibitory activity
toward C. albicans
7.37 µg/mL
Callyaerin B [13]
marine sponge
Anti-TB activity against Mycobacterium tuberculosis
7.8 µg/mL
Callyaerin E, H [13]
marine sponge
Cytotoxicity against L5178Y cell line
7.91 and 9.59 µg/mL
Euryjanicin C [14]
marine sponge
Inhibitory activity against human hepatitis B virus
49 µg/mL
Polydiscamides B–D [18]
marine sponge
Agonist activity against human sensory neuron-specific G protein
couple receptor (SNSR) that is involved in the modulation of pain
-
Axinellin A, B [21]
marine sponge
Antitumor activity against human bronchopulmonary
non-small-cell lung-carcinoma lines (NSCLC-N6)
3.0 and 7.3 µg/mL
Wainunuamide [23]
marine sponge
Cytotoxic activity against A2780 ovarian tumor and K562
leukemia cancer cells
19.15 and
18.36 µg/mL
0.0011 µg/mL
Stylissatin A [24]
marine sponge
Inhibition of NO production in LPS-stimulated RAW264.7 cells
Scleritodermin A [26]
marine sponge
Inhibition of tubulin polymerization and human tumor cell lines
-
Axinastatin 5 [30]
marine sponge
Cytotoxic activity against human and murine cancer cells
0.3–3.3 µg/mL
Phakellistatin 1 [32]
marine sponges
Cell growth inhibitory activity against P-388 murine leukemia
7.5 µg/mL
Stylissamide X [33]
marine sponge
Inhibitory activity against migration of HeLa cells
0.001–0.1 µg/mL
0.0012–0.0026 µg/mL
Carteritin A [34]
marine sponge
Cytotoxicity against HeLa, HCT116 and RAW264 cells
Hymenistatin 1 [35]
marine sponge
Cytotoxicity against P-388 leukemia cells
3.5 µg/mL
Kapakahine A, C [37]
marine sponge
Cytotoxicity against P-388 murine leukemia cells
5.4 and 5.0 µg/mL
Microspinosamide [38]
marine sponge
Anti-HIV activity in CEM-SS cells
0.2 µg/mL
Axinastatin 2 [39]
marine sponge
Cytotoxicity against murine leukemia P-388 cell line
0.02 µg/mL
Axinastatin 3 [39]
marine sponge
Cytotoxicity against PS leukemia cell line
0.4 µg/mL
Mollamide [40]
sea squirt
Cytotoxicity against P-388 (murine leukemia) and A549 (human
lung carcinoma), HT29 (human colon carcinoma) cells
1.0–2.5 µg/mL
Cycloforskamide [41]
sea slug
Cytotoxicity against murine leukemia P-388 cells
8.51 µg/mL
marine tunicate
Cytotoxic activity against human L1210 lymphocytic leukemia
cell lines; pancreatic carcinoma (BX-PC3) cell lines; prostatic
cancer (DU-145) cell lines; head and neck carcinoma
(UMSCC10b) cell lines
0.0025 µg/mL;
0.002 µg/mL;
0.0015 µg/mL;
0.0018 µg/mL
Didemnin B [43]
121
Mar. Drugs 2016, 14, 194
Table 2. Cont.
Pharmacological Activity
Resource
PRCPs
Susceptibility
MIC Value
0.0018 µg/mL;
0.0014 µg/mL;
0.0009 µg/mL
Tamandarin A [44]
marine ascidian
Cytotoxic activity against human pancreatic carcinoma (BX-PC3)
cell lines; prostatic cancer (DU-145) cell lines; head and neck
carcinoma (UMSCC10b) cell lines
Wewakpeptin A [46]
marine cyanobacterium
Cytotoxicity against NCI-H460 human lung tumor and the
neuro-2a mouse neuroblastoma cell lines
0.001 µg/mL
8.87–15.29 µg/mL
Wewakazole B [47]
marine cyanobacterium
Cytotoxicity against human MCF7 breast/H460 lung cancer cells
Pahayokolide A [48]
marine cyanobacteria
Antibacterial activity against Bacillus megaterium, Bacillus subtilis
5 µg/mL
Trichormamide A [49]
marine cyanobacteria
Antiproliferative activities against the human melanoma cell line
(MDA-MB-435) and the human colon cancer cell line (HT-29)
8.45 and 8.53 µg/mL
Axinastatin 4 [76]
marine sponge
Cytotoxic activity against P-388 lymphocytic leukemia cell line
0.057 µg/mL
Phakellistatin 2 [89]
marine sponge
Cell growth inhibitory activity against P-388 cell line
0.34 µg/mL
Phakellistatin 7–9 [137]
marine sponge
Cell growth inhibitory activity against P-388 murine leukemia
3.0, 2.9 and
4.1 µg/mL
Axinellin C [94]
marine sponge
Cytotoxic activity against A2780 ovarian tumor and
K562 leukemia cancer cells
13.17 and
4.46 µg/mL
Callyaerin G [99]
marine sponge
Cytotoxic towards the mouse lymphoma cell line
(L5178Y) and HeLa cells
0.53 and 5.4 µg/mL
marine sponge
Inhibitory effects against human tumor cell lines including
HCT-116, HepG2, BGC-823, NCI-H1650, A2780 and MCF7
0.0013 µg/mL
Phakellistatin 10, 11 [91]
marine sponge
Cell growth inhibitory activity against murine P-388
lymphocytic leukemia
2.1, 0.20 µg/mL
Stylopeptide 1 [79]
marine sponge
Cell growth inhibitory activity against murine P-388
lymphocytic leukemia
0.01 µg/mL
Phakellistatin 12 [138]
marine sponge
Cell growth inhibitory activity against murine P-388
lymphocytic leukemia
2.8 µg/mL
Stylissatin B [97]
3.1. Mechanism of Action
In drug development, a good antimicrobial candidate should exhibit highly specific biological
activity followed by a good pharmacokinetic profile and low immunogenicity. Studies have
demonstrated that the members of the proline-rich peptide group and their derivatives act with
a completely divergent mechanism than the lytic amphiphilic antimicrobial peptides. Retaining highly
potent antimicrobial activities, proline-rich antimicrobial peptides subsequently act in a divergent
way, including stereospecific interaction with the membrane translocation system followed by
intracellular targeting, compared with the more general membrane disruption mode of action of
traditional antimicrobial peptides. It has been further suggested that proline-rich antimicrobial peptides
stereo-specifically bind to intracellular targets, such as the bacterial heat shock DnaK protein, and this
binding can be correlated with the observed antimicrobial activity. Moreover, proline-rich peptides
are characterized by good water solubility, high potency against bacteria killing and low cytotoxic
effects at high concentrations, making them attractive lead candidates for the development of novel
antimicrobial therapeutic agents [103].
Further, proline-rich antimicrobial peptides are actively transported inside the bacterial
cell where they bind and inactivate specific targets like the bacterial ribosome and, thereby,
inhibit protein synthesis. This implies that they can be used as molecular hooks to identify the
intracellular or membrane proteins that are involved in their mechanism of action and that may
be subsequently used as targets for the design of novel antibiotics with mechanisms different
from those now in use. Didemnin B is a heterodetic non-polar cyclic peptide associated with
antiviral, antitumor, immunomodulating properties, potently inhibits protein and DNA synthesis by
binding to the eukaryotic translation elongation factor EF-1α in a GTP-dependent manner, and the
formation of the didemnin B-GTP-EF-1α complex may be responsible for the observed inhibition
of protein synthesis [139]. Inhibition of protein synthesis by didemnin B occurs by stabilization
of aminoacyl-tRNA to the ribosomal A-site, preventing the translocation of phenylalanyl-tRNA
from the A- to the P-site, but not preventing peptide bond formation. Tamandarin A may act
122
Mar. Drugs 2016, 14, 194
by the same mechanism as didemnin B. Aplidine’s (dehydrodidemnin B) mechanism of action
involves several pathways, including cell cycle arrest and inhibition of protein synthesis. Aplidine
induces early oxidative stress and results in a rapid and persistent activation of JNK and p38
MAPK phosphorylation with activation of both kinases occurring very rapid, long before the
execution of apoptosis [140]. Didemnin B induces the death of a variety of transformed cells with
apoptotic morphology, DNA fragmentation within the cytosol and the generation of DNA ladders.
Scleritodermin A acts by tubulin polymerization inhibition [26].
The immunosuppressive activity of cyclolinopeptide A results from the formation of the complex
with cyclophilin and inhibition of the phosphatase activity of calcineurin, a phosphatase that plays
an important role in T lymphocyte signaling [141]. Cemadotin (LU103793) is a water-soluble synthetic
analogue of linear peptide dolastatin 15, which is believed to act on microtubules involving binding to
tubulin and strong suppression of microtubule dynamics.
3.2. Peptide Market and PRCPs in Clinical Trials
Currently, there are more than 60 U.S. Food and Drug Administration (FDA)-approved peptide
medicines on the market, and this is expected to grow significantly, with approximately 140 peptide
drugs currently in clinical trials and more than 500 therapeutic peptides in preclinical development.
In terms of value, the global peptide drug market has been predicted to increase from US$14.1 billion in
2011 to an estimated US$25.4 billion in 2018, with an underlying increase in novel innovative peptide
drugs from US$8.6 billion in 2011 (60%) to US$17.0 billion (66%) in 2018 [74]. Currently, most peptide
drugs are administered by the parental route, and approximately 75% are given as injectables.
However, alternative administration forms are gaining increasing traction, including oral, intranasal
and transdermal delivery routes, according to the respective technology developments. The use of
alternative administration forms could also enable greater usage of peptide therapeutics in other
disease areas, such as inflammation, where topical administration of peptides could be the basis for
highly efficacious novel treatments.
The cyclic depsipeptide didemnin B was the first marine-derived cyclopolypeptide to undergo
clinical trials targeted at oncological patients. However, high toxicity, poor solubility and short
life span led to the discontinuation of clinical trials of didemnin B and rendered it unsuitable for
further drug development [142]. The linear depsipeptide kahalalide F is known for its antifungal
and antitumor activities, and its phase II clinical trials are underway. Another cyclic depsipeptide
plitidepsin (dehydrodidemnin B or aplidine) is in clinical development. In 2003, plitidepsin was
granted orphan drug status by the European Medicines Agency for treating acute lymphoblastic
leukemia. In 2007, it was undergoing multicenter phase II clinical trials, and in 2016, early results
in a small phase I trial for multiple myeloma were announced. The two most promising peptides of
antimitotic dolastatins group, dolastatin 10 and 15, were selected for development and are currently
undergoing phase II clinical trials. Cemadotin, the synthetic analogue of dolastatin 15, is also in phase
II clinical trials as a promising cancer chemotherapeutic agent [143,144].
4. Conclusions and Future Prospects
There is increased evidence of the emergence of resistance to conventional drugs illustrating the
importance of research on natural peptide-based drug development. PRCPs have several structural
features making them good drug leads, and there are several naturally-occurring cyclic peptides
in clinical use and in clinical trials. In addition, biologically-active proline-rich cyclic peptides have
been developed with synthetic approaches, and they are useful as therapeutics and biochemical tools.
With the introduction of new high throughput screening methods, there will be more availability
of marine-based PRCPs with interesting biological properties. PRCPs can work on their targets
very selectively, as the interaction with the targets is very specific compared to small molecules.
In addition to the merits of peptides, especially “proline-rich cyclic structures” as drug molecules,
cyclopolypeptides could make even better peptide drugs for future use. Moreover, the future
123
Mar. Drugs 2016, 14, 194
development of peptide drugs will continue to build upon the strengths of naturally-occurring
proline-rich peptides, with the application of traditional rational design to improve their weaknesses,
such as their chemical and physical properties. Further, emerging peptide technologies will help
broaden the applicability of PRCPs as therapeutics. While still in the early stages of development,
PRCPs drug leads have started gaining the attention of the pharmaceutical industry; however, their true
potential is still very much unknown.
Supplementary Materials: The following are available online at www.mdpi.com/1660-3397/14/11/194/s1.
Table S1: Various steric and lipophilic parameters for proline-rich cyclopolypeptides from diverse marine resources.
Acknowledgments: The authors wish to thank chief librarians of Central Drug Research Institute (CDRI),
Lucknow, Uttar Pradesh, India, National Medical Library (NML), New Delhi, India, Faculty of Medical Sciences,
The University of the West Indies, Trinidad and Tobago, West Indies and Wuhan University of Technology,
Wuhan, China, for providing literature support.
Author Contributions: All authors were involved in all aspects of the work done for this paper.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
Bai, R.; Friedman, S.J.; Pettit, G.R.; Hamel, E. Dolastatin 15, a potent antimitotic depsipeptide derived from
Dolabella auricularia: Interaction with tubulin and effects on cellular microtubules. Biochem. Pharmacol. 1992,
43, 2637–2645. [CrossRef]
Okamoto, S.; Iwasaki, A.; Ohno, O.; Suenaga, K. Isolation and structure of kurahyne B and total synthesis of
the kurahynes. J. Nat. Prod. 2015, 78, 2719–2725. [CrossRef] [PubMed]
Iwasaki, A.; Ohno, O.; Sumimoto, S.; Ogawa, H.; Nguyen, K.A.; Suenaga, K. Jahanyne, an apoptosis-inducing
lipopeptide from the marine cyanobacterium Lyngbya sp. Org. Lett. 2015, 17, 652–655. [CrossRef] [PubMed]
Jordan, M.A.; Walker, D.; de Arruda, M.; Barlozzari, T.; Panda, D. Suppression of microtubule dynamics
by binding of cemadotin to tubulin: Possible mechanism for its antitumor action. Biochemistry 1998, 37,
17571–17578. [CrossRef] [PubMed]
Fusetani, N.; Warabi, K.; Nogata, Y.; Nakao, Y.; Matsunaga, S.; van Soest, R.R.M. Koshikamide A1 , a new
cytotoxic linear peptide isolated from a marine sponge Theonella sp. Tetrahedron Lett. 1999, 40, 4687–4690.
[CrossRef]
Pettit, G.R.; Herald, C.L.; Boyd, M.R.; Leet, J.E.; Dufresne, C.; Doubek, D.L.; Schmidt, J.M.; Cerny, R.L.;
Hooper, J.N.A.; Rutzler, K.C. Antineoplastic agents. 219. Isolation and structure of the cell growth inhibitory
constituents from the western Pacific marine sponge Axinella sp. J. Med. Chem. 1991, 34, 3339–3340.
[CrossRef] [PubMed]
Gulavita, N.K.; Gunasekela, S.P.; Pomponi, S.A.; Robinson, E.V. Polydiscamide A: A new bioactive
depsipeptide from the marine sponge Discodermia sp. J. Org. Chem. 1992, 57, 1767–1772. [CrossRef]
Tsuda, M.; Shigemori, H.; Mikami, Y.; Kobayashi, J. Hymenamides C–E, new cyclic heptapeptides with
two proline residues from the Okinawan marine sponge Hymeniacidon sp. Tetrahedron 1993, 49, 6785–6796.
[CrossRef]
Cebrat, M.; Wieczorek, Z.; Siemion, I.Z. Immunosuppressive activity of hymenistatin 1. Peptides 1996, 17,
191–196. [CrossRef]
Tan, L.T.; Williamson, R.T.; Gerwick, W.H.; Watts, K.S.; McGough, K.; Jacobs, R. cis,cis- and
trans,trans-Ceratospongamide, new bioactive cyclic heptapeptides from the indonesian red alga
Ceratodictyon spongiosum and symbiotic sponge Sigmadocia symbiotica. J. Org. Chem. 2000, 65, 419–425.
[CrossRef] [PubMed]
Lu, Z.; Harper, M.K.; Pond, C.D.; Barrows, L.R.; Ireland, C.M.; van Wagoner, R.M. Thiazoline peptides
and a tris-phenethyl urea from Didemnum molle with anti-HIV activity. J. Nat. Prod. 2012, 75, 1436–1440.
[CrossRef] [PubMed]
Sera, Y.; Adachi, K.; Fujii, K.; Shizuri, Y. A new antifouling hexapeptide from a palauan sponge, Haliclona sp.
J. Nat. Prod. 2003, 66, 719–721. [CrossRef] [PubMed]
124
Mar. Drugs 2016, 14, 194
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
Ibrahim, S.R.; Min, C.C.; Teuscher, F.; Ebel, R.; Kakoschke, C.; Lin, W.; Wray, V.; Edrada-Ebel, R.;
Proksch, P. Callyaerins A–F and H, new cytotoxic cyclic peptides from the Indonesian marine sponge
Callyspongia aerizusa. Bioorg. Med. Chem. 2010, 18, 4947–4956. [CrossRef] [PubMed]
Vera, B.; Vicente, J.; Rodriguez, A.D. Isolation and structural elucidation of euryjanicins B–D,
proline-containing cycloheptapeptides from the Caribbean marine sponge Prosuberites laughlini. J. Nat. Prod.
2009, 72, 1555–1562. [CrossRef] [PubMed]
Berer, N.; Rudi, A.; Goldberg, I.; Benayahu, Y.; Kashman, Y. Callynormine A, a new marine cyclic peptide of
a novel class. Org. Lett. 2004, 6, 2543–2545. [CrossRef] [PubMed]
Williams, D.E.; Patrick, B.O.; Behrisch, H.W.; van soest, R.; Roberge, M.; Andersen, R.J. Dominicin, a cyclic
octapeptide, and laughine, a bromopyrrole alkaloid, isolated from the Caribbean marine sponge
Eurypon laughlini. J. Nat. Prod. 2005, 68, 327–330. [CrossRef] [PubMed]
Daletos, G.; Kalscheuer, R.; Koliwer-Brandl, H.; Hartmann, R.; de Voogd, N.J.; Wray, V.; Lin, W.; Proksch, P.
Callyaerins from the marine sponge Callyspongia aerizusa: Cyclic peptides with antitubercular activity.
J. Nat. Prod. 2015, 78, 1910–1925. [CrossRef] [PubMed]
Feng, Y.; Carroll, A.R.; Pass, D.M.; Archbold, J.K.; Avery, V.M.; Quinn, R.J. Polydiscamides B–D from a marine
sponge Ircinia sp. as potent human sensory neuron-specific G protein coupled receptor agonists. J. Nat. Prod.
2008, 71, 8–11. [CrossRef] [PubMed]
Mohammed, R.; Peng, J.; Kelly, M.; Hamann, M.T. Cyclic heptapeptides from the jamaican sponge
Stylissa caribica. J. Nat. Prod. 2006, 69, 1739–1744. [CrossRef] [PubMed]
Zhan, K.X.; Jiao, W.H.; Yang, F.; Li, J.; Wang, S.P.; Li, Y.S.; Han, B.N.; Lin, H.W. Reniochalistatins A–E,
cyclic peptides from the marine sponge Reniochalina stalagmitis. J. Nat. Prod. 2014, 77, 2678–2684. [CrossRef]
[PubMed]
Randazzo, A.; Piaz, F.D.; Orrù, S.; Debitus, C.; Roussakis, C.; Pucci, P.; Gomez-Paloma, L. Axinellins A and
B: New proline-containing antiproliferative cyclopeptides from the Vanuatu sponge Axinella carteri. Eur. J.
Org. Chem. 1998, 11, 2659–2665. [CrossRef]
Woo, J.K.; Jeon, J.E.; Kim, C.K.; Sim, C.J.; Oh, D.C.; Oh, K.B.; Shin, J. Gombamide A, a cyclic thiopeptide from
the sponge Clathria gombawuiensis. J. Nat. Prod. 2013, 76, 1380–1383. [CrossRef] [PubMed]
Tabudravu, J.; Morris, L.A.; Kettenes-van den Bosch, J.J.; Jaspars, M. Wainunuamide, a histidine-containing
proline-rich cyclic heptapeptide isolated from the Fijian marine sponge Stylotella aurantium. Tetrahedron Lett.
2001, 42, 9273–9276. [CrossRef]
Kita, M.; Gise, B.; Kawamura, A.; Kigoshi, H. Stylissatin A, a cyclic peptide that inhibits nitric oxide
production from the marine sponge Stylissa massa. Tetrahedron Lett. 2013, 54, 6826–6828. [CrossRef]
Zhang, H.J.; Yi, Y.H.; Yang, G.J.; Hu, M.Y.; Cao, G.D.; Yang, F.; Lin, H.W. Proline-containing cyclopeptides
from the marine sponge Phakellia fusca. J. Nat. Prod. 2010, 73, 650–655. [CrossRef] [PubMed]
Schmidt, E.W.; Raventos-Suarez, C.; Bifano, M.; Menendez, A.T.; Fairchild, C.R.; Faulkner, D.J.
Scleritodermin A, a cytotoxic cyclic peptide from the lithistid sponge Scleritoderma nodosum. J. Nat. Prod.
2004, 67, 475–478. [CrossRef] [PubMed]
Fernandez, R.; Omar, S.; Feliz, M.; Quinoa, E.; Riguera, R. Malaysiatin, the first cyclic heptapeptide from
a marine sponge. Tetrahedron Lett. 1992, 33, 6017–6020. [CrossRef]
Erickson, K.L.; Gustafson, K.R.; Milanowski, D.J.; Pannell, L.K.; Klose, J.R.; Boyd, M.R. Myriastramides A–C,
new modified cyclic peptides from the Phillipines marine sponge Myriastra clavosa. Tetrahedron 2003, 59,
10231–10238. [CrossRef]
Brennan, M.R.; Costello, C.E.; Maleknia, S.D.; Pettit, G.R.; Erickson, K.L. Stylopeptide 2, a proline-rich
cyclodecapeptide from the sponge Stylotella sp. J. Nat. Prod. 2008, 71, 453–436. [CrossRef] [PubMed]
Pettit, G.R.; Gao, F.; Schmidt, J.M.; Cerny, R. Isolation and structure of axinastatin 5 from a Republic of
Comoros marine sponge. Bioorg. Med. Chem. Lett. 1994, 4, 2935–2940. [CrossRef]
Kobayashi, J.; Tsuda, M.; Nakamura, T.; Mikami, Y.; Shigemori, H. Hymenamides A and B, new proline-rich
cyclic heptapeptides from the okinawan marine sponge hymeniacidon sp. Tetrahedron 1993, 49, 2391–2402.
[CrossRef]
Pettit, G.R.; Cichacz, Z.; Barkoczy, J.; Dorsaz, A.C.; Herald, D.L.; Williams, M.D.; Doubek, D.L.; Schmidt, J.M.;
Tackett, L.P.; Brune, D.C.; et al. Isolation and structure of the marine sponge cell growth inhibitory cyclic
peptide phakellistatin 1. J. Nat. Prod. 1993, 56, 260–267. [CrossRef] [PubMed]
125
Mar. Drugs 2016, 14, 194
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
Arai, M.; Yamano, Y.; Fujita, M.; Setiawan, A.; Kobayashi, M. Stylissamide X, a new proline-rich cyclic
octapeptide as an inhibitor of cell migration, from an Indonesian marine sponge of Stylissa sp. Bioorg. Med.
Chem. Lett. 2012, 22, 1818–1821. [CrossRef] [PubMed]
Afifi, A.H.; El-Desoky, A.H.; Kato, H.; Mangindaan, R.E.P.; de Voogd, N.J.; Ammar, N.M.; Hifnawy, M.S.;
Tsukamoto, S. Carteritins A and B, cyclic heptapeptides from the marine sponge Stylissa carteri.
Tetrahedron Lett. 2016, 57, 1285–1288. [CrossRef]
Pettit, G.R.; Clewlow, P.J.; Dufrense, C.; Doubek, D.L.; Cerny, R.L.; Rutzler, K. Antineoplastic agents. 193.
Isolation and structure of the cyclic peptide hymenistatin 1. Can. J. Chem. 1990, 68, 708–711. [CrossRef]
Vicente, J.; Vera, B.; Rodriguez, A.D.; Rodriguez-Escudero, I.; Raptis, R.G. Euryjanicin A: A new
cycloheptapeptide from the Caribbean marine sponge Prosuberites laughlini. Tetrahedron Lett. 2009, 50,
4571–4574. [CrossRef] [PubMed]
Yeung, B.K.S.; Nakao, Y.; Kinnel, R.B.; Carney, J.R.; Yoshida, W.Y.; Scheuer, P.J.; Kelly-Borges, M.
The Kapakahines, cyclic peptides from the marine sponge Cribrochalina olemda. J. Org. Chem. 1996, 61,
7168–7173. [CrossRef] [PubMed]
Rashid, M.A.; Gustafson, K.R.; Cartner, L.K.; Shigematsu, N.; Pannell, L.K.; Boyd, M.R.
Microspinosamide, a new HIV-inhibitory cyclic depsipeptide from the marine sponge Sidonops microspinosa.
J. Nat. Prod. 2001, 64, 117–121. [CrossRef] [PubMed]
Pettit, G.R.; Gao, F.; Cerny, R.L.; Doubek, D.L.; Tackett, L.P.; Schmidt, J.M.; Chapuis, J.C. Antineoplastic
agents. 278. Isolation and structure of axinastatins 2 and 3 from a western Caroline Island marine sponge.
J. Med. Chem. 1994, 37, 1165–1168. [CrossRef] [PubMed]
Carroll, A.R.; Bowden, B.F.; Coll, J.C.; Hockless, D.C.R.; Skelton, B.W.; White, A.H. Studies of australian
ascidians. IV. Mollamide, a cytotoxic cyclic heptapeptide from the compound ascidian Didemnum molle.
Aust. J. Chem. 1994, 47, 61–69. [CrossRef]
Tan, K.O.; Wakimoto, T.; Takada, K.; Ohtsuki, T.; Uchiyama, N.; Goda, Y.; Abe, I. Cycloforskamide, a cytotoxic
macrocyclic peptide from the sea slug Pleurobranchus forskalii. J. Nat. Prod. 2013, 76, 1388–1391. [CrossRef]
[PubMed]
Whitson, E.L.; Ratnayake, A.S.; Bugni, T.S.; Harper, M.K.; Treland, C.M. Isolation, structure elucidation and
synthesis of eudistomides A and B, lipopeptides from a fijian ascidian Eudistoma sp. J. Org. Chem. 2009, 74,
1156–1162. [CrossRef] [PubMed]
Rinehart, K.L., Jr.; Gloer, J.B.; Cook, J.C., Jr.; Mizsak, S.A.; Scahill, T.A. Structures of the didemnins, antiviral
and cytotoxic depsipeptides from a Caribbean tunicate. J. Am. Chem. Soc. 1981, 103, 1857–1859. [CrossRef]
Vervoort, H.; Fenical, W. Tamandarins A and B: New cytotoxic depsipeptides from a Brazilian ascidian of the
family Didemnidae. J. Org. Chem. 2000, 65, 782–792. [CrossRef] [PubMed]
Mercader, A.G.; Duchowicz, P.R.; Sivakumar, P.M. Chemometrics Applications and Research: QSAR in Medicinal
Chemistry; Apple Academic Press, Inc.: Oakville, ON, Canada, 2016; p. 278.
Han, B.; Goeger, D.; Maier, C.S.; Gerwick, W.H. The Wewakpeptins, cyclic depsipeptides from a papua
new guinea collection of the marine cyanobacterium Lyngbya semiplena. J. Org. Chem. 2005, 70, 3133–3139.
[CrossRef] [PubMed]
Lopez, J.A.V.; Al-Lihaibi, S.S.; Alarif, W.M.; Abdel-Lateff, A.; Nogata, Y.; Washio, K.; Morikawa, M.; Okino, T.
Wewakazole B, a cytotoxic cyanobactin from the cyanobacterium Moorea producens collected in the red sea.
J. Nat. Prod. 2016, 79, 1213–1218. [CrossRef] [PubMed]
An, T.; Kumar, T.K.; Wang, M.; Liu, L.; Lay, J.O., Jr.; Liyanage, R.; Berry, J.; Gantar, M.; Marks, V.; Gawley, R.E.;
et al. Structures of pahayokolides A and B, cyclic peptides from a Lyngbya sp. J. Nat. Prod. 2007, 70, 730–735.
[CrossRef] [PubMed]
Luo, S.; Krunic, A.; Kang, H.S.; Chen, W.L.; Woodard, J.L.; Fuchs, J.R.; Swanson, S.M.; Orjala, J.
Trichormamides A and B with antiproliferative activity from the cultured freshwater cyanobacterium
Trichormus sp. UIC 10339. J. Nat. Prod. 2014, 77, 1871–1880. [CrossRef] [PubMed]
Fujii, K.; Sivonen, K.; Kashiwagi, T.; Hirayama, K.; Harada, K.I. Nostophycin, a novel cyclic peptide from the
toxic cyanobacterium Nostoc sp. 152. J. Org. Chem. 1999, 64, 5777–5782. [CrossRef]
Davies-Coleman, M.T.; Dzeha, T.M.; Gray, C.A.; Hess, S.; Pannell, L.K.; Hendricks, D.T.; Arendse, C.E.
Isolation of homodolastatin 16, a new cyclic depsipeptide from a Kenyan collection of Lyngbya majuscula.
J. Nat. Prod. 2003, 66, 712–715. [CrossRef] [PubMed]
126
Mar. Drugs 2016, 14, 194
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
Nogle, L.M.; Gerwick, W.H. Isolation of four new cyclic depsipeptides, antanapeptins A–D, and dolastatin 16
from a madagascan collection of Lyngbya majuscula. J. Nat. Prod. 2002, 65, 21–24. [CrossRef] [PubMed]
Dahiya, R. Cyclopolypeptides with antifungal interest. Coll. Pharm. Commun. 2013, 1, 1–15.
Dahiya, R.; Gautam, H. Synthesis, characterization and biological evaluation of cyclomontanin D. Afr. J.
Pharm. Pharmacol. 2011, 5, 447–453. [CrossRef]
Dahiya, R.; Gautam, H. Synthetic and pharmacological studies on a natural cyclopeptide from
Gypsophila arabica. J. Med. Plant Res. 2010, 4, 1960–1966.
Dahiya, R.; Singh, S. Synthesis, characterization and biological screening of diandrine A. Acta Pol. Pharm.
2016, submitted.
Dahiya, R.; Gautam, H. Solution phase synthesis and bioevaluation of cordyheptapeptide B. Bull. Pharm. Res.
2011, 1, 1–10.
Dahiya, R. Synthesis of a phenylalanine-rich peptide as potential anthelmintic and cytotoxic agent.
Acta Pol. Pharm. 2007, 64, 509–516. [PubMed]
Dahiya, R.; Gautam, H. Toward the first total synthesis of gypsin D: A natural cyclopolypeptide from
Gypsophila arabica. Am. J. Sci. Res. 2010, 11, 150–158.
Dahiya, R.; Kaur, K. Synthesis and pharmacological investigation of segetalin C as a novel antifungal and
cytotoxic agent. Arzneimittelforschung 2008, 58, 29–34. [CrossRef] [PubMed]
Dahiya, R. Synthetic and pharmacological studies on longicalycinin A. Pak. J. Pharm. Sci. 2007, 20, 317–323.
[PubMed]
Dahiya, R.; Kumar, A. Synthetic and biological studies on a cyclopolypeptide of plant origin. J. Zhejiang Univ.
Sci. B 2008, 9, 391–400. [CrossRef] [PubMed]
Dahiya, R.; Gautam, H. Synthesis and pharmacological studies on a cyclooligopeptide from marine bacteria.
Chin. J. Chem. 2011, 29, 1911–1916.
Dahiya, R. Synthesis, characterization and biological evaluation of a glycine-rich peptide—Cherimolacyclopeptide
E. J. Chil. Chem. Soc. 2007, 52, 1224–1229. [CrossRef]
Dahiya, R.; Gautam, H. Toward the synthesis and biological screening of a cyclotetrapeptide from marine
bacteria. Mar. Drugs 2011, 9, 71–81. [CrossRef] [PubMed]
Dahiya, R.; Maheshwari, M.; Yadav, R. Synthetic and cytotoxic and antimicrobial activity studies on
annomuricatin B. Z. Naturforsch. 2009, 64, 237–244. [CrossRef]
Aneiros, A.; Garateix, A. Bioactive peptides from marine sources: Pharmacological properties and isolation
procedures. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 2004, 803, 41–53. [CrossRef] [PubMed]
Silver, F.H. Mechanosensing and Mechanochemical Transduction in Extracellular Matrix. Biochemical, Chemical,
Engineering, and Physiological Aspects. Macromolecular Structures in Tissues; Springer: Berlin/Heidelberg,
Germany, 2006; Volume XVI, p. 33.
Pandey, A.K.; Naduthambi, D.; Thomas, K.M.; Zondlo, N.J. Proline editing: A general and practical approach
to the synthesis of functionally and structurally diverse peptides. Analysis of steric versus stereoelectronic
effects of 4-substituted prolines on conformation within peptides. J. Am. Chem. Soc. 2013, 135, 4333–4363.
[CrossRef] [PubMed]
Roxin, A.; Zheng, G. Flexible or fixed: A comparative review of linear and cyclic cancer-targeting peptides.
Future Med. Chem. 2012, 4, 1601–1618. [CrossRef] [PubMed]
Goodwin, D.; Simerska, P.; Toth, I. Peptides as therapeutics with enhanced bioactivity. Curr. Med. Chem.
2012, 19, 4451–4461. [CrossRef] [PubMed]
Jensen, J.E.; Mobli, M.; Brust, A.; Alewood, P.F.; King, G.F.; Rash, L.D. Cyclisation increases the stability of
the sea anemone peptide APETx2 but decreases its activity at acid-sensing ion channel 3. Mar. Drugs 2012,
10, 1511–1527. [CrossRef] [PubMed]
Roxin, A. Towards Targeted Photodynamic Therapy: Synthesis and Characterization of Aziridine
Aldehyde-Cyclized Cancertargeting Peptides and Bacteriochlorin Photosensitizers. Ph.D. Thesis,
Graduate Department of Pharmaceutical Sciences, University of Toronto, Toronto, ON, Canada, 2014.
Fosgerau, K.; Hoffmann, T. Peptide therapeutics: Current status and future directions. Drug Discov. Today
2015, 20, 122–128. [CrossRef] [PubMed]
Shanmugam, S.; Kumar, S.T.; Selvam, K.P. Laboratory Handbook on Biochemistry, 1st ed.; Prentice-Hall of India
Private Limited: New Delhi, India, 2010.
127
Mar. Drugs 2016, 14, 194
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
92.
93.
94.
95.
96.
97.
Pettit, G.R.; Gao, F.; Cerny, R. Isolation and structure of axinastatin 4 from the western indian ocean marine
sponge Axinella cf. carteri. Heterocycles 1993, 35, 711–718. [CrossRef]
Kawagishi, H.; Somoto, A.; Kuranari, J.; Kimura, A.; Chiba, S. A novel cyclotetrapeptide produced by
Lactobacillus helveticus as a tyrosinase inhibitor. Tetrahedron Lett. 1993, 34, 3439–3440. [CrossRef]
Pergament, I.; Carmeli, S. Schizotrin A; a novel antimicrobial cyclic peptide from a cyanobacterium.
Tetrahedron Lett. 1994, 35, 8473–8476. [CrossRef]
Pettit, G.R.; Srirangam, J.K.; Herald, D.L.; Xu, J.P.; Boyd, M.R.; Cichacz, Z.; Kamano, Y.; Schmidt, J.M.;
Erickson, K.L. Isolation and crystal structure of stylopeptide 1, a new marine porifera cycloheptapeptide.
J. Org. Chem. 1995, 60, 8257–8261. [CrossRef]
Carroll, A.R.; Coll, J.C.; Bourne, J.C.; MacLeod, J.K.; Zanriskie, T.M.; Ireland, C.M.; Bowden, B.F. Patellins 1-6
and Trunkamide A: Novel cyclic hexa-, hepta- and octa-peptides from colonial ascidians, Lissoclinurn sp.
Aust. J. Chem. 1996, 49, 659–667.
Kobayashi, J.; Nakamura, T.; Tsuda, M. Hymenamide F, new cyclic heptapeptide from marine sponge
Hymeniacidon sp. Tetrahedron 1996, 52, 6355–6360. [CrossRef]
Shin, H.J.; Matsuda, H.; Murakami, M.; Yamaguchi, K. Agardhipeptins A and B, two new cyclic hepta- and
octapeptide, from the cyanobacterium Oscillatoria agardhii (NIES-204). Tetrahedron 1996, 52, 13129–13136.
[CrossRef]
Belofsky, G.N.; Gloer, J.B.; Wicklow, D.T.; Dowd, P.F. Shearamide A: A new cyclic peptide from the
ascostromata of Eupenicillium shearii. Tetrahedron Lett. 1998, 39, 5497–5500. [CrossRef]
Murakami, M.; Itou, Y.; Ishida, K.; Shin, H.J. Prenylagaramides A and B, new cyclic peptides from two strains
of Oscillatoria agardhii. J. Nat. Prod. 1999, 62, 752–755. [CrossRef] [PubMed]
Milanowski, D.J.; Rashid, M.A.; Gustafson, K.R.; O’Keefe, B.R.; Nawrocki, J.P.; Pannell, L.K.; Boyd, M.R.
Cyclonellin, a new cyclic octapeptide from the marine sponge Axinella carteri. J. Nat. Prod. 2004, 67, 441–444.
[CrossRef] [PubMed]
Leikoski, N.; Fewer, D.P.; Jokela, J.; Wahlsten, M.; Rouhiainen, L.; Sivonen, K. Highly diverse cyanobactins in
strains of the genus Anabaena. Appl. Environ. Microbiol. 2010, 76, 701–709. [CrossRef] [PubMed]
Cheng, Y.X.; Zhou, L.L.; Yan, Y.M.; Chen, K.X.; Hou, F.F. Diabetic nephropathy-related active cyclic peptides
from the roots of Brachystemma calycinum. Bioorg. Med. Chem. Lett. 2011, 21, 7334–7439. [CrossRef] [PubMed]
Aviles, E.; Rodriguez, A.D. Euryjanicins E–G, poly-phenylalanine and poly-proline cyclic heptapeptides
from the Caribbean sponge Prosuberites laughlini. Tetrahedron 2013, 69, 10797–10804. [CrossRef] [PubMed]
Pettil, G.R.; Tan, R.; Williams, M.D.; Tackett, L.; Schmidt, J.M.; Cerny, R.L.; Hooper, J.N.A. Isolation and
structure of phakellistatin 2 from the eastern indian ocean marine sponge phakellia carteri. Bioorg. Med.
Chem. Lett. 1993, 3, 2869–2874. [CrossRef]
Tsuda, M.; Sasaki, T.; Kobayashi, J. Hymenamides G, H, J, and K, four new cyclic octapeptides from the
Okinawan marine sponge Hymeniacidon sp. Tetrahedron 1994, 50, 4667–4680. [CrossRef]
Pettit, G.R.; Tan, R.; Ichihara, Y.; Williams, M.D.; Doubek, D.L.; Tackett, L.P.; Schmidt, J.M.; Cerny, R.L.;
Boyd, M.R.; Hooper, J.N. Antineoplastic agents, 325. Isolation and structure of the human cancer cell growth
inhibitory cyclic octapeptides phakellistatin 10 and 11 from Phakellia sp. J. Nat. Prod. 1995, 58, 961–965.
[CrossRef] [PubMed]
Rashid, M.A.; Gustafson, K.R.; Boswell, J.L.; Boyd, M.R. Haligramides A and B, two new cytotoxic
hexapeptides from the marine sponge Haliclona nigra. J. Nat. Prod. 2000, 63, 956–959. [CrossRef] [PubMed]
Guan, L.L.; Sera, Y.; Adachi, K.; Nishida, F.; Shizuri, Y. Isolation and evaluation of nonsiderophore cyclic
peptides from marine sponges. Biochem. Biophy. Res. Commun. 2001, 283, 976–981. [CrossRef] [PubMed]
Tabudravu, J.N.; Morris, L.A.; Kettenes-van den Bosch, J.J.; Jaspars, M. Axinellin C, a proline-rich cyclic
octapeptide isolated from the Fijian marine sponge Stylotella aurantium. Tetrahedron 2002, 58, 7863–7868.
[CrossRef]
Sera, Y.; Adachi, K.; Fujii, K.; Shizuri, Y. Isolation of haliclonamides: New peptides as antifouling substances
from a marine sponge species, Haliclona. Mar. Biotechnol. 2002, 4, 441–446. [CrossRef] [PubMed]
Nogle, L.M.; Marquez, B.L.; Gerwick, W.H. Wewakazole, a novel cyclic dodecapeptide from a papua new
guinea Lyngbya majuscule. Org. Lett. 2003, 5, 3–6. [CrossRef] [PubMed]
Sun, J.; Cheng, W.; de Voogd, N.J.; Proksch, P.; Lin, W. Stylissatins B–D, cycloheptapeptides from the marine
sponge Stylissa massa. Tetrahedron Lett. 2016, in press.
128
Mar. Drugs 2016, 14, 194
98.
99.
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
111.
112.
113.
114.
115.
116.
117.
118.
119.
120.
121.
Wieland, T.; Luben, G.; Ottenheym, H.; Faesel, D.C.J.; de Vries, J.X.; Prox, A.; Schmid, D.C.J. The discovery,
isolation, elucidation of structure, and synthesis of antamanide. Angew. Chem. Int. Ed. 1968, 7, 204–208.
[CrossRef] [PubMed]
Ibrahim, S.R.M.; Edrada-Ebel, R.A.; Mohamed, G.A.; Youssef, D.T.A.; Wray, V.; Proksch, P. Callyaerin G,
a new cytotoxic cyclic peptide from the marine sponge Callyspongia aerizusa. ARKIVOC Arch. Org. Chem.
2008, 2008, 164–171.
Pettit, G.R.; Tan, R.; Herald, D.L.; Cerny, R.L.; Williams, M.D. Antineoplastic agents. 277. Isolation and
structure of phakellistatin 3 and isophakellistatin 3 from a republic of Comoros marine sponge. J. Org. Chem.
1994, 59, 1593–1595. [CrossRef]
Martins, J.; Vasconcelos, V. Cyanobactins from cyanobacteria: Current genetic and chemical state of
knowledge. Mar. Drugs 2015, 13, 6910–6946. [CrossRef] [PubMed]
Donia, M.S.; Ravel, J.; Schmidt, E.W. A global assembly line to cyanobactins. Nat. Chem. Biol. 2008, 4, 341–343.
[CrossRef] [PubMed]
Mojsoska, B.; Jenssen, H. Peptides and peptidomimetics for antimicrobial drug design. Pharmaceuticals 2015,
8, 366–415. [CrossRef] [PubMed]
Wedemeyer, W.J.; Welker, E.; Scheraga, H.A. Proline cis-trans isomerization and protein folding. Biochemistry
2002, 41, 14637–14644. [CrossRef] [PubMed]
Sarkar, P.; Reichman, C.; Saleh, T.; Birge, R.B.; Kalodimos, C.G. Proline cis-trans isomerization controls
autoinhibition of a signaling protein. Mol. Cell 2007, 25, 413–426. [CrossRef] [PubMed]
Vitagliano, L.; Berisio, R.; Mastrangelo, A.; Mazzarella, L.; Zagari, A. Preferred proline puckerings in cis
and trans peptide groups: Implications for collagen stability. Protein Sci. 2001, 10, 2627–2632. [CrossRef]
[PubMed]
Bhushan, R.; Bruckner, H. Marfey’s reagent for chiral amino acid analysis: A review. Amino Acids 2004, 27,
231–247. [CrossRef] [PubMed]
Anand, M.; Alagar, M.; Ranjitha, J.; Selvaraj, V. Total synthesis and anticancer activity of a cyclic heptapeptide
from marine sponge using water soluble peptide coupling agent EDC. Arab. J. Chem. 2016, in press.
Shinde, N.V.; Himaja, M.; Bhosale, S.K.; Ramana, M.V.; Sakarkar, D.M. Synthesis and biological evaluation of
delavayin-C. Indian J. Pharm. Sci. 2008, 70, 827–831. [CrossRef] [PubMed]
Dahiya, R. Synthesis, spectroscopic and biological investigation of cyclic octapeptide: Cherimolacyclopeptide G.
Turk. J. Chem. 2008, 32, 205–215.
Dahiya, R. Total synthesis and biological potential of psammosilenin A. Arch. Pharm. Chem. Life Sci. 2008,
341, 502–509. [CrossRef] [PubMed]
Dahiya, R.; Pathak, D.; Himaja, M.; Bhatt, S. First total synthesis and biological screening of hymenamide E.
Acta Pharm. 2006, 56, 399–415. [PubMed]
Dahiya, R.; Kumar, A.; Gupta, R. Synthesis, cytotoxic and antimicrobial screening of a proline-rich
cyclopolypeptide. Chem. Pharm. Bull. (Tokyo) 2009, 57, 214–217. [CrossRef] [PubMed]
Dahiya, R.; Gautam, H. Total synthesis and antimicrobial activity of a natural cycloheptapeptide of marine
origin. Mar. Drugs 2010, 8, 2384–2394. [CrossRef] [PubMed]
Poojary, B.; Belagali, S.L. Synthetic studies on cyclic octapeptides: Yunnanin F and hymenistatin. Eur. J.
Med. Chem. 2005, 40, 407–412. [CrossRef] [PubMed]
Poojary, B.; Kumar, K.H.; Belagali, S.L. Synthesis and biological evaluation of pseudostellarin B. Pharmaco
2001, 56, 331–334. [CrossRef]
Dahiya, R.; Kaur, K. Synthetic and biological studies on natural cyclic heptapeptide: Segetalin E.
Arch. Pharm. Res. 2007, 30, 1380–1386. [CrossRef] [PubMed]
El Khatib, M.; Elagawany, M.; Caliskan, E.; Davis, E.F.; Faidallah, H.M.; El-Feky, S.A.; Katritzky, A.R.
Total synthesis of cyclic heptapeptide rolloamide B. Chem. Commun. (Camb.) 2013, 49, 2631–2633. [CrossRef]
[PubMed]
Poojary, B.; Kumar, K.H.; Belagali, S.L. Synthesis of a new cyclic peptide, pseudostellarin G. Z. Naturforsch. B
2004, 59, 817–820. [CrossRef]
Zhang, C.M.; Guo, J.X.; Wang, L.; Chai, X.Y.; Hu, H.G.; Wu, Q.Y. Total synthesis of cyclic heptapeptide
euryjanicin B. Chin. Chem. Lett. 2011, 22, 631–634. [CrossRef]
McKeever, B.; Pattenden, G. Total synthesis of mollamide, a reverse prenyl substituted cytotoxic cyclic
peptide from Didemnum molle. Tetrahedron Lett. 1999, 40, 9317–9320. [CrossRef]
129
Mar. Drugs 2016, 14, 194
122. Dellai, A.; Maricic, I.; Kumar, V.; Arutyunyan, S.; Bouraoui, A.; Nefzi, A. Parallel synthesis and
anti-inflammatory activity of cyclic peptides cyclosquamosin D and Met-cherimolacyclopeptide B and
their analogs. Bioorg. Med. Chem. Lett. 2010, 20, 5653–5657. [CrossRef] [PubMed]
123. Fairweather, K.A.; Sayyadi, N.; Roussakis, C.; Jolliffi, K.A. Synthesis of the cyclic heptapeptide axinellin A.
Tetrahedron 2010, 66, 935–939. [CrossRef]
124. Napolitano, A.; Bruno, I.; Riccio, R.; Gomez-Paloma, L. Synthesis, structure, and biological aspects of
cyclopeptides related to marine phakellistatins 7–9. Tetrahedron 2005, 61, 6808–6815. [CrossRef]
125. Ali, L.; Musharraf, S.G.; Shaheen, F. Solid-phase total synthesis of cyclic decapeptide phakellistatin 12.
J. Nat. Prod. 2008, 71, 1059–1062. [CrossRef] [PubMed]
126. Sleebs, M.M.; Scanlon, D.; Karas, J.; Maharani, R.; Hughes, A.B. Total synthesis of the antifungal depsipeptide
petriellin A. J. Org. Chem. 2011, 76, 6686–6693. [CrossRef] [PubMed]
127. Napolitano, A.; Bruno, I.; Rovero, P.; Lucas, R.; Peris, M.P.; Gomez-Paloma, L.; Riccio, R.
Synthesis, structural aspects and bioactivity of the marine cyclopeptide hymenamide C. Tetrahedron 2001, 57,
6249–6255. [CrossRef]
128. Garcia-Barrantes, P.M.; Lindsley, C.W. Total synthesis of gombamide A. Org. Lett. 2016, 18, 3810–3813.
[CrossRef] [PubMed]
129. Sellanes, D.; Manta, E.; Serra, G. Toward the total synthesis of scleritodermin A: Preparation of the C1 –N15
fragment. Tetrahedron Lett. 2007, 48, 1827–1830. [CrossRef] [PubMed]
130. Dahiya, R.; Pathak, D. First total synthesis and biological evaluation of halolitoralin A. J. Serb. Chem. Soc.
2007, 72, 101–107. [CrossRef]
131. Dahiya, R.; Maheshwari, M.; Kumar, A. Toward the synthesis and biological evaluation of hirsutide.
Monatsh. Chem. 2009, 140, 121–127. [CrossRef]
132. Huang, T.; Zou, Y.; Wu, M.C.; Zhao, Q.J.; Hu, H.G. Total synthesis of proline-rich cyclic octapeptide
stylissamide X. Chem. Nat. Prod. 2015, 51, 523–526. [CrossRef]
133. Santhakumar, G.; Payne, R.J. Total synthesis of polydiscamides B, C, and D via a convergent native chemical
ligation-oxidation strategy. Org. Lett. 2014, 16, 4500–4503. [CrossRef] [PubMed]
134. Pettit, G.R.; Holman, J.W.; Boland, G.M. Synthesis of the cyclic heptapeptides axinastatin 2 and axinastatin 3.
J. Chem. Soc. Perkin Trans. 1 1996, 2411–2416. [CrossRef]
135. Dahiya, R.; Pathak, D. Cyclic peptides: New hope for antifungal therapy. Egypt. Pharm. J. (NRC) 2006, 5,
189–199.
136. Pathak, D.; Dahiya, R. Cyclic peptides as novel antineoplastic agents: A review. J. Sci. Pharm. 2003, 4,
125–131.
137. Pettit, G.R.; Xu, J.P.; Dorsaz, A.C.; Williams, M.D.; Boyd, M.R.; Cerny, R.L. Isolation and structure of the
human cancer cell growth inhibitory cyclic decapeptides phakellistatins 7, 8 and 9. Bioorg. Med. Chem. Lett.
1995, 5, 1339–1344. [CrossRef]
138. Pettit, G.R.; Tan, R. Antineoplastic agents 390. Isolation and structure of phakellistatin 12 from a Chuuk
Archipelago marine sponge. Bioorg. Med. Chem. Lett. 2003, 13, 685–688. [CrossRef]
139. Li, L.H.; Timmins, L.G.; Wallace, T.L.; Krueger, W.C.; Prairie, M.D.; Im, W.B. Mechanism of action of
didemnin B, a depsipeptide from the sea. Cancer Lett. 1984, 23, 279–288. [CrossRef]
140. Zheng, L.H.; Wang, Y.J.; Sheng, J.; Wang, F.; Zheng, Y.; Lin, X.K.; Sun, M. Antitumor peptides from marine
organisms. Mar. Drugs 2011, 9, 1840–1859. [CrossRef] [PubMed]
141. Siemion, I.Z.; Cebrat, M.; Wieczorek, Z. Cyclolinopeptides and their analogs—A new family of peptide
immunosuppressants affecting the calcineurin system. Arch. Immunol. Ther. Exp. 1999, 47, 143–153.
142. Malaker, A.; Ahmad, S.A.I. Therapeutic potency of anticancer peptides derived from marine organism. Int. J.
Eng. Appl. Sci. 2013, 2, 53–65.
143. Simmons, T.L.; Andrianasolo, E.; McPhail, K.; Flatt, P.; Gerwick, W.H. Marine natural products as anticancer
drugs. Mol. Cancer Ther. 2005, 4, 333–342. [PubMed]
144. Proksch, P.; Ebel, R.; Edrada, R.A.; Wray, V.; Steube, K. Bioactive natural products from marine invertebrates
and associated fungi. Prog. Mol. Subcell. Biol. 2003, 37, 117–142. [PubMed]
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
130
marine drugs
Review
Preclinical and Clinical Studies on Antioxidative,
Antihypertensive and Cardioprotective Effect of
Marine Proteins and Peptides—A Review
Ida-Johanne Jensen * and Hanne K. Mæhre
Norwegian College of Fishery Science, Faculty of Biosciences, Fisheries and Economics,
UIT The Arctic University of Norway, N-9037 Tromsø, Norway; hanne.maehre@uit.no
* Correspondence: ida-johanne.jensen@uit.no; Tel.: +47-776-46-721
Academic Editor: Se-Kwon Kim
Received: 3 October 2016; Accepted: 11 November 2016; Published: 18 November 2016
Abstract: High seafood consumption has traditionally been linked to a reduced risk of cardiovascular
diseases, mainly due to the lipid lowering effects of the long chained omega 3 fatty acids.
However, fish and seafood are also excellent sources of good quality proteins and emerging
documentation show that, upon digestion, these proteins are sources for bioactive peptides with
documented favorable physiological effects such as antioxidative, antihypertensive and other
cardioprotective effects. This documentation is mainly from in vitro studies, but also animal studies
are arising. Evidence from human studies evaluating the positive health effects of marine proteins
and peptides are scarce. In one study, a reduction in oxidative stress after intake of cod has been
documented and a few human clinical trials have been performed evaluating the effect on blood
pressure. The results are, however, inconclusive. The majority of the human clinical trials performed
to investigate positive health effects of marine protein and lean fish intake, has focused on blood
lipids. While some studies have documented a reduction in triglycerides after intake of lean fish,
others have documented no effects.
Keywords: marine; proteins; peptides; bioactive; antioxidative; clinical trials; preclinical; animal studies
1. Introduction
Cardiovascular diseases (CVDs) are a group of diseases affecting the heart and blood vessels
and they are the largest cause of morbidity and premature deaths worldwide [1] accounting for 31%
of all global deaths in 2012 [2]. The development of CVDs is associated with several risk factors,
both modifiable and non-modifiable, and the danger of developing CVD increases considerably with
the number of risk factors present [3]. Gender, heredity and increasing age are risk factors that
are non-modifiable. Modifiable risk factors are often life-style related and may be associated with
oxidative stress. Tobacco smoking, physical inactivity, diabetes mellitus, obesity and overweight are,
along with hypertension and dyslipidemia, examples of such preventable risk factors. Although the
risk factors associated with the development of CVDs are many and affect several processes in the
body, there are two major underlying causes for CVD, namely hypertension and atherosclerosis [1].
Nutritional intervention is well accepted as a safe and effective approach to health maintenance
and it has been estimated that a change in nutritional pattern may reduce cardiovascular-related
deaths by 60% [4]. Seafood consumption has been linked to a reduced risk of these illnesses, and
traditionally the beneficial effects have been associated with the long-chained omega 3 polyunsaturated
fatty acids eicosapentaenoic acid (EPA, 20:5n3) and docosahexaenoic acid (DHA, 22:6n3) [5–10].
Emerging evidence has now demonstrated that the proteins, as well as other bioactive compounds,
may also be relevant for improving human health by different mechanisms. Fish and seafood are
Mar. Drugs 2016, 14, 211
131
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2016, 14, 211
excellent sources of good quality proteins that upon digestion may be sources for bioactive peptides
with documented favorable physiological effects such as antioxidative, antihypertensive and other
cardioprotective effects. The documentation is mainly from in vitro studies, but the number of
preclinical studies and human trials performed is arising. This review aims to summarize these
preclinical and clinical studies.
Clinical Trials
In order to evaluate causal relationships between nutrients and chronic diseases, two main
approaches are normally applied, namely epidemiological and experimental studies. There are
advantages and disadvantages associated with both study types, and a combination of studies will
probably return the most solid foundation for evidence. In brief, epidemiological studies range over
a long period of time and include large population groups. Data material may be very large, there are
few restrictions in diet and diseases can be included as endpoint. The main drawback is that they
are poorly controlled and that the sources of error are many. Experimental studies are performed in
a more controlled environment compared to epidemiological studies. Clinical trials involving human
volunteers and preclinical trials involving animals fall into this category. In such studies, test subjects
are enrolled into a controlled environment where their diets, together with other relevant measures,
are regulated. Effects are registered through a range of different physiological parameters, depending
on the aim of the study.
In our opinion, experimental clinical studies on humans are by far the most accurate way to
evaluate the health effects of different diets or food components. However, such studies are also
very expensive, time consuming and complex. Further, inclusion criteria for participants may vary
according to the aim of the study and comparisons between studies may therefore be difficult.
2. Oxidative Stress and Antioxidative Status
Aerobic metabolism is accompanied by an inevitable production of reactive oxygen species,
normally referred to as ROS. To reduce the production and counter the harm of these ROS,
the human body is equipped with several antioxidant systems involving mechanisms that prevent
free radicals from causing damage and mechanisms that repair or mitigate any occurred damage [11].
However, the balance between ROS and antioxidants may shift in favor of ROS, and a condition
called oxidative stress arises. This condition has been related to several disorders, atherosclerosis [12]
in particular. There is now a general acceptance that consumption of dietary antioxidants is an
effective approach to increase the body’s antioxidant load and mitigate the effects of ROS [13].
The mechanisms may be inactivation of ROS [14], scavenging of free radicals [15], chelating of
pro-oxidative transition metals [16] and reduction of hydroperoxides [17,18]. Some amino acids,
in particular histidine, glutamic acid, aspartic acid, along with phosphorylated serine and threonine,
have the ability to chelate prooxidative transition metals [16]. Usually, peptides are considered more
potent antioxidants due to the stability of the resultant peptide radical [13]. The antioxidant potential
of a protein or peptide depends on the amino acids being exposed and accessible to prooxidants.
Increased exposure of amino acids can be attained by food processing, fermentation or gastrointestinal
digestion. The in vitro antioxidant activity of marine protein hydrolysates has been shown for
several fish species, mollusks, crustaceans and microalgae. The link to a beneficial health outcome in
humans is, however, still on a theoretical level. Despite evidence showing clear associations between
oxidative stress and CVDs, epidemiological data on antioxidant intake and disease prevention are
inconclusive. Natural antioxidant intake from foods has been proven beneficial [19], whereas analyses
with antioxidant supplementation have been proven unfavorable or even resulting in adverse effects
in preventing all-cause mortality [20,21].
132
Mar. Drugs 2016, 14, 211
2.1. Human Studies
One study has been published focusing on the effect of marine proteins on oxidative stress and
antioxidative status (Table 1). During a randomized parallel intervention, 276 overweight subjects
were following a diet designed for weight loss [22]. The subjects were randomized to four groups and
followed a diet plan with either lean meat, lean meat supplemented with omega-3 fatty acids, cod or
salmon during eight weeks. The oxidation product malondialdehyd and the antioxidative capacity
were measured before and after the trial. After the intervention period, the amount of the oxidation
product was significantly reduced in the group following the cod based diet (from 1.81 nM to 1.72 nM).
At the same time, the antioxidative capacity in this group increased significantly (from 0.62 nM to
0.71 nM) and was significantly higher than that in the individuals following both the lean meat diet
and the lean meat with omega-3 capsules. It was suggested by the authors that the specific protein
characteristics of cod or the high amount of taurine may have contributed to this effect.
2.2. Animal Studies
Documentation from preclinical trials has been increasing. Two studies investigated the effect
of fish protein compared to casein in the feed for male spontaneously hypertensive rats (SHR) over
a two months period. In one study, lipid peroxidation (measured as TBARS) in heart and liver were
significantly lower in the SHR receiving the fish protein diet compared to the SHR receiving the
casein diet [23], whereas no difference was observed in muscle and adipose tissue and higher lipid
peroxidation was observed in kidney. The antioxidant status in heart and liver increased with the fish
protein diet, whereas it remained unchanged in plasma during the feeding trial. This suggests that fish
protein plays an important role in the antioxidative defense system in heart and liver, but not in plasma.
In the second study 50%, of the SHR were induced with diabetes after one month, which resulted in
increased plasma antioxidative status in the fish protein fed SHR compared to the casein fed SHR [24].
In a recent study by Jensen et al. [25], apolipoprotein E-deficient (apoeE−/−) mice were used to
evaluate the effect of dietary cod and scallop on atherosclerotic burden and related parameters, among
them gene expressions of antioxidative proteins. Twenty-four 5-week-old female apoeE−/− mice
were fed Western type diets with chicken or cod and scallop as the protein sources for 13 weeks. It was
shown that the hepatic endogenous antioxidant paraoxonase 2 (Pon2 gene) was down regulated in
mice fed the cod-scallop diet, suggesting lower oxidative stress in this group.
3. Atherosclerosis, Dyslipidemia and Inflammation
Atherosclerosis (originating from Greek: athero meaning gruel and sclerosis meaning hardness)
is a complex, progressive and multifactorial inflammatory condition affecting the arteries. The arteries
consist of three distinct layers: the outer layer, tunica adventitia, consists of flexible fibrous connective
tissue, tunica media consists of smooth muscle cell tissue and elastic connective tissue, whereas the
inner layer, tunica intima, consists of a membrane of collagen and glycoproteins lined by endothelial
cells. The endothelial cells have a vast range of metabolic and regulatory functions, including transport
of metabolic substances, regulation of vascular tone, defense against inflammation, angiogenesis and
regulation of hemostasis and coagulation [26]. Disturbance of these regulatory processes, for instance
by oxidative stress, is often the trigger for the onset of atherosclerosis. Under normal conditions,
vasoactive substances are released from endothelial cells [27], but reduced bioavailability of these
compounds, in combination with accumulated low density lipoprotein (LDL) could lead to activation
of endothelial cells and subsequently a condition known as endothelial dysfunction [28]. Activation of
endothelial cells leads to an inflammatory response involving the production of a cascade of
chemokines, adhesion factors and integrins that are stimulated by transcription factors, such as nuclear
factor kappa b (NFκB) [29]. These substances recruit monocytes to the endothelial surface, followed
by adherence and transmigration into the intima. The influx of monocytes is often accompanied by
influx of other inflammation cells, such as T-cells, dendritic cells and mast cells. Once placed in the
133
Mar. Drugs 2016, 14, 211
intima, monocytes may differentiate into macrophages influenced by pro-inflammatory cytokines.
Macrophages are phagocytic cells expressing scavenger receptors for uptake of modified LDL.
The activated macrophages are programmed to protect our body against danger, and thus the normal
processes for cholesterol handling and transport are impaired and accumulation of cholesteryl esters
eventually leads to the formation of foam cells, and fatty streaks [30]. Continued inflammatory
responses may further accelerate the atherosclerotic process. Stimulation of proliferation and migration
of smooth muscle cells to the intima and release of intracellular contents (lipids, cholesterol)
from both macrophages and smooth muscle cells, may build up a large plaque inside the intima.
Protease secretion by macrophages degrade extracellular matrix, such as collagen, and a fibrous cap is
formed around the excess lipids. Expression of collagen degrading enzymes can gradually weaken the
fibrous cap leading to plaque rupture and release of intracellular content into the arteries, thrombus
formation, and this may eventually result in myocardial infarction [31,32].
3.1. Inflammation
Very few studies documenting the effect of marine proteins on inflammation or parameters
associated with inflammation are published (Table 1).
3.1.1. Human Studies
The effect of lean fish on inflammatory gene expression has been investigated in two published
studies, one study evaluated the effect of lean fish in patients with coronary heart disease [33] and
another study evaluated the effect in healthy subjects [34]. In the study with coronary heart disease
patients, 27 subjects were divided into three groups eating either lean fish or fatty fish four portions
a week for eight weeks. One group served as control and did not consume fish during the intervention
period. No effect on the inflammatory gene expression was observed in this study [33]. In the clinical
trial with healthy individuals, 71 subjects were divided into five groups eating 400 g cod per week for
eight weeks or the same amount of smoked salmon or fresh salmon. One group maintained their regular
diet, and another group maintained their regular diet only supplemented with 15 mL cod liver oil.
No changes in the measured inflammatory parameters were observed. Ouellet et al. [35] investigated
the effect of cod protein compared to other animal protein sources on C-reactive protein. For four
weeks, 19 insulin resistant, overweight subjects participated in a crossover study and were given a
diet with 60% of proteins as cod or other animal sources. After the four weeks, the subjects returned
to their normal diet for two weeks, before they switched to the opposite diet. C-reactive protein was
reduced by 24% in the cod group compared to an increase of 13% in the group eating other animal
protein sources.
3.1.2. Animal Studies
In a study published by Jensen et al. [25], apolipoprotein E-deficient (apoeE−/−) mice were
also used to evaluate the effect of dietary cod and scallop on atherosclerotic burden and related
inflammatory parameters. Twenty-two five-week-old female apoeE−/− mice were fed Western type
diets with chicken or cod and scallop as the protein sources for 13 weeks. After the study period the
mice given cod-scallop as the protein source had a 24% lower atherosclerotic plaque compared to the
mice eating the chicken feed. Additionally, the cod-scallop group had a 19% lower expression of the
inflammatory gene vascular cell adhesion molecule 1. Dort et al. [36] investigated the effect of cod
on the resolution of inflammation in 128 male Wistar rats. For three weeks, the rats had free access to
feed with cod protein or casein protein. Thereafter the leg was injured with bupivacaine. The results
showed that the inflammation due to the bupivacaine injection resoluted earlier in the cod group.
At 14 and 24 days post damage, the amount of neutrophile granulocytes was significantly lower in the
cod group compared to the casein group. In another study by the same group, it was confirmed that
the anti-inflammatory effect of cod was due to the amino acids arginine, glycine and taurine [37].
134
Mar. Drugs 2016, 14, 211
3.2. Dyslipidemia
Lipids such as cholesterol and triglycerides are highly hydrophobic and have to be transported by
lipoproteins in the blood stream. Both LDL and high density lipoproteins (HDL) are important parts
of the regulation of the cholesterol homeostasis in the body; LDL delivers cholesterol from the liver
to the various organs, whereas HDL is important for the reverse transport from the organs back to
the liver. An imbalance between these two lipoproteins in favor of LDL will lead to accumulation of
cholesterol in the vasculature and in tissues other than the liver [38] and a condition, named dyslipidemia
occurs [39]. This condition is one of the most prominent risk factors for the development of atherosclerosis.
Elevated plasma concentrations of triglycerides have in several prospective studies been shown to
make up a considerable risk factor for atherosclerosis [40,41]. Lowering of LDL cholesterol, by medicinal
treatment or by lifestyle/dietary changes, has been adapted as a means to reduce the risk of atherosclerosis.
Increasing the level of HDL cholesterol is considered as a way of reducing the risk of atherosclerosis. In
addition to its reverse cholesterol transport properties, HDL is also associated with vasodilation [42].
3.2.1. Human Studies
Several cross over studies have been conducted on healthy individuals comparing diets where
lean seafood is the major protein source to diets with non-seafood, such as beef, chicken, eggs, and milk,
as the major protein source (Table 1). A significant reduction in triglycerides was observed in some of
the studies [43,44], whereas no significant difference between the diets was the conclusion in other
studies [45,46]. In a study by Elvevoll et al. [47], 80 participants were given either a regular fish
pate or a fish pate enriched with taurine. After the intervention period, subjects eating the taurine
enriched fish pate experienced a reduction in cholesterol and LDL compared to the subjects eating
fish pate without enrichment, suggesting an extensive beneficial effect of taurine. In other studies,
the participants were selected based on being overweight, with a BMI over 27 (Table 1). In a double
blind, randomized, placebo controlled study, 40 subjects were given supplements with fish protein
or placebo over a period of eight weeks. No significant difference between the groups was observed
for neither cholesterol, HDL nor triglycerides. LDL, however, was significantly reduced compared to
baseline in the fish protein group [48]. Further the HDL/LDL ratio increased in the fish group during
the intervention period. The effect of cod as the protein source in energy restricted diets for weight
loss have been investigated in several studies [22,49,50]. In neither of the studies a significant effect
on cholesterol was observed, whereas, in some studies, triglyceride levels were reduced compared
to control diets [22,49]. In a crossover study by Ouellet et al. [35], cod was compared to other animal
proteins in a four weeks crossover study with participants being overweight and diabetic (Table 1).
In this study, the cholesterol and LDL was significantly reduced in the group eating the animal proteins
compared to the group eating the cod protein. In addition, Erkkila et al. [51] conducted a clinical trial
with patients with coronary heart disease (Table 1). For eight weeks the participants had either lean
white fish or meat as protein source. No significant difference in blood lipids was found after the eight
weeks. A similar study was repeated later with the same conclusion [52].
3.2.2. Animal Studies
The effects of marine proteins on blood lipids have been investigated in both mice and rat models.
Cod and scallop were compared to chicken and casein as protein sources to assess their effect on
blood lipids in a high fat diet and in a Western diet [25,53]. The level of triglycerides was reduced
after seven weeks on the high fat diet with cod and scallop, whereas no effects on total cholesterol or
HDL-cholesterol were observed. In the other study with the Western diet, the mice eating cod–scallop
had lower LDL-cholesterol compared to those eating chicken feed. Liaset et al. [54] divided 15 rats into
three groups and fed them saithe hydrolysate, soy or casein as protein source for almost four weeks.
The plasma concentration of triglycerides was reduced in the saithe hydrolysate fed rats compared to
soy and casein fed rats. In two studies, spontaneously hypertensive rats were given feed with 20%
fish protein compared to 20% casein. The group eating fish protein had significantly reduced total
cholesterol in both studies [24,55]. In the latter study, the triglyceride levels were reduced after the
135
Mar. Drugs 2016, 14, 211
intervention period as well. The combined effect of cod protein and oil on triglyceride metabolism has
been investigated in rats [56]. The rats were fed different protein sources and oils during four weeks.
Cod protein alone did not affect the level of triglycerides, whereas together with menhaden oil, the cod
protein reduced triglyceride levels by 50% compared to casein.
3.3. Coronary Heart Disease
Coronary heart disease is a collective term for heart attack and angina pectoris. An epidemiological
study evaluated the association between increased seafood consumption and reduced risk for coronary
heart disease.
Human Studies
Bernstein et al. [57] followed 84,136 30–55 year old women in the Nurses’ health study (Table 1).
The women in this study had no known cancer, diabetes mellitus, angina, myocardial infarction, stroke,
or other vascular diseases, for 26 years. In a model which statistically controlled for energy intake,
it was shown that one serving of fish per day was associated with a 30% reduction in risk for coronary
heart disease compared with one serving of red meat.
4. Hypertension
The blood pressure is a measure of the heart’s ability to pump blood and is presented as systolic
above diastolic pressure. Systolic designates the pressure of the pumping heart and diastolic designates
the pressure of the relaxed heart. A blood pressure of 120/80 mmHg is regarded normal and if one
or both numbers are elevated, the heart’s workload is increased and a condition called hypertension
arises. This condition is one of the most important precursors for CVD, and is associated with heart
failure, myocardial infarction and stroke [58], affecting almost one third of adults worldwide [59].
An increase of 20/10 mmHg above normal has been reported to double the risk of fatal CVD among
people between 40 and 49 years [60].
The regulation of blood pressure is a complex process involving several mechanisms. Some of
these, such as change of arteries diameter, regulation of blood volume in the blood stream and addition
or removal of fluids in the blood stream, are purely mechanic, whereas others are more complex
regulatory systems. One of these is the renin-angiotensin-aldosterone-system (RAAS). When blood
flow or volume through the kidney decreases, the enzyme renin is excreted from the glomerulus.
Renin cleaves angiotensinogen produced in the liver to form the decapeptide angiotensin I (Ang I).
Angiotensin Converting Enzyme (ACE) produced mainly in the lungs further cleaves Ang I to the
octapeptide Angiotensin II (Ang II) which constricts the arterial vessels and induces a rise of the blood
pressure. In addition, it stimulates the adrenal cortex to produce aldosterone, which increases the
reabsorption of sodium and water from the kidneys and further increases the blood pressure [61].
Another regulatory system is the kinin-kallicrein system (KKS). The ACE also participates in this
system where it inactivates the vasodilator bradykinin [62]. Hence, inhibition of ACE will in both
regulatory systems result in a prevention of blood pressure rising. In addition to being an independent
risk factor for CVDs, high blood pressure is also recognized as a risk of atherosclerosis [63,64].
The effect of marine protein on blood pressure has been evaluated in several animal models,
but limited data from epidemiological studies have suggested any association between fish intake and
blood pressure.
4.1. Human Studies
The effect on blood pressure of lean fish as the protein source, has been evaluated and documented
in two dietary intervention studies (Table 1). Erkkila et al. [51] randomized 33 medicated patients with
coronary heart disease into three groups eating lean fish, fatty fish or lean meat as protein sources
four times a week during eight weeks. After the intervention period, both systolic and diastolic blood
pressure was reduced in the group eating lean fish. Ramel et al. [50] investigated the dose-response
136
Mar. Drugs 2016, 14, 211
effect of number of cod meals per week. They randomized 126 healthy, overweight individuals into
three groups, all following an energy restricted diet with either no cod, cod three times, or five times
a week for eight weeks. The results from the blood pressure measurements were, however, inconsistent
and therefore not reliable. Double-blind placebo controlled studies are generally regarded as a gold
standard for evaluating the effect of different substances (Table 1). In one study, 34 overweight adults
received supplementation of fish protein capsules or placebo tablets for eight weeks [48]. The intake of
the supplement was 3 g per day the first four weeks and thereafter 6 g per day. No effect on blood
pressure was observed. In another similar study, the effect of a salmon peptide on blood pressure
was evaluated [65]. A number of 52 mild hypertensive individuals were divided into three groups
drinking a beverage (50 mL/day) with 1 g, 0.3 g or no salmon peptide for four weeks. The systolic
blood pressure was significantly reduced (140 to 135 mmHg) in the group receiving 1 g salmon peptide.
Kawasaki et al. [66] evaluated the effect of a peptide administered to 29 individuals with high-normal
blood pressure and mild essential hypertension. The subjects were randomized into two groups for
a cross over placebo-controlled trial. The dipeptide drink significantly reduced the blood pressure in
the dipeptide group, whereas no change was observed in the placebo group.
Results on blood pressure are not easily extrapolated between fish species, as taurine is known
for its blood pressure reducing effect [67]. Taurine content varies greatly between fish species [68],
however, compared to other foods, it is generally high in marine foods.
4.2. Animal Studies
While the documentation of blood pressure reducing effect in humans is scarce, several studies
performed on animal are published. The, by far, commonest model for hypertension evaluation is
using spontaneously hypertensive rats (SHR). These rats are bread to develop high blood pressure,
and are well suited for monitoring through both acute and chronic studies. The majority of the
studies published on the effect of marine protein on blood pressure, are acute studies. The SHR
are given marine hydrolysates or peptides orally and the blood pressure has been measured before
administration, just after administration up to several hours after administration. The first studies
documenting the antihypertensive effect of bonito in SHR were published already in the 1990s [69–71].
Later, single oral doses of 10 mg/kg body weight of tuna hydrolysate [72,73] and yellow fin sole
hydrolysate [74] have been shown to significantly reduce blood pressure. A blood pressure reducing
effect has been documented in hydrolysates from shrimp [75], oyster [76], loach [77], sea cucumber [78],
sardine [66], jellyfish [79], salmon [65,80], cobia [81] and skate [82]. In these studies, the test doses vary,
making any comparison difficult. Nevertheless, the results may give an indication that marine protein
in general is potential as a blood pressure reducing nutraceutical, food ingredient or food.
Some studies have also evaluated the chronic effect of marine hydrolysates on blood pressure.
In such studies, the SHR are given the test items daily. Negative control is normally water or saline,
while the positive control commonly is captopril. Jellyfish hydrolysate [79], sardine peptide [83] and sea
bream hydrolysate [84] have all been tested in chronic studies. SHR have been administered daily over
a period of four weeks with the hydrolysates in different dosages, resulting in significantly lowered
blood pressure, even comparable to that of captopril. Hydrolysates of cod, haddock and salmon did not
significantly reduce blood pressure in SHR during a four-week study [85], although the blood pressure
in the group treated with cod hydrolysate did not increase after day 7. Fish has also been evaluated as
part of the feed itself. Spontaneously hypertensive rats fed a standard chow supplemented with tuna
hydrolysate, Katsuo-bushi, for seven weeks, experienced reduced blood pressure [71]. In three studies
lasting for two months, SHR were fed standard animal chow where 20% of the feed was either fish
protein or casein protein [24,55,86]. The blood pressure in the SHR eating fish protein was significantly
reduced compared to that in those eating the casein protein. However, when this was investigated in
rats with diabetes, no effect on blood pressure was observed [24].
137
Parameter
Study
Subjects, Inclusion Criteria
Protein Source
Result
Year
References
Oxidative stress
8 weeks, randomized
parallel intervention
276 (4 groups), overweight, healthy
Cod, salmon, fish oil, control
Oxidation product reduced, AOC
increased in cod group
2007
[22]
Blood pressure
8 weeks, double blind, randomized,
controlled intervention
34 (2 groups), overweight
Fish protein capsules, placebo
No significant effect
2013
[48]
126 (3 groups), overweight
150 g cod 1/week, 150 g cod
3/week, no cod
No results
2009
[50]
8 weeks controlled, parallel
dietary intervention
Inflammation
Blood lipids
138
Coronary heart disease
8 weeks controlled,
parallel intervention
31 (3 groups), myocardial infarction
Lean fish, fatty fish, no fish
Blood pressure reduced in lean
fish group
2008
[51]
4 weeks double blind,
placebo-controlled
52 (3 groups), mild hypertension
Salmon peptide, placebo
Systolic blood pressure reduced in
peptide group
2008
[65]
4 weeks randomized, double blind,
placebo-controlled
29 (2 groups), high-normal blood
pressure and mild essential
hypertension
Sardine peptide
Blood pressure reduced in peptide group
2000
[66]
8 weeks, randomized, parallel
dietary intervention
27 (3 groups) coronary heart disease
Lean fish, fatty fish, no fish
No significant effect
2009
[33]
2 × 4 weeks crossover design
19 overweight/obesity
insulin-resistance
Cod, other animal protein sources
24% reduction in plasma CRP
2008
[35]
2 × 4 weeks, randomize,
crossover design
20 healthy
Lean seafood, non-seafood
Reduced TG in lean seafood-group
2015
[43]
4 weeks prospective, randomized
crossover design
10 healthy
Lean seafood, beef diet
Reduced TG, cholesterol and VLDL
2009
[44]
2 × 4 weeks, randomized
crossover design
11 healthy men
Lean fish, non-fish
No significant effect
2000
[46]
2 × 4 weeks crossover design
14 healthy premenopausal women
Fish, non-fish
No significant effect
1996
[45]
7 weeks dietary intervention
80 (2 groups) healthy
Fish pate, fish pate with taurine
Reduced cholesterol and LDL
with taurine
2008
[47]
8 weeks, double blind, randomized,
controlled intervention
34 (2 groups) overweight
Fish protein capsules, placebo
Reduced LDL in fish group compared
to baseline
2013
[48]
8 weeks, randomized parallel
dietary intervention
276 (4 groups) overweight, healthy
Cod, salmon, fish oil, control
Reduced TG in cod-group
2007
[22]
8 weeks, randomized, parallel
dietary intervention
2008
[49]
324 (4 groups), overweight
Lean fish, oily fish, control, fish oil
Reduced TG
8 weeks controlled, parallel
dietary intervention
126 (3 groups) overweight
150 g cod 1/week, 150 g cod
3/week, no cod
No results
2 × 4 weeks crossover design
19 overweight/obese
insulin-resistant subjects
Cod, other animal protein sources
Reduced cholesterol and LDL
2008
[35]
8 weeks controlled, parallel
dietary intervention
31 (3 groups) subjects with
myocardial infarction
Lean fish, fatty fish, no fish
No significant effect
2008, 2014
[51,52]
Epidemiological study, 26 years
Healthy women aged 30–55
Fish
Reduced risk for coronary heart disease
[50]
AOC, antioxidative capacity; CRP, C-reactive protein; TG, triglycerides; VLDL, very low density lipoprotein; LDL, low density lipoprotein.
[57]
Mar. Drugs 2016, 14, 211
Table 1. Clinical trials investigating cardio protective of marine proteins and peptides.
Mar. Drugs 2016, 14, 211
5. Conclusions
Focus on health benefits from marine resources has traditionally been on the long chain omega-3
fatty acids. However, emerging evidence points out that other nutrients, such as peptides and
proteins also play a major role. The current review sums up preclinical and clinical trials on the
cardioprotective effects of marine protein and peptides. Clinical studies on humans are the superior
method for evaluation of health effects, but also the most expensive, time consuming and complex
way. The number of studies is thus quite low, but there are indications that marine proteins may
have a positive effect on oxidative stress. Studies on inflammation parameters, blood lipid and
hypertension are inconclusive. Further, as inclusion criteria for participants in each study vary greatly,
depending on weight, gender, age and health status, conclusions from the different studies are difficult
to draw and the clinical relevance is therefore limited. The number of animal studies published
is larger and, particularly, the effects of marine proteins on hypertension are well documented.
However, documentation of the effect on atherosclerosis and inflammation is scarce and further
research on this field is also acquired. It is therefore of utmost importance to include more research
from both animal, and most importantly, human studies on cardiovascular health effects of marine
proteins and peptides.
Acknowledgments: This work was supported by the Publication Fund of UIT The Arctic University of Norway.
Author Contributions: The authors contributed equally in the writing of this manuscript.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
Mendis, S.; Puska, P.; Norrving, B. Global Atlas on Cardiovascular Disease Prevention and Control;
WHO: Gevena, Switzerland, 2011.
Cardiovascular Diseases. Available online: http://www.who.int/mediacentre/factsheets/fs317/en/
(accessed on 28 September 2016).
Yusuf, H.R.; Giles, W.H.; Croft, J.B.; Anda, R.F.; Casper, M.L. Impact of multiple risk factor profiles on
determining cardiovascular disease risk. Prev. Med. 1998, 27, 1–9. [CrossRef] [PubMed]
Kris-Etherton, P.M.; Harris, W.S.; Appel, L.J.; American Heart Association Nutrition Committee.
Fish consumption, fish oil, omega-3 fatty acids, and cardiovascular disease. Circulation 2002, 106, 2747–2757.
[CrossRef] [PubMed]
De Leiris, J.; de Lorgeril, M.; Boucher, F. Fish oil and heart health. J. Cardiovasc. Pharmacol. 2009, 54, 378–384.
[CrossRef] [PubMed]
He, K.; Song, Y.; Daviglus, M.L.; Liu, K.; Horn, L.V.; Dyer, A.R.; Greenland, P. Accumulated evidence on fish
consumption and coronary heart disease mortality: A meta-analysis of cohort studies. Circulation 2004, 109,
2705–2711. [CrossRef] [PubMed]
Marik, P.E.; Varon, J. Omega-3 dietary supplements and the risk of cardiovascular events: A systematic
review. Clin. Cardiol. 2009, 32, 365–372. [CrossRef] [PubMed]
Mozaffarian, D.; Rimm, E.B. Fish intake, contaminants, and human health: Evaluating the risks and the
benefits. JAMA 2006, 296, 1885–1899. [CrossRef] [PubMed]
Saremi, A.; Arora, R. The utility of omega-3 fatty acids in cardiovascular disease. Am. J. Ther. 2009, 16,
421–436. [CrossRef] [PubMed]
Zheng, J.; Huang, T.; Yu, Y.; Hu, X.; Yang, B.; Li, D. Fish consumption and CHD mortality: An updated
meta-analysis of seventeen cohort studies. Public Health Nutr. 2012, 15, 725–737. [CrossRef] [PubMed]
Lakshmi, S.V.V.; Padmaja, G.; Kuppusamy, P.; Kutala, V.K. Oxidative stress in cardiovascular disease. Indian J.
Biochem. Biophys. 2009, 46, 421–440. [PubMed]
Bonomini, F.; Tengattini, S.; Fabiano, A.; Bianchi, R.; Rezzani, R. Atherosclerosis and oxidative stress.
Histol. Histopatol. 2008, 23, 381–390.
Elias, R.J.; Kellerby, S.S.; Decker, E.A. Antioxidant activity of proteins and peptides. Crit. Rev. Food Sci. Nutr.
2008, 48, 430–441. [CrossRef] [PubMed]
Fang, Y.Z.; Yang, S.; Wu, G.Y. Free radicals, antioxidants, and nutrition. Nutrition 2002, 18, 872–879. [CrossRef]
139
Mar. Drugs 2016, 14, 211
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
Guiotto, A.; Calderan, A.; Ruzza, P.; Borin, G. Carnosine and carnosine-related antioxidants: A review.
Curr. Med. Chem. 2005, 12, 2293–2315. [CrossRef] [PubMed]
Seth, A.; Mahoney, R.R. Iron chelation by digests of insoluble chicken muscle protein: The role of histidine
residues. J. Sci. Food Agric. 2001, 81, 183–187. [CrossRef]
Garner, B.; Witting, P.K.; Waldeck, A.R.; Christison, J.K.; Raftery, M.; Stocker, P. Oxidation of high density
lipoproteins 1. Formation of methionine sulfoxide in apolipoproteins AI and AII is an early event that
accompanies lipid peroxidation and can be enhanced by alpha-tocopherol. J. Biol. Chem. 1998, 273, 6080–6087.
[CrossRef] [PubMed]
Pryor, W.A.; Jin, X.; Squadrito, G.L. One-electron and 2-electron oxidations of methionine by peroxynitrite.
Proc. Natl. Acad. Sci. USA 1994, 91, 11173–11177. [CrossRef] [PubMed]
Qureshi, S.A.; Lund, A.C.; Veierød, M.B.; Carlsen, M.H.; Blomhoff, R.; Andersen, L.F.; Ursin, G. Food items
contributing most to variation in antioxidant intake; A cross-sectional study among Norwegian women.
BMC Public Health 2014. [CrossRef] [PubMed]
Bjelakovic, G.; Nikolova, D.; Gluud, L.L.; Simonett, R.G.; Gludd, C. Antioxidant supplements for prevention
of mortality in healthy participants and patients with various diseases. Cochrane Database Syst. Rev. 2012.
[CrossRef]
Bjelakovic, G.; Nikolova, D.; Gluud, C. Meta-regression analyses, meta-analyses, and trial sequential analyses
of the effects of supplementation with beta-carotene, vitamin A, and vitamin E singly or in different
combinations on all-cause mortality: Do we have evidence for lack of harm? PLoS ONE 2013, 8, e74558.
[CrossRef] [PubMed]
Parra, D.; Bandarra, N.M.; Kiely, M.; Thorsdottir, I.; Martinez, J.A. Impact of fish intake on oxidative stress
when included into a moderate energy-restricted program to treat obesity. Eur. J. Nutr. 2007, 46, 460–467.
[CrossRef] [PubMed]
Yahia, D.A.; Madani, S.; Prost, E.; Prost, J.; Bouchenak, M.; Belleville, J. Tissue antioxidant status differs in
spontaneously hypertensive rats fed fish protein or casein. J. Nutr. 2003, 133, 479–482. [PubMed]
Boukortt, F.O.; Girard, A.; Prost, J.L.; Ait-Yahia, D.; Bouchenak, M.; Belleville, J. Fish protein improves the total
antioxidant status of streptozotocin-induced diabetes in spontaneously hypertensive rat. Med. Sci. Monit.
2004, 10, 397–404.
Jensen, I.J.; Walquist, M.; Liaset, B.; Elvevoll, E.O.; Eilertsen, K.E. Dietary intake of cod and scallop reduces
atherosclerotic burden in female apolipoprotein E-deficient mice fed a Western-type high fat diet for 13 weeks.
Nutr. Metab. 2016, 13. [CrossRef] [PubMed]
Galley, H.F.; Webster, N.R. Physiology of the endothelium. Br. J. Anaesth. 2004, 93, 105–113. [CrossRef]
[PubMed]
Deanfield, J.E.; Halcox, J.P.; Rabelink, T.J. Endothelial function and dysfunction: testing and clinical relevance.
Circulation 2007, 115, 1285–1295. [PubMed]
Bonetti, P.O.; Lerman, L.O.; Lerman, A. Endothelial dysfunction: A marker of atherosclerotic risk.
Arterioscler. Thromb. Vasc. Biol. 2003, 23, 168–175. [CrossRef] [PubMed]
Sprague, A.H.; Khalil, R.A. Inflammatory cytokines in vascular dysfunction and vascular disease.
Biochem. Pharmacol. 2009, 78, 539–552. [CrossRef] [PubMed]
McLaren, J.E.; Michael, D.R.; Ashlin, T.G.; Ramji, D.P. Cytokines, macrophage lipid metabolism and foam
cells: implications for cardiovascular disease therapy. J. Am. Heart Assoc. 2011, 50, 331–347. [CrossRef]
[PubMed]
Szmitko, P.E.; Wang, C.H.; Weisel, R.D.; de Almeida, J.R.; Anderson, T.J.; Verma, S. New markers of
inflammation and endothelial cell activation: Part I. Circulation 2003, 108, 1917–1923. [CrossRef] [PubMed]
Szmitko, P.E.; Wang, C.H.; Weisel, R.D.; Jeffries, G.A.; Anderson, T.J.; Verma, S. Biomarkers of vascular
disease linking inflammation to endothelial activation: Part II. Circulation 2003, 108, 2041–2048. [CrossRef]
[PubMed]
De Mello, V.D.; Erkkila, A.T.; Schwab, U.S.; Pulkkinen, L.; Kolehmainen, M.; Atalay, M.; Mussalo, H.;
Lankinen, M.; Oresic, M.; Lehto, S.; et al. The effect of fatty or lean fish intake on inflammatory gene
expression in peripheral blood mononuclear cells of patients with coronary heart disease. Eur. J. Nutr. 2009,
48, 447–455. [CrossRef] [PubMed]
140
Mar. Drugs 2016, 14, 211
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
Elvevoll, E.O.; Barstad, H.; Breimo, E.S.; Brox, J.; Eilertsen, K.E.; Lund, T.; Olsen, J.O.; Osterud, B.
Enhanced incorporation of n-3 fatty acids from fish compared with fish oils. Lipids 2006, 41, 1109–1114.
[CrossRef] [PubMed]
Ouellet, V.; Weisnagel, S.J.; Marois, J.; Bergeron, J.; Julien, P.; Gougeon, R.; Tchernof, A.; Holub, B.J.; Jacques, H.
Dietary cod protein reduces plasma C-reactive protein in insulin-resistant men and women. J. Nutr. 2008,
138, 2386–2391. [CrossRef] [PubMed]
Dort, J.; Sirois, A.; Leblanc, N.; Cote, C.H.; Jacques, H. Beneficial effects of cod protein on skeletal muscle
repair following injury. Appl. Physiol. Nutr. Metab. 2012, 37, 489–498. [CrossRef] [PubMed]
Dort, J.; Leblanc, N.; Maltais-Giguere, J.; Liaset, B.; Cote, C.H.; Jacques, H. Beneficial effects of cod protein on
inflammatory cell accumulation in rat skeletal muscle after injury are driven by its high levels of arginine,
glycine, taurine and lysine. PLoS ONE 2013, 8, e77274. [CrossRef] [PubMed]
Babiak, J.; Rudel, L.L. Lipoproteins and atherosclerosis. Baillieres Clin. Endocrinol. Metab. 1987, 1, 515–550.
[CrossRef]
Angelico, F.; Baratta, F.; Ben, M.D. Current ways of treating dyslipidemias to prevent atherosclerosis.
Ther. Apher. Dial. 2013, 17, 125–129. [CrossRef] [PubMed]
Hokanson, J.E.; Austin, M.A. Plasma triglyceride level is a risk factor for cardiovascular disease independent
of high-density lipoprotein cholesterol level: A meta-analysis of population-based prospective studies.
J. Cardiovasc. Risk 1996, 3, 213–219. [CrossRef] [PubMed]
Nordestgaard, B.G.; Benn, M.; Schnohr, P.; Tybjaerg-Hansen, A. Nonfasting triglycerides and risk of
myocardial infarction, ischemic heart disease, and death in men and women. JAMA 2007, 298, 299–308.
[CrossRef] [PubMed]
Mineo, C.; Yuhanna, I.S.; Quon, M.J.; Shaul, P.W. High density lipoprotein-induced endothelial nitric-oxide
synthase activation is mediated by Akt and MAP kinases. J. Biol. Chem. 2003, 278, 9142–9149. [CrossRef]
[PubMed]
Aadland, E.K.; Lavigne, C.; Graff, I.E.; Eng, O.; Paquette, M.; Holthe, A.; Mellgren, G.; Jacques, H.; Liaset, B.
Lean-seafood intake reduces cardiovascular lipid risk factors in healthy subjects: Results from a randomized
controlled trial with a crossover design. Am. J. Clin. Nutr. 2015, 102, 582–592. [CrossRef] [PubMed]
Leaf, D.A.; Hatcher, L. The effect of lean fish consumption on triglyceride levels. Phys. Sportsmed. 2009, 37,
37–43. [CrossRef] [PubMed]
Gascon, A.; Jacques, H.; Moorjani, S.; Deshaies, Y.; Brun, L.D.; Julien, P. Plasma lipoprotein profile and
lipolytic activities in response to the substitution of lean white fish for other animal protein sources in
premenopausal women. Am. J. Clin. Nutr. 1996, 63, 315–321. [PubMed]
Lacaille, B.; Julien, P.; Deshaies, Y.; Lavigne, C.; Brun, L.D.; Jacques, H. Responses of plasma lipoproteins and
sex hormones to the consumption of lean fish incorporated in a prudent-type diet in normolipidemic men.
J. Am. Coll. Nutr. 2000, 19, 745–753. [CrossRef] [PubMed]
Elvevoll, E.O.; Eilertsen, K.E.; Brox, J.; Dragnes, B.T.; Falkenberg, P.; Olsen, J.O.; Kirkhus, B.; Lamglait, A.;
Osterud, B. Seafood diets: Hypolipidemic and antiatherogenic effects of taurine and n-3 fatty acids.
Atherosclerosis 2008, 200, 396–402. [CrossRef] [PubMed]
Vikoren, L.A.; Nygard, O.K.; Lied, E.; Rostrup, E.; Gudbrandsen, O.A. A randomised study on the effects of
fish protein supplement on glucose tolerance, lipids and body composition in overweight adults. Br. J. Nutr.
2013, 109, 648–657. [CrossRef] [PubMed]
Gunnarsdottir, I.; Tomasson, H.; Kiely, M.; Martinez, J.A.; Bandarra, N.M.; Morais, M.G.; Thorsdottir, I.
Inclusion of fish or fish oil in weight-loss diets for young adults: Effects on blood lipids. Int. J. Obes. 2008, 32,
1105–1112. [CrossRef] [PubMed]
Ramel, A.; Jonsdottir, M.T.; Thorsdottir, I. Consumption of cod and weight loss in young overweight and
obese adults on an energy reduced diet for 8-weeks. Nutr. Metab. Cardiovasc. Dis. 2009, 19, 690–696.
[CrossRef] [PubMed]
Erkkila, A.T.; Schwab, U.S.; de Mello, V.D.F.; Lappalainen, T.; Mussalo, H.; Lehto, S.; Kemi, V.;
Lamberg-Allardt, C.; Uusitupa, M.I.J. Effects of fatty and lean fish intake on blood pressure in subjects with
coronary heart disease using multiple medications. Eur. J. Nutr. 2008, 47, 319–328. [CrossRef] [PubMed]
Erkkila, A.T.; Schwab, U.S.; Lehto, S.; de Mello, V.D.; Kangas, A.J.; Soininen, P.; Ala-Korpela, M.;
Uusitupa, M.I. Effect of fatty and lean fish intake on lipoprotein subclasses in subjects with coronary
heart disease: A controlled trial. J. Clin. Lipidol. 2014, 8, 126–133. [CrossRef] [PubMed]
141
Mar. Drugs 2016, 14, 211
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
Tastesen, H.S.; Ronnevik, A.K.; Borkowski, K.; Madsen, L.; Kristiansen, K.; Liaset, B. A mixture of cod and
scallop protein reduces adiposity and improves glucose tolerance in high-fat fed male C57BL/6 J mice.
PLoS ONE 2014, 9, e112859. [CrossRef] [PubMed]
Liaset, B.; Madsen, L.; Hao, Q.; Criales, G.; Mellgren, G.; Marschall, H.U.; Hallenborg, P.; Espe, M.;
Froyland, L.; Kristiansen, K. Fish protein hydrolysate elevates plasma bile acids and reduces visceral
adipose tissue mass in rats. Biochim. Biophys. Acta 2009, 1791, 254–262. [CrossRef] [PubMed]
Yahia, D.A.; Madani, S.; Prost, J.; Bouchenak, M.; Belleville, J. Fish protein improves blood pressure but alters
HDL2 and HDL3 composition and tissue lipoprotein lipase activities in spontaneously hypertensive rats.
Eur. J. Nutr. 2005, 44, 10–17. [CrossRef] [PubMed]
Demonty, I.; Deshaies, Y.; Lamarche, B.; Jacques, H. Cod protein lowers the hepatic triglyceride secretion
rate in rats. J. Nutr. 2003, 133, 1398–1402. [PubMed]
Bernstein, A.M.; Sun, Q.; Hu, F.B.; Stampfer, M.J.; Manson, J.E.; Willett, W.C. Major Dietary Protein Sources
and Risk of Coronary Heart Disease in Women. Circulation 2010, 122, 876–883. [CrossRef] [PubMed]
Harris, T.; Cook, E.F.; Kannel, W.; Schatzkin, A.; Goldman, L. Blood pressure experience and risk of
cardiovascular disease in the elderly. Hypertension 1985, 7, 118–124. [CrossRef] [PubMed]
Saleh, A.S.; Zhang, Q.; Shen, Q. Recent Research in Antihypertensive Activity of Food Protein-derived
Hydrolyzates and Peptides. Crit. Rev. Food Sci. Nutr. 2016, 56, 760–787. [CrossRef] [PubMed]
Lewington, S.; Clarke, R.; Qizilbash, N.; Peto, R.; Collins, R. Age-specific relevance of usual blood pressure
to vascular mortality: A meta-analysis of individual data for one million adults in 61 prospective studies.
Lancet 2002, 360, 1903–1913. [CrossRef]
Goodfriend, T.L.; Elliott, M.E.; Catt, K.J. Angiotensin receptors and their antagonists. N. Engl. J. Med. 1996,
334, 1649–1654. [PubMed]
Witherow, F.N.; Helmy, A.; Webb, D.J.; Fox, K.A.; Newby, D.E. Bradykinin contributes to the vasodilator
effects of chronic angiotensin-converting enzyme inhibition in patients with heart failure. Circulation 2001,
104, 2177–2181. [CrossRef] [PubMed]
Graninger, M.; Reiter, R.; Drucker, C.; Minar, E.; Jilma, B. Angiotensin receptor blockade decreases markers
of vascular inflammation. J. Cardiovasc. Pharmacol. 2004, 44, 335–339. [CrossRef] [PubMed]
McGraw, A.P.; Bagley, J.; Chen, W.S.; Galayda, C.; Nickerson, H.; Armani, A.; Caprio, M.; Carmeliet, P.;
Jaffe, I.Z. Aldosterone increases early atherosclerosis and promotes plaque inflammation through a placental
growth factor-dependent mechanism. J. Am. Heart Assoc. 2013. [CrossRef] [PubMed]
Enari, H.; Takahashi, Y.; Kawarasaki, M.; Tada, M.; Tatsuta, K. Identification of angiotensin I-converting
enzyme inhibitory peptides derived from salmon muscle and their antihypertensive effect. Fish. Sci. 2008,
74, 911–920. [CrossRef]
Kawasaki, T.; Seki, E.; Osajima, K.; Yoshida, M.; Asada, K.; Matsui, T.; Osajima, Y. Antihypertensive effect
of valyl-tyrosine, a short chain peptide derived from sardine muscle hydrolyzate, on mild hypertensive
subjects. J. Hum. Hypertens. 2000, 14, 519–523. [CrossRef] [PubMed]
Sun, Q.; Wang, B.; Li, Y.; Sun, F.; Li, P.; Xia, W.; Zhou, X.; Li, Q.; Wang, X.; Chen, J.; et al. Taurine
Supplementation Lowers Blood Pressure and Improves Vascular Function in Prehypertension: Randomized,
Double-Blind, Placebo-Controlled Study. Hypertension 2016, 67, 541–549. [CrossRef] [PubMed]
Dragnes, B.T.; Larsen, R.; Ernstsen, M.H.; Mæhre, H.K.; Elvevoll, E.O. Impact of processing on the taurine
content in processed seafood and their corresponding unprocessed raw materials. Int. J. Food Sci. Nutr. 2008,
12, 1–10. [CrossRef] [PubMed]
Fujii, M.; Matsumura, N.; Mito, K.; Shimizu, T.; Kuwahara, M.; Sugano, S.; Karaki, H. Antihypertensive effects
of peptides in autolysate of bonito bowels on spontaneously hypertensive rats. Biosci. Biotechnol. Biochem.
1993, 57, 2186–2188. [CrossRef] [PubMed]
Karaki, H.; Kuwahara, M.; Sugano, S.; Doi, C.; Doi, K.; Matsumura, N.; Shimizu, T. Oral administration
of peptides derived from bonito bowels decreases blood pressure in spontaneously hypertensive rats by
inhibiting angiotensin converting enzyme. Comp. Biochem. Physiol. C 1993, 104, 351–353. [PubMed]
Fujita, H.; Yokoyama, K.; Yasumoto, R.; Yoshikawa, M. Antihypertensive effect of thermolysin digest of dried
bonito in spontaneously hypertensive rat. Clin. Exp. Pharmacol. Physiol. Suppl. 1995, 22, 304–305. [CrossRef]
Lee, S.H.; Qian, Z.J.; Kim, S.W. A novel angiotensin I converting enzyme inhibitory peptide from tuna frame
protein hydrolysate and its antihypertensive effect in spontaneously hypertensive rats. Food Chem. 2010, 118,
96–102. [CrossRef]
142
Mar. Drugs 2016, 14, 211
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
Qian, Z.J.; Je, J.Y.; Kim, S.K. Antihypertensive effect of angiotensin I converting enzyme-inhibitory peptide
from hydrolysates of Bigeye tuna dark muscle, Thunnus obesus. J. Agric. Food Chem. 2007, 55, 8398–8403.
[CrossRef] [PubMed]
Jung, W.K.; Mendis, E.; Je, J.Y.; Park, P.J.; Son, B.W.; Kim, H.C.; Choi, J.K.; Kim, S.K. Angiotensin I-converting
enzyme inhibitory peptide from yellowfin sole (Limanda aspera) frame protein and its antihypertensive
effect in spontaneously hypertensive rats. Food Chem. 2006, 94, 26–32. [CrossRef]
Cao, W.; Zhang, C.; Hong, P.; Ji, H.; Hao, J. Purification and identification of an ACE inhibitory peptide from
the peptic hydrolysate of Acetes chinensis and its antihypertensive effects in spontaneously hypertensive
rats. Int. J. Food Sci. Technol. 2010, 45, 959–965. [CrossRef]
Xie, C.L.; Kim, J.S.; Ha, J.M.; Choung, S.Y.; Choi, Y.J. Angiotensin I-converting enzyme inhibitor derived
from cross-linked oyster protein. Biomed. Res. Int. 2014. [CrossRef] [PubMed]
Li, Y.; Zhou, J.; Huang, K.; Sun, Y.; Zeng, X. Purification of a novel angiotensin I-converting enzyme (ACE)
inhibitory peptide with an antihypertensive effect from loach (Misgurnus anguillicaudatus). J. Agric. Food Chem.
2012, 60, 1320–1325. [CrossRef] [PubMed]
Zhao, Y.; Li, B.; Dong, S.; Liu, Z.; Zhao, X.; Wang, J.; Zeng, M. A novel ACE inhibitory peptide isolated from
Acaudina molpadioidea hydrolysate. Peptides 2009, 30, 1028–1033. [CrossRef] [PubMed]
Liu, X.; Zhang, M.; Zhang, C.; Liu, C. Angiotensin converting enzyme (ACE) inhibitory, antihypertensive
and antihyperlipidaemic activities of protein hydrolysates from Rholipema esculentum. Food Chem. 2012, 134,
2134–2140. [CrossRef] [PubMed]
Ono, S.; Hosokawa, M.; Miyashita, K.; Takahashi, K. Isolation of Peptides with Angiotensin I-converting
Enzyme Inhibitory Effect Derived from Hydrolysate of Upstream Chum Salmon Muscle. J. Food Sci. 2003, 68,
1611–1614. [CrossRef]
Yang, P.; Jiang, Y.; Hong, P.; Cao, W. Angiotensin I converting enzyme inhibitory activity and antihypertensive
effect in spontaneously hypertensive rats of cobia (Rachycentron canadum) head papain hydrolysate. Food Sci.
Technol. Int. 2013, 19, 209–215. [CrossRef] [PubMed]
Ngo, D.H.; Kang, K.H.; Ryu, B.; Vo, T.S.; Jung, W.K.; Byun, H.G.; Kim, S.K. Angiotensin-I converting enzyme
inhibitory peptides from antihypertensive skate (Okamejei kenojei) skin gelatin hydrolysate in spontaneously
hypertensive rats. Food Chem. 2015, 174, 37–43. [CrossRef] [PubMed]
Otani, L.; Ninomiya, T.; Murakami, M.; Osajima, K.; Kato, H.; Murakami, T. Sardine peptide with angiotensin
I-converting enzyme inhibitory activity improves glucose tolerance in stroke-prone spontaneously
hypertensive rats. Biosci. Biotechnol. Biochem. 2009, 73, 2203–2209. [CrossRef] [PubMed]
Fahmi, A.; Morimura, S.; Guo, H.C.; Shigematsu, T.; Kida, K.; Uemura, Y. Production of angiotensin I
converting enzyme inhibitory peptides from sea bream scales. Process. Biochem. 2004, 39, 1195–1200.
[CrossRef]
Jensen, I.J.; Eysturskareth, J.; Madetoja, M.; Eilertsen, K.E. The potential of cod hydrolyzate to inhibit blood
pressure in spontaneously hypertensive rats. Nutr. Res. 2014, 34, 168–173. [CrossRef] [PubMed]
Ait-Yahia, D.; Madani, S.; Savelli, J.L.; Prost, J.; Bouchenak, M.; Belleville, J. Dietary fish protein lowers
blood pressure and alters tissue polyunsaturated fatty acid composition in spontaneously hypertensive rats.
Nutrition 2003, 19, 342–346. [CrossRef]
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
143
marine drugs
Review
Alkynyl-Containing Peptides of Marine Origin:
A Review
Qiu-Ye Chai 1,2,† , Zhen Yang 3,† , Hou-Wen Lin 1, * and Bing-Nan Han 1, *
1
2
3
*
†
Research Center for Marine Drugs, Department of Pharmacy, State Key Laboratory of Oncogenes and
Related Genes, Renji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200127, China;
chaiqiuye123@sina.cn
School of Pharmacy, Jiangxi University of Traditional Chinese Medicine, Nanchang 330000, China
Department of Pharmacy, Graduate School, Hunan University of Chinese Medicine,
Changsha 410208, China; zyyangzhen1991@163.com
Correspondence: franklin67@126.com (H.-W.L.); hanbingnan@shsmu.edu.cn (B.-N.H.);
Tel.: +86-21-6838-3346 (B.-N.H.); Fax: +86-21-5873-2594 (B.-N.H.)
These authors contributed equally to this work.
Academic Editor: Se-Kwon Kim
Received: 19 September 2016; Accepted: 16 November 2016; Published: 23 November 2016
Abstract: Since the 1990s, a number of terminal alkynyl residue-containing cyclic/acyclic peptides
have been identified from marine organisms, especially cyanobacteria and marine mollusks.
This review has presented 66 peptides, which covers over 90% marine peptides with terminal
alkynyl fatty acyl units. In fact, more than 90% of these peptides described in the literature are of
cyanobacterial origin. Interestingly, all the linear peptides featured with terminal alkyne were solely
discovered from marine cyanobacteria. The objective of this article is to provide an overview on the
types, structural characterization of these unusual terminal alkynyl fatty acyl units, as well as the
sources and biological functions of their composed peptides. Many of these peptides have a variety
of biological activities, including antitumor, antibacterial, antimalarial, etc. Further, we have also
discussed the evident biosynthetic origin responsible for formation of terminal alkynes of natural
PKS (polyketide synthase)/NRPS (nonribosome peptide synthetase) hybrids.
Keywords: marine cyanobacteria; mollusk; alkynyl peptides; biological activity; absolute configuration
1. Introduction
As oceans comprise over 70% of the earth’s surface and harbor a tremendous variety of flora and
fauna, marine habitat represents a rich source of diverse chemical structures and biological activities
of natural products [1], which include alkaloids, terpenoids, peptides, polyketides, steroids, etc.
Peptides as an important bioactive natural product, present in many marine species, including sponges,
ascidians, seaweeds, mollusks, and marine microorganisms, have been extensively studied [2,3].
Interestingly, diverse structural classes of peptides such as linear peptides, linear depsipeptides, linear
lipopeptides, cyclic peptides, cyclic depsipeptides, and cyclic lipopeptides have been discovered from
all of these marine species. The broad bioactivity spectrum of marine peptides has high medicinal
potential which attracts the attention of the pharmaceutical industry. Since the discovery of the first
marine-derived antitumorcyclic peptide, ulithiacyclamide, many marine anticancerpeptides have
entered into clinical trials with good prospects for drug development [4–6], such as kahalalide F,
hemiasterlin, dolastatins, cemadotin, soblidotin, didemnins, aplidine, etc. [7]. Cyclic peptides as
a valuable lead for drug discovery with better resistance to enzymatic degradation and higher
bioavailability in vivo have attracted considerable attention for further study in the areas of
marine natural products [4,8]. Acyclic peptides with the prospect of pharmacological activity
Mar. Drugs 2016, 14, 216
144
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2016, 14, 216
are also promising, such as the well-known anticancer lead dolastatin 10 isolated from both sea
hare Dollabella auricularia [9] and its diet of marine cyanobacterium, the Symploca species [10],
whose synthetic derivatives have been used in clinical phase III trials [7]. In recent years, a number of
structurally intriguing peptides containing diverse fatty acyl units with a terminal alkyne functional
group have been found in multiple marine organisms [11–14], especially marine cyanobacteria and
mollusks. The structural characteristics of these peptides with various unusual amino acid residues
have displayed their variety of biological functions as antitumor, antibacterial, antimalarial activities,
etc., which seemed in some cases correlated to the presence of the terminal alkynyl moieties [14–16].
Cyanobacteria, also known as blue-green algae, are ancient photosynthetic prokaryotes living in a wide
range of habitats including open oceans, tropical reefs, shallow water environments, and terrestrial
substrates. The rich elaboration of biologically active natural products has assisted some of these
organisms to survive in predator-rich ecosystems. A major part of cyanobacterial secondary metabolites
arepeptides or possess peptidic substructures, which contribute to the more than 600 cyanobacterial
peptides discovered thus far [17,18]. Mollusks are the largest marine phylum, comprising about
23% of all the named marine organisms. The gastropods (snails and slugs) are by far the most
numerous mollusks in terms of classified species, and account for 80% of the total [19]. To date,
over 100 mollusks peptides with diverse structures have been reported (Data based on reviewing the
literatures, Marine Natrual Products in Natural Product Reports published during 1985–2015), some of
which displayed a variety of bioactivities as antitumor, anti-HIV, ion blockers, etc. [20,21].
In this review, we have provided an overview of the types and structural characterization of
these unusual terminal alkynyl fatty acyl units, as well as the sources and biological functions
of their composed peptides from marine cyanobacteria and mollusks. Further, we have also
discussed the evident biosynthetic origins responsible for formation of terminal alkynes of natural
PKS (polyketide synthase)/NRPS (nonribosome peptide synthetase) hybrids, providing perspective
insight for drug discovery research.
2. Cyclic Peptides Containing Terminal Alkyne
A number of terminal alkynylfatty acyl moieties are identified in the cyclic/acyclic marine
peptides, which are different by structure and bioactivities (Table 1, Figure 1). Onchidin as the first
terminal alkynyl-containing cyclic peptide, featured with 3-amino-2-methyl-7-octynoicacid (Amoya, a)
moiety was isolated as a molluscan metabolite in 1994 [11]. Since then, Amoya as a component of cyclic
peptides has been identified from many marine cyanobacterial metabolites including ulongapeptin,
guineamide C, and companeramides A and B. It is likely that the 3-hydroxy-2-methyloct-7-ynoic acid
(Hmoya, b) moiety was originally discovered in onchidin B from a marine mollusk, and subsequently
identified in many cyanobacterial metabolites such as antanapeptin A and D, trungapeptin A,
and hantupeptin A. Interestingly, abromine-containing 3-hydroxy-2-methyloct-7-ynoic acidmoiety
(Br-Hmoya, c) was subsequently identified in several veraguamides isolated from marine cyanobacteria
as well. The 2,2-dimethyl-3-hydroxy-7-octynoic acid (Dhoya, d) moiety was first discovered
as a fatty acyl component in kulolide-1, from a cephalaspidean mollusk, Philinopsis speciosa,
thereafter reported in many cyclic peptides with cyanobacteria origin as yanucamides A and B,
pitipeptolide A, viequeamides A, and more. The 3-amino-6-octyneoic acid (Aoy, e) residue and the
5,7-dihydroxy-2,6-dimethyldodec-2-en-11-ynoic acid (Dddd, f) residue have been only identified
in dolastatin 17 from a marine mollusk Dolebella auricularia and in Palau’amide from a marine
cyanobacteria Lyngbya sp., respectively.
145
Mar. Drugs 2016, 14, 216
Table 1. Terminal alkynyl-containing cyclic/acyclic peptides from marine cycanobacteria and mollusks.
Moiety Unit
Compound
Organism
Bioactivities
Reference
Yanucamides A (1) and
B (2)
Marine cyanobacterium
Lyngbya majuscule,
Schizothrix sp.
Strong brine shrimp toxicity
[12]
Pitipeptolides A (3)
Pitipeptolides D–F (4–6)
Marine cyanobacterium
Lyngbya majuscula
Antitumor cytotoxicity
[22,23]
Georgamide (7)
Marine cyanobacterium
anti-HIV cytotoxicity
[24]
Mantillamide (10)
Dudawalamide A (11)
Marine cyanobacterium
Lyngbya sp.
Antitumor cytotoxicity
Antimalaria parasites
[25]
Guineamide G (12)
Marine cyanobacterium
Lyngbya majuscula
Brine shrimp toxicity
Antitumor cytotoxicity
[26]
Cocosamides A–B
(13–14)
Marine cyanobacterium
Lyngbya majuscula
Antitumor cytotoxicity
[27]
Viequeamides A–B
(15–16) and E–F (17–18)
Marine cyanobacterium
Rivularia sp.
Antitumor cytotoxicity
[28]
Kulolide-1 (38)
Marine mollusk Philinopsis
speciosa Pease
Antitumor cytotoxicity
[29]
Kulokainalide-1 (39)
Marine cephalaspidean
mollusk Philinopsis speciosa
Moderate antitumor
cytotoxicity
[30]
Wewakpeptins A and C
(8a–9)
Marine cyanobacterium
Lyngbya semiplena
Antitumor cytotoxicity
[31]
Malevamide C (19)
Marine cyanobacterium
Symplocalaete-viridis
No cytotoxicity
[32]
Guineamide C (20)
Marine cyanobacterium
Lyngbya majuscula
Antitumor cytotoxicity
[33]
Ulongapeptin (21)
Marine cyanobacterium
Lyngbya sp.
Antitumor cytotoxicity
[34]
Companeramides A–B
(22–23)
Marine cyanobacterium
Leptolyngbya sp.
Antiplasmodial activity
[35]
Onchidin (36)
Marine pulmonate mollusk
Onchidium sp.
Strong antitumor
cytotoxicity
[11,36]
Antanapeptin A and D
(24–25)
Marine cyanobacterium
Lyngbya majuscula
Na+ channel modulation
Antimicrobial activity
[37]
Trungapeptins A (26)
Marine cyanobacterium
Lyngbya majuscula
Brine shrimp toxicity and
ichthyotoxicity
[30,38]
Hantupeptin A (27)
Marine cyanobacterium
Lyngbya majuscula
Brine shrimp toxicity
Antitumor cytotoxicity
[39]
Veraguamides B–F
(29–33)
Marine cyanobacterium
Symploca cf. hydnoides
Veraguamides A and C,
antitumor cytotoxicity
[40]
Veraguamides H (34)
Marine cyanobacterium
Oscillatoria margaritifera
No cytotoxicity
[13]
Onchidin B (37)
Marine pulmonate mollusk
Onchidium sp.
Strong antitumor
cytotoxicity
[11,36]
Kulomo’opunalide-1 (40)
and (41)
Marine cephalaspidean
mollusk Philinopsis speciosa
Moderate antitumor
cytotoxicity
[30]
Dddd
Palau’amide (35)
Marine cyanobacterium
Lyngbya sp.
Strong antitumor
cytotoxicity
[41]
Aoy
Dolastatin 17 (42)
Marine mollusk Dolebella
auricularia
Antitumor cytotoxicity
[12,42]
Oya
Apramides B and G
(44,47)
Marine cyanobacterium
Lyngbya majuscula
Apramide A exhibited
stimulating elastase activity
[43]
Apramides A,D and G
(43,45–46)
Marine cyanobacterium
Lyngbya majuscula
Apramide A exhibited
stimulating elastase activity
[43]
Dragonamides A–B
(48–49)
Marine cyanobacterium
Lyngbya majuscule Gomont
Antileishmaniasis
[44–47]
Dragonamides C–E
(50–52)
Marine cyanobacterium
Lyngbya polychroa
Antileishmaniasis
[47]
Dhoya
Dhoaa
Amoya
Hmoya
Moya
146
Mar. Drugs 2016, 14, 216
Table 1. Cont.
Moiety Unit
Compound
Organism
Bioactivities
Reference
Dragomabin (53)
Marine cyanobacterium
Lyngbya majuscula
Antiparasite toxicity
[45]
Almiramide B (54)
Marine cyanobacterium
Lyngbya majuscule
Antitumor cytotoxicity
[14]
Almiramides D–H
(55–59)
Marine cyanobacterium
Oscillatoria nigroviridis
Antitumor cytotoxicity
[48]
Viridamides A–B (61–62)
Marine cyanobacterium
Oscillatoria nigro-Wiridis
Antitrypanosomal activity
Antileishmanial activity
[49]
Veraguamides A (28)
Marine cyanobacterium
Symploca cf. hydnoides
Veraguamides A and C,
antitumor cytotoxicity
[40]
Viridamides K–L (63–64)
Marine cyanobacteria, cf.
Oscillatoria margaritifera
Antitumor cytotoxicity
[13]
[50]
[51–53]
Moya
Mdyna
Br-Hmoya
2,4-dimethyl-9decynoic acid
Carmabins A (60)
Marine cyanobacterium
Lyngbya majuscula
Antimalaria against the W2
chloroquine-resistant
malaria strain
9-(chloromethylene)-6methyltetradec-4-en13-ynoic acid
Jamaicamide A–B
(65–66)
Marine Cyanobacterium
Lyngbya majuscula
not mentioned
NH 2
O
OH
2
3
OH
3
a
O
2
2
OH
OH
8
Br
O
c
b
O
NH2
OH
3
OH
O
OH
OH
5
3
2
OH
OH
3
OH
3
2
O
d
e
OH
OH
4
f
OH
2
2
O
O
g
O
h
O
i
O
O
O
3
O
OH
5
3
OH
2
j
O
OH
k
l
Cl
O
O
OH
m
R
OH
5
2
HO
3
n
O
2
7
jaA R=Br
jaB R=H
OH
3
o
Figure 1. Structures of the terminal alkynyl fatty acyl moieties identified in cyclic/acyclic marine
peptides. a. 3-amino-2-methyl-7-octynoicacid (Amoya); b. 3-hydroxy-2-methyloct-7-ynoic acid
(Hmoya); c. bromine-containing 3-hydroxy-2-methyloct-7-ynoic acid (Br-Hmoya); d. 2,2-dimethyl-3hydroxy-7-octynoic acid (Dhoya); e. 3-amino-6-octyneoic acid (Aoy); f. 5,7-dihydroxy-2,6-dimethyldodec
-2-en-11-ynoic acid (Dddd); g. 2,4-dimethyl-9-decynoic acid; h. 2-methyl-7-octynoic acid (Moya);
i. 7-octynoic acid (Oya); j. 5-methoxydec-9-ynoic acid (Mdyna); k. 3-methoxy-2-en-7-octynoic acid;
l. 3-keto-7-octynoic acid; m. (E)-2-methyloct-2-en-7-ynoic acid; n. (4E,9E)-9- (chloromethylene)-6methyltetradec-4-en-13-ynoic acid; o. 2,2-dimethyl-3-hydroxy-7-octanoic acid (Dhoaa).
147
Mar. Drugs 2016, 14, 216
2.1. Cyclic Peptides with Dhoya Unit from Marine Cyanobacteria
Cyclic peptides are representative secondary metabolites of cyanobacteria, and in recent years
a number of structurally diverse terminal alkynyl-containing cyclic peptides have been found in
marine cyanobacteria. The 2,2-dimethyl-3-hydroxy-7-octynoic acid (Dhoya) moiety appeared to
be most frequently identified in the terminal alkynyl-containing cyclic peptides. The first two
Dhoya unit-containing cyanobacterial cyclic depsipeptides, yanucamides A (1) and B (2, Table 1,
Figure 2), were isolated from the lipid extract of a Lyngbya majuscula and Schizothrix sp. assemblage
collected at Yanuca Island, Fiji, in 2000 [12]. Interestingly, the Dhoya unit had previously been
found only in kulolide-1 (38) and kulokainalide-1 (39), metabolites isolated from the marine
mollusk Philinopsis speciosa. Thus, the discovery of the yanucamides from a field-collected marine
cyanobacterium substantiated the hypothesis that marine cyanobacteria are the probable source of the
kulolides and their related metabolites. Both yanucamides A and B displayed strong brine shrimp
toxicity (LD50 , 5 ppm). In 2001, Luesch et al. reported isolation and identification of two new cyclic
depsipeptides, pitipeptolides A (3, Figure 2) and B, from a population of the marine cyanobacterium
Lyngbya majuscula collected at Piti Bomb Holes, Guam [22]. Pitipeptolide A with a Dhoya unit and
B with a reduced form of Dhoya unit, both showed potent in vitro cytotoxicity against LoVo cells
with IC50 values of 2.25 and 1.95 µg/mL, respectively; and also exhibited certain growth inhibition
for Mycobacterium tuberculosis strains ATCC 25177 and ATCC 35818 in the diffusion susceptibility
assay. Both compounds were also observed to increase elastase activity (2.76-fold and 2.55-fold,
respectively, at 50 µg/mL). Further, in 2011, Luesch et al. revisited larger collections of the same
cyanobacterium and obtained additional analogs of pitipeptolides A and B, as well aspitipeptolides C
(tetrahydro analog of 3) and D–F (4c, 5–6, Figure 2) [23]. Pitipeptolide A as the major metabolite
in this series was reported to act as a feeding deterrent at natural concentrations against a range of
marine grazers, suggesting that pitipeptolide A may play an important ecological role among these
organisms [54]. Although pitipeptolides C–F were less potent than pitipeptolides A and B against
HT-29 colon adenocarcinoma and MCF7 breast cancer cell lines, pitipeptolides C and E showed similar
antimycobacterial activities comparable to pitipeptolides A and B. Among them, pitipeptolide F
exhibited the highest potency, but pitipeptolide D did not show activities against both mammalian and
bacterial cells. As a result, it indicates that the activities of pitipeptolides are not strongly impacted by
the Dhoya unit in the structure. Georgamide (7, Figure 2), another analog of pitipeptolides featuring
Dhoya residue, was obtained from an Australian cyanobacterium Q66C5927 at the head of the King
George River, Northwestern Australia [24].
In 2005, an assay-based screening program for anticancer compounds from the marine
cyanobacterium Lyngbya semiplena collected from Papua New Guinea led to the discovery of four
new depsipeptides: wewakpeptins A–D featured with Dhoya or its fully reduced form (Dhoaa, o)
residues [31]. Intriguingly, wewakpeptins A (8a, Figure 2) and B were approximately 10-fold more
toxic than C (9) and D, with an LC50 of approximately 0.4 µM to NCI H-460 human lung tumor and
mouse neuroblastoma cells. These cyclic depsipeptides most likely derive from a nonribosomal
polypeptide synthetase (NRPS) pathway, and thus, the structural variation of wewakpeptins is
intriguing and might suggest that adenylation domains with relaxed substrate specificity are involved
in their biosynthesis [31]. Mantillamide (10), and dudawalamide A (11) featured with Dhoya
residues were obtained from the marine cyanobacterium Lyngbya sp. because of their biological
activity to cancer cells or malaria parasites, and they were able to be identified in a rapid manner
using an annotation program developed from tandem mass spectra called MS-CPA available as a
web tool (http://lol.ucsd.edu/ms-cpa_v1/Input.py) [25]. Isolation of a new cyclic depsipeptide,
guineamide G (12) was reported in 2011 from the marine cyanobacterium Lyngbya majuscula, collected
from Papua New Guinea. Guineamide G was the only cyclic depsipetide featuring Dhoya residue
in the series of guineamides, which showed potent brine shrimp toxicity and moderate cytotoxicity
to a mouse neuroblastoma cell line with LC50 value of 2.7 µM [26]. In 2011, Paul et al. reported
isolation and identification of cocosamides A (13) and B (14) from the lipophilic extract of a
148
Mar. Drugs 2016, 14, 216
collection of Lyngbya majuscula from Cocos Lagoon, Guam [27]. Cocosamide A consisting of Dhoea
(a reduced form of Dhoya residue) was less potent than cocosamide B (featuring Dhoyaresidue)
against HT-29 cells with IC50 values of 24 and 11 µM, respectively, indicating the presence of Dhoya
moiety may have a slight effect on the cytotoxicity. In 2012, the family of viequeamides A–F was
discovered from a shallow subtidal collection of a cyanobacterium (Rivularia sp.) near the island
of Vieques, Puerto Rico, among which viequeamides A–B (15–16) and E–F (17–18, Figure 2) are
2,2-dimethyl-3-hydroxy-7-octynoic acid (Dhoya)-containing cyclic depsipeptides [28]. Intriguingly,
viequeamide A was found to be the most active (IC50 = 60 ± 10 nM) against H460 human lung cancer
cell line, whereas the other viequeamides with quite similar structures were inactive.
H
N
O
O
N
O
O
O
O
O
H
N
N
O
O
O
O
O
O
O
N
H
O
O
O
O
HN
O
O
N
N
H
N
H
O
Pitipeptolides A (3)
Yanucamide B (2)
Yanucamide A (1)
N
N
H
O
O
R
R1
O
N
H
O
HN
O
O
O
O
O
O
O
O
O
H
N
O
O
HN
O
OH
O
N
O
O
O
O
N
N
O
N
, R2 =CH3 , R3 =CH 3, R 4=CH 3
Georgamide (7)
, R 2=CH 3, R 3=CH3 , R4 =CH 3
, R2 =H, R 3=CH 3, R 4=CH 3
, R 2=CH3 , R3 =H, R 4=CH 3
, R 2=CH3 , R3 =CH3 , R4 =H
D (4c) R 1=
E (5) R1 =
F (6) R1 =
O
O
O
O
Pitipeptolides
B (4a) R1=
C (4b) R 1=
N
N
H
NH
O
N
R3
O
N
O
N
N
N
H
R4
O
R2
N
O
Wewakpeptin A (8a) R=
Wewakpeptin B (8b) R=
R
HN
O
O
N
N
H
O
O
HN
O
N
O
O
N
O
O
O
O
N
O
HN
N
O
O
O
O
O
O
NH
N
O
NH
N
O
N
N
O
N
O
O
O
N
N
O
N
O
O
O
O
O
Dhoya
O
Wewakpeptin C (9a) R=
Mantillamide (10)
Dudawalamide A (11)
Wewakpeptin D (9b) R=
ȱ
O
O
N
H
O
N
O
O
O
N
N
O
N
N
O
HN
NH
O
O
N
O
O
O
NH
O
R
Cocosamides A (13) R=
Cocosamides B (14) R=
Guineamide G (12)
N
N
N
O
O
O
O
O
N
NH
N
O
NH
O
O
N
O
NH
HO
O
Viequeamide A (15)
O
O
O
O
O
O
O
O
N
NH
NH
O
N
O
O
O
N
O
O
NH
Viequeamide E (17)
Viequeamide B (16)
O
O
N
O
O
O
O
O
O
N
NH
N
O
O
NH
O
O
Viequeamide F (18)ȱ
Figure 2. Structures of cyclic peptides with Dhoya residue from marine cyanobacteria.
149
Mar. Drugs 2016, 14, 216
2.2. Cyclic Peptides with Amoya Unit from Marine Cyanobacteria
Malevamide C (19, Table 1, Figure 3), as the first reported 3-amino-2-methyl-7-octynoic acid
(Amoya)-containing cyanobactrial peptide, was obtained from a cyanobactrium Symplocalaete-viridis
collected in waters adjacent to AlaMoana Beach Park, Hawaii in 2000. The unusual β-amino acid
residue, Amoya, was only previously identified in onchidin, a cyclic depsipeptide isolated from a
marine mollusk Onchidium spp. [32]. However, malevamide C did not display potent cytotoxicity
against a variety of cancer cell lines. In 2003, another Amoya-containing cyclic depsipeptide,
guineamide C (20, Figure 3) was discovered by William Gerwick’s group from a Papua New Guinea
collection of the marine cyanobacterium Lyngbya majuscula. As malevamide C, guineamide C, only
exhibited moderate cytotoxicity against neuroblastoma cells with an IC50 value of 16 µM [33].
Meanwhile, Williams et al. reported discovery of ulongapeptin (21) featuring Amoya residue,
isolated from a dark reddish-black clump of cyanobacterium, designated VP755 collected at Ulong
Channel in Palau. Interestingly, ulongapeptin showed strong cytotoxicity against KB cells at an IC50
value of 0.63 µM [34]. Just recently, two new cyclic depsipeptides, companeramides A (22) and B (23)
containing Amoya unit, were obtained from a marine cyanobacterial assemblage comprising a small
filament Leptolyngbya species, from Coiba Island, Panama. It is interesting to note that companeramides
A and B showed high nanomolar in vitro antiplasmodial activity, though not quite cytotoxic to human
cancer cell lines [35].
O
N
N
O O
N
O
O
N
O
O
O
N
NH
HN
N
O
O
O
O
N
H
O
N
O
O
HN
O
O
O
O
O
N
N
N
O
O
O
NH
N
N
O
O
O
NH
N
H
H
N
N
O
O
HN
N
O
O
OCH3
Ulongapeptin (21)
Guineamide C (20)
Malevamide C (19)
O
H
N
O
O
O
H
N
N
N
N
O
O
O
O
O
O
HN
HN
O
O
N
O
O
O
HN
HN
N
N
N
O
O
O
N
O
N
O
N
O
N
H
O
Companeramides A (22)
N
H
Companeramides B (23)
ȱ
Figure 3. Structures of cyclic peptides with Amoya residue from marine cyanobacteria.
2.3. Cyclic Peptides with Hmoya/Br-Hmoya/Dddd Units from Marine Cyanobacteria
While the 3-hydroxy-2-methyloctynoic acid (Hmoya) residue was initially identified in the
molluscan metabolite onchidin B [11,36], antanapeptin A (24) and antanapeptin D (25, Figure 4)
are the first two cyclic peptides containing Hmoya residue, obtained from a cyanobacterium
Lyngbya majuscule collected from Antany Mora, Madagascar [37]. The antanapeptins were observed
inactive in brine shrimp toxicity, sodium channel modulation, and antimicrobial bioassays.
Subsequently, Sitachitta et al. in 2006, reported isolation and identification of three new cyclic
peptides, trungapeptins A (26)–C, containing Hmoya residue, 3-hydroxy-2-methyl-7-octenoic acid
(Hmoea), and 3-hydroxy-2-methyl-7-octanoic acid (Hmoaa) residues, respectively [38]. The relative
150
Mar. Drugs 2016, 14, 216
stereochemistry of Hmoya residue of trungapeptin A was determined to be syn configuration between
H-2 and H-3 by measurement of homonuclear coupling constant as well as comparison of the literature
value. The absolute stereochemistry of the Hmoya unit was established as 2S, 3R by Mosher’s analysis.
Intriguingly, herein the stereochemistry of the Hmoya unit is identical to that of kulomo’opunalides [30],
but is diastereomeric to that of onchidin B (2R, 3R). Unlike antanapeptins, trungapeptin A exhibited
potent brine shrimp toxicity and ichthyotoxicity at 10 ppm and 6.25 ppm, respectively. However, it was
inactive against KB and LoVo cells at 10 µg/mL. In 2009, a new Hmoya-containing analog of
trungapeptin A, hantupeptin A (27, Figure 4) was discovered from the marine cyanobacterium
Lyngbya majuscula from PulauHantuBesar, Singapore [39]. The absolute configuration at C-3 was
determined to be S by Mosher’s analysis following methanolysis of hantupeptin A and isolation of
the Hmoya fragment. However, the stereochemistry at C-3 of the Hmoya unit in hantupeptin A is
different from that of trungapeptin A. Further, hantupeptin A afforded both brine shrimp toxicity at
10 ppm and strong cytotoxicity against the leukemia cell line MOLT-4 with an IC50 value of 32 nM.
O
O
O
N
HN
O
HN
OO
O
O
O
O
N
O
N
O
OO
O
N
O
O
N
O
N
N
N
O
H
N
O
O
O
R6
O
O
R1
O
NH
O
R2
Hmoya
Trugapetin A (26)
O
Hmoya
Hantupeptin A (27)
O
Veraguamides
N
1
2
3
4
5
6
R3 A (28) R =Br, R =H, R =H, R =Et, R =Me, R =H
N
N
O
N
O
O
O
O
H
N
O
R5
O O
O
N
O
R4
N
N
Antanapeptins D (25)
O
NH
O
Antanapeptins A (24)
N
O
B (29)
C (30)
D (31)
E (32)
F (33)
H (34)
R1=Br, R2=H, R3=H, R4=Me, R5=Me, R6=H
R1 =H, R2 =H, R3 =H, R4 =Et, R5=Me, R6=H
R1 =H, R2 =H, R3 =H, R4 =Et, R5=Me, R6=Me
R1=H, R2=Me, R3 =Me, R4=Et, R5=Me, R6 =H
R1=H, R2=H, R3=H, R4=Ph, R5=Me, R6 =H
R1 =H, R2 =H, R3 =H, R4 =Me, R5 =Me, R6=H
HN
O
O
N
H
O
O
O
O
O
N
O
OH
Palau'amide (35)
Figure 4. Structures of cyclic peptides with Hmoya/Br-Hmoya/Dddd residue from marine cyanobacteria.
In 2011, the Luesch group and Gerwick group coincidently reported isolation and identification of
a series of peptides featured with Hmoya and its derived residues, veraguamides A–F (28–33), from a
cyanobacterium Symploca cf. hydnoides at Cetti Bay, Guam [40], and veraguamides H (34), I–L from
the marine cyanobacterium cf. Oscillatoria margaritifera at the Coiba National Park, Panama [13],
respectively. Among them, veraguamides A and B are 8-bromo-3-hydroxy-2-methyl-7-octynoic
acid (Br-Hmoya) moiety-containing cyclic peptides, while veraguamides K and L (63–64) are
Br-Hmoya-containing linear peptides (more in Section 3). It is interesting to note that veraguamides D
and E were five-fold more potent than their related congener veraguamide C against HT29 colorectal
and HeLa cervical adenocarcinoma cells, while veraguamides A, B and F were inactive againstthese
cancer cell lines. Surprisingly, veraguamide A exhibited strong potency in the H-460 cytotoxicity assay
(LD50 = 141 nM), but veraguamides B, C, K and L were much less active.
Palau’amide (35, Figure 4) is a unique terminal alkynyl-containing cyclic depsipeptide,
consisting of a novel polyketide unit, 5,7-dihydroxy-2,6-dimethyldodec-2-en-11-ynoic acid (Dddd),
which was obtained from a Lyngbya sp. from Palau. Palau’amide showed strong cytotoxicity against
KB cells with an IC50 value of 13 nM [41].
151
Mar. Drugs 2016, 14, 216
2.4. Cyclic Peptides from Marine Mollusks
Onchidin (36, Figure 5) as the first report of a dimeric depsipeptide from a mollusc, featured with
two 3-amino-2-methyl-7-octynoicacid (Amoya, a) residues, was obtained from the pulmonate mollusk
Onchidium sp. collected off New Caledonian 1994 [11]. Onchidin B (37) isolated and identified
along with onchidin from the same extract, shares quite similar structural features with onchidin.
Interestingly, onchidin B featured with two 3-hydroxy-2-methyloct-7-ynoic acid (Hmoya, b) does
not have a C2 axis of symmetry as does onchidin, due to the presence of the two enantiomers of
proline that renders the two halves of the molecule different [36]. Onchidin and onchidin B exhibited
identical cytotoxicity against P-388 murine leukemia cells (IC50 = 8 µg/mL) and Kb human epidermoid
carcinoma cells (IC50 = 8 µg/mL), respectively.
O
H
N
O
O
O
O
HN
O
O
Amoya
O
O
O
O
O
N
N
O
NH
Amoya
O
O
O
H
N
N
HN
Dhoya
O
O
Hmoya
O
N
N
O
O
N
O
O
Dhoya
O
O
N
N
O
O
O
HN
O
O
Hmoya
O
Kulolide-1 (38)
O
O
O
H
N
N
N
O
O
O
N
H
N
O
Onchidin B (37)
O
O O
O O
O
O
O
O
H
N
O
O
N
Onchidin (36)
HN
N
O
O
Hmoya
N
H
O
O
O
O
O
Kulomo,opunalide-1 (40)
Kulokainalide-1 (39)
O
O
N
O
O
N
O
O
N
O
N
O
N
O
O
O
HN
O
N
O
O
NH
O
O
NH
O
Hmoya
Aoy
Kulomo,opunalide 2 (41)
Dolastatin 17 (42)
Figure 5. Structures of cyclic peptides with Amoya/Hmoya/Dhoya/Aoy residue from marine mollusks.
A cephalaspidean mollusk, Philinopsis speciosa Pease, 1860 collected off North Shore,
Oahu’s (Hawaiian Islands) Shark Bay, afforded the first 2,2-dimethyl-3-hydroxy-7-octynoic acid
(Dhoya)-containing cyclic depsipeptide, kulolide-1 (38, Figure 5) [29]. Kulolide-1was active against
L-1210 leukemia cells and P388 murine leukemia cells at IC50 values of 0.7 and 2.1 µg/mL, respectively.
Along with kulolide-1, three other terminal alkynyl-containing cyclic depsipeptides, kulokainalide-1
(Dhoya, 39), kulomo’opunalide-1 (Hmoya, 40) and kulomo’opunalide-2 (Hmoya, 41), were also
discovered from the same sample of the cephalaspidean mollusk, Philinopsis speciosa [30].
3-amino-6-octyneoic acid (Aoy, e) as an unprecedented terminal alkynyl moiety, was only
identified in a novel cyclic depsipeptide, dolastatin 17, isolated from a sea hare Dolebella auricularia [12].
Dolastatin 17 (42, Figure 5) displayed significant growth-inhibitory activity against OVCAR-3 (GI50
0.67 µg/mL), SF-295 (GI50 0.55 µg/mL), NCI-H460 (GI50 0.74 µg/mL), KM20L (GI50 0.45 µg/mL)
human cancer cell lines [42].
152
Mar. Drugs 2016, 14, 216
3. Acyclic Lipopeptides Containing Terminal Alkyne from Marine Cyanobacteria
It is interesting to note that many linear peptides have also been found to possess the terminal alkynyl
fatty acyl moieties, including 2,4-dimethyl-9-decynoic acid (g), 2-methyl-7-octynoic acid (Moya, h),
7-octynoic acid unit (Oya, i), 5-methoxydec-9-ynoic acid (Mdyna, j), 3-methoxy-2-en-7-octynoic acid
(MeO-Oya-2-ene, k), 3-keto-7-octynoic acid (l), and (E)-2-methyloct-2-en-7-ynoic acid (m), which are
different from that of cyclic peptides, except for Hmoya and Br-Hmoya residues present in both linear
and cyclic veraguamides (Table 1). In addition, an acyclic amide-like secondary metabolite from the
marine cyanobacteria Lyngbya majuscula, termed jamaiapcamides A, has provided an alkynyl bromide,
vinyl chloride, β-methoxyeneone moiety (n) to the terminal alkynyl-containing peptides.
All the terminal alkynyl-containing linear peptides were solely discovered from marine
cyanobacteria. In 2000, Luesch et al. reported the isolation and identification of six new linear peptides,
apramides A–G (Figure 6), from the marine cyanobacterium Lyngbya majuscule collected at Apra Harbor,
Guam [43]. Apramides A (43), D (45) and G (46) are Moya-containing acylic peptides, while apramides
C and F consist of 2-methyl-7-octenoic acid moiety (Moea) in their structures. Apramides B (44) and
E (47) possess a 7-octynoicacid unit (Oya) in lieu of the Moya moiety, and the rest of the structures are
identical to apramides A and D, respectively. Apramides A–G was inactive in cytotoxic, antibacterial,
antifungal assays, but apramide A exhibited stimulating elastase activity.
R'
O
O
N
N
N
N
N
O
N
O
O
S
Apramides
A R' = CH3 (43)
B R' = H (44)
R'
OMe
O
O
N
N
S
N
N
O
O
N
O
Apramides
D R' = CH3 (45)
E R' = H (46)
N
N
O
OMe
O
O
N
N
O
N
N
O
N
N
O
N
O
S
N
N
N
O
O
Apramide G (47)
Figure 6. Structures of linear peptides (apramides A–G) from marine cyanobacteria.
Dragonamides are a family of structurally close linear peptides composing of a variety of
terminal alkynyl units (Figure 7). Several separate Panamanian collections of Lyngbya majuscule
Gomont afforded dragonamides A, B (48–49) and E [44–46], while the collection of brown
Lyngbya polychroa from Hollywood Beach, Fort Lauderdale, FL led to the discovery of dragonamides
C and D [47]. Dragonamides A and B contain a terminal 2-methyl-7-octynoic acid unit (Moya),
whereas dragonamides C, D and E (50–52) possess three different terminal acetylene units,
3-methoxy-2-en-7-octynoic acid (k), 3-keto-7-octynoic (l) (E)-2-methyloct-2-en-7-ynoic acid (m),
respectively, which were not previously reported from marine peptides. Dragonamides did not exhibit
strong activities against a variety of tumor cell lines, except dragonamides A and E which showed
moderate in vitroactivity against leishmaniasis. Along with dragonamides A and B, another terminal
Moya-containing linear peptide, dragomabin (53, Figure 7), was isolated and identified in 2007, from a
Panamanian strain of the marine cyanobacterium Lyngbya majuscula [45]. Dragomabin possesses
the best differential toxicity between parasite and mammalian cells, with IC50 value of 6.0 µM
153
Mar. Drugs 2016, 14, 216
against the W2 chloroquine-resistant malaria strain and IC50 value of 182.3 µM against Vero cells
(kidney epithelial cells).
O
O
N
N
N
NH 2
N
O
O
O
Dragonamide A (48)
O
O
N
N
N
NH 2
N
O
O
O
Dragonamide B (49)
O
O
O
N
O
N
N
N
NH2
O
O
Dragonamide C (50)
O
O
O
N
O
N
N
N
NH2
O
O
Dragonamide D (51)
O
O
N
N
N
O
NH 2
N
O
O
OCH3
Dragonamide E (52)
O
O
N
N
N
H
O
NH2
N
O
O
Dragomabin (53)
Figure 7. Structures of linear peptides (dragonamides A–E, dragomabin) from marine cyanobacteria.
In 2010, Linington et al. reported the isolation and identification of a series of terminal fatty
acyl units-containing linear peptides, almiramides A–C, from a Panamanian strain of the marine
cyanobacterium Lyngbya majuscule [14]. Among them, almiramide B (54) is featured with a terminal
Moya unit (Figure 8), whereas almiramide C contains a reduced form of Moya as a 2-methyloct-7-enoic
acid residue. Biological evaluation of these three compounds showed that almiramides B and C
possessed good selectivity between parasite and mammalian cells with strong in vitro antiparasitic
activity against leishmania (IC50 = 2.4 and 1.9 µM, respectively), and weak activity against Vero cells
(IC50 = 52.3 and 33.1 µM, respectively). Just recently, a series of new terminal Moya-containing
linear peptides, almiramides D–H (55–59) along with known almiramide B (Figure 8), were isolated
and identified from a cyanobacterium sample of Oscillatoria nigroviridis collected at the Colombian
Caribbean Sea [48]. Intriguingly, two structurally representative almiramides B and D showed mild
toxicity against five human tumor cell lines, but high toxicity against the gingival fibroblast cell line
was used as reference to evaluate selectivity against tumor cell lines compared with primary cell line.
Two novel terminal fatty acyl-containing linear peptides, carmabins A (60) and B were discovered
from a collection of the marine cyanobacterium Lyngbya majuscule at Barbara Beach (Spanish Waters),
154
Mar. Drugs 2016, 14, 216
Curacao, Netherlands Antilles in 1998 [50]. Carmabin A (Figure 9) is featured with a novel terminal
2,4-dimethyl-9-decynoic acid residue, but in carmabin B, the acetylene functional group is replaced
with a methyl ketone. To the best of our knowledge, carmabin A is the only reported compound
containing a 2,4-dimethyldec-9-ynoic acid moiety. Carmabin A exhibited moderate cytotoxicity to
Vero cells (IC50 = 9.8 µM), and mild activity against the W2 chloroquine-resistant malaria strain
(IC50 = 4.3µM).
O
N
O
H
N
N
O
O
N
N
O
NH 2
O
Almiramide B (54)
O
N
R3
O
O
H
N
N
O
N
N
O
NH2
R1
O
R2
Almiramides
R1=Me, R2=Me, R3=Me
R1=Me, R2=Me, R3=H
R1=CH2OH, R 2=Me, R3=Me
R 1=Me, R 2=H, R3=Me
R1=H, R2=Me, R3=Me
D (55)
E (56)
F (57)
G (58)
H (59)
Figure 8. Structures of linear peptides (almiramide B, D–H) from marine cyanobacteria.
OCH 3
O
N
O
N
N
H
O
NH 2
N
O
O
Carmabin A (60)
O
O
H
N
N
O
O
N
H
O
N
N
O
O
O
O
O
Viridamide A (61)
O
O
O
H
N
N
O
N
N
H
O
N
O
O
O
O
O
Viridamide B (62)
R
O
N
N
O
O
O
O
N
O
OH
Br
N
H
O
Veraguamides
K (63) R=Me
L (64) R=H
O
Cl
O
O
R
N
H
N
O
Jamaicamides
O
A R=Br (65)
B R=H (66)
ȱ
Figure 9. Structures of linear peptides (carmabin A, viridamide A–B, veraguamides K and L,
and jamaicamides A–B) from marine cyanobacteria.
155
Mar. Drugs 2016, 14, 216
In 2008, Simmons et al. reported discovery of two new linear peptides, viridamides A and B
(61–62, Figure 9) isolated from the marine cyanobacterium Oscillatoria nogroviridis [51] (Figure 9),
whose structures contain a novel terminal 5-methoxydec-9-ynoic acid moiety (Mdyna). Viridamide A
displayed antitrypanosomal activity (IC50 1.1 µM to Trypanosoma cruzi) and antileishmanial activity
(IC50 1.5 µM to Leishmania mexicana).
4. Different Methods to Determine the Absolute Configuration of Different Alkynyl Fragments
4.1. Amoya (a)
Determination of stereochemistry of the 3-amino-2-methyl-7-octynoic acid (Amoya, a) residue
in the cyclic depsipeptides was established using differential methods such as NMR or Marfey’s
analysis. The configuration of an Amoya unit in onchidin was found to be threo through
analysis of the NOE data and their coupling constants for critical protons, which indicated the
relative stereochemistry of the pentine side chain on the same side as the neighboring MeVal
and Val isopropyl groups. As a result, the absolute configuration of an Amoya unit in onchidin
was determined to be 7S, 9S [11]. The stereochemistry of the Amoya unit in ulongapeptin was
determined using the synthetically saturated 3-amino-2-methyloctanoic acid C-2 diastereomers (2R,
3R and 2S, 3R) as standards for Marfey’s analysis. Comparison with the derivatized hydrogenated
hydrolysate of ulongapeptin established the absolute configuration of the Amoya as 2S, 3S [34].
Surprisingly, the absolute configuration of the Amoya unit in companeramides A (22) and B (23) was
determined to be 2S, 3R using the method of Marfey’s analysis in comparison with synthetically
saturated 3-amino-2-methyloctanoic acid C-2 diastereomeric (2R, 3R and 2S, 3R) standards [35].
4.2. Hmoya (b)
Determination of stereochemistry of 3-hydroxy-2-methyloct-7-ynoic acid (Hmoya) was first
accomplished in the work of identification of onchidin B [36]. As beginning of the work, all four
possible stereoisomers of Hmoya were synthesized in a diastereo selective mode. However, direct
comparative analysis of the methyl esters of the four synthetic standards with the methyl ester
of the natural Hmoya hydrolyzed from onchidin B using chiral gas chromatography (GC) and
HPLC was not successful due to a separation issue. Consequently, the problem was overcome by
derivation of the four hydroxy esters with (−)-(R)-α-methoxy-α-(9-anthryl) acetic acid as well as the
natural Hmoya component to obtain good resolution of the four synthetic stereoisomers in LC-MS
analysis, which indicated that the absolute configuration of Hmoya moiety in onchidin B was 2R,
3R. The stereochemistry of the Hmoya unit in Kulomo’opunalide-1 (40) and kulomo’opunalide-2 (41)
was initially worked on comparison of chemical shifts of the p-bromobenzoyl derivatized synthetic
standards with the derivatized natural Hmoaa (hydrogenated form of Hmoya) in 1 H NMR spectra to
provide the relative stereochemistry of 2S*, 3R*. Comparison of retention time and co-injection of the
standards with hydrolyte of the hydrogenated (40) and (41) confirmed the absolute stereochemistry
of the Hmoya unit as 2S, 3R [30], which is surprisingly different from 2R, 3R of the Hmoya unit in
onchidin B. Interestingly, the absolute configuration of the Hmoya unit in trungapeptin A (26) was
determined to be 2S, 3R by application of the J-based configuration analysis as well as Mosher’s
method [38]. Further, the stereochemistry of Hmoya in hantupeptin A (27) was determined to be S
at C-3 using Mosher’s analysis, but the configuration at C-2 was not established [39]. In addition,
the absolute configuration of the Br-Hmoya unit in veraguamide A (28) was also determined to be 2S,
3R identical to that of trungapeptin A using the J-based configuration analysis as well as the Mosher’s
method subjected to the linear veraguamide A following methanolysis of 28 [40].
4.3. Dhoya (d)
Determination of absolute configuration of 2,2-dimethyl-3-hydroxy-7-octynoic acid (Dhoya)
residue was initially achieved in the structure elucidation of kulolide-1 (38), which was treated with
156
Mar. Drugs 2016, 14, 216
NaOMe to release the free hydroxyl functional group in the Dhoya-containing fragment, followed by
Mosher’s analysis to reveal the R-configuration at C-3 of Dhoya [29]. Interestingly, the stereochemistry
of the Dhoya unit in kulokainalide-1 was determined to be 3S by comparing the values of optical
rotation of Dhoaa (saturated form of Dhoya) residues obtained from the acid hydrolysates of both
hydrogenated kulolide-1 and kulokainalide-1 [30]. Further, Ye et al. achieved a total synthesis
of yanucamide A to confirm the absolute configuration of Dhoya to be the same (3S) as in
kulokainalide-1 [55]. The stereochemistry of the Dhoya unit in pitipeptolide A (3) was also revealed
as 3S using the optical rotation data of the obtained Dhoaa unit [22]. Interestingly, the absolute
configuration of the Dhoya unit in wewakpeptin A (8) was determined to be R by chiral GC-MS
analysis of the hydrogenated Dhoya in 8 possessing the same retention time as synthetic R-Dhoaa [31].
The chiral center of Dhoya residue in cocosamide B (14), was suggested to possess the same 3S
configuration as in pitipeptolide A, by comparison of the NOE correlations of specific protons observed
for Dhoya as well as related protons in the structures of cocosamide B and pitipeptolide A [27].
The configuration of Dhoya residue in viequeamide A was revealed to be S by chiral GC-MS analysis
of the synthetic standards and the obtained natural Dhoya unit [28].
4.4. Moya (h)
The 2-methyl-7-octynoic acid (Moya, h) unit is the most frequently identified terminal alkynyl
residue in the linear peptides. The absolute configuration at C-2 in apramides was proposed to
be R based on the negative contribution of the C-2 stereocenter to the molar optical rotation of the
molecule [50], because it is known for a closely related model compound that the 2S epimer gives a more
positive rotation in CHCl3 than the corresponding epimer with R configuration in the lipid chain [56].
The stereochemistry of Moya residue in dragonamide A was initially determined to be R, which was
inferred by comparison of optical rotation data of 2-methyloctanoic acid obtained from hydrolyte
of hydrogenated dragonamide A with literature values of other 2-methylalkanoic acids [57,58].
Subsequently, the later total synthesis of dragonamide A has led to a reassignment of the configuration
as S at the stereogenic center of the Moya unit of the molecule [16]. Further, dragonamide B and
dragomabin were isolated with dragonamide A from a Panamanian collection of Lyngbya majuscule
Gomont, while the NMR and optical rotation data for this dragonamide A closely match the 2S
synthetic product, but differ significantly from the 2R synthetic product [45]. Therefore, it was
concluded that dragonamide A, dragonamide B, and dragomabin all contain 2S-methyloct-7-ynoic acid.
The stereochemistry at C-2 of Moya residue in almiramides B and C was investigated by comparison of
commercial standards with obtained natural Moya derivatives using GC-MS, which was determined
to be R configuration [46], surprisingly opposite to the absolute configuration of the Moya unit
in dragonamides.
4.5. Other Special Fragments
Determination of stereochemistry of 5,7-dihydroxy-2,6-dimethyldodec-2-en-11-ynoic acid
(Dddd, f) residue in Palau’amide was a bit complex, due to an inter-converting mixture of rotamers
around these stereocenters of Dddd. With the secured NMR assignments for the two major conformers
of Palau’amidein CDCl3 (C-R1/-R2), subsequent NOE experiments recorded in CDCl3 revealed a
strong correlation between H-40 and H-46 that indicated the erythro configuration of C-38 and C-39.
The Mosher’s analysis of the absolute configuration of C-39 was carried on the α-methoxy phenyl
acetic acid (MPA) derivatives of Palau’amide. Comparison of the ∆δRS values for these derivatives
established the R configuration of C-39 [41]. While the configuration of C-37 could not be rigorously
established by chemical means, analysis of molecular models in conjunction with NOE data suggested
an S-configuration for this chiral center. The double bond configuration of 3-methoxy-2-en-7-octynoic
acid (k) in dragonamide C and that of 2-methyloct-2-en-7-ynoic acid (m) in dragonamide E, were both
assigned as E-geometry by NOE analysis [47,48].
157
Mar. Drugs 2016, 14, 216
5. Conclusions
A number of structurally intriguing peptides containing diverse terminal alkynyl fatty acyl
residues, such as Dhoya, Hmoya, Amoya, Aoy, Moya, etc., have been found in multiple marine
organisms, especially marine mollusk and cyanobacteria. In 1998, a study about the biological origin of
Dhoya-containing cyclic depsipeptide, kulolide-1, by Scheuer and coworkers showed that the marine
mollusk Philinopsis speciosa preyed on the herbivorous sea hare Stylocheilus longicaudus that is well
recognized to possess the predator-prey relationship with cyanobacteria [30]. Interestingly, Scheuer and
coworkers succeeded in isolating kulolide-1 from sea hare Stylocheilus longicaudus, which suggests
that kulolide-1 discovered from P. speciosa is possibly accumulated from its prey Stylocheilus
longicaudus, known to sequester secondary metabolites from its diet of mat-forming cyanobacteria [29].
Thus, similarity among the terminal alkynyl-containing cyclic peptides is suggestive that this intriguing
structure family of metabolites in fact originates in cyanobacteria. Interestingly, all the terminal alkynyl
fatty acyl moieties identified in the linear peptides were solely discovered as the constituents of
metabolites of marine cyanobacteria.
Overall, many of these terminal alkynyl-containing peptides have shown a variety of biological
functions as antitumor, antibacterial and antimalarial activities. Intriguingly, some of them with minor
structural variations have presented different biological effects. For example, viequeamide A was found
to be the most active (IC50 = 60 ± 10 nM) against H460 human lung cancer cell line, whereas the other
viequeamides with quite similar structures were inactive; hantupeptin A exhibited strong cytotoxicity
against the leukemia cell line MOLT-4 with an IC50 value of 32 nM, but trungapeptin A was reported
to be inactive against KB or LoVo cells at 10 µg/mL. Some cases further indicated that the unsaturated
terminal moieties may play an important role in the biological activity, as illustrated by almiramide B
and C possessing strong in vitro antiparasitic activity against L. donovani, whereas almiramide A was
completely inactive.
Another research area to exploit marine peptides as a source of new therapeutics is to harness the
genetic versatility of its biosynthetic gene clusters. Acetylenases, a special family of desaturases that
catalyze O2 -dependent dehydrogenation of C–C bonds, have been considered to be responsible for
formation of terminal alkynes of many natural products [15]. In 2015, Zhu and Zhang et al. reported a
thorough characterization of terminal alkyne biosynthetic enzymes responsible for the synthesis of
jamaicamide A and B (65–66) and carmabins [51,52], which demonstrated the in vitro formation of a
short-chain alkynoic starter unit by a three-gene operon, jamABC, where jamA, jamB and jamC encode a
homolog of fatty acyl-CoA ligase, a membrane-bound fatty acid desaturase and an acyl carrier protein
(ACP), respectively [53]. Therefore, the biosynthetic evidences have further shown that the fatty acyl
starter unit and the extender units could be engineered using jamABC and other modular assembly
lines of PKS/NRPS enzymatic machinery to form the terminal alkyne-containing natural product.
A well-known reaction referred to as the “click reaction” (the triazole forming via azide-alkyne
cyclo addition), has been quite often used in selective imaging and study of azide- or alkyne-labeled
macromolecule interaction. In our opinion, the azide-alkyne click chemistry may serve as a powerful
tool to study the drug mechanism of the terminal alkyne-containing peptides as well as to explore
their structure activity relationship (SAR). Not surprisingly, it is highly expected to see application of
the “click reaction” in combination with the biosynthetically engineered alkynyl-containing peptides
playing a role in drug discovery research in the near future.
Acknowledgments: The authors acknowledge the National Natural Science Fund of China (No. 41476121,
81402844, 81302691, 81373321, 41106127, 81172978, 81072573, and 81001394).
Author Contributions: Bing-Nan Han and Qiu-Ye Chai were responsible for writing the review. Zhen Yang
assisted in providing references and the final editing the manuscript. Hou-Wen Lin and Bing-Nan Han were in
charge of the financial support of this project.
Conflicts of Interest: The authors declare no conflict of interest.
158
Mar. Drugs 2016, 14, 216
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Costa, M.; Costa-Rodrigues, J.; Fernandes, M.H.; Barros, P.; Vasconcelos, V.; Martins, R. Marine cyanobacteria
compounds with anticancer properties: A review on the implication of apoptosis. Mar. Drugs 2012, 10,
2181–2207. [CrossRef] [PubMed]
Cheung, R.C.; Ng, T.B.; Wong, J.H. Marine peptides: Bioactivities and applications. Mar. Drugs 2015, 13,
4006–4043. [CrossRef] [PubMed]
Jo, C.; Khan, F.F.; Khan, M.I.; Iqbal, J. Marine bioactive peptides: Types, structures, and physiological
functions. Food Rev. Int. 2016, 33, 44–61. [CrossRef]
Zheng, L.H.; Wang, Y.J.; Sheng, J.; Wang, F.; Zheng, Y.; Lin, X.K.; Sun, M. Antitumor peptides from marine
organisms. Mar. Drugs 2011, 9, 1840–1859. [CrossRef] [PubMed]
Sipkema, D.; Franssen, M.C.; Osinga, R.; Tramper, J.; Wijffels, R.H. Marine sponges as pharmacy.
Mar. Biotechnol. 2005, 7, 142–162. [CrossRef] [PubMed]
Andavan, G.S.; Lemmens-Gruber, R. Cyclodepsipeptides from marine sponges: Natural agents for drug
research. Mar. Drugs 2010, 8, 810–834. [CrossRef] [PubMed]
Rawat, D.S.; Joshi, M.C.; Joshi, P.; Atheaya, H. Marine peptides and related compounds in clinical trial.
Anti-Cancer Agents Med. Chem. 2006, 6, 33–40. [CrossRef]
Blunt, J.W.; Copp, B.R.; Keyzers, R.A.; Munro, M.H.; Prinsep, M.R. Marine natural products. Nat. Prod. Rep.
2014, 31, 160–258. [CrossRef] [PubMed]
Park, Y.J.; Jeong, J.-K.; Choi, Y.M.; Lee, M.S.; Choi, J.H.; Cho, E.J.; Song, H.; Park, S.J.; Lee, J.-H.; Hong, S.S.
Dolastatin-10 derivative method of producing the same and anticancer drug composition containing the
same. J. Am. Chem. Soc. 1987, 109, 6883–6885.
Luesch, H.; Moore, R.E.; Paul, V.J.; Mooberry, S.L.; Corbett, T.H. Isolation of dolastatin 10 from the marine
cyanobacterium symploca species vp642 and total stereochemistry and biological evaluation of its analogue
symplostatin 1. J. Nat. Prod. 2001, 64, 907–910. [CrossRef] [PubMed]
Rodríguez, J.; Fernández, R.; Quiñoá, E.; Riguera, R.; Debitus, C.; Bouchetj, P. Onchidin: A cytotoxic
depsipeptide with C2 symmetry from a marine mollusc. Tetmhedron Lett. 1994, 35, 9239–9242. [CrossRef]
Sitachitta, N.; Williamson, R.T.; Gerwick, W.H. Yanucamides a and b, two new depsipeptides from an
assemblage of the marine cyanobacteria Lyngbya majuscula and Schizothrix species. J. Nat. Prod. 2000, 63,
197–200. [CrossRef] [PubMed]
Mevers, E.; Liu, W.T.; Engene, N.; Mohimani, H.; Byrum, T.; Pevzner, P.A.; Dorrestein, P.C.; Spadafora, C.;
Gerwick, W.H. Cytotoxic veraguamides, alkynyl bromide-containing cyclic depsipeptides from the marine
cyanobacterium cf. Oscillatoria margaritifera. J. Nat. Prod. 2011, 74, 928–936. [CrossRef] [PubMed]
Sanchez, L.M.; Lopez, D.; Vesely, B.A.; Della Togna, G.; Gerwick, W.H.; Kyle, D.E.; Linington, R.G.
Almiramides a–c: Discovery and development of a new class of leishmaniasis lead compounds. J. Med. Chem.
2010, 53, 4187–4197. [CrossRef] [PubMed]
Minto, R.E.; Blacklock, B.J. Biosynthesis and function of polyacetylenes and allied natural products.
Prog. Lipid Res. 2008, 47, 233–306. [CrossRef] [PubMed]
Yamaguchi, M.; Park, H.-J.; Ishizuka, S.; Omata, K.; Hirama, M. Chemistry and antimicrobial activity of
caryoynencins analogs. J. Med. Chem. 1995, 38, 5015–5022. [CrossRef] [PubMed]
Nagarajan, M.; Maruthanayagam, V.; Sundararaman, M. A review of pharmacological and toxicological
potentials of marine cyanobacterial metabolites. J. Appl. Toxicol. 2012, 32, 153–185. [CrossRef] [PubMed]
Raja, R.; Hemaiswarya, S.; Ganesan, V.; Carvalho, I.S. Recent developments in therapeutic applications of
cyanobacteria. Crit. Rev. Microbiol. 2016, 42, 394–405. [CrossRef] [PubMed]
Chapman, A.D. Numbers of Living Species in Australia and the World; Departmwnt of the Environment:
Canberra, Australia, 2010.
