The pathology of pyrethrum yield-decline in Australia Azin Moslemi ORCID identifier 0000-0002-9637-5397 Submitted in total fulfilment of the requirements of the degree of Doctor of Philosophy Faculty of Veterinary and Agricultural Sciences The University of Melbourne September 2017 Declaration I declare that this thesis comprises only my original work towards the degree of Doctor of Philosophy. Due acknowledgement has been made in the text to all other material used. This thesis does not exceed 100,000 words, and complies with the stipulations set out for the degree of Doctor of Philosophy by the University of Melbourne. Azin Moslemi September 2017 I Acknowledgements I would like to express my gratitude appreciation to my supervisor Professor Paul Taylor for his unconditional support during my Ph.D., his immense knowledge in Plant Pathology and patience. I appreciate the effort you made and the time you spared reading and editing my manuscripts. It would not be possible to complete a Ph.D. without your support. I sincerely thank my supervisor Dr. Peter Ades whose advice particularly on statistical analysis of my research helped me understand the significance of the research. I would not be able to publish scientific papers without your guidance. Thanks also to Dr. Marc Nicolas, my supervisor for his positive impact on the research more specifically in glasshouse bioassays. Warmest regards to Professor Pedro Crous for his invaluable contribution in taxonomy and phylogenetic studies of my research and influential assistance in my publications. Besides my supervisors, I would like to thank my committee members Dr. Derek Russell and Dr. Phil Salisbury for their insightful comments and encouragements. I thank the Laboratory Managers Michelle Rhee and Carolyn Selway and, the Laboratory Technical Officer Martin Ji for their continuous support and assistance throughout my Ph.D. A massive thank you to my fellow lab mates Dr. Eden Tongson, Dr. Jiang Chang, Dr. Veradina Dharjono, Dr. Baki Bhuiyan and Dilani De Silva for their support, help and friendship, and for all the hard work and fun we have had for four years. Thanks to Dr. Niloofar Vaghefi for being a great guide and a good friend throughout my Ph.D. My sincere thanks go to Mr. Tim Groom from the Botanical Resources Australia Pty. Ltd. for his motivation and valuable comments which helped me improve the quality of my Ph.D. research. Thanks to Dr. Jason Scott for his contribution to my publication and his insightful comments on some aspects of my Ph.D. project. II I also thank Dr. Lorenzo Lombard for his influential advice on PCR amplification of Fusarium and Paraphoma. I gratefully thank the financial support provided by the Botanical Resources Australia Pty. Ltd., Melbourne International Research Scholarship (MIRS) and Melbourne International Fee Remission Scholarship (MIFRS) awarded by the University of Melbourne. Last but not the least I appreciate my family’s continuous support. My kind, supportive and patient parents Mina and Mehdi, and my gorgeous brothers and friends Arash and Ashkan who spiritually supported me during my Ph.D. and my life in general. III Abstract The association of biotic and abiotic stresses with pyrethrum yield-decline has been reported for more than a decade. Although, many pathogens have been isolated from different tissues of yield-decline affected plants, very few of these pathogens have been shown to cause serious diseases of pyrethrum. A few studies have actually shown a relationship between specific pathogens and abiotic stress factors that may be involved in yield-decline of pyrethrum. As well, the effect of biotic stresses on the plant may mask the symptoms of the pathogens that are infecting plants and causing diseases. In this thesis, several new fungal pathogens of pyrethrum were isolated from yielddecline affected plants in fields in northern Tasmania and Ballarat in Victoria, Australia. These were identified as causing diseases of pyrethrum. Symptoms of yield-decline were redefined as discoloured crown tissues, suppressed growth of the affected plants, weak root system and necrotic leaf lesions. Three new species of Paraphoma were identified based on morphological characters, multigene phylogenetic analyses and pathogenicity trials in the glasshouse. Paraphoma vinacea was described as a new species and shown to cause crown rot of pyrethrum. Pathogenicity trials resulted in significant below-ground and total biomass growth reduction, and the production of red-brown crown discolouration which is a typical symptom of field plants affected by yield-decline. Two new Paraphoma species isolated from necrotic leaf lesions from plants growing in the fields in northern Tasmania were taxonomically described as P. chlamydocopiosa and P. pye. Pathogenicity trials showed that both new species infected leaves, upper roots and crown tissues, and caused significant reduction of above-ground, belowground and total biomass of pyrethrum plants. Fusarium species were isolated from roots, crowns and basal petioles of infected pyrethrum plants in yield-decline affected fields of northern Tasmania. Multigene phylogenetic analyses identified F. oxysporum and F. avenaceum which were the most frequently isolated species associated with crown discolouration of the yield-decline affected pyrethrum plants. The pathogenicity of these two Fusarium species was IV confirmed in glasshouse bioassays with significant below-ground and total biomass reduction 2 months after inoculation. Although both species infected roots and crown tissues causing crown rot, F. oxysporum was more pathogenic than F. avenaceum. Additionally, sample collections from a wide range of geographical locations in Tasmania and Ballarat showed a high association of F. oxysporum and F. avenaceum with yield-decline of pyrethrum. Alternaria infectoria and Stemphylium herbarum were also identified as new leaf pathogens of pyrethrum plants causing necrotic leaf lesions. These were initially identified from pseudothecia that formed at the base of dead flower stems. Both were able to reproduce the same symptoms in in vivo and in vitro tests, therefore were identified as pathogens of pyrethrum. These foliar pathogens may also be part of the complex of pathogens that cause yield-decline of pyrethrum. Waterlogging is an important environmental stress and a 4-day waterlogging treatment had a significant effect on growth of plants inoculated with F. oxysporum, F. avenaceum and P. vinacea. The incidence of infection of crown, basal petioles and roots was similar in both waterlogged and non-waterlogged treatments. The interaction between waterlogging and each pathogen treatment resulted in significant below-ground dry weight reductions 2 months after waterlogging for all three pathogens. The growth reduction caused by F. oxysporum and P. vinacea was more severe than by F. avenaceum. However, 6 months after the waterlogging treatment there was no significant effect by pathogens nor an interaction between pathogens and waterlogging on flower production, although waterlogging alone significantly reduced flower production. Improved identification of the pathogens of pyrethrum in northern Tasmania and ability to identify these pathogens by symptoms will be extremely important in monitoring disease incidence in the field specifically as the prominence of each pathogen may fluctuate over time with changes in environmental conditions. Therefore, accurate identification of the newly emerged pathogens and their interaction with abiotic stresses will help in the implementation of integrated disease management practices to reduce the effect of yield-decline in pyrethrum production. V Table of Contents Declaration………………………………………………………………………………I Acknowledgements………………………………………………..…………………...II Abstract……………………………………………………………..………………....IV Table of Contents…...…………………………………………….…………….…….VI List of tables………...……………………………………………….……...…….…VIX List of figures..…………………………………………...……….………..…….….XIII List of abbreviations...……………………………………………….…..…..…..…XVI Preface………..……………….……………………………………….…….……....XIX Chapter 1 – Introduction………………………………………...…………………….1 Chapter 2 – Review of the literature………………………………………….……….4 2.1. Pyrethrum…………………………..............……………………………………….4 2.1.1. Pyrethrum history…………………………………………………………4 2.1.2. Biology and cropping……………………………………………………..5 2.1.3. Morphology………………………………………………………...……..6 2.1.4. Pyrethrins………………………………………………………………….7 2.1.5. Pyrethrin production in Australia…………………...…………………….8 2.1.6. Limitations to pyrethrum production………………………….…………..8 2.2. Impact of pathogens (biotic stresses)…………………………………………..……9 2.3. Aetiology and taxonomy of Fusarium and Paraphoma diseases……..………...…15 2.3.1. Fusarium…………………………………...…………………………….15 2.3.1.1. Morphology………………………………………………...….17 2.3.1.2. Biogeography and dispersal………………………..…………..20 2.3.1.3. Taxonomy…………………………………….………………..21 2.3.1.4. Phylogeny and molecular identification………………….……22 2.3.2. Paraphoma………………...………………………...…………………..24 2.3.2.1. Morphology……………………………………………………25 2.3.2.2. Hosts………………………………………………………..….28 2.3.2.3. Taxonomy……………………………………………..……….28 2.3.2.4. Phylogeny…………………………………………..………….29 2.4. Impact of environmental factors (abiotic stresses)……………….………………..30 2.5. Pyrethrum yield-decline……………………………………………….…………..33 2.5.1. Symptoms……………………………………….……………………….34 2.5.2. A review of yield-decline of other important crops……………………..34 VI 2.6. Objectives………………………………………………………………………….35 Chapter 3 – General materials and methods…………………………….………….37 3.1. Media preparation……………………………………………...…………………..37 3.2. Single sporing……………………………..……………………………………….39 3.3. Preservation………………………………………………………………….…….39 3.3.1. Short term preservation…………………..………………………...……39 3.3.2. Long term preservation………..…………………………………………40 3.4. DNA extraction and PCR amplification……………………………………….…..40 3.5. Microtome sectioning……………………...………………………………………41 Chapter 4 – Isolation and identification of fungal pathogens from pyrethrum in yield-decline affected fields of northern Tasmania…………………………………43 4.1. Introduction………………………………………………………………………..43 4.2. Materials and methods………………………….………………………………….44 4.2.1. Sample collection………………………………………………………..44 4.2.2. Isolation of fungal pathogens………………………………………..…..47 4.2.3. Identification of fungal pathogens…………………...…………………..47 4.2.3.1. Morphological description……………………………………..47 4.2.3.2. Molecular taxonomy…………………………….……………..48 4.2.4. Glasshouse experiment 1………………………………………...………49 4.2.4.1. Assessment of glasshouse experiment 1…………………….....51 4.2.5. Glasshouse experiment 2………………………………………..……….51 4.3. Results……………………………………………………………….…………….52 4.4. Discussion………………………………………………...………………………..68 4.5. Conclusion…………………………………………………………………………71 Chapter 5 – Alternaria infectoria and Stemphylium herbarum, two new pathogens of pyrethrum (Tanacetum cinerariifolium) in Australia………………………..…..72 5.1. Introduction and aims…………………………………………………………..….72 5.2. Published manuscript………………………………………………………………73 5.3. Corrections to the manuscript…………..……………………………………….....83 Chapter 6 – Paraphoma crown rot of pyrethrum (Tanacetum cinerariifolium)…..84 6.1. Introduction and aims……………………………..……………………………….84 6.2. Published manuscript……………………………………………...……………….85 Chapter 7 – Paraphoma chlamydocopiosa sp. nov. and Paraphoma pye sp. nov., two new species associated with leaf and crown infection of pyrethrum……..………..92 VII 7.1. Introduction and aims………………………………………………..…………….92 7.2. Published manuscript…………………………………………..…………………..93 Chapter 8 – Fusarium oxysporum and Fusarium avenaceum associated with yielddecline of pyrethrum in Australia…………………….…………………………….105 8.1. Introduction and aims……………….……………………………………………105 8.2. Published manuscript……………………………………………………………..106 8.3. Further sample collections in 2013……………………………………………….120 8.4. The mode of infection and colonization of F. oxysporum in pyrethrum…………123 Chapter 9 – Influence of waterlogging on growth of pyrethrum plants infected with crown and root rot pathogens- Fusarium oxysporum, Fusarium avenaceum and Paraphoma vinacea……………………………………..……………………….128 9.1. Introduction……………………………………………………………..………..128 9.2. Materials and methods…………………………………………………..………..129 9.2.1. Waterlogging treatment………….……………………………………..130 9.2.2. Two months after inoculation: incidence of infection and effect of F. oxysporum, F. avenaceum and P. vinacea on growth of inoculated pyrethrum plants…………………………………………………………………………..132 9.2.3. Two months after waterlogging: effect of waterlogging alone and in combination with infection by each of the pathogens on disease incidence, growth and photosynthesis of pyrethrum plants………...…………………….132 9.2.4. Six months after waterlogging: effect of waterlogging alone and in combination with infection by each of the pathogens on disease incidence, growth of pyrethrum plants and on flowering……...…………………………133 9.3. Results……………………………………………………………………………134 9.3.1. Disease incidence…………………………………...………………….134 9.3.2. Stress severity classes of waterlogged plants…………………………..137 9.3.3. Dry weight analyses…………………………………………………….139 9.3.4. Photosynthesis at 2 months after waterlogging………………….……..143 9.4. Discussion………………………………………………….……………………..144 9.5. Conclusion…………………………………………………………………….….146 Chapter 10 – General discussion…………………………………..………………..147 10.1. Fusarium formae specialis identification……………………………………….152 10.2. Interaction of waterlogging with pathogens on growth of pyrethrum….……….153 10.3. Management…………………………………………………………………….154 List of references……………………………………………………………………..157 VIII List of tables Chapter 4 Table 1. Information of pyrethrum plants collected from nine yield-decline affected sites of northern Tasmania Table 2. Species and isolates used for inoculation of plants in glasshouse for both inoculation methods Table 3. Isolates from leaf, petiole, crown and root of pyrethrum plants of northern Tasmania identified based on morphological and ITS gene sequencing Table 4. Fusarium isolates from different pyrethrum plant tissues in yield decline affected fields of northern Tasmania Table 5. List of isolates with related strain numbers for ITS gene sequencing Table 6. Isolates identified on different plant tissues after three different inoculation methods Table 7. A comparison of the dry weight of pyrethrum plants inoculated with 4 different isolates of Fusarium oxysporum, Fusarium avenaceum, Fusarium equiseti, Plectospherella cucumerina Chapter 5 Published manuscript Table 1. Morphological features of Alternaria infectoria and Stemphylium herbarum Table 2. List of isolates used for multigene phylogenetic analyses VIX Chapter 6 Published manuscript Table 1. Isolates used in multigene phylogenetic analyses of Paraphoma vinacea Table 2. Dry weight analyses of pants root-dip inoculated with P. vinacea using least significant difference of the means (LSD) Chapter 7 Published manuscript Table 1. Information of the location in Tasmania (Australia), field code, collectors and dates in which new Paraphoma isolates from pyrethrum (Tanacetum cinerariifolium) used in this study were recovered Table 2. List of isolates used for multigene phylogenetic analyses of Paraphoma chlamydocopiosa and Paraphoma pye Table 3. Disease incidence caused by P. chlamydocopiosa, P. pye and P. vinacea for 10 plants in two separate glasshouse experiments Table 4. Effect of P. chlamydocopiosa, P. pye and P. vinacea on growth of the root-dip inoculated pyrethrum plants in a combined analysis Chapter 8 Published manuscript Table 1. Information of nine yield-decline affected fields in which Fusarium spp. were isolated from different tissues of the diseased plants in June 2014 from Tasmania Table 2. Information of three yield-decline affected fields in northern Tasmania in January 2015 and the infected tissues X Table 3. Information of two separate sample collections (three fields each time) from the yield-decline affected fields in Ballarat, Victoria in September 2015 and February 2016 Table 4. List of isolates used for multigene phylogenetic analyses of Fusarium spp. Table 5. Morphological features of F. oxysporum and F. avenaceum Table 6. The effect of F. oxysporum and F. avenaceum on below-ground, above-ground and total biomass of the root-dip inoculated plants using combined analysis Table 7. Isolation of pathogens from crown, root, petiole and leaf tissues from a sample collection in September 2016 from pyrethrum yield-decline affected fields of Burnie, northern Tasmania Chapter 9 Table 1. Post-waterlogging stress severity class of plants inoculated with Fusarium oxsyporum, Fusarium avenaceum, and Paraphoma vinacea, 7 days after waterlogging Table 2. Number of infected plants two months after inoculation (2 mai) with Fusarium oxysporum, Fusarium avencaeum and Paraphoma vinacea per 10 replicates Table 3. Disease incidence two months after inoculation (2 mai), 2 months after waterlogging (2 maw) and 6 months after waterlogging (6 maw) for plants inoculated with Fusarium oxysporum, Fusarium avenaceum and Paraphoma vinacea Table 4. The relative stress severity scores of plants inoculated with Fusarium oxysporum, Fusarium avenaceum, and Paraphoma vinacea, 7 days after waterlogging XI Table 5. Effect of water logging on the number of pyrethrum flowers, flower stems, basal petioles and leaves (green and yellow), 6 months after waterlogging Table 6. The effect of waterlogging on dry weights of pyrethrum plants infected with Fusarium oxysporum, Fusarium avencaeum and Paraphoma vinacea, before waterlogging (0 bw), 2 months after waterlogging (2 maw) and 6 months after waterlogging (6 maw) Table 7. The effect of waterlogging on photosynthesis of the plants inoculated with Fusarium oxysporum, Fusarium avenaceum and Paraphoma vinacea, 2 months after waterlogging Chapter 10 Table 1. Fungal pathogens associated with yield-decline affected pyrethrum plants XII List of figures Chapter 2 Fig.1. Pale Refined Pyrethrin, a yellow substance with oily consistency and weak flower odour Fig.2. Identification of Fusarium species based on spore shape. A-D Macroconidia Fig.3. Fusarium venenatum colony morphology and microscopic features Fig.4. Microscopic characters of Paraphoma radicina Fig.5. The effect of environmental stresses, hump and hollows and frost on growth of pyrethrum in yield-decline affected fields of northern Tasmania Fig.6. A comparison between a terminated pyrethrum site after the second harvesting season and an acceptable regrowth of pyrethrum after first harvest Chapter 4 Fig.1. Symptoms associated with yield-decline of pyrethrum in the fields of northern Tasmania Fig.2. Various colony morphologies of isolates recovered from pyrethrum in yield-decline affected sites Fig.3. Maximum parsimony phylogenetic tree constructed for four Fusarium species complexes using sequences of ITS region Fig.4. Maximum Likelihood phylogenetic tree of ITS for Plectosphaerella spp. Fig.5. Maximum Likelihood phylogenetic tree of ITS for Bionectria spp. Fig.6. Maximum Likelihood phylogenetic tree of ITS for Rhizoctonia spp. XIII Chapter 5 Published manuscript Fig.1. Pseudothecia at the base of the dead pyrethrum flower stem Fig.2. Alternaria infectoria morphological features Fig.3. Stemphylium herbarum morphological features Fig.4. Combined maximum likelihood phylogenetic tree of ITS-EF1-RPB2GAPDH generated for species of A. infectoria and S. herbarum Fig.5. Combined maximum likelihood phylogenetic tree of ITS-EF1-GAPDH generated for specifically species of S. herbarum Fig.6a and 6b. Symptoms caused by A. infectoria and S. herbarum on the plants in vivo and in vitro Chapter 6 Published manuscript Fig.1. Morphological features of Paraphoma vinacea Fig.2. Maximum likelihood phylogenetic tree of ITS-LSU generated for the species of Paraphoma vinacea Fig.3. Maximum likelihood phylogenetic tree of ITS-EF1-TUB generated for the species of Paraphoma to differentiate P. vinacea from the type and ex-neotype species Chapter 7 Published manuscript Fig.1. Maximum likelihood combined phylogenetic tree of ITS-EF1-TUB generated for the two new species of Paraphoma, P. chlamydocopiosa and P. pye XIV Fig.2. Morphological features of P. chamydocopiosa Fig.3. Morphological features of P. pye Fig.4. Symptoms caused by P. chlamydocopiosa in vivo and in vitro Fig.5. Symptoms caused by P. pye in vivo and in vitro Chapter 8 Published manuscript Fig.1. Maximum parsimony phylogenetic tree of combined ITS-EF1-RPB2 generated for the species of Fusarium in four different species complexes Fig.2. Symptoms of yield-decline in pyrethrum plant in northern Tasmania, September 2016 Fig.3. Transverse and longitudinal microtome sections obtained from root and crown tissues infected with F. oxysporum two months after inoculation using quadruple staining method Chapter 9 Fig.1. O₂ concentration (mg/L) measured for 20 plants per treatment from day 0 to 3 Fig.2. Symptoms cause by waterlogging, 7 days after waterlogging Fig.3. Interaction plots showing significant interaction between waterlogging and each pathogen treatment, before waterlogging (0 bw), 2 months after waterlogging (2 maw) and 6 months after waterlogging (6 maw) in the waterlogged and non-waterlogged plots XV List of abbreviations Acl1 ATP citrate lase ACT Actin AFLP Amplified fragment length polymorphism AGRF Australian Genome Research Facility AIC Akaike information criterion ai Active ingredient AMF Arbascular michorhizal fungi BIC Bayesian information criterion BOC British Oxygen Company BRA Botanical Resources Australia Pty. Ltd. BRIP Queensland Plant Pathology herbarium CAL Calmadulin CBS Centraalbureau voor Schimmelcultures fungal collection CHA Cherry decoction agar CI Consistency index CLA Carnation leaf agar CSIRO Commonwealth Scientific Industrial Research Organisation diam Diameter df Degree of freedom FAA Formaldehyde acetic acid EF1 Translation elongation factor 1-α ELISA Enzyme linked immunosorbent assay EPAA Ethanol potassium amoxicillin agar FIEFC Fusarium incarnatum-equiseti species complex FOSC Fusarium oxysporum species complex FRC Fusarium research centre FTSC Fusarium triticinum species complex FSAMSC Fusarium sambucinum species complex GAPDH Glyceraldehyde-3-phosphate dehydrogenase XVI GIS Commonwealth Industrial Gases Ltd ITS Internal transcribed spacer of nrDNA LSD Least significant difference LSU Large subunit of nrDNA maw Month after waterlogging mai Months after inoculation MEA Malt extract agar ML Maximum likelihood MLST Multi locus sequence typing NCBI National Centre of Biotechnology Information NJ Neighbour-joining NRRL Agricultural Research Service Culture Collection OA Oatmeal agar nrDNA Nuclear ribosomal DNA PCR Polymerase chain reaction PDA Potato dextrose agar RAPD Random amplified polymorphic DNA REML Residual maximum likelihood RFLP Restriction fragment length polymorphism RI Retention index RO Reverse osmosis RPB2 Second largest subunit SD Standard deviation SNA Synthetic nutrient-poor agar SPR Subtree pruning regrafting SSR Single sequence repeat SSU Small subunit 18S nrDNA TAS Tasmanian Institute of Agriculture Fungal Collection TBA Tertiary butyl alcohol TFC Terminal Fusarium clade XVII TUB2 Beta tubulin 2 UOM University of Melbourne fungal collection UT University of Tasmania UTAS University of Tasmania VCG Vegetative compatibility group WA Water agar XVIII Preface Publications from this thesis International peer-reviewed papers: Moslemi A, Ades PK, Groom T, Nicolas ME, Scott JB, Crous WP and Taylor PWJ (2017). Paraphoma chlamydocopiosa sp. nov. and Paraphoma pye sp. nov., two new species associated with leaf and crown infection of pyrethrum. Plant Pathology Doi: 10.1111/ppa.12719. Moslemi A, Ades PK, Groom T, Nicolas ME and Taylor PWJ (2017). Fusarium oxysporum and Fusarium avenaceum associated with yield-decline of pyrethrum in Australia. European Journal of Plant Pathology 149 (1), 43-56. Moslemi A, Ades PK, Groom T, Nicolas ME and Taylor PWJ (2017). Alternaria infectoria and Stemphylium herbarum, two new pathogens of pyrethrum (Tanacetum cinerariifolium) in Australia. Australasian Plant Pathology 46(1):91-101. Moslemi A, Ades PK, Groom T, Crous PW, Nicolas ME and Taylor PWJ (2016). Paraphoma crown rot of pyrethrum (Tanacetum cinerariifolium). Plant Disease 100(12):2363-69. XIX Conference proceedings: Moslemi A, Ades PK, Nicolas ME, Taylor PWJ. 22nd November 2016. Pyrethrum Pathology Forum, University of Melbourne, Faculty of Veterinary and Agricultural Sciences (FVAS). Oral presentation. Fusarium Laboratory Workshop; 29th May- 3rd June 2016. Forestry and Agriculture Biotechnology Institute (FABI), University of Pretoria, South Africa. Moslemi A, Ades PK, Nicolas ME, Taylor PWJ. 20th January 2016. Pyrethrum yield decline in Tasmania. Horticulture showcase. The University of Melbourne, Faculty of Veterinary and Agricultural Sciences (FVAS). Oral presentation. Moslemi A, Ades PK, Groom T, Nicolas ME, Taylor PWJ. 3-4 th December 2015. The role of fungal pathogens in pyrethrum yield decline. Postgraduate symposium, The University of Melbourne, Faculty of Vet and Agricultural Sciences (FVAS). Oral presentation. Moslemi A, Groom T, Ades PK, Nicolas ME and Taylor PWJ. 14-16th September 2015. Identification of pathogens associated with pyrethrum yield decline in northern Tasmania. Australian Plant Pathology Society (APPS) conference, Perth. Poster presentation. Moslemi A, Ades PK, Nicolas ME and Taylor PWJ. 10-13th November 2014. Slow Plant Loss After Single Harvest (SPLASH) syndrome on pyrethrum plants of northern Tasmania. 8th Australian Soil-borne Diseases Symposium (ASDS), Tasmania. Oral presentation. Moslemi A, Ades PK, Nicolas ME and Taylor PWJ. 5th November 2014. Slow Plant Loss After Single Harvest (SPLASH) syndrome on pyrethrum plants of northern Tasmania. Workshop on taxonomy and pathogenicity of fungal plant pathogens –the University of Melbourne. Oral presentation. XX Chapter 1: Introduction Chapter 1 Introduction Pyrethrum (Tanacetum cinerariifolium) Sch. Bip. is a perennial and herbaceous plant in the Asteraceae, which has been widely used for production of natural pyrethrin insecticides (Casida and Quistad 1995). More than 70% of the world pyrethrum production (3000 ha) occurs in northern Tasmania and the Ballarat region of Victoria, Australia (Hay et al. 2015) where the cool and humid environmental conditions induce flowers to produce pyrethrins (Glover 1955). These environmental conditions are also conducive to infection by fungal pathogens which are a threat to the sustainability of the pyrethrum industry (Pethybridge et al. 2004). This thesis is focused on yield-decline of pyrethrum in the fields of northern Tasmania and Ballarat which has become an important limitation to production over the last 10 years. The cause of yield-decline is unknown however, Pethybridge et al. (2010), reported that the problem was most likely due to a combined effect of physiological, environmental and biological factors that affected the growth of pyrethrum plants in specific fields. In the past, disease surveys mostly concentrated on foliar diseases of pyrethrum and not on soil-borne diseases associated with pyrethrum growth. Although, Hay et al. (2012) isolated several soil-borne pathogens such as Verticillium dahliae, Rhizoctonia solani, Phytohpthora spp., Fusarium solani, Pratylenchus spp. and Meloidogyne spp. nematodes from plants during field surveys, the pathogenicity of these fungal and nematode species was not determined. Therefore, in this thesis, prevalent soil-borne fungal pathogens associated with pyrethrum yield-decline were isolated, identified and their pathogenicity assessed. The second chapter is a review of the literature with a general introduction about the pyrethrum plant and its industrial importance, abiotic and biotic limitations to pyrethrum production which threaten pyrethrum health, particularly fungal pathogens and environmental stress, and a review of the aetiology and taxonomy of Paraphoma and Fusarium, two important soil-borne pathogens. The chapter concludes with an overview of the current understanding of pyrethrum yield-decline. 1 Chapter 1: Introduction The third chapter describes the common methods used in the research such as media preparation, short and long-term isolate preservation techniques, establishment of fungal cultures for single sporing, histopathology and molecular methods for fungal identification such as DNA extraction and PCR amplifications. Chapter 4 lists details of fungal isolates cultured from nine yield-decline affected fields in northern Tasmania. Identification of frequently isolated fungal species was made using morphological characters and DNA analysis based on internal transcribed spacer (ITS) region. Plant material especially crown and root tissue growing in the soil is often colonised by many different fungal species which makes it difficult to distinguish pathogens from endophytes, saprophytes and opportunistic fungi. Thus, all frequently isolated fungal species were tested for pathogenicity in glasshouse trials. Chapter 5 taxonomically describes the identification of two new pathogens Alternaria infectoria and Stemphylium herbarum identified from pseudothecia that were recovered from the base of dead pyrethrum flower stems of plants affected by yield-decline. The pathogenicity of these was also demonstrated in glasshouse trials. Chapter 6 taxonomically describes Paraphoma vinacea inoculated from discoloured crown tissue of affected plants while Chapter 7 describes two further new species of pathogenic Paraphoma, P. chlamydocopiosa and P. pye, isolated from necrotic pyrethrum leaf lesions. The pathogenicity of these was also shown in glasshouse bioassays. The role of the Paraphoma complex in pyrethrum pathology is discussed. Chapter 8 focuses on the Fusarium spp. isolated from infected crown and roots of pyrethrum plants and describes F. oxysporum and F. avenaceum as important soil-borne pathogens of pyrethrum. Pathogenicity of F. oxysporum, F. avenaceum, F. equiseti and F. venenatum is assessed, using multiple pathogenicity tests and species identified by molecular identification using multigene phylogenetic studies. Very little is known about the interaction between fungal pathogens of pyrethrum and abiotic stresses and the effect that these have on growth and yield. Groom (2014) reported that waterlogging was an important environmental stress in pyrethrum fields of northern Tasmania. Javid et al. (2013) showed that waterlogging of pyrethrum had significant effect on root and shoot dry weights and the number of flower stems of ray 2 Chapter 1: Introduction blight infected pyrethrum plants. Chapter 9 identifies the importance of waterlogging alone and in combination with F. oxysporum, F. avenaceum and P. vinacea on the growth of pyrethrum plants in glasshouse trials. The thesis research chapters are then discussed in relationship to the overall aims of the project in a final discussion. 