Fungal Diversity (2017) 82:183–219 DOI 10.1007/s13225-016-0370-0 Evidence for the polyphyly of Encoelia and Encoelioideae with reconsideration of respective families in Leotiomycetes Kadri Pärtel 1,2 & Hans-Otto Baral 3 & Heidi Tamm 1 & Kadri Põldmaa 1 Received: 30 December 2015 / Accepted: 16 July 2016 / Published online: 9 August 2016 # School of Science 2016 Abstract This study focuses on the genus Encoelia and the subfamily Encoelioideae in the morphologically and ecologically diverse Helotiales. The 28S and 18S rDNA as well as tef1, rpb1 and rpb2 were sequenced for 70 species. Phylogenetic analyses revealed Encoelia and Encoelioideae to be highly polyphyletic, with species distributed among eight major lineages. Encoelia fascicularis and E. pruinosa belonged to Sclerotiniaceae and were combined in a new genus, Sclerencoelia. Rutstroemiaceae comprised E. tiliacea and Dencoeliopsis johnstonii, both accepted in Rutstroemia. The type of Encoelia, E. furfuracea, was closely related to species of Velutarina, Cenangiopsis and Crumenulopsis. These species together with members of Hemiphacidiaceae formed a clade conforming to the emended concept of Cenangiaceae, i n t r o d u c e d h e r e . A n o t h e r r e s u r r e c t e d f a m i l y, Cordieritidaceae, comprised E. fimbriata, E. heteromera and species of Ameghiniella, Cordierites, Diplocarpa and Ionomidotis, characterised by inamyloid asci and a positive ionomidotic reaction. Encoelia glauca showed closest affinities with Chlorociboria species in Chlorociboriaceae. A new genus, Xeropilidium, with sporodochial and pycnidial synanamorphs, was described for the distinct encoelioid member of the Chaetomellaceae, previously known as E. fuckelii. Morphological and ecological synapomorphies were distinguished from convergent characters to delimit monophyletic taxa including encoelioid fungi. Incorporation of public sequences from various biological samples in ITS rDNA analyses allowed identification of sequenced organisms at species, genus, or family level and added information on the ecology of seversal taxa. Members of Cenangiaceae appeared to be widespread as endophytes. Inclusion of encoelioid genera in Chaetomellaceae and Sclerotiniaceae added xylicolous saprotrophs to these families. Electronic supplementary material The online version of this article (doi:10.1007/s13225-016-0370-0) contains supplementary material, which is available to authorized users. The order Helotiales represents one of the largest groups of inoperculate discomycetes, comprising species of diverse lifestyle and morphology (Wang et al. 2006a). The traditional teleomorph-based taxa are recognised to be closely related to many anamorphic taxa that inhabit various substrata in aquatic and terrestrial environments (Baschien et al. 2013; Kohout et al. 2012; Réblová et al. 2011). In addition, diverse unnamed lineages have been distinguished through molecular analyses of complex biological samples (Hazard et al. 2014; Tedersoo et al. 2009; Walker et al. 2011). Phylogenetic analyses have shown that the Helotiales is not a monophyletic group and that Rhytismatales, Erysiphales, Phacidiales, Cyttariales and * Kadri Pärtel kadri.partel@ut.ee 1 Institute of Ecology and Earth Sciences, University of Tartu, Lai 40, EE-51005 Tartu, Estonia 2 Mycological Collections, Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences, Tartu, Estonia 3 Blaihofstraße 42, 72074 Tübingen, Germany Keywords Environmental sequencing . Fungicolous ascomycetes . Helotiaceae . Lichenicolous fungi . Forest pathogens . Taxonomy Introduction 184 Thelebolales are nested within the Helotiales. However, the delimitation and relationships among most helotialean families are obscure (Crous et al. 2014; Johnston et al. 2014a; Lantz et al. 2011; Schoch et al. 2009; Wang et al. 2006a, b). This study focuses on taxa traditionally assigned to the subfamily Encoelioideae in the family Helotiaceae and, particularly, in the genus Encoelia. In 1932 Nannfeldt proposed the Encoelioideae to be a subdivision of the Helotiaceae, distinguished from the related Ciborioideae by longevity and leathery consistency of apothecia. His concept included Cenangiopsis quercicola, Encoelia furfuracea, E. fascicularis, Encoeliella ravenelii ≡ Unguiculariopsis ravenelii, Encoeliopsis rhododendri, Holwaya mucida, Midotiopsis bambusicola, and Velutarina rufoolivacea. Most of these taxa had been assigned previously to the family Cenangiaceae Rehm. By adhering to observations by Höhnel (von Höhnel 1923: 104 f.), Nannfeldt (1932: 312) excluded Cenangium ferruginosum Fr., the type species of the genus, from the Encoelioideae. Korf (1973), however, assigned Cenangium in its restricted sense to this subfamily along with Encoelia, Cenangiopsis, Cordierites, Dencoeliopsis, Discocainia, Holwaya, Nipterella, Pestalopezia, and Velutarina. Encoelioideae sensu Korf was distinguished from other members of the Leotiaceae (which at that time included the Helotiaceae) mainly by characters of the excipulum and was accepted by Torkelsen and Eckblad (1977). Zhuang (1988a, b, c) expanded Korf’s concept to include the genera Ameghiniella, Chlorencoelia, Encoeliopsis, Hemiglossum, Ionomidotis, Parencoelia, Phaeofabraea, Sageria, and Unguiculariopsis. Based on morphological evidence, Diplocarpa (Baral 2003) and Llimoniella (Hafellner and Navarro-Rosinés 1993) were included in this subfamily. Members of Encoelioideae are characterised by long-lived and desiccation-tolerant apothecia. While growing on airexposed substrata, the apothecia desiccate and revive repeatedly, and can periodically discharge ascospores over an extended period of time. During dry periods, the fruitbodies turn leathery and horny, often by inrolling and becoming hysteriform or triangular in shape, but regaining their original form upon rehydratation. The outermost cells of the ectal excipulum are mostly globose and sometimes loose by forming the characteristic mealy or pustulate-floccose surface of some taxa, whereas the medullary tissue consists of thin-walled interwoven hyphae. Throughout the text we use the term ‘encoelioid taxa’ to refer to species and genera exhibiting these features. Encoelia, currently classified in the Sclerotiniaceae (Lumbsch and Huhndorf 2010), includes ca. 40 species excluding synonymic and misapplied names (Kirk et al. 2015). The name Encoelia translates as ‘enclosed space’, which is appropriate for its type species, E. furfuracea (Roth) P. Karst. The apothecia of this species are initially erumpent under the bark of attached but dead deciduous branches or standing trunks, remaining closed for a long period before opening an irregular, crater-like aperture, Fungal Diversity (2017) 82:183–219 thereby leaving the margin lacerate. Characteristic of Encoelia species in general are the leathery, externally brown or blackish and scurfy apothecia of >1 mm diam. These are formed on a short, simple stipe and open in either the prohymenial or the mesohymenial phase. Asci are clavate to cylindrical, with the ultrastructure of the apex as described in E. tiliacea (Bellemere 1977), E. fimbriata (Verkley 1995) and E. furfuracea (Pärtel 2014) representing three dissimilar types. Ascospores are cylindrical, generally allantoid, hyaline and non-septate when discharged, and paraphyses cylindric-filiform, usually slightly and gradually enlarged in their upper part. Species of Encoelia typically live on angiosperms as saprotrophs (Korf and Kohn 1976, Zhuang 1988a) or parasites (Itturriaga 1994, Juzwik and Hinds 1984). However, a parasitic or endophytic lifestyle can be suggested for many species that inhabit recently dead or living parts of trees, shrubs, or more rarely herbaceous plants. Zhuang et al. (2000) showed that members of Encoelioideae sensu Korf cluster with species from distinct helotialean families, indicative of a polyphyletic subfamily. Although this study included more representatives of Encoelioideae than later works, the support for many relationships remained low because only the 18S rDNA of a rather restricted set of taxa were analysed. Likewise, phylogenetic revisions of the Leotiomycetes based on rDNA data suggest the three included encoelioid species are only distantly related (Wang et al. 2006a, b). Among these species, Chlorencoelia versiformis formed a clade with members of Hemiphacidiaceae, and Holwaya mucida with members of Bulgariaceae, whereas relationships of Cordierites frondosa remained unresolved. A recent phylogenetic study analysing sequences of four genes (Peterson and Pfister 2010) revealed that even the genus Encoelia is not monophyletic, and that these three species fall into two distinct groups, one (E. fascicularis) in the Sclerotiniaceae (in agreement with results by Holst-Jensen et al. 1997) and the other two (E. heteromera, E. helvola) near Cordierites and Ionomidotis in the BHelotiaceae^. However, the phylogenetic relationships of most species of Encoelia and related genera, including the type species of the genus, E. furfuracea, which had not been included in any molecular studies, remained largely unknown. Originating mostly from biological samples such as soil and plant tissues, the ITS rDNA sequences of Leotiomycetes, the DNA barcode marker of fungi (Schoch et al. 2012), are well represented in international nucleotide sequence databases (INSD). Members of this class, particularly those referred to the Helotiales, have been found to constitute most of the endophytic fungal species in various trees (Kernaghan and Patriquin 2011, Tedersoo et al. 2009; Toju et al. 2013; Vralstad et al. 2002), especially in conifers and in Pinaceae (Arnold et al. 2007; Rodriguez et al. 2009; Sieber 2007), but also in temperate orchids (Kohout et al. 2013; Stark et al. 2009) and other vascular plants (Higgins et al. 2007). However, identification of such ‘environmental sequences’ Fungal Diversity (2017) 82:183–219 below the kingdom, phylum, class or order level has usually been impossible due to the paucity of related sequences from named voucher specimens. The aims of this study were (1) to reveal the phylogenetic affinities of species included in the subfamily Encoelioideae and particularly in the genus Encoelia, with reference to its type species E. furfuracea; (2) to define monophyletic groups including encoelioid fungi; (3) to revise the morphological delimitation of taxa including encoelioid species; (4) to elucidate ecological distinction of taxa by combined analyses of original specimen-based and INSD biological sample data. Materials and methods The studied specimens of Encoelioideae were obtained from the following fungaria (acronyms according to Thiers 2015): BPI, C, CUP, DAOM, FH, K, LD, M, NY, O, OULU, QCNE, S, TAAM, TNS, TU, and from the private collections of HansOtto Baral, Guy Marson, Jens Henrik Petersen, Ingo Wagner and Enrique Rubio Domínguez. The morphology of living apothecia and anamorphs was studied in tap water (unless otherwise stated). Dry, dead specimens were rehydrated and mounted in water to which was added a 3 % aqueous potassium hydroxide solution (KOH). In addition, the staining reagents cotton blue (CB, in lactic acid), cresyl blue (CRB, aqueous), Melzer’s regent (MLZ) and Lugol’s solution (IKI) were used to examine specific structures. All specimens were tested for an ionomidotic reaction, a chemical reaction by which an alkaline medium extracts pigments from the fungal tissue (Korf 1958), by applying 3–10 % KOH to a water mount of apothecial fragments. The symbols used in the descriptions indicate the following: * living cells studied, † dead cells studied; t. = texture (textura) of excipular tissue types, ø = specimen not preserved, {} the number of studied specimens. Microphotos and measurements of microscopical elements were taken from freehand sections or squash mounts using a Nikon 80i or a Zeiss Standard 14 microscope. Genomic DNA was extracted from dried specimens using a High Pure PCR Template Preparation Kit (Roche, Basel, Switzerland) or a Qiagen DNeasy 96 Plant Kit (Qiagen, Crawley, West Sussex, UK) according to the manufacturer’s instructions. A piece of apothecium of fresh specimens was soaked in a buffer of 0.015 U/μl proteinase K (Thermo Fisher Scientific, Waltham, MA, USA), 0.8 M Tris-HCl, 0.2 M (NH4)2SO4 and 0.2 % w/v Tween-20 (Solis BioDyne, Tartu, Estonia) and incubated at 56 °C for 24 h. After inactivation of proteinase K at 98 °C for 15 min, the lysate was centrifuged at 8000 rpm for 2 min. The supernatant was diluted by 10 times and used as a template for PCR. Selected regions of the nuclear 18S and 28S ribosomal subunits and of three protein-coding genes, tef1, rpb1 and rpb2, were amplified in 70 specimens using the primers listed 185 in Table 1. Because PCR with existing primers often failed to amplify 18S rDNA and rpb1, we designed new primers that successfully paired with the target regions of these loci in most of the probes. Sequentially, the amplicons obtained with primer pairs SSU1/SSU31R and SSU3/SSU42R (Table 1) encompass the region homologous to positions 95–1585 in the 18S rDNA of Saccharomyces cerevisiae. The new primer RPB1-B was used to amplify the B-D region of rpb1 in combination with RPB1-6R1asc. The ITS region of rDNA, including the 5.8S, was amplified in 79 specimens using the primers listed in Table 1. PCR was performed using PuRe Taq Ready-ToGo™ PCR beads (Amersham Pharmacia Biotech., Piscataway, NJ, USA) or 5 x HOT FIREPol® Blend Master Mix (Solis BioDyne, Tartu, Estonia) with a 25 μl reaction volume. Although amplification often entailed trials with different combinations of primer pairs, all five gene regions could not be amplified for several specimens. The PCR products were purified using Exo-SAP enzymes (Sigma, St. Louis, MO, USA). Sequencing was performed by Macrogen Inc. (Seoul, Korea or Amsterdam, The Netherlands) or Estonian Biocentre (Tartu, Estonia). Sequences were edited and assembled with Sequencher 4.10.1 (Gene Codes, Ann Arbor, MI, USA) and deposited in INSD under the accession numbers presented in Table S1. This table also includes Species Hypothesis (SH) codes (Kõljalg et al. 2013), when available, for ITS sequences, assigned in the UNITE database via the PlutoF platform (Abarenkov et al. 2010). Table S2 includes additional sequences downloaded from INSD. Sequence alignment was performed using MAFFT v7 (Katoh and Standley 2013), followed by manual adjustment in Genedoc 2.7 (Nicholas et al. 1997). The combined dataset of 18S and 28S rDNA, rpb1, rpb2 and tef1 regions was divided into eight partitions, distinguishing each gene and their codon positions (first and second together, third separately). Ambiguously aligned sites were excluded from further analyses. To construct the Bayesian phylogeny, GTR + I + G evolutionary model was selected using MrModeltest (Nylander 2004) for most of the partitions, with the exception of F81 + I + G for first and second positions of tef1. MrBayes v. 3.2.6 (Ronquist et al. 2012) was used to analyse the partitioned five-gene dataset. The analyses were run for 50 million generations at the CIPRES Science Gateway v3.3 (http://www.phylo.org), and sampled at each 1000th generation. By the end of the run the average standard deviation of split frequencies attained 0.01. The first 25 % of the trees were discarded as a burn-in and the posterior probabilities (PP) were calculated from the remaining trees. Due to the high variability in the ITS regions, these sequences were aligned in six separate matrices, conforming to the relevant families. In addition to our original sequences, most similar sequences were obtained from GenBank by applying BLAST search for the target species, and added to the respective matrices. Two additional matrices were constructed to 186 Table 1 Fungal Diversity (2017) 82:183–219 Primers used for PCR and sequencing of the six target loci Locus Primer Direc- tion* Reference Sequence ITS ITS0F ITS5 fwd fwd Tedersoo et al. 2008 White et al. 1990 ACTTGGTCATTTAGAGGAAGT GGAAGTAAAAGTCGTAACAAGG ITS4 PNS1 nssu131 NS1 rev fwd fwd fwd White et al. 1990 Hibbett 1996 Kauff and Lutzoni 2002 White et al. 1990 TCCTCCGCTTATTGATATGC CCAAGCTTGAATTCGTAGTCATATGCTTGTCTC CAGTTATCGTTTATTTGATAGTACC GTAGTCATATGCTTGTCTC NS3 NS4 NS8 fwd rev rev White et al. 1990 White et al. 1990 White et al. 1990 GCAAGTCTGGTGCCAGCAGCC CTTCCGTCAATTCCTTTAAG TCCGCAGGTTCACCTACGGA NS19b NS24 NS41 fwd rev rev Hibbett 1996 Gargas and Taylor 1992 Hibbett 1996 CCGGAGAGGGAGCCTGAGAAAC AAACCTTGTTACGACTTTTA CCCGTGTTGAGTCAAATTA NRC3R NRC4R SSU1 SSU31R rev rev fwd rev Peterson and Pfister 2010 Peterson and Pfister 2010 This study This study GAKAACATCGCCCGATCC GCAGGTTAAGGTCTCGTTCG GGCTCATTAWATCAGTTATYG TTRAGACTACGACGGTATCTG 18S 28S tef1 rpb1 rpb2 SSU3 fwd This study GCCAGCAGCCGCGGTAATTC SSU42R LR0R CTB6 rev fwd fwd This study Moncalvo et al. 1993 Garbelotto et al. 1997 CCTCGTTGAAGAGCAATAATTG ACCCGCTGAACTTAAGC GCATATCAATAAGCGGAGG LR5 LR7 EF1-983F rev rev fwd Vilgalys and Hester 1990 Vilgalys and Hester 1990 Rehner 2001 TCCTGAGGGAAACTTCG TACTACCACCAAGATCT GCYCCYGGHCAYCGTGAYTTYAT EF1-2218R RPB1-AFasc RPB1-6R1asc rev fwd rev Rehner 2001 Hofstetter et al. 2007 Hofstetter et al. 2007 ATGACACCRACRGCRACRGTYTG ADTGYCCYGGYCATTTYGGT ATGACCCATCATRGAYTCCTTRTG RPB1-Af fwd Stiller & Hall 1997 RPB1-Cr RPB1-B RPB2-5F rev fwd fwd Matheny et al. 2002 This Study Liu et al. 1999 GARTGYCCDGGDCAYTTYGG CCNGCDATNTCRTTRTCCATRTA GARGAYGAYYTRACNTAYAA GAYGAYMGWGATCAYTTYGG RPB2-7cR rev Liu et al. 1999 CCCATRGCTTGYTTRCCCAT *fwd – forward, rev – reverse clarify the distinction of species in Chlorencoelia and Cenangium. These resulting datasets were analysed using MrBayes v.3.2.6 (Ronquist et al. 2012) in CIPRES. Of 10 million generations, 75 % of the trees were retained to calculate PP. Results and including 28 encoelioid species. Four species of Sordariomycetes, Hypocrea lutea, Neurospora crassa, Sordaria fimicola and Xylaria hypoxylon, were included to constitute the outgroup. Among the total of 10,166 characters, ambiguously aligned positions and long insertions that were present in a few sequences were removed, leaving 5641 characters for analyses. Parsimony-informative characters were distributed as follows: 18S – 291 bp; 28S – 560 bp; rpb1– Phylogenetic analyses Multigene analysis The combined dataset of 18S, 28S rDNA and the three protein-coding genes comprised sequences of 141 specimens, representing 50 species from diverse groups of Leotiomycetes Fig. 1 Bayesian phylogeny of Leotiomycetes revealing affinities of„ encoelioid fungi as inferred from the analysis of combined 18S and 28S rDNA, rpb1, rpb2 and tef1 data. Species traditionally recognised in Encoelioideae are presented in bold, with those of Encoelia in capital letters. Colours distinguish included orders of Leotiomycetes and families of the Helotiales. Branches with posterior probability scores ≥0.95 are presented in bold. Scale bar indicates substitutions per site Fungal Diversity (2017) 82:183–219 187 KL290 Rutstroemia firma Rutstroemia firma KL291 Rutstroemia firma KL292 Rutstroemia firma KL222 Rutstroemia bolaris KL234 Rutstroemia juniperi KL310 Rutstroemia johnstonii KL160 RUTSTROEMIA TILIACEA KL393 Rutstroemiaceae sp. KL288 Rutstroemiaceae sp. KL217 Lanzia luteovirescens Rutstroemia sp. as “Ciboria americana” Lambertella subrenispora Scleromitrula shiraiana 62001 KL156 SCLERENCOELIA FRAXINICOLA KL347 SCLERENCOELIA FASCICULARIS “Encoelia” fascicularis KL344 SCLERENCOELIA PRUINOSA Monilinia laxa ATCC 18683 Sclerotinia sclerotiorum CBS 499.50 Sclerotinia sclerotiorum 109263 Dumontinia tuberosa VTT D-071295 Botryotinia fuckeliana OSC 100012 Botryotinia fuckeliana Scleromitrula shiraiana KUS-F52447 KL267 Pycnopeziza sejournei KL212 Ciboria viridifusca KL243 “Cenangium” acuum KL276 “Cenangium” acuum Piceomphale clade KL374 Piceomphale bulgarioides KL98 Piceomphale bulgarioides KL375 “Velutarina” alpestris KL378 “Velutarina” alpestris KL157 “Velutarina” alpestris KL174 Cenangiopsis quercicola KL377 Cenangiopsis sp. KL332 Trochila craterium KL336 Trochila laurocerasi KL106 ENCOELIA FURFURACEA KL108 ENCOELIA FURFURACEA KL107 ENOELIA FURFURACEA KL92 ENCOELIA FURFURACEA KL253 Velutarina rufoolivacea KL244 Cenangiaceae sp. KL167 Chlorencoelia torta KL21 Chlorencoelia versiformis KP606 Chlorencoelia versiformis KL254 Crumenulopsis sororia Sarcotrochila longispora Heyderia abietis KL216 Heyderia pusilla KL20 Heyderia abietis KL390 Cenangium ferruginosum Rhabdocline laricis Ionomidotis sp. KL391 Ameghiniella australis KL299 Ionomidotis frondosa KL301 Ionomidotis olivascens Rhymbocarpus fuscoatrae “ENCOELIA” HETEROMERA KL164 “ENCOELIA” HETEROMERA KL304 “ENCOELIA” HETEROMERA KL231 Ionomidotis fulvotingens KL239 Ionomidotis fulvotingens SK91 Skyttea radiatilis Cordierites guianensis TH90 Thamnogalla crombiei SK80x Diplolaeviopsis ranula TU64867 Unguiculariopsis lettaui KL154 Ionomidotis irregularis KL317 Diplocarpa curreyana KL111 “ENCOELIA” FIMBRIATA LL95 Llimoniella gregorellae Chlorociboria aeruginosa KL238 CHLOROCIBORIA GLAUCA KL152 Chlorociboria aeruginascens KL247 Chlorociboria aeruginella Marssonina brunnea KL153 Peltigeromyces sp. KL118 Encoeliopsis rhododendri Loramyces macrosporus Mollisia cinerea Vibrissea truncorum Cyttaria hariotii 44 Cyttaria hariotii 55 Cyttaria darwinii Ascocoryne sarcoides Gelatinodiscaceae Neobulgaria pura KL221 Hyaloscypha albohyalina Hyaloscyphaceae Connersia rilstonii KL219 Phaeohelotium geogenum Cudoniella cf. clavus KL215 Phaeohelotium imberbe KL120 Perrotia populina Lachnaceae Lachnum virgineum Dermea acerina Pezicula carpinea Dermateaceae Neofabraea malicorticis AR8 Calycina vulgaris Pezizellaceae Bisporella citrina Blumeria graminis