Fungal Diversity (2012) 57:1–44 DOI 10.1007/s13225-012-0175-8 Multigene phylogeny and taxonomy of the genus Melanconiella (Diaporthales) Hermann Voglmayr & Amy Y. Rossman & Lisa A. Castlebury & Walter M. Jaklitsch Received: 7 March 2012 / Accepted: 15 May 2012 / Published online: 11 July 2012 # Mushroom Research Foundation 2012 Abstract Molecular phylogenetic analyses of LSU rDNA demonstrate monophyly of the genus Melanconiella, and its status as a genus distinct from Melanconis is confirmed. Data of macro- and microscopic morphology, pure cultures and phylogenetic analyses of partial SSU-ITS-LSU rDNA, tef1 and rpb2 sequences revealed 13 distinct species of Melanconiella, six of which are described as new (M. chrysodiscosporina, M. chrysomelanconium, M. chrysorientalis, M. echinata, M. elegans, M. meridionalis). Melanconiella hyperopta var. orientalis is described as a new variety. Diaporthe carpinicola, D. ellisii, D. flavovirens, D. hyperopta and D. ostryae are formally combined into Melanconiella. The name Melanconiella chrysostroma is excluded from Melanconiella, as it is an obligate synonym of Wuestneia xanthostroma. The type of Melanconiella is confirmed as M. spodiaea. Several species are lecto- and/or epitypified. A key to all treated species of Melanconiella is provided, and the circumscriptions of the genera Melanconis and Melanconiella are emended. Most Melanconiella species revealed by molecular phylogenetic analyses can be well characterised by a suite of morphological traits including ascospore shape, length and width, colour, absence/presence and shape of appendages and the anamorph. Anamorph-teleomorph connections were confirmed by pure culture and DNA data, revealing H. Voglmayr (*) : W. M. Jaklitsch Department of Systematic and Evolutionary Botany, Faculty Centre of Biodiversity, University of Vienna, Rennweg 14, 1030, Wien, Austria e-mail: hermann.voglmayr@univie.ac.at A. Y. Rossman : L. A. Castlebury Systematic Mycology & Microbiology Laboratory, USDA, Agricultural Research Service, B010A, 10300 Baltimore Ave, Beltsville, MD 20705, USA the presence of a single melanconium- or discosporina-like anamorph for each species. Colony growth was found to be characteristic of the respective species. Melanconiella is shown to be confined to the host family Betulaceae, and all species are found to be highly host-specific, mostly confined to a single host species. The biodiversity of Melanconiella was determined to be centred on the genus Carpinus with nine species, five of which have been confirmed on C. betulus. Europe appears to be the geographic centre of Melanconiella biodiversity. Keywords High diversity . Host specificity . Melanconidaceae . Molecular phylogeny . New species . Pathogen . Systematics Introduction The Diaporthales are an order of ascomycetes within the Sordariomycetidae that are characterised by forming black perithecia with or without a well-developed stroma or pseudostroma and a diaporthalean-type centrum development, i.e. with broad deliquescent paraphyses and asci that float free at maturity, often having a refractive apical ring (Barr 1978; Castlebury et al. 2002). Many species occur on hardwood trees in temperate regions although a few species have been discovered in subtropical areas. Many species are opportunistic pathogens and endophytes (Sieber 2007), and some of those are serious threats to forestry and agriculture. Within the Diaporthales, the family Melanconidaceae has traditionally been conceived to include many genera having perithecia immersed in a well-developed stroma with ostioles (“beaks”) that emerge through an ectostromatic disc (Barr 1978). Based on phylogenetic data, it was concluded that the Melanconidaceae should be restricted to a single genus Melanconis (Castlebury et al. 2002). This narrowly 2 circumscribed family is closely related to the Gnomoniaceae. Castlebury et al. (2002) determined that species previously placed in the genus Melanconis are phylogenetically distributed throughout the Diaporthales. The genus Melanconis, based on the type species M. stilbostoma, includes species with perithecia immersed in the substrate arranged in a circle with oblique or lateral ostioles convergent and erumpent through an ectostromatic disc and hyaline ascospores. Melanconis stilbostoma occurs on Betula and is congeneric with M. alni and M. marginalis, which also occur on members of the Betulaceae (Castlebury et al. 2002). The genus Melanconiella Sacc. 1882 was established for species that are similar to Melanconis but have dark coloured ascospores, although even Saccardo placed a hyaline-spored species (M. chrysostroma) in this genus. Subsequently, 21 taxa were placed in Melanconiella primarily in the late nineteenth and early twentieth century. Following Wehmeyer (1941), recent authors including Müller and von Arx (1962) and Barr (1978) considered Melanconiella to be a synonym of Melanconis, whereas Munk (1957), Petrak (1952a) and Dennis (1968) preferred to maintain separate genera. During many years of collecting, the last author noticed a high variability of ascospore size and morphology, especially within the hyaline-spored Melanconis species growing on Carpinus betulus and Ostrya carpinifolia, which all keyed out as Melanconis (0Melanconiella) chrysostroma based on the available taxonomic literature (Wehmeyer 1941; Ellis and Ellis 1997). Results of recent studies on ascomycetes with similar ecology (e.g. Voglmayr and Jaklitsch 2008, 2011; Mejía et al. 2011a) revealed a much higher biodiversity than previously perceived, which cast doubt on the wide species concept commonly applied to Melanconiella chrysostroma. The fact that no recent monographic treatment is available for the genera Melanconis and Melanconiella led us to initiate thorough morphological and molecular phylogenetic studies on Melanconiella involving extensive studies of numerous fresh collections and types from various hosts to evaluate morphological variability, resolve species boundaries and clarify host ranges. Cultures were obtained from both ascospores and conidia to elucidate the anamorph-teleomorph connections by DNA data. In addition, molecular phylogenetic analyses were performed to determine the phylogenetic relationships within the genus as well as the phylogenetic position of Melanconiella within the Diaporthales. Materials and methods Sample sources Details of the specimens used for morphological investigations are listed in the Taxonomy section under the respective descriptions. The herbarium acronyms are given according to Thiers Fungal Diversity (2012) 57:1–44 (2012): B—Botanischer Garten und Botanisches Museum Berlin-Dahlem, Germany; BPI—U.S. National Fungus Collections, Beltsville, USA; DAOM—Agriculture and AgriFood Canada, Ottawa, Canada; G—Conservatoire et Jardin botaniques de la Ville de Genève, Switzerland; GZU—KarlFranzens-Universität Graz, Austria; K—Royal Botanic Gardens Kew, UK; M—Botanische Staatssammlung München, Germany; NY—New York Botanical Garden, USA; UPS— Uppsala University, Sweden; W—Naturhistorisches Museum Wien, Austria; WU—Universität Wien, Austria. Morphology Morphological observations and measurements were carried out on a Nikon SMZ 1500 stereo-microscope and after mounting in tap water or 3 % KOH on a Zeiss AxioImager A1 compound microscope using Nomarski differential interference contrast (DIC). Images were recorded with a Nikon DS-Fi1, a Nikon Coolpix 4500 (cultures) or a Zeiss AxioCam ICc3 digital camera. Measurements are reported as maxima and minima in parentheses and the mean plus and minus the standard deviation of a number of measurements given in parentheses. Culture preparation, DNA extraction, PCR and sequencing Single ascospore or conidium isolates were prepared and grown on 2 % malt extract agar (MEA), or on 2 % corn meal agar plus 2 %w/v dextrose (CMD) with subsequent transfer and storage on CM agar slants. To record growth characteristics, they were grown on 2 % MEA at room temperature under natural daylight. Mycelium for DNA extraction was grown, freeze-dried and ground according to Voglmayr and Jaklitsch (2011). DNA was extracted using the modified CTAB protocol described in Riethmüller et al. (2002). In collections of Melanconiella echinata, M. elegans and M. ellisii for which no cultures could be obtained, DNA was isolated directly from ascomata or conidiomata according to Voglmayr and Jaklitsch (2011), but after the chloroform-isoamyl alcohol step of the CTAB extraction, the supernatant was further processed with the NucleoSpin Extract II kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions to obtain highly purified DNA. The partial nuSSU-complete ITS-partial nuLSU rDNA region was amplified using the primers V9G (de Hoog and Gerrits van den Ende 1998) and LR5 (Vilgalys and Hester 1990). For amplification of DNA from herbarium specimens, ITS and LSU were sometimes amplified separately, with the primers V9G or ITS5 (White et al. 1990) and LR1 for ITS and with LR0R and LR5 (Vilgalys and Hester 1990) for LSU. For the type specimen of M. echinata, ITS1 and ITS2 were separately amplified with the primers ITS5/f5.8SR and f5.8SF Fungal Diversity (2012) 57:1–44 (Jaklitsch and Voglmayr 2011)/LR1, respectively. As the LSU sequence of M. echinata could not be revealed with the primers listed above, it was amplified as three separate fragments about 300 bp long, using the primers LR0R/LR2-A (5′ TGCTTTTCATCTTTCGATCAC 3′), LR2R-A (5′ CAGAGACCGATAGCGCAC 3′)/LR3 (Vilgalys and Hester 1990) and LR3R (http://www.biology.duke.edu/fungi/ mycolab/primers.htm)/LR5. A ca. 1.4 kb fragment of the tef1 (translation elongation factor 1 alpha) gene was amplified with the primers EF1728F (Chaverri and Samuels 2003) and TEF1LLErev (Jaklitsch et al. 2006). The latter fragment includes the fourth and the fifth intron and a significant portion of the last large exon. A ca. 1.2 kb fragment of RNA polymerase II subunit B (rpb2) was amplified using the primer pair fRPB2-5f and fRPB2-7cr (Liu et al. 1999). PCR products were purified using an enzymatic PCR cleanup (Werle et al. 1994) as described in Voglmayr and Jaklitsch (2008). DNA was cycle-sequenced using the ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit v. 3.1 (Applied Biosystems,Warrington, UK) and the PCR primers; in addition, primers ITS4 (White et al. 1990) and LR3 were used for the partial nuSSUcomplete ITS-partial nuLSU rDNA region. Sequencing was performed on an automated DNA sequencer (ABI 3730xl Genetic Analyzer, Applied Biosystems). Data analysis To reveal the phylogenetic position of Melanconiella within the Diaporthales and to investigate whether the genus is monophyletic, a phylogenetic analysis was performed with nuLSU rDNA sequences. Sequences of representative species were selected from Castlebury et al. (2002) and supplemented with sequences from GenBank; two accessions of Gaeumannomyces (Magnaporthaceae) were included as outgroup. GenBank accession numbers are given in the phylogenetic tree (Fig. 1). For detailed investigations of species relationships and delimitation within Melanconiella, a combined matrix of nuSSU-ITS1-5.8S-ITS2-LSU rDNA, rpb2 and tef1 sequences was produced for phylogenetic analyses, with Melanconis stilbostoma as outgroup. The GenBank accession numbers of sequences used in these analyses are given in Table 1. Sequence alignments for phylogenetic analyses were produced with either MUSCLE version 3.6 (Edgar 2004) or MAFFT 6.847 (Katoh et al. 2002; Katoh and Toh 2008) implemented in UGENE 1.10.0 (http://ugene.unipro.ru), with a maximum of 100 iterative refinements and gap opening penalties of 1.03 for ITS-LSU and 0.83 for tef1, respectively. The resulting alignments were checked using BioEdit version 7.0.9.0 (Hall 1999). After the exclusion of excessive leading and trailing gap regions and of ambiguously aligned positions, 3 the LSU matrix contained 1363 characters. The combined data matrix contained 4370 characters; viz. 1689 nucleotides of SSU-ITS-LSU, 1173 nucleotides of rpb2 and 1508 nucleotides of tef1. In Maximum Likelihood (ML) and Bayesian analyses, substitution model parameters were calculated separately for the different gene regions included in the combined analyses. For ML analyses, 500 rounds of random addition of sequences as well as 500 fast bootstrap replicates were computed with RAxML (Stamatakis 2006) as implemented in raxmlGUI 0.95 (Silvestro and Michalak 2011) using the GTRGAMMA algorithm. For Bayesian analyses (BA), the GTR + I + G model was implemented. Bayesian analyses were performed with the computer program MrBayes (version 3.1.2; Huelsenbeck and Ronquist 2001). Three parallel runs of four incrementally heated, simultaneous Markov chains were performed over 5 million generations of which every 500th and 100th tree was sampled in each run in the LSU and combined analyses, respectively. The first 1000 and 10000 trees sampled were discarded in the LSU and combined analyses, respectively, and a 90 % majority rule consensus of the remaining trees was computed to obtain posterior probabilities. To test convergence of runs, the results were analysed using AWTY (Nylander et al. 2008); no indication of lack of convergence was detected. Maximum parsimony (MP) bootstrap analyses were performed with PAUP* version 4.0 b10 (Swofford 2002), using 1000 replicates of heuristic search with 5 rounds of random addition of sequences and subsequent TBR branch swapping (MULTREES option in effect, COLLAPSE 0 MAXBRLEN, steepest descent option not in effect); each bootstrap replicate was limited to 1 million rearrangements. Results Molecular phylogenetic analyses Of the 1363 characters in the LSU alignment, 218 were parsimony informative. Figure 1 shows the best ML tree (lnL0−5505.723). Tree topologies of the Bayesian analyses were fully compatible with the ML analyses. The three Bayesian runs revealed highly similar posterior probabilities (PP). ML and MP bootstrap support above 60 % and Bayesian posterior probabilities above 90 % are given in Fig. 1 at the first, second and third positions, respectively, above or below the branches. Of the 4370 characters in the combined data matrix, 1009 were parsimony informative. Figure 2 shows the best ML tree (lnL0−16890.279). Tree topologies of the Bayesian analyses were compatible with the ML tree except for minor topological differences within some species; in addition, M. 4 Fungal Diversity (2012) 57:1–44 Melanconiella decorahensis MD Melanconiella flavovirens MFV -/-/91 Melanconiella carpinicola A.R. 3883 Melanconiella elegans A.R. 3993 Melanconiella meridionalis MOK Melanconiella ostryae CBS 208.38 95/89/100 Melanconiella chrysomelanconium MCM 74/64/96 98/97/100 98/100/100 Melanconiella chrysodiscosporina MCH Melanconiella chrysorientalis MGB Melanconiella echinata DAOM 121196 Melanconiella hyperopta A.R. 3832 92/90/100 Melanconiella spodiaea AF408370 Melanconiella ellisii BPI878343 Phragmoporthe conformis AF408377 -/-/100 Gnomonia gnomon AF408361 77/61/100 87/64/100 Ophiognomonia leptostyla AF408362 Apiognomonia errabunda AF408334 100/99/100 100/100/100 65/-/98 Plagiostoma euphorbiae AF408382 Cryptosporella hypodermia AF408347 75/-/- Melanconis stilbostoma AF408374 -/-/92 Harknessia eucalypti AF408363 96/70/100 85/75/- Chromendothia citrina AF408335 Cryphonectria parasitica JN940858 86/92/99 96/97/100 Chrysoporthe cubensis AF408338 Prosthecium pyriforme EU039992 Prosthecium galeatum EU039989 91/82/100 Prosthecium ellipsosporum EU039986 Diaporthe fibrosa AF408351 92/94/100 Diaporthe detrusa AF408349 85/78/100 87/83/100 Diaporthe eres AF408350 Diaporthe pustulata AF408357 Mazzantia napelli AF408368 Valsa ceratosperma AF408386 100/100/100 Leucostoma niveum AF408367 100/100/100 Hercospora tiliae AF408365 99/97/100 Melanconis desmazieri AF408372 97/75/100 81/-/99/100/100 Sillia ferruginea EU683076 Sydowiella fenestrans EU683078 Chapeckia nigrospora EU683068 Hapalocystis berkeleyi AY616230 Pseudovalsa longipes EU683072 Gaeumannomyces medullaris FJ176854 Gaeumannomyces graminis JF414899 0.005 substitutions/site Fig. 1 Phylogram of the best ML tree (lnL0−5505.723) revealed by RAxML from an analysis of the LSU matrix of selected Diaporthales, showing the phylogenetic position of Melanconiella. ML and MP bootstrap support above 60 % and Bayesian posterior probabilities above 90 % are given at the first, second and third positions, respectively, above or below the branches. GenBank accession numbers are given following the taxon names; generic types are formatted in bold Fungal Diversity (2012) 57:1–44 5 Table 1 Taxa, sources of DNA extracts and GenBank accession numbers of Melanconis and Melanconiella sequences used for the phylogenetic multi-gene analyses or species identification. Details on the strains are found under specimens examined in the Taxonomy section Taxon Strain/culture or specimen Isolated/extracted from ITS-LSU rpb2 tef1 Melanconiella carpinicola M. carpinicola M. carpinicola M. carpinicola M. carpinicola M. carpinicola M. carpinicola M. chrysodiscosporina M. chrysodiscosporina M. chrysodiscosporina M. chrysodiscosporina M. chrysodiscosporina M. chrysodiscosporina A.R. 3883 MENU MNM MNP MNUK MSMI MSR MCAn MCH MCHA MEE MEL MGG ascospore conidium ascospore ascospore ascospore ascospore ascospore conidium ascospore conidium conidium ascospore ascospore JQ926230 JQ926231 JQ926232 JQ926233 JQ926234 JQ926235 JQ926236 JQ926237 JQ926238 JQ926239 JQ926240 JQ926241 JQ926242 JQ926303 JQ926304 JQ926305 JQ926306 JQ926307 JQ926308 JQ926309 JQ926310 JQ926311 JQ926312 JQ926313 JQ926314 JQ926369 JQ926370 JQ926371 JQ926372 JQ926373 JQ926374 JQ926375 JQ926376 JQ926377 JQ926378 JQ926379 JQ926380 M. M. M. M. M. M. M. M. M. M. M. M. M. M. M. M. M. M. chrysodiscosporina chrysodiscosporina chrysodiscosporina chrysodiscosporina chrysomelanconium chrysomelanconium chrysomelanconium chrysomelanconium chrysomelanconium chrysomelanconium chrysomelanconium chrysomelanconium chrysomelanconium chrysorientalis chrysorientalis chrysorientalis chrysorientalis decorahensis MGJ MH1 MH2 MRi MCM MEH MEUK MGH MGL MGR MGS MGSt MGUK MGB MGP MGV MVH CBS 159.26* ascospore ascospore ascospore ascospore ascospore conidium conidium ascospore ascospore ascospore ascospore ascospore ascospore ascospore ascospore ascospore conidium ascospore JQ926243 JQ926244 JQ926245 JQ926246 JQ926247 JQ926248 JQ926249 JQ926250 JQ926251 JQ926252 JQ926253 JQ926254 JQ926255 JQ926256 JQ926257 JQ926258 JQ926259 JQ926260 JQ926315 JQ926316 JQ926317 JQ926318 JQ926319 JQ926320 JQ926321 JQ926322 JQ926323 JQ926324 JQ926325 JQ926326 JQ926327 JQ926328 JQ926329 JQ926330 JQ926331 JQ926332 JQ926381 JQ926382 JQ926383 JQ926384 JQ926385 JQ926386 JQ926387 JQ926388 JQ926389 JQ926390 JQ926391 JQ926392 JQ926393 JQ926394 JQ926395 JQ926396 JQ926397 JQ926398 M. M. M. M. M. M. M. M. M. M. M. M. M. M. decorahensis decorahensis echinata elegans elegans elegans elegans ellisii ellisii ellisii ellisii flavovirens flavovirens flavovirens MD MED DAOM 121196** CBS 131494* CBS 131617* BPI 843574** BPI 872067** BPI 843491** BPI 883227** BPI 883227** BPI 878343** MFA MFV MFV1 ascospore conidium stroma ascospore ascospore conidioma conidioma stroma conidioma stroma stroma conidium ascospore ascospore JQ926261 JQ926262 JQ926263 JQ926264 JQ926265 JQ926266 JQ926267 JQ926268 JQ926269 JQ926270 JQ926271 JQ926272 JQ926273 JQ926274 JQ926333 JQ926334 JQ926399 JQ926400 JQ926335 JQ926336 JQ926337 JQ926338 JQ926401 JQ926402 JQ926403 JQ926404 JQ926405 JQ926339 JQ926340 JQ926341 JQ926342 JQ926406 JQ926407 JQ926408 JQ926409 MFV2 MFV3 A.R. 3619 ascospore ascospore ascospore JQ926275 JQ926276 