3 Chapter 2: Litereture review Chapter 2 Review of the Literature 2.1. Pyrethrum Pyrethrum, (Tanacetum cinerariifolium (Trevir.) Sch. Bip. = Tanacetum cinerariifolium Sch. Bip. (IPNI 2016), syn. Pyrethrum cinerariifolium Trev. ≡ Chrysanthemum cinerariifolium (Trev.) Vis.) (Greenhill 2007), is an herbaceous perennial plant in the Asteraceae (ex Compositae), which have been widely used for production of natural pyrethrins derived from the achenes of the mature pyrethrum flowers (Casida and Quistad 1995; Grdisa et al. 2009). The word ‘pyrethrum’ has been solely attributed to Tanacetum cinerariifolium or Dalmatian pyrethrum as it is the only species which is commercially used for insecticidal purposes, although, other members of the genus such as T. coccineum (Persian pyrethrum), T. carneum (= C. carneum) and T. roseum (= C. roseum) also contain pyrethrins (Greenhill 2007; West 1959). Hence, the word pyrethrum used in this thesis particularly refers to T. cinerariifolium (Dalmatian pyrethrum). 2.1.1. Pyrethrum history Pyrethrum insect powders, were widely used by soldiers in armies against hair and body lice between mid-18th to early 19th centuries (BRA 2014; West 1959). For many years, Dalmatia (previously a section of Yugoslavia), was the biggest producer of T. cinerariifoilum and this continued until World War I, when Japan took over the production of pyrethrum in 1918 (Greenhill 2007). Japan remained the main source of pyrethrum production until 1940 after which Kenya became the dominant world supplier of T. cinerariifolium (Greenhill 2007; Hitmi et al. 2000; West 1959). Other East African countries such as Rwanda, Tanzania and Uganda also had significant roles in pyrethrum production in Africa and produced considerable amounts of pyrethrum over time (Greenhill 2007). Gnadinger (1936), reported other countries including European countries (Albania, Bulgaria, Cyprus, France, Greece, Italy, Spain, Switzerland, Sweden, Turkey and Russia), Asian and Western Asia (Iran, China, Philippines and India) and South America (Bolivia, Brazil, Chile, Equator, Mexico and Peru) as other pyrethrum producers and retailers around the world however, production was not sustainable in these countries due to unfavourable environmental conditions. 4 Chapter 2: Litereture review Pyrethrum production in Africa also declined in part due to time-consuming and laborious action of hand-picking of the flower heads (up to 14 pickings per annum as pyrethrum cultivars in Africa flower asynchronously) and lack of environmental conditions such as long day lights and cool temperatures required for pyrethrum growth in some pyrethrum production regions (Cotching 2012; Glover 1955). Moreover, with the introduction of synthetic pyrethroids, pyrethrum production decreased in East Africa (Greenhill 2007). However, Africa is still one of the major countries of pyrethrum production. Today, Australia, East Africa and China are important pyrethrum suppliers worldwide with Australia as the major supplier globally (Greenhill 2007; Pethybridge et al. 2008d) 2.1.2. Biology and cropping In Australia, fields are planted with pyrethrum seed from July to September. First harvest occurs in December and January of the following year (15 to 17 months after planting). Thereafter, harvests are implemented annually at the same time. The plant is semi dormant from the emergence of the first spring until the following spring. This means that a pyrethrum plant is not ready for harvest for almost two subsequent years (Greenhill 2007). Every spring thereafter, plants produce multiple stems in response to increasing day length, reaching the maximum height of approximately 1-1.5 m within 12 weeks (Pethybridge et al. 2008d). Effective management of weeds with herbicides, top dressing with fertilizers, intensive overhead irrigation during flowering and disease management with fungicides are factors that affect agronomic performance of pyrethrum plants (Pethybridge et al. 2008d). Weed management is carried out in spring, from September to November (Greenhill 2007). Plants are harvested mechanically by swathing the crop (flowers and stems) into windrows (~ 7 days) for drying followed by mechanically harvesting the flower heads and achenes using specialized equipment. After all these steps, flowers are transferred to the processing factory in Burnie in Tasmania for pelletizing and pyrethrin extraction (Pethybridge et al. 2008d). A pyrethrum plant can be harvested three to four harvesting seasons (Hay et al. 2015; Pethybridge et al. 2008d) and after the fourth harvest the crop is terminated. The fields are then placed into rotation with vegetable crops such as potatoes, onions, carrots, brassicas or poppies (Greenhill 2007). 5 Chapter 2: Litereture review In Kenya however, pyrethrum is grown in the fields either by planting the seedlings and plantlets which are segregated from the mother plants by seed sown in autumn (Greenhill 2007; Pethybridge et al. 2008d). Plants that emerge from seed can flower one year after seeding, while those grown from the seedlings produce flowers in a threemonth period (Pethybridge et al. 2008d). To extract pyrethrin, flower heads are soaked in hexane to obtain the concentrated dark oil ‘oleoresin’. Oleoresin (a crude extract containing waxes, chlorophyll and oils from flowers) is then refined with active carbon (used to decolour the oil) using carbon dioxide refining technique to produce “Pale Refined Pyrethrins”, a yellow viscous liquid which is exported (Kiriamiti et al. 2003; Tóth et al. 2012). Fig.1. Pale Refined Pyrethrin, a yellow substance with oily consistency and weak flower odour; A unfiltered; B filtered. Image was taken by T. Groom, BRA 2014 2.1.3. Morphology A pyrethrum plant grows to a height of 1-1.5 m (Brown and Menary 1994). Single flowers grow at the end of the branched flower stems and consist of two types of florets; 40 to 100 bisexual, yellow disk florets (small tubular flowers in the centre of the flower head) in the centre surrounded by a ring of white ray florets (long strap-shaped flowers) attached to convex receptacles (the enlarged tip of the flower head which bears the 6 Chapter 2: Litereture review florets) by a tubular corolla (petals). Short stalk stamens are located inside the enveloped corolla. White petals terminate with three teeth. The corolla is connected to the ovary by calyx (sepals). The ovary is pentagonal and has a single ovule inside. Leaves are narrow and alternate (the arrangement of the leaves are opposite on petioles) possessing many grandular trichomes (small hairs on the surface of the plant produced by epidermal cell divisions) on the surface. Cauline leaves (small leaves arising from the upper part of the petioles and usually smaller than the foliage leaves) are produced by young shoots (petioles). There are three to 10 achenes (small, one-seeded and indehiscent dry fruit) between the floret and receptacle related to disk and ray florets. Oil glands containing pyrethrins, are located on the surface of the achenes. Bracts (leaflike structures usually smaller than the foliage leaves) are in three rows and the thickness of involucres (a ring of bracts at the base of an inflorescence) is generally between 12 to 18 mm (Grdisa et al. 2009; Greenhill 2007; Pethybridge et al. 2008d). 2.1.4. Pyrethrins Pyrethrum plants have active insecticidal materials, pyrethrins, and the name of the plant applies to the flower head or flower extract (Ambrozic et al. 2007). The pyrethrins are produced by esterification of two acids, chrysanthemic acid and pyrethric acid, with ketone alcohols pyrethrolone, cinerolone and jasmoline (Hitmi et al. 2000). The glandular trichomes on the surface of the mature achenes are believed to be associated with pyrethrin production as the key biosynthetic enzyme, chrysanthemyl diphosphate synthase is only expressed in trichomes. However, no evidence exist on the production of pyrethrins by trichomes (Ramirez et al. 2012). Pyrethrins contain six closely related esters including pyrethrin I, cinerin I and jasmolin I collectively called “Pyrethrins I”; and pyrethrin II, cinerin II and jasmolin II collectively called “Pyrethrins II” (Casida 1973; Suraweera et al. 2015a). Pyrethrins also exist in other genera of the Asteraceae, such as Calendula sp., Chrysanthemum sp. and Tagetes sp. (Ambrozic et al. 2007). The most important advantages of pyrethrins compared to pyrethroids which are produced synthetically are rapid degradation and low toxicity for humans and other mammals, effectiveness at low dosages on a wide range of domestic and public health insects, repellent and the lack of bioaccumulation in food chains and ground water (Ambrozic et al. 2007). Hitmi et al. 7 Chapter 2: Litereture review (2000) reported that ‘Pyrethrins I’ had knock-down effect while, ‘Pyrethrins II’ had better kill effect, however, content of the pyrethrins in pyrethrum plants depended on climate, harvesting intervals, plants genotype, age and drying methods. At least 94% of the pyrethrins are produced in the oil glands of flowers which contained on average 1.8-2.5% pyrethrins and in lower percentages in leaves, stems and roots (Morris et al. 2006; Pethybridge et al. 2008d). 2.1.5. Pyrethrum production in Australia Pyrethrum production in Australia was first reported in 1895 by Baron von Mueller, the director of Melbourne Botanical Gardens (Casida and Quistad 1995). He reported that the first commercial growth of pyrethrum occurred in 1890 in the Lower Latrobe River, Victoria, Australia. Later, in 1930-1, Commonwealth Scientific Industrial Research Organisation (CSIRO) introduced four different strains of pyrethrum to Australia from England, Switzerland, Japan and the United States, which were planted in Black Mountain, Canberra. Pyrethrum was also planted in two other Australian States, New South Wales between 1932-5 and Tasmania from 1941 to 1944 (MacDonald 1995). However, major pyrethrum production in Australia only occurred in 1981. In 1981, Commonwealth Industrial Gases Ltd (GIC) (a subsidiary of the British Oxygen Company) (BOC), began to develop the pyrethrum industry in Tasmania into a commercial proposition and continued the industrial development of pyrethrum for 15 years. In 1996, Botanical Resources Australia Pty Ltd- Agricultural Services (BRA) was formed by a staff of BOC. By 2011, 4000 hectares of northern Tasmanian fields were in pyrethrum cultivation. In 2009, world demand for natural pyrethrins enabled BRA to become the main producer of pyrethrum around the world. Pyrethrum production was expanded into the Ballarat region of Victoria and in 2010, 575 hectares of Ballarat fields were in pyrethrum cultivation (BRA 2014). 2.1.6. Limitations to pyrethrum production Ideally, under the intensive production system of pyrethrum in Australia, pyrethrum fields should persist for at least three harvests (Hay et al. 2015). However, yield-decline occurs resulting in the premature termination of a significant proportion of the crop 8 Chapter 2: Litereture review which has been often reported, to be as high as almost 30% of fields, annually (Pethybridge et al. 2008d). Yield-decline is defined as an integration of factors resulting in reduced probability of plant survival, leading to significant decreases in stand density, and gradual reductions in vigour of the plants that do survive (Pethybridge et al. 2008d). Poor persistence of plants is likely to be attributed to an interaction of both biotic and abiotic factors. 2.2. Impact of pathogens (biotic stresses) Previous studies attempting to improve persistence of pyrethrum focused on soil fertility (Salardini et al. 1994b; Salardini et al. 1994a) weed competition (Rawnsley et al. 2007b; Rawnsley et al. 2006b) and plant pathogens (Pethybridge et al., 2008b). The most important plant disease affecting pyrethrum plants in Australia is ray blight caused by Satagonosporopsis tanaceti, which occurs in early spring and requires several fungicide treatments to avoid severe yield losses (Vaghefi et al. 2012). Pyrethrum is also susceptible to root rot caused by lesion nematodes Pratylenchus penetrans and P. crenatus (Hay et al. 2009); winter blight caused by Alternaria tenuissima (Pethybridge et al. 2004); Sclerotinia crown and flower blight caused by S. sclerotiorum (Scott et al. 2014); Botrytis flower blight caused by Botrytis cinerea (Pethybridge et al. 2008d); tan spot caused by Didymella tanaceti (Pearce et al. 2015); petal blight caused by Itersonilia perplexans (Hey et al. 2015), and pink spot caused by Stemphylium botryosum (Pethybridge et al. 2003). Recently, pyrethrum plants have been shown to be infected by a new pathogen, Colletotricum tanaceti, causing anthracnose disease of pyrethrum (Barimani et al. 2013). Fungal pathogens have been reported to cause large yield losses annually. They have been managed by application of different types of fungicides. A brief description of the most important pathogens of pyrethrum follows: Ray blight disease of pyrethrum caused by S. tanaceti (Vaghefi et al. 2012) has remained the most prevalent foliar disease of pyrethrum in Tasmania to date. The lifecycle of S. tanaceti has been recently shown to be quite complex (Bhuiyan et al., 2016). Stagonosporopsis tanaceti may exist as an endophyte in infected seeds or have a short hemibiotrophic life style after infection of leaves and flower stems before entering the 9 Chapter 2: Litereture review necrotrophic phase and causing disease (Bhuiyan et al. 2016). The disease severity is increased in cool and humid environmental conditions (Pethybridge et al. 2003). The disease symptoms appear in spring as necrotic lesions on leaf margins. Lesions expand to encompass the entire leaf that results in stunting and defoliation. In severe outbreaks of ray blight chlorotic lesions were initially produced on flower stems followed by the appearance of necrotic lesions on buds of pyrethrum plants (Bhuiyan et al. 2016; Vaghefi et al. 2012). The disease causes flower stems to bend at the end (Shepard’s crook) and flower and bud death (Pethybridge and Wilson 1998). Severity of the disease is at the highest in late spring through early spring (November to December) (Pethybridge et al. 2008a). If left unmanaged, the disease can lead to plant death. Once plants are infected, pycnidia develop in necrotic lesions on leaves and flower stems. Secondary infection of plants probably occurs through rain splash and wind dispersal of spores to new leaves and flowers. As the plant tissue dies, pseudosclerotia may be formed and these can supposedly survive in the soil for many years. However, the role of pseudosclerotia in the disease cycle is unknown (Pethybridge et al. 2008d). The disease has been controlled successfully with a combination of pyraclostrobin and boscalid fungicides for disease management (Pethybridge et al. 2008a). Tan spot disease of pyrethrum caused by D. tanaceti is a foliar pathogen isolated from necrotic lesions of the leaves, flower stems and buds of pyrethrum. The disease severity has increased over the past years. Pethybridge et al. (2008c) isolated D. tanaceti from necrotic leaf spots of pyrethrum plants in low frequencies in 2003. The isolation frequency of the pathogen increased in 2005 and 2006, where 65% of the leaves with necrotic lesions were infected with D. tanaceti. In summer 2015, >73.2% of the fields in northern Tasmania were infected with the pathogen (Hay et al. 2015). The fungus has a saprophytic life style before becoming pathogenic. Ray blight disease of pyrethrum caused by S. tanaceti, has a synergetic effect on the disease severity of D. tanaceti (Pearce et al. 2015; Pethybridge et al. 2008c). The name of the pathogen was changed from Microsphaeropsis tanaceti to D. tanaceti by Pearce et al. (2015) based on morphological and molecular characterisation. Anthracnose disease of pyrethrum caused by C. tanaceti, is a foliar disease which causes initial infection on pyrethrum leaves by means of a brief biotrophic phase 10 Chapter 2: Litereture review associated with intercellular hyphae and then infection switches to the destructive necrotrophic phase associated with leaf necrosis (Barimani et al. 2013). However, in a recent survey carried out by Hay et al. (2015), the isolation frequency of C. tanaceti from necrotic leaf lesions of pyrethrum in the field, declined from 6.2% in winter to 1.1% in summer indicating that the disease occurred sporadically in pyrethrum fields of northern Tasmania. Sclerotinia crown rot and flower blight of pyrethrum caused by the two species S. sclerotiorum and S. minor, effects plant growth and has been shown to cause early termination of the crops in pyrethrum fields of Tasmania (Pethybridge et al. 2008d). The pathogen has a necrotrophic life-style and produces sclerotia as resting structures in the soil. Sclerotia can remain viable in the soil for more than eight years and then germinate in favourable environmental conditions. Crown rot occurs after the germination of sclerotia and penetration by infection hyphae into the crown resulting in wilt and plant death; and flower blight occurs after sclerotia produce apothecia and air-borne ascospores infect the flowers (Scott et al. 2014). Fungicide management with procymidone has been successful for the disease control (Scott et al. 2014). Alternaria blight of pyrethrum caused by A. tenuissima was first reported by Srinath and Sarwar (1965) when the pathogen caused brown patches on the apical part of the pyrethrum leaves. Pethybridge et al. (2004) identified two species of Alternaria isolated from necrotic leaf lesions on pyrethrum, A. alternata and A. tenuissima, with A. alternata causing marginal leaf necrosis and A. tenuissima causing leaf spots. However, the major Alternaria sp. which affects pyrethrum production in Tasmania was reported to be A. tenuissima, the causal agent of winter blight disease. The pathogen has a necrotrophic life style and infects a large number of ornamental plants such as chrysanthemum flowers (Pethybridge et al. 2008d). Necrotic lesions caused by Alternaria spp. have been also reported to be associated with diseases of pyrethrum in East Africa (Pethybridge et al. 2008d). Isolation frequency of A. tenuissima in Tasmania decreased from 92% of the fields in winter to 40% in summer between 2012 and 2013 (Hay et al. 2015). Pink spot disease of pyrethrum caused by Stemphylium botryosum is commonly found in pyrethrum fields of Tasmania (Pethybridge et al. 2008d). Symptoms caused by S. botryosum are mostly confused with A. tenuissima, causing winter blight of 11 Chapter 2: Litereture review pyrethrum. The impact of frost and continuous usage of herbicides also produce similar symptoms to both pathogens. However, S. botryosum is identified based on the necrotic lesions produced in the centre of the pink/brown margins (Pethybridge et al. 2008d). Although, the disease severity in the field is not yield-limiting, the pathogen reduces green leaf area and the ability of plants to produce flowers by reducing photosynthesis (Pethybridge et al. 2004). Different species of Stemphylium have been reported as pathogens of Asteraceae such as chrysanthemum and aster (Pethybridge et al. 2003). Hay et al. (2015) also isolated S. botryosum at low frequencies from necrotic lesions on pyrethrum. Fusarium root rot caused by Fusarium spp. was reported to cause low pyrethrin content in flowers (Casida and Quistad 1995). Fusarium species are significant pathogens of pyrethrum plants in South Africa and Kenya where they were reported to cause damping off of seedlings and wilt, necrosis and chlorosis of the mature plants (Pethybridge et al. 2008d). Pethybridge et al. (2010a) and Hay et al. (2002) isolated Fusarium species (F. oxysporum and F. solani) from pyrethrum plants in yield-decline affected sites in northern Tasmania but never assessed the pathogenicity of these species to pyrethrum. Fusarium oxysporum f. sp. chrysanthemi has also been reported as a pathogen of chrysanthemum and other members of Asteraceae such as Paris daisy (A. frutescens), African daisy (Osteospermum sp.), C. morifolium and Gerbera (Gerbera jamesonii) causing wilt, stunted growth and abnormal growth of flowers and buds (Singh and Kumar 2013, 2014). Paraphoma leaf spot caused by P. chrysanthemicola has been isolated at low frequency from necrotic lesions of pyrethrum plants in association with other foliar pathogens (Hay et al. 2015). Botrytis flower blight caused by B. cinerea, is a foliar pathogen of pyrethrum causing necrotic lesions on disk florets of the plants. Infected disk florets and flowers fuse together and appear as though flowers are attached to each other. Botrytis flower blight causes significant yield loss in Tasmanian pyrethrum fields especially when environmental conditions such as high temperature and humidity are favourable for infection (Pethybridge et al. 2008d). The pathogen is a necrotroph, causing host cell death resulting in serious damage to plant tissues ending in rot of the plant and post- 12 Chapter 2: Litereture review harvest flowers (Pethybridge et al. 2008d). Pethybridge et al. (2008d) suggested application of two fungicides, tebuconazole and carbendazim, for disease management. Rhizoctonia solani anastomosis group AG-2.1 was isolated from pyrethrum roots in yield-decline affected fields of northern Tasmania (Hay et al. 2012; Pethybridge et al. 2010a). Pathogenicity of R. solani on pyrethrum has not been reported on pyrethrum in Tasmania however, Alam et al. (2006) found R. solani AG-4 as a severe pathogen of pyrethrum in northern India. The disease caused necrotic lesions on the roots and basal petioles of the infected plants terminating with wilt and premature death. Although, R. solani AG-2.1 was isolated from the roots of pyrethrum in yield-decline affected fields in Tasmania, the population of the pathogen in both infected and non-infected soils was not different hence, it was not identified as a biotic stress associated with yield-decline of pyrethrum in Tasmania (Groom 2014; Pethybridge et al. 2010a). Rhizoctonia solani AG-2.1 has been reported as a pathogen on a wide range of plants across the world such as head rot of cabbage in China (Zhang et al. 2009b), and damping-off of canola in USA (Paulitz et al. 2006). Verticillium wilt caused by Verticillium dahliae was isolated from both the soil and roots of pyrethrum plants in yield-decline affected fields of northern Tasmania in 2014, however, similar to R. solani, the isolation frequency of the pathogen was no different comparing the yield-decline affected and non-affected sites, therefore, it did not appear to be associated with yield-decline syndrome (Groom 2014; Pethybridge et al. 2010a). The pathogen has been identified to have wide host range causing verticillium wilt in temperate and subtropical areas of the world (Klosterman et al. 2009). The pathogen produces microsclerotia which remains viable in the soil over 14 years (Klosterman et al. 2009). Microsclerotia germinate and mycelia infect the root then colonise the vascular tissue. At this stage, conidia are produced and transferred within vessels acropetally, germinate and produce more conidia (Klosterman et al. 2009). However, no infection of pyrethrum with Verticillium spp. has been reported globally. Phytophthora spp. have frequently been isolated from the roots of pyrethrum plants in yield-declined fields of northern Tasmania (Groom 2014; Pethybridge et al. 2010a). The pathogen is considered a threat to native ecosystems and causes many 13 Chapter 2: Litereture review important diseases around the world such as dieback of eucalyptus caused by P. cinnamomi in Victoria and Western Australia (Newell 1998), oak decline caused by P. alni in Europe (Brasier et al. 2004) and sudden death of oak caused by P. ramorum in California, USA (Rizzo et al. 2002). Species of Phytophthora have also caused many diseases in Tasmania. Potato late blight caused by P. infestans (Drenth et al. 1995) and rubbery brown rot of carrots caused by P. megasperma (Dowson 1934) are important diseases reported in Tasmania, Australia. Oospores are the survival structures in soil which germinate in favourable environmental conditions (moistened soil and temperatures above 10°C) to produce sporangia baring motile uninucleate zoospores. Zoospores attack the fine roots and produce aseptate hyphae which colonises the root tissue resulting in root rot and distortion. Phytophthora spp. in yield-decline affected fields of northern Tasmania have not been identified to species level. Groom (2014) and Pethybridge et al. (2010a) suggested more investigations to be carried out to determine the association of Phytophthora spp. with yield-decline of pyrethrum in Tasmania. Results from the comparison of Phytophthora spp. population in autoclaved and non-autoclaved soils of yield-decline affected fields in Tasmania showed that soil sterilisation was an effective control as there was a significant difference in the population of Phytophthora spp. in treated compered to non-treated soils (Hay et al. 2012). The fungicides Agri-Fos 600, Shirlan and Envy applied in autumn were reported to reduce the population of Phytophthora spp. on roots of affected pyrethrum plants however, the effect of the treatments was not significant (Hay et al. 2012). Nematodes have been isolated from the roots of pyrethrum plants in northern Tasmania. They cause serious diseases in pyrethrum production areas in Kenya and East Africa (Hay et al. 2009; Pethybridge et al. 2008d). Lesion nematodes Paratylenchus penetrans and P. crenatus were shown to be associated with pyrethrum poor regrowth in Tasmania as they were recovered from 87% of yield-decline affected fields (Hay et al. 2012; Hay et al. 2009; Pethybridge et al. 2008d). Hay et al. (2009) reported that P. crenatus caused significant growth reduction and defoliation of pyrethrum in northern Tasmania. Paratylenchus thornei and P. neglectus were isolated in low frequencies of 10% and 7% of the yield-decline affected fields respectively (Pethybridge et al. 2010a). Root-knot nematodes (Meloidogyne haplae) have also been reported on pyrethrum but apparently do not cause significant yield loss 14 Chapter 2: Litereture review hence, were not identified as pathogens of pyrethrum (Hay et al. 2012). Hay et al. (2012) reported that nematodes (lesion and root-knot) have not been identified as single causes of yield loss in Tasmanian pyrethrum fields and speculated that a synergistic interaction of nematodes with soil-borne pathogens Fusarium spp., R. solani and V. dahliae may occur on pyrethrum plants in the fields in Tasmania. Nematicide application using fenamiphos on infected pyrethrum plants significantly increased yield of pyrethrum flowers in Tasmania (Hay et al. 2012). 2.3. Aetiology and taxonomy of Fusarium and Paraphoma diseases As the thesis has chapters dedicated to the identification and pathogenicity of new Fusarium spp. and Paraphoma spp. pathogens of pyrethrum isolated from the fields of northern Tasmania, detailed information of the biogeography, morphology and taxonomic status of these two genera and aetiology of the diseases they produce is provided. 2.3.1. Fusarium Fusarium (Nectriaceae, Hypocreales, Sordariomycetes) (Aoki et al. 2014; Gerlach and Nirenberg 1982; Summerell et al. 2010) diseases are ubiquitous. They occur in soil, water and all substrates and have a destructive role on wild and cultivated plants. Many species are pathogenic and either cause intensive vascular wilts or root and crown rot. Some populations are initially endophytes and become pathogens later in their life cycle and some are saprophytes living on dead material. Snyder and Hansen (1954) referred to Fusarium as the most damaging genus among other genera. Fusarium dry rot of potato has significantly reduced potato production in different parts of the world. Thirteen Fusarium species are believed to be associated with this disease such as F. coeruleum in the UK, F. sambucinum in North America and Europe; and F. avenaceum in Scotland (Cullen et al. 2005; Peters et al. 2008). Potato tubers that have been wounded during storage process become infected by Fusarium dry rot and the disease distributes globally through tuber transfer (Saremi et al. 2011). Panama or banana wilt disease caused by F. oxysporum f. sp. cubense is a devastating disease of banana plants in South Asia and Africa causing significant yield loss each year (O’Donnell et al. 1998). Backhouse et al. (2004) suggested that F. culmorum and 15 Chapter 2: Litereture review F. pseudograminearum were the causal agents of crown and foot rot of wheat, sorghum and barley in Victoria and South Australia. Uhlig et al. (2007) reported that there were three Fusarium spp. associated with head blight disease of cereals including F. avenaceum, F. culmorum and F. graminearum. The population of these species differs in different geographical locations. While F. graminearum causes head blight disease in temperate areas such as the USA, Australia and Canada, F. avenaceum and F. culmorum cause significant infections in cooler regions of the world such as North West Europe and Canada. Species of Fusarium are usually described using the species concepts of morphology, biology and phylogeny. Morphological species concept solely relies on morphological identification of the species and is based on a type culture which represents the variation within an entire species. This concept has been widely and successfully used by taxonomists (Gerlach and Nirenberg 1982; Wollenweber and Reinking 1935). However, morphological concept fails in some aspects of species identification as the number of identifiable morphological characters is significantly less than the number of species in need to be distinguished (Summerell et al. 2010; Summerell et al. 2003). Biological species concept is based on the ability of crosses between isolates to produce fertile progenies (Aoki et al. 2014). In this concept, unidentified isolates are crossed to female-fertile testers to determine whether they group in the same biological species as the tester strain. This method has been successful for limited number of species complexes such as Giberella fujikuroi. However, biological concept has not been successful in large scale taxonomy as most Fusarium strains are anamorph and hardly cross even in suitable laboratory conditions (Summerell et al. 2010; Summerell et al. 2003). Phylogenetic species concept is a new concept based on DNA sequences of selected genes and quantifies the genetic relatedness between species (Summerell et al. 2010). However, including enough loci and taxa in phylogenetic analysis is a necessity for accurate identification of the species (Aoki et al. 2014). Setting isolates into groups that are biologically meaningful is one of the issues in phylogenetic species concept (Summerell et al. 2003). 16 Chapter 2: Litereture review Nevertheless, none of these concepts alone have been successful to accurately identify Fusarium species, unless for unique species complexes such as G. fujikuroi which contains teleomorph stage and can be precisely identified using either biological or phylogenetic species concepts (Aoki et al. 2014; Leslie and Summerell 2006; Summerell et al. 2010; Summerell et al. 2003; Wingfield et al. 2012). 