Aneiros, A.; Garateix, A. Bioactive peptides from marine sources: Pharmacological properties and isolation
procedures. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 2004, 803, 41–53. [CrossRef] [PubMed]
Suarez-Jimenez, G.M.; Burgos-Hernandez, A.; Ezquerra-Brauer, J.M. Bioactive peptides and depsipeptides
with anticancer potential: Sources from marine animals. Mar. Drugs 2012, 10, 963–986. [CrossRef] [PubMed]
Luesch, H.; Pangilinan, R.; Yoshida, W.Y.; Moore, R.E.; Paul, V.J. Pitipeptolides a and b, new
cyclodepsipeptides from the marine cyanobacterium Lyngbya majuscula. J. Nat. Prod. 2001, 64, 304–307.
[CrossRef] [PubMed]
159
Mar. Drugs 2016, 14, 216
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
Han, B.; Gross, H.; McPhail, K.L.; Goeger, D.; Maier, C.S.; Gerwick, W.H. Wewakamide a and
guineamide g, cyclic depsipeptides from the marine cyanobacteria Lyngbya semiplena and Lyngbya majuscula.
J. Microbiol. Biotechnol. 2011, 21, 930–936. [CrossRef] [PubMed]
Wan, F.; Erickson, K.L. Georgamide, a new cyclic depsipeptide with an alkynoic acid residue from an
australian cyanobacterium. J. Nat. Prod. 2001, 64, 143–146. [CrossRef] [PubMed]
Liu, W.-T.; Ng, J.; Meluzzi, D.; Bandeira, N.; Gutierrez, M.; Simmons, T.L.; Schultz, A.W.; Linington, R.G.;
Moore, B.S.; Gerwick, W.H.; et al. Interpretation of tandem mass spectra obtained from cyclic nonribosomal
peptides. Anal. Chem. 2009, 81, 4200–4209. [CrossRef] [PubMed]
Montaser, R.; Paul, V.J.; Luesch, H. Pitipeptolides c-f, antimycobacterial cyclodepsipeptides from the marine
cyanobacterium Lyngbya majuscula from guam. Phytochemistry 2011, 72, 2068–2074. [CrossRef] [PubMed]
Gunasekera, S.P.; Owle, C.S.; Montaser, R.; Luesch, H.; Paul, V.J. Malyngamide 3 and cocosamides a and b
from the marine cyanobacterium Lyngbya majuscula from cocos lagoon, guam. J. Nat. Prod. 2011, 74, 871–876.
[CrossRef] [PubMed]
Boudreau, P.D.; Byrum, T.; Liu, W.T.; Dorrestein, P.C.; Gerwick, W.H. Viequeamide a, a cytotoxic member of
the kulolide superfamily of cyclic depsipeptides from a marine button cyanobacterium. J. Nat. Prod. 2012,
75, 1560–1570. [CrossRef] [PubMed]
Reese, M.T.; Gulavita, N.K.; Nakao, Y.; Hamann, M.T.; Yoshida, W.Y.; Coval, S.J.; Scheuer, P.J. Kulolide: A
cytotoxic depsipeptide from a cephalaspidean mollusk, philinopsis speciosa1. J. Am. Chem. Soc. 1996, 118,
11081–11084. [CrossRef]
Nakao, Y.; Yoshida, W.Y.; Szabo, C.M.; Baker, B.J.; Scheuer, P.J. More peptides and other diverse constituents
of the marine mollusk philinopsis speciosa. J. Org. Chem. 1998, 63, 3272–3280. [CrossRef]
Han, B.; Goeger, D.; Maier, C.S.; Gerwick, W.H. The wewakpeptins, cyclic depsipeptides from a papua
new guinea collection of the marine cyanobacterium Lyngbya semiplena. J. Org. Chem. 2004, 70, 3133–3139.
[CrossRef] [PubMed]
Horgen, F.D.; Yoshida, W.Y.; Scheuer, P.J. Malevamides a–c, new depsipeptides from the marine
cyanobacterium symploca laete-viridis. J. Nat. Prod. 2000, 63, 461–467. [CrossRef] [PubMed]
Tan, L.T.; Sitachitta, N.; Gerwick, W.H. The guineamides, novel cyclic depsipeptides from a papua new
guinea collection of the marine cyanobacterium Lyngbya majuscula. J. Nat. Prod. 2002, 66, 764–771. [CrossRef]
[PubMed]
Williams, P.G.; Yoshida, W.Y.; Quon, M.K.; Moore, R.E.; Paul, V.J. Ulongapeptin, a cytotoxic cyclic
depsipeptide from a palauan marine cyanobacterium Lyngbya sp. J. Nat. Prod. 2003, 66, 651–654. [CrossRef]
[PubMed]
Vining, O.B.; Medina, R.A.; Mitchell, E.A.; Videau, P.; Li, D.; Serrill, J.D.; Kelly, J.X.; Gerwick, W.H.;
Proteau, P.J.; Ishmael, J.E.; et al. Depsipeptide companeramides from a panamanian marine cyanobacterium
associated with the coibamide producer. J. Nat. Prod. 2015, 78, 413–420. [CrossRef] [PubMed]
Fernández, R.; Rodríguez, J.; Quiñoá, E.; Riguera, R.; Muñoz, L.; Fernández-Suárez, M.; Debitus, C.
Onchidin b: A new cyclodepsipeptide from the mollusc Onchidium sp. J. Am. Chem. Soc. 1996, 118,
11635–11643. [CrossRef]
Nogle, L.M.; Gerwick, W.H. Isolation of four new cyclic depsipeptides, antanapeptins a–d, and dolastatin 16
from a madagascan collection of Lyngbya majuscula. J. Nat. Prod. 2001, 65, 21–24. [CrossRef]
Bunyajetpong, S.; Yoshida, W.Y.; Sitachitta, N.; Kaya, K. Trungapeptins A-C, cyclodepsipeptides from the
marine cyanobacterium Lyngbya majuscula. J. Nat. Prod. 2006, 69, 1539–1542. [CrossRef] [PubMed]
Tripathi, A.; Puddic, J.; Prinsep, M.R.; Lee, P.P.F.; Tan, L.T. Hantupeptin a, a cytotoxic cyclic depsipeptide
from a singapore collection of Lyngbya majuscula. J. Nat. Prod. 2009, 72, 29–32. [CrossRef] [PubMed]
Salvador, L.A.; Biggs, J.S.; Paul, V.J.; Luesch, H. Veraguamides a–g, cyclic hexadepsipeptides from a dolastatin
16-producing cyanobacterium symploca cf. Hydnoides from guam. J. Nat. Prod. 2011, 74, 917–927. [CrossRef]
[PubMed]
Williams, P.G.; Yoshida, W.Y.; Quon, M.K.; Moore, R.E.; Paul, V.J. The structure of palau’amide, a potent
cytotoxin from a species of the marine cyanobacterium Lyngbya. J. Nat. Prod. 2003, 66, 1545–1549. [CrossRef]
[PubMed]
Pettit, G.R. Isolation and Stuctural Elucidation of the Cytostatic Linear and Cyclo-Depsipeptides
Dolastatin 16, Dolastatin 17, and Dolastatin 18. U.S. Patent 6,239,104 B1, 29 May 2001.
160
Mar. Drugs 2016, 14, 216
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
Luesch, H.; Yoshida, W.Y.; Moore, R.E.; Paul, V.J. Apramides a–g, novel lipopeptides from the marine
cyanobacterium Lyngbya majuscula. J. Nat. Prod. 2000, 63, 1106–1112. [CrossRef] [PubMed]
Jiménez, J.I.; Scheuer, P.J. New lipopeptides from the caribbean cyanobacterium Lyngbya majuscula.
J. Nat. Prod. 2001, 64, 200–203. [CrossRef] [PubMed]
McPhail, K.L.; Correa, J.; Linington, R.G.; González, J.; Ortega-Barría, E.; Capson, T.L.; Gerwick, W.H.
Antimalarial linear lipopeptides from a panamanian strain of the marine cyanobacterium Lyngbya majuscula.
J. Nat. Prod. 2007, 70, 984–988. [CrossRef] [PubMed]
Balunas, M.J.; Linington, R.G.; Tidgewell, K.; Fenner, A.M.; Ureña, L.-D.; Togna, G.D.; Kyle, D.E.;
Gerwick, W.H. Dragonamide e, a modified linear lipopeptide from Lyngbya majuscula with antileishmanial
activity. J. Nat. Prod. 2010, 73, 60–66. [CrossRef] [PubMed]
Gunasekera, S.P.; Ross, C.; Paul, V.J.; Matthew, S.; Luesch, H. Dragonamides c and d, linear lipopeptides from
the marine cyanobacterium brown Lyngbya polychroa. J. Nat. Prod. 2008, 71, 887–890. [CrossRef] [PubMed]
Quintana, J.; Bayona, L.M.; Castellanos, L.; Puyana, M.; Camargo, P.; Aristizabal, F.; Edwards, C.;
Tabudravu, J.N.; Jaspars, M.; Ramos, F.A. Almiramide d, cytotoxic peptide from the marine cyanobacterium
oscillatoria nigroviridis. Bioorg. Med. Chem. 2014, 22, 6789–6795. [CrossRef] [PubMed]
Simmons, T.L.; Engene, N.; Ureña, L.D.; Romero, L.I.; Ortega-Barría, E.; Gerwick, L.; Gerwick, W.H.
Viridamides a and b, lipodepsipeptides with antiprotozoal activity from the marine cyanobacterium
oscillatoria nigro-wiridis. J. Nat. Prod. 2008, 71, 1544–1550. [CrossRef] [PubMed]
Hooper, G.J.; Orjala, J.; Schatzman, R.C.; Gerwick, W.H. Carmabins a and b, new lipopeptides from the
caribbean cyanobacterium Lyngbya majuscula. J. Nat. Prod. 1998, 61, 529–533. [CrossRef] [PubMed]
Edwards, D.J.; Marquez, B.L.; Nogle, L.M.; McPhail, K.; Goeger, D.E.; Roberts, M.A.; Gerwick, W.H.
Structure and biosynthesis of the jamaicamides, new mixed polyketide-peptide neurotoxins from the
marine cyanobacterium Lyngbya majuscula. Chem. Biol. 2004, 11, 817–833. [CrossRef] [PubMed]
Jones, A.C.; Monroe, E.A.; Podell, S.; Hess, W.R.; Klages, S.; Esquenazi, E.; Niessen, S.; Hoover, H.;
Rothmann, M.; Lasken, R.S.; et al. Genomic insights into the physiology and ecology of the marine
filamentous cyanobacterium Lyngbya majuscula. Proc. Natl. Acad. Sci. USA 2011, 108, 8815–8820. [CrossRef]
[PubMed]
Zhu, X.; Liu, J.; Zhang, W. De novo biosynthesis of terminal alkyne-labeled natural products. Nat. Chem. Boil.
2015, 11, 115–120. [CrossRef] [PubMed]
Cruz-Rivera, E.; Paul, V.J. Chemical deterrence of a cyanobacterial metabolite against generalized and
specialized grazers. J. Chem. Ecol. 2007, 33, 213–217. [CrossRef] [PubMed]
Xu, Z.; Peng, Y.; Ye, T. The total synthesis and stereochemical revision of yanucamide a. Org. Lett. 2003, 5,
2821–2824. [CrossRef] [PubMed]
Vorde, C.; Hogberg, H.-E.; Hedenström, E. Resolution of 2-methylalkanoic esters: Enantioselective aminolysis
by (R)-l-phenylethylamine of ethyl 2-methyloctanoate catalysed by lipase B from Candida antarctica.
Tetrahedron Asymmetry 1996, 7, 1507–1513. [CrossRef]
Engel, K.-H. Lipase-catalyzed enantioselective esterification of 2-methylalkanoic acids. Tetrahedron Asymmetry
1991, 2, 165–168. [CrossRef]
Berglund, P.; Holmquist, M.; Hedenstrom, E.; Hult, K.; Hiigberg, H.-E. 2-Methylalkanoic acids resolved
by esterification catalysed by lipase from candida rugosa: Alcohol chain length and enantioselectivity.
Tetrahedron Asymmetry 1993, 4, 1869–1878. [CrossRef]
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
161
marine drugs
Article
Anti-Fatigue Effect by Peptide Fraction from
Protein Hydrolysate of Croceine Croaker
(Pseudosciaena crocea) Swim Bladder through
Inhibiting the Oxidative Reactions including
DNA Damage
Yu-Qin Zhao, Li Zeng, Zui-Su Yang, Fang-Fang Huang, Guo-Fang Ding * and Bin Wang *
Zhejiang Provincial Engineering Technology Research Center of Marine Biomedical Products,
School of Food and Pharmacy, Zhejiang Ocean University, 1st Haidanan Road, Changzhi Island, Lincheng,
Zhoushan 316022, China; zhaoy@hotmail.com (Y.-Q.Z.); 9001000@163.com (L.Z.); yangzs87@163.com (Z.-S.Y.);
gracegang@126.com (F.-F.H.)
* Correspondence: dinggf2007@163.com (G.-F.D.); wangbin4159@hotmail.com (B.W.);
Tel.: +86-580-229-9809 (G.-F.D.); +86-580-255-5085 (B.W.);
Fax: +86-580-229-9809 (G.-F.D.); +86-580-255-4781 (B.W.)
Academic Editor: Se-Kwon Kim
Received: 17 September 2016; Accepted: 24 November 2016; Published: 13 December 2016
Abstract: The swim bladder of the croceine croaker (Pseudosciaena crocea) was believed to have
good curative effects in various diseases, including amnesia, insomnia, dizziness, anepithymia,
and weakness after giving birth, in traditional Chinese medicine. However, there is no research
focusing on the antioxidant and anti-fatigue peptides from croceine croaker swim bladders at present.
Therefore, the purpose of this study was to investigate the bioactivities of peptide fractions
from the protein hydrolysate of croceine croaker related to antioxidant and anti-fatigue effects.
In the study, swim bladder peptide fraction (SBP-III-3) was isolated from the protein hydrolysate
of the croceine croaker, and its antioxidant and anti-fatigue activities were measured using
in vitro and in vivo methods. The results indicated that SBP-III-3 exhibited good scavenging
activities on hydroxyl radicals (HO•) (EC50 (the concentration where a sample caused a 50%
decrease of the initial concentration of HO•) = 0.867 mg/mL), 2,2-diphenyl-1-picrylhydrazyl
radicals (DPPH•) (EC50 = 0.895 mg/mL), superoxide anion radical (O2− •) (EC50 = 0.871 mg/mL),
and 2,2′ -azino-bis-3-ethylbenzothiazoline-6-sulfonic acid radical (ABTS+ •) (EC50 = 0.346 mg/mL).
SBP-III-3 also showed protective effects on DNA damage in a concentration-effect manner and
prolonged the swimming time to exhaustion of Institute of Cancer Research (ICR) mice by
57.9%–107.5% greater than that of the control. SBP-III-3 could increase the levels of muscle glucose
(9.4%–115.2% increase) and liver glycogen (35.7%–157.3%), and decrease the levels of blood urea
nitrogen (BUN), lactic acid (LA), and malondialdehyde (MDA) by 16.4%–22.4%, 13.9%–20.1%,
and 28.0%–53.6%, respectively. SBP-III-3 also enhanced the activity of lactic dehydrogenase to
scavenge excessive LA for slowing the development of fatigue. In addition, SBP-III-3 increased the
activities superoxide dismutase, catalase, and glutathione peroxidase to reduce the reactive oxygen
species (ROS) damage in mice. In conclusion, SBP-III-3 possessed good anti-fatigue capacities on
mice by inhibiting the oxidative reactions and provided an important basis for developing the swim
bladder peptide functional food.
Keywords: croceine croaker (Pseudosciaena crocea); swim bladder; peptide; antioxidant activity;
anti-fatigue activity
Mar. Drugs 2016, 14, 221
162
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2016, 14, 221
1. Introduction
Fatigue is one of the most common and disabling non-motor problems, which generally leads to
negative effects on physical and cognitive function. Therefore, fatigue is best defined as the difficulty
in initiating or sustaining voluntary activities, and classified into mental and physical fatigue [1].
Exercise-induced fatigue usually associates with increased stress levels caused by modern lifestyles,
along with a decline in exercise performance [2]. At present, several theories including “exhaustion
theory” and “radical theory” have been put forward to explain the mechanisms of exercise-induced
fatigue [1]. Among them, the “exhaustion theory” speculates that energy sources, including glucose
and liver glycogen, will be exhausted during exercise, which is accompanied by physical fatigue. In this
theory, some studies indicated that post-exercise nutrition through the administration of proteins,
saccharides, and amino acids can eliminate the accumulated harmful metabolites, repair the damage
of organisms, and facilitate recovery from fatigue [3]. Compared with these nutrient substances,
protein hydrolysates and peptides have been widely studied due to their potential health benefits
associated with high bioactivities, low molecular weight (MW), easy absorption, and less toxicity [4,5].
Ding et al. reported that jellyfish collagen hydrolysate could promote climbing endurance and had
anti-fatigue effects in rats [2]. Wang et al. reported that the spleen-derived peptide CMS001 had
anti-fatigue effects in mice. Therefore, bioactive protein hydrolysates and peptides are believed to be
helpful for counteracting and ameliorating physical fatigue [6].
Except for exhaustion of energy sources, high-intensity exercise often destroys the balance
between the oxidation system and anti-oxidation system of human body. The accumulated reactive
oxygen species (ROS) will put the body in a state of oxidative stress and bring injury to the body
by attacking biomacromolecules and cell organs [6,7]. Some reports found that exogenous dietary
antioxidants can decrease the contribution of exercise-induced oxidative stress and improve the
animal’s physiological condition [5]. You et al. reported that loach peptide could scavenge hydroxyl
radical (HO•) and, 2,2-diphenyl-1-picrylhydrazyl radical (DPPH•) in vitro and increase the activities
of superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-Px) in vivo [1].
Wei et al. reported that high Fischer ratio oligopeptides derived from food sources such as corn, tuna,
and pinctada martensii, could scavenge free radicals in vitro and increase the activities of SOD, CAT,
and GSH-Px in vivo [8]. In addition, high Fischer ratio oligopeptides could prolong the swimming
time, increase liver glucogen contents, and lower blood urea nitrogen (BUN) and lactic acid (LA) levels
of exercised mice. However, the anti-fatigue and anti-oxidation mechanisms of protein hydrolysates
and peptides have not been fully elucidated. Therefore, more detailed research should be done seeking
more high-efficiency antioxidant peptides used in the daily diet to reduce oxidative damage and fight
against fatigue.
At present, large quantities of byproducts, accounting for 50%–70% of the original raw material,
are generated during the aquatic products processing, and optimal use of these byproducts are
an effective approach to protect the environment and produce value-added products to increase
the revenue of fish processors [9]. Therefore, preparation of protein hydrolysates and peptides
from fish byproducts are extensively researched [5,10]. Proteins in food resources possess a variety
of active peptide sequences, and enzymatic hydrolysis is thought as an effective method to
release those active fragments without destroying their nutritional value and adding hazardous
substances, including residual organic solvents and toxic chemicals in the final products [4,5].
HO• attacks almost every molecule in living cells and is demonstrated to be a highly damaging
species in free radical pathology. Thus, the removal of HO• is probably one of the most
effective defenses against various diseases for a living body [10]. In our previous research,
three antioxidant peptides including Tyr–Leu–Ser–Met–Ser–Arg (YLSMSR), Val–Leu–Tyr–Glu–Glu
(VLYEE), and Met–Ile–Leu–Met–Arg (MILMR) were isolated from proteins hydrolysate of croceine
croaker (Pseudosciaena crocea) muscle and showed strong DPPH•, HO•, superoxide anion radical
(O2− •), and 2,2′ -azino-bis-3-ethylbenzothiazoline-6-sulfonic acid radical (ABTS+ •) scavenging
activities [11]. Acid and pepsin-soluble collagens from croceine croaker scales were prepared and
163
Mar. Drugs 2016, 14, 221
characterized [12], and antioxidant peptides including Gly–Phe–Arg–Gly–Thr–Ile–Gly–Leu–Val–Gly
(GFRGTIGLVG), Gly–Pro–Ala–Gly–Pro–Ala–Gly (GPAGPAG), and Gly–Phe–Pro–Ser–Gly (GFPSG)
from the acid-soluble collagen showed strong DPPH•, HO•, ABTS+ •, and O2− • scavenging
activities [13]. Traditional Chinese medicine considers that swim bladder of the croceine croaker to
have good curative effects in various diseases, including amnesia, insomnia, dizzy, anepithymia,
and weakness after giving a birth, and present researchers also suggest that it could serve to
remove free radicals and ward against inflammation and cancer [14]. However, there was no
research focusing on the antioxidant and anti-fatigue peptides from croceine croaker swim bladders.
Therefore, the objectives of the present study were to prepare the active peptide fraction from croceine
croaker swim bladders, and its bioactivities related to antioxidant and anti-fatigue effects of prepared
fraction were also evaluated.
2. Results and Discussion
2.1. Preparation of Protein Hydrolysates of Swim Bladder and Their HO• Scavenging Activities
In the experiment, four proteases, including alcalase, papain, pepsin, and trypsin were used to
hydrolyze the proteins of croceine croaker swim bladders, respectively. The degree of hydrolysis (DH)
and the HO• scavenging activities were used to screen the most suitable enzymes for subsequent
experiments, and HO• scavenging activities was expressed as EC50 (the concentration where a
sample caused a 50% decrease of the initial concentration of HO•) (Table 1). The DH (%) of alcalase
hydrolysate was 22.32% ± 0.74%, which was significantly higher than those of papain hydrolysate
(17.84% ± 0.71%), pepsin hydrolysate (19.52% ± 0.49%), trypsin hydrolysate (16.21% ± 0.37%),
and neutrase hydrolysate (21.37% ± 0.67%) (p < 0.05). The EC50 value of alcalase hydrolysate
was 8.85 mg/mL, which was significantly lower than those of papain hydrolysate (11.76 mg/mL),
pepsin hydrolysate (13.68 mg/mL), and trypsin hydrolysate (10.02 mg/mL) (p < 0.05). The result was
in accordance with the previous reports that high DH and low MW of hydrolysates made a great
contribute to their antioxidant activities including HO• scavenging activity [15,16]. Proteases digest
long protein chains into shorter fragments by splitting the peptide bonds that link amino acid residues.
Due to the specificity of enzymes reactions, protein hydrolysates from the same proteins hydrolyzed
using different proteases exhibit different DH and bioactivities because the obtained peptides are
diverse in terms of chain length and amino acid sequence [5]. Therefore, alcalase hydrolysate
(designated as SBP) was selected for further study.
Table 1. HO• scavenging activities of protein hydrolysate of scalloped hammerhead cartilage using
different proteases (c = 15 mg protein/mL). All of the values were mean ± standard deviation (SD) (n = 3).
Protease
Papain
Alcalase
Trypsin
Pepsin
Neutrase
a–d
Enzymolysis Condition
pH 7.0, 60 ◦ C, 4 h,
total enzyme dose 2.5%
pH 8.0, 50 ◦ C, 4 h,
total enzyme dose 2.5%
pH 8.0, 40 ◦ C, 4 h,
total enzyme dose 2.5%
pH 2.0, 37 ◦ C, 4 h,
total enzyme dose 2.5%
pH 6.0, 50 ◦ C, 4 h,
total enzyme dose 2.5%
Degree of Hydrolysis (DH%)
HO• Scavenging Rate (%)
a
34.85 ± 1.05 a
22.32 ± 0.74 b
54.76 ± 1.94 b
16.21 ± 0.37 c
62.38 ± 1.67 c
19.52 ± 0.49 d
55.47 ± 2.02 b
21.37 ± 0.67 b
50.67 ± 1.85 d
17.84 ± 0.71
Values with different letters indicated significant differences at the same concentration (p < 0.05).
164
Mar. Drugs 2016, 14, 221
2.2. Preparation of Antioxidant Peptides from SBP
2.2.1. Fractionation of SBP by Ultrafiltration
Protein hydrolysate is composed of peptides with different molecular sizes and free amino acids,
and their bioactivities are influenced by the molecular size of peptides. Therefore, ultrafiltration is a
popular method for fractionation and enrichment concentration of peptides with specific molecular
sizes from hydrolysates [17]. To obtain purified swim bladder peptide, SBP was fractionated by
ultrafiltration with three molecular weight (MW) cut-off membranes of 10, 5, and 3 kDa in turn,
respectively, and the resulting four fractions were prepared and named as SBP-I (MW < 3 kDa),
SBP-II (3 kDa < MW < 5 kDa), SBP-III (5 kDa < MW < 10 kDa)„ and SBP-IV (MW > 10 kDa), respectively.
The yields of SBP-I, SBP-II, SBP-III, and SBP-IV were 10.08, 17.30, 23.37, and 28.97 mg protein/g swim
bladder, respectively.
For acquiring the fraction with high antioxidant activity, HO• scavenging activities of four
prepared fractions were measured, and the results indicated that HO• scavenging activities of
SBP, SBP-I, SBP-II, SBP-III, and SBP-IV were 50.32% ± 0.90%, 34.89% ± 2.01%, 40.63% ± 1.59%,
58.36% ± 1.72%, and 52.57% ± 2.20%, respectively, at the concentration of 5 mg/mL. SBP-III showed
significantly higher antioxidant activity than SBP and the other three fractions at the tested
concentrations (p < 0.05). In addition, the EC50 of SBP-III was 3.579 mg/mL and significantly less
than that of SBP (8.85 mg/mL). The result was in line with the previous report that that samples with
lower average molecular weights possibly contained more substrates, which were electron donors and
could react with free radicals to convert them to more stable products and terminate the radical chain
reactions [9]. From the data, it could be concluded that SBP-III contained more effective antioxidant
peptides and could be chosen for subsequent separation.
2.2.2. Gel Filtration Chromatography of SBP-III
Gel filtration chromatography is an effective separation technique on the basis of molecule size
and widely applied to separate components in a mixture [10]. As shown in Figure 1, SBP-III was
separated into four subfractions (SBP-III-1 to SBP-III-4) using a Sephadex G-25 column. From the
linear equation (Log MW = −0.2036Rt + 7.6164, R2 = 0.9766), the MWs of four subfractions were
9.48 kDa (SBP-III-1), 7.74 kDa (SBP-III-2), 6.78 kDa (SBP-III-3), and 5.79 kDa (SBP-III-4), respectively.
HO• scavenging activities of SBP-III-3 was 58.53% ± 2.17% at the concentration of 1 mg/mL, which was
significantly higher than those of SBP-III-1 (21.15% ± 1.03%), SBP-III-2 (42.67% ± 1.94%), and SBP-III-4
(33.27% ± 2.11%), respectively (p < 0.05). The data indicated that SBP-III-3 could effectively restrain the
production of HO• and terminate the radical chain reaction. Pan et al. reported that the hydrolysate
subfraction from the skate (Raja porosa) cartilage protein using a Sephadex G-15 column had higher
radical scavenging activity than other subfractions with smaller molecular size [10]. These results
indicated that some factors, including amino acid composition and sequence, may also influence the
activities of peptides in addition to the MW. Therefore, SBP-III-3 was chosen for further evaluation on
in vitro antioxidant activity and the in vivo anti-fatigue effect.
2.3. In Vitro Antioxidant Activity of SBP-III-3
2.3.1. HO• Scavenging Activity
HO• is a highly reactive radical to the organism because it can destroy virtually all types
of macromolecules including carbohydrates, nucleic acids (mutations), lipids (lipid peroxidation),
and amino acids (e.g., conversion of Phe to m-Tyrosine and o-Tyrosine). As shown in Figure 2A,
the HO• scavenging rate of SBP-III-3 showed a dose-response relationship, and the EC50 of SBP-III-3
was 0.867 mg/mL, which was lower than those of Pro–Ser–Tyr–Val (PSYV) (2.64 mg/mL) [18],
Pro–Ser–Lys–Tyr–Glu–Pro–Phe–Val (PSKYEPFV) (2.86 mg/mL) [19], Pro–Tyr–Ser–Phe–Lys (PYSFK)
(2.283 mg/mL), Gly–Phe–Gly–Pro–Leu (GFGPL) (1.612 mg/mL), Val–Gly–Gly–Arg–Pro (VGGRP)
165
Mar. Drugs 2016, 14, 221
(2.055 mg/mL) [20], Phe–Ile–Met–Gly–Pro–Tyr (FIMGPY) (3.037 mg/mL), Gly–Pro–Ala–Gly–Asp–Tyr
(GPAGDY) (3.92 mg/mL), and Ile–Val–Ala–Gly–Pro–Gln (IVAGPQ) (5.03 mg/mL) [10] from protein
hydrolysates of weatherfish loach muscle, grass carp muscle and skin, and skate cartilages.
SBP-III-3 showed good HO• scavenging activity, which demonstrated that it could serve as a scavenger
for reducing the damage induced by HO• in biological systems.
Figure 1. (A) Gel filtration chromatography of SBP-III on a Sephadex G-25 column; and (B) HO•
scavenging activities of subfractions from SBP-III. All of the values were mean ± SD (n = 3).
a–d Columnwise values with the same superscripts of this type indicated no significant difference
(p > 0.05).
Figure 2. HO• (A), DPPH• (B), O2− • (C), and ABTS+ • (D) scavenging activities of SBP-III-3. All of the
values were mean ± SD (n = 3).
166
Mar. Drugs 2016, 14, 221
2.3.2. DPPH• Scavenging Activity
DPPH• scavenging assay is popular and efficient in predicting the antioxidant activities of protein
hydrolysates and peptides. It has a deep violet colour in solution and generates a strong absorption
band at about 517 nm. The solution becomes colourless or pale yellow following the reduction of the
absorption value at 517 nm when the radicals are neutralized [21]. Therefore, DPPH• scavenging
activity of SBP-III-3 was measured and shown in Figure 2B. SBP-III-3 scavenged DPPH• in
a concentration-effect manner with EC50 of 0.895 mg/mL, but its activity was lower than the
positive control of ascorbic acid. In addition, the EC50 of SBP-III-3 was lower than those of
PSYV (17.0 mg/mL) [18], Phe–Leu–Asn–Glu–Phe–Leu–His–Val (FLNEFLHV) (4.950 mg/mL) [22],
Thr–Thr–Ala–Asn–Ile–Glu–Asp–Arg–Arg (TTANIEDRR) (2.503 mg/mL) [23], FIMGPY (2.60 mg/mL),
GPAGDY (3.48 mg/mL) and IVAGPQ (3.93 mg/mL) [10], PYSFK (1.575 mg/mL) [20],
and Leu–Leu–Pro–Phe (LLPF) (1.084 mg/mL) [24] from hydrolysates of loach, blue mussel,
bluefin leatherjacket, salmon pectoral fin, skate cartilage, grass carp skin, and corn gluten meal, but it
was higher than those of Gly–Ser–Gln (GSQ) (0.61 mg/mL) [25], Pro–Ile–Ile–Val–Tyr–Trp–Lys (PIIVYWK)
(0.713 mg/mL) [20], His–Phe–Gly–Asp–Pro–Phe–His (HFGBPFH) (0.20 mg/mL) [26], Phe–Leu–Pro–Phe
(FLPF) (0.789 mg/mL), and Leu–Pro–Phe (LPF) (0.777 mg/mL) [24] from protein hydrolysates of
Chinese leek, blue mussel, grass carp skin, mussel sauce and corn gluten meal. Therefore, these results
indicated that SBP-III-3 had the strong ability to donate an electron or hydrogen radical for inhibiting the
DPPH• reaction.
2.3.3. O2− • Scavenging Activity
O2− • can promote oxidative reaction to generate H2 O2 and HO• to damage the biomacromolecule
because it can release protein-bound metals and form perhydroxyl radicals which initiate lipid
oxidation. The O2− • scavenging activity of SBP-III-3 was increased with increasing concentration
ranged from 0.5 mg/mL to 5.0 mg/mL (Figure 2C). The IC50 value of SBP-III-3 was 0.871
mg/mL, which was lower than those of MILMR (0.993 mg/mL) [11], FIMGPY (1.61 mg/mL),
GPAGDY (1.66 mg/mL), and IVAGPQ (1.82 mg/mL) [10] from protein hydrolysates of croceine
croaker muscle and skate cartilage. Therefore, SBP-III-3 might have ability to remove O2− • damage in
biological systems.
2.3.4. ABTS+ • Scavenging Activity
The blue/green ABTS+ • produced by oxidation of ABTS with K2 S2 O8 has an absorption
maximum of 734 nm and can be converted back to its colorless neutral form by antioxidants
following the decrease of the absorption. As shown in Figure 2D, SBP-III-3 showed strong
ABTS+ • scavenging activity in a dose-effect manner with EC50 value of 0.346 mg/mL, which was
lower than those of FLNEFLHV (1.548 mg/mL) [22], FLPF (1.497 mg/mL), LPF (1.013 mg/mL),
LLPF (1.031 mg/mL) [24], FIMGPY (1.04 mg/mL), GPAGDY (0.77 mg/mL), and IVAGPQ (1.29
mg/mL) [10], VGGRP (0.465 mg/mL) [20], Trp–Glu–Gly–Pro–Lys (WEGPK) (5.407 mg/mL),
Gly–Pro–Pro (GPP) (2.472 mg/mL), and Gly–Val–Pro–Leu–Thr (GVPLT) (3.124 mg/mL) [17] from
protein hydrolysates of salmon, corn gluten meal, skate cartilage, grass carp skin, and bluefin
leatherjacket heads. These results indicated that SBP-III-3 could convert ABTS+ • to its colorless
neutral form and block the free radical reaction.
2.3.5. Protective Activity against Free Radical-Induced DNA Damage
In the organism, the excessive production of ROS may cause a quantity of degenerative processes
such as cancer, premature aging, and cardiovascular and neurodegenerative diseases, while DNA
damage is a key step in these ROS-induced effects [13,27]. Therefore, the protective activity of SBP-III-3
against oxidative damage of DNA induced by H2 O2 was also evaluated and showed in Figure 3.
The damage of plasmid DNA results in a cleavage of one of the phosphodiester chains and produces a
167
Mar. Drugs 2016, 14, 221
relaxed open circular form. Further cleavage near the first breakage leads to linear double stranded
DNA molecules. The formation of circular form of DNA is indicative of single-strand breaks and
the formation of linear form of DNA is indicative of double-strand breaks [28]. The plasmid DNA
(pBR322DNA) was mainly of the supercoiled form in the absence of FeSO4 and H2 O2 (Figure 3, lane 1,
control). HO• would be generated from iron-mediated decomposition of H2 O2 when FeSO4 and
H2 O2 were added into the sample, and it subsequently broke the supercoiled DNA and converted the
supercoiled form into the open circular form (Figure 3, lane 5). In the experiment, the linear form of
DNA was not observed, which indicated that the generated HO• from iron-mediated decomposition
of H2 O2 might be too small and could not break the double-strand of DNA. As shown in Figure 3
(lanes 2, 3, and 4), the contents of supercoiled form of DNA was obvious higher than that of Figure 3
(lane 5). In addition, the contents of supercoiled form of DNA in Figure 3 (lane 2) were higher than that
of Figure 3 (lane 4). These data indicated that both SBP-III-3 and the positive control of ascorbic acid
could have protective effects on DNA damage in a concentration-effect manner. Therefore, SBP-III-3
could prevent the reaction of Fe2+ with H2 O2 and directly scavenge HO• by donating a hydrogen
atom or electron and, therefore, protecting the supercoiled plasmid DNA from HO• dependent strand
breaks. This finding was in line with the result that SBP-III-3 could effectively scavenge HO• in HO•
scavenging assay in vitro.
ȱ
Figure 3. DNA damage protective effect of SBP-III-3. Lane 1, the native pBR322DNA; lanes 2, the
DNA treated with FeSO4 , H2 O2 and SBP-III-3 (3.0 mg/mL); lane 3, the DNA treated with FeSO4 , H2 O2 ,
and ascorbic acid (1.0 mg/mL); lane 4, the DNA treated with FeSO4 , H2 O2 , and SBP-III-3 (1.0 mg/mL);
lane 5, the pBR322DNA treated with FeSO4 and H2 O2 .
2.4. In Vivo Anti-Fatigue Effects of SBP-III-3
2.4.1. SBP-III-3 Prolonged Exhaustive Swimming Time
Exercise tolerance assay is the most direct and objective indicators of reflecting physical fatigue.
Swimming to exhaustion is an experimental exercise model to evaluate anti-fatigue; it works well for
evaluating the endurance capacity of mice, and gives a high reproducibility [29]. The improvement
of exercise endurance was the most powerful representation of anti-fatigue effect. In the experiment,
the anti-fatigue effect of SBP-III-3 was investigated through the weight-loaded swimming test, and the
length of the swimming time to exhaustion indicated the degree of fatigue. As shown in Figure 4, the
mean exhaustion time of the SBP-III-3-HG was 33.41 ± 2.40 min (107.5% greater than that of NCG);
the mean exhaustion time of the SBP-III-3-MG was 28.86 ± 1.01 min (79.2% greater than that of NCG);
and the mean exhaustion time of the SBP-III-3-LG was 25.43 ± 1.91 min (57.9% greater than that of
NCG) (p < 0.05 or p < 0.01). Therefore, the average loaded swimming time of mice was significantly
longer in the SBP-III-3 treatment group (SBP-III-3-LG, SBP-III-3-MG, SBP-III-3-HG) than that of the
normal control group (NCG) (16.1 ± 1.46 min) (p < 0.05 or p < 0.01), and these results indicate that
SBP-III-3 has significant effects on movement and endurance in mice, thereby postponing the fatigue.
168
Mar. Drugs 2016, 14, 221
Figure 4. Effects of SBP-III-3 on loaded swimming time of mice. All the values were mean ± SD
(n = 12). * p < 0.05, ** p < 0.01 compared with NCG.
2.4.2. Biologic Parameters Determination
SBP-III-3 Decreased Blood Urea Nitrogen (BUN)
Urea is formed in the liver as the end product of protein metabolism. During digestion, protein is
broken down into small peptides and amino acids. The amino acid nitrogen is removed as NHt4, while
the rest of the molecule is used to produce energy or other substances needed by the cell [30]. Thus,
BUN is the metabolic outcome of amino acids and protein, and is one of the sensitive parameters
related to fatigue. Therefore, it is usually applied to evaluate the tolerance capability when an animal
suffers from a weight load. In other words, the less an animal is adapted to exercise, the more the
BUN level increases [1]. As shown in Table 2, the BUN levels of the mice were significantly lower by
16.38%, 16.59%, and 22.06% in the SBP-III-3-LH, SBP-III-3-MG and SBP-III-3-HG compared to the NCG
(p < 0.05 or p < 0.01), respectively. It was clear that SBP-III-3 treatment weakened the increase in BUN
levels induced by catabolism of amino acids and proteins, which indicated that SBP-III-3 could reduce
decomposition of proteins for energy, enhance adaptive capacity to physical load, and eventually
improve tolerance capacity. The reduced protein metabolism of SBP-III-3 treatment groups is indicative
of enhanced endurance.
Table 2. Effects of SBP-III-3 on BUN, LA, LDH, liver glycogen, muscle glycogen, SOD, GSH-Px, CAT,
and MDA in mice (n = 3).
BUN (mmol/L)
LA (mmol/L)
LDH (U/gprot)
Liver glycogen (mg/g)
Muscle glycogen (mg/g)
SOD (U/mg prot)
GSH-Px (IU)
CAT (U/g prot)
MDA in liver (mmol/L)
MDA in plasma (mmol/L)
NCG
SBP-III-3-LG
SBP-III-3-MG
SBP-III-3-HG
9.34 ± 0.39
3.08 ± 0.21
2784.95 ± 322.92
8.32 ± 0.47
2.23 ± 0.56
68.82 ± 6.17
43.22 ± 4.09
186.14 ± 2.26
2.39 ± 0.55
19.92 ± 2.87
7.81 ± 0.61 **
2.65 ± 0.47 *
3397.10 ± 215.90
11.29 ± 2.31 *
2.44 ± 0.36
71.74 ± 2.52
71.89 ± 2.34
325.27 ± 1.52 *
1.72 ± 0.25 **
11.75 ± 2.62 **
7.79 ± 0.47 **
2.56 ± 0.35 *
3605.87 ± 315.21 *
17.36 ± 1.16 **
3.39 ± 0.35 *
79.63 ± 7.40 *
102.05 ± 5.78 **
349.75 ± 4.09 *
1.23 ± 0.31 **,a
9.97 ± 1.31 **
7.28 ± 0.43 **,a
2.46 ± 0.34 *
3690.76 ± 337.18 *
21.41 ± 5.23 **,b
4.80 ± 1.12 *
99.24 ± 4.38 **,b
147.16 ± 12.80 **,b
483.00 ± 5.87 **,a
1.11 ± 0.23 **,b
9.50 ± 0.55 **
* p < 0.05, ** p < 0.01 compared with the control; a p < 0.05, b p < 0.01 compared with the low group.
SBP-III-3 Decreased Lactic Acid (LA)
The response to exercise in mammals begins with an increase in aerobic muscular activity,
which switches over to anaerobic metabolism if the exercise is intense, which leads to the accumulation
of LA [31]. Thus, the accumulation of blood serum LA is an important cause of fatigue. The increased
content of LA will lower the pH in muscle tissue and blood, and induce some side effects of various
physiological and biochemical processes, which affect both the cardio-circulating system and the
169
Mar. Drugs 2016, 14, 221
skeletal muscle system function, and then do harm to the body performance [6]. The decrease in
the contractive strength of the muscle eventually induces fatigue [32]. Therefore, LA was measured
as another index to evaluate the level of fatigue. Table 2 showed the LA levels of the mice were
significantly lower by 13.96%, 16.88%, and 20.13% in the SBP-III-3-LH, SBP-III-3-MG, and SBP-III-3-HG
compared to the NCG (p < 0.05), respectively. The LA values of mice from these three groups had
a similar trend in the BUN levels. The results indicated that reducing the LA levels might be an
anti-fatigue pathway of SBP-III-3.
SBP-III-3 Increased the Activity of Lactic Dehydrogenase (LDH)
Serum LDH is known to be an accurate indicator of muscle damage, the normal function of LDH
in cells is to catalyse the interconversion of pyruvate and lactate, thereby reducing the accumulation of
LA in muscle [30]. As shown in Table 3, LDH activity was significantly higher in the SBP-III-3-MG
(3605.87 ± 315.21 U/gprot) and SBP-III-3-HG (3690.76 ± 337.18U/gprot) compared to the NCG
(2784.95 ± 322.92 U/gprot) (p < 0.05). LDH activity in the SBP-III-3-LG (3397.10 ± 215.90 U/gprot)
was higher than that of the NCG (2784.95 ± 322.92 U/gprot), but the LDH activity showed no
significant difference between SBP-III-3-LG and the NCG (p < 0.05). The present results suggested that
SBP-III-3, especially high-dose groups could scavenge excessive LA by enhancing the activity of LDH,
thereby slowing the development of fatigue.
Table 3. The amino acid composition of SBP-III-3 (n = 3).
Amino Acid
Concentration (µmol/L)
Composition (%)
Asp
Glu
Ser
Gly
His
Arg
Thr
Ala
Pro
Hyp
Tyr
Val
Met
Ile
Leu
Phe
Lys
Essential amino acid (EAA)
Total
871.33 ± 18.56
1317.30 ± 35.14
540.61 ± 20.47
6744.51 ± 143.47
86.39 ± 2.34
718.84 ± 12.38
450.29 ± 13.54
2343.97 ± 34.56
2165.95 ± 40.68
1629.48 ± 26.87
60.96 ± 1.35
499.64 ± 12.58
244.28 ± 8.51
207.49 ± 8.34
388.61 ± 12.97
233.10 ± 9.08
453.21 ± 14.58
3017.23 ± 86.37
18,955.96 ± 315.20
4.60 ± 0.10
6.86 ± 0.18
2.82 ± 0.11
35.10 ± 0.75
0.45 ± 0.04
3.74 ± 0.06
2.34 ± 0.07
13.46 ± 0.19
11.28 ± 0.21
8.49 ± 0.14
0.32 ± 0.01
2.60 ± 0.07
1.27 ± 0.05
1.08 ± 0.04
2.02 ± 0.07
1.21 ± 0.05
2.36 ± 0.08
15.70 ± 0.45
100%
SBP-III-3 Increased Liver and Muscle Glycogens
The level of energy stored as glycogen is of great importance in evaluating the capacity for
high-intense exercise. Energy providing for exercise is derived initially from the decomposition of
glycogen, and then from circulation glycogen released by the muscle and liver [33]. When the muscle
glycogen level decreases during exercise, the reduction of liver glycogen may be the limiting factor in
the capacity of endurance exercise. Thus, increasing the liver and muscle glycogen storage contributes
to elevating the tolerance capacity and athletic capacity [33]. Fatigue will happen when the liver and
muscle glycogen is mostly consumed [32]. Table 2 showed the liver glycogen levels of the mice in
SBP-III-3-LH, SBP-III-3-MG and SBP-III-3-HG groups were increased by 35.70%, 108.65%, and 157.33%,
respectively, and the liver glycogen levels in three treated groups were significantly higher than that
in the NCG (p < 0.05 or p < 0.01). Muscle glycogen levels of the mice were significantly higher in
170
Mar. Drugs 2016, 14, 221
the SBP-III-3-MG (3.39 ± 0.35 mg/g) and SBP-III-3-HG (4.80 ± 1.12 mg/g) compared to the NCG
(2.23 ± 0.56mg/g) (p < 0.05). Muscle glycogen levels of the mice in the SBP-III-3-LG (2.44 ± 0.36 mg/g)
were increased by 9.42% compared to the NCG, but the muscle glycogen level was no significant
difference between SBP-III-3-LG and the NCG (p < 0.05). These results show that the anti-fatigue
activity of SBP-III-3 may be related to the improvement in the metabolic control of exercise and the
activation of energy metabolism [34].
2.4.3. SBP-III-3 Enhanced the Antioxidant Enzymes and Decreased the Malondialdehyde (MDA)
Growing evidence indicates that reactive oxygen species (ROS) are responsible for exerciseinduced protein oxidation, and contribute strongly to muscle fatigue [35]. ROS, including free
radicals such as peroxyl radicals (ROO•), hydroxyl radicals (HO•), nitric oxide radicals (NO•),
and superoxide radicals (O2− •), are physiological metabolites formed during aerobic life as a result of
the metabolism of oxygen [5]. Under normal conditions, ROS are effectively eliminated by antioxidant
defense systems, such as antioxidant enzymes and non-enzymatic factors. However, the balance
between the generation and elimination of ROS is broken under pathological conditions, as a result of
these events; bio-macromolecules are damaged by ROS-induced oxidative stress [36]. Muscle cells
contain complex endogenous cellular defense mechanisms to clear up ROS to protect the body
from exercise-induced oxidative injuries and DNA damages. For example: GSH-Px accelerates the
reaction between H2 O2 and glutathione (GSH) and converts them into H2 O and oxidized GSH, SOD
scavenges the O2− •, and CAT decomposes the HO•. Thus, the improvement in the activities of these
defense mechanisms can help to fight against fatigue. Therefore, the present study investigated the
activity of GSH-Px, SOD, and CAT to evaluate the anti-fatigue effects of SBP-III-3 on mice. As shown
in Table 2, the SOD activities of SBP-III-3-HG and SBP-III-3-MG significantly increased by 44.2%
and 15.7%, respectively, compared to the NCG (p < 0.05), while the SOD activity of SBP-III-3-LG
increased by 4.2% and was without statistical significance compared to that of the NCG (p > 0.05).
Moreover, the SOD activities between SBP-III-3-HG and SBP-MG showed a statistical difference
(p < 0.01). The activities of GSH-Px and CAT showed a similar trend in the SOD activities. The GSH-Px
activities of mice treated with SBP-III-3-HG, SBP-III-3-MG, and SBP-III-3-LG increased by 240.5%,
136.1%, and 66.3%, respectively, compared to that of the NCG. In addition, the CAT activities of
SBP-III-3-HG, SBP-III-3-MG, and SBP-III-3-LGsignificantly increased by 159.5%, 87.9% and 74.7%,
respectively, compared to that of the NCG (p < 0.05 or p < 0.01). These results suggested that SBP-III-3
could exert its anti-fatigue effects by enhancing the activities of antioxidant enzymes for eliminating
the superfluous free radicals in organism.
Fatigue results in the release of ROS which cause lipid peroxidation of membrane structure.
MDA, an oxidative degradation product of cell membrane lipids, is generally considered as an
indicator of lipid peroxidation. In fatigue conditions, MDA level is increased and accompanied with
a decrease in levels of the antioxidant enzymes GSH-Px and SOD [37]. Therefore, MDA is used as
a biomarker to measure the level of oxidative stress in an organism. As shown in Table 2, the MDA
levels in mice liver and plasma were decreased with the increase of SBP-III-3 dosage. In mice liver,
the MDA levels of SBP-III-3-HG, SBP-III-3-MG, and SBP-III-3-LG significantly decreased by 53.6%,
49.9%, and 28.0%, respectively, compared to that of the NCG (p < 0.01). In addition, the MDA levels
of SBP-III-3-HG, SBP-III-3-MG, and SBP-III-3-LG significantly lessen by 52.3%, 48.5%, and 41.0%,
respectively, compared to that of the NCG in mice plasma (p < 0.01). The present data were in line
with the decrease in levels of the antioxidant enzymes GSH-Px and SOD. These results indicated that
SBP-III-3 might induce the MDA level by inhibiting lipid peroxidation of cell membrane lipids.
2.5. Amino Acid Composition of SBP-III-3
The bioactivities of protein hydrolysates and peptides were directly influenced by the amino
acid compositions. Chen, Chi, Zhao, and Lv reported that Gly residue may contribute significantly to
antioxidant activity since the single hydrogen atom in the side chain of Gly serves as a proton-donator
171
Mar. Drugs 2016, 14, 221
and neutralizes active free radical species [38]. Nimalaratne, Bandara, and Wu also reported that the
single hydrogen atom of Gly residue could provide a high flexibility to the peptide backbone and
positively influence the antioxidant properties [39]. Pan et al. reported that hydrophobic amino acid
residues including Ala, Leu, and Met played an important role in scavenging free radicals because
the large hydrophobic group could help them make contact with hydrophobic radical species [10].
The pyrimidine ring of the Pro residue can increase the flexibility of the peptides and also be capable of
quenching singlet oxygen due to its low ionization potential [38]. As shown in Table 2, the contents of
Gly, Ala, and Pro residues in SBP-III-3 were 35.10%, 13.46%, and 11.28%, respectively, which reached to
59.84% of the total content of amino acids. In addition, the aromatic amino acid , such as Phe, Trp, His,
and Tyr, with imidazole groups were also proved to have the ability to quench free radicals by direct
electron transfer [11], and acid and basic amino acid residues, including Glu and Asp, were identified
to have strong abilities to chelate metal ions, as well as scavenge HO•. Therefore, SBP-III-3 was rich
in amino acids with antioxidant activity, which should be one of the important factors of its high
antioxidant activity.
Amino acids were also found to play a key role in the regulatory metabolism involved in
muscular activity. Vineyard et al. reported that feeding horses with an amino acid-based supplement
every day might support muscle development during exercise and promote exercise metabolism
and recovery [40]. The essential amino acid (EAA) ingestion during the exercise could attenuate
the degradation of myofibrillar protein, thereby enhancing the exercise capability [41]. The EAA
content of SBP-III-3 is 15.7%, which might be beneficial to its anti-fatigue capability. Glu residue
was proved to have positive influence to the nervous system and would also be beneficial during
exercise [42]. Marquezi et al. reported that Asp residue was advantageous in the oxidative deamination
and could induce the blood ammonia concentration and postpone the occurrence of fatigue [43].
Therefore, SBP-III-3 contains 6.86% Glu residue and 4.54% Asp residue, suggesting that it might have
a potential anti-fatigue effect. Furthermore, Bazzarre et al. reported that the content of amino acid
residues, especially Gly, Ala, Val, Thr, Ile, Ser, and Tyr in the plasma will quickly reduce during an
endurance test [44]. Table 3 showed that SBP-III-3 contained 57.72% of the above amino acid residues,
which was higher than that of loach peptides (32.2%) with antioxidant activity and anti-fatigue
effect [1]. The data indicated that these amino acids could enhance the exercise capability of SBP-III-3.
In addition, the result of amino acid composition provided a basis for the good antioxidant and
anti-fatigue capacities of SBP-III-3.
3. Experimental Section
3.1. Chemicals and Reagents
Frozen swim bladders of the croceine croaker (P. crocea) with an average body weight of 300–350 g
were obtained from Zhejiang Dahaiyang Sci-Tech Co., Ltd. (Zhoushan, China). Alcalase, Sephadex
G-25, and trifluoroacetic acid (TFA) were purchased from Ythx biotechnology Co., Ltd. (Beijing, China).
All of the kits, including SOD, CAT, GSH-Px, MDA, BUN, lactic acid (LA), lactic dehydrogenase (LDH),
liver glycogen, and muscle glycogen, were purchased from Nanjing Jiancheng Bioengineering Institute
(Nanjing, China). Plasmid DNA (pBR322DNA) was purchased from TaKaRa Biotechnology Co., Ltd.
(Dalian, China). Other reagents were of analytical grade and purchased from Sinopharm Chemical
Reagent Co., Ltd. (Shanghai, China).
3.2. Preparation Protein Hydrolysate of Swim Bladders
Frozen swim bladders were unfrozen, cut into small pieces (0.5 × 0.5 cm) and soaked in 0.1 M
NaOH with a solid/solvent ratio of 1:10 (w/v) to remove non-collagenous proteins. The mixture was
continuously stirred for 24 h at 4 ◦ C, and the NaOH solution was changed every 4 h. Thereafter, the
residues were washed with cold distilled water to achieve the neutral pH. Washed samples were
then suspended in 10% butyl alcohol for 12 h with a change of solution every 3 h. Defatted samples
172
Mar. Drugs 2016, 14, 221
were thoroughly washed with cold water, homogenized, and suspended in phosphate buffer solution
(PBS) with a solid/solvent of 1:3 and hydrolyzed for 8 h separately using alcalase at pH 9.0, 45 ◦ C,
papain at pH 7.0, 50 ◦ C, pepsin at pH 3.0, 37 ◦ C, and trypsin at pH 8.0, 60 ◦ C with a total enzyme dose
2%. Enzymatic hydrolysis was stopped by heating for 10 min in boiling water, and hydrolysate was
centrifuged at 8000× g for 10 min. The resulting supernatants using alcalase were lyophilized and
named as SBP.
3.3. Isolation and Purification of Antioxidant Peptide from SBP
SBP was fractionated using ultrafiltration (8400, Millipore, Hangzhou, China) with MW cutoffs
of 10 kDa, 5 kDa, and 3 kDa membranes, respectively, (Millipore, Hangzhou, China) for the lab
scale at 0.30 MPa, 20 ◦ C. Four fractions termed SBP-I (MW < 3 kDa), SBP-II (3 kDa < MW < 5 kDa),
SBP-III (5 kDa < MW < 10 kDa), and SBP-IV (MW > 10 kDa) were pooled, concentrated, and
lyophilized. SBP-III with the highest HO• scavenging activity among all ultrafiltration fractions
was redissolved in distilled water and separated using a Sephadex G-25 gel filtration chromatography
column (Φ2.6 cm × 60 cm, Huanyu Glass Co., Ltd., Xuchang, China) eluted with distilled water
at a flow rate of 1.5 mL/min, and the eluate was monitored at 280 nm. Four peaks (SBP-III-1 to
SBP-III-4) were collected and measured their HO• scavenging activities and SBP-III-3 was chosen for
further analysis.
3.4. Degree of Hydrolysis (DH)
DH analysis was performed according to the previously described method [13]. The hydrolysate
(50 µL) was mixed with 0.5 mL of 0.2 M phosphate buffer, pH 8.2, and 0.5 mL of 0.05%
2,4,6-trinitrobenzenesulfonic acid (TNBS) reagent. TNBS was freshly prepared before use by diluting
with deionized water. The mixture was incubated at 50 ◦ C for 1 h in a water bath. The reaction was
stopped by adding 1 mL of 0.1 M HCl, incubating at room temperature for 30 min. The absorbance
was monitored at 420 nm. L-leucine was used as a standard. To determine the total amino acid content,
mungbean meal was completely hydrolysed with 6 M HCl with a sample to acid ratio of 1:100 at
120 ◦ C for 24 h. DH (%) was calculated using the following equation:
DH = ((At − A0 )/(Amax − A0 )) × 100
where At was the amount of a-amino acids released at time t, A0 was the amount of a-amino acids in
the supernatant at 0 h, and Amax was the total amount of a-amino acids obtained after acid hydrolysis
at 120 ◦ C for 24 h.
3.5. MW Distribution
MW distribution of SBP-III-1 to SBP-III-4 were determined by high-performance size exclusion
chromatography (HPSEC) on a TSK-G3000SWXL column (TOSOH Corporation, Tokyo, Japan)
using a high-pressure liquid chromatography system (Agilent 1200 HPLC, Agilent Ltd.,
Santa Rosa, CA, USA) [45]. The mobile phase consisted of 0.1 M sodium phosphate buffer (pH 7.0).
A sample (20 µL) was eluted at a flow rate of 0.5 mL/min, and measured by monitoring the absorbance
at 230 nm. The approximate MW was determined using standard protein samples (Sigma-Aldrich Co.,
LLC., St. Louis, MO, USA) as reference: thyroglobulin (670 kDa), γ-globulin (150 kDa), ovalbumin
(44 kDa), trypsin inhibitor (20.1 kDa), ribonuclease A (14.7 kDa), Pro–Tyr–Phe–Asn–Lys (667 Da),
and Trp–Asp–Arg (475 Da).
The calibration curve showed that the column separated the standard proteins well. The fitted
linear equation between MW (logMW) and the retention time (Rt , min) was calculated by the method
of least squares, as Log MW = −0.2036Rt + 7.6164 (R2 = 0.9766). The MW of SBP-III-1 to SBP-III-4 was
calculated by the elution time.
173
Mar. Drugs 2016, 14, 221
3.6. Amino Acid Composition Analysis
The amino acid composition of SBP-III-3 was analyzed according to the previous method [46].
To determine the amino acid composition, freeze-dried SBP-III-3 was dissolved in distilled water
to obtain a concentration of 1 mg/mL, and an aliquot of 50 mL was dried and hydrolyzed in a
vacuum-sealed glass tube at 110 ◦ C for 24 h in the presence of 6 M HCl, which contained 0.1%
phenol. Norleucine (Sigma Aldrich, Inc., St. Louis, MO, USA) was used as an internal standard.
After hydrolysis, the samples were again vacuum-dried, dissolved in application buffer, and injected
into an automated amino acid analyzer (HITACHI 835-50 Amino Acid Analyzer, Tokyo, Japan).
Determination of tryptophan was also performed by HPLC analysis after alkaline hydrolysis [47].
Briefly, samples (5 mg) were dissolved in 3 mL of 4 N NaOH, sealed in hydrolysis tubes under
nitrogen, and incubated in an oven at 100 ◦ C for 4 h. Hydrolysates were cooled on ice, neutralized
to pH 7 using 12 N HCl, and diluted to 25 mL with 1 M sodium borate buffer (pH 9). Aliquots of
these solutions were filtered through a 0.45 µm Millex filter (Millipore, Hangzhou, China) prior to
injection. Standard solutions of tryptophan were prepared by dilution of a stock solution (0.51 mg
tryptophan/mL 4 N sodium hydroxide). They were diluted to 3 mL with 4 N sodium hydroxide and
incubated as above. Finally, 20 µL samples and tryptophan solutions were determined by an HPLC
system (Agilent 1260 HPLC, Agilent Ltd.).
3.7. Antioxidant Activity
3.7.1. Radical Scavenging Activities
The DPPH•, HO•, O2− •, and ABTS+ • scavenging activities were measured by the previous
method [13], and the half elimination ratio (EC50 ) was defined as the concentration where a sample
caused a 50% decrease of the initial concentration of DPPH•, HO•, O2− •, and ABTS+ •, respectively.
HO• Scavenging Activity
First, 1.0 mL of a 1.865 mM 1,10-phenanthroline solution and 2.0 mL of the sample were added to
a screw-capped tube and mixed. Then, 1.0 mL of a FeSO4 ·7H2 O solution (1.865 mM) was added to the
mixture. The reaction was initiated by adding 1.0 mL of H2 O2 (0.03%, v/v). After incubating at 37 ◦ C
for 60 min in a water bath, the absorbance of the reaction mixture was measured at 536 nm against a
reagent blank. The reaction mixture without any antioxidant was used as the negative control, and a
mixture without H2 O2 was used as the blank. The HO• scavenging activity was calculated using the
following formula:
HO• scavenging activity (%) = ((As − An )/(Ab − An )) × 100
where As , An , and Ab are the absorbance values determined at 536 nm of the sample, the negative
control, and the blank after the reaction, respectively.
DPPH• Scavenging Activity
Two millilitres of samples consisting of distilled water and different concentrations of the analytes
were placed in cuvettes, and 500 µL of an ethanolic solution of DPPH (0.02%) and 1.0 mL of ethanol
were added. A control sample containing the DPPH solution without the sample was also prepared.
In the blank, the DPPH solution was substituted with ethanol. The antioxidant activity of the sample
was evaluated using the inhibition percentage of the DPPH• with the following equation:
DPPH• scavenging activity (%) = (A0 + A′ − A)/A0 × 100
where A is the absorbance rate of the sample, A0 is the control group absorbance, and A′ is the
blank absorbance.
174
Mar. Drugs 2016, 14, 221
O2− • Scavenging Activity
In the experiment, superoxide anions were generated in 1 mL of nitrotetrazolium blue chloride
(NBT) (2.52 mM), 1 mL of NADH (624 mM), and 1 mL of different sample concentrations. The reaction
was initiated by adding 1 mL of phenazinemethosulphate (PMS) solution (120 µM) to the reaction
mixture. The absorbance was measured at 560 nm against the corresponding blank after 5-min
incubation at 25 ◦ C. The scavenging capacity of the O2− • was calculated using the following equation:
O2− • scavenging activity (%) = ((Acontrol − Asample )/Acontrol ) × 100%,
where Acontrol is the absorbance without the sample and Asample is the absorbance with the sample.
ABTS+ • Scavenging Activity
ABTS+ • was generated by mixing an ABTS stock solution (7 mM) with potassium persulphate
(2.45 mM). The mixture was left in the dark for 16 h at room temperature. The ABTS+ • solution
was diluted in 5 mM phosphate-buffered saline (PBS, pH 7.4) to an absorbance of 0.70 ± 0.02 at
734 nm. One millilitre of diluted ABTS+ • solution was mixed with one millilitre of the different sample
concentrations. Ten minutes later, the absorbances were measured at 734 nm against the corresponding
blank. The ABTS+ • scavenging activities of the samples were calculated using the same equation as
indicated in O2− • scavenging activity (%).
3.7.2. DNA Damage Protective Effect
The ability of SBP-III-3 to protect supercoiled pBR322 plasmid DNA was measured by the previous
method with a slight modification [28]. The reaction mixtures (15 µL) contained 5 µL of PBS (10 mM,
pH 7.4), 1 µL of plasmid DNA (0.5 µg), 5 µL of the SBP-III-3, 2 µL of 1 mM FeSO4 , and 2 µL of 1 mM
H2 O2 were incubated at 37 ◦ C for 30 min. After incubation, 2 µL of a loading buffer (50% glycerol (v/v),
40 mM EDTA and 0.05% bromophenol blue) was added to stop the reaction and the reaction mixtures
were electrophoresed on 1% agarose gel containing 0.5 µg/mL ethidium bromide in Tris/acetate/EDTA
gel buffer for 50 min (60 V), and the DNA in the gel was visualized and photographed under ultraviolet
light. Ascorbic acid was used as a positive control.
3.8. Animals and Experimental Diets
Male Institute of Cancer Research (ICR) mice with an average body weight of 20–25 g were
purchased from the Zhejiang Academy of Medical Sciences (China). All of the in vivo tests were
carried by the School of Food and Pharmacy of Zhejiang Ocean University (China), which obtained the
permission for performing the research protocols and all animal experiments conducted during the
present study from the ethics committee of Zhejiang Ocean University. All experimental procedures
were conducted under the oversight and approval of the Academy of Experimental Animal Center
of Zhejiang Ocean University and in strict accordance with the NIH Guide for the Care and Use of
Laboratory Animals (NIH, 2002).
In vivo anti-fatigue activity was determined on the previous method with a slight
modification [3,48]. Male ICR mice were housed in a SPF level laboratory under controlled temperature
of 21 ± 1 ◦ C with moderate humidity of 55% ± 5%, and air flow conditions in a 12 h light/dark cycle;
noise was <60 dB. Mice had free access to the standard diet and water during the experiments. After one
week adaptation, 48 mice were randomly divided into four groups (12 mice per group): the normal
control group (NCG) and three swim bladder peptide (SBP-III-3) treatment groups. Mice in NCG
were administered with physiological saline (0.1 mL/10 g body weight per day) by gastrogavage;
mice in SBP-III-3 treatment groups were respectively fed with SBP-III-3 in three different doses (50, 100,
and 200 mg/kg body weight per day) by gastrogavage, and the three groups were accordingly
175
Mar. Drugs 2016, 14, 221
named as low-dose group (SBP-III-3-LG), middle-dose group (SBP-III-3-MG), and high-dose group
(SBP-III-3-HG).
3.9. In Vivo Anti-Fatigue Effect of SBP-III-3
3.9.1. Weight-Loaded Swimming Test in ICR Mice
Weight-loaded swimming test was according to the previous method with some
modifications [49,50]. Physiological saline/SBP-III-3 were administrated orally (8:00 a.m.) to mice
of the normal control group (NCG) and three swim bladder peptide (SBP-III-3) treatment groups
(SBP-III-3-LG, SBP-III-3-MG, and SBP-III-3-HG) once daily for 28 days. After the treatment with
SBP-III-3 or physiological saline for 30 min at the last time point, the loaded swimming experiment
was carried out. All of the mice were weighed and loaded with an iron ring equaling 5% of
each mouse’s body weight on the tail root of each mouse; they were placed in a swimming pool
(50 cm × 50 cm × 40 cm) with 30 cm deep water with 25 ± 1◦ C. The swimming time of mice was
calculated from the time they began to swim up to the time the exhibited exhaustion, which was
determined as a loss of coordinated movements and failure to return to the surface within 10 s.
The length of the swimming time to exhaustion was evaluated as the degree of fatigue.
3.9.2. Biochemical Parameter Determination on Anti-Fatigue
Biochemical parameters were determined according to the method described by You et
al. [1], and were performed according to the recommended procedures provided by the kits
(Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Briefly, two days later after
weight-loaded swimming test, all the mice were forced to swim for 90 min without a load after
gavage for 30 min, then anesthetized with 10% chloral hydrate after 60 min rest, and the mice were
sacrificed by cervical dislocation.
For the serum assays, 250 L of arterial blood was respectively collected from left femoral artery to
determine MDA, BUN, and LA content and LDH, SOD, CAT, and GSH-Px activity using commercial
diagnostic kits. The GSH-Px has the ability to decompose hydrogen peroxide (H2 O2 ) and other organic
hydroperoxides (ROOH). The reaction uses GSH to complete the reaction using H2 O2 , as the substrate.
The consumption of nicotinamide adenine dinucleotide phosphate (NADPH) is used to determine the
GSH-Px activity. The catalase activity was determined colorimetrically with a CAT assay kit, which is
based on the decomposition of the H2 O2 optical density at 415 nm by CAT.
For the hepatic and muscular assays, the muscles and livers of the mice were also taken to
determine the content of MDA and glycogen. The muscles and livers of the mice were dissected
immediately after removal, washed with 0.9% saline, and blotted dry with filter paper. Liver samples
(∼100 mg) were accurately weighed, and homogenized in 8 mL of homogenization buffer. The content
of MDA and glycogen was determined according to the recommended procedures.
3.10. Statistical Analysis
The data are reported as the mean ± standard deviation (SD). An ANOVA test using SPSS 19.0
(Statistical Program for Social Sciences, SPSS Corporation, Chicago, IL, USA) was used to analyze
the experimental data. Duncan’s multiple range test was used to measure the differences among the
parameters means. The differences were considered significant if p < 0.05 or p < 0.01.
4. Conclusions
Our study firstly prepared and evaluated the high antioxidant and anti-fatigue activities of the
peptide fraction (SBP-III-3) from the croceine croaker (P. crocea) swim bladder. The results showed that
SBP-III-3 could effectively scavenge HO•, DPPH•, O2− •, and ABTS+ •, prolong the swimming time to
exhaustion of mice, decreased the BUN, LA, and MDA levels, and increase the LDH, liver glycogen,
and muscle glycogen levels in mice. In addition, SBP-III-3 could improve the activities of SOD, GSH-Px,
176
Mar. Drugs 2016, 14, 221
and CAT in vivo. These results confirmed that SBP-III-3 possessed good antioxidant and anti-fatigue
capacities in mice and provided an important basis for developing the swim bladder peptide served as
a novel functional food.
Protein hydrolysates are composed of free amino acids and short-chain peptides that exhibit
numerous advantages as nutraceuticals, functional foods, or medicines. Structure-activity studies
of antioxidant peptides reported that peptides and protein hydrolysates display different activities
depending on the peptide size, the amino acid sequence, and the presence of amino acids involved
in oxidative reactions. Therefore, further research should be done in order to purify and identify
antioxidant and anti-fatigue peptides from SBP-III-3, and more detailed studies on physiological
functions, pharmacological effects, and structure-activity relationship of SBP-III-3 and the purified
peptides will also be needed.
Acknowledgments: This work was funded by the National Natural Science Foundation of China (NSFC)
(81673349), Zhejiang Provincial Natural Science Foundation (LY15C200016), the State-level Spark Program
(2015GA700044), Zhejiang Ocean University R & D start funding (Q1203) and Key Scientific and Technological
Project of Zhejiang Ocean University (X12ZD09).
Author Contributions: Bin Wang and Guo-Fang Ding conceived and designed the experiments. Li Zeng,
Zui-Su Yang, Fang-Fang Huang and Yu-Qin Zhao performed the experiments. Yu-Qin Zhao and Bin Wang
analyzed the data. Guo-Fang Ding and Bin Wang contributed the reagents/materials/analytical tools and wrote
the paper.
Conflicts of Interest: The authors declare no conflicts of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
You, L.; Zhao, M.; Regenstein, J.M.; Ren, J. In vitro antioxidant activity and in vivo anti-fatigue effect of
loach (Misgurnus anguillicaudatus) peptides prepared by papain digestion. Food Chem. 2011, 124, 188–194.
[CrossRef]
Ding, J.F.; Li, Y.Y.; Xu, J.J.; Su, X.Y.; Gao, X.; Yue, F.P. Study on effect of jellyfish collagen hydrolysate on
anti-fatigue and anti-oxidation. Food Hydrocoll. 2011, 25, 1350–1353. [CrossRef]
Xu, C.; Lv, J.; Lo, Y.M.; Cui, S.W.; Hu, X.; Fan, M. Effects of oat β-glucan on endurance exercise and its
anti-fatigue properties in trained rats. Carbohyd. Polym. 2013, 92, 1159–1165. [CrossRef] [PubMed]
Agyei, D.; Ongkudon, C.M.; Wei, C.Y.; Chan, A.S.; Danquah, M.K. Bioprocess challenges to the isolation and
purification of bioactive peptides. Food Bioprod. Process 2016, 98, 244–256. [CrossRef]
Sila, A.; Bougatef, A. Antioxidant peptides from marine by-products: Isolation, identification and application
in food systems. A review. J. Funct. Foods 2016, 21, 10–26. [CrossRef]
Wang, L.; Zhang, H.L.; Lu, R.; Zhou, Y.J.; Ma, R.; Lv, J.Q.; Li, X.L.; Chen, L.J.; Yao, Z. The decapeptide CMS001
enhances swimming endurance in mice. Peptides 2008, 29, 1176–1182. [CrossRef] [PubMed]
Chi, C.F.; Hu, F.Y.; Wang, B.; Li, Z.R.; Luo, H.Y. Influence of amino acid compositions and peptide profiles
on antioxidant capacities of two protein hydrolysates from skipjack tuna (Katsuwonus pelamis) dark muscle.
Mar. Drugs 2015, 13, 2580–2601. [CrossRef] [PubMed]
Wei, R.; Huang, C.; Luo, H.; Song, R. Progress in preparation and application of high Fischer ratio
oligopeptides derived from food protein source. Food Sci. 2014, 35, 289–294.
Li, Z.R.; Wang, B.; Chi, C.F.; Zhang, Q.H.; Gong, Y.D.; Tang, J.J.; Luo, H.Y.; Ding, G.F. Isolation and
characterization of acid soluble collagens and pepsin soluble collagens from the skin and bone of spanish
mackerel (Scomberomorous niphonius). Food Hydrocoll. 2013, 31, 103–113. [CrossRef]
Pan, X.; Zhao, Y.Q.; Hu, F.Y.; Wang, B. Preparation and identification of antioxidant peptides from protein
hydrolysate of skate (Raja porosa) cartilage. J. Funct. Foods 2016, 25, 220–230. [CrossRef]
Chi, C.F.; Hu, F.Y.; Wang, B.; Ren, X.J.; Deng, S.G.; Wu, C.W. Purification and characterization of three
antioxidant peptides from protein hydrolyzate of croceine croaker (Pseudosciaena crocea) muscle. Food Chem.
2015, 168, 662–667. [CrossRef] [PubMed]
Wu, Q.Q.; Li, T.; Wang, B.; Ding, G.F. Preparation and characterization of acid and pepsin-soluble collagens
from scales of croceine and redlip croakers. Food Sci. Biotechnol. 2015, 24, 2003–2010. [CrossRef]
177
Mar. Drugs 2016, 14, 221
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
Wang, B.; Wang, Y.M.; Chi, C.F.; Luo, H.Y.; Deng, S.G.; Ma, J.Y. Isolation and characterization of collagen
and antioxidant collagen peptides from scales of croceine croaker (Pseudosciaena crocea). Mar. Drugs 2013, 11,
4641–4661. [CrossRef] [PubMed]
Zhao, X.; Qian, Y.; Li, G.J.; Tan, J. Preventive effects of the polysaccharide of Larimichthys crocea swim bladder
on carbon tetrachloride (CCl4 )-induced hepatic damage. Chin. J. Nat. Med. 2015, 13, 521–528. [CrossRef]
Abeyrathne, E.D.; Lee, H.Y.; Jo, C.; Suh, J.W.; Ahn, D.U. Enzymatic hydrolysis of ovomucin and the functional
and structural characteristics of peptides in the hydrolysates. Food Chem. 2016, 192, 107–113. [CrossRef]
[PubMed]
Chi, C.; Hu, F.; Li, Z.; Wang, B.; Luo, H. Influence of different hydrolysis processes by trypsin on the
physicochemical, antioxidant, and functional properties of collagen hydrolysates from Sphyrna lewini,
Dasyatis akjei, and Raja porosa. J. Aquat. Food Prod. Technol. 2016, 25, 616–632. [CrossRef]
Chi, C.F.; Wang, B.; Wang, Y.M.; Zhang, B.; Deng, S.G. Isolation and characterization of three antioxidant
peptides from protein hydrolysate of bluefin leatherjacket (Navodon septentrionalis) heads. J. Funct. Foods
2015, 12, 1–10. [CrossRef]
You, L.; Zhao, M.; Regenstein, J.M.; Ren, J. Purification and identification of antioxidative peptides from
loach (Misgurnus anguillicaudatus) protein hydrolysate by consecutive chromatography and electrospray
ionization-mass spectrometry. Food Res. Int. 2010, 43, 1167–1173. [CrossRef]
Ren, J.; Zhao, M.; Shi, J.; Wang, J.; Jiang, Y.; Cui, C.; Kakuda, Y.; Xue, S.J. Purification and identification of
antioxidant peptides from grass carp muscle hydrolysates by consecutive chromatography and electrospray
ionization-mass spectrometry. Food Chem. 2008, 108, 727–736. [CrossRef] [PubMed]
Cai, L.; Wu, X.; Zhang, Y.; Li, X.; Ma, S.; Li, J. Purification and characterization of three antioxidant peptides
from protein hydrolysate of grass carp (Ctenopharyngodon idella) skin. J. Funct. Foods 2015, 16, 234–242.
[CrossRef]
Wang, B.; Li, L.; Chi, C.F.; Ma, J.H.; Luo, H.Y.; Xu, Y.F. Purification and characterisation of a novel antioxidant
peptide derived from blue mussel (Mytilus edulis) protein hydrolysate. Food Chem. 2013, 138, 1713–1719.
[CrossRef] [PubMed]
Ahn, C.B.; Kim, J.G.; Je, J.Y. Purification and antioxidant properties of octapeptide from salmon byproduct
protein hydrolysate by gastrointestinal digestion. Food Chem. 2014, 147, 78–83. [CrossRef] [PubMed]
Park, S.Y.; Kim, Y.S.; Ahn, C.B.; Je, J.Y. Partial purification and identification of three antioxidant peptides with
hepatoprotective effects from blue mussel (Mytilus edulis) hydrolysate by peptic hydrolysis. J. Funct. Foods
2016, 20, 88–95. [CrossRef]
Zhuang, H.; Tang, N.; Yuan, Y. Purification and identification of antioxidant peptides from corn gluten meal.
J. Funct. Foods 2013, 5, 1810–1821. [CrossRef]
Hong, J.; Chen, T.T.; Hu, P.; Yang, J.; Wang, S.Y. Purification and characterization of an antioxidant peptide
(GSQ) from Chinese leek (Allium tuberosum Rottler) seeds. J. Funct. Foods 2014, 10, 1–10. [CrossRef]
Rajapakse, N.; Mendis, E.; Jung, W.K.; Je, J.Y.; Kim, S.K. Purification of a radical scavenging peptide from
fermented mussel sauce and its antioxidant properties. Food Res. Int. 2005, 38, 175–182. [CrossRef]
Apostolou, A.; Stagos, D.; Galitsiou, E.; Spyrou, A.; Haroutounian, S.; Portesis, N.; Trizoglou, I.;
Wallace Hayes, A.; Tsatsakis, A.M.; Kouretas, D. Assessment of polyphenolic content, antioxidant activity,
protection against ROS-induced DNA damage and anticancer activity of Vitisvinifera stem extracts. Food
Chem. Toxicol. 2013, 61, 60–68. [CrossRef] [PubMed]
Gao, C.Y.; Lu, Y.H.; Tian, C.R.; Xu, J.G.; Guo, X.P.; Zhou, R.; Hao, G. Main nutrients, phenolics,
antioxidant activity, DNA damage protective effect and microstructure of Sphallerocarpus gracilis root at
different harvest time. Food Chem. 2011, 127, 615–622. [CrossRef] [PubMed]
Jiang, D.Q.; Guo, Y.; Xu, D.H.; Huang, Y.S.; Yuan, K.; Lv, Z.Q. Antioxidant and anti-fatigue effects of
anthocyanins of mulberry juice purification (MJP) and mulberry marc purification (MMP) from different
varieties mulberry fruit in China. Food Chem. Toxicol. 2013, 59, 1–7. [CrossRef] [PubMed]
Koo, H.N.; Lee, J.K.; Hong, S.H.; Kim, H.M. Herbkines increases physical stamina in mice. Biol. Pharm. Bull.
2004, 27, 117–119. [CrossRef] [PubMed]
Evans, D.A.; Subramoniam, A.; Rajasekharan, S.; Pushpangadan, P. Effect of Trichopus zeylanicus leaf extract
on the energy metabolism in mice during exercise and at rest. Indian J. Pharmacol. 2002, 34, 32–37.
Jia, J.M.; Wu, C.F. Antifatigue activity of tissue culture extracts of Saussurea involucrate. Pharm. Biol. 2008, 46,
433–436. [CrossRef]
178
Mar. Drugs 2016, 14, 221
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
Van-Loon, L.J.; Saris, W.H.; Kruijshoop, M.; Wagenmakers, A.J. Maximizing postexercise muscle glycogen
synthesis: carbohydrate supplementation and the application of amino acid or protein hydrolysate mixtures.
Am. J. Clin. Nutr. 2000, 72, 106–111. [PubMed]
Wang, J.J.; Shieh, M.J.; Kuo, S.L.; Lee, C.L.; Pan, T.M. Effect of red mold rice on antifatigue and exercise-related
changes in lipid peroxidation in endurance exercise. Appl. Microbiol. Biotechnol. 2006, 70, 247–253. [CrossRef]
[PubMed]
Powers, S.K.; DeRuisseau, K.C.; Quindry, J.; Hamilton, K.L. Dietary antioxidants and exercise. J. Sport Sci.
2004, 22, 81–94. [CrossRef] [PubMed]
Ko, S.C.; Kim, D.; Jeon, Y.J. Protective effect of a novel antioxidative peptide purified from a marine
Chlorella ellipsoidea protein against free radical-induced oxidative stress. Food Chem. Toxicol. 2012, 50,
2294–2302. [CrossRef] [PubMed]
Wang, J.; Li, S.; Fan, Y.; Chen, Y.; Liu, D.; Cheng, H.; Gao, X.; Zhou, Y. Anti-fatigue activity of the water-soluble
polysaccharides isolated from Panax ginseng C. A. Meyer. J. Ethnopharmacol. 2010, 130, 421–423. [CrossRef]
[PubMed]
Chen, C.; Chi, Y.J.; Zhao, M.Y.; Lv, L. Purification and identification of antioxidant peptides from egg white
protein hydrolysate. Amino Acids 2012, 43, 457–466. [CrossRef] [PubMed]
Nimalaratne, C.; Bandara, N.; Wu, J. Purification and characterization of antioxidant peptides from
enzymatically hydrolyzed chicken egg white. Food Chem. 2015, 188, 467–472. [CrossRef] [PubMed]
Vineyard, K.R.; Gordonm, M.E.; Graham-Thiersm, P.; Jerina, M. Effects of daily administration of an amino
acid-based supplement on muscle and exercise metabolism in working horses. J. Equine Vet. Sci. 2013, 33,
321–399. [CrossRef]
Bird, S.P.; Tarpenning, K.M.; Marino, F.E. Liquid carbohydrate/essential amino acid ingestion during a
short-termbout of resistance exercise suppresses myofibrillar protein degradation. Metabolism 2006, 55,
570–577. [CrossRef] [PubMed]
Guezennec, C.Y.; Abdelmalki, A.; Serrurier, B.; Merino, D.; Bigard, X.; Berthelot, M.; Pierard, C.; Peres, M.
Effect of prolonged exercise on brain ammonia and amino acids. Int. J. Sports Med. 1998, 19, 323–327.
[CrossRef] [PubMed]
Marquezi, M.L.; Roschel, H.A.; Costa, A.D.S.; Sawada, L.A.; Lancha, A.H., Jr. Effect of aspartate and
asparagine supplementation on fatigue determinants in intense exercise. Int. J. Sport Nutr. Exerc. Metab.
2003, 13, 65–75. [CrossRef] [PubMed]
Bazzarre, T.L.; Murdoch, S.D.; Wu, S.M.; Herr, D.G.; Snider, I.P. Plasma amino acid responses of trained
athletes to two successive exhaustion trials with and without interim carbohydrate feeding. J. Am. Coll. Nutr.
1992, 11, 501–511. [CrossRef] [PubMed]
Li, Z.; Wang, B.; Chi, C.; Gong, Y.; Luo, H.; Ding, G. Influence of average molecular weight on antioxidant
and functional properties of cartilage collagen hydrolysates from Sphyrna lewini, Dasyatis akjei and Raja porosa.
Food Res. Int. 2013, 51, 283–293. [CrossRef]
Chi, C.F.; Wang, B.; Li, Z.R.; Luo, H.Y.; Ding, G.F.; Wu, C.W. Characterization of acid-soluble collagen from
the skin of hammerhead shark (Sphyrna lewini). J. Food Biochem. 2014, 38, 236–247. [CrossRef]
Yust, M.M.; Pedroche, J.; Girón-Calle, J.; Vioque, J.; Millán, F.; Alaiz, M. Determination of tryptophan
by high-performance liquid chromatography of alkaline hydrolysates with spectrophotometric detection.
Food Chem. 2004, 85, 317–320. [CrossRef]
Liu, J.; Jia, L.; Kan, J.; Jin, C.H. In vitro and in vivo antioxidant activity of ethanolic extract of white button
mushroom (Agaricus bisporus). Food Chem. Toxicol. 2013, 51, 310–316. [CrossRef] [PubMed]
Tan, W.; Yu, K.Q.; Liu, Y.Y.; Ouyang, M.Z.; Yan, M.H.; Luo, R.; Zhao, X.S. Anti-fatigue activity of
polysaccharides extract from Radix Rehmanniae Preparata. Int. J. Biol. Macromol. 2012, 50, 59–62. [CrossRef]
[PubMed]
Yu, B.; Lu, Z.X.; Bie, X.M.; Lu, F.X.; Huang, X.Q. Scavenging and anti-fatigue activity of fermented defatted
soybean peptides. Eur. Food Res. Technol. 2008, 226, 415–421. [CrossRef]
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
179
marine drugs
Article
Antimicrobial and Antitumor Activities of Novel
Peptides Derived from the Lipopolysaccharide- and
β-1,3-Glucan Binding Protein of the Pacific Abalone
Haliotis discus hannai
Bo-Hye Nam 1, *, Ji Young Moon 1 , Eun Hee Park 1 , Hee Jeong Kong 1 , Young-Ok Kim 1 ,
Dong-Gyun Kim 1 , Woo-Jin Kim 1 , Chul Min An 1 and Jung-Kil Seo 2, *
1
2
*
Biotechnology Research Division, National Institute of Fisheries Science, 216, Gijanghaean-ro, Gijang-eup,
Gijang-gun, Busan 46083, Korea; moonjy@gmail.com (J.Y.M.); jeh8478@naver.com (E.H.P.);
heejkong@korea.kr (H.J.K.); yobest12@korea.kr (Y.-O.K.); combikola@korea.kr (D.-G.K.);
wj2464@korea.kr (W.-J.K.); ancm@korea.kr (C.M.A.)
Department of Food Science and Biotechnology, Kunsan National University, Kunsan 54150, Korea
Correspondence: nambohye@korea.kr (B.-H.N.); jungkileun@kunsan.ac.kr (J.-K.S.);
Tel.: +82-51-720-2452 (B.-H.N.); +82-63-469-1827 (J.-K.S.)
Academic Editor: Se-Kwon Kim
Received: 24 September 2016; Accepted: 23 November 2016; Published: 14 December 2016
Abstract: Antimicrobial peptides are a pivotal component of the invertebrate innate immune
system. In this study, we identified a lipopolysaccharide- and β-1,3-glucan-binding protein
(LGBP) gene from the pacific abalone Haliotis discus hannai (HDH), which is involved in the
pattern recognition mechanism and plays avital role in the defense mechanism of invertebrates
immune system. The HDH-LGBP cDNA consisted of a 1263-bp open reading frame (ORF) encoding
a polypeptide of 420 amino acids, with a 20-amino-acid signal sequence. The molecular mass
of the protein portion was 45.5 kDa, and the predicted isoelectric point of the mature protein
was 4.93. Characteristic potential polysaccharide binding motif, glucanase motif, and β-glucan
recognition motif were identified in the LGBP of HDH. We used its polysaccharide-binding motif
sequence to design two novel antimicrobial peptide analogs (HDH-LGBP-A1 and HDH-LGBP-A2).
By substituting a positively charged amino acid and amidation at the C-terminus, the pI and net
charge of the HDH-LGBP increased, and the proteins formed an α-helical structure. The HDH-LGBP
analogs exhibited antibacterial and antifungal activity, with minimal effective concentrations ranging
from 0.008 to 2.2 μg/mL. Additionally, both were toxic against human cervix (HeLa), lung (A549),
and colon (HCT 116) carcinoma cell lines but not much on human umbilical vein cell (HUVEC).
Fluorescence-activated cell sorter (FACS) analysis showed that HDH-LGBP analogs disturb the cancer
cell membrane and cause apoptotic cell death. These results suggest the use of HDH-LGBP analogs
as multifunctional drugs.
Keywords: antimicrobial peptide; cytotoxic peptide; lipopolysaccharide- and β-1,3-glucan binding
protein; Haliotis discus hannai
1. Introduction
Invertebrates lack antibodies and an adaptive immune system; instead, they rely on innate
immunity to defend themselves against invading pathogens. The innate immune system of marine
invertebrates allows them to survive and grow in their microbe-rich benthic environment.
The first stage of the immune response is the recognition of invasive pathogens. Microbial cell-wall
components referred to as pathogen-associated molecule patterns (PAMPs), such as LPS, β-1,3-glucan,
Mar. Drugs 2016, 14, 227
180
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2016, 14, 227
and peptidoglycans, are recognized by a specific pattern recognition receptors (PRRs) or pattern
recognition proteins (PRPs). PRPs bind to PAMPs to form complexes that subsequently activate
immune responses such as phagocytosis, nodule formation, encapsulation, activation of proteinase
cascades, and synthesis of antimicrobial peptides. To date, various types of invertebrate PRPs, such as
peptidoglycan recognition proteins (PGRPs), C-type lectins, lipopolysaccharide (LPS)-binding proteins,
and β-glucan binding proteins (βGBPs), have been reported.
Lipopolysaccharide- and β-1,3-glucan-binding proteins (LGBPs) consist of two polysaccharide
recognition motifs for polysaccharide binding and a β-glucan recognition motif that recognizes
bacterial antigens (saccharide moieties) such as LPS, peptidoglycan, and β-1,3-glucan, a major cellular
component of yeast and fungi [1]. Several LGBPs have been cloned and characterized in aquatic
animals such as crayfish (Pacifastacus leniusculus) [2], kuruma shrimp (Marsupenaeus japonicas) [3],
Chinese shrimp (Fenneropenaeus chinensis) [4], Zhikong scallop (Chlamys farreri) [5], disk abalone
(Haliotis discus) [6], and pearl oyster (Pinctada fucata)LGBPs [7]. The LGBP of Pacifastacus leniusculus
was shown to play an important role in prophenoloxidase activation [2].
The LPS-binding or recognition domain has been used to design new antimicrobial peptides
(AMPs). For example, the corresponding synthetic LPS-binding domain peptides of anti-LPS
factor (ALF) from several crustacean species were shown to exhibit antimicrobial activities [8–13].
Lactoferrin is a non-hemic iron-binding glycoprotein with antimicrobial activity via its LPS-binding
domain (reviewed by [14]). The recombinant N-terminal domain of gram-negative binding protein 3
(GNBP3) binds β-1,3-glucan and shows antimicrobial activity [15]. These studies demonstrated that the
antimicrobial properties of the polysaccharide recognition motif can be used to develop novel AMPs.
Moreover, recent studies of AMPs have shown that they possess other biological properties, including
antiviral and cytotoxic activities [16,17]. In particular, cationic antimicrobial peptides, which are toxic
to bacteria but not to normal animal cells, possess a broad spectrum of cytotoxic activity against cancer
cells (reviewed by [18]).
In the present study, we identified and designed two novel AMPs based on the polysaccharidebinding domain of the β-1,3-glucan-binding protein of Haliotis discus hannai. The antimicrobial activities
of these peptides against gram-positive and gram-negative bacteria, as well as yeast, and their cytotoxic
activities against three tumor cell lines were examined.
2. Results
2.1. Identification of the Antimicrobial Peptide and cDNA Sequences
By using expressed sequencing tags of Haliotis discus hannai, a clone with an incomplete open
reading frame (ORF) that showed high similarity to the Haliotis discus discus LGBP was isolated.
A 632-bp sequence was obtained from clone DGT-151, and the N-terminal coding sequence was
obtained using the Rapid amplification of cDNA-end (RACE) method and gene-specific primers.
The sequence of the 380-bp fragment amplified by 5′ -RACE overlapped with an EST sequence to
generate the full-length cDNA sequence of the Haliotis discus hannai LPS- and β-1,3-glucan binding
protein (HDH-LGBP) (Figure 1). The complete sequence of the HDH-LGBP cDNA consisted of a
31-bp 5′ -untranslated region (5′ -UTR), a 162-bp 3′ -UTR with a poly-(A) tail, and a 1263-bp ORF
encoding a polypeptide of 420 amino acids with an estimated molecular mass of 47.8 kDa and a
theoretical pI of 5.27. The HDH-LGBP gene also encodes a 20-amino-acid putative signal sequence.
Therefore, the mature HDH-LGBP consists of 400 amino acid residues with a calculated molecular
mass of the protein portion of 45.5 kDa and a predicted pI of 4.93 for the mature protein.
Simple Modular Architecture Research Tool (SMART) analysis revealed that the region
corresponding to amino acids 164–301 was similar to that of proteins in the glycoside hydrolase
family. Five putative glycosylation sites (Asn–Xaa–Ser/Thr, NXS/T) for N-linked carbohydrate
chains were identified in the mature protein sequence, at Asn-28, -99, -265, -310, and -350. One of the
N-linked glycosylation sites was located in proximity to the β-glucan recognition motif, suggesting
181
Mar. Drugs 2016, 14, 227
that glycosylation at this site influences the β-glucan-binding capacity. A short putative cell adhesion
site and an integrin binding site, Arg/Lys–Gly–Asp (R/KGD), were also detected in the sequence of
the mature protein from Lys-189 to Asp-191. The HDH-LGBP also contained a β-1,3-glucanase site,
with Trp-209, Glu-214, Ile-215, and Asp-216 as the active residues (Figure 1).
Figure 1. Nucleotide and deduced amino acid sequence of Haliotis discus hannai lipopolysaccharideand β-1,3-glucan binding protein (HDH-LGBP). The sequences are numbered at the right margin
of each line. The signal peptide is underlined, and the poly-(A) signal site is bold and underlined.
The integrin-binding motif and N-glycosylation sites are boxed and highlighted in gray, respectively.
The polysaccharide-binding motif is shown in italics and underlined.
2.2. Peptide Design and Synthesis
To develop a novel AMP, we designed a synthetic peptide analog of HDH-LGBP based on
the amino acids sequences located in its polysaccharide-binding motif. One native peptide and
two analogs were predicted to show antimicrobial activity. The predicted pI, net positive charge,
hydrophobicity, and Boman index are listed in Table 1. Peptide activity is influenced by factors such as
hydrophobicity, net charge, and the Boman index, which is an estimate of the potential of peptides
to bind to other proteins, including receptors. It is defined as the sum of the free energies of the
amino acid residue side chains, divided by the total number of amino acid residues. The native
parental peptide WLWPAIWKLPT, rich in W and P residues, has an acidic pI value (5.52) and a zero
net charge, but its Boman index is low (−2.21). Schiffer-Edmundson helical wheel projections were
used to predict the hydrophobic and hydrophilic regions in the secondary structure of the synthetic
peptides HDH-LGBP-A1 (WLWKAIWKLLT) and HDH-LGBP-A2 (WLWKAIWKLLK) (Figure 2).
Table 1. Sequences and physicochemical properties of the peptides used in this study.
Peptide Name
HDH-LGBP-N
HDH-LGBP-A1
HDH-LGBP-A2
Sequence
WLWPAIWMLPT-OH
WLWKAIWKLLT-NH2
WLWKAIWKLLK-NH2
Length
M.W.
p.I.
Hydrophobicity
Hydrophobicmoment
Charge
Boman Index
(kcal/mol)
11
11
11
1413.7
1457.8
1484.8
5.52
10.0
10.3
−1.62
−1.12
−0.81
0.11
0.86
1.07
0
+3
+4
−2.12
−1.34
−1.07
182
Structure
T&R
H
H
Mar. Drugs 2016, 14, 227
Figure 2. A Schiffer-Edmundson helical wheel representation of HDH-LGBP. The arrows indicate the
amino acid residues substituted in the peptide. The hydrophobic and hydrophilic residues are shown
in a rectangular box and a circle, respectively.
2.3. Antimicrobial Activity of HDH-LGBP Analogs
The antimicrobial activity of the two HDH-LGBP analogs was determined by measuring their
minimum effective concentrations (MECs) against gram-positive bacteria, gram-negative bacteria,
and the yeast C. albicans using URDA (Table 2). The HDH-LGBP analogs showed antimicrobial activity
against the gram-positive bacteria B. cereus, S. aureus, S. mutans, and S. iniae (MECs 0.008–1.92 µg/mL)
and the gram-negative bacterium P. aeruginosa (MECs 1.92–2.12 µg/mL), with maximal killing activity
at a peptide concentration of 5 µg/mL. By contrast, the antimicrobial activity of the native peptide
(HDH-LGBP-N) was low (data not shown). The two analogs also showed potent activity against
C. albicans (MECs 2.11–2.16 µg/mL). In the liquid culture bacterial growth inhibition test, the curve
clearly showed that growth of microorganisms (Gram negative bacteria: B. cereus; S. auresus; S. iniae;
S. mutans, Gram positive bacteria: P. aeruginosa; V. anguillarum; V. harveyi) was suppressed at 1 µg/mL
HDH-LGBP-A1 or -A2, with greater suppression by the two analogs of up to 5 µg/mL (Figure 3).
The results demonstrated that the HDH-LGBP analogs have a broad spectrum of antimicrobial activity.
Figure 3.
Antimicrobial activity of HDH-LGBP analogs using the broth dilution assay.
(A) HDH- LGBP-A1; (B) HDH-LGBP-A2. Bacterial growth is expressed as a percentage of the maximum
optical density (OD) measured in the absence of peptide. Bacterial-killing curve of HDH-LGBP analogs
against B. cereus (), S. aureus (), S. iniae (), S. mutans (×), P. aeruginosa (*), V. anguillarum ( ),
and V. harveyi (+). The data were obtained from three independent experiments, each performed in
triplicate, and are reported as the mean ± SD.
183
Mar. Drugs 2016, 14, 227
Table 2. Antimicrobial activities of the two HDH-LGBP analogs.
Minimal Effective Concentration (µg/mL)
Microbe
B. cereus
S. aureus RM4220
S. iniae FP5229
S. mutans
P. aeruginosa
KCTC2004
V. anguillarum
V. harveyi
C. albicans KCTC7965
Gram
HDH-LGBP-A1
HDH-LGBP-A2
+
+
+
+
1.9
1.08
0.57
0.008
1.8
1.37
1.79
1.7
−
2.12
1.92
−
−
Yeast
>125
>125
2.11
>125
>125
2.16
2.4. Thermal Stability of HDH-LGBP Analogs
To investigate thermal stability, 5 µg of the synthetic HDH-LGBP peptides/mL were incubated
at 100 ◦ C for 10 min and then cooled before they were used in an URDA against gram-positive and
gram-negative bacteria and the yeast C. albicans. The antimicrobial activity of the peptides was not
greatly altered by heat treatment (Table 3), as evidenced by their strong antimicrobial activities against
the tested strains (S. aureus, P. aeruginosa, and C. albicans).
Table 3. Thermal stability of HDH-LGBP analogs against S. aureus, P. aeruginosa, and C. albicans.
The upper and lower panels show the radial diffusion assay results of non-heated peptides (N) and of
peptides heated for 10 min at 100 ◦ C (H), respectively. Scale bar = 2.3 mm.
Peptide Name
Microbe
S. aureus
P. aeroginosa
C. albicans
N
HDH-LGBP-A1
H
N
HDH-LGBP-A2
H
2.5. Cytotoxicity of HDH-LGBP Analogs
We investigated the cytotoxicity of HDH-LGBP-A1 and HDH-LGBP-A2 on three human cancer
cell lines (HeLa, A549, HCT 116 cells) and on a normal cell line, HUVEC, using the MTS assay,
which labels live cells based on their mitochondrial dehydrogenase activities, and phase-contrast
microscopy. The untreated control cells showed a typical monolayer appearance and had no significant
184
Mar. Drugs 2016, 14, 227
effect on cell viability in the presence of 1–5 µg peptides/mL. However, when the cells were treated
for 24 h with 10 µg HDH-LGBP peptides/mL, a decrease in cell number, an increase in the number
of rounded cells, and cell shrinkage were observed (Figure 4A,C). In HeLa, A549, and HCT 116 cells
treated with 50 µg peptides/mL, cell detachment, swelling, and damage were detected within 5 min
(data not shown). This result indicated that higher concentrations (50 µg/mL) of HDH-LGBP-A1
and -A2 directly disrupt the cell membrane. A dose-response experiment showed that treatment of the
three cancer cell lines with 1, 5, 10, 25, and 50 µg HDH-LGBP-A1 or -A2/mL for 24 h decreased their
viability in a dose-dependent manner (Figure 4B,D). The cytotoxicity of HDH-LGBP-A1 against HeLa
cells resulted in 12.4, 98.7, and 99% non-viable cells in cultures exposed to peptide concentrations
of 10, 25, and 50 µg/mL, respectively (Figure 4B). The same concentrations also yielded cytotoxic
effects in A549 cells (15, 98.5, and 99%) and in HCT 116 cells (22.57, 93.96, and 99%) (Figure 4B).
For HDH-LGBP-A2, the corresponding values were 34.4, 99, and 95% in HeLa cells; 24.3, 98.8, and
96.9% in A549 cells; and 29.4, 93.6, and 92% in HCT 116 cells (Figure 4D). At the highest concentration of
50 µg/mL, however, the viability of normal cells was decreased to 32.8% and 47.9% by HDH-LGBP-A1
and HDH-LGBP-A2, respectively (Figure 4D).
Figure 4. In vitro cytotoxicity of HDH-LGBP analogs. HUVEC, HeLa, A549, and HCT 116 cells were
treated with the indicated concentrations of HDH-LGBP-A1 and HDH-LGBP-A2 at 37 ◦ C for 24 h.
Cell morphology of HeLa, A549, and HCT116 treated with 10 or 50 µg/mL HDH-LGBP analogs were
observed by microscopy (A and C). Cell viability was measured by an MTS assay after exposure to 0, 1,
5, 10, 25, or 50 µg/mL for 24 h (B and D). Values represent the mean ± SD (n = 3). Scale Bar = 200 µm.
2.6. Effect of HDH-LGBP on Cancer Cell Membranes
Cell death induced by AMPs is thought to involve membrane disruption [19]. In this study,
the cell-membrane effects of the HDH-LGBP analogs were investigated using Annexin V-FITC/PI
185
Mar. Drugs 2016, 14, 227
staining. Figure 5 shows the dose-dependent decreases in the proportion of viable HeLa cells
(quadrant Q3) and the corresponding increases in damaged and dead HeLa cells (quadrants Q2
and Q4). The percentage of viable HeLa cells decreased from 90.5% (control) to 86.13 (1 µg/mL),
73.33 (5 µg/mL), 68.01 (10 µg/mL), and 40.06% (20 µg/mL) after HDH-LGBPA1 treatment; and to
86.89 (1 µg/mL), 75.21 (5 µg/mL), 51.55 (10 µg/mL), and 29.76% (20 µg/mL) after HDH-LGBPA2
treatment. These results showed that HDH-LGBP analogs disrupt membrane integrity (increased PS
exposure) and increase membrane permeability (increase cellular uptake of PI), thereby inducing
cell death.
Figure 5. Quantitative analysis of HeLa cells apoptosis and necrosis induced by treatments with abalone
HDH-LGBP-A1 (A) and HDH-LGBP-A2 (B). The cells were incubated with different concentration
of 1, 5, 10, and 20 µg HDH-LGBP-A1 and HDH-LGBP-A2/mL for 24 h and then stained with
Annexin-V-FITC/PI. Fluorescence intensity was determined using FACS analysis. The upper left
part (Q1) represents necrotic cells and the upper right part (Q2) represents secondary necrotic and
late apoptotic cells and the lower left part (Q3) represents viable cells and the lower right part (Q4)
represents early apoptotic cells.
3. Discussion
AMPs are generally cationic and amphipathic, which enables them to interact with and disrupt
lipid membranes. They are also typically very short (5–40 amino acid residues) and contain relatively
large (≥30%) proportions of charged (e.g., Lys and Arg) and hydrophobic residues. Some AMPs, such
as lactoferricins and indolicidin, are rich in Trp and Arg residues [20]. Unlike currently available
conventional antibiotics, which typically interact with a specific target protein, cationic AMPs
tend to target the cell membrane of invading microorganisms, leading to cell lysis and death [21].
Thus, AMPs may provide a new class of therapeutic agents whose activities are complementary to
those of existing antibiotics. Moreover, bacteria are unlikely to develop resistance to AMPs.
To develop a novel AMP, we designed cationic analogs corresponding to the polysaccharidebinding domain sequence of the abalone β-1,3-glucan-binding protein. The LPS-binding domain is
conserved in some PRPs, and is a useful template for designing a mimetic peptide with potential
antimicrobial activity. The putative LPS-binding domain of the anti-LPS factor, a small protein with
broad-spectrum antimicrobial activities, is pivotal in its antibacterial activity [22]. The synthetic
loop of the LPS-binding domain from the ALFs of mud crab [8], shrimp [9,11,12], and Indian mud
186
Mar. Drugs 2016, 14, 227
crab [10] inhibit both gram-negative and gram-positive bacteria, while that from the ALF of black
tiger shrimp protects hematopoietic cell cultures from white spot syndrome virus infection [23].
Li et al. [13] had compared antibacterial and antiviral activities of the LPS-binding domain of seven
ALF isoforms from the Chinese shrimp and revealed that an identical Lys residue site was specifically
conserved in peptide with antimicrobial activity, suggesting that a certain Lys residue is a key residue
in antimicrobial activity.
In the present study, to increase the antimicrobial activity of the LGBP derived peptide,
we modified the Pro215, Met219, and Pro221 residues of the parent peptide (HDH-LGBP-N)
were substituted with Lys, Lys, and Leu to create HDH-LGBP A1; by substituting the Try222 of
HDH-LGBP-A1 with Lys, HDH-LGBP-A2 was created (Table 1 and Figure 2). Unlike the parent peptide,
the synthetic peptide analogs exhibited inhibitory activities not only against gram-negative and
gram-positive bacteria but also against the yeast C. albicans. This may have been due to the increased
cationicity (net charge) and hydrophobicity of HDH-LGBP-A1 and HDH-LGBP-A2, which facilitated
their penetration of the bacterial membrane. The positively charged region of AMPs presumably
interacts with the negatively charged bacterial membrane bilayer to form pores via “barrel-stave”,
“carpet”, “toroidal-pore”, or “detergent” mechanisms [21,24,25]. Schiffer-Edmandson helical wheel
modeling indicated that our LGBP analogs had a hydrophobic area positioned on one side and a
positive region on the opposite side (Figure 2). However, the substitution of Lys residue at C-terminus
of HDH-LGBP-A2 did not increase the antimicrobial activity (Table 2 and Figure 3).
The antimicrobial and cytotoxic activities of AMPs are mediated by targeting the membrane.
To determine the effects of HDH-LGBP on mammalian cells, we investigated the toxic effects of
HDH-LGBP-A1 and HDH-LGBP-A2 on normal HUVECs and on three cancer cell lines (HeLa, A549,
and HCT 116) (Figure 4). The two peptides showed greater cytotoxic than normal-cell toxicity,
as determined by comparison of the number of lysed cells. Flow cytometry showed that the two analogs
bind to cancer cells and interrupt the cell membrane; thus, the mechanism of the peptides’ cytotoxic
effects are similar to that underlying their antimicrobial activities. Like the bacterial cell membrane,
the membrane of a cancer cell is rich in negatively charged components such as PS, glycoproteins,
and glycosaminoglycans [26]. Accordingly, these negatively charged membrane components favor
the binding of positively charged AMPs. Further studies are needed to examine the direct interaction
of LGBPs with bacterial and cancer cell membranes and to understand the mechanism underlying
the cytotoxic effects of these peptides. In our laboratory, we are currently investigating the cytotoxic
mechanisms and activities of HDH-LGBP-A1 and HDH-LGBP-A2.
The therapeutic application of AMPs has been hindered by problems such as toxicity, low stability,
and high production costs. Furthermore, the salt sensitivity and thermal stability of AMPs pose major
obstacles in their development as novel antibiotics, as many of these peptides lose their antimicrobial
activities under physiological salt concentrations and high temperatures [27]. HDH-LGBP-A1 and
HDH-LGBP-A2, by contrast, maintained their antimicrobial activities after high-temperature treatment.
Therefore, these two analogs may be of value in therapeutic applications.
In conclusion, we successfully designed novel AMPs with high thermal stability and anti-cancer
activity using peptide mimetics based on the polysaccharide binding motif of the LGBP of Haliotis
discus hannai. Synthetic, stable HDH-LGBP-A1 and HDH-LGBP-A2 showed potent antimicrobial
activity against bacteria and fungi as well as specific cytotoxicity against cancer, but not normal cells,
at concentrations <50 µg/mL. Importantly, because HDH-LGBP-A1 and HDH-LGBP-A2 do not contain
non-natural or chemically modified amino acids, they can be produced in a cost-effective manner in
biological expression systems. Low in vivo stability, toxicity to mammalian cells, and the high cost of
production of most AMPs have prevented their clinical use. However, the absence of these features
combined with the antimicrobial and cytotoxic effects of HDH-LGBP-A1 and -A2 demonstrated in this
study recommend their further exploration for clinical applications.
187
Mar. Drugs 2016, 14, 227
4. Materials and Methods
4.1. Cloning and Sequencing the Full-Length cDNA of Abalone LGBP
cDNA libraries were constructed from seven tissues obtained from three-year-old disk abalones
(Haliotis discus hannai), and the expressed sequence tags were analyzed as described in a previous
study [28]. The sequence of the 632-bp EST clone DGT-151, isolated from the cDNA library prepared
from digestive tract tissues, was homologous to the sequences of the LGBPs of other species. To obtain
the full-length cDNA of the LGBP gene, digestive tract cDNAs for the 5′ - and 3′ -random amplification
of cDNA ends (RACE) were synthesized using a SMART RACE cDNA amplification kit (BD Bioscience,
San Jose, CA, USA) according to the manufacturer’s instructions. Gene-specific primers for 5′ - and
3′ -RACE were designed based on the partial sequences of the DGT-151 clone (Table 1). The amplified
fragments were subcloned into pGEM-T Easy vector (Promega, Madison, WI, USA) and sequenced
using an ABI3130 automatic DNA sequencer (Applied Biosystems, Carlsbad, CA, USA). To complete
the full-length sequence of LGBP cDNA, the partial sequences of the 5′ - and 3′ -ends and the partial
sequence of DGT-151 were combined and aligned using GENETYX version 8.0 (SDC Software
Development, Tokyo, Japan).
4.2. Computational Sequence Analysis
The amino acid sequence was deduced from the obtained cDNA, and the molecular mass
and isoelectric point were calculated using GENETYX version 8.0 (SDC Software Development,
Tokyo, Japan). Sequence similarities with other known sequences were identified using the BLASTP
program from the NCBI [29]. The presence of signal peptides was predicted using SignalP 3.0 [30],
and domain searches were conducted in the CD-search in NCBI and Pfam sequence search [31].
4.3. Structure Prediction
The secondary structure of the peptides was predicted using the GOR method (ExPASy).
The theoretical isoelectric point (pI) and net charge were estimated using the ExPASy server [32].
Helical wheel diagrams were produced using EMBOSS Pepwheel (European Bioinformatics Institute,
Cambridge, UK) [33]. The Boman index [34] was calculated according to the online Antimicrobial
Peptide Database [35].
4.4. Peptide Design and Synthesis
A peptide with the amino acid sequence WLWPAIWMLPT, corresponding to the polysaccharidebinding domain of HDH-LGBP and named HDH-LGBP-N, and two modified analogs (HDH-LGBP-A1
and HDH-LGBP-A2) were designed and synthesized commercially by Peptron, Inc. (Daejeon, Korea);
the purity grade was >95%. Briefly, the peptide was synthesized using Fmoc solid-phase peptide
synthesis (SPPS) with ASP48S (Peptron, Inc., Daejeon, Korea) and purified using reverse-phase
high-performance liquid chromatography with a Vydac Everest C18 column (250 mm × 22 mm, 10 µm;
Grace, Deerfield, IL, USA). The fractions were eluted with a water-acetonitrile linear gradient (3%–40%
(v/v) of acetonitrile) containing 0.1% (v/v) trifluoroacetic acid. The molecular masses of the purified
peptides were confirmed using liquid chromatography/mass spectrometry (HP1100 series; Agilent,
Santa Clara, CA, USA). All synthetic peptides were dissolved in 0.01% acetic acid to obtain stock
solutions of 1000 µg/mL.
4.5. Ultrasensitive Radial Diffusion Assay (URDA) for Antimicrobial Potency
The antimicrobial activity of the purified peptide was assessed as described previously [31].
The antimicrobial activities of the synthetic peptides were tested against the gram-positive bacteria,
Bacillus cereus, Staphylococcus aureus RM4220, Streptococcu siniae FP5229, and S. mutans; the gram-negative
bacteria, Pseudomonas aeruginosa KCTC2004, Vibrio anguillarum, and Vibrio harveyi KCCM40866; and the
188
Mar. Drugs 2016, 14, 227
yeast, Candida albicans KCTC7965. The bacterial strains were grown in brain-heart infusion medium
(BHI; BD Biosciences, San Jose, CA, USA) at the appropriate temperature (25 ◦ C for P. aeruginosa and S.
iniae, and 37 ◦ C for the other strains). The yeast strain C. albicans KCTC7965 was grown in yeast medium
(YM) at 25 ◦ C. After 16–18 h of incubation, the bacterial and C. albicans suspensions were diluted
to a McFarland turbidity standard of 0.5 (Vitek Colorimeter #52-1210; Hach, Loveland, CO, USA)
corresponding to ~108 CFU/mL for bacteria and ~106 CFU/mL for C. albicans. A 500-mL aliquot
of the diluted bacterial or C. albicans suspension was added to 9.5 mL of underlay gel containing
5 × 106 CFU/mL or 5 × 104 CFU/mL in 10 mM phosphate-buffered saline (PBS; pH 6.6) with
0.03% Tryptic Soy Broth (TSB) or 0.03% Sabouraud Dextrose Broth (SDB) and 1% type I low-EEO
agarose. The purified peptide was serially diluted twofold in 5 µL of acidified water (0.01% HAc), and
each dilution was added to 2.5-mm-diameter wells made in the 1-mm-thick underlay gels. After a 3 h
incubation at either 25 ◦ C (P. aeruginosa, S. iniae, and C. albicans) or 37 ◦ C (the other strains), the bacterial
or yeast suspension was overlaid with 10 mL of double-strength overlay gel containing 6% BHI or
6% YM prepared in 10 mM PBS (pH 6.6) and using 1% agarose. The plates were incubated for an
additional 18–24 h, after which, the clearing zone diameters were measured. After subtracting the
diameter of the well, the clearing zone diameter was expressed in units (0.1 mm = 1 U).
4.6. Minimal Effective Concentration of the GBP-Derived Analogs
All tested bacteria and yeast were prepared as described above. The minimal effective concentration
(MEC, µg/mL) of the synthetic peptides was calculated as the x-intercept of a plot of the abovedescribed units against the log10 of the peptide concentration [36,37]. The antimicrobial assay was
performed in triplicate, and the results were averaged.
4.7. Effect of Temperature on Antimicrobial Activity
To explore thermal stability, the LGBP analogs were incubated at 100 ◦ C for 10 min, cooled,
and then used in the above-described URDA against the bacteria, B. cereus, S. aureus, S. iniae,
and P. aeruginosa; and the yeast, C. albicans.
4.8. Cell Culture
Primary umbilical vein endothelial cells (HUVEC; normal human cells), HeLa (human cervical
adenocarcinoma), A549 (human lung adenocarcinoma), and HCT 116 (human colorectal carcinoma)
cell lines were purchased from the American Type Culture Collection (ATCC; Rockville, MD, USA).
HUVEC cells were maintained in vascular cell basal medium (ATCC PCS-100-030) containing Plus
One endothelial cell growth factor (ATCC PCS-100-040), and 100 U antibiotics-antimycotics/mL
(Life Technologies, Carlsbad, CA, USA) at 37 ◦ C in a 5% CO2 incubator (SANYO, Moriguchi, Osaka,
Japan). The three cancer cell lines were maintained in DMEM (Welgene, Gyeongsan, Korea) containing
10% fetal bovine serum (Gibco, Grand Island, NY, USA) and 100 U antibiotics–antimycotics/mL
(Life Technologies, Carlsbad, CA, USA) at 37 ◦ C in a 5% CO2 incubator.
4.9. Cell Viability
The cytotoxicity of the AMPs in HUVEC, HeLa, A549, and HCT 116 cells was determined
individually using an MTS assay, according to the manufacturer’s instructions of CellTiter 96®
Aqueous One Solution Cell Proliferation Assay (Promega, Mannheim, Germany). Briefly, HUVEC,
HeLa, A549, and HCT 116 cells (4 × 103 cells/well) were cultured at 37 ◦ C in 96-well plates
(Corning, New York, NY, USA) overnight and then incubated for an additional 24 h with 1, 5, 10, 25,
or 50 µg/mL of HDH-LGBP-A1 or -A2. Cells in the control group were incubated with 0.01% acetic
acid. At the end of the treatment period, 20 µL of a mixture of MTS and the electron-coupling reagent
phenazinemethosulfate (Promega, Mannheim, Germany) was added, and the cells were incubated
for 4 h at 37 ◦ C. A microtiter plate reader (Perkin Elmer, Waltham, MA, USA) was used to measure
the absorbance at 490 nm. The experiment was performed in triplicate and in three independent
189
Mar. Drugs 2016, 14, 227
experiments. The results are expressed as the percentage inhibition of viable cells. Negative control
(0.01% acetic acid) values were subtracted from the experimental results.
4.10. FITC-Annexin V and Propidium Iodide (PI) Staining
To evaluate the effects of HDH-LGBP on cell membrane integrity and cell-surface
phosphatidylserine (PS) exposure, HeLa cells seeded in a 35-mm dish (3.5 × 105 cells/dish)
(Corning, New York, NY, USA) and incubated at 37 ◦ C for 24 h were treated with HDH-LGBP-A1 or
-A2 at concentrations of 1–50 µg/mL or with 0.01% acetic acid (negative control). After 24 h, the cells
were harvested by tryptic digestion, washed with cold PBS, resuspended in binding buffer (0.01 M
Hepes/NaOH (pH 7.4), 0.14 M NaCl, 2.5 mM CaCl2 ), and stained according to the manufacturer's
instructions with FITC-annexin V and PI (FITC-Annexin V apoptosis detection kit, BD Biosciences).
The stained cells were gently mixed and evaluated by flow cytometry (FC500, Beckman Coulter).
The results were analyzed using Cell Quest software (BD Biosciences, San Jose, CA, USA). During the
early stage of apoptosis, PS shifts from the inner to the outer layer of the plasma membrane. Annexin V,
a calcium-dependent, phospholipid-binding protein, binds to PS with high affinity, providing a marker
of cell apoptosis. Viable cells with an intact membrane exclude PI, whereas the disrupted membranes
of damaged or dead cells are permeable to the dye. The Q1, Q2, Q3, and Q4 gates represented dead
cells, the late stage of cell apoptosis, normal cells, and the early stage of cell apoptosis, respectively.
Acknowledgments: This work was supported by grants from the National Institute of Fisheries Science (R2016024)
and Marine Biotechnology Program (PJT200620) funded by Ministry of Oceans and Fisheries, Korea.
Author Contributions: B.-H.N. and J.-K.S. conceived and designed the experiments, and wrote the paper;
J.Y.M. and E.H.P. performed the experiments; H.J.K., Y.-O.K., D.-G.K., W.-J.K. and C.M.A. revised and edited
the manuscript.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
Hoffman, O.A.; Olson, E.J.; Limper, A.H. Fungal beta glucans modulate macrophage release of tumor
necrosis factor-alpha in response to bacterial lipopolysaccharide. Immunol. Lett. 1993, 37, 19–25. [CrossRef]
Lee, S.Y.; Wang, R.; Söderhäll, K. A lipopolysaccharide- and beta-1,3-glucan-binding protein from hemocytes
of the freshwater crayfish Pacifastacus leniusculus. Purification, characterization, and cDNA cloning.
J. Biol. Chem. 2000, 275, 1337–1343. [CrossRef] [PubMed]
Lin, Y.C.; Vaseeharan, B.; Chen, J.C. Identification and phylogenetic analysis on lipopolysaccharide and
beta-1,3-glucan binding protein (LGBP) of kuruma shrimp Marsupenaeus japonicus. Dev. Comp. Immunol.
2008, 32, 1260–1269. [CrossRef] [PubMed]
Liu, F.; Li, F.; Dong, B.; Wang, X.; Xiang, J. Molecular cloning and characterisation of a pattern
recognition protein, lipopolysaccharide and beta-1,3-glucan binding protein (LGBP) from Chinese shrimp
Fenneropenaeus chinensis. Mol. Biol. Rep. 2009, 36, 471–477. [CrossRef] [PubMed]
Su, J.; Ni, D.; Song, L.; Zhao, J.; Qiu, L. Molecular cloning and characterization of a short type peptidoglycan
recognition protein (CfPGRP-S1) cDNA from Zhikong scallop Chlamys farreri. Fish Shellfish Immunol. 2007,
23, 646–656. [CrossRef] [PubMed]
Nikapitiya, C.; De Zoysa, M.; Lee, J. Molecular characterization and gene expression analysis of a pattern
recognition protein from disk abalone, Haliotis discus discus. Fish Shellfish Immunol. 2008, 25, 638–647.
[CrossRef] [PubMed]
Zhang, D.; Ma, J.; Jiang, J.; Qiu, L.; Zhu, C.; Su, T.; Li, Y.; Wu, K.; Jiang, S. Molecular characterization
and expression analysis of lipopolysaccharide and β-1,3-glucan-binding protein (LGBP) from pearl oyster
Pinctada fucata. Mol. Biol. Rep. 2010, 37, 3335–3343. [CrossRef] [PubMed]
Imjongjirak, C.; Amparyup, P.; Tassanakajon, A.; Sittipraneed, S. Antilipopolysaccharide factor (ALF) of
mud crab Scylla paramamosain: Molecular cloning, genomic organization and the antimicrobial activity of its
synthetic LPS binding domain. Mol. Immunol. 2007, 44, 3195–3203. [CrossRef] [PubMed]
190
Mar. Drugs 2016, 14, 227
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
Pan, C.Y.; Chao, T.T.; Chen, J.C.; Chen, J.Y.; Liu, W.C.; Lin, C.H.; Kuo, C.M. Shrimp (Penaeus monodon) antilipopolysaccharide factor reduces the lethality of Pseudomonas aeruginosa sepsis in mice. Int. Immunopharmacol.
2007, 7, 687–700. [CrossRef] [PubMed]
Sharma, S.; Yedery, R.D.; Patgaonkar, M.S.; Selvaakumar, C.; Reddy, K.V. Antibacterial activity of a synthetic
peptide that mimics the LPS binding domain of Indian mud crab, Scylla serrata anti-lipopolysaccharide
factor (SsALF) also involved in the modulation of vaginal immune functions through NF-kB signaling.
Microb. Pathog. 2011, 50, 179–191. [CrossRef] [PubMed]
Guo, S.Y.; Li, S.H.; Li, F.H.; Zhang, X.J.; Xiang, J.H. Modification of a synthetic LPS-binding domain of
anti-lipopolysaccharide factor from shrimp reveals strong structure-activity relationship in their antimicrobial
characteristics. Dev. Comp. Immunol. 2014, 45, 227–232. [CrossRef] [PubMed]
Li, S.H.; Guo, S.Y.; Li, F.H.; Xiang, J.H. Characterization and function analysis of an anti-lipopolysaccharide
factor (ALF) from the Chinese shrimp Fenneropenaeus chinensis. Dev. Comp. Immunol. 2014, 46, 349–355.
[CrossRef] [PubMed]
Li, S.H.; Guo, S.Y.; Li, F.H.; Xiang, J.H. Functional diversity of anti-lipopolysaccharide factor isoforms in
shrimp and their characters related to antiviral activity. Mar. Drugs 2015, 13, 2602–2616. [CrossRef] [PubMed]
Drago-Serrano, M.E.; de la Garza-Amaya, M.; Luna, J.S.; Campos-Rodriguez, R. Lactoferrin-lipopolysaccharide
(LPS) binding as key to antibacterial and antiendotoxic effects. Int. Immunopharmacol. 2012, 12, 1–9.
[CrossRef] [PubMed]
Lee, H.; Kwon, H.M.; Park, J.W.; Kurokawa, K.; Lee, B.L. N-terminal GNBP homology domain of
Gram-negative binding protein 3 functions as a beta-1,3-gluganc binding motif in Tenebrio molitor. BMB Rep.
2009, 42, 506–510. [CrossRef] [PubMed]
Zasloff, M. Antimicrobial peptides of multicellular organisms. Nature 2002, 415, 389–395. [CrossRef]
[PubMed]
Hancock, R.E.; Diamond, G. The role of cationic antimicrobial peptides in innate host defences.
Trends Microbiol. 2000, 8, 402–410. [CrossRef]
Gaspar, D.; Veiga, A.S.; Castanho, M.A.R.B. From antimicrobial to cytotoxic peptides. A review.
Front. Microbiol. 2013, 4, 1–16. [CrossRef] [PubMed]
Ausbacher, D.; Svineng, G.; Hansen, T.; Strom, M.B. Cytotoxic mechanisms of action of two small amphipathic
beta(2,2)-amino acid derivatives derived from antimicrobial peptides. Biochim. Biophys. Acta 2012, 1818,
2917–2925. [CrossRef] [PubMed]
Reddy, K.V.R.; Yedery, R.D.; Aranha, C. Antimicrobial peptides: Premises and promises. Int. J.
Antimicrob. Agents 2004, 24, 536–547. [CrossRef] [PubMed]
Oren, Z.; Hong, J.; Shai, Y. A comparative study on the structure and function of a cytolytic alpha-helical
peptide and its antimicrobial beta-sheet diastereomer. Eur. J. Biochem. 1999, 259, 360–369. [CrossRef]
[PubMed]
Rosa, R.D.; Vergnes, A.; de Lorgeril, J.; Goncalves, P.; Perazzolo, L.M.; Sauné, L.; Romestand, B.; Fievet, J.;
Gueguen, Y.; Bachère, E.; et al. Functional divergence in shrimp anti-lipopolysaccharide factors (ALFs):
From recognition of cell wall components to antimicrobial activity. PLoS ONE 2013, 8, e67937. [CrossRef]
[PubMed]
Tharntada, S.; Ponprateep, S.; Somboonwiwat, K.; Liu, H.; Söderhäll, I.; Söderhäll, K.; Tassanakajon, A.
Role of anti-lipopolysaccharide factor from the black tiger shrimp, Penaeus monodon, in protection from white
spot syndrome virus infection. J. Gen. Virol. 2009, 90, 1491–1498. [CrossRef] [PubMed]
Pouny, Y.; Shai, Y. Interaction of D-amino acid incorporated analogs of pardaxin with membranes.
Biochemistry 1992, 31, 9482–9490. [CrossRef] [PubMed]
Schweizer, F. Cationic amphiphilic peptides with cancer-selective toxicity. Eur. J. Pharmacol. 2009, 625,
190–194. [CrossRef] [PubMed]
Hoskin, D.W.; Ramamoorthy, A. Studies on cytotoxic activities of antimicrobial peptides. Biochim. Biophys.
Acta Biomembr. 2008, 1778, 357–375. [CrossRef] [PubMed]
Goldman, M.J.; Anderson, G.M.; Stolzenberg, E.D.; Kari, U.P.; Zasloff, M.; Wilson, J.M. Human b-defensin-1
is a salt-sensitive antibiotic in lung that is inactivated in cystic fibrosis. Cell 1997, 88, 553–560. [CrossRef]
Park, E.M.; Nam, B.H.; Kim, Y.O.; Kong, H.J.; Kim, W.J.; Lee, S.J.; Kong, I.S.; Choi, T.J. EST-based survey of
gene expression in seven tissue types from the abalone Haliotis discus hannai. J. Fish. Sci. Technol. 2007, 10,
119–126. [CrossRef]
191
Mar. Drugs 2016, 14, 227
29.
30.
31.
32.
33.
34.
35.
36.
37.
National Center for Biotechnology Information. Available online: http://ncbi.nlm.nih.gov/blast/
(accessed on 8 January 2013).
SignalP 4.1 Server. Available online: http://www.cbs.dtu.dk/services/SignalP/ (accessed on 11 April 2013).
Pfam Protein Family Database. Available online: http://pfam.xfam.org/search/ (accessed on 30 June 2013).
SIB Bioinformatics Resources Portal. Available online: http://web.expasy.org/peptide_mass/ (accessed on
30 June 2013).
Ramachandran, G.N.; Sasisekharan, V. Conformation of polypeptides and proteins. Adv. Prot. Chem. 1968,
23, 283–437.
Boman, H. Antibacterial peptides, basic facts and emerging concepts. J. Int. Med. 2003, 254, 197–215.
[CrossRef]
The Antimicrobial Peptide Database. Available online: http://aps.unmc.edu/Ap/main.php/ (accessed on
30 June 2013).
Seo, J.K.; Crawford, J.M.; Stone, K.L.; Noga, E.J. Purification of a novel arthropod defensin from the American
oyster, Crassostrea virginica. Biochem. Biophys. Res. Commun. 2005, 338, 1998–2004. [CrossRef] [PubMed]
Lehrer, R.I.; Rosenman, M.; Harwig, S.S.L.; Jackson, R.; Eisenhaur, P. Ultrasensitive assay for endogenous
antimicrobial polypeptides. J. Immunol. Methods 1991, 137, 167–173. [CrossRef]
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
192
marine drugs
Article
Protective Effects of Hydrolyzed Nucleoproteins from
Salmon Milt against Ethanol-Induced Liver Injury
in Rats
Akiko Kojima-Yuasa 1, *, Mayu Goto 1 , Eri Yoshikawa 1 , Yuri Morita 1 , Hirotaka Sekiguchi 2 ,
Keita Sutoh 2 , Koji Usumi 2 and Isao Matsui-Yuasa 1
1
2
*
Department of Food and Human Health Sciences, Graduate School of Human Life Science,
Osaka City University, Osaka 558-8585, Japan; v-oooogue@ezweb.ne.jp (M.G.); eri92011@gmail.com (E.Y.);
morimaru.y@gmail.com (Y.M.); yuasa-i@hotmail.co.jp (I.M.-Y.)
Life Science Institute Co., Ltd., Tokyo 103-0012, Japan; sekiguchi@life-science.co.jp (H.S.);
sutoh@life-science.co.jp (K.S.); usumi@life-science.co.jp (K.U.)
Correspondence: kojima@life.osaka-cu.ac.jp; Tel.: +81-6-6605-2865
Academic Editor: Se-Kwon Kim
Received: 17 October 2016; Accepted: 15 December 2016; Published: 19 December 2016
Abstract: Dietary nucleotides play a role in maintaining the immune responses of both animals
and humans. Oral administration of nucleic acids from salmon milt have physiological functions
in the cellular metabolism, proliferation, differentiation, and apoptosis of human small intestinal
epithelial cells. In this study, we examined the effects of DNA-rich nucleic acids prepared from
salmon milt (DNSM) on the development of liver fibrosis in an in vivo ethanol-carbon tetrachloride
cirrhosis model. Plasma aspartate transaminase and alanine transaminase were significantly less
active in the DNSM-treated group than in the ethanol plus carbon tetrachloride (CCl4 )-treated group.
Collagen accumulation in the liver and hepatic necrosis were observed histologically in ethanol plus
CCl4 -treated rats; however, DNSM-treatment fully protected rats against ethanol plus CCl4 -induced
liver fibrosis and necrosis. Furthermore, we examined whether DNSM had a preventive effect against
alcohol-induced liver injury by regulating the cytochrome p450 2E1 (CYP2E1)-mediated oxidative
stress pathway in an in vivo model. In this model, CYP2E1 activity in ethanol plus CCl4 -treated
rats increased significantly, but DNSM-treatment suppressed the enzyme’s activity and reduced
intracellular thiobarbituric acid reactive substances (TBARS) levels. Furthermore, the hepatocytes
treated with 100 mM ethanol induced an increase in cell death and were not restored to the control
levels when treated with DNSM, suggesting that digestive products of DNSM are effective for the
prevention of alcohol-induced liver injury. Deoxyadenosine suppressed the ethanol-induced increase
in cell death and increased the activity of alcohol dehydrogenase. These results suggest that DNSM
treatment represents a novel tool for the prevention of alcohol-induced liver injury.
Keywords: DNA-rich nucleic acid prepared from salmon milt (DNSM); in vivo ethanol-carbon
tetrachloride cirrhosis model; plasma aminotransferases (AST and ALT); collagen accumulation;
CYP2E1 activity; alcohol-induced liver injury; rats
1. Introduction
Alcoholic liver disease is a pathological process characterized by progressive liver damage that
leads to steatosis, steatohepatitis, fibrosis, and ultimately cirrhosis, which may further progress
to hepatocellular cancer [1–3]. Oxidative stress plays an important role in this process [4,5].
Alcohol-induced oxidative stress associated with ethanol metabolism in the liver plays a major role in
ethanol-induced liver injury. Alcohol dehydrogenase is the major enzyme responsible for oxidizing
Mar. Drugs 2016, 14, 232
193
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2016, 14, 232
ethanol to aldehyde in alcohol metabolism. Heavy consumption of ethanol induces cytochrome
p450 2E1 (CYP2E1) activity in hepatocytes. This enzyme complements the activity of a constitutively
expressed alcohol dehydrogenase in oxidizing ethanol to acetaldehyde [6]. However, CYP2E1 generates
reactive oxygen species (ROS) quite efficiently, which appears to play a major role in ethanol-induced
liver injury [7–10]. Therefore, possible strategies for preventing the production of these ROS may be
effective in attempts to minimize the hepatotoxicity of ethanol in humans.
Animal models of liver fibrosis are important for understanding the underlying mechanisms of the
treatments used to combat this disease. Currently, two models have been developed for administering
alcohol to animals: the Lieber-De Carli liquid diet [11] and the Tsukamoto-French gastric model [12].
In the Lieber-De Carli liquid diet, ethanol replaces the carbohydrates of a normal diet. Tsukamoto and
French developed an in vivo animal model in which enteral ethanol is continuously administered to
the animal via intragastric infusion. However, neither the Lieber De Caarli nor the Tsukamoto/French
feeding protocol results in cirrhosis in rats. Tipoe et al. reported another model for administering
dietary alcohol and fish oil (30% of calories) and showed that an increase in profibrogenic mediators
was not associated with the presence of histological evidence of fibrosis [13]. Contrastingly, Siegers et al.
developed a model for the administration of low-dose carbon tetrachloride (CCl4 ) and a 5% ethanol
solution that produced histological changes in rats similar to those found in human alcoholic cirrhosis
within four weeks [14]. We have also shown that hepatic histological changes occurred within four
weeks of the administration of low-dose CCl4 and a 5% ethanol solution [15,16].
Salmon milts contain mainly nucleic acids, protamine, and polyamine. These components play
an important role in the diet. Dietary nucleic acids are particularly important for the development
and growth of tissues. Nucleic acids are partly degraded by nucleases in the intestine and absorbed as
nucleosides and nucleobases. Dietary nucleotides play a role in maintenance of immune responses in
both animals and humans [17–19]. Several researchers have also reported that orally administered
nucleic acids from salmon milt play a role in physiological functions such as cellular metabolism,
proliferation, differentiation, and apoptosis in human small intestinal epithelial cells [17,20,21].
Additionally, Sakai et al. have reported that dietary ribonucleic acid (RNA) suppresses inflammation
in adipose tissue and improves glucose intolerance in mice fed a high-fat diet [22].
In this study, we examined the effect of DNA-rich nucleic acids prepared from salmon milt
(DNSM) on the development of liver fibrosis in an in vivo ethanol-CCl4 -induced cirrhosis rat model
and in an in vitro alcohol-injury hepatocytes model, and we found that DNSM protected hepatocytes
against ethanol induced liver injury.
2. Results
Figure 1 shows changes in body weight during the experimental period. The body weights of
ethanol plus CCl4 -treated rats and 0.12% DNSM diet- and ethanol plus CCl4 -treated rats tended to
be lower than those rats fed the control diet or CCl4 alone. However, these differences were not
statistically significant.
Figure 1. Changes in body weight. : Control diet, : Control diet with 5% ethanol plus CCl4 ,
△: Control diet with CCl4 , : 0.12% DNSM diet with 5% ethanol plus CCl4 .
194
Mar. Drugs 2016, 14, 232
We examined the effect of nucleoprotein treatment on plasma aspartate aminotransferase (AST)
and alanine aminotransferase (ALT) activities. As shown in Figure 2, in the ethanol plus CCl4
(0.1 mL/kg of body weight)-treated group, plasma AST and ALT activities increased by 1.8- and
3.5-fold, respectively, compared to the control group. However, these same enzymes were significantly
less active in the DNSM-treated group compared to the ethanol plus CCl4 -treated group.
Figure 2. The effect of DNSM on serum AST and ALT activity in ethanol plus CCl4 -treated rats. Effect of
DNSM on (A) serum AST activity; and (B) serum ALT activity. Data are presented as the mean ± S.E. of
the activity of five rats. Values without a common letter are significantly different (p < 0.01). : Control
diet, : Control diet with 5% ethanol plus CCl4 , △: Control diet with CCl4 , : 0.12% DNSM diet with
5% ethanol plus CCl4 .
Histological analysis was performed by hematoxylin and eosin staining as well as elastic
van Gieson (EVG) staining and Mason’s trichrome staining to assess liver damage (Figure 3).
No histological abnormalities were observed in the control rats or CCl4 -treated rats, but collagen
accumulation in the liver and hepatic necrosis were observed in ethanol plus CCl4 -treated rats.
However, treatment with DNSM fully protected the rats from liver fibrosis and necrosis induced
by ethanol plus CCl4 .
Figure 3. Cont.
195
Mar. Drugs 2016, 14, 232
Figure 3. The effect of DNSM on the changes in liver morphology. Liver sections were processed
for (A) EVG staining; and (B) Masson’s trichrome staining. (a) Control diet; (b) Control diet with 5%
ethanol plus CCl4 ; (c) Control diet with CCl4 ; (d) 0.12% DNSM diet with 5% ethanol plus CCl4 .
Ethanol-induced oxidative stress from CYP2E1 appears to play a major role in ethanol-induced
liver injury [7–10]. We have previously demonstrated that Yerba mate extract suppressed the CTP2E1
activity induced by ethanol in both in vitro and in vivo models [16]. Therefore, we examined whether
DNSM treatment could also have a preventive effect against alcohol-induced liver injury by regulating
the CYP2E1 enzyme in an in vivo model. In ethanol plus CCl4 -treated rats, CYP2E1 activity increased
2.1-fold compared to the control group. However, DNSM-treatments suppressed CYP2E1 activity
(Figure 4). We examined the effect of DNSM on the increase in intracellular lipid peroxidation using the
thiobarbituric acid reactive substances (TBARS) assay. In ethanol plus CCl4-treated rats, hepatic TBARS
levels were significantly increased. However, DNSM-treatment maintained the intracellular TBARS
levels at the lower levels of the control rats (Figure 5).
Figure 4. The effect of DNSM on CYP2E1 activity in the livers of ethanol plus CCl4 -treated rats.
CYP2E1 activity was determined using the ̺-nitrophenol (PNP) assay, as described in the Materials
and Methods. (C) Control diet; (ET) Control diet with 5% ethanol plus CCl4 ; (T) Control diet with
CCl4 ; (DNSM) 0.12% DNSM diet with 5% ethanol plus CCl4 . Data are presented as the mean ± S.E. of
five animals. Values without a common letter are significantly different (p < 0.01).
196
Mar. Drugs 2016, 14, 232
Figure 5. The effect of DNSM on lipid peroxidation in the liver. The measurement of lipid peroxidation
using a colorimetric reaction with thiobarbitric acid (TBA) was carried out according to the method
described by Ohkawa. The measured lipid peroxidation was expressed as malondialdehyde (MDA).
(C) Control diet; (ET) Control diet with 5% ethanol plus CCl4 ; (T) Control diet with CCl4 ; (DNSM) 0.12%
DNSM diet with 5% ethanol plus CCl4 . Each bar is the mean ± S.E. of five animals. Values without a
common letter are significantly different (p < 0.01).
Furthermore, we measured the weights of various organs after the experimental period. As shown
in Table 1, there were no differences among the weights of liver, kidney, and spleen in rats of the four
groups. However, the masses of epididymal fat and visceral fat of ethanol plus CCl4 -treated rats and
DNSM diet- and ethanol plus CCl4 -treated rats were lower than those rats fed the control diet or CCl4
alone. These results suggest that loss of body weight in ethanol plus CCl4 -treated rats and DNSM
diet- and ethanol plus CCl4 -treated rats may depend on the loss of fat and the loss may be induced by
ethanol ingestion.
Table 1. Changes in organ weight of rats.
Organ Weight (g)
Groups
C
ET
T
DNSM
Liver
Kidney
Spleen
Visceral Fat
Epididymal Fat
10.82 ± 0.38
10.54 ± 0.46
12.35 ± 0.47
10.76 ± 0.34
1.60 ± 0.03
1.58 ± 0.05
1.70 ± 0.08
1.66 ± 0.02
0.76 ± 0.04
0.75 ± 0.03
0.72 ± 0.02
0.70 ± 0.03
6.52 ± 0.55
4.54 ± 0.48
6.22 ± 0.52
4.79 ± 0.52
7.49 ± 0.61
4.74 ± 0.37
6.02 ± 0.20
5.44 ± 0.52
(C) Control diet; (ET) Control diet with 5% ethanol plus CCl4 ; (T) Control diet with CCl4 ; (DNSM) 0.12% DNSM
diet with 5% ethanol plus CCl4 .
To elucidate whether the protective effect of DNSM is dependent on digestion, we measured the
effect of DNSM treatment in an in vitro alcohol-induced injury model in hepatocytes. We previously
demonstrated that a treatment of 100 mM ethanol for 24 h significantly decreased cell viability of
hepatocytes compared with control cells [15]. Here, we measured the cell viability of hepatocytes
treated with 100 mM ethanol with or without various concentrations of DNSM. As shown in Figure 6A,
DNSM did not prevent cell death. These results suggest that digestive products of DNSM are effective
for the prevention of alcohol-induced liver injury. Therefore, the following experiments were carried
out with the presence of deoxyadenosine. Adenosine which is the digestive product of RNA also
was measured. Treatments of deoxyadenosine and adenosine prevented cell death in the hepatocytes
treated with 100 mM ethanol (Figure 6B). Furthermore, the effect of deoxyadenosine and adenosine on
the activity of alcohol dehydrogenase (ADH)—a main pathway of alcohol metabolism—was examined
in the cells incubated for 4 h with 100 mM ethanol. The treatment of deoxyadenosine and adenosine
increased the activities of ADH compared with the cells treated with 100 mM ethanol (Figure 7).
197
Mar. Drugs 2016, 14, 232
Figure 6. The effect of DNSM on ethanol-treated hepatocyte cell viability. Hepatocytes were incubated
with 100 mM ethanol with or without (A) various DNSM concentrations; and (B) deoxyadenosine or
adenosine for 24 h. Cell viability was measured by the Neutral Red assay, as described in the Materials
and Methods section. Data are presented as the mean ± S.E. of three experiments. Values without a
common letter are significantly different (p < 0.01).
Figure 7. Effects of adenosine or deoxyadenosine on ADH activity in ethanol-treated hepatocytes.
Hepatocytes were incubated for 4 h with 100 mM ethanol, with or without 25 µM deoxyadenosine or
adenosine. ADH activity analysis was performed as described in the Materials and Methods section.
Data are presented as the mean ± S.E.
198
Mar. Drugs 2016, 14, 232
3. Discussion
This study has shown that DNSM protects against ethanol-induced liver injury.
Here, we demonstrated that the liver damage biomarkers, ALT and AST, were increased in a
rat model given ethanol plus CCl4 to induce liver damage, but this increase was reduced by nucleic
acid supplementation. Furthermore, the DNSM treatment did not affect cell viability in ethanol-treated
hepatocytes, suggesting the digestive products, which are created by the degradation of DNSM by
nucleases in the intestine, are effective against alcohol-induced liver injury.
Alcohol-induced liver injury is induced by heavy drinking and is accompanied by the
degeneration or necrosis of hepatocytes, which disrupts normal liver function via oxidative stress.
The CYP2E1 enzyme is one of the major producers of ethanol-induced ROS. Therefore, decreasing or
inhibiting CYP2E1 activity may be a feasible strategy for minimizing the hepatotoxicity of ethanol.
Recently, we demonstrated that Ecklonia cava polyphenol-treatment maintained CYP2E1 activity in
ethanol-treated hepatocytes below that of control cells [23]. We also reported that treatment with
an extract of Yerba Mate tea suppressed ethanol-induced increases in CYP2E1 activity to the level
of the control cells in an in vitro, alcohol-induced hepatocyte model and an in vivo ethanol plus
CCl4 -induced liver-injury model [16].
In the present study, we have shown that DNSM treatment suppressed ethanol-induced increases
in CYP2E1 activity to the activity levels observed in the control rats and that the treatment of
deoxyadenosine increased the ADH activity compared with the cells treated with ethanol in an
in vitro alcohol injury hepatocyte model.
There are several reports that adenosine and deoxyadenosine has a protective effect against
various diseases. Modis et al. reported that adenosine and its metabolite, inosine, exerted cytoprotective
effects in an in vitro model of liver ischemia-reperfusion injury [24]. Hasemi et al. have shown that
adenosine and deoxyadenosine induces apoptosis in human breast cancer cells via the activation
of the mitochondria/intrinsic apoptotic pathway [25]. Furthermore, Lee reported that adenosine
protected Sprague-Dawley rats from a high-fat diet and repeated acute restraint stress-induced
intestinal inflammation and altered expression of nutrient transporters [26].
In the present study, the precise mechanism of the DNSM protection against ethanol-induced
liver injuries in rats is not clear. However, there are two possible explanations for this protection.
The first is via the cyclic AMP (cAMP)/protein kinase A (PKA) pathway. There are some reports
that the cAMP/PKA signaling pathway regulates the activities of alcohol dehydrogenase and
CYP2E1 in ethanol metabolism [27,28]. The administration of theophylline to rats, which inhibits
cAMP phosphodiesterase and thus increases endogenous cAMP levels, or the addition of dibutyryl
cAMP to hepatocyte cultures, both increased ADH activity [27]. Contrastingly, cAMP-dependent
phosphorylation of CYP2E1 lead to a reduction in CYP2E1 activity [28]. We have shown that the
treatment of Ecklonia cava polyphenol with ethanol increased the activity of alcohol dehydrogenase
and inhibits CYP2E1 activity [23]. The changes in CYP2E1 and alcohol dehydrogenase activity were
suppressed by treatment with H89, an inhibitor of PKA, suggesting that Eclonia cava polyphenol has a
protective effect against ethanol-induced liver injury in a cAMP-dependent manner.
Charest et al. showed that adenosine and AMP increased cAMP concentration by interacting with
the adenosine receptor [29,30]. These results suggest that DNSM was digested by nucleases in the
intestine and absorbed as nucleosides and nucleobases. Adenosine and AMP subsequently bind to the
adenosine receptor, which activates adenylate cyclase.
Another possibility is the involvement of the adenosine monophosphate-activated protein kinase
(AMPK) signaling pathway. AMPK is a sensor that regulates cellular metabolism and oxidative
stress [31,32]. Chronic alcohol consumption results in inhibition of the hepatic AMPK signaling
pathway by ethanol, which leads to steatosis [33]. Fat accumulation in hepatocytes leads to the
development of fatty liver. With continued alcohol consumption, fatty liver may progress to hepatitis
and cirrhosis. Therefore, it is important to enhance AMPK pathway signaling to protect the liver
against diseases induced by ethanol. Shin et al. have reported that β-lapachone, a naturally occurring
199
Mar. Drugs 2016, 14, 232
quinone, activated the AMPK pathway in ethanol-fed rats [34]. Wang et al. also indicated that
oligomeric proanthocyanidines, a class of flavonoid compounds, alleviated liver steatosis and damage
through AMPK activation against alcohol-induced liver steatosis and injury [35]. On the other hand,
Stenesen et al. reported that dietary adenine controlled adult lifespan via adenosine nucleotide
biosynthesis and AMPK activation [36]. Dietary adenine feeding increases the ratio of AMP:ATP and
ADP:ATP and activates AMPK. These results suggest that nucleoproteins activate the AMPK signaling
pathway in the liver.
It is important to know the precise mechanism of the DNSM protection against ethanol-induced
liver injuries in rats. Especially, the involvement of cAMP/PKA pathway or AMPK pathway in an
in vivo ethanol-carbon tetrachloride cirrhosis model need to be elucidated further.
4. Materials and Methods
4.1. Materials
DNA-rich nucleic acids from salmon milt (DNSM) were water-solubilized using nuclease
and protease. The nucleotide and amino acid composition of the DNSM is shown in Table 2.
DNSM were provided by Fordays Co., Ltd. (Tokyo, Japan) and L•S Corporation. Williams’ Medium
E and β-nicotinamide adenine dinucleotide hydrate were obtained from Sigma-Aldrich Co.
(St. Louis, MO, USA). Fetal bovine serum (FBS) was purchased from Nichirei Biosciences, Inc. (Tokyo,
Japan). The other chemicals used in this study were special-grade commercial products purchased
from WAKO Pure Chemical Co., Ltd. (Osaka, Japan).
Table 2. Composition of nucleotides and amino acids in DNSM.
Nucleotides *
Amount (g/100 g)
5′ -dCMP
5′ -dAMP
5′ -dTMP
5′ -dGMP
6.01
9.15
9.26
6.93
Total
31.35
Amino Acids
Amount (g/100 g)
Arg
Lys
His
Phe
Tyr
Leu
Ile
Met
Val
Ala
Gly
Pro
Glu
Ser
Thr
Asp
Trp
Cys
17.80
2.66
0.65
0.89
0.88
1.95
1.25
0.60
2.12
1.95
4.11
2.62
3.48
2.49
1.27
2.24
0.20
0.25
Total
47.41
* The amounts of nucleotides were analyzed after treatment of nuclease P1 .
200
Mar. Drugs 2016, 14, 232
4.2. Animals
Male Wistar rats were purchased from Japan SLC Inc. (Shizuoka, Japan). The rats were housed at
a constant temperature and were allowed free access to water and standard rat chow (LaboMR stock,
Japan SLC, Inc. Shizuoka, Japan). All animal experiments followed our institution’s criteria for the
care and use of laboratory animals in research, which meet the guidelines for animal experimentation
at Osaka City University.
4.3. Animal Experiments
Male Wistar rats weighing 180–210 g were fed a standard laboratory diet and water ad libitum
until three days prior to the experiment. The rats were then fed a control diet for three days and divided
into four groups. Group 1 was the control; Group 2 was treated with ethanol and CCl4 ; Group 3 was
treated with CCl4 alone; Group 4 was treated with ethanol, CCl4 , and 0.12% DNSM. The composition
of each diet is presented in Table 3. CCl4 (0.1 mL/kg of body weight diluted with olive oil to 25%) was
administered by intraperitoneal injection twice a week (on Mondays and Thursdays), and 5% ethanol
was administered in the drinking water ad libitum. The rats were euthanized after three weeks.
Table 3. Composition of diets.
Components (g)
Control
0.12% DNSM
Casein
L -Cystine
Cornstarch
α-Cornstarch
Sucrose
Soybean oil
Cellulose powder
Mineral mix (AIN-93G-MX) 1
Vitamin mix (AIN-93VX) 2
Choline hydrogen tartrate
t-Butylhydroquinone
DNSM
Total
200
3
397.486
132
100
70
50
35
10
2.5
0.014
0
1000
200
3
396.286
132
100
70
50
35
10
2.5
0.014
1.2
1000
1
Composition in g/kg diet: Calcium Carbonate, 357; Potassium Phosphate, Monobasic, 196;
Potassium Citrate·H2 O, 70.78; Sodium Chloride, 74; Potassium Sulfate, 46.6; Magnesium Oxide, 24; Ferric
Citrate, 6.06; Zinc Carbonate, 1.65; Manganese Carbonate, 0.63; Cupric Carbonate, 0.324; Potassium
Iodate, 0.01; Sodium Selenate, 0.01025; Chromium K Sulfate·12H2 O, 0.275; Ammonium Molybdate·4H2 O,
0.00795; Sodium Silicate·9H2 O, 1.45; Lithium Chloride, 0.0174; Boric Acid, 0.0815; Sodium Fluoride, 0.0635;
Nickel Carbonate·4H2 O, 0.0306; Ammonium Vanadate, 0.0066; Sucrose, 221.0032; 2 Composition in g/kg diet:
Vitamin A Acetate (500,000 IU/g), 0.8; Vitamin D3 (400,000 IU/g), 0.25; Vitamin E Acetate (500 IU/g), 15;
Phylloquinone, 0.075; Biotin, 2; Cyanocobalamin, 2.5; Folic Acid, 0.2; Nicotinic Acid, 3; Calcium Pantothenate,
1.6; Pyridoxine-HCl, 0.7; Riboflavin, 0.6; Thiamin HCl, 0.6; Sucrose, 974.655.
4.4. Histological Analysis
Liver samples were collected from each rat, fixed in 10% buffered formalin fixative, and then
dehydrated in a graded alcohol series. Following xylene treatment, the specimens were embedded in
paraffin blocks and cut into 5-µm sections. Consecutive sections were stained with EVG and Masson’s
trichrome staining. The pathologist was blinded to the rats’ group assignments.
4.5. Liver Damage Biomarkers
The activity of plasma AST and ALT were estimated using a Transaminase CII-test kit
(Wako, Japan).
201
Mar. Drugs 2016, 14, 232
4.6. CYP2E1 Activity Analysis
Livers were homogenized in nine volumes of tris HCl buffer (containing 0.25 M sucrose, pH 7.4)
using a Polytron 1600E (Central Science Trade Co., Inc., Tokyo, Japan). The homogenates were
centrifuged at 700× g for 10 min at 4 ◦ C. The supernatant was collected as an S9 fraction. The activity
of CYP2E1 was determined by the rate of hydroxylation of PNP measured at 546 nm [37]. The S9
fraction was added to 100 mM KH2 PO4 (containing 0.2 mM PNP and 2.0 mM NADPH, pH 6.8) and
incubated in a 37 ◦ C water bath for 20 min. The reaction was stopped using 0.6 M perchloric acid
(250 µL) and 10 M NaOH (75 µL) was added to the remaining supernatant. The results were expressed
as the amount of p-nitrophenol pmols/min/mg protein formed and the determined concentration of
4-nitrocatechol (ε = 10. 28 mM−1 ·cm−1 ).
4.7. Measurement of Lipid Peroxidation
Lipid peroxidation was measured according to the method described by Ohkawa using a
colorimetric reaction with thiobarbitric acid (TBA) and the measured lipid peroxidation was expressed
as malondialdehyde (MDA) [38]. The frozen liver samples were excised and homogenized in nine
volumes of ice-cold 1.15% KCl. Samples consisting of less than 0.2 mL of 10% (w/v) tissue homogenate
were then added to 0.2 mL of 8.1% sodium dodecyl sulfate, 1.5 mL of 20% acetic acid solution adjusted
to pH 3.5 with NaOH, and 1.5 mL of a 0.8% aqueous solution of TBA. The mixture was brought to a
total volume of 4.0 mL using distilled water, mixed with 5.0 mL of a mixture of n-butanol and pyridine
(15:1, v/v), and shaken vigorously. After centrifugation at 4000 rpm for 10 min, the organic layer was
collected and its absorbance was measured at 532 nm. 1,1,3,3-Terramethoxypropane was used as an
external standard. The level of lipid peroxidation was expressed in nmol of MDA.
4.8. Hepatocyte Preparation and Culture
Hepatocytes were isolated by collagenase perfusion following their removal from 10-week-old
male Wistar rats anesthetized with sodium pentobarbital [39]. The viability of the isolated hepatocytes
was greater than 90%, as determined by 0.2% trypan blue exclusion. The cells were plated on 35-mm
plastic dishes at a density of 2.5 × 105 cells/mL in 2 mL of Williams’ Medium E supplemented with
10% FBS. The cells were cultured in a humidified atmosphere (5% CO2 /95% air) at 37 ◦ C overnight.
After pre-incubation, the cells were cultured in 10% FBS containing fresh Williams’ Medium E with
different concentrations of ethanol, with or without DNSM, adenosine, or deoxyadenosine for 0–24 h.
4.9. Cell Viability Assay
The cell viability of the hepatocytes was measured by the Neutral Red assay, as previously
described [40]. Neutral Red stock solution (0.4% Neutral Red in water) was diluted 1:80 in
phosphate-buffered saline (PBS). Hepatocytes were incubated with the Neutral Red solution for
2 h at 37 ◦ C to allow for the uptake of the lysosomal dye into viable cells. The Neutral Red solution
was then removed, and the cultures were washed rapidly (in under 2.5 min) with a mixture of 1%
formaldehyde-1% calcium chloride. A mixture of 1% acetic acid-50% ethanol was added to the cells at
room temperature for 30 min to extract the Neutral Red from the hepatocytes. The optical density of
each sample was then measured at 540 nm with a spectrophotometer. Cell viability was estimated as a
percentage of the value obtained for untreated controls.
4.10. Assay of ADH Activities
After incubation, the cells were washed twice and then dissolved with cold PBS. The debris
was obtained by centrifugation at 2600× g for 1 min at 4 ◦ C, and then buffer (50 mM HEPES pH 7.5,
0.25 M sucrose, 1 mM EDTA, 1 mM dithiothreitol (DTT), 3 mM MgCl2 , 1 mM phenylmethylsulphonyl
fluoride) was added. After two freeze-thaw cycles using liquid nitrogen, the cells were sonicated
and centrifuged at 12,000× g for 20 min at 4 ◦ C. Finally, the supernatant was collected. ADH activity
202
Mar. Drugs 2016, 14, 232
was determined at 25 ◦ C in a 1.5 mL volume (50 mM HEPES pH 8.0, 10 mM MgCl2 , 1 mM DTT,
300 µM NAD+ ) in the presence or absence of ethanol (50 µL). The reaction was started by adding
ethanol, and the absorbance at 340 nm was followed with a spectrophotometer. The linear initial
increase in absorbance was used to determine specific enzyme activities with an absorption coefficient
of 6.2 mM·cm−1 .
4.11. Statistical Analysis
Statistical comparisons were performed between groups using one-way analysis of variance and
post hoc multiple comparisons using Tukey’s test. A p-value less than 0.05 was considered significant.
5. Conclusions
In conclusion, we found that DNSM had protective effects against ethanol-induced liver injury.
Although its precise mechanisms need to be elucidated further, DNSM may represent a novel tool for
preventing alcohol-induced liver injury.
Acknowledgments: This study was partially supported by a Grant-in-Aid for Scientific Research from the Japan
Society for the Promotion of Science (24500987).
Author Contributions: A.K-Y. and I.M-Y. contributed to the concept of the study and the manuscript preparation.
A.K-Y., I.M-Y., H.S., K.S. and K.U. wrote the paper. A.K-Y., M.G., E.Y., Y.M., H.S. and K.S. performed experiments
and analyzed data.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
Lieber, C.S. Ethanol metabolism, cirrhosis and alcoholism. Clin. Chim. Acta 1997, 257, 59–84. [CrossRef]
Tsukamoto, H.; Lu, S.C. Current concepts in the pathogenesis of alcoholic liver injury. FASEB J. 2001, 15,
1335–1349. [CrossRef] [PubMed]
Lucey, M.R.; Mathurin, P.; Morgan, T.R. Alcoholic hepatitis. N. Engl. J. Med. 2009, 360, 2758–2769. [CrossRef]
[PubMed]
Zima, T.; Fialova, L.; Mestek, O.; Janebova, M.; Crikovska, J.; Malbonan, I.; Stipek, S.; Milkulikova, L.;
Popov, P. Oxidative stress, metabolism of ethanol and alcohol-related disease. J. Biomed. Sci. 2001, 8, 59–70.
[CrossRef] [PubMed]
Albano, E. Alcohol, oxidative stress and free radical damage. Proc. Nutr. Soc. 2006, 65, 278–290. [CrossRef]
[PubMed]
Lieber, C.S.; DeCarli, L.M. Ethanol oxidation by hepatic microsomes-adaptive increase after ethanol feeding.
Science 1968, 162, 912–918. [CrossRef]
Lieber, C.S. CYP2E1: From ASH to NASH. Hepatol. Res. 2004, 28, 1–11. [CrossRef] [PubMed]
Guengrich, F.P. Oxidative cleavage of carboxylic esters by cytochrome-P-450. J. Biol. Chem. 1987, 262,
8459–8462.
Porter, T.D.; Coon, M.J. Cytochrome P-450: Multiplicity of isoforms, substrates, and catalytic and regulatory
mechanisms. J. Biol. Chem. 1991, 266, 13469–13472. [PubMed]
Robertson, G.; Leclercq, I.; Farrell, G.C. Nonalcoholic p-450 enzymes and oxidative stress. Am. J. Physiol.
Gastrointest. Liver Physiol. 2001, 281, G1135–G1139. [PubMed]
Lieber, C.A.; De Carli, L.M.; Sorrel, M.F. Experimental methods of ethanol administration. Hepatology 1989,
10, 501–510. [CrossRef] [PubMed]
Tsukamoto, H.; Horne, W.; Kamimura, S.; Niemela, O.; Parkkla, S.; Ylaherttula, S.; Brinttenham, G.M.
Experimental liver cirrhosis induced by alcohol and iron. J. Clin. Investig. 1995, 96, 620–630. [CrossRef]
[PubMed]
Tipoe, G.L.; Liong, E.C.; Casey, C.A.; Donohue, T.M., Jr.; Eagon, P.K.; So, H.; Leung, Y.M.; Fogt, F.; Nanji, A.A.
A voluntary oral ethanol-feeding rat model associated with necroinflammatory liver injury. Alcohol Clin.
Exp. Res. 2008, 32, 669–682. [CrossRef] [PubMed]
Siegers, C.P.; Pauli, V.; Korb, G.; Younes, M. Hepatoprotection by malotilate against carbon tetrachloridealcohol-induced liver fibrosis. Agents Actions 1986, 18, 600–603. [CrossRef] [PubMed]
203
Mar. Drugs 2016, 14, 232
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
Takahashi, M.; Satake, N.; Yamashita, H.; Tamura, A.; Sasaki, M.; Matsui-Yuasa, I.; Tabuchi, M.; Akahoshi, Y.;
Terada, M.; Kojima-Yuasa, A. Ecklonia-cava polyphenol protects the liver against ethanol-induced injury in
rats. Biochim. Biophysica. Acta 2012, 1820, 978–988. [CrossRef] [PubMed]
Tamura, A.; Sasaki, M.; Yamashita, H.; Matsui-Yuasa, I.; Saku, T.; Hikima, T.; Tabuchi, M.; Munakata, H.;
Kojima-Yuasa, A. Yerba-mate (Ilex paraguarienesis) extract prevents ethanol-induced liver injury in rats.
J. Funct. Food. 2013, 5, 1714–1723. [CrossRef]
Carver, J.D. Dietary nucleotides: Effects on the immune and gastrointestinal systems. Acta Paediatr. Suppl.
1999, 88, 83–88. [CrossRef] [PubMed]
Jyonouchi, H.; Sun, S.; Abiru, T.; Winship, T.; Kuchan, M.J. Dietary nucleotides modulate antigen-specific
type 1 and type 2 T-cell responses in young c57bl/6 mice. Nutrition 2000, 16, 442–446. [CrossRef]
Sudo, N.; Aiba, Y.; Oyama, N.; Yu, X.N.; Matsunaga, M.; Koga, Y.; Kudo, C. Dietary nucleic acid and
intestinal microbiota synergistically promote a shift in the Th1/Th2 balance toward Th1-dominant immunity.
Clin. Exp. Allergy 2004, 135, 132–135.