JQ926277 JQ926343 JQ926344 JQ926410 JQ926411 M. flavovirens M. flavovirens M. hyperopta 6 Fungal Diversity (2012) 57:1–44 Table 1 (continued) Taxon Strain/culture or specimen Isolated/extracted from ITS-LSU rpb2 tef1 M. M. M. M. M. M. M. M. M. M. M. M. A.R. 3832 CBS 114600* MCHBV MCHE MCL MCR MCS MHG MHP MHVA MSK MOA ascospore ascospore ascospore ascospore ascospore ascospore ascospore conidium ascospore conidium ascospore conidium JQ926278 JQ926279 JQ926280 JQ926281 JQ926282 JQ926283 JQ926284 JQ926285 JQ926288 JQ926287 JQ926286 JQ926289 JQ926345 JQ926346 JQ926347 JQ926348 JQ926349 JQ926350 JQ926351 JQ926352 JQ926353 JQ926354 JQ926355 JQ926412 JQ926413 JQ926414 JQ926415 JQ926416 JQ926417 JQ926418 JQ926420 JQ926419 JQ926421 JQ926422 MOK MOM MON MOS MOSJ MOSO MOU CBS 208.38* MSH MVS SPOD SPOD1 CBS 121894* CBS 109778* ascospore ascospore ascospore ascospore ascospore ascospore ascospore ascospore ascospore conidium ascospore conidium ascospore ascospore JQ926290 JQ926291 JQ926292 JQ926293 JQ926294 JQ926295 JQ926296 JQ926297 JQ926298 JQ926299 JQ926300 JQ926301 JQ926229 AF408374 JQ926356 JQ926357 JQ926358 JQ926359 JQ926360 JQ926361 JQ926362 JQ926363 JQ926364 JQ926365 JQ926366 JQ926367 JQ926302 EU219299 JQ926423 JQ926424 JQ926425 JQ926426 JQ926427 JQ926428 JQ926429 JQ926430 JQ926431 JQ926432 JQ926433 JQ926434 JQ926368 DQ836910 hyperopta hyperopta hyperopta hyperopta hyperopta hyperopta hyperopta hyperopta hyperopta var. orientalis hyperopta var. orientalis hyperopta var. orientalis meridionalis M. meridionalis M. meridionalis M. meridionalis M. meridionalis M. meridionalis M. meridionalis M. meridionalis M. ostryae M. spodiaea M. spodiaea M. spodiaea M. spodiaea Melanconis stilbostoma M. stilbostoma * DNA isolated from CBS cultures, ** from herbarium specimens chrysodiscosporina, M. chrysomelanconium, M. chrysorientalis, M. decorahensis, M. flavovirens, M. meridionalis and M. ostryae form a monophylum with moderate support (92–95 % PP) in the Bayesian trees (not shown). The three Bayesian runs revealed highly similar posterior probabilities. ML bootstrap support above 70 %, MP bootstrap support above 70 % and Bayesian posterior probabilities above 90 % are given in Fig. 2 at the first, second and third positions, respectively, above or below the branches. In most cases, ITS sequences were identical or nearly identical within the species. However, in one accession of M. chrysodiscosporina (MEL), the ITS showed major differences, and another accession of the same species (MCAn) had two different ITS copies, but both accessions had rpb2 and tef1 sequences identical to other accessions of M. chrysodiscosporina. Therefore, the ITS sequences of both deviating accessions were removed from the combined matrix before analysis. Molecular phylogenetic analyses of the nuLSU matrix (Fig. 1) confirmed that Melanconiella based on M. spodiaea is distinct from Melanconis, the latter represented in our study by its generic type, M. stilbostoma. In addition, monophyly of Melanconiella is highly supported, but its closest relatives within the Diaporthales remain uncertain due to partly low backbone support. Internal support is mostly lacking within Melanconiella in Fig. 1, but the basal position of M. ellisii/M. spodiaea, the position of their neighbour M. hyperopta and sister group relationship of M. hyperopta to all other Melanconiella species received high support (Fig. 1). All 13 Melanconiella species included in the LSU matrix are revealed as phylogenetically distinct (Fig. 1). Molecular phylogenetic analyses of the combined matrix revealed 12 distinct lineages within Melanconiella (Fig. 2), which are recognised at the species level, and one described at the varietal level. Of these, Melanconiella spodiaea and M. decorahensis have already been validly combined; five lineages represent already described taxa requiring formal transfer to Melanconiella (Diaporthe carpinicola, D. ellisii, D. flavovirens, D. hyperopta and D. ostryae); and five represent yet undescribed species. All species were Fungal Diversity (2012) 57:1–44 7 As C G co on Seq eo sp id u gr or ium en .o e c Ho rig colocoloe fr st ins ur ur om 100/75/98 Hosts Betula pendula Betula sp. Carpinus betulus Carpinus caroliniana Carpinus orientalis Corylus avellana Ostrya carpinifolia Ostrya virginiana Geographic origins A North America E Europe Morphology Ascospores/conidia hyaline Ascospores/conidia brown Sequence from A anamorph T teleomorph 100/100/100 M. chrysodiscosporina MGJ M. chrysodiscosporina MH2 M. chrysodiscosporina MCH M. chrysodiscosporina MGG M. chrysodiscosporina MEE M. chrysodiscosporina MRi 100/100/100 M. chrysodiscosporina MH1 M. chrysodiscosporina MCHA M. chrysodiscosporina MCAn 99/99/100 M. chrysodiscosporina MEL M. chrysomelanconium MGH 100/99/100 M. chrysomelanconium MGSt M. chrysomelanconium MGL M. chrysomelanconium MCM M. chrysomelanconium MEUK M. chrysomelanconium MGUK 100/100/100 M. chrysomelanconium MEH 100/100/100 M. chrysomelanconium MGR M. chrysomelanconium MGS 87/-/- M. chrysorientalis MGP M. chrysorientalis MGV M. chrysorientalis MVH 100/100/100 M. chrysorientalis MGB M. carpinicola MNM M. carpinicola MSMI M. carpinicola MNUK M. carpinicola MNP 100/100/100 M. carpinicola MSR M. carpinicola MENU 100/-/100 M. elegans CBS 131617 M. elegans BPI 872067 100/100/100 M. elegans CBS 131494 M. elegans BPI 843574 100/100/100 M. decorahensis MD 100/100/100 M. decorahensis MED M. decorahensis CBS 159.26 M. meridionalis MOA 100/100/100 M. meridionalis MOSO M. meridionalis MOK M. meridionalis MOM 72/-/- M. meridionalis MOSJ 100/100/100 M. meridionalis MOU M. meridionalis MOS 100/100/100 M. meridionalis MON M. ostryae CBS 208.38 M. flavovirens MFV 93/71/100 M. flavovirens MFV2 100/100/100 M. flavovirens MFV1 M. flavovirens MFA M. flavovirens MFV3 M. hyperopta MCHBV M. hyperopta MCR M. hyperopta MCS 100/100/100 M. hyperopta MCHE M. hyperopta MHG M. hyperopta MCL 100/100/100 M. hyperopta var. orientalis MHP 100/100/100 M. hyperopta var. orientalis MHVA M. hyperopta var. orientalis MSK M. hyperopta CBS 114600 M. spodiaea MSH 100/100/100 M. spodiaea SPOD M. spodiaea MVS 99/100/100 98/97/100 M. spodiaea SPOD1 82/72/92 M. ellisii BPI 843491 M. ellisii BPI 878343 100/99/100 M. ellisii BPI 883227 Ms. stilbostoma CBS 121894 Ms. stilbostoma CBS 109778 E E E E E E E E E E E E E E E E E E E E E E E E E E E E E A A A A E E A E E E E E E E E A E E E E E E E E E E E E E E E E E E E A A A E E T T T T A T T A A T T T T T A T A T T T T A T T T T T T A T A T A T A T A T T T T T T T T T T T A T T T T T A T T A T T T T A A T T A T T 0.005 substitutions/site Fig. 2 Phylogram of the best ML tree (lnL0−16890.279) revealed by RAxML from an analysis of the combined ITS-LSU-rpb2-tef1 matrix of Melanconiella, with Melanconis stilbostoma selected as outgroup. ML and MP bootstrap support above 70 % and Bayesian posterior probabilities above 90 % are given at the first, second and third positions, respectively, above or below the branches. Strain/culture or herbarium specimen are given following the taxon names; holo- or epitype strains/specimens are formatted in bold 8 molecularly highly distinct and received high internal support. The clade containing M. ellisii and M. spodiaea was placed as sister to the other species with medium (MP) to high (ML, BA) support (Fig. 2), and within the latter, M. hyperopta was sister clade to the residual lineages with high support. Also the two species of Melanconiella on Ostrya (M. meridionalis, M. ostryae) form a highly supported clade. Melanconiella chrysodiscosporina, M. chrysomelanconium and M. chrysorientalis, which are highly similar in their stroma and ascospore features, consistently formed a highly supported monophylum in nuLSU and combined analyses, and relationships within that clade also received high support. Fungal Diversity (2012) 57:1–44 Chrysostromae of his subgenus Eumelanconis, except for M. carthusiana, M. desmazierii, M. juglandis, M. pallida and M. platystroma, which do not belong here. Wehmeyer’s (1941) sect. Stilbostomae corresponds to Melanconis sensu stricto, although M. apocrypta, M. antarctica and M. fennica may not belong there. Melanconis everhartii has been recognized in Macrodiaporthe. Other subgenera that Wehmeyer (1941) recognized in Melanconis have been transferred or relocated to other genera, such as Chapeckia (Barr 1978), Hapalocystis (Jaklitsch and Voglmayr 2004), Macrodiaporthe, Massariovalsa (Barr 1978), Prosthecium (Voglmayr and Jaklitsch 2008), Pseudovalsa (M. modonia, De Silva et al. 2009) and Pseudovalsella (von Höhnel 1918). Anamorph-teleomorph relationships and cultures Molecular phylogeny, species delimitation and barcoding For each Melanconiella species, a single characteristic anamorph could be identified by DNA data obtained from ascospore and conidial cultures or directly from ascomata and conidiomata, apart from M. echinata for which no anamorph is known. Both dark brown melanconium-like conidia as well as hyaline discosporina-like conidia were present within the genus Melanconiella, but both were never found within the same species; conidial morphology was constant within a species. The production of dark brown and hyaline conidia did not correlate with phylogenetic relationships, but in several cases, phylogenetic species pairs with one having hyaline, the other dark brown conidia were revealed (M. chrysodiscosporina/M. chrysomelanconium; M. meridionalis/M. ostryae). Culture characteristics like growth rates, morphological patterns of colonies on MEA and pigment formation were observed to be highly distinct for each species (Fig. 3). Conidiation was not observed on MEA cultures, but one PDA culture of M. elegans produced aberrant conidia of variable shapes, the size of which was within the range observed on the natural substrate. Discussion Circumscription of the genus Melanconiella Morphologically Melanconiella is similar to Melanconis. Species of the latter genus cause more conspicuous bumps in the bark of the hosts than those of Melanconiella and form light-coloured, white or yellowish ectostromatic discs. Wehmeyer (1941) used this trait to distinguish his section Stilbostomae from his Chrysostromae, which are characterized by dark coloured discs. Light coloured discs are not uncommon in Melanconiella, as exemplified by e.g. M. hyperopta or M. meridionalis. Melanconiella as circumscribed here basically matches Wehmeyer’s (1941) section Extensive morphological and molecular phylogenetic data for Melanconiella reveal high species diversity within this genus. Most of the phylogenetically distinct species of Melanconiella show a suite of teleomorph characteristics enabling species identification based on morphology. In some cases, teleomorph features do not allow distinction of closely related species, but host association as well as anamorphteleomorph relationships provide important information for reliable identification. As in many host-specific ascomycetes inhabiting recently dead corticated branches, knowledge of the host is crucial for correct species identification. At present the genus Melanconiella does not appear to belong to any established family within the Diaporthales. Phylogenetic analyses remain inconclusive about its relationships within the order (Fig. 1). Although previously placed as a synonym of Melanconis in the Melanconidaceae, this genus and thus the family have been shown to be closely related to the Gnomoniaceae (Fig. 1). Within the genus Melanconiella, all terminal branches are highly supported, however, the infrageneric relationships remain often unresolved due to lack of backbone support (Fig. 2). The short branch lengths in the phylograms indicate that speciation occurred within a short time frame, obscuring the evolutionary relationships. The ITS region has been proposed as the primary barcoding locus for fungi (Schoch et al. 2012). In most accessions of Melanconiella sequenced in our study, the ITS enabled unequivocal identification. However, in M. chrysodiscosporina we found a deviating sequence in one accession and two different ITS copies in another accession, whereas both accessions had rpb2 and tef1 sequences identical to other accessions of M. chrysodiscosporina. This variation indicates that the ITS region is not always suitable for reliable species identification, and results of ITS barcoding have to be treated with caution. In addition, it also demonstrates that a polyphasic approach is necessary in species- Fungal Diversity (2012) 57:1–44 9 a b c d e f g h i j k l Fig. 3 Melanconiella cultures on MEA at room temperature, all after 20 d except where noted. a. M. carpinicola (MSMI). b. M. chrysodiscosporina (MGJ). c. M. chrysomelanconium (MEH, 28 d). d. M. chrysorientalis (MGB). e. M. decorahensis (MED). f. M. elegans (AR3830, 25 d). g. M. flavovirens (MFV3). h. M. flavovirens (MFA, 63 d). i. M. hyperopta (MCL). j. M. hyperopta var. orientalis (MHP, 31 d). k. M. meridionalis (MOM, 65 d). l. M. spodiaea (MSH, 28 d) 10 Table 2 List of Melanconiella species, their hosts and distribution. Taxa in bold represent new species, varieties or combinations Fungal Diversity (2012) 57:1–44 Host species Melanconiella species Distribution Betula spp. C. betulus C. betulus C. betulus C. betulus C. betulus, C. orientalis C. caroliniana C. caroliniana C. caroliniana C. orientalis C. orientalis Corylus avellana Ostrya carpinifolia O. virginiana M. decorahensis M. carpinicola comb. nov. M. chrysodiscosporina sp. nov. M. chrysomelanconium sp. nov. M. hyperopta comb. nov. M. spodiaea M. echinata sp. nov. M. elegans sp. nov. M. ellisii comb. nov. M. chrysorientalis sp. nov. M. hyperopta var. orientalis var. nov. M. flavovirens comb. nov. M. meridionalis sp. nov. M. ostryae comb. nov. Europe, North America Europe Europe Europe Europe Europe North America North America North America Europe Europe Europe, ?North America Europe Europe rich groups for robust and reliable identification, and it is important to sequence also other genes (e.g. Gazis et al. 2011). ITS alone is definitely not sufficient to provide reliable characterisation of closely related species in many ascomycete lineages (e.g. Voglmayr & Jaklitsch 2008; Jaklitsch 2009, 2011; Pavlic et al. 2009; Druzhinina et al. 2010; Jaklitsch et al. 2012). Biodiversity and nomenclature of Melanconiella on Carpinus Until now, only two species of Melanconiella (usually as Melanconis) have been commonly recognised on Carpinus: the brown-spored M. spodiaea and the hyaline-spored M. chrysostroma. This was mainly influenced by Wehmeyer (1941), who was subsequently widely followed, e.g. by Ellis and Ellis (1997). Wehmeyer (1941) listed numerous synonyms for M. chrysostroma, however, he may not have examined all of the numerous authentic or type specimens he cited, as re-examination of several type specimens revealed that they are not even diaporthalean (see below). According to the spore size (14–23×3.5–7 μm) listed in Wehmeyer (1941), his concept of M. chrysostroma was apparently based on a mixture of M. carpinicola and M. hyperopta. Wehmeyer (1941) also established Melanconis chrysostroma var. ellisii for North American collections from Carpinus, which were considered to differ mainly by smaller ascospores. Present investigations show that M. chrysostroma cannot be retained, because it is an obligate synonym of Wuestneia xanthostroma (see below). The molecular phylogenetic investigations show that specimens referred to as M. chrysostroma are highly heterogeneous, consisting of at least eight species. Three of these taxa (M. carpinicola, M. ellisii, M. hyperopta) have been described in the 19th century with accurate descriptions, but had been synonymised under M. chrysostroma. Anamorphs Our pure culture and DNA sequence data revealed the presence of a single, characteristic anamorph for each species of Melanconiella, which is either melanconium- or discosporinalike. This contrasts with Wehmeyer (1937, 1941), who recorded at least two different types of conidia (alpha and beta) for several species now placed in Melanconiella. In his pure culture studies of M. decorahensis, M. ellisii and M. ostryae, he reported the production of only a single anamorph, and his conclusions on alpha- and beta-conidia were mainly based on associations found in herbarium specimens. Knowing that several species of Melanconiella can co-occur on the same branch, it is not surprising that this observational evidence resulted in recording different conidial forms for one species. Several of the anamorphs of Melanconiella have been described as species of Melanconium. According to Sutton (1980), more than 200 binomials have been described in Melanconium, and no generic revision is available. As many of the Melanconium binomials date back to the early 19th century, they cannot be interpreted based on the scanty original descriptions, which often indicate a mixture of discordant elements based on the hosts listed. Original material is often not extant, in bad condition, or unavailable for examination. In addition, the few morphological characters and the similarity of many Melanconium species are serious obstacles for appropriate interpretation. Most Melanconium names have not been used in the last decades. Therefore, clear preference should be given to the teleomorph epithets, which are mostly well interpretable, as well as to the respective teleomorph genera that were historically associated with Melanconium. In addition to Melanconium, species of the anamorph genera Discosporium and Discosporina have been linked to teleomorphs now placed in Melanconiella. According to Sutton (1980), the teleomorph of the type species of Discosporium, Fungal Diversity (2012) 57:1–44 D. populeum (Sacc.) Sutton, is Cryptodiaporthe populea (Sacc.) Butin (now Plagiostoma populinum (Fuckel) L.C. Mejía; Mejía et al. 2011b). All Discosporium species attributable to Melanconiella have been transferred to Discosporina (Petrak 1962); of the four species placed in Discosporina, three (D. carpinicola and D. deplanata from Carpinus; D. sulphurea from Corylus) are anamorphs of Melanconiella, but only D. sulphurea can be unequivocally attributed to a species, viz. M. flavovirens, the latter having priority. Ecology and host range Like many Diaporthales inhabiting woody plants, all species of Melanconiella are restricted to recently dead corticated branches of their hosts, often colonising extensive parts. This is indicative of weak pathogenicity or opportunistic growth, which appears to be common within the Diaporthales. As the Diaporthales have been shown to be common endophytes in broadleaf trees, often remaining dormant until host tissue senescence (Sieber 2007), species of Melanconiella may be widely present in healthy branches. This is supported by the rapid and extensive development of Melanconiella anamorphs commonly observed on recently cut branches. All species of Melanconiella were observed to be highly host-specific as they were found to be confined mostly to a single, sometimes a few closely related hosts (Table 2). It is not surprising that we found a new species and variety on Carpinus orientalis (M. chrysorientalis, M. hyperopta var. orientalis) and a new species on Ostrya carpinifolia (M. meridionalis), hosts that are largely understudied. Whereas most host genera of Melanconiella harbour only a single or two species that do not co-occur in the same area, the situation is markedly different with Carpinus, which harbours the vast majority of Melanconiella biodiversity. On Carpinus betulus, several species of Melanconiella can co-occur in close