Differential protein expression in Colletotrichum acutatum: changes associated with reactive oxygen species and nitrogen starvation implicated in pathogenicity on strawberry

Sigal Brown Horowitz

The cellular outcome of changes in nitrogen availability in the context of development and early stages of pathogenicity was studied by quantitative analysis of two-dimensional gel electrophoresis of Colletotrichum acutatum infecting strawberry. Significant alterations occurred in the abundance of proteins synthesized during appressorium formation under nitrogen-limiting conditions compared with a complete nutrient supply. Proteins that were up- or down-regulated were involved in energy metabolism, nitrogen and amino acid metabolism, protein synthesis and degradation, response to stress and reactive oxygen scavenging. Members belonging to the reactive oxygen species (ROS) scavenger machinery, superoxide dismutase and glutathione peroxidase, were up-regulated at the appressorium formation stage, as well as under nitrogen-limiting conditions relative to growth with a complete nutrient supply, whereas abundance of bifunctional catalase was up-regulated predominantly at the appressorium formation stage. Fungal ROS were detected within germinating conidia during host pre-penetration, penetration and colonization stages, accompanied by plant ROS, which were abundant in the apoplastic space. Application of exogenous antioxidants quenched ROS production and reduced the frequency of appressorium formation. Up-regulation in metabolic activity was detected during appressorium formation and nutrient deficiency compared with growth under complete nutrient supply. Enhanced levels of proteins related to the glyoxylate cycle and lipid metabolism (malate dehydrogenase, formate dehydrogenase and acetyl-CoA acetyltransferase) were observed at the appressorium formation stage, in contrast to down-regulation of isocitrate dehydrogenase. The present study demonstrates that appressoria formation processes, occurring under nutritional deprivation, are accompanied by metabolic shifts, and that ROS production is an early fungal response that may modulate initial stages of pathogen development.

MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 DOI: 10.1111/J.1364-3703.2007.00454.X Blackwell Publishing Ltd Differential protein expression in Colletotrichum acutatum: changes associated with reactive oxygen species and nitrogen starvation implicated in pathogenicity on strawberry S I G A L H O R O W I T Z B R O W N 1 , 2 , O D E D YA R D E N 1 , N ATA N G O L L O P 3 , S O N G B I C H E N 3 , A I D A Z V E I B I L 2 , E D UA R D B E L AU S OV 2 A N D S TA N L E Y F R E E M A N 2 , * 1 Department of Plant Pathology and Microbiology, Faculty of Agricultural, Food and Environmental Quality Sciences, The Hebrew University of Jerusalem, Rehovot 76100, Israel 2 Department of Plant Pathology and Weed Research and 3Department of Food Science, ARO, The Volcani Center, Bet Dagan 50250, Israel S U M M A RY The cellular outcome of changes in nitrogen availability in the context of development and early stages of pathogenicity was studied by quantitative analysis of two-dimensional gel electrophoresis of Colletotrichum acutatum infecting strawberry. Significant alterations occurred in the abundance of proteins synthesized during appressorium formation under nitrogen-limiting conditions compared with a complete nutrient supply. Proteins that were up- or down-regulated were involved in energy metabolism, nitrogen and amino acid metabolism, protein synthesis and degradation, response to stress and reactive oxygen scavenging. Members belonging to the reactive oxygen species (ROS) scavenger machinery, superoxide dismutase and glutathione peroxidase, were up-regulated at the appressorium formation stage, as well as under nitrogen-limiting conditions relative to growth with a complete nutrient supply, whereas abundance of bifunctional catalase was up-regulated predominantly at the appressorium formation stage. Fungal ROS were detected within germinating conidia during host pre-penetration, penetration and colonization stages, accompanied by plant ROS, which were abundant in the apoplastic space. Application of exogenous antioxidants quenched ROS production and reduced the frequency of appressorium formation. Up-regulation in metabolic activity was detected during appressorium formation and nutrient deficiency compared with growth under complete nutrient supply. Enhanced levels of proteins related to the glyoxylate cycle and lipid metabolism (malate dehydrogenase, formate dehydrogenase and acetyl-CoA acetyltransferase) were observed at the appressorium formation stage, *Correspondence: Tel.: 972 3 9683537; Fax: 972 3 9683532; E-mail: Freeman@volcani.agri.gov.il Nucleotide sequence data reported here are available in the GenBank database under accession numbers EF100120 (sod1), EF100121 (cat2), EF100122 (20S proteasome subunit alpha) and EF100123 (hsp70). © 2007 BLACKWELL PUBLISHING LTD in contrast to down-regulation of isocitrate dehydrogenase. The present study demonstrates that appressoria formation processes, occurring under nutritional deprivation, are accompanied by metabolic shifts, and that ROS production is an early fungal response that may modulate initial stages of pathogen development. INTRODUCTION Colletotrichum acutatum Simmonds, with its broad geographical host range, is the primary causal agent of strawberry anthracnose, causing petiole, stolon, crown fruit and root infections (Freeman and Katan, 1997; Kenneth et al., 2002). Under nutritional limitation, conidia germinate on the plant surface and develop an adjacent appressorium, breach host tissue via an emerging penetration peg, and enter the cuticle, cell wall and cell, where an infection vesicle forms. Penetrating mycelia originating from the infection vesicle grow and acquire nutrients from the host (Leandro et al., 2001; O’Connell et al., 2000). Although C. acutatum is a generalist invader, the fungus possesses a very brief (less than 12 h) symptomless biotrophic phase before entering the extended necrotrophic phase, which involves major nutritional changes (Horowitz et al., 2002; Kenneth et al., 2002). The switch in fungal lifestyle is attributed to lack of nutrients, one of the signals controlling the expression of genes involved in pathogenicity. Recent studies on C. acutatum infecting strawberry have indicated that a defect in the nir1-like transcription factor involved in nitrogen metabolism confers morphological abnormalities and lack of pathogenicity (Horowitz et al., 2006). This study also determined that the effect of nitrogen starvation on virulence is stage-specific and that nitrogen availability is a dominant factor in directing fungal morphogenesis. Nitrogen utilization in fungi is a tightly regulated process that confers the ability to take up nitrogen from a variety of sources when preferred substrates are lacking, 171 172 S. H. BROWN et al. while efficient regulation of this process most likely allows fungi to colonize the infected host plant (Pellier et al., 2003). For example, in Colletotrichum lindemuthianum , targeted gene disruption of CLNR1, the AREA-NIT2-like global nitrogen regulator, results in reduced pathogenicity (Pellier et al., 2003). Moreover, nitrogen starvation induces fungal gene expression during plant infection in a variety of pathogens (Divon et al., 2005; Divon and Fluhr, 2007; Donofrio et al., 2006; Snoeijers et al., 2000). Results obtained with Fusarium oxysporum indicate that the global nitrogen regulator FNR1 regulates fungal nutrition genes and fitness during pathogenesis on tomato (Divon et al., 2006). The ability to adapt to changes in nutrient availability is an essential attribute of many successful pathogens. Protein analysis has been successfully used for the study of various developmental trends in filamentous fungi of economic interest, such as Aspergillus oryzae (Nandakumar et al., 2002), Trichoderma reesi (Lim et al., 2001), Erysiphe pisi (Curto et al., 2006) and Botrytis cinerea (Fernandez-Acero et al., 2006). Similar studies in Magnaporthe grisea have provided information on proteins associated with the development and generation of appressoria (Kim et al., 2004). Even though several examples link pathogenicity to nutrient regulation, its contribution to the virulence of Colletotrichum spp. remains largely unexplored. In the present study, the effect of nitrogen availability on development and early stages of pathogenicity was further studied through two-dimensional gel electrophoresis (2-DE) of C. acutatum infecting strawberry. Quantitative analysis of proteins synthesized during appressorium formation compared with growth under nitrogen-limiting conditions or in the presence of a complete nutrient supply revealed significant alterations in the abundance of different proteins. The functional implications of the identified proteins, with special emphasis on the essential role of reactive oxygen species (ROS) as an early response to nitrogen deficiency, were studied. A combination of pharmacological and microscopic approaches were taken to substantiate the possibility that the accumulation of ROS is part of the signalling mechanism involved in governing the early stages of pathogen development in the presence of the host. R E S U LT S 2-DE, spot analysis and identification of differentially expressed proteins Nine 2-DE gels, three gels per treatment covering the pH range 4–7, were resolved. Representative gels are presented (Fig. 1). Examination of gels by means of Delta2D and Z3 software followed by visual confirmation revealed 36 spots that showed a significant decrease or increase in staining intensity. Spot differences were only considered if a relative fold-change of > 2 or < 0.5 was measured among the treatments and was consistently mani- fested in all replicates. Relative quantification was achieved by computer-based comparison of gel images, which matches and compares protein-spot intensities between gels. The sum of each spot represents the relative quantity of corresponding protein, relative to other spots on the gel. The average relative quantity of each spot and the fold-change, calculated as an expression ratio, are presented in Table 1. As indicated, analyses of spots were focused on those whose relative quantity