ERYSIPHALES Erysiphe glycines Pseudeurotium zonatum Pseudeurotidaceae THELEBOLALES Thelebolus microsporus Leuconeurospora pulcherrima Pseudeurotidaceae TU112863 Holwaya mucida Tympanidaceae KL220 Microglossum olivaceum Microglossum rufum Leotiaceae Leotia lubrica KL218 Claussenomyces prasinulus Tympanidaceae Bulgaria inquinans Phacidium lacerum Potebniamyces pyri Coccomyces strobi Rhytisma huangshanense Tryblidiopsis pinastri Cyclaneusma minus Naemacyclus fimbriatus KL159 XEROPILIDIUM DENNISII KL251 XEROPILIDIUM DENNISII Pilidium acerinum Pilidium concavum Chaetomella acutiseta Zoellneria rosarum Chaetomella oblonga Neurospora crassa Sordaria fimicola Hypocrea lutea Xylaria hypoxylon Rutstroemiaceae Sclerotiniaceae Cenangiaceae Cordieritidaceae Chlorociboriaceae Mollisiaceae s. l. CYTTARIALES Helotiaceae PHACIDIALES RHYTISMATALES Marthamycetaceae Chaetomellaceae SORDARIOMYCETES 0.1 188 648 bp; rpb2–631 bp; tef1–463 bp. Bayesian analysis of the partitioned five-gene dataset resulted in a well-resolved consensus of the 37,500 trees retained (Fig. 1). Most terminal clades as well as a large part of the deeper branches received strong support. The Bayesian phylogeny based on the five-gene dataset revealed the Helotiales to be paraphyletic, with members of the Cyttariales, Thelebolales, Erysiphales, Phacidiales and Rhytismatales nested within. While the monophyly of these five orders was highly supported, their relationships with various families of the Helotiales remained unresolved due to a lack of support to most of the branches. Species of Chaetomella, Pilidium and Xeropilidium dennisii (= Encoelia fuckelii) formed a strongly supported group, representing Chaetomellaceae, with an unresolved position at the base of the tree. Most of the encoelioid taxa were distributed among three major clades in the multigene phylogeny (Fig. 1). The first clade included a strongly supported monophyletic group formed of the Rutstroemiaceae and Sclerotiniaceae together with Cenangium acuum and Piceomphale bulgarioides as their sister group. The second strongly supported larger clade comprised the core group of the subfamily Encoelioideae and members of the Hemiphacidiaceae that appeared paraphyletic. All members of this clade are herein treated in the resurrected family Cenangiaceae Rehm. The third strongly supported clade comprised members of eleven encoelioid genera of which six are lichenicolous. These are all considered to constitute the Cordieritidaceae Sacc., another family resurrected herein. These three major clades formed a strongly supported group with largely unresolved relationships. Members of Encoelioideae formed six monophyletic groups recognised as distinct families, and three clades with unsettled taxonomy (Encoeliopsis, Holwaya, Piceomphale). Likewise, the genus Encoelia appeared highly polyphyletic, with eight species placed six families the whole ingroup. The type species of Encoelia, E. furfuracea, formed a strongly supported group together with species of Velutarina and Cenangiopsis (Encoelioideae s.str.), as well as Trochila spp. and an undescribed taxon. Its sister clade comprised species of Chlorencoelia, Sarcotrochila and Heyderia (Hemiphacidium clade in Wang et al. 2006a), as well as Crumenulopsis sororia and Cenangium ferruginosum. Altogether these two subclades as well as Rhabdocline laricis are considered herein to belong to the Cenangiaceae, which consequently includes the Hemiphacidiaceae. Encoelia fascicularis and E. pruinosa, shown to belong to the Sclerotiniaceae, are reassigned to a newly described genus Sclerencoelia. However, phylogenetic relationships of this strongly supported genus with their closest relatives in Monilinia, Botryotinia, Sclerotinia, Dumontinia, and Ciboria remained largely unresolved. The sister group of the Sclerotiniaceae, the Rutstroemiaceae, comprised E. tiliacea Fungal Diversity (2017) 82:183–219 and Dencoeliopsis johnstonii. These two species formed a strongly supported subclade with morphologically similar species of Rutstroemia. For the time being, the taxonomy of Cenangium acuum and Piceomphale bulgarioides remains unsettled. One of the INSD strains of Scleromitrula shiraiana (Henn.) S. Imai clustered with members of Sclerotiniaceae and the other with Rutstroemiaceae. In the Cordieritidaceae, the 11 encoelioid species were not segregated from lichenicolous taxa represented by species of Diplolaeviopsis, Rhymbocarpus, Skyttea and Thamnogalla. Among the encoelioid taxa, Encoelia and Ionomidotis appeared polyphyletic, while only one species of Ameghiniella, Cordierites and Diplocarpa was included in the analysis. Two species of Encoelia, most distantly related to the core group of Encoelioideae in Cenangiaceae, appeared to belong to two distant families with unclear position in the Leotiomycetes. Chlorociboriaceae comprised species of Chlorociboria and E. glauca, which is herein transferred to this genus. Encoelia fuckelii represented a distinct lineage in the Chaetomellaceae and was combined in the newly described genus Xeropilidium. In addition to Encoelia, other genera of the subfamily Encoelioideae appeared polyphyletic. These include Cenangium and Velutarina in the Cenangiaceae and Ionomidotis in the Cordieritidaceae. Members of Encoelioideae for which phylogenetic relationships could not be resolved include Encoeliopsis rhododendri and Holwaya mucida. The former has been accepted in the Helotiaceae (Groves 1969; Lumbsch and Huhndorf 2010) but is assigned to the Mollisiaceae when treated in a broad sense, while the latter was recently accepted in Tympanidaceae (Baral 2015). The long-branch attraction may be the reason for the inclusion of Holwaya mucida in a clade comprising members of Pseudoeurotiaceae and Thelebolales. It is likely that Holwaya represents a morphologically and genetically divergent lineage in the Leotiomycetes, thereby showing diverse affinities depending on the taxa and genes analysed (Zhuang et al. 2000; Wang et al. 2006b; Baschien et al. 2013; Crous et al. 2014). ITS rDNA analyses Cenangiaceae INSD BLAST searches were conducted with nine sequences representing the different genera of this family according to the multigene analysis (Fig. 1). In each case, the ITS sequences of ≥90 % similarity to the query were downloaded and merged into one matrix. However, the query sequence of E. furfuracea, showed only 87 % overlap with the most similar INSD sequence. Only two of our reference sequences showed greater similarity to E. furfuracea, including Cenangiopsis quercicola (88.3 %) and Cenangium ferruginosum (88 %). Pairwise ITS sequence similarities among the analyzed species varied between 83.8 % Fungal Diversity (2017) 82:183–219 SCLERENCOELIA FASCICULARIS Z81431, Corylus avellana, Norway KL347 SCLERENCOELIA FASCICULARIS, Populus tremula, Germany KL144 SCLERENCOELIA FASCICULARIS, Populus tremula, Estonia KL401 SCLERENCOELIA FASCICULARIS, neotype, Populus tremula, Estonia Uncultured Encoelia HM240815, Pinus sylvestris needles, Finland TAAM198511 SCLERENCOELIA FRAXINICOLA, holotype, Fraxinus excelsior twig, Germany Fungal sp. FJ228207, Fraxinus excelsior shoot, Sweden KL156 SCLERENCOELIA FRAXINICOLA, Fraxinus excelsior branch, Germany KL344 SCLERENCOELIA PRUINOSA, Populus tremuloides bark, USA UT KL346 SCLERENCOELIA PRUINOSA, Populus deltoides bark, USA NY KL343 SCLERENCOELIA PRUINOSA, Populus tremuloides bark, USA UT Monilinia fructicola FJ515894, China KL309 Ciboria conformata, Alnus leaves, Denmark Ciboria conformata KF545323, Alnus glutinosa leaf litter, Netherlands Ciboria conformata KJ941075, Alnus glutinosa leaves, Spain Kohninia linnaeicola AY236423, Linnaea borealis, Norway Botryotinia squamosa EU519208, Allium, China Sclerotinia sclerotiorum AF455526, Homo sapiens nasal mucus KL102 Ciboria aff. conformata, Salix glauca leaves, Greenland KL402 Elliottinia kerneri, Abies alba twigs, Switzerland TU109263 Dumontinia tuberosa, Anemone nemorosa, Estonia KL212 Ciboria viridifusca, Alnus catkins, Estonia Valdensinia heterodoxa KF212190, Vaccinium corymbosum, Poland Pycnopeziza sympodialis KF859927, USA KL365 Ciboria batschiana, Quercus robur ahorn, Estonia KL217 Lanzia luteovirescens, Acer platanoides petioles, Estonia Rutstroemia firma KF588368, Quercus robur, Spain KL312 Rutstroemia johnstonii, Xenotypa aterrima on Betula, Denmark KL222 Rutstroemia bolaris, Betula twig, Estonia KL351 Rutstroemia juniperi, Juniperus communis twigs, Norway KL160 RUTSTROEMIA TILIACEA, Tilia branch, Germany Rutstroemia echinophila KF545332, Quercus castaneifolia cupule, Netherlands KL289 Rutstroemia sydowiana, Quercus robur leaves, Estonia Rutstroemia sp. as “Ciboria americana” JN033399, chestnut bur, Korea Lanzia allantospora AY755334, Agathis australis, New Zealand Lambertella subrenispora KF545329 Rutstroemia paludosa KF545316, Symplocarpus foetidus ,USA NY Rutstroemia calopus KF545314, dead grass, Netherlands Rutstroemia maritima KF588372, Ammophila arenaria dead stems, Spain Scleromitrula shiraiana HQ833456, Morus fruit Piceomphale bulgarioides KJ941086, Picea abies cone, Switzerland KL98 Piceomphale bulgarioides, Picea abies cone, Estonia Piceomphale bulgarioides Z81441, Picea abies, Norway KL374 Piceomphale bulgarioides, Picea abies cone, Estonia KL373 Piceomphale bulgarioides, Picea abies cone, Finland KL232 “Cenangium” acuum, Pinus sylvestris needles, Norway KL276 “Cenangium” acuum, Pinus sylvestris needles, Czech Republic KL243 “Cenangium” acuum, Pinus sylvestris needles, Germany KL233 “Cenangium” acuum, Pinus sylvestris needles, Norway 0.1 Sclerotiniaceae Fig. 2 Bayesian phylogeny based on rDNA ITS sequences of selected members of the Rutstroemiaceae and the Sclerotiniaceae with BCenangium^ acuum and Piceomphale as an outgroup. Analysis included sequences from fruitbodies (in italics) and INSD sequences from other biological samples with ≥95 % similarity to the encoelioid species (in bold). Species traditionally recognised in Encoelia are presented in capital letters. Branches with posterior probability scores ≥0.95 are in bold. Scale bar indicates substitutions per site 189 Rutstroemia s. str. Rutstroemia calopus clade Piceomphale clade (Rhabdocline laricis vs. E. furfuracea) and 94.4 % (Chlorencoelia versiformis vs. Crumenulopsis sororia). The phylogenetic tree calculated for these 87 sequences distinguished a number of well-supported lineages, but remained largely unresolved (Fig. S1). The monophyly of genera and species was strongly supported for Heyderia, Rhabdocline, Sarcotrochila and Trochila. Our ITS phylogeny supported the distinction of the endophytic R. parkeri with a Meria anamorph from the pathogenic species of Rhabdocline (R. pseudotsugae, R. epiphylla, R. oblonga, R. obovata). Rhabdocline (= Meria) laricis formed a sister group to all these species with the genus appearing distinct from all other members of the Cenangiaceae. The almost identical sequences from five collections of E. furfuracea formed a divergent sister group of a clade comprising sequences of Trochila, Velutarina alpestris and Cenangiopsis spp. However, relationships within this clade and its affinities to other groups could not be clarified. While the monophyly of Chlorencoelia was not supported, the strong support received for the clade comprising sequences derived from apothecia of Cenangium ferruginosum and from isolates of various endophytes indicated their conspecific or congeneric status. Besides C. ferruginosum, sequences from biological samples (mostly of foliar endophytes) were included in Heyderia abietis, Rhabdocline laricis, R. parkeri and in the Chlorencoelia clade. In addition, three strongly supported groups with unresolved relationships comprised sequences only from endophytes, mostly from roots or soil. Obviously, more INSD sequences from biological samples belong to the Cenangiaceae, yet the delimitation of this family could not be determined on the basis of ITS rDNA data alone. Further analysis focused on Cenangium ferruginosum and its closest relatives. Among the 18 unidentified INSD 190 sequences with 95 to 100 % similarity to C. ferruginosum (KL390), six appeared to belong to this species (Fig. S2). Specifically, four INSD sequences originating from Viscum album parasitizing Pinus sylvestris and two others from needles or twigs of Pinus spp. formed a strongly supported clade with six sequences obtained from apothecia growing on twigs of Pinus spp. An isolate of C. japonicum formed their sister group. The other strongly supported clade comprised sequences from surface sterilised tissues of two conifers, a forest grass, a liverwort and a lichen. The relationship of sequences from two further hosts remained unresolved at the base of the tree. Phylogenetic analysis of nine ITS sequences obtained from apothecia of Chlorencoelia spp. and ten INSD sequences with 95–99 % similarity to KL21 (C. versiformis) distinguished C. versiformis from two clades of sequences accessioned as C. torta (Fig. S3). The sister clade of these apothecia-derived sequences was formed of sequences originating from biological samples, mostly from ectomycorrhizal root tips of Larix spp. and Pinus spp. or from coniferous litter. The anamorphic Vestigium trifidum, described from Abies balsamea, and an undescribed teleomorphic member of Cenangiaceae from Salix branches formed the basal lineages of the ingroup. Sclerotiniaceae The ITS rDNA phylogeny supported the distinctiveness of encoelioid members within the family (Fig. 2), for which the genus Sclerencoelia is described below. Among these, both S. fascicularis and the new species S. fraxinicola included apothecial and endophytic isolates in their respective clades. Phylogenetic relationships among the sclerotiniaceous genera remained largely unresolved, likewise in the analyses of an extended dataset (not shown), which included similar INSD sequences obtained mostly from soil samples. Rutstroemiaceae The analysis of ITS rDNA of an extended set of samples (Fig. S4) supported the multigene phylogeny (Fig.1) in distinguishing the monophyly of this family. The former, as well as an analysis of ITS data of Rutstroemiaceae and Sclerotiniaceae (Fig. 2) revealed Rutstroemia and Lanzia as polyphyletic, although only the terminal branches were supported. Almost all INSD sequences from biological samples fell into a well-supported clade comprising apotheciaderived sequences of Rutstroemia calopus, R. maritima and R. paludosa. This species complex appeared distinct from the clade comprising the type of the genus, R. firma, as well as the two encoelioid species, Dencoeliopsis johnstonii and Encoelia tiliacea. Chlorociboriaceae The initial datamatrix included representatives of all species of Chlorociboria with available ITS sequences, and E. glauca together with >85 % similar INSD sequences. While this was the lowest ITS similarity value observed among species of Chlorociboria, the list of all Fungal Diversity (2017) 82:183–219 sequences with >85 % similarity to E. glauca also included representatives from different families of the Helotiales and many unidentified sequences from biological samples. In the initial analysis all these sequences formed an unsupported clade distinct from that of Chlorociboria sequences, but were excluded from the final analysis. Despite the high number of variable characters, the ITS-based phylogeny of remaining Chlorociboria sequences was largely unresolved and the genus was not supported as monophyletic (Fig. S5). Chaetomellaceae The ITS matrix included INSD sequences with ≥85 % similarity to KL251 (Xeropilidium dennisii) as well as some more dissimilar sequences from genera shown to belong to the family (Johnston et al. 2014a; Rossman et al. 2004). The analysis (Fig. S6) revealed Xeropilidium dennisii as the most basal group in the phylogeny. The two sequences derived from apothecia were indentical to the one obtained from a culture isolate and to an INSD sequence obtained from the European elm bark beetle (Scolytus multistriatus), the vector of Dutch elm disease. The rest of the ingroup included Chaetomella spp., Pilidium spp., Sphaerographium nyssicola, Corniculariella brasiliensis and unidentified INSD sequences originating from various plants. Taxonomy Species combined in Encoelia in the past belong to three previously described genera (Chlorociboria, Encoelia, Rutstroemia) and four new genera (Sclerencoelia, Xeropilidium and two unnamed genera) as revealed by the phylogenetic analysis of multigene data. In the multigene phylogeny (Fig. 1), these genera were distributed among the families Cenangiaceae and Cordieritidaceae, both resurrected here, Chlorociboriaceae and Chaetomellaceae, proposed recently (Baral 2015), as well as Rutstroemiaceae and Sclerotiniaceae. Morphological characters of taxa, so far treated in Encoelia and Encoelioideae (Table S3), were reevaluated with respect to their phylogenetic relationships, revealed for the first time in this study. This resulted in several taxonomic changes, involving descriptions of new genera and species, new combinations and expansion of the concept of some genera and families due to the inclusion of previously misplaced members. In the following we present detailed descriptions of six species previously assigned to Encoelia and of one new species. In addition, 14 genera of the previous Encoelioideae for which material was available are discussed. Cenangiaceae Rehm (as BFamilie Cenangieae^), in Winter, Rabenh. Krypt.Fl., Edn 2 (Leipzig) 1.3(lief. 31): 213 (Rehm 1889) [1896], emend. Baral & Pärtel. – Type genus: Cenangium Fr. (Fig. 3). Fungal Diversity (2017) 82:183–219 191 Fig. 3 Morphology in species of Cenangiaceae. a Apothecia of Cenangiopsis quercicola. b–d Chlorencoelia versiformis, b apothecia, c marginal cells* with vacuolar bodies (VBs), d ascus apical ring in IKI. e Closed young apothecia of Encoelia furfuracea. f–i Cenangium ferruginosum, f apothecia, g cells of ectal excipulum, h–i asci with asymmetrical apex, h dead state in CB, i living state. j Apothecia of Hysterostegiella dumeti, with lids (arrows). k–n Velutarina rufoolivacea, k external cells of excipulum with crystalloid deposits, l ascus apical ring in IKI, m vesicular cell* with VB in medullary excipulum, n young apothecia. o–q Trochila laurocerasi, o apothecia, p ascus apical ring† in IKI, q marginal cells* of excipulum with VBs. r–s Heyderia pusilla, r hair-like cells* on stipe with VBs, s apothecium on a needle. Scales: a, f, j, n, o, s = 1 mm; b, e = 1 cm; c, g–i, k–m, p– r = 10 μm; d = 5 μm. Sources: a H.B. 8521; b, d TU 119720; c M.H. 13.X.08, e TU 112918; f TAAM 198451; g OULU 24441; h OULU 24432; i H.B. 7615; j I.W. 110,703; k, n H.B. 8977; l, m H.B. 9181; o– q M.H. VII.2011, r–s H.B. 9617. Photos a by J.H. Petersen; c, o–q by M. Hairaud; f by B. Perić; j by I. Wagner = Helotiaceae subfam. Encoelioideae Nannf. Nannfeldt 1932 (s. str.) – Type genus: Encoelia (Fr.) P. Karst. = Hemiphacidiaceae Korf 1962 – Type genus: Hemiphacidium Korf (= Sarcotrochila Höhn. fide Stone and Gernandt 2005). Apothecia 0.2–20 mm in diam., opening with a circumscissile or lacerate rupture of the overlying host tissue, immersed or erumpent, stroma absent, cupulate to plane, rarely capitate (Heyderia); the disc often closing upon drying or retracting under the covering lid (Fig. 3j); ± sessile (but longstipitate in Heyderia); leathery or soft, brownish-greyish, ochraceous, yellowish or greenish; margin and exterior smooth or tomentose to pustulate due to brownish hair-like elements. Ectal excipulum of hyaline to brown t. globulosa- 192 angularis, strongly reduced in immersed genera, sometimes with crystals. Paraphyses cylindrical or lanceolate, exceeding the asci or not; *terminal cell mostly containing a large, hyaline or yellow to greenish or brownish, elongate (rarely multiguttulate) refractive vacuole (VB), VBs rarely absent (Cenangium p.p., Velutarina p.p.). Asci cylindric-clavate, apex hemispherical to conical, inamyloid or amyloid (usually with Calycina-type apical ring) (Figs. 3d–p) with or without croziers, (2–4–)8-spored, rarely polysporous. Ascospores ellipsoidal, ovoid, fusoid, clavate, or allantoid; aseptate, rarely 1–3-septate when overmature; hyaline, in some species brown when overmature; lipid content low to high; sometimes covered by a sheath, sometimes budding microconidia on short germ tubes. Ionomidotic reaction absent, very rarely positive (yellowish to reddish-brown in Cenangium ferruginosum). Anamorphs acervular (Rhabdocline, Rhabdogloeopsis), sporodochial (Rhabdocline), or stromatic (Crumenulopsis) but unknown in most of the taxa. Habitat lignicolous or foliicolous, endophytic, saprotrophic or parasitic on gymnoand angiosperms, causing leaf blight and branch canker especially in conifers (Abies, Larix, Picea, Pinus, Pseudotsuga) (Korf 1962; Hein 1983; Gernardt et al. 1997, Stone and Gernandt 2005, Wang et al. 2006a; Wang et al. 2009), mostly desiccation-tolerant. Included genera: Cenangiopsis Rehm, Cenangium Fr., Chlorencoelia J.R. Dixon, Crumenulopsis J.W. Groves, Encoelia (Fr.) P. Karst. s. str., Fabrella Kirschst., Heyderia (Fr.) Link, Rhabdocline Syd., Sarcotrochila Höhn., Trochila Fr. and Velutarina Korf ex Korf. (Based on morphology, Didymascella Maire & Sacc., Hysterostegiella Höhn. and Korfia J. Reid & Cain could be included, but molecular evidence to support this is lacking.) The core group of Encoelioideae formed a monophyletic group with several members of the Hemiphacidiaceae in the multigene phylogeny (Fig. 1). The former group was represented by type species of two genera, Encoelia furfuracea and Cenangium ferruginosum, as well as species of Cenangiopsis, Crumenulopsis, and