Development of wheat genotypes possessing a combination of leaf rust resistance genes Lr19 and Lr24 S. Šliková1, E. Gregová1, P. Bartoš2, A. Hanzalová2, M. Hudcovicová1, J. Kraic1 1Research 2Research Institute of Plant Production, Piešťany, Slovakia Institute of Crop Production, Prague-Ruzyně, Czech Republic ABSTRACT Endopeptidase allele Ep-D1c and DNA marker-assisted selection have been used for the incorporation of Lr19 + Lr24 leaf rust resistance genes combination into adapted commercial winter wheat cultivars. The first step was the transfer of the gene Lr19 from the donor cultivar Agrus into acceptor cultivars Simona and Lívia. The progenies possessing the null allele Ep-D1c linked to the gene Lr19 have been screened for their resistance to leaf rust by isolate 4332 SaBa. The plants homozygous properties at the Ep-D1c locus and resistant against leaf rust were used for crossing with NIL Thatcher/Lr24 – a donor of the gene Lr24. Plants possessing both Lr genes were selected from F2 population by STS and isozyme markers linked to the Lr genes. Progenies of 18 F2 plants have been selected by STS marker and tested for resistance against leaf rust. Results obtained with isozyme and STS markers corresponded with resistance testing. Altogether 6 progenies of F3 generation possessing a resistance gene combination of Lr19 + Lr24 in a homozygous condition were developed. Keywords: Triticum aestivum L.; leaf rust; Lr19 gene; Lr24 gene; markers; molecular breeding Leaf rust caused by Puccinia triticina (syn. Puccinia recondita Rob. ex Desm. f.sp. tritici) is one of the most important pathogens of wheat. It causes cardinal yield decreases in susceptible cultivars, mainly in the years with a high infection pressure of the pathogen. Resistance against this fungus is based on the possession of effective leaf rust (Lr) resistance genes. Forty-seven different Lr genes have been identified until the year 1995 (McIntosh et al. 1995). Other Lr genes were included into a catalogue since that time. The commercial wheat cultivars usually exploit only a limited number from them and each cultivar possess usually only one Lr gene. The most commonly used Lr genes in the western European wheat cultivars are Lr1, Lr3a, Lr10, Lr13, Lr14a, Lr17b, Lr20, Lr26, Lr37 (Park et al. 2001). At the present time wheat cultivars cultivated in Slovakia and in the Czech Republic possess mostly genes Lr3, Lr13, and Lr26 or their combinations. These genes are effective only against a limited number of pathogen races (Bartoš et al. 2001). Gene pyramiding is a breeding strategy when two or more genes are combined together within one genotype. The combinations of the genes Lr16 and Lr13 (Samborski and Dyk 1982) or Lr9 and Lr24 (Long et al. 1994) were reported to provide reliable control against leaf rust. The lines with the pairs of genes Lr13 and Lr34, Lr13 and Lr37, Lr34 and Lr37 provided a higher level of resistance than lines with individual genes (Kloppers and Pretorius 1997). The combination of two or more resistance genes is often difficult or impossible due to lack of specific pathogen races necessary for detection and confirmation of specific resistance genes. Available molecular markers, tightly linked to desired Lr genes can help in the selection of individuals with introduced genes, within segregating populations. This approach is used in different crops, also in wheat (Liu et al. 2000). Many specific PCR-based markers, linked to race-specific rust resistance genes, have been already developed. Therefore the STS, SCAR, and CAPS markers for genes Lr1 (Feuillet et al. 1995), Lr28 (Naik et al. 1998), Lr9 and Lr24 (Schachermayr et al. 1994, 1995), Lr35 (Seyfarth et al. 1999), Lr37 (Seah et al. 2000), Lr47 (Helguera et al. 2000) are available for the molecular breeding approach. The aim of this work was to transfer a pair of highly effective resistance genes against leaf rust – Lr19 and Lr24, into wheat genotypes with none or limited resistance against leaf rust but adapted to our growing conditions. Supported by the Ministry of Agriculture of the Slovak Republic, Grant No. 2003 SP 27/028 0D 01/028 0D 01. 