The pathology of pyrethrum yield-decline in
Australia
Azin Moslemi
ORCID identifier 0000-0002-9637-5397
Submitted in total fulfilment of the requirements of the degree of
Doctor of Philosophy
Faculty of Veterinary and Agricultural Sciences
The University of Melbourne
September 2017
Declaration
I declare that this thesis comprises only my original work towards the degree of Doctor
of Philosophy. Due acknowledgement has been made in the text to all other material
used. This thesis does not exceed 100,000 words, and complies with the stipulations set
out for the degree of Doctor of Philosophy by the University of Melbourne.
Azin Moslemi
September 2017
I
Acknowledgements
I would like to express my gratitude appreciation to my supervisor Professor Paul
Taylor for his unconditional support during my Ph.D., his immense knowledge
in Plant Pathology and patience. I appreciate the effort you made and the time
you spared reading and editing my manuscripts. It would not be possible to
complete a Ph.D. without your support.
I sincerely thank my supervisor Dr. Peter Ades whose advice particularly on statistical
analysis of my research helped me understand the significance of the research. I would
not be able to publish scientific papers without your guidance.
Thanks also to Dr. Marc Nicolas, my supervisor for his positive impact on the research
more specifically in glasshouse bioassays.
Warmest regards to Professor Pedro Crous for his invaluable contribution in taxonomy
and phylogenetic studies of my research and influential assistance in my publications.
Besides my supervisors, I would like to thank my committee members Dr. Derek
Russell and Dr. Phil Salisbury for their insightful comments and encouragements.
I thank the Laboratory Managers Michelle Rhee and Carolyn Selway and, the
Laboratory Technical Officer Martin Ji for their continuous support and assistance
throughout my Ph.D. A massive thank you to my fellow lab mates Dr. Eden Tongson,
Dr. Jiang Chang, Dr. Veradina Dharjono, Dr. Baki Bhuiyan and Dilani De Silva for
their support, help and friendship, and for all the hard work and fun we have had for
four years. Thanks to Dr. Niloofar Vaghefi for being a great guide and a good friend
throughout my Ph.D.
My sincere thanks go to Mr. Tim Groom from the Botanical Resources Australia Pty.
Ltd. for his motivation and valuable comments which helped me improve the quality of
my Ph.D. research. Thanks to Dr. Jason Scott for his contribution to my publication and
his insightful comments on some aspects of my Ph.D. project.
II
I also thank Dr. Lorenzo Lombard for his influential advice on PCR amplification of
Fusarium and Paraphoma.
I gratefully thank the financial support provided by the Botanical Resources Australia
Pty. Ltd., Melbourne International Research Scholarship (MIRS) and Melbourne
International Fee Remission Scholarship (MIFRS) awarded by the University of
Melbourne.
Last but not the least I appreciate my family’s continuous support. My kind, supportive
and patient parents Mina and Mehdi, and my gorgeous brothers and friends Arash and
Ashkan who spiritually supported me during my Ph.D. and my life in general.
III
Abstract
The association of biotic and abiotic stresses with pyrethrum yield-decline has been
reported for more than a decade. Although, many pathogens have been isolated from
different tissues of yield-decline affected plants, very few of these pathogens have been
shown to cause serious diseases of pyrethrum. A few studies have actually shown a
relationship between specific pathogens and abiotic stress factors that may be involved
in yield-decline of pyrethrum. As well, the effect of biotic stresses on the plant may
mask the symptoms of the pathogens that are infecting plants and causing diseases.
In this thesis, several new fungal pathogens of pyrethrum were isolated from yielddecline affected plants in fields in northern Tasmania and Ballarat in Victoria, Australia.
These were identified as causing diseases of pyrethrum. Symptoms of yield-decline
were redefined as discoloured crown tissues, suppressed growth of the affected plants,
weak root system and necrotic leaf lesions.
Three new species of Paraphoma were identified based on morphological characters,
multigene phylogenetic analyses and pathogenicity trials in the glasshouse. Paraphoma
vinacea was described as a new species and shown to cause crown rot of pyrethrum.
Pathogenicity trials resulted in significant below-ground and total biomass growth
reduction, and the production of red-brown crown discolouration which is a typical
symptom of field plants affected by yield-decline.
Two new Paraphoma species isolated from necrotic leaf lesions from plants growing in
the fields in northern Tasmania were taxonomically described as P. chlamydocopiosa
and P. pye. Pathogenicity trials showed that both new species infected leaves, upper
roots and crown tissues, and caused significant reduction of above-ground, belowground and total biomass of pyrethrum plants.
Fusarium species were isolated from roots, crowns and basal petioles of infected
pyrethrum plants in yield-decline affected fields of northern Tasmania. Multigene
phylogenetic analyses identified F. oxysporum and F. avenaceum which were the most
frequently isolated species associated with crown discolouration of the yield-decline
affected pyrethrum plants. The pathogenicity of these two Fusarium species was
IV
confirmed in glasshouse bioassays with significant below-ground and total biomass
reduction 2 months after inoculation. Although both species infected roots and crown
tissues causing crown rot, F. oxysporum was more pathogenic than F. avenaceum.
Additionally, sample collections from a wide range of geographical locations in
Tasmania and Ballarat showed a high association of F. oxysporum and F. avenaceum
with yield-decline of pyrethrum.
Alternaria infectoria and Stemphylium herbarum were also identified as new leaf
pathogens of pyrethrum plants causing necrotic leaf lesions. These were initially
identified from pseudothecia that formed at the base of dead flower stems. Both were
able to reproduce the same symptoms in in vivo and in vitro tests, therefore were
identified as pathogens of pyrethrum. These foliar pathogens may also be part of the
complex of pathogens that cause yield-decline of pyrethrum.
Waterlogging is an important environmental stress and a 4-day waterlogging treatment
had a significant effect on growth of plants inoculated with F. oxysporum, F.
avenaceum and P. vinacea. The incidence of infection of crown, basal petioles and roots
was similar in both waterlogged and non-waterlogged treatments. The interaction
between waterlogging and each pathogen treatment resulted in significant below-ground
dry weight reductions 2 months after waterlogging for all three pathogens. The growth
reduction caused by F. oxysporum and P. vinacea was more severe than by F.
avenaceum. However, 6 months after the waterlogging treatment there was no
significant effect by pathogens nor an interaction between pathogens and waterlogging
on flower production, although waterlogging alone significantly reduced flower
production.
Improved identification of the pathogens of pyrethrum in northern Tasmania and ability
to identify these pathogens by symptoms will be extremely important in monitoring
disease incidence in the field specifically as the prominence of each pathogen may
fluctuate over time with changes in environmental conditions. Therefore, accurate
identification of the newly emerged pathogens and their interaction with abiotic stresses
will help in the implementation of integrated disease management practices to reduce
the effect of yield-decline in pyrethrum production.
V
Table of Contents
Declaration………………………………………………………………………………I
Acknowledgements………………………………………………..…………………...II
Abstract……………………………………………………………..………………....IV
Table of Contents…...…………………………………………….…………….…….VI
List of tables………...……………………………………………….……...…….…VIX
List of figures..…………………………………………...……….………..…….….XIII
List of abbreviations...……………………………………………….…..…..…..…XVI
Preface………..……………….……………………………………….…….……....XIX
Chapter 1 – Introduction………………………………………...…………………….1
Chapter 2 – Review of the literature………………………………………….……….4
2.1. Pyrethrum…………………………..............……………………………………….4
2.1.1. Pyrethrum history…………………………………………………………4
2.1.2. Biology and cropping……………………………………………………..5
2.1.3. Morphology………………………………………………………...……..6
2.1.4. Pyrethrins………………………………………………………………….7
2.1.5. Pyrethrin production in Australia…………………...…………………….8
2.1.6. Limitations to pyrethrum production………………………….…………..8
2.2. Impact of pathogens (biotic stresses)…………………………………………..……9
2.3. Aetiology and taxonomy of Fusarium and Paraphoma diseases……..………...…15
2.3.1. Fusarium…………………………………...…………………………….15
2.3.1.1. Morphology………………………………………………...….17
2.3.1.2. Biogeography and dispersal………………………..…………..20
2.3.1.3. Taxonomy…………………………………….………………..21
2.3.1.4. Phylogeny and molecular identification………………….……22
2.3.2. Paraphoma………………...………………………...…………………..24
2.3.2.1. Morphology……………………………………………………25
2.3.2.2. Hosts………………………………………………………..….28
2.3.2.3. Taxonomy……………………………………………..……….28
2.3.2.4. Phylogeny…………………………………………..………….29
2.4. Impact of environmental factors (abiotic stresses)……………….………………..30
2.5. Pyrethrum yield-decline……………………………………………….…………..33
2.5.1. Symptoms……………………………………….……………………….34
2.5.2. A review of yield-decline of other important crops……………………..34
VI
2.6. Objectives………………………………………………………………………….35
Chapter 3 – General materials and methods…………………………….………….37
3.1. Media preparation……………………………………………...…………………..37
3.2. Single sporing……………………………..……………………………………….39
3.3. Preservation………………………………………………………………….…….39
3.3.1. Short term preservation…………………..………………………...……39
3.3.2. Long term preservation………..…………………………………………40
3.4. DNA extraction and PCR amplification……………………………………….…..40
3.5. Microtome sectioning……………………...………………………………………41
Chapter 4 – Isolation and identification of fungal pathogens from pyrethrum in
yield-decline affected fields of northern Tasmania…………………………………43
4.1. Introduction………………………………………………………………………..43
4.2. Materials and methods………………………….………………………………….44
4.2.1. Sample collection………………………………………………………..44
4.2.2. Isolation of fungal pathogens………………………………………..…..47
4.2.3. Identification of fungal pathogens…………………...…………………..47
4.2.3.1. Morphological description……………………………………..47
4.2.3.2. Molecular taxonomy…………………………….……………..48
4.2.4. Glasshouse experiment 1………………………………………...………49
4.2.4.1. Assessment of glasshouse experiment 1…………………….....51
4.2.5. Glasshouse experiment 2………………………………………..……….51
4.3. Results……………………………………………………………….…………….52
4.4. Discussion………………………………………………...………………………..68
4.5. Conclusion…………………………………………………………………………71
Chapter 5 – Alternaria infectoria and Stemphylium herbarum, two new pathogens
of pyrethrum (Tanacetum cinerariifolium) in Australia………………………..…..72
5.1. Introduction and aims…………………………………………………………..….72
5.2. Published manuscript………………………………………………………………73
5.3. Corrections to the manuscript…………..……………………………………….....83
Chapter 6 – Paraphoma crown rot of pyrethrum (Tanacetum cinerariifolium)…..84
6.1. Introduction and aims……………………………..……………………………….84
6.2. Published manuscript……………………………………………...……………….85
Chapter 7 – Paraphoma chlamydocopiosa sp. nov. and Paraphoma pye sp. nov., two
new species associated with leaf and crown infection of pyrethrum……..………..92
VII
7.1. Introduction and aims………………………………………………..…………….92
7.2. Published manuscript…………………………………………..…………………..93
Chapter 8 – Fusarium oxysporum and Fusarium avenaceum associated with yielddecline of pyrethrum in Australia…………………….…………………………….105
8.1. Introduction and aims……………….……………………………………………105
8.2. Published manuscript……………………………………………………………..106
8.3. Further sample collections in 2013……………………………………………….120
8.4. The mode of infection and colonization of F. oxysporum in pyrethrum…………123
Chapter 9 – Influence of waterlogging on growth of pyrethrum plants infected
with crown and root rot pathogens- Fusarium oxysporum, Fusarium avenaceum
and Paraphoma vinacea……………………………………..……………………….128
9.1. Introduction……………………………………………………………..………..128
9.2. Materials and methods…………………………………………………..………..129
9.2.1. Waterlogging treatment………….……………………………………..130
9.2.2. Two months after inoculation: incidence of infection and effect of F.
oxysporum, F. avenaceum and P. vinacea on growth of inoculated pyrethrum
plants…………………………………………………………………………..132
9.2.3. Two months after waterlogging: effect of waterlogging alone and in
combination with infection by each of the pathogens on disease incidence,
growth and photosynthesis of pyrethrum plants………...…………………….132
9.2.4. Six months after waterlogging: effect of waterlogging alone and in
combination with infection by each of the pathogens on disease incidence,
growth of pyrethrum plants and on flowering……...…………………………133
9.3. Results……………………………………………………………………………134
9.3.1. Disease incidence…………………………………...………………….134
9.3.2. Stress severity classes of waterlogged plants…………………………..137
9.3.3. Dry weight analyses…………………………………………………….139
9.3.4. Photosynthesis at 2 months after waterlogging………………….……..143
9.4. Discussion………………………………………………….……………………..144
9.5. Conclusion…………………………………………………………………….….146
Chapter 10 – General discussion…………………………………..………………..147
10.1. Fusarium formae specialis identification……………………………………….152
10.2. Interaction of waterlogging with pathogens on growth of pyrethrum….……….153
10.3. Management…………………………………………………………………….154
List of references……………………………………………………………………..157
VIII
List of tables
Chapter 4
Table 1. Information of pyrethrum plants collected from nine yield-decline
affected sites of northern Tasmania
Table 2. Species and isolates used for inoculation of plants in glasshouse for
both inoculation methods
Table 3. Isolates from leaf, petiole, crown and root of pyrethrum plants of
northern Tasmania identified based on morphological and ITS gene sequencing
Table 4. Fusarium isolates from different pyrethrum plant tissues in yield
decline affected fields of northern Tasmania
Table 5. List of isolates with related strain numbers for ITS gene sequencing
Table 6. Isolates identified on different plant tissues after three different
inoculation methods
Table 7. A comparison of the dry weight of pyrethrum plants inoculated with 4
different
isolates
of
Fusarium
oxysporum,
Fusarium
avenaceum,
Fusarium equiseti, Plectospherella cucumerina
Chapter 5
Published manuscript
Table 1. Morphological features of Alternaria infectoria and Stemphylium
herbarum
Table 2. List of isolates used for multigene phylogenetic analyses
VIX
Chapter 6
Published manuscript
Table 1. Isolates used in multigene phylogenetic analyses of Paraphoma
vinacea
Table 2. Dry weight analyses of pants root-dip inoculated with P. vinacea using
least significant difference of the means (LSD)
Chapter 7
Published manuscript
Table 1. Information of the location in Tasmania (Australia), field code,
collectors and dates in which new Paraphoma isolates from pyrethrum
(Tanacetum cinerariifolium) used in this study were recovered
Table 2. List of isolates used for multigene phylogenetic analyses of
Paraphoma chlamydocopiosa and Paraphoma pye
Table 3. Disease incidence caused by P. chlamydocopiosa, P. pye and P.
vinacea for 10 plants in two separate glasshouse experiments
Table 4. Effect of P. chlamydocopiosa, P. pye and P. vinacea on growth of the
root-dip inoculated pyrethrum plants in a combined analysis
Chapter 8
Published manuscript
Table 1. Information of nine yield-decline affected fields in which Fusarium
spp. were isolated from different tissues of the diseased plants in June 2014 from
Tasmania
Table 2. Information of three yield-decline affected fields in northern Tasmania
in January 2015 and the infected tissues
X
Table 3. Information of two separate sample collections (three fields each time)
from the yield-decline affected fields in Ballarat, Victoria in September 2015
and February 2016
Table 4. List of isolates used for multigene phylogenetic analyses of Fusarium
spp.
Table 5. Morphological features of F. oxysporum and F. avenaceum
Table 6. The effect of F. oxysporum and F. avenaceum on below-ground,
above-ground and total biomass of the root-dip inoculated plants using
combined analysis
Table 7. Isolation of pathogens from crown, root, petiole and leaf tissues from a
sample collection in September 2016 from pyrethrum yield-decline affected
fields of Burnie, northern Tasmania
Chapter 9
Table 1. Post-waterlogging stress severity class of plants inoculated with
Fusarium oxsyporum, Fusarium avenaceum, and Paraphoma vinacea, 7 days
after waterlogging
Table 2. Number of infected plants two months after inoculation (2 mai) with
Fusarium oxysporum, Fusarium avencaeum and Paraphoma vinacea per 10
replicates
Table 3. Disease incidence two months after inoculation (2 mai), 2 months after
waterlogging (2 maw) and 6 months after waterlogging (6 maw) for plants
inoculated with Fusarium oxysporum, Fusarium avenaceum and Paraphoma
vinacea
Table 4. The relative stress severity scores of plants inoculated with Fusarium
oxysporum, Fusarium avenaceum, and Paraphoma vinacea, 7 days after
waterlogging
XI
Table 5. Effect of water logging on the number of pyrethrum flowers, flower
stems, basal petioles and leaves (green and yellow), 6 months after waterlogging
Table 6. The effect of waterlogging on dry weights of pyrethrum plants infected
with Fusarium oxysporum, Fusarium avencaeum and Paraphoma vinacea,
before waterlogging (0 bw), 2 months after waterlogging (2 maw) and 6 months
after waterlogging (6 maw)
Table 7. The effect of waterlogging on photosynthesis of the plants inoculated
with Fusarium oxysporum, Fusarium avenaceum and Paraphoma vinacea, 2
months after waterlogging
Chapter 10
Table 1. Fungal pathogens associated with yield-decline affected pyrethrum
plants
XII
List of figures
Chapter 2
Fig.1. Pale Refined Pyrethrin, a yellow substance with oily consistency and
weak flower odour
Fig.2. Identification of Fusarium species based on spore shape. A-D
Macroconidia
Fig.3. Fusarium venenatum colony morphology and microscopic features
Fig.4. Microscopic characters of Paraphoma radicina
Fig.5. The effect of environmental stresses, hump and hollows and frost on
growth of pyrethrum in yield-decline affected fields of northern Tasmania
Fig.6. A comparison between a terminated pyrethrum site after the second
harvesting season and an acceptable regrowth of pyrethrum after first harvest
Chapter 4
Fig.1. Symptoms associated with yield-decline of pyrethrum in the fields of
northern Tasmania
Fig.2. Various colony morphologies of isolates recovered from pyrethrum in
yield-decline affected sites
Fig.3. Maximum parsimony phylogenetic tree constructed for four Fusarium
species complexes using sequences of ITS region
Fig.4. Maximum Likelihood phylogenetic tree of ITS for Plectosphaerella spp.
Fig.5. Maximum Likelihood phylogenetic tree of ITS for Bionectria spp.
Fig.6. Maximum Likelihood phylogenetic tree of ITS for Rhizoctonia spp.
XIII
Chapter 5
Published manuscript
Fig.1. Pseudothecia at the base of the dead pyrethrum flower stem
Fig.2. Alternaria infectoria morphological features
Fig.3. Stemphylium herbarum morphological features
Fig.4. Combined maximum likelihood phylogenetic tree of ITS-EF1-RPB2GAPDH generated for species of A. infectoria and S. herbarum
Fig.5. Combined maximum likelihood phylogenetic tree of ITS-EF1-GAPDH
generated for specifically species of S. herbarum
Fig.6a and 6b. Symptoms caused by A. infectoria and S. herbarum on the
plants in vivo and in vitro
Chapter 6
Published manuscript
Fig.1. Morphological features of Paraphoma vinacea
Fig.2. Maximum likelihood phylogenetic tree of ITS-LSU generated for the
species of Paraphoma vinacea
Fig.3. Maximum likelihood phylogenetic tree of ITS-EF1-TUB generated for the
species of Paraphoma to differentiate P. vinacea from the type and ex-neotype
species
Chapter 7
Published manuscript
Fig.1. Maximum likelihood combined phylogenetic tree of ITS-EF1-TUB
generated for the two new species of Paraphoma, P. chlamydocopiosa and P.
pye
XIV
Fig.2. Morphological features of P. chamydocopiosa
Fig.3. Morphological features of P. pye
Fig.4. Symptoms caused by P. chlamydocopiosa in vivo and in vitro
Fig.5. Symptoms caused by P. pye in vivo and in vitro
Chapter 8
Published manuscript
Fig.1. Maximum parsimony phylogenetic tree of combined ITS-EF1-RPB2
generated for the species of Fusarium in four different species complexes
Fig.2. Symptoms of yield-decline in pyrethrum plant in northern Tasmania,
September 2016
Fig.3. Transverse and longitudinal microtome sections obtained from root and
crown tissues infected with F. oxysporum two months after inoculation using
quadruple staining method
Chapter 9
Fig.1. O₂ concentration (mg/L) measured for 20 plants per treatment from day 0
to 3
Fig.2. Symptoms cause by waterlogging, 7 days after waterlogging
Fig.3. Interaction plots showing significant interaction between waterlogging
and each pathogen treatment, before waterlogging (0 bw), 2 months after
waterlogging (2 maw) and 6 months after waterlogging (6 maw) in the
waterlogged and non-waterlogged plots
XV
List of abbreviations
Acl1
ATP citrate lase
ACT
Actin
AFLP
Amplified fragment length polymorphism
AGRF
Australian Genome Research Facility
AIC
Akaike information criterion
ai
Active ingredient
AMF
Arbascular michorhizal fungi
BIC
Bayesian information criterion
BOC
British Oxygen Company
BRA
Botanical Resources Australia Pty. Ltd.
BRIP
Queensland Plant Pathology herbarium
CAL
Calmadulin
CBS
Centraalbureau voor Schimmelcultures fungal collection
CHA
Cherry decoction agar
CI
Consistency index
CLA
Carnation leaf agar
CSIRO
Commonwealth Scientific Industrial Research Organisation
diam
Diameter
df
Degree of freedom
FAA
Formaldehyde acetic acid
EF1
Translation elongation factor 1-α
ELISA
Enzyme linked immunosorbent assay
EPAA
Ethanol potassium amoxicillin agar
FIEFC
Fusarium incarnatum-equiseti species complex
FOSC
Fusarium oxysporum species complex
FRC
Fusarium research centre
FTSC
Fusarium triticinum species complex
FSAMSC
Fusarium sambucinum species complex
GAPDH
Glyceraldehyde-3-phosphate dehydrogenase
XVI
GIS
Commonwealth Industrial Gases Ltd
ITS
Internal transcribed spacer of nrDNA
LSD
Least significant difference
LSU
Large subunit of nrDNA
maw
Month after waterlogging
mai
Months after inoculation
MEA
Malt extract agar
ML
Maximum likelihood
MLST
Multi locus sequence typing
NCBI
National Centre of Biotechnology Information
NJ
Neighbour-joining
NRRL
Agricultural Research Service Culture Collection
OA
Oatmeal agar
nrDNA
Nuclear ribosomal DNA
PCR
Polymerase chain reaction
PDA
Potato dextrose agar
RAPD
Random amplified polymorphic DNA
REML
Residual maximum likelihood
RFLP
Restriction fragment length polymorphism
RI
Retention index
RO
Reverse osmosis
RPB2
Second largest subunit
SD
Standard deviation
SNA
Synthetic nutrient-poor agar
SPR
Subtree pruning regrafting
SSR
Single sequence repeat
SSU
Small subunit 18S nrDNA
TAS
Tasmanian Institute of Agriculture Fungal Collection
TBA
Tertiary butyl alcohol
TFC
Terminal Fusarium clade
XVII
TUB2
Beta tubulin 2
UOM
University of Melbourne fungal collection
UT
University of Tasmania
UTAS
University of Tasmania
VCG
Vegetative compatibility group
WA
Water agar
XVIII
Preface
Publications from this thesis
International peer-reviewed papers:
Moslemi A, Ades PK, Groom T, Nicolas ME, Scott JB, Crous WP and Taylor PWJ
(2017). Paraphoma chlamydocopiosa sp. nov. and Paraphoma pye sp. nov., two new
species associated with leaf and crown infection of pyrethrum. Plant Pathology Doi:
10.1111/ppa.12719.
Moslemi A, Ades PK, Groom T, Nicolas ME and Taylor PWJ (2017). Fusarium
oxysporum and Fusarium avenaceum associated with yield-decline of pyrethrum
in Australia. European Journal of Plant Pathology 149 (1), 43-56.
Moslemi A, Ades PK, Groom T, Nicolas ME and Taylor PWJ (2017). Alternaria
infectoria
and
Stemphylium
herbarum,
two
new
pathogens
of
pyrethrum
(Tanacetum cinerariifolium) in Australia. Australasian Plant Pathology 46(1):91-101.
Moslemi A, Ades PK, Groom T, Crous PW, Nicolas ME and Taylor PWJ (2016).
Paraphoma crown rot of pyrethrum (Tanacetum cinerariifolium). Plant Disease
100(12):2363-69.
XIX
Conference proceedings:
Moslemi A, Ades PK, Nicolas ME, Taylor PWJ. 22nd November 2016. Pyrethrum
Pathology Forum, University of Melbourne, Faculty of Veterinary and Agricultural
Sciences (FVAS). Oral presentation.
Fusarium Laboratory Workshop; 29th May- 3rd June 2016. Forestry and Agriculture
Biotechnology Institute (FABI), University of Pretoria, South Africa.
Moslemi A, Ades PK, Nicolas ME, Taylor PWJ. 20th January 2016. Pyrethrum yield
decline in Tasmania. Horticulture showcase. The University of Melbourne, Faculty of
Veterinary and Agricultural Sciences (FVAS). Oral presentation.
Moslemi A, Ades PK, Groom T, Nicolas ME, Taylor PWJ. 3-4 th December 2015. The
role of fungal pathogens in pyrethrum yield decline. Postgraduate symposium, The
University of Melbourne, Faculty of Vet and Agricultural Sciences (FVAS). Oral
presentation.
Moslemi A, Groom T, Ades PK, Nicolas ME and Taylor PWJ. 14-16th September 2015.
Identification of pathogens associated with pyrethrum yield decline in northern
Tasmania. Australian Plant Pathology Society (APPS) conference, Perth. Poster
presentation.
Moslemi A, Ades PK, Nicolas ME and Taylor PWJ. 10-13th November 2014. Slow
Plant Loss After Single Harvest (SPLASH) syndrome on pyrethrum plants of northern
Tasmania. 8th Australian Soil-borne Diseases Symposium (ASDS), Tasmania. Oral
presentation.
Moslemi A, Ades PK, Nicolas ME and Taylor PWJ. 5th November 2014. Slow Plant
Loss After Single Harvest (SPLASH) syndrome on pyrethrum plants of northern
Tasmania. Workshop on taxonomy and pathogenicity of fungal plant pathogens –the
University of Melbourne. Oral presentation.
XX
Chapter 1: Introduction
Chapter 1
Introduction
Pyrethrum (Tanacetum cinerariifolium) Sch. Bip. is a perennial and herbaceous plant in
the Asteraceae, which has been widely used for production of natural pyrethrin
insecticides (Casida and Quistad 1995). More than 70% of the world pyrethrum
production (3000 ha) occurs in northern Tasmania and the Ballarat region of Victoria,
Australia (Hay et al. 2015) where the cool and humid environmental conditions induce
flowers to produce pyrethrins (Glover 1955). These environmental conditions are also
conducive to infection by fungal pathogens which are a threat to the sustainability of the
pyrethrum industry (Pethybridge et al. 2004).
This thesis is focused on yield-decline of pyrethrum in the fields of northern Tasmania
and Ballarat which has become an important limitation to production over the last 10
years. The cause of yield-decline is unknown however, Pethybridge et al. (2010),
reported that the problem was most likely due to a combined effect of physiological,
environmental and biological factors that affected the growth of pyrethrum plants in
specific fields. In the past, disease surveys mostly concentrated on foliar diseases of
pyrethrum and not on soil-borne diseases associated with pyrethrum growth. Although,
Hay et al. (2012) isolated several soil-borne pathogens such as Verticillium dahliae,
Rhizoctonia solani, Phytohpthora spp., Fusarium solani, Pratylenchus spp. and
Meloidogyne spp. nematodes from plants during field surveys, the pathogenicity of
these fungal and nematode species was not determined. Therefore, in this thesis,
prevalent soil-borne fungal pathogens associated with pyrethrum yield-decline were
isolated, identified and their pathogenicity assessed.
The second chapter is a review of the literature with a general introduction about the
pyrethrum plant and its industrial importance, abiotic and biotic limitations to
pyrethrum production which threaten pyrethrum health, particularly fungal pathogens
and environmental stress, and a review of the aetiology and taxonomy of Paraphoma
and Fusarium, two important soil-borne pathogens. The chapter concludes with an
overview of the current understanding of pyrethrum yield-decline.
1
Chapter 1: Introduction
The third chapter describes the common methods used in the research such as media
preparation, short and long-term isolate preservation techniques, establishment of fungal
cultures for single sporing, histopathology and molecular methods for fungal
identification such as DNA extraction and PCR amplifications.
Chapter 4 lists details of fungal isolates cultured from nine yield-decline affected fields
in northern Tasmania. Identification of frequently isolated fungal species was made
using morphological characters and DNA analysis based on internal transcribed spacer
(ITS) region. Plant material especially crown and root tissue growing in the soil is often
colonised by many different fungal species which makes it difficult to distinguish
pathogens from endophytes, saprophytes and opportunistic fungi. Thus, all frequently
isolated fungal species were tested for pathogenicity in glasshouse trials.
Chapter 5 taxonomically describes the identification of two new pathogens Alternaria
infectoria and Stemphylium herbarum identified from pseudothecia that were recovered
from the base of dead pyrethrum flower stems of plants affected by yield-decline. The
pathogenicity of these was also demonstrated in glasshouse trials.
Chapter 6 taxonomically describes Paraphoma vinacea inoculated from discoloured
crown tissue of affected plants while Chapter 7 describes two further new species of
pathogenic Paraphoma, P. chlamydocopiosa and P. pye, isolated from necrotic
pyrethrum leaf lesions. The pathogenicity of these was also shown in glasshouse
bioassays. The role of the Paraphoma complex in pyrethrum pathology is discussed.
Chapter 8 focuses on the Fusarium spp. isolated from infected crown and roots of
pyrethrum plants and describes F. oxysporum and F. avenaceum as important soil-borne
pathogens of pyrethrum. Pathogenicity of F. oxysporum, F. avenaceum, F. equiseti and
F. venenatum is assessed, using multiple pathogenicity tests and species identified by
molecular identification using multigene phylogenetic studies.
Very little is known about the interaction between fungal pathogens of pyrethrum and
abiotic stresses and the effect that these have on growth and yield. Groom (2014)
reported that waterlogging was an important environmental stress in pyrethrum fields of
northern Tasmania. Javid et al. (2013) showed that waterlogging of pyrethrum had
significant effect on root and shoot dry weights and the number of flower stems of ray
2
Chapter 1: Introduction
blight infected pyrethrum plants. Chapter 9 identifies the importance of waterlogging
alone and in combination with F. oxysporum, F. avenaceum and P. vinacea on the
growth of pyrethrum plants in glasshouse trials. The thesis research chapters are then
discussed in relationship to the overall aims of the project in a final discussion.
