Mycologia, 104(4), 2012, pp. 845–856. DOI: 10.3852/11-306 2012 by The Mycological Society of America, Lawrence, KS 66044-8897 # Cytological karyotyping and characterization of a 410 kb mini-chromosome in Nectria haematococca MPI Ahmed M. Mahmoud ed squash, pumpkin and cucumber (Tousson and Snyder 1961, Fantino et al. 1989). Historically the name of this fungus has been changed from time to time. Nectria ipomaeae Halst., Hypomyces ipomoeae (Halst.) Wollenw., H. solani f. cucurbitae W.C. Snyder & H.N. Hansen and N. haematococca var. cucurbitae (W.C. Snyder & H.N. Hansen) Dingley all have been applied to the teleomorph. Currently N. haematococca var. cucurbitae is widely used, although there is an opinion that the fungus should be transferred to the genus Haematonectria (Rossman et al. 1999). The correct name for this fungus remains under debate and likely will be changed again as the result of molecular phylogenetic studies, hence the most familiar name, N. haematococca, is used here. The anamorph first was recorded as Fusarium javanicum Koord., and later Fusarium solani f. cucurbitae W.C. Snyder & H.N. Hansen was erected for this fungus, without discrimination of races (Snyder and Hansen 1941). Race 1 and race 2 were separated in this taxon based on differences in pathogenicity (Tousson and Snyder 1961), leading to the current name, F. solani f. sp. cucurbitae races 1 and 2. N. haematococca, on the other hand, is known to comprise several mating populations, MPs I–VII, each probably corresponding to a biological species (Matuo and Snyder 1973, VanEtten and Kistler 1988), of which F. solani f. sp. cucurbitae race 1 belongs to mating population I (MPI). This organism also has been designated as phylogenetic species 10 of Fusarium solani species complex (FSSC 10) (O’Donnell et al. 2008). N. haematococca MPI is heterothallic and produces perithecia readily by artificial crossing in the laboratory. Eight unordered ascospores are formed in a linear array in each ascus and at maturity the ascospores ooze from the ostiole of each perithecium (Georgepoulos 1963, Snyder et al. 1975). Both tetrad and random ascospore analysis are possible by isolating these ascospores. Snyder and his colleagues pioneered conventional genetics of this fungus, in which traits relating to sexual reproduction such as mating type and perithecial color were analyzed (Snyder 1941; Hansen and Snyder 1943, 1946). Subsequently other traits including cultural appearance, heterothallism and tolerance to fungistatic compounds were studied (for reviews see Snyder et al. 1975, VanEtten and Kistler 1988). Although such genetic studies on N. haematococca MPI predated genetic analysis of other plant pathogenic fungi in those days, investigations ceased after 1970. Botany and Microbiology Department, Faculty of Science, Al Azhar University, Assiut (71524), Egypt Graduate school of Natural Science and Technology, Okayama University, 3-1-1 Tsushima-naka, Kita-ku, Okayama 700-8530, Japan Masatoki Taga1 Department of Biology, Faculty of Science, Okayama University, 3-1-1 Tsushima-naka, Kita-ku, Okayama 700-8530, Japan Abstract: Karyotypes of the cucurbit pathogen Nectria haematococca MPI (anamorph Fusarium solani f. sp. cucurbitae race 1) was studied using the two standard strains ATCC18098 and ATCC18099. Complete separation of all chromosomes was difficult with pulsed field gel electrophoresis due to both the large size and co-migration of chromosomes. In contrast, cytological karyotyping was done successfully with fluorescence microscopy combined with the germ tube burst method for sample preparation to visualize mitotic metaphase chromosomes. For each strain the basic chromosome number (CN) was nine, which revises previous chromosome estimates of n 5 4. Chromosomes were morphologically characterized by their sizes, intensely fluorescing segments, and protrusion of rDNA. In addition to the basic chromosome complement, ATCC18098 had a mini-chromosome of ,410 kb present as a single copy in somatic nuclei. Chromosome fluorescence in situ hybridization indicated that this mini-chromosome is not a derivative from the other chromosomes in the genome. In addition, crossing experiments suggested that it was transmitted in a Mendelian manner to the ascospore progeny. Key words: fluorescence in situ hybridization, Fusarium solani, germ tube burst method, minichromosome, rDNA INTRODUCTION Nectria haematococca mating population I (MPI) (anamorph Fusarium solani f. sp. cucurbitae race 1) is the causal agent of fusarium crown and foot rot disease of cucurbits (Tousson and Snyder 1961). It occurs worldwide, causing serious damage to cultivatSubmitted 17 Sep 2011; accepted for publication 1 Jan 2012. 1 Corresponding author. Email: mtaga@cc.okayama-u.ac.jp 845 846 MYCOLOGIA Information on karyotype is essential in genetic analysis, irrespective of whether it is conventional or molecular, as well as whole genome sequencing. Cytological investigations on the karyotype of N. haematococca MPI were done more than 50 y ago, in which the haploid CN of this fungus was estimated to be four, including a large nucleolus-organizing chromosome, two medium chromosomes and one small chromosome (Hirsch 1947, 1949; El-Ani 1954, 1956). Thereafter no additional data have been added to the cytological karyotype of this fungus. Since its introduction in early 1980s, pulsed field gel electrophoresis (PFGE) has replaced cytology in routine karyotyping of fungi. With PFGE, information of the number and size of chromosomal DNA bands separated on a gel are described as electrophoretic karyotype (EK) (for reviews see Mills and McCluskey 1990, Walz 1995). Curiously, EKs of many other N. haematococca including MPII, MPIII, MPIV, MPVI and homothallic strains have been published (Miao et al. 1991, Nazareth and Bruschi 1994, Taga et al. 1998, Suga et al. 2002), whereas the EK of N. haematococca MPI has never been reported. Thus, presently available information of the karyotype of this fungus is only from classical cytology. The success in visualizing fungal mitotic chromosomes by using a cytological method called the germ tube burst (GTBM) (Shirane et al. 1988, Taga and Murata 1994) showed that the previous conventional cytology often is erroneous in counting meiotic chromosomes. The typical example was presented by Taga et al. (1998) with a homothallic strain of N. haematococca. In their study the CN estimated by using conventional meiotic cytology was n 5 6 or 7, whereas the CN by GTBM was n 5 12, even though the same strain was used in both analyses. A similar contradiction