179 Mycological Progress 2(3): 179–196, August 2003 Phenotypic and genotypic identification and phylogenetic characterisation of Taphrina fungi on alder Kamila BACIGÁLOVÁ1, Ksenija LOPANDIC2, Manuel G. RODRIGUES3, Alvaro FONSECA3, Michael HERZBERG4, Wilhelm PINSKER5, and Hansjörg PRILLINGER2,* Dedicated to Prof. Dr. Hanns Kreisel on the occasion of his 70th birthday All Taphrina species are dimorphic with a mycelium stage biotrophic on vascular plants and a saprophytic yeast stage. European species of Taphrina on Alnus species (Betulaceae) were identified using morphological, physiological and molecular characteristics, the latter including determination of PCR fingerprints and of nucleotide sequences from selected nuclear ribosomal DNA regions. PCR fingerprinting gives a good overview of species identification, as do nucleotide sequences, which in addition, help to clarify phylogenetic relationships. Taphrina alni is a homogeneous species that exhibited more than 50% similarity in PCR fingerprinting with three different primers. Morphologically, it produces tonguelike outgrowths from female catkins of Alnus incana. Taphrina robinsoniana from A. rugosa and A. serrulata in North America is phylogenetically closely related to T. alni, but the two species could be separated by their PCR fingerprints, partial sequences of 26S rDNA (D1/D2) and ITS1/ITS2 sequences. T. epiphylla and T. sadebeckii are two phylogenetically closely related species. T. epiphylla causes witches brooms in crowns of A. incana. In addition, T. epiphylla forms slightly yellow white-grey leaf spots in midsummer on A. incana. Yellow white-grey leaf spots up to 10 mm on A. glutinosa are characteristic for T. sadebeckii. Both species can be separated well by PCR fingerprinting. Different from T. epiphylla, T. sadebeckii is genotypically more heterogeneous. Only two out of three different primers showed similarity values above 50% in different European strains of T. sadebeckii. Although genetic variability was not detected in complete sequences of the 18S ribosomal DNA of T. sadebeckii, ITS1/ITS2 sequences appeared to be more heterogeneous, too. Taphrina tosquinetii is a genotypically homogeneous species causing leaf curl on Alnus glutinosa. It was not possible to distinguish the yeast phases from different Taphrina species on Alnus using morphological and physiological characteristics only. B iotrophic fungi of the genus Taphrina Fr. are pathogens on ferns and higher plants. They are dimorphic with a saprophytic yeast stage and parasitic mycelial stage on plant hosts, causing characteristic morphological changes on infected plants: “leaf curl”, “witches brooms”, tongue-like outgrowths from female catkins, spots on leaves or deformed fruits. The genus Taphrina was described for the first time by Fries in 1832 (fde. in MIX 1949) who identified the species Taphrina populina on the poplar Populus nigra. SADEBECK Institute of Botany, Slovak Academy of Sciences, Dúbravská cesta 14, 845 23 Bratislava, Slovak Republic, botubaci@savba.sk 2 Institute of Applied Microbiology, University of Agricultural Science, Muthgasse 18, A–1190 Vienna, Austria 3 Centro de Recursos Microbiológicos (CREM), Secção Autónoma de Biotechnologia, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, Caparica, Portugal 4 University Marburg, Karl von Frisch Str., D–35043 Marburg, Germany 5 Insitut für Medizinische Biologie, Arbeitsgruppe Genetik, Universität Wien, Währingerstr. 10, A–1090 Wien * corresponding author, Email: h.prillinger@iam.boku.ac.at 1 (1893), the author of the first monograph of the Taphrina fungi, distinguished within the family Taphrinaceae three genera: Exoascus, Magnusiella and Taphrina. The last monograph from MIX (1949) and several other mycologists (GÄUMANN 1964, SA¸ATA 1974, KRAMER 1987) recognised in the order Taphrinales one family Taphrinaceae with the genus Taphrina. On the other hand, ARX (1967) and KREISEL (1969), described within the order Taphrinales two families: Protomycetaceae with five genera (Protomyces, Protomycopsis, Burenia, Volkartia and Taphridium) and Taphrinaceae with the genus Taphrina. The close phylogenetic relationship between Protomycetaceae and Taphrinaceae was confirmed in the last decade by chemotaxonomic and genotypic methods (PRILLINGER et al. 1990, 1993, 2000, KURTZMAN 1993, SJAMSURIDZAL et al. 1997). Both families, however, could be separated well by morphological, karyological and ultrastructural characteristics (HEATH, ASHTHON & KAMINSKY 1987). Phylogenetically, the Taphrinales can be included in the class Protomycetes within the Ascomycota (PRILLINGER et al. 2002, SCHWEIGKOFLER et al. 2002). Identification of the majority of the Taphrina fungi was made on the basis of morphological features, such as the size © DGfM 2003 180 and shape of asci and ascospores, habit of mycelium, presence or absence of stalk cells, shape and size of stalk cells and pathological effect on host plant tissues (SADEBECK 1893, GJAERUM 1964, SA¸ATA 1974) and physiological characteristics (MIX 1953, 1954). Although MIX (1949) in his monograph already described phenotypically all known Taphrina species, the recent taxonomic studies of the genus Taphrina using the methods of molecular biology helped to elucidate many discussed taxonomic and phylogenetic problems (NISHIDA et al. 1995, SJAMSURIDZAL et al. 1997, PRILLINGER et al. 2000, RODRIGUES & FONSECA 2003). The alder species (Alnus glutinosa Gaertn., A. incana Moench, A. incana x glutinosa, A. viridis DC.) are most frequently infected by Taphrina fungi causing “leaf curl”, “witches brooms”, ”tongue-like outgrowth” from female catkins or moderate-sized yellow spots on leaves. Because the Taphrina species on these host plants exhibit different anatomic-morphological properties, the taxonomy of the Taphrina species was often discussed. Taphrina tosquinetii, a cosmopolitan species causing “leaf curl” on A. glutinosa and A. incana x glutinosa and a rare species Taphrina alni causing tongue-like outgrowths from female catkins on A. incana and A. glutinosa, were taxonomically defined by SADEBECK (1893), GJAERUM (1966) and SA¸ATA (1974). The problem of characterising Taphrina species parasitising A. glutinosa and A. incana and forming the spots of different colours were approached by several authors. The white-grey moderate-sized spots on A. incana were considered as the first growth stage of Taphrina epiphylla and defined as T. epiphylla