3
Chapter 2: Litereture review
Chapter 2
Review of the Literature
2.1. Pyrethrum
Pyrethrum, (Tanacetum cinerariifolium (Trevir.) Sch. Bip. = Tanacetum cinerariifolium
Sch. Bip. (IPNI 2016), syn. Pyrethrum cinerariifolium Trev. ≡ Chrysanthemum
cinerariifolium (Trev.) Vis.) (Greenhill 2007), is an herbaceous perennial plant in the
Asteraceae (ex Compositae), which have been widely used for production of natural
pyrethrins derived from the achenes of the mature pyrethrum flowers (Casida and
Quistad 1995; Grdisa et al. 2009). The word ‘pyrethrum’ has been solely attributed to
Tanacetum cinerariifolium or Dalmatian pyrethrum as it is the only species which is
commercially used for insecticidal purposes, although, other members of the genus such
as T. coccineum (Persian pyrethrum), T. carneum (= C. carneum) and T. roseum (= C.
roseum) also contain pyrethrins (Greenhill 2007;
West 1959). Hence, the word
pyrethrum used in this thesis particularly refers to T. cinerariifolium (Dalmatian
pyrethrum).
2.1.1. Pyrethrum history
Pyrethrum insect powders, were widely used by soldiers in armies against hair and body
lice between mid-18th to early 19th centuries (BRA 2014; West 1959). For many years,
Dalmatia (previously a section of Yugoslavia), was the biggest producer of T.
cinerariifoilum and this continued until World War I, when Japan took over the
production of pyrethrum in 1918 (Greenhill 2007). Japan remained the main source of
pyrethrum production until 1940 after which Kenya became the dominant world
supplier of T. cinerariifolium (Greenhill 2007; Hitmi et al. 2000; West 1959). Other
East African countries such as Rwanda, Tanzania and Uganda also had significant roles
in pyrethrum production in Africa and produced considerable amounts of pyrethrum
over time (Greenhill 2007). Gnadinger (1936), reported other countries including
European countries (Albania, Bulgaria, Cyprus, France, Greece, Italy, Spain,
Switzerland, Sweden, Turkey and Russia), Asian and Western Asia (Iran, China,
Philippines and India) and South America (Bolivia, Brazil, Chile, Equator, Mexico and
Peru) as other pyrethrum producers and retailers around the world however, production
was not sustainable in these countries due to unfavourable environmental conditions.
4
Chapter 2: Litereture review
Pyrethrum production in Africa also declined in part due to time-consuming and
laborious action of hand-picking of the flower heads (up to 14 pickings per annum as
pyrethrum cultivars in Africa flower asynchronously) and lack of environmental
conditions such as long day lights and cool temperatures required for pyrethrum growth
in some pyrethrum production regions (Cotching 2012; Glover 1955). Moreover, with
the introduction of synthetic pyrethroids, pyrethrum production decreased in East Africa
(Greenhill 2007). However, Africa is still one of the major countries of pyrethrum
production. Today, Australia, East Africa and China are important pyrethrum suppliers
worldwide with Australia as the major supplier globally (Greenhill 2007; Pethybridge
et al. 2008d)
2.1.2. Biology and cropping
In Australia, fields are planted with pyrethrum seed from July to September. First
harvest occurs in December and January of the following year (15 to 17 months after
planting). Thereafter, harvests are implemented annually at the same time. The plant is
semi dormant from the emergence of the first spring until the following spring.
This means that a pyrethrum plant is not ready for harvest for almost two subsequent
years (Greenhill 2007). Every spring thereafter, plants produce multiple stems in
response to increasing day length, reaching the maximum height of approximately
1-1.5 m within 12 weeks (Pethybridge et al. 2008d). Effective management of
weeds with herbicides, top dressing with fertilizers, intensive overhead irrigation
during flowering and disease management
with
fungicides
are
factors
that
affect agronomic performance of pyrethrum plants (Pethybridge et al. 2008d). Weed
management is carried out in spring, from September to November (Greenhill 2007).
Plants are harvested mechanically by swathing the crop (flowers and stems) into
windrows (~ 7 days) for drying followed by mechanically harvesting the flower
heads and achenes using specialized equipment. After all these steps, flowers are
transferred to the processing factory in Burnie in Tasmania for pelletizing and
pyrethrin extraction (Pethybridge et al. 2008d). A pyrethrum plant can be
harvested three to four harvesting seasons (Hay et al. 2015; Pethybridge et al.
2008d) and after the fourth harvest the crop is terminated. The fields are then placed
into rotation with vegetable crops such as potatoes, onions, carrots, brassicas or
poppies (Greenhill 2007).
5
Chapter 2: Litereture review
In Kenya however, pyrethrum is grown in the fields either by planting the seedlings and
plantlets which are segregated from the mother plants by seed sown in autumn
(Greenhill 2007; Pethybridge et al. 2008d). Plants that emerge from seed can flower
one year after seeding, while those grown from the seedlings produce flowers in a threemonth period (Pethybridge et al. 2008d).
To extract pyrethrin, flower heads are soaked in hexane to obtain the concentrated dark
oil ‘oleoresin’. Oleoresin (a crude extract containing waxes, chlorophyll and oils from
flowers) is then refined with active carbon (used to decolour the oil) using carbon
dioxide refining technique to produce “Pale Refined Pyrethrins”, a yellow viscous
liquid which is exported (Kiriamiti et al. 2003; Tóth et al. 2012).
Fig.1. Pale Refined Pyrethrin, a yellow substance with oily consistency and weak
flower odour; A unfiltered; B filtered. Image was taken by T. Groom, BRA 2014
2.1.3. Morphology
A pyrethrum plant grows to a height of 1-1.5 m (Brown and Menary 1994). Single
flowers grow at the end of the branched flower stems and consist of two types of florets;
40 to 100 bisexual, yellow disk florets (small tubular flowers in the centre of the flower
head) in the centre surrounded by a ring of white ray florets (long strap-shaped flowers)
attached to convex receptacles (the enlarged tip of the flower head which bears the
6
Chapter 2: Litereture review
florets) by a tubular corolla (petals). Short stalk stamens are located inside the
enveloped corolla. White petals terminate with three teeth. The corolla is connected to
the ovary by calyx (sepals). The ovary is pentagonal and has a single ovule inside.
Leaves are narrow and alternate (the arrangement of the leaves are opposite on petioles)
possessing many grandular trichomes (small hairs on the surface of the plant produced
by epidermal cell divisions) on the surface. Cauline leaves (small leaves arising from
the upper part of the petioles and usually smaller than the foliage leaves) are produced
by young shoots (petioles). There are three to 10 achenes (small, one-seeded and
indehiscent dry fruit) between the floret and receptacle related to disk and ray florets.
Oil glands containing pyrethrins, are located on the surface of the achenes. Bracts (leaflike structures usually smaller than the foliage leaves) are in three rows and the
thickness of involucres (a ring of bracts at the base of an inflorescence) is generally
between 12 to 18 mm (Grdisa et al. 2009; Greenhill 2007; Pethybridge et al. 2008d).
2.1.4. Pyrethrins
Pyrethrum plants have active insecticidal materials, pyrethrins, and the name of the
plant applies to the flower head or flower extract (Ambrozic et al. 2007). The pyrethrins
are produced by esterification of two acids, chrysanthemic acid and pyrethric acid, with
ketone alcohols pyrethrolone, cinerolone and jasmoline (Hitmi
et al. 2000). The
glandular trichomes on the surface of the mature achenes are believed to be associated
with pyrethrin production as the key biosynthetic enzyme, chrysanthemyl diphosphate
synthase is only expressed in trichomes. However, no evidence exist on the production
of pyrethrins by trichomes (Ramirez et al. 2012). Pyrethrins contain six closely related
esters including pyrethrin I, cinerin I and jasmolin I collectively called “Pyrethrins I”;
and pyrethrin II, cinerin II and jasmolin II collectively called “Pyrethrins II” (Casida
1973; Suraweera et al. 2015a).
Pyrethrins also exist in other genera of the Asteraceae, such as Calendula sp.,
Chrysanthemum sp.
and Tagetes sp. (Ambrozic et al. 2007). The most important
advantages of pyrethrins compared to pyrethroids which are produced synthetically are
rapid degradation and low toxicity for humans and other mammals, effectiveness at low
dosages on a wide range of domestic and public health insects, repellent and the lack of
bioaccumulation in food chains and ground water (Ambrozic et al. 2007). Hitmi et al.
7
Chapter 2: Litereture review
(2000) reported that ‘Pyrethrins I’ had knock-down effect while, ‘Pyrethrins II’ had
better kill effect, however, content of the pyrethrins in pyrethrum plants depended on
climate, harvesting intervals, plants genotype, age and drying methods.
At least 94% of the pyrethrins are produced in the oil glands of flowers which contained
on average 1.8-2.5% pyrethrins and in lower percentages in leaves, stems and roots
(Morris et al. 2006; Pethybridge et al. 2008d).
2.1.5. Pyrethrum production in Australia
Pyrethrum production in Australia was first reported in 1895 by Baron von Mueller, the
director of Melbourne Botanical Gardens (Casida and Quistad 1995). He reported that
the first commercial growth of pyrethrum occurred in 1890 in the Lower Latrobe River,
Victoria, Australia. Later, in 1930-1, Commonwealth Scientific Industrial Research
Organisation (CSIRO) introduced four different strains of pyrethrum to Australia from
England, Switzerland, Japan and the United States, which were planted in Black
Mountain, Canberra. Pyrethrum was also planted in two other Australian States, New
South Wales between 1932-5 and Tasmania from 1941 to 1944 (MacDonald 1995).
However, major pyrethrum production in Australia only occurred in 1981. In 1981,
Commonwealth Industrial Gases Ltd (GIC) (a subsidiary of the British Oxygen
Company) (BOC), began to develop the pyrethrum industry in Tasmania into a
commercial proposition and continued the industrial development of pyrethrum for 15
years.
In 1996, Botanical Resources Australia Pty Ltd- Agricultural Services (BRA) was
formed by a staff of BOC. By 2011, 4000 hectares of northern Tasmanian fields were
in pyrethrum cultivation. In 2009, world demand for natural pyrethrins enabled
BRA to become the main producer of pyrethrum around the world. Pyrethrum
production was expanded into the Ballarat region of Victoria and in 2010, 575 hectares
of Ballarat fields were in pyrethrum cultivation (BRA 2014).
2.1.6. Limitations to pyrethrum production
Ideally, under the intensive production system of pyrethrum in Australia, pyrethrum
fields should persist for at least three harvests (Hay et al. 2015). However, yield-decline
occurs resulting in the premature termination of a significant proportion of the crop
8
Chapter 2: Litereture review
which has been often reported, to be as high as almost 30% of fields, annually
(Pethybridge et al. 2008d). Yield-decline is defined as an integration of factors resulting
in reduced probability of plant survival, leading to significant decreases in stand
density, and gradual reductions in vigour of the plants that do survive (Pethybridge et al.
2008d). Poor persistence of plants is likely to be attributed to an interaction of both
biotic and abiotic factors.
2.2. Impact of pathogens (biotic stresses)
Previous studies attempting to improve persistence of pyrethrum focused on soil fertility
(Salardini et al. 1994b; Salardini et al. 1994a) weed competition (Rawnsley et al.
2007b; Rawnsley et al. 2006b) and plant pathogens (Pethybridge et al., 2008b). The
most important plant disease affecting pyrethrum plants in Australia is ray blight caused
by Satagonosporopsis
tanaceti, which occurs in early spring and requires several
fungicide treatments to avoid severe yield losses (Vaghefi et al. 2012). Pyrethrum is
also susceptible to root rot caused by lesion nematodes Pratylenchus penetrans and P.
crenatus (Hay et al. 2009); winter blight caused by Alternaria tenuissima (Pethybridge
et al. 2004); Sclerotinia crown and flower blight caused by S. sclerotiorum (Scott et al.
2014); Botrytis flower blight caused by Botrytis cinerea (Pethybridge et al. 2008d); tan
spot caused by Didymella tanaceti (Pearce et al. 2015); petal blight caused by
Itersonilia perplexans (Hey et al. 2015), and pink spot caused by Stemphylium
botryosum (Pethybridge et al. 2003). Recently, pyrethrum plants have been shown to be
infected by a new pathogen, Colletotricum tanaceti, causing anthracnose disease of
pyrethrum (Barimani et al. 2013).
Fungal pathogens have been reported to cause large yield losses annually. They have
been managed by application of different types of fungicides. A brief description of the
most important pathogens of pyrethrum follows:
Ray blight disease of pyrethrum caused by S. tanaceti (Vaghefi et al. 2012) has
remained the most prevalent foliar disease of pyrethrum in Tasmania to date. The lifecycle of S. tanaceti has been recently shown to be quite complex (Bhuiyan et al., 2016).
Stagonosporopsis tanaceti may exist as an endophyte in infected seeds or have a short
hemibiotrophic life style after infection of leaves and flower stems before entering the
9
Chapter 2: Litereture review
necrotrophic phase and causing disease (Bhuiyan et al. 2016). The disease severity is
increased in cool and humid environmental conditions (Pethybridge et al. 2003).
The disease symptoms appear in spring as necrotic lesions on leaf margins. Lesions
expand to encompass the entire leaf that results in stunting and defoliation. In severe
outbreaks of ray blight chlorotic lesions were initially produced on flower stems
followed by the appearance of necrotic lesions on buds of pyrethrum plants (Bhuiyan et
al. 2016; Vaghefi et al. 2012).
The disease causes flower stems to bend at the end (Shepard’s crook) and flower and
bud death (Pethybridge and Wilson 1998). Severity of the disease is at the highest in
late spring through early spring (November to December) (Pethybridge et al.
2008a). If left unmanaged, the disease can lead to plant death. Once plants are
infected, pycnidia develop in necrotic lesions on leaves and flower
stems. Secondary infection of plants probably occurs through rain splash
and wind dispersal of spores to new leaves and flowers. As the plant
tissue dies, pseudosclerotia may be formed and these can supposedly survive in the
soil for many years.
However, the role of pseudosclerotia in the disease
cycle is unknown (Pethybridge et al. 2008d). The disease has been controlled
successfully with a combination of pyraclostrobin and boscalid fungicides for
disease management (Pethybridge et al. 2008a).
Tan spot disease of pyrethrum caused by D. tanaceti is a foliar pathogen
isolated from necrotic lesions of the leaves, flower stems and buds of pyrethrum. The
disease severity has increased over the past years. Pethybridge et al. (2008c) isolated D.
tanaceti from necrotic leaf spots of pyrethrum plants in low frequencies in 2003. The
isolation frequency of the pathogen increased in 2005 and 2006, where 65% of the
leaves with necrotic lesions were infected with D. tanaceti. In summer 2015, >73.2% of
the fields in northern Tasmania were infected with the pathogen (Hay et al. 2015). The
fungus has a saprophytic life style before becoming pathogenic. Ray blight disease
of pyrethrum caused by S. tanaceti, has a synergetic effect on the disease severity of
D. tanaceti (Pearce et al. 2015; Pethybridge et al. 2008c). The name of the pathogen
was changed from Microsphaeropsis tanaceti to D. tanaceti by Pearce et al. (2015)
based on morphological and molecular characterisation.
Anthracnose disease of pyrethrum caused by C. tanaceti, is a foliar disease
which causes initial infection on pyrethrum leaves by means of a brief biotrophic phase
10
Chapter 2: Litereture review
associated with intercellular hyphae and then infection switches to the destructive
necrotrophic phase associated with leaf necrosis (Barimani et al. 2013). However, in a
recent survey carried out by Hay et al. (2015), the isolation frequency of C. tanaceti
from necrotic leaf lesions of pyrethrum in the field, declined from 6.2% in winter to
1.1% in summer indicating that the disease occurred sporadically in pyrethrum fields of
northern Tasmania.
Sclerotinia crown rot and flower blight of pyrethrum caused by the two species
S. sclerotiorum and S. minor, effects plant growth and has been shown to cause early
termination of the crops in pyrethrum fields of Tasmania (Pethybridge et al. 2008d).
The pathogen has a necrotrophic life-style and produces sclerotia as resting structures in
the soil. Sclerotia can remain viable in the soil for more than eight years and then
germinate in favourable environmental conditions. Crown rot occurs after the
germination of sclerotia and penetration by infection hyphae into the crown resulting in
wilt and plant death; and flower blight occurs after sclerotia produce apothecia
and air-borne ascospores infect the flowers (Scott et al. 2014). Fungicide
management with procymidone has been successful for the disease control (Scott et al.
2014).
Alternaria blight of pyrethrum caused by A. tenuissima was first reported by
Srinath and Sarwar (1965) when the pathogen caused brown patches on the apical part
of the pyrethrum leaves. Pethybridge et al. (2004) identified two species of Alternaria
isolated from necrotic leaf lesions on pyrethrum, A. alternata and A. tenuissima, with A.
alternata causing marginal leaf necrosis and A. tenuissima causing leaf spots. However,
the major Alternaria sp. which affects pyrethrum production in Tasmania was
reported to be A. tenuissima, the causal agent of winter blight disease. The
pathogen has a necrotrophic life style and infects a large number of ornamental
plants such as chrysanthemum flowers (Pethybridge et al. 2008d). Necrotic
lesions caused by Alternaria spp. have been also reported to be associated with
diseases of pyrethrum in East Africa (Pethybridge et al. 2008d). Isolation frequency of
A. tenuissima in Tasmania decreased from 92% of the fields in winter to 40% in
summer between 2012 and 2013 (Hay et al. 2015).
Pink spot disease of pyrethrum caused by Stemphylium botryosum is commonly
found in pyrethrum fields of Tasmania (Pethybridge et al. 2008d). Symptoms caused by
S. botryosum are mostly confused with A. tenuissima, causing winter blight of
11
Chapter 2: Litereture review
pyrethrum. The impact of frost and continuous usage of herbicides also produce similar
symptoms to both pathogens. However, S. botryosum is identified based on the necrotic
lesions produced in the centre of the pink/brown margins (Pethybridge et al. 2008d).
Although, the disease severity in the field is not yield-limiting, the pathogen reduces
green leaf area and the ability of plants to produce flowers by reducing photosynthesis
(Pethybridge et al. 2004). Different species of Stemphylium have been reported as
pathogens of Asteraceae such as chrysanthemum and aster (Pethybridge et al. 2003).
Hay et al. (2015) also isolated S. botryosum at low frequencies from necrotic lesions on
pyrethrum.
Fusarium root rot caused by Fusarium spp. was reported to cause low
pyrethrin content in flowers (Casida and Quistad 1995). Fusarium species are
significant pathogens of pyrethrum plants in South Africa and Kenya where they were
reported to cause damping off of seedlings and wilt, necrosis and chlorosis of the
mature plants (Pethybridge et al. 2008d). Pethybridge et al. (2010a) and Hay et al.
(2002) isolated Fusarium species (F. oxysporum and F. solani) from pyrethrum plants
in yield-decline affected sites in northern Tasmania but never assessed the pathogenicity
of these species to pyrethrum. Fusarium oxysporum f. sp. chrysanthemi has also been
reported as a pathogen of chrysanthemum and other members of Asteraceae such as
Paris daisy (A. frutescens), African daisy (Osteospermum sp.), C. morifolium and
Gerbera (Gerbera jamesonii) causing wilt, stunted growth and abnormal growth of
flowers and buds (Singh and Kumar 2013, 2014).
Paraphoma leaf spot caused by P. chrysanthemicola has been isolated at low
frequency from necrotic lesions of pyrethrum plants in association with other foliar
pathogens (Hay et al. 2015).
Botrytis flower blight caused by B. cinerea, is a foliar pathogen of pyrethrum
causing necrotic lesions on disk florets of the plants. Infected disk florets and flowers
fuse together and appear as though flowers are attached to each other. Botrytis flower
blight causes significant yield loss in Tasmanian pyrethrum fields especially when
environmental conditions such as high temperature and humidity are favourable for
infection (Pethybridge et al. 2008d). The pathogen is a necrotroph, causing host cell
death resulting in serious damage to plant tissues ending in rot of the plant and post-
12
Chapter 2: Litereture review
harvest flowers (Pethybridge et al. 2008d). Pethybridge et al. (2008d) suggested
application of two fungicides, tebuconazole and carbendazim, for disease management.
Rhizoctonia solani anastomosis group AG-2.1 was isolated from pyrethrum
roots in yield-decline affected fields of northern Tasmania (Hay et al. 2012;
Pethybridge et al. 2010a). Pathogenicity of R. solani on pyrethrum has not been
reported on pyrethrum in Tasmania however, Alam et al. (2006) found R. solani AG-4
as a severe pathogen of pyrethrum in northern India. The disease caused necrotic lesions
on the roots and basal petioles of the infected plants terminating with wilt and
premature death. Although, R. solani AG-2.1 was isolated from the roots of pyrethrum
in yield-decline affected fields in Tasmania, the population of the pathogen in both
infected and non-infected soils was not different hence, it was not identified as a biotic
stress
associated
with
yield-decline
of
pyrethrum
in
Tasmania
(Groom
2014; Pethybridge et al. 2010a). Rhizoctonia solani AG-2.1 has been reported as a
pathogen on a wide range of plants across the world such as head rot of cabbage in
China (Zhang et al. 2009b), and damping-off of canola in USA (Paulitz et al. 2006).
Verticillium wilt caused by Verticillium dahliae was isolated from both the soil
and roots of pyrethrum plants in yield-decline affected fields of northern Tasmania in
2014, however, similar to R. solani, the isolation frequency of the pathogen was no
different comparing the yield-decline affected and non-affected sites, therefore, it did
not appear to be associated with yield-decline syndrome (Groom 2014; Pethybridge et
al. 2010a). The pathogen has been identified to have wide host range causing
verticillium wilt in temperate and subtropical areas of the world (Klosterman et al.
2009). The pathogen produces microsclerotia which remains viable in the soil over 14
years (Klosterman et al. 2009). Microsclerotia germinate and mycelia infect the root
then colonise the vascular tissue. At this stage, conidia are produced and transferred
within vessels acropetally, germinate and produce more conidia (Klosterman et al.
2009). However, no infection of pyrethrum with Verticillium spp. has been reported
globally.
Phytophthora spp. have frequently been isolated from the roots of pyrethrum
plants in yield-declined fields of northern Tasmania (Groom 2014; Pethybridge et al.
2010a). The pathogen is considered a threat to native ecosystems and causes many
13
Chapter 2: Litereture review
important diseases around the world such as dieback of eucalyptus caused by P.
cinnamomi in Victoria and Western Australia (Newell 1998), oak decline caused by P.
alni in Europe (Brasier et al. 2004) and sudden death of oak caused by P. ramorum in
California, USA (Rizzo et al. 2002). Species of Phytophthora have also caused many
diseases in Tasmania. Potato late blight caused by P. infestans (Drenth et al. 1995) and
rubbery brown rot of carrots caused by P. megasperma (Dowson 1934) are important
diseases reported in Tasmania, Australia. Oospores are the survival structures in soil
which germinate in favourable environmental conditions (moistened soil and
temperatures above 10°C) to produce sporangia baring motile uninucleate zoospores.
Zoospores attack the fine roots and produce aseptate hyphae which colonises the root
tissue resulting in root rot and distortion. Phytophthora spp. in yield-decline affected
fields of northern Tasmania have not been identified to species level. Groom (2014) and
Pethybridge et al. (2010a) suggested more investigations to be carried out to determine
the association of Phytophthora spp. with yield-decline of pyrethrum in Tasmania.
Results from the comparison of Phytophthora spp. population in autoclaved and
non-autoclaved soils of yield-decline affected fields in Tasmania showed that
soil sterilisation was an effective control as there was a significant difference in
the population of Phytophthora spp. in treated compered to non-treated soils (Hay
et al. 2012). The fungicides Agri-Fos 600, Shirlan and Envy applied in autumn were
reported to reduce the population of Phytophthora spp. on roots of affected
pyrethrum plants however, the effect of the treatments was not significant (Hay et al.
2012).
Nematodes have been isolated from the roots of pyrethrum plants in northern
Tasmania. They cause serious diseases in pyrethrum production areas in Kenya and East
Africa (Hay et al. 2009;
Pethybridge et al. 2008d). Lesion nematodes
Paratylenchus penetrans and P. crenatus were shown to be associated with pyrethrum
poor regrowth in Tasmania as they were recovered from 87% of yield-decline
affected fields (Hay et al. 2012; Hay et al. 2009; Pethybridge et al. 2008d). Hay et al.
(2009) reported that P. crenatus caused significant growth reduction and defoliation of
pyrethrum in northern Tasmania. Paratylenchus thornei and P. neglectus were
isolated in low frequencies of 10% and 7% of the yield-decline affected fields
respectively (Pethybridge et al. 2010a). Root-knot nematodes (Meloidogyne haplae)
have also been reported on pyrethrum but apparently do not cause significant yield loss
14
Chapter 2: Litereture review
hence, were not identified as pathogens of pyrethrum (Hay et al. 2012). Hay et al.
(2012) reported that nematodes (lesion and root-knot) have not been identified as
single causes of yield loss in Tasmanian pyrethrum fields and speculated that a
synergistic interaction of nematodes with soil-borne pathogens Fusarium spp., R.
solani and V. dahliae may occur on pyrethrum plants in the fields in Tasmania.
Nematicide application using fenamiphos on infected pyrethrum plants significantly
increased yield of pyrethrum flowers in Tasmania (Hay et al. 2012).
2.3. Aetiology and taxonomy of Fusarium and Paraphoma diseases
As the thesis has chapters dedicated to the identification and pathogenicity of new
Fusarium spp. and Paraphoma spp. pathogens of pyrethrum isolated from the fields of
northern Tasmania, detailed information of the biogeography, morphology and
taxonomic status of these two genera and aetiology of the diseases they produce is
provided.
2.3.1. Fusarium
Fusarium (Nectriaceae, Hypocreales, Sordariomycetes) (Aoki et al. 2014; Gerlach and
Nirenberg 1982; Summerell et al. 2010) diseases are ubiquitous. They occur in soil,
water and all substrates and have a destructive role on wild and cultivated plants. Many
species are pathogenic and either cause intensive vascular wilts or root and crown rot.
Some populations are initially endophytes and become pathogens later in their life cycle
and some are saprophytes living on dead material. Snyder and Hansen (1954) referred to
Fusarium as the most damaging genus among other genera. Fusarium dry rot of potato
has significantly reduced potato production in different parts of the world. Thirteen
Fusarium species are believed to be associated with this disease such as F. coeruleum in
the UK, F. sambucinum in North America and Europe; and F. avenaceum in Scotland
(Cullen et al. 2005; Peters et al. 2008). Potato tubers that have been wounded during
storage process become infected by Fusarium dry rot and the disease distributes
globally through tuber transfer (Saremi et al. 2011).
Panama or banana wilt disease caused by F. oxysporum f. sp. cubense is a devastating
disease of banana plants in South Asia and Africa causing significant yield loss each
year (O’Donnell et al. 1998). Backhouse et al. (2004) suggested that F. culmorum and
15
Chapter 2: Litereture review
F. pseudograminearum were the causal agents of crown and foot rot of wheat, sorghum
and barley in Victoria and South Australia. Uhlig et al. (2007) reported that there were
three Fusarium spp. associated with head blight disease of cereals including F.
avenaceum, F. culmorum and F. graminearum. The population of these species differs
in different geographical locations. While F. graminearum causes head blight disease in
temperate areas such as the USA, Australia and Canada, F. avenaceum and F.
culmorum cause significant infections in cooler regions of the world such as North West
Europe and Canada.
Species of Fusarium are usually described using the species concepts of morphology,
biology and phylogeny. Morphological species concept solely relies on morphological
identification of the species and is based on a type culture which represents the variation
within an entire species. This concept has been widely and successfully used by
taxonomists (Gerlach and Nirenberg 1982; Wollenweber and Reinking 1935).
However, morphological concept fails in some aspects of species identification as the
number of identifiable morphological characters is significantly less than the number of
species in need to be distinguished (Summerell et al. 2010; Summerell et al. 2003).
Biological species concept is based on the ability of crosses between isolates to produce
fertile progenies (Aoki et al. 2014). In this concept, unidentified isolates are crossed to
female-fertile testers to determine whether they group in the same biological species as
the tester strain. This method has been successful for limited number of species
complexes such as Giberella fujikuroi. However, biological concept has not been
successful in large scale taxonomy as most Fusarium strains are anamorph and hardly
cross even in suitable laboratory conditions (Summerell et al. 2010; Summerell et al.
2003).
Phylogenetic species concept is a new concept based on DNA sequences of selected
genes and quantifies the genetic relatedness between species (Summerell et al. 2010).
However, including enough loci and taxa in phylogenetic analysis is a necessity for
accurate identification of the species (Aoki et al. 2014). Setting isolates into groups that
are biologically meaningful is one of the issues in phylogenetic species concept
(Summerell et al. 2003).
16
Chapter 2: Litereture review
Nevertheless, none of these concepts alone have been successful to accurately identify
Fusarium species, unless for unique species complexes such as G. fujikuroi which
contains teleomorph stage and can be precisely identified using either biological or
phylogenetic species concepts (Aoki et al. 2014;
Leslie and Summerell 2006;
Summerell et al. 2010; Summerell et al. 2003; Wingfield et al. 2012).
2.3.1.1. Morphology
Morphological identification of Fusarium species is often difficult due to the isolates
variability (different spore size) and lack of microscopic features required for
morphological identification (certain fungal structures cannot be produced on a specific
medium). However single spored cultures and selective media can greatly help with
accurate identification. The main microscopic features of Fusarium are as follows:
Macroconidia are the most typical structures of Fusarium species. Leslie and
Summerell (2006) suggested using carnation leaf agar (CLA) as a medium for inducing
macroconidia production. The size of macroconidia, number of cells, basal and apical
cell shapes are important diagnostic characters. Macroconidia are produced in
sporodochia (a mass of compact hyphae bearing asexual spores) (Leslie and Summerell
2006).
Microconidia are important fungal spore structures as not all Fusarium species are able
to produce these spores. The size and shape of microconidia are important in species
identification. Moreover, conidia are formed on two types of conidiogenous cells,
monophialides and polyphialides. Phialides are specific conidiogenous cells which
produce conidia without an increase in length. Monophialides have only a single
opening per cell while, polyphialides have multiple openings. Microconidia can form on
phialides in chains, individually or in false heads. Collapse of a spore chain results in
false head production (Mycology-Online 2016).
Mesoconidia are the third form of conidia produced by Fusarium spp. and can possess
none to seven septa (Anaissie et al. 1992). They are not produced in sporodochia and
are normally attached to the hyphae. Hence, the term ‘aerial conidia’ has been attributed
to these structures (Leslie and Summerell 2006). The shape of mesoconidia is different
to macroconidia as they do not have notched or foot-shaped basal cells and are smaller
17
Chapter 2: Litereture review
than macroconidia. Species of F. chlamydosporum and F. avenaceum produce
mesoconidia (Leslie and Summerell 2006).