2.3.1.1. Morphology Morphological identification of Fusarium species is often difficult due to the isolates variability (different spore size) and lack of microscopic features required for morphological identification (certain fungal structures cannot be produced on a specific medium). However single spored cultures and selective media can greatly help with accurate identification. The main microscopic features of Fusarium are as follows: Macroconidia are the most typical structures of Fusarium species. Leslie and Summerell (2006) suggested using carnation leaf agar (CLA) as a medium for inducing macroconidia production. The size of macroconidia, number of cells, basal and apical cell shapes are important diagnostic characters. Macroconidia are produced in sporodochia (a mass of compact hyphae bearing asexual spores) (Leslie and Summerell 2006). Microconidia are important fungal spore structures as not all Fusarium species are able to produce these spores. The size and shape of microconidia are important in species identification. Moreover, conidia are formed on two types of conidiogenous cells, monophialides and polyphialides. Phialides are specific conidiogenous cells which produce conidia without an increase in length. Monophialides have only a single opening per cell while, polyphialides have multiple openings. Microconidia can form on phialides in chains, individually or in false heads. Collapse of a spore chain results in false head production (Mycology-Online 2016). Mesoconidia are the third form of conidia produced by Fusarium spp. and can possess none to seven septa (Anaissie et al. 1992). They are not produced in sporodochia and are normally attached to the hyphae. Hence, the term ‘aerial conidia’ has been attributed to these structures (Leslie and Summerell 2006). The shape of mesoconidia is different to macroconidia as they do not have notched or foot-shaped basal cells and are smaller 17 Chapter 2: Litereture review than macroconidia. Species of F. chlamydosporum and F. avenaceum produce mesoconidia (Leslie and Summerell 2006). Chlamydospores are thick walled hyphal cells and resting structures which germinate in appropriate environmental condition and cause infection (Nobile et al. 2003). Not many Fusarium species produce chlamydospores. Leslie & Summerell (2006) suggested synthetic nutrient agar (SNA) as a selective medium to be used for chlamydospore production. Chalmydospores are formed singly, in chains, as clumps or as doubles. Colony pigmentation is a secondary characteristic. Potato dextrose agar (PDA) has been suggested as the culture medium for assessment of colony colour (Leslie and Summerell 2006). Incubation conditions such as light regime (12hr dark/12hr light) and temperature are important factors which effect colony pigmentation (Burgess et al. 1991). Fusarium colony colours vary from white, yellow, orange and brown to grey, red and violet. However, colony pigmentation cannot be used as a reliable characteristic factor for morphological identification of Fusarium species as changes in incubation conditions such as light and temperature cause mutation and hence colony colour differences (Leslie and Summerell 2006). Growth rate should be measured after three days at 25°C to 30°C (Burgess et al. 1991; Francis and Burgess 1977). A number of replicates is required to precisely measure the growth rate. Some Fusarium spp. grow slower than others (Burgess et al. 1991). Other morphological characteristics such as production of circinate (coiled) hyphae in species of G. fujikuroi species complex such as F. circinatum, crystals on CLA, sclerotial-like structures, secondary metabolites and mycotoxins have been also studied by Leslie and Summerell (2006) which rarely occur in many species of Fusarium. 18 Chapter 2: Litereture review Fig.2. Identification of Fusarium species based on spore shape. A-D Macroconidia A Typical shape of a macroconidim; B Needle-shaped Macroconidium; C Macroconidium with dorsoventral curvature; D Macroconidium with dorsal side more curved than ventral; E-H Macroconidia apical cell shapes E blunt F Papillate G Hooked H Tapering; I-L Macroconidia basal cell shapes I Foot-shaped J Elongated foot-shaped K Distinctly notched L Barely notched; M-T Microconidia spore shapes M Oval N Twocelled O Three-celled oval P Reniform (kidney-shaped) Q Obvoid with a truncate base R Pyriform S Napiform T Globose; U-X Phialides morphology U Monophilides (false 19 Chapter 2: Litereture review heads) V Monophialides W-X Polyphialides; Y-Z Microconidial chians. Image was adapted from Leslie and Summerell (2006) Fig.3. Fusarium venenatum A colony morphology; B conidiogenous cells (polyphialides); C macroconidia with papillate apical cell and foot-shaped basal cell; D macroconidia; E chains of chlamydospores; B, C and E scale bars 20 µm; D 200 µm 2.3.1.2. Biogeography and dispersal As members of Fusarium are dispersed globally, it is difficult to find their origin (Summerell et al. 2010). Summerell et al. (2010) indicated that climate and host range were informative factors in determination of Fusarium species origin as it revealed the geographic location from which they were recovered. In Australia, F. graminearum is restricted to warm and subtropical areas, causing diseases on maize. However, the pathogen was recovered from carnation in Victoria, indicating that Fusarium species were able to extend their host range in favourable environmental conditions (Backhouse and Burgess 2002). Fusarium species are inhabitats of various climatic regions. Fusarium oxysporum, F. equiseti, F. solani and F. dimerum are cosmopolitan and have been isolated from 20 Chapter 2: Litereture review different climatic regions of the world. This raises the concern about identification of the species which are genetically distinct but morphologically similar (cryptic species) (Summerell et al. 2003). Other species such as F. beomiforme and F. longipes have been recovered only from tropical areas (Sangalang et al. 1995). Burgess and Summerell (1992) reported that the diversity of Fusarium species was related to environmental conditions such as rainfall, vegetation and temperature Fusarium graminearum can disperse long distances through air-borne drifts. Other Fusarium species also can transfer long distances via passive dispersal such as wind or storm or active dispersal such as ascospores (Burgess 1981). Chlamydospores are the means of soil dispersal and transfer to long distances via water, such as chalmydospores of F. oxysporum f. sp. vasinfectum. Endophytic and parasitic species of Fusarium mostly disperse via different parts of the host plant such as seed or fruit by anthropogenic activities; and disperse to short distances via water splash or wind (Summerell et al. 2010; Summerell et al. 2003). Fusarium species can survive in soil as chlamydospores, mycelium or conidia in plant residues (Burgess 1981; Mandeel et al. 1995). More investigations need to be carried out to determine the effect of temperature and climate on distribution of Fusarium species as the significant correlation between environmental conditions makes it difficult to distinguish the effect of each factor individually on Fusarium distribution (Burgess and Summerell 1992). 2.3.1.3. Taxonomy Taxonomy of Fusarium species was solely based on morphological species concept before 1977 (Aoki et al. 2014; Summerell et al. 2010). Fusarium was first described by Link (1809). Significant advances in taxonomy of Fusarium was observed when Wollenweber and Reinking (1935) published ‘Die Fusarien’ which included 16 sections, 65 species, 55 varieties and 22 forms (Messiaen and Cassini 1981). Although detailed morphological identification of Fusarium species was presented in Wollenweber and Reinking (1935), however the revised taxonomy was not accepted due to time consuming microscopic identification process (Aoki et al. 2014). In 1940, Snyder and Hanson reduced the number of sections from 16 to nine, by combining 21 Chapter 2: Litereture review species of sections Anthrosporiella, Discolor, Roseum and Gibossum into one section, Roseum. As the species of section Roseum were important pathogens of cereals, pathogenic species of this section were called F. roseum f. sp. cerealis and nonpathogenic members were simply called F. roseum (Nelson et al. 1981; Snyder and Hansen 1940, 1941, 1945). This method was highly accepted among plant pathologists as it was simply based on visual observation of the culture morphology (Aoki et al. 2014). Booth in 1971 returned to Wollenweber and Reinking’s taxonomic classification method while following Snyder and Hanson’s classification system for only one section ‘Elegans’ which he equated it to F. oxysporum (Nelson et al. 1981). Gerlach and Nirenberg (1982) also followed Wollenweber and Reinking’s taxonomic classification by increasing the number of species from 65 to 78 morphologically distinct species. Gräfenhan et al. (2011) defined two main Fusarium clades according to Fusarium sensu Wollenweber: ‘terminal Fusarium clade (TFC)’ including species of agricultural, clinical and research importance; and a collection of fusarium-like genera at the base of the phylogenetic tree as ‘basal fusarium-like clade’. In the study conducted by Gräfenhan et al. (2011), TFC node received low bootstrap support in Baysian PP (posterior probability) and Maximum Likelihood (ML) statistical analyses using the second largest subunit (RPB2) and ATP citrate lyase (acl1) loci for 26 taxa. However, Geiser et al. (2013) obtained more robust results using combined sequences of polymerase II largest subunit RPB1 and RPB2, for analysis of 93 taxa. The Baysian PP value increased however, ML bootstrap value remained weak. Therefore, members of the basal fusarium-like clades (Macroconica, Fusicolla, Stylonectria and Microcera) which were previously included in the genus were identified as non-pathogenic to plants, humans and animals (Geiser et al. 2013; Gräfenhan et al. 2011), and were removed from the TFC. 2.3.1.4. Phylogeny and Molecular Identification Currently, the genus Fusarium comprises at least 300 phylogenetically distinct species, 20 species complexes and nine monotypic lineages (O'Donnell et al. 2015). Molecular and phylogenetic studies have effectively improved identification of Fusarium isolates to species level. Current species identification is based on multilocus sequence data (O'Donnell et al. 2015). For sequence-based identification of Fusarium species Hyde et 22 Chapter 2: Litereture review al. (2014) and O'Donnell et al. (2015) suggested to use RPB1 and RPB2 and elongation factor 1-α (EF1). O’Donnell et al. (2010) reported that all the three genes had equal levels of species identification within Fusarium. However, Lombard et al. (2015) reported that RPB1 and RPB2 had the highest bootstrap support compared to EF1. O'Donnell et al. (2015) suggested using at least two independent loci to increase the accuracy of identification. Internal transcribed spacer (ITS) and domains D1/D2, at the 5´ end of the 28S ribosomal large subunit (LSU rDNA) sequences are too conserved to resolve species limits of most fusaria and had the least phylogenetically informative characters compared to the other loci (O'Donnell et al. 2015). Therefore, phylogenetic analyses using ITS and LSU is not suggested for Fusarium species identification. However, a combined phylogenetic tree of ITS and/or LSU rDNA has been used to determine the placement of unknown species of Fusarium within different species complexes (Balajee et al. 2009). Internet-accessible validated databases dedicated to the identification of fusaria via nucleotide BLAST queries are available at FUSARIUM-ID at Pennsylvania State University (http://www.fusariumdb.org) (Geiser et al. 2004) and Fusarium MLST at the CBS-KNAW Fungal Biodiversity Centre (http://www.cbs.knaw.nl/Fusarium/) (O'Donnell et al. 2015). Lesser usage of NCBI GenBank database has been suggested as application of nomenclature of Fusarium in GenBank is not consistent (Geiser et al. 2013; O'Donnell et al. 2015). For instance, teleomorph names of F. graminearum and F. verticillioides (G. zeae and G. moniliformis respectively) have been used instead of the anamorphic names which is against the new rules of International Code of Nomenclature for Algae, Fungi and Plants that ruled out the use of teleomorph names in January 1 2013 (Geiser et al. 2013; Gräfenhan et al. 2011; Lombard et al. 2015; O'Donnell et al. 2015). In addition, many sequences in GenBank are misidentified or have not been updated (O'Donnell et al. 2015). The reason for using FUSARIUM-ID or Fusarium MLST databases is that they have housed the most phylogenetically informative sequences derived from Fusarium research centre (FRC), ARS culture collection (NCBI) and CBS KNAW-Biodiversity centre (O'Donnell et al. 2015). O'Donnell et al. (2015) suggested care to be taken in sequence alignments to assure sequences are free of ambiguities. Moreover, where multiple species names have similar scores with the top BLASTn matches, it may be necessary to sequence additional loci. 23 Chapter 2: Litereture review Members of the F. oxysporum species complex (FOSC) are considered as important pathogens of different hosts causing root rot and damping-off. However, in some cases FOSC isolates do not produce disease (Ellis et al. 2014). Host specific Fusarium spp. pathogens are known as formae speciales as they attack only one or a group of host species (Bogale et al. 2007). However, F. oxysporum species are morphologically similar with multiple phylogenetic origins (polyphyletic). Historically, species of F. oxysporum had been divided into formae speciales based on their virulence to closely related hosts, for instance, by testing pathogenicity of F. oxysporum strains to a host cultivar with different levels of disease resistance (Correll 1991). However, pathogenicity tests are time-consuming and prevent identification of non-pathogenic F. oxysporum species with clinical and agricultural importance, and extremely affected by environmental conditions such as temperature (Correll 1991; O'Donnell et al. 2009b). Vegetative compatibility groups (VCGs), the ability to anastomose and form heterokaryons, have provided better understanding of evolutionary origins of Fusarium (O'Donnell et al. 2009b). Some formae speciales are divided into races according to their pathogenicity to a set of varieties of one or more host species (O'Donnell et al. 2009b). Differentiation of formae speciales of F. oxysporum has been proved to be more efficient using molecular markers obtained by restriction fragment length polymorphism (RFLP) (Bogale et al. 2007), amplified fragment length polymorphism (AFLP) and simple sequence repeat (SSR) methods on sequences of EF1 (Bogale et al. 2006). Sequences of house-keeping genes obtained by conventional PCR do not show enough polymorphism needed to identify form species of Fusarium spp (Lievens et al. 2007). Pathogenicity of some F. oxysporum form species, e.g. F. oxysporum f. sp. chrysanthemi can be linked to the presence of specific transposons (Fot1) which can be used to develop specific markers (Lievens et al. 2008). 2.3.2. Paraphoma Pleosporales is the largest order in the family Dothideomycetes including more than 4700 species (Zhang et al. 2009a). Parapohma spp. including P. radicina (the ex-type species of the genus Paraphoma), P. chrysanthemicola (the ex-neotype species) and P. fimeti are soil-borne pathogens associated with roots in temperate areas of Australia, America 24 Chapter 2: Litereture review and Eurasia (De Gruyter et al. 2010). Species of Phoma section Paraphoma can be also saprobic but mostly are pathogenic to herbaceous plants (Zhang et al. 2012). This pathogen has been also identified in pyrethrum fields of northern Tasmania, in conjunction with ray blight infection of pyrethrum (Hay et al. 2015). Further studies on these pathogens need to be carried out to determine the degree of pathogenicity and to correctly identify the species. 2.3.2.1. Morphology Species of the genus Paraphoma are mainly identified by abundant production of straight or flexuous septate pale brown to brown setae (Boerema et al. 2004; De Gruyter et al. 2010). Setae may be short or relatively long; and stiff or hyphal-like. Setae can be either scattered on the surface of the pycnidia such as those produced by the ex-type species P. radicina, or abundant around the ostioles such as species of other Phoma sections such as Pyrenochaeta (Boerema et al. 2004; Q-bank 2016). However, setae production differs between species of Paraphoma. For instance, P. radicina and P. chrysanthemicola produce pycnidia with long setae, while, P. fimeti produces glabrous pycnidia (De Gruyter and Boerema 2002). Conidiogenous cells logeniform, monophialidic, hyaline to sub-hyaline (Q-bank 2016). Species of the section Pyrenochaeta produce long and branched conidiophores instead of doliiform or ampulliform conidiogenous cells which are the characteristics of species of Paraphoma (De Gruyter et al. 2010). Conidiomata pycnidial, globose to sub-globose and papillate, thick-walled and pseudoparenchymatous, ostiolate, uniloculate. Micropycnidia fertile or sterile produced abundantly in some species of Paraphoma, submerged in the medium. The colour of the pycnidial matrix is an informative character for species identification and varies from white or buff to cream, yellow, brown or colourless (Boerema et al. 2004; Q-bank 2016). Conidia ellipsoidal to sub-globose, hyaline and guttulate, always aseptate in vivo and in vitro (Boerema et al. 2004). Chlamydospores are produced solitary, in short or long chains or aggregated. Chlamydospores are distinguished in two types of unicellular and multicellular. Multicellular chlamydospores (dictyochlamydospores) are divided into Alterneroid, Pseudosclerotioid, Epiccocoid and Botryoid depend on the species, although, this characteristic has been mostly observed in species of section Peyronellaea (Aveskamp et al. 2009; Q-bank 2016). However, they have been also observed in species 25 Chapter 2: Litereture review of Paraphoma such as P. chrysanthemicola which produces pseudosclerotioid masses of chalmydpspores (De Gruyter et al. 2010). Some species of Paraphoma do not produce chlamydospores. Hence, morphological features, mainly production of setose pycnidia and chlamydospores, may vary between species of Paraphoma and other genera (Q-bank 2016). Colony colour, growth and pigmentation are greatly dependant on the media and incubation condition (De Gruyter and Boerema 2002). The colour that Paraphoma isolates produce on different media varies from black, brown, olivaceous, yellow and red to pink, grey and white (Q-bank 2016). The type of aerial mycelia is also an important feature in species identification. Aerial mycelia is formed in five different types including flat/effuse (aerial mycelia sparsely formed), floccose (tufted), felty (felt like texture), woolly (loosely packed mycelium) and compact (densely packed mycelium). Margins of the colonies are also important morphological features and known in two types of regular (smooth and sharp) and irregular (crenate and lobate) (Qbank 2016). Optimal media and incubation conditions are assessed using three different media of cherry decoction agar (CHA) for colony growth and pigmentation, malt extract agar (MEA) mostly for colony pigmentation and acidified oatmeal agar (OA) for both colony pigmentation and morphological identification. Incubation for one week in dark and the following week under 11hr/13hr dark/UV light regime at 20-22°C to simulate the pigmentation of the colonies and the formation of pycnidia is also recommended (Boerema et al. 2004; Q-bank 2016). Physiological characters are assessed by two methods: 1- Application of 1N NaOH directly to the culture medium which causes a sudden increase in pH rate and hence change of color to red (pH>5.5) and blue-green (pH>12.5) on OA. This defines a metabolite ‘E’ producing strain which turns into green (pigment α) in 10 minutes and to red (pigment β) in one hour (Boerema et al. 2004; Vaghefi et al. 2012). 2- Application of iodine on a squashed or sectioned pycnidium. Change of cell wall color to red upon application of iodine indicates presence of scleroplectenchymatous 26 Chapter 2: Litereture review cell wall; and change of color of the cell contents or no change of color indicates presence of pseudoparenchymatous cell wall type (Boerema et al. 2004; Q-bank 2016). Fig. 4. A setose pycnidia (top left) and conidiogenous cells and conidia (top right) and a sectioned obpyriform (flask-shaped) pycnidium of Paraphoma radicina (middle right); 27 Chapter 2: Litereture review B ostiolar zone of a pycnidium with setae and a sectioned subglobose pycnidium; adapted from De Gruyter and Boerema (2002) 2.3.2.2. Hosts Species of the genus Paraphoma can be saprobic but mostly are pathogenic to herbaceous plants. Most species of Paraphoma are soil-borne pathogens with a wide host range of plants including monocotyledonous plants, species of Asteraceae, Solanaceae, Cupressaceae and stone fruits (Rosaceae). 2.3.2.3. Taxonomy The genus Phoma contains nine sections including Phoma, Paraphoma, Heterospora, Peyronellae, Phyllostictiodes, Plendomus, Schlerophomella, Pilosa and Macrospora (Aveskamp et al. 2009; Boerema et al. 2004; De Gruyter et al. 2013). Most sections of the genus are placed in Didymellaceae however, type species of Phoma sections Paraphoma, Heterospora, Pilosa and Plendomus clustered in a separate group outside Didymellacea and hence were excluded from Phoma in 2013 (De Gruyter et al. 2013). Phoma section Paraphoma (Pleosporales, Phaeospheriaceae, Dothideomycetes) (Phookamsak et al. 2014; Zhang et al. 2009a) contains 11 species with setose pycnidia according to De Gruyter and Boerema (2002) including Phoma radicina (section Paraphoma), P. setariae, P. terrestris, P. briardii and P. gardenia, P. indica (transferred to the section Pyrenochaeta), P. septicidalis, P. carteri and P. glycinicola (transferred to Coniothyriaceae), P. terricola (transferred to the genus Pyrenochaetopsis) and P. Leveillei. The teleomorph of this section is still unknown. The genus Paraphoma was first introduced by Morgan-Jones and White (1983). The extype species P. radicina (≡Pyrenochaeta radicina) (McAlpine 1902) is a pathogen of root of monocotyledonous plants such as Iridaceae and Leguminosae (Boerema et al. 2004). Papraphoma was first placed in Pyrenochaeta by McAlpine (1902) and later Boerema and Dorenbosch transferred it to genus Phoma in 1979 (Zhang et al. 2012). Morgan-Jones and White (1983) transferred species of Paraphoma into Phoma according to the morphological feature, setose pycnidia. De Gruyter et al. (2010) 28 Chapter 2: Litereture review reintroduced Phoma section Paraphoma to Phaeosphaeriaceae using phylogenetic studies. Paraphoma chrysanthemicola was first described by Hollós in 1907 (De Gruyter et al. 2010). Later, Srivastava (1953) reported a phoma-like pathogen at the base of the flower stems of Chrysanthemum spp. and identified it as P. chrysanthemicola. However, these claims were solely based on morphological characters. Paraphoma chrysanthemicola was also isolated from the roots of Chrysanthemum morifolium in Germany, in 1967 (De Gruyter et al. 2010). Later, Dorenbosch (1970) reported it as a pathogen involved with the root disease of florists’ Chrysanthemum. Johnston (1981) also reported it as root pathogen of Leguminosae causing damping-off and root rot. 2.3.2.4. Phylogeny and molecular identification The type species of the genus Paraphoma, P. radicina, clustered in a separate group outside Didymellacea and hence was excluded from Phoma in 2013. These species clustered mainly in Phaeosphaericea, Cucurbitariaceae and Coniothyriaceae based on 28S ribosomal RNA (LSU) and small subunit 18S nrDNA (SSU) phylogenetic analysis. Morphology of phoma-like isolates seems not to be congruent with molecular studies (Aveskamp et al. 2009). For instance Aveskamp et al. (2009) reported that P. chrysanthemicola (formerly placed in section Peyronellaea) did not clade with species of section Peyronellaea in the multigene phylogenetic study using actin (ACT), beta tubulin (TUB) and internal transcribed spacer (ITS) gene sequencing. Instead, it clustered with species of the genus Paraphoma as it had semi-setose pycnidia which were closely related to the ex-type species of Phoma section Paraphoma, P. radicina (Aveskamp et al. 2010). Hence, morphological characters which are thought to be specific of a section are polyphyletic. Setose pycnidia and dictyochlamydospores (chlamydospore possessing longitudinal and transverse septa, http://www.mycobank.org), characteristics of species of sections Paraphoma and Peyronellaea can be observed in species of other sections such as Pyrenochaeta and Pleurophoma (Aveskamp et al. 2010). Aveskamp et al. (2010) observed polymorphism in multilocus phylogeny of genus Paraphoma using LSU and SSU in the phylogenetic study. 29 Chapter 2: Litereture review In order to phylogenetically identify species of Phoma nine loci have been used in different studies: ITS, LSU and SSU as molecular markers and RPB1, RPB2, EF1, ACT, TUB, calmadulin (CAL) and chitin synthase (CH1) as protein coding genes (Q-bank 2016). However, Zhang et al. (2012) suggested including more genes in a phylogenetic study of phoma-like species to be able to clearly identify relationships between orders and families within individual orders. He advised using ITS and LSU in combination with protein coding genes RPB1, RPB2, EF1, ACT and TUB for precise identification of species of Paraphoma. Inclusion of more taxa in the multigene phylogenetic analysis of Paraphoam is necessary for accurate identification and estimation of the evolutionary process (Zwickl and Hillis 2002). The role of EF1 in species identification within Phoma has not been studied clearly however, in this study, EF1 was easily amplified and provided high resolution and included more parsimony-informative nucleotide sites compared to TUB, using primer pairs of EF827 (forward) and EF2 (reverse) according to Quaedvlieg et al. (2013). 2.4. Impact of environmental factors (abiotic stresses) Environmental factors such as temperature, soil moisture and pH may accelerate the development of disease and have direct relationship with pyrethrum production (Greenhill 2007). Cool temperatures of the North West Coast of Tasmania with mean temperature of 20°C in summer and 13°C in winter, creates an excellent environmental condition for pyrethrum production in Tasmania (Greenhill 2007) whereas, continuous cool temperatures and a sudden wave of heat in summer in countries such as Japan and Croatia made pyrethrum production unsuccessful (Glover 1955). Cool temperatures at night and day length in Tasmania induce pyrethrum plants to produce flowers (Greenhill 2007). Greenhill (2007) suggested that cool temperatures during vernalisation period in winter (June-August), 16°C or lower at least for two weeks, and high temperatures during flowering increased pyrethrin production in the achenes in the flower heads, and higher temperatures >30°C reduce pyrethrin contents (Greenhill 2007). Other environmental stresses such as frost, continuous usage of herbicides to control weeds and high annual rainfalls (waterlogging) have been reported by Groom (2014) to affect pyrethrum production. The increase in rainfall causes soil erosion and 30 Chapter 2: Litereture review susceptibility of plants to a range of diseases due to excess wetness of the canopy (Pethybridge et al. 2008d). However, low soil moisture during summer also stress the plants with less expansion of the roots (due to infection by soil-borne pathogens) thus preventing the uptake of water from lower soil levels (Pethybridge et al. 2010a). Suraweera et al. (2015a) indicated that pyrethrin production in flower heads increased under sprinkler irrigation during flowering period and flower development, as the application of water slowed down the flower development and increased the duration of flowering. Ray blight has been reported to have an interaction with waterlogging (particularly in the relatively high rainfall regions where pyrethrum is grown) to reduce plant vigour and cause poor regrowth after first harvest (Groom 2014). Javid et al. (2013) studied the effect of S. tanaceti and waterlogging on root and shoot dry weights, leaf area and the number of stems of pyrethrum plants in glasshouse trials. Javid et al. (2013) confirmed that a combined treatment of waterlogging and ray blight had a more severe effect on root system expansion and root dry weight than waterlogging alone. Javid et al. (2013) reported that ray blight resistance in cultivars was not correlated with recovery after the waterlogging treatment, as in some cases, more resistant cultivars were less able to recover compared to waterlogging sensitive plants. According to Pethybridge et al. (2010b), abiotic factors such as soil compaction and cutting height contributed to poor regrowth of pyrethrum plants in yield-decline affected sites. More investigations in 2014 showed that waterlogging, dense harvest, frost and continuous application of herbicides were other important factors associated with the problem (Groom 2014). Groom (2014) also reported that field topology which included “hump and hollows” and a dense growing of weeds in yield-decline affected fields were other physiological stresses playing an important role in yield-decline. 31 Chapter 2: Litereture review Fig.5. A the effect of hump and hollows on growth of pyrethrum; poor growth in the swales and reasonable growth in ridges; B the effect of frost in lower parts of the field versus a good growth on upper hills; photos were adapted from Groom (2014) 32 Chapter 2: Litereture review 2.5. Pyrethrum yield-decline Pyrethrum yield-decline has been reported for almost two decades (Groom 2014; Hay et al. 2012; Hay et al. 2002; Pethybridge et al. 2010a) however, the incidence was at the highest in 2010 in Tasmania (Pethybridge et al. 2010a). The main causal agent of the decline has not been identified and it is believed that a combination of biotic and abiotic stresses are associated with the syndrome (Hay et al. 2012; Hay et al. 2002; Pethybridge et al. 2010a). Groom (2014) mentioned that this syndrome was not related to pyrethrum plants individually, but referred to the pyrethrum crop as many individual plants did not die but pyrethrum yield was reduced significantly. Pethybridge et al. (2010b) and Hay et al. (2012) reported that pyrethrum plants in yield-decline affected fields showed less density in autumn and after the first harvest most plants were not vigorous enough to regrow or had lower yield in the second harvesting season. In a field with high crop density, reduction of light to the crown reduced the number of buds able to regrow after first harvest. In pyrethrum crops, the number of flowers per plant, flower dry weight and the amount of pyrethrin produced within each flower was affected by the amount of light intercepted by the canopy (Pethybridge et al. 2008b). Fig.6. A a terminated pyrethrum site after the second harvesting season; B an acceptable regrowth of pyrethrum after first harvest 33 Chapter 2: Litereture review 2.5.1. Symptoms Roots of infected plants have been shown to contain necrotic lesions and the epidermal layer was detachable suggesting roots were infected by pathogens. Discolouration and necrosis of crown tissue was observed on a majority of pyrethrum plants in yielddecline affected fields. The root extension in affected plants compared to non-affected plants was reduced and in some cases no feeder roots were observed (Hay et al. 2012). Groom (2014) reported that die back of plants in winter increased their tendency to become attacked by slugs and snails. 