ratio differed between the treatments by at least two-fold. All of the 36 differentially regulated proteins were analysed by LC-MS/MS and the most accurate database match for each protein is listed in Table 2. Good agreement was observed between the theoretical molecular mass of the identified proteins and their location in the 2-DE gels (Fig. 1, Table 2). Most of the assemblies were derived from proteins of other fungi such as Aspergillus spp., Neurospora crassa, Magnaporthe oryzae, Colletotrichum spp. and Gibberella zeae. These results suggest that there are many peptide sequences in common between proteins in C. acutatum and those in other ascomycetous fungi. In general, variably expressed proteins belonged to the following main functional categories: (1) ROS scavenger machinery, (2) carbohydrate and lipid metabolism, (3) nitrogen metabolism and (4) protein synthesis and degradation. In the case of the appressorial protein maps (Fig. 1), 18 differentially expressed protein spots were induced during the appressorium formation stage (App) compared with growth under nitrogen-limiting (MM) and complete nutrient (Reg) conditions, and 11 spots were common for mycelial growth under nitrogenlimiting conditions and during the appressorium formation stage, compared with growth under complete nutrient supply (Tables 1 and 2). Their functional significance in relation to nitrogenstarvation perception, development and pathogenicity is discussed below. Abundance of oxidative stress-related factor Enzymes associated with the ROS scavenger machinery, Cu/ ZnSOD and glutathione peroxidase (GPX) (spots 4, 14, Fig. 1A,B, respectively), were up-regulated during the appressorium-formation (App) stage (5.9-fold and 2.3-fold change, respectively), compared with growth with a complete nutrient (Reg) supply, but were not significantly different from the corresponding proteins synthesized under nitrogen-limiting (MM) conditions (Table 1). The bifunctional catalase peroxidase (CAT2) (spot 60, Fig. 1B) was significantly up-regulated during appressorium formation compared with mycelia grown under nitrogen limitation or a complete nutrient supply (5.2- and 2-fold change, respectively). QRT-PCR was used to analyse transcriptional levels of the corresponding genes. During nitrogen limitation and the appressorium formation stage, ten-fold higher expression was detected for sod1 compared with that in dormant conidia and growth with MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 © 2007 BLACKWELL PUBLISHING LTD Differential protein expression in Colletotrichum acutatum Fig. 1 Representative 2-DE gels of Colletotrichum acutatum from: (A) MM, mycelia grown in minimal medium; (B) App, appressorium formation stage; (C) Reg, mycelia grown in complete nutrient supply. Proteins (500 µg) were resolved in first-dimension strips, pH 4–7 linear gradient, and second-dimension gels (12% SDSPAGE). Proteins were detected using colloidal CBB G-250 staining. Molecular mass (Mr) in kDa is denoted on the left, while the pI (IEF) is given at the top of the figure. Protein spots marked with arrows, which were significantly differentially expressed between treatments, were further characterized and identified (see Table 1). © 2007 BLACKWELL PUBLISHING LTD MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 173 174 S. H. BROWN et al. Table 1 Detection and quantification of differentially expressed protein spots in Colletotrichum acutatum under various conditions* Spot property† Spot property Spots marked in images Spot no. App relative quantity MM relative quantity MM 1 2 4 5 20 22 33 34 37 39 40 41 42 57 58 0.206 nd§ 1.068 0.008 0.12 0.055 0.228 0.004 0.334 nd§ 0.812 0.136 0.387 0.101 0.02 1.984 0.81 1.253 0.358 0.279 0.11 0.308 0.175 0.8 0.037 1.63 0.872 0.82 0.369 0.018 App 7 14 15 16 26 28 32 36 43 44 46 48 49 51 52 53 55 56 60 1.547 0.706 0.312 0.383 0.421 1.426 0.368 0.816 0.343 0.905 0.271 0.163 0.499 0.407 0.906 0.778 0.625 0.462 0.617 Reg 8 38 nd 0.053 Expression ratio‡ Spots marked in images Spot no. App relative quantity Reg relative quantity Expression ratio 0.104 — 0.852 0.022 0.430 0.500 0.740 0.023 0.418 — 0.498 0.156 0.472 0.274 1.111 MM 1 2 4 5 20 22 33 34 37 39 40 41 42 57 58 0.206 nd 1.068 0.008 0.12 0.125 0.228 0.004 0.334 nd 0.812 0.136 0.387 0.101 0.129 0.901 nd 0.179 0.172 0.315 0.08 0.491 0.009 0.78 0.627 0.58 0.653 0.92 0.53 0.16 0.229 — 5.966 0.047 0.381 1.5 0.464 0.444 0.428 — 1.400 0.208 0.421 0.191 0.806 0.245 0.437 0.015 0.42 0.25 0.124 0.09 0.25 0.122 0.377 0.008 0.075 0.436 0.15 0.636 0.476 0.041 0.445 0.119 6.314 1.616 20.800 0.912 1.684 11.500 4.089 3.264 2.811 2.401 33.875 2.173 1.144 2.713 1.425 1.634 15.244 1.038 5.185 App 7 14 15 16 26 28 32 36 43 44 46 48 49 51 52 53 55 56 60 1.547 0.706 0.312 0.383 0.421 1.426 0.368 0.816 0.343 0.905 0.271 0.163 0.499 0.407 0.906 0.778 0.625 0.462 0.617 0.729 0.31 0.007 0.12 0.202 0.054 0.23 0.174 0.18 0.202 0.09 0.062 0.489 0.023 0.203 0.372 0.068 0.007 0.298 2.122 2.277 44.571 3.192 2.084 26.407 1.600 4.690 1.906 4.480 3.011 2.629 1.020 17.696 4.463 2.091 9.191 66.000 2.070 0.988 0.106 — 0.500 Reg 8 38 nd 0.192 1.9 0.422 — 0.455 *Comparison of the relative quantities of C. acutatum protein spots among the treatments, generated from Fig. 1: appressorium formation stage (App) compared with w.t. grown in minimal medium (MM) and w.t. grown under complete nutrient supply (Reg). Proteins were analysed by the Delta2D software (version 3.2) (Decodon, Greifswald, Germany). Three images for each treatment were grouped to calculate the average relative quantity of each individual protein spot. †Relative quantity of each spot was quantified by setting total spot quantity on a gel to 100%. ‡The numerical expression ratio is the mean of the relative quantity of the ‘sample spot’ divided by the mean of the relative quantity of the ‘master spot’, calculated for each gel and spot. The numerical expression ratio was calculated by determining local background regions of 17; average spot size is 5, weak spot sensitivity is 20% and noise cut-off is 40%. Proteins were considered differentially expressed when a relative fold-change of > 2 or < 0.5 was measured. §nd, not detectable. a complete nutrient supply (Fig. 2A). SOD activity was assessed by gel-activity assays (Fig. 2B). The two detected putative SOD enzymes corresponded to MnSOD (upper band) and Cu/ZnSOD (lower band), based on a previous report (Dolashka-Angelova et al., 1999). Cu/ZnSOD activity was markedly enhanced by nitrogen starvation and at the appressorium formation stage, compared with activity observed in the presence of complete nutrient supply and in dormant conidia (Fig. 2B). Transcript levels of cat2 MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 © 2007 BLACKWELL PUBLISHING LTD Function* ROS scavenging and stress response Main carbohydrate, glyoxylate and lipid metabolism Spot† GenBank accession no.‡ 4 AAD19338 14 EAA74714 15 EAA57651 33 EAA77628 40 XP366662 60 AP007175.1 1 EAA59740 8 CAF31997 20 36 CAA82232 XP680863 37 P54117 44 EAA69530 52 EAA75069 Best database match§ Cu-Zn superoxide dismutase (Glomerella cingulata) Hypothetical protein, similar to gluthatione peroxidase (Gibberella zeae) Hypothetical protein, CD: pfam00012 Hsp70 protein (Aspergillus nidulans) Hypothetical protein, similar to putative stress response protein (Gibberella zeae) Hypothetical protein, similar to cell death-related protein (Magnaporthe grisea) Hypothetical protein, similar to bifunctional catalase peroxidase (Cat2) (Aspergillus oryzae) Coverage (%)†† Total score‡‡ App Reg MM regulation§§ 20.3;6.3/16;5.9 29(8) 90 +–+ 18.8;6.5/19.1;6.3 15(5) 93.3 +–+ 26.3;5.8/72.3;5.7 8(4) 90 +–– 20.6;4.7/28.4;4.33 9(2) 82 –++ 15.9;5.1/15;5.3 8(1) 93 ––+ 80;6.2/82;5.8 4(4) 91 +–– 14.8;4.8/17.8.5;5.6 10(2) 93 –++ 40.4;4.1/41.7;8.7 10(2) 97 ndi + – 25.9;6.14/47.9;5.6 14;6.7/14.7;6.03 13(3) 17(5) 90.6 92 –++ +–– 24.18;6.6/36.3;6.54 12(4) 85 –++ 53.6;6.18/53.4;5.4 9(4) 92 +–– 16(8) 94 +–– 38.6;6.2/40;6.1 175 Hypothetical protein, CD: Cytochrome c oxidase subunit pfam02284 (Aspergillus nidulans) Putative isocitrate dehydrogenase (Aspergillus fumigatus) Enolase 2 (Ricinus communis) Hypothetical protein, glutathionedependent formaldehyde activating (Aspergillus nidulans) Glyceraldehyde 3-phosphate dehydrogenase (Glomerella lindemuthiana) Hypothetical protein, CD: pfam00171 aldehyde dehydrogenase family (Gibberella zeae) Hypothetical protein, CD: Formate dehydrogenase NADdependent (Gibberella zeae) Mol. mass;pI/¶experimental/ theoretical Differential protein expression in Colletotrichum acutatum © 2007 BLACKWELL PUBLISHING LTD MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 Table 2 Proteins identified by LC-MS/MS from spots that differed in their expression ratio among growth of wild type (w.t.) of Colletotrichum acutatum under nitrogen-limiting conditions (mm), w.t. growth under complete nutrient supply (reg) and during the appressorium formation stage (app). Proteins were classified according to functional categories 176 Table 2 continued. MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 © 2007 BLACKWELL PUBLISHING LTD Cellular, signal transduction and co-factor metabolism Nitrogen and amino acid metabolism. Protein synthesis, transcription and degradation Spot† GenBank accession no.‡ 53 EAA68236 56 EAA73569 58 EAA77220 2 Q7RVL0 7 XP457640 26 XP328263 28 S30118 42 XP326472 48 EAA74730 49 CAD60606 55 EAA76084 57 XP323373 5 XP322910 Mol. mass;pI/¶experimental/ theoretical Coverage (%)†† Total score‡‡ App Reg MM regulation§§ Hypothetical protein, CD: Malate dehydrogenase (Gibberella zeae) Hypothetical protein, CD: Acetyl-CoA acetyltransferase (Gibberella zeae) Hypothetical protein, similar to succinate dehydrogenase (Gibberella zeae) 23.7;6.5/34;6.4 25(8) 93 +–– 49.6;6.6/43.6;7.5 6(3) 83 +–+ 196.7;6/50.2;5.8 1(1) 92 ––– GTP-binding nuclear protein GSP1/Ran (Neurospora crassa) Hypothetical protein, similar to CipC protein of Emericella nidulans (Debaryomyces hansenii) Hypothetical protein, similar to protoporphyrinogen oxidase [Coenzyme metabolism] (Neurospora crassa) Orotate phosphoribosyl transferase (Colletotrichum graminicola) Hypothetical protein, CD: Calmodulin-related Ca2+-binding protein (Neurospora crassa) Hypothetical protein, similar to secretory pathway gdp dissociation inhibitor CD: pfam00996 (Gibberella zeae) Hypothetical protein, CD: Thiosulfate sulfur transferase (Podospora anserine) Hypothetical protein, CD: pfam00890 FAD binding domain, Cytochrome b5-like heme/steroid binding domain (Gibberella zeae) β-tubulin chain (Neurospora crassa) 14.8;5/24.2;6.4 21(5) 93 nd nd + 14;5.9/14.9;5.3 14(4) 86 +–– 60;6.17/57.9;5.8 8(3) 83 +–– 28.7;6.7/25.2;5.9 11(2) 89 +–– 13.6;4.3/16.3;4.5 18(2) 54.5;5.6/51.4;5.37 9(4) 94 +–– 35.6;6/38.4;6.7 10(3) 91 +–+ 70.2;6.6/67.9;6 16(13) 88 +–– 38.5;5.2/49.4;4.84 8(3) 85 –++ 29.2;6.5/44.6;8.5 6(2) 95 ––+ Best database match§ Ketol-acid reductoisomerase precursor (Neurospora crassa) –++ S. H. BROWN et al. Function* Function* Unknown function Spot† GenBank accession no.