Chlamydospores are thick walled hyphal cells and resting structures which germinate
in appropriate environmental condition and cause infection (Nobile et al. 2003). Not
many Fusarium species produce chlamydospores. Leslie & Summerell (2006)
suggested synthetic nutrient agar (SNA) as a selective medium to be used for
chlamydospore production. Chalmydospores are formed singly, in chains, as clumps or
as doubles.
Colony pigmentation is a secondary characteristic. Potato dextrose agar (PDA) has
been suggested as the culture medium for assessment of colony colour (Leslie and
Summerell 2006). Incubation conditions such as light regime (12hr dark/12hr light) and
temperature are important factors which effect colony pigmentation (Burgess et al.
1991). Fusarium colony colours vary from white, yellow, orange and brown to grey, red
and violet. However, colony pigmentation cannot be used as a reliable characteristic
factor for morphological identification of Fusarium species as changes in incubation
conditions such as light and temperature cause mutation and hence colony colour
differences (Leslie and Summerell 2006).
Growth rate should be measured after three days at 25°C to 30°C (Burgess et al. 1991;
Francis
and
Burgess
1977).
A
number
of
replicates
is
required
to
precisely measure the growth rate. Some Fusarium spp. grow slower than others
(Burgess et al. 1991).
Other morphological characteristics such as production of circinate (coiled) hyphae in
species of G. fujikuroi species complex such as F. circinatum, crystals on CLA,
sclerotial-like structures, secondary metabolites and mycotoxins have been also studied
by Leslie and Summerell (2006) which rarely occur in many species of Fusarium.
18
Chapter 2: Litereture review
Fig.2. Identification of Fusarium species based on spore shape. A-D Macroconidia A
Typical shape of a macroconidim; B Needle-shaped Macroconidium; C Macroconidium
with dorsoventral curvature; D Macroconidium with dorsal side more curved than
ventral; E-H Macroconidia apical cell shapes E blunt F Papillate G Hooked H
Tapering; I-L Macroconidia basal cell shapes I Foot-shaped J Elongated foot-shaped K
Distinctly notched L Barely notched; M-T Microconidia spore shapes M Oval N Twocelled O Three-celled oval P Reniform (kidney-shaped) Q Obvoid with a truncate base
R Pyriform S Napiform T Globose; U-X Phialides morphology U Monophilides (false
19
Chapter 2: Litereture review
heads) V Monophialides W-X Polyphialides; Y-Z Microconidial chians. Image
was adapted from Leslie and Summerell (2006)
Fig.3. Fusarium venenatum A colony morphology; B conidiogenous cells
(polyphialides); C macroconidia with papillate apical cell and foot-shaped basal cell; D
macroconidia; E chains of chlamydospores; B, C and E scale bars 20 µm; D 200 µm
2.3.1.2. Biogeography and dispersal
As members of Fusarium are dispersed globally, it is difficult to find their origin
(Summerell et al. 2010). Summerell et al. (2010) indicated that climate and host range
were informative factors in determination of Fusarium species origin as it revealed the
geographic location from which they were recovered. In Australia, F. graminearum is
restricted to warm and subtropical areas, causing diseases on maize. However, the
pathogen was recovered from carnation in Victoria, indicating that Fusarium species
were able to extend their host range in favourable environmental conditions (Backhouse
and Burgess 2002).
Fusarium species are inhabitats of various climatic regions. Fusarium oxysporum, F.
equiseti, F. solani and F. dimerum are cosmopolitan and have been isolated from
20
Chapter 2: Litereture review
different climatic regions of the world. This raises the concern about identification of
the species which are genetically distinct but morphologically similar (cryptic species)
(Summerell et al. 2003). Other species such as F. beomiforme and F. longipes have
been recovered only from tropical areas (Sangalang et al. 1995). Burgess and
Summerell (1992) reported that the diversity of Fusarium species was related to
environmental conditions such as rainfall, vegetation and temperature
Fusarium graminearum can disperse long distances through air-borne drifts. Other
Fusarium species also can transfer long distances via passive dispersal such as wind or
storm or active dispersal such as ascospores (Burgess 1981). Chlamydospores are the
means of soil dispersal and transfer to long distances via water, such as chalmydospores
of F. oxysporum f. sp. vasinfectum. Endophytic and parasitic species of Fusarium
mostly disperse via different parts of the host plant such as seed or fruit by
anthropogenic activities; and disperse to short distances via water splash or wind
(Summerell et al. 2010; Summerell et al. 2003). Fusarium species can survive in soil as
chlamydospores, mycelium or conidia in plant residues (Burgess 1981; Mandeel et al.
1995).
More investigations need to be carried out to determine the effect of temperature and
climate on distribution of Fusarium species as the significant correlation between
environmental conditions makes it difficult to distinguish the effect of each factor
individually on Fusarium distribution (Burgess and Summerell 1992).
2.3.1.3. Taxonomy
Taxonomy of Fusarium species was solely based on morphological species concept
before 1977 (Aoki et al. 2014; Summerell et al. 2010). Fusarium was first described by
Link (1809). Significant advances in taxonomy of Fusarium was observed when
Wollenweber and Reinking (1935) published ‘Die Fusarien’ which included 16
sections, 65 species, 55 varieties and 22 forms (Messiaen and Cassini 1981). Although
detailed morphological identification of Fusarium species was presented in
Wollenweber and Reinking (1935), however the revised taxonomy was not accepted
due to time consuming microscopic identification process (Aoki et al. 2014). In 1940,
Snyder and Hanson reduced the number of sections from 16 to nine, by combining
21
Chapter 2: Litereture review
species of sections Anthrosporiella, Discolor, Roseum and Gibossum into one section,
Roseum. As the species of section Roseum were important pathogens of cereals,
pathogenic species of this section were called F. roseum f. sp. cerealis and nonpathogenic members were simply called F. roseum (Nelson et al. 1981; Snyder and
Hansen 1940, 1941, 1945). This method was highly accepted among plant pathologists
as it was simply based on visual observation of the culture morphology (Aoki et al.
2014). Booth in 1971 returned to Wollenweber and Reinking’s taxonomic classification
method while following Snyder and Hanson’s classification system for only one section
‘Elegans’ which he equated it to F. oxysporum (Nelson et al. 1981). Gerlach and
Nirenberg (1982) also followed Wollenweber and Reinking’s taxonomic classification
by increasing the number of species from 65 to 78 morphologically distinct species.
Gräfenhan et al. (2011) defined two main Fusarium clades according to Fusarium sensu
Wollenweber: ‘terminal Fusarium clade (TFC)’ including species of agricultural,
clinical and research importance; and a collection of fusarium-like genera at the base of
the phylogenetic tree as ‘basal fusarium-like clade’. In the study conducted by
Gräfenhan et al. (2011), TFC node received low bootstrap support in Baysian PP
(posterior probability) and Maximum Likelihood (ML) statistical analyses using the
second largest subunit (RPB2) and ATP citrate lyase (acl1) loci for 26 taxa.
However, Geiser et al. (2013) obtained more robust results using combined sequences
of polymerase II largest subunit RPB1 and RPB2, for analysis of 93 taxa. The Baysian
PP value increased however, ML bootstrap value remained weak. Therefore, members
of the basal fusarium-like clades (Macroconica, Fusicolla, Stylonectria and Microcera)
which were previously included in the genus were identified as non-pathogenic to
plants, humans and animals (Geiser et al. 2013; Gräfenhan et al. 2011), and were
removed from the TFC.
2.3.1.4. Phylogeny and Molecular Identification
Currently, the genus Fusarium comprises at least 300 phylogenetically distinct species,
20 species complexes and nine monotypic lineages (O'Donnell et al. 2015). Molecular
and phylogenetic studies have effectively improved identification of Fusarium isolates
to species level. Current species identification is based on multilocus sequence data
(O'Donnell et al. 2015). For sequence-based identification of Fusarium species Hyde et
22
Chapter 2: Litereture review
al. (2014) and O'Donnell et al. (2015) suggested to use RPB1 and RPB2 and elongation
factor 1-α (EF1). O’Donnell et al. (2010) reported that all the three genes had equal
levels of species identification within Fusarium. However, Lombard et al. (2015)
reported that RPB1 and RPB2 had the highest bootstrap support compared to EF1.
O'Donnell et al. (2015) suggested using at least two independent loci to increase the
accuracy of identification.
Internal transcribed spacer (ITS) and domains D1/D2, at the 5´ end of the 28S ribosomal
large subunit (LSU rDNA) sequences are too conserved to resolve species limits of
most fusaria and had the least phylogenetically informative characters compared to the
other loci (O'Donnell et al. 2015). Therefore, phylogenetic analyses using ITS and LSU
is not suggested for Fusarium species identification. However, a combined phylogenetic
tree of ITS and/or LSU rDNA has been used to determine the placement of unknown
species of Fusarium within different species complexes (Balajee et al. 2009).
Internet-accessible validated databases dedicated to the identification of fusaria via
nucleotide BLAST queries are available at FUSARIUM-ID at Pennsylvania State
University (http://www.fusariumdb.org) (Geiser et al. 2004) and Fusarium MLST at the
CBS-KNAW
Fungal
Biodiversity
Centre
(http://www.cbs.knaw.nl/Fusarium/)
(O'Donnell et al. 2015). Lesser usage of NCBI GenBank database has been suggested as
application of nomenclature of Fusarium in GenBank is not consistent (Geiser et al.
2013; O'Donnell et al. 2015). For instance, teleomorph names of F. graminearum and
F. verticillioides (G. zeae and G. moniliformis respectively) have been used instead of
the anamorphic names which is against the new rules of International Code of
Nomenclature for Algae, Fungi and Plants that ruled out the use of teleomorph names in
January 1 2013 (Geiser et al. 2013; Gräfenhan et al. 2011; Lombard et al. 2015;
O'Donnell et al. 2015). In addition, many sequences in GenBank are misidentified or
have not been updated (O'Donnell et al. 2015). The reason for using FUSARIUM-ID or
Fusarium MLST databases is that they have housed the most phylogenetically
informative sequences derived from Fusarium research centre (FRC), ARS culture
collection (NCBI) and CBS KNAW-Biodiversity centre (O'Donnell et al. 2015).
O'Donnell et al. (2015) suggested care to be taken in sequence alignments to assure
sequences are free of ambiguities. Moreover, where multiple species names have similar
scores with the top BLASTn matches, it may be necessary to sequence additional loci.
23
Chapter 2: Litereture review
Members of the F. oxysporum species complex (FOSC) are considered as important
pathogens of different hosts causing root rot and damping-off. However, in some cases
FOSC isolates do not produce disease (Ellis et al. 2014). Host specific Fusarium spp.
pathogens are known as formae speciales as they attack only one or a group of host
species (Bogale et al. 2007). However, F. oxysporum species are morphologically
similar with multiple phylogenetic origins (polyphyletic). Historically, species of F.
oxysporum had been divided into formae speciales based on their virulence to closely
related hosts, for instance, by testing pathogenicity of F. oxysporum strains to a host
cultivar with different levels of disease resistance (Correll 1991). However,
pathogenicity tests are time-consuming and prevent identification of non-pathogenic F.
oxysporum species with clinical and agricultural importance, and extremely affected by
environmental conditions such as temperature (Correll 1991; O'Donnell et al. 2009b).
Vegetative compatibility groups (VCGs), the ability to anastomose and form
heterokaryons, have provided better understanding of evolutionary origins of Fusarium
(O'Donnell et al. 2009b).
Some formae speciales are divided into races according to their pathogenicity to a set of
varieties of one or more host species (O'Donnell et al. 2009b). Differentiation of formae
speciales of F. oxysporum has been proved to be more efficient using molecular
markers obtained by restriction fragment length polymorphism (RFLP) (Bogale et al.
2007), amplified fragment length polymorphism (AFLP) and simple sequence repeat
(SSR) methods on sequences of EF1 (Bogale et al. 2006). Sequences of house-keeping
genes obtained by conventional PCR do not show enough polymorphism needed to
identify form species of Fusarium spp (Lievens et al. 2007). Pathogenicity of some F.
oxysporum form species, e.g. F. oxysporum f. sp. chrysanthemi can be linked to the
presence of specific transposons (Fot1) which can be used to develop specific markers
(Lievens et al. 2008).
2.3.2. Paraphoma
Pleosporales is the largest order in the family Dothideomycetes including more than
4700 species (Zhang et al. 2009a). Parapohma spp. including P. radicina (the ex-type
species of the genus Paraphoma), P. chrysanthemicola (the ex-neotype species) and
P. fimeti are soil-borne pathogens associated with roots in temperate areas of Australia,
America
24
Chapter 2: Litereture review
and Eurasia (De Gruyter et al. 2010). Species of Phoma section Paraphoma can be also
saprobic but mostly are pathogenic to herbaceous plants (Zhang et al. 2012). This
pathogen has been also identified in pyrethrum fields of northern Tasmania, in
conjunction with ray blight infection of pyrethrum (Hay et al. 2015). Further studies on
these pathogens need to be carried out to determine the degree of pathogenicity and to
correctly identify the species.
2.3.2.1. Morphology
Species of the genus Paraphoma are mainly identified by abundant production of straight
or flexuous septate pale brown to brown setae (Boerema et al. 2004; De Gruyter et al.
2010). Setae may be short or relatively long; and stiff or hyphal-like. Setae can be either
scattered on the surface of the pycnidia such as those produced by the ex-type species P.
radicina, or abundant around the ostioles such as species of other Phoma sections such as
Pyrenochaeta (Boerema et al. 2004; Q-bank 2016). However, setae production differs
between species of Paraphoma. For instance, P. radicina and P. chrysanthemicola
produce pycnidia with long setae, while, P. fimeti produces glabrous pycnidia (De
Gruyter and Boerema 2002). Conidiogenous cells logeniform, monophialidic, hyaline to
sub-hyaline (Q-bank 2016). Species of the section Pyrenochaeta produce long and
branched conidiophores instead of doliiform or ampulliform conidiogenous cells which
are the characteristics of species of Paraphoma (De Gruyter et al. 2010). Conidiomata
pycnidial, globose to sub-globose and papillate, thick-walled and pseudoparenchymatous,
ostiolate, uniloculate. Micropycnidia fertile or sterile produced abundantly in some
species of Paraphoma, submerged in the medium. The colour of the pycnidial matrix is
an informative character for species identification and varies from white or buff to cream,
yellow, brown or colourless (Boerema et al. 2004; Q-bank 2016).
Conidia ellipsoidal to sub-globose, hyaline and guttulate, always aseptate in vivo and in
vitro (Boerema et al. 2004). Chlamydospores are produced solitary, in short or long
chains or aggregated. Chlamydospores are distinguished in two types of unicellular and
multicellular. Multicellular chlamydospores (dictyochlamydospores) are divided into
Alterneroid, Pseudosclerotioid, Epiccocoid and Botryoid depend on the species, although,
this characteristic has been mostly observed in species of section Peyronellaea
(Aveskamp et al. 2009; Q-bank 2016). However, they have been also observed in species
25
Chapter 2: Litereture review
of Paraphoma such as P. chrysanthemicola which produces pseudosclerotioid masses of
chalmydpspores (De Gruyter et al. 2010). Some species of Paraphoma do not produce
chlamydospores. Hence, morphological features, mainly production of setose pycnidia
and chlamydospores, may vary between species of Paraphoma and other genera (Q-bank
2016).
Colony colour, growth and pigmentation are greatly dependant on the media and
incubation condition (De Gruyter and Boerema 2002). The colour that Paraphoma
isolates produce on different media varies from black, brown, olivaceous, yellow and
red to pink, grey and white (Q-bank 2016). The type of aerial mycelia is also an
important feature in species identification. Aerial mycelia is formed in five different
types including flat/effuse (aerial mycelia sparsely formed), floccose (tufted), felty (felt
like texture), woolly (loosely packed mycelium) and compact (densely packed
mycelium). Margins of the colonies are also important morphological features and
known in two types of regular (smooth and sharp) and irregular (crenate and lobate) (Qbank 2016).
Optimal media and incubation conditions are assessed using three different media of
cherry decoction agar (CHA) for colony growth and pigmentation, malt extract agar
(MEA) mostly for colony pigmentation and acidified oatmeal agar (OA) for both colony
pigmentation and morphological identification. Incubation for one week in dark and the
following week under 11hr/13hr dark/UV light regime at 20-22°C to simulate the
pigmentation of the colonies and the formation of pycnidia is also recommended
(Boerema et al. 2004; Q-bank 2016).
Physiological characters are assessed by two methods:
1- Application of 1N NaOH directly to the culture medium which causes a sudden
increase in pH rate and hence change of color to red (pH>5.5) and blue-green
(pH>12.5) on OA. This defines a metabolite ‘E’ producing strain which turns into green
(pigment α) in 10 minutes and to red (pigment β) in one hour (Boerema et al. 2004;
Vaghefi et al. 2012).
2- Application of iodine on a squashed or sectioned pycnidium. Change of cell wall
color to red upon application of iodine indicates presence of scleroplectenchymatous
26
Chapter 2: Litereture review
cell wall; and change of color of the cell contents or no change of color indicates
presence of pseudoparenchymatous cell wall type (Boerema et al. 2004; Q-bank 2016).
Fig. 4. A setose pycnidia (top left) and conidiogenous cells and conidia (top right) and a
sectioned obpyriform (flask-shaped) pycnidium of Paraphoma radicina (middle right);
27
Chapter 2: Litereture review
B ostiolar zone of a pycnidium with setae and a sectioned subglobose pycnidium;
adapted from De Gruyter and Boerema (2002)
2.3.2.2. Hosts
Species of the genus Paraphoma can be saprobic but mostly are pathogenic to
herbaceous plants. Most species of Paraphoma are soil-borne pathogens with a wide
host range of plants including monocotyledonous plants, species of Asteraceae,
Solanaceae, Cupressaceae and stone fruits (Rosaceae).
2.3.2.3. Taxonomy
The genus Phoma contains nine sections including Phoma, Paraphoma, Heterospora,
Peyronellae, Phyllostictiodes, Plendomus, Schlerophomella, Pilosa and Macrospora
(Aveskamp et al. 2009; Boerema et al. 2004; De Gruyter et al. 2013). Most sections of
the genus are placed in Didymellaceae however, type species of Phoma sections
Paraphoma, Heterospora, Pilosa and Plendomus clustered in a separate group outside
Didymellacea and hence were excluded from Phoma in 2013 (De Gruyter et al. 2013).
Phoma section Paraphoma (Pleosporales, Phaeospheriaceae, Dothideomycetes)
(Phookamsak et al. 2014; Zhang et al. 2009a) contains 11 species with setose pycnidia
according to De Gruyter and Boerema (2002) including Phoma radicina (section
Paraphoma), P. setariae, P. terrestris, P. briardii and P. gardenia, P. indica
(transferred to the section Pyrenochaeta), P. septicidalis, P. carteri and P. glycinicola
(transferred
to
Coniothyriaceae),
P.
terricola
(transferred
to
the
genus
Pyrenochaetopsis) and P. Leveillei. The teleomorph of this section is still unknown.
The genus Paraphoma was first introduced by Morgan-Jones and White (1983). The extype species P. radicina (≡Pyrenochaeta radicina) (McAlpine 1902) is a pathogen of
root of monocotyledonous plants such as Iridaceae and Leguminosae (Boerema et al.
2004). Papraphoma was first placed in Pyrenochaeta by McAlpine (1902) and later
Boerema and Dorenbosch transferred it to genus Phoma in 1979 (Zhang et al. 2012).
Morgan-Jones and White (1983) transferred species of Paraphoma into Phoma
according to the morphological feature, setose pycnidia. De Gruyter et al. (2010)
28
Chapter 2: Litereture review
reintroduced Phoma section Paraphoma to Phaeosphaeriaceae using phylogenetic
studies.
Paraphoma chrysanthemicola was first described by Hollós in 1907 (De Gruyter et al.
2010). Later, Srivastava (1953) reported a phoma-like pathogen at the base of the flower
stems of Chrysanthemum spp. and identified it as P. chrysanthemicola. However, these
claims were solely based on morphological characters. Paraphoma chrysanthemicola
was also isolated from the roots of Chrysanthemum morifolium in Germany, in 1967
(De Gruyter et al. 2010). Later, Dorenbosch (1970) reported it as a pathogen involved
with the root disease of florists’ Chrysanthemum. Johnston (1981) also reported it as
root pathogen of Leguminosae causing damping-off and root rot.
2.3.2.4. Phylogeny and molecular identification
The type species of the genus Paraphoma, P. radicina, clustered in a separate group
outside Didymellacea and hence was excluded from Phoma in 2013. These species
clustered mainly in Phaeosphaericea, Cucurbitariaceae and Coniothyriaceae based on
28S ribosomal RNA (LSU) and small subunit 18S nrDNA (SSU) phylogenetic analysis.
Morphology of phoma-like isolates seems not to be congruent with molecular studies
(Aveskamp et al. 2009). For instance Aveskamp et al. (2009) reported that P.
chrysanthemicola (formerly placed in section Peyronellaea) did not clade with species
of section Peyronellaea in the multigene phylogenetic study using actin (ACT), beta
tubulin (TUB) and internal transcribed spacer (ITS) gene sequencing. Instead, it
clustered with species of the genus Paraphoma as it had semi-setose pycnidia which
were closely related to the ex-type species of Phoma section Paraphoma, P. radicina
(Aveskamp et al. 2010). Hence, morphological characters which are thought to be
specific of a section are polyphyletic. Setose pycnidia and dictyochlamydospores
(chlamydospore
possessing
longitudinal
and
transverse
septa,
http://www.mycobank.org), characteristics of species of sections Paraphoma and
Peyronellaea can be observed in species of other sections such as Pyrenochaeta and
Pleurophoma (Aveskamp et al. 2010). Aveskamp et al. (2010) observed polymorphism
in multilocus phylogeny of genus Paraphoma using LSU and SSU in the phylogenetic
study.
29
Chapter 2: Litereture review
In order to phylogenetically identify species of Phoma nine loci have been used in
different studies: ITS, LSU and SSU as molecular markers and RPB1, RPB2, EF1, ACT,
TUB, calmadulin (CAL) and chitin synthase (CH1) as protein coding genes (Q-bank
2016). However, Zhang et al. (2012) suggested including more genes in a phylogenetic
study of phoma-like species to be able to clearly identify relationships between orders
and families within individual orders. He advised using ITS and LSU in combination
with protein coding genes RPB1, RPB2, EF1, ACT and TUB for precise identification
of species of Paraphoma. Inclusion of more taxa in the multigene phylogenetic analysis
of Paraphoam is necessary for accurate identification and estimation of the evolutionary
process (Zwickl and Hillis 2002). The role of EF1 in species identification within
Phoma has not been studied clearly however, in this study, EF1 was easily amplified
and provided high resolution and included more parsimony-informative nucleotide sites
compared to TUB, using primer pairs of EF827 (forward) and EF2 (reverse) according
to Quaedvlieg et al. (2013).
2.4. Impact of environmental factors (abiotic stresses)
Environmental factors such as temperature, soil moisture and pH may accelerate the
development of disease and have direct relationship with pyrethrum production
(Greenhill 2007). Cool temperatures of the North West Coast of Tasmania with mean
temperature of 20°C in summer and 13°C in winter, creates an excellent environmental
condition for pyrethrum production in Tasmania (Greenhill 2007) whereas, continuous
cool temperatures and a sudden wave of heat in summer in countries such as Japan and
Croatia made pyrethrum production unsuccessful (Glover 1955). Cool temperatures at
night and day length in Tasmania induce pyrethrum plants to produce flowers
(Greenhill 2007). Greenhill (2007) suggested that cool temperatures during
vernalisation period in winter (June-August), 16°C or lower at least for two weeks, and
high temperatures during flowering increased pyrethrin production in the achenes in the
flower heads, and higher temperatures >30°C reduce pyrethrin contents (Greenhill
2007).
Other environmental stresses such as frost, continuous usage of herbicides to control
weeds and high annual rainfalls (waterlogging) have been reported by Groom (2014) to
affect pyrethrum production. The increase in rainfall causes soil erosion and
30
Chapter 2: Litereture review
susceptibility of plants to a range of diseases due to excess wetness of the canopy
(Pethybridge et al. 2008d). However, low soil moisture during summer also stress the
plants with less expansion of the roots (due to infection by soil-borne pathogens) thus
preventing the uptake of water from lower soil levels (Pethybridge et al. 2010a).
Suraweera et al. (2015a) indicated that pyrethrin production in flower heads increased
under sprinkler irrigation during flowering period and flower development, as the
application of water slowed down the flower development and increased the duration of
flowering.
Ray blight has been reported to have an interaction with waterlogging (particularly in
the relatively high rainfall regions where pyrethrum is grown) to reduce plant vigour
and cause poor regrowth after first harvest (Groom 2014). Javid et al. (2013) studied the
effect of S. tanaceti and waterlogging on root and shoot dry weights, leaf area and the
number of stems of pyrethrum plants in glasshouse trials. Javid et al. (2013) confirmed
that a combined treatment of waterlogging and ray blight had a more severe effect on
root system expansion and root dry weight than waterlogging alone. Javid et al. (2013)
reported that ray blight resistance in cultivars was not correlated with recovery after the
waterlogging treatment, as in some cases, more resistant cultivars were less able to
recover compared to waterlogging sensitive plants.
According to Pethybridge et al. (2010b), abiotic factors such as soil compaction and
cutting height contributed to poor regrowth of pyrethrum plants in yield-decline affected
sites. More investigations in 2014 showed that waterlogging, dense harvest, frost and
continuous application of herbicides were other important factors associated with the
problem (Groom 2014). Groom (2014) also reported that field topology which included
“hump and hollows” and a dense growing of weeds in yield-decline affected fields were
other physiological stresses playing an important role in yield-decline.
31
Chapter 2: Litereture review
Fig.5. A the effect of hump and hollows on growth of pyrethrum; poor growth in the
swales and reasonable growth in ridges; B the effect of frost in lower parts of the field
versus a good growth on upper hills; photos were adapted from Groom (2014)
32
Chapter 2: Litereture review
2.5. Pyrethrum yield-decline
Pyrethrum yield-decline has been reported for almost two decades (Groom 2014; Hay
et al. 2012; Hay et al. 2002; Pethybridge et al. 2010a) however, the incidence was at
the highest in 2010 in Tasmania (Pethybridge et al. 2010a). The main causal agent of
the decline has not been identified and it is believed that a combination of biotic and
abiotic stresses are associated with the syndrome (Hay et al. 2012; Hay et al. 2002;
Pethybridge et al. 2010a). Groom (2014) mentioned that this syndrome was not related
to pyrethrum plants individually, but referred to the pyrethrum crop as many individual
plants did not die but pyrethrum yield was reduced significantly. Pethybridge et al.
(2010b) and Hay et al. (2012) reported that pyrethrum plants in yield-decline affected
fields showed less density in autumn and after the first harvest most plants were not
vigorous enough to regrow or had lower yield in the second harvesting season. In a field
with high crop density, reduction of light to the crown reduced the number of buds able
to regrow after first harvest. In pyrethrum crops, the number of flowers per plant, flower
dry weight and the amount of pyrethrin produced within each flower was affected by the
amount of light intercepted by the canopy (Pethybridge et al. 2008b).
Fig.6. A a terminated pyrethrum site after the second harvesting season; B an acceptable
regrowth of pyrethrum after first harvest
33
Chapter 2: Litereture review
2.5.1. Symptoms
Roots of infected plants have been shown to contain necrotic lesions and the epidermal
layer was detachable suggesting roots were infected by pathogens. Discolouration and
necrosis of crown tissue was observed on a majority of pyrethrum plants in yielddecline affected fields. The root extension in affected plants compared to non-affected
plants was reduced and in some cases no feeder roots were observed (Hay et al. 2012).
Groom (2014) reported that die back of plants in winter increased their tendency to
become attacked by slugs and snails.
2.5.2. A review of yield-decline of other important crops
As yield-decline causes significant yield loss in Tasmania, it is relevant to review and
compare physiological factors which have contributed to yield-decline in various
important Australian crops such as sugarcane and canola.
The Australian sugar industry has been severely affected by yield-decline. The
definition of yield decline in the Australian sugar industry was based on the long-term,
monoculture system in which the soil lost its productive capacity (Garside et al. 2005;
Pankhurst et al. 2003). Planting a single crop for a long period of time and cultural
practices used for crop growing or either of these factors, are attributed to yield-decline.
Breaking the monoculture with appropriate crops such as legumes in sugarcane fields
and rotation experiments improved the biological, chemical and physical properties
of the soil (Pankhurst et al. 2003). Biotic stresses such as fungal pathogens and
nematodes have significant effects in yield reduction of sugarcane plants in Australia.
Croft and Magarey (1984) frequently isolated two species of Pythium (P.
arrhenomanes and P. graminicola) from the roots of sugarcane plants in yield-decline
affected fields. Other fungal pathogens such as Rhizoctonia spp. and Phytophthora spp.
were also reported as root pathogens of
sugarcane in Australia (Croft and
Magarey 1984). Pachymetra chaunorhiza was also identified as an important new
pathogen of sugarcane which was specifically isolated from the soils in
Queensland, Australia (Pankhurst et al. 2003). Moreover, the negative effect of
arbuscular micorhizal fungi (AMF) in soils with high levels of phosphorus (P) on
growth of sugarcane plants was reported, however, Pankhurst et al. (2003) suggested
more investigation to be carried out as the negative effect of AMF on yield reduction in
34
Chapter 2: Litereture review
soils with high levels of P was not consistent.
Root knot nematode Meloidogyne javanica and lesion nematode Paratylenchus
zeae were reported as the most important species causing significant root
damages in sugarcane plants. Other nematodes such as stubby root (Nanidorus
minor) and spiral nematodes (Helicotylenchus pseudorobustus) were also isolated in
less frequency in sugarcane yield-decline affected fields (Pankhurst et al. 2003).
Results from investigation of yield-decline of sweet potato in Papua New
Guinea showed that, there was a positive correlation between rainfall and yield-decline
(Garside et al. 2005). In this survey, yield-decline was attributed to a combination
of factors such as nematode infestation and changes in soil chemical properties.
These changes happened during the time when frequent land-use became a routine and
old lands were planted repeatedly (Garside et al. 2005).
In a series of studies about canola yield-decline in south-eastern Australia,
abiotic stresses such as soil compaction, acidity, salinity and sodicity were
recognised as considerable factors contributing to yield-decline. In waterlogged
soils, manganese toxicity caused photosynthesis reduction which affected plant
growth directly. Liming was suggested as an effective management technique in these
areas. In sodic soils, soil particles block the soil pores in wet condition and form hard
structures when dry. This affected the root distribution and plant growth in canola
fields of New South Wales. Moreover, salt particles around the root resulted in
reduced water uptake and finally the plant growth (Anon 2009).