He, Y.; Sanderson, I.R.; Walker, W.A. Uptake, transport and metabolism of exogenous nucleosides in intestinal
epithelial cell culture. J. Nutr. 1994, 124, 1942–1949. [PubMed]
Tanaka, M.; Lee, K.; Martinez-Augustin, O.; He, Y.; Sanderson, L.R.; Walker, W.A. Exogenous nucleotides
after the proliferation, differentiation and apoptosis of human small intestinal epitherium. J. Nutr. 1996, 126,
424–433. [PubMed]
Sakai, T.; Taki, T.; Nakamoto, A.; Tazaki, S.; Arakawa, M.; Nakamoto, M.; Tsutsumi, R.; Shuto, E.
Dietary ribonucleic acid suppresses inflammation of adipose Tissue and improves glucose intolerance
that is medicated by immune cells in C57BL/6 Mice fed a high-fat diet. J. Nutr. Sci. Vitaminol. 2015, 61, 73–78.
[CrossRef] [PubMed]
Yamashita, H.; Goto, M.; Matsui-Yuasa, I.; Kojima-Yuasa, A. Ecklonia cava polyphenol has a protective effect
against ethanol-induced liver injury in a cyclic AMP-dependent manner. Mar. Drugs 2015, 13, 3877–3891.
[CrossRef] [PubMed]
Módis, K.; Geró, D.; Stangl, R.; Rosero, O.; Szijártó, A.; Lotz, G.; Mohácsik, P.; Szoleczky, P.; Coletta, C.;
Szabó, C. Adenisine and inosine exert cytoprotective effects in an in vitro model of liver ischemia-reperfusion
injury. Int. J. Mol. Med. 2013, 31, 437–446. [PubMed]
Hasemi, M.; Karami-Tehrani, F.; Ghavami, S.; Maddika, S. Adenosine and deoxyadenosine induced apoptosis
in oestrogen receptor-positive and -negative human breast cancer cells via the intrinsic pathway. Cell Prolif.
2005, 38, 269–285. [CrossRef] [PubMed]
Lee, C.Y. Adenosine protects Sprague Dawley rats from high-fat diet and repeated acute restraint
stress-induced intestinal inflammation and altered expression of nutrient transporters. J. Anim. Physiol.
Anim. Nutr. 2015, 99, 317–325. [CrossRef] [PubMed]
Potter, J.J.; MacDougalg, O.A.; Mezey, E. Regulation of rat alcohol dehydrogenase by cyclic AMP in primary
hepatocyte culture. Arch. Biochem. Biophys. 1995, 321, 329–335. [CrossRef] [PubMed]
Oesch-Bartlomowicz, B.; Padma, P.R.; Becker, R.; Richter, B.; Hengstler, J.G.; Freeman, J.E.; Wolf, C.R.;
Oesch, F. Differential modulation of CYP2E1 activity by cAMP-dependent protein kinase upon Ser129
replacement. Exp. Cell Res. 1998, 242, 294–302. [CrossRef] [PubMed]
Charest, R.; Blckmore, P.F.; Exton, J.H. Characterization of responses of isolated rat hepatocytes to ATP and
ADP. J. Biol. Chem. 1985, 260, 15789–15794. [PubMed]
Okajima, F.; Tokumitsu, Y.; Kondo, Y.; Ui, M. P2-Purinergic receptors are coupled to two signal transduction
systems leading to inhibition of cAMP generation and to production of inositol trisphosphate in rat
hepatocytes. J. Biol. Chem. 1987, 262, 13483–13490. [PubMed]
Mandrekar, P.; Szabo, G. Signalling pathways in alcohol-induced liver inflammation. J. Hepatol. 2009, 50,
1258–1266. [CrossRef] [PubMed]
Long, Y.C. AMP-activated protein kinase signaling in metabolic regulation. J. Clin. Investig. 2006, 116,
1776–1783. [CrossRef] [PubMed]
Sid, B.; Verrax, J.; Calderon, P.B. Role of AMPK activation in oxidative cell damage: Implications for
alcohol-induced liver disease. Biochem. Pharmacol. 2013, 86, 200–209. [CrossRef] [PubMed]
Shin, S.; Park, J.; Li, Y.; Min, K.N.; Kong, G.; Hur, G.M.; Kim, J.M.; Shong, M.; Jung, M.-S.; Park, J.K.; et al.
β-Lapachone alleviates alcoholic fatty liver disease in rats. Cell. Signal. 2014, 26, 295–305. [CrossRef]
[PubMed]
204
Mar. Drugs 2016, 14, 232
35.
36.
37.
38.
39.
40.
Wang, Z.; Su, B.; Fan, S.; Fei, H.; Zhao, W. Protective effect of oligomeric proanthocyanidins against
alcohol-induced liver steatosis and injury in mice. Biochem. Biophys. Res. Commun. 2015, 458, 757–762.
[CrossRef] [PubMed]
Stenesen, D.; Suh, J.M.; Seo, J.; Yu, K.; Lee, K.-S.; Kim, J.-S.; Min, K.-J.; Graff, J.M. Dietary adenine controls
adult lifespan via adenosine nucleotide biosynthesis and AMPK, and regulates the longevity benefit of
caloric restriction. Cell Metab. 2013, 8, 101–112. [CrossRef] [PubMed]
Sapone, A.; Affatato, A.; Canistro, D.; Broccoli, M.; Trespidi, S.; Pozzetti, L.; Biagi, G.L.; Cantelli-Forti, G.;
Paoline, M. Induction and suppression of cytochrome P450 isoenzymes and generation of oxygen radicals
by procymidone in liver, kidney and lung of CD1 mice. Mutat. Res. 2003, 527, 67–80. [CrossRef]
Ohkawa, H.; Ohnishi, N.; Yagi, K. Assay for lipidperoxide in animal tissues by thiobarbituric acid reaction.
Anal. Biochem. 1979, 95, 351–358. [CrossRef]
Moldéus, P.; Högber, J.; Orrenius, S. Isolation and use of liver cells. Methods Enzymol. 1978, 52, 60–71.
[PubMed]
Zhang, S.Z.; Lipsky, M.M.; Trump, B.F.; Hsu, I.C. Neutral red (NR) assay for cell viability and
xenobiotic-induced cytotoxicity in primary culture of human and rat hepatocytes. Cell Biol. Toxicol. 1990, 6,
219–234. [CrossRef] [PubMed]
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
205
marine drugs
Article
Novel Peptide with Specific Calcium-Binding
Capacity from Schizochytrium sp. Protein
Hydrolysates and Calcium Bioavailability
in Caco-2 Cells
Xixi Cai 1,2 , Jiaping Lin 2 and Shaoyun Wang 2, *
1
2
*
The Key Lab of Analysis and Detection Technology for Food Safety of the MOE, College of Chemistry,
Fuzhou University, Fuzhou 350108, China; caixx_0123@163.com
College of Biological Science and Technology, Fuzhou University, Fuzhou 350108, China;
kathleen369@163.com
Correspondence: shywang@fzu.edu.cn; Tel.: +86-591-2286-6375
Academic Editor: Se-Kwon Kim
Received: 1 October 2016; Accepted: 20 December 2016; Published: 27 December 2016
Abstract: Peptide-calcium can probably be a suitable supplement to improve calcium absorption in
the human body. In this study, a specific peptide Phe-Tyr (FY) with calcium-binding capacity was
purified from Schizochytrium sp. protein hydrolysates through gel filtration chromatography and
reversed phase HPLC. The calcium-binding capacity of FY reached 128.77 ± 2.57 µg/mg. Results of
ultraviolet spectroscopy, fluorescence spectroscopy, and infrared spectroscopy showed that carboxyl
groups, amino groups, and amido groups were the major chelating sites. FY-Ca exhibited excellent
thermal stability and solubility, which were beneficial to be absorbed and transported in the basic
intestinal tract of the human body. Moreover, the calcium bioavailability in Caco-2 cells showed that
FY-Ca could enhance calcium uptake efficiency by more than three times when compared with CaCl2 ,
and protect calcium ions against dietary inhibitors, such as tannic acid, oxalate, phytate, and Zn2+ .
Our findings further the progress of algae-based peptide-calcium, suggesting that FY-Ca has the
potential to be developed as functionally nutraceutical additives.
Keywords: Schizochytrium sp.; protein hydrolysate; calcium-binding peptide; structure; bioavailability
1. Introduction
Marine algae, which have traditionally formed part of the diet for centuries, especially in Asian
countries such as China, Korea, and Japan, have become a popular research topic because of their
biological implication [1]. Schizochytrium sp., belonging to marine fungi, possesses a large number
of bioactive substances beneficial to the human body, such as unsaturated fatty acids, pigments, and
proteins [2]. Schizochytrium sp. has been widely used in the industrial production of docosahexaenoic
acid. The remaining by-products, containing about 41% protein, are usually used for biological
baits or just discarded as industrial waste. Preparation of bioactive peptides from proteins through
enzymatic hydrolysis has been a hot topic [3,4]. Therefore, the utilization of protein from the defatted
Schizochytrium sp. by-products presents an opportunity.
Calcium is the most abundant mineral in the human body, mostly stored in the bones and
supporting their structure and function. Calcium deficiency may result in many diseases, such as
osteoporosis, kidney stones, and arterial hypertension [5,6]. Therefore, numerous calcium-fortified
medicines and foods have come to market. However, calcium deficiency is still widespread due to
insufficient absorption of the intake calcium. Ionized calcium is the primary calcium supplement
for humans, but intestinal absorption of ionized calcium could be easily affected by the presence of
Mar. Drugs 2017, 15, 3
206
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2017, 15, 3
dietary factors, such as tannin, phytate, oxalate, and other divalent metal ions [7]. Thus, a new class
of calcium-enriched nutrients that can overcome these shortcomings has the potential to improve
calcium nutrition. Organic calcium supplements show their superiority. Calcium-binding peptides,
one of the organic calcium supplements, such as casein ophosphopeptides (CPPs) [8], soybean protein
hydrolysates [9], whey protein hydrolysates [10], and serum protein hydrolysates [11], have been
reported to be capable of promoting calcium uptake. Among these, CPPs were known as excellent
mineral carriers with a significant role in promoting calcium ion absorption through the formation of
CPP-Ca aggregates and maintaining the solubility [8,12]. CPPs induced calcium uptake in Caco-2 cells
involved the transient receptor potential cation of the vanilloid subfamily V member 6, TRPV6 channel,
also designated as calcium transporter-1, or CaT1 [13]. In the previous study, the nanocomposites
of Schizochytrium sp. protein hydrolysate (SPH) chelated with calcium ions were prepared and the
characterization of nano-composites was investigated by our group [14]. However, none has been
reported about purified peptide with specific calcium-binding capacity from Schizochytrium sp. protein
hydrolysate and calcium bioavailability. The research on the purified peptide is necessary to further
understand the relationship between structure and function, and action mechanism.
The objectives of this study were, therefore, to isolate and characterize specific calcium-binding
peptides from Schizochytrium sp. protein hydrolysate (SPH) and explore the possible chelating
mechanism. Additionally, the Caco-2 cell monolayer model was used to determine the calcium
bioavailability. This study could provide a new train of thought of the calcium-binding peptide from
Schizochytrium sp. protein hydrolysate for the potential to be developed as a new kind of functionally
nutraceutical supplements to improve bone health in the human body.
2. Results and Discussion
2.1. Purification of Calcium-Binding Peptide
Schizochytrium sp. protein hydrolysates consisted of various peptides were confirmed to possess
calcium-binding capacity [14]. Systematic investigation on the calcium-binding properties of various
peptides in SPH is of great importance. For this purpose, a specific peptide with calcium-binding
capacity was first purified.
As shown in Figure 1a, SPH was divided into three size-dependent fraction through Sephadex
G-25 chromatography. The calcium-binding capacities of F2 and F3 were similar and remarkably
higher than F1 and SPH. Many studies have shown that peptides with lower molecular mass exhibited
higher chelating capacity [15–17]. Therefore, the active fraction F3 with lower molecular mass was
pooled and loaded onto semi-preparative C18 RP-HPLC. Twenty-two distinct fractions were collected
and all of them exhibited different degrees of calcium-binding capacities (Figure 1b). Among them,
activities of fraction 13 and fraction 17 were significantly higher than other fractions and fraction F3
from Sephadex G-25 chromatography (p < 0.05). Fraction 17, which showed the highest chelating
capacity, was first selected for further purification by analytic RP-HPLC. Finally, fraction A, with the
highest calcium-binding activity (128.77 ± 2.57 µg/mg), was collected and lyophilized for further
studies (Figure 1c).
207
Mar. Drugs 2017, 15, 3
F1
160
Absorbance at 214 nm
Calcium-binding capacity (ȝg/mg)
180
140
120
100
80
100
95
90
85
80
75
70
F1
F2
F3
SPH
Fraction
60
F2
40
F3
20
0
0
10
20
30
40
50
60
70
80
90
100
Fraction number
(a)ȱ
(b)ȱ
(c)ȱ
Figure 1. Elution profiles and calcium-binding capacities of calcium-binding peptides. (a) Sephadex
G-25 gel filtration chromatography of SPH; (b) semi-preparative C18 RP-HPLC of fraction F3;
and (c) analytic RP-HPLC of fraction 17 from semi-preparative HPLC.
208
Mar. Drugs 2017, 15, 3
2.2. Identification of the Calcium-Binding Peptide
The amino acid sequence of fraction A was determined to be Phe-Tyr (FY) with a molecular weight
(MW) of 328.17 Da using liquid chromatography-electrospray ionization-tandem mass spectrometry
(LC-ESI-MS/MS) (Figure 2). Subsequently, the identified peptide was chemically synthesized and the
calcium-binding capacity was determined to be 125.91 ± 1.63 µg/mg, which was equivalent to the
purified sample. Calcium-binding peptides from various sources with different MW and sequences
have been isolated. Jeon reported that a peptide purified from Chlorella protein hydrolysates had
a calcium binding activity of 0.166 mM and was determined to be 700.48 Da [18]. In our previous
works, four dipeptides or tripeptides from whey protein hydrolysates were confirmed to possess
70–80 µg/mg calcium-binding capacity [19–22]. Not only the differences in the length and net
charge of peptides, but also the different amino acid composition and sequence, could affect the
extent of chelate formation with divalent metal cations [15,23]. Previous reports showed that the
phosphorylation of tyrosine residues could provide appropriate chelating sites for positively charged
metals, like calcium, zinc, and iron [24]. Kim indicated that an iron-binding peptide separated from
heated whey hydrolysates contained 16.58% of phenylalanine residues, which was higher than other
amino acids [25]. Moreover, dipeptide or tripeptide was deemed to promote metal ion absorption
more effectively than higher MW peptides in intestinal epithelial cells [26]. Consequently, both of the
Phe and Tyr residues in the purified peptide might contributed to chelation with metal cations.
Figure 2. Identification of the amino acid sequence of the calcium-binding peptide using
LC-ESI-MS/MS.
2.3. Structural Characterization of Peptide-Calcium Chelate
2.3.1. Ultraviolet Spectroscopy Analysis
Aromatic amino acids including tryptophan, phenylalanine, and tryptophan residues, could
produce different UV spectra because of different chromophores. Phenylalanine has a specific
absorption peak at 260 nm, and tyrosine at 280 nm approximately [27]. Therefore, the UV spectra was
utilized to discuss the chelating mechanism of FY. As shown in Figure 3, the UV absorption spectra
of FY-Ca chelates presented distinct differences from that of FY, which implied that a new substance
was formed when FY interacted with calcium ions. Dipeptide FY had a maximum UV absorption
peak at about 196 nm. With the increase of calcium ion concentration, the absorbance of the maximum
absorption peak gradually increased from 1.937 to 2.149, showing a hyperchromic effect and redshift
phenomenon. The results indicated that the chromophore groups (-C=O, -COOH) and auxochrome
groups (-OH, -NH2 ) generated polarizing changes when the ligands bound with calcium ions in the
chelating process [28,29]. In addition, both FY and FY-Ca chelate had specific absorption peaks near
280 nm with the same intensity, suggesting that the tyrosine structure remained unchanged and the
phenolic hydroxyl group of Tyr in FY was not involved in the chelation reaction because of the steric
209
Mar. Drugs 2017, 15, 3
hindrance of the benzene ring. Hence, it could be presumed that the nitrogen atom of -NH- and -NH2
and the oxygen atom of -C=O and -COOH participated in the chelation.
2.5
Absorbance
Absorbance
2.0
1.5
2.2
FY
FY+1.0 mM CaCl2
2.0
FY+3.0 mM CaCl2
FY+5.0 mM CaCl2
1.8
FY+7.0 mM CaCl2
1.6
FY+9.0 mM CaCl2
1.4
1.0
1.2
194 196 198 200 202 204 206 208
Wavelengh (nm)
0.5
0.0
200
250
300
350
400
ȱ
Wavelengh (nm)
Figure 3. UV spectra of FY with different CaCl2 concentrations over the wavelength range
from 190 to 400 nm.
2.3.2. Fluorescence Spectroscopy Analysis
The specific calcium-binding peptide FY included Phe and Tyr, which could generate endogenous
fluorescence at an excitation wavelength of 280 nm, and the corresponding emission peaks of Phe
and Tyr were 303 nm and 313 nm, respectively. The fluorescence spectra of FY and FY-Ca chelate
were shown in Figure 4. With the increase of calcium ion concentration, the intensity of endogenous
fluorescence at 310 nm was reduced, which implied that calcium ions could be chelated by aromatic
amino acids and lead to fluorescence quenching. Particularly, obvious endogenous fluorescence
quenching appeared as soon as 1.0 mM of CaCl2 was introduced. However, when the concentration
of calcium ion reached 5.0 mM, no further changes were observed. This potentially manifested that
changes in the fluorescence occurred when calcium chelated with the peptides and excess free calcium
made no difference. Similar results has been reported by Zhou that fluorescence quenching was
observed when calcium ions combined with the calcium-chelating peptide [30]. Moreover, Wu proved
that reduced fluorescence intensity was a classic indicator of peptide folding when ferrous ions chelated
with sturgeon protein peptide, and ferrous ions closed to tryptophan residues in the folding process [31].
Therefore, the results demonstrated that the calcium ions chelated with FY might cause folding of the
peptide and form a compact structure, which contributed to the decrease in fluorescence intensity.
500
Fluorescence intensity
400
FY
FY+1.0 mM CaCl2
FY+3.0 mM CaCl2
300
FY+5.0 mM CaCl2
FY+7.0 mM CaCl2
200
FY+9.0 mM CaCl2
100
0
260
280
300
320
340
Wavelengh (nm)
360
380
400
ȱ
Figure 4. Fluorescence spectra of FY with different CaCl2 concentration over the wavelength range
from 295 to 500 nm.
210
Mar. Drugs 2017, 15, 3
2.3.3. Fourier Transform Infrared Spectroscopy (FTIR) Measurement
The specific FTIR absorption peak changes of the amides and carboxylates in FY could reflect
the interaction of calcium ions and organic ligand groups of the peptides. As shown in Figure 5,
displacement and intensity changes of main absorption peaks could be observed when calcium
ions bound with the amino acid residues. The two most important vibrational modes of amides
are the amide-I vibration and amide-II vibration, the amide-I vibration is primarily caused by the
stretching of C=O bonds, amide-II vibration is assigned to deformation of N-H bonds and stretching
of C–N bonds [21,32]. The absorption band of FY at 1668.17 cm−1 for the amide I band shifted
to a higher frequency (1680.58 cm−1 ) after chelating with calcium, manifesting that the -COOgroup participated in the covalent combining reaction with the metal cations [33]. Additionally,
the amide II band at 1516.43 cm−1 in FY also shifted to 1587.11 cm−1 in the FY-Ca chelate. The
characteristic peak of amide-A stretching vibration of FY shifted from 3394.61 cm−1 to 3422.96 cm−1
might be due to the replacement of N-OH bonds (hydrogen bonds) with Ca-N bonds after calcium
chelation [22]. After chelation, the spectrum shifted towards high-frequency wavenumbers (3500–2800
cm−1 ), indicating that dipole field effect or induced effect led to the electron cloud density and
frequency increased [14]. In the fingerprint region, the absorption intensity at 1187.51 cm−1 decreased
and moved towards 1214.78 cm−1 simultaneously when FY chelated with calcium. A reasonable
explanation was that FY bound with calcium ion and form C–O–Ca [14]. Furthermore, the absorption
intensity observably reduced at lower frequency 837.24 cm−1 in FY-Ca chelate, it might attributed
to the changes of -C–H group and -N–H group of FY in the chelating procedure. Previous research
showed that the carboxyl group loss of protons and negative electricity (-COO-) was also potential
binding site. Additionally, the amino group (-NH2 ) and imino group of the peptide bond (-NH) were
also likely to be involved in the formation of chelate [34]. The results of FTIR proved that oxygen
atoms of the carboxyl group and nitrogen atoms of the amino group might be involved in the chelating
reaction and generated a new substance.
Relative transmissivity rate (%)
80
FY-Ca
FY
70
1441.30
838.37
1389.89
60
3233.53
1680.58
3422.96
1520.55
1214.78
1587.11
50
837.24
40
30
1444.85
3236.95
3394.61
1516.43
20
4000
1187.51
1668.17
3500
3000
2500
2000
1500
1000
500
凟1
Wavenumber (cm )
Figure 5. Fourier transform infrared (FTIR) spectra of FY and FY-Ca chelate in the regions
from 4000 to 400 cm−1 .
2.4. Thermal and pH Stability Analysis of Peptide-Calcium Chelate
2.4.1. Thermogravimetry-Differential Scanning Calorimetry (TG-DCS) Analysis
The difference of thermostability between FY and FY-Ca chelate was explored through TG-DSC
analysis. As shown in Figure 6a, the TG curve of dipeptide FY revealed that the thermal decomposition
reaction of FY involved three stages in the whole process of 76.35% weight loss, and the thermal
211
Mar. Drugs 2017, 15, 3
transition temperature was 155.16 ◦ C, 161.26 ◦ C, 298.66 ◦ C, and 386.34 ◦ C, respectively according
to DSC analysis. The endothermic peaks were mainly caused by the destruction of C–N bonds in
different positions of FY [20]. However, the TG curve of FY-Ca performed only two stages and lost
43.42% of its weight entirely (Figure 6b). The temperature of endothermic peaks significantly shifted
to 265.12 ◦ C, 335.75 ◦ C, and 417.82 ◦ C after the calcium ion chelated with FY, suggesting that FY-Ca
chelate was less sensitive to thermal denaturation and performed better thermostability than FY,
which was advantageous for application in medicine and functional food.
110
5
TG
DSC
0
0
100
-1
伽=-29.53%
-2
-3
161.26
伽=-42.75%
40
386.34
伽=-21.02%
265.12
-10
80
TG (%)
TG (%)
伽=-4.07%
60
-5
90
155.16
DSC (mV/mg)
80
335.75
-15
70
-4
60
-5
50
417.82
伽=-22.40%
-20
DSC (mV/mg)
TG
DSC
100
-25
20
298.66
50
100 150
200 250 300 350
400 450 500
50
100
150
200
250
300
ș ( C)
ș ( C)
(a)ȱ
(b)
o
350
400
450
-30
500
o
Figure 6. Typical TG-DSC thermograms of (a) FY and (b) FY-Ca chelate.
2.4.2. Calcium-Releasing Percentage Assay
The calcium-releasing percentages of the FY-Ca chelate and CaCl2 at different pH were shown in
Figure 7. The solubility of FY-Ca and CaCl2 was obviously different. The calcium-releasing percentage
of CaCl2 exhibited a distinctly downward trend with the increase of pH value, and was reduced to
75.7% at pH 8.0, which could deduce that the free calcium ions and OH− formed precipitates and
led to a decline in the percentage. In contrast, the calcium-releasing percentage of FY-Ca chelate was
always apparently higher than that of CaCl2 at pH 2.0–8.0, and it maintained a relatively stable value
of about 95% as well. The pH value in human intestinal tract is approximately pH 7.2, and FY-Ca
chelate had higher solubility and better bioavailability in the gastrointestinal tract, which implied
that FY-Ca chelate could be effectively absorbed and transported by intestinal epithelial cells than
CaCl2 [35].
FY-Ca
CaCl2
Calcium-releasing ability (%)
100
90
80
70
60
50
2
3
4
5
pH
6
7
8
ȱ
Figure 7. Calcium-releasing percentage of FY-Ca chelate and CaCl2 at different pH.
212
Mar. Drugs 2017, 15, 3
2.5. Calcium Bioavailability in Human Intestinal Caco-2 Cell Lines
2.5.1. Cell Uptake of FY-Ca
For the uptake studies, Caco-2 cells were pre-incubated with FY-Ca chelate at different
concentrations with CaCl2 used as control. The effect of FY-Ca on the intracellular calcium concentration
increased dose-dependently and then approximately trended to stable when the calcium concentration
reached 9 mM, according to results in Figure 8. Additionally, the absorption-enhanced effects of FY-Ca
were more than three times that of CaCl2 at the same calcium concentration. Similar findings were also
reported for desalted duck egg white peptides [36], soybean protein hydrolysates-calcium complex [9],
and CPPs [37], which might act as calcium carriers and interact with the plasma membrane to transport
calcium to the cytosol and ultimately significantly promote calcium uptake.
FY-Ca
CaCl2
[Ca2+]i (% on basal value)
200
160
120
80
40
3
6
9
12
15
Calcium concentration (mM)
Figure 8. Cell uptake of FY-Ca chelate and CaCl2 in Caco-2 cell by Fluo-3-AM loading for
fluorescence analysis.
2.5.2. Calcium Bioavailability under the Action of Dietary Inhibition Factors
Well-established dietary factors, such as tannic acid, oxalate, phytate, and zinc ions, were chosen
to evaluate whether the typical inhibitors from food would affect the uptake of calcium chelated by FY,
with CaCl2 as control. As expected, the addition of zinc ions, oxalate, phytate, and tannic acid severely
decreased the calcium uptake efficiency of CaCl2 by 39.7%, 84.4%, 74.9%, and 86.6%. FY-Ca, by contrast,
could protect calcium ions from precipitation caused by oxalate, phytate, and tannic acid, and retain
83.0%, 65.2%, and 36.5% of calcium uptake efficiency, which were 5.3, 2.6, and 2.7 times higher than
CaCl2 , respectively (Figure 9). Furthermore, the addition of Zn ions had little impact on the calcium
uptake efficiency of FY-Ca.
Divalent metal ions, such as zinc and ferrous ions, have negative interactions with calcium
nutrients and inhibit their uptake since the common receptors for these metal ions, DMT1, are located
in the intestine [38]. In this study, the addition of FY could significantly attenuate the inhibition effect
of zinc ions on calcium uptake, indicating that FY-Ca might pass through the cell membrane through
specific pathways other than the DMT1 receptor. Organic phosphates, such as oxalate and phytate,
greatly inhibit calcium uptake due to the formation of insoluble and indigestible complexes [7,39].
In the present study, the calcium uptake efficiency of FY-Ca was superior to CaCl2 in the same condition,
obviously, which might be due to the stronger chelating power of FY than organic phosphate and
prevention of calcium precipitation. Tannin is another dietary factor belonging to polyphenols that
exhibits extremely strong protein degeneration and metal ions complexing actions [40]. The addition
of tannic acid also decreased the absorptivity of FY-Ca in Caco-2, which might be attributed to the
peptide denaturation under high-dose tannic acid. Despite all of these, the calcium uptake efficiency
of FY-Ca was remarkably higher than CaCl2 . These results demonstrated that FY could prevent a great
213
Mar. Drugs 2017, 15, 3
amount of calcium from being precipitated by certain substances, thus improving calcium uptake.
The present study provides powerful evidence for the idea that some proteins/peptides could be
considered as mineral carriers because of their ability to bind and solubilize calcium with the possible
role in increasing calcium transport across intestinal epithelial cells [41].
*
200
*
FY-Ca
CaCl2
[Ca2+]i (% on basal value)
*#
150
*#
100
*#
#
50
*#
*#
*#
*#
0
—
Zn2+
oxalate
phytate
tannic acid
Inhibitor
Figure 9. Effect of FY-Ca chelate on calcium bioavailability under the action of dietary inhibition factors.
The concentration of calcium was 10 mM and tannic acid/Ca, oxalate/Ca, phytate/Ca, or Zn/Ca = 20:1.
* Statistical significance p < 0.05, compared with the CaCl2 control group. # Statistical significance
p < 0.05, compared with the FY-Ca control group.
3. Materials and Methods
3.1. Materials
The defatted Schizochytrium sp. was kindly provided by Fisheries Research Institute of
Fujian, China. The commercial protease, Alcalase (EC. 3.4.21.62, 2.2 × 105 U/g) and Flavourzyme
(EC. 3.4.11.1, 7.8 × 104 U/g) were products of Novozymes (Copenhagen, Denmark). Sephadex G-25
was purchased from Amersham Pharmacia Co. (Uppsala, Sweden). Methanol and acetonitrile used in
liquid chromatography were of HPLC grade. All of the other chemicals and solvents were of analytical
grade and commercially available.
3.2. Preparation of Schizochytrium sp. Protein Hydrolysates
Schizochytrium sp. protein was prepared from Schizochytrium sp. by alkali extraction and acid
precipitation, and Schizochytrium sp. protein hydrolysate possessing high calcium-binding capacity
was prepared through stepwise enzymatic hydrolysis with Alcalase and Flavourzyme, as described in
our previous work [14].
3.3. Purification of Specific Calcium-Binding Peptides
The lyophilized SPH dissolved in deionized water was loaded onto a Sephadex G-25 column
(100 × 2.0 cm) and then eluted with deionized water at a flow rate of 0.3 mL/min. The absorbance of
the elution was monitored at 214 nm and the calcium-binding capacity of the fractions was determined.
The fraction with the highest calcium-binding activity from Sephadex G-25 chromatography was
pooled and further purified by semi-preparation reversed phase HPLC on a C18 reversed-silica gel
chromatograph (Gemini 5 µ C18, 250 × 10 mm; Phenomenex Inc.; Torrance, CA, USA). Elution was
performed with solution A (0.05% trifluoroacetic acid (TFA) in water) and solution B (0.05% TFA in
acetonitrile) with a gradient of 0%–40% B at a flow rate of 2 mL/min for 50 min. The elution was
monitored at 214 nm, and the fractions were collected for calcium-binding capacity analysis. The most
active fraction was further purified by analytic HPLC. Buffers A and B were the same as those used in
214
Mar. Drugs 2017, 15, 3
semi-preparative RP-HPLC. Runs were conducted with a liner gradient of 0%–30% solvent B at a flow
rate of 1 mL/min.
3.4. Identification of Purified Calcium-Binding Peptide
The molecular mass and amino acid sequence of the purified calcium-binding peptide were
determined using LC-ESI-MS/MS (Delta Prep 4000, Waters Co., Milford, MA, USA) over the m/z
range of 300–3000.
3.5. Synthesis of the Purified Peptide
The purified peptide (Phe-Tyr, FY) was synthesized by GL Biochem Corporation. Ltd.
(Shanghai, China) through a solid-phase procedure. The purity of the synthesized peptide was
99.22% by HPLC analysis and the structure of peptide was confirmed by mass spectrometry analysis.
3.6. Analysis of Calcium-Binding Capacity
The calcium-binding capacity was measured with ortho-cresolphthalein complexone reagent
according to the method described by Wang [35] with some modifications. One milliliter of 9 mM
CaCl2 was mixed with 2 mL of 0.2 M sodium phosphate buffer (pH 8.0), and then 1 mL of 1 mg/mL
of peptides was added to create a competitive environment. The mixture was stirred at 37 ◦ C for 2 h.
Afterward, the insoluble calcium phosphate salts was removed by centrifugation at 10,000 rpm for
10 min and the calcium contents in the supernatant were determined by the absorbance at 570 nm after
introducing the working solution to the samples.
3.7. Structural Characterization of Peptide-Calcium Chelate
3.7.1. Fabrication of Peptide-Calcium Chelate
One-hundred milligrams of lyophilized peptide was dissolved in 10 mL of distilled water,
and CaCl2 solution was introduced subsequently to a 3:1 ratio of peptide to calcium (w/w) at
pH 6.0. The reaction solution was placed in a shaking water bath at 140 rpm and 37 ◦ C for
20 min. Peptide-calcium chelate was precipitated after introducing absolute ethanol and collected by
centrifugation at 10,000 rpm for 20 min.
3.7.2. Ultraviolet Spectroscopy
The ultraviolet spectra of calcium-binding peptide and its calcium chelate were monitored over
the wavelength range from 190 nm to 400 nm using an ultraviolet spectrophotometer (UV-2600,
UNICO Instrument Co. Ltd., Shanghai, China) as the method described in our previous work with
some modifications [14]. For determinations, 20 µg/mL of peptide solution was prepared and the pH
was adjusted to 6.5. Then 0, 0.5, 1.0, 1.0, 1.0, and 1.0 µL of 2 M CaCl2 was constantly introduced every
10 min and the UV spectra were recorded.
3.7.3. Fluorescence Spectroscopy
Fluorescence spectroscopy was utilized to investigate the conformational changes of the peptide
chelating with calcium ions by a Hitachi F-4600 fluorescence spectrophotometer (Hitachi Co.,
Tokyo, Japan). The excitation wavelength was 285 nm and the emission wavelengths between 250 and
400 nm were recorded. The slit width of excitation and emission was 20 and 30 nm respectively, and the
sensitivity was 1. The preparation of sample was the same as that of ultraviolet spectroscopy analysis.
3.7.4. FTIR
One milligram of lyophilized sample and 100 mg of dried KBr were fully mixed and ground
in an agate mortar. After tableting, FTIR spectra were recorded at room temperature by an infrared
215
Mar. Drugs 2017, 15, 3
spectrophotometer (360 Intelligent, Thermo Nicolet Co., Madison, WI, USA) from 4000 to 400 cm−1 .
For each spectrum, 64 scans were acquired at 4 cm−1 resolution. The peak signals in the spectra were
analyzed using OMNIC 8.2 software (Thermo Nicolet Co., Madison, WI, USA).
3.8. Thermal and pH Stability Analysis of Peptide-Calcium Chelate
3.8.1. TG-DCS Analysis
A TG-DSC simultaneous thermal analyzer (STA449C, NETZSCH, Bavaria, Germany) was used
to analyze the thermostability of the samples. The lyophilized powder samples (5 mg) were set in
hermetic pans and heated from 30 ◦ C to 500 ◦ C with programmed heating rate of 10 ◦ C/min and argon
flow rate of 30 mL/min.
3.8.2. Calcium Releasing Assay
The calcium ions releasing percentages of peptide-calcium chelate and CaCl2 (50 µg/mL in
deionized water) were determined at pH ranges of 2.0–8.0. After incubation in a water bath shaking
at 140 rpm and 37 ◦ C for 2 h, the reaction solutions were centrifuged at 10,000 rpm for 10 min.
The calcium content of the supernatant and the total calcium in the solution were measured using a
colorimetric method with ortho-cresolphthalein complexone reagent. The calcium-releasing percentage
was calculated as follows:
Calcium releasing (%) =
Calcium in supernatant
× 100
Total calcium in solution
(1)
3.9. The Effect of Peptide-Calcium Chelate on the Cellular Uptake of Calcium
3.9.1. Cell Culture
The human colon adenocarcinoma cells, Caco-2, were grown in dulbecco’s modified eagle medium
(DMEM) supplemented with 15% (v/v) fetal bovine serum (FBS), 1% non-essential amino acid,
100 units/mL penicillin, and 100 µg/mL streptomycin and maintained at 37 ◦ C in a humidified
atmosphere with 5% CO2 . At 80%–90% confluence, cells were seeded on 12-well plastic cell culture
clusters at a density of 1 × 104 cells/cm2 for seven days.
3.9.2. Fluorescence Analysis for Calcium Bioavailability
Caco-2 cells were pre-incubated with peptide-calcium chelate, CaCl2 , at different concentrations,
and tannic acid/phytate/oxalate/Zn2+ plus chelate, and tannic acid/phytate/oxalate/Zn2+ plus
CaCl2 , respectively, for 1 h after cells were grown in 12-well plastic cell culture clusters for seven days.
The cells were then washed with Hank's balanced salt solution (HBSS, without calcium and magnesium)
three times followed by treatment with 10 µM Fluo-3-AM. After incubation for 1 h, cells were washed
with HBSS and harvested for analysis by a F-4600 FL spectrophotometer. Intracellular calcium
concentrations [Ca2+ ]i are expressed as an increase in fluorescence intensity compared to the baseline,
which is the original fluorescence intensity without the addition of exogenous calcium.
3.10. Statistical Analyses
All data were presented as means ± standard deviations (SDs) in three replicates.
Statistical analysis was performed adopting SPSS 17.0 (SPSS, Chicago, IL, USA). Analysis of variance
(ANOVA) was done to determine the significance of the main effects. A confidence level of p < 0.05
was considered statistically significant.
4. Conclusions
In summary, a specific dipeptide Phe-Tyr (FY) with strong calcium-chelating capacity from
Schizochytrium sp. protein hydrolysates was purified and the chelating mechanism was investigated.
216
Mar. Drugs 2017, 15, 3
It showed that calcium ions could form dative bonds with carboxyl oxygen atoms and amino nitrogen
atoms, as well as nitrogen and oxygen atoms of amido bonds, inducing conformational changes of
the dipeptide, and ultimately a new and stable peptide-calcium chelate was formed. The calcium
bioavailability of FY-Ca was superior to CaCl2 , suggesting the potential of FY-Ca to be used as
functionally nutraceutical additives.
Acknowledgments: This work was supported by Natural Science Foundation of China (No. 31571779),
High & New project of Fujian Marine Fisheries Department (No. [2015]20), Fujian Production & Study project of
Provincial Science & Technology Hall (No. 2016N5006), China.
Author Contributions: Xixi Cai, Jiaping Lin and Shaoyun Wang conceived and designed the experiments;
Jiaping Lin and Xixi Cai carried out the experiments and analyzed the data; Xixi Cai drafted the paper;
Shaoyun Wang reviewed the manuscript and provided useful suggestion to improve the manuscript. All authors
read and approved the final manuscript.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
Ngo, D.H.; Wijesekara, I.; Vo, T.S.; Van Ta, Q.; Kim, S.K. Marine food-derived functional ingredients as
potential antioxidants in the food industry: An overview. Food Res. Int. 2011, 44, 523–529. [CrossRef]
Yaguchi, T.; Tanaka, S.; Yokochi, T.; Nakahara, T.; Higashihara, T. Production of high yields of
docosahexaenoic acid by Schizochytrium sp. strain SR21. J. Am. Oil Chem. Soc. 1997, 74, 1431–1434.
[CrossRef]
Opheim, M.; Šližytė, R.; Sterten, H.; Provan, F.; Larssen, E.; Kjos, N.P. Hydrolysis of Atlantic salmon
(Salmo salar) rest raw materials—Effect of raw material and processing on composition, nutritional value,
and potential bioactive peptides in the hydrolysates. Process Biochem. 2015, 50, 1247–1257. [CrossRef]
Coscueta, E.R.; Amorim, M.M.; Voss, G.B.; Nerli, B.B.; Picó, G.A.; Pintado, M.E. Bioactive properties of
peptides obtained from Argentinian defatted soy flour protein by Corolase PP hydrolysis. Food Chem. 2016,
198, 36–44. [CrossRef] [PubMed]
Adluri, R.S.; Zhan, L.J.; Bagchi, M.; Maulik, N.; Maulik, G. Comparative effects of a novel plant-based calcium
supplement with two common calcium salts on proliferation and mineralization in human osteoblast cells.
Mol. Cell. Biochem. 2010, 340, 73–80. [CrossRef] [PubMed]
Singh, G.; Muthukumarappan, K. Influence of calcium fortification on sensory, physical and rheological
characteristics of fruit yogurt. LWT—Food Sci. Technol. 2008, 41, 1145–1152. [CrossRef]
Amalraj, A.; Pius, A. Bioavailability of calcium and its absorption inhibitors in raw and cooked green leafy
vegetables commonly consumed in India—An in vitro study. Food Chem. 2015, 170, 430–436. [CrossRef]
[PubMed]
Bennett, T.; Desmond, A.; Harrington, M.; McDonagh, D.; FitzGerald, R.; Flynn, A.; Cashman, K.D. The effect
of high intakes of casein and casein phosphopeptide on calcium absorption in the rat. Br. J. Nutr. 2000, 83,
673–680. [CrossRef] [PubMed]
Lv, Y.; Bao, X.L.; Yang, B.C.; Ren, C.G.; Guo, S.T. Effect of soluble soybean protein hydrolysate-calcium
complexes on calcium uptake by Caco-2 cells. J. Food Sci. 2008, 73, H168–H173. [CrossRef] [PubMed]
Pan, D.D.; Lu, H.Q.; Zeng, X.Q. A newly isolated Ca binding peptide from whey protein. Int. J. Food Prop.
2013, 16, 1127–1134. [CrossRef]
Choi, D.W.; Lee, J.H.; Chun, H.H.; Song, K.B. Isolation of a calcium-binding peptide from bovine serum
protein hydrolysates. Food Sci. Biotechnol. 2012, 21, 1663–1667. [CrossRef]
Cosentino, S.; Donida, B.M.; Marasco, E.; Del Favero, E.; Cantù, L.; Lombardi, G.; Colombini, A.; Iametti, S.;
Valaperta, S.; Fiorilli, A.; et al. Calcium ions enclosed in casein phosphopeptide aggregates are directly
involved in the mineral uptake by differentiated HT-29 cells. Int. Dairy J. 2010, 20, 770–776. [CrossRef]
Perego, S.; Zabeo, A.; Marasco, E.; Giussani, P.; Fiorilli, A.; Tettamanti, G.; Ferraretto, A.
Casein phosphopeptides modulate calcium uptake and apoptosis in Caco-2 cells through their interaction
with the TRPV6 calcium channel. J. Funct. Foods 2013, 5, 847–857. [CrossRef]
Lin, J.P.; Cai, X.X.; Tang, M.R.; Wang, S.Y. Preparation and evaluation of the chelating nanocomposite
fabricated with marine algae Schizochytrium sp. protein hydrolysate and calcium. J. Agric. Food Chem. 2015,
63, 9704–9714. [CrossRef] [PubMed]
217
Mar. Drugs 2017, 15, 3
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
Chaud, M.V.; Izumi, C.; Nahaal, Z.; Shuhama, T.; de Lourdes Pires Bianchi, M.; de Freitas, O. Iron derivatives
from casein hydrolysates as a potential source in the treatment of iron deficiency. J. Agric. Food Chem. 2002,
50, 871–877. [CrossRef] [PubMed]
Huang, G.G.; Ren, L.; Jiang, J.X. Purification of a histidine-containing peptide with calcium binding activity
from shrimp processing byproducts hydrolysate. Eur. Food Res. Technol. 2010, 232, 281–287. [CrossRef]
Huang, G.R.; Ren, Z.Y.; Jiang, J.X. Separation of iron-binding peptides from shrimp processing by-products
hydrolysates. Food Bioprocess Technol. 2010, 4, 1527–1532. [CrossRef]
Jeon, S.J.; Lee, J.H.; Song, K.B. Isolation of a calcium-binding peptide from Chlorella protein hydrolysates.
J. Food Sci. Nutr. 2010, 15, 282–286. [CrossRef]
Zhao, L.N.; Cai, X.X.; Huang, S.L.; Wang, S.Y.; Huang, Y.F.; Hong, J.; Rao, P.F. Isolation and identification of a
whey protein-sourced calcium-binding tripeptide Tyr-Asp-Thr. Int. Dairy J. 2015, 40, 16–23. [CrossRef]
Zhao, L.N.; Huang, Q.M.; Huang, S.L.; Lin, J.P.; Wang, S.Y.; Huang, Y.F.; Hong, J.; Rao, P.F. Novel peptide
with a specific calcium-binding capacity from whey protein hydrolysate and the possible chelating mode.
J. Agric. Food Chem. 2014, 62, 10274–10282. [CrossRef] [PubMed]
Zhao, L.N.; Huang, S.L.; Cai, X.X.; Hong, J.; Wang, S.Y. A specific peptide with calcium chelating capacity
isolated from whey protein hydrolysate. J. Funct. Foods 2014, 10, 46–53. [CrossRef]
Huang, S.L.; Zhao, L.N.; Cai, X.X.; Wang, S.Y.; Huang, Y.F.; Hong, J.; Rao, P.F. Purification and characterisation
of a glutamic acid-containing peptide with calcium-binding capacity from whey protein hydrolysate.
J. Dairy Res. 2015, 82, 29–35. [CrossRef] [PubMed]
Lv, Y.; Liu, Q.; Bao, X.L.; Tang, W.X.; Yang, B.C.; Guo, S.T. Identification and characteristics of iron-chelating
peptides from soybean protein hydrolysates using IMAC-Fe3+ . J. Agric. Food Chem. 2009, 57, 4593–4597.
[CrossRef] [PubMed]
Miquel, E.; Farré, R. Effects and future trends of casein phosphopeptides on zinc bioavailability. Trends Food
Sci. Technol. 2007, 18, 139–143. [CrossRef]
Kim, S.B.; Seo, I.S.; Khan, M.A.; Ki, K.S.; Lee, W.S.; Lee, H.J.; Shin, H.S.; Kim, H.S. Enzymatic hydrolysis
of heated whey: Iron-binding ability of peptides and antigenic protein fractions. J. Dairy Sci. 2007, 90,
4033–4042. [CrossRef] [PubMed]
Wang, C.; Li, B.; Ao, J. Separation and identification of zinc-chelating peptides from sesame protein
hydrolysate using IMAC-Zn2+ and LC-MS/MS. Food Chem. 2012, 134, 1231–1238. [CrossRef] [PubMed]
Aitken, A.; Learmonth, M. Protein Determination by UV Absorption. In The Protein Protocols Handbook;
Walker, J.M., Ed.; Humana Press: Totowa, NJ, USA, 1996; pp. 3–6.
Houser, R.P.; Fitzsimons, M.P.; Barton, J.K. Metal-dependent intramolecular chiral Induction: The Zn2+
complex of an ethidium-peptide conjugate. Inorg. Chem. 1999, 38, 1368–1370. [CrossRef] [PubMed]
Armas, A.; Sonois, V.; Mothes, E.; Mazarguil, H.; Faller, P. Zinc(II) binds to the neuroprotective peptide
humanin. J. Inorg. Biochem. 2006, 100, 1672–1678. [CrossRef] [PubMed]
Zhou, J.; Wang, X.; Ai, T.; Cheng, X.; Guo, H.Y.; Teng, G.X.; Mao, X.Y. Preparation and characterization of
β-lactoglobulin hydrolysate-iron complexes. J. Dairy Sci. 2012, 95, 4230–4236. [CrossRef] [PubMed]
Wu, H.H.; Liu, Z.Y.; Zhao, Y.H.; Zeng, M.Y. Enzymatic preparation and characterization of iron-chelating
peptides from anchovy (Engraulis japonicus) muscle protein. Food Res. Int. 2012, 48, 435–441. [CrossRef]
Nara, M.; Morii, H.; Tanokura, M. Coordination to divalent cations by calcium-binding proteins studied by
FTIR spectroscopy. Biochim. Biophys. Acta 2013, 1828, 2319–2327. [CrossRef] [PubMed]
Liu, F.R.; Wang, L.; Wang, R.; Chen, Z.X. Calcium-binding capacity of wheat germ protein hydrolysate and
characterization of peptide-calcium complex. J. Agric. Food Chem. 2013, 61, 7537–7544. [CrossRef] [PubMed]
Wang, X.L.; Li, K.; Yang, X.D.; Wang, L.L.; Shen, R.F. Complexation of Al(III) with reduced glutathione in
acidic aqueous solutions. J. Inorg. Biochem. 2009, 103, 657–665. [CrossRef] [PubMed]
Wang, X.; Zhou, J.; Tong, P.S.; Mao, X.Y. Zinc-binding capacity of yak casein hydrolysate and the
zinc-releasing characteristics of casein hydrolysate-zinc complexes. J. Dairy Sci. 2011, 94, 2731–2740.
[CrossRef] [PubMed]
Hou, T.; Wang, C.; Ma, Z.L.; Shi, W.; Lui, W.W.; He, H. Desalted duck egg white peptides: Promotion of
calcium uptake and structure characterization. J. Agric. Food Chem. 2015, 63, 8170–8176. [CrossRef] [PubMed]
Cosentino, S.; Gravaghi, C.; Donetti, E.; Donida, B.M.; Lombardi, G.; Bedoni, M.; Fiorilli, A.; Tettamanti, G.;
Ferraretto, A. Caseinphosphopeptide-induced calcium uptake in human intestinal cell lines HT-29 and
Caco-2 is correlated to cellular differentiation. J. Nutr. Biochem. 2010, 21, 247–254. [CrossRef] [PubMed]
218
Mar. Drugs 2017, 15, 3
38.
39.
40.
41.
Hallberg, L.; Brune, M.; Erlandsson, M.; Sandberg, A.S.; Rossander-Hultén, L. Calcium: Effect of different
amounts on nonheme- and heme-iron absorption in humans. Am. J. Clin. Nutr. 1991, 53, 112–119. [PubMed]
Li, M.L.; Zhang, T.; Yang, H.X.; Zhao, G.H.; Xu, C.S. A novel calcium supplement prepared by phytoferritin
nanocages protects against absorption inhibitors through a unique pathway. Bone 2014, 64, 115–123.
[CrossRef] [PubMed]
Ma, Z.H.; Lu, Z.B.; Shi, B. Chemical properties and application of tannic acid. Nat. Prod. Res. Dev. 2003, 15,
87–91.
Daengprok, W.; Garnjanagoonchorn, W.; Naivikul, O.; Pornsinlpatip, P.; Issigonis, K.; Mine, Y.
Chicken eggshell matrix proteins enhance calcium transport in the human intestinal epithelial cells, Caco-2.
J. Agric. Food Chem. 2003, 51, 6056–6061. [CrossRef] [PubMed]
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
219
marine drugs
Article
In vitro Anti-Thrombotic Activity of Extracts from
Blacklip Abalone (Haliotis rubra) Processing Waste
Hafiz Ansar Rasul Suleria 1,2 , Barney M. Hines 2 , Rama Addepalli 2 , Wei Chen 2 , Paul Masci 1 ,
Glenda Gobe 1, * and Simone A. Osborne 2, *
1
2
*
School of Medicine, The University of Queensland, Translational Research Institute, Kent Street,
Woolloongabba 4102, Australia; hafiz.suleria@uqconnect.edu.au (H.A.R.S.); p.masci@uq.edu.au (P.M.)
CSIRO Agriculture, 306 Carmody Road, St Lucia 4067, Australia; barney.hines@csiro.au (B.M.H.);
rama.addepalli@csiro.au (R.A.); wei.chen@csiro.au (W.C.)
Correspondence: g.gobe@uq.edu.au (G.G.); simone.osborne@csiro.au (S.A.O.)
Academic Editor: Se-Kwon Kim
Received: 17 November 2016; Accepted: 28 December 2016; Published: 31 December 2016
Abstract: Waste generated from the processing of marine organisms for food represents an
underutilized resource that has the potential to provide bioactive molecules with pharmaceutical
applications. Some of these molecules have known anti-thrombotic and anti-coagulant activities
and are being investigated as alternatives to common anti-thrombotic drugs, like heparin and
warfarin that have serious side effects. In the current study, extracts prepared from blacklip abalone
(Haliotis rubra) processing waste, using food grade enzymes papain and bromelain, were found to
contain sulphated polysaccharide with anti-thrombotic activity. Extracts were found to be enriched
with sulphated polysaccharides and assessed for anti-thrombotic activity in vitro through heparin
cofactor-II (HCII)-mediated inhibition of thrombin. More than 60% thrombin inhibition was observed
in response to 100 µg/mL sulphated polysaccharides. Anti-thrombotic potential was further assessed
as anti-coagulant activity in plasma and blood, using prothrombin time (PT), activated partial
thromboplastin time (aPTT), and thromboelastography (TEG). All abalone extracts had significant
activity compared with saline control. Anion exchange chromatography was used to separate extracts
into fractions with enhanced anti-thrombotic activity, improving HCII-mediated thrombin inhibition,
PT and aPTT almost 2-fold. Overall this study identifies an alternative source of anti-thrombotic
molecules that can be easily processed offering alternatives to current anti-thrombotic agents
like heparin.
Keywords: blacklip abalone; processing waste; bioactive molecules; anti-thrombotic activity
1. Introduction
Marine organisms are increasingly being investigated as sources of bioactive molecules with
therapeutic applications as nutraceuticals and pharmaceuticals [1]. Accordingly, processing waste
from these organisms is an important source of bioactive molecules [2]. Abalone, a marine gastropod,
contains a variety of bioactive molecules with reported anti-oxidant, anti-thrombotic, anti-inflammatory,
anti-microbial and anti-cancer activities [3]. For thousands of years, different cultures have used
abalone as a traditional functional food, believing that its consumption provides health benefits [4].
Recent research has revealed that abalone is composed of many bioactive molecules like sulphated
polysaccharides, proteins and fatty acids that provide health benefits beyond basic nutrition [3]. In recent
years abalone has been investigated as source of sulphated polysaccharides with anti-thrombotic activity
with the potential to reduce thrombosis [5].
Thrombosis involves local clotting of blood in the vessel system that often leads to severe health
related disorders like heart attack and stroke. The risk factors for thrombosis are abnormally high
Mar. Drugs 2017, 15, 8
220
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2017, 15, 8
blood lipids, high blood glucose, elevated plasma fibrinogen, hypertension and cancer insurgence [6].
In the last several decades, prevention and treatment of thrombosis has been achieved with drugs,
including heparin and warfarin. Heparin, a highly sulphated glycosaminoglycan (GAG) present in
many mammalian tissues, is used commercially as an anti-coagulant or anti-thrombotic drug [7].
Heparin is administered intravenously, with frequent laboratory monitoring needed to prevent
unwanted and sometimes life-threatening bleeding [8]. Heparin-induced thrombocytopenia (a low
platelet count) is another serious complication following heparin therapy, particularly in some cardiac
patients [9]. Heparin also has other disadvantages as it is extracted and purified from bovine and
porcine internal organs making its production difficult and prone to contamination by other GAGs
present in these sources [10].
These disadvantages have necessitated a field of research aimed at discovering novel anti-thrombotic
and anti-coagulant agents with fewer side effects than heparin. Heparin-like molecules are present in
lower invertebrates [11], lobster [12], ascidians and tunicates [13]. Many other marine species including
molluscs, that are rich in sulphated polysaccharides, contain GAG-like molecules that have comparable
biological activity to heparin [14]. These uniquely sulphated polysaccharides have complex structures
composed of galactose, fucose, glucuronic acid and galactosamine. Sulphated polysaccharides isolated
from molluscs were found to contain anti-thrombin and anti-coagulant bioactive molecules with unique
3-O-sulphated glycosamine residues [11]. In general, these sulphated polysaccharides significantly vary
between species with respect to their composition. Furthermore, bioactivity has also been found to differ
depending upon the degree of sulphation, molecular weight, types of saccharides present and glycosidic
branching [15].
Many studies have demonstrated abalone viscera, gonads and pleopods are sources of
potent anti-thrombotic and anti-coagulant polysaccharides, however limited research has been
conducted in vitro using plasma and blood to investigate the anti-thrombotic and anti-coagulant
mechanisms [8,11,14,15]. Several well-established analyses are used to indicate anti-thrombotic activity
including prothrombin time (PT), activated partial thrombin time (aPTT) and thromboelastography
(TEG). These assays help to indicate if molecules act in both the intrinsic and extrinsic pathways
of the blood coagulation cascade [16] and what the impact on platelets might be. The aim of the
current research was to extract, purify and characterise GAG-like sulphated polysaccharides from offal
samples from processed wild caught H. rubra and assess anti-thrombotic and anti-coagulant activity in
the extracts using in vitro plasma and blood assays.
2. Results and Discussion
2.1. Protein and Sulphated Polysaccharide Content of Extracts from Blacklip Abalone Processing Waste
Table 1 shows the protein and sulphated polysaccharides that were estimated in all crude
extracts and expressed as mg sulphated polysaccharides or protein per gram of starting abalone
processing waste material (wet weight). Sulphated polysaccharides were similar across all samples,
however protein content was found to be significantly higher in canned abalone extracts compared to
the liquid abalone extracts, particularly following enzymatic treatment with papain, and with papain
and bromelain combined.
There were no sulphated polysaccharides detected in any enzyme (empty digest) control.
However as expected, protein was detected in all enzyme controls (data not shown). Simultaneous
digestion with papain and bromelain produced higher contents of sulphated polysaccharides in both
canned and liquid samples compared to single enzyme digestions, however these differences were
not statistically significant. Initial screening of anti-thrombin activity mediated by heparin cofactor-II
(HCII) depicted that most of the thrombin inhibition arose directly from the abalone samples with
enzyme control contributing less than 10% of the total thrombin inhibition.
The presence of sulphated polysaccharides in abalone processing waste has been observed
previously in other abalone species [17]. The extraction and purification of these sulphated
221
Mar. Drugs 2017, 15, 8
polysaccharides can be achieved by different processes, including enzyme digestion. Different enzymes
have different hydrolysing activities that vary in efficiency depending upon sample type, time of
incubation, pH and buffer [18]. Kechaou et al. [19] digested cuttlefish and sardine viscera with several
commercial proteases, including papain. In this study the degree of hydrolysis for cuttlefish was higher
than that obtained for sardine. The authors speculated that the differences may be due to a difference
in protein composition of the tissues and nature of the samples influencing the digestion profile.
In short, enzyme digestion varies depending upon the nature of the sample and hydrolysing conditions,
however it appears as though papain is commonly used in the digestion of various marine samples.
Table 1. Protein and sulphated polysaccharide content of extracts from abalone processing waste
expressed in mg per gram (on a wet weight basis).
Abalone Waste
Treatments
Protein (mg/g)
Sulphated
Polysaccharides (mg/g)
Anti-Thrombin HCII
(% Inhibition)
Canned
Canned
Papain
Bromelain
Papain +
Bromelain
29.95 ± 0.51 b
25.06 ± 1.79 c
1.36 ± 0.09 a
1.39 ± 0.91 a
92.1 ± 1.31 b
89.9 ± 2.09 c
36.10 ± 0.72 a
1.46 ± 0.38 a
96.8 ± 1.12 a
Papain
Bromelain
Papain +
Bromelain
18.82 ± 0.10 e
23.38 ± 2.09 d
1.27 ± 0.82 a
1.03 ± 0.13 a
97.1 ± 0.08 a
95.4 ± 2.13 a
18.90 ± 0.80 e
1.41 ± 0.68 a
91.1 ± 0.79 b
Canned
Liquid
Liquid
Liquid
Alphabetic letters shows the difference between different samples and treatments. HCII, heparin cofactor-II.
In the study presented here, combined enzymatic treatment with 0.5% w/v papain and 0.5%
w/v bromelain liberated the highest levels of sulphated polysaccharides and protein from canned
abalone processing waste compared to separate treatments with 1% w/v papain or 1% w/v bromelain.
These results suggest that the different protease activities of bromelain and papain are required
to produce optimal release of sulphated polysaccharides and protein from abalone processing
waste. Regardless of enzyme treatment, all extracts were investigated for anti-thrombotic and
anti-coagulant activity.
2.2. Separation of Abalone Extracts Using Anion Exchange Chromatography-Fast Performance Liquid
Chromatography (AEC-FPLC)
Based on previous studies it was hypothesised that sulphated polysaccharides present
in the abalone processing waste may confer both anti-thrombotic and anti-coagulant activity.
To produce fractions from the abalone extracts with enhanced sulphated polysaccharide content
and anti-thrombotic and anti-coagulant activity, all extracts were subjected to an anion exchange
chromatography-fast performance liquid chromatography (AEC-FPLC) system. As shown in
Figure 1, separation into sulphated polysaccharide-containing fractions was monitored through their
interactions with 1,9-dimethylene blue (DMMB) dye. Similar elution profiles were observed for
almost all extracts where sulphated polysaccharide concentration was mostly lower in first 10 eluted
fractions (0.4 M NaCl) and generally increased until fraction 30 (1.6 M NaCl). For analysis, seven
AEC pools were prepared. Five AEC pools were prepared from the NaCl gradient (AEC pools 1–5),
whilst the initial unbound material and a final column wash were also collected and analyzed for
bioactivity along linear gradient pools. All three enzyme controls showed similar elution profiles.
Most of the peptides eluted during sample application while few peptides were detected in AEC Pool
1. However, there was no protein or sulphated polysaccharides detected after AEC Pool 1 in all three
enzyme controls indicating no binding with column. Finally, to decrease NaCl concentration in all pools,
3 kDa spin columns and deionised water washes were performed until the NaCl concentration was
below 60 mM.
222
Mar. Drugs 2017, 15, 8
223
Figure 1. AEC-FPLC chromatograms showing separation of abalone extracts through interaction with DMMB. Concentration of sulphated polysaccharide (SP)ȱ ȱis
shown in relation to linear NaCl gradientȱ ȱin canned abalone processing waste digested with (A) papain; (B) bromelain; (C) papain + bromelain, and liquid abalone
processing waste digested with (D) papain; (E) bromelain and (F) papain + bromelain.
Mar. Drugs 2017, 15, 8
Protein and sulphated polysaccharides concentrations (via Blyscan™ Sulphated GAG assay)
were estimated in all the AEC pools and are shown in Table 2. The highest sulphated polysaccharide
concentrations were mostly measured in the gradient AEC pools 3 and 4 (0.8–1.0 M NaCl) whereas the
highest protein concentrations were measured in the unbound material because of almost complete
elution of enzymes. Some of the enzyme peptides were also detected in early AEC pool 1 during ion
exchange chromatography of empty control/enzyme controls.
Table 2. Protein and sulphated polysaccharide concentration of pooled fractions from AEC-FPLC
abalone extracts.
Sample Descriptions
Protein (mg/mL)
Sulphated Polysaccharides (mg/mL)
Can_Ab_Pap_Unbound material
Can_Ab_Pap_AEC Pool 1
Can_Ab_Pap_AEC Pool 2
Can_Ab_Pap_AEC Pool 3
Can_Ab_Pap_AEC Pool 4
Can_Ab_Pap_AEC Pool 5
Can_Ab_Pap_Final column wash
3.40 ± 1.1
0.76 ± 0.7
0.59 ± 0.4
1.87 ± 0.2
0.37 ± 0.1
0.23 ± 0.9
0.36 ± 2.3
1.12 ± 0.9
0.19 ± 0.4
1.04 ± 0.2
1.82 ± 1.2
1.49 ± 0.2
1.15 ± 1.3
0.03 ± 2.1
Can_Ab_Bro_Unbound material
Can_Ab_Bro_AEC Pool 1
Can_Ab_Bro_AEC Pool 2
Can_Ab_Bro_AEC Pool 3
Can_Ab_Bro_AEC Pool 4
Can_Ab_Bro_AEC Pool 5
Can_Ab_Bro_Final column wash
5.77 ± 1.4
0.74 ± 0.4
0.64 ± 0.1
0.16 ± 0.2
0.11 ± 0.1
0.05 ± 1.2
0.06 ± 2.1
0.56 ± 0.9
0.30 ± 0.3
1.02 ± 0.8
1.11 ± 0.4
1.21 ± 0.1
0.22 ± 1.1
0.02 ± 2.1
Can_Ab_Pap+Bro_Unbound material
Can_Ab_Pap+Bro_AEC Pool 1
Can_Ab_Pap+Bro_AEC Pool 2
Can_Ab_Pap+Bro_AEC Pool 3
Can_Ab_Pap+Bro_AEC Pool 4
Can_Ab_Pap+Bro_AEC Pool 5
Can_Ab_Pap+Bro_Final column wash
8.92 ± 1.2
1.31 ± 0.3
1.90 ± 0.1
0.37 ± 0.7
0.33 ± 0.1
0.05 ± 0.3
0.67 ± 0.9
0.65 ± 0.4
0.42 ± 0.2
2.01 ± 1.1
2.45 ± 0.9
2.00 ± 0.1
0.38 ± 0.7
0.54 ± 1.2
Liquid_Ab_Pap_Unbound material
Liquid_Ab_Pap_AEC Pool 1
Liquid_Ab_Pap_AEC Pool 2
Liquid_Ab_Pap_AEC Pool 3
Liquid_Ab_Pap_AEC Pool 4
Liquid_Ab_Pap_AEC Pool 5
Liquid_Ab_Pap_Final column wash
2.52 ± 1.1
0.17 ± 0.2
0.44 ± 0.8
0.33 ± 0.3
0.13 ± 0.1
0.02 ± 1.2
0.39 ± 2.1
0.03 ± 0.4
0.04 ± 0.1
0.70 ± 0.8
1.25 ± 0.7
1.64 ± 0.2
0.16 ± 0.7
0.01 ± 1.1
Liquid_Ab_Bro_Unbound material
Liquid_Ab_Bro_AEC Pool 1
Liquid_Ab_Bro_AEC Pool 2
Liquid_Ab_Bro_AEC Pool 3
Liquid_Ab_Bro_AEC Pool 4
Liquid_Ab_Bro_AEC Pool 5
Liquid_Ab_Bro_Final column wash
6.12 ± 1.1
0.00 ± 2.1
0.00 ± 0.5
0.91 ± 0.1
1.41 ± 0.5
0.21 ± 1.2
0.11 ± 0.9
0.40 ± 0.9
0.01 ± 0.1
0.02 ± 0.9
1.04 ± 0.2
3.10 ± 0.7
0.61 ± 1.1
0.47 ± 1.9
Liquid_Ab_Pap+Bro_Unbound material
Liquid_Ab_Pap+Bro_AEC Pool 1
Liquid_Ab_Pap+Bro_AEC Pool 2
Liquid_Ab_Pap+Bro_AEC Pool 3
Liquid_Ab_Pap+Bro_AEC Pool 4
Liquid_Ab_Pap+Bro_AEC Pool 5
Liquid_Ab_Pap+Bro_Final column wash
10.34 ± 0.9
0.45 ± 0.7
0.39 ± 0.9
0.56 ± 0.3
0.27 ± 0.2
0.11 ± 0.1
0.10 ± 1.1
0.95 ± 0.5
0.06 ± 0.6
2.07 ± 0.7
2.06 ± 0.2
1.43 ± 0.1
0.53 ± 0.9
0.05 ± 0.1
“Ab” stands for abalone, “Pap” stands for papain enzyme, “Bro” stands for bromelain enzyme while “Pap+Bro”
reflects the combination of both papain and bromelain enzymes.
224
Mar. Drugs 2017, 15, 8
In similar separation studies, different types of sulphated polysaccharides have been obtained
from visceral portions and gonads of abalone [20]. Wang et al. [21] isolated and characterized
three sulphated polysaccharides, AAP, AVAP I and AVAP II, from the pleopods and viscera of the
abalone H. discus hannai Ino. The crude polysaccharide extract was initially separated by AEC on a
diethylaminoethyl-cellulose (DEAE-cellulose) column with the main polysaccharide fraction from the
pleopods eluted with 0.42–0.60 M NaCl, whilst two fractions from the viscera eluted with 0.28–0.40 M
NaCl and 0.44–0.56 M NaCl.
Zhu et al. [22] demonstrated that sulphated polysaccharides isolated from pleopods of abalone
consist of 1-1,4-, 1,6-, or 1,4,6-linked glucose, and in accretion 1-, 1,3-, 1,6-, and 1,4,6-linked
galactose. Prior to this, She [23] also proposed that sulphated polysaccharides from abalone pleopods
are comprised of galactose, glucose, fructose and xylose. The acidic polysaccharide content has
not been fully determined, however several GAG-like structures have been defined in abalone.
The chemical structure of sulphated polysaccharides, isolated by Li et al. [17], contains a galactosamine
and glucuronic acid backbone linked to sulphated-fucose and galactose, considered to be similar
to the fucosylated chondroitin sulphate present in the sea cucumber [24]. In abalone, even though
these sulphated polysaccharides are linked with galactose to the fucose branch, it is still considered a
chondroitin-like polysaccharide [17].
Based on the assumption that the sulphated polysaccharides present in abalone processing waste
are also GAG-like molecules, the anti-thrombotic and anti-coagulant activities were investigated using
several in vitro assays.
2.3. Anti-Thrombotic Activity Measured through HCII-Mediated Thrombin Inhibition
To determine the anti-thrombotic activity of the different abalone processing waste extracts and
AEC pooled fractions, HCII-mediated thrombin inhibition was measured using the chromogenic
substrate Chromozym TH. All samples were initially screened without dilution to determine which
extracts and AEC pooled fractions contained anti-thrombotic molecules (data not shown). No activity
was observed in the enzyme controls, AEC Pool 1 and in the final column washes (data not shown).
The extracts and AEC pooled fractions that produced anti-thrombotic activity were then examined
further in order to compare the in vitro HCII-mediated thrombin inhibition between the different
samples. In vitro HCII-mediated anti-thrombin activity, expressed as percentage inhibition of thrombin,
is presented in Table 3 and shows that AEC pools 4 or 5 displayed the highest activity. AEC Pool 4 of
all abalone extracts showed significantly higher inhibition of thrombin (p < 0.05) relative to other pools
at a sulphated polysaccharide concentration of 100 µg/mL.
It was also observed that most of the time AEC pool 4 displayed highest activity at 10 and
1 µg/mL sulphated polysaccharide concentration. Moreover, specific enzyme digestion also showed
a marked effect on percentage inhibition; papain treatment alone or in combination appeared to be
the most efficient enzyme with respect to release of sulphated polysaccharides, whilst bromelain
digestion inconsistently inhibited thrombin and generally produced the lowest percentage inhibition.
The activity of the AEC pool 4 of the liquid abalone sample digested with papain and bromelain
showed thrombin inhibition only 2–3 times less compared to the heparin standard (on a similar
sulphated polysaccharides basis).
Other studies involving sulphated polysaccharides from marine sources support the
anti-thrombotic effects observed in this study [25]. These studies also proposed different mechanisms
of action involving factors Xa and thrombin (IIa) mediated by HCII and anti-thrombin III (ATIII) [26].
The specific pattern of sulphation and the position of glycosidic linkages varied among different species
and may contribute to difference in activity [27]. For example, sea cucumber polysaccharides displayed
weaker anti-factor Xa and anti-thrombin activities mediated by ATIII compare to both heparin and
low molecular weight heparin, suggesting that their anti-coagulant mechanisms are different from
those of heparin-like drugs. Thus, the structural interaction of these polysaccharides with coagulation
225
Mar. Drugs 2017, 15, 8
cofactors (HCII and ATIII) and their target proteases may be influenced by the conformation and
length of repetitive sulphated units [28].
Based on previous reports and on the findings presented here, extracts as well as the AEC pooled
fractions 3–5 were selected for further assessment using PT, aPTT and TEG assays to confirm the
anti-thrombotic and anti-coagulant effect of these samples in blood and plasma and to help elucidate
the role of these molecules in the coagulation cascade.
Table 3. Heparin cofactor II-mediated thrombin inhibition by abalone samples expressed as percentage
inhibition of thrombin activity.
Percentage Inhibition of Thrombin Mediated by HCII at 10 min
Sample Description
Sulphated Polysaccharide Concentration (µg/mL)
100
50
10
j
1
Can_Ab_Pap
Can_Ab_Pap_Unbound material
Can_Ab_Pap_AEC Pool 2
Can_Ab_Pap_AEC Pool 3
Can_Ab_Pap_AEC Pool 4
Can_Ab_Pap_AEC Pool 5
d
93.1 ± 0.8
56 ± 0.4 k
8.5 ± 1.9 s
87.6 ± 3.2 e
96.1 ± 0.4b c
97.5 ± 0.2 ab
26 ± 7.5
26.9 ± 0.8 j
8.7 ± 3.4 q
81.8 ± 0.8 f
92.7 ± 1.7 c
94.6 ± 1.8 b
11.4 ± 10.2
0
0
13.9 ± 6.6 k
43 ± 3.9 f
78.2 ± 2.7 b
0
0
0
0
9.4 ± 6.6 d
20.7 ± 4.2 b
Can_Ab_Bro
Can_Ab_Bro_Unbound material
Can_Ab_Bro_AEC Pool 2
Can_Ab_Br_AEC Pool 3
Can_Ab_Bro_AEC Pool 4
Can_Ab_Bro_AEC Pool 5
72.3 ± 1.2 g
14.2 ± 5.1 r
56.6 ± 1.9 jk
26.4 ± 3.7 q
93.1 ± 0.5 d
45.3 ± 2.1 n
13.2 ± 2.9 ◦
0
38.5 ± 6.1 h
21.5 ± 3.6 m
89.4 ± 0.2 e
17.9 ± 3.8 n
2.4 ± 1.1 p
0
0
3.6 ± 4.5 ◦
27.7 ± 3.8 g
0
0
0
0
0
0
0
Can_Ab_Pap + Bro
Can_Ab_Pap+Bro_Unbound material
Can_Ab_Pap+Bro_AEC Pool 2
Can_Ab_Pap+Bro_AEC Pool 3
Can_Ab_Pap+Bro_AEC Pool 4
Can_Ab_Pap+Bro_AEC Pool 5
82.4 ± 0.6 f
61.27 ± 4.8 i
34.3 ± 1.9 ◦
93.6 ± 0.3 d
96.4 ± 0.3b c
58.45 ± 2.8 j
24 ± 2.2 l
13.21 ± 3.9 ◦
25.8 ± 2.4 kl
90.9 ± 0.5 d
94.9 ± 0.3 b
21.29 ± 1.2 m
10.3 ± 6.2 m
0
0
19.4 ± 2 j
56.9 ± 2.1 d
9.8 ± 2.7 mn
0
0
0
0
14.3 ± 4.2 c
0
Liquid_Ab_Pap
Liquid_Ab_Pap_Unbound material
Liquid_Ab_Pap_AEC Pool 2
Liquid_Ab_Pap_AEC Pool 3
Liquid_Ab_Pap_AEC Pool 4
Liquid_Ab_Pap_AEC Pool 5
93.4 ± 1.1 d
12.43 ± 1.8 r
28.3 ± 0.9 q
94.9 ± 0.1 cd
98.5 ± 0.1 a
57.12 ± 0.7 jk
65.2 ± 2.1 g
0
11.2 ± 0.7 p
88.5 ± 1.8 e
96.3 ± 0.2 a
21.23 ± 0.1 m
21.4 ± 0.9 i
0
0
24.8 ± 2.3 h
69.1 ± 2.2 c
10.2 ± 1.1 m
5.4 ± 1.1 e
0
0
0
13 ± 3.5 c
0
Liquid_Ab_ Bro
Liquid_Ab_Bro_Unbound material
Liquid_Ab_Bro_AEC Pool 3
Liquid_Ab_Bro_AEC Pool 4
Liquid_Ab_Bro_AEC Pool 5
64.32 ± 1.9 h
14.26 ± 4.9 r
34.68 ± 0.8 ◦
52.9 ± 0.7 l
64.98 ± 1.8 h
21.4 ± 0.4 m
2.7 ± 1.9 r
11.2 ± 2.9 p
34.7 ± 1.9 i
38.9 ± 0.7 h
10.2 ± 1.9 mn
0
0
10.21 ± 0.8 mn
9.7 ± 1.9 n
0
0
0
0
1.1 ± 1.8 f
Liquid_Ab_Pap+Bro
Liquid_Ab_Pap+Bro_AEC Pool 2
Liquid_Ab_Pap+Bro_AEC Pool 3
Liquid_Ab_Pap+Bro_AEC Pool 4
Liquid_Ab_Pap+Bro_AEC Pool 5
93.1 ± 0.8 d
32.1 ± 0.6 p
95.3 ± 0.3 cd
98.4 ± 0.1 a
47.4 ± 2.9 m
26 ± 3.5 jk
20.6 ± 3.5 m
93.6 ± 1 c
96.1 ± 2.2 a
21.49 ± 4.1 m
11.4 ± 10.2 l
3.1 ± 4.1 ◦
47.3 ± 0.8 e
92.4 ± 1.2 a
1.4 ± 2.9 q
0
0
2.8 ± 2.2 ef
25.7 ± 0.4 a
0
Heparin Standard
16
91.5 ± 0.6 a
4
75.0 ± 1.3 b
2
48.0 ± 2.1 c
0.5
27.6 ± 1.2 d
l
“Ab” stands for abalone, “Pap” stands for papain enzyme, “Bro” stands for bromelain enzyme while “Pap+Bro”
reflects the combination of both papain and bromelain enzymes. Alphabetic letters shows the difference between
different samples and treatments, ANOVA p < 0.05.
226
Mar. Drugs 2017, 15, 8
2.4. Anti-Thrombotic and Anti-Coagulant Activity in Blood and Plasma
2.4.1. Prothrombin and Activated Partial Thromboplastin Time
The in vitro clotting assays PT and aPTT showed positive responses to all abalone extracts and
pools 3 and 4. Figure 2 demonstrates that PT increased with sulphated polysaccharide concentration,
and that pools 3 and 4 generally prolonged PT time more effectively than the original extracts.
In particular, pool 4 from both the canned and liquid abalone samples significantly increased PT
compared with other pools. Comparing to heparin standard, both extract and pools showed an
increase in PT activity. PT and aPTT were not observed in the enzyme controls. The aPTT also showed
an increase with sulphated polysaccharide concentration. In Figure 3, both canned and liquid extracts,
digested with different enzymes, prolonged aPTT significantly compared to the saline control.
Furthermore, all three enzyme controls were also subjected to aPTT analysis and they were unable
to prolong aPTT. Moreover, heparin standard was also subjected to aPTT analysis. Even at a very low
concentration of 0.02 mg/mL, no clot formed, demonstrating that heparin standard has a very strong
aPTT activity and it can prolong aPTT many fold higher compared with our extract. However, from the
results it appeared that AEC pools 3 and 4 prolonged aPTT more compared with the original extract.
Furthermore, AEC pool 4 from both the canned and liquid abalone processing waste appeared to
prolong aPPT more when compared to the remaining AEC pools.
The results presented here are supported by several other studies that report the pharmaceutical
importance of abalone. Previously, Li et al. [17] isolated a GAG-like polysaccharide from abalone,
and conducted in vitro investigations on its anti-coagulant activity. Usually in vitro anti-coagulant
assays thrombin time (TT), PT and aPTT and help to indicate anti-coagulant activity with respect to the
intrinsic and extrinsic pathways in the blood coagulation cascade. PT reflects the extrinsic pathway of
the coagulation cascade whilst aPTT reflects changes in the intrinsic pathway of the blood coagulation
cascade [16]. Li et al. [17] found that the GAG-like polysaccharide could prolong aPTT as well as TT.
In another study by Li et al. [29], different types of extracts were prepared from abalone viscera
and it was found that water extracts were associated with higher PT, aPTT and TT when compared
to extracts prepared using different solvents. The heparin control displayed higher specific activity
in processing waste from abalone offal. Other research also demonstrated that GAG-like molecules
isolated from different sea cucumbers did not show a prominent effect on PT but efficiently improved
the aPTT and TT. It also indicated that the type of sulphated polysaccharides present in sea cucumber
may affect the intrinsic but not the extrinsic and common coagulation process [24] compared with
abalone. This suggests abalone sulphated polysaccharides are involved in both intrinsic and extrinsic
pathways. In order to confirm this mode of action and further demonstrate a role for abalone sulphated
polysaccharides in both intrinsic and extrinsic pathway, an in vitro blood assay was performed
using TEG.
227
Mar. Drugs 2017, 15, 8
228
ȱ
Figure 2. Prothrombin time (PT) of abalone processing waste extracts and AEC pooled fractions. Graphs (A, A-3): canned abalone processing waste digested with
papain, bromelain and a combination of papain and bromelain and their respective AEC pools 3 and 4; (B, B-3): liquid abalone processing waste digested with
papain, bromelain and a combination of papain and bromelain and their respective AEC pools 3 and 4. * = Statistical significance determined using a one way
ANOVA with Dunnett’s Multiple Comparison Test compared to saline control with * p < 0.05 and ** p < 0.01.
Mar. Drugs 2017, 15, 8
229
ȱ
Figure 3. Activated partial thrombin time (aPTT) of abalone processing waste extracts and AEC pooled fractions. (A, A-3) canned abalone digested with papain,
bromelain and a combination of papain and bromelain and their respective AEC pool 3 and 4 while (B, B-3), liquid abalone samples digested with papain, bromelain
and a combination of papain and bromelain and their respective AEC pool 3 and 4. * Statistical significance determined using a one way ANOVA with Dunnett’s
Multiple Comparison Test compared to saline control with * p < 0.05 and ** p < 0.01. Heparin standard did not form a clot even at very low concentration. It showed
that the heparin standard is many times stronger in aPTT activity compare to abalone extract and anion exchanged pools.
Mar. Drugs 2017, 15, 8
2.4.2. Thromboelastography (TEG)
TEG is a global assessment of haemostatic function investigating the interaction of platelets
with the coagulation cascade from the time of initial fibrin formation through to platelet aggregation,
clot strengthening, fibrin cross linkage, and to eventual clot lysis. To assess anti-coagulant activity in
this study, TEG parameters including R-time, α-angle and MA value were measured.
All extracts and AEC pooled fractions were freeze dried, resuspended in deionised water and
added to whole blood in the TEG assay. Table 4 demonstrates that both liquid and canned abalone
samples have anti-coagulant activity. In particular, R time is prolonged significantly when sulphated
polysaccharide concentrations are increases compared to the saline control. Higher anti-coagulant
activity was associated with stronger effects on α-angle and MA values that decreased significantly
compared to saline control. These results suggest that molecules present in abalone extracts have an
effect on clot strength and platelet function indicating that the kinetics of fibrin polymerization and
networking are also affected.
Table 4. Abalone extracts and AEC pools and thromboelastography.
Sample Description
SP Conc.
(µg/mL)
R (s)
MA (mm)
Control Saline
0
445 ± 14.5
55.2 ± 1.2
45.2 ± 0.5
Can_Ab_Pap
20
80
20
30
22
34
760 ± 20.5 **
1115 ± 21.8 **
770 ± 8.5 **
1245 ± 12.2 **
930 ± 10.6 **
1475 ± 25.5 **
37.6 ± 2.4 **
33.3 ± 1.7 **
35.3 ± 2.3 **
34.8 ± 0.5 **
34.4 ± 1.9 **
24.9 ± 1.5 **
12 ± 1.5 **
22.2 ± 5.4 **
12 ± 1.7 **
15.4 ± 0.9 **
12.8 ± 0.8 **
10 ± 0.9 **
10
60
7
35
8
635 ± 10.2 **
1010 ± 24.7 **
515 ± 15.6 **
915 ± 20.3 **
495 ± 4.9 **
49.1 ± 2.5 **
29.8 ± 1.9 **
40.2 ± 3.6 **
33.4 ± 2.8 **
27 ± 0.5 **
23.1 ± 3.7 **
5.6 ± 4.1 **
31.7 ± 2.1 **
12.5 ± 1.7 **
18.1 ± 0.6 **
38
20
70
15
31
13
645 ± 15.6 **
845 ± 12.8 **
1340 ± 24.7 **
810 ± 20.3 **
1180 ± 25.9 **
690 ± 6.5 **
33.6 ± 1.2 **
41.6 ± 1.4 **
37.3 ± 2.5 **
37.3 ± 4.9 **
35.6 ± 1.6 **
28.5 ± 1.4 **
26 ± 0.9 **
19 ± 2.1 **
14.3 ± 1.9 **
17.4 ± 1.1 **
16.6 ± 0.4 **
17.2 ± 0.2 **
25
30
50
8
39
10
855 ± 12.5 **
940 ± 16.5 **
1410 ± 35.2 **
670 ± 14.7 **
1540 ± 23.6 **
500 ± 6.9 **
21.7 ± 1.8 **
34.5 ± 4.4 **
31.2 ± 1.2 **
46.3 ± 6.5 **
33.6 ± 3.9 **
33.8 ± 2.1 **
20.8 ± 0.4 **
12.5 ± 4.7 **
14.9 ± 1.2 **
26.9 ± 4.9 **
13.6 ± 3.4 **
28.8 ± 0.2 **
51
40
90
32
64
4
705 ± 11.8 **
710 ± 7.5 **
1075 ± 12.5 **
990 ± 4.2 **
1295 ± 10.9 **
620 ± 27.1 **
25.1 ± 0.5 **
38.9 ± 4.7 **
31.5 ± 1.2 **
36.1 ± 1.9 **
26.9 ± 2.9 **
36.7 ± 5.9 **
10.2 ± 0.9 **
25.9 ± 2.8 **
12.2 ± 3.1 **
35.7 ± 1.7 **
17.5 ± 2.1 **
32.3 ± 3.5 **
19
20
40
13
26
9
45
1115 ± 12.8 **
890 ± 8.5 **
1495 ± 24.5 **
685 ± 14.3 **
1865 ± 20.5 **
650 ± 10.3 **
1420 ± 15.8 **
33.8 ± 7.6 **
39.6 ± 3.2 **
36.1 ± 1.9 **
43 ± 2.9 **
31.8 ± 3.9 **
27.3 ± 1.2 **
35.6 ± 0.9 **
13.7 ± 4.7 **
23.5 ± 1.9 **
12.4 ± 2.2 **
29.6 ± 4.1 **
8.5 ± 3.2 **
27.7 ± 0.8 **
15.2 ± 0.1 **
Can_Ab_Pap_AEC Pool 3
Can_Ab_Pap_AEC Pool 4
Can_Ab_Bro
Can_Ab_Bro_AEC Pool 3
Can_Ab_Bro_AEC Pool 4
Can_Ab_Pap+Bro
Can_Ab_Pap+Bro_AEC Pool 3
Can_Ab_Pap+Bro_AEC Pool 4
Liquid_Ab_Pap
Liquid_Ab_Pap_AEC Pool 3
Liquid_Ab_Pap_AEC Pool 4
Liquid_Ab_Bro
Liquid_Ab_Bro_AEC Pool 4
Liquid_Ab_Bro_AEC Pool 5
Liquid_Ab_Pap+Bro
Liquid_Ab_Pap+Bro_AEC Pool 3
Liquid_Ab_Pap+Bro_AEC Pool 4
α (Degree)
“SP” stands for Sulphated Polysaccharides “Ab” stands for abalone, “Pap” stands for papain enzyme,
“Bro” stands for bromelain enzyme while “Pap+Bro” reflects the combination of both papain and bromelain
enzymes. ** Using the Dunnett’s Multiple Comparison Test, all the treatment are significantly different to each
other by comparing with saline control.
The AEC pool fractions prolonged R time more than the original extracts. Generally, AEC pool
3 and 4 appeared to increase R time more than other AEC pools (data not shown).
In these samples, R time increased with an increasing sulphated polysaccharide concentration.
230
Mar. Drugs 2017, 15, 8
However it was also observed that both fractions from AEC pool 3 and 4 affected MA values and
α-angles more than the extracts, suggesting a greater effect on clot strength and platelet function
because α-angles indicate fibrin build up and cross-linking while MA values reflect clot formation,
firmness and platelet function.
The relationship between structure and anti-coagulant activity has been previously investigated
in detail for heparin and fucosylated chondroitin sulphate [24]. Both molecules inhibit the intrinsic
and/or common pathways of coagulation and thrombin activity or conversion of fibrinogen to
fibrin, as observed in the study presented here. This is in agreement with a TEG study reported
by Fischer et al. [30] who demonstrated that a variety of glucosamine-based biopolymers including
the marine-derived poly-N-acetyl glucosamine could decrease the R time and increase maximal clot
strength in plasma. The haemostatic properties were highly dependent on the chemical nature and
tertiary/quaternary structure of these biomaterials.
3. Materials and Methods
3.1. Chemicals
All chemicals were reagent grade and unless otherwise indicated were from Sigma-Aldrich
(St Louis, MO, USA). Food grade enzymes papain 30,000 (30,000 PU/gram, Papain Units) and
bromelain concentrate (2400 GDU/gram, Gelatin Digestion Units) were from Enzyme Solutions
Pty Ltd. (Croydon South, Australia). The Blyscan™ Glycosaminoglycan Assay was from
Biocolor (Carrickfergus, County Antrim, UK). Other suppliers are listed here: Pierce BCA
Protein Assay kit (Quantum Scientific, Murarrie, Australia); Q Sepharose™ Big Beads (GE
Healthcare Life Science, Chicago, IL, USA); Thromborel S® (Dade Behring Inc. Newark, NJ, USA);
Triniclot (Haemostasis, Wicklow, Ireland); Chromozym TH (Roche Diagnostics, Basel, Switzerland);
and human alpha-thrombin and human Heparin Cofactor II (HCII) (US Biologicals, Salem, MA, USA).
3.2. Preparation of Extracts
Processed wild caught H. rubra byproducts (comprised of viscera and gonads) were provided by
Lonimar Australia Pty Ltd (formerly of Melbourne, Australia). Samples were received either as a paste
(canned) or liquid (hot-filled bag). All samples were stored at −20 ◦ C.
Extracts were prepared using the food grade proteases papain and bromelain either separately or
combined as a 1:1 ratio. Each digest contained 20 g abalone processing waste and 1% w/v papain or
bromelain, or a mixture of 0.5% w/v papain and 0.5% w/v bromelain, in water (final volume 100 mL).
For the purpose of determining the contribution of the two enzymes to the subsequent assay
measurements, enzyme-only control digests were prepared using the same concentrations and
conditions but with no added abalone extract. Digests were incubated overnight (14–16 h)
at 50 ◦ C, inactivated by heating at 95 ◦ C for 10 min, cooled on ice and centrifuged (Beckman Coulter,
Avanti® J-26XP1, Brea, CA, USA) at 5940× g for 10 min to remove undigested material (pellet).
Approximately 0.6 g of undigested material was usually discarded. Supernatants were clarified
using 2, 1 μm (Whatman™, GE Healthcare, Life Science, Chicago, IL, USA) and 0.45 μm filtration
(mixed cellulose ester, Merck Millipore, Bayswater VIC, Australia) and extracts were stored at −20 ◦ C.
Due to likely interference with bioassays, salt ions were removed from all abalone extracts and
pooled fractions using 3 kDa molecular weight cut off (MWCO) spin columns (Centrifuge Filter Unit,
Merck Millipore, Billerica, MA, USA). 10 mL samples were added into the spin column and centrifuged
at 3270× g for 30 min. This process was repeated using deionised water until salt was at or below
60 mM. Conductivity was measured using a Metler Toledo-AG conductivity meter (VWR International
Pty, Ltd., Dietikon, Switzerland). Salt concentration was extrapolated using a NaCl standard curve.
231
Mar. Drugs 2017, 15, 8
3.3. Estimation of Sulphated Glycosaminoglycan Content
3.3.1. Dimethyl-Methylene Blue (DMMB) Assay
Sulphated polysaccharide concentration was initially estimated in samples and extracts through
interaction with DMMB dye. 200 µL DMMB dye solution was added to 25 µL samples, blanks or
standards (chondroitin sulphate from bovine trachea, Sigma-Aldrich, Castle Hill, NSW, Australia) in
triplicate, in a 96 well plate (Nunclon Delta Surface, Thermo Fisher Scientific, Waltham, MA, USA).
The plate was mixed for 1 min using a plate mixer (IKA® MS digital 96 Well Plate Mixer,
Staufen im Breisgau, Germany) and absorbance was measured at 525 nm using a Spectra-Max M3
System spectrophotometer (Molecular Devices, Sunnyvale, CA, USA). Sulphated polysaccharides
were calculated from the standard curve using SoftMax-Pro 6.1 software (Molecular Devices,
Sunnyvale, CA, USA).
3.3.2. Blyscan Sulphated Glycosaminoglycan (GAG) Assay
Sulphated polysaccharide concentration was measured in all samples and pooled fractions
using the Blyscan™ Sulphated Glycosaminoglycan assay according to manufacturer’s instructions
(Biocolor Ltd., Carrickfergus, County Antrim, UK), with modifications. Blyscan Dye Reagent
(250 µL) was added to 25 µL sample, blank or standard (chondroitin sulphate from bovine trachea,
Sigma-Aldrich, Castle Hill, NSW, Australia) in triplicate, in a 96 well V-bottom plate (Stor Plate-96
V-bottom, Perkin Elmer, Waltham, MA, USA). The plate was placed on an orbital shaker for 30 min
(500 rpm) followed by centrifugation at 3270× g (Beckman Coulter, Allegra™ X-12R, Lane Cove,
NSW, Australia) for 10 min. Supernatant was removed without disturbing the pellet using a vacuum
before 250 µL Blyscan Dye Dissociation Reagent was added to each well. The plate was again placed
on the orbital shaker for 30 min (500 rpm) or until complete dissociation of the pellet. 200 µL of the
resuspended solution was transferred from each well into a 96 Well Plate to enable absorption to be
measured at 656 nm in a Spectra-Max M3 System spectrophotometer. Sulphated polysaccharides were
calculated from the standard curve using SoftMax-Pro 6.1 software.
3.4. Estimation of Protein Content
Protein content was estimated in all samples and extracts using the Pierce BCA Protein Assay
Kit (Thermo Fisher Scientific, Waltham, MA, USA) with bovine serum albumin (BSA) as a protein
standard, according to manufacturer’s instructions. Absorbance was measured at 562 nm using a
Spectra-Max M3 System spectrophotometer. Protein concentration was calculated from the standard
curve using SoftMax-Pro 6.1 software.
3.5. Separation of Extracts Using Anion Exchange Chromatography-Fast Performance Liquid
Chromatography (AEC-FPLC)
An empty 200 mm × 16 mm column (GE-XK 16/20) packed with 13.5 mL Q Sepharose™ Big
Beads and connected to fast protein liquid chromatography (FPLC) system (ÄKTA Lab-Scale Systems,
GE Healthcare Life Science, Chicago, IL, USA) was used to fractionate the abalone extracts on the basis
of their anionic interactions. The column was equilibrated with deionised water (Buffer A) before
approximately 28 mg sample (based on sulphated polysaccharides as measured by DMMB assay) was
loaded onto the column. Flow rate was set at 5 mL/min with a column pressure of 1 MPa. Fractions
(2 mL each) were collected using a 0–2 M NaCl linear gradient over 20 min. AEC fractions were
collected and pooled (7 pools for each sample) on the basis of their interactions with DMMB dye.
For further analysis, all AEC pooled samples were desalted using 3 kDa MWCO spin columns and
washed using deionised water.
232
Mar. Drugs 2017, 15, 8
3.6. Assessment of Anti-Thrombotic and Anti-Coagulant Activity
3.6.1. Heparin Cofactor II (HCII) Mediated Thrombin Inhibition Assay
In vitro HCII-mediated thrombin inhibition was measured in the extracts and AEC pooled
fractions using a kinetic assay as previously described by Dupouy et al. [31] with modifications by
Hines et al. [32]. Briefly, 12.9 µM HCII in 0.02 M Tris-HCl pH 7.4/0.15 M NaCl/1 mg/mL polyethylene
glycol (PEG) and 1 µL serially diluted extract, sample or standard (heparin from porcine intestinal
mucosa, Sigma-Aldrich) was added to a 384 well plate (SpectraPlate-384 TC, clear, tissue culture with
lid, Perkin Elmer, Waltham, MA, USA) by an epMotion® 5075L/epMotion® 5075TMX automated
pipetting system (Eppendorf, Hamburg, Germany), mixed and incubated at room temperature for
22 min. Thrombin was then added (0.45 µM) prior to the final addition of 83 µM Chromozym TH.
The assay was incubated at 37 ◦ C for 40 min with absorbance measured at 405 nm every 2 min in a
Spectra-Max M3 System spectrophotometer. HCII-mediated thrombin inhibition was measured at 10 min
in triplicate and expressed as the mean percentage inhibition of thrombin activity ± standard error.
3.6.2. Prothrombin Time (PT) Assay
To measure PT, 100 µL citrated plasma was added to a glass clotting tube and incubated at 37 ◦ C
on the heating block of a Hyland-Clotek clotting machine for 5 min. 50 µL saline (negative control),
heparin/Clexane (positive control) or diluted abalone extracts or AEC pooled fractions were added
to the tube. The volume was adjusted to 150 µL with plasma before the final addition of 100 µL
Thromborel S® (Dade Behring Inc. Newark, NJ, USA) to initiate clotting. Time in seconds until clot
formation was measured in triplicate and expressed as the mean ± standard error.
3.6.3. Activated Partial Thromboplastin Time (aPTT) Assay
To measure aPTT, 100 µL citrated plasma, 100 µL Triniclot (Haemostasis, Wicklow, Ireland) and
diluted abalone extracts and AEC pooled fractions were added to a clotting tube. The final volume
was adjusted to 250 µL with saline. The clotting tube was incubated at 37 ◦ C in a heating block
(Hyland-Clotek clotting machine) for 5 min before 50 µL 50 mM calcium solution in saline were added
to initiate clotting. Time in seconds until clot formation was measured in triplicate and expressed as
the mean ± standard error.
3.6.4. Thromboelastography (TEG)
To measure clot dynamics in the presence of abalone extracts and AEC pooled fractions,
TEG (Haemonetics, Braintree, MA, USA) analyses were undertaken. These analyses provide
measurements of whole blood hemostasis that help to assess bleeding and thrombotic risks,
as well as monitor anti-thrombotic therapies by investigating the shear elasticity of a clot as it forms
or lyses through the following parameters: reaction time (R) which is the time from the start of a
sample run until the first detectable clot formation (this is the point at which most traditional plasma
clotting assays reach their end point); α-Angle (α) which is the measurement of the rapidity of fibrin
build-up and cross-linking (or clot strengthening); and maximal amplitude (MA) which is the maximal
stiffness or strength (maximal shear modulus) of the developed clot. A typical TEG tracing, generated
by the TEG companion software is shown in Figure 4 and depicts R, α and MA. The parameters are as
labelled and described by the TEG® (Haemostasis Analyser, Braintree, MA, USA) 5000 Series Manual.
In this method, 280 μL citrated whole blood and 20 μL 0.2 M CaCl2 , along with 20 μL of the
negative (saline) or positive (heparin) controls or the abalone test compounds, were added into a
disposable TEG cup (Haemonetics, Braintree, MA, USA).
233
Mar. Drugs 2017, 15, 8
ȱ
Figure 4. Representation of a typical TEG trace obtained during the clotting of citrated whole blood [33].
3.7. Statistical Analyses
All statistical analyses were conducted using a one-way ANOVA with post hoc comparisons
using Tukey’s multiple comparison test. These calculations were carried out using GraphPad Prism 5
Software for Windows (GraphPad 5 Software, San Diego, CA, USA, www.graphpad.com).
4. Conclusions
Extracts were prepared from blacklip abalone processing waste using food grade proteases and
separated by AEC to produce fractions enriched with sulphated polysaccharides. These sulphated
polysaccharides appeared to display properties similar to GAG-like molecules previously characterised
in other abalone species by inhibiting thrombin activity through HCII and displaying significant
anti-coagulant activity in plasma and blood. Further studies are needed to improve our understanding
of the anti-coagulant mechanism in vitro and the critical structures required for the mechanism/s
behind the anti-coagulant activity.
Acknowledgments: Hafiz Ansar Rasul Suleria was awarded an International Postgraduate Research Scholarship
(IPRS), Australia Postgraduate Award (APA) and Postgraduate Studentship (Commonwealth Scientific and
Industrial Research Organisation, CSIRO) from the Australian Government at the University of Queensland,
Australia. This research received funding from the Fisheries Research and Development Corporation for initial
work, which is sponsored by the Australian Government.
Author Contributions: Hafiz Ansar Rasul Suleria, Simone A. Osborne and Paul Masci conceived and designed
the experiments; Hafiz Ansar Rasul Suleria performed all the experiments; Barney M. Hines and Rama Addepalli
helped in analyzing the data; Glenda Gobe and Wei Chen contributed reagents/materials/analysis tools;
Hafiz Ansar Rasul Suleria wrote the original draft while edited by Simone Osborne and Glenda Gobe.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
Ngo, D.H.; Vo, T.S.; Ngo, D.N.; Wijesekara, I.; Kim, S.K. Biological activities and potential health benefits
of bioactive peptides derived from marine organisms. Int. J. Biol. Macromol. 2012, 51, 378–383. [CrossRef]
[PubMed]
Hickey, R.M. Extraction and characterization of bioactive carbohydrates with health benefits from marine
resources: macro- and microalgae, cyanobacteria, and invertebrates. In Marine Bioactive Compounds: Sources,
Characterization and Applications; Hayes, M., Ed.; Springer: Boston, MA, USA, 2012; pp. 159–172.
Suleria, H.A.R.; Masci, P.P.; Gobe, G.C.; Osborne, S.A. Therapeutic potential of abalone and status of bioactive
molecules: A comprehensive review. Crit. Rev. Food Sci. Nutr. 2015. [CrossRef] [PubMed]
Gates, K.W. Marine nutraceuticals: prospects and perspectives Edited by Se-Kwon Kim. J. Aquat. Food
Prod. Technol. 2014, 23, 522–527. [CrossRef]
Harnedy, P.A.; FitzGerald, R.J. Bioactive peptides from marine processing waste and shellfish: A review.
J. Funct. Foods 2012, 4, 6–24. [CrossRef]
234
Mar. Drugs 2017, 15, 8
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
Leopold, J.A.; Loscalzo, J. Oxidative risk for atherothrombotic cardiovascular disease. Free Radic. Biol. Med.
2009, 47, 1673–1706. [CrossRef] [PubMed]
David, J.C. Pharmacology and Pharmaco-Therapeutics, 7th ed.; Vikas Publishing House: New Delhi, India, 1979.
Franchini, M.; Liumbruno, G.M.; Bonfanti, C.; Lippi, G. The evolution of anticoagulant therapy.
Blood Transfus. 2016, 14, 175–184. [PubMed]
Ahmed, I.; Majeed, A.; Powell, R. Heparin induced thrombocytopenia: Diagnosis and management update.
Postgrad. Med. J. 2007, 83, 575–582. [CrossRef] [PubMed]
Shanmugam, M.; Mody, K.H.; Oza, R.M.; Ramavat, B.K. Blood anticoagulant activity of a green marine alga
Codium dwarkense (Codiaceae, Chlorophyta) in relation to its growth stages. Indian J. Geo-Mar. Sci. 2001,
30, 49–52.
Kim, Y.S.; Jo, Y.Y.; Chang, I.M.; Toida, T.; Park, Y.; Linhardt, R.J. A new glycosaminoglycan from the giant
African snail Achatina fulica. J. Biol. Chem. 1996, 271, 11750–11755. [CrossRef] [PubMed]
Mauro, M.C.; Toutain, S.; Walter, B.; Pinck, L.; Otten, L.; Coutos-Thevenot, P.; Barbier, P. High efficiency
regeneration of grapevine plants transformed with the GFLV coat protein gene. Plant Sci. 1995, 112, 97–106.
[CrossRef]
Santos, J.C.; Mesquita, J.M.F.; Belmiro, C.L.R.; da Silveira, C.B.M.; Viskov, C.; Mourier, P.A.; Pavão, M.S.G.
Isolation and characterization of a heparin with low antithrombin activity from the body of Styela plicata
(Chordata-Tunicata). Distinct effects on venous and arterial models of thrombosis. Thromb. Res. 2007, 121,
213–223. [CrossRef] [PubMed]
Lopes-Lima, M.; Ribeiro, I.; Pinto, R.A.; Machado, J. Isolation, purification and characterization of
glycosaminoglycans in the fluids of the mollusc Anodonta cygnea. Comp. Biochem. Physiol. A 2005, 141,
319–326. [CrossRef] [PubMed]
Qi, H.; Zhang, Q.; Zhao, T.; Chen, R.; Zhang, H.; Niu, X.; Li, Z. Antioxidant activity of different sulfate
content derivatives of polysaccharide extracted from Ulva pertusa (Chlorophyta) in vitro. Int. J. Biol. Macromol.
2005, 37, 195–199. [CrossRef] [PubMed]
Sikka, P.; Bindra, V.K. Newer antithrombotic drugs. Indian journal of critical care medicine: Peer-reviewed.
Off. Publ. Indian Soc. Crit. Care Med. 2010, 14, 188–195. [CrossRef] [PubMed]
Li, G.Y.; Chen, S.G.; Wang, Y.M.; Xue, Y.; Chang, Y.G.; Li, Z.J.; Xue, C.H. A novel glycosaminoglycan-like
polysaccharide from abalone Haliotis discus hannai Ino: Purification, structure identification and anticoagulant
activity. Int. J. Biol. Macromol. 2001, 49, 1160–1166. [CrossRef] [PubMed]
Zhou, D.Y.; Tang, Y.; Zhu, B.W.; Qin, L.; Li, D.M.; Yang, J.F.; Murata, Y. Antioxidant activity of hydrolysates
obtained from scallop (Patinopecten yessoensis) and abalone (Haliotis discus hannai Ino) muscle. Food Chem.
2012, 132, 815–822. [CrossRef]
Kechaou, E.S.; Dumay, J.; Donnay-Moreno, C.; Jaouen, P.; Gouygou, J.P.; Bergé, J.P.; Amar, R.B.
Enzymatic hydrolysis of cuttlefish (Sepia officinalis) and sardine (Sardina pilchardus) viscera using commercial
proteases: Effects on lipid distribution and amino acid composition. J. Biosci. Bioeng. 2009, 107, 158–164.
[CrossRef] [PubMed]
Zhu, B.W.; Zhou, D.Y.; Li, T.; Yan, S.; Yang, J.F.; Li, D.M.; Murata, Y. Chemical composition and free radical
scavenging activities of a sulphated polysaccharide extracted from abalone gonad (Haliotis discus hannai Ino).
Food Chem. 2010, 121, 712–718. [CrossRef]
Wang, Y.M.; Wu, F.J.; Du, L.; Li, G.Y.; Takahashi, K.; Xue, Y.; Xue, C.H. Effects of polysaccharides from
abalone (Haliotis discus hannai Ino) on HepG2 cell proliferation. Int. J. Biol. Macromol. 2014, 66, 354–361.
[CrossRef] [PubMed]
Zhu, B.W.; Zhou, D.Y.; Yang, J.F.; Li, D.M.; Yin, H.L.; Tada, M. A neutral polysaccharide from the abalone
pleopod, Haliotis discus hannai Ino. Eur. Food Res. Technol. 2008, 228, 591–595.
She, Z.G.; Hu, G.P.; Wu, Y.W. Study on the methanolysis of the sulphated polysaccharide Hal-A from
Haliotis diverisicolor Reeve. Chin. J. Org. Chem. 2002, 22, 367–370.
Chen, S.; Xue, C.; Yin, L.A.; Tang, Q.; Yu, G.; Chai, W. Comparison of structures and anticoagulant activities
of fucosylated chondroitin sulfates from different sea cucumbers. Carbohydr. Polym. 2011, 83, 688–696.
[CrossRef]
Bordbar, S.; Anwar, F.; Saari, N. High-value components and bioactives from sea cucumbers for functional
foods—A review. Mar. Drugs 2011, 9, 1761–1805. [CrossRef] [PubMed]
235
Mar. Drugs 2017, 15, 8
26.
27.
28.
29.
30.
31.
32.
33.
Pomin, V.H.; Pereira, M.S.; Valente, A.-P.; Tollefsen, D.M.; Pavão, M.S.G.; Mourão, P.A.S. Selective cleavage
and anticoagulant activity of a sulfated fucan: Stereospecific removal of a 2-sulfate ester from the
polysaccharide by mild acid hydrolysis, preparation of oligosaccharides, and heparin cofactor II–dependent
anticoagulant activity. Glycobiology 2005, 15, 369–381. [CrossRef] [PubMed]
Pereira, M.S.; Melo, F.R.; Mourão, P.A.S. Is there a correlation between structure and anticoagulant action of
sulfated galactans and sulfated fucans? Glycobiology 2002, 12, 573–580. [CrossRef] [PubMed]
Wu, M.; Wen, D.; Gao, N.; Xiao, C.; Yang, L.; Xu, L.; Lian, W.; Peng, W.; Jiang, J.; Zhao, J. Anticoagulant and
antithrombotic evaluation of native fucosylated chondroitin sulfates and their derivatives as selective
inhibitors of intrinsic factor Xase. Eur. J. Med. Chem. 2015, 92, 257–269. [CrossRef] [PubMed]
Li, J.; Tong, T.; Ko, D.O.; Kang, S.G. Antithrombotic potential of extracts from abalone, Haliotis discus hannai
Ino: and animal studies. Food Sci. Biotechnol. 2013, 22, 471–476. [CrossRef]
Fischer, T.H.; Bode, A.P.; Demcheva, M.; Vournakis, J.N. Hemostatic properties of glucosamine-based
materials. J. Biomed. Mater. Res. A 2007, 80, 167–174. [CrossRef] [PubMed]
Dupouy, D.; Sié, P.; Dol, F.; Boneu, B. A simple method to measure dermatan sulfate at sub-microgram
concentrations in plasma. Thromb. Haemost. 1988, 60, 236–239. [PubMed]
Hines, B.M.; Suleria, H.A.R.; Osborne, S.A. Automated screening potential thrombin inhibitors using the
epMotion® 5075. Eppendorf 2016, 377, 1–6.
Rivard, G.E.; Brummel-Ziedins, K.E.; Mann, K.G.; Fan, L.; Hofer, A.; Cohen, E. Evaluation of the profile
of thrombin generation during the process of whole blood clotting as assessed by thromboelastography.
J. Thromb. Haemost. 2005, 3, 2039–2043. [CrossRef] [PubMed]
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
236
marine drugs
Article
Biochemical and Structural Insights into a Novel
Thermostable β-1,3-Galactosidase from Marinomonas
sp. BSi20414
Haitao Ding, Qian Zeng, Lili Zhou, Yong Yu and Bo Chen *
SOA Key Laboratory for Polar Science, Polar Research Institute of China, Shanghai 200136, China;
htding@outlook.com (H.D.); zengqianmu@126.com (Q.Z.); lilizhou1199@163.com (L.Z.);
yuyong@pric.org.cn (Y.Y.)
* Correspondence: chenbo@pric.org.cn; Tel.: +86-21-5871-1026
Academic Editor: Se-Kwon Kim
Received: 1 November 2016; Accepted: 24 December 2016; Published: 8 January 2017
Abstract: A novel β-1,3-galactosidase, designated as MaBGA (β-galactosidase from Marinomonas sp.
BSi20414), was successfully purified to homogeneity from Marinomonas sp. BSi20414 isolated from
Arctic sea ice by ammonium sulfate precipitation and anion exchange chromatography, resulting in
an 8.12-fold increase in specific activity and 9.9% recovery in total activity. MaBGA displayed
its maximum activity at pH 6.0 and 60 ◦ C, and maintained at least 90% of its initial activity over
the pH range of 5.0–8.0 after incubating for 1 h. It also exhibited considerable thermal stability,
which retained 76% of its initial activity after incubating at 50 ◦ C for 6 h. In contrast to other
β-galactosidases, MaBGA displayed strict substrate specificity, not only for the glycosyl group,
but also for the linkage type. To better understand the structure–function relationship, the encoding
gene of MaBGA was obtained and subject to bioinformatics analysis. Multiple alignments and
phylogenetic analysis revealed that MaBGA belonged to the glycoside hydrolase family 42 and had
closer genetic relationships with thermophilic β-galactosidases of extremophiles. With the aid of
homology modeling and molecular docking, we proposed a reasonable explanation for the linkage
selectivity of MaBGA from a structural perspective. On account of the robust stability and 1,3-linkage
selectivity, MaBGA would be a promising candidate in the biosynthesis of galacto-oligosaccharide
with β1–3 linkage.
Keywords: β-galactosidase; Marinomonas; thermostable; purification; gene cloning; linkage selectivity
1. Introduction
The enzyme β-galactosidases (EC 3.2.1.23, BGA), which are widely distributed in various
organisms, including animals, plants, bacteria, archaea, yeasts and fungi, are capable of catalyzing the
hydrolysis of molecules containing the β-glycosidic bond, to release their terminal non-reducing
galactose molecules. In some cases, β-galactosidases can catalyze the reverse reaction of the
hydrolysis, transglycosylation, when receptors of galactosyl are monosaccharides, disaccharides or
oligosaccharides, instead of water molecules [1]. Due to the catalytic characteristic, β-galactosidases are
important for the dairy industry to produce milk with low/no lactose for people who suffer from
lactose intolerance [2]. Moreover, β-galactosidases are also widely utilized for enzymatic synthesis
of galacto-oligosaccharides, which can be employed to stimulate the growth of beneficial bacteria
selectively in the gut, as prebiotics [3].
Based on the similarity of the amino acid sequences, β-galactosidases are mainly divided into four
glycoside hydrolase (GH) families [4]—GH1, GH2, GH35 and GH42—according to the carbohydrate-active
enzymes database (CAZy) [5]. All of these four families belong to the GH-A superfamily, of which
Mar. Drugs 2017, 15, 13
237
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2017, 15, 13
members have two glutamic acid residues as catalytic active sites located in an (α/β)8 TIM
(the triosephosphate isomerase) barrel domain [6]. Generally, GH1 and GH2 β-galactosidases
are mainly found in mesophiles and display high lactase activity [7]. GH35 β-galactosidases are
usually found in pathogens such as Streptococcus pneumoniae [8–10], with specific activity toward
β-1,3-linkages. β-galactosidases belonging to the GH42 family are mostly stemmed from extremophiles,
including thermophiles [11–15], halophiles [16,17] and alkaliphiles [18].
Owing to the attractive properties such as heat resistance and salt tolerance,
GH42 β-galactosidases have received extensive attention in recent years. It is expected to obtain
new enzymes with excellent properties from microorganisms living in extreme environments [19].
The Arctic is one of the most extreme regions to be inhabited by plenty of microorganisms,
which have been proven to be the natural treasure house for screening novel enzymes [20,21].
In our previous study, a strain designated as BSi20414 with high β-galactosidase activity was
isolated from Arctic sea ice and identified as Marinomonas [22]. The optimal catalytic temperature
of the crude enzyme was determined as 60 ◦ C, indicating that it might be a thermophilic
enzyme. Generally, robust thermal-stability is indispensable for the practical application of
enzymes. Thus, to obtain a promising thermal-stable β-galactosidase and provide a comprehensive
evaluation of its potential in practical application, the enzyme that possessed β-galactosidase activity
from Marinomonas sp. BSi20414 was purified to homogeneity and characterized extensively in the
present work. In addition to biochemical characterization, the encoding gene of MaBGA was cloned
by degenerate PCR and chromosome walking, and was further subject to bioinformatics analysis to
investigate its structure–function relationships.
2. Results
2.1. Purification of Wild-Type MaBGA
The crude enzyme was concentrated by 60% of ammonium sulfate and then separated into
five components, peak I–V (Figure 1a), by anion exchange chromatography. Among these five peaks,
only peak IV exhibited β-galactosidase activity toward o-nitrophenyl-β-galactoside (ONPG). The purity
of peak IV was examined by SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis)
analysis, which showed a single band corresponding to about 70 kDa (Figure 1b), indicating that
MaBGA had been successfully purified. As shown in Table 1, the two-step purification procedure
yielded an 8.12-fold increase in specific activity and a recovery of 9.9% in total activity.
ȱ
Figure 1. Purification of wild-type MaBGA (β-galactosidase from Marinomonas sp. BSi20414).
(a) Ion exchange chromatography. Peak I was unbound proteins; Peak II and III were proteins eluted
by 0.1–0.2 M of NaCl; Peak IV was protein eluted by 0.20–0.24 M of NaCl; Peak V was protein eluted
by 0.24–0.6 M of NaCl; (b) SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis)
analysis of purified MaBGA. Lane M: protein molecular weight marker; Lane E: purified MaBGA.
238
Mar. Drugs 2017, 15, 13
Table 1. Purification of MaBGA.
Purification Steps
Total Protein
(mg)
Total Activity
(U)
Specific Activity
(U/mg)
Recovery
(%)
Purification
Fold
Cell lysate
Ammonium sulfate precipitation
HiTrap DEAE FF
162.54
29.9
1.01
1818.18
927.27
91.80
11.19
31.01
90.89
100
51
9.9
1
2.77
8.12
2.2. Enzymatic Characterization of MaBGA
2.2.1. Effect of pH on the Activity and Stability of MaBGA
The optimum pH of MaBGA was determined as 6.0, and it exhibited more than 80% of its
maximum activity over the pH range of 5.0–7.0, outside of which the activity decreased sharply
(Figure 2a). The stability of MaBGA showed a similar pattern with that of the activity response to pH,
which was stable around the neural condition, and could maintain at least 90% of its initial activity
over the pH ranging from 5.0 to 8.0, after incubating in Britton–Robinson buffer with different pH
values for 1 h (Figure 2b).
2.2.2. Effect of Temperature on the Activity and Stability of MaBGA
MaBGA exhibited the highest activity at 60 ◦ C, and less than 50% of the maximum activity was
measured at temperatures below 45 ◦ C (Figure 2c). Generally, an enzyme with a relatively high optimal
reaction temperature often possessed superior thermal stability. With no exception, MaBGA was stable
at 50 ◦ C, which could maintain 76% of its initial activity after incubating for 6 h (Figure 2d). In addition,
the half-life of MaBGA at 50 ◦ C was determined as 16 h.
2.2.3. Effect of NaCl on the Activity and Stability of MaBGA
MaBGA showed the highest activity with 0.5 M NaCl contained in the reaction buffer.
Although the activity decreased along with the increase in the concentration of NaCl, MaBGA still
displayed 55% of its maximum activity with 5 M NaCl added (Figure 2e). MaBGA was unstable while
incubated in buffers containing NaCl above 0.5 M, and it could only maintain 30% of its initial activity
after incubating in buffer with 5 M NaCl added for 1 h (Figure 2f).
ȱ
Figure 2. Effects of pH, temperature and NaCl on the activity and stability of MaBGA. (a) Effect of pH
on the activity of MaBGA; (b) Effect of pH on the stability of MaBGA; (c) Effect of temperature on the
activity of MaBGA; (d) Effect of time on the stability of MaBGA; (e) Effect of NaCl on the activity of
MaBGA; (f) Effect of NaCl on the stability of MaBGA.
239
Mar. Drugs 2017, 15, 13
2.2.4. Effects of Metal Ions and Chemicals on the Activity of MaBGA
As shown in Table 2, K+ , Na+ and Mn2+ displayed no significant effects on the activity of MaBGA,
as well as EDTA. Interestingly, Fe2+ is capable of improving the activity of MaBGA by 111%, whereas
other bivalent cations—Mg2+ , Co2+ , Ni2+ and Zn2+ —slightly inhibited the activity of the enzyme.
Moreover, reducing agents, such as L-cysteine, L-glutathion and dithiotreitol showed no notable effect
on the activity of MaBGA, indicating that no disulfide bond was indispensable to the enzyme.
Table 2. Effects of metal ions and chemicals on the activity of MaBGAL.
Metal Ions
Relative Activity (%)
Chemicals
Relative Activity (%)
K+
Na+
Fe2+
Mn2+
Mg2+
Co2+
Ni2+
Zn2+
96
95
211
98
89
88
76
74
EDTA
L -Cysteine
L -Glutathion
Dithiotreitol
98
110
103
106
2.2.5. Substrate Specificity and Steady-State Kinetic Analysis
MaBGA possessed a narrow substrate spectrum, which showed no activity toward p-nitrophenylβ-D-glucopyranoside, p-nitrophenyl-β- D -xylopyranoside, p-nitrophenyl-β- D -lactopyranoside,
p-nitrophenyl-a-D-galactopyranoside,
p-nitrophenyl-β-Lp-nitrophenyl-β- D -glucuronide,
arabinopyranoside and p-nitrophenyl-β-D-cellobioside.
Moreover, MaBGA showed not only
group selectivity, but also showed linkage selectivity in the substrate recognition process, of which the
activity toward p-nitrophenyl-β-D-galactopyranoside was 4.22-fold greater than that of ONPG (Table 3).
Table 3. Substrate specificity of MaBGA.
Substrate
Relative Activity (%)
o-nitrophenyl-β-D-galactopyranoside
p-nitrophenyl-β-D-galactopyranoside
p-nitrophenyl-β-D-glucopyranoside
p-nitrophenyl-β-D-xylopyranoside
p-nitrophenyl-β-D-lactopyranoside
p-nitrophenyl-β-D-glucuronide
p-nitrophenyl-a-D-galactopyranoside
p-nitrophenyl-β-L-arabinopyranoside
p-nitrophenyl-β-D-cellobioside
100
422
<1
<1
<1
<1
<1
<1
<1
The steady-state kinetic constants of MaBGA were determined by using a nonlinear fitting plot.
The apparent Michaelis–Menten constant Km and the maximum reaction velocity V max were calculated
as 14.19 mM and 1.049 μM·min−1 , respectively.
2.2.6. Linkage Selectivity Analysis
As shown in Figure 3, the chromatograms of Galβ1–4GlcNAc showed no change before and
after the reaction catalyzed by MaBGA, as well as Galβ1–6GlcNAc, suggesting that MaBGA was
unable to hydrolyze both Galβ1–4GlcNAc and Galβ1–6GlcNAc. With regard to Galβ1–3GlcNAc,
the product chromatogram generated a new peak corresponding to the standard of β-galactose,
with an identical retention time of 10.1 min, indicating that MaBGA was capable of degrading
Galβ1–3GlcNAc selectively.
240
Mar. Drugs 2017, 15, 13
Figure 3. Linkage selectivity analysis. (a), (c), (e) and (g) were chromatograms of Galβ1–4GlcNAc,
Galβ1–6GlcNAc, Galβ1–3GlcNAc and galactose, respectively; (b), (d) and (f) were chromatograms of
Galβ1–4GlcNAc, Galβ1–6GlcNAc and Galβ1–3GlcNAc hydrolyzed by MaBGA, respectively.
2.3. Gene Cloning and Sequence Analysis
2.3.1. Gene Cloning
A 500-bp fragment was amplified from the genomic DNA of Marinomonas sp. BSi20414,
by using the degenerate primers F1 and R2 (Figure 4a). The nucleotide sequence of the fragment
showed an identity of 84% with a putative β-galactosidase gene of Marinomonas sp. MWYL1,
suggesting that the partial β-galactosidase gene sequence of Marinomonas sp. BSi20414 had been
241
Mar. Drugs 2017, 15, 13
successfully obtained. After chromosome walking, 1800-bp and a 1600-bp DNA fragments (Figure 4b),
corresponding to the upstream and downstream sequence of the target gene, were amplified and
sequenced. The intermediate and flanking sequences were utilized for assembly and subsequent
amplification of the intact mabga gene, with a size of 2000 bp (Figure 4c).
Figure 4.
Agarose gel electrophoresis analysis of DNA fragments amplified by PCR.
(a) Degenerated PCR; (b) Chromosome walking PCR; (c) Full length amplification. Lane M:
DNA marker; Lane C: Fragment amplified by F1/R2; Lane D: Downstream fragment; Lane U:
Upstream fragment; Lane W: Full-length fragment of gene mabga.
2.3.2. Sequence Analysis
Gene mabga encodes a peptide consisting of 656 amino acids with a calculated molecular weight
of 74.28 kDa in accordance with the results of SDS-PAGE. Significant Pfam-A matches revealed that
MaBGA belonged to the glycoside hydrolase family 42. The protein sequence of MaBGA showed
54.6%, 54.0%, 52.5%, 52.0%, 40.6%, and 38.2% identities with the well-characterized galactosidases from
Thermus sp. IB-21 (Q8GEA9) [13], Thermus thermophilus A4 (O69315) [23], Thermus sp. T2 (O54315) [14],
Thermus brockianus ITI360 (Q9X6C6) [24], Halorubrum lacusprofundi ATCC 49239 (B9LW38) [16], and
Haloferax lucentense DSM 14919 (P94804) [17], respectively. In addition, MaBGA exhibited the highest
identity of 90% with a putative BGA from Marinomonas sp. MWYL1.
Multiple alignments of protein sequences of structure-solved GH42 β-galactosidase showed that
MaBGA shared the conserved catalytic residues, Glu142 and Glu314, as well as other GH42 BGAs
(Figure 5). Phylogenetic analysis of characterized BGAs showed that these BGAs diverged into two
clusters, and MaBGA affiliated to the branch consisting of thermophilic BGAs (Figure 6) that exhibited
considerable stability against heat in previous studies, suggesting that these BGAs, including MaBGA,
might be originated from the same ancestral sequence.
2.4. Structural Analysis of MaBGA
2.4.1. Homology Modelling
The tertiary structures of MaBGA were constructed by various software or online servers,
including SWISS-MODEL [25], Robetta [26], MODELLER [27] and I-TASSER [28], then evaluated
by ProSA [29] and PROCHECK [30]. Both of the Z-score and Ramachandran plot statistics indicated
that the three-dimensional structures of MaBGA had been modeled reasonably (Table 4), especially for
the model constructed by MODELLER, which scored highest and was selected for the docking study.
The superposition of the MaBGA monomer structure onto the structure of β-galactosidase from
Thermus thermophilus A4 [23] demonstrated the relatively high similarity between them, with a root
mean square deviation value of 0.17 (Figure 7a). As with other GH42 BGAs [11,18,23], the quaternary
structure of MaBGA was predicted as a homo-trimer, which resembles a flowerpot, with a cone-shaped
tunnel in the center of the flowerpot surrounded by three subunits (Figure 7b).
242
Mar. Drugs 2017, 15, 13
Figure 5.
Multiple alignment of structure-solved β-galactosidases of the GH42 family
(glycoside hydrolase 42 family). Identical residues and conserved substitutions are shaded red and
yellow, respectively. Secondary structures of β-galactosidases are presented on the top: helices with
squiggles, β-strands with arrows, turns with TT letters.
Figure 6. Unrooted phylogenetic tree of β-galactosidase belonging to the GH42 family. The phylogenetic
tree was built using the neighbor joining method [31] in MEGA 6 [32], with a bootstrap test of
1000 replicates. The GenBank accession numbers were provided in the bracket followed by the
species names.
243
Mar. Drugs 2017, 15, 13
Table 4. Evaluation of models generated by different modeling approaches.
Model
Z-Score 1
Template (4oif)
Robetta
Ramachandran Plot 2
Most Favored (%)
Additional Allowed (%)
Generously Allowed (%)
Disallowed (%)
−12.19
−10.19
88.3
87.9
10.7
10.2
0.6
1.6
0.3
0.4
Template (1kwk)
SWISS-MODEL
MODELLER
−12.24
−9.93
−10.08
90.6
89.7
91.9
8.2
8.1
6.8
0.7
1.5
0.4
0.4
0.7
0.9
Template (1kwg)
I-TASSER
−12.27
−10.14
91.2
79.1
7.9
15.8
0.6
3.2
0.4
1.9
1
2
Calculated by ProSA-web; Calculated by PROCHECK.
(a)
(b)
(c)
(d)
(e)
(f)
Figure 7. Three-dimensional structures of MaBGA. (a) Superposition of the MaBGA monomer
structure (green) on the structures of β-galactosidase from Thermus thermophilus A4 (cyan; PDB entry
1kwk); (b) Ribbon representation of the trimer structure of MaBGA; (c) Ball and stick representation
of the docking models of MaBGA with Galβ1–3GlcNAc (white), Galβ1–4GlcNAc (cyan) and
Galβ1–6GlcNAc (magenta), respectively; (d) Schematic diagram of MaBGA/Galβ1–3GlcNAc
interactions; (e) Schematic diagram of MaBGA/Galβ1–4GlcNAc interactions; (f) Schematic diagram of
MaBGA/Galβ1–6GlcNAc interactions.
2.4.2. Molecular Docking Analysis
The model of MaBGA generated by MODELLER [27] was subject to GROMACS [33] software
packages for energy minimization, to remove steric clashes. The refined model was employed for
molecular docking with Galβ1–3GlcNAc, Galβ1–4GlcNAc and Galβ1–6GlcNAc by Autodock 4.2 [34],
respectively. Cluster analysis was performed on different conformations with a root mean square
deviation (RMSD) tolerance of 2.0 Å. Conformation with the lowest estimated binding free energy
was utilized for analysis. As shown in Figure 7c, the galactosyl group of these three substrates
adopts similar conformations, including the oxygen atom which links the acetylglucosamine group.
However, the acetylglucosamine group of the substrates adopts a varied conformation corresponding
to their lowest free energy. The two-dimensional projection of the interaction of the enzyme/substrate
complex showed that no hydrogen bond was generated between the enzyme and the glucosyl group of
Galβ1–3GlcNAc (Figure 7d), in contrast to those of Galβ1–4GlcNAc (Figure 7e) and Galβ1–6GlcNAc
(Figure 7f), which formed three and four pairs with the enzyme, respectively.
3. Discussion
In the present study, a thermostable β-1,3-galactosidase MaBGA was successfully purified to
homogeneity from Marinomonas sp. BSi20414 isolated from Arctic sea ice by ammonium sulfate
244
Mar. Drugs 2017, 15, 13
precipitation and anion exchange chromatography, resulting in an 8.12-fold increase in specific activity
and 9.9% recovery in total activity. The purification results showed that the two-step purification
method is efficient for separating MaBGA from the wild-type strain of Marinomonas sp. BSi20414,
which also provides a reference for extracting other proteins from strains belonging to the genus
of Marinomonas.
Interestingly, as an enzyme stemmed from a strain living in permanently low-temperature marine
environments, MaBGA displayed extraordinary stability against heat, with the half-life determined
as 16 h at 50 ◦ C. Phylogenetic analysis of characterized GH42 BGAs also revealed that MaBGA
had closer genetic relationships with thermophilic BGAs derived from extremophiles, including
thermophiles [11–15] and halophiles [16,17]. On account of the enzymatic and phylogenetic analyses,
MaBGA was considered as a thermophilic enzyme, although the thermal stability of MaBGA is weaker
than those of its thermophilic counterparts. Additionally, MaBGA only shared high identity (>70%)
with BGAs of the genus Marinomonas, and no sequence with identity more than 55% was found in
their related marine species. On the basis of the above evidence, a putative explanation was proposed
to illustrate the mismatch of enzyme stability and circumstance. It is supposed that the ancestor of the
genus Marinomonas acquired the gene encoding thermophilic β-galactosidase from other thermophiles
by occasional horizontal transfer, then experienced adaptive evolution under low-temperature marine
environments for a long period, which led to a decrease in thermal stability without selection pressures.
Another point worth mentioning is that MaBGA has a strict substrate specificity, unlike other GH42
BGAs. Furthermore, it displayed not only group selectivity, but also linkage selectivity in the substrate
recognition process. As indicated above, MaBGA was able to hydrolyze Galβ1–3GlcNAc, but was
unable to hydrolyze Galβ1–4GlcNAc and Galβ1–6GlcNAc. To better understand the linkage selectivity
of MaBGA, it is essential to put MaBGA against its structural contexts. Thus, the three-dimensional
structure of MaBGA was constructed and subject to docking analysis after energy minimization by
molecular dynamics. As shown in Figure 7c, for all these three substrates, although the galactosyl group
adopts similar lowest energy conformations, the distance is a bit long for the reaction between the oxygen
atom linking the acetylglucosamine group and the carboxyl group of catalytic residues (Glu142/Glu314).
Therefore, the substrate molecule needs to fine-tune its geometry to shorten the distance mentioned
above by overcoming the energy barrier. However, the planar representation of the interaction of
the enzyme/substrate complex indicated that the strong interaction between the glucosyl group of
Galβ1–4GlcNAc (Figure 7e)/Galβ1–6GlcNAc (Figure 7f) and the enzyme might lead to the failure of
the substrates to adjust their conformation for an optimal fit. Therefore, we proposed that the favored
binding conformation with lowest free binding energy of the substrate is not close enough to the
catalytic residues to let the reaction occur, thus the substrate might be fine-tuning its conformation to
achieve an optimal geometry for the reaction. However, due to the different binding energy between
the glucosyl group and enzyme, Galβ1–4GlcNAc and Galβ1–6GlcNAc cannot readily overcome the
energy barrier, other than Galβ1–3GlcNAc. In general, further experiments, such as enzyme/substrate
complex co-crystallization and site-directed mutagenesis, are still needed to test the hypothesis.
A previous study had proven that galacto-oligosaccharides with β1–3 linkage have a stronger
bifidogenic effect than those with β1–4 and β1–6 linkages [35], indicating that the former would be
more popular as prebiotics than the latter two. Generally, the production of galacto-oligosaccharides
is implemented by the transglycosylation activity of β-galactosidase [36], therefore, the linkage
of galacto-oligosaccharides will depend on the linkage recognition ability of β-galactosidase.
Since β-galactosidases that existed in the nature which are capable of recognizing β1–3 galactoside
linkage are very few, the β-1,3-galactosidase MaBGA studied in the present work not only could provide
a promising candidate for the biosynthesis of galacto-oligosaccharides with β1–3 linkage, but also
would offer a good model for research on the substrate recognition mechanism of β-galactosidase.
245
Mar. Drugs 2017, 15, 13
4. Materials and Methods
4.1. Strains, Plasmids, and Culture Conditions
Strain BSi20414, used as the source of β-galactosidase, was isolated from a core sample of sea ice
collected from Canada Basin, Arctic Ocean, and was characterized as Marinomonas in our previous
study [22]. The strain was cultivated in medium (pH 7.0) containing MgCl2 (0.5%, w/v), MgSO4 ·7H2 O
(0.4%, w/v), KCl (0.1%, w/v), CaCl2 (0.06%, w/v), lactose (1.5%, w/v) and Tryptone (0.5%, w/v), on a
shaking incubator at 180 rev·min−1 at 30 ◦ C for 96 h. Escherichia coli DH5α used for gene cloning was
cultivated at 37 ◦ C in Luria–Bertani medium. Plasmid pMD18-T (Takara) was used to conduct TA
cloning for sequencing. All chemicals used in this study were of analytical grade.
4.2. Purification of Wild-Type MaBGA
All purification steps were conducted at 4 ◦ C. Cells were harvested by centrifugation at 10,000× g
for 10 min. The pellet was washed three times with normal saline and was suspended by pre-cooling
PBS buffer (pH 7.0, 50 mM). The suspension was lysed by sonication (burst of 2 s followed by intervals
of 5 s for 30 min). The cell debris was removed by centrifugation at 10,000× g for 15 min and the
supernatant was precipitated with ammonium sulfate (60%, w/v). The precipitate was collected by
centrifugation at 10,000× g for 10 min, then dissolved and dialyzed using PBS buffer (pH 7.0, 50 mM)
overnight. Subsequently, the protein solution was filtered by cellulose acetate film with pore size of
0.22 μm, and the filtrate was loaded onto an anion exchange column HiTrap DEAE FF, which was
pre-equilibrated with PBS buffer (pH 8.0, 50 mM). The column was first washed with PBS buffer
(pH 8.0, 50 mM) for tenfold resin volumes, then was eluted by PBS buffer (pH 8.0, 50 mM) containing
NaCl with a linear gradient from 0.1 M to 0.6 M. Every eluting peak was collected and measured by
standard activity assay. The protein concentration was assayed by the method of Bradford using BSA
(bovine serum albumin) as a standard [37].
4.3. SDS-PAGE Analysis
The purified MaBGA was analyzed by denaturing discontinuous SDS-PAGE on a 5% stacking gel
and a 10% separating gel as described by Laemmli [38]. Gels were stained with Coomassie Brilliant
Blue R-250. The molecular weight of MaBGA was determined by comparing its electrophoretic mobility
with Protein Molecular Weight Marker (MBI).
4.4. β-galactosidase Activity Assay
The β-galactosidase activity was assayed by measuring the absorbance of ONP (o-nitrophenyl)
at 420 nm in 50 mM PBS buffer (pH 7.0) with 10 mM ONPG as substrate. The ONP concentration
was calculated from the standard curve obtained under the same experimental condition. One unit of
enzyme activity was defined as the amount of the enzyme that catalyzed the formation of 1 μmol of
ONP per minute.
4.5. Effect of pH on the Activity and Stability of MaBGA
The optimum pH for MaBGA was determined by measuring the activity in Britton–Robinson
buffer with different pH ranging from 3.0 to 12.0. The pH stability was assayed by measuring the
residual activity after incubating MaBGA in different pH buffers at 37 ◦ C for 1 h.
4.6. Effect of Temperature on the Activity and Stability of MaBGA
To study the effect of temperature on the activity of MaBGA, the enzyme activity was assayed at
different temperatures from 10 to 70 ◦ C with 5 ◦ C intervals at pH 7.0. The thermal stability was determined
by assaying the residual activity after incubating the enzyme at 50 ◦ C for 6 h with 1 h intervals.
246
Mar. Drugs 2017, 15, 13
4.7. Effect of NaCl on the Activity and Stability of MaBGA
In order to determine the effects of NaCl on the activity of MaBGA, the enzyme activity was
assayed with 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5 M NaCl added individually. The NaCl tolerance of
MaBGA was determined by measuring the residual activity after incubating the enzyme in buffers
containing diverse concentration of NaCl from 0.5 M to 5M at 37 ◦ C for 1 h.
4.8. Effect of Metal Ions and Chemicals on the Activity of MaBGA
To investigate the effects of metal ions and chemicals on the MaBGA activity, 1 mM of KCl,
NaCl, FeCl2 , MnCl2 , MgCl2 , CoCl2 , NiCl2 , ZnCl2 , EDTA and 10 mM of L-cysteine, L-glutathion and
dithiotreitol were added to the reaction system individually, and the activity of MaBGA was then
measured under the standard assay as described above. No chemical was added in the control.
4.9. Substrate Specificity
The substrates’ specificity of MaBGA was measured by the standard assay, except that
ONPG was replaced by p-nitrophenyl-β-D-galactopyranoside, p-nitrophenyl-β-D-glucopyranoside,
p-nitrophenyl-β-D-xylopyranoside, p-nitrophenyl-β-D-lactopyranoside, p-nitrophenyl-β-D-glucuronide,
p-nitrophenyl-a-D-galactopyranoside, p-nitrophenyl-β-L-arabinopyranoside, p-nitrophenyl-β-Dcellobioside, respectively.
4.10. Steady-State Kinetic Analysis
For steady-state kinetic analysis, the activity of MaBGA was measured by using various
concentrations of ONPG from 0.1 mM to 19 mM. The kinetic constants of the enzyme were determined
by using a nonlinear fitting of the Michaelis–Menten equation: v = V max ·[S]/(Km + [S]), where [S] and
Km are the concentration and Michaelis constants of ONPG, respectively.
4.11. Linkage Selectivity Analysis
To determine the activity of MaBGA toward different linkage types, Galβ1–3GlcNAc,
Galβ1–4GlcNAc and Galβ1–6GlcNAc were used as substrates, respectively. The reaction products
were filtered by nitrocellulose membrane with pore size of 0.22 μm, in advance of being subject to
detection by HPLC equipped with an Aminex HPX-87P column and differential detector. The column
temperature and flow rate were set as 85 ◦ C and 0.5 mL·min−1 .
4.12. Gene Cloning and Sequence Analysis
The partial sequence of gene mabga was amplified by using degenerate primer pairs F1/R1, F1/R2,
F1/R3, F2/R1, F2/R2, F2/R3, F3/R1, F3/R2, F3/R3, A208/B1, A208/C1, A208/C2, A76/B1, A76/C1,
A76/C2, A195/B1, A195/C1 and A195/C2 (Table 1), respectively, which were designed according to
the conservative regions of the protein sequence of β-galactosidases. PCR was performed as follows:
95 ◦ C for 4 min; followed by 30 cycles of 95 ◦ C for 1 min, 50 ◦ C for 1 min, and 72 ◦ C for 2 min;
with a final extension at 72 ◦ C for 10 min. The amplified fragment was inserted into the pMD18-T
vector and then transformed into E. coli DH5α for sequencing.
The 5′ and 3′ flanking regions of the known partial sequence were obtained by using DNA
Walking SpeedUp™ Kit of Seegene, which adopted the thermal asymmetric interlaced PCR (TAIL-PCR)
strategy [39]. The nested specific primers for upstream and downstream regions were designed
based on the obtained partial sequence (Table 5). TAIL-PCR was performed as described by the
kit. The amplified fragments were purified and ligated into the pMD18-T vector for sequencing.
The upstream, downstream and obtained partial sequences were assembled to obtain a full-length
mabga gene.
247
Mar. Drugs 2017, 15, 13
Table 5. Primers used for gene cloning.
Primers
Sequence (5′ to 3′ )
Purpose
F1
F2
F3
R1
R2
R3
A208
A76
A195
B1
C1
C2
U1
D1
U2
D2
U3
D3
DW-ACP 1
DW-ACP 2
DW-ACP 3
DW-ACP 4
DW-ACP N
Uni-primer
MaBGA-F
MaBGA-R
GCNTGGGGNAAYGTNTTYT
TNTGGACNTGGGARGCNTT
GGARCARCARCCNGGNCCNGT
CCARCANGCRTCRTARTCRAA
RAANGCYTCCCANGTCCA
GGRTTRTGNGGNGCCARTT
TGGATHATGGAGGAGCCC
CGGGACCTGGTGCAYAAYTAY
CAYAAYTAYATGGGCTTCTTC
CAGACCCAGAACGAGTAYKGN
GCACCACAAGTACCACCARGA
GTYCTRDWNCTGCACCGGCCG
CCGTAAAGAATCCCATGAGT
GGACATTTTGCGTGCG
AACGCTGAAAGTCCAACCCGAT
GGACACTTATCCGCTGGGTTT
GATTGGCTTCGGTCACGGT
CCCGATTTTGGTGCTTTTCA
ACP-AGGTC
ACP-TGGTC
ACP-GGGTC
ACP-CGGTC
ACPN-GGTC
TCACAGAAGTATGCCAAGCGA
CGGAATTCAAGTTAGGTGTATGTTACTACCCAG
GTTCGCGCTCGAGGATTTCTTGCCAAATGGC
Degenerated PCR
Degenerated PCR
Degenerated PCR
Degenerated PCR
Degenerated PCR
Degenerated PCR
Degenerated PCR
Degenerated PCR
Degenerated PCR
Degenerated PCR
Degenerated PCR
Degenerated PCR
DNA Walking (1st-round upstream)
DNA Walking (1st-round downstream)
DNA Walking (2nd-round upstream)
DNA Walking (2nd-round downstream)
DNA Walking (3rd-round upstream)
DNA Walking (3rd-round downstream)
DNA Walking (1st-round)
DNA Walking (1st-round)
DNA Walking (1st-round)
DNA Walking (1st-round)
DNA Walking (2nd-round)
DNA Walking (3rd-round)
Full-length amplification
Full-length amplification
Homologous search in GenBank was performed using the BLAST server (http://www.ncbi.
nlm.nih.gov/BLAST). Alignment of multiple protein sequences was conducted using the Clustal
X 2.0 program [40] and rendered by ESPript [41]. A phylogenetic tree of multiple β-galactosidase
was constructed using the neighbor-joining method [31] in MEGA6 [32], with a bootstrap test of
1000 replicates.
4.13. Homology Modelling and Molecular Docking Analysis
The three-dimensional model of MaBGA was constructed by using MODELLER [27], Robetta [26],
I-TASSER [28] and SWISS-MODEL [25], respectively. Precise evaluation of the model quality was
performed using ProSA-web [29] and PROCHECK [30]. To remove steric clashes, the constructed
model was subject to an energy minimization process in vacuum by using the steepest descent method
for about 5000 iterations in GROMACS 4.5 [33].
The refined model was used for docking with Galβ1–3GlcNAc, Galβ1–4GlcNAc and Galβ1–6GlcNAc,
respectively, using Autodock 4.2 [34] with default parameters. The representation of the protein
structure was achieved using the program PyMOL (The PyMOL Molecular Graphics System,
Version 1.7 Schrödinger, LLC., New York, NY, USA).
5. Conclusions
In this work, a thermostable β-1,3-galactosidase MaBGA derived from Marinomonas sp. BSi20414,
was first purified to homogeneity and characterized extensively. MaBGA displayed robust stability
against heat and strict substrate specificity toward both the glycosyl group and the linkage type.
Although further experiments are required to decipher its substrate recognition mechanism, our study
provided an attractive alternative for biosynthesis of galacto-oligosaccharide with β1–3 linkage and
laid the groundwork for the protein engineering to modify the linkage preference of β-galactosidase.
248
Mar. Drugs 2017, 15, 13
Acknowledgments: This study was supported by Chinese Polar Environment Comprehensive Investigation and
Assessment Program (CHINARE-01-06, CHINARE-04-02, CHINARE-02-01), Open Fund of Key Laboratory
of Biotechnology and Bioresources Utilization (Dalian Minzu University, KF2015009), State Ethnic Affairs
Commission & Ministry of Education of China, and National Natural Science Foundation of China (31200599).
Author Contributions: Y.Y. and B.C. conceived and designed the experiments; Q.Z. and L.Z. performed the
experiments; H.D., Q.Z. and L.Z. analyzed the data; Y.Y. and B.C. contributed reagents/materials/analysis tools;
H.D. and B.C. wrote the paper.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
Juers, D.H.; Matthews, B.W.; Huber, R.E. LacZ β-galactosidase: Structure and function of an enzyme of
historical and molecular biological importance. Protein Sci. 2012, 21, 1792–1807. [CrossRef] [PubMed]
Oliveira, C.; Guimaraes, P.M.; Domingues, L. Recombinant microbial systems for improved β-galactosidase
production and biotechnological applications. Biotechnol. Adv. 2011, 29, 600–609. [CrossRef] [PubMed]
Park, A.R.; Oh, D.K. Galacto-oligosaccharide production using microbial β-galactosidase: Current state
and perspectives. Appl. Microbiol. Biotechnol. 2010, 85, 1279–1286. [CrossRef] [PubMed]
Henrissat, B.; Davies, G. Structural and sequence-based classification of glycoside hydrolases. Curr. Opin.
Struct. Biol. 1997, 7, 637–644. [CrossRef]
Lombard, V.; Ramulu, H.G.; Drula, E.; Coutinho, P.M.; Henrissat, B. The carbohydrate-active enzymes
database (cazy) in 2013. Nucleic Acids Res. 2014, 42, D490–D495. [CrossRef] [PubMed]
Davies, G.; Henrissat, B. Structures and mechanisms of glycosyl hydrolases. Structure 1995, 3, 853–859.
[CrossRef]
Adam, A.C.; Rubio-Texeira, M.; Polaina, J. Lactose: The milk sugar from a biotechnological perspective.
BFSN 2005, 44, 553–557. [CrossRef]
Singh, A.K.; Pluvinage, B.; Higgins, M.A.; Dalia, A.B.; Woodiga, S.A.; Flynn, M.; Lloyd, A.R.; Weiser, J.N.;
Stubbs, K.A.; Boraston, A.B.; et al. Unravelling the multiple functions of the architecturally intricate
streptococcus pneumoniae β-galactosidase, BgaA. PLoS Pathog. 2014, 10, e1004364. [CrossRef] [PubMed]
Hu, D.; Zhang, F.; Zhang, H.; Hao, L.; Gong, X.; Geng, M.; Cao, M.; Zheng, F.; Zhu, J.; Pan, X.; et al.
The β-galactosidase (BgaC) of the zoonotic pathogen streptococcus suis is a surface protein without the
involvement of bacterial virulence. Sci. Rep. 2014, 4, 4140. [CrossRef] [PubMed]
Cheng, W.; Wang, L.; Jiang, Y.L.; Bai, X.H.; Chu, J.; Li, Q.; Yu, G.; Liang, Q.L.; Zhou, C.Z.; Chen, Y.
Structural insights into the substrate specificity of streptococcus pneumoniae β(1,3)-galactosidase BgaC.
J. Biol. Chem. 2012, 287, 22910–22918. [CrossRef] [PubMed]
Solomon, H.V.; Tabachnikov, O.; Lansky, S.; Salama, R.; Feinberg, H.; Shoham, Y.; Shoham, G.
Structure-function relationships in Gan42B, an intracellular GH42 β-galactosidase from geobacillus
stearothermophilus. Acta Crystallogr. Sect. D Biol. Crystallogr. 2015, 71, 2433–2448. [CrossRef] [PubMed]
Solomon, H.V.; Tabachnikov, O.; Feinberg, H.; Govada, L.; Chayen, N.E.; Shoham, Y.; Shoham, G.
Crystallization and preliminary crystallographic analysis of ganb, a GH42 intracellular β-galactosidase from
geobacillus stearothermophilus. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 2013, 69, 1114–1119.
[CrossRef] [PubMed]
Kang, S.K.; Cho, K.K.; Ahn, J.K.; Bok, J.D.; Kang, S.H.; Woo, J.H.; Lee, H.G.; You, S.K.; Choi, Y.J. Three forms
of thermostable lactose-hydrolase from Thermus sp. IB-21: Cloning, expression, and enzyme characterization.
J. Biotechnol. 2005, 116, 337–346. [CrossRef] [PubMed]
Vian, A.; Carrascosa, A.V.; Garcia, J.L.; Cortes, E. Structure of the β-galactosidase gene from thermus sp.
Strain T2: Expression in escherichia coli and purification in a single step of an active fusion protein.
Appl. Environ. Microbiol. 1998, 64, 2187–2191. [PubMed]
Ohtsu, N.; Motoshima, H.; Goto, K.; Tsukasaki, F.; Matsuzawa, H. Thermostable β-galactosidase from
an extreme thermophile, Thermus sp. A4: Enzyme purification and characterization, and gene cloning
and sequencing. Biosci. Biotechnol. Biochem. 1998, 62, 1539–1545. [CrossRef] [PubMed]
Karan, R.; Capes, M.D.; DasSarma, P.; DasSarma, S. Cloning, overexpression, purification, and characterization
of a polyextremophilic β-galactosidase from the antarctic haloarchaeon halorubrum lacusprofundi.
BMC Biotechnol. 2013, 13, 3. [CrossRef] [PubMed]
249
Mar. Drugs 2017, 15, 13
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
Holmes, M.L.; Scopes, R.K.; Moritz, R.L.; Simpson, R.J.; Englert, C.; Pfeifer, F.; Dyall-Smith, M.L.
Purification and analysis of an extremely halophilic β-galactosidase from haloferax alicantei.
Biochim. Biophys. Acta 1997, 1337, 276–286. [CrossRef]
Maksimainen, M.; Paavilainen, S.; Hakulinen, N.; Rouvinen, J. Structural analysis, enzymatic characterization,
and catalytic mechanisms of β-galactosidase from bacillus circulans sp. Alkalophilus. FEBS J. 2012, 279,
1788–1798. [CrossRef] [PubMed]
Ferrer, M.; Golyshina, O.; Beloqui, A.; Golyshin, P.N. Mining enzymes from extreme environments.
Curr. Opin. Microbiol. 2007, 10, 207–214. [CrossRef] [PubMed]
Lee, H.S.; Kwon, K.K.; Kang, S.G.; Cha, S.-S.; Kim, S.-J.; Lee, J.-H. Approaches for novel enzyme discovery
from marine environments. Curr. Opin. Biotechnol. 2010, 21, 353–357. [CrossRef] [PubMed]
Ferrer, M.; Beloqui, A.; Timmis, K.N.; Golyshin, P.N. Metagenomics for mining new genetic resources of
microbial communities. J. Mol. Microbiol. Biotechnol. 2008, 16, 109–123. [CrossRef] [PubMed]
Zeng, Q.; Wang, Y.; Sun, K.; Yu, Y.; Chen, B. Preliminary studies on the screening, identification and
optimum fermentative conditions of a strain Marinomonas sp. Bsi20414 isolated from arctic sea ice producing
β-galactosidase. Chin. J. Polar Res. 2011, 108–114.
Hidaka, M.; Fushinobu, S.; Ohtsu, N.; Motoshima, H.; Matsuzawa, H.; Shoun, H.; Wakagi, T. Trimeric crystal
structure of the glycoside hydrolase family 42 β-galactosidase from thermus thermophilus a4 and the
structure of its complex with galactose. J. Mol. Biol. 2002, 322, 79–91. [CrossRef]
Fridjonsson, O.; Watzlawick, H.; Gehweiler, A.; Rohrhirsch, T.; Mattes, R. Cloning of the gene encoding
a novel thermostable α-galactosidase from thermus brockianus ITI360. Appl. Environ. Microbiol. 1999, 65,
3955–3963. [PubMed]
Biasini, M.; Bienert, S.; Waterhouse, A.; Arnold, K.; Studer, G.; Schmidt, T.; Kiefer, F.; Gallo Cassarino, T.;
Bertoni, M.; Bordoli, L.; et al. Swiss-model: Modelling protein tertiary and quaternary structure using
evolutionary information. Nucleic Acids Res. 2014, 42, W252–W258. [CrossRef] [PubMed]
Kim, D.E.; Chivian, D.; Baker, D. Protein structure prediction and analysis using the robetta server.
Nucleic Acids Res. 2004, 32, W526–W531. [CrossRef] [PubMed]
Webb, B.; Sali, A. Comparative protein structure modeling using Modeller. Curr. Protoc. Bioinform. 2014.
[CrossRef]
Yang, J.; Yan, R.; Roy, A.; Xu, D.; Poisson, J.; Zhang, Y. The I-tasser suite: Protein structure and function prediction.
Nat. Methods 2015, 12, 7–8. [CrossRef] [PubMed]
Wiederstein, M.; Sippl, M.J. Prosa-web: Interactive web service for the recognition of errors in three-dimensional
structures of proteins. Nucleic Acids Res. 2007, 35, W407–W410. [CrossRef] [PubMed]
Laskowski, R.A.; MacArthur, M.W.; Moss, D.S.; Thornton, J.M. Procheck: A program to check the
stereochemical quality of protein structures. J. Appl. Crystallogr. 1993, 26, 283–291. [CrossRef]
Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees.
Mol. Biol. Evol. 1987, 4, 406–425. [PubMed]
Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics
Analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [CrossRef] [PubMed]
Pronk, S.; Páll, S.; Schulz, R.; Larsson, P.; Bjelkmar, P.; Apostolov, R.; Shirts, M.R.; Smith, J.C.; Kasson, P.M.;
van der Spoel, D. Gromacs 4.5: A high-throughput and highly parallel open source molecular simulation toolkit.
Bioinformatics 2013, 29, 845–854. [CrossRef] [PubMed]
Morris, G.M.; Huey, R.; Lindstrom, W.; Sanner, M.F.; Belew, R.K.; Goodsell, D.S.; Olson, A.J. Autodock4 and
autodocktools4: Automated docking with selective receptor flexibility. J. Comput. Chem. 2009, 30, 2785–2791.
[CrossRef] [PubMed]
Depeint, F.; Tzortzis, G.; Vulevic, J.; I’Anson, K.; Gibson, G.R. Prebiotic evaluation of a novel galactooligosaccharide
mixture produced by the enzymatic activity of bifidobacterium bifidum ncimb 41171, in healthy humans:
A randomized, double-blind, crossover, placebo-controlled intervention study. Am. J. Clin. Nutr. 2008, 87,
785–791. [PubMed]
Legler, G. Glycoside hydrolases: Mechanistic information from studies with reversible and irreversible
inhibitors. Adv. Carbohydr. Chem. Biochem. 1990, 48, 319–384. [PubMed]
Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein
utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [CrossRef]
250
Mar. Drugs 2017, 15, 13
38.
39.
40.
41.
Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage t4. Nature
1970, 227, 680–685. [CrossRef] [PubMed]
Liu, Y.G.; Whittier, R.F. Thermal asymmetric interlaced pcr: Automatable amplification and sequencing
of insert end fragments from p1 and yac clones for chromosome walking. Genomics 1995, 25, 674–681.
[CrossRef]
Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.;
Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and clustal X version 2.0. Bioinformatics 2007, 23,
2947–2948. [CrossRef] [PubMed]
Gouet, P.; Robert, X.; Courcelle, E. Espript/endscript: Extracting and rendering sequence and 3d information
from atomic structures of proteins. Nucleic Acids Res. 2003, 31, 3320–3323. [CrossRef] [PubMed]
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
251
marine drugs
Article
Preparation of Antioxidant Peptides from Salmon
Byproducts with Bacterial Extracellular Proteases
Ribang Wu 1,† , Leilei Chen 2,† , Dan Liu 1 , Jiafeng Huang 1 , Jiang Zhang 1 , Xiao Xiao 1 , Ming Lei 1 ,
Yuelin Chen 1 and Hailun He 1, *
1
2
*
†
School of Life Science, State Key Laboratory of Medical Genetics, Central South University,
Changsha 410013, China; ribang.wu@gmail.com (R.W.); liudan.forever@163.com (D.L.);
1608110217@csu.edu.cn (J.H.); zhangjiang915@163.com (J.Z.); 162511013@csu.edu.cn (X.X.);
leiming@csu.edu.cn (M.L.); lumc96@hotmail.com (Y.C.)
Institute of Agro-Food Science and Technology & Shandong Provincial Key Laboratory of Agro-Products
Processing Technology, Shandong Academy of Agricultural Sciences, Jinan 250100, China;
chenleilei8210@163.com
Correspondence: helenhe@csu.edu.cn; Tel.: +86-731-8265-0230
These authors contributed equally to this work.
Academic Editor: Se-Kwon Kim
Received: 26 September 2016; Accepted: 16 December 2016; Published: 11 January 2017
Abstract: Bacterial extracellular proteases from six strains of marine bacteria and seven strains of
terrestrial bacteria were prepared through fermentation. Proteases were analyzed through substrate
immersing zymography and used to hydrolyze the collagen and muscle proteins from a salmon
skin byproduct, respectively. Collagen could be degraded much more easily than muscle protein,
but it commonly showed weaker antioxidant capability. The hydrolysate of muscle proteins was
prepared with crude enzymes from Pseudoalteromonas sp. SQN1 displayed the strongest activity of
antioxidant in DPPH and hydroxyl radical scavenging assays (74.06% ± 1.14% and 69.71% ± 1.97%),
but did not perform well in Fe2+ chelating assay. The antioxidant fractions were purified through
ultrafiltration, cation exchange chromatography, and size exclusion chromatography gradually, and
the final purified fraction U2-S2-I displayed strong activity of antioxidant in DPPH, hydroxyl radical
scavenging assays (IC50 = 0.263 ± 0.018 mg/mL and 0.512 ± 0.055 mg/mL), and oxygen radical
absorption capability assay (1.960 ± 0.381 mmol·TE/g). The final purified fraction U2-S2-I possessed
the capability to protect plasmid DNA against the damage of hydroxyl radical and its effect was
similar to that of the original hydrolysis product. It indicated that U2-S2-I might be the major active
fraction of the hydrolysate. This study proved that bacterial extracellular proteases could be utilized
in hydrolysis of a salmon byproduct. Compared with collagen, muscle proteins was an ideal material
used as an enzymatic substrate to prepare antioxidant peptides.
Keywords: bacterial extracellular proteases; antioxidant peptide;
peptide purification; evaluation of antioxidant activity
enzymatic hydrolysis;
1. Introduction
Oxidative stress is an imbalance between oxidation and antioxidation, caused by external or
internal stimulation. Reactive oxygen species (ROS), such as superoxide anion radicals (O2 − ),
hydrogen peroxide (H2 O2 ), hydroxyl radicals ( OH), and peroxyl radicals (ROO ), can damage
DNA, proteins, and membrane systems, which is the significant nosogenesis of chronic diseases [1],
including cancer [2], heart disease [3], and Alzheimer’s [4]. In addition, free-radical-mediated
lipid peroxidation can lead to food spoilage and the generation of potentially toxic products.
Although an endogenous antioxidant system containing antioxidant enzymes (superoxide dismutase,
Mar. Drugs 2017, 15, 4
252
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2017, 15, 4
glutathione S-transferase, and catalase) and antioxidant substrates (glutathine and victamin C) can
scavenge ROS to protect cells in vivo, the excessive ROS that cannot be removed promptly still damage
cells and tissues. In the food industry, synthetic antioxidants, such as butylated-hydroxytoluene (BHT),
butylated-hydroxyanisole (BHA), tertbutyl-hydroquinone (TBHQ), and propyl gallate (PG), have been
used during food processing, but existing potentially toxic effect on health. Antioxidant peptides are a
series of oligopeptides with specific amino acid sequences, which can scavenge free radicals or inhibit
the generation of ROS.
A lot of studies have reported that the enzymatic hydrolysis of protein is an effective way to
prepare novel bioactive peptides, including antioxidant peptides. Numerous protein resources were
found to be ideal materials of antioxidant peptides preparation, such as blacktip shark skin [5],
blue mussel protein [6], cod protein [7], skate skin [8], oysters [9], and so on. Meanwhile, during fish
processing, a great amount of fish byproducts, such as fish skin, bone frame, and fins, were processed
into animal feed, which were not utilized comprehensively and therefore caused a severe waste
of protein resources. Recent studies have reported that byproducts with abundant protein can be
recycled and used to prepare bioactive peptides. Series of peptides can be released from the parental
protein by enzymatic hydrolysis, and they may possess different kinds of biological activities, such as
antioxidant, inhibition of angiotensin I-converting enzyme (ACE), antibiotic, anti-freezing, and so
on [5,10]. Salmon is a valuable and popular edible fish worldwide [11]. Previous studies have reported
that salmon byproducts could be hydrolyzed by various proteases to prepare bioactive peptides.
Sathiel et al. extracted functional and nutritional peptides from salmon head hydrolysates with different
enzymes [12]. Ahn et al. used six kinds of proteases to hydrolyze protein from the salmon pectoral
fin, and found that peptic hydrolysates exhibited antioxidant and anti-inflammatory activities [13].
Most of the enzymes used in these researches are commercial proteases, such as pepsin, trypsin,
chymotrypsin, papain, flavourzyme, and so on. However, non-commercial proteases were seldom
reported in peptide preparation.
Recently, marine bacteria have become important sources for the selection of novel enzymes.
The proteases secreted by marine bacteria play an important role in the decomposition of organic
nitrogen in oceans, and therefore they have incomparable advantages in hydrolyzing marine-sourced
protein [14]. Compared with land proteases, marine proteases usually have higher catalytic efficiency
in hydrolyzing marine protein, such as fish skin, muscle, and bone frame [15,16]. The cleavage site
of proteases from different bacteria also varies widely. With these enzymes, peptides obtained from
protein hydrolysate may possess different amino acid sequences. It would be beneficial to discover
more new bioactive peptides. This study aimed at investigating the effect of several extracellular
proteases from bacteria on hydrolyzing the protein of salmon byproduct. The antioxidant activity of
each hydrolysate and purified fraction was evaluated in order to verify the possibility of application.
2. Results and Discussion
2.1. Substrate-Immersing Zymography of Bacterial Extracellular Proteases
The bacterial fermentation products were obtained every 24 h for five days. Then the enzymatic
activity and concentration of total protein were quantified with the Folin’s phenol and BCA
method to calculate specific activity and the time course of protease activity, respectively (Figure 1).
It was obvious that Pseualtermonas sp. SQN1 produced a protease with much higher specific activity
(347.27 ± 5.58 U/mg) compared with other tested bacteria from sea water. The enzymatic activity
could become stable after 72 h fermentation, which was faster than Vibrio sp. SQS2-3 and Vibrio sp.
SWN2. Bacteria from fresh water commonly display lower specific activity, such as Bacillus sp. MH12,
Aeromonas sp. ZM3, and Aeromonas sp. ZM7. In addition, Exiguobacterium sp. MH2 and Pseudomonas
sp. ZM9 could produce proteases in a shorter time, but the specific activity decreased rapidly after two
and three days, respectively.
253
Mar. Drugs 2017, 15, 4
ȱ
ȱ
Figure 1. Time course specific activity of bacterial crude enzymes came from marine bacteria (a) and
fresh water bacteria (b) during five-day fermentation. Values are displayed as means ± SD (n = 3).
The enzymatic activity and protease composition of each bacterial fermentation products after
five days were detected through substrate immersing zymography. The result of zymography was
summarized in Table 1, including the amount of proteases, the total protein concentration of crude
enzyme, specific activity, and the molecular weight of each active band. As shown in Figure 2,
crude enzymes from Pseudoalteromonas sp. J2, Pseudoalteromonas sp. SQN1, Vibrio sp. SQS2-3,
and Bacillus sp. MH12 contained several proteases. Only one kind of protease was displayed in
the lanes of Photobacterium sp. YJ2, Bacillus sp. TC3, and Pseudomonas sp. ZM9. The enzymes
from Aeromonas sp. ZM3 and Aeromona sp. ZM7 showed the strongest enzymatic activity on casein.
