available online at www.studiesinmycology.org STUDIES IN MYCOLOGY 98: 100116 (2021). Fusarium: more than a node or a foot-shaped basal cell Studies in Mycology P.W. Crous1,2, L. Lombard1*, M. Sandoval-Denis1,3*, K.A. Seifert4, H.-J. Schroers5, P. Chaverri6,7, J. Gen
e8, J. Guarro8, Y. Hirooka9, K. Bensch1, G.H.J. Kema2, S.C. Lamprecht10, L. Cai11,12, A.Y. Rossman13, M. Stadler14, R.C. Summerbell15,16, J.W. Taylor17, S. Ploch18, C.M. Visagie19, N. Yilmaz19, J.C. Frisvad20, A.M. Abdel-Azeem21, J. Abdollahzadeh22, A. Abdolrasouli23,24, A. Akulov25, J.F. Alberts26, J.P.M. Araújo27, H.A. Ariyawansa28, M. Bakhshi29, M. Bendiksby30,31, A. Ben Hadj Amor1, J.D.P. Bezerra32, T. Boekhout1, M.P.S. C^amara33, M. Carbia34, G. Cardinali35, R.F. Casta~neda-Ruiz36, A. Celis37, V. Chaturvedi38, J. Collemare1, D. Croll39, U. Damm40, C.A. Decock41, R.P. de Vries1, C.N. Ezekiel42, X.L. Fan43, N.B. Fern
andez44,45, E. Gaya46, C.D. Gonz
alez47, D. Gramaje48, J.Z. Groenewald1, M. Grube49, M. Guevara-Suarez50, V.K. Gupta51,52, V. Guarnaccia53, A. Haddaji54, F. Hagen1, D. Haelewaters55,56, K. Hansen57, A. Hashimoto58, M. Hern
andez-Restrepo1, J. Houbraken1, V. Hubka59, K.D. Hyde60, T. Iturriaga61, R. Jeewon62, Z. Jurjevi
c64, _I. Karalti65, L. Korsten66, E.E. Kuramae3,67, I. Kusan68, R. Labuda69, D.P. Lawrence70, H.B. Lee71, P.R. Johnston63,  72 C. Lechat , H.Y. Li73, Y.A. Litovka74,75, S.S.N. Maharachchikumbura76, Y. Marin-Felix14, B. Matio Kemkuignou14, N. Matocec68, A.R. McTaggart77, P. Mlcoch78, L. Mugnai79, C. Nakashima80, R.H. Nilsson81, S.R. Noumeur82, I.N. Pavlov74,75, M.P. Peralta83, A.J.L. Phillips84, J.I. Pitt85, G. Polizzi86, W. Quaedvlieg87, K.C. Rajeshkumar88, S. Restrepo89, A. Rhaiem90, J. Robert54, V. Robert1, A.M. Rodrigues91, C. Salgado-Salazar92, R.A. Samson1, A.C.S. Santos93, R.G. Shivas94, C.M. Souza-Motta93, G.Y. Sun95, W.J. Swart96, S. Szoke54, Y.P. Tan94,97, J.E. Taylor98, P.W.J. Taylor99, P.V. Tiago93, K.Z. V
aczy100, N. van de Wiele54, N.A. van der Merwe19, G.J.M. Verkley1, W.A.S. Vieira33, A. Vizzini101, B.S. Weir63, N.N. Wijayawardene102, J.W. Xia103, M.J. Y
a~nez-Morales104, A. Yurkov105, J.C. Zamora106, R. Zare29, C.L. Zhang107, and M. Thines18,108,109 1 Westerdijk Fungal Biodiversity Institute, 3508 AD, Utrecht, the Netherlands; 2Wageningen University and Research Centre (WUR), Laboratory of Phytopathology, Droevendaalsesteeg 1, 6708 PB, Wageningen, the Netherlands; 3Netherlands Institute of Ecology (NIOO-KNAW), Department of Microbial Ecology, Droevendaalsesteeg 10, 6708 PB, Wageningen, the Netherlands; 4Department of Biology, Carleton University, 1125 Colonel By Drive, Ottawa, Ontario, K1S 5B6, Canada; 5Plant Protection Department, Agricultural Institute of Slovenia, Hacquetova ulica 17, 1000, Ljubljana, Slovenia; 6Department of Plant Science and Landscape Architecture, University of Maryland, College Park, MD, USA; 7Escuela de Biología and Centro de Investigaciones en Productos Naturales, Universidad de Costa Rica, San Pedro, Costa Rica; 8Unitat de Micologia, Facultat de Medicina i Ciencies de la Salut i Institut d’Investigaci
o Sanitaria Pere Virgili (IISPV), Universitat Rovira i Virgili, 43201, Reus, Spain; 9Department of Clinical Plant Science, Faculty of Bioscience, Hosei University, 3-7-2 Kajino-cho, Koganei, Tokyo, 184-8584, Japan; 10ARC-Plant Health and Protection, Private Bag X5017, Stellenbosch, 7599, Western Cape, South Africa; 11State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences, Beijing, 100101, China; 12University of Chinese Academy of Sciences, Beijing, 100049, China; 13 Department of Botany & Plant Pathology, Oregon State University, Corvallis, OR, 97330, USA; 14Department of Microbial Drugs, Helmholtz Centre for Infection Research GmbH (HZI), Inhoffenstrasse 7, 38124 Braunschweig, Germany; 15Sporometrics, Toronto, ON, Canada; 16Dalla Lana School of Public Health, University of Toronto, Toronto, ON, Canada; 17Plant and Microbial Biology, 111 Koshland Hall, University of California, Berkeley, CA, 94720-3102, USA; 18Senckenberg Biodiversity and Climate Research Center, Senckenberganlage 25, D-60325, Frankfurt am Main, Germany; 19Department of Biochemistry, Genetics and Microbiology, Forestry and Agricultural Biotechnology Institute (FABI), Faculty of Natural and Agricultural Sciences, University of Pretoria, P. Bag X20, Hatfield, 0028, Pretoria, South Africa; 20Department of Biotechnology and Biomedicine, DTU-Bioengineering, Technical University of Denmark, 2800, Kongens Lyngby, Denmark; 21Systematic Mycology Lab., Botany and Microbiology Department, Faculty of Science, Suez Canal University, Ismailia, 41522, Egypt; 22Department of Plant Protection, Faculty of Agriculture, University of Kurdistan, P.O. Box 416, Sanandaj, Iran; 23Department of Medical Microbiology, King's College Hospital, London, UK; 24Department of Infectious Diseases, Imperial College London, London, UK; 25Department of Mycology and Plant Resistance, V. N. Karazin Kharkiv National University, Maidan Svobody 4, 61022, Kharkiv, Ukraine; 26Department of Food Science and Technology, Cape Peninsula University of Technology, P.O. Box 1906, Bellville, 7535, South Africa; 27School of Forest Resources and Conservation, University of Florida, Gainesville, FL, USA; 28Department of Plant Pathology and Microbiology, College of Bio-Resources and Agriculture, National Taiwan University, No.1, Sec.4, Roosevelt Road, Taipei, 106, Taiwan, ROC; 29 Iranian Research Institute of Plant Protection, Agricultural Research, Education and Extension Organization (AREEO), P.O. Box 19395-1454, Tehran, Iran; 30 Natural History Museum, University of Oslo, Norway; 31Department of Natural History, NTNU University Museum, Trondheim, Norway; 32Setor de Micologia/ Departamento de Bioci^encias e Tecnologia, Instituto de Patologia Tropical e Saúde Pública, Rua 235 - s/n – Setor Universit
ario - CEP: 74605-050, Universidade Federal de Goi
as/Federal University of Goi
as, Goi^ania, Brazil; 33Departamento de Agronomia, Universidade Federal Rural de Pernambuco, Recife, 52171-900, PE, Brazil; 34Departamento de Parasitología y Micología, Instituto de Higiene, Facultad de Medicina – Universidad de la República, Av. A. Navarro 3051, Montevideo, Uruguay; 35Department of Pharmaceutical Science, University of Perugia, Via Borgo 20 Giugno, 74 Perugia, Italy; 36Instituto de Investigaciones Fundamentales en Agricultura Tropical Alejandro de Humboldt (INIFAT), Acad
emico Titular de la Academia de Ciencias de, Cuba; 37Grupo de Investigaci
on Celular y Molecular de Microorganismos Pat
ogenos (CeMoP), Departamento de Ciencias Biol
ogicas, Universidad de Los Andes, Bogot
a, 111711, Colombia; 38Mycology Laboratory, New York State Department of Health Wadsworth Center, Albany, NY, USA; 39Laboratory of Evolutionary Genetics, Institute of Biology, University of Neuchatel, CH-2000, Neuchatel, Switzerland; 40Senckenberg Museum of Natural History Görlitz, PF 300 154, 02806, Görlitz, Germany; 41Mycotheque de l'Universit
e catholique de Louvain (MUCL, BCCMTM), Earth and Life Institute – ELIM – Mycology, Universit
e catholique de Louvain, Croix du Sud 2 bte L7.05.06, B-1348, Louvain-laNeuve, Belgium; 42Department of Microbiology, Babcock University, Ilishan Remo, Ogun State, Nigeria; 43The Key Laboratory for Silviculture and Conservation of Ministry of Education, Beijing Forestry University, Beijing, 100083, China; 44Laboratorio de Micología Clínica, Hospital de Clínicas, Universidad de Buenos Aires, Buenos Aires, Argentina; 45Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Buenos Aires, Argentina; 46Royal Botanic Gardens, Kew, Richmond, Surrey, TW9 3DS, UK; 47Laboratorio de Salud de Bosques y Ecosistemas, Instituto de Conservaci
on, Biodiversidad y Territorio, Facultad de Ciencias Forestales y Recursos Naturales, Universidad Austral de Chile, casilla 567, Valdivia, Chile; 48Institute of Grapevine and Wine Sciences (ICVV), Spanish National Research Council (CSIC)-University of La Rioja-Government of La Rioja, Logro~no, 26007, Spain; 49Institut für Biologie, Karl-Franzens-Universit€at Graz, Holteigasse 6, 8010, Graz, Austria; 50Applied genomics research group, Universidad de los Andes, Cr 1 # 18 a 12, Bogot
a, Colombia; 51Center for Safe and Improved Food, Scotland's Rural College (SRUC), Kings Buildings, West Mains Road, Edinburgh, EH9 3JG, UK; 52Biorefining and Advanced Materials Research Center, Scotland's Rural College (SRUC), Kings Buildings, West Mains Road, Edinburgh, EH9 3JG, UK; 53Department of Agricultural, Forestry and Food Sciences (DISAFA), University of Torino, Largo P. Braccini 2, 10095, Grugliasco, TO, Italy; 54BioAware, Hannut, Belgium; 55Research Group Mycology, Department of Biology, Ghent University, 35 
e Budejovice, Czech Republic; K.L. Ledeganckstraat, 9000, Ghent, Belgium; 56Faculty of Science, University of South Bohemia, Branisovsk
a 31, 370 05, Cesk 57 Department of Botany, Swedish Museum of Natural History, P.O. Box 50007, SE-104 05, Stockholm, Sweden; 58Microbe Division/Japan Collection of Microorganisms RIKEN BioResource Research Center, 3-1-1 Koyadai, Tsukuba, Ibaraki, 305-0074, Japan; 59Department of Botany, Charles University in Prague, Peer review under responsibility of Westerdijk Fungal Biodiversity Institute. © 2021 Westerdijk Fungal Biodiversity Institute. Production and hosting by ELSEVIER B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/). 1 CROUS ET AL. Prague, Czech Republic; 60Center of Excellence in Fungal Research, Mae Fah Luang University, Chaing Rai, 57100, Thailand; 61Cornell University, 334 Plant Science Building, Ithaca, NY, 14850, USA; 62Department of Health Sciences, Faculty of Medicine and Health Sciences, University of Mauritius, Reduit, Mauritius; 63Manaaki Whenua Landcare Research, Private Bag 92170, Auckland, 1142, New Zealand; 64EMSL Analytical, Inc., 200 Route 130 North, Cinnaminson, NJ, 08077, USA; 65 Department of Nutrition and Dietetics, Faculty of Health Sciences, Yeditepe University, Turkey; 66Department of Plant and Soil Sciences, University of Pretoria, P. Bag X20 Hatfield, Pretoria, 0002, South Africa; 67Institute of Environmental Biology, Ecology and Biodiversity, Utrecht University, 3584 CH, Utrecht, the Netherlands; 68 Laboratory for Biological Diversity, RuCer Boskovi
c Institute, Bijenicka cesta 54, HR-10000, Zagreb, Croatia; 69University of Veterinary Medicine, Vienna (VetMed), Institute of Food Safety, Food Technology and Veterinary Public Health, Veterinaerplatz 1, 1210 Vienna and BiMM – Bioactive Microbial Metabolites group, 3430 Tulln a.d. Donau, Austria; 70University of California, Davis, One Shields Ave., Davis, CA, 95616, USA; 71Department of Agricultural Biological Chemistry, College of Agriculture & Life Sciences, Chonnam National University, Yongbong-Dong 300, Buk-Gu, Gwangju, 61186, South Korea; 72Ascofrance, 64 route de Chiz
e, 79360, Villiers-en-Bois, France; 73The Key Laboratory of Molecular Biology of Crop Pathogens and Insects of Ministry of Agriculture, The Key Laboratory of Biology of Crop Pathogens and Insects of Zhejiang Province, Institute of Biotechnology, Zhejiang University, 866 Yuhangtang Road, Hangzhou, 310058, China; 74V.N. Sukachev Institute of Forest SB RAS, Laboratory of Reforestation, Mycology and Plant Pathology, Krasnoyarsk, 660036, Russia; 75Reshetnev Siberian State University of Science and Technology, Department of Chemical Technology of Wood and Biotechnology, Krasnoyarsk, 660037, Russia; 76School of Life Science and Technology, University of Electronic Science and Technology of China, Chengdu, 611731, China; 77Queensland Alliance for Agriculture and Food Innovation, The University of Queensland, Ecosciences Precinct, G.P.O. Box 267, Brisbane, 4001, Australia; 78Department of Botany, Faculty of Science, Palacký University  Olomouc, Slechtitelů 27, CZ-783 71, Olomouc, Czech Republic; 79Department of Agricultural, Food, Environmental and Forestry Science and Technology (DAGRI), Plant Pathology and Entomology section, University of Florence, P.le delle Cascine 28, 50144, Firenze, Italy; 80Graduate school of Bioresources, Mie University, Kurima-machiya 1577, Tsu, Mie, 514-8507, Japan; 81Gothenburg Global Biodiversity Center at the Department of Biological and Environmental Sciences, University of Gothenburg, Box 461, 405 30, Gothenburg, Sweden; 82Department of Microbiology and Biochemistry, Faculty of Natural and Life Sciences, University of Batna 2, Batna, 05000, Algeria; 83Laboratorio de Micodiversidad y Micoprospecci
on, PROIMI-CONICET, Av. Belgrano y Pje. Caseros, Argentina; 84Universidade de Lisboa, Faculdade de Ci^encias, Biosystems and Integrative Sciences Institute (BioISI), Campo Grande, 1749-016, Lisbon, Portugal; 85Microbial Screening Technologies, 28 Percival Rd, Smithfield, NSW, 2164, Australia; 86Dipartimento di Agricoltura, Alimentazione e Ambiente, sez. Patologia vegetale, University of Catania, Via S. Sofia 100, 95123 Catania, Italy; 87Phytopathology, Van Zanten Breeding B.V., Lavendelweg 15, 1435 EW, Rijsenhout, the Netherlands; 88National Fungal Culture Collection of India (NFCCI), Biodiversity and Palaeobiology (Fungi) Group, Agharkar Research Institute, Pune, Maharashtra, 411 004, India; 89 Laboratory of Mycology and Phytopathology – (LAMFU), Department of Chemical and Food Engineering, Universidad de los Andes, Cr 1 # 18 a 12, Bogot
a, Colombia; 90Plant Pathology and Population Genetics, Laboratory of Microorganisms, National Gene Bank, Tunisia; 91Laboratory of Emerging Fungal Pathogens, Department of Microbiology, Immunology, and Parasitology, Discipline of Cellular Biology, Federal University of S~ao Paulo (UNIFESP), S~ao Paulo, 04023062, Brazil; 92 USDA-ARS Mycology & Nematology Genetic Diversity & Biology Laboratory, Bldg. 010A, Rm. 212, BARC-West, 10300 Baltimore Ave, Beltsville, MD, 20705, USA; 93Departamento de Micologia Prof. Chaves Batista, Universidade Federal de Pernambuco, Centro de Bioci^encias, Cidade Universit
aria, Av. Prof. Moraes Rego, s/n, Recife, PE, CEP: 50670-901, Brazil; 94Centre for Crop Health, University of Southern Queensland, Toowoomba, 4350, Queensland, Australia; 95College of Plant Protection, Northwest A&F University, Yangling, Shaanxi, China; 96Faculty of Natural and Agricultural Sciences, Department of Plant Sciences, University of the Free State, P.O. Box 339, Bloemfontein, 9300, South Africa; 97Queensland Plant Pathology Herbarium, Department of Agriculture and Fisheries, Dutton Park, Queensland, 4102, Australia; 98Royal Botanic Garden Edinburgh, 20A Inverleith Row, Edinburgh, EH3 5LR, United Kingdom; 99Faculty of Veterinary and Agricultural Sciences, The University of Melbourne, Parkville, VIC, 3010, Australia; 100Food and Wine Research Institute, Eszterh
azy K
aroly University, 6 Le
anyka Street, H3300, Eger, Hungary; 101Department of Life Sciences and Systems Biology, University of Torino and Institute for Sustainable Plant Protection (IPSP-SS Turin), C.N.R, Viale P.A. Mattioli, 25, I-10125, Torino, Italy; 102Center for Yunnan Plateau Biological Resources Protection and Utilization, College of Biological Resource and Food Engineering, Qujing Normal University, Qujing, Yunnan, 655011, China; 103Shandong Provincial Key Laboratory for Biology of Vegetable Diseases and Insect Pests, College of Plant Protection, Shandong Agricultural University, Taian, 271018, China; 104Fitosanidad, Colegio de Postgraduados-Campus Montecillo, Montecillo-Texcoco, 56230 Edo. de Mexico, Mexico; 105Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures GmbH, Inhoffenstrasse 7 B, 38124, Braunschweig, Germany; 106Museum of Evolution, Uppsala University, Norbyv€agen 16, SE-752 36, Uppsala, Sweden; 107Ministry of Agriculture Key Laboratory of Molecular Biology of Crop Pathogens and Insects, Institute of Biotechnology, College of Agriculture and Biotechnology, Zhejiang University, No. 866 Yuhangtang Road, Hangzhou, 310058, China; 108Goethe-University Frankfurt am Main, Department of Biological Sciences, Institute of Ecology, Evolution and Diversity, Max-von-Laue Str. 13, D-60438, Frankfurt am Main, Germany; 109LOEWE Centre for Translational Biodiversity Genomics, Georg-Voigt-Str. 14-16, D60325, Frankfurt am Main, Germany *Correspondence: L. Lombard, l.lombard@wi.knaw.nl; M. Sandoval-Denis, m.sandoval@wi.knaw.nl Abstract: Recent publications have argued that there are potentially serious consequences for researchers in recognising distinct genera in the terminal fusarioid clade of the family Nectriaceae. Thus, an alternate hypothesis, namely a very broad concept of the genus Fusarium was proposed. In doing so, however, a significant body of data that supports distinct genera in Nectriaceae based on morphology, biology, and phylogeny is disregarded. A DNA phylogeny based on 19 orthologous protein-coding genes was presented to support a very broad concept of Fusarium at the F1 node in Nectriaceae. Here, we demonstrate that re-analyses of this dataset show that all 19 genes support the F3 node that represents Fusarium sensu stricto as defined by F. sambucinum (sexual morph synonym Gibberella pulicaris). The backbone of the phylogeny is resolved by the concatenated alignment, but only six of the 19 genes fully support the F1 node, representing the broad circumscription of Fusarium. Furthermore, a re-analysis of the concatenated dataset revealed alternate topologies in different phylogenetic algorithms, highlighting the deep divergence and unresolved placement of various Nectriaceae lineages proposed as members of Fusarium. Species of Fusarium s. str. are characterised by Gibberella sexual morphs, asexual morphs with thin- or thick-walled macroconidia that have variously shaped apical and basal cells, and trichothecene mycotoxin production, which separates them from other fusarioid genera. Here we show that the Wollenweber concept of Fusarium presently accounts for 20 segregate genera with clear-cut synapomorphic traits, and that fusarioid macroconidia represent a character that has been gained or lost multiple times throughout Nectriaceae. Thus, the very broad circumscription of Fusarium is blurry and without apparent synapomorphies, and does not include all genera with fusarium-like macroconidia, which are spread throughout Nectriaceae (e.g., Cosmosporella, Macroconia, Microcera). In this study four new genera are introduced, along with 18 new species and 16 new combinations. These names convey information about relationships, morphology, and ecological preference that would otherwise be lost in a broader definition of Fusarium. To assist users to correctly identify fusarioid genera and species, we introduce a new online identification database, Fusarioid-ID, accessible at www.fusarium.org. The database comprises partial sequences from multiple genes commonly used to identify fusarioid taxa (act1, CaM, his3, rpb1, rpb2, tef1, tub2, ITS, and LSU). In this paper, we also present a nomenclator of names that have been introduced in Fusarium up to January 2021 as well as their current status, types, and diagnostic DNA barcode data. In this study, researchers from 46 countries, representing taxonomists, plant pathologists, medical mycologists, quarantine officials, regulatory agencies, and students, strongly support the application and use of a more precisely delimited Fusarium (= Gibberella) concept to accommodate taxa from the robust monophyletic node F3 on the basis of a welldefined and unique combination of morphological and biochemical features. This F3 node includes, among others, species of the F. fujikuroi, F. incarnatum-equiseti, F. oxysporum, and F. sambucinum species complexes, but not species of Bisifusarium [F. dimerum species complex (SC)], Cyanonectria (F. buxicola SC), Geejayessia (F. staphyleae SC), Neocosmospora (F. solani SC) or Rectifusarium (F. ventricosum SC). The present study represents the first step to generating a new online monograph of Fusarium and allied fusarioid genera (www.fusarium.org). Key words: Multi-gene phylogeny, Mycotoxins, Nectriaceae, Neocosmospora, Novel taxa, Pathogen, Taxonomy. 2 FUSARIUM REDELIMITED Taxonomic novelties: New genera: Luteonectria Sand.-Den., L. Lombard, Schroers & Rossman, Nothofusarium Crous, Sand.-Den. & L. Lombard, Scolecofusarium L. Lombard, Sand.-Den. & Crous, Setofusarium (Nirenberg & Samuels) Crous & Sand.-Den.; New species: Fusarium echinatum Sand.-Den. & G.J. Marais, Fusarium lyarnte J.L. Walsh, Sangal., L.W. Burgess, E.C.Y. Liew & Summerell, Fusarium palustre W.H. Elmer & Marra, Fusarium prieskaense G.J. Marais & Sand.-Den., Fusarium werrikimbe J.L. Walsh, L.W. Burgess, E.C.Y. Liew & B.A. Summerell, Fusicolla quarantenae J.D.P. Bezerra, Sand.-Den., Crous & Souza-Motta, Fusicolla meniscoidea L. Lombard & Sand.-Den., Fusicolla sporellula Sand.-Den. & L. Lombard, Macroconia bulbipes Crous & Sand.-Den., Macroconia phlogioides Sand.Den. & Crous, Neocosmospora epipeda Quaedvl. & Sand.-Den., Neocosmospora merkxiana Quaedvl. & Sand.-Den., Neocosmospora neerlandica Crous & Sand.Den., Neocosmospora nelsonii Crous & Sand.-Den., Neocosmospora pseudopisi Sand.-Den. & L. Lombard, Nothofusarium devonianum L. Lombard, Crous & Sand.-Den., Stylonectria corniculata Gr€afenhan, Crous & Sand.-Den., Stylonectria hetmanica Akulov, Crous & Sand.-Den.; New combinations: Apiognomonia platani (L
ev.) L. Lombard, Calloria tremelloides (Grev.) L. Lombard, Cosmosporella cavisperma (Corda) Sand.-Den., L. Lombard & Crous, Cylindrodendrum orthosporum (Sacc. & P. Syd.) L. Lombard, Dialonectria volutella (Ellis & Everh.) L. Lombard & Sand.-Den., Fusarium armeniacum (G.A. Forbes et al.) L.W. Burgess & Summerell, Hymenella aurea (Corda) L. Lombard, Hymenella spermogoniopsis (Jul. Müll.) L. Lombard & Sand.-Den., Luteonectria albida (Rossman) Sand.-Den. & L. Lombard, Luteonectria nematophila (Nirenberg & Hagedorn) Sand.-Den. & L. Lombard, Neocosmospora floridana (T. Aoki et al.) L. Lombard & Sand.-Den., Neocosmospora obliquiseptata (T. Aoki et al.) L. Lombard & Sand.-Den., Neocosmospora rekana (Lynn & Marinc.) L. Lombard & Sand.-Den., Neocosmospora tuaranensis (T. Aoki et al.) L. Lombard & Sand.-Den., Scolecofusarium ciliatum (Link) L. Lombard, Sand.-Den. & Crous, Setofusarium setosum (Samuels & Nirenberg) Sand.-Den. & Crous.; Epitypes (basionyms): Fusarium buharicum Jacz. ex Babajan & Teterevn.-Babajan, Fusarium cavispermum Corda, Fusarium flocciferum Corda, Fusarium graminearum Schwabe, Fusarium heterosporum Nees & T. Nees, Fusarium redolens Wollenw., Fusarium reticulatum Mont., Fusarium scirpi Lambotte & Fautrey, Fusarium stilboides Wollenw., Fusarium xylarioides Steyaert, Fusisporium culmorum Wm.G. Sm., Fusisporium incarnatum Roberge ex Desm., Selenosporium equiseti Corda, Sphaeria sanguinea var. cicatricum Berk., Sporotrichum poae Peck.; Lectotypes (basionyms): Atractium pallidum Bonord., Cephalosporium sacchari E.J. Butler, Fusarium aeruginosum Delacr., Fusarium agaricorum Sarrazin, Fusarium albidoviolaceum Dasz., Fusarium aleyrodis Petch, Fusarium amentorum Lacroix, Fusarium annuum Leonian, Fusarium arcuatum Berk. & M.A. Curtis, Fusarium aridum O.A. Pratt, Fusarium arthrosporioides Sherb., Fusarium asparagi Delacr., Fusarium batatas Wollenw., Fusarium biforme Sherb., Fusarium cactacearum Pasin. & Buzz.-Trav., Fusarium cacti-maxonii Pasin. & Buzz.-Trav., Fusarium caudatum Wollenw., Fusarium cavispermum Corda, Fusarium cepae Hanzawa, Fusarium cesatii Rabenh., Fusarium citriforme Jamal., Fusarium citrinum Wollenw., Fusarium citrulli Taubenh., Fusarium clavatum Sherb., Fusarium coccinellum Kalchbr., Fusarium cromyophthoron Sideris, Fusarium cucurbitae Taubenh., Fusarium cuneiforme Sherb., Fusarium delacroixii Sacc., Fusarium dimerum var. nectrioides Wollenw., Fusarium epicoccum McAlpine, Fusarium eucheliae Sartory, R. Sartory & J. Mey., Fusarium fissum Peyl, Fusarium flocciferum Corda, Fusarium gemmiperda Aderh., Fusarium genevense Dasz., Fusarium graminearum Schwabe, Fusarium graminum Corda, Fusarium heterosporioides Fautrey, Fusarium heterosporum Nees & T. Nees, Fusarium idahoanum O.A. Pratt, Fusarium juruanum Henn., Fusarium lanceolatum O.A. Pratt, Fusarium lateritium Nees, Fusarium loncheceras Sideris, Fusarium malvacearum Taubenh., Fusarium martii f. phaseoli Burkh., Fusarium muentzii Delacr., Fusarium nigrum O.A. Pratt, Fusarium oxysporum var. asclerotium Sherb., Fusarium palczewskii Jacz., Fusarium polymorphum Matr., Fusarium poolense Taubenh., Fusarium prunorum McAlpine, Fusarium pusillum Wollenw., Fusarium putrefaciens Osterw., Fusarium redolens Wollenw., Fusarium reticulatum Mont., Fusarium rhizochromatistes Sideris, Fusarium rhizophilum Corda, Fusarium rhodellum McAlpine, Fusarium roesleri Thüm., Fusarium rostratum Appel & Wollenw., Fusarium rubiginosum Appel & Wollenw., Fusarium rubrum Parav., Fusarium samoense Gehrm., Fusarium scirpi Lambotte & Fautrey, Fusarium secalis Jacz., Fusarium spinaciae Hungerf., Fusarium sporotrichioides Sherb., Fusarium stercoris Fuckel, Fusarium stilboides Wollenw., Fusarium stillatum De Not. ex Sacc., Fusarium sublunatum Reinking, Fusarium succisae Schröt. ex Sacc., Fusarium tabacivorum Delacr., Fusarium trichothecioides Wollenw., Fusarium tritici Liebman, Fusarium tuberivorum Wilcox & G.K. Link, Fusarium tumidum var. humi Reinking, Fusarium ustilaginis Kellerm. & Swingle, Fusarium viticola Thüm., Fusarium willkommii Lindau, Fusarium xylarioides Steyaert, Fusarium zygopetali Delacr., Fusisporium andropogonis Cooke ex Thüm., Fusisporium anthophilum A. Braun, Fusisporium arundinis Corda, Fusisporium clypeaster Corda, Fusisporium culmorum Wm.G. Sm., Fusisporium didymum Harting, Fusisporium elasticae Thüm., Fusisporium episphaericum Cooke & Ellis, Fusisporium flavidum Bonord., Fusisporium hordei Wm.G. Sm., Fusisporium incarnatum Roberge ex Desm., Fusisporium lolii Wm.G. Sm., Fusisporium pandani Corda, Gibberella phyllostachydicola W. Yamam., Menispora penicillata Harz, Selenosporium equiseti Corda, Selenosporium hippocastani Corda, Selenosporium urticearum Corda., Sphaeria sanguinea var. cicatricum Berk.; Neotypes (basionyms): Atractium ciliatum Link, Fusarium longipes Wollenw. & Reinking, Fusisporium avenaceum Fr., Selenosporium sarcochroum Desm. Published online xxx; https://doi.org/10.1016/j.simyco.2021.100116. INTRODUCTION The relevance and impact of Fusarium (Ascomycota, Hypocreales, Nectriaceae) to humankind is substantial. Over the past 100 years, it has attracted considerable attention from scientists as the extent of species diversity and the impact on agriculture and human health became clear. After an initial period of discovery and cataloguing by 19th century naturalists, its taxonomy became the target of research from a broad range of scientists, that resulted in the emergence of distinct “schools” that promoted different taxonomic approaches to fusarium-like organisms. With the advent of an objective and reproducible framework for phylogenetic relationships inferred from molecular phylogenetics, it might have been expected that controversies would melt away, and a stable, universally accepted taxonomy of Fusarium and its species would emerge, but this does not yet appear to be the case (Fig. 1). However, all scientists working with Fusarium desire a stable taxonomic system, and all agree that taxonomic changes should be made with the aim of promoting stability. Recently, Geiser et al. (2021), largely in response to papers published by Gr€afenhan et al. (2011), Schroers et al. (2011), Lombard et al. (2015), and Sandoval-Denis et al. (2019), proposed a cladistic solution to redelimit a generic concept for www.studiesinmycology.org Fusarium. The generic treatment of Fusarium by Geiser et al. (2013, 2021), produced an ill-delimited genus without clear synapomorphies, as fusarium-like macroconidia are strongly polyphyletic within Nectriaceae and also occur outside their very broadly circumscribed Fusarium concept. We argue that a narrower concept of genera with a clear, unique combination of features is needed for the majority of fusarioid species. Dual nomenclature and consensus on the use of the generic name Fusarium In accordance with the single-name system for fungi, that was adopted at the International Botanical Congress, Melbourne (IBCM) in 2011, we are in full agreement with Geiser et al. (2013, 2021) and O'Donnell et al. (2020) that the name Fusarium applies to any genus with a delimitation that includes the conserved lectotype of the type species, F. sambucinum (sexual morph synonym Gibberella pulicaris), as stated by Rossman et al. (2013). Unfortunately, a single joint paper explaining the choice of this name supported by the entire Fusarium community was planned but failed because of the insistence of a subset of authors to adopt a broad generic concept. 3 CROUS ET AL. Fig. 1. Timeline summarising important events in the taxonomy and nomenclature of Fusarium and related taxa. Taxonomy and nomenclature are different concepts, although they are frequently confused, leading to misinterpretations. Support for dual nomenclature ended at the IBCM in August 2011. The significance of 1 January 2013 was to ensure the formal nomenclatural validity of newly proposed dual names (new species or new combinations) that were in press or part of studies about to be submitted for publication. These dates have no significance for names proposed in a single name system, which can be done at any time. Despite these technicalities, virtually all members of the Fusarium community accept that Fusarium must be used over the sexually-typified name Gibberella in the single name system, a recommendation included in the proposed list of Protected Names submitted to the Nomenclature Committee for Fungi, the body with the authority to recommend its formal acceptance (Kirk et al. 2013). However, statements in Geiser et al. (2013) seem to reflect a confusion about how the nomenclatural decision affected taxonomic concepts. The name Fusarium has never been at risk during the nomenclatural transition, and the community support for its use in a single name system is unanimous. We fully agree with Geiser et al. (2013, 2021) and Rossman et al. (2013) that Fusarium equals Gibberella. Fusarium will always be applied to the clade that includes the type species of Fusarium, F. sambucinum, which is the same fungus that also typifies Gibberella. In this study, we show that the clade defined as Fusarium s. str. (O'Donnell et al. 2013, as Gibberella; Geiser et al. 2013, as Clade B) combines monophyly, morphology of sexual and asexual morphs, and biochemical data in a coherent way that can logically be recognised at the generic rank. Expanding the concept of Fusarium to node F1 sensu Geiser et al. (2013, 2021) 4 results in the combination of several distinct genera and does not resolve the issue of fusarium-like macroconidia in genera outside their broad circumscription of Fusarium. Phylogenetic structure and distribution of fusarioid asexual morphs in Nectriaceae (Hypocreales) Gr€afenhan et al. (2011) and Schroers et al. (2011) presented a phylogenetic overview of selected Nectriaceae based on combined analyses of two different genes, namely the commonly employed and phylogenetically informative RNA polymerase II second largest subunit (rpb2) and exon regions of the larger subunit of ATP citrate lyase (acl1). The two papers were the first to apply a single name system to fusarioid fungi (i.e., genera with fusarium-like macroconidia), and were written along with others (see Rossman & Seifert 2011) to promote discussions that eventually led to changes to the International Code of Nomenclature for algae, fungi, and plants (ICNafp) (Turland et al. 2018). The main focus of the Gr€afenhan et al. (2011) paper was to deal with extraneous elements that had long been included in Fusarium. These fungi had distinct phenotypic characters, such as thin, collapsing perithecial walls, slow growing agar colonies lacking aerial mycelium, or sparsely septate macroconidia. Users of the Gerlach & Nirenberg (1982) and Nelson et al. (1983) identification manuals may be familiar with some of these species, then called Fusarium aquaeductuum, F. coccophilum and F. merismoides. There was evidence in the first papers on the molecular phylogeny of Fusarium that these species did not belong to Fusarium (e.g., see O'Donnell 1993). It was not until FUSARIUM the study by Gr€afenhan et al. (2011) that other genera in the family, such as members of the Cylindrocarpon generic complex (Chaverri et al. 2011), Calonectria (Liu et al. 2020), Tubercularia (Hirooka et al. 2012), and minor genera such as Mariannaea, Pseudonectria, and Volutella (also see Lombard et al. 2015) were adequately sampled to yield generic-level resolution. The phylograms showed the division of fusarioid taxa into two large groups, which Gr€afenhan et al. (2011) called the Terminal Fusarium Clade (abbreviated TFC by Geiser et al. 2013) and the ill-delineated Basal Fusarium Clade (BFC) that contained several of the genera noted above. A single-genus recognition for the BFC was not feasible because of the great morphological, genetic, and ecological divergence among the sampled species. The BFC included seven genera, each with their monophyly strongly supported and more or less ecologically coherent. Species with fusarioid conidia were reclassified in the phylogenetically redefined but previously described genera Atractium, Cosmospora, Dialonectria, Fusicolla, Macroconia, Microcera, and Stylonectria (Gr€afenhan et al. 2011, Schroers et al. 2011). Geiser et al. (2013) accepted these segregate genera in the BFC as distinct from the TFC, while correctly pointing out the weak support values obtained for the phylogenetic backbone of the tree. One consequence of the widespread occurrence of macroconidia in the taxon sampling (fusarioid genera, cylindrocarpon-like genera, and Calonectria) was the suggestion that especially the fusarioid macroconidium is a plesiomorphic character (that is, an ancestral character) and had been lost in some lineages in Nectriaceae (Gr€afenhan et al. 2011). The second paper by Schroers et al. (2011) recovered similar phylogenies as Gr€afenhan et al. (2011), but focused on the TFC, supplementing this with a five-gene analysis of a particular subclade within the TFC intended to delimit phylogenetic genera and a few species. This demonstrated the monophyly of the treated genera and resulted in the acceptance of the previously described Cyanonectria (Samuels et al. 2009), as well as the description of the genus Geejayessia. Again, Geiser et al. (2013) correctly criticised the weakness of the backbone of the tree, especially in the BFC. About 75 % of the phylogenetic signal in the analysis came from one gene, rpb2. Schroers et al. (2011) did not discuss the taxonomic fate of Neocosmospora (the Fusarium solani species complex, FSSC), which was represented by only two species in their analysis, but was excluded from Fusarium s. str. The call for more genetic markers and even genome analysis by Geiser et al. (2013), to better resolve the phylogenetic backbone of the TFC was justified, but the increased number of markers should have been matched by increased taxon sampling of all known genera of Nectriaceae, as taxon sampling is equally important for inferring robust and meaningful phylogenies (Zwickl & Hillis 2002, Heath et al. 2008). Lombard et al. (2015) greatly expanded both the number of genetic markers and the taxon sampling in order to explore the generic boundaries across the Nectriaceae, including all genera known from culture and many genera for which no DNA data was previously available. A 10-gene phylogeny was inferred including all the markers previously used by Gr€afenhan et al. (2011), Schroers et al. (2011), Geiser et al. (2013), and O'Donnell et al. (2013), plus nrDNA sequences and other markers of known phylogenetic utility, namely actin (act1), beta-tubulin (tub2), calmodulin (CaM), histone (his3), and the translation elongation factor 1-α (tef1). From this, a phylogeny of the TFC overall congruent to that presented by Gr€afenhan et al. (2011) and www.studiesinmycology.org REDELIMITED Geiser et al. (2013) was obtained. Importantly, the monophyly of Albonectria, Cyanonectria, Geejayessia, Fusarium, and Neocosmospora was reaffirmed and a few early diverging lineages previously included in the TFC were segregated into new fusarioid genera i.e., Bisifusarium (formerly the F. dimerum species complex) and Rectifusarium (formerly the F. ventricosum species complex) (Lombard et al. 2015). After nearly a hundred years of quandary, a modern revision was published for Neocosmospora (Sandoval-Denis et al. 2019), In this study, many unnamed phylogenetic species were morphologically characterised and given Latin binomials, while old names were resurrected, epitypified, and linked to DNA barcodes. Two recent publications by O'Donnell et al. (2020) and Geiser et al. (2021) argued for the broad Fusarium concept of Geiser et al. (2013). Both papers present very similar phylogenetic analyses, relying on 19 genes, including 12 newly sampled markers, namely: cytochrome P450 reductase (cpr1), ATPdependent DNA helicase II (ku70), sphinganine palmitoyl transferase subunit 2 (lcb2), DNA replication licensing factor (mcm7), phosphoglycerate kinase (pgk1), topoisomerase (top1), two subunits each of the DNA polymerase (dpa1 and dpe1), the fatty acid synthase (fas1, fas2), alpha-tubulin (tub1), and tub2. The previously employed marker his3 was not included, nor were nrDNA markers. The results are in essence the same as those of the previously published phylogenies, but with stronger support for the backbone in the combined analyses (see Cummings & Meyer 2005). Geiser et al. (2021) claimed that the F1 node was supported by 12, and the F2 node by 14 of the individual genes, but did not mention that all 19 genes supported the F3 node (Fusarium s. str. = the Gibberella clade). In this study we re-investigated the Geiser et al. (2021) dataset using several different high-resolution phylogenetic approaches, and we found that their evaluations of concordance were based on an inadequate interpretation of Ultra-Fast bootstrap results (only values  95 % are to be deemed significant, see Minh et al. 2013, Hoang et al. 2018). In addition to the topological incongruences among six genes (act1, CaM, DNA polymerase epsilon subunit dpe1, ku70, pgk1, tef1, and tub2), only six and 11 genes actually support the F1 and F2 nodes, respectively, while all 19 genes support the F3 node. The low internode certainty (IC) and IC All (ICA) values obtained for F1 (0.19 and 0.33, respectively) were misinterpreted by Geiser et al. (2021) as IC values close to 0 indicate conflict between the partitions (Salichos et al. 2014). The F3 node was well supported with IC and ICA values at 1 (Geiser et al. 2021, Supplementary Table. S1), which indicates the absence of conflict. While the effort by O'Donnell et al. (2020) and Geiser et al. (2021) to include a high diversity of DNA markers is commendable, it is undermined by an imbalanced selection of taxa for their analyses. Specifically, there is a marked overrepresentation of node F1 species, while sampling and taxon selection across the Nectriaceae is almost absent. Excluding any of the major genus-level clades, especially those relevant to the recognition of Bisifusarium, Neocosmospora and Rectifusarium, introduces taxon sampling biases in a way that reduce the reliability of phylogenetic inferences and support values with respect to the backbone of the Nectriaceae. Furthermore, neither O'Donnell et al. (2020) nor Geiser et al. (2021) give full consideration to morphological and ecological evidence. In principle, a genus should always be delimited as monophyletic, supported by derived traits. In addition, its circumscription should 5 CROUS ET AL. depend on the systematic (phylogenetic and biological) structure of the family it belongs to, in this case, the Nectriaceae. Phylogenetics has rapidly advanced from a powerful adjunct tool for understanding evolutionary relationships to the dominant principle for classification, especially for delimitation of taxa at all ranks. However, the resulting analyses and phylogenies are compromised if they are not reconciled with other biological data. The call for additional genomic data in the Fusarium clade (Geiser et al. 2013, Aoki et al. 2019) may improve backbone node support values, but the phylogenetic structure is unlikely to change; it is the translation of that data into practicable taxonomy. The broad Fusarium concept of Aoki et al. (2019), O'Donnell et al. (2020) and Geiser et al. (2021) is phylogenetically possible, but it does not offer a generic definition based on a combination of available genetic, morphological, biochemical and ecological data. It is, thus, impractical in that it is so broad that the genus would not have any synapomorphies when compared to other genera of the Nectriaceae outside their broad circumscription of Fusarium. The arguments presented by Aoki et al. (2019), O'Donnell et al. (2020) and Geiser et al. (2021) are centred around the phylogenetic support of some nodes, which have never been a key subject of the discussion, as the made observations generally match the interpretations made by many authors. While the very broad circumscription of Fusarium reflects as a monophyletic group in DNA phylogenetic analyses, the TFC is a conglomerate of several monophyletic genera that has a common ancestor (node F1 in Geiser et al. 2013). Each of these genera has a distinctive combination of morphological features. An analogous situation was observed in the monophyletic sister clade that was originally classified as Cylindrocarpon s. lat., but that is currently viewed as composed of several monophyletic genera i.e., Cinnamomeonectria, Corinectria, Cylindrodendrum, Dactylonectria, Ilyonectria, Macronectria, Neonectria, Pleiocarpon, Rugonectria, Thelonectria and Tumenectria (Chaverri et al. 2011, Gr€afenhan et al. 2011, Lombard et al. 2014, Salgado-Salazar et al. 2016, Gonz
alez & Chaverri 2017). What is a genus? Taxonomically, a genus is a group that is defined by a type species, and that often includes additional species considered to belong to the same group (Vellinga et al. 2015). The observations or category of data involved in delineating genera have varied over time, and in many cases, the characters used to delimit well accepted genera have proven to be homoplasious and the genera polyphyletic (Crous et al. 2009). However, it is a fundamental principle that taxonomic entities should reflect evolutionary relationships. This has led to inevitable splitting of well-known fungal taxa, both genera and species, into smaller groups, but sometimes also genera were merged with others based on the reappraisal or discovery of derived characters (e.g., Voglmayr & Thines 2007). This proceeds with each technological revolution providing ever deeper insight into the biological/evolutionary relationships of organisms, and has accelerated again since molecular phylogenetics came into widespread use. There is a prevailing notion that nature made species, but that humans made all other taxonomic ranks for their own convenience. However, it is increasingly recognised that all taxonomic ranks, including the species level, do not have solid boundaries but are more like a steam cloud with fuzzy margins. At the genus level, these 6 boundaries are often even more obscure, but is a genus just an arbitrary (but statistically well-supported) monophyletic convenience, a consensus accepted by a self-appointed committee? Or is a genus a meaningful, definable unit resulting from evolutionary processes, which can be recognised by patterns of biological structure, biochemistry, behaviour, and adaptation to specific niches? We believe that the latter should be the case. While we recognise that generic delimitations will always depend on a subjective choice, we believe that generic concepts should always be guided in a phylogenetic context by morphological, biochemical, or ecological characters that can both be used for practical recognition and convey evolutionary information. The generic concept for Fusarium proposed by Geiser et al. (2013, 2021) is a rejection of this concept, as it merges lineages with divergent characters that were accepted and applied not only throughout the family Nectriaceae for the delimitation of genera but also in other fungal families and orders. The very broad genus Fusarium that it gives rise to does not have clearcut features, as the diversity of characters shared with the rest of the Nectriaceae is so high that it could be extended almost arbitrarily to the entire family. It would, in fact be as if the concept of cryptic species was expanded to genera, that is, genera that can only be recognised as a well-supported node on a phylogram, which is, in our view, in disagreement with fundamental principles of practical classification. The node F1 selected by Geiser et al. (2013, 2021) for defining Fusarium is devoid of phenotypic support and includes several genera with distinct evolutionary traits. Indeed, the Geiser et al. (2013, 2021) concept of Fusarium is strictly phylogenetically defined and essentially amounts to a list of the species bound within a selected clade. Their morphological circumscription does not admit the existence of synapomorphies (i.e., unique diagnostic characters possessed by all included species), and it extends beyond their chosen node to other groups in Nectriaceae. In this very wide definition of Fusarium, phenotypic characters and ecological patterns that correlate with well-supported monophyletic groups within the larger, poorly supported TFC are disregarded as basis for generic delineation. Admittedly, phenotypic characters in the TFC are tricky to interpret. The fusarioid macroconidium with or without a welldeveloped foot-shaped basal cell (i.e., basal conidial cell showing an asymmetrical papillum, delimited from the rest of the cell and forming a distinct notch) occurs in the majority but not all of the species in the traditional generic concept, but is also a feature present in a significant proportion of other members of the Nectriaceae, or even of the unrelated genus Microdochium (Amphisphaeriaceae). It is, therefore, not a unique feature for generic delineation (Gr€afenhan et al. 2011). Perithecial pigmentation has been used to delimit genera in Nectriaceae. The orange/red perithecium is an ancestral character in the family and common also to members of the BFC and early diverging lineages of the TFC, including all Neocosmospora species known to reproduce sexually, Setofusarium, and some species of Cyanonectria and Geejayessia. These structures are easily distinguished from the homogeneously bluish/black perithecia of true Fusarium s. str. species in the Gibberella clade sensu O'Donnell et al. (2013). Contrary to what was suggested by Geiser et al. (2021), it is not Neocosmospora which represents an interesting but morphologically aberrant lineage, since neither its type nor the members of its modern morphological circumscription (Nalim et al. 2011) exhibit aberrant characteristics. It is the dark-coloured perithecia typical of FUSARIUM Fusarium s. str. (= Gibberella clade) that are aberrant and unusual within Nectriaceae. The dark purple to black perithecium formerly used to characterise Fusarium s. str. (= Gibberella), represents a synapomorphic state. Ascomata with similar colours have evolved independently in some, but not all, species of Geejayessia, while heterogeneously coloured bluish black or bicoloured perithecia can be observed in several species of Cyanonectria, which often appears as a sister genus to Fusarium. However, Cyanonectria and Geejayessia differ from Fusarium and Neocosmospora by their typically well-developed stromata as well as their thinner and smooth perithecial walls. Notably, pale yellowish perithecia occur in several clades and are a derived character as well, and one genus that we accept, Albonectria, was initially defined by white perithecia (Rossman et al. 1999). Also, in terms of its ascospores, Fusarium shows a derived state. With the exception of Albonectria, which includes species with hyaline, ellipsoidal to fusoid, 3-septate, smooth to finely striated ascospores, the genera mentioned above present mostly pale yellow-brown ascospores. Ascospores of Fusarium s. str. are more often subhyaline, ellipsoidal to fusoid, 1–3-septate, and smooth-walled when viewed with light microscopy. Ascospores of Neocosmospora are easily distinguished from those of Fusarium by being ovoid to ellipsoidal, (0–)1-septate, pigmented, conspicuously striate or more rarely cerebriform or spinulose. It is worth noting that most of the above-mentioned characters and differences are the same applied to define genera across the whole Nectriaceae (Rossman et al. 1999, Lombard et al. 2015), where they correlate well with phylogenetic inferences. Ascospores showing similarly many septa as in Fusarium s. str. have independently evolved in Nectria diploa (now Microcera), as well as in N. glabra, and N. decora (now Flammocladiella). The fact that none of these species is a member of the TFC supports the interpretation that multiseptate ascospores might be apomorphic for Fusarium s. str., separating it clearly from other phylogenetically related genera. Behaviour and other adaptations, determine how an organism operates and survives in nature and are the ultimate determinants and products of natural selection. They may be difficult to translate into nodes and other results of phylogenetic analyses such as phylogenetic distance. Despite this, similarities in adaptive traits are frequently used to calibrate phylogenetic delimitations of genera. For example, all known species of Microcera are pathogens of scale insects. It is easy to understand the hypothesis that the ancestor of this clade jumped to these hosts, followed by subsequent radiation and speciation (Thines 2019). This resulted in considerable micromorphological diversity, while a core of adaptation resulting from the parasitic life style remained conserved. Similarly, several of the genuslevel clades include mostly mycoparasitic species or pathogens of plants. If we apply this kind of thinking to the well-supported clades of the TFC, as noted by Schroers et al. (2011), species of Cyanonectria and Geejayessia occur only on woody hosts (mostly species of Buxus, Celtis and Staphylea) and would typically not occur as soil-borne plant pathogens or pathogens of grasses. They are also not known to produce trichothecene mycotoxins. This is in stark contrast with the prevailing ecological concept of Fusarium s. str. as a genus of primarily soil-borne fungi, of which many are in a firm biological association with grasses and herbs. Importantly, the vast majority of Fusarium s. str. species produce trichothecene mycotoxins as a chemical synapomorphy. Most of the strongly supported clades within the www.studiesinmycology.org REDELIMITED TFC can be supported by these kinds of morphological, chemical, and biological traits, allowing the possibility of non-arbitrary recognition of biologically meaningful genera. One such clade is Neocosmospora. Arguments for and the practicality of recognising Neocosmospora (the F. solani species complex) as a genus In the days of dual nomenclature, the distinction between the red perithecia of Neocosmospora, as amended by Nalim et al. (2011), and the typically purple or blackish perithecia of the trichothecene-producing Gibberella species was generally accepted by Fusarium taxonomists. The ecological distinctiveness of Neocosmospora as a group of soil fungi, often associated with roots and causing root rot and vascular wilt diseases, was also generally acknowledged. In addition to the dissimilar sexual characters mentioned above, the asexual morphs of this group are also distinctive. The macroconidia are usually thickwalled, with blunt, rounded apical cells, and they usually have inconspicuous foot-shaped basal cells. Microconidia are produced on very long, narrow phialides. Cultures of a vast majority of species of this group can easily be recognised morphologically, even with a dissecting microscope. The ecological similarities of the members of Neocosmospora with F. oxysporum have to be acknowledged, as noted by Geiser et al. (2013, 2021). However, these two groups of species are morphologically distinct, even as asexual morphs. Fusarium oxysporum produces macroconidia with acutely pointed apical cells, and microconidia from phialides that are usually 5–10 times shorter than those of Neocosmospora species. Geiser et al. (2013, 2021) have pointed out that microchromosomes or conditionally dispensable chromosomes occur in Neocosmospora and members of their F3 clade, namely F. oxysporum. Microchromosomes have been observed, however, also in phylogenetically distinct taxa such as Magnaporthe oryzae (Yoshida et al. 2009, now Pyricularia oryzae), Mycosphaerella graminicola (Stukenbrock et al. 2010, now Zymoseptoria tritici), and Alternaria arborescens (Hu et al. 2012) and might occur sporadically as a result of horizontal gene transfer. They are thought to increase the ability of a pathogen to adapt to the host's defence mechanisms. The ability to acquire conditionally dispensable chromosomes might thus be seen as a general genetic tool allowing organisms to gain ecologically advantageous genes. Similarly, they could present a general driving force in co-evolutionary processes, but the per se occurrence of conditionally dispensable chromosomes in two taxa can hardly be used as a criterion for drawing conclusions on or imply generic relatedness. In the Nelson et al. (1983) manual and in one of the last vestiges of the ultra-reductionist Snyder & Hansen (1941) system, F. solani was recognised as the only species of section Martiella, even though the existence of several distinct mating populations was known. The European system (exemplified by Gerlach & Nirenberg 1982) accepted several more species, derived from the classic Wollenweber & Reinking (1935) treatment. When molecular phylogenetic studies of this group began in earnest, Neocosmospora included three major clades and many species (O'Donnell 1993, 2000, O'Donnell et al. 2008a). To date, 86 species are formally described in this group (Aoki et al. 2019, Sandoval-Denis et al. 2019, Guarnaccia et al. 2021), but 7 CROUS ET AL. additional novel phylogenetic lineages are recognised and await formal description. Thus, in Neocosmospora we have a group of species that can easily be recognised morphologically by both sexual and asexual morphs, exhibit generally consistent ecological behaviour, lack trichothecene mycotoxins, and form a strongly supported monophyletic group. This sounds like a biologically meaningful calibration of a genus, but what about the practicality of doing this? Presently, the data supporting the recognition of Neocosmospora (and equally, also Fusarium s. str., the F3 clade) is stronger than the data supporting either of the nodes favoured for designating a broader concept of Fusarium. If there are 100 plus species in Neocosmospora, and hundreds of species in the trichothecene-producing, Poaceae-loving Fusarium s. str. clade, it will be useful for students, plant pathologists, clinical microbiologists, and other scientists to have different generic names for each group. Those names will convey information about relationships and behaviour that are lost in a broader definition of Fusarium with much greater diversity of ecological and biochemical behaviours. Geiser et al. (2013) raised concerns that grant evaluators, government regulators and medical practitioners who now believe they know what Fusarium means will be confused by the segregation of these fusarioid fungi into different genera, and that confusion could lead to unpredictable consequences. However, in our experience these end users continuously familiarise themselves with up-to-date, informative taxonomic and nomenclatural concepts for socio-economically important fungal groups, thus allowing them to predict the possible real-world effects of reliably identified fungi with increased precision. To them, the segregation of a heterogeneous concept of Fusarium into biologically and biochemically predictive genera will be helpful. With Neocosmospora accepted as a different genus, Albonectria, Cyanonectria, and Geejayessia, as defined by Schroers et al. (2011), as well as Bisifusarium and Rectifusarium as defined in Lombard et al. (2015) must also be accepted as separate genera. As previously said, these are all monophyletic groups, also characterised by distinctive ecological and morphological traits. The end consequence of our strategy is a series of phylogenetically well-supported genera, each with a recognisable suite of morphological characters, and ecological, pathological, and biochemical behaviour. Indeed, the results of such splitting activities applied to what we called the Wollenweber concept of Fusarium s. lat. accounts for 20 segregate genera. Most importantly, both Fusarium and Neocosmospora will have generic names to indicate their important but distinct significance. The extraneous species, with different ecology and generally much lower economic or agricultural significance can now justifiably be classified elsewhere, where they can be appreciated for their own features without the need for the uncertainty inherent in a broad concept of the generic name Fusarium. The generic concept of Fusarium proposed by Geiser et al. (2013, 2021) functions well as a phylogenetic concept only if taxonomists turn their eyes away from all other kinds of data and observations applied to the family Nectriaceae. It is a political generic concept, meant to assuage the concerns of plant pathologists and other applied scientists, many of whom are already upset by the proliferation of cryptic phylogenetic species. Ironically, this late-blooming alleged pragmatism seems to betray 8 the cladistic ideals that many of its authors profess to adhere to (Taylor 2014). All authors agree on the use of the single name Fusarium, have a common understanding of a phylogenetic structure of the family Nectriaceae, and agree that removing Neocosmospora from the main Fusarium core is the critical point of discussion. Sequencing additional markers may lead to increased phylogenetic support, but it is a false comfort if the taxon sampling does not include as many genera of Nectriaceae as possible. Expanded representation of the TFC in the dataset will not solve the controversy, and the resulting phylogenies will remain unbalanced. The segregation of Neocosmospora from Fusarium certainly needs to be done efficiently by those who have the most comprehensive expertise on the relevant species, which include several of the co-authors of the Geiser et al. (2013, 2021) and O'Donnell et al. (2020) papers as well as the present one. Fusarium taxonomy has long been confused because of the nine-species system of Snyder & Hansen (1940, 1941), the misleading overlaps caused by convergent evolution and character loss, the difficulty in characterising perithecia, the phenomenon of cultural degeneration, and rigid opinions of the taxonomists and plant pathologists who have worked on them. To arrive at a stable taxonomy for Fusarium, the generic concept needs to be fixed in a practical and evolutionary reasonable manner so that future technologies and applications will not disrupt it. SECONDARY METABOLITES OF FUSARIOID GENERA The phylogenetic distribution of the fusarioid genera presented here is further corroborated by their ability to produce genusspecific secondary metabolites. The commercial database Dictionary of Natural Products (DNP; http://dnp.chemnetbase.com), was used to search for secondary metabolites produced by the genera and species treated here. The database contained (as of March 6, 2021) over 720 entries on metabolites from Fusarium s. lat., even though some plant metabolites, discovered during studies on the elicitation of phytoalexins by challenging plant cells with a Fusarium strain, are included. The number of metabolites from Fusarium s. lat. is therefore estimated to be around 680, which is still behind Aspergillus s. lat. (over 3 000 entries) and Penicillium s. lat. (over 2 700 entries). Hits that were retrieved were confirmed by consulting the original literature. The reported structures were corroborated, with a selection of these compounds presented here (Figs 2–4). It remains uncertain if the reported taxonomy is reliable, since the producer strains may have been misidentified or determined using one of many outdated taxonomic concepts. However, several compound classes have been encountered multiple times from the same species or species complex, and in some instances, the strains were identified by experts and/or sequenced later in phylogenetic studies (O'Donnell et al. 2018). The situation is further complicated by the fact that certain secondary metabolites have been given similar names, but represent different molecules. The name solaniol has been given to both a trichothecene (Fusarium s. str.) and a naphthoquinone (Neocosmospora), and the fusariumins represent four different secondary metabolites. FUSARIUM REDELIMITED Fig. 2. Secondary metabolites from Fusarium spp. / Neocosmospora spp. Typical metabolites of Fusarium s. str. Fusarium sambucinum, the type species of the genus, has not been studied in much detail, but among the 20 metabolites known from this species, several metabolites are ranked in the classes trichothecenes and enniatins. The trichothecenes represents a well-known and notoriously dangerous class of mycotoxins belonging to the scirpene terpenoid type. These www.studiesinmycology.org compounds are widely distributed within the genus Fusarium s. str., including familiar plant pathogenic species such as, F. culmorum, F. graminearum, F. sporotrichioides and F. tricinctum (Bamburg et al. 1968, Tatsuno et al. 1968, Yoshizawa & Morooka, 1973, Jim
enez et al. 1997). The enniatins, known from 17 Fusarium s. str. species (Munkvold 2017, O'Donnell et al. 2018), are cyclic depsipeptides that have strong antibiotic activities (Plattner et al. 1948, German-Fattal 2001, 9 CROUS ET AL. Fig. 3. Some of the most important mycotoxins from Fusarium spp. Bills & Gloer 2017). Similar to trichothecenes, they are only known from Fusarium s. str. in the current taxonomic concept, although Trichoderma and Beauveria, which belong to different families of the Hypocreales, also produce trichothecenes or enniatin-like beauvericins, respectively. However, trichothecenes have not been reported from Neocosmospora or “F. solani” except from two isolates misidentified as “F. solani” (Ueno et al. 1972, Sugimoto et al. 2002) (Supplementary Table S2) Two other well-known classes of mycotoxins, the fumonisins (Bezuidenhout et al. 1988) and zearalenone (Urry et al. 1966), are also found frequently among species of Fusarium s. str. Similarly, equisetin, also considered a “mycotoxin” and originally found from a Fusarium sp. strain (NRRL 5537) in the FIESC (Vesonder et al. 1979, Xia et al. 2019) is actually a strong antibiotic. A more complex derivative known as fusarisetin A was reported from an unidentified Fusarium sp. (Jang et al. 2011). Some rather unique compounds only known from Fusarium s. str., include wortmannin (Abbas & Mirocha, 1988) and oxysporizoline (Nenkep et al. 2016), which have interesting biological activities and may be species or even strain-specific. Among the compounds that are not regarded as mycotoxins, the antimicrobial sesquiterpenes of the fusarielin type (Sørensen et al. 2013) and the antiparasitic and cytostatic cyclopeptides of the apicidin type (Jiang et al. 2002, Von Bargen et al. 2013) have been respectively isolated from Fusarium s. str. Additionally, aurofusarin (Munkvold 2017, O'Donnell et al. 2018), chlamydosporol (Munkvold 2017, O'Donnell et al. 2018), fusapyrone (Evidente et al. 1994), fusaric acid (Munkvold 2017, O'Donnell et al. 2018), fusoxysporone (Abraham & Hannsen 1992), fusaproliferin, moniliformin (Munkvold 2017, O'Donnell et al. 2018) and the terpestacins (Liu et al. 2013) are other examples of secondary metabolites found only in Fusarium s. str. Thus far, only one report has indicated that a Neocosmospora species can produce fusaric acid (Zhou et al. 2019). Both aurofusarin and bikaverin produced by Fusarium s. str. and other bis-naphthoquinone and bis-naphthopyrone pigments protect fungi from predation (Xu et al., 2019), while Neocosmospora species produce other naphthoquinones such as javanicin (Arnstein & Cook 1947, Kimura et al. 1981) as potential predator protectors. Some unique compounds have been reported from marine strains of 10 certain Fusarium species, which include the mangicols, rare sesterterpenes produced by a strain tentatively classified as F. heterosporum (Renner et al. 2000). Typical metabolites of Neocosmospora and other fusarioid genera Neocosmospora species and other fusarioid genera apparently have a different secondary metabolism, or have not been intensively studied in the past. A striking example are the cyclosporins, which are immunosuppressive peptides. Originally, these were obtained from Tolypocladium inflatum, but later also found to be produced by species of Neocosmospora (Sawai et al. 1981, Nakajima et al. 1989). However, they have not been reported from Fusarium s. str. Other unique compounds only known from Neocosmospora species, include dihydrofusarin (Kurobane et al. 1980, Kyekyeku et al. 2017), the polyketides neovasipyrones (Furumoto et al. 1995, Nakajima et al. 1995) and vasinfectin A (Furumoto et al. 1997). The rare cyclopeptides of the neosansalvamide type (Lee & Lee 2012) and the resorcylic acid lactones of the monorden/monocillin type (Cutler et al. 1987, Gao et al. 2013) are also known from Neocosmospora and other fungi, but not from Fusarium s. str., even though the latter compounds bear a high structural resemblance to zearalenone. Several Neoscomospora species produce a range of naphthoquinones that are members of a widespread class of polyketides (Roos 1977). The fusarioid genus Bisifusarium is known to produce the PKS/NRPS hybrid siderophore, dimerumic acid (= dimerum acid) (Diekmann 1970), and indole acetic acid (Reddy & Reddy 1992, Kulkarni et al. 2011, 2013). The parnafungins, which are under development as antimycotics, are only known from Microcera larvarum (Parish et al. 2008). Additionally, Microcera larvarum is also known to produce monocerin and fusarentins, which are not known from any other fungi (Grove & Pople 1979), except a Colletotrichum species (Tianpanich et al. 2011). The anticancer agent balanol (azepinostatin) (Ohshima et al. 1994) is known to be produced by two Fusicolla species, which might be applied as a taxonomic marker for this genus, although it has also been FUSARIUM REDELIMITED Fig. 4. Secondary metabolites from fusarioid Hypocreales. found in species of the Ophiocordycipitaceae. Unfortunately, there is no available information on secondary metabolites for the other fusarioid genera treated here. However, secondary www.studiesinmycology.org metabolite studies of these missing genera will facilitate for the discovery of novel molecules and help to elucidate the functional biodiversity of these fungi. 11 CROUS ET AL. RECOMMENDED METHODS FOR THE IDENTIFICATION AND CHARACTERISATION OF FUSARIUM AND ALLIED GENERA The following part of this study presents an overview of the morphological and phylogenetic characters of Fusarium and related genera as well as an account of recommended methods for the identification and characterisation of these taxa. In addition, novel genera and species are described and, in view of the recent taxonomic data, a list of names that are applied to the genus Fusarium s. lat. with their current scientific names is presented. Morphology Current Fusarium taxonomy is dominated by molecular phylogenetic studies. Nonetheless, morphology is a fundamental component of the generic and species concepts of fungi and must not be overlooked. Key morphological features for generic circumscription include characteristics of sexual morphs such as perithecial colour, wall thickness and anatomy, surface structures and the presence and nature of a basal stroma, ascospore shape, septation, colour and surface ornamentation (Rossman et al. 1999). Classification of taxa solely based on their asexual morphs can be trickier than integrated systems using sexual and asexual characters. However, the general shapes, different types and combinations of conidiogenous structures and conidia present in culture can be sufficient to allow a preliminary identification (Fig. 5), especially if host data are also available (Leslie & Summerell 2006). For species-level characterisation, a number of morphological traits must be carefully studied, particularly those of the asexual morph, while sexual morphs are generally less suitable, especially as they are typically not produced in culture. Diagnostic characters for species identification include colony characters such as colony morphology, pigmentation, and type of aerial mycelium. Also included are the dimensions and characteristics of aerial conidiophores and conidiogenous cells (mono- vs polyphialides), presence/absence and characteristics of sporodochia, the types of conidia produced, e.g., aerial microconidia, mesoconidia, and aerial and sporodochial macroconidia. In examining conidia themselves, consideration is given to the overall shape, septation and curvature of the macroconidia, as well as characteristics of their apical and basal cells; with aerial microconidia, their dimensions, shape, septation and spatial organisation (forming slimy heads, chains or a combination of both) are noted. Finally, the presence or absence of chlamydospores may be important. Culture media and incubation Vigorous growth, sporulation, and pigment production of fusarioid fungi can be achieved on numerous agar formulations. The morphology of fungal structures will vary dramatically depending on the selection of media and growth conditions which may compromise the identification process. In addition, it is also common for fusaria to degenerate and lose viability in culture, particularly when they are grown on nutrient-rich media (Nelson et al. 1983, Nirenberg 1990, Summerell et al. 2003, Leslie & Summerell 2006). Culture conditions and media have been extensively summarised in the literature (Booth 1971, Nirenberg 12 1990, Nelson et al. 1994, Summerell et al. 2003, Leslie & Summerell 2006). Consequently, we recommend the agar formulations listed in Table 1 to be employed for the isolation and description of fusaria. A summary of the procedures and conditions suitable for work with fusarioid fungi is shown in Fig. 6. An important condition that must be stressed is that the identification must always be made on the basis of a monosporic culture (a culture produced from a single sporulating conidium, ascospore, or hyphal tip), as multiple species are commonly found to co-occur in the same substrate tissue. A freshly isolated fusarioid strain should be sub-cultured onto at least two different culture media, a relatively rich one suitable for examination of gross morphology, and a nutrient-poor one for micromorphological examination and for further culture propagation. The standard culture setup for initial assessment of growth rates and colony characters i.e., colony pigmentation, diffusible pigments, and colour of sporodochia, is to use potato dextrose agar (PDA) incubated for 1–2 wk. Fusarium and related genera will also grow and sporulate well on malt extract agar (MEA, recipe in Crous et al. 2019a), which can be a suitable alternative for initial isolation and monosporic cultivation. However, MEA should not be used to assess colony or morphological characters. Standard incubation is commonly made in total darkness; however, exposure to light will normally result in a faster and more intense pigmentation. We have observed better colour formation using in-house prepared media rather than commercial formulae. While colony colour cannot be employed as a primary criterion for species identification, it can provide useful means to grossly distinguish related groups and to direct the identification process towards determining genera or species complexes. The high nutrient content of these agar media strongly affects sporulation, commonly resulting in the development of atypical structures. Therefore, we strongly discourage the use of PDA for micromorphological assessment or culture propagation of Fusarium spp. (Nelson et al. 1994, Summerell et al. 2003). Oatmeal agar (OA) is a suitable alternative for strain sub-culturing, allowing for good sporulation with reduced strain degeneration; however, it is not recommended for micromorphological studies. Carnation leaf agar (CLA), synthetic nutrient-poor agar (SNA), and water agar (WA) are the standard culture media for micromorphological analyses. Also, by reducing culture degeneration, they allow for prolonged storage of actively growing cultures (Nirenberg 1976, Nelson et al. 1983, Leslie & Summerell 2006). Subcultures on CLA will normally produce abundant sporodochia and macroconidia on the surface or around the carnation leaf pieces with consistent morphological features. Incubation at room temperature (20–25 °C) for 1–2 wk under a 12/12 h nearUV light (wavelength 320–400 nm)/dark or near-UV light/cool fluorescent light cycles results in stronger sporulation and good development of sporodochial pigmentation (Nirenberg 1990, Seifert 1996, Summerell et al. 2003, Leslie & Summerell 2006). The use of continuous near-UV light (also commonly termed "blacklight" or UV-A light) is also suitable although it often results in the formation of unusually long macroconidia (Nirenberg 1990), and it can suppress the development of useful morphological characters such as the globose microconidia of Fusarium globosum. Nevertheless, incubation under near-UV light is fundamental since isolates of some species such as Fusarium poae and F. sacchari are known to lack macroconidia or to produce them in only small quantities unless they are stimulated by incubation under a near-UV light source (Leslie et al. 2005, Leslie & Summerell 2006). Fusarium cultures also need FUSARIUM REDELIMITED Fig. 5. Basic morphological features of fusarioid fungi. A. Macroconidial shapes. A1. Slender with no significant curvature. A2. Curved with parallel walls. A3. Unequally curved. A4. Widest at the middle portion. A5. Widest at the apical third, wedge-shaped. A6. Widest at the basal portion. A7. Irregularly clavate and swollen. A8. Elongate, whip-like. A9. Distinctly curved. B. Macroconidial apex. B1. Curved. B2. Long and tapered. B3. Pointed. B4. Blunt. B5. Hooked. B6. Elongated. C. Macroconidial base. C1. Obtuse, non foot-shaped. C2. Papillate, non foot-shaped. C3. Poorly developed, foot-shaped. C4. Well-developed, foot-shaped. C5. Elongate, foot-shaped. D. Aerial phialides and microconidial organization. D1. Monophialide. D2–D5. Polyphialides. D2. Simple polyphialide. D3–D4. Polyphialides with multiple conidiogenous loci. D5. Sympodially proliferating polyphialides. D6, D7. Microconidia forming false heads. D8, D9. Microconidia in chains (D8. Dry chain. D9. Palisade). E. Sporodochial conidiophore and conidiogenous cells. F. Aerial conidiophore bearing mesoconidia. G. Mesoconidia. H. Microconidial shapes. H1. Fusiform. H2. Oval. H3. Obovoid. H4. Reniform. H5. Allantoid. H6. Clavate. H7. Napiform. H8. Pyriform. H9. Limoniform. www.studiesinmycology.org 13 CROUS 14 Table 1. Recommended agar media formulations for the isolation and cultivation of fusaria. Components1 Preparation2 Incubation3 Application Reference Carnation leaf agar (CLA) Sterilised carnation leaves WA Carnation leaves are cut into approximately 5 × 5 mm pieces and dried at 60 °C for 24 h; sterilise by gamma radiation or autoclave; place 3–5 pieces on nearly solid 2 % WA surface. 25 °C; 7–14 d under 12 h near-UV-light/dark cycle; 7–14 d under 24 h near-UV-light Micromorphological characterisation: formation of sporodochia; sporodochial macroconidia Fisher et al. (1982), Crous et al. (2019a) Selective Fusarium Agar (SFA) Glucose (Dextrose) KH2PO4 NaNO3 MgSO4$7H2O Yeast Extract 1 % FeSO4$7H2O (aquous) Streptomycin Neomycin Dichloran Agar Water 20 g 1g 2g 0.5 g 1g 1 ml (5 % w/v) 20 mL (1 % w/v) 12 mL (50 % w/v in ethanol) 13 mL 20 g 1 000 mL Add all components, except antibiotics, to water and autoclave; cool to 45–50 °C and add antibiotics. Dichloran can be replaced by PCNB (0.75 g). 25 °C; 7–14 d in dark Selective isolation of fusaria from soil Tio et al. (1977), Leslie & Summerell (2006) Komada's Medium D-Galactose L-Asparagine KH2PO4 KCl MgSO4$7H2O PCNB Fe3Na EDTA Streptomycin Oxgall stock solution Na2B4O7$10H2O (borax) Agar Water 20 g 2g 1g 0.5 g 0.5 g 0.75 g 0.01 g (5 % w/v) 6 mL 0.5 g 0.5 g 15–20 g 1 000 mL Add all components, except antibiotics, oxgall and borax; to water and autoclave; cool to 45–50 °C and add the reamining components. Adjust pH to 3.8 ± 0.2 prior to autoclaving. 25 °C; 7–14 d in dark Selective isolation of fusaria from soil, particularly those belonging to the Fusarium oxysporum species complex. Other fusaria can be inhibited by this medium Komada (1975), Leslie & Summerell (2006) Malachite Green Agar (MGA) Peptone KH2PO4 MgSO4$7H2O Malachite green oxalate Streptomycin Penicillin Agar Water 15 g 1g 0.5 g 2.5 mg (5 % w/v) 20 mL (5 % w/v) 20 mL 20 g 1 000 mL Add all components, except antibiotics, to water and autoclave; cool to 45–50 °C and add antibiotics. Penicillin can be also replaced by chloramphenicol (5 % w/v) or neomycin (1 % w/v). 25 °C; 7–14 d in dark Selective isolation of fusaria from soil and plant material, with improved inhibition of nonfusarioid contaminants Castell