f. maculans (SADEBECK 1893). On the other hand, WIEBEN (1927) and JÖRSTAD (1945), described this species as Taphrina klebahni and Taphrina sadebeckii, respectively. MIX (1949) characterised the species causing “witches brooms” and in midsummer yellow spots on leaves on Alnus incana as Taphrina epiphylla, and those causing moderate-sized yellow spots on leaves of A. glutinosa as Taphrina sadebeckii. GJAERUM (1966) considered the species T. sadebeckii as a synonym of T. epiphylla, which causes yellow spots on leaves of A. glutinosa and “witches brooms” and rarely leaf spots on A. incana, though both taxa differ by pathological symptoms and by anatomical-morphological characteristics of apical part of the ascus. In the monograph of SA¸ATA (1974) T. epiphylla was described as a species causing only “witches brooms” on A. incana in Poland. Likewise BACIGÁLOVÁ (1994a, 1997) found rarely occurring leaf spots on A. incana in Slovakia and considered the spots were caused by the species T. sadebeckii. In the present paper, we focused on the genotypic investigations of several Taphrina species from A. incana and A. glutinosa isolated in Austria, Germany, and Slovakia. Using nucleotide sequences from selected nuclear rDNA regions we wanted to study phylogenetic relationships within the genus Taphrina. In addition, our objective was to find species boundaries between T. sadebeckii and T. epiphylla using PCR fingerprinting. The phenotypic and genotypic methods as well as morphological symptoms of disease and anatomic-mor© DGfM 2003 Taphrina fungi on alder phological characteristics were considered in determination of the discussed Taphrina species. So far we were not able to find enough yeast isolates from Taphrina viridis pathogenic on Alnus viridis. Material and methods Anatomic-morphological identification of Taphrina strains on Alnus The mycofloristic research in Slovakia showed that Alnus species (A. glutinosa, A. incana and Duscheckia alnobetula – syn. A. viridis) are frequently infected by fungi causing ”leaf curl”, ”witches brooms”, tongue-like outgrowths from female catkins or yellow or white-grey moderate-sized spots on leaves (BACIGÁLOVÁ 1994a). For identification of the Taphrina species both visual symptoms of infected plants and morphological features were used (habit of mycelium, shape and size of asci, presence or absence of stalk cells, shape and size of stalk cells and size of ascospores). They were observed by taking thin cross sections from naturally infected leaves or twigs in 50 % lactic acid. An evaluation was made by means of a Zeiss “Amplival” microscope with microphotograph equipment (BACIGÁLOVÁ 1994a, b). For the study both fresh and herbarium material were used. Herbarium items were obtained from the following institutes: Mycological Herbarium of the Slovak National Museum, Bratislava-BRA, Moravia Museum Brno-BRNM, Mycological Department, National Museum, Prague-PRM, Department of Botany, Faculty of Natural Sciences, Charles University, Prague-PRC, Natural History Museum Vienna-W. All collected specimens of Taphrina in Slovakia are deposited in the Mycological Herbarium of the Institute of Botany, Slovak Academy of Sciences SAV. Yeast strains In order to isolate yeast stages (anamorphic stage) from naturally infected host-plant tissues, pieces of Alnus incana or A. glutinosa with mature asci were fixed to the lids of plates containing malt extract (2 %), yeast extract (0,5 %), peptone (0,5%) (MYP) agar. Ascospores or blastospores from the asci grew on this medium as pale pink round yeast colonies. Colonies from spore-drops were aseptically isolated on glucose (2 %), yeast extract (0,5 %), peptone (1 %) (GYP) agar and cultivated at 21 °C for 10 days. Cryopreservation of yeast strains was performed in liquid medium with 10 % DMSO as a cryoprotectant (Bacto-Peptone 5g, yeast extract 3g, malt extract 3 g, DSMO 10 g, 1000 ml dest. H2O, pH 6,2) using a Forma Scientific –82 °C Freezer. All isolated specimens of Taphrina are deposited in the culture collection of Institutes of Applied Microbiology, University of Agricultural Science, Vienna (Austrian Center Biological Resources). The Taphrina species used in this study are shown in Table 1. 181 Mycological Progress 2(2) / 2003 Fig. 1. Tongue-like outgrowths from female catkins of Alnus incana caused by T. alni (A; Vysoké Tatry Mts., valley of KeÏmarskej Bielej vody, 1200 m, 3th August 1987, K. Bacigálová, SAV) and asci of T. alni in the subcuticular layer of tongue-like outgrowths from female catkins of A. incana (B) Ultrastructure For scanning electron microscopy, square blocks (3–5 mm) were cut from solid media yeast cultures. The blocks were left for 4 days in a vapour chamber the bottom of which was covered with 5 % w/w glutaraldehyde (VOBIS, 1991). In the next step the blocks where gently placed into 5 % w/w glutaraldehyde for 12 hours and later in water for 2 hours, with a change every 30 minutes. After 12 hours in ethylene glycol monoethyl ether the samples where left in 100 % dehydrated acetone for 6 hours. The acetone was changed every two hours. The fixed material was critical point dried in a Polaron E 3000 Apparature (Balzer Union) and sputter-coated with gold using a sputter coater (Balzer Union). The samples were observed with a Hitachi S-530 microscope. The images were recorded on Agfapan (APX 100) Film. Phenotypic characterisation The physiological properties of the yeast isolates were investigated according to the methods described by YARROW (1998) with minor modifications. Fermentation tests were carried out for 3 weeks at 21 °C using Durham tubes. The carbon compound assimilation tests were performed in culture tubes with Yeast Nitrogen Base (6.7g), Noble Agar (15g), bromcresolpurple (1 ml) and carbon sources (10 %), pH 6,5 for 21 days at 21 °C and in API 50 strips (bio Mérieux), respectively. API strips were incubated at 21 °C and evaluated after 7 and 21 days. Utilisation of nitrogen sources was examined in culture tubes with Yeast Carbon Base agar slants containing bromcresolpurple (pH 6,5) using a starved inoculum (NAKASE & SUZUKI 1986). Vitamin requirements were tested after at least 3 consecutive inoculations on vitamin-free medium. Genotypic characterisation DNA preparation Genomic DNA was isolated as described by DE GRAAFF et al. (1988) with minor modifications. A 20 mg portion of wet yeast cells grown on solid growth medium was suspended in 0.4 ml of lysis buffer