2.5.2. A review of yield-decline of other important crops As yield-decline causes significant yield loss in Tasmania, it is relevant to review and compare physiological factors which have contributed to yield-decline in various important Australian crops such as sugarcane and canola. The Australian sugar industry has been severely affected by yield-decline. The definition of yield decline in the Australian sugar industry was based on the long-term, monoculture system in which the soil lost its productive capacity (Garside et al. 2005; Pankhurst et al. 2003). Planting a single crop for a long period of time and cultural practices used for crop growing or either of these factors, are attributed to yield-decline. Breaking the monoculture with appropriate crops such as legumes in sugarcane fields and rotation experiments improved the biological, chemical and physical properties of the soil (Pankhurst et al. 2003). Biotic stresses such as fungal pathogens and nematodes have significant effects in yield reduction of sugarcane plants in Australia. Croft and Magarey (1984) frequently isolated two species of Pythium (P. arrhenomanes and P. graminicola) from the roots of sugarcane plants in yield-decline affected fields. Other fungal pathogens such as Rhizoctonia spp. and Phytophthora spp. were also reported as root pathogens of sugarcane in Australia (Croft and Magarey 1984). Pachymetra chaunorhiza was also identified as an important new pathogen of sugarcane which was specifically isolated from the soils in Queensland, Australia (Pankhurst et al. 2003). Moreover, the negative effect of arbuscular micorhizal fungi (AMF) in soils with high levels of phosphorus (P) on growth of sugarcane plants was reported, however, Pankhurst et al. (2003) suggested more investigation to be carried out as the negative effect of AMF on yield reduction in 34 Chapter 2: Litereture review soils with high levels of P was not consistent. Root knot nematode Meloidogyne javanica and lesion nematode Paratylenchus zeae were reported as the most important species causing significant root damages in sugarcane plants. Other nematodes such as stubby root (Nanidorus minor) and spiral nematodes (Helicotylenchus pseudorobustus) were also isolated in less frequency in sugarcane yield-decline affected fields (Pankhurst et al. 2003). Results from investigation of yield-decline of sweet potato in Papua New Guinea showed that, there was a positive correlation between rainfall and yield-decline (Garside et al. 2005). In this survey, yield-decline was attributed to a combination of factors such as nematode infestation and changes in soil chemical properties. These changes happened during the time when frequent land-use became a routine and old lands were planted repeatedly (Garside et al. 2005). In a series of studies about canola yield-decline in south-eastern Australia, abiotic stresses such as soil compaction, acidity, salinity and sodicity were recognised as considerable factors contributing to yield-decline. In waterlogged soils, manganese toxicity caused photosynthesis reduction which affected plant growth directly. Liming was suggested as an effective management technique in these areas. In sodic soils, soil particles block the soil pores in wet condition and form hard structures when dry. This affected the root distribution and plant growth in canola fields of New South Wales. Moreover, salt particles around the root resulted in reduced water uptake and finally the plant growth (Anon 2009). 2.6 Objective Evaluating fungal pathogens associated with pyrethrum yield-decline in Australia Aims: 1. To isolate and identify putative fungal pathogens associated with pyrethrum yield-decline affected plants in the fields of northern Tasmania and Ballarat 2. To identify Fusarium and Paraphoma species associated with yield-decline of pyrethrum to species level using morphological characters, multigene 35 Chapter 2: Litereture review phylogenetic analysis, and pathogenicity tests to assess the role these pathogens have on growth of pyrethrum 3. To assess the influence of waterlogging on growth of pyrethrum plants infected with F. oxysporum, F. avenaceum and P. vinacea 36 Chapter 3: Methodology Chapter 3 General Materials and Methods 3.1. Media preparation Agar used in media preparation was commercial agar (Leiner Davis Gelatine Co., powdered agar Grade J3, Australia) unless otherwise stated. Sterilised water was RO (Reverse Osmosis) water autoclaved for 20 min at 121°C. Cherry Decoction Agar (CHA) To prepare cherry extract, 1 Kg of cherries were washed and pitted. They were then placed in a 2 L flask, water added and the mixture was simmered for 2 hr. The extract was filtered through a cheesecloth and then autoclaved for 20 min at 121°C. To prepare CHA, 200 mL of the extract was mixed with 800 mL sterile water and 15 g of agar was added to the mixture. They were then re-autoclaved for 5 min at 102°C (Crous et al. 2009). Ethanol Potassium Amoxycillin Agar (EPAA) To prepare 1 L of EPAA, 15 g of agar was combined with 1.5 g of KH PO (ChemSupply Pty. Ltd., Australia) and 4 g of K HPO (Chem-Supply Pty. Ltd., Australia) mixed with 1L of sterile water; then autoclaved for 20 min at 121°C. The medium was left in a waterbath at 55-60°C to cool down before antibiotic and ethanol were added. Thereafter, 50 mg of Amoxycillin (Sigma-Aldrich, USA) was added to the autoclaved medium with 2 mL of 100% Ethanol under a fume cupboard. All the ingredients were mixed using a magnetic rotor for 10 min (Mansoori 2011). Malt Extract Agar (MEA) Forty g of the commercial malt extract powder (Oxoid, Thermo Fisher Scientific, Adelaide, Australia) was added to 15 g of agar and then mixed with 1 L of sterile water. The solution was autoclaved for 20 min at 121°C (Boerema et al. 2004). Oatmeal Agar (OA) Oatmeal extract was prepared by boiling 20 g of oatmeal flakes (Homebrand, Woolworth, Australia) wrapped in muslin cloth and hanged in a 2 L glass Becker on a 37 Chapter 3: Methodology heater for 2 hr. The extract was filtered through cheesecloth and made up to 1 L using tap water, then sterilised for 20 min at 121°C. Thereafter, 1 L of acidified OA extract was mixed with 15 g of agar and re-sterilised for 5 min at 102°C. Acidified OA: 32 mL of 0.1 N HCl was added to 1 L of the autoclaved OA (Crous et al. 2009). 0.1 N HCl was prepared by adding 8.3 mL of 36.5% HCl (Ajax Finechem Pty. Ltd., Auckland, New Zealand) to 1 L of distilled water. Potato Dextrose Agar (PDA) One L of sterile water was mixed with 39 g of the commercial PDA powder (Difco, BD, NSW, Australia) and autoclaved for 20 min at 121°C. Synthetic Nutrient-Poor Agar (SNA) One g of KH PO , 1 g KNO (Chem-Supply Pty. Ltd., Australia), 0.5 g of hydrated MgSO (Ajax Finechem Pty. Ltd., Auckland, New Zealand), 0.5 g of KCl (SigmaAldrich, USA) , 0.2 g of each glucose and saccharose (Sigma-Aldrich, USA); and 20 g of agar were mixed with 1 L of sterile water and autoclaved for 20 min at 121°C (Leslie and Summerell 2006). 2% Water Agar (WA) Twenty g of agar was mixed with 1 L of sterile water and autoclaved at 121°C for 20 min (Crous et al. 2009). V8 Juice agar (V8) V8 juice agar was prepared according to Vaghefi (2014) by adding 200 mL V8 juice (V8 veg juice, Australia) to 800 mL of sterile water and 20 g of agar. The pH was adjusted to 6.25 by adding a few drops of 10M NaOH. In case when pH exceeded 6.25, few drops of 6N HCl were added to the solution. 1.5% Agarose Gel To prepare 1 L of agarose gel, 11.25 g of agarose gel (Scientifix Pty. Ltd.; France) was mixed with TAE buffer. To make 1 L of TAE buffer, 242 g of Tris Base (SigmaAldrich, USA) was dissolved in 600 mL of ddH O (double distilled water) and mixed with 57.1 mL Glacial Acetic Acid (Ajax Finechem Pty. Ltd., Auckland, New Zealand) and 100 mL of 0.5M EDTA (Chem-Supply Pty. Ltd., Australia). 38 Chapter 3: Methodology 3.2. Single sporing Cultures were single spored to reduce variation in morphological characters and virulence (Leslie and Summerell 2006). Colonies of Fusarium spp. were grown on SNA with 2.5 cm diam pieces of double autoclaved filter papers (Whatman International Ltd., England), autoclaved for 20 min at 121°C, to induce sporulation before single sporing. Colonies were grown at 23-25°C under 12 hr dark /12 hr fluorescent light for 7 days (Leslie and Summerell 2006). Spore suspension was prepared by taking hyphae and conidiophores from growing margins of the colonies and mixing with 1 mL of sterilised water in a 1.5 mL microcentrifuge tube (Ajax, Australia). The suspension was vortexed for 20 sec and then the spore suspension concentration was calculated using a haemocytometer. Thereafter, 100 µL of spore suspension was pipetted and spread on the surface of a WA plate using a sterilised glass spreader (swabbed with 80% ethanol). The plate was sealed with parafilm and left at room temperature on a 45° slant overnight. The day after, single germinated spores were observed under a dissecting microscope. Small agar plugs including a single germinated spore were lifted using a sterilised needle (0.80 × 38 mm, Terumo, Belgium) and transferred to an EPAA plate in order to reduce the chance of bacterial contamination and incubated at 24°C for 2 days. Well grown colonies were subcultured onto PDA plates to grow for another 2 days. Plates were incubated similar to the condition described formerly. To induce Paraphoma species to sporulate, OA culture plates were incubated at 2022°C in dark for one week and then under 11hr/13hr dark/UV light regime (Boerema et al. 2004) for one month. An alternative method was used to induce sporulation by placing fungal mycelial plugs next to 5 cm pieces of double autoclaved pyrethrum flower stems on WA. Similar single sporing technique was used for Paraphoma spp. 3.3. Preservation 3.3.1. Short-term Mycelial plugs were prepared from 7-day-old single spored colonies grown on PDA for Fusarium spp. and on OA for Paraphoma spp. and transferred into sterilised CryoTubes (Thermo Fischer Scientifics, Australia) containing sterilised water. Tubes were 39 Chapter 3: Methodology labelled and kept in a cold room at 4°C. To revive colonies, plugs were directly cultured on PDA. In addition, 5 cm pieces of double autoclaved pyrethrum flower stems which were colonised by Fusarium spp. and Paraphoma spp. on WA were placed separately in small paper bags and stored at room temperature in a desiccator containing silica gel. To revive cultures, flower stems were cut into 0.5 cm pieces using a sterilised scalpel and transferred onto PDA/OA. 3.3.2. Long-term Single spored young colonies of Fusarium and Paraphoma grown on PDA or OA were used for long-term storage. Blocks of agar were cut from the growing margins of the colonies using a sterilised borer and transferred into empty sterile Petri dishes with the lids covering 75% of the Petri dish, and left in a biohazard cabinet overnight to dry. Plugs were transferred into sterilised Cryo-vials and labelled. Vials were stored in a -80 freezer. 3.4. DNA extraction and PCR amplification A sterile scalpel was used to scrape 7-day-old fungal mycelia off the plate which was ground with liquid N using a mortar and pestle until a fine powder was obtained. To avoid DNA thawing and degrading, microcentrifuge tubes were kept in a polystyrene box containing liquid N after grinding and before buffer AP1 was added. For each gel run, 3 µL of DNA plus 2 µL of loading dye (Invitrogen, Australia) were loaded into wells. A stock of 10 ng/µL was prepared for DNA products after sizing the bands using a Lambda DNA/HindIII Marker (Thermo Ficsher Scientific, Australia). DNA products were amplified using primers of specific fungal genes according to references. However, a range of five different temperatures, below and above the primer melting temperature (Tm) was tested to determine the primer’s optimal annealing temperature using gradient PCR technique. To amplify EF1, a Touchdown PCR, started from 10°C above the annealing temperature of the primer, following the protocol of Rehner (2001) at http://www.aftol.org/pdfs/EF1primer.pdf was also carried out in order to obtain bands with the highest intensity. All the PCRs were carried out in a 12.5 µL volume/reaction. Thereafter, a gel was run by loading 2 µL of the PCR products plus 1.3 40 Chapter 3: Methodology µL of loading dye into each well. Bands were compared to a 1 kb ladder (Invitrogen, Australia). Agarose gels were made using SYBER-Safe DNA gel stain (USA) and visualised with a GelDoc (BioRad, Australia). 3.5. Microtome sectioning Tissues were incubated in Formaldehyde Acetic Acid (FAA) for 48 hr. After 2 days, FAA was poured off and tissues were rinsed in 20% Tertiary Butyl Alcohol (TBA). Samples were dehydrated in increasing tertiary butyl alcohol concentrations (20, 40, 60, 80% and 3 times in 100%) for 15 min at each concentration. Then they were immersed in TBA and xylene (1:1) solution and incubated at room temperature in the fume hood for 2 hr. Samples were immersed in 100% xylene for another 2 hr at room temperature. Xylene was used as clearing agent and made the samples more translucent. Thereafter, samples were left in a mixture of 50% paraffin – 50% xylene in Falcon tubes which were placed into a rack and the whole rack was left in water bath at 55-60̊ C overnight. The day after, 50% paraffin was replaced with 100% paraffin and left for another 2 days in the water bath at 58̊ C. Fresh paraffin was changed twice a day. After 2 days, samples were taken out of the paraffin and placed on a hot plate in order to maintain paraffin in a liquid phase. Using a metal mold, tissue was embedded in paraffin and fixed in the mold. The tissue was oriented inside the mold for both longitudinal and transverse sectioning. A plastic mold was placed on top of the metal mold, the mold was filled with liquid paraffin and placed on the cold plate to solidify. Blocks were ready to be sectioned after 30 min. Before sectioning, blocks were trimmed with a sharp razor blade then sectioned using a Leica microtome RM2125 RTS. Sections of 6 µm thickness were mounted on glass slides. The slides were placed on a hot plate to expand the paraffin sections. Slides were dried using a piece of tissue paper then transferred to the fume hood. 100% xylene was dropped on the slides and kept for 10 minutes. A few minutes after the wax dissolved, slides were rinsed with decreasing concentrations of ethanol (100%, 75%, 50% and 25%) for 10 minutes at each concentration. Ethanol was used to remove the xylene. The slides were rinsed with sterilised water. Sections were stained with the Johansen 41 Chapter 3: Methodology quadruple staining method described by Bhuiyan et al. (2015) and mounted using a mounting liquid (Micromount Surgipath Australia) and visualised with bright field and differential inference contrast illuminations. 42 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Chapter 4 Isolation and identification of fungal pathogens from pyrethrum in yield-decline affected fields of northern Tasmania 4.1. Introduction Many pathogens have been isolated from pyrethrum plants that cause devastating diseases affecting pyrethrum growth and reducing pyrethrin content in flowers. Ray blight of pyrethrum caused by S. tanaceti is one of the most devastating diseases causing significant yield loss in Tasmania annually. Ray blight has been managed successfully applying fungicides however, this form of control is not sustainable especially under cool and moist environmental conditions that favour disease (Vaghefi et al. 2015). Bhuiyan et al. (2015) showed that the pathogen colonised leaf lamina by direct parenchyma cells or penetration and moved between mesophyll moved horizontally in epidermal cells however, more investigations are needed to determine the role of S. tanaceti in crown and root infections and in yiedl-decline. The incidence of infection by Didymella tanaceti the causal agent of tan spot has considerably increased (Hay et al. (2015). Other foliar pathogens such as C. tanaceti, Alternaria spp., P. chrysanthemicola, S. botryosum and Itersonilia perplexans that cuase necrotic and water-soaked leaf lesions have been less frequently isolated and appear to be influenced by favourable environmental conditions (Hay et al. (2015). This emphasises the fact that many foliar pathogens exist in the field that can infect and cause disease in pyrethrum and shows the possibility that these fungi can become severe pathogens of pyrethrum with a change of environmental conditions that favour specific fungal pathogens. Soil-borne diseases of pyrethrum have not been recognized as of major concern and hence, not many investigations have been carried out to determine the role these pathogens have on pyrethrum yield-decline. Phytophthora spp., R. solani, V. dahliae and Fusarium spp. have been isolated from the roots and soils where pyrethrum yield-decline was observed (Groom 2014; Pethybridge et al. 2010a). However, the role these pathogens play in yield-decline and their interaction with other 43 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum pathogens play in yield-decline and their interaction with other pathogens and environmental stresses needs to be further assessed. Phytophthora spp. were the most prevalent pathogens isolated from the roots of pyrethrum in yield-decline affected fields of northern Tasmania but the pathogenicity of these isolates to pyrethrum was never assessed (Pethybridge et al. 2010a). The aim of this chapter, was to isolate and identify putative fungal pathogens from the leaves, petioles, crowns and roots of yield-decline affected pyrethrum plants. The most frequently isolated putative pathogens were identified using ITS gene sequencing and the disease incidence and severity of the pathogens assessed using pathogenicity tests. The importance of this chapter is to broaden the knowledge of soil-borne pathogens that currently cause disease of pyrethrum plants in yield-decline sites of northern Tasmania. 4.2. Materials and Methods Part A. Isolation and identification of fungal pathogens from yield-decline affected plants 4.2.1. Sample collection In June 2014, two pyrethrum plants each were randomly selected and uprooted with intact sub-crown and partial root systems from nine yield-decline affected fields in northern Tasmania. These nine fields were planted in September 2012 with RS7, BR1 and RS5 varieties. Previously potato and poppy plants were grown in these fields. The highest rainfall rate was observed in May and July 2012 (98.4 and 121.6 mL/month respectively). Fields mostly sloped to the south. Plants were transferred into plastic bags with detailed information of symptoms, site number and cultivar. Bags were placed into a polystyrene box and surrounded by icepacks. Plants were sent to the University of Melbourne and stored in cold room until further processing. The crown tissue discolouration was assessed based on a visual scale where 0= no discolouration, 1= mild discolouration and 2= severe discolouration. 44 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Table 1. Information of pyrethrum plants collected from nine yield-decline affected sites of northern Tasmania Crown discolouration scale Site Symptoms 49206 Healthy roots, grey old leaves dried, reddish-brown lesions darker at the edge and lighter approaching the centre on both sides of the leaves, in some leaves lesions encompassed the entire leaf, black round lesions at the base of the flower stems 1 RS7 74201 Healthy roots, young new shoots grew out of the plant, reddish-brown lesions darker at the edge and lighter approaching the centre on both sides of the leaves, old leaves wilted and died, black round lesions at the base of the flower stems 0 NA 76406 Healthy roots, young new shoots and green leaves grew out of the plant, reddish-brown lesions darker at the edge and lighter approaching the centre on both sides of the leaves, black round lesions at the base of the flower stems 0 86901 Healthy roots, young new shoots and green leaves grew out of the plants, reddishbrown lesions darker at the edge and lighter approaching the centre on both sides of the leaves, black round lesions at the base of the flower stems 1 45 Cultivar NA NA Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum 46410 Healthy roots, large number of young new shoots and leaves grew out of the plant, reddishbrown lesions darker at the edge and lighter approaching the centre on both sides of the leaves, black round lesions at the base of the flower stems 1 BR1 47110 Healthy roots, young new shoots and green leaves grew out of the plants, same spots on the leaves but less than the other sites, black round lesions at the base of the flower stems 2 NA 49207 Healthy roots, young new shoots and green leaves grew out of the plant, reddish-brown lesions darker at the edge and lighter approaching the centre on both sides of the leaves, black round lesions at the base of the flower stems, petioles fresh at the base and dried and curved at the end, white fluffy mycelium on the crown tissue 1 RS5 49301 Healthy roots, old leaves grey in colour and dried, reddishbrown lesions darker at the edge and lighter approaching the centre on both sides of the leaves, in some leaves lesions encompassed entire leaf, black round lesions at the base of the flower stems 2 RS7 46 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum 64209 Healthy roots, old leaves grey in colour and dried, reddishbrown lesions darker at the edge and lighter approaching the centre on both sides of the leaves, in some leaves lesions encompassed entire leaf, black round lesions at the base of the flower stems 2 NA 4.2.2. Isolation of fungal pathogens One plant from each site was selected and roots were washed gently under the tap water for 5 minutes to remove excess soil. Plants were transferred to the laboratory in clean plastic bags. Tissues from the upper roots, crowns, petioles and leaves were sectioned (3 replicates each) and surface sterilised in 80% ethanol for 30 sec, 1% active ingredient (ai) sodium hypochlorite for 1 min and then transformed to sterilised water twice for 1 minute respectively. Tissues were then blotted on a sterilised paper towel and cultured onto both water agar and EPAA. Plates were incubated at 23° C for 3-4 days until fungal hyphae were observed growing from the tissue. Mycelium was subsequently subcultured onto PDA and incubated for a further 5 days at 23 °C. Young shoots and dried pieces of the base of the flower stems were also randomly selected and placed on moistened filter paper inside Petri dishes. The filter papers were moistened with distilled water to enhance humidity. Plates were incubated for 5 to 10 days at 20-24°C, and then stem pieces were observed under a stereomicroscope. Fungal structures and fruiting bodies were then collected with a sterile needle, mounted on a microscope slide and observed under compound microscope. 4.2.3. Identification of fungal pathogens 4.2.3.1. Morphological description Single spore colonies were obtained from isolates which were grown on PDA and incubated for 10 days at 22-24°C with a 12 hr photoperiod, under cool white fluorescent light (Burgess and Summerell 1992) and single spored as described. 47 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Cultures were identified based on colony morphology and colour; spore shape and size, presence or absence of chlamydospores, micro and macro conidia, sporodochia, mono or poly-phialides, pycnidia and pseudothecia (Barnett and Hunter 1972). Many of the Hyphomycete fungi, especially in the Fusarium-like genus, were difficult to identify based on culture and spore morphology, hence these were divided into different morphotypes. 4.2.3.2. Molecular taxonomy DNA extraction and PCR amplification of ITS gene Thirteen Hyphomycete isolates from a range of morphotype groups were selected for molecular analysis. Fungal mycelia were scraped directly from 7-day-old single spored cultures on PDA and were ground with liquid nitrogen using a mortar and pestle. DNA was extracted using the DNeasy Plant Mini Kit (Qiagen) following the manufacture’s instruction and quantified by comparing the band density to a set of molecular markers after electrophoresis in 1.5% agarose gel. 550 bp of the Internal transcribed spacer region (ITS) was amplified with ITS1 (forward:CAACTCCCAAACCCCTGTGA) and ITS4 (reverse: GCGACGATTACCAGTAACGA) (White et al. 1990). PCR was performed in 20 µL reaction volumes containing 2 mM MgCl (Invitrogen, Australia), 1 unit of MangoTaq (Invitrogen, Australia) DNA polymerase, 200 µM dNTPs (Invitrogen, Australia) and PCR reaction buffer 5X (Invitrogen, Australia) and 1.0 µL of template DNA (White et al. 1990). The annealing temperature was adjusted to 56°C. DNA amplification was carried out using an Eppendorf thermal cycler (BioRad, Australia). PCR products were then purified using QIAquick PCR purification kit (Qiagen) and an electrophoresis gel was run after purification to test the integrity of the bands. All PCR and purification products were stained in ethidium bromide and visualised under UV light. Sequencing and phylogenetic analysis Purified amplicons were sent to Australian Genome Research Facility Ltd. (AGRF) for sequencing. Sequence intensity was assessed using Chromas Lite MFS and then were aligned using the multiple alignment program ClustalW. To obtain the best alignment 48 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum results, sequences were edited both manually using the sequence alignment editing program MEGA6 and electronically, browsing the sequences in MAFFT (http://mafft.cbrc.jp/alignment/software/). Phylogenetic trees were constructed for each genus individually in MEGA6. Trees were analysed using Maximum Parsimony statistical method. The best substitution model for each individual tree constructed for each genus, was determined using MEGA6. To assess the relative stability of branches, bootstrap analysis with 1000 pseudoreplicates was performed. Gaps were treated as missing data. Gene bank accession numbers for Fusaruim spp. were derived from O'Donnell et al. (2009a), Bakan et al. (2002), O'Donnell et al. (2013) and O'Donnell et al. (2007), for Rhizoctonia spp. from Johanson et al. (1998) and González et al. (2006), for Bionectria spp. from Hirooka and Kobayashi (2007) and Paul et al. (2013), and for Plectosphaerella spp. from Carlucci et al. (2012). Part B. Pathogenicity of putative fungal species To investigate the role of pathogenic fungal species on the growth of pyrethrum plants, two experiments were conducted. 4.2.4 Glasshouse experiment 1 Pyrethrum seedlings of cultivar Pyrate were germinated from steam sterilised seed and raised in seedling mix in Tasmania. Seedlings were then sent to University of Melbourne and in May 2014, 700 seedlings were each transferred to 10 cm diameter pots with potting mix and fertilized with 5 g of Osmocote (Scotts, Australia) per pot. Pots were then left in glasshouse for 2 months. To confirm purity of cultures used for inoculation, spore suspensions were prepared from the single spore cultures of F. oxysporum (5 isolates), F. avenaceum (5 isolates), F. venenatum (1 isolate) and F. equiseti (2 isolates), Paraphoma sp., Bionectria spp., Plectosphaerella sp. and Rhizoctonia spp. and the concentration of each spore suspension was calculated to 10 spore/mL using a haemocytometer (Table 2). Three inoculation methods of root-dip, foliar spraying and placing mycelial plugs on detached petioles were considered for inoculation of the plants in the glasshouse. For the root and foliar spray inoculations, there were three replicates for each isolate and a total number of 120 plants (considering the controls). 49 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Two different irrigation methods were used, drippers for the plants which were spray inoculated, and sprinklers for the root-dip inoculated plants. Table 2. Species and isolates used for inoculation of plants in glasshouse with root-dip and foliar spray inoculation methods F. oxysporum UoM005 UoM006 UoM0011 UoM0015 UoM0025 F. avenaceum UoM001 UoM002 UoM0012 UoM0014 UoM0016 F. venenatum UoM0020 F. equiseti UoM0022 UoM0023 Bionectria spp. UoM004 UoM0010 Plectosphaerella sp. UoM0021 UoM008 Rhizoctonia sp. UoM0019 U0M009 For foliar inoculation 50 mL of the spore suspension was used to spray the plants with a hand sprayer. Each pot was then covered with a plastic bag for 24 hr with water added to each plastic bag to enhance humidity. After 24 hr bags were removed and pots were maintained in the glasshouse for 2 months. For root-dip inoculation plants were uprooted from the potting mix and roots were washed in tap water for 5 min. They were dipped into 200 mL of spore suspension and were then transplanted into new 10 cm pots filled with potting mix. All pots were maintained in the glasshouse for a further 2 months. Control plants in both treatment methods were inoculated with sterile water. After 2 months, plants from both foliar spray and root-dip inoculation methods were harvested and roots were washed with tap water for 5 min. Plants were placed in plastic bags, taken to the laboratory, tissue from the crown of each plant was sectioned and cultured onto WA and incubated for 3 days at 24 °C. Fungal mycelia were then subcultured onto PDA and incubated for 5 days for morphological identification. In order to measure the above and below-ground biomass, plants were packed in paper bags and placed into an oven at 71 °C for 3 days for dry weight measurement. 