also was obtained for Cochliobolus heterostrophus, in which a CN of eight was estimated by conventional meiotic cytology (Guzman et al. 1982), but a CN of 15 or 16 was determined by GTBM (Tsuchiya and Taga 2001). These examples led us to reexamine the karyotype of N. haematococca MPI. In this study we present a reliable karyotype of this important plant pathogen, N. haematococca MPI, by combining PFGE and GTBM. In addition, a minichromosome discovered during karyotyping was analyzed for its cytological nature and meiotic inheritance mode. hermaphrodite that produces red perithecia as a female, and ATCC18099 is a MAT1-2 hermaphrodite with white perithecia. They were maintained on synthetic low nutrient agar (SNA, Nirenberg 1990) at 4 C and grown on potato dextrose agar (PDA) for routine use. Mung bean broth (Gale et al. 2005) and potato dextrose broth (PDB) were used respectively to produce macroconidia and microconidia. V8-juice agar (M-29, Stevens 1974) was used for crossing experiments. Protoplast isolation and preparation of agarose plugs.— Protoplasts were prepared from germinated microconidia as described by Taga et al. (1998) with a modification of enzyme solution (25 mg driselase [Kyowa Hakko, Tokyo], 5 mg cellulase Onozuka RS [Yakult Pharmaceuticals, Tokyo] and 5 mg kitalase [Wako Pure Chemicals, Osaka, Japan] per milliliter 0.8 M MgSO4). Protoplasts released in the enzyme solution were harvested and washed twice by centrifugation at 1000 3 g for 15 min in 0.8 M NaCl. Protoplast-agarose plugs were prepared according to the method of Miao et al. (1991b) with some modifications. Briefly, the pellet of protoplasts was suspended in SE (1 M sorbitol, 50 mM EDTA, pH 8.0) at a concentration of 4–6 3 108/mL, mixed with an equal volume of molten 1% (w/v) low melting point agarose (Bio-Rad, Hercules, California) dissolved in SE and solidified in the molds to make plugs. The plugs were soaked in NDS (0.5 M EDTA, 10 mM TrisHCl, pH 8.0, 1% [w/v] N-lauroylsarcosine sodium salt) at 37 C at least 14 h. After three washes of 30 min each in 50 mM EDTA (pH 8.0), the plugs can be stored in the same solution at 4 C for several years. Micorconidia-agarose plugs that contained microconidia in agarose were prepared by modifying the method of McCluskey et al. (1990) as follows. Budding cells produced by shaking culture in PDB were filtered through one layer of Kimwipe (Cresia, Tokyo) and washed twice with centrifugation in distilled water. TSE buffer (25 mM Tris-HCl, pH 7.5, 1 M sorbitol and 25 mM EDTA, pH 8.0) was added to the final pellets to make conidial suspensions of 0.8–1 3 108/mL. An equal volume of 2.5% (w/v) low melting agarose in TSE was added, mixed and put in the mold of PFGE plug. The solidified plugs were transferred to lysis buffer (1% [w/v] SDS, 1 mg/mL proteinase K and 0.5 M EDTA, pH 8.0) and incubated at 50 C for 24 h with gentle shaking. The plugs were rinsed with 0.5 M EDTA three times 30 min each and stored in fresh 0.5 M EDTA solution at 4 C until use. MATERIALS AND METHODS Pulsed field gel electrophoresis.— A contour-clamped homogenous electric field-type apparatus (CHEF DRII, Bio-Rad) was used for chromosome separation though 0.8% agarose gels (pulsed field certified or chromosome grade agarose, Bio-Rad). The running buffer was 0.5 3 Tris-borate-EDTA (Sambrook et al. 1989), which was kept at 10 C during the runs. Specific conditions for each run were described in the figure legends. Chromosomal DNAs of Saccharomyces cerevisiae and Schizosaccharomyce pombe (Bio-Rad) were used as size markers. Fungal strains and culture.—Two strains of N. haematococca MPI, ATCC18098 and ATCC18099, were obtained from American Type Cultural Collection. ATCC18098 is a MAT1-1 Southern blot hybridization.— Chromosomal DNAs from PFGE gel were alkaline-transferred to Hybond N+ nylon membrane (Amersham Biosciences, Bucks, UK). Briefly, the MAHMOUD AND TAGA: KARYOTYPE OF NECTRIA HAEMATOCOCCA MPI gel was soaked in 0.25 N HCl for 15 min and washed twice with 0.4 N NaOH/1.5 M NaCl for 15 min with gentle shaking. After chromosomal DNAs were transferred onto the membrane with a vacuum-blotting apparatus (Atto, Tokyo) at 0.01 MPa for 1.5 h using 0.25 N NaOH solution, the membrane was rinsed twice with 23 SSC for 15 min with gentle shaking, dried at 80 C for 10 min, and kept in dehydrated condition until use (Sambrook et al. 1989). The telomeric probe was prepared from plasmid pNC36 (Schechtman 1990) containing telomere repeats (TTAGGG)n of Neurospora crassa by excising ,750 bp fragment with HindIII. For probe labeling, hybridization and detection, the AlkPhos direct labeling and detection system (Amersham Biosciences) was used according to the manufacturer’s instructions. Meiotic cytology.—Meiotic chromosomes were observed by the procedure suggested by Raju (1982). Perithecia containing developing asci were placed on a glass slide in a drop of 25% (v/v) glycerol solution and gently crushed with a handmade flexible glass needle under a stereomicroscope to release asci. After removing the perithecial walls and any debris 15 mL 1 mg/mL 49,6-diamidino-2-phenylindole (DAPI) dissolved in antifade mounting solution (Johnson and Nogueira Araujo 1981) was added and samples gently covered with glass without pressing. Observation was made immediately by UV excitation with an epiflourescence microscope (Olympus BH2/BHS-RFC) equipped with a 1003 oil immersion objective lens (N.A. 5 1.3). Fluorescent images were recorded with a digital camera (Olympus C5050-Z) attached to the microscope and processed with Adobe Photoshop 7.0. Mitotic cytology.—Mitotic chromosomes of cytological specimens were prepared either by GTBM (Shirane et al. 1988, Taga et al. 1998) or the dropping method developed in this study. In GTBM, 100 mL macroconidial suspension in PDB (3–5 3 105 conidia/mL) were placed on a clean slide and incubated at 25 C in a humid chamber (Tsuchiya and Taga 2010) 6–7 h until the germ tubes grew to about double the length of the macroconidia. To arrest nuclear division at metaphase conidia were treated with thiabendazole dissolved in PDB at 50 mg/mL for 1 h before the end of incubation (Tsuchiya and Taga 2010). After incubation slides were soaked in distilled water to wash off PDB, wiped with filter paper around the area of the specimen and immersed in fixative (methanol:acetic acid 5 17 : 3 [v/v]) 15–30 min at room temperature. Finally, the slides were flame-dried and stored in dry condition until use. In the dropping method germinated microconidia prepared by gentle overnight shaking in PDB were harvested and washed twice in distilled water by centrifugation. The pelleted germlings were suspended in ice-cold fixative (methanol : acetic acid 5 3 : 1) more than 1 h. A total of 100–150 mL of suspension was gently dropped on the center of a slide preheated to 80 C, then immediately transferred to a hot, humid condition made with a water bath at 60 C. Chromosome spreads of good quality were obtained when dropping distance was 25–30 cm above the slide. Slides were air-dried and stored until use. 847 For chromosome observation, specimens were stained with DAPI at 1 mg/mL or both DAPI and propidium iodide (PI) at 1 mg/mL each (DAPI/PI staining) dissolved in the antifade mounting solution. Observations, photography and image processing were carried out with the same system used for meiotic observation. The measurement of axial length of chromosome was made with ImageJ 1.44 (http://rsbweb.nih.gov/ij/index.html). Fluorescence in situ hybridization (FISH).