containing 0.1 M Tris (hydroxymethyl)aminomethane, 1.4 M NaCl and 50 mM ethylenediaminetetraacetate (EDTA), pH 8.0 in a 1.5 ml Eppendorf tube. The suspension was frozen at –20 °C and thawed three times. An aliquot of 0.4 ml of phenol was added and the freezing-thawing procedures were repeated. The mixture was heated in a water-bath at 55 °C for 10 min. and supplemented with 0.4 ml chloroform. After heating at 55 °C for 10 min., the mixture was centrifuged at 15.500 x g for 30 min. A volume of 0.3 ml of the upper aqueous layer containing the nucleic acids was transferred into a new Eppendorf tube and precipitated with 0.45 ml of 2-propanol, centrifuged at 15.500 x g for 10 min. and the pellet was washed with 0.7 ml of 70 % ethanol. The pellet was dried under vacuum and dissolved in 50 µl of TE buffer (10 mM Tris.HCl, 1 mM EDTA, pH 8.0). To remove RNA molecules 0.05 µg ml-1 RNase (Roche, Vienna, Austria) was added and the reaction mixture was incubated at 37 °C for 1 hour. To control purity and concentration, 15 µl of the DNA preparation mixed with 2 µl of loading buffer (40 % sucrose, 0.25 % bromphenol blue) was analysed by electrophoresis on a 1 % agarose gel (with 0.5 µg ml-1 ethidium bromide) run in TBE buffer ( 5.4 g l-1 Tris.HCl, 2.75 g l-1 boric acid, 4.1 g EDTA x 2H2O, pH 8.0) at 6 Vcm-1 for 45 min. The preparation was diluted with TE buffer to a concentration of approximately 5 ng µl-1 and stored at –20 °C. © DGfM 2003 182 Taphrina fungi on alder Fig. 2. “Witches brooms” on Alnus incana caused by T. epiphylla (A; Slovenské Beskydy Mts., valley of the river O‰ãadnica, 697 m, 31th May 1989, K. Bacigálová, SAV) and asci of T. epiphylla in the subcuticular leaf layer of A. incana (B). Yellow or white-grey spots on leaves of A. incana caused by T. epiphylla (C; Vysoké Tatry Mts., Tatranská Lomnica in the park, 760 m, 8th August 2002, K. Bacigálová, SAV) and asci in the subcuticular leaf layer (D). “Witches brooms” are indicated by arrows. PCR fingerprinting Amplification reactions were carried out in 50 µl volumes containing Tris-based buffer pH 8.8 (20 mM Tris.HCl, 10 mM KCl, 10 mM (NH4)2SO4, 0.01 % Triton 100), 0.015 % Bovine serum albumin (heat treated before use at 75 °C for 15 min.), 0.1 mM each of dATP, dCTP, dGTP and dTTP (Promega, Madison, Wisconsin, USA), 1 ng µl-1 primer (Codon Genetic System, Vienna, Austria), 5–20 ng of template DNA, 0.02 U µl-1 Taq-DNA Polymerase (Biomedica, Vienna, Aust© DGfM 2003 ria) and overlaid with 1 drop of mineral oil (Sigma Chemie GmbH, Gisenhofen, Germany). Polymerase chain reaction (PCR) was performed in a Trio-Thermoblock TB1 thermocycler (Biometra, Göttingen, Germany) programmed for 40 cycles of: denaturation at 98 °C for 15s; annealing at 40 °C for 90s; extension at 72 °C for 100s. Two artificial decamers: TGCCGAGCTG (Primer 1), TGCAGCGTGG (Primer 2; RAPDPCR), and one minisatellite 5’-GAGGGTGGCGGTTCT-3’ (Primer 3), derived from the core-sequence of the wild-type Mycological Progress 2(2) / 2003 183 Fig. 3. Moderate sized yellow or white-grey leaf spots on Alnus glutinosa caused by T. sadebeckii (A; Malé Karpaty Mts., Píla, valley of the river Gidra, 245 m, 31th August 1988, K. Bacigálová, SAV) and asci of T. sadebeckii in the subcuticular leaf layer of A. glutinosa (B). Fig. 4. “Leaf curl” on Alnus glutinosa caused by T. tosquinetii (A; Malé Karpaty Mts., Limbach, 181 m, 31th August 1988, K. Bacigálová, SAV) and asci of T. tosquinetii in the subcuticular leaf layer of A. glutinosa (B) © DGfM 2003 184 Taphrina fungi on alder Fig. 5. Scanning electron microscopy of yeast like cultures of T. alni HA1364 (A), T.epiphylla HA1339 (B), T. sadebeckii HA1345 (C) and T. tosquinetii HA1347 (D) phage M13 were used as single primers. A 20 µl aliquot of the reaction mixture was mixed with 2 µl loading buffer and applied to a 1.5 % agarose gel. The gel image was photographed under UV and stored in the UVP gel analysis system. Sequencing of 18S rRNA encoding gene A fragment of approximately 2 kb was amplified with the primers NS0 and ITS2p (Table 2). The PCR was performed in 50 µl reaction mixture containing Tris-based buffer pH 8.8 (10 mM KCl, 10 mM (NH4)2SO4, 20 mM Tris.HCl, 0.01% Triton 100), 4.5 mM MgSO4, 0.2 mM of each deoxynucleotide triphosphate (Peqlab), 1 ng µl-1 of each primer, 5–20 ng © DGfM 2003 of DNA preparation and 0.8 U BioTherm-DNA-Polymerase (GeneCraft). Total of 36 amplification cycles were performed in a Trio-Thermoblock TB1 thermocycler (Biometra): 98 °C, 15 sec.; 59 °C, 1 min.; 72 °C, 2 min. The reaction was completed by a last elongation step at 72 °C for 10 min.. To remove the remaining primers and nucleotides, the PCR products were purified by QIAquick PCR Purification Kit (Qiagen). The amplicons were sequenced by IBL (Vienna, Austria) using a fluorescent dye dideoxy nucleotide termination protocol on a 377 DNA Sequencer (Applied Biosystems, Foster City, CA, U.S.A.). Table 2 shows the primer sequences used for the estimation of 1748 bp of the 18S rDNA. The sequences 185 Mycological Progress 2(2) / 2003 are deposited at Genbank with accession numbers listed in Tab. 1. A pairwise alignment was calculated using the ClustalX program (THOMPSON et al. 1997) and visually corrected. Phylogenetic relationships were estimated by PAUP4.0b10 (SWOFFORD 2002) treating all alignment gaps as missing. Maximum parsimony trees were inferred using heuristic search, stepwise addition and tree bisection-reconnection. Confidence values for individual branches were determined by a bootstrap analysis with 100 repeated samplings of the data. Sequencing of the D1/D2 and ITS1-5.8S-ITS2 region PCR amplification prior to sequencing employed primers NS7 (5’-GAGGCAATAACAGGTCTGTGATGC-3’) or ITS5 (5’-GGAAGTAAAAGTCGTAACAAGG-3’) and LR6 (5’CGCCAGTTCTGCTTACC-3’) using a Uno II Thermal Cycler (Biometra) and the resulting amplicon was purified with the GFX Band Purification Kit (Amersham Pharmacia Biotech). Cycle sequencing of the D1/D2 variable domains of the 26S rDNA employed forward NL1 (5’-GCATATCAATAAGCGGAGGAAAAG-3’) and reverse primer NL4 (5’ GGTCCGTGTTTCAAGACGG-3’) and that of the ITS spacer region (comprising ITS1, 5.8S rRNA gene and ITS2) employed the ITS1 (5’-TCCGTAGGTGAACCTGCGG-3’) and ITS4 primer (5’-TCCTCCGCTTATTGATATGC-3’), following standard protocols. Sequences were obtained with an ALFexpress II DNA Analyser (Amersham Biosciences), aligned with MegAlign (DNAStar software package) and visually corrected. Phylogenetic