Velutarina. Nannfeldt (1932) treated the Encoelioideae as a subfamily of Helotiaceae, and until now most of these genera were accepted in this family. The transfer of E. fascicularis to the Sclerotiniaceae (Holst-Jensen et al. 1997) was later extrapolated to E. furfuracea and to other species in the genus (Lumbsch and Huhndorf 2010, Kirk et al. 2015). However, our multigene phylogeny revealed this affiliation to be erroneous. Hemiphacidiaceae was introduced as a group of small parasitic fungi (genera: Didymascella, Fabrella, Gremmenia, Hemiphacidium, Korfia, Lophophacidium, Naemacyclus, Rhabdocline (= Meria) and Sarcotrochila) with reduced excipulum immersed in leaves of conifers (Korf 1962, 1973; Reid and Cain 1963). The family was subsequently expanded based on results of phylogenetic analyses (Wang et al. 2006a, b) to include some morphologically more divergent genera, Fungal Diversity (2017) 82:183–219 such as Heyderia and Chlorencoelia. The family has been distinguished as a sister group of Sclerotiniaceae and Rutstroemiaceae in previous phylogenetic studies (Spatafora et al. 2006; Wang et al. 2006b; Johnston et al. 2014a; Crous et al. 2014). In our analyses of the multigene data, however, neither the core group of Encoelioideae nor the Hemiphacidiaceae appeared monophyletic while forming a well-supported sister group of Sclerotiniaceae and Rutstroemiaceae. Based on this evidence, we consider the core group of Encoelioideae and the analysed members of Hemiphacidiaceae (Chlorencoelia, Sarcotrochila, Heyderia, Rhabdocline), to form a single family, the Cenangiaceae. In addition, the genera Trochila and Hysterostegiella, previously accepted in the Dermateaceae (Nauta and Spooner 2000b, Lumbsch and Huhndorf 2010), are included in the Cenangiaceae. The transfer of these genera is based on close relationship of Trochila to studied members of Cenangiaceae (Fig. 1), and on the morphological similarity of Hysterostegiella to Trochila and Sarcotrochila. Alternatively, a division into two families could be attained by the inclusion of Crumenulopsis and Cenangium ferruginosum in the Hemiphacidiaceae while recognising its sister group as a new family. These two groups are distinguished by differences in the host, being mostly gymnosperms in the Hemiphacidiaceae-clade and usually angiosperms in the Encoelia-Cenangiopsis-Velutarina clade. However, the two subdivisions cannot be delimited on morphological grounds, whereas the affinities of Rhabdocline with either of these clades remained unresolved (Fig. 1). Cenangiaceae is herein resurrected to include all the above-mentioned genera, as it is the oldest family name available for this group. Rehm (1889) described this family to comprise species that have erumpent, urn-shaped to cupulate, leathery apothecia with a rough exterior, being closed at the beginning and opening by a mostly roundish pore with a sharp margin. Rehm included five genera in the family, of which our concept retained Cenangium s. str. (C. ferruginosum) and Crumenulopsis (≡ Crumenula Rehm), with Cenangella Sacc. placed in synonymy with Dermea (Dermateaceae, Rehm 1912), Godronia Moug. & Lév. in the recently described Godroniaceae (Baral 2015), and Tryblidiella Sacc. in Patellariaceae, Dothideomycetes (Kutorga and Hawksworth 1997). Members of the expanded Cenangiaceae including those of the previous Hemiphacidiaceae share several morphological characters. Most of these taxa are characterised by fruitbodies that are initially or in dry periods closed either by a lid or a roof-like apothecial margin, while the shape and size of the apothecia are quite variable among different genera. The outermost, generally globose cells of the ectal excipulum are often loosely connected or the excipular tissue is reduced. Refractive vacuoles, observed solely in the terminal cells of living paraphyses or in excipular cells (Figs. 3c–r and 4m–n), Fungal Diversity (2017) 82:183–219 193 Fig. 4 Encoelia furfuracea. a Closed juvenile apothecia. b–c Mature apothecia showing a lacerate margin. d–e Cross-section of fruitbody. f Loosely attached outermost cells forming sharp outgrowths covered by crystalloid matter. g Cells of ectal excipulum covered with rough exudate. h Medullary excipulum. i Hymenium*. j Ascus apex† in KOH + MLZ. k Asci in KOH + MLZ. l Ascospores*, two with microconidia. m–n Paraphyses* with apical refractive vacuole, n in CRB. Scale bars: a– c = 1 cm, d = 50 μm, e = 100 μm, f = 20 μm, g–j, k–n = 10 μm. Sources: a TU 112918; b–c TU 104532; d–e, TAAM 198454; f–i, m, n TU 104527; j, l TU 104533; k TU 104511. Photos b, c by V. Liiv serve as a synapomorphy for almost all genera assigned herein to the Cenangiaceae for which living material could be studied. This feature is absent in only a few species (Cenangium ferruginosum, Velutarina bertiscensis). Refractive vacuoles have rarely been mentioned in earlier descriptions, because this feature is usually invisible in dried material. In the lack of fresh collections, it could so far not be explored in Didymascella, Fabrella, Korfia and Rhabdocline. The longevity of fruitbodies is characteristic of many members of the Cenangiaceae. Their apothecia often grow on corticated branches or leaves still attached to trees even several meters above ground. 194 INSD sequences from biological samples that had >90 % similarity to our reference sequences of the Cenangiaceae originated mostly from tissues of various plants (Figs. S1– S3). Whereas endophytes from leaves and twigs could often be identified to genus or species, root endophytes formed separate clades distinct from identified strains. The data accompanying these ITS sequences reveal that an endophytic lifestyle is shared by members of the previous Hemiphacidiaceae and the core group of Encoelioideae. In addition to several lineages including sequences from only endophytes, these data provide evidence of the occurrence of the endophytic stage also in various species that form apothecia. Cenangium Fr. Fries 1822 Type species: Cenangium ferruginosum Fr. In Cenangium apothecia are erumpent, leathery and cupulate, with margins inrolled when dry. The excipulum is brown and formed mainly of globose thick-walled cells and the ascospores are ellipsoidal (Fig. 3 f–i). While numerous species have been included previously in Cenangium, the most recent works including the genus (Korf 1973; Dennis 1978) have retained only BC.^ acuum in addition to the type species. Cenangium ferruginosum is distinguished from many other members of Cenangiaceae by an inamyloid ascus apex, representing a unique type (Verkley 1995) and a positive ionomidotic reaction. Both C. ferruginosum (apothecia on xeric pine bark) and BC.^ acuum (on xeric pine needles) may grow endophytically in pine needles, but differ most remarkably in the ascus apex, the latter possessing an amyloid apical ring (Table S3). The closest relatives of C. ferruginosum in the multigene phylogeny (Fig. 1) were Heyderia spp., which grow on coniferous needles. By contrast, BC.^ acuum formed a more distantly related group together with Piceomphale bulgarioides, inhabiting hygric spruce cones. The presense of C. ferruginosum apothecia on diseased pines and culture experiments with pine needles have demonstrated a parasitic-endophytic lifestyle for this species (Sieber et al. 1999; Jurc et al. 2000). It is considered to cause damage to pines in Poland (Duda and Sierota 1997), Spain (Santamaria et al. 2007) and Japan (Koiwa et al. 1997). ITS rDNA provided additional evidenc e of the p arasitic -endop hytic lifestyle of C. ferruginosum with four INSD sequences from Viscum album on Pinus sylvestris and four sequences from fruitbodies of C. ferruginosum on pines each differing only in a few autapomorphies. With respect to ITS phylogeny, an ITS sequence from apothecia on P. nigra, another from a P. halepensis endophyte and the third from pine needles were distinguished in the C. ferruginosum clade by sharing one synapomorphy (Fig. S1). Altogether these 11 sequences formed a strongly supported clade with the morphologically very similar C. japonicum as a sister group. Furthermore, several presumably congeneric endophytic fungi Fungal Diversity (2017) 82:183–219 detected from various hosts appeared closely related to these two species of Cenangium (Figs. S1, S2). Cenangiopsis Rehm 1912 Type species: Cenangiopsis quercicola (Romell) Rehm Cenangiopsis quercicola is a sessile, cupulate, externally pustulate and marginally hairy fungus (Fig. 3a). It differs from Encoelia furfuracea in having more fragile fruitbodies with a paler (beige) disc and protruding lanceolate paraphyses. The species forms apothecia on recently dead, thin, corticated branches of living oak trees (Læssøe and Petersen 2007), resembling E. furfuracea in tolerating long periods of low air humidity by inrolling the disc. The multigene (Fig. 1.) and ITS rDNA phylogeny (Fig. S1) both revealed a close relationship between C. quercicola and an undescribed species of Cenangiopsis, BVelutarina^ alpestris and Trochila spp. Chlorencoelia J. R. Dixon 1975 Type species: Chlorencoelia versiformis (Pers.) J. R. Dixon, Fig. 3b–d. Members of the Cenangiaceae grow typically on xeric leaves or bark, but Chlorencoelia spp. form apothecia on hygric, rotten, decorticated wood, mainly of angio- but also gymnosperms. Dixon (1975) discussed the overlap of character ranges of Chlorencoelia versiformis and C. torta. However, analysis of ITS data, including sequences from recent collections in Estonia and USA, distinguished these two species (Fig. S3). Ascospores examined in these collections also provide a clear distinction, being 2–6-guttulate and subcylindric-allantoid in C. versiformis, but biguttulate and subcylindric- ellipsoidal in C. torta. Ascospores from collections of both species germinated on MEA, producing sterile olivaceous colonies comprised of hyphae 1.5–3.5 μm in diam. All isolates remained sterile over 2 months, with no characters observed to distinguish the two species in culture. The ITS phylogenies did not support the monophyly of Chlorencoelia (Figs. S1 and S3). Among collections labelled as C. torta, those from North America (collected near the type locality), were distinct from South-East Asian collections, suggesting that these represent distinct species. INSD ITS se que nce s with ≥ 95 % similarity obtained from ectomycorrhizal root tips or litter of conifers probably represent one or more closely related taxa, segregated from C. versiformis and C. torta at the species or generic level. Whereas these two species produce apothecia on decaying hygric wood, their close relatives can grow as endophytes of aerial plant parts, which is characteristic of members of the Cenangiaceae. Crumenulopsis J.W. Groves 1969 Type species: Crumenulopsis pinicola (Rebent.) J.W. Groves. Crumenulopsis is a genus with rather dark long-haired apothecia growing on xeric coniferous bark. The genus resembles Cenangiopsis quercicola in that it forms fragile apothecia. The type species, C. pinicola (Rebent.) J.W. Fungal Diversity (2017) 82:183–219 Groves could not be included in the analysis due to the lack of a recent collection. Crumenulopsis sororia is a parasite causing pine dieback (Butin 1989), which forms black globular pycnidia in culture (van Vloten and Gremmen 1953). Multigene analysis (Fig. 1) supported a close relationship with Chlorencoelia, while the ITS rDNA data did not resolve its affinities (Fig. S1). Encoelia (Fr.) P. Karst. Karsten 1871. Encoelia was established as a tribe within Peziza sect. Aleuria by Fries (1822) and raised to generic level by Karsten (1871). Rehm (1889: 219) treated Encoelia (together with Eucenangium) as a subgenus of Cenangium in the subfamily Cenangieae in Dermateaceae. Kirschstein (1935) accepted Encoelia with three subgenera, Euencoelia, Encoeliopsis [non Encoeliopsis Nannf.], and Ocellaria. Korf and Kohn (1976) adopted this concept concerning the former two subgenera, by using the older name Phibalis Wallr. (as subgen. Phibalis and Kirschsteinia, respectively). Encoelia was lectotypified with E. furfuracea (Roth) P. Karst. (Clements and Shear 1931), and Eckblad et al. (1978) proposed its conservation at the generic level against Phibalis Wallr., which had shortly before been lectotypified with the same species, Phibalis furfuracea (Roth) Wallr., by Korf and Kohn (1976). Encoelia furfuracea (Roth) P. Karst., Bidr. Känn. Finl. Nat. Folk 19: 218 (Karsten 1871) (Fig. 4) ≡ Peziza furfuracea Roth, Catal. Bot. 1: 257 (1797) ≡ Phibalis furfuracea (Roth) Wallr., Flora Cryptogamica Germaniae (Norimbergae) 2: 447 (1833) ≡ Cenangium furfuraceum (Roth) De Not., Porp. Rettif. Profilo Discomyc.: 30 (1864) = Peziza furfuracea var. caespitosa Alb. & Schwein., Consp. fung. (Leipzig): 343 (1805) Apothecia ca. 5–20(−33) mm in diam., growing usually in scattered clusters of a few fruitbodies or rarely solitary, erumpent, arising from a wide stipe-like base, 2–3 × 2– 2.5 mm, deeply immersed in bark, seated on wood below, sometimes with black stromatic tissue in wood. At first closed (cleistohymenial, opening in the mesohymenial phase when young asci already formed) and usually irregularly cushionshaped, sometimes elongated, outside strongly furfuraceousflaky, beige, light clay-pink to light cinnamon-brown; tough. After opening by an irregularly torn aperture which remains as a lacerate margin, the fruitbodies become ± cupulate or almost flat by curling outward the margin to expose the disc. In dry condition the margin is strongly inrolled and the disc closed, external surface hydrophilous, rapidly taking up water. Disc smooth, bright hazel- to dark chestnut brown, sometimes with greyish hue, darkening when dry. Ectal excipulum 80– 200 μm thick, of reddish-brownish, loose t. globulosa, cells 7–15 μm in diam., with golden brown and partly refractive thick walls and brown, rough intercellular substance (exudate), the outermost layer Bflaking^ into c. 50–80 μm long 195 pyramid-like pustules, sometimes terminally with sharply pointed and branched, hyaline to brown hyphae, heavily incrusted with hyaline crystalloid matter that stains turquoise blue in CRB, KOH does not change or dissolve the pigment but ± dissolves the crystalloid matter (also MLZ). Medullary excipulum 200–1000 μm thick, in centre 2–4 mm thick, of t. intricata, hyphae (2–)4–7(−10) μm wide, thin- to very thickwalled, loosely interwoven, walls heavily incrusted with hyaline or light yellowish to brownish exudate, vesicular cells absent. Subhymenium ochraceous, 50 μm thick, of t. intricata, hyphae 3–4 μm wide. Asci narrowly clavate, tapered towards the base in a very long and relatively narrow stipe, *125–150 × (7.5–)8–8.5(−9.3) μm {2}, †90–115 × 5– 7(−8) μm {5}; apex rounded, subtruncate or subconical, apical ring euamyloid, staining deep blue in IKI and MLZ, Calycina-like, spores * ± obliquely 2–3-seriate, pars sporifera * ~ 28–30 μm long, arising from croziers, partly with small perforation {4}. Ascospores allantoid, slightly to strongly curved, hyaline, non-septate, *(8–)9–11(−12) × 2–2.5(−3) μm {4}, †6–10(−12) × (1.5–)2–2.6 μm, with 1–2 mediumsized and a few small guttules (LBs) near each end; in overmature apothecia sometimes producing subglobose to ovoid microconidia *2.2–3.2 × 1.8–2 μm directly at one end. Paraphyses slightly shorter than living asci, narrowly clavate, 2–3.5 μm thick in lower half, gradually widened near apex to *3.5–5(−6.5) μm, covered by a thin, hyaline to pale brown gel sheath, living terminal cell containing a refractive, ochraceous- to greenish-yellow vacuole *8–20 × 3–6 μm, staining turquoise-blue in CRB. Rhomboid crystals absent. Habitat: on dead, still standing, corticated trunks and branches of Corylus spp., Alnus spp. and Carpinus betulus, 0.5–3 m above ground. Phenology: growing mostly in the cold season but can be found almost all year around. Distribution: common in boreal and temperate regions of Europe and North America (Breitenbach and Kränzlin 1984, Hansen and Knudsen 2000, Beug et al. 2014). Comments: This fungus is one of the few members of the Helotiales in the temperate and boreal humid zone that develops comparatively large apothecia that persist throughout the winter when the forest floor can be snow-covered. Based on our observations the whole fruitbody is drought-tolerant and can survive desiccation for at least a month. Morphologically, E. furfuracea most resembles Velutarina rufoolivacea, and these two species formed a strongly supported clade in the multigene phylogeny (Fig. 1). Their morphological similarities are manifested in the composition of the ectal excipulum and its furfuraceous outer layer (Table S3). A striking difference was noted in regard to water uptake by the surface of the receptacle. Specifically, dry apothecia of E. furfuracea (and V. bertiscensis) are soaked rather rapidly after adding a drop of water on their surface, whereas V. rufoolivacea is water-repellent and absorbs water tardily (Baral and Perić 2014). Furthermore, Velutarina 196 rufoolivacea is plurivorous, whereas E. furfuracea is restricted to species of Betulaceae. The distinctness of Encoelia furfuracea is manifested not only in morphology but also at a molecular level. A long branch distinguished E. furfuracea from other members of the Cenangiaceae in the multigene (Fig. 1) and ITS phylogeny (Fig. S1). In both trees its closest relatives included species of Velutarina, Cenangiopsis and Trochila. The most similar INSD ITS sequences were >13 % different and represented endophytic isolates from various plants. Intraspecific variation in ITS, however, was low, with the one North American specimen differing from the European specimens on various hosts at only one position. Specimens examined CANADA, Newfoundland and Labrador, Newfoundland Co, Humber village, Maple Ave 13, 48.98528°N 57.77°W, alt. 11 m, in broad-leaved wood, Alnus incana subsp. rugosa, on a dead trunk, 22 Mar 2010, leg. A. Voitk (TAAM 198454, KL 400); ibid., 25 Mar 2010 (TAAM 198456); near Blow-Me-Down hiking trail, 49.06° N 58.29189°W, alt. 240 m, Alnus sp., on dead trunk, 4 May 2015, A. & M. Voitk (TU 104533). ESTONIA, Jõgevamaa, Puurmani Comm., Kursi forestry sq. 95, 58.5333°N 26.275°E, alt. 43 m, on branches of deciduous tree, 8 Oct 1997, A. Raitviir (TAAM 137509, KL92); Raplamaa, Juuru Comm., Järlepa forestry sq. 41, 59.1383°N 24.983°E, alt. 75 m, on dead branches of Corylus avellana, 22 May 2004, K. Pärtel (TAAM 165978, KL106); LääneVirumaa, Kadrina Comm., near Pariisi, 59.266°N 26.15°E, alt. 117 m, C. avellana, on a dead branch, 13 May 2000, K. Pärtel (TAAM 165633, KL107); Rakvere, in oak forest, 59.33972°N 26.35138°E, alt. 107 m, C. avellana, on a dead branch, 30 Oct 2011, K. Põldmaa (TU 112918); Tartumaa, Nõo Comm., Vapramäe, 58.25°N 26.467°E, alt. 58 m, C. avellana, on a dead branch, 28 Jan. 2001, A. Raitviir (TAAM 165767, KL108); ibid., 58.25333°N 26.46167°E, alt. 54 m, C. avellana, on standing dead trunk, K. Pärtel, 28 Mar 2015 (TU 104527); Saaremaa, Lümanda Comm., Viidu, Viidumäe Nature Reserve, 58.28277°N 22.12916°E, alt. 50 m, C. avellana, on dead trunks, 6 Apr 2011, V. Liiv (TU 118321); ibid. 58.2826°N 22.1294°E, 1 Apr 2015, V. Liiv (TU 104532). GERMANY, Baden-Württemberg, 7.5 km NW of Stuttgart, 1.3 km WSW of Weilimdorf, Fasanenwald, 48.812°N, 9.098°E, alt. 340 m, branch of Carpinus betulus, 11 Feb. 1990, O. Baral & H.O. Baral (H.B. 4010); 6 km NW of Stuttgart, 1 km S of Korntal, Tachensee, 48.821°N 9.124°E, alt. 320 m, branch of Corylus avellana, 27 Jan. 1974, H.O. Baral & O. Baral (H.B. 1038); 8 km S of Böblingen, 3.5 km S of Holzgerlingen, Schleißenhau, 48.607°N, 9.022°E, alt. 500 m, trunk & branch of C. avellana, 18 Dec 1989, H.O. Baral (ø); Bayern, 8.5 km ESE of Sonthofen, 2.5 km SSE of Hindelang, E of Hornkapelle, SW of Bruck, 47.483° N 10.383°E, alt. 870 m, branch of C. avellana, 27 Mar 1977, Fungal Diversity (2017) 82:183–219 H.O. Baral (H.B. 1783); 13.5 km ESE of Regensburg, 0.5 km E of Roith, Moosgraben, 48.982°N 12.28°E, alt. 340 m, branch of Alnus, 1 Feb. 1990, E. Weber & H.O. Baral (H.B. 3980). SWITZERLAND, Bern, Jura bernois, Tavannes, 47.22°N 7.194°E, alt. 800 m, Corylus avellana, on recently died branch, 1 Mar 2014, A. Ordynets (TU 104511); Thurgau, 4.5 km NW of Frauenfeld, 0.5 km S of Horben, Ittingerwald, 47.585° N 8.86°E, alt. 490 m, branch of Alnus, 15 Dec 1986, P. Blank (H.B. 3137). Velutarina Korf ex Korf 1971 Type species: Velutarina rufoolivacea (Alb. & Schwein.) Korf (Fig. 3k–n) The genus is characterised by erumpent, sessile, brown, externally pruinose-tomentose, rather thick, cleistohymenial apothecia. Based on multigene phylogeny, Velutarina is paraphyletic. The type species of the genus, V. rufoolivacea, resembles most its phylogenetically closest species, Encoelia furfuracea, from which it differs mainly in the broadly ellipsoid ascospores. A similar apothecial development with a late opening in the mesohymenial phase is notable for both taxa. Moreover, both taxa have tough and revivable apothecia with the rust-brownish outer surface that appears furfuraceous due to globose excipular cells, which are loosely interconnected and lack hyphal orientation. These cells rarely exceed 15 μm in diam., but in V. rufoolivacea some can measure up to 30 μm in diam. and have a greenish vacuolar content. Such greenish vesicular cells are found mainly in the medullary excipulum, and are absent in E. furfuracea. However, the same greenish or chlorinaceous vacuolar sap is found in the living terminal cells of paraphyses in both species. These morphological differences between V. rufoolivacea and E. furfuracea (Suppl. Tab. 3), together with some