2.6 Objective
Evaluating fungal pathogens associated with pyrethrum yield-decline in Australia
Aims:
1. To isolate and identify putative fungal pathogens associated with pyrethrum
yield-decline affected plants in the fields of northern Tasmania and Ballarat
2. To identify Fusarium and Paraphoma species associated with yield-decline
of pyrethrum to species level using morphological characters, multigene
35
Chapter 2: Litereture review
phylogenetic analysis, and pathogenicity tests to assess the role these
pathogens have on growth of pyrethrum
3. To assess the influence of waterlogging on growth of pyrethrum plants
infected with F. oxysporum, F. avenaceum and P. vinacea
36
Chapter 3: Methodology
Chapter 3
General Materials and Methods
3.1. Media preparation
Agar used in media preparation was commercial agar (Leiner Davis Gelatine Co.,
powdered agar Grade J3, Australia) unless otherwise stated. Sterilised water was RO
(Reverse Osmosis) water autoclaved for 20 min at 121°C.
Cherry Decoction Agar (CHA)
To prepare cherry extract, 1 Kg of cherries were washed and pitted. They were then
placed in a 2 L flask, water added and the mixture was simmered for 2 hr. The extract
was filtered through a cheesecloth and then autoclaved for 20 min at 121°C. To prepare
CHA, 200 mL of the extract was mixed with 800 mL sterile water and 15 g of agar was
added to the mixture. They were then re-autoclaved for 5 min at 102°C (Crous et al.
2009).
Ethanol Potassium Amoxycillin Agar (EPAA)
To prepare 1 L of EPAA, 15 g of agar was combined with 1.5 g of KH PO (ChemSupply Pty. Ltd., Australia) and 4 g of K HPO (Chem-Supply Pty. Ltd., Australia)
mixed with 1L of sterile water; then autoclaved for 20 min at 121°C. The medium was
left in a waterbath at 55-60°C to cool down before antibiotic and ethanol were added.
Thereafter, 50 mg of Amoxycillin (Sigma-Aldrich, USA) was added to the autoclaved
medium with 2 mL of 100% Ethanol under a fume cupboard. All the ingredients were
mixed using a magnetic rotor for 10 min (Mansoori 2011).
Malt Extract Agar (MEA)
Forty g of the commercial malt extract powder (Oxoid, Thermo Fisher Scientific,
Adelaide, Australia) was added to 15 g of agar and then mixed with 1 L of sterile water.
The solution was autoclaved for 20 min at 121°C (Boerema et al. 2004).
Oatmeal Agar (OA)
Oatmeal extract was prepared by boiling 20 g of oatmeal flakes (Homebrand,
Woolworth, Australia) wrapped in muslin cloth and hanged in a 2 L glass Becker on a
37
Chapter 3: Methodology
heater for 2 hr. The extract was filtered through cheesecloth and made up to 1 L using
tap water, then sterilised for 20 min at 121°C. Thereafter, 1 L of acidified OA extract
was mixed with 15 g of agar and re-sterilised for 5 min at 102°C.
Acidified OA: 32 mL of 0.1 N HCl was added to 1 L of the autoclaved OA (Crous et
al. 2009). 0.1 N HCl was prepared by adding 8.3 mL of 36.5% HCl (Ajax Finechem
Pty. Ltd., Auckland, New Zealand) to 1 L of distilled water.
Potato Dextrose Agar (PDA)
One L of sterile water was mixed with 39 g of the commercial PDA powder (Difco, BD,
NSW, Australia) and autoclaved for 20 min at 121°C.
Synthetic Nutrient-Poor Agar (SNA)
One g of KH PO , 1 g KNO (Chem-Supply Pty. Ltd., Australia), 0.5 g of hydrated
MgSO (Ajax Finechem Pty. Ltd., Auckland, New Zealand), 0.5 g of KCl (SigmaAldrich, USA) , 0.2 g of each glucose and saccharose (Sigma-Aldrich, USA); and 20 g
of agar were mixed with 1 L of sterile water and autoclaved for 20 min at 121°C (Leslie
and Summerell 2006).
2% Water Agar (WA)
Twenty g of agar was mixed with 1 L of sterile water and autoclaved at 121°C for 20
min (Crous et al. 2009).
V8 Juice agar (V8)
V8 juice agar was prepared according to Vaghefi (2014) by adding 200 mL V8 juice
(V8 veg juice, Australia) to 800 mL of sterile water and 20 g of agar. The pH was
adjusted to 6.25 by adding a few drops of 10M NaOH. In case when pH exceeded 6.25,
few drops of 6N HCl were added to the solution.
1.5% Agarose Gel
To prepare 1 L of agarose gel, 11.25 g of agarose gel (Scientifix Pty. Ltd.; France) was
mixed with TAE buffer. To make 1 L of TAE buffer, 242 g of Tris Base (SigmaAldrich, USA) was dissolved in 600 mL of ddH O (double distilled water) and mixed
with 57.1 mL Glacial Acetic Acid (Ajax Finechem Pty. Ltd., Auckland, New Zealand)
and 100 mL of 0.5M EDTA (Chem-Supply Pty. Ltd., Australia).
38
Chapter 3: Methodology
3.2. Single sporing
Cultures were single spored to reduce variation in morphological characters and
virulence (Leslie and Summerell 2006).
Colonies of Fusarium spp. were grown on SNA with 2.5 cm diam pieces of double
autoclaved filter papers (Whatman International Ltd., England), autoclaved for 20 min
at 121°C, to induce sporulation before single sporing. Colonies were grown at 23-25°C
under 12 hr dark /12 hr fluorescent light for 7 days (Leslie and Summerell 2006). Spore
suspension was prepared by taking hyphae and conidiophores from growing margins of
the colonies and mixing with 1 mL of sterilised water in a 1.5 mL microcentrifuge tube
(Ajax, Australia). The suspension was vortexed for 20 sec and then the spore suspension
concentration was calculated using a haemocytometer. Thereafter, 100 µL of spore
suspension was pipetted and spread on the surface of a WA plate using a sterilised glass
spreader (swabbed with 80% ethanol). The plate was sealed with parafilm and left at
room temperature on a 45° slant overnight.
The day after, single germinated spores were observed under a dissecting microscope.
Small agar plugs including a single germinated spore were lifted using a sterilised
needle (0.80 × 38 mm, Terumo, Belgium) and transferred to an EPAA plate in order to
reduce the chance of bacterial contamination and incubated at 24°C for 2 days. Well
grown colonies were subcultured onto PDA plates to grow for another 2 days. Plates
were incubated similar to the condition described formerly.
To induce Paraphoma species to sporulate, OA culture plates were incubated at 2022°C in dark for one week and then under 11hr/13hr dark/UV light regime (Boerema et
al. 2004) for one month. An alternative method was used to induce sporulation by
placing fungal mycelial plugs next to 5 cm pieces of double autoclaved pyrethrum
flower stems on WA. Similar single sporing technique was used for Paraphoma spp.
3.3. Preservation
3.3.1. Short-term
Mycelial plugs were prepared from 7-day-old single spored colonies grown on PDA for
Fusarium spp. and on OA for Paraphoma spp. and transferred into sterilised CryoTubes (Thermo Fischer Scientifics, Australia) containing sterilised water. Tubes were
39
Chapter 3: Methodology
labelled and kept in a cold room at 4°C. To revive colonies, plugs were directly cultured
on PDA.
In addition, 5 cm pieces of double autoclaved pyrethrum flower stems which were
colonised by Fusarium spp. and Paraphoma spp. on WA were placed separately in
small paper bags and stored at room temperature in a desiccator containing silica gel. To
revive cultures, flower stems were cut into 0.5 cm pieces using a sterilised scalpel and
transferred onto PDA/OA.
3.3.2. Long-term
Single spored young colonies of Fusarium and Paraphoma grown on PDA or OA were
used for long-term storage. Blocks of agar were cut from the growing margins of the
colonies using a sterilised borer and transferred into empty sterile Petri dishes with the
lids covering 75% of the Petri dish, and left in a biohazard cabinet overnight to dry.
Plugs were transferred into sterilised Cryo-vials and labelled. Vials were stored in a -80
freezer.
3.4. DNA extraction and PCR amplification
A sterile scalpel was used to scrape 7-day-old fungal mycelia off the plate which was
ground with liquid N using a mortar and pestle until a fine powder was obtained. To
avoid DNA thawing and degrading, microcentrifuge tubes were kept in a polystyrene
box containing liquid N after grinding and before buffer AP1 was added. For each gel
run, 3 µL of DNA plus 2 µL of loading dye (Invitrogen, Australia) were loaded into
wells. A stock of 10 ng/µL was prepared for DNA products after sizing the bands using
a Lambda DNA/HindIII Marker (Thermo Ficsher Scientific, Australia).
DNA products were amplified using primers of specific fungal genes according to
references. However, a range of five different temperatures, below and above the primer
melting temperature (Tm) was tested to determine the primer’s optimal annealing
temperature using gradient PCR technique. To amplify EF1, a Touchdown PCR, started
from 10°C above the annealing temperature of the primer, following the protocol of
Rehner (2001) at http://www.aftol.org/pdfs/EF1primer.pdf was also carried out in order
to obtain bands with the highest intensity. All the PCRs were carried out in a 12.5 µL
volume/reaction. Thereafter, a gel was run by loading 2 µL of the PCR products plus 1.3
40
Chapter 3: Methodology
µL of loading dye into each well. Bands were compared to a 1 kb ladder (Invitrogen,
Australia).
Agarose gels were made using SYBER-Safe DNA gel stain (USA) and visualised with a
GelDoc (BioRad, Australia).
3.5. Microtome sectioning
Tissues were incubated in Formaldehyde Acetic Acid (FAA) for 48 hr. After 2 days,
FAA was poured off and tissues were rinsed in 20% Tertiary Butyl Alcohol (TBA).
Samples were dehydrated in increasing tertiary butyl alcohol concentrations (20, 40, 60,
80% and 3 times in 100%) for 15 min at each concentration. Then they were immersed
in TBA and xylene (1:1) solution and incubated at room temperature in the fume hood
for 2 hr. Samples were immersed in 100% xylene for another 2 hr at room temperature.
Xylene was used as clearing agent and made the samples more translucent. Thereafter,
samples were left in a mixture of 50% paraffin – 50% xylene in Falcon tubes which
were placed into a rack and the whole rack was left in water bath at 55-60̊ C overnight.
The day after, 50% paraffin was replaced with 100% paraffin and left for another 2 days
in the water bath at 58̊ C. Fresh paraffin was changed twice a day.
After 2 days, samples were taken out of the paraffin and placed on a hot plate in order to
maintain paraffin in a liquid phase. Using a metal mold, tissue was embedded in
paraffin and fixed in the mold. The tissue was oriented inside the mold for both
longitudinal and transverse sectioning. A plastic mold was placed on top of the metal
mold, the mold was filled with liquid paraffin and placed on the cold plate to solidify.
Blocks were ready to be sectioned after 30 min.
Before sectioning, blocks were trimmed with a sharp razor blade then sectioned using a
Leica microtome RM2125 RTS. Sections of 6 µm thickness were mounted on glass
slides. The slides were placed on a hot plate to expand the paraffin sections. Slides were
dried using a piece of tissue paper then transferred to the fume hood. 100% xylene was
dropped on the slides and kept for 10 minutes. A few minutes after the wax dissolved,
slides were rinsed with decreasing concentrations of ethanol (100%, 75%, 50% and
25%) for 10 minutes at each concentration. Ethanol was used to remove the xylene. The
slides were rinsed with sterilised water. Sections were stained with the Johansen
41
Chapter 3: Methodology
quadruple staining method described by Bhuiyan et al. (2015) and mounted using a
mounting liquid (Micromount Surgipath Australia) and visualised with bright field and
differential inference contrast illuminations.
42
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Chapter 4
Isolation and identification of fungal pathogens from
pyrethrum in yield-decline affected fields of northern
Tasmania
4.1. Introduction
Many pathogens have been isolated from pyrethrum plants that cause devastating
diseases affecting pyrethrum growth and reducing pyrethrin content in flowers. Ray
blight of pyrethrum caused by S. tanaceti is one of the most devastating diseases
causing significant yield loss in Tasmania annually. Ray blight has been
managed successfully applying fungicides however, this form of control is not
sustainable especially under cool and moist environmental conditions that favour
disease (Vaghefi et al. 2015). Bhuiyan et al. (2015) showed that the pathogen
colonised leaf lamina by direct
parenchyma
cells
or
penetration
and
moved
between
mesophyll
moved horizontally in epidermal cells however, more
investigations are needed to determine the role of S. tanaceti in crown and root
infections and in yiedl-decline.
The incidence of infection by Didymella tanaceti the causal agent of tan spot
has considerably
increased (Hay et al. (2015). Other foliar pathogens such as C.
tanaceti, Alternaria spp., P. chrysanthemicola, S. botryosum and Itersonilia
perplexans that cuase necrotic and water-soaked leaf lesions have been less
frequently isolated and appear to be influenced by favourable environmental
conditions (Hay et al. (2015). This emphasises the fact that many foliar pathogens
exist in the field that can infect and cause disease in pyrethrum and shows the
possibility that these fungi can become severe pathogens of pyrethrum with a
change of environmental conditions that favour specific fungal pathogens.
Soil-borne diseases of pyrethrum have not been recognized as of major concern
and hence, not many investigations have been carried out to determine the role
these pathogens have on pyrethrum yield-decline. Phytophthora spp., R. solani, V.
dahliae and Fusarium spp. have been isolated from the roots and soils where
pyrethrum yield-decline was observed (Groom 2014;
Pethybridge et al. 2010a).
However, the role these pathogens play in yield-decline and their interaction with other
43
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
pathogens play in yield-decline and their interaction with other pathogens and
environmental stresses needs to be further assessed. Phytophthora spp. were the most
prevalent pathogens isolated from the roots of pyrethrum in yield-decline affected fields
of northern Tasmania but the pathogenicity of these isolates to pyrethrum was never
assessed (Pethybridge et al. 2010a).
The aim of this chapter, was to isolate and identify putative fungal pathogens from the
leaves, petioles, crowns and roots of yield-decline affected pyrethrum plants. The most
frequently isolated putative pathogens were identified using ITS gene sequencing and
the disease incidence and severity of the pathogens assessed using pathogenicity tests.
The importance of this chapter is to broaden the knowledge of soil-borne pathogens that
currently cause disease of pyrethrum plants in yield-decline sites of northern Tasmania.
4.2. Materials and Methods
Part A. Isolation and identification of fungal pathogens from yield-decline affected
plants
4.2.1. Sample collection
In June 2014, two pyrethrum plants each were randomly selected and uprooted with
intact sub-crown and partial root systems from nine yield-decline affected fields in
northern Tasmania.
These nine fields were planted in September 2012 with RS7, BR1 and RS5
varieties. Previously potato and poppy plants were grown in these fields. The highest
rainfall rate was observed in May and July 2012 (98.4 and 121.6 mL/month
respectively). Fields mostly sloped to the south.
Plants were transferred into plastic bags with detailed information of symptoms, site
number and cultivar. Bags were placed into a polystyrene box and surrounded by
icepacks. Plants were sent to the University of Melbourne and stored in cold room until
further processing. The crown tissue discolouration was assessed based on a visual scale
where 0= no discolouration, 1= mild discolouration and 2= severe discolouration.
44
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Table 1. Information of pyrethrum plants collected from nine yield-decline affected sites of
northern Tasmania
Crown
discolouration
scale
Site
Symptoms
49206
Healthy roots, grey old leaves
dried, reddish-brown lesions
darker at the edge and lighter
approaching the centre on both
sides of the leaves, in some
leaves lesions encompassed the
entire leaf, black round lesions
at the base of the flower stems
1
RS7
74201
Healthy roots, young new
shoots grew out of the plant,
reddish-brown lesions darker at
the
edge
and
lighter
approaching the centre on both
sides of the leaves, old leaves
wilted and died, black round
lesions at the base of the flower
stems
0
NA
76406
Healthy roots, young new
shoots and green leaves grew
out of the plant, reddish-brown
lesions darker at the edge and
lighter approaching the centre
on both sides of the leaves,
black round lesions at the base
of the flower stems
0
86901
Healthy roots, young new
shoots and green leaves grew
out of the plants,
reddishbrown lesions darker at the edge
and lighter approaching the
centre on both sides of the
leaves, black round lesions at
the base of the flower stems
1
45
Cultivar
NA
NA
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
46410
Healthy roots, large number of
young new shoots and leaves
grew out of the plant, reddishbrown lesions darker at the edge
and lighter approaching the
centre on both sides of the
leaves, black round lesions at
the base of the flower stems
1
BR1
47110
Healthy roots, young new
shoots and green leaves grew
out of the plants, same spots on
the leaves but less than the
other sites, black round lesions
at the base of the flower stems
2
NA
49207
Healthy roots, young new
shoots and green leaves grew
out of the plant, reddish-brown
lesions darker at the edge and
lighter approaching the centre
on both sides of the leaves,
black round lesions at the base
of the flower stems, petioles
fresh at the base and dried and
curved at the end, white fluffy
mycelium on the crown tissue
1
RS5
49301
Healthy roots, old leaves grey
in colour and dried, reddishbrown lesions darker at the edge
and lighter approaching the
centre on both sides of the
leaves, in some leaves lesions
encompassed entire leaf, black
round lesions at the base of the
flower stems
2
RS7
46
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
64209
Healthy roots, old leaves grey
in colour and dried, reddishbrown lesions darker at the edge
and lighter approaching the
centre on both sides of the
leaves, in some leaves lesions
encompassed entire leaf, black
round lesions at the base of the
flower stems
2
NA
4.2.2. Isolation of fungal pathogens
One plant from each site was selected and roots were washed gently under the tap water
for 5 minutes to remove excess soil. Plants were transferred to the laboratory in clean
plastic bags. Tissues from the upper roots, crowns, petioles and leaves were sectioned (3
replicates each) and surface sterilised in 80% ethanol for 30 sec, 1% active ingredient
(ai) sodium hypochlorite for 1 min and then transformed to sterilised water twice for 1
minute respectively. Tissues were then blotted on a sterilised paper towel and cultured
onto both water agar and EPAA. Plates were incubated at 23° C for 3-4 days until
fungal hyphae were observed growing from the tissue. Mycelium was subsequently
subcultured onto PDA and incubated for a further 5 days at 23 °C.
Young shoots and dried pieces of the base of the flower stems were also randomly
selected and placed on moistened filter paper inside Petri dishes. The filter papers were
moistened with distilled water to enhance humidity. Plates were incubated for 5 to 10
days at 20-24°C, and then stem pieces were observed under a stereomicroscope. Fungal
structures and fruiting bodies were then collected with a sterile needle, mounted on a
microscope slide and observed under compound microscope.
4.2.3. Identification of fungal pathogens
4.2.3.1. Morphological description
Single spore colonies were obtained from isolates which were grown on PDA and
incubated for 10 days at 22-24°C with a 12 hr photoperiod, under cool white
fluorescent light (Burgess and Summerell 1992) and single spored as described.
47
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Cultures were identified based on colony morphology and colour; spore shape and size,
presence or absence of chlamydospores, micro and macro conidia, sporodochia, mono
or poly-phialides, pycnidia and pseudothecia (Barnett and Hunter 1972).
Many of the Hyphomycete fungi, especially in the Fusarium-like genus, were difficult
to identify based on culture and spore morphology, hence these were divided into
different morphotypes.
4.2.3.2. Molecular taxonomy
DNA extraction and PCR amplification of ITS gene
Thirteen Hyphomycete isolates from a range of morphotype groups were selected for
molecular analysis. Fungal mycelia were scraped directly from 7-day-old single spored
cultures on PDA and were ground with liquid nitrogen using a mortar and pestle. DNA
was extracted using the DNeasy Plant Mini Kit (Qiagen) following the manufacture’s
instruction and quantified by comparing the band density to a set of molecular markers
after electrophoresis in 1.5% agarose gel. 550 bp of the Internal transcribed spacer
region (ITS) was amplified with ITS1 (forward:CAACTCCCAAACCCCTGTGA) and
ITS4 (reverse: GCGACGATTACCAGTAACGA) (White et al. 1990).
PCR was performed in 20 µL reaction volumes containing 2 mM MgCl (Invitrogen,
Australia), 1 unit of MangoTaq (Invitrogen, Australia) DNA polymerase, 200 µM
dNTPs (Invitrogen, Australia) and PCR reaction buffer 5X (Invitrogen, Australia) and
1.0 µL of template DNA (White et al. 1990). The annealing temperature was adjusted
to 56°C.
DNA amplification was carried out using an Eppendorf thermal cycler
(BioRad, Australia). PCR products were then purified using QIAquick PCR purification
kit (Qiagen) and an electrophoresis gel was run after purification to test the integrity of
the bands. All PCR and purification products were stained in ethidium bromide and
visualised under UV light.
Sequencing and phylogenetic analysis
Purified amplicons were sent to Australian Genome Research Facility Ltd. (AGRF) for
sequencing. Sequence intensity was assessed using Chromas Lite MFS and then were
aligned using the multiple alignment program ClustalW. To obtain the best alignment
48
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
results, sequences were edited both manually using the sequence alignment editing
program
MEGA6
and
electronically,
browsing
the
sequences
in
MAFFT
(http://mafft.cbrc.jp/alignment/software/). Phylogenetic trees were constructed for each
genus individually in MEGA6. Trees were analysed using Maximum Parsimony
statistical method. The best substitution model for each individual tree constructed for
each genus, was determined using MEGA6. To assess the relative stability of branches,
bootstrap analysis with 1000 pseudoreplicates was performed. Gaps were treated as
missing data. Gene bank accession numbers for Fusaruim spp. were derived from
O'Donnell et al. (2009a), Bakan et al. (2002), O'Donnell et al. (2013) and O'Donnell et
al. (2007), for Rhizoctonia spp. from Johanson et al. (1998) and González et al. (2006),
for Bionectria spp. from Hirooka and Kobayashi (2007) and Paul et al. (2013), and for
Plectosphaerella spp. from Carlucci et al. (2012).
Part B. Pathogenicity of putative fungal species
To investigate the role of pathogenic fungal species on the growth of pyrethrum plants,
two experiments were conducted.
4.2.4 Glasshouse experiment 1
Pyrethrum seedlings of cultivar Pyrate were germinated from steam sterilised seed and
raised in seedling mix in Tasmania. Seedlings were then sent to University of
Melbourne and in May 2014, 700 seedlings were each transferred to 10 cm diameter
pots with potting mix and fertilized with 5 g of Osmocote (Scotts, Australia) per pot.
Pots were then left in glasshouse for 2 months.
To confirm purity of cultures used for inoculation, spore suspensions were prepared from
the single spore cultures of F. oxysporum (5 isolates),
F. avenaceum (5 isolates), F.
venenatum (1 isolate) and F. equiseti (2 isolates), Paraphoma sp., Bionectria spp.,
Plectosphaerella sp. and Rhizoctonia spp. and the concentration of each spore
suspension was calculated to 10 spore/mL using a haemocytometer (Table 2). Three
inoculation methods of root-dip, foliar spraying and placing mycelial plugs on detached
petioles were considered for inoculation of the plants in the glasshouse. For the root and
foliar spray inoculations, there were three replicates for each isolate and a total number
of 120 plants (considering the controls).
49
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Two different irrigation methods were used, drippers for the plants which were spray
inoculated, and sprinklers for the root-dip inoculated plants.
Table 2. Species and isolates used for inoculation of plants in glasshouse with root-dip and
foliar spray inoculation methods
F. oxysporum
UoM005
UoM006
UoM0011
UoM0015
UoM0025
F. avenaceum
UoM001
UoM002
UoM0012
UoM0014
UoM0016
F. venenatum
UoM0020
F. equiseti
UoM0022
UoM0023
Bionectria spp.
UoM004
UoM0010
Plectosphaerella sp.
UoM0021
UoM008
Rhizoctonia sp.
UoM0019
U0M009
For foliar inoculation 50 mL of the spore suspension was used to spray the plants with a
hand sprayer. Each pot was then covered with a plastic bag for 24 hr with water
added to each plastic bag to enhance humidity. After 24 hr bags were removed and
pots were maintained in the glasshouse for 2 months.
For root-dip inoculation plants were uprooted from the potting mix and roots were
washed in tap water for 5 min. They were dipped into 200 mL of spore suspension and
were then transplanted into new 10 cm pots filled with potting mix. All pots were
maintained in the glasshouse for a further 2 months. Control plants in both treatment
methods were inoculated with sterile water.
After 2 months, plants from both foliar spray and root-dip inoculation methods were
harvested and roots were washed with tap water for 5 min. Plants were placed in plastic
bags, taken to the laboratory, tissue from the crown of each plant was sectioned and
cultured onto WA and incubated for 3 days at 24 °C. Fungal mycelia were then
subcultured onto PDA and incubated for 5 days for morphological identification. In
order to measure the above and below-ground biomass, plants were packed in paper
bags and placed into an oven at 71 °C for 3 days for dry weight measurement.
50
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Leaf petioles from healthy pyrethrum plants growing in the glasshouse were detached
and transferred to the laboratory in plastic bags. Filter papers were placed inside plastic
containers and sterilised water was added to each container to increase humidity.
Sterilised detached petioles were placed inside the containers (3 replicates each
container) and mycelial plugs from each isolate were set on the petioles. Pure PDA
blocks were used to inoculate control plants. Containers were then incubated for 7 days
at 24 °C.
4.2.4.1 Assessment of glasshouse experiment 1
Detection of the pathogen on pyrethrum leaves
Eleven days after inoculation, senesced and curled leaves were randomly selected from
each replicate of both sprayed and root-dipped plants, surface sterilised and cultured
onto WA. They were incubated at 25°C for 3 days. Fungal mycelia were subcultured
onto PDA and incubated for a further 6 days.
Detection of the pathogen on pyrethrum petioles
Petioles from both sprayed and root-dipped plants were detached (one petiole per
replicate) and transferred to the laboratory in plastic bags. The bottom to the middle
section of the petioles of plants sprayed with spore suspension tissues were surface
sterilised and then sectioned, for culturing on WA and incubated for 5 days at 23°C. For
the plants root-dipped inoculated only tissues from the base of the petiole were
considered for culturing. Hyphae were then subcultured onto PDA and incubated for
another 7 days.
4.2.5. Glasshouse experiment 2
In this experiment, four replicates of healthy pyrethrum plants were inoculated by
dipping the roots in 10⁵ spore/mL spore suspension of the most frequently isolated fungi
in experiment 1: UoM0011 (F. oxysporum), UoM0023 (F. equiseti), UoM0014 (F.
chlamydosporum), UoM0021 (Plectosphaerella sp.). They were then transplanted into
15 cm diameter (1.5 L) pots and maintained in the glasshouse for 4 months. Inoculated
plants were harvested after 4 months and tissues from the leaves, petioles, crowns and
roots were cultured and subcultured onto water agar and PDA respectively. They were
51
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
then placed into paper bags and dried in the oven for three days at 70°C for dry weight
measurement. Results from measuring the dry weight were statistically analysed in a
one-way ANOVA using Statistical Analysis System (SAS) computer package.
4.3. Results
Part A. Isolation and identification of fungal pathogens from yield-decline affected
plants
Symptoms
In the field survey conducted in June 2014, green shoots and leaves were able to grow
in most diseased pyrethrum plants while some plants were unable to regrow and died.
Brown and water soaked lesions were observed on both sides of the leaves. Flower buds
and heads were curved approaching the end of the branched flower stems. Severe crown
discolouration and growth reduction were also observed on the yield-decline affected
plants. Roots were weak and in some cases no feeder roots were observed. In some
cases pseudothecia-like fungal fruiting bodies were observed at the base of the senesced
flower stems.
52
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Fig.1. Symptoms associated with yield-decline of pyrethrum in the fields of northern
Tasmania; A internal crown discolouration; B necrotic leaf spots; C weak root
expansion of the plants; D die back and poor regrowth of a yield-declined
pyrethrum plant. Image D was adapted from Groom (2014)
Isolation and identification of fungal pathogens
Using morphological characters and molecular identification based on ITS gene
sequences, Fusarium spp. (89% of sites, S. tanaceti (ray blight, 89%, Paraphoma sp.
and D. tanaceti (67%, were the most frequently isolated fungi from the nine sites
(Table 3. Alternaria spp., P. cucumerina, R. oryzae-sativa, B. ochroleuca, Stemphylium
sp., Cladosporium sp. and Epicoccum sp. were isolated in lower percentages from
the roots, crowns, petioles and leaves.
53
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Plectosphaerella sp., Bionectria spp. and Rhizoctonia sp. were identified based on ITS
gene sequence and separated from the nine Fusarium species which were tentatively
identified as F. oxysporum, F. avenaceum, F. venenatum and F. equseti (Figures 2-5).
Plectospharella sp., clustered with P. cucumerina species complex (Figure 3).
Bionectria isolate (UoM004) clustered with other Bionectria ochroleuca reference
isolates (Figure 4) and Rhizoctonia clustered with species of R. oryzae-sativae species
complex in ITS phylogenetic trees (Figure 5).
Of the sites where the plants had severe necrosis of the crown tissue (Table 1),
Paraphoma sp. was isolated from sites 47110 and 64209, whereas Fusarium spp. were
isolated from plants in sites 47110, 49301 and 49206 (Table 4). Isolates of F.
oxysporum were mostly isolated from the crown and basal petiole and root tissue and in
lower percentages from the leaves.
Stagonosporopsis tanaceti was isolated from the crown and/or roots of 50% of the
infected plants as well as from the leaf and petiole tissues indicating that S. tanaceti was
the most important pathogen among isolates identified in yield-decline affected sites. In
four fields, the crown tissue, and in one field the root tissue was found to be infected
with the pathogen.
Paraphoma sp. was mostly isolated from the root tissue but in one plant each from the
crown, petiole and leaf tissues. In contrast, D. tanaceti (foliar pathogen) was only
isolated from the leaf or petiole tissues.
Different Fusarium spp. isolates were isolated frequently from the crown and root and
in rare cases from the leaves and petioles of pyrethrum plants in yield-decline affected
sites. In Table 3, isolate UoM0011, F. oxysporum was the most frequent species
identified from root and crown tissue of affected pyrethrum plants from 3 different sites,
and UoM0025 was isolated from 2 sites. Other isolates were isolated from one site only.