—Chromosome FISH staining was carried out according to the method of Taga et al. (1999) using the 410 kb chromosomal DNA of ATCC18098 as a probe. To prepare probe DNA protoplastagarose plugs were subjected to PFGE with short-run conditions (FIG. 1B). The agarose blocks containing 410 kb band were excised from the gel and subjected to another run of PFGE with the same condition used for the first run to ensure the purity of DNA. DNA was extracted from the band on the second PFGE gel using GENECLEAN II kit (BIO 101, Vista, California) and amplified by the multiple displacement amplification method (Dean et al. 2002) using REPLI-g kit (QIAGEN, Valencia, California). Finally, DNA was labeled with biotin-14-dATP by nick translation using a BioNick labeling system (Invitrogen, Carlsbad, California). For hybridization detection and counter staining avidin-FITC (Boehringer Mannheim, Indianapolis, Indiana) and DAPI/PI were used. Observation was with a Nikon E600 epifluorescence microscope equipped with UA1A and B-2A cubes. Micrographs were taken with an Olympus DP-70CCD camera attached to the microscope. Ascospore analysis.—Reciprocal crossing between ATCC18098 and ATCC18099 were set up by the modified procedure of VanEtten (1978). Conidia of each strain were spread separately on V8 juice agar in plastic Petri dishes (10 cm diam), and mycelia were allowed to develop by incubating at 22–24 C for 10–15 d under continuous fluorescence lighting. For spermatization, about 10 mL of conidial suspension prepared from the V8 juice plate culture was poured on the mycelia of the strain acting as the female. After 5 min the conidial suspension was drained, and the fertilized cultures were incubated as above 2–3 wk to allow formation of mature perithecia. In random ascospore analysis, ascospore masses oozing from mature perithecia were suspended in distilled water and spread on 4% (w/v) water gelatin plates. Single ascospores were isolated randomly with a handmade flexible glass needle and cultured on PDA slants. For tetrad analysis, mature perithecia from each cross were washed with water to remove any conidia on their surface and squashed with a pair of forceps in a drop of water on the surface of 4% water gelatin plates to release asci. The individual asci were moved to new water gelatin plates. Ascospores were isolated from each ascus with a glass needle and cultured on PDA slants. PCR.—Total DNA as template for PCR was isolated from 3 d old mycelia grown in PDB with the procedure described by Garmaroodi and Taga (2007). For the PCR determination of the mating type (MAT) of progeny, a new primer set (Nh98MAT1-F2, CGCCCTCTGAATGCCTTTAT and Nh98-MAT1-R2, 848 MYCOLOGIA FIG. 1. Pulsed field gel electrophoresis of Nectria haematococca MPI strains ATCC18098 and ATCC18099. A. Separation of chromosomal DNAs below ,6 Mb. Running conditions: 0.8% agarose, 50 V, ramped pulse time 3600– 1800 s, 115 h; 50 V, 1800–1300 s, 24 h; 60 V, 1300–800 s, 24 h; 80 V, 800–600 s, 27 h. B. Separation of small chromosomal DNAs. Running conditions: 200 V, 60 s, 12 h; 90 s, 8 h. C. Southern hybridization analysis with a telomere probe. The gel in FIG. 1B was used for blotting. Sp: Schizosaccharomyces pombe. Sc: Saccharomyces cerevisiae. 98: ATCC18098. 99: ATCC18099. Numbers to the left of each panel indicate DNA sizes. CGCATGATAGGGCAGCAA) was designed for MAT1-1 based on the sequence information of other Fusarium spp. (AJ535625, AF318048, 77-13-7, AY040737, AJ535626, AJ535627, AJ535628). These primers were tested with ATCC18098 and ATCC18099 and several progeny with known MAT. MAT1-2 were amplified with the degenerate primers fusHMG-for (CGACCTCCCAAYGCYTACAT) and fusHMG-rev (TGGGCGGTACTGGTARTCRGG) as described by Kerenyi et al. (2004). PCR amplification was done in 10 mL PCR reaction mixtures containing 1 ng/mL template DNA, 2 mM each of primers, 5 mL GoTaq Green master mix (Promega, Madison, Wisconsin). PCR amplification conditions were: initial denaturation at 94 C for 1 min, followed by 30 cycles of 94 C for 1 min, 60 C for 1 min, and 72 C for 1 min, and a final extension at 72 C for 10 min. Amplification of the expected fragment was analyzed by gel electrophoresis through a 1.2% agarose gels in 13 Tris-Acetate EDTA buffer. RESULTS Electrophoretic karyotyping.—Electrophoretic karyotyping of ATCC18098 and ATCC18099 was attempted using a standard running condition of PFGE suitable to separate chromosomes below ,6 Mb. Two middlesized chromosome bands were clearly resolved, but larger bands were not separable because they exceed the upper limit of resolution (FIG. 1A). The resolved two bands migrated similarly between the two strains, and they were estimated to be ,3.5 Mb and ,2.5 Mb by comparing with size markers assuming that migration of chromosome bands is a linear function of chromosome size. Further attempts were made to separate chromosomes larger than 6 Mb with different running conditions, but chromosomes were clumped in a broad band in the upper region of the gel (data not shown). In addition to these bands, an extra small band was detected in ATCC18098 (FIG. 1A, B). With a standard curve made between migration distance and chromosomal DNA size of S. cerevisiae (data not shown), extra band was calculated to be ca. 410 kb. Southern hybridization of this band with telomere repeats (TTAGGG)n from N. crassa as a probe showed the presence of telemetric repeats within this band (FIG. 1C), suggesting that this band is a chromosome not a huge plasmid. Meiotic observation.