a et al. (1997), Leslie & Summerell (2006) Oatmeal agar (OA) Oatmeal extract Agar 1 000 mL 15–20 g Oatmeal flakes (30 g/L) are wrapped in cloth and simmered in water for 2 h; liquid is squeezed and filtered through cloth. 25 °C; 7–14 d in dark Macromorphological characterisation, colony characteristics Crous et al. (2019a) ET AL. Agar media Table 1. (Continued). www.studiesinmycology.org Agar media Components1 Preparation2 Incubation3 Application Reference Potato dextrose agar (PDA) Potato extract Agar Water 230 mL 15–20 g 770 mL Potatoes (5 kg; peeled and sliced) are minced; soak in water (300 mL/100 g potato) overnight at 4 °C; filter through cloth; adjust pH to 6.6. 25 °C; 7–14 d in dark; 5–40 °C (5 °C increments for growth curves) Inoculum preparation, macromorphological characterisation: colony characteristics; growth curve Crous et al. (2019a) Peptone Pentachloronitrobenzene (PCNB) agar (PPA) Peptone KH2PO4 MgSO4$7H2O PCNB Streptomycin Penicillin Agar Water 15 g 1g 0.5 g 0.75 g (5 % w/v) 20 mL (5 % w/v) 20 mL 20 g 1 000 mL Add all components, except antibiotics, to water and autoclave; cool to 45–50 °C and add antibiotics. Penicillin can be also replaced by chloramphenicol (5 % w/v) or neomycin (1 % w/v). 25 °C; 7–14 d in dark Selective isolation of fusaria from soil and plant material Nash & Snyder (1962), Booth (1971), Leslie & Summerell (2006) Rose Bengal-Glycerine-Urea Medium (RbGU) Glycerol Urea L-Alaninw PCNB Rose Bengal Streptomycin Agar Water 10 g 1g 0.5 g 1g 0.5 g (5 % w/v) 20 mL 15 g 1 000 mL Add all components, except antibiotics, to water and autoclave; cool to 45–50 °C and add antibiotics. 25 °C; 7–14 d in dark Isolation of fusaria from soil and plant material van Wyk et al. (1986), Leslie & Summerell (2006) Synthetic nutrient-poor agar (SNA) KH2PO4 KNO3 MgSO4$7H2O KCl Glucose Saccharose Water 1g 1g 0.5 g 0.5 g 0.2 g 0.2 g 1 000 mL Add all components to water and autoclave. 25 °C; 7–14 d under 12 h nearUV-light/dark cycle Inoculum preparation, micromorphological characterisation: aerial conidiophores and micro- & macroconidia; chlamydospore formation Nirenberg (1976), Crous et al. (2019a) Water agar (WA) Agar Water 15–20 g 1 000 mL 25 °C; 7–14 d in dark Inoculum preparation, base agar for CLA Crous et al. (2019a) 1 FUSARIUM Unless specified differently, antibiotic stock solutions are prepared in distilled water. Water refers to distilled water; autoclave = 121 °C for 15 min. 3 Near-UV = near ultraviolet spectrum (wavelength 320–400 nm). 2 REDELIMITED 15 CROUS ET AL. Fig. 6. Flow diagram summarising recommended methods for the preservation, identification, and characterisation of fusarioid fungi. adequate aeration to produce conidia reliably and to attain stable growth rates, and hence we discourage the incubation of sealed plates. Carnation leaf agar, SNA, and WA are also suitable for the observation of conidiophore disposition and microconidial arrangements such as the formation of false heads, chains or both. These structures can easily be examined under a dissecting microscope or at low magnification under a compound light microscope (Leslie & Summerell 2006). Examination of micromorphological characters must be carried out using slide preparations mounted in water. Lactic acid, lactophenol and Shear's mounting media can cause considerable shrinking of the structures and can alter the appearance of the cell surface; hence we advise against the use of these mountants for examination of morphological characters in Fusarium and related genera. Additional culture media, incubation conditions, and protocols are available for induction of sexual characters in Fusarium and related genera (Klittich & Leslie 1988, Leslie & Summerell 2006, Guo et al. 2018, Kim et al. 2019, Santos et al. 2019). Carrot agar (CA) and half-strength CA are the most commonly used media. 16 The crossing procedures are often variations from the protocol of Klittich & Leslie (1988), in which strains of opposite mating types are paired in all possible combinations as male and female parents, together with crosses made against tester strains from known mating populations (Leslie & Summerell 2006). The process can be shortened by reducing the number of combinations to be crossed by first determining the MAT gene alleles carried by each strain by means of specific mating type idiomorph PCR primers (Ker
enyi et al. 1999, 2004, Steenkamp et al. 2000). Molecular studies Several genes, primer combinations and PCR conditions have been listed in the Fusarium literature (O'Donnell et al. 1998a, b, 2000a, b, 2007, 2010, 2013, Gr€afenhan et al. 2011, Lombard et al. 2015, 2019a, b), including whole-genome sequencing to mine for the desired genes (O'Donnell et al. 2020, Geiser et al. 2021). Here we detail those DNA markers that have shown the best results in routine diagnosis (Table 2, Fig. 6). FUSARIUM REDELIMITED Table 2. Recommended PCR primers for DNA amplification of Fusarium and related genera. Gene/DNA region 1 2 Primer Name Abbreviation Name Direction Sequence (5'/3') Reference 28S large subunit of the nrDNA LSU LR0R LR5 NL42 Forward Reverse Reverse ACCCGCTGAACTTAAGC ATCCTGAGGGAAACTTC GGTCCGTGTTTCAAGACGG Vilgalys & Sun (1994) Vilgalys & Hester (1990) Kurtzman & Robnett (1997) ATP citrate lyase acl1 230up 1220low Forward Reverse AGCCCGATCAGCTCATCAAG CCTGGCAGCAAGATCVAGGAAGT Gr€afenhan et al. (2011) Gr€afenhan et al. (2011) Beta-tubulin tub2 T1 TUB-2Fd2 TUB4RD Forward Forward Reverse AACATGCGTGAGATTGTAAGT GTBCACCTYCARACCGGYCARTG CCRGAYTGRCCRAARACRAAGTTGTC O'Donnell & Cigelnik (1997) Woudenberg et al. (2009) Woudenberg et al. (2009) Calmodulin CaM CAL-228f CAL-CL12 CAL-CL2A2 CAL-2Rd Forward Forward Reverse Reverse GAGTTCAAGGAGGCCTTCTCCC GARTWCAAGGAGGCCTTCTC TTTTTGCATCATGAGTTGGAC TGRTCNGCCTCDCGGATCATCTC Carbone & Kohn (1999) O'Donnell et al. (2000b) O'Donnell et al. (2000b) Quaedvlieg et al. (2011) Internal transcribed spacer region of the nrDNA ITS ITS5 V9G2 ITS4 Forward Forward Reverse GGAAGTAAAAGTCGTAACAAGG TTACGTCCCTGCCCTTTGTA TCCTCCGCTTATTGATATGC White et al. (1990) de Hoog & van den Ende (1998) White et al. (1990) RNA polymerase largest subunit rpb1 Fa F7 F81 F61 R8 R9 G2R1 Forward Forward Forward Forward Reverse Reverse Reverse CAYAARGARTCYATGATGGGWC CRACACAGAAGAGTTTGAAGG TTCTTCCACGCCATGGCTGGTCG CTGCTGGTGGTATCATTCACG CAATGAGACCTTCTCGACCAGC TCARGCCCATGCGAGAGTTGTC GTCATYTGDGTDGCDGGYTCDCC O'Donnell O'Donnell O'Donnell O'Donnell O'Donnell O'Donnell O'Donnell RNA polymerase second largest subunit rpb2 RPB2-5f2 fRPB2-7cf fRPB2-7cr RPB2-11ar Forward Forward Reverse Reverse GGGGWGAYCAGAAGAAGGC ATGGGYAARCAAGCYATGGG CCCATRGCTTGYTTRCCCAT GCRTGGATCTTRTCRTCSACC Reeb et al. (2004) Liu et al. (1999) Liu et al. (1999) Liu et al. (1999) Translation elongation factor 1-alpha tef1 EF-1 EF-2 Forward Reverse ATGGGTAAGGARGACAAGAC GGARGTACCAGTSATCATG O'Donnell et al. (1998b) O'Donnell et al. (1998b) et et et et et et et al. al. al. al. al. al. al. (2010) (2010) (2010) (2010) (2010) (2010) (2010) Used only for sequencing reactions. Alternative primer, not used in this study. Nuclear ribosomal DNA (nrDNA), including the internal transcribed spacer region cistron (ITS) and the 28S large subunit nrDNA (LSU), are nearly useless for species recognition in Fusarium and related genera. Nevertheless, given the ease of amplification and the extensive data available for comparison in public databases (Schoch et al. 2012), these markers are useful in the discrimination between the multiple species complexes of Fusarium, and for obtaining a confident genus-level identification for Fusarium and related genera, allowing further DNA markers to be incorporated in the analyses. The ITS region can still provide valuable information at species level for related genera containing species formerly included in Fusarium (Bisifusarium, Cosmosporella, Fusicolla, Macroconia, Microcera, and Stylonectria). Many protein-coding genes have been explored for identification and taxonomic purposes in Fusarium and fusarioid fungi. The two main genes used for identification are tef1 and rpb2. Both offer high discriminatory power and are well represented in public databases. Translation elongation factor 1-α is commonly the first-choice identification marker as it has very good resolution power for most species in all the genera treated here, while rpb2 allows for enhanced discrimination between closely related species. For example, some species in the Fusarium fujikuroi species complex (FFSC) and in Neocosmospora that are not easily separated by using tef1 alone (O'Donnell 2000, Nalim et al. 2011, Herron et al. 2015), can be resolved with rpb2. On the other hand, PCR amplification and sequencing success are often better for tef1 than for rpb2. When used for phylogenetic analyses, sequence alignments of rpb2 sequences are much www.studiesinmycology.org more robust and less ambiguous than tef1 data, given the former gene's advantageously low proportion of introns. An analogous situation has been shown in Aspergillus (Samson et al. 2014) and Penicillium (Visagie et al. 2014). Additional genetic markers, often employed in association with the previously mentioned genes in multigene phylogenetic analyses include acl1, tub2, CaM, and rpb1. These markers have variable resolution or applicability depending on the genus or species complex. For example, use of CaM data may yield conflicting clade resolutions in the FFSC (O'Donnell 2000, AlHatmi et al. 2019), while paralogous or xenologous gene copies have been demonstrated for tub2 in the F. chlamydosporum and F. incarnatum-equiseti species complexes (O'Donnell et al. 2009) as well as in Neocosmospora (O'Donnell 2000, O'Donnell et al. 2008a). The most widely used algorithm for fungal identification by means of DNA markers is the Basic Local Alignment Search Tool (BLAST), available at the NCBI's GenBank website. This is a quick and useful method that can convey a great deal of information, but its results must be analysed with care given the presence of a high proportion of misidentified strains and lowquality sequences that must be filtered out (Vilgalys 2003, Nilsson et al. 2012). Sequences from type material are present in the GenBank nucleotide database for most fusarioid species known from culture, especially for rpb2 and tef1 barcodes, but the ex-type status of these sequences is not always explicitly mentioned. In many cases the names listed do not reflect the current taxonomy, even for sequences derived from ex-type cultures. 17 CROUS ET AL. Some sequences used in past phylogenetic analyses of O'Donnell et al. (2020) and Geiser et al. (2021) appear to be linked to incorrect Fusarium names, likely due to errors in the database used. For this reason, we recommend the use of our curated database: Fusarioid-ID (https://www.fusarium.org). It can also be used for sequence similarity-based analysis of routine isolations and for identifications within several related genera. MALDI-TOF A number of studies have thus far demonstrated the utility of mass spectrometry (MS) for species determination of subgroups of Fusarium, particularly members of the FFSC (Al-Hatmi et al. 2015, 2016, Wigmann et al. 2019). It is also useful for clinically relevant subgroups within several Fusarium species complexes (Marinach-Patrice et al. 2009, Triest et al. 2015, Sleiman et al. 2016, Paziani et al. 2020) and clinically relevant Bisifusarium (Triest et al. 2015, Paziani et al. 2020) and Neocosmospora species (Marinach-Patrice et al. 2009, Triest et al. 2015, Sleiman et al. 2016, Paziani et al. 2020). These techniques show highly accurate discriminative power, comparable to what has been shown with bacteria and yeasts. Only a limited number of taxa have thus far been evaluated, and a genus-wide evaluation of applicability of MALDI-TOF to Fusarium and related taxa is pending. The main limiting factor is, as usual, the current lack of representation of these taxa in commercial spectrum databases, a matter that can be resolved by constructing in-house, curated reference databases of spectra. Online availability and comparison of MS spectra of Fusarium has been proposed by Triest et al. (2015). MATERIALS AND METHODS Isolates and fungarium specimens Fungal strains were obtained from the Westerdijk Fungal Biodiversity Institute (WI) collection (CBS), the Belgian Coordinated Collections of Microorganisms (IHEM), the International Mycological Institute (IMI), and the personal collection of Pedro W. Crous (CPC) housed at WI. For the list of names applied to the genus Fusarium and related fungarium specimens, the following fungaria were approached for holotype specimens: B, BM, BO, BP, BPI, BR, BRA, C, CBS, CO, DAOM, E, FH, H, HAL, IMI, K(M), L, LEP, M, MASS, MPA, NY, PC, PAD, PARMA, PAV, PH, PRM, ROVP, SIENA, STR, UPS, VPRI, W, and WIR. DNA amplification and phylogeny Total genomic DNA was extracted from isolates grown for 7 d on PDA or MEA (recipes in Crous et al. 2019a; Table 1) incubated at 24 °C under a 12/12 h photoperiod using the Wizard® Genomic DNA purification Kit (Promega Corporation, Madison, WI, USA), following the manufacturer's instructions. Partial gene sequences were determined for eight DNA markers, i.e., acl1, CaM, ITS, LSU, rpb1, rpb2, tef1, and tub2 using PCR protocols described elsewhere (O'Donnell et al. 1998b, 2007, 2010, Lombard et al. 2015). Primer pairs used for amplification and sequencing of 18 the respective gene regions are summarised in Table 2. Consensus sequences for each marker were assembled in Geneious R11 (Kearse et al. 2012) or SeqMan Pro v. 15.3.0 (DNASTAR, Madison, WI, USA). All sequences generated in this study were deposited in GenBank (Table 3; also see Diagnostic DNA Barcodes in list of Fusarium names). The multiple sequence alignments and phylogenetic trees were deposited in TreeBASE (study ID 28093). Sequences of the individual markers, including introns, were aligned using MAFFT v. 7.110 (Katoh et al. 2019) using default parameters and manually corrected where necessary. Seven multimarker datasets (Table 4) were assembled and analysed using Maximum Likelihood (ML) and Bayesian Inference (BI). For the ML analyses, concatenated phylogenies, where each marker was treated as a separate partition, were determined using IQ-TREE v. 2.1.2 (Nguyen et al. 2015, Minh et al. 2020b) with ultrafast bootstrapping (UFBoot2; Hoang et al. 2018) for estimation of branch support. The most suitable evolutionary model for each partition was estimated using ModelFinder (Kalyaanamoorthy et al. 2017; Minh et al. 2020b) as implemented in IQ-TREE. To assess whether the individual markers were compatible, genealogical concordance factors (gCF) were calculated using IQ-TREE (Minh et al. 2020a, b). Additional ML analyses were performed using RAxML v. 8.2.12 (randomised accelerated (sic) maximum likelihood for high performance computing; Stamatakis 2014) with the system's default modelling options. The robustness of the analysis was evaluated by bootstrap support (BS) with the number of bootstrap replicates automatically determined by the software. The BI analyses were carried out through the CIPRES website (http://www.phylo.org) using MrBayes v. 3.2.7a (Ronquist & Huelsenbeck 2003) incorporating the best evolutionary models for each marker as determined by MrModeltest v. 2.3 (Nylander 2004). Two parallel Markov Chain Monte Carlo (MCMC) runs of four incrementally heated chains (temp parameter = 0.2) were run starting from a random tree topology. The MCMC analyses lasted for 5M generations, and convergence of the runs was checked by average standard deviation of split frequencies below 0.01. Trees were saved every 1 000 generations and the first 25 % of saved trees were discarded as the “burn-in” phase. Posterior probabilities (PP) were determined from the remaining trees. Proper mixing of the MCMC runs was further confirmed by checking that all chains converged (minimum and average Estimated Sampled Size [ESS >200], Potential Scale Reduction Factor [PSRF = 1.0]) and by plotting and analysing trace file results using Tracer v.1.7.1 (Rambaut et al. 2018). The phylogenetic re-analysis of the dataset presented by Geiser et al. (2021) was first made according to the original exons-only alignment file and procedures as indicated in Geiser et al. (2021) (Supplementary Table S1). Additionally, the dataset was split into the 19 genes according to the original partitioning file, and every gene was realigned using the MAFFT webserver (v. 7, Katoh et al. 2019) applying the G-INSi algorithm. All other parameters were set to default. Six of the 19 genes exhibited a diverging alignment length. No subsequent changes were done to the alignments. The sequences were merged using BioEdit (v. 7.2.5, Hall 1999), and the phylogenetic trees were calculated using Minimum evolution (ME) and ML algorithms, and BI. The ME tree was calculated using FastTree 2 (Price et al. 2010) using standard settings and 1 000 bootstraps (Felsenstein 1985). The ML analysis was done using RAxML (v. 8.2.12, Stamatakis 2014) with the Table 3. Details of strains included in the phylogenetic analyses. Species name Strain1 Substrate GenBank accession number2 Country acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2 www.studiesinmycology.org Albonectria albosuccinea NRRL 20459 Unidentified tree Venezuela — — JAADYS010000048.1* JAADYS010000048.1* JX171471 JX171585 JAADYS010002360.1* — A. rigidiuscula CBS 133754 Bauhinia longicupsis French Guiana — — MW827602 MW827641 MW834177 MW833995 MW834269 — Atractium crassum CBS 180.31T = NRRL 20894 Water tap Germany — — KM231790 MH866623 MW834178 HQ897722 KM231919 — At. stilbaster DAOM 215627 Cut stump Canada — — — HQ843769 — HQ897748 — — Bisifusarium delphinoides CBS 110140 = FRC E-0073 = NRRL 36160 Human eye USA — — MW827603 MW827642 JX171535 HM347219 EU926302 — B. dimerum CBS 108944ET = NRRL 36140 Human blood Netherlands — — JQ434586 JQ434514 — HM347218 KR673912 — T B. nectrioides CBS 176.31 = NRRL 20689 Humus Honduras — — EU926245 EU926245 JX171477 JX171591 EU926312 — B. penzigii CBS 116508 = ATCC 15621 = NRRL 20711 Human eye Sri Lanka — — EU926256 EU926256 JX171482 HM347217 EU926323 — Corinectria fuckeliana CBS 239.29 = IMI 039700 Picea sitchensis Scotland — — MW827604 MW827643 MW834179 MW833996 DQ789728 — Co. tsugae CBS 788.69T Tsuga heterophylla Canada — — KM231763 KM231763 — KM231763 MW834270 — Cosmospora butyri CBS 301.38T = MUCL 9950 Butter Denmark — — MW827605 MW827644 MW834180 HQ897729 — — Cs. coccinea CBS 341.70 Inonotus nodulosus on Fagus sylvatica Germany — — MH859703 KM231692 MW834181 HQ897777 KM231947 — Cs. khandalensis CBS 356.65IT = ATCC 16091 = IMI 112790 = MUCL Bambusa sp. India — — MH858608 NG_069711 — MW833997 — — 7974 Cs. lavitskiae CBS 530.68T = ATCC 18666 = IMI 133984 Plant debris Ukraine — — KU563624 HQ231997 — MW833998 MW834271 — Cs. viridescens CBS 102433 Tilia sp. Czech Republic — — KJ676148 KJ676185 MW834182 MW833999 KJ676343 — Cosmosporella cavisperma CBS 172.31ET = NRRL 13996 Pinus sylvestris Norway — — MW827606 MW827645 JX171465 MW834000 — — Dead terminal branches connected Slovenia — — NR_145049 MH875034 MW834183 MW834001 KM231939 — France — — FJ474076 MH874353 MW834184 MW834002 HM626647 — Cyanonectria buxi ET CBS 125551 with alive Buxus sempervirens var. elegantissima C. cyanostoma CBS 101734ET = CBS 115512 = GJS 98-127 Buxus sempervirens Dialonectria episphaeria CBS 125494 Old ascomycete ascomata Canada — — MH863609 MH875085 MW834185 HQ897756 KM231953 — D. ullevolea CBS 125493 Ascomycete on Fagus americana USA — — KM231821 KM231696 — HQ897782 KM231952 — Fusarium acutatum CBS 402.97T = BBA 69580 = FRC O-1117 = NRRL Unknown India — MW402459 — — MW402653 MW402768 MW402125 MW402323 13309 Agapanthus sp. Australia — KU900611 — — KU900620 KU900625 KU900630 KU900635 F. ananatum CBS 118516T = CMW 18685 = MRC 8165 Ananas comosus fruit South Africa — LT996175 — — LT996188 LT996137 LT996091 LT996112 F. andiyazi CBS 119857T = NRRL 31727 Sorghum bicolor soil debris South Africa — LT996176 — — LT996189 LT996138 LT996092 LT996113 F. anthophilum CBS 737.97 = DAOM 225119 = FRC M-1355 = IMI Hippeastrum sp. Germany — LT996177 — — LT996190 LT996139 LT996093 LT996114 F. bactridioides NRRL 20476 Cronartium conigenum USA — AF158343 — — Not public Not public AF160290 U34434 Begonia elatior hybrid Germany — AF158346 — — LT996191 LT996140 AF160293 U61543 Soil New Caledonia — — U61674 U61648 JX171506 JX171619 PVQB02000800* — 375325 = NRRL 13602 F. begoniae T CBS 403.97 = BBA 67781 = DAOM 225116 = IMI 375315 = NRRL 25300 19 F. beomiforme CBS 740.97 = BBA 65829 = DAOM 225123 = IMI 375328 = NRRL 25174 (continued on next page) REDELIMITED NRRL 54463T FUSARIUM F. agapanthi CROUS 20 Table 3. (Continued). F. brevicatenulatum Strain1 Substrate CBS 404.97T = BBA 69197 = DAOM 225122 = IMI ET AL. Species name GenBank accession number2 Country acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2 Striga asiatica Madagascar — MW834108 — — — MN534295 MN533995 MN534063 Hibiscus cannabinus Iran — — U34581 U34552 JX171449 JX171563 — — Nerine bowdenii Germany — KF466327 — — KF466394 KF466404 KF466415 KF466437 Pinus radiata USA — KM231393 — — JX171510 HM068354 KM231943 KM232080 375329 = NRRL 25446 F. buharicum CBS 796.70 = ATCC 24135 = BBA 11122 = DSM 62165 = FRC R-4955 = IMI 141195 = NRRL 13371 F. bulbicola CBS 220.76T = BBA 12293 = BBA 63628 = DAOM 225114 = IMI 202877 = IMI 375322 = NRRL 13618 F. circinatum CBS 405.97T = BBA 69720 = DAOM 225113 = IMI 375321 = MRC 7541 = NRRL 25331 F. coicis NRRL 66233T = RBG 5368 Coix gasteenii Australia — LT996178 — — KP083269 KP083274 KP083251 LT996115 F. compactum NRRL 13829 River sediments Japan — — — — JX171460 JX171574 — — T Musa sapientum Costa Rica — AF158335 — — LT996192 JF741086 AF160282 U61548 F. concentricum CBS 450.97 = BBA 64354 = CBS 833.85 = DAOM 225146 = IMI 375352 = NRRL 25181 F. cugenangense CBS 130308 = NRRL 25387 = ATCC 26225 Human toe nail New Zealand — — MW827607 MW827646 JX171512 JX171625 MH485011 — F. curvatum CBS 744.97 = IMI 375335 = NRRL 22902 Pseudotsuga menziesii USA — AF158365 — — LT996203 LT575065 AF160312 U34424 F. denticulatum CBS 735.97 = NRRL 25302 Ipomoea batatas USA — AF158322 — — LT996195 LT996143 AF160269 U61550 F. dlaminii CBS 119860T = BBA 69859 = FRC M-1637 = MRC Soil debris in cornfield South Africa — AF158330 — — KU171681 KU171701 AF160277 U34430 CBS 146496 = CPC 30814 Unidentified tree South Africa — MW834109 — — MW834186 MW834003 MW834272 MW834300 CBS 146497T = CPC 30815 Unidentified tree South Africa — MW834110 — — MW834187 MW834004 MW834273 MW834301 3032 = NRRL 13164 F. echinatum F. equiseti CBS 245.61 = NRRL 20697 Beta vulgaris Chile — — MH858038 MH869603 JX171481 JX171595 — — F. flocciferum CBS 831.85 = BBA 64346 = NRRL 25473 Triticum aestivum Germany — — — MW827647 JX171514 JX171627 — — F. fracticaudum CBS 137234PT = CMW 25237 Pinus maximonoii Colombia — LT996179 — — LT996196 LT996144 KJ541059 KJ541051 F fractiflexum NRRL 28852T Cymbidium sp. Japan — AF158341 — — Not public LT575064 AF160288 AF160315 F. fredkrugeri T CBS 144209 = CPC 33747 Melhania acuminata rhizosphere South Africa — LT996181 — — LT996199 LT996147 LT996097 LT996117 F. fujikuroi CBS 221.76T = BBA 12428 = BBA 63630 = IHEM Oryza sativa Taiwan — — MW827608 MW827648 MW834188 MW834005 AF160279 — Oryza sativa China — AF158332 — — JX171456 JX171570 AF160279 U34415 Zea mays South Africa — KF466329 — — KF466396 KF466406 KF466417 KF466439 3821 = IMI 196086 = IMI 202879 = NRRL 13620 = NRRL 13998 = NRRL 22174 NRRL 13566 = ATCC 38941 = DAOM 225143 = IMI 300793 = IMI 375349 = NRRL 5538 = NRRL A-26483 F. globosum CBS 428.97T = DAOM 214966 = FRC M-8014 = IMI 375330 = MRC 6647 = NRRL 26131 = PREM 51878 F. graminearum CBS 123657 = NRRL 31084 Zea mays USA — — DQ459823 DQ459823 JX171531 JX171644 AY452957 — F. heterosporum CBS 720.79 = NRRL 20693 Claviceps purpurea on Lolium perenne Netherlands — — MW827609 MW827649 JX171480 JX171594 JAAGWP010000622.1* — Vicia faba Germany — AF158366 — — JX171469 JX171583 AF008479 U34435 F. inflexum Table 3. (Continued). Species name Strain1 Substrate GenBank accession number2 Country www.studiesinmycology.org acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2 T CBS 716.74 = ATCC 32213 = BBA 63203 = DAOM 225130 = DSM 63203 = IMI 375336 = NRRL 20433 F. konzum CBS 119849T = MRC 8427 Sorghastrum nuttans USA — LT996182 — — LT996200 LT996148 LT996098 LT996118 F. lactis CBS 411.97ET = BBA 68590 = DAOM 225145 = IMI Ficus carica USA — AF158325 — — LT996201 LT996149 AF160272 U61551 Ulmus sp. USA — — — — JX171457 JX171571 — — 375351 = NRRL 25200 F. lateritium NRRL 13622 = NRRL A-26433 F. longipes NRRL 20723 = IMI 265540 Unknown England — — — — JX171483 JX171596 — — F. mangiferae NRRL 25226 = BBA 69662 = DAOM 225155 = IMI Mangifera indica Israel — AF158334 — — JX171509 HM068353 AF160281 U61561 "F." melanochlorum CBS 202.65 = ATCC 16069 = BBA 9831 = DSM Fagus sylvatica Austria — — MH858541 MH870179 JX171537 JX171649 — — Mangifera indica Mexico — GU737389 — — LR792579 LR792615 GU737416 GU737308 Pennisetum typhoides Namibia — AF158319 — — HM347136 EF470117 AF160266 U34428 304063 = IMI 375361 62248 = NRRL 36353 F. mexicanum F. napiforme NRRL 47473 T CBS 748.97 = BBA 69861 = DAOM 225147 = FRC M-3563 = IMI 375353 = MRC 4144 = NRRL 13604 F. nurragi CBS 392.96 = NRRL 36452 Soil Australia — — MW827610 MW827650 JX171538 JX171650 JAALXI010000436.1* — F. nygamai CBS 749.97T = ATCC 58555 = BBA 69862 = DAOM Sorghum bicolor Australia — AF158326 — — LT996202 EF470114 AF160273 U34426 225148 = FRC M-1375 = IMI 375354 = NRRL 13448 F. parvisorum CBS 137236T Pinus patula Colombia — LT996183 — — — LT996150 KJ541060 KJ541055 F. phyllophilum CBS 216.76T = BBA 11730 = BBA 63625 = DAOM Dracaena deremensis Italy — KF466333 — — KF466399 KF466410 KF466421 KF466443 F. poae NRRL 13714 = FRC T-503 = MRC 2181 Overwintered wheat Canada — — — — JX171458 JX171572 — — 225132 = IMI 202874 = IMI 375338 = NRRL 13617 F. prieskaense F. phyllophilum CPC 30825 Aloidendron dichotomum South Africa — MW834111 — — MW834189 MW834006 MW834274 MW834302 CBS 146498T = CPC 30826 Prunus spinosa South Africa — MW834112 — — MW834190 MW834007 MW834275 MW834303 CBS 146499 = CPC 30827 Prunus spinosa South Africa — MW834113 — — MW834191 MW834008 MW834276 MW834304 CBS 217.76 = BBA 11341 = BBA 63624 = DAOM Cattleya sp. Germany — KF466333 U34558 U34529 JX171504 JX171617 AF160280 KF466443 Solanum sp. Ghana — AF158324 — — LT996204 LT996151 AF160271 U34427 Hordeum vulgare Australia — — DQ459871 DQ459871 JX171524 JX171637 AF212468 — Pennisetum typhoides Nigeria — AF158316 — — LT996205 LT996152 AF160263 U34421 Ficus carica USA — KF466335 — — KF466401 KF466412 KF466423 KF466445 Pseudotsuga menziesii Canada — — U34565 U34536 JX171503 JX171616 MT409452 — 225133 = IMI 202873 = IMI 375339 = NRRL 22944 F. pseudocircinatum CBS 449.97T = ATCC 24379 = BBA 69636 = CBS 126.73 = IMI 105384 = NRRL 22946 F. pseudograminearum F. pseudonygamai CBS 109956T = NRRL 28062 T CBS 417.97 = BBA 69552 = FRC M-1166 = IMI F. ramigenum CBS 418.98T = BBA 68592 = DAOM 225137 = IMI 375343 = NRRL 25208 CBS 743.97 = DAOM 225128 = IMI 375334 = NRRL 22901 21 (continued on next page) REDELIMITED F. redolens FUSARIUM 375342 = NRRL 13592 CROUS 22 Table 3. (Continued). F. sacchari Strain1 Substrate CBS 223.76ET = BBA 63340 = DAOM 225138 = IMI ET AL. Species name GenBank accession number2 Country acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2 Saccharum officinarum India — AF158331 — — JX171466 JX171580 AF160278 U34414 Solanum tuberosum England — — — — JX171493 JX171606 MW834277 — 202881 = NRRL 13999 F. sambucinum CBS 146.95 = BBA 64226 = NRRL 22187 = NRRL 20727 F. sarcochroum CBS 745.79 = BBA 63714 = NRRL 20472 Viscum album Switzerland — — MW827611 MW827651 JX171472 JX171586 MW834278 — F. scirpi NRRL 13402 Soil Australia — — GQ505681 GQ505681 JX171452 JX171566 GQ505592 — F. sororula CBS 137242T = CMW 40578 Pinus patula Colombia — LT996184 — — LT996206 LT996153 KJ541067 KJ541057 Fusarium sp. CBS 102163 = GJS 84-426 Bamboo Venezuela — — KM231812 KM231681 MW834193 MW834009 KM231940 — F. sterilihyposum NRRL 25623 Mango South Africa — AF158353 — — MW402713 MN193897 AF160300 AF160316 F. stilboides NRRL 20429 = ATCC 15662 Coffea sp. Nyasaland — — — — JX171468 JX171582 — — Zea mays USA — AF158342 — — JX171486 JX171599 AF160289 U34417 Soil Costa Rica — — HQ897830 KM231680 JX171451 JX171565 — — Succisa pratensis Germany — AF158344 — — LT996207 LT996154 AF160291 U34419 Striga hermonthica Sudan — LT996185 — — LT996208 LT996155 KU711697 KU603909 F. subglutinans CBS 747.97 ET = BBA 62451 = DAOM 225141 = FRC M-36 = MRC 8554 = NRRL 22016 = NRRL 22114 F. sublunatum CBS 189.34T = BBA 62431 = DSM 62431 = NRRL 20840 = NRRL 13384 F. succisae CBS 219.76ET = BBA 12287 = BBA 63627 = DAOM 225142 = IMI 202876 = IMI 375347 = NRRL 13613 F. sudanense CBS 454.97T = BBA 65862 = NRRL 25451 = NRRL 26793 F. temperatum NRRL 25622 = NRRL 26616 Zea mays South Africa — AF158354 — — Not public Not public AF160301 AF160317 F. terricola CBS 483.94T = FRC M-1650 Soil Australia — KU603951 — — LT996209 LT996156 KU711698 KU603908 F. thapsinum CBS 733.97 = DAOM 225109 = IMI 375317 = MRC Sorghum bicolor South Africa — LT996186 — — JX171487 JX171600 AF160270 U34418 6002 = NRRL 22045 F. tjaetaba CBS 144400T = NRRL 66243 = RBG 5361 Sorghum interjectum Australia — LT996187 — — MW834192 KP083275 KP083263 GU737296 F. torreyae CBS 133858T = NRRL 54151 Torreya sp. USA — — HM068344 MW827652 JX171548 JX171660 HM068337 — ET F. tricinctum CBS 393.93 Winter wheat culm base Germany — — HM068317 HM068317 JX171516 JX171629 AB674263 — F. tupiense NRRL 53984 Mangifera indica Brazil — GU737377 — — LR792583 LR792619 GU737404 GU737296 F. udum CBS 178.32 = BBA 1813 = DAOM 225111 = IMI Lactarius pubescens Germany — AF158328 — — LT996220 LT996172 AF160275 U34433 = BBA 64485 = NRRL 25481 375319 = NRRL 22949 F. venenatum NRRL 22196 = BBA 65031 Zea mays Germany — — — — JX171494 JX171607 — — F. verticillioides CBS 734.97 = BBA 62264 = IMI 375318 = NRRL Zea mays Germany — AF158315 — — LT996221 EF470122 AF160262 U34413 F. xylarioides CBS 258.52ET = NRRL 25486 22172 Fusicolla acetilerea Coffea sp. Ivory Coast — — — — JX171517 HM068355 AY707136 AY707118 Polluted soil Japan — — HQ897790 U88108 — HQ897701 — — Table 3. (Continued). Species name Strain1 Substrate GenBank accession number2 Country www.studiesinmycology.org acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2 T BBA 63789 = IMI 181488 = NRRL 20827 Fu. aquaeductuum BBA 63789 = IMI 181488 = NRRL 20827 Polluted soil Japan HQ897839 — HQ897790 U88108 — HQ897701 — — CBS 734.79 = BBA 63669 = NRRL 20686 Drinking water Germany — — MW827612 MW827653 JX171476 HQ897742 MW847905 — CBS 268.53 Rubber tubing Netherlands — — MH857190 MH868728 — — — — CBS 837.85ET =BBA 64559 = NRRL 20865 = NRRL Plug in water tap Germany — — KM231823 KM231699 — — — KM232094 BBA 64317ET Triticum aestivum Germany HQ897917 — MH855265 MH866717 — HQ897781 — — T Avicennia marina India — — MK152510 MK152511 — MK157022 — MK376462 Cassia fistula Thailand — — MT215497 MT215549 — — — — Diatrypella sp., on Betula sp. England HQ897901 — — AF228352 — HQ897765 — — 37595 Fu. betae Fu. bharatavarshae NFCCI 4423 Fu. cassiae-fistulae MFLUCC 19-0318T Fu. epistroma BBA 62201 ET = ATCC 24369 = IMI 85601 = NRRL 20439 = NRRL 20461 Fu. gigantispora Fu. matuoi HKAS 101990 Bruguiera sp. Thailand — — MN047106 MN017870 — — — — MFLU 161206T Avicennia marina Thailand — — MN047105 MN017876 — — — — CBS 581.78 = ATCC 18694 = MAFF 238445 = NRRL Albizzia julibrissin Japan HQ897858 — KM231822 KM231698 MW834194 HQ897720 KM231954 KM232093 Melogramma campylosporum on Carpinus sp. England — — KX897140 KY092489 — HQ897720 — MW834305 20427 Fu. melogrammae CBS 141092T Fu. meniscoidea CBS 110189 = FRC E-0086 Soil Australia MW834043 — MW827613 MW827654 — MW834010 MW834279 MW834306 Fu. merismoides CBS 186.34 = BBA 1867a = NRRL 20895 Acer sp. Germany — — MH855482 MH866963 — — — — Bone of wild boar Belgium — — MF628022 MF628021 — MW834011 MW834280 MW834307 Melocactus zehntneri Brazil — — MW553789 MW553788 — MW556626 MW556625 MW556624 T Fu. ossicola CBS 140161 Fu. quarantenae URM 8367T = CBS 141541 T Fu. septimanifiniscientiae CBS 144935 Soil Netherlands — — MK069422 MK069418 — — MK077808 MK069408 Fu. siamensis MFLUCC 17-2577T Cassia fistula Thailand — — MT215498 MT215550 — — — — Fu. sporellula CBS 110191 = FRC E-0139 Soil South Africa MW834044 — MW827614 MW827655 — MW834012 MW834281 MW834308 Fu. violacea CBS 634.76T = BBA 62461 = NRRL 20896 Quadraspidiotus perniciosus Iran — — KM231824 U88112 MW834195 HQ897696 KM231956 KM232095 Geejayessia atrofusca CBS 125482 = DAOM 238117 Staphylea trifolia Canada — — MH863592 MH875066 MW834196 HQ897775 MW834282 — NRRL 22316 Staphylea trifolia USA — — AF178423 AF178392 JX171496 EU329502 AF178361 — CBS 125502T Celtis occidentalis Canada HM626625 — HM626657 HM626669 MW834197 MW834013 HM626638 KM232074 G. cicatricum CBS 125550 Dead twig connected with alive Buxus sempervirens Slovenia — — HM626654 HM626666 MW834198 HQ897697 HM626642 — Dead twig Slovenia HQ728171 — HQ728145 MH875038 — HQ728153 HM626644 — var. elegantissima CBS 125552 T CBS 132815 Protea sp. South Africa — — NR_152887 NG_070049 MW834199 MW834014 JX231119 — I. destructans CBS 264.65 Cyclamen persicum Sweden — — MH858563 KM515927 — MW834015 JF735695 — Luteonectria albida CBS 102683 = GJS 99-73 = GJS 8522A Tree bark Costa Rica — — MW827615 MH874402 MW834200 MW834016 MW834283 — 23 (continued on next page) REDELIMITED Ilyonectria capensis FUSARIUM G. celtidicola CROUS 24 Table 3. (Continued). Strain1 Substrate GenBank accession number2 Country acl1 T L. nematophila Macroconia bulbipes ET AL. Species name CaM ITS LSU rpb1 rpb2 tef1 tub2 NRRL 22152 = NRRL 13950 Woody stem bark Jamaica — — JABFEP010000142.1* JABFEP010000142.1* JX171492 JX171605 JABFEP010002685.1* — NRRL 54600 Unknown Germany — — JABFFA010000104.1* JABFFA010000104.1* JX171552 JX171664 JABFFA010003988.1* — CBS 146678 = CPC 37137 Erica sp. associated with Dimerosporiopsis engleriana South Africa MW834045 MW834114 MW827616 MW827656 MW834201 MW834017 — MW834309 CBS 146679T = CPC 37138 Erica sp. associated with Dimerosporiopsis engleriana South Africa MW834046 MW834115 MW827617 MW827657 MW834202 MW834018 — MW834310 Stylodothis sp. on unidentified tree China — — EF121864 EF121870 — — — — Rotten stem of bamboo associated with other fungi China — — EF121853 EF121869 — — — — T Ma. cupularis HMAS 173240 Ma. gigas HMAS 173239T Ma. leptosphaeriae CBS 100001 Leptosphaeria on dead stem of Urtica dioica Netherlands HQ897891 MW834116 HQ897810 HQ897755 MW834203 HQ728164 KM231959 KM232097 Ma. papillionacearum CBS 125495 Ascomycete on Fabaceae USA HQ897912 MW834117 HQ897826 MH875086 MW834204 HQ897776 — KM232096 Ma. phlogioides Ma. sphaeriae Mariannaea elegans CBS 125496 Quercus sp., branch in stream USA HQ897868 MW834118 MW827618 MW827658 MW834205 HQ897732 MW834284 MW834311 CBS 146500 = CPC 35388 Encephalartos sp. leaf South Africa MW834047 MW834119 MW827619 MW827659 MW834206 MW834019 — MW834312 CBS 146501T = CPC 35389 Encephalartos sp. leaf South Africa MW834048 MW834120 MW827620 MW827660 MW834207 MW834020 — MW834313 CBS 717.74 Pyrenomycete on Coronilla emerus France MW834049 MW834121 MW827621 MW827661 — KM232390 — KM232099 CBS 112770 Cucurbitaria laburni on Laburnum anagyroides Austria KM231061 KM231413 MW827622 MW827662 MW834208 MW834021 — KM232098 DAOM 226709 Betula sp. Canada — — — HQ843768 — HQ897747 — — T M. samuelsii CBS 125515 = DAOM 235814 Soil Guatemala — — NR_137767 NG_060269 — HQ897752 — — Microcera coccophila CBS 310.34 = NRRL 13962 Scale insect Italy — — MH855540 KM231703 JX171462 JX171576 — — Mi. diploa CBS 735.79 = BBA 61173 = NRRL 36545 Quadraspidiotus perniciosus Iran — — MW827623 MW827663 JX171463 JX171577 — — Mi. larvarum CBS 738.79 = BBA 62239 = DSM 62239 = MUCL Quadraspidiotus perniciosus Iran — — KM231825 KM231701 JX171473 JX171587 KM231957 — Quadraspidiotus perniciosus on Prunus domestica Iran HQ897903 KM231409 MH861019 MH872790 — HQ897767 — MW834314 19033 = NRRL 20473 Mi. rubra CBS 638.76IT = BBA 62460 = NRRL 20475; NRRL 22111; NRRL 22170 Microcera sp. NRRL 26790 Parmelia rudecta USA — — — — JX171523 JX171636 — — Nectria cinnabarina CBS 125165ET Aesculus sp. France KM231074 — HM484548 HM484562 — KM232402 HM484527 — "Nt." flavoviridis CBS 124353 = BBA 65542 = NRRL 22093 Decorticated wood USA — — HQ897791 MW827664 MW834209 HQ897702 — — Neocosmospora acutispora CBS 145461T = NRRL 22574 = BBA 62213 Coffea arabica Guatemala MW834050 MW834122 LR583700 LR583908 MW834210 LR583814 LR583593 — CBS 146509 = CPC 37127 Citrus sinensis South Africa MW218004 MW218051 MW173041 MW173032 MW218097 MW446574 MW248740 — CBS 146510T = CPC 37128 Citrus sinensis South Africa MW218005 MW218052 MW173042 MW173033 MW218098 MW446575 MW248741 — Euwallacea fornicatus India — — EU329669 EU329669 MW834211 EU329503 FJ240350 — N. addoensis N. ambrosia CBS 571.94 ET = NRRL 22346 = BBA 65390 = MAFF 246287 N. ampla N. bataticola NRRL 20438 = IMI 296597 Xyleborus fornicatus India — — AF178397 AF178366 JX171470 JX171584 NIZV01000014.1* — CBS 202.32T = BBA 4170 Coffea sp. German East Africa MW834051 MW834123 LR583701 LR583909 MW834212 LR583815 LR583594 — CBS 144397 = NRRL 22400 = BBA 64683 Ipomoea batatas USA MW218006 MW218053 AF178407 AF178376 MW218099 EU329509 AF178343 — CBS 144398T = NRRL 22402 = BBA 64954 = FRC S- Ipomoea batatas USA MW218007 MW218054 AF178408 AF178377 MW218100 FJ240381 AF178344 — 0567 Table 3. (Continued). Species name www.studiesinmycology.org N. borneensis Strain1 Substrate CBS 145462ET = NRRL 22579 = BBA 65095 = GJS Bark or recently dead tree GenBank accession number2 Country Indonesia acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2 MW834052 MW834124 AF178415 AF178384 MW834213 EU329515 AF178352 — 85-197 CBS 144.25NT Soil Honduras MW218008 MW218055 LR583704 LR583912 MW218101 LR583818 LR583597 — CBS 392.66 = NRRL 25325 = BBA 69595 Bertholletia excelsa Unknown MW218009 MW218056 LR583705 LR583913 MW218102 LR583819 LR583598 — N. brevicona CBS 204.31ET = NRRL 22659 = BBA 2123 Gladiolus sp. Indonesia MW218010 MW218057 LR583707 LR583915 MW218103 LR583821 LR583600 — N. brevis CBS 130326 = NRRL 28009 = CDC B-5543 Human eye USA MW834053 MW834125 DQ094351 DQ236393 MW834214 EF470136 DQ246869 — CBS 143228 = NRRL 54992 = UTHSC 09-1008 Stegostoma fasciatum USA MW218011 MW218058 KC808255 KC808255 MW218104 KC808354 KC808213 — CBS 143229T = NRRL 54993 = UTHSC 09-1009 Stegostoma fasciatum USA MW218012 MW218059 KC808256 KC808256 MW218105 KC808355 KC808214 — N. bostrycoides N. catenata N. citricola CBS 146512 = CPC 37130 Citrus sinensis South Africa MW218014 MW218061 MW173047 MW173035 MW218107 MW446580 MW248746 — CBS 146513T = CPC 37131 Citrus sinensis South Africa MW218015 MW218062 MW173048 MW173036 MW218108 MW446581 MW248747 — T N. crassa CBS 144386 = MUCL 11420 Unknown France MW218016 MW218063 LR583709 LR583917 MW218109 LR583823 LR583604 — N. cryptoseptata CBS 145463T = NRRL 22412 = BBA 65024 Bark French Guiana MW834054 MW834126 AF178414 AF178383 MW834215 EU329510 AF178351 — CBS 410.62 = NRRL 22658 = CECT 2864 Cucurbita viciifolia Netherlands MW834055 MW834127 LR583710 LR583918 MW834216 LR583824 DQ247640 — CBS 616.66T = NRRL 22399 = BBA 64411 Cucurbita viciifolia Netherlands MW834056 MW834128 LR583711 LR583919 MW834217 LR583825 DQ247592 — N. cucurbitae CBS 518.82T Human foot Netherlands MW218017 MW218064 AB190389 LR583920 MW218110 LR583826 LR583605 — CBS 637.82 Human foot Netherlands MW218018 MW218065 LR583712 LR583921 MW218111 LR583827 LR583606 — N. diminuta CBS 144390T = MUCL 18798 Coelocaryon preusii Unknown MW834057 MW834129 LR583713 LR583922 MW834218 LR583828 LR583607 — N. elegans CBS 144395 = NRRL 22163 = MAFF 238540 = ATCC Xanthoxylum piperitum Japan MW218019 MW218066 AF178394 AF178363 MW218112 EU329496 AF178328 — Xanthoxylum piperitum Japan MW218020 MW218067 AF178401 AF178370 MW218113 FJ240380 AF178336 — N. cyanescens 18690 CBS 144396ET = NRRL 22277 = MAFF 238541 = ATCC 42366 CBS 146523T = CPC 38310 Bouvardia sp. imported from Uganda Netherlands MW834058 MW834130 MW827624 MW827665 MW834219 MW834022 MW834285 — CBS 146524 = CPC 38311 Bouvardia sp. imported from Uganda Netherlands MW834059 MW834131 MW827625 MW827666 MW834220 MW834023 MW834286 — N. euwallaceae CBS 135854T = NRRL 54722 Euwallacea sp. Israel — — JQ038014 JQ038014 JQ038021 JQ038028 JQ038007 — N. falciformis CBS 475.67T = IMI 268681 Human mycetoma Puerto Rico MW218021 MW218068 MG189935 MG189915 MW218114 LT960558 LT906669 — CBS 121450 Declined grape vine Syria MW218022 MW218069 JX435211 JX435211 MW218115 JX435261 JX435161 — NRRL 43529 = CDC 2006743575 Human cornea USA — — EF453117 EF453117 JX171541 JX171653 EF452965 — N. epipeda Switzerland MW834060 MW834132 DQ094446 DQ236488 MW834221 EU329581 DQ246979 — Citrus sinensis Italy MW834061 MW834133 LT746276 LT746276 MW834222 LT746341 LR583602 — N. floridana NRRL 62628T = MAFF 246849 Euwallacea interjectus USA — — KC691563 KC691563 KC691593 KC691624, KC691653 KC691535 — N. gamsii CBS 143207T = NRRL 32323 = UTHSC 99-205 Human bronchoalveolar lavage fluid USA MW834062 MW834134 DQ094420 DQ236462 MW834223 EU329622 DQ247103 — CBS 143211 = NRRL 32794 = FRC S-1152 Humidifier coolant USA MW834063 MW834135 DQ094563 DQ236605 MW834224 EU329576 DQ246951 — CBS 146502T = VG16 = CPC 37120 Citrus sinensis South Africa MW218023 MW218070 MW173063 MW173038 MW218116 MW446611 MW248762 — Dying tree Sri Lanka MW834064 MW834136 KM231797 KM231664 — LT960561 DQ247510 N. gamtoosensis N. haematococca ET CBS 119600 = FRC S-1832 — (continued on next page) 25 REDELIMITED Human subcutaneous nodule CPC 28194 FUSARIUM CBS 109028T = NRRL 32437 N. ferruginea CROUS 26 Table 3. (Continued). Strain1 Substrate GenBank accession number2 Country acl1 N. hypothenemi N. illudens ET AL. Species name CaM ITS LSU rpb1 rpb2 tef1 tub2 CBS 145464T = NRRL 52782 = ARSEF 5878 Hypothenemus hampei Benin MW218024 — LR583715 LR583923 MW218117 JF741176 JF740850 — CBS 145466 = NRRL 52783 = ARSEF 5879 Hypothenemus hampei Uganda MW218025 MW218071 MW827626 MW827667 MW218118 MW834024 MW834287 — CBS 147303 = NRRL 22090 = BBA 67606 = GJS 82- Beilschmiedia tawa New Zealand MW834065 MW834137 AF178393 AF178362 JX171488 JX171601 AF178326 — CBS 353.87 = NRRL 22657 Gerbera sp. Netherlands MW218026 MW218072 LR583717 LR583925 MW218119 LR583831 DQ247639 — CBS 833.97 Rosa sp. Netherlands MW218027 MW218073 LR583719 LR583927 MW218120 LR583833 LR583611 — = FRC S-1837 = GJS 02-114 Branch of unidentified tree Sri Lanka MW834066 MW834138 LR583720 LR583928 MW834225 LR583834 LR583612 — CBS 125722PT = FRC S-1836 = GJS 02-114 Branch of unidentified tree Sri Lanka MW834067 MW834139 JF433039 JF433039 MW834226 LR583835 DQ247515 — 98 N. ipomoeae N. keleraja N. keratoplastica CBS 125720 CBS 490.63 PT T CBS 144389 = MUCL 18301 T Human Japan MW218028 MW218074 LR583721 LR583929 MW218121 LT960562 LT906670 — Greenhouse humic soil Belgium MW218029 MW218075 LR583722 LR583930 MW218122 LR583836 LR583613 — N. kuroshio CBS 142642 Euwallacea sp. USA MW834068 MW834140 LR583723 LR583931 MW834227 LR583837 KX262216 — N. kurunegalensis CBS 119599T = GJS 02-94 Recently cut tree Sri Lanka MW834069 MW834141 JF433036 JF433036 MW834228 LR583838 DQ247511 — N. lerouxii CBS 146514T = CPC 37132 Citrus sinensis South Africa MW218030 MW218076 MW173069 MW173039 MW218123 MW446617 MW248768 — N. lichenicola CBS 509.63 = MUCL 8050 = IMUR 410 Air Brazil MW834070 MW834142 LR583728 LR583936 MW834229 LR583843 LR583618 — CBS 623.92ET Human Germany MW834071 MW834143 LR583730 LR583938 — LR583845 LR583620 — CBS 117481T = NRRL 22389 = BBA 67587 = GJS 91- Liriodendron tulipifera USA MW218031 MW218077 AF178404 AF178373 MW218124 EU329506 AF178340 — — N. liriodendri 148 N. longissima CBS 126407T = GJS 85-72 Tree bark New Zealand MW834072 MW834144 LR583731 LR583939 MW834230 LR583846 LR583621 N. macrospora CBS 142424T = CPC 28191 Citrus sinensis Italy MW218032 MW218078 LT746266 LT746281 MW218125 LT746331 LT746218 — CPC 28193 Citrus sinensis Italy MW218033 MW218079 LT746268 LT746283 MW218126 LT746333 LT746220 — Dead branch on live tree Sri Lanka MW834073 MW834145 JF433045 JF433045 MW834231 LT960563 DQ247513 — — N. mahasenii CBS 119594T ET N. martii CBS 115659 Solanum tuberosum Germany MW834074 MW834146 JX435206 JX435206 MW834232 JX435256 JX435156 N. merkxiana CBS 146525T Chrysanthemum sp. imported from Uganda Netherlands MW834075 MW834147 MW827627 MW827668 MW834233 MW834025 MW834288 — CBS 146526 Chrysanthemum sp. imported from Uganda Netherlands MW834076 MW834148 MW827628 MW827669 MW834234 MW834026 MW834289 — — = FRC S-0679 = MRC 2198 CBS 135789T Human pleural effusion Greece MW218034 MW218080 LR583738 LR583946 MW218127 LR583849 LR583627 CBS 143219 = NRRL 46708 = FMR 8634 Human foot Spain MW218035 MW218081 LR583744 LR583948 MW218128 LR583851 LR583629 — N. mori CBS 145467T = NRRL 22230 = MAFF 238539 Morus alba Japan MW834077 MW834149 DQ094305 DQ236347 MW834235 EU329499 AF178358 — CBS 145468 = NRRL 22157 = MAFF 238538 Morus alba Japan MW834078 MW834150 DQ094306 DQ236348 MW834236 EU329493 AF178359 — N. neerlandica CBS 232.34T Pisum sativum Netherlands MW834079 MW834151 MW827629 MW827670 MW834237 MW847903 MW847906 — T N. metavorans N. nelsonii CBS 309.75 Pisum sativum Unknown MW834080 MW834152 MW827630 MW827671 MW834238 MW847904 MW847907 — N. nirenbergiana CBS 145469T = NRRL 22387 = BBA 65023 = GJS 87- Bark French Guiana MW834081 MW834153 AF178403 AF178372 — EU329505 AF178339 — N. noneumartii CBS 115658T = FRC S-0661 Solanum tuberosum Israel MW218036 MW218082 LR583745 LR583949 MW218129 MW446618 LR583630 — N. obliquiseptata NRRL 62611 = MAFF 246845 Euwallacea sp. Australia — — KC691576 KC691576 KC691606 KC691637, KC691666 KC691548 — 127 Table 3. (Continued). Species name Strain1 Substrate GenBank accession number2 Country www.studiesinmycology.org acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2 N. oblonga CBS 130325T = NRRL 28008 = CDC B-4701 Human eye USA MW834082 MW834154 LR583746 LR583950 MW834239 LR583853 LR583631 — N. oligoseptata CBS 143241T = NRRL 62579 = FRC Euwallacea validus USA MW834083 MW834155 KC691566 KC691566 KC691596 LR583854 KC691538 — Solanum tuberosum Argentina MW834084 MW834156 LR583747 LR583951 MW834240 LR583855 DQ247549 — S-2581 = MAFF 246283 N. paraeumartii CBS 487.76T = NRRL 13997 = BBA 62215 T N. parceramosa CBS 115695 Soil South Africa MW218037 MW218083 JX435199 JX435199 — JX435249 JX435149 — N. perseae CBS 144142T = CPC 26829 Persea americana Italy MW218038 MW218084 LT991940 LT991947 MW218130 LT991909 LT991902 — N. petroliphila N. phaseoli N. piperis CBS 203.32 = NRRL 13952 Pelargonium sp. South Africa MW218039 MW218085 DQ094320 DQ236362 MW218131 LR583857 DQ246835 — CBS 224.34 = NRRL 28579 Human toenail Cuba MW218040 MW218086 DQ094383 DQ236425 MW218132 LR583858 DQ246910 — CBS 265.50 Phaseolus sp. USA MW834085 MW834157 LR583750 LR583954 — KJ511278 FJ919464 — NRRL 22276 = ATCC 38466 Phaseolus vulgaris USA — — EU329668 EU329668 JX171495 JX171608 AY220186 — CBS 145470T = NRRL 22570 = GJS Piper nigrum Brazil MW834086 MW834158 AF178422 AF178391 MW834241 EU329513 AF178360 — 89-14 = CML 1888 N. pisi CBS 123669ET = NRRL 45880 = ATCC MYA-4622 Progeny of parentals from Pisum sativum and soil USA MW834087 MW834159 LR583753 LR583957 MW834242 LR583862 LR583636 — CBS 142372 Trifolium subterraneum Germany MW834088 MW834160 LR583755 LR583959 MW834243 LR583864 KY556454 — — N. plagianthi NRRL 22632 = GJS 83-146 Hoheria glabrata New Zealand — — AF178417 AF178386 JX171501 JX171614 AF178354 N. protoensiformis CBS 145471T = NRRL 22178 = GJS 90-168 Dicot tree Venezuela MW834089 MW834161 AF178399 AF178368 MW834244 EU329498 AF178334 — N. pseudensiformis CBS 130.78 = NRRL 22575 = NRRL 22653 Cocos nucifera Indonesia MW834090 MW834162 LR583759 LR583963 MW834245 LR583868 DQ247635 — N. pseudopisi CBS 266.50 Pisum sativum Unknown MW834091 MW834163 MW827631 MW827672 MW834246 MW834027 MW834290 — N. pseudoradicicola CBS 145472T = NRRL 25137 = ARSEF 2313 Diseased cocoa pods Papua New Guinea MW218041 MW218087 JF740899 JF740899 MW218133 JF741084 JF740757 — T N. quercicola CBS 141.90 = NRRL 22652 Quercus cerris Italy MW834092 MW834164 LR583760 LR583964 MW834247 LR583869 DQ247634 — N. rectiphora CBS 125726 = FRC S-1842 Dead tree Sri Lanka MW834093 MW834165 JF433043 JF433043 MW834248 MW834028 JF433026 — N. regularis N. rekana CBS 125727T = GJS 02-89 = FRC S-1831 Dead tree Sri Lanka MW834094 MW834166 JF433034 JF433034 MW834249 LR583871 DQ247509 — CBS 190.35 Phaseolus sp. USA MW834095 MW834167 LR583762 LR583966 MW834250 LR583872 LR583642 — CBS 230.34T Pisum sativum Netherlands MW834096 MW834168 LR583763 LR583967 — MW834029 LR583643 — CMW 52862T Euwallacea perbrevis Indonesia — — MN249094 — — MN249137, MN249108 MN249151 — T CBS 145473 = NRRL 22395 = BBA 65682 Bark Venezuela — MW834169 AF178405 LR583968 MW834251 EU329507 AF178341 — CBS 114067T = GJS 89-70 Bark Guyana MW834097 MW834170 LR583764 LR583969 MW834252 LR583874 LR583644 — CBS 119601 = GJS 98-135 Populus nigra France MW834098 MW834171 LR583765 LR583970 MW834253 LR583875 LR583645 — CBS 123846T = GJS 04-147 Liriodendron tulipifera USA MW834099 MW834172 LR583766 LR583971 MW834254 LR583876 LR583646 — Solanum tuberosum Slovenia MW218042 MW218088 KT313633 KT313633 MW218134 KT313623 KT313611 — N. silvicola N. solani CBS 140079 ET = NRRL 66304 = GJS 09-1466 = FRC S-2364 CBS 145474T = NRRL 28541 = UTHSC 98-1305 Human synovial fluid USA MW218045 MW218091 EU329674 EU329674 MW218137 EU329542 DQ246882 — N. stercicola CBS 142481T = DSM 106211 Compost yard debris Germany MW834100 MW834173 LR583779 LR583984 MW834255 LR583887 LR583658 — (continued on next page) 27 REDELIMITED N. spathulata FUSARIUM N. robusta N. samuelsii CROUS 28 Table 3. (Continued). Strain1 Substrate GenBank accession number2 Country acl1 N. suttoniana N. tonkinensis N. tuaranensis ET AL. Species name CaM ITS LSU rpb1 rpb2 tef1 tub2 CBS 144388 = MUCL 18299 Greenhouse humic soil Belgium MW834101 MW834174 LR583780 LR583985 MW834256 LR583888 LR583659 — CBS 143214T = NRRL 32858 Human wound USA MW218046 MW218092 DQ094617 DQ236659 MW218138 EU329630 DQ247163 — CBS 143224 = NRRL 54972 Equine eye USA MW218047 MW218093 MG189940 MG189925 MW218139 KC808336 KC808197 — CBS 115.40T Musa sapientum Vietnam MW218048 MW218094 MG189941 MG189926 MW218140 LT960564 LT906672 — CBS 118931 Solanum lycopersicum UK MW218049 MW218095 LR583784 LR583989 MW218141 LR583891 LR583662 — Hevea brasiliensis damaged by unknown ambrosia Malaysia — — KC691570 KC691570 KC691600 KC691631, KC691660 KC691542 — South Africa — — AF178412 AF178381 JX171497 JX171610 AF178348 — NRRL 22231T = ATCC 16563 = MAFF 246842 beetle N. vasinfecta CBS 325.54 = ATCC 16238 = IFO 7591 = IMI Soil 251386 = NRRL 22436 CBS 446.93 = IMI 316967 = NHL 2919 Soil Japan MW834102 MW834175 LR583791 LR583996 MW834257 LR583898 LR583670 — CBS 533.65 = IMI 302625 Unknown India MW834103 MW834176 LR583792 LR583997 MW834258 LR583899 LR583671 — Neonectria coccinea CBS 125484 Fagus sylvatica Germany — — HQ897832 MH875068 MW834259 HQ897785 — — Ne. ditissima CBS 125486 Fagus americana Canada — — HQ897824 MH877864 — HQ897774 — — Nothofusarium devonianum CBS 147304T = NRRL 22134 Ruscus aculeatus United Kingdom — — MW827632 MW827673 JX171490 JX171603 MW834291 — Pseudofusicolla belgica CBS 147300 = IHEM 5322 Recycled water from air-conditioning humidifier Belgium — — KJ125590 KJ126478 — KP835473 KJ126182 — CBS 147301T = IHEM 2413 Recycled water, spray humidifier in air-conditioned Belgium — — KJ125588 KJ126476 — KP835474 KJ126180 — CBS 147302 = IHEM 2440 Humidifier water from air-conditioning Belgium — — KJ125589 KJ126477 — KP835475 KJ126181 — IHEM 2105 Recycled humidifier water from airconditioning Belgium — — KP835478 KP835480 — KP835476 KP835484 — building Rectifusarium robinianum CBS 430.91T = NRRL 25729 Robinia pseudoacacia Germany — — KM231794 NG_058096 JX171520 JX171633 KM231923 — R. ventricosum CBS 748.79T = BBA 62452 = NRRL 20846 = NRRL Wheat field soil Germany — — HQ897816 KM231658 JX171484 JX171597 KM231924 — Rugonectria castaneicola CBS 128360 Bark China — — MH864901 MH876352 MW834260 MW834030 MW834292 — 22113 Ru. neobalansae CBS 125120 = GJS 85-219 Dead tree Indonesia — — KM231750 HM364322 — MW834031 KM231874 — Ru. rugulosa CBS 126565 = GJS 09-1245 Dead wood Venezuela — — KM231749 MH877897 MW834261 MW834032 KM231873 — Setofusarium setosum Scolecofusarium ciliatum CBS 574.94 = BBA 65063 Unknown French Guiana — — MW827633 MW827674 MW834262 MW834033 MW834293 — CBS 635.92ET = GJS 88-12 = NRRL 36526 Tree bark French Guiana — — MW827634 MW827675 JX171539 JX171651 MW834294 — CBS 155.86 = NRRL 22284 Hordeum vulgare mouldy grain, associated with scale Denmark — — MW827635 MW827676 MW834263 MW834034 MW834295 — Germany — — MW827636 MW827677 MW834264 MW834035 MW834296 — insects CBS 191.65NT = ATCC 16068 = ATCC 24137 = BBA Fagus sylvatica 9661 = DSM 62172 = IMI 112499 = NRRL 20431 CBS 144385 = IHEM 2989 Fagus sylvatica Belgium — — KJ125591 KJ126479 MW834265 KP835472 MW834297 — CBS 125489 Unidentified ascomycete on Betula sp. Canada HQ897875 — HQ897805 KM231689 — HQ897739 KM231944 — St. carpini DAOM 235819 Melanconis spodiaea on Carpinus betulus Austria HQ897909 — HQ897823 — — HQ897773 — — St. corniculata CBS 125491T Unidentified ascomycete on Carpinus sp. Germany HQ897915 — HQ897829 KM231691 — HQ897779 KM231946 — Diaporthe sp. on Frangula alnus Ukraine MW834104 — MW827637 — — MW834036 — — Stylonectria applanata St. hetmanica T CBS 147305 = CPC 38725 Table 3. (Continued). Species name Strain1 Substrate GenBank accession number2 Country www.studiesinmycology.org acl1 St. norvegica CaM ITS LSU rpb1 rpb2 tef1 tub2 CBS 147306 = CPC 38848 Dothiorella sarmentorum on Acer platanoides Ukraine MW834105 — MW827638 — — MW834037 — — CBS 139239T Dead sporodochia of fusarium state on pyrenomycete Norway MW834106 — KR605485 — — MW834038 — — Norway MW834107 — MW827639 — — MW834039 — — Picea abies Germany HQ897919 — HQ897831 — — HQ897783 — — (presumably Amphiporthe sp.) CBS 139242 On sporodochia of fusarium-like on unidentified pyrenomycete St. purtonii DAOM 235818 T St. qilianshanensis HMAS 255803 Unknown ascomycete on Picea asperata China MT087289 — — — — MT087288 — — St. wegelianiana CBS 125490 Hapalycystis bicaudata on Ulmus glabra Austria HQ897890 — KM231817 KM231690 — HQ897754 KM231945 — Thelonectria discophora CBS 125487 Aesculus hippocastanum Germany — — HQ897789 MW827678 MW834266 HQ897700 MW834298 — T. olida CBS 215.67NT = ATCC 16548 = DSM 62520 = IMI Asparagus officinalis Germany — — MW827640 MW827679 MW834267 MW834040 MW834299 — 116873 Tumenectria laetidisca CBS 100284 Bamboo Japan — — KJ022017 KJ022066 — MW834041 KJ022400 — CBS 101909ET Bamboo Jamaica — — KJ022018 KJ022067 MW834268 MW834042 KJ022401 — 1 ARSEF: Collection of entomopathogenic fungal cultures, US Department of Agriculture (USDA), Agricultural Research Service (ARS), Ithaca, NY, USA; ATCC: American Type Culture Collection, Manassas, VA, USA; BBA: Biologische Bundesanstalt für Land- und Forstwirtschaft, Institut für Mikrobiologie, Berlin, Germany; CBS: Westerdijk Fungal Biodiverity Institute (WI), Utrecht, The Netherlands; CDC: Centers for Disease Control and Prevention, Atlanta, GA, USA; CECT: Spanish Type Culture Collection, Universidad de Valencia, Burjassot, Spain; CML: Coleç~ao Micol
ogica de Lavras, Universidade Federal de Lavras, Minas Gerais, Brazil; CMW: Culture collection at the FABI, University of Pretoria, South Africa; CPC: Collection of P.W. Crous, held at WI; DAOM: Canadian National Mycological Herbarium and Culture Collection, AAFC, Ottawa, Ontario, Canada; DSM: DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig, Germany; FMR: Facultat de Medicina i Ciencies de la Salut, Reus, Spain; FRC: Fusarium Research Center, Pennsylvannia State University, PA, USA; GJS: Collection of G.J. Samuels, USDA-ARS, USA; HKAS: Herbarium of Cryptogams, Kunming Institute of Botany, Kunming, China; HMAS: Herbarium Mycologicum Academiae Sinicae, Chinese Academy of Sciences, Beijing, China; IFO: Institute for Fermentation, Osaka, Yodogawa-ku, Osaka, Japan; IHEM: Biomedical Fungi and Yeasts Collection, Scientific Institute of Public Health, Belgium; IMI: CABI Bioscience, Egham, UK; IMUR: Institute of Mycology, University of Recife, Recife, Brazil; MAFF: Ministry of Agriculture, Forestry and Fisheries, Tsukuba, Ibaraki, Japan; MFLU: Mae Fah Luang University herbarium, Chiang Rai, Thailand; MRC: Microbial Culture Collection, South African Medical Research Council, Tygerberg, South Africa; MUCL: Mycotheque de
lUniversit
e Catholique de Louvain, Louvain-la-Neuve, Belgium; NHL: National Institute of Hygienic Sciences, Tokyo, Japan; NRRL: Agricultural Research Service Culture Collection, National Center for Agricultural Utilization Research, USDA, Peoria, IL, USA; RBG: Royal Botanic Gardens Trust, Sydney, New South Wales, Australia; URM: Micoteca do Departmento de Micologia, Universidade Federal de Pernambuco, Recife, Brazil; UTHSC: Fungus Testing Laboratory, Department of Pathology, University of Texas Health Science Center, San Antonio, USA. ET: Ex-epitype; IT: Ex-isotype; NT: Exneotype; PT: Ex-paratype; T: Ex-type. 2 acl1 = ATP citrate lyase; CaM = Calmodulin; ITS = Internal transcribed spacer region of the nrDNA; LSU = 28S large subunit of the nrDNA; rpb1 = RNA polymerase largest subunit; rpb2 = RNA polymerase second largest subunit; tef1 = translation elongation factor 1-alpha; tub2 = Beta-tubulin. Sequences generated in this study are shown in bold; Not public = sequences not available at GenBank, obtained from K. O’Donnell's alignment datasets; * = Whole genome sequence contig accession numbers. FUSARIUM REDELIMITED 29 CROUS ET AL. Table 4. Summary of phylogenetic information generated in this study. Analysis Nuclear region Length + gap PI Var. BI unique site patterns Model (AIC) Model (BIC) ML -InL (IQ) Generic delimitation ITS LSU rpb1 rpb2 tef1 Combined 626 435 1 371 1 761 699 4 892 249 90 705 834 448 2 326 310 109 755 892 489 2 555 378 118 823 989 551 2 859 GTR+I+G GTR+I+G GTR+I+G GTR+I+G GTR+I+G n/d TIMe+I+G4 TIM2+F+I+G4 TIM3e+I+G4 GTR+F+I+G4 TIM2e+I+G4 n/d -3099.276 -15223.682 -27263.487 -8493.378 -40875.16 -94954.982 Ex-type strains rpb1 rpb2 tef1 Combined 1 724 1 789 859 4 372 980 788 463 2 231 550 916 301 1 767 1 358 1 056 700 3 114 GTR+I+G GTR+I+G GTR+I+G n/d TIM3e+R4 TIM2e+R6 GTR+F+I+G4 n/d -37377.092 -44286.314 -25546.628 -113450.62 Fusarium fujikuroi species complex CaM rpb1 rpb2 tef1 tub2 Combined 545 1 534 1 541 676 488 4 794 76 201 241 137 76 731 131 340 362 243 150 1 226 150 344 365 305 182 1 346 SYM+G SYM+G GTR+I+G GTR+I+G SYM+G n/d G4TNe+G4 TIM2e+G4 TNe+G4 TNe+I+G4 TNe+G4 n/d -4032.663 -5669.761 -7415.729 -2062.906 -1930.688 -22043.423 Fusicolla acl1 ITS LSU rpb2 tef1 tub2 Combined 908 518 476 1 702 476 484 4 564 153 54 34 258 109 83 691 346 111 69 447 216 162 1 351 241 128 72 359 202 159 1 161 GTR+G GTR+I+G K80+I SYM+I+G SYM+I GTR+G n/d TNe+I TIM2e+I+G4 K80+R2 TIM2e+G4 TIM2+F+G4 K80+G4 n/d -3238.214 -1704.698 -1229.69 -5692.247 -2051.471 -1780.157 -16092.82 Macroconia acl1 CaM ITS LSU rpb1 rpb2 tub2 Combined 801 551 540 694 814 778 519 4 697 207 150 36 21 116 160 101 791 332 223 64 37 182 618 168 1 624 205 159 94 3 96 151 142 850 SYM+I K80+I GTR+I GTR+I SYM+G SYM+I SYM+G n/d K80+I K80+I TNe+G4 TNe+I TNe+G4 TNe+G4 TNe+G4 n/d -1241.031 -2092.487 -2259.518 -3097.338 -2620.526 -1784.381 -1205.535 -14388.257 Neocosmospora acl1 CaM ITS LSU rpb1 rpb2 tef1 Combined 630 586 476 482 1 492 1 613 688 5 967 173 171 119 36 390 449 230 1 568 271 231 357 63 506 564 323 2 315 297 280 211 76 636 621 370 2 491 K80+I+G HKY+I+G GTR+I+G GTR+I+G GTR+I+G GTR+I+G GTR+I+G n/d TIM3e+I+G4 TIM2e+R3 TNe+G4 TIM3e+I+G4 TIM2e+R3 TIM2e+I+G4 K80+G4 n/d -13572.514 -5595.928 -4164.678 -10056.777 -2888.743 -1496.116 -4087.046 -46528.083 Stylonectria acl1 ITS rpb2 Combined 897 544 1 631 3 072 254 21 183 458 426 39 442 907 416 47 299 762 GTR+G HKY+I GTR+G n/d K80+I TNe+G4 TNe+G4 n/d -1022.317 -5181.494 -4061.543 -10441.718 PI = parsimony informative characters; Var. = variable characters; BI = Bayesian inference; Model (AIC) = evolutionary model selected by MrModeltest; Model (BIC) = evolutionary model selected by ModelFinder in IQ-TREE; ML -InL (R) = best tree score determined using RAxML; ML -InL(IQ) = best tree score determined in IQTREE. F = Empirical base frequencies; G = Rate of discrete Gamma categories; GTR = General time reversible model; HKY = Unequal transition/transversion rates and unequal base frequencies; I = Proportion of invariable sites; K80 = Unequal transition/transversion rates and equal base frequencies; R = FreeRate model; SYM = Symmetric model; TIM2 = Transition model, AC = AT, CG = GT and unequal base frequencies; TIM2e = TIM2 with equal base frequencies; TIM3e = Transition model, AC = CG, AT = GT with equal base frequencies; TNe = Unequal transition/transversion rates with unequal purine/pyrimidine rates and equal base frequencies; TPM2 = AC = AT, AG = CT, CG = GT and equal base frequencies. generalized time-reversible (GTR) model and applying the partitioning option, which estimates the Gamma-shape parameter and the proportion of invariable sites for every gene separately. Again 1 000 bootstraps were calculated to estimate branch support. Bayesian inference was conducted using MrBayes v. 3.2.7 (Ronquist & Huelsenbeck 2003) with the partitioned dataset. The Gamma-shape parameter and proportion of invariable sites were estimated independently for each partition. MrBayes was run for 5 M generations with every 500th tree sampled and a burn-in of 30 % of the sampled trees to ensure sampling from the stationary phase. All other parameters were set to default. 30 Morphology Morphological characterisation followed standard procedures as described by Leslie & Summerell (2006) using PDA, SNA (Nirenberg 1976), and CLA (Fisher et al. 1982). Colony morphology and pigmentation were evaluated on PDA after 7 to 14 d at 25 °C in darkness. Colour notation was based on the colour charts of Rayner (1970). Fungarium specimens were rehydrated in 3 % aqueous KOH for a few minutes and then rinsed by replacing the KOH solution with sterile distilled water or 100 % lactic acid (Samuels 1976a, b, Samuels et al. 1990). Unless otherwise mentioned, micromorphological characters FUSARIUM were examined using water as mounting medium on a Zeiss Axioskop 2 plus or a Nikon Eclipse 80i, both equipped with Differential Interference Contrast (DIC) optics and a Nikon AZ100 dissecting microscope all fitted with Nikon DS-Ri2 highdefinition colour digital cameras to photo-document fungal structures. Measurements were taken using the Nikon software NIS-elements D v. 4.50. The dimensions of at least 30 randomly selected elements were recorded for every fungal structure. Average, standard deviation, and maximum– minimum values were determined for elements using five or more individual measurements. To facilitate the comparison of relevant micro- and macroconidial features, composite photo plates were assembled from separate photo micrographs using Adobe Photoshop CC. RESULTS DNA phylogeny The results of DNA evolutionary model selection, alignment length, and composition as well as tree statistics for all the multimarker datasets included in this study are summarised in Table 4. Re-analysis of the dataset of Geiser et al. (2021): A reanalysis of the dataset of Geiser et al. (2021) revealed no major differences in the ML analysis. However, in ME analysis (Supplementary Fig. S3), we found that the backbone architecture is less solid than previously thought and a large monophyletic clade containing Neocosmospora, Albonectria, and several other genera formed as sister group to Fusarium s. str. with strong support. Generic delimitation of fusarioid taxa in Nectriaceae: The analyses included nectriaceous taxa historically ascribed to Fusarium s. lat., including several recently segregated fusarioid genera (Gr€afenhan et al. 2011, Schroers et al. 2011, Lombard et al. 2015), cylindrocarpon-like taxa (Chaverri et al. 2011), and the closely related – although morphologically distinct – phylogenetic relatives Cosmospora and Mariannaea. Analyses using ML and BI of the individual genes and combined datasets resulted in phylogenies with congruent topologies. Therefore, only IQ-TREE-ML topologies are presented with RAxML-BS, UFboot2-BS, BI-PP and gCF support values superimposed (Fig. 7). The combined alignment of ITS, LSU, rpb1, rpb2 and tef1 comprised 100 strains representing 92 species, including the outgroup Nectria cinnabarina (CBS 125165). Phylogenetic analyses resolved 27 monophyletic genera, of which 19 contain taxa with fusarioid asexual morphs and nectria- or cosmospora-like sexual morphs. Of these, 15 clades represent currently described genera, namely Albonectria, Atractium, Bisifusarium, Cosmosporella, Cyanonectria, Dialonectria, Fusarium, Fusicolla, Geejayessia, Macroconia, Microcera, Neocosmospora, Pseudofusicolla, Rectifusarium, and Stylonectria. The fusarioid genera Cosmosporella and Dialonectria, both of which have cosmospora-like sexual morphs, clustered as sister clades to Cosmospora; the latter, however, differ by having acremoniumlike asexual morphs. The remaining four clades with fusarioid morphology represent undescribed taxa, formally described here as the new genera Luteonectria, Nothofusarium, Scolecofusarium, and Setofusarium. A strongly supported clade comprising six cylindrocarpon-like genera (Corinectria, Ilyonectria, Neonectria, Rugonectria, Thelonectria, and Tumenectria) www.studiesinmycology.org REDELIMITED and the genus Mariannaea resolved as successive sister groups to the F1 node. Twenty-four out of the 27 genera included in the analysis resolved as fully supported clades, including all but one (Nothofusarium with RAxML-BS = 99 % / UFboot-BS = 92 % / PP = 1) of the fusarioid genera (Fig. 7). The two remaining clades (Cosmospora and Neonectria), however, received high statistical support (RAxML-BS = 99 % / UFboot-BS = 100 % / PP = 1 and RAxML-BS = 92 % / UFboot-BS = 95 % / PP = 1, respectively). Similarly, the combined phylogeny resolved most of the internal nodes with high to full bootstrap and Bayesian PP support including the nodes F1, F2, and F3 sensu Geiser et al. (2013, 2021) and O'Donnell et al. (2013, 2020). Nevertheless, only F3 was resolved with confidence by all the individual marker phylogenies (Supplementary Fig. S4). Node F2 was resolved with high statistical support in the ITS, rpb1, and tef1 phylogenies, but unsupported in the LSU and rpb2 trees, while node F1 resolved without bootstrap and PP support in the ITS, rpb1, rpb2, and tef1 phylogenies and was not recovered in the LSU tree. To illustrate shared and differential morphological characters among the different genera recognised here, a tree was constructed based on the phylogeny presented in Fig. 7, and the main morphological features were plotted for each clade/genus (Fig. 8). In addition to the genera recognised above, the recently described aquatic fusarioid genus Varicosporella (Lechat & Fournier 2015) is not included in the phylogenetic analyses due to lack of available sequences; however, is accepted here based on its distinct morphology. Non-molecular character variation supports the phylogenetic relationship of fusarioid taxa in Nectriaceae. The 20 fusarioid genera in Nectriaceae are characterised by phialidic asexual morphs with variously septate, falcate conidia with diverse degrees of foot-shaped basal cell development, formed on aerial or sporodochial conidiophores, with or without additional production of microconidia. Characteristic macroconidial foot-shaped basal cells are found most of the time, but not always (e.g., Fusarium caeruleum) in clade F1, i.e., Albonectria, Bisifusarium, Cyanonectria, Fusarium, Geejayessia, Luteonectria, Neocosmospora, Nothofusarium, Rectifusarium, and Setofusarium, but are also present in distantly related genera such as Cosmosporella, Dialonectria, Macroconia, and Microcera. Setofusarium is clearly recognisable by the formation of thick-walled, slightly rugose setae on its sporodochia. With the exception of Atractium, Bisifusarium, Nothofusarium, and Pseudofusicolla, most fusarioid genera have sexual morphs, usually seen as nectria-like or cosmospora-like perithecial ascomata. The ascomata show various colour reactions or no reaction in KOH; the colour reaction correlates with the phylogenetic distribution. Apart from Albonectria, with white to pale yellow perithecia, Luteonectria, with white to buff coloured perithecia and Fusarium, with dark blue-violet to black perithecia, Fusicolla, with yellow-orange perithecia and Varicosporella, with yellow perithecia, the rest of fusarioid genera all present orange to red perithecial ascomata. Going beyond this prototypical group, perithecia of Cyanonectria species are often unequally red to dark blue, while those of Geejayessia can be bright red or black. Anatomically, two types of perithecial walls can be distinguished among the known fusarioid genera, based on wall thickness: thin-walled perithecia, in which a single region can be identified, and thick-walled perithecia, on which distinctive inner and outer regions can be recognised (but see Schroers et al. 2011 for differing interpretations). The former is seen in Cosmosporella, Cyanonectria, Dialonectria, Fusicolla, Geejayessia, 31 CROUS 32 ET AL. FUSARIUM Luteonectria, Macroconia, Microcera, Scolecofusarium, and Varicosporella; and the latter is found in Albonectria, Fusarium, Neocosmospora, Rectifusarium, Setofusarium and Stylonectria. With the exception of Rectifusarium and Stylonectria, the perithecial surface of the thick-walled genera is typically warted; nevertheless, those of Setofusarium often present additional scaly protrusions, while smooth perithecia can be rarely found in Neocosmospora (i.e., N. vasinfecta). Additionally, both Cyanonectria and Geejayessia most commonly have smooth perithecial walls. The remaining genera, that is Cosmosporella, Dialonectria, Fusicolla, Luteonectria, Macroconia, Microcera, Rectifusarium, Scolecofusarium, Stylonectria, and Varicosporella, all form smooth-walled perithecia. Significant variation also exists among fusarioid genera regarding ascospore characteristics. Most genera consistently form 1-septate ascospores. These are seen in Cosmosporella, Cyanonectria, Dialonectria, Fusicolla, Geejayessia, Macroconia, Microcera, Rectifusarium, Scolecofusarium, Setofusarium, Stylonectria, and Varicosporella. Except for Cyanonectria, in which the ascospores remain hyaline and smooth; Setofusarium, in which the ascospores surface is finely striated, and Varicosporella, in which the ascospore surface is ribbed, ascospores of the above-mentioned genera are often pale yellow to pale brown and smooth at first, becoming finely spinulose or tuberculate. The genus Neocosmospora forms (0–)1-septate, yellow-brown ascospores, which are often markedly striate, or more rarely cerebriform (i.e., N. vasinfecta) or spiny (i.e., N. spinulosa). Albonectria and Luteonectria form characteristic 3-septate, pale yellow-brown, faintly striate ascospores, while Fusarium produces 1–3-septate, hyaline to pale yellow-brown and smooth ascospores. Based on the morphological variation observed in these taxa, an identification scheme is presented for fusarioid genera of the Nectriaceae (Fig. 9). Ex-type strain phylogeny: The analyses included partial rpb1, rpb2 and tef1 sequences of only the ex-, epi- and neotype strains as indicated in the nomenclator list of all the names that have been introduced in Fusarium. The analyses used both ML inferences and BI of the individual genes and combined datasets, and they resulted in phylogenies with congruent topologies. Therefore, the RAxML topology is presented with RAxML-BS, UFboot2-BS, BIPP and gCF support values superimposed (Fig. 10). The combined alignment comprised 325 strains from 309 species of 14 fusarioid genera including Atractium stilbaster (CBS 410.67) as the outgroup. A total of 14 fusarioid genera were resolved of which six (Cosmosporella, Microcera, Nothofusarium, Rectifusarium, Scolecofusarium, and Setofusarium) were represented by single lineages, mostly due to a lack of living isolates directly linked to type material available for other species recognised within these genera at present. The genera Fusarium (224 strains; 220 accepted species) and Neocosmospora (83 strains; 71 accepted species) both represented the largest sampling of living isolates directly linked to type material available. The remaining five genera were represented by two or more strains and include Bisifusarium (five species and REDELIMITED strains), Cyanonectria (two species and strains), Fusicolla (three species and strains), Geejayessia (two species and strains), and Luteonectria (two species and strains). In order to describe novel species found for the genera treated in this study, additional phylogenies were constructed for the Fusarium fujikuroi species complex (FFSC), Fusicolla, Macroconia, Neocosmospora, and Stylonectria. Fusarium fujikuroi SC phylogeny: The analyses included partial sequences of five genes (CaM, rpb1, rpb2, tef1 and tub2) from 52 strains representing 46 species of the FFSC, and two outgroup taxa (F. curvatum CBS 744.97 and F. inflexum CBS 716.74) (Fig. 11). The analysis of the combined dataset fully supported five main clades corresponding to the African, American and Asian clades sensu O'Donnell et al. (2000b), plus the African B-clade (Sandoval-Denis et al. 2018b, Yilmaz et al. 2021) and a fifth, monotypic clade, which formed the sister clade to the joint American and African B clades and which is here termed African C. The latter clade included two strains showing a clear genealogical and morphological separation from their closest phylogenetic relatives; both came from an unknown tree species in South Africa. This clade is here described as the novel species F. echinatum. Another fully supported novel monophyletic group was found within the main African clade, related to but distinct from F. brevicatenulatum and F. pseudonygamai. This novel group, represented by isolates of South African origin isolated from Prunus spinosa and from the South African indigenous species Aloidendron dichotomum, is here recognised as the novel species F. prieskaense. Fusicolla phylogeny: The alignment consisted of partial acl1, ITS, LSU, rpb2, tef1, and tub2 sequences from 20 type or reference strains, representing 17 species of Fusicolla (Fu.) plus one outgroup taxon (Macroconia leptosphaeriae CBS 100001). The analysis confidently resolved 11 ingroup taxa (Fig. 12), including three novel monotypic lineages, represented by strains URM 8367, CBS 110189, and CBS 110191, described here as the new species Fu. quarantenae, Fu. meniscoidea and Fu. sporellula. Due to a partial lack of sequence data, six species could not be clearly resolved. Fusicolla cassiae-fistulae and Fu. siamensis did not receive statistical support in the combined analysis but are well-resolved using nrDNA sequence data (data not shown). Fusicolla acetilerea and Fu. bharatavarshae, while well-delimited in the individual ITS, LSU and rpb2 analyses (data not shown), were ill-supported in the 6-marker combined analysis. Similarly, Fu. epistroma and Fu. ossicola were not differentiated in either the multimarker analysis, or in the individual rpb2 analysis. The lack of sequences available to allow comparison with Fu. epistroma, for which only LSU and rpb2 sequences are available, prevented further analysis, as did a similar problem with Fu. bharatavarshae, for which only nrDNA and rpb2 are available. Macroconia phylogeny: The analysis consisted of partial acl1, CaM, ITS, LSU, rpb1, rpb2, and tub2 sequences from 12 strains representing seven lineages of Macroconia (Ma.) plus one outgroup taxon (Microcera rubra CBS 638.76) (Fig. 13). Four out of Fig. 7. Maximum-Likelihood (IQ-TREE-ML) consensus tree inferred from the combined ITS, LSU, rpb1, rpb2 and tef1 multiple sequence alignment of members of Nectriaceae. Numbers at the branches indicate support values (RAxML-BS / UFboot2-BS / BI-PP / gCF) above 70 % / 0.95 with thickened branches indicating full support (RAxML-BS / UFboot2-BS / gCF = 100 %; BI-PP = 1). The scale bar indicates expected changes per site. The tree is rooted to Nectria cinnabarina (CBS 125165). Arrows “F1”, “F2” and “F3” indicate the three alternative Fusarium hypotheses sensu Geiser et al. (2013). Ex-epitype, ex-isotype, ex-neotype and ex-type strains are indicated with ET, IT, NT, and T, respectively. www.studiesinmycology.org 33 CROUS 34 ET AL. FUSARIUM REDELIMITED Fig. 8. (Continued). www.studiesinmycology.org 35 CROUS ET AL. Fig. 8. (Continued). 36 FUSARIUM REDELIMITED Fig. 8. Morphological features and phylogenetic affinities of fusarioid genera of Nectriaceae and close relatives. The tree was delineated based on the phylogeny presented in Fig. 7 and does not indicate phylogenetic distances. Fully supported branches are indicated in bold. The genus Fusarium is indicated in blue. Arrows “F1”, “F2” and “F3” indicate the three alternative Fusarium hypotheses sensu Geiser et al. (2013). Fusarium. A, B. Ascomata. C–E. Ascospores. F, G. Conidiogenous cells. H–J. Macroconidia. (B. Adapted from Schroers et al. 2011). Cyanonectria. A, B. Ascomata. C–E. Ascospores. F. Conidiogenous cells. G. Macroconidia. Neocosmospora. A, B. Ascomata. C–E. Ascospores. F, G. Conidiogenous cells. H, I. Macroconidia. [A. Adapted from Sandoval-Denis & Crous (2018). G. Adapted from Sandoval-Denis et al. (2019)]. Albonectria. A, B. Ascomata. C–E. Ascospores. F, G. Conidiophores and conidiogenous cells. H. Macroconidia. Setofusarium. A, B. Ascomata. C–E. Ascospores. F–H. Setae formed on sporodochia. I. Conidiophore. J. Conidia. Geejayessia. A, B. Ascomata. C–E. Ascospores. F, G. Conidiophores and conidiogenous cells. H, I. Macroconidia. [A. Adapted from Schroers et al. (2011)]. Nothofusarium. A–D. Conidiophores and conidiogenous cells. E. Conidia. Luteonectria. A, B. Ascomata. C–D. Ascospores. F, G. Conidiophores and conidiogenous cells. H. Conidia. Rectifusarium. A–D. Conidiophores and conidiogenous cells. E, F. Conidia. Bisifusarium. A–D. Conidiophores and conidiogenous cells. E, F. Conidia. Mariannaea. A, B. Conidiophores. C, D. Conidiogenous cells. E. Conidia. Tumenectria. A, B. Ascomata. C. Ascospores. D, E. Conidiophores and conidiogenous cells. F. Conidia. [A–C. Adapted from Salgado-Salazar et al. (2016)]. Rugonectria. A, B. Ascomata. C–E. Ascospores. F, G. Conidiophores and conidiogenous cells. H. Conidia. Thelonectria. A, B. Ascomata. C, D. Ascospores. E, F. Conidiophores and conidiogenous cells. G. Conidia. Corinectria. A, B. Ascomata. C–E. Ascospores. F, G. Conidiophores and conidiogenous cells. H. Conidia. (H. Picture by C. Gonz