54
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Fig.2. Various colony morphologies of isolates recovered from pyrethrum in yielddecline affected sites; A Paraphoma vinacea; B-D F. oxysporum strains (UoM0015,
UoM0011 and UoM005); E-G F. avenaceum morphotypes (UoM002, 12 and 14); H F.
venenatum (UoM0020); I F. equiseti (UoM0023); J-M S. tanaceti morphotypes; N-O
Chladosporium spp.; P D. tanaceti; Q R. oryzae-sativa (UoM0019); R B. ochroleuca
(UoM004); S Stemphylium sp.; T P. cucmerina (UoM0021)
55
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Table 3. Isolates from leaf, petiole, crown and root of pyrethrum plants of northern Tasmania identified based on morphological and ITS gene sequencing
Site No.
47110
46410
74201
64209
49301
76406
49206
49207
86901
Tissue
Root
Crown
Petiole
Leaf
Root
Crown
Petiole
Leaf
Root
Crown
Petiole
Leaf
Root
Crown
Petiole
Leaf
Root
Crown
Petiole
Leaf
Root
Crown
Petiole
Leaf
Root
Crown
Petiole
Leaf
Root
Crown
Petiole
Leaf
Root
Crown
Petiole
Leaf
Isolates distribution
%
56
S.
Fusarium
Paraphoma
tanaceti
spp.
sp.
●
●
●
Didymella tanaceti
Alternaria
spp.
Plectosphaerella
Rhizoctonia
Stemphylium
Cladosporium
Bionectria
Epicoccum
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
89%
●
89%
●
●
67%
67%
33%
44%
44%
22%
22%
11%
11%
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Table 4. Fusarium isolates from different pyrethrum plant tissues in yield decline affected fields of northern Tasmania. The UoM code was given to each isolate to
represent different morphological variations of each species; isolates identified by the PCR of the ITS genes are shown in red
Fusarium strains isolated from different fields
Site
47110
46410
74201
64209
49301
76406
49206
49207
86901
57
Tissue
Root
Crown
Petiole
Leaf
Root
Crown
Petiole
Leaf
Root
Crown
Petiole
Leaf
Root
Crown
Petiole
Leaf
Root
Crown
Petiole
Leaf
Root
Crown
Petiole
Leaf
Root
Crown
Petiole
Leaf
Root
Crown
Petiole
Leaf
Root
Crown
F. oxysporum
UoM005
UoM006
F. avenaceum
UoM0011
●
UoM0015
UoM0025
UoM001
UoM002
UoM0012
UoM0014
UoM0016
F.
venenatum
UoM0020
F. equiseti
UoM0022
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
UoM0023
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Petiole
Leaf
58
●
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Fig.3. One of the three most parsimonious ITS trees (length = 110) is shown. The consistency index (CI)
= 84%, the retention index (RI) = 97% for parsimony-informative sites. The MP tree was obtained using
the Subtree-Pruning-Regrafting (SPR) algorithm. The analysis involved 28 nucleotide sequences. All
positions containing gaps and missing data were eliminated. There were a total of 431 positions in the
final dataset. Evolutionary analyses were conducted in MEGA6 (Tamura et al. 2013b). The tree is rooted
59
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
to F. concolor (O'Donnell et al. 2009a). Maximum likelihood (ML) values are presented under nodes.
K2+G was determined as the best substitution model using MEGA6 (Tamura et al. 2013a). Scale bar
shows the number of changes per site
Fig.4. Maximum Likelihood phylogenetic tree of ITS for Plectosphaerella spp. based on the Tamura-Nei
model (Tamura and Nei 1993). The tree with the highest log likelihood (-1105.9462) is shown. The tree is
drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis
involved 12 nucleotide sequences. All positions containing gaps and missing data were eliminated. There
were a total of 402 positions in the final dataset. Evolutionary analyses were conducted in MEGA6
(Tamura et al. 2013a). The tree was rooted to C. agaves (CBS 318.79) (Carlucci et al. 2012). Isolate
UoM0021, P. cucumerina used in the phylogenetic analysis is highlighted in red. K2+I was determined as
the best substitution model using MEGA6 (Tamura et al. 2013a). Scale bar shows the number of changes
per site
60
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Fig.5. Maximum Likelihood phylogenetic tree of ITS for Bionectria spp. based on the Tamura-Nei model
(Tamura and Nei 1993). The tree with the highest log likelihood (-802.6242) is shown. The tree is drawn
to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 10
nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total
of 376 positions in the final dataset. Evolutionary analyses were conducted in MEGA6 (Tamura et al.
2013a). The tree was rooted to I. japonica (BCC 2821) (Paul et al. 2013). Isolate UoM004, B. ochroleuca
used in the phylogenetic analysis is highlighted in red. K2 was determined as the best substitution model
using MEGA6 (Tamura et al. 2013a). Scale bar shows the number of changes per site
61
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Fig.6. Maximum Likelihood phylogenetic tree of ITS for Rhizoctonia spp. based on the Tamura-Nei
model (Tamura and Nei 1993). The tree with the highest log likelihood (-1587.2715) is shown. The tree is
drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis
involved 15 nucleotide sequences. All positions containing gaps and missing data were eliminated. There
were a total of 376 positions in the final dataset. Evolutionary analyses were conducted in MEGA6
(Tamura et al. 2013a). The tree was rooted to Waitea circinata (IMI 375119) (Johanson et al. 1998).
Isolate UoM0019, R. oryzae-sativa used in the phylogenetic analysis is highlighted in red. HKY+G was
determined as the best substitution model using MEGA6 (Tamura et al. 2013a). Scale bar shows the
number of changes per site
62
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Table 5. List of isolates with related strain numbers for ITS gene sequencing
Genus
Fusarium
63
Isolates
Strain/culture collection No.
Location
Isolate source
ITS Accession No.
F. avenaceum
UoM002; BRIP 64445
Australia- Tasmania
Tanacetum cinerariifoilum, root and crown
KU529152
F. avenaceum
UoM0012; BRIP 64442
Australia- Tasmania
Tanacetum cinerariifoilum, leaf
KU529153
F. avenaceum
UoM0014; BRIP 64443
Australia- Tasmania
Tanacetum cinerariifoilum, crown
KU529154
F. avenaceum
UoM0016; BRIP 64444
Australia- Tasmania
Tanacetum cinerariifoilum, petiole
KU529155
F. avenaceum
NRRL 34036
Colorado
Human ethmoid sinus
GQ505453
F. avenaceum
NRRL 45999
California
Human scalp
GQ505465
F. avenaceum
NRRL 36147
Unknown
Human bronchial secretion
GQ505452
F. avenaceum
NRRL 45994
Texas
Cloaca
GQ505432
F. concolor
NRRL 13459
South Africa
Plant debris
GQ505674
F. culmorum
NRRL 25475
Japan
-
U85543
F. equiseti
UoM0022; BRIP 64447
Tasmania; Australia
Tanacetum cinerariifoilum, crwon
KU529156
F. equiseti
UoM0023; BRIP 64448
Tasmania; Australia
Tanacetum cinerariifoilum, petiole
KU529157
F. equiseti
NRRL 20697
Chile
Beet
GQ505683
F. equiseti
NRRL 26419
Germany
Soil
GQ505688
F. equiseti
NRRL 36136
Unknown
Unknown
GQ505733
F. equiseti
NRRL 26417
Cuba
Leaf litter
GQ505687
F. equiseti
NRRL 28577
Romania
Grave stone
GQ505692
F. equiseti
NRRL 32865
Brazil
Human endocartitis
GQ505703
F. oxysporum
UoM005; BRIP 64449
Tasmania; Australia
Tanacetum cinerariifoilum, root and crown
KU529150
F. oxysporum
UoM0011; BRIP 64441
Tasmania; Australia
Tanacetum cinerariifoilum, root and crown
KU529151
F. oxysporum
NRRL 43539
Missouri
Cornea
DQ790552
F. oxysporum
NRRL 43504
Pennsylvania
Cornea
EF453107
F. oxysporum
NRRL 43466
Ohio
Contact lens case
EF453091
F. oxysporum
NRRL 43521
Florida
Cornea
EF453114
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Plectosphaerella
Bionectria
64
F. oxysporum
NRRL 43668
New Jersey
Cornea
EF453151
F. oxysporum
NRRL 43431
Connecticut
Cornea
DQ790535
F. venenatum
UoM0020; BRIP 64446
Tasmania; Australia
Tanacetum cinerariifoilum, crown
KU529149
F. venenatum
NRRL 22196
England
-
AF006342
P. cucumerina
UoM0021
Australia- Tasmania
Tanacetum cinerariifoilum, root and crown
-
P. cucumerina
Plec 7
Italy
Melon collar
HQ238978
P. cucumerina
Plec 11, CBS 131739
Italy
Melon collar
HQ238980
P. cucumerina
Plec 4
Italy
Melon collar
HQ238977
P. cucumerina
Plec 341
Italy
Tomato root
HQ239002
P. citrullae
Plec 157; CBS 131741
Italy
Watermelon root
HQ238962
P. citullae
Plec 189
Italy
Watermelon root
HQ238964
P. citullae
Plec 151; CBS 131740
Italy
Melon root
HQ238961
P. alismatis
CBS 113362
Italy
Alismata plantago-aquatica
JF780523
P. delsorbi
CBS 116708
Italy
Curcuma alismatifolia
EF543847
P. melonis
Plec 211; CBS 131858
Italy
Melon collar
HQ238695
Colletotrichum agaves
CBS 318.79
Netherlands
Agave
DQ286219
B. ochroleuca
BBA 68698
Germany
Clonostachys rosea
AF106532
B. ochroleuca
ATCC 48395
USA
Clonostachys rosea
GU256754
B. ochroleuca
UoM004
Australia-Tasmania
Tanacetum cinerariifoilum, root and crown
-
B. ochroleuca
RSF_P102
Austria
Clonostachys rosea
HQ115729
B. ochroleuca
OUT 430
Canada
Clonostachys rosea
GU934503
Clonostachys rosea f. catenulata
NRRL 22970
USA
Clonostachys rosea
HM751081
B. ochroleuca
CGA 605-5
Mexico
Clonostachys rosea
DQ279793
B. ochroleuca
wxm12
China
Clonostachys rosea
HM037946
Gliocladium roseum
G97012
China
Clonostachys rosea
AJ309334
Isaria japonica
BCC 2821
Thailand
Isaria japonica
EU828662
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Rhizoctonia
65
R. oryzae-sativae
IMI 375129
Coê te d'Ivoire
Rice
AJ000191
R. oryzae-sativae
IMI 062599
Japan
Rice
AJ000192
R. oryzae-sativae
IMI 375130
Japan
Rice
AJ000193
R. oryzae-sativae
IMI 375133
Japan
Rice
AJ000194
R. oryzae/Waitea circinata
IMI 375119
Japan
Rice
AJ000196
R. solani
IMI 360366
Vietnam
Rice
AJ000199
R. solani
IMI 360038
Coê te d'Ivoire
Rice
AJ000200
R. oryzae-sativae
UoM0019
Australia; Tasmania
Tanacetum cinerariifoilum, root and crown
-
R. oryzae-sativae
C-662
Japan
Soil
AF354092
R. oryzae-sativae
SIR-2
Japan
Soil
AF354092
R. solani
22Rs
Japan
Soil
AF354070
R. solani
W45b3
US
Wheat
AF354111
R. solani
ATCC 66159
US
Soybean
AF354060
R. solani
TE2-4
Japan
Soil
AB000044
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Part B. Pathogenicity of putative fungal species
Experiment 1
Inoculation methods
After 2 months, plants sprayed with Fusarium spore suspension had crown tissues
infected with F. oxysporum (UoM0011, UoM005, UoM0025) and F. avenaceum
(UoM0012). Other isolates were not isolated from different tissues of plants sprayed
with spore suspension (Table 6).
Petioles, crowns and roots of root-dipped pyrethrum plants were infected with F.
oxysporum (UoM0011, UoM005, UoM0025, UoM0015) and Bionectria spp. (UoM004)
after 2 months. Petioles and mostly the crown tissues of plants of all three replicates
inoculated with Paraphoma sp. in both inoculation methods were infected. Crown
discolouration was observed in root-dip inoculated plants.
In the first experiment, visual observation of plants in the glasshouse showed a
difference between the heights of the root-dipped plants and the sprayed plants. Plants
which were root-dipped in spore suspension were slightly shorter than those sprayed.
Seven days after inoculation of the detached petioles with mycelial plugs of all isolates,
tissues from 1 to 4 cm below and above the mycelial plug were infected. Brown and
necrotic lesions appeared under the inoculation point of all three replicates except for
Paraphoma sp. which was not infected.
66
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
Table 6. Isolates identified on different plant tissues after three different inoculation methods. This table
includes all isolates (Fusarium oxysporum, Fusarium avenaceum, Fusarium equiseti, Plectosphaerella
cucumerina, Paraphoma sp. and Bionectria ochroleuca) used in both experiments. The rest were not
reisolated. 1=infection 0=no infection
F. oxysporum
F.
F.
equiseti
avenaceum
P. cucumerina
B.
Paraphoma
ochroleuca
sp.
Inoculation
UoM
UoM
UoM
UoM
UoM
UoM
UoM
UoM
UoM
UoM
UoM
UoM
UMPv
methods
005
006
0011
0015
0025
0023
0014
0012
008
009
0021
004
005
Root-dip
1
0
1
1
1
1
1
0
1
0
1
1
1
Spray
1
0
1
0
1
0
0
1
0
1
0
0
1
1
1
1
1
1
1
1
1
1
1
1
1
0
Mycelial
plug
Assessment of glasshouse trial
Six fungal isolates were obtained from the leaves collected from either sprayed and
root-dipped plants. Plectosphaerella cucumerina (UoM009, UoM0021), F. equiseti
(UoM0023) and F. oxysporum (UoM006), were isolated from the root-dipped plants
and in a few cases P cucumerina and F. oxysporum were isolated from the leaves of the
plants sprayed with spore suspension.
No infection could be found on the petioles of plants sprayed with spore suspension,
while for plants root-dip inoculated, isolates F. oxysporum (UoM0015, UoM0025,
UoM0011), Pcucumerina (UoM009) and F. avenaceum (UoM0014) were isolated from
the basal petioles.
Experiment 2
Plants in the glasshouse inoculated with F. oxysporum (UoM0011) and F. avenaceum
(UoM0014) resulted in infection of crown and basal petiole tissue.
Fusarium
oxysporum was very virulent as it was recovered from the crown and basal petiole
tissue of most of the plants. Fusarium equiseti (UoM0023), P. cucumerina (UoM0021)
67
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
and B. ochroleuca (UoM004) were not isolated from different tissues of the inoculated
plants.
The dry weight of pyrethrum plants in this trial was mostly not significant with only F.
oxysporum and F. equiseti significantly reducing the total biomass. The above-ground
biomass was significantly reduced by F. oxysporum and P. cucumerina. Table 7 shows
the effect of each isolate on the mean dry weight of inoculated plants and the least
significant difference (LSD) of three different groups of dry weights (above, below and
total).
Table 7. A comparison of the dry weight of pyrethrum plants inoculated with Fusarium
oxysporum, Fusarium avenaceum, Fusarium equiseti, Plectospherella cucumerina comparing least
significant difference of the means (LSD test). Means with different letters in each row are significantly
different
Dry weight (g
Total
Above-ground
Below-ground
Control
F. oxysporum
F. avenaceum
P. cucumerina
F. equiseti
LSD
12.02a
9.31b
10.24ab
9.44ab
8.50b
2.6
6.76a
5.18ab
5.36ab
4.66b
4.13b
1.7
5.26a
4.13a
4.89a
4.78a
4.37a
1.2
4.4. Discussion
Part A
Isolation and identification of fungal pathogens
The sample collection in June 2014 from the yield-decline affected fields of northern
Tasmania showed that S. tanaceti and Fusarium spp. were the most frequent fungal
pathogens isolated from the leaf, basal petiole, crown and root tissues as 89% of the
fields were infected with each pathogen. Stagonosporopsis tanaceti remained the most
frequently isolated species recovered mostly from the leaf and petiole tissues with less
isolation frequency from the infected crown and roots. Fusarium oxysporum and F.
avenaceum isolated from basal petioles, crowns and root tissues were found to be the
most prevalent pathogens compared to F. venenatum and F. equiseti. Parsaphoma spp.
68
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
were also frequently isolated from the discoloured crown and root tissues. Similar
isolation rate was observed from infected leaf and petiole tissues with D. tanaceti.
Diseases caused by Fusarium are cosmopolitan. Many species are pathogenic and
cause intensive vascular wilts of cash crops in the world. Some populations are initially
endophytes and become pathogens later in their life cycle and some are saprophytes
living on dead material (Laurence et al. 2011). However, determination of their
ecological role is not simple as their life cycle can change by either biotic or abiotic
stresses (Laurence et al. 2011). The reason for Fusarium species being hard to identify
is that they vary widely in morphological and non-morphological characteristics
such as virulence and this criteria are used in taxonomic systems (Windles 1991).
Molecular and phylogenetic studies have effectively improved identification of
Fusarium isolates to species level. Pethybridge et al. (2008d), reported that
Fusarium diseases were exacerbated in waterlogged soils with lower capability of
drainage and nematodes. Fusarium infection is highly related to temperature changes
(Mandeel et al. 1995;
Sangalang et al. 1995). Tasmania possesses cold and wet
winters following dry summers. A long wet period, would most likely, make
pyrethrum plants vulnerable to a range of fungal pathogens such as Fusarium wilt
and root rot. Fusarium spp. and Paraphoma sp. were often associated with root and
crown diseases (De Gruyter et al. 2013; Laurence et al. 2011) whereas S. tanaceti and
D. tanaceti were known as foliar pathogens.
Plectosphaerella cucumerina and Rhizoctonia oryzae-sativa had similar infection rate
of 44% and were not found to be associated with growth reduction in
glasshouse experiments. Bionectria ochroleuca was also found to be non-pathogenic to
pyrethrum. Alternaria sp., Stemphylium sp. and Epicaccum sp. were the least
frequently isolated. Plectosphaerella
spp.
are
known
as
pathogens
causing
root and collar rot. Colletotrichum tanaceti was not isolated from any of the
sites which may have been related to the season, as this pathogen is favoured by
cool and moist environments (Barimani et al. 2013). With the exception of A.
tenuissima and C. tanaceti, these less frequently isolated fungi have not been
recorded as important plant pathogens of pyrethrum and are generally regarded as
opportunistic pathogens in a range of plant species (Pethybridge et al. 2004).
69
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
This was the first report of S. tanaceti isolated from infected crown and roots of
pyrethrum plants and this may have serious implications in the management of the
disease. Previously, the pathogen was identified on leaves and petioles of pyrethrum
plants and these plant tissues were targeted for application of fungicides to control the
disease (Pethybridge et al. 2008d). Leaves of pyrethrum plants have a dense layer of
trichomes that repels moisture thus in the field, splash dispersal of spores onto leaves
most likely resulted in spores being washed down the petioles into the crown tissue.
However, previous reports showed no infection of crown and root with S. tanaceti on
pyrethrum. More investigations need to be implemented to determine the role of S.
tanaceti in crown and root infection of pyrethrum plants and especially the interaction
of S. tanaceti with environmental stresses.
Part B
Experiment 1
Root-dip inoculation method seemed to be a more appropriate method for establishing
infection than foliar spraying as the number of isolates recovered from root-dip
inoculated plants was more than for the foliar sprayed plants. This was probably a result
of the roots being damaged (wounded) during the root-dip inoculation method hence,
being more conducive to infection.
The experiment was optimised with the plants receiving water with the same irrigation
system. Inoculation of detached petioles with mycelial plugs might be more precise if
petioles were incubated for a shorter period of time (3-4 days) as the tissue under the
mycelial plug was less colonised.
Plants inoculated with root-dip method were more likely to be infected with the same
Fusarium isolate that was used for the initial inoculation. As Fusarium is a soil-borne
pathogen, root-dip inoculation method was more appropriate than spraying method to
establish infection.
Experiment 2
None of these isolates had effect on below-ground dry weights. However, F. oxysporum
had a significant reduction in below-ground and total biomass and was isolated from the
70
Chapter 4: Fungi isolated and identified from the yield-decline affected pyrethrum
crown and in lower percentages from the petiole tissues of most pyrethrum plants,
especially those plants which were inoculated using the root-dip technique. Although
the effect of F. equiseti and P. cucmerina on total and above-ground dry weights was
statistically significant, these isolates were not isolated from any of the plant tissues.
This growth reduction might have been related to the low number of replicates. More
number of replicates need to be included in the trial to reduce variability between
replicates and obtain the exact effect of each isolate on the dry weight of plants.
Fluctuating glasshouse environmental conditions may have also played a role in the
significant differences in dry weights.
4.5. Conclusion
Fusarium oxysporum (isolates UoM005, UoM0011, UoM25, UoM15 and UoM006)
were frequently isolated from different plant tissues especially with the plants rootdipped in spore suspension. Fusarium equiseti (UoM0023) and P. cucumerina
(UoM0021, UoM008 and UoM009) were also frequently isolated from the root and
crown tissues of pyrethrum plants inoculated by root-dip method. Bionectria ochroleuca
(UoM004) was rarely isolated from the crown and root tissue of the root-dipped plants.
Fusarium avenaceum (UoM0012) was also found to infect plants sprayed with spore
suspension. After the dry weight measurement, only F. oxysporum was found to be
pathogenic as there were effects on the total biomass of pyrethrum plants. Also
pathogenicity was proved as the pathogen was reisolated from the crown and basal
petioles of plants in experiment 2. All plants which were inoculated with mycelial plugs
were found infected.
Consistency in isolation of F. oxysporum, F. avenaceum, and Paraphoma sp. showed
that more studies needed to be focused on pathogenicity tests along with phylogenetic
studies of these three important pathogens.
71
Chapter 5: Alternaria infectoria and Stemphylium herbarum
Chapter 5
Alternaria infectoria and Stemphylium herbarum, two new
pathogens of pyrethrum (Tanacetum cinerariifolium) in
Australia
5.1. Introduction and aims
During the 2014, 2015 and 2016 field surveys in Tasmania, various fungal fruiting
structures were observed at the base of dead flower stems of pyrethrum plants showing
yield-decline symptoms. Spores from black pycnidia were mono-celled, oval and
hyaline similar to S. tanaceti and Paraphoma sp (Vaghefi et al. 2012; Moslemi et al.
2016). In some cases spores were gray-olivaceous, oval and two celled which were
more likely to be related to Didymella sp. (Pethybridge et al. 2008c). Pseudothecia with
were also identified from the base of the dead flower stems with asci containing eight,
multi-celled ascospore. The ascospores and pseudothecia were morphologically similar
to species in the Pleosporales such as Alternaria and Stemphylium which had
previously been reported on necrotic leaves of pyrethrum (Pethybridge et al. 2004).
Section 5.2. presents the published manuscript that identified the fungal species
associated with pseudothecia at the base of the dead pyrethrum flower stems and
determined the pathogenicity of these species to pyrethrum.
72
Chapter 5: Alternaria infectoria and Stemphylium herbarum
5.2. Published manuscript
73
Chapter 5: Alternaria infectoria and Stemphylium herbarum
74
Chapter 5: Alternaria infectoria and Stemphylium herbarum
75
Chapter 5: Alternaria infectoria and Stemphylium herbarum
76
Chapter 5: Alternaria infectoria and Stemphylium herbarum
77
Chapter 5: Alternaria infectoria and Stemphylium herbarum
78
Chapter 5: Alternaria infectoria and Stemphylium herbarum
79
Chapter 5: Alternaria infectoria and Stemphylium herbarum
80
Chapter 5: Alternaria infectoria and Stemphylium herbarum
81
Chapter 5: Alternaria infectoria and Stemphylium herbarum
82
Chapter 5: Alternaria infectoria and Stemphylium herbarum
5.3. Corrections to the manuscript
The terminology for the sexual fruiting structures of A. infectoria and S. herbarum were
incorrectly written as perithecia. Since these fungi are Dothideomycetes, they produce
pseudothecia.
83
Chapter 6: Paraphoma vinacea, the causal agent of pyrethrum crown rot
Chapter 6
Paraphoma
crown
rot
of
pyrethrum
(Tanacetum
cinerariifolium)
6.1. Introduction and aims
The identification of many foliar pathogens associated with diseases of pyrethrum has
been reported (Pethybridge et al. 2004; Vaghefi et al. 2012; Barimani et al. 2013; Pearce
et al. 2015). Some of these pathogens such as S. tanaceti and D. tanaceti cause
significant yield-loss annually and some, although severe, are not yield limiting such as
C. tanaceti or A. tenuissima. However, very few studies have focused on soil-borne
diseases of pyrethrum and their association with yield-decline. Many pyrethrum plants
from yield-decline affected sites in northern Tasmania have necrotic crown tissues,
suppressed growth and weak root system. A Paraphoma sp. has been amongst the most
prevalent pathogens recovered from the discoloured crown and root tissues of yielddecline affected pyrethrum plants however, taxonomy of this Paraphoma sp. has not
been addressed.
Section 6.2. presents the published manuscript that identified the Paraphoma species
associated with crown rot of pyrethrum and assessed its pathogenicity on pyrethrum.
84
Chapter 6: Paraphoma vinacea, the causal agent of pyrethrum crown rot
6.2. Published manuscript
85
Chapter 6: Paraphoma vinacea, the causal agent of pyrethrum crown rot
86
Chapter 6: Paraphoma vinacea, the causal agent of pyrethrum crown rot
87
Chapter 6: Paraphoma vinacea, the causal agent of pyrethrum crown rot
88
Chapter 6: Paraphoma vinacea, the causal agent of pyrethrum crown rot
89
Chapter 6: Paraphoma vinacea, the causal agent of pyrethrum crown rot
90
Chapter 6: Paraphoma vinacea, the causal agent of pyrethrum crown rot
91
Chapter 7: P. chlamydocopiosa and P. pye
Chapter 7
Paraphoma chlamydocopiosa sp. nov. and Paraphoma pye sp.
nov., two new species associated with leaf and crown infection
of pyrethrum
7.1. Introduction and aims
Paraphoma species, usually associated with crown rot of pyrethrum (P. vinacea,
Moslemi et al. 2016) were also isolated from necrotic leaf lesions on pyrethrum plants
in yield-decline affected fields of Table Cape, Tasmania. Most species of Paraphoma
have been reported as soil-borne pathogens isolated from crown and root tissues of a
range of plant species of different hosts including plants in the Asteraceae, Rosaceae,
Cupressaceae, Solanaceae, Amarylidaceae and Iridaceae (Boerema et al. 2004).
Section 7.2. presents the published manuscript that taxonomically described two new
Paraphoma species that caused foliar infection of pyrethrum, and assessed the
pathogenicity of these species as foliar and crown rot pathogens. This manuscript also
revised the taxonomy of the Paraphoma species from Australia and overseas that
infected a broad range of host species.
92
Chapter 7: P. chlamydocopiosa and P. pye
7.2. Published manuscript
93
Chapter 7: P. chlamydocopiosa and P. pye
94
Chapter 7: P. chlamydocopiosa and P. pye
95
Chapter 7: P. chlamydocopiosa and P. pye
96
Chapter 7: P. chlamydocopiosa and P. pye
97
Chapter 7: P. chlamydocopiosa and P. pye
98
Chapter 7: P. chlamydocopiosa and P. pye
99
Chapter 7: P. chlamydocopiosa and P. pye
100
Chapter 7: P. chlamydocopiosa and P. pye
101
Chapter 7: P. chlamydocopiosa and P. pye
102
Chapter 7: P. chlamydocopiosa and P. pye
103
Chapter 7: P. chlamydocopiosa and P. pye
104
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
Chapter 8
Fusarium oxysporum and Fusarium avenaceum associated
with yield-decline of pyrethrum in Australia
8.1. Introduction and aims
Infection of pyrethrum plants by Fusarium oxysporum has been reported in pyrethrum
fields of Kenya where the causal agent produced damping-off and wilt of the infected
plants (Pethybridge et al. 2008d). Fusarium oxysporum has never been reported as a
pathogen of pyrethrum in Australia.
During field collections from pyrethrum yield-decline affected fields of northern
Tasmania and Ballarat region of Victoria, Fusarium spp. appeared to be one of the most
prevalent pathogens isolated from pyrethrum crown and root tissues. Infected plants
often had crown chlorosis and necrosis followed by a pink discolouration at the end of
the flower stems and inside the crown.
Section 8.2. presents the published manuscript that assessed the pathogenicity of
Fusarium oxysporum and F. avenaceum that caused root and crown rot of pyrethrum.
Multigene phylogenetic analysis was used to identify isolates of both Fusarium spp.
isolated from infected root and crown tissues of yield-decline affected pyrethrum plants.
Section 8.3. reports the results of an additional field survey in 2016 to confirm the
incidence of Fusarium and Paraphoma species associated with pyrethrum yield-decline,
and to determine the distribution of each species in various geographical locations of
Tasmania and Victoria. Section 8.4. investigates the mode of infection and colonisation
of F. oxysporum in pyrethrum.
105
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
8.2. Published manuscript
106
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
107
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
108
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
109
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
110
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
z
111
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
112
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
113
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
114
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
115
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
116
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
117
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
118
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
119
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
8.3. Additional field survey in 2016
Consistency in isolation of a specific pathogen associated with a disease from different
geographical regions confirms the importance of this pathogen in causing the disease. A
further survey and sample collection from the yield-decline affected fields of northern
Tasmania was carried out in September 2016 to confirm the presence of Fusarium spp.
and Paraphoma sp. in yield-decline affected plants.
Materials and Methods
Sample collection was carried out in five fields located in Burnie, northern Tasmania.
Seven plants from each field were collected and transferred to the University of
Melbourne. Isolation and identification of the fungal pathogens from different tissues of
the yield-declined affected pyrethrum plants including upper root, basal petiole, crown
and leaf tissues were carried out according to Moslemi et al. (2017b).
Results and Discussion
Crown discolouration was observed in plants at all sites. At sites 69511 and 63907 F.
oxysporum was isolated from the infected roots and crowns. Root rot was also observed
in some plants (Fig. 2). Fusarium oxysporum was isolated from approximately 75% of
the plants at each site which had crown infection and from 43% of plants which had
root infection. Fusarium avencaeum was isolated from 35% of the plants with crown
infection and 18% with root infection. Fusarium avenaceum was not isolated from
infected roots at site 63907. There were a few cases of F. avenaceum being isolated
from basal petioles and in some cases there was no infection with F. oxysporum.
Fusarium venenatum was only isolated from the crown tissue of one plant at each site
83005 and 51804, and two plants at site 63907.
There was one case of root infection with S. tanaceti at site 83005 and two cases of
crown infection at sites 69309 and 51804. Leaves and basal petioles of most of the
plants were infected with S. tanaceti and D. tanaceti. Paraphoma vinacea and P.
chlamydocopiosa were isolated from the roots of the plants at site 61511. Crown tissue
of the plants at sites 83005, 51804 and 61511 were infected with P. vinacea. There was
one case of crown infection with P. chlamydocopiosa at site 51804 (Table 7).