additional aspects pointed out by Kohn (1977), do not support merging the two species into one genus. Recently described Velutarina bertiscensis and „V.B alpestris specimens from Europe lack oversized cells with greenish content and amyloid asci, and V. bertiscensis also lacks the refractive vacuoles in the paraphyses (Baral and Perić 2014, see also Suppl. Tab. 3). ITS sequences could not be obtained for V. rufoolivacea and V. bertiscensis. Further studies are needed to resolve the generic placement of Velutarina spp. Sclerotiniaceae Whetzel, Mycologia 37(6): 652 (1945). Type genus: Sclerotinia Fuckel The phylogenies presented herein corroborate the results by Holst-Jensen et al. (1997, 2004) by assigning E. fascicularis to the Sclerotiniaceae. This species and E. pruinosa are transferred to a new genus Sclerencoelia. Both species, as well as a newly described species, share typical sclerotiniaceous features such as a subtruncate ascus apex resembling the Sclerotinia-type, globose cells of the ectal Fungal Diversity (2017) 82:183–219 excipulum, and ascospores that form microconidia. However, the formation of subsessile coriaceous, persistent apothecia with rich external crystals on woody substrata is untypical in this family. In addition, the characters of stromatal tissues, described below, are unique to Sclerencoelia. Baral & Richter (1997: Figs 12, 17) discussed the uncertain relationship of E. fascicularis to Encoelia subgenus Kirschsteinia based on the deviating t. globulosa in this species aggregate, as exemplified by a collection on Fraxinus (H.B. 3005). Sclerencoelia Pärtel & Baral gen. nov. MycoBank MB 815439. Diagnosis: Apothecia growing out from substratal sclerotia or crust-like stromatic tissue within bark, erumpent through bast (secondary phloem) and periderm; gregarious or in small clusters, cupulate, when dry compressed or retracted, subsessile, development cleistohymenial, opening rather lately, disc brownish to black, receptacle surface (blackish-)grey, white-pruinose from crystals. Ectal excipulum of t. globulosa, inner part of globose to broadly ellipsoid, ± hyaline cells, sharply delimited from medullary excipulum, outer part of brown, thick-walled globose cells, pigment olivaceous to black-brown in KOH. Medullary excipulum of hyaline t. intricata. Asci cylindric-clavate, 8-spored; apex rounded to truncate, inamyloid or faintly blue in iodine (IKI), reduced Sclerotinia-type. Ascospores cylindrical, slightly curved (allantoid), eguttulate, uninucleate, 0–1-septate when overmature, budding small subglobose conidia. Paraphyses apically uninflated to slightly clavate or fusoid, septate, upper part covered by rough brown exudate. Crystals always present, hexagonal, abundantly covering the exterior of the ectal excipulum. Anamorphs Myrioconium-like (sporodochial, or formed on germinating ascospores). Ecology: parasitic or saprobic on xeric bark and wood of deciduous trees. Type species: Sclerencoelia fascicularis (Alb. & Schwein.: Fr.) Pärtel & Baral. Etymology: Sclerencoelia refers to the presence of substratal sclerotia and the relatedness to members of the family Sclerotiniaceae, and the encoelioid appearance of apothecia. Comments: The three species recognized in the genus are morphologically almost indistinguishable with all having long-lived, desiccation-tolerant apothecia. In both the multigene (Fig. 1) and the ITS analysis (Fig. 2), the monophyly of Sclerencoelia was strongly supported, yet its relationship with other genera remained unresolved. While S. fraxinicola seems restricted to Fraxinus, S. fascicularis and S. pruinosa most commonly occur on Populus spp. Which species of Sclerencoelia occur in North America remains uncertain. Sclerencoelia fascicularis (Alb. & Schwein.) Pärtel & Baral comb. nov. MycoBank MB 815440 (Fig. 5). 197 Basionym: Peziza fascicularis Alb. & Schwein., Conspectus Fungorum in Lusatiae superioris (Leipzig): 315, tab. XII Fig. 2 (von Albertini and von Schweinitz 1805). ≡ Phibalis fascicularis (Alb. & Schwein.) Wallr., Flora Cryptogamica Germaniae 2: 445 (1833). ≡ Encoelia fascicularis (Alb. & Schwein.) P. Karst., Bidrag till Kännedom av. Finlands Natur och Folk 19: 217 (Karsten 1871). ≡ Cenangium fasciculare (Alb. & Schwein.) Quél., Mémoires de la Société d’Émulation de Montbéliard 5: 415 (1873). = Peziza populnea Pers., Syn. meth. Fung. (Göttingen) 2: 671 (Persoon 1801). ≡ Encoelia populnea (Pers.) J. Schröt., Krypt.-Fl. Schlesien (Breslau) 3.2(7): 140 (1893). ≡ Cenangium populneum (Pers.) Rehm, in Winter, Rabenh. Krypt.-Fl., Edn 2 (Leipzig) 1.3(lief. 31): 220 (1889) [1896]. = Dermea (BDermatea^) fascicularis forma carpini Rehm in Voss, Verh. Zool.-Bot. Ges. Österreich 37: 223 (1887). ≡ Cenangium carpini Rehm, Discom. Rabenhorst’s Kryptogamen–Flora, Pilze – Ascomyceten 1(3): 221 (1889). ≡ Encoelia carpini (Rehm) Boud., Histoire et Classification des Discomycètes d’Europe: 161 (1907). Holotype absent. Neotype TU 104531 designated here, INSD accession number MBT204575. Sclerotia developing within or beneath the bark, usually flattened button-shaped. Apothecia erumpent, 1–6 in a cluster, sometimes in rows along bark splits, sessile to substipitate, cupulate, 2–10(−14) mm in diam. (mainly 3–6 mm), 400– 700 μm thick at lower flanks, 200 μm near margin; disc dark fawn- to umber-brown, olivaceous-grey or brownish black, margin finely rough or crenulate, not rarely incised, dark reddish-brown, ± densely covered by white to pale cream pruina, outside greyish- to brownish black, scattered whitishpruinose; black when dry. Ectal excipulum 50–70 μm thick at base, 20–30(−40) μm at lower flanks and towards margin, inner part of vertically oriented t. globulosa-angularisprismatica, cortical cells broadly ellipsoid to globose, *thinwalled, † thick-walled, 6–10 μm in diam., with grey-brown (in KOH olivaceous) exudate especially towards the cortex; marginal cells cylindrical, forming free protruding elements, covered by rough, olive-brown exudate, septate, 3.5–6.5 μm wide, apically rounded, uninflated or slightly clavate. Medullary excipulum 400–600 μm thick in centre, 80– 100 μm at lower flanks, of dense or loose t. intricata, nongelatinized, hyaline or with brownish hue (in KOH olivaceous), hyphae 2–5 μm wide, slightly rough, light olive towards ectal and medullary excipulum. Subhymenium light brown (in KOH olive) of small-celled, dense t. intricata. Asci cylindric-clavate, apex truncate-rounded with †1– 2.5 μm thick apical wall (mature 1–1.5 μm), inamyloid {3} or faintly blue {9} in upper part of wall in MLZ or IKI (especially when KOH-pretreated), *100–130(−140) × (8.5–)10– 198 Fig. 5 Sclerencoelia fascicularis. a–b Hydrated apothecial clusters. c Lower face of bark under apothecia showing sclerotial structures. d–f Dry apothecial clusters with external crystals (d with sclerotia, e with blackened substrate, f seen from below). g Cross-section of apothecium in KOH. h Cross-section of ectal excipulum in KOH. i–j Cross-section of ectal excipulum (j in KOH). k Marginal cells in KOH (squash mount). l Medullary excipulum (squash mount). m Crystals on outside of Fungal Diversity (2017) 82:183–219 apothecium. n Asci*. o Ascus apices† from juvenile to dehisced, in IKI. p croziers in CR. q Ascospores (q1 in KOH, q2*). r–s Paraphyses in KOH. Scale bars: a–b = 5 mm, c–f = 1 mm, g = 50 μm, h–n, q– s = 10 μm, o–p = 5 μm. Sources: a, j, k, r H.B. 2542; b, f–g, n, o, q TU 104531 (neotype); c TAAM1 98,296; d TAAM 122302; e TAAM 77702; m1 I.W. 110,402, m2 TU 104508. Photos a by A. Bollmann; b by V. Liiv; i, l, m1, p, s by I. Wagner Fungal Diversity (2017) 82:183–219 12(−12.5) μm {5}, †(80–)88–100 × (6–)6.7–8.3 μm {6}, pars sporifera *30–40 μm, arising from croziers {7}. Ascospores cylindric-allantoid, slightly to moderately curved, *(12–)13– 15.5(−17) × (3.2–)3.5–4.2(−4.7) μm {5}, †10.6–15.3 × 3– 3.8(−4.2) μm {7}, aseptate, but sometimes one-septate during germination, sometimes forming globose microconidia directly or on short germ tubes at one or both ends, *2.2–3 × 2– 2.5 μm diam., with 1–2 oil drops. Paraphyses apically uninflated to slightly clavate, fusoid, or moniliform, sometimes with apical outgrowths, */†3–5.5(−6.5) μm wide, the upper part hyaline or pale to bright brown, surrounded by brown exudate, slightly roughened to densely covered with light to dark brown granules. Crystals 4–12 μm in diam., abundant, especially on outer surface of the receptacle, some also on hymenium, in some specimens forming abundant 12–32 μm large subglobose druses in ectal excipulum. Habitat: on dead bark and wood of 1–50 cm thick, corticated, detached branches and fallen logs of Populus tremula, P. tremuloides, P. grandidentata, P. balsamifera, rarely P. × canadensis, lying on the ground more or less covered by litter, sometimes up to 0.5 m above ground. Phenology: Oct–Jun. Distribution: common in temperate and hemiboreal Europe and North America (Seaver 1951; Groves and Elliott 1971, Torkelsen and Eckblad 1977, Breitenbach and Kränzlin 1984, Hansen and Knudsen 2000). Comments: Typically, apothecia of this species form clusters, unlike in other species of the genus. Often rhizomorphlike structures, referable to sclerotia, are observed in the substrate in or under the bark. The ascospores and asci remain viable in dried specimens for nearly three months. Most commonly the apothecia form when the host is blooming, a phenomenon also characteristic of some other taxa in the Sclerotiniaceae, members of which are mainly parasites of various plants (Kirk et al. 2008). The amount of crystals varied among the studied samples, and only in H.B. 3424 were they seen to form abundant large druses in the ectal excipulum. The ascus amyloidity is better visible after KOH-pretreatment but even in that case the reaction of the apical ring is faint, infrequently seen only in some of the asci. Encoelia carpini (Rehm) Boud. closely resembles Sclerencoelia fascicularis in erumpent apothecia growing in dense roundish fascicles of up to 12 fruitbodies. Because we detected no morphological differences between the type material in S and specimens of S. fascicularis on Populus, we consider E. carpini a synonym of S. fascicularis. The taxon was described from dead, dry, corticated twigs and branches of Carpinus betulus (von Voss 1887, Rehm 1889). The holotype contains only bark, which did not permit us to confirm the host identity. The ITS sequence from a collection from Telemark (Norway), reported on Corylus avellana under the name E. fascicularis (Holst-Jensen et al. 1997), is almost identical to ITS sequences obtained from apothecia growing on Populus. 199 Persoon (1801), and von Albertini and von Schweinitz (1805) described the same fungus under different names using collections of Populus tremula (unlocalized, and Niesky, Eastern Saxony, Germany, respectively). Saccardo (1889: 565) accepted Cenangium populneum (Pers.) Rehm as the valid name by placing Peziza fascicularis Alb. et Schwein. in synonymy. However, Fries (1822: 75) reversed this scheme by placing Peziza populnea Pers. in synonymy of Peziza fascicularis Alb. et Schwein. Herewith, Fries sanctioned the name P. fascicularis over the older populnea (Art. 13 ICN). Persoon reported caespitose (= fasciculate), cupulate, grey apothecia while Albertini & Schweinitz described these to grow by 6–12 fruitbodies, almost tightly caespitose, internally dirty olivaceous, black outside. The latter authors distinguished a BVar. ß^ on Salix and Fraxinus, with entirely black apothecia growing subsolitary or in small fascicles, which appears to refer at least in part to Sclerencoelia fraxinicola. Herbarium material of Albertini has generally not been preserved. Therefore, in order to stabilize nomenclature in this group, we designate the neotype of Sclerencoelia fascicularis. Apothecia-derived ITS sequences from three collections formed a group together with a sequence from an endophyte from needles of P. sylvestris (Fig. 2). Type specimens examined: ESTONIA, Saaremaa, Lümanda Comm.,Viidumäe Nature Reserve, 58.2687°N 22.1298°E, alt. 50 m, Populus tremula, on bark of a fallen trunk; 19 Apr 2015, V. Liiv (TU 104531), neotype, KL401. Specimens examined: ESTONIA, Jõgevamaa, Puurmani Comm., Pikknurme, Laanesaare, P. tremula, on bark of felled trunks, 17 Apr 1969, K. Kalamees (TAAM 77702); LääneVirumaa, Laekvere Comm., Luusika, Hanguse, 58.9833°N 26.6167°E, alt. 90 m, P. tremula, on bark of a branch, 14 May 1970, K. Kalamees (TAAM 78467); Tartumaa, Meeksi Comm., Järvselja Nature Reserve, forestry sq. 226, 58.2813°N, 27.3261 °E, alt. 50 m, P. tremula, on bark, 24 May 1970, K. Kalamees (TAAM 198296); Tartu Comm., 2 km N of Väägvere, 58.483°N 26.839°E, alt. 48 m, in wet Populus mixed forest, P. tremula, on corticated branches, 15 Apr 1982, K. Kalamees (TAAM 122302); Tartu Comm., Muri, near parking place of Lake Vasula, 58.4302°N 26.7232°E, alt. 54 m, in mixed forest with Betula and Populus, on bark of P. tremula, on a fallen trunk in snow, 9 Apr 1966, K. Kalamees (TAAM 76013); Tähtvere Comm., Vorbuse, 58.435°N 26.652°E, alt. 44 m, swampy mixed birch forest, P. tremula, on fallen log, 12 Apr 1959, A. Raitviir (TAAM 200564, KL144). GERMANY, Saarland, Lebach, Steinbach, Seiterswald, 49.46°N 6.95°E, alt. 370 m, P. tremula, on a dead standing branch, 23 May 2010, D. Gerstner (TU 104508, KL347); Thüringen, 3 km NW of Sonneberg, 1.8 km N of Bettelhecken, Wehd, 50.382°N 11.1445°E, alt. 480 m, branch of P. tremula, on bark, 10 Mar 2012, I. Wagner (ø); 2.8 km SW of Sonneberg, 1 km N 200 of Ebersdorf, Oberlinder Müß, 50.338°N 11.151°E, alt. 353 m, branch of P. tremula, on bark, 2 Apr 2011, I. Wagner (I.W. 110,402); Baden-Württemberg, 7.5 km NW of Stuttgart, 1.3 km W of Weilimdorf, Fasanenwald, 48.812° N 9.095°E, alt. 340 m, branch of P. x canadensis, on bark, 10 Dec 1977, H.O. Baral (H.B. 2221); ibid., 16 Dec 1977, O. Baral & H.O. Baral (H.B. 2232); ibid., 25 Oct 1992, H.O. Baral & E. Weber (H.B. 4798). LUXEMBOURG, Gutland, 6 km SW of Ettelbruck, 1 km SE of Michelbouch, Biischtert, Haerenhecken, 49.814°N 6.033°E, alt. 360 m, branch of P. tremula, on wood, 30 Apr 1988, G. Marson (G.M., 3696, H.B. 3424). FRANCE, Champagne-Ardenne, Dépt. Marne, Brie, 14 km W of Sézanne, 2.3 km WSW of Esternay, Bois de Nogentel, 48.722°N 3.531°E, alt. 185 m, branch & trunk of P. tremula, on bark, 15 May 1993, H.O. Baral & G. Marson (G.M.). ITALY: Trentino–Alto Adige, Südtirol, 18 km SSW of Bozen, NNE of Montagne, 46.336°N 11.3085°E, alt. 600 m, branch of P. tremula, on bark, 13 Apr 1979, A. Bollmann (H.B. 2542). SLOVENIA, Ulrichsberg near Krainburg, ‘Carpinus betulus’ (perhaps Populus, only bark present), on bark, 6 Mar 1886, W. Voss, holotype of Dermatea fascicularis forma carpini Rehm (S-F73569). Sclerencoelia fraxinicola Baral & Pärtel sp. nov. MycoBank MB 815441 (Fig. 6). Etymology: The name refers to the host that this species is restricted to. Diagnosis: This species is characterized by its growing on Fraxinus, unlike the two other known Sclerencoelia species, which grow on Populus. It differs from S. fascicularis by its solitary to gregarious apothecia, which usually do not form roundish fascicles. Holotype TAAM 198511, isotype M-0,281,055/H.B. 9358. Sclerotia-like aggregations developing within or beneath the bark, discoid-shaped or with one side elongated, in association of flat, reticulate dark brown strands >10 mm long, 0.4–0.8 mm wide, 0.25–0.3 mm thick, composed of branched blackish brown-walled hyphae. Apothecia erumpent, scattered or densely aggregated in small groups of 2–3 apothecia, sessile to substipitate, hydrated cupulate, slightly tough, 2–8 mm in diam., 300–500 μm thick at lower flanks, 200 μm near margin; disc brownish grey to brownish black, margin finely rough to crenulate, outside blackish-grey, ± strongly white-pruinose, especially near margin; dry greyishblack. Ectal excipulum 25–50(−70) μm thick at flanks, inner part of vertically oriented t. globulosa-angularis-prismatica, cells *11–18(−21) × 7–10(−11.5) μm, slightly gelatinized, cortical cells broadly ellipsoid to globose, * thin-walled, † thick-walled, 6–10 μm in diam., with scattered grey-brown (in KOH olivaceous) exudate especially towards the cortex; marginal cells cylindric-clavate, forming free protruding elements, covered by brown exudate. Medullary excipulum 200–300 μm thick, less towards the margin, of rather dense Fungal Diversity (2017) 82:183–219 t. intricata, non-gelatinized, hyaline or with brownish hue, cells 60–85 × 2–8 μm, slightly rough, forming a 15–20 μm thick pale grey-brown (in KOH black-brown) layer towards the ectal excipulum. Subhymenium light olivaceous-brown, small-celled. Asci cylindric-clavate, apex medium truncate to rounded with †1–2(−3.5) μm thick apical wall (mature 0.5– 1.5 μm), inamyloid {2} or faintly blue {1} in upper part of wall in MLZ or IKI (without KOH-pretreatment), *(79–)85– 120(−142) × (9–)10–12(−13) μm {4}, †85–90 × 6.8–8 μm {1}, *equal with or finally 15–25 μm longer than paraphyses, † shorter than paraphyses, pars sporifera *31–40 μm, arising from croziers {4}. Ascospores cylindric-allantoid, slightly to strongly curved, *(11–)12–15(−18) × (2.9–)3.2–3.5(−4) μm {6}, †11–15(−16) × 2.8–3.4(−3.8) μm {1}, aseptate but when overmature 1(−3)-septate, rarely forming globose to ellipsoid conidia at one or both ends. Paraphyses apically uninflated to slightly clavate-capitate or moniliform, partly flexuous or with outgrowths, *2.5–5.3 μm wide, upper 10–20(−38) μm densely covered by light to dark olivaceous-brown granules, surrounded by brown exudate, sometimes apices tipped by fasciculate hyaline phialides forming subglobose conidia {2}. Crystals 4–10 μm in diam., abundant on exterior of excipulum, also some in inner parts and over hymenium, abundant in sclerotia. Habitat: on dead wood or bark of corticated, 4–8 mm thick, attached or fallen twigs, or 10–15 cm thick, recently felled trunks of Fraxinus excelsior, 0–2 m above ground. Phenology: nearly year round. Distribution: known only from temperate humid Central Europe. Comments: The present concept of S. fraxinicola is based mainly on the available molecular data (two strains from Germany). Tissue cells survive for at least 6 weeks in dry specimens. Seaver (1951) discussed the ash-inhabiting populations of E. fascicularis but concluded that these all represent one species, because the ascospore measurements are the same as in poplarinhabiting specimens. Gremmen (1952) described E. fascicularis in culture, isolated from apothecia growing on Fraxinus. The mycelia produced crystals on agar. Mature apothecia developed after pieces of a Fraxinus branch were added to the agar medium. Gremmen compared cultures derived from apothecia on Populus and found them to be similar. Based on rDNA ITS BLAST search in GenBank, a sequence originating from Fraxinus shoots with advanced necrosis symptoms (Bakys et al. 2009) was found to be identical to our apothecia-derived sequences of S. fraxinicola. In the ITS phylogeny (Fig. 2), all three sequences formed a strongly supported group, distinguished from S. fascicularis by 15 synapomorphies. Type specimens examined: GERMANY, BadenWürttemberg, 5 km NE of Tübingen, Pfrondorf, Blaihofstraße, 48.552°N 9.109°E, alt. 435 m, attached dead Fungal Diversity (2017) 82:183–219 201 Fig. 6 Sclerencoelia fraxinicola. a–d Apothecia (a, d rehydrated, b–c dry). e, g Cross-section of apothecium, e in KOH. f, h Ectal excipulum with crystals on outer part. i Outer ectal excipulum in KOH. j–k Medullary excipulum, k in KOH. l–m Asci*. n Ascus apex† in IKI. o Croziers in KOH. p Ascospores*. q–s Paraphyses in KOH. Scale bars: a– b = 1 mm; c–d = 5 mm; e = 100 μm; g = 50 μm; f, h–m, p–s = 10 μm; n– o = 5 μm. Sources: a–e, g, h, j–n, p, q TAAM 198511/H.B. 9358 holo/ isotype; f, i, o, r, s M-0,281,054/ H.B. 5714 twigs & branches of Fraxinus excelsior, on bark, 11 Jul 2010, H.O. Baral (TAAM 198511 holotype, M-0281055 isotype, INSD accession number KT876983); ibid., 24 Aug 2010, H.O. Baral (H.B. 9421, topotype). 202 Specimens examined: GERMANY, Sachsen-Anhalt, 9.5 km SW of Merseburg, 2 km E of Braunsbedra, Kleinkayna, forest in old lignite mine, 51.283°N, 11.916°E, alt. 150 m, F. excelsior, on branch lying on pile, 10 Feb. 1997, U. Richter (M-0,281,054/ H.B. 5714, KL156). BadenWürttemberg, 7.5 km W of Karlsruhe, 2.5 km W of Daxlanden, Großgrund, 49.005°N 8.30°E, alt. 115 m, branch of F. excelsior, on bark, 1 Jan. 1994, S. Philippi (H.B. 5020); 6.5 km SE of Nürtingen, 2.5 km WNW of Owen, Moosbacher Wald, 48.592°N 9.418°E, alt. 380 m, trunk of F. excelsior, on bark, 24 Sep. 1992, U. Richter, H.O. Baral & E. Weber (H.B. 4756); Bayern, Schwaben, W of Leipheim, E of Weißlingen, 48.445°N 10.19°E, alt. 450 m, branch & trunk of F. excelsior, 19 Apr 1980, M. Enderle (H.B. 2841); Oberbayern, 8.5 km SE of München, 1 km ESE of Neuperlach, Kieswerk, Putzbrunner Str., 48.09°N 11.665°E, alt. 550 m, branch of F. excelsior, on bark, 4 May 2015, B. Fellmann (d.v.). SWITZERLAND, Thurgau, 3.5 km NNE of Frauenfeld, Ochsenfurt, 47.585°N 8.92°E, alt. 400 m, branch of F. excelsior, on bark, 14 Mar 1986, P. Blank (H.B. 3005). Sclerencoelia pruinosa (Ellis & Everh.) Pärtel & Baral comb. nov. MycoBank MB 815442 (Fig. 7). Basionym: Dermatea pruinosa Ellis & Everh., J. Mycol. 