The crude enzyme from Bacillus sp. SQN5, Vibrio sp. SWN2, Exiguobacterium sp. MH2, and Paenibacillus
sp. ZM8 did not display the ability of degrading casein in zymography. Theoretically, multi-proteases
possess more enzymatic cleavage sites, which could hydrolyze protein more effectively. The antioxidant
peptides were commonly separated from the hydrolysates with a relatively higher hydrolysis degree,
so multi-proteases might be more suitable for antioxidant peptide preparation. Wang et al. reported
that hydrolyzing collagen from croceine croaker with pepsin and trypsin could obtain peptides
with higher antioxidant activity compared with preparation with pepsin or trypsin alone [17].
Meanwhile, other factors should be considered when choosing enzymes, such as enzymatic activity
254
Mar. Drugs 2017, 15, 4
and substrate binding capability. Higher enzymatic activity and substrate binding capability could
shorten the reaction time and release antioxidant peptides more easily. On the other hand, some crude
proteases contain a lot of extracellular polysaccharide, which makes the samples sticky and impedes the
migration of proteases in gel, just like the enzymes from Aeromonas sp. ZM3 and Aeromonas sp. ZM7.
The byproducts of fermentation would increase cost and difficulty in purification, so these two enzymes
were not selected. Zymography analysis of bacterial proteases was necessary and helpful to choose
enzymes by screening before the preparation of antioxidant peptides. With zymography analysis,
the enzymatic activity, the amount of proteases, purification difficulty, or even the type of each protease
could be forecasted to a certain degree.
Table 1. Summary of crude enzymes from bacterial fermentation.
Bacteria Strain
Concentration of
Total Protein (mg/mL)
Specific
Activity (U/mg)
2.63
1.26
1.98
1.18
1.65
2.00
39.06
347.27
161.06
293.95
236.92
54.93
1.03
2.20
3.84
5.35
5.26
1.02
1.06
110.04
103.67
208.78
99.47
19.25
114.68
168.12
Bacteria from sea water
Pseudoalteromonas sp. J2
Pseudoalteromonas sp. SQN1
Bacillus sp. SQN5,
Vibrio sp. SQS2-3
Vibrio sp. SWN2
Photobacterium sp. YJ2
Bacteria from fresh water
Bacillus sp. TC3
Exiguobacterium sp. MH2
Bacillus sp. MH12
Aeromonas sp. ZM3
Aeromonas sp. ZM7
Paenibacillus sp. ZM8
Pseudomonas sp. ZM9
Amount of Proteases
Molecular
Weight (kD)
3
2
90, 40, 30~40
90~120, 40
3
60, 40, 30
1
14
1
<14
2
Proteases cannot be separated
Proteases cannot be separated
<14
1
30~40
ȱ
Figure 2. Substrate immersing zymography of different bacterial extracellular proteases.
2.2. Hydrolysis of Salmon Protein
The collagen and muscle proteins from salmon byproducts were both hydrolyzed with different
kinds of bacterial proteases, respectively. The hydrolysis results of 5 min were analyzed by sodium
dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) (Figure 3) and the rate of hydrolysis of
each bacterial crude enzyme was also measured (Figure 4). The antioxidant activities of each hydrolysis
product after 30 min were measured. As depicted in Figure 3, collagen obtained from salmon skin
through hot water treatment consisted of proteins of similar molecular weight. The triple α-helical
structure of marine-sourced collagen was unstable at high temperature; it could convert from tight
form to relaxed form, and part of the collagen fiber would be broken during hot water treatment.
That might be the reason why the salmon collagen extracted in hot water did not display as
several specific bands. It could be observed that crude enzymes from Pseudoalteromonas sp. J2,
Pseudoalteromonas sp. SQN1, Vibrio sp. SQS2-3, Photobacterium sp. YJ2, Bacillus sp. TC3, Bacillus sp.
MH12, Aeromonas sp. ZM3, and Aeromonas sp. ZM7 could hydrolyze collagen into smaller pieces more
effectively. Compared with the results of substrate-immersing zymography, those crude enzymes that
degraded collagen quickly commonly contained several proteases or formed brilliant bands in gel,
255
Mar. Drugs 2017, 15, 4
which indicated high enzymatic activity. The antioxidant activity of each group was measured
through DPPH, hydroxyl radical scavenging assays, and ferrous ion chelating assay (Figure 3).
The products with a higher hydrolysis degree tend to display strong activity in DPPH and hydroxyl
radical scavenging assays, such as J2-C (47.77% ± 1.78% in DPPH and 32.75% ± 3.49 in OH),
SQS2-3-C (44.08% ± 1.77% in DPPH and 25.67% ± 3.38% in OH), and ZM3-C (42.36% ± 1.61% in
DPPH and 44.88% ± 1.70% in OH). These results indicated that those antioxidant peptides scavenging
free radicals directly were closely related to the degree of hydrolysis or molecular weight. Peptides with
small molecular weight could react with free radicals more easily and displayed stronger antioxidant
activity [17]. However, collagen hydrolysates with higher hydrolysis degree did not show significant
activity in Fe2+ chelating assay. Contrarily, the MH2-C and ZM8-C groups with lower hydrolysis
degree displayed relatively stronger Fe2+ chelating activity (21.75% ± 2.87% and 20.96% ± 2.44%).
ȱ
(a)ȱ
Figure 3. Cont.
256
Mar. Drugs 2017, 15, 4
ȱ
(b)ȱ
Figure 3. Cont.
257
Mar. Drugs 2017, 15, 4
ȱ
(c)ȱ
Figure 3. Cont.
258
Mar. Drugs 2017, 15, 4
ȱ
(d)ȱ
Figure 3. Hydrolysis results of (a) salmon collagen with sea water bacterial proteases; (b) salmon
collagen with fresh water bacterial proteases; (c) salmon muscle protein with sea water bacterial
proteases; and (d) salmon muscle proteins with fresh water bacterial proteases in SDS-PAGE,
and the antioxidant activity measured with DPPH, hydroxyl radical scavenging assays, and ferrous ion
chelating assay (n = 3).
259
Mar. Drugs 2017, 15, 4
ȱ
Figure 4. Hydrolysis rate of (a) marine bacterial proteases towards collagen; (b) fresh water bacterial
proteases towards collagen; (c) marine bacterial proteases towards muscle protein; and (d) fresh water
bacterial proteases towards muscle protein. Values were displayed as means ± SD (n = 3).
Previous studies commonly hydrolyzed collagen with commercial proteases. For example,
Wang et al. used trypsin and pepsin to degrade collagen from a croceine croaker for 4 h,
and obtained products with hydroxyl radical scavenging activity (53.11% ± 0.97% and 44.96% ± 1.97%,
at a concentration of 10 mg/mL, respectively) [18]. Yang et al. reported that bromelain or papain could
finish the digestion of retorted gelatin from cobia skin within 0.5 h, producing antioxidant fractions,
while pancreatin or trypsin needed at least 2 h [19]. Mendis et al. obtained antioxidant peptides from
the skin gelatin of jumbo squid with trypsin for 4 h [20]. Compared with the crude enzymes used
in this study, most of the commercial proteases took longer to produce antioxidant peptides. It was
common that commercial proteases were single-enzyme, while crude enzymes obtained from bacterial
fermentation were multi-enzymes. Multi-proteases possessed more cleavage sites. More potential
bioactive peptides would be released and the reaction time could be shortened.
The protein component from salmon muscle was more complicated than collagen,
which contained a series of proteins with different molecular weights (Figure 3). In addition,
it was much more difficult for enzymes to hydrolyze muscle proteins compared with collagen.
In the first five minutes, Bacillus sp. TC3 and Bacillus sp. MH12 could degrade most of the
protein from salmon muscle. Pseudoalteromonas sp. SQN1, Vibrio sp. SQS2-3, Photobacterium sp. YJ2,
Bacillus sp. MH12, Aeromonas sp. ZM3, and Aeromonas sp. ZM7 could hydrolyze part of muscle
protein. In DPPH and hydroxyl radical scavenging assays, the antioxidant activity of muscle
hydrolysate was much stronger than that of collagen hydrolysate. The product of muscle hydrolyzed
with enzyme from Pseudoalteromonas sp. SQN1 showed the strongest activity after 30 min
hydrolysis (74.06% ± 1.14% in DPPH and 69.71% ± 1.97% in OH). Compared with the Fe2+
chelating assay results of collagen hydrolysates, muscle protein hydrolysates generally displayed
stronger activity, especially the MH2-M and ZM-8 groups, which exhibited significant activity
(55.52% ± 4.51% and 41.42% ± 2.29%, respectively). Similar to collagen hydrolysates, those muscle
260
Mar. Drugs 2017, 15, 4
protein hydrolysates with a lower hydrolysis degree displayed higher Fe2+ chelating activity.
It was possible that a suitable hydrolysis degree was an important factor in preparing peptides
with better ion chelating activity. It was also reported that the amino acid residues of source
protein could affect the antioxidant activity of peptides [17]. Nazeer et al. used gastrointestinal
digestive enzymes to hydrolyze croaker (Otolithes ruber) muscle proteins and prepared a peptide
Lys-Thr-Phe-Cys-Gly-Arg-His with strong DPPH and hydroxyl radical scavenging activity (84.5% ± 1.2%
and 62.4% ± 2.9%) [21]. Chi et al. used trypsin to hydrolyze monkfish muscle proteins and prepared
three peptides Glu-Trp-Pro-Ala-Gln, Phe-Leu-His-Arg-Pro, and Leu-Met-Gly-Gln-Trp. All of these
peptides displayed strong activities in DPPH (EC50 2.408, 3.751, and 1.399 mg/mL), hydroxyl radical
(EC50 0.269, 0.114, and 0.040 mg/mL), and superoxide anion radical (EC50 0.624, 0.101, and 0.042 mg/mL)
scavenging assays [20]. Most of these reported antioxidant peptides contained specific amino acid,
such as cysteine, tyrosine, histidine, and so on, and they made a great contribution to remove free
radical or chelate oxidation-related ions [17]. The Gly-X-Y repeating sequence made the amino acid
composition of collagen simple and rich in glycine and proline, which do not possess strong active
sites against free radicals. The amino acid composition of muscle proteins was more complicated
than that of collagen, which may exist more potential antioxidant peptide sequences. In addition,
the muscle proteins were much more stable than collagen. Extracted with homogenization,
the structure of the muscle proteins could be kept intact, which ensures that the activity of the products
was very similar even though they were prepared in different batches. Therefore the muscle was more
suitable than collagen to be used in antioxidant peptide preparation.
2.3. Optimization of Hydrolysis Condition
A single factor analysis towards the hydrolysis of muscle protein with enzyme from
Pseudoalteromonas sp. SQN1 was carried out, including time of hydrolysis, temperature of hydrolysis,
and the ratio of [E]/[S] (Figure 5). Then the time, temperature, and ratio of [E]/[S] were selected to
be 25 min, 45 ◦ C, and 1:50 (g/g). The central composite design was designed with Design Expert 8.0.
The experimental conditions and DPPH scavenging activity are listed in Table 2. Variance analysis
of linear model with ANOVA is displayed in Table 3, which indicates that the ratio of [E]/[S] was a
significant factor influencing the DPPH scavenging activity of muscle protein hydrolysate.
Table 2. Optimization of muscle protein hydrolysis condition through central composite design (CCD).
Group
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
Time (min)
Temperature (◦ C)
Ratio of [E]/[S] (g/g)
DPPH Scavenging Activity (%)
29.2
25
25
22.5
20.8
25
25
27.5
25
27.5
25
27.5
25
25
25
22.5
22.5
22.5
27.5
25
45
45
45
47.5
45
45
40.8
42.5
45
42.5
49.2
47.5
45
45
45
42.5
47.5
42.5
47.5
45
1:50
1:50
1:50
1.5:50
1:50
1:50
1:50
0.5:50
1.8:50
1.5:50
1:50
0.5:50
1:50
1:50
1:50
1.5:50
0.5:50
0.5:50
1.5:50
0.2:50
68.13
68.70
69.27
71.19
72.91
70.80
69.46
70.99
74.44
76.54
69.66
67.93
73.67
71.95
73.48
73.29
69.08
70.42
70.80
70.43
261
Mar. Drugs 2017, 15, 4
Table 3. Variance analysis of linear model with ANOVA.
Source
Model
A-Time
B-Temperature
C-Ratio of [E]/[S]
Residual
Lack of Fit
Pure Error
Cor Total
Sum of Square
10−3
0.390 ×
9.880 × 10−5
3.781 × 10−4
3.213 × 10−3
3.013 × 10−3
2.197 × 10−3
8.152 × 10−4
6.703 × 10−3
df
Mean Square
3
1
1
1
16
11
5
19
10−3
1.230 ×
9.880 × 10−5
3.781 × 10−4
3.213 × 10−3
1.883 × 10−4
1.998 × 10−4
1.630 × 10−4
F Value
p-Value (Prob > F)
6.53
0.52
2.01
17.07
0.0043
0.4793
0.1756
0.0008
1.23
0.4375
ȱ
Figure 5. Single-factor analysis of muscle protein hydrolysis with SQN1: (a) incubated at 50 ◦ C with
a ratio of [E]/[S] in 1:10 for 5, 10, 15, 20, 25, 30, and 35 min; (b) incubated at 25, 30, 35, 40, 45, 50,
and 55 ◦ C with a ratio of [E]/[S] in 1:10 for 30 min; (c) incubated at 50 ◦ C for 30 min with a ratio of
[E]/[S] in 1:4, 1:6, 1:8, 1:10, 1:12, and 1:14. Values were displayed as means ± SD (n = 3).
2.4. Purification of Antioxidant Peptides from Hydrolysate of Muscle Proteins
Since the crude enzyme from Pseudoalteromonas sp. SQN1 could hydrolyze salmon muscle
proteins to release peptides with strong antioxidant activity, the active fractions were further purified
with ultrafiltration, cation exchange chromatography, and size exclusion chromatography gradually.
Ultrafiltration tubes with 3 kDa molecular weight cutoff (MWCO) were selected to separate small
peptides after 30 min hydrolysis. As shown in Table 4, the DPPH and hydroxyl radical scavenging
activity of muscle hydrolysis product (IC50 0.721 ± 0.024 mg/mL and 1.371 ± 0.178 mg/mL) was
higher than the activity of smaller fraction U2 (IC50 0.377 ± 0.013 mg/mL and 0.882 ± 0.127 mg/mL)
but lower than U1, which was the fraction with a larger size (IC50 0.972 ± 0.031 mg/mL and
1.495 ± 0.214 mg/mL). This indicated that peptides with smaller size were the major active fraction in
this product, and therefore U2 was chosen to be further purified with cation exchange chromatography.
As shown in Figure 6a, U2 was separated into three major fraction peaks, which were collected,
lyophilized, and detected. The first eluted peak (U2-S2) showed the strongest antioxidant activity
(IC50 0.289 ± 0.022 mg/mL and 0.681 ± 0.078 in DPPH and OH). This fraction was further purified
with a Sephadex G-15 size exclusion column (Uppsala, Sweden), and two fractions (U2-S2-I and
U2-S2-II) were obtained (Figure 6b). U2-S2-I accounted for 99.03% of U2-S2 according to the integral
area calculation of Bio-Rad ChromLab software (Hercules, CA, USA). Furthermore, this fraction also
displayed similar DPPH and hydroxyl radical scavenging activity (IC50 0.263 ± 0.018 mg/mL and
0.512 ± 0.055 mg/mL) compared with U2-S2. This result showed that U2-S2-I was the major active
fraction. As shown in Table 5, the fraction U2-S2-I displayed higher DPPH scavenging activity
compared with other reported antioxidant peptides purified from different muscle protein hydrolysate.
This indicated that salmon muscle hydrolyzed by protease from Pseualtermonas sp. SQN1 would be a
feasible method to prepare antioxidant peptides.
262
Mar. Drugs 2017, 15, 4
ȱ
Figure 6. Purification of antioxidant fractions with fast protein liquid chromatography on
(a) Macro-Prep High S column and (b) Sephadex G-15 column.
Table 4. DPPH scavenging activity of purified fractions in each step.
Preparation Step
IC50 Value (mg/mL)
Fractions
Yield (%)
DPPH
OH
Hydrolysate
0.721 ± 0.024
1.371 ± 0.178
100
U1
U2
0.972 ± 0.151
0.377 ± 0.013
1.495 ± 0.214
0.882 ± 0.127
35.18
Cation exchange
chromatography
U2-S1
U2-S2
U2-S3
1.781 ± 0.048
0.289 ± 0.022
0.972 ± 0.053
1.689 ± 0.118
0.681 ± 0.078
0.920 ± 0.093
12.81
Size exclusion
chromatography
U2-S2-I
U2-S2-II
0.263 ± 0.018
4.832 ± 0.552
0.512 ± 0.055
3.191 ± 0.323
12.68
Enzymatic
hydrolysis
Ultrafiltration
Table 5. Comparing with reported antioxidant peptides sourced from muscle protein.
Source
Salmon muscle
Scorpaena notata muscle
Croceine croaker muscle
Monkfish muscle
Smooth hound muscle
Sphyrna ewini muscle
Enzyme
Protease from Pseudoalteromonas sp. SQN1
neutral serine protease
pepsin and alcalase
trypsin
gastrointestinal proteases
papain
Antioxidant Activity
(DPPH)
IC50
IC50
IC50
IC50
IC50
IC50
= 0.51 mg/mL
= 0.60 mg/mL
= 1.35 mg/mL
= 1.40 mg/mL
= 0.60 mg/mL
= 3.06 mg/mL
Reference
[22]
[23]
[24]
[25]
[26]
2.5. Oxygen Radical Absorption Capability (ORAC) Assay
Oxygen radical absorption capability assay was used to detect the antioxidant activity against
peroxyl radicals [27]. Peroxyl radical was considered to be the major free radical generated during
the auto-oxidation process of lipid and fatty acid. Peptides with strong absorption capability
against peroxyl radical could be a potential antioxidant additive in the food processing industry.
The activities of two fractions separated in size exclusion chromatography were detected with this
method. The decay speed of the fluorescence curve reflected the reaction speed of the peptides and the
area under the curve reflected the quantity of the peroxyl radical removed by antioxidant. As shown
in Figure 7, U2-S2-I displayed its effect in decreasing the decay of fluorescence and its antioxidant
activity (1.960 ± 0.381 mmol·TE/g) was much stronger than U2-S2-II (0.344 ± 0.079 mmol·TE/g).
Antioxidant-donating hydrogen could block the radical chain reaction caused by peroxyl radical in
ORAC assay. The result indicated that U2-S2-I might contain active peptides working as hydrogen
263
Mar. Drugs 2017, 15, 4
donors. Specific amino acid residues, such as cysteine, tyrosine, and histidine, could provide hydrogen
for free radicals from the sulfydryl group (-SH), the phenolic hydroxyl group, and the iminazole circle,
respectively. Meanwhile, specific amino acid residues could also form a stable structure to stop the
radical chain reaction.
Figure 7. Oxygen radical absorption capability of U2-S2-I and U2-S2-II compared with PBS control
group and trolox-positive group.
2.6. DNA Protection Effect against Oxidation-Induced Damage
Hydroxyl radicals are known for causing oxidative breaks in DNA strands. The DNA protection
effect of U2-S2-I was examined using plasmid DNA in vitro compared with the initial hydrolysate.
The results in Figure 8 showed that the concentration of supercoil DNA significantly decreased,
and the open circle DNA appeared in damage group. When the plasmid DNA was exposed to
U2-S2-I or initial hydrolysate, the concentration of supercoil DNA was still high. This indicated that
both the hydrolysis product and the final purified fractions have an antioxidant effect. In addition,
the antioxidant effect of these two groups was similar, which also indicates that the final fraction
U2-S2-I might be the major active fraction of this hydrolysis product. DNA damage is a typical
phenomenon of cytopathy caused by oxidative stress in vivo. Peptides with a DNA protection effect
against oxidation could be further developed as a functional supplement to prevent diseases related to
oxidation. Sheih et al. prepared an antioxidant peptide with DNA protection effect from algae protein
hydrolysate, and the peptide could increase the viability of AGS cells [28]. Karawita et al. found that
the enzymatic extracts of microalgae could effectively inhibit DNA damage and repair H2 O2 -induced
DNA damage in mouse lymphoma L5178 cells [29].
264
Mar. Drugs 2017, 15, 4
ȱ
Figure 8. DNA protection effect of U2-S2-I against oxidation-induced damage. Lane 1: plasmid DNA
pET-22b without oxidation damage; Lane 2: plasmid DNA pET-22b without antioxidant was attacked
by hydroxyl radical; Lane 3: plasmid DNA pET-22b was protected by U2-S2-I against the attack of
hydroxyl radical; Lane 4: plasmid DNA pET-22b was protected by SQN1-M hydrolysate against the
attack of hydroxyl radical.
3. Experimental Section
3.1. Materials
Fresh salmon skin with muscle was purchased from a seafood market in Shanghai, China,
and was stored at −20 ◦ C prior to use. The soybean meal, corn powder, and wheat bran were
purchased from a supermarket in Changsha, Hunan province, China. Tryptone and yeast extraction
were purchased from Thermo Fisher Oxoid (Basingstoke, Hamshire, UK). Sephadex G-15 size exclusion
gel was purchased from GE Healthcare Life Sciences (Uppsala, Sweden). The other regents used are
commercially available.
Pseudoalteromonas sp. J2, Pseudoalteromonas sp. SQN1, Bacillus sp. SQN5, Vibrio sp. SQS2-3,
Vibrio sp. SWN2, and Photobacterium sp. YJ2 were from the inshore environment of the South China
Sea. Bacillus sp. TC3, Exiguobacterium sp. MH2, Bacillus sp. MH12, Aeromonas sp. ZM3, Aeromonas sp.
ZM7, Paenibacillus sp. ZM8, and Pseudomonas sp. ZM9 were from the lakes on the Yungui plateau.
3.2. Preparation of Bacterial Extracellular Proteases
3.2.1. Preparation of Bacterial Proteases from Fermentation
The method of proteases preparation was modified according to Liu’s study [30].
The protease-producing bacteria were activated in a 2216E medium with shaking at 200 rpm and
18 ◦ C. When the OD600 value reached 0.6, the bacteria were incubated in a fermentation broth
(0.5% corn powder, 0.5% bean powder, 0.25% wheat bran, 0.1% CaCl2 , 0.4% Na2 HPO4 , and 0.03%
KH2 PO4 , prepared with sea water) [31] and fermented at 200 rpm and 18 ◦ C for 5fivedays.
The supernatant was centrifuged at 12,000× g and 4 ◦ C for 30 min to collect the crude proteases.
3.2.2. Detection of Proteases with Substrate-Immersing Zymography
Substrate immersing zymography was modified to detect the proteolytic activities according to
the method developed by Liu [30]. Crude proteases (16 µL) were loaded in a 12.5% SDS-PAGE gel
with constant voltage at 100 V for 10 min and 160 V for 50 min in proper order. The gel was washed
three times with 2.5% Triton X-100 for 15 min to remove SDS after electrophoresis. Then the gel was
washed with 50 mM Tris-HCl (pH 8.0) and immersed in 0.1% casein at 37 ◦ C for 60 min. Subsequently,
the gel was stained with 0.1% Coomassie Brilliant Blue R-250 for 3 h, and destained by ethanol/acetic
acid/H2 O (2:1:7) mixture with shaking until the bands of proteolytic activity became visible.
265
Mar. Drugs 2017, 15, 4
3.3. Protein Hydrolysis of Salmon Byproducts Using Bacterial Extracellular Proteases
The salmon byproducts consisted of fish skin and subcutaneous muscle, which were separated
and pretreated in different ways. The total protein concentration of crude enzymes from different
bacteria was diluted to 1 mg/mL.
3.3.1. Hydrolysis of Salmon Collagen Using Bacterial Extracellular Proteases
Fish skin was cut into pieces and washed with cold distilled water three times. Then 5 g fish
skin was cooked in 50 mL distilled water at 75 ◦ C for 30 min. The supernatant was collected by
centrifugation at 12,000× g for 15 min. Salmon skin collagen was lyophilized for 24 h until the protein
changed into a solid. Then the collagen was dissolved into ddH2 O to the concentration of 10 mg/mL,
then mixed with different kinds of bacterial extracellular proteases at an enzyme/substrate ratio of
1:90 (g/g), and the mixtures were incubated at 50 ◦ C. After 5 min, 20 µL of hydrolysates were sampled
and inactivated at 90 ◦ C for 10 min. The hydrolysis of collagen was detected by 12.5% SDS-PAGE.
The hydrolysis rates of collagen with different bacterial crude enzyme were quantified as follows:
Rate of hydrolysis (µmol/min·g) = (ct − c0 ) × 0.18 mL/(5 min × 1 mg/mL × 0.02 mL),
where c0 and ct were defined as the concentration of peptides product before and after hydrolysis,
respectively. After 25 min, the mixtures of hydrolysis were inactivated at 90 ◦ C for 10 min.
3.3.2. Hydrolysis of Salmon Muscle Using Bacterial Extracellular Proteases
The salmon muscle was homogenized at a speed of 10,000 rpm for 2 min in distilled water.
Then the supernatant was collected by centrifugation at 13,000× g for 30 min. The concentration of
muscle proteins was quantified and diluted to 5 mg/mL with BCA method. Then the muscle protein
was mixed with different proteases at an enzyme/substrate ratio of 1:45 (g/g), and the mixtures were
incubated at 50 ◦ C. After 5 min, 20 µL of hydrolysates were sampled and inactivated at 90 ◦ C for 10 min.
The hydrolysis of collagen was detected by 12.5% SDS-PAGE. The hydrolysis rates of muscle protein
with different bacterial crude enzyme were quantified using the method described in Section 3.3.1.
After 25 min, the mixtures of hydrolysis were inactivated at 90 ◦ C for 10 min.
3.4. Isolation of Antioxidant Peptides from Muscle Hydrolysate
3.4.1. Isolation of Muscle Hydrolysate by Ultrafiltration
After being hydrolyzed by proteases from Pseudoalteromonas sp. SQN1, the hydrolysate of
salmon muscle proteins was centrifuged in ultrafiltration tube with 3 kDa molecular weight cutoff
(Millipore, Temecula, CA, USA) at 5000× g for 30 min to isolate fractions above 3 kDa (MUF-1) and
below 3 kDa (MUF-2). The antioxidant activities of these two fractions were detected by hydroxyl
radical scavenging assay.
3.4.2. Cation Exchange Chromatography
The active fraction MUF-2 was further purified in a Bio-Rad Macro-Prep High S column
(5 × 1.26 cm) with NGC chromatography system (Bio-Rad, Hercules, CA, USA). The column
was equilibrated with distilled water. Then 5 mL MUF-2 were loaded into the pre-equilibrated
column at a flow rate of 1.5 mL/min, and eluted with distilled water for 18 min at a flow rate of
1.5 mL/min. Then the column was eluted with a linear gradient of 1 M NaCl (0%–50%) at a flow rate of
1.5 mL/min for 20 min. Peptide fractions were monitored at 220 nm and collected at a volume of 5 mL.
All the fractions were lyophilized.
266
Mar. Drugs 2017, 15, 4
3.4.3. Size Exclusion Chromatography
After cation exchange chromatography, the fraction with the strongest activity was further purified
by Sephadex G-15 size exclusion column (1.6 × 80 cm) with NGC chromatography system (Bio-Rad).
Fraction was dissolved in 1 mL distilled water and loaded into a column pre-equilibrated with distilled
water. The column was eluted with distilled water at a flow rate of 0.75 mL/min. Peptide fractions
were monitored at 220 nm and collected at a volume of 5 mL. All the fractions were lyophilized and
the antioxidant activities were evaluated by DPPH radical scavenging assay.
3.5. Evaluation of Antioxidant Activity
3.5.1. DPPH Radical Scavenging Activity
The DPPH radicals scavenging activity assay was measured according to the method of
Shimada et al. [32]. One hundred microliters of DPPH solution (0.1 mM in 95% ethanol) were
mixed with 20 µL of purified fraction solution in an Eppendorf tube to initiate the reaction,
which was incubated at room temperature for 60 min. Then the reaction mixture was transferred
into a 96-well microplate. The absorbance of the resulting solution was measured at 517 nm using an
Enspire 2300 microplate reader (Perkin Elmer, Waltham, MA, USA). For the blank, the purified fraction
was replaced with distilled water. The DPPH radicals scavenging activity was calculated using the
following formula:
DPPH radical scavenging activity (%) = [1 − ABSsample /ABSblank ] × 100%.
3.5.2. Hydroxyl Radical Scavenging Activity
Hydroxyl radical scavenging activity was measured according to the method developed by
Wang et al. [33]. Hydroxyl radicals were generated by the Fenton reaction. Ferrous ion (Fe2+ ) could
combine with 1,10-phenanthroline to form red compounds with a maximum absorbance at 536 nm.
The absorbance value would decrease when ferrous ion was oxidized into ferric ions by a hydroxyl
radical, which reflected the concentration of hydroxyl radicals. In this system, 1,10-phenanthroline
(40 µL, 2 mM) and the sample (80 µL) were added into an Eppendorf tube and mixed. The FeSO4
solution (40 µL, 2 mM) was then pipetted into the mixture. The reaction was initiated by adding
40 µL H2 O2 (0.03% v/v). After being incubated at 37 ◦ C for 60 min, the reaction mixture was transferred
into a 96-well microplate. The absorbance of the resulting solution was measured at 536 nm using an
Enspire 2300 Multimode Plate Reader (Perkin Elmer). The group without any antioxidant was used
as a negative control, while the mixture without H2 O2 was used as the blank. The hydroxyl radical
scavenging activity (HRSA) was calculated as follows:
HRSA (%) = [(As − An )/(Ab − An )] × 100%,
where As , An , and Ab were the absorbance values of the sample, the negative control, and the blank
determined at 536 nm after the reaction, respectively.
3.5.3. Ferrous Ion Chelating Assay
The ferrous ion chelating activity was measured according to the method of Thiansilakul [34].
Fresh ferrous sulfate (2 mM, 40 µL) and a 400-µL sample were mixed together, and the ferrous ion was
detected by 80 µL 5 mM ferrozine. Distilled water was added into the mixture until the total volume
reached 2 mL. Then the mixture was incubated at 37 ◦ C for 20 min. The absorbance of the reaction
product was measured at 562 nm, and the chelating ratio was calculated as follows:
Fe2+ chelating ratio (%) = 1 − (As /Ac ) × 100%,
267
Mar. Drugs 2017, 15, 4
where As and Ac were the absorbance values of the sample group and the control group determined
at 562 nm, respectively.
3.5.4. Oxygen Radical Absorbance Capability (ORAC) Assay
The ORAC assay was measured according to the method developed by Alberto et al. [35].
Sample solution (20 µL) and fluorescein (100 µL, 96 nM) were added into a 96-well microplate
and pre-incubated at 37 ◦ C in Enspire 2300 Multimode Plate Reader (Perkin Elmer). The reaction
was initiated by adding 30 µL pre-warmed AAPH (320 mM). The reaction was performed at 37 ◦ C.
The fluorescence intensity was measured every 30 s for 180 cycles with excitation and emission
wavelengths of 485 nm and 538 nm, respectively. Trolox was used as a positive control. The ORAC
was defined as the trolox equivalent (mmol·TE/g) according to the area under the curve (AUC),
and was calculated as follows:
ORAC = (AUCsample − AUCcontrol )/(AUCTrolox − AUCcontrol ) × (MTrolox /Msample ),
where AUCsample , AUCcontrol , and AUCTrolox were the integral areas under the fluorescence decay
curve of the peptide, 75 mM PBS (pH 7.4), and Trolox, respectively. MTrolox and Msample are the
concentrations of trolox and peptide.
3.5.5. Protection Effect on Oxidation-Induced DNA Damage
The protection effect on oxidation-induced DNA damage assay was modified according to the
method described by Qian et al. [36]. Plasmid DNA displays different structures and a different
running rate in agarose gel electrophoresis according to the damage degree. The reaction system
included 6 µL of pET-22b DNA, 3 µL of 2 mM FeSO4 , 6 µL of antioxidant, and 5 µL of 0.3% H2 O2 .
The mixture was incubated at 37 ◦ C for 10 min, and then analyzed by 1% agarose gel electrophoresis at
a constant voltage (130 V) for 30 min. The gel was then monitored in a gel imaging system (Bio-Rad)
after being immersed in ethidium bromide for 15 min.
3.6. Statistical Analysis
All experiments were conducted in triplicate (n = 3). The values were expressed as
mean ± standard deviation, which were calculated with the Origin 9.1 software. An ANOVA test was
used to analyze data in the SPSS 19.0 software.
4. Conclusions
Marine protein resources are considered to be a huge treasury of bioactive peptides.
More and more researchers are attempting to prepare novel bioactive peptides from marine protein
through enzymatic hydrolysis. This study proved that muscle proteins from salmon byproducts were
more suitable to be used as a preparation material of antioxidant peptides compared with collagen
from salmon byproducts. Moreover, the antioxidant peptide fraction exhibited a DNA protection
effect, which could be developed as a potential dietary supplement to prevent oxidation-related
diseases. In addition, commercial proteases were the first choice to be used in protein hydrolysis in
previous studies, because these proteases are relatively thoroughly studied and are easily obtained
from supermarkets. However, non-commercial proteases from bacteria also possess great potential in
bioactive peptide preparation, due to their high efficiency and low cost.
Acknowledgments: The work was supported by the National Natural Science Foundation of China (31070061,
31370104, 21205142), the National Sparking Plan Project (2013GA770009), the Opening Foundation of
the Chinese National Engineering Research Center for Control and Treatment of Heavy Metal Pollution
(No. 2015CNERC-CTHMP-07), the Open-End Fund for the Valuable and Precision Instruments of Central South
University (CSUZC201640), the Young Talents Training Program of Shandong Academy of Agricultural Sciences,
and the Fundamental Research Funds for the Central Universities of Central South University (2015zzts273).
268
Mar. Drugs 2017, 15, 4
Author Contributions: R.W., L.C. and H.H. conceived and designed this study. D.L. and J.Z. provided the bacteria
separated from sea water and fresh water, respectively. R.W., J.H. and M.L. performed the experiments. R.W., L.C.
and H.H. wrote this article. X.X. and Y.C. reviewed and edited the manuscript. All authors read and approved
the manuscript.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Rizzo, A.M.; Berselli, P.; Zava, S.; Montorfano, G.; Negroni, M.; Corsetto, P.; Berra, B.
Endogenous antioxidants and radical scavengers. Adv. Exp. Med. Biol. 2010, 698, 52–67. [PubMed]
Spolarics, Z. Endotoxemia, Pentose cycle, and the oxidant/antioxidant balance in the hepatic sinusoid.
J. Leukoc. Biol. 1998, 63, 534–541. [PubMed]
Diaz, M.N.; Frei, B.; Vita, J.A.; Keaney, J.F. Antioxidant and atherosclerotic heart disease. N. Engl. J. Med.
1997, 337, 408–416. [PubMed]
Stohs, S.J. The role of free radicals in toxicity and disease. J. Basic Clin. Physiol. Pharmacol. 1995, 6, 205–228.
[CrossRef] [PubMed]
Phanat, K.; Soottawat, B.; Wonnop, V.; Fereidoon, S. Gelatin hydrolysate from blacktip shark skin prepared
using papaya latex enzyme: Antioxidant activity and its potential in model systems. Food Chem. 2002,
135, 1118–1126.
Wang, B.; Li, L.; Chi, C.F.; Luo, H.Y.; Xu, Y.F. Purification and characterisation of a novel antioxidant peptide
derived from blue mussel (Mytilus edulis) protein hydrolysate. Food Chem. 2013, 138, 1713–1719. [CrossRef]
[PubMed]
Abraham, T.G.; He, R.; Fida, M.H.; Chibuike, C.U.; Tom, A.G.; Rotimi, E.A. Evaluation of the in vitro
antioxidant properties of a cod (Gadus morhua) protein hydrolysate and peptide fractions. Food Chem. 2015,
173, 652–659.
Ngo, D.H.; Ryu, B.; Kim, S.K. Active peptides from skate (Okamejei kenojei) skin gelatin diminish angiotensin-I
converting enzyme activity and intracellular free radical-mediated oxidation. Food Chem. 2014, 143, 246–255.
[CrossRef] [PubMed]
Wang, Q.K.; Li, W.; He, Y.H.; Ren, D.D.; Felicia, K.; Song, L.L.; Yu, X.J. Novel antioxidative peptides from
the protein hydrolysate of oysters (Crassostrea talienwhanensis). Food Chem. 2014, 145, 991–996. [CrossRef]
[PubMed]
Mirari, Y.A.; Ailén, A.; Marta, M.C.; López-Caballero, M.E.; Pilar, M.; Gómez-Guillén, M.C. Antimicrobial and
antioxidant chitosan solutions enriched with active shrimp (Litopenaeus vannamei) waste materials.
Food Hydrocoll. 2014, 35, 710–717.
Yang, R.; Wang, J.; Liu, Z.; Pe, X.; Han, X.; Li, Y. Antioxidant effect of a marine oligopeptide preparation from
chum salmon (Oncorhynchus keta) by enzymatic hydrolysis in radiation injured mice. Mar. Drugs 2011, 9,
2304–2315. [CrossRef] [PubMed]
Subramaniam, S.; Scott, S.; Witoon, P.; Peter, J.B. Functional and nutritional properties of red salmon
(Oncorhynchus nerka) enzymatic hydrolysates. J. Food Sci. 2005, 70, 401–406.
Ahn, C.B.; Kim, J.G.; Je, J.Y. Purification and antioxidant properties of octapeptide from salmon byproduct
protein hydrolysate by gastrointestinal digestion. Food Chem. 2014, 147, 78–83. [CrossRef] [PubMed]
Hunter, E.M.; Mills, H.J.; Kostka, J.E. Microbial Community diversity associated with carbon and nitrogen
cycling in permeable marine sediments. Appl. Environ. Microbiol. 2006, 72, 5689–5701. [CrossRef] [PubMed]
Gómez-Estaca, J.; Bravo, L.; Gómez-Guillén, M.C.; Alemán, A.; Montero, P. Antioxidant properties of
tuna-skin and bovine-hide gelatin films induced by the addition of oregano and rosemary extracts.
Food Chem. 2009, 112, 18–25. [CrossRef]
Kim, S.Y.; Je, J.Y.; Kim, S.K. Purification and characterization of antioxidant peptide from hoki
(Johnius belengerii) frame protein by gastrointestinal digestion. J. Nutr. Biochem. 2007, 18, 31–38. [CrossRef]
[PubMed]
Wu, R.B.; Wu, C.L.; Liu, D.; Yang, X.H.; Huang, J.F.; Zhang, J.; Liao, B.Q.; He, H.L.; Li, H. Overview of
antioxidant peptides derived from marine resources: The sources, characteristic, purification, and evaluation
methods. Appl. Biochem. Biotechnol. 2015, 176, 1815–1833. [CrossRef] [PubMed]
269
Mar. Drugs 2017, 15, 4
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
Wang, B.; Wang, Y.M.; Chi, C.F.; Luo, H.Y.; Deng, S.G.; Ma, J.Y. Isolation and characterization of collagen
and antioxidant collagen peptides from scales of croceine croaker (Pseudosciaena crocea). Mar. Drugs 2013, 11,
4641–4661. [CrossRef] [PubMed]
Yang, J.I.; Ho, H.Y.; Chu, Y.J.; Chow, C.J. Characteristic and antioxidant activity of retorted gelatin
hydrolysates from cobia (Rachycentron canadum) skin. Food Chem. 2008, 110, 128–136. [CrossRef] [PubMed]
Mendis, E.; Rajapakse, N.; Byun, H.G.; Kim, S.K. Investigation of jumbo squid (Dosidicus gigas) skin gelatin
peptides for their in vitro antioxidant effects. Life Sci. 2005, 77, 2166–2178. [CrossRef] [PubMed]
Nazeer, R.A.; Sampath, K.N.S.; Jai, G.R. In vitro and in vivo studies on the antioxidant activity of fish peptide
isolated from the croaker (Otolithes ruber) muscle proteins hydrolysate. Peptides 2012, 35, 261–268. [CrossRef]
[PubMed]
Ferid, A.; Neyssene, A.; Chobert, J.M.; Thomas, H.; Mohamed, N.M. Neutral serine protease from
Penicillium italicum. purification, biochemical characterization, and use for antioxidative peptide preparation
from Scorpaena notata muscle. Appl. Biochem. Biotechnol. 2014, 174, 186–205.
Chi, C.F.; Hu, F.Y.; Wang, B.; Ren, X.J.; Deng, S.G.; Wu, C.W. Purification and characterization of three
antioxidant peptides from protein hydrolyzate of croceine croaker (Pseudosciaena crocea) muscle. Food Chem.
2015, 168, 662–667. [CrossRef] [PubMed]
Chi, C.F.; Wang, B.; Deng, Y.Y.; Wang, Y.M.; Deng, S.G.; Ma, J.Y. Isolation and characterization of three
antioxidant pentapeptides from protein hydrolysate of monkfish (Lophius litulon) muscle. Food Res. Int. 2014,
55, 222–228. [CrossRef]
Ali, B.; Mohamed, H.; Rafik, B.; Imen, L.; Yosra, T.E.; Moncef, N. Antioxidant and free radical-scavenging
activities of smooth hound (Mustelus mustelus) muscle protein hydrolysates obtained by gastrointestinal
proteases. Food Chem. 2009, 114, 1198–1205.
Luo, H.Y.; Wang, B.; Li, Z.R.; Chi, C.F.; Zhang, Q.H.; He, G.Y. Preparation and evaluation of antioxidant
peptide from papain hydrolysate of Sphyrna lewini muscle protein. LWT Food Sci. Technol. 2013, 51, 281–288.
[CrossRef]
Elias, R.J.; Kellerby, S.S.; Decker, E.A. Antioxidant activity of proteins and peptides. Crit. Rev. Food Sci. Nutr.
2008, 48, 430–441. [CrossRef] [PubMed]
Sheih, I.C.; Wu, T.K.; Fang, T.J. Antioxidant properties of a new antioxidative peptide from algae protein
waste hydrolysate in different oxidation systems. Bioresour. Technol. 2009, 100, 3419–3425. [CrossRef]
[PubMed]
Karawita, R.; Senevirathne, M.; Athukorala, Y.; Affan, A.; Lee, Y.J.; Kim, S.K.; Lee, J.B.; Jeon, Y.J.
Protective effect of enzymatic extracts from microalgae against DNA damage induced by H2 O2 .
Mar. Biotechnol. 2007, 9, 479–490. [CrossRef] [PubMed]
Liu, D.; Yang, X.H.; Huang, J.F.; Wu, R.B.; Wu, C.L.; He, H.L.; Li, H. In situ demonstration and characteristic
analysis of the protease components from marine bacteria using substrate immersing zymography.
Appl. Biochem. Biotechnol. 2014, 175, 489–501. [CrossRef] [PubMed]
He, H.L.; Guo, J.; Chen, X.L.; Xie, B.B.; Zhang, X.Y.; Yu, Y.; Chen, B.; Zhang, Y.Z.; Zhou, B.C. Structural and
functional characterization of mature forms of metalloprotease E495 from arctic sea-ice bacterium
Pseudoalteromonas sp. SM495. PLoS ONE 2012, 7, e35442. [CrossRef] [PubMed]
Shimada, K.; Fujikawa, K.; Yahara, K.; Nakamura, T. Antioxidative properties of xanthan on the antioxidation
of soybean oil in cyclodextrin emulsion. J. Agric. Food Chem. 1992, 40, 945–948. [CrossRef]
Wang, B.; Li, Z.R.; Chi, C.F.; Zhang, Q.H.; Luo, H.Y. Preparation and evaluation of antioxidant peptides
from ethanol-soluble proteins hydrolysate of Sphyrna lewini Muscle. Peptides 2012, 36, 240–250. [CrossRef]
[PubMed]
Thiansilakul, Y.; Benjakul, S.; Shahidi, F. Compositions functional properties and antioxidative activity of
protein hydrolysates prepared from round scad (Decapterus maruadsi). Food Chem. 2007, 103, 1385–1394.
[CrossRef]
270
Mar. Drugs 2017, 15, 4
35.
36.
Alberto, D.; Carmen, G.C.; Begona, B. Extending applicability of the oxygen radical absorbance capacity
(ORAC-fluorescein) assay. J. Agric. Food Chem. 2004, 52, 48–54.
Qian, Z.J.; Jung, W.K.; Byun, H.G.; Kim, S.K. protective effect of an antioxidative peptide purified
from gastrointestinal digests of oyster (Crassostrea gigas) against free radical induced DNA damage.
Bioresour. Technol. 2008, 99, 3365–3371. [CrossRef] [PubMed]
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
271
marine drugs
Review
Marine Antifreeze Proteins: Structure, Function,
and Application to Cryopreservation as
a Potential Cryoprotectant
Hak Jun Kim 1, *, Jun Hyuck Lee 2, *, Young Baek Hur 3 , Chang Woo Lee 2 , Sun-Ha Park 2 and
Bon-Won Koo 1
1
2
3
*
Department of Chemistry, Pukyong National University, Busan 48513, Korea; 89guti14@gmail.com
Unit of Polar Genomics, Korea Polar Research Institute, Incheon 21990, Korea; justay@kopri.re.kr (C.W.L.);
psh@kopri.re.kr (S.-H.P.)
Tidal Flat Research Institute, National Fisheries Research and Development Institute, Gunsan,
Jeonbuk 54014, Korea; hur0100@korea.kr
Correspondence: kimhj@pknu.ac.kr (H.J.K.); junhyucklee@kopri.re.kr (J.H.L.);
Tel.: +82-51-629-5587 (H.J.K.); +82-32-760-5555 (J.H.L.)
Academic Editor: Keith B. Glaser
Received: 1 December 2016; Accepted: 20 January 2017; Published: 27 January 2017
Abstract: Antifreeze proteins (AFPs) are biological antifreezes with unique properties,
including thermal hysteresis (TH), ice recrystallization inhibition (IRI), and interaction with
membranes and/or membrane proteins. These properties have been utilized in the preservation
of biological samples at low temperatures. Here, we review the structure and function of
marine-derived AFPs, including moderately active fish AFPs and hyperactive polar AFPs. We also
survey previous and current reports of cryopreservation using AFPs. Cryopreserved biological
samples are relatively diverse ranging from diatoms and reproductive cells to embryos and organs.
Cryopreserved biological samples mainly originate from mammals. Most cryopreservation trials
using marine-derived AFPs have demonstrated that addition of AFPs can improve post-thaw viability
regardless of freezing method (slow-freezing or vitrification), storage temperature, and types of
biological sample type.
Keywords: antifreeze proteins; ice-binding proteins; ice recrystallization inhibition; cryoprotectant;
slow-freezing; vitrification
1. Introduction
Antifreeze proteins (AFPs) are biological antifreeze materials originally found in polar fish;
AFPs can bind to ice and subsequently inhibit the growth of the ice crystals. Fish can inhabit ice-laden
or cold seawater below the freezing point (−0.7 ◦ C) of their blood serum by virtue of AFPs [1–4].
However, in a literal sense, the term AFP is a misnomer since AFP does not stop freezing of the blood
serum or solution containing AFP. Hence, the term ice-binding protein (IBP) has been proposed to
include any protein that binds to ice including AFPs [5]. The term IBP has a bit more nuance than
the term AFP. The term ice structuring protein (ISP), which is not used frequently, is synonymous
with AFP. However, AFPs are a subset of the larger class of IBPs that includes ice nucleating proteins.
In short, all AFPs are IBPs, but not all IBPs are AFPs. In this review, the terms AFP and IBP are
used interchangeably.
Marine organisms known to possess or express AFPs, as shown in Figure 1, include bacteria [6–9],
fungi [10–12], crustacean [13], microalgae [14–19], and fish [20]. Propelled by next-generation
sequencing (NGS) technologies, identification of antifreeze genes from marine organisms has advanced
Mar. Drugs 2017, 15, 27
272
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2017, 15, 27
rapidly within the last few years. However, until now, other than fish AFPs, only a few AFPs have been
thoroughly characterized from Colwellia sp. [21], Flavobacterium frigoris [7], Glaciozyma antarctica [12,22],
Navicula glaciei [16], Fragilariopsis cylindrus [23,24], and Chaetocero neoglacile [15]. The unique function
of AFPs, i.e., enabling fish to survive in subfreezing environments, has inspired the researchers in
academia and industries to examine the potential applications of AFPs as a potential cryoprotective
agents or cryoprotectants (CPAs) in the cryopreservation of biological samples [25–31]. In this review,
we discuss the biophysical and biochemical aspects of marine-derived AFPs as well as investigate past
and current research of the practical applications of AFPs in cryopreservation. We also describe the
possible role of AFPs in cryopreservation.
Figure 1. Structural diversity of AFPs: (A) core unit structure of antifreeze glycoproteins (AFGPs);
(B) Type I HPLC6 AFP structure; (C) Type I ss3 AFP structure; (D) the structure of AFP Maxi from
winter flounder, Pseudopleuronectes americanus; (E) calcium-dependent type II AFP structure; (F) Type III
HPLC12 AFP structure; (G) the structure of MpAFP from Marinomonas primoryensis; (H) the structure
of LeIBP from Glaciozyma sp. AY30; (I) the structure of TisAFP8 from Typhula ishikariensis; (J) the
structure of FfIBP from Flavobacterium frigoris PS I; and (K) the structure of ColAFP from Colwellia sp.
strain SLW05.
2. AFP Properties: Thermal Hysteresis (TH), Ice Recrystallization Inhibition (IRI), and Interaction
with Biological Membranes
Generally, AFPs can be characterized based on two properties: TH and IRI. However, interaction
of AFPs with membranes should not be ruled out. In this section, the unique features of AFPs and their
contribution to cryopreservation are discussed briefly (for more an in-depth biophysical discussion on
these properties, refer to recent reviews [32,33]).
TH refers to the difference between melting and freezing points of a solution. In AFP-containing
solution, the temperature gap can be created by irreversible binding of AFPs to ice crystals and
subsequent inhibition of their growth until the temperature decreases to the non-equilibrium freezing
point [32,34–39]. Below the non-equilibrium freezing point, the burst of the ice crystal can be observed
(Figure 2A). During the TH gap, AFPs bind to the specific planes of ice crystals, shaping a unique
ice morphology. For example, type I AFPs bind to the prism plane of ice and creates a hexagonal
273
Mar. Drugs 2017, 15, 27
bipyramidal shape [35,40], whereas hyperactive FfIBP binds to prism and basal planes and generates
a lemon shape [41]. Moderately active AFPs bind to prism and/or pyramidal planes [40,42,43],
whereas hyperactive AFPs are able to bind to the basal plane of ice crystals [42,44]. The ice morphology
shaped by AFPs is a hallmark of binding of AFPs to ice (inset of Figure 2A) [20]. TH has been
used to describe the activity of AFPs quantitatively. For most fish AFPs, the observed TH activity
is approximately 1 ◦ C [20,45]. This temperature gap provides enough cushion against seawater
during the winter season (−1.9 ◦ C) for polar fish to survive in cold environments. In addition to fish
AFPs, many marine AFPs are associated with sea ice [7,13,14,16,21,23,46]. Unlike the blood plasma of
polar fish, seawater in brine channels in sea ice undergoes freezing to ice. Hence, AFPs from sea-ice
associated bacteria, microalgae, and eukaryotic protists are secreted into the surrounding environment
to protect themselves from freezing, and some of them are hyperactive (Figure 2B) [7,21,41].
ȱ
(A)
ȱ
(B)
Figure 2. (A) Cartoon illustration of TH phenomenon. In the left panel, the ice starts to grow rapidly as
temperature drops. However, as shown in the right panel, AFPs adsorb irreversibly on to the specific
planes of ice surface, inhibiting the further growth of ice until the temperature reaches nonequilibrium
freezing point. This adsorption-inhibition mechanism by AFPs separates melting and freezing points of
solution. The inset shows the bipyramidal and lemon ice morphologies created by moderately active
type I AFP (left) and hyperactive FfIBP (right), respectively; (B) Comparison of TH activities of AFPs from
various organisms. TH activity of marine-derived FfIBP (from Flavobacterium frigoris), and type I-Hyp
(from Pseudopleuronectes americanus) are comparable to hyperactive insect and fungal AFPs, TmAFP and
TisAFP, respectively, of non-marine origin. Other marine AFPs are moderately. Abbreviations are as
follows: TmAFP, Tenebrio molitor AFP; TisAFP, Thyphula ishikariensis AFP; FcAFP, Fragilariopsis cylindrus
AFP; and LeIBP, Glaciozyma (formerly known as Leucosporidium) sp. IBP.
274
Mar. Drugs 2017, 15, 27
The second function of AFPs, which may be more useful for cryopreservation, is IRI.
Ice recrystallization (IR), as depicted in Figure 3, explains a thermodynamically favorable process in
which the formation of larger ice grains takes place at the expense of smaller ones with a high internal
energy [47,48]. Eventually, the larger ice crystals formed because of this phenomenon can be fatal to the
cryopreserved cells as well as the organisms inhabiting polar or cold regions [49,50]. Fortunately for
these organisms, AFPs can inhibit IR at very low concentrations. The AFP-dependent IRI mechanism
remains to be elucidated; however, similar to TH activity, IRI is attributed to the binding of AFPs
to ice [5,45,51]. AFPs at the interface between the grain boundaries bind to the surface of ice grains
and inhibit the growth process [50]. The IRI is more likely to be a key property for cold-tolerant
organisms to survive in extremely cold environments [47,52–55]. To this end, IRI is eventually thought
to defend membranes against freezing injury [27–31,56,57]. IRI activity was first analyzed using
a splat cooling assay developed by Knight [58]. In splat assays, a small droplet of a solution is
expelled from a height of 2 m onto a very cold (−70 ◦ C) metal plate and freezes instantaneously as
a polycrystalline wafer. The ice is then annealed at −6 ◦ C over a certain period of time, allowing ice
recrystallization to occur. Modified methods have been proposed wherein the ice grains are generated
from a few-microliter sample placed between coverslips by flash freezing [54,55] or where the sample
inside 10 µL glass capillary undergoes freezing and annealing [59]. However, the IRI result was only
semi-quantitatively reported by presenting the IRI endpoint, expressed as mg/mL or µM, where IRI is
no longer observed [54,55,58,59]. To assess IRI activity quantitatively, Jackman et al. employed domain
recognition software to measure and report the mean grain size (MGS) of the 10 largest ice crystals
after the annealing period [60]. This method displayed percent MGS as a function of AFP relative to
the control. Very recently, Voets’ group adopted an automated image analysis using the circle Hough
transform (CHT) algorithm with a modified splat assay [55] to quantitatively evaluate IRI [61,62].
The CHT is a basic technique for detecting circular objects in a digital image. They attempted to include
all ice crystal images instead of only the 10 largest ice crystals in the calculation, which obviously
makes the quantitative evaluation of IR kinetics more statistically significant. In this method, the
inflection point of the kinetic curve was presented as an IRI endpoint.
ȱ
Figure 3. Results of ice recrystallization inhibition (IRI) assay using modified splat assay. In this assay,
AFP containing solution was mixed with 30% sucrose in a 1:1 ratio. The mixed solution was spotted
between two coverslips and flash frozen. Then, the sample was placed at −6 ◦ C stage and the changes
were observed over a specific period of time-in this case 30 min. As in upper panel, larger ice grains
grow as expense of smaller ice crystals, while the growth was halted in lower panel in the presence of
AFPs. All subfigures are drawn in the same scale.
Both TH and IRI properties are based on the affinity of AFPs for ice. Intriguingly, however, TH activity
is not always proportional to IRI activity (Figure 4), which remains to be elucidated [63]. In the comparison
of TH and IRI activities of hyperactive insect, bacterial, and fish AFPs with moderately active fish AFPs,
275
Mar. Drugs 2017, 15, 27
Yu et al. reported that the TH hyperactivity of AFPs was not reflected in their IRI activity [63]. This was
corroborated by other marine-derived AFPs, i.e., LeIBP and FfIBP [7,10,41,44,64]. Olijve et al. also
demonstrated that type III AFP and its mutant showed different TH values but almost the same IRI
activity [61]. The hyperactive FfIBP showed less activity in IRI, compared to the moderately active
LeIBP [7,44]. These results implied that TH activity was not necessarily translated into improvements
in the cryopreservation efficiency of biological samples [65–69]. Therefore, the utilization of AFPs in
cryopreservation cannot be considered from their TH activity only.
Figure 4. A graph of TH and IRI activities of marine-derived AFPs. TH values, represented as a bar,
are from Figure 2B. The IRI activities (O) are expressed as the reciprocal of endpoint of each AFP.
The endpoint indicates the lowest concentration at which the AFP shows IRI activity. Higher IRI value
means more effective in IRI. The LeIBP is weaker in TH but higher in IRI activity, but vice versa in
FfIBP. This plot demonstrates that the TH values are not proportional to IRI activities.
Along with the IRI feature, the interaction of AFPs with membranes (or proteins in membranes)
also may also ameliorate the cryoinjury of cells. In the early study of Rubinsky and his colleagues,
fish AFPs were found to protect cell membranes during hypothermic storage [70]. As membranes are
cooled to low temperatures, one mechanism of injury is often thermotropic phase transition partly
due to weakened hydrophobic interactions [71–75]. During the transition from liquid crystalline to gel
phase, membranes become leaky, resulting in the loss of intracellular contents [76]. It is not entirely
clear what causes leakage during the phase transition; however, this process may be related to defects
in packing of the hydrocarbon chains during the coexistence of gel and liquid crystalline domains [71].
Since the phase transition temperature of each lipid depends on the degree of unsaturation of
lipid tails and the number of carbons in the lipid alkane chains, model membranes with diverse
compositions, such as dielaidoylphosphatidylcholine (DEPC), dielaidoylphos-phatidylethanolamine
(DEPE), and dielaidoylphosphatidylglycerol (DEPG), have been used in order to better understand the
nature of the interactions between AFPs and cell membranes [72,73,75,77–82]. The results showed that
these interactions were lipid specific, i.e., the lipid composition of the bilayer dictates whether or not a
certain AFP or antifreeze glycoprotein (AFGP) will protect/interact with the membranes [61,62,64–69].
Other reports have indicated that the cryoprotective effects of AFPs arose from their interaction with
membrane proteins, such as potassium and calcium ion channels [83–86]. However, in some cases,
the addition of AFPs in cryopreservation medium induces leakage from cryopreserved cells [87–95].
These results implied that protection against freezing damage by AFPs depends on the type of
membrane and the type of AFP [80,96].
276
Mar. Drugs 2017, 15, 27
3. Marine-Derived AFPs
3.1. Fish AFPs
Two scientists, Scholander and DeVries, first observed that some fish inhabiting the polar
oceans could survive in cold water that occasionally reached sub-zero temperatures [1,3,97].
Following this observation, they attempted to elucidate how these fish could survive in icy water,
reaching temperatures below the freezing point of fish blood. When cooling was increased even
further, they observed that the growth of ice crystals was sluggish and delayed due to the presence
of glycoproteins that depress the noncolligative freezing point of solutions [98]. These proteins were
designated AFGPs [3]. Thereafter, nonglycosylated AFPs (type I AFPs) were found in the winter
flounder, Pseudopleuronectes americanus [99]. In addition, several types of AFPs have been discovered
and classified within distinct groups (classified into types I, II, III, and IV) in the Arctic and Antarctic
regions. Even though the AFP types are fundamentally different in terms of their primary sequences
and three-dimensional structures, they all have equivalent properties allowing them to bind to ice and
depress the freezing point of the solutions. Moreover, these different types of AFPs do not seem to
share any common ancestor genes.
AFGPs contain a three amino-acid (Ala-Ala-Thr) repeating sequence motif with a disaccharide
connected to the hydroxyl group of the threonine residue [100]. However, there are sequence
variations at the first residue position; sometimes, the first Ala residue is replaced by a Pro,
Thr, or Arg. There are eight AFGPs (AFGP1-8), named according to the number of repeating
units. AFGP1 has about 50 repeating units and therefore the highest molecular weight (33.7 kDa),
whereas AFGP8 has the lowest molecular weight (2.6 kDa), with only four repeating units.
Typically, the antifreeze activities of AFGPs are proportional to the number of repeating units.
It is thought that high-molecular-weight AFGPs cover a wider ice surface and inhibit ice growth
more efficiently than smaller AFGPs [47,101–104]. Recent studies have also shown that carbohydrate
moieties are important for AFGP activity. Structural studies using nuclear magnetic resonance (NMR)
have revealed that carbohydrate moieties and Ala residues are located on opposite sides. This feature
confers AFGPs with a helical shape and amphipathic characteristics. Consequently, AFGPs show
strong recrystallization properties. However, there are several limitations regarding their commercial
utilization toward cryopreservation. Natural polar fish sources are not sufficient to prepare large
quantities of AFGPs, and chemical synthesis is difficult to establish in large-scale mass production
systems. In contrast, AFPs can be prepared in large quantities by recombinant protein expression
techniques. For that reason, AFPs have been more broadly used for application studies than AFGPs.
This review focuses on marine AFPs used for cryopreservation applications.
3.1.1. Type I AFPs
Type I AFPs are found in many flounders and sculpins. Type I AFP HPLC6 from winter flounder
has been the most extensively studied. This protein possesses 37 amino acids and its sequences
are composed of 11 amino acid repeating units [20,105]. Moreover, this protein also has a high Ala
residue content, making up 23 of 37 residues. The molecular structure of HPLC6 (PDB code 1WFA)
was determined using the X-ray crystallography, which showed that HPLC6 AFP is an α-helical
protein with amphipathic characteristics. Another type I AFP has been isolated from the shorthorn
sculpin (Myoxocephalus Scorpius; ss3 AFP), also displaying a high Ala content (21 Ala residues among
a total of 33 residues). The structure of the ss3 AFP (PDB code 1Y03) was determined by NMR
spectroscopy. The overall structure of ss3 AFP is similar to that of HPLC6 AFP; however, ss3 AFP
contains a Pro residue at position 4, inducing a helix kink. Recently, the four-repeat containing
isoform AFP9 and a much larger type I AFP (a 195-residue protein, AFP Maxi) were discovered in
winter flounder (Pseudopleuronectes americanus). These two proteins exhibit significantly higher TH
activities than HPLC6 AFP. Moreover, the increased size of the AFP may induce higher antifreeze
activity by facilitating binding to multiple ice crystals and increasing coverage of the ice surface.
277
Mar. Drugs 2017, 15, 27
Furthermore, analysis of the AFP Maxi structure (PDB code 4KE2) revealed that this protein folds into a
dimeric four-helix bundle and that its ordered water may be involved in ice binding, thereby enhancing
its antifreeze activity.
The ice-binding mechanism of type I AFP was previously investigated through an ice-etching
experiment, which is used to identify AFP binding sites. A simple crystal growth and etching technique
allows the identification of the crystallographic planes where the binding occurs [40]. Furthermore,
ice etching has also been used to identify the ice-binding planes of AFPs and enhanced green
fluorescent protein (EGFP) fusion constructs allow their clear visualization. In 1991, Knight et al.
reported that type I AFPs from winter flounder (Pseudopleuronectes americanus) and Alaskan plaice
(Pleuronectes quadritaberulatus) adsorb onto the {2 0 −2 1} pyramidal planes of ice, whereas the sculpin
(Myoxocephalus scorpius) AFP adsorbs onto {2 −1 −1 0}, the secondary prism planes [40]. This finding
suggests that each type I AFP has a unique ice-binding mechanism depending on its sequence
length and composition. Moreover, ice-binding sites of type I AFPs were analyzed by site-directed
mutagenesis, truncated variants, and molecular docking studies [106–111]. Currently, it is generally
accepted that ice-binding sites of type I AFPs are located on their Ala-rich hydrophobic faces.
3.1.2. Type II AFPs
Type II AFPs are found in sea raven, smelt, herring, and long snout poacher. Type II AFPs are
globular cysteine-rich fish AFPs with molecular weights ranging from 11 to 24 kDa. The overall
structure of type II AFPs shows numerous similarities with C-type lectin-like domains (CTLDs).
Type II AFPs have two α-helices and nine β-strands with specific cysteines forming disulfide bonds.
Those disulfide bonds are known for their capacity to increase the structural stability of type II
AFPs [112–116]. Structural comparison studies between various groups of type II AFPs showed that
even if their amino acid sequence similarity is low, overall, their structures are similar, and they
display the same functions. These results indicate that type II AFPs evolved from the backbones of
CTLDs [117].
Type II AFPs are distinguished by their dependence on calcium ions to enable their antifreeze
activities. Herring and two types of smelts produce Ca2+ -dependent type II AFPs. Herring type II AFP
(hAFP) has close structural similarities with lithostathine (PDB code: 1qdd; root mean square deviation
[RMSD] = 1.7 Å for 122 Cα atoms) and mannose-binding protein (PDB code: 1sl6; RMSD = 2.2 Å
for 124 Cα atoms). However, these two proteins have no ice-binding activities. Likewise, hAFP has
no carbohydrate-binding activity. Thus, this high similarity in carbon backbone structure along
with different activities indicates a divergent evolutionary pattern. Another difference between
hAFP and C-type lectin protein is the number of cysteine bonds. hAFP has five disulfide bonds,
whereas C-type lectin only possesses three or four. Thr96, Leu97, Thr98, and Thr115 residues are
important for ice-binding. Interestingly, all of these residues are located near the Ca2+ binding
site. Therefore, the results obtained from these investigations suggest that Ca2+ binding in hAFP
is critical for forming an ice-binding state structure and increasing ice-binding activity [115]. Sea raven
and long snout poacher produce Ca2+ -independent type II AFPs. Structural comparisons between
Ca2+ -dependent and -independent type II AFPs showed that several residues near the Ca2+ binding
site are different. Gln92, Asp94, Glu99, and Asn113 residues of hAFP are substituted with Lys95, Asn97,
Asp102, and Asp116 residues, respectively, in long snout poacher AFP (lpAFP). Through these studies,
the critical amino acids for Ca2+ binding were identified. These amino acids could be important
indicators allowing the distinction between Ca2+ -dependent and-independent type II AFPs [116].
Additionally, a type II AFP was found in Japanese smelt (Hypomesus nipponensis; HniAFP), which does
not inhabit polar regions, but instead is found in fresh waters in regions near the middle latitudes.
Interestingly, HniAFP can bind to Ca2+ , but its ice binding activity does not depend on this feature;
indeed, despite adding ethylenediaminetetraacetic acid (EDTA) to remove Ca2+ , its antifreeze activity
was not affected [118].
278
Mar. Drugs 2017, 15, 27
3.1.3. Type III AFPs
Type III AFPs are small globular proteins with an average molecular weight of 6.5 kDa, found
in Antarctic eelepout (Macrozoarces americanus) and wolf fish [119,120]. Type III AFPs can be divided
into two groups, quaternary-amino-ethyl (QAE) and sulfopropyl (SP) sephadex-binding isoforms,
based on both their sequence similarities and affinities for SP and QAEs [121]. QAEs can be further
categorized into QAE1 and QAE2 subgroups [122]. According to some studies, QAE1 isoforms
have higher TH activities than the QAE2 and SP isoforms. SP and QAE2 isoforms are incapable of
stopping ice growth [123,124]. The structures of type III AFPs have been extensively studied, and about
40 models have been solved and deposited in the protein data bank (http://www.rcsb.org/pdb/)
to date. Among these, the three-dimensional structure of HPLC12 AFP, belonging to the QAE1
subgroup, was the first to be determined, showing a globular β-sandwich consisting of two antiparallel
triple-stranded β-sheets [125–127]. Although type III AFPs are mainly composed of several loops, they
form stable structures through hydrophobic interactions and a number of hydrogen bonds at the center
of the structure. Type III AFPs were found to be active over a broad pH range (2–11), indicating that
the protein fold is stable even at extreme pH, which would normally cause protein denaturation [125].
Recent studies have shown that temperature treatment at 80 ◦ C and pressure treatment at 400 MPa
(duration of 1 min for both treatments) did not influence the IRI activity of type III AFPs [128].
Interestingly, sialic acid synthase (SAS) has a C-terminal antifreeze-like domain similar to that of
type III AFPs. However, these two homologous proteins have very different temperature-dependent
stabilities, activities, and backbone dynamics. While type III AFPs are mostly rigid, with a few residues
showing slow motions, SAS is remarkably flexible at low temperature [129,130]. These two proteins,
displaying different functions, may have evolved from a common structural ancestor.
The most widely accepted hypothesis to describe the mechanism through which type III AFPs
interact with ice crystals involves the Thr18 residue located on the flat surface; this residue is thought
to be responsible for the recognition and interaction with the primary prism planes of ice. AFPs cover
water-accessible ice surfaces, thereby inhibiting ice growth. Several reports have shown that putative
ice-binding residues (Gln9, Asn14, Thr15, Ala16, Thr18, and Gln44) are capable of significantly altering
TH activity and ice crystal morphology [125,126,131,132]. Notably, the replacement of Thr18 by Asn
causes a significant loss of TH activity (90% loss). Computer simulation studies have emphasized
that hydrophobic interactions within ice-binding sites are also important for the antifreeze activity of
the protein [132,133]. When hydrophobic residues, such as Leu19, Val20, and Val41, were replaced
with Ala, a 20% loss in activity was observed. Double mutants (L19A/V41A and L10A/I13A) showed
more than 50% loss of activity compared with the activity of the wild-type protein [124]. Ice-etching
studies revealed a more complex ice-binding mechanism within type III AFPs, showing that they
could interact with both the primary prism and a pyramidal plane of ice [1]. While the QAE1 isoform
is able to bind both the primary prism and a pyramidal plane of ice, the SP and QAE2 isoforms can
only bind pyramidal ice planes [134]. Interestingly, a triple mutant of the inactive QAE2 isoform
(V9Q/V19L/G20V) is able to bind to the primary prism ice plane and shows full TH activity, similar to
the QAE1 isoform [135]. More recently, NMR experiments with inactive QAE2-like mutants containing
the V20G mutation were reported. These experiments showed that the mutants exhibited increased
conformational flexibility and were incapable of binding to the primary prism plane of ice crystals.
These results suggested that inactive type III AFPs may be unable to anchor water molecules via H-bond
interactions in the first 310 helix (residues 18–22) and therefore have no antifreeze activity [136].
Interestingly, two almost identical type III AFP domains tied by linker residues, designated RD3,
were found in nature in the Antarctic eelpout, Rhigophila dearborni [137–139]. RD3 possesses 5.9-fold
higher activity than a single domain in the range of 0 to 0.5 mM. This high activity at low concentrations
may be related to the need for much smaller concentrations of AFP for cryopreservation, as
mentioned below.
279
Mar. Drugs 2017, 15, 27
3.2. Fungal AFPs
To date, various mushrooms and Basidiomycetous psychrophilic yeast species have been screened
and reported to have antifreeze activities. Only two mushrooms (enoki and shiitake), one snow mold
fungus (Typhula ishikariensis), and two yeast organisms (Glaciozyma antarctica and Glaciozyma sp. AY30)
have been characterized both genomically and for their antifreeze properties [9,10,140,141].
Lee et al. were the first to report the antifreeze activity of a protein isolated from the psychrophilic
yeast Glaciozyma sp. AY30, itself isolated from an ice core sample of a freshwater pond near the
Dasan station, Ny-Ålesund, Svalbard archipelago, Norway, and named LeIBP [10]. LeIBP contains a
right-handed β-helical structure, which provides the advantage of a broad-range interaction surface
for ice binding [44,64]. The ice-binding site of LeIBP was determined to be a B-face using site-directed
mutagenesis experiments [64]. Moreover, the codon-optimized LeIBP (pLeIBP) was constructed and
subjected to high-level expression in the Pichia pastoris system [142]. In pilot-scale fermentation (700 L),
pLeIBP was secreted into culture medium, and the yield was 300 mg/L. The TH activity of pLeIBP
was about 0.42 ◦ C, which was similar to that of LeIBP expressed in E. coli. The availability of large
quantities of pLeIBP allowed us to use this protein in further application studies [65–67,143–145].
Snow mold fungus (Typhula ishikariensis) secretes seven antifreeze protein isoforms composing
the TisAFPs [141]. Among them, the structures of TisAFP6 (PDB code 3VN3) and TisAFP8 (PDB
code 5B5H) were determined and their antifreeze mechanisms were characterized [146]. The results
suggested that TisAFP8 has a more adapted shape and higher hydrophobicity to allow ice binding than
TisAFP6, which may possess a higher TH activity. Notably, the overall structures of LeIBP (PDB code
3UYU), TisAFP6, and TisAFP8 are very similar, with RMSD values within 0.73 Å when superimposed.
Glaciozyma antarctica AFP (Afp1), described by Hashim et al., possesses both TH and RI activities
and shows 30% sequence similarity with TisAFPs [12]. Amino-acid sequence analysis showed that
Afp1 contains four α-helices. Shah et al. confirmed the antifreeze activity of each helical peptide [22].
In addition, the NMR structures of the peptides were determined and the ice-binding model was
generated using a molecular dynamics method. The results indicated that the Afp1 peptides work like
type I AFPs. In 2014, another Glaciozyma antarctica AFP (Afp4) was identified and characterized [147].
The Afp4 sequence shows the highest amino acid similarity (93%) to LeIBP. A recombinant Afp4
protein changed ice crystals into hexagonal shaped crystals and showed a TH value of 0.8 ◦ C at a
protein concentration of 5 mg/mL.
3.3. Diatom AFPs
Studies aiming to identify new AFP genes from polar sea diatoms (Chaetoceros neogracile,
Berkeleya sp., Navicula sp., Fragilariopsis sp., and Nitzschia frustulum) have been performed, and further
gene expression studies have shown that the expression of AFP genes is regulated in response to stress
conditions, such as cold temperature and high salinity [16,17,23,24,148]. Thus, AFP genes may play
an important role in the environmental adaptation of diatoms. In 2009, Gwak et al. first produced
recombinant antifreeze protein (Cn-AFP) from a marine diatom, C. neogracile, and characterized its
antifreeze activity [15]. The TH value of the mature form of Cn-AFP is 0.8 ◦ C, whereas pre-mature
Cn-AFP has a 16-fold lower TH activity, indicating that the signal peptide induces improper folding of
Cn-AFP or masks the ice-binding site.
3.4. Bacterial AFPs
In 2004, Gilbert et al. published an interesting finding showing bacterial AFP screening results
obtained from Antarctic lake bacteria [149]. The authors managed to culture 866 bacterial isolates from
an Antarctic lake and found RI activity in 19 of these isolates. The first bacterial IBP gene (~25 kDa)
was identified, and the protein purified through ice affinity purification, in the sea ice gram-negative
bacterium Colwellia strain SLW05 [8]. In 2008, other bacterial IBPs (54 kDa) were isolated from a deep
Antarctic ice core of the subglacial Lake Vostok, at a depth of 3519 m (GenBank EU694412) [140].
280
Mar. Drugs 2017, 15, 27
The sequence of the protein is similar to those of IBPs previously found in sea ice habitats, even though
the protein is longer. In addition, uncharacterized proteins similar to IBPs were found in sea ice bacteria
Polaribacter irgensii (ZP_01118128; sequence identity: 61%, sequence similarity: 75%), Psychromonas
ingrahamii (ZP_01349469; sequence identity: 59%, sequence similarity: 71%), and marine bacterium
Shewanella frididimarina (YP_749708; sequence identity: 52%, sequence similarity: 69%).
The first bacterial AFP structure was solved using a protein isolated from an Antarctic
lake bacterium (Marinomonas primoryensis; MpAFP) [150]. MpAFP is a 1.5-MDa protein with
calcium-dependent antifreeze activity [6]. The solved MpAFP structure (PDB code 3P4G) shows
a calcium-bound β-helical fold and bound water molecules, which fit well onto the ice crystal lattice.
Therefore, this structure may explain the anchored clathrate mechanism of AFPs when binding to ice.
Recently, another IBP (FfIBP) from the Antarctic bacterium F. frigoris PS1 was identified from sea ice
on the shore of McMurdo Sound (GenBank accession no. AHKF00000000.1) and characterized [41,151].
FfIBP shares 56% sequence similarity with LeIBP, but displays an antifreeze activity that is up to 10-fold
higher than that of LeIBP. Structural and functional characterization of FfIBP revealed that this protein
displays regular motifs (T-A/G-X-T/N motif) and more regularly aligned ice-binding residues on its
IBS than LeIBP [7]. These structural differences may confer FfIBP with higher TH activity.
In 2014, structural and biochemical data on an AFP from Colwellia sp. strain SLW05 (ColAFP)
were published [21]. Interestingly, the ColAFP structure is similar to those of LeIBP, TisAFP, and FfIBP,
displaying a β-helical structure. In addition, the alignment of sequences and phylogenetic trees
of the bacterial AFPs with those of other AFPs and IBPs suggests that eukaryotic IBPs could have
been acquired from bacteria by horizontal gene transfer (HGT) [151]. One theory in favor of HGT
is “restricted occurrence”, which suggests that the same small set of organisms can be found in
different locations [152]. IBPs seem to satisfy this criterion because hundreds of organisms have IBPs
or IBP-like genes. Another potential explanation involves virus-mediated transformation of IBP genes.
For example, Arctic cryoconite holes are built on snow, glaciers, or ice caps where viruses are abundant;
these viruses are able to infect a broad range of bacterial species and other organisms, suggesting that
viruses in the environment may play a role in the exchange of genetic material [153].
Furthermore, a new bacterial AFP [154] with high IRI activity [155] was reported very recently.
Metagenomic sequencing of the Antarctic psychrophilic marine ciliate Euplotes focardii revealed two
sequences encoding IBPs, designated as EFsymbAFP and EFsymbIBP, obtained from its putative
bacterial symbiont [154,155]. These IBPs seem to be structurally similar to TisIBP, LeIBP, and FfIBP [154].
Of these, N-terminal 23 residue-deleted EFsymbAFP was recombinantly expressed in E. coli and
characterized [155]. Its TH activity was 0.53 ◦ C at 50 μM, but its IRI activity was in the nanomolar
range, as determined by Voets method. This value is the lowest observed to date. The recombinant
protein also effectively protected bacterial cells from freezing damage. Further investigations of this
IBP will provide more insight into the relationships among IRI and TH and the evolution of IBP.
4. Cryopreservation Using AFPs as a Potential Cryoprotectants (CPAs)
4.1. Cryopreservation and Ice Recrystallization
Cryopreservation is an important technique used to store various types of cells, tissues, and organs
at very low temperature, usually in liquid nitrogen (−196 ◦ C) [156], and has become crucial
in cell biology and regenerative medicine [157,158]. However, cells are not always viable after
thawing [145,159]. The freezing and thawing process during cryopreservation causes cryo-injury to
cells (Figure 5). Currently, two methods, i.e., slow-freezing [156] and vitrification [160], are commonly
adopted in cryopreservation. Prior to addressing the role of AFPs in cryopreservation, we will discuss
the association of cryo-injury with freezing with regard to methods other than decreased temperature.
During the slow-freezing process, since the solute concentration inside a cell is higher than that in
the medium, the cell is supercooled and ice forms extracellularly [156]. The growth of extracellular
ice leaves the unfrozen fraction highly concentrated with salt, leading to dehydration of the cell and
281
Mar. Drugs 2017, 15, 27
destabilization of cellular membranes simultaneously due to osmotic pressure. Incomplete dehydration
inside the cell allows intracellular ice formation, which is believed to be detrimental to cells.
Eventually the further growth of extracellular ice may cause rupture of the cell membrane. In addition,
recrystallization of intracellular and extracellular ice during the thawing process may further damage
the cryopreserved cells. Since cell-penetrating CPAs, such as dimethylsulfoxide (DMSO) and glycerol,
reduce ice formation by replacing water outside and within the cell as well as stabilize the membranes,
the addition of CPAs can increase the post-thaw viability of cryopreserved cells.
Vitrification is a process in which a liquid turns into an amorphous glass solid in the absence
of crystallization [160]. Vitrification of cells requires very high concentrations of CPAs and ultrafast
cooling rates to completely avoid fatal intracellular and extracellular ice formation [160,161]. In addition
to the osmotic stress and chemical toxicity caused by high CPA concentrations, however, vitrification is
also associated with ice recrystallization during thawing. In both cases, ice recrystallization during
thawing seems to be one of major cold damages. In this context, AFPs are believed to play a crucial role
in inhibiting ice recrystallization, improving the cryopreservation efficiency.
Figure 5. Schematic illustration of freezing rate and ice recrystallization during warming. In slow
freezing process, the extracellular ice starts to form below the equilibrium freezing point. Subsequently,
water is expelled from inside the cell by osmotic pressure, eventually eliminating the intracellular ice
formation. Fast freezing process, however, causes the intracellular ice formation since water cannot
leave the cell quickly. In ultrarapid cooling, such as vitrification process, theoretically no bulk ice will
form in the presence of higher concentration of CPAs. The ice formed during freezing will become
problematic, when the cryopreserved cells are thawed (or warmed). They start to grow bigger: a process
known as ice recrystallization. This process is fatal to the cells. Even in vitrification, ice can form during
the warming. Therefore, freezing rate should be optimized depending of cell type, CPAs used, etc.
The addition of AFPs in freezing media seems to alleviate the ice formation and recrystallization.
282
Mar. Drugs 2017, 15, 27
4.2. AFPs in Cryopreservation
The first application of marine AFPs to the protection of membranes at hypothermic temperatures
was made in 1990 using AFGP from Antarctic and Arctic fishes [83]. Since then, marine-derived AFPs have
been tested for cryopreservation on numerous occasions. Almost all reports of cryopreservation using
AFPs are summarized in Table 1. Of eight AFPs, including nonmarine insect DcAFP, as shown in Figure 6A,
type III AFP has been tested most in cryopreservation, followed by type I AFP, AFGP, and LeIBP. This is
because type III AFP is easy to produce recombinantly compared with other fish AFPs and because it has
been studied longer than other marine-derived AFPs, such as LeIBP and FfIBP. The results listed in Table 1
also showed that hyperactive AFPs do not always ensure better cryopreservation efficiency [65,66,145].
For example, moderately active LeIBP protects mouse ovarian tissue more effectively than 10-fold
hyperactive FfIBP [65]. The same result was obtained in human cell line cryopreservation (Hak Jun Kim,
unpublished result), consistent with the observation that hyperactive AFPs do not ensure increased IRI
activity (Figure 4) [63]. The AFP concentration used in cryopreservations was also determined empirically
(Table 1). The IRI endpoint, sometimes expressed as mg/mL, does not indicate the effective amount of
AFP in cryopreservation, and the solubility of AFPs and the molar concentration in the freezing medium
should also be considered [145]. Quite frequently, higher concentrations of AFPs lead to a decrease in the
post-thaw survival of cryopreserved cells, which may be due to the formation of destructive needle-like
ice at high AFP concentrations [65,66,68,69,92,162,163].
Cryopreserved biological samples are relatively diverse ranging from diatoms and reproductive cells
to embryos and organs (Figure 6B). Most cryopreserved biological samples originated from mammals.
Most cryopreservation trials using AFPs have demonstrated that the addition of AFPs could improve
post-thaw viability, regardless of the freezing method (slow-freezing or vitrification), storage temperature,
and biological sample, but several reports showed no beneficial effects [68,87–94,164,165].
(A)ȱ
(B)
Figure 6. Cryopreservation research using AFPs: (A) frequency of AFPs used in cryopreservation;
and (B) types and frequency of biological samples in cryopreservation using AFPs.
283
AFPs
Origin Species
of AFPs
Cryopreserved Biological Samples
Organisms
Sample Types
AFP Quantities Used
Freezing Methods
References
20 nL (final conc. 0.77 mg/mL) of 10
mg/mL type III AFP injected in yolk sac
0.23914 mm3 )
Vitrification
[166]
III
Fish
Turbot
(Scophthalmus maximus)
Embryos
I/III
Fish
Gilthead seabream
(Sparus aurata)
Sperm
1 µg/mL
Vitrification
[167]
I/III/AFGP
Fish
Bull
Sperm
0.1, 1, 10, and 100 µg/mL
Cryopreservation
[168]
LeIBP
Yeast
Boar
Sperm
0.01, 0.1, and 1 mg/mL
Cryopreservation
[169]
III
FfIBP
LeIBP
Fish
Bacteria
Yeast
Mouse
Ovarian tissue
0.1, 1, and 10 mg/mL
Vitrification
[65]
[170]
284
AFGP
Fish
Buffalo
Sperm
0.1, 1, and 10 µg/mL
Vitrification
III
Fish
Buffalo
Sperm
0.01, 0.1, 1, and 10 mg/mL
Cryopreservation
[171]
III
Fish
Bovine
Embryos
10 mg/mL
Hypothermic
[172]
AFGP
Fish
Pig
Oocyte
40 mg/mL
Hypothermic
[83]
I
II
III
Winter flounder
Sea raven
Eel pout
Bovine
Oocyte
20 mg/mL
Hypothermic
[70]
III
Notched-fin
eelpout
Human
HepG2
2–10 mg/mL
Hypothermic
[173]
10 mg/mL
Hypothermic
[174]
I/III/AFGP
Fish
Rat
RIN-5F cells
(insulinoma)
I
III
Winter flounder
Ocean pout
Sheep
Embryo
1 or 10 mg/mL
Hypothermic
[175]
0.1, 1, 10, and 100 µg/mL
100, 500, and 1000 µg/mL
Vitrification
[176]
III
Fish
Rabbit
Sperm
Embryo
III
Fish
Mouse
Oocyte
500 ng/mL
Vitrification
[177]
LeIBP
Yeast
Diatom
Diatom
0.1 mg/mL
Cryopreservation
[143]
AFGP
Fish
Carp
Spermatozoa
2–10 mg/mL
Hypothermic
[178]
I
III
Fish
Mouse
0.1 and 1.0 mg/mL
0.1 mg/mL
Vitrification
[92]
I/III
Fish
Sea bream
Pronuclear
embryos,
4-cell embryos
Spermatozoa
0.1, 1, and 10 µg/mL
Cryopreservation
[165]
AFGP
Fish
Equine
Embryos
20 mg/mL
Hypothermic/
Cryopreservation
[91]
DcAFP
Insect
Mouse
A10 smooth
muscle cell
1 µg/mL
Cryopreservation
[179]
Mar. Drugs 2017, 15, 27
Table 1. Lists of AFPs used in cryopreservation of biological samples.
AFPs
Origin Species
of AFPs
AFGP
Cryopreserved Biological Samples
285
AFP Quantities Used
Freezing Methods
References
Embryos
20 mg/mL
Vitrification
[180]
Mouse
Ovarian tissue
0, 5, and 20 mg/mL
Vitrification
[67]
Fish
Mouse
Mature oocyte
2.5 mg/mL
Vitrification
[181]
I
Fish
Rat
Hippocampal slice
cultures
10 mg/mL
Hypothermic
[182]
AFGP
Fish
Pig
Oocyte
40 mg/mL
Vitrification
[183]
AFGP
Fish
Mouse
Embryos
20 mg/mL
Vitrification
[183]
LeIBP
Yeast
Human
Red blood cells
0.4–0.8 mg/mL
Cryopreservation
[144]
III
Fish
Rat
Heart
3, 5, and 15 mg/mL
Hypothermic
[184]
AFGP
Fish
Rat
Cardiomyoctes
0.5–10 mg/mL
Hypothermic (−4
◦ C)
[162]
III
Fish
Mouse
Oocytes
500 ng/mL
Cryopreservation
[185]
AFGP
Fish
Rat
Cardiac
10 µg/mL, 10 and 15 mg/mL
Hypothermic
[164]
I/III
Fish
Zebra fish
Embryo
40 µg/mL
Hypothermic
[186]
NgIBP
Diatom
Human
Red blood cells
25, 50, and 77 µg/mL
Cryopreservation
[18]
I/III
Fish
Zebra fish
Embryo
40 µg/mL
Vitrification/
Cryopreservation
[187]
DcAFP
Insect
Centipede
Gut cells
0.02 mg/mL
Cryopreservation
[188]
III
Fish
Rat
Hearts
15 mg/mL
Hypothermic
[189]
AFGP
Fish
Mouse
Oocytes
1 mg/mL
Cryopreservation
[190]
I/III
Fish
Mouse
Blastocysts
0.1, 1.0 mg/mL
Cryopreservation
[191]
I/III/AFGP
Fish
Mouse
Spermatozoa
1–100 µg/mL
Cryopreservation
[192]
AFGP
Synthetic
Rat
Islet cell
500 µg/mL
Cryopreservation
[193]
Organisms
Sample Types
Gadus morhua
Mouse
III
Fish
III
I/II/III/AFGP
Fish
Mouse
Oocytes
20 mg/mL
Vitrification
[194]
I
Fish
Human
Myelogenous
leukemia cells
0~1000 µg/mL
Cryopreservation
[163]
III
Ocean pout
Chimpanzee
(Pan troglodytes)
Spermatozoa
1, 10, and 100 µg/mL
Cryopreservation
[195]
Mar. Drugs 2017, 15, 27
Table 1. Cont.
AFPs
Origin Species
of AFPs
I
Cryopreserved Biological Samples
AFP Quantities Used
Freezing Methods
Embryos
20 nL of 10 mg/mL type I AFP injected
Vitrification
[196]
Embryos
10 mg/mL
Hypothermic
[166]
Liver
1 mg/mL
Hypothermic
[94]
Hearts
10, 15, and 20 mg/mL
Hypothermic
[69]
0–1.54 mg/mL
Cryopreservation
[197]
5–160 µg/mL
Cryopreservation
[68]
0.1 mg/mL
0.05 mg/mL
0.1 mg/mL
Vitrification
[66]
Oocyte
0.5–1 µg/mL
Vitrification
[198]
Oocyte
1 mM (2.6 mg/mL)
Vitrification
[199]
Buffalo
Semen
0.1, 1.0, and 10 µg/mL
Cryopreservation
[200]
Human
Cell lines
0.1 mg/mL
Cryopreservation
[145]
Organisms
Sample Types
Fish
Seabream
III
Fish
Turbot
I
Fish
Rat
I/III
Fish
Rat
I/II/III
Fish
Human
Red blood cells
I
Fish
Human
Red blood cells
III
FfIBP
LeIBP
Eel pout
Bacteria
Yeast
Mouse
Oocyte
III
Eel pout
Bovine
AFGP8
Fish
Bovine
DcAFP
LeIBP
Beetle
Dendroides canadensis
Yeast
References
Mar. Drugs 2017, 15, 27
Table 1. Cont.
286
Mar. Drugs 2017, 15, 27
In the cryopreservation of cell lines, AFPs have been used as additives to conventional freezing
medium to reduce the high amount of cytotoxic CPAs and reduce freezing damage [31]. Some of the
cell types tested for cryopreservation with the addition of AFPs include sperms [167–171,176,178,200],
oocytes [66,70,83,177,181,183,185,190,198,199], human liver cells [173], RIN-5F insulin tumor cells [174],
diatoms [143], red blood cells [18,144,197], muscle cells [162,179], gut cell [188], islet cells [193],
E. coli [83], and human cell lines [145] including HeLa cells, NIH/3T3 cells, preosteoblasts (MC3T3-E1
cells), and human ketatinocytes (HaCaT cells). Thus, the addition of AFPs seems to mainly enhance
the cryopreservation efficiency regardless of cell type and freezing method, with a handful of
exceptions [68,89,90,162,164]. Notably, these exceptions appear to be related to the concentration
of AFPs used; indeed, at higher concentrations, AFPs form needle-like ice, which penetrates and
destroys cells during freezing [68,143–145,162,193,201]. The amount used in cryopreservation also
differs between AFPs. LeIBP, which shows lower TH activity, but higher IRI activity than fish AFPs
has been used in the range of 0.1–0.8 mg/mL in red blood cells [144], diatoms [143], oocytes [66],
and mammalian cell lines [145], whereas fish AFPs have been used at concentrations lower than
0.1 mg/mL, depending on the cell type (Table 1). Interestingly, in the vitrification of mouse oocytes,
0.05 mg/mL FfIBP is more effective at maintaining in murine oocyte quality and embryo development
than 0.1 mg/mL LeIBP and 0.1 mg/mL type III AFP [66]. Since the results obtained vary between
studies, the utilization of AFPs in cryopreservation needs fine-tuning depending on the type of AFPs,
cells, freezing media, and storage temperature.
Embryos from fish [166,186,187,196,202], cows [172,203], sheep [175], rabbits [176],
mice [67,92,183,191], and horses [91] were preserved in the presence of AFPs. Early attempts with equine
and mouse embryos demonstrated that fish AFPs had negligible effects [91,92]; however, fish embryos
subjected to microinjection or incubation in type I AFP solution showed significantly increased survival
after chilling at 4 ◦ C or −10 ◦ C. Vitrified 5-somite embryos in type I AFP solution showed similar
survival to that of cells recovered from unfrozen embryos [187]. Similarly, AFPs can help improve the
survival of embryos preserved at hypothermic temperatures [150,153,154]. These promising results
may fuel research in not only hypothermic storage but also vitrification of other embryos such as
mammalian embryos.
Lee and colleagues evaluated the beneficial effects of AFPs in vitrification of mouse ovarian
tissues [65,67]. Ovarian tissues treated with type III AFPs showed significantly higher intact follicle
ratios and lower apoptotic follicle rates than control tissues. The transplanted vitrified-warmed ovaries
showed higher intact follicle ratios [65]. In another attempt, all AFP-treated groups had significantly
improved follicle preservation with decreasing efficiency in the order of LeIBP > FfIBP > type III
AFP [65].
Few studies have evaluated the potential use of AFPs in the hypothermic storage of
organs [94,164,184,204]. The TH activity of AFPs has been exploited for subzero preservation of
organs. As anticipated, the presence of AFPs decreases cold-induced injury during the hypothermic
storage of rat livers [204] and mammalian hearts [69,205] by decreasing the ice formation [189,204,206].
In contrast, Wang et al. reported that higher concentrations of AFGPs have adverse effects on heart
preservation [164].
5. Conclusions and Perspective
Thanks to their unique properties as biological antifreezes, AFPs have attracted interest from
researchers in academia and biomedical fields. In this review, we surveyed the past and current
trends in cryopreservation applications of AFPs. The first property of freezing point depression,
termed TH, has typically been utilized primarily in the hypothermic storage of tissues and organs.
Due to the complexity and size of tissues and organs, more advancement is needed to achieve effective
hypothermic storage of these biological materials. The ability to inhibit ice recrystallization is known
to neutralize the catastrophic large icy environment for the cryopreserved cells during freezing and/or
warming. The third and less characterized function of AFPs is the interaction with cellular membranes
287
Mar. Drugs 2017, 15, 27
and/or integral membrane proteins. It is not likely that these interactions themselves can confer the
cryopreserved cells with post-thaw viability. However, AFPs are thought to augment the viability or
cryopreservation efficiency of the cells together with the other two features, particularly IRI.
Our physicochemical understanding of unique binding of AFPs to ice crystal has been the
main focus of scientists within the last five decades [51,207]. Relatively few studies have evaluated
the application of AFPs in cryopreservation. This is mainly because AFPs are expensive to obtain.
Therefore, prior and current cryopreservation research has been limited only to moderately active fish
AFPs. Additionally, the applications of AFPs has still only partly characterized based on empirical
features, similar to other CPAs [31]. In other words, researchers still need to determine the optimal
working concentrations of AFPs in cryopreservation; neither TH nor IRI can provide this information.
For the application of AFPs to be practical, a few questions should be addressed.
First, mass production of AFPs should be established. Currently, only type III AFP has been produced
on the industrial scale owing to its use as an ingredient in ice cream. However, advancements
in molecular biology and genomics have improved our ability to produce genes and proteins
easily, expanding AFP-related research. Indeed, a mass production system for LeIBP, Glaciozyma
IBP, has been reported [142]. Additionally, the LeIBP has been shown to yield better post-thaw
viability in several studies compared with that of other marine-derived AFPs [65,66,143–145].
Second, the behaviors of AFPs in freezing medium should be characterized thoroughly. Typically,
freezing medium contains high concentrations of chemicals, such as DMSO, ethylene glycol,
polyvinylpyrrolidone, and polyethylene glycol, which may destabilize AFPs, leading to loss of
function [208]. Third, functionalized AFPs should be engineered and developed to overcome the
limitations of natural counterparts. Mother nature has suggested the use of RD3 and an IBP from Vostok
glacial bacterium [137,209]. In both cases, connecting two almost homologous domains increases the
TH value cooperatively compared with their monomeric AFPs [139,209]. Studies from the laboratories
of Tsuda, Davies, and Holland have demonstrated that the multimerization of native type III AFP
can increase TH activity [210–212]. Recently, Steven et al. claimed the dendrimer-like AFPs showed
higher TH values [213], and Phippen et al. demonstrated 12 AFP-fused protein cage nanoparticles
that increased the TH value to more than 50-fold that of monomeric AFP [214]. A few groups have
attempted to synthesize AFP or AFGP derivatives to elucidate the underlying mechanism of action
and to develop practical applications [215–221]. Another interesting approach is the development
of cell-internalizable or -penetrating AFPs. AFPs are usually nonpenetrating, such that the internal
ice formation should be inhibited by high amounts of cytotoxic CPAs. Cell-internalizable AFPs
may also reduce the amount of CPAs in freezing medium, eventually increasing the efficiency
of cryopreservation.
Finally, it is encouraging that many research groups studying AFP worldwide have started
expanding their research into cryopreservation using AFPs. We hope these concerted efforts will
accelerate the development of biomedical application of AFPs.
Acknowledgments: We thank the anonymous reviewers for their careful reading of our manuscript and their
insightful comments and suggestions. This work is supported by the Polar Genomics 101 Project: Genome analysis
of polar organisms and establishment of application platform (PE17080) funded by the Korea Polar Research
Institute (KOPRI), and National Fisheries Research and Development Institute (R2017013 to Y.B.H).
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
DeVries, A.L.; Wohlschlag, D.E. Freezing resistance in some Antarctic fishes. Science 1969, 163, 1073–1075.
[CrossRef] [PubMed]
DeVries, A.L.; Komatsu, S.K.; Feeney, R.E. Chemical and physical properties of freezing point-depressing
glycoproteins from Antarctic fishes. J. Biol. Chem. 1970, 245, 2901–2908. [PubMed]
DeVries, A.L. Glycoproteins as biological antifreeze agents in antarctic fishes. Science 1971, 172, 1152–1155.
[CrossRef] [PubMed]
288
Mar. Drugs 2017, 15, 27
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
DeVries, A.L. Freezing resistance in fishes of the Antarctic penninsula. Antarct. J. US 1969, 4, 104–105.
Davies, P.L. Ice-binding proteins: A remarkable diversity of structures for stopping and starting ice growth.
Trends Biochem. Sci. 2014, 39, 548–555. [CrossRef] [PubMed]
Gilbert, J.A.; Davies, P.L.; Laybourn-Parry, J. A hyperactive, Ca2+ -dependent antifreeze protein in an Antarctic
bacterium. FEMS Microbiol. Lett. 2005, 245, 67–72. [CrossRef] [PubMed]
Do, H.; Kim, S.J.; Kim, H.J.; Lee, J.H. Structure-based characterization and antifreeze properties of a
hyperactive ice-binding protein from the Antarctic bacterium Flavobacterium frigoris PS1. Acta Crystallogr. D
Biol. Crystallogr. 2014, 70, 1061–1073. [CrossRef] [PubMed]
Raymond, J.A.; Fritsen, C.; Shen, K. An ice-binding protein from an Antarctic sea ice bacterium.
FEMS Microbiol. Ecol. 2007, 61, 214–221. [CrossRef] [PubMed]
Singh, P.; Hanada, Y.; Singh, S.M.; Tsuda, S. Antifreeze protein activity in Arctic cryoconite bacteria.
FEMS Microbiol. Lett. 2014, 351, 14–22. [CrossRef] [PubMed]
Lee, J.K.; Park, K.S.; Park, S.; Park, H.; Song, Y.H.; Kang, S.H.; Kim, H.J. An extracellular ice-binding
glycoprotein from an Arctic psychrophilic yeast. Cryobiology 2010, 60, 222–228. [CrossRef] [PubMed]
Boo, S.Y.; Wong, C.M.V.L.; Rodrigues, K.F.; Najimudin, N.; Murad, A.M.A.; Mahadi, N.M. Thermal stress
responses in Antarctic yeast, Glaciozyma antarctica PI12, characterized by real-time quantitative PCR. Polar Biol.
2013, 36, 381–389. [CrossRef]
Hashim, N.H.; Bharudin, I.; Nguong, D.L.; Higa, S.; Bakar, F.D.; Nathan, S.; Rabu, A.; Kawahara, H.;
Illias, R.M.; Najimudin, N.; et al. Characterization of Afp1, an antifreeze protein from the psychrophilic yeast
Glaciozyma antarctica PI12. Extremophiles 2013, 17, 63–73. [CrossRef] [PubMed]
Kiko, R. Acquisition of freeze protection in a sea-ice crustacean through horizontal gene transfer? Polar Biol.
2010, 33, 543–556. [CrossRef]
Jung, W.; Gwak, Y.; Davies, P.L.; Kim, H.J.; Jin, E. Isolation and characterization of antifreeze proteins
from the antarctic marine microalga Pyramimonas gelidicola. Mar. Biotechnol. 2014, 16, 502–512. [CrossRef]
[PubMed]
Gwak, I.G.; Jung, W.; Kim, H.J.; Kang, S.H.; Jin, E. Antifreeze protein in Antarctic marine diatom,
Chaetoceros neogracile. Mar. Biotechnol. 2009, 12, 630–639. [CrossRef] [PubMed]
Janech, M.; Krell, A.; Mock, T.; Kang, J.-S.; Raymond, J. Ice-binding proteins from sea ice diatoms
(bacillariophyceae). J. Phycol. 2006, 42, 410–416. [CrossRef]
Krell, A.; Beszteri, B.; Dieckmann, G.; Glöckner, G.; Valentin, K.; Mock, T. A new class of ice-binding
proteins discovered in a salt-stress-induced cDNA library of the psychrophilic diatom Fragilariopsis cylindrus
(Bacillariophyceae). Eur. J. Phycol. 2008, 43, 423–433. [CrossRef]
Kang, J.S.; Raymond, J.A. Reduction of freeze-thaw-induced hemolysis of red blood cells by an algal
ice-binding protein. Cryo Lett. 2004, 25, 307–310.
Raymond, J.A.; Janech, M.; Fritsen, C. Novel ice-binding proteins from a psychrophilic antarctic alga
(Chlamydomonadaceae, chlorophyceae). J. Phycol. 2009, 45, 130–136. [CrossRef] [PubMed]
Davies, P.L.; Hew, C.L. Biochemistry of fish antifreeze proteins. FASEB J. 1990, 4, 2460–2468. [PubMed]
Hanada, Y.; Nishimiya, Y.; Miura, A.; Tsuda, S.; Kondo, H. Hyperactive antifreeze protein from an Antarctic
sea ice bacterium Colwellia sp. has a compound ice-binding site without repetitive sequences. FEBS J. 2014,
281, 3576–3590. [CrossRef] [PubMed]
Shah, S.H.H.; Kar, R.K.; Asmawi, A.A.; Rahman, M.B.A.; Murad, A.M.A.; Mahadi, N.M.; Basri, M.;
Rahman, R.N.Z.A.; Salleh, A.B.; Chatterjee, S.; et al. Solution structures, dynamics, and ice growth inhibitory
activity of peptide fragments derived from an antarctic yeast protein. PLoS ONE 2012, 7, e49788. [CrossRef]
[PubMed]
Bayer-Giraldi, M.; Weikusat, I.; Besir, H.; Dieckmann, G. Characterization of an antifreeze protein from the
polar diatom Fragilariopsis cylindrus and its relevance in sea ice. Cryobiology 2011, 63, 210–219. [CrossRef]
[PubMed]
Uhlig, C.; Kabisch, J.; Palm, G.J.; Valentin, K.; Schweder, T.; Krell, A. Heterologous expression, refolding
and functional characterization of two antifreeze proteins from Fragilariopsis cylindrus (Bacillariophyceae).
Cryobiology 2011, 63, 220–228. [CrossRef] [PubMed]
Hew, C.L.; Davies, P.L.; Fletcher, G. Antifreeze protein gene transfer in Atlantic salmon. Mol. Mar.
Biol. Biotechnol. 1992, 1, 309–317. [PubMed]
289
Mar. Drugs 2017, 15, 27
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
Wohrmann, A.P. Antifreeze glycopeptides of the high-Antarctic silverfish Pleuragramma antarcticum
(Notothenioidei). Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol. 1995, 111, 121–129. [CrossRef]
Barrett, J. Thermal hysteresis proteins. Int. J. Biochem. Cell Biol. 2001, 33, 105–117. [CrossRef]
Ben, R.N. Antifreeze glycoproteins-preventing the growth of ice. Chembiochem 2001, 2, 161–166. [CrossRef]
Bouvet, V.; Ben, R.N. Antifreeze glycoproteins. Cell Biochem. Biophys. 2003, 39, 133–144. [CrossRef]
Harding, M.M.; Anderberg, P.I.; Haymet, A.D. “Antifreeze” glycoproteins from polar fish. Eur. J. Biochem.
2003, 270, 1381–1392. [CrossRef] [PubMed]
Fuller, B.J. Cryoprotectants: The essential antifreezes to protect life in the frozen state. Cryo Lett. 2004, 25,
375–388.
Kristiansen, E.; Zachariassen, K.E. The mechanism by which fish antifreeze proteins cause thermal hysteresis.
Cryobiology 2005, 51, 262–280. [CrossRef] [PubMed]
Bar Dolev, M.; Braslavsky, I.; Davies, P.L. Ice-binding proteins and their function. Annu. Rev. Biochem. 2016,
85, 515–542. [CrossRef] [PubMed]
Raymond, J.A.; DeVries, A.L. Freezing behavior of fish blood glycoproteins with antifreeze properties.
Cryobiology 1972, 9, 541–547. [CrossRef]
Raymond, J.A.; DeVries, A.L. Adsorption inhibition as a mechanism of freezing resistance in polar fishes.
Proc. Natl. Acad. Sci. USA 1977, 74, 2589–2593. [CrossRef] [PubMed]
Wilson, P.W.; Beaglehole, D.; Devries, A.L. Antifreeze glycopeptide adsorption on single crystal ice surfaces
using ellipsometry. Biophys. J. 1993, 64, 1878–1884. [CrossRef]
Wilson, P.W. Explaining thermal hysteresis by the Kelvin effect. Cryo Lett. 1993, 14, 31–36.
Wilson, P.W.; Leader, J.P. Stabilization of supercooled fluids by thermal hysteresis proteins. Biophys. J. 1995,
68, 2098–2107. [CrossRef]
Celik, Y.; Drori, R.; Pertaya-Braun, N.; Altan, A.; Barton, T.; Bar-Dolev, M.; Groisman, A.; Davies, P.L.;
Braslavsky, I. Microfluidic experiments reveal that antifreeze proteins bound to ice crystals suffice to prevent
their growth. Proc. Natl. Acad. Sci. USA 2013, 110, 1309–1314. [CrossRef] [PubMed]
Knight, C.A.; Cheng, C.C.; DeVries, A.L. Adsorption of alpha-helical antifreeze peptides on specific ice
crystal surface planes. Biophys. J. 1991, 59, 409–418. [CrossRef]
Do, H.; Lee, J.H.; Lee, S.G.; Kim, H.J. Crystallization and preliminary X-ray crystallographic analysis
of an ice-binding protein (FfIBP) from Flavobacterium frigoris PS1. Acta Crystallogr. Sect. F Struct. Biol.
Cryst. Commun. 2012, 68, 806–809. [CrossRef] [PubMed]
Drori, R.; Celik, Y.; Davies, P.L.; Braslavsky, I. Ice-binding proteins that accumulate on different ice crystal
planes produce distinct thermal hysteresis dynamics. J. R. Soc. Interface 2014, 11, 2014526. [CrossRef]
[PubMed]
Pertaya, N.; Marshall, C.B.; Celik, Y.; Davies, P.L.; Braslavsky, I. Direct visualization of spruce budworm
antifreeze protein interacting with ice crystals: Basal plane affinity confers hyperactivity. Biophys. J. 2008, 95,
333–341. [CrossRef] [PubMed]
Park, K.S.; Do, H.; Lee, J.H.; Park, S.I.; Kim, E.J.; Kim, S.J.; Kang, S.H.; Kim, H.J. Characterization of the
ice-binding protein from Arctic yeast Leucosporidium sp. AY30. Cryobiology 2012, 64, 286–296. [CrossRef]
[PubMed]
Fletcher, G.L.; Hew, C.L.; Davies, P.L. Antifreeze proteins of teleost fishes. Annu. Rev. Physiol. 2001, 63,
359–390. [CrossRef] [PubMed]
Jung, W.; Campbell, R.L.; Gwak, Y.; Kim, J.I.; Davies, P.L.; Jin, E. New cysteine-rich ice-binding protein
secreted from Antarctic microalga, Chloromonas sp. PLoS ONE 2016, 11, e0154056. [CrossRef] [PubMed]
Knight, C.A.; DeVries, A.L.; Oolman, L.D. Fish antifreeze protein and the freezing and recrystallization of ice.
Nature 1984, 308, 295–296. [CrossRef] [PubMed]
Knight, C.A.; Wen, D.; Laursen, R.A. Nonequilibrium antifreeze peptides and the recrystallization of ice.
Cryobiology 1995, 32, 23–34. [CrossRef] [PubMed]
Raymond, J.A.; Fritsen, C.H. Semipurification and ice recrystallization inhibition activity of ice-active
substances associated with Antarctic photosynthetic organisms. Cryobiology 2001, 43, 63–70. [CrossRef]
[PubMed]
Raymond, J.A.; Knight, C.A. Ice binding, recrystallization inhibition, and cryoprotective properties of
ice-active substances associated with Antarctic sea ice diatoms. Cryobiology 2003, 46, 174–181. [CrossRef]
290
Mar. Drugs 2017, 15, 27
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
Jia, Z.; Davies, P.L. Antifreeze proteins: An unusual receptor-ligand interaction. Trends Biochem. Sci. 2002, 27,
101–106. [CrossRef]
Knight, C.A.; Duman, J.G. Inhibition of recrystallization of ice by insect thermal hysteresis proteins:
A possible cryoprotective role. Cryobiology 1986, 23, 256–262. [CrossRef]
Worrall, D.; Elias, L.; Ashford, D.; Smallwood, M.; Sidebottom, C.; Lillford, P.; Telford, J.; Holt, C.; Bowles, D.
A carrot leucine-rich-repeat protein that inhibits ice recrystallization. Science 1998, 282, 115–117. [CrossRef]
[PubMed]
Smallwood, M.; Worrall, D.; Byass, L.; Elias, L.; Ashford, D.; Doucet, C.J.; Holt, C.; Telford, J.; Lillford, P.;
Bowles, D.J. Isolation and characterization of a novel antifreeze protein from carrot (Daucus carota). Biochem. J.
1999, 340, 385–391. [CrossRef] [PubMed]
Sidebottom, C.; Buckley, S.; Pudney, P.; Twigg, S.; Jarman, C.; Holt, C.; Telford, J.; McArthur, A.; Worrall, D.;
Hubbard, R.; et al. Heat-stable antifreeze protein from grass. Nature 2000, 406, 256. [CrossRef] [PubMed]
Hew, C.L.; Yang, D.S. Protein interaction with ice. Eur. J. Biochem. 1992, 203, 33–42. [CrossRef] [PubMed]
Wohrmann, A. Antifreeze glycoproteins in fishes: Structure, mode of action and possible applications.
Tierarztl. Prax. 1996, 24, 1–9. [PubMed]
Knight, C.A.; Hallett, J.; DeVries, A.L. Solute effects on ice recrystallization: An assessment technique.
Cryobiology 1988, 25, 55–60. [CrossRef]
Tomczak, M.M.; Marshall, C.B.; Gilbert, J.A.; Davies, P.L. A facile method for determining ice recrystallization
inhibition by antifreeze proteins. Biochem. Biophys. Res. Commun. 2003, 311, 1041–1046. [CrossRef] [PubMed]
Jackman, J.; Noestheden, M.; Moffat, D.; Pezacki, J.P.; Findlay, S.; Ben, R.N. Assessing antifreeze activity of
AFGP 8 using domain recognition software. Biochem. Biophys. Res. Commun. 2007, 354, 340–344. [CrossRef]
[PubMed]
Olijve, L.L.C.; Oude Vrielink, A.S.; Voets, I.K. A simple and quantitative method to evaluate ice
recrystallization kinetics using the circle Hough Transform algorithm. Cryst. Growth Des. 2016, 16, 4190–4195.
[CrossRef]
Olijve, L.L.C.; Meister, K.; DeVries, A.L.; Duman, J.G.; Guo, S.; Bakker, H.J.; Voets, I.K. Blocking rapid ice
crystal growth through nonbasal plane adsorption of antifreeze proteins. Proc. Natl. Acad. Sci. USA 2016,
113, 3740–3745. [CrossRef] [PubMed]
Yu, S.O.; Brown, A.; Middleton, A.J.; Tomczak, M.M.; Walker, V.K.; Davies, P.L. Ice restructuring inhibition
activities in antifreeze proteins with distinct differences in thermal hysteresis. Cryobiology 2010, 61, 327–334.
[CrossRef] [PubMed]
Lee, J.H.; Park, A.K.; Do, H.; Park, K.S.; Moh, S.H.; Chi, Y.M.; Kim, H.J. Structural basis for the antifreeze
activity of an ice-binding protein from an Arctic yeast. J. Biol. Chem. 2012, 287, 11460–11468. [CrossRef]
[PubMed]
Lee, J.; Kim, S.K.; Youm, H.W.; Kim, H.J.; Lee, J.R.; Suh, C.S.; Kim, S.H. Effects of three different types
of antifreeze proteins on mouse ovarian tissue cryopreservation and transplantation. PLoS ONE 2015,
10, e0126252. [CrossRef] [PubMed]
Lee, H.H.; Lee, H.J.; Kim, H.J.; Lee, J.H.; Ko, Y.; Kim, S.M.; Lee, J.R.; Suh, C.S.; Kim, S.H. Effects of antifreeze
proteins on the vitrification of mouse oocytes: Comparison of three different antifreeze proteins. Hum. Reprod.
2015, 30, 2110–2119. [CrossRef] [PubMed]
Lee, J.R.; Youm, H.W.; Lee, H.J.; Jee, B.C.; Suh, C.S.; Kim, S.H. Effect of antifreeze protein on mouse ovarian
tissue cryopreservation and transplantation. Yonsei Med. J. 2015, 56, 778–784. [CrossRef] [PubMed]
Carpenter, J.F.; Hansen, T.N. Antifreeze protein modulates cell survival during cryopreservation:
Mediation through influence on ice crystal growth. Proc. Natl. Acad. Sci. USA 1992, 89, 8953–8957.
[CrossRef] [PubMed]
Amir, G.; Rubinsky, B.; Kassif, Y.; Horowitz, L.; Smolinsky, A.K.; Lavee, J. Preservation of myocyte structure
and mitochondrial integrity in subzero cryopreservation of mammalian hearts for transplantation using
antifreeze proteins-an electron microscopy study. Eur. J. Cardiothorac. Surg. 2003, 24, 292–297. [CrossRef]
Rubinsky, B.; Arav, A.; Fletcher, G.L. Hypothermic protection-a fundamental property of “antifreeze”
proteins. Biochem. Biophys. Res. Commun. 1991, 180, 566–571. [CrossRef]
Quinn, P.J. A lipid-phase separation model of low-temperature damage to biological membranes. Cryobiology
1985, 22, 128–146. [CrossRef]
291
Mar. Drugs 2017, 15, 27
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
92.
93.
94.
Hays, L.M.; Feeney, R.E.; Crowe, L.M.; Crowe, J.H.; Oliver, A.E. Antifreeze glycoproteins inhibit leakage
from liposomes during thermotropic phase transitions. Proc. Natl. Acad. Sci. USA 1996, 93, 6835–6840.
[CrossRef] [PubMed]
Tomczak, M.M.; Hincha, D.K.; Estrada, S.D.; Wolkers, W.F.; Crowe, L.M.; Feeney, R.E.; Tablin, F.; Crowe, J.H.
A mechanism for stabilization of membranes at low temperatures by an antifreeze protein. Biophys. J. 2002,
82, 874–881. [CrossRef]
Tomczak, M.M.; Vigh, L.; Meyer, J.D.; Manning, M.C.; Hincha, D.K.; Crowe, J.H. Lipid unsaturation
determines the interaction of AFP type I with model membranes during thermotropic phase transitions.
Cryobiology 2002, 45, 135–142. [CrossRef]
Tablin, F.; Oliver, A.E.; Walker, N.J.; Crowe, L.M.; Crowe, J.H. Membrane phase transition of intact human
platelets: Correlation with cold-induced activation. J. Cell. Physiol. 1996, 168, 305–313. [CrossRef]
Crowe, J.H.; Crowe, L.M. Water and carbohydrate interactions with membranes: Studies with infrared
spectroscopy and differential scanning calorimetry methods. Methods Enzymol. 1986, 127, 696–703. [PubMed]
Hays, L.M.; Crowe, J.H.; Wolkers, W.; Rudenko, S. Factors affecting leakage of trapped solutes from
phospholipid vesicles during thermotropic phase transitions. Cryobiology 2001, 42, 88–102. [CrossRef]
[PubMed]
Tomczak, M.M.; Hincha, D.K.; Estrada, S.D.; Feeney, R.E.; Crowe, J.H. Antifreeze proteins differentially affect
model membranes during freezing. Biochim. Biophys. Acta 2001, 1511, 255–263. [CrossRef]
Kun, H.; Byk, G.; Mastai, Y. Effects of antifreeze protein fragments on the properties of model membranes.
Adv. Exp. Med. Biol. 2009, 611, 85–86. [PubMed]
Wu, Y.; Fletcher, G.L. Efficacy of antifreeze protein types in protecting liposome membrane integrity depends
on phospholipid class. Biochim. Biophys. Acta 2001, 1524, 11–16. [CrossRef]
Kun, H.; Mastai, Y. Isothermal calorimetry study of the interactions of type I antifreeze proteins with a lipid
model membrane. Protein Pept. Lett. 2009, 17, 739–743. [CrossRef]
Tomczak, M.M.; Hincha, D.K.; Crowe, J.H.; Harding, M.M.; Haymet, A.D. The effect of hydrophobic
analogues of the type I winter flounder antifreeze protein on lipid bilayers. FEBS Lett. 2003, 551, 13–19.
[CrossRef]
Rubinsky, B.; Arav, A.; Mattioli, M.; Devries, A.L. The effect of antifreeze glycopeptides on membrane
potential changes at hypothermic temperatures. Biochem. Biophys. Res. Commun. 1990, 173, 1369–1374.
[CrossRef]
Negulescu, P.A.; Rubinsky, B.; Fletcher, G.L.; Machen, T.E. Fish antifreeze proteins block Ca entry into rabbit
parietal cells. Am. J. Physiol. 1992, 263, C1310–C1313. [PubMed]
Arav, A.; Rubinsky, B.; Seren, E.; Roche, J.F.; Boland, M.P. The role of thermal hysteresis proteins during
cryopreservation of oocytes and embryos. Theriogenology 1994, 41, 107–112. [CrossRef]
Rubinsky, B.; Mattioli, M.; Arav, A.; Barboni, B.; Fletcher, G.L. Inhibition of Ca2+ and K+ currents by
“antifreeze” proteins. Am. J. Physiol. 1992, 262, R542–R545. [PubMed]
Wang, J.H.; Bian, H.W.; Huang, C.N.; Ge, J.G. Studies on the application of antifreeze proteins in
cryopreservation of rice suspension cells. Shi Yan Sheng Wu Xue Bao 1999, 32, 271–276. [PubMed]
Wang, L.H.; Wusteman, M.C.; Smallwood, M.; Pegg, D.E. The stability during low-temperature storage of an
antifreeze protein isolated from the roots of cold-acclimated carrots. Cryobiology 2002, 44, 307–310. [CrossRef]
Ishiguro, H.; Rubinsky, B. Influence of fish antifreeze proteins on the freezing of cell suspensions with
cryoprotectant penetrating cells. Int. J. Heat Mass Transf. 1998, 41, 1907–1915. [CrossRef]
Payne, S.R.; Oliver, J.E.; Upreti, G.C. Effect of antifreeze proteins on the motility of ram spermatozoa.
Cryobiology 1994, 31, 180–184. [CrossRef] [PubMed]
Lagneaux, D.; Huhtinen, M.; Koskinen, E.; Palmer, E. Effect of anti-freeze protein (AFP) on the cooling and
freezing of equine embryos as measured by DAPI-staining. Equine Vet. J. Suppl. 1997, 25, 85–87. [CrossRef]
Shaw, J.M.; Ward, C.; Trounson, A.O. Evaluation of propanediol, ethylene glycol, sucrose and antifreeze
proteins on the survival of slow-cooled mouse pronuclear and 4-cell embryos. Hum. Reprod. 1995, 10,
396–402. [PubMed]
Mezhevikina, L.M.; Karanova, M.V. The use of antifreeze glycoproteins in the freezing in liquid nitrogen of
early mouse embryos. Izv. Akad. Nauk. Seriia Biol. Akad. Nauk. 1994, 2, 172–177.
Soltys, K.A.; Batta, A.K.; Koneru, B. Successful nonfreezing, subzero preservation of rat liver with
2,3-butanediol and type I antifreeze protein. J. Surg. Res. 2001, 96, 30–34. [CrossRef] [PubMed]
292
Mar. Drugs 2017, 15, 27
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
111.
112.
113.
114.
115.
116.
117.
Zhang, E.; Zhang, L.; Wang, B.; Yan, B.; Wang, Q. Cryopreservation of marine diatom algae by
encapsulation-vitrification. Cryo Lett. 2009, 30, 224–231.
Larese, A.; Acker, J.; Muldrew, K.; Yang, H.Y.; McGann, L. Antifreeze proteins induce intracellular nucleation.
Cryoletters 1996, 17, 175–182.
Scholander, P.F.; Van Dam, L.; Kanwisher, J.W.; Hammel, H.T.; Gordon, M.S. Supercooling and
osmoregulation in Arctic fish. J. Cell. Physiol. 1957, 49, 5–24. [CrossRef]
Komatsu, S.K.; DeVries, A.L.; Feeney, R.E. Studies of the structure of freezing point-depressing glycoproteins
from an Antarctic fish. J. Biol. Chem. 1970, 245, 2909–2913. [PubMed]
Duman, J.G.; Devries, A.L. Freezing resistance in winter flounder Pseudopleuronectes americanus. Nature 1974,
247, 237–238. [CrossRef]
Slaughter, D.; Fletcher, G.L.; Ananthanarayanan, V.S.; Hew, C.L. Antifreeze proteins from the sea raven,
Hemitripterus americanus. Further evidence for diversity among fish polypeptide antifreezes. J. Biol. Chem.
1981, 256, 2022–2026. [PubMed]
Feeney, R.E.; Yeh, Y. Antifreeze proteins from fish bloods. Adv. Protein Chem. 1978, 32, 191–282. [PubMed]
Burcham, T.S.; Osuga, D.T.; Chino, H.; Feeney, R.E. Analysis of antifreeze glycoproteins in fish serum.
Anal. Biochem. 1984, 139, 197–204. [CrossRef]
Kao, M.H.; Fletcher, G.L.; Wang, N.C.; Hew, C.L. The relationship between molecular weight and antifreeze
polypeptide activity in marine fish. Can. J. Zool. 1986, 64, 578–582. [CrossRef]
Ahlgren, J.A.; Cheng, C.C.; Schrag, J.D.; DeVries, A.L. Freezing avoidance and the distribution of antifreeze
glycopeptides in body fluids and tissues of Antarctic fish. J. Exp. Biol. 1988, 137, 549–563. [PubMed]
Hew, C.L.; Wang, N.C.; Yan, S.; Cai, H.; Sclater, A.; Fletcher, G.L. Biosynthesis of antifreeze polypeptides in
the winter flounder. Eur. J. Biochem. 1986, 160, 267–272. [CrossRef] [PubMed]
Chao, H.; Houston, M.E., Jr.; Hodges, R.S.; Kay, C.M.; Sykes, B.D.; Loewen, M.C.; Davies, P.L.; Sönnichsen, F.D.
A diminished role for hydrogen bonds in antifreeze protein binding to ice. Biochemistry 1997, 36, 14652–14660.
[CrossRef] [PubMed]
Haymet, A.D.; Ward, L.G.; Harding, M.M.; Knight, C.A. Valine substituted winter flounder “antifreeze”:
Preservation of ice growth hysteresis. FEBS Lett. 1998, 430, 301–306. [CrossRef]
Loewen, M.C.; Chao, H.; Houston, M.E., Jr.; Baardsnes, J.; Hodges, R.S.; Kay, C.M.; Sykes, B.D.;
Sönnichsen, F.D.; Davies, P.L. Alternative roles for putative ice-binding residues in type I antifreeze protein.
Biochemistry 1999, 38, 4743–4749. [CrossRef] [PubMed]
Zhang, W.; Laursen, R.A. Structure-function relationships in a type I antifreeze polypeptide. The role of
threonine methyl and hydroxyl groups in antifreeze activity. J. Biol. Chem. 1998, 273, 34806–34812. [CrossRef]
[PubMed]
Vasina, E.N.; Paszek, E.; Nicolau, D., Jr.; Nicolau, D.V. The BAD project: Data mining, database and prediction
of protein adsorption on surfaces. Lab Chip 2009, 9, 891–900. [CrossRef] [PubMed]
Baardsnes, J.; Kondejewski, L.H.; Hodges, R.S.; Chao, H.; Kay, C.; Davies, P.L. New ice-binding face for type
I antifreeze protein. FEBS Lett. 1999, 463, 87–91. [CrossRef]
Ewart, K.V.; Yang, D.S.; Ananthanarayanan, V.S.; Fletcher, G.L.; Hew, C.L. Ca2+ -dependent antifreeze proteins.
Modulation of conformation and activity by divalent metal ions. J. Biol. Chem. 1996, 271, 16627–16632.
[PubMed]
Gronwald, W.; Loewen, M.C.; Lix, B.; Daugulis, A.J.; Sönnichsen, F.D.; Davies, P.L.; Sykes, B.D. The solution
structure of type II antifreeze protein reveals a new member of the lectin family. Biochemistry 1998, 37,
4712–4721. [CrossRef] [PubMed]
Drickamer, K. C-type lectin-like domains. Curr. Opin. Struct. Biol. 1999, 9, 585–590. [CrossRef]
Liu, Y.; Li, Z.; Lin, Q.; Kosinski, J.; Seetharaman, J.; Bujnicki, J.M.; Sivaraman, J.; Hew, C.L. Structure and
evolutionary origin of Ca2+ -dependent herring type II antifreeze protein. PLoS ONE 2007, 2, e548. [CrossRef]
[PubMed]
Nishimiya, Y.; Kondo, H.; Takamichi, M.; Sugimoto, H.; Suzuki, M.; Miura, A.; Tsuda, S. Crystal structure
and mutational analysis of Ca2+ -independent type II antifreeze protein from longsnout poacher,
Brachyopsis rostratus. J. Mol. Biol. 2008, 382, 734–746. [CrossRef] [PubMed]
Ewart, K.V.; Lin, Q.; Hew, C.L. Structure, function and evolution of antifreeze proteins. Cell. Mol. Life Sci.
1999, 55, 271–283. [CrossRef] [PubMed]
293
Mar. Drugs 2017, 15, 27
118. Yamashita, Y.; Miura, R.; Takemoto, Y.; Tsuda, S.; Kawahara, H.; Obata, H. Type II antifreeze protein from a
mid-latitude freshwater fish, Japanese smelt (Hypomesus nipponensis). Biosci. Biotechnol. Biochem. 2003, 67,
461–466. [CrossRef] [PubMed]
119. Yeh, Y.; Feeney, R.E. Antifreeze proteins: Structures and mechanisms of function. Chem. Rev. 1996, 96,
601–618. [CrossRef] [PubMed]
120. Antson, A.A.; Smith, D.J.; Roper, D.I.; Lewis, S.; Caves, L.S.; Verma, C.S.; Buckley, S.L.; Lillford, P.J.;
Hubbard, R.E. Understanding the mechanism of ice binding by type III antifreeze proteins. J. Mol. Biol. 2001,
305, 875–889. [CrossRef] [PubMed]
121. Hew, C.L.; Wang, N.C.; Joshi, S.; Fletcher, G.L.; Scott, G.K.; Hayes, P.H.; Buettner, B.; Davies, P.L. Multiple
genes provide the basis for antifreeze protein diversity and dosage in the ocean pout, Macrozoarces americanus.
J. Biol. Chem. 1988, 263, 12049–12055. [PubMed]
122. Nishimiya, Y.; Sato, R.; Takamichi, M.; Miura, A.; Tsuda, S. Co-operative effect of the isoforms of type
III antifreeze protein expressed in Notched-fin eelpout, Zoarces elongatus Kner. FEBS J. 2005, 272, 482–492.
[CrossRef] [PubMed]
123. DeLuca, C.I.; Chao, H.; Sönnichsen, F.D.; Sykes, B.D.; Davies, P.L. Effect of type III antifreeze protein dilution
and mutation on the growth inhibition of ice. Biophys. J. 1996, 71, 2346–2355. [CrossRef]
124. Baardsnes, J.; Davies, P.L. Contribution of hydrophobic residues to ice binding by fish type III antifreeze
protein. Biochim. Biophys. Acta 2002, 1601, 49–54. [CrossRef]
125. Chao, H.; Sönnichsen, F.D.; DeLuca, C.I.; Sykes, B.D.; Davies, P.L. Structure-function relationship in the
globular type III antifreeze protein: Identification of a cluster of surface residues required for binding to ice.
Protein Sci. 1994, 3, 1760–1769. [CrossRef] [PubMed]
126. Jia, Z.; DeLuca, C.I.; Chao, H.; Davies, P.L. Structural basis for the binding of a globular antifreeze protein to
ice. Nature 1996, 384, 285–288. [CrossRef] [PubMed]
127. Sönnichsen, F.D.; DeLuca, C.I.; Davies, P.L.; Sykes, B.D.; Sönnichsen, F.D.; DeLuca, C.I.; Davies, P.L.;
Sykes, B.D. Refined solution structure of type III antifreeze protein: Hydrophobic groups may be involved
in the energetics of the protein–ice interaction. Structure 1996, 4, 1325–1337. [CrossRef]
128. Leiter, A.; Rau, S.; Winger, S.; Muhle-Goll, C.; Luy, B.; Gaukel, V. Influence of heating temperature,
pressure and pH on recrystallization inhibition activity of antifreeze protein type III. J. Food Eng. 2016,
187, 53–61. [CrossRef]
129. Hamada, T.; Ito, Y.; Abe, T.; Hayashi, F.; Guntert, P.; Inoue, M.; Kigawa, T.; Terada, T.; Shirouzu, M.;
Yoshida, M.; et al. Solution structure of the antifreeze-like domain of human sialic acid synthase. Protein Sci.
2006, 15, 1010–1016. [CrossRef] [PubMed]
130. Choi, Y.-G.; Park, C.-J.; Kim, H.-E.; Seo, Y.-J.; Lee, A.-R.; Choi, S.-R.; Lee, S.S.; Lee, J.-H. Comparison of
backbone dynamics of the type III antifreeze protein and antifreeze-like domain of human sialic acid synthase.
J. Biomol. NMR 2015, 61, 137–150. [CrossRef] [PubMed]
131. DeLuca, C.I.; Davies, P.L.; Ye, Q.; Jia, Z. The effects of steric mutations on the structure of type III antifreeze
protein and its interaction with ice. J. Mol. Biol. 1998, 275, 515–525. [CrossRef] [PubMed]
132. Graether, S.P.; DeLuca, C.I.; Baardsnes, J.; Hill, G.A.; Davies, P.L.; Jia, Z. Quantitative and qualitative analysis
of type III antifreeze protein structure and function. J. Biol. Chem. 1999, 274, 11842–11847. [CrossRef]
[PubMed]
133. Chen, G.; Jia, Z. Ice-binding surface of fish type III antifreeze. Biophys. J. 1999, 77, 1602–1608. [CrossRef]
134. Garnham, C.P.; Natarajan, A.; Middleton, A.J.; Kuiper, M.J.; Braslavsky, I.; Davies, P.L. Compound ice-binding
site of an antifreeze protein revealed by mutagenesis and fluorescent tagging. Biochemistry 2010, 49,
9063–9071. [CrossRef] [PubMed]
135. Garnham, C.P.; Nishimiya, Y.; Tsuda, S.; Davies, P.L. Engineering a naturally inactive isoform of type III
antifreeze protein into one that can stop the growth of ice. FEBS Lett. 2012, 586, 3876–3881. [CrossRef]
[PubMed]
136. Choi, S.; Seo, Y.; Kim, M.; Eo, Y.; Ahn, H.; Lee, A.; Park, C.; Ryu, K.; Cheong, H.; Lee, S.S. NMR study of
the antifreeze activities of active and inactive isoforms of a type III antifreeze protein. FEBS Lett. 2016, 590,
4202–4212. [CrossRef] [PubMed]
137. Wang, X.; DeVries, A.L.; Cheng, C.H. Antifreeze peptide heterogeneity in an antarctic eel pout includes an
unusually large major variant comprised of two 7 kDa type III AFPs linked in tandem. Biochim. Biophys. Acta
1995, 1247, 163–172. [CrossRef]
294
Mar. Drugs 2017, 15, 27
138. Miura, K.; Ohgiya, S.; Hoshino, T.; Nemoto, N.; Suetake, T.; Miura, A.; Spyracopoulos, L.; Kondo, H.; Tsuda, S.
NMR analysis of type III antifreeze protein intramolecular dimer. Structural basis for enhanced activity.
J. Biol. Chem. 2001, 276, 1304–1310. [CrossRef] [PubMed]
139. Miura, K.; Ohgiya, S.; Hoshino, T.; Nemoto, N.; Odaira, M.; Nitta, K.; Tsuda, S. Determination of the solution
structure of the N-domain plus linker of Antarctic eel pout antifreeze protein RD3. J. Biochem. 1999, 126,
387–394. [CrossRef] [PubMed]
140. Raymond, J.A.; Christner, B.C.; Schuster, S.C. A bacterial ice-binding protein from the Vostok ice core.
Extremophiles 2008, 12, 713–717. [CrossRef] [PubMed]
141. Xiao, N.; Suzuki, K.; Nishimiya, Y.; Kondo, H.; Miura, A.; Tsuda, S.; Hoshino, T. Comparison of functional
properties of two fungal antifreeze proteins from Antarctomyces psychrotrophicus and Typhula ishikariensis.
FEBS J. 2010, 277, 394–403. [CrossRef] [PubMed]
142. Lee, J.H.; Lee, S.G.; Do, H.; Park, J.C.; Kim, E.; Choe, Y.H.; Han, S.J.; Kim, H.J. Optimization of the pilot-scale
production of an ice-binding protein by fed-batch culture of Pichia pastoris. Appl. Microbiol. Biotechnol. 2013,
97, 3383–3393. [CrossRef] [PubMed]
143. Koh, H.Y.; Lee, J.H.; Han, S.J.; Park, H.; Lee, S.G. Effect of the antifreeze protein from the Arctic
yeast Leucosporidium sp. AY30 on cryopreservation of the marine diatom Phaeodactylum tricornutum.
Appl. Biochem. Biotechnol. 2015, 175, 677–686. [CrossRef] [PubMed]
144. Lee, S.G.; Koh, H.Y.; Lee, J.H.; Kang, S.H.; Kim, H.J. Cryopreservative effects of the recombinant ice-binding
protein from the arctic yeast Leucosporidium sp. on red blood cells. Appl. Biochem. Biotechnol. 2012, 167,
824–834. [CrossRef] [PubMed]
145. Kim, H.J.; Shim, H.E.; Lee, J.H.; Kang, Y.-C.; Hur, Y.B. Ice-binding protein derived from Glaciozyma can
improve the viability of cryopreserved mammalian cells. J. Microbiol. Biotechnol. 2015, 25, 1989–1996.
[CrossRef] [PubMed]
146. Kondo, H.; Hanada, Y.; Sugimoto, H.; Hoshino, T.; Garnham, C.P.; Davies, P.L.; Tsuda, S. Ice-binding site of
snow mold fungus antifreeze protein deviates from structural regularity and high conservation. Proc. Natl.
Acad. Sci. USA 2012, 109, 9360–9365. [CrossRef] [PubMed]
147. Hashim, N.H.F.; Sulaiman, S.; Bakar, F.D.A.; Illias, R.M.; Kawahara, H.; Najimudin, N.; Mahadi, N.M.;
Murad, A.M.A. Molecular cloning, expression and characterisation of Afp4, an antifreeze protein from
Glaciozyma antarctica. Polar Biol. 2014, 37, 1495–1505. [CrossRef]
148. Bayer-Giraldi, M.; Uhlig, C.; John, U.; Mock, T.; Valentin, K.; Bayer-Giraldi, M.; Uhlig, C.; John, U.; Mock, T.;
Valentin, K. Antifreeze proteins in polar sea ice diatoms: Diversity and gene expression in the genus
Fragilariopsis. Environ. Microbiol. 2010, 12, 1041–1052. [CrossRef] [PubMed]
149. Gilbert, J.A.; Hill, P.J.; Dodd, C.E.; Laybourn-Parry, J. Demonstration of antifreeze protein activity in Antarctic
lake bacteria. Microbiology 2004, 150, 171–180. [CrossRef] [PubMed]
150. Garnham, C.P.; Gilbert, J.A.; Hartman, C.P.; Campbell, R.L.; Laybourn-Parry, J.; Davies, P.L.
A Ca2+ -dependent bacterial antifreeze protein domain has a novel beta-helical ice-binding fold. Biochem. J.
2008, 411, 171–180. [CrossRef] [PubMed]
151. Raymond, J.A.; Kim, H.J. Possible role of horizontal gene transfer in the colonization of sea ice by algae.
PLoS ONE 2012, 7, e35968. [CrossRef] [PubMed]
152. Gogarten, J.P.; Doolittle, W.F.; Lawrence, J.G. Prokaryotic evolution in light of gene transfer. Mol. Biol. Evol.
2002, 19, 2226–2238. [CrossRef] [PubMed]
153. Anesio, A.M.; Mindl, B.; Laybourn-Parry, J.; Hodson, A.J.; Sattler, B. Viral dynamics in cryoconite holes on a
high Arctic glacier (Svalbard). J. Geophys. Res. Biogeosci. 2007, 112, G04S31. [CrossRef]
154. Pucciarelli, S.; Chiappori, F.; Devaraj, R.R.; Yang, G.; Yu, T.; Ballarini, P.; Miceli, C. Identification and
analysis of two sequences encoding ice-binding proteins obtained from a putative bacterial symbiont of the
psychrophilic Antarctic ciliate Euplotes focardii. Antarct. Sci. 2014, 26, 491–501. [CrossRef]
155. Mangiagalli, M.; Bar-Dolev, M.; Tedesco, P.; Natalello, A.; Kaleda, A.; Brocca, S.; Pascale, D.; Pucciarelli, S.;
Miceli, C.; Bravslavsky, I. Cryo-protective effect of an ice-binding protein derived from Antarctic bacteria.
FEBS J. 2016. [CrossRef] [PubMed]
156. Mazur, P. Freezing of living cells: Mechanisms and implications. Am. J. Physiol. 1984, 247, C125–C142.
[PubMed]
295
Mar. Drugs 2017, 15, 27
157. Naaldijk, Y.; Staude, M.; Fedorova, V.; Stolzing, A. Effect of different freezing rates during cryopreservation
of rat mesenchymal stem cells using combinations of hydroxyethyl starch and dimethylsulfoxide.
BMC Biotechnol. 2012, 12, 49. [CrossRef] [PubMed]
158. Fowler, A.; Toner, M. Cryo-injury and biopreservation. Ann. N. Y. Acad. Sci. 2006, 1066, 119–135. [CrossRef]
[PubMed]
159. Chaytor, J.L.; Tokarew, J.M.; Wu, L.K.; Leclre, M.; Tam, R.Y.; Capicciotti, C.J.; Guolla, L.; Von Moos, E.;
Findlay, C.S.; Allan, D.S.; et al. Inhibiting ice recrystallization and optimization of cell viability after
cryopreservation. Glycobiology 2012, 22, 123–133. [CrossRef] [PubMed]
160. Fahy, G.M.; MacFarlane, D.R.; Angell, C.A.; Meryman, H.T. Vitrification as an approach to cryopreservation.
Cryobiology 1984, 21, 407–426. [CrossRef]
161. Wowk, B.; Leitl, E.; Rasch, C.M.; Mesbah-Karimi, N.; Harris, S.B.; Fahy, G.M. Vitrification enhancement by
synthetic ice blocking agents. Cryobiology 2000, 40, 228–236. [CrossRef] [PubMed]
162. Mugnano, J.A.; Wang, T.; Layne, J.R., Jr.; DeVries, A.L.; Lee, R.E., Jr. Antifreeze glycoproteins promote
intracellular freezing of rat cardiomyocytes at high subzero temperatures. Am. J. Physiol. 1995, 269,
R474–R479. [PubMed]
163. Hansen, T.N.; Smith, K.M.; Brockbank, K.G. Type I antifreeze protein attenuates cell recoveries following
cryopreservation. Transpl. Proc. 1993, 25, 3182–3184.
164. Wang, T.; Zhu, Q.; Yang, X.; Layne, J.R., Jr.; Devries, A.L. Antifreeze glycoproteins from antarctic notothenioid
fishes fail to protect the rat cardiac explant during hypothermic and freezing preservation. Cryobiology 1994,
31, 185–192. [CrossRef] [PubMed]
165. Zilli, L.; Beirão, J.; Schiavone, R.; Herraez, M.P.; Gnoni, A.; Vilella, S. Comparative proteome analysis of
cryopreserved flagella and head plasma membrane proteins from sea bream spermatozoa: Effect of antifreeze
proteins. PLoS ONE 2014, 9, e99992. [CrossRef] [PubMed]
166. Robles, V.; Cabrita, E.; Anel, L.; Herraez, M.P. Microinjection of the antifreeze protein type III (AFPIII) in
turbot (Scophthalmus maximus) embryos: Toxicity and protein distribution. Aquaculture 2006, 261, 1299–1306.
[CrossRef]
167. Beirão, J.; Zilli, L.; Vilella, S.; Cabrita, E.; Schiavone, R.; Herraez, M.P. Improving sperm cryopreservation
with antifreeze proteins: Effect on gilthead seabream (Sparus aurata) plasma membrane lipids. Biol. Reprod.
2012, 86, 59. [CrossRef] [PubMed]
168. Prathalingam, N.S.; Holt, W.V.; Revell, S.G.; Mirczuk, S.; Fleck, R.A.; Watson, P.F. Impact of antifreeze proteins
and antifreeze glycoproteins on bovine sperm during freeze-thaw. Theriogenology 2006, 66, 1894–1900.
[CrossRef] [PubMed]
169. Kim, J.S.; Yoon, J.H.; Park, G.H.; Bae, S.H.; Kim, H.J.; Kim, M.S.; Hwang, Y.J.; Kim, D.Y. Influence of antifreeze
proteins on boar sperm DNA damaging during cryopreservation. Dev. Biol. 2011, 356, 195. [CrossRef]
170. Qadeer, S.; Khan, M.A.; Ansari, M.S.; Rakha, B.A.; Ejaz, R.; Iqbal, R.; Younis, M.; Ullah, N.; DeVries, A.L.;
Akhter, S. Efficiency of antifreeze glycoproteins for cryopreservation of Nili-Ravi (Bubalus bubalis) buffalo
bull sperm. Anim. Reprod. Sci. 2015, 157, 56–62. [CrossRef] [PubMed]
171. Qadeer, S.; Khan, M.A.; Ansari, M.S.; Rakha, B.A.; Ejaz, R.; Husna, A.U.; Ashiq, M.; Iqbal, R.; Ullah, N.;
Akhter, S. Evaluation of antifreeze protein III for cryopreservation of Nili-Ravi (Bubalus bubalis) buffalo bull
sperm. Anim. Reprod. Sci. 2014, 148, 26–31. [CrossRef] [PubMed]
172. Ideta, A.; Aoyagi, Y.; Tsuchiya, K.; Nakamura, Y.; Hayama, K.; Shirasawa, A.; Sakaguchi, K.; Tominaga, N.;
Nishimiya, Y.; Tsuda, S. Prolonging hypothermic storage (4 ◦ C) of bovine embryos with fish antifreeze
protein. J. Reprod. Dev. 2015, 61, 1–6. [CrossRef] [PubMed]
173. Hirano, Y.; Nishimiya, Y.; Matsumoto, S.; Matsushita, M.; Todo, S.; Miura, A.; Komatsu, Y.; Tsuda, S.
Hypothermic preservation effect on mammalian cells of type III antifreeze proteins from notched-fin eelpout.
Cryobiology 2008, 57, 46–51. [CrossRef] [PubMed]
174. Kamijima, T.; Sakashita, M.; Miura, A.; Nishimiya, Y.; Tsuda, S. Antifreeze protein prolongs the life-time of
insulinoma cells during hypothermic preservation. PLoS ONE 2013, 8, e73643. [CrossRef] [PubMed]
175. Baguisi, A.; Arav, A.; Crosby, T.F.; Roche, J.F.; Boland, M.P. Hypothermic storage of sheep embryos with
antifreeze proteins: Development in vitro and in vivo. Theriogenology 1997, 48, 1017–1024. [CrossRef]
176. Nishijima, K.; Tanaka, M.; Sakai, Y.; Koshimoto, C.; Morimoto, M.; Watanabe, T.; Fan, J.; Kitajima, S. Effects of
type III antifreeze protein on sperm and embryo cryopreservation in rabbit. Cryobiology 2014, 69, 22–25.
[CrossRef] [PubMed]
296
Mar. Drugs 2017, 15, 27
177. Jo, J.W.; Jee, B.C.; Lee, J.R.; Suh, C.S. Effect of antifreeze protein supplementation in vitrification medium on
mouse oocyte developmental competence. Fertil. Steril. 2011, 96, 1239–1245. [CrossRef] [PubMed]
178. Karanova, M.V.; Pronina, N.D.; Tsvetkova, L.I. The effect of antifreeze glycoproteins on survival and quality
of fish spermatozoa under the conditions of long-term storage at +4 degree C. Izv. Akad. Nauk. Ser. Biol. 2002,
1, 88–92.
179. Halwani, D.O.; Brockbank, K.G.; Duman, J.G.; Campbell, L.H. Recombinant Dendroides canadensis antifreeze
proteins as potential ingredients in cryopreservation solutions. Cryobiology 2014, 68, 411–418. [CrossRef]
[PubMed]
180. Karanova, M.V.; Mezhevikina, L.M.; Petropavlov, N.N. Study of cryoprotective properties of antifreeze
glycoproteins from the white sea cod Gadus morhua on low temperature freezing of mouse embryos. Biofizika
1994, 40, 1341–1347.
181. Wen, Y.; Zhao, S.; Chao, L.; Yu, H.; Song, C.; Shen, Y.; Chen, H.; Deng, X. The protective role of antifreeze
protein 3 on the structure and function of mature mouse oocytes in vitrification. Cryobiology 2014, 69, 394–401.
[CrossRef] [PubMed]
182. Rubinsky, L.; Raichman, N.; Lavee, J.; Frenk, H.; Ben-Jacob, E.; Bickler, P.E. Antifreeze protein suppresses
spontaneous neural activity and protects neurons from hypothermia/re-warming injury. Neurosci. Res. 2010,
67, 256–259. [CrossRef] [PubMed]
183. Rubinsky, B.; Arav, A.; Devries, A.L. The cryoprotective effect of antifreeze glycopeptides from antarctic
fishes. Cryobiology 1992, 29, 69–79. [CrossRef]
184. Amir, G.; Rubinsky, B.; Smolinsky, A.K.; Lavee, J. Successful use of ocean pout thermal hysteresis protein
(antifreeze protein III) in cryopreservation of transplanted mammalian heart at subzero temperature. J. Hear
Lung Transplant. 2002, 21, 137. [CrossRef]
185. Jo, J.W.; Jee, B.C.; Suh, C.S.; Kim, S.H. The Beneficial Effects of antifreeze proteins in the vitrification of
immature mouse oocytes. PLoS ONE 2012, 7, e37043. [CrossRef] [PubMed]
186. Martínez-Páramo, S.; Pérez-Cerezales, S.; Robles, V.; Anel, L.; Herraez, M.P. Incorporation of antifreeze
proteins into zebrafish embryos by a non-invasive method. Cryobiology 2008, 56, 216–222. [CrossRef]
[PubMed]
187. Martínez-Páramo, S.; Barbosa, V.; Pérez-Cerezales, S.; Robles, V.; Herraez, M.P. Cryoprotective effects of
antifreeze proteins delivered into zebrafish embryos. Cryobiology 2009, 58, 128–133. [CrossRef] [PubMed]
188. Tursman, D.; Duman, J.G. Cryoprotective effects of thermal hysteresis protein on survivorship of frozen gut
cells from the freeze-tolerant centipede Lithobius forficatus. J. Exp. Zool. 1995, 272, 249–257. [CrossRef]
189. Amir, G.; Rubinsky, B.; Horowitz, L.; Miller, L.; Leor, J.; Kassif, Y.; Mishaly, D.; Smolinsky, A.K.; Lavee, J.
Prolonged 24-hour subzero preservation of heterotopically transplanted rat hearts using antifreeze proteins
derived from arctic fish. Ann. Thorac. Surg. 2004, 77, 1648–1655. [CrossRef] [PubMed]
190. O’Neil, L.; Paynter, S.J.; Fuller, B.J.; Shaw, R.W.; DeVries, A.L. Vitrification of mature mouse oocytes in a 6 M
Me2 SO solution supplemented with antifreeze glycoproteins: The effect of temperature. Cryobiology 1998, 37,
59–66. [CrossRef] [PubMed]
191. Shaw, J.M.; Ward, C.; Trounson, A.O. Survival of mouse blastocysts slow cooled in propanediol or ethylene
glycol is influenced by the thawing procedure, sucrose and antifreeze proteins. Theriogenology 1995, 43,
1289–1300. [CrossRef]
192. Koshimoto, C.; Mazur, P. Effects of warming rate, temperature, and antifreeze proteins on the survival of
mouse spermatozoa frozen at an optimal rate. Cryobiology 2002, 45, 49–59. [CrossRef]
193. Matsumoto, S.; Matsusita, M.; Morita, T.; Kamachi, H.; Tsukiyama, S.; Furukawa, Y.; Koshida, S.; Tachibana, Y.;
Nishimura, S.; Todo, S. Effects of synthetic antifreeze glycoprotein analogue on islet cell survival and function
during cryopreservation. Cryobiology 2006, 52, 90–98. [CrossRef] [PubMed]
194. Arav, A.; Rubinsky, B.; Fletcher, G.; Seren, E. Cryogenic protection of oocytes with antifreeze proteins.
Mol. Reprod. Dev. 1993, 36, 488–493. [CrossRef] [PubMed]
195. Younis, A.I.; Rooks, B.; Khan, S.; Gould, K.G. The effects of antifreeze peptide III (AFP) and insulin transferrin
selenium (ITS) on cryopreservation of chimpanzee (Pan troglodytes) spermatozoa. J. Androl. 1998, 19, 207–214.
[PubMed]
196. Robles, V.; Barbosa, V.; Herraez, M.P.; Martinez-Paramo, S.; Cancela, M.L. The antifreeze protein type I
(AFP I) increases seabream (Sparus aurata) embryos tolerance to low temperatures. Theriogenology 2007, 68,
284–289. [CrossRef] [PubMed]
297
Mar. Drugs 2017, 15, 27
197. Chao, H.; Davies, P.L.; Carpenter, J.F. Effects of antifreeze proteins on red blood cell survival during
cryopreservation. J. Exp. Biol. 1996, 199, 2071–2076. [PubMed]
198. Chaves, D.F.; Campelo, I.S.; Silva, M.M.A.S.; Bhat, M.H.; Teixeira, D.I.A.; Melo, L.M.; Souza-Fabjan, J.M.G.;
Mermillod, P.; Freitas, V.J.F. The use of antifreeze protein type III for vitrification of in vitro matured bovine
oocytes. Cryobiology 2016, 73, 324–328. [CrossRef] [PubMed]
199. Bouvet, V.R.; Lorello, G.R.; Ben, R.N. Aggregation of antifreeze glycoprotein fraction 8 and its effect on
antifreeze activity. Biomacromolecules 2006, 7, 565–571. [CrossRef] [PubMed]
200. Qadeer, S.; Khan, M.A.; Shahzad, Q.; Azam, A.; Ansari, M.S.; Rakha, B.A.; Ejaz, R.; Husna, A.U.; Duman, J.G.;
Akhter, S. Efficiency of beetle (Dendroides canadensis) recombinant antifreeze protein for buffalo semen
freezability and fertility. Theriogenology 2016, 86, 1662–1669. [CrossRef] [PubMed]
201. Liu, S.; Wang, W.; Moos, E.; Jackman, J.; Mealing, G.; Monette, R.; Ben, R.N. In vitro studies of antifreeze
glycoprotein (AFGP) and a C-linked AFGP analogue. Biomacromolecules 2007, 8, 1456–1462. [CrossRef] [PubMed]
202. Martinez-Paramo, S.; Perez-Cerezales, S.; Barbosa, V.; Robles, V.; Herraez, M.P. Advances on fish embryo
cryopreservation using antifreeze proteins. Biol. Reprod. 2008, 78, 152.
203. Ideta, A.; Aoyagi, Y.; Tsuchiya, K.; Kamijima, T.; Nishimiya, Y.; Tsuda, S. A simple medium enables bovine
embryos to be held for seven days at 4 ◦ C. Sci. Rep. 2013, 3, 1173. [CrossRef] [PubMed]
204. Lee, C.Y.; Rubinsky, B.; Fletcher, G.L. Hypothermic preservation of whole mammalian organs with antifreeze
proteins. Cryo-Letters 1992, 13, 59–66.
205. Amir, G.; Horowitz, L.; Rubinsky, B.; Yousif, B.S.; Lavee, J.; Smolinsky, A.K. Subzero nonfreezing
cryopresevation of rat hearts using antifreeze protein I and antifreeze protein III. Cryobiology 2004, 48,
273–282. [CrossRef] [PubMed]
206. Rubinsky, B.; Arav, A.; Hong, J.S.; Lee, C.Y. Freezing of mammalian livers with glycerol and antifreeze
proteins. Biochem. Biophys. Res. Commun. 1994, 200, 732–741. [CrossRef] [PubMed]
207. Davies, P.L.; Sykes, B.D. Antifreeze proteins. Curr. Opin. Struct. Biol. 1997, 7, 828–834. [CrossRef]
208. Arakawa, T.; Kita, Y.; Timasheff, S.N. Protein precipitation and denaturation by dimethyl sulfoxide.
Biophys. Chem. 2007, 131, 62–70. [CrossRef] [PubMed]
209. Wang, C.; Oliver, E.E.; Christner, B.C.; Luo, B.-H. Functional Analysis of a bacterial antifreeze protein indicates a
cooperative effect between its two ice-binding domains. Biochemistry 2016, 55, 3975–3983. [CrossRef] [PubMed]
210. Nishimiya, Y.; Ohgiya, S.; Tsuda, S. Artificial multimers of the type III antifreeze protein. Effects on thermal
hysteresis and ice crystal morphology. J. Biol. Chem. 2003, 278, 32307–32312. [CrossRef] [PubMed]
211. Baardsnes, J.; Kuiper, M.J.; Davies, P.L. Antifreeze protein dimer: When two ice-binding faces are better than
one. J. Biol. Chem. 2003, 278, 38942–38947. [CrossRef] [PubMed]
212. Can, O.; Holland, N.B. Utilizing avidity to improve antifreeze protein activity: A type III antifreeze protein
trimer exhibits increased thermal hysteresis activity. Biochemistry 2013, 52, 8745–8752. [CrossRef] [PubMed]
213. Stevens, C.A.; Drori, R.; Zalis, S.; Braslavsky, I.; Davies, P.L. Dendrimer-linked antifreeze proteins have
superior activity and thermal recovery. Bioconjug. Chem. 2015, 26, 1908–1915. [CrossRef] [PubMed]
214. Phippen, S.W.; Stevens, C.A.; Vance, T.D.R.; King, N.P.; Baker, D.; Davies, P.L. Multivalent display of
antifreeze proteins by fusion to self-assembling protein cages enhances ice-binding activities. Biochemistry
2016, 55, 6811–6820. [CrossRef] [PubMed]
215. Bang, J.K.; Lee, J.H.; Murugan, R.N.; Lee, S.G.; Do, H.; Koh, H.Y.; Shim, H.E.; Kim, H.C.; Kim, H.J. Antifreeze
peptides and glycopeptides, and their derivatives: Potential uses in biotechnology. Mar. Drugs 2013, 11,
2013–2041. [CrossRef] [PubMed]
216. Balcerzak, A.K.; Capicciotti, C.J.; Briard, J.G.; Ben, R.N. Designing ice recrystallization inhibitors:
From antifreeze (glyco) proteins to small molecules. RSC Adv. 2014, 4, 42682–42696. [CrossRef]
217. Liu, S.; Ben, R.N. C-linked galactosyl serine AFGP analogues as potent recrystallization inhibitors. Org. Lett.
2005, 7, 2385–2388. [CrossRef] [PubMed]
218. Garner, J.; Harding, M.M. Design and synthesis of antifreeze glycoproteins and mimics. Chembiochem 2010,
11, 2489–2498. [CrossRef] [PubMed]
219. Hachisu, M.; Hinou, H.; Takamichi, M.; Tsuda, S.; Koshida, S.; Nishimura, S. One-pot synthesis of cyclic
antifreeze glycopeptides. Chem. Commun. 2009. [CrossRef] [PubMed]
298
Mar. Drugs 2017, 15, 27
220. Garner, J.; Harding, M.M. Design and synthesis of alpha-helical peptides and mimetics. Org. Biomol. Chem.
2007, 5, 3577–3585. [CrossRef] [PubMed]
221. Can, O.; Holland, N.B. Conjugation of type I antifreeze protein to polyallylamine increases thermal hysteresis
activity. Bioconjug. Chem. 2011, 22, 2166–2171. [CrossRef] [PubMed]
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
299
marine drugs
Review
Enzyme-Assisted Discovery of Antioxidant Peptides
from Edible Marine Invertebrates: A Review
Tsun-Thai Chai 1,2, *, Yew-Chye Law 1 , Fai-Chu Wong 1,2 and Se-Kwon Kim 3,4
1
2
3
4
*
Department of Chemical Science, Faculty of Science, Universiti Tunku Abdul Rahman, 31900 Kampar,
Malaysia; yew_chye89@hotmail.com (Y.-C.L.); wongfc@utar.edu.my (F.-C.W.)
Centre for Bio-diversity Research, Universiti Tunku Abdul Rahman, 31900 Kampar, Malaysia
Department of Marine Bio-Convergence Science, Pukyong National University, 48513 Busan, Korea;
sknkim@pknu.ac.kr
Institute for Life Science of Seogo (ILSS), Kolmar Korea Co, 137-876 Seoul, Korea
Correspondence: chaitt@utar.edu.my; Tel.: +60-5-468-8888
Academic Editor: Orazio Taglialatela-Scafati
Received: 29 November 2016; Accepted: 8 February 2017; Published: 16 February 2017
Abstract: Marine invertebrates, such as oysters, mussels, clams, scallop, jellyfishes, squids, prawns,
sea cucumbers and sea squirts, are consumed as foods. These edible marine invertebrates are sources
of potent bioactive peptides. The last two decades have seen a surge of interest in the discovery
of antioxidant peptides from edible marine invertebrates. Enzymatic hydrolysis is an efficient
strategy commonly used for releasing antioxidant peptides from food proteins. A growing number
of antioxidant peptide sequences have been identified from the enzymatic hydrolysates of edible
marine invertebrates. Antioxidant peptides have potential applications in food, pharmaceuticals
and cosmetics. In this review, we first give a brief overview of the current state of progress of
antioxidant peptide research, with special attention to marine antioxidant peptides. We then focus
on 22 investigations which identified 32 antioxidant peptides from enzymatic hydrolysates of
edible marine invertebrates. Strategies adopted by various research groups in the purification
and identification of the antioxidant peptides will be summarized. Structural characteristic of the
peptide sequences in relation to their antioxidant activities will be reviewed. Potential applications of
the peptide sequences and future research prospects will also be discussed.
Keywords: antioxidant peptide; enzymatic hydrolysis; marine invertebrate; peptide identification;
peptide purification
1. Introduction
Reactive oxygen species (ROS) and reactive nitrogen species (RNS) are free radicals that play vital
roles in the body, such as participating in intracellular signaling cascades and host defense against
invading pathogens. Imbalance between free radical production and endogenous antioxidant defense
may result in cellular oxidative stress, causing oxidative damage to various cellular components,
such as DNA, proteins and membrane lipids. Oxidative damage has been implicated in and is believed
to be a key factor causing various pathological conditions, such as heart disease, stroke, arteriosclerosis,
diabetes, and cancer [1–4]. Furthermore, accumulation of oxidized proteins underlies the aging process
in humans and the development of some age-related diseases [5]. Dietary intake of antioxidants has
been associated with reduced risks of some of the aforementioned diseases [6,7]. The effectiveness of
antioxidant therapies in preventing and/or managing human pathologies was also highlighted [8–10].
Oxidation in the form of lipid peroxidation is also a deleterious process occurring in foodstuffs.
Lipid peroxidation is a major cause of rancidity and reduced shelf-life in foods [11]. Oxidation compromises
the nutritive value of food, in addition to causing the loss of flavors and the formation of toxic by-products.
Mar. Drugs 2017, 15, 42
300
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2017, 15, 42
An effective approach to keep oxidation of food constituents in check is by incorporating synthetic
food-grade antioxidants (e.g., butylated hydroxytoluene (BHT), butylated hydroxyanisole (BHA),
tert-butylhydroquinone (TBHQ), and propyl gallate) during food processing [11,12].
Free radicals can be quenched through a number of mechanisms. Antioxidants can directly
scavenge free radicals (e.g., via hydrogen atom transfer or electron transfer) or prevent free radical
formation by chelating metal ions. Antioxidants can also interrupt the radical chain reactions of lipid
peroxidation, thus retarding its progression. There is currently great interest to search for natural
antioxidants as alternatives to the synthetic ones for applications in food processing, functional food
development, cosmetic formulations, and therapy. One of the factors driving such a trend is the concern
about potential side effects of synthetic antioxidants and consumer preference for natural antioxidants,
which are perceived as relatively safe, especially those derived from edible sources [11–14].
The last two decades have seen a marked increase worldwide in studies searching for bioactive
peptides from edible animals and plants as well as from food products and processing wastes derived
from them. Bioactive peptides have a broad range of activities, such as antioxidant, antimicrobial,
antiviral, antitumor, antihypertensive, immunomodulatory, analgesic, anti-diabetic, and neuroprotective
activities [15]. Such bioactive peptides are potential candidates for development into future peptide
drugs. The global market for peptide therapeutics was valued at USD 17.5 billion in 2015, expected to
hit USD 47 billion by 2025 [16]. There are more than 60 FDA-approved peptide drugs already on the
market [17], with about 400 more peptide therapeutics in different phases of preclinical and clinical
development as of February 2016 [16]. Overall, peptide drugs are recognized as one of the fastest
growing segment, with enormous future growth potential, in the pharmaceutical industry [16,17].
Bioactive peptides are encrypted in an inactive state within the structure of the parent proteins.
Such peptides become active after release from the parent proteins, which can be achieved by means of
in vitro enzymatic hydrolysis, gastrointestinal digestion, and food processing (e.g., fermentation) [18–20].