vicinity, sometimes even on the same branches, which can pose problems for identification. However, there appears to be some ecological differentiation. Some species were only found on 11 branches still attached to the tree in open habitats (e.g. M. carpinicola, M. chrysomelanconium), whereas others mostly occurred on recently fallen or cut branches within forests (M. hyperopta, M. chrysodiscosporina), or were concentrated on branches still attached to the trees within forests (M. spodiaea). Some of the species also show different seasonality. While M. hyperopta has mainly been found in the winter season from late autumn to spring, M. carpinicola, M. chrysodiscosporina and M. chrysomelanconium were mostly found in the summer season from late spring to autumn. The reasons for this evolutionary radiation on a single host genus are unknown, but similar cases are known for other corticolous ascomycetes, e.g. Prosthecium (Voglmayr and Jaklitsch 2008) or Massaria (Voglmayr and Jaklitsch 2011), where biodiversity is concentrated on the host genus Acer. In those cases, co-occurrence of several related species on the same host has been observed, indicating that this may be a widespread phenomenon in weakly pathogenic corticolous ascomycetes. Geographic distribution Inhabiting hosts belonging to the temperate family Betulaceae, the genus Melanconiella is confined to the north temperate zone. Remarkably, the diversity of Melanconiella is highest in Europe with currently nine species and one variety, followed by North America with five confirmed species. The report of M. spodiaea on Castanea crenata from Japan by Kobayashi (1970) is likely based on a misidentification. The only additional Asian record referable to Melanconiella has been recently published by Vasilyeva and Stephenson (2010), who report M. ellisii (as M. carpinigera) from the Russian Far East. Considering that several taxa were included in M. ellisii until the current study, detailed morphological and DNA studies are necessary to reveal its true identity. There is little species overlap between Europe and North America; only M. decorahensis has been confirmed for both continents in the present study, whereas conspecificity of North American and European accessions of M. flavovirens remains to be verified. Taxonomy Key to the genera Melanconis and Melanconiella Ectostroma conspicuous, typically projecting up to 1 mm above the substrate, light coloured, white, cream or yellowish; conidia brown .............................................................................................................................................................. Melanconis Ectostroma inconspicuous, typically projecting up to 0.5 mm above the substrate, light or dark coloured; conidia hyaline or brown ............................................................................................................................................ Melanconiella Melanconis Tul. & C. Tul., Selecta fung carpol (Paris) 2:115 (1863), emend. Type: Melanconis stilbostoma (Fr.) Tul., Ann Sci nat, ser 4, 5:109 (1856). Pseudostromata consisting of a well-developed, conspicuous, distinctly erumpent, light coloured, white or yellow ectostromatic disc causing a coarsely pustulate bark surface. Ectostromatic disc surrounded by bark or not. Central 12 column beneath the disc more or less conical, comprising hyaline hyphae mixed with a hyaline or light-coloured powdery amorphous substance; residual entostroma between perithecia of scant hyaline hyphae. Stromatic zones lacking. Perithecia often appearing as rounded bumps beneath the bark surface surrounding the ectostromatic disc, oblique or horizontal, often arranged in a circle around the central column, with long lateral ostioles that converge at the margin of the column and emerge at the margin or within the ectostromatic disc, flat discoid or slightly projecting and convex, typically not obscuring the disc. Paraphyses broad bands, deliquescent at maturity. Asci oblong or fusoid, octosporous, with an apical ring typically distinct when fresh; asci becoming detached from their base. Ascospores hyaline, ellipsoid, bicellular, with a central or slightly eccentric, not or slightly constricted septum, smooth, with or without blunt or pointed appendages. Conidial state: melanconium-like. Conidiomata acervular; typically possessing the same type of ectostromatic disc and central column as the teleomorph, usually preceding it. Conidiophores branched only at the base, septate, fewcelled, smooth, hyaline. Conidiogenous cells annellidic. Conidia brown, ellipsoid or subglobose. Melanconiella Sacc., Syll Fung 1:741 (1882), emend. Type: Melanconiella spodiaea (Tul.) Sacc., Syll Fung 1:741 (1882); lectotype designated by Müller and von Arx (1962). Pseudostromata consisting of an inconspicuous, erumpent, light or more frequently dark coloured ectostromatic disc or pulvillus (referred to as ectostromatic disc below) causing a more or less pustulate bark surface. Ectostromatic disc convex, flat or concave, variously coloured, surrounded by bark or not. Central column beneath the disc more or less conical, comprising hyaline or pigmented hyphae mixed with a pigmented, most commonly cream, yellow, olive, brownish or gray, powdery amorphous substance; residual entostroma between perithecia mostly of scant hyphae. Stromatic zones lacking. Perithecia inconspicuous at the bark level or appearing as rounded bumps beneath the bark surface surrounding the ectostromatic disc, oblique or horizontal, scattered or often arranged in a circle around the central column, with long lateral ostioles that converge at the margin of the central column or within. Ostioles emerging in various positions in the ectostromatic disc, flat in the disc or slightly projecting, rarely distinctly projecting and cylindrical, often obscuring the disc. Paraphyses broad bands, deliquescent at maturity. Asci oblong or fusoid, octosporous, with a distinct apical ring, becoming detached from their base. Ascospores hyaline, yellowish or brown, fusoid or ellipsoid, bicellular, with a central or slightly eccentric, not or slightly constricted septum, smooth; wall Fungal Diversity (2012) 57:1–44 swelling in water mounts or not, with or without short, blunt appendages and sometimes with a narrow gelatinous sheath. Conidial state: melanconium- or discosporina-like. Conidiomata acervular, peridermal or subperidermal; possessing the same type of ectostromatic disc and central column or lighter than that of the teleomorph, usually preceding it. Conidiophores branched and septate only at the base, few-celled, smooth, hyaline to light brown. Conidiogenous cells annellidic (in melanconium-like conidiation) or phialidic (in discosporina-like conidiation). Conidia brown or hyaline, ellipsoid, subglobose, ovoid or oblong, with or without distinct hyaline sheath. Notes: In the original description of Melanconiella, Saccardo (1882) mentioned uniseptate ascospores becoming brown at maturity and he listed two species, M. spodiaea and M. chrysostroma, without selecting a generic type. Although Clements and Shear (1931) lectotypified the genus with M. chrysostroma, this species is in serious conflict with the generic protologue, as it is an obligate synonym of Wuestneia xanthostroma (see below), a taxon of the Diaporthales with one-celled, hyaline ascospores. The lectotypification of Clements and Shear (1931) is therefore superseded according to the ICBN Art. 9.17(b). We agree with Müller and von Arx (1962) who considered M. spodiaea to be the type species of Melanconiella and thus the lectotypification is attributed to them. Anamorphs of Melanconis and Melanconiella are usually referred to as Melanconium. Although Melanconium Link, Mag. Gesell. naturf. Freunde, Berlin 3(1–2): 9 (1809) is older than the teleomorph genera, it is not used here. Its type species M. atrum is said to occur on Fagus sylvatica (Sutton 1980), but intense searches for many years has not yielded any Melanconium on Fagus. Re-examination of the lectotype of M. atrum (K(M) 171588) revealed conidia with a lighter brown equatorial zone and a size of 10–13×6–8 μm, which do not fit known anamorphs of Melanconiella. Conidial size and morphology of M. atrum is similar to the anamorph of Melanconis alni, which, however, does not occur on Fagus. Identity, systematic affiliation and phylogenetic position of Melanconium atrum are therefore obscure. Melanconiella carpinicola (Fuckel) Voglmayr & Jaklitsch, comb. nov. (Fig. 4) MycoBank MB 800113 Basionym: Diaporthe carpinicola Fuckel, Jb Nassau Ver Naturk 27–28:37 (1874) [1873–74]. Synonym: Diaporthe kunzeana Sacc., Nuovo Giorn Bot Ital 8:180 (1876) (type not seen). Pseudostromata 0.8–1.7 mm diam, inconspicuous, slightly projecting or not, perithecia only rarely projecting; centre bluntly conical. Ectostromatic disc circular or oblong, Fungal Diversity (2012) 57:1–44 13 a b d f e j i c l k r s t g h m n o p q u v w x y c1 z d1 a1 e1 f1 g1 b1 h1 i1 j1 Fig. 4 Melanconiella carpinicola. a. Panoramic view of pseudostromata. b. Pseudostroma in transverse section showing central column and perithecia immersed in the entostroma. c. Pseudostroma showing perithecial bumps, ectostromatic disc and ostioles in surface view. d–f. Ectostromatic discs and ostioles in surface view. g, h. Transverse section below ectostromatic disc. i. Ascus. j. Ascus tip with apical ring. k–y. Ascospores. z. Conidioma in surface view. a1. Transverse k1 l1 m1 section of conidioma, showing central column. b1, c1. Conidiophores. d1–m1. Conidia. k, l in 3 % KOH, all other mounts in water. a02 mm, b, c, z, a10500 μm, d–h0300 μm, i–y, b1–m1010 μm. Sources: a, m. WU 31806; b, c, f, h. WU 31802; d, g, k, l. G 00111395 (lectotype); i, j, n–s. WU 31801; t–y, c1, f1, g1, h1. WU 31805; z–b1, i1–m1. WU 31807; d1, e1. M-0177882 (isotype) 14 cream, pale yellowish to dark brown or black, 0.15–0.6 mm long, sometimes concealed by densely arranged ostioles, often pulvinate; bark often darkened in a ring around the disc. Central column grey. Entostroma indistinct. Ostioles 1–10 per disc, 40–125 μm diam, plane or slightly papillate, black. Perithecia 0.3–0.5 mm diam, arranged in various configurations. Asci fusoid, (60–)67–82(–92)×8–11(–13) μm (n029), containing 8 irregularly biseriate ascospores, with apical ring distinct when fresh, 2.5–2.8 μm diam, 1.3– 1.8 μm high, only faintly visible in older herbarium specimens. Ascospores hyaline, fusoid, distinctly constricted at the septum, (12–)15–18(–22)×(3.0–)3.8–5.3(–6.5), l/w0 (2.5–)3.1–4.3(–6.2) (n0388) μm; without appendages; cells dimorphic, upper cell mostly larger, with subacute end, lower cell narrowly rounded, multiguttulate containing mostly one large and numerous small guttules per cell; wall ca. 0.2–0.4 μm thick, not swelling. Anamorph: discosporina-like. Conidiomata 1–2.5 mm diam, visible as darker spots, mostly with central or eccentric stromatic column; at maturity covered by whitish discharged conidial masses. Conidiogenous cells phialidic, 10– 18×1.5–2.5 μm, hyaline. Conidia hyaline, elongate to suballantoid, (10–)12–14(–15.5)×(2.7–)3.2–3.7(–4.0) μm, l/ w0(2.8–)3.3–4.2(–5.1) (n0115), multiguttulate; wall ca. 0.2–0.4 μm, without gelatinous sheath. Culture: Colony on MEA after 17 d at room temperature ca. 55 mm diam, without a distinct radial arrangement of surface hyphae, first white, turning dull yellow, eventually dark brown; aerial hyphae frequent only in the centre; diffusing pigment lacking. Habitat and host range: dead corticated twigs and branches of Carpinus betulus attached to the tree; it has only been found in open sites like forest edges and hedges. Distribution: Europe; uncommon but widely distributed. Typification: GERMANY, Hessen, near Oestrich, on dry branches of Carpinus betulus, autumn, L. Fuckel, Fungi Rhenani 2660 (G 00111395, lectotype of Diaporthe carpinicola here designated; M-0177882, M-0177883 and WU: isotypes). AUSTRIA, Niederösterreich, Michelbach Markt, Mayerhöfen, map grid 7860/4, on corticated branches of Carpinus betulus, 18 June 2011, H. Voglmayr & W. Jaklitsch, strain MSMI (from teleomorph) (WU 31801, epitype of Diaporthe carpinicola here designated; ex-epitype culture CBS 131706), ex-epitype sequences JQ926235 (ITS-LSU), JQ926307 (rpb2), JQ926373 (tef1). Additional specimens examined: AUSTRIA, Kärnten, St. Margareten im Rosental, Kramerstrauch, map grid 9452/4, 12 May 2010, H. Voglmayr, strain MNM (from teleomorph) (WU 31802). ibid., 6 July 2002, W. Jaklitsch, strain A.R. 3883 (from teleomorph) (BPI 841338). ibid., Gupf, near Brici (Writze), 6 July 2006, W. Jaklitsch, W.J. 2924 (WU 31803). ibid., Trieblach, near Ledra, soc. M. chrysomelanconium, 7 June 1996, W. Jaklitsch, W.J. 891 (WU 31804). Oberösterreich, Fungal Diversity (2012) 57:1–44 Raab, map grid 7647/2, soc. M. chrysomelanconium, 1 Aug. 2010, H. Voglmayr, strain MSR (from teleomorph) (WU 31805). GERMANY, Sachsen-Anhalt, Eisleben, Oct. 1875, G. Winter, Thümen, Mycoth. Univ. 469 (WU). SLOVENIA, Gorenjska, Povodje, 16 May 2010, H. Voglmayr & W. Jaklitsch, strain MNP (from teleomorph) (WU 31806). SWEDEN, Skåne, Äsphult par., Forshult, 8 July 1978, K. & L. Holm (UPS 412042a, as Melanconis chrysostroma). UNITED KINGDOM, West Yorkshire, Wakefield, Newmillerdam N Barnsley, Newmillerdam Country Park, soc. M. chrysomelanconium, 17 May 2011, H. Voglmayr & W. Jaklitsch, strains MNUK (from teleomorph), MENU (from anamorph) (WU 31807, culture CBS 131700). Notes: Melanconiella carpinicola is well characterised by protruding and narrowly aggregated ostioles mostly at the margin of a small inconspicuous ectostromatic disc, which, at low magnification, gives them a typical appearance of distinct, small, elevated, black bumps on the twigs. In addition, its small ascospores without swelling walls in combination with its growth on Carpinus betulus are distinctive. Ecologically, this species is apparently confined to open habitats, where it is commonly associated with M. chrysomelanconium even on the same twigs. When co-occurring, the areas of both species can be easily distinguished by their abundant conidiomata which produce hyaline conidia in M. carpinicola and dark brown conidia in M. chrysomelanconium. The description of conidia by Fuckel (1874) is in agreement with our data; the anamorph-teleomorph connection was proven in the present study by DNA data from conidial and ascospore cultures. Considering the preservation and abundance of the collection, the part of Fuckel’s original collection of Herbier Barbey-Boissier housed in G is designated as lectotype here. To ensure nomenclatural stability, a recent collection, for which a culture and sequences are available, is designated here as epitype. Although no type specimen could be located and investigated, Diaporthe kunzeana is clearly a synonym of M. carpinicola according to the general description, particularly the ascospore size (16–19×3.5–4 μm) and host given in Saccardo (1876). Melanconiella chrysodiscosporina Voglmayr & Jaklitsch, sp. nov. (Fig. 5) MycoBank MB 800114 Etymology: referring to the yellow stroma and the discosporina-like anamorph. Pseudostromata typically indistinct, ill-defined, confluent, irregular, sometimes with circular outline, 1.5–3.4 mm diam, typically projecting by less than 0.5 mm; perithecial bumps sometimes distinct. Ectostromatic disc minute, 0.2– 0.6(–0.8) mm long, circular when young, then usually Fungal Diversity (2012) 57:1–44 15 a b d i f e j k q c g m l r s h n t u o p v w a1 x b1 y c1 d1 e1 z f1 g1 h1 Fig. 5 Melanconiella chrysodiscosporina. a. Panoramic view of pseudostromata. b. Pseudostroma in transverse section. c. Three pseudostromata in surface view. d–g. Ectostromatic discs and ostioles in surface view. h. Transverse section below ectostromatic disc. i. Ascus. j. Ascus tip with apical ring. k–w. Ascospores (k, w showing appendages). x. Conidioma in surface view. y. Transverse section of conidioma, showing central column. z, a1. Conidiophores. b1–h1. Conidia. All mounts in water. a02 mm, b, c, x, y0500 μm, d–h0 300 μm, i–w, z–h1010 μm. Sources: a, e. WU 31861; b–d, x, y, b1–f1. WU 31867; f, g. WU 31864; h, z, a1. WU 31862; g1, h1. WU 31824 narrowly fusoid-oblong-linear, often filled by ostioles, light or bright yellow or greyish to shades of brown. Central column yellow, greyish yellow, yellow-olive or (light) olive. Entostroma crumbly, of subhyaline to yellowish hyphae. Ostioles 1–8(–10) per disc, 50–160 μm diam, variously arranged in the disc, black, short papillate, 16 apically rounded or flat, sometimes acute with tips 15– 30 μm wide, only slightly projecting above the disc level. Perithecia 0.3–0.8 mm. Asci cylindrical to fusoid, (90–)100–119(–127)×(10–)11–15(–18) μm (n039), containing 8 uni- or irregularly biseriate ascospores, with distinct apical ring, 3.0–3.8 μm diam, 2.0–3.3 μm high. Ascospores hyaline, broadly ellipsoid, not constricted at the septum, (15.5–)17–20(–22) × (6.2–)7.2–10.0(–14.5) μm, l/w 0(1.4–)1.9–2.4(–2.9) (n 0276); ends broadly rounded to truncate, with hyaline cap-like appendages 1–2.5 μm long, 2.2–5.2 μm wide, fading and eventually absent in microscope mounts; cells monomorphic, multiguttulate with one large and numerous small guttules per cell; wall distinctly swelling and sometimes distinctly bulging particularly at the septum, 0.6–1.4 μm thick, becoming ca. 1.2–4.7 μm thick at the septum. Anamorph: discosporina-like. Conidiomata 0.7–4.7 mm diam, visible as often lobed, darker spots lined by a distinct dark brown to blackish marginal zone, with a central or eccentric stromatic column; at maturity covered by whitish discharged conidial masses. Conidiogenous cells phialidic, 18–32×2.5–4.5 μm, hyaline. Conidia hyaline, ellipsoid, oblong or cylindrical, (12–)13–15.5(–19)×(4.3–)4.8–5.5(– 6.5) μm, l/w0(2.1–)2.4–3.2(–4) (n0227), with two large and numerous small guttules; wall ca. 0.4 μm thick, with distinct gelatinous sheath ca. 0.6–0.8 μm thick. Culture: Colony on MEA after 17 d at room temperature ca. 56 mm diam, not zonate, surface sometimes appearing mottled due to varying mycelial density, aerial hyphae irregularly arranged, abundant only in the centre or causing a finely floccose surface; first whitish or pale yellowish, turning brown from the centre, margin turning dull yellowbrown or black; diffusing pigment lacking; odour indistinct. Habitat and host range: dead corticated twigs and branches of Carpinus betulus mostly lying on the ground. Distribution: confined to Europe where it is common. Type: AUSTRIA, Niederösterreich, Michelbach Markt, Mayerhöfen, map grid 7860/4, on corticated branches of Carpinus betulus, 20 June 2009, W. Jaklitsch & H. Voglmayr, strain MCH (from teleomorph) (WU 31859, holotype; ex-holotype culture CBS 125597), ex-holotype sequences JQ926238 (ITS-LSU), JQ926310 (rpb2), JQ926376 (tef1). Additional specimens examined (all on Carpinus betulus): AUSTRIA, Kärnten, St. Margareten im Rosental, map grid 9452/4, 23 Sep. 2010, H. Voglmayr & W. Jaklitsch (WU 31860). Niederösterreich, Gießhübl, Seewiese, map grid 7863/3, 6 June 2010, H. Voglmayr, strain MGG (from teleomorph) (WU 31861). Gießhübl, Wassergspreng, map grid 7963/1, 15 Aug. 2010, H. Voglmayr (WU 31862). Hardegg, Merkersdorf, Semmelfeld, map grid 7161/3, 8 Aug. 2010, W. Jaklitsch & H. Voglmayr (WU 31863). Mannersdorf am Leithagebirge, Schweingraben, map grid 8065/2, soc. M. hyperopta (teleomorph), 17 April 2010, H. Fungal Diversity (2012) 57:1–44 Voglmayr & I. Greilhuber, strain MCAn (from anamorph) (WU 31824). Michelbach Markt, Mayerhöfen, map grid 7860/4, soc. M. chrysomelanconium, 20 June 2009, W. Jaklitsch & H. Voglmayr, strain MCH (WU 31864). ibid., 3 June 2000, W. Jaklitsch, W.J. 1464 (BPI 747940, WU 31872). Mödling, Hinterbrühl, map grid 7963/2, 20 June 2010, H. Voglmayr (WU 31865). Oberösterreich, Raab, Riedlhof, map grid 7647/2, 4 April 2010, H. Voglmayr, strain MRi (from teleomorph) (WU 31866). Steegen, Rittberg, map grid 7648/3, 28 June 2010, H. Voglmayr, strain MEE (from anamorph) (WU 31867). Wien, Döbling, Hermannskogel, map grid 7763/2, 18 April 2010, H. Voglmayr, strains MH1, MH2 (from teleomorph), MCHA (from anamorph) (WU 31868). Favoriten, Laaerbergstraße, map grid 7864/3, 8 April 2010, W. Jaklitsch & H. Voglmayr, strain MEL (from teleomorph) (WU 31869). Floridsdorf, Jedlersdorferstraße/Marchfeldkanalweg, map grid 7764/1, soc. M. chrysomelanconium, 9 May 2010, W. Jaklitsch, strain MGJ (from teleomorph) (WU 31870, culture CBS 131703). Liesing, Maurerwald, map grid 7863/1, soc. M. chrysomelanconium, 10 July 1993, W. Jaklitsch (WU 15980). CZECH REPUBLIC, Moravia, Lednice, palace grounds, 1 Oct. 2010, W. Jaklitsch & H. Voglmayr (WU 31871). SWEDEN, Skåne, Äsphult par., Forshult, 8 July 1978, K. & L. Holm (UPS 412042b, as Melanconis chrysostroma). Notes: Melanconiella chrysodiscosporina is similar to the two closely related species M. chrysomelanconium and M. chrysorientalis, differing mainly in ITS, rpb2 and tef1 sequences; in addition M. chrysomelanconium has dark brown conidia and slightly larger ascospores than those of M. chrysodiscosporina and M. chrysorientalis occurs on a different host, Carpinus orientalis. Melanconiella chrysodiscosporina is most commonly found on recently cut branches lying on the ground, where it is often associated with M. hyperopta. As M. chrysodiscosporina has sometimes been found to co-occur on the same branches with the highly similar M. chrysomelanconium, reliable species identification is only possible on anamorph traits. The anamorph-teleomorph connection was repeatedly proven by DNA data from conidial and ascospore cultures. Melanconiella chrysomelanconium Voglmayr & Jaklitsch, sp. nov. (Fig. 6) MycoBank MB 800115 Etymology: referring to the yellow stroma and the melanconium-like anamorph. Pseudostromata 1.5–2.6 mm diam, more or less circular, typically prominent, usually causing distinct bumps in the bark, but often densely aggregated or confluent, projecting to ca. 0.5 mm; individual perithecial contours causing small bumps in the bark. Ectostromatic disc small, 0.2–0.7(–0.9) Fungal Diversity (2012) 57:1–44 17 a b d i c f e g h j k l m n o p q r s t u x v y w z a1 b1 Fig. 6 Melanconiella chrysomelanconium. a. Panoramic view of pseudostromata. b. Pseudostroma in transverse section. c. Pseudostroma showing ectostromatic disc and ostioles in surface view. d–g. Ectostromatic discs and ostioles in surface view. h. Transverse section below ectostromatic disc. i. Ascus. j. Ascus tip with apical ring. k–u. Ascospores (k–n, s, u showing appendages). v. Conidioma in surface c1 view. w. Transverse section of conidioma (left), showing central column, and of young stroma and perithecium (right). x. Conidiophores. y–c1. Conidia. All mounts in water. a02 mm, b, c, v, w0500 μm, d– h0300 μm, i–u, x–c1010 μm. Sources: a, d, e, j. WU 31878; b, i, p–s. WU 31874; c, x–c1. WU 31879; f–h, o, w. WU 31875; k, l. WU 31873; m, n. WU 31876; t, u. WU 15180; v. WU 31877 18 mm, usually fusoid or oblong, sometimes circular, yellow, yellow-brown, greyish yellow or light to dark brown. Central column often crumbly, bright yellow, grey, brown, olive. Entostroma inconspicuous or crumbly and olive. Ostioles 1– 10 (commonly up to 6) per disc, 50–160 μm diam at their base, ca. 30–65 μm at their tips, variably located in the disc, papillate or with flat apex, brown or shiny black. Perithecia 0.4–0.8 mm diam; connection to the central column often difficult to ascertain. Asci cylindrical, (93–)109–128(–133)×(12–)14–19(–22) μm (n022), containing 8 uni- or irregularly biseriate ascospores, with distinct apical ring, 3.5–4.5 μm diam, 2.4–3 μm high. Ascospores hyaline, broadly ellipsoid, not constricted at the septum, (16–)19–23(–27.5)×(7.5–)9.0–12.3(–15.5) μm, l/w0(1.1–)1.8–2.2(–2.6) (n0307); ends broadly rounded to truncate, with hyaline cap-like appendages 1.7–3 μm long, 3–5.4 μm wide, fading and disappearing in microscope mounts; cells monomorphic, multiguttulate with one large and numerous small guttules per cell; wall 0.6–2.6 μm thick, distinctly swelling particularly at the septum, sometimes distinctly bulging out becoming 1.5–4.8 μm thick at the septum. Anamorph: melanconium-like. Conidiomata 0.6–4 mm diam, visible as dark brown to blackish spots, with central or eccentric stromatic column; at maturity covered by black discharged conidial masses. Conidiogenous cells annellidic, 18– 40×3–5 μm, hyaline. Conidia dark brown, broadly ellipsoid to broadly pip-shaped, (12.5–)13–15(–16)×(8.5–)8.8–9.5(–10.0) μm, l/w0(1.3–)1.4–1.6(–1.8) (n098), multiguttulate with 1–2 large and numerous small guttules; wall ca. 0.6–0.8 μm thick, with distinct gelatinous sheath 0.8–1.1(–1.4) μm thick. Culture: Colony on MEA after 17 d at room temperature ca. 56 mm diam, after 4 wk plate nearly entirely covered by mycelium. Colony circular, with diffuse concentric zones; aerial hyphae short, only frequent or abundant in the centre, forming diffuse, transparent whitish zones, below these zones colony pale yellowish-greenish, turning dark brown, grey to nearly black from the centre; margin dull golden yellow to olive; odour slightly sour; diffusing pigment lacking, agar faintly yellowish. Habitat and host range: dead corticated twigs and branches of Carpinus betulus attached to the tree; it has only been found in open sites like forest edges, parks and hedges. Distribution: Europe; uncommon but widely distributed. Type: AUSTRIA, Wien, Floridsdorf, Marchfeldkanalweg, map grid 7764/1, on corticated branches of Carpinus betulus, 9 Nov. 2008, W. Jaklitsch, strain MCM (from teleomorph) (WU 31873, holotype; ex-holotype culture CBS 124271), exholotype sequences JQ926247 (ITS-LSU), JQ926319 (rpb2), JQ926385 (tef1). Additional specimens examined (all on Carpinus betulus): AUSTRIA, Kärnten, St. Margareten im Rosental, Trieblach, near Ledra, map grid 9452/4, soc. M. carpinicola, 7 June 1996, W. Jaklitsch, W.J. 891 (WU 31804). Niederösterreich, Fungal Diversity (2012) 57:1–44 Michelbach Markt, Mayerhöfen, map grid 7860/4, soc. M. chrysodiscosporina, 20 June 2009, W. Jaklitsch & H. Voglmayr (WU 31864). Oberösterreich, Raab, map grid 7647/2, soc. M. carpinicola, 1 Aug. 2010, H. Voglmayr, strain MGR (from teleomorph) (WU 31877). Wien, Favoriten, Laaerbergstraße/Fontanastraße, map grid 7864/3, 30 May 1993, W. Jaklitsch (WU 15180). Floridsdorf, Lazarsfeldgasse, map grid 7764/2, 23 May 2010, W. Jaklitsch, strain MGL (from teleomorph) (WU 31874). Floridsdorf, Jedlersdorferstraße, map grid 7764/1, soc. M. chrysodiscosporina, 9 May 2010, W. Jaklitsch (WU 31870). Landstraße, Botanical Garden, map grid 7864/1, 23 May 2010, H. Voglmayr, strains MGH (from teleomorph), MEH (from anamorph) (WU 31875, culture CBS 131699). Landstraße, Stadtpark, map grid 7764/3, 3 Sep. 2010, H. Voglmayr & W. Jaklitsch, strain MGSt (from teleomorph) (WU 31876). Liesing, Maurerwald, map grid 7863/1, soc. M. chrysodiscosporina, 10 July 1993, W. Jaklitsch (WU 15980). SPAIN, Asturias, Luarca, finca ‘Fonte Baixa’, 8 May 2010, E. Rubio Domínguez, E.R.D. 5108, strain MGS (from teleomorph) (WU 31878). UNITED KINGDOM, West Yorkshire, Wakefield, Newmillerdam N Barnsley, Newmillerdam Country Park, soc. M. carpinicola, 17 May 2011, H. Voglmayr & W. Jaklitsch, strains MGUK (from teleomorph), MEUK (from anamorph) (WU 31879, culture CBS 131701). Notes: Melanconiella chrysomelanconium is similar to the closely related M. chrysodiscosporina and M. chrysorientalis, from which it differs mainly by dark brown conidia, slightly larger ascospores and ITS, rpb2 and tef1 sequences; M. chrysorientalis differs also by the host (Carpinus orientalis). Although M. chrysodiscosporina and M. chrysomelanconium share the same host, they appear to be ecologically separated: Melanconiella chrysodiscosporina has been mainly collected on fallen or cut branches within forests, whereas M. chrysomelanconium is apparently confined to open habitats, where it is commonly associated with M. carpinicola on twigs attached to the tree. However, M. chrysomelanconium has sometimes also been found to cooccur on the same branches with M. chrysodiscosporina at the edges of larger forests. Therefore, reliable identification is only possible with the anamorph. The anamorph-teleomorph connection was repeatedly proven by DNA data from conidial and ascospore cultures. The teleomorph of the Spanish collection is beautifully illustrated with macro- and microphotographs at http://www.ascofrance.com/search_recolte/2696 or http://www.asturnatura.com/fotografia/setas-hongos/melan conis-chrysostroma-fr-tul-c-tul-3/9039.html. Melanconiella chrysorientalis Voglmayr & Jaklitsch, sp. nov. (Fig. 7) MycoBank MB 800116 Etymology: referring to the yellow stroma and its host, Carpinus orientalis. Fungal Diversity (2012) 57:1–44 19 a b d e j i k r s z d1 f l m t u a1 e1 f1 c h g n o v p w x h1 Fig. 7 Melanconiella chrysorientalis. a. Panoramic view of pseudostromata. b. Pseudostroma in transverse section. c. Three pseudostromata in surface view. d–g. Ectostromatic discs and ostioles in surface view. h. Transverse section below ectostromatic disc. i. Ascus. j. Ascus tip with apical ring. k–y. Ascospores (k–m showing appendages). z. i1 y c1 b1 g1 q j1 k1 l1 m1 Conidioma in surface view. a1. Transverse section of conidioma, showing central column. b1, c1. Conidiophores. d1–m1. Conidia. All mounts in water. a02 mm, b, c, z, a10500 μm, d–h0300 μm, i–y, b1– m1010 μm. Sources: a, b, e–h, k–m, z–m1. WU 31858; c, d. WU 31880; i, j, n–y. WU 31881 20 Pseudostromata inconspicuous, 0.9–2.4 mm diam, slightly (0.1–0.3 mm) projecting, circular or contours illdefined, merging; perithecial contours often evident. Ectostromatic discs 0.1–0.6 mm, often densely disposed, with oblong, elliptic or circular outline, yellowish, light yellow, dull yellow, dark yellow-brown or grey. Central column crumbly, dull yellow, greenish yellow or olive; entostroma of light or olive-green hyphae. Ostioles 1–10 per disc, 50–140 μm diam, shiny black or brown with black centre, convex-papillate, scarcely projecting. Perithecia 0.3–0.6 mm diam; connection to central column often unclear. Asci cylindrical, (104–)114–130(–137)×(11–)13–15 (–17) μm (n033), containing 8 uni-, rarely biseriate ascospores, with distinct apical ring, 3.8–4.3 μm diam, 2.5– 3.2 μm high. Ascospores broadly ellipsoid, not constricted at the septum, (15.7–)17–19(–22)× (6.0–)7.5–9.3(–10.2) μm, l/w0(1.7–)1.9–2.4(–3) (n0111); ends broadly rounded to sometimes truncate, with hyaline cap-like appendages 1.3– 2 μm long, 2.4–4.2 μm wide, fading and eventually absent in microscope mounts; cells monomorphic, multiguttulate, each with one large and numerous small guttules; wall distinctly swelling and sometimes distinctly bulging out particularly at the septum, 0.6–1.1 μm thick, 1.3–3 μm at the septum. Anamorph: discosporina-like. Conidiomata 1–2 mm diam, only scarcely visible in face view, with diffuse margins, with central or eccentric stromatic column; at maturity covered by discharged whitish to greyish conidial masses. Conidiogenous cells phialidic, 9–18×2.5–4 μm, hyaline. Conidia hyaline, ellipsoid, oblong or cylindrical, (11.7–) 12.3–14.0(–15.3)×(5.5–)6.0–6.8(–7.3) μm, l/w0(1.7–)1.9– 2.2(–2.7) (n079), with 1–2 large and numerous small guttules; wall ca. 0.5 μm thick, with distinct gelatinous sheath ca. 0.6–0.9 μm thick. Culture: Colony on MEA after 17 d at room temperature ca. 61 mm diam, after 4 wk mycelium (nearly) covering the entire plate. Colony forming several concentric zones, each covered by a conspicuous, whitish, stellate mat of aerial hyphae; brown zones progressing from the centre, eventually dark brown below the whitish structure; agar pale yellow to brownish; odour sour. Habitat and host range: dead corticated twigs and branches of Carpinus orientalis; only found on branches attached to the trees. Distribution: South-eastern Europe, uncommon; collected in Croatia and Greece (Corfu) but likely to co-occur with its host in other countries. Type: CROATIA, Istria, Barbariga, on corticated branches of Carpinus orientalis, 15 May 2010, H. Voglmayr & W. Jaklitsch, strain MGB (from teleomorph) (WU 31880, holotype; ex-holotype culture CBS 131702), ex-holotype sequences JQ926256 (ITS-LSU), JQ926328 (rpb2), JQ926394 (tef1). Additional specimens examined (all on Carpinus orientalis): CROATIA, Istria, Poreč, Gedici, 1 Nov. 2010, H. Fungal Diversity (2012) 57:1–44 Voglmayr & I. Greilhuber, strain MGP (from teleomorph) (WU 31881). Vrsar, soc. M. spodiaea (anamorph), 14 May 2010, H. Voglmayr & W. Jaklitsch, strains MGV (from teleomorph), MVH (from anamorph) (WU 31858). GREECE, Kerkyra (Corfu), W Analipsis, 24 April 2012, H. Voglmayr & W. Jaklitsch (WU 32000). SE Ano Korakiana, 24 April 2012, H. Voglmayr & W. Jaklitsch (WU 32001). S Kouramaditika, 22 April 2012, H. Voglmayr & W. Jaklitsch (WU 32002). Notes: Melanconiella chrysorientalis is similar to the closely related M. chrysodiscosporina and M. chrysomelanconium, from which it differs mainly by ITS, rpb2 and tef1 sequences and a different host (C. orientalis) and from M. chrysomelanconium by hyaline conidia. The anamorphteleomorph connection was proven by DNA data from conidial and ascospore cultures. Melanconiella decorahensis (Ellis) Sacc., Syll Fung 2: Addenda Vol I:LIV (1883). (Fig. 8) MycoBank MB 210729 Basionym: Melanconis decorahensis Ellis, [as ‘decoraensis’], Am Nat 17:195 (1883). Synonyms: Melanconis decorahensis var. subviridis Ellis & Everh., North American Pyrenomycetes 528 (1892) (type not seen). Melanconiella subviridis (Ellis) Dearn. & House, Bull NY State Mus 266:81 (1925). Pseudostromata 1.5–3 mm diam, circular, often inconspicuous, with their centre typically projecting to ca. 0.6, rarely 0.8 mm; perithecial contours only rarely evident. Ectostromatic discs variable, mostly narrow, fusoid or linear, 0.2–1.6 mm long, pale yellow, bright yellow, greenish yellow, greenish grey, olive or dull greyish brown. Central column grey, greenish grey or olive-brown. Entostroma inconspicuous. Ostioles variously arranged in the disc, 1– 20 per disc, 40–140(–160) μm diam, shiny black, flat or papillate, tips typically flattened. Perithecia 0.3–0.5 mm diam. Asci narrowly cylindrical, (114–)125–145(–150)× (11–)12–14(–16) μm (n 035), containing 8 uniseriate ascospores, with an apical ring distinct when fresh, 3.7–4.2 μm diam, 3.7–4 μm high, often indistinct in older herbarium specimens. Ascospores dark brown, ellipsoid, distinctly constricted at the septum, (13.5–)16– 20(–22)×(7.5–)8.5–10(–11) μm, l/w0(1.6–)1.8–2.2(–2.4) (n 057); ends broadly rounded, without appendages; cells more or less monomorphic, multiguttulate; wall not swelling, ca. 0.7–0.8 μm. Anamorph: melanconium-like. Conidiomata 1.5–2.5 mm diam, blackish brown, at maturity covered by black discharged conidial masses, forming conspicuous thick black pustules or spots 1–3 mm diam, sometimes confluent to 1–2 cm. Conidiogenous cells distinctly annellidic, 20–35×3.5–4 μm, Fungal Diversity (2012) 57:1–44 21 a b d e f k l m r s t c g n u i h o v p q w x a1 j z y Fig. 8 Melanconiella decorahensis. a. Panoramic view of pseudostromata. b. Pseudostroma in transverse section. c. Pseudostroma in surface view. d–f. Ectostromatic discs and ostioles in surface view. g–i. Transverse sections below ectostromatic disc. j. Ascus. k. Ascus tip with apical ring. l–x. Ascospores. y. Conidioma in surface view. z, a1. b1 c1 d1 e1 f1 g1 h1 i1 Conidiophores. b1–i1. Conidia. v–x in 3 % KOH, all other mounts in water. a02 mm, b–g, y0500 μm, h, i0200 μm, j–x, z–i1010 μm. Sources: a–c, f–h, j–u, y–e1. WU 31808; i. Wehmeyer 3644 (NY); v–x, f1–i1. Ellis & Everhart, N. Amer. Fungi. Ser. II: 1562 (NY) 22 at first hyaline, becoming brown with age. Conidia dark brown, pip-shaped, (13–)15–17(–19)×(8–)9–10(–11) μm, l/ w0(1.2–)1.5–2(–2.3) (n0121), multiguttulate when fresh, with a large guttule when dead; wall ca. 0.6–0.7 μm thick, with hyaline gelatinous sheath ca. 0.5 μm thick. Culture: Colony on MEA after 17 d at room temperature ca. 67 mm diam, whitish, outline irregular, covering the plate in 3–4 wk, aerial hyphae nearly lacking at the margin, but dense in central areas, forming more or less radially arranged spots; aged cultures only pale yellowish brown; diffusing pigment lacking. Habitat and host range: dead corticated twigs and branches of Betula spp. Distribution: common in North America (USA, Canada); rare in Europe (France). The French collection investigated in the present study is the first verified record from Europe. Wehmeyer (1941) mentioned a European collection deposited in PC without providing further details, but considered this record to be dubious due to the similarity of M. decorahensis to M. spodiaea, where ascospore appendages may not be seen in old material. Typification: USA, Iowa, Decorah, on corticated branches of Betula sp., Aug. 1882, E. W. D. Holway (NY 922009, lectotype of Melanconis decorahensis here designated; NY 922008, isotype). Additional selected specimens examined: FRANCE, Ariège, Rimont, on twigs of Betula pendula, 14 July 2010, J. Fournier, J.F. 10095, strains MD (from teleomorph), MED (from anamorph) (WU 31808, culture CBS 131698). USA, Alabama, Marion Co., Hamilton, Buttahatchee (“Ballahatchie”) River, on twigs of Betula sp., 14 July 1925, L. E. Wehmeyer 3644 (DAOM 121211, NY). Iowa, Decorah, on twigs of Betula sp., E. W. D. Holway, Ellis & Everhart, N. Amer. Fungi. Ser. II: 1562 (NY, 3 specimens). Massachusetts, Waverly, on twigs of Betula sp., 20 Sep. 1925, L. E. Wehmeyer 3806 (DAOM 121219, culture CBS 159.26). Indiana, Kankakee River & Route # 43, on twigs of Betula lutea, 3 Sep. 1938, L. E. Wehmeyer 3876 (DAOM 121187). Notes: Melanconiella decorahensis is characterised by dark brown ascospores lacking appendages, pip-shaped dark brown conidia and growth on Betula spp. It is most similar to M. spodiaea, which mainly differs by the presence of caplike ascospore appendages, differently shaped conidia and different hosts (Carpinus spp.). Melanconis stilbostoma, which is common on Betula spp., mainly differs by hyaline ascospores and whitish ectostromatic discs. The anamorphteleomorph connection was proven by culture (Wehmeyer 1926) and DNA data. We have not been able to study the type of M. decorahensis var. subviridis (0M. subviridis), but according to Wehmeyer (1941) it represents merely a well-developed specimen of M. decorahensis. Fungal Diversity (2012) 57:1–44 Melanconiella echinata Voglmayr & Jaklitsch, sp. nov. (Fig. 9) MycoBank MB 800117 Etymology: referring to the ostioles projecting from the prominently erumpent ectostromatic discs, resulting in a spiny appearance. Pseudostromata 1.2–2.5 mm diam, projecting 0.3–0.6(– 0.8) mm, well-defined, distinct, circular, causing a ring-like elevation of the bark surrounding the ectostromatic disc; perithecial bumps indistinct. Ectostromatic disc 0.4–0.9(– 1.3) mm diam, well-developed, distinctly projecting, often pulvinate, with circular, angular or ellipsoid outline, cream, yellow, honey, cinnamon, orange brown to brown. Central column bright olive-yellow when young, later olive-green to olive-brown. Entostroma well-developed, compact, of compacted hyphae, olive-green or olive-brown. Ostioles 1–25(– 30) per