‡ 16 AAB00322 22 CAD70393 32 BAE62886 34 AAF82115 39 EAA77131 41 CAC28704 43 EAA68262 46 CAF05873 51 XP_682383 38 XP328441 Best database match§ Glutamine synthetase (Glomerella cingulata) Conserved hypothetical protein, similar to 20S proteasome subunit alpha type 6 (Neurospora crassa) Hypothetical protein, similar to 26s proteasome regulatory subunit mts4 (Aspergillus oryzae) Cobalamin-independent methionine synthase (Aspergillus nidulans) EF2_NEUCR elongation factor 2 (EF-2) (Gibberella zeae) Hypothetical protein, similar to ubiquitin-conjugating enzyme ubcP3 (Neurospora crassa) Hypothetical protein, similar to prolidase (Gibberella zeae) Glycine hydroxymethyl transferase cytosolic (Neurospora crassa) Hypothetical protein, similar to threonine dehydrogenase and related Zn-dependent dehydrogenases (Aspergillus nidulans) Hypothetical protein (Neurospora crassa) Mol. mass;pI/¶experimental/ theoretical Coverage (%)†† Total score‡‡ App Reg MM regulation§§ 39.9;5.7/39.9;5.7 23(11) 89 +–+ 29.5;6/27.7;5.6 13(4) 90 ––+ 41.4;6.7/100;4.89 1(1) 89 ++– 14.9;5.9/86.8;6.36 3(3) 93 ––+ 41.5;6.2/91.6;6.45 6(4) 95 +–+ 16.8;5.2/18.5;5 5(1) 93 –++ 21.4;6.2/26.1;5.8 6(2) 86 +–– 23.7;6.5/52.9;6.93 6(2) 82 +–– 40.7;6.2/42.5;5.3 8(3) 89 +–– 26.5;6/36.2;6.3 8(2) 90 nd – + 177 *Main functional categories. †Assigned spot number as indicated in Fig. 1. ‡Accession numbers in the NCBI databases. §Best database match according to NR-NCBI or specific databases; in the case of hypothetical proteins, putative functions were found by using the on-line conserved domains (CD) search in the NCBI database. The CD with the highest score was listed as the CD for the respective hypothetical protein. The corresponding organism from which the identified protein originates is denoted in parentheses. ¶Experimental and theoretical mass (kDa) and pI of identified protein. Experimental values were calculated with PD-Quest software and standard molecular-weight markers. Theoretical values were retrieved from the protein database. ††Percentage sequence coverage and number of peptides identified in parentheses. ‡‡Total peptide score: a peptide was considered to be of high quality if its Pep-Miner identification score was greater than 80 and had a sequest Xcore of 1.5 for single-charged peptides, 2.5 for double-charged peptides and 3 for triple-charged peptides. §§Significantly up- or down-regulated (+/–, respectively, among treatments). ¶¶nd, not detectable. Differential protein expression in Colletotrichum acutatum © 2007 BLACKWELL PUBLISHING LTD MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 Table 2 continued. 178 S. H. BROWN et al. Expression of the corresponding hsp70, analysed by QRT-PCR, during the appressorial formation stage and in dormant conidia, was ten-fold higher than that measured in mycelial samples from cultures grown under different nutritional conditions (Fig. 2A). An additional hypothetical protein, similar to a stress-response protein from G. zeae (spot 33, Fig. 1A), and a protein similar to a cell death-related protein from M. oryzae (spot 40, Fig. 1A) were up-regulated under nitrogen-limiting conditions. Fungal ROS production in pre-penetration and penetration structures during nitrogen deprivation and host invasion Fig. 2 (A) Quantitative real-time PCR (QRT-PCR) analysis of expression of sod1, cat2, hsp70 and a proteasome of Colletotrichum acutatum during the appressorium formation stage (APP), in dormant conidia (CONIDIA), growth under complete nutrient supply (REG) and nitrogen-limiting conditions (MM). Values were calculated as fold-change of expression of the corresponding gene among treatments relative to that at the appressorium formation stage. All samples were analysed in triplicate with the appropriate single QRT-PCR controls (no reverse transcriptase and no template). Averaged CT values, the cycle at which the amplification curve reached threshold fluorescence, were then normalized to the endogenous β-tubulin control gene. Fold-changes in target genes were determined by the 2−ΔΔCT method, where –ΔΔCT = (CTTarget – CTβ-tubulin)treatment – (CTTarget – CTβ-tubulin)control. The appressorium-extracted sample was used as the control treatment. Mean comparisons of the 2−ΔΔCT values among treatments were calculated using LSD, according to the Tukey–Kramer multiple comparison test (treatments with different letters are significant at P < 0.05). (B) Relative superoxide dismutase (SOD) activity assay. SOD activity was determined by staining the native polyacrylamide gel with nitro blue tetrazolium and riboflavin. Protein samples (20 µg) were extracted from dormant conidia (CONIDIA), the appressorium formation stage (APP), growth under a complete nutrient supply (REG) and from mycelia of C. acutatum grown under nitrogen-limiting conditions (MM). The two apparent SODs, MnSOD and Cu/ZnSOD, are denoted by arrows. increased during the appressorium formation stage in comparison with mycelia grown under the different nutritional conditions, albeit by only 2.5-fold. Expression of cat2 in dormant conidia was four-fold higher than in mycelia grown under different nutritional conditions (Fig. 2A). Additional proteins associated with stress and defence were identified: spot 15, which designates a protein similar to Hsp70 from Aspergillus nidulans, was up-regulated at the appressorium formation stage, compared with growth under nitrogen limitation or under complete nutrient supply (21- and 44.5-fold change, respectively; Fig. 1B). The detection of increased levels of ROS scavengers during the appressorium formation stage and under nitrogen limitation prompted us to investigate the distribution of ROS products in vitro with different supplied nutrients, and in vivo during pathogenesis. Generation of intracellular ROS was investigated using H2DCFDA as a probe to detect and quantify intracellularly produced H2O2. ROS generation was observed within 3 h of conidial germination in water but was not detected in dormant conidia (Fig. 3A–C). ROS were observed in germinating conidia on a hard surface in the presence of water and accumulated in the subsequent appressorium structure (as indicated by the arrows in Fig. 3D–F), indicating changes in ROS synthesis during development. ROS was barely detectable in mycelia growing in the presence of a complete nutrient supply (Fig. 3G,H), as opposed to the enhanced levels that accumulated under nitrogen-limiting conditions (Fig. 3J,K). ROS intensity decreased when preferred nitrogen sources such as ammonia (Fig. 3I) were available, in contrast to nitrate (Fig. 3L), a less preferred source (arrows indicate an individual conidium with accumulated ROS). Likewise, there was a significant increase in ROS accumulation within 3 h, as measured by fluorescence values, in conidia germinating in the presence of water, as compared with germination under complete nutrient supply or dormant conidia. In addition, ROS decreased with the addition of preferred nitrogen sources such as ammonia, but increased with less preferred nitrogen sources such as nitrate (Fig. 4). Following strawberry inoculation, rapid accumulation of ROS was mainly observed beneath the appressorium structures and appeared to be highly localized in the host apoplast at the host–appressorium interface (Fig. 5A,B). Halo formation was frequently observed near the appressorial structures, possibly due to a decrease in host ROS accumulation (Fig. 5C). Generation and accumulation of ROS was observed within the appressorium structures, the emerging penetration peg and infection vesicles, 16 h post-inoculation (as shown by the arrows in Fig. 5E–G, respectively) (Fig. 5D–G). ROS was observed in the intercellular and intracellular penetration hyphae as indicated by arrows (Fig. 5H–J), and accompanied all host-colonization stages up to 4 days post-inoculation (Fig. 5K,L). MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 © 2007 BLACKWELL PUBLISHING LTD Differential protein expression in Colletotrichum acutatum 179 Fig. 3 Assessment of intracellular reactive oxygen species (ROS) production under different nutritional conditions and morphologies of Colletotrichum acutatum. In vitro ROS production in fungal cells was determined using the H2DCFDA probe, and visualized with a laser-scanning confocal microscope. Rapid generation of ROS was detected within 3 h after germination (A,B), and 12 h after germination at the appressorium formation stage (C). ROS levels were barely detected in mycelia grown with a complete nutrient supply (D). ROS levels were lower in conidia germinating in the presence of ammonium as sole nitrogen source (E), while enhanced levels of ROS were detected in fungal hyphae grown under nitrogen-limiting conditions (F). Enhanced levels of ROS were also detected in germinating conidia in the presence of nitrate as sole nitrogen source (G). Micrographs A, D, G and J were analysed by fluorescence microscopy and corresponding images B, E, H and K are light micrographs as viewed under differential interference contrast (DIC) microscopy. Micrographs C, F, I and L were analysed through superposition of DIC and fluorescence microscopy. Scale bars = 16 µM. © 2007 BLACKWELL PUBLISHING LTD MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 180 S. H. BROWN et al. Fig. 4 Quantitative relative fluorescence measurements of Colletotrichum acutatum conidia germinating under different nutritional conditions: M3S-rich medium, dormant conidia (dormant), minimal medium without nitrogen (mm), minimal medium with ammonium (mm+a), minimal medium with nitrate (mm+n), water without a nitrogen source (water), water with ammonium (water+a) and water with nitrate (water+n) as sole nitrogen sources. After