120
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
Fig.2. Symptoms of yield-decline in pyrethrum plant in northern Tasmania, September
2016. Severe crown discolouration and root rot caused by a complex of Fusarium
oxysporum, F. avenaceum and Paraphoma vinacea
121
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
Table 7. Isolation of pathogens from crown, root, petiole and leaf tissues from a sample collection in
September 2016 from pyrethrum yield-decline affected fields of Burnie, northern Tasmania. Site numbers
and tissues infected with Fusarium spp., Paraphoma spp., S. tanaceti and D. tanaceti are shown.
Site
83005
(crown
discolouration)
69309
(crown
discolouration)
Replicates
Root
Crown
Petiole
Leaf
1
F. oxysporum
F. oxysporum- F. avenaceum
S. tanaceti
S. tanaceti
2
S. tanaceti
P. vinacea
D. tanaceti
3
F. oxysporum
F. oxysporum. F. avenaceum
S. tanaceti
4
F. oxysporum
F. avenaceum- P. vinacea
S. tanaceti
tanaceti
tanaceti
F. oxysporum- F. avenaceum
S. tanaceti
S. tanaceti
F. oxysporum- F. avenaceum
S. tanaceti
S. tanaceti
F. oxysporum
S. tanaceti
S. tanaceti
Rhizoctonia sp.
D. tanaceti
7
1
F. avenaceum
2
F. oxysporum
3
F. oxysporum
2
F. oxysporum (no
discolouration)
S. tanaceti
F. oxysporum
4
1
F. oxysporum
F. oxysporum
S.
S. tanaceti
tanaceti
F. oxysporum
F. avenaceum
Phytophthora
sp.
P. chlamydocopisa
F. avenaceum
F. venenatum- P. vinacea
4
F. oxysporum- S. tanaceti
5
6
F. oxysporum
S. tanaceti
F. oxysporum- F. avenaceum-
3
7
122
F. avenaceum- D.
6
7
discolouration)
S. tanaceti- D.
F. oxysporum- F. avenaceum
6
(crown
P. vinacea
5
5
51804
F. oxysporum- F. venenatum-
tanaceti-
S. tanaceti
F. avenaceum- P.
vinacea
S.
tanaceti-
P.
vinacea
F. avenaceum
S. tanaceti
F. avenaceum
F. avenaceum
S. tanaceti
F. oxysporum- P. vinacea
S. tanaceti
F. avenaceum
F. oxysporum
P. vinacea
S. tanaceti
D.
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
63907
1
F. oxysporum- F. avenaceum
2
F. oxysporum
3
F. oxysporum
4
F. oxysporum
5
F. avenaceum
(crown
discolouration
and root rot)
6
7
F. oxysporumF. avenaceum
F. oxysporum
3
61511
(crown
discolouration
and root rot)
F. oxysporumP. vinacea
F. avenaceum
F. avenaceum- F.
venenatum
F. oxysporum- F. avenaceum
F. oxysporum- F. venenatum
F. avenaceum
S.
tanaceti-
P. vinacea
S. tanaceti
S. tanaceti
F. oxysporum
chlamydocopi
F. oxysporum
S.
tanaceti-
tanaceti
F. oxysporum
8.4. The mode of infection and colonisation by F. oxysporum in pyrethrum
In many plant species F. oxysporum particularly the vascular wilt form species, are able
to block the xylem tissue and prevent flow of sap and water within the xylem. Infection
of roots of susceptible plants occurs by direct penetration by hyphae originating from
chlamydospores under favourable environmental conditions (Di Pietro et al. 2003).
Hyphae penetrate the epidermal cells and grow intracellular until infecting the vascular
tissue. They then block the xylem vessels by means of microconidia production, and
wilting occurs due to lack of root ability to transfer water within xylem (Di Pietro et al.
2003).
123
D.
tanaceti
S. tanaceti
osa
7
F. avenaceum
F. oxysporum
Paraphoma
6
S. tanaceti
F. oxysporum
F. oxysporum- P. vinacea
4
5
S. tanaceti
discolouration)
F. oxysporum- P. vinacea
1
2
F. oxysporum (no
D.
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
Although the pathogenicity of F. oxysporum was reported by Moslemi et al. (2017b) in
chapter 7, the mode of infection and colonisation was not determined.
Materials and Methods
Pyrethrum plants of cultivar Pyrate were received from Tasmania, planted into new pots
and maintained in the glasshouse as described in section 8.2. Three replicates of each
treatment involved plants being inoculated by the root-dip method at 10⁵ spores/mL of a
spore suspension of F. oxysporum. Controls were root-dipped in sterile water.
Plants were left in the glasshouse for two months to establish infection and tissue
colonisation by F. oxysporum. One cm pieces of each root, crown and basal petiole
tissues were cut in order to obtain two 0.5 cm pieces. One piece of each tissue was
cultured on WA and then fungal mycelium was transferred to PDA to determine
infection, and the other section was transferred into a 1.5 mL Eppendorf
microcentrifuge tube (Eppendorf, Australia) containing FAA and incubated for 7 days.
Tissues assessed on PDA as being infected, were selected for microtome sectioning as
described in Chapter 3.
Results and Discussion
High incidence of root and crown infection with F. oxysporum was observed in all the
three replicates. No infection of the controls was observed. Fungal hyphae of F.
oxysporum were observed in infected plant tissues in large and small xylem vessels with
the surrounding cells infected (Fig. 3). There was no infection of phloem or vascular
cambium. Pyrethrum plants showed infection of xylem vessels two months after rootdip inoculation however, there was no noticeable visual wilt symptoms on the plants
probably because the xylem vessels were not heavily colonised, thus not blocking water
movement in the xylem. Perhaps 2 months was too a short period of time for severe
colonisation of xylem and thus for disease symptoms to appear. Nevertheless, the plants
were susceptible to infection by F. oxysporum as shown by the high incidence of tissue
infection.
Accurate identification of Fusarium formae speciales is necessary for developing
management strategies and resistant breeding schemes (Bogale et al. 2007). Form
124
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
species (formae speciales) of F. oxysporum have been identified by molecular markers
such as restriction fragment length polymorphism (RFLP), amplified fragment length
polymorphism (AFLP), simple sequence repeat (SSR), random amplified polymorphic
DNAs (RAPD), and PCR-RFLP approaches using F. oxysporum specific primers
(Belabid et al. 2004; Bogale et al. 2006; Bogale et al. 2007). However, cross-host
pathogenicity tests and histological studies can also confirm the specificity or formae
specialis of Fusarium spp.
In this chapter, Fusarium spp. isolated from different tissues of yield-decline affected
fields of northern Tasmania were identified as mostly F. oxysporum and F. avenaceum
with F. oxysporum being more pathogenic to pyrethrum than F. avenaceum. These
pathogens along with P. vinacea were confirmed to be associated with yield-decline
affected plants. Since,F. oxysporum was shown to be infecting xylem vessels in the
crown tissue, it is likely to be a formae specialis of pyrethrum. However, cross-host
pathogenicity assays need to be conducted on a range of plant species related to
pyrethrum to confirm formae specialis.
125
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
Fig.3. Transverse and longitudinal microtome sections obtained from root and crown
tissues infected with F. oxysporum two months after inoculation using quadruple
126
Chapter 8: Pathogenicity of Fusarium spp. to pyrethrum
staining method. A-B accumulation of hyphae in xylem, root longitudinal section; C
crown longitudinal section showing the growing hyphae in xylem; D-F transverse
sections of an infected crown with hyphae in xylem; G crown transverse sections
clearly showing hyphae in parenchyma cells. See arrows. ×100 magnification (20 µm)
127
Chapter 9: Effect of waterlogging on pyrethrum growth
Chapter 9
Influence of waterlogging on growth of pyrethrum plants infected with
crown and root rot pathogens - Fusarium oxysporum, Fusarium
avenaceum and Paraphoma vinacea
9.1. Introduction
Pyrethrum yield-decline was recently identified where plants failed to regrow after first
harvest or yield reduction occurred after the second harvesting season (Moslemi et al.
2017b). Poor persistence or yield-decline has no obvious single cause and has been
attributed to interaction between various crown and root rot pathogens and abiotic
stresses (Moslemi et al. 2017b).
Plants affected by yield-decline exhibited severe discolouration of crown tissues,
reduced root growth and stunting (Moslemi et al. 2017b). The fungal pathogens
Paraphoma vinacea, Fusarium oxysporum and F. avenaceum were found to be
associated with these affected plants and have been shown to affect plant growth
(Moslemi et al. 2016;
Moslemi et al. 2017b). Foliar pathogens such as
Stagonosporopsis tanaceti and Didymella tanaceti (Pearce et al. 2015; Vaghefi et al.
2015) have also been observed in the yield-declined plants. Recently Bhuiyan et al.
(2016) showed that S. tanaceti infection reduced plant vigour causing poor regrowth
after harvest which suggested that S. tanaceti may be one of the causes of yield-decline.
Alternaria infectoria and Stemphylium herbarum were also isolated from the bases of
dead flower stems in yield-decline affected fields in northern Tasmania and may also
contribute to the complex pathology of yield-decline syndrome (Moslemi et al. 2017a).
According to Pethybridge et al. (2010), various abiotic factors such as soil compaction
and cutting height also contributed to poor regrowth of pyrethrum plants. Previous
studies attempting to improve production of pyrethrum have focused on soil fertility
(Salardini et al. 1994b, a), weed competition (Rawnsley et al. 2007a; Rawnsley et al.
2006a) and waterlogging (Javid et al. 2013), as well as plant pathogens (Jones et al.
2007; Pethybridge et al. 2008d). Identification of pathogens to which the crops are
128
Chapter 9: Effect of waterlogging on pyrethrum growth
susceptible and developing pathogen management strategies should reduce sensitivity of
crops to environmental stresses.
Waterlogging is an important abiotic factor having a significant role in pyrethrum yield
reduction and a negative effect on flower and pyrethrin production. Developing
molecular strategies to produce waterlogging-resistant genotypes (Dennis et al. 2000),
planting crops on graded surfaces to reduce water accumulation and avoiding long-term
irrigations after a waterlogging period (Setter and Waters 2003) can help reduce the
exposure of the plants to prolonged waterlogging in field conditions.
Javid et al. (2013) subjected pyrethrum plants to a 6-day waterlogging period followed
by inoculation with S. tanaceti and found that the combination of stresses affected root
expansion and dry weight. The number of stems per plant in the combined treatment
decreased within 3 months. This synergistic effect may have been due to the abiotic
stress predisposing the plants to more severe infection. Bradford (1983) showed that
waterlogged tomato plants were more susceptible to a range of fungal diseases by a
change in the nutritional balance and increased humidity and temperature in the canopy
of the stressed plants.
Javid et al. (2013) reported that waterlogging affected cytokinin production, a
phytohormone vital for root expansion, in root tips and shoots of the waterlogged
pyrethrum plants. Suraweera et al. (2015b) showed that a water deficit treatment
significantly reduced flower production and pyrethrin content of the pyrethrum flowers.
Since pyrethrum crops are subjected to regular waterlogging, and crown and root rot
pathogens are prevalent in field plants, further studies should focus on the interaction
between biotic and abiotic stresses and the effect on plant growth and development.
Hence, the aim of this study was to assess the effect a 4-day period of waterlogging on
growth and flower production of pyrethrum plants infected with the crown and root rot
pathogens F. oxysporum, F. avenaceum and P. vinacea.
9.2. Materials and Methods
Ten-week-old pyrethrum seedlings of cultivar Pyrate were germinated from steam
sterilised seeds and raised in seedling mix, then 250 seedlings were individually
transferred to 20 cm diam (2.8 L) pots with potting mix (Debco, Victoria, Australia) and
fertilized with 5 g of Osmocote Plus (Scotts Australia Pty. Ltd.) per pot. Seedlings were
129
Chapter 9: Effect of waterlogging on pyrethrum growth
maintained in a glasshouse for two months at 25–27 °C under natural light and
Osmocote Plus was applied to the plants once a month.
Two separate glasshouse experiments were conducted to assess the effect of
waterlogging on infected pyrethrum plants. The first experiment involved seedlings
being inoculated with F. oxysporum and F. avenaceum. The second experiment
involved inoculation with P. vinacea. Drip irrigation was used to water the plants to
minimize cross infection by water splash.
Fifty plants per treatment were inoculated by immersing the roots of plants in 10
spore/mL spore suspension of each pathogen as described in Moslemi et al. (2017b).
Controls were identically treated but with sterilised water. Plants were maintained in the
glasshouse for two months before a waterlogging treatment was applied. To assess the
effect of the pathogens, waterlogging and their interaction plants were sampled at three
different time intervals: two months after inoculation (four-month-old plants, prewaterlogging stage - 0 bw,); two months after the waterlogging treatment (rosette stage,
four months after inoculation – 2 maw); and six months after waterlogging (flowering
stage, eight months after inoculation – 6 maw).
9.2.1. Waterlogging treatment
Of the 40 root-dip inoculated plants remaining after undertaking the first harvest in each
treatment, 20 were subjected to a 4-day-waterlogging treatment and the other 20 were
non-waterlogged. Pots to be waterlogged were placed individually in 16 L plastic
buckets. Buckets were then filled with water until the water level reached the surface of
the soil. Buckets were then left on the bench in the glasshouse for four days. During the
waterlogging period O₂ concentration was measured for each pot daily to assess the
depletion of O2 using a dissolved oxygen meter (model HI 9147, Hanna® instruments,
USA). This was done by immersing the O₂ electrode in water inside the 16 L buckets
and waiting until the O₂ levels stabilized. Water temperature was maintained at 22-24°C
at all times. O₂ concentration dropped gradually but significantly from day 0 to 3 (Fig.
1).
130
Chapter 9: Effect of waterlogging on pyrethrum growth
7
6
O co ce tratio
g/L
5
4
5.77
5.44
4.77
4.67
4.65
5.59
5.38
2.83
3
4.57
3.56
3.08
3.53
3.06
2.55
5.42
4.46
3.31
3.21
2.35
1.93
2
1
0
Control F
F. ox
F. aven
Control P
P. vin
Days
d0
d1
d2
d3
Fig.1. O₂ concentration (mg/L) measured for 20 plants per treatment from day 0 to 3;
means were calculated for 20 plants/day. F= Fusarium, P= Paraphoma, F. ox= F.
oxysporum, F. aven= F. avenaceum, P. vin= P. vinacea. Capped lines show +/- standard
error of the mean (n=20)
Waterlogging treatment was stopped after 4 days with the onset of wilting of the new
petioles and leaves, leaf chlorosis and necrosis. Pots were removed from the buckets
and allowed to drain, then all plants were maintained in the glasshouse as described
before. Symptoms caused by waterlogging treatment were also checked daily. A stress
severity class of 0 to 4 was attributed to each plant. Stress severity was assessed 7 days
after waterlogging by assessing the degree of necrosis and chlorosis of the lower leaves
and petioles (Table 1).
131
Chapter 9: Effect of waterlogging on pyrethrum growth
Table 1. Post-waterlogging stress severity class of plants inoculated with Fusarium
oxsyporum, Fusarium avenaceum, and Paraphoma vinacea, 7 days after waterlogging
Stress class
Description
0
Healthy looking plants showing no wilt, chlorosis or necrosis
1
2
Plants begin showing necrosis and chlorosis of the lower leaves and petioles, moderate
wilting
Wilting of the newly immerged petioles and leaves, chlorosis and necrosis of the lower
leaves and petioles
3
Severe wilt, chlorosis and necrosis of the young and senesced leaves, shoots and petioles
4
Plants wilted and died
9.2.2. Two months after inoculation, pre-waterlogging (0 bw): incidence of
infection and effect of F. oxysporum, F. avenaceum and P. vinacea on growth of
inoculated pyrethrum plants
Two months after root-dip inoculation, 10 plants were randomly sampled from
each treatment. Roots were washed for 5 minutes under the tap water to remove excess
soil. Thereafter, 0.5 cm pieces of the upper roots, crowns, basal petiole, and leaves
were surface sterilised with 80% ethanol for 30 sec, 1.5% (ai) sodium hypochlorite for 1
min and rinsed two times in sterile water each for 1 min. They were then blotted
on a sterilised paper towel, cultured onto water agar (WA) and fungal hyphae
cultured onto potato dextrose agar (PDA) for isolate identification. Plates were
incubated under a light regime of 12h light/12h dark at 23-25° C for 3-4 days for
plants inoculated with Fusarium spp. (Burgess and Summerell 1992), and in the dark
with similar temperature and incubation condition as described by Boerema et al.
(2004) for those inoculated with P. vinacea.
132
Chapter 9: Effect of waterlogging on pyrethrum growth
9.2.3. Two months after waterlogging, (2 maw): effect of waterlogging alone
and in combination with infection by each of the pathogens on disease
incidence, growth and photosynthesis of pyrethrum plants
The effect of waterlogging on growth alone and combined with prior infection by each
of F. oxysporum, F. avenaceum and P. vinacea was assessed 2 months after
waterlogging when the plants were at the rosette stage. By this time waterlogged plants
had partly recovered and had new shoots and young leaves emerging from the crown.
Twenty plants, including 10 waterlogged and 10 non-waterlogged from each infection
treatment were randomly sampled.
Roots were washed gently under tap water and tissues from the upper roots, crowns,
basal petiole and leaves were cultured on WA and then fungal hyphae was subcultured
onto PDA as described. Dry weight was measured for individual plants after drying in
an oven for 3 days at 71°C. The effect of waterlogging and F. oxysporum, F. avenaceum
and P. vinacea on photosynthesis rate was also assessed on these plants before they
were destructively sampled as described.
Photosynthesis rate was measured using a LI-COR® portable photosynthesis system
(LI-6400, LI-COR, Lincoln, Nebraska, USA) and with measuring the uptake of CO2
method. This was carried out using an IRGA (Infra-Red Gas Analyzer) which compared
the CO2 concentration in gas entering and leaving a chamber in which the leaf was
enclosed. Leaf areas were measured by capturing images using a Nikon Coolpix A100
compact camera (Digidirect, Australia) and analysing with MATLAB (MathWorks®
R2016a) image analysis software and photosynthesis rate was calculated per cm² leaf
area.
9.2.4. Six months after waterlogging (6 maw): effect of waterlogging alone and
in combination with infection by each of the pathogens on disease incidence,
growth of pyrethrum plants and on flowering
Two months after waterlogging (i.e. 4 months after inoculation) the remaining plants
including 20 plants per infection treatment (10 waterlogged and 10 non-waterlogged)
were moved outside of the glasshouse for vernalisation to induce flowering and
133
Chapter 9: Effect of waterlogging on pyrethrum growth
maintained there for 4 months. At 6 months after waterlogging each plant was assessed
for the number of flowers and flower stems, petioles, green and yellow leaves, then
destructively sampled to assess disease incidence and dry weights similar to the
previous samplings. Leaf tissues were not cultured at this time as no leaf infection had
been found in the previous samplings but flower stem bases were sampled.
In each experiment above-ground, below-ground and total biomass were measured and
results were analysed using SAS V.9.4. Data from both experiments were analysed to a
completely randomised design. Dry weight data were analysed at 0 bw, 2 maw and 6
maw; and for the flowering parameters 6 maw. The GLM procedure was used in a 2way ANOVA for analysis of both experiments using pathogen and waterlogging
treatments as independent variables in different time periods.
Data from plants that were inoculated but could not be confirmed to have been infected
successfully were eliminated from the analyses using time and pathogen treatments as
independent variables. Data were log transformed to improve residuals distribution.
9.3. Results
9.3.1. Disease incidence
Disease incidence was compared in infected plants at 0 bw (pre-waterlogging) and at 2
and 6 maw. At 2 mai, 100% of sampled plants inoculated with F. oxysporum had
infection of the upper root and crown tissues while 80% had infection of the basal
petioles. Of the 10 plants inoculated with F. avenaceum 70% were infected with four
plants having upper root infection, four crown infection, and two basal petiole infection.
Of the 10 plants inoculated with P. vinacea eight were infected with severe infection in
the upper roots, three in the crowns and one infected in the basal petioles. No infection
could be found in any of the non-inoculated control plants (Table 2 and 3).
Two maw the disease incidence of the plants inoculated with F. oxysporum and P.
vinacea was similar in both waterlogged and non-waterlogged plants with 100% of
plants infected by Fusarium oxysporum and 90% infected by P. vinacea. Whereas 80%
of plants inoculated with F. avenaceum and waterlogged where infected, while only
50% of non-waterlogged plants were infected by F. avenaceum.
134
Chapter 9: Effect of waterlogging on pyrethrum growth
All plants infected by F. oxysporum had crown tissue infection in both waterlogged and
non-waterlogged treatments 2 maw, whereas 70% and 60% of plants had crown tissue
infected by P. vinacea in the waterlogged and non-waterlogged treatments respectively.
For F. avenaceum infected plants only 50% and 20% of plants had crown tissue
infection in the waterlogged and non-waterlogged treatments respectively. Again, no
infection was observed in any of the control plants in both waterlogged and nonwaterlogged treatments.
At 6 maw disease incidence remained similar to the pre-waterlogging and 2 maw stages
for both Fusarium and Paraphoma trials. More plants had the basal flower stems
infected by F. oxysporum than by P. vinacea and F. avenaceum. There was a higher
incidence of crown infection in plants inoculated by F. avenaceum at 6 maw than at 2
maw.
Table 2. Number of infected plants two months after inoculation, pre-waterlogging (0
bw) with Fusarium oxysporum, Fusarium avencaeum and Paraphoma vinacea per 10
replicates. W= waterlogged, NW=non-waterlogged
Treatment
Control
F. oxysporum
F. avenaceum
Control
P. vinacea
0 bw
0
10
7
0
8
W
2 maw
0
10
8
0
9
NW
0
10
5
0
9
W
6 maw
0
10
7
0
9
NW
0
10
6
0
9
135
Chapter 9: Effect of waterlogging on pyrethrum growth
Table 3. Disease incidence two months after inoculation at pre-waterlogging (0 bw), 2 months after waterlogging (2 maw) and 6 months
after waterlogging (6 maw) for plants inoculated with Fusarium oxysporum, Fusarium avenaceum and Paraphoma vinacea. Each cell
shows the number of infected tissues/10 replicates. W= waterlogged, NW=non-waterlogged
0 bw
2 maw
6 maw
W
Treatment
Leaf
Control
0
F. oxysporum
Basal
Crown
Root
Leaf
0
0
0
0
0
8
10
10
F. avenaceum
0
2
4
Paraphoma
Control
0
0
trial
P. vinacea
0
1
Fusarium
trial
petiole
NW
Basal
Basal
stem
petiole
0
0
10
8
0
2
0
0
0
2
Root
Leaf
0
0
0
0
0
8
10
9
4
0
1
5
0
0
0
0
3
7
0
1
Basal
NW
Flower
Crown
petiole
W
Crown
Root
0
0
0
7
3
0
0
0
7
7
petiole
Flower
Basal
stem
petiole
0
0
10
3
0
7
0
0
1
1
Crown
Root
Crown
Root
0
0
0
0
0
7
3
4
3
10
2
3
1
2
0
0
5
1
0
0
0
0
0
0
0
0
6
6
5
5
3
1
3
5
136
Chapter 9: Effect of waterlogging on pyrethrum growth
9.3.2. Stress severity classes of waterlogged plants
The waterlogging treatment was terminated on day 4 at the onset of chlorosis and
necrosis of the young petioles and leaves (Fig. 1). A shift in severity class was observed
7 days after waterlogging when 75% and 70% of plants infected with F. oxysporum and
F. avenaceum respectively had severity class 1 , and 40% of the plants infected with P.
vinacea had severity class 2 (Table 4). The stress severity on plants inoculated with P.
vinacea was the highest of all the treatments. Only 10% of the waterlogged plants
showed no symptoms while 40% had severe wilt and necrosis of the lower leaves and
petioles, 10% had severe wilt and 5% died. Stress severity in both F. oxysporum and F.
avenaceum treatments was mostly similar with F. oxysporum causing slightly higher
degree of necrosis and chlorosis of the lower leaves and petioles and wilt compared to
plants infected by F. avenaceum. Uninfected control plants in both Fusarium and
Paraphoma trials showed no severe symptoms and mostly had moderate necrosis and
chlorosis of the lower leaves and petioles (Table 4). No wilting, chlorosis and necrosis
were observed in the non-inoculated controls of the non-waterlogged plants (data not
shown).
After 6 months, waterlogging caused a significant (p<0.05) reduction in the number of
flowers, flower stems, petioles and yellow leaves in the waterlogged plants in both
Fusarium and Paraphoma trials. There was no significant difference in green leaves in
the Fusarium trial. However, none of the pathogens had a significant effect on these
traits in the waterlogged and non-waterlogged plants (Table 5).
137
Chapter 9: Effect of waterlogging on pyrethrum growth
Fig.2. A wilting of the new petioles and leaves 7 days after the waterlogging treatment;
B chlorosis and necrosis of lower leaves and petioles, wilting of the young petioles and
leaves, 7 days after waterlogging
Table 4. The relative stress severity scores of plants inoculated with Fusarium
oxysporum, Fusarium avenaceum, and Paraphoma vinacea, 7 days after waterlogging.
Twenty plants per treatment were considered
Severity
class
0
1
2
3
4
Control
Fusarium
9 (45%)
11 (55%)
0
0
0
F. oxysporum
F. avenaceum
Control Paraphoma
P. vinacea
4 (20%)
15 (75%)
1 (5%)
0
0
5 (25%)
14 (70%)
1 (5%)
0
0
6 (30%)
13 (65%)
1 (5%)
0
0
2 (10%)
7 (35%)
8 (40%)
2 (10%)
1 (5%)
138
Chapter 9: Effect of waterlogging on pyrethrum growth
Table 5. Effect of water logging on the number of pyrethrum flowers, flower stems,
basal petioles and leaves (green and yellow), 6 months after waterlogging. Means for
each pathogen treatment are shown in each column. Significant differences between
waterlogging and non-waterlogging treatments for each pathogen (Fusarium and
Paraphoma) trial are shown as HSD in rows using a Tukey’s HSD (honest significant
difference) test at α=0.05. * Significant t-value; ns= not significant t-value.
W=waterlogged, NW=non-waterlogged
Flowers
Treatment
NW
W
Control
7.6
3.2
F. oxysporum
6.5
2.5
F. avenaceum
7.6
1.7
NW
W
10
2.7
Control
HSD
2.28*
HSD
Flower stems
Basal petioles
NW
NW
W
5
1.7
4.2
2.1
4.9
1
NW
W
5.7
1.2
2.93*
P. vinacea
5.9
1.6
HSD
1.2*
HSD
W
68.5
41.1
63.1
40.3
67.3
37.2
NW
W
72.6
34.7
1.6*
3.3
1
HSD
9.53*
HSD
Green leaves
Yellow leaves
NW
HSD
NW
W
2.13
9.6
b
11.2
22.8
13
20.9
12.5
HSD
NW
W
HSD
6.1
1.85*
6.6
a
4.6
a
1.91
W
6.4
3.5
4.7
2.4
4.7
3.9
NW
W
6.6
2.6
15.46*
56.5
35.4
3.9
2.1
ns
4.5
HSD
3.93*
ns
9.3.3. Dry weight analyses
At each sampling time there was a significant (p<0.05) difference in mean dry weight
between inoculated and non-inoculated plants, and between waterlogged and nonwaterlogged treatments. The interaction between sampling time and waterlogging
treatment, and sampling time and pathogen treatments for all the three pathogens were
highly significant (Fig. 3). In plants grown at optimum soil water capacity F. oxysporum
and P. vinacea significantly reduced the below-ground and total biomass of plants at
pre-waterlogging (0 bw), and 2 and 6 maw (Table 6). Although F. avenaceum was
pathogenic it had a significant effect only on below-ground biomass at 2 and 6 maw
(Table 6).
Waterlogging generally caused a significant reduction in above-ground, below-ground
and total biomass of the pyrethrum plants inoculated with F. oxysporum, F. avenaceum,
P. vinacea as well as in the non-infected controls (Fig. 3). At 2 maw, significant
reduction of dry weight occurred in plants infected with each of three pathogens.
139
Chapter 9: Effect of waterlogging on pyrethrum growth
Whereas, at 6 maw only F. oxysporum and P. vinacea significantly affected plant
growth in the waterlogged treatment. The waterlogging main effect was significant for
below-ground and total dry weight at both 2 and 6 maw (Table 6).
By 6 maw plants had begun to recover from the waterlogging treatment by producing
new leaf petioles and increased growth. However, there was a highly significant
difference in dry weights of the plants between the waterlogged and non-waterlogged
groups (Table 6). Plants infected with F. oxysporum had significantly reduced aboveground, below-ground and total biomass in both waterlogged and non-waterlogged
treatments. Plants infected with F. avenaceum had no significant difference in aboveground and total biomass in both groups. Plants infected with P. vinacea had no
significant difference in above-ground dry weights.
140
Chapter 9: Effect of waterlogging on pyrethrum growth
Table 6. The effect of waterlogging on dry weights of pyrethrum plants infected with Fusarium oxysporum, Fusarium avencaeum and Paraphoma
vinacea, pre-waterlogging (0 bw), 2 months after waterlogging (2 maw) and 6 months after waterlogging (6 maw). Means with different letters in each
column for each pathogen treatment were obtained using Tukey’s HSD (honest significant difference) test at α=0.05 and are significantly different.