trees were computed with PAUP version 4.0b8 (Sinauer Associates, Inc.) using the neighbourjoining method and the Kimura two-parameter model for calculating distances. Bootstrap analysis was based on 1000 replicates. Nucleotide sequences were deposited in GenBank under the accession numbers listed in Table 1. Results Characteristics of parasitic (mycelial) stage The investigation of the infection symptoms have indicated that different Taphrina species can be distinguished according to their morphological features. Taphrina alni produced rather large tongue-like outgrowths from the young female catkins of Alnus incana covered by asci as a white cover (Fig. 1). The second species Taphrina epiphylla formed typical “witches brooms“ in crowns of A. incana (Fig. 2 A). They grow straight up (negative geotropism) and remain on the trees during the next vegetation seasons. The surface of leaves of young shoots of “witches brooms” are covered by matured asci as a white cover (Fig. 2B). T. epiphylla forms in addition slightly yellow white-grey leaf spots on leaves of A. incana in midsummer (August) (Fig. 2 C,D). The species Taphrina sadebeckii causes moderate-sized (up to 10 mm in diam.) yellow white-grey spots on the matured leaves of Alnus glutinosa (Fig. 3). The spots are never joined together to cause a “leaf-curl” as in the case of T. tosquinetii. Typical deformations of part or of the whole blade of leaves (“leaf-curl”), which become white when covered by asci, were caused by Taphrina tosquinetii on Alnus glutinosa (Fig. 4). Saprophytic yeast stage: morphological and physiological characteristics The yeast cultures of T. alni, T. epiphylla, T. sadebeckii and T. tosquinetii could not be distinguished morphologically on GYP agar after 1 month (Fig. 5). The pink, round and shiny colonies of blastospores on GYP and MYP agar is a first indication that all isolates belonged to the genus Taphrina. All investigated Taphrina isolates showed positive EAS tests, negative DBB tests and positive urease tests. Table 3. shows results of the physiological investigations using the standard methods on agar medium (LAASER 1989, YARROW 1998) and API 50 CH strips. All Taphrina strains (T. alni, T. epiphylla, T. sadebeckii and T. tosquinetii) displayed no fermentation ability. They showed no growth at 0.01 % and 0.1 % cycloheximide and in a 50 % glucose-medium. The maximum growth temperature was 25 °C. Of all tested vitamines only thiamin is necessary for growth. Taphrina species are able to assimilate a wide range of carbon compounds. As indicated in bold in Table 3, differences in the carbon assimilation pattern were observed with L/D-arabinose, maltose, α,α-trehalose, α-methyl-D-glucoside, arbutin, adonitol, Dglucono-1,5-lacton, propane-1,2-diol, L-xylose, D-lyxose, amygdaline, L-fucose and L-arabitol. No differences were observed among investigated Taphrina strains in nitrogen assimilation patterns (Table 3). It was not possible to separate T. alni, T. epiphylla, T. sadebeckii and T. tosquinetii unequivocally using physiological characteristics only. L-arabinose and D-glucono-1,5-lacton are useful to distinguish T. sadebeckii and T. tosquinetii (Table 3). Phylogenetic analysis Phylogenetic analysis based on the 18S rDNA sequences showed that the genus Taphrina parasitising different Alnus plants forms a cluster of closely related species in a maximum parsimony tree (Fig. 6). The topology of a neighbour-joining tree was similar (results not shown). Although statistically not very well supported (< 50 %), the cluster occupies a separate position on the tree in comparison to the other Taphrina strains isolated from species of Prunus (T. deformans, T. padi, T. communis, T. mirabilis, T. pruni, T. insititiae, T. wiesneri, T. flavorubra, T. pruni-subcordata), Ulmus (T. ulmi), Populus (T. populina, T. johansonii), Betula (T. nana, T. carnea), Ostrya (T. virginica) and Acer (T. letifera). Within the clade two groups are recognisable. Three T. tosquinetii isolates from Alnus glutinosa and different strains of T. alni and T. robinsoniana constitue the first cluster with 65 % bootstrap support. We sequenced T. robinsoniana strain CBS 382.39 and compared it with the corresponding sequence from Genbank (AB000958). Nucleotide differences at 18 positions were de© DGfM 2003 186 Taphrina fungi on alder Fig. 6. Phylogenetic tree based on 18S rDNA sequences of Taphrina species parasitising on Alnus and related taxa. This is 1 of 9503 most parsimonious trees (tree length = 1691, CI = 0.737, RI = 0.691, RC = 0.509, HI = 0.263, gaps are treated as missing). The bootstrap factors less than 50 % are not shown. Saccharomyces cerevisiae, Taphrina farlowii and T. deformans were used as out group. Own isolates are indicated by HA numbers and bold face. The other species are indicated by their accession numbers. © DGfM 2003 187 Mycological Progress 2(2) / 2003 termined, which explains the different positions in Fig. 6. The second cluster, supported by a confidence level of 99 %, is composed of T. epiphylla isolated from Alnus incana and T. sadebeckii isolates from Alnus glutinosa. In addition, we studied phylogenetic relationships of Taphrina isolates from A. incana and A. glutinosa by employing partial sequences of 26S rDNA as well as the ITS1-5.8S-ITS2 sequences (Fig. 7). The tree topologies from neighbour-joining and maximum parsimony analyses of the D1/D2 region and of the ITS sequences were similar and only the former are shown. The results coming from both data sets support the existence of three clusters within the Taphrina isolates from Alnus. The clade comprising of closely related T. sadebeckii and T. epiphylla is supported with bootstrap factors of 100 % in both trees. Investigated D1/ D2 regions of 26S rDNA of T. sadebeckii CBS102170 (HA1308) and T. epiphylla HA1439 strains showed only two nucleotide differences. On the basis of calculated nucleotide differences of ITS regions it was difficult to distinguish among T. sadebeckii and T. epiphylla strains. For example there are 3 base difference between T. sadebeckii CBS102170 (HA1308 ) and T. epiphylla HA1439 and the same number of differences are between T. sadebeckii HA1308 and HA1326 strains. Genotypic identification PCR fingerprinting was performed with three primers under conditions already described under the Materials and Methods section. Genomic similarity levels were calculated by comparing PCR fingerprints of every individual