incubation, conidia were immersed in 80 µL of 10 µM H2DCFDA for 1 h. Relative fluorescence of the H2DCFDA probe was measured within 10 h. Mean comparisons of fluorescence values were calculated using LSD, according to the Tukey–Kramer multiple comparison test at P < 0.05. Fluorescence values for treatments with different letters are significant. Effect of antioxidant application on appressorium development during nutritional limitation The role played by ROS in cell differentiation in C. acutatum under nitrogen-limiting conditions was tested using proline, Nacetyl-L-cysteine (NAC) and mannitol, which act as potent antioxidants and inhibitors of ROS production. Unlike proline, addition of NAC (Fig. 6A) and mannitol (Fig. 6B) quenched ROS levels, as determined by fluorescence, characteristic of nonenzymatic defence against oxidative stress. A significant decrease in ROS accumulation was correlated with a significant decrease in the percentage of appressorium formation with applications of threshold concentrations of 0.025 mM NAC or 250 mM mannitol, respectively (Fig. 6A,B). Proteins associated with energy and lipid metabolism Several of the differentially regulated proteins detected in the 2DE gels appeared to be involved in energy metabolism. Isocitrate dehydrogenase (IDH), a typical tricarboxylic acid cycle protein, was markedly up-regulated (spot 8, Fig. 1D; Tables 1 and 2) under growth in the presence of a complete nutrient supply, although it was down-regulated under nitrogen-limiting conditions, and absent during the appressorium formation stage. Enzymes involved in the glyoxylate cycle (formate dehydrogenase and malate dehy- drogenase) and in fatty acid metabolism (aldehyde dehydrogenase and acetyl-CoA acetyltransferase (protein spots 44, 52, 53 and 56, respectively) were up-regulated (4.5-, 4.46-, 2-, and 65.7fold, respectively) during the appressorium formation stage, compared with growth with a complete nutrient supply (Table 1, Fig. 1B,D). Protein spot 2, corresponding to a GTP-binding nuclear protein GSP1/Ran belonging to the Rab GTPases, was up-regulated under nitrogen limitation but was not detected during the appressorium formation stage or under complete nutrient supply (Fig. 1A, Tables 1 and 2). In relation to increased catabolism, also worth noting was the identification of different key enzymes of the glycolysis/gluconeogenesis pathways, namely glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (protein spot 37) and glutathione-dependent formaldehyde (protein spot 36), which were differentially expressed among treatments (Fig. 1). This response suggests a shift in C. acutatum metabolism required for compensation during increased stress. Occurrence and distribution of lipid bodies during nutritional deprivation To study further the potential role of lipid metabolism under nutrient deprivation and during appressorium function, the distribution of lipid bodies was examined under different growth conditions and developmental stages by Nile Red staining. Confocal analysis of germinating conidia in water showed movement of lipid-droplet reserves, mobilized from the conidium into the germ-tube apex and to the incipient appressorium, within 12 h (as indicated by the arrows in Fig. 7A,F). Lipid bodies appeared inside secondary conidia at the initial stages of production (arrows in Fig 7. C,D). The appearance of lipid droplets was essentially varied for conidia germinated in the presence of a complete nutrient supply or in water. Under glucose or nitrogen deficiency, large lipid deposits were observed before being taken up into large vacuoles (Fig. 7G–I). Lipid bodies observed during growth in the presence of glucose and nitrate (Fig. 7J,K) or under complete nutrient supply (Fig. 7L,M) were disseminated along the hyphae and were generally smaller and homogeneous in size compared with growth under nutritional limitation (Fig. 7E–I). These observations suggest that fatty acid metabolism is increased under the nutritional deprivation that occurs during appressorium formation. Proteins associated with nitrogen metabolism, protein synthesis and degradation Up-regulation of proteins involved in nitrogen metabolism, such as glutamine synthetase (GS) (spot 16, Fig. 1B), and enzymes involved in the biosynthesis of different amino acids or protein synthesis such as glycine hydroxymethyltransferase (spot 46, Fig. 1B), ketol acid reductoisomerase (spot 5, Fig. 1A), cobalamin- MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 © 2007 BLACKWELL PUBLISHING LTD Differential protein expression in Colletotrichum acutatum 181 Fig. 5 Assessment of in vivo fungal reactive oxygen species (ROS) production during infection of strawberry by Colletotrichum acutatum. Cross-sections of infected tissues were prepared 12 and 72 h post-inoculation. Section samples were incubated with H2DCFDA for 1 h and examined by confocal microscopy. Superposition of differential interference contrast (DIC) and fluorescence images revealed a rapid response of ROS accumulation beneath the appressorium depression, as indicates by the arrows (A,B), and directly adjacent to the host cell. Local accumulation of plant ROS response and halo formation was observed close to the appressorium formation (C). Penetration of an appressorium germ tube accompanied by fungal ROS production (D, light micrograph), with the right corresponding image (E) and F analysed through superposition of DIC and fluorescence microscopy. Formation of an infection vesicle and hyphae growing in the intercellular spaces of host cells accompanied by ROS production (G–J). Colonization, 72 h post-inoculation, of inner-layer cells was accompanied by fungal ROS production as analysed by DIC and fluorescence microscopy (K) and L the corresponding image analysed by fluorescent microscopy. Scale bars = 10 µM. © 2007 BLACKWELL PUBLISHING LTD MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 182 S. H. BROWN et al. Fig. 6 Effect of N-acetyl-L-cysteine (NAC) and mannitol on appressorium formation and intracellular ROS production of Colletotrichum acutatum. Conidia were germinated in water in the presence of 0.005–1 mM NAC or 1–1000 mM mannitol for 12 h before measuring ROS (Flu) and percentage appressorium formation (App). Mean comparisons from three independent experiments of germination and appressorium formation were calculated using LSD, according to the Tukey– Kramer multiple comparison test at P < 0.05. Mean values with different letters (Flu, upper case; App, lower case) are significant. independent methionine synthase (spot 34, Fig. 1A), threonine dehydrogenase (spot 51, Fig. 1B) and prolidase (spot 43, Fig. 1B), were differentially expressed among treatments (Fig. 1, Tables 1 and 2). Proteins involved in degradation via the proteasome were detected in profiles from the appressorium-formation stage and nitrogen limitation. The 20S proteasome subunit alpha type 6 and the 26S proteasome regulatory subunit mts4 (spots 22 and 32, respectively) were up-regulated during nitrogen limitation. Expression analysis of the 20S proteasome subunit alpha type 6 revealed a relative increase in proteasome expression during appressorium formation compared with dormant conidia or mycelial growth under different conditions (Fig. 2A). Up-regulation of these proteins may demonstrate a general activation of the degradation apparatus, but may also indicate specific functions in appressorium formation. DISCUSSION The present study focuses on quantitative changes in differentially regulated proteins which may play a role under the nitrogen deprivation that occurs during the development and pathogenicity of Colletotrichum acutatum in strawberry. The hypothesis that plant-pathogenic fungi experience nitrogen nutrient limitation during in planta growth is based on our previous data in C. acutatum, which showed that nir1 is required for transcription of nitrate reductase (NR) necessary for nitrate assimilation, which is also involved in additional processes related to appressorium formation (Horowitz et al., 2006). Results presented in the present study demonstrate that nutrition deprivation conditions, which occur during appressoria formation, increase the demand for energy and metabolite precursors and require precise regulation. Likewise, nitrogen deprivation and early pre-penetration stages are accompanied by an intricate balance between host and pathogen ROS accumulation. Linkage between nutritional regulation, development and ROS generation was proposed recently in Colletotrichum trifolii, whereby Cdc42 (a highly conserved small GTP-binding protein) together with Ras (a small monomeric GTP binding protein) are critical for proper growth and development, especially hyphal morphology, conidiation and appressorium differentiation (Chen et al., 2006; Ha et al., 2003). Expression of dominant active Cdc42 or Ras in C. trifolii induces MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 © 2007 BLACKWELL PUBLISHING LTD Differential protein expression in Colletotrichum acutatum 183 Fig. 7 Cellular distribution of lipid droplets under nutrient deficiency compared with growth with a complete nutrient supply in germinated conidia and mycelia of Colletotrichum acutatum. Images A, C, E, G, I, J and L were analysed by fluorescence microscopy while images B, D, F, H, K and M are superpositions of differential interference contrast and fluorescence images. Conidia were allowed to germinate for 12 h in water drops (A–F) or in minimal media (MM) in the presence of nitrate and absence of glucose (G,H), in MM in the presence of glucose and absence of nitrate (I), MM in the presence of glucose and nitrate (J,K), or complete nutrient supply (G) and were stained for lipid bodies using Nile Red. Numerous small lipid droplets were observed under growth with a complete nutrient supply (indicated by arrows), whereas under nitrogen- or glucose-limiting conditions, larger lipid droplets were observed coalescing into vacuolar structures (indicated by arrows). Scale bars = 10 µM. © 2007 BLACKWELL PUBLISHING LTD MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 184 S. H. BROWN et al. large amounts of ROS under nutrient deprivation conditions, which was quenched by proline (Chen et al., 2006). Similar to the fungal response, in plants, ROS, notably hydrogen peroxide, mediate an early root response to