50 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Leaf petioles from healthy pyrethrum plants growing in the glasshouse were detached and transferred to the laboratory in plastic bags. Filter papers were placed inside plastic containers and sterilised water was added to each container to increase humidity. Sterilised detached petioles were placed inside the containers (3 replicates each container) and mycelial plugs from each isolate were set on the petioles. Pure PDA blocks were used to inoculate control plants. Containers were then incubated for 7 days at 24 °C. 4.2.4.1 Assessment of glasshouse experiment 1 Detection of the pathogen on pyrethrum leaves Eleven days after inoculation, senesced and curled leaves were randomly selected from each replicate of both sprayed and root-dipped plants, surface sterilised and cultured onto WA. They were incubated at 25°C for 3 days. Fungal mycelia were subcultured onto PDA and incubated for a further 6 days. Detection of the pathogen on pyrethrum petioles Petioles from both sprayed and root-dipped plants were detached (one petiole per replicate) and transferred to the laboratory in plastic bags. The bottom to the middle section of the petioles of plants sprayed with spore suspension tissues were surface sterilised and then sectioned, for culturing on WA and incubated for 5 days at 23°C. For the plants root-dipped inoculated only tissues from the base of the petiole were considered for culturing. Hyphae were then subcultured onto PDA and incubated for another 7 days. 4.2.5. Glasshouse experiment 2 In this experiment, four replicates of healthy pyrethrum plants were inoculated by dipping the roots in 10⁵ spore/mL spore suspension of the most frequently isolated fungi in experiment 1: UoM0011 (F. oxysporum), UoM0023 (F. equiseti), UoM0014 (F. chlamydosporum), UoM0021 (Plectosphaerella sp.). They were then transplanted into 15 cm diameter (1.5 L) pots and maintained in the glasshouse for 4 months. Inoculated plants were harvested after 4 months and tissues from the leaves, petioles, crowns and roots were cultured and subcultured onto water agar and PDA respectively. They were 51 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum then placed into paper bags and dried in the oven for three days at 70°C for dry weight measurement. Results from measuring the dry weight were statistically analysed in a one-way ANOVA using Statistical Analysis System (SAS) computer package. 4.3. Results Part A. Isolation and identification of fungal pathogens from yield-decline affected plants Symptoms In the field survey conducted in June 2014, green shoots and leaves were able to grow in most diseased pyrethrum plants while some plants were unable to regrow and died. Brown and water soaked lesions were observed on both sides of the leaves. Flower buds and heads were curved approaching the end of the branched flower stems. Severe crown discolouration and growth reduction were also observed on the yield-decline affected plants. Roots were weak and in some cases no feeder roots were observed. In some cases pseudothecia-like fungal fruiting bodies were observed at the base of the senesced flower stems. 52 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Fig.1. Symptoms associated with yield-decline of pyrethrum in the fields of northern Tasmania; A internal crown discolouration; B necrotic leaf spots; C weak root expansion of the plants; D die back and poor regrowth of a yield-declined pyrethrum plant. Image D was adapted from Groom (2014) Isolation and identification of fungal pathogens Using morphological characters and molecular identification based on ITS gene sequences, Fusarium spp. (89% of sites, S. tanaceti (ray blight, 89%, Paraphoma sp. and D. tanaceti (67%, were the most frequently isolated fungi from the nine sites (Table 3. Alternaria spp., P. cucumerina, R. oryzae-sativa, B. ochroleuca, Stemphylium sp., Cladosporium sp. and Epicoccum sp. were isolated in lower percentages from the roots, crowns, petioles and leaves. 53 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Plectosphaerella sp., Bionectria spp. and Rhizoctonia sp. were identified based on ITS gene sequence and separated from the nine Fusarium species which were tentatively identified as F. oxysporum, F. avenaceum, F. venenatum and F. equseti (Figures 2-5). Plectospharella sp., clustered with P. cucumerina species complex (Figure 3). Bionectria isolate (UoM004) clustered with other Bionectria ochroleuca reference isolates (Figure 4) and Rhizoctonia clustered with species of R. oryzae-sativae species complex in ITS phylogenetic trees (Figure 5). Of the sites where the plants had severe necrosis of the crown tissue (Table 1), Paraphoma sp. was isolated from sites 47110 and 64209, whereas Fusarium spp. were isolated from plants in sites 47110, 49301 and 49206 (Table 4). Isolates of F. oxysporum were mostly isolated from the crown and basal petiole and root tissue and in lower percentages from the leaves. Stagonosporopsis tanaceti was isolated from the crown and/or roots of 50% of the infected plants as well as from the leaf and petiole tissues indicating that S. tanaceti was the most important pathogen among isolates identified in yield-decline affected sites. In four fields, the crown tissue, and in one field the root tissue was found to be infected with the pathogen. Paraphoma sp. was mostly isolated from the root tissue but in one plant each from the crown, petiole and leaf tissues. In contrast, D. tanaceti (foliar pathogen) was only isolated from the leaf or petiole tissues. Different Fusarium spp. isolates were isolated frequently from the crown and root and in rare cases from the leaves and petioles of pyrethrum plants in yield-decline affected sites. In Table 3, isolate UoM0011, F. oxysporum was the most frequent species identified from root and crown tissue of affected pyrethrum plants from 3 different sites, and UoM0025 was isolated from 2 sites. Other isolates were isolated from one site only. 54 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Fig.2. Various colony morphologies of isolates recovered from pyrethrum in yielddecline affected sites; A Paraphoma vinacea; B-D F. oxysporum strains (UoM0015, UoM0011 and UoM005); E-G F. avenaceum morphotypes (UoM002, 12 and 14); H F. venenatum (UoM0020); I F. equiseti (UoM0023); J-M S. tanaceti morphotypes; N-O Chladosporium spp.; P D. tanaceti; Q R. oryzae-sativa (UoM0019); R B. ochroleuca (UoM004); S Stemphylium sp.; T P. cucmerina (UoM0021) 55 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Table 3. Isolates from leaf, petiole, crown and root of pyrethrum plants of northern Tasmania identified based on morphological and ITS gene sequencing Site No. 47110 46410 74201 64209 49301 76406 49206 49207 86901 Tissue Root Crown Petiole Leaf Root Crown Petiole Leaf Root Crown Petiole Leaf Root Crown Petiole Leaf Root Crown Petiole Leaf Root Crown Petiole Leaf Root Crown Petiole Leaf Root Crown Petiole Leaf Root Crown Petiole Leaf Isolates distribution % 56 S. Fusarium Paraphoma tanaceti spp. sp. ● ● ● Didymella tanaceti Alternaria spp. Plectosphaerella Rhizoctonia Stemphylium Cladosporium Bionectria Epicoccum ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 89% ● 89% ● ● 67% 67% 33% 44% 44% 22% 22% 11% 11% Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Table 4. Fusarium isolates from different pyrethrum plant tissues in yield decline affected fields of northern Tasmania. The UoM code was given to each isolate to represent different morphological variations of each species; isolates identified by the PCR of the ITS genes are shown in red Fusarium strains isolated from different fields Site 47110 46410 74201 64209 49301 76406 49206 49207 86901 57 Tissue Root Crown Petiole Leaf Root Crown Petiole Leaf Root Crown Petiole Leaf Root Crown Petiole Leaf Root Crown Petiole Leaf Root Crown Petiole Leaf Root Crown Petiole Leaf Root Crown Petiole Leaf Root Crown F. oxysporum UoM005 UoM006 F. avenaceum UoM0011 ● UoM0015 UoM0025 UoM001 UoM002 UoM0012 UoM0014 UoM0016 F. venenatum UoM0020 F. equiseti UoM0022 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● UoM0023 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Petiole Leaf 58 ● Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Fig.3. One of the three most parsimonious ITS trees (length = 110) is shown. The consistency index (CI) = 84%, the retention index (RI) = 97% for parsimony-informative sites. The MP tree was obtained using the Subtree-Pruning-Regrafting (SPR) algorithm. The analysis involved 28 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 431 positions in the final dataset. Evolutionary analyses were conducted in MEGA6 (Tamura et al. 2013b). The tree is rooted 59 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum to F. concolor (O'Donnell et al. 2009a). Maximum likelihood (ML) values are presented under nodes. K2+G was determined as the best substitution model using MEGA6 (Tamura et al. 2013a). Scale bar shows the number of changes per site Fig.4. Maximum Likelihood phylogenetic tree of ITS for Plectosphaerella spp. based on the Tamura-Nei model (Tamura and Nei 1993). The tree with the highest log likelihood (-1105.9462) is shown. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 12 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 402 positions in the final dataset. Evolutionary analyses were conducted in MEGA6 (Tamura et al. 2013a). The tree was rooted to C. agaves (CBS 318.79) (Carlucci et al. 2012). Isolate UoM0021, P. cucumerina used in the phylogenetic analysis is highlighted in red. K2+I was determined as the best substitution model using MEGA6 (Tamura et al. 2013a). Scale bar shows the number of changes per site 60 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Fig.5. Maximum Likelihood phylogenetic tree of ITS for Bionectria spp. based on the Tamura-Nei model (Tamura and Nei 1993). The tree with the highest log likelihood (-802.6242) is shown. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 10 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 376 positions in the final dataset. Evolutionary analyses were conducted in MEGA6 (Tamura et al. 2013a). The tree was rooted to I. japonica (BCC 2821) (Paul et al. 2013). Isolate UoM004, B. ochroleuca used in the phylogenetic analysis is highlighted in red. K2 was determined as the best substitution model using MEGA6 (Tamura et al. 2013a). Scale bar shows the number of changes per site 61 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Fig.6. Maximum Likelihood phylogenetic tree of ITS for Rhizoctonia spp. based on the Tamura-Nei model (Tamura and Nei 1993). The tree with the highest log likelihood (-1587.2715) is shown. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 15 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 376 positions in the final dataset. Evolutionary analyses were conducted in MEGA6 (Tamura et al. 2013a). The tree was rooted to Waitea circinata (IMI 375119) (Johanson et al. 1998). Isolate UoM0019, R. oryzae-sativa used in the phylogenetic analysis is highlighted in red. HKY+G was determined as the best substitution model using MEGA6 (Tamura et al. 2013a). Scale bar shows the number of changes per site 62 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Table 5. List of isolates with related strain numbers for ITS gene sequencing Genus Fusarium 63 Isolates Strain/culture collection No. Location Isolate source ITS Accession No. F. avenaceum UoM002; BRIP 64445 Australia- Tasmania Tanacetum cinerariifoilum, root and crown KU529152 F. avenaceum UoM0012; BRIP 64442 Australia- Tasmania Tanacetum cinerariifoilum, leaf KU529153 F. avenaceum UoM0014; BRIP 64443 Australia- Tasmania Tanacetum cinerariifoilum, crown KU529154 F. avenaceum UoM0016; BRIP 64444 Australia- Tasmania Tanacetum cinerariifoilum, petiole KU529155 F. avenaceum NRRL 34036 Colorado Human ethmoid sinus GQ505453 F. avenaceum NRRL 45999 California Human scalp GQ505465 F. avenaceum NRRL 36147 Unknown Human bronchial secretion GQ505452 F. avenaceum NRRL 45994 Texas Cloaca GQ505432 F. concolor NRRL 13459 South Africa Plant debris GQ505674 F. culmorum NRRL 25475 Japan - U85543 F. equiseti UoM0022; BRIP 64447 Tasmania; Australia Tanacetum cinerariifoilum, crwon KU529156 F. equiseti UoM0023; BRIP 64448 Tasmania; Australia Tanacetum cinerariifoilum, petiole KU529157 F. equiseti NRRL 20697 Chile Beet GQ505683 F. equiseti NRRL 26419 Germany Soil GQ505688 F. equiseti NRRL 36136 Unknown Unknown GQ505733 F. equiseti NRRL 26417 Cuba Leaf litter GQ505687 F. equiseti NRRL 28577 Romania Grave stone GQ505692 F. equiseti NRRL 32865 Brazil Human endocartitis GQ505703 F. oxysporum UoM005; BRIP 64449 Tasmania; Australia Tanacetum cinerariifoilum, root and crown KU529150 F. oxysporum UoM0011; BRIP 64441 Tasmania; Australia Tanacetum cinerariifoilum, root and crown KU529151 F. oxysporum NRRL 43539 Missouri Cornea DQ790552 F. oxysporum NRRL 43504 Pennsylvania Cornea EF453107 F. oxysporum NRRL 43466 Ohio Contact lens case EF453091 F. oxysporum NRRL 43521 Florida Cornea EF453114 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Plectosphaerella Bionectria 64 F. oxysporum NRRL 43668 New Jersey Cornea EF453151 F. oxysporum NRRL 43431 Connecticut Cornea DQ790535 F. venenatum UoM0020; BRIP 64446 Tasmania; Australia Tanacetum cinerariifoilum, crown KU529149 F. venenatum NRRL 22196 England - AF006342 P. cucumerina UoM0021 Australia- Tasmania Tanacetum cinerariifoilum, root and crown - P. cucumerina Plec 7 Italy Melon collar HQ238978 P. cucumerina Plec 11, CBS 131739 Italy Melon collar HQ238980 P. cucumerina Plec 4 Italy Melon collar HQ238977 P. cucumerina Plec 341 Italy Tomato root HQ239002 P. citrullae Plec 157; CBS 131741 Italy Watermelon root HQ238962 P. citullae Plec 189 Italy Watermelon root HQ238964 P. citullae Plec 151; CBS 131740 Italy Melon root HQ238961 P. alismatis CBS 113362 Italy Alismata plantago-aquatica JF780523 P. delsorbi CBS 116708 Italy Curcuma alismatifolia EF543847 P. melonis Plec 211; CBS 131858 Italy Melon collar HQ238695 Colletotrichum agaves CBS 318.79 Netherlands Agave DQ286219 B. ochroleuca BBA 68698 Germany Clonostachys rosea AF106532 B. ochroleuca ATCC 48395 USA Clonostachys rosea GU256754 B. ochroleuca UoM004 Australia-Tasmania Tanacetum cinerariifoilum, root and crown - B. ochroleuca RSF_P102 Austria Clonostachys rosea HQ115729 B. ochroleuca OUT 430 Canada Clonostachys rosea GU934503 Clonostachys rosea f. catenulata NRRL 22970 USA Clonostachys rosea HM751081 B. ochroleuca CGA 605-5 Mexico Clonostachys rosea DQ279793 B. ochroleuca wxm12 China Clonostachys rosea HM037946 Gliocladium roseum G97012 China Clonostachys rosea AJ309334 Isaria japonica BCC 2821 Thailand Isaria japonica EU828662 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Rhizoctonia 65 R. oryzae-sativae IMI 375129 Coê te d'Ivoire Rice AJ000191 R. oryzae-sativae IMI 062599 Japan Rice AJ000192 R. oryzae-sativae IMI 375130 Japan Rice AJ000193 R. oryzae-sativae IMI 375133 Japan Rice AJ000194 R. oryzae/Waitea circinata IMI 375119 Japan Rice AJ000196 R. solani IMI 360366 Vietnam Rice AJ000199 R. solani IMI 360038 Coê te d'Ivoire Rice AJ000200 R. oryzae-sativae UoM0019 Australia; Tasmania Tanacetum cinerariifoilum, root and crown - R. oryzae-sativae C-662 Japan Soil AF354092 R. oryzae-sativae SIR-2 Japan Soil AF354092 R. solani 22Rs Japan Soil AF354070 R. solani W45b3 US Wheat AF354111 R. solani ATCC 66159 US Soybean AF354060 R. solani TE2-4 Japan Soil AB000044 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Part B. Pathogenicity of putative fungal species Experiment 1 Inoculation methods After 2 months, plants sprayed with Fusarium spore suspension had crown tissues infected with F. oxysporum (UoM0011, UoM005, UoM0025) and F. avenaceum (UoM0012). Other isolates were not isolated from different tissues of plants sprayed with spore suspension (Table 6). Petioles, crowns and roots of root-dipped pyrethrum plants were infected with F. oxysporum (UoM0011, UoM005, UoM0025, UoM0015) and Bionectria spp. (UoM004) after 2 months. Petioles and mostly the crown tissues of plants of all three replicates inoculated with Paraphoma sp. in both inoculation methods were infected. Crown discolouration was observed in root-dip inoculated plants. In the first experiment, visual observation of plants in the glasshouse showed a difference between the heights of the root-dipped plants and the sprayed plants. Plants which were root-dipped in spore suspension were slightly shorter than those sprayed. Seven days after inoculation of the detached petioles with mycelial plugs of all isolates, tissues from 1 to 4 cm below and above the mycelial plug were infected. Brown and necrotic lesions appeared under the inoculation point of all three replicates except for Paraphoma sp. which was not infected. 66 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum Table 6. Isolates identified on different plant tissues after three different inoculation methods. This table includes all isolates (Fusarium oxysporum, Fusarium avenaceum, Fusarium equiseti, Plectosphaerella cucumerina, Paraphoma sp. and Bionectria ochroleuca) used in both experiments. The rest were not reisolated. 1=infection 0=no infection F. oxysporum F. F. equiseti avenaceum P. cucumerina B. Paraphoma ochroleuca sp. Inoculation UoM UoM UoM UoM UoM UoM UoM UoM UoM UoM UoM UoM UMPv methods 005 006 0011 0015 0025 0023 0014 0012 008 009 0021 004 005 Root-dip 1 0 1 1 1 1 1 0 1 0 1 1 1 Spray 1 0 1 0 1 0 0 1 0 1 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 0 Mycelial plug Assessment of glasshouse trial Six fungal isolates were obtained from the leaves collected from either sprayed and root-dipped plants. Plectosphaerella cucumerina (UoM009, UoM0021), F. equiseti (UoM0023) and F. oxysporum (UoM006), were isolated from the root-dipped plants and in a few cases P cucumerina and F. oxysporum were isolated from the leaves of the plants sprayed with spore suspension. No infection could be found on the petioles of plants sprayed with spore suspension, while for plants root-dip inoculated, isolates F. oxysporum (UoM0015, UoM0025, UoM0011), Pcucumerina (UoM009) and F. avenaceum (UoM0014) were isolated from the basal petioles. Experiment 2 Plants in the glasshouse inoculated with F. oxysporum (UoM0011) and F. avenaceum (UoM0014) resulted in infection of crown and basal petiole tissue. Fusarium oxysporum was very virulent as it was recovered from the crown and basal petiole tissue of most of the plants. Fusarium equiseti (UoM0023), P. cucumerina (UoM0021) 67 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum and B. ochroleuca (UoM004) were not isolated from different tissues of the inoculated plants. The dry weight of pyrethrum plants in this trial was mostly not significant with only F. oxysporum and F. equiseti significantly reducing the total biomass. The above-ground biomass was significantly reduced by F. oxysporum and P. cucumerina. Table 7 shows the effect of each isolate on the mean dry weight of inoculated plants and the least significant difference (LSD) of three different groups of dry weights (above, below and total). Table 7. A comparison of the dry weight of pyrethrum plants inoculated with Fusarium oxysporum, Fusarium avenaceum, Fusarium equiseti, Plectospherella cucumerina comparing least significant difference of the means (LSD test). Means with different letters in each row are significantly different Dry weight (g Total Above-ground Below-ground Control F. oxysporum F. avenaceum P. cucumerina F. equiseti LSD 12.02a 9.31b 10.24ab 9.44ab 8.50b 2.6 6.76a 5.18ab 5.36ab 4.66b 4.13b 1.7 5.26a 4.13a 4.89a 4.78a 4.37a 1.2 4.4. Discussion Part A Isolation and identification of fungal pathogens The sample collection in June 2014 from the yield-decline affected fields of northern Tasmania showed that S. tanaceti and Fusarium spp. were the most frequent fungal pathogens isolated from the leaf, basal petiole, crown and root tissues as 89% of the fields were infected with each pathogen. Stagonosporopsis tanaceti remained the most frequently isolated species recovered mostly from the leaf and petiole tissues with less isolation frequency from the infected crown and roots. Fusarium oxysporum and F. avenaceum isolated from basal petioles, crowns and root tissues were found to be the most prevalent pathogens compared to F. venenatum and F. equiseti. Parsaphoma spp. 68 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum were also frequently isolated from the discoloured crown and root tissues. Similar isolation rate was observed from infected leaf and petiole tissues with D. tanaceti. Diseases caused by Fusarium are cosmopolitan. Many species are pathogenic and cause intensive vascular wilts of cash crops in the world. Some populations are initially endophytes and become pathogens later in their life cycle and some are saprophytes living on dead material (Laurence et al. 2011). However, determination of their ecological role is not simple as their life cycle can change by either biotic or abiotic stresses (Laurence et al. 2011). The reason for Fusarium species being hard to identify is that they vary widely in morphological and non-morphological characteristics such as virulence and this criteria are used in taxonomic systems (Windles 1991). Molecular and phylogenetic studies have effectively improved identification of Fusarium isolates to species level. Pethybridge et al. (2008d), reported that Fusarium diseases were exacerbated in waterlogged soils with lower capability of drainage and nematodes. Fusarium infection is highly related to temperature changes (Mandeel et al. 1995; Sangalang et al. 1995). Tasmania possesses cold and wet winters following dry summers. A long wet period, would most likely, make pyrethrum plants vulnerable to a range of fungal pathogens such as Fusarium wilt and root rot. Fusarium spp. and Paraphoma sp. were often associated with root and crown diseases (De Gruyter et al. 2013; Laurence et al. 2011) whereas S. tanaceti and D. tanaceti were known as foliar pathogens. Plectosphaerella cucumerina and Rhizoctonia oryzae-sativa had similar infection rate of 44% and were not found to be associated with growth reduction in glasshouse experiments. Bionectria ochroleuca was also found to be non-pathogenic to pyrethrum. Alternaria sp., Stemphylium sp. and Epicaccum sp. were the least frequently isolated. Plectosphaerella spp. are known as pathogens causing root and collar rot. Colletotrichum tanaceti was not isolated from any of the sites which may have been related to the season, as this pathogen is favoured by cool and moist environments (Barimani et al. 2013). With the exception of A. tenuissima and C. tanaceti, these less frequently isolated fungi have not been recorded as important plant pathogens of pyrethrum and are generally regarded as opportunistic pathogens in a range of plant species (Pethybridge et al. 2004). 69 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum This was the first report of S. tanaceti isolated from infected crown and roots of pyrethrum plants and this may have serious implications in the management of the disease. Previously, the pathogen was identified on leaves and petioles of pyrethrum plants and these plant tissues were targeted for application of fungicides to control the disease (Pethybridge et al. 2008d). Leaves of pyrethrum plants have a dense layer of trichomes that repels moisture thus in the field, splash dispersal of spores onto leaves most likely resulted in spores being washed down the petioles into the crown tissue. However, previous reports showed no infection of crown and root with S. tanaceti on pyrethrum. More investigations need to be implemented to determine the role of S. tanaceti in crown and root infection of pyrethrum plants and especially the interaction of S. tanaceti with environmental stresses. Part B Experiment 1 Root-dip inoculation method seemed to be a more appropriate method for establishing infection than foliar spraying as the number of isolates recovered from root-dip inoculated plants was more than for the foliar sprayed plants. This was probably a result of the roots being damaged (wounded) during the root-dip inoculation method hence, being more conducive to infection. The experiment was optimised with the plants receiving water with the same irrigation system. Inoculation of detached petioles with mycelial plugs might be more precise if petioles were incubated for a shorter period of time (3-4 days) as the tissue under the mycelial plug was less colonised. Plants inoculated with root-dip method were more likely to be infected with the same Fusarium isolate that was used for the initial inoculation. As Fusarium is a soil-borne pathogen, root-dip inoculation method was more appropriate than spraying method to establish infection. Experiment 2 None of these isolates had effect on below-ground dry weights. However, F. oxysporum had a significant reduction in below-ground and total biomass and was isolated from the 70 Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum crown and in lower percentages from the petiole tissues of most pyrethrum plants, especially those plants which were inoculated using the root-dip technique. Although the effect of F. equiseti and P. cucmerina on total and above-ground dry weights was statistically significant, these isolates were not isolated from any of the plant tissues. This growth reduction might have been related to the low number of replicates. More number of replicates need to be included in the trial to reduce variability between replicates and obtain the exact effect of each isolate on the dry weight of plants. Fluctuating glasshouse environmental conditions may have also played a role in the significant differences in dry weights. 4.5. Conclusion Fusarium oxysporum (isolates UoM005, UoM0011, UoM25, UoM15 and UoM006) were frequently isolated from different plant tissues especially with the plants rootdipped in spore suspension. Fusarium equiseti (UoM0023) and P. cucumerina (UoM0021, UoM008 and UoM009) were also frequently isolated from the root and crown tissues of pyrethrum plants inoculated by root-dip method. Bionectria ochroleuca (UoM004) was rarely isolated from the crown and root tissue of the root-dipped plants. Fusarium avenaceum (UoM0012) was also found to infect plants sprayed with spore suspension. After the dry weight measurement, only F. oxysporum was found to be pathogenic as there were effects on the total biomass of pyrethrum plants. Also pathogenicity was proved as the pathogen was reisolated from the crown and basal petioles of plants in experiment 2. All plants which were inoculated with mycelial plugs were found infected. Consistency in isolation of F. oxysporum, F. avenaceum, and Paraphoma sp. showed that more studies needed to be focused on pathogenicity tests along with phylogenetic studies of these three important pathogens. 71 Chapter 5: Alternaria infectoria and Stemphylium herbarum Chapter 5 Alternaria infectoria and Stemphylium herbarum, two new pathogens of pyrethrum (Tanacetum cinerariifolium) in Australia 5.1. Introduction and aims During the 2014, 2015 and 2016 field surveys in Tasmania, various fungal fruiting structures were observed at the base of dead flower stems of pyrethrum plants showing yield-decline symptoms. Spores from black pycnidia were mono-celled, oval and hyaline similar to S. tanaceti and Paraphoma sp (Vaghefi et al. 2012; Moslemi et al. 2016). In some cases spores were gray-olivaceous, oval and two celled which were more likely to be related to Didymella sp. (Pethybridge et al. 2008c). Pseudothecia with were also identified from the base of the dead flower stems with asci containing eight, multi-celled ascospore. The ascospores and pseudothecia were morphologically similar to species in the Pleosporales such as Alternaria and Stemphylium which had previously been reported on necrotic leaves of pyrethrum (Pethybridge et al. 2004). Section 5.2. presents the published manuscript that identified the fungal species associated with pseudothecia at the base of the dead pyrethrum flower stems and determined the pathogenicity of these species to pyrethrum. 72 Chapter 5: Alternaria infectoria and Stemphylium herbarum 5.2. Published manuscript 73 Chapter 5: Alternaria infectoria and Stemphylium herbarum 74 Chapter 5: Alternaria infectoria and Stemphylium herbarum 75 Chapter 5: Alternaria infectoria and Stemphylium herbarum 76 Chapter 5: Alternaria infectoria and Stemphylium herbarum 77 Chapter 5: Alternaria infectoria and Stemphylium herbarum 78 Chapter 5: Alternaria infectoria and Stemphylium herbarum 79 Chapter 5: Alternaria infectoria and Stemphylium herbarum 80 Chapter 5: Alternaria infectoria and Stemphylium herbarum 81 Chapter 5: Alternaria infectoria and Stemphylium herbarum 82 Chapter 5: Alternaria infectoria and Stemphylium herbarum 5.3. Corrections to the manuscript The terminology for the sexual fruiting structures of A. infectoria and S. herbarum were incorrectly written as perithecia. Since these fungi are Dothideomycetes, they produce pseudothecia. 83 Chapter 6: Paraphoma vinacea, the causal agent of pyrethrum crown rot Chapter 6 Paraphoma crown rot of pyrethrum (Tanacetum cinerariifolium) 6.1. Introduction and aims The identification of many foliar pathogens associated with diseases of pyrethrum has been reported (Pethybridge et al. 2004; Vaghefi et al. 2012; Barimani et al. 2013; Pearce et al. 2015). Some of these pathogens such as S. tanaceti and D. tanaceti cause significant yield-loss annually and some, although severe, are not yield limiting such as C. tanaceti or A. tenuissima. However, very few studies have focused on soil-borne diseases of pyrethrum and their association with yield-decline. Many pyrethrum plants from yield-decline affected sites in northern Tasmania have necrotic crown tissues, suppressed growth and weak root system. A Paraphoma sp. has been amongst the most prevalent pathogens recovered from the discoloured crown and root tissues of yielddecline affected pyrethrum plants however, taxonomy of this Paraphoma sp. has not been addressed. Section 6.2. presents the published manuscript that identified the Paraphoma species associated with crown rot of pyrethrum and assessed its pathogenicity on pyrethrum. 84 Chapter 6: Paraphoma vinacea, the causal agent of pyrethrum crown rot 6.2. Published manuscript 85 Chapter 6: Paraphoma vinacea, the causal agent of pyrethrum crown rot 86 Chapter 6: Paraphoma vinacea, the causal agent of pyrethrum crown rot 87 Chapter 6: Paraphoma vinacea, the causal agent of pyrethrum crown rot 88 Chapter 6: Paraphoma vinacea, the causal agent of pyrethrum crown rot 89 Chapter 6: Paraphoma vinacea, the causal agent of pyrethrum crown rot 90 Chapter 6: Paraphoma vinacea, the causal agent of pyrethrum crown rot 91 Chapter 7: P. chlamydocopiosa and P. pye Chapter 7 Paraphoma chlamydocopiosa sp. nov. and Paraphoma pye sp. nov., two new species associated with leaf and crown infection of pyrethrum 7.1. Introduction and aims Paraphoma species, usually associated with crown rot of pyrethrum (P. vinacea, Moslemi et al. 2016) were also isolated from necrotic leaf lesions on pyrethrum plants in yield-decline affected fields of Table Cape, Tasmania. Most species of Paraphoma have been reported as soil-borne pathogens isolated from crown and root tissues of a range of plant species of different hosts including plants in the Asteraceae, Rosaceae, Cupressaceae, Solanaceae, Amarylidaceae and Iridaceae (Boerema et al. 2004). Section 7.2. presents the published manuscript that taxonomically described two new Paraphoma species that caused foliar infection of pyrethrum, and assessed the pathogenicity of these species as foliar and crown rot pathogens. This manuscript also revised the taxonomy of the Paraphoma species from Australia and overseas that infected a broad range of host species. 