disc, 90–190 μm diam, typically regularly arranged in the disc, cream to brown with shiny black tips, distinctly projecting, papillate or conical, tips flat or rounded. Perithecia 0.4–0.8 mm diam. Asci fusoid, (66–)72–81(– 83)×(13–)14–16.5(–18) μm (n033), containing 8 uni- or biseriate ascospores, with a distinct apical ring, ca. 3 μm diam, 2 μm high. Ascospores hyaline, fusoid, slightly curved, slightly to distinctly constricted at the septum, (18–)20–22(–26)×(6.0–)6.5–7.5(–8.7) μm, l/w0(2.5–)2.8– 3.2(–3.7) (n0121); ends subacute to narrowly rounded, with hyaline cap-like appendages 1–1.5 μm long, 2–2.5 μm wide, soon fading in microscope mounts; cells slightly dimorphic, with four large guttules when fresh, mostly disappearing in herbarium specimens; wall ca. 0.4 μm thick, sometimes distinctly swelling at the septum. Anamorph: not observed. Habitat and host range: dead corticated twigs and branches of Carpinus caroliniana; probably rare. Distribution: North America (USA). Type: USA, New York, Ringwood, Lloyd-Cornell Preserve, on corticated branches of Carpinus caroliniana, 6 Sep. 1952, R. M. Horner (DAOM 121196, holotype). Additional specimens examined: USA, Pennsylvania, West Chester, on Carpinus caroliniana, Aug. 1883, Haines & Everhart, issued as Melanconis chrysostroma in Ellis & Everhart, N. Amer. Fungi. Ser. II: 1563 (GZU). Notes: As no recent collections have been available, only the ITS-LSU region could be obtained for M. echinata, and it could not be included in the combined phylogenetic analyses. The LSU demonstrates that the fungus belongs to Melanconiella, and that it is also distinct from all other species (Fig. 1). Morphologically it fits well in Melanconiella, except for its distinctly pustulate stromata, which have not been observed in any other species of the genus. Although otherwise being similar to M. elegans, M. echinata is distinct due to its differently shaped, larger Fungal Diversity (2012) 57:1–44 23 a b c f e i d n w k j o p x q y g r z h l m s t u v a1 b1 c1 d1 Fig. 9 Melanconiella echinata. a. Panoramic view of pseudostromata. b. Pseudostroma in transverse section. c. Groups of detached perithecia in well developed entostroma from below. d. Three pseudostromata in surface view. e. Vertical section of pseudostroma. f. Ectostromatic disc with projecting ostioles in side view. g–i. Young ectostromatic discs and ostioles in surface view. j–l. Fully developed ectostromatic discs and ostioles in surface view. m. Transverse section below ectostromatic disc. n. Ascus. o. Ascus tip with apical ring. p–d1. Ascospores (p–s, z showing appendages). n–t in water, u–d1 in 3 % KOH. a02 mm, b, c, e–m0500 μm, d01 mm. Sources: a, b, d–y. DAOM 121196; c, z–d1. Ellis & Everhart, N. Amer. Fungi. Ser. II: 1563 (GZU) ascospores, its prominent erumpent ectostromatic discs causing a coarsely pustulate bark surface similar to Melanconis and its distinctly projecting ostioles. In addition, the entostroma is well developed and of distinctly olive- yellow to olive-green colour. Although the label of Ellis and Everhart, N. Amer. Fungi 1563 states that the specimens show no asci, fully mature perithecia were present in the specimen from GZU, having asci and ascospores fully 24 in agreement with the type. Interestingly, this exsiccatum was issued as Melanconis chrysostroma, and it was distributed in the same fascicle as the type collection of Melanconiella ellisii (N. Amer. Fungi 1567, issued as Valsa (Diaporthe) ellisii), which was collected at the same locality. This suggests that Ellis and Everhart considered these collections to represent distinct taxa. Ellis and Everhart (1892) based their description of Melanconis chrysostroma on the exsiccatum N. Amer. Fungi 1563, applying the name with some doubts. In the broad species concept of Wehmeyer (1941), the specimen was listed under Melanconis chrysostroma var. ellisii. We found no anamorph on the two collections examined. Melanconiella elegans Voglmayr & Jaklitsch, sp. nov. (Fig. 10) MycoBank MB 800118 Etymology: referring to the regular yellowish ectostromatic discs with evenly distributed ostioles, providing an elegant appearance. Pseudostromata 1.2–3 mm diam, projecting to ca. 0.6(– 0.8) mm, well-defined, distinct, circular, or confluent with densely disposed discs, causing small bumps in the bark; perithecial bumps often distinct. Ectostromatic disc 0.2– 0.8 mm diam, rarely larger (1.6 mm), well-developed, distinctly projecting, often pulvinate, with typically circular or angular, sometimes ellipsoid, fusoid or oblong outline, pale or bright yellow to light brown, or concealed by ostioles. Central column yellow, olive, grey or brownish. Entostroma well-developed, compact, of compacted hyphae, dull yellow, olive or brownish. Ostioles 1–20 per disc, 30–140(–160) μm diam, typically evenly spaced in the disc, brown with shiny black tips, slightly projecting, papillate or conical, tips flat, rounded or nearly acute. Perithecia 0.2–0.6 mm diam. Asci fusoid, (49–)54–69(–77)×(9–)10–13(–15) μm (n067), containing 8 uni- or biseriate ascospores, with distinct apical ring, 2.4–2.8 μm diam, 1.8–2.6 μm high. Ascospores hyaline, fusoid, slightly to distinctly constricted at the septum, (11.8–)14.5–17.0(–19.5) × (3.5–)4.3–5.3(–6.7) μm, l/w 0(2.3–)2.9–3.7(–5.0) (n 0261); ends narrowly rounded to subacute, appendages mostly indistinct; cells slightly dimorphic, each containing 2 large guttules; wall not swelling, ca. 0.4 μm thick. Anamorph: discosporina-like. Conidiomata inconspicuous, typically only the central or eccentric ectostromatic disc visible at the substrate surface or their presence indicated by discharged conidial masses, 1–2.5 mm diam. Conidiogenous cells phialidic, 10–25×2–3 μm, hyaline. Conidia hyaline, fusoid or suballantoid, (7.5–)8.8–12.0(–14.3)×(2.2–)2.5–3.0 (–3.5) μm, l/w0(2.3–)2.9–4.4(–5.8) (n0215), multiguttulate Fungal Diversity (2012) 57:1–44 with numerous small guttules; wall and hyaline gelatinous sheath each ca. 0.3 μm thick. Culture: Colony on MEA after 14 d at room temperature ca. 14–35 mm diam, indistinctly zonate, surface slightly farinose due to loosely disposed, small collapsed flocks of aerial hyphae, first whitish, turning reddish-brown or rosy mixed with yellow tones from the centre; after ca. 3 wk purple pigment diffusing into the agar, colony turning dark reddish-brown and eventually dark brown, grey to black; diffusing pigment transient, unstable, grading off into brown. Habitat and host range: dead corticated twigs and branches of Carpinus caroliniana; widespread. Distribution: North America (USA). Type: USA, Maryland, Prince George’s County, Beltsville/Greenbelt, Beaver Dam Road, on corticated branches of Carpinus caroliniana, 14 May 2003, W. Jaklitsch & H. Voglmayr W.J. 2118, strain A.R. 3993 (BPI 843574, holotype; WU 31809, isotype; ex-holotype culture CBS 131617), ex-holotype sequences JQ926265 (ITSLSU), JQ926336 (rpb2), JQ926402 (tef1). Additional selected specimens examined (all on Carpinus caroliniana): CANADA, Ontario, London, July 1891, J. Dearness, Ellis & Everhart, N. Amer. Fungi. Ser. II: 2742 (K(M) 171590, issued as Diaporthe decipiens). USA, M ar y l a n d , B e l t sv i l le , L i t t l e P a i nt B r a n c h , s o c . Discosporina carpinicola, 20 May 1950, F. Petrak; Poelt & Scheuer, Reliqu. Petrak. 2815 (GZU, issued as Discosporina carpinicola). New York, vic. Ithaca, Arnot Forest, 10 July 2002, L. Vasilyeva, strain A.R. 3830 (BPI 870990, culture CBS 131494). Tennessee, Gatlinburg, Great Smoky Mountains National Park, Old Sugarlands Trail, 24 May 2003, W. Jaklitsch & H. Voglmayr, W.J. 2213 (BPI 872067). Virginia, Edinburg, George Washington National Forest, Columbia Furnace/Wolf Gap, 27 May 2003, W. Jaklitsch & H. Voglmayr, W.J. 2238 (WU 31810). Notes: Asci, ascospores and anamorph of Melanconiella elegans are similar to those of M. ellisii. Melanconiella elegans has beautiful cream, yellowish to bright yellow ectostromatic discs, which are uniform in shape and characterised by evenly scattered ostioles. The colour of its central stromatic column is remarkably variable, ranging from cream, light to dark grey, yellow, olive to brownish. Melanconiella elegans is morphologically most similar to the European M. carpinicola, which may be the closest relative (Fig. 2). As the anamorph-teleomorph connection could not be directly proven with pure cultures, DNA was extracted from conidiomata present on the natural substrate. Three independent DNA extractions from two specimens (BPI 843574, BPI 872067) each confirmed the connection. Morphological descriptions of Melanconis xanthostroma by Wehmeyer (1937), later referred to as Melanconis chrysostroma var. ellisii by him (Wehmeyer 1941), are likely to Fungal Diversity (2012) 57:1–44 25 a e b g f m l h u v a1 b1 d i o n t c c1 Fig. 10 Melanconiella elegans. a. Panoramic view of pseudostromata. b, c. Pseudostromata in transverse section. d. Two pseudostromata in surface view. e–i. Ectostromatic discs and ostioles in surface view. j, k. Transverse section below ectostromatic disc. l. Ascus. m. Ascus tip with apical ring. n–z. Ascospores. a1. Conidioma in surface view. b1. j p w k q r x s y z d1 e1 f1 g1 h1 i1 j1 k1 l1 m1 Transverse section of conidioma, showing central column. c1. Conidiophores. d1–m1. Conidia. d1–f1, i1, j1 in water, all other mounts in 3 % KOH. a02 mm, b, c, a1, b10500 μm, d01 mm, e–k0300 μm, l–z, c1–m1010 μm. Sources: a, b, g, h, k, b1. WU 31809; c, h1. BPI 872067; e, f, j, m–s. BPI 870990; i, l, t–a1, c1–g1, i1–m1. BPI 873574 26 be based on M. elegans. In his studies Wehmeyer (1937) reported the production of large alpha conidia (16–30(– 37)×3.5–5 μm) in culture and similar conidia in a few herbarium specimens. However, his cultures did not produce the small beta-conidia he frequently observed on herbarium specimens. In one of our collections of M. elegans (BPI 870990), numerous conidiomata containing such large conidia were present. However, these could not be confirmed to represent a conidial state of M. elegans. A PDA culture from ascospores of BPI 870990 produced conidia similar in size (9–11×3–4 μm) to the small beta-conidia of Wehmeyer (1937, 1941), which were confirmed to represent the anamorph of M. elegans in our study. Sequences obtained from the large-spored anamorph on the natural substrate were either impure (from two extraction trials containing conidia, conidiophores and stromatic columns), or were revealed as an unidentified, probably diaporthalean fungus not belonging to Melanconiella by a BLAST search (sequences from a DNA extract obtained only from conidia). This indicates that the conidia belong to a fungus that probably parasitizes stromata of M. elegans. The type collection of Discosporina carpinicola, which was considered to be the anamorph of M. ellisii by Petrak (1952b), includes the teleomorph of M. elegans. However, morphologically the conidia present on the specimen are more similar to those of M. ellisii. Considering common co-occurrence and intermingled growth of teleomorphs and anamorphs of different species on the same branches in Melanconiella and the subtle morphological differences between the anamorphs of M. ellisii and M. elegans, it remains uncertain to which species of Melanconiella Discosporina carpinicola is connected. The species epithet is a later homonym of Diaporthe carpinicola and therefore not available for use in Melanconiella. Melanconiella ellisii (Rehm ex Ellis & Everh.) Voglmayr & Jaklitsch, comb. nov. (Fig. 11) MycoBank MB 800119 Basionym: Diaporthe ellisii Rehm ex Ellis & Everh., Bull Torr Bot Club 10:89 (1883). Synonyms: ?Discosporina carpinicola Petr., Sydowia 6:357 (1952). Melanconis chrysostroma var. ellisii (Rehm ex Ellis & Everh.) Wehm., Univ Michigan Stud Sci Ser 14:33 (1941). Pseudostromata 1–2.6 mm diam, projecting up to ca. 0.7 mm, inconspicuous, circular, distinct or confluent; distinct perithecial bumps uncommon. Ectostromatic disc 0.2– 1.2(–2) mm diam, with circular, angular or oblong outline, commonly surrounded by irregular edges or flaps of bark, drab, light to dark grey or dark brown. Central column grey or brownish. Entostroma typically indistinct, sometimes compact above perithecia, of subhyaline hyphae. Ostioles Fungal Diversity (2012) 57:1–44 1–15 per disc, 30–160(–170) μm diam at the base, typically arranged at the disc margin, shiny black, plane, papillate or conical and projecting up to 180 μm, tips flattened, rounded or acute. Perithecia 0.2–0.5 mm diam. Asci fusoid, (39–) 50–69(–80)×(7–)9–11(–13) μm (n084), containing 8 unior biseriate ascospores, with distinct apical ring, 1.8–2.5 μm diam, 1.4–2 μm high. Ascospores hyaline, fusoid, slightly to distinctly constricted at the septum, (10–)12.5–16(–20)× (3.5–)4.0–5.5(–6.5) μm, l/w0(2.2–)2.7–3.3(–4) (n0239); ends narrowly rounded to subacute, mostly without appendages; cells mono- to slightly dimorphic, with (1–)2 large and numerous small guttules; wall not swelling, ca. 0.3 μm thick. Anamorph: discosporina-like. Conidiomata inconspicuous, typically only their central or eccentric ectostromatic disc visible on the substrate surface or their presence indicated by discharged conidial masses, 0.5–2 mm diam. Conidiogenous cells phialidic, 10–18×2–3.5 μm, hyaline. Conidia hyaline, fusoid, narrowly ellipsoid, elongate to suballantoid, (8.5–)9.5–11.5(–13.0)× (2.5–)3.0–3.5(–4.0) μm, l/w0(2.2–)2.8–3.9(–4.8) (n0148), multiguttulate, commonly with four to six large guttules; wall ca. 0.3 μm, hyaline gelatinous sheath ca. 0.4 μm thick. Habitat and host range: dead corticated twigs and branches of Carpinus caroliniana; widespread. Distribution: North America (USA, Canada). Typification: USA, Pennsylvania, West Chester, on Carpinus caroliniana, without date, Haines & Everhart, Ellis & Everhart, N. Amer. Fungi. Ser. II: 1567 (M0177942, lectotype of Diaporthe ellisii here designated; BPI bound, K(M) 171591, isotypes). Additional selected specimens examined (all on Carpinus caroliniana): USA, Maryland, Beltsville/Greenbelt, Beaver Dam Road, 14 May 2003, W. Jaklitsch & H. Voglmayr, W.J. 2118a (BPI 883227; WU 31811). Maryland, Prince George’s Co., Beltsville Agricultural Research Station, Bottomland Research Forest, 3 June 2002, L. Vasilyeva (BPI 843491). Tennessee, Great Smoky Mountains National Park, vic. Cosby, 8 May 2006, L. Vasilyeva (BPI 878343). Notes: Melanconiella ellisii, commonly referred to as Melanconis chrysostroma var. ellisii, was previously considered to be a well-defined taxon in North America (Wehmeyer 1941). However, the current study shows that it is a heterogeneous taxon, and M. elegans is separated as a distinct species. Melanconiella ellisii is characterised by its drab, grey to dark brown ectostromatic discs of irregular shape with ostioles inserted mostly at the margin of the ectostromatic disc, which is reminiscent of the closely related M. spodiaea. Unfortunately, no pure cultures have been available for M. ellisii, but DNA extraction from teleomorphs and anamorphs of three collections of M. ellisii revealed consistent results. Fungal Diversity (2012) 57:1–44 27 a b d f e l k g m s t h u c1 Fig. 11 Melanconiella ellisii. a. Panoramic view of pseudostromata. b. Pseudostroma in transverse section. c. Six pseudostromata in surface view. d–i. Ectostromatic discs and ostioles in surface view. j. Transverse section below ectostromatic disc. k. Ascus. l. Ascus tip with apical ring. m–z. Ascospores (m, r showing appendages). a1. Conidioma in surface view. b1. Transverse section of conidioma showing i o n a1 b1 c p w v j q x r y z d1 e1 f1 g1 h1 i1 j1 k1 l1 m1 central column. c1. Conidiophores. d1–m1. Conidia. All mounts in 3 % KOH. a02 mm, b, d–i0500 μm, c, j01 mm, k–z, c1–m1010 μm, a1, b10300 μm. Sources: a, d, e, l, s–v. BPI 843491; b, f, j, k, w–z. BPI 878343; c–g, m, a1–b1, i1–m1. M-0177942 (lectotype); h, i, n–r. K(M) 171591 (isotype); c1–h1. BPI 883227) 28 Ellis and Everhart (1892) described the conidia as fournucleate, measuring 8–11× 2–2.5 μm. On the original collection deposited in Kew (K(M) 171591), the conidia are distinctly wider (4–5.5 μm) than those of the collection deposited in Munich (M-0177942), as well as in our collection BPI 883227 (WJ 2118a) for which the connection was confirmed by sequence data. It remains to be verified whether the conidia of M. ellisii show a variable width or whether these wider conidia belong to a different taxon. For reasons of priority, Petrak (1952b) proposed that the species epithet carpinigera should be used for the species. However, this is a misapplied name, as the type specimen of the basionym, Diatrype carpinigera, is clearly not a diaporthalean fungus but rather a Valsaria (see below). He also described Discosporina carpinicola as the anamorph of M. ellisii, but the type specimen contains the teleomorph of only M. elegans. As D. carpinicola is morphologically more similar to the anamorph of M. ellisii, it is here considered a synonym of the latter. The recent record of M. ellisii (as Melanconis carpinigera) from Carpinus cordata near Vladivostok, Russian Far East by Vasilyeva and Stephenson (2010) cannot be evaluated without detailed study of the specimen. Melanconiella flavovirens (G.H. Otth) Voglmayr & Jaklitsch, comb. nov. (Fig. 12) MycoBank MB 800120 Basionym: Diaporthe flavovirens G.H. Otth, Mitt naturf Ges Bern 1868:47 (1869). Synonyms: Melanconis flavovirens (G.H. Otth) Wehm., Mycologia 29:602 (1937). ?Diaporthe flavovirens var. tetraspora G.H. Otth, Mitt naturf Ges Bern 1868:47 (1869). Diaporthe olivaestroma (Cooke) Berl. & Voglino [as ‘elaeostroma’], in Saccardo, Syll Fung, Addit I–IV:105 (1886). Diaporthe sulphurea Fuckel, Jb Nassau Ver Naturk 23– 24:205 (1870) [1869–70] (type not seen). Discodiaporthe sulphurea (Fuckel) Petr., Hedwigia 62:294 (1921). Discosporina sulphurea (Sacc.) Petr., Sydowia 16:187 (1963) [1962]. Discosporium sulphureum (Sacc.) Petr., Hedwigia 62: 292 (1921). Melanconis sulphurea (Fuckel) Petr., Ann Mycol 21:321 (1923). Myxosporium sulphureum Sacc., Syll Fung 3:725 (1884). Valsa olivaestroma Cooke, Grevillea 14(no. 70):48 (1885). Pseudostromata 1.5–3.4 mm diam, mostly irregularly confluent, with slightly projecting centre, sometimes welldefined, circular with circinately arranged perithecial Fungal Diversity (2012) 57:1–44 bumps. Ectostromatic disc 0.3–1.3 mm diam, circular, elliptic or oblong, often pulvinate, in this case not surrounded by bark, powdery, mostly dull yellowish green to olive, but also cream or yellow-brown, eventually black when old. Central column grey, olive-brown, dull green or lacking. Entostroma comprising olive or yellow mycelium, more or less well developed. Ostioles 1–15(–25) per disc, emerging in various positions in the disc, 40–160 μm diam, shiny black, slightly papillate, less commonly plane, sometimes cylindrical and projecting up to 150 μm when the disc disintegrates. Perithecia 0.3–0.6(–0.8) mm diam. Asci fusoid, (84–)95– 107(–114) × (13–)14–17(–18) μm (n 031), containing 8 biseriate ascospores, with distinct apical ring, 3.2– 4.0 μm diam, 2.5–3.3 μm high. Ascospores hyaline, inequilaterally ellipsoid or broadly fusoid, not to slightly constricted at the septum, (17–)20.5–24.5(–30)×(7.0–)7.5–8.8 (–9.8) μm, l/w0(2.1–)2.5–3.0(–3.7) (n0134); ends narrowly rounded or subacute, with distinct persistent, knob-like hyaline appendages 0.7–1.4 μm long, 1.6–2.4 μm wide; cells mostly monomorphic, distinctly triangular-ovate in outline, with one large and numerous small guttules; wall not swelling, ca. 0.5–0.6 μm thick, at the septum 1.5–2 μm. Anamorph: discosporina-like. Conidiomata 1.5–2.5 mm