nutrient deficiency, suggesting a link between ROS generation and nutrient deprivation (Shin et al., 2004). These reports together with findings presented in this study suggest that ROS generation is involved in a nutrient signalling cascade that may regulate fungal development under nitrogen deficiency occurring during the early stages of infection. Antioxidant enzymes as indicators of ROS during appressorium morphogenesis ROS accumulation is balanced via a cellular antioxidant system, some major players of which are catalase, SOD and components of the ascorbate–glutathione cycle (Aguirre et al., 2005; Chen and Dickman, 2005; Rodriguez and Redman, 2005). Up-regulation of SOD, GPX and CAT2 during the appressorium formation phase and differential regulation under nitrogen limitation prompted an examination of the spatial and temporal distribution of ROS in vitro, under different morphologies and growth conditions, and in vivo during strawberry colonization. ROS, in particular the superoxide anion ( O2− ), its conjugated acid the perhydroxyl radical (HO2) and their dismutation product hydrogen peroxide (H2O2), have been regarded as inevitable harmful by-products of aerobic metabolism. However, there is increasing evidence supporting an alternative view, in which specific enzymes that produce ROS regulate different cellular functions including cell proliferation, cell differentiation, signal transduction and ion transport. Several reports in different eukaryotic systems have shown a correlation between developmental processes and the up-regulation of specific antioxidant enzymes, such as SODs, catalases, catalase peroxidases and peroxiredoxins (Aguirre et al., 2005). For example, an MnSOD gene is induced during conidial development in Colletotrichum graminicola (Fang et al., 2002), and one of the developmental pathways in the slime mould Physarum polycephalum is accompanied by strong induction of SOD activity (Aguirre et al., 2005). SOD is essential for stationary-phase survival in Saccharomyces cerevisiae (Longo et al., 1996), and in Candida albicans a cytoplasmic MnSOD is expressed upon initiation of the stationary phase (Lamarre et al., 2001). In Magnaporthe oryzae, a catalase (catB) mutant phenotype displayed reduced sporulation, conidia and appressoria more prone to collapse under hyperosmotic stress. It is suggested that the large subunit catalase (CatB) in M. oryzae is involved in the formation or maintenance of a robust fungal cell wall (Skamnioti et al., 2007). Induction of antioxidant enzymes in structures that are undergoing development and the association of these enzymes with fully differentiated structures suggest that ROS are produced initially and during appressorium differentiation in C. acutatum. Furthermore, application of NAC and mannitol quenched ROS levels and decreased appressorium formation (Fig. 6). The ability of these antioxidants to inhibit appressorium formation is consistent with the idea that ROS are required for the initiation of developmental processes. Similar results were obtained with M. oryzae, where scavenging of the oxygen radicals by exogenous antioxidants such as ascorbic acid or MnTMPyp significantly delayed the development of appressoria and altered their morphology. Moreover, mutants disrupted in two superoxidegenerating NADPH oxidase encoding genes, Nox1 and Nox2, are incapable of causing disease owing to a lack of appressoriummediated cuticle penetration (Egan et al., 2007). ROS perception and antioxidant responses in C. acutatum A successful pathogen must be able to overcome or suppress the complex array of ROS-mediated host defences. Microbial suppression of ROS-mediated defences by secretion of ROSscavenging enzymes such as SOD and catalase, which convert ROS into less reactive species, has been documented in plant and animal pathogens (Jennings et al., 1998). As is well known, H2O2 generation plays a role in restricting fungal penetration and inhibiting fungal invasion, leading to the hypersensitive response and triggering rapid necrosis at infection sites, or activating defence-related genes (Apel and Hirt, 2004; Divon et al., 2006; Garre et al., 1998). Rapid accumulation of ROS by the host, which was observed beneath the appressorial structures, is apparently caused by local mechanical pressure generated by the developing appressoria. In C. lindemuthianum, it was shown that appressorium maturation, but not function, is sufficient to induce most plant defence responses (Veneault-Fourrey et al., 2005). The presence of abundant ROS produced by the host to account for penetration failure has also been observed for Colletotrichum coccodes causing anthracnose disease in tomato. Furthermore, enzymatic removal of H2O2 resulted in increased penetration success (Mellersh et al., 2002). In some of the observed penetration events, the plant ROS response was not observed, suggesting that C. acutatum evades recognition by the host, detoxifies the compounds (as indicated by halo formations near the appressoria) or is able to suppress other key defences capable of generating ROS. Up-regulation of fungal ROS scavengers during the appressorium formation stage could be an indication of the involvement of enzymatic ROS scavenging in protecting the fungus from the general stress generated by host defence mechanisms. This is in agreement with the requirement of Cu/ZnSOD for the protection of Candida albicans against oxidative stresses and full expression of its virulence (Hwang et al., 2002). Various findings demonstrated that loss of catalase CATB function for M. oryzae resulted in compromised pathogen fitness but did not influence the accumulation or detoxification of the host-imposed oxidative burst; however, CATB appeared to play a part in strengthening the fungal wall MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 © 2007 BLACKWELL PUBLISHING LTD Differential protein expression in Colletotrichum acutatum prior to host penetration (Skamnioti et al., 2007). These results suggest alternative and additional roles of these enzymes in pathogenesis. Despite the evidence indicating that ROS are related to, and probably required for, cell differentiation in eukaryotic cells, the sources of these ROS and their contribution to development remain to be determined. Recent research has demonstrated a novel role for the noxA NADPH oxidase-encoding gene, the primary source of ROS, in regulating the mutualistic interaction between a clavicipitaceous fungal endophyte, Epichloë festucae, and its grass host, Lolium perenne (Tanaka et al., 2006). These results suggest that fungal ROS production is critical in maintaining this mutualistic fungal–plant interaction. Results presented here suggest that ROS and the ROS scavenger machinery play important roles in mechanisms related to regulation of the morphology and host–pathogen interaction of the C. acutatum pathosystem under nitrogen deprivation. A metabolic shift is mediated by coordinated regulation of the glyoxylate cycle Induction of the glyoxylate cycle indicates that the cell is utilizing lipid metabolism as its predominant source for ATP generation, involving β-oxidation of fatty acids and the production of acetylCoA (Wang et al., 2003, 2005). Lipid-droplet deposits observed during nutrition deprivation indicate that they are utilized during appressorium development (Fig. 7). IDH, an important branchpoint between catabolic and anabolic processes in the cell, was clearly up-regulated under growth with a complete nutrient supply (Fig. 1). Thus, the catabolic process occurring during appressorium formation in C. acutatum induced the synthesis of a series of proteins involved in the glyoxylate cycle (formate dehydrogenase and malate dehydrogenase), or in fatty acid metabolism (aldehyde dehydrogenase and acetyl-CoA acetyltransferase). Two key studies examining the role of the glyoxylate cycle in the fungal phytopathogens M. oryzae and Leptosphaeria maculans have demonstrated that mutants lacking ICL activity, a key enzyme of the pathway, are unable to germinate and cause disease (Idnurm et al., 2002; Solomon et al., 2004). Recent work in C. lagenarium suggests that peroxisomal metabolic pathways play functional roles in appressorial and subsequent host-invasion steps (Asakura et al., 2006). Similarly, in the present study, it is suggested that C. acutatum uses lipid metabolism extensively during appressorium formation and under conditions of nitrogen deprivation (Fig. 7). Enhancement of nitrogen and protein metabolism during early developmental events Increased abundance of GS, which allows assimilation of nitrogen and biosynthesis of glutamine when preferential primary nitrogen sources are lacking, is consistent with previous findings in C. acutatum that nitrogen starvation prevails during appres- 185 sorium formation (Horowitz et al., 2006). Similar enhanced expression of GS has been documented during pathogenesis of Colletotrichum gloeosporioides on Stylosanthes guianensis (Stephenson et al., 1997). In Gibberella fujikuroi it was shown that GS has a significant impact on transcriptional control of primary and secondary metabolism (Teichert et al., 2004), and thus its expression might contribute to the metabolic shift that occurs during appressorium formation and under nitrogen starvation. Consequently, an increase in differentially regulated proteins during appressorium formation and under nitrogen-limiting conditions appears to be represented by proteins involved in amino acid metabolism, and protein synthesis and degradation. Kim et al. (2004) have demonstrated up-regulation of the mts4 subunit of the proteasome 26S during appressoria formation previously in M. oryzae, with 20S proteasome subunits, which take part in the degradation of targeted proteins. Furthermore, Kim et al. (2004) suggested that the proteasome might be involved in mobilizing storage proteins during appressorium formation. Therefore, the function of the proteasome subunit in appressorium formation deserves further study. In conclusion, this study reports on an initial approach for proteome analyses of C. acutatum infecting strawberry. Here we propose that ROS and nitrogen deficiency play an important role in the developmental programme occurring in germinating conidia under nutritional deprivation. Activation of the glyoxylate bypass, and generation and