92 Chapter 7: P. chlamydocopiosa and P. pye 7.2. Published manuscript 93 Chapter 7: P. chlamydocopiosa and P. pye 94 Chapter 7: P. chlamydocopiosa and P. pye 95 Chapter 7: P. chlamydocopiosa and P. pye 96 Chapter 7: P. chlamydocopiosa and P. pye 97 Chapter 7: P. chlamydocopiosa and P. pye 98 Chapter 7: P. chlamydocopiosa and P. pye 99 Chapter 7: P. chlamydocopiosa and P. pye 100 Chapter 7: P. chlamydocopiosa and P. pye 101 Chapter 7: P. chlamydocopiosa and P. pye 102 Chapter 7: P. chlamydocopiosa and P. pye 103 Chapter 7: P. chlamydocopiosa and P. pye 104 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum Chapter 8 Fusarium oxysporum and Fusarium avenaceum associated with yield-decline of pyrethrum in Australia 8.1. Introduction and aims Infection of pyrethrum plants by Fusarium oxysporum has been reported in pyrethrum fields of Kenya where the causal agent produced damping-off and wilt of the infected plants (Pethybridge et al. 2008d). Fusarium oxysporum has never been reported as a pathogen of pyrethrum in Australia. During field collections from pyrethrum yield-decline affected fields of northern Tasmania and Ballarat region of Victoria, Fusarium spp. appeared to be one of the most prevalent pathogens isolated from pyrethrum crown and root tissues. Infected plants often had crown chlorosis and necrosis followed by a pink discolouration at the end of the flower stems and inside the crown. Section 8.2. presents the published manuscript that assessed the pathogenicity of Fusarium oxysporum and F. avenaceum that caused root and crown rot of pyrethrum. Multigene phylogenetic analysis was used to identify isolates of both Fusarium spp. isolated from infected root and crown tissues of yield-decline affected pyrethrum plants. Section 8.3. reports the results of an additional field survey in 2016 to confirm the incidence of Fusarium and Paraphoma species associated with pyrethrum yield-decline, and to determine the distribution of each species in various geographical locations of Tasmania and Victoria. Section 8.4. investigates the mode of infection and colonisation of F. oxysporum in pyrethrum. 105 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum 8.2. Published manuscript 106 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum 107 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum 108 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum 109 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum 110 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum z 111 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum 112 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum 113 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum 114 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum 115 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum 116 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum 117 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum 118 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum 119 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum 8.3. Additional field survey in 2016 Consistency in isolation of a specific pathogen associated with a disease from different geographical regions confirms the importance of this pathogen in causing the disease. A further survey and sample collection from the yield-decline affected fields of northern Tasmania was carried out in September 2016 to confirm the presence of Fusarium spp. and Paraphoma sp. in yield-decline affected plants. Materials and Methods Sample collection was carried out in five fields located in Burnie, northern Tasmania. Seven plants from each field were collected and transferred to the University of Melbourne. Isolation and identification of the fungal pathogens from different tissues of the yield-declined affected pyrethrum plants including upper root, basal petiole, crown and leaf tissues were carried out according to Moslemi et al. (2017b). Results and Discussion Crown discolouration was observed in plants at all sites. At sites 69511 and 63907 F. oxysporum was isolated from the infected roots and crowns. Root rot was also observed in some plants (Fig. 2). Fusarium oxysporum was isolated from approximately 75% of the plants at each site which had crown infection and from 43% of plants which had root infection. Fusarium avencaeum was isolated from 35% of the plants with crown infection and 18% with root infection. Fusarium avenaceum was not isolated from infected roots at site 63907. There were a few cases of F. avenaceum being isolated from basal petioles and in some cases there was no infection with F. oxysporum. Fusarium venenatum was only isolated from the crown tissue of one plant at each site 83005 and 51804, and two plants at site 63907. There was one case of root infection with S. tanaceti at site 83005 and two cases of crown infection at sites 69309 and 51804. Leaves and basal petioles of most of the plants were infected with S. tanaceti and D. tanaceti. Paraphoma vinacea and P. chlamydocopiosa were isolated from the roots of the plants at site 61511. Crown tissue of the plants at sites 83005, 51804 and 61511 were infected with P. vinacea. There was one case of crown infection with P. chlamydocopiosa at site 51804 (Table 7). 120 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum Fig.2. Symptoms of yield-decline in pyrethrum plant in northern Tasmania, September 2016. Severe crown discolouration and root rot caused by a complex of Fusarium oxysporum, F. avenaceum and Paraphoma vinacea 121 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum Table 7. Isolation of pathogens from crown, root, petiole and leaf tissues from a sample collection in September 2016 from pyrethrum yield-decline affected fields of Burnie, northern Tasmania. Site numbers and tissues infected with Fusarium spp., Paraphoma spp., S. tanaceti and D. tanaceti are shown. Site 83005 (crown discolouration) 69309 (crown discolouration) Replicates Root Crown Petiole Leaf 1 F. oxysporum F. oxysporum- F. avenaceum S. tanaceti S. tanaceti 2 S. tanaceti P. vinacea D. tanaceti 3 F. oxysporum F. oxysporum. F. avenaceum S. tanaceti 4 F. oxysporum F. avenaceum- P. vinacea S. tanaceti tanaceti tanaceti F. oxysporum- F. avenaceum S. tanaceti S. tanaceti F. oxysporum- F. avenaceum S. tanaceti S. tanaceti F. oxysporum S. tanaceti S. tanaceti Rhizoctonia sp. D. tanaceti 7 1 F. avenaceum 2 F. oxysporum 3 F. oxysporum 2 F. oxysporum (no discolouration) S. tanaceti F. oxysporum 4 1 F. oxysporum F. oxysporum S. S. tanaceti tanaceti F. oxysporum F. avenaceum Phytophthora sp. P. chlamydocopisa F. avenaceum F. venenatum- P. vinacea 4 F. oxysporum- S. tanaceti 5 6 F. oxysporum S. tanaceti F. oxysporum- F. avenaceum- 3 7 122 F. avenaceum- D. 6 7 discolouration) S. tanaceti- D. F. oxysporum- F. avenaceum 6 (crown P. vinacea 5 5 51804 F. oxysporum- F. venenatum- tanaceti- S. tanaceti F. avenaceum- P. vinacea S. tanaceti- P. vinacea F. avenaceum S. tanaceti F. avenaceum F. avenaceum S. tanaceti F. oxysporum- P. vinacea S. tanaceti F. avenaceum F. oxysporum P. vinacea S. tanaceti D. Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum 63907 1 F. oxysporum- F. avenaceum 2 F. oxysporum 3 F. oxysporum 4 F. oxysporum 5 F. avenaceum (crown discolouration and root rot) 6 7 F. oxysporumF. avenaceum F. oxysporum 3 61511 (crown discolouration and root rot) F. oxysporumP. vinacea F. avenaceum F. avenaceum- F. venenatum F. oxysporum- F. avenaceum F. oxysporum- F. venenatum F. avenaceum S. tanaceti- P. vinacea S. tanaceti S. tanaceti F. oxysporum chlamydocopi F. oxysporum S. tanaceti- tanaceti F. oxysporum 8.4. The mode of infection and colonisation by F. oxysporum in pyrethrum In many plant species F. oxysporum particularly the vascular wilt form species, are able to block the xylem tissue and prevent flow of sap and water within the xylem. Infection of roots of susceptible plants occurs by direct penetration by hyphae originating from chlamydospores under favourable environmental conditions (Di Pietro et al. 2003). Hyphae penetrate the epidermal cells and grow intracellular until infecting the vascular tissue. They then block the xylem vessels by means of microconidia production, and wilting occurs due to lack of root ability to transfer water within xylem (Di Pietro et al. 2003). 123 D. tanaceti S. tanaceti osa 7 F. avenaceum F. oxysporum Paraphoma 6 S. tanaceti F. oxysporum F. oxysporum- P. vinacea 4 5 S. tanaceti discolouration) F. oxysporum- P. vinacea 1 2 F. oxysporum (no D. Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum Although the pathogenicity of F. oxysporum was reported by Moslemi et al. (2017b) in chapter 7, the mode of infection and colonisation was not determined. Materials and Methods Pyrethrum plants of cultivar Pyrate were received from Tasmania, planted into new pots and maintained in the glasshouse as described in section 8.2. Three replicates of each treatment involved plants being inoculated by the root-dip method at 10⁵ spores/mL of a spore suspension of F. oxysporum. Controls were root-dipped in sterile water. Plants were left in the glasshouse for two months to establish infection and tissue colonisation by F. oxysporum. One cm pieces of each root, crown and basal petiole tissues were cut in order to obtain two 0.5 cm pieces. One piece of each tissue was cultured on WA and then fungal mycelium was transferred to PDA to determine infection, and the other section was transferred into a 1.5 mL Eppendorf microcentrifuge tube (Eppendorf, Australia) containing FAA and incubated for 7 days. Tissues assessed on PDA as being infected, were selected for microtome sectioning as described in Chapter 3. Results and Discussion High incidence of root and crown infection with F. oxysporum was observed in all the three replicates. No infection of the controls was observed. Fungal hyphae of F. oxysporum were observed in infected plant tissues in large and small xylem vessels with the surrounding cells infected (Fig. 3). There was no infection of phloem or vascular cambium. Pyrethrum plants showed infection of xylem vessels two months after rootdip inoculation however, there was no noticeable visual wilt symptoms on the plants probably because the xylem vessels were not heavily colonised, thus not blocking water movement in the xylem. Perhaps 2 months was too a short period of time for severe colonisation of xylem and thus for disease symptoms to appear. Nevertheless, the plants were susceptible to infection by F. oxysporum as shown by the high incidence of tissue infection. Accurate identification of Fusarium formae speciales is necessary for developing management strategies and resistant breeding schemes (Bogale et al. 2007). Form 124 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum species (formae speciales) of F. oxysporum have been identified by molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeat (SSR), random amplified polymorphic DNAs (RAPD), and PCR-RFLP approaches using F. oxysporum specific primers (Belabid et al. 2004; Bogale et al. 2006; Bogale et al. 2007). However, cross-host pathogenicity tests and histological studies can also confirm the specificity or formae specialis of Fusarium spp. In this chapter, Fusarium spp. isolated from different tissues of yield-decline affected fields of northern Tasmania were identified as mostly F. oxysporum and F. avenaceum with F. oxysporum being more pathogenic to pyrethrum than F. avenaceum. These pathogens along with P. vinacea were confirmed to be associated with yield-decline affected plants. Since,F. oxysporum was shown to be infecting xylem vessels in the crown tissue, it is likely to be a formae specialis of pyrethrum. However, cross-host pathogenicity assays need to be conducted on a range of plant species related to pyrethrum to confirm formae specialis. 125 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum Fig.3. Transverse and longitudinal microtome sections obtained from root and crown tissues infected with F. oxysporum two months after inoculation using quadruple 126 Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum staining method. A-B accumulation of hyphae in xylem, root longitudinal section; C crown longitudinal section showing the growing hyphae in xylem; D-F transverse sections of an infected crown with hyphae in xylem; G crown transverse sections clearly showing hyphae in parenchyma cells. See arrows. ×100 magnification (20 µm) 127 Chapter 9: Effect of waterlogging on pyrethrum growth Chapter 9 Influence of waterlogging on growth of pyrethrum plants infected with crown and root rot pathogens - Fusarium oxysporum, Fusarium avenaceum and Paraphoma vinacea 9.1. Introduction Pyrethrum yield-decline was recently identified where plants failed to regrow after first harvest or yield reduction occurred after the second harvesting season (Moslemi et al. 2017b). Poor persistence or yield-decline has no obvious single cause and has been attributed to interaction between various crown and root rot pathogens and abiotic stresses (Moslemi et al. 2017b). Plants affected by yield-decline exhibited severe discolouration of crown tissues, reduced root growth and stunting (Moslemi et al. 2017b). The fungal pathogens Paraphoma vinacea, Fusarium oxysporum and F. avenaceum were found to be associated with these affected plants and have been shown to affect plant growth (Moslemi et al. 2016; Moslemi et al. 2017b). Foliar pathogens such as Stagonosporopsis tanaceti and Didymella tanaceti (Pearce et al. 2015; Vaghefi et al. 2015) have also been observed in the yield-declined plants. Recently Bhuiyan et al. (2016) showed that S. tanaceti infection reduced plant vigour causing poor regrowth after harvest which suggested that S. tanaceti may be one of the causes of yield-decline. Alternaria infectoria and Stemphylium herbarum were also isolated from the bases of dead flower stems in yield-decline affected fields in northern Tasmania and may also contribute to the complex pathology of yield-decline syndrome (Moslemi et al. 2017a). According to Pethybridge et al. (2010), various abiotic factors such as soil compaction and cutting height also contributed to poor regrowth of pyrethrum plants. Previous studies attempting to improve production of pyrethrum have focused on soil fertility (Salardini et al. 1994b, a), weed competition (Rawnsley et al. 2007a; Rawnsley et al. 2006a) and waterlogging (Javid et al. 2013), as well as plant pathogens (Jones et al. 2007; Pethybridge et al. 2008d). Identification of pathogens to which the crops are 128 Chapter 9: Effect of waterlogging on pyrethrum growth susceptible and developing pathogen management strategies should reduce sensitivity of crops to environmental stresses. Waterlogging is an important abiotic factor having a significant role in pyrethrum yield reduction and a negative effect on flower and pyrethrin production. Developing molecular strategies to produce waterlogging-resistant genotypes (Dennis et al. 2000), planting crops on graded surfaces to reduce water accumulation and avoiding long-term irrigations after a waterlogging period (Setter and Waters 2003) can help reduce the exposure of the plants to prolonged waterlogging in field conditions. Javid et al. (2013) subjected pyrethrum plants to a 6-day waterlogging period followed by inoculation with S. tanaceti and found that the combination of stresses affected root expansion and dry weight. The number of stems per plant in the combined treatment decreased within 3 months. This synergistic effect may have been due to the abiotic stress predisposing the plants to more severe infection. Bradford (1983) showed that waterlogged tomato plants were more susceptible to a range of fungal diseases by a change in the nutritional balance and increased humidity and temperature in the canopy of the stressed plants. Javid et al. (2013) reported that waterlogging affected cytokinin production, a phytohormone vital for root expansion, in root tips and shoots of the waterlogged pyrethrum plants. Suraweera et al. (2015b) showed that a water deficit treatment significantly reduced flower production and pyrethrin content of the pyrethrum flowers. Since pyrethrum crops are subjected to regular waterlogging, and crown and root rot pathogens are prevalent in field plants, further studies should focus on the interaction between biotic and abiotic stresses and the effect on plant growth and development. Hence, the aim of this study was to assess the effect a 4-day period of waterlogging on growth and flower production of pyrethrum plants infected with the crown and root rot pathogens F. oxysporum, F. avenaceum and P. vinacea. 9.2. Materials and Methods Ten-week-old pyrethrum seedlings of cultivar Pyrate were germinated from steam sterilised seeds and raised in seedling mix, then 250 seedlings were individually transferred to 20 cm diam (2.8 L) pots with potting mix (Debco, Victoria, Australia) and fertilized with 5 g of Osmocote Plus (Scotts Australia Pty. Ltd.) per pot. Seedlings were 129 Chapter 9: Effect of waterlogging on pyrethrum growth maintained in a glasshouse for two months at 25–27 °C under natural light and Osmocote Plus was applied to the plants once a month. Two separate glasshouse experiments were conducted to assess the effect of waterlogging on infected pyrethrum plants. The first experiment involved seedlings being inoculated with F. oxysporum and F. avenaceum. The second experiment involved inoculation with P. vinacea. Drip irrigation was used to water the plants to minimize cross infection by water splash. Fifty plants per treatment were inoculated by immersing the roots of plants in 10 spore/mL spore suspension of each pathogen as described in Moslemi et al. (2017b). Controls were identically treated but with sterilised water. Plants were maintained in the glasshouse for two months before a waterlogging treatment was applied. To assess the effect of the pathogens, waterlogging and their interaction plants were sampled at three different time intervals: two months after inoculation (four-month-old plants, prewaterlogging stage - 0 bw,); two months after the waterlogging treatment (rosette stage, four months after inoculation – 2 maw); and six months after waterlogging (flowering stage, eight months after inoculation – 6 maw). 9.2.1. Waterlogging treatment Of the 40 root-dip inoculated plants remaining after undertaking the first harvest in each treatment, 20 were subjected to a 4-day-waterlogging treatment and the other 20 were non-waterlogged. Pots to be waterlogged were placed individually in 16 L plastic buckets. Buckets were then filled with water until the water level reached the surface of the soil. Buckets were then left on the bench in the glasshouse for four days. During the waterlogging period O₂ concentration was measured for each pot daily to assess the depletion of O2 using a dissolved oxygen meter (model HI 9147, Hanna® instruments, USA). This was done by immersing the O₂ electrode in water inside the 16 L buckets and waiting until the O₂ levels stabilized. Water temperature was maintained at 22-24°C at all times. O₂ concentration dropped gradually but significantly from day 0 to 3 (Fig. 1). 130 Chapter 9: Effect of waterlogging on pyrethrum growth 7 6 O co ce tratio g/L 5 4 5.77 5.44 4.77 4.67 4.65 5.59 5.38 2.83 3 4.57 3.56 3.08 3.53 3.06 2.55 5.42 4.46 3.31 3.21 2.35 1.93 2 1 0 Control F F. ox F. aven Control P P. vin Days d0 d1 d2 d3 Fig.1. O₂ concentration (mg/L) measured for 20 plants per treatment from day 0 to 3; means were calculated for 20 plants/day. F= Fusarium, P= Paraphoma, F. ox= F. oxysporum, F. aven= F. avenaceum, P. vin= P. vinacea. Capped lines show +/- standard error of the mean (n=20) Waterlogging treatment was stopped after 4 days with the onset of wilting of the new petioles and leaves, leaf chlorosis and necrosis. Pots were removed from the buckets and allowed to drain, then all plants were maintained in the glasshouse as described before. Symptoms caused by waterlogging treatment were also checked daily. A stress severity class of 0 to 4 was attributed to each plant. Stress severity was assessed 7 days after waterlogging by assessing the degree of necrosis and chlorosis of the lower leaves and petioles (Table 1). 131 Chapter 9: Effect of waterlogging on pyrethrum growth Table 1. Post-waterlogging stress severity class of plants inoculated with Fusarium oxsyporum, Fusarium avenaceum, and Paraphoma vinacea, 7 days after waterlogging Stress class Description 0 Healthy looking plants showing no wilt, chlorosis or necrosis 1 2 Plants begin showing necrosis and chlorosis of the lower leaves and petioles, moderate wilting Wilting of the newly immerged petioles and leaves, chlorosis and necrosis of the lower leaves and petioles 3 Severe wilt, chlorosis and necrosis of the young and senesced leaves, shoots and petioles 4 Plants wilted and died 9.2.2. Two months after inoculation, pre-waterlogging (0 bw): incidence of infection and effect of F. oxysporum, F. avenaceum and P. vinacea on growth of inoculated pyrethrum plants Two months after root-dip inoculation, 10 plants were randomly sampled from each treatment. Roots were washed for 5 minutes under the tap water to remove excess soil. Thereafter, 0.5 cm pieces of the upper roots, crowns, basal petiole, and leaves were surface sterilised with 80% ethanol for 30 sec, 1.5% (ai) sodium hypochlorite for 1 min and rinsed two times in sterile water each for 1 min. They were then blotted on a sterilised paper towel, cultured onto water agar (WA) and fungal hyphae cultured onto potato dextrose agar (PDA) for isolate identification. Plates were incubated under a light regime of 12h light/12h dark at 23-25° C for 3-4 days for plants inoculated with Fusarium spp. (Burgess and Summerell 1992), and in the dark with similar temperature and incubation condition as described by Boerema et al. (2004) for those inoculated with P. vinacea. 132 Chapter 9: Effect of waterlogging on pyrethrum growth 9.2.3. Two months after waterlogging, (2 maw): effect of waterlogging alone and in combination with infection by each of the pathogens on disease incidence, growth and photosynthesis of pyrethrum plants The effect of waterlogging on growth alone and combined with prior infection by each of F. oxysporum, F. avenaceum and P. vinacea was assessed 2 months after waterlogging when the plants were at the rosette stage. By this time waterlogged plants had partly recovered and had new shoots and young leaves emerging from the crown. Twenty plants, including 10 waterlogged and 10 non-waterlogged from each infection treatment were randomly sampled. Roots were washed gently under tap water and tissues from the upper roots, crowns, basal petiole and leaves were cultured on WA and then fungal hyphae was subcultured onto PDA as described. Dry weight was measured for individual plants after drying in an oven for 3 days at 71°C. The effect of waterlogging and F. oxysporum, F. avenaceum and P. vinacea on photosynthesis rate was also assessed on these plants before they were destructively sampled as described. Photosynthesis rate was measured using a LI-COR® portable photosynthesis system (LI-6400, LI-COR, Lincoln, Nebraska, USA) and with measuring the uptake of CO2 method. This was carried out using an IRGA (Infra-Red Gas Analyzer) which compared the CO2 concentration in gas entering and leaving a chamber in which the leaf was enclosed. Leaf areas were measured by capturing images using a Nikon Coolpix A100 compact camera (Digidirect, Australia) and analysing with MATLAB (MathWorks® R2016a) image analysis software and photosynthesis rate was calculated per cm² leaf area. 9.2.4. Six months after waterlogging (6 maw): effect of waterlogging alone and in combination with infection by each of the pathogens on disease incidence, growth of pyrethrum plants and on flowering Two months after waterlogging (i.e. 4 months after inoculation) the remaining plants including 20 plants per infection treatment (10 waterlogged and 10 non-waterlogged) were moved outside of the glasshouse for vernalisation to induce flowering and 133 Chapter 9: Effect of waterlogging on pyrethrum growth maintained there for 4 months. At 6 months after waterlogging each plant was assessed for the number of flowers and flower stems, petioles, green and yellow leaves, then destructively sampled to assess disease incidence and dry weights similar to the previous samplings. Leaf tissues were not cultured at this time as no leaf infection had been found in the previous samplings but flower stem bases were sampled. In each experiment above-ground, below-ground and total biomass were measured and results were analysed using SAS V.9.4. Data from both experiments were analysed to a completely randomised design. Dry weight data were analysed at 0 bw, 2 maw and 6 maw; and for the flowering parameters 6 maw. The GLM procedure was used in a 2way ANOVA for analysis of both experiments using pathogen and waterlogging treatments as independent variables in different time periods. Data from plants that were inoculated but could not be confirmed to have been infected successfully were eliminated from the analyses using time and pathogen treatments as independent variables. Data were log transformed to improve residuals distribution. 9.3. Results 9.3.1. Disease incidence Disease incidence was compared in infected plants at 0 bw (pre-waterlogging) and at 2 and 6 maw. At 2 mai, 100% of sampled plants inoculated with F. oxysporum had infection of the upper root and crown tissues while 80% had infection of the basal petioles. Of the 10 plants inoculated with F. avenaceum 70% were infected with four plants having upper root infection, four crown infection, and two basal petiole infection. Of the 10 plants inoculated with P. vinacea eight were infected with severe infection in the upper roots, three in the crowns and one infected in the basal petioles. No infection could be found in any of the non-inoculated control plants (Table 2 and 3). Two maw the disease incidence of the plants inoculated with F. oxysporum and P. vinacea was similar in both waterlogged and non-waterlogged plants with 100% of plants infected by Fusarium oxysporum and 90% infected by P. vinacea. Whereas 80% of plants inoculated with F. avenaceum and waterlogged where infected, while only 50% of non-waterlogged plants were infected by F. avenaceum. 134 Chapter 9: Effect of waterlogging on pyrethrum growth All plants infected by F. oxysporum had crown tissue infection in both waterlogged and non-waterlogged treatments 2 maw, whereas 70% and 60% of plants had crown tissue infected by P. vinacea in the waterlogged and non-waterlogged treatments respectively. For F. avenaceum infected plants only 50% and 20% of plants had crown tissue infection in the waterlogged and non-waterlogged treatments respectively. Again, no infection was observed in any of the control plants in both waterlogged and nonwaterlogged treatments. At 6 maw disease incidence remained similar to the pre-waterlogging and 2 maw stages for both Fusarium and Paraphoma trials. More plants had the basal flower stems infected by F. oxysporum than by P. vinacea and F. avenaceum. There was a higher incidence of crown infection in plants inoculated by F. avenaceum at 6 maw than at 2 maw. Table 2. Number of infected plants two months after inoculation, pre-waterlogging (0 bw) with Fusarium oxysporum, Fusarium avencaeum and Paraphoma vinacea per 10 replicates. W= waterlogged, NW=non-waterlogged Treatment Control F. oxysporum F. avenaceum Control P. vinacea 0 bw 0 10 7 0 8 W 2 maw 0 10 8 0 9 NW 0 10 5 0 9 W 6 maw 0 10 7 0 9 NW 0 10 6 0 9 135 Chapter 9: Effect of waterlogging on pyrethrum growth Table 3. Disease incidence two months after inoculation at pre-waterlogging (0 bw), 2 months after waterlogging (2 maw) and 6 months after waterlogging (6 maw) for plants inoculated with Fusarium oxysporum, Fusarium avenaceum and Paraphoma vinacea. Each cell shows the number of infected tissues/10 replicates. W= waterlogged, NW=non-waterlogged 0 bw 2 maw 6 maw W Treatment Leaf Control 0 F. oxysporum Basal Crown Root Leaf 0 0 0 0 0 8 10 10 F. avenaceum 0 2 4 Paraphoma Control 0 0 trial P. vinacea 0 1 Fusarium trial petiole NW Basal Basal stem petiole 0 0 10 8 0 2 0 0 0 2 Root Leaf 0 0 0 0 0 8 10 9 4 0 1 5 0 0 0 0 3 7 0 1 Basal NW Flower Crown petiole W Crown Root 0 0 0 7 3 0 0 0 7 7 petiole Flower Basal stem petiole 0 0 10 3 0 7 0 0 1 1 Crown Root Crown Root 0 0 0 0 0 7 3 4 3 10 2 3 1 2 0 0 5 1 0 0 0 0 0 0 0 0 6 6 5 5 3 1 3 5 136 Chapter 9: Effect of waterlogging on pyrethrum growth 9.3.2. Stress severity classes of waterlogged plants The waterlogging treatment was terminated on day 4 at the onset of chlorosis and necrosis of the young petioles and leaves (Fig. 1). A shift in severity class was observed 7 days after waterlogging when 75% and 70% of plants infected with F. oxysporum and F. avenaceum respectively had severity class 1 , and 40% of the plants infected with P. vinacea had severity class 2 (Table 4). The stress severity on plants inoculated with P. vinacea was the highest of all the treatments. Only 10% of the waterlogged plants showed no symptoms while 40% had severe wilt and necrosis of the lower leaves and petioles, 10% had severe wilt and 5% died. Stress severity in both F. oxysporum and F. avenaceum treatments was mostly similar with F. oxysporum causing slightly higher degree of necrosis and chlorosis of the lower leaves and petioles and wilt compared to plants infected by F. avenaceum. Uninfected control plants in both Fusarium and Paraphoma trials showed no severe symptoms and mostly had moderate necrosis and chlorosis of the lower leaves and petioles (Table 4). No wilting, chlorosis and necrosis were observed in the non-inoculated controls of the non-waterlogged plants (data not shown). After 6 months, waterlogging caused a significant (p<0.05) reduction in the number of flowers, flower stems, petioles and yellow leaves in the waterlogged plants in both Fusarium and Paraphoma trials. There was no significant difference in green leaves in the Fusarium trial. However, none of the pathogens had a significant effect on these traits in the waterlogged and non-waterlogged plants (Table 5). 