species pair. Fig. 8 shows PCR fingerprints of Taphrina alni strains, isolated from white alder (Alnus incana) in Slovakia (HA 1364), Germany (HA857), Austria (HA872, HA859) and of an American strain of Taphrina robinsoniana (HA850). Calculated genomic similarity levels among European strains lie over 50 % (Tab. 4). T. robinsoniana was characterised as a genotypically different species from T. alni, showing similarities in the PCR fingerprinting patterns less than 50 %. The patterns of Austrian isolates (HA872, HA859) show more differences with those of Slovak (HA1364) and German (HA 857) isolates (Fig. 8). Taphrina epiphylla strains parasitising A. incana (Slovakia) and causing different pathological symptoms, yellow spots on leaves (HA1440) and “witches brooms” (HA1334, HA1439), respectively, generated the PCR fingerprints of similarity levels > 60 % with all three primers (Fig. 9; Tab. 5). PCR fingerprints of T. sadebeckii strains isolated from infected leaves of A. glutinosa with typical yellow spots showed different similarity coefficients depending on the primer used. Higher similarity coefficients (>60%) were detected among strains HA1344, HA1345 (Slovakia), HA1308, HA1309, HA1325 and HA1326 (Germany) when they were investigated with primer 1 and 3, than when primer 2 was used in the amplification reaction (Fig. 10; Table 6A, B). The similarity coefficients were remarkably below 50 % when primer 2 was used (Fig. 10; Tab. 6B). These data indicate that T. sadebeckii is genetically the most heterogeneous species. Using PCR fingerprinting it was, however, no problem to distinguish T. epiphylla HA1440 with yellow spots on A. incana from the different T. sadebeckii isolates. The similarity coefficients were below 50% with all the three primers (Fig. 10; Tab. 6). Based on PCR fingerprinting T. epiphylla can be considered as a distinct species closely related to T. sadebeckii. Fig. 11 shows the PCR fingerprints of Taphrina tosquinetii strains isolated from European alder (Alnus glutinosa) in Slovakia (HA1365, HA1346, HA1335), Germany (HA1327, HA1310, HA851, HA856), Austria (HA1328, HA1329, HA 1330) and USA (HA1314). Independent of the primers used, the average similarity coefficient lies above 60 % (Fig. 11; Tab. 7). Discussion In a comparative study LAASER (1989) has investigated assimilation tests in liquid medium of many Taphrina species. His studies showed that about 90 % of the investigated Taphrina species were able to grow on glucose, maltose, cellobiose, glycerol, sorbitol, mannitol, succinate, nitrate, nitrite and at 25 °C. No growth was observed with rhamnose, melibiose, lactose, erythritol, galactidol, myo-inositol, D-glucuronate, methanol, creatin and creatinine. With the exception of maltose and nitrite, the investigated Taphrina species on alder fit well in this physiological profile. In the investigation of LAASER (1989) it was not possible to distinguish 9 different strains of T. tosquinetii from 5 strains of T. sadebeckii strains. As already shown by PRILLINGER et al. (1990) and SJAMSURIDZAL et al. (1997), the genus Taphrina is homogeneous. T. vestergrenii is a remarkable exception having fucose in its cell walls and distinct 18S and 26S ribosomal DNA sequences (PRILLINGER et al. 1990, 1993, RODRIGUES & FONSECA 2003). PRILLINGER et al. (2001) suggested the new genus Fucotaphrina ined. for this species. T. californica D14166, T. maculans AB000953, T. farlowii AB000950 and T. deformans MUCL 30957 (X69852) were identified as contaminants by PRILLINGER et al. (1990) and SJAMSURIDZAL et al. (1997, see also Fig. 6). Based on 26S rDNA D1/D2 RODRIGUES & FONSECA (2003) demonstrated an interspecies sequence divergence of 5 % for the genus Taphrina and 4 % for the genus Protomyces. In the present study we found an interspecies sequence divergence within the 18S rDNA of 2.4 % for the investigated Taphrina (T. carnea/T. flavorubra Fig. 6) species and 2.5 % for the investigated Protomyces species (P. macrosporus/P. lactucae-debilis Fig. 6). T. alni differs in the 18S rDNA from T. sadebeckii (HA1308, HA1309, HA1326, HA1345) in 8 bp and from T. tosquinetii in 4 bp (Fig. 6). T. sadebeckii (HA1308, HA1309, HA1326, HA1345) differs from T. epiphylla in 1 bp except strain HA1325 which differs in 2 bp. The greatest 18S rDNA sequence divergence within © DGfM 2003 188 Taphrina fungi on alder Fig. 7. Phylogenetic trees of Taphrina spp. on Alnus based on (A) the D1/D2 domains of the 26S rRNA and (B) the ITS region (ITS1 + 5.8S rRNA gene + ITS2). The bootstrap factors less than 50% are not shown. Taphrina deformans and T. pruni were used as outgroup. Taphrina on Alnus was found between T. sadebeckii and T. tosquinetii (10 bp). Taphrina species parasitising Alnus incana and Alnus glutinosa are phylogenetically closely related species. Two or three sub-clusters are recognisable on the phylogenetic trees constructed on the basis of the complete sequences of 18S rDNA, D1/D2 domain of 26S rDNA and ITS1-5.8S-ITS2 © DGfM 2003 fragments, respectively. Taphrina alni and T. robinsoniana isolates from Alnus incana, A. rugosa and A. serrulata represent a different clade from T. tosquinetii strains isolated from A. glutinosa. These two groups differ also according to their pathological symptoms. Whereas T. alni and T. robinsoniana form tongue-like outgrowths from female catkins, T. tosquinetii causes “leaf curl” on A. glutinosa. The complete 18S Mycological Progress 2(2) / 2003 189 Fig. 8. PCR fingerprints of Taphrina alni strains (1. HA1364; 2. HA857; 3. HA872; 4. HA859) and a Taphrina robinsoniana strain (5. HA850) Fig. 9. PCR fingerprints of Taphrina epiphylla strains causing „witches brooms“ (1. HA1334; 2. HA1439) and yellow or white-gray spots on leaves (3. HA1440) of Alnus incana rDNA from the American isolate T. robinsoniana is identical with the sequence of strains of T. alni, but their PCR fingerprints differ considerably (Fig. 8). T. alni and T. robinsoniana cause very similar pathological symptoms. The only difference is that T. alni forms larger tongue-like outgrowths on A. incana (MIX 1949). The second clade, which is statistically supported with a 99 % bootstrap coefficient, is composed of T. epiphylla and T. sadebeckii isolates. Whereas T. sadebeckii forms exclusively yellow moderate sized spots covered with white cover on the matured leaves of A. glutinosa, T. epiphylla is characterised by the formation of both “witches brooms” and yellow spots covered