—Because meiotic chromosomes in pachytene have been used for karyotyping in conventional fungal cytology we observed pachytene chromosomes in asci obtained from the cross between ATCC18098 and ATCC18099. Pachytene was found unsuitable for karyotyping, however, because observation of individual chromosomes was hampered by the aggregation of elongated chromosomes (FIG. 2A). It was noticed that chromosomes in this stage showed knobs or segments on the chromosome. These structures were intensely stained with DAPI and hence supposedly AT-rich heterochromatin (FIG. 2A). Compared to pachytene, chromosomes in the subsequent stages of meiosis I were more or less discretely separated (FIG. 2B). Nevertheless, reliable karyotyping on such stages seemed difficult due to the clumping of some chromosomes. Chromosomes in meiosis II or post-meiotic mitosis were not suitable either for the same reasons (data not shown). Mitotic karyotyping.—Before karyotyping we optimized methods to visualize mitotic chromosomes by examination of ATCC18098. In chromosome specimens preparation, the dropping method newly developed in this study was compared to GTBM. For staining, DAPI only or double staining with DAPI and PI (DAPI/PI) was tested. The results are summarized (FIG. 3). The dropping method was shown to have some merit in obtaining chromosome specimens at relatively high frequency. However, most specimens prepared by this method were in prophase, containing stretched or elongated chromosomes on which morphological features of most chromosomes was difficult to discern (FIG. 3A, B). In the observation with the dropping method, the mini-chromosome MAHMOUD AND TAGA: KARYOTYPE OF NECTRIA HAEMATOCOCCA MPI FIG. 2. Meiotic chromosomes in the ascus obtained from the cross between Nectria haematococca MPI strains ATCC18098 and ATCC18099. Chromosomes were visualized by DAPI staining. A. Pachytene chromosomes. Elongated chromosomes are aggregated and overlapping. Note heterochromatic knobs on the chromosomes. B. Chromosomes in late diakinesis or early metaphase in meiosis I. Chromosomes are condensed and some of them clumped. Bars 5 1 mm. that corresponds to 410 kb chromosomal DNA band in PFGE (see chromosome painting FISH described below) was slender and rod-like with the terminal knob on each end (FIG. 3A). GTMB, on the other hand, enabled preparation of metaphase chromosomes that were more suitable for karyotyping in terms of the characterization of morphological features of chromosomes (FIG. 3C–E). In GTBM without thiabendazole treatment, the frequency of obtaining metaphase samples was low and some chromosomes tended to stick to each other to hinder chromosome counting (FIG. 3C). In contrast, metaphase frequency was relatively high and fully condensed chromosomes were discretely separated to enable reliable chromosome counting in GTBM with thiabendazole treatment (FIG. 3D, E). DAPI/PI staining highlighted chromosome regions that were differentially stained with these two dyes more clearly than DAPI alone (FIG. 3D, E). Consequently, we decided to use GTBM combined with thiabendazole treatment and DAPI/PI staining for karyotyping. The results are as follows: In both ATCC18098 and ATCC18099, nine chromosomes were routinely 849 FIG. 3. Mitotic chromosomes of Nectria haematococca MPI strain ATCC18098 visualized by different preparation and staining methods. A. DAPI-stained chromosomes in late prophase prepared by the dropping method. B. DAPIstained chromosomes presumably in early metaphase prepared by the dropping method. C. DAPI/PI-stained chromosomes presumably in early metaphase prepared by the germ tube burst method (GTBM) without thiabendazole treatment. D. DAPI-stained chromosomes in midmetaphase prepared by GTBM combined with thiabendazole treatment. E. DAPI/PI-stained chromosomes in midmetaphase prepared by GTBM combined with thiabendazole treatment. The arrows indicate the minichromosome. Bars 5 1 mm. counted with an extra mini-chromosome in ATCC18098. Thus, CNs of ATCC18098 and ATCC18099 were determined to be n 5 10 and n 5 9 respectively. Detailed karyotyping for each strain was attempted with the representative specimen. Chromosomes first were aligned in the order of chromosome size measured in longitudinal axis length and numbered in the decreasing order of size (FIG. 4A). Then, features of each chromosome such as intensely fluorescing segments (IFSs) and the protrusion of rDNA were identified visually, and finally all the data were integrated into idiograms (FIG. 4B). The reproducibility of IFS pattern and protrusion of rDNA among samples was confirmed in each strain with two additional specimens selected from different slides. In ATCC18098, distinct features usable for the instant identification of specific chromosomes were intercalary IFS in chromosome 2, terminal IFS in chromosome 3, protrusion of rDNA in chromosome 5 and 850 MYCOLOGIA FIG. 4. Cytological karyotypes of Nectria haematococca MPI strains ATCC18098 and ATCC18099 with mitotic metaphase chromosomes. Specimens were prepared by the germ tube burst method combined with thiabendazole treatment and stained with DAPI/PI. A. Chromosome spread of nucleus (upper in each panel) and chromosomes arranged by length (lower in each panel). Chromosome alignment was done by cutting each chromosome from the spread image and arranging in the decreasing order of axial length. Numbers 1–10 were assigned to the individual chromosomes. The arrowheads indicate rDNA protrusion on chromosome 5 in both strains. B. Idiograms corresponding to the aligned chromosomes in A. The features of chromosomes detected in A were integrated into the idiograms. Blue, light blue and red represent intensely fluorescing segments, regions with relatively high affinity for DAPI and regions with relatively high affinity for PI respectively. The figures below the idiograms indicate relative percentage values of axial length of each spread. Bars 5 1 mm. intercalary IFS in chromosome 7. The other chromosomes in addition to chromosomes 2, 3, 5 and 7 also were identifiable based on the combination of IFS and chromosome length as illustrated in the idiogram. Among the chromosome complements, chromosome 5 was designated as NOR chromosome because rDNA is referred to as nuclear organizer region (NOR) in terms of its function. Although chromosome 10 was too small (ca. 0.4–0.6 mm long) to recognize IFS inside, the whole chromosome was stained more with DAPI than with PI, suggesting that this chromosome is relatively AT rich. In ATCC18099, distinct features as the markers for rapid identification of specific chromosomes were intercalary IFS in chromosome 3, terminal IFS in chromosome 4, protrusion of rDNA in chromosome 5 and intercalary