elimination of ROS may be fundamental in permitting pathogenicity to proceed before host invasion. To our knowledge, no comparable study on nutrient deprivation has demonstrated a link between ROS, nitrogen deficiency and development. These results should deepen our understanding of Colletotrichum biology, as well as the biology of other hemibiotrophs, in relation to nutritional adaptation during the early phase of infection, possibly providing new potential targets for disease prevention. E X P E R I M E N TA L P R O C E D U R E S Fungal strains and growth conditions Colletotrichum acutatum wild type (w.t.) C.a 149 (IMI391664) (Horowitz et al., 2006) was used throughout this study. The w.t. strain was maintained at 25 °C on modified Mathur’s medium (M3S) (Freeman et al., 1993) or on regeneration (Reg) medium [145.7 g/L mannitol (Sigma Aldrich, Steinheim, Germany), 4 g/L yeast extract (Difco Laboratories, Detroit, MI), 1 g/L soluble starch, 50 ml/L pea juice (Robinson and Sharon, 1999)]. Prior to seedling inoculation or fungal culturing, conidia were isolated by flooding 5- to 6-day-old cultures with distilled water, and adjusted to a final concentration of 105 conidia/mL with a haemacytometer (Brand, Wertheim, Germany). For induction of nitrogen-limiting conditions, the w.t. strain was cultured in flasks © 2007 BLACKWELL PUBLISHING LTD MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 186 S. H. BROWN et al. containing M3S liquid medium and incubated at 25 °C with horizontal shaking at 150 r.p.m. for 2 days. Cultures were then filtered through Whatman no. 54 filter paper and subcultured in flasks with minimal medium (MM), 20 g/L D-glucose, 1 g/L KH2PO4, 0.5 g/L MgSO4, 0.5 g/L KCl, 0.15 g/L CaCl2(2H2O), 3 mg/ L FeSO4(7H2O), 3 mg/L ZnSO4(7H2O), 1.25 mg/L CuSO4(5H2O), 350 µg/L MnSO4(H2O), 250 µg/L Na2MoO4(2H2O), 6.25 × 10–6 µg/L biotin and 1.25 mg/L thiamine for 6 h. For culturing in complete growth medium, mycelia were subcultured on Reg medium for 6 h. Mycelia cultured in MM and Reg media were then harvested by filtering through Whatman no. 54 filter paper, lyophilized, frozen in liquid nitrogen and stored at –80 °C, prior to RNA or protein extractions. For appressoria induction, conidia of C. acutatum (106 conidia/mL) were spread onto glass Petri dishes (13 cm diameter) containing 10 mL of water and were incubated for 12 h in the dark at 25 °C. Appressoria formation was confirmed by microscopy and the germinated conidia were harvested by scraping them off the Petri dishes using a rubber policeman. The appressoria were then harvested by collecting on 0.45-µm sterile nylon membrane filters (Milipore, Billercay, MA), lyophilized and subjected to RNA or protein extraction. In vitro and in vivo intracellular ROS and lipid-droplet detection Intracellular levels of ROS in C. acutatum were monitored with the oxidant-sensitive probe 2′,7′-dichlorofluorescein diacetate (H2DCFDA) (Molecular Probes, Leiden, The Netherlands), an established compound used to detect and quantify intracellularly produced H2O2. H2DCFDA (10 µM) in 50 mM MES buffer pH 6.2 (Duchefa Biochemie, Haarlem, The Netherlands) was used to detect ROS production. For measurement of ROS upon nutritional induction, 80 µL conidia (105 conidia/mL) were resuspended in Reg medium or in water containing 5 mM of one of the various nitrogen-containing compounds tested (glutamine, urea, nitrate, nitrite or ammonium sulphate), and allowed to germinate in Microtest plates (Sarstedt, Inc., Newton, NC) for various times within a 16-h period, before staining for 1 h with the H2DCFDA probe. Fluorescence levels were then measured by fluorometry (Microplate Fluorescence Reader FL600; BIO-TEK, Winooski, VT). Fluorescence levels were corrected by subtracting the fluorescence background of each medium used and dividing by ROS levels measured with the water treatment to obtain relative values. Following ROS production in planta, slices were prepared from inoculated strawberry stolons and leaves 12–72 h post-inoculation (p.i.) and subjected to the fluorescent dye for 1 h before confocal microscopic observation. Lipid droplets were visualized in germinating conidia and appressoria by staining with a Nile Red solution (Sigma Aldrich) as previously described (Thines et al., 2000). Cytological analysis was performed with freshly harvested conidia incubated under different nutritional conditions. Suitable material was mounted directly in 5 µg/mL Nile Red in glycerol solution. This solution was prepared from an initial solution of 1 mg/mL Nile Red in acetone. Within a few seconds, lipid droplets began to fluoresce. Antioxidant pharmacological treatments For all pharmacological treatments, conidia were resuspended with antioxidant solutions at various concentrations: N-acetyl-L-cysteine (0.005–1 mM), L-proline (0.5–4 mM) and mannitol (1–1000 mM) (Sigma Aldrich), and allowed to germinate for 3–12 h in Microtest plates for fluorescent measurements, or on Glasstic (HYCOR Biomedical Inc., Garden Grove, CA) slides for determining percentage appressorium formation. Induction of appressorium formation and germination upon antioxidant treatments was determined by placing 20 µL of a 5 × 105 conidia/mL suspension of w.t. isolate into three of the Glasstic slides. Conidial germination and appressorial development were observed in three microscopic fields of each of the three cells per slide. Three germination and appressorium formation phenotypes were assessed: conidial germination and immediate appressorium formation, germ-tube formation (> 2× the conidial length) and subsequent appressorium formation, and conidial germination without appressorium formation. The described phenotypes were calculated for each strain and treatment, based on respective percentages of the germinating conidia. The mean and standard deviation were calculated for three independent experiments. Mean comparisons of germination and appressorium formation were calculated using LSD, according to the Tukey–Kramer multiple comparison test at P < 0.05. Protein extraction Protein extraction from C. acutatum mycelia and appressoria was carried out according to Hurkman and Tanaka (1986), with minor modifications. Dry mycelia, conidia or appressorium-forming structures (0.25 g) were ground and homogenized to a very fine powder in a chilled mortar and pestle with liquid nitrogen in 5 mL extraction buffer (0.1 M Tris, pH 8.0, 5% w/v sucrose, 2% w/v SDS, 50 mM DTT, 2 mM PMSF) and 100 µL of Complete Inhibitor [one tablet of complete protease inhibitor (Roche Diagnostics GmbH, Mannheim, Germany) dissolved in 1 mL ddH2O]. The homogenates were kept on ice for 10 min and centrifuged at 4000 g for 30 min at 4 °C. The supernatant fraction was collected and transferred to a new tube and 5 mL of water-saturated phenol solution was added. The mixture was kept on ice with shaking for 10 min. The phenol fraction was collected and transferred to a new tube containing 5 mL of extraction buffer. The tube was kept on ice, shaken for 10 min, re-centrifuged at 4000 g for 30 min at 4 °C, and the phenol fraction was again transferred to a new tube. The proteins were precipitated overnight with 25 mL of 0.1 M ammonium acetate in cold methanol at –20 °C, followed by centrifugation at MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 © 2007 BLACKWELL PUBLISHING LTD Differential protein expression in Colletotrichum acutatum 4000 g for 30 min at 4 °C. The pellet was washed three times with 15 mL of 0.1 M ammonium acetate in cold methanol, and again with 15 mL of cold acetone. The air-dried pellet was dissolved in 600 µL of rehydration solution containing 9 M urea, 3% (w/v) CHAPS, 0.5% (w/v) Triton X-100, 2% (v/v) IPG (immobilized Ph gradient) buffer, 0.3% (w/v) DTT and 0.002% (w/v) bromophenol blue. The protein content was measured with the bicinchoninic acid protein assay kit (Sigma, St Louis, MO) according to the manufacturer’s instructions. 2-DE, image acquisition and mass-spectrometry analysis of proteins 2-DE was performed with immobilized pH gradients according to the manufacturer’s recommendations (Amersham Pharmacia Biotech, Amersham, UK), with minor modifications. For analytical and preparative gels, 13-cm IPG strips (pH 4–7) (Amersham Pharmacia Biotech) were rehydrated overnight with 250 µL of rehydration solution containing 50 µg protein at room temperature. The isoelectric focusing step was conducted at 18 °C with a Multiphor II apparatus (Amersham Biosciences) under the following conditions: 300 V for 15 min, 500 V for 15 min, 1000 V for 15 min, 1500 V for 15 min, 2000 V for 15 min, 2500 V for 15 min, 3000 V for 15 min and 3500 V for 4 h. The focused strips were equilibrated twice for 15 min in 10 mL of equilibration solution; the first equilibration solution contained 50 mM Tris-HCl, pH 8.8, 6 M urea, 30% (v/v) glycerol, 2% SDS, 0.002% bromophenol blue and 2 mM tributylphosphine (TBP); the second equilibration solution was the same except that TBP was replaced with 2.5% (w/v) iodoacetamide. The second dimension was SDS-PAGE in a vertical slab of 12.5% acrylamide with an SE 600 Series Vertical Slab Gel Unit (Hoeffer Scientific Instruments, San Francisco, CA). The protein spots were visualized by staining with colloidal Coomassie Blue G-250. 