with white cover on leaves of A. in© DGfM 2003 190 Taphrina fungi on alder Fig. 10. PCR fingerptints of Taphrina epiphylla strain (1. HA1440) causing yellow white-gray spots on leaves of Alnus incana and Taphrina sadebeckii strains (2. HA1344; 3. HA1345; 4. HA 1308; 5. HA 1309; 6. HA1325; 7. HA1326) causing yellow white-gray spots on leaves of Alnus glutinosa Fig. 11. PCR fingerprints of Taphrina tosquinetii strains (1. HA1314; 2. HA1365; 3. HA1346; 4. HA1335; 5. HA1327; 6. HA1310; 7. HA851; 8. HA856; 9. HA1328; 10. HA1329; 11. HA1330) isolated from european alder (Alnus glutinosa) cana. The morphological features of T. sadebeckii and T. epiphylla were discussed by several taxonomists before they occupied the current taxonomic positions (SADEBECK 1893, WIEBEN 1927, JÖRSTAD 1945, MIX 1949, GJAERUM 1966). In the ITS1/ITS2 tree the bootstrap support for the T. epiphylla and T. sadebeckii clade is 67 % and 88 %. The PCR fingerprinting also exhibits differences between investigated isolates (Fig. 10, Tab. 6A,B). Interestingly, whereas two T. epiphylla strains causing “witches brooms” and yellow spots, respectively, show almost identical fingerprints (> 60 % similarity levels), within the T. sadebeckii isolates more variability was detected. © DGfM 2003 Acknowledgements This study was supported by grant agency VEGA (No 2/1069/ 21) and the agency SAIA, Aktion Österreich-Slowakei (No 35s15). Thanks to the ZIB-BOKU for giving financial support. M.H. thanks the “Deutsche Bundesstiftung Umwelt” for a Ph.D. scholarship and financial support. We thank Prof. Dr. G. Kost for the use of scanning electron microscope. This work was supported by a grant from FWF (P13876-MOB). For the electronic data processing we have to thank Ing. S. Huss. Mycological Progress 2(2) / 2003 References ARX JA (1967) Pilzkunde. J. Cramer-Lehre. BACIGÁLOVÁ K (1994a) Species of Taphrina on Alnus in Slovakia. – Czech Mycology 47: 223-236. BACIGÁLOVÁ K (1994b) Taphrina viridis – a new species for the Karpaty Mts. – Czech Mycology 47: 285-288. BACIGÁLOVÁ K (1997) Ecological notes to the distribution of Taphrinales fungi in Slovakia. – Biologia Bratislava 52: 7-10. DE GRAAFF L, VAN DEN BROEK HWJ, VISSER J (1988) Isolation and transformation of the pyruvate kinase gene of Aspergillus nidulans. – Current Genetics. 13: 315-321. FRIES E (1832) Taphrina Fries. In Systema Mycologicum 3: 520 (fde. MIX 1949). GÄUMANN E (1964) Die Pilze. Grundzüge ihrer Entwicklungsgeschichte und Morphologie. Birkhäuser, Basel und Stuttgart. GJAERUM HB (1964) The genus Taphrina Fr. in Norway. – Nytt Magasin for Botanikk 11: 5-26. GJAERUM HB (1966) Oretunge forarsaket av Taphrina alni (B. & Br.) n. comb. i Norge. Taphrina alni (B. & Br.) n. comb. in Norway. – Saertrykk AV Blyttia 24: 188-195. HEATH IB, ASHTHON ML, KAMINSKYJ SGW (1987) Mitosis as a phylogenetic marker among the yeasts – review and observations on novel mitotic systems in freeze substituted cells of the Taphrinales. – Studies in Mycology 30: 279-297. JÖRSTAD I (1945) Parasittsoppene pa kultur og nyttevekster i Norge. I. Sekksporesopper (Ascomycetes) og konidiesopper (Fungi imperfecti). Melding nr.1fra States plantepathology institute Tillegg C til Landbruksdirektörens melding for 1943. pp.142. Oslo KRAMER CL (1987) The Taphrinales. – Studies in Mycology 30: 151166. KREISEL H (1969) Grundzüge eines natürlichen Systems der Pilze. Jena KURTZMAN CP (1993) Systematics of the ascomycetous yeasts assessed from ribosomal RNA sequence divergence. – Antonie van Leeuwenhoek 63: 165-174. LAASER G (1989) Vergleichende systematische Studien an Basidiomcetenhefen unter besonderer Berücksichtigung der Hefestadien. – Bibliotheca Mycologica 130: 1-335. MIX AJ (1949) A monograph of the genus Taphrina. – The University of Kansas Science Bulletin 33: 1-167. MIX AJ (1953) Differentiation of species of Taphrina in culture. Utilization of nitrogen compounds. – Mycologia 45: 649-669. MIX AJ (1954) Differentiation of species of Taphrina in culture. Utilization of carbon compounds. – Mycologia 46: 721-727. NAKASE T, SUZUKI M (1986) Bullera megalospora, a new species of yeast forming large ballistospores isolated from dead leaves of Oryza sativa, Miscanthus sinensis and Sasa sp. in Japan. – Journal General Applied Microbiology 32: 225-240. NISHIDA H, ANDO K, ANDO Y, HIRATA A, SUGIYAMA J (1995) Mixia osmundae: transfer from the Ascomycota to the Basidiomycota based on evidence from molecules and morphology. – Canadian Journal of Botany 73: 660-666. PRILLINGER H, DÖRFLER C, LAASER G, ECKERLEIN B, LEHLE K (1990) Ein Beitrag zur Systematik und Entwicklungsbiologie Höherer Pilze: Hefe-Typen der Basidiomyceten. Teil I: Schizosaccharomycetales, Protomyces-Typ. – Zeitschrift für Mykologie 56: 219-250. 191 PRILLINGER H, OBERWINKLER F, UMILE C, TLACHAC K, BAUER R, DÖRFLER C, TAUFRATZHOFER E (1993) Analysis of cell wall carbohydrates (neutral sugars) from ascomycetous and basidiomycetous yeasts with and without derivatization. – Journal of General and Applied Microbiology 39: 1-34. PRILLINGER H, BACIGÁLOVÁ K, LOPANDIC K, BINDER M (2000) Taphrina padi in Bayern und der Slowakei. – Hoppea 61: 275294. PRILLINGER H, LOPANDIC K, SUZUKI M, STERFLINGER K, WEBER E, OBERWINKLER F (2001) Molecular phylogeny and systematics of yeasts and yeast-like fungi with specialy reference to the Asco and Basidiomycota. – Yeast Newsletter 50: 75-76 PRILLINGER H, LOPANDIC K, SCHWEIGKOFLER W, DEAK R, AARTS, HJM, BAUER R, STERFLINGER K, KRAUS G, MARAZ A. (2002) Phylogeny and Systematics of the Fungi with Special Reference to the Ascomycota and Basidiomycota. In Breitenbach M, Crameri R, Lehrer S (eds.): Fungal Allergy and Pathogenicity. Chemical Immunology Vol. 81, pp. 207-294. Karger, Basel. RODRIGUES MG, FONSECA A (2003) Molecular systematics of the dimorphic ascomycete genus Taphrina. – International Journal Systematic Evolutionary Microbiology 53: 607-616. SADEBECK R (1893) Die parasitischen Exoasceen. Eine Monographie. – Jahrbuch der Hamburger Wissenschaft Anstalten 10: 1-108. SA¸ATA B (1974) Flora Polska, Grzyby Tom VI. Szpetkowe-Taphrinales. – Panstwowe Wydawnictwo Naukowe, WarszawaKraków 6: 1-87. SCHWEIGKOFLER W, LOPANDIC K, MOLNÁR O, PRILLINGER H. (2002) Analysis of phylogenetic relationships among Ascomycota with yeast phases using ribosomal DNA sequences and cell wall sugars. – Organisms Diversity Evolution 2: 1-17. SJAMSURIDZAL W, TAJIRI Y, NISHIDA H, THUAN TB, KAWASAKI H, HIRATA A, YOKOTA A, SUGIYAMA