IFS in chromosome 7. Chromosomes 1, 2 and 6 were identifiable by the distribution patterns of IFS combined with chromosome length. Chromosomes 8 and 9 could be distinguished in that they were the smallest and did not have IFS, but distinction between these two chromosomes was difficult. Comparing the two karyotypes, chromosome 1 of each strain and chromosomes 3 and 7 of ATCC18098 MAHMOUD AND TAGA: KARYOTYPE OF NECTRIA HAEMATOCOCCA MPI FIG. 5. Chromosome staining fluorescence in situ hybridization using 410 kb chromosomal DNA as probe. A. Hybridization on the interphase nucleus of ATCC18098. The arrow indicates 410 kb mini-chromosome with dot-like shape in interphase. B. DAPI-stained image of the same nucleus as in A. C. Overlaid image of A and B. The arrow indicates 410 kb mini-chromosome. Note that the minichromosome does not coincide with highly AT-rich and condensed regions. D. Hybridization on the metaphase chromosomes of ATCC 18098. The arrow indicates the mini-chromosome stained by the probe. Note that the other chromosomes were not stained. E, F. Hybridization on the interphase nucleus (E) and metaphase chromosomes (F) of ATCC18099. In contrast to ATCC18098, no signals were detected. Bars 5 1 mm. and chromosomes 4 and 7 of ATCC18099 seemed to be homologous as indicated by the idiograms. In contrast, the other chromosomes were not homologous judging from the difference in IFS. Chromosome 5 in each strain typically had an rDNA protrusion at its end, but the two chromosomes were different from each other in the occurrence of intercalary IFS. Putting aside IFS, relative ratio of chromosome length among the complements were somewhat similar between the two strains except chromosome 5. Chromosome staining FISH of mini-chromosome.— Chromosome staining FISH using the 410 kb chromosomal DNA band of ATCC18098 as a probe was carried out on the specimens of the two strains. The probe hybridized to a single spot in the interphase nucleus of strain ATCC 18098, proving that the 410 kb band is linked to DNA in the nucleus not in the cytoplasm (FIG. 5A–C). The probe also hybridized to the mini-chromosome in the mitotic specimen (FIG. 5D). In either case, hybridization signals were not detected elsewhere. For strain ATCC18099, no signals were detected in interphase nuclei or in chromosomes spread (FIG. 5E, F). These results confirmed that the 410 kb band on the PFGE gel 851 FIG. 6. Detection of the mini-chromosome in ascospore progenies by pulsed field gel electrophoresis with microconidia-agarose plugs. Lanes 1–6 represent six ascospore progenies isolated from the single ascus. The bands representing the mini-chromosome are recognized in lanes 1–4 but not in 5 and 6. Note that no large difference in band size is recognized among lanes 1–4. Running conditions were: 0.8% agarose, 180 V with constant pulse time of 120 s for 12 h and 180 s for 8 h. Saccharomyces cerevisiae (Sc) was used as DNA size standard. Numbers to the left of each panel indicate DNA sizes. represents the mini-chromosome detected in cytological observation and that it is not the derivative of other A chromosomes of either strains. The dot-like appearance of signals in the interphase nucleus indicates that the mini-chromosome is not decondensed but more or less condensed even in interphase. Inheritance of mini-chromosome through sexual crossing.—The mode of inheritance of the mini-chromosome in sexual crosses was studied by tetrad and random ascospore analysis with ascospores obtained from reciprocal crossings between ATCC18098 and ATCC18099. To detect mini-chromosomes in the progeny microconidia-agarose plugs instead of protoplast-agarose plugs were used in PFGE because of the relatively simple procedure of plug preparation. With these plugs, the bands representing mini-chromosome were separated at the expected position throughout the study, which suggested that the mini-chromosome did not undergo chromosome rearrangements during meiosis (FIG. 6). In addition to presence of the mini-chromosome, MAT and the perithecial color were determined in both types of ascospore analyses to check whether segregation in sexual crosses was normal for the other chromosomes. In tetrad analysis, many sets of eight ascospores were isolated from asci but no complete tetrads (or more precisely, octads) were obtained, perhaps due to failure of ascospore germination. Consequently a 852 MYCOLOGIA TABLE I. Unordered tetrad analysis for the segregation of 410 kb mini-chromosome Observed ratio Crossing (female 3 male) : number asci analyzed 3+ : 42 4+ : 22 3+ : 32 3+ : 32 ATCC18099 ATCC18098 ATCC18099 ATCC18098 3 3 3 3 ATCC18098 ATCC18099 ATCC18098 ATCC18099 : : : : 1 1 4 5 Speculated ratioa 4+ : 42 4+ : 42 4+ : 42 4+ : 42 a Speculated ratio in the reconstructed complete tetrad. +, 410 kb mini-chromosome detected; 2, 410 kb mini-chromosome not detected. total of 11 incomplete tetrads with six or seven germinated ascospores were subjected to analyses by deducing the phenotypes of ungerminated ascospores. The reconstruction of full tetrad was based on the assumption that each of the four meiotic products was duplicated by post-meiotic mitosis to yield eight ascospores in an ascus. Irrespective of whether the mini-chromosome was transmitted from female or male, each of the reconstructed tetrads showed 4 : 4 segregation for the occurrence and absence of mini-chromosome, suggesting that this chromosome was inherited in a Mendelian manner (TABLE I). In random ascospore analysis a total of 90 ascospores were analyzed for the segregation of mini-chromosome in each of the reciprocal crossings (TABLE II). A chi-square test supported the inference that progeny with and without the mini-chromosome segregated in 1 : 1 in each cross, again suggesting Mendelian inheritance of this chromosome. Random assortment between the mini-chromosome and other chromosomes during meiosis subsequently were examined with MAT and perithecial color as the markers. In our preliminary experiments these two traits were shown to be controlled by single genes and independently inherited (data not shown). With 40 ascospores selected randomly from each cross, linkage analysis showed that the mini-chromosome segregated independently from either trait. This indicates random assortment of the mini-chromosome and the other two chromosomes. It is probable that the same relationship exists between the minichromosome and the rest of the chromosomes in the genome. DISCUSSION In this study CN of two strain N. haematococca MPI was determined to be 10 for ATCC18098 and nine for ATCC18099 by mitotic