2-DE was conducted three times with each protein sample, while accurate and reproducible protein patterns were produced among technical replicates from independent extractions. Image analysis software Delta2D, version 3.2 (Decodon, Greifswald, Germany) as well as Z3 software (Compugen Inc., Nes Ziona, Israel) were used for gel-to-gel matching and spot quantification. The data were obtained from three independent experiments, and gels with best resolution were digitized and compared using the Delta2D software. To ascertain quantitative changes in proteomic maps of each treatment, comparisons of the absolute quantities of each spot among the treatments were generated by the Delta2D software (version 3.2). Relative quantity of the computed spot was calculated by setting total spot quantity on a gel to 100%, excluding the background. Three images for each treatment were grouped to calculate the average quantities of all individual spots. The numerical expression ratio that determines the fold-change is the mean of the relative quantity of the ‘sample spot’ divided by the mean relative quantity of 187 the ‘master spot’, calculated for each spot. These values were used to designate the significantly differentially expressed spots. We focused our analyses of spots on those whose relative quantity ratio differed between the treatments by at least two-fold, while all other proteins were classified as ‘not regulated’. The analysis was re-evaluated by visual inspection, focusing on those spots that were most dramatically altered between treatments, and consistent in all replicates. Spots showing consistent differential expression patterns between treatments were excised from the gels, digested and subjected to LC-MS/MS analysis to determine protein identity. For in-gel proteolysis, proteins were reduced with 10 mM DTT (60 °C for 30 min) and modified with 100 mM iodoacetamide in 10 mM ammonium bicarbonate (room temperature for 30 min). The gel pieces were dehydrated with acetonitrile and rehydrated with 10% acetonitrile in 10 mM ammonium bicabonate containing trypsin (modified trypsin; Promega, Madison, WI) at a 1 : 100 enzyme-to-substrate ratio. The gel pieces were incubated overnight at 37 °C and the resulting peptides were recovered and analysed. Electrospray-ion-trap analysis of proteins was performed at the Smoler Proteomics Center (Department of Biology, Technion-Israel Institute of Technology, Haifa, Israel). The tryptic peptides were resolved by reversed-phase chromatography on 0.1 × 200-mm fused silica capillaries (J&W, 100 micrometer ID) packed with Everest reversedphase material (Grace Vydac, Hesperia, CA). The peptides were eluted with linear 50-min gradients of 5–95% acetonitrile with 0.1% formic acid in water at flow rates of 0.4 µL/min. Mass spectrometry (MS) was performed by an ion-trap mass spectrometer (LCQ-DecaXP, Finnigan, San Jose, CA) in positive mode, using repetitive full MS scans followed by collisioninduced dissociation (CID) of the three most dominant ions, selected from the first MS scan. The MS data were clustered and analysed using the Sequest software (J. Eng and J. Yates, University of Washington and Finnigan, San Jose, CA) or Pep-Miner (Beer et al., 2004), searching the NR-NCBI or specific databases. In addition, a trained operator assessed the accuracy of identification of individual peptides visually. A peptide was considered to be of high quality if its Pep-Miner identification score was greater than 80 and it had a Sequest Xcore of 1.5 for singlecharged peptides, 2.5 for double-charged peptides and 3.0 for triple-charged peptides. To determine the possible functions and classifications of hypothetical proteins, the sequence information was used to search for conserved domains (CDs) in an on-line CD search in the NCBI database. The CD with the highest score was listed as the CD for the respective hypothetical protein. Detection of SOD activity Negative staining (Hwang et al., 2002), detected the activities of two types of SOD (Cu/ZnSOD and MnSOD) on a non-denaturing polyacrylamide gel. The two bands of SOD activity were identified © 2007 BLACKWELL PUBLISHING LTD MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 188 S. H. BROWN et al. Gene Name Product Primer sequence (5′−3′) Sod.dg.F Sod.dg.R Hsp.dg.F Hsp.dg.R Proteasome.dg.F Proteasome.dg.R Catalase.dg.F Catalase.dg.R SOD.qrt.F SOD.qrt.R HSP.qrt.F HSP.qrt.R Proteasome.qrt.F Proteasome.qrt.R Catalase.qrt.F Catalase.qrt.R β-tubulin.qrt.F β-tubulin.qrt.R Cu/Zn superoxide dismutase Cu/Zn superoxide dismutase Heat-shock protein 70 Heat-shock protein 70 Proteasome 26S subunit Proteasome 26S subunit Bifunctional catalase Bifunctional catalase Cu/Zn superoxide dismutase Cu/Zn superoxide dismutase Heat-shock protein 70 Heat-shock protein 70 Proteasome 26S subunit Proteasome 26S subunit Bifunctional catalase Bifunctional catalase Tubulin β-chain Tubulin β-chain CTTTGAGCAGGAGTCCGAGTC ACCCTTGCCRAGRTCGTCRGTRCC AAGATGAAGGAGACCGCYGAG ACAGCCTCATCGGGGTTGACGGAC CAAGTTGARTAYGCYTTCAAGG GTGTARACYTGGCTGATGTTKGC GCHTGGTTCAAGCTC ACRAAGAAGTCGTTSGTCA TTGTGGGGATTGAAGTGAGG CCACCATTACCTGGGACATC AAGTCCTCACCACCCAAGTG AGAAGGAGGAGGACCGTGTT CAAGTTGARTAYGCYTTCAAGG GTGTARACYTGGCTGATGTTKGC GTCGCCTGCTCTCAAGAAGG CCCAGGCAGTAGAGATGAGCTT TACCGACAAAGGTGGAGGAC AGGATGTCGAGGACCAGATG Table 3 Primers used throughout this study. The suffix dg refers to degenerate primers while qrt refers to primers used in quantitative real-time (QRT)-PCR experiments (F indicates forward primer; R indicates reverse primer). according to Dolashka-Angelova et al. (1999). The gel was incubated with gentle shaking in 50 mM phosphate buffer (pH 7.8) for 10 min, in nitro-blue-tetrazolium solution (1 mg/mL) for 10 min and then in 50 mM phosphate buffer (pH 7.8) containing 0.01 mg/ mL riboflavin (Sigma Aldrich) and 3.25 mg/mL N′,N′,N′,N′tetramethylethylenediamine (TEMED) for 10 min at room temperature. Areas of SOD activity remained clear when the gel was exposed to the light. The gel was scanned immediately after the photochemical reaction and the data were quantified using the NIH Image program (Macintosh, North Mathews, Urbana, IL). Isolation and analysis of nucleic acids Plasmid DNA, propagated in Escherichia coli strain DH5α, was isolated using the QIAprep Spin miniprep kit (Qiagen, Hilden, Germany). Total RNA from C. acutatum mycelia, conidia and the appressorium formation stage was extracted using Tri-reagent according to the manufacturer’s instructions (Sigma-Aldrich). Gene expression analysis by quantitative real-time (QRT) PCR Regions of the genes encoding C. acutatum SOD (sod1), bifunctional catalase (cat2), heat-shock protein (hsp70) and proteasome subunit alpha type 6 were cloned by PCR amplification on cDNA templates with degenerate primers based on peptide sequences. Mycelia grown under nitrogen-limiting conditions, a complete nutrient supply and at the appressorium formation stage were separated from the medium by filtration, and total RNA was isolated using Tri-reagent. Reverse transcription was carried out on 1 µg total RNA treated with RQ1 DNase (Promega) using Reverse-iT™ RTase Blend (ABgene, Epsom, UK) with an anchored oligo-dT primer. The resultant cDNA was subjected to PCR amplification in 50-µL reactions with the following components: 4 µL cDNA, 5 U/µL Taq DNA polymerase, 1× Taq polymerase buffer, 0.2 mM dNTP and the upstream and downstream primers listed in Table 3 to final concentrations of 0.2 µM. Samples were tested for the presence of genomic DNA contamination by using extracted treated RNA directly as a PCR template, prior to cDNA synthesis, under the same PCR conditions. RT-PCR products were resolved in 0.8% agarose gels and cloned. For QRT-PCR, cDNA samples were diluted 1 : 10 to a final template concentration with primers (330 nM) which were designed based on the sequenced cDNA clones listed in Table 3. Real-time detection was performed with ABsolute SYBR green ROX mix (ABgene) in a Rotor-Gene 3000 machine (Corbett Research, Sydney, Australia) and results were analysed with the Rotor-Gene 6 software. The β-tubulin gene served as an endogenous control while the appressorium-extracted sample was used as the calibrator (Yarden and Katan, 1993). A mixture of all cDNAs was used as a template for calibration curves designed for each pair of primers, for all the treatments. Relative quantification was calculated based on ΔΔCT values. The ΔCT value was determined by subtracting the CT results for the target gene from those of the endogenous control gene and then normalizing, as suggested by Rotor Gene (ΔΔCT). The final relative quantification value is MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 © 2007 BLACKWELL PUBLISHING LTD Differential protein expression in Colletotrichum acutatum 2−ΔΔCT , which represents the level of expression of the gene in relation to the appressorium-stage treatment (relative quantification). Each experiment was conducted four times with similar results, and results from one representative experiment are presented. Mean values of 2−ΔΔCT ± SD of the same cDNA measurements of each treatment were used for mean comparisons by LSD, according to the Tukey–Kramer multiple comparison test at P < 0.05. Infection assays, light and confocal microscopy For infection assays, stolons and leaves of 2-week-old strawberry daughter plants cv. Malach, an anthracnose-susceptible strawberry cultivar, were infected with a suspension of C. acutatum conidia at a concentration of 10 5 conidia/mL. Individual 10-µL drops of inoculum suspension were placed on strawberry stolons and leaves, incubated for 12–72 h at 25 °C in a moist chamber, and samples were removed at 12-, 24-, 48- and 72-h intervals for observation. Tissue slices were sampled from beneath the site at which inoculum droplets were applied and mounted directly in H2DCFDA probe for microscopic examination of ROS. Alternatively, in vitro germinating conidia exposed to different nutritional treatments were examined for ROS production or lipid-body detection by microscopic observation. All microscopic observations and image acquisitions were performed with an Olympus IX-81 FluoView FV500 confocal microscope (Olympus Optical Co., Tokyo, Japan) equipped with a 488-nm argon-ion laser. Transmitted light images were obtained using Nomarski differential interference contrast microscopy. For ROS detection, samples were excited by 488-nm light and the emission was collected through a BA 505-525 filter. A BA 660 IF emission filter was used to detect autofluorescence. For lipid-body detection, samples were excited by a 543-nm HeNe laser and image acquisition was accomplished using an E600LP (long pass) emission filter. AC K N O W L E D G M E N T S This research was supported in part by grants US-3260-01C and US-3774-05C from BARD–The United States–Israel Binational Agricultural Research and Development Fund, awarded to S.F. We thank the Smoler Proteomics Center at the Technion, Haifa, Israel, for their expert assistance. REFERENCES Aguirre, J., Rios Momberg, M., Hewitt, D. and Hansberg, W. (2005) Reactive oxygen species and development in microbial eukaryotes. Trends Microbiol. 13, 11–118. Apel, K. and Hirt, H. (2004) Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 55, 373–399. 189 Asakura, M., Okuno, T. and Takano, Y. (2006) Multiple contributions of peroxisomal metabolic function to fungal pathogenicity in Colletotrichum lagenarium. Appl. Environ. Microbiol. 