alez). Neonectria. A, B. Ascomata. C, D. Ascospores. E, F. Conidiophores and conidiogenous cells. G, H. Conidia. [A. Adapted from Chaverri et al. (2011)]. Ilyonectria. A, B. Ascomata. C, D. Ascospores. E, F. Conidiophores and conidiogenous cells. G, H. Conidia. Atractium. A, B. Conidiophores. C, D. Conidiogenous cells. E, F. Conidia. Fusicolla. A, B. Ascomata. C. Ascospores. D, E. Conidiogenous cells. F, G. Conidia. (A–C. Pictures by C. Lechat). Scolecofusarium. A. Ascomata. B, C. Ascospores. D, E. Conidiophores and conidiogenous cells. F. Conidia. Microcera. A. Ascomata. B. Ascospores. C, D. Conidiogenous cells. E, F. Conidia. (A, B. Pictures by N. Aplin, Fungi of Great Britain and Ireland). Macroconia. A, B. Ascomata. C–E. Ascospores. F, G. Conidiophores and conidiogenous cells. H, I. Conidia. (B. Picture by P. Mlcoch). Pseudofusicolla. A, B. Conidiophores and conidiogenous cells. C, D. Conidia. [A–D. Adapted from Triest et al. (2016)]. Cosmospora. A, B. Ascomata. C, D. Ascospores. E, F. Conidiophores and conidiogenous cells. G. Conidia. Dialonectria. A, B. Ascomata. C–E. Ascospores. F, G. Conidiophores and conidiogenous cells. H. Conidia. (A. Picture by P. Mlcoch). Cosmosporella. A, B. Ascomata. C–E. Ascospores. F, G. Conidiophores and conidiogenous cells. H, I. Conidia. (A–E. Pictures by P. Mlcoch). Stylonectria. A, B. Ascomata. C–E. Ascospores. F–I. Conidiophores and conidiogenous cells. J. Conidia. (A–C, E. Pictures by B. Wergen). the five Macroconia spp. previously known from culture, Ma. gigas, Ma. leptosphaeriae, Ma. papilionacearum, and Ma. sphaeriae, resolved as highly to fully-supported lineages. The poorly resolved position of the ex-type isolate of Ma. cupularis (HMAS 173240) should be interpreted in light of the fact that only nrDNA sequences were available for analysis. However, separate ITS and LSU comparisons demonstrated it as distinct (data not shown). Two distinct and highly supported novel lineages of South African origin were determined and are described here as the novel species, Ma. bulbipes and Ma. phlogioides. Neocosmospora phylogeny: The alignment consisted of partial acl1, CaM, ITS, LSU, rpb1, rpb2, and tef1 sequences of 107 ex-type and reference strains, including two outgroup taxa (Geejayessia atrofusca NRRL 22316 and G. cicatricum CBS 125552). The analysis resolved 76 terminal clades, of which 71 correspond to known species of Neocosmospora (Fig. 14). www.studiesinmycology.org Seventy of these clades resolved with high support from two or more independent algorithms (RAxML, IQ-TREE-ML, and BI). The position of the ex-type of N. crassa (CBS 144386) is poorly resolved and only partially supported by BI. Similarly, except for the types of N. ambrosia (CBS 571.94), N. obliquiseptata (NRRL 62611), N. rekana (CMW 52862), and the reference strain of N. pseudensiformis (CBS 130.78), the position of most members of the well-delimited Ambrosia-clade of Neocosmospora were only partially supported by the individual analyses (only BI in N. kuroshio, N. oligoseptata, and N. tuaranensis, and only IQTREE-ML-BS for N. euwallaceae and N. floridana). All these lineages were represented by single isolates in these analyses. Of the five unnamed phylogenetic clades, one corresponded to a species previously known from phylogenetic analyses (FSSC 41, Cardoso 2015), for which a Latin binomial is lacking; this species is here formally described as N. merkxiana. The four additional 37 CROUS ET AL. novel lineages discovered here are proposed as the novel species N. neerlandica, N. nelsonii, N. pseudopisi, and N. epipeda. Stylonectria phylogeny: The alignment consisted of partial acl1, ITS and rpb2 sequences of 11 strains, including the outgroup (Nectria cinnabarina CBS 125165). The analyses (Fig. 15) identified eight species-level clades, of which six represented previously known species of the genus: St. applanata, St. carpini, St. norvegica, St. purtonii, St. qilianshanensis, and St. wegeliniana. One strain, CBS 125491, isolated from an unknown ascomycetous host, corresponded to a previously known unnamed and fully supported monophyletic lineage, which is formally described here as St. corniculata. In addition, a fully supported clade formed by two strains, CBS 147305 from Diaporthe sp. and CBS 147306 from Dothiorella sarmentorum, is here recognised as the novel species St. hetmanica. Taxonomy Albonectria Rossman & Samuels, Stud. Mycol. 42: 105. 1999. Figs 8, 16. Type species: Albonectria rigidiuscula (Berk. & Broome) Rossman & Samuels, Stud. Mycol. 42: 105. 1999. (See F. colorans in List section for synonyms) Ascomata perithecial, solitary or gregarious, superficial on a sparse to well-developed, pseudoparenchymatous stroma, globose to subglobose to ellipsoidal or ovoid to obovoid, not collapsing or laterally pinched when dry, off-white to pale yellow to pale ochraceous, not changing in KOH, strongly tuberculate and thick-walled, with or without a small, pointed papilla, lacking hairs or appendages. Ascomatal wall of three regions: outer region of thick-walled, textura angularis to textura globulosa; middle region of elongate thick-walled cells; inner region with thin-walled, hyaline elongated cells. Asci narrowly to broadly clavate or ellipsoidal, 4–8-spored, ascospores obliquely uniseriate or biseriate. Ascospores ellipsoidal to long-ellipsoidal or fusoid to long-fusoid, 3- to multiseptate, hyaline to yellow-brown, smooth to striate, not to slightly constricted at the septum. Conidiophores mononematous (aerial conidiophores) or grouped on sporodochia; aerial conidiophores unbranched or irregularly branched, bearing terminal or lateral phialides, often reduced to single phialides; conidiogenouhs cells monophialidic, cylindrical to subcylindrical, smooth- and thin-walled, with periclinal thickening inconspicuous or absent, producing arial micro- and macroconidia. Microconidia hyaline, thin-walled, 0- or 1-septate, ovoid to obovoid, with or without a flattened basal papilla, borne in dry chains or small slimy heads. Macroconidia falcate, multiseptate, thick-walled, with a blunt to hooked apical cell and well-developed foot-shaped basal cell or distinctly beaked at both ends. Sporodochia cream to yellow; sporodochial conidiophores verticillately branched and densely packed, consisting of short, smooth- and thin-walled stipes bearing apical whorls of 2–4 monophialides; sporodochial conidiogenous cells monophialidic, cylindrical to subulate, smooth- and thin-walled, with reduced or flared collarette. Sporodochial macroconidia formed in off-white or creamy slimy masses, falcate, 5–9-septate, thick-walled, gently curved to straight, with a blunt to hooked apical cell and distinct welldeveloped foot-shaped basal cell. Chlamydospores absent. [Description adapted from Rossman et al. (1999), Booth (1971) and Lombard et al. (2015)]. 38 Diagnostic features: Off-white to pale yellow to pale ochraceous perithecia producing narrowly or broadly clavate to ellipsoidal asci containing (long) ellipsoidal to fusoid, 3- to multiseptate ascospores; fusarioid asexual morph characterised by monophialides producing distinctly long, robust, slightly curved to straight multiseptate macroconidia and dry chains or small slimy heads of ovoid microconidia. Chlamydospores absent. Atractium Link, Mag. Ges. Naturf. Freunde Berlin 3: 10. 1809 (Fries, Syst. Mycol. 1: XLI. 1821, nom. sanct.). Figs 8, 17. Type species: Atractium stilbaster Link, Mag. Ges. Naturf. Freunde Berlin 3: 10. 1809. Ascomata unknown. Conidiophores aggregated into sporodochia or synnemata, non-stromatic; synnemata determinate, pale brown, composed of a stipe of parallel hyphae and a divergent capitulum of conidiophores giving rise to a slimy conidial mass; conidiophore branching once or twice monochasial, 2-level verticillate, monoverticillate or irregularly biverticillate. Conidiogenous cells monophialidic, hyaline, subulate with conspicuous periclinal thickening, producing micro- and macroconidia. Microconidia hyaline, thin-walled, 0- or 1-septate, ellipsoidal, allantoid, broadly lunate to reniform, straight or slightly curved, tapering towards both apices with rounded base. Macroconidia 3–5-septate, falcate, gently curved, with a rounded to blunt apical cell, and obtuse, non foot-shaped basal cell, forming yellow to orange masses. [Description adapted from Gr€afenhan et al. (2011)]. Diagnostic features: Synnematous asexual morph characterised by fusarioidal macroconidia lacking foot-shaped basal cells. Bisifusarium L. Lombard et al., Stud. Mycol. 80: 223. 2015. Figs 8, 18. Type species: Bisifusarium dimerum (Penz.) L. Lombard & Crous, Stud. Mycol. 80: 225. 2015. (See F. dimerum in List section for synonyms) Ascomata unknown. Conidiophores mononematous (aerial conidiophores) or grouped on sporodochia; aerial conidiophores simple, unbranched or irregularly branched, mostly reduced to terminal or single lateral conidiogenous cells. Conidiogenous cells often formed as (i) lateral phialidic pegs arising from superficial or submerged intercalary hyphal cells or, (ii) cylindrical and slightly tapering towards apex or ampulliform, smooth- and thin-walled monophialides, rarely polyphialides, with inconspicuous or absent periclinal thickening, solitary or aggregated to represent a poorly developed pionnotal sporodochial-like structure, producing micro- and macroconidia. Microconidia hyaline, thin-walled, 0- or 1-septate, ellipsoidal, allantoid, broadly lunate to reniform, straight or curved, tapering towards both ends. Macroconidia falcate, (0–)1–2(–3)-septate, thick-walled, curved to lunate, with a blunt to hooked apical cell and obtuse to poorly developed, foot-shaped basal cell, typically formed on sporodochia. Sporodochia pale yellow to orange; sporodochial conidiophores verticillately branched and densely packed, consisting of short, smooth- and thin-walled stipes bearing an apical whorl of 2–3 monophialides; sporodochial conidiogenous cells monophialidic, cylindrical to subulate, smooth- and thinwalled, with reduced or flared collarette. Chlamydospores, if present, globose to subglobose to ellipsoidal, solitary or in chains, sometimes aggregated in sclerotia. FUSARIUM REDELIMITED Fig. 9. Characters for morphological identification of fusarioid genera in Nectriaceae. The rings show, from inside to outside: conidial morphology; ascospore morphology, septation and surface; colour reaction of ascomata in 3 % KOH/lactic acid (nr = no reaction); ascomata wall thickness; and general colour, appearance and wall surface of ascomata. [Description adapted from Schroers et al. (2009) and Lombard et al. (2015)]. Diagnostic features: Fusarioid asexual morph characterised by lateral phialidic pegs arising from superficial or submerged intercalary hyphal cells or solitarily formed monophialides producing microconidia; distinctly short (< 30 μm long), curved to lunate, (0–)1–2(–3)-septate macroconidia typically formed on sporodochia on plant tissue such as carnation leaf pieces. Corinectria C. Gonz
alez & P. Chaverri, Mycol. Progr. 16: 1021. 2017. Fig. 8. Type species: Corinectria fuckeliana (C. Booth) C. Gonz
alez & P. Chaverri, Mycol. Progr. 16: 1023. 2017. www.studiesinmycology.org Basionym: Nectria fuckeliana C. Booth, Mycol. Pap. 73: 56. 1959. Synonym: Neonectria fuckeliana (C. Booth) Castl. & Rossman, Canad. J. Bot. 84: 1428. 2006. Ascomata perithecial, gregarious, seated on an erumpent stroma, superficial, globose to subglobose, orange, red to dark red darkening around ostiolar region, turning black in KOH, pigment dissolving in lactic acid, not collapsing when dry, slightly papillate to papillate, smooth-walled, lacking hairs or appendages. Ascomatal wall of 2–3 regions: outer region of thick-walled, pigmented cells forming a textura epidermoidea; middle and inner regions of globose to elongate, hyaline, thin-walled cells, becoming thinner toward the centrum. Asci cylindrical, 8-spored, with an apical ring, uniseriate. Ascospores ellipsoidal to fusoid, 139 CROUS 40 ET AL. FUSARIUM REDELIMITED Fig. 10. (Continued). www.studiesinmycology.org 41 CROUS 42 ET AL. FUSARIUM REDELIMITED Fig. 10. Maximum-Likelihood (IQ-TREE-ML) consensus tree inferred from the combined rpb1, rpb2 and tef1 sequence alignment of the living type strains as indicated in the nomenclator list. Numbers at the branches indicate support values (RAxML-BS / UFboot2-BS / BI-PP) above 70 % / 0.95 with thickened branches indicating full support (RAxML-BS / UFboot2-BS = 100 %; BI-PP = 1). The scale bar indicates expected changes per site. The tree is rooted to Atractium stilbaster (CBS 410.67). Names indicated in bold are in current use. Subdivision of the Fusarium clade (blue block) represent the recognised species complexes. septate, hyaline, smooth. Conidiophores mononematous, hyaline, septate, unbranched or sparsely branched, terminating in 1–2 phialides or reduced to lateral phialides. Conidiogenous cells monophialidic, cylindrical, tapering towards the apex, with inconspicuous periclinal thickening and collarettes. Sporodochia not formed. Microconidia ellipsoidal to obovoid, hyaline, aseptate, sometimes forming false heads on phialides. Macroconidia cylindrical, mostly straight, (3–)5–7-septate, with rounded ends. Chlamydospores unknown. [Description adapted from Gonz
alez & Chaverri (2017)]. Diagnostic features: Orange to dark red, smooth-walled perithecia with papilla producing cylindrical asci bearing ellipsoidal to fusoid, 1-septate ascospores and cylindrocarpon-like asexual morph characterised by (3–)5–7-septate macroconidia. Cosmospora Rabenh., Hedwigia 2: 59. 1862. Fig. 8. Synonyms: Crysogluten Briosi & Farneti, Atti Ist. Bot. Univ. Lab. Crittog. Pavia 8: 117. 1904. Botryocrea Petr., Sydowia 3: 140. 1949. Type species: Cosmospora coccinea Rabenh., Hedwigia 2: 59. 1862 [non Nectria coccinea (Pers.) Fr. 1849]. Synonyms: Nectria cosmariospora Ces. & De Not., Comment. Soc. Crittog. Ital. 1: 195. 1863. Dialonectria cosmariospora (Ces. & De Not.) Cooke, Grevillea 12: 110. 1884. Cucurbitaria cosmariospora (Ces. & De Not.) Kuntze, Revis. Gen. Pl. 3: 461. 1898. www.studiesinmycology.org Dialonectria cosmariospora (Ces. & De Not.) Z. Moravec, Cesk
a Mykol. 8: 92. 1954, an isonym, Art. 6.3, Note 2. Verticillium olivaceum W. Gams, Cephalosporium-artige Schimmelpilze: 129. 1971. Ascomata perithecial, solitary or gregarious, with inconspicuous or absent stroma, obpyriform with an acute or papillate apex, orange red or bright red, turning dark red in KOH, smooth walled. Asci narrowly clavate to cylindrical, with an apical ring, 8spored. Ascospores initially hyaline, becoming yellow brown to reddish brown, 1-septate, becoming tuberculate when mature. Conidiophores acremonium-like, consisting of lateral phialides on somatic hyphae, or with one or two levels of monochasial branching, or verticillate, hyaline. Conidiogenous cells monophialidic, cylindrical to subulate to subclavate, hyaline. Microconidia ellipsoidal, oblong or clavate or slightly allantoid, aseptate, hyaline, forming slimy heads. Macroconidia absent or rare, subcylindrical, curved, slightly narrowing towards each end, apical cell often slightly hooked with a more or less pointed apex, basal cell obtuse to poorly developed, foot-shaped, 3–5-septate, hyaline. [Description adapted from Rossman et al. (1999) and Gr€afenhan et al. (2011)]. Diagnostic features: Orange-red to bright red perithecia with an acute or papillate apex producing cylindrical to narrowly clavate asci, yellow brown to reddish brown, 1-septate, tuberculate ascospores and acremonium-like asexual morph. 43 CROUS ET AL. Cosmosporella S.K. Huang et al., Cryptog. Mycol. 39: 179. 2018. Figs 8, 19. Type species: Cosmosporella olivacea S.K. Huang et al., Cryptog. Mycol. 39: 181. 2018. Ascomata perithecial, solitary to gregarious, superficial, on immersed to erumpent stroma, ovoid, globose to obpyriform, collapsing laterally when dry, orange red, red to pale yellow, not reacting in KOH, with a central ostiole, with hyaline periphyses. Ascomatal wall membranous, composed of orange to hyaline cells of textura angularis, with septate paraphyses. Asci cylindrical to slightly clavate, apically rounded, with evanescent wall, pedicel combined with paraphyses, 8-spored, unitunicate. Ascospores hyaline to pale brown, ellipsoidal to ovoid, 0- or 1-septate. Conidiophores acremonium-like, mononematous, hyaline, septate, consisting of lateral phialides on somatic hyphae, or with one or two levels of monochasial branching, or irregularly branched. Conidiogenous cells monophialidic, cylindrical, producing micro- and macroconidia. Microconidia ellipsoidal to obovoid, 0- or 1-septate, hyaline, forming a false head on phialides. Macroconidia falcate, almost straight to curved, 1–3-septate, with a blunt to hooked apical cell and poorly to welldeveloped foot-shaped basal cell. Chlamydospores unknown. [Description adapted from Huang et al. (2018)]. Diagnostic features: Pale yellow to orange-red perithecia lacking a papilla producing cylindrical to narrowly clavate asci, pale brown, 1-septate ascospores and fusarioid asexual morph characterised by overly long, 1–3-septate macroconidia. Cosmosporella cavisperma (Corda) Sand.-Den., L. Lombard & Crous, comb. nov. MycoBank MB 838659. Basionym: Fusarium cavispermum Corda, Icon. Fung. 1: 3. 1837. Synonyms: Fusarium aquaeductuum var. cavispermum (Corda) Raillo, Fungi of the Genus Fusarium: 280. 1950. Fusarium oxydendri Ellis & Everh., Bull. Torrey Bot. Club 24: 477. 1897. Fusarium cavispermum var. minus Wollenw., Fusaria Autogr. Delin. 3: 848. 1930. Lectotypus: Czech Republic, near Carlsstein, on pine resin, A.K.J. Corda, Icon. Fung. 1: tab. I, fig. 58 (MBT 10001322 hic designatus). Epitype of Fusarium cavispermum (CBS 172.31, MBT 10000645 hic designatus, a metabolically inactive culture). Norway, from Pinus sylvestris, 1929, H.W. Wollenweber, culture ex-epitype CBS 172.31 = NRRL 13996. Notes: The genus Cosmosporella was erected by Huang et al. (2018) to accommodate Cm. olivacea and the superfluous taxon Cm. obscura, shown to cluster within a subset of taxa pertaining to Cosmospora s. lat. (Rossman et al. 1999), former members of the Nectria episphaeria group sensu Booth (1959) and Nectria subgenus Dialonectria (Samuels et al. 1991) characterised by cosmospora-like sexual morphs and fusarioid asexual morphs. More recently, this monophyletic clade had been ascribed to the Fusarium cavispermum species complex (O'Donnell et al. 2013) and, separated from any of the polyphyletic taxa formerly classified in Fusarium section Eupionnotes (O'Donnell 1993, Schroers et al. 2009, Gr€afenhan et al. 2011). “Fusarium” melanochlorum, its purposed sexual morph “Nectria” flavoviridis (Gerlach & Nirenberg 1982), and “Fusarium” cavispermum have also been resolved as members of this clade (Gr€afenhan et al. 2011, O'Donnell et al. 2013, Huang et al. 2018, and Fig. 7 in this paper). Here, the new combination Cm. cavisperma is proposed, lectotypified, and an epitype 44 is designated to stabilise the application of the name based on material studied by Wollenweber [number 849 in Wollenweber (1916–1935) and Gerlach & Nirenberg (1982)]. The suggested conspecificity of “F”. melanochlorum and “N”. flavoviridis, however, is questioned given the large phylogenetic distance between the currently available strains. Fresh isolations and a thorough phylogenetic revision of the entire group including additional Cosmospora s. lat. taxa having fusarioid asexual morphs are necessary. Cyanonectria Samuels & Chaverri, Mycol. Progr. 8: 56. 2009. Figs 8, 20. Type species: Cyanonectria cyanostoma (Sacc. & Flageolet) Samuels & Chaverri, Mycol. Progr. 8: 56. 2009. Basionym: Nectria cyanostoma Sacc. & Flageolet, Rendiconti Congr. Bot. Palermo 1902: 53. 1902. Synonym: Fusarium cyanostomum (Sacc. & Flageolet) O'Donnell & Geiser, Phytopathology 103: 404. 2013. Ascomata perithecial, gregarious or caespitose, with a reduced or well-developed prosenchymatous stroma, smooth- and thinwalled, ampulliform to obpyriform to pyriform, apex dark bluish purple to bluish black and body less intensely dark bluish or red or reddish brown, turning darker in KOH, pigment dissolving in lactic acid to become red to yellow, non-papillate, lacking hairs or appendages. Ascomatal wall consisting of a single region, comprising several layers of morphologically similar cells. Asci cylindrical to narrowly clavate, with rounded to flattened thickened apex, with or without refractive ring, 8-spored, ascospores overlapping uniseriate or biseriate above and uniseriate below. Ascospores ellipsoidal, 1-septate, not or slightly constricted at septum, pale yellow-brown, smooth-walled or finely verrucose. Conidiophores mononematous (aerial conidiophores) or grouped on sporodochia; aerial conidiophores unbranched or rarely branched, bearing terminal or lateral phialides, often reduced to single phialides. Conidiogenous cells monophialidic, cylindrical to subcylindrical, smooth- and thin-walled, with periclinal thickening inconspicuous or absent. Sporodochia white to bluish; sporodochial conidiophores verticillately branched and densely packed, consisting of short, smooth- and thin-walled stipes bearing apical whorls of 2–3 monophialides; sporodochial conidiogenous cells monophialidic, cylindrical to subulate, smooth- and thin-walled, with reduced or flared collarette. Macroconidia formed in off-white or creamy or greyish blue slimy masses, falcate, straight to gently curved, with inequilateral fusoid or hooked apical cell and well-developed, foot-shaped basal cell. Microconidia unknown. Chlamydospores absent or rarely formed from cells of the macroconidia, subglobose. [Description adapted from Samuels et al. (2009) and Schroers et al. (2011)]. Diagnostic features: Bicoloured or dark bluish purple to bluish black perithecia producing cylindrical to narrowly clavate asci containing ellipsoidal, 1-septate ascospores and fusarioid asexual morph characterised by monophialides producing long, narrow, almost straight macroconidia, lacking microconidia and hyphal-borne chlamydospores. Dialonectria (Sacc.) Cooke, Grevillea 12: 77, 109. 1884. Figs 8, 21. Basionym: Nectria subgen. Dialonectria Sacc., Syll. Fung. 2: 490. 1883. Type species: Dialonectria episphaeria (Tode) Cooke (as “episphaerica”), Grevillea 12: 82. 1884. FUSARIUM REDELIMITED Fig. 11. Maximum-Likelihood (IQ-TREE-ML) consensus tree inferred from the combined CaM, rpb1, rpb2, tef1, and tub2 sequence alignment of members of the Fusarium fujikuroi species complex. Numbers at the branches indicate support values (RAxML-BS / UFboot2-BS / BI-PP) above 70 % / 0.95 with thickened branches indicating full support (RAxML-BS / UFboot2-BS = 100 %; BI-PP = 1). Novel taxa are indicated in bold. The scale bar indicates expected changes per site. The tree is rooted to Fusarium curvatum CBS 744.97 and Fusarium inflexum CBS 716.74. Ex-epitype, ex-neotype and ex-type strains are indicated with ET, NT, and T, respectively. Basionym: Sphaeria episphaeria Tode, Fung. mecklenb. sel. 2: 21. 1791. Ascomata perithecial, solitary or gregarious, with inconspicuous or absent stroma, obpyriform with an acute or round papilla, www.studiesinmycology.org orange red to carmine red, turning dark red in KOH, smoothwalled. Asci narrowly clavate to cylindrical, with an apical ring, 8spored, uniseriate. Ascospores initially hyaline, becoming pale brown, 1-septate, becoming tuberculate when mature. Conidiophores mononematous, initially as lateral phialides on 45 CROUS ET AL. Fig. 12. Maximum-Likelihood (IQ-TREE-ML) consensus tree inferred from the combined acl1, ITS, LSU, rpb2, tef1, and tub2 sequence alignment of members of the genus Fusicolla. Numbers at the branches indicate support values (RAxML-BS / UFboot2-BS / BI-PP) above 70 % / 0.95 with thickened branches indicating full support (RAxML-BS / UFboot2-BS = 100 %; BI-PP = 1). Novel taxa are indicated in bold. The scale bar indicates expected changes per site. The tree is rooted to Macroconia leptosphaeriae CBS 100001. Ex-epitype and ex-type strains are indicated with ET, and T, respectively. somatic hyphae, sometimes verticillate, hyaline. Conidiogenous cells monophialidic, subulate to subclavate, hyaline. Microconidia ellipsoidal to clavate, aseptate, hyaline, abundant. Macroconidia if present subcylindrical, moderately curved, slightly narrowing towards each end, apical cell often slightly hooked with a more or less pointed tip, basal cell obtuse to poorly developed, footshaped, predominantly 3–5-septate, hyaline. Chlamydospores unknown. [Description adapted from Rossman et al. (1999) and Gr€afenhan et al. (2011)]. Diagnostic features: Orange-red to carmine-red perithecia with an acute or round papilla producing cylindrical to narrowly clavate asci, pale brown, 1-septate, tuberculate ascospores and asexual morph that rarely produces macroconidia. Fusarium Link, Mag. Ges. Naturf. Freunde Berlin 3: 10. 1809. Figs 8, 22. Synonyms: Fusisporium Link, Mag. Ges. Naturf. Freunde Berlin 3: 19. 1809. Selenosporium Corda, Icon. Fung. 1: 7. 1837. Gibberella Sacc., Michelia 1: 43. 1877. Lisea Sacc., Michelia 1: 43. 1877. Sporotrichella P. Karst., Meddel. Soc. Fauna Fl. Fenn. 14: 96. 1887. Gibberella subgen. Lisiella Cooke & Massee, Grevillea 16: 5. 1887. 46 Lisiella (Cooke & Massee) Sacc., Syll. Fung. 9: 945. 1891. Septorella Allesch., Hedwigia 36: 241. 1897. Ustilaginoidella Essed, Ann. Bot. 25: 351. 1911. Rachisia Linder, Deutsche Essigind. 17: 467. 1913. Stagonostroma Died., Krypt.-Fl. Mark Brandenb. 9: 561. 1914. Fusidomus Grove, J. Bot. 67: 201. 1929. Pseudofusarium Matsush., Microfungi Solomon Isl. Papua-New Guinea: 46. 1971. Type species: Fusarium sambucinum Fuckel, Fungi Rhen. Exs., Fasc. 3, no. 211. 1863, nom. cons. (See List section for synonyms) Ascomata perithecial, mostly gregarious, non-stromatic or on a thin stroma erumpent through the epidermis, superficial, subglobose to globose to broadly pyriform, not collapsing or laterally pinched when dry, bluish purple to black, turning dark purple in KOH, pigment dissolving in lactic acid, non-papillate, slightly rugose to tuberculate, lacking hairs or appendages. Ascomatal wall of two regions: outer region of thick-walled, pigmented cells forming a textura angularis or textura globulosa; inner region of elongate, hyaline, thin-walled cells, becoming thinner towards the centrum. Asci clavate, apex simple, 8-spored often with an apical ring, biseriate to pluriseriate. Ascospores ellipsoidal to cylindrical, 1–3septate, not or slightly constricted at the septa, pale tan, smoothwalled. Conidiophores mononematous (aerial conidiophores) or grouped on sporodochia; aerial conidiophores, if consistenly FUSARIUM REDELIMITED Fig. 13. Maximum-Likelihood (ML) consensus tree inferred from the combined acl1, CaM, ITS, LSU, rpb1, rpb2, and tub2 sequence alignment of members of the genus Macroconia. Numbers at the branches indicate support values (RAxML-BS / UFboot2-BS / BI-PP / gCF) above 70 % / 0.95 with thickened branches indicating full support (RAxML-BS / UFboot2-BS = 100 %; BI-PP = 1). Novel taxa are indicated in bold. The scale bar indicates expected changes per site. The tree is rooted to Microcera rubra CBS 638.76. Ex-type and ex-isotype strains are indicated with T, and IT, respectively. formed, unbranched, sympodial or irregularly branched, bearing terminal or lateral phialides, often reduced to single phialides. Conidiogenous cells mono- or polyphialidic, subulate to subcylindrical, smooth- and thin-walled, sometimes proliferating percurrently, with periclinal thickening inconspicuous or absent. Aerial conidia hyaline, smooth- and thin-walled, of three types: microconidia ellipsoidal to fusoid to ovoid to obovoid to reniform to allantoid to clavate to napiform to pyriform to limoniform, 0–5septate, borne in false heads or chains on the phialides; mesoconidia (occurring in some species or species complexes) falcate, slender with no significant curvature to curved with parallel walls, 1–5-septate, tapering towards both ends, with a pointed to blunt apical cell and obtuse to flattened basal cell; macroconidia, typically formed on sporodochia, falcate, slightly to strongly curved dorsiventrally, 1-septate to multiseptate, with a curved, long and tapering, pointed, blunt, hooked or elongated apical cell and obtuse, poorly developed, well-developed, to elongate, foot-shaped basal cell. Sporodochia cream to pale tan to orange to saffron to blue; sporodochial conidiophores verticillately branched and densely packed, consisting of short, smooth- and thin-walled stipes bearing an apical whorl of 2–4 monophialides; sporodochial conidiogenous cells subulate to subcylindrical, smooth- and thin-walled, with reduced or flared collarette; sporodochial (macro)conidia falcate, smooth- and thin-walled, distinctly curved to curved with parallel walls to unequally curved, tapering towards both ends, with pointed, blunt, papillate, hooked, or elongate apical cell and obtuse, poorly developed, well-developed, to elongate, foot-shaped basal cell. Chlamydospores globose to subglobose to ovoid to obovoid, hyaline to subhyaline, smooth-walled to slightly verrucose, terminal or intercalary, solitary or in pairs or forming chains or aggregating to form microsclerotia. [Description adapted from Rossman et al. (1999) and Lombard et al. (2015)]. www.studiesinmycology.org Diagnostic features: Dark blue to black perithecia producing clavate asci bearing ellipsoidal to cylindrical 1- to multiseptate ascospores and asexual morphs producing micro- and macroconidia, and sometimes mesoconidia on aerial conidiophores with mono- and/or polyphialides or only macroconidia in sporodochia. Chlamydospores form in hyphae, rarely in macroconidia. Fusarium echinatum Sand.-Den. & G.J. Marais, sp. nov. MycoBank MB 838660. Fig. 23. Etymology: From the Latin echinatus, prickly, referring to the spiny appearance of its multiloculate, often swollen and rather deformed conidiogenous cells. Typus: South Africa, unidentified tree species, 2010, A. Lubben (holotype CBS H-24658, culture ex-type CBS 146497 = CPC 30815 = CAMS 000733). Conidiophores on aerial mycelium 10–120 μm tall, unbranched or irregularly laterally branched, bearing lateral and terminal single phialides; aerial conidiogenous cells polyphialidic, subulate, subcylindrical or more commonly irregularly shaped, curved, swollen and distorted due to abundant conidiogenous loci, smooth- and thin-walled, 6.5–36.5 × 2–3.5 μm, polyphialides with 2–3 or more commonly 10–18 conidiogenous openings, with inconspicuous to absent periclinal thickening and collarettes. Aerial microconidia forming small false heads on tips of phialides, hyaline, smooth, and thin-walled, commonly ovoid to ellipsoidal, 0- or 1-septate, 4–11(–19) × 2–3.5(–4.5) μm (av. 7.5 × 2.7 μm), and more rarely napiform, smooth and thin-walled, 0-septate, (5–)5.5–7 × (3.5–)4.5–5.5 μm (av. 6.4 × 4.5 μm). Sporodochial conidiophores 28.5–60(–68.5) μm tall, irregularly branched, bearing terminal solitary monophialides or whorls of up to three monophialides. Sporodochial conidiogenous 47 CROUS 48 ET AL. FUSARIUM REDELIMITED Fig. 14. Maximum-Likelihood (IQ-TREE-ML) consensus tree inferred from the combined acl1, CaM, ITS, LSU, rpb1, rpb2, and tef1 sequence alignment of members of the genus Neocosmospora. Numbers at the branches indicate support values (RAxML-BS / UFboot2-BS / I-PP) above 70 % / 0.95 with thickened branches indicating full support (RAxML-BS / UFboot2-BS = 100 %; BI-PP = 1). Novel taxa are indicated in bold. The scale bar indicates expected changes per site. The tree is rooted to Geejayessia atrofusca NRRL 22316 and G. cicatricum CBS 125552. Ex-epitype, ex-neotype, ex-paratype and ex-type strains are indicated with ET, NT, PT, and T, respectively. www.studiesinmycology.org 49 CROUS ET AL. cells monophialidic, subulate to subcylindrical, smooth- and thinwalled, (8.5–)11.5–16(–17.5) × (1.5–)2.5–3.5 μm. Sporodochial macroconidia moderately curved to wedge-shaped, slender, tapering towards the basal part, apical cell of equal size than the adjacent cell, blunt to slightly hooked; basal cell poorly to well-developed, foot-shaped, (1–)2–3(–4)-septate, hyaline, thin- and smooth-walled: 1-septate conidia: (16.5–) 19.5–32.5(–36) × 2.5–3.5 μm (av. 26.1 × 2.9 μm); 2-septate conidia: (19.5–)25–36(–37.5) × 2.5–3.5 μm (av. 30.5 × 3.1 μm); 3-septate conidia: (20.5–)28.5–36(–40) × (2.5–) 3–3.5(–4.5) μm (av. 32.5 × 3.2 μm); 4-septate conidia: (27–) 30.5–39(–40.5) × 3–4 μm (av. 35.4 × 3.6 μm); overall: (19.5–) 28.6–36.5(–40.5) × (2.5–)3–3.5(–4.5) μm (av. 32.4 × 3.2 μm). Chlamydospores not observed. Culture characteristics: Colonies on PDA reaching 31–63 mm diam at 25 °C after 7 d. Surface white, pale luteus to sulphur yellow, flat, woolly to cottony with radial patches of white aerial mycelium, margin regular and filiform. Reverse white, sulphur yellow to pure yellow at centre. On OA pale luteus to sulphur yellow, flat, membranous at first, quickly becoming velvety to dusty, margin regular. Reverse sulphur yellow. Additional material examined: South Africa, unidentified tree species, 2010, A. Lubben, culture CBS 146496 = CPC 30814 = CAMS 000730. Notes: Yilmaz et al. (2021) recently revised the FFSC, including formal descriptions for several species, while fixing the typification of relevant plant pathogenic and toxigenic species. Species in this complex have been traditionally organised according to their biogeographic patterns, which roughly match their phylogenetic distribution. Apart from the monophyletic American and Asian clades, the complex contains a non-monophyletic African clade, which is currently known to cluster into two distinct clades: the speciose core African clade and the African “B” clade encompassing F. dlaminii and F. fredkrugeri (O'Donnell et al. 2000b, Herron et al. 2015, Sandoval-Denis et al. 2018b, Yilmaz et al. 2021). The novel South African species F. echinatum, however, formed a fully-supported single lineage that did not belong to any of the currently known biogeographically defined clades (Fig. 11). The most noticeable morphological feature that distinguishes F. echinatum is the presence of well-developed polyphialides bearing multiple conidiogenous openings that are often concentrated in large numbers and that cause a deformation of the apical region. Somewhat similar, conspicuous polyphialides can be found in Fusarium chlamydosporum and F. concolor (syn. F. polyphialidicum); however, these species are not directly related, in that they belong to two different species complexes, the F. chlamydosporum and F. concolor species complexes, respectively (Fig. 10). The polyphialides formed by these two species do not show as many conidiogenous loci as do those of F. echinatum. Fusarium prieskaense G.J. Marais & Sand.-Den., sp. nov. MycoBank MB 838661. Fig. 24. Etymology: Referring to Prieska, a town in Northern Cape Province, South Africa, where the type was collected. Typus: South Africa, Northern Cape Province, Prieska, on Prunus spinosa, 2010, F.J.J. van der Walt & G.J. Marais (holotype CBS H-24660, culture ex-type CBS 146498 = CPC 30826 = CAMS 001176). 50 Conidiophores on aerial mycelium 12.5–43.5 μm tall, unbranched or rarely irregularly or sympodially branched and proliferating, bearing terminal single phialides or whorls of 2–3 phialides, commonly reduced to solitary conidiogenous cells borne laterally on hyphae; aerial conidiogenous cells mono- and polyphialides, subulate to subcylindrical, smooth- and thin-walled, 8–29.5 × 2–5 μm, polyphialides often with 2–3 conidiogenous openings, periclinal thickening and collarettes often inconspicuous or absent. Aerial microconidia forming small false heads and short chains on phialide tips, hyaline, obovoid to short clavate, smooth and thin-walled, 0-septate, (4.5–) 6–9(–13) × 2–3(–4) μm (av. 7.4 × 2.6 ìm). Sporodochial conidiophores 24.5–39(–45) μm tall, irregularly branched, bearing terminal solitary or whorls of 2–3 phialides. Sporodochial conidiogenous cells monophialidic, doliiform, subulate to subcylindrical, smooth- and thin-walled, (8.5–) 10–14(–15) × 2–4.5 μm. Sporodochial conidia straight to moderately curved and slender, tapering towards the basal part, apical cell more or less equally sized as the adjacent cell, blunt to slightly hooked; basal cell well-developed, foot-shaped, rarely papillate, (1–)3–4-septate, hyaline, thin- and smooth-walled: 1septate conidia: 23.5 × 3.5 μm; 3-septate conidia: (33.5–) 44.5–58(–68.5) × (3–)3.5–4.5(–5) μm (av. 51.1 × 4 μm); 4septate conidia: (52.5–)55.5–67.5(–71) × 3.5–4.5 μm (av. 61.3 × 4.1 μm); overall: (23–)44–59(–71) × 3–4(–5) μm (av. 51.3 × 4 μm). Chlamydospores not observed. Culture characteristics: Colonies on PDA reaching 42–68 mm diam at 25 °C after 7 d. Surface pale luteous, luteous to pale sienna, flat, velvety to felty, sometimes with small white patches of aerial mycelium, margin filiform and regular. Reverse sulphur yellow to amber, pale orange at centre. On OA, sienna to pale umber, flat, membranous to dusty, margin entire and regular; reverse sienna to pale umber. Additional material examined: South Africa, Northern Cape Province, Prieska, on Prunus spinosa, 2010, F.J.J. van der Walt & G.J. Marais, culture CBS 146499 = CPC 30827 = CAMS 001177; on Aloidendron dichotomum, 2010, F.J.J. van der Walt & G.J. Marais, culture CPC 30825 = CAMS 001175. Notes: Fusarium prieskaense is nested within the core African clade of the FFSC (Fig. 11). Similar to most members of this clade, this species is characterised by forming mostly monophialides and occasional to frequent polyphialides, sometimes proliferating and producing aerial conidia typically organised in a combination of false heads and short to long chains. Fusarium prieskaense is morphologically and phylogenetically related to Fusarium brevicatenulatum and F. pseudonygamai from which it can be differentiated by its pale luteus to yellow colony pigmentation on PDA, versus the orange to dark blue or violet pigments produced by the two latter species (Leslie & Summerell 2006). Additionally, sporodochia and macroconidia are commonly and abundantly produced by F. prieskaense, whereas these structures are relatively rare in the two aforementioned species. Moreover, the obovoid to short clavate microconidia of F. prieskaense also distinguishes this species from F. brevicatenulatum, which is characterised by long oval to obovoid microconidia (Nirenberg et al. 1998). Fusicolla Bonord., Handb. Allg. Mykol.: 150. 1851. Figs 8, 25. Type species: Fusicolla betae (Desm.) Bonord., Handb. Allg. Mykol.: 150. 1851. FUSARIUM REDELIMITED Fig. 15. Maximum-Likelihood (IQ-TREE-ML) consensus tree inferred from the combined acl1, ITS, and rpb2 sequence alignment of members of the genus Stylonectria. Numbers at the branches indicate support values (RAxML-BS / UFboot2-BS / BI-PP) above 70 % / 0.95 with thickened branches indicating full support (RAxML-BS / UFboot2BS = 100 %; BI-PP = 1). Novel taxa are indicated in bold. The scale bar indicates expected changes per site. The tree is rooted to Macroconia leptosphaeriae CBS 100001. Exepitype and ex-type strains are indicated with ET and T, respectively. Fig. 16. Albonectria spp. A–C. Ascomata on natural substrate. D. Surface view of perithecial wall in 2 % KOH. E–K. Asci and ascospores (J, K. Surface view). L–P. Conidiophores and conidiogenous cells. Q, R. Microconidia. S. Macroconidia. A, C–F, H–J. Albonectria rigidiuscula (BPI 553050). B, G, K. Albonectria rigidiuscula (BPI 1104484). L, M, P–S. Albonectria rigidiuscula (CBS 122570). N, O. Albonectria rigidiuscula (CBS 133.25). Scale bars: A–C = 100 μm; all others = 10 μm (G applies to H–K). www.studiesinmycology.org 51 CROUS ET AL. Fig. 17. Atractium spp. A, B. Synnemata. C–G. Conidiophores and conidiogenous cells. H. Microconidia. I. Macroconidia. A–D, H. Atractium stilbaster (CBS 410.67). E–G, I. Atractium crassum (CBS 180.31). Scale bars: A = 100 μm; all others = 10 μm. Fig. 18. Bisifusarium spp. A–D, F–J. Conidiophores and conidiogenous cells. K, L. Microconidia. E, M. Macroconidia. A–E. Bisifusarium dimerum (CBS 108944). F–M. Bisifusarium delphinoides (CBS 120718). Scale bars: H, J = 5 μm; all others = 10 μm. (See F. betae in List section for synonyms) Ascomata perithecial, solitary, rarely gregarious, with erumpent stroma, fully or partially immersed in a slimy, pale orange sheet of hyphae over the substrate, globose to pyriform with a short acute or disk-like papilla, not collapsing when dry, yellow, pale buff to orange, not changing colour in KOH, smooth-walled, rarely tuberculate, generally lacking hairs or with short, thick-walled hyphae-like structures. Asci cylindrical to narrowly clavate, with an apical ring, 8spored. Ascospores broadly ellipsoidal, 1-septate, slightly constricted at the septum, verrucose, hyaline to pale brown. Conidiophores initially as lateral phialides on somatic hyphae, sometimes monochasial, verticillate or penicillate, hyaline. Conidiogenous cells monophialidic, cylindrical to subulate, hyaline. Microconidia absent or sparse, ellipsoidal to allantoid, aseptate, hyaline. Macroconidia falcate, straight to curved, narrowing towards the ends, apical cell often hooked with a pointed tip, basal cell poorly 52 developed, foot-shaped, 1–3-septate or 3–5-septate or up to 10septate, hyaline. Chlamydospores absent to abundant, globose, single, in pairs or chains, sometimes formed in macroconidia. [Description adapted from Gerlach & Nirenberg (1982) and Gr€afenhan et al. (2011)]. Diagnostic features: Yellow to orange, mostly smooth-walled perithecia with a short acute or disk-like papilla producing cylindrical to narrowly clavate asci bearing broadly ellipsoidal, 1septate, verrucose ascospores and fusarioid asexual conidia. Fusicolla quarantenae J.D.P. Bezerra, Sand.-Den., Crous & Souza-Motta, sp. nov. MycoBank MB 838692. Fig. 26. Etymology: The epithet refers to the quarantine period during the 2020–2021 coronavirus pandemic, which killed thousands of people on five continents, and during which this species was described. FUSARIUM REDELIMITED Fig. 19. Cosmosporella spp. A–D. Ascomata on natural substrate. E. Surface view of perithecial wall. F. Asci. G–J. Ascospores. K, L. Conidiophores. M. Microconidia. N, O. Macroconidia. A–J. “Cosmospora” flavoviridis (photos P. Mlcoch). K–N. “Cosmospora” flavoviridis (CBS 124353). O. Cosmosporella cavisperma (CBS 172.31). Scale bars: A–D = 300 μm; E = 50 μm; G–J = 5 μm; all others = 10 μm. Fig. 20. Cyanonectria spp. A–C. Ascomata on natural substrate. D. Longitudinal section through perithecium in Shears. E. Surface view of perithecial wall in 2 % KOH. F, G. Asci. H–K. Ascospores (K. Surface view). L–O. Conidiogenous cells. P. Macroconidia. A–C, E–J. Cyanonectria buxi (CBS H-20380). D, K. Cyanonectria buxi (CBS H-20379). L–N. Cyanonectria buxi (CBS 130.97). O, P. Cyanonectria buxi (CBS 125551). [A, D, L. adapted from Schroers et al. (2011).] Scale bars: A–D = 100 μm; H–K = 5 μm (H applies to I and J); all others = 10 μm. Typus: Brazil, Pernambuco state, Itaíba municipality, Curral Velho Farm, 9º08.895 S 37º12.069 W, on cladodes of Melocactus zehntneri, Sep. 2013, J.D.P. Bezerra (holotype URM 94407, culture ex-type URM 8367 = CBS 141541). Conidiophores arising laterally from somatic hyphae, simple, straight, hyaline, thin- and smooth-walled, septate, 25–116 × 1.5–2.5 μm, or reduced to solitary conidiogenous cells. Conidiogenous cells monophialidic, arising laterally from hyphae, cylindrical to subulate, straight, hyaline, thin- and smooth-walled, 1–22 × 0.5–2 μm, or as short lateral pegs. Macroconidia falcate, more or less straight, slightly narrowing towards the ends, apical cell often hooked with a more or less pointed tip, basal cell poorly developed, foot-shaped, www.studiesinmycology.org hyaline, thin- and smooth-walled, 3-septate, (21–) 27–35(–38.5) × 2–2.5(–3) μm (av. 29.5 × 2.5 μm, n = 30). Microconidia, chlamydospores and sexual morph not observed. Culture characteristics: Colonies on PDA reaching 15 mm diam after at 25 °C after 7 d. Surface yellow to apricot in centre, peach to brick in middle, and salmon at margin, flat, aerial mycelium absent, slimy, with entire margin; reverse yellow to brick. Notes: Fusicolla quarantenae, an endophyte of Melocactus zehntneri, is morphologically reminiscent of Fu. betae, Fu. epistroma, and Fu. septimanifiniscientiae, all of which produce mainly 3-septate macroconidia. Fusicolla betae and Fu. epistroma differ by having larger conidia (50–60 μm and 19–45 μm long, 53 CROUS ET AL. Fig. 21. Dialonectria spp. A–D. Ascomata on natural substrate. E. Surface view of perithecial wall in 2 % KOH. F–H. Asci. I–M. Ascospores (L, M. Surface view). N, O. Conidiophores and conidiogenous cells. P. Macroconidia. A, B. Dialonectria episphaeria (photos P. Mlcoch). C, D, F, M. Dialonectria episphaeria (CBS H-19716). E, G, K. Dialonectria sanguinea (CBS H-2127). H–J, L. Dialonectria episphaeria (CBS H-2662). N–P. Dialonectria episphaeria (CBS 125494). Scale bars: A–D = 100 μm; I, L, M = 5 μm (I applies to J and K); all others = 10 μm. Fig. 22. Fusarium spp. A–D. Ascomata on natural substrate. E. Surface view of perithecial wall in 2 % KOH. F–H. Asci. I–M. Ascospores (M. Surface view). N–P. Conidiophores and conidiogenous cells. Q–T. Microconidia. U–A2. Macroconidia. A. Fusarium graminearum (photo P. Cannon). B, C, F. Fusarium sambucinum [adapted from Wergen (2018)]. D. Fusarium sp. (HPC 2244). E. Fusarium cf. tricinctum (CBS H-12819). G, I. Fusarium lateritium (photo P. Cannon). H, K. Fusarium equiseti (CBS H-12817). J. Fusarium sambucinum (BPI 632307). L, M. Fusarium sambucinum (CBS H-12818). N. Fusarium avenaceum (CPC 30660). O, Q. Fusarium fredkrugerii (CBS 144209). P, W. Fusarium prieskaense (CBS 146498). R. Fusarium madaense (CBS 146669). S. Fusarium globosum (CBS 428.97). T. Fusarium echinatum (CBS 146497). U. Fusarium avenaceum (CBS 408.86). V. Fusarium caeruleum (CBS 146590). X. Fusarium longicaudatum [CBS 123.73, adapted from Xia et al. (2019)]. Y. Fusarium transvaalense [CBS 144211, adapted from Sandoval-Denis et al. (2018b)]. Z. Fusarium gamsii (CBS 143610). A1. Fusarium oxysporum [CBS 144134, adapted from Lombard et al. (2019b)]. A2. Fusarium convolutans [CBS 144207, adapted from Sandoval-Denis et al. (2018b)]. Scale bars: A–D = 100 μm; I–M, Q–T = 5 μm; all others = 10 μm. 54 FUSARIUM REDELIMITED Fig. 23. Fusarium echinatum (CBS 146497). A–D. Aerial conidiophores. E–G. Conidiogenous cells on aerial conidiophores. H, I. Microconidia. J. Sporodochia formed on the surface of carnation leaves. K. Sporodochial conidiophores and conidiogenous cells. L. Macroconidia. Scale bars: A = 20 μm; J = 100 μm; all others = 10 μm. respectively, Gerlach & Nirenberg 1982). The absence of chlamydospores in Fu. quarantenae further differentiates this species from Fu. epistroma and Fu. septimanifiniscientiae (Gerlach & Nirenberg 1982, Crous et al. 2018). Fusicolla meniscoidea L. Lombard & Sand.-Den., sp. nov. MycoBank MB 838662. Fig. 27. Etymology: From Greek meniskos, crescent, in reference to the shape of its conidia. Typus: Australia, from soil, unknown collection date (before 1978), unknown collector (holotype CBS H-24662, culture extype CBS 110189 = FRC E-0086).1 Conidiophores arising laterally or terminally from somatic hyphae 50–70 μm long, simple or sparingly branched laterally, straight, www.studiesinmycology.org hyaline, smooth- and thin-walled, bearing terminal and lateral conidiogenous cells, or more commonly reduced to single conidiogenous cells borne laterally on the substrate and aerial hyphae. Conidiogenous cells monophialidic, subcylindrical, cylindrical to slightly subulate, 10.5–35 × 2–3.5 μm, smooth- and thin-walled, without noticeable periclinal thickening, a minute apical collarette can be present. Macroconidia falcate, tapering gently towards both ends, apical cell often hooked with a blunt to pointy apex, basal cell obtuse to poorly developed, foot-shaped, 0–2(–3)-septate, predominantly 1-septate, hyaline, smooth- and thin-walled; 0-septate (8–)9–13(–15) × 2–3.5 μm (av. 11.1 × 2.9 μm); 1-septate, (9–) 11.5–15(–17.5) × 2.5–3.5 μm (av. 13.1 × 2.9 μm); 2-septate, 13–17.5(–18) × 2.5–4 μm (av. 15.4 × 3 μm); 3-septate, 20–24.5(–25.5) × 3–3.5 μm (av. 22.6 × 3.3 μm). Microconidia, chlamydospores and sexual morph not observed. 55 CROUS ET AL. Fig. 24. Fusarium prieskaense (CBS 146498). A–D. Aerial conidiophores. E–G. Conidiogenous cells on aerial conidiophores. H. Microconidia. I. Sporodochia formed on the surface of carnation leaves. J–L. Sporodochial conidiophores and conidiogenous cells. M. Macroconidia. Scale bars: A, B = 20 μm; I = 100 μm; all others = 10 μm. Culture characteristics: Colonies on PDA reaching 21–30 mm diam at 25 °C after 7 d. Surface white to pale luteus at periphery, centre salmon to pale orange, flat to slightly radially folded, membranous to slimy, margin entire to slightly undulate; reverse luteous to pale salmon at centre. On OA, pale luteous to pale salmon, flat, membranous, margin entire; reverse pale luteous. Notes: Fusicolla meniscoidea is here introduced based on an isolate originally misidentified as Bisifusarium dimerum. Despite the great genetic differences and phylogenetic distance, the two taxa share similar morphological traits, particularly regarding macroscopic aspects of colonial growth, and the shape and size of conidiophores and conidia. However, unlike in B. dimerum, conidia of Fu. meniscoidea present a much more pronounced curvature involving both conidial planes (somewhat parallel walls), while foot-shaped basal cells are 56 less evident or absent. Fusicolla aqueductuum, Fu. betae, Fu. quarantenae, and Fu. violacea are all morphologically related to Fu. meniscoidea by showing similar conidial septation ranges and lacking chlamydospores. Conidial size in Fu. meniscoidea is, however, markedly reduced and often closer to the lower limits of the conidial size of all the aforementioned species. Another species also described here, Fusicolla sporellula, lacks chlamydospores but has similar, although smaller, conidia with a reduced range of septa (0- or 1-septate). It furthermore differs from Fu. meniscoidea by its shorter and doliiform conidiogenous cells. Fusicolla sporellula Sand.-Den. & L. Lombard, sp. nov. MycoBank MB 838663. Fig. 28. Etymology: From Latin, very small spores, in reference to its very small conidia. FUSARIUM REDELIMITED Fig. 25. Fusicolla spp. A. Slimy macroscopic growth on natural substrate. B–E. Ascomata on natural substrate. F. Ostiolar hairs. G. Asci. H. Ascospores. I–K. Conidiophores and conidiogenous cells. L–N. Macroconidia. A. Fusicolla merismoides (photo J. Cunningham). B. Fusicolla melogrammae [CLL 16006, adapted from Crous et al. (2016)]. C–H. Fusicolla ossicola (photos N. Aplin and P. Cannon). I. Fusicolla merismoides (photo P. Cannon). J, K, M. Fusicolla aquaeductuum (CBS 734.79). L. Fusicolla violacea (CPC 38810). N. Fusicolla matuoi (CBS 581.78). Scale bars: B–E = 100 μm; F, H. 5 μm; all others = 10 μm. Fig. 26. Fusicolla quarantenae (URM 8367). A. Host. B–G. Conidiophores, conidiogenous cells and conidia. H. Macroconidia. Scale bars = 10 μm. Typus: South Africa, Transkei, from soil, unknown collection date (before 1983), unknown collector (holotype CBS H-24663, culture ex-type CBS 110191 = FRC E-0139). Conidiophores arising laterally from substrate and aerial hyphae 14–35 μm long, simple or laterally and verticillately branched, straight, hyaline, smooth- and thin-walled, or reduced to single conidiogenous cells. Conidiogenous cells monophialidic, doliiform, short lageniform to subulate 7.5–20 × 2.5–4 μm, smooth- and thin-walled, with or without inconspicuous periclinal thickening, collarettes absent; or reduced to short phialidic pegs emerging laterally from hyphae, 1–5 × 1–2.5 μm, smooth- and thin-walled, with inconspicuous periclinal thickening and an often conspicuously flared collarette. Macroconidia lunate to falcate, moderately to strongly www.studiesinmycology.org dorsiventrally curved, slightly narrowing towards both ends, apical cell blunt, more or less hooked, basal cell obtuse to poorly developed, foot-shaped, hyaline, thin- and smoothwalled, 0- or 1-septate, predominantly 1-septate, 0-septate: (11–)12–14( –15) × 2–3( –3.5) μm (av. 13.2 × 2.7 μm), 1-septate: (11.5–)13–16.5( –20) × 2.5–3.5 μm (av. 14.6 × 2.8 μm). Microconidia, chlamydospores, and sexual morph not observed. Culture characteristics: Colonies on PDA reaching 24–31 mm diam at 25 °C after 7 d. Surface white, luteous to orange, flat to slightly radially folded, membranous to slimy, margin entire; reverse pale luteous to saffron, peach at centre. On OA, pale luteous to peach, flat, membranous with filiform to undulate margins; reverse pale peach to saffron. 57 CROUS ET AL. Fig. 27. Fusicolla meniscoidea (CBS 110189). A–D. Conidiophores. E–H. Conidiogenous cells. I. Macroconidia. Scale bars: A–D, G–I = 10 μm; E, F = 5 μm. Fig. 28. Fusicolla sporellula (CBS 110191). A–C. Conidiophores. D–F. Conidiogenous cells. G. Macroconidia. Scale bars = 10 μm. Notes: Fusicolla sporellula presents the smallest conidia described to date for any species in this genus. This taxon is phylogenetically and morphologically related to Fu. meniscoidea, from which it can be differentiated by its smaller and less septate conidia, and by the characteristic doliiform shape of its conidiogenous cells. Geejayessia Schroers et al., Stud. Mycol. 68: 124. 2011. Figs 8, 29. Type species: Geejayessia cicatricum (Berk.) Schroers, Stud. Mycol. 68: 124. 2011. (See F. cicatricum in List section for synonyms) Ascomata perithecial, caespitose, with erumpent, byssoid or densely prosenchymatous stroma, superficial, broadly ampulliform with short ostiolar neck to broadly ellipsoidal, not collapsing when dry, pale orange, brownish to reddish orange, bright, reddish black or black, changing colour in KOH if not black and 58 becoming purple in lactic acid, mostly smooth-walled, lacking hairs or appendages. Ascomatal wall consists of a single region, comprising several layers of morphologically similar cells. Asci cylindrical to clavate, with a broadly rounded or flattened apex, with or without a minute refractive ring, 8-spored, mostly overlapping, uniseriate or biseriate above and uniseriate below. Ascospores broadly ellipsoidal to ellipsoidal, 1-septate, slightly constricted at the septum, verrucose, hyaline to pale brown. Conidiophores mononematous (aerial conidiophores) or grouped on sporodochia. Aerial conidiophores unbranched, sympodial or irregularly branched, bearing terminal or lateral phialides, often reduced to single phialides. Conidiogenous cells monophialidic, subcylindrical to cylindrical, smooth- and thin-walled, with periclinal thickening inconspicuous or absent. Aerial conidia hyaline, smooth- and thin-walled, of two types: microconidia, present in some species, ellipsoidal to fusoid, 0- or 1-septate, with rounded ends, straight to slightly curved; macroconidia typically formed on sporodochia, falcate, straight to gently curved dorsiventrally, FUSARIUM REDELIMITED Fig. 29. Geejayessia spp. A–E. Ascomata on natural substrate. F. Surface view of perithecial wall in 2 % KOH. G–I. Asci. J–M. Ascospores. N, O. Conidiophores and conidiogenous cells. P, Q. Macroconidia. A, C. Geejayessia cicatricum [CBS H-20375, adapted from Schroers et al. (2011)]. C. Geejayessia cicatricum (CBS H-20374). D, H, K, M. Geejayessia atrofusca (CBS H-20381). E–G, I, J, L. Geejayessia desmazieri (CBS H-20372). N, O, Q. Geejayessia atrofusca (CBS 502.94). P. Geejayessia cicatricum (CBS 125549). Scale bars: A = 500 μm; B, D, E = 200 μm; C = 100 μm; J–M = 5 μm; all others = 10 μm. 3–8-septate, with a blunt apical cell and well-developed footshaped basal cell. Sporodochia cream to pale yellow; sporodochial conidiophores verticillately branched and densely packed, consisting of short, smooth- and thin-walled stipes bearing an apical whorl of 2–3 monophialides; sporodochial conidiogenous cells monophialidic, cylindrical to subcylindrical, smooth- and thin-walled, with reduced or flared collarette. Chlamydospores unknown. [Description adapted from Schroers et al. (2011) and Lombard et al. (2015)]. Diagnostic features: Pale orange, brownish to reddish orange, bright red, reddish black to black, mostly smooth-walled perithecia with short ostiolar neck producing clavate to cylindrical asci bearing ellipsoidal, 1-septate, verrucose ascospores and asexual morphs producing only macroconidia on sporodochia or micro- and macroconidia on elongate subulate to subcylindrical aerial conidiophores with monophialides. Chlamydospores absent. aggregated, unbranched or sparsely branched, bearing up to three phialides; complex conidiophores solitary or aggregated in small sporodochia, repeatedly and irregularly branched. Conidiogenous cells monophialidic, cylindrical, tapering towards the apex. Microconidia 0- or 1-septate, ovoid to fusoid to ellipsoidal, with a minutely or clearly laterally displaced hilum, formed in heads on solitary conidiophores or as masses on sporodochia. Macroconidia straight, cylindrical, 1–3(–4)-septate, with both ends obtusely rounded, base sometimes with a visible, centrally located to laterally displaced hilum, forming flat domes of slimy masses. Chlamydospores globose to subglobose, thick-walled, intercalary or solitary, initially hyaline, becoming brown with age. [Description adapted from Chaverri et al. (2011)]. Diagnostic features: Red, mostly smooth-walled perithecia with conical papilla or flattened apex producing cylindrical asci bearing ellipsoidal, 1-septate ascospores and cylindrocarpon-like asexual morph characterised by 1–3(–4)-septate macroconidia with centrally located to laterally displaced hilum. Ilyonectria P. Chaverri & C. Salgado, Stud. Mycol. 68: 69. 2011. Fig. 8. Luteonectria Sand.-Den., L. Lombard, Schroers & Rossman, gen. nov. MycoBank MB 838664. Figs 8, 30. Type species: Ilyonectria destructans (Zinssm.) Rossman et al., Stud. Mycol. 80: 217. 2015. (See F. aderholdii in List section for synonyms) Etymology: Name refers to the luteous coloured, nectria-like ascomata characteristic of these fungi. Ascomata perithecial, solitary or gregarious, non-stromatic, superficial, globose to subglobose or ovoid to obpyriform, red, turning purple to dark purple in KOH, pigment dissolving in lactic acid, not collapsing when dry, with broadly conical papilla or flattened apex, smooth to slightly rugulose, lacking hairs or appendages. Ascomatal wall of two regions: outer region of thickwalled, pigmented cells forming a textura globosa; inner region of compressed, flattened cells, becoming thinner towards the centrum. Asci narrowly clavate to cylindrical, 8-spored, apex subtruncate, with inconspicuous apical ring, uniseriate. Ascospores ellipsoidal, 1-septate, hyaline, smooth. Conidiophores simple or complex or sporodochial; simple conidiophores arising laterally or terminally from aerial mycelium, solitary or loosely www.studiesinmycology.org Type species: Luteonectria albida (Rossman) Sand.-Den. & L. Lombard Ascomata perithecial, gregarious on a well-developed stroma composed of pseudoparenchymatous cells, covered with loose, white hyphae, smooth and thin-walled, globose to pyriform, offwhite to pale luteous, becoming ochraceous when dry, with a broadly rounded and papillate apical region, not changing colour in KOH or lactic acid, short setae-like hairs sometimes emerging from perithecial wall. Asci clavate with simple apex, 8-spored, ascospores overlapping irregularly uniseriate to biseriate. Ascospores fusiform with rounded ends, 3-septate, slightly constricted at septum, hyaline, becoming pale yellow-brown, smooth-walled to finely striate. Conidiophores mononematous, 59 CROUS ET AL. Fig. 30. Luteonectria albida. A–C. Ascomata on natural substrate. D. Surface view of perithecial wall in lactic acid. E. Detail of ascomata hair. F. Asci. G–J. Ascospores (J. Surface view). K, L. Conidiophores and conidiogenous cells. M. Macroconidia. A, C. BPI 550103. B. BPI 1108874. D–J. BPI 1108875. K–M. CBS 102683. Scale bars: A, B = 100 μm; C = 50 μm; all others = 10 μm. septate and irregularly branched, bearing terminal phialides. Conidiogenous cells monophialidic, cylindrical to subcylindrical, smooth- and thin-walled, with periclinal thickening inconspicuous to absent. Macroconidia fusoid and multiseptate, 1–7-septate, curved, hyaline, with a wide, blunt apical cell and a poorly- to well-developed, foot-shaped basal cell. Micro- and mesoconidia unknown. Chlamydospores unknown. [Description adapted from Rossman (1983) and Schroers et al. (2011)]. 1999, G.J. Samuels et al., BPI 746587, culture CBS 102683. Jamaica, Newcastle, Chesterville Youth Developmental Camp, on undetermined host, 8 Jan. 1971, A.Y. Rossman, BPI 550103. Venezuela, Los Venados, El Avila, along Trail 1–2 km above Los Venados, El Avila, on undetermined substrate, 24 Jul. 1972, K.P. Dumont et al., BPI 1108875. Diagnostic features: Off-white to pale luteous perithecia that do not change colour on KOH or lactic acid, formed on welldeveloped stroma producing clavate asci containing fusiform, 3septate, finely striate ascospores and fusarioid asexual morph characterised by monophialides producing robust multiseptate conidia from aerial conidiophores, lacking micro- and mesoconidia, and chlamydospores. Typus: Germany, Berlin, from soil with roots of Hedera helix, unknown date and collector (holotype BBA 72279 in B, culture ex-type BBA 72279 = NRRL 54600). Luteonectria albida (Rossman) Sand.-Den. & L. Lombard, comb. nov. MycoBank MB 838665. Basionym: Nectria albida Rossman, Mycol. Pap. 150: 79. 1983. Synonyms: Albonectria albida (Rossman) Guu & Y.M. Ju, Bot. Stud. (Taipei) 48: 189. 2007. Fusarium albidum (Rossman) O'Donnell & Geiser, Phytopathology 103: 404. 2013. Typus: Jamaica, Hanover Parish, Dolphin Head Mt. near Askenish, on bark of woody stem of unknown host, 22 Jan. 1971, R.P. Korf et al. (holotype CUP-MJ 942, culture ex-type ATCC 44543 = CTR 71-110 = BBA 67603 = NRRL 13950 = NRRL 22152). Description and illustration: Rossman (1983), Guu et al. (2007), Schroers et al. (2011). Additional material examined: Costa Rica, Lim
on, Central Distrito Valle, Valle del Estrella, Selva Biologia Hitoi Caneri, 100 –150 m alt, on bark of living tree, 7 Jul. 60 Luteonectria nematophila (Nirenberg & Hagedorn) Sand.-Den. & L. Lombard, comb. nov. MycoBank MB 838666. Basionym: Fusarium nematophilum Nirenberg & Hagedorn, Nachrichtenbl. Deutsch. Pflanzenschutzdienstes 60: 214. 2008. Description and illustration: Nirenberg & Hagedorn (2008). Macroconia (Wollenw.) Gr€afenhan et al., Stud. Mycol. 68: 101. 2011. Figs 8, 31. Basionym: Nectria sect. Macroconia Wollenw., Angew. Bot. 8: 179. 1926. Type species: Macroconia leptosphaeriae (Niessl) Gr€afenhan & Schroers, Stud. Mycol. 68: 102. 2011. Synonyms: Nectria leptosphaeriae Niessl, in Krieger, Fungi Saxon. Exs.: no. 165. 1886. Cucurbitaria leptosphaeriae (Niessl) Kuntze, Revis. Gen. Pl. 3: 461. 1898. Hypomyces leptosphaeriae (Niessl) Wollenw., Fusaria Autogr. Delin. 1: 57. 1916. Lasionectria leptosphaeriae (Niessl) Petch, Trans. Brit. Mycol. Soc. 21: 268. 1938. Cosmospora leptosphaeriae (Niessl) Rossman & Samuels, Stud. Mycol. 42: 122. 1999. Ascomata perithecial, solitary, with stroma inconspicuous or absent, subglobose with or without a small apical papilla, orange to carmine red, turning dark red to violet in KOH, sometimes with FUSARIUM hyphal hairs arising from the outer wall. Asci cylindrical to narrowly clavate, with a simple apex, 8-spored, uniseriate or partially biseriate. Ascospores yellowish, 1-septate, smooth, sometimes becoming striate when mature. Conidiophores initially as lateral phialides on somatic hyphae, later monochasial to verticillate, hyaline. Conidiogenous cells monophialidic, cylindrical to subulate, hyaline. Microconidia rare or absent, ellipsoidal to allantoid, hyaline. Macroconidia subcylindrical to curved, apical cell conical or hooked, basal cell poorly- to well-developed, footshaped, 3–7(–14)-septate, hyaline. Chlamydospores absent to rare, globose, single, in pairs or chains in hyphae. [Description adapted from Gr€afenhan et al. (2011)]. Diagnostic features: Orange-red to carmine-red perithecia with or without a small papilla producing cylindrical to narrowly clavate asci bearing 1-septate ascospores that sometimes become striate when mature, and asexual morphs characterised by verticillate conidiophores producing large, multiseptate fusarioid macroconidia. Macroconia bulbipes Crous & Sand.-Den., sp. nov. MycoBank MB 838667. Fig. 32. Etymology: Named after the shape of the basal cell, which is commonly swollen, bulbous. Typus: South Africa, Western Cape Province, Swellendam, Bontebok National Park, from Erica sp. associated with Dimerosporiopsis engleriana, 24 Sep. 2018, A.R. Wood (holotype CBS H-24664, culture ex-type CBS 146679 = CPC 37138). Conidiophores commonly aggregated into sporodochia, more rarely simple (aerial). Aerial conidiophores borne laterally on hyphae and commonly reduced to single conidiogenous cells, hyaline, thin- and smooth-walled, 23.5–39.6 μm long; conidiogenous cells monophialidic, subcylindrical to cylindrical, hyaline, (23–) 24–25(–26.5) × 3–4 μm, without discernible periclinal thickening or collarettes. Sporodochia abundantly formed on carnation leaves and on the agar surface, pink to pink-brown coloured. Sporodochia REDELIMITED light orange-peach, turning dark brick coloured in old cultures; sporodochial conidiophores irregularly or verticillately branched, 40–55.5 μm long, irregularly branched, bearing lateral and terminal solitary monophialides. Sporodochial conidiogenous cells monophialidic, cylindrical to subcylindrical to subulate, (8–) 14.5–26.5(–30.5) × 3.5–5.5 μm with inconspicuous periclinal thickening, flared collarettes absent. Microconidia absent. Macroconidia straight to moderately dorsiventrally curved, tapering toward the apex, apical cell conical or hooked, and slightly extended, basal cell well-developed, foot shaped, commonly irregularly swollen at bottom, (2–)3–5(–6)-septate, predominantly 4-septate, hyaline, thick- and smooth-walled: 2-septate conidia: 43–45.5 × 5–5.5 μm (av. 44.2 × 5.1 μm); 3-septate conidia: (38.5–) 41–53(–55) × 5–6 μm (av. 48.1 × 5.4 μm); 4-septate conidia: (45.5–)50–62(–67.5) × 5–6(–7) μm (av. 56.1 × 5.8 μm); 5-septate conidia: (58–)61–77(–80.5) × 5–6.5 μm (av. 68.9 × 5.8 μm); 6septate conidia: (70–)71–74 × 5.5–6.5(–7) μm (av. 72.1 × 6.4 μm); overall: (38.5–)48–68(–80.5) × 5–6(–7) μm (av. 58 × 5.7 μm). Chlamydospores commonly formed in the substrate mycelium and conidia, spherical to subspherical, 8.5–11(–12.5) μm diam, hyaline and smooth-walled. Sexual morph not observed. Culture characteristics: Colonies on PDA reaching 21–24 mm diam at 25 °C after 7 d. Surface salmon to buff, flat, membranous to velvety, with scant aerial mycelium and pionnotal, margin white and regular; reverse pale salmon with radial white to pale yellow patches. On OA, salmon to buff, flat, membranous and pionnotal, with regular margin; reverse pale pink to salmon. Additional material examined: South Africa, Western Cape Province, Swellendam, Bontebok National Park, from Erica sp. associated with Dimerosporiopsis engleriana, 24 Sep. 2018, A.R. Wood, culture CBS 146678 = CPC 37137. Notes: Macroconia bulbipes resolved as the closest phylogenetic relative to Ma. gigas and Ma. papilionacearum (Fig. 13). The former is, however, clearly distinguished morphologically by its Fig. 31. Macroconia spp. A–D. Ascomata on natural substrate. E. Surface view of perithecial wall in 2 % KOH. F. Asci. G–J. Ascospores (J. Surface view). K–M. Conidiophores and conidiogenous cells. N. Microconidia. O, P. Macroconidia. A. Macroconia cupularis [HMAS 97514, adapted from Luo & Zhuang (2008)]. B, C. Macroconia leptosphaeriae (photo P. Mlcoch). D. Macroconia gigas [HMAS 99592, adapted from Luo & Zhuang (2008)]. E–J. Macroconia leptosphaeriae (CBS H-15051). K, L. Macroconia phlogioides (CBS 125496). M, N. Macroconia leptosphaeriae (CBS 10001). O. Macroconia phlogioides (CBS 146500). P. Macroconia bulbipes (CBS 146679). Scale bars: A–D = 100 μm; G–J = 5 μm; all others = 10 μm. www.studiesinmycology.org 61 CROUS ET AL. Fig. 32. Macroconia bulbipes (CBS 146679). A–D. Conidiophores and conidiogenous cells. E, F. Sporodochia formed on the agar surface. G, H. Detail of macroconidia basal cells. I. Macroconidia. Scale bars: E, F = 100 μm; G, H = 5 μm; all others = 10 μm. smaller and less septate conidia (rarely up to 80.5 μm long and up to 6-septate vs longer than 100 μm and more than 10-septate in the latter two species). On the contrary, the asexual morph of Ma. bulbipes is closer to that of Ma. leptosphaeriae and Ma. sphaeriae (recognised as two distinct species in Gr€afenhan et al. 2011). The conidia of Ma. bulbipes, however, differ by having commonly swollen basal cells. Macroconia phlogioides Sand.-Den. & Crous, sp. nov. MycoBank MB 838668. Fig. 33. Etymology: From Greek fl