Significant differences between waterlogging and non-waterlogging treatments for each dry weight category are shown as P-values. ns= not significant,
*=P<.0001, **=P<.0005, ***=P<.0082, ****=P<.0070, ai= after inoculation, maw= months after waterlogging. W=waterlogged, NW=nonwaterlogged
0 bw
Dry weight
Treatment
Control
Above-ground F. oxysporum
F. avenaceum
Control
Fusarium trial
Below-ground F. oxysporum
F. avenaceum
Control
Total
F. oxysporum
F. avenaceum
Treatment
Control
Above-ground
P. vinacea
Control
Paraphoma trial Below-ground
P. vinacea
Control
Total
P. vinacea
y
Equivalent to 4 and 8 months after inoculation
4.17 a
2.35 b
3.13 ab
3.38 a
2.07 b
2.58 ab
7.55 a
4.42 b
5.71 ab
Mean
4.87 a
2.63 b
2.95 a
2.12 b
7.83 a
4.76 b
y
2 maw
NW
W
8.28 a
8.01 a
6.38 b
5.65 b
7.99 ab
5.88 b
13.38 a
6.78 a
6.02 b
2.1 b
7.99 b
3.70 b
21.38 a
14.80 a
12.40 b
7.98 b
16.27 b
9.35 b
NW
W
8.22 a
7.20 a
7.40 a
4.58 a
8.34 a
5.21 a
4.89 b
1.72 b
16.56 a
12.41 a
12.29 b
6.31 b
Means
P-value
ns
*
**
P-value
ns
**
****
6 mawy
NW
15.66 a
12.65 b
13.95 a
18.50 a
13.99 b
15.24 b
34.17 a
26.65 b
29.19 ab
NW
15.42 a
12.62 a
16.75 a
12.55 b
32.17 a
25.17 b
W
P-value
10.57 a
7.17 b
*
9.62 a
15.08 a
11.03 b
***
12.32 b
25.65 a
26.20 b
*
21.94 ab
W
P-value
6.28 a
*
7.97 a
10.79 a
*
5.99 b
17.07 a
*
13.78 b
141
Chapter 9: Effect of waterlogging on pyrethrum growth
142
Chapter 9: Effect of waterlogging on pyrethrum growth
Fig.3. Interaction plots between waterlogging and each pathogen treatment, prewaterlogging (0 bw), 2 months after waterlogging (2 maw) and 6 months after
waterlogging (6 maw) in the waterlogged and non-waterlogged plots. A plants infected
with Fusarium oxysporum and Fusarium avenaceum B plants infected with Paraphoma
vinacea. Y axis refers to mean biomass of the plants (log transformed). X axis refers to
the sampling time in which the dry weight of the inoculated plants was measured. The
same time 0 bw (before waterlogging) has been used for both waterlogged and nonwaterlogged treatments
9.3.4. Photosynthesis at 2 months after waterlogging
At 2 maw there was a significant (p<0.05) interaction between inoculated and noninoculated plants on photosynthesis rate, and a significant interaction between
waterlogging and no waterlogging treatments however, there was no significant
interaction between inoculation and waterlogging treatments. Plants infected by each of
the pathogens had the lowest photosynthesis rate in both waterlogged and the nonwaterlogged treatments (Table 7). Photosynthesis rate measurements showed that leaf
photosynthesis in the waterlogged plants was significantly lower than in those which
had not been waterlogged in both trials (Table 7).
143
Chapter 9: Effect of waterlogging on pyrethrum growth
Table 7. The effect of waterlogging on photosynthesis of the plants inoculated with
Fusarium oxysporum, Fusarium avenaceum and Paraphoma vinacea, 2 months after
waterlogging. Means with different letters in each column for each pathogen treatment
were obtained using Tukey’s HSD (honest significant difference) test at α=0.05 and are
significantly different.
Significant differences between waterlogging and non-
waterlogging treatments for each pathogen trial are shown as P-values. W=waterlogged,
NW=non-waterlogged
Photosynthesis rate (µmol CO2 m-2 s- 1)
Trial
Fusarium
trial
Paraphoma
trial
Treatment
Control
F. oxysporum
F. avenaceum
Control
P. vinacea
W
0.91 a
0.26 b
0.44 b
0.91 a
0.31 b
NW
1.64 a
1.37 b
1.60 b
2.73 a
1.24 b
P-value
<.0001
<.0001
9.4. Discussion
All three pathogens had a significant effect on dry weight of the inoculated plants from
pre-waterlogging to 6 months after waterlogging. The interactions between
sampling time and pathogens, and sampling time and waterlogging treatment
were highly significant. A 4-day waterlogging treatment significantly affected
the growth of pyrethrum plants infected by Fusarium oxysporum, F. avenaceum
and Paraphoma vinacea. At 2 maw there were significant differences in aboveground, below-ground and total dry weights of plants infected by these pathogens.
Whereas, at 6 maw F. oxysporum and P. vinacea had larger effect than F.
avenaceum causing significant reduction in total dry weight. Although F.
avenaceum did not significantly reduce above-ground or total dry weights at 6
maw, the below-ground biomass was significantly reduced. These results
confirmed previous studies by Moslemi et al. (2017b) that F. oxysporum and P.
vinacea were important pathogens of pyrethrum but that F. avenaceum was a minor
pathogen although it retained its pathogenicity 6 maw and significantly reduced the
dry weight.
Above-ground dry weight of plants was less affected by infection caused by F.
avenaceum and P. vinacea than by F. oxysporum which is indicative of the severity of
144
Chapter 9: Effect of waterlogging on pyrethrum growth
pathogenicity of F. oxysporum. At 7 days after waterlogging, plants infected by P.
vinacea showed more severe necrosis and chlorosis of leaves and severe wilting of the
shoots and petioles than the controls and plants inoculated with the two Fusarium spp.
This may have indicated that these plants had more severely weakened root systems due
to infection by P. vinacea which resulted in more severe symptoms of stress when
subjected to the waterlogging stress. In a previous study Moslemi et al (2016) showed
that pyrethrum plants inoculated with spore suspension of P. vinacea had significant
reduction of above-ground, below-ground and total biomass of root-dip inoculated
plants in two separate glasshouse experiments. Significant reduction of O₂ during the
4-day waterlogging period would have caused a reduction in the amount of oxygen in
roots (hypoxia). Hypoxia decreases ATP production that is vital for respiration and
photosynthesis and has direct effect on root and shoot growth of waterlogged plants
(Davies et al. 2000). The reduction in O₂ may not have affected growth of the fungal
pathogens but may have enhanced infection and colonisation of affected roots weakened
by hypoxia.
Waterlogging did not appear to enhance disease incidence for any of the pathogens
perhaps because incidence of infection by all three pathogens was high before the
waterlogging treatment. At 6 maw treatment plants infected with F. oxysporum had high
incidence of infection of flower stem bases and crown tissues whereas, P. vinacea
was isolated from a high proportion of crown and root tissues. Waterlogging
treatment caused significant reduction of the number of flowers, flower stems,
petioles, green leaves in the Paraphoma trial and yellow leaves in the Fusarium
trial. Similar results were reported by Javid et al. (2013) where a 6-day waterlogging
treatment followed by inoculation with the foliar pathogen S. tanaceti reduced plant
growth. Javid et al. (2013) suggested that poor plant growth occurred as a result of
the reduction of adenosine triphosphate (ATP) synthesis in the roots of the
waterlogged plants which affected the ability of the plants to uptake nutrients from the
soil.
The photosynthesis rate significantly reduced 2 maw in all the plants including the
controls. McDonald and Dean (1996) showed that waterlogging increased the
concentration of ethylene in shoots which resulted in plants becoming more
susceptible to diseases by causing stomatal closure and photosynthesis reduction.
145
Chapter 9: Effect of waterlogging on pyrethrum growth
9.5. Conclusion
In plants grown at optimum soil water capacity F. oxysporum and P. vinacea
significantly reduced the below-ground and total biomass of plants at 2, 4 and 8 months
after inoculation (0 bw, 2 maw, 6 maw) but had little effect on above-ground biomass.
Although F. avenaceum was pathogenic it only had a significant effect on below-ground
biomass at 4 and 8 months after inoculation. At 7 days after the 4-day waterlogging
treatment, plants infected with P. vinacea had more severe wilting, necrosis and
chlorosis of the basal leaves and petioles than plants infected with the other two
pathogens or non-infected plants. Significant interaction between pathogen treatments
and waterlogging occurred at 2 maw, whereas at 6 maw plants had recovered and no
significant interaction was observed between the pathogen treatments and waterlogging.
The effect of waterlogging on below-ground dry weight of the plants infected with F.
oxysporum and P. vinacea, 2 maw was more severe than those infected with F.
avenaceum. There was no significant interaction between waterlogging and pathogens
on photosynthesis 2 maw however, plants infected by each of the pathogens had the
lowest photosynthesis rate in both waterlogged and the non-waterlogged treatments. Six
maw the number of flowers, flower stems, petioles and leaves were significantly
reduced by waterlogging however, there was no significant effect by pathogens nor an
interaction between pathogens and waterlogging on these growth parameters.
146
Chapter 10: Discussion
Chapter 10
General discussion
New soil-borne and foliar pathogens of pyrethrum were isolated and identified from
plants showing yield-decline symptoms. Three new species of Paraphoma were
identified including P. vinacea that caused red-brown discolouration of the crown and
growth reduction of pyrethrum, and P. chlamydocopiosa and P. pye that caused necrotic
leaf lesions and growth reduction. These species were identified based on multigene
phylogenetic analyses and pathogenicity bioassays. In addition, a complex of Fusarium
species including F. oxysporum, F. avenaceum, F. venenatum and F. equiseti were
isolated from plants with yield-decline symptoms. Fusarium oxysporum and F.
avenaceum were the main Fusarium pathogens causing reduced growth and crown
discolouration of pyrethrum. Additionally, A. infectoria and S. herbarum were
identified as potential foliar pathogens of pyrethrum in the fields of northern Tasmania.
Pathogenicity experiments confirmed the significant role that these pathogens had in
reducing pyrethrum growth and potential yield reduction and helped categorise these
pathogens as major or minor pathogens of pyrethrum. Fungal pathogens identified to be
associated with yield-decline affected pyrethrum plants are summarised in Table 1.
Identification of soil-borne pathogens associated with pyrethrum yield-decline is of
major importance in pyrethrum pathology as previous studies mostly focused on foliar
pathogens of pyrethrum (Barimani et al. 2013; Pearce et al. 2015; Vaghefi et al. 2012).
Only Sclerotina sclerotiorum and S. minor (Scott et al. 2014) and F. oxysporum in
Kenya (Pethybridge et al. 2008d) were previously reported as soil-borne fungal
pathogens of pyrethrum.
147
Chapter 10: Discussion
Table 1. Fungal pathogens associated with yield-decline affected pyrethrum plants
Pathogen isolates
Alternaria infectoria
strain/isolate Accession No.
UMAi01- BRIP 65180
Tissue infected
Flower stem base
Location
isolated
Table Cape &
Burnie
Collector
Date
collected
Symptoms on pyrethrum
Reference
pseudothecia at the base of old flower
A. Moslemi
Sep-16
stems, necrotic leaf lesions on both sides
Moslemi et al. (2017a)
of the leaves
UoM005; BRIP 64449
UoM0011; BRIP 64441
Fusarium oxysporum
UoM0026; BRIP 64452
Crown and upper
UoM0027; BRIP 64453
roots
UoM0028; BRIP 64454
Devonport,
Burnie,
Jun 2014;
A. Molsemi
Jan 2015;
Ballarat
Sep 2016
Devonport,
Jun 2014;
Severe crown discolouration and
suppressed growth
Moslemi et al. (2017b)
UoM0029; BRIP 64455
UoM002-BRIP 64445
UoM0012; BRIP 64442
Fusarium avenaceum
UoM0014; BRIP 64443
Leaf, basal petiole,
UoM0016; BRIP 64444
crown and root
UoM0024; BRIP 64450
Burnie,
A. Molsemi
Ballarat
Jan 2015;
Sep 2016
Severe crown discolouration and
suppressed growth
Moslemi et al. (2017b)
UoM0025; BRIP 64451
Fusarium equiseti
UoM0022; BRIP 64447
UoM0023; BRIP 64448
Crown and basal
petioles
Jun 2014;
Devonport
A. Molsemi
Jan 2015;
Crown discolouration
Moslemi et al. (2017b)
Crown discolouration
Moslemi et al. (2017b)
Sep 2016
Jun 2014;
Fusarium venenatum
UoM0020; BRIP 64446
Crown
Devonport
A. Molsemi
Jan 2015;
Sep 2016
Stemphylium herbarum
UMSh02- BRIP 65181
Flower stem base
Table Cape &
Burnie
A. Moslemi
Sep-16
pseudothecia at the base of old flower
stems, necrotic leaf lesions on both sides
Moslemi et al. (2017a)
148
Chapter 10: Discussion
of the leaves
UMPc01- BRIP 65168
UMPc03- BRIP 65170
UTAS01- BRIP 57988
UTAS02-BRIP 65174
Paraphoma
UTAS04- BRIP 65173
chlamydocopiosa
UTAS05-BRIP 57989
N. Vaghefi, T.
Leaf
Table Cape
Pearce, F.
2013
Hay, J. Scott
UTAS06-BRIP 65176
Necrotic leaf lesions on both sides of the
leaves and growth reduction
Moslemi et al. (2017c)
UTAS07-BRIP 65177
UTAS09-BRIP 65178
UTAS010-BRIP 65179
N. Vaghefi, T.
Paraphoma pye
UMPp02-BRIP 65169
Leaf
Table Cape
Pearce, F.
2013
Hay, J. Scott
Necrotic leaf lesions on both sides of the
leaves and growth reduction
Moslemi et al. (2017c)
UMPv001-BRIP 63684
Paraphoma vinacea
UMPv002-BRIP 63683
Crown, basal
UMPv003-BRIP 63682
petiole, upper root
Burnie
A. Moslemi
Jun-14
Severe crown discolouration and growth
reduction
Moslemi et al. (2016)
UMPv004- BRIP 63685
149
Chapter 10: Discussion
Bionectria ochroleuca, Plectosphaerella cucumerina and Rhizoctonia oryzaesativa were also isolated from the crown, roots and basal petioles of pyrethrum plants
in the survey conducted in 2014 in Tasmania. However, these putative pathogens
did not appear to be important pathogens of pyrethrum as glasshouse experiments
revealed that they did not significantly reduce the dry weight and were infrequently
isolated from the inoculated plants in the glasshouse. Besides, these pathogens were not
detected in other field surveys. This comprehensive study of the pathogens isolated
from pyrethrum plants in yield-decline affected fields of northern Tasmania
has improved the knowledge of the fungal pathogens that exist in affected fields.
The minor pathogens may become more important to pyrethrum production with a
change in environmental conditions that favours infection and colonisation. This
could
occur
with
the development of climate change (Elad and Pertot 2014).
Further research is needed into the effect that different environmental conditions will
have on host-pathogen interaction for each of these pathogens.
The pathogenicity of the major pathogens was initially assessed using three different
inoculation techniques of root-dip, soil drench and foliar spray to optimize the most
effective inoculation method. The root-dip method was the most effective technique to
enhance infection and accelerate disease symptom development (Moslemi et al. 2017b).
This was most likely because of damage to roots of plants during the inoculation
process thus enabling direct infection to take place. In glasshouse pathogenicity trials
several inoculated plants in each treatment appeared not to be infected as the pathogen
could not be reisolated from the plant tissue. Hence, non-infected plants were removed
from the dry weight analyses to reduce the error caused by inclusion of dry weight of
the non-infected plants. Paraphoma vinacea and F. oxysporum caused severe crown and
root infection with the root-dip inoculation method compared to soil drench and foliar
spray.
Of all the four Fusarium species, F. equiseti was found to be the least important
pathogen, although it was isolated from the roots of the root-dip inoculated pyrethrum
plants and significantly reduced the below-ground dry weight. However, as the
pathogen was not consistently isolated from any other tissues in the glasshouse
experiments this was excluded from further pathogenicity trials. Fusarium venenatum
150
Chapter 10: Discussion
was isolated from the yield-decline affected fields in northern Tasmania and Ballarat
region of Victoria however, incidence of the pathogen fluctuated between different field
collections and the pathogen did not significantly reduce the plant biomass in any of the
glasshouse experiments.
Fusarium oxysporum and F. avenaceum appeared to be the most prevalent Fusarium
pathogens isolated from the yield-decline affected fields of northern Tasmania and
Ballarat region of Victoria, and significantly reduced the below-ground and total
biomass of the root-dip inoculated pyrethrum plants in glasshouse bioassays. Although,
Fusarium avenaceum significantly reduced the below-ground dry weight, occasional
inconsistencies were observed in above-ground and total biomass reduction in some
trials. Pathogenicity of F. avenaceum in pyrethrum was confirmed in the waterlogging
experiments, where the pathogen significantly and constantly reduced above-ground,
below-ground and total biomass of the root-dip inoculated pyrethrum plants under both
optimal and waterlogged conditions. In contrast, F. oxysporum reduced above-, belowground and total biomass of the infected plants significantly in all the glasshouse
experiments. Hence, both F. oxysporum and F. avenaceum can now be recognised as
important pathogens of pyrethrum.
Paraphoma vinacea was able to significantly reduce above-ground, below-ground and
total biomass of plants inoculated by root-dip method compared to the other two
inoculation techniques. However, the number of infected plants between root-dip and
soil drench inoculation techniques was not different and only the foliar spray method
caused less infection. For P. vinacea, cross contamination occurred in preliminary
experiments due to use of overhead sprinklers in the glasshouse which provided an ideal
environment for conidiospore transmission from infected to non-infected controls.
Therefore, subsequent experiments used drip irrigation to supply water to the pots to
minimize splash dispersal of conidia. Pycnidia most likely formed on the infected upper
crown or base of necrotic petioles above the soil surface, which enabled water splash
dispersal of conidia. This indicated an efficient means of dispersal of spores even
though the pathogen is a root and crown rot pathogen. Spores that splashed onto the
surface of the leaves were probably washed down the petiole to infect the crown region
of the healthy plants.
151
Chapter 10: Discussion
Paraphoma chlamydocopiosa and P. pye were originally isolated from necrotic leaf
lesions however, glasshouse pathogenicity bioassays using root-dip inoculation showed
significant infection of the crown tissue, and reduction of above-ground, below-ground
and total biomass. These pathogens also produced leaf lesions after foliar spray
inoculation.
Alternaria infectoria and Stemphylium herbarum were identified from pseudothecia
formed at the base of the dead pyrethrum flower stems in field plants. This was the first
report of the sexual stage of Alternaria and Stemphylium on pyrethrum plants (Moslemi
et al. 2017a). However, Stemphylium botryosum and Alternaria tenuissima had been
reported in previous studies by Pethybridge et al. (2004) and Hay et al. (2015) as foliar
pathogens of pyrethrum. Stemphylium herbarum was identified based on morphological
and taxonomic differences compared to S. botryosum (Moslemi et al. 2017a). Hay et al.
(2015) reported that the incidence and severity of Alternaria tenuissima in the fields of
northern Tasmania changed according to changes in environmental conditions. A
change in the climate may be shifting the predominant Alternaria spp from A.
tenuissima to A. infectoria, especially if the sexual stage of this later pathogen is readily
produced. Sexual reproduction of a pathogen leads to greater adaptability to changing
environments (Vaghefi et al. 2016). Therefore, further studies are needed to determine
the role of S. herbarum, A. infectoria, S. botryosum and A. tenuissima as foliar
pathogens in yield-decline of pyrethrum.
10.1. Fusarium formae specialis identification
Fusarium oxysporum species were identified using multigene phylogenetic analyses.
However, further studies are required to determine host specificity and if this F.
oxysporum species is a formae specialis specific to pyrethrum or if it has a broad host
range capable to infect multiple host species. To identify the form species of F.
oxysporum as a specific pathogen of pyrethrum, further studies need to investigate
cross-host infection and disease development by F. oxysporum from pyrethrum and
disease development in different closely related species, particularly in the Asteraceae.
Pathotypes of F. oxysporum may also exist within the pathogen population however, to
determine pathotypes resistant cultivars of pyrethrum need to be identified and screened
152
Chapter 10: Discussion
for host reaction to isolates of the pathogen. However, resistance to F. oxysporum in
pyrethrum cultivars has yet to be identified.
Fusarium oxysporum f. sp. chrysanthemi was identified as a specific pathogen infecting
chrysanthemum plants (Singh and Kumar 2013, 2014) as it blocked the xylem vessel
and caused significant wilt in the inoculated plants by production of toxins. Fusarium
oxysporum f. sp. chrysanthemi has also been identified by Lievens et al. (2008) using
specific primers designed from transposable element Fot1 as the specific marker. Class
I and class II transposons have been reported as means of identification of formae
speciales of F. oxysporum as these carry specific pathogenic genes which only some
species of F. oxysporum possess. Transposable elements are DNA distinct fragments
which jump or replicate to various locations of the pathogenic gene hence, create
specific sequences which can be used to design specific primers (Lievens et al. 2008).
The movement mechanism of transposon class I and class II is through retroposition and
cut-and-paste mechanisms (Lievens et al. 2008). Pathogenicity of some Fusarium spp.
can be related to certain transposons. Fot1 is one of the transposable elements for
developing specific markers used for identification of F. oxysporum f. sp. albedinis on
palm dates (Lievens et al. 2008).
In addition, sequences of some cell wall degrading enzymes exuded by pathogenic fungi
can be used to design specific primers for the identification of form species of
Fusarium. For instance, polygalacturonase is specifically produced by Fusarium spp.
and has been successfully used for identification of F. oxysporum f. sp. lycopersici and
F. oxysporum f. sp. radices-lycopersici (Hirano and Arie 2006).
10.2. Interaction of waterlogging with pathogens on growth of pyrethrum
Waterlogging caused wilt, necrosis and chlorosis of young leaves, petioles of the
inoculated pyrethrum plants. Significant differences in stress severity occurred when
plants were exposed to a 4-day waterlogging stress. A significant interaction occurred
between waterlogging and pathogen treatments 2 maw with significant reduction in the
below-ground dry weight specifically with plants inoculated with F. oxysporum and P.
vinacea. The time period from before waterlogging to 2 maw was an important factor in
growth reduction of pyrethrum as the interaction between sampling time and pathogens,
and sampling time and waterlogging treatment were very significant at 2 maw.
153
Chapter 10: Discussion
Therefore, waterlogging exacerbated the effect of F. oxysporum and P. vinacea on
growth of pyrethrum 2 maw. However, the number of flowers, flower stems and green
shoots was only significantly affected by the waterlogging treatment 6 maw and not by
the pathogens or interaction between the waterlogging and pathogens.
The effect of waterlogging alone on the growth and yield of pyrethrum requires further
studies as all plants except the non-inoculated controls were root-dip inoculated before
waterlogging stress was imposed. Hence, future experiments can be conducted in which
the plants are infected after the waterlogging treatment. This would enable a better
understanding of the synergistic effect of waterlogging on fungal pathogen infection of
the inoculated plants. Different inoculation techniques affected disease incidence and
severity in previous experiments. Therefore, different inoculation techniques such as
root-dip and soil drench might show significantly different results for growth reduction
and pathogenicity, when used after exposure of the plants to a waterlogging stress.
Hence, using different inoculation methods to infect plants after a short period of
waterlogging and assessing the effect of each variable on pyrethrum growth and yield in
future studies are suggested.
10.3. Management
Accurate identification of pathogens associated with pyrethrum yield-decline and
understanding their life cycles is of great importance as this helps in the determination
of appropriate control techniques. Many species of the genus Fusarium are nonpathogenic or even beneficial thus, it is important to be able to identify the pathogenic
species (Lievens et al. 2007). Accurate identification of all pyrethrum pathogens is
critical to all aspects of biosecurity and invasive species management to implement
appropriate decisions and actions (Summerell et al. 2003). Management of F.
oxysporum, F. avenaceum and P. vinacea in the yield-decline affected fields of northern
Tasmania or Ballarat has not been specifically studied. Little is known about the
appropriate control practices required to reduce the population of these pathogens in the
yield-decline affected sites. Therefore, a review of management techniques such as
application of fungicides or crop rotation used for the control of foliar pathogens such
as S. tanaceti and D. tanaceti causing diseases of pyrethrum might be informative, and
154
Chapter 10: Discussion
can also be applied for effective control of root and crown rot pathogens in pyrethrum
fields.
Many different management methods have been used to control Fusarium spp. in other
cropping systems such as soil sanitation, rotation with non-host crops, and chemical or
biological control using species of Trichoderma, Aspergillus and Penicillium (KullnigGradinger et al. 2002; Singh and Kumar 2014). Soil fumigation prior to cultivation and
using high resistant cultivars are recommended as a control technique however, in
pyrethrum production soil fumigants are too expensive and no susceptible or resistant
pyrethrum varieties are known.
Lievens et al. (2007, 2008) speculated that new pathotypes or form species of Fusarium
may emerge from the non-pathogenic species due to mutations and this makes it
difficult to control diseases caused by various Fusarium spp. Singh and Kumar (2014)
stated that Trichoderma viride and Aspergillus ochraceous had significant roles in
reduction of mycelia of F. oxysporum f. sp. chrysanthemi in the infected xylems of
Chrysanthemum sp. Larkin and Fravel (1998) recommended the use of a group of
biocontrol microorganisms which live in the same rhizosphere or on the same plant to
control Fusarium wilt of tomato. Several non-pathogenic Fusarium strains isolated from
suppressive soils were known to be highly effective in the control of Fusarium wilt of
tomato caused by F. oxysporum f. sp. lycopersici.
The import of plant material of species closely related to pyrethrum such as
Chrysanthemum sp. may lead to the introduction of exotic pathogens that pose a threat
to the pyrethrum industry. These may be transmitted through infected seed or
propagatable material.
According to the Biosecurity Import Condition System
(BICON) in Australia, plants such as Chrysanthemum spp. which are propagatable need
to be devitalised using glyphosate previous to being transported to Australia and need
transport permit (Department of Agriculture and Water Resources). Hot water treatment
of seed has been shown to reduce incidence of seed-borne pathogens transmitted by
infected seed. Stagonosporopsis tanaceti that causes ray blight disease of pyrethrum
has been shown to be controlled through application of hot water to prevent
transmission (Bhuiyan et al. 2016). The hot water treatment may be applicable to
control other fungal pathogens that are seed transmitted.
155
Chapter 10: Discussion
PCR approaches are relatively cost effective and fast in detection of a specific fungal
pathogen infecting symptomless plants. This method may be used to detect exotic
pathogens in infected imported plant material in quarantine. In addition, quantified
PCR (qPCR) with fluorescent probes and Taq DNA polymerase (TaqMan) have been
able to detect and quantify DNA of the pathogen in planta (Boyle et al. 2004). As well,
real time PCR techniques have been used to track the pathogen within the infected
tissues and accelerated the process of identification in planta. Singh and Kumar (2014)
reported that severity of symptoms caused by F. oxysporum f. sp. chrysanthemi was
dependent on resistance or susceptibility of cultivars. Therefore, detection of Fusarium
spp. in planta is of high value especially as the pathogen does not produce clear
symptoms on pyrethrum.
qPCR has also been used to determine the amount of
inoculum in field soil thus resulting in the identification of threshold levels of inoculum
required for disease development (Lievens et al. 2007).
No control techniques have been recommended for management of diseases caused by
Paraphoma spp. However, removal of dead plant material and debris, which can be
sources of pycnidia, from the fields and crop rotation with non-host plants may be
effective in reducing inoculum levels to control disease development. Further studies
into the life cycle of Paraphoma spp. infecting pyrethrum will provide a better insight
into how these pathogens infect and reproduce which will enable better control
strategies.
In conclusion, new pathogens of pyrethrum have been identified using morphological
and phylogenetic analyses. This expands the pyrethrum industry’s knowledge of the
range of diseases that can affect growth and production, especially in yield-decline
affected fields of northern Tasmania. Assessment of the interaction between these
pathogens and abiotic stresses such as waterlogging is a step forward to a better
understanding of pyrethrum yield-decline syndrome. In addition, pathogenicity tests
with each pathogen have enabled disease symptoms to be described. This will assist the
industry to early detect these diseases and to implement appropriate, specific and useful
management techniques to prevent severe disease outbreaks.
156
List of references
Alam M, Sattar A, Abdul-Khaliq, Samad A, Khanuja SPS, 2006. A root rot and wilt
disease of pyrethrum (Chrysanthemum cineraefolium) caused by Rhizoctonia
solani AG-4 in the north Indian plains. Plant Pathology 55, 301.
Anaissie E, Nelson P, Beremand M, Kontoyiannis D, Rinaldi M, 1992. Fusariumcaused Hyalohyphomycosis: An Overview. Current Topics in Medical Mycology
4, 231-49.
Anon, 2009. Canola yield decline in South-Eastern Australia. In: Group FLR, ed.
Results from the Canola In Depth Project.
Aoki T, O’donnell K, Geiser DM, 2014. Systematics of key phytopathogenic Fusarium
species: current status and future challenges. J Gen Plant Pathol 80, 189-201.
Aubertot JN, West JS, Bousset-Vaslin L, Salam MU, Barbetti MJ, Diggle AJ, 2006.
Improved resistance management for durable disease control: A case study of
Phoma stem canker of oilseed rape (Brassica napus). European Journal of Plant
Pathology 114, 91-106.
Aveskamp MM, Verkley GJ, De Gruyter J, Murace MA, Perello A, Woudenberg JH,
Groenewald JZ, Crous PW, 2009. DNA phylogeny reveals polyphyly of Phoma
section Peyronellaea and multiple taxonomic novelties. Mycologia 101, 363-82.
Aveskamp MM, De Gruyter J, Woudenberg JH, Verkley GJ, Crous PW, 2010.
Highlights of the Didymellaceae: A polyphasic approach to characterise Phoma
and related Pleosporalean genera. Studies in Mycology 65, 1-60.
Backhouse, Burgess LW, 2002. Climatic analysis of the distribution of Fusarium
graminearum, F. pseudograminearum and F. culmorum on cereals in Australia.
Australasian Plant Pathology 31, 321–7.
Backhouse, Abubakar AA, Burgess LW, Dennis I, Hollaway GJ, Wildermuth GB,
Wallwork H, Henry FJ, 2004. Survey of Fusarium species associated with
crown rot of wheat and barley in eastern Australia. Australasian Plant Pathology
33, 255–61.
Bakan B, Giraud-Delville C, Pinson L, Richard-Molard D, Fournier E, Brygoo Y, 2002.
Identification by PCR of Fusarium culmorum strains producing large and small
157
amounts of deoxynivalenol. Applied and Environmental Microbiology 68, 54729.
Balajee SA, Borman AM, Brandt M, E., Cano J, Cuenca-Estrella M, Dannaoui E,
Guarro J, Haase G, Kibbler CC, Meyer WS, O’Donnell K, Petti CA, RodriguezTudela JL, Sutton DA, Velegraki A, Wickes BL, 2009. Sequence-based
identification of Aspergillus, Fusarium, and Mucorales species in the clinical
mycology laboratory: where are we and where should we go from here? Journal
of Clinical Microbiology 877-84.
Barimani M, Pethybridge SJ, Vaghefi N, Hay FS, Taylor PWJ, 2013. A new
anthracnose disease of pyrethrum caused by Colletotrichum tanaceti sp nov.
Plant Pathology 62, 1248-57.
Barnett HL, Hunter BB, 1972. Illustrated genera of imperfect fungi. Minnesota: Burgess
Publishing Company.
Belabid L, Baum M, Fortas Z, Bouznad Z, Eujayl I, 2004. Pathogenic and genetic
characterization of Algerian isolates of Fusarium oxysporum f. sp. lentis by
RAPD and AFLP analysis. African Journal of Biotechnology 3, 25-31.
Bhuiyan MaHB, Groom T, Nicolas ME, Taylor PWJ, 2015. Histopathology of S.
tanaceti infection in pyrethrum leaf lamina. Australasian Plant Pathology 44,
629-36.