4(10): 100 (1888). ≡ Cenangium pruinosum (Ellis & Everh.) Seaver, North American Cup-fungi, (Inoperculates) (New York): 300 (1951). ≡ Phibalis pruinosa (Ellis & Everh.) L.M. Kohn & Korf, Mem. N. Y. Bot. Gdn. 28(1): 111 (1976). ≡Encoelia pruinosa (Ellis & Everh.) Tork. & Eckblad, Norw. J. Bot. 24(2): 139 (1977). = Cenangium populneum var. singulare Rehm, Bih. K. Svenska Vetensk Akad. Handl., Afd. 3 21(5): 19 (1895). ≡ Cenangium singulare (Rehm) R.W. Davidson & Cash, Phytopathology 46: 36 (1956). Type specimen in NY (not examined). Stromatic tissue on the upper part of the bark of the host, ± continuous black crust ~0.5 mm thick, connected with anastomosing rhizomorph-like elements, ca. 0.2 mm thick, with irregular width, composed of dark brown melanised outer layer and light bark fibres inside, and loosely interwined, branched, brown hyphae, 2–3 μm in diam.; the whole bark often becoming covered with dark brown powdery mass (decayed wood elements) which spreads by touching. Apothecia erumpent, densely gregarious but not forming clusters, substipitate or sessile, deeply cupulate, becoming more shallow when mature, 2–4 mm in diam., *disc greyish yellow to greyish brown, black when dry; margin crenulate of stiff hairs, receptacle dark brown with white to creamcoloured pruina like being covered by salt-crust. Ectal excipulum ca. 100 μm thick near base, 40–60 μm at flanks, outer part of brown t. globulosa, *thin-walled, cells 4–10 μm Fungal Diversity (2017) 82:183–219 in diam., walls surrouned by dark brown exudate; inner part vertically oriented hyaline to light brown t. globulosaangularis-prismatica, slightly gelatinized, cells †6–18 × 3– 5.5 μm; margin with bristle-like hairs, sometimes grouped/ agglutinated, 35–100 × 2.5–5 μm, 2–3 septate, apically slightly gradually narrowed, walls subhyaline to light brown. Medullary excipulum ca. 200 μm thick, hyaline or with light brown hue, of t. intricata with ± rough walls, cells 2.5–4 μm in diam. Subhymenium of light brown dense t. intricata. Asci cylindric-clavate, apex truncate-rounded, IKI–, MLZ– or some very faintly blue (with KOH-pretreatment), with annulus colored only in upper part, *(80–)84–94(−101) × (6–)6.5– 8(−8.5) μm {1}, †53–80 × 5–7 μm {5} (55 μm in protologue), pars sporifera 39–45 μm, arising from croziers. Ascospores cylindric-allantoid, slightly curved, hyaline, aseptate or when overmature 1-septate, *(11.5–)12– 13 × (2–)3 μm {1}, †9–13 × 2–3.5 μm {5}, *often with several <1 μm diam. guttules on polar sides; sometimes forming globose microconidia 2.5–3.5 μm in diam. Paraphyses cylindrical, sparsely branched, sometimes slightly curved, apical part brown, gradually enlarged, 2–5 μm wide, covered by light brown exudate. Crystals on exterior of apothecium very abundant, occasionally in medullary excipulum and hymenial elements, 3–12 μm in diam. Habitat: on bark of living or dead trunks of Populus tremuloides, P. grandidentata and P. balsamifera,? P. tremula. Phenology: more frequent in spring and summer, nearly year around. Distribution: temperate and boreal Northern America and? Northern Europe. Comments: Sclerencoelia pruinosa is distinguished from other members of the genus by more extensive black stromatic tissue under the gregarious unclustered apothecia. In addition, the asci and ascospores are distinctly smaller, the medullary excipulum thinner, and the hair-like elements at the margin longer than in the other species. Juzwik and Hinds (1984) described slimy sporodochial Myrioconium-like anamorphs on agar in S. pruinosa producing similar microconidia like those formed from the ascospores of S. fascicularis and S. fraxinicola. In three specimens we examined phialidic conidiogenous cells arising from apothecial receptacle, which produced microconidia similar to those formed from ascospores. The asci in this material were disintegrated and the conidia probably developed from germinated ascospores. Obviously the fruitbodies became mature in spring, followed by development of the conidial stage during summer when the specimens were collected. This species is associated with the sooty bark canker of aspens (Davidson and Cash 1955, Juzwik and Hinds 1984, Anonymous 2011) and is observed forming fruitbodies 1– 2 years after the bark has died. Infection starts from wounds, either superficial or reaching the xylem, followed by growth through the inner bark and cambium. Usually no callus is Fungal Diversity (2017) 82:183–219 203 Fig. 7 Sclerencoelia pruinosa. a–b Fruitbodies on stromatic tissue (a dry, b*). c Outside of rhizomorph-like element. d Cross-section of apothecium. e–f Crystals on outside of apothecium. g Cells of outer part of ectal excipulum in KOH. h, j Ectal and medullary excipulum with crystals on the outside, h *, j in KOH. i Marginal hairs in KOH. k1 Ascus*. k2 Ascus† in MLZ. l Ascospores, l1 in KOH some with microconidia and septum (arrow), l2*. m Paraphyses and young asci. n Conidiophores formed in hymenium, in KOH. Scale bars: a–b = 1 mm, c = 50 μm, d = 100 μm, e–n = 10 μm. Sources: a, l1 NY 02533481; b, h, i, k1, l2, m DAOM 675081; d–f, k2 NY 02533482; g, j; NY 02533480; c, n BPI 875779. Photos b, h, i, k1, l2, m by J.B. Tanney formed. When the bark has fallen off following the death of the host tree, the dark stroma forms a characteristic Bleopard spotting^ symptom. Sclerencoelia pruinosa has been listed as growing on Salix and Fraxinus spp. (Anonymous 2011). The 204 species was collected in the first half of the nineteenth century in Norway (Torkelsen and Eckblad 1977) and in the 1890s in Sweden (Starbäck 1895). Our examination of these historical specimens confirmed their identification. However, this pathogen has not succeeded in establishing populations in European native poplars, its distribution being limited to North America. In the ITS phylogeny sequences from three specimens of S. pruinosa formed a strongly supported sister group of S. fascicularis and S. fraxinicola (Fig. 2). Type specimen examined: SWEDEN, Örebro Co., Lerbäck, Klockarhyttan, on bark of trunk of Populus tremula, Aug 1891, leg. R. Sernander, det. H. Rehm (holotype of Cenangium populneum var. singulare Rehm). Other specimens examined: NORWAY, Nordland, Saltdal, Populus sp., on bark, Nov 1822, leg. S. Ch. Sommerfelt, det. A.-E. Torkelsen (O F174425); Oslo, Linderud, 59.9409°N, 10.8354°E , P. tremula, on bark, 1840, leg. N. G. Moe, det. A.-E. Torkelsen (O F174667). CANADA, Quebec, Gatineau, Ay l m e r, F o r ź t B o u c h e r, P o p u l u s s p . ( p r o b a b l y P. grandidentata or P. tremuloides), on decaying fallen log, 11 Dec 2015, J. B. Tanney (DAOM 675081). USA, New York, Ithaca, Lower Creek road near Etna, 42.47722°N, 76.40667°W, alt. 300 m, P. deltoides, on bark of a standing trunk, 7 May 1975, leg. L.M. Kohn, R.P. Korf, T. Stasz, det. L.M. Kohn, R.P. Korf (BPI 875779); ibid. R.P. Korf & Gruff, Discomyc. Exsiccati 75 (NY 02533479, KL346); Utah, Tooele Co., Stansbury Mountains, South Willow Creek, NE of Deseret Peak, Wasatch National Forest, 40.4827 N, 112.605°W, alt. 2295 m, P. tremuloides, on bark of a dead trunk, 20 Jul 1981, C. T. Rogerson (NY 02533480); Rich Co., Cache national forest, Old Canyon, west of Randolph, near Leo reservoir, alt. 1700 m, P. tremuloides, on bark of a dead trunk, 2 Sep. 1971, C. T. Rogerson (NY 02533481, KL343); Weber Co., North Fork County Park, along Cobble Creek, Wasatch mountains, 41.371°N 111.907°W, alt. ~1700 m, P. tremuloides, on dead bark, 12 Jul 1984, C. T. Rogerson (NY 02533482, KL344). Rutstroemiaceae Holst-Jensen, L.M. Kohn & T. Schumach., Mycologia 89(6): 895 (Holst-Jensen et al. 1997). In our multigene (Fig. 1) and ITS phylogeny of an extended dataset (Fig. S4), members of the Rutstroemiaceae formed a monophyletic group. This stands in contrast to the analysis of ITS sequences including also species of the Sclerotiniaceae, Piceomphale bulgarioides and BCenangium^ acuum (Fig. 2) as well as to recent rDNA-based analyses, which suggest the family to be paraphyletic (Johnston et al. 2014a; Galán et al. 2015). However, all our analyses revealed that E. tiliacea and Dencoeliopsis johnstonii, formerly placed in Helotiaceae, belong to the genus Rutstroemia in Rutstroemiaceae. This result is in concordance with the morphology of both species, which Fungal Diversity (2017) 82:183–219 share several characters typical of this family. These include a sclerotiniaceous ascus apical ring, a black substratal stroma, brown, externally radially fibrous fruitbodies, brownish warted excipular hyphae, elongate, brownish low-refractive vacuolar bodies in paraphyses, and overmature septate ascospores budding conidia. The combination Rutstroemia johnstonii (Berk.) K. & L. Holm, proposed by Holm and Holm (1977), is therefore accepted for this supposedly fungicolous species growing on stromata of Diatrypaceae. Based on the examination of the holotype (K(M) 190051) of Encoelia toomansis (Berk. & Broome) Dennis (= Banksiamyces toomansis (Berk. & Broome) G.W. Beaton), growing on Banksia sp. cones in Australia, this species most probably also belongs to the Rutstroemiaceae. Rutstroemia P. Karst. Type species: Rutstroemia firma (Pers.) P. Karst. Rutstroemia tiliacea (Fr.) K. & L. Holm, Symbolae Botanicae Upsalienses 21(3): 7 (Holm and Holm 1977) (Fig. 8) ≡ Peziza tiliacea Fr., Systema Mycologicum (Lundae) 2(1): 76 (1822). ≡ Encoelia tiliacea (Fr.) P. Karst., Bidrag till Kännedom av. Finlands Natur och Folk 19: 218 (Karsten 1871). ≡ Cenangium tiliaceum (Fr.) P. Karst., Rev. Monag. Ascom.: 145 (1885) ≡ Phibalis tiliacea (Fr.) Korf & L.M. Kohn, Memoirs of the New York Botanical Garden 28: 116 (Korf and Kohn 1976). Apothecia with a short stout stipe, erumpent from small black round holes in host’s periderm, singly or in small fascicles, cupulate, leathery, outside radially fibrillose, ochraceousbrown. Disc 4–8(−10) mm in diam., ochraceous- to dark chestnut-brown, margin slightly protruding and crenulate. Stipe basally black, forming black demarcation lines inside the wood. Ectal excipulum of t. prismatica-porrecta, oriented horizontally, main layer of hyaline to brownish cells *7– 14 μm wide, external hyphae roughened by pale yellowish to red-brown exudate, 4.5–6.5 μm in diam., loosely attached, causing the fibrous exterior. Medullary excipulum of t. intricata, hyaline or with light brown hue, hyphae *3– 10 μm wide, slightly rough. Asci cylindric-clavate, *117– 165 × (9–)10–11.5 μm {4}, †95–130 × 8–10(−11) μm {2}, spores obliquely biseriate in living asci, pars sporifera *31– 38 μm; apex truncate-rounded, IKI and MLZ faintly to strongly blue (somewhat T-shaped), Sclerotinia-type (reduced, without protruding lower ring); arising from croziers (partly with small perforation) {6}. Ascospores cylindric-suballantoid, non-septate inside living asci, *(9–)13–18(−20) × (3–)3.2– 3.8(−4.2) μm {5}, †11–15 × 2.5–3.5 μm, with quite a few very small guttules (LBs) scattered in each half or only towards the ends; overmature 1(−3)-septate, producing one or a few consecutive microconidia at both ends, subglobose or broadly ellipsoid, *2.5–3.3 × 1.9–2.6 μm, with a ± large Fungal Diversity (2017) 82:183–219 205 Fig. 8 Rutstroemia tiliacea. a–c Apothecia (hydrated), c in cross-section (showing pseudosclerotium in wood). d–e Cross-section of apothecium. f-h Ectal excipulum, f cortical hyphae. i Medullary excipulum. j Ascus*. k–l Ascus apices† in IKI. m Crozier. n–o Asci† in IKI. p Ascospores*, p1 overmature 1-septate, budding conidia, p2 mature, lower left overmature, with 3-septa († in IKI). q Ascus and paraphyses* containing brown vacuoles. Scale bars: a = 5 mm, b–c = 1 mm, d = 100 μm, e = 50 μm, f–j, m– q = 10 μm, k–l = 5 μm. Sources: a, f–h, k, l, m, p1 E.R.D.4388; b, c, j, k, p2, q H.B. 9065; d, e, n TAAM132844; i TAAM165849; o S31483. Photos a, f-h, k, l, m, p1 by E. Rubio Domínguez eccentrical LB. Paraphyses cylindrical or slightly moniliform, smooth, gradually broadening towards the apex, terminal cell *33–60 × 2–5.5 μm, with non- to low-refractive ochraceous to red-brown vacuoles (deep chestnut-brown in dead state). Habitat: on 3.5–15 mm thick, attached (0.2–1.5 m above ground) or fallen, corticated twigs and branches of Tilia {5}, Salix {1}, Pinus {1}, Ulmus {1}. Phenology: all the year round. Distribution: uncommon in Europe (Spain, Austria, Germany, Denmark, United Kingdom, Sweden, Estonia, Finland) (Dennis 1956; Hansen and Knudsen 2000). Comments: All parts of the fruitbodies survive complete desiccation, which is unusual in the genus Rutstroemia. The collection on Ulmus sp. resembles Encoelia siparia Baral and Richter (1997), yet deviates from this species by a distinct amyloid ring at the ascal apex that extends to the lower part of the apical thickening. In our multigene (Fig. 1) and the ITS phylogenies (Fig. 2, S4) R. tiliacea was closely related to the type species of the family, R. firma, as well as to R. johnstonii and R. juniperi. ITS data further revealed close affinities of these four species with R. echinophila, R. bolaris, R. sydowiana, R. pseudosydowiana and R. fruticeti. 206 Specimens examined: AUSTRIA, N of Wien, Marfeldkanalweg, 48.30°N 16.35°E, alt 165 m, branch of Ulmus minor, on wood, 17 Nov 2002, W. Jaklitsch (W.J. 2023, H.B. 7279); ESTONIA, Tartumaa, Meeksi, Järvselja Forest Reserve, 58.2833°N 27.32°E, alt. 48 m, on a rotten twig of Tilia, 27 Sep. 2001, K. Pärtel (TAAM 165849, KL211); GERMANY, Sachsen-Anhalt, SW of Freyburg/ Unstrut, SW of Burgheßler, Metzenholz, 51.156°N 11.64°E, alt. 250 m, on bark of a branch of Tilia, 31 May 2009, W. Huth (H.B. 9065); ENE of Freyburg/Unstrut, Alte Göhle, 51.222°N 11.792°E, alt. 195 m, on bark of a branch of Tilia, 21 Jul 2000, M. Huth (H.B. 6734, TAAM 132844, KL160); BadenWürttemberg, NW of Schwäbisch Hall, N of Wackershofen, Am Grundbach, 49.138°N 9.703°E, alt. 330 m, branch of Salix, on bark, 17 Oct 1986, L.G. Krieglsteiner (H.B. 3097); NE of Reichenbach, E of Thomashardt, Lindenallee, 48.75°N 9.505°E, alt. 480 m, branch of Tilia, 1 Jan. 1961, H. Haas (STU H.H. 1030, H.B. 184); Bayern, Oberfranken, WSW of Bayreuth, W of Oberaufseß, Lindenallee, 49.89°N 11.215°E, alt. 450 m, branch of Tilia, on bark, 11 Jun 1990, H. Engel (H.E. 13,034, H.B. 4112). SPAIN, Asturias, E of Pola de Somiedo, S of Villarín, 43.097°N 6.199°W, alt. 900 m, on bark of twigs of Pinus sylvestris, 1 Mar 2008, E. Rubio (E.R.D. 4388). SWEDEN, Uppland, Bondkyrka, Gottsunda, substrate unknown, Sep. 1905, K. Starbäck (S-F31483, L. Romell 16533). Cordieritidaceae Sacc. [as ‘Cordieriteae’], Syll. fung. (Abellini) 8: 810 (1889). Type genus: Cordierites Mont. ≡ Patellariaceae subdivision Cordieriteae Sacc., Bot. Centralb. 18: 8: 253 (1884) (unranked). The family Cordieritidaceae was introduced by Saccardo (1884) as an unranked subdivision Cordieriteae of Patellariaceae Fr. (as Patellarieae), a subgroup of Discomyceteae Fr., with the diagnosis Bbranched-stipitate, corky or horny-carbonaceous^. This subdivision included the genus Cordierites Mont. and a current member of the Lecanoromycetes, Acroscyphus Lév. Later on, Saccardo (1889: 810) gave this taxon the family rank by using the suffix B-eae^ for families throughout the work (Art. 18.4 ICN), and provided an extended description (Fig. 8). The rank of a family was accepted by Lindau (1897); Saccardo & Traverso (1907: 26) and Kellerman (1907). The history of Cordieritidaceae was reviewed by Boedijn (1936) and later by Zhuang (1988b) who agreed with Korf (1973) and Dennis (1978) that Cordierites belongs to the subfamily Encoelioideae in the Helotiaceae. The synonymisation of Cordierititaceae with Helotiaceae was followed by Lumbsch and Huhndorf (2010) and Kirk et al. (2015). This study resurrects the family Cordieritidaceae to include both the type species of Cordierites, C. guianensis and Fungal Diversity (2017) 82:183–219 a number of related taxa, thereby forming a strongly supported clade in the multigene phylogeny (Fig. 1). Our extended family concept includes several previous members of Encoelioideae, while showing more variation in morphological diversity than the description by Saccardo (1889) (Fig. 9). However, our examination of 15 species revealed that most are characterised either by a positive ionomidotic reaction or by excipular pigments changing colour in aqueous KOH. The latter applies to lichenicolous species, except for Thamnogalla crombiei. The asci are inamyloid with a typically rounded apex, while the ectal excipulum is often rough or pustulate outside, sometimes with distinct hairs. Different combinations of these characters distinguish members of the Cordieritidaceae from the families Helotiaceae and Hyaloscyphaceae, to which several of the genera had been previously assigned. On the basis of the presented multigene phylogeny (Fig. 1), the following genera are accepted in the family: Ameghiniella Speg., Cordierites Mont., Diplocarpa Massee (= Ionomidotis E.J. Durand ex Thaxt.), Diplolaeviopsis Giralt & D. Hawksw., Llimoniella Hafellner & Nav.-Ros., Rhymbocarpus Zopf, Skyttea Sherwood, D. Hawksw. & Coppins, Thamnogalla D. Hawksw., Unguiculariopsis Rehm, and two undescribed genera (Pärtel et al., in prep.), which include Encoelia heteromera and E. fimbriata. Encoelia helvola, a species of unclear generic disposition, is included based on the phylogeny presented by Peterson and Pfister (2010), and Macroskyttea Etayo, Flakus, Suija & Kukwa based on Etayo et al. (2015). The generic circumscription of several genera accepted herein in the expanded Cordieritidaceae is unsettled and will be addressed in a further study. Although encoelioid taxa incorporated in the family are mostly known as lignicolous, accumulating evidence suggests that various members of Cordieritidaceae grow in association with other fungi, including lichens. Cordierites guianensis has been recorded growing with Xylariaceae, Ionomiodotis olivascens with Hypoxylon spp., and I. fulvotingens and I. frondosa with unspecified fungi (Zhuang 1988a, 1988b). Many genera accepted in this family include obligatory lichenicolous species: Diplolaeviopsis, Llimoniella, Macroskyttea, Rhymbocarpus, Skyttea, Thamnogalla and Unguiculariopsis (pro parte) (Suija et al. 2015; Etayo et al. 2015). Fig. 9 Description of Cordieriteae by Saccardo, P. A. 1889. Sylloge Fungorum. Vol. 8, p. 810 Fungal Diversity (2017) 82:183–219 Ameghiniella Speg. 1887. Type species: Ameghiniella australis Speg. Species of Ameghiniella have black, shortly stipitate, irregularly lobate, wrinkled, relatively large (~2 cm) apothecia that often grow as rosettes. The ectal excipulum is composed of thick-walled, protruding round-celled or hyphoid elements, oriented perpendicular to the surface, and shows an orangebrown ionomidotic reaction. We consider Ionomidotis chilensis Durand as a synonym of Ameghiniella australis. This synonymy was established by Gamundi (1991), who noted the similarity of the excipulum of the two species. Ameghiniella australis is distributed in South America (Zhuang 1988b; Gamundi 1991; Gamundí and Romero 1998), and based on the multigene phylogeny (Fig. 1), is related to particular species currently assigned to Ionomidotis. Cordierites Mont. 1840. Type species: C. guianensis Mont. The restricted concept of Zhuang (1988b) includes three species that form discoid to ear- or funnel-shaped, nonionomidotic (C. guianensis) or ionomidotic apothecia arising from a common base or from branched stipes, externally covered by brown hyphal protrusions (see also Saccardo 1889: 810). In the multigene analysis, the tropical type species clustered with Thamnogalla on a long branch. Sequences of target protein-coding genes could not be obtained from C. guianensis since it is poorly represented in fungal collections. Diplocarpa Massee 1895. Type species: Diplocarpa curreyana Massee (= Diplocarpa bloxamii (Berk. ex W. Phillips) Seaver). The deep blood-red ionomidotic reaction we observed in D. curreyana is not mentioned by Nauta and Spooner (2000a), who accepted the genus in Dermateaceae. The species is probably fungicolous, as it has been repeatedly observed growing directly on rhizomorphs of Armillaria. A blackstipitate anamorph with brown arthroconidia emerges from the common base of the apothecia, noted also by Ribollet (2002) and illustrated in MycoKey (Læssøe and Petersen 2008). Diplocarpa curreyana appeared closely related to the morphologically similar type species of Ionomidotis. The genus Diplocarpa will be addressed in a separate paper (Baral et al. in prep.). BEncoelia^ fimbriata Spooner and Trigaux 1985. This is a rare lignicolous species known only from damp habitats in Europe (Spooner and Trigaux 1985, Marson 1987; Krieglsteiner and Luschka 2000). The stipitate, deeply cupulate apothecia of E. fimbriata arise from cushion-like fascicles through the host’s bark. The fruitbody surface is light olivaceous-ochraceous and pustulate, whereas the disc is cinnamon-clay-pink to red, with a white-beige margin, fimbriate from lanceolate hairs. The ionomidotic reaction is deep yellow. Apothecia are long-lived and desiccation-tolerant, becoming closed by the hairs during unsuitable conditions. It 207 grows on Salix in association with the white-rot causing basidiomycete Pseudochaete tabacina, or with other ascomycetes such as Ionomidotis fulvotingens or Hypocreopsis lichenoides as observed by Marson (1987). BEncoelia^ heteromera (Mont.) Nannf 1939. Tropical distribution and relatively large (~2 cm) apothecia distinguish this species among the studied taxa. The fruitbodies are stipitate, discoid, with one side elongated, leathery, outside pustulate and ochraceous yellow, disc chestnut- to umber-brown. The ionomidotic reaction is yellow(−orange) and the substrate hygric angiosperm wood and bark (Romero and Gamundi 1986, Zhuang and Korf 1989, Iturriaga 1994). Ionomidotis E.J. Durand ex Thaxt. Type species: Ionomidotis irregularis (Schwein.) E.J. Durand Ionomidotis was introduced by Durand (1923) based on a strong ionomidotic reaction (Bexuding a deep violet solution with KOH^), blackish violet-brown or olive apothecia, being often elongated on one side and partly arising from a common base, a parenchymatic ectal excipulum, and small hyaline ascospores. Our multigene phylogeny, including four species from this genus, reveals it to be polyphyletic within the Cordieritidaceae (Fig. 1). Taxonomic changes to delimit monophyletic genera that include species previously accepted in Ionomidotis will be presented in a study that will include additional material (Baral et al. in prep.). Chlorociboriaceae Baral & P.R. Johnst., Index Fungorum 225: 1 (Baral 2015) Type genus: Chlorociboria Seaver Type species: Chlorociboria aeruginosa (Oeder) Seaver ex C.S. Ramamurthi, Korf & L.R. Batra. Chlorociboria glauca (Dennis) Baral & Pärtel comb. nov. MycoBank MB 815443 (Fig. 10) Basionym: Encoelia glauca Dennis, Kew Bulletin 30(2): 350 (Dennis 1975), holotype K! Apothecia cupulate to saucer-shaped, (0.7–)1–2.5(−5.5) mm in diam., receptacle comparatively thin (150–300 μm); scattered or usually gregarious, often 2–5 apothecia growing in clusters, ± deformed by mutual proximity, singly or arising from a ± common base, erumpent from small holes in the periderm, opening in the prohymenial phase; flesh fragile, non-gelatinous; outside pale grey, sometimes with glaucous hue or dirty white, pruinose to pustulate; disc sometimes wrinkled similar to Disciotis venosa, whitish to pale yellowishgreyish(−glaucous) or beige, mustard-coloured when dry; with a 0.3–0.8 mm long and 0.5–1 mm wide stipe. Ectal excipulum 40–60 μm at lower flanks, 25–30 μm at upper flanks, of indistinctly vertical t. angularis-globulosa, cells *6–12 × 5–7 μm, ± thin-walled (†thick-walled), hyaline, with light yellowish-ochraceous cloddy intercellular exudate, 208 Fig. 10 Chlorociboria glauca. a-c Apothecia (a–b hydrated, a1 pustulate outer surface, c dry). d, e Marginal hairs. f Cross-section of apothecium. g Hairs at flanks. h Medullary excipulum. i Ectal excipulum with ochreyellow exudate. j, k Ascus apex† in IKI. l Crozier in KOH. m Hymenial elements* in CRB. n Paraphyses in KOH. o Ascospores*. p–q Pycnidia * Fungal Diversity (2017) 82:183–219 r Cross-section of conidioma. s Conidiophores. t–u Conidia. Scale bars: a–c = 1 mm; p–q = 200 μm; f = 50 μm; e = 20 μm, g–i, m–o, r–s = 10 μm, d, j–l, tu = 5 μm. Sources: a, d J.H.P.