J (1997) Evolutionary relationships of members of the genera Taphrina, Protomyces, Schizosaccharomyces, and related taxa within the archiascomycetes: Integrated analysis of genotypic and phenotypic characters. – Mycoscience 38: 267-280. SWOFFORD DL (2002) PAUP*, Phylogenetic analysis using parsimony (*and other methods). Version 4. Sinauer Associates, Sounderland. Massachusetts. THOMPSON JD, GIBSON TJ., PLEWNIAK F, JEANMOUGIN F, HIGGINS DG (1997) The ClustalX windows interface: flexible strategies for multiple sequence alignments aided by quality analysis tools. – Nucleic Acids Research 24: 4874-4882. VOBIS G (1991) Morphological approaches to rapid recognition of sporangiate and non-sporangiate genera. In Dietz, A. (coordinator): Actinoplanetes and Maduromycetes, Isolation and Characterization. International symposium on biology of Actinomycetes. pp 1-33. University of Wisconsin, Madison, USA. WIEBEN M (1927) Die Infection, die Myzelüberwinterung und die Kopulation bei Exoasceen. – Forschungen auf den Gebiet der Pflanzenkrankheiten und der Immunität in Pflanzenreiche 3: 139-176. YARROW D (1998) Methods for the isolation, maintenance and identification of yeasts. In Kurtzman CP, Fell JW (eds) The yeasts, a taxonomic study. 4th edition pp.77-100. Elsevier, Amsterdam. Accepted: 20.5.2003 © DGfM 2003 192 Taphrina fungi on alder Tab. 1. Taphrina specimens and other strains used for genotypic and phylogenetic characterisation Strain Source Neolecta vitellina UME29192 Pneumocystis carini Origin 18S rDNA Taxon 4754 X12708 IFO6898, (IFO6627) Crepis japonica, NI2171 (K. Tubaki) D11377 Protomyces lactucae-debilis IFO6899 NI2172 (K. Tubaki) D14164 Protomyces macrosporus ATCC56196 Torilis japonica, G.E. Templeton D85143 Protomyces pachydermus IFO6900, (IFO6628) NI2173 (K.Tubaki) D85142 Taxon 4932 J01353 Taxon 4896 X54866 A. incana, Vysoké Tatry Mts., Slovak Republic, det. et leg. K. Bacigálová A. incana, F. Oberwinkler AJ495829 Saitoella complicata IAM12963 Schizosaccharomyces pombe D12530 Taphrina alni HA1364 T. alni T. alni HA857 FO 29242.00 HA872 T. alni HA859 T. californica CBS374.39 no strains available T. carnea CBS332.55 Betula intermedia, A.J. Mix AB000948 T. communis CBS352.35 Prunus americana, A.J. Mix AB000949 T. deformans HA855, CBS356.35 ATCC34556 MUCL30957, CBS356.35 Prunus persica, Netherlands, A.J. Mix Prunus amygdalus, France Prunus persica, Netherlands, A.J. Mix AJ495826 T. epiphylla HA1334 T. epiphylla HA1439 T. epiphylla HA1440 A. incana, Podsuchá, Nízke Tatry Mts., Slovak Republic, det. et leg. K. Bacigálová A. incana, Belianske Tatry Mts., Slovak AJ495821 Republic, det. et leg. K. Bacigálová A. incana, Vysoké Tatry Mts., Slovak AJ495822 Republic, det. et leg. K. Bacigálová T. deformans T. deformans A. incana, Falbeson, Stubai, Tyrol, Austria, det. et leg. H. Prillinger A. incana, Falbeson, Stubai, Tyrol, Austria, det. et leg. H. Prillinger AF492076 AJ495834 AJ495831 AF492024 AF49077 AF492038 AF492093 AF492039 AF492096 AJ495832 D14166 U00971 X69852 Taphrina farlowii CBS376.39 Prunus serotina A.J. Mix T. flavorubra CBS377.39 Prunus susquehanae, W.W. Ray AB000951 T. insititiae HA1571 P. insititia, Banská ·tiavnica, ·tiavnické vrchy Mts., Slovak Republic, det. et leg. K. Bacigálová AJ495827 T. johansoni HA1569 Populus tremula, Banská ·tiavnica, ·tiavnické vrchy Mts., Slovak Republic, det. et leg. K. Bacigálová AJ495835 T. letifera CBS335.55 Acer spicatum A.J. Mix AB000952 T. maculans CBS427.69 no strains available AB000953 T. mirabilis CBS357.35 Prunus angustifolia AB000954 AY090487 AB000950 T. nana CBS336.55 Betula nana A.J. Mix AB000955 T. padi HA100, RBF680 Prunus padus Regensburg, Germany, det. et leg. H. Prillinger AJ495833 T. populina CBS337.55 Populus nigra A.J. Mix D14165 T. pruni T. pruni Prunus domestica A.J. Mix P. domestica A.J.Mix AB000956 AJ495828 T. pruni CBS358.35 HA1313, CBS358.35 HA1306 P. domestica, Bratislava, Malé Karpaty Mts., Slovak Republic, det. et leg. K. Bacigálová AJ495815 T. pruni-subcordatae CBS381.39 Prunus subcordata A.J. Mix AB000957 © DGfM 2003 ITS Z27393 Protomyces inouyei Saccharomyces cerevisiae D1/D2 domain AF492056 AF492111 193 Mycological Progress 2(2) / 2003 Tab. 1. Continued Strain Source Origin 18S rDNA T. robinsoniana T. robinsoniana CBS382.39 HA850, CBS382.39, RBF692 Alnus rugosa A.J. Mix Alnus rugosa A.J. Mix AB000958 AJ495830 T. sadebeckii HA1345 AJ495819 AF492119 T. sadebeckii HA1326, RBF697 HA1308, CBS102.170 HA1309, DMS5488 HA1325, RBF695 A. glutinosa, Bratislava-Lamaã, Malé Karpaty Mts., Slovak Republic, det. et leg. K. Bacigálová A. glutinosa, Regensburg, Bavaria, Germany, det. et leg. H. Prillinger A.glutinosa, Steinsberg, Bavaria, Germany, det. et leg. H. Prillinger A. glutinosa, Tübingen, Germany, det. et leg. H. Prillinger A. glutinosa, Tiefenbach, Bavaria, Germany, det. et leg. H.Prillinger AJ495818 AY090488 T. sadebeckii T. sadebeckii T. sadebeckii T. tosquinetii HA1592 T. tosquinetii HA1314, CBS276.28 HA1346 T. tosquinetii T. tosquinetii HA851, RBF707 HA856, RBF700 HA1310, DSM5490 HA1327, RBF703 HA1328, RBF704 HA1329, RBF705 HA1330, RBF706 HA1335 T. tosquinetii HA1347 T. tosquinetii HA1365 T. tosquinetii T. tosquinetii T. tosquinetii T. tosquinetii T. tosquinetii T. tosquinetii T. tosquinetii A. glutinosa, Vysoké Tatry Mts., Slovak Republic, det. et leg. K. Bacigálová M. Wieben T. ulmi CBS420.54 Ulmus rubra C.L. Kramer HA244 Dryopteris filix-mas Vogesen, France, det. et leg. F. Oberwinkler T. virginica CBS340.55 Ostrya virginiana A.J. Mix T. wiesneri IFO7776 (IFO79) K. Tubaki FO IFO ATCC BCCMTM/MUCL RBF DSMZ ITS AF492062 AF492118 AF492066 AF492121 AJ495817 AJ495820 AJ495825 AJ495824 A. glutinosa, Bratislava, Malé Karpaty Mts., Slovak Republic, det. et leg. K. Bacigálová A. glutinosa Mödishofener Moor, Bavaria, Germany, det. et leg. H. Prillinger A. glutinosa, Langau, Bavaria, Germany, det. et leg. H. Prillinger A. glutinosa, Langau, Bavaria, Germany, det. et leg. H. Prillinger A. glutinosa, Langau, Bavaria, Germany, det. et leg. H. Prillinger A. glutinosa, Langenlois, NÖ Austria, det. et leg. H. Prillinger A. glutinosa, Langenlois, NÖ Austria, det. et leg. H. Prillinger A. glutinosa, Langenlois, NÖ Austria, det. et leg. H. Prillinger A. glutinosa, Kokava nad Rimavicou, Slovenské Rudohorie Mts., Slovak Republic, det. et leg. K. Bacigálová A. glutinosa, Bratislava, Malé Karpaty Mts., Slovak Republic, det. et leg. K. Bacigálová A. glutinosa, Vysoké Tatry Mts., Slovak Republic, det. et