cytology with GTBM. These CNs are in marked contrast to the estimate of n 5 4 for this fungus that was obtained by conventional meiotic cytology (Hirsch 1947, 1949; El-Ani 1954, 1956). Although variation of CN is known to occur even among strains in the same fungal species (reviewed in Zolan 1995), this great discrepancy in CN between the two types of cytology is not reasonably explained by the difference of strains in this and previous studies. Considering the high quality of our specimens and the proven reliability of GTBM for chromosome counting (Taga et al. 1998, Akamatsu et al. 1999, Tsuchyia and Taga 2001, Eusebio-Cope et al. 2009), our estimate is thought to represent correct CNs for this fungus. Such discrepancy in chromosome counting has been reported by Taga et al. (1998) with homothallic strains of N. haematococca, in which clustering of chromosomes in meiosis was suggested to cause underestimation of CN. Correct chromosome counting by meiotic cytology was concluded to be difficult for C. heterostrophus due to poor spreading or separation of chromosomes (Raju 2008). These examples of Nectria and Cochliobolus indicate that meiotic chromosome counting is not reliable unless separation of chromosomes in the specimen is assured. Because we observed aggregation or clumping of chromosomes in pachytene and diakinesis/ early metaphase of meiosis I it is likely that the clustered chromosomes were counted as one chromosome as a whole to result in underestimation in the previous studies. In recent fungal karyotyping PFGE has replaced cytology because it is much easier to perform than cytology and can be applied to almost all fungi. However, PFGE has a demerit in that large chromosomes beyond upper resolution limit or chromosomes of similar size are difficult to analyze with this technique. In this study we abandoned obtaining EK of N. haematococca MPI because some large chromosomes were clumped in a broad band and could not be separated with the conditions we tested. Neither genetic linkage map nor physical map that represents individual chromosomes to serve as the source of chromosome-specific markers presently are available in this fungus. Therefore, identification of individual chromosomes in the clumped band as has been done for N. crassa (Orbach et al. 1988) and Manaporthe grisea (Orbach et al. 1996) was difficult for this Random ascospore analysis for the segregation of 410 kb mini-chromosome Segregation Cross (female 3 male) ATCC18099 3 ATCC18098 mini-chromosome mini-chromosome, mating type mini-chromosome, perithecial color mini-chromosome, mating type, perithecial color ATCC18098 3 ATCC18099 mini-chromosome mini-chromosome, mating type mini-chromosome, perithecial color mini-chromosome, mating type, perithecial color a a 2a Total 48 MAT1-1:MAT1-2 5 12 : 13 red : white 5 13 : 12 MAT1-1, red : white 5 7 : 5 MAT1-2, red : white 5 6 : 7 42 MAT1-1:MAT1-2 5 8 : 7 red : white 5 5 : 10 MAT1-1, red : white 5 3 : 5 MAT1-2, red : white 5 2 : 5 90 40 40 40b (1 : 1) (1 : 1 : 1 : 1) (1 : 1 : 1 : 1) (1 : 1 : 1 : 1 : 1 : 1 : 1 : 1) 0.50 0.25 0.25 0.50 , , , , P P P P , , , , 0.75 0.50 0.50 0.75 52 MAT1-1:MAT1-2 5 9 : 10 red : white 5 10 : 9 MAT1-1, red : white 5 5 : 4 MAT1-2, red : white 5 5 : 5 38 MAT1-1:MAT1-2 5 9 : 12 red : white 5 8 : 13 MAT1-1, red : white 5 4 : 5 MAT1-2, red : white 5 4 : 8 90 40 40 40c (1 : 1) (1 : 1 : 1 : 1) (1 : 1 : 1 : 1) (1 : 1 : 1 : 1 : 1 : 1 : 1 : 1) 0.10 0.75 0.50 0.95 , , , , P P P P , , , , 0.25 0.90 0.75 0.90 + Chi-square test +, mini-chromosome detected; 2, mini-chromosome not detected. Segregation frequencies between mating type and perithecial color were: MAT1-1,red:MAT1-1,white: MAT1-2,red:MAT1-2,white 5 10 : 10 : 8 : 12. P of x2 test (1 : 1 : 1 : 1) is .0.9, indicating independent segregation of the two traits. c Segregation frequencies between mating type and perithecial color were: MAT1-1,red:MAT1-1,white: MAT1-2,red:MAT1-2,white 5 9 : 9 : 9 : 13. P of x2 test (1 : 1 : 1 : 1) is .0.9, indicating independent segregation of the two traits. b MAHMOUD AND TAGA: KARYOTYPE OF NECTRIA HAEMATOCOCCA MPI TABLE II. 853 854 MYCOLOGIA fungus. The absence of EK for this fungus in past studies may be explained similarly. Compared to PFGE, cytology has merits in that it does not have a size limitation for chromosomes and in that it is feasible to discover morphological characters chromosomes. Such merits of cytology have been well exemplified in performing mitotic cytology with GTBM for F. gramineanum whose genome consists of four large chromosomes exceeding 7 Mb (Gale et al. 2005) and also for Cryphonectria parasitica that contains five similar-sized chromosomes in its genome (Eusebio-Cope et al. 2009). This study presents an additional example of the value of cytology for fungal karyotyping. While cytological information is meaningful in its own, it is also useful in complementing PFGE. For instance, the 3.5 Mb and 2.5 Mb chromosomal bands separated by PFGE in both ATCC18098 and ATCC18099 were uncertain as to their state as singlets or doublets. With the result of cytology that both strains have two pairs of small, similar-sized chromosomes, that is chromosomes 6 and 7 as one pair and chromosome 8 and 9 as another pair, each of these two bands is deducible to be doublet. In cytological karyotyping IFS and rDNA served as the useful morphological markers for the identification of chromosomes. Regarding IFS, four chromosomes out of nine were identified in each strain by noticing intercalary or terminal IFS. IFS first was used for cytological karyotyping in C. parasitica and regarded as AT-rich constitutive heterochromatin by actinomycin D/DAPI staining (Eusebio-Cope et al. 2009). Although we used DAPI/PI staining here, IFS of N. haematococca MPI also is presumed to be constitutive heterochromatin because DAPI/PI staining worked similarly to actinomycin D/DAPI to reveal heterochromatin in C. parasitica. An intriguing finding about IFS in this study was that distribution of IFS on the chromosomes was significantly different between ATCC18098 and ATCC18099. Chromosome rearrangements obviously could be a potent cause of such difference because they occur ubiquitously among strains in filamentous fungi (Kistler and Miao 1992, Zolan 1995). However, the big difference in the number of IFS between the two strains (i.e. 20 in ATCC18098 except 450 kb mini-chromosome vs. 10 in ATCC18099 as shown in FIG. 4B) seems difficult to explain solely by the chromosome rearrangements such as deletion or duplication. Preferential amplification of heterochromatin in ATCC18098 may be involved