-12.344; b, f–i, k–m, o H.B. 9232; c, e, j, n holotype K (M) 41444; p–u H.B. 9236. Photos a, d by J.H. Petersen; k by J.P. Dechaume Fungal Diversity (2017) 82:183–219 towards medulla cells gradually turning paler light yellowbrown. Hairs hyaline, smooth, protruding, at the margin subcylindrical, flexuous, branching, up to 35–54 × 1.4– 2.2 μm, at the flanks up to 8–18 × 2–4(−5) μm, refractive and thick-walled, hyphoid, causing the pruinose appearance of fruitbodies. Medullary excipulum 40–60 μm thick, of dense or loose, to pale avellaneous t. intricata, hyphae *1.5– 3.5 μm wide, ± parallel to apothecial surface, thin-walled, with ± scattered, very pale yellowish granular exudate. Subhymenium indistinctly delimited, of a thin, hyaline, dense t. intricata. Asci cylindric-clavate, *38–55 × 4.7– 5.6 μm {2}, †31–42 × 3.8–5.3 μm {2}, spores (*) obliquely biseriate, pars sporifera *14–19 μm long, apex (*/†) subconical, apical ring pale blue in IKI and MLZ (without KOH-pretreatment), euamyloid, more distinctly blue in living asci, of ‘Calycina-type’, not liberating spores in water mount even when adding IKI, arising from croziers {4} (rarely with small perforation). Ascospores narrowly subcylindrical, straight to suballantoid, aseptate, with 2–3(−4) small guttules (LBs) near each end, hyaline, *5.5–7.5(−8.5) × 1.5–1.7 μm {2}, †(4–)5–7 × 1.3–1.5 μm {1}. Paraphyses cylindrical to slightly moniliform, straight or slightly flexuous, hyaline, sometimes branched in the middle, sometimes firm-walled in the lower part, terminal cell *22–38 × 2.2–2.7 μm, †1.7– 2.1 μm wide, not exceeding the living asci and only slightly the dead asci, lower cells *10–18 × 1.5–2(−2.5) μm; containing non-refractive hyaline vacuoles and a few small LBs; pale (olivaceous-)yellowish granular to cloddy resinous exudate present among and above the hymenial elements, staining bright turquoise-blue in CRB, completely dissolving in KOH (like the exudate in the excipulum) by extruding a very weak pale yellow pigment in the medium (indistinctly ionomidotic). Crystals are absent. Anamorph (observed only on natural substrate in H.B. 9236): forming remote, ± gregarious groups of pycnidia on the same branch with the teleomorph, deep greyish-greenish (glaucous), ± globose with a conical tip, densely aggregated to confluent, 0.15–0.3 mm diam., unilocular, peridial cells of t. prismatica-intricata with abundant yellowish-brownish exudate, on the margin forming straight, hyaline, apically tapered (0.9 μm), aseptate hairs 20–30 × 1.4–1.7 μm. Conidiophores arranged in a hymenium, multi-branched (verticillate), conidiogneous cells phialidic, hyaline, subcylindric, *15– 20 × 1.5–2 μm, without collarette. Conidia subcylindrical, straight to very slightly allantoid, hyaline, *3.7– 5(−5.3) × (1–)1.1–1.3(−1.4) μm, containing 1(−2) small LBs near each end. Habitat: on corticated, partly xeric (0–30 cm above ground) branches of deciduous trees and shrubs (Corylus avellana, Prunus spinosa, Salix sp., Rosa sp., canes of Rubus fruticosus). Phenology: Sep. – Dec. Distribution: rare in Europe (Spain, France, United Kingdom). 209 Comments. In characterising E. glauca, Dennis (1975) commented on its similarity with BChlorosplenium^ (= Chlorociboria) based on its greenish colour, but he placed it in Encoelia because of the allantoid spores, despite its friable apothecial texture. Asci and ascospores in the holotype as given by Dennis (1975, 40 × 4 μm and 5 × 1 μm, respectively) concur well with the measurements that we observed in other specimens of this species when compared in the dead state. In the holotype in K only juvenile asci and no free ascospores were observed. By the rather small and narrow, subcylindrical, suballantoid ascospores, C. glauca resembles C. aeruginascens (Nyl.) Kanouse and the recently described bryicolous C. lamellicola Huhtinen & Döbbeler (Huhtinen et al. 2010). In other characters C. glauca is more similar to some species described by Johnston and Park (2005) from New Zealand rather than to the few holarctic lignicolous species of Chlorociboria recently revised by Tudor et al. (2014). Specifically, the non-aerugineous, yellowish-glaucous-grey apothecia are reminiscent of some New Zealand taxa, such as C. albohymenia, C. clavula and C. poutoensis. Chlorociboria glauca possesses several unique characters in the genus. It differs from all other species, except C. lamellicola, by not producing a blue-green stain (xylindein) in the substrate. A pale yellow ionomidotic reaction, observed in C. glauca, has not been observed before in this genus. The long and narrow protruding cells on the surface of apothecia, called tomentum hyphae or hairs (Dixon 1975; Johnston and Park 2005, Huhtinen et al. 2010), characteristic of Chlorociboria species, are less prominent in C. glauca. The species grows on corticated branches of various woody substrates, including Rubus spp. In the sample from Ireland, the inhabited branch projected into the air. C. glauca can tolerate desiccation as a few mature asci and many ascospores were still viable ten days after drying under inside air humidity. By contrast, most other lignicolous Chlorociboria form apothecia on decorticated branches or trunks that lie on moist ground. In the multigene analysis Chlorociboria glauca formed a strongly supported clade with C. aeruginosa and C. aeruginascens (Fig. 1), whereas in analyses of the ITS region the relationship of C. glauca with these two and species from the Southern Hemisphere remained unresolved (Fig. S5). Chlorociboria aeruginella, a hairy blue-green fungus growing on stems of Filipendula, appeared to be genetically more distant than the other two species common in the Northern Hemisphere (Fig. 1). In the ITS phylogeny it formed a strongly supported group with C. halonata from New Zealand (Fig. S5). Considering the unusually high 11–17 % interspecific variation in the ITS regions, observed also by Johnston and Park (2005), and the lack of support to the genus both in multigene and ITS analyses, current Chlorociboria obviously includes distinct phylogenetic lineages. However, 210 resolving their phylogenetic relationships and generic delimitation in the group warrants expanding the current multigene analyses. Type specimen examined: UNITED KINGDOM, Scotland, Argyll and Bute, isle of Mull, Croggan, ~56.381°N 5.716°W, alt. ~20 m, Corylus avellana, on dead branch, 29 Sep. 1972, M.C. Clark (K(M) 41444 holotype). Additional specimens examined: UNITED KINGDOM, North-Ireland, 16.5 km WNW of Enniskillen, 3.8 km WSW of Derrygonnelly, Knockmore, 54.4017°N 7.867°W, alt. 253 m, on grassland, projecting branch of Prunus spinosa, on bark covered with moss, 24 Oct 2012, leg. A. Gminder, det. J. H. Petersen & A. Gminder (J.H.P.-12.344). FRANCE, Bourgogne, Saône-et-Loire, 8 km NE of Le Creusto, 2 km NNW of St.-Pierre-de-Varennes, Étang de Brandon, 46.8587° N 4.492°E, alt. 395 m, Salix sp., on corticated branch, 10 Dec 2009, J.P. Dechaume, det. H.O. Baral (H.B. 9232, TAAM 198458, KL238); ibid. with anamorph, on Rubus fruticosus dead canes (H.B. 9236, TAAM 198459, KL237). SPAIN, Asturias, Cangas de Onís, 2.5 km SE of Covadonga, alt. 535 m, 15 Mar 2008, branch of Rosa sp., on bark, J. Linde, vid. E. Rubio (E.R.D. 4401). Mollisiaceae s l clade Encoeliopsis rhododendri (Ces.) Nannf. represents the type species of the genus Encoeliopsis Nannf. It is a droughttolerant fungus, and its apothecia resemble those of Pyrenopeziza spp. (compare e.g. Nauta and Spooner 2000b). It is likely that the taxa selected for molecular analyses did not include the closest relatives of E. rhododendri. This taxon formed on a long branch the sister group of an unpublished Peltigeromyces and Marssonina brunnea (Ellis & Everh.) Magnus with likewise long branches (Fig. 1), altogether forming a sister group to a clade including members of Loramycetaceae, Mollisiaceae, and Vibrisseaceae. Marssonina Magnus is currently included in the Drepanopezizaceae while the relationship of the genus P e l t i g e ro m y c e s i s u n c e r t a i n ( B a r a l 2 0 1 6 ) . L i k e E. rhododendri, the apothecia of Peltigeromyces resemble Pyrenopeziza (Ploettnerulaceae) or Mollisia (Mollisiaceae), except for their large size and black stroma in the wood. Based on the present sequence and those available in INSD, Peltigeromyces is distinct from these genera and of unclear relationship. Chaetomellaceae Baral, P.R. Johnst. & Rossman, Index Fungorum 225: 1 (Baral 2015). Type genus: Chaetomella Fuckel. Xeropilidium Baral & Pärtel gen. nov. MycoBank MB815743. Fungal Diversity (2017) 82:183–219 Diagnosis: Apothecia erumpent through bark in small clusters, cupulate, subsessile, gelatinous, disc semitranslucent, shining, outside greyish-brownish, white-pruinose from crystals. Ectal excipulum of t. angularis vertically oriented, thickand brown-walled. Medullary excipulum hyaline, moderately gelatinized, upper part of vertically oriented t. porrecta, lower part of t. intricata. Asci clavate, 8-spored, long-stipitate, apex rounded-truncate, inamyloid. Ascospores cylindrical, guttulate, aseptate. Paraphyses filiform, equally septate, covered with granules. Crystals on the flanks and margin and inside the fruitbody. Synanamorphs sporodochial and pycnidial, conidia cylidric-ellipsoidal, hyaline. Ecology: parasitic or saprobic on deciduous bark. Type species: Xeropilidium dennisii Baral, Pärtel & G. Marson. Etymology: from Greek adjective ξερός (dry) referring to the occurrence on dry bark and the close relationship to the morphologically similar genus Pilidium. Xeropilidium dennisii Baral, Pärtel & G. Marson sp. nov. MycoBank MB815744 (Fig. 11). = Encoelia fuckelii Dennis, Kew Bull. 25(2): 348 (Dennis 1971), nom. illegit. ICN Art. 53.1 [non Encoelia fuckelii (Sacc.) Boud., Hist. Class. Discom. Eur. (Paris): 161 (Saccardo and Traverso 1907), (?) = Velutarina rufoolivacea, see Baral and Perić (2014)]. Holotype TU 104501, ex-type culture TFC 201986 Apothecia gregarious, in fascicles of 2–6, hydrated (0.5–)1–2(−2.7) mm in diam., cupulate to saucer-shaped or finally flat, distinctly gelatinous, resembling a Mollisia, receptacle 0.3–0.45 mm thick; disc rehydrated milky whitish-cream to bright grey to brownish grey, shining, seemingly waxy, semitranslucent; outside bright grey to dark olive- to blackish-brown, covered with white pruina, margin light reddish- to dark olivaceous-brown; subsessile with a hidden stalk ~0.3– 0.6 × 0.25–0.6 mm, stalks always separate, erumpent from beneath the periderm, inserted on bast; receptacle compressed when dry, hysteriform to triangular. Ectal excipulum 150 μm thick near the base, 30–50 μm at flanks, 20 μm near margin, of vertically oriented t. angularis(−prismatica), cells *7– 12 × 4–8 μm (†3–11 × 1.5–3 μm), wall strongly swollen in dead state (†0.8–1.5 μm), with bright reddish-ochre to dark brown exudate towards the outer surface, continuously paler yellowish-amber inside, exudate not dissolved or changing colour in KOH, ± indistinctly separated from medullary excipulum by a t. porrecta. Medullary excipulum hyaline, upper part 60–80 μm thick, of slightly gelatinized t. porrecta oriented perpendicular to disc surface (paraphysis-like), hyphae *1.5–3 μm wide; lower part 70–90 μm thick, of gelatinized t. intricata forming a thin t. porrecta near ectal excipulum, cells *2–5 μm wide (†1.5–3.5 μm), with gelatinous coat being strongly swollen in dead state. Asci narrowly clavate, *42–85(−105) × 4.5–5.8 μm {5}, †(33–)38– 60(−70) × 3–4.5 μm {3}, 8-spored, spores ~3–4-seriate, pars Fungal Diversity (2017) 82:183–219 211 Fig. 11 Xeropilidium dennisii. a Rehydrated apothecia. b–c Cross-section of apothecium, c in IKI. d Margin in external view, in CB. e–g Ectal excipulum with crystals. h Immature hymenium, subhymenium of vertically oriented hyphae, medullary excipulum, in CB. i Asci† in CB. j Ascus*. k Ascus apex† in IKI. l Crystals in CB. m Ascospores. n Paraphyses in KOH, holotype. o Sporodochia on MEA, emerging from a common base in left bottom corner. p Crystals on outside of sporodochia. q Conidiophores in KOH. Scale bars: a = 1 mm; b = 100 μm; c, e, f, h = 50 μm; d, g, i, l–n, p, q = 10 μm; j, k = 5 μm, o = 1 mm. Sources: a TU 104501, holotype; b, i, n K(M) 31,026, holotype of E. fuckelii; c–h, l M-0,281,058/H.B. 8071; j, k, m E.R.D. 4818; o–q TFC 201986, ex-type culture. Microphotos a by G. Marson; j, k, m by E. Rubio Domínguez sporifera *12–22 μm long; apex rounded to medium truncate, IKI- {6}, MLZ-, with apical thickening †1.5–2.2(−3.5) of juvenile asci, 1–1.3 μm of mature asci {6} (*0.3–0.4 μm); gradually tapering into a short to very long stalk, arising from 212 small croziers {5}. Ascospores narrowly cylindrical, sometimes ellipsoid or ± clavate, straight, rarely slightly curved, hyaline, *4.5–8(−10) × (1.2–)1.4–1.8(−2) μm {5}, †4.2– 8 × 1–1.5 μm {2}, aseptate, containing 0–4 min LBs (0.1– 0.2 μm); exceptionally seen to form conidia at their ends. Paraphyses filiform, equally septate, terminal cell ~12– 22 μm long, simple or branched in the upper ¼, ± flexuous to bent or even hooked, surrounded with small crystals, exceeding the dead asci (but living asci projecting 0–10 μm), *1–1.5(−2.2) μm wide {3} (†0.7–1 μm), containing a few minute LBs, without VBs. Abundant hyaline to pale yellowish, cloddy-amorphous (resinous) granules loosely interspersed between paraphyses {2}, abundant also in medullary excipulum, staining turquoise(−blue) in CRB. Hyaline mass of crystals covering flanks and margin {9}, each ca. 2–5 μm in diam., rhomboid, partly forming druses, more sparse on hymenium and in medullary excipulum. Synanamorphs: 1) Sporodochial, in culture Colonies 5 cm in diam. (while 3 months old), slow growing on MEA, radial growth 9 mm /week. Aerial mycelium lacking, except for the margin. Marginal zone fimbriate, slimy, hyphae on surface branching; subsequent zone ca. 1 cm, formed of sparse hyphae covered with crystals; the central zone of submerged hyphae. Sporodochia densely formed in central part of the colony and sparsely over the rest of the colony; sessile or with a submerged short stipe; 0.4–0.9 mm wide and up to 1.2 mm high, pale ochraceous; formed singly or aggregated; initially cupulate, sometimes with horizontal outgrowths or irregularly cushion-shaped, later covered by a clavate-spherical, slimy and shiny, cream-coloured conidial mass. Conidiomatal wall paler than conidial mass, appearing rough due to external crystals, 5–10 μm in diam.; outermost cells hyaline, thin-walled, 6–10 μm in diam., septate, forming t. angularis-globulosa; inner part t. intricata, of hyaline, septate cells, 2.5–4.6 μm in diam. Conidiophores hyaline, septate, di- to trichotomously branched, forming whorls of conidiogenous cells in the basal part, 3–6 branches formed from one point, one branch often up to two times longer than others; 0.8–1.5 μm wide near the base, tapering gradually toward the apex, smooth-walled, individual cells 6–8 μm long. Conidiogenous cells terminal, subcylindricsublageniform, hyaline, 6–12 × 1.3–1.7 μm, phialidic, with an inconspicuous collarette at the conidiogenous locus at the apex. Conidia cylindric-ellipsoidal, straight, hyaline, thinwalled, aseptate, smooth, with two small guttules, *2.7– 3.5 × 0.8–1.3 μm. Isolate examined: TFC 201986, inoculated from ascospores from the holotype specimen TU 104501 by G. Marson. 2) Pycnidial, on natural substrate Pycnidia growing next to apothecia or found on separate branches, singly or in fascicles of 2–10 by arising from a common stromatic base, globose to broadly ellipsoid or subangular, 0.25–0.6 × 0.25–0.35 mm, with minute papilla Fungal Diversity (2017) 82:183–219 from which a slimy conidial drop emerges; greyish ochrebrown when moist, upper half whitish-grey and pruinose when dry due to a dense cover of crystals; stipitate, erumpent from beneath the host’s periderm, on bast; stalk blackish redbrown, up to 0.35 mm high, laterally compressed. Conidiophores di- to trichotomously branched or verticillate (up to 6). Conidiogenous cells *8–14 × (1.2–)1.4–1.7 μm {2}, subcylindrical-sublageniform, tapering gradually towards the apex, phialidic, without or with an inconpicuous collarette. Conidia cylindrical to sometimes ellipsoidal, straight, mostly with 1–2 min guttules, *(2.5–)3– 3.7(−4) × 1–1.4 μm {4}. Hyaline setae emerging abundantly from basal branches of the conidiophores {3}, up to 100 μm long, 1.7 μm wide at the base, gradually tapering towards the pointed apex, thin-walled, hyaline, with oil drops near the septa. Habitat: on thin, corticated, xeric, still attached branches of Cornus sanguinea {1}, Crataegus spp.{4}, Prunus spinosa {4}, Rosa spp. {2} and Salix spp. {2}, 1–3 m above ground, or on cut branches lying in piles, host bark often detaching, erumpent through periderm of bark {14}. Phenology: from autumn to spring (Oct–Jun). Distribution: rare in Europe (Spain, Luxembourg, Germany, United Kingdom, Sweden). Comments: Based on the illegitimacy of E. fuckelii Dennis, we recommend changing the specific epithet and describe Dennis’ fungus as a new species in a new genus. We designate as the holotype a recently collected specimen for which, in addition to the sexual morph, supporting asexual morph and DNA-associated data are available. In the multigene phylogeny X. dennisii forms a group with species of the originally anamorph-typified genera Pilidium Kunze and Chaetomella Fuckel, members of Chaetomellaceae (Baral 2015). The affinities of this recently described family in Leotiomycetes, which is distinct from any other family or order, are not yet resolved (Rossman et al. 2004; Wang et al. 2006a; Johnston et al. 2014a). The phylogeny presented herein as well as analyses of the morphology show that X. dennisii was misplaced in the genus Encoelia by Dennis (1971), but support its inclusion in the Chaetomellaceae. Until now this family, which includes 4 genera and c. 80 species (Baral 2016), comprised only two species with a known teleomorph. In both cases an earlier name based on the type containing only the anamorph was recently protected against a later name described for the teleomorph, viz. Pilidium lythri (Desm.) Rossman over Discohainesia oenothera (Cooke & Ellis) Nannf. and Chaetomella oblonga Fuckel over Zoellneria rosarum Velen. (Johnston et al. 2014b). The teleomorph characters shared by these two species and X. dennisii are the inamyloid asci and the extracellular resinous drops among the apically branched paraphyses. P. lythri, as studied by Shear and Dodge (1921), resembles Fungal Diversity (2017) 82:183–219 X. dennisii also in forming subsessile apothecia with a pale disc and reddish-brown ectal excipulum comprised of isodiametric cells becoming more elongated towards the margin. Both species are characterised by a paraphysoid upper medullary excipulum, narrow, apically branched paraphyses forming a waxy epihymenial cover, and asci with a tapered base. The sexual state of Chaetomella oblonga differs from the other two by having short, narrow apothecial stipes which are, like its pycnidia, densely covered by brown setae. These three genera of Chaetomellaceae share similar synanamorphs. The pycnidia and sporodochia of Xeropilidium resemble those in the genus Pilidium as described by Palm (1991) and Rossman et al. (2004) as well as in Chaetomella (Rossman et al. 2004). However, the morphs of both Pilidium and Chaetomella lack the crystals characteristic of X. dennisii. Species of Chaetomella differ by forming conspicuous brown setae on both the ana- and teleomorph (Rossman et al. 2004; Johnston et al. 2014a). Pilidium and Chaetomella are either plurivorous or host-specific, growing as weak parasites on leaves or stems, and on fruits of various dicots. Xeropilidium dennisii is the only member of Chaetomellaceae that grows on bark of trees or shrubs. It also is drought-tolerant, as paraphyses and anamorph remain viable after a 1.5 months stay in the fungarium. The phylogeny drawn from multigene data (Fig. 1) and ITS rDNA characters (Fig. S6) revealed the distinctness of Xeropilidium dennisii within the family. The three ITS sequences derived from specimens were identical not only to each other but also to one INSD sequence from the European elm bark beetle from Scandinavia. Type specimens examined: LUXEMBOURG, 7 km SE of Luxembourg, 2 km ESE of Alzingen, Héid, 49.5635°N 6.195°E, alt. 300 m, branches of Crataegus sp., on bark, 21 Feb. 2013, G. Marson (TU 104501, holotype, ex-type culture TFC 201986, INSD accession number LT158441). Specimens examined: UNITED KINGDOM, West Sussex, 2.5 km N of Ardingly, Wakehurst Place, 51.0695°N 0.0845°W, alt. 135 m, on bark of Prunus spinosa, 7 Apr 1968, R.W.G. Dennis (K(M) 31,026 as holotype of E. fuckelii nom. illegit.), Cambridgeshire, 9 km NNW of Huntington, Monks Wood National Nature reserve, 52.4°N 0.24°W, alt. ~40 m, on bark of an unidentified tree, 15 Oct 1960, R.W.G. Dennis & E. Milne-Redhead, det. R.W.G. Dennis (K(M) 42,869). LUXEMBOURG, Gutland, Luxembourg Plateau, 5.5 km NNW of Luxembourg, 1.5 km E of Bridel, Plakigebierg, 49.66°N 6.11°E, alt. 280 m, branch of Crataegus monogyna, on bark, 5 Jan. 1992, G. Marson (H.B. 4582); 6.5 km E of Luxembourg, 2 km S of Sandweiler, Weierboesch (W of Kallecksuewen), 49.60° N 6.215° E, alt. 330 m, branch of Prunus spinosa, on bark, 19 Jan. 1990, G. Marson (H.B. 3964); 4 km S of Luxembourg, 1 km NE of Kockelscheier, Laangeweier, 49.565°N 6.125°E, alt. 305 m, P. spinosa, 15 Mar 1988, G. Marson (G.M. 3627); 5 km S of Luxembourg, 1.5 km W of Hesperange, forest between Biersak and 213 Géisselbierg, 49.57°N 6.13°E, alt. 290 m, branches of Salix, on bark, 7 May 2004, G. Marson (ø); Terres rouges, 1 km E of Bettembourg, Bierg, 49.52°N 6.12°E, alt. 285 m, branches of Crataegus sp., on bark, 14 Nov 1991, G. Marson (H.B. 4557); 1.7 km NNW of Esch-sur-Alzette, 1.3 km SE of Ehlerange, Laankelzer Boesch, 49.515°N 5.98°E, alt. 300 m, branches of Crataegus sp., on bark, 12 Jan. 1990, G. Marson (G.M. 4018, H.B. 3959); ibid., branch of Rosa canina, on bark, 2 Feb. 1989, G. Marson (G.M. 3813, H.B. 3673). 