The activation of antioxidant peptides upon their liberation from the parent protein may be due to
their less restricted interaction with free radicals, unhindered by their positions within the bulky
protein structure or by poor lipid solubility of the parent protein. The aforementioned proposal,
however, remains to be experimentally validated. Enzymatic hydrolysis under optimal conditions is
the most efficient and reliable strategy for releasing antioxidant and other bioactive peptides from
food proteins, including proteins of the marine origin [21–23]. It is also the preferred method for
bioactive peptide production in the food and pharmaceutical industries [24]. Antioxidant peptides
liberated upon enzymatic hydrolysis of parent proteins are small, ranging from 2 to 20 residues [13,18].
Such peptides usually contain varying percentages of hydrophobic amino acids (e.g., Ala, Leu, and Pro)
or aromatic amino acids (e.g., Tyr, His, and Phe) in their sequences. The functionality of antioxidant
peptides has been attributed to the ability of such amino acid constituents to donate protons to free
radicals, chelate metal ions and/or trap lipid peroxyl radicals [25,26].
Antioxidant peptides are an important area of scientific interest. The input query “antioxidant
peptide” OR “antioxidative peptide” in the Scopus database [27], as of November 2016, revealed
542 publications between the years 1992 and 2016. An increasing trend in the number of publications
can be seen over the last 24 years, leading to about 80 publications annually between 2013 and 2016
(see Figure S1). A more precise input query “antioxidant peptide” OR “antioxidative peptide” AND
“marine” in the Scopus database revealed 22 publications between 2009 and 2016. This comprised
of 15 journal article, five book chapters and two reviews. As of September 2016, 531 antioxidant
peptide sequences ranging between 2 and 20 residues in length have been deposited into the BIOPEP
database [28]. All these point to a growing interest in the research area of antioxidant peptides over
the last two decades.
Antioxidant peptides have been isolated and identified from numerous edible marine animals,
including various fish species [29,30], and edible marine invertebrates, such as mussels [31,32],
clams [33,34], and oysters [35,36]. Identification of antioxidant peptides from food products manufactured
from edible marine invertebrates, e.g., fermented mussel sauce [37,38] and shrimp paste [39], has
301
Mar. Drugs 2017, 15, 42
also been reported. The effectiveness of the marine invertebrate peptides in scavenging ROS,
chelating metals, suppressing lipid peroxidation, and protecting cells against ROS-induced toxicity
has been demonstrated by using chemical and cell-based assays [40–43]. Notably, the in vivo effects of
antioxidant peptides identified from the mussel [44] and sea squirt [45] were reported, suggesting that
antioxidant peptides identified from edible marine invertebrates can have biological or physiological
significance. Collectively, the aforementioned findings suggest that edible marine invertebrates deserve
more attention than they have received to date as a promising source of potent antioxidant peptides.
In reviews on marine bioactive peptides, enzymatic hydrolysates and antioxidant peptides of fish
and their processing by-products often overshadowed those of edible marine invertebrates [18,29,46,47].
In this review, we focus on antioxidant peptides purified and identified from enzymatic hydrolysates
of edible marine invertebrates, including those prepared by using in vitro gastrointestinal digestion.
This review presents an overview of enzyme-assisted production, assay-guided purification,
and identification of antioxidant peptides, in addition to their structure–activity relationships.
Potential applications of the pure antioxidant peptides in food, therapy and cosmetics are
discussed. Future research opportunities, in relation to gaps in current knowledge, are highlighted.
When preparing for this review, we analyzed the published antioxidant peptide sequences that
were identified from edible marine invertebrates for additional functions (e.g., anticancer activity)
or properties (e.g., allergenicity) by using a number of in silico tools. The significance of the
new information is discussed in this review where relevant. Our emphasis is on studies which
have successfully identified potential antioxidant peptides from edible marine invertebrates.
Nonetheless, evidence from protein hydrolysate studies may still be referred to where appropriate.
We also highlight studies which have taken the additional step of validating the antioxidant activity of
the identified peptide sequences by using synthetic peptides. Literature pertaining to the identification
of antioxidant peptides naturally occurring in the cells of edible marine invertebrates, or those present
in fermented products (e.g., [38,39]) is not within the scope of this review.
2. Enzyme-Assisted Production, Purification, and Identification of Antioxidant Peptides
Antioxidant peptides encrypted in the proteins of edible marine invertebrates have been effectively
released by enzymatic proteolysis and identified. Table 1 shows the primary structures of 13 edible
marine invertebrate-derived antioxidant peptides whose activities were validated using chemically
synthesized peptides. A general workflow employed in the purification and identification of
antioxidant peptides from edible marine invertebrates is shown in Figure 1.
Table 1. Primary structures of selected antioxidant peptides identified from edible marine invertebrates.
Antioxidant Peptides
References
VKP, VKCFR
IKK, FKK, FIKK
HMSY, PEASY
LWHTH
LPHPSF
PIIVYWK, FSVVPSPK, TTANIEDRR
GPLGLLGFLGPLGLS
[42]
[48]
[49]
[50]
[45]
[32]
[51]
302
Mar. Drugs 2017, 15, 42
Figure 1. A workflow used for the purification and identification of antioxidant peptides from
enzymatic hydrolysates of edible marine invertebrates.
2.1. Production of Antioxidant Peptides
Different forms of protein samples from edible marine invertebrates have been used as the starting
material for the isolation of antioxidant peptides. Crude homogenate or mince of samples in cold
water as well as pulverized, lyophilized samples, without further protein enrichment, were used
for proteolysis and subsequent isolation of antioxidant peptides from the oyster [35], prawn [48],
short-neck clam [34], mussels [32,44,52,53], shrimp processing waste [54], scallop female gonad [49],
and sea squirt [50]. Isopropanol was used to defat the homogenates of the blood clam [33] and blue
mussel [31] prior to their use in the preparation of hydrolysates. To prepare a protein isolate to be
used for hydrolysis, Zhou et al. [55] used the trichloroacetic acid/acetone precipitation method to
extract proteins from the body wall of the sea cucumber. Nonetheless, most of the aforementioned
studies used either crude homogenates or pulverized samples as their starting materials for antioxidant
peptide isolation. This suggests that the preparation of a protein isolate or protein-enriched sample is
not a requisite for successful isolation of antioxidant peptides.
Enzymatic hydrolysis of protein samples of edible marine invertebrates has been performed
by using individual proteases or a combination of digestive proteases with the aim of simulating
gastrointestinal digestion. Proteases of animal, plant, and microbial origins that are commercially
available in pure form, such as pepsin, trypsin, α-chymotrypsin, papain, alcalase, and neutrase, have
been used to prepare protein hydrolysates from edible marine invertebrates. Other commercial
303
Mar. Drugs 2017, 15, 42
proteases that have been used, but less frequently, include kojizyme, flavourzyme, protamex,
neutral protease, acid protease, newlase F, pronase and pancreatin [44,45,48,50,53,55].
Owing to the unique cleavage specificities of the proteases, when the same protein sample is
treated with different proteases, hydrolysates each consisting of a complex pool of polypeptides
hydrolyzed to different extents can be produced. Proteolysis and the generation of various peptides
often alter the antioxidant activity of the original protein sample. Hence, one strategy used by
some studies was comparing the degree of hydrolysis (DH), yield, and/or antioxidant activity of
multiple hydrolysates produced by using different proteases under optimum pH and temperature
conditions. A hydrolysate was then chosen and used for the subsequent purification and identification
of antioxidant peptides [31,33,41,43–45,48,50,53,55–57]. For example, Rajapakse, Mendis, Byun and
Kim [43] hydrolyzed squid muscle separately with pepsin, trypsin and α-chymotrypsin for six hours.
Tryptic hydrolysate, which showed the highest DH and inhibitory activity against linoleic acid oxidation,
was selected for further purification. This led to the discovery of two potent antioxidant oligopeptides
NADFGLNGLEGLA and NGLEGLK [43]. A number of studies successfully identified antioxidant
peptides from optimum hydrolysates chosen based on only antioxidant efficacy, without considering
DH or yield (e.g., [31,44,45,53]). Ko, Kim, Jung, Kim, Lee, Son, Kim and Jeon [45] hydrolyzed sea squirt
with nine proteases. Based on only relative antioxidant efficacies of the hydrolysates, the authors chose
tryptic hydrolysate for further purification; this culminated in the discovery of an antioxidant peptide
LPHPSF [45]. Thus, unless it is the objective of the study to evaluate the effectiveness of proteolysis or
that availability of protein sources is limited, measurements of DH and yield appear omittable when
screening for an optimum hydrolysate for purification of antioxidant peptides.
In contrast to the aforementioned studies, some investigations omitted the tedious process of
screening for an optimum hydrolysate, focusing directly on a protein hydrolysate generated by using
a single protease. The protease treatments in these studies were chosen based on previously reported
efficacy on other species or sample matrices [32,34,35,42,49,51,54]. In these studies, the protease
treatments may not be considered optimum for the samples anymore. Even though antioxidant
peptides were eventually identified in these studies, the questions remain whether a more potent
hydrolysate could have been generated from the samples under investigation, and whether antioxidant
peptides of greater potency could have been discovered.
Reports of the use of in vitro gastrointestinal digestion to release antioxidant peptides from proteins
of edible marine invertebrates, which culminated in the identification of antioxidant peptide sequences,
are scarce. Through the use of pepsin, trypsin and α-chymotrypsin under simulated gastrointestinal
conditions and followed by subsequent purification work, antioxidant peptides LVGDEQAVPAVCVP
and LKQELEDLLEKQE were identified from the mussel [52] and oyster [40], respectively. The use of
a single commercial protease in enzymatic hydrolysis is relatively straightforward when compared with
a combination of several proteases, as is the case in in vitro gastrointestinal digestion. Single-protease
hydrolysis likely allows a better control of the physicochemical conditions of the process, in addition
to that of the compositions and molecular weights of the resulting peptides [58]. For single-protease
hydrolysis, proteolysis is carried out only under a selected optimum temperature and pH. Optimum
hydrolysis duration is often selected by screening a range of different durations to identify the
one which produces the highest DH and/or antioxidant activity (e.g., [31,35,50,56,57]). Often, the
N- or C-terminal amino acid residues of the resulting peptides can be predicted based on the
cleavage specificity of the protease used. On the other hand, in vitro gastrointestinal digestion by
using proteases requires more complicated pH control and is more time-consuming. For example,
simulated gastrointestinal digestion of mussel muscle was performed by first hydrolyzing the sample
with pepsin at 37 ◦ C and pH 2.5 for 120 min. Next, the resulting digest was hydrolyzed by trypsin
and α-chymotrypsin at 37 ◦ C and pH 7.0 for 150 min [52]. Due to the use of multiple proteases
and the unique cleavage specificity of each protease, prediction of the molecular compositions of
the resulting peptides is no longer straightforward. Nevertheless, it is believed that purification of
antioxidant peptides from simulated gastrointestinal digests may increase the chance of producing
304
Mar. Drugs 2017, 15, 42
peptides that resist breakdown by gastrointestinal peptidases in vivo [40,59]. Notwithstanding this
potential advantage, the latter approach is less commonly adopted than the single-protease hydrolysis
approach, possibly owing to the aforementioned difficulties.
2.2. Purification of Antioxidant Peptides
A protein hydrolysate is essentially a mixture comprising of both antioxidant and prooxidant
peptides [60]. Further fractionation will aid in eliminating the prooxidant components [22].
Active hydrolysates produced from edible marine invertebrates were usually subjected to assay-guided
fractionation to enrich and eventually isolate the most potent antioxidant peptides. Peptide variability in
terms of the molecular mass, net charge and polarity/hydrophobicity underlies the basis of separation
techniques used, which include membrane ultrafiltration (UF), low-pressure column chromatography,
fast protein liquid chromatography (FPLC), and high-performance liquid chromatography (HPLC).
Table 2 summarizes the purification techniques, which enabled successful purification and
identification of antioxidant peptides from edible marine invertebrates in various studies.
305
Protease Used for Hydrolysis *
Antioxidant Parameters Used to Guide Purification and
Characterize Purified Peptides
Purification Techniques
Peptide Sequence
Identified
Validated with
Synthetic Peptides
Reference
Oyster (Crassostrea madrasensis)
Papain
DPPH scavenging
OH• scavenging #
FRAP #
Iron chelating #
LPI #
UF
SPE
RP-HPLC
ISIGGQPAGRIVM
×
[36]
Oyster (Crassostrea gigas)
In vitro gastrointestinal digestion
(Pepsin, Trypsin and α-Chymotrypsin
OH• scavenging
O2 •− scavenging
Cellular radical scavenging Protection against OH• -induced DNA
damage
LPI
AEC
RP-HPLC(×2)
LKQELEDLLEKQE
×
[40]
Oyster (Crassostrea talienwhanensis)
Subtilisin (Alcalase)
DPPH scavenging
OH• scavenging
UF
SEC
RP-HPLC(×2)
PVMGA
QHGV
×
[35]
Mussel (Mytilus coruscus)
Papain
DPPH scavenging
OH• scavenging
O2 •− scavenging
Alkyl radical scavenging
In vivo antioxidant defense
UF
AEC
RP-HPLC(×2)
GPC
SLPIGLMIAM
×
[44]
Mussel (Mytilus coruscus)
In vitro gastrointestinal digestion
(Pepsin, Trypsin and α-Chymotrypsin)
LPI
OH• scavenging
O2 •− scavenging
Carbon-centered radical scavenging
AEC
SEC
RP-HPLC
LVGDEQAVPAVCVP
×
[52]
Blue mussel (Mytilus edulis)
Pepsin
DPPH scavenging
ORAC
Protection against H2 O2 -induced cytotoxicity
UF
CEC
RP-HPLC(×2)
PIIVYWK
TTANIEDRR
FSVVPSPK
√
[32]
Blue mussel (Mytilus edulis)
Neutrase
DPPH scavenging
OH• scavenging
O2 •− scavenging
LPI
UF
SEC
RP-HPLC
YPPAK
×
[31]
Blood Clam (Tegillarca granosa)
Neutrase
DPPH scavenging
ABTS scavenging
OH• scavenging
O2 •− scavenging
LPI
UF
AEC
SEC
RP-HPLC
WPP
QP
×
[33]
Short-necked Clam (Ruditapes philippinarum)
α-Chymotrypsin
DPPH scavenging
OH• scavenging
Alkyl radicalscavenging
O2 •− scavenging
UF
AEC
RP-HPLC(×3)
SVEIQALCDM
×
[53]
Short-necked Clam (Ruditapes philippinarum)
Trypsin
DPPH scavenging
Reducing power
Protection against OH• -induced DNA damage
UF
SEC
RP-HPLC
GDQQK
×
[34]
Scallop (Patinopecten yessoensis)
Neutrase
DPPH scavenging #
OH• scavenging
Iron chelating #
Reducing power #
Protection against OH• -induced DNA damage
SEC
HMSY
PEASY
√
[49]
Jellyfish (Rhopilema esculentum)
Alcalase
OH• scavenging
Protection against H2 O2 -induced cytotoxicity
Cellular antioxidant enzyme activity
UF
AEC
RP-HPLC
VKP
VKCFR
√
[42]
Species
Mar. Drugs 2017, 15, 42
Table 2. Selected antioxidant peptides identified from edible marine invertebrates as reported in the literature between years 2000 and 2016.
306
Protease Used for Hydrolysis *
Antioxidant Parameters Used to Guide Purification and
Characterize Purified Peptides
Purification Techniques
Peptide Sequence
Identified
Validated with
Synthetic Peptides
Reference
Jumbo squid (Dosidicus gigas)
Trypsin
LPI
OH• scavenging
Carbon-centered radical scavenging
Iron chelating #
Protection against t-butyl hydroperoxide-induced cytotoxicity
UF
CEC
SEC
RP-HPLC
FDSGPAGVL
NGPLQAGQPGER
×
[41]
Giant squid (Dosidicus gigas)
Trypsin
LPI
OH• scavenging
O2 •− scavenging
Carbon-centered radical scavenging
Protection against t-butyl hydroperoxide-induced cytotoxicity
UF
CEC
SEC
RP-HPLC(×2)
NADFGLNGLEGLA
NGLEGLK
×
[43]
Giant squid (Dosidicus gigas) (skin)
Alcalase
ABTS scavenging
FRAP
UF
SEC
GPLGLLGFLGPLGLS
√
[51]
Trypsin
DPPH scavenging
ABTS scavenging #
O2 •− scavenging #
Total antioxidant capacity #
Reducing power
Iron chelating #
LPI
Protection against OH• -induced DNA damage
AEC SEC
I/L N I/L CCN
×
[56]
Indian squid (Loligo duvauceli)
α-chymotrypsin
DPPH scavenging
OH• scavenging
O2 •− scavenging #
Reducing power
Iron chelating
LPI
Protection against OH• -induced DNA damage
Cellular radical scavenging
AEC
SEC
WCTSVS
×
[57]
Prawn (Penaeus japonicus)
Pepsin
LPI
SEC
CEC
RP-HPLC
IKK
FKK
FIKK
√
[48]
Methanol extraction
CEC
SEC
RP-HPLC(×2)
SVAMLFH
×
[54]
Species
Shortclub cuttlefish (Sepia brevimana)
307
Shrimp processing by-products
Alcalase
DPPH scavenging
Sea cucumber (Stichopus japonicus)
Trypsin
OH• scavenging
O2 •− scavenging
SEC
AEC
SEC
RP-HPLC
GPEPTGPT
GAPQWLR
×
[55]
Sea squirt (Styela clava)
Pepsin
Peroxyl radical scavenging
SEC
RP-HPLC
LWHTH
√
[50]
Trypsin
Peroxyl radical scavenging
DPPH scavenging
OH• scavenging
Cellular radical scavenging
Protection against APPH-induced cytotoxicity
Protection against APPH-induced
ROS generation and cell death in zebrafish embryos
AEC
SEC
RP-HPLC
LPHPSF
√
[45]
Sea squirt (Styela plicata)
* Only the protease which was associated with the peptide sequence identified is listed. # Not tested with purified or synthetic peptides. AEC, anion exchange chromatography; CEC,
cation exchange chromatography; FRAP, Ferric Reducing Antioxidant Power; LPI, lipid peroxidation inhibition; RP-HPLC(
×2), two-step RP-HPLC; RP-HPLC(×3), three-step RP-HPLC;
√
SEC, size exclusion chromatography; SPE, solid phase extraction; UF, ultrafiltration membrane; ×, not validated; , validated.
Mar. Drugs 2017, 15, 42
Table 2. Cont.
Mar. Drugs 2017, 15, 42
Membrane UF of protein hydrolysates is often the first step in the assay-guided purification
of antioxidant peptides from edible marine invertebrates. This technique uses special porous
membranes having certain molecular weight cut-off (MWCO) specifications and made of materials
such as regenerated cellulose and polyethersulfone to fractionate peptides in a protein hydrolysate.
UF membranes with different MWCO values were frequently used in combination for the fractionation
of antioxidant peptides. For example, UF membranes of MWCO 3, 5 and 10 kDa were used to separate
the hydrolysates of squid muscle, squid skin gelatin, and the short-necked clam into multiple fractions
of different molecular mass ranges [34,41,43]. UF membranes of MWCO 1 and 3 kDa were used to
separate a jellyfish protein hydrolysate into three fractions [42]. Less frequently, some studies used only
one UF membrane of a selected MWCO for initial fractionation of hydrolysates [33,35,51]. When the
antioxidant activities of UF fractions were compared, the fraction with the smallest molecular size,
e.g., <1 kDa [33,42] or <3 kDa [31,34,41,43], often showed the strongest activity and was therefore
chosen for further purification.
Following membrane UF, the most active fraction obtained from marine invertebrate protein
hydrolysates was usually further purified by means of size-exclusion chromatography (SEC) and/or
ion exchange chromatography (IEC), either driven by FPLC (e.g., [45,52,56,57]), or carried out as low
pressure column chromatography (e.g., [33,34,50]). Notably, some studies omitted the UF step and
directly purified protein hydrolysates on an SEC and/or IEC column [45,46,56,57]. Sephadex G-15,
G-25 and G-50 are SEC stationary phases that have been used in the purification of antioxidant peptides
from marine invertebrate hydrolysates. Sephadex G-15 was used in the purification of antioxidant
peptides from the oyster [35] and blue mussel [31]. Sephadex G-25 was used more commonly by
other researchers [33,34,41,43,45,48–50,54,56,57]. Zhou, Wang and Jiang [55] used both Sephadex G-25
and G-50 stationary phases to purify antioxidant peptides from the sea cucumber. Elution of SEC
columns was usually performed by using deionized or distilled water and monitored at 214 nm [36],
220 nm [33,34,49,55], or 280 nm [31,45,54,56,57].
IEC can be divided into two broad classes based on the type of exchangers used: anion exchange
chromatography (AEC) and cation exchange chromatography (CEC). For the purification of antioxidant
peptides by AEC from the Indian squid [57], shortclub cuttlefish [56], oyster [40], mussel [44,52],
sea cucumber [55], short-necked clam [53], blood clam [33], sea squirt [45], and jellyfish [42], weak anion
exchangers with diethylaminoethyl (DEAE) exchange groups were used. To purify antioxidant
peptides by CEC from the prawn [48], squid [43], shrimp processing by-products [54], and jumbo
squid skin gelatin [41], resins with sulphopropyl (SP) strong cation exchange groups were used. Prior to
IEC, Zhao, Huang and Jiang [54] extracted lyophilized hydrolysate of shrimp processing by-products
with 90% methanol overnight to remove interfering non-protein compounds having high antioxidant
activity. Most of the aforementioned studies eluted peptide fractions during AEC and CEC by using
a linear NaCl gradient, although step gradient elution with NaCl was also reported for the purification
of antioxidant peptides from the blood clam and sea cucumber [33,55]. Elution profiles of IEC were
monitored in these studies at 215 nm [43], 220 nm [33,41,55], and 280 nm [40,44,45,53,54,56,57].
Some researchers purified their peptide samples on only SEC [34,50], whereas others on only
IEC [32,40], before proceeding to peptide purification by Reversed-Phase HPLC (RP-HPLC). The use
of both SEC and IEC to purify antioxidant peptides from the protein hydrolysates of the prawn [48],
Indian squid [57], shortclub cuttlefish [56], sea squirt [45], and shrimp processing by-products [54] has
also been reported. When purifying antioxidant peptides from the sea cucumber, Zhou, Wang and
Jiang [55] adopted the approach of two-step SEC linked by IEC. Their peptide sample was purified on
a Sephadex G-50 column, followed by a DEAE cellulose DE-52 column, and lastly on a Sephadex G-25
column, guided by OH• and O2 •− scavenging assays. The Sephadex G-25 step allowed them to desalt
their sample prior to subjecting it to RP-HPLC separation [55].
RP-HPLC was almost always the last purification technique performed before the peptides purified
from edible marine invertebrates were taken to peptide sequence determination. Peptide samples were
often purified with low-pressure column chromatography before they were subjected to RP-HPLC
308
Mar. Drugs 2017, 15, 42
purification. Notwithstanding, Asha, Remya Kumari, Ashok Kumar, Chatterjee, Anandan and
Mathew [36] purified an active UF fraction of the oyster protein hydrolysate with four C18 solid
phase extraction (SPE) cartridges connected in series prior to subjecting it to RP-HPLC purification.
With a few exceptions [49,56,57], most studies which successfully identified antioxidant peptides
from edible marine invertebrates purified their peptides by RP-HPLC at least once. RP-HPLC was
carried out using a C18 stationary phase with a linear gradient of acetonitrile either containing low
percentage of formic acid [51], or trifluoroacetic acid (TFA)(e.g., [31–33,36,45,54]), or without any
mobile-phase modifiers [34,41,43,44,50,52,53]. An alternative mobile phase comprising of a linear
gradient of methanol with 0.1% TFA was reported by others who successfully purified and identified
antioxidant peptides from the jellyfish [42] and sea cucumber [55]. Eluted RP-HPLC fractions were
monitored at 214 nm [36,54,55], 215 nm [32,40,41,43,44,52,53], 220 nm [33,34,42,48,50], 230 nm [35],
or 280 nm [31,35,45,61].
Multi-step RP-HPLC involving the use of a semi-preparative C18 column followed by one or two
analytical C18 columns was used to purify antioxidant peptides from the short-necked clam [53],
giant squid [43], oyster [40], hard-shelled mussel [44], and shrimp processing by-products [54].
To isolate antioxidant peptides from the blue mussel, Park, Kim, Ahn and Je [32] purified their sample
on the same semi-preparative C18 column twice, each time using a different linear acetonitrile gradient.
2.3. Identification of Antioxidant Peptides
Following RP-HPLC purification, the purified antioxidant peptides were usually taken to amino
acid sequence identification by using either liquid chromatography-tandem mass spectrometry
(LC-MS/MS) or the Edman degradation method. Typical LC-MS/MS experiments which enabled
successful identification of antioxidant peptides from edible marine invertebrates involved the use
of a quadrupole time-of-flight tandem mass spectrometer, equipped with an electrospray ionization
(ESI) source and run in the positive ion mode (e.g., [42,49]). Alternatively, the use of a hybrid triple
quadrupole/linear ion trap mass spectrometer to sequence antioxidant peptides from the oyster [36],
shortclub cuttlefish [56], and Indian squid [57] was reported. To identify a radical scavenging peptide
from shrimp processing by-products, Zhao, Huang and Jiang [54] used an ESI-triple quadrupole mass
spectrometer run in the negative ion mode. Mass spectra data obtained were typically analyzed with
de novo sequencing algorithms to identify the amino acid sequences of the peptides isolated. At the
same time, information on molecular mass of the isolated peptide can be computed from the mass
spectra data [32,42,55].
On the other hand, using a protein sequencer, the sequencing of antioxidant peptides purified
from the short-necked clam [34,53], hard-shelled mussel [44], blue mussel [31], blood clam [33],
and prawn [48] was carried out based on the Edman degradation reaction. Following peptide
sequencing, mass spectrometry was used by some research groups to determine the molecular masses
of the antioxidant peptides identified [31,33,48]. The use of SEC to further purify the antioxidant
peptide contained in an active RP-HPLC fraction prior to determining the amino acid sequence of the
peptide by using the Edman degradation method was also reported [44,53].
After an antioxidant peptide is identified, synthesizing the peptide and validating its bioactivity
will provide valuable confirmation of the function of the antioxidant peptide. A search of the literature
revealed that of the 22 reports published in the last 16 years of antioxidant peptides identified from
edible marine invertebrates, only seven studies have validated the antioxidant peptides identified
with chemically synthesized peptides [32,42,45,48–51]. For synthetic peptide production, Fmoc-based
solid-phase peptide synthesis was typically carried out. Purity of the synthetic peptide and its
molecular mass were analyzed by means of RP-HPLC and mass spectrometry [32,45,49,51].
3. Evaluation of Antioxidant Activities
Different types of chemical and cell-based assays have been used in the assay-guided purification
and the characterization of antioxidant peptides from edible marine invertebrates (Table 2). Among the
309
Mar. Drugs 2017, 15, 42
chemical assays used, radical scavenging and lipid peroxidation inhibition assays were common.
Concerning the principles as well as the advantages and limitations of the antioxidant assays
listed in Table 2, we refer the reader to reviews by Zhong and Shahidi [11], Sila and Bougatef [18],
Samaranayaka and Li-Chan [21], and Wu, et al. [46].
The 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging assay, likely due to its simplicity,
was used in quite a number of studies to guide the purification of antioxidant peptides from the
oyster [35,36], mussel [31,32], blood clam [33], short-necked clam [34], scallop female gonad [49],
shortclub cuttlefish [56], Indian squid [57], and shrimp processing by-products [54]. Besides DPPH
scavenging activity, the ability of antioxidant peptides identified from edible marine invertebrates
to quench ABTS, OH• , O2 •− , alkyl, peroxyl, and carbon-centered radicals have been reported
(Table 2). Using a linoleic acid model system, the ability of antioxidant peptides identified from the
oyster [40], mussel [31,52], blood clam [33], squid [41,43], shortclub cuttlefish [56], Indian squid [57],
and prawn [48] to inhibit lipid peroxidation has also been demonstrated. The ability to protect against
OH• -induced DNA damage has been demonstrated for oyster-derived peptide LKQELEDLLEKQE [40],
short-necked clam-derived GDQQK [34], scallop-derived HMSY and PEASY [49], Indian squid-derived
WCTSVS [57], and shortclub cuttlefish-derived I/L N I/L CCN [56]. Using the fluorescence
probe DCFH-DA, cellular radical scavenging activity of LKQELEDLLEKQE and LPHPSF in mouse
macrophage cells (RAW 264.7) [40,45] and that of WCTSVS in human breast adenocarcinoma cells
(MCF7) [57] has been demonstrated.
Antioxidant peptides identified from the giant squid [43], blue mussel [32], jellyfish [42],
sea squirt [45], and jumbo squid skin gelatin [41] were shown to mitigate radical-induced cytotoxicity
(Table 2). Cell types used in these studies were human lung fibroblast cells [41,43], Chang
liver cells [32], RAW 264.7 [45], and rat cerebral microvascular endothelial cells (RCMEC) [42].
Notably, the cytoprotective activity of PIIVYWK, FSVVPSPK, VKP, and VKCFR was confirmed using
chemically synthesized peptide sequences, rather than purified fractions [32,42]. Mendis, Rajapakse,
Byun and Kim [41] found that the efficacy of FDSGPAGVL and NGPLQAGQPGER in protecting human
lung cells against t-butyl hydroperoxide-induced oxidative cell death was comparable to or surpassed
that of α-tocopherol. On the other hand, the concentration range of Indian squid-derived WCTSVS that
was non-toxic to MCF7 cells [57], of shortclub cuttlefish-derived I/L N I/L CCN non-toxic to human
colorectal adenocarcinoma cells (HT29) [56], and of sea squirt-derived LPHPSF non-toxic to RAW
264.7 cells [45] have been reported. LKQELEDLLEKQE purified from the oyster was also reportedly
non-toxic to human embryonic lung fibroblast and RAW 264.7 cells, although the range of peptide
concentration tested was not reported [40].
Little work has been done to elucidate the molecular or biochemical basis underlying the
cytoprotective effects of antioxidant peptides identified from edible marine invertebrates. The two
peptides PIIVYWK and FSVVPSPK derived from the blue mussel protected human liver cells against
H2 O2 -induced toxicity by upregulating the protein expression of hemeoxygenase-1 [32]. Protection of
RCMEC cells by jellyfish-derived peptides VKP and VKCFR against H2 O2 -induced toxicity, on the
other hand, was associated with enhanced enzymatic activities of superoxide dismutase, catalase,
and glutathione peroxidase [42]. Current evidence is preliminary, but the observed cytoprotection
appears attributable to the ability of the antioxidant peptides to activate the expression of cytoprotective
enzymes. To the authors’ knowledge, only two animal studies have been conducted to investigate the
effects of antioxidant peptides identified from any edible marine invertebrates. Oral administration of
peptide SLPIGLMIAM to mice was reported to inhibit the level of malondialdehyde in the liver,
thus providing evidence for in vivo antioxidant effect [44]. The treatment enhanced superoxide
dismutase activity in vivo but had no effects on catalase or glutathione peroxidase activities [44].
Recently, sea squirt-derived antioxidant peptide LPHPSF was shown to be capable of attenuating
radical-induced cell death and ROS production in zebrafish embryos [45]. Figure 2 summarizes modes
of action reported for antioxidant peptides identified from edible marine invertebrates.
310
Mar. Drugs 2017, 15, 42
Figure 2. Antioxidant mechanisms reported for antioxidant peptides identified from edible
marine invertebrates.
Owing to the diverse types of assays and assay conditions used to characterize the bioactivities of
food-derived antioxidant peptides, comparison between studies is often difficult [21]. For example,
Zhou, Wang and Jiang [55] and Sudhakar and Nazeer [57] reported markedly different levels of BHT
potency in their hydroxyl radical and superoxide anion radical scavenging assays. Such a discrepancy
is likely due to the different assay protocols used in the two studies. Chi et al. [33] compared the EC50
values of blood clam-derived WPP for DPPH and ABTS scavenging activities with EC50 values reported
for other antioxidant peptides by other research groups. Such a comparison will be more meaningful if
identical assay conditions and ideally an identical positive control were established between studies
to check for laboratory-to-laboratory variations. Although Chi et al. [33] and Zhuang et al. [62] both
ran the DPPH and ABTS scavenging assays using ascorbic acid as the positive control, comparison
of relative potency of peptides between studies remains difficult because EC50 for ascorbic acid was
reported by only Zhuang et al. [62]. Comparison of antioxidant potential between peptides based on
data obtained from different antioxidant assay procedures in different studies (e.g., [31,32]) should
therefore be considered with caution.
4. Molecular Characteristics and Structure–Activity Relationship
The structure–activity relationships (SAR) of food-derived antioxidant peptides were recently
reviewed [18,25,26]. Comprehension of SAR may contribute towards an effective prediction of potential
antioxidant activity in a new peptide and the development of strategies for enzyme-assisted release of
antioxidant peptides from food proteins [18]. Generally, structural characteristics such as molecular
mass, hydrophobicity, amino acid composition, and peptide sequence are considered determinants of
the antioxidant activity of a peptide [25,26]. Despite such generalizations, current knowledge of the
SAR of antioxidant peptides is still incomplete.
In the context of molecular mass, a majority of the food-derived antioxidant peptides have
molecular masses ranging between 500 and 1800 Da [21]. Concurring with this, we found that 26
of the 32 antioxidant peptides identified from edible marine invertebrates fall within this range (Table 3).
311
Mar. Drugs 2017, 15, 42
Peptides having smaller molecular masses are generally believed to have greater antioxidant activity
than those having larger masses [25,26]. In accordance with this, during the fractionation of marine
invertebrate protein hydrolysates with UF membranes, peptidic fractions having the lowest molecular
mass range showed the highest DPPH radical scavenging activity [31,33,36] and the highest hydroxyl
radical scavenging activity [42,53]. Similarly, UF fractions with the lowest molecular mass range
(<3 kDa), which were prepared from the giant squid muscle [43] and jumbo squid skin gelatin [41],
had the highest inhibitory activity against linoleic acid oxidation relative to other UF fractions in
the same study. By contrast, in SEC or gel filtration chromatography, the peptidic fraction with the
lowest molecular mass was not always the most potent antioxidant fraction. SEC fractions with the
lowest molecular mass were reported to be the most active fraction in scavenging DPPH [54,57],
hydroxyl [35,57], and peroxyl [50] radicals, as well as having the highest reducing power [57].
Furthermore, others reported that SEC fractions with intermediate molecular masses were the most
active in scavenging DPPH [31,33,34,49,56] and ABTS [51], as well as having the strongest reducing
power [34,51,56]. Zhou, Wang and Jiang [55] had purified antioxidant peptides from a sea cucumber
protein hydrolysate by using a two-step SEC. In the first step, the fraction with the lowest molecular
mass showed the highest superoxide and hydroxyl scavenging activity. In the second step, the fraction
with the highest molecular mass was the most potent [55]. Alemán et al. [51] suggested that in SEC,
a peptidic fraction with the lowest molecular mass may contain large number of free amino acids and
small peptides lacking antioxidant activity. Taken together, the aforementioned discrepancies imply
that the notion of smaller peptides exhibiting greater antioxidant activity may be oversimplified, or is
only applicable to the analysis of protein hydrolysates purified by certain techniques. The proposal
thus contributes only limited, if any, knowledge about the SAR of antioxidant peptides.
Table 3. Molecular masses of 32 antioxidant peptides identified from edible marine invertebrates.
Antioxidant Peptides
Molecular Mass (Da)
References
QP
VKP
IKK
WPP
FKK
QHGV
PVMGA
FIKK
HMSY
PEASY
YPPAK
GDQQK
VKCFR
I/L N I/L CCN
WCTSVS
LWHTH
LPHPSF
NGLEGLK
SVAMLFH
FSVVPSPK
FDSGPAGVL
PIIVYWK
SLPIGLMIAM
TTANIEDRR
SVEIQALCDM
NGPLQAGQPGER
ISIGGQPAGRIVM
NADFGLNGLEGLA
GPLGLLGFLGPLGLS
GPEPTGPTGAPQWLR
LVGDEQAVPAVCVP
LKQELEDLLEKQE
243.23
342
388
398.44
422
440
518
535
536.16
565.21
574
574.27 *
651
679.5
682.5
692.2
696.3
747
804.4
860.09
880.18
1004.57
1044.57 *
1074.54
1107.49 *
1241.59
1297.72
1307
1409.63 **
1563
1590
1600
[33]
[42]
[48]
[33]
[48]
[35]
[35]
[48]
[49]
[49]
[31]
[34]
[42]
[56]
[57]
[50]
[45]
[43]
[54]
[32]
[41]
[32]
[44]
[32]
[53]
[41]
[36]
[43]
[51]
[55]
[52]
[40]
* Calculated online using PepDraw [63]; ** Calculated from the m/z value reported.
312
Mar. Drugs 2017, 15, 42
Hydrophobicity is an important determinant of antioxidant activity of peptides. The presence of
hydrophobic residues allows an antioxidant peptide to interact with lipid-soluble free radicals and
retard lipid peroxidation [64]. In agreement with this, 15 antioxidant peptides identified from edible
marine invertebrates, which inhibited lipid peroxidation in vitro, contain 28%–100% hydrophobic
residues in their sequences (Table 4). In fact, the 12 antioxidant peptides identified from edible marine
invertebrates, whose antioxidant activities (radical scavenging, reducing power, and inhibition of lipid
peroxidation) were validated by using synthetic peptides, contain 22%–71% hydrophobic residues
(Table 5). Alemán et al. [51] compared the reducing power and ABTS radical scavenging activity of three
peptides having the same molecular mass, namely GPLGLLGFLGPLGLS, GPOGOOGFOGPOGOS
(where O represents hydroxyproline), and GPOGOOGFLGPOGOS. The peptide GPLGLLGFLGPLGLS,
the most hydrophobic sequence of the three, was found to have the strongest antioxidant activity [51].
Apparently, hydrophobicity may confer antioxidant activity to peptides not only in a lipid oxidation
model, but also via other antioxidant mechanisms.
Table 4. Percentages of hydrophobic residues in 15 edible marine invertebrate-derived antioxidant
peptides, which exhibited lipid peroxidation inhibitory activity.
Antioxidant Peptides
Hydrophobic Amino Acid Residue (%) *
References
NGLEGLK
LKQELEDLLEKQE
NGPLQAGQPGER
IKK
FKK
WCTSVS
I/L N I/L CCN
FDSGPAGVL
NADFGLNGLEGLA
QP
FIKK
ISIGGQPAGRIVM
YPPAK
LVGDEQAVPAVCVP
WPP
28.57
30.77
33.33
33.33
33.33
33.33
33.33
44.44
46.15
50
50
53.85
60
64.29
100
[43]
[40]
[41]
[48]
[48]
[57]
[56]
[41]
[43]
[33]
[48]
[36]
[31]
[52]
[33]
* Percentages of hydrophobic residues were computed manually, based on the classification of A, I, L, M, F, P, W,
and V as hydrophobic amino acids (The IARCTP53 Database [65]).
Table 5. Percentages of hydrophobic residues in 13 edible marine invertebrate-derived antioxidant
peptides, whose activities were confirmed using pure synthetic peptides.
Antioxidant Peptides
Hydrophobic Amino Acid Residue (%) *
References
TTANIEDRR
HMSY
IKK
FKK
PEASY
LWHTH
VKCFR
FIKK
GPLGLLGFLGPLGLS
FSVVPSPK
VKP
LPHPSF
PIIVYWK
22.22
25
33.33
33.33
40
40
40
50
60
62.5
66.67
66.67
71.43
[32]
[49]
[48]
[48]
[49]
[50]
[42]
[48]
[51]
[32]
[42]
[45]
[32]
* Percentages of hydrophobic residues were computed manually, based on the classification of A, I, L, M, F, P, W,
and V as hydrophobic amino acids (The IARCTP53 Database [65]).
313
Mar. Drugs 2017, 15, 42
Amino acid compositions and peptide sequences also influence the antioxidant activity of
a peptide [25,26]. Food-derived antioxidant peptides often contain hydrophobic residues at the
N-terminus, in addition to having Pro, His, Tyr, Trp, Met, and Cys in the peptide sequences [21].
Examination of the list of 32 antioxidant peptides identified from edible marine invertebrates
(Table 3) revealed 18 sequences containing a hydrophobic residue at the N-terminus (FDSGPAGVL,
FIKK, FKK, FSVVPSPK, I/L N I/L CCN, IKK, ISIGGQPAGRIVM, LKQELEDLLEKQE, LPHPSF,
LVGDEQAVPAVCVP, LWHTH, PEASY, PIIVYWK, PVMGA, VKCFR, VKP, WCTSVS, and WPP).
The 14 other peptides in Table 3, although lacking a hydrophobic N-terminal residue, contain at least
one hydrophobic residue in their sequences. The ability of some of the aforementioned peptides to
inhibit lipid peroxidation (Table 4) may therefore be attributable, at least in part, to the presence of
hydrophobic residues. GDQQK identified from the short-necked clam is the only antioxidant peptide
which contains no hydrophobic residue in its sequence. At present there is no report of GDQQK
having any lipid peroxidation inhibitory activity [34].
His-containing peptides can exert their antioxidant effects through the hydrogen donating, lipid
peroxyl radical trapping, and metal ion chelating actions of the His imidazole group [66]. On this
score, the presence of His residue may account for, to a certain extent, the radical scavenging activities
exhibited by QHGV [35], LWHTH [50], SVAMLFH [54], LPHPSF [45] and HMSY [49]. On the other
hand, aromatic amino acid residues (e.g., Tyr, Trp and Phe) in peptides may exert antioxidant effects
by donating protons to electron-deficient free radicals [26,67]. Thus, the presence of aromatic amino
acid residues may account for the antioxidant activities demonstrated by some peptides identified
from edible marine invertebrates (e.g., WPP, FKK, and FIKK).
IKK (388 Da) and FKK (422 Da), two antioxidant tripeptides identified from the prawn, showed
different levels of inhibition against linoleic acid oxidation despite both containing one hydrophobic
residue. Furthermore, a mixture of the constituent amino acids at the same concentrations as the
peptides showed no antioxidant activity [48]. This suggests that the specific amino acid sequences,
and more specifically, the identity of the N-terminal residue of the tripeptides, are key to their
potency as antioxidants. Wu et al. [49] compared the antioxidant activity of two peptides of similar
molecular masses that were identified from scallop female gonads, namely HMSY (536 Da) and
PEASY (565 Da). HMSY, despite its lower content of hydrophobic residues (25%), exhibited 4.6-fold
stronger hydroxyl radical scavenging activity than PEASY (40% hydrophobic residues) [49]. It was
suggested that antioxidant activity of the two peptides may be attributed to the Tyr residue at the
C-terminus of the peptides [49]. Nevertheless, considering their distinct difference in antioxidant
potency, the specific amino acid sequences in HMSY and PEASY may have imparted different levels of
antioxidant effects too.
Several antioxidant peptides identified from edible marine invertebrates which exhibited lipid
peroxidation inhibition activity (Table 4) were amphiphilic in nature. For example, NGLEGLK,
NGPLQAGQPGER, and FIKK are antioxidant peptides containing one or more hydrophilic, basic
amino acids (e.g., K and R), in addition to varying percentages of hydrophobic residues in their
sequences. The lipophilic and hydrophilic amino acid residues may have collectively contributed to
the overall antioxidant activity of the peptides. It was noted that the amphiphilic nature of peptides
may influence their antioxidant activity by facilitating their interaction with a hydrophobic target
and also proton exchanges with free radicals [26]. Amphiphilic peptides may reside in the oil-water
interface and effectively quench free radicals in both the aqueous and oil phases of a linoleic acid
emulsion system [68].
Altogether, despite others’ assertions [25,26], molecular mass is not a reliable determinant of
antioxidant activity of peptide fractions derived from edible marine invertebrates. On the other hand,
our assessment of the hydrophobicity and amino acid compositions of the antioxidant peptides
identified from edible marine invertebrates supports the proposal that these two parameters are
important determinants of peptide antioxidant efficacy [25,26]. Thus, hydrophobicity and amino
314
Mar. Drugs 2017, 15, 42
acid compositions are two criteria that are useful to future efforts to develop strategies to discover
antioxidant peptides from edible marine invertebrates based on SAR knowledge.
5. Potential Applications in Food, Therapy and Cosmetics
The bioactive peptide ingredient market, currently dominated by the soy and dairy industries,
is very competitive [69]. Bioactive peptides, in pure form and as an unpurified mixture,
have been incorporated into a number of functional foods and dietary supplements already on
the market [64,69–71]. At present, a number of peptides with well-established antioxidant effects
are commercially available as dietary supplements, e.g., reduced glutathione, carnosine, anserine,
and melatonin. Thus there is market demand for antioxidant peptide-based supplements or functional
foods. Nevertheless, marine peptide-based functional foods and dietary supplements with approved
antioxidant health claims are scarce [12,72]. To the authors’ knowledge, health foods or supplements
containing pure antioxidant peptides identified from edible marine invertebrates are either unavailable
or have not been documented in the literature. Apparently, opportunities abound for the development
of novel foods or dietary supplements containing antioxidant peptides identified from edible marine
invertebrates. On this score, peptides which exhibited antioxidant potential in cell culture models and
in mice, for example, VKP and VKCFR identified from the jellyfish [42] and SLPIGLMIAM identified
from the mussel [44] are promising candidates for the development of high-value peptide ingredients
for health food or supplements. Furthermore, VKP and VKCFR which demonstrated antioxidant and
angiotensin converting enzyme inhibitory activities [42] as well as WPP which showed antioxidant
and antiproliferative potential [33] are valuable candidates for the development of multifunctional
health foods or supplements.
Antioxidant peptides which can inhibit lipid oxidation are potentially useful in the preservation
of lipid-rich foods [18]. Besides food quality preservation during storage, antioxidant peptides
incorporated into foodstuffs can provide nutrients in the form of amino acids when consumed,
which is an advantage over synthetic antioxidants. Among the antioxidant peptides identified from
edible marine invertebrates, 15 of them inhibited in vitro lipid oxidation (Table 4). Peptides isolated
from the giant squid (NADFGLNGLEGLA, and NGLEGLK) [43], mussel (LVGDEQAVPAVCVP) [52],
and oyster (LKQELEDLLEKQE) [40], for instance, were comparable or superior to lipid-soluble
antioxidant alpha-tocopherol in inhibiting lipid peroxidation. Tripeptide WPP isolated from blood clam
protein hydrolysate was as effective as glutathione in attenuating lipid peroxidation [33]. Among the
15 peptides, prawn muscle-derived IKK, FKK, and FIKK are the most notable. Their ability to dampen
lipid peroxidation, validated using chemically synthesized peptides designed based on the identified
sequences, surpassed that of alpha-tocopherol [48]. Currently, the antioxidant effects of edible marine
invertebrate-derived peptides in food systems are a gap in knowledge. Nevertheless, some work
has been done using protein hydrolysates prepared from edible marine invertebrates. Squid protein
hydrolysate prepared using papain was shown to retard lipid oxidation in a sardine mince model
system as effectively as ascorbic acid [73]. Cuttlefish skin gelatin hydrolysate prepared with alcalase
delayed lipid oxidation in cooked turkey meat sausage during storage at 4 ◦ C [74]. Protein hydrolysates
prepared by alcalase hydrolysis of shrimp waste, when applied as a dipping treatment on whole Croaker
fish, reduced lipid oxidation and maintained fish skin color during storage at 4 ◦ C for 10 days [75].
Recently, the peptide PAGT isolated from Amur sturgeon skin gelatin was reported to inhibit lipid
oxidation when added to the Japanese sea bass mince [76] and to retard both lipid and protein oxidation
when applied in combination with caffeic acid to the same mince model [77]. These studies [76,77]
suggest that besides protein hydrolysates, pure antioxidant peptides may be developed into novel
food additives to be used for delaying oxidative rancidity and maintain food quality. Edible marine
invertebrate-derived peptides with the ability to inhibit lipid oxidation in vitro (Table 2) have potential
applications as food preservatives, but future work is required to first investigate their efficacy in food
systems. Furthermore, issues such as potential unfavorable effects on food organoleptic properties
and antioxidant peptide stability following food processing operations (e.g., heat treatment) have
315
Mar. Drugs 2017, 15, 42
to be addressed [21]. To make their application as food antioxidant additives economically feasible,
it is crucial that such peptides have considerably higher efficacy than crude protein hydrolysates,
thus allowing the peptides to be used at low quantities (0.001%–0.02%) [18]. Otherwise, the use of
crude protein hydrolysates, e.g., those prepared from the squid, cuttlefish skin gelatin and shrimp
waste [73–75], are likely more cost-effective options as food antioxidant additives. Moreover, certain
aromatic and hydrophobic amino acids that confer antioxidant activity on peptides may impart
bitterness. Antioxidant peptides having high potency can be added to foodstuffs in small quantities,
thus minimizing the issue of food bitterness [78].
Antioxidant peptides have promising future applications as therapeutics or adjunct
therapeutics against oxidative damage-related diseases or conditions. In rats, the ability of a
mitochondrion-targeted antioxidant peptide SS31 to reduce myocardial lipid peroxidation and infarct
size in ischemia-reperfusion injury was reported [79]. The peptide also mitigated kidney injury in
diabetic mice [80] and retinal damage in diabetic rats [81]. In a mouse model of burn injury, the
antioxidant peptide SS31 alleviated symptoms of burn injury and promoted recovery of skeletal muscle
mitochondrial functions [82,83]. An antioxidant peptide identified from ostrich egg white protein
hydrolysate was also shown to promote wound healing in rats [84]. At present, the effects of pure
antioxidant peptides identified from edible marine invertebrates have not been tested in animal models
of human diseases. Future research in this direction should provide a better understanding of the
potential of edible marine invertebrate-derived antioxidant peptides as therapeutic agents for targeting
oxidative stress-related diseases or conditions. One current focus of the pharmaceutical industry
is the development of peptide drugs having multiple pharmacological activities [17]. On this score,
some antioxidant peptides identified from edible marine invertebrates (Table 2) may have potential
applications in the development of future multifunctional peptide therapeutics and/or adjunct drugs.
Promising candidates include blood clam-derived WPP, which in addition to its antioxidant activity,
also inhibited the proliferation of different cancer cell lines, showing only marginal cytotoxicity
against normal cells [33]. Other multifunctional antioxidant peptides discovered from edible marine
invertebrates are VKP and VKCFR (jellyfish) [42] and GPLGLLGFLGPLGLS (squid skin gelatin) [51]
which exhibited angiotensin converting enzyme inhibitory activity.
Skin care or cosmetic products are one area in which antioxidant peptides discovered from
edible marine invertebrates may have applications. The beneficial effects of bioactive peptides
whether as cosmeceuticals or as dermatologic tools which modulate collagen, elastin and melanin
synthesis have been highlighted [85–88]. The observations that more than 25 different peptides are
used as active ingredients in skin care products manufactured by companies based in Canada,
USA, Spain, Switzerland, and France, and that many more skin care-relevant peptides are in
development worldwide point to the commercial value of peptides as cosmeceutical ingredients [88].
Antioxidant peptides, exemplified by glutathione and carnosine, are one of the many bioactive peptides
used in skin care products. One key consideration in using peptides in the formulation of skin care
products is skin penetration. Longer peptides (e.g., containing six or more amino acids) generally do
not penetrate well into deeper layers of the skin [85]. Longer peptides are also likely more expensive
to produce compared to the shorter ones. Hence, among the antioxidant peptides derived from
edible marine invertebrates (Table 2), those with short sequences (e.g., QHGV [35], WPP, QP [33],
HMSY [49], VKP [42], IKK, FKK, and FIKK [48]) may have greater potential for application in skin
care products compared with the rest. Such short peptides can be used as lead structures for the
development of effective peptide ingredients taking into considerations factors such as potency,
transcutaneous delivery, stability and compatibility within cosmetic formulations, toxicity, and cost of
production [85,88]. In the light of many bioactive peptides used currently in skin care formulations,
antioxidant peptides identified from edible marine invertebrates may have to outperform current
peptide ingredients in critical areas, such as cost of production, potency and multifunctionality,
in order to stand out as candidates for future peptide ingredients. The copper-binding tripeptide
GHK-Cu, which is popularly used in skin care products, is an antioxidant peptide with wound healing,
316
Mar. Drugs 2017, 15, 42
anti-inflammatory, and anti-aging properties [89]. Glutathione, in addition to its well-established
antioxidant properties, also exhibits skin-lightening effects [90]. Thus, the multifunctional nature of
the antioxidant peptides identified from edible marine invertebrates (Table 2) warrants more research.
6. Current Gaps in Knowledge and Future Perspectives
6.1. Biological Significance
One issue to take note of in future research is the biological significance of edible marine
invertebrate-derived antioxidant peptides. Among the 32 antioxidant peptides identified from edible
marine invertebrates (Table 2), three peptides showed cellular radical scavenging activity [40,45,57];
nine peptides, protective effects against AAPH-, H2 O2 - or t-butyl hydroperoxide-induced
cytotoxicity [32,41–43,45]; and two peptides, in vivo antioxidant effects [44,45]. It is unclear whether
antioxidant effects of the other 19 peptides, discovered by using cell-free or chemical-based methods, have
any biological significance. Shen et al. [91] identified 16 antioxidant peptides from ovotransferrin guided
by the oxygen radical absorbance capacity (ORAC) assay; antioxidant activity of pure peptides synthesized
based on the 16 sequences was validated with the ORAC assay. Recently, Jahandideh et al. [92] reported
that these 16 peptides had no antioxidant activities in human umbilical vein endothelial cells.
A plausible explanation would be that a chemical- or cell-free antioxidant assay, such as the ORAC
assay, fails to reflect the complexity of a biological system when used to assess antioxidant peptides [92].
Whether the same observation will hold had a different cellular antioxidant assay or cell type been
used to test the 16 peptides in the study of Jahandideh, Chakrabarti, Davidge and Wu [92] is an open
question. In any case, if the targeted applications of an edible marine invertebrate-derived antioxidant
peptide involve a biological system, it is highly desirable to have its biological significance ascertained
at least in a cell culture model before more time and effort are invested to studying it.
6.2. Stability
Depending on the intended applications for an antioxidant peptide, its stability upon thermal
processing and gastrointestinal digestion, its bioactivity in biological tissues or cells, as well
as its bioavailability may or may not be crucial. For example, antioxidant peptides to be used
for food preservation may not need to exhibit significant cellular radical scavenging activity or
gastrointestinal stability, but should remain active when incorporated into food matrices and ideally
be thermal-stable. Meanwhile, antioxidant peptides to be used as injectable therapeutics may not need
to be thermal-stable or resistant to gastrointestinal digestion, but should not be readily degraded by
human plasma peptidases.
To gauge the potential of an antioxidant peptide as orally administered therapeutic agent
or as functional food ingredient, the intestinal stability and absorption of the peptide is a key
consideration. Monolayers of the human colorectal adenocarcinoma cell (Caco-2) are considered
a model of the intestinal epithelium. The Caco-2 permeability assay has been used to demonstrate
that CKYVCTCKMS, an antioxidant peptide derived from buffalo milk product, had good stability
against brush-border peptidases and was absorbed intact through a Caco-2 monolayer [93]. On the
other hand, the in vitro resistance of a lactoferricin B-derived antihypertensive peptide RRWQWR to
human plasma peptidases has also been investigated through monitoring their degradation in human
serum over time with RP-HPLC [94]. At present, very little is known about the in vivo stability of
the antioxidant peptides identified from edible marine invertebrates. Future studies to investigate
their bioavailability and stability against intestinal and plasma peptidases are warranted to better
appraise their potential applications in biological systems. Certain strategies may be adopted to
enhance the intestinal and systemic stability of the edible marine invertebrate-derived antioxidant
peptides if necessary. Peptide structural modifications such as cyclisation and replacement of L-amino
acid with D-amino acid as well as other related strategies have been reviewed [95,96]. Proline- and
hydroxyproline-containing peptides are generally able to resist breakdown by digestive enzymes [97].
317
Mar. Drugs 2017, 15, 42
On this score, selection of proline-containing peptides from the pool of antioxidant peptides identified
from edible marine invertebrates for further study or incorporation of a proline residue into a selected
antioxidant peptide may be a promising approach.
Development of efficacious and stable peptide drugs that can be administered orally, thus
improving patient convenience, is one of the current foci of the pharmaceutical industry [17].
Notwithstanding, a pertinent point to consider is that in vivo absorption of an antioxidant peptide may
not always be required for its application. Ingested materials and pathogens can induce gastrointestinal
oxidative injury and inflammation, which may increase the risks of diseases such as peptic ulcers,
cancers, and inflammatory bowel disease [98]. Hence, antioxidant peptides that are resistant to
gastrointestinal proteolysis following oral administration, even without getting absorbed, may still
play a role in maintaining the health of the epithelial lining of the gastrointestinal tract [22].
6.3. Application of In Silico Tools
Integration of in silico and in vitro experiments is a promising research strategy for the
discovery of antioxidant peptides from food sources, including edible marine invertebrates.
Recently, some research groups have used in silico tools to predict bioactive peptides that can be
enzymatically released from selected protein sources and compare relative effectiveness of different
proteases. To the authors’ knowledge, the applications of in silico tools in the discovery of potential
antioxidant peptides from edible marine invertebrates are scarce. BIOPEP is a database which
currently houses 3285 bioactive peptides, including 531 antioxidant peptides (accessed in September
2016) [28]. Darewicz et al. [99] used the BIOPEP database and its computational tools to identify
carp proteins that are potential sources of bioactive peptides, in addition to predicting whether
those peptides can be released during human gastrointestinal digestion. Their in silico analyses
predicted that peptides with 11 types of bioactivity, including antioxidant activity, could be released
by carp protein proteolysis. Meanwhile, 13 antioxidant peptides could potentially be released from
myosin heavy chain after gastro-duodenal digestion [99], suggesting that the protein is an excellent
source of antioxidant peptides. Huang et al. [100] used the BIOPEP database tools to predict the
number of antioxidant peptides and other biopeptides that could be released from seven tilapia
proteins after in silico proteolysis by using 27 proteases. The study identified myosin heavy chain
as the best source of antioxidant peptides. Moreover, chymotrypsin C, ficain, and thermolysin were
predicted to be the three most effective among 27 proteases for releasing antioxidant peptides from
myosin heavy chain, potentially releasing 13, 13, and 17 antioxidant peptides, respectively, from the
protein [100]. Meanwhile, Garcia-Mora et al. [101] used the BIOPEP database to identify antioxidant
amino acid sequences harbored within the primary structures of 17 peptides they identified from a
pinto bean hydrolysate exhibiting antioxidant activity. On the other hand, in silico analyses involving
PeptideRanker, BioPep, and PepBank were used to select five candidates from bioactive peptides
identified from donkey milk for chemical synthesis. Further validations of the synthetic peptides
lead to the discovery of two novel antioxidant peptides from donkey milk [102]. Considering the
aforementioned examples, in silico tools may be a useful set of resources for the discovery of antioxidant
peptides from edible marine invertebrates in future. These tools may expedite the screening or
pre-selection of protein precursors in edible marine invertebrates for potential sources of bioactive
peptides. In silico tools can also be used for searching potential strategies to release bioactive peptides
from marine invertebrate proteins [99].
6.4. Multifunctionality
Multifunctionality of antioxidant peptides is a potentially productive area of research. As pointed
out above, some edible marine invertebrate-derived peptides which showed multiple bioactivities,
i.e., WPP, VKP, VKCFR, and GPLGLLGFLGPLGLS [33,42,51], are promising starting points for
the design and development of future peptide therapeutics and/or adjunct drugs. When we used
antioxidant peptide sequences in Table 2 as queries in the BIOPEP database (accessed in July 2016),
318
Mar. Drugs 2017, 15, 42
we found that QP identified from the blood clam [33] was also reported by others as an inhibitor of
dipeptidyl peptidase IV, a potential therapeutic target for the treatment of type 2 diabetes mellitus [103].
SATPdb is a database of therapeutic peptides curated from 22 public domain peptide databases.
Analysis of the 19,192 experimentally validated peptide sequences in the database revealed that 39%
of the sequences (7512 peptides) have two to three functions [104]. A list of 26 antioxidant peptides
with additional experimentally validated bioactivities (e.g., antibacterial, antifungal, anticancer and
antihypertensive activities) can be accessed at the SATPdb database (accessed in July 2016) [104].
Thus, it should not be surprising that the antioxidant peptides identified from edible marine
invertebrates (Table 2), even many other marine antioxidant peptides yet to be discovered, have
multiple functionalities. For example, when we used antioxidant peptide sequences in Table 2 as
queries in C2Pred webserver (accessed in July 2016) [105], ten peptide sequences, namely, LPHPSF,
YPPAK, WPP, QP, GDQQK, PEASY, VKP, VKCFR, IKK, and FKK, were predicted to be cell-penetrating
peptides. Except for GDQQK, the other nine of these peptides were predicted to have anticancer
potential by the AntiCP webserver [106]. Despite in silico predictions, experimental validations of
the anticancer activity of these peptides and their ability to cross the cellular membrane is necessary
in future. Antioxidant peptides that have additional functions, e.g., anticancer and cell-penetrating
activity, likely possess greater versatility and commercial value than other antioxidant peptides when
it comes to applications in therapy and cosmetics.
6.5. Safety
Safety or toxicity assessment of food-derived antioxidant peptides, including those identified
from edible marine invertebrates, requires more attention in future. Even when such peptides are
identified from food with a long history of human consumption without adverse effects, absence
of toxicity and allergenicity in vivo should still be asserted [107,108] before they are used in food,
therapy and cosmetics. For the initial screening of potential allergens in food proteins, the European
Food Safety Authority (EFSA) recommended the use of in silico tools [109]. A total 2872 peptides
identified from hydrolysates of bovine blood globulins were recently assessed in silico for toxicity
and allergenicity [110]. Potential toxicity was predicted using the ToxinPred web server [111].
Potential allergenicity of the peptides was assessed by using AlgPred [112] and AllerTOP [113].
In silico analyses predicted that all the peptides were non-toxic, although 564 peptides were predicted
to be potential allergens. Such a large-scale screening of peptides for toxicity and allergenicity in the
laboratory is predictably expensive. In silico tools represent a less costly and faster strategy to conduct
screenings. Such an approach may also be used to narrow down the choices of bioactive peptides to be
used for chemical synthesis and further validation of bioactivity, depending on the research objectives.
Such a strategy in initial screening for potential toxicity and allergenicity can be adopted in the future
search for safe antioxidant peptides from edible marine invertebrates.
When we used the 32 antioxidant peptide sequences listed in Table 2 as input queries in
the ToxinPred server, all were predicted to be non-toxic, except for I/L N I/L CCN (accessed in
July 2016). The four sequence variations (i.e., INICCN, LNICCN, INLCCN, and LNLCCN) of
shortclub cuttlefish-derived antioxidant peptide I/L N I/L CCN [56] were predicted to be toxic.
Interestingly, Sudhakar and Nazeer [56] reported that I/L N I/L CCN was not cytotoxic to HT29 cells,
which showed greater than 50% viability when exposed to up to 140 µg/mL peptide. Whether the
peptide varies in toxicity in different cell types or biological models is an interesting question to address
in future. Meanwhile, prediction by ToxinPred or other related in silico tools should also be considered
with caution. Such in silico prediction tools, especially when developed primarily based on datasets
of bacterial origin, may not always generate predictions that are relevant to the human body [114].
On the other hand, four antioxidant peptides, i.e., LKQELEDLLEKQE [40], NGPLQAGQPGER [41],
NADFGLNGLEGLA [43], and GPLGLLGFLGPLGLS [51], were predicted to be allergenic by AlgPred
and AllerTOP servers (accessed in July 2016). Such predictions, although still requiring experimental
validations, apparently contradict the general assumption that food-derived peptides are safe and
319
Mar. Drugs 2017, 15, 42
non-toxic. Methodologies for the assessment of food peptide toxicity are beyond the scope of this
review. For a review on the in vitro, in vivo and in silico tools used for evaluating toxicology of food,
the reader is referred to Gosslau [115]. For a comprehensive discussion on empirical and in silico
approaches to designing peptides with low toxicity and to predicting peptide toxicity, we refer the
reader to Gupta et al. [114].
6.6. Need for More Intensive Research on Processing Wastes
Antioxidative protein hydrolysates prepared from by-products/processing wastes of edible
marine invertebrates (e.g., squid skin [41,51,116], shrimp waste [54,75,117], shrimp processing
wastewater [118], sea cucumber viscera and green sea urchin processing waste [119], scallop gonads [49],
and cuttlefish processing wastewater [120]) have been reported. Nevertheless, investigations on such
bioresources which culminated in the identification of antioxidant peptide sequences are limited (e.g.,
see [41,49,51,54]). The antioxidant properties of protein hydrolysates prepared from edible marine
invertebrate and their processing by-products were previously reviewed [121,122]. In general, more
progresses have been made in the discovery of antioxidant peptides from fish processing by-products
than from by-products of edible marine invertebrates. Worldwide catching and processing of shellfish
(i.e., cephalopods, bivalves, echinoderms and crustaceans) generate enormous amount of by-products
and processing wastes annually [123–126]. These are protein-rich raw materials which should be
tapped into more intensively for the discovery of antioxidant peptides. Meanwhile, more antioxidant
peptides have been identified from mussels and oysters, whereas other edible marine invertebrates,
such as the lobster, crab, octopus, jellyfish, scallop, abalone, sea cucumber, and sea squirt are
underexplored. Future research to valorize shellfish processing by-products should also pay attention
to these underexplored species as promising sources of marine antioxidant peptides.
7. Conclusions
The purpose of this review was to summarize current progress in the discovery of antioxidant
peptides from edible marine invertebrates and to discuss potential applications of the peptides.
It is clear from the research reviewed that enzyme-assisted release of peptides from edible marine
invertebrates is an effective strategy for the purification and identification of marine antioxidant
peptides. A number of edible marine invertebrate-derived peptides exhibiting antioxidant effects
in vitro were identified; some of which also demonstrated antioxidant effects in animal models and/or
additional bioactivities. Notwithstanding, knowledge gaps exist with regards to the multifunctionality,
in vivo stability and safety of edible marine invertebrate-derived peptides. Future research in
this direction, supported by the application of bioinformatics tools, should contribute towards
realizing potential future applications of these antioxidant peptides in the food, pharmaceutical
and cosmetics industries.
Supplementary Materials: The following are available online at www.mdpi.com/1660-3397/15/2/42/s1.
Figure S1: The trends in the numbers of publications in the field of antioxidant peptides over the past 24 years,
based on the Scopus database (accessed in November 2016). Input query used was “antioxidant peptide” OR
“antioxidative peptide”.
Acknowledgments: Current work on marine bioactive peptides in the laboratory of T.-T.C., Y.-C.L. and F.-C.W. is
funded by Fundamental Research Grant Scheme of Ministry of Education, Malaysia.
Author Contributions: T.-T.C. and Y.-C.L. performed search of the literature and wrote the review. S.-K.K. and
F.-C.W. commented, revised, and proofread the paper. All authors agreed with the final submitted version.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Weidinger, A.; Kozlov, A. Biological activities of reactive oxygen and nitrogen species: Oxidative stress
versus signal transduction. Biomolecules 2015, 5, 472–484. [CrossRef] [PubMed]
320
Mar. Drugs 2017, 15, 42
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
Ye, Z.-W.; Zhang, J.; Townsend, D.M.; Tew, K.D. Oxidative stress, redox regulation and diseases of cellular
differentiation. BBA-Gen. Subj. 2015, 1850, 1607–1621. [CrossRef] [PubMed]
Luca, M.; Luca, A.; Calandra, C. The role of oxidative damage in the pathogenesis and progression of
Alzheimer’s disease and vascular dementia. Oxid. Med. Cell. Longev. 2015, 2015, 504678. [CrossRef] [PubMed]
Chakrabarti, S.; Jahandideh, F.; Wu, J. Food-Derived bioactive peptides on inflammation and oxidative stress.
Biomed. Res. Int. 2014, 2014, 608979. [CrossRef] [PubMed]
Reeg, S.; Grune, T. Protein oxidation in aging: Does it play a role in aging progression? Antioxid. Redox Signal.
2015, 23, 239–255. [CrossRef] [PubMed]
Miyake, Y.; Fukushima, W.; Tanaka, K.; Sasaki, S.; Kiyohara, C.; Tsuboi, Y.; Yamada, T.; Oeda, T.; Miki, T.;
Kawamura, N.; et al. Dietary intake of antioxidant vitamins and risk of Parkinson’s disease: A case–control
study in Japan. Eur. J. Neurol. 2011, 18, 106–113. [CrossRef] [PubMed]
Bo, Y.; Lu, Y.; Zhao, Y.; Zhao, E.; Yuan, L.; Lu, W.; Cui, L.; Lu, Q. Association between dietary vitamin C
intake and risk of esophageal cancer: A dose-response meta-analysis. Int. J. Cancer 2016, 138, 1843–1850.
[CrossRef] [PubMed]
Aboonabi, A.; Singh, I. The effectiveness of antioxidant therapy in aspirin resistance, diabetes population for
prevention of thrombosis. Biomed. Pharmacother. 2016, 83, 277–282. [CrossRef] [PubMed]
Tamay-Cach, F.; Quintana-Pérez, J.C.; Trujillo-Ferrara, J.G.; Cuevas-Hernández, R.I.; Del Valle-Mondragón, L.;
García-Trejo, E.M.; Arellano-Mendoza, M.G. A review of the impact of oxidative stress and some antioxidant
therapies on renal damage. Ren. Fail. 2016, 38, 171–175. [CrossRef] [PubMed]
Bielli, A.; Scioli, M.G.; Mazzaglia, D.; Doldo, E.; Orlandi, A. Antioxidants and vascular health. Life Sci. 2015,
143, 209–216. [CrossRef] [PubMed]
Zhong, Y.; Shahidi, F. Methods for the assessment of antioxidant activity in foods. In Handbook of Antioxidants
for Food Preservation; Shahidi, F., Ed.; Woodhead Publishing: Oxford, UK, 2015; pp. 287–333.
Agyei, D.; Danquah, M.K.; Sarethy, I.P.; Pan, S. Antioxidative peptides derived from food proteins. In Free
Radicals in Human Health and Disease; Rani, V., Yadav, S.U.C., Eds.; Springer: New Delhi, India, 2015;
pp. 417–430.
Sarmadi, B.H.; Ismail, A. Antioxidative peptides from food proteins: A review. Peptides 2010, 31, 1949–1956.
[CrossRef] [PubMed]
Sampath Kumar, N.S.; Nazeer, R.A.; Jaiganesh, R. Purification and identification of antioxidant peptides
from the skin protein hydrolysate of two marine fishes, horse mackerel (Magalaspis cordyla) and croaker
(Otolithes ruber). Amino Acids 2011, 42, 1641–1649. [CrossRef] [PubMed]
Cheung, R.C.F.; Ng, T.B.; Wong, J.H. Marine peptides: Bioactivities and applications. Mar. Drugs 2015, 13,
4006–4043. [CrossRef] [PubMed]
Ghosh, S. Peptide therapeutics market: Forecast and analysis 2015–2025. Chim. Oggi Chem. Today 2016, 34, 5–7.
Fosgerau, K.; Hoffmann, T. Peptide therapeutics: Current status and future directions. Drug Discov. Today
2015, 20, 122–128. [CrossRef] [PubMed]
Sila, A.; Bougatef, A. Antioxidant peptides from marine by-products: Isolation, identification and application
in food systems. A review. J. Funct. Foods 2016, 21, 10–26. [CrossRef]
Lemes, A.C.; Sala, L.; Ores, J.d.C.; Braga, A.R.C.; Egea, M.B.; Fernandes, K.F. A review of the latest advances
in encrypted bioactive peptides from protein-rich waste. Int. J. Mol. Sci. 2016, 17, 950. [CrossRef] [PubMed]
Ngo, D.-H.; Vo, T.-S.; Ngo, D.-N.; Wijesekara, I.; Kim, S.-K. Biological activities and potential health benefits
of bioactive peptides derived from marine organisms. Int. J. Biol. Macromol. 2012, 51, 378–383. [CrossRef]
[PubMed]
Samaranayaka, A.G.P.; Li-Chan, E.C.Y. Food-derived peptidic antioxidants: A review of their production,
assessment, and potential applications. J. Funct. Foods 2011, 3, 229–254. [CrossRef]
Xiong, Y.L. Antioxidant peptides. In Bioactive Proteins and Peptides as Functional Foods and Nutraceuticals;
Mine, Y., Li-Chan, E., Jiang, B., Eds.; Wiley-Blackwell: Oxford, UK, 2010; pp. 29–42.
Kim, S.-K.; Wijesekara, I. Marine-Derived Peptides: Development and Health Prospects. In Marine Proteins
and Peptides: Biological Activities and Applications; Kim, S.-K., Ed.; John Wiley & Sons, Ltd.: Chichester, UK,
2013; pp. 1–3.
Kim, S.-K.; Wijesekara, I. Development and biological activities of marine-derived bioactive peptides:
A review. J. Funct. Foods 2010, 2, 1–9. [CrossRef]
321
Mar. Drugs 2017, 15, 42
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
Li, Y.; Yu, J. Research progress in structure-activity relationship of bioactive peptides. J. Med. Food 2015, 18,
147–156. [CrossRef] [PubMed]
Zou, T.-B.; He, T.-P.; Li, H.-B.; Tang, H.-W.; Xia, E.-Q. The structure-activity relationship of the antioxidant
peptides from natural proteins. Molecules 2016, 21, 72. [CrossRef] [PubMed]
Scopus. Available online: http://www.scopus.com (accessed on 29 November 2016).
Minkiewicz, P.; Dziuba, J.; Iwaniak, A.; Dziuba, M.; Darewicz, M. BIOPEP database and other programs for
processing bioactive peptide sequences. J. AOAC Int. 2008, 91, 965–980. [PubMed]
Halim, N.R.A.; Yusof, H.M.; Sarbon, N.M. Functional and bioactive properties of fish protein hydolysates
and peptides: A comprehensive review. Trends Food Sci. Technol. 2016, 51, 24–33. [CrossRef]
Senevirathne, M.; Kim, S.-K. Development of bioactive peptides from fish proteins and their health promoting
ability. Adv. Food Nutr. Res. 2012, 65, 235–248. [PubMed]
Wang, B.; Li, L.; Chi, C.F.; Ma, J.H.; Luo, H.Y.; Xu, Y.F. Purification and characterisation of a novel antioxidant
peptide derived from blue mussel (Mytilus edulis) protein hydrolysate. Food Chem. 2013, 138, 1713–1719.
[CrossRef] [PubMed]
Park, S.Y.; Kim, Y.S.; Ahn, C.B.; Je, J.Y. Partial purification and identification of three antioxidant peptides with
hepatoprotective effects from blue mussel (Mytilus edulis) hydrolysate by peptic hydrolysis. J. Funct. Foods
2016, 20, 88–95. [CrossRef]
Chi, C.F.; Hu, F.Y.; Wang, B.; Li, T.; Ding, G.F. Antioxidant and anticancer peptides from the protein
hydrolysate of blood clam (Tegillarca granosa) muscle. J. Funct. Foods 2015, 15, 301–313. [CrossRef]
Li, R.; Yang, Z.S.; Sun, Y.; Li, L.; Wang, J.B.; Ding, G. Purification and antioxidant property of antioxidative
oligopeptide from short-necked clam (Ruditapes philippinarum) hydrolysate in vitro. J. Aquat. Food Prod. Technol.
2015, 24, 556–565. [CrossRef]
Wang, Q.; Li, W.; He, Y.; Ren, D.; Kow, F.; Song, L.; Yu, X. Novel antioxidative peptides from the protein
hydrolysate of oysters (Crassostrea talienwhanensis). Food Chem. 2014, 145, 991–996. [CrossRef] [PubMed]
Asha, K.K.; Remya Kumari, K.R.; Ashok Kumar, K.; Chatterjee, N.S.; Anandan, R.; Mathew, S.
Sequence determination of an antioxidant peptide obtained by enzymatic hydrolysis of oyster Crassostrea
madrasensis (Preston). Int. J. Pept. Res. Ther. 2016, 1–13. [CrossRef]
Jung, W.K.; Rajapakse, N.; Kim, S.K. Antioxidative activity of a low molecular weight peptide derived from
the sauce of fermented blue mussel, Mytilus edulis. Eur. Food Res. Technol. 2005, 220, 535–539. [CrossRef]
Rajapakse, N.; Mendis, E.; Jung, W.K.; Je, J.Y.; Kim, S.K. Purification of a radical scavenging peptide from
fermented mussel sauce and its antioxidant properties. Food Res. Int. 2005, 38, 175–182. [CrossRef]
Kleekayai, T.; Harnedy, P.A.; O’Keeffe, M.B.; Poyarkov, A.A.; CunhaNeves, A.; Suntornsuk, W.;
FitzGerald, R.J. Extraction of antioxidant and ACE inhibitory peptides from Thai traditional fermented
shrimp pastes. Food Chem. 2015, 176, 441–447. [CrossRef] [PubMed]
Qian, Z.-J.; Jung, W.-K.; Byun, H.-G.; Kim, S.-K. Protective effect of an antioxidative peptide purified
from gastrointestinal digests of oyster, Crassostrea gigas against free radical induced DNA damage.
Bioresour. Technol. 2008, 99, 3365–3371. [CrossRef] [PubMed]
Mendis, E.; Rajapakse, N.; Byun, H.-G.; Kim, S.-K. Investigation of jumbo squid (Dosidicus gigas) skin gelatin
peptides for their in vitro antioxidant effects. Life Sci. 2005, 77, 2166–2178. [CrossRef] [PubMed]
Li, J.; Li, Q.; Li, J.; Zhou, B. Peptides derived from Rhopilema esculentum hydrolysate exhibit angiotensin
converting enzyme (ACE) inhibitory and antioxidant abilities. Molecules 2014, 19, 13587–13602. [CrossRef]
[PubMed]
Rajapakse, N.; Mendis, E.; Byun, H.-G.; Kim, S.-K. Purification and in vitro antioxidative effects of giant
squid muscle peptides on free radical-mediated oxidative systems. J. Nutr. Biochem. 2005, 16, 562–569.
[CrossRef] [PubMed]
Kim, E.-K.; Oh, H.-J.; Kim, Y.-S.; Hwang, J.-W.; Ahn, C.-B.; Lee, J.S.; Jeon, Y.-J.; Moon, S.-H.; Sung, S.H.;
Jeon, B.-T.; et al. Purification of a novel peptide derived from Mytilus coruscus and in vitro/in vivo evaluation
of its bioactive properties. Fish Shellfish Immunol. 2013, 34, 1078–1084. [CrossRef] [PubMed]
Ko, S.C.; Kim, E.A.; Jung, W.K.; Kim, W.S.; Lee, S.C.; Son, K.T.; Kim, J.I.; Jeon, Y.J. A hexameric peptide
purified from Styela plicata protects against free radical-induced oxidative stress in cells and zebrafish model.
RSC Adv. 2016, 6, 54169–54178. [CrossRef]
322
Mar. Drugs 2017, 15, 42
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
Wu, R.B.; Wu, C.L.; Liu, D.; Yang, X.H.; Huang, J.F.; Zhang, J.; Liao, B.; He, H.L.; Li, H. Overview of
antioxidant peptides derived from marine resources: The sources, characteristic, purification, and
evaluation methods. Appl. Biochem. Biotechnol. 2015, 176, 1815–1833. [CrossRef] [PubMed]
Ngo, D.-H.; Kim, S.-K. Marine bioactive peptides as potential antioxidants. Curr. Protein Pept. Sci. 2013, 14,
189–198. [CrossRef] [PubMed]
Suetsuna, K. Antioxidant peptides from the protease digest of prawn (Penaeus japonicus) muscle. Mar. Biotechnol.
2000, 2, 5–10. [PubMed]
Wu, H.T.; Jin, W.G.; Sun, S.G.; Li, X.S.; Duan, X.H.; Li, Y.; Yang, Y.T.; Han, J.R.; Zhu, B.W. Identification of
antioxidant peptides from protein hydrolysates of scallop (Patinopecten yessoensis) female gonads. Eur. Food
Res. Technol. 2016, 242, 713–722. [CrossRef]
Kang, N.; Ko, S.C.; Samarakoon, K.; Kim, E.A.; Kang, M.C.; Lee, S.C.; Kim, J.; Kim, Y.T.; Kim, J.S.;
Kim, H.; et al. Purification of antioxidative peptide from peptic hydrolysates of Mideodeok (Styela clava)
flesh tissue. Food Sci. Biotechnol. 2013, 22, 541–547. [CrossRef]
Alemán, A.; Giménez, B.; Pérez-Santin, E.; Gómez-Guillén, M.C.; Montero, P. Contribution of Leu and
Hyp residues to antioxidant and ACE-inhibitory activities of peptide sequences isolated from squid gelatin
hydrolysate. Food Chem. 2011, 125, 334–341. [CrossRef]
Jung, W.-K.; Qian, Z.-J.; Lee, S.-H.; Choi, S.Y.; Sung, N.J.; Byun, H.-G.; Kim, S.-K. Free radical scavenging
activity of a novel antioxidative peptide isolated from in vitro gastrointestinal digests of Mytilus coruscus.
J. Med. Food 2007, 10, 197–202. [CrossRef] [PubMed]
Kim, E.K.; Hwang, J.W.; Kim, Y.S.; Ahn, C.B.; Jeon, Y.J.; Kweon, H.J.; Bahk, Y.Y.; Moon, S.H.; Jeon, B.T.;
Park, P.J. A novel bioactive peptide derived from enzymatic hydrolysis of Ruditapes philippinarum: Purification
and investigation of its free-radical quenching potential. Process Biochem. 2013, 48, 325–330. [CrossRef]
Zhao, J.; Huang, G.; Jiang, J. Purification and characterization of a new DPPH radical scavenging peptide
from shrimp processing by-products hydrolysate. J. Aquat. Food Prod. Technol. 2013, 22, 281–289. [CrossRef]
Zhou, X.; Wang, C.; Jiang, A. Antioxidant peptides isolated from sea cucumber Stichopus Japonicus. Eur. Food
Res. Technol. 2012, 234, 441–447. [CrossRef]
Sudhakar, S.; Nazeer, R.A. Preparation of potent antioxidant peptide from edible part of shortclub cuttlefish
against radical mediated lipid and DNA damage. LWT-Food Sci. Technol. 2015, 64, 593–601. [CrossRef]
Sudhakar, S.; Nazeer, R.A. Structural characterization of an Indian squid antioxidant peptide and its
protective effect against cellular reactive oxygen species. J. Funct. Foods 2015, 14, 502–512. [CrossRef]
Grienke, U.; Silke, J.; Tasdemir, D. Bioactive compounds from marine mussels and their effects on
human health. Food Chem. 2014, 142, 48–60. [CrossRef] [PubMed]
Pérez-Vega, J.A.; Olivera-Castillo, L.; Gómez-Ruiz, J.T.; Hernández-Ledesma, B. Release of multifunctional
peptides by gastrointestinal digestion of sea cucumber (Isostichopus badionotus). J. Funct. Foods 2013, 5,
869–877. [CrossRef]
Amarowicz, R.; Shahidi, F. Antioxidant activity of peptide fractions of capelin protein hydrolysates.
Food Chem. 1997, 58, 355–359. [CrossRef]
Ngo, D.-H.; Wijesekara, I.; Vo, T.-S.; Van Ta, Q.; Kim, S.-K. Marine food-derived functional ingredients as
potential antioxidants in the food industry: An overview. Food Res. Int. 2011, 44, 523–529. [CrossRef]
Zhuang, H.; Tang, N.; Yuan, Y. Purification and identification of antioxidant peptides from corn gluten meal.
J. Funct. Foods 2013, 5, 1810–1821. [CrossRef]
PepDraw. Available online: http://www.tulane.edu/~biochem/WW/PepDraw/ (accessed on 30 July 2016).
Harnedy, P.A.; FitzGerald, R.J. Bioactive peptides from marine processing waste and shellfish: A review.
J. Funct. Foods 2012, 4, 6–24. [CrossRef]
IARC TP53 Database. Available online: http://p53.iarc.fr/AAProperties.aspx (accessed on 30 July 2016).
Chan, K.M.; Decker, E.A.; Feustman, C. Endogenous skeletal muscle antioxidants. Crit. Rev. Food Sci. Nutr.
1994, 34, 403–426. [CrossRef] [PubMed]
Dhaval, A.; Yadav, N.; Purwar, S. Potential applications of food derived bioactive peptides in management
of health. Int. J. Pept. Res. Ther. 2016, 1–22. [CrossRef]
Wang, B.; Wang, Y.-M.; Chi, C.-F.; Luo, H.-Y.; Deng, S.-G.; Ma, J.-Y. Isolation and characterization of collagen
and antioxidant collagen peptides from scales of croceine croaker (Pseudosciaena crocea). Mar. Drugs 2013, 11,
4641–4661. [CrossRef] [PubMed]
323
Mar. Drugs 2017, 15, 42
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
Thorkelsson, G.; Kristinsson, H.G. Bioactive Peptides from Marine Sources. State of Art. Report to the NORA Fund;
Matis Food Research, Innovation and Technology: Reykjavik, Iceland, 2009; pp. 1–19.
Hartmann, R.; Meisel, H. Food-Derived peptides with biological activity: From research to food applications.
Curr. Opin. Biotechnol. 2007, 18, 163–169. [CrossRef] [PubMed]
Dziuba, B.; Dziuba, M. Milk proteins-derived bioactive peptides in dairy products: Molecular, biological and
methodological aspects. Acta Sci. Pol. Technol. Aliment. 2014, 13, 5–26. [CrossRef] [PubMed]
Freitas, A.C.; Andrade, J.C.; Silva, F.M.; Rocha-Santos, T.A.P.; Duarte, A.C.; Gomes, A.M. Antioxidative
peptides: Trends and perspectives for future research. Curr. Med. Chem. 2013, 20, 4575–4594. [CrossRef]
[PubMed]
Sivaraman, B.; Shakila, R.J.; Jeyasekaran, G.; Sukumar, D.; Manimaran, U.; Sumathi, G. Antioxidant activities
of squid protein hydrolysates prepared with papain using response surface methodology. Food Sci. Biotechnol.
2016, 25, 665–672. [CrossRef]
Jridi, M.; Lassoued, I.; Nasri, R.; Ayadi, M.A.; Nasri, M.; Souissi, N. Characterization and potential use of
cuttlefish skin gelatin hydrolysates prepared by different microbial proteases. Biomed. Res. Int. 2014, 2014,
461728:1–461728:14. [CrossRef] [PubMed]
Dey, S.S.; Dora, K.C. Antioxidative activity of protein hydrolysate produced by alcalase hydrolysis from
shrimp waste (Penaeus monodon and Penaeus indicus). J. Food Sci. Technol. (Mysore) 2014, 51, 449–457.
[CrossRef] [PubMed]
Nikoo, M.; Benjakul, S.; Ehsani, A.; Li, J.; Wu, F.; Yang, N.; Xu, B.; Jin, Z.; Xu, X. Antioxidant and cryoprotective
effects of a tetrapeptide isolated from Amur sturgeon skin gelatin. J. Funct. Foods 2014, 7, 609–620. [CrossRef]
Nikoo, M.; Regenstein, J.M.; Ghomi, M.R.; Benjakul, S.; Yang, N.; Xu, X. Study of the combined effects
of a gelatin-derived cryoprotective peptide and a non-peptide antioxidant in a fish mince model system.
LWT-Food Sci. Technol. 2015, 60, 358–364. [CrossRef]
Aluko, R.E. Amino acids, peptides, and proteins as antioxidants for food preservation. In Handbook of
Antioxidants for Food Preservation; Shahidi, F., Ed.; Woodhead Publishing: Oxford, UK, 2015; pp. 105–140.
Cho, J.; Won, K.; Wu, D.; Soong, Y.; Liu, S.; Szeto, H.H.; Hong, M.K. Potent mitochondria-targeted peptides
reduce myocardial infarction in rats. Coron. Artery Dis. 2007, 18, 215–220. [CrossRef] [PubMed]
Hou, Y.; Li, S.; Wu, M.; Wei, J.; Ren, Y.; Du, C.; Wu, H.; Han, C.; Duan, H.; Shi, Y. Mitochondria-Targeted
peptide SS-31 attenuates renal injury via an antioxidant effect in diabetic nephropathy. Am. J. Physiol.
Ren. Physiol. 2016, 310, F547–F559. [CrossRef] [PubMed]
Huang, J.; Li, X.; Li, M.; Li, J.; Xiao, W.; Ma, W.; Chen, X.; Liang, X.; Tang, S.; Luo, Y. Mitochondria-targeted
antioxidant peptide SS31 protects the retinas of diabetic rats. Curr. Mol. Med. 2013, 13, 935–945. [CrossRef]
[PubMed]
Righi, V.; Constantinou, C.; Mintzopoulos, D.; Khan, N.; Mupparaju, S.P.; Rahme, L.G.; Swartz, H.M.;
Szeto, H.H.; Tompkins, R.G.; Tzika, A.A. Mitochondria-targeted antioxidant promotes recovery of skeletal
muscle mitochondrial function after burn trauma assessed by in vivo 31P nuclear magnetic resonance and
electron paramagnetic resonance spectroscopy. FASEB J. 2013, 27, 2521–2530. [CrossRef] [PubMed]
Lee, H.Y.; Kaneki, M.; Andreas, J.; Tompkins, R.G.; Martyn, J.A.J. Novel mitochondria-targeted antioxidant
peptide ameliorates burn-induced apoptosis and endoplasmic reticulum stress in the skeletal muscle of mice.
Shock 2011, 36, 580–585. [CrossRef] [PubMed]
Homayouni-Tabrizi, M.; Asoodeh, A.; Abbaszadegan, M.R.; Shahrokhabadi, K.; Nakhaie Moghaddam, M.
An identified antioxidant peptide obtained from ostrich (Struthio camelus) egg white protein hydrolysate
shows wound healing properties. Pharm. Biol. 2015, 53, 1155–1162. [CrossRef] [PubMed]
Lintner, K. Peptides and proteins. In Cosmetic Dermatology: Products and Procedures; Draelos, Z.D., Ed.;
John Wiley & Sons, Ltd.: Oxford, UK, 2015; pp. 308–317.
Reddy, B.; Jow, T.; Hantash, B.M. Bioactive oligopeptides in dermatology: Part I. Exp. Dermatol. 2012, 21,
563–568. [CrossRef] [PubMed]
Reddy, B.Y.; Jow, T.; Hantash, B.M. Bioactive oligopeptides in dermatology: Part II. Exp. Dermatol. 2012, 21,
569–575. [CrossRef] [PubMed]
Zhang, L.; Falla, T.J. Cosmeceuticals and peptides. Clin. Dermatol. 2009, 27, 485–494. [CrossRef] [PubMed]
Pickart, L.; Vasquez-Soltero, J.; Margolina, A. GHK-Cu may prevent oxidative stress in skin by regulating
copper and modifying expression of numerous antioxidant genes. Cosmetics 2015, 2, 236–247. [CrossRef]
324
Mar. Drugs 2017, 15, 42
90.
91.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
Sonthalia, S.; Daulatabad, D.; Sarkar, R. Glutathione as a skin whitening agent: Facts, myths, evidence and
controversies. Indian J. Dermatol. Venereol. Leprol. 2016, 82, 262–272. [CrossRef] [PubMed]
Shen, S.; Chahal, B.; Majumder, K.; You, S.-J.; Wu, J. Identification of novel antioxidative peptides derived
from a thermolytic hydrolysate of ovotransferrin by LC-MS/MS. J. Agric. Food. Chem. 2010, 58, 7664–7672.
[CrossRef] [PubMed]
Jahandideh, F.; Chakrabarti, S.; Davidge, S.T.; Wu, J. Antioxidant peptides identified from ovotransferrin by
the ORAC method did not show anti-inflammatory and antioxidant activities in endothelial cells. J. Agric.
Food. Chem. 2016, 64, 113–119. [CrossRef] [PubMed]
Tenore, G.C.; Ritieni, A.; Campiglia, P.; Stiuso, P.; Di Maro, S.; Sommella, E.; Pepe, G.; D’Urso, E.; Novellino, E.
Antioxidant peptides from “Mozzarella di Bufala Campana DOP” after simulated gastrointestinal digestion:
In vitro intestinal protection, bioavailability, and anti-haemolytic capacity. J. Funct. Foods 2015, 15, 365–375.
[CrossRef]
Fernández-Musoles, R.; Salom, J.B.; Castelló-Ruiz, M.; Contreras, M.d.M.; Recio, I.; Manzanares, P.
Bioavailability of antihypertensive lactoferricin B-derived peptides: Transepithelial transport and resistance
to intestinal and plasma peptidases. Int. Dairy J. 2013, 32, 169–174. [CrossRef]
Renukuntla, J.; Vadlapudi, A.D.; Patel, A.; Boddu, S.H.S.; Mitra, A.K. Approaches for enhancing oral
bioavailability of peptides and proteins. Int. J. Pharm. 2013, 447, 75–93. [CrossRef] [PubMed]
Bruno, B.J.; Miller, G.D.; Lim, C.S. Basics and recent advances in peptide and protein drug delivery. Ther. Deliv.
2013, 4, 1443–1467. [CrossRef] [PubMed]
Vermeirssen, V.; Camp, J.V.; Verstraete, W. Bioavailability of angiotensin I converting enzyme inhibitory
peptides. Br. J. Nutr. 2004, 92, 357–366. [CrossRef] [PubMed]
Bhattacharyya, A.; Chattopadhyay, R.; Mitra, S.; Crowe, S.E. Oxidative stress: An essential factor in the
pathogenesis of gastrointestinal mucosal diseases. Physiol. Rev. 2014, 94, 329–354. [CrossRef] [PubMed]
Darewicz, M.; Borawska, J.; Pliszka, M. Carp proteins as a source of bioactive peptides—An in silico approach.
Czech J. Food Sci. 2016, 34, 111–117. [CrossRef]
Huang, B.B.; Lin, H.C.; Chang, Y.W. Analysis of proteins and potential bioactive peptides from tilapia
(Oreochromis spp.) processing co-products using proteomic techniques coupled with BIOPEP database.
J. Funct. Foods 2015, 19, 629–640. [CrossRef]
Garcia-Mora, P.; Peñas, E.; Frias, J.; Zieliński, H.; Wiczkowski, W.; Zielińska, D.; Martínez-Villaluenga, C.
High-pressure-assisted enzymatic release of peptides and phenolics increases angiotensin converting enzyme
I inhibitory and antioxidant activities of pinto bean hydrolysates. J. Agric. Food. Chem. 2016, 64, 1730–1740.
[CrossRef] [PubMed]
Zenezini Chiozzi, R.; Capriotti, A.L.; Cavaliere, C.; La Barbera, G.; Piovesana, S.; Samperi, R.; Laganà, A.
Purification and identification of endogenous antioxidant and ACE-inhibitory peptides from donkey milk by
multidimensional liquid chromatography and nanoHPLC-high resolution mass spectrometry. Anal. Bioanal. Chem.
2016, 408, 5657–5666. [CrossRef] [PubMed]
Hikida, A.; Ito, K.; Motoyama, T.; Kato, R.; Kawarasaki, Y. Systematic analysis of a dipeptide library
for inhibitor development using human dipeptidyl peptidase IV produced by a Saccharomyces cerevisiae
expression system. Biochem. Biophys. Res. Commun. 2013, 430, 1217–1222. [CrossRef] [PubMed]
Singh, S.; Chaudhary, K.; Dhanda, S.K.; Bhalla, S.; Usmani, S.S.; Gautam, A.; Tuknait, A.; Agrawal, P.;
Mathur, D.; Raghava, G.P.S. SATPdb: A database of structurally annotated therapeutic peptides.
Nucleic Acids Res. 2015, 44, D1119–D1126. [CrossRef] [PubMed]
Tang, H.; Su, Z.-D.; Wei, H.-H.; Chen, W.; Lin, H. Prediction of cell-penetrating peptides with feature selection
techniques. Biochem. Biophys. Res. Commun. 2016, 477, 150–154. [CrossRef] [PubMed]
Tyagi, A.; Kapoor, P.; Kumar, R.; Chaudhary, K.; Gautam, A.; Raghava, G.P.S. In silico models for designing
and discovering novel anticancer peptides. Sci. Rep. 2013, 3, 2984. [CrossRef] [PubMed]
Hartmann, R.; Wal, J.M.; Bernard, H.; Pentzien, A.K. Cytotoxic and allergenic potential of bioactive proteins
and peptides. Curr. Pharm. Des. 2007, 13, 897–920. [CrossRef] [PubMed]
Schaafsma, G. Safety of protein hydrolysates, fractions thereof and bioactive peptides in human nutrition.
Eur. J. Clin. Nutr. 2009, 63, 1161–1168. [CrossRef] [PubMed]
Christer, H.; Andersson, S.; Arpaia, D.; Casacuberta, J.; Davies, H.; Jardin, P.; Flachowsky, G. Scientific opinion
on the assessment of allergenicity of GM plants and microorganisms and derived food and feed. EFSA J.
2010, 8, 1700.
325
Mar. Drugs 2017, 15, 42
110. Lafarga, T.; Wilm, M.; Wynne, K.; Hayes, M. Bioactive hydrolysates from bovine blood globulins:
Generation, characterisation, and in silico prediction of toxicity and allergenicity. J. Funct. Foods 2016, 24, 142–155. [CrossRef]
111. Gupta, S.; Kapoor, P.; Chaudhary, K.; Gautam, A.; Kumar, R.; Raghava, G.P.S. In silico approach for predicting
toxicity of peptides and proteins. PLoS ONE 2013, 8, e0073957. [CrossRef] [PubMed]
112. Saha, S.; Raghava, G.P.S. AlgPred: Prediction of allergenic proteins and mapping of IgE epitopes.
Nucleic Acids Res. 2006, 34, W202–W209. [CrossRef] [PubMed]
113. Dimitrov, I.; Bangov, I.; Flower, D.R.; Doytchinova, I. AllerTOP v.2—A server for in silico prediction of allergens.
J. Mol. Model. 2014, 20, 1–6. [CrossRef] [PubMed]
114. Gupta, S.; Kapoor, P.; Chaudhary, K.; Gautam, A.; Kumar, R.; Raghava, G.P.S. Peptide toxicity prediction.
In Computational Peptidology; Zhou, P., Huang, J., Eds.; Springer: New York, NY, USA, 2015; pp. 143–157.
115. Gosslau, A. Assessment of food toxicology. Food Sci. Hum. Wellness 2016. [CrossRef]
116. Nakchum, L.; Kim, S.M. Preparation of squid skin collagen hydrolysate as an antihyaluronidase,
antityrosinase, and antioxidant agent. Prep. Biochem. Biotechnol. 2016, 46, 123–130. [CrossRef] [PubMed]
117. Vieira, M.A.; Oliveira, D.D.; Kurozawa, L.E. Production of peptides with radical scavenging activity and
recovery of total carotenoids using enzymatic protein hydrolysis of shrimp waste. J. Food Biochem. 2016.
[CrossRef]
118. Tonon, R.V.; Dos Santos, B.A.; Couto, C.C.; Mellinger-Silva, C.; Brígida, A.I.S.; Cabral, L.M.C. Coupling of
ultrafiltration and enzymatic hydrolysis aiming at valorizing shrimp wastewater. Food Chem. 2016, 198,
20–27. [CrossRef] [PubMed]
119. Mamelona, J.; Saint-Louis, R.; Pelletier, É. Nutritional composition and antioxidant properties of protein
hydrolysates prepared from echinoderm byproducts. Int. J. Food Sci. Technol. 2010, 45, 147–154. [CrossRef]
120. Amado, I.R.; Vázquez, J.A.; González, M.P.; Murado, M.A. Production of antihypertensive and antioxidant
activities by enzymatic hydrolysis of protein concentrates recovered by ultrafiltration from cuttlefish
processing wastewaters. Biochem. Eng. J. 2013, 76, 43–54. [CrossRef]
121. Giménez, B.; López-Caballero, E.M.; Montero, P.M.; Gómez-Guillén, C.M. Antioxidant peptides from
marine origin: Sources, properties and potential applications. In Antioxidant Polymers: Synthesis, Properties,
and Applications; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2012; pp. 203–257.
122. Lee, J.K.; Jeon, J.K.; Kim, S.K.; Byun, H.G. Characterization of bioactive peptides obtained from marine
invertebrates. Adv. Food Nutr. Res. 2012, 65, 47–72. [PubMed]
123. Yan, N.; Chen, X. Sustainability: Don’t waste seafood waste. Nature 2015, 524, 155–157. [CrossRef] [PubMed]
124. Food and Agriculture Organization of the United Nations (FAO). The State of World Fisheries and Aquaculture
2014. Opportunities and Challenges; Food and Agriculture Organization of the United Nations: Rome, Italy, 2014.
125. Food and Agriculture Organization of the United Nations (FAO). The State of World Fisheries and Aquaculture
2016. Contributing to Food Security and Nutrition for All; Food and Agriculture Organization of the
United Nations: Rome, Italy, 2016.
126. Olsen, R.L.; Toppe, J.; Karunasagar, I. Challenges and realistic opportunities in the use of by-products from
processing of fish and shellfish. Trends Food Sci. Technol. 2014, 36, 144–151. [CrossRef]
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
326
marine drugs
Article
Purification and Identification of Antioxidant
Peptides from Protein Hydrolysate of Scalloped
Hammerhead (Sphyrna lewini) Cartilage
Xue-Rong Li 1 , Chang-Feng Chi 1, *, Li Li 1 and Bin Wang 2, *
1
2
*
School of Marine Science and Technology, Zhejiang Ocean University, 1st Haidanan Road, Changzhi Island,
Lincheng, Zhoushan 316022, China; xuerongl0312@163.com (X.-R.L.); wenwenlili@163.com (L.L.)
School of Food and Pharmacy, Zhejiang Ocean University, 1st Haidanan Road, Changzhi Island,
Lincheng, Zhoushan 316022, China
Correspondence: chichangfeng@hotmail.com (C.-F.C.); wangbin4159@hotmail.com (B.W.);
Tel.: +86-580-255-4818 (C.-F.C.); +86-580-255-5085 (B.W.);
Fax: +86-580-255-4818 (C.-F.C.); +86-580-255-4781 (B.W.)
Academic Editor: Paul Long
Received: 26 August 2016; Accepted: 18 February 2017; Published: 1 March 2017
Abstract: The aim of this study was to purify and identify peptides with antioxidant properties
from protein hydrolysate of scalloped hammerhead (Sphyrna lewini) cartilage. Cartilaginous proteins
of the scalloped hammerhead were extracted by guanidine hydrochloride, and three antioxidant
peptides, named enzymolysis peptide of scalloped hammerhead cartilage A (SCPE-A), SCPE-B
and SCPE-C, were subsequently isolated from the hydrolysate of the cartilaginous proteins
using ultrafiltration and chromatography. The amino acid sequences of SCPE-A, SCPE-B
and SCPE-C were identified as Gly-Pro-Glu (GPE), Gly-Ala-Arg-Gly-Pro-Gln (GARGPQ), and
Gly-Phe-Thr-Gly-Pro-Pro-Gly-Phe-Asn-Gly (GFTGPPGFNG), with molecular weights of 301.30 Da,
584.64 Da and 950.03 Da, respectively. As per in vitro activity testing, SCPE-A, SCPE-B and
SCPE-C exhibited strong scavenging activities on 2,2-diphenyl-1-picrylhydrazyl radicals (DPPH•)
(half elimination ratio (EC50 ) 2.43, 2.66 and 1.99 mg/mL), hydroxyl radicals (HO•) (EC50 0.28, 0.21
and 0.15 mg/mL), 2,2′ -azino-bis-3-ethylbenzothiazoline-6-sulfonic acid radicals (ABTS+ •) (EC50 0.24,
0.18 and 0.29 mg/mL), and superoxide anion radicals (O2− •) (EC50 0.10, 0.14 and 0.11 mg/mL).
In addition, SCPE-A showed inhibition activity similar to butylated hydroxytoluene (BHT) in lipid
peroxidation in a linoleic acid model system. The amino acid residues of Gly, Pro and Phe could
positively influence the antioxidant activities of GPE, GARGPQ and GFTGPPGFNG. These results
suggested that GPE, GARGPQ and GFTGPPGFNG might serve as potential antioxidants and be used
as food additives and functional foods.
Keywords: scalloped hammerhead (Sphyrna lewini); cartilage; peptide; antioxidant activity
1. Introduction
Oxidation is an important factor in the food industry because it causes a loss of nutrition, color and
functionality, as well as undesirable off-flavors and toxic compounds, which further induce the
deterioration of food. Furthermore, the accumulation of toxic products is dangerous to the health of
consumers [1,2]. Therefore, the inhibition of free radical formation and oxidation reactions play an
important role in preventing or retarding the autoxidation of food components [3]. Many synthetic
antioxidants, including butylated hydroxytoluene (BHT), butylated hydroxyanisole (BHA), and tertiary
butylhydroquinone (TBHQ), are widely used in the food industry for preservation and to retard lipid
oxidation [4,5]. However, the dosages of the synthetic antioxidants are under strict regulation due to
Mar. Drugs 2017, 15, 61
327
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2017, 15, 61
their potential health hazards and toxic effects [6,7]. Therefore, there has been a large amount of interest
in researching safe antioxidants from natural sources as an alternative to synthetic antioxidants [8].
In recent years, peptides with different activities, including anticancer, antioxidant, antimicrobial,
antihypertensive, and mineral-binding properties, have been isolated from various bioresources,
such as byproducts from the fish processing industry [9]. Antioxidant peptides have drawn great
attention and have been extensively reported as free radical scavengers, peroxide decomposers,
metal inactivators and oxygen inhibitors to protect food and organisms from reactive oxygen
species (ROS) [8,10]. Arg-Gln-Ser-His-Phe-Ala-Asn-Ala-Gln-Pro (RQSHFANAQP), with molecular
weight (MW) 1155 Da, from the protein hydrolysate of chickpeas showed significant dose-dependent
scavenging activities on hydroxyl radicals (HO•) (EC50 2.03 µmol/mL), 2,2-diphenyl-1-picrylhydrazyl
radicals (DPPH•) (EC50 3.15 µmol/mL) and 2, 2′ -azino-bis-3-ethylbenzothiazoline-6-sulfonic acid
radicals (ABTS+ •) (EC50 2.31 µmol/mL) [10]. Asp-Leu-Glu-Glu (DLEE), with MW 504.2 Da,
was confirmed to be one of the main antioxidant peptides generated in dry-cured Xuanwei ham,
and its DPPH• scavenging rate was 74.45% at 0.5 mg/mL [9]. Phe-Ile-Met-Gly-Pro-Tyr (FIMGPY),
Gly-Pro-Ala-Gly-Asp-Tyr (GPAGDY) and Ile-Val-Ala-Gly-Pro-Gln (IVAGPQ), with MWs of 726.90 Da,
578.58 Da and 583.69 Da, respectively, showed strong scavenging activities on DPPH• (EC50 3.5768,
6.0147 and 6.733 M), HO• (EC50 4.1821, 6.7752 and 8.6176 M), superoxide anion radicals (O2− •)
(EC50 2.2149, 2.8691 and 3.1181 M) and ABTS+ • (EC50 1.4307, 1.3308 and 2.2101 M) [11]. In addition,
FIMGPY induced HeLa cell apoptosis by up-regulating the Bax (B-cell lymphoma 2 (Bcl-2) assaciated
X protein)/Bcl-2 ratio and caspase-3 activation [12]. Structure–activity studies on the antioxidant
peptides suggested that the peptide length and the composition and position of amino acids in a
peptide sequence are important determinants of the bioactivity of a specific peptide [8,13,14].
Cartilage is a form of connective tissue that is chemically abundant in bioactive components,
and many cartilaginous proteins, low MW proteins, glycoproteins, and peptides have been prepared
from various soft bone fish sources, such as bamboo and blacktip sharks [15], Prionace glauca [16],
Amur sturgeon [17], spotless smoothhound [7], and silvertip shark [18]. Current research has shown
that those active substances could be used as angiogenesis inhibitors, tumor cells inhibitory factors,
antioxidants, immune regulatory factors, and anti-invasion factors for the treatment of some diseases,
especially in tumor therapy and prevention. Scalloped hammerhead (Sphyrna lewini), belonging to
the family Triakidae, is a commercially valuable fishery resource. At present, large quantities of
muscle protein and cartilages (except the cartilages from fins) from scalloped hammerhead are
not used efficiently. In our previous research, three antioxidant peptides, Trp-Asp-Arg (WDR),
Pro-Tyr-Phe-Asn-Lys (PYFNK) and Leu-Asp-Lys (LDK), were isolated from the hydrolysate of
scalloped hammerhead muscle, and WDR, PYFNK and LDK exhibited good scavenging activities on
DPPH• (EC50 3.63, 4.11 and 3.06 mg/mL), HO• (EC50 0.15, 0.24 and 0.17 mg/mL), ABTS+ • (EC50 0.34,
0.12 and 0.19 mg/mL), and O2− • (EC50 0.09, 0.11 and 0.12 mg/mL) [19,20]. Acid-soluble collagen
and its hydrolysate were prepared from scalloped hammerhead cartilage [21]. However, to the
best of our knowledge, there is no research focusing on the antioxidative peptides in scalloped
hammerhead cartilage. Thus, in this study, three novel antioxidant peptides were isolated from the
protein hydrolysate of scalloped hammerhead cartilage and their antioxidant activities were evaluated
by DPPH•, HO•, O2− •, and ABTS+ • scavenging and lipid peroxidation inhibition assays.
2. Results and Discussion
2.1. Preparation of the Protein Hydrolysate of Scalloped Hammerhead Cartilage (SHCH)
Proteins in raw and processed foods possess antioxidant peptide sequences and structural
domains, and enzymatic hydrolysis is considered as an attractive way for releasing those active
fragments without impairing their nutritional value and without leaving residual organic solvents and
toxic chemicals in the final product [22]. In addition, protein hydrolysates using different proteases
exhibit different antioxidant activities against various antioxidant systems because the peptides are
328
Mar. Drugs 2017, 15, 61
different in terms of chain length and amino acid sequence [1,23]. Therefore, five proteases including
papain, alcalase, trypsin, pepsin, and neutrase were used to hydrolyze the cartilaginous proteins of
scalloped hammerhead. HO• scavenging assay is quick, convenient, and efficient in predicting the
antioxidant activities of protein hydrolysates and purified peptides. As a consequence, HO• was used
to evaluate the antioxidant activity of compounds to act as free radical scavengers or hydrogen donors,
and the results are shown in Table 1.
Table 1. Hydroxyl radical (HO•) scavenging activity of the protein hydrolysate of scalloped
hammerhead cartilage using different proteases (c = 15 mg protein/mL).
Protease
Enzymolysis Condition
Yields (g/100 g
Cartilage)
Degree of
Hydrolysis (DH%)
HO• Scavenging
Rate (%)
Papain
pH 7.0, 60 ◦ C, 4 h,
total enzyme dose 2.5%
1.93 ± 0.08 a
18.33 ± 0.25 a
34.85 ± 1.05 a
Alcalase
pH 8.0, 50 ◦ C, 4 h,
total enzyme dose 2.5%
1.96 ± 0.10 a,b
21.37 ± 0.35 b,c
54.76 ± 1.94 b
Trypsin
pH 8.0, 40 ◦ C, 4 h,
total enzyme dose 2.5%
2.11 ± 0.11 b
23.72 ± 0.31 c
62.38 ± 1.67 c
Pepsin
pH 2.0, 37 ◦ C, 4 h,
total enzyme dose 2.5%
1.99 ± 0.07 a,b
21.58 ± 0.26 c
55.47 ± 2.02 b
Neutrase
pH 6.0, 50 ◦ C, 4 h,
total enzyme dose 2.5%
1.85 ± 0.06 a
20.87 ± 0.36 b
50.67 ± 1.85 d
a–d
Values with different letters indicate significant differences at the same concentration (p < 0.05).
The yield and degree of hydrolysis (DH%) of trypsin hydrolysate was 2.11 ± 0.11 g/100 g
cartilage and 23.72% ± 0.31%, respectively, which was higher than for papain hydrolysate, alcalase
hydrolysate, pepsin hydrolysate, and neutrase hydrolysate. The result indicated that trypsin could
more effectively hydrolyze the proteins from scalloped hammerhead cartilages than the other four
proteases. Furthermore, trypsin hydrolysate (SHCH) showed a significantly higher HO• scavenging
activity (p < 0.05) with 62.38% ± 1.67% at 15 mg/mL, whereas papain hydrolysate showed a
significantly lower HO• scavenging activity (p < 0.05) at 34.85% ± 1.05%. Based on these data,
the protein hydrolysate of scalloped hammerhead cartilage produced by trypsin was named SHCH
and was selected for follow-up studies.
2.2. Purification of the Antioxidant Peptides from SHCH
2.2.1. Ultrafiltration
Protein hydrolysate is a complex mixture of active and inactive peptides (of various sizes) and
amino acid compositions, and ultrafiltration membrane technology is an important method for the
fractionation of protein hydrolysate and the enrichment of peptides with specific MW ranges [1,5].
SHCH was fractionated by ultrafiltration using two molecular weight cut-off (MWCO) membranes
(10 and 3 kDa), and three fractions, SHCH-I (MW < 3 kDa), SHCH-II (3 kDa < MW < 10 kDa),
and SHCH-III (MW > 10 kDa), were prepared. As shown in Figure 1, the HO• scavenging activity
of SHCH-I was 79.10% ± 2.38% at 15 mg protein/mL, which was significantly stronger than those
of SHCH, SHCH-II, and SHCH-III (p < 0.05). The MW of peptides plays a critical role in bioactivity,
and protein hydrolysates with smaller MW usually exhibited higher antioxidant activity than larger
MW hydrolysates [4,5]. SHCH-I, which is abundant in smaller MW peptides, showed high HO•
scavenging activity, and the result was in agreement with other reports that the ultrafiltration fractions
of protein hydrolysates with lower MW could more effectively interact with the free radicals interfering
in oxidative processes [6,9].
329
Mar. Drugs 2017, 15, 61
Figure 1. HO• scavenging activities of trypsin hydrolysate (SHCH) and its three fractions at 15 mg
protein/mL. All data are presented as the mean ± standard deviation (SD) of triplicate results.
a–c Values with same letters indicate no significant difference for each group of samples at the same
concentration (p > 0.05).
2.2.2. Anion-Exchange Chromatography
Ion-exchange chromatography is used to separate the charged molecules based on their affinity to
the ion exchanger (anion and/or cation exchange resins), and their interaction was determined by the
number and location of the charges on the molecules [5]. SHCH-I was loaded onto a Diethylaminoethyl
cellulose 52 (DEAE-52) cellulose anion-exchange column and separated by stepwise elution using
deionized water and 0.1, 0.5, and 1.0 M NaCl (Figure 2A). Five separated fractions (Fr.1 to Fr.5) were
collected. Their HO• scavenging activities were measured and are shown in Figure 2B. The HO•
scavenging rate of Fr.4 reached 72.03% ± 2.64% at 10 mg protein/mL, and it exhibited significantly
more efficient antioxidant activity than the other fractions (p < 0.05). Peptides with basic and/or
hydrophobic amino acid residues, such as His, Lys and Pro, are thought to have strong antioxidant
activities [24]. Therefore, anion and cation exchange resins have been widely used to purify antioxidant
peptides from protein hydrolysates [25–27]. The present data showed that Fr.4 had the strongest HO•
scavenging activity and was selected for further purification.
ȱ
Figure 2. Elution profile of SHCH-I in DEAE-52 cellulose chromatography (A); and the HO• scavenging
rate (%) of different fractions of SHCH-I at 10 mg protein/mL (B). All data are presented as the mean
± standard deviation (SD) of triplicate results. a–d Values with same letters indicate no significant
difference for each group of samples at the same concentration (p > 0.05). Fr: separated fractions.
2.2.3. Gel Filtration Chromatography
Molecular size is an important determinant of the bioactivity of a specific peptide [8].
Therefore, gel filtration chromatography is an important method to purify peptides. Fr.4 was loaded
onto a Sephadex G-15 column and separated into two fractions of Fr.4-1 and Fr.4-2 (Figure 3A).
Each fraction was collected, lyophilized, and evaluated for HO• scavenging activity. As shown in
Figure 3B, the HO• scavenging rate of Fr.4-1 reached 87.80% ± 2.24% at 5 mg protein/mL and was
higher than those of Fr.4 (72.03% ± 2.64%) and Fr.4-2 (52.38% ± 1.62%). Therefore, Fr.4-1 was selected
for further purification by RP-HPLC.
330
Mar. Drugs 2017, 15, 61
ȱ
Figure 3. Elution profile of Fr.4 in Sephadex G-15 chromatography (A) and HO• scavenging activity
of Fr.4 and its fractions at 5 mg protein/mL (B). All data are presented as the mean ± SD of triplicate
results. a–c Values with same letters indicate no significant difference for each group of samples at the
same concentration (p > 0.05).
2.2.4. Isolation of Peptides from Fr.4-1 by Reversed-Phase High Performance Liquid
Chromatography (RP-HPLC)
The hydrophobic and hydrophilic properties of peptides play a key role in their retention
time (RT) on an RP-HPLC column, and the RT can be adjusted by changing the ratio of polar
(water) and nonpolar (methanol, acetonitrile) solvents [11]. Using an ultrafiltration membrane system,
anion-exchange chromatography and gel filtration chromatography, Fr.4-1, which had the highest
HO• scavenging activity among all fractions, was separated using RP-HPLC on a Zorbax C-18
column, and the eluted fractions were collected separately according to the chromatographic peaks
(Figure 4). Three fractions, referred to as enzymolysis peptide of scalloped hammerhead cartilage
A (SCPE-A), SCPE-B and SCPE-C, with RTs of 10.642, 13.605, and 17.979 min, respectively, showed
high antioxidant activities, and their HO• scavenging rates reached 80.7% ± 1.22%, 75.4% ± 2.33%,
and 92.2% ± 3.44%, respectively, at 3.0 mg/mL. Therefore, SCPE-A, SCPE-B and SCPE-C were collected
for further research.
ȱ
Figure 4. RP-HPLC profile of Fr.4-1 on a Zorbax C18 column with a linear gradient of acetonitrile
(0%–50% for 32 min) containing 0.1% trifluoroacetic acid (TFA) at a flow rate of 0.8 mL/min.
2.3. Molecular Mass and Amino Acid Sequences of the Purified Peptides
The properties of peptides are related to their composition, structure, MW, amino acid
sequence and hydrophobicity. Considering the radical-scavenging ability, the amino acid sequences
and molecular mass of the three isolated peptides were analyzed using a protein sequencer
and quadrupole-time of flight mass spectrometry (Q-TOF MS), respectively. The mass spectra
of the three isolated peptides were shown in Figure 5. The amino acid sequences of SCPE-A,
SCPE-B and SCPE-C were identified as Gly-Pro-Glu (GPE), Gly-Ala-Arg-Gly-Pro-Gln (GARGPQ),
331
Mar. Drugs 2017, 15, 61
and Gly-Phe-Thr-Gly-Pro-Pro-Gly-Phe-Asn-Gly (GFTGPPGFNG), with molecular masses of 301.30 Da,
584.64 Da and 950.03 Da, respectively, which were in agreement with the theoretical masses of 301.27 Da,
584.64 Da, and 949.12 Da, respectively.
Figure 5. Mass spectrograms of SCPE-A, SCPE-B and SCPE-C.
2.4. Antioxidant Activity of SCPE-A, SCPE-B and SCPE-C
2.4.1. DPPH• Scavenging Activity
DPPH is a relatively stable organic radical that can be scavenged by accepting a proton-donating
substance (H+ ), which reduces the absorbance at 517 nm because the solution color changes
from deep purple to yellow [19]. As shown in Figure 6A, SCPE-A, SCPE-B and SCPE-C showed
dose-dependent anti-DPPH• activity, with EC50 values of 2.43, 2.43, and 1.99 mg/mL, respectively,
and SCPE-C exhibited the highest radical-scavenging activity among all samples, except the
positive control of ascorbic acid. The EC50 of SCPE-C was lower than that of Pro-Ser-Tyr-Val
(PSYV) (17.0 mg/mL) [28], Thr-Thr-Ala-Asn-Ile-Glu-Asp-Arg-Arg (TTANIEDRR) (2.503 mg/mL) [26],
Phe-Leu-Asn-Glu-Phe-Leu-His-Val (FLNEFLHV) (4.950 mg/mL) [29], Trp-Glu-Gly-Pro-Lys (WEGPK)
(4.438 mg/mL), Gly-Val-Pro-Leu-Thr (GVPLT) (4.541 mg/mL) [5], Gly-Phe-Gly-Pro-Leu (GFGPL)
(2.249 mg/mL), Val-Gly-Gly-Arg-Pro (VGGRP) (2.937 mg/mL) [30], FIMGPY (2.60 mg/mL), GPAGDY
(3.48 mg/mL), IVAGPQ (3.93 mg/mL) [11], WDR(3.63 mg/mL), PYFNK (4.11 mg/mL) and LDK
(3.06 mg/mL) [19,20] from the protein hydrolysates of loach, blue mussel, salmon, bluefin leatherjacket,
grass carp skin, skate (Raja porosa) cartilage and scalloped hammerhead muscle, but it was
higher than that of Gly-Ser-Gln (GSQ) (0.61 mg/mL) [31], Pro-Ile-Ile-Val-Tyr-Trp-Lys (PIIVYWK)
(0.713 mg/mL), Phe-Ser-Val-Val-Pro-Ser-Pro-Lys (FSVVPSPK) (0.937 mg/mL) [29], Pro-Tyr-Ser-Phe-Lys
(PYSFK) (1.575 mg/mL) [30], His-Phe-Gly-Asp-Pro-Phe-His (HFGDPFH) (0.20 mg/mL) [32],
332
Mar. Drugs 2017, 15, 61
Phe-Leu-Pro-Phe (FLPF) (0.789 mg/mL), Leu-Pro-Phe (LPF) (0.777 mg/mL) and Leu-Leu-Pro-Phe
(LLPF) (1.084 mg/mL) [33] from the protein hydrolysates of Chinese leek, blue mussel, grass carp skin,
mussel sauce and corn gluten meal. Therefore, the present results suggested that SCPE-A, SCPE-B and
SCPE-C were DPPH• inhibitors and primary antioxidants that reacted with free radicals.
Figure 6.
DPPH• (A); HO• (B); ABTS+ • (C); and O2− • (D) scavenging activities of
SCPE-A, SCPE-B and SCPE-C. All data are presented as the mean ± SD of triplicate results.
DPPH•: 2,2-diphenyl-1-picrylhydrazyl radicals; ABTS+ •: 2, 2′ -azino-bis-3-ethylbenzothiazoline-6-sulfonic
acid radicals; O2− •: superoxide anion radicals.
2.4.2. HO• Scavenging Activity
HO• is highly reactive and consequently short-lived and can damage virtually all types
of macromolecules, including carbohydrates, nucleic acids, lipids, and proteins [5]. The HO•
scavenging activity of SCPE-A, SCPE-B and SCPE-C was dose-dependent at the test concentrations,
as shown in Figure 6B. The EC50 values of SCPE-A, SCPE-B and SCPE-C were 0.28, 0.21, and 0.15
mg/mL, respectively, and SCPE-C exhibited the highest HO• scavenging activity. The EC50
of SCPE-C was lower than that of PYFNK (0.24 mg/mL), LDK (0.17 mg/mL) [19,20],
Leu-Gly-Leu-Asn-Gly-Asp-Asp-Val-Asn (LGLNGDDVN) (0.687 mg/mL) [34], PSYV (2.64 mg/mL) [28],
HFGDPFH (0.50 mg/mL) [32], Phe-Pro-Glu-Leu-Leu-Ile (FPELLI) (0.57 mg/mL) and Val-Phe-Ala-Ala-Leu
(VFAAL) (0.31 mg/mL) [4], as well as that of Tyr-Pro-Pro-Ala-Lys (YPPAK) (0.228 mg/mL) [23],
Pro-Ser-Lys-Tyr-Glu-Pro-Phe-Val (PSKYEPFV) (2.86 mg/mL) [35], PYSFK (2.283 mg/mL),
GFGPL (1.612 mg/mL), VGGRP (2.055 mg/mL) [30], Tyr-Leu-Gly-Ala-Lys (YLGAK) (scavenging rate:
45.14% at 0.5 mg/mL), Gly-Gly-Leu-Glu-Pro-Ile-Asn-Phe-Gln (GGLEPINFQ) (scavenging rate:
41.07% at 0.5 mg/mL) [36], Asn-Gly-Leu-Glu-Gly-Leu-Lys (NGLEGLK) (0.313 mg/mL),
Asn-Ala-Asp-Phe-Gly-Leu-Asn-Gly-Leu-Glu-Gly-Leu-Ala (NADFGLNGLEGLA) (0.612 mg/mL) [32],
FIMGPY (3.04), GPAGDY (3.92 mg/mL) and IVAGPQ (5.03 mg/mL) [11] from the protein hydrolysates
of scalloped hammerhead muscle, conger eel, weatherfish loach, mussel sauce, Chinese cherry seeds,
blue mussel, grass carp, egg white, giant squid and skate (R. porosa) cartilage. The three isolated peptides,
especially SCPE-C, revealed good HO• scavenging activity, which demonstrated that it could serve as a
scavenger to reduce or eliminate the damage induced by HO• in foods and biological systems.
333
Mar. Drugs 2017, 15, 61
2.4.3. ABTS+ • Scavenging Activity
The ABTS+ • scavenging assay is a sensitive method to determine the antioxidant capacity of
bioactive compounds, in which sodium persulfate converts ABTS to its radical cation with a blue color
and an absorption maximum of 734 nm, and the blue ABTS+ • is converted back to its colorless neutral
form when ABTS+ • is reactive towards an antioxidant [10,37,38]. The abilities of SCPE-A, SCPE-B and
SCPE-C to scavenge ABTS+ • in comparison with ascorbic acid were investigated, and dose-related
effects were observed at different peptide concentrations ranging from 0 to 5.0 mg/mL (Figure 6C).
SCPE-B, with an EC50 of 0.18 mg/mL, showed the strongest scavenging activity on ABTS+ • among
the protein hydrolysate, fractions, and prepared peptides at all tested concentrations. The EC50 of
SCPE-B was lower than those of WDR (0.34 mg/mL) [19], LDK (0.19 mg/mL) [20], FLNEFLHV
(1.548 mg/mL) [29], FPELLI (0.40 mg/mL) and VFAAL (0.38 mg/mL) [4], FLPF (1.497 mg/mL),
LPF (1.013 mg/mL), LLPF (1.031 mg/mL) [33], GFGPL (0.328 mg/mL), VGGRP (0.465 mg/mL) [30],
WEGPK (5.407 mg/mL), Gly-Pro-Pro (GPP) (2.472 mg/mL), GVPLT (3.124 mg/mL) [6], FIMGPY
(1.04 mg/mL), GPAGDY (0.77 mg/mL) and IVAGPQ (1.29 mg/mL) [11] from the protein hydrolysates
of scalloped hammerhead muscle, salmon, Chinese cherry seeds, corn gluten meal, grass carp skin,
bluefin leatherjacket heads and skate cartilage. The present results indicated that SCPE-A, SCPE-B and
SCPE-C could strongly donate electrons or hydrogen atoms to inactivate ABTS+ •.
2.4.4. O2− • Scavenging Activity
O2− • is the most common free radical and can produce hydrogen peroxide and hydroxyl radicals
through dismutation and other reactions in vivo, which can cause damage to DNA, proteins and
cell membranes. The O2− • scavenging activities of SCPE-A, SCPE-B and SCPE-C were studied,
and the dose–effect relations were observed as the concentration gradually increased from 0.1
to 5.0 mg/mL (Figure 6D). The EC50 values of SCPE-A, SCPE-B and SCPE-C were 0.08, 0.14,
and 0.11 mg/mL, respectively. SCPE-A showed stronger O2− • scavenging activity than SCPE-B
and SCPE-C and reached 91.7% ± 2.58% scavenging activity at 5.0 mg/mL. The EC50 of SCPE-A
was lower than that of WDR (0.09 mg/mL), PYFNK (0.11 mg/mL), LDK(0.12 mg/mL) [19,20],
HFGDPFH (0.20 mg/mL) [32], GSQ (0.70 mg/mL) [31], Ser-Leu-Pro-Ile-Gly-Leu-Met-Ile-Ala-Met
(SLPIGLMIAM) (0.3168 mg/mL) [39], YLGAK (scavenging rate: 36.27% at 1.0 mg/mL), GGLEPINFQ
(scavenging rate: 32.05% at 1.0 mg/mL) [36], His-Asp-His-Pro-Val-Cys (HDHPVC) (0.265 mg/mL)
and His-Glu-Lys-Val-Cys (HEKVC) (0.235 mg/mL) [40], Tyr-Leu-Met-Arg (YLMR) (0.450 mg/mL),
Val-Leu-Tyr-Glu-Glu (VLYEE) (0.693 mg/mL), Met-Ile-Leu-Met-Arg (MILMR) (0.993 mg/mL) [41],
FIMGPY (1.61 mg/mL), GPAGDY (1.66 mg/mL) and IVAGPQ (1.82 mg/mL) [11] from the protein
hydrolysates of scalloped hammerhead muscle, mussel sauce, Chinese leek seeds, Mytilus coruscus,
egg white, round scad, croceine croaker muscle and skate cartilage. O2− • could be catalyzed into
hydrogen peroxide and oxygen by superoxide dismutase (SOD) with a reaction rate 10,000-fold higher
than that of spontaneous dismutation in an organism [19]. Therefore, SCPE-A, SCPE-B and SCPE-C
might have high antioxidant activity similar to SOD and could be applied as O2− • scavengers in
biological systems.
2.4.5. Lipid Peroxidation Inhibition Assay
Scavenging activities on DPPH•, ABTS+ •, HO• and O2− • have been widely used to assess the
antioxidant capacities of protein hydrolysates and peptides. However, each of these assays only
measures an antioxidant property representing a different mechanism, which does not reflect the
multiple mechanisms by which samples may act as antioxidants to retard or inhibit lipid oxidation
in a food system [42]. Therefore, in this section, the ability of the soluble samples to suppress lipid
peroxidation in a linoleic acid model system was investigated. Lipid peroxidation is a complex process
that involves the formation and propagation of lipid radicals and lipid hydroperoxides, which are
formed as the primary oxidation products in the presence of oxygen [43]. The inhibitory activities
334
Mar. Drugs 2017, 15, 61
of SCPE-A, SCPE-B and SCPE-C were measured by lipid peroxidation in an in vitro model and were
compared with the commercially available antioxidant BHT for 7 days. Figure 7 shows that SCPE-A
had a similar inhibitory effect on lipid peroxidation as BHT and significantly retarded the lipid
peroxidation compared with the control (without sample), SCPE-B and SCPE-C. In previous research,
SCPE-A showed excellent scavenging activity on DPPH•, HO•, ABTS+ • and O2− •, with EC50 values
of 2.43, 0.28, 0.24, and 0.08 mg/mL, respectively. Therefore, the inhibition effect of lipid peroxidation
caused by SCPE-A could be attributed to its radical-scavenging activity. In addition, SCPE-A may
have potential applications in the food industry for retarding the production of unwanted off-flavors
and toxic products.
ȱ
Figure 7. Lipid peroxidation inhibition assays of SCPE-A, SCPE-B and SCPE-C. All data are presented
as the mean ± SD of triplicate results.
2.5. Structure-Antioxidant Activity Relationship of Peptides
The structural characteristics of peptides provide guides for the evaluation of food-derived
proteins as potential precursors of antioxidant peptides and predict the possible release of bioactive
peptides from various proteins using an appropriate protease [1].
Many researchers found that the antioxidant activity of peptides was highly dependent on their
amino acid sequence and composition. Chen et al. (2012) reported that the Gly residue may contribute
significantly to antioxidant activity since the single hydrogen atom in the side chain of Gly serves as a
proton-donating source and neutralizes active free radical species [44]. In addition, Nimalaratne et al.
(2015) reported that the single hydrogen atom of Gly (G) can provide high flexibility to the peptide
backbone and positively influence the antioxidant properties [8]. Therefore, Gly residues might be
important contributors to the antioxidant activity of SCPE-A, SCPE-B, and SCPE-C because there are
one, two and four Gly residues in their amino acid sequences, respectively.
The pyrrolidine ring of proline (P) can interact with the secondary structure of the peptide,
thereby increasing the flexibility, and it is also capable of quenching singlet oxygen due to its low
ionization potential [6]. Samaranayaka and Li-Chan (2011) reported that the Pro residue plays an
important role in the antioxidant activity of the peptide purified from Saccharomyces cerevisiae protein
hydrolysate [45]. Therefore, the one, one and two Pro residues in the amino acid sequences of SCPE-A,
SCPE-B, and SCPE-C should enhance the radical-scavenging activities of the three peptides.
Aromatic amino acids, such as Phe, Tyr, His, and Trp, and hydrophobic amino acids, including Ala,
Val, and Leu, have been reported to be critical to the antioxidant activities of peptides [1]. Huang et al.
(2005) reported that amino acids with aromatic residues, such as Phe, Tyr and Trp, can quench free
radicals by direct electron transfer [46]. The results from Guo et al. (2015) indicated that hydrophobic
amino acids (e.g., Val, Ala, Leu) and aromatic amino acids (Phe, His, Tyr and Trp) can enhance the
radical-scavenging abilities of peptides from Chinese cherry seeds [4]. Therefore, the presence of
335
Mar. Drugs 2017, 15, 61
the one Ala residue and two Phe residues in the sequences of SCPE-B and SCPE-C, respectively,
should have a positive impact on their radical-scavenging and lipid peroxidation inhibitory activities.
The presence of acidic and basic amino acids plays a critical role in the metal ion chelating activity,
which is related to the carboxyl and amino groups in their side chains [47]. Similar results were reported
by Memarpoor-Yazdi et al. (2012), who found that the basic (Arg) and acidic (Asp and Glu) amino
acid residues in the sequences of Asn-Thr-Asp-Gly-Ser-Thr-Asp-Tyr-Gly-Ile-Leu-Gln-Ile-Asn-Ser-Arg
(NTDGSTDYGILQINSR) and Leu-Asp-Glu-Pro-Asp-Pro-Leu-Ile (LDEPDPLI) were critical to their
antioxidant activities [48]. Díaz, et al. (2003) found that Glu is an effective cation chelator that
forms complexes with calcium, iron and zinc and may contribute to the antioxidant activity [49].
Therefore, Glu in SCPE-A and Arg in SCPE-B might be favorable to their antioxidant activities.
In addition, the antioxidant activities of peptides are dependent on their molecular
size, and shorter peptides, especially peptides with 2–10 amino acid residues, have stronger
radical-scavenging and lipid peroxidation inhibition activities than their parent native proteins or
long-chain peptides [1,46]. SCPE-A, SCPE-B, and SCPE-C exhibited good antioxidant activities in the
radical scavenging and lipid peroxidation inhibition assays, which suggested that the short SCPE-A,
SCPE-B, and SCPE-C could interact more effectively and easily with free radicals and inhibit the
propagation cycles of lipid peroxidation in the radical scavenging and lipid peroxidation model
system [50]. However, SCPE-A had the strongest O2− • scavenging and lipid peroxidation inhibition
activities, SCPE-B had the strongest scavenging activity on ABTS+ •, and SCPE-C exhibited the highest
DPPH• and HO• scavenging activities among all samples and fractions. The results indicated no
consistent trends in the antioxidant capacities of SCPE-A, SCPE-B, and SCPE-C in different antioxidant
assays. Therefore, more detailed study should be performed to clarify the relationship between the
activity and structure of the three isolated peptides.
3. Experimental Section
3.1. Chemicals and Reagents
Scalloped hammerhead (S. lewini) was purchased from Fengmao market in Zhoushan City,
Zhejiang Province, China. DEAE-52 cellulose and Sephadex G-15 were purchased from Shanghai
Source Poly Biological Technology Co., Ltd. (Shanghai, China). Acetonitrile was of liquid
chromatography (LC) grade and was purchased from Thermo Fisher Scientific Co., Ltd. (Shanghai,
China). All other reagents used in the experiment were of analytical grade and were purchased from
Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China).
3.2. Preparation of the Protein Hydrolysate from Scalloped Hammerhead Cartilage
Frozen scalloped hammerhead cartilage was thawed, minced to homogenate and soaked in 1.0 M
guanidine hydrochloride with a solid-to-solvent ratio of 1:5 (w/v) for 48 h with continuous stirring, and
the liquid supernatant was collected by centrifugation at 12,000× g at 4 ◦ C for 10 min. The resulting
supernatant was dialyzed (MW 5 kDa) against 25 volumes of distilled water for 12 h, with the solution
changed every 4 h, and the resulting dialysate was freeze-dried.
The freeze-dried sample was dissolved (5% w/v) in 0.2 M phosphate buffer solution (PBS, pH
7.2) and hydrolyzed for 4 h using neutrase at pH 7.0, 60 ◦ C; alcalase at pH 8.0, 50 ◦ C; trypsin at pH
8.0, 40 ◦ C; pepsin at pH 2.0, 37 ◦ C; or papain at pH 6.0, 50 ◦ C, with a total enzyme dose of 2.5%.
Enzymatic hydrolysis was stopped by heating for 10 min in boiling water, and the hydrolysate was
centrifuged at 9000× g for 15 min. The supernatant was freeze-dried and stored at −20 ◦ C for further
analysis. The protein hydrolysate of scalloped hammerhead cartilage using trypsin was named SHCH.
336
Mar. Drugs 2017, 15, 61
3.3. Isolation of Peptides from SHCH
3.3.1. Fractionation of SHCH by Ultrafiltration
SHCH was fractionated using ultrafiltration (8400, Millipore, Hangzhou, China) with 10 kDa and
3 kDa MW cutoff (MWCO) membranes (Millipore, Hangzhou, China). Three peptide fractions, named
SHCH-I (MW < 3 kDa), SHCH-II (3 kDa < MW < 10 kDa) and SHCH-III (MW > 10 kDa), were collected
and lyophilized.
3.3.2. Anion-Exchange Chromatography
SHCH-I (5 mL, 40.0 mg/mL) was injected onto a DEAE-52 cellulose column (1.6 × 70 cm) that
was pre-equilibrated with deionized water and stepwise eluted with 150 mL distilled water and 0.1,
0.5, and 1.0 M NaCl solution at a flow rate of 1.0 mL/min. Each eluted fraction (5 mL) was collected
and measured at 280 nm, and five fractions (Fr.1–5) were pooled and lyophilized.
3.3.3. Gel filtration Chromatography
Fr.4 (5 mL, 10.0 mg/mL) was fractionated on a Sephadex G-15 column (2.6 × 160 cm) eluted
with deionized water at a flow rate of 0.6 mL/min. Each eluate (3 mL) was collected and monitored
at 280 nm, and two fractions (Fr.4-1 and Fr.4-2) were lyophilized.
3.3.4. RP-HPLC
Fr.4-2 was separated by RP-HPLC (Agilent 1260 HPLC, Agilent Ltd., Santa Rosa, CA, USA) on
a Thermo C-18 column (4.6 × 250 mm, 5 µm) (Thermo Co., Ltd., Yokohama, Japan) using a linear
gradient of acetonitrile (0%–50% in 0–32 min) in 0.1% trifluoroacetic acid at a flow rate of 0.8 mL/min.
The eluate was analyzed at 280 nm, and three peptides (SCPE-A, SCPE-B and SCPE-C) were isolated
and lyophilized.
3.4. Determination of the Amino Acid Sequence and Molecular Mass
The amino acid sequences of SCPE-A, SCPE-B and SCPE-C were determined on an Applied
Biosystems 494 protein sequencer (Perkin Elmer/Applied Biosystems Inc., Foster City, CA, USA).
The molecular masses were determined using a Q-TOF mass spectrometer coupled to an electrospray
ionization source (ESI) (Micromass, Waters, Los Angeles, CA, USA).
3.5. Degree of Hydrolysis (DH)
DH analysis was performed according to the previously described method [49]. The hydrolysate
(50 µL) was mixed with 0.5 mL of 0.2 M phosphate buffer, pH 8.2 and 0.5 mL of 0.05%
trinitrobenzenesulfonic acid (TNBS) reagent. TNBS was freshly prepared before use by diluting
with DI water. The mixture was incubated at 50 ◦ C for 1 h in a water bath. The reaction was stopped
by adding 1 mL of 0.1 M HCl and incubating at room temperature for 30 min. The absorbance was
monitored at 420 nm. L-leucine was used as a standard. To determine the total amino acid content,
mungbean meal was completely hydrolyzed with 6 M HCl with a sample to acid ratio of 1:100 at 120 ◦ C
for 24 h. DH (%) was calculated using the following equation:
DH = [(At − A0 )/(Amax − A0 )] × 100
where At was the amount of a-amino acids released at time t, A0 was the amount of a-amino acids in
the supernatant at 0 h, and Amax was the total amount of a-amino acids obtained after acid hydrolysis
at 120 ◦ C for 24 h.
337
Mar. Drugs 2017, 15, 61
3.6. Antioxidant Activity
The radical (DPPH•, HO•, O2− •, and ABTS+ •) scavenging activity and lipid peroxidation
inhibition assays were performed according to previously reported methods [19,51], and the half
elimination ratio (EC50 ) was defined as the concentration of a sample that caused a 50% decrease in
the initial concentration of DPPH•, O2− •, HO•, and ABTS+ •. The EC50 was calculated based on the
linear relationship of the radical-scavenging rate and concentration of the samples.
3.6.1. HO• Scavenging Activity
In this system, hydroxyl radicals are generated by the Fenton reaction. Hydroxyl radicals can
oxidize Fe2+ into Fe3+ , and only Fe2+ can combine with 1,10-phenanthroline to form a red compound
(1,10-phenanthroline-Fe2+ ) with the maximum absorbance at 536 nm. The concentration of hydroxyl
radical is reflected by the degree of decolorization of the reaction solution. Briefly, 1,10-phenanthroline
solution (1.0 mL, 1.865 mM) and the sample (2.0 mL) were added into a screw-capped tube and mixed.
The FeSO4 ·7H2 O solution (1.0 mL, 1.865 mM) was then pipetted into the mixture. The reaction was
initiated by adding 1.0 mL H2 O2 (0.03% v/v). After being incubated at 37 ◦ C for 60 min in a water bath,
the absorbance of the reaction mixture was measured at 536 nm against a reagent blank. The reaction
mixture without any antioxidant was used as the negative control, and mixture without H2 O2 was
used as the blank. The HO• scavenging activity was calculated by the following formula:
HO• scavenging activity (%) = [(As − An )/(Ab − An )] × 100%
where As , An , and Ab were the absorbance values determined at 536 nm of the sample, the negative
control, and the blank after reaction, respectively.
3.6.2. DPPH• Scavenging Activity
Two milliliters of deionized water containing different concentrations of samples were placed
in cuvettes, and then 500 µL of ethanol solution of DPPH (0.02%) and 1.0 mL of ethanol were added
into. A control sample containing DPPH solution without sample was also prepared. For the blank
absorbance, DPPH solution was substituted with ethanol. The antioxidant activity of the sample was
evaluated by the inhibition percentage of DPPH• with the following equation:
DPPH• scavenging activity (%) = (A0 + A′ − A)/A0 × 100%
where A was sample absorbance rate; A0 was the absorbance of control group; A′ was the
blank absorbance.
3.6.3. O2− • Scavenging Activity
In the experiment, superoxide anions were generated in 1 mL of nitrotetrazolium blue chloride
(NBT) (2.52 mM), 1 mL of nicotinamide adenine dinucleotide (NADH) (624 mM) and 1 mL of different
concentrations of samples. The reaction was initiated by adding 1 mL of phenazine methosulfate
(PMS) solution (120 µg) to the reaction mixture. The absorbance was measured at 560 nm against
the corresponding blank after 5 min of incubation at 25 ◦ C. The capacity of scavenging the O2− • was
calculated using the following equation:
O2− • scavenging activity (%) =
Acontrol − Asample /Acontrol × 100%
where Acontrol was the absorbance without sample and Asample was the absorbance with sample.
338
Mar. Drugs 2017, 15, 61
3.6.4. ABTS+ • Scavenging Activity
The ABTS radical cation was generated by mixing ABTS stock solution (7 mM) with potassium
persulphate (2.45 mM). The mixture was left in the dark at room temperature for 16 h. The ABTS
radical solution was diluted in 5 mM phosphate buffered saline (PBS) pH 7.4, to an absorbance of
0.70 ± 0.02 at 734 nm. One milliliter of diluted ABTS radical solution was mixed with one milliliter
of different concentrations of samples. Ten minutes later, the absorbance was measured at 734 nm
against the corresponding blank. The ABTS+ • scavenging activity of samples was calculated using the
following equation:
ABTS+ • scavenging activity (%) = [(Acontrol − Asample )/Acontrol ] × 100%
where Acontrol was the absorbance without sample and Asample was the absorbance with sample.
3.6.5. Lipid Peroxidation Inhibition Assay
A sample (5.0 mg) was dissolved in 10 mL of 50 mM phosphate buffer (pH 7.0), and added to a
solution of 0.13 mL of linoleic acid and 10 mL of 99.5% ethanol. Then, the total volume was adjusted to
25 mL with deionized water. The mixture was incubated in a conical flask with a screw cap at 40 ± 1 ◦ C
in a dark room and the degree of oxidation was evaluated by measuring the ferric thiocyanate values.
The reaction solution (100 µL) incubated in the linoleic acid model system was mixed with 4.7 mL of
75% ethanol, 0.1 mL of 30% ammonium thiocyanate, and 0.1 mL of 20 mM ferrous chloride solution
in 3.5% HCl. After 3 min, the thiocyanate value was measured by reading the absorbance at 500 nm
following color development with FeCl2 and thiocyanate at different intervals during the incubation
period at 40 ± 1 ◦ C.
3.7. Statistical Analysis
All experiments were performed in triplicate (n = 3), and the data are expressed as the
mean ± standard deviation (SD). ANOVA was applied to analyze the data using SPSS 19.0
(SPSS Corporation, Chicago, IL, USA). Duncan’s multiple range test was used to measure the
differences between the parameter means. The differences were considered significant if p < 0.05.
4. Conclusions
In this study, three new antioxidant peptides (SCPE-A, SCPE-B and SCPE-C) were
isolated from the protein hydrolysate of scalloped hammerhead (S. lewini) cartilage by
ultrafiltration and chromatography, and their amino acid sequences were identified as Gly-Pro-Glu
(GPE), Gly-Ala-Arg-Gly-Pro-Gln (GARGPQ), and Gly-Phe-Thr-Gly-Pro-Pro-Gly-Phe-Asn-Gly
(GFTGPPGFNG). SCPE-A, SCPE-B and SCPE-C exhibited strong radical scavenging and lipid
peroxidation inhibition activities. These results suggested that the purified peptides from the protein
hydrolysate of scalloped hammerhead cartilage may be applied as ingredients in functional foods in
bioactive food products. Our subsequent studies will focus on the molecular mechanisms and the
relationship between the antioxidant activity and structure of the three isolated peptides.
Acknowledgments: This work was funded by the National Natural Science Foundation of China (NSFC)
(No. 81673349) and the International Science and Technology Cooperation Program of China (No. 2012DFA30600).
Author Contributions: Bin Wang and Chang-Feng Chi conceived and designed the experiments. Xue-Rong Li
and Li Li performed the experiments. Xue-Rong Li and Bin Wang analyzed the data. Chang-Feng Chi and
Bin Wang contributed the reagents, materials, and analytical tools and wrote the paper.
Conflicts of Interest: The authors declare no conflicts of interest.
339
Mar. Drugs 2017, 15, 61
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Sila, A.; Bougatef, A. Antioxidant peptides from marine by-products: Isolation, identification and application
in food systems. A review. J. Funct. Foods 2016, 21, 10–26. [CrossRef]
Jang, H.L.; Liceaga, A.M.; Yoon, K.Y. Purification, characterisation and stability of an antioxidant peptide
derived from sandfish (Arctoscopus japonicus) protein hydrolysates. J. Funct. Foods 2016, 20, 433–442.
[CrossRef]
Wattanasiritham, L.; Theerakulkait, C.; Wickramasekara, S.; Maier, C.S.; Stevens, J.F. Isolation and
identification of antioxidant peptides from enzymatically hydrolyzed rice bran protein. Food Chem. 2016,
192, 156–162. [CrossRef] [PubMed]
Guo, P.; Qi, Y.; Zhu, C.; Wang, Q. Purification and identification of antioxidant peptides from Chinese cherry
(Prunus pseudocerasus Lindl.) seeds. J. Funct. Foods 2015, 19, 394–403. [CrossRef]
Chi, C.F.; Hu, F.Y.; Wang, B.; Li, Z.R.; Luo, H.Y. Influence of amino acid compositions and peptide profiles
on antioxidant capacities of two protein hydrolysates from skipjack tuna (Katsuwonus pelamis) dark muscle.
Mar. Drugs 2015, 13, 2580–2601. [CrossRef] [PubMed]
Mirzaei, M.; Mirdamadi, S.; Ehsani, M.R.; Aminlari, M.; Hosseini, E. Purification and identification of
antioxidant and ACE-inhibitory peptide from Saccharomyces cerevisiae protein hydrolysate. J. Funct. Foods
2015, 19, 259–268. [CrossRef]
Wang, B.; Gong, Y.D.; Li, Z.R.; Yu, D.; Chi, C.F.; Ma, J.Y. Isolation and characterisation of five novel antioxidant
peptides from ethanol-soluble proteins hydrolysate of spotless smoothhound (Mustelus griseus) muscle.
J. Funct. Foods 2014, 6, 176–185. [CrossRef]
Nimalaratne, C.; Bandara, N.; Wu, J. Purification and characterization of antioxidant peptides from
enzymatically hydrolyzed chicken egg white. Food Chem. 2015, 188, 467–472. [CrossRef] [PubMed]
Xing, L.; Hu, Y.; Hu, H.; Ge, Q.; Zhou, G.; Zhang, W. Purification and identification of antioxidative peptides
from dry-cured Xuanwei ham. Food Chem. 2016, 194, 951–958. [CrossRef] [PubMed]
Xue, Z.; Wen, H.; Zhai, L.; Yu, Y.; Li, Y.; Yu, W.; Cheng, A.; Wang, C.; Kou, X. Antioxidant activity and
anti-proliferative effect of a bioactive peptide from chickpea (Cicer arietinum L.). Food Res. Int. 2015, 77, 75–81.
[CrossRef]
Pan, X.; Zhao, Y.Q.; Hu, F.Y.; Wang, B. Preparation and identification of antioxidant peptides from protein
hydrolysate of skate (Raja porosa) cartilage. J. Funct. Foods 2016, 25, 220–230. [CrossRef]
Pan, X.; Zhao, Y.Q.; Hu, F.Y.; Chi, C.F.; Wang, B. Anticancer activity of a hexapeptide from skate (Raja porosa)
cartilage protein hydrolysate in HeLa Cells. Mar. Drugs 2016, 14, 153. [CrossRef] [PubMed]
Guo, H.; Kouzuma, Y.; Yonekura, M. Structures and properties of antioxidative peptides derived from royal
jelly protein. Food Chem. 2009, 113, 238–245. [CrossRef]
You, L.; Zhao, M.; Regenstein, J.M.; Ren, J. Purification and identification of antioxidative peptides from
loach (Misgurnus anguillicaudatus) protein hydrolysate by consecutive chromatography and electrospray
ionizationmass spectrometry. Food Res. Int. 2010, 43, 1167–1173. [CrossRef]
Kittiphattanabawon, P.; Benjakul, S.; Visessanguan, W.; Shahidi, F. Isolation and characterization of
collagen from the cartilages of brownbanded bamboo shark (Chiloscyllium punctatum) and blacktip shark
(Carcharhinus limbatus). LWT Food Sci. Technol. 2010, 43, 792–800. [CrossRef]
Zheng, L.; Ling, P.; Wang, Z.; Niu, R.; Hu, C.; Zhang, T.; Lin, X. A novel polypeptide from shark cartilage
with potent anti-angiogenic activity. Cancer Biol. Ther. 2007, 6, 775–780. [CrossRef] [PubMed]
Liang, Q.; Wang, L.; Sun, W.; Wang, Z.; Xu, J.; Ma, H. Isolation and characterization of collagen from the
cartilage of Amur sturgeon (Acipenser schrenckii). Process Biochem. 2014, 49, 318–323. [CrossRef]
Jeevithan, E.; Bao, B.; Bu, Y.S.; Zhou, Y.; Zhao, Q.B.; Wu, W.H. Type II collagen and gelatin from silvertip shark
(Carcharhinus albimarginatus) cartilage: Isolation, purification, physicochemical and antioxidant properties.
Mar. Drugs 2014, 12, 3852–3873. [CrossRef] [PubMed]
Wang, B.; Li, Z.R.; Chi, C.F.; Zhang, Q.H.; Luo, H.Y. Preparation and evaluation of antioxidant peptides
from ethanol-soluble proteins hydrolysate of Sphyrna lewini muscle. Peptides 2012, 36, 240–250. [CrossRef]
[PubMed]
Luo, H.Y.; Wang, B.; Li, Z.R.; Chi, C.F.; Zhang, Q.H.; He, G.Y. Preparation and evaluation of antioxidant
peptide from papain hydrolysate of Sphyrna lewini muscle protein. LWT Food Sci. Technol. 2013, 51, 281–288.
[CrossRef]
340
Mar. Drugs 2017, 15, 61
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
Li, Z.; Wang, B.; Chi, C.; Gong, Y.; Luo, H.; Ding, G. Influence of average molecular weight on antioxidant
and functional properties of cartilage collagen hydrolysates from Sphyrna lewini, Dasyatis akjei and Raja porosa.
Food Res. Int. 2013, 51, 283–293. [CrossRef]
Najafian, L.; Babji, A.S. Production of bioactive peptides using enzymatic hydrolysis and identification
antioxidative peptides from patin (Pangasius sutchi) sarcoplasmic protein hydolysate. J. Funct. Foods 2014, 9,
280–289. [CrossRef]
Wang, B.; Li, L.; Chi, C.F.; Ma, J.H.; Luo, H.Y.; Xu, Y.F. Purification and characterisation of a novel antioxidant
peptide derived from blue mussel (Mytilus edulis) protein hydrolysate. Food Chem. 2013, 138, 1713–1719.
[CrossRef] [PubMed]
Delgado, M.C.O.; Nardo, A.; Pavlovic, M.; Rogniaux, H.; Añón, M.C.; Tironi, V.A. Identification and
characterization of antioxidant peptides obtained by gastrointestinal digestion of amaranth proteins.
Food Chem. 2016, 197, 1160–1167. [CrossRef] [PubMed]
Liu, K.; Zhao, Y.; Chen, F.; Fang, Y. Purification and identification of Se-containing antioxidative peptides
from enzymatic hydrolysates of Se-enriched brown rice protein. Food Chem. 2015, 187, 424–430. [CrossRef]
[PubMed]
Park, S.Y.; Kim, Y.S.; Ahn, C.B.; Je, J.Y. Partial purification and identification of three antioxidant peptides with
hepatoprotective effects from blue mussel (Mytilus edulis) hydrolysate by peptic hydrolysis. J. Funct. Foods
2016, 20, 88–95. [CrossRef]
Wu, Q.; Du, J.; Jia, J.; Kuang, C. Production of ACE inhibitory peptides from sweet sorghum grain protein
using alcalase: Hydrolysis kinetic, purification and molecular docking study. Food Chem. 2016, 199, 140–149.
[CrossRef] [PubMed]
You, S.J.; Wu, J.P. Angiotensin-I converting enzyme inhibitory and antioxidant activities of egg protein
hydrolysates produced with gastrointestinal and nongastrointestinal enzymes. J. Food Sci. 2011, 76, 801–807.
[CrossRef] [PubMed]
Ahn, C.B.; Kim, J.G.; Je, J.Y. Purification and antioxidant properties of octapeptide from salmon byproduct
protein hydrolysate by gastrointestinal digestion. Food Chem. 2014, 147, 78–83. [CrossRef] [PubMed]
Cai, L.; Wu, X.; Zhang, Y.; Li, X.; Ma, S.; Li, J. Purification and characterization of three antioxidant peptides
from protein hydrolysate of grass carp (Ctenopharyngodon idella) skin. J. Funct. Foods 2015, 16, 234–242.
[CrossRef]
Hong, J.; Chen, T.T.; Hu, P.; Yang, J.; Wang, S.Y. Purification and characterization of an antioxidant peptide
(GSQ) from Chinese leek (Allium tuberosum Rottler) seeds. J. Funct. Foods 2014, 10, 1–10. [CrossRef]
Rajapakse, N.; Mendis, E.; Jung, W.K.; Je, J.Y.; Kim, S.K. Purification of a radical scavenging peptide from
fermented mussel sauce and its antioxidant properties. Food Res. Int. 2005, 38, 175–182. [CrossRef]
Zhuang, H.; Tang, N.; Yuan, Y. Purification and identification of antioxidant peptides from corn gluten meal.
J. Funct. Foods 2013, 5, 1810–1821. [CrossRef]
Ranathunga, S.; Rajapakse, N.; Kim, S.K. Purification and characterization of antioxidative peptide derived
from muscle of conger eel (Conger myriaster). Eur. Food Res. Technol. 2006, 222, 310–315. [CrossRef]
Ren, J.; Zhao, M.; Shi, J.; Wang, J.; Jiang, Y.; Cui, C.; Kakuda, Y.; Xue, S.J. Purification and identification of
antioxidant peptides from grass carp muscle hydrolysates by consecutive chromatography and electrospray
ionization-mass spectrometry. Food Chem. 2008, 108, 727–736. [CrossRef] [PubMed]
Chen, C.; Chi, Y.J.; Zhao, M.Y.; Lv, L. Purification and identification of antioxidant peptides from egg white
protein hydrolysate. Amino Acids 2012, 43, 457–466. [CrossRef] [PubMed]
Re, R.; Pellegrini, N.; Proteggente, A.; Pannala, A.; Yang, M.; Rice-Evans, C. Antioxidant activity applying an
improved ABTS radical cation decolorization assay. Free Radic. Biol. Med. 1999, 26, 1231–1237. [CrossRef]
Zheng, L.; Zhao, M.; Xiao, C.; Zhao, Q.; Su, G. Practical problems when using ABTS assay to assess the
radical-scavenging activity of peptides: Importance of controlling reaction pH and time. Food Chem. 2016,
192, 288–294. [CrossRef] [PubMed]
Kim, E.K.; Oh, H.J.; Kim, Y.S.; Hwang, J.W.; Ahn, C.B.; Lee, J.S.; Jeon, Y.J.; Moon, S.H.; Sung, S.H.; Jeon, B.T.;
et al. Purification of a novel peptide derived from Mytilus coruscus and in vitro/in vivo evaluation of its
bioactive properties. Fish Shellfish Immunol. 2013, 34, 1078–1084. [CrossRef] [PubMed]
Jiang, H.; Tong, T.; Sun, J.; Xu, Y.; Zhao, Z.; Liao, D. Purification and characterization of antioxidative
peptides from round scad (Decapterus maruadsi) muscle protein hydrolysate. Food Chem. 2014, 154, 158–163.
[CrossRef] [PubMed]
341
Mar. Drugs 2017, 15, 61
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
Chi, C.F.; Hu, F.Y.; Wang, B.; Ren, X.J.; Deng, S.G.; Wu, C.W. Purification and characterization of three
antioxidant peptides from protein hydrolyzate of croceine croaker (Pseudosciaena crocea) muscle. Food Chem.
2015, 168, 662–667. [CrossRef] [PubMed]
Conway, V.; Gauthier, S.F.; Pouliot, Y. Antioxidant activities of buttermilk proteins, whey proteins, and their
enzymatic hydrolysates. J. Agric. Food Chem. 2013, 61, 364–372. [CrossRef] [PubMed]
Hu, F.Y.; Chi, C.F.; Wang, B.; Deng, S.G. Two novel antioxidant nonapeptides from protein hydrolysate of
skate (Raja porosa) muscle. Mar. Drugs 2015, 13, 1993–2009. [CrossRef] [PubMed]
Chen, C.; Chi, Y.J.; Zhao, M.Y.; Xu, W. Influence of degree of hydrolysis on functional properties,
antioxidant and ACE inhibitory activities of egg white protein hydrolysate. Food Sci. Biotechnol. 2012,
21, 27–34. [CrossRef]
Samaranayaka, A.G.P.; Li-Chan, E.C.Y. Food-derived peptidic antioxidants: A review of their production,
assessment, and potential applications. J. Funct. Foods 2011, 3, 229–254. [CrossRef]
Huang, D.; Ou, B.; Prior, R.L. The chemistry behind antioxidant capacity assays. J. Agric. Food Chem. 2005,
53, 1841–1856. [CrossRef] [PubMed]
Gimenez, B.; Aleman, A.; Montero, P.; Gomez-Guillen, M.C. Antioxidant and functional properties of gelatin
hydrolysates obtained from skin of sole and squid. Food Chem. 2009, 114, 976–983. [CrossRef]
Memarpoor-Yazdi, M.; Asoodeh, A.; Chamani, J. A novel antioxidant and antimicrobial peptide from hen
egg white lysozyme hydrolysates. J. Funct. Foods 2012, 4, 278–286. [CrossRef]
Díaz, M.; Dunn, C.M.; McClements, D.J.; Decker, E.A. Use of caseinophosphopeptides as natural antioxidants
in oil-in-water emulsions. J. Agric. Food Chem. 2003, 51, 2365–2370. [CrossRef] [PubMed]
Wiriyaphan, C.; Xiao, H.; Decker, E.A.; Yongsawatdigul, J. Chemical and cellular antioxidative properties of
threadfin bream (Nemipterus spp.) surimi byproduct hydrolysates fractionated by ultrafiltration. Food Chem.
2015, 167, 7–15. [CrossRef] [PubMed]
Wang, B.; Wang, Y.M.; Chi, C.F.; Hu, F.Y.; Deng, S.G.; Ma, J.Y. Isolation and characterization of collagen and
antioxidant collagen peptides from scales of croceine croaker (Pseudosciaena crocea). Mar. Drugs 2013, 11,
4641–4661. [CrossRef] [PubMed]
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
342
marine drugs
Review
Bioactive Peptide of Marine Origin for the Prevention
and Treatment of Non-Communicable Diseases
Ratih Pangestuti 1 and Se-Kwon Kim 2,3, *
1
2
3
*
Research Center for Oceanography, Indonesian Institute of Sciences (LIPI), Jakarta 14430, Indonesia;
ratih.pangestuti@lipi.go.id or pangestuti.ratih@gmail.com
Department of Marine-bio Convergence Science, Pukyong National University, Busan 608-737, Korea
Institute for Life Science of Seogo (ILSS), Kolmar Korea Co., Seoul 137-876, Korea
Correspondence: sknkim@pknu.ac.kr; Tel.: +82-51-629-7550
Academic Editor: Keith B. Glaser
Received: 1 December 2016; Accepted: 6 March 2017; Published: 9 March 2017
Abstract: Non-communicable diseases (NCD) are the leading cause of death and disability worldwide.
The four main leading causes of NCD are cardiovascular diseases, cancers, respiratory diseases
and diabetes. Recognizing the devastating impact of NCD, novel prevention and treatment strategies
are extensively sought. Marine organisms are considered as an important source of bioactive
peptides that can exert biological functions to prevent and treatment of NCD. Recent pharmacological
investigations reported cardio protective, anticancer, antioxidative, anti-diabetic, and anti-obesity
effects of marine-derived bioactive peptides. Moreover, there is available evidence supporting
the utilization of marine organisms and its bioactive peptides to alleviate NCD. Marine-derived
bioactive peptides are alternative sources for synthetic ingredients that can contribute to a consumer’s
well-being, as a part of nutraceuticals and functional foods. This contribution focus on the bioactive
peptides derived from marine organisms and elaborates its possible prevention and therapeutic roles
in NCD.