in this difference. As to rDNA, it appeared as a thread-like protrusion from the apex of chromosome 5 in both strains, and hence chromosome 5 was designated as NOR chromosome. This observation is not compatible with the report of El-Ani (1956) that the NOR chromosome was the largest in the genome. The morphological feature of rDNA in the shape of its protrusion is not unique to N. haematococca MPI. A similar appearance of rDNA has been observed in GTBM-prepared chromosome specimens of other fungi, and its entity as rDNA or NOR was proven by FISH (Shirane et al. 1988; Taga and Murata 1994; Taga et al. 1998, 2003; Akamatsu et al. 1999). Of interest, NOR chromosomes of N. haematococca MPVI and homothallic N. haematococca were also the fourth or fifth largest among 12–17 chromosome complements (Taga et al. 1998). This study showed that strain ATCC18098 contains a mini-chromosome of ca. 410 kb by PFGE and cytology. The smallest records of fungal chromosomes visualized under a light microscope are 245 kb meiotic chromosomes of S. cerevisiae (Kuroiwa et al. 1984) and 350 kb mitotic chromosome of Mycosphaerella graminicola (Mehrabi et al. 2007). Therefore this 410 kb mini-chromosome is the third smallest ever seen by light microscopy. Minute chromosomes like this 410 kb mini-chromosome that is present in certain strains are usually regarded as dispensable (Covert 1998). In this study dispensability of this mini-chromosome was not shown by deleting it from the host strain ATCC18098. However, this chromosome is highly likely to be dispensable based on the fact that every ascospore progeny obtained in tetrad and random ascospore analyses grew similarly on media irrespective of the presence of the minichromosome. Combining this with the facts that both strains have karyotypes with similar chromosome complements, except the 410 kb mini-chromosome and the mini-chromosome, is extremely small compared with others, it is thought to be reasonable to conclude its dispensability and that the basic CN for this fungus is nine. An intriguing question is whether this chromosome is a conditionally dispensable (CD) chromosome that contains functional genes and can confer adaptive advantages to the host fungus (Miao et al. 1991, Covert 1998). Our FISH results showed that this chromosome is not a derivative of any other chromosome in the genome. At least in this respect it resembles the CD chromosomes of N. haematococca MPVI (Taga et al. 1999, Garmaroodi and Taga 2007) and Alternaria alternata (Y Akagi pers comm), in which chromosome painting FISH with the DNA from CD chromosome yielded the same results as that obtained here. Further analysis for the occurrence of functional genes and effects on the traits of host strain is necessary to confirm that it is a true CD chromosome. Tetrad analysis in this study suggested that the 410 kb mini-chromosome was transmitted in a Mendelian manner in crosses between ATCC18098 and MAHMOUD AND TAGA: KARYOTYPE OF NECTRIA HAEMATOCOCCA MPI ATCC18099. Two explanations are possible. One is that the two sister chromatids moved to one pole in meiosis I, followed by the separation of sister chromatids in meiosis II to yield a 2 : 2 ratio for the occurrence and absence of the chromosome in a tetrad. The other is that sister chromatids separated at meiosis I instead of meiosis II in a manner called pre-division or premature centromere division. Examples of such division have been reported in fungi (Fulton and Bond 1983) and animals (Angell 1991). We tried to distinguish between the two hypotheses cytologically but failed due to the difficulty to discern the min-chromosome in the cluster of meiotic chromosomes (unpubl). In conclusion, defined cytological karyotypes of the two standard strains of N. haematococca MPI were obtained in this study. The information presented here should be useful not only for future genetic studies including linkage mapping and analysis of karyotype polymorphism in the populations but also for a genome project on this fungus. In addition, the 410 kb mini-chromosome discovered in this study will serve as an attractive model for studying the origin and function of fungal mini-chromosome. ACKNOWLEDGMENTS Ahmed M. Mahmoud was supported by scholarship No. 55/ 5/1 from the Egyptian Ministry of Higher Education. LITERATURE CITED Akamatsu H, Taga M, Kodama M, Johnson R, Otani H, Kohmoto K. 1999. Molecular karyotypes for Alternaria plant pathogens known to produce host-specific toxins. Curr Genet 35:647–656, doi:10.1007/s002940050464 Angell RR. 1991. Predivision in human oocytes at meiosis I: a mechanism for trisomy formation in man. Hum Genet 86:383–387, doi:10.1007/BF00201839 Covert SF. 1998. Supernumerary chromosomes in filamentous fungi. Curr Genet 33:311–319, doi:10.1007/ s002940050342 Dean FB, Hosono S, Fang L, Wu X, Faruqi AF, Bray-Ward P, Sun Z, Zong Q, Du Y, Du J, Driscoll M, Song W, Kingsmore SF, Egholm M, Lasken RS. 2002. Comprehensive human genome amplification using multiple displacement amplification. Proc Natl Acad Sci USA 99: 5261–5266. El-Ani AS. 1954. Chromosomes of Hypomyces solani f. cucurbitae. Science 120:323–324, doi:10.1126/science.120.3112.323 ———. 1956. Ascus development and nuclear behavior in Hypomyces solani f, cucurbitae. Am J Bot 43:769–778, doi:10.2307/2438991 Eusebio-Cope A, Suzuki N, Sadeghi-Garmaroodi H, Taga M. 2009. Cytological and electrophoretic karyotyping of the chestnut blight fungus Cryphonectria parasitica. Fungal Genet Biol 46:342–351, doi:10.1016/j.fgb. 2009.01.005 855 Fantino MG, Fantuz F, Gennari S. 1989. Study of squash rot caused by F. solani f. sp. cucurbitae. Difesa delle piante 12:147–153. Fulton AM, Bond DJ. 1983. An investigation into the origins of meiotic aneuploid using ascus analysis. Genet Res 41: 165–179, doi:10.1017/S0016672300021200 Gale LR, Bryant JD, Calvo S, Giese H, Katan T, O’Donnell K, Suga H, Taga M, Usgaard TR, Ward TJ, Kistler H. 2005. Chromosome complement of the fungal pathogen Fusarium graminearum based on genetic and physical mapping and cytological observations. Genetics 171: 985–1001, doi:10.1534/genetics.105.044842 Garmaroodi HS, Taga M. 2007. Duplication of a conditionally dispensable chromosome carrying pea pathogenicity (PEP) gene clusters in Nectria haematococca. Mol Plant-Microbe Interact 20:1495–1504, doi:10.1094/ MPMI-20-12-1495 Georgopoulos SG. 1963. Genetic markers and linkage relationships from tetrad data in Hypomyces solani f. cucurbitae. Can J Bot 41:649–659, doi:10.1139/b63-052 Guzman D, Garber RC, Yoder OC. 1982. Cytology of meiosis I and chromosome number of Cochliobolus heterostrophus (Ascomycetes). Can J Bot 60: 1138– 1141, doi:10.1139/b82-143 Hansen HN, Snyder WC. 1943. The dual phenomenon and sex in Hypomyces solani f. cucurbitae. Am J Bot 30:419– 422, doi:10.2307/2437209 ———, ———. 