diam, indistinct, mostly with central or eccentric stromatic column; usually no dicharged conidial masses evident. Conidiogenous cells phialidic, 16–27×2.5–3.5 μm, hyaline. Conidia hyaline, variable in shape, pip-shaped, narrowly ellipsoid, elongate to suballantoid, sometimes with a distinct apiculus, (11–)12–15(–17.5)×(4.7–)5.0–5.5(–6.5) μm, l/w0(1.9–)2.3–2.8(–3.3) (n065), multiguttulate, often with one or two larger and numerous small guttules; wall and hyaline gelatinous sheath each ca. 0.5 μm thick. Culture: Colony on MEA after 17 d at room temperature ca. 23 mm diam, after reaching a diam of 2–2.5 cm growth discontinued or at most small irregular lobes formed; colony dull greenish-yellow to yellow-brown with whitish margin, turning dark brown to black from the centre; aerial hyphae scant or abundant, causing a floccose surface; after 3–4 wk pale to medium brown pigment diffusing into the agar; odour reminiscent of fermenting yeast. Habitat and host range: dead corticated twigs and branches of Corylus avellana lying on the ground. Distribution: Europe, probably also North America (Canada, USA); common. Collections from North American Corylus species need to be thoroughly studied to evaluate whether they are conspecific. Typification: SWITZERLAND, near Steffisburg, without date, G. Otth 31 (B 700014743, lectotype of Diaporthe flavovirens here designated; B 700014742, isotype). SWITZERLAND, 2 May 1867, P. Morthier, Herb. Fuckel 56 (G 00111561, holotype of Diaporthe sulphurea). SWITZERLAND, Jura, 31 March 1871, P. Morthier, Herb. Fungal Diversity (2012) 57:1–44 29 a b d x f e j i c q y g h k l m n o p r s t u v w z a1 b1 c1 f1 g1 h1 i1 d1 j1 e1 k1 Fig. 12 Melanconiella flavovirens. a. Panoramic view of pseudostromata. b. Pseudostroma in transverse section. c. Two pseudostromata in surface view. d–g. Ectostromatic discs and ostioles in surface view. h. Transverse section below ectostromatic disc. i. Ascus. j. Ascus tip with apical ring. k–w. Ascospores. x. Transverse section of conidioma. y. Conidiophores. z–k1. Conidia. All mounts in water. a02 mm, b, c0 1 mm, d–h, x0500 μm, i–w, y–k1010 μm. Sources: a–d, j–n, x–k1. WU 31822; e. WU 31815; f–i, o–w. WU 31816 Fuckel 27 (G 00111404, lectotype of Myxosporium sulphureum here designated). UK, England, Middlesex, Hendon, M.C. Cooke 209 (K(M) 174473, holotype of Valsa olivaestroma) 30 Additional specimens examined (all on Corylus avellana): AUSTRIA, Kärnten, St. Margareten im Rosental, Sabosach, map grid 9452/3, 30 Oct. 1994, W. Jaklitsch, W.J. 322 (WU 31812). ibid., shrubs between the village and Stariwald, map grid 9452/4, 10 June 1993, W. Jaklitsch (WU 15584). ibid., 27 Aug. 1993, W. Jaklitsch (WU 15510). ibid., 19 Feb. 1994, W. Jaklitsch (WU 15376). ibid., Trieblach, below Kucher, map grid 9452/2, 25 March 1995, W. Jaklitsch, W.J. 536 (WU 31813). ibid., Schwarzgupf, map grid 9452/4, 10 Sep. 1998, W. Jaklitsch, W.J. 1202 (WU 31814). ibid., Wograda, map grid 9452/3, 27 Oct. 2000, W. Jaklitsch, W.J. 1666 (WU 31815). ibid., Zabrde, map grid 9452/4, 17 Oct. 2011, H. Voglmayr, strain MFV2 (from teleomorph) (WU 31816). Niederösterreich, Orth an der Donau, Tierboden, map grid 7866/3, 1 Nov. 2011, H. Voglmayr & W. Jaklitsch, strain MFV4 (from teleomorph) (WU 31817). Stockerau, Unterzögersdorf, map grid 7663/1, 24 April 2010, H. Voglmayr (WU 31818). Oberösterreich, Raab, Rotes Kreuz, map grid 7648/1, 6 Sep. 2009, H. Voglmayr, strain MFV (from teleomorph) (WU 31819, culture CBS 125598). St. Willibald, Aichet, map grid 7648/1, 3 June 2011, H. Voglmayr, strain MFV1 (from teleomorph) (WU 31820). Steiermark, Pöllau, Schönauklamm, map grid 8760/2, 12 Sep. 2002, W. Jaklitsch, W.J. 1952 (WU 31821). GERMANY, Reichartshausen, spring, without date, L. Fuckel, Fungi Rhen. Exs. 2539 (K(M) 174474, issued as Diaporthe sulphurea). ITALY, Lombardia, Vobarno, 21 Oct. 2011, H. Voglmayr & W. Jaklitsch, strains MFV3 (from teleomorph), MFA (from anamorph) (WU 31822). SWITZERLAND, Neuchâtel, 14 April 1869, P. Morthier, Herb. Barbey-Boissier 105 (BPI 617275 as Diaporthe sulphurea). same place, date and collector (G 00111562 as Diaporthe sulphurea). Notes: Melanconiella flavovirens is characterised by growth on Corylus, by mostly large ectostromatic discs with distinctly yellowish green tints and by broad ascospores of cells that are distinctly triangular to ovate in outline and by small persistent knob-like appendages. The anamorph is less prominent than in other Melanconiella species, inconspicuous and rarely seen. Despite thorough studies of several fresh collections, conidiomata were only found in a single collection from Italy. The anamorph, Myxosporium sulphureum, was formally described by Saccardo (1884), who referred to the description by Fuckel (1871). Apart from a few omissions, the wording of the diagnosis (including measurements) in Saccardo (1884) is identical with Fuckel’s description (1871:318– 319). Therefore, Myxosporium sulphureum should be based on a collection studied by Fuckel, and the specimen from the Fuckel herbarium housed in G is here designated as lectotype. The measurements of Fuckel (1871), repeated in Saccardo (1884), agree with ours. The anamorph-teleomorph connection was proven in the Fungal Diversity (2012) 57:1–44 present study by DNA data from conidial and ascospore cultures. We examined two specimens of the type collection of Diaporthe flavovirens preserved in B. Considering the preservation and abundance of the collection, B 700014743 is here designated as lectotype. According to the detailed description and the host (Fuckel 1870), Diaporthe sulphurea is a synonym of Melanconiella flavovirens, which has been confirmed by examination of the type. Otth (1869) described a four-spored variety of M. flavovirens, but no such specimen has been seen. Melanconiella hyperopta (Nitschke ex G.H. Otth) Voglmayr & Jaklitsch, comb. nov. (Fig. 13) MycoBank MB 800121 Basionym: Diaporthe hyperopta Nitschke ex G.H. Otth, Mitt naturf Ges Bern 1868:47 (1869). Synonyms: Diaporthe decipiens Sacc, Fung Ven 4:6 (1875) (type not seen). Melanconis hyperopta (Nitschke ex G.H. Otth) Wehm., Univ Michigan Stud Sci Ser 9:254 (1933). Pseudostromata typically distinct, well-defined, with circular outline, 1.5–3.4 mm diam, projecting up to 0.5 mm; perithecial bumps often evident; sometimes confluent and irregular. Ectostromatic disc concave, flat or slightly pustulate, surrounded by bark or not, little projecting above the perithecial level, 0.3–0.9 mm long, circular, fusoid to linear, whitish, cream, pale or dull yellow to brown. Central column pale, yellowish, pale greyish brown or brownish. Entostroma inconspicuous, pale, slightly lighter than bark interior, comprising subhyaline to yellowish hyphae. Ostioles 1–15 per disc, 60–160 μm diam, marginal or emergent within the disc, plane, discoid or papillate with rounded or flattened apices. Perithecia 0.3–0.8 mm diam. Asci fusoid, (73–)80–98(–111)×(12–)13–17(–21) μm (n071), containing 8 biseriate ascospores, with distinct apical ring, 2.6–3.1 μm diam, 2.4–3 μm high. Ascospores hyaline, fusoid, distinctly constricted at the septum, (17.7–)21–24(– 29.5)×(4.5–)5.5–6.8(–8.3) μm, l/w0(2.9–)3.3–4(–5.1) (n0 472); ends subacute to narrowly rounded, with hyaline caplike appendages 1.3–2.4 μm long, 3.5–5.6 μm wide, soon fading in microscope mounts; cells dimorphic, upper cell mostly larger, multiguttulate; wall not swelling, ca. 0.4 μm thick. Anamorph: discosporina-like. Conidiomata 1–1.5 mm diam, often lined by a distinct, narrow blackish marginal zone, with a central or eccentric stromatic column; at maturity covered by whitish discharged conidial masses. Conidiogenous cells phialidic, 10–30×1.5–3 μm, hyaline. Conidia hyaline, variable in shape, narrowly ellipsoid, elongate to slightly allantoid, (10–)11.5–14(–16.5)×(3.0–)3.8– 4.5(–5.0) μm, l/w 0(2.2–)2.7–3.5(–4.6) (n 0172), Fungal Diversity (2012) 57:1–44 31 a b d i e f k l m n q r s t u y c1 d1 h g j x b1 c o v z e1 f1 p w a1 g1 Fig. 13 Melanconiella hyperopta. a. Panoramic view of pseudostromata. b. Pseudostroma in transverse section. c. Two pseudostromata in surface view. d–g. Ectostromatic discs and ostioles in surface view. h. Transverse section below ectostromatic disc. i. Ascus. j. Ascus tip with apical ring. k–w. Ascospores. x. Conidioma in surface view. y. Trans- h1 i1 j1 k1 l1 verse section of conidioma. z, a1. Conidiophores. b1–l1. Conidia. k, l in 3 % KOH, all other mounts in water. a02 mm, b–h, x, y0500 μm, i–w, z–l1010 μm. Sources: a. WU 31828; b–e. WU 31831; f, g, k, l. Otth 115 (B, holotype); h, v. WU 31827; i, j, u, x–l1. WU 31836; m, n. WU 31823; o–p. WU 31832; q–t. WU 31826; w. WU 31825 32 multiguttulate, often with one to four larger and few to numerous small guttules; wall ca. 0.4 μm thick; sometimes with an indistinct hyaline gelatinous sheath ca. 0.5 μm thick. Culture: Colony on MEA after 17 d at room temperature ca. 75 mm diam, after ca. 20 d plate nearly entirely covered (no further growth); colony not zonate, surface with distinct radial to substellate arrangement of surface hyphae, aerial hyphae irregularly arranged, inconspicuous or causing minute floccules on the surface; colony first white, turning bright yellow to orange from the centre, eventually dull orange; diffusing pigment lacking, agar slightly yellowish. Habitat and host range: dead corticated twigs and branches of Carpinus betulus mostly lying on the ground. Distribution: Europe; common. Typification: SWITZERLAND, near Bern, on corticated branch of Carpinus betulus, without date, G. Otth 115 (B 700009156; lectotype designated by Wehmeyer (1933)). Niederösterreich, Gaaden, Badener Bürgerspitalswald, map grid 7963/1, on corticated branch of Carpinus betulus, 3 Dec. 2012, H. Voglmayr & I. Greilhuber, strain MHG (from anamorph) (WU 31836, epitype here designated; ex-epitype culture CBS 132231), ex-epitype sequences JQ926285 (ITS-LSU), JQ926351 (rpb2), JQ926418 (tef1). Additional specimens examined (all on Carpinus betulus): AUSTRIA, Burgenland, Neusiedl/See, Edelstal, Spitzerberg, map grid 7967/2, 10 April 2010, H. Voglmayr & I. Greilhuber, strain MCS (from teleomorph) (WU 31823). Kärnten, St. Margareten im Rosental, Trieblach, near Ledra, map grid 9452/4, 1 May 2002, W. Jaklitsch, W.J. 1878, strain A.R. 3832 (BPI 843521, culture CBS 131492). Niederösterreich, Mannersdorf am Leithagebirge, Schweingraben, map grid 8065/2, soc. M. chrysodiscosporina (anamorph), 17 April 2010, H. Voglmayr & I. Greilhuber (WU 31824). Mauerbach, near the cemetery, map grid 7763/1, 28 Sep. 1996, W. Jaklitsch, W.J. 968 (WU 31825). ibid., 12 June 2011, W. Jaklitsch (WU 31826). Oberösterreich, Raab, Riedlhof, map grid 7647/2, 4 April 2010, H. Voglmayr, strain MCR (from teleomorph) (WU 31827). Raab, Wetzlbach, map grid 7648/1, 4 April 2010, H. Voglmayr (WU 31828). St. Willibald, Loitzmayr, map grid 7648/3, 8 April 2010, H. Voglmayr, strain MCL (from teleomorph) (WU 31829, culture CBS 131697). Wien, Döbling, Cobenzl, map grid 7763/2, 11 Feb. 2001, W. Jaklitsch, W.J. 1715, strain A.R. 3619 (BPI 840939, WU 31830, culture CBS 131493). Döbling, Hermannskogel, map grid 7763/2, soc. M. chrysodiscosporina (anamorph), 18 April 2010, H. Voglmayr, strain MCHE (from teleomorph) (WU 31831, culture CBS 131696). Landstraße, Botanical Garden, map grid 7864/1, 31 March 2010, H. Voglmayr, strain MCHBV (from teleomorph) (WU 31832). Liesing, Maurer Wald, map grid 7863/1, 3 Oct. 1998, W. Jaklitsch, W.J. 1224 (WU 31833). ibid., 22 April Fungal Diversity (2012) 57:1–44 2006, W. Jaklitsch, W.J. 2911 (WU 31834). Ottakring, Wilhelminenberg, Kreuzeichenwiese, map grid 7763/4, 19 March 2006, H. Voglmayr (WU 31835). GERMANY, Bayern, München, Allach, Lochholz, 16 March 1998, L. Beenken, Triebel, Microf. Exs. 273 (UPS 173895). Sachsen-Anhalt, Eisleben, Oberrissdorfer Tal, May 1875, J. Kunze, Fungi Sel. Exs. 122 (M-0177941, issued as Diaporthe decipiens). SWEDEN, Skåne, Helsingborg, Gyhults gård, 20 Jan. 1997, S.-Å. Hanson 25634 (UPS 200066). Skåne, Helsingborg, Frederiksdals Friluftsmuseum, 28 Feb. 2012, S.-Å. Hanson 2012-007 (WU 31615). Skåne, Södra Mellby par, Stenshuvud, 20 Oct. 1990, K. & L. Holm 5607a (UPS 412043, UPS 412044, culture CBS 114600). UKRAINE, Stryj, Podhorce, 27 Dec. 1916, F. Petrak, Fungi Polon. Exs. 637 (M-0157851, W). Notes: Besides Melanconiella spodiaea, M. hyperopta is the most common species of the genus occurring on Carpinus betulus in Europe, where it is mainly found on broken or fallen branches lying on the ground within forests. It is commonly associated with M. chrysodiscosporina. During attempts to establish anamorph-teleomorph connections in the present study, M. chrysodiscosporina was isolated several times from conidiomata closely associated with stromata of M. hyperopta. Although the conidia of both species are hyaline and of similar size, those of M. chrysodiscosporina can be distinguished by their more regular, cylindrical shape and the presence of two large guttules in the cell content. The anamorph-teleomorph connection was proven by DNA data from conidial and ascospore cultures. A culture of a Swedish collection (CBS 114600) had distinct ITS-LSU, rpb2 and tef1 sequences (Fig. 2), but the microscopic features of the specimen (UPS 412044) agreed fully with the other collections from Carpinus betulus. The collections from Carpinus orientalis are described as a new variety based on slightly smaller ascospores and the different host (see below). Wehmeyer (1933) proposed the combination Melanconis hyperopta, but he included M. carpinicola in his species concept. Finally, he synonymised M. hyperopta with M. chrysostroma (Wehmeyer 1941). According to the spore sizes given by Munk (1957) and Ellis and Ellis (1997), their concept of Melanconis chrysostroma was evidently based on collections of M. hyperopta. According to Gerhardt and Hein (1979), the herbarium of Nitschke, containing duplicates of Otth’s material, is present in the herbarium in Berlin (B). The spore size given in Otth (1869) is somewhat smaller (18–20×4–5 μm) than that revealed for the authentic collection deposited in Berlin (20–26×5–7.5), which is within the typical range of M. hyperopta. A similar case of underestimated spore sizes given by Otth (1869) was also recorded for Massaria pyri (Voglmayr and Jaklitsch 2011), indicating that the measurements given by Otth may Fungal Diversity (2012) 57:1–44 commonly be too small. To ensure nomenclatural stability, a recent collection, for which cultures and sequences are available, is designated here as epitype. The basionym of M. hyperopta, Diaporthe hyperopta, has been commonly ascribed to Nitschke, following Otth (1869) who attributed the taxon to Nitschke. However, there is no indication that Nitschke provided a diagnosis, and Otth himself stated in the introduction that the descriptions were intended to be provisional and based on his own observations (Otth 1869:37–38). Therefore, the author citation for D. hyperopta should be Nitschke ex G.H. Otth. Although no type specimen was available for study, Diaporthe decipiens is clearly a synonym of M. hyperopta, according to spore size and host. Diaporthe nigro-annulata Kunze, considered a synonym of M. hyperopta by Wehmeyer (1933), has apparently never been validly published; the schedae of the exsciccatum listed as type (Kunze, Fungi Sel. Exs. 122) were issued as Diaporthe decipiens Sacc., giving “Diap. nigro-annulata Johs. Kze. in sched.” as a synonym. Re-examination of two specimens of Kunze, Fungi Sel. Exs. 122 from Munich revealed one as M. hyperopta (M-0177941), whereas the other contains immature M. carpinicola (M-0177940). Melanconiella hyperopta var. orientalis Voglmayr & Jaklitsch, var. nov. (Fig. 14) MycoBank MB 800122 Etymology: referring to the epithet of the host, Carpinus orientalis. Pseudostromata 1.5–3 mm diam, typically distinct, welldefined, with circular outline, projecting up to 0.5 mm, perithecial bumps often evident; sometimes confluent and irregular. Ectostromatic disc typically flat, little projecting above the perithecial level, 0.2–0.6(–0.8) mm long, circular to linear, whitish, cream, light or pale yellow. Central column whitish, grey or brownish, entostroma inconspicuous. Ostioles 1–12 per disc, 50–160 μm diam, marginal or disposed within the disc, plane, discoid or papillate with rounded or flattened apices. Perithecia 0.3–0.6 mm diam. Asci fusoid, (84–)87–103(–107)×13–17(–18) μm (n012), containing 8 biseriate ascospores, with distinct apical ring, 2.5– 3.6 μm diam, 1.8–2.3 μm high. Ascospores hyaline, fusoid, distinctly constricted at the septum, (17.5–)18.7–22(–24)× (4.7–)5.7–6.7(–7.5) μm, l/w0(2.7–)3.0–3.5(–4.4) (n0110); ends subacute to narrowly rounded, with hyaline cap-like appendages 1–2 μm long, 2.7–4.2 μm wide, soon fading in microscope mounts; cells dimorphic, upper cell mostly larger, multiguttulate; wall not swelling, ca. 0.4 μm thick. Anamorph: discosporina-like. Conidiomata 0.9–1.5 mm diam, visible as darker spots and lined by a darker marginal zone, mostly with a central or eccentric stromatic column; at 33 maturity covered by whitish conidial masses. Conidiogenous cells phialidic, 7–22×2–3.5 μm, hyaline. Conidia hyaline, variable in shape, narrowly ellipsoid, elongate to slightly allantoid, (9.3–)10.5–12.7(–14.5)×(3.0–)3.5–4.0(–4.5) μm, l/w0(2.2–)2.8–3.6(–4.4) (n071), multiguttulate, often with one to three larger and few to numerous small guttules; wall and hyaline gelatinous sheath each ca. 0.5 μm thick. Culture: Colony on MEA after 17 d at room temperature 83 mm diam, after 4–5 wk plate nearly entirely covered by mycelium. Colony white, with pale brownish spots, or centre white, followed by a diffuse brownish, less commonly rosy zone, otherwise not zonate, with distinct radial to substellate arrangement of surface hyphae; aerial hyphae scant, sometimes abundant in the centre, diffusing pigment lacking; odour slightly musty. Habitat and host range: dead corticated twigs and branches of Carpinus orientalis; only found on branches attached to the trees. Distribution: South-eastern Europe, uncommon; only known from Croatia but likely to co-occur elsewhere with its host. Type: CROATIA, Istria, Krnica, on corticated twigs of Carpinus orientalis, 15 May 2010, H. Voglmayr & W. Jaklitsch, strain MSK (from teleomorph) (WU 31837, holotype; ex-holotype culture CBS 131705), ex-holotype sequences JQ926286 (ITS-LSU), JQ926354 (rpb2), JQ926421 (tef1). Additional specimen examined: CROATIA, Istria, Poreč, Gedici, on corticated twigs of Carpinus orientalis, 1 Nov. 2010, H. Voglmayr & I. Greilhuber, strains MHP (from teleomorph), MHVA (from anamorph) (WU 31838). Notes: Melanconiella hyperopta var. orientalis is similar to the closely related M. hyperopta, from which it differs mainly by host, slightly smaller ascospores and conidia and ITS, rpb2 and tef1 sequences. As these differences are subtle, the fungus on Carpinus orientalis is described as a new variety of M. hyperopta. The spores and conidia exhibit pronounced drought resistance, as most were still vital after storage for more than one year. The anamorph-teleomorph connection was proven by DNA data from conidial and ascospore cultures. Melanconiella meridionalis Voglmayr & Jaklitsch, sp. nov. (Fig. 15) MycoBank MB 800123 Etymology: referring to the southern distribution within Europe. Pseudostromata 0.8–2.3 mm diam, projecting up to ca. 0.5 mm, inconspicuous, indistinct, confluent, less commonly distinct and circular, causing minute bumps in the bark; perithecial bumps distinct or not. Ectostromatic disc 34 Fungal Diversity (2012) 57:1–44 a b d j a1 s f e l k t c g