72, 6345–6354. Beer, I., Barnea, E., Ziv, T. and Admon, A. (2004) Improving large-scale proteomics by clustering of mass spectrometry data. Proteomics, 4, 950– 960. Chen, C. and Dickman, M.B. (2005) Proline suppresses apoptosis in the fungal pathogen Colletotrichum trifolii. Proc. Natl Acad. Sci. USA, 102, 3459–3464. Chen, C., Ha, Y., Min, Ji., Memmott, S.D. and Dickman, M.B. (2006) Cdc42 is required for proper growth and development in the fungal pathogen Colletotrichum trifolii. Eukaryot. Cell, 5, 155–166. Curto, M., Camafeita, E., Lopez, J.A., Meldonado, A.M., Rubiales, D. and Jorrin, J.V. (2006) A proteomic approach to study pea (Pisum sativum) responses to powdery mildew (Erysiphe pisi ). Proteomics, 6, 163– 174. Divon, H.H. and Fluhr, R. (2007) Nutrition acquisition strategies during fungal infection of plants. FEMS Microbiol. 266, 65–74. Divon, H.H., Rothan-Denoyes, B., Davydov, O., Di Pietro, A. and Fluhr, R. (2005) Nitrogen-responsive genes are differentially regulated in planta during Fusarium oxyspsorum f.sp. lycopersici infection. Mol. Plant Pathol. 6, 459–470. Divon, H.H., Ziv, C., Davydov, O., Yarden, O. and Fluhr, R. (2006) The global nitrogen regulator, FNR1, regulates fungal nutrition-genes and fitness during Fusarium oxysporum pathogenesis. Mol. Plant Pathol. 7, 485–497. Dolashka-Angelova, P., Hristova, R., Genova, L., Angelova, M., Pashova, S., Stoeva, S., Voelter, W. and Stefanov, B. (1999) Isolation and characterization of a novel superoxide dismutase from fungal strain Humicola lutea 110. J. Pept. Res. 54, 279–289. Donofrio, N.M., Oh, Y., Lundy, R., Pan, H., Brown, D.E., Jeong, J.S., Coughlan, S., Mitchell, T.K. and Dean, R.A. (2006) Global gene expression during nitrogen starvation in the rice blast fungus, Magnaporthe grisea. Fungal Genet. Biol. 43, 316–325. Egan, M.J., Wang, Z., Jones, M.A., Smirnoff, N. and Talbot, N.J. (2007) Generation of reactive oxygen species by fungal NADPH oxidases is required for rice blast disease. Proc. Natl Acad. Sci. USA, 104, 11772– 11777. Fang, G.C., Hanau, R.M. and Vaillancourt, L.J. (2002) The SOD2 gene, encoding a manganese-type superoxide dismutase, is up-regulated during conidiogenesis in the plant-pathogenic fungus Colletotrichum graminicola. Fungal Genet. Biol. 36, 155–165. Fernandez-Acero, F.J., Jorge, I., Calvo, E., Vallejo, I., Carbu, M., Camafeita, E., Lopz, J.A., Cantoral, J.M. and Jorrin, J. (2006) Two dimensional electrophoresis protein profile of the phytopathogenic fungus Botrytis cinerea. Proteomics, 6, 88–96. Freeman, S. and Katan, T. (1997) Identification of Colletotrichum species responsible for anthracnose and root necrosis of strawberry in Israel. Phytopathology, 87, 516–521. Freeman, S., Pham, M. and Rodriguez, R.J. (1993) Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A+T-rich DNA, and nuclear DNA analyses. Exp. Mycol. 17, 309–322. Garre, V., Tenberge, K.B. and Eising, R. (1998) Secretion of a fungal extracellular catalase by Claviceps purpurea during infection of rye: putative role in pathogenicity and suppression of host defense. Phytopathology, 88, 744–753. Ha, Y.S., Memmott, S.D. and Dickman, M.B. (2003) Functional analysis of Ras in Colletotrichum trifolii. FEMS Microbiol. Lett. 226, 315–321. © 2007 BLACKWELL PUBLISHING LTD MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 190 S. H. BROWN et al. Horowitz, S., Freeman, S. and Sharon, A. (2002) Use of green fluorescent protein transgenic strains to study pathogenic and non-pathogenic lifestyles in Colletotrichum acutatum. Phytopathology, 92, 743–749. Horowitz, S., Freeman, S., Zveibil, A. and Yarden, O. (2006) A defect in nir1, a nirA-like transcription factor, confers morphological abnormalities and loss of pathogenicity in Colletotrichum acutatum. Mol. Plant Pathol. 7, 341–354. Hurkman, W.J. and Tanaka, C.K. (1986) Solubilization of plant membrane proteins for analysis by two-dimensional gel electrophoresis. Plant Physiol. 81, 802–806. Hwang, C.S., Rhie, G., Oh, J.H., Huh, W.K., Yim, H.S. and Kang, S.O. (2002) Copper and zinc containing superoxide dismutase (Cu/ZnSOD) is required for the protection of Candida albicans against oxidative stresses and the expression of its full virulence. Microbiology, 148, 3705–3713. Idnurm, A. and Howlett, B.J. (2002) Isocitrate lyase is essential for pathogenicity of the fungus Leptosphaeria maculans to Canola (Brassica napus). Eukaryot. Cell, 1, 719–724. Jennings, D.B., Ehrenshaft, M., Pharr, D.M. and Williamson, J.D. (1998) Roles for mannitol and mannitol dehydrogenase in active oxygenmediated plant defense. Proc. Natl Acad. Sci. USA, 95, 15129–15133. Kenneth, J.C., Maritza, A., Jana, B.A. and Smith, B.J. (2002) Strawberry anthracnose: histopathology of Colletotrichum acutatum and C. fragariae. Phytopathology, 92, 1055–1063. Kim, S.T., Yu, S., Kim, S.G., Kim, H.J., Kang, S.Y., Hwang, D.H., Jang, Y.S. and Kang, K.Y. (2004) Proteomics analysis of rice blast fungus (Magnaporthe grisea) proteome during appressorium formation. Proteomics, 4, 3579–3587. Lamarre, C., Lemay, J.D., Deslauriers, N. and Bourbonnais, Y. (2001) Candida albicans expresses an unusual cytoplasmic manganese-containing superoxide dismutase (SOD3 gene product) upon the entry and during the stationary phase. J. Biol. Chem. 276, 43784–43791. Leandro, L.F.S., Gleason, M.L., Nutter, F.W. Jr., Wegulo, S.N. and Dixon, P.M. (2001) Germination and sporulation of Colletotrichum acutatum on symptomless strawberry leaves. Phytopathology, 91, 659–664. Lim, D., Hains, P., Walsh, P., Bergquist, P. and Nevalainen, H. (2001) Proteins associated with the cell envelope of Trichoderma reesei: a proteomic approach. Proteomics, 1, 899–910. Longo, V.D., Gralla, E.B. and Valentine, J.S. (1996) Superoxide dismutase activity is essential for stationary phase survival in Saccharomyces cerevisiae. Mitochondrial production of toxic oxygen species in vivo. J. Biol. Chem. 271, 12275–12280. Mellersh, D.G., Foulds, I.V., Higgins, V.J. and Heath, M.C. (2002) H2O2 plays different roles in determining penetration failure in three diverse plant-fungal interactions. Plant J. 29, 257–268. Nandakumar, M.P. and Marten, M.R. (2002) Comparison of lysis methods and preparation protocols for one-and two-dimensional electrophoresis of Aspergillus oryzae intracellular proteins. Electrophoresis, 23, 2216–2222. O’Connell, R., Perfect, S., Hughes, B., Carazaniga, R., Bailey, J. and Green, J. (2000) Dissecting the cell biology of Colletotrichum infection processes. In: Colletotrichum: Host Specificity, Pathology and Host Pathogen Interaction (Prusky, D., Freeman, S. and Dickman, M.B., eds), pp. 57–77. St. Paul, MN: APS Press. Pellier, A.L., Lauge, R., Veneault-Fourrey, C. and Langin, T. (2003) CLNR1, the AREA/NIT2-like global nitrogen regulator of the plant fungal pathogen Colletotrichum lindemuthianum is required for the infection cycle. Mol. Microbiol. 48, 639–655. Robinson, M. and Sharon, A. (1999) Transformation of the bioherbicide Colletotrichum gloeosporioides f.sp. aeschynomene by electroporation of germinated conidia. Curr. Genet. 36, 98–104. Rodriguez, R. and Redman, R. (2005) Balancing the generation and elimination of reactive oxygen species. Proc. Natl Acad. Sci. USA, 102, 3175–3176. Shin, R. and Schachtman, D.P. (2004) Hydrogen peroxide mediates plant root cell response to nutrient deprivation. Proc. Natl Acad. Sci. USA, 101, 8827–8832. Skamnioti, P. Henderson, C., Zhang, Z., Robinson, Z. and Gurr, S.J. (2007) A novel role for catalase B in the maintenance of fungal cell-wall integrity during host invasion in the rice blast fungus Magnaporthe grisea. Mol. Plant–Microbe Interact. 120, 568–580. Snoeijers, S.S., Perez-Garcia, A., Joosten, M.H.A.J. and De Wit, P.J.G.M. (2000) The effect of nitrogen on disease development and gene expression in bacterial and fungal plant pathogens. Eur. J. Plant Pathol. 106, 493–506. Solomon, P.S., Lee, R.C., Wilson, T.J.G. and Oliver, R.P. (2004) Pathogenicity of Stagonospora nodorum requires malate synthase. Mol. Microbiol. 53, 1065–1073. Stephenson, S.A., Green, J.R., Manners, J.M. and Maclean, D.J. (1997) Cloning and characterization of glutamine synthetase from Colletotrichum gloeosporioides and demonstration of elevated expression during pathogenesis on Stylosanthes guianensis. Curr. Genet. 31, 447–454. Tanaka, A., Christensen, M.J., Takemoto, D., Park, P. and Scott, B. (2006) Reactive oxygen species play a role in regulating a fungus-perennial ryegrass mutualistic interaction. Plant Cell, 18, 1052–1066. Teichert, S., Schonig, B., Richter, S. and Tudzynski, B. (2004) Deletion of the Gibberella fujikuroi glutamine synthetase gene has significant impact on transcriptional control of primary and secondary metabolism. Mol. Microbiol. 53, 1661–1675. Thines, E., Weber, R.W.S. and Talbot, N.J. (2000) MAP kinase and protein kinase A-depenent mobilization of triacylglycerol and glycogen during appressorium turgor generation by Magnaporthe grisea. Plant Cell, 12, 1703–1718. Veneault-Fourrey, C., Lauge, R. and Langin, T. (2005) Nonpathogenic strains of Colletotrichum lindemuthianum trigger progressive bean defense responses during appressorium-mediated penetration. Appl. Environ. Microbiol. 71, 4761–4770. Wang, Z.Y., Thornton, C.R., Kershaw, L.D. and Talbot, N.J. (2003) The glyoxylate cycle is required for temporal regulation of virulence by the plant pathogenic fungus Magnaporthe grisea. Mol. Microbiol. 47, 1601– 1612. Wang, Z.Y., Jenkinson, J.M., Holcombe, L.J., Soanes, D.M., VeneaultFourrey, C., Bhambra, G.K. and Talbot, N.J. (2005) The molecular biology of appressorium turgor generation by the rice blast fungus Magnaporthe grisea. Biochem. Soc. Trans. 33, 384–388. Yarden, O. and Katan, T. (1993) Mutations leading to substitutions at amino acids 198 and 200 of beta-tubulin that correlate with benomylresistance phenotypes of field strains of Botrytis cinerea. Phytopathology, 83, 1478–1483. MOLECULAR PLANT PATHOLOGY (2008) 9(2), 171–190 © 2007 BLACKWELL PUBLISHING LTD

RELATED PAPERS

RELATED TOPICS

Log In

Differential protein expression in Colletotrichum acutatum: changes associated with reactive oxygen species and nitrogen starvation implicated in pathogenicity on strawberry

Differential protein expression in Colletotrichum acutatum: changes associated with reactive oxygen species and nitrogen starvation implicated in pathogenicity on strawberry

Related Papers

RELATED PAPERS

RELATED TOPICS