2 km NNE of Dudelange, 1.5 km S of Bettembourg, railway, 49.505°N 6.097°E, alt. 275 m, branch of Salix caprea, on bark, 20 Jun 1998, G. Marson (H.B. 6173b); Velée de Moselle, 6 km NNE of Grevenmacher, 2 km NW of Wasserbillig, WNW of Langsur, 49.726°N 6.48°E, alt. 254 m, branch of Cornus sanguinea, 14 Dec 2014, G. Marson (ø). GERMANY, Nordrhein-Westfalen, 7 km NE of Gelsenkirchen, 3.7 km SSE of Herten, Hoppenbruchhalde, 51.562°N 7.153°E, alt. 60 m, branch of Rosa, on bark, 23 Feb. 2006, F. Kasparek (M-0281058/ H.B. 8071, TU 104524, KL159). SPAIN, Asturias, 18 km SSE of Pola de Lena, 2 km SSW of Pajares, Hayedo de Valgrande, 43.00°N 5.78°W, alt. 1035 m, branches of Prunus spinosa, on bark, 6 Jun 2009, E. Rubio (E.R.D. 4818, d.v.). Discussion This study revealed that the genus Encoelia and the subfamily Encoelioideae are highly polyphyletic, its species belonging to six major lineages in the Leotiomycetes. Although polyphyly had been suggested earlier (Peterson and Pfister 2010, Wang et al. 2006a; Zhuang et al. 2000), we have elaborated considerably the evidence underlying the inferences concerning the phylogenetic relationships of encoelioid fungi. Our analyses involved six gene regions and 28 species of Encoelioideae, including eight species currently referred to Encoelia. The extended sampling in terms of genes and taxa resulted in increased support for many phylogenetic relationships in the Leotiomycetes that could not be resolved in previous studies based only on rDNA regions (Crous et al. 2014; Spatafora et al. 2006; Wang et al. 2006a, 2006b). In addition to the distinction of several widely accepted and wellsupported intraordinal groups, the analyses of our dataset added evidence for the delimitation of thus far neglected (Cenangiaceae, Cordieritidaceae) or recently distinguished (Chlorociboriaceae, Chaetomellaceae) families. However, the rarity of many of the encoelioid taxa limited the set of species analysed in this study. Reevaluation of morphological characters Encoelioid ascomycetes represent a good example of convergent evolution, resulting in similar appearance or adaptations 214 to survive unsuitable conditions. Among the seven genera accepted in Encoelioideae, Nannfeldt (1932: 302) already suggested this convergence, and our molecular analyses confirm his suggestions. Despite some gross morphological resemblance, the distantly related encoelioid taxa are distinguished by unique combinations of hymenial and excipular characters of the apothecia, shared with other members of groups they belong to. Thus, these taxa are defined by a combination of several characters rather than individual features. High diagnostive value can be ascribed to the features of stromata/sclerotia, the ionomidotic reaction, and the anamorphs. However, equally important is the apothecial micromorphology: the features of excipular cells, refractive vacuoles in living paraphyses, ascus apex ultrastructure, as well as extracellular structures of the hamathecium and excipulum (crystals, resinous particles) (Table S3). Clearly, the reason for long time recognition of the highly polyphyletic Encoelia and Encoelioideae has resulted from the reliance on homoplasious characters. Advances in molecular taxonomy have revealed such a phenomenon in several groups of Leotiomycetes, e.g. apothecial hairs used to delimit the Hyaloscyphaceae (Han et al. 2014), or the presence of filiform spores in combination with the shape of apothecia used in the taxonomy of the Rhytismatales (Lantz et al. 2011). Likewise, brown setae have evolved independently in Rutstroemiaceae, Helotiaceae and Chaetomellaceae (Johnston et al. 2014a). In our study, the main homoplasious feature, overemphasized in the taxonomy, is the mealy appearance of apothecia. This feature, however, is a result of the formation of various structures (crystals, loose globular cells, protruding hyphae, pyramidal cell aggregations) in different groups of Leotiomycetes. The other similarities in encoelioid fungi include leathery consistency, cleistohymenial development, and longevity of the apothecia coupled with desiccation-tolerance, extending ascospore production over a long period. Additional evidence of convergent evolution is provided by allantoid ascospores, which are typical of species previously treated in Encoelia (Korf 1973; Hansen and Knudsen 2000). These are found in several distantly related species: E. furfuracea, BE.^ fimbriata, Rutstroemia tiliacea, Sclerencoelia spp., as well as in Ameghiniella australis and Ionomidotis fulvotingens, with gradual transitions in each lineage to related taxa that have more or less straight spores. Our molecular analyses ascertain the taxonomic value of some morphological characters that have thus far been overlooked in the systematics of helotialean ascomycetes. Two previous members of Encoelia, Chlorociboria glauca and Xeropilidium dennisii, indicate the importance of anamorph morphology in reflecting phylogenetic relationships, as recognized in many other groups of ascomycetes (e.g. Hirooka et al. 2012; Réblová et al. 2011). Xeropilidium dennisii shares similar synanamorphs with related species of Pilidium and Chaetomella in the Chaetomellaceae whereas Fungal Diversity (2017) 82:183–219 Chlorociboria glauca forms a Dothiorina anamorph, like other species of the genus in the Chlorociboriaceae. Another taxonomically important feature is the presence of stromatic structures. Although sclerotia have usually been considered to be absent in encoelioid fungi (Korf and Kohn 1976; Smith et al. 2015), Holst-Jensen et al. (1997) found determinate stromata embedded in the inner bark in hosts of E. fascicularis. Our finding of dense hyphal strands with a black-brown cortex forming sclerotinized tissues in the bark is unique for species of Sclerencoelia. Like the typical sclerotia of Sclerotiniaceae, these structures may serve in the survival of the fungus as resource-storage structures that are more protected than apothecia. We also observed black demarcation lines inside the wood in Rutstroemia tiliacea, a typical feature of the genus. The ionomidotic reaction also served to be a useful character in distinguishing encoelioid taxa. Characteristic of many Cordieritidaceae, this reaction can be observed even in dried specimens. However, the chemical background of this reaction, based mainly on the solubility of pigmented exudate in alkali, remains unknown. Further research is needed to elucidate the secondary metabolites that could potentially provide additional characters for the delimitation of taxa in the Leotiomycetes. Secondary metabolites have added valuable information in resolving the taxonomy of various fungal groups, e.g. in Hygrophoraceae (Lodge et al. 2014), Penicillum (Frisvad and Samson 2004, Samson et al. 2004), and Xylariaceae (Stadler et al. 2014), of which Xylariaceae showed KOH-extractable pigments comparable in colour to those in the Cordieritidaceae. Refractive vacuoles in paraphyses turned out as one of the main synapomorphies distinguishing members of the Cenangiaceae. This character has taxonomic value also for other groups of Helotiales, e.g. in discrimination of Pezizellaceae vs. Hyaloscyphaceae, Cyathicula vs. Crocicreas, and Mollisiaceae vs. Ploettnerulaceae (Baral 2016). Ecology Among Leotiomycetes, most of the encoelioid fungi are distinguished by long-lasting apothecia, which can remain alive during dry periods. This adaptation is correlated with various features that have apparently contributed to the acceptance of encoelioid fungi in one subfamily. One such feature is the coarse outside of fruitbodies and the retraction of the disc. This study, however, revealed the homoplasious nature of these and other morphological characters, some of which might have evolved together with desiccation-tolerance. This adaptation is found in various leotiomycetous groups, being, for instance, a consistent character in Dermateaceae (s.str.). Therefore, we consider desiccation-tolerance to have arisen several times independently in the evolution of the Leotiomycetes, likewise suggested for other adaptations, e.g. Fungal Diversity (2017) 82:183–219 the colonization of the aquatic environment (Baschien et al. 2013). The inclusion of encoelioid members in different families either supported or expanded the known ecological spectrum described for these groups. For example, the Chaetomellaceae and Sclerotiniaceae now encompass desiccation-tolerant species with xylicolous lifestyle. In Rutstroemiaceae, desiccation-tolerance had been observed in some species (in Rutstroemia coracina, Baral ined.), whereas fungicolous habit was added here by the inclusion of R. (≡ Dencoeliopsis) johnstonii. By contrast, Cordieritidaceae appeared ecologically distinct due to the high extent of fungicolous and lichenicolous taxa. Until recently, ecological features of fungi were deduced mainly from the occurrence of sexual or asexual structures. These structures have revealed host preference in various taxa and suggested saprotrophic or parasitic lifestyle for the encoelioid fungi. Most of the encoelioid fungi form apothecia on bark or wood of various tree species. While some species, such as Velutarina rufoolivacea, Chlorociboria glauca and Xeropilidium dennisii, are generalists on different woody substrates, others exhibit a more restricted host range. However, for many encoelioid taxa the habitat requirements and lifestyle are still poorly known. Incorporation of public ITS rDNA sequences obtained from various biological samples further expanded the fruitbody-based understanding of the ecology in several groups. ITS sequences of fungi from different tissues of various plants formed the majority among the sequences found as most similar to those of encoelioid fungi. Phylogenetic analyses often enabled identification of endophytes from leaves and twigs as well as fungi from soil samples to a species or genus, whereas root endophytes tended to cluster apart from groups incorporating specimen-derived sequences. Distinct groups of Leotiomycetes, members of which share a common lifestyle, e.g. grow as root or foliar endophytes, have been documented in previous studies (Arnold et al. 2007; Higgins et al. 2007; Tedersoo et al. 2009). However, it remains unknown whether these represent lineages that lack reproductive structures or if these have not yet been discovered or sequenced. On the other hand, some apothecia-derived ITS sequences did not have >90 % similar sequences available. This applied to the key species of Encoelioideae, E. furfuracea, which, given its morphological uniqueness, likely represents an early diverged species with no extant siblings rather than a member of a poorly sampled larger group. ITS analysis provided strong evidence for the occurrence of Cenangium ferruginosum as an endophyte in pine needles and twigs, as well as in Viscum album parasitizing pine, while apothecia have only been found on twigs and branches of Pinus spp. Despite its frequent isolation from diseased P. halepensis in Spain (Santamaria et al. 2007) and recently in V. album (Peršoh et al. 2010), these endophytic isolates 215 could not be identified earlier due to the absence of reference sequences from apothecia. The sister group of C. ferruginosum comprised endophytic isolates from pines, a juniper, a grass, a liverwort and a lichen. Therefore, one of the three most common OTUs detected in needles of adult loblolly pines (P. taeda) in North Carolina, USA (Oono et al. 2015) could be identified as belonging to the genus Cenangium. In the Sclerotiniaceae, a sequence originating from shoots of Fraxinus was assigned to Sclerencoelia fraxinicola, providing additional evidence for the distinction of this supposedly Fraxinus-restricted species from S. fascicularis and S. pruinosa, which grow mainly on Populus spp. An INSD sequence of S. fascicularis from an isolate from pine needles supports the idea that the host range of a fungus can be broader in the endophytic stage than in the saprotrophic sexual stage, as has been described for several ascomycetes (Sieber 2007). An INSD sequence for Xeropilidium dennisii indicated that the European bark beetle participates in the dissemination as well as expanded the known distribution range of this fungus. INSD data from biological samples revealed the commonness of the endophytic-parasitic lifestyle in the Cenangiaceae, recognised earlier in members of the previous Hemiphacidiaceae and now included in the expanded Cenangiaceae. Based on ITS sequence analyses, many endophytes, mostly from leaves and roots of coniferous trees, appeared closely related to the encoelioid species in the Cenangiaceae. This agrees with the occurrence of their apothecia on still attached, recently dead leaves or branches. Formation of apothecia is presumably preceded by a mycelium, thriving in the living host tissue and providing nutrients during a prolonged period that might secure the longevity of fruitbodies noted for the encoelioid species. It is likely that several Cenangiaceae represent latent saprotrophs that start to form fruitbodies upon the senescence or the death of the host organ as known for several ascomycetes (Saikkonen et al. 1998; Porras-Alfaro and Bayman 2011). Other taxa seem to act as pathogens or grow as symptomless endophytes with presumably several factors determining the fungus to switch between these two strategies (Delaye et al. 2013). The divergence of the stroma-forming sister group of Cenangiaceae appears to have been accompanied by a shift to soil-associated substrata and the formation of desiccationsensitive apothecia. While members of the Sclerotiniaceae are generally parasites in their first stage of development, in a saprotrophic phase they produce mainly desiccation-sensitive, soil-associated apothecia on decaying herbaceous stems, rootstock, flowers, fruits and leaves. Rutstroemiaceae are known to grow mainly as saprotrophs on fallen branches, leaves or fruits and dead herbaceous stems (Baral 2016; Holst-Jensen et al. 1997). Even the lignicolous members of Rutstroemiaceae depend apparently on soil moisture by preferring branches close to the soil. The ecological distinction of the two sister families from the Cenangiaceae was supported 216 also by similar INSD ITS sequences originating mostly from soil and not from endophyte samples as observed in the latter family. Regarding the Rutstroemiaceae, ITS data revealed that members of the Rutstroemia calopus-clade are common in soil in various habitats and regions of the world. This group, in which apothecia form on decaying, previous year’s monocot stems, appeared, as in a recent study on the Rutstroemiaceae (Galán et al. 2015), distinct from the R. firma-group, members of which grow on various parts of trees. In conclusion, the multigene and ITS rDNA analyses of the highly polyphyletic encoelioid fungi provided a good example of how combining data on voucher specimens and biological samples can complement each other in recognizing morphological, ecological, and sequence characters for the delimitation of monophyletic taxa in the Leotiomycetes. Moreover, this allowed species, genus, or family level identification of the source organism of many ITS sequences, labelled as ‘uncultured Helotiales/Leotiomycetes/Ascomycota/fungus’ and cumulating at high speed in the INSD. Incorporation of such sequences, in turn, either supported or expanded the present knowledge on the ecology of the studied taxa in the Leotiomycetes. Wang et al. (2006b) proposed an endophytic ancestor inhabiting conifers for the clade comprising the Rutstroemiaceae and Sclerotiniaceae. Our results showed that also in a sister group of these families, the Cenangiaceae, symptomless growth in various hosts is far more common than previously known for the included members of the Hemiphacidiaceae. Selective expression of a basic toolbox o f g en e s fo r p l a n t sy m b i o s i s , d es c r i be d f o r t h e Sclerotiniaceae (Andrew et al. 2012), probably enables the realisation of various forms of interactions with hosts also in other fungal groups. However, despite the wide occurrence of endophytism in Leotiomycetes (Wang et al. 2006a), this lifestyle seems not to define the morphology of associated fruitbodies as suggested by Wang et al. (2009). Apparently numerous fungi can form their mycelium inside living plant tissues, changes in which (senescense, weakening etc.) provide stimuli for the development of morphologically diverse fruitbodies. Acknowledgments We are grateful to the late Ain Raitviir, under whose supervision this study was initiated. D. Pfister is acknowledged for valuable comments and for providing a recent Ameghiniella specimen, and G. Marson for sending an isolate of Xeropilidium and DNA sequences of some taxa. R. Galán, P. Johnston and A. Suija shared unpublished molecular results, and A. Suija added her ideas concerning lichenicolous fungi. J. Tanney is acknowledged for forwarding images and the description of a recent Sclerencoelia specimen. B. Perić, T. Læssøe, G. Marson, N. Aplin, A. Bogacheva, U. Graf, J. Karakehian, O. Koukol, A. Ordynets, B. Senn-Irlet, A. Voitk and curators of BPI, C, CUP, GB, FH, K, M, NY, O, OULU, S and TNS fungal collections are thanked for sending specimens, and Rasmus Puusepp for conducting the PCR. A. Bollmann, J.P. Dechaume, M. Hairaud, V. Liiv, B. Perić, J.H. Petersen, E. Rubio and I. Wagner provided images of encoelioid fungi. R. Fungal Diversity (2017) 82:183–219 Szava-Kovats is thanked for linquistic proofreading. The study was supported by the Estonian Science Agency (project IUT20-30), the European Regional Development Fund (Centre of Excellence EcolChange). References Abarenkov K, Tedersoo L, Nilsson RH, Vellak K, Saar I, Veldre V, Parmasto E, Prous M, Aan A, Ots M, Kurina O, Ostonen I, Jõgeva J, Halapuu S, Põldmaa K, Toots M, Truu J, Larsson K-H, Kõljalg, U (2010) PlutoF – a web based workbench for ecological and taxonomic research, with an online implementation for fungal ITS sequences. Evol Bioinform 6:189–196. doi:10.4137/EBO.S6271 Andrew M, Barua R, Short SM, Kohn LM (2012) Evidence for a common toolbox based on necrotrophy in a fungal lineage spanning necrotrophs, biotrophs, endophytes, host generalists and specialists. Plos One 7. doi:10.1371/journal.pone.0029943 Anonymous (2011) Forest Health Protection Rocky Mountain Region http://www.fs.usda.gov/Internet/FSE_ DOCUMENTS/stelprdb5342691.pdf Arnold AE, Henk DA, Eells RL, Lutzoni F, Vilgalys R (2007) Diversity and phylogenetic affinities of foliar fungal endophytes in loblolly pine inferred by culturing and environmental PCR. Mycologia 99: 185–206 Bakys R, Vasaitis R, Barklund P, Thomsen IM, Stenlid J (2009) Occurrence and pathogenicity of fungi in necrotic and nonsymptomatic shoots of declining common ash (Fraxinus excelsior) in Sweden. Eur J Forest Res 128:51–60 Baral HO (2003) No. 3584. Diplocarpa Massee. In: Eriksson OE, Baral HO, Currah RS, Hansen K, Kurtzman CP, Læssøe T, Rambold G, eds. Notes on ascomycete systematics. Nos. 3580–362. Myconet 9: 91–103 Baral HO (2015) Nomenclatural novelties. Index Fungorum no.225 http://www.indexfungorum.org/Publications/Index%20 Fungorum%20no.225.pdf Baral HO (2016) Class Leotiomycetes. In W. Jaklitsch, H.O. Baral, R. Lücking, T. Lumbsch, Ascomycota. 