Keywords: bioactive peptide; marine; prevention; treatment; non-communicable diseases
1. Introduction
Non-communicable diseases (NCD), sometimes referred to as chronic diseases, are the leading
cause of death and disability globally [1,2]. NCD are not passed from person to person, and these
diseases are of long duration and slow progression. Many of the NCD are strongly associated
with lifestyle-related choices (unhealthy diet, physical inactivity, and tobacco and alcohol use),
and environmental and genetic factors [3]. The four main leading causes of NCD deaths are
cardiovascular diseases (CVD), cancers, respiratory diseases and diabetes [4]. In 2012, CVD was
responsible for around 17.5 million deaths (46.2% of NCD deaths), while cancers around 8.2 million
deaths (21.7% of NCD deaths) (Figure 1).
NCD are increase rapidly poses one of the major health challenges of the 21st century. Of the
56 million global deaths in 2012, 68% or 38 million were attributed to NCD and projected to rise
further worldwide. It has been predicted by the World Health Organization of the United Nations
(WHO) that NCD will be responsible for a significant increase total number of deaths in the next decade.
The greatest NCD increase is expected to be seen in low and middle income countries where 80% of
NCD deaths occur. Notably, NCD are projected to surpass communicable, maternal, perinatal and
nutritional diseases as the most common cause of death by 2030 in Africa [5]. The rapidly growing
burden of NCD in low and middle income countries is not only accelerated by population aging,
but also by the negative impact of globalization [2].
Mar. Drugs 2017, 15, 67
343
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2017, 15, 67
Figure 1. Top four cause of death attributed to non-communicable diseases in the world (References: [1,2]).
Recognizing the devastating impact of NCD, novel preventive and therapeutic strategies are
extensively sought. Many research groups have combed both terrestrial and marine natural resources
for NCD remedies [4,6–8]. Marine organisms are consistently exposed to biotic and abiotic pressures,
which exert an influence on the organisms physiology, leading to the production of metabolites to
survive and thrive [4,9]. Therefore, marine organisms are reservoirs of structurally diverse bioactive
materials with numerous biological effects for human’s body. These bioactive materials include
polysaccharides (agar, alginates, carrageenan, fucoidan, ulvan, laminarin, porphyran, and fulcellaran),
pigments (chlorophyll, carotenoids, and phycobillins), protein and peptides, polyunsaturated fatty
acids (PUFA), polyphenols, and other bioactive compounds. Among marine-derived bioactive
materials, much attention has been paid to unraveling the structural and biological properties
of bioactive peptides. Depending on the structural and sequence of amino acids, these peptides
can exhibit diverse activities for NCD remedies, including cardio protective, antihypertensive,
anticancer, anti-diabetic, and antioxidative. Not restricted to one activity, many of the bioactive
peptides are multifunctional and can exert more than one of the effects mentioned. For above
reasons, marine-derived bioactive peptides are considered prominent candidates for NCD prevention
and treatment.
This article focuses on bioactive peptides reported from fish, mollusks, crustaceans, and seaweeds.
It highlights and compiles the most relevant studies on the structural diversity of peptides found in
these marine organisms and outlines their potential as candidate raw materials for the generation of
bioactive peptides. Notably, their possible biological role with potential utilization as NCD prevention
and remedy will be briefly discussed. Furthermore, some purification and isolation technique of
marine-derived bioactive peptides will be outlined.
2. Marine-Derived Cardio Protective Peptides
The CVD is the leading cause of death and diseases burden in many countries [10,11]. The major
independent risk factor for CVD is hypertension. In 2000, the estimated total number of adults with
hypertension was nearly one billion or equal to 25% of the total adult population worldwide. The total
number of adult with hypertension was predicted to increase to a total of 1.56 billion (60% of the total
adult population) in 2025 [12].
The important regulator of blood pressure homeostasis in mammals is renin-angiotensin
system (RAS). Renin (EC 3.4.23.15) converts angiotensinogen to angiotensin I, and it will be converted to
biologically active angiotensin II by angiotensin-I converting enzyme (ACE, peptidyldipeptide hydrolase,
EC 3.4.15.1), which ultimately leads to hypertension. In addition, ACE regulates the inactivation of
bradykinin [13]. Therefore, ACE and renin inhibitor makes a positive contribution to hypertension
treatment and specific inhibitors are currently used in pharmaceuticals. Synthetic hypertension drugs
such as captopril, enalapril, and lisinopril are remarkably effective; however, they are known to cause
adverse side effects. Hence, search for natural antihypertensive as alternative to synthetic inhibitors are
344
Mar. Drugs 2017, 15, 67
of interest. Marine-derived anti-hypertensive peptides have shown potent renin and ACE inhibitory
activities (Figure 2) and, therefore, potential to be used and developed as cardio protective peptides.
Figure 2. Potent renin and angiotensin-I converting enzyme inhibitory activity of marine-derived
anti-hypertensive peptides.
2.1. Marine-Derived Renin Inhibitory Peptides
Renin has long been recognized as the key regulator of RAS, which has an established role in
controlling blood volume, arterial pressure, and cardiac and vascular function [14]. The first new class
of orally active, non-peptide, low molecular weight renin inhibitors was discovered in Switzerland.
The renin inhibitor was named Aliskiren (formerly CGP 60536) [15]. Afterwards, many studies have
identified renin inhibitory substances derived from plant sources.
In 2012, Fitzgerald and his colleagues had successfully isolated and characterized renin inhibitory
peptides derived from marine red algae Palmaria palmata papain hydrolysates [16]. The tridecapeptide
sequence was identified as Ile-Arg-Leu-Ile-Ile-Val-Leu-Met-Pro-Ile-Leu-Met-Ala. In vivo result showed
that P. palmata hydrolysate and tridecapeptide reduced spontaneously hypertensive rat (SHR) blood
pressure when administered orally after a 24 h period. After 24 h, SHR group fed the P. palmata
hydrolysate recorded a drop of 34 mm Hg in systolic blood pressure (SBP), while the group fed the
tridecapeptide presented a drop of 33 mm Hg in blood pressure compared to the SBP recorded at time
zero [17]. It was concluded that the potential active form of the peptide is dipeptides originated along
the passage through gastrointestinal tract [18]. Further, P. palmata protein hydrolysate was formulated
in wheat bread. Four percent P. palmata protein hydrolysate content in wheat bread did not affect the
texture or sensory properties of the bread to a large degree. Interestingly, wheat bread containing the
hydrolysate retained renin inhibitory bioactivity after the baking process; therefore, baked products
may be one of the suitable delivery vehicles for bioactive peptides as renin inhibitor [19].
2.2. Marine-Derived ACE Inhibitory Peptides
It was revealed that ACE inhibitors significantly reduced the mortality of heart failure patients.
Marine-derived ACE inhibitory peptides have been studied intensively and the first one was isolated
from sardine by a Japanese scientist [20]. Afterwards, many other marine-derived ACE inhibitory
peptides have been discovered. Up to now, more than 125 ACE-inhibitory peptides sequences have
been isolated and identified from marine organisms. The potency of marine-derived ACE inhibitory
peptides are normally expressed as half maximal inhibitory concentration (IC50 ) value, which is
the ACE inhibitor concentration leading to 50% inhibition of ACE activity [8]. The ACE inhibition
patterns of marine-derived ACE inhibitory peptides were analyzed by Lineweaver–Burk plot and
the competitive inhibitions are the more frequent reported pattern compared to non-competitive
345
Mar. Drugs 2017, 15, 67
inhibition [21]. Competitive inhibition means that marine-derived ACE inhibitory peptides can bind
to the active site to block it or to the inhibitor binding site that is remote from the active site to alter the
enzyme conformation such as that the substrate no longer binds to the active site [22].
As summarized in Table 1, peptides derived from algae, tuna, shark and salmon showed stronger
ACE inhibitory activity compared to other marine organisms such as oyster, sipuncula, and jellyfish.
The ACE inhibitory activity of marine-derived bioactive peptides were higher compared to ACE
inhibitory peptide-derived from terrestrial food source (i.e., milk, chicken muscle and bovine) [23,24].
Marine-derived ACE inhibitory peptides are generally short chain peptides [18,25–27]. It was reported
that amino acid residues with bulky side chain as well as hydrophobic side chains were more active
for dipeptides [28]. Meanwhile, for tripeptides, the most favorable residue for the C-terminus was
aromatic amino acids, positively charged amino acid in the middle and hydrophobic amino acid in the
N-terminus [29]. Molecular weight is also an important factor on ACE inhibitory activity of peptides.
Generally, ACE inhibitory peptides are short sequences of hydrophobic amino acids, and have low
molecular weights.
Table 1. ACE inhibitory activity of marine-derived bioactive peptides.
Source
Extraction
Sequence
Inhibition (IC50 )
References
Hot water extraction; Chromatography
Ile-Tyr
2.7 µM
[18]
Enzymatic hydrolysis (Protease S);
Chromatography
Ile-Trp
1.5 µM
[30]
Seaweed
(P. yezoensis)
Chromatography
Ala-Lys-Tyr-Ser-Tyr
1.52 µM
[31]
Microalgae
(Spirulina platensis)
Enzymatic hydrolysis (Pepsin);
Chromatography
Ile-Ala-Pro-Gly
11.4 µM
[32]
Yellowfin tuna
(Neothunnus macropterus)
Chromatography
Pro-Thr-His-Ile-LysTrp-Gly-Asp
2 µM
[33]
Skipjack tuna
(Katsuwonus pelamis) bowels
Chromatography
Leu-Arg-Pro
1 µM
[34]
Alaska Pollack skin
(Theragra chalcogramma)
Enzymatic hydrolysis
(serial protease); Chromatography
Gly-Pro-Leu
2.6 µM
[35]
Chum salmon
(Oncorhynchus keta) muscle
Enzymatic hydrolysis (Thermolysin);
Chromatography
Val-Trp
2.5 µM
[36]
Pink salmon
(Oncorhynchus gorbuscha)
Enzymatic hydrolysis (papain);
Chromatography
Ile-Trp
1.2 µM
[37]
Skate skin
(Okamejei kenojei)
Enzymatic hydrolysis
(alkalase/protease); Chromatography
Met-Val-Gly-Ser-AlaPro-Gly-Val-Leu
3.09 µM
[38]
Small-spotted catshark
(Scyliorhinus canicula)
Enzymatic hydrolysis
(Trypsin, subtilisin); Chromatography
Val-Ala-Met-Pro-Phe
0.44 µM
[39]
Pelagic thresher
(Alopias pelagicus) muscle
Enzymatic hydrolysis (thermolysin);
Chromatography
Ile-Lys-Trp
0.54 µM
[26]
Enzymatic hydrolysis (Protease);
Chromatography
Ile-Phe-Val-Pro-Ala-Phe
3.4 µM
[40]
Fermentation; Chromatography
Asp-Pro
2.15 µM
[41]
Enzymatic hydrolysis (Pepsin);
Chromatography
Leu-His-Pro
3.4 µM
[42]
Izumi shrimp
(Plesionika izumiae Omori, 1971)
Enzymatic hydrolysis (Protease);
Chromatography
Ser-Thr
4.03 µM
[43]
Jellyfish
(Rhopilema esculentum)
Enzymatic hydrolysis (pepsin, papain);
ultrafiltration; Chromatography
Gln-Pro-Gly-Pro-Thr
80.67 µM
[44]
Sipuncula
(Phascolosoma esculenta)
Enzymatic hydrolysis (Pepsin);
Chromatography
Ala-Trp-Leu-His-ProGly-Ala-Pro-Lys-Val-Phe
135 M
[45]
Pearl oyster
(Pinctada fucata martensii)
Enzymatic hydrolysis (Pepsin);
Chromatography
Ala-Leu-Ala-Pro-Glu
167.5 µM
[46]
Seaweed
(Undaria pinnatifida)
Marine shrimp
(Acetes chinensis)
Many in vivo studies in SHR and hypertensive human volunteers demonstrated that marine-derived
ACE inhibitory peptides significantly reduce blood pressure. For example, bonito oligopeptide (at a dose
of 3 mg/day) decreased blood pressure in human subjects with borderline or mild hypertension.
346
Mar. Drugs 2017, 15, 67
More recently, the purified oligopeptide from bonito was optimized by ultrafiltration methods.
The optimized bonito peptide (at a dose of 1.5 mg/day) showed anti-hypertensive effects in a double-blind,
randomized, cross-over study in 61 human subjects with borderline or mild hypertension without any
side-effects [47,48]. Subsequent report indicated that bonito oligopeptide played a direct action on
relaxation of vascular smooth muscle in addition to the ACE-inhibitory activity [49].
Anti-hypertensive effect of peptides-derived from fish gelatin has already been reported
in SHR. Peptides-derived from O. kenojei inhibited vasoconstriction via PPAR-c expression, activation
and phosphorylation of eNOS in lungs. The peptides also involved in the expression levels
of endothelin-1, RhoA, a-smooth muscle actin, cleaved caspase 3 and MAPK were decreased
by SAP in lungs. SP1 (Leu-Gly-Pro-Leu-Gly-Val-Leu, molecular weight (MW): 720 Da) and SP2
(Met-Val-Gly-Ser-Ala-Pro-Gly-Val-Leu, MW: 829 Da) showed potent ACE inhibition with IC50
values of 4.22 and 3.09 µM, respectively [38]. Peptide from tuna and chum salmon (O. keta) also
showed potent anti-hypertensive activity as tested in SHR [50,51]. Oral administration of tuna
peptides (Gly-Asp-Leu-Gly-Lys-Thr-Thr-Thr-Val-Ser-Asn-Trp-Ser-Pro-Pro-Lys-Try-Lys-Asp-Thr-Pro,
MW: 2480 Da) in SHR decreased SBP of 21 mmHg. Lee et al. (2014) demonstrated that oral
administration (20 mg/kg) of chum salmon peptides showed a strong suppressive effect on SBP of SHR.
They claimed that antihypertensive activity of chum salmon peptide was similar with captopril [50].
The ACE inhibitory activities of brown and red seaweed-derived bioactive peptides have been
confirmed in SHR. More than one decade ago, Suetsuna et al. (2000) successfully characterized diand tetrapeptides derived from the brown algae, U. pinatifida and showed that administration of those
peptides in SHR significantly decreased blood pressure in SHR [25]. Marine microalgae (C. ellipsoidea)
tetrapeptides (Val-Glu-Gly-Tyr) also showed a potent anti-hypertensive activity. Oral administration
of C. ellipsoidea tetrapeptides at a dose of 10 mg/kg significantly decrease SBP in SHR [52].
Due to their effectiveness in regulating blood pressure, marine-derived bioactive peptides
have prospective use as high quality diets for the prevention and treatment of CVD as well as
other NCD. In Japan, some of the marine-derived peptides and hydrolysates have been approves
as “foods for specified health uses” (FOSHU) by Japanese Ministry of Health, Labor, and Welfare.
Presently, bonito oligopeptide are incorporated in blood pressure lowering capsules and sold as
nutraceuticals worldwide. However, generally, marine-derived anti-hypertensive peptides are short
sequences of hydrophobic amino acids, which normally give bitter taste. Therefore, to increase
consumer’s acceptance, flavor manipulation needs to be used when developing marine-derived
peptides as functional foods products.
3. Marine-Derived Anti-Cancer Peptides
Cancer is a condition of uncontrolled growth of cells which interferes with the normal functioning
of the body and has undesirable systematic effects [53]. It is a dreadful NCD which increases with
changing lifestyle, unhealthy diet and global warming [54]. Therefore, fruitful approaches are needed
for the prevention and treatment of these diseases. Current cancer available treatments such as
chemotherapy many times causing disastrous side effect; and most anticancer drugs currently used
in chemotherapy are giving toxic effects to the normal cells which cause immunotoxicity and,
hence, aggravate patient’s recovery [55]. In this context, a variety of ingredients of traditional
medicines are being widely investigated to analyze their potential as cancer therapeutic agents.
Presently, more than 60% of the used anticancer agents are derived from natural sources [56].
Although marine resources are still underrepresented in current pharmacopeia, it is anticipated that
marine environment will become the invaluable source for cancer therapeutic agents in the future [57].
Many studies reported that marine-derived bioactive peptides could induce cancer cell death by
different mechanisms such as apoptosis, affecting the tubulin-microtubule equilibrium, or inhibiting
angiogenesis [57,58].
347
Mar. Drugs 2017, 15, 67
3.1. Anti-Cancer Peptides Derived from Sponges
Marine sponges (Porifera) are the oldest metazoan group, having an outstanding importance
as a living fossil. There are approximately 8000 described species of sponges and perhaps twice
as many un-described species. Sponges inhabit every type of marine environment, from polar
seas to temperate and tropical waters and also thrive and prosper at all depths. Marine sponges
have been renowned and ranked at the top with respect to the discovery of bioactive compounds
with the diversity in chemical structures being related to an equally diverse pattern of activities.
The chemical diversity of sponge bioactive metabolites is remarkable, including unusual nucleosides,
bioactive terpenes, sterols, peptides, alkaloids, fatty acids, peroxides, and amino acid derivatives
(which are frequently halogenated). In recent years, anticancer peptides have been isolated from
marine sponges.
Discodermins is the first head-to-side chain novel cyclodepsipeptides isolated from marine
sponge Discodermia kiiensis. Discodermins A–H contain 13–14 known and rare amino acids as a chain,
with a macrocyclic ring constituted by lactonization of a threonine unit with the carboxy terminal.
All the discodermins types are cytotoxic against murine leukemia (P388) cells, human lung (A549) cell
with IC50 values from 0.02 to 20 µg/mL. It was demonstrated that macrolactone ring is also essential
for the cytotoxic activity. Furthermore, Fusetani and co-workers (1995) reported the isolation and
structure of Halicylindramides A–C, which are cyclic depsipeptides isolated from the Japanese marine
sponge Halichondria cylindrata. Further, the structures of halicylindramide D and halicylindramide E
have also been reported. Halicylindramide E is a truncated and linear version of Halicylindramide B
amidated at the C-terminus. Compared to other type of Halicylindramide, Halicylindramide E loses
cytotoxicity and shows low antifungal activity; suggesting that “head to side chain” arrangement are
crucial for the bioactivity of these peptides.
Jaspamide (also known as Jasplakinolide) is a cyclic depsipeptide with 15-carbon macrocyclic
ring containing three amino acid residues (L-alanine, N-methyl-2-bromotryptophan, and β-tyrosine).
Jasplakinolide was originally isolated from the marine sponge Jaspis johnstoni [59]. These cyclic
depsipeptides have been extensively investigated as a potential cancer therapeutic agent.
Jaspamide has been demonstrated to have growth inhibitory effect on PC-3, prostate carcinoma
(DU-145), and Lewis lung carcinoma (LNCaP) cells [60]. It is unique anti-cancer agents that stabilizes
actin filaments in vitro, and disrupts actin filaments and induce polymerization of monomeric
actin into amorphous masses in vivo. In recent years, several analogs of jaspamides have been
isolated from J. splendens and many of them possess anticancer activity [61]. Another sponge-derived
cyclic depsipeptide, Geodiomolides A, B, H and I, also showed anti-proliferative activity
against breast cancer (T47D and MCF-7) cells via actin depolymerization. Geodiamolides were
previously isolated and characterized from the Carribean sponge Geodia sp. (order Astrophorida;
family Geodidae). Further experiments demonstrated that geodiamolide H induces striking phenotypic
modifications in human breast cancer (Hs578T) cells [62]. Geodiamolide H decreases Hs578T cell
migration and invasion which probably mediated through modifications in the actin cytoskeleton.
Interestingly, Geodiamolides H was not cytotoxic for human mammary epithelial (MCF 10A) cell
lines [63].
Hemiasterlins comprise a small family of naturally occurring N-methylated tripeptide with
highly alkylated unnatural amino acids, was originally isolated from the sponge Hemiasterella minor
(class, Demospongiae; order, Hadromedidia; family, Hemiasterllidae). Hemiasterlins act as potent
tumor growth inhibitors. It was reported that Hemiasterlins exhibit antimitotic activity and thus are
useful for the treatment of certain cancers. Synthetic analog of hemiasterlins, taltobulin (HTI-286) was
a potent inhibitor of proliferation in 18 human tumor cell lines and had substantially less interaction
with multidrug resistance protein 1 than currently used antimicrotubule agents, including vinblastine,
paclitaxel, docetaxel, or vinorelbine [64]. HTI-286 and another hemiasterlin analog (E7974) are recently
being evaluated in clinical trials [65].
348
Mar. Drugs 2017, 15, 67
Arenastatin A, also known as cryptophycin-24, is potent cytotoxic cyclodepsipeptide isolated from
the Okinawan marine sponge Dysidea arenaria [66]. Arenastatin A showed extremely potent cytotoxicity
against an epidermal carcinoma [67] tumor cell line. Further experiments of cryptophycin-24
showed only marginal in vivo antitumor activity, making it ineligible for further clinical trials [68].
Phakellistatins, a group of proline rich cyclopeptides, have been isolated from Phakellia sp.
(class Demospongiae, order Axinellida). Up to now, 19 phakellistatins have been isolated [69–72].
Of all the phakellistatins, four comprise the distinctive Pro-Pro track, which represents a considerable
synthetic challenge. Phakellistatin 3 represents a new type of cyclopeptide containing an amino acid
unit apparently derived from a photooxidation product of tryptophan. Interestingly, all phakellistatins
exhibited cancer cell growth inhibitory activities [73]. Reniochalistatins is another group of cyclopeptides
rich in proline residues from an extract of a tropical marine sponge, Reniochalina stalagmitis Lendenfeld
(class Demospongiae, order Halichondria, family Axnellidae) [74]. Recently, Zhan et al. successfully
isolated reniochalistatin [75] and reported that only octapeptide (reniochalistatin) was effective
inhibited growth different tumor cell lines (RPMI-8226, MGC-803, HL-60, HepG2, and HeLa).
Notably, owing to conflicting reports of naturally occurring, proline-rich cyclopeptides that were
initially described as having anti-proliferative activity, but subsequent synthetic samples were not
active; it is premature to draw any general conclusions regarding a structure–activity relationship
among the proline-rich cyclic peptides.
Mostly, anti-cancer activities of peptides-derived from sponge were investigated in vitro, therefore
further detailed animal studies and clinical human trials are highly needed to evaluate the physiological
anti-cancer activities of these peptides. It is important to note that sponges are susceptible to over
exploitation due to their richness in bioactive compounds, hence management and conservations issue
of sponge also need to be addressed. Once isolated and characterized, bioactive peptides derived
from sponges can be synthesized by peptide synthesis. Synthesis of anticancer peptides derived
from sponges can be used for further steps of clinical trials and may provide an alternative to the
overexploitation of sponges as for medicinal purposes
3.2. Anti-Cancer Peptides Derived from Fish
The medicinal use of shark cartilage originated from the basic science and observational studies.
Early theories regarding the use of shark cartilage for cancer stemmed from the belief that sharks are
not afflicted by cancer. In 1992, William Lane published a book entitled “Sharks Don’t Get Cancer” [76].
Additionally, cartilage is often recommended by natural medicine experts for cancer, psoriasis,
and inflammatory joint diseases [77]. Those traditional remedies and studies have gained attention to
develop commercialized anti-cancer agents derived from shark cartilage.
Neovastat (AE-941) is a standardized liquid extract comprising the <500 kDa fraction
from the cartilage of shark, Squalus acanthias [78]. In vitro and in vivo studies of AE-941 have
demonstrated anti-tumor, anti-angiogenic and anti-inflammatory properties. AE-941 could inhibit
matrix metalloproteinases (MMP)-2, MMP-9, and MMP-12, and stimulate tissue plasminogen activator
enzymatic activities. AE-941 also selectively competes for the binding of vascular endothelial
growth factor (VEGF) to its receptor (VEGFR), causing disruption of the signaling pathway which
finally induces apoptotic activities in endothelial cells [79]. Further, AE-941 has been tested in
a randomized phase III trial in patients with advanced solid tumors (prostate, lung, breast and kidney).
However, the result showed that AE-941 was inactive in patients with advanced-stage cancers.
AE-941 failed to meet endpoint in the phase III trial, and hence the development was stopped [80].
In 2007, Zheng et al. purified a linear polypeptide with (PG155) from the cartilage of
blue shark (Prionace glauca). The isolated peptide could inhibit VEGF induced migration and
tubulogenesis of human umbilical vein endothelial cells (HUVECs) [81]. As summarized in Table 2,
anti-cancer peptides from other marine fish such as pipefish, Red Sea Moses sole, tuna, anchovy
and grouper have also been isolated and purified [82–86]. The peptides isolated from marine fish
showed anti-cancer activity in human breast cancer (MCF-7), human lung carcinoma (A549), human
349
Mar. Drugs 2017, 15, 67
leukemic lymphoblasts (CCRF-CEM), hepatocellular carcinoma (HA59T/VGH), cervical cancer [87],
human liver cancer (HepG2), human fibrosarcoma (HT1080), human myeloid leukemia (U937), human
prostate cancer (PC-3), and oral squamous cell carcinoma (OSCC) cells. Pardaxin, a cell-penetrating
peptide with cytotoxicity against cancer cells has been isolated from the marine fish Red Sea
Moses sole (Pardachirus marmoratus) [88]. Pardaxin anti-cancer activity was mediated by apoptosis,
as demonstrated by an increase in the externalization of plasma membrane phosphatidylserine and
the presence of chromatin condensation. Cancer cells treated with pardaxin also showed elevation
of caspase-3/7 activities, disruption of the mitochondrial membrane potential, and accumulation
of reactive oxygen species (ROS) production [89]. However, compared to the snake-derived venom
peptide; IC50 value of anti-cancer effects of marine-derived bioactive peptides is relatively higher
(Table 2).
Anticancer peptide has also been isolated from half-fin anchovy (Setipinna taty), the peptide
sequence was identified as Tyr-Ala-Leu-Pro-Ala-His. The peptide was found to be active inhibiting
prostate cancer cells proliferation. Further, three modified peptide were synthesized in order to
disclose the contribution of specific amino acid residue to the anti-proliferative activity. The authors
concluded that hydrogen-bond formation of the guanidine moiety in arginine (R) with phosphates,
sulfates, and carboxylates on cellular components was proposed to be appreciated for cell-permeation
efficacy and crucial for the anti-cancer activity. However, the underlying mechanisms of anti-cancer
activities are yet clarified.
Table 2. Anti-cancer effects of bioactive peptides derived from marine fish and other organisms.
Name
Source
Anti-Cancer Activity
References
Neovastat
(AE-941)
Spiny dogfish shark
(Squalus acanthias)
Inhibition of metastatic activity on HUVEC,
BAEC cells; inhibition of matrix
metalloproteinase; Anti-angiogenic effects;
Pro-apoptotic on BAEC cells
[78,90]
Pardaxin
Red Sea Moses sole
(Pardachirus marmoratus)
Pro-apoptotic on HT1080
(IC50 : 14.52–15.74 µg/mL), HeLa, OSCC cells
[89,91–94]
PG155
Blue shark
(Prionace glauca)
Anti-angiogenic effects on HUVECs
[81]
Syngnathusin
Pipefish
(Syngnathus acus)
Pro-apoptotic on A549 (IC50 : 84.9 µg/mL),
and CCRF-CEM (IC50 : 215.3 µg/mL), cells
[86]
Epinecidin-1
Grouper
(Epinephelus coioides)
Anti-angiogenic effects on A549,
HA59T/VGH, HeLa, HepG2, and HT1080
cells Pro-apoptotic on U937 cells
[82,83]
PAB 1; PAB2
Long tail tuna
(Thunnus tonggol)
Pro-apoptotic on MCF-7 cells
(IC50 : 8.1; 8.8 µM)
[84]
YALRAH
Half-fin anchovy
(Setipinna taty)
Pro-apoptotic on PC-3 cells (IC50 : 11.1 µM)
[85]
Rusvinoxidase
Venom of
Daboia russelii russelii
Pro-apoptotic on MCF-7 cells (IC50 : 83 nM)
[95]
The Food and Agriculture Organization of the United Nations (FAO) estimates that world
global fishery capture in 2014 was 93.4 million tons, 81.5 million tons from marine waters and
11.9 million tons from inland waters [96]. These numbers are estimated to rise every year due to
the increasing consumer knowledge about health benefits of fish. It was estimated that in high-risk
populations, consumption of 40–60 g fish per day leads to 50% reduction in death from NCD
(i.e., CVD, and cancer) [97]. Supporting those epidemiological studies, anti-cancer effects of fish-derived
bioactive peptides in several cell lines also has been reported (Table 2). Unfortunately, fish consumption
is very low even in some countries known for their large fish stock, such as in the north African
region; hence, nutraceuticals derived from fish peptide can be develop in order to alleviate NCD.
For many years, a great deal of interest has been developed by many research groups towards
350
Mar. Drugs 2017, 15, 67
identification of anti-cancer peptides from fish. To develop fish-derived anti-cancer peptides as bioactive
materials in food and pharmaceutical industries, large further research is needed. In addition,
the potential value of fish by-product is still being ignored. It was estimated that almost half of the fish
is commonly discarded to prepared seafood industrially. The amount of fisheries by-products varies
depending on species, size, season, and the fishing grounds [98]. Assuming 25% of the animal weight
is wasted, the total amount of waste generated from marine capture can be as high as 20.4 million tons
per year. These huge amounts of fish by-product harbor useful source of anti-cancer and other bioactive
peptides. Scientists should find sustainable ways to refine fish and fish by-products, and governments
and industry should invest in using this marine resource in sustainable ways.
3.3. Anti-Cancer Peptides Derived from Urochordata
The urochordata, also known as tunicates and ascidians, have emerged as a rich source
of metabolites with potent anticancer activities [99]. Chemical studies of Caribbean tunicates,
Trididemnum solidum, led to the discovery of the didemnin depsipeptides. Of the didemnins that have
been isolated, didemnin B is the most well-known member. Early studies reported that didemnin B
possesses in vitro and in vivo antitumor activity against melanoma (B-16), sarcoma (M5076), prostatic,
and leukemia (P388) cell lines [100,101]. Based on the significant activity and low toxicity of didemnin
B in pre-clinical models, this peptide has been submitted to clinical trials, making it the first marine
natural product evaluated in clinical trials [102]. Didemnin B has been tested in clinical phase I and
phase II trials against several human tumors. In a clinical phase II trial, patients with non-Hodgkin’s
lymphoma were given a short intravenous infusion of didemnin B every 28 days, and antitumor effects
were observed [103]. Didemnin B has shown modest activity in patients with advanced pretreated
non-Hodgkin’s lymphoma, and advances epithelial ovarian cancer [100,103]. Nausea, vomiting and
anemia are the most frequent reported toxicities due to didemnin B. However, didemnin B clinical trials
were stopped, owing to the onset of severe fatigue in patients. An analog of didemnin B that appears
to be more active in preclinical models is aplidine (plitidepsin, degydrodidemnin B, DDB or aplidin).
Aplidine, a cyclic depsipeptides isolated from the tunicates Aplidium albicans, has a pyruvyl group
instead of a lactyl group in the linear peptide moiety of didemnin B [104]. Preclinical studies indicate
that aplidine is active against several human tumor cell lines. Currently, aplidine has passed clinical
phase I and II trials and is currently undergoing phase III trials for relapsed/refractory myeloma
(NCT01102426) [105]. The exact mechanism of action of aplidine has not been fully elucidated.
However, some researcher suggests that aplidine blocks the secretion of the angiogenic factor VEGF in
human leukemia cells (MOLT-4) leading to the blockage of VEGF/VEGF-1 autocrine loop [106]. It has
also been shown that aplidine induces a cell cycle perturbation with a block of MOLT-4 cells mainly
in G1 phase of the cell cycle. Another mechanism of actions for the activity is aplidine induces cell
apoptosis by inducing caspase-3 and -9 activation, cytrochrome c and membrane dysfunction [107].
Aplidine also induces p53-independent apoptosis in different cancer cell lines in vitro. Similar to
didemnin B, aplidine also has dose-limiting toxicities, including diarrhea, dermal toxicity, asthenia,
and neuromuscular.
Tamandarins A and B are two naturally occurring cytotoxic cyclic depsipeptides which are closely
related to didemnin; these peptides were isolated from a Brazilian ascidian of the family Didemnidae.
The structures of are similar to that of didemnin B, the molecules were found to differ only by the
presence of hydroxyisovaleric acid (Hiv2), instead of the hydroxyisovalerylpropionic acid (Hip2) unit
which is present in didemnins [108]. Tamandarin A showed slightly more potent cytotoxicity against
pancreatic carcinoma (BX-PC3) cells, prostate carcinoma (DU145) cells, and head and neck carcinoma
(UMSCC10) cells as tested in vitro. The cytotoxic effect of tamandarins has been experimentally shown,
but the precise molecular mechanism of action remains uncharacterized. Another cytotoxic peptides
derived from ascidian with uncharacterized molecular mechanisms is mollamide. Mollamide is
a cytotoxic cyclopeptide obtained from the ascidian Didemnum molle and it has shown cytotoxicity
against P388, A549, HT29, and monkey kidney fibroblast (CV1) cells [102]. Trunkamide A is
351
Mar. Drugs 2017, 15, 67
a cyclopeptide with a tiazoline ring and structurally analogs to mollamides [109]. Trunkamide A has
already undergone preclinical trials with promising antitumor effects against cell lines derived from
humans, including P-388, A-549, HT-29 and human melanoma (MEL-28) cells [110].
3.4. Anti-Cancer Peptides Derived from Mollusks
Mollusk is one of the most diverse groups of animals on the Earth. Apart from their important
ecological role and commercial value for human food, their pharmacological roles are also of
notable interest. Several anti-cancer peptides have been found in mollusks. Dolastatins, a group
of cytotoxic peptides, have been isolated from marine mollusks Dolabella auricularia, with dolastatin
10 and dolastatin 15 the most prominent [102]. Dolastatin 10 is a pentapeptide containing several
unique amino acid subunits. Cytotoxic activity of dolastatin 10 against mouse lymphocytic leukemia
(L1210), human promyelocytic leukemia (HL-60), human acute myelomonocytic leukemia (ML-2),
human monocytic (THP-1), multiple lymphoma, small cell lung cancer (NCI-H69, -H82, -H446,
and -H510) and PC-3 cells have been reported [111,112]. It has been reported that anticancer activity of
dolastatin involves microtubule assembly by interacting with tubulin and blocking tubulin-dependent
GTP hydrolysis [113,114]. Dolastatin 10 also affects Bcl-2 level and an increase in p53 expression [115].
However, dolastatin 10 clinical trial result was unsatisfactory; hence, dolastatin 10 was withdrawn
from further trials. Another cytotoxic peptide from marine mollusk is the Keenamide A isolated
from Pleurobranchus forskalii. These hexapeptide exhibited significant activity against the P-388, A-549,
MEL-20, and HT-29 tumor cell lines [58,102,115]. Liu et al. (2012) isolated a 15 kDa linier peptides
(Mere15) derived from Meretrix meretrix [116,117]. Mere15 inhibited the growth of leukemia (K562)
cells and the cytotoxicity was related to the apoptosis induction, cell cycle arrest and microtubule
disassembly [116]. Further, in vivo analysis revealed that Mere15 inhibited the growth of A549 cells
xenograft in nude mice by activating intrinsic pathway [117].
Kahalalides are cyclic depsipeptides that was originally isolated from the Hawaiian marine
mollusks Elysia rufescens. Of the seven isolated Kahalalides (A–F), Kahalalide F showed significant
cytotoxic activity against cell lines and tumor specimens derived from various human solid
tumors, including prostate, breast, non-small-cell lung, ovarian, and colon carcinomas [102,118].
Gonzales et al. (2003) demonstrated that cancer cells treated with Kahalalide F underwent a series of
profound alterations including severe cytoplasmic swelling and vacuolization, dilation and vesiculation
of the endoplasmic reticulum, mitochondrial damage, and plasma membrane rupture, suggesting
that Kahalalide F induces cell death via oncosis preferentially in tumor cells. Subsequently, it was
reported that ErbB3 and the downstream PI3K-Akt pathway is an important determinants of the
cytotoxic activity of Kahalalide F in vitro [118]. Kahalalide F was dropped from phase II clinical trials
due to a lack of efficacy despite results indicating a limited number of patients achieved a positive
response. Based on the pharmacokinetic studies, it was suggested that Kahalalide F has a short half-life,
which may affect its efficacy [119].
Ziconotide (formerly SNX-111, Neurex Pharmaceuticals, Menlo Park, CA, USA) is the synthetic
equivalent of ω-conopeptide MVIIA, a 25-amino-acid polybasic peptide originally isolated from the
venom of Conus magus, a marine snail [120]. Ziconotide is an analgesic agent administered intrathecally
and has been for almost one decade for the treatment of chronic cancer pain [121]. However, the use
of ziconotide can induce several and sometimes serious adverse events. Hence, a low initial dosage
followed by slow titration is recommended to reduce serious adverse events.
3.5. Anti-Cancer Peptides Derived from Cyanobacteria
Cyanobacteria (blue-green algae) are a very old and diverse group of photosynthetic,
prokaryotic organisms that produce a variety of secondary metabolites with various biological activities,
including phenols, peptides, alkaloids or terpenoids [122]. Cyclic depsipeptides, grassypeptolides D
and E, have been isolated from the marine cyanobacterium Leptolyngbya sp. [123]. These peptides have
shown cytotoxic effect against mouse neuroblastoma (N2A) and HeLa cell line, which was confirmed
352
Mar. Drugs 2017, 15, 67
by MTT cell viability assay. Lyngbya majuscula, a benthic filamentous marine cyanobacterium, has been
extensively studied and has produced more than 250 compounds with diverse structural features.
This diversity is in part attributable to the fact that a major theme in L. majuscula biochemistry relies on
the production of metabolites via polyketide synthases and nonribosomal peptide synthetases within
specialized biosynthetic pathways. Malyngamide 4, somocystinamide A, and hectochlorins are potent
anti-cancer lipopeptides isolated from L. majuscula [124–126]. Hectochlorins have been reported to be
strong actin-disrupting agents. Hectochlorin showed great anti-proliferative activity against colon,
melanoma, ovarian, and renal cancer cells [127]. Shaala et al. (2013) demonstrate that malyngamide
A inhibited proliferations of A549, HT29, and breast adenocarcinoma (MDA-MB-231) cells cultured
in vitro. Another lipopetide isolated from L. majuscula, Somocystinamide A showed potent cytotoxicity
against N2A cells. Further, Somocystinamide was found as potent apoptosis inductor in a number of
tumor cell lines and angiogenic endothelial cells via intrinsic and extrinsic pathways, but the more
effective mechanism is the activation of caspase 8 [126]. Apratoxin A is a cyclodepsipeptide isolated
from a L. majuscula. This peptide showed anti-proliferative activity in KB and LoVo cancer cells.
Apratoxin A mediates its anti-proliferative activity through the induction of G1 cell cycle arrest and
an apoptotic cascade, which partially initiated through antagonism of FGF signaling via STAT3 [128].
The blue-green colored pigment-protein complex, c-phycocyanin, isolated from marine
cyanobacteria Agmenellum quadruplicatum, Mastigocladus laminosus, Oscillatoria tenuis appeared
to be a potent activator of pro-apoptotic gene and downregulator of anti-apoptotic gene
expression [129]. Transduction of apoptosis signals resulting apoptosis of HeLa cells in vitro [130].
Further, apoptosis features such as cell shrinkage, membrane blebbing, nuclear condensation and DNA
fragmentation were observed in A549 and HT29 treated with c-phycocyanin [131].
Cyanobacteria possess several advantages to be developed as nutraceuticals for the prevention
and treatment of cancer and other NCD. The advantages of cyanobacteria include simple
growth requirement, ease of genetic manipulation, and attractive platforms for carbon neutral
production process [132]. However, it should be noted that some cyanobacteria produce cyanotoxins,
therefore an appropriate regulatory framework should be developed for pharmaceutical and
nutraceutical products from cyanobacteria to ensure that safety and quality standards are met.
4. Marine-Derived Antioxidant Peptides
In addition to the general risk factors in the development of NCD, free radicals are also known
to play a significant role in NCD. Marine-derived protein, protein hydrolysates, peptides and amino
acids have been shown to have significant antioxidant effects. Marine organisms are probably the most
extensively studied as an important source of antioxidants. Antioxidant activity of marine organisms
has been determined by various in vitro and in vivo methods, such as 2,2-diphenyl-1-picrylhydrazyl
(DPPH), peroxide, hydroxyl and superoxide anion radical scavenging activities which have been
detected by electronspin resonance spectroscopy method as well as intra cellular free radical scavenging
assays, such as DNA oxidation, ROS scavenging, membrane protein oxidation and membrane
lipid oxidation [133]. Many studies reported that proteins from marine organisms exhibit potent
antioxidant activity; however, in many cases, peptide fractions or protein hydrolysates showed greater
antioxidant activity. These suggest that peptides play a significant role in antioxidant actions of
marine proteins. Therefore, many individual bioactive peptides responsible for antioxidant activity of
marine protein or protein hydrolysates were then purified and identified. Marine-derived peptides
have varied antioxidant activities depending on the structure. The peptide structure including the
size and amino acid sequences were influenced by the protein sources and extraction conditions.
As an example, clam peptides, isolated from body or viscera of clam (Meretrix casta) protein hydrolyse
with three different enzymes such as trypsin, pepsin and papain resulted in different DPPH radical
scavenging activities, ranging from 9.1% to 82.5% and reducing power ranging from 0.1 to 0.7,
measured as the ability of the hydrolysate to reduce iron (III) [134]. Rajapakse et al. (2005) identified
four different molecular weight peptides from giant squid mussel by employing ultrafiltration
353
Mar. Drugs 2017, 15, 67
membrane with three different molecular weight cut off membranes (10, 5 and 3 kDa). Lower molecular
weight peptide was found to possess stronger antioxidant activity compared to the higher molecular
weight peptides. They assumed that lower molecular weight improves contact ability with membrane
lipids and or permeability [135]. Further, it is believed that aromatic amino acid and histidine act
positively as direct radical scavengers within peptide sequences. The presence of aromatic amino acids
in the structure of a peptide is an advantage in this regard because they can donate protons easily
to electron-deficient radicals and, at the same time, maintain their stability via resonance structures.
Hence, it can be speculated that difference in scavenging activity could be due to the molecular weight
or the specific arrangement of amino acid residues in the peptide sequence [13].
In addition to marine peptides, marine processing by-products have also been explored for
production of proteins, peptides, and hydrolysates with antioxidant potentials [136]. Purification of
antioxidant peptides derived from marine by-product using enzymatic hydrolysis has been in
practice during recent years. Antioxidant peptides derived from marine processing by-product
were found to possess strong antioxidant activity in linoleic acid model [137,138]. Himaya et al. (2012)
demonstrated that peptide isolated from Japanese flounder skin gelatin could protect against cellular
oxidative damage. Some peptides derived from marine processing by-product were found to possess
strong activity to inhibit lipid peroxidation in linoleic acid models. This activity was attributed to the
ability of peptide to interfere propagation cycle of lipid peroxidation and there by slowing radical
mediated linoleic acid oxidation. Hydrophobic amino acids in peptide sequences may contribute to
peroxidation inhibition by increasing the solubility of peptide in lipid and thereby facilitating better
interaction with radical species [139]. Position of hydrophobic amino acid, Leu at the N-terminus of
the peptide sequences has been shown to increase the interaction between peptides and fatty acids.
More importantly, hydrophobic peptides can protect macromolecule oxidation by donating photons to
reactive radicals [13,140]. Moreover, the activity of histidine containing peptides has also been reported
to act against lipid peroxidation. In addition, Shahidi and Zhong (2008) reported that in the case of
tripeptide, tripeptides containing 2 tyrosine units had higher capacity than those containing 2 histidine
units in inhibiting linoleic acid oxidation. Later, it was reported that histidine-containing peptides can
act as metal chelator, active oxygen quencher, and hydroxyl radical scavenger, thus contributing to the
antioxidant activity of the protein hydrolysate and peptide.
Epidemiological studies show that a diet rich in antioxidants is associated with low prevalence
of NCD, longevity and good health. Therefore, researchers are continually seeking for a good
source of diet with potent antioxidant ability as an alternative for the dietary supplements and
food. Bioactive peptides of marine origin have the potential to subside the biochemical imbalances
induced by the formation of free radicals, and many of these peptides have been viewed as promising
agents for the prevention and treatment of NCD. One of the commercially available products from
marine organisms to reduce oxidative stress is Fortidium Liquamen, a hydolyzed skin of white fish
(Molva molva) [141]. Based on those collective findings, it may be assumed that marine-derived
bioactive peptides is a healthy choice to strengthen the body’s fight against oxidative stress and other
related NCD.
5. Anti-Diabetic and Hypocholesterolemic Effects of Marine-Derived Bioactive Peptides
Metabolic disorders comprise a collection of health disorders that increase the risk of morbidity
and loss qualify of life, these includes diabetes and obesity. Marine-derived proteins and their peptides
exert anti-diabetic effects. Zhu et al. (2010) have reported that treatment with oligopeptides from
marine salmon skin modulated type 2 diabetes mellitus-related hyperglycemia and β-cell apoptosis
in rats induced by high fat diet and low doses of streptozotocin. The anti-diabetic effect of salmon
skin-derived oligopeptides was mediated by down-regulation of type 2 diabetes mellitus-related
oxidative stresses and inflammation, which then protect the pancreatic β-cells from apoptosis [142].
A marine collagen peptide (MCP) isolated from wild marine fish caught from the East China Sea
has shown anti-diabetic effects in patients with or without hypertension [143]. The levels of free fatty
354
Mar. Drugs 2017, 15, 67
acid, hs-CRP, resistin and prostacyclin were decreased significantly following MCP treatment, indicating
that MCP could offer protection against diabetes and hypertension by affecting levels of molecules
involved in diabetic and hypertensive pathogenesis. Further, it was confirmed that MCP modulates
glucose and lipid metabolism in patients with type 2 diabetes mellitus [144]. It was demonstrated that
MCP is a peptide mixture containing two to six amino acid residues in length with molecular weight
100–800 Da. Unfortunately, the amino acid sequence of MCP is not elucidated yet. Peptide possess
anti-metabolic disorder are generally low molecular weight (500–800 Da) [145]. Peptide sequence
also plays an important role in anti-diabetic and anti-obesity effects. Generally, anti-diabetic and
anti-obesity peptides are hydrophobic. Such a hydrophobic peptide is envisaged to be able to cross
(biological) membranes. Vernaleken et al. (2007) described that specific functional tripeptide fragments
(i.e., “Gln-Cys-Val” and “Gln-Cys-Pro”) are potent inhibitors of monosaccharide-dependent exocytotic
pathway of Na+ -D-Glucose co transporter SGLT1. The specific peptide sequence may influence
negatively specific nutrient transporters/receptors in vivo which further lead to posttranscriptional
down regulation of nutrient transporters and reduction of body weight [146]. It was also reported that
high amounts of Gly amino acids in marine-derived proteins could contribute to an increase in fecal
cholesterol and/or bile acid excretion, thus contributing to improvement in plasma lipid variables [147].
In addition, low molecular weight peptides derived from Salmon rich in Gly significantly alleviated
obesity-linked inflammation. Many studies have shown that pro-inflammatory mediators including
tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β) and interleukin-6 (IL-6) are increased during
obesity and diabetes. The suppression of these pro-inflammatory mediators may decrease the risk of
developing metabolic disorders-associated inflammation and insulin [148].
Hyperlipidemia, particularly hypercholesterolemia, is an obesity related condition common in
diabetic patients, and also one of the most important risk factors contributing to the development
of NCD. Natural extracts with cholesterol-lowering effect have been explored for their potential
in prevention and treatment of hypercholesterolemia. In vivo study showed that protein derived
from microalgae (Spirulina platensis) c-phycocyanin, plays a crucial role in the hypocholesterolemic
activities [149]. In addition, Colla et al. (2008) demonstrated that Spirulina platensis when added
in rabbit feed for 30–60 days reduced the levels of total cholesterol, high-density lipoprotein and
triacylglycerols [150].
Current food environments are unhealthy which dominated by energy-dense, nutrient-poor
processed food products which are widely available and relatively inexpensive [151]. These seem to
create a supply-side “push” effect on unhealthy diets which is the prevailing driver of population
unhealthy weight gain and NCD. To reduce hypercholesterolemic, diabetes, and other diet-related
NCD, there needs to be a central focus on creating “healthy food environments” which shift population
diets, especially those of socially disadvantaged populations, towards healthy diets. Marine-derived
bioactive peptides have excellent potential as functional food ingredients to reduce NCD as they
possess advantageous physiological effects, with medicinal characteristics and added health benefits
such as anti-diabetic and hyocholesterolemic activities.
6. Future Perspectives of Marine-Derived Bioactive Peptides
Successful characterization of marine-derived bioactive peptides and investigations of their
cardio protective, antihypertensive, anticancer, anti-diabetic, and anti-oxidative effects suggest their
promising future for NCD. However, current marine peptides are still unable to meet the design
parameters for drugs for NCD due to their low metabolic stability, low membrane permeability,
and their high costs of manufacture [152]. Therefore, marine-derived bioactive peptides can be
administered using different delivery vehicles such as functional food and or nutraceuticals. In order
to be used as ingredients in food products, different studies should be carried out to determine if
bioactivity of marine peptides is maintained after manufacturing and cooking processes. For example,
wheat bread containing the hydrolysate from red algae retained renin inhibitory bioactivity after the
baking process [19]. Furthermore, biological effect of marine-derived peptides is strongly influenced
355
Mar. Drugs 2017, 15, 67
by their bioavailability, which is predominantly determined by their susceptibility to degradation into
inactive fragments by digestive enzymes peptidase and intestinal absorption. Bioavailability should be
taken into account when developing food and beverages products containing marine-derived bioactive
peptides for the prevention and treatment of NCD.
Bioavailability of peptides can be defined as the quantity that passes through the cell membranes
in the intestine and is available for action within the cells [153]. Bioavailability of peptides are generally
affected by physicochemical properties of the peptides such as molecular size, charge, sequence,
and solubility; smaller peptides are transported across the enterocytes through intestinal-expressed
peptide transporters, whereas oligopeptides may be absorbed by passive transport through
hydrophobic regions of membrane epithelia or tight junctions [154]. Many studies demonstrated
that marine-derived peptides are mostly peptides of small molecular weights, especially tripeptides
from marine algae and small oligopeptides. These small molecular weight peptides are too small
for the substrates of digestive proteases, and therefore they have high resistance to gastrointestinal
digestion and are easily to be absorbed. In addition, small molecular weight peptides are convenient
and cheaper to be synthesized through chemical method. Thus, chemical synthesis can be used to
produce large quantities of marine-derived bioactive peptides to be used in functional foods and
pharmaceuticals to meet the needs for NCD remedy.
Several studies have demonstrated the bioavailability of marine-derived bioactive peptides
for the treatment of NCD using both animal models and human volunteers. For example,
long-term oral administration of peptides derived from jellyfish reduced systolic blood pressure
and diastolic blood pressure of the renovascular hypertension rats [155]. Interestingly, these bioactive
peptides affected the production of Angiotensin II only in kidney but not in plasma. In addition,
Lee et al. (2010) demonstrated that oral administration of peptide-derived from tuna frame
significantly reduced systolic blood pressure and diastolic blood pressure in spontaneously
hypertensive rats. That information provides basic information that peptide-derived from tuna
frame show stability against gastrointestinal proteases and original peptide sequences that displayed
anti-hypertensive activity are delivered to the cellular sites of action. These provide evidence that
marine-derived bioactive peptides can be used for the preparation of oral treatment for blood pressure
homeostasis which further protects cardiovascular system.
Up to now, many marine peptides are unable to meet the requirements for food
(e.g., taste, bioavailability, or stability). Bitterness of some marine-derived peptides is an undesirable
property, which should be reduced during food, beverages and or pharmaceuticals production.
Marine-derived bioactive peptides hosting residues with hydrophobic side chains have a distinct bitter
taste. Therefore, further studies on controlling these properties are needed. These can be achieved by
several methods including chemical or physical modifications of the peptides (i.e., microencapsulation,
and quantitating the bitter taste relationship). Microencapsulation not only increases consumer’s
acceptance, but also ensures that the marine-derived peptide sequences that displayed bioactivity
are conserved and delivered to the cellular sites of action in NCD. Further, microencapsulation will
enhance their stability and absorption.
In order to develop food and beverages product containing marine-derived bioactive peptides,
methods must be developed to enhance their availability and bioactivity. Bioactive peptides can
be obtained from marine organisms by organic solvent extraction, fermentation and enzymatic
hydrolysis by proteolytic enzymes. In food industries, the last methods are more preferred due
to the lack of residual organic solvents or toxic chemicals in the products and or microbial residue.
Notably, physico-chemical conditions of the reaction media, such as temperature and pH of the protein
solution, must then be adjusted in order to optimize the activity of the enzyme used. Further, to obtain
desired molecular weight and functional properties of marine-derived bioactive peptides, a suitable
method is the use of an ultrafiltration membrane system. This system has the main advantage that the
molecular weight distribution of the desired peptide can be controlled by adoption of an appropriate
ultrafiltration membrane.
356
Mar. Drugs 2017, 15, 67
The number of marine organism’s consumption is estimated to rise each year due to the increasing
consumer knowledge about their health benefit effects. Marine organisms are viewed as “natural
and healthy” by consumers, and this promotes a positive response in consumers, who often regard
natural entities. Therefore, marine organisms may be considered a consumer friendly source of
functional foods which may use to prevent and treat NCD. Last but not least, scientists should work
out sustainable ways to refine bioactive peptides derived from marine organisms, and develop food
and pharmaceuticals products to alleviate NCD.
7. Conclusions
Many studies have shown that marine-derived bioactive peptides possess remarkable activities
relevant to the prevention and treatment of NCD. The possibilities of designing new functional
foods, nutraceuticals, and pharmaceuticals derived from marine bioactive peptides for the prevention
and treatment of NCD are promising. While much information is available on biological activities
of marine-derived bioactive peptides, future studies should be directed towards evaluation of
bioavailability in human subjects as well as clinical trials. In addition, safety and quality standards of
marine-derived peptides-based products should be evaluated prior to commercialization.
Acknowledgments: This study is supported by Thematic Research Program Research Center for Oceanography,
Indonesian Institute of Sciences (P2O-LIPI).
Author Contributions: R.P. prepared the review article under the supervision of S.-K.K.
Conflicts of Interest: The authors declare no conflict of interest.
Abbreviations
The following abbreviations are used in this manuscript:
ACE
CVD
DPPH
FAO
FOSHU
IC50
IL-6
IL-1β
MCP
MW
NCD
PUFA
RAS
ROS
SHR
SBP
TNF-α
WHO
Angiotensin converting enzymes
Cardiovascular disease
2,2-diphenyl-1-picrylhydrazyl
Food and Agriculture Organization
foods for specified health uses
half maximal inhibitory concentration
interleukin-6
interleukin-1β
marine collagen peptide
Molecular weight
Non communicable diseases
polyunsaturated fatty acids
renin-angiotensin system
reactive oxygen species
spontaneously hypertensive rat
systolic blood pressure
tumor necrosis factor-α
World Health Organization
References
1.
2.
3.
World Health Organization. Global Status Report on Noncommuniacble Diseases; World Health Organization:
Genève, Switzerland, 2014; p. 280.
World Health Organization. Global Status Report on Noncommunicable Diseases; World Health Organization:
Genève, Switzerland, 2010; p. 162.
Bhandari, G.P.; Angdembe, M.R.; Dhimal, M.; Neupane, S.; Bhusal, C. State of non-communicable diseases
in Nepal. BMC Public Health 2014, 14, 23. [CrossRef] [PubMed]
357
Mar. Drugs 2017, 15, 67
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
Collins, K.G.; Fitzgerald, G.F.; Stanton, C.; Ross, R.P. Looking Beyond the Terrestrial: The Potential of
Seaweed Derived Bioactives to Treat Non-Communicable Diseases. Mar. Drugs 2016, 14, 60. [CrossRef]
[PubMed]
Wagner, K.-H.; Brath, H. A global view on the development of non communicable diseases. Prev. Med. 2012,
54, S38–S41. [CrossRef] [PubMed]
Erdmann, K.; Cheung, B.W.Y.; Schröder, H. The possible roles of food-derived bioactive peptides in reducing
the risk of cardiovascular disease. J. Nutr. Biochem. 2008, 19, 643–654. [CrossRef] [PubMed]
Kris-Etherton, P.M.; Hecker, K.D.; Bonanome, A.; Coval, S.M.; Binkoski, A.E.; Hilpert, K.F.; Griel, A.E.;
Etherton, T.D. Bioactive compounds in foods: Their role in the prevention of cardiovascular disease
and cancer. Am. J. Med. 2002, 113 (Suppl. 9), 71S–88S. [CrossRef]
Wijesekara, I.; Pangestuti, R.; Kim, S.K. Biological activities and potential health benefits of sulfated
polysaccharides derived from marine algae. Carbohydr. Polym. 2010, 84, 14–21. [CrossRef]
Pangestuti, R.; Kim, S.-K. Biological activities and health benefit effects of natural pigments derived from
marine algae. J. Funct. Foods 2011, 3, 255–266. [CrossRef]
Yusuf, S.; Wood, D.; Ralston, J.; Reddy, K.S. The World Heart Federation’s vision for worldwide
cardiovascular disease prevention. Lancet 2015, 386, 399–402. [CrossRef]
Nichols, M.; Townsend, N.; Scarborough, P.; Rayner, M. Cardiovascular disease in Europe 2014:
Epidemiological update. Eur. Heart J. 2014, 35, 2950–2959. [CrossRef] [PubMed]
Kearney, P.M.; Whelton, M.; Reynolds, K.; Muntner, P.; Whelton, P.K.; He, J. Global burden of hypertension:
Analysis of worldwide data. Lancet 2005, 365, 217–223. [CrossRef]
Himaya, S.; Ngo, D.-H.; Ryu, B.; Kim, S.-K. An active peptide purified from gastrointestinal enzyme
hydrolysate of Pacific cod skin gelatin attenuates angiotensin-1 converting enzyme (ACE) activity and
cellular oxidative stress. Food Chem. 2012, 132, 1872–1882. [CrossRef]
Kher, V. Renin inhibition—Benefit beyond hypertension control. J. Assoc. Phys. India 2009, 57, 518–521.
Allikmets, K. Aliskiren—An orally active renin inhibitor. Review of pharmacology, pharmacodynamics,
kinetics, and clinical potential in the treatment of hypertension. Vasc. Health Risk Manag. 2007, 3, 809.
[PubMed]
Fitzgerald, C.N.; Mora-Soler, L.; Gallagher, E.; O’Connor, P.; Prieto, J.; Soler-Vila, A.; Hayes, M. Isolation and
characterization of bioactive pro-peptides with in vitro renin inhibitory activities from the macroalga
Palmaria palmata. J. Agric. Food Chem. 2012, 60, 7421–7427. [CrossRef] [PubMed]
Fitzgerald, C.; Aluko, R.E.; Hossain, M.; Rai, D.K.; Hayes, M. Potential of a renin inhibitory peptide from the
red seaweed Palmaria palmata as a functional food ingredient following confirmation and characterization of
a hypotensive effect in spontaneously hypertensive rats. J. Agric. Food Chem. 2014, 62, 8352–8356. [CrossRef]
[PubMed]
Suetsuna, K.; Maekawa, K.; Chen, J.-R. Antihypertensive effects of Undaria pinnatifida (wakame) peptide on
blood pressure in spontaneously hypertensive rats. J. Nutr. Biochem. 2004, 15, 267–272. [CrossRef] [PubMed]
Fitzgerald, C.; Gallagher, E.; Doran, L.; Auty, M.; Prieto, J.; Hayes, M. Increasing the health benefits of
bread: Assessment of the physical and sensory qualities of bread formulated using a renin inhibitory
Palmaria palmata protein hydrolysate. LWT Food Sci. Technol. 2014, 56, 398–405. [CrossRef]
Suetsuna, K.; Osajika, K. The inhibitroy activity of angiotensin-1 converting enzyme of basic peptides from
sardine and hair tail meat. Bull. Jpn. Soc. Sci. Fish. 1986, 52, 1981–1984. [CrossRef]
Kim, S.; Wijesekara, I. Development and biological activities of marine-derived bioactive peptides: A review.
J. Funct. Foods 2010, 2, 1–9. [CrossRef]
Wijesekara, I.; Kim, S.K. Angiotensin-I-converting enzyme (ACE) inhibitors from marine resources:
Prospects in the pharmaceutical industry. Mar. Drugs 2010, 8, 1080–1093. [CrossRef] [PubMed]
Nakamura, Y.; Yamamoto, N.; Sakai, K.; Okubo, A.; Yamazaki, S.; Takano, T. Purification and Characterization
of Angiotensin I-Converting Enzyme Inhibitors from Sour Milk. J. Dairy Sci. 1995, 78, 777–783. [CrossRef]
Ariyoshi, Y. Angiotensin-converting enzyme inhibitors derived from food proteins. Trends Food Sci. Technol.
1993, 4, 139–144. [CrossRef]
Suetsuna, K.; Nakano, T. Identification of an antihypertensive peptide from peptic digest of wakame
(Undaria pinnatifida). J. Nutr. Biochem. 2000, 11, 450–454. [CrossRef]
Nomura, A.; Noda, N.; Maruyama, S. Purification of angiotensin I-converting enzyme inhibitors in pelagic
thresher Alopias pelagicus muscle hydrolysate and viscera extracts. Fish. Sci. 2002, 68, 954–956. [CrossRef]
358
Mar. Drugs 2017, 15, 67
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
Ikeda, A.; Ichino, H.; Kiguchiya, S.; Chigwechokha, P.; Komatsu, M.; Shiozaki, K. Evaluation and
Identification of Potent Angiotensin-I Converting Enzyme Inhibitory Peptide Derived from Dwarf Gulper
Shark (Centrophorus atromarginatus). J. Food Process. Preserv. 2015, 39, 107–115. [CrossRef]
Wu, H.; He, H.-L.; Chen, X.-L.; Sun, C.-Y.; Zhang, Y.-Z.; Zhou, B.-C. Purification and identification of novel
angiotensin-I-converting enzyme inhibitory peptides from shark meat hydrolysate. Proc. Biochem. 2008, 43,
457–461. [CrossRef]
Jian, P.W.; Aluko, R.E.; Nakai, S. Structural Requirements of Angiotensin I-Converting Enzyme Inhibitory
Peptides: Quantitative Structure-Activity Relationship Study of Di- and Tripeptides. J. Agric. Food Chem.
2006, 54, 732–738.
Sato, M.; Hosokawa, T.; Yamaguchi, T.; Nakano, T.; Muramoto, K.; Kahara, T.; Funayama, K.; Kobayashi, A.;
Nakano, T. Angiotensin I-converting enzyme inhibitory peptides derived from wakame (Undaria pinnatifida)
and their antihypertensive effect in spontaneously hypertensive rats. J. Agric. Food Chem. 2002, 50, 6245–6252.
[CrossRef] [PubMed]
Suetsuna, K. Purification and identification of angiotensin I-converting enzyme inhibitors from the red alga
Porphyra yezoensis. J. Mar. Biotechnol. 1998, 6, 163–167. [PubMed]
Suetsuna, K.; Chen, J.-R. Identification of Antihypertensive Peptides from Peptic Digest of Two Microalgae,
Chlorella vulgaris and Spirulina platensis. Mar. Biotechnol. 2001, 3, 305–309. [CrossRef] [PubMed]
Kohama, Y.; Matsumoto, S.; Oka, H.; Teramoto, T.; Okabe, M.; Mimura, T. Isolation of angiotensin-converting
enzyme inhibitor from tuna muscle. Biochem. Biophys. Res. Commun. 1988, 155, 332–337. [CrossRef]
Matsumura, N.; Fujii, M.; Takeda, Y.; Sugita, K.; Shimizu, T. Angiotensin I-converting enzyme inhibitory
peptides derived from bonito bowels autolysate. Biosci. Biotechnol. Biochem. 1993, 57, 695–697. [CrossRef]
[PubMed]
Kim, S.-K.; Kim, Y.-T.; Byun, H.-G.; Nam, K.-S.; Joo, D.-S.; Shahidi, F. Isolation and characterization of
antioxidative peptides from gelatin hydrolysate of Alaska pollack skin. J. Agric. Food Chem. 2001, 49,
1984–1989. [CrossRef] [PubMed]
Ono, S.; Hosokawa, M.; Miyashita, K.; Takahashi, K. Isolation of Peptides with Angiotensin I-converting
Enzyme Inhibitory Effect Derived from Hydrolysate of Upstream Chum Salmon Muscle. J. Food Sci. 2003, 68,
1611–1614. [CrossRef]
Enari, H.; Takahashi, Y.; Kawarasaki, M.; Tada, M.; Tatsuta, K. Identification of angiotensin I-converting
enzyme inhibitory peptides derived from salmon muscle and their antihypertensive effect. Fish. Sci. 2008,
74, 911–920. [CrossRef]
Ngo, D.-H.; Kang, K.-H.; Ryu, B.; Vo, T.-S.; Jung, W.-K.; Byun, H.-G.; Kim, S.-K. Angiotensin-I converting
enzyme inhibitory peptides from antihypertensive skate (Okamejei kenojei) skin gelatin hydrolysate in
spontaneously hypertensive rats. Food Chem. 2015, 174, 37–43. [CrossRef] [PubMed]
García-Moreno, P.J.; Espejo-Carpio, F.J.; Guadix, A.; Guadix, E.M. Production and identification of
angiotensin I-converting enzyme (ACE) inhibitory peptides from Mediterranean fish discards. J. Funct. Foods
2015, 18, 95–105. [CrossRef]
He, H.L.; Chen, X.L.; Sun, C.Y.; Zhang, Y.Z.; Zhou, B.C. Analysis of novel angiotensin 1 converting enzyme
inhibitory peptides from protease-hydrolyzed marine shrimp Acetes chinensis. J. Pept. Sci. 2006, 12, 726–733.
Wang, Y.-K.; He, H.-L.; Chen, X.-L.; Sun, C.-Y.; Zhang, Y.-Z.; Zhou, B.-C. Production of novel
angiotensin I-converting enzyme inhibitory peptides by fermentation of marine shrimp Acetes chinensis with
Lactobacillus fermentum SM 605. Appl. Microbiol. Biotechnol. 2008, 79, 785–791. [CrossRef] [PubMed]
Cao, W.; Zhang, C.; Hong, P.; Ji, H.; Hao, J. Purification and identification of an ACE inhibitory peptide from
the peptic hydrolysate of Acetes chinensis and its antihypertensive effects in spontaneously hypertensive rats.
Int. J. Food Sci. Technol. 2010, 45, 959–965. [CrossRef]
Nii, Y.; Fukuta, K.; Yoshimoto, R.; Sakai, K.; Ogawa, T. Determination of antihypertensive peptides from
an izumi shrimp hydrolysate. Biosci. Biotechnol. Biochem. 2008, 72, 861–864. [CrossRef] [PubMed]
Liu, X.; Zhang, M.; Jia, A.; Zhang, Y.; Zhu, H.; Zhang, C.; Sun, Z.; Liu, C. Purification and characterization of
angiotensin I converting enzyme inhibitory peptides from jellyfish Rhopilema esculentum. Food Res. Int. 2013,
50, 339–343. [CrossRef]
Du, L.; Fang, M.; Wu, H.; Xie, J.; Wu, Y.; Li, P.; Zhang, D.; Huang, Z.; Xia, Y.; Zhou, L. A novel angiotensin
I-converting enzyme inhibitory peptide from Phascolosoma esculenta water-soluble protein hydrolysate.
J. Funct. Foods 2013, 5, 475–483. [CrossRef]
359
Mar. Drugs 2017, 15, 67
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
Suetsuna, K. Identification of antihypertensive peptides from peptic digest of the short-necked clam
Tapes philippinarum and the pearl oyster Pinctada fucata martensii. Fish. Sci. 2002, 68, 233–235. [CrossRef]
Fujita, H.; Yamagami, T.; Ohshima, K. Effects of an ACE-inhibitory agent, katsuobushi oligopeptide, in the
spontaneously hypertensive rat and in borderline and mildly hypertensive subjects. Nutr. Res. 2001, 21,
1149–1158. [CrossRef]
Fujita, H.; Yoshikawa, M. LKPNM: A prodrug-type ACE-inhibitory peptide derived from fish protein.
Immunopharmacology 1999, 44, 123–127. [CrossRef]
Kouno, K.; Hirano, S.-I.; Kuboki, H.; Kasai, M.; Hatae, K. Effects of Dried Bonito (Katsuobushi) and
Captopril, an Angiotensin I-Converting Enzyme Inhibitor, on Rat Isolated Aorta: A Possible Mechanism of
Antihypertensive Action. Biosci. Biotechnol. Biochem. 2005, 69, 911–915. [CrossRef] [PubMed]
Lee, J.K.; Jeon, J.-K.; Byun, H.-G. Antihypertensive effect of novel angiotensin I converting enzyme inhibitory
peptide from chum salmon (Oncorhynchus keta) skin in spontaneously hypertensive rats. J. Funct. Foods 2014,
7, 381–389. [CrossRef]
Lee, S.-H.; Qian, Z.-J.; Kim, S.-K. A novel angiotensin I converting enzyme inhibitory peptide from tuna
frame protein hydrolysate and its antihypertensive effect in spontaneously hypertensive rats. Food Chem.
2010, 118, 96–102. [CrossRef]
Ko, S.-C.; Kang, N.; Kim, E.-A.; Kang, M.C.; Lee, S.-H.; Kang, S.-M.; Lee, J.-B.; Jeon, B.-T.; Kim, S.-K.; Park, S.-J.
A novel angiotensin I-converting enzyme (ACE) inhibitory peptide from a marine Chlorella ellipsoidea and its
antihypertensive effect in spontaneously hypertensive rats. Proc. Biochem. 2012, 47, 2005–2011. [CrossRef]
Roy, M.; Mukherjee, A.; Sarkar, R.; Mukherjee, S.; Biswas, J. In search of natural remediation for cervical cancer.
Anti-Cancer Agents Med. Chem. 2015, 15, 57–65. [CrossRef]
He, G.; Karin, M. NF-κB and STAT3—Key players in liver inflammation and cancer. Cell Res. 2011, 21,
159–168. [CrossRef] [PubMed]
Hall, E.; Cameron, D.; Waters, R.; Barrett-Lee, P.; Ellis, P.; Russell, S.; Bliss, J.; Hopwood, P.; Investigators, T.T.
Comparison of patient reported quality of life and impact of treatment side effects experienced with
a taxane-containing regimen and standard anthracycline based chemotherapy for early breast cancer: 6 year
results from the UK TACT trial (CRUK/01/001). Eur. J. Cancer 2014, 50, 2375–2389. [CrossRef] [PubMed]
Kim, S.-K.; Kalimuthu, S. Introduction to Anticancer Drugs from Marine Origin. In Handbook of Anticancer
Drugs from Marine Origin; Springer: Berlin, Germany, 2015; pp. 1–13.
Zheng, L.-H.; Wang, Y.-J.; Sheng, J.; Wang, F.; Zheng, Y.; Lin, X.-K.; Sun, M. Antitumor peptides from
marine organisms. Mar. Drugs 2011, 9, 1840–1859. [CrossRef] [PubMed]
Cheung, R.C.F.; Ng, T.B.; Wong, J.H. Marine peptides: Bioactivities and applications. Mar. Drugs 2015, 13,
4006–4043. [CrossRef] [PubMed]
Crews, P.; Manes, L.V.; Boehler, M. Jasplakinolide, a cyclodepsipeptide from the marine sponge, Jaspis sp.
Tetrahedron Lett. 1986, 27, 2797–2800. [CrossRef]
Takeuchi, H.; Ara, G.; Sausville, A.E.; Teicher, B. Jasplakinolide: Interaction with radiation and hyperthermia
in human prostate carcinoma and Lewis lung carcinoma. Cancer Chemother. Pharmacol. 1998, 42, 491–496.
[CrossRef] [PubMed]
Robinson, S.J.; Morinaka, B.I.; Amagata, T.; Tenney, K.; Bray, W.M.; Gassner, N.C.; Lokey, R.S.; Crews, P.
New Structures and Bioactivity Properties of Jasplakinolide (Jaspamide) Analogues from Marine Sponges.
J. Med. Chem. 2010, 53, 1651–1661. [CrossRef] [PubMed]
Rangel, M.; Prado, M.P.; Konno, K.; Naoki, H.; Freitas, J.C.; Machado-Santelli, G.M. Cytoskeleton alterations
induced by Geodia corticostylifera depsipeptides in breast cancer cells. Peptides 2006, 27, 2047–2057. [CrossRef]
[PubMed]
Freitas, V.M.; Rangel, M.; Bisson, L.F.; Jaeger, R.G.; Machado-Santelli, G.M. The geodiamolide H, derived from
Brazilian sponge Geodia corticostylifera, regulates actin cytoskeleton, migration and invasion of breast cancer
cells cultured in three-dimensional environment. J. Cell. Physiol. 2008, 216, 583–594. [CrossRef] [PubMed]
Chatterjee, J.; Rechenmacher, F.; Kessler, H. N-Methylation of Peptides and Proteins: An Important Element
for Modulating Biological Functions. Angew. Chem. Int. Ed. 2013, 52, 254–269. [CrossRef] [PubMed]
Tran, T.D.; Pham, N.B.; Fechner, G.A.; Hooper, J.N.; Quinn, R.J. Potent cytotoxic peptides from the Australian
marine sponge Pipestela candelabra. Mar. Drugs 2014, 12, 3399–3415. [CrossRef] [PubMed]
360
Mar. Drugs 2017, 15, 67
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
Kobayashi, M.; Aoki, S.; Ohyabu, N.; Kurosu, M.; Wang, W.; Kitagawa, I. Arenastatin A, a potent cytotoxic
depsipeptide from the okinawan marine sponge Dysidea arenaria. Tetrahedron Lett. 1994, 35, 7969–7972.
[CrossRef]
Silva, M.A.D.; Bierhalz, A.C.K.; Kieckbusch, T.G. Alginate and pectin composite films crosslinked with Ca2+
ions: Effect of the plasticizer concentration. Carbohydr. Polym. 2009, 77, 736–742. [CrossRef]
Murakami, N.; Tamura, S.; Koyama, K.; Sugimoto, M.; Maekawa, R.; Kobayashi, M. New analogue of
arenastatin A, a potent cytotoxic spongean depsipeptide, with anti-tumor activity. Bioorg. Med. Chem. Lett.
2004, 14, 2597–2601. [CrossRef] [PubMed]
Pettit, G.R.; Tan, R. Isolation and Structure of Phakellistatin 14 from the Western Pacific Marine Sponge
Phakellia sp. 1. J. Nat. Prod. 2005, 68, 60–63. [CrossRef] [PubMed]
Li, W.-L.; Yi, Y.-H.; Wu, H.-M.; Xu, Q.-Z.; Tang, H.-F.; Zhou, D.-Z.; Lin, H.-W.; Wang, Z.-H. Isolation and
Structure of the Cytotoxic Cycloheptapeptide Phakellistatin 13. J. Nat. Prod. 2003, 66, 146–148. [CrossRef]
[PubMed]
Pettit, G.R.; Tan, R.; Ichihara, Y.; Williams, M.D.; Doubek, D.L.; Tackett, L.P.; Schmidt, J.M.; Cerny, R.L.;
Boyd, M.R.; Hooper, J.N. Antineoplastic agents, 325. Isolation and structure of the human cancer cell growth
inhibitory cyclic octapeptides phakellistatin 10 and 11 from Phakellia sp. J. Nat. Prod. 1995, 58, 961–965.
[CrossRef] [PubMed]
Pettit, G.R.; Xu, J.-P.; Dorsaz, A.-C.; Williams, M.D.; Boyd, M.R.; Cerny, R.L. Isolation and structure of
the human cancer cell growth inhibitory cyclic decapeptides phakellistatins 7, 8 and 9 1, 2. Bioorg. Med.
Chem. Lett. 1995, 5, 1339–1344. [CrossRef]
Pelay-Gimeno, M.; Meli, A.; Tulla-Puche, J.; Albericio, F. Rescuing biological activity from synthetic
phakellistatin 19. J. Med. Chem. 2013, 56, 9780–9788. [CrossRef] [PubMed]
Zhan, K.-X.; Jiao, W.-H.; Yang, F.; Li, J.; Wang, S.-P.; Li, Y.-S.; Han, B.-N.; Lin, H.-W. Reniochalistatins A–E,
cyclic peptides from the marine sponge Reniochalina stalagmitis. J. Nat. Prod. 2014, 77, 2678–2684. [CrossRef]
[PubMed]
Edrada-Ebel, R.; Jaspars, M. The 9th European Conference on Marine Natural Products. Mar. Drugs 2015, 13,
7150–7249. [CrossRef] [PubMed]
Ernst, E.; Consortium, C.C. Shark Cartilage: Concerted Action for Complementary and Alternative Medicine
Assessment in the Cancer Field (CAM-Cancer); NAFKAM: Tromsø, Norway, 2013; pp. 1–53.
Ulbricht, C.; Hammerness, P.; Barrette, E.-P.; Boon, H.; Szapary, P.; Sollars, D.; Smith, M.; Tsouronis, C.;
Bent, S. Shark cartilage monograph: A clinical decision support tool. J. Herb. Pharmacother. 2002, 2, 71–93.
[CrossRef]
Dupont, E.; Falardeau, P.; Mousa, S.A.; Dimitriadou, V.; Pepin, M.-C.; Wang, T.; Alaoui-Jamali, M.A.
Antiangiogenic and antimetastatic properties of Neovastat (AE-941), an orally active extract derived from
cartilage tissue. Clin. Exp. Metastasis 2002, 19, 145–153. [CrossRef] [PubMed]
Gingras, D.; Boivin, D.; Deckers, C.; Gendron, S.; Barthomeuf, C.; Béliveau, R. Neovastat—A novel
antiangiogenic drug for cancer therapy. Anti-Cancer Drugs 2003, 14, 91–96. [CrossRef] [PubMed]
Dredge, K. AE-941 (AEterna). Curr. Opin. Investig. Drugs 2004, 5, 668–677. [PubMed]
Zheng, L.; Ling, P.; Wang, Z.; Niu, R.; Hu, C.; Zhang, T.; Lin, X. A novel polypeptide from shark cartilage
with potent anti-angiogenic activity. Cancer Biol. Ther. 2007, 6, 775–780. [CrossRef] [PubMed]
Chen, J.-Y.; Lin, W.-J.; Wu, J.-L.; Her, G.M.; Hui, C.-F. Epinecidin-1 peptide induces apoptosis which enhances
antitumor effects in human leukemia U937 cells. Peptides 2009, 30, 2365–2373. [CrossRef] [PubMed]
Lin, W.-J.; Chien, Y.-L.; Pan, C.-Y.; Lin, T.-L.; Chen, J.-Y.; Chiu, S.-J.; Hui, C.-F. Epinecidin-1, an antimicrobial
peptide from fish (Epinephelus coioides) which has an antitumor effect like lytic peptides in human
fibrosarcoma cells. Peptides 2009, 30, 283–290. [CrossRef] [PubMed]
Hsu, K.-C.; Li-Chan, E.C.; Jao, C.-L. Antiproliferative activity of peptides prepared from enzymatic
hydrolysates of tuna dark muscle on human breast cancer cell line MCF-7. Food Chem. 2011, 126, 617–622.
[CrossRef]
Song, R.; Wei, R.-B.; Luo, H.-Y.; Yang, Z.-S. Isolation and identification of an antiproliferative peptide derived
from heated products of peptic hydrolysates of half-fin anchovy (Setipinna taty). J. Funct. Foods 2014, 10,
104–111. [CrossRef]
361
Mar. Drugs 2017, 15, 67
86.
87.
88.
89.
90.
91.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
Wang, M.; Nie, Y.; Peng, Y.; He, F.; Yang, J.; Wu, C.; Li, X. Purification, characterization and antitumor
activities of a new protein from Syngnathus acus, an officinal marine fish. Mar. Drugs 2011, 10, 35–50.
[CrossRef] [PubMed]
Freitas-Júnior, A.C.; Costa, H.M.; Icimoto, M.Y.; Hirata, I.Y.; Marcondes, M.; Carvalho, L.B.; Oliveira, V.;
Bezerra, R.S. Giant Amazonian fish pirarucu (Arapaima gigas): Its viscera as a source of thermostable trypsin.
Food Chem. 2012, 133, 1596–1602. [CrossRef]
Shai, Y.; Fox, J.; Caratsch, C.; Shih, Y.-L.; Edwards, C.; Lazarovici, P. Sequencing and synthesis of pardaxin,
a polypeptide from the Red Sea Moses sole with ionophore activity. FEBS Lett. 1988, 242, 161–166. [CrossRef]
Huang, T.-C.; Lee, J.-F.; Chen, J.-Y. Pardaxin, an antimicrobial peptide, triggers caspase-dependent and
ROS-mediated apoptosis in HT-1080 cells. Mar. Drugs 2011, 9, 1995–2009. [CrossRef] [PubMed]
Boivin, D.; Gendron, S.; Beaulieu, É.; Gingras, D.; Béliveau, R. The Antiangiogenic Agent Neovastat (Æ-941)
Induces Endothelial Cell Apoptosis 1 Supported by Æterna Laboratories, Québec City, Québec, Canada. 1.
Mol. Cancer Ther. 2002, 1, 795–802. [PubMed]
Oren, Z.; Shai, Y. A Class of Highly Potent Antibacterial Peptides Derived from Pardaxin, A Pore-Forming
Peptide Isolated from Moses Sole Fish Pardachirus marmoratus. Eur. J. Biochem. 1996, 237, 303–310.
[CrossRef] [PubMed]
Hsu, J.-C.; Lin, L.-C.; Tzen, J.T.; Chen, J.-Y. Pardaxin-induced apoptosis enhances antitumor activity in
HeLa cells. Peptides 2011, 32, 1110–1116. [CrossRef] [PubMed]
Pan, C.-Y.; Lin, C.-N.; Chiou, M.-T.; Yu, C.Y.; Chen, J.-Y.; Chien, C.-H. The antimicrobial peptide pardaxin
exerts potent anti-tumor activity against canine perianal gland adenoma. Oncotarget 2015, 6, 2290–2301.
[CrossRef] [PubMed]
Han, Y.; Cui, Z.; Li, Y.-H.; Hsu, W.-H.; Lee, B.-H. In vitro and in vivo anticancer activity of pardaxin against
proliferation and growth of oral squamous cell carcinoma. Mar. Drugs 2015, 14, 2. [CrossRef] [PubMed]
Mukherjee, A.K.; Saviola, A.J.; Burns, P.D.; Mackessy, S.P. Apoptosis induction in human breast cancer
(MCF-7) cells by a novel venom L-amino acid oxidase (Rusvinoxidase) is independent of its enzymatic
activity and is accompanied by caspase-7 activation and reactive oxygen species production. Apoptosis 2015,
20, 1358–1372. [CrossRef] [PubMed]
Food and Agriculture Organization (FAO). The State of World Fisheries and Aquaculture 2016; FAO: Roma, Italy,
2016; p. 200.
Boutayeb, A.; Boutayeb, S. The burden of non communicable diseases in developing countries. Int. J.
Equity Health 2005, 4, 2. [CrossRef] [PubMed]
Tahergorabi, R.; Jaczynski, J. Isoelectric solubilization/precipitation as a means to recover protein and
lipids from seafood by-products. In Seafood Processing By-Products; Springer: New York, NY, USA, 2014;
pp. 101–123.
Schwartsmann, G.; da Rocha, A.B.; Berlinck, R.G.; Jimeno, J. Marine organisms as a source of new
anticancer agents. Lancet Oncol. 2001, 2, 221–225. [CrossRef]
Cain, J.M.; Liu, P.; Alberts, D.E.; Gallion, H.H.; Laufman, L.; O’Sullivan, J.; Weiss, G.; Bickers, J.N. Phase II
trial of didemnin-B in advanced epithelial ovarian cancer. Investig. New Drugs 1992, 10, 23–24. [CrossRef]
Urdiales, J.; Morata, P.; De Castro, I.N.; Sánchez-Jiménez, F. Antiproliferative effect of dehydrodidemnin B
(DDB), a depsipeptide isolated from Mediterranean tunicates. Cancer Lett. 1996, 102, 31–37. [CrossRef]
Suarez-Jimenez, G.-M.; Burgos-Hernandez, A.; Ezquerra-Brauer, J.-M. Bioactive peptides and depsipeptides
with anticancer potential: Sources from marine animals. Mar. Drugs 2012, 10, 963–986. [CrossRef] [PubMed]
Kucuk, O.; Young, M.L.; Habermann, T.M.; Wolf, B.C.; Jimeno, J.; Cassileth, P.A. Phase II Trial of Didemnin B
in Previously Treated Non-Hodgkin’s Lymphoma: An Eastern Cooperative Oncology Group (ECOG) Study.
Am. J. Clin. Oncol. 2000, 23, 273–277. [CrossRef] [PubMed]
Da Rocha, A.B.; Lopes, R.M.; Schwartsmann, G. Natural products in anticancer therapy. Curr. Opin. Pharmacol.
2001, 1, 364–369. [CrossRef]
Cooper, E.L.; Albert, R. Tunicates: A vertebrate ancestral source of antitumor compounds. In Handbook of
Anticancer Drugs from Marine Origin; Springer: Berlin, Germany, 2015; pp. 383–395.
Broggini, M.; Marchini, S.; Galliera, E.; Borsotti, P.; Taraboletti, G.; Erba, E.; Sironi, M.; Jimeno, J.; Faircloth, G.;
Giavazzi, R. Aplidine, a new anticancer agent of marine origin, inhibits vascular endothelial growth factor
(VEGF) secretion and blocks VEGF-VEGFR-1 (flt-1) autocrine loop in human leukemia cells MOLT-4. Leukemia
2003, 17, 52–59. [CrossRef] [PubMed]
362
Mar. Drugs 2017, 15, 67
107. Kitagaki, J.; Shi, G.; Miyauchi, S.; Murakami, S.; Yang, Y. Cyclic depsipeptides as potential cancer therapeutics.
Anti-Cancer Drugs 2015, 26, 259–271. [CrossRef] [PubMed]
108. Vervoort, H.; Fenical, W.; Epifanio, R.D.A. Tamandarins A and B: New cytotoxic depsipeptides from
a Brazilian ascidian of the family Didemnidae. J. Org. Chem. 2000, 65, 782–792. [CrossRef] [PubMed]
109. Blanco-Míguez, A.; Gutiérrez-Jácome, A.; Pérez-Pérez, M.; Pérez-Rodríguez, G.; Catalán-García, S.;
Fdez-Riverola, F.; Lourenço, A.; Sánchez, B. From amino acid sequence to bioactivity: The biomedical
potential of antitumor peptides. Protein Sci. 2016, 25, 1084–1095. [CrossRef] [PubMed]
110. Bowden, B.; Gravalos, D.G. Cyclic Hepta-Peptide Derivative from Colonial Ascidians, Lissoclinum sp.
U.S. Patent No. US 20040033940 A1, 3 April 2004.
111. Kalemkerian, P.G.; Ou, X.; Adil, R.M.; Rosati, R.; Khoulani, M.M.; Madan, K.S.; Pettit, R.G. Activity of
dolastatin 10 against small-cell lung cancer in vitro and in vivo: Induction of apoptosis and bcl-2 modification.
Cancer Chemother. Pharmacol. 1999, 43, 507–515. [CrossRef] [PubMed]
112. Aneiros, A.; Garateix, A. Bioactive peptides from marine sources: Pharmacological properties and
isolation procedures. J. Chromatogr. B 2004, 803, 41–53. [CrossRef] [PubMed]
113. Margolin, K.; Longmate, J.; Synold, T.W.; Gandara, D.R.; Weber, J.; Gonzalez, R.; Johansen, M.J.; Newman, R.;
Baratta, T.; Doroshow, J.H. Dolastatin-10 in Metastatic Melanoma: A Phase II and Pharmokinetic Trial of the
California Cancer Consortium. Investig. New Drugs 2001, 19, 335–340. [CrossRef]
114. Turner, T.; Jackson, W.H.; Pettit, G.R.; Wells, A.; Kraft, A.S. Treatment of human prostate cancer cells with
dolastatin 10, a peptide isolated from a marine shell-less mollusc. Prostate 1998, 34, 175–181. [CrossRef]
115. Zheng, L.; Lin, X.; Wu, N.; Liu, M.; Zheng, Y.; Sheng, J.; Ji, X.; Sun, M. Targeting cellular apoptotic pathway
with peptides from marine organisms. BBA Rev. Cancer 2013, 1836, 42–48. [CrossRef] [PubMed]
116. Liu, M.; Zhao, X.; Zhao, J.; Xiao, L.; Liu, H.; Wang, C.; Cheng, L.; Wu, N.; Lin, X. Induction of apoptosis,
G0 /G1 phase arrest and microtubule disassembly in K562 leukemia cells by Mere15, a novel polypeptide
from Meretrix meretrix Linnaeus. Mar. Drugs 2012, 10, 2596–2607. [CrossRef] [PubMed]
117. Wang, H.; Wei, J.; Wu, N.; Liu, M.; Wang, C.; Zhang, Y.; Wang, F.; Liu, H.; Lin, X. Mere15, a novel polypeptide
from Meretrix meretrix, inhibits adhesion, migration and invasion of human lung cancer A549 cells via
down-regulating MMPs. Pharm. Biol. 2013, 51, 145–151. [CrossRef] [PubMed]
118. Janmaat, M.L.; Rodriguez, J.A.; Jimeno, J.; Kruyt, F.A.; Giaccone, G. Kahalalide F induces necrosis-like cell
death that involves depletion of ErbB3 and inhibition of Akt signaling. Mol. Pharmacol. 2005, 68, 502–510.
[CrossRef] [PubMed]
119. Wang, B.; Waters, A.L.; Valeriote, F.A.; Hamann, M.T. An efficient and cost-effective approach to kahalalide F
N-terminal modifications using a nuisance algal bloom of Bryopsis pennata. Biochim. Biophys. Acta 2015, 1850,
1849–1854. [CrossRef] [PubMed]
120. Staats, P.S.; Yearwood, T.; Charapata, S.G.; Presley, R.W.; Wallace, M.S.; Byas-Smith, M.; Fisher, R.; Bryce, D.A.;
Mangieri, E.A.; Luther, R.R. Intrathecal ziconotide in the treatment of refractory pain in patients with cancer
or AIDS: A randomized controlled trial. JAMA 2004, 291, 63–70. [CrossRef] [PubMed]
121. Olivier Brenet, M.; Sabine de Bourmont, M.; Florence Dixmerias, M.; Nadia Buisset, M.; Nathalie Lebrec, M.;
Dominique Monnin, M. Ziconotide adverse events in patients with cancer pain: A multicenter observational
study of a slow titration, multidrug protocol. Pain Phys. 2012, 15, 395–403.
122. Mundt, S.; Kreitlow, S.; Nowotny, A.; Effmert, U. Biochemical and pharmacological investigations of
selected cyanobacteria. Int. J. Hyg. Environ. Health 2001, 203, 327–334. [CrossRef] [PubMed]
123. Thornburg, C.C.; Thimmaiah, M.; Shaala, L.A.; Hau, A.M.; Malmo, J.M.; Ishmael, J.E.; Youssef, D.T.;
McPhail, K.L. Cyclic depsipeptides, grassypeptolides D and E and Ibu-epidemethoxylyngbyastatin 3,
from a Red Sea Leptolyngbya cyanobacterium. J. Nat. Prod. 2011, 74, 1677–1685. [CrossRef] [PubMed]
124. Do Rosário Martins, M.; Costa, M. Marine Cyanobacteria Compounds with Anticancer Properties:
Implication of Apoptosis. In Handbook of Anticancer Drugs from Marine Origin; Kim, S.-K., Ed.; Springer:
Cham, Germany, 2015; pp. 621–647.
125. Shaala, L.A.; Youssef, D.T.; McPhail, K.L.; Elbandy, M. Malyngamide 4, a new lipopeptide from the Red Sea
marine cyanobacterium Moorea producens (formerly Lyngbya majuscula). Phytochem. Lett. 2013, 6, 183–188.
[CrossRef]
126. Wrasidlo, W.; Mielgo, A.; Torres, V.A.; Barbero, S.; Stoletov, K.; Suyama, T.L.; Klemke, R.L.; Gerwick, W.H.;
Carson, D.A.; Stupack, D.G. The marine lipopeptide somocystinamide A triggers apoptosis via caspase 8.
Proc. Natl. Acad. Sci. USA 2008, 105, 2313–2318. [CrossRef] [PubMed]
363
Mar. Drugs 2017, 15, 67
127. Marquez, B.L.; Watts, K.S.; Yokochi, A.; Roberts, M.A.; Verdier-Pinard, P.; Jimenez, J.I.; Hamel, E.; Scheuer, P.J.;
Gerwick, W.H. Structure and absolute stereochemistry of hectochlorin, a potent stimulator of actin assembly.
J. Nat. Prod. 2002, 65, 866–871. [CrossRef] [PubMed]
128. Luesch, H.; Chanda, S.K.; Raya, R.M.; DeJesus, P.D.; Orth, A.P.; Walker, J.R.; Belmonte, J.C.I.; Schultz, P.G.
A functional genomics approach to the mode of action of apratoxin A. Nat. Chem. Biol. 2006, 2, 158–167.
[CrossRef] [PubMed]
129. Singh, R.K.; Tiwari, S.P.; Rai, A.K.; Mohapatra, T.M. Cyanobacteria: An emerging source for drug discovery.
J. Antibiot. 2011, 64, 401–412. [CrossRef] [PubMed]
130. Li, B.; Gao, M.H.; Zhang, X.C.; Chu, X.M. Molecular immune mechanism of c-phycocyanin from
Spirulina platensis induces apoptosis in HeLa cells in vitro. Biotechnol. Appl. Biochem. 2006, 43, 155–164.
[PubMed]
131. Thangam, R.; Suresh, V.; Princy, W.A.; Rajkumar, M.; SenthilKumar, N.; Gunasekaran, P.; Rengasamy, R.;
Anbazhagan, C.; Kaveri, K.; Kannan, S. C-Phycocyanin from Oscillatoria tenuis exhibited an antioxidant and
in vitro antiproliferative activity through induction of apoptosis and G0 /G1 cell cycle arrest. Food Chem.
2013, 140, 262–272. [CrossRef] [PubMed]
132. Lau, N.-S.; Matsui, M.; Abdullah, A.A.-A. Cyanobacteria: Photoautotrophic microbial factories for the
sustainable synthesis of industrial products. BioMed Res. Int. 2015, 2015, 754934. [CrossRef] [PubMed]
133. Ngo, D.H.; Wijesekara, I.; Vo, T.S.; Van Ta, Q.; Kim, S.K. Marine food-derived functional ingredients as
potential antioxidants in the food industry: An overview. Food Res. Int. 2011, 44, 523–529. [CrossRef]
134. Nazeer, R.; Prabha, K.D.; Kumar, N.S.; Ganesh, R.J. Isolation of antioxidant peptides from clam, Meretrix casta
(Chemnitz). J. Food Sci. Technol. 2013, 50, 777–783. [CrossRef] [PubMed]
135. Rajapakse, N.; Mendis, E.; Byun, H.-G.; Kim, S.-K. Purification and in vitro antioxidative effects of giant
squid muscle peptides on free radical-mediated oxidative systems. J. Nutr. Biochem. 2005, 16, 562–569.
[CrossRef] [PubMed]
136. Shahidi, F.; Zhong, Y. Bioactive Peptides. J. AOAC Int. 2008, 91, 914–931. [PubMed]
137. Je, J.-Y.; Park, P.-J.; Kim, S.-K. Antioxidant activity of a peptide isolated from Alaska pollack
(Theragra chalcogramma) frame protein hydrolysate. Food Res. Int. 2005, 38, 45–50. [CrossRef]
138. Jun, S.-Y.; Park, P.-J.; Jung, W.-K.; Kim, S.-K. Purification and characterization of an antioxidative peptide
from enzymatic hydrolysate of yellowfin sole (Limanda aspera) frame protein. Eur. Food Res. Technol. 2004,
219, 20–26.
139. Mendis, E.; Rajapakse, N.; Kim, S.-K. Antioxidant properties of a radical-scavenging peptide purified from
enzymatically prepared fish skin gelatin hydrolysate. J. Agric. Food Chem. 2005, 53, 581–587. [CrossRef]
[PubMed]
140. Himaya, S.; Ryu, B.; Ngo, D.-H.; Kim, S.-K. Peptide Isolated From Japanese Flounder Skin Gelatin Protects
Against Cellular Oxidative Damage. J. Agric. Food Chem. 2012, 60, 9112–9119. [CrossRef] [PubMed]
141. Guérard, F.; Decourcelle, N.; Sabourin, C.; Floch-Laizet, C.; Le Grel, L.; Le Floc’H, P.; Gourlay, F.; Le Delezir, R.;
Jaouen, P.; Bourseau, P. Recent developments of marine ingredients for food and nutraceutical applications:
A review. J. Sci. Halieut. Aquat. 2010, 2, 21–27.
142. Zhu, C.-F.; Peng, H.-B.; Liu, G.-Q.; Zhang, F.; Li, Y. Beneficial effects of oligopeptides from marine salmon
skin in a rat model of type 2 diabetes. Nutrition 2010, 26, 1014–1020. [CrossRef] [PubMed]
143. Zhu, C.-F.; Li, G.-Z.; Peng, H.-B.; Zhang, F.; Chen, Y.; Li, Y. Effect of marine collagen peptides on markers of
metabolic nuclear receptors in type 2 diabetic patients with/without hypertension. Biomed. Environ. Sci.
2010, 23, 113–120. [CrossRef]
144. Zhu, C.-F.; Li, G.-Z.; Peng, H.-B.; Zhang, F.; Chen, Y.; Li, Y. Treatment with marine collagen peptides
modulates glucose and lipid metabolism in Chinese patients with type 2 diabetes mellitus. Appl. Physiol.
Nutr. Metab. 2010, 35, 797–804. [CrossRef] [PubMed]
145. Chance, W.T.; Tao, Z.; Sheriff, S.; Balasubramaniam, A. WRYamide, A NPY-based tripeptide that antagonizes
feeding in rats. Brain Res. 1998, 803, 39–43. [CrossRef]
146. Vernaleken, A.; Veyhl, M.; Gorboulev, V.; Kottra, G.; Palm, D.; Burckhardt, B.-C.; Burckhardt, G.; Pipkorn, R.;
Beier, N.; van Amsterdam, C. Tripeptides of RS1 (RSC1A1) inhibit a monosaccharide-dependent exocytotic
pathway of Na+ -D-glucose cotransporter SGLT1 with high affinity. J. Biol. Chem. 2007, 282, 28501–28513.
[CrossRef] [PubMed]
364
Mar. Drugs 2017, 15, 67
147. Chevrier, G.; Mitchell, P.L.; Rioux, L.-E.; Hasan, F.; Jin, T.; Roblet, C.R.; Doyen, A.; Pilon, G.; St-Pierre, P.;
Lavigne, C. Low-molecular-weight peptides from salmon protein prevent obesity-linked glucose intolerance,
inflammation, and dyslipidemia in LDLR−/− /ApoB100/100 mice. J. Nutr. 2015, 145, 1415–1422. [CrossRef]
[PubMed]
148. Dandona, P.; Aljada, A.; Bandyopadhyay, A. Inflammation: The link between insulin resistance, obesity
and diabetes. Trends Immunol. 2004, 25, 4–7. [CrossRef] [PubMed]
149. Nagaoka, S.; Shimizu, K.; Kaneko, H.; Shibayama, F.; Morikawa, K.; Kanamaru, Y.; Otsuka, A.; Hirahashi, T.;
Kato, T. A novel protein c-phycocyanin plays a crucial role in the hypocholesterolemic action of
Spirulina platensis concentrate in rats. J. Nutr. 2005, 135, 2425–2430. [PubMed]
150. Colla, L.M.; Muccillo-Baisch, A.L.; Costa, J.A.V. Spirulina platensis effects on the levels of total cholesterol,
HDL and triacylglycerols in rabbits fed with a hypercholesterolemic diet. Braz. Arch. Biol. Technol. 2008, 51,
405–411. [CrossRef]
151. Lordan, S.; Ross, R.P.; Stanton, C. Marine Bioactives as Functional Food Ingredients: Potential to Reduce the
Incidence of Chronic Diseases. Mar. Drugs 2011, 9, 1056–1110. [CrossRef] [PubMed]
152. Craik, D.J.; Fairlie, D.P.; Liras, S.; Price, D. The future of peptide-based drugs. Chem. Biol. Drug Des. 2013, 81,
136–147. [CrossRef] [PubMed]
153. Shahidi, F.; Chandrasekara, A. Millet grain phenolics and their role in disease risk reduction and health
promotion: A review. J. Funct. Foods 2013, 5, 570–581. [CrossRef]
154. Udenigwe, C.C.; Aluko, R.E. Food protein-derived bioactive peptides: Production, processing, and potential
health benefits. J. Food Sci. 2012, 77, R11–R24. [CrossRef] [PubMed]
155. Zhuang, Y.; Sun, L.; Zhang, Y.; Liu, G. Antihypertensive Effect of Long-Term Oral Administration of Jellyfish
(Rhopilema esculentum) Collagen Peptides on Renovascular Hypertension. Mar. Drugs 2012, 10, 417–426.
[CrossRef] [PubMed]
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
365
marine drugs
Review
Marine Peptides as Potential Agents for the
Management of Type 2 Diabetes
Mellitus—A Prospect
En-Qin Xia, Shan-Shan Zhu, Min-Jing He, Fei Luo, Cheng-Zhan Fu and Tang-Bin Zou *
Dongguan Key Laboratory of Environmental Medicine, School of Public Health, Guangdong Medical University,
Dongguan 523808, China; enqinxia@163.com (E.-Q.X.); zss90y@163.com (S.-S.Z.);
minjinghe0818@163.com (M.-J.H.); luofei_00@163.com (F.L.); fuchengzhan@126.com (C.-Z.F.)
* Correspondence: zoutb@163.com; Tel.: +86-769-2289-6572
Academic Editor: Se-Kwon Kim
Received: 30 January 2017; Accepted: 20 March 2017; Published: 23 March 2017
Abstract: An increasing prevalence of diabetes is known as a main risk for human health in the last
future worldwide. There is limited evidence on the potential management of type 2 diabetes mellitus
using bioactive peptides from marine organisms, besides from milk and beans. We summarized
here recent advances in our understanding of the regulation of glucose metabolism using bioactive
peptides from natural proteins, including regulation of insulin-regulated glucose metabolism, such as
protection and reparation of pancreatic β-cells, enhancing glucose-stimulated insulin secretion
and influencing the sensitivity of insulin and the signaling pathways, and inhibition of bioactive
peptides to dipeptidyl peptidase IV, α-amylase and α-glucosidase activities. The present paper tried to
understand the underlying mechanism involved and the structure characteristics of bioactive peptides
responsible for its antidiabetic activities to prospect the utilization of rich marine organism proteins.
Keywords:
marine protein;
structure active relationship
bioactive
peptide;
regulation;
glucose
metabolism;
1. Introduction
Diabetes mellitus is known as a seriously chronic metabolism disorder. According to the forecast,
the prevalence of type 2 diabetes mellitus (T2DM) will increase from 350 million today to 592
million by 2035 [1]. The nutrient overload in prolonged periods was the key factor causing the
bad situation due to impairing the pancreatic β cell function. In sequence, insulin resistance, the
impaired secretary insulin and glucose tolerance become true, and the following result is to develop
T2DM [2–4]. Fortunately, recent studies of Zhu et al. suggest that peptides and protein hydrolysates
from wild Chum Salmon (Oncorhynchus kern) skin markedly decreased the level of fasting glucose level
and the pancreatic apoptosis of islet cells [5]. Pandey et al. reported that the bacteria associated with
marine sponge, Aka coralliphaga, produce many glucosidase inhibitory peptides [6]. Among marine
microalgae, Chlorella vulgaris (C. vulgaris) is regarded as a complementary medicine, due to its
supplements, and exhibited benefits for some health disorders, such as dyslipidemia, hyperglycemia,
and hypertension as well as weight loss in several studies [7,8]. These results indicated that the
natural marine bioactive peptides can improve the deleterious process of T2DM. However, few reports
involved antidiabetic activities of marine natural peptides can be found in literature in our knowledge.
Therefore, the present review will summarize all evidence on antidiabetic activities of natural peptides
from milk, bean and marine organisms. Its primary coverage involved the response of insulin-regulated
glucose metabolism and dipeptidyl peptidase IV (DPP-IV), α-amylase and α-glucosidase activities
on the bioactive peptides. The mechanism underlying each antidiabetic activity and the structure
Mar. Drugs 2017, 15, 88
366
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2017, 15, 88
characteristics of bioactive peptides responsible for its antidiabetic activities were also carefully
discussed for the future novel marine peptides investigation.
2. Regulation of Bioactive Peptides on the Insulin-Regulated Glucose Metabolism
2.1. Protecting Pancreatic β-Cells of Bioactive Peptides
Adequate insulin secretion is necessary to maintain blood glucose levels within a physiological
range, and competent pancreatic β-cells are responsible for that task. However, it becomes insufficient
for the T2DM individuals due to their pancreatic β-cell failure [9]. The major factor causing the adverse
effect on pancreatic β cells was reported as chronic nutrient overload, which causes a cell to increase its
function and mass to match the increasing nutrient availability and insulin resistance [10]. As it can not
adapt to maintaining glucose homeostasis at the high glucose challenges over prolonged periods [4],
hyperglycemia was developed, which was verified to generate over-production of free radical species
including reactive oxygen species (ROS) and nitric oxide (NO) radicals. These free radicals can cause
defects in the mitochondrial respiratory chain by excessive requirements of oxidative enzymes activities
(e.g., NOX), protein glycation and non-enzymatic oxidation and peroxidation of carbohydrates
and lipids, and so on. Ultimately, increasing oxygen free radicals generate in various tissues
including pancreas and kidneys [11–13]. Based on in vitro cell models and animal models of diabetes
assays, researchers found that increased intracellular ROS production can significantly promote
peripheral insulin resistance and induce endoplasmic reticulum (ER) stress, mitochondrial dysfunction,
apoptosis and cell death. Subsequently, pancreatic β cell mass become deficient and its secretory
function was impaired [14–20]. Using Min6 cells and pancreatic islets, Mailloux and coworkers found
that an increase in mitochondrial matrix ROS can reverse the glutathionylation of uncoupling protein-2,
which subsequently impedes glucose-stimulated insulin secretion from β cells [21]. In addition, it is
reported that insulin-secreting β cells of the pancreatic islets contain gene expression and activity of
the H2 O2 -reducing enzymes catalase and glutathione peroxidase (GPx) in islets accounting for only
1%–5% of the values in liver, and levels of cytosolic and mitochondrial superoxide dismutases (SOD)
in islets only around 30% of those in the liver [22,23]. Obviously, as induced by chronic hyperglycemia
and exposure to proinflammatory cytokines, the poor antioxidant defense capability of pancreatic β
cells was sensitive towards oxidative stress [23–25]. Overexpression of these antioxidant enzymes has
been observed to protect various β cell lines against oxidative damage [26–28]. Reactive oxygen
species sensitized by metallothionein and catalase in nonobese diabetic mice was predicted to
protect the pancreatic β cells from autoimmune destruction in male non-obese diabetic (NOD) [29].
Therefore, control of oxidative stress and inflammatory may be key approaches to reduce pancreatic β
cell damage and the development of T2DM [30].
Recently, researchers reported that natural nutrient metabolites can exert a significant role
to preserve β cell functions and mass, prolong the pre-diabetic phase and delay the progress to
frank T2DM. For instance, consumption of dairy products was found linking with a decrease in the
risk of type 2 diabetes [31,32]. Nasri et al. also reported that orally administered goby fish protein
hydrolysates, not undigested goby fish protein, can significantly attenuate hyperglycemia and restored the
antioxidant status under high-fat-high-fructose diet-induced oxidative stress in rats [33]. The same results
reported that the effectiveness of the natural administration of fish protein hydrolysates, produced from
Sardinella aurita and Salaria basilisca, in improving the oxidative status antioxidant for cholesterol-fed rats
and alloxan-induced diabetic rats, respectively [34,35]. The results suggest that the presence of potent
active peptides in fish protein hydrolysates was effective in enhancement of the antioxidant status.
Using in vitro assays, scavenging free radical capacity of bioactive peptides was observed
by several researchers [14,36–38]. After being treated with pinto Durango bean (P. vulgaris L.)
alcalase hydrolysates for 20 h at the concentration of 100 μg/mL, ROS production due to tertbutyl
hydroperoxide (t-BOOH) was almost eradicated in in vitro cell assay [36]. Fernández-Tomé [37] also
found that lunasin, a soy peptide, exerted an effective scavenger as high as 190% of the intracellular
367
Mar. Drugs 2017, 15, 88
ROS generation in HepG2 cells due to exposed to t-BOOH, compared to the control. In addition,
the receptor in HepG2 cells for advanced glycation end products (RAGE) showed the lowest expression
treated with the complete protein hydrolysates. While RAGE was found in pancreatic islets acting
as an inducer of pancreatic β-cell apoptosis and developing of chronic diabetic complications via
nicotinamide adenine dinucleotide phosphate oxidase mediated ROS generation in vitro assays [38].
Treatment with β-casomorphin-7, a milk-derived bioactive peptide, a considerable reduction in H2 O2
content (p < 0.05) and a remarkable increase in the activity of GSH-peroxidase, SOD and catalase of
the anti-oxidation system were observed. Simultaneously, the abatement of free-radical-mediated
oxidative stress in blood and myocardium and cardiac indexes were also observed [39]. Protective effect
of peptides on pancreatic β-cells against intracellular ROS due to a high glucose exposure has also
been observed [14].
Natural peptides were also reported to efficiently ameliorate the diabetes symptoms. The levels
of blood glucose of streptozotocin-induced diabetic rats markedly decreased after treatment with
β-casomorphin-7, compared with model control group (p < 0.01) [39]. Bioactive peptides were observed
to reduce the expression of cytokines such as interleukin-1β and tumor necrosis factor-α in pancreatic
β-cells, which both generate as the cells were exposed to high glucose in vitro [40]. A Chlorella-11
peptide was also able to suppress lipopolysaccharide-induced nitric oxide (NO), serum TNF-α and
inflammation [41]. In addition, it was reported that the common bean peptides can upregulated
the expression of insulinlike growth factor 2 (IGF-II), a kind of adipokines in pancreatic β-cells now
being believed to play a negative role in the development of obesity-associated insulin resistance and
anti-inflammation [42].
2.2. Enhancement of Glucose-Stimulated Insulin Secretion
It has been revealed that T2DM develops when the insulin secretory capacity is unable to
compensate for the increase of insulin resistance. The incretins, gut-derived hormones released
from small intestine enteroendocrine cells (EECs), i.e., glucagonlike peptide 1 (GLP-1) and glucose
dependent insulinotropic peptide (GIP), exert the significant role in regulation of food digestion
by stimulation of glucose-dependent insulin secretion, as well food intake by promoting satiety
to decrease appetite [43–45]. However, studies showed that circulating GLP-1 levels increase after
meal intake but rapidly decrease 80%–90% due to cleaved by dipeptidyl peptidase IV (DDP-IV) [46].
Therefore, the DPP-IV inhibitors have indirect effects on islet function via contributing to insulin
secretion and lowering blood glucose by increasing incretin action [47]. As early as 1988, Liddle et al.
found that protein digestion can stimulate gut hormone secretion and expression in rats [48].
According to Caron et al., intestinal digestion derived from bovine haemoglobin exhibited significant
efficiency on gut hormone release and DPP-IV activity inhibition, and those hormones’ gene expression
was also up-expressed [49]. The DPP-IV inhibition capacity of some diet origin peptides above 200 μM
of in literature is displayed in Table 1.
Table 1. The precursors, sequences, inhibition capacity (IC 50) of some natural origin peptides with
dipeptidyl peptidase IV inhibitory activity in literature with IC 50 < 200 μM.
Food
Precursor Protein
Peptide Sequence
IC 50 (µM)
Reference
Plant Protein
Macroalga Palmaria
palmate protein
ILAP
LLAP
MAGVDHI
43.40
53.67
159.37
[50]
Halibut skin
gelatin
SPGSSGPQGFTG
GPVGPAGNPGANGLN
PPGPTGPRGQPGNIGF
101.6
81.3
146.7
Tilapia skin gelatin
IPGDPGPPGPPGP
LPGERGRPGAPGP
GPKGDRGLPGPPGRDG
65.4
76.8
89.6
Tuna cooking juice
hydrolysates
PACGGFWISGRPG
CAYQWQRPVDRIR
PGVGGPLGPIGPCYE
96.4
78
116.1
Collagen
368
[51]
[52]
Mar. Drugs 2017, 15, 88
Table 1. Cont.
Food
Precursor Protein
Peptide Sequence
IC 50 (µM)
Reference
Collagen
Deer skin protein
GPVGXAGPPGK
GPVGPSGPXGK
83.3
93.7
[53]
α-Lactalbumin
LKPTPEGDL
LAHKALCSEKL
LCSEKLDQ
TKCEVFRE
45
165
186
166
[54]
β-Lactalbumin
VAGTWY
IPAVF
174
44.7
[55]
[56]
Atlantic salmon
collagen/gelatin
GPAE
GPGA
49.6
41.9
[52]
Gouda-type cheese
VPITPTL
VPITPT
LPQNIPPL
VAGTWY
LPQ
110
130
46
174
82
[57]
Whey protein
LAHKALCSEKL
WLAHKALCSEKLDQ
LKPTPEGDL
LKPTPEGDLEIL
WLAHKALCSEKLDQ
WR
IPIQY
WCKDDQNPHS
TKCEVFRE
IPA
VA3, VL, WL, WI
LKPTPEGDLE
LKALPMH
165
141
45 9
57
141
31.4
28.2
75.0
166
49
<170
42
193
[58–63]
Milk protein
WA
WR
WK
LPYPY
WQ
WI
WN
YPYY
92.6
37.8
40.6
108.3
120.3
138.7
148.5
194.4
[46,64–66]
Milk protein
WN
IP
IPI
IPIQY
FLQP
WV
LPVPQ
IPM
HL
VA
WL
WP
148.5
149.6
3.5
35.2
65.3
65.7
48.2
73.9
143.2
168.2
43.6
44.5
[46,64–66]
Milk protein
Milk protein
From Table 1, milk is the main source of peptides with efficient DPP-IV inhibitors in literature.
Skin from halibut, tilapia and deer also showed significant DPP-IV inhibition capacity with IC 50
lower than 200 μM. Plant proteins digested in vitro or in vivo have been investigated the DPP-IV
inhibitory peptides by some researchers, such as cowpea bean [67], Quinoa [68], rice bran [69],
raw amaranth flour, soybean flour, and wheat flour [70]. However, except for Macroalga Palmaria
palmate, DPP-IV inhibition capacity were exhibited with IC 50 far higher than 200 μM. The collected
data showed that novel original peptides from natural proteins, especially from marine organisms,
have been widely investigated for the management of T2DM.
2.3. Regulation of Glucose Uptake and Lipid Accumulation
Hyperglycemia has been identified as a key factor to induce to deficiency in insulin secretion
and/or decreased reaction of the organs to insulin (World Health Organization, 1999). Besides diet
and lifestyle modifications, control and prevention of hyperglycemia are primary approaches in
the management of diabetes mellitus, which is involved in several physiological processes, such as
369
Mar. Drugs 2017, 15, 88
increasing utilization of the glucose by the peripheral tissues and lowering hepatic glucose output and
adipocyte fat-accumulation [71].
Some studies showed that natural peptides can correct high blood sugar, even without regulation
of insulin secretion. For instance, the bean hydrolysates from pinto Durango had a dose-dependent
insulin sensitizing effect (p < 0.05) comparing to the control. The most potent fraction was pinto
Durango-alcalase < 1 kDa, which caused insulin resistant cells to increase (67 ± 3.2)% of glucose
uptake compared to the non-insulin resistant cells [37]. The plasma glucose was also significantly
decreased (25%–34%), after simultaneously intervening rats high-fat-high-fructose diet (HFFD) and
goby fish protein hydrolysates, compared to the HFFD group [33]. β-casomorphin-7, a peptide from
milk, was also found to restrain the elevation of blood glucose, and its effect is slightly inferior to
insulin (11.18 ± 0.72 to 14.92 ± 0.66 mmol/L) [39]. The same results were found that the hypoglycemic
effect of protein hydrolysates from muscle fish Zebra blenny in alloxan-induced diabetic rats [35] and
from the vegetable Momordica charantia L. in alloxan-induced diabetic mice [33]. Yuh et al. found
significantly enhanced hypoglycemic effects of chlorella consumption on streptozocin (STZ) induced
diabetic mice [72]. By the similar assays, Jeong et al. observed significant improvement of insulin
sensitivity in type 2 diabetic and normal Wistar rats., but the glucose-stimulated insulin secretion had
not been influenced by chlorella consumption [73] Aglycin, a peptide from soy, exhibited effectively in
preventing hyperglycemia in a diabetic animal model with impaired glucose tolerance and insulin
resistance, which were induced in BALB/c mice (i.e., the laboratory bred strain of albino mice
specially used for the study of cancer, neurological diseases) with a high-fat diet and received a
single intraperitoneal injection of STZ [74]. Aglycin reduced blood glucose levels by 45.0% after
long-term treatment (aglycin vs. model day 21 7.3 ± 0.5 vs. 11.3 ± 0.4 mmol/L; day 28 7.1 ± 0.2
vs. 12.4 ± 0.6 mmol/L, Pb.01, respectively) [74]. The notable efficiency has also been observed by
Veloso et al. [75]. However, insulin secretion and body weight control in aglycin treated mice was
not affected. Glucose levels were lowered after insulin loading in aglycin-treated mice in the insulin
tolerance test. It indicated that glucose control induced by aglycin is largely mediated by enhancing
glucose utilization and insulin sensitivity in peripheral insulin target sites [74]. Peptides from salmon
hydrolysate, separated by electrodialysis with filtration membrane, also enhanced glucose uptake in
L6 skeletal muscle cells by up to 40% without insulin increase [76].
Recently, researchers found that there was an inverse relationship between amount of secretory
adiponectin, known as an insulin sensitizor, and the percentage of adipose tissue in the internal
organs. It indicates that the decreased fat accumulation may improve glucose tolerance by the
enhancement of insulin sensitivity [77]. According to results of Toledo et al., lipid accumulation was
inhibited from 13% to 28% when adipocytes were treated with the bean hydrolysates throughout
the differentiation process, and their <1 kDa peptide fraction showed slightly higher than whole
hydrolysates [36]. Similarly, Martinez-Villaluenga et al. showed an inhibition of lipid accumulation
from 27% to 46% in 3T3-L1 adipocytes when treated with alcalase soy hydrolysates at a concentration
of 100 μM (1000 μg/mL) with an average of molecular mass of 10 kDa [78]. This study showed that
common bean hydrolysates have the inhibitory effect on lipid accumulation. Lipid accumulation
in adipose tissue can be reduced by different mechanisms, e.g., reducing lipid uptake through
suppressing lipoprotein lipase or reducing lipid synthesis through inhibiting fatty acid synthase
(FAS) [79]. To investigate the effect of peptides from natural protein on liquid accumulation, human
white pre-adipocytes (HWP) received intervention from 11 peptides from fish, seaweed, shellfish, in
order to investigate proliferation, differentiation and maturation. The results showed that Ala-Pro,
Val-Ala-Pro and Ala-Lys-Lys greatly affected viability of HWP during the proliferation period, while
Lys-Trp and Val-Trp reduced the number of viable cells during the differentiation stage. The decrease
of their final lipid content and of the mRNA level of adipocyte markers (aP2, GLUT4, LPL and
AGT) was also involved. Kim et al. showed that the peptide GAGVGY also downregulates lipid
accumulation modulating of gene expression such as sterol regulatory element-binding proteins-1c,
Peroxisome proliferator-activated receptor gamma and fatty acid synthase [80], which exhibited
370
Mar. Drugs 2017, 15, 88
a dual effect regulating glucose uptake and lipid accumulation in a similar way as the present
results [81–83]. In literature, some peptides from goat and soybean have been reported to inhibit
growth of preadipocytes, decrease the differentiation process and decrease the final lipid content in
human white preadipocytes and lipid accumulation [79,81]. These results suggest that natural peptides
may be a potential compound on regulation of T2DM via inhibitory lipid accumulation.
2.4. Regulation of the Insulin-Signaling Pathways
Correction insulin resistance is an important therapeutic strategy for T2DM. Insulin resistance
is a physiological condition, in which cells fail to respond to the normal actions of the hormone
insulin, and reduction or impairment of insulin-stimulated glucose uptake. Insulin receptor
substrate-1/phosphoinositide-3-kinase/protein kinase B (IRS-1/PI3K/Akt) signaling pathways was
found as a main target to correct insulin regulating glucose uptake [84]. A defect in protein kinase
B (PKB or Akt) signaling that reduces the translocation of the glucose transporter protein GLUT4
to the cellular membrane may be a main impairment of insulin-stimulated glucose uptake under
insulin resistance conditions [85]. The action mechanism of IRS-1/PI3K/Akt signaling pathways
on regulation of blood sugar is illustrated in Figure 1. In vivo assays showed that under insulin
resistance of diabetes, phosphorylation level of Akt Ser473 decreases, and insulin signal transduction
also significantly abates due to a decrease in insulin receptor concentration and kinase activity [86,87].
Therefore, insulin receptor (IR), insulin receptor substrate-1/2 (IRS-1/2), PI3K and Akt all might be
efficient targets to regulate downstream signaling cascade to lower blood sugar level.
Figure 1. Some regulation evidence of natural peptides on the insulin-signaling pathways. Note: ‘∆’ and
‘▽’ mean the natural peptides display upregulation and downregulation on the corresponding
bioprecessed, respectively.
Some evidence has reported on the upregulation of GLUT4 in T2DM individuals by natural
peptides. The effect of aglycin, a peptide from soy, on insulin signaling in the mice skeletal muscle
showed that a significant increase in the expression of IR and IRS1 genes, as well as total IR,
IRS1, p-Akt protein and membrane GLUT4, was observed. An increase of 75% of basal glucose
uptake was found in both normal and insulin-resistant C2C12 cells [74]. B-casomorphin-7 and insulin
371
Mar. Drugs 2017, 15, 88
increased (p < 0.05) 1.37-fold and 1.62-fold of the expression of GLUT-4 in myocardium, respectively.
In contrast with the model group, soybean peptides also have been reported to improve insulin action
via increasing the expressions of GLUT4 and insulin regulatory genes in diabetic animals [88,89].
The peptide GAGVGY, a fibroin derivative, increased both basal and insulin stimulated glucose
uptake through enhancement of GLUT1 expression and PI3K-dependent GLUT4 translocation [80].
Tripeptides such as GEY and GYG, derived from the peptide E5K6 from silk, stimulated glucose uptake
in 3T3-L1 adipocytes by inducing the expression of glucose transporters GLUT1 and GLUT4 [90].
In adipose tissue, insulin is also responsible for the enhanced uptake of glucose by GLUT4.
When adipocytes show insulin resistance, GLUT4 does not translocate to cell membrane in response
to insulin release by the pancreas, and this leads to reduced glucose uptake. Common bean peptides
modulating glucose transporters in insulin resistant adipocyte 3T3-L1 were evaluated by confocal
microscopy. Results showed that there was a dose-dependence between the upregulation expression
of glucose transporters GLUT4 and fraction peptides with <1 kDa derived from alcalase and
bromelain [36]. In addition, a fermented soybean extract significantly increased the expression of
GLUT4 and glucose uptake in 3T3-L1 adipocytes [91].
In vivo assays showed that fat accumulation was strongly associated with the inhibition of the
PI3k signaling pathway, which was involved in the inhibition of insulin signaling [92]. Recovery of the
activity of PI3K/Akt could protect the liver from non-alcoholic fatty liver disease induced injury [93].
These results might explain the fact that long-term feeding of soy peptide induced weight loss in obese
mice both in healthy and diabetic animal models [74,94].
In addition, Akt is one of the major downstream targets of PI3K and responsible for the
physiological function of insulin in adipocytes [95]. Phosphatase and tensin homologue (PTEN) is a
lipid phosphatase that downregulates the action of PI3K decreasing insulin signaling, playing a role in
regulating glucose metabolism [96]. A reduction of PTEN was presented with pinto Durango-bromelain
bean hydrolysate and its <1 kDa peptide fraction treatments [36].
2.5. Clinical Trials
In very rare clinical human studies on anti-diabetes peptides, the efficacy of Chlorella vulgaris
(C. Vulgaris) in prevention and treatment of dyslipidemia, hyperglycemia, hypertension as well as
weight loss was found in literature [97–99]. C. vulgaris, a single-celled marine green algae, has been
regarded as a complementary medicine [100]. Studies showed consumption of chlorella tablets for
16 weeks led to ameliorate insulin signaling pathways and noticeable reduction in serum glucose
concentrations [97]. Panahi et al. also reported that C. vulgaris supplementation results in a marked
decrease in insulin resistance and fasting serum glucose level in non-alcoholic fatty liver disease
(NAFLD) patients [98]. Recently, Ebrahimi-Mameghani et al. recruited 70 obese patients with
NAFLD aged 20–50 years to interfere with C. vulgaris supplementation. The results showed that
1200 mg C. vulgaris supplementation brought several potential beneficial effects, such as loss of weight,
lowering serum glucose level, improvement of inflammatory biomarkers and liver function in NAFLD
patients [99].
3. Inhibition of Bioactive Peptides to α-Amylase and α-Glucosidase Activities
Other approaches to decrease hyperglycemia are to control or delay glucose absorption by
inhibition of α-glucosidase or α-amylase in the gastrointestinal tract. α-amylase is an enzyme that
hydrolyses α-bonds polysaccharide such as glycogen and starch to oligosaccharides. α-Glucosidase is
present in the epithelial mucosa of the small intestine and cleaves glycosidic bonds in oligosaccharides,
releasing monosaccharides into blood sugar [30,101]. Thus, inhibition of α-amylase and α-glucosidase
is an alternative pathway to management of the blood glucose levels and T2DM [102].
A significant increase in the serum α-amylase activity (by 86.08%) was found in HFFD-fed
rats compared to control rats (p < 0.05). As oral administration of goby fish protein hydrolysates,
the α-amylase activity in that of high-fat-high-fructose feed rats decreased by about 62% compared to
372
Mar. Drugs 2017, 15, 88
the HFFD group [35]. Pinto bean peptides (<3 kDa fraction) and cumin seed-derived peptides also
showed α-amylase inhibitory capacity at 62.1% and 24.54%, respectively [103,104]. Some inhibitory
peptides and its IC50 and sequences has been detected or identified in literature and are illustrated
in Table 2. To our knowledge, reports about inhibitory α-amylase peptides were limited, and less
references could be obtained on the α-glucosidase inhibitory peptides in literature.
Table 2. The sequences, inhibition capacity (IC 50) and precursors of natural peptides with α-amylase
and α-glucosidase inhibitory activity in literature.
Ingredient
α-amylase
Peptides Sequence
IC 50
Precursors
Reference
PPHMLP
PLPWGAGF
PPHMGGP
PLPLHMLP
LSSLEMGSLGALFVCM
1.97 (mg mL−1 )
8.96 (mg mL−1 )
14.63 (mg mL−1 )
18.45 (mg mL−1 )
20.56 (mg mL−1 )
Pinto bean
[103]
FFRSKLLSDGAAAAKGALLPQYW
RCMAFLLSDGAAAAQQLLPQYW
DPAQPNYPWTAVLVFRH
0.02 (µM)
0.04 (µM)
0.03 (µM)
Cumin seed
protein
[104]
RCMAFLLSDGAAAAQQLLPQYW
DPAQPNYPW TAVLVFRH
0.04 (µM)
0.15 (µM)
Cumin seed
protein
[105]
WEVM
AKSPLF
-
Black bean protein
[106]
<3 kDa fraction
-
Rice bran protein
[107]
KLPGF
NVLQPS
120.0 ± 4.0 (µM)
110.0 ± 6.2 (µM)
Albumin
[108]
Bean protein
[109]
36.3%–50.1%
DW
α-glucosidase
mg−1
TTGGKGGK
-
Black bean protein
[107]
KLPGF
NVLQPS
59.5 ± 5.7 (µM)
100.0 ± 5.7 (µM)
Albumin
[108]
4. The Structure Characteristics of Antidiabetes Peptides
Different approaches have been suggested potential for the treatment and management of Type 2
diabetes by natural peptides. A limited number of studies focus on the structural features that govern
the properties of peptides in literature, including the structure of DPP-IV inhibitory, insulinotropic and
α-amylase peptides.
For DPP-IV inhibitory peptides, they exert their effect by binding either at the active site and/or
outside the catalytic center of the enzyme. In silico studies predicted that the active site of DPP-IV
comprises a hydrophobic S1 (Tyr662 and Tyr666) pocket and a charged S2 (Phe357 and Arg125)
pocket with an overall negative charge [110,111]. Hydrogen bonds and hydrophobic interactions
were involved between N-terminal amino acids of DPP-IV inhibitory peptides and the catalytic
active site of DPPIV. Thus, the structural features of DPP-IV inhibitors generally were inferred
as a hydrophobic or aromatic amino acid at the N-terminus, such as Ile, Leu, Val, Phe, Trp or
Tyr [52]. However, several non-inhibitory peptides possessing hydrophobic or aromatic amino
acids at their N-terminus were also found (Table 1). Statistically, 77% of all hydrophobic peptides
(with an hydrophobicity index >0) and 53% of the hydrophilic peptides were detected with DPP-IV
inhibition [46]. It indicates that N-terminal hydrophobicity or aromaticity is a desirable characteristic,
but not sufficient for inhibition.
To investigate the preferential amino acids involving in DPP-IV inhibition, the amount of
each amino acid occurring in the DPP-IV inhibitory peptides was calculated based on Table 1.
The preferential amino acids were also found as Pro, Leu, Gly, Ala, Trp in decreasing order, and Pro
occurred most frequently in DDP-IV inhibitory peptides. Studies also showed that collagen from fish
373
Mar. Drugs 2017, 15, 88
and mammals has also attracted notable attention as a potential source of DPP-IV inhibitory peptides
partly due to its high content in Pro residue [51,52]. In addition, peptides with the presence of a Trp
at the N-terminus was found as more potent DPP-IV inhibitors with an IC 50 value <200 mM [65].
A positive correlation between the presence of Trp-containing peptides within plant (hemp, pea,
rice and soy) protein hydrolysates and their DPP-IV inhibitory properties have been observed [68].
However, containing the most preferring amino acid, i.e., Pro, Ile-Pro and Pro-Tyr were shown
to be a DPP-IV inhibitor while Pro-Ile and Tyr-Pro were not [69,112]. The results indicated that the
different stereochemistry between them may exert a role in the biological activity of the peptide.
Indeed, the existence of exclusion volumes in the S1 pocket of DPP-IV might explain the results,
which may restrict the access of bulky amino acids and allow access to smaller residues such as Pro,
Ala and Gly [113].
In literature, hydrolysis fractions (<1 kDa) of hard-to-cook bean proteins and whey
proteins hydrolysis both showed insulin secretagogue action and improved insulin signaling in
adipocytes [36,114]. In vitro studies using pancreatic β-cell lines or primary islet cells displayed significant
insulinotropic effects of different amino acid residues, including Ala, Leu, Arg and Gln [115,116].
Without carbohydrates, only ingestion of amino acids (Leu, Arg, Ile, Phe and Ala) or milk-derived
peptides also exhibited an increase of insulin secretion [117,118]. Furthermore, studies verified that
branched chain amino acids were closely associated with insulinotropic effects [115,116,119,120].
Investigation of whey protein hydrolysis showed that the most potent insulinotropic
fractions obtained were hydrophilic, which might be responsible for the activity observed [114].
However, other peptides with hydrophobic characteristics may also contribute to the insulinotropic
properties of the whey protein hydrolysate [63]. In addition, the levels of Arg and Phe were found
to be associated with an insulinotropic activity [116]. According to the results above, it was inferred
that free amino acids and dipeptides would be bioavailable and therefore may reach pancreatic β cells
in vivo.
The complex mechanisms of these amino acids exerting their action involve mitochondrial
metabolism. During fasting periods, glutamine and alanine are important factors to modulate glucagon
release from pancreatic α-cells and subsequently influence insulin secretion from β-cells. On the other
hand, high glucose levels raise ATP/ADP ratio in β-cells, and inhibit glutamate oxidation to amplify
insulin signals [36].
The structural features of α-amylase peptide inhibitor were investigated by Yu et al. [108].
The amino acids, such as Leu, Pro, Gly and Phe, are frequently found in α-amylase inhibitory activity.
Peptides with Pro at the N-terminal of Gly or Phe and C-terminal of Phe or Leu were found owning
α-amylase inhibitory activity. The positioning of these amino acids at the N- or C-terminal were
believed to be the contributors to α-amylase inhibitory activity of peptides extracted from Pinto
bean [121]. Some reports showed that the high molecular weights of amino acids with aromatic ring,
such as Arg, Phe, Trp, and Tyr, were crucial for interacting with the active site of human pancreatic
α-amylases [104,122]. However, the results on the structural active relationship of α-amylase inhibitor
peptides are still limited and not many studies have been conducted. Evenly, the data on the structure
features for peptides such as potential α-glucosidase inhibitors have not been found in literature [108].
5. Conclusions
Nowadays, the discovery of novel ocean bioactive peptides is one of the most exciting new
directions of pharmaceutical science due to their nutritional attributes, large output and uniqueness
in terms of diversity, and structural and functional features with respect to peptides isolated from
terrestrial plants. The diverse nature of T2DM means that food ingredients, such as natural peptides,
will be more suitable for combating it and its associated complications than the synthetic and other
drugs with significant side effects in the long term. This review concluded that natural origin peptides
derived from several kinds of marine organisms, for instance, macro- and micro-algae, marine sponge,
fish skin gelatin, and even tuna cooking juice hydrolysates, besides from milk and beans, showed great
374
Mar. Drugs 2017, 15, 88
potential to regulate glucose metabolism for insulin resistance individuals. Chlorella vulgaris, one type
of marine microalgae with large biomass and high quality protein accounting for over 60% (Wt),
has been reported with significant antidiabetic activities in rare clinical trials. This evidence suggested
that valuable antidiabetic activities associated with marine bioactive peptides, especially derived from
marine microorganisms and their metabolites might be used in future potentialities in nutraceutical and
pharmaceutical industries. Investigation of the structural features of peptides linked with anti-diabetic
activity, using bioinformatics combined with molecular biological technology, will be a powerful tool
to exploit new peptides from abundant marine proteins. In addition, the performances of research
studies using human models or clinical trials are necessary in the future for their further application.
Acknowledgments: This work was supported by grants from the National Natural Science Foundation of China
(81302416), the Guangdong Science and Technology Planning Project (2014A020212297), the Guangdong Training
Plan for Outstanding Young Teachers (YQ201405), the Dongguan Science and Technology Planning Project
(2014108101053), and a grant from the Dongguan Key Laboratory of Environmental Medicine.
Author Contributions: Tang-Bin Zou designed the review; En-Qin Xia and Shan-Shan Zhu analyzed and wrote
drafts of the manuscript; Min-Jing He, Fei Luo and Cheng-Zhan Fu helped rewrite the revised manuscript;
Tang-Bin Zou and En-Qin Xia revised the manuscript and approved it in its final form. All authors read and
approved the final manuscript.
Conflicts of Interest: The author declares no conflict of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Lee, J.E.; Min, S.H.; Lee, D.H.; Oh, T.J.; Kim, K.M.; Moon, J.H.; Choi, S.H.; Park, K.S.; Jang, H.C.;
Lim, S. Comprehensive assessment of lipoprotein subfraction profiles according to glucose metabolism
status, and association with insulin resistance in subjects with early-stage impaired glucose metabolism.
Int. J. Cardiol. 2016, 225, 327–331. [CrossRef] [PubMed]
Leavens, K.F.; Birnbaum, M.J. Insulin signaling to hepatic lipid metabolism in health and disease. Crit. Rev.
Biochem. Mol. Biol. 2011, 46, 200–215. [CrossRef] [PubMed]
So, W.Y.; Leung, P.S. Irisin ameliorates hepatic glucose/lipid metabolism and enhances cell survival in
insulin-resistant human HepG2 cells through adenosine monophosphate-activated protein kinase signaling.
Int. J. Biochem. Cell Biol. 2016, 78, 237–247. [PubMed]
Maulucci, G.; Daniel, B.; Cohen, O.; Avrahami, Y.; Sasson, S. Hormetic and regulatory effects of lipid
peroxidation mediators in pancreatic β cells. Mol. Aspects Med. 2016, 49, 49–77. [CrossRef] [PubMed]
Zhu, C.F.; Peng, H.B.; Liu, G.Q.; Zhang, F.; Li, Y. Beneficial effects of oligopeptides from marine salmon skin
in a rat model of type 2 diabetes. Nutrition 2010, 26, 1014–1020. [CrossRef] [PubMed]
Pandey, S.; Sree, A.; Dash, S.S.; Sethi, D.P.; Chowdhury, L. Diversity of marine bacteria producing
β-glucosidase inhibitors. Microb. Cell Fact. 2013, 12, 35. [CrossRef] [PubMed]
Shibata, S.; Hayakawa, K.; Egashira, Y.; Sanada, H. Hypocholesterolemic mechanism of Chlorella:
Chlorella and its indigestible fraction enhance hepatic cholesterol catabolism through upregulation of
cholesterol 7α-hydroxylase in rats. Biosci. Biotechnol. Biochem. 2007, 71, 916–925. [CrossRef] [PubMed]
Mello-Sampayo, C.; Luisa-Corvo, M.; Mendes, R.; Duarte, D.; Lucas, J.; Pinto, R. Insights on the safety of
carotenogenic Chlorella vulgaris in rodents. Algal Res. 2013, 2, 409–915.
Belgardt, B.F.; Ahmed, K.; Spranger, M.; Latreille, M.; Denzler, R.; Kondratiuk, N.; von, Meyenn, F.;
Villena, F.N.; Herrmanns, K.; Bosco, D.; et al. The microRNA-200 family regulates pancreatic β cell survival
in type 2 diabetes. Nat. Med. 2015, 21, 619–627. [CrossRef] [PubMed]
Kaiser, N.; Leibowitz, G. Failure of β-cell adaptation in type 2 diabetes Lessons from animal models.
Front. Biosci. (Landmark Ed). 2009, 14, 1099–1115. [CrossRef] [PubMed]
Houstis, N.; Rosen, E.D.; Lander, E.S. Reactive oxygen species have a causal role in multiple forms of insulin
resistance. Nature 2006, 440, 944–948. [CrossRef] [PubMed]
Khan, S.R. Is oxidative stress; a link between nephrolithiasis and obesity; hypertension; diabetes;
chronic kidney disease; metabolic syndrome? Urol. Res. 2012, 40, 95–112. [CrossRef] [PubMed]
Roberts, C.K.; Sindhu, K.K. Oxidative stress and metabolic syndrome. Life Sci. 2009, 84, 705–712. [PubMed]
375
Mar. Drugs 2017, 15, 88
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
Fernandez-Millan, E.; Cordero-Herrera, I.; Ramos, S.; Escriva, F.; Alvarez, C.; Goya, L.; Martin, M.A.
Cocoa-rich diet attenuates β cell mass loss and function in young Zucker diabetic fatty rats by preventing
oxidative stress and β cell apoptosis. Mol. Nutr. Food Res. 2015, 59, 820–824. [CrossRef] [PubMed]
Bayod, S.; Del, Valle, J.; Lalanza, J.F.; Sanchez-Roige, S.; de Luxan-Delgado, B.; Coto-Montes, A.;
Canudas, A.M.; Camins, A.; Escorihuela, R.M.; Pallas, M. Long-term physical exercise induces changes in
sirtuin 1 pathway and oxidative parameters in adult rat tissues. Exp. Gerontol. 2012, 47, 925–935. [CrossRef]
[PubMed]
Carnagarin, R.; Dharmarajan, A.M.; Dass, C.R. PEDF-induced alteration of metabolism leading to insulin
resistance. Mol. Cell Endocrinol. 2015, 40, 98–104.
Cnop, M.; Igoillo-Esteve, M.; Cunha, D.A.; Ladriere, L.; Eizirik, D.L. An update on lipotoxic endoplasmic
reticulum stress in pancreatic β-cells. Biochem. Soc. Trans. 2008, 36, 909–915.
Lenzen, S. Oxidative stress the vulnerable β-cell. Biochem. Soc. Trans. 2008, 36, 343–347. [CrossRef] [PubMed]
Newsholme, P.; Haber, E.P.; Hirabara, S.M.; Rebelato, E.L.; Procopio, J.; Morgan, D.; Oliveira-Emilio, H.C.;
Carpinelli, A.R.; Curi, R. Diabetes associated cell stress and dysfunction: Role of mitochondrial and
non-mitochondrial ROS production and activity. J. Physiol. 2007, 583, 9–24. [CrossRef] [PubMed]
Poitout, V.; Amyot, J.; Semache, M.; Zarrouki, B.; Hagman, D.; Fontes, G. Glucolipotoxicity of the pancreatic
β cell. Biochim. Biophys. Acta 2010, 1801, 289–298. [CrossRef]
Mailloux, R.J.; Fu, A.; Robson-Doucette, C.; Allister, E.M.; Wheeler, M.B.; Screaton, R.; Harper, M.E.
Glutathionylation state of uncoupling protein-2 and the control of glucose-stimulated insulin secretion.
J. Biol. Chem. 2012, 287, 39673–39685. [PubMed]
Lenzen, S.; Drinkgern, J.; Tiedge, M. Low antioxidant enzyme gene expression in pancreatic islets compared
with various other mouse tissues. Free Radic. Biol. Med. 1996, 20, 463–466. [PubMed]
Tiedge, M.; Lortz, S.; Drinkgern, J.; Lenzen, S. Relation between antioxidant enzyme gene expression and
antioxidative defense status of insulin-producing cells. Diabetes 1997, 46, 1733–1742. [PubMed]
Corbett, J.A.; Wang, J.L.; Hughes, J.H.; Wolf, B.A.; Sweetland, M.A.; Lancaster, J.R.; McDaniel, M.L.
Nitric oxide and cyclic GMP formation induced by interleukin 1 β in islets of Langerhans. Evidence
for an effector role of nitric oxide in islet dysfunction. Biochem. J. 1992, 287, 229–235. [PubMed]
Morgan, D.; Oliveira-Emilio, H.R.; Keane, D.; Hirata, A.E.; Santos, da, Rocha, M.; Bordin, S.; Curi, R.;
Newsholme, P.; Carpinelli, A.R. Glucose, palmitate and pro-inflammatory cytokines modulate production
and activity of a phagocyte-like NADPH oxidase in rat pancreatic islets and a clonal β cell line. Diabetologia
2007, 50, 359–369. [PubMed]
Lei, X.G.; Vatamaniuk, M.Z. Two tales of antioxidant enzymes on β cells and diabetes. Antioxid. Redox Signal.
2011, 14, 489–503. [PubMed]
Tiedge, M.; Lortz, S.; Munday, R.; Lenzen, S. Protection against the co-operative toxicity of nitric oxide and
oxygen free radicals by overexpression of antioxidant enzymes in bioengineered insulin-producing RINm5F
cells. Diabetologia 1999, 42, 849–855.
Wolf, G.; Aumann, N.; Michalska, M.; Bast, A.; Sonnemann, J.; Beck, J.F.; Lendeckel, U.; Newsholme, P.;
Walther, R. Peroxiredoxin III protects pancreatic ss cells from apoptosis. J. Endocrinol. 2010, 207, 163–175.
[PubMed]
Li, X.; Chen, H.; Epstein, P.N. Metallothionein and catalase sensitize to diabetes in nonobese diabetic mice
reactive oxygen species may have a protective role in pancreatic β-cells. Diabetes 2006, 55, 1592–1604.
[PubMed]
Ibrahim, M.A.; Koorbanally, N.A.; Islam, M.S. Antioxidative activity and inhibition of key enzymes linked
to type-2 diabetes (α-glucosidase and α-amylase) by Khaya senegalensis. Acta Pharm. 2014, 64, 311–324.
[CrossRef]
Choi, H.K.; Willett, W.C.; Stampfer, M.J.; Rimm, E.; Hu, F.B. Dairy consumption and risk of type 2 diabetes
mellitus in men a prospective study. Arch. Intern. Med. 2005, 165, 997–1003. [PubMed]
Tremblay, A.; Gilbert, J.A. Milk products; insulin resistance syndrome and type 2 diabetes. J. Am. Coll. Nutr.
2009, 28 (Suppl. S1), 91S–102S. [PubMed]
Nasri, R.; Abdelhedi, O.; Jemil, I.; Daoued, I.; Hamden, K.; Kallel, C.; Elfeki, A.; Lamri-Senhadji, M.;
Boualga, A.; Nasri, M.; et al. Ameliorating effects of goby fish protein hydrolysates on high-fat-high-fructose
diet-induced hyperglycemia; oxidative stress and deterioration of kidney function in rats. Chem-Biol. Interact.
2015, 24, 271–280.
376
Mar. Drugs 2017, 15, 88
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
Ben, Khaled, H.; Ghlissi, Z.; Chtourou, Y.; Hakim, A.; Ktari, N.; Fatma, M.A.; Barkia, A.; Sahnoun, Z.;
Nasri, M. Effect of protein hydrolysates from sardinelle (Sardinella. aurita) on the oxidative status and blood
lipid profile of cholesterol-fed rats. Food Res. Int. 2012, 45, 60–68.
Ktari, N.; Nasri, R.; Mnafgui, K.; Hamden, K.; Belguith, O.; Boudaouara, T.; El, Feki, A.; Nasri, M.
Antioxidative and ACE inhibitory activities of protein hydrolysates from zebra blenny (Salaria. basilisca) in
alloxan-induced diabetic rats. Process Biochem. 2014, 49, 890–897.
Oseguera, Toledo, M.E.; Gonzalez de Mejia, E.; Sivaguru, M.; Amaya-Llano, S.L. Common bean
(Phaseolus. vulgaris L.) protein-derived peptides increased insulin secretion; inhibited lipid accumulation;
increased glucose uptake and reduced the phosphatase and tensin homologue activation in vitro.
J. Func. Foods 2016, 27, 160–177.
Fernández-Tomé, S.; Ramos, S.; Cordero-Herrera, I.; Recio, I.; Goya, L.; Hernández-Ledesma, B. In vitro
chemo-protective effect of bioactive peptide lunasin against oxidative stress in human HepG2 cells.
Food Res. Int. 2014, 62, 793–800.
Lee, K.W.; Kim, S.J. Uptake of modified LDLs in HepG2 cells and cholesterol accumulation by modified
LDLs in THP-1 macrophages. Toxicol. Lett. 2010, 196, s243. [CrossRef]
Han, D.N.; Zhang, D.H.; Wang, L.P.; Zhang, Y.S. Protective effect of β-casomorphin-7 on cardiomyopathy of
streptozotocin-induced diabetic rats via inhibition of hyperglycemia and oxidative stress. Peptides 2013, 44,
120–126. [CrossRef]
Donath, M.Y.; Storling, J.; Maedler, K.; Mandrup-Poulsen, T. Inflammatory mediators and islet β-cell failure
a link between type 1 and type 2 diabetes. J. Mol. Med. (Berl.). 2003, 81, 455–470. [CrossRef]
Cherng, J.Y.; Liu, C.C.; Shen, C.R.; Lin, H.H.; Shih, M.F. Beneficial effects of Chlorella-11 peptide on blocking
LPS-induced macrophage activation and alleviating thermal injury-induced inflammation in rats. Int. J.
Immuno. Pathol. Pharmacol. 2010, 23, 811–820. [CrossRef] [PubMed]
Polyzos, S.A.; Kountouras, J.; Mantzoros, C.S. Adipokines in nonalcoholic fatty liver disease. Metabolism
2016, 65, 1062–1079. [PubMed]
Moran, T.H.; Dailey, M.J. Minireview Gut peptides targets for antiobesity drug development? Endocrinology
2009, 150, 2526–2530. [PubMed]
Perry, B.; Wang, Y. Appetite regulation and weight control the role of gut hormones. Nutr. Diabetes 2012, 2,
e26. [CrossRef] [PubMed]
Troke, R.C.; Tan, T.M.; Bloom, S.R. The future role of gut hormones in the treatment of obesity. Ther. Adv.
Chronic Dis. 2014, 5, 4–14.
Nongonierma, A.B.; FitzGerald, R.J. Inhibition of dipeptidyl peptidase IV (DPP-IV) by proline containing
casein-derived peptides. J. Funct. Foods 2013, 5, 1909–1917.
Omar, B.; Ahlkvist, L.; Yamada, Y.; Seino, Y.; Ahren, B. Incretin hormone receptors are required for normal β
cell development and function in female mice. Peptides 2016, 79, 58–65. [CrossRef] [PubMed]
Liddle, R.A.; Carter, J.D.; McDonald, A.R. Natural regulation of rat intestinal cholecystokinin gene expression.
J. Clin. Invest. 1988, 81, 2015–2019.
Caron, J.; Domenger, D.; Belguesmia, Y.; Kouach, M.; Lesage, J.; Goossens, J.F.; Dhulster, P.; Ravallec, R.;
Cudennec, B. Protein digestion and energy homeostasis How generated peptides may impact intestinal
hormones? Food Res. Int. 2016, 88, 310–318.
Harnedy, P.A.; O'Keeffe, M.B.; FitzGerald, R.J. Purification and identification of dipeptidyl peptidase (DPP)
IV inhibitory peptides from the macroalga Palmaria. palmata. Food Chem. 2015, 172, 400–406. [PubMed]
Wang, T.Y.; Hsieh, C.H.; Hung, C.C.; Jao, C.L.; Chen, M.C.; Hsu, K.C. Fish skin gelatin hydrolysates as
dipeptidyl peptidase IV inhibitors and glucagon-like peptide-1 stimulators improve glycaemic control in
diabetic rats: A comparison between warm- and cold-water fish. J. Func. Foods 2015, 18, 330–340.
Huang, S.L.; Jao, C.L.; Ho, K.P.; Hsu, K.C. Dipeptidyl-peptidase IV inhibitory activity of peptides derived
from tuna cooking juice hydrolysates. Peptides 2012, 35, 114–121. [CrossRef] [PubMed]
Jin, Y.; Yan, J.; Yu, Y.; Qi, Y. Screening and identification of DPP-IV inhibitory peptides from deer skin
hydrolysates by an integrated approach of LC–MS/MS and in silico analysis. J. Funct. Foods 2015, 18,
344–357. [CrossRef]
Lacroix, I.M.; Li-Chan, E.C. Overview of food products and natural constituents with antidiabetic properties
and their putative mechanisms of action a natural approach to complement pharmacotherapy in the
management of diabetes. Mol. Nutr. Food Res. 2014, 58, 61–78. [CrossRef] [PubMed]
377
Mar. Drugs 2017, 15, 88
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
Uchida, M.; Ohshiba, Y.; Mogami, O. Novel dipeptidyl peptidase-4-inhibiting peptide derived from
β-lactoglobulin. J. Pharmacol. Sci. 2011, 117, 63–66. [CrossRef] [PubMed]
Silveira, S.T.; Martinez-Maqueda, D.; Recio, I.; Hernandez-Ledesma, B. Dipeptidyl peptidase-IV inhibitory
peptides generated by tryptic hydrolysis of a whey protein concentrate rich in β-lactoglobulin. Food Chem.
2013, 141, 1072–1077. [PubMed]
Uenishi, K. Diabetes mellitus and osteoporosis. Natural therapy of diabetes related osteoporosis.
Clin. Calcium. 2012, 22, 1398–1402. [PubMed]
Lacroix, I.M.; Li-Chan, E.C. Inhibition of dipeptidyl peptidase (DPP)-IV and α-glucosidase activities by
pepsin-treated whey proteins. J. Agric. Food Chem. 2013, 61, 7500–7506. [CrossRef]
Lacroix, I.M.; Li-Chan, E.C. Isolation and characterization of peptides with dipeptidyl peptidase-IV inhibitory
activity from pepsin-treated bovine whey proteins. Peptides 2014, 54, 39–48. [CrossRef] [PubMed]
Lacroix, I.M.; Li-Chan, E.C. Comparison of the susceptibility of porcine and human dipeptidyl-peptidase IV
to inhibition by protein-derived peptides. Peptides 2015, 69, 19–25. [PubMed]
Lacroix, I.M.E.; Meng, G.; Cheung, I.W.Y.; Li-Chan, E.C.Y. Do whey protein-derived peptides have dual
dipeptidyl-peptidase IV and angiotensin I-converting enzyme inhibitory activities? J. Funct. Foods 2016, 21,
87–96. [CrossRef]
Tulipano, G.; Sibilia, V.; Caroli, A.M.; Cocchi, D. Whey proteins as source of dipeptidyl dipeptidase IV
(dipeptidyl peptidase-4) inhibitors. Peptides 2011, 32, 835–838. [CrossRef] [PubMed]
Le Maux, S.; Nongonierma, A.B.; FitzGerald, R.J. Improved short peptide identification using HILIC-MS/MS
retention time prediction model based on the impact of amino acid position in the peptide sequence.
Food Chem. 2015, 17, 3847–3854. [CrossRef]
Nongonierma, A.B.; FitzGerald, R.J. Dipeptidyl peptidase IV inhibitory and antioxidative properties of milk
protein-derived dipeptides and hydrolysates. Peptides 2013, 39, 157–163. [CrossRef] [PubMed]
Nongonierma, A.B.; Mooney, C.; Shields, D.C.; FitzGerald, R.J. In silico approaches to predict the potential
of milk protein-derived peptides as dipeptidyl peptidase IV (DPP-IV) inhibitors. Peptides 2014, 57, 43–51.
[CrossRef] [PubMed]
Nongonierma, A.B.; FitzGerald, R.J. Strategies for the discovery; identification and validation of milk
protein-derived bioactive peptides. Trends. Food Sci. Tec. 2016, 50, 26–43.
De Souza Rocha, T.; Hernandez, L.M.R.; Chang, Y.K.; de Mejía, E.G. Impact of germination and enzymatic
hydrolysis of cowpea bean (Vigna. unguiculata) on the generation of peptides capable of inhibiting dipeptidyl
peptidase IV. Food Res. Int. 2014, 64, 799–809.
Nongonierma, A.B.; Le, Maux, S.; Dubrulle, C.; Barre, C.; FitzGerald, R.J. Quinoa (Chenopodium. quinoa
Willd.) protein hydrolysates with In Vitro dipeptidyl peptidase IV (DPP-IV) inhibitory and antioxidant
properties. J. Cereal Sci. 2015, 65, 112–118.
Hatanaka, T.; Inoue, Y.; Arima, J.; Kumagai, Y.; Usuki, H.; Kawakami, K.; Kimura, M.; Mukaihara, T.
Production of dipeptidyl peptidase IV inhibitory peptides from defatted rice bran. Food Chem. 2012, 134,
797–802. [PubMed]
Velarde-Salcedo, A.J.; Barrera-Pacheco, A.; Lara-Gonzalez, S.; Montero-Morán, G.M.; Díaz-Gois, A.;
de Mejia, E.G.; Barba, de la Rosa, A.P. In Vitro inhibition of dipeptidyl peptidase IV by peptides derived
from the hydrolysis of amaranth (Amaranthus hypochondriacus L.) proteins. Food Chem. 2013, 136, 758–764.
[CrossRef] [PubMed]
Zeng, Z.; Shuai, T.; Yi, L.J.; Wang, Y.; Song, G.M. Effect of case management on patients with type 2 diabetes
mellitus: A meta-analysis. Chinese Nursing Research 2016, 3, 71–76.
Jong-Yuh, C.; Mei-Fen, S. Potential hypoglycemic effects of Chlorella in streptozotocin-induced diabetic mice.
Life Sci. 2005, 77, 980–990. [CrossRef]
Jeong, H.; Kwon, H.J.; Kim, M.K. Hypoglycemic effect of Chlorella vulgaris intake in type 2 diabetic
Goto-Kakizaki and normal Wistar rats. Nutr. Res. Prac. 2009, 3, 23–30.
Lu, J.; Zeng, Y.; Hou, W.; Zhang, S.; Li, L.; Luo, X.; Xi, W.; Chen, Z.; Xiang, M. The soybean peptide aglycin
regulates glucose homeostasis in type 2 diabetic mice via IR/IRS1 pathway. J. Nutr. Biochem. 2012, 23,
1449–1457. [CrossRef] [PubMed]
Veloso, R.V.; Latorraca, M.Q.; Arantes, V.C.; Reis, M.A.; Ferreira, F.; Boschero, A.C.; Carneiro, E.M.
Soybean diet improves insulin secretion through activation of cAMP/PKA pathway in rats. J. Nutr. Biochem.
2008, 19, 778–784. [PubMed]
378
Mar. Drugs 2017, 15, 88
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
92.
93.
Roblet, C.; Akhtar, M.J.; Mikhaylin, S.; Pilon, G.; Gill, T.; Marette, A.; Bazinet, L. Enhancement of glucose
uptake in muscular cell by peptide fractions separated by electrodialysis with filtration membrane from
salmon frame protein hydrolysate. J. Funct. Foods 2016, 22, 337–346.
Kwon, D.Y.; Daily, J.W.; Kim, H.J.; Park, S. Antidiabetic effects of fermented soybean products on type 2
diabetes. Nutr. Res. 2010, 30, 1–13. [CrossRef]
Martinez-Villaluenga, C.; Bringe, N.A.; Berhow, M.A.; Gonzalez, de Mejia, E. B-conglycinin embeds active
peptides that inhibit lipid accumulation in 3T3-L1 adipocytes In Vitro. J. Agric. Food Chem. 2008, 56,
10533–10543. [CrossRef] [PubMed]
Martinez-Villaluenga, C.; Dia, V.P.; Berhow, M.; Bringe, N.A.; Gonzalez de Mejia, E. Protein hydrolysates
from β-conglycinin enriched soybean genotypes inhibit lipid accumulation and inflammation In Vitro.
Mol. Nutr. Food Res. 2009, 53, 1007–1018. [CrossRef] [PubMed]
Kim, E.D.; Kim, E.; Lee, J.H.; Hyun, C.K. Gly-Ala-Gly-Val-Gly-Tyr: A novel synthetic peptide; improves
glucose transport and exerts beneficial lipid metabolic effects in 3T3-L1 adipoctyes. Eur. J. Pharmacol. 2011,
650, 479–485. [CrossRef]
Hammé, V.; Sannier, F.; Piot, J.M.; Bordenave-Juchereau, S. Effects of lactokinins from fermented acid goat
whey on lipid content and adipogenesis of immortalised human adipocytes. Int. Dairy J. 2010, 20, 642–645.
[CrossRef]
Yim, M.J.; Hosokawa, M.; Mizushina, Y.; Yoshida, H.; Saito, Y.; Miyashita, K. Suppressive effects of
Amarouciaxanthin A on 3T3-L1 adipocyte differentiation through downregulation of PPARγ and C/EBPα
mRNA expression. J. Agric. Food Chem. 2011, 59, 1646–1652. [PubMed]
Ben, Henda, Y.; Laamari, M.; Lanneluc, I.; Travers, M.A.; Agogué, H.; Arnaudin, I.; Bridiau, N.; Maugard, T.;
Piot, J.M.; Sannier, F.; et al. Di and tripeptides from marine sources can target adipogenic process and
contribute to decrease adipocyte number and functions. J. Funct. Foods 2015, 17, 1–10.
Wang, L.L.; Hao, S.; Zhang, S.; Guo, L.J.; Hu, C.Y.; Zhang, G.; Gao, B.; Zhao, J.J.; Jiang, Y.; Tian, W.G.; et al.
PTEN/PI3K/AKT protein expression is related to clinicopathologic features and prognosis in breast cancer
with axillary lymph node metastases. Hum. Pathol. 2017, 61, 49–57. [PubMed]
Govers, R. Molecular mechanisms of GLUT4 regulation in adipocytes. Diabetes Metab. 2014, 40, 400–410.
[CrossRef]
Morino, K.; Neschen, S.; Bilz, S.; Sono, S.; Tsirigotis, D.; Reznick, R.M.; Moore, I.; Nagai, Y.; Samuel, V.;
Sebastian, D.; et al. Muscle-specific IRS-1 Ser->Ala transgenic mice are protected from fat-induced insulin
resistance in skeletal muscle. Diabetes 2008, 57, 2644–2651. [CrossRef] [PubMed]
Bozulic, L.; Hemmings, B.A. PIKKing on PKB regulation of PKB activity by phosphorylation. Curr. Opin.
Cell Biol. 2009, 21, 256–261. [PubMed]
Davis, J.; Higginbotham, A.; O'Connor, T.; Moustaid-Moussa, N.; Tebbe, A.; Kim, Y.C.; Cho, K.W.; Shay, N.;
Adler, S.; Peterson, R.; et al. Soy protein and isoflavones influence adiposity and development of metabolic
syndrome in the obese male ZDF rat. Ann. Nutr. Metab. 2007, 51, 42–52. [PubMed]
Nordentoft, I.; Jeppesen, P.B.; Hong, J.; Abudula, R.; Hermansen, K. Increased insulin sensitivity and
changes in the expression profile of key insulin regulatory genes and β cell transcription factors in diabetic
KKAy-mice after feeding with a soy bean protein rich diet high in isoflavone content. J. Agric. Food Chem.
2008, 56, 4377–4385. [CrossRef] [PubMed]
Han, B.K.; Lee, H.J.; Lee, H.S.; Suh, H.J.; Park, Y. Hypoglycaemic effects of functional tri-peptides from silk
in differentiated adipocytes and streptozotocin-induced diabetic mice. J. Sci. Food Agric. 2016, 96, 116–121.
Huang, K.C.; Huang, H.J.; Chen, C.C.; Chang, C.T.; Wang, T.Y.; Chen, R.H.; Chen, Y.C.; Tsai, F.J. Susceptible
gene of stasis-stagnation constitution from genome-wide association study related to cardiovascular
disturbance and possible regulated traditional Chinese medicine. BMC Complement. Altern. Med. 2015, 15,
229. [CrossRef] [PubMed]
McCurdy, C.E.; Klemm, D.J. Adipose tissue insulin sensitivity and macrophage recruitment Does PI3K pick
the pathway? Adipocyte 2013, 21, 135–142.
Zhang, Y.; Hai, J.; Cao, M.; Zhang, Y.; Pei, S.; Wang, J.; Zhang, Q. Silibinin ameliorates steatosis and insulin
resistance during non-alcoholic fatty liver disease development partly through targeting IRS-1/PI3K/Akt
pathway. Int. Immunopharmacol. 2013, 17, 714–720. [PubMed]
379
Mar. Drugs 2017, 15, 88
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
111.
112.
113.
Ishihara, K.; Oyaizu, S.; Fukuchi, Y.; Mizunoya, W.; Segawa, K.; Takahashi, M.; Mita, Y.; Fukuya, Y.; Fushiki, T.;
Yasumoto, K. A soybean peptide isolate diet promotes postprandial carbohydrate oxidation and energy
expenditure in type II diabetic mice. J. Nutr. 2003, 133, 752–757. [PubMed]
Zhu, K.N.; Jiang, C.H.; Tian, Y.S.; Xiao, N.; Wu, Z.F.; Ma, Y.L.; Lin, Z.; Fang, S.Z.; Shang, X.L.; Liu, K.; et al.
Two triterpeniods from Cyclocarya paliurus (βl) Iljinsk (Juglandaceae) promote glucose uptake in 3T3-L1
adipocytes: The relationship to AMPK activation. Phytomedicine 2015, 22, 837–846.
Butler, A.E.; Janson, J.; Bonner-Weir, S.; Ritzel, R.; Rizza, R.A.; Butler, P.C. β-cell deficit and increased β-cell
apoptosis in humans with type 2 diabetes. Diabetes 2003, 52, 102–110. [PubMed]
Mizoguchi, T.; Takehara, I.; Masuzawa, T.; Saito, T.; Naoki, Y. Nutrigenomic studies of effects of Chlorella on
subjects with high-risk factors for lifestyle-related disease. J. Med. Food 2008, 11, 395–404. [PubMed]
Panahi, Y.; Ghamarchehreh, M.E.; Beiraghdar, F.; Zare, R.; Jalalian, H.R.; Sahebkar, A. Investigation of the
effects of Chlorella vulgaris supplementation in patients with non-alcoholic fatty liver disease: A randomized
clinical trial. Hepatogastroenterology 2012, 59, 2099–2103. [PubMed]
Ebrahimi-Mameghani, M.; Sadeghi, Z.; Farhangi, M.A.; Vaghef-Mehrabany, E.; Aliashrafi, S.