434 PLANT SOIL ENVIRON., 50, 2004 (10): 434–438 MATERIAL AND METHODS Wheat cultivars Simona (without Lr genes) was highly susceptible to leaf rust in 1996 (Bartoš et al. 1999). Cultivar Lívia possessing gene Lr26 (Bartoš et al. 1994) expressed a highly susceptible reaction in the years 1995 and 1996. Both cultivars have been used as recipients of Lr19 + Lr24 gene pair. The cultivar Agrus has been used as a donor of the Lr19 gene, which was introgressed into wheat genome from Agropyron elongatum (Host.) Beauv., characterized and included into the catalogue of wheat genes (McIntosh et al. 1995). Near isogenic line (NIL) based on cultivar Thatcher possessing the gene Lr24 has been used as a donor of this gene. The gene Lr24 originated from Agropyron elongatum (Host.) Beauv. was incorporated into the wheat chromosome 3D by spontaneous translocation (Smith et al. 1968). The Lr19 + Lr24 gene pair was transferred into adapted cultivars by crosses (Simona × Agrus) × Thatcher/Lr24 and (Lívia × Agrus) × Thatcher/Lr24. Protein extracts for endopeptidase analyses were isolated either from young leaves or from embryos. Isoelectrofocusing was performed in prefocused polyacrylamide gels contained ampholyte (Pharmalyte pH 4.2–4.9) according to Koebner et al. (1988) and Winzeler et al. (1995). The catolyte was 0.5 mol/l NaOH, the anolyte 0.5 mol/l acetic acid. Fast Black K salt was used for specific staining of endopeptidases. Endopeptidase alleles encoded by the Ep-D1 locus were classified according to Koebner et al. (1988). DNA was isolated from young leaves and purified by the method of Dellaporta et al. (1993). A PCR-based DNA-STS marker, linked to the gene Lr24, developed by Schachermayr et al. (1995), has been used for the screening of plants possessing this gene. The sequences of primers (TCTAGTCTGTACATGGGGGC – forward primer, TGGCACATGAACTCCATACG – reverse primer) and amplification conditions were according to Schachermayr et al. (1995). Plants of F3 generations were tested by inoculation with leaf rust pathotype 4332 SaBa virulent to 1 2 3 4 5 6 7 8 9 Lr26 and avirulent to Lr24 in greenhouse conditions by rubbing of the first leaf with urediospore water suspension and then plants were kept 24 hours at high air humidity in closed glass cylinders. Infection types were scored 14 days after inoculation using the scale developed by Stakman et al. (1962). RESULTS AND DISSCUSSION Altogether 7 plants from the cross Simona × Agrus and 10 plants from Lívia × Agrus, respectively, possessing null allele Ep-D1c have been selected from segregating F2 populations. All 17 plants were tested for leaf rust resistance by phytopathological test. Seven individuals from the cross Simona × Agrus and 8 from Lívia × Agrus were resistant to leaf rust in the seedling stage. Plants possessing null endopeptidase marker allele and resistant against leaf rust at the same time, have been used for a second cross to combine gene Lr19 and Lr24. Altogether 168 F2 plants from the cross (Simona × Agrus) × Thatcher/Lr24 and 172 from the cross (Lívia × Agrus) × Thatcher/Lr24 were obtained and screened by DNA-STS specific marker linked to Lr24 gene (Figure 1). Altogether 118 plants carrying Lr24 DNA-STS dominant marker linked to the desired gene were selected from the cross (Simona × Agrus) × Thatcher/Lr24 and 120 from the cross (Lívia × Agrus) × Thatcher/Lr24. Segregation of the marker in the F2 