oga. Referring to the flame-like macroscopic semblance of the sporodochia. Typus: South Africa, Limpopo Province, Tzaneen, on leaf of Encephalartos sp., 2019, P.W. Crous (holotype CBS H-24665, culture ex-type CBS 146501 = CPC 35389). Conidiophores simple (aerial) or aggregated into sporodochia. Aerial conidiophores often borne laterally on hyphae and reduced to single conidiogenous cells, rarely 1-septate, hyaline, thin- and smooth-walled, 13–17 × 26–32 μm; conidiogenous cells monophialidic, subcylindrical to cylindrical, hyaline, (13–) 16–24(–27.5) × (3.5–)4–5 μm conidiogenous opening rather wide, with inconspicuous periclinal thickening and no discernible apical collarettes. Sporodochia orange-pink to pink-brown coloured, often acquiring a flame-like, somewhat pointy macroscopic appearance and later merging into pionnotal crusts; sporodochial conidiophores irregularly or verticillately branched, 37.5–46 μm long, often bearing groups of 2–3 conidiogenous cells; sporodochial conidiogenous cells monophialidic, subcylindrical to subulate, (10–)18.5–26(–30) × (2.5–)3.5–5 μm with inconspicuous periclinal thickening, collarettes absent. Microconidia absent. Macroconidia robust, often with a nearly 62 straight central portion and markedly curved and tapering towards both ends, apical cell conical to hooked, basal cell welldeveloped, foot-shaped, (1–)9–15(–19)-septate, predominantly 11-septate, hyaline, thick- and smooth-walled: 9-septate conidia: (106.5–)119.5–140(–143.5) × 7.5–8.5(–9) μm (av. 129 × 8 μm); 10-septate conidia: (116–)120–144.5(–164) × (7–)7.5–9 μm (av. 132 × 8 μm); 11-septate conidia: (122–)127–140 (–153.5) × 7.5–9(–9.5) μm (av. 134 × 8.5 μm); 12-septate conidia: (119–)127.5–146.5(–153) × 7.5–9.5(–10) μm (av. 137 × 8.5 μm); 13-septate conidia: (128–)132–155 (–172) × (7–)8–9(–10) μm (av. 143.5 × 8.5 μm); 14-septate conidia: (133.5–)136–157(–168) × 8–9.5 μm (av. 146.5 × 9 μm); 15-septate conidia: 147–163.5(–173.5) × 8.5–9.5(–10) μm (av. 155 × 9 μm); overall: (86–) 123.5–150(–175) × (7–)8–9(–10) μm (av. 137 × 8.5 μm). Chlamydospores and sexual morph not observed. Culture characteristics: Colonies on PDA reaching 17–25 mm diam at 25 °C after 7 d. Surface salmon, buff to rosy buff, flat to slightly raised at centre, glabrous or with central patches of white, dense aerial mycelium; membranous to dusty with regular margin; reverse pale luteous to sulphur yellow, with salmon patches. On OA, salmon, flat, membranous, inconspicuously radially folded with regular margin; reverse pale pink to luteous with more intense salmon-coloured patches. Additional material examined: South Africa, Limpopo Province, Tzaneen, on leaf of Encephalartos sp., 2019, P.W. Crous, culture CBS 146500 = CPC 35388. USA, Arizona, Huachuca Mountains, Miller Canyon, on branch of Quercus sp. in stream, 1 Oct. 2008, T. Gr€afenhan, culture CBS 125496. Notes: Macroconia phlogioides is morphologically related to Ma. papilionacearum and Ma. gigas. These three species are characterised by producing robust and large (often above 100 μm FUSARIUM REDELIMITED Fig. 33. Macroconia phlogioides (CBS 146501). A–C. Conidiophores. D, E. Conidiogenous cells. F, G. Sporodochia formed on the agar surface. H. Macroconidia. Scale bars: B, C = 20 μm; F, G = 50 μm; all others = 10 μm. long) macroconidia. Unlike the above-mentioned species, however, conidia of Ma. phlogioides tend to present a higher number of septa (up to 19 vs up to 12 and 14, for Ma. papilionacearum and Ma. gigas, respectively), with rounder and less tapered apical cells, contrasting with the elongated conidial apices of Ma. gigas. Conidia of Ma. phlogioides also differ by having a more pronounced and continuous curvature compared to Ma. gigas and Ma. papilionacearum. These three species are clearly different phylogenetically, clustering in distant monophyletic lineages of the genus (Fig. 13). Mariannaea G. Arnaud ex Samson, Stud. Mycol. 6: 74. 1974. Fig. 8. Type species: Mariannaea elegans (Corda) Samson, Stud. Mycol. 6: 75. 1974. Basionym: Penicillium elegans Corda, Icon. Fung. 2: 17. 1838. Synonyms: Hormodendron elegans (Corda) Bonorden, Handb. Allg. Mykol.: 76. 1851. Spicaria elegans (Corda) Harz., Bull. Soc. Imp. Naturalistes Moscou 44: 238. 1871. Paecilomyces elegans (Corda) Mason & Hughes, Mycol. Pap. 45: 27. 1951. Ascomata perithecial, solitary, non-stromatic or on inconspicuous stroma, superficial, globose with flat apex, not collapsing or laterally pinched when dry, pale yellow, orange or brown, not reacting in KOH, smooth-walled to slightly rugose, lacking hairs or appendages. Asci cylindrical to narrowly clavate, 8-spored sometimes with inconspicuous apical ring, uniseriate to apically biseriate. Ascospores 1-septate, hyaline, smooth-walled to spinulose. Conidiophores verticillate to penicillate, hyaline, with phialides arising directly from the stipe or forming whorls of metulae on lower parts of stipe; stipe hyaline, becoming yellow- www.studiesinmycology.org brown at the base. Conidiogenous cells monophialidic, ampulliform, hyaline, usually with obvious periclinal thickening and inconspicuous collarettes. Conidia limoniform, aseptate, hyaline, in chains that collapse to form slimy heads. Chlamydospores globose to ellipsoidal, hyaline, formed in intercalary chains. [Description adapted from Samson (1974), Gr€afenhan et al. (2011) and Lombard et al. (2015)]. Diagnostic features: Pale yellow, orange to brown perithecia with flattened apex producing cylindrical to narrowly clavate asci bearing 1-septate ascospores and asexual morphs characterised by verticillate to penicillate conidiophores producing small, aseptate, limoniform conidia in chains that collapse into slimy heads. Microcera Desm., Ann. Sci. Nat. Bot., s
er. 3, 10: 359. 1848. Figs 8, 34. Synonym: Pseudomicrocera Petch, Trans. Brit. Mycol. Soc. 7: 164. 1921. Type species: Microcera coccophila Desm., Ann. Sci. Nat. Bot., s
er. 3, 10: 359. 1848. (See F. coccophilum in List section for synonyms) Ascomata perithecial, solitary or gregarious, with stroma and/or byssus covering host, globose, with a blunt papilla, orange to dark red, turning dark red or violet in KOH, finely roughened. Asci cylindrical to narrowly clavate, with an apical ring, 8-spored. Ascospores hyaline to pale yellow-brown, 1(–3)-septate, smooth, sometimes becoming tuberculate when mature. Conidiophores as lateral phialides on somatic hyphae, becoming monochasial, verticillate to penicillate, hyaline, forming discrete sporodochia or synnemata on the host. Conidiogenous cells monophialidic, cylindrical to subulate to subclavate, hyaline. Macroconidia pale, orange, pink or bright red in mass, subcylindrical, moderately or conspicuously curved, apical cell often 63 CROUS ET AL. slightly or conspicuously hooked, basal cell papillate to welldeveloped, foot-shaped, (0–)3–5(–12)-septate, hyaline. [Description adapted from Gr€afenhan et al. (2011)]. Diagnostic features: Orange to dark red perithecia with a blunt papilla producing cylindrical to narrowly clavate asci bearing yellow-brown, 1(–3)-septate ascospores; asexual morphs characterised by verticillate to penicillate conidiophores producing small macroconidia; species typically associated with scale insects. Neocosmospora E.F. Sm., Bull. U.S.D.A. 17: 45. 1899. Figs 8, 35. Type species: Neocosmospora vasinfecta E.F. Sm., Bull. U.S.D.A. 17: 45. 1899. (See F. neocosmosporiellum in List section for synonyms) Ascomata perithecial, solitary or gregarious, non-stromatic or with reduced basal stroma, superficial, globose to pyriform, not collapsing when dry, orange-brown to bright red, darkening or becoming purple in KOH, papillate or with short ostiolar neck, commonly tuberculate, rarely smooth-walled, lacking hairs or appendages. Ascomatal wall of two regions: outer region of thickwalled, pigmented cells forming a textura angularis; inner region of elongate, hyaline, thin-walled cells, becoming thinner towards the centrum. Asci saccate, clavate to cylindrical, unitunicate, apex simple, rounded or flattened, 8-spored, uniseriate to irregularly biseriate. Ascospores globose to ellipsoidal, with or without slightly truncate ends, typically 1-septate, hyaline when young becoming yellow golden-brown at maturity, thick-walled, longitudinally striate; ascospores in some species 0-septate, cerebriform or spinulose. Conidiophores mononematous (aerial) or grouped on sporodochia, or somewhat erect, loosely branched sporodochial pustules. Aerial conidiophores simple, sparsely to highly branched; aerial conidiogenous cells monophialidic, elongate subulate to subcylindrical. Aerial conidia hyaline, smooth- and thick-walled, of two types: microconidia subglobose, ellipsoidal to somewhat clavate, 0–2(–4)-septate, borne in false heads on phialides; macroconidia falcate, slightly to strongly curved dorsiventrally, 1-septate to multiseptate, with blunt to hooked to slightly pointed apical cell and papillate to welldeveloped foot-shaped basal cell. Sporodochia cream, pale luteous, light green, olivaceous, bluish, hazel to greyish sepia; sporodochial conidiophores verticillately or sympodially branched or sparingly branched and densely packed, consisting of short, smooth- and thin-walled stipes bearing apical whorl of 2–4 monophialides; sporodochial conidiogenous cells monophialidic, doliiform, short subcylindrical to subulate, smooth- and thinwalled, periclinal thickening and collarettes inconspicuous or absent. Sporodochial macroconidia falcate, smooth- and thickwalled, straight or curved with parallel walls to unequally curved, in some species clavate and asymmetrical, tapering towards both ends, with a pointed to blunt to hooked apical cell and papillate to well-developed foot-shaped basal cell. Chlamydospores globose to subglobose to ovoid to obovoid, hyaline to pale golden brown, smooth-walled to slightly verrucose, terminal or intercalary, solitary or in pairs or forming chains or aggregating in some species to form buff, olive aeruginous or bluish microsclerotia. [Description adapted from Rossman et al. (1999) and SandovalDenis et al. (2019)]. Diagnostic features: Orange-brown to frequently bright, blood red warted perithecia with papillate or short ostiolar neck producing saccate, clavate to cylindrical asci bearing globose to ellipsoidal, 0or 1-septate, longitudinally striate, cerebriform or spinulose ascospores and asexual morphs producing micro- and macroconidia on elongate subulate to subcylindrical aerial conidiophores with monophialides or only macroconidia in sporodochia. Chlamydospores formed in hyphae, rarely observed in macroconidia. Neocosmospora epipeda Quaedvl. & Sand.-Den., sp. nov. MycoBank MB 838669. Fig. 36. Fig. 34. Microcera spp. A–C. Ascomata on natural substrate. D. Surface view of perithecial wall in 2 % KOH. E, F. Asci. G–K. Ascospores (J, K. Surface view). L–N. Conidiophores and conidiogenous cells. O–Q. Macroconidia. A. Microcera auranticola (photo N. Aplin). B, O. Microcera coccophila [adapted from Gr€afenhan et al. (2011)]. C. Microcera larvarum [adapted from Gr€afenhan et al. (2011)]. D, F–J. Microcera coccophila (K(M) 165807). E, K. Microcera larvarum (photo P. Cannon). L, M, Q. Microcera rubra (CBS 638.76). N, P. Microcera larvarum (CBS 169.30). Scale bars: A, B = 100 μm; G–K = 5 μm; all others = 10 μm. 64 FUSARIUM REDELIMITED Fig. 35. Neocosmospora spp. A–E. Ascomata on culture. F. Surface view of perithecial wall in 2 % KOH. G–I. Asci. J–Q. Ascospores (K, M, O, Q. Surface view). R–U. Aerial conidiophores. V. Sporodochial conidiophores. W, X. Microconidia. Y–A5. Macroconidia. A, I, N, O. Neocosmospora vasinfecta (CBS 446.93). B. Neocosmospora sp. (CPC 34617). C, S, W, A1. Neocosmospora elegans (CBS 144396). D. Neocosmospora vasinfecta (CBS 863.70). E. Neocosmospora bataticola (CBS 144398). F, L, M. Neocosmospora ipomoeae (CBS 833.97). G. Neocosmospora robiniae (CBS 119601). H, J, K. Neocosmospora diminuta (CBS 144390). O, Q. Neocosmospora spinulosa (CBS H5443). R, V, A3. Neocosmospora solani (CBS 140079). T. Neocosmospora bataticola (CBS 144398). U. Neocosmospora suttoniana (CBS 143214). X. Neocosmospora tonkinensis (CBS 115.40). Y. Neocosmospora longissima (CBS 126407). Z. Neocosmospora mori (CBS 145467). A2. Neocosmospora pseudoradicicola (CBS 145472). A4. Neocosmospora keratoplastica (CBS 490.63). A5. Neocosmospora oligoseptata (CBS 143241). [A, C, S, T, W, Y, Z, A1, A2. Adapted from adapted from Sandoval-Denis et al. (2019). R, V, A3, Adapted from Crous et al. (2019a). U, X, A4. Adapted from Sandoval-Denis & Crous (2018)]. Scale bars: A, B = 200 μm; C–E 100 μm; R–T = 20 μm; J–Q, W, X = 5 μm; all others = 10 μm. Etymology: From the Greek επ ίπεδα, flat; referring to the microconidia of this species commonly being flattened on one side. Typus: Netherlands, from Bouvardia sp. imported from Uganda, 2019, W. Quaedvlieg (holotype CBS H-24666, culture ex-type CBS 146523 = CPC 38310). Conidiophores borne on the agar substrate and aerial mycelium, 78–230 μm tall, unbranched or more commonly sympodially branched at various levels, bearing terminal single phialides; www.studiesinmycology.org aerial conidiogenous cells monophialidic, subulate, subcylindrical to acicular, smooth- and thin-walled, 27.5–62 × 2–3.5 μm, short apical collarettes and periclinal thickening inconspicuous or absent. Aerial conidia microconidial, arranged in false heads on phialide tips, hyaline, broadly ellipsoidal, ellipsoidal to short clavate, commonly asymmetrical with a somewhat flattened side, smooth- and thin-walled, aseptate, (4.5–)6–10(–13.5) × (2–) 3–5 μm (av. 8 × 3.5 μm). Sporodochia pale luteous to orange, formed abundantly on the surface of carnation leaves; 65 CROUS ET AL. sporodochial conidiophores laterally and irregularly branched bearing apical groups of 2–3 monophialides; sporodochial conidiogenous cells monophialidic, subulate to subcylindrical, 11–19.5 × 3–4.5 μm, smooth and thin-walled, with short, nonflared collarettes and inconspicuous or absent periclinal thickening. Sporodochial conidia falcate, almost straight to slightly curved dorsoventrally, broadest near the half portion or the upper third, tapering towards both ends, with a blunt to somewhat pointy and slightly curved apical cell and an often welldeveloped foot-shaped basal cell, (3–)4–7(–8)-septate, predominantly 5-septate, hyaline, smooth- and thick-walled; 3septate conidia: 42.5 × 4.4 μm; 4-septate conidia: (41.5–) 44–58(–60) × 4–5 μm (av. 51.1 × 4.4 μm); 5-septate conidia: (53.5–)59–69.5(–76) × 4–6 μm (av. 64.3 × 5 μm); 6-septate conidia: 68–75.5(–79.5) × 4.5–6 μm (av. 71.7 × 5.3 μm); 7-septate conidia: (68–)69–74.5(–77) × 5–6 μm (av. 71.7 × 5.5 μm); 8-septate conidia: 74–75.5 × 5–6 μm (av. 74.7 × 5.3 μm); overall: (42.5–)59–73.5(–79.5) × (4–)5–6 μm (av. 66.3 × 5.1 μm). Chlamydospores and sexual morph not observed. Culture characteristics: Colonies on PDA reaching 38–53 mm diam at 25 °C after 7 d. Surface white to sulphur yellow with scarce pale ochreous to pale rust patches, flat to slightly raised with abundant white aerial mycelium, cottony to woolly, margin filiform; reverse pale luteous to sulphur yellow, pale apricot to pale rust at centre. On OA, pale luteous, flat, membranous with entire margin; reverse pale luteous. Additional material examined: Netherlands, from Bouvardia sp. imported from Uganda, 2019, W. Quaedvlieg, culture CBS 146524 = CPC 38311. Notes: The name N. epipeda is coined here for a novel phylogenetic lineage discovered on a Bouvardia sp. imported from Uganda. The new species clusters as the closest phylogenetic relative of N. catenata (Fig. 14), an opportunistic animal-pathogenic species characterised by abundant production of catenate to clustered, pigmented chlamydospores, and by the absence (as far as known) of macroconidia (O'Donnell et al. 2016, Sandoval-Denis & Crous 2018). These characters form the most notable differences with respect to N. epipeda. Additionally, N. epipeda can be differentiated from N. catenata by its less Fig. 36. Neocosmospora epipeda (CBS 146524). A–C. Aerial conidiophores and conidiogenous cells. D. Microconidia. E, F. Sporodochia formed on the surface of carnation leaves. G. Sporodochial conidiophores and conidiogenous cells. H. Macroconidia. Scale bars: A–C = 20 μm; E, F = 200 μm; D, G, H = 10 μm. 66 FUSARIUM septate and shorter microconidia (aseptate and up to 13.5 μm vs up to 1-septate and 11 μm in N. catenata). Other species producing macroconidia of similar size and shape to those of N. epipeda include N. quercicola, N. robusta, and N. silvicola; however, the three latter species are genetically distant in that they belong to monophyletic lineages of clade 3 (N. quercicola and N. silvicola) and clade 1 (N. robusta) of Neocosmospora sensu O'Donnell et al. (2008a). Neocosmospora epipeda can be distinguished morphologically from N. robusta by the production of microconidia with absence of aerial macroconidia in the former species. Morphological differentiation of the novel species from N. quercicola and N. silvicola is difficult because of overlapping features; nevertheless, subtle differences exist in the size and morphology of the microconidia (aseptate in N. epipeda vs up to 1-septate in both N. quercicola and N. silvicola, being also reniform and longer in the latter species) and sporodochial colour (pale luteous to orange in N. epipeda vs greenish to citrine in N. quercicola and N. silvicola, respectively). Neocosmospora merkxiana Quaedvl. & Sand.-Den., sp. nov. MycoBank MB 838670. Fig. 37. Etymology: Named after Trix Merkx, senior technician at the Westerdijk Fungal Biodiversity Institute, in recognition of her career as the foremost link in strain handling between the research groups and the culture collection. Typus: Netherlands, from Chrysanthemum sp. imported from Uganda, unknown date, W. Quaedvlieg (holotype CBS H24669, culture ex-type CBS 146525 = CPC 38701). Conidiophores borne on the agar substrate and aerial mycelium, 99–205 μm tall, unbranched or rarely laterally branched, bearing terminal single phialides; aerial conidiogenous cells monophialidic, subulate to subcylindrical, smooth- and thin-walled, 41.5–77 × 2.5–4.5 μm, with short and flared apical collarettes and inconspicuous periclinal thickening. Aerial conidia of two types: microconidia oval to broadly ellipsoidal, straight to slightly curved and asymmetrical, smooth- and thin-walled, 0(–1)-aseptate, (8.5–)9–15.5(–18.5) × 3–5.5 μm (av. 12.4 × 4.3 ìm), arranged in false heads on phialide tips; macroconidia falcate to navicular, smooth- and thin-walled, almost straight to slightly dorsiventrally curved, ventral face almost straight, with a blunt apical cell, basal cell obtuse to poorly-developed, footshaped, 1–3-septate, predominantly 1-septate, 1-septate conidia: (17.5–)20.5–27(–30.5) × (4.5–)5–6.5(–7.5) μm (av. 23.8 × 5.8 μm); 2-septate conidia: (25.5–) 27–30(–32) × 5.5–7 μm (av. 28.4 × 6 μm); 3-septate conidia: (27–)28.5–33.5(–35.5) × 5–7.5 μm (av. 31.1 × 6.3 μm); overall: (17.5–)22–31(–35.5) × (4.5–)5–6.5(–7.5) μm (av. 26.4 × 6 μm), arranged in false heads at the tip of monophialides and produced intermixed with microconidia. Sporodochia pale luteous, formed on aerial and substrate mycelium, uncommon on carnation leaves. Sporodochial conidiophores laterally and irregularly branched bearing apical groups of 2–3 monophialides; sporodochial conidiogenous cells monophialidic, doliiform, subulate to subcylindrical, (13.5–) 15–21.5(–27) × 2.5–5.5 μm, smooth and thin-walled, lacking apical collarettes and with inconspicuous periclinal thickening. Sporodochial macroconidia falcate, straight to slightly dorsiventrally curved, broadest at the half portion and tapering towards both ends, apical cell blunt and slightly curved, basal cell poorlyto well-developed, foot-shaped, (1–)3–5-septate, predominantly 4-septate, hyaline, smooth- and thick-walled; 1-septate conidia: www.studiesinmycology.org REDELIMITED (23.5–)24.5–28.5 × 5–6.5 μm (av. 25.8 × 5.6 μm); 2-septate conidia: 27–29 × 5.5–6.5 μm (av. 28 × 6 μm); 3-septate conidia: (29–)35–45 × (4.5–)5–6 μm (av. 40.1 × 5.3 μm); 4-septate conidia: (41–)44.5–49.5(–51.5) × 4.5–6.5 μm (av. 47 × 5.6 μm); 5-septate conidia: (42–)45.5–51.5(–52.5) × 5–6 μm (av. 48.5 × 5.6 μm); overall: (24.5–)39–51.5(–52.5) × 4.5–6(–6.5) μm (av. 45.2 × 5.6 μm). Chlamydospores obovoidal, subspherical to spherical, hyaline to pale yellow brown, smooth-walled to slightly roughened, thick-walled, 5–13.5 μm, single or in chains, terminal, intercalary or produced on short lateral stipes. Culture characteristics: Colonies on PDA reaching 45–56 mm diam at 25 °C after 7 d. Surface pale luteus to sulphur yellow, becoming buff to honey, flat with abundant aerial mycelium, cottony to woolly with entire to filiform margin; reverse luteous to buff, pale scarlet to bay at centre. On OA pale luteous to peach with sparse white cushions of aerial mycelium, flat, velvety to cottony; reverse pale luteous, peach to pale scarlet. Additional material examined: Netherlands, from Chrysanthemum sp. imported from Uganda, unknown date, W. Quaedvlieg, culture CBS 146526 = CPC 38702. Notes: Neocosmospora merkxiana represents the phylogenetic species formerly known as “FSSC 41”, one of the few previously known clades lacking a Latin binomial, originally reported as an agent of collar rot on Passiflora edulis f. flavicarpa in Brazil (Cardoso 2015, Sandoval-Denis et al. 2019). Here, this species is reported causing collar and stem rot symptoms in Chrysanthemum imported from Uganda. In the phylogenetic analysis (Fig. 14), N. merkxiana resolved as the most basal taxon within a lineage containing the morphologically similar species N. ipomoeae, N. martii, and N. noneumartii, all characterised by producing both aerial microconidia and macroconidia, in addition to relatively long sporodochial conidia. Differing from the aforementioned species, N. merkxiana can be differentiated by its fewer septate and shorter aerial and sporodochial macroconidia formed on pale luteous sporodochia, and its pale luteous colonies on PDA, thus contrasting with the greenish sporodochial colouration observed in both N. ipomoeae and N. noneumartii, and the red pigmentation on PDA typical of N. martii. Sexual morphs were not observed in the isolates studied here; however, this lineage was reported as heterothallic, and fertile perithecial ascomata have been induced in vitro (Cardoso characterised by ascomata measuring 2015), 230–355 × 175–290 μm, 57.5–75 × 5 μm asci producing 1septate, 10–12.5 × 5 μm ascospores. Neocosmospora neerlandica Crous & Sand.-Den., sp. nov. MycoBank MB 838671. Fig. 38. Etymology: Named after the country where the type was isolated, the Netherlands. Typus: Netherlands, Zeeland Province, Zuid-Beveland, near Wolphaartsdijk, from Pisum sativum, unknown date, J.C. Went (holotype CBS H-24667, culture ex-type CBS 232.34). Conidiophores borne on agar substrate and aerial mycelium up to 290 μm tall, unbranched or irregularly laterally branched, bearing terminal single monophialides, commonly proliferating percurrently; aerial conidiogenous cells monophialidic, subulate to subcylindrical, commonly extended percurrently, smooth- and thin-walled, 21–87 × 1.5–3.5 μm, with short and flared apical 67 CROUS ET AL. Fig. 37. Neocosmospora merkxiana (CBS 146525). A–E. Aerial conidiophores and conidiogenous cells. F. Sporodochium on aerial mycelium. G, H. Chlamydospores. I, J. Sporodochial conidiophores and conidiogenous cells. K. Microconidia. L. Aerial macroconidia. M. Sporodochial macroconidia. Scale bars: A, E = 100 μm; C = 20 μm; all others = 10 μm. collarettes and rather evident periclinal thickening. Aerial conidia of two types: microconidia oval to broadly ellipsoidal, smoothand thin-walled, 0- or 1-septate, (5.5–)8–14(–30) × (2–) 3–4.5(–5.5) μm (av. 11 × 3.8 μm), arranged in false heads on phialide tips; macroconidia fusiform to falcate, smooth- and thick-walled, straight to slightly curved, with a blunt apical cell, basal cell often flattened to obtuse, (1–)2–3-septate, predominantly 3-septate, 1-septate conidia: 22.5–26 × 4.5–6 μm (av. 24.4 × 5.1 μm); 2-septate conidia: (22.5–) 68 23.5–32 × 3.5–5 μm (av. 27 × 4.3 μm); 3-septate conidia: (24–) 25–32.5(–38.5) × (3.5–)4.5–5.5(–6) μm (av. 28.7 × 4.8 μm); overall: (22.5–)24–31.5(–38.5) × (3.5–)4.5–6 μm (av. 27.7 × 4.8 μm), arranged in false heads at the tip of monophialides and produced intermixed with microconidia. Chlamydospores subspherical to spherical, pale golden brown, smooth- and thick-walled, 6–8 μm, single or in pairs, terminal or more often formed intercalary on hyphae. Sexual morph and sporodochia unknown. FUSARIUM REDELIMITED Fig. 38. Neocosmospora neerlandica (CBS 232.34). A–C. Conidiophores. D. Microconidia. E, F. Chlamydospores. G. Macroconidia. Scale bars: F = 5 μm; all others = 10 μm. Culture characteristics: Colonies on PDA reaching 42–51 mm diam at 25 °C after 7 d. Surface white to pale luteous, flat with abundant dense aerial mycelium, velvety to cottony, margin regular and filiform; reverse pale luteous to sulphur yellow. On OA white to pale luteous, flat to slightly raised, velvety to cottony, margin regular and filiform; reverse pale luteous. Notes: The type of N. neerlandica was originally deposited as N. pisi, an important root pathogen of Pisum sativum. Besides sharing the same host association, both species are genetically related, but cluster in distinct phylogenetic lineages and have a different morphology. Although N. pisi produces typical wedgeshaped, larger macroconidia (up to 46 um long) on abundant  si
c et al. 2018b), N. neerlandica is characterised sporodochia (Si by short falcate macroconidia (up to 38.5 um long) produced on aerial conidiophores, while sporodochia are not formed. The latter features relate N. neerlandica to N. diminuta, a phylogenetically distant species that produces the shortest falcate conidia known in Neocosmospora (Sandoval-Denis et al. 2019). Nevertheless, N. diminuta is a homothallic species that conspicuously produces sexual structures, while a sexual morph is not known for N. neerlandica. Additionally, macroconidia of N. neerlandica differ from those of N. diminuta by having less curved apices and poorly developed or non foot-shaped basal cells. Neocosmospora nelsonii Crous & Sand.-Den., sp. nov. MycoBank MB 838672. Fig. 39. Etymology: In honour of Paul E. Nelson, prominent Fusarium researcher and collector of the ex-type strain of this species. Typus: Unknown country, from Pisum sativum, unknown date, P.E. Nelson (holotype CBS H-12719, culture ex-type CBS 309.75). Conidiophores borne on agar substrate and aerial mycelium, 59–330 μm tall, often simple and reduced to solitary phialides borne laterally from hyphae, or laterally irregularly and sympodially branching one or two times, bearing terminal single phialides; aerial conidiogenous cells monophialidic, subulate to www.studiesinmycology.org subcylindrical, smooth- and thin-walled, 21–57.5 × 2–5 μm, flared apical collarettes and periclinal thickening present. Aerial microconidia arranged in false heads on phialide tips, hyaline, broadly ellipsoidal, obovate to broadly clavate, smooth- and thinwalled, 0(–1)-septate, (5–)7–13(–17) × 2.5–5 μm (av. 10.1 × 3.7 μm). Sporodochia (from holotype specimen) pale citrine to olivaceous; sporodochial conidiophores copiously branched, laterally, verticillate and irregularly, bearing apical groups of 2–3 monophialides and lateral solitary phialides; sporodochial conidiogenous cells monophialidic, doliiform, subulate to subcylindrical, 6–21.5 × 3–4.5 μm, smooth and thinwalled, with short, conspicuously flared collarettes and conspicuous periclinal thickening, profusely proliferating percurrently. Sporodochial macroconidia falcate, gently and regularly curved dorsoventrally or with an almost straight ventral line, broadest at the middle portion, apical cell blunt and slightly hooked, basal cell papillate to well-developed, foot-shaped, 1–3(–4)-septate, predominantly 3-septate, hyaline, smooth- and thick-walled; 1-septate conidia: (17.5–)19–26(–29.5) × 4–5 μm (av. 22.4 × 4.4 μm); 2-septate conidia: (26–) 27–34 × 3.5–5.5 μm (av. 30 × 4.7 μm); 3-septate conidia: (25.5–)30.5–38(–42) × 4–5.5 μm (av. 34.3 × 4.8 μm); 4-septate conidia: 38.5–43.5 × 4.5–5.5 μm (av. 40.7 × 5.0 μm); overall: (17.5–)27–38(–43.5) × (3.5–)4–5.5 μm (av. 32.5 × 4.7 μm). Chlamydospores subspherical to spherical, pale golden brown, smooth- and thick-walled, 4–11.5 μm, formed singly and terminally on hyphae. Sexual morph not observed. Culture characteristics: Colonies on PDA reaching 35–49 mm diam at 25 °C after 7 d. Surface pale luteous, pale saffron to sulphur yellow, flat with abundant dense and short aerial mycelium, velvety to woolly, margin filiform; reverse sulphur yellow. On OA pale luteous, flat, membranous to dusty with filiform margin; reverse pale luteous. Notes: The ex-type of N. nelsonii, originally determined as “F.” solani, currently presents a very simple microconidial morphology with a rather acremonioid touch given its slender, generally simple conidiophores and mostly aseptate 69 CROUS ET AL. Fig. 39. Neocosmospora nelsonii (CBS 309.75). A–D. Conidiophores and conidiogenous cells. E, F. Chlamydospores. G. Microconidia. H. Sporodochium. I, J. Sporodochial conidiophores and conidiogenous cells. K. Macroconidia. Scale bars: E, F = 5 μm; all others = 10 μm. microconidia. Hence, there are no clear phenotypic characters to differentiate the species. Failed attempts to induce formation of sporodochia indicate that the ex-type strain may have lost the ability to produce macroconidia in vitro. The holotype material, is, however, a dried subculture from the type strain dated from 1982. It still contains a large amount of well-preserved sporodochia and sporodochial conidia, which we describe here. These macroconidia are comparable in size to those observed in closely related species such as N. brevis, N. pisi, and N. neerlandica. However, macroconidia in N. brevis and N. neerlandica are produced only in the aerial mycelium, while N. nelsonii produces only a single type of aerial conidia (microconidia), which also differ from those observed in the aforementioned species by their reduced size. In addition, sporodochial conidia in N. nelsonii are shorter and stout, with shorter and rounder apices compared to those of N. pisi. Neocosmospora pseudopisi Sand.-Den. & L. Lombard, sp. nov. MycoBank MB 838673. Fig. 40. Etymology: Named after its morphological, phylogenetic and host affinity with Neocosmospora pisi. Typus: Unknown country, from Pisum sativum, unknown date and collector (holotype CBS H-24668, culture ex-type CBS 266.50). Conidiophores borne on agar substrate and aerial mycelium, erect and prostrate, up to 340 μm tall, unbranched or irregularly laterally branched, bearing terminal single phialides, rarely proliferating percurrently; aerial conidiogenous cells monophialidic, rarely extended percurrently, subulate to subcylindrical, smooth- and thin-walled, 24.5–74 × 2–4 μm, with cup-shaped, elongated, and flared apical collarettes and 70 conspicuous periclinal thickening. Aerial microconidia arranged in false heads on phialide tips, hyaline, broadly ellipsoidal to clavate, often lightly curved and asymmetrical, smooth- and thin-walled, 0(–1)-septate, (4.5–)6.5–11(–17.5) × (2–) 3–4(–5) μm (av. 8.6 × 3.2 μm). Sporodochia pale luteous to pale sienna coloured, rarely formed on the surface of carnation leaves, agar surface or on aerial mycelium; sporodochial conidiophores unbranched or laterally and irregularly branched bearing single monophialides or groups of groups of up to three monophialides; sporodochial conidiogenous cells monophialidic, subulate to subcylindrical, 10–25 × 2–5 μm, smooth and thinwalled, collarettes and periclinal thickening present. Sporodochial macroconidia falcate, gently tapering towards both ends, slightly curved dorsoventrally to almost straight, apical cell blunt to inconspicuously papillate, basal cell obtuse to poorly-developed, foot-shaped, 1–4(–5)-septate, predominantly 4-septate, hyaline, smooth- and thick-walled; 1-septate conidia: 21.5–26(–27.5) × 4–5 μm (av. 24.7 × 4.3 μm); 2-septate conidia: 28–30 × 4.5–5 μm; 3-septate conidia: (28.5–) 34–46.5(–50) × 4–5.5 μm (av. 40.1 × 4.7 μm); 4-septate conidia: (36–)42.5–54(–56) × 4–5.5 μm (av. 48 × 4.9 μm); 5septate conidia: 50.5 × 5 μm; overall: (21.5–) 34.5–51.5(–56) × 4–5.5 μm (av. 42.9 × 4.8 μm). Chlamydospores subspherical to spherical, hyaline to pale yellow, smoothwalled, thick-walled, 5.5–10.5 μm, single or in pairs, terminal or intercalary. Sexual morph not observed. Culture characteristics: Colonies on PDA reaching 35–48 mm diam at 25 °C after 7 d. Surface pale luteous to pale sulphur yellow, flat with abundant short aerial mycelium, velvety to dusty, margin regular entire to filiform; reverse pale luteous to sulphur yellow. On OA pale luteous to pale sulphur yellow, FUSARIUM REDELIMITED Fig. 40. Neocosmospora pseudopisi (CBS 266.50). A–C. Conidiophores and conidiogenous cells. D. Microconidia. E. Sporodochia formed on aerial hyphae. F. Macroconidia and chlamydospores. G. Macroconidia. Scale bars: C = 20 μm; E = 100 μm; all others = 10 μm. flat, velvety to dusty, margin entire to filiform; reverse pale luteous. Notes: The type of N. pseudopisi was determined as pathogenic to Pisum sativum and deposited in WI by W.C. Snyder. It is phylogenetically and morphologically related to N. pisi, a major  si
c et al. 2018b). However, both pathogen of Pisum sativum (Si species resolved as very closely related lineages in the sevenmarker phylogeny (Fig. 14), as well as on the individual CaM, ITS, rpb1, and rpb2 phylogenies (data not shown). Morphologically, N. pseudopisi can be differentiated from N. pisi by its longer sporodochial conidia (up to 56 μm long vs up to 46 μm long in  si
c et al. 2018b). Based on the features of its macroN. pisi, Si conidia, N. pseudopisi resembles N. crassa and N. pseudotonkinensis; the two latter species, though, are phylogenetically well-separated. Neocosmospora pseudopisi, however, differs from N. crassa and N. pseudotonkinensis by the absence of aerial macroconidia in the former species, while unlike N. crassa, the sporodochial conidia of N. pseudopisi are often wider on its apical third (vs wider at its basal part in N. crassa). centrum. Asci cylindrical, 8-spored, without an apical ring, uniseriate. Ascospores ellipsoidal to fusoid, 1-septate, hyaline, smooth or finely spinulose. Sporodochia not formed. Conidiophores mononematous, hyaline, septate, unbranched or irregularly branched, terminating in 1–3 phialides or reduced to lateral phialides. Conidiogenous cells monophialidic, cylindrical, tapering towards the apex, with inconspicuous periclinal thickening and collarettes. Microconidia abundant, ellipsoidal to obovoid, hyaline, aseptate, sometimes forming false heads on phialides. Macroconidia cylindrical, mostly straight, 3–7(–9)septate, with rounded ends. Chlamydospores globose to subglobose, hyaline to subhyaline, smooth-walled to slightly verrucose, terminal or intercalary, solitary or in pairs or forming chains. [Description adapted from Chaverri et al. (2011)]. Diagnostic features: Red, mostly smooth-walled perithecia lacking papilla producing cylindrical asci bearing ellipsoidal to fusoid, 1septate ascospores and Cylindrocarpon asexual morph. Nothofusarium Crous, Sand.-Den. & L. Lombard, gen. nov. MycoBank MB 838674. Fig. 8. Neonectria Wollenw., Ann. Mycol. 15: 52. 1917, nom. cons. prop. Fig. 8. Synonym: Cylindrocarpon Wollenw., Phytopathology 3: 225. 1913. (see Chaverri et al. 2011 for additional synonyms) Etymology: From the Greek prefix notho-, false, illegitimate; and Fusarium, in reference to the genetic affinity and morphological resemblance to the genus Fusarium s. str. Type species: Neonectria ramulariae Wollenw., Ann. Mycol. 15: 52. 1917. Ascomata unknown. Conidiophores mononematous (aerial conidiophores) or grouped on sporodochia. Aerial conidiophores simple, unbranched or irregularly branched, sometimes reduced to single lateral phialides or phialidic pegs on the hyphae; conidiogenous cells monophialidic, cylindrical, tapering towards apex, smooth- and thin-walled, with periclinal thickening inconspicuous or absent, solitary. Microconidia not formed. Aerial macroconidia falcate, 1–5(–6)-septate, thick-walled, curved to lunate, with a blunt apical cell and often obtuse, poorly- to welldeveloped foot-shaped basal cell. Sporodochia white, pale luteous to pale citrine. Sporodochial conidiophores irregularly Ascomata perithecial, gregarious, seated on an erumpent stroma, superficial, subglobose to broadly obpyriform, red, turning dark red in KOH, pigment dissolving in lactic acid, not collapsing when dry, with blunt to acute apex, rarely papillate, smooth to slightly rugulose, lacking hairs or appendages. Ascomatal wall of two regions: outer region of thick-walled, pigmented cells forming a textura epidermoidea; inner region of elongate, hyaline, thin-walled cells, becoming thinner toward the www.studiesinmycology.org Type species: Nothofusarium devonianum L. Lombard, Crous & Sand.-Den. 71 CROUS ET AL. Fig. 41. Nothofusarium devonianum (CBS 147304). A–F. Aerial conidiophores and conidiogenous cells. G–I. Sporodochia formed on the surface of carnation leaves. J–O. Sporodochial conidiophores and conidiogenous cells. P, Q. Chlamydospores. R. Macroconidia. Scale bars: B, D = 20 μm; G, H = 200 μm; O, P = 5 μm; all others = 10 μm. and verticillately branched, consisting of short, smooth- and thinto thick-walled stipes bearing apical whorls of mono- and polyphialides. Sporodochial conidiogenous cells monophialidic and polyphialidic, doliiform, subulate to subcylindrical, smooth- and thin-walled, with reduced apical collarette. Sporodochial macroconidia similar to aerial macroconidia. Chlamydospores subglobose to ellipsoidal, solitary or most commonly in chains. Diagnostic features: Fusarioid asexual morph characterised by aerial monophialides and sporodochial mono- and polyphialides producing slightly curved and slender, mostly 3-septate macroconidia. Nothofusarium devonianum L. Lombard, Crous & Sand.-Den., sp. nov. MycoBank MB 838675. Fig. 41. Etymology: The epithet refers to Devon, the English county where the type specimen was collected. Typus: UK, England, Devon, Totnes, Berry Pomeroy, Loventor Manor, on dead cladodes of Ruscus aculeatus, 17 Jul. 1983, B.C. Sutton & A.V. Sutton (holotype CBS H-24670, culture extype CBS 147304 = IMI 279297 = NRRL 22134). Conidiophores borne on substrate mycelium, prostrate or erect and quickly collapsing to the agar surface, 70–240 μm tall, unbranched or less commonly irregularly laterally branched, bearing terminal single phialides; aerial conidiogenous cells monophialidic, subulate to cylindrical, smooth- and thin-walled, 9–34 μm long, 2–5 μm at the widest part, or reduced to short phialidic pegs, 3–6 × 2–3.5 μm, formed laterally on aerial 72 hyphae, apical collarettes short or lacking, periclinal thickening absent. Aerial macroconidia borne on tips of conidiogenous cells on aerial conidiophores, almost straight or slightly curved, falcate, 1–5(–6)-septate, predominantly 3-septate, hyaline, smooth- and thick-walled, with a blunt apical cell and obtuse, sometimes papillate to poorly-developed, foot-shaped basal cell, 1-septate conidia: (15.5–)19–28(–32) × 2.5–4 μm (av. 23.5 × 4.3 μm); 2-septate conidia: (25.5–)27–31 × 2.5–4 μm (av. 28.8 × 3.2 μm); 3-septate conidia: (13–) 41–57(–63.5) × 3–4(–4.5) μm (av. 49 × 3.6 μm); 4-septate conidia: (48.5–)50–60(–61.5) × 3–4.5 μm (av. 55.1 × 3.8 μm); 5-septate conidia: (47–)50–64(–71) × 3.5–4.5 μm (av. 56.9 × 3.9 μm); 6-septate conidia: (54–)55–71.5 × 3.5–4 μm (av. 62.3 × 3.8 μm); overall: (13–)35.5–59(–71.5) × 2.5–4.5 μm (av. 47.2 × 3.6 μm). Sporodochia pale luteous to pale citrine coloured, small, formed abundantly on the agar surface and less regularly on the surface of carnation leaves; sporodochial conidiophores irregularly verticillately branched bearing solitary lateral and terminal phialides or apical groups of 2–3 phialides; sporodochial conidiogenous cells mono- and polyphialidic, doliiform, subulate to subcylindrical, 3–25.5 × 2.5–5 μm, smooth and thin-walled, commonly proliferating sympodially, collarettes and periclinal thickening absent or inconspicuous. Sporodochial conidia undifferentiable from aerial conidia. Chlamydospores subglobose to ellipsoidal, solitary or most commonly in chains. Sexual morph unknown. Culture characteristics: Colonies on PDA reaching 23–27 mm diam at 25 °C after 7 d. Surface straw-coloured, pale FUSARIUM REDELIMITED Fig. 42. Pseudofusicolla belgica. A, B. Conidiophores. C–G. Conidiogenous cells. H. Microconidia. I. Chlamydospores. J. Macroconidia. A, B, D–J. IHEM 2413. C. IHEM 5322. Scale bars: A = 20 μm; F, G = 5 μm; all others = 10 μm. luteous to pale ochreous, flat, dusty to velvety; reverse white to pale luteous without diffusible pigments. On OA, grey-white to pale luteous, flat, membranous to dusty, with irregular velvety peripheral patches cottony; reverse pale luteous. Notes: The type of No. devonianum was erroneously assigned to Trichofusarium rusci (Sutton, 1986) and recombined in Fusarium (Fusarium rusci, Geiser et al. 2013). Nevertheless, the morphology exhibited by this strain does not match in respect with the original description of the supposed basionym nor its purported synonym Pycnofusarium rusci, as confirmed also by examination of authentic material of T. rusci (BPI 453152A and IMI 291476). The latter taxon is characterised by a setose sporodochial asexual morph with small, fusoid, aseptate conidia, more reminiscent of the genus Alfaria (Stachybotryaceae, Crous et al. 2014). Pseudofusicolla D. Triest, Mycobiology 44: 127. 2016. Figs 8, 42. Type species: Pseudofusicolla belgica D. Triest, Mycobiology 44: 127. 2016. Ascomata unknown. Conidiophores initially as lateral phialides on somatic hyphae, sometimes monochasial, verticillate or penicillate, hyaline. Conidiogenous cells monophialidic, cylindrical to subulate, hyaline, producing micro- and macroconidia. Microconidia strongly falcate, 0- or 1-septate, hyaline. Macroconidia strongly falcate, narrowing towards the ends, apical cell hooked with a pointed tip, basal cell papillate to poorly-developed, foot-shaped, 0–3-septate, hyaline. Chlamydospores globose, in terminal pairs or intercalary chains. [Description adapted from Triest et al. (2016)]. Basionym: Fusarium ventricosum Appel & Wollenw., Phytopathology 3: 32. 1913. (See F. ventricosum in List section for synonyms) Ascomata perithecial, mostly gregarious, non-stromatic or on a thin stroma erumpent through the epidermis, superficial, subglobose to globose, laterally pinched when dry, dark red, with short ostiolar neck, smooth-walled, lacking hairs and appendages. >Ascomatal wall of two regions: outer region of thick-walled, pigmented cells forming a textura angularis or textura globulosa; inner region of elongate, hyaline, thin-walled cells, becoming thinner towards the centrum. Asci clavate, apex rounded with distinct pore, 8-spored often with an apical ring, uniseriate to biseriate. Ascospores ellipsoidal, 1-septate, constricted at the septum, pale tan, verrucose. Sporodochia not formed. Conidiophores simple, mononematous, straight to flexuous, hyaline, septate, unbranched or rarely branched, terminating in single phialides. Conidiogenous cells monophialidic, cylindrical, tapering towards the apex, with periclinal thickening and flared collarettes, usually producing macroconidia. Microconidia rarely formed, ellipsoidal to fusoid, 0- or 1-septate, hyaline. Macroconidia falcate, straight to slightly curved dorsiventrally, 3-septate, with blunt to slightly pointed apical cell and poorly-developed foot-shaped basal cell. Chlamydospores globose to subglobose to ovoid, hyaline to subhyaline, verrucose, terminal or intercalary, solitary or in pairs or forming chains or developing directly from macroconidia. [Description adapted from Booth (1971), Gerlach & Nirenberg (1982) and Lombard et al. (2015)]. Rectifusarium L. Lombard et al., Stud. Mycol. 80: 229. 2015. Figs 8, 43. Diagnostic features: Dark red, smooth-walled perithecia with short ostiolar neck producing clavate asci bearing ellipsoidal, 1septate ascospores and asexual morphs producing micro- and macroconidia on elongate cylindrical aerial conidiophores with monophialides, and not forming sporodochia. Chlamydospores formed in hyphae and macroconidia. Type species: Rectifusarium ventricosum (Appel & Wollenw.) L. Lombard & Crous, Stud. Mycol. 80: 229. 2015. Rugonectria P. Chaverri & Samuels, Stud. Mycol. 68: 73. 2011. Fig. 8. Diagnostic features: Fusarioid asexual morph that produces strongly curved, 0- or 1-septate microconidia, and 0–3-septate macroconidia. www.studiesinmycology.org 73 CROUS ET AL. Fig. 43. Rectifusarium spp. A–F. Conidiophores and conidiogenous cells. G. Microconidia. H. Macroconidia. A–D, H. Rectifusarium robinianum (CBS 430.91). E–G. Rectifusarium ventricosum (CBS 748.79). Scale bars = 10 μm. Type species: Rugonectria rugulosa (Pat. & Gaillard) Samuels et al., Stud. Mycol. 68: 73. 2011. Basionym: Nectria rugulosa Pat. & Gaillard, Bull. Soc. Mycol. France 4: 115. 1889. Synonyms: Cucurbitaria rugulosa (Pat. & Gaillard) Kuntze, Revis. Gen. Pl. 3: 461. 1898. Neonectria rugulosa (Pat. & Gaillard) Mantiri & Samuels, Canad. J. Bot. 79: 339. 2001. Cylindrocarpon rugulosum Brayford & Samuels, Sydowia 46: 148. 1994. Ascomata perithecial, solitary or gregarious, stromatic, superficial or partly immersed in stroma, subglobose to globose, orange to red, turning dark red in KOH, pigment dissolving in lactic acid, non-papillate, rugose to tuberculate, lacking hairs or appendages. Ascomatal wall of two regions: outer region of thick-walled, pigmented cells forming a textura angularis; inner region of elongate, hyaline, thin-walled cells, becoming thinner towards the centrum. Asci clavate, apex simple, 8-spored. Ascospores ellipsoidal to oblong, 1-septate, not to slightly constricted at the septum, pale yellow, striate. Sporodochia not formed. Conidiophores simple, mononematous, straight to flexuous, hyaline, septate, unbranched or rarely to irregularly branched, terminating in single phialides. Conidiogenous cells monophialidic, cylindrical, tapering towards the apex, with periclinal thickening and flared collarettes, producing micro- and macroconidia. Microconidia ovoid to cylindrical, 0- or 1-septate, hyaline. Macroconidia fusoid, curved, (3–)5–7(–9)-septate, tapering to both ends, basal cell obtuse with inconspicuous hilum. Chlamydospores not observed. [Description adapted from Samuels et al. (1990), Samuels & Brayford (1994) and Chaverri et al. (2011)]. Diagnostic features: Orange to red, rugose to tuberculate, partially immersed perithecia producing clavate asci bearing fusoid, 1-septate yellowish, striate ascospores and cylindrocarpon-like asexual morph characterised by curved, multiseptate macroconidia with inconspicuous hilum. Scolecofusarium L. Lombard, Sand.-Den. & Crous, gen. nov. MycoBank MB 838676. Figs 8, 44. Etymology: From Greek skṓlex, worm, in reference to the wormlike appearance of the macroconidia. Type species: Scolecofusarium ciliatum (Link) L. Lombard, Sand.-Den. & Crous Ascomata perithecial, solitary or gregarious, partially immersed on a stroma, smooth- and thin-walled, globose to broadly pyriform, red, with a broad, discoid apical region, turning darker in 74 KOH, pigment dissolving in lactic acid to become yellow, lacking hairs and warts. Ascomatal wall of a single region composed of unevenly thickened cells of textura epidermoidea. Asci cylindrical, apex with an obscure refractive ring, 8-spored, ascospores uniseriate. Ascospores ellipsoidal to fusiform-ellipsoidal, 1septate, not constricted at septum, yellow-brown, finely spinulose. Conidiophores mononematous (aerial) or grouped on sporodochia. Aerial conidiophores unbranched to loosely irregularly branched, bearing terminal phialides; conidiogenous cells monophialidic, subcylindrical, smooth- and thin-walled, with evident periclinal thickening and a non-flared collarette, producing only macroconidia. Sporodochia pink, orange to salmon coloured; sporodochial conidiophores irregularly and verticillately branched, consisting of short, often swollen, smooth- and thinwalled stipes bearing single terminal monophialides or apical whorls of 2–3 monophialides; sporodochial conidiogenous cells monophialidic, cylindrical to subcylindrical, smooth- and thinwalled, with evident periclinal thickening. Macroconidia formed in pink to salmon slimy masses, subcylindrical, (0–)3–7(–10)septate, straight or slightly curved, with blunt apical cell and obtuse to poorly developed, foot-shaped basal cell. Microconidia unknown. Chlamydospores unknown. [Description adapted from Samuels et al. (1991) & Gerlach & Nirenberg (1982)]. Diagnostic features: Red perithecia producing cylindrical asci containing ellipsoidal, 1-septate, finely spinulose ascospores and fusarioid asexual morph characterised by monophialides producing slender and delicate, almost cylindrical macroconidia from aerial conidiophores and pink to salmon coloured sporodochia, lacking microconidia as well as chlamydospores. Scolecofusarium ciliatum (Link) L. Lombard, Sand.-Den. & Crous, comb. nov. MycoBank MB 838677. Basionym: Atractium ciliatum Link, Mag. Ges. Naturf. Freunde Berlin 7: 32. 1816. Synonyms: Fusarium ciliatum (Link) Link, in Willdenow, Sp. Pl., Ed. 4, 6: 105. 1825. Microcera ciliata (Link) Wollenw., Fusaria Autogr. Delin. 1: 435. 1916. Calonectria ciliata (Link) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 32: 664. 1945. Sphaeria agnina Desm., Ann. Sci. Nat., Bot. s
er. 3, 6: 72. 1846. Calonectria agnina (Desm.) Sacc., Michelia 1: 311. 1878. Dialonectria agnina (Desm.) Cooke, Grevillea 12: 111. 1884. Fusarium peltigerae Westend., Herb. Crypt. Belg. 9: no. 414. 1849. Fusarium parasiticum Westend., Bull. S
eances Cl. Sci. Acad. Roy. Sci. Belgique, s
er. 2, 11: 652. 1861. FUSARIUM REDELIMITED Fig. 44. Scolecofusarium ciliatum. A, B. Ascomata on natural substrate. C, D. Asci. E–G. Ascospores (G. Surface view). H. Pionnote on agar surface. I. Sporodochium. J–L. Conidiophores and conidiogenous cells. M. Macroconidia. A–H, J–L. CBS 146674. I. CBS 146676. M. CBS 144385. Scale bars: A, B = 100 μm; E–G = 5 μm; H = 1 mm; I = 20 μm; all others = 10 μm. Nectria massariae Pass., in Rabenhorst, Fungi Eur. Exs. no. 1827. 1874. Microcera massariae Sacc., Michelia 1: 263. 1878. Calonectria massariae (Pass.) Sacc., Michelia 1: 312. 1878. Fusisporium filisporum Cooke, Grevillea 8: 8. 1879. Fusarium filisporum (Cooke) Sacc., Syll. Fung. 4: 708. 1886. Fusarium scolecoides Sacc. & Ellis, Atti Reale Ist. Veneto Sci. Lett. Arti, s
er. 6, 3: 728. 1885. Fusarium elongatum Cooke, Grevillea 19: 4. 1890. Calonectria dearnessii Ellis & Everh., Proc. Acad. Nat. Sci. Philadelphia 42: 245. 1891. Typus: Germany, on branch canker of Fagus sylvatica, 1961, W. Gerlach (neotype of Atractium ciliatum CBS H-12687 hic designatus, MBT 10000646, culture ex-neotype CBS 191.65 = ATCC 16068 = ATCC 24137 = BBA 9661 = DSM 62172 = IMI 112499 = NRRL 20431). Additional descriptions and illustrations: Wollenweber & Reinking (1935), Doidge (1938), Gerlach & Nirenberg (1982). Additional material examined: Belgium, Mons, Pommeroeul, on leaf of Fagus sylvatica, 1984, unknown collector, culture CBS 144385 = IHEM 2989. Denmark, on Hordeum vulgare mouldy grain, associated with scale insects, 1986, U. Thrane, culture CBS 155.86 = NRRL 22284. Netherlands, Noord-Brabant Province, Boxmeer, on Quercus sp., Mar. 2016, S. Helleman, cultures CBS 146672 = CPC 30654; CBS 146673 = CPC 30655; CBS 146674 = CPC 30656; CBS 146675 = CPC 30657; CBS 146676 = CPC 30658; CBS 146677 = CPC 30659. Notes: No existent holotype material was located for At. ciliatum. Therefore, a neotype is designated here. The neotype specimen originates from a representative isolate studied by Gerlach & Nirenberg (1982). Setofusarium (Nirenberg & Samuels) Crous & Sand.-Den., gen. et stat. nov. MycoBank MB 838678. Figs 8, 45. Basionym: Fusarium sect. Setofusarium Nirenberg & Samuels, Canad. J. Bot. 67: 3376. 1989. Etymology: The name refers to the presence of setose sporodochia and to its resemblance to the genus Fusarium. www.studiesinmycology.org Type species: Fusarium setosum Nirenberg & Samuels, Canad. J. Bot. 67: 3372. 1989. Ascomata perithecial, solitary or gregarious on a well-developed immersed stroma composed of pseudoparenchymatous to hyphal cells, scaly to warty and thick-walled, pyriform, dark red with an often darker red-coloured, flattened and non-papillate apical region, turning darker in KOH, pigment dissolving in lactic acid to become yellow, lacking hairs. >Ascomatal wall of two regions: outer region of thick-walled, pigmented cells of textura angularis to textura globulosa at warts cells; inner region of elongate, hyaline, thin-walled cells, becoming thinner towards the centrum. Asci cylindrical to clavate, with rounded to flattened simple apex, 8spored, ascospores overlapping uniseriate to biseriate. Ascospores ellipsoidal, 1-septate, not constricted at septum, pale yellow-brown, smooth-walled to finely striate. Conidiophores mononematous (aerial) or grouped on sporodochia. Aerial conidiophores unbranched or rarely branched, bearing terminal phialides; conidiogenous cells monophialidic, cylindrical to subcylindrical, smooth- and thin-walled, with periclinal thickening inconspicuous to evident, producing only macroconidia. Sporodochia grey; setae arising between and around sporodochia, stiff, erect, thick-walled with acute tip, at first hyaline later becoming pale golden brown; sporodochial conidiophores irregularly and verticillately branched and densely packed, consisting of short, often swollen, smooth- and thin-walled stipes bearing apical whorl of 2–3 monophialides or single, terminal monophialides; sporodochial conidiogenous cells monophialidic, cylindrical to subcylindrical, smooth- and thin-walled, with inconspicuous to evident periclinal thickening. Macroconidia formed in off-white or grey slimy masses, cylindrical, (0–)3–5(–7)-septate, gently curved, with a blunt apical cell and an obtuse to poorly developed foot-shaped basal cell. Microconidia unknown. Chlamydospores unknown. [Description adapted from Samuels & Nirenberg (1989)]. Diagnostic features: Dark red perithecia producing cylindrical to clavate asci containing ellipsoidal, 1-septate, finely striate ascospores and fusarioid asexual morph characterised by monophialides producing robust, almost cylindrical macroconidia from 75 CROUS ET AL. Fig. 45. Setofusarium setosum. A–C. Ascomata on natural substrate. D. Surface view of perithecial wall in lactic acid. E. Ascus. F–H. Ascospores (H. Surface view). I, J. Setose sporodochia. K–M. Setae. N–P. Detail of setae (N. Base. O. Middle portion wall. P. Surface view of apical wall). Q. Conidiophore. R. Macroconidia. A–H. BPI 882043. I–R. CBS 635.92. Scale bars: A–C, I, Q = 100 μm; J–L = 20 μm; H, P = 5 μm; all others = 10 μm. aerial conidiophores and setose sporodochia, lacking microconidia as well as chlamydospores. Setofusarium setosum (Nirenberg & Samuels) Sand.-Den. & Crous, comb. nov. MycoBank MB 838679. Basionym: Fusarium setosum Nirenberg & Samuels, Canad. J. Bot. 67: 3372. 1989. Synonym: Nectria setofusarii Samuels & Nirenberg, Canad. J. Bot. 67: 3372. 1989. Typus: French Guiana, piste de Saint-Elie: km 16 on road between Sinnamary and St. Elie, ORSTOM research area “ECEREX”, on bark of living liana, Mar. 1986, G.J. Samuels, holotype NY00927992. Epitype of F. setosum (CBS H-24723 hic designatus, MBT 10000647): French Guiana, Vic. Cayenne, 15 km from Remise, trail to Vidal-old farm, secondary forest, from bark, 25 Feb. 1988, A.Y. Rossman, culture ex-epitype CBS 635.92 = G.J.S. 88-12. Description and illustrations: Samuels & Nirenberg (1989). Additional material examined: French Guiana, unknown host and collection date, A.Y. Rossman, culture CBS 574.94; from wood from unknown host, Feb. 1988, A.Y. Rossman, IMI 324476. Ghana, Western Region: Wiawso District, Bia National Park, trail from camp 1, disturbed forest, on living liana, J.G. Samuels & H.C. Evans, BPI 882043. Notes: The monotypic, former Fusarium section Setofusarium is here elevated to generic rank to accommodate “Fusarium setosum”, a genetically and morphologically divergent taxon 76 easily differentiated from any known fusarioid taxa by the production of setose sporodochia (Samuels & Nirenberg 1989). No living ex-type culture could be located for this taxon. Isolate CBS 635.92 (as G.J.S. 88-12) is an authentic strain of Fusarium setosum (Samuels & Nirenberg 1989). Therefore, a dried culture from this strain is designated as epitype here. Stylonectria Höhn., Sitzungsber. Kaiserl. Akad. Wiss. Wien, Math.-Naturwiss. Cl., Abt. 1, 124: 52. 1915. Figs 8, 46. Type species: Stylonectria applanata Höhn., Sitzungsber. Kaiserl. Akad. Wiss. Wien, Math.-Naturwiss. Kl., Abt. 1, 124: 52. 1915. Ascomata perithecial, gregarious in groups of up to 20, on a thin, white to yellow hyphal or subiculum-like stroma, superficial, subglobose, pyriform to subcylindrical, pale yellow, orange-red, orange-brown, or pale to dark red, becoming dark red to purple in KOH, with a rounded or broad, circular, flat disc on a venter-like neck, smooth to slightly rugulose, lacking hairs or appendages. Ascomatal wall consisting of two layers; inner layer of hyaline, thin-walled, compressed, elongated cells and outer layer of distinct, isodiametric to oblong, angular or globose, thick-walled cells. Asci cylindrical to clavate, 8-spored, with simple apex or apical ring. Ascospores cylindrical to allantoid to ellipsoidal, 1septate, hyaline or yellow to pale brown, smooth or tuberculate. Conidiophores initially formed as unbranched phialides on somatic hyphae, sometimes loosely branched, sometimes forming small sporodochia. Conidiogenous cells monophialidic, FUSARIUM REDELIMITED Fig. 46. Stylonectria spp. A–D. Ascomata on natural substrate. E. Ascomata on culture. F. Surface view of perithecial wall in lactic acid. G, H. Asci. I–K. Ascospores. L–M. Conidiophores and conidiogenous cells. O, P. Microconidia. Q, R. Macroconidia. A, G. Stylonectria qilianshanensis [HMAS 255803, adapted from Zeng et al. (2020)]. B. Stylonectria norvegica [CLL14047, adapted from Lechat et al. (2015)]. C. Stylonectria purtonii (photo P. Mlcoch). D, I, K. Stylonectria wegeliana (photo B. Bergen). E, F, Q. Stylonectria hetmanica (CBS 147306). H, J, O. Stylonectria sp. (HPC 2668). L, M. Stylonectria corniculata (CBS 125491). N, P, R. Stylonectria applanata (CBS 125489). Scale bars: A–E = 100 μm; I–K = 5 μm; all others = 10 μm. cylindrical to subcylindrical, with a distinct collarette. Microconidia sparse, allantoid to lunulate, slightly or strongly curved, aseptate, in slimy heads. Macroconidia orange in mass, subcylindrical or moderately to strongly curved, falcate, 0- or 1-septate, apex narrower than base, apical cell blunt or hooked, basal cell not or scarcely foot-shaped. [Description adapted from Höhnel (1915) and Gr€afenhan et al. (2011)]. Diagnostic features: Pale yellow to dark red, mostly smoothwalled perithecia with rounded or broad, circular, flat disc on a venter-like neck, producing cylindrical to clavate asci bearing cylindrical to allantoid to ellipsoidal, 1-septate hyaline or yellow to pale brown ascospores and fusarioid asexual morph characterised by 0- or 1-septate macroconidia with blunt or hooked apical cell, lacking a foot-shaped basal cell. Stylonectria corniculata Gr€afenhan, Crous & Sand.-Den., sp. nov. MycoBank MB 838680. Fig. 47. Etymology: From Latin corniculum, little horn. Referring to the shape of the conidiophores. Typus: Germany, Brandenburg, Stolpe, near Gellmersdorfer Forst, from unidentified ascomycete on Carpinus sp., 1 Mar. 2007, T. Gr€afenhan, holotype CBS H-24671, culture ex-type CBS 125491. Conidiophores often as single phialides borne laterally on substrate and aerial hyphae, or irregularly branched and crowded with phialides produced laterally and terminally, hyaline, thin- and smooth-walled, 24–89 μm long. Conidiogenous cells monophialidic, short doliiform, subcylindrical to subulate, 6–28.5 × 2–3.5 μm, often with a conspicuous flared collarette, periclinal thickening absent, producing micro- and macroconidia. Microconidia cylindrical to allantoid, hyaline, thin- and smoothwalled, 0(–1)-septate, (4.5–)6–13.5(–21) × (1.5–)2–3 μm (av. 9.7 × 2.1 μm). Macroconidia falcate, almost straight or gently www.studiesinmycology.org dorsiventrally curved, tapering toward the basal portion, (0–)1septate, with a blunt apical cell and obtuse basal cell, (20–) 28–47(–56) × 2–3.5 μm (av. 37.6 × 2.5 μm). Chlamydospores and sexual morph not observed. Culture characteristics: Colonies on PDA reaching 16–20 mm diam at 25 °C after 7 d. Surface at first white and membranous, becoming slimy, saffron to orange, to bright orange at the centre, flat, aerial mycelium absent, moisty at the centre, velvety at the margin, margin regular, filiform to undulate; reverse white, pale saffron to orange at centre. On OA, white to pale orange, flat, membranous to slimy, with regular and undulate margin; reverse pale luteous to pale saffron. Notes: The species is here described based on its morphology in vitro, where only the asexual morph was obtained. This prevents further comparisons with known species of this genus. The only known collection, CBS 125491, has been shown to represent the most basal lineage in Stylonectria in previous phylogenetic studies (Gr€afenhan et al. 2011, Lechat et al. 2015), which was confirmed here (Fig. 15). Although with neither a clear host association – an important character for species recognition in Stylonectria – nor any known sexual morphology, St. corniculata shows a distinctive morphology when it comes to its asexual morph, especially regarding the branching pattern and the shape of its mature conidiophores, which can be very elaborate and largely resemble antlers (Fig. 47). Stylonectria hetmanica Akulov, Crous & Sand.-Den., sp. nov. MycoBank MB 838681. Fig. 48. Etymology: The epithet refers to the Cossack Hetmanate (Ukrainian Hetmanscyna), the name of the former Cossack state territories where the type was collected. Typus: Ukraine, Sumy, Okhtyrka, vicinities of Klymentove village, Hetmanskyi National Nature Park, on the ascomata of Diaporthe sp., associated with Phomopsis asexual morph, on 77 CROUS ET AL. Fig. 47. Stylonectria corniculata (CBS 125491). A–E. Conidiophores and conidiogenous cells. F. Microconidia. G. Macroconidia. Scale bars = 10 μm. dead branches of Frangula alnus still attached to the tree, 13 Oct. 2019, Ya. Mieshkov, CWU (Myc) AS 7177, holotype CBS H-24672, culture ex-type CBS 147305 = CPC 38725. Ascomata perithecial, gregarious or solitary, broadly pyriform, 220–310 μm wide, with a distinctive flat and discoid papilla, 130–225 μm wide, dark red, becoming darker in 3 % KOH and light yellow in lactic acid. Ascomatal wall smooth, 30–45 um thick, composed of two regions: outer region 25–40 μm thick, of irregularly shaped cells of textura intricata to textura epidermoidea; inner region 5–10 μm thick of thin-walled, flattened cells of textura prismatica to textura angularis. Asci subcylindrical, 45–72 × 4–8 μm, 8-spored, apices rounded and simple, uniseriate or irregularly biseriate. Ascospores ellipsoidal, 1-septate, often constricted at septum, (7.5–) 8.5–11(–12.5) × 3–4.5(–5.5) μm, smooth to finely spinulose, thick-walled, hyaline at first, becoming pale golden brown at maturity. Conidiophores often as single phialides or short phialidic pegs borne laterally on the substrate and aerial hyphae, rarely irregularly to verticillately branched. Conidiogenous cells monophialidic, short doliiform, subcylindrical to subulate, 4–21(–27.5) × 2–3.5 μm, often with a conspicuous flared collarette, periclinal thickening absent, producing micro- and macroconidia. Microconidia allantoid, hyaline, smooth- and thinwalled, 0(–1)-septate, (9–)10.5–13.5(–15) × 2–3 μm (av. 12 × 2.4 μm). Macroconidia subcylindrical to falcate, almost straight or moderately dorsiventrally curved, tapering towards both ends, 0–1(–2)-septate, apical cell blunt to slightly hooked, basal cell obtuse to poorly-developed, foot-shaped (11.5–) 16.5–28(–34) × 2–3 μm (av. 22.2 × 2.5 μm). Chlamydospores not observed. Culture characteristics: Colonies on PDA reaching 2.5–3 mm diam at 25 °C after 7 d. Surface straw-coloured to 78 luteous, pale orange at centre, flat or radially folded, membranous to slimy, margin filiform to undulate; reverse pale luteous to pale orange. On OA orange to pale apricot, flat, membranous to slimy, margin filiform with abundant submerged mycelium; reverse pale orange. Additional material examined: Ukraine, Sumy, Okhtyrka, in the vicinities of the village Klymentove, Hetmanskyi National Nature Park, on the conidiomata of Dothiorella sarmentorum, on recently dead branches of Acer platanoides still attached to the tree, 13 Oct. 2019, A. Akulov, CWU (Myc) AS 7278, culture CBS 147306 = CPC 38848. Notes: The morphological description of St. hetmanica is based on its growth on OA, where both studied strains showed optimal growth and sporulation. Contrary to most fusarioid genera, St. hetmanica grows very poorly and fails to sporulate on SNA and WA. Stylonectria hetmanica is morphologically comparable and genetically close to St. purtonii, St. norvegica, and St. wegeliana. Nevertheless, ascospores of St. hetmanica are smaller than those of St. purtonii and St. wegeliana. Additionally, macroconidia of St. hetmanica, while similar in size to those of St. purtonii, are less septate (0- or 1-septate, rarely 2-septate in St. hetmanica, and up to 3-septate in St. purtonii). The sexual morph of the recently described St. norvegica is very similar to that of St. hetmanica, although both species are genetically less closely related. The latter species can be distinguished by the production of shorter macroconidia. Thelonectria P. Chaverri & C. Salgado, Stud. Mycol. 68: 76. 2011. Fig. 8. Type species: Thelonectria discophora (Mont.) P. Chaverri & C. Salgado, Stud. Mycol. 68: 76. 2011. Basionym: Sphaeria discophora Mont., Ann. Sci. Nat. Bot., s
er. 2, 3: 353. 1835. FUSARIUM REDELIMITED Fig. 48. Stylonectria hetmanica (CBS 147305). A–C. Ascomata (A. On natural substrate. B, C. In culture). D. Surface view of perithecial wall in lactic acid. E–G. Ascospores (G. Surface view). H–K. Conidiophores and conidiogenous cells. L. Macroconidia. Scale bars: A–C = 100 μm; E–I = 5 μm; all others = 10 μm. Synonyms: Nectria discophora (Mont.) Mont., Fl. Chil. 7: 454. 1850. Cucurbitaria discophora (Mont.) Kuntze, Revis. Gen. Pl. 3: 461. 1898. Neonectria discophora (Mont.) Mantiri & Samuels, Canad. J. Bot. 79: 339. 2001. Nectria tasmanica Berk., in Hooker, Bot. Antarct. Voy. III, Fl. Tasman. 2: 279. 1860. Cucurbitaria tasmanica (Berk.) Kuntze, Revis. Gen. Pl. 3: 462. 1898. Nectria umbilicata Henn., Hedwigia 41: 3. 1902. Creonectria discostiolata Chard
on, Bol. Soc. Venez. Ci. Nat. 5: 341. 1939. Ascomata perithecial, solitary to gregarious, non-stromatic or sometimes seated on an immersed inconspicuous stroma, superficial, globose to subglobose or pyriform to elongated, orange to red, with prominent areolate papilla or darkly pigmented apex, smooth to slightly rugulose, lacking hairs or appendages. Ascomatal wall of two regions: outer region of thick-walled, pigmented cells forming a textura epidermoidea; inner region of elongate, hyaline, thin-walled cells, becoming thinner towards the centrum. Asci cylindrical to narrowly clavate, 8-spored, with an apical ring, uniseriate. Ascospores ellipsoidal to fusoid, 1septate, hyaline, smooth or finely spinulose or striate. Sporodochia not formed. Conidiophores mononematous, hyaline, septate, irregularly branched, terminating in 1–3 phialides or reduced to lateral phialides. Conidiogenous cells monophialidic, cylindrical or slightly swollen, tapering towards the apex, with periclinal thickening and flared collarettes, producing usually macroconidia. Microconidia rarely formed, globose to ovoid, hyaline, aseptate, with displaced inconspicuous hilum. Macroconidia subcylindrical to slightly fusoid, curved, broadest at upper third, (3–)5–7(–9)-septate, with rounded ends or flattened at the basal cell. Chlamydospores unknown. www.studiesinmycology.org [Description adapted from Chaverri et al. 2011)]. Diagnostic features: Orange to red, mostly smooth-walled perithecia with prominent darkened papilla producing cylindrical to narrowly clavate asci bearing ellipsoidal to fusoid, 1-septate ascospores and cylindrocarpon-like asexual morph. Tumenectria C. Salgado & Rossman, Fungal Diversity 80: 451. 2016. Fig. 8. Type species: Tumenectria laetidisca (Rossman) C. Salgado & Rossman, Fungal Diversity 80: 451. 2016. Basionym: Nectria laetidisca Rossman, Mycol. Pap. 150: 36. 1983. Synonym: Cylindrocarpon bambusicola Matsush., Matsush. Mycol. Mem. 5: 9. 1987. Ascomata perithecial, mostly solitary to gregarious, non-stromatic, superficial, broadly pyriform, not collapsing when dry, orange to sienna, turning blood red in KOH, pigment dissolving in lactic acid, broadly rounded to flattened papilla, smooth-walled, lacking hairs and appendages. Ascomatal wall of two regions: outer region of thick-walled, pigmented cells forming a textura angularis; inner region of elongate, hyaline, thin-walled cells, becoming thinner towards the centrum. Asci narrowly clavate, apex simple, 8-spored, lacking an apical ring, irregularly multiseriate. Ascospores fusoid, 3-septate, hyaline, smooth or finely spinulose. Sporodochia not formed. Conidiophores simple, mononematous, straight to flexuous, hyaline, septate, unbranched or rarely branched, terminating in a single phialide or reduced to lateral phialides. Conidiogenous cells monophialidic, cylindrical or slightly swollen, tapering towards the apex, with periclinal thickening and flared collarettes. Microconidia not formed. Macroconidia cylindrical to slightly fusoid, straight to slightly curved, 3–6-septate, with rounded ends. Chlamydospores unknown. 79 CROUS ET AL. [Description adapted from Rossman (1983) and Salgado-Salazar et al. (2016)]. Diagnostic features: Orange to sienna, smooth-walled perithecia with broadly rounded to flattened papilla producing narrowly clavate asci bearing fusoid, 3-septate phragmo-ascospores and cylindrocarpon-like asexual morph. FUSARIUM AND ALLIED GENERA: LIST OF ACCEPTED NAMES The following nomenclator lists names that have been introduced in Fusarium up to January 2021, as well as their current status (with accepted names indicated in bold and underlined for easier recognition). Where type specimens have been located, these details, as well as any ex-type cultures and diagnostic DNA barcode data are provided, along with notes regarding potential synonymy. This list will be updated and republished at regular intervals, and will form the basis for a monograph of Fusarium and allied genera that will be freely available on www. Fusarium.org. aberrans Fusarium J.W. Xia et al., Persoonia 43: 192. 2019. Holotypus: CBS H-24050. Ex-type culture: CBS 131385. Type locality: Australia, Northern Territory, Roper River area. Type substrate: Stem of Oryza australiensis. Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb2: MN170378; tef1: MN170445. acaciae Fusarium Berl. & Voglino, Syll. Fung., Addit. I–IV: 201. 1886, nom. illegit., Art. 53.1. (See Fusarium acaciae Cooke & Harkn.) acaciae Fusarium Cooke & Harkn., Grevillea 12: 96. 1884. Synonyms: ?Fusarium acaciae Berl. & Voglino, Syll. Fung., Addit. I–IV: 201. 1886, nom. illegit., Art. 53.1. ?Fusarium acaciae Sacc., Syll. Fung. 9: 958. 1891, nom. illegit., Art. 53.1. (See Fusarium lateritium) Holotypus: ?BPI 451718. Type locality: USA, California. Type substrate: Stem of Acacia sp. Note: Synonym fide Wollenweber & Reinking (1935). acaciae Fusarium Sacc., Syll. Fung. 9: 958. 1891, nom. illegit., Art. 53.1. (See Fusarium acaciae Cooke & Harkn.) acaciae-mearnsii Fusarium O'Donnell et al., Fungal Genet. Biol. 41: 619. 2004. Holotypus: BPI 843477. Ex-type culture: CBS 110254 = MRC 5120 = NRRL 25754. Type locality: South Africa, KwaZulu-Natal, Pietermaritzburg. Type substrate: Acacia mearnsii. Descriptions and illustrations: See O'Donnell et al. (2004). Diagnostic DNA barcodes: rpb1: JAAWUD010000100; rpb2: JAAWUD010000080; tef1: AF212448. acicola Fusarium Bres., in Strasser, Verh. Zool.-Bot. Ges. Wien 60: 328. 1910. Holotypus: Not located. Type locality: Austria, Sonntagberg. Type substrate: Rotting needles of Pinus sp. 80 Descriptions and illustrations: See Strasser (1910). Note: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). acremoniopsis Fusarium Vincens, Bull. Soc. Mycol. France 31: 26. 1915. (See Fusarium larvarum) Holotypus: ?PC. Type locality: Brazil, Par
a, Bel
em. Type substrate: Agrotis sp. (cutworm). Descriptions and illustrations: See Vincens (1915). Note: Synonym fide Wollenweber & Reinking (1935). acridiorum Fusarium (Trab.) Brongn. & Delacr., Bull. S
eances Soc. Natl. Agric. France 51: 631. 1891. Trichothecium acridiorum (Trab.) Madelin, Trans. Brit. Mycol. Soc. 49: 284. 1966. Basionym: Botrytis acridiorum Trab., Compt. Rend. Hebd. S
eances Acad. Sci. 112: 1383. 1891. Synonym: Lachnidium acridiorum Giard, Compt. Rend. Hebd. S
eances Acad. Sci. 112: 1520. 1891. Holotypus: Not located. Type locality: Algeria. Type substrate: Acrididae (locust). Description and illustrations: See Madelin (1966). acuminatum Fusarium Ellis & Everh., Proc. Acad. Nat. Sci. Philadelphia 47: 441. 1895. Synonyms: Microcera acuminata (Ellis & Everh.) Höhn., in Weese, Sitzungsber. Akad. Wiss. Wien, Math.-Naturwiss. Kl., Abt. 1. 128: 729. 1919. Fusarium scirpi var. acuminatum (Ellis & Everh.) Wollenw., Fusaria Autogr. Delin. 3: 930. 1930. Fusarium scirpi subsp. acuminatum (Ellis & Everh.) Raillo, Fungi of the Genus Fusarium: 177. 1950. Fusarium gibbosum var. acuminatum (Ellis & Everh.) Bilaĭ, Mikrobiol. Zhurn. 49: 6. 1987. ?Selenosporium hippocastani Corda, Icon. Fung. 2: 7. 1838. Fusarium hippocastani (Corda) Sacc., Syll. Fung. 4: 703. 1886. Fusarium erubescens Appel & Oven, Landwirtsch. Jahrb. 1905, nom. illegit., Art. 53.1. Fusarium caudatum Wollenw., J. Agric. Res. 2: 262. 1914. Fusarium scirpi var. caudatum (Wollenw.) Wollenw., Fusaria Autogr. Delin. 3: 934 & 935. 1930. Fusarium equiseti var. caudatum (Wollenw.) Joffe, Mycopathol. Mycol. Appl. 53(1–4): 220. 1974. Fusarium arcuosporum Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 186. 1915. Fusarium ferruginosum Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 190. 1915. Fusarium sanguineum Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 193. 1915. Fusarium lanceolatum O.A. Pratt, J. Agric. Res. 13: 83. 1918. Fusarium pseudoeffusum Murashk., Arb. Landwirtsch. Akad. Omsk. 3: 19. 1924. Fusarium moronei Curzi, Revista Biol. (Lisbon)10: 141. 1928. Fusarium russianum Manns, Bull. N. Dakota Agric. Exp. Sta. 259: 34. 1932. Gibberella acuminata Wollenw., Fusarien: 68. 1935. Spermospora oryza M. Rao, Sci. & Cult. 32: 94. 1966. Gibberella acuminata C. Booth, The Genus Fusarium: 161. 1971, nom. illegit., Art. 53.1. Holotypus: NY00928689. FUSARIUM Type locality: USA, New York, Geneva. Type substrate: Solanum tuberosum. Descriptions and illustrations: See Sherbakoff (1915), Booth (1971), Gerlach & Nirenberg (1982), Burgess & Summerell (2000) and Leslie & Summerell (2006). Notes: Fusarium acuminatum is an established name in the Fusarium literature, but it lacks living type material to confirm its taxonomic position. Although an older epithet, based on Selenosporium hippocastani, could be used, we refrain from providing a new combination for this well-known species due to a lack of DNA-based evidence to support this combination. Moreover, Holubov
a-Jechov