1946. Inheritance of sex in fungi. Proc Natl Acad Sci USA 32:272–273, doi:10.1073/pnas.32.10.272 Hirsch HE. 1947. Cytological phonomena and sex in Hypomyces solani f. cucurbitae. Proc Natl Acad Sci USA 33:268–270, doi:10.1073/pnas.33.9.268 ———. 1949. The cytogenetics of sex in Hypomyces solani f. cucurbitae. Am J Bot 36:113–121, doi:10.2307/2438128 Johnson GD, de Nogueira Araujo GM. 1981. A simple method of reducing the fading of immunofluorescence during microscopy. J. Immunol Meth 43:349–350, doi:10.1016/0022-1759(81)90183-6 Kerenyi Z, Moretti A, Waalwijk C, Olah B, Hornok L. 2004. Mating type sequences in asexually reproducing Fusarium species. Appl Environ Microbiol 70:4419– 4423, doi:10.1128/AEM.70.8.4419-4423.2004 Kistler HC, Miao VPW. 1992. New modes of genetic change in filamentous fungi. Annu Rev Phytopathol 30:131– 152. Kuroiwa T, Kojima H, Miyakawa I, Sando N. 1984. Meiotic karyotype of the yeast Saccharmyces cerevisiae. Exp Cell Res 153:259–256, doi:10.1016/0014-4827(84)90469-5 Matuo T, Snyder WC. 1973. Use of morphology and mating populations in the identification of formae speciales in Fusarium solani. Phytopathology 63:562–565, doi:10. 1094/Phyto-63-562 McCluskey K, Russel BW, Mills D. 1990. Electrophoretic karyotyping without the need for generating protoplasts. Curr Genet 18:385–386, doi:10.1007/BF00318221 Mehrabi R, Taga M, Kema GHJ. 2007. Electrophoretic and cytological karyotyping of the foliar wheat pathogen Mycosphaerella graminicola reveals many chromosomes with a large size range. Mycologia 99:868–876, doi:10.3852/mycologia.99.6.868 856 MYCOLOGIA Miao VPW, Covert SF, VanEtten HD. 1991a. A fungal gene for antibiotic resistance on a dispensable (B) chromosome. Science 254:1773–1776, doi:10.1126/science. 1763326 ———, Matthews DE, VanEtten HD. 1991b. Identification and chromosomal locations of a family of cytochrome P-450 genes for pisatin detoxification in the fungus Nectria haematococca. Mol Gen Genet 226:214–223. Mills D, McCluskey K. 1990. Electrophoretic karyotypes of fungi: the new cytology. Mol Plant-Microbe Interact 3: 351–357, doi:10.1094/MPMI-3-351 Nazareth SW, Bruschi CV. 1994. Electrophoretic karyotype of Fusarium solani. Microbiology 140:1373–1375, doi:10.1099/00221287-140-6-1373 Nirenberg HI. 1990. Recent advances in the taxonomy of Fusarium. Stud Mycol 32:91–101. O’Donnell K, Sutton DA, Fothergill A, McCarthy D, Rinaldi MG, Brandt ME, Zhang N, Geiser DM. 2008. Molecular phylogenetic diversity, multilocus haplotype nomenclature, in vitro antifungal resistance within the Fusarium solani species complex. J Clinical Microbiol 46:2477– 2490, doi:10.1128/JCM.02371-07 Orbach MJ, Chumley FG, Valent B. 1996. Electrophoretic karyotype of Magnaporthe grisea pathogens of diverse grasses. Mol Plant Microbe Interact 9:261–271, doi:10.1094/MPMI-9-0261 ———, Vollrath D, Davis RW, Yanofsky C. 1988. An electrophoretic karyotype of Neurospora crassa. Mol Cell Biol 8:1469–1473. Raju NB. 1982. Easy methods for fluorescent staining of Neurospora nuclei. Neurospora Newslett 29:24–26. ———. 2008. Meiosis and ascospore development in Cochliobolus heterostophus. Fungal Genet Biol 45:554– 564, doi:10.1016/j.fgb.2007.08.007 Rossman A, Samuels G, Rogerson C, Lowen R. 1999. Genera of Bionectriaceae, Hypocreaceae and Nectriaceae (Hypocreales, Ascomycetes). Stud Mycol 42:1–248. Sambrook J, Fritsch EF, Maniatis TA. 1989. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory. Schechtman MG. 1990. Characterization of telomere DNA from Neurospora crassa. Gene 88:159–165, doi:10.1016/ 0378-1119(90)90027-O Shirane N, Masuko M, Hayashi Y. 1988. Light microscopic observation on nuclei and mitotic chromosomes of Botrytis species. Phytopathology 79:728–730, doi:10.1094/Phyto79-728 Snyder WC. 1940. White perithecia and the taxonomy of Hypomyces ipomoeae. Mycologia 32:646–648. ———, Georgopoulos SG, Webster RK, Smith SN. 1975. Sexuality and genetic behavior in the fungus Hypomyces (Fusarium) solani f. sp. cucurbitae. Hilgardia 43:161– 185. ———, Hansen HN. 1941. The species concept in Fusarium with reference to section Martiella. Am J Bot 28:738– 742, doi:10.2307/2436688 Stevens RB. 1974. Mycology guidebook. Seattle: Univ. Washington Press. 703 p. Suga H, Ikeda S, Taga M, Kageyama K, Hyakumachi M. 2002. Electrophoretic karyotyping and gene mapping of seven formae speciales in Fusarium solani. Curr Genet 41:254–260, doi:10.1007/s00294-002-0303-1 Taga M, Murata M. 1994. Visualization of mitotic chromosomes in filamentous fungi by fluorescence staining and fluorescence in situ hybridization. Chromosoma 103:408–413, doi:10.1007/BF00362285 ———, ———, Saitoh H. 1998. Comparison of different karyotyping methods in filamentous ascomycetes—a case study of Nectria haematococca. Mycol Res 102:1355– 1364, doi:10.1017/S0953756298006455 ———, ———, VanEtten HD. 1999. Visualization of a conditionally dispensable (CD) chromosome in the filamentous ascomycetes Nectria haematococca by fluorescence in situ hybridization. Fungal Genet Biol 26: 169–177, doi:10.1006/fgbi.1999.1123 ———, Tsuchiya D, Murata M. 2003. Dynamic changes of rDNA condensation state during mitosis in filamentous fungi revealed by fluorescence in situ hybridization. Mycol Res 107:1012–1020, doi:10.1017/S0953756203008244 Toussoun TA, Snyder WC. 1961. The pathogenicity, distribution and control of two races of Fusarium (Hypomyces) solani f. cucurbitae. Phytopathology 51:17–22. Tsuchiya D, Taga M. 2001. Cytological karyotyping of three Cochliobolus spp. by the germ tube burst method. Phytopathology 91:354–360, doi:10.1094/PHYTO.2001.91.4.354 ———, ———. 2010. Fluorescence in situ hybridization for molecular cytogenetic analysis in filamentous fungi. In: Amir S, ed. Molecular and cell biology methods for fungi. Methods in molecular biology. New York: Humana Press, Springer Science + Business Media. 638 p. VanEtten HD. 1978. Identification of additional habitats of Nectria haematococca mating population VI. Phytopathology 68:1552–1556, doi:10.1094/Phyto-68-1552 ———, Kistler HC. 1988. Nectria haematococca mating population I and VI. In: Sidhu GS, ed. Advances in plant pathology. Vol. 6. Genetics of plant pathogenic fungi. London: Academic Press. Walz M. 1995. Electrophoretic karyotyping. In: Kuck L, ed. Genetics and biotechnology. Mycota II: 61–73. Zolan ME. 1995. Chromosome-length polymorphism in fungi. Microbiol Mol Biol Rev 59:686–698.