n m u v b1 Fig. 14 Melanconiella hyperopta var. orientalis. a. Panoramic view of pseudostromata. b. Two pseudostromata in transverse section. c. Three pseudostromata in surface view. d–h. Ectostromatic discs and ostioles in surface view. i. Transverse section below ectostromatic disc. j. Ascus. k. Ascus tip with apical ring. l–z. Ascospores. a1. Conidioma o w c1 i h p x q r y z d1 e1 f1 g1 h1 i1 j1 k1 in surface view. b1. Transverse section of conidioma showing central column. c1. Conidiophores. d1–k1. Conidia. All mounts in water. a0 2 mm, b01 mm, c0500 μm, d–i, a1, b10300 μm, j–z, c1–k1010 μm. Sources: a, b, h, i, v–z. WU 31837; c–g, j–u, a1–k1. WU 31838 Fungal Diversity (2012) 57:1–44 35 a b d c e f h g j i k l m n o p q u r v w x s y z Fig. 15 Melanconiella meridionalis. a. Panoramic view of pseudostromata. b. Pseudostroma in transverse section. c. Group of pseudostromata in surface view. d–g. Ectostromatic discs and ostioles in surface view. h. Transverse section below ectostromatic disc. i. Ascus. j. Ascus tip with apical ring. k–q. Ascospores. r, s. Conidiomata in surface view. t. t a1 b1 Transverse section of conidioma. u. Conidiophores. v–b1. Conidia. All mounts in water. a02 mm, b–h, r0500 μm, s, t0200 μm, i–q, u–b10 10 μm. Sources: a, c, d–f, r, s, u. WU 31845; b, g–j. WU 31844; k–p. WU 31849; q. WU 31846; t. WU 31839; v–b1. WU 31840 36 typically minute, 0.1–0.6 mm long, circular, oblong or linear, whitish, cream, pale yellowish to greyish or greyish brown, or concealed by ostioles. Central column (pale) grey or greyish brown. Entostroma whitish, of hyaline hyphae, scant or well-developed. Ostioles few, 1–5 per disc, commonly only 1–3, rarely 7, 50–125(–160) μm diam, shiny black, plane or slightly papillate with flattened or rounded tips. Perithecia valsoid around the column or solitary, 0.2– 0.5(–0.8) mm diam. Asci broadly cylindrical to fusoid, (85–) 91–104(–115)×(13–)15–18(–21) μm (n031), containing 8 uni- or irregularly biseriate ascospores, with distinct apical ring, 3.5–4.4 μm diam, 2.4–3 μm high. Ascospores hyaline, fusoid, constricted at the septum, (20–)23–28(–38)×(5.0–) 6.5–8.0(–9.5) μm, l/w0(2.8–)3.2–3.9(–4.6) (n090); ends narrowly rounded, with hyaline persistent cap-like appendages 1–1.8 μm long, 2.8–3.4 μm wide; cells dimorphic, upper cell mostly larger, with (1–)2 large and numerous small guttules; wall not swelling, 0.4 μm thick. Anamorph: discosporina-like. Conidiomata 0.4–1.5 mm diam, visible as dark brown spots lined by a darker marginal zone, with a central or eccentric stromatic column; at maturity covered by whitish discharged conidial masses. Conidiogenous cells phialidic, 19–37×3–4 μm, hyaline. Conidia hyaline, cylindrical to suballantoid, (13–)15–17.5 (–19.5)×(5.8–)6.3–7.0(–8.0) μm, l/w0(1.7–)2.2–2.7(–3.2) (n0120), with (1–)2 large and numerous small guttules; wall ca. 0.4–0.6 μm thick, with prominent gelatinous sheath 0.8–1.2 μm thick. Culture: On MEA growth conspicuously slow, colony reaching a diam of ca. 16 mm after 17 d and ca. 22 mm after 4 wk, white with diffuse yellow centre, dense, compact, thick; aerial hyphae short, forming delicate flocks; diffusing pigment lacking; odour slightly yeast-like. Habitat and host range: dead corticated twigs and branches of Ostrya carpinifolia mostly still attached to the tree. Distribution: Southern Europe; known from Austria, Croatia, Greece, Italy and Slovenia; common in the natural distribution range of its host. Type: AUSTRIA, Kärnten, St. Margareten im Rosental, on corticated branches of Ostrya carpinifolia, map grid 9452/4, 12 May 2010, H. Voglmayr, strain MOM (from teleomorph) (WU 31839, holotype; ex-holotype culture CBS 131704), ex-holotype sequences JQ926291 (ITSLSU), JQ926357 (rpb2), JQ926424 (tef1). Additional specimens examined (all on Ostrya carpinifolia): AUSTRIA, Kärnten, St. Margareten im Rosental, Novina, map grid 9452/4, 3 July 2007, W. Jaklitsch, W.J. 3106 (WU 31842). ibid., shrubs W of Stariwald, map grid 9452/4, 17 May 2010, H. Voglmayr & W. Jaklitsch, strain MOA (from anamorph) (WU 31840). ibid, map grid 9452/4, 10 Sep. 2010, W. Jaklitsch (WU 31841). ibid., Wograda, map grid 9452/3, 13 Sep. 2001, W. Jaklitsch, W.J. 1810 Fungal Diversity (2012) 57:1–44 (WU 31843). CROATIA, Primorsko-goranska (Istria), nature park Učka, Veprinac WSW Opatija, 15 May 2010, H. Voglmayr & W. Jaklitsch, strain MOU (from teleomorph) (WU 31844). Vela Učka, Poklon, 15 May 2010, H. Voglmayr & W. Jaklitsch, strain MOK (from teleomorph) (WU 31845). GREECE, Kerkyra (Corfu), Kastellani near Troumpettas, 21 April 2012, H. Voglmayr & W. Jaklitsch (WU 32003). ITALY, Toscana, Grosseto, Sovana, 29 July 2009, H. Voglmayr, W. Jaklitsch & W. Gams, strain MOSO (from teleomorph) (WU 31846). Trentino, Nembia, 19 Oct. 2011, H. Voglmayr & W. Jaklitsch (WU 31847). SLOVENIA, Vipava, Mt. Nanos massif, Rebrnice NE Lozice, 13 June 2009, H. Voglmayr & I. Greilhuber, strain MON (from teleomorph) (WU 31848). Divača, Škocjan, 12 June 2009, H. Voglmayr & I. Greilhuber, strain MOS (from teleomorph) (WU 31849). Divača, Škocjanska jama, 12 June 2009, H. Voglmayr & I. Greilhuber, strain MOSJ (from teleomorph) (WU 31850, culture CBS 125599). Notes: Melanconiella meridionalis is characterised by its large, mostly biguttulate ascospores with dimorphic cells and the growth on Ostrya carpinifolia. In addition, it has the least developed stroma of all Melanconiella species. It is closely related to the North American Melanconiella ostryae, which differs by distinctly smaller ascospores (15–23×4–8 μm), dark brown conidia with a lighter equatorial zone and the different host O. virginiana. The anamorph-teleomorph connection was proven by DNA data from conidial and ascospore cultures. Melanconiella ostryae (Dearn.) Voglmayr & Jaklitsch, comb. nov. (Fig. 16) MycoBank MB 800124 Basionym: Diaporthe ostryae Dearn., Mycologia 18:246 (1926). Synonym: Melanconis ostryae (Dearn.) Wehm., Mycologia 29:601 (1937). Pseudostromata 1–2.2 mm diam, typically inconspicuous, sometimes distinct, circular, slightly projecting to ca. 0.5 mm, perithecial bumps uncommon. Ectostromatic disc small, well-defined, with circular or elliptic outline, 0.1– 0.5 mm long, whitish, cream, grey to pale greyish brown. Central column whitish, grey or brownish. Entostroma whitish or cream, of hyaline hyphae. Ostioles 1–5(–7) per disc, variously arranged, 40–125 μm diam, shiny black, flat or papillate. Perithecia 0.2–0.5 mm diam. Asci cylindrical to fusoid, (55–)77–100(–120)×10–13(–14) μm (n057), containing 8 irregularly biseriate ascospores, with apical ring distinct when fresh, 2.8–3 μm diam, 2.2–3 μm high, only faintly visible in older herbarium specimens. Ascospores hyaline, fusoid, slightly to not constricted at the septum, (14.5–)16.5–19(–23)×(4.0–)5.5–7.0(–8.3) μm, l/w0(2.1–) 2.5–3.3(–4.2) (n0209); ends narrowly rounded to subacute, Fungal Diversity (2012) 57:1–44 37 a b d f e k j i c r s m l t g n v u h o p q w x y c1 z d1 a1 e1 f1 b1 g1 h1 i1 Fig. 16 Melanconiella ostryae. a. Panoramic view of pseudostromata. b. Pseudostroma in transverse section. c. Three pseudostromata in surface view. d–g. Ectostromatic discs and ostioles in surface view. h. Transverse section below ectostromatic disc. i. Ascus. j. Ascus tip with apical ring. k–y. Ascospores (k, u–y showing appendages). z, a1. Conidiomata in surface view. b1. Transverse section of conidioma, j1 k1 showing central column. c1, d1. Conidiophores. e1–k1. Conidia. k–v in 3 % KOH, all other mounts in water. a02 mm, b, c, z–b10500 μm, d–h0200 μm, i–y, c1–k1010 μm. Sources: a, e–q, b1. Bowser 37–102 (NY); b–d, u, v. Dearness 27 July 1893, Ellis 2162 (NY); r–t, a1. M.E.B.B. 4365 (NY); w–y. Ellis 2162B (NY); z. TRTC 44844 (NY); c1–k1. BPI 615036 38 with hyaline cap-like appendages 0.6–2 μm long, 2.2– 3.8 μm wide, soon disappearing in microscope mounts; cells slightly dimorphic, upper cell mostly larger, multiguttulate, sometimes with one large and numerous small guttules per cell; wall not swelling, ca. 0.4 μm thick. Anamorph: melanconium-like. Conidiomata 1–1.5 mm diam, margins not visible on the surface, with central or eccentric stromatic column; at maturity covered by black discharged conidial masses. Conidiogenous cells annellidic, 20–32×3–5 μm, hyaline. Conidia dark brown, with a light brown equatorial zone ca. 1.5–2.2 μm wide, ellipsoid, slightly constricted in the middle, (12–)13–15.5(–17) × (6.2–)7.0–8.0(–8.8) μm, l/w0(1.6–)1.7–2.1(–2.4) (n076), without guttules or granules; wall and hyaline gelatinous sheath each ca. 0.5–0.7 μm thick. Habitat and host range: dead corticated twigs and branches of Ostrya virginiana. Distribution: North America (USA, Canada); common. Typification: CANADA, Ontario, Mt. Pleasant near London, on corticated branches of Ostrya virginiana, 6 July 1904, J. Dearness 3152 (DAOM, lectotype of Diaporthe ostryae here designated); same place, date and collector, herbarium L. E. Wehmeyer 3278 (DAOM 120563, isotype). Additional specimens examined (all on Ostrya virginiana): CANADA, Ontario, London, 27 July 1893, J. Dearness, (NY, 2 specimens: Ellis 2162 & 2162B). ibid., without date, J. Dearness, Ellis & Everhart, N. Amer. Fungi. Ser. II: 3430 (NY). Huron Distr., Bruce Co., Brinkman Corner, 31 May 1964, R. F. Cain, TRTC 44844 (NY). Bruce Co., Garrick twp., Con. XIII, Lot 31, 22 July 1960, R. L. Bowser 37-102 (NY). York Co., Nashville, 2 May 1954, R. F. Cain (NY). USA, Vermont, Lamoille Co., Stowe, Covered Bridge Road, 2 July 1964, H. E. & M. E. Bigelow M.E.B.B. 4191 (NY). ibid., Pinnacle Trail, 21 July 1964, H. E. & M. E. Bigelow M.E.B.B. 4365 (NY). Notes: Melanconiella ostryae is characterised by growth on Ostrya virginiana and dark brown conidia with a distinctly lighter brown equatorial zone, which is unique in Melanconiella. Due to the dark brown conidia, which are produced in large numbers, colonised twigs are blackened, providing a strong contrast to the whitish ectostromatic discs. In several collections, no black ostioles were visible in the ectostromatic discs, and sections revealed that no or only aborted perithecia were present. Due to the lack of fresh collections, no cultures and sequences could be obtained from the anamorph in the present study. However, the anamorph-teleomorph connection was experimentally proven in pure culture studies by Wehmeyer (1937). Melanconiella ostryae is closely related to M. meridionalis, which differs by distinctly larger ascospores (20– 38×5–10 μm), hyaline conidia, a different host (O. carpinifolia) and European distribution. Fungal Diversity (2012) 57:1–44 Melanconiella spodiaea (Tul.) Sacc., Syll Fung 1:740 (1882). (Fig. 17) MycoBank MB210704 Basionym: Melanconis spodiaea Tul., Ann Sci nat, ser 4, 5:109 (1856) (type not seen). Pseudostromata inconspicuous, 1.3–3 mm diam, little projecting, circular, perithecial contours typically not evident. Ectostromatic disc 0.25–1.1 mm long, mostly oblong, sometimes circular or triangular, generally laterally enclosed by bark, projecting 0.1–0.5 mm, often concealed by densely disposed ostioles, light to dark grey, greyish brown, light to dull or dark brown. Central column well-defined, light to dark grey, greyish brown or grey-olive, perforated by ostioles. Entostroma of subhyaline or yellowish hyphae. Ostioles often in 1 or 2 rows, 1–15 per disc, 60–190 μm diam, shiny black, stout, papillate to short cylindrical, with rounded, sometimes flattened apices, distinct or fused in the disc. Perithecia 0.3–0.5 mm diam, up to 20 per stroma. Asci cylindrical, (104–)110–120(–121)× (14–)15–17(–18) μm (n016), containing 8 uniseriate ascospores, with distinct apical ring, 3–3.8 μm diam, 1–1.5 μm high. Ascospores dark umber brown, broadly ellipsoid, slightly constricted at the straight to slightly oblique septum, (13.5–)15.5–18.3 (–19.5)×(6.5–)7.5–8.8(–9.8) μm, l/w0(1.6–)1.9–2.3(–2.5) (n082); ends broadly rounded, with broad, persistent, hyaline cap-like appendages 1–1.7 μm long, 4–5.5 μm wide; cells monomorphic to slightly dimorphic, multiguttulate, often with one large guttule almost entirely filling the lumen and few peripheral small guttules; wall not swelling, ca. 0.7 μm thick. Anamorph: melanconium-like. Conidiomata 1–4 mm diam, blackish, mostly with central or eccentric stromatic column; at maturity covered by black discharged conidial masses. Conidiogenous cells annellidic, 20–29×2.5–5 μm, hyaline. Conidia dark umber brown, variable in shape, ovoid, obovoid, ellipsoid, oblong, sometimes shmooshaped or slightly constricted in the middle, (12.5–)13.3– 15.2(–16.5)×(7.0–)7.5–8.5(–9.0) μm, l/w0(1.4–)1.6–1.9(– 2.1) (n031), multiguttulate; wall and gelatinous sheath each ca. 0.7 μm thick. Culture: Colony on MEA after 17 d at room temperature ca. 64 mm diam, with continuous or distinctly lobed margin, surface whitish, farinose or granulose due to aerial hyphae that form densely disposed floccules; floccules producing hyaline, rosy to violaceous brown drops; reverse and agar turning rosy, later reddish brown 9–10DE5–8 by a diffusing pigment; eventually colony reverse dark red, purple to nearly black, surface dull whitish to grey; agar decolourised to pale brownish; odour typically distinctly musty (like fermenting fruits). Habitat and host range: dead corticated twigs and branches of Carpinus betulus and C. orientalis. Fungal Diversity (2012) 57:1–44 39 a b d e j i f l k q c r s h g m n o p t u v w a1 x b1 y c1 d1 z e1 f1 Fig. 17 Melanconiella spodiaea. a. Panoramic view of pseudostromata. b. Two pseudostromata in transverse section. c, h. Transverse sections below ectostromatic disc. d–g. Ectostromatic discs and ostioles in surface view. i. Ascus. j. Ascus tip with apical ring. k–w. Ascospores. x, y. Conidiomata in surface view. z. Transverse section of g1 h1 two conidiomata, showing central columns. a1. Conidiophores. b1–h1. Conidia. All mounts in water. a, x02 mm, b–h, y, z0500 μm, i–w, a1– h1010 μm. Sources: a–d, i, p–u, x–h1. WU 31854; e–h, v, w. WU 31855; j–o. WU 31614 40 Distribution: Europe; common and widespread. Specimens examined: On Carpinus betulus: AUSTRIA, Burgenland, Hornstein, Lebzelterberg, map grid 8064/4, 11 Sep. 2010, H. Voglmayr, strain MSH (from teleomorph) (WU 31851). Kärnten, St. Margareten im Rosental, Ledra, map grid 9452/4, 7 June 1996, W. Jaklitsch, W.J. 893 (WU 31852). Niederösterreich, Michelbach Markt, Mayerhöfen, Hegerberg, map grid 7860/4, 20 June 2009, W. Jaklitsch & H. Voglmayr, strain SPOD (WU 31853, culture CBS 125641). ibid., 3 June 2000, W. Jaklitsch, W.J. 1485, strain A.R. 3462 (BPI 747944, culture CBS 109762). Mauerbach, near the cemetery, map grid 7763/1, 12 Nov. 2011, W. Jaklitsch, strain SPOD1 (from anamorph) (WU 31854). ibid., 22 Aug. 1992, W. Jaklitsch (WU 16067). Hainbuch, map grid 7763/1, 21 Aug. 1993, W. Jaklitsch (WU 15993). Gaaden, Badener Bürgerspitalswald, map grid 7963/1, 3 Dec. 2012, H. Voglmayr & I. Greilhuber (WU 31614). Oberösterreich, Raab, Großrothmayr, map grid 7647/2, 4 April 2010, H. Voglmayr (WU 31855). Wien, Döbling, Hermannskogel, map grid 7763/2, 15. Feb. 1998, W. Jaklitsch, W.J. 1135 (WU 31856). ibid., 27 March 1999, W. Jaklitsch, W.J. 1295 (WU 31857). Hietzing, Lainzer Tiergarten, map grid 7863/1, 28 June 1992, W. Jaklitsch (WU 15204). Liesing, Maurerwald, map grid 7863/1, 10 July 1993, W. Jaklitsch (WU 15037). On Carpinus orientalis: CROATIA, Istria, Vrsar, soc. M. chrysorientalis, 14 May Fungal Diversity (2012) 57:1–44 2010, H. Voglmayr & W. Jaklitsch, strain MVS (from anamorph) (WU 31858). GREECE, Kerkyra (Corfu), ESE Ano Korakiana, W Ag. Vasilios, 23 April 2012, H. Voglmayr & W. Jaklitsch (WU 32004). Notes: Melanconiella spodiaea is the most common and conspicuous species of the genus in Europe. It is often associated with Prosthecium ellipsosporum, which appears to be rarer. Melanconiella spodiaea is most similar to M. decorahensis, which has dark brown ascospores of similar size, but differs by the absence of ascospore appendages, by pip-shaped conidia, an ectostroma of light to dark grey or brown colour and different hosts (Betula spp.). Colonised twigs are often distinctly blackened by numerous dark brown conidia and ascospores. The anamorph-teleomorph connection was repeatedly proven by DNA data from conidial and ascospore cultures. Several Melanconium species have been described, which could represent the conspicuous melanconium-like anamorph of M. spodiaea. However, as the original descriptions are very brief and incomplete and as original material is often unavailable for study, these cannot be confidently connected to the currently accepted Melanconiella species. In addition, they often consist of mixed elements considering the various hosts listed, and most of these binomials have not been used in recent literature. They should therefore be considered dubious names. Key to species of Melanconiella Note: Although the anamorph is often important and helpful in the distinction of similar species and is therefore essential for identification, this feature has to be evaluated carefully in species growing on Carpinus betulus. In the present study two different species were often found on the same twig, e.g. species with hyaline and dark brown conidia: M. carpinicola/M. chrysomelanconium and M. chrysomelanconium/M. chrysodiscosporina; or M. hyperopta/M. chrysodiscosporina, both with hyaline conidia but with different conidial shapes and contents. Ascospores and conidia should be examined in water mounts, as in KOH some features are either quickly disappearing (appendages, hyaline sheath) or less evident (swelling of ascospore walls). 1 Ascospores dark brown; conidia dark brown .................................................................................................................................... 2 Ascospores hyaline; conidia hyaline or dark brown ............................................................................................................................ 3 2(1) Ascospores with hyaline, broad cap-like appendages; conidia usually not distinctly pip-shaped; on Carpinus in Europe ......................................................................................................................................................... M. spodiaea Ascospores without appendages; conidia pip-shaped; on Betula spp. in Europe and North America ....................... M. decorahenis 3(1) On Carpinus ................................................................................................................................................................................ 4 On other hosts ................................................................................................................................................................................... 12 4(3) Ascospores with distinctly swelling ascospore wall and with monomorphic, (sub)globose to bullet-shaped ascospore cells mostly wider than 7 μm; commonly with bright yellow ectostroma; in Europe .................................................. 5 Ascospores without distinctly swelling ascospore wall and with slightly to distinctly dimorphic cells mostly narrower than 7 μm; ectostroma grey, brownish, cinnamon, cream or yellow ............................................................................................................ 7 5(4) Ascospores (16–)19–23(–27.5)×(7.5–)9–12.5(–15.5) μm; always associated with conspicuous conidiomata containing dark brown conidia; on C. betulus in open habitats (parks, hedges, forest edges) ........................................ M. chrysomelanconium Ascospores (15.5–)17–20(–22)×(6–)7–10(–15) μm; with conidiomata containing hyaline conidia ................................................. 