a et al. (1994) could not locate any holotype material for S. hippocastani, abstaining from introducing a neotype, which they argued would cause nomenclatural instability, a view we fully support. acutatum Fusarium Nirenberg & O'Donnell, Persoonia 46: 144. 2021. Synonym: Fusarium acutatum Nirenberg & O'Donnell, Mycologia 90: 435. 1998, nom. inval., Art. 40.1. Holotypus: B 70 0001695. Ex-type culture: BBA 69580 = CBS 402.97 = FRC 0-1117 = IMI 376110 = NRRL 13309. Type locality: India. Type substrate: Unknown. Descriptions and illustrations: See Nirenberg & O'Donnell (1998) and Yilmaz et al. (2021). Diagnostic DNA barcodes: rpb1: MT010947; rpb2: KT154005; tef1: KR071754. acutisporum Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 1. 2020. Neocosmospora acutispora Sand.-Den. & Crous, Persoonia 43: 108. 2019. Holotypus: CBS H-23969. Ex-type culture: BBA 62213 = CBS 145461 = NRRL 22574. Type locality: Guatemala. Type substrate: Coffea arabica Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834210; rpb2: LR583814; tef1: LR583593. aderholdii Fusarium Osterw., Bericht Schweiz. Versuchsanst. Obst-, Wein- und Gartenbau 1913/14: 519. 1915. Ilyonectria destructans (Zinssm.) Rossman et al., Stud. Mycol. 80: 217. 2015. Basionym: Ramularia destructans Zinssm., Phytopathology 8: 570. 1918. Synonyms: Cylindrocarpon destructans (Zinssm.) Scholten, Netherlands J. Plant Pathol. 70 suppl. (2): 9. 1964. Fusarium polymorphum Marchal, Bull. Soc. Roy. Bot. Belgique 34: 145. 1895, nom. illegit., Art. 53.1. Cylindrocarpon radicicola Wollenw., Fusaria Autogr. Delin. 2: 651. 1924. Nectria radicicola Gerlach & L. Nilsson, Phytopathol. Z. 48: 255. 1963. Neonectria radicicola (Gerlach & L. Nilsson) Mantiri & Samuels, Canad. J. Bot. 79: 339. 2001. Ilyonectria radicicola (Gerlach & L. Nilsson) P. Chaverri & C.G. Salgado, Stud. Mycol. 68: 71. 2011. ?Fusarium rhizogenum Aderh., Centralbl. Bacteriol. Parasitenk., 2. Abth., 6: 623. 1900, nom. illegit., Art. 53.1. www.studiesinmycology.org REDELIMITED ?Septocylindrium radicicola Aderh., Centralbl. Bakteriol. Parasitenk., 2. Abth., 6: 623, 1900, nom. illegit., Art. 53.1. ?Septocylindrium aderholdii Sacc & P. Syd., Syll. Fung. 16: 1048. 1902. Holotypus: Not located. Type locality: Germany. Type substrate: Unknown. Notes: Synonymy fide Wollenweber & Reinking (1935). Although older epithets are available for Ilyonectria destructans, we refrain from providing a new combination for this well-known species due to a lack of DNA-based evidence to support this combination. adesmiae Fusarium Henn., Hedwigia 36: 246. 1897. Synonym: Ramularia adesmiae (Henn.) Wollenw., Fusaria Autogr. Delin. 1: 466. 1916. Holotypus: In B fide Hein (1988). Type locality: Chile, Bío-Bío Province. Type substrate: Adesmia sp. Note: Status unclear, not Ramularia fide Braun (1998). aduncisporum Fusarium Weimer & Harter, J. Agric. Res. 32: 312. 1926. (See Fusarium solani) Lectotypus: BPI 451321, designated in Sandoval-Denis et al. (2019). Lectotype locality: USA, California, Ventura. Lectotype substrate: Stems of Melilotus alba. Note: Synonym fide Wollenweber & Reinking (1935). aecidii-tussilaginis Fusarium Allesch., Ber. Bot. Vereines Landshut 12: 131. 1892. (See Fusarium avenaceum) Holotypus: In M. Type locality: Germany, Oberammergau. Type substrate: Aecidium tussilaginis. Note: Synonym fide Wollenweber & Reinking (1935). aeruginosum Fusarium Delacr., Bull. Soc. Mycol. France 7: 110. 1891. (See Fusarium caeruleum) Lectotypus (hic designatus, MBT 10000648): France, Paris, from Solanum tuberosum, April 1891, G. Delacroix, Bull. Soc. Mycol. France 7: pl. VIII, fig. h. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. aethiopicum Fusarium O'Donnell et al., Fungal Genet. Biol. 45: 1521. 2008. Holotypus: BPI 878409. Ex-type culture: CBS 122858 = NRRL 46726. Type locality: Ethiopia, Bure district, west Gojjam zone of Amhara region. Type substrate: Triticum aestivum. Descriptions and illustrations: See O'Donnell et al. (2008b). Diagnostic DNA barcodes: rpb1: MW233298; rpb2: MW233470; tef1: FJ240298. affine Fusarium Fautrey & Lambotte, Rev. Mycol. (Toulouse) 18: 68. 1896. Syntypes: ILL00221136 (Roumeguere, Fungi Sel. Gall. Exs. no. 6927) & ILL00221137 (Roumeguere, Fungi Sel. Gall. Exs. no. 6928). Type locality: France. Type substrate: Solanum tuberosum. 81 CROUS ET AL. Notes: Booth (1971) examined the exsiccatae (Fung. Sel. Gall. Exs., No. 6927 & 6928) of F. affine and found that one part (no. 6927) is F. solani and the other part (no. 6928) represented another fungus that was interpreted as Hymenula affinis by Wollenweber (1916–1935). Booth (1971) indicated that F. affine might be a possible synonym of F. tabacinum, which is now regarded as Plectosphaerella cucumerina (Palm et al. 1995, Giraldo & Crous 2019). However, both Gams & Gerlach (1968) and Palm et al. (1995) considered F. affine as a misapplied synonym of P. cucumerina. Sherbakoff (1915) also treated the fungus as F. affine, which was later reinterpreted as Septomyxa affine by Wollenweber (1916–1935). Therefore, the current status of F. affine is uncertain and requires further investigation. agapanthi Fusarium O'Donnell et al., Mycologia 108: 987. 2016. Holotypus: VPRI 41777. Ex-type culture: NRRL 54463 = VPRI 41777. Type locality: Australia, Victoria, Melbourne, Royal Botanic Gardens. Type substrate: Agapanthus praecox. Descriptions and illustrations: See Edwards et al. (2016). Diagnostic DNA barcodes: rpb1: KU900620; rpb2: KU900625; tef1: KU900630. agaricorum Fusarium Sarrazin, Rev. Mycol. (Toulouse) 9: 170. 1887. Lectotypus (hic designatus, MBT 10000649): France, on the cap of Psalliota campestris (syn. Agaricus campestris), 1887, F. Sarrazin, ILL00218415 (Roumeguere, Fungi Sel. Gall. Exs. no. 4298). Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). ailanthinum Fusarium Speg., Anales Mus. Nac. Hist. Nat. Buenos Aires 6: 350. 1899. (See Fusarium lateritium) Holotypus: In LPS (Fungi Argent. n.v.c. #864). Type locality: Argentina. Type substrate: Trunk and branches of Ailanthus glandulosa. Note: Synonym fide Wollenweber & Reinking (1935). alabamense Fusarium Sacc., Syll. Fung. 4: 722. 1886, nom. illegit., Art. 52.1. Synonym: Fusarium erubescens Berk. & M.A. Curtis, Grevillea 3: 98. 1875. Holotypus: ?K(M). Type locality: USA, Alabama, Beaumont. Type substrate: Bark. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). albedinis Fusarium Kill. & Maire ex Malençon, Compt. Rend. Hebd. S
eances Acad. Sci. 198: 1261. 1934, nom. inval., Art. 6.10. Synonym: Cylindrophora albedinis Kill. & Maire, Bull. Soc. Hist. Nat. Afrique N. 21: 97. 1930, nom. inval., Art. 36.1. (See Fusarium oxysporum) Authentic material: Not located. Original locality: Indicated as ‘oasis in Sahara’. Original substrate: Dead trunk and leaf of Phoenix dactylifera. Note: Synonym fide Booth (1971). albertii Fusarium Roum., Fungi Sel. Gall. Exs., Cent. 19: no. 1867. 1881, nom. inval., Art. 38.1(a). 82 (See Fusarium lateritium) Authentic material: BR5020140140720. Original locality: France. Original substrate: Petiole of Ziziphus volubilis. Note: Synonym fide Wollenweber & Reinking (1935). albidoviolaceum Fusarium Dasz. (as ‘albido-violaceum’), Bull. Soc. Bot. Geneve, s
er. 2, 4: 293. 1912. (See Fusarium oxysporum) Lectotypus (hic designatus, MBT 10000650): Switzerland, Geneva, from soil, 1912, W. Daszewska, Bull. Soc. Bot. Geneve, 2 s
er. 4: 292, fig. 15. Notes: Wollenweber (1916–1935; Fusaria Autogr. Delin. 1: 361) indicated that the living ex-type culture was lodged in the laboratory of W.C. Scholten in Amsterdam, which in turn has been accessioned into the CBS. However, no record or culture can be located in the CBS collection. Therefore, an illustration accompanying the original protologue is designated as lectotype here. albidum Fusarium (Rossman) O'Donnell & Geiser, Phytopathology 103: 404. 2013. Luteonectria albida (Rossman) Sand.-Den. & L. Lombard, Stud. Mycol. 98 (no. 100116): 60. 2021. Basionym: Nectria albida Rossman, Mycol. Pap. 150: 79. 1983. Synonym: Albonectria albida (Rossman) Guu & Y.M. Ju, Bot. Stud. (Taipei) 48: 189. 2007. Holotypus: CUP-MJ 942. Ex-type culture: ATCC 44543 = BBA 67603 = CTR 71110 = NRRL 13950 = NRRL 22152. Type locality: Jamaica, Hanover Parish, Dolphin Head Mountain, near Askenish. Type substrate: Erumpent through thin bark of woody stem. Diagnostic DNA barcode: rpb1: JX171492; rpb2: HQ897738; tef1: MW834283. albiziae Fusarium Woron., Vestn. Tiflissk. Bot Sada 48: 34. 1920. (See Fusarium merismoides) Syntypes: BPI 451733, BPI 451734 & CUP-017160. Type locality: Georgia, Batumi, Adjara. Type substrate: Albizia julibrissin. Notes: Synonym fide Wollenweber & Reinking (1935). Lectotypification requires further investigation of the syntypes. albocarneum Fusarium (Cooke & Harkn.) Sacc., Syll. Fung. 4: 720. 1886. Basionym: Fusidium albocarneum Cooke & Harkn., Grevillea 9: 129. 1881. Syntype: BPI 408577. Type locality: USA, California, San Francisco, San Francisco Odd Fellows Cemetery. Type substrate: Eucalyptus sp. Notes: The generic name Cylindrocarpon (= Neonectria; Rossman et al. 2013) was conserved over Fusidium, making the latter generic name a nom. rej. (Art. 14.1, 14.6 & 14.7). Therefore, Fusidium albocarneum should be transferred to Neonectria after further investigation. Lectotypification requires further investigation of the syntype. albosuccineum Fusarium (Pat.) O'Donnell & Geiser, Phytopathology 103: 404. 2013. Albonectria albosuccinea (Pat.) Rossman & Samuels, Stud. Mycol. 42: 107. 1999. Basionym: Calonectria albosuccinea Pat., Bull. Soc. Mycol. France 8: 132. 1892. FUSARIUM REDELIMITED Synonyms: Nectria albosuccinea (Pat.) Rossman, Mycotaxon 8: 487. 1979. Calonectria ecuadorica Petrak, Sydowia 4: 463. 1950. Holotypus: In FH fide Rossman (1983). Type locality: Ecuador, Puente Chimbo. Type substrate: Bark. Holotypus: EMC, Palacios-Prü, 3 April 1998. Type locality: Venezuela, Merida State, south of Sierra La Culata, Valle de San Javier, Los Pinos. Type substrate: Beetle immersed in kerosene. Descriptions and illustrations: See Marcano et al. (2001). Note: No living type material could be located. album Fusarium Sacc., Michelia 1: 82. 1877. Neonectria punicea (J.C. Schmidt) Castl. & Rossman, Canad. J. Bot. 84: 1425. 2006. Basionym: Sphaeria punicea J.C. Schmidt, in Schmidt & Kunze, Mykol. Hefte 1: 61. 1817. Synonyms: Nectria punicea (J.C. Schmidt) Fr., Summa Veg. Scand. 2: 387. 1849. Cucurbitaria punicea (J.C. Schmidt) Kuntze, Revis. Gen. Pl. 3: 461. 1898. Cylindrocarpon album (Sacc.) Wollenw., Fusaria Autogr. Delin. 1: no. 473. 1916. Nectria punicea f. ilicicola Rehm, Ascomyceten: no. 337. 1876. Nectria punicea var. ilicis C. Booth, Mycol. Pap. 73: 54. 1959. Cylindrocarpon album var. majus Wollenw., Z. Parasitenk. (Berlin) 1: 154. 1928. Fusarium album var. abietinum Beeli, Bull. Soc. Roy. Bot. Belgique 62: 131. 1930. Holotypus: Not located. Type locality: Italy. Type substrate: Bark of Pinus sp. Note: Synonym fide Wollenweber & Reinking (1935). allescheri Fusarium Sacc. & P. Syd., Syll. Fung. 14: 1128. 1899. Replaced synonym: Fusarium glandicola Allesch., Ber. Bot. Vereines Landshut 12: 130. 1892, nom. illegit., Art. 53.1; non Cooke & W.R. Gerard 1878. (See Fusarium melanochlorum) Holotypus: In M. Type locality: Germany, München. Type substrate: Quercus pedunculata. Note: Synonym fide Wollenweber & Reinking (1935). aleurinum Fusarium Ellis & Everh., Bull. Torrey Bot. Club 24: 476. 1897. (See Fusarium avenaceum) Syntypes: In BPI, BRU, CLEMS, CUP, F, FLAS, ILL, ILLS, ISC, MICH, MSC, MU, NCU, NEB, OSC, PH, PUL, UC, WIS & WSP. Type locality: USA, West Virginia, Fayette County Nuttallburg, south of Edmond. Type substrate: Wheat flour that had been on the ground for four months. Notes: Synonym fide Wollenweber & Reinking (1935). Lectotypification requires further investigation of the syntypes. aleyrodis Fusarium Petch, Trans. Brit. Mycol. Soc. 7: 164. 1921. Lectotypus (hic designatus, MBT 10000651): USA, Florida, Sutherland, from Aleyrodes citri, 13 Sep. 1907, F. Wills, in Petch 1921, Trans. Brit. Mycol. Soc. 7, pl. V, fig. 12. Notes: Wollenweber & Reinking (1935) considered this species as a synonym of F. scirpi. However, based on the descriptions and illustrations provided by Fawcett (1908) and Petch (1920), this species belongs to the genus Microcera, which is also in agreement with its aetiology. Therefore, a new combination will presumably be required after further investigation. algeriense Fusarium Laraba & O'Donnell, Mycologia 109: 944. 2017. Holotypus: BPI 910347. Ex-type culture: CBS 142638 = NRRL 66647. Type locality: Algeria, Guelma Province, Djeballah Khemissi. Type substrate: Triticum durum. Descriptions and illustrations: See Laraba et al. (2017). Diagnostic DNA barcodes: rpb1: MF120488; rpb2: MF120499; tef1: MF120510. alkanophilum Fusarium Palacios-Prü & V. Marcano, Rev. Ecol. Latinoamer. 8: 5. 2001. www.studiesinmycology.org allescherianum Fusarium Henn., Verh. Bot. Vereins Prov. Brandenburg 40: 175. 1899. Synonyms: Gloeosporium allescherianum (Henn.) Wollenw., Fusaria Autogr. Delin. 1: 495. 1916. ?Fusarium personatum Cooke, in Harkness, Grevillea 7: 12. 1878. Holotypus: In B fide Hein (1988). Type locality: Germany. Type substrate: Leaves of Ocotea foetens. Notes: Status unclear. The taxonomic status of Gloeosporium allescherianum is questionable. Furthermore, there is no DNAbased evidence linking F. allescherianum to F. personatum although Wollenweber & Reinking (1935) considered them both synonyms under G. allescherianum. allii-sativi Fusarium Allesch., Ber. Bot. Vereines Landshut 12: 131. 1892. (See Fusarium solani) Holotypus: In M. Type locality: Germany, Unterammergau. Type substrate: Allium sativum. alluviale Fusarium Wollenw. & Reinking, Phytopathology 15: 167. 1925. (See Fusarium solani) Holotypus: Not located. Type locality: Honduras. Type substrate: Alluvial soil. aloes Fusarium Kalchbr. & Cooke, Grevillea 9: 23. 1880. (See Fusarium scirpi) Holotypus: ?K(M). Type locality: South Africa, Eastern Cape Province, Somerset East. Type substrate: Aloe arborescens. Note: Synonym fide Wollenweber & Reinking (1935). ambrosium Fusarium (Gadd & Loos) Agnihothr. & Nirenberg, Stud. Mycol. 32: 98. 1990. Neocosmospora ambrosia (Gadd & Loos) L. Lombard & Crous, Stud. Mycol. 80: 227. 2015. Basionym: Monacrosporium ambrosium Gadd & Loos, Trans. Brit. Mycol. Soc. 31: 17. 1947. Synonyms: Dactylella ambrosia (Gadd & Loos) K.Q. Zhang et al., Mycosystema 7: 112. 1995. Fusarium bugnicourtii Brayford, Trans. Brit. Mycol. Soc. 89: 350. 1987. 83 CROUS ET AL. Lectotypus: Trans. Brit. Mycol. Soc. 31: 16, Text-fig. 5. 1947, designated by Aoki et al. (2018). Lectotype locality: Sri Lanka. Lectotype substrate: Gallery of Euwallacea fornicatus infesting Camellia sinensis. Epitypus: BPI 910524, designated by Aoki et al. (2018). Ex-epitype culture: BBA 65390 = CBS 571.94 = NRRL 22346 = MAFF 246287. Epitype locality: India, Upasi Tea Institute. Epitype substrate: Gallery of Euwallacea fornicatus infesting Camellia sinensis. Diagnostic DNA barcodes: rpb1: KC691587; rpb2: EU329503; tef1: FJ240350 amenti Fusarium Rostr., Bot. Tidsskr. 14: 240. 1885. (See Fusarium avenaceum) Holotypus: F-604398 in UPS. Type locality: Denmark, Fyn, Holmdrup. Type substrate: Salix cinerea. Note: Synonym fide Wollenweber & Reinking (1935). amentorum Fusarium Lacroix, Fl. Maine-et-Loire 2 (Suppl.): [1]. 1854. (See Fusarium avenaceum) Lectotypus (hic designatus, MBT 10000652): France, St. Romain-sur-Vienne, from Salix cinerea, date unknown, J.B.H.J. Desmazieres, BR5020140143752. Note: Synonym fide Wollenweber & Reinking (1935). amethysteum Fusarium P. Crouan & H. Crouan, Fl. Finistere: 14. 1867. Holotypus: Not located. Type locality: France. Type substrate: Dead stem of Urtica sp. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). ampelodesmi Fusarium Fautrey & Roum., in Roumeguere, Rev. Mycol. (Toulouse) 13: 82. 1891. (See Fusarium reticulatum) Syntype: ILL00219841 (Roumeguere, Fungi Sel. Gall. Exs. no. 5687). Type locality: France, Jardin de Noidan. Type substrate: Ampelodesmos tenax Notes: Synonym fide Wollenweber & Reinking (1935). Lectotypification requires further investigation of the syntype. amplum Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 1. 2020. Neocosmospora ampla Sand.-Denis & Crous, Persoonia 43: 110. 2019. Holotypus: CBS H-23970. Ex-type culture: BBA 4170 = CBS 202.32. Type locality: German East Africa. Type substrate: Coffea sp. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834212; rpb2: LR583815; tef1: LR583594. ananatum Fusarium A. Jacobs et al., Fung. Biol. 114: 522. 2010. Holotypus: PREM 58713. Ex-type culture: CBS 118516 = CMW 18685 = FCC 2986 = MRC 8165. Type locality: South Africa, KwaZulu-Natal Province, Hluhluwe. 84 Type substrate: Ananas comosus. Descriptions and illustrations: See Jacobs et al. (2010). Diagnostic DNA barcodes: rpb1: MT010937; rpb2: LT996137; tef1: MT010996. andinum Fusarium Syd., Ann. Mycol. 37: 437. 1939. Holotypus: S-F 45569. Type locality: Ecuador, Tungurahua. Type substrate: Chusquea serrulata. Descriptions and illustrations: See Sydow & Sydow (1939). andiyazi Fusarium Marasas et al., Mycologia 93: 1205. 2001. Holotypus: BPI 748223. Ex-type culture: CBS 119857 = IMI 386078 = KSU 4804 = MRC 6122. Type locality: South Africa, KwaZulu-Natal Province, Greytown. Type substrate: Soil debris of Sorghum bicolor. Descriptions and illustrations: See Marasas et al. (2001) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: LT996189; rpb2: LT996138; tef1: LT996092. andropogonis Fusarium Cooke ex Sacc., Syll. Fung. 10: 726. 1892. Synonyms: Fusisporium andropogonis Cooke ex Thüm., Mycoth. Univ. 7: no. 676. 1877, nom. inval., Art. 38.1(a). Ramularia andropogonis (Cooke ex Sacc.) Wollenw., Fusaria Autogr. Delin. 1: 469. 1916. Lectotypus (hic designatus, MBT 10000653): USA, New Jersey, Newfield, from dead stem of Andropogon virginicus, Oct. 1874, J.B. Ellis, BR5020081431482 (Thümen, Mycoth. Univ. 7: no. 676). Notes: Status unclear, not Ramularia fide Braun (1998). Synonym fide Wollenweber & Reinking (1935). anguioides Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 169. 1915. Typus: ?CUP-007479. Type locality: USA, New York, Castile. Type substrate: Solanum tuberosum. Descriptions and illustrations: See Sherbakoff (1915), Gerlach & Nirenberg (1982) and Nelson et al. (1995). Notes: Nelson et al. (1995) designated BPI 72044 as neotype of F. anguioides, erroneously stating that no materials were available for epi- and lectotypification. However, Sherbakoff (1915) did provide an illustration with the original protologue of F. anguioides and placed material in CUP, as CUP-007479. Furthermore, the neotype (BPI 72044) of Nelson et al. (1995) originated from China and was isolated from soil in a bamboo grove. An isolate from the original locality (USA) and host (Solanum tuberosum) needs to be selected. Lectotypification pending study of material lodged in CUP. angustum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 203. 1915. (See Fusarium oxysporum) Typus: ?CUP-007435. Type locality: USA, New York, Ithaca. Type substrate: Solanum tuberosum. Descriptions and illustrations: See Sherbakoff (1915). Notes: Synonym fide Wollenweber & Reinking (1935). Lectotypification pending study of material lodged in CUP. anisophilum Fusarium Picado, J. Dept. Agric. Porto Rico 16: 391. 1932. FUSARIUM (See Fusarium lateritium) Holotypus: Not located. Type locality: Costa Rica. Type substrate: Living stem of Coffea sp. Note: Synonym fide Wollenweber & Reinking (1935). annulatum Fusarium Bugnic., Rev. G
en. Bot. 59: 17. 1952. Holotypus: IMI 202878. Ex-type culture: BBA 63629 = CBS 258.54 = IMI 202878 = MUCL 8059 = NRRL 13619. Type locality: New Caledonia. Type substrate: Grain of Oryza sativa. Descriptions and illustrations: See Bugnicourt (1952), Yilmaz et al. (2021). Diagnostic DNA barcodes: rpb1: MT010944; rpb2: MT010983; tef1: MT010994. annuum Fusarium Leonian, Bull. New Mex. Coll. Agric. Mech. Arts 121: 9. 1919. Lectotypus (hic designatus, MBT 10000654): USA, New Mexico, from Capsicum annuum, 1919, L.H. Leonian, In Bull. New Mex. Coll. Agric. Mech. Arts 121: 32, fig. 7. Notes: No type specimen could be located. Wollenweber & Reinking (1935) mentioned this species but did not study or treat it any further. A new collection is required for epitypification from the type locality and substrate. anomalum Fusarium Berk. & M.A. Curtis, in Berkeley, Grevillea 3: 99. 1875. Holotypus: ?K(M). Type locality: USA, the New England region. Type substrate: Gleditsia sp. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). anthophilum Fusarium (A. Braun) Wollenw., Ann. Mycol. 15: 14. 1917. Basionym: Fusisporium anthophilum A. Braun, in Rabenhorst, Fungi Eur. Exs.: no. 1964. 1875. Synonyms: Fusarium moniliforme var. anthophilum (A. Braun) Wollenw., Fusaria Autogr. Delin. 3: 975. 1930. Fusarium tricinctum var. anthophilum (A. Braun) Bilaĭ, Fusarii (Biologija I sistematika): 251. 1955. Fusarium sporotrichiella var. anthophilum (A. Braun) Bilaĭ, Mikrobiol. Zhurn. 49: 7. 1987. Fusarium sanguineum var. pallidius Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 196. 1915. Fusarium wollenweberi Raillo, Fungi of the Genus Fusarium: 189. 1950, nom. inval., Art. 41.1. Lectotypus: Rabenhorst, Fungi Eur. Exs. no. 1964 in B, designated by Yilmaz et al. (2021). Lectotype locality: Germany, Berchtesgaden. Lectotype substrate: Succisa pratensis. Epitypus: CBS 222.76 (preserved as metabolically inactive culture), designated by Yilmaz et al. (2021). Ex-epitype culture: BBA 63270 = CBS 222.76 = IMI 196084 = IMI 202880 = NRRL 22943 = NRRL 25216. Epitype locality: Germany, Berlin. Epitype substrate: Euphorbia pulcherrima. Descriptions and illustrations: See Wollenweber & Reinking (1935), Nirenberg (1976), Gerlach & Nirenberg (1982), Nelson et al. (1983) and Leslie & Summerell (2006). www.studiesinmycology.org REDELIMITED Diagnostic DNA barcodes: rpb1: MW402641; rpb2: MW402811; tef1: MW402114. apii Fusarium P.E. Nelson & Sherb., Techn. Bull. Michigan Agric. Exp. Sta. 155: 42. 1937. (See Fusarium oxysporum) Holotypus: Not located. Type locality: USA. Type substrate: Apium graveolens var. dulce. apiogenum Fusarium Sacc., Syll. Fung. 4: 717. 1886. (See Fusarium lactis) Holotypus: Not located. Type locality: Germany. Type substrate: Rotten fruit. aquaeductuum Fusarium (Radlk. & Rabenh.) Lagerh. & Rabenh., Centralbl. Bakteriol. Parasitenk. Abth.9: 655. 1891. Fusicolla aquaeductuum (Radlk. & Rabenh.) Gr€afenhan et al., Stud. Mycol. 68: 100. 2011. Basionym: Selenosporium aquaeductuum Radlk. & Rabenh., Kunst- und Gewerbeblatt des Polytechnischen Vereins des Königreichs Bayern 41(1): 10. 1863. Synonyms: Fusisporium moschatum Kitasato, Centralbl. Bakteriol. Parasitenk., 1. Abth. 5: 368. 1889. Fusarium moschatum (Kitasato) Sacc., Syll. Fung. 10: 729. 1892. Fusarium magnusianum Allesch., Fungi Bav. no. 400. 1895. Fusarium aquaeductuum var. pusillum Wollenw., Ann. Mycol. 15: 53. 1917. Fusarium aquaeductuum var. volutum Wollenw., Ann. Mycol. 15: 53. 1917. Fusarium aquaeductuum var. elongatum Wollenw., Fusaria Autogr. Delin. 3: 847. 1930. Fusarium aquaeductuum var. majus Wollenw., Fusaria Autogr. Delin. 3: 845. 1930. Fusarium bicellulare Kirschst., Hedwigia 80: 136. 1941. Lectotypus: B 700014034, designated in Gr€afenhan et al. (2011). Lectotype locality: Germany, Bayern, München, Gasteigberg. Lectotype substrate: Water in water fountain. Epitypus: BBA 64559, designated in Gr€afenhan et al. (2011). Ex-epitype culture: BBA 64559 = CBS 837.85 = NRRL 20865 = NRRL 37595. Epitype locality: Germany. Epitype substrate: Water from plugged water tap in BBA. Descriptions and illustrations: See Gerlach & Nirenberg (1982). Diagnostic DNA barcodes: rpb1: KM232250; rpb2: HQ897744; tef1: KM231955. arachnoideum Fusarium (Corda) Sacc., Syll. Fung. 4: 721. 1886. Basionym: Fusisporium arachnoideum Corda, Icon. Fung. 1: 11. 1837. (See Fusarium merismoides) Typus: In PRM. Type locality: Czech Republic, Prague. Type substrate: Soil. Note: Synonym fide Wollenweber & Reinking (1935). Lectotypification pending study of material lodged in PRM. arcuatisporum Fusarium M.M. Wang et al., Persoonia 43: 78. 2019. Holotypus: HAMS 248034. Ex-type culture: CGMCC 3.19493 = LC 12147. Type locality: China, Hubei. 85 CROUS ET AL. Type substrate: Pollen of Brassica campestris. Descriptions and illustrations: See Wang et al. (2019). Diagnostic DNA barcodes: rpb1: MK289799; rpb2: MK289739; tef1: MK289584. (1993) paper, rather than the intended basionym alone, rendering the combination invalid (Art. 41.5, Ex. 15). Here we validate the new combination with the correct citation of the basionym. arcuatum Fusarium Berk. & M.A. Curtis, Grevillea 3: 99. 1875. (See Fusarium avenaceum) Lectotypus (hic designatus, MBT 10000655): USA, South Carolina, Malus pumila (syn. Pyrus malus), date unknown, M.A. Curtis, PH00005557. Note: Synonym fide Wollenweber & Reinking (1935). arthrosporioides Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 175. 1915. Typus: ?CUP-007467. Type locality: USA, New York, Castile. Type substrate: Solanum tuberosum. Descriptions and illustrations: See Sherbakoff (1915), Booth (1971) and Gerlach & Nirenberg (1982). Notes: Synonym fide Wollenweber & Reinking (1935). Lectoand epitypification pending study of material lodged in CUP. arcuosporum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 186. 1915. (See Fusarium acuminatum) Typus: ?CUP-007477. Type locality: USA, New York, Castile. Type substrate: Solanum tuberosum. Descriptions and illustrations: See Sherbakoff (1915). Notes: Synonym fide Wollenweber & Reinking (1935). Lectotypification pending study of material lodged in CUP. argillaceum Fusarium (Fr.) Sacc., Syll. Fung. 4: 718. 1886. Basionym: Fusisporium argillaceum Fr., Syst. Mycol. 3: 446. 1832. Synonyms: Fusarium solani var. argillaceum (Fr.) Bilaĭ, Mikrobiol. Zhurn. 49: 7. 1987. Nectria solani Reinke & Berthold, Untersuch. Bot. Lab. Univ. Göttingen 1: 39. 1879. Dialonectria solani (Reinke & Berthold) Cooke, Grevillea 12: 111. 1884. Cucurbitaria solani (Reinke & Berthold) Kuntze, Revis. Gen. Pl. 3: 461. 1898. Holotypus: Not located. Type locality: Unknown. Type substrate: Periderm of Cucumis sp. Notes: Status unclear. Requires recollection from type locality and substrate. aridum Fusarium O.A. Pratt, J. Agric. Res. 13: 89. 1918. (See Fusarium sambucinum) Lectotypus (hic designatus, MBT 10000656): USA, Idaho, from soil, 1918, O.A. Pratt, in J. Agric. Res.13: 87, fig. 2Q. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. armeniacum Fusarium (G.A. Forbes et al.) L.W. Burgess & Summerell, comb. nov. MycoBank MB 837636. Basionym: Fusarium acuminatum subsp. armeniacum G.A. Forbes et al., Mycologia 85: 120. 1993. Holotypus: DAR 67507. Ex-type culture: ATCC 90020 = CBS 485.94 = FRC R-9335 = IMI 352099 = MRC 6230 = NRRL 26908 = NRRL 25141 = NRRL 29133. Type locality: Australia, New South Wales, Edgeroi. Type substrate: Triticum aestivum. Descriptions and illustrations: See Burgess et al. (1993), Burgess & Summerell (2000) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: KT597715; rpb2: GQ915485; tef1: GQ915501. Notes: When proposing F. armeniacum, Burgess & Summerell (2000) cited the basionym as F. acuminatum subsp. armeniacum with reference to the entire pagination of Burgess et al.'s 86 arundinis Fusarium (Corda) Sacc., Syll. Fung. 4: 724. 1886. Trichoderma viride Pers., Neues Mag. Bot. 1: 92. 1794, nom. sanct. [Fr., Syst. Mycol. 3: 215. 1829]. Synonyms: Pyrenium lignorum Tode, Fung. Mecklenb. Sel. 1: 33, tab. 3, fig. 29. 1790. Trichoderma lignorum (Tode) Harz, Bull. Soc. Imp. Naturalistes Moscou 44: 116. 1871. Trichoderma viride Schumach., Enum. Pl. 2: 235. 1803, nom. illegit., Art. 53.1. Fusisporium arundinis Corda, Icon. Fung. 1: 11. 1837. Trichoderma glaucum E.V. Abbott, Iowa State Coll. J. Sci. 1: 27. 1927. Lectotypus (hic designatus, MBT 10000657): Czech Republic, Prague, rotten leaves of reeds, 1837, A.C.J. Corda, Icon. Fung. 1, tab. II, fig. 163. Notes: Synonyms fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. arvense Fusarium Speg., Anales Soc. Ci. Argent. 10: 60. 1880. (See Fusarium merismoides) Holotypus: In LPS (Fungi Argent. pug. 2, #153). Type locality: Argentina. Type substrate: Dried fruits of Solanum elaeagnifolium. Note: Synonym fide Wollenweber & Reinking (1935). asclepiadeum Fusarium Fautrey, Rev. Mycol. (Toulouse) 18: 68. 1896. (See Fusarium lateritium) Syntype: ILL00221138 (Fungi Sel. Gall. Exs. #6929). Type locality: France, Montagne de Bard. Type substrate: Vincetoxicum officinale (syn. V. hirundinaria). Note: Synonym fide Wollenweber & Reinking (1935). asclerotium Fusarium (Sherb.) Wollenw., Fusaria Autogr. Delin. 1: 364. 1916. Basionym: Fusarium oxysporum var. asclerotium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 222. 1915. (See Fusarium oxysporum) Lectotypus (hic designatus, MBT 10000658): USA, New York, Atlanta, rotten tuber of Solanum tuberosum, 1915, C.D. Sherbakoff, in Mem. Cornell Univ. Agric. Exp. Sta. 6: 221, fig. 35 B–J. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. asiaticum Fusarium O'Donnell et al., Fungal Genet. Biol. 41: 619. 2004. Holotypus: BPI 843478. FUSARIUM REDELIMITED Ex-type culture: CBS 110257 = FRC R-5469 = NRRL 13818. Type locality: Japan. Type substrate: Hordeum vulgare. Descriptions and illustrations: See O'Donnell et al. (2004). Diagnostic DNA barcodes: rpb1: JX171459; rpb2: JX171573; tef1: AF212451. Typus: No. 156060 in PRM. Isotypus: IMI 133948 (slide). Type locality: France. Type substrate: Dead branch. Note: Synonym fide Wollenweber & Reinking (1935). Lectotypification pending study of material lodged in PRM. asparagi Fusarium Briard, Rev. Mycol. (Toulouse) 12: 142. 1890. (See Fusarium incarnatum) Holotypus: ?PC. Type locality: France, Aube, Troyes. Type substrate: Asparagus sp. Note: Synonym fide Wollenweber & Reinking (1935). aureum Fusarium Corda, Icon. Fung. 1: 4. 1837. Hymenella aurea (Corda) L. Lombard, comb. nov. MycoBank MB 837637. Basionym: Fusarium aureum Corda, Icon. Fung. 1: 4. 1837. Synonym: Hymenula aurea (Corda) Wollenw., Fusarien: 319. 1935. Typus: In PRM fide Pilat (1938). Type locality: Czech Republic, Prague. Type substrate: Rotten vegetables. Notes: Wollenweber & Reinking (1935) provided a new combination for F. aureum in the genus Hymenula. However, the generic name Hymenella (1822) predates the generic name Hymenula (1828) and therefore we provide a new combination in the latter genus. Lectotypification pending study of material lodged in PRM. asparagi Fusarium Delacr., Bull. Soc. Mycol. France 6: 99. 1890, nom. illegit., Art. 53.1., non Fusarium asparagi Briard 1890. Replacing synonym: Fusarium delacroixii Sacc., Syll. Fung. 10: 725. 1892. (See Fusarium sambucinum) Notes: Synonym fide Wollenweber & Reinking (1935). See F. delacroixii for lectotypification. asperifoliorum Fusarium (Westend.) Sacc., Syll. Fung. 4: 703. 1886. Basionym: Selenosporium asperifoliorum Westend., Bull. Acad. Roy. Sci. Belgique, s
er. 2, 11: 652. 1861. Holotypus: BR5020140146784. Type locality: Belgium, Oudenaarde. Type substrate: Borago officinalis. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). aspidioti Fusarium Sawada, Bot. Mag. (Tokyo) 28: 312. 1914. (See Fusarium larvarum) Holotypus: TNS-F-218710. Type locality: Japan, Shizuoka. Type substrate: Quadraspidiotus perniciosus (= Aspidiotus perniciosus) (San Jose scale). Note: Synonym fide Wollenweber & Reinking (1935). atrovinosum Fusarium L. Lombard & Crous, Fungal Syst. Evol. 4: 190. 2019. Holotypus: CBS H-24015. Ex-type culture: CBS 445.67 = BBA 10357 = DSM 62169 = IMI 096270 = NRRL 26852 = NRRL 26913. Type locality: Australia. Type substrate: Triticum aestivum. Descriptions and illustrations: See Lombard et al. (2019a). Diagnostic DNA barcodes: rpb1: MN120713; rpb2: MW928822; tef1: MN120752. atrovirens Fusarium (Berk.) Mussat, Syll. Fung. 15: 144. 1901, nom. inval., Arts. 35.1, 36.1(a), (c). Fusariella atrovirens (Berk.) Sacc., Atti Reale Ist. Veneto Sci. Lett. Arti, ser. 6, 2: 463. 1884. Basionym: Fusisporium atrovirens Berk., in Smith, Engl. Fl. 5 (2): 351. 1836. Holotypus: ?K(M). Type locality: UK, Northamptonshire, Kings Cliffe. Type substrate: Allium sp. Note: Synonym fide Wollenweber & Reinking (1935). aurantiacum Fusarium Corda, in Sturm, Deutschl. Fl., 3 Abt. (Pilze Deutschl.) 2: 19. 1829. (See Fusarium oxysporum) www.studiesinmycology.org austroafricanum Fusarium A. Jacobs et al., Mycologia 110: 1197. 2018. Holotypus: PREM 62137. Ex-type culture: NRRL 66741 = PPRI 10408. Type locality: South Africa, Eastern Cape Province, Humansdorp. Type substrate: Endophyte of Pennisetum clandestinum. Descriptions and illustrations: See Jacobs-Venter et al. (2018). Diagnostic DNA barcodes: rpb1: MH742537; rpb2: MH742616; tef1: MH742687. austroamericanum Fusarium T. Aoki et al., Fungal Genet. Biol. 41: 617. 2004. Holotypus: BPI 843473. Ex-type culture: CBS 110244 = NRRL 2903. Type locality: Brazil. Type substrate: Polypore. Descriptions and illustrations: See O'Donnell et al. (2004). Diagnostic DNA barcodes: rpb1: JAAMOD010000230; rpb2: JAAMOD010000315; tef1: JAAMOD010000079. avenaceum Fusarium (Fr.) Sacc., Syll. Fung. 4: 713. 1886. Basionym: Fusisporium avenaceum Fr., Syst. Mycol. 2: 238. 1822, nom. sanct. [Fr., l.c.]. Synonyms: Sarcopodium avenaceum (Fr.) Fr., Summa Veg. Scand. 2: 472. 1849. Fusarium herbarum var. avenaceum (Fr.) Wollenw., Fusaria Autogr. Delin. 3: 899. 1930. Fusarium roseum var. avenaceum (Fr.) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 32: 663. 1945. Fusisporium pyrinum Fr., Syst. Mycol. 3: 445. 1832, nom. sanct. [Fr., l.c.]. Fusarium pyrinum (Fr.) Sacc., Syll. Fung. 4: 720. 1886, nom. illegit., Art. 53.1. Fusarium tenue Corda, Icon. Fung. 1: 3. 1837. Selenosporium tubercularioides Corda, Icon. Fung. 1: 7. 1837. Fusarium tubercularioides (Corda) Sacc., Syll. Fung. 4: 697. 1886. Fusarium herbarum var. tubercularioides (Corda) Wollenw., Fusaria Autogr. Delin. 3: 892. 1930. Selenosporium herbarum Corda, Icon. Fung. 3: 34. 1839. Fusarium herbarum (Corda) Fr., Summa Veg. Scand. 2: 472. 1849. 87 CROUS ET AL. Fusarium graminum var. herbarum (Corda) Wollenw., Fusaria Autogr. Delin. 3: 941. 1930. Fusarium avenaceum var. herbarum (Corda) Bilaĭ, Fusarii (Biologija i sistematika): 95. 1955. Fusarium tritici Liebman bis, Tidsskr. Landoekon., n.s., 2: 515. 1840. Fusisporium zeae Westend., Bull. Acad. Roy. Sci. Belgique 18: 414. 1851. Fusarium zeae (Westend.) Sacc., Syll. Fung. 4: 713. 1886. Fusarium amentorum Lacroix, Fl. Maine-et-Loire 2 (Suppl.): [1]. 1854. Gloeosporium amentorum (Lacroix) Lind, Ann. Mycol. 3: 431. 1905. Calogloeum amentorum (Lacroix) Nannf., Svensk Bot. Tidskr. 25: 25. 1931. Platycarpium amentorum (Lacroix) Petr., Sydowia 7: 296. 1953. Fusamen amentorum (Lacroix) Arx, Verh. Kon. Akad. Wetensch., Afd. Natuurk. 51: 57. 1957. Fusisporium incarcerans Berk., Intellectual Observ. 2: 11. 1863. Fusarium incarcerans (Berk.) Sacc., Syll. Fung. 4: 713. 1886. Fusarium stercoris Fuckel, Fungi Rhen. Exs., Suppl. Fasc. 5: no. 1921, 1867. Menispora penicillata Harz, Bull. Soc. Imp. Naturalistes Moscou 44: 127. 1871. Fusarium penicillatum (Harz) Sacc., Syll. Fung. 4: 710. 1886. Fusisporium schiedermayeri Thüm., Fungi Austr. Exs. Cent. 1: no. 78. 1871. Fusarium schiedermayeri (Thüm.) Sacc., Syll. Fung. 4: 712. 1886. Fusarium arcuatum Berk. & M.A. Curtis, Grevillea 3: 99. 1875. Fusarium viticola Thüm., Pilze Weinst.: 52. 1878. Fusarium herbarum var. viticola (Thüm.) Wollenw., Fusaria Autogr. Delin. 3: 898. 1930. Fusarium gaudefroyanum Sacc., Michelia 2: 132. 1880. Fusisporium cucurbitariae Pat., Rev. Mycol. (Toulouse) 3: 10. 1881. Fusarium cucurbitariae (Pat.) Sacc., Syll. Fung. 4: 708. 1886, nom. illegit., Art. 53.1, non Fusarium cucurbitariae Peyronel 1918. Fusarium amenti Rostr., Bot. Tidsskr. 14: 240. 1885. Fusarium urenidicola Jul. Müll., Ber. Deutsch. Bot. Ges. 3: 395. 1885. Fusarium diffusum Carmich., Grevillea 16: 81. 1888. Fusarium iridis Oudem., Ned. Kruidk. Arch., ser. 2, 5: 515. 1889. Fusarium ustilaginis Kellerm. & Swingle, Rep. (Annual) Kansas Agric. Exp. Sta. 2: 285. 1890. Fusarium ruberrimum Delacr., Bull. Soc. Mycol. France 6: 139. 1890. Fusarium peckii Sacc., Syll. Fung. 10: 727. 1892, nom. illegit., Art. 53.1 [pro. p. fide Wollenweber & Reinking (1935)]. Fusarium aecidii-tussilaginis Allesch., Ber. Bot. Vereines Landshut 12: 131. 1892. Fusarium subviolaceum Roum. & Fautrey, Rev. Mycol. (Toulouse) 14: 106. 1892. Fusarium granulosum Ellis & Everh., Proc. Acad. Nat. Sci. Philadelphia 45: 466. 1894 [1893]. Fusarium jungiae Pat., Bull. Soc. Mycol. France 11: 234. 1895. Fusarium schnablianum Allesch., Hedwigia 34: 289. 1895. Fusarium seemenianum Henn., Allg. Bot. Z. Syst. 2: 83. 1896. Fusarium aleurinum Ellis & Everh., Bull. Torrey Bot. Club 24: 476. 1897. Fusarium pseudonectria Speg., Anales Mus. Nac. Hist. Nat. Buenos Aires 6: 351. 1899. Fusarium limosum Rostr., Bot. Tidsskr. 22: 263. 1899. Fusarium gracile McAlpine, Proc. Linn. Soc. New South Wales 28: 554. 1903. 88 Fusarium putrefaciens Osterw., Mitth. Thurgauischen Naturf. Ges. 16: 123. 1904. Fusarium paspali Henn., Bot. Jahrb. Syst. 38: 129. 1905. Fusarium sorghi Henn., Ann. Mus. Congo Belge, Bot., S
er. 5, 2: 105. 1907. Fusarium speiseri Lindau, Rabenh. Krypt.-Fl., ed. 2, 1(9): 580. 1909. Fusarium palczewskii Jacz., Bull. Soc. Mycol. France 28: 345. 1912. Fusarium pseudoheterosporum Jacz., Bull. Soc. Mycol. France 28: 347. 1912. Fusarium metachroum Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: 141. 1913. Fusarium subulatum Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: 131. 1913. Fusarium biforme Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 166. 1915. Fusarium lucidum Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 157. 1915. Fusarium metachroum var. minus Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 145. 1915. Fusarium subulatum var. brevius Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 149. 1915. Fusarium truncatum Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 155. 1915. Fusarium avenaceum var. pallens Wollenw., Fusaria. Autogr. Delin. 2: 575. 1924. Fusarium venerorum Dounin & Goldmacher. Actes du premier Congres Internat. des Sylvicult.: 284–298. 1927. Fusarium herbarum var. volutum Wollenw., Fusaria Autogr. Delin. 3: 893. 1930. Fusarium avenaceum var. volutum (Wollenw.) Wollenw. & Reinking, Fusarien: 56. 1935. Fusarium avenaceum subsp. volutum (Wollenw.) Raillo, Fungi of the Genus Fusarium: 188. 1950. Fusarium avenaceum var. fabae T.F. Yu, Phytopathology 34: 392. 1944. Fusarium avenaceum f. fabae (T.F. Yu) W. Yamam., Sci. Rep. Hyogo Univ. Agric., Ser. Agr. Biol. 2: 60. 1955. Gibberella avenacea R.J. Cook, Phytopathology 57: 735. 1967. Fusarium avenaceum f. fabalis X.Y. Ruan et al., Acta Phytopathol. Sin. 12: 32. 1982, nom. inval., Art. 39.1. Fusarium avenaceum f. fabarum X.Y. Ruan et al., Acta Phytopathol. Sin. 12: 32. 1982, nom. inval., Art. 39.1. Neotypus (hic designatus, MBT 10000659): Denmark, Hordeum vulgare, 3 Feb. 1986, U. Thrane, CBS 408.86 (preserved as metabolically inactive culture). Ex-neotype culture: CBS 408.86 = FRC R-8510 = IMI 309354 = NRRL 26850 = NRRL 26911. Descriptions and illustrations: See Wollenweber & Reinking (1935), Booth (1971), Gerlach & Nirenberg (1982), Nelson et al. (1983) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: MG282372; rpb2: MG282401; tef1: MW928836. Notes: No type material could be located for this species. Therefore, to provide taxonomic stability to this important cereal-associated Fusarium species, CBS 408.86 is designated here as exneotype of Fusisporium avenaceum (= Fusarium avenaceum). awaxy Fusarium Petters-Vandresen et al., Persoonia 43: 363. 2019. Holotypus: UPCB93138-H. Ex-type culture: CMRP 4013 = LGMF1930. FUSARIUM Type locality: Brazil, Paran
a, Guarapuava. Type substrate: Rotten stalks of Zea mays. Descriptions and illustrations: See Crous et al. (2019b). Diagnostic DNA barcodes: rpb2: MK766941; tef1: MG839004. aywerte Fusarium (Sangal. & L.W. Burgess) Benyon & L.W. Burgess, Mycol. Res. 104: 1171. 2000. Basionym: Fusarium avenaceum subsp. aywerte Sangal. & L.W. Burgess, Mycol. Res. 99: 287. 1995. Holotypus: DAR 69501. Ex-type culture: F10108 = NRRL 25410. Type locality: Australia, Northern Territory, Deep Well. Type substrate: Soil. Descriptions and illustrations: See Sangalang et al. (1995), Benyon et al. (2000) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: JX171513; rpb2: JX171626; tef1: JABCQV010000336. azedarachinum Fusarium (Thüm.) Sacc., Syll. Fung. 4: 704. 1886. Basionym: Fusisporium azedarachinum Thüm., Mycoth. Univ. 14: no. 1379. 1879. (See Fusarium lateritium) Syntypes: In BPI, CUP, ILL, NEB, NY, NYS PH & PUL (Mycotheca Universalis no. 1379). Type locality: USA, South Carolina, Aiken. Type substrate: Melia azedarach. Note: Synonym fide Wollenweber & Reinking (1935). azukiicola Fusarium T. Aoki et al. (as ‘azukicola’), Mycologia 104: 1075. 2012. Neocosmospora phaseoli (Burkh.) L. Lombard & Crous, Stud. Mycol. 80: 227. 2015. Basionym: Fusarium martii f. phaseoli Burkh., Mem. Cornell Univ. Agric. Exp. Sta. 26: 1007. 1919. Synonyms: Fusarium solani f. phaseoli (Burkh.) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 28: 740. 1941. Fusarium phaseoli (Burkh.) T. Aoki & O'Donnell, Mycologia 95: 671. 2003. ?Fusarium epimyces Cooke, Grevillea 17: 15. 1888. ?Fusarium pestis Sorauer, Atlas Pfl.-Krankh. 4: 19, pl. XXV. 1890. ?Fusarium martii var. viride Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 247. 1915. Fusarium solani var. martii Appel & Wollenw. f. 3 Snyder, Centralbl. Bakteriol. Parasitenk., 2. Abth. 91: 179. 1934. Fusarium solani f. sp. glycines K. Roy, Pl. Dis. 81: 264. 1997. Fusarium tucumaniae T. Aoki et al., Mycologia 95: 664. 2003. Neocosmospora tucumaniae (T. Aoki et al.) L. Lombard & Crous, Stud. Mycol. 80: 228. 2015. Fusarium virguliforme O'Donnell & T. Aoki, Mycologia 95: 667. 2003. Neocosmospora virguliformis (O'Donnell & T. Aoki) L. Lombard & Crous, Stud. Mycol. 80: 228. 2015. Fusarium brasiliense T. Aoki & O'Donnell, Mycoscience 46: 166. 2005. Fusarium cuneirostrum O'Donnell & T. Aoki, Mycoscience 46: 170. 2005. Fusarium crassistipitatum Scandiani et al., Mycoscience 53: 171. 2011. Holotypus: BPI 881712. Ex-type culture: MAFF 242371 = NRRL 54364. Type locality: Japan, Hokkaido, Tokachi, Urahoro. Type substrate: Roots of Vigna angularis. Descriptions and illustrations: See Aoki et al. (2012b). www.studiesinmycology.org REDELIMITED Diagnostic DNA barcodes: rpb1: KJ511276; rpb2: KJ511287; tef1: JQ670137. babinda Fusarium Summerell et al., Mycol. Res. 99: 1345. 1995. Holotypus: DAR 70287. Ex-type culture: BBA 69872 = F11217 = NRRL 25807. Type locality: Australia, Queensland, Mount Lewis. Type substrate: Plant material in soil. Descriptions and illustrations: See Summerell et al. (1995) and Leslie & Summerell (2006). Diagnostic DNA barcode: rpb2: MN534245; tef1: AF160305. Note: The Fusarium babinda species complex encompassed strains incorrectly assigned to this taxon, based on reference strains of F. babinda, plus one unnamed Fusarium species (O'Donnell et al. 2013, Jacobs-Venter et al. 2019, Geiser et al. 2021). However, DNA sequences from diverse gene regions and phylogenetic analyses made by several authors place the ex-type of F. babinda (NRRL 25807) within the Fusarium fujikuroi species complex, as confirmed here (Fig. 8) (O'Donnell et al. 2000b, Lima et al. 2012, Herron et al. 2015, Crous et al. 2019b). Hence, the species in FBSC need to be reassessed and the species complex renamed accordingly. baccharidicola Fusarium Henn., Hedwigia 48: 20. 1908. (See Fusarium coccophilum) Syntype: Puttemans no. 1274 in B (syntype fide Hein (1988). Type locality: Brazil, S~ao Paulo, Pirutuba. Type substrate: Baccharis dracunculifolia in association with cochineal (Dactylopius coccus) Note: Synonym fide Wollenweber & Reinking (1935). bacilligerum Fusarium (Berk. & Broome) Sacc., Syll. Fung. 4: 711. 1886. Pseudocercospora bacilligera (Berk. & Broome) Y.L. Guo & X.J. Liu, Mycosystema 2: 229. 1989. Basionym: Fusisporium bacilligerum Berk. & Broome, Ann. Mag. Nat. Hist., ser. 2, 7: 178. 1851. Synonyms: Cercospora bacilligera (Berk. & Broome) Wollenw., Fusaria Autogr. Delin. 1: 450. 1916. Fusisporium erubescens Durieu & Mont., Exploration scientifique de l'Alg
erie 1–9: 351.1848. Fusarium erubescens (Durieu & Mont.) Sacc., Syll. Fung. 4: 719. 1886, nom. illegit., Art. 53.1. Holotypus: ?K(M). Type locality: UK, Wiltshire, Spye Park. Type substrate: Leaves of Rhamnus alaternus. Note: Synonyms fide Wollenweber & Reinking (1935). bactridioides Fusarium Wollenw., Science, N.Y. 79: 572. 1934. Lectotypus: NY00936830, designated in Seifert & Gr€afenhan (2012). Ex-type culture: BBA 4748 = BBA 63602 = CBS 100057 = CBS 177.35 = DAOM 225115 = IMI 375323 = NRRL 22201. Type locality: USA, Arizona, Chiricahua Mountains. Type substrate: Parasitic on Cronartium conigenum growing on a mummified cone of Pinus leiophylla. Descriptions and illustrations: See Wollenweber (1934), Gerlach & Nirenberg (1982) and Seifert & Gr€afenhan (2012). Diagnostic DNA barcodes: rpb1: MT010939; rpb2: MT010963; tef1: KC514053. bagnisianum Fusarium Thüm., Nuovo Giorn. Bot. Ital. 8: 252. 1876. Ascochyta caricis Fuckel, Fungi Rhen. Suppl. Fasc. 2: no. 1697. 1866. 89 CROUS ET AL. Synonyms: Phyllosticta caricis (Fuckel) Sacc., Syll. Fung. 3: 61. 1884. Ascochyta caricis Lambotte & Fautrey, Rev. Mycol. (Toulouse) 19: 141. 1897, nom. illegit., Art. 53.1. Syntypes: In BPI, ILL, NEB, NY, PUL & S. Type locality: Italy, Rome, Insugherata. Type substrate: Spartium junceum. Note: Synonym fide Wollenweber & Reinking (1935). bambusae Fusarium (Teng) Z.Q. Zeng & W.Y. Zhuang, Mycosystema 36: 279. 2017. Basionym: Lisea australis var. bambusae Teng, Sinensia 4: 278. 1934. Synonym: Gibberella bambusae (Teng) W.Y. Zhuang & X.M. Zhang, Nova Hedwigia 76: 195. 2003. Holotypus: BPI 631179. Type locality: China, Anhui, Huang-shan. Type substrate: Bambusoideae culm. Descriptions and illustrations: See Zhang & Zhuang (2003) and Zeng & Zhuang (2017a). bambusicola Fusarium Hara, Bot. Mag. (Tokyo) 27: 255. 1913. Holotypus: Not located. Type locality: Japan, Tokyo. Type substrate: Phyllostachys reticulata. Note: Type material (specimen(s) and/or living ex-type culture) not located. baptisiae Fusarium Henn., Notizbl. Bot. Gart. Berlin 2: 383. 1899. (See Fusarium dimerum) Holotypus: In B fide Hein (1988). Type locality: Germany, Berlin, Botanical Garden. Type substrate: Baptisia tinctoria. Note: Synonym fide Wollenweber & Reinking (1935). barbatum Fusarium Ellis & Everh., J. Mycol. 4: 45. 1888. Raffaelea barbata (Ellis & Everh.) D. Hawksw. (as ‘barbatum'’), Bull. Brit. Mus. (Nat. Hist.), Bot. 6: 272. 1979. Holotypus: NY00928690. Type locality: USA, New Jersey, Newfield. Type substrate: Usnea barbata. bartholomaei Fusarium Peck, Bull. Torrey Bot. Club 36: 157. 1909. Septogloeum bartholomaei (Peck) Wollenw., Fusaria Autogr. Delin. 2: 638. 1924. Synonym: Trichofusarium bartholomaei (Peck) Sacc., Syll. Fung. 22: 1473. 1913. Holotypus: NYS-F-000437. Type locality: USA, Kansas, Stockton. Type substrate: Sorghastrum nutans. Note: Synonym fide Wollenweber & Reinking (1935). batatas Fusarium Wollenw. (as ‘batatae’), J. Agric. Res. 2: 268. 1914. (See Fusarium oxysporum) Lectotypus (hic designatus, MBT 10000660): USA, Washington, Ipomoea batatas, 1914, L.L. Harter & E.C. Field, in Wollenweber, J. Agric. Res. 2: 268, pl. XVI, figs A–E. Notes: Synonym fide Wollenweber & Reinking (1935). As no holotype specimen could be located, an illustration accompanying the original protologue is designated here as lectotype. bataticola Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 1. 2020. 90 Neocosmospora bataticola Sand.-Den. & Crous, Persoonia 43: 112. 2019. Synonym: ?Fusarium solani f. batatas T.T. McClure, Phytopathology 41: 75. 1951, nom. inval., Art. 39.1. Holotypus: CBS H-23971. Ex-type culture: BBA 64954 = CBS 144398 = FRC S0567 = NRRL 22402. Type locality: USA, North Carolina. Type substrate: Ipomoea batatas. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW218100; rpb2: FJ240381; tef1: AF178344. begoniae Fusarium Nirenberg & O'Donnell, Mycologia 90: 437. 1998. Holotypus: B 70 0001694. Ex-type culture: BBA 67781 = CBS 403.97 = IMI 375315 = NRRL 25300. Type locality: Germany. Type substrate: Begonia elatior. Descriptions and illustrations: See Nirenberg & O'Donnell (1998) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: JAAOAG010000375; rpb2: MN193886; tef1: AF160293. beomiforme Fusarium P.E. Nelson et al., Mycologia 79: 886. 1987. Holotypus: DAOM 196987. Ex-type culture: CBS 100160 = DAR 58880 = FRC M-1425 = IMI 316127 = MRC 4593 = NRRL 13606. Type locality: Australia, Queensland, Rockhampton. Type substrate: Soil. Descriptions and illustrations: See Nelson et al. (1987) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: MF120485; rpb2: MF120496; tef1: MF120507. berenice Fusarium (Berk. & M.A. Curtis) Sacc., Syll. Fung. 4: 721. 1886. Ascocalyx berenice (Berk. & M.A. Curtis) Baschien, IMA Fungus 5: 93. 2014. Basionym: Fusisporium berenice Berk. & M.A. Curtis, in Berkeley, Grevillea 3: 147. 1875. Synonyms: Bothrodiscus berenice (Berk. & M.A. Curtis) J.W. Groves, Canad. J. Bot. 46: 1273. 1968. Holotypus: ?K(M). Type locality: USA, Massachusetts, Boston, Murray. Type substrate: Peziza sp. berkeleyi Fusarium (Mont.) Berk. & Broome, North Amer. Fung.: 108. 1875. Basionym: Gloeosporium berkeleyi Mont., Ann. Sci. Nat., Bot., s
er. 3, 12: 296. 1849. (See Fusarium lateritium) Holotypus: Not located. Type locality: USA, Alabama. Type substrate: Leaves of Hibiscus syriacus. Note: Synonym fide Wollenweber & Reinking (1935). betae Fusarium (Desm.) Sacc., Michelia 2: 132. 1880. Fusicolla betae (Desm.) Bonord., Handb. Mykol.: 150. 1851. Basionym: Fusisporium betae Desm., Ann. Sci. Nat., Bot., S
er. 1, 19: 436. 1830. FUSARIUM Synonyms: Pionnotes betae (Desm.) Sacc., Syll. Fung. 4: 726. 1886. Pionnotes rhizophila var. betae (Desm.) De Wild. & Durieu, Prodr. Fl. Belg. 2: 367. 1898. Lectotypus: K(M) 167520, designated in Gr€afenhan et al. 2011. Lectotype locality: France. Lectotype substrate: Tuber of Beta vulgaris. Epitypus: BBA 64317, designated in Gr€afenhan et al. 2011. Ex-epitype culture: BBA 64317. Epitype locality: Germany, Schleswig-Holstein, Kiel. Epitype substrate: Triticum aestivum. Descriptions and illustrations: See Gr€afenhan et al. (2011). Diagnostic DNA barcodes: rpb2: HQ897781. beticola Fusarium A.B. Frank, Kampfbuch gegen die Sch€adlinge unserer Feldfrüchte: 137. 1897. (See Fusarium oxysporum) Holotypus: ?NY. Type locality: Germany. Type substrate: Beta sp. Note: Synonym fide Wollenweber & Reinking (1935). biasolettianum Fusarium Corda, Icon. Fung. 2: 3. 1838. (See Fusarium merismoides) Typus: PRM 155487. Type locality: Czech Republic, near Prague. Type substrate: Young stalks of Betula sp. Notes: Synonym fide Wollenweber & Reinking (1935). Synonymy under Fusicolla merismoides still questionable (See Gr€afenhan et al. 2011). Lectotypification pending study of material lodged in PRM. bicellulare Fusarium Kirschst., Hedwigia 80: 136. 1941. (See Fusarium aquaeductuum) Holotypus: B 70 0100184. Type locality: Germany. Type substrate: Parasitic on Cryptosporella hypodermia with Nectria episphaeria. Note: Synonym fide Wollenweber & Reinking (1935). biforme Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 166. 1915. (See Fusarium avenaceum) Lectotypus (hic designatus, MBT 10000661): USA, Wisconsin, rotten tubers of Solanum tuberosum, date unknown, C.D. Sherbakoff, in Mem. Cornell Univ. Agric. Exp. Sta. 6: 166, fig. 17 (1915). Notes: Synonym fide Wollenweber & Reinking (1935). As no holotype specimen could be located, an illustration accompanying the original protologue is designated here as lectotype. bipunctatum Fusarium Preuss, Linnaea 25: 741. 1852. (See Fusarium tortuosum) Holotypus: ?B. Type locality: Germany. Type substrate: Branches of unknown tree. Note: Synonym fide Wollenweber & Reinking (1935). biseptatum Fusarium Sawada, Special Publ. Coll. Agric. Natl. Taiwan Univ. 8: 228. 1959, nom. inval., Art. 39.1. Authentic material: Not located. Original locality: Taiwan. Original substrate: Leaves of Stephania cepharantha. www.studiesinmycology.org REDELIMITED biseptatum Fusarium Schroers et al., Mycologia 101: 59. 2009. (non Fusarium biseptatum Sawada 1959). Bisifusarium biseptatum (Schroers et al.) L. Lombard & Crous, Stud. Mycol. 80: 224. 2015. Holotypus: CBS H-20126. Ex-type culture: CBS 110311 = FRC E-0228 = NRRL 36184. Type locality: South Africa, Transkei. Type substrate: Soil. Descriptions and illustrations: See Schroers et al. (2009). Diagnostic DNA barcode: tef1: EU926319. blackmannii Fusarium W. Br. & A.S. Horne (as ‘blackmanni'’), Ann. Bot. (London) 38: 379. 1924. (See Fusarium lateritium) Notes: Name withdrawn by original author (W. Brown), See Brown (1928). Synonym fide Wollenweber & Reinking (1935). blasticola Fusarium Rostr. (as ‘blasticolum’), Gartn.-Tidende 1895: 122. 1895. (See Fusarium oxysporum) Holotypus: Not located. Type locality: Germany. Type substrate: Pinus sylvestris. Note: Synonym fide Wollenweber & Reinking (1935). bomiense Fusarium (Z.Q. Zeng & W.Y. Zhuang) O'Donnell et al., Index Fungorum 440: 1. 2020. Neocosmospora bomiensis Z.Q. Zeng & W.Y. Zhuang, Phytotaxa 319: 177. 2017. Holotypus: HMAS 254519. Ex-type culture: HMAS 248885. Type locality: China, Tibet Autonomous Region, Bom^e County. Type substrate: Twigs. Descriptions and illustrations: See Zeng & Zhuang (2017b). Diagnostic DNA barcode: tef1: KY829449. bonordenii Fusarium Sacc., Syll. Fung. 4: 699. 1886. Replaced synonym: Selenosporium aurantiacum Bonord., Abh. Naturf. Ges. Halle 8: 97. 1864, nom. illegit., Art. 53.1, non Fusarium aurantiacum Corda 1829. (See Fusarium dimerum) Holotypus: Not preserved fide Holubov
a-Jechov
a et al. (1994). Type locality: Germany. Type substrate: Branches of unknown tree. Note: Synonym fide Wollenweber & Reinking (1935). boothii Fusarium O'Donnell et al., Fungal Genet. Biol. 41: 618. 2004. Holotypus: BPI 843475. Ex-type culture: CBS 316.73 = IMI 160243 = NRRL 26916. Type locality: South Africa. Type substrate: Zea mays. Descriptions and illustrations: See O'Donnell et al. (2004). Diagnostic DNA barcodes: rpb1: KM361641; rpb2: KM361659; tef1: GQ915503. borneense Fusarium (Petr.) O'Donnell et al., Index Fungorum 440: 1. 2020. Neocosmospora borneensis (Petr.) Sand.-Den. & Crous, Persoonia 43: 115. 2019. Basionym: Nectria borneensis Petr., Sydowia 8: 20. 1954. Holotypus: K(M) 252860. Epitypus: CBS H-23972, designated in Sandoval-Denis et al. (2019). 91 CROUS ET AL. Ex-epitype culture: BBA 65095 = CBS 145462 = G.J.S. 85197 = NRRL 22579. Epitype locality: Indonesia, North Sulawesi, Bogani Nani Wartabone National Park. Epitype substrate: Bark of a recently dead unidentified tree. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834213; rpb2: FJ240381; tef1: AF178344. bostrycoides Fusarium Wollenw. & Reinking, Phytopathology 15: 166. 1925. Neocosmospora bostrycoides (Wollenw. & Reinking) Sand.Den. et al., Persoonia 43: 115. 2019. Neotypus: CBS H-23973, designated in Sandoval-Denis et al. (2019). Ex-neotype culture: CBS 144.25. Neotype locality: Honduras, Tela. Neotype substrate: Soil. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW218101; rpb2: LR583818; tef1: LR583597. brachiariae Fusarium M.M. Costa et al., Mycol. Progr. 20: 67. 2021. Holotypus: UB 24188. Ex-type culture: CML 3032. Type locality: Brazil, Mato Grosso do Sul, Campo Grande. Type substrate: Seed of Brachiaria decumbens. Descriptions and illustrations: See Costa et al. (2021). Diagnostic DNA barcodes: rpb2: MT901314; tef1: MT901348. brachygibbosum Fusarium Padwick, Mycol. Pap. 12: 11. 1945. Holotypus: IMI 268019. Ex-type culture: BBA 64691 = NRRL 20954. Type locality: India, Telangana, Hyderabad, Parbhani. Type substrate: Sorghum vulgare. Descriptions and illustrations: See Padwick (1945). Diagnostic DNA barcodes: rpb1: MW233246; rpb2: MW233418; tef1: MW233075. brasilicum Fusarium T. Aoki et al., Fungal Genet. Biol. 41: 620. 2004. Holotypus: BPI 843480. Ex-type culture: CBS 119180 = NRRL 31281. Type locality: Brazil. Type substrate: Avena sativa. Descriptions and illustrations: See O'Donnell et al. (2004). Diagnostic DNA barcodes: rpb1: JABCJS010000032; rpb2: JABCJS010000357; tef1: AY452964. brasiliense Fusarium T. Aoki & O'Donnell, Mycoscience 46: 166. 2005. (See Fusarium azukiicola) Holotypus: BPI 843352. Ex-type culture: MAFF 239050 = NRRL 31757. Type locality: Brazil, Districto Federal, Brasilia. Type substrate: Glycines max. Descriptions and illustrations: See Aoki et al. (2005). Diagnostic DNA barcodes: rpb1: MAEC01003448; rpb2: EU329565; tef1: MAEC01004196. brassicae Fusarium Lib. ex Cooke, Grevillea 8: 83. 1880. (See Fusarium candidum Ehrenb.) Holotypus: In B, Libert s.n. fide Index Fungorum. 92 Type locality: France. Type substrate: Stem of Brassica oleracea. Note: Synonym fide Wollenweber & Reinking (1935). brassicae Fusarium (Thüm.) Sacc., Syll. Fung. 4: 701. 1886, nom. illegit., Art. 53.1. Basionym: Selenosporium brassicae Thüm., Hedwigia 19: 191. 1880. (See Fusarium avenaceum) Holotypus: Not located. Type locality: Belgium. Type substrate: Stem of Brassica oleracea. Note: Synonym fide Wollenweber & Reinking (1935). breve Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 1. 2020. Neocosmospora brevis Sand.-Den. & Crous, Persoonia 43: 119. 2019. Holotypus: CBS H-23975. Ex-type culture: CBS 144387 = MUCL 16108. Type locality: Belgium, Heverlee. Type substrate: Soil-water polluted with diethylene glycerol and ethylene glycerol. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834214; rpb2: LR583822; tef1: LR583601. brevicatenulatum Fusarium Nirenberg et al., Mycologia 90: 460. 1998. Holotypus: Specimen in B fide Nirenberg et al. (1998). Ex-type culture: BBA 69197 = CBS 404.97 = DAOM 225122= IMI 375329 = NRRL 25446. Type locality: Madagascar. Type substrate: Striga asiatica. Descriptions and illustrations: See Nirenberg et al. (1998) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: MT010948; rpb2: MT010979; tef1: MT011005. brevicaudatum Fusarium J.W. Xia et al., Persoonia 43: 195. 2019. Holotypus: CBS H-24051. Ex-type culture: NRRL 43638 = UTHSC R-3500. Type locality: USA, Florida. Type substrate: Trichechus sp. (manatee). Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb1: KC808322; rpb2: GQ505843; tef1: GQ505665. breviconum Fusarium (Wollenw.) O'Donnell et al., Index Fungorum 440: 1. 2020. Neocosmospora brevicona (Wollenw.) Sand.-Den. & Crous, Persoonia 43: 117. 2019. Basionym: Hypomyces haematococcus var. breviconus Wollenw., Fusaria Autogr. Delin. 3: no. 828 (1930). Synonyms: Fusarium solani var. minus Wollenw., Fusarien: 134. 1935. Nectria haematococca var. brevicona (Wollenw.) Gerlach, Fusarium: Diseases, Biology, and Taxonomy (Philadelphia): 422. 1981. Lectotypus: Fig. 828 in Wollenweber (1930), designated in Sandoval-Denis et al. (2019). Epitypus: CBS H-23974 designated in Sandoval-Denis et al. (2019). FUSARIUM Ex-epitype culture: BBA 2123 = CBS 204.31 = NRRL 22659. Epitype locality: Indonesia, West Java, Bogor. Epitype substrate: Gladiolus sp. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW218103; rpb2: LR583821; tef1: LR583600. briosianum Fusarium Ferraris, Fl. Ital. Crypt. Hyphales, Fasc. 13: 857. 1914. (See Fusarium lateritium) Holotypus: Not located. Type locality: Italy, Pavia. Type substrate: Branches of Styphnolobium japonicum (syn. Sophora japonica). Note: Synonym fide Wollenweber & Reinking (1935). bubalinum Fusarium J.W. Xia et al., Persoonia 43: 195. 2019 Holotypus: CBS H-24052. Ex-type culture: CBS 161.25 = NRRL 26857 = NRRL 26918. Type locality: Australia. Type substrate: Unknown. Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb2: MN170381; tef1: MN170448. bufonicola Fusarium (Speg.) Sacc. & Trotter, Syll. Fung. 22: 1486. 1913. (See Fusarium graminearum) Basionym: Selenosporium bufonicola Speg., Anales Mus. Nac. Buenos Aires, ser. 3, 13: 458. 1910. Holotypus: In LPS (Myc. Argent. ser. 5, no. 1166) fide Farr (1973). Type locality: Argentina, Buenos Aires. Type substrate: Decaying body of Amphibia (toad). Note: Synonym fide Wollenweber & Reinking (1935). bugnicourtii Fusarium Brayford, Trans. Brit. Mycol. Soc. 89: 350. 1987. (See Fusarium ambrosium) Synonym: Fusarium tumidum var. coeruleum Bugnic., Encycl. Mycol. 11: 83. 1939. Holotypus: IMI 296597. Ex-type culture: IMI 296597 = NRRL 20438 = MAFF 246291. Type locality: India, Chinchona. Type substrate: Euwallacea fornicatus on Camellia sinensis. Descriptions and illustrations: See Brayford (1987). Diagnostic DNA barcodes: rpb1: JX171470; rpb2: JX171584; tef1: AF178332. buharicum Fusarium Jacz. ex Babajan & Teterevn.-Babajan, Mater. Mikol. Fitopatol. 8: 216. 1929. Holotypus: LEP 127667. Epitypus (hic designatus, MBT 10000662): Uzbekistan, Tashkent, on Gossypium herbaceum, 1928, A.I. Raillo, CBS 178.35 (preserved as metabolically inactive culture). Ex-epitype culture: CBS 178.35 = DSM 62166 = NRRL 25488. Descriptions and illustrations: See Gerlach & Nirenberg (1982). Diagnostic DNA barcodes: rpb1: KX302920; rpb2: KX302928; tef1: KX302912. Notes: Gerlach & Nirenberg (1982) designated CBS 178.35 as neotype of F. buharicum as they were unable to locate the type specimen. However, A. Jaczweski did place a specimen in LEP. Therefore, the neotype designation is superseded here (Art. 9.13) and CBS 178.35 is retained as epitype for this species. www.studiesinmycology.org REDELIMITED bulbicola Fusarium Nirenberg & O'Donnell, Mycologia 90: 452. 1998. Replaced synonym: Fusarium sacchari var. elongatum Nirenberg, Mitt. Biol. Bundesanst. Land- Forstw. Berlin-Dahlem 169: 59. 1976, non Fusarium elongatum Reinking 1934. Holotypus: IMI 202877. Ex-type culture: BBA 63628 = CBS 220.76 = DAOM 225114 = IMI 375322 = NRRL 13618. Type locality: Germany. Type substrate: Haemanthus sp. Descriptions and illustrations: See Nirenberg (1976), Nirenberg & O'Donnell (1998) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: KF466394; rpb2: KF466404; tef1: AF160294. bulbigenum Fusarium Cooke & Massee, Grevillea 16: 49. 1887. (See Fusarium oxysporum) Holotypus: ?K(M). Type locality: UK. Type substrate: Narcissus sp. Note: Synonym fide Wollenweber & Reinking (1935). bullatum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 198. 1915. (See Fusarium equiseti) Typus: CUP-007455. Type locality: USA, Iowa. Type substrate: Rotten tuber of Solanum tuberosum. Lectotypification pending study of material lodged in CUP. burgessii Fusarium M.H. Laurence et al., Fungal Diversity 49: 109. 2011. Holotypus: CBS 125537 (preserved as metabolically inactive culture). Ex-type culture: CBS 125537 = NRRL 66654 = RBG 5315. Type locality: Australia, Queensland, Idalia National Park. Type substrate: Soil. Descriptions and illustrations: See Laurence et al. (2011). Diagnostic DNA barcodes: rpb1: MT409440; rpb2: HQ646393; tef1: HQ667148. butleri Fusarium Wollenw., Phytopathology 3: 38. 1913, nom. illegit., Art. 52.1. (See Fusarium udum) Authentic material: ?B. Original locality: India. Original substrate: Cajanus cajan. Note: Synonym fide Wollenweber & Reinking (1935). butleri Fusarium Kr.P. Singh & Edward, Allahabad Farmer 49: 94. 1979, nom. illegit., Art. 53.1, non Fusarium butleri Wollenw. 1913. Synonym: Gibberella butleri Kr.P. Singh & Edward, Allahabad Farmer 49: 92. 1979. Authentic material: Not located. Original locality: India. Original substrate: Cajanus cajan. Notes: Status unclear. No further records available for this taxon. buxi Fusarium Spreng., Syst. Veg., ed. 16, 4: 565. 1827. Pseudonectria buxi (DC.) Seifert et al., Stud. Mycol. 68: 107. 2011. Basionym: Tubercularia buxi DC., Fl. Franç., ed. 3, 5/6: 110. 1815. Synonyms: Fusisporium buxi (DC.) Fr., Syst. Mycol. 3: 447. 1832, nom. sanct. [Fr., l.c.] 93 CROUS ET AL. Psilonia buxi (DC.) Fr., Syst. Mycol. 3: 447. 1832, nom. inval., Art. 36.1(c). Chaetostroma buxi (DC.) Corda, Icon. Fung. 2: 31. 1838. Volutella buxi (DC.) Berk. & Broome, Ann. Mag. Nat. Hist., ser. 2, 5: 465. 1850. Chaetodochium buxi (DC.) Höhn., Mitt. Bot. Inst. T. H. Wien 9: 45. 1932. Nectria rousseliana Mont., Ann. Sci. Nat., Bot., s
er. 3, 16: 44. 1851. Stigmatea rousseliana (Mont.) Fuckel, Jahrb. Nassauischen Vereins Naturk. 23–24: 97. 1870. Nectriella rousseliana (Mont.) Sacc., Syll. Fung. 2: 452. 1883. Lasionectria rousseliana (Mont.) Cooke (as ‘rousselliana’), Grevillea 12: 111. 1884. Pseudonectria rousseliana (Mont.) Wollenw., Z. Parasitenk. (Berlin) 3: 489. 1931. Notarisiella rousseliana (Mont.) Clem. & Shear, The genera of Fungi: 280. 1931. Nectria rousseliana var. viridis Berk. & Broome, Ann. Mag. Nat. Hist., ser. 3, 3: 376. 1859. Volutella buxi f. rusci Sacc., Michelia 2: 644. 1882. Holotypus: ?PC. Type locality: ?Germany/France. Type substrate: Leaf of Buxus sp. buxicola Fusarium Sacc., Syll. Fung. 2: 518. 1883. Cyanonectria buxi (Fuckel) Schroers et al., Stud. Mycol. 68: 120. 2011. Basionym: Gibbera buxi Fuckel, Jahrb. Nassauischen Vereins Naturk. 27–28: 32. 1874. Synonyms: Lisea buxi (Fuckel) Sacc., Syll. Fung. 2: 518. 1883. Gibberella buxi (Fuckel) Cooke, Grevillea 12: 112. 1884. Fusarium subcorticale Oudem., Ned. Kruidk. Arch., s
er. 3, 3: 135. 1898. Fusarium dimorphum J.V. Almeida & Sousa da C^amara, Revista Agron. (Lisbon) 1: 306. 1903. Fusarium buxicola var. chlamydosporum Batikyan (as ‘chlamydosporeae’), Biol. Zhurn. Armenii 22: 90. 1969. Fusarium lateritium var. buxi C. Booth, The Genus Fusarium: 113. 1971. Lectotypus: G 00111019, selected in Schroers et al. (2011). Epitypus: CBS H-20379, designated in Schroers et al. (2011). Ex-epitype culture: CBS 125551. Epitype locality: Slovenia, Arboretum Volcji Potok. Epitype substrate: Decaying twig of Buxus sempervirens var. elegantissima. Descriptions and illustrations: See Schroers et al. (2011). Diagnostic DNA barcodes: rpb2: HM626689; tef1: HM626648. Holotypus: UB 24189. Ex-type culture: CML 3657. Type locality: Brazil, S~ao Paulo, Guaíra. Type substrate: Brachiaria brizantha. Descriptions and illustrations: See Costa et al. (2021). Diagnostic DNA barcodes: rpb2: MT901316; tef1: MT901350. caatingaense Fusarium A.C.S. Santos et al., Mycologia 111: 248. 2019. Holotypus: URM 91192. Ex-type culture: MUM 1859 = URM 6779. Type locality: Brazil, Pernambuco, Ibimirim. Type substrate: Dactylopius opuntiae. Descriptions and illustrations: See Santos et al. (2019). Diagnostic DNA barcodes: rpb2: LS398495; tef1: LS398466. cactacearum Fusarium Pasin. & Buzz.-Trav., Nuovo Giorn. Bot. Ital. 42: 120. 1935. Lectotypus (hic designatus, MBT 10000663): Italy, Milan, Thelocactus nidulans, 1935, L. Pasinetti & A. Buzzati-Traverso, in Nuovo Giorn. Bot. Ital. 42: Pl. I, fig. 1. Descriptions and illustrations: See Pasinetti & Buzzati-Traverso (1935). Notes: Based on illustrations by Pasinetti & Buzzati-Traverso (1935), this species could be a synonym of Neocosmospora solani but requires further investigation. No holotype specimen could be located and therefore an illustration is designated as lectotype. cacti-maxonii Fusarium Pasin. & Buzz.-Trav., Nuovo Giorn. Bot. Ital. 42: 120. 1935. Lectotypus (hic designatus, MBT 10000664): Italy, Milan, Cactus maxonii, 1935, L. Pasinetti & A. Buzzati-Traverso, in Nuovo Giorn. Bot. Ital. 42: Pl. I, fig. 4. Descriptions and illustrations: See Pasinetti & Buzzati-Traverso (1935). Notes: Based on illustrations by Pasinetti & Buzzati-Traverso (1935), this species could be a synonym of Fusarium oxysporum but requires further investigation. No holotype specimen could be located and therefore an illustration is designated as lectotype. byssinum Fusarium McAlpine, Proc. Linn. Soc. New South Wales 22: 698. 1897. Holotypus: VPRI 2556. Type locality: Australia, New South Wales, Murwillumbah. Type substrate: Desmodium sp. Notes: Status unclear. This species was considered a member of Diymopsis by Saccardo (1899); Hymenula by Wollenweber & Reinking (1935); and Aschersonia by Walker (1962), who examined the type specimen and found that the fungus occurred in association with a scale insect on Desmodium. It is likely that this species belongs in Microcera, which are usually parasites of scale insects. caeruleum Fusarium Lib. ex Sacc. (as ‘cæruleum’), Syll. Fung. 4: 705. 1886. Synonyms: Fusarium solani var. caeruleum (Lib. ex Sacc.) Bilaĭ, Fusarii (Biologija i sistematika): 287. 1955, nom. inval., Art. 41.5. Fusarium solani var. caeruleum (Lib. ex Sacc.) C. Booth, The Genus Fusarium: 51. 1971. ?Fusarium violaceum Fuckel, Fungi Rhen. Exs., Fasc. 3: no. 209. 1863. Fusarium aeruginosum Delacr., Bull. Soc. Mycol. France 7: 110. 1891. Selenosporium caeruleum Lib., 1834. (in herb.; nom. inval., Art. 38.1a). Fusarium caeruleum var. cellulosae Sartory et al., Papier 38: 43. 1935. ?Hypomyces asclepiadis Zerova, Zhurn. Inst. Bot. Vseukraïns'k. Akad. Nauk 11: 103. 1937. Holotypus: BR5020140171069. Type locality: Belgium. Type substrate: Solanum tuberosum. Notes: Status doubtful. See Sandoval-Denis et al. (2019). caapi Fusarium M.M. Costa et al., Mycol. Progr. 20: 67. 2021. calcareum Fusarium (Thüm.) Sacc., Syll. Fung. 4: 712. 1886. 94 FUSARIUM (See Fusarium oxysporum) Basionym: Fusisporium calcareum Thüm., Inst. Coimbra 28: 262. 1881. Holotypus: S-F45605. Type locality: Portugal, Coimbra. Type substrate: Lagenaria vulgaris. Note: Synonym fide Wollenweber & Reinking (1935). ?calidariorum Fusarium Sacc., Ann. Mycol. 4: 274. 1906. Colletotrichum anthurii Delacr., Bull. Soc. Mycol. France 13: 110. 1897. Synonyms: Fusoma calidariorum Sacc., Ann. Mycol. 4: 274. 1906. Fusoma calidariorum var. acanthi Lindegg, Riv. Patol. Veg. 25: 233. 1935. Holotypus: In PAD. Type locality: Italy, Padua, botanical garden. Type substrate: Anthurium scherzerianum. Notes: Synonym fide Wollenweber & Reinking (1935). No record could be located for the transfer of this epithet to the genus Fusarium. In Saccardo (1906) on p. 274, no new combination is provided and only the new name Fusoma calidariorum was introduced. Similarly, Lindegg (1935) introduced a new variety as Fusoma calidariorum var. acanthi, not in the genus Fusarium. Although Wollenweber & Reinking (1935) did treat this as Fusoma, Booth (1971) incorrectly treated the variety acanthi in the genus Fusarium. callistephi Fusarium L. Lombard & Crous, Persoonia 43: 15. 2018 [2019]. Holotypus: CBS H-23608. Ex-type culture: CBS 187.53 = NRRL 36330. Type locality: Netherlands, Oostenbrink. Type substrate: Callistephus chinensis. Descriptions and illustrations: See Lombard et al. (2019b). Diagnostic DNA barcodes: rpb2: MH484875; tef1: MH484966. callosporum Fusarium Pat., Bull. Soc. Mycol. France 9: 164. 1893. (See Fusarium coccophilum) Holotypus: Not located. Type locality: Ecuador, Quito. Type substrate: Parasitic on Septobasidium pedicellatum. Note: Synonym fide Wollenweber & Reinking (1935). camerunense Fusarium Henn., Bot. Jahrb. Syst. 22: 81. 1895. Gloeosporium camerunense (Henn.) Wollenw., Fusaria Autogr. Delin. 1: 499. 1916. Holotypus: In B fide Hein (1988). Type locality: Cameroon, Itoki. Type substrate: Bark of unknown tree. Note: Synonym fide Wollenweber & Reinking (1935). camptoceras Fusarium Wollenw. & Reinking, Phytopathology 15: 158. 1925. Neotypus: CBS H-24077, designated in Xia et al. (2019). Ex-neotype culture: ATCC 16065 = ATCC 24364 = BBA 9810 = CBS 193.65 = DSM 62167 = IMI 112500 = NRRL 20716 = NRRL 36344. Neotype locality: Costa Rica. Neotype substrate: Cushion gall of Theobroma cacao. Descriptions and illustrations: See Wollenweber & Reinking (1935), Booth (1971), Gerlach & Nirenberg (1982), Marasas et al. (1998) and Leslie & Summerell (2006). www.studiesinmycology.org REDELIMITED Diagnostic DNA barcodes: rpb1: MW928800; rpb2: MN170383; tef1: MN170450. campylopodii Fusarium Weir, Mycologia 60: 374. 1968, nom. inval., Art. 38.1(a). Authentic material: Not located. Original locality: USA, Washington. Original substrate: Arceuthobium sp. Note: The name is mentioned but neither a diagnosis nor a description was provided. candidulum Fusarium Sacc., Ann. Mycol. 6: 567. 1908. (See Fusarium oxysporum) Holotypus: Not located. Type locality: Mexico. Type substrate: Myrtillocactus geometrizans. Note: Synonym fide Wollenweber & Reinking (1935). candidum Fusarium Ehrenb., Sylv. Mycol. Berol.: 24. 1818. Neonectria candida (Ehrenb.) Rossman et al., Stud. Mycol. 80: 217. 2015. Synonyms: Ramularia candida (Ehrenb.) Wollenw., Phytopathology 1: 220. 1913. Cylindrocarpon ehrenbergii Wollenw., Fusaria Autogr. Delin. 1: 461. 1916. Sclerotium castaneum Lib., in herb. 1832, nom. nud. Fusarium castaneum Lindau (as “(Lib.) Lindau”), Rabenh. Krypt.Fl. 1(9): 556. 1909. ?Fusidium candidum Willk., Die mikroskopischen Feinde des Waldes 1: 103. 1866, nom. illegit., Art. 53.1. ?Fusarium candidum Sacc. & D. Sacc., Syll. Fung. 18: 674. 1906, nom. illegit., Art. 53.1. ?Fusarium candidum Dasz., Bull. Soc. Bot. Geneve, 2 s
er. 4: 293. 1913, nom. illegit., Art. 53.1. Fusarium brassicae Lib. ex Cooke, Grevillea 8: 83. 1880. Selenosporium brassicae Thüm., Hedwigia 19: 191. 1880. Fusarium brassicae (Thüm.) Sacc., Syll. Fung. 4: 701. 1886, nom. illegit., Art. 53.1. Fusarium obtusiusculum Sacc., Michelia 2: 297. 1881. Fusarium rhizogenum Pound & Clem., Bot. Surv. Nebraska 3: 12. 1894. Fusarium oxysporum var. obtusiusculum (Sacc.) Cif., Ann. Bot. (Rome) 16: 221. 1924. Cylindrocarpon obtusiusculum (Sacc.) U. Braun, Cryptog. Bot. 4: 113. 1993. Fusarium eichleri Bres., Ann. Mycol. 1: 130. 1903. Neonectria ramulariae Wollenw., Ann. Mycol. 15: 52. 1917. Nectria ramulariae (Wollenw.) E. Müll., Beitr. Kryptogamenfl. Schweiz 11: 634. 1962. Cylindrocarpon magnusianum Wollenw., Z. Parasitenk. (Berlin) 1: 172. 1928. Holotypus: Not located. Type locality: Germany, Berlin. Type substrate: Unknown. candidum Fusarium (Link) Sacc., Syll. Fung. 4: 720. 1886, nom. illegit., Art. 53.1. Neonectria ditissima (Tul. & C. Tul.) Samuels & Rossman, CBS Biodiversity Ser. 4: 134. 2006. Basionym: Nectria ditissima Tul. & C. Tul., Select. Fung. Carpol. 3: 73. 1865. Synonyms: Cucurbitaria ditissima (Tul. & C. Tul.) Kuntze, Revis. Gen. Pl. 3: 461. 1898. 95 CROUS ET AL. Fusidium candidum Link, Mag. Neuesten Entdeck. Gesammten Naturk. Ges. Naturf. Freunde Berlin 3: 8. 1809, nom. sanct. [Fr., Syst. Mycol. 3: 481. 1832]. Cylindrocarpon candidum (Link) Wollenw., Fusaria Autogr. Delin. 1: 476. 1916. ?Fusisporium cylindricum Mont., Ann. Sci. Nat., Bot., s
er. 2, 17: 120. 1842. ?Fusarium cylindricum (Mont.) Sacc., Syll. Fung. 4: 720. 1886. Fusarium fissum Peyl, Lotos 8: 30. 1858. ?Fusarium heteronemum Berk. & Broome (as ‘heteronema'’), Ann. Mag. Nat. Hist., Ser. 3, 15: 402. 1865. ?Cylindrocarpon heteronema (Berk. & Broome) Wollenw. (as ‘heteronemum’), Fusaria Autogr. Delin. 1: 460. 1916. ?Ramularia heteronema (Berk. & Broome) Wollenw. (as ‘heteronemum'’), Fusaria Autogr. Delin. 1: 460. 1916. Fusarium ulmi P. Crouan & H. Crouan, Fl. Finistere: 14. 1867. Fusarium fragrans P. Crouan & H. Crouan, Fl. Finistere: 14. 1867. Fusarium decipiens Cooke & Massee, in Cooke, Handb. Austral. Fungi: 388. 1892, nom. inval., Art. 39.1. Fusarium mali Allesch., Ber. Bot. Vereines Landshut 12: 130. 1892. Fusarium sarcochroum f. mali (Allesch.) Ferraris, 1910. Cylindrocarpon mali (Allesch.) Wollenw., Phytopathology 18: 225. 1928. Sporotrichum amenti P. Karst., Hedwigia 31: 296. 1892. Fusarium fractum Sacc. & Cavara, Nuovo Giorn. Bot. Ital., n.s. 7: 308. 1900. Cylindrocarpon fractum (Sacc. & Cavara) Wollenw., Fusaria Autogr. Delin. 2: 655. 1924. Nectria galligena Bres., in Strasser, Verh. K. K. Zool.-Bot. Ges. Wien 51: 413. 1901. Dialonectria galligena (Bres.) Petch ex E.W. Mason & Grainger, Cat. Yorkshire Fung.: 32. 1937. Neonectria galligena (Bres.) Rossman & Samuels, Stud. Mycol. 42: 159. 1999. Fusarium prunorum McAlpine, Fungus Diseases of stone-fruit trees in Australia: 91. 1902. Fusarium willkommii Lindau, Rabenh. Krypt.-Fl. ed. 2, 1(9): 551. 1909. Cylindrocarpon willkommii (Lindau) Wollenw., Z. Parasitenk. (Berlin) 1: 150. 1928. Fusarium luteum Parav., Ann. Mycol. 16: 302. 1918, nom. illegit., Art. 53.1. Nectria ditissima var. arctica Wollenw., Angew. Bot. 8: 189. 1926. Cylindrocarpon candidum var. medium Wollenw., Z. Parasitenk. (Berlin) 1: 158. 1928. Cylindrocarpon candidum var. majus Wollenw., Z. Parasitenk. (Berlin) 1: 158. 1928. Cylindrocarpon candidum var. minus Wollenw., Z. Parasitenk. (Berlin) 1: 155. 1928. Cylindrocarpon mali var. flavum Wollenw., Z. Parasitenk. (Berlin) 1: 150. 1928. Cylindrocarpon willkommii var. pluriseptatum Wollenw., Z. Parasitenk. (Berlin) 1: 152. 1928. Cylindrocarpon willkommii var. minus Wollenw., Z. Parasitenk. (Berlin) 1: 152. 1928. Holotypus: Not located. Type locality: Unknown. Type substrate: Branch. Notes: Synonyms fide Wollenweber & Reinking (1935). Several names that include Fusidium candidum (1809), Fusisporium 96 cylindricum (1842) and Fusarium fissum (1858) should take preference for this taxon. However, the epithet “candidum” is already occupied in the genus Neonectria and cannot be used. Furthermore, the link between Fusisporium cylindricum and Fusarium fissum with Neonectria ditissima still needs to be established. Therefore, we choose to retain the name Neonectria ditissima for this taxon. candidum Fusarium Sacc. & D. Sacc., Syll. Fung. 18: 674. 1906, nom. illegit., Art. 53.1, non Fusarium candidum Ehrenb. 1818. Basionym: Fusidium candidum Willk., Die mikroskopischen Feinde des Waldes 1: 103. 1866. Replacing synonym: Fusarium willkommii Lindau, Rabenh. Krypt.-Fl. ed. 2, 1(9): 551. 1910. (See Fusarium willkommii) capitatum Fusarium Schwein., Trans. Amer. Philos. Soc., n.s., 4: 302. 1832. Synonym: Pionnotes capitata (Schwein.) Fr., Summa Veg. Scand. 2: 481. 1849. Holotypus: PH00081394. Type locality: USA, Pennsylvania. Type substrate: Tsuga canadensis. Notes: The type material of Fusarium capitatum, type species of the genus Pionnotes, was re-examined by Seifert (2013). It represents not a hyphomycete but a basidiomycete identical to Dacrymyces chrysospermus. Therefore, the generic name Pionnotes is a synonym of Dacrymyces rather than Fusarium. Further evaluations are necessary in future phylogenetic revisions of the Dacrymycetales. caricis Fusarium Oudem., Verslagen Meded. Afd. Natuurk. Kon. Akad. Wetensch., ser. 3, 7: 325. 1890. (See Fusarium graminearum) Holotypus: ?L. Type locality: Netherlands, Zuid-Holland Province, Den Haag. Type substrate: Leaves of Carex sp. Note: Synonym fide Wollenweber & Reinking (1935). caries Fusarium Nees, Nova Acta Phys.-Med. Acad. Caes. Leop.-Carol. Nat. Cur. 19, Suppl. 1: 478. 1843. Holotypus: ?B, L or STR. Type locality: China. Type substrate: Meoschium lodiculare. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). carminascens Fusarium L. Lombard et al., Persoonia 43: 19. 2018 [2019]. Holotypus: CBS H-23609. Ex-type culture: CBS 144738 = CPC 25800. Type locality: South Africa, KwaZulu-Natal Province. Type substrate: Zea mays. Descriptions and illustrations: See Lombard et al. (2019b). Diagnostic DNA barcodes: rpb1: MW928801; rpb2: MH484937; tef1: MH485028. carneolum Fusarium P. Karst., Meddeland. Soc. Fauna Fl. Fenn. 16: 35. 1888. Vermicularia herbarum Westend., Herb. Crypt. Belg. no. 393. 1849. Holotypus: ?H. Type locality: Finland, Tammela. Type substrate: Iris pseudacorus. Note: Synonym fide Wollenweber & Reinking (1935). FUSARIUM carneoroseum Fusarium Cooke, Grevillea 19: 4. 1890. (See Fusarium lateritium) Holotypus: In K(M), Colenso 538 fide Index Fungorum. Type locality: New Zealand. Type substrate: Bark. Note: Synonym fide Wollenweber & Reinking (1935). carneum Fusarium (Mont.) Sacc., Syll. Fung. 4: 724. 1886. Basionym: Fusisporium carneum Mont., Ann. Sci. Nat., Bot., s