Glucose homeostasis, insulin resistance and inflammatory biomarkers in patients with non-alcoholic fatty
liver disease: Beneficial effects of supplementation with microalgae Chlorella vulgaris: A double-blind
placebo-controlled randomized clinical trial. Clin. Nutr. 2016. [CrossRef]
Jo, B.H.; Lee, C.S.; Song, H.R.; Lee, H.G.; Oh, H.M. Development of novel microsatellite markers for
strain-specific identification of Chlorella vulgaris. J. Microbiol. Biotechnol. 2014, 24, 1189–1195.
Kim, M.; Kim, E.; Kwak, H.S.; Jeong, Y. The ingredients in Saengshik; a formulated health food; inhibited
the activity of α-amylase and α-glucosidase as anti-diabetic function. Nutr. Res. Pract. 2014, 8, 602–606.
[PubMed]
Ren, Y.; Liang, K.; Jin, Y.; Zhang, M.; Chen, Y.; Wu, H.; Lai, F. Identification and characterization of two novel
α-glucosidase inhibitory oligopeptides from hemp (Cannabis sativa L.) seed protein. J. Funct. Foods 2016, 26,
439–450. [CrossRef]
Ngoh, Y.Y.; Gan, C.Y. Enzyme-assisted extraction and identification of antioxidative and α-amylase inhibitory
peptides from Pinto beans (Phaseolus. vulgaris cv. Pinto). Food Chem. 2016, 190, 331–337. [PubMed]
Siow, H.L.; Gan, C.Y. Extraction; identification; and structure–activity relationship of antioxidative and
α-amylase inhibitory peptides from cumin seeds (Cuminum. cyminum). J. Funct. Foods 2016, 22, 1–12.
[CrossRef]
Siow, H.L.; Lim, T.S.; Gan, C.Y. Development of a workflow for screening and identification of α-amylase
inhibitory peptides from food source using an integrated Bioinformatics-phage display approach Case
study-Cumin seed. Food Chem. 2017, 214, 67–76. [CrossRef]
Mojica, L.; de Mejia, E.G. Optimization of enzymatic production of anti-diabetic peptides from black bean
(Phaseolus. vulgaris L.) proteins; their characterization and biological potential. Food. Funct. 2016, 7, 713–727.
Uraipong, C.; Zhao, J. Rice bran protein hydrolysates exhibit strong in vitro α-amylase; β-glucosidase and
ACE-inhibition activities. J. Sci. Food Agric. 2016, 96, 1101–1110. [CrossRef]
Yu, Z.; Yin, Y.; Zhao, W.; Liu, J.; Chen, F. Anti-diabetic activity peptides from albumin against α-glucosidase
and α-amylase. Food Chem. 2012, 135, 2078–2085. [CrossRef]
Mojica, L.; Luna-Vital, D.A.; Gonzalez de Mejia, E. Characterization of peptides from common bean protein
isolates and their potential to inhibit markers of type-2 diabetes; hypertension and oxidative stress. J. Sci.
Food Agric. 2016. [CrossRef]
Engel, M.; Hoffmann, T.; Wagner, L.; Wermann, M.; Heiser, U.; Kiefersauer, R.; Huber, R.; Bode, W.;
Demuth, H.U.; Brandstetter, H. The crystal structure of dipeptidyl peptidase IV (CD26) reveals its functional
regulation and enzymatic mechanism. Proc. Natl. Acad. Sci. USA 2003, 100, 5063–5068. [CrossRef]
Juillerat-Jeanneret, L. Dipeptidyl peptidase IV and its inhibitors therapeutics for type 2 diabetes and what
else? J. Med. Chem. 2014, 57, 2197–2212.
Nongonierma, A.B.; FitzGerald, R.J. Susceptibility of milk protein-derived peptides to dipeptidyl peptidase
IV (DPP-IV) hydrolysis. Food Chem. 2014, 145, 845–852.
Lu, I.L.; Tsai, K.C.; Chiang, Y.K.; Jiaang, W.T.; Wu, S.H.; Mahindroo, N.; Chien, C.H.; Lee, S.J.; Chen, X.;
Chao, Y.S.; et al. A three-dimensional pharmacophore model for dipeptidyl peptidase IV inhibitors. Eur. J.
Med. Chem. 2008, 43, 1603–1611. [CrossRef]
380
Mar. Drugs 2017, 15, 88
114. Nongonierma, A.B.; Gaudel, C.; Murray, B.A.; Flynn, S.; Kelly, P.M.; Newsholme, P.; FitzGerald, R.J.
Insulinotropic properties of whey protein hydrolysates and impact of peptide fractionation on insulinotropic
response. Int. Dairy J. 2013, 32, 163–168.
115. Dixon, G.; Nolan, J.; McClenaghan, N.; Flatt, P.R.; Newsholme, P. A comparative study of amino acid
consumption by rat islet cells and the clonal β-cell line BRIN-BD11-the functional significance of L-alanine.
J. Endocrinol. 2003, 179, 447–454.
116. Bender, K.; Newsholme, P.; Brennan, L.; Maechler, P. The importance of redox shuttles to pancreatic β-cell
energy metabolism and function. Biochem. Soc. Trans. 2006, 34, 811–814. [CrossRef]
117. Power, O.; Hallihan, A.; Jakeman, P. Human insulinotropic response to oral ingestion of native and
hydrolysed whey protein. Amino Acids 2009, 37, 333–339. [CrossRef]
118. Horner, K.; Drummond, E.; Brennan, L. Bioavailability of milk protein-derived bioactive peptides a glycaemic
management perspective. Nutr. Res. Rev. 2016, 29, 91–101. [CrossRef]
119. Manders, R.J.; Koopman, R.; Sluijsmans, W.E.; van den Berg, R.; Verbeek, K.; Saris, W.H.; Wagenmakers, A.J.;
van Loon, L.J. Co-ingestion of a protein hydrolysate with or without additional leucine effectively reduces
postprandial blood glucose excursions in Type 2 diabetic men. J. Nutr. 2006, 136, 1294–1299.
120. Manders, R.J.; Praet, S.F.; Meex, R.C.; Koopman, R.; De Roos, A.L.; Wagenmakers, A.J.; Saris, W.H.;
Van Loon, L.J. Protein hydrolysate/leucine co-ingestion reduces the prevalence of hyperglycemia in type 2
diabetic patients. Diabetes Care 2006, 29, 2721–2722.
121. Ngoh, Y.Y.; Lim, T.S.; Gan, C.Y. Screening and identification of five peptides from pinto bean with inhibitory
activities against α-amylase using phage display technique. Enzyme. Microb. Technol. 2016, 89, 76–84.
122. Ochiai, T.; Sugita, T.; Kato, R.; Okochi, M.; Honda, H. Screening of an α-amylase inhibitor peptide by
photolinker-peptide array. Biosci. Biotechnol. Biochem. 2012, 76, 819–824. [CrossRef]
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
381
marine drugs
Article
In Vitro Antioxidant Activities of Enzymatic
Hydrolysate from Schizochytrium sp. and Its
Hepatoprotective Effects on Acute Alcohol-Induced
Liver Injury In Vivo
Xixi Cai 1,2 , Ana Yan 2 , Nanyan Fu 1 and Shaoyun Wang 2, *
1
2
*
The Key Lab of Analysis and Detection Technology for Food Safety of the MOE, College of Chemistry,
Fuzhou University, Fuzhou 350108, China; caixx_0123@163.com (X.C.); nanyan_fu@fzu.edu.cn (N.F.)
College of Biological Science and Technology, Fuzhou University, Fuzhou 350108, China;
m18144065085@163.com
Correspondence: shywang@fzu.edu.cn; Tel.: +86-591-2286-6375
Academic Editors: Se-Kwon Kim and Anake Kijjoa
Received: 1 October 2016; Accepted: 7 April 2017; Published: 10 April 2017
Abstract: Schizochytrium protein hydrolysate (SPH) was prepared through stepwise enzymatic
hydrolysis by alcalase and flavourzyme sequentially. The proportion of hydrophobic amino acids of
SPH was 34.71%. The molecular weight (MW) of SPH was principally concentrated at 180–3000 Da
(52.29%). SPH was divided into two fractions by ultrafiltration: SPH-I (MW < 3 kDa) and SPH-II
(MW > 3 kDa). Besides showing lipid peroxidation inhibitory activity in vitro, SPH-I exhibited high
DPPH and ABTS radicals scavenging activities with IC50 of 350 µg/mL and 17.5 µg/mL, respectively.
In addition, the antioxidant activity of SPH-I was estimated in vivo using the model of acute
alcohol-induced liver injury in mice. For the hepatoprotective effects, oral administration of SPH-I at
different concentrations (100, 300 mg/kg BW) to the mice subjected to alcohol significantly decreased
serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities and hepatic
malondialdehyde (MDA) level compared to the untreated mice. Besides, SPH-I could effectively
restore the hepatic superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-Px)
activities and glutathione (GSH) level. Results suggested that SPH was rich in biopeptides that could
be exploited as antioxidant molecules against oxidative stress in human body.
Keywords: Schizochytrium; protein hydrolysate; antioxidant; hepatoprotective effects; alcohol-induced
liver injury
1. Introduction
Schizochytrium sp., a kind of heterotrophic marine fungus, is well known for the production of Ω-3
fatty acids, pigments, proteins, polysaccharides, etc. [1,2]. A number of researchers have focused on
the industrial production of docosahexaenoic acid for Schizochytrium sp. studies [3]. However, there is
little information on the utilization of Schizochytrium sp. byproduct. In addition to a high content
of fat, Schizochytrium sp. also contains a high amount of protein, which is about 40% (dry weight).
Therefore, great efforts are needed to transform these biological wastes into value-added bioproducts.
Thus, the utilization of protein recovered from the defatted byproduct presents an opportunity to
develop pharmaceutical products and food ingredients.
Free radicals such as the superoxide anion radical (O2 ·− ) and hydroxyl radical (·OH) are highly
reactive oxygen species (ROS) with single and unpaired electrons that are involved in biological
oxidation process and can cause many adverse effects on food and biological systems [4]. In human
organs, free radicals, which are inevitably produced through oxidative metabolism, can induce several
Mar. Drugs 2017, 15, 115
382
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2017, 15, 115
diseases such as arteriosclerosis and cancer. Liver injury is a widespread disease that can be caused by
an overload of xenobiotics, such as alcohol, CCl4 , and bromobenzene. Alcohol-induced liver injury
has been one of the most frequent causes of liver diseases. The mechanism of liver dysfunction
induced by alcohol is thought to involve the generation of free radicals, oxidative stress, and lipid
peroxidation [5,6]. More attention has been paid to search for safe antioxidants for effective therapy of
oxidative stress-induced diseases. Small molecules with strong antioxidant activities from plants [7,8]
and algal [9] have been widely investigated. In addition, preparation of bioactive peptides from
proteins through enzymatic hydrolysis has been a hot topic. Peptides from the hydrolysates of Alaska
Pollock skin collagen [10], egg white protein [11], chickpea protein [12], and algae protein waste [13]
have been prepared and shown to possess antioxidant activities in different oxidation systems.
In this study, Schizochytrium sp. byproduct protein hydrolysate was prepared by stepwise
enzymatic hydrolysis. The in vitro antioxidant activities of the enzymatic hydrolysates and the
hepatoprotective effects on acute alcohol-induced liver injury in vivo were evaluated. The present
study suggests that Schizochytrium protein hydrolysates have the potential in increasing resistivity
against oxidative stress in the human body.
2. Results and Discussion
2.1. Analyses of Amino Acid Composition and Molecular Weight Distribution of SPH
Schizochytrium sp. protein isolates (SP) were enzymatically hydrolyzed by alcalase and
flavourzyme sequentially for the preparation of antioxidant peptides. It has been recognized that the
amino acid composition of the peptides plays critical roles in their antioxidant activities. The amino
acid composition of SPH was determined by amino acid automatic analyzer. Results showed that SPH
was rich in Glx and Asx, which accounted for 17.66% and 15.89%, respectively (Table 1). In addition, the
total hydrophobic amino acids content in SPH constituted 34.71%. Udenigwe et al. [14] indicated that
acidic amino acids such as Glu and Asp contributed to the antioxidant activities of peptides due to the
presence of excess electrons which could be donated during interaction with free radicals. For protein
hydrolysates and peptides, an increase in hydrophobicity would increase their interaction with lipid
targets or entry of the peptides into target organs through hydrophobic associations, which was
good for enhancing their antioxidant effects [15–17]. In addition, SPH contained 5.79% Lys and
7.81% Arg. Reports have demonstrated that peptides containing amino acids with carboxyl or amino
side chains, such as Glu, Gln, Lys, and Arg, could donate electrons or hydrogen atoms to interact
with pro-oxidants and inactivate their activity [18–20]. Moreover, the amino acids that contained
nucleophilic sulphur-containing side chains (Met and Cys), aromatic side chains (Phe and Tyr),
or imidazole-containing side chains (His) could donate electron to convert radicals into stable
molecules [21].
Table 1. Amino acid composition of Schizochytrium protein hydrolysate (SPH).
Amino Acids
Content (%)
Ile
Leu
Met
Phe
Thr
Val
Lys
Cys
Tyr
Asx a
Ser
Glx b
3.52
9.96
1.35
5.27
3.93
5.17
5.79
0.62
2.72
15.89
5.42
17.66
383
Mar. Drugs 2017, 15, 115
Table 1. Cont.
a
Amino Acids
Content (%)
Gly
Ala
Pro
Arg
His
THAA c
Total
3.88
5.28
4.16
7.81
1.57
34.71
100
Asx: containing Asp and Asn; b Glx: containing Glu and Gln; c THAA: total hydrophobic amino acid.
Besides amino acid composition, the molecular weight of peptides is also a significant factor that
reflects the antioxidant activities of peptides. MW distribution of SPH was determined using HPLC
and the results are shown in Figure 1. The fraction of peptides with MW ranging from 180 to 3000 Da
was abundant in SPH, accounting for 52.29%. There are several reports suggesting that peptides with
low MW have stronger antioxidant activities than their high MW counterparts. In fact, peptides with
low MW could cross the intestinal barrier and further exert their antioxidant effects [22,23].
Content (%)
30
20
10
0
>10000
10000-3000 3000-1000
1000-500
500-180
<180
Molecular weight (Da)
Figure 1. Molecular mass distribution of SPH.
2.2. In Vitro Antioxidant Activities of SPH and Its Fractions
The degrees of hydrolysis (DHs) and DPPH radical scavenging activity of hydrolysate were
studied at different hydrolysis stages (Data not shown). The DPPH radical scavenging activity increased
from 12.16% (SP) to 38.08% after the first step of hydrolysis by alcalase and the DH reached 8.37%. The
activity was further enhanced to 58.06% at the second step of hydrolysis by flavourzyme with a DH of
21.48%.
In order to study the effect of MW on the antioxidant activities of the peptides, SPH was further
fractionated by ultrafiltration to obtain SPH-I (MW < 3 kDa) and SPH-II (MW > 3 kDa). To evaluate the
antioxidant activities of SPH and its fractions in vitro, different antioxidant parameters were obtained.
2.2.1. Free Radical Scavenging Activities
The ability of SPH and its fractions to scavenge DPPH and ABTS radicals is shown in Figure 2.
DPPH and ABTS radicals scavenging activities of SPH and its fractions increased in a concentration
dependent manner. SPH-I (MW < 3 kDa) had higher DPPH and ABTS radicals scavenging activities
than SPH and SPH-II (MW > 3 kDa) at the same concentration. A lower IC50 value was indicative
of higher scavenging activity, and the IC50 values of SPH-I against DPPH and ABTS radicals were
350 µg/mL and 17.5 µg/mL, respectively. These results indicated that free radical scavenging activities
of peptides were related to their MW. Similar results were reported by Li et al. [12], who found that
384
Mar. Drugs 2017, 15, 115
the fraction with low MW of chickpea protein hydrolysate had the highest DPPH radical scavenging
activity compared to other fractions. In addition, the peptides with MW < 1 kDa from egg white
protein hydrolysate and ethanol-soluble proteins hydrolysate of the Sphyrna lewini muscle were found
to exhibit higher antioxidant activities than the high MW fractions [11,24].
(b)
100
80
SPH
SPH-I
SPH-II
60
40
20
0
0.0
0.2
0.4
0.6
0.8
1.0
ABTS radical scavenging activity (%)
DPPH radical scavenging activity (%)
(a)
100
SPH
SPH-I
SPH-II
80
60
40
20
0
10
Concentration (mg/mL)
20
30
40
50
Concentration (ȝg/mL)
Figure 2. Free radical scavenging activities of SPH and its fractions. (a) 1,1-diphenyl-2-picrylhydrazyl
(DPPH) radical scavenging activity; (b) 2,2′ -azinobis-3-ethylbenzthiazoline-6-sulphonate (ABTS) radical
scavenging activity.
2.2.2. Reducing Power
Reducing power was measured to evaluate the capacity of compounds to donate electrons or
hydrogen atoms, and was related to their ability to inhibit the transformation of Fe3+ to Fe2+ [21,23].
The reducing power of SPH and its fractions was determined and the results are shown in Figure 3.
SPH-I had the highest reducing power as compared with SPH and SPH-II in a concentration dependent
manner. At the concentration of 1 mg/mL, the absorbance at 700 nm of SPH, SPH-I, and SPH-II was
0.43, 0.54, and 0.33, respectively. This result suggested that all three fractions have the potential to react
with free radicals and block radical chain reactions.
0.7
SPH
SPH-I
SPH-II
Absorbance at 700 nm
0.6
0.5
0.4
0.3
0.2
0.1
0.2
0.4
0.6
0.8
1.0
Concentration (mg/mL)
Figure 3. Reducing power of SPH and its fractions.
2.2.3. Inhibition of Linoleic Acid Peroxidation
Lipid peroxidation was thought to proceed via radical mediated abstraction of hydrogen atoms
from methylene carbons in polyunsaturated fatty acids [16]. The process of lipid peroxidation generated
385
Mar. Drugs 2017, 15, 115
a series of potentially toxic substances such as electrophilic aldehydes and ketones [25,26]. The
inhibitory ability of SPH and its fractions on lipid peroxidation was determined in a linoleic acid
system. As shown in Figure 4, the control had the highest absorbance at 500 nm, indicating the highest
oxidation degree, while the samples with SPH and its fractions (1 mg/mL) could lower the absorbance.
SPH-I exhibited the strongest lipid peroxidation inhibition activity, which was in accordance with
the previous report [27] showing that low MW peptides were more effective against linoleic acid
peroxidation. The lipid peroxidation inhibition activity of SPH and the ultrafiltration fractions may be
related to the high content of hydrophobic amino acids, molecular size, and the amino acid residues at
the terminal end of the peptides [28].
Absorbance at 500 nm
2.0
Control
SPH
SPH-I
SPH-II
1.5
1.0
0.5
0.0
0
1
2
3
4
5
6
7
Incubation time (day)
Figure 4. Inhibition activity of SPH and its fractions on linoleic acid peroxidation.
2.3. Effects of SPH-I on Acute Alcohol-Induced Liver Injury in Mice
Various pathways involving multiple types of enzymes and oxidative stress were thought to
be associated with the pathological process of alcohol-induced liver injury [6,29]. Oxidative stress,
caused by partially-reduced ROS such as superoxide anion (O2 ·− ), hydroxyl free radical (·OH), and
hydrogen peroxide (H2 O2 ), played a part in the pathogenesis of alcohol-induced liver injury [25,30].
To study the antioxidant effect of SPH-I in vivo, the well-described alcohol-induced mice hepatotoxicity
was used. Alcohol administration was likely to enhance production of free radicals that would initiate
lipid peroxidation and decreased activities of antioxidative enzymes, leading to cell membrane damage,
intracellular enzyme leakage, and even cell necrosis [18,31].
In this study, forty male Kunming (KM) mice were randomly divided into four groups of ten mice
each. Group I served as the normal control and group II was the alcohol model group. Group III and IV
were mice treated with SPH-I at 100 and 300 mg/kg BW, respectively, for 24 consecutive days. At the
end of the experiment, the mice were euthanized and related biochemical indices were measured.
2.3.1. Effects of SPH-I on Serum ALT and AST Activities
ALT is a cytosolic enzyme that mainly exists in the liver, while AST is primarily present in
mitochondria and cytoplasm in the liver. Once hepatocytes are damaged, ALT and AST will leak
through the liver cell membrane into circulation and the levels of these enzymes will increase in the
serum [30].
The effects of SPH-I on the serum ALT and AST activities are shown in Figure 5. Mice with
alcohol administration (groups II, III, and IV) showed a significant increase of serum ALT and AST
activities compared with those of group I (p < 0.05) and the values of AST/ALT were less than 1,
indicating that the alcohol-induced liver injury model in mice was well-established. Administration of
SPH-I at 100 and 300 mg/kg BW revealed a significant protective effect on the alcohol-induced liver
386
Mar. Drugs 2017, 15, 115
injury by attenuating the elevation of the activity of ALT by 38.9% and 41.4%, respectively (Figure 5a)
and depressing the increase of the activity of AST by 23.8% and 25.8%, respectively, compared with
the alcohol model group (Figure 5b).
(a) 100
(b)
50
#
#
40
60
*#
AST(U/L)
ALT(U/L)
80
*#
40
*#
*#
III
IV
30
20
*
20
10
*
0
I
II
III
0
IV
I
II
Group
Group
Figure 5. Effects of SPH-I on the activities of serum (a) alanine aminotransferase (ALT) and
(b) aspartate aminotransferase (AST). Group I, normal control; Group II, alcohol model; Group
III, SPH-I (100 mg/kg BW) + alcohol; Group IV, SPH-I (300 mg/kg BW) + alcohol; each group
contained 10 KM mice.* Statistical significance p < 0.05, compared with alcohol-treated group.
# Statistical significance p < 0.05, compared with control group.
2.3.2. Effect of SPH-I on Hepatic MDA Level
MDA is the end-product of lipid peroxidation, whose levels could reflect the extent of cellular
damage, serving as a marker of free radical-mediated lipid peroxidation [32]. Results shown in Figure 6
manifested that the hepatic MDA level of group II was remarkably enhanced after exposure to alcohol
by 93.3%, indicating oxidative damage to the liver. Treatment of mice with SPH-I at the doses of
100 and 300 mg/kg significantly reversed the elevation of MDA levels by 27.0% and 38.7%, respectively,
compared to the alcohol model (group II), suggesting that SPH-I could inhibit alcohol induced lipid
peroxidation in the liver.
#
MDA (nM/mg protein)
6.0
5.0
*#
4.0
3.0
*
*
2.0
1.0
0.0
I
II
III
IV
Group
Figure 6. Effect of SPH-I on the hepatic malondialdehyde (MDA) level. Group I, normal control; Group II,
alcohol model; Group III, SPH-I (100 mg/kg BW) + alcohol; Group IV, SPH-I (300 mg/kg BW) + alcohol;
each group contained 10 Kunming (KM) mice. * Statistical significance p < 0.05, compared with
alcohol-treated group. # Statistical significance p < 0.05, compared with control group.
387
Mar. Drugs 2017, 15, 115
2.3.3. Effects of SPH-I on Hepatic SOD, CAT, GSH-Px Activities, and GSH Level
Antioxidant enzymes play important roles in elimination of ROS derived from the redox reactions
of xenobiotics in liver [33]. SOD is an efficient enzyme that catalyzes the conversion of superoxide
into O2 and H2 O2 , and H2 O2 could be further decomposed into H2 O and O2 by CAT, GSH-Px,
and the participation of GSH [34]. As a main non-enzymatic antioxidant in cells, GSH plays a critical
role in antioxidant defense to protect cells from oxidative damage of ROS such as hydroxyl radical,
lipid peroxyl radical, and H2 O2 [35]. The effects of SPH-I on hepatic SOD, CAT, GSH-Px activities
and GSH level were shown in Figure 7. Compared to the control group, the GSH level and GSH-Px,
CAT, SOD activities were significantly decreased after exposure to alcohol by 67.6%, 22.8%, 33.3%,
and 11.5%, respectively. The levels of GSH were 45.7% and 114% higher than those of group II with
administration of SPH-I at the doses of 100 and 300 mg/kg BW respectively. Pretreatment of mice
with SPH-I could also remarkably increase the hepatic SOD, CAT, and GSH-Px activities at the same
time (p < 0.05), indicating that the hepatoprotective effects of SPH-I against acute alcohol-induced liver
injury were due to the stabilization of intracellular antioxidant defense systems.
(a)
(b)
6.0
600
*
*
4.0
*#
GSH-Px (U/mg protein)
GSH (mg/g protein)
5.0
*#
3.0
#
2.0
1.0
500
III
IV
300
200
100
0
I
II
III
IV
I
II
Group
(d)
250
SOD (U/mg protein)
200
*
*
#
#
*#
*
#
45
ȱ
Group
75
60
CAT (U/mg protein)
*#
400
0.0
(c)
*#
#
30
*
150
100
50
15
0
0
I
II
III
I
IV
II
III
IV
Group
Group
Figure 7. Effects of SPH-I on the level of hepatic (a) glutathione (GSH) level and (b) glutathione
peroxidase (GSH-Px), (c) superoxide dismutase (SOD), (d) catalase (CAT) activities. Group I, normal
control; Group II, alcohol model; Group III, SPH-I (100 mg/kg BW) + alcohol; Group IV, SPH-I
(300 mg/kg BW) + alcohol; each group contained 10 KM mice.* Statistical significance p < 0.05,
compared with alcohol-treated group. # Statistical significance p < 0.05, compared with control group.
Previous report showed that a peptide from duck skin byproducts hydrolysate with strong free
radical scavenging activities could inhibit the production of ROS and cell death against alcohol-induced
liver cell damage, and enhanced the antioxidative enzymes (SOD, CAT, GSH-Px) activities in response
388
Mar. Drugs 2017, 15, 115
to alcohol-induced oxidative damage in rats [36]. The antioxidant activity of an antioxidant compound
has been attributed to various mechanisms, among which are radical scavenging, binding of transition
metal ion catalysts, reductive capacity, prevention of chain initiation, decomposition of peroxides,
and prevention of continued hydrogen abstraction [37]. The results obtained from the present study
clearly validated powerful antioxidant activity of SPH-I against various oxidation systems in vitro,
which contributed to its hepatoprotective effects of SPH-I in alcohol-induced liver injury in mice.
3. Materials and Methods
3.1. Materials
Schizochytrium processing byproduct was kindly provided by Fisheries Research Institute
of Fujian, China, and was stored at −20 ◦ C before use. The commercial protease,
alcalase (EC. 3.4.21.62, 2.2 × 105 U/g) and flavourzyme (EC. 3.4.11.1, 7.8 × 104 U/g) were purchased
from Novozymes (Copenhagen, Denmark). 2,2′ -azinobis-3-ethylbenzthiazoline-6-sulphonate (ABTS),
1,1-diphenyl-2-picrylhydrazyl (DPPH) were obtained from Sigma Chemical Co. (St. Louis, MO, USA).
All the kits for biochemical analyses used in the animal experiment were the products of Nanjing
Jiancheng Bioengineering Institute (Nanjing, China). All other chemicals and reagents were of
analytical grade and commercially available.
3.2. Preparation of SP
SP was extracted by using alkaline extraction and acid precipitation as described previously [38].
The Schizochytrium byproduct was ground to powder (sieved through a 50 mesh sieve). One percent
(w/v) Schizochytrium powder in 0.39 M NaOH solution was stirred at 90 ◦ C for 30 min and then
centrifuged at 11,000× g, 20 ◦ C for 20 min. The supernatant was adjusted to pH 3.0 by 6 M HCl
solution and kept for 30 min (pH 3.0 was confirmed to precipitate most of the protein from the alkaline
extract in our preliminary experiments). The mixture was centrifuged at 11,000× g, 20 ◦ C for 20 min.
The precipitated SP was lyophilized for further enzymatic hydrolysis.
3.3. Preparation of SPH
SPH was prepared through stepwise enzymatic hydrolysis by alcalase and flavourzyme
sequentially. Two percent (w/v) SP was first hydrolyzed by alcalase at a ratio of alcalase to SP
of 10% (w/w), pH 9.0 at 50 ◦ C for 6 h. Then the mixture was hydrolyzed for another 8 h at 50 ◦ C,
pH 6.7 by flavourzyme (the ratio of flavourzyme to SP was 12.5%, w/w). The hydrolysate was heated
at 100 ◦ C for 10 min to inactive the enzymes and then cooled to room temperature. The SPH in the
supernatant was collected by centrifugation at 11,000× g for 20 min, and then lyophilized and stored
at −20 ◦ C for further analysis.
3.4. Analysis of Amino Acid Composition
The lyophilized hydrolysate was digested at 110 ◦ C for 24 h with HCl (6 M) under nitrogen
atmosphere. A High Speed Amino Acid Analyzer Model L-8900 (Hitachi High-Technologies Co.,
Tokyo, Japan) was used to analyze the amino acid composition of the hydrolysate.
3.5. Determination of MW Distribution of SPH
MW distribution of SPH was determined using HPLC. The sample was applied to a Waters
650E Advanced Protein Purification System (Waters Corporation, Milford, MA, USA) equipped
with TSKgel2000 SWXL column (300 mm × 7.8 mm). The mobile phase was 45% acetonitrile and
55% deionized water containing 0.1% trifluoroacetic acid. Chromatographic analysis was carried out
with a flow rate of 0.5 mL/min and a column temperature at 30 ◦ C. The absorbance was monitored at
220 nm. A calibration curve was obtained with bovine carbonic anhydrase (29,000 Da), horse heart
cytochrome C (12,500 Da), aprotinin (6500 Da), bacitracin (1450 Da), gly–gly–tyr–arg (451 Da) and
389
Mar. Drugs 2017, 15, 115
gly–gly–gly (189 Da). With the help of elution time of calibration materials, the linear regression
equation was obtained for the calculation of MW. The results were processed with Millennium32
version 3.05 (Waters Corporation, Milford, MA, USA).
3.6. Ultrafiltration of SPH
SPH obtained from alcalase and flavourzyme digestion was fractionated through ultrafiltration
membrane with a MW cut-off of 3 kDa (Millipore, Billerica, MA, USA). All fractions recovered were
collected as SPH-I (MW < 3 kDa) and SPH-II (MW > 3 kDa).
3.7. Detemination of Antioxidant Activity In Vitro
3.7.1. DPPH Radical Scavenging Activity
The scavenging activity of SPH and its fractions against DPPH radical was tested according
to the method of Wu et al. [39] with slight modification. DPPH was dissolved in ethanol to a final
concentration of 0.1 mM. 1 mL of sample was mixed with 1 mL of DPPH solution and then kept in
the dark for 30 min at room temperature. Distilled water instead of the sample was used for control.
The absorbance values of samples and control were measured at 517 nm. The scavenging rate of DPPH
radical of the sample was evaluated with the following equation:
DPPH radical scavenging activity (%) =
Acontrol − Asample /Acontrol × 100,
(1)
where Asample and Acontrol were the absorbances of sample and control group, respectively.
3.7.2. ABTS Radical Scavenging Activity
The ABTS radical scavenging assay was carried out according to the method of Wang et al. [24].
The ABTS radical was generated by mixing ABTS stock solution (7 mM) with equal volume of
potassium persulfate (2.45 mM), and the mixture was incubated in the dark at room temperature for
12–16 h. The ABTS radical solution was diluted in phosphate buffer (5 mM, pH 7.4) to an absorbance
of 0.70 ± 0.02 at 734 nm before used. 1 mL ABTS radical solution was added to 1 mL sample solution.
The mixture was then incubated in the dark for 10 min and the absorbance was read at 734 nm.
Distilled water instead of the sample was used for control. The ABTS radical scavenging activity of the
samples was calculated by the following equation:
ABTS radical scavenging activity (%) =
Acontrol − Asample /Acontrol × 100,
(2)
where Asample and Acontrol were the absorbances of sample and control group, respectively.
3.7.3. Reducing Power
The reducing power of SPH and its fractions was estimated according to Oyaizu [40] with some
modification. 1 mL sample was mixed with 1 mL of phosphate buffer (0.2 M, pH 6.6) and 1 mL of 1% of
potassium ferricyanide. The mixture was then incubated at 50 ◦ C for 20 min followed by addition
of 1 mL of 10% trichloroacetic acid. The mixture was then centrifuged at 2500× g for 10 min. 1 mL
of the supernatant was mixed with 1 mL distilled water and 0.2 mL of 0.1% FeCl3 . After 10 min,
the absorbance was recorded at 700 nm.
3.7.4. Inhibition of Linoleic Acid Peroxidation
The capacity of inhibiting linoleic acid peroxidation of SPH and its fractions was measured
according to the method described by Osawa and Namiki [41] with some modification.
Briefly, samples were dissolved in distilled water to a concentration of 1 mg/mL and then mixed with
2 mL of ethanol, 26 µL of linoleic acid and 2 mL of phosphate buffer (50 mM, pH 7.0). The mixture was
390
Mar. Drugs 2017, 15, 115
incubated in a colorimetric tube with plug at 40 ◦ C in the dark. The degree of oxidation was measured
at 24 h intervals using the ferric thiocyanate (FTC) method of Mitsuda et al. [42]. 100 µL of the reaction
mixture was added to a solution of 4.7 mL of 75% ethanol, 0.1 mL of 30% ammonium thiocyanate, and
0.1 mL of 20 mM FeCl2 solution in 3.5% of HCl. After 3 min, the degree of color development that
represented the linoleic acid oxidation was measured spectrophotometrically at 500 nm.
3.8. Evaluation of Hepatoprotective Effects of SPH-I in Mice
3.8.1. Animals and Treatments
Forty male KM mice with body weight (BW) of about 20 g were purchased from Slac Laboratory
Animal Center (Shanghai, China). Throughout the experiments, mice were fed with standard pellet
laboratory animal feed and had free access to food and water. The experiments were carried out
in accordance with the guidelines issued by the Ethical Committee of Fujian Medical University
(Fujian, China).
After a seven-day period of acclimatizing, forty mice were randomly divided into four groups
with ten mice in each group. Group I served as normal control. Group II was alcohol model group
in which mice were treated with alcohol alone. Group III and IV were mice treated with SPH-I at
100 and 300 mg/kg BW respectively for 24 consecutive days (the test dosages of SPH-I were decided
by preliminary tests). Mice in group I and II were orally given the same volume of deionized water
instead of SPH-I solution. One hour after substances administration at the 24th day, the mice except
the normal control group were treated with single dose of 50% of alcohol (12 mL/kg BW), while group
I was treated with the same volume of water. Whole blood was collected after a fasting period of 24 h.
The mice were then euthanized and their livers were excised.
3.8.2. Analysis of Serum Biochemical Indices
Blood samples were collected immediately and the serum was separated by centrifugation at
1500× g for 10 min at 4 ◦ C. The activities of serum ALT and AST were analyzed using ALT and AST
assay kits according to the manufacturer’s protocol.
3.8.3. Analysis of Hepatic Biochemical Indices
Liver tissues were excised and homogenized in 0.1 g/mL of cold normal saline. The supernatant
of the homogenate was collected after centrifugation at 3000× g for 10 min at 4 ◦ C. The activities
of SOD, CAT, GSH-Px, and the level of GSH and MDA were determined with T-SOD assay kit
(hydroxylamine method), CAT assay kit (visible light), GSH-PX assay kit (colorimetric method), GSH
assay kit, and MDA assay kit (TBA method) according to the manufacturer’s protocol, respectively.
The total protein content of liver homogenate was determined according to the Bradford method [43].
3.9. Statistical Analysis
All results are presented as means ± standard deviation (SD). Statistical analysis was carried
out with IBM SPSS 17.0 software (SPSS, Chicago, IL, USA). Statistical analysis was performed by
one-way analysis of variance (ANOVA) with Duncan’s test for post hoc analysis and p < 0.05 values
were considered as statistically significant.
4. Conclusions
In this study, Schizochytrium sp. protein hydrolysate was prepared by alcalase and flavourzyme
sequentially, and mainly composed of Glu (17.66%), Asp (15.89%), Leu (9.96%), and Arg (7.81%) along
with small amounts of Phe (5.27%), Tyr (2.71%), and His (1.57%). After ultrafiltration of SPH with
3 kDa membrane, SPH-1, peptides with MW below 3 kDa, exhibited the highest DPPH and ABTS
radicals scavenging activities, reducing power and lipid peroxidation inhibition potential. In addition,
SPH-I could significantly alleviate alcohol-induced hepatotoxicity in mice. Results of the present study
391
Mar. Drugs 2017, 15, 115
indicated that SPH-I could be developed as a potential functional antioxidant additive for effective
therapy of alcohol-induced liver diseases.
Acknowledgments: This work was supported by the Natural Science Foundation of China (No. 31571779),
the High & New project of Fujian Marine Fisheries Department (No. [2015]20), and the Fujian Production & Study
project of Provincial Science & Technology Hall (No. 2016N5006), China.
Author Contributions: Xixi Cai, Ana Yan and Shaoyun Wang conceived and designed the experiments; Ana Yan
and Xixi Cai carried out the experiments; Xixi Cai and Nanyan Fu analyzed the data; Xixi Cai drafted the
paper; Shaoyun Wang and Nanyan Fu reviewed the manuscript and provided useful suggestion to improve the
manuscript. All authors read and approved the final manuscript.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
Wu, S.T.; Yu, S.T.; Lin, L.P. Effect of culture conditions on docosahexaenoic acid production by
Schizochytrium sp. S31. Process Biochem. 2005, 40, 3103–3108. [CrossRef]
Morita, E.; Kumon, Y.; Nakahara, T.; Kagiwada, S.; Noguchi, T. Docosahexaenoic acid production and
lipid-body formation in Schizochytrium limacinum SR21. Mar. Biotechnol. 2006, 8, 319–327. [CrossRef]
[PubMed]
Yaguchi, T.; Tanaka, S.; Yokochi, T.; Nakahara, T.; Higashihara, T. Production of high yields of
docosahexaenoic acid by Schizochytrium sp. strain SR21. J. Am. Oil Chem. Soc. 1997, 74, 1431–1434.
[CrossRef]
Mendis, E.; Rajapakse, N.; Kim, S.K. Antioxidant properties of a radical-scavenging peptide purified from
enzymatically prepared fish skin gelatin hydrolysate. J. Agric. Food Chem. 2005, 53, 581–587. [CrossRef]
[PubMed]
Sindhu, E.R.; Preethi, K.C.; Kuttan, R. Antioxidant activity of carotenoid lutein in vitro and in vivo. Indian J.
Exp. Biol. 2010, 48, 843–848. [PubMed]
Wang, M.C.; Zhu, P.L.; Jiang, C.X.; Ma, L.P.; Zhang, Z.J.; Zeng, X.X. Preliminary characterization, antioxidant
activity In Vitro and hepatoprotective effect on acute alcohol-induced liver injury in mice of polysaccharides
from the peduncles of Hovenia dulcis. Food Chem. Toxicol. 2012, 50, 2964–2970. [CrossRef] [PubMed]
Impei, S.; Gismondi, A.; Canuti, L.; Canini, A. Metabolic and biological profile of autochthonous
Vitis vinifera L. ecotypes. Food Funct. 2015, 6, 1526–1538. [CrossRef] [PubMed]
Giovannini, D.; Gismondi, A.; Basso, A.; Canuti, L.; Braglia, R.; Canini, A.; Mariani, F.; Cappelli, G.
Lavandula angustifolia Mill. essential oil exerts antibacterial and anti-Inflammatory effect in macrophage
mediated immune response to Staphylococcus aureus. Immunol. Investig. 2016, 45, 11–28. [CrossRef] [PubMed]
Gammone, M.; Riccioni, G.; Orazio, N. Marine carotenoids against oxidative stress: Effects on human health.
Mar. Drugs 2015, 13, 6226–6246. [CrossRef] [PubMed]
Sun, L.P.; Chang, W.D.; Ma, Q.Y.; Zhuang, Y.L. Purification of antioxidant peptides by high
resolution mass spectrometry from simulated gastrointestinal digestion hydrolysates of Alaska Pollock
(Theragra chalcogramma) skin collagen. Mar. Drugs 2016, 14, 186. [CrossRef] [PubMed]
Lin, S.Y.; Jin, Y.; Liu, M.Y.; Yang, Y.; Zhang, M.S.; Guo, Y.; Jones, G.; Liu, J.B.; Yin, Y.G. Research on the
preparation of antioxidant peptides derived from egg white with assisting of high-intensity pulsed electric
field. Food Chem. 2013, 139, 300–306. [CrossRef] [PubMed]
Li, Y.H.; Jiang, B.; Zhang, T.; Mu, W.M.; Liu, J. Antioxidant and free radical-scavenging activities of chickpea
protein hydrolysate (CPH). Food Chem. 2008, 106, 444–450. [CrossRef]
Sheih, I.C.; Wu, T.K.; Fang, T.J. Antioxidant properties of a new antioxidative peptide from algae protein
waste hydrolysate in different oxidation systems. Bioresour. Technol. 2009, 100, 3419–3425. [CrossRef]
[PubMed]
Udenigwe, C.C.; Aluko, R.E. Chemometric analysis of the amino acid requirements of antioxidant food
protein hydrolysates. Int. J. Mol. Sci. 2011, 12, 3148–3161. [CrossRef] [PubMed]
Sarmadi, B.H.; Ismail, A. Antioxidative peptides from food proteins: A review. Peptides 2010, 31, 1949–1956.
[CrossRef] [PubMed]
Rajapakse, N.; Mendis, E.; Jung, W.K.; Je, J.Y.; Kim, S.K. Purification of a radical scavenging peptide from
fermented mussel sauce and its antioxidant properties. Food Res. Int. 2005, 38, 175–182. [CrossRef]
392
Mar. Drugs 2017, 15, 115
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
Saiga, A.; Tanabe, S.; Nishimura, T. Antioxidant activity of peptides obtained from porcine myofibrillar
proteins by protease treatment. J. Agric. Food Chem. 2003, 51, 3661–3667. [CrossRef] [PubMed]
Giménez, B.; Alemán, A.; Montero, P.; Gómez-Guillén, M.C. Antioxidant and functional properties of gelatin
hydrolysates obtained from skin of sole and squid. Food Chem. 2009, 114, 976–983. [CrossRef]
Xia, Y.C.; Bamdad, F.; Gänzle, M.; Chen, L.Y. Fractionation and characterization of antioxidant peptides
derived from barley glutelin by enzymatic hydrolysis. Food Chem. 2012, 134, 1509–1518. [CrossRef] [PubMed]
Hong, J.; Chen, T.T.; Hu, P.; Yang, J.; Wang, S.Y. Purification and characterization of an antioxidant peptide
(GSQ) from Chinese leek (Allium tuberosum Rottler) seeds. J. Funct. Foods 2014, 10, 144–153. [CrossRef]
Shi, Y.N.; Kovacs-Nolan, J.; Jiang, B.; Tsao, R.; Mine, Y. Antioxidant activity of enzymatic hydrolysates
from eggshell membrane proteins and its protective capacity in human intestinal epithelial Caco-2 cells.
J. Funct. Foods 2014, 10, 35–45. [CrossRef]
Chen, M.; Li, B. The effect of molecular weights on the survivability of casein-derived antioxidant peptides
after the simulated gastrointestinal digestion. Innov. Food Sci. Emerg. Technol. 2012, 16, 341–348. [CrossRef]
Chen, N.; Yang, H.M.; Sun, Y.; Niu, J.; Liu, S.Y. Purification and identification of antioxidant peptides from
walnut (Juglans regia L.) protein hydrolysates. Peptides 2012, 38, 344–349. [CrossRef] [PubMed]
Wang, B.; Li, Z.R.; Chi, C.F.; Zhang, Q.H.; Luo, H.Y. Preparation and evaluation of antioxidant peptides
from ethanol-soluble proteins hydrolysate of Sphyrna lewini muscle. Peptides 2012, 36, 240–250. [CrossRef]
[PubMed]
Niki, E. Assessment of antioxidant capacity in vitro and in vivo. Free Radic. Biol. Med. 2010, 49, 503–515.
[CrossRef] [PubMed]
Winczura, A.; Zdżalik, D.; Tudek, B. Damage of DNA and proteins by major lipid peroxidation products in
genome stability. Free Radic. Res. 2012, 46, 442–459. [CrossRef] [PubMed]
Je, J.Y.; Park, P.J.; Kim, S.K. Antioxidant activity of a peptide isolated from Alaska pollack
(Theragra chalcogramma) frame protein hydrolysate. Food Res. Int. 2005, 38, 45–50. [CrossRef]
Cheung, I.W.Y.; Cheung, L.K.Y.; Tan, N.Y.; Li-Chan, E.C.Y. The role of molecular size in antioxidant activity
of peptide fractions from Pacific hake (Merluccius productus) hydrolysates. Food Chem. 2012, 134, 1297–1306.
[CrossRef] [PubMed]
Cederbaum, A.I.; Lu, Y.K.; Wu, D.F. Role of oxidative stress in alcohol-induced liver injury. Arch. Toxicol.
2009, 83, 519–548. [CrossRef] [PubMed]
Obogwu, M.B.; Akindele, A.J.; Adeyemi, O.O. Hepatoprotective and in vivo antioxidant activities of the
hydroethanolic leaf extract of Mucuna pruriens (Fabaceae) in antitubercular drugs and alcohol models. Chin. J.
Nat. Med. 2014, 12, 273–283. [CrossRef]
Yazdanparast, R.; Bahramikia, S.; Ardestani, A. Nasturtium officinale reduces oxidative stress and enhances
antioxidant capacity in hypercholesterolaemic rats. Chem. Biol. Interact. 2008, 172, 176–184. [CrossRef]
[PubMed]
Cheng, N.; Du, B.; Wang, Y.; Gao, H.; Cao, W.; Zheng, J.B.; Feng, F. Antioxidant properties of jujube honey
and its protective effects against chronic alcohol-induced liver damage in mice. Food Funct. 2014, 5, 900–908.
[CrossRef] [PubMed]
Choi, D.W.; Lee, J.H.; Chun, H.H.; Song, K.B. Isolation of a calcium-binding peptide from bovine serum
protein hydrolysates. Food Sci. Biotechnol. 2012, 21, 1663–1667. [CrossRef]
Cai, X.X.; Yang, Q.; Wang, S.Y. Antioxidant and hepatoprotective effects of a pigment-protein complex from
Chlorella vulgaris on carbon tetrachloride-induced liver damage in vivo. RSC Adv. 2015, 5, 96097–96104.
[CrossRef]
Wu, G.Y.; Fang, Y.Z.; Yang, S.; Lupton, J.R.; Turner, N.D. Glutathione metabolism and its implications for
health. J. Nutr. 2004, 134, 489–492. [PubMed]
Lee, S.J.; Kim, Y.S.; Hwang, J.W.; Kim, E.K.; Moon, S.H.; Jeon, B.T.; Jeon, Y.J.; Kim, J.M.; Park, P.J.
Purification and characterization of a novel antioxidative peptide from duck skin byproducts that protects
liver against oxidative damage. Food Res. Int. 2012, 49, 285–295. [CrossRef]
GüLCIN, I.; Alici, H.A.; Cesur, M. Determination of in vitro antioxidant and radical scavenging activities of
propofol. Chem. Pharm. Bull. 2005, 53, 281–285. [CrossRef] [PubMed]
Lin, J.P.; Cai, X.X.; Tang, M.R.; Wang, S.Y. Preparation and evaluation of the chelating nanocomposite
fabricated with marine algae Schizochytrium sp. protein hydrolysate and calcium. J. Agric. Food Chem. 2015,
63, 9704–9714. [CrossRef] [PubMed]
393
Mar. Drugs 2017, 15, 115
39.
40.
41.
42.
43.
Wu, H.C.; Chen, H.M.; Shiau, C.Y. Free amino acids and peptides as related to antioxidant properties in
protein hydrolysates of mackerel (Scomber austriasicus). Food Res. Int. 2003, 36, 949–957. [CrossRef]
Oyaizu, M. Antioxidative activities of browning products of glucosamine fractionated by organic solvent
and thin-layer chromatography. J. Jpn. Soc. Food Sci. 1988, 35, 771–775. [CrossRef]
Osawa, T.; Namiki, M. A novel type of antioxidant isolated from leaf wax of Eucalyptus leaves.
Agric. Biol. Chem. 1981, 45, 735–739. [CrossRef]
Mitsuda, H.; Yuasumoto, K.; Iwami, K. Antioxidation action of indole compounds during the autoxidation
of linoleic acid. Eiyo Shokuryo 1966, 19, 210–214. [CrossRef]
Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein
utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [CrossRef]
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
394
marine drugs
Article
Hydrolysates of Fish Skin Collagen: An Opportunity
for Valorizing Fish Industry Byproducts
María Blanco *, José Antonio Vázquez, Ricardo I. Pérez-Martín and Carmen G. Sotelo
Instituto de Investigaciones Marinas (IIM-CSIC), Eduardo Cabello, 6, Vigo, Galicia 36208, Spain;
jvazquez@iim.csic.es (J.A.V.); ricardo@iim.csic.es (R.I.P.-M.); carmen@iim.csic.es (C.G.S.)
* Correspondence: mblanco@iim.csic.es; Tel.: +34-986-231-930; Fax: +34-986-292-762
Academic Editors: Se-Kwon Kim and Peer B. Jacobson
Received: 21 March 2017; Accepted: 2 May 2017; Published: 5 May 2017
Abstract: During fish processing operations, such as skinning and filleting, the removal of
collagen-containing materials can account for up to 30% of the total fish byproducts. Collagen is
the main structural protein in skin, representing up to 70% of dry weight depending on the species,
age and season. It has a wide range of applications including cosmetic, pharmaceutical, food industry,
and medical. In the present work, collagen was obtained by pepsin extraction from the skin of
two species of teleost and two species of chondrychtyes with yields varying between 14.16% and
61.17%. The storage conditions of the skins appear to influence these collagen extractions yields.
Pepsin soluble collagen (PSC) was enzymatically hydrolyzed and the resultant hydrolysates were
ultrafiltrated and characterized. Electrophoretic patterns showed the typical composition of type I
collagen, with denaturation temperatures ranged between 23 ◦ C and 33 ◦ C. In terms of antioxidant
capacity, results revealed significant intraspecific differences between hydrolysates, retentate, and
permeate fractions when using β-Carotene and DPPH methods and also showed interspecies
differences between those fractions when using DPPH and ABTS methods. Under controlled
conditions, PSC hydrolysates from Prionace glauca, Scyliorhinus canicula, Xiphias gladius, and Thunnus
albacares provide a valuable source of peptides with antioxidant capacities constituting a feasible way
to efficiently upgrade fish skin biomass.
Keywords: collagen; enzymatic hydrolysis; antioxidant activity; β-carotene; DPPH; ABTS
1. Introduction
As the human population is growing and their consumption behavior changing, the worldwide
demand for fishery products is increasing as is the demand for ready to cook meals in the form of
loins or steaks. These kinds of processed products generate a large amount of by-products in the form
of skin, bones, viscera, heads, scales, etc. Those organic materials are considered postharvest fish
losses (by-products) and are a main concern for current fishery management policies because they
represent a significant source of valuable compounds as proteins, fat, minerals, etc. Although part of
these by-products are already being used, either for fish meal or oil production (35% of world fishmeal
production was obtained from fish byproducts) [1]; this kind of utilization is considered to produce
very little added-value, but due to present technological developments, a more valuable and profitable
use is possible [2].
Fishing activity in Galicia (North-West Spain) constitutes a key sector for the economy of the
region, with a high concentration of small, medium, and big businesses dedicated to fish processing
activities that render a wide variety of by-products susceptible to valorization. During fish processing
operations the removal of collagen-containing materials (mainly skin, bones and scales) could account
for as much as 30% of the total by-products generated after filleting (75% of the total catch weight) [3,4].
Mar. Drugs 2017, 15, 131
395
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2017, 15, 131
Although collagen is the main protein component of fish skin and its particular heterotrimeric
structure [α1 (I)]2 α2 (I) has been previously described, there have been only a few publications
describing the properties of fish skin collagen hydrolysates [5–7], and even less research has been
conducted on the characterization of hydrolysates obtained from pepsin soluble collagen of marine
origin [7]. As acid solubilisation of collagen has been shown to render low yields, enzymatic proteolysis
has been studied as an alternative to enhance the yield and at the same time obtaining hydrolysates
with good nutritional composition, increased solubility and better emulsifying, foaming, and gelating
properties, as well as biologically active peptides [8–10].
Two sharks, blue shark (Prionace glauca; PGLA) and small-spotted catshark (Scyliorhinus canicula;
SCAN), and two bonny fishes, yellowfin tuna (Thunnus albacares; TALB) and swordfish (Xiphias gladius;
XGLA) were selected since a significant amount of these are industrially processed generating
significant amounts of skin [11–13]. The objective of this study was to evaluate the potential use
of skins which are obtained as a by-product of the fish processing industry to obtain fish skin collagen
hydrolysates and to test the influence of some biochemical properties, as the amino acid content or
molecular weight, on antioxidant capacity of hydrolysates. This is the first time, as far as we know
that the extraction, characterization and comparison of collagen hydrolysates from these species,
is described.
2. Results and Discussion
Fish skin can be an important by-product for some fishery industries, for example some
companies produce pieces of skinned and deboned fish which render important amounts of
skins and bones as by-products. One of the problems associated with these by-products is the
heterogeneity of them: they are originated from different species, previous frozen storage conditions
can be different (frozen storage in brine), they can be mixed with bones or other by-products,
etc. Appropriate management of these by-products should take into account these problems,
and one important and initial step is to estimate the value associated with each type of product.
Therefore, the initial chemical characterization and the estimations of collagen content are important
data in evaluating the potential value of these by-products. Low yields of collagen extraction can
be expected in industrial conditions because of the previous treatment and storage history of the
raw materials. Hydrolysis would help to overcome some of the problems associated with these
previous treatments, increasing the yield of a valuable product, collagen hydrolysates, which has many
interesting properties, such as antioxidant activity [14,15].
2.1. Chemical Composition of Skin By-Products
2.1.1. Proximate Composition
Table 1 shows the chemical composition of the skins of the four species analysed, these were
similar to the skins of other fish species. Skin of the two elasmobranch contained similar amounts of
protein, while swordfish skin presented the lowest protein content of all species, while those from tuna
were the highest. In the case of swordfish, it is remarkably the highest lipid content (30.53%), which
may also be the target of valorisation for this type of by-product. The higher ash content in the skin
of the small-spotted catshark is remarkable and it could be attributed to its particular skin structure;
a thinner skin with a higher proportion of scales compared to the skin of the blue shark. The skin of
the blue shark is thicker and presents two different layers with scales only present in the upper layer.
2.1.2. Hydroxyproline (HPro) Content
Hydroxyproline has been used as a method to quantify the amount of collagen in a particular
tissue [16]. This analytical approach was used to estimate the collagen content in the skin of all the
species analyzed, assuming that all HPro content of skin is due to collagen and taking into account
that the ratio of HPro in collagen is 12.5 g of HPro/100 g of collagen [17]. Table 2 shows that the
396
Mar. Drugs 2017, 15, 131
collagen content was higher in the skin of TALB, followed by the two species of elasmobranch which
showed similar values (SCAN and PGLA), and finally the lowest value corresponded to the skin
of XGLA, these results are in coherence with the protein content found in the skin of these species
(Table 1). Collagen content reported previously for other fish species was similar with slight variations
depending on the species [18].
Sotelo et al. [19] have reported a low collagen content in the skin of SCAN (11.6% in a wet basis),
which may be explained by differences in the previous treatment of skins for this species (used fresh in
this study).
Chemical composition of fish skins from the four species used for the study.
Table 1.
Values, expressed in a wet basis, are means of 3 determinations ± standard deviation
(Protein = N × 5.4).
Composition (%)
Species
PGLA
SCAN
XGLA
TALB
Moisture
Protein
Lipids
Ash
76.03 ± 0.83
61.5 ± 0.79
42.87 ± 0.54
62.57 ± 2.4
20.14 ± 0.97
22.09 ± 0.96
16.28 ± 2.21
26.96 ± 2.04
0.24 ± 0.03
0.36 ± 0.01
30.53 ± 1.99
3.22 ± 0.72
4.24 ± 0.24
14.01 ± 0.5
2.49 ± 0.21
0.67 ± 0.14
Table 2. Hydroxyproline (OHPro) content in skin (g OHPro/100 g skin), collagen content calculated
from the hydroxiproline values, and yield of PSC1 (g collagen/100 g skin), and PSC2 (g collagen/100 g
collagen of the skin). The average values (±SD) expressed in a wet weight basis are means of
three replicates.
Hydroxyproline Content in Skin (%)
Collagen Content (%)
PSC1 Yield (%)
PSC2 Yield (%)
1.23 ± 0.11
1.85 ± 0.14
1.08 ± 0.16
2.69 ± 0.26
9.84 ± 0.88
14.8 ± 1.14
8.64 ± 1.28
21.53 ± 2.09
5.87 ± 0.49
4.89 ± 0.85
2.59 ± 0.22
2.97 ± 0.98
61.17 ± 5.15
33.00 ± 5.25
31.33 ± 5.55
14.16 ± 6.14
PGLA
SCAN
XGLA
TALB
2.2. Extraction of Collagen
2.2.1. Yield of PSC
Previous reports have shown that pepsin enhances the extraction efficiency in collagen because
it is able to cleave specifically telopeptide regions of collagen [20,21]. Besides, by hydrolysing the
non-triple helice domain, non-collagen proteins are more easily removed, and thus collagen becomes
readily solubilized in acid solution and the antigenicity caused by telopeptides is reduced, obtaining
a collagen with higher purity with the possibility of using it in different applications [22–24].
Table 2 shows PSC yields obtained for PGLA, SCAN, TALB, and XGLA. Extraction yields
obtained for PGLA and SCAN were similar to other PSC extracted from different fish species, such
as bigeye snapper skin [25], brownstripe red snapper skin [26], or largefin longbarbel catfish [27].
However, the yields obtained for TALB and XGLA are lower than those values. While TALB showed
the highest collagen content values (determined by means of hydroxyproline analysis in skin), it also
showed (together with XGLA skins) lower extraction yields (PSC1 and PSC2 ). These results could be
attributed to several factors such as differences in the structure of the collagen fibers or the storage
conditions; processing of tuna usually involves freezing and frozen storage, most of the times in brine.
This treatment may cause protein denaturation, a higher degree of crosslinking and therefore lower
collagen solubility and extraction yields [27–30].
397
Mar. Drugs 2017, 15, 131
2.2.2. Characterization of PSC
Polyacrylamide Gel Electrophoresis (SDS-PAGE)
Figure 1 shows the PSC electrophoretic patterns of the analysed species. The PSC SDS-PAGE
pattern from PGLA and TALB were more similar to the type I collagen pattern where two identical
α1 -chains (120 kDa), one α2 -chain (110 kDa), and one β dimer band of about 200 kDa can be
observed [16,31]. The molecular weight data obtained for α and β chains of PSC from TALB are
similar to those previously published for the same species [23,32]. The cross-linking rate of collagen
has been reported to be low; which might explain why highly cross-linked components (γ-component)
in PGLA, TALB, and XGLA are shown only as a faint bands in Figure 1 [33,34]. This result indicates
that pepsin was able to hydrolyse the cross-links in the telopeptide region without damaging the
integrity of the triple-helix.
PSC from SCAN was characterized by a high susceptibility to pepsin hydrolysis, as revealed by
the fact that neither dimer nor trimer could be observed in SDS-PAGE, and also by the presence of
several weak α subunits lower than 110 kDa, which could be products of enzymatic hydrolysis of
collagen components (Figure 1). In fact, previous publications have shown that β and γ-components
were present in acid soluble collagen from SCAN skin [19].
In the electrophoretic pattern of XGLA, one intermediate band was observed between the β
and α component with an approximate molecular weight of about 150 kDa. The presence of similar
components have also been reported for PSC from different species, suggesting either an incomplete
hydrolysis of β dimers, or the presence of a mixture of different collagens [35,36].
ȱ
Figure 1. 7% Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis (SDS-PAGE) showing Pepsin
soluble collagen (PSC) from Prionace glauca (PGLA), Scyliorhinus canicula (SCAN), Thunnus albacares
(TALB) and Xiphias gladius (XGLA). M.W: Molecular Weight Standards. Col I: standard collagen type I
from mammal.
Amino Acid Content
Table 3 shows the amino acid composition of the PSC of the four studied species and also that from
calf skin (data obtained from Zhang et al. [21]). To our knowledge, amino acid composition has never
previously been reported for PSC collagen of these species except for TALB [32]. Although, Glycine was
the most abundant amino acid in all the species studied, yet did not represent one third of the total
amino acid residues as expected [19,20]. Similar results have been previously reported in PSC obtained
from yellowfin tuna skin [32] and squid skin collagen [7]. This result might be explained due to the
presence of telopeptide fractions in which the repetitive occurrence of glycine every three amino acid
is absent [30].
398
Mar. Drugs 2017, 15, 131
The lower imino acid content found in SCAN PSC, contributes to the low stability of the triple
helix structure [35], which is a result that is in agreement with the SDS profiles shown above, indicating
the higher susceptibility of this species to the action of pepsin.
Table 3. Amino acid composition of PSC of PGLA, SCAN, TALB and XGLA (residues/1000). Data from
calf skin collagen is also included [21]. Imino acids includes proline and hydroxyproline.
PSC
Amino Acid
Hydroxyproline
Aspartic acid
Serine
Gultamic acid
Glycine
Histidine
Arginine
Threonine
Alanine
Proline
Cystine
Tyrosine
Valine
Methionine
Lysine
Isoleucine
Leucine
Phenylalanine
Iminoacids
% hydroxylation of proline
CALF
PGLA
SCAN
TALB
XGLA
84.62 ± 0.98
46.58 ± 0.42
35.98 ± 0.42
92.02 ± 1.00
214.80 ± 2.92
15.80 ± 0.20
111.50 ± 1.09
33.59 ± 0.16
108.57 ±0.87
107.68 ± 0.76
0.88 ± 0.01
3.39 ± 0.05
27.77 ± 0.39
13.51 ± 0.33
33.48 ± 0.36
24.62 ± 0.30
25.97 ± 0.36
19.25 ± 0.22
192.3
44.00
88.28 ± 0.62
52.16 ± 0.43
54.02 ± 0.14
92.10 ± 0.47
234.69 ± 1.36
17.35 ± 0.10
91.26 ± 1.08
33.41 ± 0.44
89.79 ± 0.97
95.22 ± 0.29
0.31 ± 0.00
1.36 ± 0.00
34.13 ± 0.12
14.06 ± 0.20
37.78 ± 0.13
18.29 ± 0.02
27.30 ± 0.07
18.49 ± 0.01
183.5
48.10
87.38 ± 0.60
55.40 ± 0.54
35.53 ± 0.25
97.89 ± 0.43
217.22 ± 1.32
12.70 ± 0.05
92.16 ± 2.97
40.00 ± 1.81
111.78 ± 2.58
114.86 ± 0.45
0.07 ± 0.00
4.42 ± 0.07
25.64 ± 0.15
6.29 ± 0.13
35.37 ± 0.23
14.26 ± 0.15
28.28 ± 0.21
20.75 ± 0.15
202.24
43.20
76.55 ± 0.87
61.32 ± 0.46
39.89 ± 0.74
94.64 ± 0.96
210.20 ± 3.22
15.67 ± 0.34
89.54 ± 2.26
42.89 ± 1.60
105.20 ± 2.39
121.89 ± 1.30
0.61 ± 0.01
6.45 ± 0.15
26.95 ± 0.40
3.53 ± 0.15
31.52 ± 0.43
20.47 ± 0.38
31.19 ± 0.68
21.50 ± 0.47
198.44
38.57
94
45
33
75
330
5
50
18
119
121
0
3
21
6
26
11
23
3
215
44
Determination of Denaturation Temperature
DSC analyses of lyophilized PSC were performed. Calf skin type I collagen was used for
comparison purposes. Denaturation temperatures for PGLA, SCAN, TALB, and XGLA PSCs were
33 ◦ C, 23.6 ◦ C, 30.6 ◦ C, and 31.4 ◦ C respectively, which are similar to those found in literature for
other PSC in different marine organisms: paper nautilus [37], striped catfish [38], bighead carp [35],
or blueshark [39]. Denaturation temperatures of PSC in all species were lower than that of collagen
type I of calf skin (Td = 40 ◦ C). Among the four species studied, the lower denaturation temperature
was found in SCAN PSC. These results agree with the lower imino acid content (hydroxyproline and
proline) found in the collagen obtained from this species. Thermal stability of collagen is related to the
restriction of the secondary structure imposed by the pyrrolidine rings of proline and hydroxyproline,
contributing to the strength of the triple helix [20,40]. Sotelo et al. [19] have found a higher denaturation
temperature for ASC obtained from small-spotted catshark skin, suggesting the influence of pepsin
cross-link cleavage on lower thermal stability found in PSC. Similar results were obtained for ASC and
PSC from the skin of brownbanded bamboo shark [32].
2.3. Enzymatic Hydrolysis of PSC
2.3.1. Degree of Hydrolysis
Hydrolysis curves were similar to others previously reported for different marine skin
proteins [41,42]. The hydrolysis degree (DH) (average values ±SD) calculated using the pH-STAT
method were 16.52 ± 3.74%, 15.80 ± 0.99%, 11.49 ± 1.5%, and 12.56 ± 1.79% for PGLA, SCAN,
TALB, and XGLA, respectively. Enzymatic proteolysis and the resulting degree of hydrolysis are key
parameters influencing peptide length and other related characteristics such as solubility, nutritional,
functional, or sensory properties [7,9].
399
Mar. Drugs 2017, 15, 131
2.3.2. Antioxidant Activities in Hydrolysates
Table 4 shows data of antioxidant analysis in collagen unfractionated hydrolysates (H) and 3kDa
ultrafiltration fractions: retentates (R) and permeates (P). The antioxidant capacities were evaluated
using 3 methods, including two based on free radical scavenging capacity, that is, DPPH and ABTS,
and one based on the inhibition of lipid peroxidation, determined by the β-carotene assay.
The precise mechanism explaining the antioxidant activity of peptides has not been entirely
elucidated, however several authors suggested the influence of hydrolysis degree [14,15]. As it was
expected, hydrolysate (H) fractions, determined with DPPH and ABTS exhibited lower values of
antioxidant activity in the hydrolysate with the highest hydrolysis degree (PGLA). However, the highest
values of antioxidant activity were found in XGLA which showed a higher hydrolysis degree than TALB,
suggesting the influence not only of the hydrolysis degree but also to the presence of some amino acids
such as cysteine which may interact with free radicals by their SH groups [14,43–45]. Thus, while XGLA
hydrolysate presented the highest values of cysteine content (53.03/1000 residues), PGLA hydrolysate
showed a low cysteine content (8.93/1000 residues) (Table 5). On the other hand, the β-carotene method
showed highest antioxidant capacity with those hydrolysates with the highest DH (SCAN and PGLA),
while those with the lowest DH showed also the lowest antioxidant capacity (Table 4).
Table 4. Antioxidant activities (Mean ± SD) of collagen unfractionated hydrolysates (H), retentates (R)
and permeates (P) quantified by means of three methods (DPPH, ABTS, and β-carotene) and calculated
as equivalents (in µg) of BHT per mL of hydrolysate.
Species
Fraction
DPPH (mg BHT Eq/mL)
ABTS (mg BHT q/mL)
β-Carotene (mg BHT Eq/mL)
XGLA
TALB
SCAN
PGLA
XGLA
TALB
SCAN
PGLA
XGLA
TALB
SCAN
PGLA
H
H
H
H
R
R
R
R
P
P
P
P
677.20 ± 114.42
578.87 ± 57.81
494.17 ± 210.3
405.30 ± 9.89
465.63 ± 30.47
435.97 ± 85.54
603.40 ± 30.88
422.97 ± 41.32
448.0 ± 66.45
457.67 ± 95.61
601.70 ± 175.33
416.03 ± 18.88
253.77 ± 1.85
199.57 ± 37.54
159.17 ± 30.78
151.20 ± 43.49
247.27 ± 10.70
174.10 ± 70.05
143.57 ± 29.80
124.90 ± 35.76
264.87 ± 18.86
192.83 ± 56.66
209.70 ± 53.71
134.87 ± 26.76
7.59 ± 1.93
5.67 ± 0.61
20.86 ± 3.53
15.26 ± 5.02
5.91 ± 1.04
11.94 ± 3.86
7.38 ± 11.69
19.18 ± 1.92
8.08 ± 0.33
15.26 ± 2.91
12.40 ± 9.14
17.03 ± 2.64
To test the influence of molecular size reduction of peptides on the functional properties of collagen
hydrolysates [10,14,46], the antioxidant capacity of unfractionated hydrolysates (H), retentates (R) and
permeates (P) were statistically analyzed. One-way ANOVA analysis of data revealed some significant
intraspecific differences between H, R, and P when using β-Carotene and DPPH methods (Figure 2)
and also showed interspecies differences between H, R, and P when using DPPH and ABTS methods
(Figure 3). The unfractionated hydrolysate (H) of XGLA showed significant higher value (p ≤ 0.05) of
antioxidant activity determined with DPPH compared to retentate or permeate fractions (Figure 2).
Significant differences were also observed in TALB, when data from the β-Carotene method were
analyzed, between unfractionated hydrolysate and the other two fractions (R and P). Interspecies
significant differences of hydrolysates, retentates, and permeates are presented in Figure 3 (p ≤ 0.05).
Figure 3A shows the differences found for unfractionated hydrolysates with ABTS; XGLA showed
the highest antioxidant activity whereas SCAN and PGLA were the lowest. However, unfractionated
hydrolysates did not show significant differences between species when the antioxidant activity
was determined with DPPH or the β-Carotene method (data not shown). In Figure 3B, it can be
also observed that the retentate fraction of SCAN presented the highest activity compared to other
three species when DPPH was used, while ABTS data (Figure 3C) showed significant differences in
retentate fractions only between XGLA and PGLA (lowest). Regarding permeate fractions (Figure 3D),
significant differences were observed only between XGLA and PGLA when ABTS data were analyzed.
400
Mar. Drugs 2017, 15, 131
Table 5. Amino acid composition of collagen hydrolysates of four species (residues/1000). Imino acids
includes proline and hydroxyproline.
HYDROLYSATES
Amino Acid
Hydroxyproline
Aspartic acid
Serine
Gultamic acid
Glycine
Histidine
Arginine
Threonine
Alanine
Proline
Cystine
Tyrosine
Valine
Methionine
Lysine
Isoleucine
Leucine
Phenylalanine
Iminoacids
% hydroxylation of prol
PGLA
SCAN
TALB
XGLA
84.65 ± 0.80
48.56 ± 0.45
36.39 ± 0.34
92.49 ± 0.89
230.71 ± 2.10
16.53 ± 0.13
93.64 ± 0.98
27.99 ± 0.32
105.81 ±1.11
106.47 ± 1.14
8.93 ±0.16
2.17 ± 0.01
27.84 ± 0.28
13.68 ± 0.15
34.16 ± 0.32
24.65 ± 0.26
26.11 ± 0.25
19.23 ± 0.19
191.12
44.29
87.50 ± 1.22
53.33 ± 0.77
52.45 ± 0.65
90.97 ± 1.27
227.17 ± 2.96
16.49 ± 0.18
93.00 ± 1.08
36.62 ± 0.59
93.50 ± 1.27
89.31 ± 1.26
8.29 ± 0.33
1.68 ± 0.02
34.12 ± 0.42
17.06 ± 0.26
37.55 ± 0.48
17.45 ± 0.20
25.95 ± 0.27
17.56 ± 0.17
176.81
49.48
86.97 ± 0.54
53.08 ± 0.24
34.81 ± 0.20
90.69 ± 0.42
215.82 ± 0.66
11. 18 ± 0.12
90.92 ± 0.65
40.00 ± .035
108.72 ± 0.74
100.22 ± 0.77
31.91 ± 0.33
1.84 ± 0.02
26.17 ± 0.17
15.19 ± 0.24
33.88 ± 0.14
13.05 ± 0.10
26.20 ± 0.13
19.34 ± 0.10
187.19
46.45
75.15 ± 0.36
59.39 ± 0.34
38.83 ± 0.19
92.02 ± 0.43
211.01 ± 1.06
14.91 ± 0.03
76.46 ± 0.16
39.00 ± 0.26
97.97 ± 0.62
99.87 ± 0.61
53.03 ± 0.16
2.24 ± 0.00
27.61 ± 0.12
12.39 ± 0.09
32.70 ± 0.17
19.15 ± 0.09
28.58 ± 0.07
19.67 ± 0.04
175.02
42.93
Figure 2. Intraspecific differences between hydrolysate (H), retentate (R) and permeate (P) in XGLA
analyzed by DPPH method and in TALB analyzed by β-Carotene method. Different letters indicate
significant differences among means (p ≤ 0.05).
Figure 3. Interspecies differences in hydrolysate fraction using ABTS (A); in retentate fraction using
DPPH (B) and ABTS (C); in permeate fraction using ABTS (D). Different letters indicate significant
differences among means (p ≤ 0.05).
401
Mar. Drugs 2017, 15, 131
Significant differences (p ≤ 0.05) were observed between the antioxidant capacity of unfractionated
hydrolysates of teleost (XGLA and TALB) and chondrychtyes (PGLA and SCAN) with the β-carotene
assay. Thus, the two teleost species XGLA and TALB showed lower antioxidant capacity than
chondrychtyes, results that might be in relation with the higher content of hydrophilic amino acids
(Asp, Ser, Gly, His, Arg, Thr, and Cys) in chondrychtyes hydrolysates compared to teleost (Table 5).
This result agree with other studies suggesting differences on the antioxidant defense system between
elasmobranchs and teleosts, due to different evolutionary rates and also due to different physical
activity, nutrient intake and environment in which each species develops [47].
In summary, antioxidant capacity results suggest that there is not a unique factor responsible for
this antioxidant capacity of hydrolysates, which seems to be influenced by the species which is being
studied, the type and length of the peptides present in the sample and the methodology employed to
determine the antioxidant activity.
2.3.3. Amino Acid Content
Table 5 shows the amino acid content of unfractionated collagen hydrolysates. Besides the
influence of amino acid composition and other factors on antioxidant activity (discussed above),
it is also of importance to highlight the increase in Cystine content in hydrolysates, in comparison
to non-hydrolyzed collagen (PSC). These variations might be explained because the alkaline pH
achieved during hydrolysis promotes reoxidation of cysteine residues to generate the original disulfide
bond [48]. The higher Cystine content found in TALB and XGLA hydrolysates is therefore related
to the low collagen yield obtained for those skins (Section 2.2.1). As it was previously reported,
the positive correlation between high disulfide bond content and low extraction yields is because of a
higher stabilization of supramolecular assemblies [49]. The higher content of methionine in SCAN
hydrolysates compared to the other species is also noteworthy.
3. Experimental Section
3.1. Raw Material
Fresh skin of the small-spotted catshark was obtained by a local fishing fleet, while frozen skin of
blue shark, swordfish, and yellowfin tuna was provided by a Lumar S.L industry (Galicia, Spain) and
stored at −20 ◦ C until used. Fins, fat, and muscle residues were removed from skins, then skin was
cut into small pieces (0.5 cm × 0.5 cm) and mixed thoroughly. The skin pieces of each species were
divided into three batches which were kept frozen at −20 ◦ C until collagen extraction.
Identification of fish species was performed by DNA analysis, following the methodology of
Blanco et al. [50].
3.1.1. Proximate Composition
Skin was analyzed for crude protein content by Kjeldhal method [51] in a DigiPREP HT digestor
(SCP Science, Quebec, QC, Canada) and a TitroLine easy titration unit (SCHOTT, Mainz, Germany).
Lipid content was determined by Bligh and Dyer [52]. Moisture was determined after heating the
sample overnight at 105 ◦ C and ash content was determined after heating the sample overnight at
600 ◦ C. The conversion factor used for calculating the protein content from Kjeldahl nitrogen data was
5.4 as collagen, the main protein present in skin, contains approximately 18.7% nitrogen [53,54].
3.1.2. Hydroxyproline Content
30 mg of dried grinded skin was introduced in hydrolysis microwaves tubes and 4 mL of 6 M HCl
were added. Hydrolysis was performed in a microwave (speed wave MWS-2) (Berghof GmbH,
Eningen, Germany) at a 150 ◦ C for 90 min at 70% power. Once the hydrolysis step finished,
samples were allowed to cool down to room temperature and were made up to a known volume with
6 M HCl. 400 µL of this solution were transferred to glass vials and left to dry in a vacuum desiccator
402
Mar. Drugs 2017, 15, 131
at 60 ◦ C in the presence of solid NaOH, after drawing air for 3 days. The resulting dry matter was
suspended in 8 mL of buffer (0.13 M citric acid, 0.75% glacial acetic acid, 0.6 M sodium acetate, 0.15 M
sodium hydroxide and 20.13% n-propanol, pH was adjusted to 6.5 with 0.2 M NaOH and volume was
brought to 660 mL with distilled water).
Hydroxyproline primary standard was prepared by dissolving 50 mg of hydroxyproline
(Sigma-Aldrich, St. Louis, MO, USA) in 100 mL of buffer. From this primary standard a
calibration curve of hydroxyproline, ranging from 0.5 µg/mL up to 10 µg/mL, was prepared.
Chloramine-T reagent was freshly prepared just before using it (0.05 M Chloramine in distilled
water). 3 mL of either samples or standards were placed in a tube and 1.5 mL of Chloramine-T reagent
was added, the mixture was allowed to react for 25 min. Upon completion of that time, chromogenic
reagent (15 g of p-dimethyl-amino-benzaldehyde, 60 mL of n-propanol, 26 mL of 70% perchloric acid
were made up to a volume of 100 mL with distilled water) was added and tubes introduced in a water
bath at 60 ◦ C for 15 min. Samples were left to cool to room temperature and after, absorbance was read
at 550 nm in a Beckman UV-VIS spectrophotometer (Beckman-Coulter, Brea, CA, USA).
3.2. Extraction of Pepsin Soluble Collagen (PSC) from Skin
Collagen from skin was extracted according to the methodology of Liu et al. [35] with
minor modifications (Figure 4). All procedures were performed at 4 ◦ C. Skin pieces of blue
shark and small-spotted-catshark were first treated with 0.1 N NaOH (1:15, w/v) and stirred for
24 h. Then, skins were washed with cold distilled water until a neutral pH was found, and skin
residues were extracted with 0.5 M acetic acid containing 0.1% (w/v) pepsin (0.5 U/mg; Acros Organics,
Janssen Pharmaceuticalaan 3a, Geel, Belgium), at a sample solution ratio of 1:40 (w/v) for 24 h.
Suspension was centrifuged at 6000× g for 20 min, the residue discarded and the supernatant was
salted-out by adding NaCl (final concentration of 2 M). The precipitate was dissolved in 0.5 M acetic
acid and dialyzed against water using 12,000 Da cut-off membranes for 3 days. Aliquots were obtained
and freeze-dried for analysis of Kjeldahl nitrogen, amino acid content, denaturation temperature,
and electrophoresis. The remaining liquid volume of dialyzed PSC was stored frozen at −20 ◦ C until
used for hydrolysis.
Figure 4. Scheme for the recovery of pepsin soluble collagen (PSC), preparation of the hydrolysate and
analytical determinations.
The procedure used for swordfish and yellowfin tuna skin was slightly different than the one
employed with sharks. Higher fat content in both swordfish and tuna skin required that after alkaline
403
Mar. Drugs 2017, 15, 131
treatment and before the acid pepsin extraction, samples were soaked in 10% butyl alcohol for 24 h to
remove any remaining fat at a sample/solid ratio of 1:10 (w/v), and then washed until neutral pH.
Also thre time for pepsin extraction of these skins was increased up to 3 days.
PSC yields were calculated using Kjeldahl nitrogen values (data not shown) in the collagen
solution considering that collagen contains approximately 18.7% of nitrogen [53,54].
3.3. Characterization of Pepsin Soluble Collagen (PSC) from Skin
3.3.1. Polyacrylamide Gel Electrophoresis
PSC samples for Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis (SDS-PAGE)
were prepared according to methodology reported by Sotelo et al. [19]. Molecular weights of PSC
subunits were estimated using high range molecular weight standards (BIO-RAD): Myosin (200 kDa);
β-Galactosidase (116 kDa); phosphorylase B (97 kDa) and analyzing the gel with the software Quantity
One (BIO-RAD).
3.3.2. Differential Scanning Calorimetry
Freeze-dried PSC samples were solubilized in 50 mM acetic acid (1 mg of freeze-dried sample/mL).
Thermostability of PSC solutions was measured in a DSC III microcalorimeter (Setaram, France)
by differential scanning calorimetry (DSC). The samples were weighed accurately in a Mettler
AE-240 balance, introduced into the calorimeter at 283.15◦ K and left for one hour to stabilize.
Afterwards, temperature increase was set to 1◦ K/min up to 343◦ K. The denaturation temperature was
calculated by difference with the apparent specific heat of ultrapure water.
3.3.3. Nitrogen Content
PSC was analyzed in terms of nitrogen content by Kjeldahl method described in Section 3.1.1
considering a 5.4 factor to obtain the collagen content.
3.3.4. Amino Acid Composition
100 mg of lyophilized PSC samples were hydrolyzed using 6 N hydrochloric acid under vacuum
pressure at 110 ◦ C for 24 h. HPLC-fluorescence determination of amino acids, using AccQ-Tag Amino
acid analysis column (Waters Co., Milford, MA, USA), was carried out after derivatization using the
AccQ-Tag Chemistry kit (Waters-WAT052875).
3.4. Enzymatic Hydrolysis of Pepsin Soluble Collagen
Enzymatic hydrolysis was carried out according to the methodology of Liu et al. [35] with
minor modifications. Prior to the hydrolysis process, the selected volume of each PSC collagen batch
was thawed. Hydrolysates were prepared in a stirred and thermostated reactor connected to a pH
electrode and a temperature probe, using the pH-Stat procedure, as described by Adler-Nissen [55].
Temperature and pH were recorded by a visual display at all time. Food-grade Alcalase (2.4 AU-A/g)
provided by Novo Nordisk (Bagsvaerd, Denmark) was used for the hydrolysis. The 2 L of thawed
PSC were introduced in the reactor and heated up to 55 ◦ C (Alcalase optimum temperature), pH was
adjusted to pH 8.0 with 1 N NaOH and maintained constant during the hydrolysis reaction by
automatically adding 1 N NaOH. Hydrolysis started with the addition of enzyme (enzyme/protein
ratio of 1:20 w/w). The hydrolysis reaction was allowed to continue for 3 h under constant stirring.
At the end of hydrolysis, the enzyme was inactivated by heating at 90 ◦ C for 5 min. The resulting
hydrolysates were freeze-dried and kept frozen at −20 ◦ C until characterization analysis.
404
Mar. Drugs 2017, 15, 131
Degree of Hydrolysis
Degree of hydrolysis (DH) was obtained according to the following expression [55,56] where DH
is the percent ratio between the total number of peptide bonds cleaved and the total number of peptide
bonds in the initial protein.
B × Nb
DH (%) =
(1)
α × M p × htot
where B is the volume (mL) of 1 M NaOH consumed during hydrolysis; Nb is the normality of NaOH;
Mp is the mass (g) of initial protein (nitrogen × 5.4); htot is the total number of peptide bonds available
for proteolytic hydrolysis, and α is the average degree of dissociation of the amino groups in the
protein substrate and was calculated as follows:
α=
10 pH − pK
1 + 10 pH − pK
(2)
The pK value dependent on the temperature of hydrolysis was calculated according to the
following expression, where T is the temperature (K):
298 − T
× 2400
pK = 7.8 +
298T
(3)
htot was calculated considering a mean molecular weight of amino acids around 125 g/mol [57],
and total content of amino acid in each PSC obtained from different species (PGLA: 78.4 g/100 g;
SCAN: 96.02 g/100 g; TALB: 92.75 g/100 g; XGLA: 80.84 g/100 g). htot of PSC collagen were 6.8 meq/g
protein, 8.3 meq/g protein, 8.06 meq/g protein and 7.02 meq/g protein for PGLA, SCAN, TALB,
and XGLA respectively.
3.5. Antioxidant Capacity of Pepsin Soluble Collagen Hydrolysates
3.5.1. Ultrafiltration
To test the influence of molecular weight on antioxidant capacity, four grams of freeze-dried
hydrolysates were dissolved in distilled water (1%) and ultrafiltrated in two steps using ultrafiltration
centrifugal devices (Amicon Ultra-15 Unit) (Merck Millipore, Billerica, MA, USA) with molecular
weight cut-off of 10 kDa and 3 kDa. After this process, fractions containing peptides with molecular
weight between 10,000 Da and 3000 Da (retentate fraction) and fractions containing peptides below
3000 Da (permeate fraction) were then freeze-dried and stored at −20 ◦ C until subjected to antioxidant
capacity analysis.
3.5.2. Antioxidant Activity Determinations
β-Carotene Bleaching Method
The β-carotene bleaching assay was performed according to Prieto et al. 2012 [58] with a microplate
spectrophotometer. Reactions were performed by combining in each well of a 96-well microplate,
25 µL of antioxidant (butyl hydroxytoluene (BHT) at 0–22.7 µM or hydrolysate samples) with 125 µL of
the β-carotene/linoleic emulsion. The microplate spectrophotometer (Multiskan Spectrum Microplate
Spectrophotometer) (Thermo Fisher Scientific, Waltham, MA, USA) was programmed to record the
absorbance at 470 nm and 45 ◦ C every three minutes during a period of 200 min with agitation at
660 cycles/min (1 mm amplitude).
1,1-Diphenyl-2-Picryhydrazyl (DPPH) Radical-Scavenging Capacity
The antioxidant activity as radical-scavenging capacity was assessed with DPPH as a free radical,
using an adaptation to the microplate of the method described by Brand-Williams et al. [59,60].
405
Mar. Drugs 2017, 15, 131
The decrease in the absorbance of hydrolysates and the BHT control (0–108 µM) was followed at
515 nm every 3 min during 200 min at 30 ◦ C.
ABTS Bleaching Method
The ABTS (2,2′ -azinobis-(3-ethyl-benzothiazoline-6-sulphonic acid) radical scavenging activities
were assessed according the protocol developed by Prieto et al. [60]. The absorbance at 414 nm and
30 ◦ C (maintaining continuous agitation) of samples and BHT (0–9.1 µM) were measured each 3 min
in the microplate reader.
In all methods, the kinetics of reaction were performed in triplicate following the methodology of
Amado et al. (2016) [61].
3.5.3. Amino Acid Composition
Hydrolysates were analyzed for amino acid content following the methodology described in
Section 3.3.3.
3.5.4. Statistical Analysis
Interspecific and intraspecific differences regarding antioxidant capacity between unfractionated
hydrolysates (H) and 3 kDa MWCO ultrafiltrated fractions: permeates (P) and retentates (R) were tested
by one-way analysis of variance (ANOVA). It was applied to a Post hoc comparison test. Significance
levels were set at p ≤ 0.05. Statistical tests were performed with IBM SPSS 23 (IBM Corporation,
Armonk, NY, USA).
Acknowledgments: The authors would like to acknowledge the financial support through the projects MARMED
(ref: Atlantic Area Programme 2011-1/164) and NOVOMAR (ref: FEDER POCTEP_0687-POCTEP Programme).
Authors are also grateful to Marta P. Testa, Araceli Menduiña and Ana Durán for their professional work
and dedication.
Author Contributions: Carmen G. Sotelo, José Antonio Vázquez, Ricardo I. Pérez-Martín and María Blanco
conceived and designed the experiments; María Blanco performed the experiments; Carmen G. Sotelo,
José Antonio Vázquez, Ricardo I. Pérez-Martín and María Blanco analyzed the data; María Blanco wrote the paper.
Carmen G. Sotelo participated in the redaction of the manuscript. Carmen G. Sotelo and Ricardo I. Pérez-Martín
critically revised the manuscript.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
6.
Food and Agriculture Organization. El Estado Mundial de la Pesca y la Acuicultura; FAO: Roma, Italy, 2016.
Blanco, M.; Fraguas, J.; Sotelo, C.G.; Pérez-Martín, R.I.; Vázquez, J.A. Production of Chondroitin
sulphate from head, skeleton and fins of Scyliorhinus canicula by-products by combination of enzymatic,
chemical precipitation and ultrafiltration methodologies. Mar. Drugs 2015, 13, 3287–3308. [CrossRef]
[PubMed]
Gómez-Guillén, M.C.; Turnay, J.; Férnandez-Díaz, M.D.; Ulmo, N.; Lizarbe, M.A.; Montero, P. Structural and
physical properties of gelatin extracted from different marine species: A comparative study. Food Hydrocoll.
2002, 16, 25–34. [CrossRef]
Karayannakidis, P.D.; Chatziantoniou, S.E.; Zotos, A. Effects of selected process parameters on physical and
sensorial properties of yellowfin tuna (Thunnus albacares) skin gelatin. J. Food Process Eng. 2014, 37, 461–473.
[CrossRef]
Chi, C.F.; Cao, Z.H.; Wang, B.; Hu, F.Y.; Li, Z.R.; Zhang, B. Antioxidant and functional properties of collagen
hydrolysates from Spanish mackerel skin as influenced by average molecular weight. Molecules 2014, 19,
11211–11230. [CrossRef] [PubMed]
Halim, N.R.A.; Yusof, H.M.; Sarbon, N.M. Functional and bioactive properties of fish protein hydrolysates
and peptides: A comprehensive review. Trends Food Sci. Technol. 2016, 51, 24–33. [CrossRef]
406
Mar. Drugs 2017, 15, 131
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
Nam, K.A.; You, S.G.; Kim, S.M. Molecular and physical characteristics of squid (Todarodes pacificus) skin
collagens and biological properties of their enzymatic hydrolysates. J. Food Sci. 2008, 73, 249–255. [CrossRef]
[PubMed]
Byun, H.G.; Kim, S.K. Purification and characterization of angiotensis I converting enzyme (ACE) inhibitory
peptides from Alaska Pollack (Theragra chalcogramma) skin. Process Biochem. 2001, 36, 1155–1162. [CrossRef]
Chalamaiah, M.; Kumar, B.D.; Hemalatha, R.; Jyothirmayi, T. Fish protein hydrolysate:
Proximate composition, amino acid composition, antioxidant activities and applications: A review.
Food Chem. 2012, 135, 3020–3038. [CrossRef] [PubMed]
Jia, J.; Zhou, Y.; Lu, J.; Chen, A.; Li, Y.; Zheng, G. Enzymatic hydrolysis of Alaska Pollack (Theragra chalcogramma)
skin and antioxidant activity of the resulting hydrolysate. J. Sci. Food Agric. 2010, 90, 635–640. [CrossRef]
[PubMed]
Vázquez, J.A.; Blanco, M.; Fraguas, J.; Pastrana, L.; Pérez-Martín, R.I. Optimisation of the extraction and
purification of chondroitin sulphate from head by-products of Prionace glauca by environmental friendly
process. Food Chem. 2016, 198, 28–35. [CrossRef] [PubMed]
Autoridad Portuaria de Vigo. Memoria Anual 2015; Autoridad Portuaria de Vigo: Pontevedra, Spain, 2015.
Blanco, M. Valorización de Descartes y Subproductos de Pintarroja (Scyliorhinus canicula). Ph.D. Thesis,
Universidad de Vigo, Pontevedra, Spain, December 2015.
Klompong, V.; Benjakul, S.; Kantachote, D.; Shahidi, F. Antioxidative activity and functional properties of
protein hydrolyste of yellow stripe trevally (Selaroides leptolepis) as influenced by the degree of hydrolysis
and enzyme type. Food Chem. 2007, 102, 1317–1327. [CrossRef]
Theodore, A.E.; Raghavan, S.; Kristinsson, H.G. Antioxidative activity of protein hydrolysates prepared from
alkaline-aided channel catfish protein isolates. J. Agric. Food Chem. 2008, 56, 7459–7466. [CrossRef] [PubMed]
Kittiphattanabawon, P.; Benjakul, S.; Visessanguan, W.; Nagai, T.; Tanaka, M. Characterisation of acid-soluble
collagen from skin and bone of bigeye snapper (Pricanthus tayenus). Food Chem. 2005, 89, 363–372. [CrossRef]
Edwards, C.A.; O’Brien, W.D., Jr. Modified assay for determination of hydroxyproline in a tissue hydrolyzate.
Clin. Chim. Acta 1980, 104, 161–167. [CrossRef]
Ahmad, M.; Benjakul, S.; Nalinanon, S. Compositional and physicochemical characteristics of acid solubilized
collagen extracted from the skin of unicorn leatherjacket (Aluterus monoceros). Food Hydrocoll. 2010, 24,
588–594. [CrossRef]
Sotelo, C.G.; Blanco, M.; Ramos-Ariza, P.; Pérez-Martín, R.I. Characterization of collagen from different
discarded fish species of the West coast of the Iberian Peninsula. J. Aquat. Food Prod. Technol. 2015, 25,
388–399. [CrossRef]
Benjakul, S.; Thiansilakul, Y.; Visessanguan, W.; Roytrakul, S.; Kishimura, H.; Prodpran, T. Extraction and
characterisation of pepsin-solubilised collagens from the skin of bigeye snapper (Priacanthus tayenus and
Prianthus macracanthus). J. Sci. Food Agric. 2010, 90, 132–138. [CrossRef] [PubMed]
Zhang, M.; Liu, W.; Li, G. Isolation and characterisation of collagens from the skin of largefin longbarbel
catfish (Mystus macropterus). Food Chem. 2009, 115, 826–831. [CrossRef]
Lynn, A.K.; Yannas, I.V.; Bonfield, W. Antigenicity and immunogenicity of collagen. J. Biomed. Mater. Res. B
2004, 71, 343–354. [CrossRef] [PubMed]
Morimoto, K.; Kunii, S.; Hamano, K.; Tonomura, B. Preparation and structural analysis of
actinidain-processed atelocollagen of yellowfin tuna (Thunnus albacares). Biosci. Biotechnol. Biochem. 2004, 68,
861–867. [CrossRef] [PubMed]
Nagai, T.; Araki, Y.; Suzuki, N. Collagen of the skin of ocellate puffer fish (Takifugu rubripes). Food Chem. 2002,
78, 173–177. [CrossRef]
Jongjareonrak, A.; Benjakul, S.; Visessanguan, W.; Tanaka, M. Isolation and characterization of collagen from
bigeye snapper (Priacanthus macracanthus) skin. J. Sci. Food Agric. 2005, 85, 1203–1210. [CrossRef]
Jongjareonrak, A.; Benjakul, S.; Visessanguan, W.; Tanaka, M. Isolation and characterization of acid and
pepsin-solubilised collagens from the skin of browntripe red snapper (Lutjanus vitta). Food Chem. 2005, 93,
475–484. [CrossRef]
Zelechowska, E.; Sadowska, M.; Turk, M. Isolation and some properties of collagen from the backbone of
Baltic cod (Gadus morhua). Food Hydrocoll. 2010, 24, 325–329. [CrossRef]
Borderías, A.J.; Montero, P. Changes in fish muscle collagen during frozen storage. In Storage Lives of Chilled
and Frozen Fish and Fish Products; International Institute of Refrigeration: Hong Kong, China, 1985; pp. 85–91.
407
Mar. Drugs 2017, 15, 131
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
Badij, F.; Howell, N. Elucidation of the effect of formaldehyde and lipids on frozen stored cod collagen by
FT-Raman spectroscopy and differential scanning calorimetry. J. Agric. Food Chem. 2003, 51, 1440–1446.
Foegeding, E.A.; Lanier, T.C.; Hultin, H.O. Characteristics of edible muscle tissues. In Food Chemistry;
Fennema, O.R., Ed.; Marcel Dekker, Inc.: New York, NY, USA, 1996; pp. 902–906.
Kittiphattanabawon, P.; Benjakul, S.; Visessanguan, W.; Kishimura, H.; Shahidi, F. Isolation and
characteridsation of collagen from the skin of brownbanded bamboo shark (Chiloscyllium punctatum).
Food Chem. 2010, 119, 1519–1526. [CrossRef]
Woo, J.; Yu, S.; Cho, S.; Lee, Y.; Kim, S. Extraction optimization and properties of collagen from yellowfin
tuna (Thunnus albacares) dorsal skin. Food Hydrocoll. 2008, 22, 879–887. [CrossRef]
Love, R.M.; Yamaguchi, K.; Créach, Y.; Lavéty, J. The connective tissues and collagens of cod during starvation.
Comp. Biochem. Physiol. B 1976, 55, 487–492. [CrossRef]
Sikorski, Z.E.; Kolakowska, A.; Pan, B.S. The nutritive composition of the major groups of marine food
organisms. In Seafood: Resources, Nutritional Composition and Preservation; Sikorski, Z.E., Ed.; CRC Press:
Boca Raton, FL, USA, 1990; pp. 29–54.
Liu, D.; Liang, L.; Regenstein, J.M.; Zhow, P. Extraction and characterisation of pepsin-solubilised collagen
from fins, scales, skins, bones and swim bladders of bighead carp (Hypophthalmichthys nobilis). Food Chem.
2012, 133, 1441–1448. [CrossRef]
Nishimoto, M.; Sakamoto, R.; Mizuta, S.; Yoshinaka, R. Identification and characterization of molecular
species of collagen in ordinary muscle and skin of the Japanese flounder Paralichthys olivaceus. Food Chem.
2005, 90, 151–156. [CrossRef]
Nagai, T.; Suzuki, N. Preparation and partial characterization of collagen from paper nautilus (Argonauta argo,
Linnaeus) uter skin. Food Chem. 2002, 76, 149–153. [CrossRef]
Singh, P.; Benjakul, S.; Maqsood, S.; Kishimura, H. Isolation and characterization of collagen extracted from
the skin of the striped catfish (Pangasianodon hypophtalmus). Food Chem. 2011, 124, 97–105. [CrossRef]
Nomura, Y.; Toki, S.; Ishii, Y.; Shirai, K. The physicochemical property of shark type I collagen gel and
membrane. J. Agric. Food Chem. 2000, 48, 2028–2032. [CrossRef] [PubMed]
Wong, D.S. Mechanism and Theory in Food Chemistry; Van Nostrand Reinhold: New York, NY, USA, 1989.
Bougatef, A.; Nedjar-Arroume, N.; Manni, L.; Ravallec, R.; Barkia, A.; Guillochon, D.; Nasri, M.
Purification and identification of novel antioxidant peptides from enzymatic hydrolysates of sardinelle
(Sardinella aurita) by-products proteins. Food Chem. 2010, 118, 559–565. [CrossRef]
Kristinsson, H.G.; Rasco, B.A. Fish protein hydrolysates: Production, biochemical and functional properties.
Crit. Rev. Food Sci. Nutr. 2000, 40, 43–81. [CrossRef] [PubMed]
Quian, Z.-J.; Jung, W.K.; Kim, S.K. Free radical scavenging activity of a novel antioxidative peptide purified
from hydrolysate of bullfrog skin, Rana catesbeiana Shaw. Bioresour. Technol. 2008, 99, 1690–1698. [CrossRef]
[PubMed]
Harman, L.S.; Mottley, C.; Mason, R. Free radical metabolites of L-cysteine oxidation. J. Boil. Chem. 1984, 259,
5606–5611.
Sarmadi, B.H.; Ismail, A. Antioxidative peptides from food proteins: A review. Peptides 2010, 31, 1949–1956.
[CrossRef] [PubMed]
Chi, C.-F.; Wang, B.; Deng, Y.Y.; Wang, Y.M.; Deng, S.G.; Ma, J.Y. Isolation and characterization of three
antioxidant pentapeptides from protein hydrolsates of monkfish (Lophius litulon) muscle. Food Res. Int. 2014,
55, 222–228. [CrossRef]
Vélez-Alavez, M. Evaluación de los Indicadores de Estrés Oxidativo Asociados a las Características de Nado
en Elasmobranquios y Teleósteos. Ph.D. Thesis, Centro de Investigaciones Biológicas del Noroeste, S.C.,
La Paz, Mexico, 2015.
Lundblad, R. Techniques in Protein Modification; CRC Press: Boca Raton, FL, USA, 1994.
Barth, D.; Kyrieleis, O.; Frank, S.; Renner, C.; Moroder, L. The role of cystine knots in collagen folding
and stability, part II. Conformational properties of (Pro-Hyp-Gly)n model trimers with N- and C-terminal
collagen type III cystine knots. Chemistry 2003, 9, 3703–3714. [CrossRef] [PubMed]
Blanco, M.; Perez-Martin, R.I.; Sotelo, C.G. Identification of Shark Species in Seafood Products by Forensically
Informative Nucleotide Sequencing (FINS). J. Agric. Food Chem. 2008, 56, 9868–9874. [CrossRef] [PubMed]
Association of Official Analytical Chemistry. Methods of Analysis, 15th ed.; Association of Official Analytical
Chemistry: Washington, DC, USA, 1997.
408
Mar. Drugs 2017, 15, 131
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
Bligh, E.G.; Dyer, W.J. A rapid method of total lipid extraction and purification. Can. J. Biochem. Phsiol. 1959,
37, 911–917. [CrossRef] [PubMed]
Muyonga, J.H.; Cole, C.G.B.; Duodu, K.G. Characterisation of acid soluble collagen from skins of Young and
adult Nile perch (Lates niloticus). Food Chem. 2004, 85, 81–89. [CrossRef]
Eastoe, J.; Eastoe, B. A method for the determination of total nitrogen in proteins. Br. Gel. Glue Res. Assoc. Res. Rep.
1952, 5, 1–17.
Adler-Nissen, J. Control of the proteolytic reaction and of the level of bitterness in protein hydrolysis
processes. J. Chem. Technol. Biotechnol. 1984, 34, 215–222. [CrossRef]
Camacho, F.; González-Tello, P.; Páez-Dueñas, M.P.; Guadix, E.M.; Guadix, A. Correlation of base
consumption with the degree of hydrolysis in enzymic protein hydrolysis. J. Dairy Res. 2001, 68, 251–265.
[CrossRef] [PubMed]
Nielsen, P.M.; Petersen, D.; Dambmann, C. Imporoved method for determining food protein degree of
hydrolysis. J. Food Sci. 2001, 66, 642–646. [CrossRef]
Prieto, M.A.; Rodríguez-Amado, I.; Vázquez, J.A.; Murado, M.A. β-Carotene assay revisited. Application to
characterize and quantify antioxidant and prooxidant activities in a microplate. J. Agric. Food Chem. 2012, 60,
8983–8993. [CrossRef] [PubMed]
Brand-Williams, W.; Cuvelier, M.E.; Berset, C. Use of a free radical method to evaluate antioxidant activity.
LWT-Food Sci. Technol. 1995, 28, 25–30. [CrossRef]
Prieto, M.A.; Curran, T.P.; Gowen, A.; Vázquez, J.A. An efficient methodology for quantification of synergy
and antagonismin single electron transfer antioxidant assays. Food Res. Int. 2015, 67, 284–298. [CrossRef]
Amado, I.R.; González, M.P.; Murado, M.A.; Vázquez, J.A. Shrimp wastewater as a source of astaxanthin
and bioactive peptides. J. Chem. Technol. Biotechnol. 2016, 91, 793–805. [CrossRef]
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
409
marine drugs
Review
Marine Fish Proteins and Peptides for
Cosmeceuticals: A Review
Jayachandran Venkatesan 1 , Sukumaran Anil 2 , Se-Kwon Kim 3, * and Min Suk Shim 1, *
1
2
3
*
Division of Bioengineering, Incheon National University, Incheon 406-772, Korea; venkatjchem@gmail.com
Department of Preventive Dental Sciences, College of Dentistry, Prince Sattam Bin Abdulaziz University,
Riyadh, Post Box 153, AIKharj 11942, Saudi Arabia; drsanil@gmail.com
Department of Marine Life Sciences, Korean Maritime and Ocean University, 727 Taejong-ro,
Yeongdo-Gu, Busan 49112, Korea
Correspondence: sknkim@pknu.ac.kr (S.-K.K.); msshim@inu.ac.kr (M.S.S.);
Tel.: +82-51-629-7550 (S.-K.K.); +82-32-835-8268 (M.S.S.)
Academic Editor: Orazio Taglialatela-Scafati
Received: 28 February 2017; Accepted: 11 May 2017; Published: 18 May 2017
Abstract: Marine fish provide a rich source of bioactive compounds such as proteins and peptides.
The bioactive proteins and peptides derived from marine fish have gained enormous interest
in nutraceutical, pharmaceutical, and cosmeceutical industries due to their broad spectrum of
bioactivities, including antioxidant, antimicrobial, and anti-aging activities. Recently, the development
of cosmeceuticals using marine fish-derived proteins and peptides obtained from chemical or
enzymatical hydrolysis of fish processing by-products has increased rapidly owing to their
activities in antioxidation and tissue regeneration. Marine fish-derived collagen has been utilized
for the development of cosmeceutical products due to its abilities in skin repair and tissue
regeneration. Marine fish-derived peptides have also been utilized for various cosmeceutical
applications due to their antioxidant, antimicrobial, and matrix metalloproteinase inhibitory
activities. In addition, marine fish-derived proteins and hydrolysates demonstrated efficient
anti-photoaging activity. The present review highlights and presents an overview of the current
status of the isolation and applications of marine fish-derived proteins and peptides. This review also
demonstrates that marine fish-derived proteins and peptides have high potential for biocompatible
and effective cosmeceuticals.
Keywords: marine fish; cosmeceuticals; proteins; peptides; hydrolysates; collagen; antioxidant;
anti-photoaging
1. Introduction
Oceans cover about 70% of the earth’s surface and are inhabited by a large variety of living
organisms. The marine environment serves as an enormous resource that provides abundant bioactive
substances in the form of food, cosmeceuticals, and pharmaceutical products. Recently, much attention
has been paid to obtaining bioactive proteins and peptides from various marine organisms, including
fish, algae, crustaceans, and sponges, for cosmeceutical and pharmaceutical applications [1,2].
Marine bioactive proteins and peptides, depending on their structures and amino acid sequences,
exhibit a wide range of biological activities including antioxidant, antimicrobial, anticancer,
immunomodulatory, antihypertensive, anticoagulant, and anti-diabetic effects [3,4].
Marine fish is mostly used as a source of food for human consumption, which has resulted
in several fish processing industries producing fish meat. However, these industries discard huge
amounts of waste containing fish skin and bones, which in turn aggravate the problem of environmental
pollution. To avoid such issues, by-products generated by seafood processing industries are utilized to
Mar. Drugs 2017, 15, 143
410
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2017, 15, 143
isolate bioactive compounds beneficial for human health. This process not only assists in decreasing
the pollution but also increases the value of the by-products from fish processing [5–7]. Fish processing
waste contains significant amounts of useful proteins, which represent a source for bioactive peptide
mining. For example, collagen is one of the most abundant proteins that can be extracted from the skin,
bones, and scales of fish. Collagen has been extensively utilized for various applications, including
cosmeceuticals [8], functional foods [9], tissue engineering [10,11], and anti-diabetic medications [12].
In addition to bioactive proteins, various bioactive peptides can be produced from marine fish
via chemical or enzymatical hydrolysis. The peptides, which are present in the inactive form within
the protein chains, are activated after their hydrolysis using enzymes, including trypsin, proteinases,
chymotrypsin, alcalase, and pepsin [3,13–15]. Marine fish waste-derived bioactive peptides have
gained tremendous interest in nutraceutical and cosmeceutical industries due to their broad spectrum
of bioactivities, including antioxidant, antimicrobial, antihypertensive, calcium-binding, and obesity
control properties [3,16]. This review describes various bioactive proteins and peptides, which were
identified in marine processing waste with emphasis on their potential bioactivities for cosmeceutical
applications. Moreover, it outlines current technologies used in the production and purification of the
marine fish-derived proteins and peptides.
2. Marine Fish Proteins and Peptides
Figure 1 depicts the increasing number of the studies on marine fish-derived proteins and peptides
in the last two decades. Marine fish proteins mainly consist of collagen, which has been widely utilized
in cosmeceutical areas owing to its moisturizing properties. In addition, it has been extensively studied
in pharmaceuticals, nutraceuticals, and food applications. Collagen can be isolated from by-products
of fish processing, such as fish bones and fish skin [17–19].
Figure 1. Articles indexed in Scopus with the keywords (A) marine fish proteins and (B) marine fish
peptides. Graph shows the continuous research growth on marine fish proteins and peptides. The bar
graph highlights the number of articles indexed in Scopus on “marine fish proteins”, which is greater
than that of “marine fish peptides”.
3. Marine Fish-Derived Collagen
Collagen is a main structural protein in connective tissues of skin and bone. It is commonly
obtained from bovine and porcine skin. The bovine and porcine collagens have been extensively used
for pharmaceutical, cosmeceutical, and nutraceutical purposes. However, the outbreak of certain
transmissible diseases such as bovine spongiform encephalopathy and some religious issues associated
with the use of bovine proteins hamper their use. Hence, there has been a need to find a suitable
alternative to solve these issues, which has led several researchers to turn toward marine sources for
the production of collagen. Marine-derived collagen has an ability to scavenge free radicals, and thus
411
Mar. Drugs 2017, 15, 143
can be utilized for skin care products [17,20,21]. Marine-derived collagen has also been widely used as
a scaffold for tissue engineering due to its excellent bioactive properties, including biocompatibility,
low antigenicity, high biodegradability, and cell growth potential [22–24]. There are two types of
collagen: fibrillar and nonfibrillar. Marine fish often contain Type I fibrillar collagen in skin and
bones [25].
3.1. Isolation of Marine Fish-Derived Collagen
Although around 75% of the fish weight consists of skin, bones, head, and scales, they are often
discarded as by-products by the seafood processing industries [26]. These by-products are a rich source
of collagen with a variety of bioactivities. Figure 2 shows the common procedures for isolating collagen
from the skin and bones of marine fish [19,26,27]. Acid solubilization and pepsin solubilization are
major methods for isolating collagen from various parts of fish species (e.g., skin, bones, and scales).
For the acid-soluble collagen (ASC) method, 0.5 M acetic acid is used to digest the fish skin in sufficient
time, whereas 10% w/v pepsin is used for the pepsin-soluble collagen (PSC) method. Table 1 shows
a list of some important marine fish species used for collagen isolation. It is observed that the PSC
method leads to higher amounts of collagen as compared to the ASC method [19,27,28]. This implies
that pepsin in the PSC method is more efficient in digesting skin or bone tissues as compared to acid
solution in the ASC method.
Figure 2. A flowchart for the isolation of collagen from marine fish skin. (A) acid-soluble collagen
(ASC) method and (B) pepsin-soluble collagen (PSC) method.
412
Mar. Drugs 2017, 15, 143
Table 1. Important marine fish species used to isolate collagen.
Fish Species Name
Parts
Method
Yield (%)
Reference
Lagocephalus gloveri
Thunnus obesus
Paralichthys olivaceus, Sebastes schlegeli,
Lateolabrax maculatus, Pagrus major
Takifugu rubripes
Sepiella inermis
Lutjanus vitta
Magalaspis cordyla
Otolithes ruber
Evenchelys macrura
Saurida spp., Trachurus japonicus, Mugil cephalis,
Cypselurus melanurus, Dentex tumifrons
Cyanea nozakii Kishinouye
Sardinella longiceps
Skin
Bone
PSC
ASC and PSC
54.3
–
[17]
[19]
Skin
ASC
–
[22]
Skin
Skin
Skin
Bone
Bone
Skin
ASC and PSC
ASC and PSC
ASC and PSC
ASC and PSC
ASC and PSC
ASC and PSC
10.7 and 44.7
0.58 and 16.23
9.0 and 4.7
30.5 and 27.6
45.1 and 48.6
80 and 7.1
[27]
[28]
[29]
[30]
[30]
[31,32]
Scales
ASC
0.13–1.5%
[33]
All parts
Scales
ASC and PSC
ASC and PSC
[34]
[35]
Priacanthus tayenus
Skin and bone
ASC
Priacanthus tayenus
Priacanthus tayenus and Priacanthus
macracanthus
Parupeneus heptacanthus
Mystus macropterus
Syngnathus schlegeli
Jellyfish
Chrysaora sp.
Skin
PSC
13.0 and 5.5
1.25 and 3
10.94 and 1.59
(Skin and bone)
–
[36]
[37]
Skin
PSC
–
[38]
Scale
Skin
All parts
All parts
All parts
ASC and PSC
ASC and PSC
ASC and PSC
PSC
PSC
0.46 and 1.2
16.8 and 28
5.5 and 33.2
46.4
9–19
[39]
[40]
[41]
[42]
[43]
3.2. Marine Fish-Derived Collagen in Cosmeceuticals
Marine fish-derived collagen is extensively employed in the development of cosmeceutical
products due to its excellent bioactivity toward skin repair and regeneration. The marine fish-derived
collagen possesses a higher absorbing capacity than the collagen from animal sources [44]. In addition,
marine fish-derived collagen has low odor and improved mechanical strength, prerequisites for
cosmetic products [8]. Skin-hydrating and skin-firming effects of cosmetic formulations (cream or
serum formulations) using collagen derived from fish were evaluated [45]. The result suggested that
serum formulations displayed a better moisturizing effect within a short duration [44,45]. The cream
formulations appeared to become more active later, particularly following the repetitive applications.
However, a sustained tensor (firming) effect was observed during the treatment using both the lotion
and the cream [45].
3.3. Marine Fish-Derived Collagen in Wound Healing and Tissue Engineering
Tissue-engineered skin substitutes serve as a promising therapeutic agent in replacing the skin
lost in wounds such as burns by providing cells, bioactive compounds, bioactive polymers, and proper
microenvironments, thereby initiating the wound healing process [46–48]. Currently, a main source
of collagen is bovine skin and tendons as well as porcine skin, which suffer from drawbacks such
as transmission of prions [49]. Therefore, marine organism-derived materials have become initiators
or co-initiators of hundreds of promising pharmaceutical and tissue-engineered skin substitutes [50].
Many studies based on marine organism-derived collagen scaffolds for skin tissue regeneration have
demonstrated a high potential in clinical applications [51]. In this regard, a composite film comprising
salmon milt DNA and salmon collagen showed a remarkable efficacy in wound regeneration [52].
The implantation of the film into a full-thickness wound in the rat dorsal region resulted in tissue
regeneration with a morphological appearance similar to that of native rat dermis tissues. In addition,
it significantly enhanced the formation of blood capillaries [52].
The abundant presence of type I collagen in fish bone tissues has widely increased the applications
of collagen-based scaffolds for bone tissue engineering [53–55]. Collagen plays an important role
in stimulating the differentiation of bone progenitor cells into osteoblasts through interaction
413
Mar. Drugs 2017, 15, 143
with transmembrane α2β1 integrin receptors, and subsequently eliciting cell growth and mineral
production [56,57]. The incorporation of glycosaminoglycans (GAGs) into collagen has shown to
enhance osteoblastic differentiation of mesenchymal stem cells (MSCs) both in vivo and in vitro [58,59].
4. Marine Fish-Derived Peptides
Marine fish proteins consist of small peptides, which are often present in the inactive form
with a full protein sequence. Enzymatic hydrolysis is frequently used to isolate short and bioactive
peptides from marine organisms and seafood waste products. A large amount of histidine-containing
dipeptides, carnosine (β-alanylhistidine), and anserine (β-alanyl-1-methylhistidine) are present in
tuna, salmon, and eels [60]. Peptides serve as important active ingredients for several pharmaceutical
and cosmeceutical applications [4,61,62]. The bioactive peptides are usually made up of 3–20 amino
acid residues. Marine fish-derived peptides exhibit various biological activities such as antioxidant,
antimicrobial, and angiotensin-I-converting inhibitory activity, as well as cancer metastasis inhibition,
and immunostimulant activity [63–65]. The most commonly used proteinases for the hydrolysis of fish
proteins include alcalase, chymotrypsin, and pepsin [66–68].
4.1. Isolation of Marine Fish Peptides
Enzymatic hydrolysis is one of the commonly used methods to obtain bioactive peptides.
The mechanistic study of the enzymatic hydrolysis of fish proteins is described elsewhere [69].
The general procedures to produce collagen peptides from marine fish skin and bone are shown
in Figure 3. Various antioxidant marine fish-derived peptides were obtained through enzymatic
hydrolysis methods [70,71]. Different kinds of enzymes (e.g., alcalase, α-chymotrypsin, neutrase,
papain, pepsin, and trypsin) were used for the optimized conditional buffer system (Table 2) [70].
The peptides are commonly separated using chromatographic techniques and ultrafiltration
membranes. The same group also reported the use of a series of ultrafiltration membranes to separate
the peptides [72]. Fast protein liquid chromatography (FPLC) and reverse phase high-pressure liquid
chromatography (RP-HPLC) were widely utilized to purify the peptides.
Figure 3. The flowchart showing the common procedures for the isolation and identification of the
marine fish-derived peptides through enzymatic hydrolysis methods [70].
414
Mar. Drugs 2017, 15, 143
Table 2. Conditions for the enzymatic hydrolysis of tuna backbone proteins.
Enzymes for Hydrolysis
Buffer
pH
Temperature (◦ C)
alcalase
α-chymotrypsin
papain
pepsin
neutrase
trypsin
0.1 M Na2 HPO4 –NaH2 PO4
0.1 M Na2 HPO4 –NaH2 PO4
0.1 M Na2 HPO4 –NaH2 PO4
0.1 M Glycine–HCl
0.1 M Na2 HPO4 –NaH2 PO4
0.1 M Na2 HPO4 –NaH2 PO4
7
8
6
2
8
8
50
37
37
37
50
37
4.2. Biological Activities of Marine Fish Peptides as Cosmeceuticals
An increasing interest in health, well-being, and physical appearance has resulted in high
demand for various cosmetics. Recently, a combination of cosmetics with pharmaceuticals and
marine-derived biologically active ingredients has become the hallmark of cosmetic industries [15,73–76].
Antioxidant, anti-inflammatory, reduction of melanin synthesis, tyrosinase inhibition, and matrix
metalloproteinase (MMP) inhibitor tests are important in the development of cosmeceuticals against
aging and wrinkling of the skin (Table 3).
Table 3. Biological activities for cosmeceutical applications. MMP: matrix metalloproteinase.
Activity
Cosmeceutical Applications
Reference
Antioxidant
Tyrosinase inhibitor
MMP inhibitor
Anti-inflammatory
Anti-aging, photo-protective effects
Whitening
Anti-wrinkle
Skin soothing
[15]
[75]
[76]
[77]
4.3. Antioxidant Fish Peptides
Antioxidants play an important role in providing protection against oxidative stress.
The generation of oxidative stress is attributed to the formation of several reactive oxygen species,
including alkyl radicals, hydroxyl radicals, superoxide radicals, peroxide radicals, and singlet
oxygen species. In the human body, an imbalance between the free radicals and antioxidants
leads to skin damage, inflammation, cancer, and neuron-related diseases [78]. The highly reactive
free radicals can easily damage cellular membranes, DNA, proteins, and lipids, and are widely
accepted as the primary reason for skin aging [79]. The human body possesses various antioxidant
enzymes (e.g., catalase, superoxide dismutase, and glutathione peroxidase) and biomolecules
(e.g., vitamin C, vitamin glutathione, and ubiquinone) to control the free radicals inside [79]. In addition,
several synthetic products are often used to inhibit free radical activity (e.g., butylated hydroxyanisole
(BHA), butylated hydroxytoluene (BHT), tert-butylhydroquinone (TBHQ), and propyl gallate [80]).
However, the major drawback of using these antioxidants is the safety concern. Therefore, considerable
attention has been diverted to the use of naturally-derived antioxidants [81–85]. Recently, a number
of studies have demonstrated that various peptides derived from marine fish serve as effective
antioxidants (Table 4) [71,86–98]. Enzymes for the isolation of antioxidant peptides from the marine
fish are also described in Table 4.
Various types of methods have been used to evaluate the antioxidant activity of
fish-derived peptides, including the 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging
assay, the 2,2′ -azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) radical scavenging assay,
hydroxyl radical scavenging activity, Cu2+ chelating activity, and Fe2+ chelating activity [99–105].
415
Mar. Drugs 2017, 15, 143
Table 4. Potential bioactive antioxidant peptides from marine fish resources.
Fish Species Name
Enzymes for Hydrolysis
Peptides (Amino Acid Sequence)
Reference
Scomber austriasicus
protease N
–
[60]
Thunnus obesus
alcalase, α-chymotrypsin, neutrase, papain,
pepsin, and trypsin
H-Leu-Asn-Leu-Pro-Thr-Ala-Val-Tyr-MetVal-Thr-OH
[71]
Salmon
alcalase, flavourzyme, neutrase, pepsin,
protamex, and trypsin
Peptides (unknown sequence, 1000–2000 Da)
[86]
Decapterus maruadsi
alcalase, neutral protease, papain, pepsin,
and trypsin
His-Asp-His-Pro-Val-Cys and
His-Glu-Lys-Val-Cys
[87]
Johnius belengerii
pepsin, trypsin, papain, α-chymotrypsin,
alcalase, and neutrase
Glu-Ser-Thr-Val-Pro-Glu-Arg-Thr-His-ProAla-Cys-Pro-Asp-Phe-Asn
[88]
Paralichthys olivaceus
papain, pepsin, trypsin, neutrase, alcalase,
kojizyme, protamex, and α-chymotrypsin
Val-Cys-Ser-Val and Cys-Ala-Ala-Pro
[89]
Magalaspis cordyla
pepsin, trypsin, and α-chymotrypsin
Ala–Cys–Phe–Leu (518.5 Da),
[90]
Magalaspis cordyla
pepsin/trypsin, and α-chymotrypsin
Asn-His-Arg-Tyr-Asp-Arg (856 Da)
[91]
Otolithes ruber
pepsin/trypsin and α-chymotrypsin
Gly-Asn-Arg-Gly-Phe-Ala-Cys-Arg-His-Ala
(1101.5 Da)
[91]
Johnius belengerii
trypsin, R-chymotrypsin, and pepsin
His-Gly-Pro-Leu-Gly-Pro-Leu
[92]
Otolithes ruber
pepsin, trypsin, and α-chymotrypsin
Lys-Thr-Phe-Cys-Gly-Arg-His
[93]
Oreochromis niloticus
alcalase, pronase E, pepsin, and trypsin
Asp-Pro-Ala-Leu-Ala-Thr-Glu-Pro-Asp-ProMet-Pro-Phe
[94]
®
®
Merluccius productus
Validase
–
[95]
Oreochromis niloticus
properase E and multifect neutral
Glu-Gly-Leu (317.33 Da) and
Tyr-Gly-Asp-Glu-Tyr
[96]
Hypoptychus dybowskii
alcalase, neutrase, α-chymotrypsin, papain,
pepsin, and trypsin
Ile–Val–Gly–Gly–Phe–Pro–His–Tyr–Leu
[97]
BNP (V) and Flavourzyme
4.4. Antimicrobial Fish Peptides
Antimicrobial peptides possess cationic moieties, which facilitate their interaction with
membranes of microbial pathogens [106]. Antimicrobial peptides from marine organisms constitute
a new generation of antibiotics. They are currently extensively studied in the development of
cosmeceutical products, including lotions, shampoos, and moisture creams. Numerous studies
have reported that marine fish-derived peptides can be used as antimicrobial agents, as shown
in Table 5 [103–106]. The enzymes used for the isolation of antimicrobial fish peptides and the
microorganisms susceptible to these antimicrobial peptides were listed in Table 5.
Table 5. Marine fish species and enzymes used in the isolation of antimicrobial peptides. Targeted
microorganisms used to check the marine fish-derived antimicrobial peptides are shown.
Name of Fish Species
Enzymes for Hydrolysis
Microorganisms
Reference
pepsin
Escherichia coli
[107]
papain, pepsin, trypsin,
alkaline protease, acidic protease,
and flavoring protease
Escherichia coli, Pseudomonas fluorescens
Proteus vulgaris, Bacillus megaterium
Staphylococcus aureus, Bacillus subtilis,
Bacillus megaterium, Sarcina lutea
[108]
Scomber scombrus
–
Listeria innocua, Escherichia coli
[109]
Scomber scombrus
protamex, neutrase, papain,
and flavourzyme.
Listeria innocua HPB13 and Escherichia coli
[110]
Setipinna taty
Setipinna taty
4.5. Matrix Metalloproteinases Inhibiting Fish Peptides
MMPs are endopeptidases containing zinc metal ion with an ability to degrade extracellular
components. MMPs are produced by a variety of cells, including fibroblasts, keratinocytes, mast cells,
macrophages, and neutrophils. Six different kinds of MMPs are available, which consist of collagenases,
gelatinases, stromelysins, matrilysins, membrane-type MMPs, and other MMPs. The MMPs are
416
Mar. Drugs 2017, 15, 143
categorized into three major functional groups. They include interstitial collagenases with affinities
toward collagen types I, II, and III, (MMP-1, -8, and -13, respectively), stromelysins with specificity
for laminin, fibronectin, and proteoglycans (MMP-3, -10, and -11, respectively), and gelatinases that
effectively cleave type IV and V collagens (MMP-2 and -9) [67].
Wrinkles are a typical symptom of skin aging, and are associated with the reduction in the amount
of collagen that dominates the elasticity of the skin dermal tissues. Since collagen fibers and other
extracellular matrix are readily degraded by MMPs, formation of wrinkles is closely associated with
increased expression of MMPs throughout the skin aging. Therefore, a variety of MMP inhibitors
have been utilized to prevent the formation of wrinkles. However, studies on the use of fish-derived
hydrolysates, proteins, and peptides as MMP inhibitors and their applications for cosmeceuticals are
limited. Only a few studies focus on the MMP inhibitory activity of marine fish-derived peptides.
Ryu et al. reported the isolation of novel peptides from seahorses that effectively increased collagen
release through the suppression of collagenases 1 and 3 [111]. The same group isolated a protein
from seahorse with an ability to inhibit MMP-1, MMP-3, and MMP-13 [112]. Shen et al. reported the
hydrolysis of fish muscle from Collichthys niveatus using four commercial enzymes, namely alcalase,
neutrase, protamex, and flavourzyme to isolate the peptides [113]. The major amino acids observed in
the hydrolysate were threonine, glutamic acid, phenylalanine, tryptophan, and lysine. The total content
of essential amino acids was calculated to be 970.7 ng/mL. The study was performed to check the
effects of enzymatic hydrolysis conditions on the composition and properties of the peptides obtained
from the hydrolysate, which could be utilized as health supplements [113]. A proteinase inhibitor
(21 kDa) with similar properties to human tissue inhibitor of MMP-2 (TIMP-2) was obtained from
Atlantic cod muscle and then identified by using gelatin affinity chromatography, real-time reverse
zymography, and mass spectroscopy [114]. The amino acid sequences of the two peptides obtained
from the inhibitor showed a high similarity to those of the human TIMP-2. The inhibitor was found to
inhibit the gelatin-degrading enzymes.
5. Photo-Protective and Anti-Photoaging Activity of Fish Peptides and Fish Protein Hydrolysates
Skin is made up of three different layers, namely epidermis, dermis, and hypodermis. It acts as
a chemical and physical barrier to protect the body against harmful foreign pollutants [115]. Skin can
be damaged by various external environmental attacks, including harmful chemicals, ultraviolet (UV)
light exposure, and temperature changes [116]. Photoaging and inflammation are often caused by UV
radiation. Photoaging, also known as dermatoheliosis, is characterized by changes in the skin due to
exposure of UV-A (400 to 320-nm wavelength) and UV-B (320 to 290-nm wavelength) light, which is
main light source for photoaging [117]. The UV-A can permeate more deeply into the dermal matrix
than UV-B, whereas UV-B is more carcinogenic compared to UV-A [118]. Considerable attention has
been given to the utilization of marine fish-derived peptides for skin protection due to an excellent
bioactivity, biocompatibility, penetration ability, and skin-repairing ability. Various fish-derived
proteins and peptides have been investigated for their usage in the protection of skin from UV
exposure [119–121].
Fish skin collagen and hydrolysates demonstrated a high biocompatibility with an ability to
provide protection against the detrimental effects of UV radiation (Table 6). Zhuang et al. reported
that jellyfish (Rhopilema esculentum) collagen (JC) and jellyfish collagen hydrolysate (JCH) alleviated
UV-induced abnormal changes of antioxidant defense systems such as superoxide dismutase and
glutathione peroxidase [116]. Both JC and JCH significantly protected the skin lipid and collagen from
UV radiation. In addition, the UV-induced changes in the total ceramide and glycosaminoglycans in
the skin were recovered, thus maintaining the balance of lipid compositions in the skin. The mechanism
is mainly based on the antioxidative properties of the both JC and JCH along with stimulation of
skin collagen synthesis. The study indicated that JCH that has lower molecular weights as compared
to JC provides a much stronger protection against UV-induced photoaging [116]. The importance of
jellyfish collagen on the antioxidant activities is further strengthened by another study that reports
417
Mar. Drugs 2017, 15, 143
jellyfish as an abundant source of collagen with a high potential for nutraceutical applications [122].
The effects of JC and JCH on UV-induced skin damage of mice were evaluated by the analysis of skin
moisture as well as microscopic analyses of skin and immunity indexes [123]. It was observed that
the moisture retention ability of UV-induced mice skin increased upon treatment with JC and JCH.
Further histological analysis demonstrated that JC and JCH could repair the endogenous collagen and
elastin protein fibers, thus maintaining the natural ratio of type I to type III collagen. The immunity
indexes showed that JC and JCH played a pivotal role in enhancing the immunity of photoaging mice
in vivo. Again, as mentioned above, JCH exhibited a much higher protective ability than JC [123].
Hou et al. evaluated the effects of collagen polypeptides isolated from cod skin on UV-induced
damage to mouse skin [124]. Collagen polypeptide fractions (CP1 (2 kDa < Mr < 6 kDa) and CP2
(Mr < 2 kDa)) were obtained through pepsin digestion and alkaline protease hydrolysis methods.
Collagen polypeptides provided good moisture absorption and retention properties, and CP2 was
more efficient than CP1. In vivo studies demonstrated that both of the peptides provided protective
effects against UV-induced wrinkle formation and destruction of skin structures (Figure 4). The action
mechanisms of the collagen polypeptides mainly involve increasing immunity, decreasing the loss of
moisture and lipid, and repairing endogenous collagen and elastin protein fibers [124].
a
c
e
b
d
f
Figure 4. Effects of collagen polypeptide 1 and collagen polypeptide 2 on the morphology of photoaging
skin (magnification 200×). (a) normal; (b) model; (c) collagen polypeptide 1 (50 mg/kg); (d) collagen
polypeptide 1 (200 mg/kg); (e) collagen polypeptide 2 (50 mg/kg); and (f) collagen polypeptide 2
(200 mg/kg). Adapted with permission from [124].
Chen et al. studied the effects of gelatin hydrolysate extracted from the Pacific cod
(Gadus macrocephalus) skin on UV radiation-induced inflammation and collagen reduction in
photoaging mouse skin. Oral administration of gelatin hydrolysate suppressed UV radiation-induced
damage to the skin by inhibiting the depletion of endogenous antioxidant enzyme activity, and by
suppressing the expression of nuclear factor-κB (NF-κB) as well as NF-κB-mediated expression of
pro-inflammatory cytokines. Furthermore, gelatin hydrolysate inhibited type I procollagen synthesis
by up-regulating the type II transforming growth factor β (TGFβ) receptor (TβRII) level and
down-regulating Smad7 levels, which demonstrates that gelatin hydrolysate is involved in matrix
collagen synthesis by activating the TGF-β/Smad pathway in the photoaging skin [125].
Age-related skin thinning is involved in a decrease in the content of collagen in the skin.
Co-treatment with collagen peptide and vitamin C upregulates the type I collagen in vivo. Shibuya et al.
418
Mar. Drugs 2017, 15, 143
demonstrated that the collagen peptides supplemented with vitamin C reduced the superoxide
dismutase 1 (Sod-1) [126]. In vitro studies further revealed that collagen oligopeptide, a digestive
product of ingested collagen peptide, significantly enhanced the bioactivity of the vitamin C derivative
with respect to the migration and proliferation of fibroblasts [126]. The collagen peptide and the
vitamin C derivative additively increased the skin thickness of hairless Sod1-deficient mice.
Recently, gelatin and its hydrolysates from salmon skin were used to protect the skin from
photoaging [127]. The average molecular weights of the gelatin and gelatin hydrolysates were found
to be 65 kDa and 873 kDa, respectively [127]. In another study, dose effects of orally administered
collagen hydrolysates on the UV-B-irradiated skin damage were investigated using UV-B-irradiated
hairless mice [128]. The low dose of collagen hydrolysates increased the skin hydration and reduced the
transepidermal water loss in the damaged skin [128]. In addition to this, tilapia gelatin peptides were
investigated against UV-induced damage to mouse skin [129]. The results suggested that tilapia gelatin
had an ability to avoid the UV damage by protecting the collagen and lipid in the skin. The antioxidant
peptide, Leu-Ser-Gly-Tyr-Gly-Pro (592.26 Da), was identified from the tilapia gelatin peptides, and the
peptide has an ability to scavenge the hydroxyl radicals with the IC50 value of 22.47 µg/mL [129,130].
ȱ
Figure 5. Scheme of the hypothesized redox-dependent mechanisms of physiological effects after
co-treatment of marine collagen peptides (MCPs) and skin-targeting antioxidants (AOs). Redrawn with
permission from [131]. In the figure, the three arrows (blue) indicate that MCPs easily penetrate the
gastrointestinal wall (GI) through blood circulation and are mainly deposited in the skin. The single
arrow (green) indicates that AOs are partially metabolized. However, AOs can reach the different layers
of skin. While circulating in the blood, MCPs activate blood phagocytes (i.e., granulocytes (G) and
monocytes (M)) and endotheliocytes (E) to generate reactive oxygen species (ROS) and reactive nitrogen
species (RNS) by provoking Toll-like receptor-4 (TLR4)-mediated signals. Co-administered antioxidants
can prevent systemic oxidative stress by blocking glutathione (GSH) oxidation, and activation of
glutathione peroxidase (GPx), glutathione-S-transferase (GST), and superoxide dismutase 3 (SOD3).
The major concern regarding the safety and clinical feasibility of administration of marine
collagen peptides (MCPs) has been raised because MCPs from different origin can activate
innate immune response through Toll-like receptor 4 (TLR4)-mediated NADPH-oxidase (NOX4)
activation and over-production of reactive oxygen species (ROS) [131]. Figure 5 represents the
419
Mar. Drugs 2017, 15, 143
hypothesized redox-dependent mechanisms behind the physiological effects of fish skin MCPs
combined with plant-derived skin-targeting antioxidants (coenzyme Q10 + grape-skin extract +
luteolin + selenium) [131]. The MCPs were derived from the skin of deep sea fish (e.g., Pollachius virens,
Hippoglossus hippoglossus, and Pleuronectes platessa). MCPs easily penetrate the gastrointestinal (GI) wall
(three arrows) through blood circulation and are mainly deposited in the skin [131]. The clinical study
demonstrated that combination treatment of MCPs with skin-targeting antioxidants can remarkably
improve skin elasticity and sebum production while lowering the oxidative damage [131]. These results
clearly indicate that skin-targeting antioxidants are essential components of MCPs-containing
cosmeceuticals for more effective and safe treatment.
Table 6. Photo-protective and anti-photoaging proteins and peptides from marine fish.
Name of Fish Species and Parts
Jellyfish
Cod skin
Cod skin
Salmon skin
Tilapia
Pollachius virens, Hippoglossus
hippoglossus, and Pleuronectes platessa
Fish-Derived Proteins
and Peptides
Enzymes for Hydrolysis
Reference
Collagen
Collagen polypeptides
Gelatin hydrolysate
Gelatin
Gelatin peptides
properase E
alkaline protease and pepsin
alkaline protease and trypsin
alkaline protease and trypsin
properase E
[123]
[124]
[125]
[127]
[129]
Marine collagen peptides
complex proteases
[131]
6. Conclusions
Marine fish-derived proteins and peptides are becoming the important resource for cosmetic
industries. Several bioactive proteins and peptides were produced from marine fish via chemical or
enzymatical hydrolysis and regarded as a safer option for the development of cosmeceutical products.
The use of marine fish-derived proteins and peptides contribute to alleviating the environmental
pollution caused by the waste generated by fish processing industries. Much attention has been
paid to marine fish collagen for cosmeceutical applications owing its properties for skin hydration,
with low odor and improved mechanical strength. In addition, marine fish-derived peptides have
been extensively explored for cosmeceutical applications due to their various biological properties
including antioxidant, antimicrobial, MMP inhibitory, photo-protective, and anti-photoaging activities.
These biological activities of the marine fish peptides have led to the development of several types of
anti-aging, skin care, and anti-wrinkle products. Despite the great potential of marine fish-derived
proteins and peptides for cosmeceutical applications, most of them are still in the experimental
stage and need to be further investigated with regard to their formulations and long-term safety for
successful commercialization. Moreover, development of supplements that can further increase the
bioavailability and tissue regeneration efficacy of marine fish-derived proteins and peptides is also
required to increase their potential for cosmeceuticals.
Acknowledgments: This work was supported by the Post-Doctor Research Program (2016) through Incheon
National University (INU), Incheon, Republic of Korea. This work was also supported by Basic Science Research
Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education
(NRF-2016R1D1A1B03933136 to M.S.S.).
Author Contributions: Jayachandran Venkatesan and Sukumaran Anil developed the concept for the review and
wrote the manuscript. Se-Kwon Kim and Min Suk Shim wrote and edited the manuscript.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
Malve, H. Exploring the ocean for new drug developments: Marine pharmacology. J. Pharm. Bioallied Sci.
2016, 8, 83–91. [CrossRef] [PubMed]
Kim, S.-K.; Venkatesan, J. Introduction to marine biotechnology. In Springer Handbook of Marine Biotechnology;
Kim, S.-K., Ed.; Springer: Berlin/Heidelberg, Germany, 2015; pp. 1–10.
420
Mar. Drugs 2017, 15, 143
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
Najafian, L.; Babji, A.S. A review of fish-derived antioxidant and antimicrobial peptides: Their production,
assessment, and applications. Peptides 2012, 33, 178–185. [CrossRef] [PubMed]
Cheung, R.C.F.; Ng, T.B.; Wong, J.H. Marine peptides: Bioactivities and applications. Mar. Drugs 2015, 13,
4006–4043. [CrossRef] [PubMed]
Senevirathne, M.; Kim, S.-K. Utilization of seafood processing by-products: Medicinal applications.
In Advances in Food and Nutrition Research; Kim, S.-K., Ed.; Academic Press: Waltham, MA, USA, 2012;
Volume 65, pp. 495–512.
Rustad, T. Physical and chemical properties of protein seafood by-products. In Maximising the Value of Marine
By-Products; Shahidi, F., Ed.; Woodhead Publishing Limited: Cambridge, UK, 2007; pp. 3–21.
Nilsang, S.; Lertsiri, S.; Suphantharika, M.; Assavanig, A. Optimization of enzymatic hydrolysis of fish
soluble concentrate by commercial proteases. J. Food Eng. 2005, 70, 571–578. [CrossRef]
Allard, R.; Malak, N.A.; Huc, A. Collagen Product Containing Collagen of Marine Origin with a Low Odor
and Preferably with Improved Mechanical Properties, and Its Use in the Form of Cosmetic or Pharmaceutical
Compositions or Products. U.S. Patent 6,660,280, 9 December 2003.
Shahidi, F.; Kamil, Y.J. Enzymes from fish and aquatic invertebrates and their application in the food industry.
Trends Food Sci. Technol. 2001, 12, 435–464. [CrossRef]
Hoyer, B.; Bernhardt, A.; Heinemann, S.; Stachel, I.; Meyer, M.; Gelinsky, M. Biomimetically mineralized
salmon collagen scaffolds for application in bone tissue engineering. Biomacromolecules 2012, 13, 1059–1066.
[CrossRef] [PubMed]
Hayashi, Y.; Yamada, S.; Guchi, K.Y.; Koyama, Z.; Ikeda, T. Chitosan and fish collagen as biomaterials
for regenerative medicine. In Advances in Food and Nutrition Research; Kim, S.K., Ed.; Academic Press:
Waltham, MA, USA, 2012; Volume 65, pp. 107–120.
Lauritano, C.; Ianora, A. Marine organisms with anti-diabetes properties. Mar. Drugs 2016, 14, 220. [CrossRef]
[PubMed]
Venugopal, V. Cosmeceuticals from marine fish and shellfish. In Marine Cosmeceuticals: Trends and Prospects;
Kim, S.-K., Ed.; CRC Press: Boca Raton, FL, USA, 2011; pp. 211–232.
Senevirathne, M.; Kim, S.-K. Development of bioactive peptides from fish proteins and their health promoting
ability. In Advances in Food and Nutrition Research; Kim, S.-K., Ed.; Academic Press: Waltham, MA, USA, 2012;
Volume 65, pp. 235–248.
Ngo, D.H.; Vo, T.S.; Ngo, D.N.; Wijesekara, I.; Kim, S.K. Biological activities and potential health benefits
of bioactive peptides derived from marine organisms. Int. J. Biol. Macromol. 2012, 51, 378–383. [CrossRef]
[PubMed]
Pangestuti, R.; Kim, S.-K. Bioactive peptide of marine origin for the prevention and treatment of
non-communicable diseases. Mar. Drugs 2017, 15, 67. [CrossRef] [PubMed]
Senaratne, L.; Park, P.-J.; Kim, S.-K. Isolation and characterization of collagen from brown backed toadfish
(Lagocephalus gloveri) skin. Bioresour. Technol. 2006, 97, 191–197. [CrossRef] [PubMed]
Pati, F.; Adhikari, B.; Dhara, S. Isolation and characterization of fish scale collagen of higher thermal stability.
Bioresour. Technol. 2010, 101, 3737–3742. [CrossRef] [PubMed]
Jeong, H.-S.; Venkatesan, J.; Kim, S.-K. Isolation and characterization of collagen from marine fish
(Thunnus obesus). Biotechnol. Bioprocess Eng. 2013, 18, 1185–1191. [CrossRef]
Xu, Y.; Han, X.; Li, Y. Effect of marine collagen peptides on long bone development in growing rats. J. Sci.
Food Agric. 2010, 90, 1485–1491. [CrossRef] [PubMed]
Swatschek, D.; Schatton, W.; Kellermann, J.; Müller, W.E.; Kreuter, J. Marine sponge collagen:
Isolation, characterization and effects on the skin parameters surface-pH, moisture and sebum. Eur. J.
Pharm. Biopharm. 2002, 53, 107–113. [CrossRef]
Cho, J.K.; Jin, Y.G.; Rha, S.J.; Kim, S.J.; Hwang, J.H. Biochemical characteristics of four marine fish skins
in Korea. Food Chem. 2014, 159, 200–207. [CrossRef] [PubMed]
Haug, I.J.; Draget, K.I.; Smidsrød, O. Physical and rheological properties of fish gelatin compared to
mammalian gelatin. Food Hydrocoll. 2004, 18, 203–213. [CrossRef]
Subhan, F.; Ikram, M.; Shehzad, A.; Ghafoor, A. Marine collagen: An emerging player in biomedical
applications. J. Food Sci. Technol. 2015, 52, 4703–4707. [CrossRef] [PubMed]
421
Mar. Drugs 2017, 15, 143
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
Muralidharan, N.; Jeya Shakila, R.; Sukumar, D.; Jeyasekaran, G. A Skin, bone and muscle collagen extraction
from the trash fish, leather jacket (Odonus niger) and their characterization. J. Food Sci. Technol. 2013, 50,
1106–1113. [CrossRef] [PubMed]
Silva, T.H.; Moreira-Silva, J.; Marques, A.L.; Domingues, A.; Bayon, Y.; Reis, R.L. Marine origin collagens
and its potential applications. Mar. Drugs 2014, 12, 5881–5901. [CrossRef] [PubMed]
Nagai, T.; Araki, Y.; Suzuki, N. Collagen of the skin of ocellate puffer fish (Takifugu rubripes). Food Chem. 2002,
78, 173–177. [CrossRef]
Shanmugam, V.; Ramasamy, P.; Subhapradha, N.; Sudharsan, S.; Seedevi, P.; Moovendhan, M.;
Krishnamoorthy, J.; Shanmugam, A.; Srinivasan, A. Extraction, structural and physical characterization of
type I collagen from the outer skin of Sepiella inermis (Orbigny, 1848). Afr. J. Biotechnol. 2012, 11, 14326–14337.
[CrossRef]
Jongjareonrak, A.; Benjakul, S.; Visessanguan, W.; Nagai, T.; Tanaka, M. Isolation and characterisation of acid
and pepsin-solubilised collagens from the skin of Brownstripe red snapper (Lutjanus vitta). Food Chem. 2005,
93, 475–484. [CrossRef]
Kumar, N.S.S.; Nazeer, R.A. Wound healing properties of collagen from the bone of two marine fishes. Int. J.
Pept. Res. Ther. 2012, 18, 185–192. [CrossRef]
Veeruraj, A.; Arumugam, M.; Balasubramanian, T. Isolation and characterization of thermostable collagen
from the marine eel-fish (Evenchelys macrura). Process Biochem. 2013, 48, 1592–1602. [CrossRef]
Veeruraj, A.; Arumugam, M.; Ajithkumar, T.; Balasubramanian, T. Isolation and characterization of drug
delivering potential of type-I collagen from eel fish Evenchelys macrura. J. Mater. Sci. Mater. Med. 2012, 23,
1729–1738. [CrossRef] [PubMed]
Minh Thuy, L.T.; Okazaki, E.; Osako, K. Isolation and characterization of acid-soluble collagen from the
scales of marine fishes from Japan and Vietnam. Food Chem. 2014, 149, 264–270. [CrossRef] [PubMed]
Zhang, J.; Duan, R.; Huang, L.; Song, Y.; Regenstein, J.M. Characterisation of acid-soluble and
pepsin-solubilised collagen from jellyfish (Cyanea nozakii Kishinouye). Food Chem. 2014, 150, 22–26. [CrossRef]
[PubMed]
Muthumari, K.; Anand, M.; Maruthupandy, M. Collagen extract from marine finfish scales as a potential
mosquito larvicide. Protein J. 2016, 35, 391–400. [CrossRef] [PubMed]
Kittiphattanabawon, P.; Benjakul, S.; Visessanguan, W.; Nagai, T.; Tanaka, M. Characterisation of acid-soluble
collagen from skin and bone of bigeye snapper (Priacanthus tayenus). Food Chem. 2005, 89, 363–372. [CrossRef]
Nalinanon, S.; Benjakul, S.; Visessanguan, W.; Kishimura, H. Use of pepsin for collagen extraction from the
skin of bigeye snapper (Priacanthus tayenus). Food Chem. 2007, 104, 593–601. [CrossRef]
Benjakul, S.; Thiansilakul, Y.; Visessanguan, W.; Roytrakul, S.; Kishimura, H.; Prodpran, T.; Meesane, J.
Extraction and characterisation of pepsin-solubilised collagens from the skin of bigeye snapper
(Priacanthus tayenus and Priacanthus macracanthus). J. Sci. Food Agric. 2010, 90, 132–138. [CrossRef] [PubMed]
Matmaroh, K.; Benjakul, S.; Prodpran, T.; Encarnacion, A.B.; Kishimura, H. Characteristics of acid soluble
collagen and pepsin soluble collagen from scale of spotted golden goatfish (Parupeneus heptacanthus).
Food Chem. 2011, 129, 1179–1186. [CrossRef] [PubMed]
Zhang, M.; Liu, W.; Li, G. Isolation and characterisation of collagens from the skin of largefin longbarbel
catfish (Mystus macropterus). Food Chem. 2009, 115, 826–831. [CrossRef]
Khan, S.B.; Qian, Z.-J.; Ryu, B.; Kim, S.-K. Isolation and biochemical characterization of collagens from
seaweed pipefish, Syngnathus schlegeli. Biotechnol. Bioprocess Eng. 2009, 14, 436–442. [CrossRef]
Nagai, T.; Ogawa, T.; Nakamura, T.; Ito, T.; Nakagawa, H.; Fujiki, K.; Nakao, M.; Yano, T. Collagen of edible
jellyfish exumbrella. J. Sci. Food Agric. 1999, 79, 855–858. [CrossRef]
Barzideh, Z.; Latiff, A.A.; Gan, C.Y.; Benjakul, S.; Karim, A.A. Isolation and characterisation of collagen from
the ribbon jellyfish (Chrysaora sp.). Int. J. Food Sci. Technol. 2014, 49, 1490–1499. [CrossRef]
Available online: https://www.justvitamins.co.uk/blog/bovine-collagen-vs-marine-collagen/ (accessed on
11 May 2017).
Xhauflaire-Uhoda, E.; Fontaine, K.; Pierard, G. Kinetics of moisturizing and firming effects of cosmetic
formulations. Int. J. Cosmet. Sci. 2008, 30, 131–138. [CrossRef] [PubMed]
Chandika, P.; Ko, S.-C.; Oh, G.-W.; Heo, S.-Y.; Nguyen, V.-T.; Jeon, Y.-J.; Lee, B.; Jang, C.H.; Kim, G.; Park, W.S.
Fish collagen/alginate/chitooligosaccharides integrated scaffold for skin tissue regeneration application.
Int. J. Biol. Macromol. 2015, 81, 504–513. [CrossRef] [PubMed]
422
Mar. Drugs 2017, 15, 143
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
Gautam, M.; Purohit, V.; Agarwal, M.; Singh, A.; Goel, R. In vivo healing potential of Aegle marmelos in
excision, incision, and dead space wound models. Sci. World J. 2014, 2014, 740197. [CrossRef] [PubMed]
Nithya, M.; Suguna, L.; Rose, C. The effect of nerve growth factor on the early responses during the process
of wound healing. Biochim. Biophys. Acta Gen. Subj. 2003, 1620, 25–31. [CrossRef]
Song, E.; Yeon Kim, S.; Chun, T.; Byun, H.J.; Lee, Y.M. Collagen scaffolds derived from a marine source and
their biocompatibility. Biomaterials 2006, 27, 2951–2961. [CrossRef] [PubMed]
Yeo, M.; Jung, W.-K.; Kim, G. Fabrication, characterisation and biological activity of phlorotannin-conjugated
PCL/β-TCP composite scaffolds for bone tissue regeneration. J. Mater. Chem. 2012, 22, 3568–3577. [CrossRef]
Hoyer, B.; Bernhardt, A.; Lode, A.; Heinemann, S.; Sewing, J.; Klinger, M.; Notbohm, H.; Gelinsky, M. Jellyfish
collagen scaffolds for cartilage tissue engineering. Acta Biomater. 2014, 10, 883–892. [CrossRef] [PubMed]
Shen, X.; Nagai, N.; Murata, M.; Nishimura, D.; Sugi, M.; Munekata, M. Development of salmon milt
DNA/salmon collagen composite for wound dressing. J. Mater. Sci. Mater. Med. 2008, 19, 3473–3479.
[CrossRef] [PubMed]
Yamada, S.; Yamamoto, K.; Ikeda, T.; Yanagiguchi, K.; Hayashi, Y. Potency of fish collagen as a scaffold for
regenerative medicine. Biomed Res. Int. 2014, 2014, 302932. [CrossRef] [PubMed]
Elango, J.; Zhang, J.; Bao, B.; Palaniyandi, K.; Wang, S.; Wenhui, W.; Robinson, J.S.
Rheological, biocompatibility and osteogenesis assessment of fish collagen scaffold for bone tissue
engineering. Int. J. Biol. Macromol. 2016, 91, 51–59. [CrossRef] [PubMed]
Jeong, S.I.; Kim, S.Y.; Cho, S.K.; Chong, M.S.; Kim, K.S.; Kim, H.; Lee, S.B.; Lee, Y.M. Tissue-engineered
vascular grafts composed of marine collagen and PLGA fibers using pulsatile perfusion bioreactors.
Biomaterials 2007, 28, 1115–1122. [CrossRef] [PubMed]
Chen, D.C.; Lai, Y.L.; Lee, S.Y.; Hung, S.L.; Chen, H.L. Osteoblastic response to collagen scaffolds varied in
freezing temperature and glutaraldehyde crosslinking. J. Biomed. Mater. Res. 2007, 80, 399–409. [CrossRef]
[PubMed]
Mullen, C.; Haugh, M.; Schaffler, M.; Majeska, R.; McNamara, L. Osteocyte differentiation is regulated
by extracellular matrix stiffness and intercellular separation. J. Mech. Behav. Biomed. 2013, 28, 183–194.
[CrossRef] [PubMed]
Byrne, E.M.; Farrell, E.; McMahon, L.A.; Haugh, M.G.; O’Brien, F.J.; Campbell, V.A.; Prendergast, P.J.;
O’Connell, B.C. Gene expression by marrow stromal cells in a porous collagen–glycosaminoglycan scaffold
is affected by pore size and mechanical stimulation. J. Mater. Sci. Mater. Med. 2008, 19, 3455–3463. [CrossRef]
[PubMed]
Keogh, M.B.; O’Brien, F.J.; Daly, J.S. A novel collagen scaffold supports human osteogenesis—Applications
for bone tissue engineering. Cell Tissue Res. 2010, 340, 169–177. [CrossRef] [PubMed]
Wu, H.-C.; Chen, H.-M.; Shiau, C.-Y. Free amino acids and peptides as related to antioxidant properties in
protein hydrolysates of mackerel (Scomber austriasicus). Food Res. Int. 2003, 36, 949–957. [CrossRef]
Kim, S.-K. Marine Proteins and Peptides: Biological Activities and Applications; John Wiley & Sons:
Hoboken, NJ, USA, 2013.
Lintner, K.; Peschard, O. Biologically active peptides: From a laboratory bench curiosity to a functional skin
care product. Int. J. Cosmet. Sci. 2000, 22, 207–218. [CrossRef] [PubMed]
Khora, S.S. Marine fish-derived bioactive peptides and proteins for human therapeutics. Int. J. Pharm.
Pharm. Sci. 2013, 5, 31–37.
Halim, N.; Yusof, H.; Sarbon, N. Functional and bioactive properties of fish protein hydolysates and peptides:
A comprehensive review. Trends Food Sci. Technol. 2016, 51, 24–33. [CrossRef]
Sila, A.; Hedhili, K.; Przybylski, R.; Ellouz-Chaabouni, S.; Dhulster, P.; Bougatef, A.; Nedjar-Arroume, N.
Antibacterial activity of new peptides from barbel protein hydrolysates and mode of action via a membrane
damage mechanism against Listeria monocytogenes. J. Funct. Foods 2014, 11, 322–329. [CrossRef]
Kim, S.K. Marine cosmeceuticals. J. Cosmet. Dermatol. 2014, 13, 56–67. [CrossRef] [PubMed]
Thomas, N.V.; Kim, S.-K. Beneficial effects of marine algal compounds in cosmeceuticals. Mar. Drugs 2013,
11, 146–164. [CrossRef] [PubMed]
Kim, S.-K.; Ravichandran, Y.D.; Khan, S.B.; Kim, Y.T. Prospective of the cosmeceuticals derived from marine
organisms. Biotechnol. Bioprocess Eng. 2008, 13, 511–523. [CrossRef]
Kristinsson, H.G.; Rasco, B.A. Fish protein hydrolysates: Production, biochemical, and functional properties.
Crit. Rev. Food Sci. Nutr. 2000, 40, 43–81. [CrossRef] [PubMed]
423
Mar. Drugs 2017, 15, 143
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
Je, J.-Y.; Qian, Z.-J.; Byun, H.-G.; Kim, S.-K. Purification and characterization of an antioxidant peptide
obtained from tuna backbone protein by enzymatic hydrolysis. Process Biochem. 2007, 42, 840–846. [CrossRef]
Je, J.-Y.; Qian, Z.-J.; Lee, S.-H.; Byun, H.-G.; Kim, S.-K. Purification and antioxidant properties of bigeye tuna
(Thunnus obesus) dark muscle peptide on free radical-mediated oxidative systems. J. Med. Food 2008, 11,
629–637. [CrossRef] [PubMed]
Jeon, Y.-J.; Byun, H.-G.; Kim, S.-K. Improvement of functional properties of cod frame protein hydrolysates
using ultrafiltration membranes. Process Biochem. 1999, 35, 471–478. [CrossRef]
Martins, A.; Vieira, H.; Gaspar, H.; Santos, S. Marketed marine natural products in the pharmaceutical and
cosmeceutical industries: Tips for success. Mar. Drugs 2014, 12, 1066–1101. [CrossRef] [PubMed]
Yoon, N.Y.; Eom, T.-K.; Kim, M.-M.; Kim, S.-K. Inhibitory effect of phlorotannins isolated from Ecklonia
cava on mushroom tyrosinase activity and melanin formation in mouse B16F10 melanoma cells. J. Agric.
Food Chem. 2009, 57, 4124–4129. [CrossRef] [PubMed]
Schurink, M.; van Berkel, W.J.; Wichers, H.J.; Boeriu, C.G. Novel peptides with tyrosinase inhibitory activity.
Peptides 2007, 28, 485–495. [CrossRef] [PubMed]
Kim, M.-M.; Van Ta, Q.; Mendis, E.; Rajapakse, N.; Jung, W.-K.; Byun, H.-G.; Jeon, Y.-J.; Kim, S.-K.
Phlorotannins in Ecklonia cava extract inhibit matrix metalloproteinase activity. Life Sci. 2006, 79, 1436–1443.
[CrossRef] [PubMed]
Kim, J.-A.; Kim, S.-K. Bioactive peptides from marine sources as potential anti-inflammatory therapeutics.
Curr. Protein Pept. Sci. 2013, 14, 177–182. [CrossRef] [PubMed]
Birben, E.; Sahiner, U.M.; Sackesen, C.; Erzurum, S.; Kalayci, O. Oxidative stress and antioxidant defense.
World Allergy Organ. J. 2012, 5, 9–19. [CrossRef] [PubMed]
Rinnerthaler, M.; Bischof, J.; Streubel, M.K.; Trost, A.; Richter, K. Oxidative stress in aging human skin.
Biomolecules 2015, 5, 545–589. [CrossRef] [PubMed]
Gülçin, İ.; Huyut, Z.; Elmastaş, M.; Aboul-Enein, H.Y. Radical scavenging and antioxidant activity of
tannic acid. Arab. J. Chem. 2010, 3, 43–53. [CrossRef]
Winata, A.; Lorenz, K. Antioxidant potential of 5-n-pentadecylresorcinol. J. Food Process. Preserv. 1996, 20,
417–429. [CrossRef]
Becker, G. Preserving food and health: Antioxidants make functional, nutritious preservatives. Food Process.
1993, 12, 54–56.
Osawa, T.; Namiki, M. Natural antioxidants isolated from Eucalyptus leaf waxes. J. Agric. Food Chem. 1985,
33, 777–780. [CrossRef]
Byun, H.-G.; Lee, J.K.; Park, H.G.; Jeon, J.-K.; Kim, S.-K. Antioxidant peptides isolated from the marine
rotifer, Brachionus rotundiformis. Process Biochem. 2009, 44, 842–846. [CrossRef]
Kim, S.-K.; Wijesekara, I. Development and biological activities of marine-derived bioactive peptides:
A review. J. Funct. Foods 2010, 2, 1–9. [CrossRef]
Ahn, C.-B.; Je, J.-Y.; Cho, Y.-S. Antioxidant and anti-inflammatory peptide fraction from salmon byproduct
protein hydrolysates by peptic hydrolysis. Food Res. Int. 2012, 49, 92–98. [CrossRef]
Jiang, H.; Tong, T.; Sun, J.; Xu, Y.; Zhao, Z.; Liao, D. Purification and characterization of antioxidative
peptides from round scad (Decapterus maruadsi) muscle protein hydrolysate. Food Chem. 2014, 154, 158–163.
[CrossRef] [PubMed]
Kim, S.-Y.; Je, J.-Y.; Kim, S.-K. Purification and characterization of antioxidant peptide from hoki
(Johnius belengerii) frame protein by gastrointestinal digestion. J. Nutr. Biochem. 2007, 18, 31–38. [CrossRef]
[PubMed]
Ko, J.-Y.; Lee, J.-H.; Samarakoon, K.; Kim, J.-S.; Jeon, Y.-J. Purification and determination of two novel
antioxidant peptides from flounder fish (Paralichthys olivaceus) using digestive proteases. Food Chem. Toxicol.
2013, 52, 113–120. [CrossRef] [PubMed]
Kumar, N.S.; Nazeer, R.; Jaiganesh, R. Purification and biochemical characterization of antioxidant peptide
from horse mackerel (Magalaspis cordyla) viscera protein. Peptides 2011, 32, 1496–1501. [CrossRef] [PubMed]
Kumar, N.S.; Nazeer, R.; Jaiganesh, R. Purification and identification of antioxidant peptides from the skin
protein hydrolysate of two marine fishes, horse mackerel (Magalaspis cordyla) and croaker (Otolithes ruber).
Amino Acids 2012, 42, 1641–1649. [CrossRef] [PubMed]
424
Mar. Drugs 2017, 15, 143
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
Mendis, E.; Rajapakse, N.; Kim, S.-K. Antioxidant properties of a radical-scavenging peptide purified from
enzymatically prepared fish skin gelatin hydrolysate. J. Agric. Food Chem. 2005, 53, 581–587. [CrossRef]
[PubMed]
Nazeer, R.; Kumar, N.S.; Ganesh, R.J. In vitro and in vivo studies on the antioxidant activity of fish peptide
isolated from the croaker (Otolithes ruber) muscle protein hydrolysate. Peptides 2012, 35, 261–268. [CrossRef]
[PubMed]
Ngo, D.-H.; Qian, Z.-J.; Ryu, B.; Park, J.W.; Kim, S.-K. In vitro antioxidant activity of a peptide isolated from
Nile tilapia (Oreochromis niloticus) scale gelatin in free radical-mediated oxidative systems. J. Funct. Foods
2010, 2, 107–117. [CrossRef]
Samaranayaka, A.G.; Li-Chan, E.C. Autolysis-assisted production of fish protein hydrolysates with
antioxidant properties from Pacific hake (Merluccius productus). Food Chem. 2008, 107, 768–776. [CrossRef]
Zhang, Y.; Duan, X.; Zhuang, Y. Purification and characterization of novel antioxidant peptides from
enzymatic hydrolysates of tilapia (Oreochromis niloticus) skin gelatin. Peptides 2012, 38, 13–21. [CrossRef]
[PubMed]
Lee, W.-S.; Jeon, J.-K.; Byun, H.-G. Characterization of a novel antioxidative peptide from the sand eel
Hypoptychus dybowskii. Process Biochem. 2011, 46, 1207–1211. [CrossRef]
Kong, Y.-Y.; Chen, S.-S.; Wei, J.-Q.; Chen, Y.-P.; Lan, W.-T.; Yang, Q.-W.; Huang, G.-R. Preparation of
antioxidative peptides from spanish mackerel (Scomberomorus niphonius) processing byproducts by enzymatic
hydrolysis. Biotechnology 2015, 14, 188–193.
Jeevithan, E.; Bao, B.; Zhang, J.; Hong, S.; Wu, W. Purification, characterization and antioxidant
properties of low molecular weight collagenous polypeptide (37 kDa) prepared from whale shark cartilage
(Rhincodon typus). J. Food Sci. Technol. 2015, 52, 6312–6322. [CrossRef] [PubMed]
Gajanan, P.G.; Elavarasan, K.; Shamasundar, B.A. Bioactive and functional properties of protein hydrolysates
from fish frame processing waste using plant proteases. Environ. Sci. Pollut. Res. 2016, 23, 24901–24911.
[CrossRef] [PubMed]
Li, J.; Li, Q.; Li, J.; Zhou, B. Peptides derived from Rhopilema esculentum hydrolysate exhibit angiotensin
converting enzyme (ACE) inhibitory and antioxidant abilities. Molecules 2014, 19, 13587–13602. [CrossRef]
[PubMed]
Harada, K.; Maeda, T.; Hasegawa, Y.; Tokunaga, T.; Ogawa, S.; Fukuda, K.; Nagatsuka, N.; Nagao, K.; Ueno, S.