generation in both types of crosses fitted in with 3:1 (χ 2 = 2.02, χ 2 = 2.51; P > 0.05). This agreed with Schachermayr et al. (1995) who confirmed that DNA-STS is a dominant marker and all resistant F 2 plants expressing an amplified DNA fragment of 350 bp, that is completely linked with the Lr24 gene, while none of the susceptible plants showed this amplification product. The codominant DNA markers are preferred but dominant markers, as the one used in our study, has been used also successfully for marker assisted selection in wheat for Lr genes transfer (Naik et al. 1998, Seyfarth et al. 1999). F 2 plants were at the same time screened with isozyme marker linked to Lr19 gene. Thirteen 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 → Figure 1. Segregation of DNA-STS specific marker linked to Lr24, in F2 plants from the cross (Simona × Agrus) × Thatcher/Lr24 (line 1 = negative control, lines 2–30 = individual plants, length of amplified fragment is 350 bp) PLANT SOIL ENVIRON., 50, 2004 (10): 434–438 435 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 → Figure 2. Endopeptidase zymograms of parental cultivars, progenies of F2 generation with Ep-D1c allele and the susceptible progenies with Ep-D1a allele – embryo extract (arrow indicates band encoded by Ep-D1a allele or lacked band corresponding to null allele Ep-D1c) 1, 9 = Chinese Spring – allele Ep-D1a 2 = Simona – allele Ep-D1a 3, 10 = Agrus – allele Ep-D1c 4 = Thatcher/Lr24 – allele Ep-D1a 5, 6, 7, 8 = progenies from cross (Simona × Agrus) × Thatcher/Lr24 – allele Ep-D1c (linked to Lr19) 11, 12, 13, 14 = progenies from cross – (Lívia × Agrus) × Thatcher/Lr24 – allele Ep-D1a 15 = Lívia – allele Ep-D1a plants possessing a marker linked to Lr19 gene were selected from the cross (Simona × Agrus) × Thatcher/Lr24 and 5 from the cross (Lívia × Agrus) × Thatcher/Lr24. All 18 F2 selected plants were selfpollinated to create F 3 progenies. Consequently homozygous from heterozygous plants were distinguished by simultaneous comparison and analysis of DNA-STS marker in F3 progenies. Differentiation of homozygous and heterozygous individuals has been performed by the analysis of ten plants from each of the F3 progenies by DNA-STS the marker linked to Lr24. If F3 individuals in all ten-desired STS marker was present, and then selected F2 plant was homozygous in marker locus. Six of the 13 progenies of (Simona × Agrus) × Thatcher/Lr24 and two from the 5 progenies of (Lívia × Agrus) × Thatcher/Lr24 were found as homozygous in DNA-STS linked Lr24 marker. The last step in the R1 R2 R3 S P Figure 3. The first leaves of plants from the progenies of the F 2 generation with Lr19 + Lr24 and the first leaves of parents 14 days after inoculation with leaf rust pathotype 4332 SaBa R1 and R2 = resistant progenies of the F2 generation from cross (Simona × Agrus) × Thatcher/Lr24 with Lr19 + Lr24 R3 = resistant progeny of the F2 generation from cross (Simona × Agrus) × Thatcher/Lr24 with Lr24 S = susceptible parental cultivar Simona without Lr genes P = resistant parental NIL – Thatcher/Lr24 with gene Lr24 436 PLANT SOIL ENVIRON., 50, 2004 (10): 434–438 marker-assisted selection was the detection of the presence or absence of Ep-D1c null allele, respectively, in embryos of 8 progenies of F2 generation. This marker allele was confirmed in 4 of them, others possessed Ep-D1a allele (Figure 2). It is probably caused by the ambiguity of evaluation of leaf endopeptidase patterns of plants from the F 2 generation. Winzeler et al. (1995) calculated a genetic distance between Lr19 gene and Ep-D1c allele to 0.33 ± 0.33 cM but a recombination between the Agropyron elongatum segment and the wheat 7DL chromosome occurred. The parental cultivars and 8 progenies of F 2 generation were tested