Bhuiyan MB, Groom T, Nicolas ME, Taylor PWJ, 2016. Infection process of
Stagonosporopsis tanaceti in pyrethrum seed and seedlings. Plant Pathology
66(5), 742-51.
Boerema GH, De Gruyter J, Noordeloos ME, Hamers MEC, 2004. Phoma identification
manual : differentiation of specific and infra-specific taxa in culture.
Wallingford, Oxfordshire, UK ; Cambridge, MA, USA: CABI Pub.
Bogale M, Wingfield BD, Wingfield MJ, Steenkamp ET, 2006. Characterization of
Fusarium oxysporum isolates from Ethiopia using AFLP, SSR and DNA
sequence analyses. Fungal Diversity 23, 51-66.
Bogale M, Wingfield BD, Wingfield MJ, Steenkamp ET, 2007. Species-specific
primers for Fusarium redolens and a PCR-RFLP technique to distinguish among
three clades of Fusarium oxysporum. FEMS Microbiology Letters 271, 27-32.
158
Boyle DG, Boyle DB, Olsen V, Morgan JaT, Hyatt AD, 2004. Detection of Ralstonia
solanacearum strains with a quantitative, multiplex, real-time, fluorogenic PCR
(TaqMan) Assay. Diseases of aquatic organisms 60, 141-8.
BRA, 2014. The Australian Pyrethrum Industry Pty. Ltd. Available online
http://www.botanicalra.com.au/.
Bradford KJ, 1983. Involvement of plant growth substances in the alteration of leaf gasexchange of flooded tomato plants. Plant Physiology 73 (2), 480-3.
Brasier CM, Kirk SA, Delcan J, Cooke DEL, Jung T, Man In't Veld WA, 2004.
Phytophthora alni sp. nov. and its variants: designation of emerging heteroploid
hybrid pathogens spreading on Alnus trees. Mycological Research 108, 1172-84.
Brown PH, Menary RC, 1994. Flowering in pyrethrum (Tanacetum cinerariaefolium
L.). II. Changes in plant growth regulator concentrations. Journal of
Horticultural Science 69, 985-92.
Burgess, 1981. General ecology of the fusaria In. Fusarium: diseases, biolgy and
taxonomy. Pennsilvania, USA: Pennsilvania State Universite Press, 225-35.
Burgess LW, Summerell BA, Nelson PE, 1991. An evaluation of several media for use
in identification of some Fusarium species. Australasian Plant Pathology 20.
Burgess LW, Summerell BA, 1992. Mycogeography of Fusarium: survey of Fusarium
species in subtropical and semi-arid grassland soils from Queensland, Australia.
Mycological Research 96 780-4.
Carlucci A, Raimondo ML, Santos J, Phillips AJL, 2012. Plectosphaerella species
associated with root and collar rots of horticultural crops in southern Italy.
Persoonia 28, 34-48.
Casida, 1973. Pyrethrum: the natural insecticide. London: Academic Press.
Casida, Quistad GB, 1995. Pyrethrum flowers: production, chemistry, toxicology and
uses New York: Oxford University Press.
Correll JC, 1991. The relationship between formae speciales, races and vgetative
compatibility groups in Fusarium oxysporum. Plant Disease 81, 1061-4.
Cotching B, 2012. Pyrethrum growing in Tasmania, Wealth from Water factsheet. In.
Tasmania: Tasmanian Institute of Agriculture.
Croft BJ, Magarey RC, 1984. Pathogenic fungi associated with northern poor root
syndrme of sugarcane. Australian Society of Sugarcane Thechnologists 55-61.
159
Crous PW, Verkley GJM, Groenewald JZ, Samson RA eds, 2009. Fungal Biodiversity.
CBS Laboratory Manual Series 1. CBS-KNAW Fungal Biodiversity Centre,
Utrecht, The Netherlands.
Cullen DW, Toth IK, Pitkin Y, Boonham N, Barker KWI, Lees AK, 2005. Use of
quantitative molecular diagnostic assays to investigate Fusarium dry rot in
potato stocks and soil. Phytopathology 95, 1462-71.
Davies CL, Turner DW, Dracup M, 2000. Yellow lupin (Lupinus luteus) tolerates
waterlogging better than narrow-leafed lupin (L. angustifolius). Shoot and root
growth in a controlled environment. Australian Journal of Agricultural Research
51(6), 701-9.
De Gruyter J, Boerema GH, 2002. Contributions towards a monograph of Phoma
(Coelomycetes) VIII - Section Paraphoma: Taxa with setose pycnidia.
Persoonia 17, 541-61.
De Gruyter J, Woudenberg JH, Aveskamp MM, Verkley GJ, Groenewald JZ, Crous
PW, 2010. Systematic reappraisal of species in Phoma section Paraphoma,
Pyrenochaeta and Pleurophoma. Mycologia 102, 1066-81.
De Gruyter J, Woudenberg JHC, Aveskamp MM, Verkley GJM, Groenewald JZ, Crous
PW, 2013. Redisposition of phoma-like anamorphs in Pleosporales reevaluation. Studies in Mycology 75, 1-36.
Di Pietro A, Madrid MP, Caracuel Z, Delgado-Jarana J, Roncero MIG, 2003. Fusarium
oxysporum: exploring the molecular arsenal of a vascular wilt fungus. Molecular
Plant Pathology 4, 315-25.
Dorenbosch MJ, 1970. Key to nine ubiquitous soil-borne phoma-like fungi. Persoonia
6, 1-14.
Dowson WJ, 1934. Phytophthora megasperma Dreshler in Tasmania. Transactions
British Mycological Society 19, 89-90.
Drenth A, Janssen EM, Govers F, 1995. Formation and survival of oospores of
Phytophthora infestans under natural conditions. Plant Pathology 44, 86-94.
Elad Y, Pertot I, 2014. Climate change impacts on plant pathogens and plant diseases.
Journal of Crop Improvement 28(1), 99-139.
160
Ellis ML, Jimenez DRC, Leandro LF, Munkvold GP, 2014. Genotypic and phenotypic
characterization of fungi in the Fusarium oxysporum species complex from
soybean roots. Phytopathology 104, 1329-39.
Francis RG, Burgess LW, 1977. Characterization of two populations of Fusarium
roseum "Graminearum" in Eastern Australia. In. Molecular identification of
fungi 68, 421-7.
Garside AL, Bell MJ, Robotham BG, Magarey RC, Stirling GR, 2005. Managing yield
decline in sugarcane cropping systems. Sugar Yield Decline Joint Venture, 7.
Geiser DM, Jime´nez-Gasco MM, Kang S, Makalowska I, Narayanan V, Ward TJ,
Zhang N, Kuldau GA, and O’Donnell K, 2004. FUSARIUM-ID v. 1.0: A DNA
sequence database for identifying Fusarium. European Journal of Plant
Pathology 110, 473-9.
Geiser DM, Aoki T, Bacon CW, Baker SE, Bhattacharyya MK, Brandt ME, Brown
DW, Burgess LW, Chulze S, Coleman JJ, Correll JC et al. 2013. One fungus,
one name: defining the genus Fusarium in a scientifically robust way that
preserves longstanding use. Phytopathology 103, 400-8.
Gerlach W, Nirenberg H, 1982. The genus Fusarium: a pictorial atlas. In. Mitteilungen
der Biologischen Bundesanstalt für Land- und Forstwirtschaft 209.
Glover J, 1955. Chilling and flower bud stimulation in pyrethrum (Chrysanthemum
cinerariaefolium). Annals of Botany 19 (1), 138-48.
Gnadinger CB, 1936. Pyrethrum flowers. Minneapolis, Minnesota.
González D, Cubeta MA, Vilgalys R, 2006. Phylogenetic utility of indels within
ribosomal DNA and -tubulin sequences from fungi in the Rhizoctonia solani
species complex. Molecular Phylogenetics and Evolution 40, 459–70.
Gräfenhan T, Schroers HJ, Nirenberg HI, Seifert KA, 2011. An overview of the
taxonomy, phylogeny, and typification of nectriaceous fungi in Cosmospora,
Acremonium, Fusarium, Stilbella, and Volutella. Studies in Mycology 68, 79113.
Grdisa M, Carovic-Stanko K, Kolak I, Satovic Z, 2009. Morphological and biochemical
diversity of dalmatian pyrethrum (Tanacetum cinerariifolium (Trevir.) Sch.Bip.).
Agriculturae Conspectus Scientificus 74, 73-80.
161
Greenhill M, 2007. Pyrethrum production: Tasmanian success story. Chronica
Horticulture 47, 5.
Groom T, 2014. An hypothesis on the cause of SPLASH. Unpublished.
Hay FS, Stirlling G, Chung B, Groom T, 2002. Investigation into the cause of
pyrethrum regrowth decline (RPD) with emphasis on the role of plant-parasitic
nematodes. Sydney, NSW: Horticulture Australia.
Hay FS, Stirling GR, Pethybridge SJ, Chung B, 2009. A survey of nematodes associated
with pyrethrum in Tasmania, Australia, and the susceptibility of pyrethrum
cultivars to root-lesion nematode. Australasian Plant Pathology 38, 1-5.
Hay FS, Pilkington S, Palmer C, Bond B, Hingston L, Pethybridge SJ, 2012. Pilot study
into ‘Slow Plant Loss After Single Harvest’ (SPLASH) syndrome in pyrethrum.
In. Commercial in confidence – not for distribution without permission of
Botanical Resources Australia. 61.
Hay FS, Gent DH, Pikongton S, Pearce TL, Scott JB, Pethybridge SJ, 2015. Changes in
distribution and frequency of fungi associated with foliar diseases complex of
pyrethrum in Australia. Plant Disease 9 (99), 1227-35.
Hirano Y, Arie T, 2006. PCR-based differentiation of Fusarium oxysporum f. sp.
lycopersici and radicis-lycopersici and races of F. oxysporum f. sp. lycopersici.
Journal of General Plant Pathology 72, 273-83.
Hirooka Y, Kobayashi T, 2007. Taxonomic studies of nectrioid fungi in Japan. II: The
genus Bionectria. The Mycological Society of Japan and Springer 48, 81-9.
Hitmi A, Coudret A, Barthomeuf C, 2000. The Production of yyrethrins by plant cell
and tissue cultures of Chrysanthemum cinerariaefolium and Tagetes Species.
Critical Reviews in Plant Sciences 19, 69-89.
Hyde KD, Nilsson RH, Alias SA, Ariyawansa HA, Blair JE, Cai L, de Cock AWAM,
Dissanayake AJ, Glockling SL, Goonasekara ID et al., 2014. One stop shop:
backbones trees for important phytopathogenic genera: I (2014). Fungal
Diversity 67, 21-125.
IPNI, 2016. The International Plant Names Index. In. http://www.ipni.org.
Javid M, Zhang PJ, Taylor PWJ, Pethybridge SJ, Groom T, Nicolas ME, 2013.
Interactions between waterlogging and ray blight in pyrethrum. Crop & Pasture
Science 64 (7), 726-35.
162
Johanson A, Turner HC, Mckay GJ, Brown AE, 1998. A PCR-based method to
distinguish fungi of the rice sheath-blight complex, Rhizoctonia solani, R-oryzae
and R-oryzae-sativae. FEMS Microbiology Letters 162, 289-94.
Johnston PR, 1981. Phoma on New-Zealand grasses and pasture legumes. New Zealand
Journal of Botany 19, 173-86.
Jones S, Pethybridge SJ, Hay FS, Groom T, Wilson C, 2007. Baseline sensitivity of
Australian Phoma ligulicola isolates from pyrethrum to azoxystrobin and
difenoconazole. Journal of Phytopathology 155, 377-80.
Kiriamiti H, Camy S, Gourdon C, Condoret JS, 2003. Supercritical carbon dioxide
processing of pyrethrum oleoresin and pale. Journal of Agricultural and Food
Chemistry 51, 880-4.
Klosterman SJ, Atallah ZK, Vallad GE, Subbarao KV, 2009. Diversity, pathogenicity;
and management of Verticillium Species. Annual Review of Phytopathology 47,
39-62.
Kullnig-Gradinger CM, Szakacs G, Kubicek CP, 2002. Phylogeny and evolution of the
genus Trichoderma: a multigene approach. Mycological Research 106, 757-67.
Larkin RP, Fravel DR, 1998. Efficacy of various fungal and bacterial biocontrol
organisms for control of Fusarium wilt of tomato. Plant Disease 82, 1022-8.
Laurence MH, Summerell BA, Burgess LW, Liew ECY, 2011. Fusarium burgessii sp.
nov. representing a novel lineage in the genus Fusarium. Fungal Diversity 49,
101–12.
Leslie JF, Summerell BA, 2006. The Fusarium laboratory manual. Ames IA Blackwell
publishing.
Lievens B, Claes L, Vakalounakis DJ, Vanachter AC, Thomma BP, 2007. A robust
identification and detection assay to discriminate the cucumber pathogens
Fusarium oxysporum f. sp. cucumerinum and f. sp. radicis-cucumerinum.
Environmental Microbiology 9, 2145-61.
Lievens B, Rep M, Thomma BPHJ, 2008. Recent developments in the molecular
discrimination of formae speciales of Fusarium oxysporum. Pest Management
Science 64, 781-8.
Link HF, 1809. Observationes in ordines plantarum naturales, Dissetatio 1 ma. Berlin
Ges. NatKde 3: 1–42), Germany.
163
Lombard L, Van Der Merwe NA, Groenewald JZ, Crous PW, 2015. Generic concepts
in Nectriaceae. Studies in Mycology, 189-245.
Macdonald WL, 1995. Pyrethrum flowers: Production in Australia New York: Oxford
University Press.
Mandeel QA, Abbas JA, Saeed AM, 1995. Survey of Fusarium species in an arid
environment of Bahrain II. Spectrum of species on five isolation media.
SYDOWIA-HORN 47, 223-39.
Mansoori B, 2011. An improved ethanol medium for efficient recovery and estimation
of Verticillium dahliae populations in soil. Canadian Journal of Plant
Pathology-Revue Canadienne De Phytopathologie 33, 88-93.
Mcalpine D, 1902. Fungus diseases of stone-fruit trees in Australia and their treatment.
RS Brain, government printer.
Mcdonald GK, Dean G, 1996. Effect of waterlogging on the severity of disease caused
by Mycosphaerella pinodes in peas (Pisum sativum L). Australian Journal of
Experimental Agriculture 36 (2), 219-22.
Messiaen CM, Cassini R, 1981. Taxonomy of Fusarium. In. Fusarium: Diseases,
Bioligy and Taxonomy. Pennsilvania, USA: The Pennsilvania State University
Press 427-45.
Morgan-Jones G, White JF, 1983. Studies on the genus Phoma. III. Paraphoma, a new
genus to accommodate Phoma radicina. Mycotaxon 18, 57–65.
Morris SE, Davies NW, Brown PH, Groom T, 2006. Effect of drying conditions on
pyrethrins content. Industrial Crops and Products 23, 9-14.
Moslemi A, Ades PK, Groom T, Crous PW, Nicolas ME, Taylor PWJ, 2016.
Paraphoma crown rot of pyrethrum (Tanacetum cinerariifolium) Plant Disease
100, 2363-9.
Moslemi A, Ades PK, Groom T, Nicolas ME, Taylor PWJ, 2017a. Alternaria infectoria
and Stemphylium herbarum, two new pathogens of pyrethrum (Tanacetum
cinerariifolium) in Australia. Australasian Plant Pathology 46 (1), 91-101.
Moslemi A, Ades PK, Groom T, Nicolas ME, Taylor PWJ, 2017b. Fusarium
oxysporum and Fusarium avenaceum associated with yield-decline of pyrethrum
in Australia. European Journal of Plant Pathology 149 (1), 43-56.
Mycology-Online, 2016. In. http://www.mycology.adelaide.edu.au/.
164
Nelson PE, Tousson TA, Cook RJ, 1981. Fusarium: Diseases, Biology and Taxonomy.
Pennsilvania, USA: Pennsilvania State university Press.
Newell GR, 1998. Characterization of vegetation in an Australian open forest
community affected
by
cinnamon
fungus
(Phytophthora
cinnamomi):
implications for faunal habitat qualit. Plant Ecology 137, 55-70.
Nobile CJ, Bruno VM, Richard ML, Davis DA, Mitchell AP, 2003. Genetic control of
chlamydospore formation in Candida albicans. Microbiology Society Journal
149, 3629-37.
O’Donnell K, Kistler HC, Cigelnik E, Ploetz R, 1998. Multiple evolutionary origins of
the fungus causing Panama disease of banana: Concordant evidence from
nuclear and mitochondrial gene genealogies. National Academy of Sciences 97,
2044-9.
O'Donnell K, Sarver BA, Brandt M, Chang DC, Noble-Wang J, Park BJ, Sutton DA,
Benjamin L, Lindsley M, Padhye A et al., 2007. Phylogenetic diversity and
microsphere array-based genotyping of human pathogenic Fusaria, including
isolates from the multistate contact lens-associated U.S. keratitis outbreaks of
2005 and 2006. Jouranl of Clinical Microbiology 45, 2235-48.
O'Donnell K, Gueidan C, Sink S, Johnston PR, Crous PW, Glenn A, Riley R, Zitomer
NC, Colyer P, Waalwijk C et al., 2009a. A two-locus DNA sequence database
for typing plant and human pathogens within the Fusarium oxysporum species
complex. Fungal Genetics and Biology 46, 936-48.
O'Donnell K, Sutton DA, Rinaldi MG, Gueidan C, Crous PW, Geiser DM, 2009b.
Novel multilocus sequence typing scheme reveals high genetic diversity of
human pathogenic members of the Fusarium incarnatum, F. equiseti and F.
chlamydosporum species complexes within the United States. Journal of
Clinical Microbiology 47, 3851-61.
O’Donnell K, Sutton DA, Rinaldi MG,Sarver BAJ, Balajee SA, Schroers HJ,
Summerbell RC, Robert VARG, Crous PW, Zhang N et al., 2010. Internetaccessible DNA sequence database for identifying fusaria from human and
animal infections. Journal of Clinical Microbiology 48, 3708-18.
O'Donnell K, Rooney AP, Proctor RH,Brown DW, McCormic SP, Ward TJ, Frandsen
RJN, Lysoe E, Rehner SA, Aoki T et al., 2013. Phylogenetic analyses of RPB1
165
and RPB2 support a middle Cretaceous origin for a clade comprising all
agriculturally and medically important fusaria. Fungal Genetics and Biology 52,
20-31.
O'Donnell K, Ward TJ, Robert VaRG, Crous PW, Geiser DM, Kang S, 2015. DNA
sequence-based identification of Fusarium: Current status and future directions.
Phytoparasitica 43, 583-95.
Pankhurst CE, Magarey RC, Stirling GR, Blair BL, Bell MJ, Garside AL, 2003.
Management practices to improve soil health and reduce the effects of
detrimental soil biota associated with yield decline of sugarcane in Queensland,
Australia. Soil & Tillage Research 72, 125-37.
Paul NC, Deng JX, Lee JH, Yu SH, 2013. New records of endophytic Paecilomyces
inflatus and Bionectria ochroleuca from chili pepper plants in Korea.
Mycobiology 41, 18-24.
Paulitz TC, Okubara PA, Schillinger WF, 2006. First report of damping-off of canola
caused by Rhizoctonia solani AG 2-1 in Washington state. Plant Disaese 90,
829.
Pearce TL, Scott JB, Crous PW, Pethybridge SJ, Hay FS, 2015. Tan spot of pyrethrum
is caused by a Didymella species complex. Plant Pathology 65, 1170-84.
Peters JC, Lees AK, Cullen DW, Sullivan L, Stroud GP, Cunnington AC, 2008.
Characterization of Fusarium spp. responsible for causing dry rot of potato in
Great Britain. Plant Pathology 57, 262-71.
Pethybridge SJ, Wilson CR, 1998. Confirmation of ray blight disease of pyrethrum in
Australia. Australasian Plant Pathology 27, 45-8.
Pethybridge SJ, Hay FS, Groom T, 2003. Seasonal fluctuations in fungi associated with
pyrethrum foliage in Tasmania. Australasian Plant Pathology 32 (2), 223-30.
Pethybridge SJ, Hay FS, Wilson CR, 2004. Pathogenicity of fungi commonly isolated
from foliar disease in Tasmanian pyrethrum crops. Australasian Plant Pathology
33, 441-4.
Pethybridge SJ, Hay FS, Esker PD, Gent DH, Wilson CR, Groom T, Nutter F W, 2008a.
Diseases of pyrethrum in Tasmania: Challenges and prospects for management.
Plant Disease 92 (9), 1260-72.
166
Pethybridge SJ, Hay FS, Esker PD, Groom T, Wilson CR, Nutter FW, 2008b. Visual
and radiometric assessment for yield losses caused by ray blight in pyrethrum.
Crop Science 48, 343-52.
Pethybridge SJ, Hay FS, Groom T, 2010a. Identification of the factors contributing to
pyrethrum SPLASH syndrome. Unpublished, 24.
Pethybridge SJ, Hay FS, Groom T, Wilson CR, 2008c. Improving the fungicide-based
management program for ray blight disease in Tasmanian pyrethrum fields.
Plant Disease 92, 887-95.
Pethybridge SJ, Jones SJ, Shivas RG, Hay FS, Wilson CR, Groom T, 2008d. Tan spot: a
new disease of pyrethrum caused by Microsphaeropsis tanaceti sp nov. Plant
Pathology 57, 1058-65.
Pethybridge SJ, Ngugi HK, Hay FS, 2010. Use of survival analysis to assess
management options for ray blight in Australian pyrethrum fields. Plant
Pathology 59, 480-91.
Phookamsak R, Liu JK, Mckenzie EHC,Manamgoda DS, Ariyawansa H, Thambugala
KM, Dai DQ, Camporesi E, Chukeatirote E, Wijayawardene NN et al., 2014.
Revision of Phaeosphaeriaceae. Fungal Diversity 68, 159-238.
Q-Bank, 2016. Phoma methodologies. In.: http://www.q-bank.eu/.
Quaedvlieg W, Verkley GJM, Shin HD, Barreto RW, Alfenas AC, Swart WJ,
Groenewald JZ, Crous PW, 2013. Sizing up Septoria. Studies in Mycology, 30790.
Ramirez AM, Stoopen G, Menzel TR, Gols R, Bouwmeester HJ, Dicke M, Jongsma
MA, 2012. Bidirectional secretions from glandular trichomes of pyrethrum
enable immunization of seedlings. Plant Cell 24, 4252-65.
Rawnsley RP, Lane PA, Brown PH, Groom T, 2006. Occurrence and severity of the
weeds Anthriscus caucalis and Torilis nodosa in pyrethrum. Australian Journal
of Experimental Agriculture 46 (5), 711-6.
Rawnsley RR, Gracie AJ, Lane PA, Brown PH, Groom T, 2007. Seed ecology of
Apiaceae weeds in pyrethrum. In.: Seeds: Biology, Development and Ecology,
Wallingford, UK: CABI Publishing, 398-406.
Rehner S, 2001. Primers for Elongation Factor 1-alpha (EF1-alpha).
167
Rizzo DM, Garbelotto M, Davidson JM, Slaughter GW, Koike ST, 2002. Phytophthora
ramorum as the cause of extensive mortality of Quercus spp. and Lithocarpus
densiflorus in California. Plant Disease 86, 205-14.
Salardini AA, Chapman KSR, Holloway RJ, 1994a. Effect of basal and side-dressed
phosphorus on the achene yield and pyrethrins concentration in the achenes of
pyrethrum (Tanacetum cinerariifolium) and on soil and plant phosphorus.
Australian Journal of Agricultural Research 45 (1), 231-41.
Salardini AA, Chapman KSR, Holloway RJ, 1994b. Effect of potassium fertilization of
pyrethrum (Tanacetum cinerariifolium) on yield, pyrethrins concentration in dry
achenes and potassium concentration in soil and plant tissues. Australian
Journal of Agricultural Research 45 (3), 647-56.
Sangalang AE, Burgess LW, Backhouse D, Duff J, Wurst M, 1995. Mycogeography of
Fusarium species in soils from tropical, arid and mediterranean regions of
Australia. Mycological Research 99 523-8.
Saremi H, Okhovvat SM, Ashraf SJ, 2011. Fusarium diseases as the main soil borne
fungal pathogen on plants and their control management with soil solarization in
Iran. African Journal of Biotechnology 10.
Scott JB, Gent DH, Pethybridge SJ, Groom T, Hay FS, 2014. Crop damage from
Sclerotinia crown rot and risk factors in pyrethrum. Plant Disaese 98, 103-11.
Setter TL, Waters I, 2003. Review of prospects for germplasm improvement for
waterlogging tolerance in wheat, barley and oats. Plant and Soil 253 (1), 1-34.
Singh PK, Kumar V, 2013. Biological control of Fusarium wilt of chrysanthemum with
Trichoderma and Botanicals. Journal of Agricultural Technology 7, 1603-13.
Singh PK, Kumar V, 2014. Fusarium Wilt of chrysanthemum – problems and prospects.
Plant Pathology & Quarantine 1, 33-42.
Snyder WC, Hansen HN, 1940. The species concept in Fusarium. American Journal of
Botany 27, 64-7.
Snyder WC, Hansen HN, 1941. The species concept in Fusarium with reference to
section Martiella. American Journal of Botany 28, 738-42.
Snyder WC, Hansen HN, 1945. The Species concept in Fusarium with reference to
Discolor and other sections. American Journal of Botany 32, 657-66.
168
Snyder WC, Hansen HN, 1954. Variation and speciation in the genuse Fusarium.
Annals New York Academy of Sciences.
Srinath KV, Sarwar M, 1965. Alternaria blight of pyrethrum. Current Science 34, 295.
Srivastava SNS, 1953. On the occurrence of Phoma chrysanthemicola Hollos on
Chrysanthemum sp. Journal of Current Sciences 22, 216.
Summerell BA, Salleh B, Malaysia P, Leslie JF, 2003. A utilitarian approach to
Fusarium identification. The American Phytopathological Society 87, 118-28.
Summerell BA, Laurence MH, Liew ECY, Leslie JF, 2010. Biogeography and
phylogeography of Fusarium: a review. Fungal Diversity 44, 3-13.
Suraweera D, Groom T, Nicolas ME, 2015a. Effects of sprinkler irrigation during the
flowering period on flower development and pyrethrin accumulation in
pyrethrum.
Building
Productive, Diverse and Sustainable Landscapes
Publication in progress.
Suraweera DD, Groom T, Nicolas ME, 2015b. Impact of elevated atmospheric carbon
dioxide and water deficit on flower development and pyrethrin accumulation in
pyrethrum. Procedia Environmental Sciences 29, 5-6.
Tamura K, Nei M, 1993. Estimation of the number of nucleotide substitutions in the
control region of mitochondrial-DNA in humans and chimpanzees. Molecular
Biology and Evolution 10, 512-26.
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S, 2013a. Brief communication
MEGA6: Molecular evolutionary genetics analysis version 6.0.
Molecular
Biology and Evolution 12, 2725-9.
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S, 2013b. MEGA6: Molecular
evolutionary genetics analysis Version 6.0. Molecular Biology and Evolution 30,
2725-7.
Tóth S, Stričík M, Týr S, Vereš T, 2012. The possibilities of Slovakian pyrethrum
production. Pesticidi i fitomedicina (Belgrade) 27 (3), 245-52.
Uhlig S, Jestoi M, Parikka P, 2007. Fusarium avenaceum- The North Europian
situation. International journal of food microbiology 119, 17-24.
Vaghefi N, Pethybridge SJ, Ford R, Nicolas ME, Corus PW, Taylor PWJ, 2012.
Stagonosporopsis spp. associated with ray blight disease of Asteraceae.
Australasian Plant Pathology 41, 675-86.
169
Vaghefi N, 2014. Systematics and population biology of the ray blight pathogen of
pyrethrum in Australia. PhD thesis, The University of Melbourne.
Vaghefi N, Hay FS, Ades PK, Pethybridge SJ, Ford R, Taylor PWJ, 2015. Rapid
changes in the genetic composition of Stagonosporopsis tanaceti population in
Australian pyrethrum fields. Phytopathology 105, 358-69.
Vaghefi N, Hay FS, Pethybridge SJ, Ford R, and Taylor PWJ 2016a. Development of
multiplex PCR diagnostic assay for the detection of Stagonosporopsis species
associated with ray blight of Asteraceae. European Journal of Plant Pathology
146, 581-95.
Vaghefi N, Pethybridge SJ, Hay FS, Ford R, Nicolas ME, Taylor PWJ, 2016b.
Revisiting Stagonosporopsis species associated with chrysanthemum and
pyrethrum ray blight. Australasian Plant Pathology 45, 561-70.
West TF, 1959. The history of the African pyrethrum industry. Journal of the Royal
Society of Arts 107, 423-41.
White TJ, Bruns T, Lee S, Taylor J, 1990. Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. In.: PCR Protocols : A guide to
methods and applications 315-22.
Windles CE, 1991. Current status of Fusarium taxonomy. The American
Phytopathological Society, Plant Disease 81.
Wingfield MJ, De Beer ZW, Slippers B, Wingfield BD, Groenewald JZ, Lombard L,
Crous PW, 2012. One fungus, one name promotes progressive plant
pathology. Molecular Plant Pathology 13, 604-13.
Wollenweber HW, Reinking OA, 1935. Die Fusarien, ihre Beschreibung,
Schadwirkung, und Bekampfung. Berlin: Verlag Paul Parey.
Zhang, Schoch CL, Fournier J, et al., 2009a. Multi-locus phylogeny of Pleosporales: a
taxonomic, ecological and evolutionary re-evaluation. Studies in Mycology 64,
85-102S5.
Zhang L, Zheng L, Hsiang T, Lv R, Huang J, 2009b. An outbreak of head rot of
cabbage caused by Rhizoctonia solani AG2-1 in central China. Plant Disaese 93,
109.
Zhang, Crous PW, Schoch CL, Hyde KD, 2012. Pleosporales. Fungal Divers 53, 1-221.
Zwickl DJ, Hillis DM, 2002. Increased taxon sampling greatly reduces phylogenetic
error. Systematic Biology 51, 588-98.
170
Minerva Access is the Institutional Repository of The University of Melbourne
Author/s:
Moslemi, Azin
Title:
The pathology of pyrethrum yield-decline in Australia
Date:
2017
Persistent Link:
http://hdl.handle.net/11343/197712
File Description:
The pathology of pyrethrum yield-decline in Australia
Terms and Conditions:
Terms and Conditions: Copyright in works deposited in Minerva Access is retained by the
copyright owner. The work may not be altered without permission from the copyright owner.
Readers may only download, print and save electronic copies of whole works for their own
personal non-commercial use. Any use that exceeds these limits requires permission from
the copyright owner. Attribution is essential when quoting or paraphrasing from these works.