137 Chapter 9: Effect of waterlogging on pyrethrum growth Fig.2. A wilting of the new petioles and leaves 7 days after the waterlogging treatment; B chlorosis and necrosis of lower leaves and petioles, wilting of the young petioles and leaves, 7 days after waterlogging Table 4. The relative stress severity scores of plants inoculated with Fusarium oxysporum, Fusarium avenaceum, and Paraphoma vinacea, 7 days after waterlogging. Twenty plants per treatment were considered Severity class 0 1 2 3 4 Control Fusarium 9 (45%) 11 (55%) 0 0 0 F. oxysporum F. avenaceum Control Paraphoma P. vinacea 4 (20%) 15 (75%) 1 (5%) 0 0 5 (25%) 14 (70%) 1 (5%) 0 0 6 (30%) 13 (65%) 1 (5%) 0 0 2 (10%) 7 (35%) 8 (40%) 2 (10%) 1 (5%) 138 Chapter 9: Effect of waterlogging on pyrethrum growth Table 5. Effect of water logging on the number of pyrethrum flowers, flower stems, basal petioles and leaves (green and yellow), 6 months after waterlogging. Means for each pathogen treatment are shown in each column. Significant differences between waterlogging and non-waterlogging treatments for each pathogen (Fusarium and Paraphoma) trial are shown as HSD in rows using a Tukey’s HSD (honest significant difference) test at α=0.05. * Significant t-value; ns= not significant t-value. W=waterlogged, NW=non-waterlogged Flowers Treatment NW W Control 7.6 3.2 F. oxysporum 6.5 2.5 F. avenaceum 7.6 1.7 NW W 10 2.7 Control HSD 2.28* HSD Flower stems Basal petioles NW NW W 5 1.7 4.2 2.1 4.9 1 NW W 5.7 1.2 2.93* P. vinacea 5.9 1.6 HSD 1.2* HSD W 68.5 41.1 63.1 40.3 67.3 37.2 NW W 72.6 34.7 1.6* 3.3 1 HSD 9.53* HSD Green leaves Yellow leaves NW HSD NW W 2.13 9.6 b 11.2 22.8 13 20.9 12.5 HSD NW W HSD 6.1 1.85* 6.6 a 4.6 a 1.91 W 6.4 3.5 4.7 2.4 4.7 3.9 NW W 6.6 2.6 15.46* 56.5 35.4 3.9 2.1 ns 4.5 HSD 3.93* ns 9.3.3. Dry weight analyses At each sampling time there was a significant (p<0.05) difference in mean dry weight between inoculated and non-inoculated plants, and between waterlogged and nonwaterlogged treatments. The interaction between sampling time and waterlogging treatment, and sampling time and pathogen treatments for all the three pathogens were highly significant (Fig. 3). In plants grown at optimum soil water capacity F. oxysporum and P. vinacea significantly reduced the below-ground and total biomass of plants at pre-waterlogging (0 bw), and 2 and 6 maw (Table 6). Although F. avenaceum was pathogenic it had a significant effect only on below-ground biomass at 2 and 6 maw (Table 6). Waterlogging generally caused a significant reduction in above-ground, below-ground and total biomass of the pyrethrum plants inoculated with F. oxysporum, F. avenaceum, P. vinacea as well as in the non-infected controls (Fig. 3). At 2 maw, significant reduction of dry weight occurred in plants infected with each of three pathogens. 139 Chapter 9: Effect of waterlogging on pyrethrum growth Whereas, at 6 maw only F. oxysporum and P. vinacea significantly affected plant growth in the waterlogged treatment. The waterlogging main effect was significant for below-ground and total dry weight at both 2 and 6 maw (Table 6). By 6 maw plants had begun to recover from the waterlogging treatment by producing new leaf petioles and increased growth. However, there was a highly significant difference in dry weights of the plants between the waterlogged and non-waterlogged groups (Table 6). Plants infected with F. oxysporum had significantly reduced aboveground, below-ground and total biomass in both waterlogged and non-waterlogged treatments. Plants infected with F. avenaceum had no significant difference in aboveground and total biomass in both groups. Plants infected with P. vinacea had no significant difference in above-ground dry weights. 140 Chapter 9: Effect of waterlogging on pyrethrum growth Table 6. The effect of waterlogging on dry weights of pyrethrum plants infected with Fusarium oxysporum, Fusarium avencaeum and Paraphoma vinacea, pre-waterlogging (0 bw), 2 months after waterlogging (2 maw) and 6 months after waterlogging (6 maw). Means with different letters in each column for each pathogen treatment were obtained using Tukey’s HSD (honest significant difference) test at α=0.05 and are significantly different. Significant differences between waterlogging and non-waterlogging treatments for each dry weight category are shown as P-values. ns= not significant, *=P<.0001, **=P<.0005, ***=P<.0082, ****=P<.0070, ai= after inoculation, maw= months after waterlogging. W=waterlogged, NW=nonwaterlogged 0 bw Dry weight Treatment Control Above-ground F. oxysporum F. avenaceum Control Fusarium trial Below-ground F. oxysporum F. avenaceum Control Total F. oxysporum F. avenaceum Treatment Control Above-ground P. vinacea Control Paraphoma trial Below-ground P. vinacea Control Total P. vinacea y Equivalent to 4 and 8 months after inoculation 4.17 a 2.35 b 3.13 ab 3.38 a 2.07 b 2.58 ab 7.55 a 4.42 b 5.71 ab Mean 4.87 a 2.63 b 2.95 a 2.12 b 7.83 a 4.76 b y 2 maw NW W 8.28 a 8.01 a 6.38 b 5.65 b 7.99 ab 5.88 b 13.38 a 6.78 a 6.02 b 2.1 b 7.99 b 3.70 b 21.38 a 14.80 a 12.40 b 7.98 b 16.27 b 9.35 b NW W 8.22 a 7.20 a 7.40 a 4.58 a 8.34 a 5.21 a 4.89 b 1.72 b 16.56 a 12.41 a 12.29 b 6.31 b Means P-value ns * ** P-value ns ** **** 6 mawy NW 15.66 a 12.65 b 13.95 a 18.50 a 13.99 b 15.24 b 34.17 a 26.65 b 29.19 ab NW 15.42 a 12.62 a 16.75 a 12.55 b 32.17 a 25.17 b W P-value 10.57 a 7.17 b * 9.62 a 15.08 a 11.03 b *** 12.32 b 25.65 a 26.20 b * 21.94 ab W P-value 6.28 a * 7.97 a 10.79 a * 5.99 b 17.07 a * 13.78 b 141 Chapter 9: Effect of waterlogging on pyrethrum growth 142 Chapter 9: Effect of waterlogging on pyrethrum growth Fig.3. Interaction plots between waterlogging and each pathogen treatment, prewaterlogging (0 bw), 2 months after waterlogging (2 maw) and 6 months after waterlogging (6 maw) in the waterlogged and non-waterlogged plots. A plants infected with Fusarium oxysporum and Fusarium avenaceum B plants infected with Paraphoma vinacea. Y axis refers to mean biomass of the plants (log transformed). X axis refers to the sampling time in which the dry weight of the inoculated plants was measured. The same time 0 bw (before waterlogging) has been used for both waterlogged and nonwaterlogged treatments 9.3.4. Photosynthesis at 2 months after waterlogging At 2 maw there was a significant (p<0.05) interaction between inoculated and noninoculated plants on photosynthesis rate, and a significant interaction between waterlogging and no waterlogging treatments however, there was no significant interaction between inoculation and waterlogging treatments. Plants infected by each of the pathogens had the lowest photosynthesis rate in both waterlogged and the nonwaterlogged treatments (Table 7). Photosynthesis rate measurements showed that leaf photosynthesis in the waterlogged plants was significantly lower than in those which had not been waterlogged in both trials (Table 7). 143 Chapter 9: Effect of waterlogging on pyrethrum growth Table 7. The effect of waterlogging on photosynthesis of the plants inoculated with Fusarium oxysporum, Fusarium avenaceum and Paraphoma vinacea, 2 months after waterlogging. Means with different letters in each column for each pathogen treatment were obtained using Tukey’s HSD (honest significant difference) test at α=0.05 and are significantly different. Significant differences between waterlogging and non- waterlogging treatments for each pathogen trial are shown as P-values. W=waterlogged, NW=non-waterlogged Photosynthesis rate (µmol CO2 m-2 s- 1) Trial Fusarium trial Paraphoma trial Treatment Control F. oxysporum F. avenaceum Control P. vinacea W 0.91 a 0.26 b 0.44 b 0.91 a 0.31 b NW 1.64 a 1.37 b 1.60 b 2.73 a 1.24 b P-value <.0001 <.0001 9.4. Discussion All three pathogens had a significant effect on dry weight of the inoculated plants from pre-waterlogging to 6 months after waterlogging. The interactions between sampling time and pathogens, and sampling time and waterlogging treatment were highly significant. A 4-day waterlogging treatment significantly affected the growth of pyrethrum plants infected by Fusarium oxysporum, F. avenaceum and Paraphoma vinacea. At 2 maw there were significant differences in aboveground, below-ground and total dry weights of plants infected by these pathogens. Whereas, at 6 maw F. oxysporum and P. vinacea had larger effect than F. avenaceum causing significant reduction in total dry weight. Although F. avenaceum did not significantly reduce above-ground or total dry weights at 6 maw, the below-ground biomass was significantly reduced. These results confirmed previous studies by Moslemi et al. (2017b) that F. oxysporum and P. vinacea were important pathogens of pyrethrum but that F. avenaceum was a minor pathogen although it retained its pathogenicity 6 maw and significantly reduced the dry weight. Above-ground dry weight of plants was less affected by infection caused by F. avenaceum and P. vinacea than by F. oxysporum which is indicative of the severity of 144 Chapter 9: Effect of waterlogging on pyrethrum growth pathogenicity of F. oxysporum. At 7 days after waterlogging, plants infected by P. vinacea showed more severe necrosis and chlorosis of leaves and severe wilting of the shoots and petioles than the controls and plants inoculated with the two Fusarium spp. This may have indicated that these plants had more severely weakened root systems due to infection by P. vinacea which resulted in more severe symptoms of stress when subjected to the waterlogging stress. In a previous study Moslemi et al (2016) showed that pyrethrum plants inoculated with spore suspension of P. vinacea had significant reduction of above-ground, below-ground and total biomass of root-dip inoculated plants in two separate glasshouse experiments. Significant reduction of O₂ during the 4-day waterlogging period would have caused a reduction in the amount of oxygen in roots (hypoxia). Hypoxia decreases ATP production that is vital for respiration and photosynthesis and has direct effect on root and shoot growth of waterlogged plants (Davies et al. 2000). The reduction in O₂ may not have affected growth of the fungal pathogens but may have enhanced infection and colonisation of affected roots weakened by hypoxia. Waterlogging did not appear to enhance disease incidence for any of the pathogens perhaps because incidence of infection by all three pathogens was high before the waterlogging treatment. At 6 maw treatment plants infected with F. oxysporum had high incidence of infection of flower stem bases and crown tissues whereas, P. vinacea was isolated from a high proportion of crown and root tissues. Waterlogging treatment caused significant reduction of the number of flowers, flower stems, petioles, green leaves in the Paraphoma trial and yellow leaves in the Fusarium trial. Similar results were reported by Javid et al. (2013) where a 6-day waterlogging treatment followed by inoculation with the foliar pathogen S. tanaceti reduced plant growth. Javid et al. (2013) suggested that poor plant growth occurred as a result of the reduction of adenosine triphosphate (ATP) synthesis in the roots of the waterlogged plants which affected the ability of the plants to uptake nutrients from the soil. The photosynthesis rate significantly reduced 2 maw in all the plants including the controls. McDonald and Dean (1996) showed that waterlogging increased the concentration of ethylene in shoots which resulted in plants becoming more susceptible to diseases by causing stomatal closure and photosynthesis reduction. 145 Chapter 9: Effect of waterlogging on pyrethrum growth 9.5. Conclusion In plants grown at optimum soil water capacity F. oxysporum and P. vinacea significantly reduced the below-ground and total biomass of plants at 2, 4 and 8 months after inoculation (0 bw, 2 maw, 6 maw) but had little effect on above-ground biomass. Although F. avenaceum was pathogenic it only had a significant effect on below-ground biomass at 4 and 8 months after inoculation. At 7 days after the 4-day waterlogging treatment, plants infected with P. vinacea had more severe wilting, necrosis and chlorosis of the basal leaves and petioles than plants infected with the other two pathogens or non-infected plants. Significant interaction between pathogen treatments and waterlogging occurred at 2 maw, whereas at 6 maw plants had recovered and no significant interaction was observed between the pathogen treatments and waterlogging. The effect of waterlogging on below-ground dry weight of the plants infected with F. oxysporum and P. vinacea, 2 maw was more severe than those infected with F. avenaceum. There was no significant interaction between waterlogging and pathogens on photosynthesis 2 maw however, plants infected by each of the pathogens had the lowest photosynthesis rate in both waterlogged and the non-waterlogged treatments. Six maw the number of flowers, flower stems, petioles and leaves were significantly reduced by waterlogging however, there was no significant effect by pathogens nor an interaction between pathogens and waterlogging on these growth parameters. 146 Chapter 10: Discussion Chapter 10 General discussion New soil-borne and foliar pathogens of pyrethrum were isolated and identified from plants showing yield-decline symptoms. Three new species of Paraphoma were identified including P. vinacea that caused red-brown discolouration of the crown and growth reduction of pyrethrum, and P. chlamydocopiosa and P. pye that caused necrotic leaf lesions and growth reduction. These species were identified based on multigene phylogenetic analyses and pathogenicity bioassays. In addition, a complex of Fusarium species including F. oxysporum, F. avenaceum, F. venenatum and F. equiseti were isolated from plants with yield-decline symptoms. Fusarium oxysporum and F. avenaceum were the main Fusarium pathogens causing reduced growth and crown discolouration of pyrethrum. Additionally, A. infectoria and S. herbarum were identified as potential foliar pathogens of pyrethrum in the fields of northern Tasmania. Pathogenicity experiments confirmed the significant role that these pathogens had in reducing pyrethrum growth and potential yield reduction and helped categorise these pathogens as major or minor pathogens of pyrethrum. Fungal pathogens identified to be associated with yield-decline affected pyrethrum plants are summarised in Table 1. Identification of soil-borne pathogens associated with pyrethrum yield-decline is of major importance in pyrethrum pathology as previous studies mostly focused on foliar pathogens of pyrethrum (Barimani et al. 2013; Pearce et al. 2015; Vaghefi et al. 2012). Only Sclerotina sclerotiorum and S. minor (Scott et al. 2014) and F. oxysporum in Kenya (Pethybridge et al. 2008d) were previously reported as soil-borne fungal pathogens of pyrethrum. 147 Chapter 10: Discussion Table 1. Fungal pathogens associated with yield-decline affected pyrethrum plants Pathogen isolates Alternaria infectoria strain/isolate Accession No. UMAi01- BRIP 65180 Tissue infected Flower stem base Location isolated Table Cape & Burnie Collector Date collected Symptoms on pyrethrum Reference pseudothecia at the base of old flower A. Moslemi Sep-16 stems, necrotic leaf lesions on both sides Moslemi et al. (2017a) of the leaves UoM005; BRIP 64449 UoM0011; BRIP 64441 Fusarium oxysporum UoM0026; BRIP 64452 Crown and upper UoM0027; BRIP 64453 roots UoM0028; BRIP 64454 Devonport, Burnie, Jun 2014; A. Molsemi Jan 2015; Ballarat Sep 2016 Devonport, Jun 2014; Severe crown discolouration and suppressed growth Moslemi et al. (2017b) UoM0029; BRIP 64455 UoM002-BRIP 64445 UoM0012; BRIP 64442 Fusarium avenaceum UoM0014; BRIP 64443 Leaf, basal petiole, UoM0016; BRIP 64444 crown and root UoM0024; BRIP 64450 Burnie, A. Molsemi Ballarat Jan 2015; Sep 2016 Severe crown discolouration and suppressed growth Moslemi et al. (2017b) UoM0025; BRIP 64451 Fusarium equiseti UoM0022; BRIP 64447 UoM0023; BRIP 64448 Crown and basal petioles Jun 2014; Devonport A. Molsemi Jan 2015; Crown discolouration Moslemi et al. (2017b) Crown discolouration Moslemi et al. (2017b) Sep 2016 Jun 2014; Fusarium venenatum UoM0020; BRIP 64446 Crown Devonport A. Molsemi Jan 2015; Sep 2016 Stemphylium herbarum UMSh02- BRIP 65181 Flower stem base Table Cape & Burnie A. Moslemi Sep-16 pseudothecia at the base of old flower stems, necrotic leaf lesions on both sides Moslemi et al. (2017a) 148 Chapter 10: Discussion of the leaves UMPc01- BRIP 65168 UMPc03- BRIP 65170 UTAS01- BRIP 57988 UTAS02-BRIP 65174 Paraphoma UTAS04- BRIP 65173 chlamydocopiosa UTAS05-BRIP 57989 N. Vaghefi, T. Leaf Table Cape Pearce, F. 2013 Hay, J. Scott UTAS06-BRIP 65176 Necrotic leaf lesions on both sides of the leaves and growth reduction Moslemi et al. (2017c) UTAS07-BRIP 65177 UTAS09-BRIP 65178 UTAS010-BRIP 65179 N. Vaghefi, T. Paraphoma pye UMPp02-BRIP 65169 Leaf Table Cape Pearce, F. 2013 Hay, J. Scott Necrotic leaf lesions on both sides of the leaves and growth reduction Moslemi et al. (2017c) UMPv001-BRIP 63684 Paraphoma vinacea UMPv002-BRIP 63683 Crown, basal UMPv003-BRIP 63682 petiole, upper root Burnie A. Moslemi Jun-14 Severe crown discolouration and growth reduction Moslemi et al. (2016) UMPv004- BRIP 63685 149 Chapter 10: Discussion Bionectria ochroleuca, Plectosphaerella cucumerina and Rhizoctonia oryzaesativa were also isolated from the crown, roots and basal petioles of pyrethrum plants in the survey conducted in 2014 in Tasmania. However, these putative pathogens did not appear to be important pathogens of pyrethrum as glasshouse experiments revealed that they did not significantly reduce the dry weight and were infrequently isolated from the inoculated plants in the glasshouse. Besides, these pathogens were not detected in other field surveys. This comprehensive study of the pathogens isolated from pyrethrum plants in yield-decline affected fields of northern Tasmania has improved the knowledge of the fungal pathogens that exist in affected fields. The minor pathogens may become more important to pyrethrum production with a change in environmental conditions that favours infection and colonisation. This could occur with the development of climate change (Elad and Pertot 2014). Further research is needed into the effect that different environmental conditions will have on host-pathogen interaction for each of these pathogens. The pathogenicity of the major pathogens was initially assessed using three different inoculation techniques of root-dip, soil drench and foliar spray to optimize the most effective inoculation method. The root-dip method was the most effective technique to enhance infection and accelerate disease symptom development (Moslemi et al. 2017b). This was most likely because of damage to roots of plants during the inoculation process thus enabling direct infection to take place. In glasshouse pathogenicity trials several inoculated plants in each treatment appeared not to be infected as the pathogen could not be reisolated from the plant tissue. Hence, non-infected plants were removed from the dry weight analyses to reduce the error caused by inclusion of dry weight of the non-infected plants. Paraphoma vinacea and F. oxysporum caused severe crown and root infection with the root-dip inoculation method compared to soil drench and foliar spray. Of all the four Fusarium species, F. equiseti was found to be the least important pathogen, although it was isolated from the roots of the root-dip inoculated pyrethrum plants and significantly reduced the below-ground dry weight. However, as the pathogen was not consistently isolated from any other tissues in the glasshouse experiments this was excluded from further pathogenicity trials. Fusarium venenatum 150 Chapter 10: Discussion was isolated from the yield-decline affected fields in northern Tasmania and Ballarat region of Victoria however, incidence of the pathogen fluctuated between different field collections and the pathogen did not significantly reduce the plant biomass in any of the glasshouse experiments. Fusarium oxysporum and F. avenaceum appeared to be the most prevalent Fusarium pathogens isolated from the yield-decline affected fields of northern Tasmania and Ballarat region of Victoria, and significantly reduced the below-ground and total biomass of the root-dip inoculated pyrethrum plants in glasshouse bioassays. Although, Fusarium avenaceum significantly reduced the below-ground dry weight, occasional inconsistencies were observed in above-ground and total biomass reduction in some trials. Pathogenicity of F. avenaceum in pyrethrum was confirmed in the waterlogging experiments, where the pathogen significantly and constantly reduced above-ground, below-ground and total biomass of the root-dip inoculated pyrethrum plants under both optimal and waterlogged conditions. In contrast, F. oxysporum reduced above-, belowground and total biomass of the infected plants significantly in all the glasshouse experiments. Hence, both F. oxysporum and F. avenaceum can now be recognised as important pathogens of pyrethrum. Paraphoma vinacea was able to significantly reduce above-ground, below-ground and total biomass of plants inoculated by root-dip method compared to the other two inoculation techniques. However, the number of infected plants between root-dip and soil drench inoculation techniques was not different and only the foliar spray method caused less infection. For P. vinacea, cross contamination occurred in preliminary experiments due to use of overhead sprinklers in the glasshouse which provided an ideal environment for conidiospore transmission from infected to non-infected controls. Therefore, subsequent experiments used drip irrigation to supply water to the pots to minimize splash dispersal of conidia. Pycnidia most likely formed on the infected upper crown or base of necrotic petioles above the soil surface, which enabled water splash dispersal of conidia. This indicated an efficient means of dispersal of spores even though the pathogen is a root and crown rot pathogen. Spores that splashed onto the surface of the leaves were probably washed down the petiole to infect the crown region of the healthy plants. 151 Chapter 10: Discussion Paraphoma chlamydocopiosa and P. pye were originally isolated from necrotic leaf lesions however, glasshouse pathogenicity bioassays using root-dip inoculation showed significant infection of the crown tissue, and reduction of above-ground, below-ground and total biomass. These pathogens also produced leaf lesions after foliar spray inoculation. Alternaria infectoria and Stemphylium herbarum were identified from pseudothecia formed at the base of the dead pyrethrum flower stems in field plants. This was the first report of the sexual stage of Alternaria and Stemphylium on pyrethrum plants (Moslemi et al. 2017a). However, Stemphylium botryosum and Alternaria tenuissima had been reported in previous studies by Pethybridge et al. (2004) and Hay et al. (2015) as foliar pathogens of pyrethrum. Stemphylium herbarum was identified based on morphological and taxonomic differences compared to S. botryosum (Moslemi et al. 2017a). Hay et al. (2015) reported that the incidence and severity of Alternaria tenuissima in the fields of northern Tasmania changed according to changes in environmental conditions. A change in the climate may be shifting the predominant Alternaria spp from A. tenuissima to A. infectoria, especially if the sexual stage of this later pathogen is readily produced. Sexual reproduction of a pathogen leads to greater adaptability to changing environments (Vaghefi et al. 2016). Therefore, further studies are needed to determine the role of S. herbarum, A. infectoria, S. botryosum and A. tenuissima as foliar pathogens in yield-decline of pyrethrum. 10.1. Fusarium formae specialis identification Fusarium oxysporum species were identified using multigene phylogenetic analyses. However, further studies are required to determine host specificity and if this F. oxysporum species is a formae specialis specific to pyrethrum or if it has a broad host range capable to infect multiple host species. To identify the form species of F. oxysporum as a specific pathogen of pyrethrum, further studies need to investigate cross-host infection and disease development by F. oxysporum from pyrethrum and disease development in different closely related species, particularly in the Asteraceae. Pathotypes of F. oxysporum may also exist within the pathogen population however, to determine pathotypes resistant cultivars of pyrethrum need to be identified and screened 152 Chapter 10: Discussion for host reaction to isolates of the pathogen. However, resistance to F. oxysporum in pyrethrum cultivars has yet to be identified. Fusarium oxysporum f. sp. chrysanthemi was identified as a specific pathogen infecting chrysanthemum plants (Singh and Kumar 2013, 2014) as it blocked the xylem vessel and caused significant wilt in the inoculated plants by production of toxins. Fusarium oxysporum f. sp. chrysanthemi has also been identified by Lievens et al. (2008) using specific primers designed from transposable element Fot1 as the specific marker. Class I and class II transposons have been reported as means of identification of formae speciales of F. oxysporum as these carry specific pathogenic genes which only some species of F. oxysporum possess. Transposable elements are DNA distinct fragments which jump or replicate to various locations of the pathogenic gene hence, create specific sequences which can be used to design specific primers (Lievens et al. 2008). The movement mechanism of transposon class I and class II is through retroposition and cut-and-paste mechanisms (Lievens et al. 2008). Pathogenicity of some Fusarium spp. can be related to certain transposons. Fot1 is one of the transposable elements for developing specific markers used for identification of F. oxysporum f. sp. albedinis on palm dates (Lievens et al. 2008). In addition, sequences of some cell wall degrading enzymes exuded by pathogenic fungi can be used to design specific primers for the identification of form species of Fusarium. For instance, polygalacturonase is specifically produced by Fusarium spp. and has been successfully used for identification of F. oxysporum f. sp. lycopersici and F. oxysporum f. sp. radices-lycopersici (Hirano and Arie 2006). 10.2. Interaction of waterlogging with pathogens on growth of pyrethrum Waterlogging caused wilt, necrosis and chlorosis of young leaves, petioles of the inoculated pyrethrum plants. Significant differences in stress severity occurred when plants were exposed to a 4-day waterlogging stress. A significant interaction occurred between waterlogging and pathogen treatments 2 maw with significant reduction in the below-ground dry weight specifically with plants inoculated with F. oxysporum and P. vinacea. The time period from before waterlogging to 2 maw was an important factor in growth reduction of pyrethrum as the interaction between sampling time and pathogens, and sampling time and waterlogging treatment were very significant at 2 maw. 153 Chapter 10: Discussion Therefore, waterlogging exacerbated the effect of F. oxysporum and P. vinacea on growth of pyrethrum 2 maw. However, the number of flowers, flower stems and green shoots was only significantly affected by the waterlogging treatment 6 maw and not by the pathogens or interaction between the waterlogging and pathogens. The effect of waterlogging alone on the growth and yield of pyrethrum requires further studies as all plants except the non-inoculated controls were root-dip inoculated before waterlogging stress was imposed. Hence, future experiments can be conducted in which the plants are infected after the waterlogging treatment. This would enable a better understanding of the synergistic effect of waterlogging on fungal pathogen infection of the inoculated plants. Different inoculation techniques affected disease incidence and severity in previous experiments. Therefore, different inoculation techniques such as root-dip and soil drench might show significantly different results for growth reduction and pathogenicity, when used after exposure of the plants to a waterlogging stress. Hence, using different inoculation methods to infect plants after a short period of waterlogging and assessing the effect of each variable on pyrethrum growth and yield in future studies are suggested. 10.3. Management Accurate identification of pathogens associated with pyrethrum yield-decline and understanding their life cycles is of great importance as this helps in the determination of appropriate control techniques. Many species of the genus Fusarium are nonpathogenic or even beneficial thus, it is important to be able to identify the pathogenic species (Lievens et al. 2007). Accurate identification of all pyrethrum pathogens is critical to all aspects of biosecurity and invasive species management to implement appropriate decisions and actions (Summerell et al. 2003). Management of F. oxysporum, F. avenaceum and P. vinacea in the yield-decline affected fields of northern Tasmania or Ballarat has not been specifically studied. Little is known about the appropriate control practices required to reduce the population of these pathogens in the yield-decline affected sites. Therefore, a review of management techniques such as application of fungicides or crop rotation used for the control of foliar pathogens such as S. tanaceti and D. tanaceti causing diseases of pyrethrum might be informative, and 154 Chapter 10: Discussion can also be applied for effective control of root and crown rot pathogens in pyrethrum fields. Many different management methods have been used to control Fusarium spp. in other cropping systems such as soil sanitation, rotation with non-host crops, and chemical or biological control using species of Trichoderma, Aspergillus and Penicillium (KullnigGradinger et al. 2002; Singh and Kumar 2014). Soil fumigation prior to cultivation and using high resistant cultivars are recommended as a control technique however, in pyrethrum production soil fumigants are too expensive and no susceptible or resistant pyrethrum varieties are known. Lievens et al. (2007, 2008) speculated that new pathotypes or form species of Fusarium may emerge from the non-pathogenic species due to mutations and this makes it difficult to control diseases caused by various Fusarium spp. Singh and Kumar (2014) stated that Trichoderma viride and Aspergillus ochraceous had significant roles in reduction of mycelia of F. oxysporum f. sp. chrysanthemi in the infected xylems of Chrysanthemum sp. Larkin and Fravel (1998) recommended the use of a group of biocontrol microorganisms which live in the same rhizosphere or on the same plant to control Fusarium wilt of tomato. Several non-pathogenic Fusarium strains isolated from suppressive soils were known to be highly effective in the control of Fusarium wilt of tomato caused by F. oxysporum f. sp. lycopersici. The import of plant material of species closely related to pyrethrum such as Chrysanthemum sp. may lead to the introduction of exotic pathogens that pose a threat to the pyrethrum industry. These may be transmitted through infected seed or propagatable material. According to the Biosecurity Import Condition System (BICON) in Australia, plants such as Chrysanthemum spp. which are propagatable need to be devitalised using glyphosate previous to being transported to Australia and need transport permit (Department of Agriculture and Water Resources). Hot water treatment of seed has been shown to reduce incidence of seed-borne pathogens transmitted by infected seed. Stagonosporopsis tanaceti that causes ray blight disease of pyrethrum has been shown to be controlled through application of hot water to prevent transmission (Bhuiyan et al. 2016). The hot water treatment may be applicable to control other fungal pathogens that are seed transmitted. 