leg. K. Bacigálová T. vestergrenii CBS HA AJ495816 D1/D2 domain AY090489 AF492067 AF492122 AB000959 AB000960 D12531 Centraalbureau voor Schimmelcultures, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands Austrian Centre of Biological Ressources, Institute of Applied Microbiology, University of Agriculture, Muthgasse 18, 1190 Vienna, Austria Collection Prof. F. Oberwinkler, University Tübingen, Germany Institute for Fermentation, Osaka, 17-85, Juso-honmachi 2-chome, Yodogawa-ku, Osaka 532, Japan American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852, USA Culture Collection, Université Catholique de Louvain, Place Croix de Sud 3, B- 1348 Louvain-la-Neuve, Belgium Raiffeisen Bioforschung Tulln, Austria Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 16, 38124 Braunschweig, Germany © DGfM 2003 194 Taphrina fungi on alder Tab. 2. Primers used for amplifying and sequencing 18S rDNA Primer NS0 18/583 18/547 18/1203 18/1184 18/1642 ITS2p 5’ end 3’ end 1 583 547 1203 1184 1642 50/5.8S 18 566 566 1186 1203 1628 31/5.8S Primer sequence TATCTGGTTGATCCTGCC GAATTACCGCGGCTGCTG TGGAGGGCAAGTCTGGTGCC GAGTTTCCCCGTGTTGAG GACTCAACACGGGGAAACTC GACGGGCGGTGTGTA GCTGCGTTCTTCATCGATGC The numbers indicate positions within a Saccharomyces cerevisiae sequence. ITS2p anneals to the 5.8S rRNA encoding gene. Tab. 3. Biochemical and physiological characteristics of the species Taphrina tosquinetii HA1330, HA1347), Taphrina sadebeckii (HA1345, HA1309), Taphrina alni (HA859, HA1364) and Taphrina epiphylla (HA1439, HA1440). Differences in assimilation patterns between different strains of a single species are indicated in bold print. Tests T. tosquinetii HA1330 HA1347 T. sadebeckii HA1345 HA1309 T. alni HA859 HA1364 T. epiphylla HA1439 HA1440 F1 Fermentation D-Glucose – – – – – – – – C1 C2 C3 C5 C6 C7 C8 C9 C10 C11 C12 C13 C14 C15 C16 C17 C18 C19 C20 C21 C22 C23 C24 C25 C26 C27 C28 C29 C30 C31 C32 C33 C34 C35 Assimilation D-Glucose D-Galactose L-Sorbose D-Ribose D-Xylose L-Arabinose D-Arabinose L-Rhamnose Sucrose Maltose α-Trehalose α,α αMethyl-D-glucoside Cellobiose Salicine Arbutin Melibiose Lactose Raffinose Melezitose Inuline Starch Glycerol Erythritol Ribitol Xylitol D-Arabitol Sorbitol D-Mannitol Galactidol Myo-Inositol D-glucono-1,5-lacton 2-Keto-D-gluconat 5-Keto-D-gluconate D-gluconat + – – + + + + w + + w w + + – – – + + w + + – – + + + + – – – + w – + – – w + + + w + + + + + + + – – + + – w + – w + + + + – – – + – – + – – + + – + – + – – w + + + – – + + – w + – + + + + + – – + + w w + – – w + – – – + w w w + + – – – + + w + + – – + + + + – – + w – – + – – + + + w w + w w + + + – – – + + w w + – w + + + + – – – w w – + – – w + w w – + – – – + w – – – + + – w + – – + + + + – – – w – w + – – + + – w – + w – – + + – – – + + – + + – + + + + + – – + + – – + – – + + – – – + – – – + + – – – + + – w + – + + + + + – – – + – – © DGfM 2003 195 Mycological Progress 2(2) / 2003 Tab. 3. Continued Tests T. tosquinetii HA1330 HA1347 T. sadebeckii HA1345 HA1309 T. alni HA859 HA1364 T. epiphylla HA1439 HA1440 C36 C37 C38 C39 C40 C41 C42 C43 C44 N1 N2 N3 N4 N5 N6 N7 N8 N9 N10 D-glucuronate D-galacturonic acid D,L-Lactate Succinate Citrate Methanol Ethanol Propane-1,2-diol Butane-2,3-diol Potassium-nitrate Sodium-nitrite Ethylamine L-Lysine Cadaverine Creatine Creatinine D-Glucosamine Imidazole D-Tryptophan – – w ++ w – + w – + – – – + – – w – ++ – – w ++ w – + w – + – – – ++ – – w – ++ – – w ++ w – + w – ++ – – – + – – w – ++ – – w ++ w – + – – ++ – – – ++ – – w – ++ – – w ++ w – + – – ++ – – – ++ – – w – ++ – – – ++ + – w – – + – – – ++ – – + – ++ – – – ++ + – + – – ++ – – – ++ – – w – ++ – – w ++ w – + – – ++ – – – ++ – – w – ++ V1 V2 V3 V4 V5 V6 V7 V9 T1 T2 O1 O2 O5 O6 M1 M3 M4 Growth Without Vitamines Without myo-Inositol Without Pantothenate Without Biotin Without Thiamin Without Biotin &Thiamin Without Pyridoxine Without Niacin at 25 °C at 30 °C 0,01% Cyclo-heximide 0,1% Cyclo-heximide 50% D-Glucose 10% NaCl, 5% Glucose Starch production Urea hydrolysis Diazonium Blue B reaction – + + + – – + + + – – – – – + + – – + + + – – + + + – – – – – + + – – + + + – – + + + – – – – – + + – – + + + – – + + + – – – – – + + – – + + + – – + + + – – – – – + + – – + + + – – + + + – – – – – + + – – + + + – – + + + – – – – – + + – – + + + – – + + + – – – – – + + – Additional tests L-Xylose βMethylxyloside D-Fructose D-Mannose αMethyl-D-mannoside N-Acetyl Glucosamine Amigdaline Esculine Glycogene βGentiobiose D-Turanose D-Lyxose D-Tagatose D-Fucose L-Fucose L-Arabitol w – + + w w + + + + + + – – w – w w + + w – + + + + + + – – w w + – + + – – + + w + + w – – – w – – + + – – w + + + w – – – – – w w + + w + + + w + + + – – + + – + + + – – w + w + w + – – w + w – + + w – + + + + w + w – – – – w + + w + + – – – w – ( +) positive; (-) negative; (w) weak positive response © DGfM 2003 196 Taphrina fungi on alder Tab. 4. Level of similarity among Taphrina alni (HA1364, HA857, HA872, HA859) and Taphrina robinsoniana (HA850) strains determined by PCR-fingerprinting (mean values of primer 1, 2 and 3) Strains HA1364 HA857 HA872 HA859 HA850 HA1364 HA857 HA872 HA859 HA850 100 94 100 78 74 100 72 73 81 100 36 36 28 26 100 Tab. 5. Level of similarity among. Taphrina epiphylla strains determined by PCR-fingerprinting (mean values of primer 1, 2 and 3) Strains HA1334 HA1439 HA1440 HA1334 HA1439 HA1440 100 72 100 66 67 100 Tab. 6. Level of similarity among Taphrina epiphylla (HA1440) and Taphrina sadebeckii (HA1344, HA1345, HA1308, HA1309, HA1325, HA1326) strains determined by PCR-fingerprinting. Mean values of primer 1 and primer 3 (A) and values calculated with primer 2 (B). Strains HA1440 A B HA1440 HA1344 HA1345 HA1308 HA1309 HA1325 HA1326 100 100 HA1344 A B 35 100 11 100 HA1345 A B 50 78 100 38 38 100 HA1308 A B 37 70 77 100 HA1309 A B 32 32 24 100 42 70 82 78 100 35 47 27 22 100 HA1325 A B HA1326 A B 32 61 69 64 73 100 43 61 68 77 64 68 100 33 44 50 32 47 100 30 40 44 38 42 30 100 Tab. 7. Level of similarity among Taphrina tosquinetii strains determined by PCR-fingerprinting (mean values of primer 1, 2 and 3) Strains HA1314 HA1365 HA1346 HA1335 HA1327 HA1310 HA851 HA856 HA1328 HA1329 HA1330 © DGfM 2003 HA 1314 HA 1365 HA 1346 HA 1335 HA 1327 HA 1310 HA 851 100 91 100 67 76 100 86 85 81 100 88 90 72 91 100 83 90 71 83 94 100 69 67 80 73 73 74 100 HA 856 HA 1328 HA 1329 HA 1330 85 93 70 87 92 90 73 100 81 83 77 83 89 80 79 87 100 76 92 74 88 84 83 72 85 74 100 87 91 69 88 93 83 68 92 89 82 100