er. 2, 17: 120. 1842. Holotypus: ?PC. Type locality: Cuba. Type substrate: Leaf of monocotyledon. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). carniforme Fusarium Ellis & Tracy, nom. inval., Art. 38.1(a). Synonym: Ramularia carniformis Sherb., Phytopathology 18: 149. 1928. Authentic material: NY0093683. Original locality: USA, Mississippi, Starkville. Original substrate: Tripsacum dactyloides. Notes: Status unclear. Braun (1998) considered this species doubtful as conidia appeared microdochium-like. carpineum Fusarium Davis, Trans. Wisconsin Acad. Sci. 18: 106. 1915. Holotypus: BPI 442722. Type locality: USA, Wisconsin, Wyalusing. Type substrate: Carpinus caroliniana. Notes: This species was not treated by any of Wollenweber & Reinking (1935), Booth (1971), or Gerlach & Nirenberg (1982). A literature search could not find any additional information pertaining to this species. carpini Fusarium Schulzer & Sacc., Hedwigia 23: 128. 1884. (See Fusarium expansum) Holotypus: Not located. Type locality: Croatia, Vinkovci. Type substrate: Carpinus betulus. Note: Synonym fide Wollenweber & Reinking (1935). cassiae Fusarium R.H. Perera et al., Mycosphere 11: 2138. 2020. Holotypus: MFLU 18-2751. Ex-type culture: MFLUCC 18-0573. Type locality: Thailand, Phayao Province. Type substrate: Pods of Cassia fistula. Descriptions and illustrations: See Perera et al. (2020). Diagnostic DNA barcodes: rpb2: MT212197; tef1: MT212205. castagnei Fusarium Mont., Ann. Sci. Nat., Bot., s
er. 3, 12: 296. 1849. Myxosporium castagnei (Mont.) Wollenw., Fusaria. Autogr. Delin. 1: 489. 1916. Holotypus: ?PC. Type locality: France, Marseille. Type substrate: Psoralea bituminosa. Note: Synonym fide Wollenweber & Reinking (1935). castaneicola Fusarium W. Yamam., Trans. Mycol. Soc. Japan 3: 114. 1962, nom. inval., Art. 39.1 & 40.1. Rugonectria castaneicola (W. Yamam. & Oyasu) Hirooka & P. Chaverri, Stud. Mycol. 68: 73. 2011. www.studiesinmycology.org REDELIMITED Basionym: Nectria castaneicola W. Yamam. & Oyasu, Sci. Rep. Hyogo Univ. Agric. 3: 15. 1957. Synonyms: Neonectria castaneicola (W. Yamam. & Oyasu) Tak. Kobay. & Hirooka, J. Gen. Pl. Pathol. 71: 126. 2005, nom. inval., Art. 41.5. Cylindrocarpon castaneicola Tak. Kobay. & Hirooka, J. Gen. Pl. Pathol. 71: 126. 2005. Authentic material: Not designated. Original locality: Japan, Hyogo. Original substrate: Castanea crenata. Note: This Fusarium epithet is invalid as neither a Latin diagnosis (Art. 39.1) nor a type designation (Art. 40.1) was included in the original description. castaneum Fusarium Lindau (as “(Lib.) Sacc.“), Rabenh. Krypt.Fl. ed. 2, 1(9): 556. 1909. Synonym: Sclerotium castaneum Lib., in herb. 1832, nom. nud. (See Fusarium candidum Ehrenb.) Authentic material: Not located. Original locality: Belgium, Ardennes. Original substrate: Brassica oleracea. cataleptum Fusarium Cooke & Harkn., Grevillea 12: 96. 1884. (See Fusarium coccophilum) Holotypus: In K(M), Harkness 1981 fide Index Fungorum. Type locality: USA, California, San Rafael. Type substrate: Acacia sp. Note: Synonym fide Wollenweber & Reinking (1935). catenatum Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum. 440: 1. 2020. Neocosmospora catenata Sand.-Den. & Crous, Persoonia 41: 115. 2018. Holotypus: CBS H-23225. Ex-type culture: CBS 143229 = NRRL 54993 = UTHSC 09-1009. Type locality: USA, Georgia. Type substrate: Stegostoma fasciatum. Descriptions and illustrations: See Sandoval-Denis & Crous (2018). Diagnostic DNA barcodes: rpb1: KC808292; rpb2: KC808355; tef1: KC808214. cateniforme Fusarium J.W. Xia et al., Persoonia 43: 197. 2019 Holotypus: CBS H-24053. Ex-type culture: ATCC 11853 = CBS 150.25. Type locality: Unknown. Type substrate: Unknown. Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb2: MN170384; tef1: MN170451. catenulatum Fusarium F.J. Chen, Mycosystema 19: 459. 2000. Holotypus: HMAS 71749. Ex-type culture: AS 3.4704. Type locality: China, Shaanxi, Yangling. Type substrate: Gossypium hirsutum. Descriptions and illustrations: See Chen (2000). caucasicum Fusarium Letov, Mater. Mikol. Fitopatol. 8: 225. 1929. Holotypus: Not located. Ex-type culture: CBS 179.35 = IFO 5979 = NRRL 13954. Type locality: Republic of Azerbaijan. Type substrate: Gossypium hirsutum. Descriptions and illustrations: See Gerlach & Nirenberg (1982). 97 CROUS ET AL. Notes: Status doubtful/unclear. The ex-type culture (CBS 179.35) accessioned in CBS appears to be either contaminated or transpositioned by another Fusarium sp. (Sandoval-Denis et al. 2019). A sequence of the tef1 gene region (DQ247543) from the copy accessioned at NRRL (NRRL 13954) places this species within the Neocosmospora falciformis clade (Sandoval-Denis et al. 2019). The status of the copy accessioned at IFO is not known. caudatum Fusarium Wollenw., J. Agric. Res. 2: 262. 1914. (See Fusarium scirpi) Lectotypus (hic designatus, MBT 10000665): USA, South Carolina, Clemson College, Ipomoea batatas, date unknown, Harter & Field, in Wollenweber, J. Agric. Res. 2: 262, pl. 16, fig. M. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. cavispermum Fusarium Corda, Icon. Fung. 1: 3. 1837. Cosmosporella cavisperma (Corda) Sand.-Den. et al., Stud. Mycol. 98 (no. 100116): 44. 2021. Synonyms: Fusarium aquaeductuum var. cavispermum (Corda) Raillo, Fungi of the Genus Fusarium: 280. 1950. Fusarium oxydendri Ellis & Everh., Bull. Torrey Bot. Club 24: 477. 1897. Fusarium cavispermum var. minus Wollenw., Fusaria Autogr. Delin. 3: 848. 1930. Lectotypus: AKJ. Corda, Icon. Fung. 1: pl. I, fig. 58, designated in this study. Type locality: Czech Republic. Type substrate: Resin of Pinus sp. Epitypus: CBS 172.31 (metabolic inactive specimen) designated in this study. Ex-epitype: CBS 172.31 = NRRL 13996. Epitype locality: Norway. Epitype substrate: Pinus sylvestris. Diagnostic DNA barcodes: rpb1: JX171465; rpb2: JX171579. celosiae Fusarium T. Abe, Mem. Coll. Agric. Kyoto Imp. Univ. 7: 51. 1928. (See Fusarium fujikuroi) Holotypus: Not located. Type locality: Japan. Type substrate: Living stems and leaves of Celosia cristata. Note: Synonym fide Wollenweber & Reinking (1935). celtidicola Fusarium Q.J. Shang et al., Phytotaxa 361: 255. 2018. Holotypus: MFLU 15-3646. Ex-type culture: KUMCC 16-0019 = MFLUCC 16-0526. Type locality: Italy, Forlì-Cesena Province, Forlì, Viale dell’Appennino. Type substrate: Celtis australis. Descriptions and illustrations: See Shang et al. (2018). Diagnostic DNA barcodes: rpb1: MH576579; rpb2: MH576577; tef1: MH576581. celtidis Fusarium Ellis & Tracy, J. Mycol. 6: 76. 1890. (See Fusarium lateritium) Syntypes: In BPI, ISC & MICH. Type locality: USA, Mississippi, Starkville. Type substrate: Celtis occidentalis. Note: Synonym fide Wollenweber & Reinking (1935). 98 celtidis Fusarium Pass., Atti Reale Accad. Lincei, Rendiconti Cl. Sci. Fis., 4 s
er. 7: 51. 1891, nom. illegit., Art. 53.1. Replacing synonym: Fusarium sphaeriiforme Sacc. (as ‘sphaeriaeforme’), Syll. Fung. 10: 723. 1892. (See Fusarium melanochlorum) Holotypus: ?PARMA. Type locality: Italy, Parma, Vigheffio. Type substrate: Dead branch of Celtis australis. Note: Synonym fide Wollenweber & Reinking (1935). cepae Fusarium Hanzawa, Mycol. Centralbl. 5(1): 5. 1914. (See Fusarium oxysporum) Lectotypus (hic designatus, MBT 10000666): Japan, Sapporo, Allium cepa, 1914, J. Hanzawa, 5(1): 6, fig. 1. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. cerasi Fusarium Rolland & Ferry, in Roumeguere, Rev. Mycol. (Toulouse) 14: 170. 1892. ?Foveostroma drupacearum (L
ev.) DiCosmo, Canad. J. Bot. 56: 1682. 1978. Basionym: Micropera drupacearum L
ev., Ann. Sci. Nat., Bot., s
er. 3, 5: 283. 1846. Synonyms: ?Peziza cerasi Pers., Neues Mag. Bot. 1: 115. 1794. ?Dermea cerasi (Pers.) Fr., Syst. Orb. Veg. 1: 115. 1825. Syntype: ILL00220294 (Fungi Sel. Gall. Exs. No. 6119). Type locality: France, Saint-Di
e-des-Vosges. Type substrate: Prunus sp. (cherry tree). Note: This species was excluded from Fusarium by Wollenweber (1943). Gerlach & Nirenberg (1982) considered this species as a possible synonym of Micropera drupacearum on which the present synonymies are based. cerealis Fusarium (P. Karst.) Gruyter & J.H.M. Schneid., Jaarb. Plantenziektenk. Dienst 1989/1990, no. 168: 135. 1991, nom. inval., Art. 41.4. Gliomastix cerealis (P. Karst.) C.H. Dickinson, Mycol. Pap. 115: 19. 1968. Basionym: Coniosporium cerealis P. Karst., Meddeland. Soc. Fauna Fl. Fenn. 14: 109. 1887. Synonyms: Acremonium cerealis (P. Karst.) W. Gams, Cephalosporium-artige Schimmelpilze (Stuttgart): 88. 1971. Gliomastix guttuliformis J.C. Br. & W.B. Kendr., Trans. Brit. Mycol. Soc. 41: 499. 1958. Holotypus: In herb. P.A. Karsten in H fide Dickinson (1968). Type locality: Finland, Mustiala. Type substrate: Secale cereale. cerealis Fusarium (Cooke) Sacc., Syll. Fung. 4: 713. 1886. Basionym: Fusisporium cerealis Cooke, Grevillea 6: 139. 1878. Synonym: Fusarium culmorum var. cerealis (Cooke) Wollenw., Fusaria Autogr. Delin. 3: 946. 1930. Fusarium roseum f. cerealis (Cooke) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 32: 663. 1945. Gibberella rosea f. cerealis (Cooke) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 32: 664. 1945. Fusarium sambucinum var. cerealis (Cooke) Raillo, Fungi of the Genus Fusarium: 211. 1950. Fusarium crookwellense L.W. Burgess et al., Trans. Brit. Mycol. Soc. 79: 498. 1982. Holotypus: ?K(M) 133541. FUSARIUM Type locality: USA, California, Gainesville. Type substrate: Zea mays. Notes: Wollenweber & Reinking (1935) considered F. cerealis as a variety of F. culmorum, whereas Raillo (1950) considered it as a variety of F. sambucinum. Gerlach & Nirenberg (1982) applied a broader concept to F. culmorum that did not separate this variety in F. culmorum. Nirenberg (1990) recognised F. cerealis as a species and considered F. crookwellense as a synonym of F. cerealis. However, Leslie & Summerell (2006) recommend the use of the name F. crookwellense over F. cerealis, indicating that no type material is available for F. cerealis. We choose to follow Nirenberg (1990) to consider F. crookwellense a synonym under F. cerealis. The material lodged in K(M) requires further investigation to determine whether epi- or neotypification is required. cesatii Fusarium Rabenh., Klotzschii Herb. Viv. Mycol. Cent. 15: no. 1440. 1850. Hymenula rubella Fr., Elench. Fung. 2: 38. 1828. Lectotypus (of Fusarium cesatii, hic designatus, MBT 10000667): Italy, Vercelli, Carex sp., 1849, collector unknown, Rabenh., Klotzschii Herb. Viv. Mycol. Ed. I no. 1440 in HAL. Note: Synonym fide Wollenweber & Reinking (1935). cesatii Fusarium Thüm., Pilze Weinst.: 49. 1878, nom. illegit., Art. 53.1, non Fusarium cesatii Rabenh. 1850. Elsinoe ampelina (de Bary) Shear, Phytopathology 19: 677. 1929. Basionym: Sphaceloma ampelina de Bary, Ann. Oenol. 4: 165. 1874. Synonyms: Manginia ampelina (de Bary) Viala & Pacottet, C. r. hebd. S
eanc. Acad. Sci., Paris 139: 88. 1904. Pionnotes cesatii Sacc., Syll. Fung. 4: 726. 1886. Ramularia ampelophaga Pass., Bol. Comit. Agric. Parmense 9: 125. 1876. Gloeosporium ampelophagum (Pass.) Sacc., Michelia 1: 217. 1878. Authentic material: S-F47363. Original locality: Italy, Vercelli. Original substrate: Decaying stump of Vitis vinifera. Note: Synonym fide Wollenweber & Reinking (1935). chaetomium Fusarium Wallr., Fl. Crypt. Germ. 2: 242. 1833. Colletotrichum chaetomium (Wallr.) S. Hughes, Canad. J. Bot. 36: 753. 1958. Holotypus: ?STR. Type locality: Germany. Type substrate: Decaying Cucurbita. chenopodinum Fusarium (Thüm.) Sacc., Syll. Fung. 4: 701. 1886. (See Fusarium scirpi) Basionym: Fusisporium chenopodinum Thüm., Mycoth. Univ. Cent. 14: no. 1378. 1879. Syntypes: In BPI, CHRB, ILL, NEB, NY, NYS & PUL. Type locality: Austria, Niederösterreich, Klosterneuburg. Type substrate: Chenopodium album. Note: Synonym fide Wollenweber & Reinking (1935). chilense Fusarium (Mont.) Sacc., Syll. Fung. 4: 716. 1886. Gloeosporium chilense (Mont.) Wollenw., Z. Parasitenk. (Berlin) 3: 496. 1931. Basionym: Fusisporium chilense Mont., in Gay, Fl. Chil. 8: 25. 1852. www.studiesinmycology.org REDELIMITED Fusisporium argillaceum Mont., Bull. Mass. Agric. Exp. Sta. no. 55. 1842, nom. illegit., Art. 53.1, non Fusarium argillaceum Fr. 1832. Holotypus: In UPS fide Wollenweber, Fusaria Autogr. Delin. 2: 658. Type locality: Chile, Juan Fern
andez Islands. Type substrate: Bark of Urtica excelsa. Note: Synonym fide Wollenweber & Reinking (1935). chinhoyiense Fusarium Yilmaz & Crous, Persoonia 46: 147. 2021. Holotypus: PREM 63215. Ex-type culture: BBA 69031 = DAOM 225149 = Frank 5bCn8 = IMI 375355 = NRRL 25221 = NY007.I2. Type locality: Zimbabwe, Chinhoyi. Type substrate: Zea mays. Descriptions and illustrations: See Yilmaz et al. (2021). Diagnostic DNA barcodes: rpb1: MW402711; rpb2: MN534262; tef1: MN534050. chlamydosporum Fusarium Wollenw. & Reinking, Phytopathology 15: 156. 1925. Synonyms: Fusarium sporotrichioides var. chlamydosporum (Wollenw. & Reinking) Joffe, Mycopathol. Mycol. Appl. 53: 211. 1974, nom. inval., Art. 41.1. Dactylium fusarioides Gonz. Frag. & Cif., Bol. Real Soc. Esp. Hist. Nat. 27: 280. 1927. Fusarium fusarioides (Gonz. Frag. & Cif.) C. Booth, The Genus Fusarium: 88. 1971. Pseudofusarium purpureum Matsush., Microfungi of the Solomon Islands and Papua New Guinea: 47. 1971. Neotypus: CBS 145.25 (preserved as metabolically inactive culture), designated in Lombard et al. (2019a). Ex-neotype culture: CBS 145.25 = NRRL 26851 = NRRL 26912. Neotype locality: Honduras, Tela. Neotype substrate: Musa sapientum. Descriptions and illustrations: See Wollenweber & Reinking (1925), Booth (1971), Gerlach & Nirenberg (1982) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: MN120715; rpb2: MN120735; tef1: MN120754. cicatricum Fusarium (Berk.) O'Donnell & Geiser, Phytopathology 103: 404. 2013. Geejayessia cicatricum (Berk.) Schroers, Stud. Mycol. 68: 124. 2011. Basionym: Sphaeria sanguinea var. cicatricum Berk., Mag. Zool. Bot. 1: 48. 1837. Synonyms: Nectria cicatricum (Berk.) Tul. & C. Tul., Select. Fung. Carpol. 3: 77. 1865. Sphaeria sanguinea var. cicatricum Haller, Syst. Nat., ed 13, 1: LII. 1768. Sphaeria coccinea var. cicatricum Desm., Ann. Sci. Nat., Bot., s
er. 3, 10: 351. 1848. Nectria coccinea var. cicatricum (Desm.) Sacc., Syll. Fung. 2: 482. 1883. Cucurbitaria cicatricum (Desm.) Kuntze, Revis. Gen. Pl. 3: 462. 1898. Nectria gibbera Fuckel, Jahrb. Nassauischen Vereins Naturk. 23–24: 177. 1870. Fusarium fuckelii Sacc., Syll. Fung. 4: 695. 1886. Nectria desmazieri Fuckel ex Sacc., Syll. Fung. 4: 695. 1886, nom. inval., Art. 36.1(d). 99 CROUS ET AL. Lectotypus: K(M) 160064 (MBT 10001323 hic designatus). Epitypus: CBS H-20374 (MBT 10001324 hic designatus). Ex-epitype culture: CBS 125549. Epitype locality: Slovenia, Arboretum Volcji Potok. Epitype substrate: Decaying twigs of Buxus sempervirens. Descriptions and illustrations: See Schroers et al. (2011). Diagnostic DNA barcodes: rpb1: KM232231; rpb2: HM626679; tef1: HM626643. Notes: The epitypification in Schroers et al. (2011) was not Code compliant as neither a supporting holo-, lecto- nor epitype was cited. The specimen in the Kew herbarium was cited as isotype. In the protologue a single gathering is mentioned, but an illustration is also cited so a lectotypification is necessary. The epitypification is validated herein. ciliatum Fusarium (Link) Link, in Willdenow, Sp. Pl., Ed. 4, 6: 105. 1825. Scolecofusarium ciliatum (Link) L. Lombard et al., Stud. Mycol. 98 (no. 100116): 74. 2021. Basionym: Atractium ciliatum Link, Mag. Neuesten Entdeck. Gesammten Naturk. Ges. Naturf. Freunde Berlin 7: 32. 1816. Synonyms: Microcera ciliata (Link) Wollenw., Fusaria Autogr. Delin. 1: 435. 1916. Calonectria ciliata (Link) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 32: 664. 1945. Sphaeria agnina Desm., Ann. Sci. Nat., Bot. s
er. 3, 6: 72. 1846. Calonectria agnina (Desm.) Sacc., Michelia 1(3): 311. 1878. Dialonectria agnina (Desm.) Cooke, Grevillea 12: 111. 1884. Fusarium peltigerae Westend., Herb. Crypt. Belg. 9: no. 414. 1849. Fusarium parasiticum Westend., Bull. S
eances Cl. Sci. Acad. Roy. Sci. Belgique, s
er. 2, 11: 652. 1861. Nectria massariae Pass., in Rabenhorst, Fungi Eur. Exs. no. 1827. 1874. Microcera massariae Sacc., Michelia 1(2): 262. 1878. Calonectria massariae (Pass.) Sacc., Michelia 1(3): 312. 1878. Fusisporium filisporum Cooke, Grevillea 8: 8. 1879. Fusarium filisporum (Cooke) Sacc., Syll. Fung. 4: 708. 1886. Fusarium scolecoides Sacc. & Ellis, Atti Reale Ist. Veneto Sci. Lett. Arti, s
er. 6, 3: 728. 1885. Fusarium elongatum Cooke, Grevillea 19: 4. 1890. Calonectria dearnessii Ellis & Everh., Proc. Acad. Nat. Sci. Philadelphia 42: 245. 1891. Neotypus: CBS H-12687 designated in this study. Ex-neotypus: ATCC 16068 = ATCC 24137 = BBA 9661 = CBS 191.65 = DSM 62172 = IMI 112499 = NRRL 20431. Neotype locality: Germany. Neotype substrate: Branch canker of Fagus sylvatica. Diagnostic DNA barcodes: rpb1: MW834264; rpb2: MW834035; tef1: MW834296. cinctum Fusarium Corda, Icon. Fung. 5: 80. 1842. Striaticonidium cinctum (Corda) L. Lombard & Crous, Persoonia 36: 229. 2016. Synonyms: Myrothecium cinctum (Corda) Sacc., Syll. Fung. 4: 751. 1886. ?Myrothecium ellipsosporum Fuckel (as ‘ellipsisporium’), Fungi Rhen. Exs. Cent. 16, no. 1529 (1865). ?Hymenopsis ellipsospora (as ‘ellipsosporum’) (Fuckel) Sacc., Syll. Fung. 4: 745. 1886. Myrothecium striatisporum N.C. Preston, Trans. Brit. Mycol. Soc. 31: 275. 1948. 100 Myrothecium longistriatisporum Matsush., Microfungi Solomon Isl. Papua-New Guinea: 39. 1971. Lectotypus: PR 155489, designated in Tulloch (1972). Epitypus: CBS H-22471, designated in Lombard et al. (2016). Ex-epitype culture: CBS 932.69 = IMI 145760. Epitype locality: Netherlands, Eastern Flevoland. Epitype substrate: Agricultural soil. Note: The lectotype was cited as holotype in Lombard et al. (2016) but this is correctable according to Art. 9.10 of the Code (see also Ex. 11). cinnabarinum Fusarium (Berk. & M.A. Curtis) Sacc., Syll. Fung. 4: 722. 1886. (See Fusarium lateritium) Basionym: Fusisporium cinnabarinum Berk. & M.A. Curtis, Grevillea 3: 146. 1875. Syntypes: In PH, Pul & USCH:Fungi (Ellis, N. Amer. F. 3990). Type locality: USA, Alabama. Type substrate: Acer negundo. Note: Synonym fide Wollenweber & Reinking (1935). circinatum Fusarium Nirenberg & O'Donnell, Mycologia 90: 442. 1998. Synonyms: Gibberella circinata Nirenberg & O'Donnell, Mycologia 90: 440. 1998, nom. inval., Art. 40.3. Gibberella circinata Nirenberg & O'Donnell ex Britz et al., Sydowia 54: 16. 2002. Holotypus: B 70 0001693. Ex-type culture: BBA 69720 = CBS 405.97 = DAOM 225113 = IMI 375321 = NRRL 25331. Type locality: USA, California. Type substrate: Pinus radiata. Descriptions and illustrations: See Nirenberg & O'Donnell (1998). Diagnostic DNA barcodes: rpb1: JX171510; rpb2: JX171623; tef1: AF160295. cirrosum Fusarium Höhn., Sitzungsber. Kaiserl. Akad. Wiss. Wien, Math.-Naturwiss. Cl., Abt. 1., 116: 153. 1907. (See Fusarium expansum) Holotypus: FH00284266. Type locality: Austria, Niederösterreich, Irenental near Untertullnerbach. Type substrate: Parasictic in the acervuli of Steganosporium pyriforme (syn. Steganosporium ovatum). Note: Synonym fide Wollenweber & Reinking (1935). citri Fusarium M.M. Wang et al., Persoonia 43: 79. 2019. Holotypus: HAMS 248036. Ex-type culture: CGMCC 3.19467 = LC6896. Type locality: China, Hunan Province. Type substrate: Leaves of Citrus reticulata. Descriptions and illustrations: See Wang et al. (2019). Diagnostic DNA barcodes: rpb1: MK289828; rpb2: MK289771; tef1: MK289617. citricola Fusarium Guarnaccia et al., Persoonia 40: 12. 2017. [2018]. Holotypus: CBS H-23020. Ex-type culture: CBS 142421 = CPC 27805. Type locality: Italy, Cosenza, Rocca Imperiale. Type substrate: Citrus reticulata ‘Caffin’. Descriptions and illustrations: See Sandoval-Denis et al. (2018a). FUSARIUM Diagnostic DNA barcodes: rpb1: LT746290; rpb2: LT746310; tef1: LT746197. citriforme Fusarium Jamal., Valt. Maatalousk. Julk. 123: 11. 1943. (See Fusarium tricinctum) Lectotypus (hic designatus, MBT 10000668): Finland, Pyhaj€arvi, Hordeum sativum, 1938, E. Jamalainen, in Valt. Maatalousk. Julk. 123: 10. 1943, fig. 2. Ex-type culture: CBS 253.50. Diagnostic DNA barcodes: rpb1: MW928802; rpb2: MW928823; tef1: KR071775. Notes: Jamalainen (1943) cited various specimens in the protologue of F. citriforme, but failed to indicate a holotype. Therefore, a lectotypification is done here to fix the name. Isolate CBS 253.50 was deposited in the public collection of CBS by E. Jamalainen in 1950. The isolate was indicated as the living extype culture of F. citriforme. citrinum Fusarium Wollenw., in Lewis, Bull. Maine Agric. Exp. Sta. 219: 256. 1913. (See Fusarium oxysporum) Lectotypus (hic designatus, MBT 10000669): Germany, Berlin, Dahlem, rotten fruit of Solanum lycopersicum, Oct. 1910, H.W. Wollenweber, B70 0100185. Notes: Synonym fide Wollenweber & Reinking (1935). Only one specimen located at B matches the original collection event, but it is not indicated as the type. Therefore B 70 0100185 is designated as lectotype here. citrulli Fusarium Taubenh., Bull. Texas Agric. Exp. Sta. 260: 27. 1920. (See Fusarium oxysporum) Lectotypus (hic designatus, MBT 10000670): USA, Texas, Waller County, seedlings of Citrullus lanatus, 1920, J.J. Taubenhaus, in Bull. Texas Agric. Exp. Sta. 260: 30, fig. 8h. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. citrulli Fusarium Sartory, Compt. Rend. Hebd. S
eances Acad. Sci. 188: 1434. 1929, nom. inval., Art. 35.2; nom. illegit., Art. 53.1. Neocosmospora martii (Appel & Wollenw.) Sand.-Den. & Crous, Persoonia 43: 142. 2019. Basionym: Fusarium martii Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land-Forstw. 8: 83. 1910. Synonyms: Fusarium solani var. martii (Appel & Wollenw.) Wollenw., Fusaria Autogr. Delin. 3: 1034. 1930. ?Selenosporium fuscum Bonord., Handb. Mykol.: 135. 1851. ?Fusarium fuscum (Bonord.) Sacc., Syll. Fung. 4: 699. 1886. Fusarium citrulli Sartory & J. Mey., Compt. Rend. Soc. Biol. 107: 55. 1931, nom. illegit., Art. 53.1, non Fusarium citrulli Taubenh. 1920. Neocosmospora croci Guarnaccia et al., Persoonia 40: 17. 2017 [2018]. Authentic material: Not located. Original locality: France. Original substrate: Citrullus vulgaris. Note: Synonyms fide Wollenweber & Reinking (1935) and Sandoval-Denis et al. (2019). clavatum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 234. 1915. (See Fusarium flocciferum) www.studiesinmycology.org REDELIMITED Lectotypus (hic designatus, MBT 10000671): USA, New York, Castile, rotten tuber of Solanum tuberosum, 1915, C.D. Sherbakoff, in Mem. Cornell Univ. Agric. Exp. Sta. 6: 235, fig. 40. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. clavus Fusarium J.W. Xia et al. (as ‘clavum’), Persoonia 43: 199. 2019. Holotypus: CBS H-24054. Ex-type culture: CBS 126202 = RMF N 38. Type locality: Namibia, northern Karoo, 30 km west of Maltahöhe. Type substrate: Desert soil. Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb2: MN170389; tef1: MN170456. clematidis Fusarium Rolland & Fautrey, Rev. Mycol. (Toulouse) 16: 72. 1894. Macroconia sphaeriae (Fuckel) Gr€afenhan & Schroers, Stud. Mycol. 68: 103. 2011. Basionym: Fusarium sphaeriae Fuckel, Fungi Rhen. Exs. Fasc. 3: no. 212. 1863. Synonyms: Fusarium sphaeriae var. robustum Davis, Trans. Wisconsin Acad. Sci. 19: 714. 1919. Septogloeum robustum (Davis) Wollenw. & Reinking, Fusarien: 336. 1935. ?Nectria leptosphaeriae var. macrospora Wollenw., Angew. Bot. 8: 187. 1926. Syntype: ILL00220727 (Roumeguere, Fungi Sel. Gall. Exs. no. 6537). Type locality: France. Type substrate: Clematis vitalba. Note: Synonym fide Wollenweber & Reinking (1935). clypeaster Fusarium (Corda) Sacc., Syll. Fung. 4: 706. 1886. Septogloeum clypeaster (Corda) Wollenw., Fusarien: 321. 1935. Basionym: Fusisporium clypeaster Corda, Icon. Fung. 4: 26. 1840. Lectotypus (hic designatus, MBT 10000672): Czech Republic, Phragmites, May 1839, A.C.J. Corda, in Icon. Fung. 4, Tab. 6, fig. 82. 1840. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. coccidicola Fusarium Henn. (as ‘coccideicola’), Bot. Jahrb. Syst. 34: 57. 1904. Microcera diploa (Berk. & M.A. Curtis) Gr€afenhan & Seifert, Stud. Mycol. 68: 106. 2011. Basionym: Nectria diploa Berk. & M.A. Curtis, J. Linn. Soc., Bot. 10: 378. 1868. Synonyms: Cucurbitaria diploa (Berk. & M.A. Curtis) Kuntze, Revis. Gen. Pl. 3: 461. 1898. Creonectria diploa (Berk. & M.A. Curtis) Seaver, Mycologia 1: 190. 1909. Calonectria diploa (Berk. & M.A. Curtis) Wollenw., Angew. Bot. 8: 193. 1926. Cosmospora diploa (Berk. & M.A. Curtis) Rossman & Samuels, Stud. Mycol. 42: 121. 1999. Fusarium derridis Henn., Beibl. Hedwigia 41: (66). 1902. Fusarium juruanum Henn., Hedwigia 43: 398. 1904. 101 CROUS ET AL. Fusarium pentaclethrae Henn., Hedwigia 44: 71. 1905. Aschersonia henningsii Koord., Verh. Kon. Ned. Akad. Wetensch., Afd. Natuurk. 13: 213. 1907. Microcera henningsii (Koord.) Petch, Ann. Roy. Bot. Gard. (Peradeniya) 5: 533. 1914. Pseudomicrocera henningsii (Koord.) Petch, Trans. Brit. Mycol. Soc. 7: 100. 1921. Microcera fujikuroi Miyabe & Sawada, J. Fac. Agric. Hokkaido Imp. Univ. 5: 83. 1913. Microcera merrillii Syd. & P. Syd., Ann. Mycol. 12(6): 576. 1914. Pseudomicrocera henningsii var. longispora Petch, Trans. Brit. Mycol. Soc. 7: 164. 1921. Fusarium microcera Bilaĭ, Fusarii (Biologija i sistematika): 292. 1955, nom. inval., Art. 39.1. Holotypus: Zimmerman no. 26 in B fide Hein (1988). Type locality: Tanzania, East Usambara, Magrotto. Type substrate: Parasitic on Coccoidea sp. on Camellia sinensis. coccinellum Fusarium Kalchbr., Flora (Regensburg) 59: 426. 1876. (See Fusarium coccophilum) Syntype: ?NY00899913. Type locality: South Africa, Eastern Cape Province, SomersetEast. Type substrate: Acacia horrida. Note: Synonym fide Wollenweber & Reinking (1935). coccineum Fusarium Schwein., Trans. Amer. Philos. Soc., n.s. 4: 302. 1834. Holotypus: ?PH00062490. Type locality: USA, Pennsylvania, Northhampton, Nazareth. Type substrate: Bark of Castanea sp. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). coccophilum Fusarium (Desm.) Wollenw. & Reinking, Fusarien: 34. 1935. Microcera coccophila Desm., Ann. Sci. Nat. Bot., s
er. 3, 10: 359. 1848. Synonyms: Tubercularia coccophila (Desm.) Bonord., Abh. Naturf. Ges. Halle 8: 96. 1864. Fusarium episphaeria f. coccophilum (Desm.) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 32: 662. 1945. Nectria episphaeria f. coccophila (Desm.) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 32: 662. 1945. Fusarium coccinellum Kalchbr., Flora (Regensburg) 56: 426. 1876. Fusisporium coccinellum (Kalchbr.) Kalchbr., in Thümen, Mycoth. Univ. no. 782. 1877. Fusarium cataleptum Cooke & Harkn., Grevillea 12: 96. 1884. Microcera pluriseptata Cooke & Massee, Grevillea 17: 43. 1888. Fusarium callosporum Pat., Bull. Soc. Mycol. France 9: 164. 1893. Fusarium baccharidicola Henn., Hedwigia 48: 20. 1908. Microcera coccophila var. platyspora Sousa da C^amara, Revista Agron. (Lisbon): 5 (extr.). 1920. Lectotypus: K(M) 165807, designated in Gr€afenhan et al. (2011). Type locality: France, Normandy, near Caen. Type substrate: Parasitic on Eulecanium tiliae on Salix sp. and Fraxinus excelsior. Descriptions and illustrations: See Gr€afenhan et al. (2011). Notes: No living type material available. Gr€afenhan et al. (2011) designated a lectotype but did not designate an epitype, which is still required. 102 coffeatum Fusarium L. Lombard & Crous, Fungal Syst. Evol. 4: 191. 2019. Replaced synonym: Fusarium chlamydosporum var. fuscum Gerlach, Phytopathol. Z. 90: 41. 1977. Holotypus: BBA 62053. Isotypus: CBS H-631. Ex-type culture: BBA 62053 = CBS 635.76 = NRRL 20841. Type locality: South Africa. Type substrate: Cynodon lemfuensis. Descriptions and illustrations: See Gerlach (1977a), Gerlach & Nirenberg (1982) and Xia et al. (2019). Diagnostic DNA barcodes: rpb1: MN120717; rpb2: MN120736; tef1: MN120755. coffeicola Fusarium Henn., Bot. Jahrb. Syst. 22: 82. 1895. Synonym: Gloeosporium coffeicola (P. Henn.) Wollenw., Fusaria Autogr. Delin. 1: 493. 1916, nom. illegit., Art. 53.1, non Gloeosporium coffeicola Tassi 1900. Holotypus: In B fide Hein (1988). Type locality: Cameroon, Victoria. Type substrate: Coffea liberica. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). coicis Fusarium Johanssen et al., Fungal Diversity 77: 356. 2015 [2016]. Holotypus: RBG 5368. Ex-type culture: FRL 19329 = NRRL 66233 = RBG 5368. Type locality: Australia, Queensland, Mareeba. Type substrate: Coix gasteenii. Descriptions and illustrations: See Laurence et al. (2016). Diagnostic DNA barcodes: rpb1: KP083269; rpb2: KP083274; tef1: KP083251. colorans Fusarium (De Jonge) Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land-Forstw. 8: 39. 1913. Albonectria rigidiuscula (Berk. & Broome) Rossman & Samuels, Stud. Mycol. 42: 105. 1999. Basionym: Nectria rigidiuscula Berk. & Broome, J. Linn. Soc., Bot. 14: 116. 1873 [1875]. Synonyms: Calonectria rigidiuscula (Berk. & Broome) Sacc., Michelia 1(3): 313. 1878. Fusarium rigidiusculum (Berk. & Broome) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 32: 664. 1945. Calonectria eburnea Rehm, Hedwigia 37: 196. 1898. Calonectria lichenigena Speg., Bol. Acad. Nac. Ci. Republ. Argent. 11: 530. 1889. Calonectria sulcata Starb€ack, Bih. Kongl. Svenska Vetensk.Akad. Handl. 25: 29. 1899. Fusarium decemcellulare Brick, Jahresber. Vereinigung Angew. Bot. 6: 227. 1908. Spicaria colorans De Jonge, Recueil Trav. Bot. N
eerl. 6: 48. 1909. Scoleconectria tetraspora Seaver, N. Amer. Fl. 3: 27. 1910. Calonectria tetraspora (Seaver) Sacc. & Trotter, Syll. Fung. 22: 487. 1913. Nectria rigidiuscula f. theobromae E.J. Ford et al., Phytopathology 57: 712. 1967. Holotypus: Not located. Type locality: Surinam. Type substrate: Theobroma cacao. Notes: Synonym fide Wollenweber & Reinking (1935). Wollenweber (1916–1935) indicated that cultures and specimens of Spicaria colorans (basionym of F. colorans) were FUSARIUM deposited in the Willie Commelin Scholten collection in Amsterdam. This collection has been accessioned into the CBS collection (CBS & CBS H). However, no cultures and specimens or records could be located at CBS. commune Fusarium K. Skovg. et al., Mycologia 95: 632. 2003. Holotypus: BBA 71639 in B. Ex-type culture: AAS 156 = BBA 71639 = CBS 110090 = NRRL 31076. Type locality: Denmark. Type substrate: Soil. Descriptions and illustrations: See Skovgaard et al. (2003). Diagnostic DNA barcodes: rpb1: MW928803; rpb2: MW934368; tef1: AF362263. commutatum Fusarium Sacc., Syll. Fung. 4: 710. 1886. (See Fusarium solani) Replaced synonym: Fusisporium candidum Bonord., Handb. Allg. Mykol.: 96 (1851), nom. illegit., Art. 53.1, non Fusisporium candidum Link 1824. Holotypus: Not located. Type locality: Germany. Type substrate: Solanum tuberosum. Note: Synonyms fide Wollenweber & Reinking (1935) and Sandoval-Denis et al. (2019). compactum Fusarium (Wollenw.) Raillo, Fungi of the Genus Fusarium: 180. 1950. Basionym: Fusarium scirpi var. compactum Wollenw., Fusaria Autogr. Delin. 3: no. 924. 1930. Synonym: Fusarium compactum (Wollenw.) Gordon, Canad. J. Bot. 30: 224. 1952, nom. inval., Art. 53.1. Lectotypus: Illustration in Wollenweber, Fusaria Autogr. Delin. no. 924 (1930), designated in Xia et al. 2019. Epitypus: CBS 186.31 (preserved as metabolically inactive culture), designated in Xia et al. (2019). Ex-epitype culture: CBS 186.31 = NRRL 36323. Epitype locality: UK, Kew. Epitype substrate: Cotton thread. Descriptions and illustrations: See Wollenweber (1916–1935, no. 924), Raillo (1950), Gordon (1952), Gerlach & Nirenberg (1982) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb2: GQ505826; tef1: GQ505648. concentricum Fusarium Nirenberg & O'Donnell, Mycologia 90: 442. 1998. Holotypus: B 70 0001694. Ex-type culture: BBA 64354 = CBS 450.97 = DAOM 225146 = IMI 375352 = NRRL 25181. Type locality: Costa Rica. Type substrate: Musa sapientum. Descriptions and illustrations: See Nirenberg & O'Donnell (1998) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: LT996192; rpb2: LT575063; tef1: AF160282. concolor Fusarium Reinking, Zentralbl. Bakteriol., 2. Abt. 89: 512. 1934. Synonym: Fusarium polyphialidicum Marasas et al., Mycologia 78: 678. 1986. Holotypus: IMI 112502. Ex-type culture: BBA 2607 = BBA 63601 = CBS 183.34 = DAOM 225131 = DSM 62179 = IMI 112502 = NRRL 13994. www.studiesinmycology.org REDELIMITED Type locality: Uruguay, Montevideo. Type substrate: Hordeum vulgare. Descriptions and illustrations: See Gerlach & Nirenberg (1982) and Marasas et al. (1986). Diagnostic DNA barcodes: rpb1: MH742492; rpb2: MH742569; tef1: MH742650. conglutinans Fusarium Wollenw., Ber. Deutsch. Bot. Ges. 31: 34. 1913. (See Fusarium oxysporum) Holotypus: Not located. Type locality: USA, Wisconsin. Type substrate: Brassica oleracea var. capitata. congoense Fusarium Wollenw., Fusaria Autogr. Delin. 1: 307. 1916. (See Fusarium heterosporum) Syntype: BPI 451889. Type locality: Democratic Republic of the Congo. Type substrate: Bromus willdenowii. Note: Synonyms fide Wollenweber & Reinking (1935). coniosporiicola Fusarium Henn., Ann. Mus. Congo Belge, Bot., S
er. 5, 2: 106. 1907. Dendrodochium coniosporiicola (Henn.) Hansf., Proc. Linn. Soc. London 155: 60. 1943. Synonym: Fusidium coniosporiicola (Henn.) Wollenw., Fusaria Autogr. Delin. 1: 477. 1916. Syntypes: In BR & S. Type locality: Democratic Republic of the Congo, Gongolo. Type substrate: Albizia aff. fastigiata. constrictum Fusarium Penz., Michelia 2: 486. 1882. Synonym: Ramularia constricta (Penz.) Wollenw., Fusarien: 322. 1935. Holotypus: Not located; destroyed fide U. Braun. Type locality: Italy, Padua. Type substrate: Leaves of Citrus sp. Notes: Status unclear. Neither Fusarium fide Wollenweber & Reinking (1935) nor Ramularia (pers. comm. U. Braun). contaminatum Fusarium L. Lombard & Crous, Persoonia 43: 20. 2018 [2019]. Holotypus: CBS H-23610. Ex-type culture: CBS 114899. Type locality: Germany, Schlüchtern. Type substrate: Pasteurised chocolate milk. Descriptions and illustrations: See Lombard et al. (2019b). Diagnostic DNA barcodes: rpb2: MH484901; tef1: MH484992. continuum Fusarium X. Zhou et al., Mycologia 108: 677. 2016. Holotypus: HMNWAFU NX-Ffpl-10-20100851. Ex-type culture: CBS 140841 = F201030 = NRRL 66286. Type locality: China, Shaanxi, Fuping, Lei village. Type substrate: Zanthoxylum bungeanum. Descriptions and illustrations: See Zhou et al. (2016). Diagnostic DNA barcodes: rpb1: KM520387; rpb2: KM236782; tef1: KM236722. convolutans Fusarium Sand.-Den. et al., MycoKeys 34: 77. 2018. Holotypus: CBS H-23495. Ex-type culture: CBS 144207 = CPC 33733. Type locality: South Africa, Kruger National Park, Skukuza, Granite Supersite. 103 CROUS ET AL. Type substrate: Rhizosphere of Kyphocarpa angustifolia. Descriptions and illustrations: See Sandoval-Denis et al. (2018b). Diagnostic DNA barcodes: rpb1: LT996193; rpb2: LT996141; tef1: LT996094. corallinum Fusarium Mattir., Atti Accad. Sci. Ist. Bologna, Cl. Sci. Fis., Mem. 6: 677. 1897, nom. illegit., Art. 53.1. (See Fusarium culmorum) Authentic material: Not located. Type locality: Italy. Type substrate: Andropogon sp. Note: Synonym fide Wollenweber (1931). corallinum Fusarium Sacc., Nuovo Giorn. Bot. Ital. 8: 196. 1876. (See Fusarium graminum) Holotypus: In PAD. Type locality: Italy, Treviso, Selva. Type substrate: Cynodon dactylon. cordae Fusarium Massee, Brit. Fung.-Fl. 3: 481. 1893. (See Fusarium oxysporum) Notes: Massee introduced this name to replace F. aurantiacum Corda, indicating that F. aurantiacum (Link) Sacc., based on Fusisporium aurantiacum Link (1809), predates Corda's use of the epithet. However, Corda's use of the epithet in Fusarium predates Saccardo's recombination into Fusarium. cortaderiae Fusarium O'Donnell et al., Fungal Genet. Biol. 41: 620. 2004. Holotypus: BPI 843479. Ex-type culture: CBS 119183 = ICMP 5435 = NRRL 29297. Type locality: New Zealand, Auckland, Henderson. Type substrate: Cortaderia selloana. Descriptions and illustrations: See O'Donnell et al. (2004). Diagnostic DNA barcodes: rpb1: KM361644; rpb2: KM361662; tef1: AY225885. crassistipitatum Fusarium Scandiani et al., Mycoscience 53: 171. 2011. (See Fusarium azukiicola) Holotypus: BPI 871490. Ex-type culture: MAFF 239757 = NRRL 36877. Type locality: Argentina, Santa Fe, Zavalla. Type substrate: Glycine max. Descriptions and illustrations: See Aoki et al. (2012a). Diagnostic DNA barcodes: rpb2: FJ240405; tef1: FJ240351. crassum Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 1. 2020. Neocosmospora crassa Sand.-Den. & Crous, Persoonia 43: 122. 2019. Holotypus: CBS H-23976. Ex-type culture: CBS 144386 = MUCL 11420. Type locality: France, Paris. Type substrate: Unknown. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW218109; rpb2: LR583823; tef1: LR583604. croceum Fusarium J.W. Xia et al., Persoonia 43: 201. 2019. Holotypus: CBS H-24055. Ex-type culture: CBS 131777. Type locality: Iran, Golestan Province, Gonbad-e Qabus. Type substrate: Triticum sp. 104 Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb2: MN170396; tef1: MN170463. croci Fusarium (Guarnaccia, Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 1. 2020. Basionym: Neocosmospora croci Guarnaccia, Sand.-Den. & Crous, Persoonia 40: 17. 2017. (See Fusarium citrulli Sartory) Holotypus: CBS H-23022. Ex-type culture: CBS 142423 = CPC 27186. Type locality: Italy, Sicily, Catania, Patern
o. Type substrate: Citrus sinensis. Descriptions and illustrations: See Sandoval-Denis et al. (2018a). Diagnostic DNA barcodes: rpb2: LT746329; tef1: LT746216. cromyophthoron Fusarium Sideris, Phytopathology 14: 212. 1924. (See Fusarium oxysporum) Lectotypus (hic designatus, MBT 10000673): USA, California, Stockton, roots of Allium sp.,1924, C.P. Sideris, in Phytopathology 14, pl. IX. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. crookwellense Fusarium L.W. Burgess et al., Trans. Brit. Mycol. Soc. 79: 498. 1982. (See Fusarium cerealis (Cooke) Sacc.) Holotypus: FRC R-3090. Ex-type culture: NRRL 13163. Type locality: Australia, New South Wales, Crookwell. Type substrate: Solanum tuberosum tubers. Descriptions and illustrations: See Burgess et al. (1982). Note: See Notes under F. cerealis. cruentum Fusarium Teich, Byull. Sredne-Aziatsk. Gosud. Univ. 19: 178. 1934. Holotypus: Not located. Type locality: Uzbekistan, Tashkent. Type substrate: Roots and stems of Vitis vinifera. Notes: Status unclear. This species was not treated by any of Wollenweber & Reinking (1935), Raillo (1950), Bilaĭ (1955), Booth (1971), Joffe (1974), or Gerlach & Nirenberg (1982). Furthermore, no additional records could be located. cryptoseptatum Fusarium (Sand.-Den. & Crous) O'Donnell, Index Fungorum 440: 1. 2020. Neocosmospora cryptoseptata Sand.-Den. & Crous, Persoonia 43: 122. 2019. Holotypus: CBS H-23977. Ex-type culture: BBA 65024 = CBS 145463 = NRRL 22412. Type locality: French Guiana. Type substrate: Bark. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834215; rpb2: EU329510; tef1: AF178351. cryptum Fusarium McAlpine, Fungus Diseases of Citrus trees in Australia: 106. 1899. (See Fusarium larvarum) Holotypus: VPRI 2557. Type locality: Australia, South Australia. Type substrate: Twigs of Citrus limonia. FUSARIUM Note: Synonym fide Wollenweber & Reinking (1935). cubense Fusarium E.F. Sm., Science, N.Y. 31: 754. 1910. (See Fusarium oxysporum) Holotypus: Not located. Type locality: Cuba. Type substrate: Musa sp. Note: Synonym fide Wollenweber & Reinking (1935). cucumerinum Fusarium Berk. & Broome, Ann. Mag. Nat. Hist., ser. 4, 17: 141. 1876. Holotypus: ?K(M). Type locality: UK, Northamptonshire, Daventry, Sibbertoft. Type substrate: Diseased Cucumis sativus. Notes: Status unclear. Wollenweber & Reinking (1935) synonymised this species under Septomyxa persicina. In contrast, Index Fungorum indicates that this species is a synonym under F. oxysporum. The original protologue (Berkeley & Broome 1876) fits neither S. persicina nor F. oxysporum. cucurbitae Fusarium Taubenh., Bull. Texas Agric. Exp. Sta. 260: 27. 1920. Lectotypus (hic designatus, MBT 10000674): USA, Texas, Waller County, from squash, date unkown, J.J. Taubenhaus, in Bull. Texas Agric. Exp. Sta. 260: 30, fig. 8j. 1920. Notes: Based on the description and illustrations provided by Taubenhaus (1920), this species could represent F. oxysporum. However, recollection and epitypification are required to confirm this. No holotype specimen could be located and therefore an illustration is designated as lectotype. cucurbitariae Fusarium (Pat.) Sacc., Syll. Fung. 4: 708. 1886. (See Fusarium avenaceum) Basionym: Fusisporium cucurbitariae Pat., Rev. Mycol. (Toulouse) 3: 10. 1881. Holotypus: ?FH01093588. Type locality: France, Lons-le-Saunier. Type substrate: Diseased Cucumis sativus. Note: Synonym fide Wollenweber & Reinking (1935). cucurbitariae Fusarium Peyronel, Nuovo Giorn. Bot. Ital., n.s. 25: 436. 1918, nom. illegit., Art. 53.1. Holotypus: ?ROPV. Type locality: Italy, Piemonte, Riclaretto. Type substrate: Parasitic on perithecia of Camarosporidiella laburni (≡ Cucurbitaria laburni). Notes: Status unclear. Not treated by any of Wollenweber & Reinking (1935), Booth (1971), or Gerlach & Nirenberg (1982). cucurbiticola Fusarium O'Donnell et al., Index Fungorum 440: 2. 2020. Neocosmospora cucurbitae Sand.-Den. et al., Persoonia 43: 125. 2019. Synonyms: Fusarium solani f. cucurbitae W.C. Snyder & H.N. Hansen, Amer. J. Bot. 28: 740. 1941. Fusarium solani f. sp. cucurbitae W.C. Snyder & H.N. Hansen, Root rots caused by Phycomycetes 28: 740. 1941. Hypomyces solani f. cucurbitae W.C. Snyder & H.N. Hansen, Amer. J. Bot. 28: 741. 1941. Nectria haematococca var. cucurbitae (W.C. Snyder & H.N. Hansen) Dingley, New Zealand J. Agric. Res. 4: 337. 1961. Nectria solani f. cucurbitae (W.C. Snyder & H.N. Hansen) G.R.W. Arnold, Z. Pilzk. 37: 193. 1972. www.studiesinmycology.org REDELIMITED Holotypus: CBS H-23978. Ex-type culture: BBA 64411 = CBS 616.66 = NRRL 22399. Type locality: Netherlands. Type substrate: Cucurbita viciifolia. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834217; rpb2: LR583825; tef1: DQ247592. cugenangense Fusarium Maryani et al., Stud. Mycol. 92: 181. 2018 [2019]. Holotypus: InaCC F984 (preserved as metabolically inactive culture). Ex-type culture: InaCC F984. Type locality: Indonesia, West Java, Cianjur, Cugenang. Type substrate: Pseudostem of Musa var. Pisang Kepok. Descriptions and illustrations: See Maryani et al. (2019a). Diagnostic DNA barcodes: rpb1: LS479560; rpb2: LS479308; tef1: LS479757. culmorum Fusarium (Wm.G. Sm.) Sacc., Syll. Fung. 10: 726. 1892. Basionym: Fusisporium culmorum Wm.G. Sm., Diseases of field and garden crops, chiefly as are caused by fungi: 209. 1884. Synonyms: Fusarium schribauxii Delacr., Bull. Soc. Mycol. France 6: 99. 1890. Fusarium corallinum Mattir., Atti Accad. Sci. Ist. Bologna, Cl. Sci. Fis., Mem. 6: 677. 1897, nom. illegit., Art. 53.1. Fusarium versicolor Sacc., Syll. Fung. 16: 1099. 1902. Fusarium heidelbergense Sacc., Ann. Mycol. 8: 346. 1910. ?Fusarium neglectum Jacz., Bull. Trimestriel Soc. Mycol. France 28: 348. 1912. Fusarium rubiginosum Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land-Forstw. 8: 108. 1910 [1913]. Fusarium culmorum var. leteius Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 242. 1915. Fusarium culmorum var. majus Wollenw., Fusaria Autogr. Delin. 2: 613. 1924. Lectotypus (hic designatus, MBT 10000675): UK, infected ear of Triticum sp., 1884, W.G. Smith, in Diseases of field and garden crops, chiefly as are caused by fungi: 210. fig. 92. Epitypus (hic designatus, MBT 10000676): Denmark, moldy kernel of Hordeum vulgare, 3 Feb. 1986, U. Thrane, CBS 417.86 (preserved as metabolic inactive culture). Ex-epitype culture: CBS 417.86 = FRC R-8504 = IMI 309344= NRRL 25475. Descriptions and illustrations: See Wollenweber & Reinking (1935), Booth (1971), Gerlach & Nirenberg (1982) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: JX171515; rpb2: JX171628; tef1: MW233082. Notes: No holotype specimen could be located. Therefore, an illustration is designated as lectotype and CBS 417.86 is designated as epitype as this isolate is commonly used as an authentic strain for F. culmorum in literature (Ward et al. 2002, O'Donnell et al. 2013, 2020, Geiser et al. 2021). cuneiforme Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 129. 1915. (See Fusarium ventricosum) Typus: ?CUP-007474. Type locality: USA, New York. Type substrate: Solanum tuberosum. 105 CROUS ET AL. Notes: Synonym fide Wollenweber & Reinking (1935) and Booth (1971). Lectotypification pending study of material lodged in CUP. cuneirostrum Fusarium O'Donnell & T. Aoki, Mycoscience 46: 170. 2005. (See Fusarium azukiicola) Holotypus: BPI 843353. Ex-type culture: FRC S-1551 = MAFF 239038 = NRRL 31157. Type locality: USA, Michigan, Presque Isle. Type substrate: Phaseolus vulgaris. Descriptions and illustrations: See Aoki et al. (2005). Diagnostic DNA barcodes: rpb1: KJ511271; rpb2: FJ240389; tef1: MAEA01003816. curvatum Fusarium L. Lombard & Crous, Persoonia 43: 21. 2018 [2019]. Holotypus: CBS H-23611. Ex-type culture: CBS 238.94 = NRRL 26422 = PD 94/184. Type locality: Netherlands. Type substrate: Beaucarnea sp. Descriptions and illustrations: See Lombard et al. (2019b). Diagnostic DNA barcodes: rpb1: MW928804; rpb2: MH484893; tef1: MH484984. cuticola Fusarium (R. Blanch.) Gu
eg., Champ. Paras. Homme: 262. 1904. (See Fusarium oxysporum) Basionym: Selenosporium cuticola R. Blanch., Compt. Rend. Hebd. S
eances Acad. Sci. 111: 479. 1890. Holotypus: Not located. Type locality: France. Type substrate: Skin of Chamaeleo vulgaris and Lacerta viridis (lizards). Notes: Synonym fide Wollenweber & Reinking (1935). Based on the substrate, this species could belong to the genus Bisifusarium. However, the protologue is not definitive, and recollection from type substrate is needed to confirm its taxonomic position. cyanescens Fusarium (G.A. de Vries et al.) O'Donnell et al., Index Fungorum 440: 2. 2020. Neocosmospora cyanescens (G.A. de Vries et al.) Summerb. et al., Biology of Microfungi (Cham): 183. 2016. Basionym: Phialophora cyanescens G.A. de Vries et al., Antonie van Leeuwenhoek 50: 150. 1984. Synonyms: Cylindrocarpon cyanescens (G.A. de Vries et al.) Sigler, J. Clin. Microbiol. 29: 1858. 1991. Holotypus: CBS 518.82 (maintained as metabolically inactive culture). Ex-type culture: CBS 518.82. Type locality: Netherlands, Groningen Province, Groningen. Type substrate: Subcutaneous tissue of the right foot of a male Homo sapiens. Descriptions and illustrations: See de Vries et al. (1984) and Zoutman & Sigler (1991). Diagnostic DNA barcodes: rpb1: MW218110; rpb2: LR583826; tef1: LR583605. cyanostomum Fusarium (Sacc. & Flageolet) O'Donnell & Geiser, Phytopathology 103: 404. 2013. Cyanonectria cyanostoma (Sacc. & Flageolet) Samuels & P. Chaverri, Mycol. Progr. 8: 56. 2009. 106 Basionym: Nectria cyanostoma Sacc. & Flageolet, Rendiconti Congr. Bot. Palermo 1902: 53. 1902. Lectotypus: BPI 551652, designated in Samuels et al. (2009). Epitypus: BPI 748307, designated in Samuels et al. (2009). Ex-epitype culture: BBA 70964 = CBS 101734 = G.J.S. 98-127. Epitype locality: France. Epitype substrate: Buxus sempervirens. Descriptions and illustrations: See Samuels et al. (2009). Diagnostic DNA barcodes: rpb1: JX171546; rpb2: HQ897759; tef1: HM626647. cyclogenum Fusarium Sacc., Nuovo Giorn. Bot. Ital. 8: 197. 1876. ?Gloeosporium orbiculare (Berk.) Berk., Just's Bot. Jahresber. 4: 1274. 1876. Basionym: Cytospora orbicularis Berk., Ann. Nat. Hist. 1: 207. 1838. Synonyms: Myxosporium orbiculare (Berk.) Berk., Outl. Brit. Fungol.: 325. 1860. Colletotrichum orbiculare (Berk.) Arx, Verh. Kon. Ned. Akad. Wetensch., Afd. Natuurk., Sect. 2, 51: 112. 1957, nom. inval., Art. 36.2 (Melbourne). Sirogloea orbicularis (Berk.) Arx, Verh. Kon. Ned. Akad. Wetensch., Afd. Natuurk., Sect. 2, 51: 113. 1957, nom. inval., Art. 36.2 (Melbourne). Syntypes: In BPI & S. Type locality: Italy, Treviso, Selva. Type substrate: Citrullus sp. Note: Cytospora orbicularis is not a Colletotrichum nor a Fusarium (small ellipsoidal conidia discharged in tendrils) as outlined in Damm et al. (2013). cydoniae Fusarium Allesch., Ber. Bot. Vereines Landshut 12: 130. 1892. (See Fusarium lateritium) Holotypus: In M. Type locality: Germany, München. Type substrate: Cydonia vulgaris. Note: Synonym fide Wollenweber & Reinking (1935). cydoniae Fusarium Roum. & Fautrey, Rev. Mycol. (Toulouse) 14: 170. 1892, nom. illegit., Art. 53.1, non Allescher 1892. (See Fusarium rollandianum) cydoniae Fusarium (Schulzer) Sacc. & Traverso, Syll. Fung. 19: 724. 1910, nom. illegit., Art. 53.1, non Allescher 1892, nec Roum. & Fautrey 1892. Basionym: Selenosporium cydoniae Schulzer, Verhand. K.K. Zool.-Bot. Ges. Wien 21: 1240. 1871. (See Fusarium lateritium) Holotypus: Not located. Type locality: Austria, Vienna. Type substrate: Cydonia vulgaris. Note: Synonyms fide Wollenweber & Reinking (1935). cylindricum Fusarium (Mont.) Sacc., Syll. Fung. 4: 720. 1886. Basionym: Fusisporium cylindricum Mont., Ann. Sci. Nat., Bot., s
er. 2, 17: 120. 1842. (See Fusarium candidum (Link) Sacc.) Holotypus: ?PC. Type locality: Cuba. Type substrate: Sarcocarp of unknown fruit. FUSARIUM Note: Synonyms fide Wollenweber & Reinking (1935). cymbiferum Fusarium Berk. & M.A. Curtis, in Berkeley, Grevillea 3: 98. 1875. Colletotrichum coccodes (Wallr.) S. Hughes, Canad. J. Bot. 36: 754. 1958. Basionym: Chaetomium coccodes Wallr., Fl. Crypt. Germ. 2: 265. 1833. Synonyms: Fusarium effusum Schwein., Trans. Amer. Philos. Soc., n.s. 4: 302. 1832 [1834]. Fusarium georginae Corda, Icon. Fung. 2: 4. 1838. Vermicularia atramentaria Berk. & Broome, Ann. Mag. Nat. Hist. 5: 378. 1850. Colletotrichum atramentarium (Berk. & Broome) Taubenh., Mem. New York Bot. Gard. 6: 554. 1916. Acrothecium solani Sacc., Michelia 1(3): 74. 1877. Fusisporium elasticae Thüm., Boll. Soc. Adriat. Sci. Nat. Trieste 3: 440. 1877. Fusarium elasticae (Thüm.) Sacc., Syll. Fung. 4: 711. 1886. Gloeosporium elasticae Cooke & Massee, in Cooke, Grevillea 18: 74. 1890. Fusarium foliicola Allesch., Hedwigia 34: 289. 1895. Gloeosporium foliicola (Allesch.) Wollenw., Fusarien: 325. 1935, nom. illegit., Art. 53.1. Colletotrichum solanicola O'Gara, Mycologia 7: 39. 1915. Colletotrichum biologicum Chaudhuri, Ann. Bot. 38: 735. 1924. Holotypus: ?K(M). Type locality: USA. Type substrate: Stems of some herbaceous plants. Note: Synonyms fide Wollenweber & Reinking (1935). cypericola Fusarium Henn., Hedwigia 48: 116. 1908. Libertella cypericola (Henn.) Wollenw., Fusaria Autogr. Delin. 1: 486. 1916. Syntype: In B fide Hein (1988). Type locality: Brazil, Par
a. Type substrate: Cyperus exaltatus. Note: Synonym fide Wollenweber & Reinking (1935). dactylidis Fusarium T. Aoki et al., Mycologia 107: 412. 2015. Holotypus: BPI 892886. Ex-type culture: CBS 119181 = ICMP 5269 = NRRL 29298. Type locality: New Zealand, Manawatu, Palmerston North. Type substrate: Dactylis glomerata. Descriptions and illustrations: See Aoki et al. (2015). Diagnostic DNA barcodes: rpb1: KM361654; rpb2: KM361672; tef1: DQ459748. decemcellulare Fusarium Brick, Jahresber. Vereinigung Angew. Bot. 6: 227. 1908. (See Fusarium colorans) Holotypus: ?HBG. Type locality: Cameroon. Type substrate: Theobroma cacao. decipiens Fusarium Cooke & Massee, in Cooke, Handb. Austral. Fungi: 388. 1892, nom. inval., Art. 39.1. (See Fusarium candidum (Link) Sacc.) Authentic material: ?K(M). Original locality: Australia, Queensland. Original substrate: Ficus aspera. Note: Synonym fide Wollenweber & Reinking (1935). deformans Fusarium J. Schröt., Jahresber. Schles. Ges. Vaterl. Cult. 61: 179. 1883. www.studiesinmycology.org REDELIMITED Gloeosporium deformans (J. Schröt.) Lind, Ann. Bot. 7: 19. 1908. Synonyms: Fusamen deformans (J. Schröt.) P. Karst., Bidrag K€annedom Finlands Natur Folk 51: 485. 1892. Calogloeum deformans (J. Schröt.) Nannf., Svensk Bot. Tidskr. 25: 25. 1931. Platycarpium deformans (J. Schröt.) Petr., Sydowia 7: 296. 1953. Holotypus: In B fide Wollenweber (1916–1935). Type locality: Poland, Breslau. Type substrate: Salix cinerea. Note: Synonyms fide Wollenweber & Reinking (1935). delacroixii Fusarium Sacc., Syll. Fung. 10: 725. 1892. (See Fusarium sambucinum) Replaced synonym: Fusarium asparagi Delacr., Bull. Soc. Mycol. France 6: 99. 1890, nom. illegit., Art. 53.1, non Fusarium asparagi Briard 1890. Lectotypus (hic designatus, MBT 10000677): France, Paris, Asparagus officinalis, 1890, M.G. Delaroix, in Bull. Soc. Mycol. France 6, pl. XV. fig. III. Notes: Synonyms fide Wollenweber & Reinking (1935). No holotype material is available for the replaced synonym F. asparagi Delacr. and therefore, an illustration from the original protologue is designated as lectotype. delphinoides Fusarium Schroers et al., Mycologia 101: 57. 2009. Bisifusarium delphinoides (Schroers et al.) L. Lombard & Crous, Stud. Mycol. 80: 224. 2015. Holotypus: CBS H-20124. Ex-type culture: CBS 120718 = NRRL 53290. Type locality: South Africa, Western Cape Province, Clanwilliam. Type substrate: Hoodia gordonii stem lesions. Descriptions and illustrations: See Schroers et al. (2009). Diagnostic DNA barcodes: rpb1: KM232210; tef1: EU926296. denticulatum Fusarium Nirenberg & O'Donnell, Mycologia 90: 445. 1998. Holotypus: B 70 0001691. Ex-type culture: BBA 67772 = CBS 407.97 = IMI 376115 = NRRL 25311. Type locality: USA, Louisiana. Type substrate: Ipomoea batatas. Descriptions and illustrations: See Nirenberg & O'Donnell (1998) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: MT010953; rpb2: MT010970; tef1: KR909385. derridis Fusarium Henn., Beibl. Hedwigia 41: (66). 1902. (See Fusarium coccidicola) Holotypus: In B fide Hein (1988). Type locality: Papua New Guinea. Type substrate: Derris sp. Note: Synonym fide Wollenweber & Reinking (1935). desaboruense Fusarium N. Maryani et al., Persoonia 43: 59. 2019. (See Fusarium sacchari) Holotypus: InaCC F951 (preserved as metabolically inactive culture). Ex-type culture: InaCC F951. Type locality: Indonesia, East Nusa Tenggara, Sikka Flores, Kecamatan Waigate, Desa Boru. Type substrate: Musa var. Pisang Kepok. Descriptions and illustrations: See Maryani et al. (2019b). 107 CROUS ET AL. Diagnostic DNA barcodes: rpb1: LS479870; rpb2: LS479852. desciscens Fusarium Oudem., Ned. Kruidk. Arch., 2 s
er., 5: 515. 1889. (See Fusarium sarcochroum) Holotypus: ?L. Type locality: Netherlands, Zuid-Holland Province, Den Haag, Scheveningen. Type substrate: Sarothamnus vulgaris. Note: Synonym fide Wollenweber & Reinking (1935). detonianum Fusarium Sacc. (as ‘de-tonianum’), Syll. Fung. 4: 708. 1886, nom. illegit., Art. 52.1. (See Fusarium miniatum Sacc.) Authentic material: Not located. Original locality: Italy. Original substrate: Sporangium of Cyathus vernicosa. dianthi Fusarium Prill. & Delacr., Compt. Rend. Hebd. S
eances Acad. Sci. 129: 745. 1899. (See Fusarium oxysporum) Holotypus: Not located. Type locality: France, Antibes. Type substrate: Dianthus caryophyllus. didymum Fusarium (Harting) Lindau, Rabenh. Krypt.-Fl. Ed. 2, 1(9): 574. 1909. Basionym: Fusisporium didymum Harting, Nieuwe Verh. Eerste Kl. Kon. Ned. Inst. Wetensch. Amsterdam 12: 228. 1846. (See Fusarium eichleri) Lectotypus (hic designatus, MBT 10000678): Netherlands, Solanum tuberosum, date unknown, Harting, in Nieuwe Verh. Eerste Kl. Kon. Ned. Inst. Wetensch. Amsterdam 12 (1846), tab. II, figs 2–4. Notes: Requires recombination into Neonectria after further investigation. No preserved specimen could be located and therefore an illustration is designated as lectotype. diffusum Fusarium Carmich., Grevillea 16: 81. 1888. (See Fusarium avenaceum) Holotypus: ?K(M). Type locality: UK, Scotland, Appin. Type substrate: Stems of Asteraceae (thristle). Note: Synonym fide Wollenweber & Reinking (1935). dimerum Fusarium Penz., Michelia 2: 484. 1882. Bisifusarium dimerum (Penz.) L. Lombard & Crous, Stud. Mycol. 80: 225. 2015. Synonyms: Fusarium aquaeductuum var. dimerum (Penz.) Raillo, Fungi of the Genus Fusarium: 279. 1950. Microdochium dimerum (Penz.) Arx, Trans. Brit. Mycol. Soc. 83: 374. 1984. ?Fusisporium flavum Fr., Syst. Mycol. 3: 444. 1832. ?Pionnotes flava (Fr.) Sacc., Syll. Fung. 4: 726. 1886. ?Fusarium flavum (Fr.) Wollenw., Z. Parasitenk. 3: 305. 1931. ?Fusarium aquaeductuum var. flavum (Fr.) Raillo, Fungi of the Genus Fusarium: 280. 1950. Selenosporium aurantiacum Bonord., Abh. Naturf. Ges. Halle 8: 97. 1864, nom. illegit., Art. 53.1. Fusarium bonordenii Sacc., Syll. Fung. 4: 699. 1886. Fusarium baptisiae Henn., Notizbl. Bot. Gart. Berlin 2: 383. 1899. Fusarium subnivale Höhn., in Penther & Zederbauer, Ann. K.K. Naturhist. Hofmus. 20: 369. 1905. Fusarium dimerum var. majusculum Wollenw., Fusaria Autogr. Delin. 1: 90. 1916. 108 ?Fusarium pusillum Wollenw., Fusaria Autogr. Delin. 2: 550. 1924. ?Fusarium dimerum var. pusillum (Wollenw.) Wollenw., Fusaria Autogr. Delin. 3: 851. 1930. Fusarium dimerum var. violaceum Wollenw., Fusaria Autogr. Delin. 3: 854. 1930. Lectotypus: Fig. 1212 in Penzig (1882), designated in Schroers et al. (2009). Epitypus: CBS H-20129, designated in Schroers et al. (2009). Ex-epitype culture: CBS 108944 = NRRL 36140. Epitype locality: Netherlands. Epitype substrate: Blood of Homo sapiens with acute myeloid leukemia. Descriptions and illustrations: See Schroers et al. (2009). Diagnostic DNA barcodes: rpb1: KM232212; rpb2: KM232363; tef1: EU926334. Note: Synonyms fide Wollenweber & Reinking (1935) and Booth (1971). diminutum Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 2. 2020. Neocosmospora diminuta Sand.-Den. & Crous, Persoonia 43: 127. 2019. Holotypus: CBS H-23979. Ex-type culture: CBS 144390 = MUCL 18798. Type locality: ?Ivory Coast. Type substrate: Treated wood of Coelocaryon preussii. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834218; rpb2: LR583828; tef1: LR583607. dimorphum Fusarium J.V. Almeida & Sousa da C^amara, Revista Agron. (Lisbon) 1: 306. 1903. (See Fusarium buxicola) Holotypus: MA-Funhist:6036-1. Type locality: Portugal. Type substrate: Buxus sempervirens. Note: Synonym fide Wollenweber & Reinking (1935). diplosporum Fusarium Cooke & Ellis, Grevillea 7: 38. 1878. (See Fusarium sarcochroum) Holotypus: ?K(M). Type locality: USA, New Jersey. Type substrate: Stems of Solanum tuberosum. Note: Synonym fide Wollenweber & Reinking (1935). discoideum Fusarium Fautrey & Roum., Rev. Mycol. (Toulouse) 13: 173. 1891. (See Fusarium lateritium) Syntype: ILL00220061 (Roumeguere, Fungi Sel. Gall. Exs. no. 5898). Type locality: France, Noidan. Type substrate: Sambucus nigra. Note: Synonym fide Wollenweber & Reinking (1935). discolor Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land-Forstw. 8: 114. 1913. (See Fusarium sambucinum) Holotypus: ?S-F45617. Type locality: Germany, Berlin. Type substrate: Solanum tuberosum. Note: Synonym fide Wollenweber & Reinking (1935). diversisporum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 161. 1915. FUSARIUM Typus: ?CUP-007430. Type locality: USA, New York. Type substrate: Solanum tuberosum Descriptions and illustrations: See Sherbakoff (1915) and Gerlach & Nirenberg (1982). Notes: This species is recognised by Gerlach & Nirenberg (1982) who considered isolate CBS 795.70 as authentic for F. diversisporum. However, typification of F. diversisporum first requires study of the specimen lodged in CUP. dlaminii Fusarium Marasas et al., Mycologia 77: 971. 1986 [1985]. Holotypus: DAOM 191112. Ex-type culture: ATCC 58097 = BBA 69859 = CBS 175.88 = DAOM 191112 = FRC M-1637 = IMI 290241 = MRC 3032 = NRRL 13164. Type locality: South Africa, Eastern Cape Province, Butterworth. Type substrate: Plant debris in soil. Descriptions and illustrations: See Marasas et al. (1985) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: KU171681; rpb2: KU171701; tef1: KU171721. domesticum Fusarium (Fr.) H.P. Bachm., LWT – Food Sci. Technol. 38: 405. 2005, nom. inval., Art. 41.5, See Art. 41.7. Bisifusarium domesticum (Fr.) L. Lombard & Crous, Stud. Mycol. 80: 225. 2015. Basionym: Trichothecium domesticum Fr., Syst. Mycol. 3: 427. 1832. Neotypus: CBS 434.34 (preserved as metabolically inactive culture), designated in Bachmann et al. (2005). Ex-neotype culture: ATCC 13417 = CBS 434.34 = MUCL 9826. Type locality: Belgium. Type substrate: Cheese. Descriptions and illustrations: See Schroers et al. (2009). dominicanum Fusarium Cif., Sydowia 9: 325. 1955 Holotypus: ?PAV. Type locality: Dominican Republic, Santo Domingo, Villa Altagracia. Type substrate: Byrsonima sp. (between mycelium of Meliola byrsonimae). Descriptions and illustrations: See Ciferri (1955). Notes: Ciferri (1955) considered this a ‘conventional’ species as the author indicated that more information based on culture characteristics is required. No living material of this species could be located and recollection from the type locality is required. duofalcatisporum Fusarium J.W. Xia et al., Persoonia 43: 201. 2019. Holotypus: CBS H-24056. Ex-type culture: CBS 384.92 = NRRL 36448. Type locality: Sudan, Nile Province. Type substrate: Seeds of Phaseolus vulgaris. Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb2: GQ505830; tef1: GQ505652. duoseptatum Fusarium Maryani et al., Stud. Mycol. 92: 181. 2018 [2019]. Holotypus: InaCC F916 (preserved as metabolically inactive culture). Ex-type culture: InaCC F916. www.studiesinmycology.org REDELIMITED Type locality: Indonesia, Central Kalimantan, Kapuas Timur, Anjir Serapat Tengah. Type substrate: Pseudostem of Musa var. Pisang Kepok. Descriptions and illustrations: See Maryani et al. (2019a). Diagnostic DNA barcodes: rpb1: LS479495; rpb2: LS479239; tef1: LS479688. echinatum Fusarium Sand.-Den. & G.J. Marais, Stud. Mycol. 98 (no. 100116): 47. 2021. Holotypus: CBS H-24658. Ex-type culture: CAMS 000733 = CBS 146497 = CPC 30815. Type locality: South Africa. Type substrate: Unidentified tree. Descriptions and illustrations: See this study. Diagnostic DNA barcodes: rpb1: MW834187; rpb2: MW834004; tef1: MW834273. echinosporum Fusarium Sibilia, Ann. Reale. Ist. Super. Agrar. Forest., ser. 2, 1: 77. 1925. Holotypus: Not located. Type locality: Italy. Type substrate: Cedrus deodara. Descriptions and illustrations: See Sibilia (1925). Notes: This species is recognised in Petrak's Lists V. 3. Wollenweber & Reinking (1935) mention this species, but they did not treat it any further. Booth (1971) considered it a possible synonym of F. graminearum. Requires recollection from the type locality and substrate. effusum Fusarium Schwein., Trans. Amer. Philos. Soc., n.s., 4: 302. 1832 [1834]. (See Fusarium cymbiferum) Holotypus: PH00062491. Type locality: USA, Pennsylvania, Northampton, Bethlehem. Type substrate: Hypericum frondosum. Note: Synonym fide Wollenweber & Reinking (1935). eichleri Fusarium Bres., Ann. Mycol. 1: 130. 1903. (See Fusarium candidum Ehrenb.) Holotypus: S-F45618. Type locality: Poland. Type substrate: Salix caprea. elaeidis Fusarium L. Lombard & Crous, Persoonia 43: 23. 2018 [2019]. Holotypus: CBS H-23612. Ex-type culture: CBS 217.49 = NRRL 36358. Type locality: Zaire. Type substrate: Elaeis sp. Descriptions and illustrations: See Lombard et al. (2019b). Diagnostic DNA barcodes: rpb1: MW928805; rpb2: MH484870; tef1: MH484961. elasticae Fusarium (Thüm.) Sacc., Syll. Fung. 4: 711. 1886. Basionym: Fusisporium elasticae Thüm., in Bolle & Thümen, Boll. Soc. Adriat. Sci. Nat. Trieste 3: 440. 1877. (See Fusarium cymbiferum) Lectotypus (hic designatus, MBT 10000679): Italy, Gorizia, Ficus elastica, 1877, F. de Thümen, in Bolle & Thümen, Boll. Soc. Adriat. Sci. Nat. Trieste 3, tab. I, fig. 13. Notes: Synonyms fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. 109 CROUS ET AL. elegans Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land-Forstw. 8: 94. 1913, nom. inval., Art. 36.1(a). (See Fusarium oxysporum) Notes: Appel and Wollenweber (l.c.) proposed this name only provisionally under Fusarium solani. They added an illustration of conidia on page 38 (fig. 2D). illegit., Art. 53.1. (See Fusarium sambucinum) Authentic material: Not located. Original locality: USA, Idaho. Original substrate: Soil. Note: Synonym fide Wollenweber & Reinking (1935). elegans Fusarium W. Yamam. & Maeda, Trans. Mycol. Soc. Japan 3: 115. 1962. Neocosmospora elegans (W. Yamam. & Maeda) Sand.-Den. & Crous, Persoonia 43: 127. 2019. Basionym: Nectria elegans W. Yamam. & Maeda, Hyogo Univ. Agric. ser. Agric. Biol. 3: 15. 1957. Synonyms: ?Fusarium solani f. xanthoxyli Y. Sakurai & Matuo, Ann. Phytopathol. Soc. Japan 26: 117. 1961, nom. inval., Art. 39.1. ?Hypomyces solani f. xanthoxyli Y. Sakurai & Matuo, Ann. Phytopathol. Soc. Japan 26: 117. 1961, nom. inval., Art. 39.1. Fusarium yamamotoi O'Donnell et al., Index Fungorum 440: 5. 2020. Lectotypus: figs 1–9, p. 16, in Yamamoto et al. (1957), designated in Sandoval-Denis et al. (2019). Epitypus: CBS H-23980, designated in Sandoval-Denis et al. (2019). Ex-epitype culture: ATCC 42366 = CBS 144396 = MAFF 238541 = NRRL 22277 = SUF XV-1. Epitype locality: Japan, Hyogo. Epitype substrate: Trunk of Zanthoxylum piperitum Diagnostic DNA barcodes: rpb1: MW218113; rpb2: FJ240380; tef1: AF178336 Note: This is a valid species name that is not a homonym since the name F. elegans Appel & Wollenw. is an invalid name. elongatum Fusarium Reinking, Zentralbl. Bakteriol. Parasitenk., Abt. 2, 89: 511. 1934, nom. illegit., Art. 53.1. (See Fusarium sublunatum) Authentic material: B 70 0100189. Original culture: CBS 190.34 = NRRL 20897. Original locality: Costa Rica. Original substrate: Soil from Musa sapientum and Theobroma cacao plantation. Diagnostic DNA barcodes: rpb1: KX302927; rpb2: KX302935; tef1: KX302919. Note: Synonym fide Wollenweber & Reinking (1935). eleocharidis Fusarium Rostr. (as ‘heleocharidis’), in Thümen, Mycoth. Univ., Cent. 22: no. 2185. 1883. (See Fusarium heterosporum) Syntypes: In BPI, NEB & S (Mycoth. Univ., Cent. 22: no. 2185). Type locality: Denmark, Fyn, Langeland. Type substrate: Eleocharis palustris. Notes: Synonym fide Wollenweber & Reinking (1935). elongatum Fusarium Cooke, Grevillea 19: 4. 1890. (See Fusarium ciliatum) Holotypus: In K(M), Colenso 538 fide Index Fungorum . Type locality: New Zealand. Type substrate: Twigs. Note: Synonym fide Wollenweber & Reinking (1935). elongatum Fusarium De Wild., Ann. Soc. Belge Microsc. 17: 42. 1893, nom illegit., Art. 53.1. Replacing synonym: Fusarium longissimum Sacc. & P. Syd., Syll. Fung. 14: 1128. 1899. Amniculicola longissima (Sacc. & P. Syd.) Nadeeshan & K.D. Hyde, IMA Fungus 7: 301. 2016. Synonyms: Anguillospora longissima (Sacc. & P. Syd.) Ingold, Trans. Brit. Mycol. Soc. 25: 402. 1942. Holotypus: Not located. Type locality: Belgium, Brussels, Botanical Garden. Type substrate: Submerged plant material. Note: Synonyms fide Rossman et al. (2016). elongatum Fusarium O.A. Pratt, J. Agric. Res. 13: 84. 1918, nom. 110 ensiforme Fusarium Wollenw. & Reinking, Phytopathology 15: 169. 1925. Synonym: Fusarium javanicum var. ensiforme (Wollenw. & Reinking) Wollenw., Z. Parasitenk. 3: 483. 1931. Fusarium javanicum subsp. ensiforme (Wollenw. & Reinking) Raillo, Fungi of the Genus Fusarium: 229. 1950. Holotypus: Not located. Type locality: Honduras. Type substrate: Rotten fruit of Ficus sp. Notes: Synonyms fide Wollenweber & Reinking (1935). Synonym of F. javanicum fide Gerlach & Nirenberg (1982). Status unclear [see Sandoval-Denis et al. (2019)]. entomophilum Fusarium Petch, Trans. Brit. Mycol. Soc. 11: 260. 1926. (See Fusarium lateritium) Holotypus: ?K(M). Type locality: Sri Lanka, Suduganga. Type substrate: Clitellaria heminopla. Note: Synonym fide Wollenweber & Reinking (1935). epicoccum Fusarium McAlpine, Fungus Diseases of Citrus trees in Australia: 113. 1899. (See Fusarium larvarum) Lectotypus (hic designatus, MBT 10000680): Australia, Victoria, Melbourne, Aspidiotus aurantium on Citrus deliciosa, 1899, D. McAlpine, in Fungus Diseases of Citrus trees in Australia, figs 177–180. Note: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. epimyces Fusarium Cooke, Grevillea 17: 15. 1888, nom. inval., Art. 38.1(a). (See Fusarium azukiicola) Authentic material: In K(M) fide Index Fungorum. Original locality: UK, Reading. Original substrate: Scleroderma sp. Note: Synonym fide Wollenweber & Reinking (1935). episphaeria Fusarium (Tode) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 32: 662. 1945. Dialonectria episphaeria (Tode) Cooke (as ‘episphærica’), Grevillea 12: 82. 1884. FUSARIUM Basionym: Sphaeria episphaeria Tode, Fung. Mecklenb. Sel. 2: 21. 1791. Synonyms: Nectria episphaeria (Tode) Fr., Summa Veg. Scand. 2: 388. 1849. Cucurbitaria episphaeria (Tode) Kuntze, Revis. Gen. Pl. 3: 461. 1898. Cosmospora episphaeria (Tode) Rossman & Samuels, Stud. Mycol. 42: 121. 1999. Hypoxylon phoeniceum Bull., Hist. Champ. France 1: 171. 1791. Sphaeria sanguinea var. media Fr., Syst. Mycol. 2: 453. 1823. Nectria episphaeria var. media (Fr.) Sacc., Syll. Fung. 2: 497. 1883. Dialonectria episphaeria var. verruculosa Cooke, Grevillea 12: 82. 1884. Nectria episphaeria var. verruculosa (Cooke) Berl. & Voglino, Syll. Fung., Addit. Vol. 1–4: 203. 1886. Nectria episphaeria var. kretzschmariae Henn., Bot. Jahrb. Syst. 14: 364. 1891. Nectria episphaeria var. gregaria Starb€ack, Ark. Bot. 5: 9. 1905. Lectotypus: L 0112704 (Herb. Lugd. Bat. 910267659 ex Herb. Persoon), selected in Booth (1959). Type locality: Unknown. Type substrate: Partially decorticated twig of Diatrype stigma. episphaericum Fusarium (Cooke & Ellis) Sacc., Syll. Fung. 4: 708. 1886. Basionym: Fusisporium episphaericum Cooke & Ellis, Grevillea 5: 50. 1876. Cosmospora nothepisphaeria (Samuels) Rossman & Samuels, Stud. Mycol. 42: 123. 1999. Basionym: Nectria nothepisphaeria Samuels, Mycol. Pap. 164: 30. 1991. Synonyms: Fusarium ciliatum var. episphaericum (Cooke & Ellis) Wollenw., Fusaria Autogr. Delin. 3: 871. 1930. Fusarium ciliatum var. majus Wollenw., Fusaria Autogr. Delin. 3: 872. 1930. Lectotypus (of Fusisporium episphaericum, hic designatus, MBT 10000681): USA, New Jersey, parasitic on Diatrypella sp. on Corylus avellana, 1876, M.C. Cooke & J.B. Ellis, in Grevillea 5, pl. 80, fig. 10. Note: No holotype specimen could be located and therefore an illustration is designated as lectotype. epistroma Fusarium (Höhn.) C. Booth (as ‘epistromum’), The Genus Fusarium: 66. 1971. Fusicolla epistroma (Höhn.) Gr€afenhan & Seifert, Stud. Mycol. 68: 100. 2011. Basionym: Dendrodochium epistroma Höhn., Sitzungsber. Kaiserl. Akad. Wiss. Wien. Math.-Naturwiss. Cl., Abt. 1., 118: 424. 1909. Lectotypus: B 700014042, designated in Gr€afenhan et al. (2011). Lectotype locality: Germany, Brandenburg, “Schmidt's Grund” near Tamsel. Lectotype substrate: Old stromata of Diatrypella favacea. Epitypus: IMI 85601, designated in Gr€afenhan et al. (2011). Ex-epitype culture: ATCC 24369 = BBA 62201 = NRRL 20439 = NRRL 20461. Epitype locality: UK, Yorkshire. Epitype substrate: Diatrypella on Betula. Diagnostic DNA barcode: rpb2: HQ897765. epithele Fusarium McAlpine, Fungus Diseases of Citrus trees in Australia: 80. 1899. www.studiesinmycology.org REDELIMITED (See Fusarium reticulatum) Holotypus: VPRI 2563. Type locality: Australia, New South Wales. Type substrate: Rotten fruit of Citrus x limon. Note: Synonym fide Wollenweber & Reinking (1935). equinum Fusarium Növgaard, Science, N.Y. 14: 899. 1901. Holotypus: Not located. Type locality: USA. Type substrate: Infected skin of Equus sp. (horse). Notes: Status unclear. Doubtful species fide Wollenweber & Reinking (1935). Based on the original substrate, this species might belong to the medically important genus Neocosmospora. However, recollection is required to confirm its taxonomic affiliation. equiseti Fusarium (Corda) Sacc., Syll. Fung. 4: 707. 1886. Basionym: Selenosporium equiseti Corda, Icon. Fung. 2: 7. 1838. Synonyms: Fusisporium ossicola Berk. & M.A. Curtis, Grevillea 3: 147. 1875. Fusarium ossicola (Berk. & M.A. Curtis) Sacc., Syll. Fung. 4: 714. 1886. Fusarium nectriae-palmicolae Henn., Bot. Jahrb. Syst. 23: 290. 1896. Fusarium gibbosum Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land-Forstw. 8: 190. 1910. Fusarium roseum var. gibbosum (Appel & Wollenw.) Messiaen & R. Cass., Ann. Inst. Natl. Rech. Agron. Tunisie 19: 435. 1968, nom. inval., Art. 41.5. Fusarium roseum var. gibbosum (Appel & Wollenw.) Messiaen & R. Cass., Agronomie 8: 220. 1988, nom. inval., Art. 41.1. Fusarium bullatum Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 198. 1915. Fusarium equiseti var. bullatum (Sherb.) Wollenw., Fusaria Autogr. Delin. 3: 916. 1930. Fusarium gibbosum var. bullatum (Sherb.) Bilaĭ, Mikrobiol. Zhurn. 49: 6. 1987. Fusarium bullatum var. roseum Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 201. 1915. Fusarium roseobullatum Wollenw. (as ‘roseo-bullatum'’), Fusaria Autogr. Delin. 1: 117. 1916. Fusarium vasinfectum var. pisi Schikora, Arbeiten. Biol. Anst. Land-Forstwirt. 5: 188, pl. 7. 1906, nom. illegit., Art. 53.1. Fusarium falcatum Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land-Forstw. 8: 184. 1910. Fusarium falcatum var. fuscum Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 138. 1915. Fusarium equiseti var. crassum Wollenw., Fusaria Autogr. Delin. 3: 921. 1930. Fusarium terrestre Manns, Bull. North Dakota Agric. Exp. Sta.: no. 259. 1932. Gibberella intricans Wollenw., Fusaria Autogr. Delin. 3: 810. 1930. Fusarium eucheliae Sartory, R. Sartory & J. Mey., Ann. Mycol. 30: 471. 1932. Fusarium equiseti var. intermedium Saccas, Agron. Trop. (Maracay) 10: 49. 1955, nom. inval., Art. 39.1. Lectotypus: (hic designatus, MBT 10001325): Czech Republic, Kuchelbad, near Prague, on stems of Equisetum sp., 1836, AKJ. Corda. Icon. Fung. 2, tab. IX, fig. 32. Epitypus (hic designatus, MBT 10000682): Germany, Braunschweig, Niedersachsen, soil, 3 Aug. 1994, H. I. Nirenberg, CBS H-5570. Ex-epitype culture: BBA 68556 = CBS 307.94 = NRRL 26419. 111 CROUS ET AL. Descriptions and illustrations: See Wollenweber & Reinking (1935), Booth (1971), Gerlach & Nirenberg (1982), Holubov
aJechov
a et al. (1994) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb2: GQ505777; tef1: GQ505599. Notes: Holubov
a-Jechov