for leaf rust resistance with six leaf rust isolates. Six progenies were resistant to leaf rust. Their reselection and reaction to leaf rust confirmed a resistance to leaf rust and the presence of the combination of genes Lr19 and Lr24. One progeny that responded as the parent Thatcher/ Lr24, i.e. reaction indicated the presence of only Lr24 gene and the absence of Lr19 gene (Figure 3). Another progeny segregated for infection type as shown by Thatcher/Lr24 and by genotypes with Lr19 and Lr24 genes (the reselection confirmed presence of allele Ep-D1a) and the response to leaf rust showed that plants are not homozygous at the Lr19 locus. Two effective leaf rust resistance genes Lr19 and Lr24 were successfully transferred into six wheat genotypes with the assistance of molecular markers. Plants carrying two leaf rust resistance genes Lr19 and Lr24 were identified simultaneously in F2 generation by protein and DNA marker, respectively. To our knowledge, no pyramiding leaf rust resistance genes by molecular markers has been reported. The gene pyramiding in wheat has been published e.g. Liu et al. (2000) who selected double homozygotes possessing powdery mildew resistance gene combinations Pm2 and Pm4a, Pm2 and Pm21, Pm4a and Pm21 by molecular markers. Molecular markers have been used also in development of advanced breeding rice lines by cumulated three resistance genes against bacterial blight pathogen (Singh et al. 2001). Hittalmani et al. (2000) used markers to combine three blast resistance genes into a single rice genotype. Indirect selection using DNA markers would facilitate the combination of these closely linked resistance genes into cultivars. It is shown in our study that molecular markers can effectively help to pyramid important genes in wheat and generate advanced breeding lines. REFERENCES Bartoš P., Huszár J., Hanzalová A., Herzová E. (2001): Wheat leaf rust races/pathotypes in Slovakia in 1999–2000. Plant Prot. Sci., 37: 85–90. PLANT SOIL ENVIRON., 50, 2004 (10): 434–438 Bartoš P., Huszár J., Herzová E. (1999): Virulence of wheat leaf rust in Slovakia in 1997–1998. Plant Prot. Sci., 35: 85–92. Bartoš P., Stuchlíková E., Hanušová R. (1994): Genetika rezistence odrůd pšenice ozimé Ilona, Lívia, Blava a Torysa ke rzi travní a rzi pšeničné. Genet. a Šlecht., 30: 123–132. Dellaporta S.L., Wood J., Hicks J.B. (1993): A plant DNA minipreparation: Version II. Plant Mol. Biol. Rep., 4: 19–21. Feuillet C., Messmer M., Schachermayr G., Keller B. (1995): Genetic and physical characterization of the Lr1 leaf rust resistance locus in wheat (Triticum aestivum L.) Mol. Gen. Genet., 248: 553–562. Helguera M., Khan I.A., Dubcovsky J. (2000): Development of PCR markers for wheat leaf rust gene Lr47. Theor. Appl. Genet., 101: 625–631. Hittalmani S., Parco A., Mew T.V., Zeigler R.S., Huang N. (2000): Fine mapping and DNA marker-assisted pyramiding of three major genes for blast resistance in rice. Theor. Appl. Genet., 100: 1121–1128. Kloppers F.J., Pretorius Z.A. (1997): Effects of combinations amongst genes Lr13, Lr34 and Lr37 on components of resistance in wheat to leaf rust. Plant Pathol., 46: 737–750. Koebner R.M.D., Miller T.E., Snape J.W., Law C.N. (1988): Wheat endopeptidase: genetic control, polymorphism, intrachromosomal gene location, and alien variation. Genome, 30: 186–192. Liu J., Liu D., Tao W., Li W., Wang S., Chen P., Cheng S., Gao D. (2000): Molecular marker-facilitated pyramiding of different genes for powdery mildew resistance in wheat. Plant Breed., 119: 21–24. Long D.L., Roelfs A.P., Leonard K.J. (1994): Virulence and diversity of Puccinia recondita f.sp. tritici tritici in the United states in 1992. Plant Dis., 78: 901–906. McIntosh R.A., Wellings C.R., Park R.F. (1995): Wheat rusts. An atlas of