13th ed. of A. Engler’s syllabus of plant families 1/2, ed. W. Frey. Gebr. Borntraeger, Stuttgart pp 157–205 Baral HO, Perić B (2014) Velutarina bertiscensis and V. alpestris spp. nov., with a redescription of V. rufoolivacea and discussion of its synonyms. Mycol Monten 17:7–52 Baral HO, Richter U (1997) Encoelia siparia im Naturschutzgebiet Kollenbeyer Holz, mit Anmerkungen zu nahestehenden EncoeliaArten. Boletus 21:39–47 Baschien C, Tsui CK-M, Gulis V, Szewzyk U, Marvanova L (2013) The molecular phylogeny of aquatic hyphomycetes with affinity to the Leotiomycetes. Fungal Biol 117:660–672 Bellemere A (1977) L’appareil apical de l’asque chez quelques Discomycetes: Étude ultrastructurale comparative. Rev Mycol 41: 233–263 Beug MW, Bessette AE, Bessette AR (2014) Ascomycete fungi of North America. University of Texas Press, A mushroom reference guide Boedijn KB (1936) The genus Cordierites in the Netherlands Indies. Bull Jard Bot Buitenzorg. 3:525–529 Breitenbach J, Kränzlin F (1984) Fungi of Switzerland. Vol.1. Ascomycetes, 2nd edn. Verlag Mycologia, Luzern, p. 178 Butin, H (1989) Krankheiten der Wald- und Parkbäume. 2. Anlage. Georg Thieme Verlag. Stuttgart New York. pp. 93–94 Clements FE, Shear CL (1931) Genera of Fungi i–vi, p:312 Crous PW, Quaedvlieg W, Hansen K, Hawksworth DL, Groenewald JZ (2014) Phacidium and Ceuthospora (Phacidiaceae) are congeneric: taxonomic and nomenclatural implications. IMA Fungus 5:173–193 Fungal Diversity (2017) 82:183–219 Davidson RW, Cash EK (1955) A Cenangium associated with sooty-bark canker of aspen. Phythopath 46:34–36 Delaye L, García-Guzmán G, Heil M (2013) Endophytes versus biotrophic and necrotrophic pathogens – are fungal lifestyles evolutionarily stable traits? Fungal Divers 60:125–135 Dennis RWG (1956) A revision of the British Helotiaceae in the herbarium of the Royal Botanic Gardens, Kew, with notes on related European species. Mycol. Pap. 62:1–216 Dennis RWG (1971) New or interesting British microfungi, III. Kew Bulletin 25:335–374 Dennis RWG (1975) New or interesting British microfungi, III. Kew Bulletin 30:345–365 Dennis RWG (1978) British Ascomycetes. Cramer, Vaduz, pp. 150–155 Dixon JR (1975) Chlorosplenium and its segregates. II. The genera Chlorociboria and Chlorencoelia. Mycotaxon 1:193–237 Duda B, Sierota Z (1997) Diseases caused by Gremmeniella abietina (Lagerb.) Schlapfer–Bernhard and Cenangium ferruginosum Fr. ex Fr. in Scots pine (Pinus sylvestris L.) stands in Poland. In: Foliage, Shoot and Stem Diseases of Trees. Proc Meet. IUFRO Working Party 7.02.02, Quebec City, Canada, May 25–31, 1997, eds. Laflamme G, Bérubé JA, Hamelin RC, Quebec, Canada: Can For Serv, pp. 90–94 Durand EJ (1923) The genera Midotis, Ionomidotis and Cordierites. Proc Am Acad Arts 59:1–19 Eckblad F-E, Holm L, Nannfeldt J-A, Müller E (1978) Proposal (448) for the conservation of Encoelia (Fr.) Karst. (Discomycetes – Helotiaceae – Encoelioideae). Taxon 27:309–310 Etayo J, Flakus A, Suija A, Kukwa M (2015) Macroskyttea parmotrematis gen. et sp. nov. (Helotiales, Leotiomycetes, Ascomycota), a new lichenicolous fungus from Bolivia. Phytotaxa 224:247–257 Fries EM (1822) Systema Mycologicum 2:74–77. Sweden, Lund Frisvad JC, Samson RA (2004) Penicillium subgenus Penicillium: new taxonomic schemes and mycotoxins and other extrolites. Stud Mycol 49:201–241 Galán R, Checa J, Blanco MN, Platas G, Tena R, Tello S, Hermosilla CE, Jaklitsch WM, Voglmayr H (2015) Taxonomic position of the genus Bicornispora and the appearance of a new species Bicornispora sedimentosa. Mycologia 107:793–807 Gamundi IJ (1991) On the synonymy of the Amenghiniella australis and Ionomidotis chilensis. Mycol Res 95:1131–1136 Gamundí IJ, Romero AI (1998) Fungi, Ascomycetes Helotiales: Helotiaceae. Flora Criptogámica de Tierra del Fuego 10:1–131 Garbelotto MM, Lee HK, Slaughter G, Popenuck T, Cobb FW, Bruns TD (1997) Heterokaryosis is not required for virulence of Heterobasidion annosum. Mycologia 89:92–102 Gargas A, Taylor JW (1992) Polymerase chain reaction (PCR) primers for amplifying, sequencing nuclear 18S rDNA from lichenized fungi. Mycologia 84:589–592 Gernardt DS, Camacho FJ, Stone JK (1997) Meria laricis, an anamorph of Rhabdocline. Mycologia 89:735–744 Gremmen J (1952) A preliminary study on the culture of Discomycetes, especially the perfect stage. Antonie Van Leeuwenhoek 18:152–164 Groves JW (1969) Notes on the genus Encoeliopsis. Can J Bot 47:1319– 1331 Groves JW, Elliott ME (1971) Notes on fungi from Northern Canada VI. Additional records of Discomycetes. Rep. Kevo Subarctic Res. Stat. 8:22–30 Hafellner J, Navarro-Rosinés P (1993) Llimoniella gen. nov. – eine weitere Gattung lichenicoler Discomyceten (Ascomycotina, Leotiales). Herzogia 9:769–778 Han J-G, Hosoya T, Sung G-H, Shin H-D (2014) Phylogenetic reassessment of Hyaloscyphaceae sensu lato (Helotiales, Leotiomycetes) based on multigene analyses. Fungal Biol 118:150–167 Hansen L, Knudsen H (2000) Nordic Macromycetes. 1. Ascomycetes. Nordsvamp. Copenhagen, p. 170 217 Hazard C, Gosling P, Mitchell DT, Doohan FM, Bending GD (2014) Diversity of fungi associated with hair roots of ericaceous plants is affected by land use. FEMS Microbiol Ecol 87:586–600 Hein B (1983) Die Gattung Hysterostegiella v. Höhnel (Ascomycetes, Dermateaceae). Nova Hedwig 38:669–702 Hibbett DS (1996) Phylogenetic evidence for horizontal transmission of group I introns in the nuclear ribosomal DNA of mushroom-forming fungi. Mol Biol Evol 13:903–917 Higgins KL, Arnold EA, Miadlikowska J, Sarvate SD, Lutzoni F (2007) Phylogenetic relationships, host affinity, and geographic structure of boreal and arctic endophytes from three major plant lineages. Mol Phylogenet Evol 42:543–555 Hirooka Y, Rossman AY, Samuels GJ, Lechat C, Chaverri P (2012) A monograph of Allantonectria, Nectria, and Pleonectria (Nectriaceae, Hypocreales, Ascomycota) and their pycnidial, sporodochial, and synnematous anamorphs. Stud Mycol 71:1–210 Hofstetter V, Miadlikowska J, Kauff F, Lutzoni F (2007) Phylogenetic comparison of protein-coding versus ribosomal RNA-coding sequence data: A case study of the Lecanoromycetes (Ascomycota). Mol Phylogenet Evol 44:412–426 Holm K, Holm L (1977) Nordic junipericolous Ascomycetes. Acta Universitatis Upsaliensis. Symb Bot Upsal 21:3. Uppsala. 70 pp Holst-Jensen A, Kohn LM, Schumacher T (1997) Nuclear rDNA phylogeny of the Sclerotiniaceae. Mycologia 89:885–899 Holst-Jensen A, Vrålstad T, Schumacher T (2004) Kohninia linnaeicola, a new species of the Sclerotiniaceae pathogenic to Linnaea borealis. Mycologia 96:135–142 Huhtinen S, Laukka T, Döbbeler P, Stenroos S (2010) Six novelties to European bryosymbiotic discomycetes. Nova Hedwig 90:413–431 Itturriaga T (1994) Discomycetes of the Guayanas. I. Introduction and some Encoelia species. Mycotaxon 51:271–288 Johnston PR, Park D (2005) Chlorociboria (Fungi, Helotiales) in New Zealand. New Zeal J Bot 43:679–719 Johnston PR, Park D, Baral H-O, Galán R, Platas G, Tena R (2014a) The phylogenetic relationships of Torrendiella and Hymenotorrendiella gen. nov. within the Leotiomycetes. Phytotaxa 177:1–25 Johnston PR, Seifert KA, Stone JK, Rossman AY, Marvanová L (2014b) Recommendations on generic names competing in use in Leotiomycetes (Ascomycota). IMA Fungus 5(1):91–120 Jurc D, Jurc M, Sieber TN, Bojovic S (2000) Endophytic Cenangium ferruginosum (Ascomycota) as a reservoir for an epidemic of Cenangium dieback in Austrian pine. Phyton 40:103–108 Juzwik J, Hinds TE (1984) Ascospore germination, mycelial growth, and microconidial anamorphs of Encoelia pruinosa in culture. Can J Bot 62:1916–1919 Karsten PA (1871) Mycologia Fennica. I. Discomycetes. Bidrag till Kännedom af Finlands Natur och Folk 19:217–220 Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol 30:772–780 Kauff F, Lutzoni F (2002) Phylogeny of the Gyalectales and Ostropales (Ascomycota, Fungi): Among and within order relationships based on nuclear ribosomal RNA small and large subunits. Mol Phylogenet Evol 25:138–156 Kellerman WA (1907) Saccardo’s recent agreement and nomenclature of the fungi. Journal of Mycology 13:242–246 Kernaghan G, Patriquin G (2011) Host associations between fungal root endophytes and boreal trees. Microbial Ecol 62:460–473 Kirk PM, Cannon PF, Minter DW, Stalpers JA (2008) Dictionary of the Fungi. 10th ed. CABI Internatioanal, p. 624 Kirk PM et al. (2015) Index Fungorum http://www.indexfungorum.org [accessed 20 Dec 2015] Kirschstein W (1935) Neue und seltene Ascomyceten. Ann Mycol 33: 202–229 218 Kohn L (1977) Notes on Phibalis II. Kirschstein’s Encoelia subgen. Velutaria (Velutarina) and its distinction from Phibalis. Mycotaxon 5:519–522 Kohout P, Sykorova Z, Ctvrtlikova M, Rydlova J, Suda J, Vohnik M, Sudova R (2012) Surprising spectra of root-associated fungi in submerged aquatic plants. FEMS Microbiol Ecol 80:216–235 Kohout P, Tesitelova T, Roy M, Vohnik M, Jersakova J (2013) A diverse fungal community associated with Pseudorchis albida (Orchidaceae) roots. Fungal Ecol 6:50–64 Koiwa T, Sakuyama T, Takahashi K (1997) Damage to Japanese pines caused by Cenangium ferruginosum in northern Honshu, Japan. In: Foliage, Shoot and Stem Diseases of Trees. Proc Meet. IUFRO Working Party 7.02.02, Quebec City, Canada, May 25–31, 1997, eds. Laflamme G, Bérubé JA, Hamelin RC, Quebec, Canada: Can For Serv, pp. 90–94 Kõljalg U, Nilsson H, Abarenkov K, Tedersoo L, Taylor A, Bahram M, Bates S, Bruns T, Bengtsson-Palme J, Callaghan T, Douglas B, Drenkhan T, Eberhardt U, Dueñas M, Grebenc T, Griffith G, Hartmann M, Kirk P, Kohout P, Larsson E, Larsson K-H (2013) Towards a unified paradigm for sequence-based identification of fungi. Mol Ecol 22 (21): 5271–5277, mec.12481 Korf RP (1958) Japanese discomycete notes I–VIII. Sci Rep Yokohama Natl Univ Ser. 2 Biol. Sci. 7:7–35 Korf RP (1962) A synopsis of the Hemiphacidiaceae, a family of the Helotiales (discomycetes) causing needle-blights of conifers. Mycologia 54:12–33 Korf RP (1973) Discomycetes and Tuberales. In: Ainsworth GC, Sparrow FK, Sussman AS (eds) The Fungi: an Advanced Treatise, vol 4B. Academic Press, New York, pp. 249–319 Korf RP, Kohn LM (1976) Notes on Phibalis, type genus of the Encoelioideae (Discomycetes). Mem N Y Bot Gard 28:109–118 Krieglsteiner L, Luschka N (2000) Pilze der NSG BIsarmündung^ und BStaatshaufen^ sowie angegrezender Auengebiete der Donau und der Isar. Hoppea 61:183–207 Kutorga E, Hawksworth DL (1997) A reassessment of the genera referred to the family Patellariaceae (Ascomycota). Systema Ascomycetum 15:1–110 Læssøe T, Petersen JH (2007) En pinse med 24 nye danske sæksvampe. Svampe 56:21–28 Læssøe T & Petersen JH (2008) MycoKey, 3.1 Funga Nordica Edition Lantz H, Johnston PR, Park D, Minter DW (2011) Molecular phulogeny reveals a core clade of Rhytismatales. Mycologia 103:57–74 Lindau G. (1897) Die natürlichen Pflanzenfamilien, Teil. 1, Abt. 1, p. 1– 513, in A. Engler & K. Prantl. Wihelm Engelmann, Leipzig Liu YJ, Whelen S, Hall BD (1999) Phylogenetic Relationships Among Ascomycetes: Evidence from an RNA Polymerse II Subunit. Mol Biol Evol 16:1799–1808 Lodge DJ, Padamsee M, Matheny PB, et al. (2014) Molecular phylogeny, morphology, pigment chemistry and ecology in Hygrophoraceae (Agaricales). Fungal Divers 64:1–99 Lumbsch TH, Huhndorf SM (2010) Outline of Ascomycota–2009 http://fieldmuseum.org/sites/default/files/Fieldiana_2010_Myconet. pdf Marson G (1987) Über drei weidenbewohnende Ascomyceten aus Luxemburg: Encoelia fimbriata Spooner & Trigaux, Glyphium elatum (Greville) Zogg und Hypocreopsis lichenioides (Tode ex Fries) Seaver. Beiträge zur Kenntnis der Pilze Mitteleuropas III: 465–484. Arbeitsgemeinschaft Mykologie Ostwürttemberg Matheny PB, Liu YJ, Ammirati JF, Hall BD (2002) Using RPB1 sequences to improve phylogenetic inference among mushrooms (Inocybe, Agaricales). Am J Bot 89:688–698 Moncalvo J-M, Rehner SA, Vilgalys R (1993) Systematics of Lyophyllum section Difformia based on evidence from culture studies and ribosomal DNA sequences. Mycologia 85:788–794 Fungal Diversity (2017) 82:183–219 Nannfeldt JA (1932) Studien über die Morphologie und Systematik der nichtlichenisierten Inoperculaten Discomyceten. Nova Acta Regiae Societatis Scientiarum Upsaliensis. Ser. 4. Vol. 8:279–307 Nauta MM, Spooner B (2000a) British Dermateaceae: 4B. Dermateoideae Genera B–E. Mycologist 14:21–28 Nauta MM, Spooner B (2000b) British Dermateaceae: 4B. Dermateoideae Genera G-Z. Mycologist 14:69–74 Nicholas KB, Nicholas HB, Deerfield DW (1997) GeneDoc: Analysis and Visualization of Genetic Variation. Embnew news 4:14 Nylander JAA (2004) MRMODELTEST 2.2. Evolutionary Biology Centre, Uppsala University, Uppsala Oono R, Lefèvre E, Simha A, Lutzoni F (2015) A comparison of the community diversity of foliar fungal endophytes between seedling and adult loblolly pines (Pinus taeda). Fung Biol 119:917–928 Palm ME (1991) Taxonomy and morphology of the synanamorphs Pilidium concavum and Hainesia lythri (coelomycetes). Mycologia 83:787–796 Pärtel K (2014) Ultrastructure of the ascus apical apparatus of Encoelia furfuracea (Helotiales). Mycol Prog 13:981–986 Peršoh D, Melcher M, Flessa F, Rambold G (2010) First fungal community analyses of endophytic ascomycetes associated with Viscum album ssp. austriacum and its host Pinus sylvestris. Fungal Biol 114:585–596 Persoon CH (1801) Synopsis Methodica Fungorum 2: Germany. Göttingen; Henricus Dieterich. p 671 Peterson KR, Pfister DH (2010) Phylogeny of Cyttaria inferred from nuclear and mitochondrial sequence and morphological data. Mycologia 102:1398–1416 Porras-Alfaro A, Bayman P (2011) Hidden fungi, emergent properties: endophytes and microbiomes. Annu Rev Phytopathol 49:291–315 Réblová M, Gams W, Štěpánek V (2011) The new hyphomycete genera Brachyalara and Infundichalara, the similar Exochalara and species of ‘Phialophora sect. Catenulatae’ (Leotiomycetes). Fungal Divers 46:67–86 Rehm H (1889) Hysteriaceen und Discomyceten. In: Rabenhorst, L., Kryptogamen-Flora von Deutschland, Österreich und der Schweiz, 2. Aufl., 1(3): Ascomyceten. Lief 31:209–272 Rehm H (1912) Zur Kenntnis der Discomyceten Deutschlands, DeutschÖsterreichs und der Schweiz. Ber Bayer Bot Ges 13:102–206 Rehner SA (2001) Primers for Elongation Factor 1-alpha (EF1-alpha). http://www.aftol.org/pdfs/EF1primer.pdf Reid J, Cain RF (1963) A new genus of the Hemiphacidiaceae. Mycologia 55:781–785 Ribollet P (2002) Un ascomycete a rechercher: Diplocarpa bloxamii (Berk. Ex Phill.) Seaver, Cahiers Mycologiques Nantais 14 – juin Rodriguez RJ, White JF Jr, Arnold AE, Redman RS (2009) Fungal endophytes: diversity and functional roles. New Phytol 182:314–330 Romero AI, Gamundi IJ (1986) Algunos discomycetes xilophilos del area subtropical de la Argentina. Darwiniana 27:43–63 Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biol 61:539–542 Rossman AY, Aime MC, Farr DF, Castlebury LA, Peterson KR, Leahy R (2004) The coelomycetous genera Chaetomella and Pilidium represent a newly discovered lineage of inoperculate discomycetes. Mycol Prog 3:275–290 Saccardo PA (1884) Conspectus generum Discomycetum hucusque cognitorum. Bot Centralb 18(213–220):247–256 Saccardo PA (1889) Sylloge Fungorum omnium hucusque cognitorum 8: 1–1143. Patavii. Saccardo PA, Traverso GB (1907) Sulla disposizione e nomenclatura dei gruppi micologici da seguirsi nella Flora Italica Cryptogama. Bull Soc Bot Ital:22–28 Fungal Diversity (2017) 82:183–219 Saikkonen K, Faeth SH, Helander M, Sullivan TJ (1998) Fungal endophytes: A continuum of interactions with host plants. Annu Rev Ecol Syst 29:319–343 Samson RA, Seifert KA, Kuijpers AFA, Houbraken JAMP, Frisvad JC (2004) Phylogenetic analysis of Penicillium subgenus Penicillium using partial β-tubulin sequences. Stud Mycol 49:175–200 Santamaria O, Tejerina L, Pajares JA, Diez JJ (2007) Effects of associated fungi Sclerophoma pythiophila and Cenangium ferruginosum on Gremmeniella abietina dieback in Spain. Forest Pathol 37:121–128 Schoch CL, Seifert KA, Huhndorf S and Fungal Barcoding Consortium (149 coauthors) (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad Sci U S A 109:6241–6246 Schoch CL, Sung GH, Lopez-Giraldez F, et al. (64 co-authors) (2009) The Ascomycota tree of life: a phylum-wide phylogeny clarifies the origin and evolution of fundamental reproductive and ecological traits. Syst Biol 58:224–239 Seaver FJ (1951) North American Cup-fungi (Inoperculates). New York. pp:300–302 Shear CL, Dodge BO (1921) The life history and dentity of Patellina fragariae, Leptothyrium macrothecium, and Peziza oenotherae. Mycologia 13:135–170 Sieber TN (2007) Endophytic fungi in forest trees: are they mutualists? Fungal Biol Rev 21:75–89 Sieber TN, Rys J, Holdenrieder O (1999) Mycobiota in symptomless needles of Pinus mugo ssp. uncinata. Mycol Res 103:306–310 Smith ME, Henkel TW, Rollins JA (2015) How many fungi make sclerotia? Fungal Ecol 13:211–220 Spatafora JW, Sung G-H, Johnson D et al. (30 co-authors) (2006) A fivegene phylogeny of Pezizomycotina. Mycologia 98:1018–1028 Spooner BM, Trigaux G (1985) A new Encoelia (Helotiales) from Prunus spinosa in France. Trans Br Mycol Soc 85:547–552 Stadler M, Læssøe T, Fournier J, Decock C, Schmieschek B, Tichy HV, Peršoh D (2014) A polyphasic taxonomy of Daldinia (Xylariaceae). Stud Mycol 77:1–143 Starbäck, K. (1895) Discomyceten Studien. Bih. K. Svenska Vetensk. Akad. Handl., Afd. 3. 21:19 Stark C, Babik W, Durka W (2009) Fungi from the roots of the common terrestrial orchid Gymnadenia conopsea. Mycol Res 113:952–959 Stone JK, Gernandt DS (2005) A reassessment of Hemiphacidium, Rhabdocline, and Sarcotrochila (Hemiphacidiaceae). Mycotaxon 91:115–126 Suija A, Ertz D, Lawrey JD, Diederich P (2015) Multiple origin of the lichenicolous life habit in Helotiales, based on nuclear ribosomal sequences. Fungal Divers 70:55–72 Tedersoo L, Pärtel K, Jairus T, Gates G, Põldmaa K, Tamm H (2009) Ascomycetes associated with ectomycorrhizas: molecular diversity and ecology with particular reference to the Helotiales. Environ Microbiol 11:3166–3179 Thiers B. (2015) + [continuously updated]: Index herbariorum: a global directory of public herbaria and associated staff. New York Botanical Garden’s Virtual Herbarium. – Published at http://sweetgum.nybg.org/ih/ [accessed 28 Oct 2015] Toju H, Yamamoto S, Sato H, Tanabe AS, Gilbert GS, Kadowaki K (2013) Community composition of root-associated fungi in a Quercus-dominated temperate forest: Bcodominance^ of mycorrhizal and root-endophytic fungi. Ecol Evol 3:1281–1293 219 Torkelsen A-E, Eckblad F-E (1977) Encoelioideae (Ascomycetes) of Norway. Norw J Bot 24:133–149 Tudor D, Margaritescu S, Sánchez-Ramírez S, Robinson SC, Cooper PA, Moncalvo JM (2014) Morphological and molecular characterization of the two known North American Chlorociboria species and their anamorphs. Fungal Biol 118:732–742 van Vloten H, Gremmen J (1953) Studies in the discomycete genera Crumenula de Not. and Cenangium Fr. Acta Bot Neerl 2:226–241 Verkley GJM (1995) Ultrastructure of the ascus apical apparatus in species of Cenangium, Encoelia, Claussenomyces and Ascocoryne. Mycol Res 99:187–199 Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J Bacteriol 172:4238–4246 von Albertini JB, von Schweinitz LD (1805) Conspectus fungorum in lusatiae superioris agro niskiensi crescentium e methodo persooniana. p. 315. Kummerian, Germany von Höhnel F (1923) Fragmente zur Mykologie (XXV. Mitt., Nr. 1215– 1225). Sitzb. Akad. Wissensch. Wien, Math.-nat. Kl. Abt. I 132:89– 118 von Voss, W (1887) Mykologisches aus Krain. Materialien zur Pilzkunde Krains. Verh. Zool.–Bot. Ges. Österreich 37:223 Vralstad T, Myhre E, Schumacher T (2002) Molecular diversity and phylogenetic affinities of symbiotic root-associated ascomycetes of the Helotiales in burnt and metal polluted habitats. New Phytol 155: 131–148 Walker JF, Aldrich-Wolfe L, Riffel A, Barbare H, Simpson NB, Trowbridge J, Jumpponen A (2011) Diverse Helotiales associated with the roots of three species of Arctic Ericaceae provide no evidence for host specificity. New Phytol 191:515–527 Wang Z, Binder M, Schoch CL, Johnston PR, Spatafora JW, Hibbett DS (2006a) Evolution of helotialean fungi (Leotiomycetes, Pezizomycotina): a nuclear rDNA phylogeny. Mol Phylogenet Evol 41:295–312 Wang Z, Johnston PR, Takamatsu S, Spatafora JW, Hibbett DS (2006b) Toward a phylogenetic classification of the Leotiomycetes based on rDNA data. Mycologia 98:1065–1075 Wang Z, Johnston PR, Yang ZL, Towsend JP (2009) Evolution of reproductive morphology in leaf endophytes. PLoS ONE 4:e4246 White TJ, Bruns TD, Lee S, Taylor JW (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand H, Sninsky JS, White TJ (eds) PCR protocols: A guide to methods and applications. Academic Press, San Diego, pp. 315–322 Zhuang W-Y (1988a) A new species of Dencoeliopsis and a synoptic key to the genera of the Encoelioideae (Leotiaceae. Mycotaxon 32:97– 104 Zhuang W-Y (1988b) Studies on some discomycete genera with an ionomidotic reaction: Ionomidotis, Poloniodiscus, Cordierites, Phyllomyces, and Ameghiniella. Mycotaxon 31:261–298 Zhuang W-Y (1988c) A monograph of the genus Unguiculariopsis (Leotiaceae, Encoelioideae. Mycotaxon 32:1–83 Zhuang W-Y, Korf RP (1989) Some new species and new records of discomycetes in China III. Mycotaxon 35:297–312 Zhuang W-Y, Z-H Y, W-P W, Langue C, Fouret N (2000) Preliminary notes on phylogenetic relationships in the Encoelioideae inferred from 18S rDNA sequences. Mycosystema 19:478–484