a et al. (1994) incorrectly designated CBS 307.94 (CBS H-5570) as neotype for Selenosporium equiseti even though original material was available in PRM as well as an illustration provided in the protologue. A lectotypification rather than a neotypification was required. Therefore, the original illustration is selected as lectotype and CBS H-5570 (= CBS 307.94) is designated as epitype here, superseding the neotype designation. equiseticola Fusarium Allesch., Hedwigia 34: 289. 1895. (See Fusarium scirpi) Holotypus: In M. Type locality: Germany, Oberammergau. Type substrate: Dried stems of Equisetum limosum. Note: Synonym fide Wollenweber & Reinking (1935). equisetorum Fusarium Desm., Pl. Crypt. N. France: no. 1546/ 1846? 1843. Basionym: Hymenula equiseti Lib., Pl. Crypt. Arduenna 3: no. 236. 1834. (See Fusarium oxysporum) Syntypes: In BPI, BRU, CUP, ISC PH, S & UPS (Pl. Crypt. Arduenna 3: no. 236). Type locality: Belgium. Type substrate: Equisetum limosum. Notes: Synonym fide Wollenweber & Reinking (1935). ershadii Fusarium M. Papizadeh et al., Europ. J. Pl. Pathol. 151: 693. 2018, nom. illegit., Art. 52.1. Basionym: Cylindrocarpon tonkinense Bugnic., Encycl. Mycol. 11: 181. 1939. (See Fusarium tonkinense) erubescens Fusarium Berk. & M.A. Curtis, Grevillea 3: 98. 1875. Synonym: Fusarium alabamense Sacc., Syll. Fung. 4: 722. 1886, nom. illegit., Art. 52.1. Holotypus: ?K(M). Type locality: USA, Alabama, Beaumont. Type substrate: Dead bark. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). erubescens Fusarium (Durieu & Mont.) Sacc., Syll. Fung. 4: 719. 1886, nom. illegit., Art. 53.1. Basionym: Fusisporium erubescens Durieu & Mont., Exploration scientifique de l'Alg
erie 1–9: 351. 1848. (See Fusarium bacilligerum) Holotypus: ?PC. Type locality: Algeria, B
ejaïa. Type substrate: Rhamnus alaternus. Note: Synonym fide Wollenweber & Reinking (1935). erubescens Fusarium Appel & Oven, Landwirtsch. Jahrb. 1905, nom. illegit., Art. 53.1. (See Fusarium acuminatum) Authentic material: Not located. Original locality: Germany. Original substrate: Solanum lycopersicum. Note: Synonym fide Wollenweber & Reinking (1935). 112 eucalypticola Fusarium Henn., Hedwigia 40: 355. 1901. Holotypus: In B fide Hein (1988). Type locality: Australia, Western Australia, Cranbrook. Type substrate: Eucalyptus baxteri (syn. E. santalifolia) Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). eucalyptorum Fusarium Cooke & Harkn., Grevillea 9: 128. 1881. (See Fusarium oxysporum) Syntype: BPI 452103. Type locality: USA, California, San Francisco Masonic Cemetery. Type substrate: Eucalyptus sp. Note: Synonym fide Arya & Jain (1962). eucheliae Fusarium Sartory, R. Sartory & J. Mey., Ann. Mycol. 30: 471. 1932. (See Fusarium equiseti) Lectotypus (hic designatus, MBT 10000683): France, digestive track of living caterpillar, 1932, A. Sartory, R. Sartory & J. Meyer, in Ann. Mycol. 30: 473, figs 1–13. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. eumartii Fusarium C.W. Carp., J. Agric. Res. 5: 204. 1915. (See Fusarium solani) Lectotypus: Illustration Plate XIV, number 4, in Carpenter (1915), designated in Sandoval-Denis et al. (2019). Type locality: Unknown. Type substrate: Solanum tuberosum. euonymi Fusarium Syd., Beibl. Hedwigia 39: (6). 1900. (See Fusarium lateritium) Syntype: S-F45621 (Sydow, Mycoth. March. no. 4896). Type al locality: Germany, Berlin. Type substrate: Euonymus bungeanus. Note: Synonym fide Wollenweber & Reinking (1935). euonymi-japonici Fusarium Henn., Hedwigia 41: 139. 1902. (See Fusarium lateritium) Holotypus: In B fide Hein (1988). Type locality: Germany, Berlin. Type substrate: Euonymus japonicus. Note: Synonym fide Wollenweber & Reinking (1935). euwallaceae Fusarium S. Freeman et al., Mycologia 105: 1599. 2013. Neocosmospora euwallaceae (S. Freeman et al.) Sand.-Den. et al., Persoonia 43: 129. 2019. Holotypus: BPI 884203. Ex-type culture: CBS 135854 = NRRL 54722. Type locality: Israel, central coastal region, Kibbutz Glil Yam. Type substrate: Euwallacea sp. beetle infecting Persea americana cv. Hass. Descriptions and illustrations: See Freeman et al. (2013). Diagnostic DNA barcodes: rpb1: JQ038021; rpb2: JQ038028; tef1: JQ038007. expansum Fusarium Schltdl., Fl. Berol. 2: 139. 1824. Synonym: ?Fusarium carpini Schulzer & Sacc., Hedwigia 23: 128. 1884. Fusarium socium Sacc., Atti Ist. Veneto Sci. Lett. Arti, s
er. 6, 2: 450. 1884. FUSARIUM Fusarium cirrosum Höhn., Sitzungsber. Kaiserl. Akad. Wiss. Wien, Math.-Naturwiss. Cl., Abt. 1., 116: 153. 1907. Fusarium macounii Dearn., Mycologia 9: 363. 1917. Holotypus: HAL 1614 F. Type locality: Germany, Berlin. Type substrate: Carpinus betulus. Descriptions and illustrations: See Wollenweber (1916–1935) and Gerlach & Nirenberg (1982). Notes: Both Wollenweber & Reinking (1935) and Gerlach & Nirenberg (1982) recognised this species. This species requires epitypification from the type locality. fabacearum Fusarium L. Lombard et al., Persoonia 43: 24. 2018 [2019]. Holotypus: CBS H-23613. Ex-type culture: CBS 144743 = CPC 25802. Type locality: South Africa, Western Cape Province. Type substrate: Glycine max. Descriptions and illustrations: See Lombard et al. (2019b). Diagnostic DNA barcodes: rpb1: MW928806; rpb2: MH484938; tef1: MH485029. falcatum Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land-Forstw. 8: 184. 1913. Replaced synonym: Fusarium vasinfectum var. pisi Schikora, Arbeiten Biol. Anst. Land-Forstwirt. 5: 188, pl. 7. 1906, nom. illegit., Art. 53.1 (See Fusarium equiseti) Holotypus: Not located. Type locality: Germany, Berlin. Type substrate: Pisum sativum. Notes: Synonym fide Wollenweber & Reinking (1935). falciforme Fusarium (Carri
on) Summerb. & Schroers, J. Clin. Microbiol. 40: 2872. 2002. Neocosmospora falciformis (Carri
on) L. Lombard & Crous, Stud. Mycol. 80: 227. 2015. Basionym: Cephalosporium falciforme Carri
on, Mycologia 43: 523. 1951. Synonyms: Acremonium falciforme (Carri
on) W. Gams, Cephalosporium-artige Schimmelpilze: 139. 1971. Fusarium paranaense S.S. Costa et al., Fungal Biology 120: 55. 2015 [2016]. Holotypus: CBS 475.67 (preserved as metabolically inactive culture). Ex-type culture: CBS 475.67 = IHM 939 = IMI 268681. Type locality: Puerto Rico. Type substrate: Mycetoma from Homo sapiens. Diagnostic DNA barcodes: rpb1: MW218114; rpb2: LT960558; tef1: LT906669. fasciculatum Fusarium J.W. Xia et al., Persoonia 43: 203. 2019. Holotypus: CBS H-24057. Ex-type culture: CBS 131382. Type locality: Australia, Northern Territories, Roper River area. Type substrate: Stems of Oryza australiensis. Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb2: MN170406; tef1: MN170473. fautreyi Fusarium Sacc., Syll. Fung. 10: 934. 1892. Replaced synonym: Fusarium parasiticum Fautrey, Rev. Mycol. (Toulouse) 11: 153. 1889, nom. illegit., Art. 53.1. (See Fusarium lateritium) www.studiesinmycology.org REDELIMITED Typus: BR5020140789424. Type locality: France, Noidan. Type substrate: Vitis vinifera. Note: Synonyms fide Wollenweber & Reinking (1935). ferrugineum Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 2. 2020. Neocosmospora ferruginea Sand.-Den. & Crous, Persoonia 43: 130. 2019. Holotypus: CBS H-23981. Ex-type culture: CBS 109028 = NRRL 32437. Type locality: Switzerland. Type substrate: Subcutaneous nodule of Homo sapiens. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: HM347157; rpb2: EU329581; tef1: DQ246979. ferruginosum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 190. 1915. (See Fusarium acuminatum) Typus: ?CUP-007445. Type locality: USA, New York, Long Island Type substrate: Solanum tuberosum Notes: Synonym fide Wollenweber & Reinking (1935). Lectotypification pending study of material lodged in CUP. ficicrescens Fusarium Al-Hatmi et al., Fungal Biol. 120: 274. 2015 [2016]. Holotypus: CBS H-21815. Ex-type culture: CBS 125178. Type locality: Iran, Estahban. Type substrate: Fruit of Ficus carica. Descriptions and illustrations: See Al-Hatmi et al. (2016). Diagnostic DNA barcodes: rpb1: MT010950; rpb2: MT010977; tef1: MT011004. filiferum Fusarium (Preuss) Wollenw., Fusaria Autogr. Delin. 1: 220. 1916. Basionym: Fusoma filiferum Preuss, Linnaea 25: 73. 1852. Synonym: Fusarium scirpi var. filiferum (Preuss) Wollenw., Fusaria Autogr. Delin. 3: 936. 1930. (See Fusarium scirpi) Holotypus: Not located. Type locality: Germany. Type substrate: Bark of Pinus sp. Note: Synonym fide Wollenweber & Reinking (1935). filisporum Fusarium (Cooke) Sacc., Syll. Fung. 4: 708. 1886. Basionym: Fusisporium filisporum Cooke, Grevillea 8: 8. 1879. (See Fusarium ciliatum) Holotypus: In K(M), Muller s.n. fide Index Fungorum. Type locality: UK, Eastbourne. Type substrate: Orthotrichum sp. Note: Synonym fide Wollenweber & Reinking (1935). fissum Fusarium Peyl, Lotos 8: 30. 1858. (See Fusarium candidum (Link.) Sacc.) Lectotypus (hic designatus, MBT 10000684): Germany, twigs of Citrus aurantiacum, 1858, J. Peyl, in Lotos 8, fig. 17. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. flagelliforme Fusarium J.W. Xia et al., Persoonia 43: 204. 2019. Holotypus: CBS H-24058. 113 CROUS ET AL. Ex-type culture: CBS 162.57 = NRRL 36269. Type locality: Croatia, Zagreb. Type substrate: Seedlings of Pinus nigra. Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb2: GQ505823; tef1: GQ505645. flavidum Fusarium (Bonord.) Sacc., Syll. Fung. 4: 698. 1886. Basionym: Fusisporium flavidum Bonord., Bot. Zeitung (Berlin) 19: 194. 1861. (See Fusarium reticulatum) Lectotypus (hic designatus, MBT 10000685): Germany, rotten tree, 1861, H.F. Bonorden, in Bot. Zeitung (Berlin) 19: tab. VIII, fig. 3. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. flavum Fusarium (Fr.) Wollenw., Z. Parasitenk. (Berlin) 3: 305. 1931. Basionym: Fusisporium flavum Fr., Syst. Mycol. 3: 444. 1832. (See Fusarium dimerum) Holotypus: Not located. Type locality: Germany, Bonn. Type substrate: Aster sp. Note: Synonym fide Booth (1971). flocciferum Fusarium Corda, in Sturm, Deutschl. Fl., Abt. 3, Pilze Deutschl. 2: 17. 1828. Synonyms: Fusarium vinosum Massee, Brit. Fung.-Fl. 3: 479. 1893. Fusarium clavatum Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 234. 1915. Fusarium idahoanum O.A. Pratt, J. Agric. Res. 13: 86. 1918. Fusarium nigrum O.A. Pratt, J. Agric. Res. 13: 90. 1918. Lectotypus: (hic designatus, MBT 10001326) Germany, Berlin, on shell of the fruit of Aesculus hippocastanum. AKJ. Corda, Sturm, Deutschl. Fl., Abt. 3, Pilze Deutschl. 2, pl. 7. Epitypus (hic designatus, MBT 10000686): Germany, greenhouse soil, 1966, D. Bredemeier, CBS 821.68 (preserved as metabolically inactive culture). Ex-epitype culture: CBS 821.68 = NRRL 28450. Descriptions and illustrations: See Booth (1971) and Gerlach & Nirenberg (1982). Diagnostic DNA barcodes: rpb1: MW928807; rpb2: MW928824; tef1: MW928837. Notes: Corda's original illustration of Fusarium flocciferum is here selected as lectotype. Gerlach & Nirenberg (1982) considered isolate CBS 821.68, along with CBS 792.70, as good representatives of F. flocciferum. Based on their observations and collection locality, CBS 821.68 is designated as epitype of F. flocciferum. floridanum Fusarium T. Aoki et al., Mycologia 111: 922. 2019. Neocosmospora floridana (T. Aoki et al.) L. Lombard & Sand.Den., comb. nov. MycoBank MB 837664. Basionym: Fusarium floridanum T. Aoki et al., Mycologia 111: 922. 2019. Holotypus: BPI 910972. Ex-type culture: MAFF 246849 = NRRL 62628. Type locality: USA, Florida, Gainsville. Type substrate: Mycangium of Euwallacea interjectus infesting Acer negundo. Descriptions and illustrations: See Aoki et al. (2019). 114 Diagnostic DNA barcodes: rpb1: KC691593; rpb2: KC691624, KC691653; tef1: KC691535. Notes: A new combination is provided in the genus Neocosmospora based on the phylogenetic relationship (Aoki et al. 2019) of this species to other Neocosmospora spp. in the ambrosia clade. foeni Fusarium (Berk. & Broome) Sacc., Syll. Fung. 4: 699. 1886. Basionym: Fusisporium foeni Berk. & Broome, Ann. Mag. Nat. Hist., ser. 2, 7: 179. 1851. (See Fusarium merismoides) Holotypus: ?K(M). Type locality: UK, Northamptonshire, Apethrope. Type substrate: A hay stalk. Note: Synonym fide Wollenweber & Reinking (1935). foetens Fusarium Schroers et al., Mycologia 96: 398. 2004. Holotypus: CBS 110286 (preserved as metabolically inactive culture). Ex-type culture: CBS 110286 = NRRL 31852 = PD 2001/7244. Type locality: Netherlands, Zuid-Holland Province, Maasland. Type substrate: Begonia elatior hybrid. Descriptions and illustrations: See Schroers et al. (2004) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: MW928808; rpb2: MW928825; tef1: AY320087. foliicola Fusarium Allesch., Hedwigia 34: 289. 1895. (See Fusarium cymbiferum) Holotypus: In M. Type locality: Germany, Oberammergau. Type substrate: Arabis alpina. Note: Synonym fide Wollenweber & Reinking (1935). fracticaudum Fusarium Herron et al., Stud. Mycol. 80: 137. 2015. Holotypus: PREM 60895. Ex-type culture: CBS 137233 = CMW 25245. Type locality: Colombia, Risaralda, Angela Maria (Santa Rosa). Type substrate: Pinus maximinoi. Descriptions and illustrations: See Herron et al. (2015). Notes: Comparisons of recently generated sequences for the living ex-type (CBS 137233 = CMW 25245) of F. fracticaudum indicate a strain transposition or contamination by another Fusarium species. Therefore, this species needs to be recollected from the type locality and substrate or sequences need to be generated from the holotype specimen. fractiflexum Fusarium T. Aoki et al., Mycoscience 42: 462. 2001. Holotypus: NIAES 20515. Ex-type culture: MAFF 237529 = NRRL 28852. Type locality: Japan, Yamanashi, Enzan. Type substrate: Cymbidium sp. Descriptions and illustrations: See Aoki et al. (2001). Diagnostic DNA barcodes: rpb1: LR792578; rpb2: LT575064; tef1: AF160288. fractum Fusarium Sacc. & Cavara, Nuovo Giorn. Bot. Ital., n.s., 7: 308. 1900. (See Fusarium candidum (Link) Sacc.) Holotypus: In PAD. Type locality: Italy. Type substrate: Fagus sp. FUSARIUM Note: Synonym fide Wollenweber & Reinking (1935). fragrans Fusarium P. Crouan & H. Crouan, Fl. Finistere: 14. 1867. (See Fusarium candidum (Link) Sacc.) Holotypus: ?PC. Type locality: France. Type substrate: Salix sp. Note: Synonym fide Wollenweber & Reinking (1935). fraxini Fusarium Allesch., Ber. Bot. Vereines Landshut 12: 130. 1892. (See Fusarium sambucinum) Holotypus: In M. Type locality: Germany, München. Type substrate: Fraxinus excelsior. Note: Synonym fide Wollenweber & Reinking (1935). fraxini Fusarium Kab
at & Bub
ak, Fungi Imperf. Exs., no. 900. 1912, nom. illegit., Art. 53.1. Fusicoccum fraxini Sherb., Phytopathology 18: 148. 1928. Authentic material: BPI 451324. Original locality: Czech Republic. Original substrate: Fraxinus excelsior. fredkrugeri Fusarium Sand.-Den. et al., MycoKeys 34: 79. 2018. Holotypus: CBS H-23496. Ex-type culture: CBS 144209 = CPC 33747. Type locality: South Africa, Kruger National Park, Skukuza, Granite Supersite. Type substrate: Rhizosphere soil of Melhania acuminata. Descriptions and illustrations: See Sandoval-Denis et al. (2018b). Diagnostic DNA barcodes: rpb1: LT996199; rpb2: LT996147; tef1: LT996097. fructigenum Fusarium Fr., Syst. Mycol. 3: 471. 1832. (See Fusarium lateritium) Holotypus: Not located. Type locality: Unknown. Type substrate: Fruit of Rosa pomifera. Note: Synonym fide Wollenweber & Reinking (1935). fuckelii Fusarium Sacc., Syll. Fung. 4: 695. 1886. Geejayessia desmazieri (Becc. & De Not.) Schroers et al., Stud. Mycol. 68: 130. 2011. Basionym: Nectria desmazieri Becc. & De Not., Schem. di Classif. Sferiacei: 10. 1863. Synonyms: Dialonectria desmazieri (Becc. & De Not.) Petch, Naturalist (London): 281. 1937. Nectria coccinea var. cicatricum Desm., Ann. Sci. Nat., Bot 10: 351. 1848 (fide Wollenweber & Reinking 1935 and Booth 1971). Nectria gibbera Fuckel, Jahrb. Nassauischen Vereins Naturk. 23–24: 177. 1870. Lectotypus: G 00110886 (Fuckel, Fungi Rhen. No. 2357), designated in Schroers et al. (2011). Type locality: Germany, Rheingau. Type substrate: Buxus sempervirens. fujikuroi Fusarium Nirenberg, Mitt. Biol. Bundesanst. LandForstw. Berlin-Dahlem 169: 32. 1976 Synonyms: Lisea fujikuroi Sawada, Special Bull. Agric. Exp. Sta. Gov. Formosa 19: 251. 1919. Gibberella fujikuroi (Sawada) Wollenw., Z. Parasitenk. (Berlin) 3: 514. 1931. www.studiesinmycology.org REDELIMITED ?Gibberella fujikuroi var. subglutinans E.T. Edwards, Agric. Gaz. New South Wales 44: 895. 1933. ?Gibberella subglutinans (E.T. Edwards) P.E. Nelson et al., Fusarium species. An illustrated manual for identification (University Park): 135. 1983. ?Oospora cephalosporioides Luchetti & Favilli, Annali Fac. Agrar. R. Univ. Pisa 1: 399. 1938. ?Gibberella fujikuroi f. oryzae Saccas, Rev. Pathol. Veg. Entomol. Agric. France 30: 77. 1951. ?Gibberella fujikuroi var. intermedia Kuhlman, Mycologia 74: 766. 1982. Holotypus: IMI 202879. Ex-type culture: BBA 12428 = BBA 63630 = CBS 221.76 = IHEM 3821 = IMI 196086 = IMI 202879 = NRRL 13620 = NRRL 13998 = NRRL 22174. Type locality: Taiwan. Type substrate: Oryza sativa. Descriptions and illustrations: See Nirenberg (1976), Gerlach & Nirenberg (1982) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: JX171456; rpb2: JX171570; tef1: AF160279. fuliginosporum Fusarium Sibilia, Ann. Reale. Ist. Super. Agrar. Forest., ser. 2, 1: 77. 1925. Holotypus: Not located. Type locality: Italy. Type substrate: Forest containing mostly Cedrus deodara. Note: Mentioned by Wollenweber & Reinking (1935), but no additional records of this species could be located. fungicola Fusarium (Har. & P. Karst.) Sacc., Syll. Fung. 10: 730. 1892. ?Alysidium hypophleodes (Corda) Bonord., Handb. Allg. Mykol.: 35. 1851. Basionym: Fusidium hypophleodes Corda, Icon. Fung. 1: 3, tab. 1, fig. 50. 1837. Synonym: Fusamen fungicola Har. & P. Karst. (as ‘fungicolum’), Rev. Mycol. (Toulouse) 12: 129. 1890. Holotypus: Not located. Type locality: Finland, Mustiala. Type substrate: Lenzites betulina. Note: Synonyms fide Wollenweber & Reinking (1935). funicola Fusarium Tassi, Bull. Lab. Orto Bot. Reale Univ. Siena 3: 131. 1900. (See Fusarium graminearum) Holotypus: ?SIENA. Type locality: Italy. Type substrate: Rotten string. Note: Synonym fide Wollenweber & Reinking (1935). fusarioides Fusarium (Gonz. Frag. & Cif.) C. Booth, The Genus Fusarium: 88. 1971. Basionym: Dactylium fusarioides Gonz. Frag. & Cif., Bol. Real Soc. Esp. Hist. Nat. 27: 280. 1927. (See Fusarium chlamydosporum) Holotypus: ?MA-Funhist: 7609-1. Type locality: Dominican Republic, Moca. Type substrate: leaves of Crotalaria sp. Note: Synonym fide Gerlach & Nirenberg (1982). fuscum Fusarium (Bonord.) Sacc., Syll. Fung. 4: 699. 1886. Basionym: Selenosporium fuscum Bonord., Handb. Mykol.: 135. 1851. 115 CROUS ET AL. (See Fusarium citrulli Sartory) Holotypus: Not preserved fide Holubov
a-Jechov
a et al. (1994). Type locality: Germany. Type substrate: Bark. Note: Synonym fide Wollenweber & Reinking (1935). gaditjirrii Fusarium Phan et al., Stud. Mycol. 50: 265. 2004. Synonym: Gibberella gaditjirrii Phan et al., Stud. Mycol. 50: 264. 2004. Holotypus: DAR 76663. Ex-type culture: CBS 116011 = F15048 = NRRL 53678. Type locality: Australia, Queensland, Walkamin Research Station. Type substrate: Heteropogon triticeus. Descriptions and illustrations: See Phan et al. (2004). Diagnostic DNA barcodes: rpb2: HQ662690; tef1: AY639636. gallinaceum Fusarium Cooke & Harkn., Grevillea 9: 8. 1880. (See Fusarium merismoides) Holotypus: BPI 452133. Type locality: USA, California, Sausalito. Type substrate: Feathers of Gallus sp. (chicken). Note: Synonym fide Wollenweber & Reinking (1935). gamsii Fusarium Torbati et al., Mycol. Progr. 18: 127. 2018 [2019]. Holotypus: CBS H-23561. Ex-type culture: CBS 143610 = CPC 30862. Type locality: Iran, West Azerbaijan Province, Orumieh-Salmas. Type substrate: Agaricus bisporus. Descriptions and illustrations: See Torbati et al. (2019). Diagnostic DNA barcodes: rpb2: LT970760; tef1: LT970788. gaudefroyanum Fusarium Sacc., Michelia 2: 132. 1880. (See Fusarium avenaceum) Holotypus: In PAD. Type locality: France, Paris. Type substrate: Cyperaceae. Note: Synonym fide Wollenweber & Reinking (1935). gemmiperda Fusarium Aderh., Z. Pflanzenkrankh. 11: 70. 1901. (See Fusarium lateritium) Lectotypus (hic designatus, MBT 10000687): Germany, Prunus cerasus, 1901, R. Aderhold, in Z. Pflanzenkrankh. 11: pl. II, figs 1–4. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. genevense Fusarium Dasz., Bull. Soc. Bot. Geneve, s
er. 2, 4: 305. 1912. (See Fusarium sambucinum) Lectotypus (hic designatus, MBT 10000688): Switzerland, Geneva, from soil, 1912, M. Daszewska, in Bull. Soc. Bot. Geneve, s
er. 2, 4: 306, fig. 27. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. georginae Fusarium Corda, Icon. Fung. 2: 4. 1838. (See Fusarium cymbiferum) Typus: In PRM fide Pilat (1938). Type locality: Czech Republic, Prague. Type substrate: Dahlia sp. 116 Notes: Synonym fide Wollenweber & Reinking (1935). Lectotypification pending study of material lodged in PRM. gerlachii Fusarium T. Aoki et al., Fungal Genet. Biol. 44: 1202. 2007. Holotypus: BPI 871657. Ex-type culture: LRG 00-551 = NRRL 36905. Type locality: USA, Minnesota, Polk County, Climax. Type substrate: Triticum aestivum. Descriptions and illustrations: See Starkey et al. (2007). Diagnostic DNA barcodes: rpb1: KM361646; rpb2: KM361664; tef1: DQ459742. gibbosum Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: 190. 1910 [1913]. (See Fusarium equiseti) Holotypus: ?BPI 452135. Type locality: Germany, Berlin Type substrate: Solanum tuberosum Note: Synonym fide Booth (1971). gigas Fusarium Speg. Anales Soc. Ci. Argent. 22: 221. 1886. Holotypus: In LPS fide Farr (1973). Type locality: Paraguay. Type substrate: Bambusa sp. Descriptions and illustrations: See Wollenweber & Reinking (1935), Booth (1971) and Gerlach & Nirenberg (1982). Notes: This species requires epitypification. Wollenweber & Reinking (1935), Booth (1971), and Gerlach & Nirenberg (1982) accepted this species, although limited information is available. glandicola Fusarium Cooke & W.R. Gerard, Grevillea 7: 14. 1878. Tubercularia glandicola (Cooke & W.R. Gerard) Wollenw. & Reinking, Fusarien: 325. 1935. Holotypus: In K(M), Gerard s.n. fide Index Fungorum. Type locality: USA, New York. Type substrate: Acorns of Quercus sp. Note: Synonym fide Wollenweber & Reinking (1935). glandicola Fusarium Allesch., Ber. Bot. Vereines Landshut 12: 130. 1892, nom. illegit., Art. 53.1. Replacing synonym. Fusarium allescheri Sacc. & P. Syd., Syll. Fung. 14: 1128. 1899. (See Fusarium melanochlorum) Authentic material: In M. Original locality: Germany, München. Original substrate: Fruits of Quercus robur (syn. Q. pedunculata). Note: Synonyms fide Wollenweber & Reinking (1935). gleditschiae Fusarium Therry (as ‘gledrischiae’), in Roumeguere, Fungi Sel. Gall. Exs.: no. 5496. 1890, nom. nud., Art. 38.1(a). Gloeosporium gleditschiae Therry ex Wollenw., Z. Parasitenk. (Berlin) 3: 437. 1931. Note: Synonym fide Wollenweber & Reinking (1935). gleditschiicola Fusarium Dearn. & Barthol. (as ‘gleditsiaecolum’), Mycologia 9: 363. 1917. (See Fusarium lateritium) Holotypus: JD 4379 in DAOM. Type locality: USA, Kansas, Stockton. Type substrate: Gleditsia triacanthos. Note: Synonym fide Wollenweber & Reinking (1935). FUSARIUM globosum Fusarium Rheeder et al., Mycologia 88: 509. 1996. Holotypus: BPI 802834. Ex-type culture: CBS 428.97 = DOAM 214966 = FRC M8014 = IMI 375330 = MRC 6647 = NRRL 26131 = PREM 51878. Type locality: South Africa, Eastern Cape Province, Butterworth district, Teko Experimental Farm. Type substrate: Zea mays. Descriptions and illustrations: See Rheeder et al. (1996) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: KF466396; rpb2: KF466406; tef1: KF466417. globulosum Fusarium Pass., in Rabenhorst, Fungi Eur. Exs. no. 2262. 1877. Syntypes: In BPI, CUP, ILL & S (Fungi Eur. Exs. # 2262). Type locality: Italy, Parma. Type substrate: Salvia verticillata. Note: Not Fusarium fide Wollenweber & Reinking (1935). gloeosporioides Fusarium Speg. (as ‘gloeosporoide’), Anales Mus. Nac. Hist. Nat. Buenos Aires 6: 350. 1898 [1899]. (See Fusarium incarnatum) Holotypus: In LPS fide Farr (1973). Type locality: Argentina, La Plata. Type substrate: Fruits of Passiflora tweediana. Note: Synonym fide Wollenweber & Reinking (1935). gloeosporioides Fusarium (Speg.) Sacc. & Trotter, Syll. Fung. 22: 1482. 1913, nom. illegit., Art. 53.1. Basionym: Selenosporium gloeosporioides Speg. (as ‘gloesporioides’), Anales Mus. Nac. Hist. Nat. Buenos Aires 13: 458. 1911. (See Fusarium lateritium) Holotypus: In LPS (Myc. Argent. ser. 5, no. 1167) fide Farr (1973). Type locality: Argentina, Buenos Aires. Type substrate: Pircunia dioica. Note: Synonym fide Wollenweber & Reinking (1935). glumarum Fusarium Sacc., Syll. Fung. 4: 706. 1886. Replaced synonym: Fusarium pallens Berk. & M.A. Curtis, Grevillea 3: 99. 1875, nom. illegit., Art. 53.1, non Fusarium pallens Nees & T. Nees 1818. (See Fusarium incarnatum) Syntype: CBRU00007755. Type locality: USA. Type substrate: Juncus sp. Note: Synonym fide Wollenweber & Reinking (1935). glycines Fusarium L. Lombard et al., Persoonia 41: 25. 2018 [2019]. Holotypus: CBS H-23614. Ex-type culture: CBS 144746 = CPC 25808. Type locality: South Africa, North West Province. Type substrate: Glycine max. Descriptions and illustrations: See Lombard et al. (2019b). Diagnostic DNA barcodes: rpb1: MW928809; rpb2: MH484942; tef1: MH485033. goolgardi Fusarium D.M. Robinson et al., Fungal Diversity 77: 357. 2015 [2016]. Holotypus: RGB5411. www.studiesinmycology.org REDELIMITED Ex-type culture: NRRL 66250 = RGB5411. Type locality: Australia, New South Wales, Bungonia State Conservation Area. Type substrate: Xanthorrhoea glauca. Descriptions and illustrations: See Laurence et al. (2016). Diagnostic DNA barcodes: rpb1: KP083270; rpb2: KP083280; tef1: KP101123. gossypinum Fusarium L. Lombard & Crous, Persoonia 41: 26. 2018 [2019]. Holotypus: CBS H-23615. Ex-type culture: CBS 116613. Type locality: Ivory Coast, Bouak
e. Type substrate: Gossypium hirsutum. Descriptions and illustrations: See Lombard et al. (2019b). Diagnostic DNA barcodes: rpb2: MH484909; tef1: MH485000. gracile Fusarium McAlpine, Proc. Linn. Soc. New South Wales 28: 554. 1903. (See Fusarium avenaceum) Holotypus: VPRI 2564. Type locality: Australia, Victoria, Sandringham. Type substrate: Flowering stem of Lobelia gibbosa. Note: Synonym fide Wollenweber & Reinking (1935). gracilipes Fusarium J.W. Xia et al., Persoonia 43: 205. 2019. Holotypus: CBS H-24059. Ex-type culture: NRRL 43635. Type locality: USA, Nebraska. Type substrate: Equus sp. (horse). Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb1: HM347188; rpb2: GQ505840; tef1: GQ505662. graminearum Fusarium Schwabe, Fl. Anhalt. 2: 285. 1839. Synonyms: Sphaeria zeae Schwein., Schriften Naturf. Ges. Leipzig 1: 48. 1822, non Fusarium zeae (Westend.) Sacc. 1886. Dothidea zeae (Schwein.) Schwein., Trans. Amer. Philos. Soc., n.s., 4: 230. 1832. Hendersoniopsis zeae (Schwein.) Woron., Fungal and Bacterial Diseases of Agricultural Plants: 255. 1922. Gibberella zeae (Schwein.) Petch, Ann. Mycol. 34: 260. 1936. Fusarium stictoides Durieu & Mont., Explor. Sci. Alg
erie 1: 334. 1848. Sphaeria saubinetii Durieu & Mont., Explor. Sci. Alg
erie 1: 479. 1849. Gibbera saubinetii (Durieu & Mont.) Mont., Syll. Gen. Sp. Crypt.: 252. 1856. Botryosphaeria saubinetii (Durieu & Mont.) Niessl, Verh. Naturf. Vereins Brünn 10: 195. 1872. Gibberella pulicaris subsp. saubinetii (Durieu & Mont.) Sacc., Michelia 1: 317. 1878. Gibberella saubinetii (Durieu & Mont.) Sacc., Michelia 1: 513. 1879. Fusisporium insidiosum Berk., Gard. Chron. 1860: 480. 1860. Fusarium insidiosum (Berk.) Sacc., Syll. Fung. 4: 707. 1886, nom. illegit., Art. 53.1. Gibberella saubinetii var. coronillae Sacc., Michelia 1: 513. 1879. Fusarium mollerianum Thüm., Inst. Coimbra 28: 263. 1881. Gibberella saubinetii subsp. pachyspora Sacc., Michelia 2: 74. 1880. 117 CROUS ET AL. Gibberella saubinetii var. pachyspora (Sacc.) Sacc., Syll. Fung. 2: 555. 1883. Fusarium caricis Oudem., Verslagen Meded. Afd. Natuurk. Kon. Akad. Wetensch., ser. 3, 7: 325. 1890. Fusarium graminearum var. caricis (Oudem.) Wollenw., Z. Parasitenk. (Berlin) 3: 365. 1931. ?Fusarium rhoicola Fautrey, Rev. Mycol. (Toulouse) 17: 171. 1895. Fusarium funicola Tassi, Bull. Lab. Orto Bot. Reale Univ. Siena 3: 131. 1900. Gibberella saubinetii f. acuum Feltgen, Vorstud. Pilzfl. Luxemburg, Nachtr. III: 303. 1903. Gibberella saubinetii var. acuum (Feltgen) Sacc. & D. Sacc., Syll. Fung. 17: 813. 1905. Gibberella saubinetii var. tetraspora Feltgen, Vorstud. Pilzfl. Luxemburg, Nachtr. III: 302. 1903. Gibberella saubinetii var. calami Henn., Beibl. Hedwigia 42: (79). 1903. Gibberella saubinetii var. mate Speg., Anales Mus. Nac. Hist. Nat. Buenos Aires 17: 129. 1908. ?Selenosporium bufonicola Speg., Anales Mus. Nac. Hist. Nat. Buenos Aires, ser. 3, 13: 458. 1910. ?Fusarium bufonicola (Speg.) Sacc. & Trotter, Syll. Fung. 22: 1486. 1913. Fusarium rostratum Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: 30. 1910 [1913]. Gibberella saubinetii var. flacca Wollenw., Z. Parasitenk. (Berlin) 3: 433. 1931. Lectotypus (hic designatus, MBT 10000689): Germany, inflorescence of Triticum sp., 1839, S.H. Schwabe, in Flora Anhaltina 2, tab. VI. fig. 7. Epitypus (hic designatus, MBT 10000690): Germany, Hordeum vulgare, 1988, L. Niessen, CBS 136009 (preserved as metabolically inactive culture). Ex-epitype culture: CBS 136009. Descriptions and illustrations: See Booth (1971), Gerlach & Nirenberg (1982) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: MW928810; rpb2: MW928826; tef1: MW928838. Notes: This well-known and economically important pathogen of gramineous hosts has a global distribution and is accepted as originally circumscribed. However, no type material is available for taxonomic reference. Therefore, a lectotype based on an illustration from the original protologue and an epitype is designated here to provide taxonomic stability for this species. graminum Fusarium Corda, Icon. Fung. 1: 3. 1837. Synonym: Fusarium herbarum var. graminum (Corda) Wollenw., Fusaria Autogr. Delin. 3: 891. 1930. Fusarium avenaceum var. graminum (Corda) Raillo, Fungi of the Genus Fusarium: 188. 1950. Fusarium corallinum Sacc., Nuovo Giorn. Bot. Ital. 8: 196. 1876. Lectotypus (hic designatus, MBT 10000691): Germany, gramineous plant, 1837, A.C.J Corda, in Icon. Fung. 1, tab. I, fig. 59. Descriptions and illustrations: See Wollenweber & Reinking (1935) and Gerlach & Nirenberg (1982). Notes: This species is recognised by Wollenweber & Reinking (1935) and Gerlach & Nirenberg (1982). Recollection from the type host and locality is required. No holotype specimen could be located and therefore an illustration is designated as lectotype. 118 granulare Fusarium Kalchbr., Crypt. Austro-Afric., no. 1068. 1874. (See Fusarium sambucinum) Holotypus: ?B 70 0100191 (Crypt. Austro-Afric., no. 1068). Type locality: South Africa, Eastern Cape Province, SomersetEast. Type substrate: Datura stramonium (syn. Datura tatula). Note: Synonym fide Wollenweber & Reinking (1935). granulosum Fusarium Ellis & Everh., Proc. Acad. Nat. Sci. Philadelphia 45: 466. 1894 [1893]. (See Fusarium avenaceum) Holotypus: Commons 2091 in NY. Type locality: USA, Delaware, New Castle, Mount Cuba. Type substrate: Smilax hispida. Note: Synonym fide Wollenweber & Reinking (1935). grosmichelii Fusarium Maryani et al., Stud. Mycol. 92: 176. 2018 [2019]. Holotypus: InaCC F833 (preserved as metabolically inactive culture). Ex-type culture: InaCC F833. Type locality: Indonesia, West Java, Bogor, Suakarya (Megamendung). Type substrate: Pseudostem of Musa acuminata var. Pisang Ambon Lumut. Descriptions and illustrations: See Maryani et al. (2019a). Diagnostic DNA barcodes: rpb1: LS479548; rpb2: LS479295; tef1: LS479744. guilinense Fusarium M.M. Wang et al., Persoonia 43: 80. 2019. Holotypus: HAMS 248037. Ex-type culture: CGMCC 3.19495 = LC12160. Type locality: China, Guangxi Province, Guilin. Type substrate: Leaf of Musa nana. Descriptions and illustrations: See Wang et al. (2019). Diagnostic DNA barcodes: rpb1: MK289831; rpb2: MK289747; tef1: MK289594. guttiforme Fusarium Nirenberg & O'Donnell, Mycologia 90: 446. 1998. Holotypus: B 70 0001690. Ex-type culture: BBA 69661 = CBS 409.97 = IMI 376113 = NRRL 25295. Type locality: Brazil. Type substrate: Ananas comosus. Descriptions and illustrations: See Nirenberg & O'Donnell (1998). Diagnostic DNA barcodes: rpb1: MT010938; rpb2: MT010967; tef1: KC514066. gymnosporangii Fusarium Jaap, Ann. Mycol. 14: 44. 1916. Nectria gymnosporangii (Jaap) Rossman, Mycotaxon 8: 515. 1979. Basionym: Calonectria gymnosporangii Jaap, Ann. Mycol. 14: 10. 1916. Synonyms: Bactridium gymnosporangii (Jaap) Wollenw., Fusaria Autogr. Delin. 1: 458. 1916. Cylindrocarpon gymnosporangii (Jaap) Rossman, Mycol. Pap. 150: 31. 1983. Holotypus: In HBG fide Rossman (1979). Type locality: Croatia, Dalmatia, Lapad near Ragusa. Type substrate: Parasitic on Gymnosporangium confusum on Juniperus phoenicea branches. FUSARIUM haematococcum Fusarium Nalim et al., Mycologia 103: 1322. 2011. Neocosmospora haematococca (Berk. & Broome) Samuels et al., Mycologia 103: 1322. 2011. Basionym: Nectria haematococca Berk. & Broome, J. Linn. Soc., Bot. 14: 116. 1875. Synonyms: Dialonectria haematococca (Berk. & Broome) Cooke, Grevillea 12: 110. 1884. Cucurbitaria haematococca (Berk. & Broome) Kuntze, Revis. Gen. Pl. 3: 461. 1898. Hypomyces haematococcus (Berk. & Broome) Wollenw., Angew. Bot. 8: 191. 1926. Haematonectria haematococca (Berk. & Broome) Samuels & Nirenberg, Stud. Mycol. 42: 135. 1999. ?Nectria lanata Pat., Bull. Soc. Mycol. France 8: 52. 1892 (fide Samuels 1976). ?Nectria aurantiella Speg., Anales Mus. Nac. Hist. Nat. Buenos Aires 6: 287. 1898. ?Nectria episphaerioides Penz. & Sacc., Malpighia 11: 511. 1898 [1897]. ?Nectria cinnabarina var. jaraguensis Höhn., Denkschr. Kaiserl. Akad. Wiss. Wien, Math.-Naturwiss. Kl. 83: 18. 1907. ?Nectria bogoriensis C. Bernard, Bull. D
ep. Agric. Indes N
eerl. 11: 45. 1907. ?Nectria victoriae Henn., in Rehm, Ann. Mycol. 5: 81. 1907, nom. inval., Art. 38.1(a). ?Nectria calonectricola Henn., Hedwigia 48: 105. 1908. ?Nectria citri Henn., Hedwigia 48: 104. 1908. ?Nectria luteococcinea Höhn., Sitzungsber. Kaiserl. Akad. Wiss. Wien, Math.-Naturwiss. Cl., Abt. 1. 118: 299. 1909. ?Nectria bainii var. hypoleuca Sacc., Nuovo Giorn. Bot. Ital. 23: 205. 1916. ?Nectria confluens Seaver, Sci. Surv. Porto Rico & Virgin Islands 8: 44. 1926, nom. illegit., Art. 53.1. Lectotypus: K(M) 252877, designated in Samuels (1976). Lectotype locality: Sri Lanka. Lectotype substrate: Unknown Epitypus: BPI 871363, designated in Nalim et al. (2011). Ex-epitype culture: CBS 119600 = FRC S-1832. Epitype locality: Sri Lanka, Sabaragamuwa Province, Sinharaja Man and Biosphere Reserve, Morningside, vicinity Bungalow in forested slope. Epitype substrate: Dying tree. Descriptions and illustrations: See Nalim et al. (2011). Diagnostic DNA barcodes: rpb2: LT960561; tef1: KM231926. hainanense Fusarium M.M. Wang et al., Persoonia 43: 82. 2019. Holotypus: HAMS 248038. Ex-type culture: CGMCC 3.19478 = LC11638. Type locality: China, Hainan Province. Type substrate: Stem of Oryza sp. Descriptions and illustrations: See Wang et al. (2019). Diagnostic DNA barcodes: rpb1: MK289833; rpb2: MK289735; tef1: MK289581. hakeae Fusarium Henn., Verh. Bot. Vereins Prov. Brandenburg 40: 175. 1899. Gloeosporium hakeae (Henn.) Wollenw., Fusaria Autogr. Delin. 1: 494. 1916. Holotypus: In B fide Hein (1988). Type locality: Germany, Berlin. www.studiesinmycology.org REDELIMITED Type substrate: Hakea salicifolia. Note: Synonym fide Wollenweber & Reinking (1935). heidelbergense Fusarium Sacc., Ann. Mycol. 8: 346. 1910. (See Fusarium culmorum) Holotypus: In PAD. Type locality: Germany, Heidelberg. Type substrate: Cymbidium sp. Note: Synonym fide Wollenweber & Reinking (1935). helgardnirenbergiae Fusarium O'Donnell et al., Index Fungorum 440: 2. 2020. Neocosmospora nirenbergiana Sand.-Den. & Crous, Persoonia 43: 143. 2019. Holotypus: CBS H-23988. Ex-type culture: BBA 65023 = CBS 145469 = G.J.S. 87127 = NRRL 22387. Type locality: French Guiana. Type substrate: Bark of unidentified tree. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb2: EU329505; tef1: AF178339. helianthi Fusarium (Schwein.) Wollenw., Fusaria Autogr. Delin. 2: 555. 1924. Basionym: Vermicularia subeffigurata helianthi Schwein., Trans. Amer. Philos. Soc., n.s., 4: 228. 1832. (See Fusarium tricinctum) Holotypus: PH00078405. Type locality: Unknown. Type substrate: Helianthus annuus. Note: Synonyms fide Wollenweber & Reinking (1935). helotioides Fusarium Berk. & M.A. Curtis, in Berkeley, Grevillea 3: 98. 1875. Holotypus: ?K(M). Type locality: USA, Alabama. Type substrate: Ilex decidua (syn. Ilex prinoides). Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). hengyangense Fusarium (Z.Q. Zeng & W.Y. Zhuang) O'Donnell et al., Index Fungorum 440: 2. 2020. Neocosmospora hengyangensis Z.Q. Zeng & W.Y. Zhuang, Phytotaxa 319: 179. 2017. Holotypus: HMAS 254518. Ex-type culture: HMAS 248884. Type locality: China, Hunan, Hengyang, Gouloufeng. Type substrate: Twigs. Descriptions and illustrations: See Zeng & Zhuang (2017b). Diagnostic DNA barcodes: tef1: KY829448. herbarum Fusarium (Corda) Fr., Summa Veg. Scand. 2: 472. 1849. Basionym: Selenosporium herbarum Corda, Icon. Fung. 3: 34, tab. 6, fig. 88. 1839. (See Fusarium avenaceum) Typus: PRM 155731. Type locality: Czech Republic, Prague. Type substrate: Gramineous plant part. Note: Synonyms fide Wollenweber & Reinking (1935). Lectotypification pending study of material lodged in PRM. heteronemum Fusarium Berk. & Broome (as ‘heteronema’), Ann. Mag. Nat. Hist., ser. 3, 15: 402. 1865. (See Fusarium candidum (Link) Sacc.) 119 CROUS ET AL. Holotypus: ?K(M). Type locality: UK, Batheaston. Type substrate: Decaying Pyrus sp. Note: Synonym fide Wollenweber & Reinking (1935). heterosporioides Fusarium Fautrey, in Roumeguere, Fungi Sel. Gall. Exs. No. 5399. 1890 and Rev. Mycol. (Toulouse) 12: 126. 1890. Syntype: ILL00219542 (Roumeguere, Fungi Sel. Gall. Exs no. 5399). Type locality: France, Charny Type substrate: Sclerotium clavus on Glyceria fluitans. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). heterosporum Fusarium Nees & T. Nees, Nova Acta Phys.Med. Acad. Caes. Leop.-Carol. Nat. Cur. 9: 235. 1818. Synonyms: ?Fusarium leucoconium Corda, Icon. Fung. 1: 4. 1837. [fide Booth (1971)]. Sphaeria cyanea Sollm., Bot. Zeitung (Berlin) 21: 193. 1863. Botryosphaeria cyanea (Sollm.) Weese, Sitzungsber. Kaiserl. Akad. Wiss. Wien, Math.-Naturwiss. Cl., Abt. 1, 128: 707. 1919. Gibberella cyanea (Sollm.) Wollenw., Fusaria Autogr. Delin. 1: 39. 1919. Fusarium secalis F
ee, M
em. Soc. Mus. Hist. Nat. Strassbourg 3: 35. 1843. Fusarium eleocharidis Rostr. (as ‘heleocharidis’), in Thümen, Mycoth. Univ., Cent. 22, no. 2185. 1883. Fusisporium lolii Wm.G. Sm., Diseases of field and garden crops, chiefly as are caused by fungi: 213. 1884. Fusarium lolii (Wm.G. Sm.) Sacc., Syll. Fung. 11: 652. 1895. Fusarium heterosporum var. lolii (Wm.G. Sm.) Wollenw., Z. Parasitenk. (Berlin) 3: 349. 1931. Fusarium heterosporum f. paspali Ellis & Everh., in Ellis, North Amer. Fung., Ser. 2, no. 2395. 1886. Fusarium parasiticum Ellis & Kellerm., J. Mycol. 3: 127. 1887, nom. illegit., Art. 53.1. Fusarium pucciniophilum Sacc. & P. Syd., Syll. Fung. 14: 1128. 1899. Fusarium stromaticum Delacr., Bull. Soc. Mycol. France 9: 186. 1893. Fusarium paspalicola Henn., Monsunia 1: 38. 1899 [1900]. Fusarium heterosporum var. paspalicola (Henn.) Wollenw., Z. Parasitenk. (Berlin) 3: 349. 1931. Fusarium congoense Wollenw., Fusaria Autogr. Delin. 1: 307. 1916. Fusarium heterosporum var. congoense (Wollenw.) Wollenw., Z. Parasitenk. (Berlin) 3: 350. 1931. Fusarium heterosporum f. aleuritis Saccas & Drouillon (as ‘aleuritidis’), Agron. Trop. 6: 251. 1951. Gibberella gordonii C. Booth, The Genus Fusarium: 177. 1971. Lectotypus (hic designatus, MBT 10000692): Germany, sclerotium of Claviceps purpurea on a spike of Triticum sp., 1818, G.C.D. Nees von Esenbeck, in Nova Acta Phys.-Med. Acad. Caes. Leop.-Carol. Nat. Cur., tab. V. fig. 5. Epitypus (hic designatus, MBT 10000693): Germany, Rotenburg near Bremen, sclerotium of Claviceps purpurea on Lolium perenne, Aug. 1967, U.G. Schlösser, CBS 391.68 (preserved as metabolically inactive culture). Ex-epitype culture: CBS 391.68 = NRRL 25798. Descriptions and illustrations: See Wollenweber & Reinking (1935), Booth (1971), Gerlach & Nirenberg (1982) and Leslie & Summerell (2006). 120 Diagnostic DNA barcodes: rpb1: MW928811; rpb2: MW928827; tef1: MW928839. Notes: This species is recognised by Wollenweber & Reinking (1935), Gerlach & Nirenberg (1982), Booth (1971), and Leslie & Summerell (2006). Index Fungorum indicates that the correct name for this species is F. lolii. However, this name is not commonly used and considered as a synonym of F. heterosporum. Additionally, the epithet ‘heterosporum’ is older than the epithet ‘lolii’ and should have priority. No holotype specimen is available and therefore an illustration is designated as lectotype. heveae Fusarium Vincens, Bull. Soc. Pathol. V
eg. France 2: 19. 1915. (See Fusarium incarnatum) Holotypus: ?PC. Type locality: Brazil, Para. Type substrate: Hevea brasiliensis. Note: Synonym fide Wollenweber & Reinking (1935). hexaseptatum Fusarium Maryani et al., Stud. Mycol. 92: 183. 2018 [2019]. Holotypus: InaCC F866 (preserved as metabolically inactive culture). Ex-type culture: InaCC F866. Type locality: Indonesia, West Java, Sukabumi, Parakan Lima. Type substrate: Musa acuminata var. Pisang Ambon Kuning. Descriptions and illustrations: See Maryani et al. (2019a). Diagnostic DNA barcodes: rpb2: LS479359; tef1: LS479805. hibernans Fusarium Lindau, Rabenh. Krypt.-Fl., ed. 2, 1(9): 542. 1909, nom. superfl., Art. 52.1. Basionym: Fusarium nivale Ces. ex Berl. & Voglino, in Saccardo, Syll. Fung., Addit. I–IV: 390. 1886, non (Fr.) Sorauer, 1901. (See Fusarium nivale) Authentic material: Klotzsch, Herb. Viv. Mycol. no. 1439 in HAL. Original locality: Italy, Vercelli. Original substrate: Leaves of overwintered crop. Note: Synonyms fide Wollenweber & Reinking (1935). hippocastani Fusarium (Corda) Sacc., Syll. Fung. 4: 703. 1886. Basionym: Selenosporium hippocastani Corda, Icon. Fung. 2: 7. 1838. (See Fusarium acuminatum) Lectotypus (hic designatus, MBT 10000694): Czech Republic, Prague, Aesculus hippocastanum, 1836, A.C.J. Corda, in Icon. Fung. 2: tab. IX. fig. 31. Notes: According to Pilat (1938) and Holubov
a-Jechov
a et al. (1994), no material was preserved in PRM. Therefore, an illustration is selected as lectotype. hoodiae Fusarium L. Lombard et al., Persoonia 41: 27. 2018 [2019]. Holotypus: CBS H-23616. Ex-type culture: CBS 132474. Type locality: South Africa, Northern Cape Province, Prieska. Type substrate: Root of Hoodia gordonii. Descriptions and illustrations: See Lombard et al. (2019b). Diagnostic DNA barcodes: rpb2: MH484929; tef1: MH485020. hordearium Fusarium Ducomet, Rech. D
evel. Champ. Parasit.: 87. 1907. Holotypus: ?MPA. Type locality: France. FUSARIUM Type substrate: Unknown. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). hordei Fusarium (Wm.G. Sm.) Sacc., Syll. Fung. 11: 652. 1895. Basionym: Fusisporium hordei Wm.G. Sm., Diseases of field and garden crops, chiefly as are caused by fungi: 212. 1884. (See Fusarium sambucinum) Lectotypus (hic designatus, MBT 10000695): Denmark, Hordeum sp., 1884, W. G. Smith, in Diseases of field and garden crops, chiefly as are caused by fungi: 211, fig. 94. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype material could be located and therefore an illustration is designated as lectotype. hostae Fusarium Geiser & Juba, Mycologia 93: 672. 2001. Synonym: Gibberella hostae Geiser & Juba, Mycologia 93: 672. 2001. Holotypus: BPI 748169. Ex-type culture: FRC O-2074 = NRRL 29889. Type locality: USA, South Carolina. Type substrate: Hosta sp. Descriptions and illustrations: See Geiser et al. (2001). Diagnostic DNA barcodes: rpb1: JX171527; rpb2: JX171640; tef1: AY329034. humi Fusarium (Reinking) Nirenberg & Hagedorn, Nachrichtenbl. Deutsch. Pflanzenschutzdienstes 60: 215. 2008. Basionym: Fusarium tumidum var. humi Reinking, Zentralbl. Bakteriol., 2. Abth. 89: 513. 1934. Lectotypus (hic designatus, MBT 10000706): Honduras, soil, 1931, O.A. Reinking, in Wollenweber's Fusaria Autogr. Delin. no. 1152 of type culture 5236. Notes: This species is recognised by Wollenweber & Reinking (1935), Gerlach & Nirenberg (1982), and Nirenberg & Hagedorn (2008). Recollection from the type host and locality is required. No holotype material could be located and therefore an illustration is designated as lectotype. humicola Fusarium L. Lombard & Crous, Fungal Syst. Evol. 4: 191. 2019. Holotypus: CBS H-24016. Ex-type culture: ATCC 24372 = CBS 124.73 = IMI 128101 = NRRL 25535. Type locality: Pakistan. Type substrate: Soil. Descriptions and illustrations: See Lombard et al. (2019a). Diagnostic DNA barcodes: rpb1: MN120718; rpb2: MN120738; tef1: MN120757. humuli Fusarium M.M. Wang et al., Persoonia 43: 83. 2019. Holotypus: HAMS 248039. Ex-type culture: CGMCC 3.19374 = CQ1039. Type locality: China, Jiangsu Province. Type substrate: Leaves of Humulus scandens. Descriptions and illustrations: See Wang et al. (2019). Diagnostic DNA barcodes: rpb1: MK289840; rpb2: MK289724; tef1: MK289570. hydnicola Fusarium Ellis & Everh. (as ‘hydnicolum’), J. Mycol. 4(4–5): 45. 1888. Alysidium hypophleodes (Corda) Bonord., Handb. Mykol.: 35. 1851. www.studiesinmycology.org REDELIMITED Basionym: Fusidium hypophleodes Corda, Icon. Fung. 1: 3, tab. 1, fig. 50. 1837. Holotypus: NY (fide Index Fungorum). Type locality: USA, Missouri, Concordia. Type substrate: Bark of dead Hydnum membranaceum. Note: Synonym fide Wollenweber & Reinking (1935). hymenula Fusarium Pound & Clem., Bot. Surv. Nebraska 4: 7. 1896. Gloeosporium intermedium var. brevipes Sacc., Syll. Fung. 3: 703. 1884. Holotypus: NEB0040541. Type locality: USA, Nebraska. Type substrate: Helianthus sp. Notes: Synonym fide Wollenweber & Reinking (1935). The name is misspelled as ‘lymenula’ in the NEB database. hyperoxysporum Fusarium Wollenw., J. Agric. Res. 2: 268. 1914. (See Fusarium oxysporum) Holotypus: Not located. Type locality: USA. Type substrate: Ipomoea batatas. Note: Synonym fide Wollenweber & Reinking (1935). hypocreoideum Fusarium Cooke & Massee, Grevillea 16: 76. 1888. Aschersonia hypocreoidea (Cooke & Massee) Petch, Ann. Roy. Bot. Gard. (Peradeniya) 7: 255. 1922. Holotypus: K(M) 127920. Type locality: Australia, Queensland. Type substrate: Ficus aspera. hypodermium Fusarium (Link) Link, in Willdenow, Sp. Pl., ed. 4, 6: 96. 1825. Basionym: Fusidium hypodermium Link, Mag. Neuesten Entdeck. Gesammten Naturk. Ges. Naturf. Freunde Berlin 8: 31. 1816 [1815]. Marssonina aurantiaca (Link) Magnus, Hedwigia 45: 90. 1906. Basionym: Cryptosporium aurantiacum Link, in Willdenow, Sp. Pl., ed 4, 6: 96. 1825, nom. sanct. (Fries, Syst. Mycol. 3: 481. 1832). Synonyms: Fusidium aurantiacum (Link) Fr., Syst. Mycol. 3: 481. 1832. Gloeosporium aurantiacum (Link) Sacc., Syll. Fung. 3: 717. 1884. Marssonia aurantiaca (Link) Rostr., Bot. Tidsskr. 19: 217. 1895. Note: Synonyms fide Wollenweber & Reinking (1935). hypothenemi Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 2. 2020. Neocosmospora hypothenemi Sand.-Den. & Crous, Persoonia 43: 132. 2019. Holotypus: CBS H-23982. Ex-type culture: ARSEF 5878 = CBS 145464 = NRRL 52782. Type locality: Benin, Niaouli. Type substrate: Adult Hypothenemus hampei (coffee borer beetle). Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW218117; rpb2: JF741176; tef1: JF740850. idahoanum Fusarium O.A. Pratt, J. Agric. Res. 13: 86. 1918. (See Fusarium flocciferum) 121 CROUS ET AL. Lectotypus (hic designatus, MBT 10000707): USA, Idaho, soil, 1918, O.A. Pratt, in J. Agric. Res. 13: 87, fig. 2. Notes: Synonyms fide Wollenweber & Reinking (1935). No holotype material could be located and therefore an illustration is designated as lectotype. illosporioides Fusarium Sacc., Harriman Alaska Exped. 5: 15. 1904. (See Fusarium lateritium) Holotypus: In PAD. Type locality: USA, Alaska, Sitka. Type substrate: Ribes sp. Note: Synonym fide Wollenweber & Reinking (1935). illudens Fusarium C. Booth, The Genus Fusarium: 54. 1971. Neocosmospora illudens (Berk.) L. Lombard & Crous, Stud. Mycol. 80: 227. 2015. Basionym: Nectria illudens Berk., in Hooker, Bot. Antarct. Voy. II (Fl. Nov.-Zel.): 203. 1855. Synonyms: Cucurbitaria illudens (Berk.) Kuntze, Revis. Gen. Pl. 3: 461. 1898. Haematonectria illudens (Berk.) Samuels & Nirenberg, Stud. Mycol. 42: 136. 1999. Neotypus: PAD S00012, designated in Forin et al. (2020) Neotype locality: New Zealand. Neotype substrate: Bark of unknown host plant, “inaequale Fusarium” Auersw. Bot. Zeitung (Berlin) 8: 439. 1850, typographic error (see Notes). Ramularia rosea (Fuckel) Sacc., Fungi Ital. Del., Tab. 1001. 1881. Basionym: Fusidium roseum Fuckel, Fungi Rhen. Fasc. III, no. 219. 1863. Synonyms: Ovularia rosea (Fuckel) Massee, Brit. Fung.-Fl. 3: 323. 1893. Cylindrospora rosea (Fuckel) J. Schröt., in Cohn, Krypt.-Fl. Schles., Pilze II: 493. 1897. Fusidium inaequale Auersw., in Rabenh., Klotzschii Herb. Viv. Mycol., Cent. 14: no. 1383. 1850. Ramularia lucidae Davis, Trans. Wis. Acad. Sci. Art. Lett. 19: 687. 1919. Authentic material: Rabenh., Klotzschii Herb. Viv. Mycol. 1383 in HAL. Original locality: Germany, Leipzig. Original substrate: Salix amygdalina. Notes: Not Fusarium fide Wollenweber & Reinking (1935). This species was first published as Fusidium inaequale Auersw., in Rabenh., Klotzschii Herb. Viv. Mycol., Cent. 14: no. 1383, 1850. The description was repeated in Bot. Zeitung 8: 439, 1850 and Flora 33: 283, 1850 (in the latter publication also under Fusidium), so that in the simultaneous publication in “Botanische Zeitung” the “F.” was undoubtedly also meant to be Fusidium and not Fusarium. Syntype material deposited at HAL has recently been examined, and Fusidium inaequale turned out to be a heterotypic synonym of Ramularia rosea (Fuckel) Sacc (see Braun 1998). incarcerans Fusarium (Berk.) Sacc., Syll. Fung. 4: 713. 1886. Basionym: Fusisporium incarcerans Berk., Intellectual Observ. 2: 11. 1863. (See Fusarium avenaceum) Holotypus: ?K(M). Type locality: UK, Northamptonshire, Fotheringhay Castle. Type substrate: Orthotrichum sp. 122 Note: Synonym fide Wollenweber & Reinking (1935). incarnatum Fusarium (Roberge ex Desm.) Sacc., Syll. Fung. 4: 712. 1886. Basionym: Fusisporium incarnatum Roberge ex Desm., Ann. Sci. Nat., Bot., s
er. 3, 11: 274. 1849. Synonyms: Fusarium semitectum Berk. & Ravenel, Grevillea 3: 98. 1875. Pseudofusarium semitectum (Berk. & Ravenel) Matsush., Icon. Microfung. Matsush. Lect. (Kobe): 119. 1975. Fusarium pallens Berk. & M.A. Curtis, Grevillea 3: 99. 1875, nom. illegit., Art. 53.1, non Fusarium pallens Nees & T. Nees 1818. Fusarium glumarum Sacc., Syll. Fung. 4: 706. 1886 (nom. nov. for F. pallens Berk. & M.A. Curtis). Fusisporium pallidoroseum Cooke, Grevillea 6: 139. 1878. Fusarium pallidoroseum (Cooke) Sacc., Syll. Fung. 4: 720. 1886. Fusarium asparagi Briard, Rev. Mycol. (Toulouse) 12: 142. 1890. Fusarium gloeosporioides Speg. (as ‘gloeosporioide’), Anales Mus. Nac. Hist. Nat. Buenos Aires 6: 350. 1899. Fusarium juglandinum Peck, Bull. Torrey Bot. Club 36: 157. 1909. Fusarium heveae Vincens, Bull. Soc. Pathol. V
eg. France 2: 19. 1915. Fusarium tenuistipes Sacc., Atti Mem. Reale Accad. Sci. Lett. Arti, Padova 33: 195. 1917. Fusarium semitectum var. majus Wollenw., Fusaria Autogr. Delin. 3: 907–910. 1930. Fusarium semitectum var. violaceum Batikyan & Abramyan (as ‘violaceae’), Biol. Zhurn. Armenii 22: 58. 1969, nom. inval., Art. 39.1. Lectotypus: (hic designatus, MBT 10001327) France, from Tagetes erecta, 1848, M. Roberge in Desmazieres, Pl. Crypt. N. France,
ed 2, No. 1303, in PC. Epitypus: (hic designatus, MBT 10001328) Malawi, on Trichosanthes dioica, date unknown, H.M. Phiri, CBS H-24060. Ex-epitype culture: ATCC 24387 = CBS 132.73 = IMI 128222 = NRRL 25478. Descriptions and illustrations: See Booth (1971), Gerlach & Nirenberg (1982) and Xia et al. (2019). Diagnostic DNA barcodes: rpb2: MN170409; tef1: MN170476. Note: The epitypification of Fusarium incarnatum by Xia et al. (2019) was not effective as the holo- or lectotype was not correctly indicated (Art. 9.9). Here, a lectotype is selected and the epitypification is validated. inflexum Fusarium R. Schneid., in Schneider & Dalchow, Phytopathol. Z. 82: 80. 1975. Holotypus: DSM 63203. Ex-type culture: ATCC 32213 = BBA 63203 = CBS 716.74 = DAOM 225130 = DSM 63203 = IMI 375336 = NRRL 20433. Type locality: Germany, Hamburg, Vierlanden. Type substrate: Stem of Vicia faba. Descriptions and illustrations: See Schneider & Dalchow (1975) and Gerlach & Nirenberg (1982). Diagnostic DNA barcodes: rpb1: JX171469; rpb2: JX171583; tef1: AF008479. inseptatum Fusarium Schwein., Trans. Amer. Philos. Soc., n.s., 4: 302. 1832 [1834]. Holotypus: PH00062493. Type locality: USA, Pennsylvania, Bethlehem. FUSARIUM Type substrate: Daphne mezereum. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). insidiosum Fusarium Roum., Michelia 2: 132. 1880. (See Fusarium lateritium) Syntypes: In BR, CUP & ILL (Roum., Fungi Sel. Gall. Exs. No. 57). Type locality: France, Pyr
en
ees-Orientales, Environs de Perpignan. Type substrate: Phytolacca decandra. Note: Synonym fide Wollenweber & Reinking (1935). insidiosum Fusarium (Berk.) Sacc., Syll. Fung. 4: 707. 1886, nom. illegit., Art. 53.1. Basionym: Fusisporium insidiosum Berk., Gard. Chron. 1860: 480. 1860. (See Fusarium graminearum) Holotypus: ?K(M). Type locality: UK. Type substrate: Agrostis pulchella. Note: Synonyms fide Wollenweber & Reinking (1935). ipomoeae Fusarium M.M. Wang et al., Persoonia 43: 83. 2019. Holotypus: HAMS 248040. Ex-type culture: CGMCC 3. 19496 = LC12165. Type locality: China, Jiangsu Province. Type substrate: Leaves of Ipomoea aquatica. Descriptions and illustrations: See Wang et al. (2019). Diagnostic DNA barcodes: rpb1: MK289859; rpb2: MK289752; tef1: MK289599. iranicum Fusarium Torbati et al., Mycol. Progr. 18: 129. 2018 [2019]. Holotypus: CBS H-23560. Ex-type culture: CBS 143608 = CPC 30860. Type locality: Iran, West Azerbaijan Province, Orumieh-Salmas. Type substrate: Agaricus bisporus. Descriptions and illustrations: See Torbati et al. (2019). Diagnostic DNA barcodes: rpb2: LT970757; tef1: LT970785. iridis Fusarium Oudem., Ned. Kruidk. Arch., 2 s
er. 5: 515. 1889. (See Fusarium avenaceum) Holotypus: ?L. Type locality: Netherlands. Type substrate: Iris pseudacorus. Note: Synonym fide Wollenweber & Reinking (1935). irregulare Fusarium M.M. Wang et al., Persoonia 43: 84. 2019. Holotypus: HAMS 248041. Ex-type culture: CGMCC 3.19489 = LC7188. Type locality: China, Guangdong Province. Type substrate: Bambusoideae. Descriptions and illustrations: See Wang et al. (2019). Diagnostic DNA barcodes: rpb1: MK289863; rpb2: MK289783; tef1: MK289629. japonicum Fusarium Allesch., Beibl. Hedwigia 36: (164). 1897. (See Fusarium tortuosum) Syntype: S-F45631 (Sydow, Mycoth. March. no. 4592). Type locality: Germany, Berlin. Type locality: Prunus japonica. Note: Synonym fide Wollenweber & Reinking (1935). javanicum Fusarium Koord., Verh. Kon. Akad. Wetensch., Afd. Natuurk., Sect. 2, 13: 247. 1907. www.studiesinmycology.org REDELIMITED Holotypus: Not located. Type locality: Indonesia, Central Java, Purworejo. Type substrate: Ficus elastica. Note: Status unclear fide Sandoval-Denis et al. (2019). juglandinum Fusarium Peck, Bull. Torrey Bot. Club 36: 157. 1909. (See Fusarium incarnatum) Holotypus: NYSf1607. Type locality: USA, Kansas, Rooks, Stockton. Type substrate: Juglans nigra. Note: Synonym fide Wollenweber & Reinking (1935). junci Fusarium P. Crouan & H. Crouan, Fl. Finistere: 14. 1867. Holotypus: ?CO. Type locality: France, Paris. Type substrate: Juncus effusus. Note: ?Fusidium fide Wollenweber & Reinking (1935). jungiae Fusarium Pat., Bull. Soc. Mycol. France 11: 234. 1895. (See Fusarium avenaceum) Holotypus: FH00965356. Type locality: Argentina, San Jorge. Type substrate: Parasitic on Puccinia sp. on Jungia sp. Note: Synonym fide Wollenweber & Reinking (1935). juruanum Fusarium Henn., Hedwigia 43: 398. 1904. (See Fusarium coccidicola) Holotypus: In B. Type locality: Brazil, Rio Jurua. Type substrate: Annonaceae sp. Note: Synonym fide Gerlach & Nirenberg (1982). kalimantanense Fusarium Maryani et al., Stud. Mycol. 92: 187. 2018 [2019]. Holotypus: InaCC F917 (preserved as metabolically inactive culture). Ex-type culture: InaCC F917. Type locality: Indonesia, Central Kalimantan, Katingan, Pulau Malan. Type substrate: Musa acuminata var. Pisang Ambon. Descriptions and illustrations: See Maryani et al. (2019a). Diagnostic DNA barcodes: rpb1: LS479497; rpb2: LS479241; tef1: LS479690. kelerajum Fusarium Samuels et al., Mycologia 103: 1326. 2011. Neocosmospora keleraja Samuels et al., Mycologia 103: 1326. 2011. Holotypus: BPI 871413. Ex-type culture: FRC S-1839 = G.J.S. 02-122. Type locality: Sri Lanka, Minneriya Natl. Forest. Type substrate: Trunk of Yakuda marang. Descriptions and illustrations: See Nalim et al. (2011). Diagnostic DNA barcode: tef1: DQ247518. keratoplasticum Fusarium Geiser et al., Fung. Gen. Biol. 53: 68. 2013. Neocosmospora keratoplastica (Geiser et al.) Sand.-Den. & Crous, Persoonia 41: 120. 2018. Synonyms: Cephalosporium keratoplasticum T. Morik., Mycopathologia 2: 66. 1939, nom. inval., Art. 39.1. Hyalopus keratoplasticum T. Morik. ex M.A.J. Barbosa, Subsidios Para o Estudo Parasitologico do Genero Hyalopus Corda, 1838: 19. 1941, nom. inval., Art. 39.1. Fusarium sedimenticola M.M. Wang et al., Botanica Marina 63: 174. 2020. 123 CROUS ET AL. Holotypus: FRC S-2477. Ex-type culture: CBS 490.63 = FRC S-2477 = NRRL 22661. Type locality: USA, Virginia, Winchester. Type substrate: Indoor plumbing. Descriptions and illustrations: See Nalim et al. (2011). Diagnostic DNA barcodes: rpb1: MW218121; rpb2: JN235897; tef1: JN235712. konzum Fusarium Zeller et al., Mycologia 95: 947. 2003. Synonym: Gibberella konza Zeller et al., Mycologia 95: 947. 2003. Holotypus: DAR 76034. Ex-type culture: CBS 119849 = KSU 10653 = NRRL 53394. Type locality: USA, Kansas, Manhattan, Konza Praire Biological Station. Type substrate: Sorghastrum nutans. Descriptions and illustrations: See Zeller et al. (2003) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: LT996200; rpb2: LT996148; tef1: LT996098. kotabaruense Fusarium Maryani et al., Persoonia 43: 65. 2019. Holotypus: InaCC F963 (preserved as metabolically inactive culture). Ex-type culture: InaCC F963. Type locality: Indonesia, South Kalimantan, Kota Baru, Kecamatan Pamukan Barat, Desa Sungai Birah. Type substrate: Musa var. Pisang Hawa. Descriptions and illustrations: See Maryani et al. (2019b). Diagnostic DNA barcodes: rpb1: LS479875; rpb2: LS479859; tef1: LS479445. kuehnii Fusarium (Fuckel) Sacc., Syll. Fung. 4: 714. 1886. Basionym: Fusisporium kuehnii Fuckel, Fungi Rhen. Exs., Suppl., Fasc. 5, no. 1920. 1867. ?Athelia arachnoidea (Berk.) Jülich, Willdenowia 7: 53. 1972. (fide Gerlach & Nirenberg 1982) Basionym: Corticium arachnoideum Berk., Ann. Mag. Nat. Hist., ser. 1, 13: 345. 1844. Synonym: Fusisporium devastans J.G. Kühn, Krankh. Kulturgew.: 32. 1858, nom. inval., Art. 38.1(a). Syntype: Fuckel, Fungi Rhen. Exs., Suppl., Fasc. 5, 1920 (e.g., HAL). Type locality: Germany. Type substrate: Lichens and mosses. Notes: Status doubtful. Considered a possible synonym of F. dimerum by Booth (1971). kurdicum Fusarium Petr., Sydowia 13: 96. 1959. Cosmospora kurdica (Petr.) Rossman & Samuels, Stud. Mycol. 42: 122. 1999. Basionym: Calonectria kurdica Petr., Sydowia 13: 95. 1959. Synonyms: Nectria kurdica (Petr.) Rossman, Mycol. Pap. 150: 35. 1983. ?Stagonopsis sclerotioides Höhn., Ann. K. K. Naturhist. Hofmus. 20: 368. 1905. ?Botryocrea sclerotioides (Höhn.) Petr., Sydowia 3: 141. 1949. ?Fusarium sclerotioides (Höhn.) Samuels & Rossman, Mycol. Pap. 164: 23. 1991. Holotypus: K.H. Rechinger, 31 Jul. 1957, in W. Type locality: Iran, Kurdistan. Type substrate: Astragalus sp. Note: Synonyms fide Rossman et al. (1999). 124 kuroshium Fusarium F. Na et al., Plant Disease 102: 1159. 2018, nom. inval., Art. 40.7. Neocosmospora kuroshio F. Na et al. ex Sand.-Den. & Crous, Persoonia 43: 137. 2019. Holotypus: BPI 910340. Ex-type culture: CBS 142642 = UCR 3641. Type locality: USA, California, San Diego, El Cajon. Type substrate: Euwallacea sp. galleries in Platanus racemosa. Descriptions and illustrations: See Na et al. (2018). Diagnostic DNA barcodes: rpb1: KX262236; rpb2: KX262256; tef1: KX262216. kurunegalense Fusarium Samuels et al., Mycologia 103: 1323. 2011. Neocosmospora kurunegalensis Samuels et al., Mycologia 103: 1324. 2011. Holotypus: BPI 871391. Ex-type culture: CBS 119599 = G.J.S. 02-94. Type locality: Sri Lanka, Wagamba Province, Kurunegala. Type substrate: Recently felled tree. Descriptions and illustrations: See Nalim et al. (2011). Diagnostic DNA barcodes: rpb1: MW834228; rpb2: LR583838; tef1: DQ247511. kyushuense Fusarium O'Donnell & T. Aoki, Mycoscience 39: 2. 1998. Holotypus: NIAES99701. Ex-type culture: ATCC 56750 = FRC T-346A = MAFF 237645 = MRC 1767 = NRRL 3509. Type locality: Japan, Kumamoto. Type substrate: Seed of Triticum aestivum. Descriptions and illustrations: See Aoki & O'Donnell (1998). Diagnostic DNA barcodes: rpb2: MH582098; tef1: MH582292. laboulbeniae Fusarium C
epede, Arch. Parasitol. 16: 373. 1914. (See Fusarium larvarum) Holotypus: Not located. Type locality: France, Pas-de-Calais, Wimereux. Type substrate: Demetrias unipunctata. Note: Synonym fide Wollenweber & Reinking (1935). lacertarum Fusarium Subrahm. (as ‘laceratum’), Mykosen 26: 478. 1983. Holotypus: IMI 300797. Ex-type culture: ATCC 42771 = CBS 130185 = IMI 300797 = NRRL 20423. Type locality: India, Poona, Pimpri. Type substrate: Skin of lizard. Descriptions and illustrations: See Subrahmanyam (1983). Diagnostic DNA barcodes: rpb1: JX171467; rpb2: JX171581; tef1: GQ505593. lactis Fusarium Pirotta, Arch. Lab. Bot. Crittog. Univ. Pavia 2 & 3: 316. 1879. Synonyms: ?Fusarium pyrinum Schwein., Trans. Amer. Philos. Soc., n.s. 4: 302. 1834. ?Fusarium apiogenum Sacc., Syll. Fung. 4: 717. 1886. Fusarium rubrum Parav., Ann. Mycol. 16: 311. 1918. Lectotypus: Arch. Lab. Bot. Crittog. Univ. Pavia 2 & 3, Tab. 21, figs 1–6, designated by Yilmaz et al. (2021). Lectotype locality: Italy, Pavia. Lectotype substrate: Clotted milk. Epitypus: B 70 0001686, designated by Yilmaz et al. (2021). FUSARIUM Ex-epitype culture: BBA 68590 = CBS 411.97 = IMI 375351 = NRRL 25200. Epitype locality: USA, California. Epitype substrate: Ficus carica. Descriptions and illustrations: See Nirenberg & O'Donnell (1998) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: LT996201; rpb2: LT996149; tef1: AF160272. lagenariae Fusarium (Schwein.) Sacc., Syll. Fung. 4: 724. 1886. Basionym: Fusisporium lagenariae Schwein., Trans. Amer. Philos. Soc., n.s., 4: 275. 1834. (See Fusarium oxysporum) Holotypus: PH00062516 Type locality: USA, Pennsylvania, Bethlehem. Type substrate: Lagenaria siceraria. lagenarium Fusarium Pass., Erb. Critt. Ital., ser. 2: no. 148. 1871. Synonym: Gloeosporium lagenarium (Pass.) Sacc. & Roum., Rev. Mycol., Toulouse 2(8): 201. 1880. (See Fusarium cyclogenum) Holotypus: In PAD. Type locality: Italy, Parma. Type substrate: Lagenaria sp. Note: Synonym fide Wollenweber & Reinking (1935). lanceolatum Fusarium O.A. Pratt, J. Agric. Res. 13: 83. 1918. (See Fusarium acuminatum) Lectotypus (hic designatus, MBT 10000709): USA, Idaho, from soil, 1918, O.A. Pratt, in J. Agric. Res. 13: 82, fig. 1A–E. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. langsethiae Fusarium Torp & Nirenberg, Int. J. Food Microbiol. 95: 248. 2004. Holotypus: B 70 0012234. Ex-type culture: BBA 70945 = CBS 113234. Type locality: Norway. Type substrate: Kernal of Avena sativa. Descriptions and illustrations: See Torp & Nirenberg (2004). Diagnostic DNA barcodes: rpb1: MW928812; rpb2: MW928828; tef1: AB674298. languescens Fusarium L. Lombard & Crous, Persoonia 43: 28. 2018 [2019]. Holotypus: CBS H-23617. Ex-type culture: CBS 645.78 = NRRL 36531. Type locality: Morocco. Type substrate: Solanum lycopersicum. Descriptions and illustrations: See Lombard et al. (2019b). Diagnostic DNA barcodes: rpb1: MW928813; rpb2: MH484880; tef1: MH484971. laricis Fusarium Sawada, Bull. Gov. Forest Exp. Sta., Meguro 46: 130. 1950. Holotypus: TFM:FPH 00771. Type locality: Japan, Aomori, Kamikita, Noheji Type substrate: Larix kaempferi. larvarum Fusarium Fuckel, Jahrb. Nassauischen Vereins Naturk. 23–24: 369. 1870. Microcera larvarum (Fuckel) Gr€afenhan et al., Stud. Mycol. 68: 105. 2011. Synonyms: Fusarium nivale var. larvarum (Fuckel) Bilaĭ, Fusarii (Biologija i sistematika): 295. 1955, nom. inval., Art. 41.1 www.studiesinmycology.org REDELIMITED Fusarium cryptum McAlpine, Fungus Diseases of Citrus trees in Australia: 106. 1899. Fusarium epicoccum McAlpine, Fungus Diseases of Citrus trees in Australia: 113. 1899. Microcera parlatoriae Trab., Bull. Agric. Alg
erie Tunisie 13: 33. 1907. Microcera curta Sacc., Ann. Mycol. 7: 437. 1909. Microcera tonduzii Pat., Bull. Soc. Mycol. France 28: 142. 1912. Fusarium aspidioti Sawada, Bot. Mag. (Tokyo) 28: 312. 1914. Fusarium laboulbeniae C
epede, Arch. Parasitol. 16: 373. 1914. Fusarium acremoniopsis Vincens, Bull. Soc. Mycol. France 31: 26. 1915. ?Fusarium meliolicola F. Stevens, Bot. Gaz. 65: 245. 1918. ?Nectria meliolicola F. Stevens, Bot. Gaz. 65: 231. 1918. Microcera aurantiicola Petch, Trans. Brit. Mycol. Soc. 7: 158. 1921. Lectotypus: G 00111015, selected in Gr€afenhan et al. (2011). Lectotype locality: Germany, Hessen, Rheingau, near OestrichWinkel. Lectotype substrate: Larva cuticles of insects on Malus domestica. Epitypus: BBA 62239, designated in Gr€afenhan et al. (2011). Ex-epitype culture: BBA 62239 = CBS 738.79 = MUCL 19033 = NRRL 20473. Epitype locality: Iran, Gilan Province, near Rasht. Epitype substrate: Parasitic on Quadraspidiotus perniciosus (scale) on Prunus domestica. Diagnostic DNA barcodes: rpb1: KM232252; rpb2: KM232387; tef1: KM231957. lateritium Fusarium Nees, Syst. Pilze: 31. 1817. Synonyms: Selenosporium lateritium (Nees) Desm., Fl. Cryptog. Flandres 2: 99. 1867. Fusarium microsporum Schltdl., Fl. Berol. 2: 139. 1824. Fusarium fructigenum Fr., Syst. Mycol. 3: 471. 1832. Fusarium lateritium var. fructigenum (Fr.) Wollenw., Fusaria Autogr. Delin. 3: 959. 1930. Sphaeria baccata Wallroth, Fl. Crypt. Germ. 2: 838. 1833. Gibbera baccata (Wallr.) Fuckel, Jahrb. Nassauischen Vereins Naturk. 23–24: 167. 1870. Gibberella pulicaris subsp. baccata (Wallr.) Sacc., Michelia 1 (3): 317. 1878. Gibberella baccata (Wallr.) Sacc., Syll. Fung. 2: 553. 1883. Fusarium lateritium var. mori Desm., Ann. Sci. Nat. Bot., ser. 2, 8: 10. 1837. Selenosporium urticarum Corda (as ‘urticearum’), Icon. Fung. 2: 7. 1838. Fusarium urticarum (Corda) Sacc., Syll. Fung. 4: 698. 1886. ?Fusarium protractum L
ev., Ann. Sci. Nat., Bot., s
er. 3, 9: 246. 1848. Gloeosporium berkeleyi Mont., Ann. Sci. Nat., Bot., s
er. 3, 12: 296. 1849. Fusarium berkeleyi (Mont.) Berk. & Broome, N. Amer. Fung.: 108. 1875. Botryosphaeria moricola Ces. & De Not., Hedwigia 4: 27. 1865. Gibberella moricola (Ces. & De Not.) Sacc., Syll. Fung. 2: 553. 1883. Gibbera euonymi Fuckel, Jahrb. Nassauischen Vereins Naturk. 23–24: 167. 1870. Gibberella euonymi (Fuckel) Sacc., Michelia 1: 318. 1878. Hendersonia euonymi (Fuckel) Sacc., Syll. Fung. 2: 556. 1883. 125 CROUS ET AL. Selenosporium cydoniae Schulzer, Verh. K.K. Zool.-Bot. Ges. Wien 21: 1240. 1871. Fusarium cydoniae (Schulzer) Sacc. & Traverso, Syll. Fung. 19: 724. 1910, nom. illegit., Art. 53.1. Fusarium sticticum Berk. & M.A. Curtis, Grevillea 3: 99. 1875. Fusisporium zavianum Sacc., Michelia 1: 83. 1877. Fusarium zavianum (Sacc.) Sacc., Syll. Fung. 4: 709. 1886. Fusarium cydoniae Roum. & Fautrey, Rev. Mycol. (Toulouse) 14: 170. 1892, nom. illegit., Art. 53.1. Fusarium salicis Fuckel, Fungi Rhen. Exs., Suppl., Fasc. 7, no. 2110. 1868. Fusarium salicis var. minus Wollenw., Fusaria Autogr. Delin. 2: 582. 1924. Fusarium sambucinum var. minus Wollenw., Fusaria Autogr. Delin. 3: 941. 1930. Gibbera mori Fuckel, Jahrb. Nassauischen Vereins Naturk. 23–24: 168. 1870. Fusarium semitectum Berk. & Ravenel, in Berkeley, Grevillea 3: 98. 1875. Fusisporium cinnabarinum Berk. & M.A. Curtis, Grevillea 3: 146. 1875. Fusarium cinnabarinum (Berk. & M.A. Curtis) Sacc., Syll. Fung. 4: 722. 1886. Fusisporium miniatum Berk. & M.A. Curtis, Grevillea 3: 147. 1875. Fusarium miniatum (Berk. & M.A. Curtis) Sacc., Syll. Fung. 4: 722. 1886, nom. illegit., Art. 53.1. Fusisporium putaminum Thüm., Oesterr. Bot. Z. 27: 272. 1877. Fusarium putaminum (Thüm.) Sacc., Syll. Fung. 4: 703. 1886. Fusisporium leguminum Cooke, Grevillea 6: 139. 1878. Fusarium leguminum (Cooke) Sacc., Syll. Fung. 4: 712. 1886. Fusarium limonis Briosi, Att. Staz. Chim. Agrar. Rome. 1878. Fusarium yuccae Cooke, Grevillea 7: 34. 1878, nom. inval., Art. 36.1(a). Fusisporium azedarachinum Thüm., Mycoth. Univ., cent. 14: no. 1379. 1879. Fusarium azedarachinum (Thüm.) Sacc., Syll. Fung. 4: 704. 1886. Fusarium insidiosum Roum., Michelia 2: 132. 1880. Fusarium roumeguerei Sacc. (as ‘roumegueri’), Syll. Fung. 4: 702. 1886, nom. illegit., Art. 52.1. Fusarium albertii Roum., Fungi Sel. Gall. Exs., Cent. 19: no. 1867. 1881. Fusarium rimicola Sacc. (as ‘rimicolum’), Michelia 2: 297. 1881. Fusarium ziziphinum Pass., Rev. Mycol., (Toulouse) 4: 22. 1882. Fusarium acaciae Cooke & Harkn., Grevillea 12: 96. 1884. Fusarium longisporum Cooke & Massee, Grevillea 16: 4. 1887. Fusarium sphaeroideum Pass., Atti Reale Accad. Lincei, Rendiconti Cl. Sci. Fis., s
er. 4, 4: 105. 1888. Fusarium parasiticum Fautrey, Rev. Mycol. (Toulouse) 11: 153. 1889, nom. illegit., Art. 53.1. Fusarium fautreyi Sacc., Syll. Fung. 10: 934. 1892. Fusarium carneoroseum Cooke, Grevillea 19: 4. 1890. Fusarium celtidis Ellis & Tracy, J. Mycol. 6: 76. 1890. Fusarium nucicola P. Karst. & Har., Rev. Mycol. (Toulouse) 12: 131. 1890. Fusarium discoideum Fautrey & Roum., Rev. Mycol. (Toulouse) 13: 173. 1891. Fusarium cydoniae Allesch., Ber. Bot. Vereines Landshut 12: 130. 1892. ?Fusarium luteum Clem., Bot. Surv. Nebraska 3: 12. 1894. 126 Fusarium asclepiadeum Fautrey, Rev. Mycol. (Toulouse) 18: 68. 1896. Fusarium samararum Allesch., Ber. Bayer. Bot. Ges. 4: 39. 1896. Fusarium sophorae Allesch., Beibl. Hedwigia 36: (164). 1897. Fusarium ailanthinum Speg., Anales Mus. Nac. Hist. Nat. Buenos Aires 6: 350. 1899. Fusarium euonymi Syd., Beibl. Hedwigia 39: (6). 1900. Fusarium gemmiperda Aderh., Z. Pflanzenkrankh. 11: 70. 1901. Fusarium euonymi-japonici Henn., Hedwigia 41: 139. 1902. Fusarium illosporioides Sacc., in Saccardo et al., Harriman Alaska Expedition 5: 15. 1904. Fusarium schawrowi Speschnew, Arbeiten Kaukas. Stat. Seidenzucht 10: 30–41. 1906. Selenosporium gloeosporioides Speg. (as ‘gloesporioides’), Anales Mus. Nac. Hist. Nat. Buenos Aires 13: 458. 1911. Fusarium gloeosporioides (Speg.) Sacc. & Trotter, Syll. Fung. 22: 1482. 1913, nom. illegit., Art. 53.1. Fusarium briosianum Ferraris, Fl. Ital. Crypt. Fungi Fasc. 13: 857. 1912. Fusarium pseudacaciae Rapaics, Z. Pflanzenkrankh. 25: 208. 1915. Fusarium gleditschiicola Dearn. & Barthol. (as ‘gleditschicola’), Mycologia 9: 363. 1917. Gibberella briosiana Turconi & Maffei, Atti Ist. Bot. Univ. Pavia, s
er. 2, 15: 148. 1918. Botryosphaeria briosiana (Turconi & Maffei) Weese, Sitzungsber. Akad. Wiss. Wien, Math.-Naturwiss. Kl., Abt. 1, 128: 708. 1919. Fusarium uncinatum Wollenw., Ann. Mycol. 15(1/2): 54. 1917. Fusarium blackmannii W. Br. & A.S. Horne (as ‘blackmanni’), Ann. Bot. (London) 38: 379. 1924. Fusarium entomophilum Petch, Trans. Brit. Mycol. Soc. 11: 260. 1925. Fusarium lateritium var. tenue Wollenw., Fusaria Autogr. Delin. 3: 955. 1930. Gibberella saubinetii var. flacca Wollenw., Z. Parasitenk. (Berlin) 3: 433. 1931. Fusarium anisophilum Picado, J. Dept. Agric. Porto Rico 16: 391. 1932. Lectotypus (hic designatus, MBT 10000710): Germany, unknown host, 1817, G.C.D. Nees von Esenbeck, in System der Pilze und Schw€amme: 31, tab. 2, fig. 26. Descriptions and illustrations: See Wollenweber & Reinking (1935), Booth (1971), Gerlach & Nirenberg (1982), Nelson et al. (1983) and Leslie & Summerell (2006). Notes: Re-collection from the type host and locality is required. No holotype specimen could be located and therefore an illustration was designated as lectotype. laxum Fusarium Peck, Bull. New York State Mus. Nat. Hist. 67: 30. 1903. (See Fusarium oxysporum) Holotypus: NYS-F-001667. Type locality: USA, New York, Albany, Delmar. Type substrate: Equisetum hyemale. Note: Synonym fide Wollenweber & Reinking (1935). leguminum Fusarium (Cooke) Sacc., Syll. Fung. 4: 712. 1886. Basionym: Fusisporium leguminum Cooke, Grevillea 6: 139. 1878. (See Fusarium lateritium) Syntypes: In CUP, ISC, NEB & PH (Fungi Amer. Exs. no. 298). Type locality: USA, South Carolina, Aiken. FUSARIUM Type substrate: Acacia sp. Note: Synonym fide Wollenweber & Reinking (1935). leucoconium Fusarium Corda, Icon. Fung. 1: 4. 1837. (See Fusarium heterosporum and F. reticulatum) Typus: In PRM fide Pilat (1938). Type locality: Czech Republic, Prague. Type substrate: Rotten plants. Note: Synonym fide Wollenweber & Reinking (1935) and Booth (1971). Lectotypification pending study of material lodged in PRM. libertatis Fusarium L. Lombard & Crous, Persoonia 43: 29. 2018 [2019]. Holotypus: CBS H-23618. Ex-type culture: CBS 144749 = CPC 28465. Type locality: South Africa, Western Cape Province, Robben Island, Van Riebeeck's Quarry. Type substrate: Rock surface. Descriptions and illustrations: See Lombard et al. (2019b). Diagnostic DNA barcodes: rpb2: MH484944; tef1: MH485035. lichenicola Fusarium C. Massal., in Maire & Saccardo, Ann. Mycol. 1: 223. 1903. Neocosmospora lichenicola (C. Massal.) Sand.-Den. & Crous, Persoonia 41: 120. 2018. Synonyms: Bactridium lichenicola (C. Massal.) Wollenw. (‘as lichenicolum’), Fusaria Autogr. Delin. 1: 456. 1916. Cylindrocarpon lichenicola (C. Massal.) D. Hawksw., Bull. Brit. Mus. (Nat. Hist.), Bot. 6: 273. 1979. Selenosporium lichenicola Speg., Anales Mus. Nac. Hist. Nat. Buenos Aires, ser. 3, 13: 459. 1911. Fusarium lichenicola (Speg.) Sacc. & Trotter, Syll. Fung. 22: 1486. 1913, nom. illegit., Art. 53.1. Monacrosporium tedeschii A. Agostini (as ‘tedeschi’), Atti Ist. Bot. Univ. Lab. Crittog. Pavia, ser. 3, 4: 195. 1933. Euricoa dominguiesii Bat. & H. Maia, Anais Soc. Biol. Pernambuco 13: 152. 1955. Hyaloflorea ramosa Bat. & H. Maia, Anais Soc. Biol. Pernambuco 13: 155. 1955. Neocosmospora ramosa (Bat. & H. Maia) L. Lombard & Crous, Stud. Mycol. 80: 227. 2015. Mastigosporium heterosporum R.H. Petersen, Mycologia 51: 729. 1959. Holotypus: In PAD. Epitypus: CBS H-23983, designated in Sandoval-Denis et al. (2019). Ex-epitype culture: CBS 623.92. Epitype locality: Germany, Göttingen. Epitype substrate: Necrotic wounds of Homo sapiens under chemotherapy. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb2: LR583845; tef1: LR583620. limonis Fusarium Briosi, Ann. R. Staz. Chim.-Agrar. Sper. Roma. 1878. (See Fusarium lateritium) Holotypus: Not located. Type locality: Italy, Sicily. Type substrate: Citrus limon. Notes: Synonym fide Wollenweber & Reinking (1935). Protologue not located. limosum Fusarium Rostr., Bot. Tidsskr. 22: 263. 1899. www.studiesinmycology.org REDELIMITED (See Fusarium avenaceum) Holotypus: C-F-111719. Type locality: Sweden. Type substrate: Mixture of lime and sugar. Note: Synonym fide Wollenweber & Reinking (1935). lineare Fusarium Moesz, Bot. Közlem. 19: 57. 1920. (See Fusarium obtusisporum) Holotypus: ?BP. Type locality: Hungary. Type substrate: Staphylea pinnata. Note: Synonym fide Wollenweber & Reinking (1935). lini Fusarium Bolley, Proc. Annual Meeting Soc. Promot. Agric. Sci. 22: 42. 1901. (See Fusarium oxysporum) Holotypus: Not located. Type locality: USA. Type substrate: Linum usitatissimum. lini Fusarium Remer, Jahresber. Schles. Ges. Vaterl. Cult. 80: 25. 1903, nom. illegit., Art. 53.1 Holotypus: Not located. Type locality: Poland. Type substrate: Linum sp. liriodendri Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 2. 2020. Neocosmospora liriodendri Sand.-Den. & Crous, Persoonia 43: 139. 2019. Holotypus: CBS H-23984. Ex-type culture: BBA 67587 = CBS 117481 = G.J.S 91148 = NRRL 22389. Type locality: USA, Maryland. Type substrate: Liriodendron tulipifera. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW218124; rpb2: EU329506; tef1: AF178340.