Antioxidant activity of the giant jellyfish Nemopilema nomurai measured by the oxygen radical absorbance
capacity and hydroxyl radical averting capacity methods. Mol. Med. Rep. 2011, 4, 919–922. [PubMed]
Samanta, J.K.M.P.K.; Khora, S. Antioxidant activity of fish protein hydrolysates from Sardinella longiceps.
Int. J. Drug Dev. Res. 2014, 6, 137–145.
Chi, C.-F.; Cao, Z.-H.; Wang, B.; Hu, F.-Y.; Li, Z.-R.; Zhang, B. Antioxidant and functional properties of
collagen hydrolysates from spanish mackerel skin as influenced by average molecular weight. Molecules
2014, 19, 11211–11230. [CrossRef] [PubMed]
Kangsanant, S.; Thongraung, C.; Jansakul, C.; Murkovic, M.; Seechamnanturakit, V. Purification and
characterisation of antioxidant and nitric oxide inhibitory peptides from Tilapia (Oreochromis niloticus)
protein hydrolysate. Int. J. Food Sci. Technol. 2015, 50, 660–665. [CrossRef]
Bardan, A.; Nizet, V.; Gallo, R.L. Antimicrobial peptides and the skin. Expert Opin. Biol. Ther. 2004, 4, 543–549.
[CrossRef] [PubMed]
Song, R.; Wei, R.-B.; Luo, H.-Y.; Wang, D.-F. Isolation and characterization of an antibacterial peptide fraction
from the pepsin hydrolysate of half-fin anchovy (Setipinna taty). Molecules 2012, 17, 2980–2991. [CrossRef]
[PubMed]
Song, R.; Wei, R.; Zhang, B.; Wang, D. Optimization of the antibacterial activity of half-fin anchovy
(Setipinna taty) hydrolysates. Food Bioprocess Technol. 2012, 5, 1979–1989. [CrossRef]
Ennaas, N.; Hammami, R.; Beaulieu, L.; Fliss, I. Purification and characterization of four antibacterial
peptides from protamex hydrolysate of Atlantic mackerel (Scomber scombrus) by-products. Biochem. Biophys.
Res. Commun. 2015, 462, 195–200. [CrossRef] [PubMed]
Ennaas, N.; Hammami, R.; Beaulieu, L.; Fliss, I. Production of antibacterial fraction from Atlantic mackerel
(Scomber scombrus) and its processing by-products using commercial enzymes. Food Bioprod. Process. 2015, 96,
145–153. [CrossRef]
425
Mar. Drugs 2017, 15, 143
111. Ryu, B.; Qian, Z.J.; Kim, S.K. SHP-1, A novel peptide isolated from seahorse inhibits collagen release through
the suppression of collagenases 1 and 3, nitric oxide products regulated by NF-κB/p38 kinase. Peptides 2010,
31, 79–87. [CrossRef] [PubMed]
112. Ryu, B.; Qian, Z.J.; Kim, S.K. Purification of a peptide from seahorse, that inhibits TPA-induced MMP,
iNOS and COX-2 expression through MAPK and NF-κB activation, and induces human osteoblastic and
chondrocytic differentiation. Chem. Biol. Interact. 2010, 184, 413–422. [CrossRef] [PubMed]
113. Shen, Q.; Guo, R.; Dai, Z.; Zhang, Y. Investigation of enzymatic hydrolysis conditions on the properties
of protein hydrolysate from fish muscle (Collichthys niveatus) and evaluation of its functional properties.
J. Agric. Food Chem. 2012, 60, 5192–5198. [CrossRef] [PubMed]
114. Lødemel, J.B.; Egge-Jacobsen, W.; Olsen, R.L. Detection of TIMP-2-like protein in Atlantic cod (Gadus morhua)
muscle using two-dimensional real-time reverse zymography. Biosci. Biotechnol. Biochem. 2004, 139, 253–259.
[CrossRef] [PubMed]
115. Katiyar, S.; Elmets, C.A.; Katiyar, S.K. Green tea and skin cancer: Photoimmunology, angiogenesis and
DNA repair. J. Nutr. Biochem. 2007, 18, 287–296. [CrossRef] [PubMed]
116. Zhuang, Y.; Hou, H.; Zhao, X.; Zhang, Z.; Li, B. Effects of collagen and collagen hydrolysate from jellyfish
(Rhopilema esculentum) on mice skin photoaging induced by UV irradiation. J. Food Sci. 2009, 74, H183–H188.
[CrossRef] [PubMed]
117. Diffey, B.L. Solar ultraviolet radiation effects on biological systems. Phys. Med. Biol. 1991, 36, 299–328.
[CrossRef] [PubMed]
118. Tanino, Y.; Budiyanto, A.; Ueda, M.; Nakada, A.; Nyou, W.T.; Yanagisawa, M.; Ichihashi, M.; Yamamoto, Y.
Decrease of antioxidants and the formation of oxidized diacylglycerol in mouse skin caused by UV irradiation.
J. Dermatol. Sci. Suppl. 2005, 1, S21–S28. [CrossRef]
119. Han, Y.-T.; Han, Z.-W.; Yu, G.-Y.; Wang, Y.-J.; Cui, R.-Y.; Wang, C.-B. Inhibitory effect of polypeptide from
Chlamys farreri on ultraviolet A-induced oxidative damage on human skin fibroblasts in vitro. Pharmacol. Res.
2004, 49, 265–274. [CrossRef] [PubMed]
120. Yu, Y.; Li, Z.; Liu, X.; Wang, Y. Effects of polypeptides from Chlamys farreri on the structure of skin and the
content of antioxidants in hairless mice irradiated by ultraviolet B. China J. Lepr. Skin Dis. 2004, 20, 20–23.
121. Wang, C.-B.; Ding, B.-X.; Guo, S.-B.; Wang, Y.-Z.; Han, Y.-T.; Wang, Y.-J. Protective effect of polypeptide from
Chlamys farreri on mitochondria in human dermal fibroblasts irradiated by ultraviolet B. Acta Pharmacol. Sin.
2003, 24, 692–696. [PubMed]
122. Leone, A.; Lecci, R.M.; Durante, M.; Meli, F.; Piraino, S. The bright side of gelatinous blooms:
Nutraceutical value and antioxidant properties of three Mediterranean jellyfish (Scyphozoa). Mar. Drugs 2015,
13, 4654–4681. [CrossRef] [PubMed]
123. Fan, J.; Zhuang, Y.; Li, B. Effects of collagen and collagen hydrolysate from jellyfish umbrella on histological
and immunity changes of mice photoaging. Nutrients 2013, 5, 223–233. [CrossRef] [PubMed]
124. Hou, H.; Li, B.; Zhang, Z.; Xue, C.; Yu, G.; Wang, J.; Bao, Y.; Bu, L.; Sun, J.; Peng, Z.; et al. Moisture absorption
and retention properties, and activity in alleviating skin photodamage of collagen polypeptide from marine
fish skin. Food Chem. 2012, 135, 1432–1439. [CrossRef] [PubMed]
125. Chen, T.; Hou, H. Protective effect of gelatin polypeptides from Pacific cod (Gadus macrocephalus)
against UV irradiation-induced damages by inhibiting inflammation and improving transforming growth
factor-β/Smad signaling pathway. J. Photochem. Photobiol. B Biol. 2016, 162, 633–640. [CrossRef] [PubMed]
126. Shibuya, S.; Ozawa, Y.; Toda, T.; Watanabe, K.; Tometsuka, C.; Ogura, T.; Koyama, Y.I.; Shimizu, T.
Collagen peptide and vitamin C additively attenuate age-related skin atrophy in Sod1-deficient mice.
Biosci. Biotechnol. Biochem. 2014, 78, 1212–1220. [CrossRef] [PubMed]
127. Chen, T.; Hou, H.; Lu, J.; Zhang, K.; Li, B. Protective effect of gelatin and gelatin hydrolysate from salmon
skin on UV irradiation-induced photoaging of mice skin. J. Ocean Univ. China 2016, 15, 711–718. [CrossRef]
128. Jimbo, N.; Kawada, C.; Nomura, Y. Optimization of dose of collagen hydrolysate to prevent UVB-irradiated
skin damage. Biosci. Biotechnol. Biochem. 2016, 80, 356–359. [CrossRef] [PubMed]
129. Sun, L.; Zhang, Y.; Zhuang, Y. Antiphotoaging effect and purification of an antioxidant peptide from tilapia
(Oreochromis niloticus) gelatin peptides. J. Funct. Foods 2013, 5, 154–162. [CrossRef]
426
Mar. Drugs 2017, 15, 143
130. Zhuang, Y.; Sun, L. Preparation of reactive oxygen scavenging peptides from tilapia (Oreochromis niloticus)
skin gelatin: Optimization using response surface methodology. J. Food Sci. 2011, 76, C483–C489. [CrossRef]
[PubMed]
131. De Luca, C.; Mikhal’Chik, E.V.; Suprun, M.V.; Papacharalambous, M.; Truhanov, A.I.; Korkina, L.G.
Skin antiageing and systemic Redox effects of supplementation with marine collagen peptides and
plant-derived antioxidants: A single-blind case-control clinical study. Oxid. Med. Cell. Longev. 2016, 2016,
4389410. [CrossRef] [PubMed]
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
427
marine drugs
Review
Microbial Diseases of Bivalve Mollusks: Infections,
Immunology and Antimicrobial Defense
Carla Zannella 1 , Francesco Mosca 2 , Francesca Mariani 2 , Gianluigi Franci 1 , Veronica Folliero 1 ,
Marilena Galdiero 1 , Pietro Giorgio Tiscar 2 and Massimiliano Galdiero 1, *
1
2
*
Department of Experimental Medicine—University of Campania “Luigi Vanvitelli”, Via Costantinopoli 16,
80138 Napoli, Italy; carlazannella88@gmail.com (C.Z.); gianluigi.franci@unina2.it (G.F.);
veronica.folliero@unina2.it (V.F.); marilena.galdiero@unina2.it (M.G.)
Faculty of Veterinary Medicine, University of Teramo, Piano d’Accio, 64100 Teramo, Italy;
fmosca@unite.it (F.M.); fmariani@unite.it (F.M.); pgtiscar@unite.it (P.G.T.)
Correspondence: massimiliano.galdiero@cantab.net
Academic Editors: Se-Kwon Kim and Peer B. Jacobson
Received: 16 January 2017; Accepted: 8 June 2017; Published: 17 June 2017
Abstract: A variety of bivalve mollusks (phylum Mollusca, class Bivalvia) constitute a prominent
commodity in fisheries and aquacultures, but are also crucial in order to preserve our ecosystem’s
complexity and function. Bivalve mollusks, such as clams, mussels, oysters and scallops, are
relevant bred species, and their global farming maintains a high incremental annual growth rate,
representing a considerable proportion of the overall fishery activities. Bivalve mollusks are filter
feeders; therefore by filtering a great quantity of water, they may bioaccumulate in their tissues a
high number of microorganisms that can be considered infectious for humans and higher vertebrates.
Moreover, since some pathogens are also able to infect bivalve mollusks, they are a threat for the
entire mollusk farming industry. In consideration of the leading role in aquaculture and the growing
financial importance of bivalve farming, much interest has been recently devoted to investigate
the pathogenesis of infectious diseases of these mollusks in order to be prepared for public health
emergencies and to avoid dreadful income losses. Several bacterial and viral pathogens will be
described herein. Despite the minor complexity of the organization of the immune system of bivalves,
compared to mammalian immune systems, a precise description of the different mechanisms that
induce its activation and functioning is still missing. In the present review, a substantial consideration
will be devoted in outlining the immune responses of bivalves and their repertoire of immune cells.
Finally, we will focus on the description of antimicrobial peptides that have been identified and
characterized in bivalve mollusks. Their structural and antimicrobial features are also of great interest
for the biotechnology sector as antimicrobial templates to combat the increasing antibiotic-resistance
of different pathogenic bacteria that plague the human population all over the world.
Keywords: marine bivalve mollusks; antimicrobial peptides; bivalve immune system
1. Introduction
Marine bivalve mollusks may be affected by numerous infectious diseases. In this review, we will
consider the most important diseases caused by viruses, bacteria and protistans, which are responsible
for mortality outbreaks and have a substantial commercial impact. To a lesser extent, other diseases are
also caused by fungi (Aspergillus, Penicillium and Fusarium) [1], Porifera (Cliona spp.) [2], and helminth
parasites, such as trematodes, cestodes and nematodes [3].
Currently, the main infectious diseases of marine bivalve mollusks, such as herpes virus infection
and bonamiasis, have taken on a worldwide distribution due to trade globalization. Since the
transmission among bivalve mollusks is direct and horizontal, high-density production systems
Mar. Drugs 2017, 15, 182
428
www.mdpi.com/journal/marinedrugs
Mar. Drugs 2017, 15, 182
and environmental changes might have contributed to increasing the spread of diseases [4];
therefore, to avoid the current risk of further spreading of illnesses throughout the world, the World
Organisation for Animal Health (OIE) Aquatic Code has set out standards and recommendations to
improve the safety of international trade in aquatic animals, including marine bivalve mollusks.
Nowadays, the aim is to prevent the pathogen’s introduction into an importing country, so as to avoid
the onset of disease outbreak rather than to eradicate the pathogen, which would be more difficult
and expensive because of the high-density production systems used in commercial hatcheries and
nurseries and the continuous stock movements around the world. Due to the absence of effective
and specific chemotherapy and anti-viral treatments or vaccines available to prevent illnesses [5],
the surveillance and control plan of these diseases based on their prevention have a key role. For this
reason, it is important to implement high levels of on-farm and live-holding facility biosecurity and to
restrict stock movements. Avoiding stressors, such as exposition to intense temperatures, a high or low
level of salinity, handling, substantial co-infection with other parasites, as well as decreasing density,
should help to reduce the impact of diseases [4]. The present review will describe bacterial and viral
pathogens that affect bivalve mollusks and will illustrate the immune responses generated in bivalves
and the repertoire of immune cells and their activation upon infection. An aspect of importance in the
immune defense mechanisms operated by bivalve mollusks is the expression of antimicrobial peptides;
therefore, the second part of the review will be dedicated to providing an outline of the antimicrobial
peptides that have been identified and characterized in bivalve mollusks.
2. Infectious Diseases of Marine Bivalve Mollusks
Taking into account all of these considerations, the development of reliable and useful diagnostic
tools is of paramount importance for the prevention and control of diseases. Considering that the
lack of bivalve molluscan cell lines has greatly limited the possibility for viral isolation and the study
of the experimental transmission of these pathogenic microorganisms, currently, the detection of the
causative agent of microbial disease is mainly based on direct diagnostic methods. Moreover, classic
serological methods are not suitable for diagnostic purposes since mollusks do not produce antibodies;
in fact, histology is considered as the standard screening diagnostic method because it supplies a
wider amount of information, but macroscopic examination usually gives no pathognomonic signs
or indicative information. It is difficult to diagnose an infection based exclusively on morphological
differences between species that have similar morphological characteristics, such as for example
Bonamia ostreae and Bonamia exitiosa, when observed under the microscope [6]. To overcome these
problems, nowadays, more specific and sensitive molecular diagnostic techniques are used in addition
to electron microscopy for specific identification of the pathogen. The OIE Manual of Diagnostic
Tests for Aquatic Animals describes specific protocols designed to detect a certain pathogen agent, to
be employed to confirm histological examination results and provides a species-specific diagnosis.
Methods used in targeted surveillance programs should not be time consuming; in fact, in most
cases, PCR and subsequently the sequencing of 16S or other candidate loci are recommended for
the identification of the isolate. For a presumptive diagnosis of a disease, the standard method is
histopathology, but for a confirmatory diagnosis, the standard methods are polymerase chain reaction
(PCR) and in situ hybridization (ISH); however, sequencing and transmission electron microscope
(TEM) are recommended.
Viral infectious diseases: the most important viruses associated with disease outbreaks and
the major cause of mortality in bivalves are currently members of the families of Herpesviridae and
Iridoviridae; nevertheless there are also other viruses that can infect bivalves belonging to the families
of Picornaviridae, Papovaviridae, Birnaviridae, Retroviridae and Reoviridae [7]. Viral pathogens are often
highly infectious and easily transmissible. High-density production systems and environmental
changes might have contributed to increasing the spread of the disease [4]. Molecular tools such as
PCR, ISH and immunochemistry are used to detect viral pathogens in mollusks [8–10].
429
Mar. Drugs 2017, 15, 182
Herpes-like viruses: The first description of herpes-like viral infection was reported
by Farley et al. (1972) [11] in Crassostrea virginica from the east coast of the USA.
Afterwards, disease outbreaks, associated with high mortality rates, particularly in larvae and
spawn during the summer period, have been reported from Pacific oysters (Crassostrea gigas) in France,
where higher mortalities were observed in 2008 and increased in 2009 and 2010 [12]. Oyster herpesvirus
type 1 variant µvar (OsHV-1 µvar) was also found associated with Pacific oyster mass mortalities in
Ireland, Italy, The Netherlands, Spain, the U.K. and in Australia, New Zealand and Korea, but is known
to be detected elsewhere in the absence of oyster mortalities (e.g., Japan) [13]. Recently, OsHV-1 was
detected in C. gigas in Japan and South Korea associated with mass mortality rate [14,15] and in Sweden
and Norway [16]. In the Thau Lagoon (France), OsHV-1 and, secondarily Vibrio splendidus are responsible
for mass mortality of C. gigas [17]. During the summer of 2012 and 2013, OsHV-1 caused high mortality of
Scapharca broughtonii in China [10]. TEM analysis showed that larvae exhibited generalized infections,
whereas focal infections usually occurred in juveniles. Adult stages were less sensitive than younger
stages. Infected larvae showed a reduction in feeding and swimming activities, and mortality can reach
100% in a few days. The effects of the disease on the hosts manifested in velar and mantle lesions, and the
attitude of larvae to swim weakly in circles. Histologically, fibroblastic-like cells exhibited abnormal
cytoplasmic basophilia and enlarged nuclei with marginated chromatin; other cell types including
hemocytes and myocytes showed extensive chromatin condensation [18].
Irido-like viruses: Maladie des branchies or gill disease is a disease caused by gill necrosis virus
(GNV), responsible for recurrent mass mortalities in adult Portuguese oysters (Crassostrea angulata),
from 1966 until the early 1970s along French coasts. To a lesser extent, gill disease also affected the
Pacific oyster, C. gigas, imported in France, but with a negligible mortality. Because of its natural
resistance to infection, C. gigas is currently the main species bred in Europe. Another Irido-like virus,
hemocyte infection virus (HIV), caused mass mortality of Portuguese adult oysters (C. angulata) in
France between 1970 and 1973. This virus is similar to GNV, and viral particles can be observed in
the cytoplasm of atypical infected hemocytes in connective tissues. A third type of Irido-like virus,
the oyster velar virus (OVV), caused a high mortality rate of Pacific larval oysters on the west coast of
North America (Washington State, USA) from 1976–1984 [19]. Currently, Irido-like virus infections are
uncommon in Europe.
Bacterial infectious diseases: Due to the marine bivalve filter-feeding habit, they concentrate a
rich and diverse bacterial commensal microbiota, composed of various species belonging to different
genera like Vibrio, Pseudomonas, Acinetobacter, Photobacterium, Moraxella, Aeromonas, Micrococcus and
Bacillus [20]; some of them may be pathogenic in larval rearing systems and not in the wild; in fact,
pathogenicity depends on the host species, their life stage, amount of bacteria and on environmental
factors. The rate of larval mortality can reach 100%, especially if larvae are reared in static systems at
high temperature and density. Diagnosis of bacterial diseases is based on macroscopic inspection of
shell valves in combination with PCR, which is the most sensitive and rapid method [21].
Gram-negative bacteria: Most bacterial diseases of bivalves are caused by a large range of
Vibrio species (Vibrio alginolyticus, V. splendidus, Vibrio anguillarum, Vibrio tubiashi, Vibrio tapetis,
Vibrio aestuarianuns, Vibrio neptunius and other Vibrio spp.), Pseudomonas and Aeromonas [22–25].
These bacteria are responsible for bacillary necrosis in a wide range of species of bivalve larvae [26].
Vibrio spp. produce exotoxins (ciliostatic factors and hemolysins), which cause deciliation, loss of
velar epithelial and abnormal swimming behavior [27]. Necrosis has been well described with
histological, immunofluorescent and ultrastructure techniques [28]. V. tapetis is the activating agent of
an epizootic infection described in adult clams called brown ring disease (BRD); the most sensitive
species is Ruditapes philippinarum [21,29]. The disease has been detected in France, Spain, Portugal,
Italy, the United Kingdom, Ireland, Norway [30] and, less frequently, in the Mediterranean and
Adriatic seas [31]. In 2006, V. tapetis was reported from Manila clams on the west coast of Korea [32].
Transmission passes through direct contact between infected clams [33]. V. tapetis adheres to and
colonizes the surface of the periostracal lamina at the mantle edge of the shell, causing anomalous
430
Mar. Drugs 2017, 15, 182
deposition of periostracum, an abnormal calcification process and the accumulation of brown organic
material, which is a striking sign of the disease. From the extrapallial space, the bacteria can penetrate
the mantle epithelium and the soft tissues, where they reproduces themselves and cause severe
damage and subsequent death [34]. Juvenile oyster disease (JOD) is a similar syndrome to BRD
that appeared in 1988 in juvenile C. virginica [35] caused by Roseovarius crassostreae; nowadays, the
disease is known as Roseovarius oyster disease [36]. Major mortal outbreaks have been reported in
cultured oysters from New York to Maine (USA). Symptoms, such as reduced growth rates, fragile
shell development, cupping on the left valve, anomalous conchiolin deposit around the periphery of
the mantle on the inner valves [37], occur when water temperature exceeds about 21–25 ◦ C, in high
salinity and high-density culture conditions. Mortality reaches up to 90% in animals <25 mm; instead,
larger juveniles forms show lower rates of mortality [38].
Gram-positive bacteria: Few Gram-positive bacteria cause diseases in bivalves; the main
pathogenic agent is represented by Nocardia crassostreae, the etiological agent of Pacific oyster
nocardiosis (PON) infecting C. gigas and Ostrea edulis cultivated near infected C. gigas along the
west coast of North America from the Strait of Georgia, British Columbia to California and Japan
(Matsushima Bay) [39]. Carella et al. (2013) [40] have notified nocardiosis in Mediterranean bivalves.
Mortality rate reaches up to 35%; infected animals show yellow-green pustules in the mantle, gills,
adductor and cardiac muscle associated with intense hemocyte infiltration around the colonies of
Nocardia [41].
Protozoan infectious diseases: The most important protozoan pathogens belong to the genera
Bonamia, Perkinsus, Haplosporidium and Marteilia; they can mainly infect oyster and clam species,
causing enormous damage to commercial productions. In particular, in this review, we will discuss
in detail the diseases caused by Perkinsus marinus, Perkinsus olseni, Marteilia refringens, B. ostreae and
B. exitiosa that are currently under surveillance and require mandatory notification by the World
Organization for Animal Health. Prevalence and intensity of infections tend to increase during the
warm season, depending on temperature and high salinity rates [42]. For correct identification of
the pathogen, histological examination is needed, as well as ISH or PCR. However, for unknown
susceptible species and unknown geographical range, confirmation by sequencing and description
by TEM are recommended. Bonamiosis represents 63% of protozoan diseases in Europe [43] and
is caused by a group of protists in the genus Bonamia. B. ostreae has spread in Europe (France,
Ireland, Netherlands, Portugal, Spain and the U.K.), but also on the west coast of Canada and both
coasts of the USA [44]. B. ostreae was found in O. edulis imported to China [45]; recently, this species
was detected in New Zealand infecting the flat oyster Ostrea chilensis [46]. B. exitiosa was found in
O. chilensis in South Island, New Zealand [47], and in Ostrea angasi in southeastern Australia [48].
Since 2003, the parasite has been observed in both the Atlantic and Pacific coasts of the USA [49],
including California [50]; B. exitiosa was also detected in O. edulis from the Galician coast (Spain) and
the Manfredonia Gulf, Italy (Adriatic Sea), including concurrent infections with B. ostreae [51] and in
Ostrea stentina in Tunisia [52]. B. exitiosa was found, as well, on the Spanish Mediterranean coast [53],
in southwestern England [54] and in southern Portugal [55]. Others species, Bonamia perspora and
Bonamia roughleyi, have been found on the east coast of the USA [56] and in southeastern Australia [57].
With the exception of B. perspora, all of the other species can be normally observed within hemocytes
of the host [58]; B. perspora occurs within connective tissues [56]. The pathogen infects the hemocytes,
multiplies within blood cells and spreads to all tissues. In highly infected adult oysters, we can find a
yellow discoloration of the tissue, extensive lesions on the gill and mantle, breakdown of connective
tissue and significant mortality (>90%). Larvae can be infected and contribute to the spread of the
parasite. A lack of resistance to infection and, therefore, high densities of oysters in closely-spaced
beds favor the development of epizootics.
In the late 1960s, two protozoans, both in the genus Marteilia, Marteilia refringens and
Marteilia sydneyi, were identified as the causative agents of disease and heavy mortalities in
the flat oyster: O. edulis, in France, and in Saccostrea glomerata, in Australia, respectively [59];
431
Mar. Drugs 2017, 15, 182
afterward, the parasite become widespread: M. refringens, infecting O. edulis, has, to date, mainly been
found in Europe (Albania, Croatia, France, Greece, Italy, Morocco, Portugal, Spain, Sweden, Tunisia and
the United Kingdom); Mytilus galloprovincialis, in the Gulf of Thermaikos, northern Greece [60], on the
north coast of the Adriatic Sea [61] and along the Campanian coast (Tyrrhenian Sea, South of Italy) [62].
Marteilia was also previously found in M. galloprovincialis bred in Puglia [63]. M. sydneyi, infecting
Saccostrea glomerata and possibly other Saccostrea spp. [64], has been reported in New South Wales,
Queensland and Western Australia [65]. Marteiliosis is also known as Aber disease (M. refringens,
two types: M and O, as defined by Peruzzi et al. [66], and Queensland Unknown (QX) disease
(M. sydneyi). Both infect the digestive system and sporulate in epithelial cells of the digestive gland
causing paleness of the digestive glands, emaciation of the oyster, dissipation of its reserves of energy,
tissue necrosis, cessation of growth and mortality up to 90% in summer. Juveniles and older life stages
are susceptible to infection, but prevalence and infection intensity are generally higher in individuals
of two years old or more [67]. By TEM analysis, M. sydneyi can be differentiated from M. refringens
by a paucity of striated inclusions within the plasmodia, the formation of eight to sixteen sporangial
primordia in each plasmodium (instead of eight for M. refringens), the occurrence of two or three spores
in each sporangium (rather than four in M. refringens) and the presence of a thick coat of concentric
biological membranes surrounding mature M. sydneyi spores.
Perkinsosis: Perkinsosis is caused by Perkinsus marinus, responsible for dermo disease in
C. virginica and, to a lesser extent, in C. gigas, Crassostrea rhizophorae and Crassostrea corteziensis [68].
The pathogen, uncommon in Europe, was first described in the Gulf of Mexico [69]. It was found along
the southeast coast of the USA from Maine to Florida [70], along the Pacific coast of Mexico [71], in the
Gulf of California (northwest Mexico) [72] and in Brazil [73]. Perkinsus olseni causes perkinsosis in
many clam species with distribution in Australia, Korea, China, Japan and Europe [32]. Both parasites
were also found associated with ten oyster species collected from both Panamanian coasts, including
the Panama Canal and Bocas del Toro [74]. Transmission is direct from oyster to oyster; viable cells
are released in host feces or on the death of the host [32] and are acquired through host feeding
mechanisms. Every life stage is susceptible to disease [75]. The pathogen infects and proliferates
in the digestive epithelium, connective tissue of all organs and hemocytes causing hemocytosis and
tissue lysis with a consequent severe emaciation; mortality arrives up to 80% based on environmental
factors [76]. In order to simplify all microbiological diseases, we generated tables with details of the
infections (Tables 1–3).
432
Disease
(Pathogenic Agent)
Host Species
Effects on Host
Geographical Distribution
References
Europe (France, Ireland, Italy, The
Netherlands, Spain); U.K.; Australia;
New Zealand, Mexico, USA, Japan,
South Korea, China
[10,13,14]
VIRUSES
Herpes virus infection
(oyster herpes virus)
Mainly hatchery-reared larvae of
Crassostrea gigas and Ostrea spp.
Gill necrosis virus (GNV)
Hemocyte infection virus (HIV)
Crassostrea angulata and C. gigas
Oyster velar virus disease (OVV)
C. gigas larvae
Velar and mantle lesions;
deterioration; swim in circles
Destruction of gill filaments
Virus infected hemocytes
Larval movement affected
through loss of infected
epithelial cells from velum
France, Portugal, Spain, U.K.
France, Spain
[77]
Washington State, USA
Table 2. Main bacterial infectious diseases of marine bivalve mollusks.
433
Disease
(Pathogenic Agent)
Host Species
Effects on Host
Geographical Distribution
References
BACTERIA
Larval and juvenile vibriosis
(Vibrio anguillarum, V. tubiashi,
V. alginolyticus, V. splendidus,
V. aestuarianus, V. neptunius)
Wide range of
hatchery-reared species
Tissue necrosis (due to production of exotoxin
by the bacteria), up to 100% larval mortality
In all marine waters where bivalve
hatchery culture is practiced
[78,79]
Brown ring disease
(Vibrio tapetis)
Ruditapes philippinarum
Brown deposit on shell; degeneration of
digestive gland followed by metabolic disorder
and death
Entire European Atlantic coast to
North Africa, including coasts of
France, Portugal, Spain, Italy, U.K.,
Ireland and Norway, west coast of
Korea
[30,32]
Roseovarius oyster disease
(Roseovarius crassostreae)
Crassostrea virginica juveniles
<25 mm shell length
Reduced growth rates, fragile shell
development, cupping on the left valve, mantle
lesions, up to 90% mortalities
USA
[37]
Pacific oyster nocardiosis
(Nocardia crassostreae)
Crassostrea gigas, Ostrea
edulis cultivated near
infected C. gigas
Yellow-green pustules in the mantle, gills,
adductor and cardiac muscle, up to 35%
mortalities
West coast of North America from the
Strait of Georgia, British Columbia to
California, and Japan (Matsushima
Bay), Mediterranean Sea
[39,40]
Mar. Drugs 2017, 15, 182
Table 1. Main viral infectious diseases of marine bivalve mollusks.
Mar. Drugs 2017, 15, 182
Table 3. Main protozoan infectious diseases of marine bivalve mollusks.
Disease
(Pathogenic Agent)
Host Species
Effects on Host
Geographical Distribution
References
Bonamiasis
(Bonamia ostreae, B. exitiosa, B. perspora,
B. roughleyi)
Wide range of oyster species
Yellow discoloration of tissue, extensive lesions
on gill and mantle, breakdown of connective
tissue, significant mortality (up to 90%)
Europe, U.K., west coast Canada, east and west
coasts of USA, New Zealand and SE Australia
[44–46,48,50,51,80]
Digestive gland (or Aber) disease
(Marteilia refringens)
Ostrea edulis and Mytilus
galloprovincialis
Pale digestive gland, severe emaciation, tissue
necrosis, cessation of growth, mortalities up to
90% in summer
In O. edulis: Europe (Albania, Croatia, France,
Greece, Italy, Morocco, Portugal, Spain, Sweden,
Tunisia, U.K.); in M. galloprovincialis: northern
Greece, in Italy, along the Adriatic Sea and the
Campanian coast (Tyrrhenian Sea)
[56–59]
QX disease
(Marteilia sydneyi)
Saccostrea glomerata and
Saccostrea spp.
Necrosis of digestive gland, loss of condition,
gonad absorption, mortalities up to 90% in
summer
New South Wales, Queensland and
Western Australia.
[60,61]
Dermo disease
(Perkinsus marinus)
Crassostrea virginica
Severe emaciation, loss of condition, high
mortality rate depending on temperature and
salinity
Gulf of Mexico, southeast coast of USA, Pacific
coast of Mexico, Gulf of California, Brazil
[65–69]
PROTISTS
434
Mar. Drugs 2017, 15, 182
In conclusion, we must as well remember that for a disease to occur, the synergy among three
factors is required. This synergy is commonly named the epidemiological triangle, which is composed
by a host, a pathogenic agent and the environment. In fact, some of the infectious agents may
be pathogenic or nonpathogenic based on the host species, its life stage (larval, juvenile or adult
form) and the immune system, on which the environmental factor plays a key role. We can, therefore,
assert that, in general, the exposition to extreme temperatures, a too high or too low level of salinity,
human handling, an increasing density in rearing systems and co-infection with other parasites may
reduce the immune defenses of the host, as well as increase the pathogenic agent rate of growth and,
hence, its pathogenicity, making the host more susceptible to illness.
Based on the knowledge we have today on how a disease can spread and acknowledging the
key role of the environment, it is clear that an improvement of the surveillance on the environment of
rearing systems is essential.
3. Defense Mechanisms in Marine Bivalve Mollusks
During the last few decades, the immunology of marine bivalve mollusks (MBM) has been
investigated with great interest, leading to the development of different branches for basic and applied
research. The hemocyte phagocytosis constitutes the major immune response in MBM, and the study
of this highly conserved process has contributed to better understanding not only the pathogenetic
mechanisms of infectious diseases in MBM [81], but also the role of the filter-feeding organisms
as passive carriers of pathogens to humans, considering the involvement of the hemocytes and
hemolymph factors on the microbial clearance from mollusk’s tissues [82].
The study of the hemocyte properties as biomarkers for monitoring the biological effects
of anthropogenic stressors in polluted sites [83], as well as measuring the economic impact of
environmental stressors on shellfish productions [84] represents another interesting immunological
field of investigation for MBM. Moreover, the basic investigation of the hemocyte/hemolymph
system represents a simplified phylogenetic model for understanding the ancestral interactions and
integrations that occur between immunity and neuroendocrine response [85] and, more generally,
between defense mechanisms and host homeostasis.
In the present section, we have mainly described the most important phases that characterize the
hemocyte phagocytosis in MBM, giving, in parallel, importance to the humoral factors that participate
in the recognition and opsonization of foreign particles, thus focusing on the common features of the
innate immunity that are shared by invertebrate hemocytes and phagocytic cells of higher vertebrates.
Hemocyte-mediated immunity: The cell-mediated immunity represents the main internal defense
response of marine bivalve mollusks. The hemocyte phagocytosis constitutes the key activity,
leading to the recognition, engulfment and demolition of biotic and abiotic foreign particles [86].
The innate immune properties of the hemocytes rely on their ancestral role in food digestion and
nutrient transport [87]. Indeed, the interplay between phagocytosis and nutrition in invertebrates
has been ascribed to the primary function of the hemocytes phagosome as the digestive organelle,
where microorganisms are degraded as nutrients source, then evolving into a more specialized
compartment to kill pathogens (Figure 1) [88].
Marine bivalve mollusks possess an open circulatory system, and the hemocytes are found
either in hemolymph or in tissues, respectively as circulating or infiltrating cells [89]. From an
ontogenetic point of view, some authors suggested that hemocytes are derived from connective
tissue cells [90]; however, different models have been proposed about the types of progenitor cell
lines [91]. The nomenclature of mollusks hemocytes still represents a subject of debate, and the
efforts at developing a uniform classification have resulted in the recognition of two main types of
cells, such as granulocytes and hyalinocytes, based on morphological appearance and granularity
under microscopic examinations. However, flow cytometry [92], electron microscopy [93,94] and
monoclonal-antibodies based assays [95] have suggested the presence of various hemocyte sub-types.
Such diversity may reveal a broad array of activities, and in particular, it is widely accepted that
435
Mar. Drugs 2017, 15, 182
granulocytes play the most active role in the phagocytosis response [96]. Nevertheless, all of the
hemocyte populations contribute to the overall immune response, operating in a differential fashion
on the basis of the different stimulations [97]. The relative concentration of the various circulating
hemocyte types can be exposed to reversible and selective modifications through physiological and
molecular mechanisms comparable to the margination/demargination processes, which take place
in humans and other mammals [98]. Therefore, the quantitative diversity of the cellular hemolymph
configuration represents an important factor for the modulation of the immune response [99].
Figure 1. The figure reports the main phases of the hemocyte phagocytosis, as well as previously
investigated in mussel (author’s unpublished figures) that are particularly described in the present
section, in combination with the main humoral opsonizing and degradative factors.
The interest for the study of the hemocyte immunity mainly derives from the role of marine
bivalve mollusks as sentinel organisms in environmental monitoring [100]. Indeed, many hemocyte
parameters have been investigated as biomarkers in field or laboratory studies [101–103], and detailed
data are available in the literature about the strong influence of natural and anthropic stressors
on the hemocyte activity. In particular, the disruption of their morpho-functional properties has
been described after exposure to low [104] and high [105] temperatures, pH acidification [106],
mechanical stress [107], salinity changes [108], exposure to air [109], harmful algal bloom [110],
organic and inorganic contaminants [111]. Nevertheless, some endogenous factors seem to have also
an important influence on the modulation of the hemocyte activity, such as age [112], gender [113] and
reproductive stage [114].
The hemocyte phagocytosis, mechanisms and kinetics: Bivalve hemocytes resemble the
vertebrate monocyte/macrophage lineage, both in structure and function [115]. The chemotactic
ability of hemocytes to migrate toward foreign particles and to incorporate them inside
phagosomes is closely dependent on morphological activation through the projections of membrane
ruffles or pseudopodia [116]. The cytoskeleton re-arrangement following proper stimulation
represents the pivotal mechanism that allows the hemocytes to acquire a morphological spreading,
from roundish to irregular shape [117]. Previous studies demonstrated that bacterial products, such as
lipopolysaccharides and formylated tripeptide (N-FMLP), were able to elicit chemotactic and/or
chemokinetic reactions in hemocytes [118], and the type of cell movement appeared as dependent
on the nature of chemoattractant, thus hypothesizing a receptor-dependent mechanism [119].
Indeed, a differential migration activity was detected in hemocytes on the basis of the bacteria types
that were encountered [120]. Both chemotaxis and chemokinesis augment the probability of physical
association between hemocytes and foreign particles, but to date, the knowledge about pattern
recognition receptors (PRRs) is still limited in bivalve hemocytes. PRRs recognize the conserved
highly repeated microbial structures, termed pathogen-associated molecular patterns (PAMPs),
and the Toll-like receptors (TRLs) have a prominent role within PRRs group, being traced to the
most ancestral multicellular invertebrates [121]. TLRs belong to type I membrane receptors and
436
Mar. Drugs 2017, 15, 182
contain an extracellular leucine-rich repeat (LRR) domain mediating the recognition of PAMPs [122].
Unlike mammal TLRs, invertebrate TLRs could not directly recognize PAMPs, but they seem to require
the cytokine-like molecule Spatzle as an assistant [123]. Indeed, some authors suggested a hybrid
function in pattern recognition for the primitive mollusk TLR, being characterized by broader ligands
affinity and involving the assistance of some serum components [124].
In the Pacific oyster C. gigas, a putative TLR was cloned and named CgToll-1,
showing upregulation in the hemolymph after challenge with V. anguillarum [125]. Similarly, in the
scallop Chlamys farreri, a Toll homologue was detected and named CfToll-1, revealing transcripts
modulation in the hemocytes after exposure to LPS [126]. In the mussel Mytilus edulis, the
transcriptome analysis indicated a wide repertoire of innate recognition receptors, including transcripts
for 27 TLR, particularly expressed in hemocytes [127]. Following binding of the ligand to the
extracellular segment of TLR, signal transduction takes place by the intracellular toll-interleukin
domain (TIR) containing adaptor molecules [128]. Each TLR recognizes distinct microbial components
and activates different signaling pathways using selected adaptor molecules, then leading to the
engagement of the signaling cascade of protein kinases that ultimately activate transcription factors
and the expression of genes involved in the immune response [129,130]. In contrast to the large
amount of data on TLR signaling systems from higher vertebrates, relatively little is known in
bivalve mollusks. The existence of genes/transcripts mediating the Toll signaling pathway in
hemocytes was reported in M. galloprovincialis, showing upregulation after bacterial challenge,
particularly by Gram-negative, whereas a marginal response was detected following stimulation
with purified PAMPs (LPS, β-glucans) [131]. Intermediate transcripts of the Toll signaling pathway
were also detected in scallop [132], clams [133] and oysters [134]. Moreover, the intensity and
duration of intermediate components activation, such as kinase-mediated cascade, appeared as
dependent on the type of extracellular stimuli [135]. This kind of evidence contributes to support
the existence of a differential hemocyte response depending on the bacteria types that are used for
challenge [136]. Although most of the studies focused on the presence of Toll pathways in marine
bivalve mollusks, other types of receptors have been investigated. Recently, the mRNA transcripts of a
new putative phagocytic receptor (CgNimc), belonging to the Nimrod superfamily, were identified
in hemocytes of C. gigas, revealing upregulation after bacterial challenge, whereas the recombinant
protein showed higher binding affinity toward LPS rather than peptidoglycan [137]. In the scallop
Argopecten irradians, a peptidoglycan recognition protein (PGRP) was cloned, sharing high identity with
PGRPs of higher organisms and showing upregulation in the hemocytes exposed to peptidoglycan,
but not to LPS [138]. Two short PGRPs were also detected in the bivalve Solen grandis, and they
were particularly induced by peptidoglycan and β-1,3-glucan [139]. Following an engulfment of
foreign particles within hemocyte phagosome, the activation of lysosomes granules leads to the
formation of phago-lysosomes vacuoles where intracellular digestion takes place [140]. The lysosomal
enzymes strongly participate in the degradation of ingested, material and the hydrolytic activity of
β-glucuronidase, phosphatases, esterases and sulfatases has been detected in mussels [141], clams [142],
cockles [143] and oysters [58]. Oxidative enzymes, such as peroxidase and phenoloxidase, are also
involved in degradative mechanisms, but their presence is not a common feature in any marine bivalve
mollusks [144,145]. The respiratory burst represents another heavy microbicidal mechanism, and the
generation of the highly oxidant reactive oxygen species (ROS) inside phago-lysosomal vacuoles
of stimulated hemocytes was suggested as an NADPH-oxidase-dependent mechanism [146–148].
The ROS synthesis has been widely reported in mussels [149], oysters [150], scallops and clams [151],
although some authors indicated the lack of the NADPH-oxidase activity in the family Veneridae.
The detection of ROS has been mostly investigated in terms of defense mechanism; however, the role
of these molecules has been also considered in cellular and tissue homeostasis [152]. Indeed, previous
reports indicated the ability of mussel hemocytes to generate ROS in the absence of phagocytic
stimulation [153], and more recent evidence has suggested that mitochondria represent the main source
of ROS in the unstimulated hemocytes, rather than the activity of lysosomal NADPH-oxidase [154].
437
Mar. Drugs 2017, 15, 182
Humoral defense factors: The hemocyte degranulation and the extracellular release of
lysosomal enzymes represent the first humoral defense mechanism that was investigated in
marine bivalve mollusks [155], a strategy commonly described as a response to pathogens [156].
However, marine bivalve mollusks possess more selective extracellular tools to contrast
invaders, including recognition and effector proteins, such as lectins, complement-like molecules,
lipopolysaccharide- (LBP) and β-1,3-glucan-binding proteins (β-GBP), fibrinogen-related proteins
(FREPs) and antimicrobial peptides (AMPs) [156–158]. Lectins represent carbohydrate-recognition
proteins, and their agglutinating and opsonizing activities have been previously described in
marine bivalve mollusks, revealing heterogeneous binding specificity towards microbial surface
sugars [159,160]. In particular, C-type lectins can recognize and bind terminal sugars on glycoproteins
and glycolipids in a calcium-dependent manner. Recent studies in different marine bivalve mollusks
have demonstrated both their gene upregulation following bacterial challenge and the binding
activity of the recombinant proteins towards purified PAMPs [161–163]. Galectins, formerly known
as S-type lectins, represent another conserved and ubiquitous family of carbohydrates-binding
proteins, particularly characterized by their affinity for β-galactosides [164–167]. In the clam R.
philippinarum [168] and scallop A. irradians [169], galectins have been cloned and characterized, showing
gene upregulation and agglutination activity following bacterial challenge. Galectins seem to possess
also an opsonizing role by promoting the hemocyte phagocytosis through cross-linking between
extracellular glycocalyx and hemocyte surface, as observed for the oyster galectin CvGal1 [170].
Homologues of the vertebrate complement cascade have been investigated in marine bivalve mollusks
for their immune role against pathogens. C1q represents the first sub-component of the classical
complement pathway, and to date, C1q domain-containing proteins have been characterized at
molecular level in oysters [171], mussels [172], scallops [173] and clams [174], revealing high molecular
diversification of this family [175]. From a functional point of view, the recombinant proteins
showed binding activity towards whole bacterial cells, as well as isolated PAMPs [176]. In addition,
some authors have identified in oyster a complement component C3-like gene, particularly expressed
in the hemocytes [177]. Although AMPs represent the most examined group of antimicrobial proteins,
further discussed in the present review, other bactericidal compounds have been identified in marine
bivalve molluscan integrative components of their humoral defense system. Member homologues of
the bactericidal/permeability-increasing protein (BPI) family were isolated, showing binding activity
toward LPS and bactericidal properties against Gram-negative bacteria [178–180]. Members of the
lysozyme families (N-acetylmuramide glycanhydrolase) have been characterized in mucosal tissues
and secretions of several bivalve species, as described in mussels [181], clams [182], scallops [183] and
oysters [184], displaying a broad spectrum of antimicrobial activity and playing a dual role both in
nutrition and immunity [185]. Moreover, the presence of plasma proteases’ activity was previously
described in marine bivalve mollusks as a microbicidal mechanism [186,187], and such evidence has
accounted for the isolation and characterization of genes encoding proteases, such as cathepsins [188].
In conclusion, the great part of the studies on bivalve immunity has been directed to investigating
the morpho-functional properties of circulating hemocytes and the humoral defense factors, providing
limited information about the spatial and temporal heterogeneity of the immune response. In the
future, a better understanding of microbe-bivalve interactions at mucosal interfaces is required,
considering the interplay between mutualistic, commensal and pathogenic microbes at the initial
encounter/colonization sites [189].
4. AMPs and Their Mechanism of Action
Marine ecosystems constitute more than 70% of the Earth’s surface, are associated with astonishing
species diversity and, therefore, represent an enormous resource of pharmacologically-active molecules.
Marine living beings can be reconsidered as a potentially unlimited reservoir of bioactive molecules,
either derived by complex metabolic reactions or gene-encoded peptides [190,191]. For each milliliter
of seawater, approximately 106 bacteria and 109 viruses are generally present; therefore, seawater
438
Mar. Drugs 2017, 15, 182
is to be considered an abundant source of pathogens. Most marine organisms reside in intimate
coexistence with pathogenic microbes, and their survival in such a hostile surrounding is directly
dependent on the development of a vigorous and successful immune system. In fact, living marine
organisms are continuously exposed to microbial hazards, and to maintain their safeguard in such a
harsh environment, they need a strong defensive mechanism to control all microbial pathogens
that are inglobated with nutrients [192,193]. In fact, microbes are accumulated in bivalves, and
microbial densities in their tissues are generally greater than in seawater. If the filtered microbes
are pathogenic, their concentration in bivalve tissues can be deleterious. In order to defend themselves
against such detrimental pathogens, bivalves depend on cellular defense mechanisms, as earlier
described, and humoral defense factors, among which AMPs play an important role.
As a matter of fact, bivalves having evolved in the constant proximity of microorganisms must
rely on their innate immune system effector molecules to contrast microbial pathogens. An ancient
mechanism of innate immunity is represented by the production of anti-microbial substances,
primarily peptides or polypeptides, which are produced by different types of cells and secretions
and are either constitutively synthesized or induced at the time of infection [191]. In this regard,
marine bivalves represent a valuable and scarcely delved source for novel antimicrobials [194].
Since the innate immunity system is supposed to represent the primary line of host defense
against invading pathogens, it is of paramount importance to maintain host-microbe homeostasis and
AMPs as ancient evolutionary molecules universally distributed in most of the multicellular organisms,
which perform a broad-spectrum antimicrobial activity and, often, also present an immunomodulatory
capacity. Therefore, AMPs play a crucial role in host defense against a wide range of microorganisms
including Gram-positive and Gram-negative bacteria, viruses, fungi and parasites. Since their first
discovery, with the isolation of a peptide named cecropin [195–197], from the insect Hyalophora
cecropia, almost 2000 sequences encoding putative AMPs have been described and included in
“The Antimicrobial Peptide Database” (http://aps.unmc.edu/AP/main.php).
AMPs are relatively small peptides (<60 amino acids) and may play polyvalent roles,
which expand beyond their ability to serve as antibiotics [198]. Several of these peptides have been
proven to possess anticancer activity, to be able to stimulate the immune system by promoting
cytokine release, promote chemotaxis, antigen presentation, angiogenesis, inflammatory responses
and adaptive immune induction [199–201]. During the last few decades, they have been purified
from plants, invertebrates and vertebrates and are consequently considered to be part of the immune
process probably in all Metazoa, representing innate immunity actors conserved along evolution in all
biological kingdoms [202–204]. Despite their ample variation in biophysical characteristics, such as
mass, composition and primary structure, several functional correlates have been identified [205].
In fact, the embracing features of most AMPs include rapid killing mechanisms, broad spectra of action,
a clear net cationic charge and a strong propensity to give rise to amphipathic surfaces able to promote
peptide: membrane interactions [206]. Although the primary structures of AMPs are diverse, based on
genomic and protein sequences analysis coupled with structural and functional studies, AMPs have
been sorted into several groups, including: (i) linear peptides able to adopt an α-helical conformation
in a membrane-mimetic environment, (ii) peptides stabilized by one or several pairs of cysteine
residues able to form disulfide bridges that have structures predominantly composed of β-sheets,
(iii) peptides with a high content of specific amino acids, such as prolines, arginines, tryptophans,
histidines and glycines, but with no uniform secondary structures, and (iv) peptides derived by
partial hydrolysis of bulky precursor proteins with unknown or limited antimicrobial activities before
the enzymatic degradation. AMPs’ antimicrobial activity derives from membrane disruption and
osmotic lysis of bacteria as opposed to the usual mechanism of action of most antibiotics where
specific sites during bacterial growth and replication are targeted. Moreover, some AMPs proved to be
also efficient in inhibiting viral infections. The putative mechanism for exerting an antiviral activity
seems to be: (i) blocking early steps of viral entry by surface carbohydrate interaction, (ii) blocking
viral attachment or penetration into the host cells by interactions with specific cellular receptors,
439
Mar. Drugs 2017, 15, 182
(iii) interaction and inactivation of viral envelope glycoproteins, (iv) modulation of host cell antiviral
responses, (v) blocking intracellular expression of viral genes and/or production of viral proteins.
However, no unequivocal correlation between AMP structures and microbial inhibition or killing
mechanisms has so far become obvious; in fact, striking differences from peptide to peptide and
specificity for particular AMP-microbe combinations are generally observed. The forthright antibiotic
action of AMPs is considered to hinge on their cationic and amphiphilic nature, which empowers
these molecules with the ability of interact with negatively-charged bacterial surfaces and membranes,
therefore leading to membrane disruption or alteration [207]. In fact, AMPs essentially take advantage
of the broad differences found in the organization of bacterial against eukaryotic membranes in
order to promote damage of the membrane. Several differences, such as the absence of cholesterol,
the abundance of anionic lipids and an electric field with a strong inward direction, are decisive
for the correlation of specificity in favor of AMPs action against bacterial pathogens and a lower
toxicity toward host cells [208,209]. Moreover, it is unlikely that bacteria can spoil these features and
develop resistance since it would necessitate a profound modification of the bacterial membranes and
their functions. Even though the exact AMP mechanisms of action remain a subject of discussion,
the majority of them share similar biophysical characteristics that allow peptides to interact with
microbes. Importantly, AMPs’ antibacterial power is directly attributable to some of these features,
such as a net positive charge, enabling AMP-bacterial membrane interactions via electrostatic forces
and the propensity to form amphipathic structures in hydrophobic environments allowing penetration
into the bacterial phospholipid bilayer. Therefore, regardless of any variations in size and structure,
AMPs are often portrayed with an intrinsic cationic and hydrophobic nature that is the key for their
first interaction with target bacterial cells. In agreement with literature data, AMPs’ mode of action
seems to proceed similarly to a pore-forming action or to a detergent effect. Several models have been
put forth to explain such mechanisms, namely the barrel-stave model, the toroidal model and the
carpet-like model (Figure 2) [210]. The three models were all elaborated following the assumption that
AMPs have the tendency of being attracted by the bacterial membrane in virtue of electrostatic bonding
forming between the peptide cationic feature and the low electric charge conferred to outer bacterial
membranes by their surface components, such as phosphate groups within the lipopolysaccharide
(LPS) of Gram-negative bacteria or lipoteichoic acids abundant on the exterior of Gram-positive
bacteria [211].
Figure 2. Mechanisms of interaction of AMPs with membranes. Top: The main proposed modes of
action are: carpet model (1), barrel stave model (2) and toroidal-pore model (3). Bottom: Interactions of
AMPs with Gram-negative and Gram-positive bacteria.
440
Mar. Drugs 2017, 15, 182
These models can be described in brief as follows: in the barrel-stave model, peptides
(more often α-helical peptides with marked hydrophobic-hydrophilic domains), once attached to
the phospholipids, aggregate and enter inside the membrane bilayer with the hydrophilic peptide
domains forming the inside of the pore, and the hydrophobic peptide parts lined up facing the lipidic
region of membrane phospholipids [212]. As a result, transmembrane pores, made up of a bundle of
amphipathic helices, are created in a perpendicular topology within the membrane. A toroidal model
with lipids intercalating between helices can be envisioned when peptides remain linked with lipid
head groups, also when peptides are located upright within the highly-curved lipid bilayer. In this
case, diffusion of lipids between the outer and inner membrane layers is granted by the continuous
surface formed by both membrane leaflets [203,213]. A carpet-like model revealed instrumental for
describing AMPs mechanism devoid of the straight insertion within the hydrophobic core of the
membrane, but with peptides accumulation in an oriented array on the membrane surface forming
a real carpet-like structure. When a threshold concentration is attained, the formation of transitory
pores with disruption of lipid assembly and a detergent-like cell lysis ensues. This also leads to
the micellization of the bilayer. Hence, all models considered, membrane perturbation is driven by
cationic and hydrophobic residues shaping the interactions between peptides and phospholipids [214].
Nevertheless, an oversimplification of the hypothetical pore models is generally applied to the
description of the mechanisms of action of AMPs [215]. More likely, a disordered or chaotic pore can be
envisaged where peptides may shift their conformation, mutating the charges and relative interactions
with lipids and, therefore, allowing the flickering of pores [216].
In conclusion, the interfacial activity is a leading determinant of the permeabilizing activity
of several peptides [217], and it also provides a useful means to differentiate between peptides
with antibacterial power that have a detrimental effect on membrane bilayers and cell-penetrating
peptides, which seem to move past the bilayer without producing serious damages [218,219]. A further
possibility for the antibacterial mechanisms is the action AMPs can exert on microbial intracellular
targets where peptides can block cell-wall and/or nucleic acid synthesis, protein production and
enzymatic activities [203].
5. Marine Bivalve Antimicrobial Peptides
Marine AMPs have been discussed thoroughly in other reviews [220–223]. However, in the
present review, we describe AMPs derived from marine mollusks and their application in fighting
infectious diseases. One unanswered enigma remains: the understanding of how mollusk survive
in the absence of an acquired immune system since they are in close contact with a magnitude of
putative pathogens such as viruses, bacteria, fungi and parasites, as a consequence of their filtering
activities. Fortunately, mollusks encode for several antimicrobial molecules, and several AMPs have
been isolated from marine mollusks, such as mussels (major species analyzed: M. galloprovincialis,
M. edulis), clams (major species analyzed: Venerupis philippinarum), scallops (major species analyzed:
A. irradians, Argopecten purpuratus and Chlamys nobilis) and oysters (major species analyzed: C. virginica
and C. gigas).
Initial identification of AMPs in bivalves dates almost 20 years ago with the pioneering
studies that led to the characterization of the first AMPs in mussels [224–227]. To date, several
AMPs have been described from mussels and other bivalves. The majority of them rank along
to the group of cysteine-containing peptides, which include a huge variety of defensins and
defensin-like peptide and larger proteins. The discovery of the first molluscan AMP was performed
by Hubert et al., 1996, from the M. galloprovincialis. Subsequently, several AMPs have been identified
and extensively studied in two main mussels species, M. galloprovincialis and M. edulis. These
molecules with antimicrobial properties have been classified into four groups following a primary
structure classification parameter: defensins, mytilins, myticins and mytimycin. Overall, mussels’
AMPs are characterized by possessing strong hydrophobic and cationic properties and a signature
amphipathic structure (α-helix, β-hairpin-like β-sheet, β-sheet or α-helix/β-sheet mixed structures), all
441
Mar. Drugs 2017, 15, 182
considered fundamental for the antimicrobial activity displayed. The principal defensin from mussels
is a 39-long peptide present in two isoforms MGD1 (PDB 1FJN) and MGD2 sharing significant sequence
homology. Furthermore, the three-dimensional structure (Figure 3 shows the 3D structure of several
mollusk-derived AMPs) has been solved using NMR analysis [228] and has shown the presence of a
side helical part (spanning from Asn7 to Ser16) and two anti-parallel β-strands (spanning fromArg20
to Cys25 and from Cys33-Arg37), which constitute the common cysteine-stabilized motif.
Figure 3. Examples of three-dimensional structures of bivalve AMPs. * The predicted structures
were designed using AIDA (ab initio domain assembly) server, a tool for the prediction of protein
tridimensional structures (http://ffas.burnham.org/AIDA).
A similar structural icon has been recently described in the attempt to unify all known classes of
Cys-stabilized antimicrobial peptides. Yount and Yeaman identified this common structural signature
and named the “γ-core motif” [229,230]. Conservation of the γ-core motif across all living organisms
suggests it may represent an antimicrobial peptide archetype; in fact, several structural topologies
resembling a γ-core motif can be described in a wide range of organisms, from unicellular organisms
to humans. The γ-core present in many AMPs is not the only structural determinant to confer
an antimicrobial activity, but in many instances, it can be used as a scaffold, to which further
antimicrobial determinants (e.g., α-helices or β-sheets) can be attached in a modular fashion to yield
various configurations. Higher organisms showed the most diversified range of γ-core polypeptides.
This is, though, expected considering the necessity to provide protection to diverse tissues and to
cooperate with other useful immune-system components. For example, several studies have been
recently conducted in the analysis of such determinant in human β-defensins (HBDs), and the
γ-core alone has been proven sufficient for retaining substantial antimicrobial activity [231–234].
Nevertheless, there is a significant difference with most of the know AMPs bearing the γ-core
signature; that is, the fact that mussels defensins are characterized from being stabilized by four
disulfide bonds (Cys4-Cys25, Cys10-Cys33, Cys14-Cys35 and Cys21-Cys38 in MGD-1), instead of the
three disulfide bonds generally described in most other molecules, including arthropod defensins.
MGD1 [224], a member of the arthropod defensin family from edible Mediterranean mussels
442
Mar. Drugs 2017, 15, 182
(M. galloprovincialis), and MGD2 [227] share the same size and sequence showing 80% identity with
amino acids. Both contain an ORF encoding 81 amino acids including a 21-residue N-terminal
sequence with a highly hydrophobic core representing a signal domain, followed by a 39-amino acid
sequence corresponding to the active defensin and a 21-residue C-terminal extension. MGDs are
principally active against Gram-positive bacteria, but MGD2 showed increased activity also against
Gram-negative bacteria. Structural features of MGD1, cardinal for the supply of antimicrobial activity,
were analyzed by Romestand et al., 2003 [235], by producing a set of synthetic peptides analogous to
the described secondary structures of the molecule. The nonapeptide from residue 25 to residue 33
(CGGWHRLRC) displayed a consistent bacteriostatic activity, especially when cyclized by a disulfide
bridge between Cys25 and Cys33.
The second group of mussels-derived AMPs is represented by the mytilins family, comprising five
isoforms (A, B, C, D and G1). Isoforms A and B were found in M. edulis plasma [236], while isoforms
B, C, D and G1 were isolated from M. galloprovincialis hemocytes [237]. Mytilin B (PDB 2EEM) is
produced from a precursor molecule, which contains an initial region (22-amino acid residues) signal
peptide region, a mature peptide 34 amino acids long, followed by a C-terminal domain of 48 residues
rich in acidic amino acids [236]. The assorted mytilin isoforms have been shown to possess distinctive
antimicrobial activities. In fact, mytilins A, B, C, and D showed a considerable activity against both
Gram-positive and Gram-negative bacteria while mytilin G1 was revealed to be functioning only
against Gram-positive bacteria. Mytilins B and D have also shown potency against the filamentous
fungus Fusarium oxysporum. Moreover, experiments for describing the kinetics of bactericidal effects
showed that, at high concentrations, several hours of incubation were needed for mytilins D and G1 to
kill all bacteria in contrast to the few minutes necessary in the presence of mytilin B. A potent antiviral
activity was also observed for mytilin B. Therefore, the different mytilin isoforms are endowed with
complementary properties, which altogether contribute to the defense mechanisms, increasing the
antimicrobial potential of mussels living in the context with a high diversity of pathogens.
A cysteine-rich peptide has also been isolated from mussels (M. galloprovincialis) and named
myticin [226]. The mature molecule is 40 residues long and shows four intra-molecular disulfide
bridges. Three different isoforms of myticin have been described (A, B and C) with the isoform C being
the most abundantly expressed transcript in adult mollusks. All isoforms are highly active against
Gram-positive bacteria and sometimes against Gram-negative bacteria, but myticin C is also a potent
antiviral compound [238,239]. Constitutively-expressed myticin C-peptides in naive mussels render
oysters resistant to ostreid herpesvirus 1 (OsHV-1) infections when oyster hemocytes are incubated
with mussel hemolymph. Moreover, myticin C molecules retain antiviral activity in vitro against
human herpes simplex viruses 1 (HSV-1) and 2 (HSV-2), showing a high potential for biotechnological
applications [240].
A strictly antifungal peptide named mytimycin (MytM) containing 12 cysteines with a molecular
weight of 6.2 KDa was derived [225] from the plasma of M. edulis. A novel cysteine-rich peptide
with noteworthy antibacterial activity was recently isolated from Mytilus coruscus and was named
myticusin-1 [241]. This is a 104-amino acid long polypeptide including 10 cysteine residues.
Antimicrobial studies showed that myticusin-1 presented a more pronounced anti-microbial activity
against Gram-positive bacteria compared to Gram-negative bacteria and fungus. From the same mussel
(M. coruscus), a novel antimicrobial peptide with 55 amino acid residues was also identified [242].
This new antimicrobial peptide is endowed by predominant activity against fungi and Gram-positive
bacteria and is characterized by possessing a chitin-biding domain and by six Cys residues forming
three intra-molecular disulfide bridges. The recent advent of genome sequencing technologies has
also allowed the identification of two previously uncharacterized mussel AMP families, big defensins
and macins. A recent analysis [243] brought to light the existence of eight novel big defensins
(MgBDs) and five novel macins (mytimacins) in the transcriptome of the Mediterranean mussel
M. galloprovincialis, therefore further extending the vast antimicrobial peptides range present in this
marine bivalve organism.
443
Mar. Drugs 2017, 15, 182
The Manila clam, V. philippinarum, is a meaningful marine bivalve for commercial purposes,
and an amino acid sequence has been identified (named VpBD) that shares common features with
other AMPs, such as an α-helical structure, a net positive charge and a high hydrophobic residue
ratio. The display and spacing of cysteine residues and their flanking amino acid residues indicated
that VpBD represents a member of the big defensin family. The structure of big defensins, generally,
comprises a highly hydrophobic region located at the N-terminal, one C-terminal cysteine-rich and
positively-charged region, as well as six cysteine residues arranged to form 1–5, 2–4, 3–6 disulfide
bonds in the mature peptide, in a similar pattern to mammalian β-defensins. The microbicidal
activities of VpBD (expressed in Escherichia coli) in vitro have been investigated and demonstrated a
strong antibacterial activity towards various bacterial species, namely Gram-negative (Pseudomonas
putida) and Gram-positive (Staphylococcus aureus) [244]. A further big defensin has been isolated from
the ark shell, Scapharca broughtonii [245] and clam myticin isoforms 1, 2 and 3, and clam mytilin,
(similar to myticins and mytilins from mussels) have been identified and characterized in Ruditapes
decussatus [246].
Extracts from acidified gills of the American oyster C. virginica [247] delivered the first defensin
molecules to be purified by oysters. The peptide (named Cv-Def ) was 38 amino acids long with
six cysteines, and the molecular mass was 4.2 KDa. The antimicrobial spectrum covered by Cv-Def
included both Gram-positive bacteria and Gram-negative bacteria [247]. Successively, three more
defensins were found and characterized from the mantle, denoted as Cg-Def, or hemocytes, designated
as Cg-defh1 (PDB 2B68) and Cg-defh2, of the Pacific oyster C. gigas [248,249], which shared the
cystine-stabilized alpha-beta motif (CS-αβ) [250]. Other AMPs are produced in C. gigas, such as Cg-Prp,
which belong to the family of proline-rich peptides and has been identified from hemocytes [251,252].
A 5.5-kDa antimicrobial peptide 55 amino acids long, and named cgMolluscidin, has been recently
purified from the acidified gill extract of C. gigas. This sequence has no homology with any known
AMPs and showed a strong antimicrobial effect against both Gram-positive bacteria (Bacillus subtilis,
Micrococcus luteus and S. aureus) and Gram-negative bacteria (E. coli, Salmonella enterica and Vibrio
parahaemolyticus). Finally, the last group of AMPs, described in the present review, has been identified
in scallops, mainly from A. irradians (AiBD) and A. purpuratus (Ap). The scallop AiBD consisted of
531 nucleotides and produced a peptide of 122 amino acids. Recombinant AiBD was able to block
the growth of both Gram-positive and Gram-negative bacteria and also presented a strong fungicidal
power [253]. AP was isolated from A. purpuratus hemocytes, consists of 47 residues and shares partial
homology with reported effective AMPs. A modified version of 30 residues designed to increase
hydrophobicity and cationicity was used in antimicrobial experiments and showed an excellent activity
against Saprolegnia sp., a parasitic pathogen fungus that attacks the culture of fish in different stages of
their life, from the egg stage to grown-up animal [254].
In order to summarize all those peptides in an intelligible overview, we generated a table with
their detailed characteristics (Table 4).
444
Name
Source
Sequence
Length
Net Charge
% Hydrophobic
Residues
Structure
Antimicrobial Activity
Reference
Defensin MGD-1
Mytilus galloprovincialis
GFGCPNNYQCHRHCKSIPGRCGGY
CGGWHRLPCTCYRCG
39
5
30
Combined helix and
β-sheet
Gram+
[224]
Mytilus galloprovincialis
GFGCPNNYACHQHCKSIRGYCGGY
CAGWFRLRCTCYRCG
38
* Combined helix and
β-sheet
Gram+ and Gram−
[227]
Mytilin A
Mytilus edulis
GCASRCKAKCAGRRCKGWASASFR
GRCYCKCFRC
34
10
47
* Combined helix and
β-sheet
Gram+ and Gram−
[225]
Mytilin B
Mytilus edulis
SCASRCKGHCRARRCGYYVSVLYRG
RCYCKCLRC
34
9
41
Combined helix and
β-sheet
Gram+ and Gram−,
antiviral
[225]
Mytilus galloprovincialis
HSHACTSYWCGKFCGTASCTHYLC
RVLHPGKMCACVHCSR
45
* Combined helix and
β-sheet
Gram+ and Gram−;
antifungal
[226]
Myticin B
Mytilus galloprovincialis
HPHVCTSYYCSKFCGTAGCTRYGCR
NLHRGKLCFCLHCSR
40
6
37
* Combined helix and
β-sheet
Gram+ and Gram−;
antifungal
[226]
Myticin C
Mytilus galloprovincialis
QSVACTSYYCSKFCGSAGCSLYGCY
LLHPGKICYCLHCSR
40
3
35
* Combined helix and
β-sheet
Gram+ and Gram−;
antifungal
[239]
Mytilus galloprovincialis
MSLVLRMTLLFVVCCVVIGMSNAA
CCHKPFWKHCWDCTAGTPYCGYRS
CNIFGCGCTCRTEPYGKSCYERGNR
CRCYTDKRKRRSLSFEDISPNIKFAGL
DINSDGLIEQFEFIKALEQMDIIDNTT
MFHHWSIMDEDKDGTITLEEFDK
150
−2
41
* Combined helix and
β-sheet
Antifungal
[225]
Mytilus galloprovincialis
MGYIGLCGVLLSLSLLMLLQIPTSDA
NVLGDCWEDWSRCTRQTNWFTNI
AWQSCPNRCKCQGHAGGNCIQVR
SNCFLWRNKRWMCNCYGRRSGPK
PGWCGF
101
7
43
* Combined helix and
β-sheet
Gram+ and Gram−
[243]
Big-Defensin
Mytilus galloprovincialis
MNRKAILCVLYATLLIIPAPILGRVV
AKKKEEKRYAAVYPIAAYAGMTVS
LPVFLALVAAYGAWTVARYHIRSRS
RSSSHNSHNCANNRGWCRPNCFRR
EYHDWYHSDTCGSYKCCRYR
119
14
42
* Combined helix and
β-sheet
Gram+ and Gram−
[243]
Myticusin-1
Mytilus coruscus
TDHQMAQSACIGVSQDNAYASAIP
RDCHGGKTCEGICADATATMDRYS
DTGGPLSIARCVNAFHFYKRRGEEN
VSYKPFVVSWKYGVAGCFYTHCGP
NFCCCIS
104
0
39
* Combined helix and
β-sheet
Gram+ and Gram−,
antifungal
[241]
Defensin MGD-2
Myticin A
445
Mytimycin
Mytimacin
39
40
5
4
Mar. Drugs 2017, 15, 182
Table 4. AMPs isolated from marine bivalves and main characteristics.
Name
Source
Sequence
Length
Net Charge
% Hydrophobic
Residues
Structure
Antimicrobial Activity
Reference
VpBD
Venerupis philippinarum
LCLDQKPEMEPFRKDAQQALEPSRQ
RRWLHRRCLSGRGFCRAICSIFEEPV
RGNIDCYFGYNCCRRMFSHYRTS
74
5
36
* Helix
Gram+ and Gram−
[244]
MCdef
Ruditapes philippinarum
GFGCPNDYSCSNHCRDSIGCRGGYC
KYQLICTCYGCKKRRSIQE
44
4
29
* Combined helix and
β-sheet
Gram+ and Gram−
[133]
Venerupis philippinarum
GFGCPEDEYECHNHCKNSVGCRGG
YCDAGTLRQRCTCYGCNQKGRSIQE
49
0
26
* Combined helix and
β-sheet
Gram+ and Gram−
[162]
Sb-BDef1
Scapharca broughtonii
MTHKIVLCCIYLLLSTSFILSKHLPEE
RKQKKQVLLAAGAGVALSELLGPV
LVGAGTLAGAALLNQAVSSNRWVI
PCANNRGWCRTDCHFGEHIDDYHS
DICHSGYKCCRY
111
3
45
* Combined helix and
β-sheet
Gram−
[245]
Ap
Argopecten purpuratus
TYMPVEEGEYIVNISYADQPKKNSPF
TAKKQPGPKVDLSGVKAYGPG
47
1
25
* Polyproline rich β-sheet
Gram+, antifungal
[254]
AiBD
Argopecten irradians
MTRPSLVRCYSLFFTALIVMAIICPA
WSEEIPKSRKKRAIPIAYVGMAVAP
QVFRWLVRAYGAAAVTAAGVTLRR
VINRSRSNDNHSCYGNRGWCRSSCR
SYEREYRGGNLGVCGSYKCCVT
122
14
44
* Combined helix and
β-sheet
Gram+ and Gram−,
antifungal
[253]
AOD
Crassostrea virginica
GFGCPWNRYQCHSHCRSIGRLGGY
CAGSLRLTCTCYRS
38
5
34
* Combined helix and
β-sheet
Gram+ and Gram−
[247]
[248]
VpDef
446
Cg-Prp
Crassostrea gigas
ILENLLARSTNEDREGSIFDTGPIRRP
KPRPRPRPEG
37
2
21
* Proline-rich peptide
Synergistic
antimicrobial activity
with Cg-Def
cgMolluscidin
Crassostrea gigas
AATAKKGAKKADAPAKPKKATKP
KSPKKAAKKAGAKKGVKRAGKKG
AKKTTKAKK
55
23
29
* Helix
Gram+ and Gram−
[247]
Cg-Defh1
Crassostrea gigas
GFGCPRDQYKCNSHCQSIGCRAGY
CDAVTLWLRCTCTDCNGKK
43
3
37
Combined helix and
β-sheet
Gram+ and Gram−
[249]
Cg-Defh2
Crassostrea gigas
GFGCPGDQYECNRHCRSIGCRAGY
CDAVTLWLRCTCTGCSGKK
43
3
37
* Combined helix and
β-sheet
Gram+ and Gram−
[229]
* The predicted structures were designed using AIDA (http://ffas.burnham.org/AIDA).
Mar. Drugs 2017, 15, 182
Table 4. Cont.
Mar. Drugs 2017, 15, 182
6. Applications of AMPs in Medicine and in Preventing Diseases of Aquatic Animals
In the present review, we first outlined the infectious diseases of marine bivalve and their defense
mechanisms including the classification and mode of action of AMPs. In the remaining and concluding
part of the review, we will focus on the potential utilization of AMPs as substitutes for antibiotics in
aquaculture and in the medical field.
The economic development of several countries relies on the aquaculture of mollusks since
a considerable amount of shellfish (mainly mollusks) for human consumption is produced by
aquaculture. Clam, scallop, oyster and mussel farming represents a noticeable share of the aquaculture
market worldwide, accounting for more than 50% of the shellfish present on the global market.
The increasing demand for seafood, including bivalves, will surely extend in the forthcoming years,
and higher capability productions will need to be accomplished to meet this demand. The major
obstacle to the thriving of the aquaculture industry is posed by the emergence and spread of many
infectious diseases, which are exacerbated by the densely-populated culture conditions in limited space.
Future research needs to include the development of novel methods to control diseases in hatcheries
in order to minimize the occurrences of mass mortalities caused by either obligate or opportunistic
pathogens. Research efforts are mandatory to explore inexpensive and effective treatments when
diseases occur in a hatchery situation to avoid production losses. Moreover, safer compounds are
highly desired considering the environmental risks and that bivalve production is mainly devoted to
human consumption. The possibilities to contain the spread of diseases in mollusks is not facilitated
by the fact that there is limited information to fully understand the physiology of marine bivalves,
in particular concerning their immune defense system. A detailed description of the immune defense
mechanisms of mollusks has been provided in the first part of the review with the intent to foster
the characterization of immune effectors to provide new understanding into healthiness and disease
management in mollusk aquaculture. Since the introduction of antibiotics for the treatment of infectious
diseases, they have been widely used in medicine and animal breeding, as well as in aquaculture
with successful regimens. However, due to the overuse and misuse of antibiotics, the resistance of
bacteria to antibiotics has dramatically increased, posing new challenges to human health and to
the sustainability of the aquaculture industry. Moreover, the worldwide threat of a rapid increase in
pathogenic multidrug-resistant (MDR) bacteria is paralleled by the environmental risks with antibiotic
compounds being distributed throughout the environment. The quest for novel compounds with
antibacterial activity that could overcome resistance emergence events is, therefore, an urgent societal
challenge. Nature-derived AMPs are regarded as convenient templates for the development of
substitutes to traditional antibiotic [255], and bivalve AMPs have been shown to be structurally
different from their analogue peptides derived from the terrestrial habitat and usually present novel
and unexploited structures [223,256]. AMPs’ antimicrobial activity relies on the early electrostatic
interactions with the negatively-charged surface of the bacteria, therefore, free ions produced by the
high salt concentrations in the surrounding medium, typical of some illnesses, could efficiently decrease
interaction and antimicrobial activity. In general, marine AMPs have evolved to easily adapt to the
high salt concentration of seawater, and probably, this has been obtained by the substitution of lysines
with arginines. Therefore, marine bivalves are a hopeful reservoir of novel bioactive molecules for the
development of alternative antimicrobials. In fact, AMPs can be regarded as encouraging candidates
for selecting new and more environmentally-friendly antimicrobials. Notwithstanding the abundance
of scientific knowledge on their activities in vitro, major challenges need to be outflanked to allow for
their clinical application. The major obstacles to be considered are: (1) rapid degradation by proteases;
(2) uncertainty of the antimicrobial activities under physiological salt, pH and serum conditions;
(3) poor oral availability; (4) laborious routes of administration; (5) burdensome transportation across
cell membranes; (6) non-selective receptor binding; and (7) costs associated with their production [223].
Excessive amounts of common antibiotics are used in aquaculture in some countries for both
therapeutic and prophylactic purposes [257–259]. Moreover, veterinary antimicrobials also include
compounds used clinically in human medicine [260]. Current knowledge regarding the genetic aspects
447
Mar. Drugs 2017, 15, 182
of antimicrobial resistance in aquatic bacteria is highly suggestive of the possibility that antibiotics used
in fish farming are likely to select antimicrobial-resistant bacteria in aquacultural environments and of
their subsequent diffusion to terrestrial counterpart [261–263]. Therefore, in order to safeguard public
health, it is of paramount importance to adopt novel methodologies used in aquaculture. The use of
AMPs is one of the main strategies currently under deep investigation. It is, though, imperative to
devote future efforts to design improved antimicrobial molecules with a broad spectrum of activity
against a wide array of pathogenic microorganisms through the modification of native AMPs in order
to achieve more selective and efficient drugs that could substitute conventional antibiotics both in
aquaculture and in clinical human medicine.
One of the most awaited goals is the use of rational design to produce AMPs with improved
characteristics, such as: (1) stronger antibacterial activity, (2) lower cytotoxicity and (3) ease of
production on an industrial scale for obtaining a marketable drug. Native AMPs can be used as
templates for the design of new antibacterial agents through peptidomimetics, where only structural
key elements of the native peptide are conserved to provide a scaffold able to preserve the AMP
characteristic of easy interaction with the biological target and produce an enhanced antimicrobial
biological response [264]. Domains responsible for activity are, therefore, analyzed in detail and
modified to obtain functionally-improved AMPs. Several authors have described the modification of
primary AMP sequences to enhance their effectiveness and stability in order to obtain promising lead
compounds for the development of therapeutic agents [265]. Attempt to increase AMP activities have
generally involved the methodical change of amino acid residues or alternative chemical alterations,
which permit the achievement of improved activities, such as: chemical modification of terminal
ends of peptides [266], development of analogues containing unnatural amino acids [267], β-peptides,
shortening of the native sequence, modifications of their amphipathic character, cyclization [234],
hybrid peptide-peptidomimetic structures, lipidation, etc. [268]. One of the reasons for the high interest
in AMPs derived from marine peptides is their ability to sustain physiological salt concentration
and protease activity. In fact, a foremost role for the improvement of AMPs therapeutic impact
is represented by the suitable harmonization of their hydrophobicity, amphipathicity and positive
charge [269,270]. Peptides with sufficient positive charge can be modified to decrease interactions with
mammalian cells, while favoring the preferential binding to bacterial cell membranes by reducing
the overall hydrophobicity of the molecule [271,272]. Exploiting the variety of post-translational
modifications displayed by marine AMPs could be instrumental in the design of AMPs with enhanced
stability and efficacy, for therapeutic utilization in human medicine [273]. For example, the high salinity
(up to 600 mM) of the marine habitat may have forged marine AMPs to be naturally endowed with a
sharpened salt resistance, allowing them to conserve strong antibacterial effectiveness in relatively
high-salt environments, such as in saliva, gastrointestinal fluid, serum or other body fluids [231,232].
Understanding the chemical propriety backing this salt independent activity could subside in the
construction of novel AMPs that could be better endowed for facing pathogens notwithstanding the
wide range of salt concentrations that could be encountered. For example, human beta defensin-1
(hBD-1) being unable to inhibit P. aeruginosa due to a 120 mM concentration of NaCl in the lungs of
cystic fibrosis patients [274] has been engineered by constructing a chimera with β-defensin-3 (hBD-3),
which shows antibacterial activity also at high salt concentrations [231,232]. The C-terminal domain
of hBD-3 presents an abundance of arginine residues considered to be involved in the activity at
high ionic conditions. Therefore, marine AMPs, dictating many of the universal rules featuring the
ability of an AMP to inhibit microorganisms under physiological salt concentrations (120–150 mM),
are of paramount importance for indicating novel strategies for the improvement of native AMP
sequences [275].
7. Conclusions
Bivalve farming has recently reached a large portion of the fish market worldwide;
therefore, from both a human health perspective and for reducing economic losses, huge efforts
448
Mar. Drugs 2017, 15, 182
are devoted to the improvement of the microbiological quality of the product. We are awaiting a
comprehensive understanding and knowledge of all of the infectious diseases that could affect bivalve
mollusks, and insights on their defense mechanisms are only recently being deeply investigated.
Several studies on bivalve immunity have expanded our understanding of the morpho-functional
properties of circulating hemocytes and the humoral defense factors, but most of the patterns for
microbe recognition and downhill immune pathways activation are still to be explored. At the same
time, in the last decade, a large amount of data on mollusk-derived AMPs has been gathered, to allow
the beginning of the initial studies to attempt to modify these lead compounds in search of a wider
applicability of their antimicrobial properties in both aquaculture and human medicine.
Acknowledgments: We thank Albert Bonaminio (M. Sci.) for linguistic editing. This work was supported by:
Regional funds “Pepmar”.
Author Contributions: All Authors contributed equally.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Santos, A.; Hauser-Davis, R.A.; Santos, M.J.; De Simone, S.G. Potentially toxic filamentous fungi associated
to the economically important Nodipecten nodosus (Linnaeus, 1758) scallop farmed in southeastern Rio De
janeiro, Brazil. Mar. Pollut. Bull. 2016, 115, 75–79. [CrossRef] [PubMed]
Carver, C.E.; Thériault, I.; Mallet, A.L. Infection of cultured eastern oysters Crassostrea virginica by the boring
sponge Cliona celata, with emphasis on sponge life history and mitigation strategies. J. Shellfish Res. 2010, 29,
905–915. [CrossRef]
Gagne, N.; Cochennec, N.; Stephenson, M.; McGladdery, S.; Meyer, G.R.; Bower, S.M. First report of a
Mikrocytos-like parasite in European oysters Ostrea edulis from Canada after transport and quarantine in
France. Dis. Aquat. Organ. 2008, 80, 27–35. [CrossRef] [PubMed]
Guo, X.; Ford, S.E. Infectious diseases of marine molluscs and host responses as revealed by genomic tools.
Philos. Trans. R. Soc. Lond. B Biol. Sci. 2016, 371. [CrossRef] [PubMed]
Sirisinha, S. Evolutionary insights into the origin of innate and adaptive immune systems: Different shades
of grey. Asian Pac. J. Allergy Immunol. 2014, 32, 3–15. [PubMed]
Ramilo, A.; Gonzalez, M.; Carballal, M.J.; Darriba, S.; Abollo, E.; Villalba, A. Oyster parasites Bonamia Ostreae
and B. exitiosa co-occur in Galicia (NW Spain): Spatial distribution and infection dynamics. Dis. Aquat. Organ.
2014, 110, 123–133. [CrossRef] [PubMed]
Suffredini, E.; Lanni, L.; Arcangeli, G.; Pepe, T.; Mazzette, R.; Ciccaglioni, G.; Croci, L. Qualitative and
quantitative assessment of viral contamination in bivalve molluscs harvested in Italy. Int. J. Food Microbiol.
2014, 184, 21–26. [CrossRef] [PubMed]
Arzul, I.; Langlade, A.; Chollet, B.; Robert, M.; Ferrand, S.; Omnes, E.; Lerond, S.; Couraleau, Y.; Joly, J.P.;
Francois, C.; et al. Can the protozoan parasite Bonamia ostreae infect larvae of flat oysters Ostrea edulis?
Vet. Parasitol. 2011, 179, 69–76. [CrossRef] [PubMed]
Batista, F.M.; Arzul, I.; Pepin, J.F.; Ruano, F.; Friedman, C.S.; Boudry, P.; Renault, T. Detection of ostreid
herpesvirus 1 DNA by PCR in bivalve molluscs: A critical review. J. Virol. Methods 2007, 139, 1–11. [CrossRef]
[PubMed]
Bai, C.; Gao, W.; Wang, C.; Yu, T.; Zhang, T.; Qiu, Z.; Wang, Q.; Huang, J. Identification and characterization
of ostreid herpesvirus 1 associated with massive mortalities of Scapharca broughtonii broodstocks in China.
Dis. Aquat. Organ. 2016, 118, 65–75. [CrossRef] [PubMed]
Farley, C.A.; Banfield, W.G.; Kasnic, G., Jr.; Foster, W.S. Oyster herpes-type virus. Science 1972, 178, 759–760.
[CrossRef] [PubMed]
Segarra, A.; Pepin, J.F.; Arzul, I.; Morga, B.; Faury, N.; Renault, T. Detection and description of a particular
Ostreid herpesvirus 1 genotype associated with massive mortality outbreaks of Pacific oysters, Crassostrea gigas,
in France in 2008. Virus Res. 2010, 153, 92–99. [CrossRef] [PubMed]
Lynch, S.A.; Carlsson, J.; Reilly, A.O.; Cotter, E.; Culloty, S.C. A previously undescribed Ostreid Herpes
Virus 1 (OsHV-1) genotype detected in the Pacific oyster, Crassostrea gigas, in Ireland. Parasitology 2012, 139,
1526–1532. [CrossRef] [PubMed]
449
Mar. Drugs 2017, 15, 182
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
Bai, C.; Wang, C.; Xia, J.; Sun, H.; Zhang, S.; Huang, J. Emerging and endemic types of Ostreid herpesvirus 1
were detected in bivalves in China. J. Invertebr. Pathol. 2015, 124, 98–106. [CrossRef] [PubMed]
Hwang, J.Y.; Park, J.J.; Yu, H.J.; Hur, Y.B.; Arzul, I.; Couraleau, Y.; Park, M.A. Ostreid herpesvirus 1 infection
in farmed Pacific oyster larvae Crassostrea gigas (Thunberg) in Korea. J. Fish Dis. 2013, 36, 969–972. [PubMed]
Mortensen, S.; Strand, A.; Bodvin, T.; Alfjorden, A.; Skar, C.K.; Jelmert, A.; Aspan, A.; Saelemyr, L.;
Naustvoll, L.J.; Albretsen, J. Summer mortalities and detection of ostreid herpesvirus microvariant in
Pacific oyster Crassostrea gigas in Sweden and Norway. Dis. Aquat. Organ. 2016, 117, 171–176. [CrossRef]
[PubMed]
Pernet, F.; Barret, J.; le Gall, P.; Corporeau, C.; Dégremont, L.; Lagarde, F.; Pépin, J.F.; Keck, N. Mass mortalities
of Pacific oysters Crassostrea gigas reflect infectious diseases and vary with farming practices in the
Mediterranean Thau Iagoon, France. Aquacult. Environ. Interact. 2012, 2, 215–237. [CrossRef]
Da Silva, P.M.; Renault, T.; Fuentes, J.; Villalba, A. Herpesvirus infection in European flat oysters
Ostrea edulis obtained from brood stocks of various geographic origins and grown in Galicia (NW Spain).
Dis. Aquat. Organ. 2008, 78, 181–188. [CrossRef] [PubMed]
Leibovitz, L.; Elston, R.; Lipovsky, V.P.; Donaldson, J. A new disease of larval Pacific oysters (Crassostrea gigas).
J. World Aquacult. Soc. 1978, 9, 603–615. [CrossRef]
Kueh, C.S.; Chan, K.Y. Bacteria in bivalve shellfish with special reference to the oyster. J. Appl. Bacteriol. 1985,
59, 41–47. [CrossRef] [PubMed]
Bidault, A.; Richard, G.G.; le Bris, C.; Paillard, C. Development of a Taqman real-time PCR assay for rapid
detection and quantification of Vibrio tapetis in extrapallial fluids of clams. PeerJ 2015, 3, e1484. [CrossRef]
[PubMed]
Garnier, M.; Labreuche, Y.; Nicolas, J.L. Molecular and phenotypic characterization of Vibrio aestuarianus
subsp. francensis subsp. nov., a pathogen of the oyster Crassostrea gigas. Syst. Appl. Microbiol. 2008, 31,
358–365. [PubMed]
Prado, S.; Dubert, J.; da Costa, F.; Martinez-Patino, D.; Barja, J.L. Vibrios in hatchery cultures of the razor
clam, Solen marginatus (Pulteney). J. Fish Dis. 2014, 37, 209–217. [CrossRef] [PubMed]
Biel, F.M.; Allen, F.A.; Hase, C.C. Autolysis in Vibrio tubiashii and Vibrio coralliilyticus. Can. J. Microbiol. 2014,
60, 57–63. [CrossRef] [PubMed]
Kwan, T.N.; Bolch, C.J. Genetic diversity of culturable Vibrio in an Australian blue mussel
Mytilus galloprovincialis hatchery. Dis. Aquat. Organ. 2015, 116, 37–46. [CrossRef] [PubMed]
Sugumar, G.; Nakai, T.; Hirata, Y.; Matsubara, D.; Muroga, K. Vibrio splendidus biovar II as the causative
agent of bacillary necrosis of Japanese oyster Crassostrea gigas larvae. Dis. Aquat. Organ. 1998, 33, 111–118.
[CrossRef] [PubMed]
Valerio, E.; Chaves, S.; Tenreiro, R. Diversity and impact of prokaryotic toxins on aquatic environments:
A review. Toxins (Basel) 2010, 2, 2359–2410. [CrossRef] [PubMed]
Gomez-Leon, J.; Villamill, L.; Salger, S.A.; Sallum, R.H.; Remacha-Trivino, A.; Leavitt, D.F.; Gomez-Chiarri, M.
Survival of eastern oysters Crassostrea virginica from three lines following experimental challenge with
bacterial pathogens. Dis. Aquat. Organ. 2008, 79, 95–105. [CrossRef] [PubMed]
Balboa, S.; Romalde, J.L. Multilocus sequence analysis of Vibrio tapetis, the causative agent of Brown Ring
Disease: Description of Vibrio tapetis subsp. britannicus subsp. Nov. Syst. Appl. Microbiol. 2013, 36, 183–187.
[CrossRef] [PubMed]
Paillard, C.; Korsnes, K.; Le Chevalier, P.; Le Boulay, C.; Harkestad, L.; Eriksen, A.G.; Willassen, E.; Bergh, O.;
Bovo, C.; Skar, C.; et al. Vibrio tapetis-like strain isolated from introduced Manila clams Ruditapes philippinarum
showing symptoms of brown ring disease in Norway. Dis. Aquat. Organ. 2008, 81, 153–161. [CrossRef]
[PubMed]
Paillard, C. A short-review of brown ring disease, a vibriosis affecting clams, Ruditapes philippinarum and
Ruditapes decussatus. Aquat. Living Resour. 2004, 17, 467–475. [CrossRef]
Park, K.I.; Yang, H.S.; Kang, H.S.; Cho, M.; Park, K.J.; Choi, K.S. Isolation and identification of Perkinsus
olseni from feces and marine sediment using immunological and molecular techniques. J. Invertebr. Pathol.
2010, 105, 261–269. [CrossRef] [PubMed]
Ramilo, A.; Iglesias, D.; Abollo, E.; Gonzalez, M.; Darriba, S.; Villalba, A. Infection of Manila clams Ruditapes
philippinarum from Galicia (NW Spain) with a Mikrocytos-like parasite. Dis. Aquat. Organ. 2014, 110, 71–79.
[CrossRef] [PubMed]
450
Mar. Drugs 2017, 15, 182
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
Allam, B.; Paillard, C.; Ford, S.E. Pathogenicity of Vibrio tapetis, the etiological agent of brown ring disease in
clams. Dis. Aquat. Organ. 2002, 48, 221–231. [CrossRef] [PubMed]
Boettcher, K.J.; Barber, B.J.; Singer, J.T. Additional evidence that juvenile oyster disease is caused by a
member of the Roseobacter group and colonization of nonaffected animals by Stappia stellulata-like strains.
Appl. Environ. Microbiol. 2000, 66, 3924–3930. [CrossRef] [PubMed]
Kessner, L.; Spinard, E.; Gomez-Chiarri, M.; Rowley, D.C.; Nelson, D.R. Draft genome sequence of
Aliiroseovarius crassostreae CV919–312, the causative agent of Roseovarius oyster disease (formerly juvenile
oyster disease). Genome Announc. 2016, 4. [CrossRef] [PubMed]
Ford, S.E.; Borrero, F.J. Epizootiology and pathology of juvenile oyster disease in the Eastern oyster,
Crassostrea virginica. J. Invertebr. Pathol. 2001, 78, 141–154. [CrossRef] [PubMed]
Ford, S.E. Roseovarius Oyster Disease (ROD) Caused by Roseovarius crassostreae; ICES Identification Leaflets for
Diseases and Parasites of Fish and Shellfish; ICES: Copenhagen, Denmark, 2011.
Friedman, C.S.; Cloney, D.F.; Manzer, D.; Hedrick, R.P. Haplosporidiosis of the Pacific oyster, Crassostrea gigas.
J. Invertebr. Pathol. 1991, 58, 367–372. [CrossRef]
Carella, F.; Carrasco, N.; Andree, K.B.; Lacuesta, B.; Furones, D.; De Vico, G. Nocardiosis in Mediterranean
bivalves: First detection of Nocardia crassostreae in a new host Mytilus galloprovincialis and in Ostrea edulis
from the Gulf of Naples (Italy). J. Invertebr. Pathol. 2013, 114, 324–328. [CrossRef] [PubMed]
Friedman, C.S.; Beattie, J.H.; Elston, R.A.; Hedrick, R.P. Investigation of the relationship between the presence
of a Gram-positive bacterial infection and summer mortality of the Pacific oyster, Crassostrea gigas Thunberg.
Aquaculture 1991, 94, 1–15. [CrossRef]
Queiroga, F.R.; Marques-Santos, L.F.; De Medeiros, I.A.; Da Silva, P.M. Effects of salinity and temperature
on in vitro cell cycle and proliferation of Perkinsus marinus from Brazil. Parasitology 2016, 143, 475–487.
[CrossRef] [PubMed]
Fernandez Robledo, J.A.; Vasta, G.R.; Record, N.R. Protozoan parasites of bivalve molluscs: Literature follows
culture. PLoS ONE 2014, 9, e100872. [CrossRef] [PubMed]
Carnegie, R.B.; Meyer, G.R.; Blackbourn, J.; Cochennec-Laureau, N.; Berthe, F.C.; Bower, S.M.
Molecular detection of the oyster parasite Mikrocytos mackini, and a preliminary phylogenetic analysis.
Dis. Aquat. Organ. 2003, 54, 219–227. [CrossRef] [PubMed]
Feng, C.; Lin, X.; Wang, F.; Zhang, Y.; Lv, J.; Wang, C.; Deng, J.; Mei, L.; Wu, S.; Li, H. Detection and
characterization of Bonamia ostreae in Ostrea edulis imported to China. Dis. Aquat. Organ. 2013, 106, 85–91.
[CrossRef] [PubMed]
Lane, H.S.; Webb, S.C.; Duncan, J. Bonamia ostreae in the New Zealand oyster Ostrea chilensis: A new host and
geographic record for this haplosporidian parasite. Dis. Aquat. Organ. 2016, 118, 55–63. [CrossRef] [PubMed]
Hine, P.M.; Cochennec-Laureau, N.; Berthe, F.C. Bonamia exitiosus n. sp. (Haplosporidia) infecting flat oysters
Ostrea chilensis in New Zealand. Dis. Aquat. Organ. 2001, 47, 63–72. [CrossRef] [PubMed]
Corbeil, S.; Arzul, I.; Robert, M.; Berthe, F.C.; Besnard-Cochennec, N.; Crane, M.S. Molecular characterisation
of an Australian isolate of Bonamia exitiosa. Dis. Aquat. Organ. 2006, 71, 81–85. [CrossRef] [PubMed]
Dungan, C.F.; Carnegie, R.B.; Hill, K.M.; McCollough, C.B.; Laramore, S.E.; Kelly, C.J.; Stokes, N.A.; Scarpa, J.
Diseases of oysters Crassostrea ariakensis and C. virginica reared in ambient waters from the Choptank River,
Maryland and the Indian River Lagoon, Florida. Dis. Aquat. Organ. 2012, 101, 173–183. [CrossRef] [PubMed]
Hill, K.M.; Stokes, N.A.; Webb, S.C.; Hine, P.M.; Kroeck, M.A.; Moore, J.D.; Morley, M.S.; Reece, K.S.;
Burreson, E.M.; Carnegie, R.B. Phylogenetics of Bonamia parasites based on small subunit and internal
transcribed spacer region ribosomal DNA sequence data. Dis. Aquat. Organ. 2014, 110, 33–54. [CrossRef]
[PubMed]
Narcisi, V.; Arzul, I.; Cargini, D.; Mosca, F.; Calzetta, A.; Traversa, D.; Robert, M.; Joly, J.P.; Chollet, B.;
Renault, T.; et al. Detection of Bonamia ostreae and B. exitiosa (Haplosporidia) in Ostrea edulis from the Adriatic
Sea (Italy). Dis. Aquat. Organ. 2010, 89, 79–85. [CrossRef] [PubMed]
Hill, K.M.; Carnegie, R.B.; Aloui-Bejaoui, N.; Gharsalli, R.E.; White, D.M.; Stokes, N.A.; Burreson, E.M.
Observation of a Bonamia sp. infecting the oyster Ostrea stentina in Tunisia, and a consideration of its
phylogenetic affinities. J. Invertebr. Pathol. 2010, 103, 179–185. [CrossRef] [PubMed]
Carrasco, N.; Villalba, A.; Andree, K.B.; Engelsma, M.Y.; Lacuesta, B.; Ramilo, A.; Gairin, I.; Furones, M.D.
Bonamia exitiosa (Haplosporidia) observed infecting the European flat oyster Ostrea edulis cultured on the
Spanish Mediterranean coast. J. Invertebr. Pathol. 2012, 110, 307–313. [CrossRef] [PubMed]
451
Mar. Drugs 2017, 15, 182
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
Longshaw, M.; Stone, D.M.; Wood, G.; Green, M.J.; White, P. Detection of Bonamia exitiosa (Haplosporidia) in
European flat oysters Ostrea edulis cultivated in mainland Britain. Dis. Aquat. Organ. 2013, 106, 173–179.
[CrossRef] [PubMed]
Batista, F.M.; Lopez-Sanmartin, M.; Grade, A.; Navas, J.I.; Ruano, F. Detection of Bonamia exitiosa in the
European flat oyster Ostrea edulis in Southern Portugal. J. Fish Dis. 2016, 39, 607–611. [CrossRef] [PubMed]
Carnegie, R.B.; Burreson, E.M.; Hine, P.M.; Stokes, N.A.; Audemard, C.; Bishop, M.J.; Peterson, C.H. Bonamia
perspora n. sp. (Haplosporidia), a parasite of the oyster Ostreola equestris, is the first Bonamia species known
to produce spores. J. Eukaryot. Microbiol. 2006, 53, 232–245. [CrossRef] [PubMed]
Lynch, S.A.; Armitage, D.V.; Coughlan, J.; Mulcahy, M.F.; Culloty, S.C. Investigating the possible role
of benthic macroinvertebrates and zooplankton in the life cycle of the haplosporidian Bonamia ostreae.
Exp. Parasitol. 2007, 115, 359–368. [CrossRef] [PubMed]
Cochennec-Laureau, N.; Auffret, M.; Renault, T.; Langlade, A. Changes in circulating and tissue-infiltrating
hemocyte parameters of European flat oysters, Ostrea edulis, naturally infected with Bonamia ostreae.
J. Invertebr. Pathol. 2003, 83, 23–30. [CrossRef]
Kleeman, S.N.; Adlard, R.D. Molecular detection of Marteilia sydneyi, pathogen of Sydney rock oysters.
Dis. Aquat. Organ. 2000, 40, 137–146. [CrossRef] [PubMed]
Schneider, O.; Sereti, V.; Machiels, M.A.; Eding, E.H.; Verreth, J.A. The potential of producing heterotrophic
bacteria biomass on aquaculture waste. Water Res. 2006, 40, 2684–2694. [CrossRef] [PubMed]
Gombac, M.; Kusar, D.; Ocepek, M.; Pogacnik, M.; Arzul, I.; Couraleau, Y.; Jencic, V. Marteiliosis in mussels:
A rare disease? J. Fish Dis. 2014, 37, 805–814. [CrossRef] [PubMed]
Carella, F.; Aceto, S.; Marrone, R.; Maiolino, P.; De Vico, G. Marteilia refringens infection in cultured and
natural beds of mussels (Mytilus galloprovincialis) along the Campanian coast (Tirrenian sea, South of Italy).
Bull. Eur. Ass. Fish Pathol. 2010, 30, 189–196.
Tiscar, P.G.; Chagot, D.; Tempesta, M.; Marsilio, F.; Buonavoglia, D. Presenza di Marteilia sp. in mitili
(Mytilus galloprovincialis, Lmk) allevati in Puglia. Boll. Soc. Ital. Patol. Ittica 1993, 12, 40–45.
Roubal, F.R.; Masel, J.; Lester, R.J.G. Studies on Marteilia sydneyi, agent of QX disease in the Sydney rock
oyster, Saccostrea commercialis, with implications for its life cycle. Aust. J. Mar. Freshw. Res. 1989, 40, 155–167.
[CrossRef]
Rubio, A.; Frances, J.; Coad, P.; Stubbs, J.; Guise, K. The onset and termination of the Qx disease window of
infection in Sydney rock oyster (Saccostrea glomerata) cultivated in the Hawkesbury River, NSW, Australia.
J. Shellfish Res. 2013, 32, 483–496. [CrossRef]
Peruzzi, L.; Gianoglio, B.; Porcellini, G.; Conti, G.; Amore, A.; Coppo, R. Neonatal chronic kidney failure
associated with cyclo-oxygenase-2 inhibitors administered during pregnancy. Minerva Urol. Nefrol. 2001, 53,
113–116. [PubMed]
Audemard, C.; Barnaud, A.; Collins, C.M.; Le Roux, F.; Sauriau, P.; Coustau, C.; Blachier, P.; Berthe, F.C.
Claire ponds as an experimental model for Marteilia refringens life-cycle studies: New perspectives. J. Exp.
Mar. Biol. Ecol. 2001, 257, 87–108. [CrossRef]
Ford, S.E. Dermo Disease of Oysters Caused by Perkinsus marinus; Ford, S.E., Ed.; ICES Identification Leaflets
for Diseases and Parasites of Fish and Shellfish; ICES: Copenhagen, Denmark, 2011.
Mackin, J.G.; Owen, H.M.; Collier, A. Preliminary note on the occurrence of a new protistan parasite,
Dermocystidium marinum n. sp. in Crassostrea virginica (Gmelin). Science 1950, 111, 328–329. [CrossRef]
[PubMed]
Remacha-Trivino, A.; Borsay-Horowitz, D.; Dungan, C.; Gual-Arnau, X.; Gomez-Leon, J.; Villamil, L.;
Gomez-Chiarri, M. Numerical quantification of Perkinsus marinus in the American oyster Crassostrea virginica
(Gmelin, 1791) (Mollusca: Bivalvia) by modern stereology. J. Parasitol. 2008, 94, 125–136. [CrossRef]
[PubMed]
Caceres-Martinez, J.; Madero-Lopez, L.H.; Padilla-Lardizabal, G.; Vasquez-Yeomans, R. Epizootiology of
Perkinsus marinus, parasite of the pleasure oyster Crassostrea corteziensis, in the Pacific coast of Mexico.
J. Invertebr. Pathol. 2016, 139, 12–18. [CrossRef] [PubMed]
Enriquez-Espinoza, T.L.; Grijalva-Chon, J.M.; Castro-Longoria, R.; Ramos-Paredes, J. Perkinsus marinus in
Crassostrea gigas in the Gulf of California. Dis. Aquat. Organ. 2010, 89, 269–273. [CrossRef] [PubMed]
Queiroga, F.R.; Vianna, R.T.; Vieira, C.B.; Farias, N.D.; Da Silva, P.M. Parasites infecting the cultured oyster
Crassostrea gasar (Adanson, 1757) in Northeast Brazil. Parasitology 2015, 142, 756–766. [CrossRef] [PubMed]
452
Mar. Drugs 2017, 15, 182
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
92.
93.
94.
Pagenkopp Lohan, K.M.; Hill-Spanik, K.M.; Torchin, M.E.; Aguirre-Macedo, L.; Fleischer, R.C.; Ruiz, G.M.
Richness and distribution of tropical oyster parasites in two oceans. Parasitology 2016, 143, 1119–1132.
[CrossRef] [PubMed]
Paynter, K.T.; Politano, V.; Lane, H.A.; Allen, S.M.; Meritt, D. Growth rates and prevalence of Perkinsus marinus
in restored oyster populations in Maryland. J. Shellfish Res. 2010, 29, 309–317. [CrossRef]
Smolowitz, R. A review of current state of knowledge concerning Perkinsus Marinus effects on Crassostrea
virginica (Gmelin) (the eastern oyster). Vet. Pathol. 2013, 50, 404–411. [CrossRef] [PubMed]
Arzul, I.; Corbeil, S.; Morga, B.; Renault, T. Viruses infecting marine molluscs. J. Invertebr. Pathol. 2017.
[CrossRef] [PubMed]
Gomez-Leon, J.; Villamil, L.; Lemos, M.L.; Novoa, B.; Figueras, A. Isolation of Vibrio alginolyticus and
Vibrio splendidus from aquacultured carpet shell clam (Ruditapes decussatus) larvae associated with mass
mortalities. Appl. Environ. Microbiol. 2005, 71, 98–104. [CrossRef] [PubMed]
Froelich, B.A.; Noble, R.T. Vibrio bacteria in raw oysters: Managing risks to human health. Philos. Trans. R.
Soc. Lond. B Biol. Sci. 2016, 371. [CrossRef] [PubMed]
Carnegie, R.B.; Hill, K.M.; Stokes, N.A.; Burreson, E.M. The haplosporidian Bonamia exitiosa is present in
Australia, but the identity of the parasite described as Bonamia (formerly Mikrocytos) roughleyi is uncertain.
J. Invertebr. Pathol. 2014, 115, 33–40. [CrossRef] [PubMed]
Engelsma, M.Y.; Culloty, S.C.; Lynch, S.A.; Arzul, I.; Carnegie, R.B. Bonamia parasites: A rapidly changing
perspective on a genus of important mollusc pathogens. Dis. Aquat. Organ. 2014, 110, 5–23. [CrossRef]
[PubMed]
Canesi, L.; Pezzati, E.; Stauder, M.; Grande, C.; Bavestrello, M.; Papetti, A.; Vezzulli, L.; Pruzzo, C.
Vibrio cholerae interactions with Mytilus galloprovincialis hemocytes mediated by serum components.
Front. Microbiol. 2013, 4, 371. [CrossRef] [PubMed]
Galloway, T.S.; Depledge, M.H. Immunotoxicity in invertebrates: Measurement and ecotoxicological
relevance. Ecotoxicology 2001, 10, 5–23. [CrossRef] [PubMed]
Perez, D.G.; Fontanetti, C.S. Hemocitical responses to environmental stress in invertebrates: A review.
Environ. Monit. Assess. 2011, 177, 437–447. [CrossRef] [PubMed]
Malagoli, D.; Ottaviani, E. Cross-talk among immune and neuroendocrine systems in molluscs and other
invertebrate models. Horm. Behav. 2017, 88, 41–44. [CrossRef] [PubMed]
Bachère, E.; Mialhe, E.; Noël, D.; Boulo, V.; Morvan, A.; Rodriguez, J. Knowledge and research prospects in
marine mollusc and crustacean immunology. Aquaculture 1995, 132, 17–32. [CrossRef]
Evariste, L.; Auffret, M.; Audonnet, S.; Geffard, A.; David, E.; Brousseau, P.; Fournier, M.; Betoulle, S.
Functional features of hemocyte subpopulations of the invasive mollusk species Dreissena polymorpha.
Fish Shellfish Immunol. 2016, 56, 144–154. [CrossRef] [PubMed]
Boulais, J.; Trost, M.; Landry, C.R.; Dieckmann, R.; Levy, E.D.; Soldati, T.; Michnick, S.W.; Thibault, P.;
Desjardins, M. Molecular characterization of the evolution of phagosomes. Mol. Syst. Biol. 2010, 6, 423.
[CrossRef] [PubMed]
Song, L.; Wang, L.; Qiu, L.; Zhang, H. Bivalve immunity. Adv. Exp. Med. Biol. 2010, 708, 44–65. [PubMed]
Smolowitz, R.M.; Miosky, D.; Reinisch, C.L. Ontogeny of leukemic cells of the soft shell clam.
J. Invertebr. Pathol. 1989, 53, 41–51. [CrossRef]
Moore, M.N.; Lowe, D.M. The cytology and cytochemistry of the hemocytes of Mytilus edulis and their
responses to experimentally injected carbon particles. J. Invertebr. Pathol. 1977, 29, 18–30. [CrossRef]
Grandiosa, R.; Merien, F.; Pillay, K.; Alfaro, A. Innovative application of classic and newer techniques for the
characterization of haemocytes in the New Zealand black-footed abalone (Haliotis iris). Fish Shellfish Immunol.
2016, 48, 175–184. [CrossRef] [PubMed]
Rebelo Mde, F.; Figueiredo Ede, S.; Mariante, R.M.; Nobrega, A.; de Barros, C.M.; Allodi, S. New insights from
the oyster Crassostrea rhizophorae on bivalve circulating hemocytes. PLoS ONE 2013, 8, e57384. [CrossRef]
[PubMed]
Wang, Y.; Hu, M.; Chiang, M.W.; Shin, P.K.; Cheung, S.G. Characterization of subpopulations and
immune-related parameters of hemocytes in the green-lipped mussel Perna viridis. Fish Shellfish Immunol.
2012, 32, 381–390. [CrossRef] [PubMed]
453
Mar. Drugs 2017, 15, 182
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
111.
112.
113.
Xue, Q.; Renault, T. Monoclonal antibodies to European flat oyster Ostrea edulis hemocytes:
Characterization and tissue distribution of granulocytes in adult and developing animals.
Dev. Comp. Immunol. 2001, 25, 187–194. [CrossRef]
Lambert, C.; Soudant, P.; Choquet, G.; Paillard, C. Measurement of Crassostrea gigas hemocyte oxidative
metabolism by flow cytometry and the inhibiting capacity of pathogenic vibrios. Fish Shellfish Immunol. 2003,
15, 225–240. [CrossRef]
Parisi, M.G.; Li, H.; Jouvet, L.B.; Dyrynda, E.A.; Parrinello, N.; Cammarata, M.; Roch, P.
Differential involvement of mussel hemocyte sub-populations in the clearance of bacteria.
Fish Shellfish Immunol. 2008, 25, 834–840. [CrossRef] [PubMed]
Renwrantz, L.; Siegmund, E.; Woldmann, M. Variations in hemocyte counts in the mussel, Mytilus edulis:
Similar reaction patterns occur in disappearance and return of molluscan hemocytes and vertebrate
leukocytes. Comp. Biochem.Physiol. A Mol. Integr. Physiol. 2013, 164, 629–637. [CrossRef] [PubMed]
Anderson, R.S.; Ozbay, G.; Kingsley, D.H.; Strauss, M.A. Oyster hemocyte mobilization and increased
adhesion activity after β-glucan administration. J. Shellfish Res. 2011, 30, 635–641. [CrossRef]
Taylor, A.M.; Edge, K.J.; Ubrihien, R.P.; Maher, W.A. The freshwater bivalve Corbicula australis as a sentinel
species for metal toxicity assessment: An in situ case study integrating chemical and biomarker analyses.
Environ. Toxicol. Chem. 2016, 36, 709–719. [CrossRef] [PubMed]
Mosca, F.; Lanni, L.; Cargini, D.; Narcisi, V.; Bianco, I.; Tiscar, P.G. Variability of the hemocyte parameters
of cultivated mussel Mytilus galloprovincialis (Lmk 1819) in Sabaudia (Latina, Italy) coastal lagoon.
Mar. Environ. Res. 2013, 92, 215–223. [CrossRef] [PubMed]
Farcy, E.; Burgeot, T.; Haberkorn, H.; Auffret, M.; Lagadic, L.; Allenou, J.P.; Budzinski, H.; Mazzella, N.;
Pete, R.; Heydorff, M.; et al. An integrated environmental approach to investigate biomarker fluctuations in
the blue mussel Mytilus edulis L. in the Vilaine estuary, France. Environ. Sci. Pollut. Res. Int. 2013, 20, 630–650.
[CrossRef] [PubMed]
Hannam, M.L.; Bamber, S.D.; Sundt, R.C.; Galloway, T.S. Immune modulation in the blue mussel Mytilus
edulis exposed to north sea produced water. Environ. Pollut. 2009, 157, 1939–1944. [CrossRef] [PubMed]
Camus, L.; Grosvik, B.E.; Borseth, J.F.; Jones, M.B.; Depledge, M.H. Stability of lysosomal and cell membranes
in haemocytes of the common mussel (Mytilus edulis): Effect of low temperatures. Mar. Environ. Res. 2000,
50, 325–329. [CrossRef]
Dimitriadis, V.K.; Gougoula, C.; Anestis, A.; Portner, H.O.; Michaelidis, B. Monitoring the biochemical and
cellular responses of marine bivalves during thermal stress by using biomarkers. Mar. Environ. Res. 2012, 73,
70–77. [CrossRef] [PubMed]
Matozzo, V.; Chinellato, A.; Munari, M.; Finos, L.; Bressan, M.; Marin, M.G. First evidence of
immunomodulation in bivalves under seawater acidification and increased temperature. PLoS ONE 2012, 7,
e33820. [CrossRef] [PubMed]
Lacoste, A.; Malham, S.K.; Gelebart, F.; Cueff, A.; Poulet, S.A. Stress-induced immune changes in the oyster
Crassostrea gigas. Dev. Comp. Immunol. 2002, 26, 1–9. [CrossRef]
Gagnaire, B.; Frouin, H.; Moreau, K.; Thomas-Guyon, H.; Renault, T. Effects of temperature and salinity
on haemocyte activities of the Pacific oyster, Crassostrea gigas (Thunberg). Fish Shellfish Immunol. 2006, 20,
536–547. [CrossRef] [PubMed]
Boyd, J.N.; Burnett, L.E. Reactive oxygen intermediate production by oyster hemocytes exposed to hypoxia.
J. Exp. Biol. 1999, 202, 3135–3143. [PubMed]
Buratti, S.; Franzellitti, S.; Poletti, R.; Ceredi, A.; Montanari, G.; Capuzzo, A.; Fabbri, E. Bioaccumulation of
algal toxins and changes in physiological parameters in Mediterranean mussels from the North Adriatic Sea
(Italy). Environ. Toxicol. 2013, 28, 451–470. [CrossRef] [PubMed]
Hoher, N.; Kohler, A.; Strand, J.; Broeg, K. Effects of various pollutant mixtures on immune responses of the
blue mussel (Mytilus edulis) collected at a salinity gradient in danish coastal waters. Mar. Environ. Res. 2012,
75, 35–44. [CrossRef] [PubMed]
Mosca, F.; Narcisi, V.; Cargini, D.; Calzetta, A.; Tiscar, P.G. Age related properties of the Adriatic clam
Chamelea gallina (L. 1758) hemocytes. Fish Shellfish Immunol. 2011, 31, 1106–1112. [CrossRef] [PubMed]
Dang, C.; Tan, T.; Moffit, D.; Deboutteville, J.D.; Barnes, A.C. Gender differences in hemocyte immune
parameters of bivalves: The Sydney rock oyster Saccostrea glomerata and the pearl oyster Pinctada fucata.
Fish Shellfish Immunol. 2012, 33, 138–142. [CrossRef] [PubMed]
454
Mar. Drugs 2017, 15, 182
114. Li, Y.; Qin, J.G.; Abbott, C.A.; Li, X.; Benkendorff, K. Synergistic impacts of heat shock and spawning on the
physiology and immune health of Crassostrea gigas: An explanation for summer mortality in Pacific oysters.
Am. J. Physiol. Regul. Integr. Comp. Physiol. 2007, 293, R2353–R2362. [CrossRef] [PubMed]
115. Hughes, T.K., Jr.; Smith, E.M.; Barnett, J.A.; Charles, R.; Stefano, G.B. LPS stimulated invertebrate hemocytes:
A role for immunoreactive TNF and IL-1. Dev. Comp. Immunol. 1991, 15, 117–122. [CrossRef]
116. Ottaviani, E.; Franchini, A.; Malagoli, D.; Genedani, S. Immunomodulation by recombinant human
interleukin-8 and its signal transduction pathways in invertebrate hemocytes. Cell. Mol. Life Sci. 2000, 57,
506–513. [CrossRef] [PubMed]
117. Panara, F.; Di Rosa, I.; Fagotti, A.; Simoncelli, F.; Mangiabene, C.; Pipe, R.K.; Pascolini, R.
Characterization and immunocytochemical localization of actin and fibronectin in haemocytes of the mussel
Mytilus galloprovincialis. Histochem. J. 1996, 28, 123–131. [CrossRef] [PubMed]
118. Schneeweiss, H.; Renwrantz, L. Analysis of the attraction of haemocytes from Mytilus edulis by molecules of
bacterial origin. Dev. Comp. Immunol. 1993, 17, 377–387. [CrossRef]
119. Fawcett, L.B.; Tripp, M.R. Chemotaxis of Mercenaria mercenaria hemocytes to bacteria in vitro.
J. Invertebr. Pathol. 1994, 63, 275–284. [CrossRef] [PubMed]
120. Kumazawa, N.H.; Morimoto, N. Chemotactic activity of hemocytes derived from a brackish-water clam,
Corbicula japonica, to Vibrio parahaemolyticus and Escherichia coli strains. J. Vet. Med. Sci. 1992, 54, 851–855.
[CrossRef] [PubMed]
121. Buchmann, K. Evolution of innate immunity: Clues from invertebrates via fish to mammals. Front. Immunol.
2014, 5, 459. [CrossRef] [PubMed]
122. Kawai, T.; Akira, S. The role of pattern-recognition receptors in innate immunity: Update on toll-like
receptors. Nat. Immunol. 2010, 11, 373–384. [CrossRef] [PubMed]
123. Lemaitre, B.; Hoffmann, J. The host defense of Drosophila melanogaster. Annu. Rev. Immunol. 2007, 25, 697–743.
[CrossRef] [PubMed]
124. Wang, M.; Wang, L.; Guo, Y.; Sun, R.; Yue, F.; Yi, Q.; Song, L. The broad pattern recognition spectrum of
the toll-like receptor in mollusk Zhikong scallop Chlamys farreri. Dev. Comp. Immunol. 2015, 52, 192–201.
[CrossRef] [PubMed]
125. Zhang, L.; Li, L.; Zhang, G. A Crassostrea gigas toll-like receptor and comparative analysis of TLR pathway in
invertebrates. Fish Shellfish Immunol. 2011, 30, 653–660. [CrossRef] [PubMed]
126. Qiu, L.; Song, L.; Xu, W.; Ni, D.; Yu, Y. Molecular cloning and expression of a toll receptor gene homologue
from Zhikong scallop, Chlamys farreri. Fish Shellfish Immunol. 2007, 22, 451–466. [CrossRef] [PubMed]
127. Philipp, E.E.; Kraemer, L.; Melzner, F.; Poustka, A.J.; Thieme, S.; Findeisen, U.; Schreiber, S.; Rosenstiel, P.
Massively parallel RNA sequencing identifies a complex immune gene repertoire in the lophotrochozoan
Mytilus edulis. PLoS ONE 2012, 7, e33091. [CrossRef] [PubMed]
128. Watters, T.M.; Kenny, E.F.; O’Neill, L.A. Structure, function and regulation of the Toll/IL-1 receptor adaptor
proteins. Immunol. Cell Biol. 2007, 85, 411–419. [CrossRef] [PubMed]
129. Kawasaki, T.; Kawai, T. Toll-like receptor signaling pathways. Front. Immunol. 2014, 5, 461. [CrossRef]
[PubMed]
130. O’Neill, L.A. How Toll-like receptors signal: What we know and what we don’t know. Curr. Opin. Immunol.
2006, 18, 3–9. [CrossRef] [PubMed]
131. Toubiana, M.; Rosani, U.; Giambelluca, S.; Cammarata, M.; Gerdol, M.; Pallavicini, A.; Venier, P.; Roch, P.
Toll signal transduction pathway in bivalves: Complete CDS of intermediate elements and related gene
transcription levels in hemocytes of immune stimulated Mytilus galloprovincialis. Dev. Comp. Immunol. 2014,
45, 300–312. [CrossRef] [PubMed]
132. Wang, M.; Yang, J.; Zhou, Z.; Qiu, L.; Wang, L.; Zhang, H.; Gao, Y.; Wang, X.; Zhang, L.; Zhao, J.;
et al. A primitive Toll-like receptor signaling pathway in mollusk Zhikong scallop Chlamys farreri.
Dev. Comp. Immunol. 2011, 35, 511–520. [CrossRef] [PubMed]
133. Moreira, R.; Balseiro, P.; Planas, J.V.; Fuste, B.; Beltran, S.; Novoa, B.; Figueras, A. Transcriptomics of
in vitro immune-stimulated hemocytes from the Manila Clam Ruditapes philippinarum using high-throughput
sequencing. PLoS ONE 2012, 7, e35009. [CrossRef] [PubMed]
134. Qu, F.; Xiang, Z.; Wang, F.; Zhang, Y.; Li, J.; Zhang, Y.; Xiao, S.; Yu, Z. Identification and function of an
evolutionarily conserved signaling intermediate in toll pathways (ECSIT) from Crassostrea hongkongensis.
Dev. Comp. Immunol. 2015, 53, 244–252. [CrossRef] [PubMed]
455
Mar. Drugs 2017, 15, 182
135. Canesi, L.; Betti, M.; Ciacci, C.; Lorusso, L.C.; Gallo, G.; Pruzzo, C. Interactions between Mytilus haemocytes
and different strains of Escherichia coli and Vibrio cholerae O1 El Tor: Role of kinase-mediated signalling.
Cell. Microbiol. 2005, 7, 667–674. [CrossRef] [PubMed]
136. Ciacci, C.; Citterio, B.; Betti, M.; Canonico, B.; Roch, P.; Canesi, L. Functional differential immune responses
of Mytilus galloprovincialis to bacterial challenge. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2009, 153,
365–371. [CrossRef] [PubMed]
137. Wang, W.; Liu, R.; Zhang, T.; Zhang, R.; Song, X.; Wang, L.; Song, L. A novel phagocytic receptor
(CgNimC) from Pacific oyster Crassostrea gigas with lipopolysaccharide and Gram-negative bacteria binding
activity. Fish Shellfish Immunol. 2015, 43, 103–110. [CrossRef] [PubMed]
138. Ni, D.; Song, L.; Wu, L.; Chang, Y.; Yu, Y.; Qiu, L.; Wang, L. Molecular cloning and mRNA expression
of peptidoglycan recognition protein (PGRP) gene in bay scallop (Argopecten irradians, Lamarck 1819).
Dev. Comp. Immunol. 2007, 31, 548–558. [CrossRef] [PubMed]
139. Wei, X.; Yang, J.; Liu, X.; Yang, D.; Xu, J.; Fang, J.; Wang, W.; Yang, J. Identification and transcriptional
analysis of two types of lectins (SgCTL-1 and SgGal-1) from mollusk Solen grandis. Fish Shellfish Immunol.
2012, 33, 204–212. [CrossRef] [PubMed]
140. Canesi, L.; Gallo, G.; Gavioli, M.; Pruzzo, C. Bacteria-hemocyte interactions and phagocytosis in marine
bivalves. Microsc. Res. Tech. 2002, 57, 469–476. [CrossRef] [PubMed]
141. Carballal, M.J.; Lopez, C.; Azevedo, C.; Villalba, A. Enzymes involved in defense functions of hemocytes of
mussel Mytilus galloprovincialis. J. Invertebr. Pathol. 1997, 70, 96–105. [CrossRef] [PubMed]
142. Cima, F.; Matozzo, V.; Marin, M.G.; Ballarin, L. Haemocytes of the clam Tapes philippinarum (Adams & Reeve,
1850): Morphofunctional characterisation. Fish Shellfish Immunol. 2000, 10, 677–693. [PubMed]
143. Matozzo, V.; Rova, G.; Marin, M.G. Haemocytes of the cockle Cerastoderma glaucum:
Morphological characterisation and involvement in immune responses.
Fish Shellfish Immunol.
2007, 23, 732–746. [CrossRef] [PubMed]
144. Wootton, E.C.; Dyrynda, E.A.; Ratcliffe, N.A. Bivalve immunity: Comparisons between the marine mussel
(Mytilus edulis), the edible cockle (Cerastoderma edule) and the razor-shell (Ensis siliqua). Fish Shellfish Immunol.
2003, 15, 195–210. [CrossRef]
145. Pampanin, D.M.; Marin, M.G.; Ballarin, L. Morphological and cytoenzymatic characterization of haemocytes
of the Venus Clam Chamelea gallina. Dis. Aquat. Organ. 2002, 49, 227–234. [CrossRef] [PubMed]
146. Anderson, R.S. Reactive oxygen species and antimicrobial defenses of invertebrates: A bivalve model.
Adv. Exp. Med. Biol. 2001, 484, 131–139. [PubMed]
147. Adema, C.M.; van Deutekom-Mulder, E.C.; van der Knaap, W.P.; Sminia, T. NADPH-oxidase activity:
The probable source of reactive oxygen intermediate generation in hemocytes of the gastropod Lymnaea
stagnalis. J. Leukoc. Biol. 1993, 54, 379–383. [PubMed]
148. Connors, V.A.; Lodes, M.J.; Yoshino, T.P. Identification of a Schistosoma mansoni sporocyst excretory-secretory
antioxidant molecule and its effect on superoxide production by Biomphalaria glabrata hemocytes.
J. Invertebr. Pathol. 1991, 58, 387–395. [CrossRef]
149. Ordas, M.C.; Novoa, B.; Figueras, A. Modulation of the chemiluminescence response of Mediterranean
mussel (Mytilus galloprovincialis) haemocytes. Fish Shellfish Immunol. 2000, 10, 611–622. [CrossRef] [PubMed]
150. Goedken, M.; De Guise, S. Flow cytometry as a tool to quantify oyster defense mechanisms. Fish Shellfish
Immunol. 2004, 16, 539–552. [CrossRef] [PubMed]
151. Bugge, D.M.; Hegaret, H.; Wikfors, G.H.; Allam, B. Oxidative burst in hard clam
(Mercenaria mercenaria) haemocytes. Fish Shellfish Immunol. 2007, 23, 188–196. [CrossRef] [PubMed]
152. Bartosz, G. Reactive oxygen species: Destroyers or messengers? Biochem. Pharmacol. 2009, 77, 1303–1315.
[CrossRef] [PubMed]
153. Winston, G.W.; Moore, M.N.; Kirchin, M.A.; Soverchia, C. Production of reactive oxygen species by hemocytes
from the marine mussel, Mytilus edulis: Ysosomal localization and effect of xenobiotics. Comp. Biochem.
Physiol. C Pharmacol. Toxicol. Endocrinol. 1996, 113, 221–229. [CrossRef]
154. Donaghy, L.; Kraffe, E.; Le Goic, N.; Lambert, C.; Volety, A.K.; Soudant, P. Reactive oxygen species in
unstimulated hemocytes of the Pacific oyster Crassostrea gigas: A mitochondrial involvement. PLoS ONE
2012, 7, e46594. [CrossRef] [PubMed]
155. Ge, W.; Li, D.; Gao, Y.; Cao, X. The roles of lysosomes in inflammation and autoimmune diseases.
Int. Rev. Immunol. 2015, 34, 415–431. [CrossRef] [PubMed]
456
Mar. Drugs 2017, 15, 182
156. Mateo, D.R.; Spurmanis, A.; Siah, A.; Araya, M.T.; Kulka, M.; Berthe, F.C.; Johnson, G.R.; Greenwood, S.J.
Changes induced by two strains of Vibrio splendidus in haemocyte subpopulations of Mya Arenaria, detected by
flow cytometry with LysoTracker. Dis. Aquat. Organ. 2009, 86, 253–262. [CrossRef] [PubMed]
157. Allam, B.; Ashton-Alcox, K.A.; Ford, S.E. Flow cytometric comparison of haemocytes from three species of
bivalve molluscs. Fish Shellfish Immunol. 2002, 13, 141–158. [CrossRef] [PubMed]
158. Garcia-Garcia, E.; Prado-Alvarez, M.; Novoa, B.; Figueras, A.; Rosales, C. Immune responses of mussel
hemocyte subpopulations are differentially regulated by enzymes of the PI 3-K, PKC, and ERK kinase
families. Dev. Comp. Immunol. 2008, 32, 637–653. [CrossRef] [PubMed]
159. Tunkijjanukij, S.; Giaever, H.; Chin, C.C.; Olafsen, J.A. Sialic acid in hemolymph and affinity purified lectins
from two marine bivalves. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 1998, 119, 705–713. [CrossRef]
160. Olafsen, J.A. Bacterial antigen priming of marine fish larvae. Adv. Exp. Med. Biol. 1995, 371A, 349–352.
[PubMed]
161. Yang, J.; Huang, M.; Zhang, H.; Wang, L.; Wang, H.; Wang, L.; Qiu, L.; Song, L. CfLec-3 from scallop:
An entrance to non-self recognition mechanism of invertebrate C-type lectin. Sci. Rep. 2015, 5, 10068.
[CrossRef] [PubMed]
162. Mu, C.; Chen, L.; Zhao, J.; Wang, C. Molecular cloning and expression of a C-type lectin gene from
Venerupis philippinarum. Mol. Biol. Rep. 2014, 41, 139–144. [CrossRef] [PubMed]
163. Huang, M.; Wang, L.; Yang, J.; Zhang, H.; Wang, L.; Song, L. A four-CRD C-type lectin from Chlamys farreri
mediating nonself-recognition with broader spectrum and opsonization. Dev. Comp. Immunol. 2013, 39,
363–369. [CrossRef] [PubMed]
164. Vasta, G.R. Galectins as pattern recognition receptors: Structure, function, and evolution. Adv. Exp. Med. Biol.
2012, 946, 21–36. [PubMed]
165. Ahmed, H.; Vasta, G.R. Galectins: Conservation of functionally and structurally relevant amino acid residues
defines two types of carbohydrate recognition domains. Glycobiology 1994, 4, 545–548. [CrossRef] [PubMed]
166. Ahmed, H.; Bianchet, M.A.; Amzel, L.M.; Hirabayashi, J.; Kasai, K.; Giga-Hama, Y.; Tohda, H.; Vasta, G.R.
Novel carbohydrate specificity of the 16-kDa galectin from Caenorhabditis elegans: Binding to blood group
precursor oligosaccharides (type 1, type 2, Talpha, and Tbeta) and gangliosides. Glycobiology 2002, 12,
451–461. [CrossRef] [PubMed]
167. Bianchet, M.A.; Ahmed, H.; Vasta, G.R.; Amzel, L.M. Soluble beta-galactosyl-binding lectin (galectin) from
toad ovary: Crystallographic studies of two protein-sugar complexes. Proteins 2000, 40, 378–388. [CrossRef]
168. Kim, J.Y.; Kim, Y.M.; Cho, S.K.; Choi, K.S.; Cho, M. Noble tandem-repeat galectin of Manila
Clam Ruditapes philippinarum is induced upon infection with the protozoan parasite Perkinsus olseni.
Dev. Comp. Immunol. 2008, 32, 1131–1141. [CrossRef] [PubMed]
169. Song, X.; Zhang, H.; Wang, L.; Zhao, J.; Mu, C.; Song, L.; Qiu, L.; Liu, X. A galectin with quadruple-domain
from bay scallop Argopecten irradians is involved in innate immune response. Dev. Comp. Immunol. 2011, 35,
592–602. [CrossRef] [PubMed]
170. Feng, C.; Ghosh, A.; Amin, M.N.; Giomarelli, B.; Shridhar, S.; Banerjee, A.; Fernandez-Robledo, J.A.;
Bianchet, M.A.; Wang, L.X.; Wilson, I.B.; et al. The galectin CvGal1 from the eastern oyster (Crassostrea
virginica) binds to blood group a oligosaccharides on the hemocyte surface. J. Biol. Chem. 2013, 288,
24394–24409. [CrossRef] [PubMed]
171. Jiang, S.; Li, H.; Zhang, D.; Zhang, H.; Wang, L.; Sun, J.; Song, L. A C1q domain containing protein from
Crassostrea gigas serves as pattern recognition receptor and opsonin with high binding affinity to LPS.
Fish Shellfish Immunol. 2015, 45, 583–591. [CrossRef] [PubMed]
172. Gerdol, M.; Manfrin, C.; De Moro, G.; Figueras, A.; Novoa, B.; Venier, P.; Pallavicini, A. The C1q domain
containing proteins of the Mediterranean mussel Mytilus galloprovincialis: A widespread and diverse family
of immune-related molecules. Dev. Comp. Immunol. 2011, 35, 635–643. [CrossRef] [PubMed]
173. Kong, P.; Zhang, H.; Wang, L.; Zhou, Z.; Yang, J.; Zhang, Y.; Qiu, L.; Wang, L.; Song, L. AiC1qDC-1, a novel
gC1q-domain-containing protein from bay scallop Argopecten irradians with fungi agglutinating activity.
Dev. Comp. Immunol. 2010, 34, 837–846. [CrossRef] [PubMed]
174. Li, C.; Yu, S.; Zhao, J.; Su, X.; Li, T. Cloning and characterization of a sialic acid binding lectins (SABL) from
Manila Clam Venerupis Philippinarum. Fish Shellfish Immunol. 2011, 30, 1202–1206. [CrossRef] [PubMed]
457
Mar. Drugs 2017, 15, 182
175. Gerdol, M.; Venier, P.; Pallavicini, A. The genome of the Pacific oyster Crassostrea gigas brings new insights on
the massive expansion of the C1q gene family in Bivalvia. Dev. Comp. Immunol. 2015, 49, 59–71. [CrossRef]
[PubMed]
176. Wang, L.; Wang, L.; Zhang, D.; Jiang, Q.; Sun, R.; Wang, H.; Zhang, H.; Song, L. A novel multi-domain
C1qDC protein from Zhikong scallop Chlamys farreri provides new insights into the function of invertebrate
C1qDC proteins. Dev. Comp. Immunol. 2015, 52, 202–214. [CrossRef] [PubMed]
177. Xu, T.; Xie, J.; Li, J.; Luo, M.; Ye, S.; Wu, X. Identification of expressed genes in cDNA library of hemocytes
from the RLO-challenged oyster, Crassostrea ariakensis gould with special functional implication of three
complement-related fragments (CaC1q1, CaC1q2 and CaC3). Fish Shellfish Immunol. 2012, 32, 1106–1116.
[CrossRef] [PubMed]
178. Mao, Y.; Zhou, C.; Zhu, L.; Huang, Y.; Yan, T.; Fang, J.; Zhu, W. Identification and expression analysis on
bactericidal permeability-increasing protein (BPI)/lipopolysaccharide-binding protein (LBP) of ark shell,
Scapharca broughtonii. Fish Shellfish Immunol. 2013, 35, 642–652. [CrossRef] [PubMed]
179. Zhang, Y.; He, X.; Li, X.; Fu, D.; Chen, J.; Yu, Z. The second bactericidal permeability increasing protein
(BPI) and its revelation of the gene duplication in the Pacific oyster, Crassostrea gigas. Fish Shellfish Immunol.
2011, 30, 954–963. [CrossRef] [PubMed]
180. Gonzalez, M.; Gueguen, Y.; Destoumieux-Garzon, D.; Romestand, B.; Fievet, J.; Pugniere, M.; Roquet, F.;
Escoubas, J.M.; Vandenbulcke, F.; Levy, O.; et al. Evidence of a bactericidal permeability increasing protein
in an invertebrate, the Crassostrea gigas Cg-BPI. Proc. Natl. Acad. Sci. USA 2007, 104, 17759–17764. [CrossRef]
[PubMed]
181. Balbi, T.; Fabbri, R.; Cortese, K.; Smerilli, A.; Ciacci, C.; Grande, C.; Vezzulli, L.; Pruzzo, C.; Canesi, L.
Interactions between Mytilus galloprovincialis hemocytes and the bivalve pathogens Vibrio aestuarianus 01/032
and Vibrio splendidus LGP32. Fish Shellfish Immunol. 2013, 35, 1906–1915. [CrossRef] [PubMed]
182. Liu, X.; Zhao, J.; Wu, H.; Wang, Q. Metabolomic analysis revealed the differential responses in two pedigrees
of clam Ruditapes philippinarum towards Vibrio harveyi challenge. Fish Shellfish Immunol. 2013, 35, 1969–1975.
[CrossRef] [PubMed]
183. Zhou, Z.; Wang, L.; Shi, X.; Zhang, H.; Gao, Y.; Wang, M.; Kong, P.; Qiu, L.; Song, L. The modulation of
catecholamines to the immune response against bacteria Vibrio anguillarum challenge in scallop Chlamys farreri.
Fish Shellfish Immunol. 2011, 31, 1065–1071. [CrossRef] [PubMed]
184. Morga, B.; Renault, T.; Faury, N.; Chollet, B.; Arzul, I. Cellular and molecular responses of haemocytes
from Ostrea edulis during in vitro infection by the parasite Bonamia ostreae. Int. J. Parasitol. 2011, 41, 755–764.
[CrossRef] [PubMed]
185. Xue, Q.G.; Schey, K.L.; Volety, A.K.; Chu, F.L.; La Peyre, J.F. Purification and characterization of lysozyme
from plasma of the eastern oyster (Crassostrea virginica). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2004,
139, 11–25. [CrossRef] [PubMed]
186. Allam, B.; Pales Espinosa, E.; Tanguy, A.; Jeffroy, F.; Le Bris, C.; Paillard, C. Transcriptional changes in Manila
clam (Ruditapes philippinarum) in response to Brown Ring Disease. Fish Shellfish Immunol. 2014, 41, 2–11.
[CrossRef] [PubMed]
187. Munoz, P.; Vance, K.; Gomez-Chiarri, M. Protease activity in the plasma of American oysters,
Crassostrea virginica, experimentally infected with the protozoan parasite Perkinsus marinus. J. Parasitol.
2003, 89, 941–951. [CrossRef] [PubMed]
188. Niu, D.; Jin, K.; Wang, L.; Feng, B.; Li, J. Molecular characterization and expression analysis of four cathepsin
L genes in the razor clam, Sinonovacula constricta. Fish Shellfish Immunol. 2013, 35, 581–588. [CrossRef]
[PubMed]
189. Allam, B.; Pales Espinosa, E. Bivalve immunity and response to infections: Are we looking at the right place?
Fish Shellfish Immunol. 2016, 53, 4–12. [CrossRef] [PubMed]
190. Mora, C.; Tittensor, D.P.; Adl, S.; Simpson, A.G.; Worm, B. How many species are there on earth and in the
ocean? PLoS Biol. 2011, 9, e1001127. [CrossRef] [PubMed]
191. Mayer, A.M.; Rodriguez, A.D.; Berlinck, R.G.; Fusetani, N. Marine pharmacology in 2007–8:
Marine compounds with antibacterial, anticoagulant, antifungal, anti-inflammatory, antimalarial,
antiprotozoal, antituberculosis, and antiviral activities; affecting the immune and nervous system, and
other miscellaneous mechanisms of action. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2011, 153, 191–222.
[PubMed]
458
Mar. Drugs 2017, 15, 182
192. Charles, F.; Grémare, A.; Amouroux, J.-M.; Cahet, G. Filtration of the enteric bacteria Escherichia coli by two
filter-feeding bivalves, Venus verrucosa and Mytilus galloprovincialis. Mar. Biol. 1992, 113, 125–131. [CrossRef]
193. McHenery, J.G. Uptake and processing of cultured microorganisms by bivalves. J. Exp. Mar. Biol. Ecol. 1985,
90, 145–163. [CrossRef]
194. Otero-Gonzalez, A.J.; Magalhaes, B.S.; Garcia-Villarino, M.; Lopez-Abarrategui, C.; Sousa, D.A.; Dias, S.C.;
Franco, O.L. Antimicrobial peptides from marine invertebrates as a new frontier for microbial infection
control. FASEB J. 2010, 24, 1320–1334. [CrossRef] [PubMed]
195. Hultmark, D.; Steiner, H.; Rasmuson, T.; Boman, H.G. Insect immunity. Purification and properties of three
inducible bactericidal proteins from hemolymph of immunized pupae of Hyalophora cecropia. Eur. J. Biochem.
1980, 106, 7–16. [CrossRef] [PubMed]
196. Steiner, H.; Hultmark, D.; Engstrom, A.; Bennich, H.; Boman, H.G. Sequence and specificity of two
antibacterial proteins involved in insect immunity. Nature 1981, 292, 246–248. [CrossRef] [PubMed]
197. Hancock, R.E.; Lehrer, R. Cationic peptides: A new source of antibiotics. Trends Biotechnol. 1998, 16, 82–88.
[CrossRef]
198. Brown, K.L.; Hancock, R.E. Cationic host defense (antimicrobial) peptides. Curr. Opin. Immunol. 2006, 18,
24–30. [CrossRef] [PubMed]
199. Hancock, R.E.; Diamond, G. The role of cationic antimicrobial peptides in innate host defenses.
Trends Microbiol. 2000, 8, 402–410. [CrossRef]
200. Gaspar, D.; Veiga, A.S.; Castanho, M.A. From antimicrobial to anticancer peptides. A review. Front. Microbiol.
2013, 4, 294. [CrossRef] [PubMed]
201. Radek, K.; Gallo, R. Antimicrobial peptides: Natural effectors of the innate immune system.
Semin. Immunopathol. 2007, 29, 27–43. [CrossRef] [PubMed]
202. Zasloff, M. Antimicrobial peptides of multicellular organisms. Nature 2002, 415, 389–395. [CrossRef]
[PubMed]
203. Brogden, K.A. Antimicrobial peptides: Pore formers or metabolic inhibitors in bacteria? Nat. Rev. Microbiol.
2005, 3, 238–250. [CrossRef] [PubMed]
204. Hancock, R.E.; Scott, M.G. The role of antimicrobial peptides in animal defenses. Proc. Natl. Acad. Sci. USA
2000, 97, 8856–8861. [CrossRef] [PubMed]
205. Jenssen, H.; Hamill, P.; Hancock, R.E. Peptide antimicrobial agents. Clin. Microbiol. Rev. 2006, 19, 491–511.
[CrossRef] [PubMed]
206. Boman, H.G. Peptide antibiotics and their role in innate immunity. Annu. Rev. Immunol. 1995, 13, 61–92.
[CrossRef] [PubMed]
207. Hancock, R.E.; Rozek, A. Role of membranes in the activities of antimicrobial cationic peptides.
FEMS Microbiol. Lett. 2002, 206, 143–149. [CrossRef] [PubMed]
208. Matsuzaki, K. Control of cell selectivity of antimicrobial peptides. Biochim. Biophys. Acta 2009, 1788,
1687–1692. [CrossRef] [PubMed]
209. Zhang, L.; Rozek, A.; Hancock, R.E. Interaction of cationic antimicrobial peptides with model membranes.
J. Biol. Chem. 2001, 276, 35714–35722. [CrossRef] [PubMed]
210. Oren, Z.; Shai, Y. Mode of action of linear amphipathic alpha-helical antimicrobial peptides. Biopolymers
1998, 47, 451–463. [CrossRef]
211. Shai, Y. Mode of action of membrane active antimicrobial peptides. Biopolymers 2002, 66, 236–248. [CrossRef]
[PubMed]
212. Ehrenstein, G.; Lecar, H. Electrically gated ionic channels in lipid bilayers. Q. Rev. Biophys. 1977, 10, 1–34.
[CrossRef] [PubMed]
213. Yang, L.; Harroun, T.A.; Weiss, T.M.; Ding, L.; Huang, H.W. Barrel-stave model or toroidal model? A case
study on melittin pores. Biophys. J. 2001, 81, 1475–1485. [CrossRef]
214. Yeaman, M.R.; Yount, N.Y. Mechanisms of antimicrobial peptide action and resistance. Pharmacol. Rev. 2003,
55, 27–55. [CrossRef] [PubMed]
215. Lee, T.H.; Hall, K.N.; Aguilar, M.I. Antimicrobial peptide structure and mechanism of action: A focus on the
role of membrane structure. Curr. Top. Med. Chem. 2016, 16, 25–39. [CrossRef] [PubMed]
216. Marrink, S.J.; de Vries, A.H.; Tieleman, D.P. Lipids on the move: Simulations of membrane pores, domains,
stalks and curves. Biochim. Biophys. Acta 2009, 1788, 149–168. [CrossRef] [PubMed]
459
Mar. Drugs 2017, 15, 182
217. Wimley, W.C. Describing the mechanism of antimicrobial peptide action with the interfacial activity model.
ACS Chem. Biol. 2010, 5, 905–917. [CrossRef] [PubMed]
218. Falanga, A.; Galdiero, M.; Galdiero, S. Membranotropic cell penetrating peptides: The outstanding journey.
Int. J. Mol. Sci. 2015, 16, 25323–25337. [CrossRef] [PubMed]
219. Galdiero, S.; Vitiello, M.; Falanga, A.; Cantisani, M.; Incoronato, N.; Galdiero, M. Intracellular delivery:
Exploiting viral membranotropic peptides. Curr. Drug Metab. 2012, 13, 93–104. [CrossRef] [PubMed]
220. Ponnappan, N.; Budagavi, D.P.; Yadav, B.K.; Chugh, A. Membrane-active peptides from marine
organisms—Antimicrobials, cell-penetrating peptides and peptide toxins: Applications and prospects.
Probiotics Antimicrob. Proteins 2015, 7, 75–89. [CrossRef] [PubMed]
221. Masso-Silva, J.A.; Diamond, G. Antimicrobial peptides from fish. Pharmaceuticals (Basel) 2014, 7, 265–310.
[CrossRef] [PubMed]
222. Kang, H.K.; Seo, C.H.; Park, Y. Marine peptides and their anti-infective activities. Mar. Drugs 2015, 13,
618–654. [CrossRef] [PubMed]
223. Falanga, A.; Lombardi, L.; Franci, G.; Vitiello, M.; Iovene, M.R.; Morelli, G.; Galdiero, M.; Galdiero, S.
Marine antimicrobial peptides: Nature provides templates for the design of novel compounds against
pathogenic bacteria. Int. J. Mol. Sci. 2016, 17, 785. [CrossRef] [PubMed]
224. Hubert, F.; Noel, T.; Roch, P. A member of the arthropod defensin family from edible Mediterranean mussels
(Mytilus galloprovincialis). Eur. J. Biochem. 1996, 240, 302–306. [CrossRef] [PubMed]
225. Charlet, M.; Chernysh, S.; Philippe, H.; Hetru, C.; Hoffmann, J.A.; Bulet, P. Innate immunity. Isolation of
several cysteine-rich antimicrobial peptides from the blood of a mollusc, Mytilus edulis. J. Biol. Chem. 1996,
271, 21808–21813. [PubMed]
226. Mitta, G.; Hubert, F.; Noel, T.; Roch, P. Myticin, a novel cysteine-rich antimicrobial peptide isolated from
haemocytes and plasma of the mussel Mytilus galloprovincialis. Eur. J. Biochem. 1999, 265, 71–78. [CrossRef]
[PubMed]
227. Mitta, G.; Vandenbulcke, F.; Hubert, F.; Roch, P. Mussel defensins are synthesised and processed in
granulocytes then released into the plasma after bacterial challenge. J. Cell Sci. 1999, 112, 4233–4242.
[PubMed]
228. Yang, Y.S.; Mitta, G.; Chavanieu, A.; Calas, B.; Sanchez, J.F.; Roch, P.; Aumelas, A. Solution structure and
activity of the synthetic four-disulfide bond Mediterranean mussel defensin (MGD-1). Biochemistry 2000, 39,
14436–14447. [CrossRef] [PubMed]
229. Yeaman, M.R.; Yount, N.Y. Unifying themes in host defense effector polypeptides. Nat. Rev. Microbiol. 2007,
5, 727–740. [CrossRef] [PubMed]
230. Yount, N.Y.; Yeaman, M.R. Multidimensional signatures in antimicrobial peptides. Proc. Natl. Acad. Sci. USA
2004, 101, 7363–7368. [CrossRef] [PubMed]
231. Scudiero, O.; Galdiero, S.; Cantisani, M.; Di Noto, R.; Vitiello, M.; Galdiero, M.; Naclerio, G.; Cassiman, J.J.;
Pedone, C.; Castaldo, G.; et al. Novel synthetic, salt-resistant analogs of human beta-defensins 1 and 3
endowed with enhanced antimicrobial activity. Antimicrob. Agents Chemother. 2010, 54, 2312–2322. [CrossRef]
[PubMed]
232. Scudiero, O.; Galdiero, S.; Nigro, E.; Del Vecchio, L.; Di Noto, R.; Cantisani, M.; Colavita, I.;
Galdiero, M.; Cassiman, J.J.; Daniele, A.; et al. Chimeric beta-defensin analogs, including the novel
3NI analog, display salt-resistant antimicrobial activity and lack toxicity in human epithelial cell lines.
Antimicrob. Agents Chemother. 2013, 57, 1701–1708. [CrossRef] [PubMed]
233. Nigro, E.; Colavita, I.; Sarnataro, D.; Scudiero, O.; Zambrano, G.; Granata, V.; Daniele, A.; Carotenuto, A.;
Galdiero, S.; Folliero, V.; et al. An ancestral host defense peptide within human beta-defensin 3 recapitulates
the antibacterial and antiviral activity of the full-length molecule. Sci. Rep. 2015, 5, 18450. [CrossRef]
[PubMed]
234. Scudiero, O.; Nigro, E.; Cantisani, M.; Colavita, I.; Leone, M.; Mercurio, F.A.; Galdiero, M.; Pessi, A.;
Daniele, A.; Salvatore, F.; et al. Design and activity of a cyclic mini-beta-defensin analog: A novel
antimicrobial tool. Int. J. Nanomed. 2015, 10, 6523–6539. [PubMed]
235. Romestand, B.; Molina, F.; Richard, V.; Roch, P.; Granier, C. Key role of the loop connecting the two beta
strands of mussel defensin in its antimicrobial activity. Eur. J. Biochem. 2003, 270, 2805–2813. [CrossRef]
[PubMed]
460
Mar. Drugs 2017, 15, 182
236. Mitta, G.; Vandenbulcke, F.; Hubert, F.; Salzet, M.; Roch, P. Involvement of mytilins in mussel antimicrobial
defense. J. Biol. Chem. 2000, 275, 12954–12962. [CrossRef] [PubMed]
237. Mitta, G.; Hubert, F.; Dyrynda, E.A.; Boudry, P.; Roch, P. Mytilin Band MGD2, two antimicrobial peptides of
marine mussels: Gene structure and expression analysis. Dev. Comp. Immunol. 2000, 24, 381–393. [CrossRef]
238. Balseiro, P.; Falco, A.; Romero, A.; Dios, S.; Martinez-Lopez, A.; Figueras, A.; Estepa, A.; Novoa, B. Mytilus
galloprovincialis Myticin C: A chemotactic molecule with antiviral activity and immunoregulatory properties.
PLoS ONE 2011, 6, e23140. [CrossRef] [PubMed]
239. Domeneghetti, S.; Franzoi, M.; Damiano, N.; Norante, R.; El Halfawy, N.M.; Mammi, S.; Marin, O.;
Bellanda, M.; Venier, P. Structural and antimicrobial features of peptides related to Myticin C, a special
defense molecule from the Mediterranean mussel Mytilus galloprovincialis. J. Agric. Food Chem. 2015, 63,
9251–9259. [CrossRef] [PubMed]
240. Novoa, B.; Romero, A.; Alvarez, A.L.; Moreira, R.; Pereiro, P.; Costa, M.M.; Dios, S.; Estepa, A.; Parra, F.;
Figueras, A. Antiviral activity of Myticin C peptide from mussel: An ancient defense against herpesviruses.
J. Virol. 2016, 90, 7692–7702. [CrossRef] [PubMed]
241. Liao, Z.; Wang, X.C.; Liu, H.H.; Fan, M.H.; Sun, J.J.; Shen, W. Molecular characterization of a novel
antimicrobial peptide from Mytilus coruscus. Fish Shellfish Immunol. 2013, 34, 610–616. [CrossRef] [PubMed]
242. Qin, C.L.; Huang, W.; Zhou, S.Q.; Wang, X.C.; Liu, H.H.; Fan, M.H.; Wang, R.X.; Gao, P.; Liao, Z.
Characterization of a novel antimicrobial peptide with chitin-biding domain from Mytilus coruscus.
Fish Shellfish Immunol. 2014, 41, 362–370. [CrossRef] [PubMed]
243. Gerdol, M.; De Moro, G.; Manfrin, C.; Venier, P.; Pallavicini, A. Big defensins and mytimacins, new AMP
families of the Mediterranean mussel Mytilus galloprovincialis. Dev. Comp. Immunol. 2012, 36, 390–399.
[CrossRef] [PubMed]
244. Zhao, J.; Li, C.; Chen, A.; Li, L.; Su, X.; Li, T. Molecular characterization of a novel big defensin from clam
Venerupis philippinarum. PLoS ONE 2010, 5, e13480. [CrossRef] [PubMed]
245. Cheng-Hua, L.; Jian-Min, Z.; Lin-Sheng, S. Molecular characterization and expression of a novel big defensin
(Sb-BDef1) from ark shell, Scapharca broughtonii. Fish Shellfish Immunol. 2012, 33, 1167–1173.
246. Gestal, C.; Costa, M.; Figueras, A.; Novoa, B. Analysis of differentially expressed genes in response to
bacterial stimulation in hemocytes of the carpet-shell clam Ruditapes decussatus: Identification of new
antimicrobial peptides. Gene 2007, 406, 134–143. [CrossRef] [PubMed]
247. Seo, J.K.; Crawford, J.M.; Stone, K.L.; Noga, E.J. Purification of a novel arthropod defensin from the American
oyster, Crassostrea virginica. Biochem. Biophys. Res. Commun. 2005, 338, 1998–2004. [CrossRef] [PubMed]
248. Gueguen, Y.; Herpin, A.; Aumelas, A.; Garnier, J.; Fievet, J.; Escoubas, J.M.; Bulet, P.; Gonzalez, M.; Lelong, C.;
Favrel, P.; et al. Characterization of a defensin from the oyster Crassostrea gigas. Recombinant production,
folding, solution structure, antimicrobial activities, and gene expression. J. Biol. Chem. 2006, 281, 313–323.
[CrossRef] [PubMed]
249. Gonzalez, M.; Gueguen, Y.; Desserre, G.; de Lorgeril, J.; Romestand, B.; Bachere, E. Molecular characterization
of two isoforms of defensin from hemocytes of the oyster Crassostrea gigas. Dev. Comp. Immunol. 2007, 31,
332–339. [CrossRef] [PubMed]
250. Li, C.; Zhao, J.-M.; Song, L.-S. A review of advances in research on marine molluscan antimicrobial peptides
and their potential application in aquaculture. Molluscan Res. 2009, 29, 17–26.
251. Gueguen, Y.; Bernard, R.; Julie, F.; Paulina, S.; Delphine, D.G.; Franck, V.; Philippe, B.; Evelyne, B.
Oyster hemocytes express a proline-rich peptide displaying synergistic antimicrobial activity with a defensin.
Mol. Immunol. 2009, 46, 516–522. [CrossRef] [PubMed]
252. Schmitt, P.; de Lorgeril, J.; Gueguen, Y.; Destoumieux-Garzon, D.; Bachere, E. Expression, tissue localization
and synergy of antimicrobial peptides and proteins in the immune response of the oyster Crassostrea gigas.
Dev. Comp. Immunol. 2012, 37, 363–370. [CrossRef] [PubMed]
253. Zhao, J.; Song, L.; Li, C.; Ni, D.; Wu, L.; Zhu, L.; Wang, H.; Xu, W. Molecular cloning, expression of a big
defensin gene from bay scallop Argopecten irradians and the antimicrobial activity of its recombinant protein.
Mol. Immunol. 2007, 44, 360–368. [CrossRef] [PubMed]
254. Arenas, G.; Guzman, F.; Cardenas, C.; Mercado, L.; Marshall, S.H. A novel antifungal peptide designed from
the primary structure of a natural antimicrobial peptide purified from Argopecten purpuratus hemocytes.
Peptides 2009, 30, 1405–1411. [CrossRef] [PubMed]
461
Mar. Drugs 2017, 15, 182
255. Galdiero, S.; Falanga, A.; Berisio, R.; Grieco, P.; Morelli, G.; Galdiero, M. Antimicrobial peptides as an
opportunity against bacterial diseases. Curr. Med. Chem. 2015, 22, 1665–1677. [CrossRef] [PubMed]
256. Cheung, R.C.; Ng, T.B.; Wong, J.H. Marine peptides: Bioactivities and applications. Mar. Drugs 2015, 13,
4006–4043. [CrossRef] [PubMed]
257. Sapkota, A.; Sapkota, A.R.; Kucharski, M.; Burke, J.; McKenzie, S.; Walker, P.; Lawrence, R.
Aquaculture practices and potential human health risks: Current knowledge and future priorities. Environ.
Int. 2008, 34, 1215–1226. [CrossRef] [PubMed]
258. Wain, L.V.; Shrine, N.; Miller, S.; Jackson, V.E.; Ntalla, I.; Soler Artigas, M.; Billington, C.K.; Kheirallah, A.K.;
Allen, R.; Cook, J.P.; et al. Novel insights into the genetics of smoking behaviour, lung function, and chronic
obstructive pulmonary disease (UK BiLEVE): A genetic association study in UK Biobank. Lancet Respir. Med.
2015, 3, 769–781. [CrossRef]
259. Barton, M.D.; Ndi, O.L. Can we feel it in our waters? Antimicrobials in aquaculture. Med. J. Aust. 2012, 197,
487. [CrossRef] [PubMed]
260. Cabello, F.C.; Godfrey, H.P.; Tomova, A.; Ivanova, L.; Dolz, H.; Millanao, A.; Buschmann, A.H.
Antimicrobial use in aquaculture re-examined: Its relevance to antimicrobial resistance and to animal
and human health. Environ. Microbiol. 2013, 15, 1917–1942. [CrossRef] [PubMed]
261. Aarestrup, F.M.; Agerso, Y.; Gerner-Smidt, P.; Madsen, M.; Jensen, L.B. Comparison of antimicrobial
resistance phenotypes and resistance genes in Enterococcus faecalis and Enterococcus faecium from humans in
the community, broilers, and pigs in denmark. Diagn. Microbiol. Infect. Dis. 2000, 37, 127–137. [CrossRef]
262. Nikaido, H. Multidrug resistance in bacteria. Annu. Rev. Biochem. 2009, 78, 119–146. [CrossRef] [PubMed]
263. Buschmann, A.H.; Tomova, A.; Lopez, A.; Maldonado, M.A.; Henriquez, L.A.; Ivanova, L.; Moy, F.;
Godfrey, H.P.; Cabello, F.C. Salmon aquaculture and antimicrobial resistance in the marine environment.
PLoS ONE 2012, 7, e42724. [CrossRef] [PubMed]
264. Avan, I.; Hall, C.D.; Katritzky, A.R. Peptidomimetics via modifications of amino acids and peptide bonds.
Chem. Soc. Rev. 2014, 43, 3575–3594. [CrossRef] [PubMed]
265. Qvit, N.; Rubin, S.J.; Urban, T.J.; Mochly-Rosen, D.; Gross, E.R. Peptidomimetic therapeutics:
Scientific approaches and opportunities. Drug Discov. Today 2017, 22, 454–462. [CrossRef] [PubMed]
266. Danial, M.; van Dulmen, T.H.; Aleksandrowicz, J.; Potgens, A.J.; Klok, H.A. Site-specific PEGylation of HR2
peptides: Effects of PEG conjugation position and chain length on HIV-1 membrane fusion inhibition and
proteolytic degradation. Bioconjug. Chem. 2012, 23, 1648–1660. [CrossRef] [PubMed]
267. Papo, N.; Oren, Z.; Pag, U.; Sahl, H.G.; Shai, Y. The consequence of sequence alteration of an amphipathic
alpha-helical antimicrobial peptide and its diastereomers. J. Biol. Chem. 2002, 277, 33913–33921. [CrossRef]
[PubMed]
268. Mojsoska, B.; Jenssen, H. Peptides and peptidomimetics for antimicrobial drug design. Pharmaceuticals (Basel)
2015, 8, 366–415. [CrossRef] [PubMed]
269. Cantisani, M.; Finamore, E.; Mignogna, E.; Falanga, A.; Nicoletti, G.F.; Pedone, C.; Morelli, G.; Leone, M.;
Galdiero, M.; Galdiero, S. Structural insights into and activity analysis of the antimicrobial peptide myxinidin.
Antimicrob. Agents Chemother. 2014, 58, 5280–5290. [CrossRef] [PubMed]
270. Cantisani, M.; Leone, M.; Mignogna, E.; Kampanaraki, K.; Falanga, A.; Morelli, G.; Galdiero, M.; Galdiero, S.
Structure-activity relations of myxinidin, an antibacterial peptide derived from the epidermal mucus of
hagfish. Antimicrob. Agents Chemother. 2013, 57, 5665–5673. [CrossRef] [PubMed]
271. Kustanovich, I.; Shalev, D.E.; Mikhlin, M.; Gaidukov, L.; Mor, A. Structural requirements for potent versus
selective cytotoxicity for antimicrobial dermaseptin S4 derivatives. J. Biol. Chem. 2002, 277, 16941–16951.
[CrossRef] [PubMed]
272. Zelezetsky, I.; Pag, U.; Sahl, H.G.; Tossi, A. Tuning the biological properties of amphipathic alpha-helical
antimicrobial peptides: Rational use of minimal amino acid substitutions. Peptides 2005, 26, 2368–2376.
[CrossRef] [PubMed]
273. Wang, G. Post-translational modifications of natural antimicrobial peptides and strategies for peptide
engineering. Curr. Biotechnol. 2012, 1, 72–79. [CrossRef] [PubMed]
462
Mar. Drugs 2017, 15, 182
274. Goldman, M.J.; Anderson, G.M.; Stolzenberg, E.D.; Kari, U.P.; Zasloff, M.; Wilson, J.M.
Human beta-defensin-1 is a salt-sensitive antibiotic in lung that is inactivated in cystic fibrosis. Cell 1997, 88,
553–560. [CrossRef]
275. Fedders, H.; Michalek, M.; Grotzinger, J.; Leippe, M. An exceptional salt-tolerant antimicrobial peptide
derived from a novel gene family of haemocytes of the marine invertebrate Ciona intestinalis. Biochem. J. 2008,
416, 65–75. [CrossRef] [PubMed]
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
463
MDPI AG
St. Alban‐Anlage 66
4052 Basel, Switzerland
Tel. +41 61 683 77 34
Fax +41 61 302 89 18
http://www.mdpi.com
Marine Drugs Editorial Office
E‐mail: marinedrugs@mdpi.com
http://www.mdpi.com/journal/marinedrugs
MDPI AG
St. Alban-Anlage 66
4052 Basel
Switzerland
Tel: +41 61 683 77 34
Fax: +41 61 302 89 18
www.mdpi.com
ISBN 978-3-03842-647-9
Barana Jayawardana