155 Chapter 10: Discussion PCR approaches are relatively cost effective and fast in detection of a specific fungal pathogen infecting symptomless plants. This method may be used to detect exotic pathogens in infected imported plant material in quarantine. In addition, quantified PCR (qPCR) with fluorescent probes and Taq DNA polymerase (TaqMan) have been able to detect and quantify DNA of the pathogen in planta (Boyle et al. 2004). As well, real time PCR techniques have been used to track the pathogen within the infected tissues and accelerated the process of identification in planta. Singh and Kumar (2014) reported that severity of symptoms caused by F. oxysporum f. sp. chrysanthemi was dependent on resistance or susceptibility of cultivars. Therefore, detection of Fusarium spp. in planta is of high value especially as the pathogen does not produce clear symptoms on pyrethrum. qPCR has also been used to determine the amount of inoculum in field soil thus resulting in the identification of threshold levels of inoculum required for disease development (Lievens et al. 2007). No control techniques have been recommended for management of diseases caused by Paraphoma spp. However, removal of dead plant material and debris, which can be sources of pycnidia, from the fields and crop rotation with non-host plants may be effective in reducing inoculum levels to control disease development. Further studies into the life cycle of Paraphoma spp. infecting pyrethrum will provide a better insight into how these pathogens infect and reproduce which will enable better control strategies. In conclusion, new pathogens of pyrethrum have been identified using morphological and phylogenetic analyses. This expands the pyrethrum industry’s knowledge of the range of diseases that can affect growth and production, especially in yield-decline affected fields of northern Tasmania. Assessment of the interaction between these pathogens and abiotic stresses such as waterlogging is a step forward to a better understanding of pyrethrum yield-decline syndrome. In addition, pathogenicity tests with each pathogen have enabled disease symptoms to be described. This will assist the industry to early detect these diseases and to implement appropriate, specific and useful management techniques to prevent severe disease outbreaks. 156 List of references Alam M, Sattar A, Abdul-Khaliq, Samad A, Khanuja SPS, 2006. A root rot and wilt disease of pyrethrum (Chrysanthemum cineraefolium) caused by Rhizoctonia solani AG-4 in the north Indian plains. Plant Pathology 55, 301. Anaissie E, Nelson P, Beremand M, Kontoyiannis D, Rinaldi M, 1992. Fusariumcaused Hyalohyphomycosis: An Overview. Current Topics in Medical Mycology 4, 231-49. Anon, 2009. Canola yield decline in South-Eastern Australia. In: Group FLR, ed. Results from the Canola In Depth Project. Aoki T, O’donnell K, Geiser DM, 2014. Systematics of key phytopathogenic Fusarium species: current status and future challenges. J Gen Plant Pathol 80, 189-201. Aubertot JN, West JS, Bousset-Vaslin L, Salam MU, Barbetti MJ, Diggle AJ, 2006. Improved resistance management for durable disease control: A case study of Phoma stem canker of oilseed rape (Brassica napus). European Journal of Plant Pathology 114, 91-106. Aveskamp MM, Verkley GJ, De Gruyter J, Murace MA, Perello A, Woudenberg JH, Groenewald JZ, Crous PW, 2009. DNA phylogeny reveals polyphyly of Phoma section Peyronellaea and multiple taxonomic novelties. Mycologia 101, 363-82. Aveskamp MM, De Gruyter J, Woudenberg JH, Verkley GJ, Crous PW, 2010. Highlights of the Didymellaceae: A polyphasic approach to characterise Phoma and related Pleosporalean genera. Studies in Mycology 65, 1-60. Backhouse, Burgess LW, 2002. Climatic analysis of the distribution of Fusarium graminearum, F. pseudograminearum and F. culmorum on cereals in Australia. Australasian Plant Pathology 31, 321–7. Backhouse, Abubakar AA, Burgess LW, Dennis I, Hollaway GJ, Wildermuth GB, Wallwork H, Henry FJ, 2004. Survey of Fusarium species associated with crown rot of wheat and barley in eastern Australia. Australasian Plant Pathology 33, 255–61. Bakan B, Giraud-Delville C, Pinson L, Richard-Molard D, Fournier E, Brygoo Y, 2002. Identification by PCR of Fusarium culmorum strains producing large and small 157 amounts of deoxynivalenol. Applied and Environmental Microbiology 68, 54729. Balajee SA, Borman AM, Brandt M, E., Cano J, Cuenca-Estrella M, Dannaoui E, Guarro J, Haase G, Kibbler CC, Meyer WS, O’Donnell K, Petti CA, RodriguezTudela JL, Sutton DA, Velegraki A, Wickes BL, 2009. Sequence-based identification of Aspergillus, Fusarium, and Mucorales species in the clinical mycology laboratory: where are we and where should we go from here? Journal of Clinical Microbiology 877-84. Barimani M, Pethybridge SJ, Vaghefi N, Hay FS, Taylor PWJ, 2013. A new anthracnose disease of pyrethrum caused by Colletotrichum tanaceti sp nov. Plant Pathology 62, 1248-57. Barnett HL, Hunter BB, 1972. Illustrated genera of imperfect fungi. Minnesota: Burgess Publishing Company. Belabid L, Baum M, Fortas Z, Bouznad Z, Eujayl I, 2004. Pathogenic and genetic characterization of Algerian isolates of Fusarium oxysporum f. sp. lentis by RAPD and AFLP analysis. African Journal of Biotechnology 3, 25-31. Bhuiyan MaHB, Groom T, Nicolas ME, Taylor PWJ, 2015. Histopathology of S. tanaceti infection in pyrethrum leaf lamina. Australasian Plant Pathology 44, 629-36. Bhuiyan MB, Groom T, Nicolas ME, Taylor PWJ, 2016. Infection process of Stagonosporopsis tanaceti in pyrethrum seed and seedlings. Plant Pathology 66(5), 742-51. Boerema GH, De Gruyter J, Noordeloos ME, Hamers MEC, 2004. Phoma identification manual : differentiation of specific and infra-specific taxa in culture. Wallingford, Oxfordshire, UK ; Cambridge, MA, USA: CABI Pub. Bogale M, Wingfield BD, Wingfield MJ, Steenkamp ET, 2006. Characterization of Fusarium oxysporum isolates from Ethiopia using AFLP, SSR and DNA sequence analyses. Fungal Diversity 23, 51-66. Bogale M, Wingfield BD, Wingfield MJ, Steenkamp ET, 2007. Species-specific primers for Fusarium redolens and a PCR-RFLP technique to distinguish among three clades of Fusarium oxysporum. FEMS Microbiology Letters 271, 27-32. 158 Boyle DG, Boyle DB, Olsen V, Morgan JaT, Hyatt AD, 2004. Detection of Ralstonia solanacearum strains with a quantitative, multiplex, real-time, fluorogenic PCR (TaqMan) Assay. Diseases of aquatic organisms 60, 141-8. BRA, 2014. The Australian Pyrethrum Industry Pty. Ltd. Available online http://www.botanicalra.com.au/. Bradford KJ, 1983. Involvement of plant growth substances in the alteration of leaf gasexchange of flooded tomato plants. Plant Physiology 73 (2), 480-3. Brasier CM, Kirk SA, Delcan J, Cooke DEL, Jung T, Man In't Veld WA, 2004. Phytophthora alni sp. nov. and its variants: designation of emerging heteroploid hybrid pathogens spreading on Alnus trees. Mycological Research 108, 1172-84. Brown PH, Menary RC, 1994. Flowering in pyrethrum (Tanacetum cinerariaefolium L.). II. Changes in plant growth regulator concentrations. Journal of Horticultural Science 69, 985-92. Burgess, 1981. General ecology of the fusaria In. Fusarium: diseases, biolgy and taxonomy. Pennsilvania, USA: Pennsilvania State Universite Press, 225-35. Burgess LW, Summerell BA, Nelson PE, 1991. An evaluation of several media for use in identification of some Fusarium species. Australasian Plant Pathology 20. Burgess LW, Summerell BA, 1992. Mycogeography of Fusarium: survey of Fusarium species in subtropical and semi-arid grassland soils from Queensland, Australia. Mycological Research 96 780-4. Carlucci A, Raimondo ML, Santos J, Phillips AJL, 2012. Plectosphaerella species associated with root and collar rots of horticultural crops in southern Italy. Persoonia 28, 34-48. Casida, 1973. Pyrethrum: the natural insecticide. London: Academic Press. Casida, Quistad GB, 1995. Pyrethrum flowers: production, chemistry, toxicology and uses New York: Oxford University Press. Correll JC, 1991. The relationship between formae speciales, races and vgetative compatibility groups in Fusarium oxysporum. Plant Disease 81, 1061-4. Cotching B, 2012. Pyrethrum growing in Tasmania, Wealth from Water factsheet. In. Tasmania: Tasmanian Institute of Agriculture. Croft BJ, Magarey RC, 1984. Pathogenic fungi associated with northern poor root syndrme of sugarcane. Australian Society of Sugarcane Thechnologists 55-61. 159 Crous PW, Verkley GJM, Groenewald JZ, Samson RA eds, 2009. Fungal Biodiversity. CBS Laboratory Manual Series 1. CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands. Cullen DW, Toth IK, Pitkin Y, Boonham N, Barker KWI, Lees AK, 2005. Use of quantitative molecular diagnostic assays to investigate Fusarium dry rot in potato stocks and soil. Phytopathology 95, 1462-71. Davies CL, Turner DW, Dracup M, 2000. Yellow lupin (Lupinus luteus) tolerates waterlogging better than narrow-leafed lupin (L. angustifolius). Shoot and root growth in a controlled environment. Australian Journal of Agricultural Research 51(6), 701-9. De Gruyter J, Boerema GH, 2002. Contributions towards a monograph of Phoma (Coelomycetes) VIII - Section Paraphoma: Taxa with setose pycnidia. Persoonia 17, 541-61. De Gruyter J, Woudenberg JH, Aveskamp MM, Verkley GJ, Groenewald JZ, Crous PW, 2010. Systematic reappraisal of species in Phoma section Paraphoma, Pyrenochaeta and Pleurophoma. Mycologia 102, 1066-81. De Gruyter J, Woudenberg JHC, Aveskamp MM, Verkley GJM, Groenewald JZ, Crous PW, 2013. Redisposition of phoma-like anamorphs in Pleosporales reevaluation. Studies in Mycology 75, 1-36. Di Pietro A, Madrid MP, Caracuel Z, Delgado-Jarana J, Roncero MIG, 2003. Fusarium oxysporum: exploring the molecular arsenal of a vascular wilt fungus. Molecular Plant Pathology 4, 315-25. Dorenbosch MJ, 1970. Key to nine ubiquitous soil-borne phoma-like fungi. Persoonia 6, 1-14. Dowson WJ, 1934. Phytophthora megasperma Dreshler in Tasmania. Transactions British Mycological Society 19, 89-90. Drenth A, Janssen EM, Govers F, 1995. Formation and survival of oospores of Phytophthora infestans under natural conditions. Plant Pathology 44, 86-94. Elad Y, Pertot I, 2014. Climate change impacts on plant pathogens and plant diseases. Journal of Crop Improvement 28(1), 99-139. 160 Ellis ML, Jimenez DRC, Leandro LF, Munkvold GP, 2014. Genotypic and phenotypic characterization of fungi in the Fusarium oxysporum species complex from soybean roots. Phytopathology 104, 1329-39. Francis RG, Burgess LW, 1977. Characterization of two populations of Fusarium roseum "Graminearum" in Eastern Australia. In. Molecular identification of fungi 68, 421-7. Garside AL, Bell MJ, Robotham BG, Magarey RC, Stirling GR, 2005. Managing yield decline in sugarcane cropping systems. Sugar Yield Decline Joint Venture, 7. Geiser DM, Jime´nez-Gasco MM, Kang S, Makalowska I, Narayanan V, Ward TJ, Zhang N, Kuldau GA, and O’Donnell K, 2004. FUSARIUM-ID v. 1.0: A DNA sequence database for identifying Fusarium. European Journal of Plant Pathology 110, 473-9. Geiser DM, Aoki T, Bacon CW, Baker SE, Bhattacharyya MK, Brandt ME, Brown DW, Burgess LW, Chulze S, Coleman JJ, Correll JC et al. 2013. One fungus, one name: defining the genus Fusarium in a scientifically robust way that preserves longstanding use. Phytopathology 103, 400-8. Gerlach W, Nirenberg H, 1982. The genus Fusarium: a pictorial atlas. In. Mitteilungen der Biologischen Bundesanstalt für Land- und Forstwirtschaft 209. Glover J, 1955. Chilling and flower bud stimulation in pyrethrum (Chrysanthemum cinerariaefolium). Annals of Botany 19 (1), 138-48. Gnadinger CB, 1936. Pyrethrum flowers. Minneapolis, Minnesota. González D, Cubeta MA, Vilgalys R, 2006. Phylogenetic utility of indels within ribosomal DNA and -tubulin sequences from fungi in the Rhizoctonia solani species complex. Molecular Phylogenetics and Evolution 40, 459–70. Gräfenhan T, Schroers HJ, Nirenberg HI, Seifert KA, 2011. An overview of the taxonomy, phylogeny, and typification of nectriaceous fungi in Cosmospora, Acremonium, Fusarium, Stilbella, and Volutella. Studies in Mycology 68, 79113. Grdisa M, Carovic-Stanko K, Kolak I, Satovic Z, 2009. Morphological and biochemical diversity of dalmatian pyrethrum (Tanacetum cinerariifolium (Trevir.) Sch.Bip.). Agriculturae Conspectus Scientificus 74, 73-80. 161 Greenhill M, 2007. Pyrethrum production: Tasmanian success story. Chronica Horticulture 47, 5. Groom T, 2014. An hypothesis on the cause of SPLASH. Unpublished. Hay FS, Stirlling G, Chung B, Groom T, 2002. Investigation into the cause of pyrethrum regrowth decline (RPD) with emphasis on the role of plant-parasitic nematodes. Sydney, NSW: Horticulture Australia. Hay FS, Stirling GR, Pethybridge SJ, Chung B, 2009. A survey of nematodes associated with pyrethrum in Tasmania, Australia, and the susceptibility of pyrethrum cultivars to root-lesion nematode. Australasian Plant Pathology 38, 1-5. Hay FS, Pilkington S, Palmer C, Bond B, Hingston L, Pethybridge SJ, 2012. Pilot study into ‘Slow Plant Loss After Single Harvest’ (SPLASH) syndrome in pyrethrum. In. Commercial in confidence – not for distribution without permission of Botanical Resources Australia. 61. Hay FS, Gent DH, Pikongton S, Pearce TL, Scott JB, Pethybridge SJ, 2015. Changes in distribution and frequency of fungi associated with foliar diseases complex of pyrethrum in Australia. Plant Disease 9 (99), 1227-35. Hirano Y, Arie T, 2006. PCR-based differentiation of Fusarium oxysporum f. sp. lycopersici and radicis-lycopersici and races of F. oxysporum f. sp. lycopersici. Journal of General Plant Pathology 72, 273-83. Hirooka Y, Kobayashi T, 2007. Taxonomic studies of nectrioid fungi in Japan. II: The genus Bionectria. The Mycological Society of Japan and Springer 48, 81-9. Hitmi A, Coudret A, Barthomeuf C, 2000. The Production of yyrethrins by plant cell and tissue cultures of Chrysanthemum cinerariaefolium and Tagetes Species. Critical Reviews in Plant Sciences 19, 69-89. Hyde KD, Nilsson RH, Alias SA, Ariyawansa HA, Blair JE, Cai L, de Cock AWAM, Dissanayake AJ, Glockling SL, Goonasekara ID et al., 2014. One stop shop: backbones trees for important phytopathogenic genera: I (2014). Fungal Diversity 67, 21-125. IPNI, 2016. The International Plant Names Index. In. http://www.ipni.org. Javid M, Zhang PJ, Taylor PWJ, Pethybridge SJ, Groom T, Nicolas ME, 2013. Interactions between waterlogging and ray blight in pyrethrum. Crop & Pasture Science 64 (7), 726-35. 162 Johanson A, Turner HC, Mckay GJ, Brown AE, 1998. A PCR-based method to distinguish fungi of the rice sheath-blight complex, Rhizoctonia solani, R-oryzae and R-oryzae-sativae. FEMS Microbiology Letters 162, 289-94. Johnston PR, 1981. Phoma on New-Zealand grasses and pasture legumes. New Zealand Journal of Botany 19, 173-86. Jones S, Pethybridge SJ, Hay FS, Groom T, Wilson C, 2007. Baseline sensitivity of Australian Phoma ligulicola isolates from pyrethrum to azoxystrobin and difenoconazole. Journal of Phytopathology 155, 377-80. Kiriamiti H, Camy S, Gourdon C, Condoret JS, 2003. Supercritical carbon dioxide processing of pyrethrum oleoresin and pale. Journal of Agricultural and Food Chemistry 51, 880-4. Klosterman SJ, Atallah ZK, Vallad GE, Subbarao KV, 2009. Diversity, pathogenicity; and management of Verticillium Species. Annual Review of Phytopathology 47, 39-62. Kullnig-Gradinger CM, Szakacs G, Kubicek CP, 2002. Phylogeny and evolution of the genus Trichoderma: a multigene approach. Mycological Research 106, 757-67. Larkin RP, Fravel DR, 1998. Efficacy of various fungal and bacterial biocontrol organisms for control of Fusarium wilt of tomato. Plant Disease 82, 1022-8. Laurence MH, Summerell BA, Burgess LW, Liew ECY, 2011. Fusarium burgessii sp. nov. representing a novel lineage in the genus Fusarium. Fungal Diversity 49, 101–12. Leslie JF, Summerell BA, 2006. The Fusarium laboratory manual. Ames IA Blackwell publishing. Lievens B, Claes L, Vakalounakis DJ, Vanachter AC, Thomma BP, 2007. A robust identification and detection assay to discriminate the cucumber pathogens Fusarium oxysporum f. sp. cucumerinum and f. sp. radicis-cucumerinum. Environmental Microbiology 9, 2145-61. Lievens B, Rep M, Thomma BPHJ, 2008. Recent developments in the molecular discrimination of formae speciales of Fusarium oxysporum. Pest Management Science 64, 781-8. Link HF, 1809. Observationes in ordines plantarum naturales, Dissetatio 1 ma. Berlin Ges. NatKde 3: 1–42), Germany. 163 Lombard L, Van Der Merwe NA, Groenewald JZ, Crous PW, 2015. Generic concepts in Nectriaceae. Studies in Mycology, 189-245. Macdonald WL, 1995. Pyrethrum flowers: Production in Australia New York: Oxford University Press. Mandeel QA, Abbas JA, Saeed AM, 1995. Survey of Fusarium species in an arid environment of Bahrain II. Spectrum of species on five isolation media. SYDOWIA-HORN 47, 223-39. Mansoori B, 2011. An improved ethanol medium for efficient recovery and estimation of Verticillium dahliae populations in soil. Canadian Journal of Plant Pathology-Revue Canadienne De Phytopathologie 33, 88-93. Mcalpine D, 1902. Fungus diseases of stone-fruit trees in Australia and their treatment. RS Brain, government printer. Mcdonald GK, Dean G, 1996. Effect of waterlogging on the severity of disease caused by Mycosphaerella pinodes in peas (Pisum sativum L). Australian Journal of Experimental Agriculture 36 (2), 219-22. Messiaen CM, Cassini R, 1981. Taxonomy of Fusarium. In. Fusarium: Diseases, Bioligy and Taxonomy. Pennsilvania, USA: The Pennsilvania State University Press 427-45. Morgan-Jones G, White JF, 1983. Studies on the genus Phoma. III. Paraphoma, a new genus to accommodate Phoma radicina. Mycotaxon 18, 57–65. Morris SE, Davies NW, Brown PH, Groom T, 2006. Effect of drying conditions on pyrethrins content. Industrial Crops and Products 23, 9-14. Moslemi A, Ades PK, Groom T, Crous PW, Nicolas ME, Taylor PWJ, 2016. Paraphoma crown rot of pyrethrum (Tanacetum cinerariifolium) Plant Disease 100, 2363-9. Moslemi A, Ades PK, Groom T, Nicolas ME, Taylor PWJ, 2017a. Alternaria infectoria and Stemphylium herbarum, two new pathogens of pyrethrum (Tanacetum cinerariifolium) in Australia. Australasian Plant Pathology 46 (1), 91-101. Moslemi A, Ades PK, Groom T, Nicolas ME, Taylor PWJ, 2017b. Fusarium oxysporum and Fusarium avenaceum associated with yield-decline of pyrethrum in Australia. European Journal of Plant Pathology 149 (1), 43-56. Mycology-Online, 2016. In. http://www.mycology.adelaide.edu.au/. 164 Nelson PE, Tousson TA, Cook RJ, 1981. Fusarium: Diseases, Biology and Taxonomy. Pennsilvania, USA: Pennsilvania State university Press. Newell GR, 1998. Characterization of vegetation in an Australian open forest community affected by cinnamon fungus (Phytophthora cinnamomi): implications for faunal habitat qualit. Plant Ecology 137, 55-70. Nobile CJ, Bruno VM, Richard ML, Davis DA, Mitchell AP, 2003. Genetic control of chlamydospore formation in Candida albicans. Microbiology Society Journal 149, 3629-37. O’Donnell K, Kistler HC, Cigelnik E, Ploetz R, 1998. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. National Academy of Sciences 97, 2044-9. O'Donnell K, Sarver BA, Brandt M, Chang DC, Noble-Wang J, Park BJ, Sutton DA, Benjamin L, Lindsley M, Padhye A et al., 2007. Phylogenetic diversity and microsphere array-based genotyping of human pathogenic Fusaria, including isolates from the multistate contact lens-associated U.S. keratitis outbreaks of 2005 and 2006. Jouranl of Clinical Microbiology 45, 2235-48. O'Donnell K, Gueidan C, Sink S, Johnston PR, Crous PW, Glenn A, Riley R, Zitomer NC, Colyer P, Waalwijk C et al., 2009a. A two-locus DNA sequence database for typing plant and human pathogens within the Fusarium oxysporum species complex. Fungal Genetics and Biology 46, 936-48. O'Donnell K, Sutton DA, Rinaldi MG, Gueidan C, Crous PW, Geiser DM, 2009b. Novel multilocus sequence typing scheme reveals high genetic diversity of human pathogenic members of the Fusarium incarnatum, F. equiseti and F. chlamydosporum species complexes within the United States. Journal of Clinical Microbiology 47, 3851-61. O’Donnell K, Sutton DA, Rinaldi MG,Sarver BAJ, Balajee SA, Schroers HJ, Summerbell RC, Robert VARG, Crous PW, Zhang N et al., 2010. Internetaccessible DNA sequence database for identifying fusaria from human and animal infections. Journal of Clinical Microbiology 48, 3708-18. O'Donnell K, Rooney AP, Proctor RH,Brown DW, McCormic SP, Ward TJ, Frandsen RJN, Lysoe E, Rehner SA, Aoki T et al., 2013. Phylogenetic analyses of RPB1 165 and RPB2 support a middle Cretaceous origin for a clade comprising all agriculturally and medically important fusaria. Fungal Genetics and Biology 52, 20-31. O'Donnell K, Ward TJ, Robert VaRG, Crous PW, Geiser DM, Kang S, 2015. DNA sequence-based identification of Fusarium: Current status and future directions. Phytoparasitica 43, 583-95. Pankhurst CE, Magarey RC, Stirling GR, Blair BL, Bell MJ, Garside AL, 2003. Management practices to improve soil health and reduce the effects of detrimental soil biota associated with yield decline of sugarcane in Queensland, Australia. Soil & Tillage Research 72, 125-37. Paul NC, Deng JX, Lee JH, Yu SH, 2013. New records of endophytic Paecilomyces inflatus and Bionectria ochroleuca from chili pepper plants in Korea. Mycobiology 41, 18-24. Paulitz TC, Okubara PA, Schillinger WF, 2006. First report of damping-off of canola caused by Rhizoctonia solani AG 2-1 in Washington state. Plant Disaese 90, 829. Pearce TL, Scott JB, Crous PW, Pethybridge SJ, Hay FS, 2015. Tan spot of pyrethrum is caused by a Didymella species complex. Plant Pathology 65, 1170-84. Peters JC, Lees AK, Cullen DW, Sullivan L, Stroud GP, Cunnington AC, 2008. Characterization of Fusarium spp. responsible for causing dry rot of potato in Great Britain. Plant Pathology 57, 262-71. Pethybridge SJ, Wilson CR, 1998. Confirmation of ray blight disease of pyrethrum in Australia. Australasian Plant Pathology 27, 45-8. Pethybridge SJ, Hay FS, Groom T, 2003. Seasonal fluctuations in fungi associated with pyrethrum foliage in Tasmania. Australasian Plant Pathology 32 (2), 223-30. Pethybridge SJ, Hay FS, Wilson CR, 2004. Pathogenicity of fungi commonly isolated from foliar disease in Tasmanian pyrethrum crops. Australasian Plant Pathology 33, 441-4. Pethybridge SJ, Hay FS, Esker PD, Gent DH, Wilson CR, Groom T, Nutter F W, 2008a. Diseases of pyrethrum in Tasmania: Challenges and prospects for management. Plant Disease 92 (9), 1260-72. 166 Pethybridge SJ, Hay FS, Esker PD, Groom T, Wilson CR, Nutter FW, 2008b. Visual and radiometric assessment for yield losses caused by ray blight in pyrethrum. Crop Science 48, 343-52. Pethybridge SJ, Hay FS, Groom T, 2010a. Identification of the factors contributing to pyrethrum SPLASH syndrome. Unpublished, 24. Pethybridge SJ, Hay FS, Groom T, Wilson CR, 2008c. Improving the fungicide-based management program for ray blight disease in Tasmanian pyrethrum fields. Plant Disease 92, 887-95. Pethybridge SJ, Jones SJ, Shivas RG, Hay FS, Wilson CR, Groom T, 2008d. Tan spot: a new disease of pyrethrum caused by Microsphaeropsis tanaceti sp nov. Plant Pathology 57, 1058-65. Pethybridge SJ, Ngugi HK, Hay FS, 2010. Use of survival analysis to assess management options for ray blight in Australian pyrethrum fields. Plant Pathology 59, 480-91. Phookamsak R, Liu JK, Mckenzie EHC,Manamgoda DS, Ariyawansa H, Thambugala KM, Dai DQ, Camporesi E, Chukeatirote E, Wijayawardene NN et al., 2014. Revision of Phaeosphaeriaceae. Fungal Diversity 68, 159-238. Q-Bank, 2016. Phoma methodologies. In.: http://www.q-bank.eu/. Quaedvlieg W, Verkley GJM, Shin HD, Barreto RW, Alfenas AC, Swart WJ, Groenewald JZ, Crous PW, 2013. Sizing up Septoria. Studies in Mycology, 30790. Ramirez AM, Stoopen G, Menzel TR, Gols R, Bouwmeester HJ, Dicke M, Jongsma MA, 2012. Bidirectional secretions from glandular trichomes of pyrethrum enable immunization of seedlings. Plant Cell 24, 4252-65. Rawnsley RP, Lane PA, Brown PH, Groom T, 2006. Occurrence and severity of the weeds Anthriscus caucalis and Torilis nodosa in pyrethrum. Australian Journal of Experimental Agriculture 46 (5), 711-6. Rawnsley RR, Gracie AJ, Lane PA, Brown PH, Groom T, 2007. Seed ecology of Apiaceae weeds in pyrethrum. In.: Seeds: Biology, Development and Ecology, Wallingford, UK: CABI Publishing, 398-406. Rehner S, 2001. Primers for Elongation Factor 1-alpha (EF1-alpha). 167 Rizzo DM, Garbelotto M, Davidson JM, Slaughter GW, Koike ST, 2002. Phytophthora ramorum as the cause of extensive mortality of Quercus spp. and Lithocarpus densiflorus in California. Plant Disease 86, 205-14. Salardini AA, Chapman KSR, Holloway RJ, 1994a. Effect of basal and side-dressed phosphorus on the achene yield and pyrethrins concentration in the achenes of pyrethrum (Tanacetum cinerariifolium) and on soil and plant phosphorus. Australian Journal of Agricultural Research 45 (1), 231-41. Salardini AA, Chapman KSR, Holloway RJ, 1994b. Effect of potassium fertilization of pyrethrum (Tanacetum cinerariifolium) on yield, pyrethrins concentration in dry achenes and potassium concentration in soil and plant tissues. Australian Journal of Agricultural Research 45 (3), 647-56. Sangalang AE, Burgess LW, Backhouse D, Duff J, Wurst M, 1995. Mycogeography of Fusarium species in soils from tropical, arid and mediterranean regions of Australia. Mycological Research 99 523-8. Saremi H, Okhovvat SM, Ashraf SJ, 2011. Fusarium diseases as the main soil borne fungal pathogen on plants and their control management with soil solarization in Iran. African Journal of Biotechnology 10. Scott JB, Gent DH, Pethybridge SJ, Groom T, Hay FS, 2014. Crop damage from Sclerotinia crown rot and risk factors in pyrethrum. Plant Disaese 98, 103-11. Setter TL, Waters I, 2003. Review of prospects for germplasm improvement for waterlogging tolerance in wheat, barley and oats. Plant and Soil 253 (1), 1-34. Singh PK, Kumar V, 2013. Biological control of Fusarium wilt of chrysanthemum with Trichoderma and Botanicals. Journal of Agricultural Technology 7, 1603-13. Singh PK, Kumar V, 2014. Fusarium Wilt of chrysanthemum – problems and prospects. Plant Pathology & Quarantine 1, 33-42. Snyder WC, Hansen HN, 1940. The species concept in Fusarium. American Journal of Botany 27, 64-7. Snyder WC, Hansen HN, 1941. The species concept in Fusarium with reference to section Martiella. American Journal of Botany 28, 738-42. Snyder WC, Hansen HN, 1945. The Species concept in Fusarium with reference to Discolor and other sections. American Journal of Botany 32, 657-66. 168 Snyder WC, Hansen HN, 1954. Variation and speciation in the genuse Fusarium. Annals New York Academy of Sciences. Srinath KV, Sarwar M, 1965. Alternaria blight of pyrethrum. Current Science 34, 295. Srivastava SNS, 1953. On the occurrence of Phoma chrysanthemicola Hollos on Chrysanthemum sp. Journal of Current Sciences 22, 216. Summerell BA, Salleh B, Malaysia P, Leslie JF, 2003. A utilitarian approach to Fusarium identification. The American Phytopathological Society 87, 118-28. Summerell BA, Laurence MH, Liew ECY, Leslie JF, 2010. Biogeography and phylogeography of Fusarium: a review. Fungal Diversity 44, 3-13. Suraweera D, Groom T, Nicolas ME, 2015a. Effects of sprinkler irrigation during the flowering period on flower development and pyrethrin accumulation in pyrethrum. Building Productive, Diverse and Sustainable Landscapes Publication in progress. Suraweera DD, Groom T, Nicolas ME, 2015b. Impact of elevated atmospheric carbon dioxide and water deficit on flower development and pyrethrin accumulation in pyrethrum. Procedia Environmental Sciences 29, 5-6. Tamura K, Nei M, 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial-DNA in humans and chimpanzees. Molecular Biology and Evolution 10, 512-26. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S, 2013a. Brief communication MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 12, 2725-9. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S, 2013b. MEGA6: Molecular evolutionary genetics analysis Version 6.0. Molecular Biology and Evolution 30, 2725-7. Tóth S, Stričík M, Týr S, Vereš T, 2012. The possibilities of Slovakian pyrethrum production. Pesticidi i fitomedicina (Belgrade) 27 (3), 245-52. Uhlig S, Jestoi M, Parikka P, 2007. Fusarium avenaceum- The North Europian situation. International journal of food microbiology 119, 17-24. Vaghefi N, Pethybridge SJ, Ford R, Nicolas ME, Corus PW, Taylor PWJ, 2012. Stagonosporopsis spp. associated with ray blight disease of Asteraceae. Australasian Plant Pathology 41, 675-86. 169 Vaghefi N, 2014. Systematics and population biology of the ray blight pathogen of pyrethrum in Australia. PhD thesis, The University of Melbourne. Vaghefi N, Hay FS, Ades PK, Pethybridge SJ, Ford R, Taylor PWJ, 2015. Rapid changes in the genetic composition of Stagonosporopsis tanaceti population in Australian pyrethrum fields. Phytopathology 105, 358-69. Vaghefi N, Hay FS, Pethybridge SJ, Ford R, and Taylor PWJ 2016a. Development of multiplex PCR diagnostic assay for the detection of Stagonosporopsis species associated with ray blight of Asteraceae. European Journal of Plant Pathology 146, 581-95. Vaghefi N, Pethybridge SJ, Hay FS, Ford R, Nicolas ME, Taylor PWJ, 2016b. Revisiting Stagonosporopsis species associated with chrysanthemum and pyrethrum ray blight. Australasian Plant Pathology 45, 561-70. West TF, 1959. The history of the African pyrethrum industry. Journal of the Royal Society of Arts 107, 423-41. White TJ, Bruns T, Lee S, Taylor J, 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In.: PCR Protocols : A guide to methods and applications 315-22. Windles CE, 1991. Current status of Fusarium taxonomy. The American Phytopathological Society, Plant Disease 81. Wingfield MJ, De Beer ZW, Slippers B, Wingfield BD, Groenewald JZ, Lombard L, Crous PW, 2012. One fungus, one name promotes progressive plant pathology. Molecular Plant Pathology 13, 604-13. Wollenweber HW, Reinking OA, 1935. Die Fusarien, ihre Beschreibung, Schadwirkung, und Bekampfung. Berlin: Verlag Paul Parey. Zhang, Schoch CL, Fournier J, et al., 2009a. Multi-locus phylogeny of Pleosporales: a taxonomic, ecological and evolutionary re-evaluation. Studies in Mycology 64, 85-102S5. Zhang L, Zheng L, Hsiang T, Lv R, Huang J, 2009b. An outbreak of head rot of cabbage caused by Rhizoctonia solani AG2-1 in central China. Plant Disaese 93, 109. Zhang, Crous PW, Schoch CL, Hyde KD, 2012. Pleosporales. Fungal Divers 53, 1-221. Zwickl DJ, Hillis DM, 2002. Increased taxon sampling greatly reduces phylogenetic error. Systematic Biology 51, 588-98. 170 Minerva Access is the Institutional Repository of The University of Melbourne Author/s: Moslemi, Azin Title: The pathology of pyrethrum yield-decline in Australia Date: 2017 Persistent Link: http://hdl.handle.net/11343/197712 File Description: The pathology of pyrethrum yield-decline in Australia Terms and Conditions: Terms and Conditions: Copyright in works deposited in Minerva Access is retained by the copyright owner. The work may not be altered without permission from the copyright owner. Readers may only download, print and save electronic copies of whole works for their own personal non-commercial use. Any use that exceeds these limits requires permission from the copyright owner. Attribution is essential when quoting or paraphrasing from these works.