resistance genes. CSIRO Australia, Kluwer Acad. Publ., Dordrecht, the Netherlands. Naik S., Gill K.S., Prakasa Rao V.S., Gupta V.S. Tamhankar S.A., Pujar S., Gill B.S., Ranjekar P.K. (1998): Identification of a STS marker linked to the Aegilops speltoides-derived leaf rust resistance gene Lr28 in wheat. Theor. Appl. Genet., 97: 535–540. Park R.F., Goyeau H., Felsenstein G., Bartoš P., Zeller F.J. (2001): Regional phenotypic diversity of Puccinia triticina and wheat host resistance in western Europe, 1995. Euphytica, 122: 113–127. Samborski D.J., Dyk P.L. (1982): Enhancement of resistance to Puccinia recondita by interactions of resistance genes in wheat. Can. J. Plant Pathol., 4: 152–156. Schachermayr G., Messmer M.M., Feuillet C., Winzeler H., Winzeler M., Keller B. (1995): Identification of molecular markers linked to the Agropyron elongatum-derived leaf rust resistance gene Lr24 in wheat. Theor. Appl. Genet., 90: 982–990. Schachermayr G., Sielder H., Gale M.D., Winzeler H., Winzeler M., Keller B. (1994): Identification and lo- 437 calization of molecular markers linked to the Lr9 leaf rust resistance gene of wheat. Theor. Appl. Genet., 88: 110–115. Seah S., Bariana H., Jahier J., Sivasithamparam L., Lagudah E.S. (2000): Introgressed segment carrying rust resistance genes Yr17, Lr37, and Sr38 in wheat can be assayed by a cloned disease resistance gene-like sequence. Theor. Appl. Genet., 102: 600–605. Seyfarth R., Feuillet C., Schachermayr G., Winzeler M., Keller B. (1999): Development of a molecular marker for the adult plant leaf rust resistance gene Lr35 in wheat. Theor. Appl. Genet., 99: 554–560. Singh S., Sidhu J.S., Huang N., Vikal Y., Li Z., Brar D.S., Dhaliwal H.S., Khush G.S. (2001): Pyramiding three bacterial blight resistance genes (xa5, xa13 and Xa21) using marker-assisted selection into indica rice cultivar PR106. Theor. Appl. Genet., 102: 1011–1015. Smith E.L., Schlehuber A.M., Young H.C., Edwards L.H. (1968): Registration of agent wheat. Crop Sci., 8: 511–512. Stakman E.C., Stewart P.M., Loegering W.Q. (1962): Identification of physiological races of Puccinia graminis var. tritici. Minn. Agr. Exp. Sci. J., Ser. Pap., 4691. Winzeler M., Winzeler H., Keller B. (1995): Endopeptidase polymorphism and linkage of the Ep-D1c null allele with the Lr19 leaf rust resistance gene in hexaploid wheat. Plant Breed., 114: 24–28. Received on January 9, 2004 ABSTRAKT Tvorba genotypů pšenice s kombinací genů rezistence ke rzi pšeničné Lr19 a Lr24 Pro přenos genů rezistence ke rzi pšeničné Lr19 + Lr24 do komerčních odrůd ozimé pšenice byl užit výběr na základě alely Ep-D1c endopeptidázy a markeru DNA. Nejdříve byl přenesen gen Lr19 z donorové odrůdy Agrus do odrůd-akceptorů Simona a Lívia. Potomstva mající nulovou alelu Ep-D1c, která je ve vazbě s genem Lr19, byla vyselektována na odolnost ke rzi pšeničné infekcí izolátem 4332 SaBa rzi pšeničné. Rostliny homozygotní v lokusu Ep-D1c a rezistentní ke rzi pšeničné se křížily s NIL Thatcher/Lr24 – donorem genu Lr24. Rostliny mající oba Lr geny byly vybrány z F2 populace pomocí STS a izozymových markerů, které jsou ve vazbě se zmíněnými Lr geny. Potomstva 18 F2 rostlin byla vybrána STS markerem a testována na odolnost ke rzi pšeničné. Výsledky získané izozymovým a STS markerem odpovídaly testům rezistence. Celkem bylo získáno 6 potomstev F 3 generace s kombinací genů rezistence Lr19 + Lr24 v homozygotní sestavě. Klíčová slova: Triticum aestivum L.; rez pšeničná; gen Lr19; gen Lr24; markery; molekulární šlechtění Corresponding author: Ing. Svetlana Šliková, Ph.D., Výskumný ústav rastlinnej výroby, Bratislavská cesta 122, 921 68 Piešťany, Slovensko phone: + 421 033 772 2311, fax: + 421 033 772 6309, e-mail: slikova@vurv.sk 438 PLANT SOIL ENVIRON., 50, 2004 (10): 434–438