6 6(5) On C. betulus; conidia (12.5–)13.5–16(–19)×4.5–5.5(–6) μm, l/w0(2.2–)2.5–3.3(–4) ..........................M. chrysodiscosporina On C. orientalis; conidia (11.5–)12.5–14(–15.5)×(5.5–)6–7(–7.5) μm, l/w0(1.7–)1.9–2.2(–2.7) ........................ M. chrysorientalis 7(4) Ascospores mostly wider than 5.5 and longer than 18.5 μm .................................................................................................... 8 Ascospores mostly narrower than 5.5 μm and shorter than 18.5 μm ............................................................................................. 10 Fungal Diversity (2012) 57:1–44 41 8(7) On Carpinus in Europe; ectostromatic discs concave, flat or slightly pustulate and little projecting above the perithecial level, whitish to dull yellow or brownish; central column pale yellowish to pale greyish brown or brownish, entostroma inconspicuous, pale, slightly lighter than bark interior ............................................................................................................................... 9 On C. caroliniana in North America; ectostromatic discs well-developed, often pulvinate, commonly with distinctly projecting ostioles thus appearing spiny, cream yellow, honey, cinnamon, orange brown to brown; central column young bright olive-yellow, then olive-green to olive-brown; entostroma well-developed, of compacted hyphae, olivegreen or olive-brown ........................................................................................................................................ M. echinata 9(8) On C. betulus ........................................................................................................................................................... M. hyperopta On C. orientalis ........................................................................................................................................ M. hyperopta var. orientalis 10(7) On C. betulus in Europe; in open habitats (parks, hedges, forest edges) .......................................................... M. carpinicola On C. caroliniana in North America ................................................................................................................................................ 11 11(10) Ectostromatic disc mostly irregularly shaped, commonly surrounded by irregular edges or flaps of bark, drab, light to dark grey or dark brown; ostioles mostly marginal in the disc; central column grey or brownish ....................................... M. ellisii Ectostromatic discs regularly shaped, mostly circular, angular or ellipsoid, distinctly projecting, often pulvinate, pale or bright yellow to light brown; ostioles mostly regularly arranged in the disc; central column yellow, olive grey or brownish ............... M. elegans 12(3) On Corylus; ascospores broadly fusoid; ascospore ends distinctly subacute with persistent knob-like hyaline appendages .................................................................................................................................................... M. flavovirens On Ostrya; ascospores fusoid; ascospore ends narrowly rounded to subacute, without or with cap-like appendages ................... 13 13(12) Ascospores (20–)23–28(–37.5)×(5–)6.5–8(–9.5) μm; conidia hyaline; on Ostrya carpinifolia in Europe ......... M. meridionalis Ascospores (14.5–)16.5–19(–23)×(4–)5.5–7(–8.5) μm; with dark brown conidia having a light brown equatorial zone; on Ostrya virginiana in North America ......................................................................................................................................... M. ostryae Species excluded from Melanconiella Apart from the species of Melanconiella recognised in the current study, most names described or combined in the genus are either incompletely known or doubtful members of Melanconiella. As we have not been able to study material of some taxa, the list below contains only species for which we have some evidence. The account also includes taxa that were previously synonymised with M. chrysostroma (fide Wehmeyer 1941) and now found to be unrelated to Melanconiella after studying their types. Diatrype carpinigera Berk. & M.A. Curtis, Grevillea 4:96 (1876). Synonym: Melanconis carpinigera (Berk. & M.A. Curtis) Petr., Sydowia 6:355 (1952). Based on a rudimentary description, this name was combined into Diaporthe by Saccardo (1883), subsequently synonymised with Melanconis chrysostroma var. ellisii by Wehmeyer (1941) and combined into Melanconis by Petrak (1952b). Re-examination of the type (K(M) 171592) showed that it is not a diaporthalean fungus; stroma morphology and shape and size (18.5–22.5×8.5–11.5 μm) of its brown, two-celled ascospores rather suggest a Valsaria sp. Melanconiella appendiculata (G.H. Otth) Sacc., Syll Fung 11:XXIX (1895). This species is currently classified as Prosthecium appendiculatum (G.H. Otth) M.E. Barr and is phylogenetically unrelated to Melanconiella (unpubl. data). Melanconiella chrysostroma (Fr.) Sacc., Syll Fung 1:741 (1882). Basionym: Valsa chrysostroma Fr., Sum Veg Scand:412 (1849). [0 Sphaeria xanthostroma Mont. & Fr. (1834), non Schwein. (1832), non J.C. Schmidt (1817)]. Synonym: Melanconis chrysostroma (Fr.) Tul., Selecta fung carpol (Paris) 2:125 (1863). Melanconiella chrysostroma is based on Valsa chrysostroma, which was established by Fries (1849) as a new name for the homonym Sphaeria xanthostroma Mont. & Fr. (Montagne 1834), non Schwein. (von Schweinitz 1832). However, Sphaeria xanthostroma Mont. & Fr. is the basionym of Wuestneia xanthostroma (Reid and Booth 1989) and represents a taxon differing from Melanconiella by unicellular ascospores. No morphological description was provided by Fries (1849). Tulasne and Tulasne (1863), who apparently did not know Wuestneia xanthostroma, considered the description and illustrations of Montagne (1834: pl. 12, Fig. 4) to be unreliable (“de peritheciorum forma et thecarum fecunditate non fida”), misapplied the name for a taxon with two-celled ascospores and combined the name into Melanconis, explicitly citing Sphaeria xanthostroma Mont. as a synonym and therefore following the nomenclatural concept of Fries (1849). Because the basionym, Valsa chrysostroma, is based on the type and description of Sphaeria xanthostroma Mont., Melanconis chrysostroma is an obligate synonym of Wuestneia xanthostroma, although the concept of Tulasne and Tulasne (1863) applies to a 42 different taxon belonging to Melanconiella. Their description does not fit a single Melanconiella species, but is rather based on a mixture of several taxa. Tulasne and Tulasne (1863) record both brown, ovate conidia, 13–15×10 μm, as well as biguttulate hyaline conidia, 10–13×3.5–5 μm. Their descriptions, measurements and illustrations could be based on a mixture of M. chrysodiscosporina (with hyaline biguttulate conidia) and M. chrysomelanconium (with brown conidia), which agrees with the illustration of biguttulate ascospores. However, they do not give ascospore sizes, but state that they are of similar width as the hyaline conidia, and they record a biseriate ascospore arrangement, features which are not in line with the former two species, but rather imply M. hyperopta or M. carpinicola. As we did not have the opportunity to examine the Tulasne collections, their concept of Melanconis chrysostroma remains obscure. Melanconiella corni (Wehm.) Petr., Sydowia 6:15 (1952). This species is currently classified as Hapalocystis corni (Wehm.) M.E. Barr and is phylogenetically unrelated to Melanconiella (unpubl. data). Melanconiella leucostroma (Niessl & Rehm) Sacc., Syll Fung 2: Addenda Vol I:LIV (1883). According to Wehmeyer (1941) this name is a synonym of Cryptodiaporthe galericulata. Melanconiella meschuttii (Ellis & Everh.) Berl. & Voglino, in Saccardo, Syll Fung, Addit. I–IV:129 (1886). According to Wehmeyer (1941) this name is a synonym of Melanconis nigrospora, now classified as Chapeckia nigrospora (Peck) M.E. Barr. Melanconiella nigrospora (Peck) Dearn. & House, Bull N Y State Mus 266:81 (1925). This is a synonym of Chapeckia nigrospora, which is unrelated to Melanconiella (Fig. 1). Melanconiella nyssaegena Ellis & Everh., J Mycol 8:18 (1902). According to Wehmeyer (1941) this name is a synonym of Massariovalsa sudans (Berk. & M.A. Curtis) Sacc. Melanconiella obruta (Ellis & Everh.) Sacc. & P. Syd., Syll Fung 16:509 (1902). According to Wehmeyer (1941) this name is a nomen dubium which cannot be interpreted because the type collection contains only a melanconium-like anamorph. Melanconis platystroma Wehm., Mycologia 29:613 (1937). Melanconis platystroma was described from Carpinus caroliniana in Michigan and included in Wehmeyer Fungal Diversity (2012) 57:1–44 (1941). Although it may belong in Melanconiella, it is unlike any species included here and differs in having truncated, grey to yellow grey ectostromatic discs with scarcely visible or barely erumpent ostioles, large, brown ascospores (25–31×12.5–14.5 μm) with a distinctly greenish tint when fresh, and large (20–31 × 16–18 μm), brown conidia (Wehmeyer 1937, 1941). Wehmeyer (1937) noted that he was unable to germinate the ascospores and conidia despite numerous attempts, which is atypical for species of Melanconiella, conidia and ascospores of which germinate easily in pure culture. Wehmeyer (1941) noted that its stromata closely match those of Massariovalsa sudans which, according to our experience, is also difficult to grow. Apparently known only from the type collection, this species cannot be appropriately classified until fresh material becomes available. Melanconiella stellata Petch, Ann Roy Bot Gard Peradeniya 7:306 (1922). According to Wehmeyer (1941) this name may be a species of Valsaria. Valsa bitorulosa Berk. & Br., Ann Mag Nat Hist Ser 3, 3:367 (1846). Synonym: Diaporthe bitorulosa (Berk. & Broome) Sacc., Syll Fung 1: 608 (1882). Based on a scanty description, this name was combined into Diaporthe by Saccardo (1882) and subsequently synonymised with Melanconis chrysostroma by Wehmeyer (1937, 1941). Re-examination of the type (K(M) 171593) showed that it is not a diaporthalean fungus; stroma morphology and shape and size (19–20×5.5–7 μm) of its brown, four-celled ascospores rather suggest a Thyridaria sp. Acknowledgements We thank Walter Gams for hospitality and excursion support in Italy; Jacques Fournier, Enrique Rubio Domínguez, Sven-Åke Hanson and Larissa Vasilyeva for collecting and communicating Melanconiella specimens; Irmgard Greilhuber and her family for organising and participating in numerous collecting trips together with HV; the fungarium curators of B, BPI, DAOM, G, GZU, K, M, NY, UPS and W for the loan of specimens; Scott Redhead (DAOM) for providing notes of L. E. Wehmeyer and for allowing DNA extraction from the type specimen of M. echinata; Walter Till (WU) for managing the herbarium loans; and the British Mycological Society for invitation to the BMS Spring Foray 2011 in Yorkshire. References Barr ME (1978) The Diaporthales in North America, with emphasis on Gnomonia and its segregates. Mycol Mem 7:1–232 Castlebury LA, Rossman AY, Jaklitsch WJ, Vasilyeva LN (2002) A preliminary overview of the Diaporthales based on large subunit nuclear ribosomal DNA sequences. Mycologia 94:1017–1031 Fungal Diversity (2012) 57:1–44 Chaverri P, Samuels GJ (2003) Hypocrea/Trichoderma (Ascomycota, Hypocreales, Hypocreaceae): species with green ascospores. Stud Mycol 48:1–116 Clements FE, Shear CL (1931) Genera of fungi, 2nd edn. H.W. Wilson, New York de Hoog GS, Gerrits van den Ende AHG (1998) Molecular diagnostics of clinical strains of filamentous basidiomycetes. Mycoses 41:183–189 De Silva H, Castlebury LA, Green S, Stone JK (2009) Characterisation and phylogenetic relationships of Anisogramma virgultorum and A. anomala in the Diaporthales (Ascomycota). Mycol Res 113:73–81 Dennis RWG (1968) British Ascomycetes. J. Cramer, Stuttgart Druzhinina IS, Kubicek CP, Komoń-Zelazowska M, Mulaw TB, Bissett J (2010) The Trichoderma harzianum demon: complex speciation history resulting in coexistence of hypothetical biological species, recent agamospecies and numerous relict lineages. BMC Evol Biol 10:94 Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32:1792–1797 Ellis MB, Ellis JP (1997) Microfungi on land plants. An identification handbook. Richmond Publishing, Slough Ellis JB, Everhart BM (1892) North American pyrenomycetes. Ellis & Everhart, Newfield Fries EM (1849) Summa Vegetabilium Scandinaviae. Sectio posterior. 259–572. A. Bonnier, Stockholm, Leipzig Fuckel KWGL (1870) Symbolae Mycologicae. Beiträge zur Kenntnis der Rheinischen Pilze. Jahrb Nassau Ver Naturkd 23–24:1–459 Fuckel KWGL (1871) Symbolae Mycologicae. Erster Nachtrag. Jahrb Nassau Ver Naturkd 25–26:289–346 Fuckel KWGL (1874) Symbolae Mycologicae. Zweiter Nachtrag. Jahrb Nassau Ver Naturkd 27–28:1–99 Gazis R, Rehner S, Chaverri P (2011) Species delimitation in fungal endophyte diversity studies and its implications in ecological and biogeographic inferences. Mol Ecol 20:3001–3013 Gerhardt E, Hein B (1979) Die nomenklatorischen Typen der von Th. Nitschke beschriebenen Arten im Pilzherbar des Botanischen Museums Berlin-Dahlem. Willdenowia 9:313–329 Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis. program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98 Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17:754–755 Jaklitsch WM (2009) European species of Hypocrea part I. The greenspored species. Stud Mycol 63:1–91 Jaklitsch WM (2011) European species of Hypocrea part II. species with hyaline ascospores. Fungal Divers 48:1–250 Jaklitsch WM, Voglmayr H (2004) Hapalocystis occidentalis - a new species of Diaporthales from North America and a key to the species of Hapalocystis. Stud Mycol 50:229–234 Jaklitsch WM, Voglmayr H (2011) Nectria eustromatica sp. nov., an exceptional species with a hypocreaceous stroma. Mycologia 103:209–218 Jaklitsch WM, Komon M, Kubicek CP, Druzhinina IS (2006) Hypocrea voglmayrii sp. nov. from the Austrian Alps represents a new phylogenetic clade in Hypocrea/Trichoderma. Mycologia 97:1365–1378 [‘2005’] Jaklitsch WM, Stadler M, Voglmayr H (2012) Blue pigment in Hypocrea caerulescens sp. nov. and two additional new species in sect. Trichoderma. Mycologia 104(4):17 Katoh K, Toh H (2008) Recent developments in the MAFFT multiple sequence alignment program. Brief Bioinform 9:286– 298 Katoh K, Misawa K, Kuma K, Miyata T (2002) MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res 30:3059–3066 43 Kobayashi T (1970) Taxonomic studies of Japanese Diaporthaceae with special reference to their life-histories. Bull Gov Forest Exp Sta 226:1–242 Liu YL, Whelen S, Hall BD (1999) Phylogenetic relationships among ascomycetes: evidence from an RNA polymerase II subunit. Mol Biol Evol 16:1799–1808 Mejía LC, Castlebury LA, Rossman AY, Sogonov MV, White JF Jr (2011a) A systematic account of the genus Plagiostoma (Gnomoniaceae, Diaporthales) based on morphology, hostassociations, and a four-gene phylogeny. Stud Mycol 68:211– 235 Mejía LC, Rossman AY, Castlebury LA, White JF Jr (2011b) New species, phylogeny, host-associations and geographic distribution of genus Cryptosporella (Gnomoniaceae, Diaporthales). Mycologia 103:379–399 Montagne C (1834) Notice sur les plantes cryptogames récemment découvertes en France, contenant aussi l’indication précise des localités de quelques espèces les plus rares de la flore Française. Ann Sci Nat Bot Sér 2(1):295–307 Müller E, von Arx JA (1962) Die Gattungen der didymosporen Pyrenomyceten. Beitr Kryptogamenfl Schweiz 11(2):1–922 Munk A (1957) Danish pyrenomycetes. A preliminary flora. Dansk Bot Ark 17:1–491 Nylander JA, Wilgenbusch JC, Warren DL, Swofford DL (2008) AWTY (are we there yet?): a system for graphical exploration of MCMC convergence in Bayesian phylogenetics. Bioinformatics 24:581–583 Otth G (1869) Sechster Nachtrag zu dem in Nr. 15–23 der Mittheilungen enthaltenen Verzeichnisse schweizerischer Pilze. Mitth Natforsch Ges Bern 1868:37–70 Pavlic D, Slippers B, Coutinho TA, Wingfield MJ (2009) Multiple gene genealogies and phenotypic data reveal cryptic species of the Botryosphaeriaceae: a case study on the Neofusicoccum parvum ⁄ N. ribis complex. Mol Phyl Evol 51:259–268 Petrak F (1952a) Fungi beltsvillenses. III. Sydowia 6:5–16 Petrak F (1952b) Fungi beltsvillenses. IV. Sydowia 6:352–360 Petrak F (1962) Mykologische Beiträge zur österreichischen Flora. Sydowia 16:155–198 Reid J, Booth C (1989) On Cryptosporella and Wuestneia. Can J Bot 67:879–908 Riethmüller A, Voglmayr H, Göker M, Weiß M, Oberwinkler F (2002) Phylogenetic relationships of the downy mildews (Peronosporales) and related groups based on nuclear large subunit ribosomal DNA sequences. Mycologia 94:834–849 Saccardo PA (1876) Fungi Veneti novi vel critici. Series V. Nuovo Giornale Botanico Italiano 8:161–211 Saccardo PA (1882) Sylloge Fungorum 1. Padova: published by the author Saccardo PA (1883) Sylloge Fungorum 2. Padova: published by the author Saccardo PA (1884) Sylloge Fungorum 3. Padova: published by the author Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W et al. (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad Sci USA, www.pnas.org/cgi/doi/10.1073/ pnas.1117018109 Sieber TN (2007) Endophytic fungi in forest trees: Are they mutualists? Fungal Biol Rev 21:75–89 Silvestro D, Michalak I (2011) raxmlGUI: a graphical front-end for RAxML. Org Divers Evol. doi:10.1007/s13127-011-0056-0 Stamatakis E (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22:2688–2690 Sutton BC (1980) The Coelomycetes. Commonwealth Mycological Institute, Kew 44 Swofford DL (2002) PAUP*: Phylogenetic Analysis Using Parsimony (*and Other Methods), Version 4.0b10. Sinauer Associates, Sunderland, Massachusetts Thiers B (2012) Index Herbariorum: a global directory of public herbaria and associated staff. New York Botanical Garden’s Virtual Herbarium. http://sweetgum.nybg.org/ih/ Tulasne LR, Tulasne C (1863) Selecta Fungorum Carpologia, vol. 2. Paris Vasilyeva LN, Stephenson SL (2010) Biogeographical patterns in pyrenomycetous fungi and their taxonomy. 1. The Grayan disjunction. Mycotaxon 114:281–303 Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J Bacteriol 172:4238–4246 Voglmayr H, Jaklitsch WM (2008) Prosthecium species with Stegonsporium anamorphs on Acer. Mycol Res 112:885–905 Voglmayr H, Jaklitsch WM (2011) Molecular data reveal high host specificity in the phylogenetically isolated genus Massaria (Ascomycota, Massariaceae). Fungal Divers 46:133–170 Fungal Diversity (2012) 57:1–44 von Höhnel F (1918) Mycologische Fragmente. Ann Mycol 16:35–174 von Schweinitz LD (1832) Synopsis fungorum in America boreali media degentium. Trans Am Philos Soc II 4:141–316 Wehmeyer LE (1926) Cultural life histories of Melanconis and Pseudovalsa. Mycologia 18:257–273 Wehmeyer LE (1933) The genus Diaporthe Nitschke and its segregates. Univ Michigan Stud Sci Ser 9:1–349 Wehmeyer LE (1937) Studies of certain species of Melanconis on Carpinus, Ostrya and Corylus. Mycologia 29:599–617 Wehmeyer LE (1941) A revision of Melanconis, Pseudovalsa, Prosthecium and Titania. Univ Michigan Stud, Sci Ser 14:1–161 Werle E, Schneider C, Renner M, Völker M, Fiehn W (1994) Convenient single-step, one tube purification of PCR products for direct sequencing. Nucleic Acids Res 22:4354–4355 White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR protocols: a guide to methods and applications. Academic, San Diego, pp 315–322