loliaceum Fusarium Ducomet, Ann. Ecole Natl. Agric. Rennes 2: 14. 1909. (See Fusarium nivale) Holotypus: ?MPA. Type locality: France. Type substrate: Unknown. Note: Synonym fide Wollenweber & Reinking (1935). lolii Fusarium (Wm.G. Sm.) Sacc., Syll. Fung. 11: 652. 1895. Basionym: Fusisporium lolii Wm.G. Sm., Diseases of field and garden crops, chiefly as are caused by fungi: 213. 1884. (See Fusarium heterosporum) Lectotypus (hic designatus, MBT 10000711): UK, Lolium perenne, date unknown, W.G. Smith, in W.G. Smith, Diseases of field and garden crops, chiefly as are caused by fungi: 213, fig. 96. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. loncheceras Fusarium Sideris, Phytopathology 14: 213. 1924. (See Fusarium oxysporum) Lectotypus (hic designatus, MBT 10000712): USA, California, Stockton, roots of Allium cepa, 1924, C.P. Sideris, in Phytopathology 14, pl. XI, fig. of F. loncheceras. 127 CROUS ET AL. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. longicaudatum Fusarium J.W. Xia et al., Persoonia 43: 208. 2019. Holotypus: CBS H-24061. Ex-type culture: ATCC 24370 = CBS 123.73 = IMI 160825 = NRRL 25477. Type locality: Tanzania, Tropical Products Research Inst. Type substrate: Unknown. Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb2: MN170414; tef1: MN170481. longicornicola Fusarium Sand.-Den., et al., Persoonia 46: 149. 2021. Holotypus: CBS H-24661. Ex-type culture: ARSEF 6455 = CBS 147247 = NRRL 52706. Type locality: Ethiopia, Kobo, Welo. Type substrate: Aiolopus longicornis. Descriptions and illustrations: See Yilmaz et al. (2021). Diagnostic DNA barcodes: rpb2: JF741114; tef1: JF740788. longifundum Fusarium J.W. Xia et al., Persoonia 43: 208. 2019. Holotypus: CBS H-24062. Ex-type culture: CBS 235.79 = NRRL 36372. Type locality: Netherlands Antilles, Curaçao. Type substrate: Air. Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb2: GQ505827; tef1: GQ505649. longipes Fusarium Wollenw. & Reinking, Phytopathology 15: 160. 1925. Synonyms: Fusarium scirpi var. longipes (Wollenw. & Reinking) Wollenw., Z. Parasitenk. (Berlin) 3: 337. 1931. Fusarium equiseti var. longipes (Wollenw. & Reinking) Joffe, Mycopathol. Mycol. Appl. 53: 221. 1974. Neotypus (hic designatus, MBT 10000713): USA, Florida, soil, 1977, W. Gams, CBS 476.77 (preserved as metabolically inactive culture). Ex-neotype culture: CBS 476.77 = NRRL 20695. Descriptions and illustrations: See Gerlach & Nirenberg (1982), Nelson et al. (1983). Diagnostic DNA barcodes: rpb1: MW233244; rpb2: GQ915493; tef1: GQ915509. Notes: This species is recognised by Gerlach & Nirenberg (1982), Nelson et al. (1983), and Leslie & Summerell (2006). No holotype specimen could be located and no illustration accompanied the original protologue. Although an illustration of the original culture (O.A. Reinking no. R34) is provided in Wollenweber's Fusaria Autogr. Delin. no. 937 (1924), this cannot be used to designate a lectotype as it does not form part of the original protologue. Therefore, isolate CBS 476.77 is designated as neotype here to provide taxonomic stability to this species, as it appears to have a paraphyletic phylogenetic structure (O'Donnell et al. 2013). longisporum Fusarium Cooke & Massee, Grevillea 16: 4. 1887. (See Fusarium lateritium) Holotypus: K(M) 159680. Type locality: Australia, Queensland, Brisbane. Type substrate: Twigs of Passiflora sp. Note: Synonym fide Wollenweber & Reinking (1935). 128 longissimum Fusarium Sacc. & P. Syd., Syll. Fung. 14: 1128. 1899. Replaced synonym: Fusarium elongatum De Wild., Ann. Soc. Belge Microscop. 17: 43. 1893, nom. illegit., Art. 53.1, non Fusarium elongatum Cooke 1890. (See Fusarium elongatum De Wild.) Holotypus: Not located. Type locality: Belgium, Brussels, Botanical Garden. Type substrate: Submerged plant material. Note: Synonymy fide Rossman et al. (2016). longum Fusarium (Wallr.) Sacc., Syll. Fung. 4: 719. 1886. Basionym: Fusisporium longum Wallr., Fl. Crypt. Germ. 2: 283. 1833. Holotypus: ?STR. Type locality: Germany, Berlin. Type substrate: Dead branch. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). louisianense Fusarium L.R. Gale et al., Fungal Genet. Biol. 48: 1105. 2011. Holotypus: BPI 881005. Ex-type culture: CBS 127525 = NRRL 54197. Type locality: USA, Louisiana. Type substrate: Seeds of Triticum sp. Descriptions and illustrations: See Sarver et al. (2011). Diagnostic DNA barcodes: rpb1: KM889655; rpb2: KM889657; tef1: KM889633. lucidum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 157. 1915. (See Fusarium avenaceum) Typus: ?CUP-007473. Type locality: USA, New York. Type substrate: Solanum tuberosum. Notes: Synonym fide Wollenweber & Reinking (1935). Lectotypification pending study of material lodged in CUP. lucumae Fusarium Henn., Hedwigia 48: 116. 1908. Ascochyta lucumae (Henn.) Wollenw., Fusaria Autogr. Delin. 1: 504. 1916. Syntypes: In BPI, ILL, MIN & WIS (Baker 218). Type locality: Brazil, Par
a. Type substrate: Lucuma rivicoa Note: Synonym fide Wollenweber & Reinking (1935). luffae Fusarium M.M. Wang et al., Persoonia 43: 85. 2019 Holotypus: HAMS 248042. Ex-type culture: CGMCC 3.19497 = LC12167. Type locality: China, Fujian. Type substrate: Luffa aegyptiaca. Descriptions and illustrations: See Wang et al. (2019). Diagnostic DNA barcodes: rpb1: MK289869; rpb2: MK289754; tef1: MK289601. lumajangense Fusarium Maryani et al., Persoonia 43: 59. 2019. Holotypus: InaCC F872 (preserved as metabolically inactive culture). Ex-type culture: InaCC F872. Type locality: Indonesia, East Java, Lumajang, Kecamatan Senduro, Desa Kandang Kepus. Type substrate: Musa acuminata var. Pisang Mas Kirana. Descriptions and illustrations: See Maryani et al. (2019b). FUSARIUM Diagnostic DNA barcodes: rpb2: LS479850; tef1: LS479441. lunatum Fusarium (Ellis & Everh.) Arx, Verh. Kon. Ned. Akad. Wetensch., Afd. Natuurk., Sect. 2, 51: 101. 1957. Bisifusarium lunatum (Ellis & Everh.) L. Lombard & Crous, Stud. Mycol. 80: 225. 2015. Basionym: Gloeosporium lunatum Ellis & Everh., Proc. Acad. Nat. Sci. Philadelphia 43: 82. 1891. Synonyms: Microdochium lunatum (Ellis & Everh.) Arx, Trans. Brit. Mycol. Soc. 83: 374. 1984. Fusarium dimerum var. violaceum Wollenw., Fusaria Autogr. Delin. 3: 854. 1930. Holotypus: NY00883039. Type locality: USA, Texas, San Antonio. Type substrate: Living leaves of Opuntia sp. Notes: This species requires epitypification. Gerlach & Nirenberg (1982) designated CBS 632.76 (= NRRL 20690) as neotype of F. dimerum var. violaceum, which was originally collected in Germany. However, Schroers et al. (2009) showed that F. lunatum is paraphyletic and needs further investigation. Therefore, CBS 632.76 cannot be designated as epitype for B. lunatum at this time. lunulosporum Fusarium Gerlach, Phytopathol. Z. 88: 283. 1977. Holotypus: BBA 62459. Ex-type culture: ATCC 36747 = BBA 62459 = CBS 636.76 = IMI 322097 = NRRL 13393. Type locality: South Africa. Type substrate: Citrus paradisi. Descriptions and illustrations: See Gerlach (1977b), Gerlach & Nirenberg (1982) and Nelson et al. (1983). Diagnostic DNA barcodes: rpb1: KM361637; rpb2: KM361655; tef1: AF212467. luteum Fusarium Clem., Bot. Surv. Nebraska 3: 12. 1894. (See Fusarium lateritium) Holotypus: NEB00040542. Type locality: USA, Nebraska, Lincoln. Type substrate: Decaying wood. Note: Synonym fide Wollenweber & Reinking (1935). luteum Fusarium Parav., Ann. Mycol. 16: 302. 1918, nom. illegit., Art. 53.1. (See Fusarium candidum) Authentic material: In Ann. Mycol. 16, pl. 4., figs 1–22. Original locality: Switzerland. Original substrate: Pyrus sp. Notes: Synonym fide Wollenweber & Reinking (1935). lutulatum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 209. 1915. (See Fusarium oxysporum) Typus: CUP-007458. Type locality: USA, Iowa. Type substrate: Solanum tuberosum. Note: Synonym fide Wollenweber & Reinking (1935). Lectotypification pending study of material lodged in CUP. lyarnte Fusarium J.L. Walsh, Sangal., L.W. Burgess, E.C.Y. Liew & Summerell, sp. nov. MycoBank MB 837697. Synonym: Fusarium lyarnte J.L. Walsh, Sangal., L.W. Burgess, E.C.Y. Liew & Summerell, Fungal Diversity 44: 153. 2010, nom. inval., Art. 40.7. www.studiesinmycology.org REDELIMITED Etymology. ‘Lyarnte’, meaning circle in eastern and central Arrernte Aboriginal language (Henderson & Dobson 1994), in reference to the conspicuous globose microconidia. For diagnosis see Walsh et al., Fungal Diversity 44: 153. 2010. Holotypus: CBS 125536 (preserved as metabolically inactive culture). Ex-type culture: CBS 125536 = NRRL 54252 = RBG 5331. Type locality: Australia, Northern Territory, Litchfield. Type substrate: Soil. Descriptions and illustrations: See Walsh et al. (2010). Diagnostic DNA barcodes: rpb1: JX171549; rpb2: JX171661; tef1: EF107118. Notes: Walsh et al. (2010) failed to indicate the holotype for F. lyarnte, thereby rendering the species name invalid (Art. 40.7). Here we validate the name. lycopersici Fusarium (Sacc.) Mussat, Syll. Fung. 15: 144. 1901, nom. inval., Art. 36.1(a), (c). Basionym: Fusarium oxysporum subsp. lycopersici Sacc., Syll. Fung. 4: 705. 1886. (See Fusarium oxysporum) Authentic material: Not located. Original locality: Italy. Original substrate: Solanum lycopersicum. lycopersici Fusarium Bruschi, Atti Reale Accad. Lincei, Rendiconti Cl. Sci. Fis., ser. 5, 21: 298. 1912. (See Fusarium oxysporum) Synonym: Fusarium bulbigenum var. lycopersici (Bruschi) Wollenw. & Reinking, Fusarien: nos. 996–997. 1935. Holotypus: Not located. Type locality: Italy. Type substrate: Solanum lycopersicum. Note: Synonym fide Wollenweber & Reinking (1935). lycopersici Fusarium (Sacc.) Wollenw., Phytopathology 3: 29. 1913, nom. illegit., Art. 53.1. Basionym: Fusarium oxysporum subsp. lycopersici Sacc., Syll. Fung. 4: 705. 1886. (See Fusarium oxysporum) Authentic material: Not located. Original locality: Italy. Original substrate: Solanum lycopersicum. macounii Fusarium Dearn., Mycologia 9: 363. 1917. (See Fusarium expansum) Holotypus: DAOM 223428b. Type locality: Canada, Vancouver Island. Type substrate: Acer sp. Note: Synonym fide Wollenweber & Reinking (1935). macroceras Fusarium Wollenw. & Reinking, Phytopathology 15: 166. 1925. Holotypus: CBS 146.25 (preserved as metabolically inactive culture). Ex-type culture: CBS 146.25 = NRRL 13958. Type locality: Honduras. Type substrate: Phaseolus vulgaris. Descriptions and illustrations: See Wollenweber & Reinking (1925, 1935) and Gerlach & Nirenberg (1982). Notes: Phylogenetic inference (not shown) revealed that the extype culture housed at CBS clustered within the N. petroliphila clade, indicating a possible strain transposition or contamination of the culture in the past. These species are not morphologically 129 CROUS ET AL. conspecific based on the original protologue (Wollenweber & Reinking 1925) of F. macroceras. macrosporum Fusarium (Sand.-Den. et al.) O'Donnell et al., Index Fungorum 440: 2. 2020. Neocosmospora macrospora Sand.-Den. et al., Persoonia 40: 21 2017 [2018]. Holotypus: CBS H-23023. Ex-type culture: CBS 142424 = CPC 28191. Type locality: Italy, Sicily, Catania, Guardia. Type substrate: Citrus sinensis. Descriptions and illustrations: See Sandoval-Denis et al. (2018a). Diagnostic DNA barcodes: rpb1: MW218125; rpb2: LT746331; tef1: LT746218. macroxysporum Fusarium Lindf., Meddel. Centralanst. Försöksv€as. Jordbruksomr. Avd. Lantbruksbot. 25: 8. 1922. (See Fusarium oxysporum) Holotypus: Not located. Type locality: Sweden. Type substrate: Pinus sylvestris. Note: Synonym fide Wollenweber & Reinking (1935). maculans Fusarium B
erenger, Atti Riunione Sci. Ital. 6: 474. 1845. Neophloeospora maculans (B
erenger) Videira & Crous, Stud. Mycol. 87: 338. 2017. Synonyms: Phloeospora maculans (B
erenger) Allesch., Rabenh. Krypt.-Fl., ed. 2, 1: 935. 1900. Phloeosporella maculans (B
erenger) Ho€hn., Mitt. Bot. Inst. Techn. Hochsch. Wien 4: 77. 1927. Cercosporella maculans (B
erenger) F.A. Wolf, J. Elisha Mitchell Sci. Soc. 51: 165. 1935. Septoria mori L
ev., Ann. Sci. Nat., Bot., ser. 3, 5: 279. 1846. Cheilaria mori (L
ev.) Desm., Ann. Sci. Nat., Bot., ser. 3, 8: 27. 1847. Phloeospora mori (L
ev.) Sacc., Michelia 1: 175. 1878. Septogloeum mori (L
ev.) Briosi & Cavara, Fung. Paras. Piante Colt. Util., Fasc. 1: no. 21. 1888. Cylindrosporium mori (L
ev.) Berl., Riv. Patol. Veg. 5: 205. 1896. Sphaeria mori Nitschke, Fungi Rhen. Exs. no. 1784. 1866, nom. inval., Art. 38.1(a). Sphaerella mori Fuckel, Jahrb. Nassauischen Vereins Naturk. 23–24: 106. 1870. Mycosphaerella mori (Fuckel) F.A. Wolf, J. Elisha Mitchell Sci. Soc. 51: 165. 1935. Sphaerella morifolia Pass., Erb. Critt. Ital., Ser. 2, Fasc. 30, no. 1464. 1885. Mycosphaerella morifolia (Pass.) Cruchet, Bull. Soc. Vaud. Sci. Nat. 55: 43. 1923. Cercospora pulvinulata f. angulosa Savul. & Sandu, Herb. Mycol. Roman. no. 188. 1931. Holotypus: Not located. Type locality: Italy. Type substrate: Leaves of Morus sp. madaense Fusarium Ezekiel et al., MycoKeys 67: 112. 2020. Holotypus: CBS H-24346. Ex-type culture: CBS 146669 = CPC 38344. Type locality: Nigeria, Nasarawa, Mada Station. Type substrate: Arachis hypogaea. 130 Descriptions and illustrations: See Ezekiel et al. (2020). Diagnostic DNA barcodes: rpb1: LR792575; rpb2: LR792589; tef1: LR792625. magnoliae-champaca Fusarium R.H. Perera et al., Mycosphere 11: 2140. 2020. Holotypus: MFLU 18-2736. Ex-type culture: MFLUCC 18-0580. Type locality: Thailand, Chiang Rai, Mae Fah Luang University garden. Type substrate: Dried fruits of Magnolia champaca. Descriptions and illustrations: See Perera et al. (2020). Diagnostic DNA barcode: rpb2: MT212198. magnusianum Fusarium Allesch., Fungi Bav. no. 400. 1895. (See Fusarium aquaeductuum) Holotypus: In M. Type locality: Germany, München. Type substrate: Salix incana. Note: Synonym fide Wollenweber & Reinking (1935). mahasenii Fusarium Samuels et al., Mycologia 103: 1325. 2011. Neocosmospora mahasenii Samuels et al., Mycologia 103: 1325. 2011. Holotypus: BPI 881228. Ex-type culture: CBS 119594 = FRC S-1845 = G.J.S. 02-105. Type locality: Sri Lanka, North Central Province, Giritale. Giritale Forest Training Center. Type substrate: Small branch of live tree. Descriptions and illustrations: See Nalim et al. (2011). Diagnostic DNA barcodes: rpb1: MW834231; rpb2: LT960563; tef1: DQ247513. mali Fusarium Allesch., Ber. Bot. Vereines Landshut 12: 130. 1892. (See Fusarium candidum) Holotypus: In M. Type locality: Germany, München. Type substrate: Malus pumila. Note: Synonym fide Wollenweber & Reinking (1935). malli Fusarium Taubenh., Bull. Texas Agric. Exp. Sta. 273: 25. 1921. (See Fusarium solani) Holotypus: ?CUP-011254. Type locality: USA, Texas, Brazos, College Station. Type substrate: Allium cepa. Note: Typification pending study of material lodged in CUP. malvacearum Fusarium Taubenh., Bull. Texas Agric. Exp. Sta. 260: 27. 1920. (See Fusarium oxysporum) Lectotypus (hic designatus, MBT 10000714): USA, Texas, Abelmoschus esculentus, 1920, J.J. Taubenhhaus, in Taubenhaus, Bull. Texas Agric. Exp. Sta. 260: 30, fig. 8g. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration was designated as lectotype. mangiferae Fusarium Britz et al., Mycologia 94: 725. 2002. Holotypus: PREM 57299. Ex-type culture: CBS 120994 = KSU 11781 = MRC 7559 = MUCL 54671 = NRRL 53980. FUSARIUM Type locality: Israel, Bet Dagan, Volcani Center. Type substrate: Mangifera indica. Descriptions and illustrations: See Britz et al. (2002). Diagnostic DNA barcodes: rpb1: MW402530; rpb2: LT575059; tef1: LT574978. marasasianum Fusarium Herron et al., Stud. Mycol. 80: 146. 2015. Holotypus: PREM 60899. Ex-type culture: CBS 137238 = CMW 25261. Type locality: Colombia, Vivero Pe~nas Negra, Valle del Cauca. Type substrate: Pinus patula. Descriptions and illustrations: See Herron et al. (2015). Notes: Comparisons of recently generated sequences for the living ex-type (CBS 137238 = CMW 25261) of F. marasasianum indicate a strain transposition or contamination by another Fusarium species. Therefore, this species needs to be recollected from the type locality and substrate or sequences need to be generated from the holotype specimen. marginatum Fusarium Berk. & M.A. Curtis, Grevillea 3: 97. 1875. Holotypus: ?K(M). Type locality: USA, Alabama, Beaumont. Type substrate: Smilax sp. Note: Not Fusarium fide Wollenweber & Reinking (1935). martiellae-discolorioides Fusarium Batikyan, Biol. Zhurn. Armenii 22: 87. 1969, nom. inval., Art. 39.1. Authentic material: Not located. Original locality: Armenia. Original substrate: Soil of wheatfield. Notes: Published without Latin diagnosis fide Gerlach & Nirenberg (1982). Also described in Biol. Zhurn. Armenii 26(2): 73. 1973, but also not in Latin. martii Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: 83. 1913. Neocosmospora martii (Appel & Wollenw.) Sand.-Den. & Crous, Persoonia 43: 137. 2019. Synonyms: Fusarium solani var. martii (Appel & Wollenw.) Wollenw., Fusaria Autogr. Delin. 3: 1034. 1930. Neocosmospora croci Guarnaccia et al., Persoonia 40: 17. 2017 [2018]. Lectotypus: BPI 452385, selected in Sandoval-Denis et al. (2019). Epitypus: CBS H-23986, designated in Sandoval-Denis et al. (2019). Ex-epitype culture: CBS 115659 = FRC S-0679 = MRC 2198. Lecto- and epitype locality: Germany, Berlin. Lecto- and epitype substrate: Solanum tuberosum. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834232; rpb2: JX435256; tef1: JX435156. massalimae Fusarium A.D. Cavalcanti et al., Mycol. Progr. 19: 1137. 2020. Holotypus: URM 94324. Ex-type culture: URM 8239. Type locality: Brazil, Alagoas, Quebrangulo, Pedra Talhada Biological Reserve. Type substrate: Handroanthus chrysotrichus. Descriptions and illustrations: See Cavalcanti et al. (2020). Diagnostic DNA barcodes: rpb2: MN939767; tef1: MN939763. matuoi Fusarium Hosoya & Tubaki, Mycoscience 45: 264. 2004. www.studiesinmycology.org REDELIMITED Fusicolla matuoi (Hosoya & Tubaki) Gr€afenhan & Seifert, Stud. Mycol. 68: 101. 2011. Synonyms: Fusarium splendens Matuo & Takah. Kobay., Trans. Mycol. Soc. Japan 2(4): 13. 1960, nom. inval., Art. 39.1. Cosmospora matuoi Hosoya & Tubaki, Mycoscience 45: 262. 2004. Holotypus: TNS F-11127. Ex-type culture: MAFF 410976. Type locality: Japan, Honshu. Type substrate: Twigs of Albizia julibrissin. Descriptions and illustrations: See Hosoya & Tubaki (2004). mauroi Fusarium Av.-Sacc
a, Revista Agric. (Piracicaba) 8: 93. 1933. Macronectria jungneri (Henn.) Salgado & P. Chaverri, Fungal Diversity 80: 448. 2016. Basionym: Nectria jungneri Henn., Bot. Jahrb. Syst. 22: 75. 1895. Synonyms: Cucurbitaria jungneri (Henn.) Kuntze, Revis. Gen. Pl. 3: 461. 1898. Neonectria jungneri (Henn.) Samuels & Brayford (as ‘Nenectria’), Mycologia 96: 580. 2004. Thelonectria jungneri (Henn.) P. Chaverri & Salgado, Stud. Mycol. 68: 76. 2011. Nectria eustoma Penz. & Sacc., Malpighia 11: 509. 1898 [1897]. Nectria leucocoma Starb€ack, Bih. Kongl. Svenska Vetensk.Akad. Handl. 25: 28. 1899. Nectria cinereopapillata Henn. & E. Nyman, inWarburg, Monsunia 1: 161. 1900 [1899]. Nectria striatospora Zimm., Centralbl. Bakteriol. II, 7: 105. 1901. Nectria theobromae Massee, Bull. Misc. Inform. Kew 1908: 218. 1908. Cylindrocarpon victoriae Wollenw., Z. Parasitenk. (Berlin) 1: 161. 1928. Nectria azureo-ostiolata Doi, Mem. Nat. Sci. Mus. Tokyo 10: 23. 1977. Holotypus: Not located. Type locality: Brazil. Type substrate: Caconema radicicola. Note: Synonyms fide Wollenweber & Reinking (1935) and Salgado-Salazar et al. (2016). maydiperdum Fusarium Bub
ak, Centralbl. Bakteriol. 2. Abth. 31: 497. 1911. (See Fusarium poae) Holotypus: BPI 452399. Type locality: Czech Republic, Tabor. Type substrate: Seeds of Zea mays. Note: Synonym fide Wollenweber & Reinking (1935). maydis Fusarium Kalchbr., Math. Term. Közlem. 3: 285. 1865. (See Fusarium sambucinum) Holotypus: BRACR33140. Type locality: Hungary. Type substrate: Zea mays. Note: Synonym fide Wollenweber & Reinking (1935). melanochlorum Fusarium (Casp.) Sacc., Syll. Fung. 4: 725. 1886. Basionym: Fusisporium melanochlorum Casp., Ber. Bekanntm. Verh. Königl. Preuss. Akad. Wiss. Berlin 1855: 309, 314. 1855. Cosmospora flavoviridis (Fuckel) Rossman & Samuels, Stud. Mycol. 42: 121. 1999. Basionym: Sphaerostilbe flavoviridis Fuckel, Jahrb. Nassauischen Vereins Naturk. 25–26: 310. 1871. 131 CROUS ET AL. Synonyms: Nectria flavoviridis (Fuckel) Wollenw. Angew. Bot. 8: 186. 1926. Fusarium celtidis Pass., Atti Reale Accad. Lincei, Rendiconti Cl. Sci. Fis., 4 s
er. 7: 51. 1891, nom. illegit., Art. 53.1. Fusarium sphaeriiforme Sacc. (as ‘sphaeriaeforme’), Syll. Fung. 10: 723. 1892. Fusarium glandicola Allesch., Ber. Bot. Vereines Landshut12: 130. 1892, nom. illegit., Art. 53.1, non Cooke & W.R. Gerard, 1878. Fusarium allescheri Sacc. & P. Syd., Syll. Fung. 14: 1128. 1899. Holotypus: Not located. Type locality: Germany, Berlin. Type substrate: Rotten aquatic plants. meliolicola Fusarium F. Stevens (as ‘meliolicolum’), Bot. Gaz. 65: 245. 1918. (See Fusarium larvarum) Holotypus: ILL00011251. Type locality: Puerto Rico, Mayagüez. Type substrate: Parasitic on Meliola paulliniae on Casearia sylvestris. Note: Synonym fide Wollenweber & Reinking (1935). meridionale Fusarium T. Aoki et al., Fungal Genet. Biol. 41: 618. 2004. Holotypus: BPI 843474. Ex-type culture: CBS 110247 = FRC R-5329 = NRRL 28436. Type locality: New Caledonia. Type substrate: Citrus sinensis. Descriptions and illustrations: See O'Donnell et al. (2004). Diagnostic DNA barcodes: rpb1: KM361642; rpb2: KM361660; tef1: AF212435. merismoides Fusarium Corda, Icon. Fung. 2: 4. 1838. Fusicolla merismoides (Corda) Gr€afenhan et al., Stud. Mycol. 68: 101. 2011. Synonyms: Fusisporium georginae Klotzsch, Herb. Viv. Mycol., Cent. 2: 186. 1832, nom. nud., Art. 38.1 (a). Fusarium rhizophilum Corda, Icon. Fung. 2: 3. 1838. Pionnotes rhizophila (Corda) Sacc., Syll. Fung. 4: 727. 1886. ?Fusisporium arachnoideum Corda, Icon. Fung. 1: 11. 1837. ?Fusarium arachnoideum (Corda) Sacc., Syll. Fung. 4: 721. 1886. ?Fusarium biasolettianum Corda, Icon. Fung. 2: 3. 1838. ?Fusisporium biasolettianum (Corda) Sacc., Mycoth. Ven. no. 1040. 1877. ?Pionnotes biasolettiana (Corda) Sacc., Syll. Fung. 4: 725. 1886. Fusisporium udum Berk., Ann. Mag. Nat. Hist. 6: 438. 1841. Pionnotes uda (Berk.) Sacc., Syll. Fung. 4: 726. 1886. Fusarium udum (Berk.) Wollenw., Phytopathology 3: 38. 1913, nom. illegit., Art. 53.1. Fusidium udum Berk., in Trotter, Syll. Fung. 25: 979. 1931, nom. inval., Art. 36.1. Fusisporium foeni Berk. & Broome, Ann. Mag. Nat. Hist., ser. 2, 7: 179. 1851. Fusarium foeni (Berk. & Broome) Sacc., Syll. Fung. 4: 699. 1886. Fusisporium roseolum H.O. Stephens ex Berk. & Broome, Ann. Mag. Nat. Hist., ser. 2, 7: 178. 1851. Fusarium roseolum (H.O. Stephens ex Berk. & Broome) Sacc., Syll. Fung. 4: 710. 1886. Fusisporium rimosum Peck, Rep. (Annual) New York State Mus. Nat. Hist. 30: 58. 1878. Fusarium rimosum (Peck) Sacc., Syll. Fung. 4: 713. 1886. 132 Fusarium roesleri Thüm., Pilze Weinst.: 51. 1878. Fusarium arvense Speg., Anales Soc. Ci. Argent. 10: 60. 1880. Fusarium gallinaceum Cooke & Harkn., Grevillea 9: 8. 1880. Fusarium nicotianae Oudem., Ned. Kruidk. Arch., s
er. 3, 2: 777. 1902. Fusarium udum var. pusillum Wollenw., Phytopathology 1: 206. 1913, nom. nud. Fusarium udum var. solani Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 131. 1915. Fusarium merismoides f. nicotianae (Oudem.) Subram., Hyphomycetes: 676. 1971. Fusarium oxysporum f. sp. nicotianae (Oudem.) Subram., Hyphomycetes: 676. 1971. Fusarium pelargonii P. Crouan & H. Crouan, Fl. Finistere: 14. 1867. Fusarium albiziae Woron., Vestn. Tiflissk. Bot Sada 48: 34. 1920. Fusarium merismoides var. majus Wollenw., Fusaria Autogr. Delin. 3: 857a. 1930. Fusarium merismoides var. chlamydosporale Wollenw., Z. Parasitenk. (Berlin) 3: 308. 1931. Fusarium merismoides var. artocarpi X.H. Fu & Q.T. Chen, Acta Mycol. Sin. 8: 42. 1989. Fusarium merismoides var. persicicola X.H. Fu & Q.T. Chen, Acta Mycol. Sin. 8: 44. 1989. Typus: PRM 155493. Type locality: Czech Republic, Prague. Type substrate: Wet shards of a plant pot. Note: Lectotypification pending study of material lodged in PRM. mesentericum Fusarium Cooke & Harkn., Grevillea 9: 128. 1881. Holotypus: ?K(M). Type locality: USA, California, San Francisco Masonic Cemetery. Type substrate: Eucalyptus sp. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). mesoamericanum Fusarium T. Aoki et al., Fungal Genet. Biol. 41: 619. 2004. Holotypus: BPI 843476. Ex-type culture: CBS 415.86 = FRC R-8506 = IMI 309346 = NRRL 25797. Type locality: Honduras. Type substrate: Musa sp. Descriptions and illustrations: See O'Donnell et al. (2004). Diagnostic DNA barcodes: rpb1: KM361639; rpb2: KM361657; tef1: AF212441. metachroum Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: 141. 1910 [1913]. (See Fusarium avenaceum) Holotypus: BPI 452408. Type locality: Poland, Pozna
n, Slivno Manor. Type substrate: Triticum aestivum. Note: Synonym fide Wollenweber & Reinking (1935). metavorans Fusarium Al-Hatmi et al., Medical Mycol. 56: S147. 2018. Neocosmospora metavorans (Al-Hatmi et al.) Sand.-Den. & Crous, Persoonia 41: 121. 2018. Holotypus: CBS 135789 (preserved as metabolically inactive culture). Ex-type culture: CBS 135789. Type locality: Greece, Athens. Type substrate: Pleural effusion of Homo sapiens. FUSARIUM Descriptions and illustrations: See Al-Hatmi et al. (2018) and Sandoval-Denis & Crous (2018). Diagnostic DNA barcodes: rpb1: MW218127; rpb2: LR583849; tef1: LR583627. mexicanum Fusarium T. Aoki et al., Phytopathology 100: 1180. 2010. Holotypus: BPI 879150. Ex-type culture: NRRL 53147. Type locality: Mexico, Nueva Italia, Michoac
an. Type substrate: Mangifera indica. Descriptions and illustrations: See Otero-Colina et al. (2010). Diagnostic DNA barcodes: rpb1: MG838088; rpb2: MN724973; tef1: MG838032. microcera Fusarium Bilaĭ, Fusarii (Biologija i sistematika): 292. 1955, nom. inval., Art. 39.1. (See Fusarium coccidicola) Note: This species was invalidly published without Latin diagnosis. microconidium Fusarium L. Lombard & Crous, Fungal Syst. Evol. 4: 192. 2019. Holotypus: CBS H-24017. Ex-type culture: CBS 119843 = MRC 8391 = KSU 11396. Type locality: Unknown. Type substrate: Unknown. Descriptions and illustrations: See Lombard et al. (2019a). Diagnostic DNA barcodes: rpb1: MN120721; tef1: MN120759. microphlyctis Fusarium Mont., Ann. Sci. Nat., Bot., s
er. 3, 12: 297. 1849. Holotypus: ?PC. Type locality: France. Type substrate: Fruit of Olea sp. Note: Gloeosporium fide Wollenweber & Reinking (1935). micropus Fusarium Sacc., Philipp. J. Sci. 18: 605. 1921. Infrafungus micropus (Sacc.) Cif., Mycopathol. Mycol. Appl. 6: 26. 1951. Holotypus: In PAD. Type locality: China, Guangdong Province. Type substrate: Parasitic on Cladosporium herbarum on leaf of Morus alba. microspermum Fusarium Berk. & M.A. Curtis, Grevillea 3: 98. 1875. Holotypus: ?K(M). Type locality: USA, South Carolina, Santee River. Type substrate: Ficus sp. Note: Hymenula fide Wollenweber & Reinking (1935). microsporum Fusarium Schltdl., Fl. Berol. 2: 139. 1824. (See Fusarium lateritium) Holotypus: HAL 1615 F. Type locality: Germany, Berlin. Type substrate: Robinia pseudoacaciae. Note: Synonym fide Wollenweber & Reinking (1935). mikaniae Fusarium Berk. & M.A. Curtis, Grevillea 3: 98. 1875. Holotypus: ?K(M). Type locality: USA, South Carolina, Santee River. Type substrate: Stems and leaves of Mikania scandens. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). www.studiesinmycology.org REDELIMITED mindoanum Fusarium Petr., Sydowia 4: 576. 1950. Holotypus: In W as no. 03550 (Petrak, Pilzherbarium no. 32229). Type locality: Ecuador, Pichincha, Mindo. Type substrate: Dryopteris diplazioides. Notes: No living material available to confirm taxonomic status. Requires recollection from type locality and substrate. miniatulum Fusarium Sacc., Syll. Fung. 10: 727. 1892. Replaced synonym: Fusarium miniatum Prill. & Delacr., Bull. Soc. Mycol. France 7: 117. 1891, nom. illegit., Art. 53.1 (See Fusarium nivale) Holotypus: Not located. Type locality: France, Paris. Type substrate: Secale cereale. Note: Synonym fide Wollenweber & Reinking (1935). miniatum Fusarium Sacc., Michelia 1: 83. 1877. Synonym: Fusarium detonianum Sacc., Syll. Fung. 4: 708. 1886, nom. illegit., Art. 52.1. Holotypus: In PAD. Type locality: Italy. Type substrate: Sporangium of Cyathus vernicosa. Note: Status unclear. Requires further investigation. miniatum Fusarium (Berk. & M.A. Curtis) Sacc., Syll. Fung. 4: 722. 1886, nom. illegit., Art. 53.1. Basionym: Fusisporium miniatum Berk. & M.A. Curtis, Grevillea 3: 147. 1875. (See Fusarium lateritium) Holotypus: ?K(M). Type locality: USA, North Carolina. Type substrate: Cornus florida. Note: Synonym fide Wollenweber & Reinking (1935). miniatum Fusarium Prill. & Delacr., Bull. Soc. Mycol. France 7: 117. 1891, nom. illegit., Art. 53.1. Replacing synonym: Fusarium miniatulum Sacc., Syll. Fung. 10: 727. 1892 (See Fusarium nivale) Authentic material: Not located. Original locality: France, Paris. Original substrate: Secale cereale. Note: Synonym fide Wollenweber & Reinking (1935). minimum Fusarium Fuckel, Fungi Rhen. Exs., Fasc. 3, no. 213. 1863. (See Fusarium nivale) Syntypes: In BPI, MICH, MU & S (Fungi Rhen. Exs., Fasc. 3, no. 213). Type locality: Germany, Oestrich, Nassau region. Type substrate: Dry leaves of Poaceae (mainly Zea mays) Note: Synonym fide Wollenweber & Reinking (1935). minutissimum Fusarium (Desm.) Sacc., Syll. Fung. 4: 703. 1886. Passalora minutissima (Desm.) U. Braun & Crous, CBS Biodiversity Ser. 1: 276. 2003. Basionym: Selenosporium minutissimum Desm., Pl. Crypt. France, ed. 3, Fasc. 10: no. 456. 1857. Phaeoramularia minutissima (Desm.) U. Braun, Nova Hedwigia 55: 214. 1992. Ramularia geranii-sanguinei C. Massal., Atti Ist. Veneto Sci. Lett. Arti 59: 688. 1900. Cercospora geranii-sanguinei Henn., Nytt Mag. Naturvidensk. 42: 33. 1904. 133 CROUS ET AL. Lectotypus: Desm., Pl. Crypt. France, Fasc. X, no. 456 in PC fide Braun (1998). Lectotype locality: France, Louvigny, Caen. Lectotype substrate: Geranium molle. minutulum Fusarium Corda, Icon. Fung. 2: 4. 1838. ?Clonostachys solani (Harting) Schroers & W. Gams, Stud. Mycol. 46: 111. 2001. Basionym: Spicaria solani Harting, Nieuwe Verh. Eerste Kl. Kon. Ned. Inst. Wetensch. Amsterdam, ser. 2, 12: 226. 1846. Synonyms: ?Gliocladium solani (Harting) Petch, Trans. Brit. Mycol. Soc. 27: 149. 1945. ?Hypomyces solani Reinke & Berthold, Untersuch. Bot. Lab. Univ. Göttingen 1: 27. 1879. ?Hypolyssus solani (Reinke & Berthold) Kuntze, Revis. Gen. Pl. 3: 488. 1898. ?Hyphonectria solani (Reinke & Berthold) Petch, Bot. J. (London) 74: 220. 1937 [1936]. ?Nectriopsis solani (Reinke & Berthold) C. Booth, Mycol. Pap. 74: 8. 1960. ?Bionectria solani (Reinke & Berthold) Schroers, Stud. Mycol. 46: 111. 2001. ?Gliocladium nigrovirens J.F.H. Beyma, Verh. Kon. Akad. Wetensch., Afd. Natuurk., Sect. 2, 29: 30. 1931. ?Clonostachys solani f. nigrovirens (J.F.H. Beyma) Schroers, Stud. Mycol. 46: 115. 2001. Typus: In PRM fide Pilat (1938). Type locality: Czech Republic, Prague. Type substrate: Wood splinters of Corylus sp. Notes: Synonym fide Wollenweber & Reinking (1935). Lectotypification pending study of material lodged in PRM. miscanthi Fusarium W. Gams et al., Mycologia 91: 264. 1999. Holotypus: CBS H-6063. Ex-type culture: CBS 577.97 = NRRL 26231. Type locality: Denmark, Zealand, Højbakkegård Experimental field. Type substrate: Miscanthus sinensis. Descriptions and illustrations: See Gams et al. (1999). Diagnostic DNA barcodes: rpb1: JX171521; rpb2: JX171634; tef1: MN193878. mollerianum Fusarium Thüm., Inst. Coimbra 28: 263. 1881. (See Fusarium graminearum) Holotypus: ?S-F45644. Type locality: Portugal, Coimbra. Type substrate: Melia azedarach. Note: Synonym fide Wollenweber & Reinking (1935). moniliforme Fusarium J. Sheld., Annual Rep. Nebraska Agric. Exp. Sta. 17: 23. 1904. (See Fusarium verticillioides) Syntypes: BPI 452450 & BPI 452452. Type locality: USA, Nebraska. Type substrate: Zea mays. Note: Typification pending further study of the syntypes. monophialidicum Fusarium J.W. Xia et al., Persoonia 43: 211. 2019. Holotypus: CBS H-24063. Ex-type culture: NRRL 54973 = UTHSC 06-1473. Type locality: USA, Ohio. Type substrate: Eye of Rhinocerotidae (rhinoceros). Descriptions and illustrations: See Xia et al. (2019). 134 Diagnostic DNA barcodes: rpb1: KC808299; rpb2: KC808362; tef1: MN170483. mori Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 2. 2020. Neocosmospora mori Sand.-Den. & Crous, Persoonia 43: 143. 2019. Holotypus: CBS H-23987. Ex-type culture: ATCC 44934 = CBS 145467 = MAFF 238539 = NRRL 22230. Type locality: Japan, Miyazaki. Type substrate: Twigs of Morus alba. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834235; rpb2: EU329499; tef1: AF178358. moronei Fusarium Curzi, Revista Biol. (Lisbon) 10: 141. 1928. (See Fusarium acuminatum) Holotypus: ?PAV. Type locality: Italy. Type substrate: Vesicle on skin of Canis lupus familiaris (dog). Note: Synonym fide Wollenweber & Reinking (1935). moschatum Fusarium (Kitasato) Sacc., Syll. Fung. 10: 729. 1892. Basionym: Fusisporium moschatum Kitasato, Centralbl. Bakteriol. Parasitenk., 1. Abth. 5: 365. 1889. (See Fusarium aquaeductuum) Holotypus: Not located. Type locality: Germany. Type substrate: Metallic medical equipment. Note: Synonym fide Wollenweber & Reinking (1935). mucidum Fusarium J.W. Xia et al., Persoonia 43: 211. 2019. Holotypus: CBS H-24064. Ex-type culture: CBS 102395. Type locality: El Salvador, Cooperaci
on Coralama. Type substrate: Mouldy nut of Anacardium occidentale. Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb2: MN170418; tef1: MN170485. muentzii Fusarium Delacr. (as ‘müntzii’), Bull. Soc. Mycol. France 8: 192. 1892. (See Fusarium tricinctum) Lectotypus (hic designatus, MBT 10000715): France, Paris, on animal waste, May 1891, G. Delacroix, Bull. Soc. Mycol. France 8, pl. XVII, fig. V. multiceps Fusarium J.W. Xia et al., Persoonia 43: 212. 2019. Holotypus: CBS H-24065. Ex-type culture: CBS 130386 = NRRL 43639 = UTHSC 04-135. Type locality: USA, Florida. Type substrate: Trichechus sp. Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb1: HM347190; rpb2: GQ505844; tef1: GQ505666. mundagurra Fusarium M.H. Laurence et al., Fungal Diversity 77: 359. 2015 [2016]. Holotypus: RBG5717. Ex-type culture: NRRL 66235 = RBG5717. Type locality: Australia, Queensland, Carnarvon Gorge National Park. Type substrate: Soil. Descriptions and illustrations: See Laurence et al. (2016). FUSARIUM Diagnostic DNA barcodes: rpb1: KP083272; rpb2: KP083276; tef1: KP083256. musae Fusarium Van Hove et al., Mycologia 103: 579. 2011. Synonym: Gibberella musae Van Hove et al., Mycologia 103: 577. 2011. Holotypus: MUCL 52574. Ex-type culture: CBS 624.87 = MUCL 52574 = NRRL 25059. Type locality: Honduras. Type substrate: Musa sp. Descriptions and illustrations: See Van Hove et al. (2011). Diagnostic DNA barcodes: rpb1: MW402689; rpb2: FN552108; tef1: FN552086. musarum Fusarium Logrieco & Marasas, Mycologia 90: 510. 1998. Holotypus: BPI 802928. Ex-type culture: FRC R-9400 = MRC 6240 = NRRL 28507. Type locality: Panama. Type substrate: Musa sapientum. Descriptions and illustrations: See Marasas et al. (1998). Diagnostic DNA barcodes: rpb1: MW233265; rpb2: MW928829; tef1: MW233094. mycophilum Fusarium (P. Karst.) Sacc., Syll. Fung. 10: 730. 1892. Basionym: Leptosporium mycophilum P. Karst., Meddel. Soc. Fauna Fl. Fenn. 16: 24. 1888. Holotypus: ?H. Type locality: Finland, Merimasku. Type substrate: Myxogastria. Note: Hymenula fide Wollenweber & Reinking (1935). mucophytum Fusarium (W.G. Sm.) Massee, Brit. Fung.-Fl. 3: 483. 1893. Basionym: Fusisporium mucophytum W.G. Sm., Gard. Chron. n.s., 22: 245. 1884. (See Fusarium scirpi) Holotypus: ?K(M). Type locality: UK. Type substrate: Agaricus arvensis. Note: Synonym fide Wollenweber & Reinking (1935). myosotidis Fusarium Cooke, Grevillea 16: 49. 1887. (See Fusarium oxysporum) Holotypus: In K(M). Type locality: UK, Forden. Type substrate: Myosotis sp. Note: Synonym fide Wollenweber & Reinking (1935). nanum Fusarium M.M. Wang et al., Persoonia 43: 85. 2019. Holotypus: HAMS 248043. Ex-type culture: CGMCC 3.19498 = LC12168. Type locality: China, Guangxi Province, Guilin. Type substrate: Leaves of Musa nana. Descriptions and illustrations: See Wang et al. (2019). Diagnostic DNA barcodes: rpb1: MK289871; rpb2: MK289755; tef1: MK289602. napiforme Fusarium Marasas et al., Mycologia 79: 910. 1988 [1987]. Holotypus: DAOM 196924. Ex-type culture: BBA 69861 = CBS 748.97 = DAOM 196924 = DAOM 225147 = FRC M-3563 = IMI 375353 = MRC 4144 = NRRL 13604. Type locality: Namibia, Ovambo. www.studiesinmycology.org REDELIMITED Type substrate: Pennisetum typhoides. Descriptions and illustrations: See Marasas et al. (1987). Diagnostic DNA barcodes: rpb1: HM347136; rpb2: EF470117; tef1: AF160266. nectriae-palmicolae Fusarium Henn., Bot. Jahrb. Syst. 23: 290. 1896. (See Fusarium equiseti) Holotypus: In B fide Hein (1988). Type locality: Samoa, Upolu. Type substrate: Leaves of Areca sp. Note: Synonym fide Wollenweber & Reinking (1935). nectriae-turraeae Fusarium Henn., Bot. Jahrb. Syst. 22: 82. 1895. (See Fusarium coccophilum) Holotypus: In B fide Hein (1988). Type locality: Tanzania, Marangu. Type substrate: Turraea volkensii. Note: Synonym fide Wollenweber & Reinking (1935). nectricreans Fusarium Kirschst., Ann. Mycol. 37: 138. 1939. Holotypus: B 70 0100202. Type locality: Germany, Berlin. Type substrate: Rotting stem of garden plant. Note: No living material was available for confirmation of taxonomic status. nectrioides Fusarium (Wollenw.) Schroers et al., Mycologia 101: 59. 2009. Bisifusarium nectrioides (Wollenw.) L. Lombard & Crous, Stud. Mycol. 80: 225. 2015. Basionym: Fusarium dimerum var. nectrioides Wollenw., Fusaria Autogr. Delin. 3: 855. 1930. Lectotypus: No. 855 in Wollenweber, Fusaria Autogr. Delin. (1930), designated in Schroers et al. (2009). Ex-type culture: CBS 176.31 = NRRL 20689. Lectotype and ex-type locality: Honduras. Lectotype and ex-type substrate: Soil. Descriptions and illustrations: See Schroers et al. (2009). Diagnostic DNA barcodes: rpb1: JX171477; rpb2: JX171591; tef1: EU926312. neglectum Fusarium Jacz., Bull. Trimestriel Soc. Mycol. France 28: 348. 1912. (See Fusarium culmorum) Holotypus: Not located. Type locality: Ukraine, Poltava. Type substrate: Zea mays. Note: Synonym fide Wollenweber & Reinking (1935). negundinis Fusarium Sherb., in Hubert, J. Agric. Res. 26: 451. 1923. (See Fusarium reticulatum) Holotypus: Not located. Type locality: USA, Wisconsin, Madison. Type substrate: Acer negundo. Note: Synonym fide Wollenweber & Reinking (1935). nelsonii Fusarium Marasas & Logrieco, Mycologia 90: 508. 1998. Holotypus: BPI 802927. Ex-type culture: CBS 119876 = FRC R-8670 = MRC 4570 = NRRL 28505 = NRRL 53945. Type locality: South Africa, Western Cape Province, Malmesbury. 135 CROUS ET AL. Type substrate: Plant debris in Triticum soil. Descriptions and illustrations: See Marasas et al. (1998). Diagnostic DNA barcodes: rpb1: MN120722; rpb2: GQ505468; tef1: GQ505404. nematophilum Fusarium Nirenberg & Hagedorn, Nachrichtenbl. Deutsch. Pflanzenschutzdienstes 60: 214. 2008. Luteonectria nematophila (Nirenberg & Hagedorn) Sand.-Den. & L. Lombard, Stud. Mycol. 98 (no. 100116): 60. 2021. Holotypus: BBA 72279 in B. Ex-type culture: BBA 72279 = NRRL 54600. Type locality: Germany, Berlin. Type substrate: Isolated from soil with roots of Hedera helix. Descriptions and illustrations: See Nirenberg & Hagedorn (2008). Diagnostic DNA barcodes: rpb1: JX171552; rpb2: JX171664; tef1: JABFFA010003988. neoceras Fusarium Wollenw. & Reinking, Phytopathology 15: 164. 1925. (See Fusarium sacchari) Holotypus: CBS 147.25 (preserved as metabolically inactive culture). Ex-type culture: BBA 69863 = CBS 147.25 = DAOM 225410 = IMI 375345= NRRL 20471. Type locality: Honduras. Type substrate: Rotting Musa sapientum. Descriptions and illustrations: See Gerlach & Nirenberg (1982). Diagnostic DNA barcodes: rpb1: MT010941; rpb2: MT010962; tef1: MT010988. neocosmosporiellum Fusarium O'Donnell & Geiser, Phytopathology 103: 405. 2013. Neocosmospora vasinfecta E.F. Sm., Bull. Div. Veg. Physiol. Pathol. U.S.D.A. 17: 45. 1899. Synonyms: Nectriella tracheiphila E.F. Sm., Proc. Amer. Assoc. Advancem. Sci. 44: 190. 1896, nom. inval. fide Cannon & Hawksworth 1984. Neocosmospora vasinfecta var. nivea E.F. Sm., Bull. Div. Veg. Physiol. Pathol. U.S.D.A. 17: 45. 1899. Neocosmospora vasinfecta var. tracheiphila E.F. Sm., Bull. Div. Veg. Physiol. Pathol. U.S.D.A. 17: 45. 1899. Fusarium tracheiphilum (E.F. Sm.) Wollenw., Phytopathology 3: 29. 1913. Fusarium vasinfectum var. pisi C.J.J. Hall, Ber. Deutsch. Bot. Ges. 21: 4. 1903. Neocosmospora vasinfecta var. pisi (C.J.J. Hall) Sacc., Syll. Fung. 20: 192. 1911. Neocosmospora africana Arx, Antonie van Leeuwenhoek 21: 161. 1955. Neocosmospora vasinfecta var. africana (Arx) P.F. Cannon & D. Hawksw., Trans. Brit. Mycol. Soc. 82: 676. 1984. ?Pseudonectria ornata Bat. & Maia, Anais Soc. Biol. Pernambuco 13: 74. 1955 (fide Cannon & Hawksworth 1984). Neocosmospora vasinfecta var. major P. Rama Rao, Mycopathol. Mycol. Appl. 21: 218. 1963. Neocosmospora ornamentata M.A.F. Barbosa, Garcia de Orta 13: 17. 1965. Fusarium ornamentatum (M.A.F. Barbosa) O'Donnell et al., Index Fungorum 440: 3. 2020. Neocosmospora vasinfecta f. conidiifera Kamyschko, Novosti Sist. Nizsh. Rast. 1965: 115. 1965. Neocosmospora boninensis Udagawa et al., Sydowia 41: 350. 1989. 136 Lectotypus: Pl. V, figs 1–2 (Smith, Bull. Div. Veg. Physiol. Pathol. U.S.D.A. 17, 1899), designated in Sandoval-Denis et al. (2019). Lectotype locality: USA. Lectotype substrate: Gossypium sp. Epitypus: BPI 910920, designated in Aoki et al. (2020). Ex-epitype culture: ATCC 62199 = NRRL 22166. Epitype locality: USA, Illinois, southern area. Epitype substrate: A cyst of Heterodera glycines in a soil sample from soybean field. Diagnostic DNA barcodes: rpb1: SSHR01002742; rpb2: EU329497; tef1: AF178350. neoscirpi Fusarium L. Lombard et al., Persoonia 43: 213. 2019. Holotypus: CBS H-24066. Ex-type culture: CBS 610.95 = NRRL 26861 = NRRL 26922. Type locality: France. Type substrate: Soil. Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb2: GQ505779; tef1: GQ505601. neosemitectum Fusarium L. Lombard et al., Persoonia 43: 214. 2019. Holotypus: CBS H-24067. Ex-type culture: CBS 189.60. Type locality: Democratic Republic of the Congo. Type substrate: Musa sapientum. Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb2: MN170422; tef1: MN170489. nepalense Fusarium T. Aoki et al., Fungal Genet. Biol. 48: 1105. 2011. Holotypus: BPI 881006. Ex-type culture: CBS 127503 = NRRL 54222. Type locality: Nepal. Type substrate: Oryza sativa. Descriptions and illustrations: See Sarver et al. (2011). Diagnostic DNA barcodes: rpb1: KM361650; rpb2: KM361668; tef1: KM889631. nervisequum Fusarium (Fuckel) Fuckel, Jahrb. Nassauischen Vereins Naturk. 23–24: 369. 1870. Basionym: Labrella nervisequa Fuckel, Fungi Rhen. Exs., Fasc. 5, no. 427. 1863. Apiognomonia platani (L
ev.) L. Lombard, comb. nov. MycoBank MB 837698. Basionym: Hymenula platani L
ev., Ann. Sci. Nat., Bot., s
er. 3, 9: 128. 1848. Synonyms: Fusarium platani (L
ev.) Mont., Ann. Sci. Nat., Bot., s
er. 3, 11: 55. 1849. Fusarium nervisequum f. platani (L
ev.) Fuckel, Jahrb. Nassauischen Vereins Naturk. 23–24: 369. 1870. Gloeosporidium platani (L
ev.) Höhn., Sitzungsber. Kaiserl. Akad. Wiss. Wien, Math.-Naturwiss. Cl., Abt. 1, 125: 95. 1916. Myxosporina platani (L
ev.) Höhn., Hedwigia 62: 48. 1920, nom. inval., Art. 35.1. Gloeosporium nervisequum (Fuckel) Sacc., Syll. Fung. 3: 711. 1884. Discula nervisequa (Fuckel) M. Morelet, Bull. Soc. Sci. Nat. Arch
eol. Toulon & Var 203: 12. 1973. Gloeosporium platani Oudem., Ned. Kruidk. Arch., s
er. 2, 1: 258. 1873. Laestadia veneta Sacc. & Speg., Michelia 1: 351. 1878. Carlia veneta (Sacc. & Speg.) Kuntze, Revis. Gen. Pl. 2: 846. 1891. FUSARIUM Apiospora veneta (Sacc. & Speg.) Sacc. ex Kleb., Z. Pflanzenkrankh. 12: 258. 1902. Gnomonia veneta (Sacc. & Speg.) Kleb., Jahrb. Wiss. Bot. 41: 533. 1905, nom. illegit., Art. 53.1. Gnomonia platani Kleb., Verhandl. Deutsch. Bot. Ges. 1: 28. 1914. Guignardia veneta (Sacc. & Speg.) Traverso, Fl. Ital. Crypt. 1: 392. 1907. Apiosporopsis veneta (Sacc. & Speg.) Traverso, Syll. Fung. 22: 78. 1913. Apiognomonia veneta (Sacc. & Speg.) Höhn., Ann. Mycol. 16: 51. 1918. Laestadia veneta var. cylindrasca Sacc. & Speg., Michelia 1: 369. 1878. Laestadia cylindrasca (Sacc. & Speg.) Sacc., Syll. Fung. 1: 422. 1882. Carlia cylindrasca (Sacc. & Speg.) Kuntze, Revis. Gen. Pl. 2: 846. 1891. Guignardia cylindrasca (Sacc. & Speg.) Lindau (as ‘cylindracea’), in Engler & Prantl, Nat. Pflanzenfam., Teil. I, 1(1): 422. 1897. Diaporthe veneta Sacc. & Speg., Michelia 1: 383. 1878. Discella platani Peck, Rep. (Annual) New York State Mus. Nat. Hist. 29: 49. 1878, nom. illegit., Art. 53.1. Discula platani Sacc., Syll. Fung. 3: 674. 1884. Sporonema platani B€aumler, Oesterr. Bot. Z. 40: 17. 1890. Placosphaeria platani (B€aumler) Limber, Mycologia 47: 398. 1955. Myxosporium platanicola Ellis & Everh. (as ‘platanicolum’), Proc. Acad. Nat. Sci. Philadelphia 46: 372. 1894. Cryptosporiopsis platanicola (Ellis & Everh.) G.F. Laundon, CBS List of Cultures (Baarn): (1). 1975. Gloeosporidina platani Butin & Kehr, Eur. J. Forest Pathol. 28: 299. 1998. Lectotypus: BPI (Fuckel, Fungi Rhen. 427) of Labrella nervisequa Fuckel, designated in Sogonov et al. (2007). Lectotype locality: Germany, Reichartshausen. Lectotype substrate: Plantanus orientalis. Epitypus: BPI 871953, designated in Sogonov et al. (2007). Epitype locality: Switzerland, Geneva. Epitype substrate: Plantanus orientalis. Notes: Based on priority and synonymies proposed by Sogonov et al. (2007), the name Hymenula platani L
ev. (1848) takes precedence over Laestadia veneta Sacc. & Speg. (1878). Therefore, a new combination is proposed here applying the older name. newnesense Fusarium M.H. Laurence et al., Fungal Diversity 77: 360. 2015 [2016]. Holotypus: RBG 610. Ex-type culture: NRRL 66241 = RBG 610. Type locality: Australia, New South Wales, Newnes State Forest. Type substrate: Soil. Descriptions and illustrations: See Laurence et al. (2016). Diagnostic DNA barcodes: rpb1: JABCJW010000176; rpb2: JABCJW010000963; tef1: KP083261. ngaiotongaense Fusarium O'Donnell et al., Index Fungorum 440: 3. 2020. Neocosmospora longissima Sand.-Den. & Crous, Persoonia 43: 141 (2019). www.studiesinmycology.org REDELIMITED Holotypus: CBS H-23985. Ex-type culture: CBS 126407 = G.J.S. 85-72. Type locality: New Zealand, Russell State Forest, Ngaiotonga Scenic Reserve. Type substrate: From tree bark. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834230; rpb2: LR583846; tef1: LR583621. nicotianae Fusarium Oudem., Ned. Kruidk. Arch., s
er. 3, 2: 777. 1902. (See Fusarium merismoides) Holotypus: ?L. Type locality: Netherlands, Noord-Holland Province, Bussum. Type substrate: Nicotiana tabacum. nigrum Fusarium O.A. Pratt, J. Agric. Res. 13: 90. 1918. (See Fusarium flocciferum) Lectotypus (hic designatus, MBT 10000716): USA, Idaho, from soil, 1918, O.A. Pratt, in J. Agric. Res. 13: 82, fig. 1J–L. Notes: Synonym fide Wollenweber & Reinking (1935). As the holotype specimen was not located, an illustration accompanying the original protologue is designated here as lectotype. nirenbergiae Fusarium L. Lombard & Crous, Persoonia 43: 29. 2018 [2019]. Holotypus: CBS H-23619. Ex-type culture: CBS 840.88. Type locality: Netherlands, Noord-Holland Province, Aalsmeer. Type substrate: Dianthus caryophyllus. Descriptions and illustrations: See Lombard et al. (2019b). Diagnostic DNA barcodes: rpb2: MH484887; tef1: MH484978. nisikadoi Fusarium T. Aoki & Nirenberg, Mycoscience 38: 330. 1997. Holotypus: BBA 69015 in B. Ex-type culture: BBA 69015 = CBS 456.97 = MAFF 237506 = NRRL 25205 = NRRL 25308. Type locality: Japan, Oita, Hita. Type substrate: Triticum aestivum. Descriptions and illustrations: See Nirenberg & Aoki (1997). Diagnostic DNA barcodes: rpb1: MG282391; rpb2: MG282421; tef1: KR909358. nitidum Fusarium Berk. & M.A. Curtis, Grevillea 3: 98. 1875. Holotypus: ?K(M). Type locality: USA, Pennsylvania, Michener. Type substrate: Aralia spinosa. Note: Doubtful species fide Wollenweber & Reinking (1935). nivale Fusarium Ces. ex Berl. & Voglino, Syll. Fung., Addit. I–IV: 390. 1886. Microdochium nivale (Fr.) Samuels & I.C. Hallett, Trans. Brit. Mycol. Soc. 81: 479. 1983. Basionym: Lanosa nivalis Fr., Summa Veg. Scand. 2: 495. 1849. Synonyms: Fusarium nivale (Fr.) Sorauer, Z. Pflanzenkrankh. 11: 220. 1901, nom. illegit., Art. 53.1. Fusarium hibernans Lindau, Rabenh. Krypt.-Fl., ed. 2, 1(9): 542. 1909, nom. superfl., Art. 52.1. Gerlachia nivalis (Ces. ex Berl. & Voglino) W. Gams & E. Müll., Netherlands J. Pl. Pathol. 86: 49. 1980. Fusarium minimum Fuckel, Fungi Rhen. Exs., Fasc. 3, no. 213. 1863. 137 CROUS ET AL. Fusarium ustilaginis Rostr., Bot. Foren. Festskr. 54: 137. 1890, nom. illegit., Art. 53.1. Fusarium miniatum Prill. & Delacr., Bull. Soc. Mycol. France 7: 117. 1891, nom. illegit., Art. 53.1. Fusarium tritici Erikss., Fungi Paras. Scand. Exs. no. 400. 1891, nom. illegit., Art. 53.1. Fusarium miniatulum Sacc., Syll. Fung. 10: 727. 1892. Nectria pseudograminicola Weese, Ann. Mycol. 8: 466. 1910, nom. inval., Art. 38.1.
Fusarium loliaceum Ducomet, Ann. Ecole Natl. Agric. Rennes 2: 14. 1909. Fusarium secalis Jacz., Bull. Trimestriel Soc. Mycol. France 28: 346. 1912, nom. illegit., Art. 53.1. Sphaerulina divergens Rehm, Ann. Mycol. 11: 397. 1913. Monographella divergens (Rehm) Petr., Ann. Mycol. 22: 144. 1924. Calonectria nivalis Schaffnit, Mycol. Centralbl. 2: 257. 1913. Griphosphaeria nivalis (Schaffnit) E. Müll. & Arx, Phytopathol. Z. 24: 356. 1955. Micronectriella nivalis (Schaffnit) C. Booth, The Genus Fusarium: 42. 1971. Monographella nivalis (Schaffnit) E. Müll., Rev. Mycol. (Paris) 41: 132. 1977. Calonectria graminicola F. Stevens, Bot. Gaz. 65: 232. 1918, nom. illegit., Art. 53.1. Melioliphila graminicola Speg., Bol. Acad. Ci. (C
ordoba) 26: 344. 1921. Calonectria graminicola var. neglecta Krampe, Angew. Bot. 8: 252. 1926. Monographella nivalis var. neglecta (Krampe) Gerlach, Netherlands J. Pl. Pathol. 86: 49. 1980. Fusarium nivale var. oryzae Zambett., Mitt. Inst. Colombo-Aleman Invest. Ci. 30: 489. 1950, nom. inval., Art. 39.1. Syntypes: In HAL & ILL [Rabenhorst, Klotzschii Herb. Viv. Mycol. no. 1439 (sub F. oxysporum)]. Type locality: Italy. Type substrate: Poaceae. niveum Fusarium E.F. Sm., Proc. Amer. Assoc. Advancem. Sci. 43: 289. 1894, nom. inval., Art. 36.1(a). (See Fusarium oxysporum) Authentic material: Not located. Original locality: USA. Original substrate: Citrullus vulgaris. niveum Fusarium McAlpine, Australas. J. Pharm. 17: 3. 1902. Note: Unable to locate protologue. nodosum Fusarium L. Lombard & Crous, Fungal Syst. Evol. 4: 193. 2019. Holotypus: CBS H-24018. Ex-type culture: CBS 201.63. Type locality: Portugal, Lisbon. Type substrate: Seed of Arachis hypogaea. Descriptions and illustrations: See Lombard et al. (2019a). Diagnostic DNA barcodes: rpb1: MN120725; rpb2: MN120743; tef1: MN120763. noneumartii Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 3. 2020. Neocosmospora noneumartii Sand.-Den. & Crous, Persoonia 43: 145. 2019. Holotypus: CBS H-23989. Ex-type culture: CBS 115658 = FRC S-0661. Type locality: Israel, Palestine. 138 Type substrate: Solanum tuberosum. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW218129; rpb2: MW446618; tef1: LR583630. nucicola Fusarium P. Karst. & Har., Rev. Mycol. (Toulouse) 12: 131. 1890. (See Fusarium lateritium) Holotypus: ?UPS fide Wollenweber, Fusaria Autogr. Delin. 1: 236. 1916. Type locality: France. Type substrate: Epicarp of nut. Note: Synonym fide Wollenweber & Reinking (1935). nurragi Fusarium (Summerell & L.W. Burgess) Benyon et al., Mycol. Res. 104: 1171. 2000. Basionym: Fusarium avenaceum subsp. nurragi Summerell & L.W. Burgess, Mycol. Res. 99: 289. 1995. Holotypus: DAR 69502. Ex-type culture: CBS 393.96 = DAR 69501 = F10108 = F11121. Type locality: Australia, Victoria, Wilson's Promontory National Park. Type substrate: Soil. Descriptions and illustrations: See Sangalang et al. (1995). Diagnostic DNA barcodes: rpb1: MW928814; rpb2: MW928830; tef1: MW928840. nygamai Fusarium L.W. Burgess & Trimboli, Mycologia 78: 223. 1986. Synonym: Gibberella nygamai Klaasen & P.E. Nelson, Mycologia 88: 967. 1997. Holotypus: FRC-M-1375. Ex-type culture: ATCC 58555 = BBA 69862 = CBS 749.97 = FRC M-1375 = IMI 375354 = NRRL 13448. Type locality: Australia, New South Wales, Narrabri. Type substrate: Necrotic roots of Sorghum sp. Descriptions and illustrations: See Burgess & Trimboli (1986). Diagnostic DNA barcodes: rpb1: LT996202; rpb2: KU604262; tef1: MT011009. obliquiseptatum Fusarium, T. Aoki et al., Mycologia 111: 929. 2019. Neocosmospora obliquiseptata (T. Aoki et al.) L. Lombard & Sand.-Den., comb. nov. MycoBank MB 837699. Basionym: Fusarium obliquiseptatum, T. Aoki et al., Mycologia 111: 929. 2019. Holotypus: BPI 910970. Ex-type culture: MAFF 246845 = NRRL 62611. Type locality: Australia, Queensland, Beerwah. Type substrate: A gallery wall of an ambrosia beetle (Euwallacea sp.) infecting Persea americana. Descriptions and illustrations: See Aoki et al. (2019). Diagnostic DNA barcodes: rpb1: KC691606; rpb2: KC691637, KC691666; tef1: KC691535. Note: A new combination is provided in the genus Neocosmospora based on the phylogenetic relationship (Aoki et al. 2019) and morphology. oblongum Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 3. 2020. Neocosmospora oblonga Sand.-Den. & Crous, Persoonia 43: 148. 2019. Holotypus: CBS H-23990. Ex-type culture: CBS 130325 = CDC B-4701= NRRL 28008. FUSARIUM Type locality: USA. Type substrate: Eye of Homo sapiens. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834239; rpb2: LR583853; tef1: LR583631. obtusatum Fusarium Corda, Icon. Fung. 1: 3. 1837. (See Fusarium tortuosum) Typus: In PRM fide Pilat (1938). Type locality: Czech Republic, Liberec (Reichenberg). Type substrate: Branches of trees and shrubs. Note: Not Fusarium fide Wollenweber & Reinking (1935). Lectotypification pending study of material lodged in PRM. obtusisporum Fusarium Cooke & Harkn., Grevillea 12: 97. 1884. Neonectria obtusispora (Cooke & Harkn.) Rossman et al., Phytopathol. Medit. 53: 529. 2014. Synonyms: Cylindrocarpon obtusisporum (Cooke & Harkn.) Wollenw., Fusaria Autogr. Delin. 1: 465. 1916. Ramularia obtusispora (Cooke & Harkn.) Wollenw., Fusaria Autogr. Delin. 1: 465. 1916. Fusarium lineare Moesz, Bot. Közlem. 19: 57. 1920. Holotypus: K(M) 128869. Type locality: USA, California. Type substrate: Twigs of Acacia sp. obtusiusculum Fusarium Sacc., Michelia 2: 297. 1881. (See Fusarium candidum Ehrenb.) Holotypus: In PAD. Type locality: Italy, Padua. Type substrate: Nelumbium sp. obtusum Fusarium (Cooke) Sacc., Syll. Fung. 4: 708. 1886. Basionym: Fusisporium obtusum Cooke, Grevillea 5: 58. 1876. Mycogloea macrospora (Berk. & Broome) McNabb, Trans. Brit. Mycol. Soc. 48: 187. 1965. Basionym: Dacrymyces macrosporus Berk. & Broome, Ann. Mag. Nat. Hist., ser. 4, 11: 343. 1873. Holotypus: In K(M) fide Index Fungorum. Type locality: UK, Scotland, Forres. Type substrate: Diatrype sp. ochraceum Fusarium (Mont.) Sacc., Syll. Fung. 4: 722. 1886. Basionym: Fusisporium ochraceum Mont., Ann. Sci. Nat., Bot., s
er. 2, 3: 355. 1835. Holotypus: In ?PC. Type locality: Chile, Juan Fern
andez Islands. Type substrate: Bark. Note: Not Fusarium fide Wollenweber & Reinking (1935). odoratissimum Fusarium Maryani et al., Stud. Mycol. 92: 159. 2019. Synonym: Fusarium purpurascens Maryani et al., Stud. Mycol. 92: 160. 2018 [2019a]. Holotypus: InaCC F822 (preserved as metabolically inactive culture). Ex-type culture: InaCC F822. Type locality: Indonesia, East Kalimantan, Kampung Salak Martadinata. Type substrate: Musa sp. cv. Pisang Kepok. Descriptions and illustrations: See Maryani et al. (2019a). Diagnostic DNA barcodes: rpb1: LS479618; rpb2: LS479386; tef1: LS479828. Notes: Re-analysis of the sequence data set of Maryani et al. (2019a) revealed that the ex-type strain of F. purpurascens www.studiesinmycology.org REDELIMITED (InaCC F971) clustered within the F. odoratissimum clade. Therefore, we consider F. purpurascens a synonym of F. odoratissimum. oidioides Fusarium Speg., Rev. Mycol. (Toulouse) 8: 183. 1886. Holotypus: In LPS (Fungi Japon. No. 2) fide Farr (1973). Type locality: Japan, Tokyo. Type substrate: Fallopia multiflora. Note: Not Fusarium fide Wollenweber & Reinking (1935). oligoseptatum Fusarium T. Aoki et al., Fung. Syst. Evol. 1: 29. 2018. Neocosmospora oligoseptata (T. Aoki et al.) Sand.-Den. & Crous, Persoonia 43: 149. 2019. Holotypus: BPI 910525. Ex-type culture: CBS 143241 = FRC S-2581 = MAFF 246283 = NRRL 62579. Type locality: USA, Pennsylvania, Dauphin. Type substrate: From a live female ambrosia beetle (Euwallacea validus), extracted from a gallery in a tree-of-heaven (Ailanthus altissima). Descriptions and illustrations: See Aoki et al. (2018). Diagnostic DNA barcodes: rpb1: KC691596; rpb2: KC691627, KC691656; tef1: KC691538. ophioides Fusarium A. Jacobs, et al., Persoonia 46: 149. 2021. Holotypus: CBS H-24659. Ex-type culture: CBS 118512 = FCC 2979 = FCC 2980 = MRC 6744. Type locality: South Africa, Mpumulanga Province, Ngodwana. Type substrate: Panicum maximum. Descriptions and illustrations: See Yilmaz et al. (2021). Diagnostic DNA barcodes: rpb2: MN534303; tef1: EU921239. opuli Fusarium Oudem., Hedwigia 37: 318. 1898. Holotypus: ?L. Type locality: Netherlands, Gelderland Province, Nunspeet. Type substrate: Viburnum opulus. Note: Not Fusarium fide Wollenweber & Reinking (1935). opuntiarum Fusarium Speg., Anales Mus. Nac. Hist. Nat. Buenos Aires 6: 350. 1898 [1899]. (See Fusarium oxysporum) Holotypus: In LPS (Fungi Argent. n.v.c. no. 866) fide Farr (1973). Type locality: Argentina, La Plata. Type substrate: Branches of Opuntia sp. Note: Synonym fide Wollenweber & Reinking (1935). orchidis Fusarium Petch, Ann. Roy. Bot. Gard. (Peradeniya) 6: 256. 1917. (See Fusarium reticulatum) Holotypus: PDA 4798. Type locality: Sri Lanka. Type substrate: Leaves of Orchidaceae. Note: Synonym fide Wollenweber & Reinking (1935). ornamentatum Fusarium (M.A.F. Barbosa) O'Donnell et al., Index Fungorum 440: 3. 2020. (See Fusarium neocosmosporiellum) Holotypus: CBS 562.70 (preserved as metabolically inactive culture). Ex-type culture: ATCC 32363 = CBS 562.70 = IMI 251387. Type locality: Guinea-Bissau. Type substrate: Stored nuts of Arachis hypogaea. Descriptions and illustrations: See Sandoval-Denis et al. (2019). 139 CROUS ET AL. Diagnostic DNA barcodes: rpb2: LR583901; tef1: DQ247606. Note: Synonym fide Sandoval-Denis et al. (2019). orobanches Fusarium Jacz., Ezhegodnik Svedeniy Boleznykh i Povrezhdeniyakh Kult'turnykh i Dikorastushchikh Poleznykh Rasteniy. Pertograd. 6: 190. 1910 [1912]. Holotypus: Not located. Type locality: Russia, Saratov. Type substrate: Orobanche sp. Notes: Status unclear. Could be a synonym of F. oxysporum. orthoceras Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: 155. 1910. (See Fusarium oxysporum) Syntypes: B 70 0100192 & B 70 0100193. Type locality: Germany, Berlin, Dahlem. Type substrate: Solanum tuberosum. Note: Typification pending further study of the syntypes in B. orthoconium Fusarium Wollenw., Fusaria Autogr. Delin. 2: 637. 1926. Mycogloea orthospora (Syd.) McNabb ex Dingley, Mem. New York Bot. Gard. 49: 206. 1989. Basionym: Microcera orthospora Syd., Ann. Mycol. 22: 317. 1924, non Fusarium orthosporum Sacc. 1902. Synonyms: Fusarium microcera var. orthoconium (Wollenw.) Bilaĭ, Mikrobiol. Zhurn. 49: 7. 1987, nom. inval., Arts. 35.1, 41.4. Holotypus: Not located. Type locality: New Zealand, Wellington, York Bay. Type substrate: Nothofagus sp. orthosporum Fusarium Sacc. & P. Syd., Syll. Fung. 16: 1100. 1902. Cylindrodendrum orthosporum (Sacc. & P. Syd.) L. Lombard, comb. nov. MycoBank MB 837700. Basionym: Fusarium orthosporum Sacc. & P. Syd., Syll. Fung. 16: 1100. 1902. Synonyms: Cylindrocarpon orthosporum (Sacc. & P. Syd.) Wollenw., Fusaria Autogr. Delin. 1: 462. 1916. Ramularia orthospora (Sacc. & P. Syd.) Wollenw., Fusaria Autogr. Delin. 1: 462. 1916. Neonectria hubeiensis W.Y. Zhuang et al., Fungal Diversity 24: 351. 2007. Ilyonectria hubeiensis (W.Y. Zhuang et al.) Z.Q. Zeng & W.Y. Zhuang, Phytotaxa 85: 17. 2013. Cylindrodendrum hubeiense (W.Y. Zhuang et al.) L. Lombard & Crous, Phytopathol. Medit. 53: 523. 2014. Holotypus: In PAD. Type locality: France. Type substrate: Juglans nigra. Descriptions and illustrations: See Zhuang et al. (2007) and Lombard et al. (2014). Notes: The epithet of Fusarium orthosporum Sacc. & P. Syd (1902) predates that of Neonectria hubeiensis W.Y. Zhuang et al. (2007). Therefore, a new combination is proposed here with the older epithet. oryzae Fusarium Vincens, Rev. Pathol. Veg. Entomol. Agric. France 10: 126. 1923. Holotypus: ?PC. Type locality: Vietnam. Type substrate: Oryza sativa. Notes: Status unclear. Could be a synonym of F. fujikuroi. osiliense Fusarium Bres. & Vestergr., Bot. Not. 1900: 33. 1900. 140 Septogloeum oxysporum Sacc. et al., Bull. Soc. Roy. Bot. Belgique 29: 294. 1890. Syntypes: In BPI, NEB, S & UPS. Type locality: Estonia, Osilia. Type substrate: Briza media. Notes: Synonym fide Wollenweber & Reinking (1935). Typification pending further study of the syntypes. ossicola Fusarium (Berk. & M.A. Curtis) Sacc., Syll. Fung. 4: 714. 1886. Basionym: Fusisporium ossicola Berk. & M.A. Curtis, Grevillea 3: 147. 1875. (See Fusarium equiseti) Holotypus: ?K(M). Type locality: USA. Type substrate: Old decaying bones. Note: Synonyms fide Wollenweber & Reinking (1935). osteophilum Fusarium Speg., Anales Soc. Ci. Argent. 10: 60. 1880. (See Fusarium scirpi) Holotypus: In LPS (Fungi Argent. pug. 2, no. 155) fide Farr (1973). Type locality: Argentina, Rio de la Plata, La Recoleta. Type substrate: Decayed bones of Gallus sp. (chicken). Note: Synonym fide Wollenweber & Reinking (1935). otomycosis Fusarium Y.N. Ming & T.F. Yu, Acta Microbiol. Sin. 12: 178. 1966. Holotypus: Not located. Type locality: China, Beijing. Type substrate: Ear of Homo sapiens. Notes: Status unclear. Requires further investigation. oxydendri Fusarium Ellis & Everh., Bull. Torrey Bot. Club 24: 477. 1897. (See Fusarium cavispermum) Syntypes: In BPI, BRU, CLEM, CUP, F, FLAS, ILL, ILLS, ISC, MICH, MSC, MU, NEB, OSC, PH, PUL, UC & WIS. Type locality: USA, West Virginia. Type substrate: Oxydendrum arboreum. Notes: Synonym fide Wollenweber & Reinking (1935). Typification pending further study of the syntypes. oxysporum Fusarium Schltdl., Fl. Berol. 2: 139. 1824. Synonyms: Fusisporium aurantiacum Link, Mag. Ges. Naturf. Freunde Berlin 3: 19. 1809. Fusarium aurantiacum (Link) Sacc., Syll. Fung. 4: 720. 1886, nom. illegit., Art. 53.1. Fusarium aurantiacum Corda, in Sturm, Deutschl. Fl., 3 Abt. (Pilze Deutschl.) 2: 19. 1829. Fusarium oxysporum var. aurantiacum (Corda) Rabenh., Deutschl. Krypt.-Fl., 1: 51. 1844. Atractium aurantiacum (Corda) Bonord., Abh. Naturf. Ges. Halle 8: 135. 1851. Fusisporium lagenariae Schwein., Trans. Amer. Philos. Soc., n.s. 4: 275. 1834. Fusarium lagenariae (Schwein.) Sacc., Syll. Fung. 4: 724. 1886. Hymenula equiseti Lib., Pl. Crypt. Arduenna Fasc. 3: no. 236. 1834. Fusarium equisetorum (Lib.) Desm., Pl. Crypt. N. France no. 1546/1846? 1843. Fusarium parasiticum Thüm., Nuovo Giorn. Bot. Ital. 12: 198. 1880, nom. illegit., Art. 53.1. FUSARIUM Fusarium thuemenii Sacc., Syll. Fung. 4: 722. 1886. Fusisporium calcareum Thüm., Inst. Coimbra 28: 262. 1881. Fusarium calcareum (Thüm.) Sacc., Syll. Fung. 4: 712. 1886. Fusarium eucalyptorum Cooke & Harkn., Grevillea 9: 128. 1881. Fusarium oxysporum f. eucalypti (Cooke & Harkn.) Arya & G.L. Jain, Phytopathology 52: 641. 1962. Fusarium oxysporum f. lycopersici Sacc., Syll. Fung. 4: 705. 1886. Fusarium lycopersici (Sacc.) Mussat, Syll. Fung. 15: 144. 1901, nom. inval., Art. 36.1(a), (c). Fusarium lycopersici (Sacc.) Wollenw., Phytopathology 3: 29. 1913, nom. illegit., Art. 53.1. Fusarium bulbigenum Cooke & Massee, Grevillea 16: 49. 1887. Fusarium myosotidis Cooke, Grevillea 16: 49. 1887. Leptosporium mycophilum P. Karst., Meddel. Soc. Fauna Fl. Fenn. 16: 24. 1888. Fusarium mycophilum (P. Karst.) Sacc., Syll. Fung. 10: 730. 1892. ?Selenosporium cuticola R. Blanch., Compt. Rend. Hebd. S
eances Acad. Sci., Ser. D. 111: 479. 1890. ?Fusarium cuticola (R. Blanch.) Gu
eg., Champ. Paras. Homme: 262. 1904. Fusarium sclerodermatis Peck, Rep. (Annual) Regents Univ. State New York New York State Mus. 43: 77. 1890, nom. illegit., Art. 53.1. Fusarium peckii Sacc., Syll. Fung. 10: 727. 1892, nom. illegit., Art. 53.1 [pro. p. fide Wollenweber & Reinking (1935)]. Fusarium saccardoanum P. Syd., Syll. Fung. 14: 1128. 1899. Fusarium vasinfectum G.F. Atk., Bull. Alabama Agric. Exp. Sta. 41: 28. 1892. Fusarium cordae Massee, Brit. Fung.-Fl. 3: 481. 1893. Fusarium niveum E.F. Sm., Proc. Amer. Assoc. Advancem. Sci. 43: 289. 1894, nom. inval., Art. 36.1(a). Fusarium bulbigenum var. niveum E.F. Sm. ex Wollenw., Fusarien: 117. 1931. Fusarium blasticola Rostr. (as ‘blasticolum’), Gartn.-Tidende 1895: 122. 1895. Fusoma blasticola (Rostr.) Sacc. & Traverso, Syll. Fung. 20: 1241. 1911. Fusarium bulbigenum var. blasticola (Rostr.) Wollenw., Z. Parasitenk. (Berlin) 3: 412. 1931. Fusarium beticola A.B. Frank, Kampfbuch gegen die Sch€adlinge unserer Feldfrüchte: 137. 1897. Fusarium dianthi Prill. & Delacr., Compt. Rend. Hebd. S
eances Acad. Sci. 129: 745. 1899. Fusarium oxysporum f. dianthi (Prill. & Delacr.) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 27: 66. 1940. Fusarium oxysporum var. dianthi (Prill. & Delacr.) Raillo, Fungi of the Genus Fusarium: 255. 1950. Fusarium opuntiarum Speg., Anales Mus. Nac. Hist. Nat. Buenos Aires 6: 350. 1898 [1899]. Fusoma pini Hartig, Lehrb. Pflanzenkrankh., Bot., Forstl., Landw. G€art.: 116. 1900. Fusarium laxum Peck, Bull. New York State Mus. Nat. Hist. 67: 30. 1903. Fusarium lini Bolley, Proc. Annual Meeting Soc. Promot. Agric. Sci. 22: 42. 1902. Fusarium oxysporum f. lini (Bolley) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 27: 66. 1940. Fusarium tabacivorum Delacr., Ann. Inst. Natl. Rech. Agron., ser. 2, 5: 207. 1906. Fusarium candidulum Sacc., Ann. Mycol. 6: 567. 1908. Fusarium cubense E.F. Sm., Science, N.Y. 31: 754. 1910. www.studiesinmycology.org REDELIMITED Fusarium oxysporum var. cubense (E.F. Sm.) Wollenw., Fusarien: 119. 1935. Fusarium oxysporum f. cubense (E.F. Sm.) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 27: 66. 1940. Fusarium orthoceras Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: 155. 1910. Fusarium oxysporum var. orthoceras (Appel & Wollenw.) Bilaĭ, Microbiol. Zhurn. 49: 7. 1987. ?Fusarium violae F.A. Wolf, Mycologia 2: 21. 1910. Fusarium albidoviolaceum Dasz. (as ‘albido-violaceum’), Bull. Soc. Bot. Geneve, s
er. 2, 4: 293. 1912. Fusarium orthoceras var. albidoviolaceum (Dasz.) Wollenw., Fusaria Autogr. Delin. 1: 361. 1916. Fusarium lycopersici Bruschi, Atti Reale Accad. Lincei, Rendiconti Cl. Sci. Fis., ser. 5, 21: 298. 1912. Fusarium bulbigenum var. lycopersici (Bruschi) Wollenw. & Reinking, Fusarien: 114. 1935. Fusarium citrinum Wollenw., in Lewis, Bull. Maine Agric. Exp. Sta. 219: 256. 1913. Fusarium conglutinans var. citrinum (Wollenw.) Wollenw., Z. Parasitenk. (Berlin) 3: 407. 1931. Fusarium conglutinans Wollenw., Ber. Deutsch. Bot. Ges. 31: 34. 1913. Fusarium orthoceras var. conglutinans (Wollenw.) Padwick, Indian J. Agric. Sci. 10: 282. 1940. Fusarium oxysporum f. conglutinans (Wollenw.) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 27: 66. 1940. Fusarium elegans Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: 94. 1913, nom. inval., Art. 36.1(a) (non Fusarium elegans W. Yamam. & Maeda 1962). Fusarium batatas Wollenw. (as ‘batatae’), J. Agric. Res. 2: 268. 1914. Fusarium bulbigenum var. batatas (Wollenw.) Wollenw., Z. Parasitenk. (Berlin) 3: 414. 1931. Fusarium oxysporum f. batatas (Wollenw.) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 27: 66. 1940. Fusarium cepae Hanzawa, Mycol. Centralbl. 5(1): 5. 1914. Fusarium oxysporum f. cepae (Hanzawa) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 27: 66. 1940. Fusarium oxysporum var. cepae (Hanzawa) Raillo, Fungi of the Genus Fusarium: 253. 1950. Fusarium hyperoxysporum Wollenw., J. Agric. Res. 2: 268. 1914. Fusarium angustum Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 203. 1915. Fusarium lutulatum Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 209. 1915. Fusarium vasinfectum var. lutulatum (Sherb.) Wollenw., Fusaria Autogr. Delin. 3: 1019. 1930. Fusarium lutulatum var. zonatum Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 214. 1915. Fusarium zonatum (Sherb.) Wollenw., Fusaria Autogr. Delin. 1: 392. 1916. Fusarium vasinfectum var. zonatum (Sherb.) Wollenw., Fusaria Autogr. Delin. 3: 1020. 1930. Fusarium oxysporum var. asclerotium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 222. 1915. Fusarium asclerotium (Sherb.) Wollenw., Fusaria Autogr. Delin. 1: 364. 1916. Fusarium sclerotioides Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 214. 1915. Fusarium sclerotioides var. brevius Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 218. 1915. 141 CROUS ET AL. Fusarium trifolii Jacz., Jahrb. Pflanzenkrankh. Russl. VII-VIII: Abt. 6. 1917. Fusarium citrulli Taubenh., Bull. Texas Agric. Exp. Sta. 260: 27. 1920. Fusarium malvacearum Taubenh., Bull. Texas Agric. Exp. Sta. 260: 27. 1920. Fusarium poolense Taubenh., Bull. Texas Agric. Exp. Sta. 260: 27. 1920. Fusarium macroxysporum Lindf., Meddel. Centralanst. Försöksv€as. Jordbruksomr. Avd. Lantbruksbot. 25: 8. 1922. Fusarium spinaciae Hungerf., Phytopathology 13: 209. 1923. Fusarium cromyophthoron Sideris, Phytopathology 14: 212. 1924. Fusarium loncheceras Sideris, Phytopathology 14: 213. 1924. Fusarium loncheceras var. microsporon Sideris, Phytopathology 14: 213. 1924. Fusarium rhizochromatistes Sideris, Phytopathology 14: 212. 1924. Fusarium sclerostromaton Sideris, Phytopathology 14: 213. 1924. Fusarium zonatum f. 1 Link & Bailey, J. Agric. Res. 33: 941. 1926. Fusarium zonatum f. 2 Link & Bailey, J. Agric. Res. 33: 941. 1926. Fusarium conglutinans var. betae D. Stewart, Phytopathology 21: 67. 1931. Fusarium oxysporum f. betae (D. Stewart) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 27: 66. 1940. Fusarium oxysporum f. 7 Wollenw., Fusaria Autogr. Delin. 4: 1176. 1935 Fusarium apii P.E. Nelson & Sherb., Techn. Bull. Michigan Agric. Exp. Sta 155: 42. 1937. Fusarium orthoceras var. apii (R. Nelson & Sherb.) Wollenw. & Reinking, Fusarien: 112. 1935. Fusarium oxysporum f. apii (R. Nelson & Sherb.) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 27: 66. 1940. Fusarium apii var. pallidum R. Nelson & Sherb., Techn. Bull. Michigan Agric. Exp. Sta. 155: 42. 1937. Fusarium bulbigenum var. apii (R. Nelson & Sherb.) Raillo, Fungi of the Genus Fusarium: 251. 1950. Cylindrophora albedinis Kill. & Maire, Bull. Soc. Hist. Nat. Afrique N. 21: 97. 1930, nom. inval., Art. 36.1(b). Fusarium oxysporum var. albedinis Kill. & Maire ex Malençon, Rev. Mycol. (Paris) 15: 45– 60. 1950, nom. inval., Art. 36.1(b). Fusarium oxysporum f. sp. albedinis Kill. & Maire ex W.L. Gordon, Canad. J. Bot. 43: 1310. 1965. Fusarium perniciosum Hepting, Circ. U.S.D.A. 535: 7. 1939. Fusarium oxysporum f. perniciosum (Hepting) Toole, Phytopathology 31: 599. 1941. Fusarium vasinfectum var. perniciosum (Hepting) Carrera, Rev. Fac. Agron. Buenos Aires 13(3): 483 1955 ?Fusarium retusum Wellman, Phytopathology 33: 957. 1943. Holotypus: HAL 1612 F. Epitypus: CBS H-23620, designated in Lombard et al. (2019b). Ex-epitype culture: CBS 144134. Type locality: Germany, Berlin. Type substrate: Solanum tuberosum. Descriptions and illustrations: See Lombard et al. (2019b) Diagnostic DNA barcodes: rpb2: MH484953; tef1: MH485044. 142 palczewskii Fusarium Jacz., Bull. Soc. Mycol. France 28: 345. 1912. (See Fusarium avenaceum) Lectotypus (hic designatus, MBT 10000717): Russia, Ussuriysk, Primorsky krai (Far East Territory), grain of Lolium sp., 1912, A.A. Jaczewski, in Bull. Soc. Mycol. France 28: 345, fig. 1. Notes: Synonyms fide Wollenweber & Reinking (1935). As no holotype specimen could be located; an illustration accompanying the original protologue is designated here as lectotype. pallens Fusarium Berk. & M.A. Curtis, Grevillea 3: 99. 1875, nom. illegit., Art. 53.1. Replacing synonym: Fusarium glumarum Sacc., Syll. Fung. 4: 706. 1886. (See Fusarium incarnatum) Authentic material: Car. Inf. no. 3799, in K(M). Original locality: USA. Original substrate: Juncus sp. Note: Synonyms fide Wollenweber & Reinking (1935). pallens Fusarium (Nees & T. Nees) Link, Sp. pl. 6(2): 104. 1825. Basionym: Atractium pallens Nees & T. Nees, Nova Acta Phys.Med. Acad. Caes. Leop.-Carol. Nat. Cur. 9: 237. 1818. Synonyms: Volutella pallens (Nees & T. Nees) Fr., Syst. Mycol. 3: 468. 1832. Selenosporium pallens (Nees & T. Nees) Corda, Icon. Fung. 1: 7. 1837. Holotypus: In B. Type locality: Germany. Type substrate: Fallen branch. Notes: The type material of Atractium pallens is deposited at B and examined by Gr€afenhan et al. (2011), identifying it as a coelomycete. pallidoroseum Fusarium (Cooke) Sacc., Syll. Fung. 4: 720. 1886. Basionym: Fusisporium pallidoroseum Cooke, Grevillea 6: 139. 1878. (See Fusarium incarnatum) Holotypus: S. Car. no. 2279 in ?K(M). Type locality: USA, South Carolina, Aiken. Type substrate: Chenopodium anthelminticum. Note: Synonyms fide Wollenweber & Reinking (1935). pallidulum Fusarium Sacc. & Trotter, Syll. Fung. 22: 1483. 1913. Replaced synonym: Atractium pallidum Bonord., Handb. Mykol.: 135. 1851. Synonym: Fusarium pallidum (Bonord.) Sacc. & Traverso, Syll. Fung. 19: 727. 1910, nom. illegit., Art. 53.1. Lectotypus (hic designatus, MBT 10000718): Germany, decaying bark, 1913, H.F. Bonorden, in Handb. Mykol., tab. 10, fig. 219. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). As no holotype specimen could be located, an illustration accompanying the original protologue is designated here as lectotype. pallidum Fusarium Berk. & M.A. Curtis, J. Linn. Soc., Bot. 10: 359. 1869. Holotypus: In K(M). Type locality: Cuba. Type substrate: Dead twigs. FUSARIUM Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). palustre Fusarium W.H. Elmer & Marra, sp. nov. MycoBank MB 837702. Synonym: Fusarium palustre W.H. Elmer & Marra, Mycologia 103(4): 815. 2011, nom. inval., Art. 40.7. Etymology. ‘palustre’, from Latin palus, referring to marsh habitat in which this fungus is found. For diagnosis see Elmer & Marra, Mycologia 103(4): 815. 2011. Holotypus: CBS 126795 (preserved as metabolically inactive culture). Ex-type culture: CBS 126796 = NRRL 54056. Type locality: USA, Connecticut, Madison, Hammonasset Beach State Park. Type substrate: Spartina alterniflora. Descriptions and illustrations: See Elmer & Marra (2011). Diagnostic DNA barcodes: rpb1: KT597718; rpb2: KT597731; tef1: GQ856941. Notes: Elmer & Marra (2011) failed to indicate the holotype for F. palustre, rendering the species name invalid (Art. 40.7). Here we validate the name. pampini Fusarium Thüm. & Pass., Pilze Weinst.: 50. 1878. Gloeosporium physalosporae Cavara, Rev. Mycol. (Toulouse) 10: 99. 1888. Holotypus: Not located. Type locality: Italy, Parma. Type substrate: Vitis vinifera. Note: Synonym fide Wollenweber & Reinking (1935). pandani Fusarium (Corda) Sacc., Syll. Fung. 4: 724. 1886. Basionym: Fusisporium pandani Corda, Icon. Fung. 1: 11. 1837. Lectotypus (hic designatus, MBT 10000719): Czech Republic, Liberec (Reichenberg), Pandanus sp., 1837, A.C.J. Corda, in Icon. Fung. 1, tab. 2, fig. 162. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). As no holotype specimen could be located, an illustration accompanying the original protologue is designated here as lectotype. pannosum Fusarium Massee, Bull. Misc. Inform. Kew 1898: 117. 1898. (See Fusarium sambucinum) Holotypus: K(M) 191093. Type locality: India, Punjab. Type substrate: Cornus macrophylla. Note: Synonym fide Wollenweber & Reinking (1935). paraeumartii Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 3. 2020. Neocosmospora paraeumartii Sand.-Den. & Crous, Persoonia 43: 149. 2019. Holotypus: CBS H-23991. Ex-type culture: BBA 62215 = CBS 487.76 = NRRL 13997. Type locality: Argentina. Type substrate: Decaying stem base of Solanum tuberosum. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834240; rpb2: LR583855; tef1: DQ247549. paranaense Fusarium S.S. Costa et al., Fungal Biology 120: 55. 2015 [2016]. (See Fusarium falciforme) www.studiesinmycology.org REDELIMITED Holotypus: CML 1830. Ex-type culture: CBS 141593 = CML 1830. Type locality: Brazil, Goi
as State, Cristalina. Type substrate: Diseased tissue of Glycine max. Descriptions and illustrations: See Costa et al. (2016). Diagnostic DNA barcodes: rpb2: KF680011; tef1: KF597797. Note: Synonym fide Sandoval-Denis et al. (2019). parasiticum Fusarium Westend., Bull. Acad. Roy. Sci. Belgique, Cl. Sci., s
er. 2, 11: 652. 1861. (See Fusarium ciliatum) Holotypus: BR5020140791441. Type locality: Belgium, Louette-Saint-Pierre. Type substrate: Sphaeria gigaspora. Note: Synonym fide Wollenweber & Reinking (1935). parasiticum Fusarium Thüm., Nuovo Giorn. Bot. Ital. 12: 198. 1880, nom. illegit., Art. 53.1. Replacing synonym: Fusarium thuemenii Sacc., Syll. Fung. 4: 722. 1886. (See Fusarium oxysporum) Authentic material: Not located. Original locality: Russia, Orenburg. Original substrate: Betula pendula. Note: Synonyms fide Wollenweber & Reinking (1935). parasiticum Fusarium Ellis & Kellerm., J. Mycol. 3: 127. 1887, nom. illegit., Art. 53.1. Replacing synonym: Fusarium pucciniophilum Sacc. & P. Syd., Syll. Fung. 14: 1128. 1899. (See Fusarium heterosporum) Authentic material: Kellerman & Swingle 1104 in NY. Original locality: USA, Manhattan. Original substrate: Parasitic on Puccinia seymeriae on Swietenia macrophylla. Note: Synonyms fide Wollenweber & Reinking (1935). parasiticum Fusarium Fautrey, Rev. Mycol. (Toulouse) 11: 153. 1889, nom. illegit., Art. 53.1. Replacing synonym: Fusarium fautreyi Sacc., Syll. Fung. 10: 934. 1892. (See Fusarium lateritium) Authentic material: BR5020140789424. Original locality: France, Noidan. Original substrate: Vitis vinifera. Note: Synonyms fide Wollenweber & Reinking (1935). parceramosum Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 3. 2020. Neocosmospora parceramosa Sand.-Den. & Crous, Persoonia 43: 151. 2019. Holotypus: CBS H-23992. Ex-type culture: CBS 115695 = CPC 1246. Type locality: South Africa. Type substrate: Soil. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb2: JX435249; tef1: JX435149. parvisorum Fusarium Herron et al., Stud. Mycol. 80: 146. 2015. Holotypus: PREM 60897. Ex-type culture: CBS 137236 = CMW 25267. Type locality: Colombia, Vivero, Pe~nas Negra, Valle del Cauca. Type substrate: Pinus patula. Descriptions and illustrations: See Herron et al. (2015). 143 CROUS ET AL. Notes: Comparisons of recently generated sequences for the living ex-type (CBS 137236 = CMW 25267) of F. parvisorum indicate a strain transposition or contamination by another Fusarium species. Therefore, this species needs to be recollected from the type locality and substrate or sequences need to be generated from the holotype specimen to confirm that it is indeed distinct. paspali Fusarium Henn., Bot. Jahrb. Syst. 38: 129. 1905. (See Fusarium avenaceum) Syntype: In B as Zenker, Georg August, no. 2152 fide Hein (1988). Type locality: Cameroon, Bipindi. Type locality: Paspalum sp. Notes: Synonym fide Wollenweber & Reinking (1935). Typification pending further study of the syntype in B. paspalicola Fusarium Henn., in Warburg, Monsunia 1: 38. 1899 [1900]. (See Fusarium heterosporum) Holotypus: In B fide Wollenweber, Fusaria Autogr. Delin. 1: 299. (1916) & Hein (1988). Type locality: Philippines, Mindanao, Davao. Type substrate: Paspalum sp. Note: Synonym fide Wollenweber & Reinking (1935). patouillardii Fusarium Sacc. (as ‘patouillardi’), Syll. Fung. 10: 729. 1892. Replaced synonym: Fusarium uredinicola Pat. & Gaillard, Bull. Soc. Mycol. France 4: 127. 1888, nom. illegit., Art. 53.1. Holotypus: ?PC or FH. Type locality: Venezuela, Caracas. Type substrate: Parasitic on Sphaerellopsis filum on Puccinia pallidissima. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). peckii Fusarium Sacc., Syll. Fung. 4: 713. 1886. Replaced synonym: Fusisporium parasiticum Peck, Rep. (Annual) New York State Mus. Nat. Hist. 29: 53. 1878, non Fusarium parasiticum Westend. 1861. Holotypus: NYSf2260. Type locality: USA, New York, Albany. Type substrate: Sphaeria collinsii. Notes: Status unclear. Not treated by Wollenweber & Reinking (1935) or Booth (1971). peckii Fusarium Sacc., Syll. Fung. 10: 727. 1892, nom. illegit., Art. 53.1. Replaced synonyms: Fusarium sclerodermatis Peck, Rep. (Annual) Regents Univ. State New York New York State Mus. 43: 77. 1890, nom. illegit., Art. 53.1, non Fusarium sclerodermatis Oudem. 1889. Fusarium saccardoanum Syd., Syll. Fung. 13: 1130. 1898. (See Fusarium oxysporum pr. p. & Fusarium avenaceum pr. p.) Authentic material: NYSf2731. Original locality: USA, New York, Suffolk. Original substrate: Scleroderma vulgaris. Note: Synonyms fide Wollenweber & Reinking (1935). pelargonii Fusarium P. Crouan & H. Crouan, Fl. Finistere: 14. 1867. (See Fusarium merismoides) Holotypus: ?PC. Type locality: France, Finistere. 144 Type substrate: Pelargonium sp. Note: Synonym fide Wollenweber & Reinking (1935). peltigerae Fusarium Westend., Herb. Crypt. Belg. Fasc. 9: no. 414. 1849. (See Fusarium ciliatum) Syntypes: In BR & PH (Herb. Crypt. Belg. 9: no. 414). Type locality: Belgium. Type substrate: Peltigera rufescens. Notes: Synonym fide Wollenweber & Reinking (1935). Typification pending further study of the syntypes. penicillatum Fusarium (Harz) Sacc., Syll. Fung. 4: 710. 1886. Basionym: Menispora penicillata Harz, Bull. Soc. Imp. Naturalistes Moscou 44: 127. 1871. (See Fusarium avenaceum) Lectotypus (hic designatus, MBT 10000720): Germany, Berlin, decaying Sclerotium clavus, 1886, C. Harz, in Bull. Soc. Imp. Naturalistes Moscou 44, tab. 1, fig. 4. Notes: Synonym fide Wollenweber & Reinking (1935). As no holotype specimen could be located, an illustration accompanying the original protologue is designated here as lectotype. pentaclethrae Fusarium Henn., Hedwigia 44: 71. 1905. (See Fusarium coccidicola) Syntype: In B (Ule no. 3011) fide Hein (1988). Type locality: Brazil, Manaus, Rio Nigro. Type substrate: Leaves of Pentaclethra sp. Notes: Synonym fide Wollenweber & Reinking (1935). Typification pending further study of the syntype in B. penzigii Fusarium Schroers et al., Mycologia 101: 61. 2009. Bisifusarium penzigii (Schroers et al.) L. Lombard & Crous, Stud. Mycol. 80: 225. 2015. Holotypus: CBS H-20125. Ex-type culture: CBS 317.34 = NRRL 22109. Type locality: UK, Surrey. Type substrate: Decayed wood of Fagus sylvatica. Descriptions and illustrations: See Schroers et al. (2009). Diagnostic DNA barcodes: rpb1: KM232211; rpb2: KM232362; tef1: EU926324. pernambucanum Fusarium A.C.S. Santos et al., Mycologia 111: 253. 2019. Holotypus: URM 91193. Ex-type culture: MUM 1862 = URM 7559. Type locality: Brazil, Pernambuco, Paudalho. Type substrate: Aleurocanthus woglumi. Descriptions and illustrations: See Santos et al. (2019). Diagnostic DNA barcodes: rpb1: MH668869; rpb2: LS398519; tef1: LS398489. perniciosum Fusarium Hepting, Circul. U.S.D.A. 535: 7. 1939. (See Fusarium oxysporum) Holotypus: Not located. Type locality: USA. Type substrate: Albizia julibrissin. persicae Fusarium (Sacc.) G.F. Atk., J. Elisha Mitchell Sci. Soc. 8: 41. 1892. Basionym: Cercospora persicae Sacc. (as ‘persica’), Hedwigia 15: 119. 1876. Mycosphaerella pruni-persicae Deighton, Trans. Brit. Mycol. Soc. 50: 328. 1967. FUSARIUM Synonyms: Cercosporella persicae (Sacc.) Sacc. (as ‘persica’), Michelia 2: 20. 1880. Clasterosporium persicae (Sacc.) Tsuji, Ann. Phytopathol. Soc. Japan 1(2): 33. 1919. Miuraea persicae (Sacc.) Hara, Byogaichu-Hoten (Manual of Pests and Diseases): 224. 1948. Mycosphaerella persicae B.B. Higgins & F.A. Wolf (as ‘persica’), Phytopathology 27: 695. 1937. Syntype: In HAL, ILL & NEB (Saccardo, Mycoth. Ven. no. 598). Type locality: Italy. Type substrate: Prunus persica. persicinum Fusarium J.W. Xia et al., Persoonia 43: 215 2019. Holotypus: CBS H-24068. Ex-type culture: CBS 479.83. Type locality: Unknown. Type substrate: Unknown. Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb2: MN170428; tef1: MN170495. personatum Fusarium Cooke, in Harkness, Grevillea 7: 12. 1878. (See Fusarium allescherianum) Holotypus: ?K(M). Type locality: USA, California. Type substrate: Oreodaphne californica. Note: Synonym fide Wollenweber & Reinking (1935). perseae Fusarium (Sand.-Den. & Guarnaccia) O'Donnell et al., Index Fungorum 440: 3. 2020. Neocosmospora perseae Sand.-Den. & Guarnaccia, Fungal Syst. Evol. 1: 136. 2018. Holotypus: CBS H-23433. Ex-type culture: CBS 144142 = CPC 26829. Type locality: Italy, Catania, San Leonardello. Type substrate: Trunk canker lesions on Persea americana. Descriptions and illustrations: See Guarnaccia et al. (2018). Diagnostic DNA barcodes: rpb1: MW218130; rpb2: LT991909; tef1: LT991902. peruvianum Fusarium L. Lombard & Crous, Fungal Syst. Evol. 4: 194. 2019. Holotypus: CBS H-24019. Ex-type culture: CBS 511.75. Type locality: Peru. Type substrate: Seedlings of Gossypium sp. Descriptions and illustrations: See Lombard et al. (2019a). Diagnostic DNA barcodes: rpb1: MN120728; rpb2: MN120746; tef1: MN120767. pestis Fusarium Sorauer, Atlas Pfl.-Krankh. 4: 19, pl. XXV. 1890. (See Fusarium azukiicola) Holotypus: Not located. Type locality: Germany. Type substrate: Solanum tuberosum. Note: Synonym fide Wollenweber & Reinking (1935). petersiae Fusarium L. Lombard, Persoonia 39: 457. 2017. Holotypus: CBS H-23233. Ex-type culture: CBS 143231. Type locality: Netherlands, Gelderland Province, Arnhem. Type substrate: Soil. Descriptions and illustrations: See Crous et al. (2017). Diagnostic DNA barcodes: rpb1: MG386139; rpb2: MG386150; tef1: MG386160. www.studiesinmycology.org REDELIMITED petroliphilum Fusarium (Q.T. Chen & X.H. Fu) Geiser et al., Fungal Genet. Biol. 53: 69. 2013. Neocosmospora petroliphila (Q.T. Chen & X.H. Fu) Sand.Den. & Crous, Persoonia 41: 121. 2018. Basionym: Fusarium solani var. petroliphilum Q.T. Chen & X.H. Fu, Acta Mycol. Sin., Suppl. 1: 330. 1987. Synonyms: Fusarium solani f. sp. cucurbitae (Race 2) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 28: 740. 1941. Holotypus: HMAS 43748. Ex-type culture: FRC S-2176 = NF4475 = NRRL 22268. Type locality: China, Beijing. Type substrate: Deteriorated petroleum. Descriptions and illustrations: See Sandoval-Denis & Crous (2018). peziziforme Fusarium Berk. & M.A. Curtis (as ‘pezizaeforme’), J. Linn. Soc., Bot. 10: 360. 1869. Holotypus: In K(M). Type locality: Cuba. Type substrate: Poaceae. Note: Not Fusarium fide Wollenweber & Reinking (1935). pezizoides Fusarium Desm., Ann. Sci. Nat., Bot., s
er. 3, 18: 373. 1852. Trochila craterium (DC.) Fr., Summa Veg. Scand. 2: 367. 1849. Basionym: Sphaeria craterium DC., Fl. Franç., ed. 3, 2: 298. 1805. Synonyms: Phacidium craterium (DC.) Gillet, Champ. France Discomyc. (7): 167. 1886. Sphaeria punctiformis var. hederae Pers., Syn. Meth. Fung. 1: 90. 1801. Myxosporium paradoxum De Not., Mem. Reale Accad. Sci. Torino, ser. 2, 3: 81. 1841. Gloeosporium paradoxum (De Not.) Mont., in Berkeley & Broome, Ann. Mag. Nat. Hist. 5: 455. 1850. Gloeosporidium paradoxum (De Not.) Petr., Ann. Mycol. 20: 14. 1922. Cryptocline paradoxa (De Not.) Arx, Verh. Kon. Ned. Akad. Wetensch., Afd. Natuurk. 51: 115. 1957. Gloeotrochila paradoxa (De Not.) Petr., Sydowia 1: 50. 1947. Trochila craterium var. nucleata Rehm, Ber. Bayer. Bot. Ges. 13: 125. 1912. Ceuthospora hederae Grove, Bull. Misc. Inform. Kew 1923: 355. 1923. Holotypus: ?PC. Type locality: France. Type substrate: Peziza insidiosa. Note: Synonyms fide Wollenweber & Reinking (1935). pezizoideum Fusarium (Berk. & M.A. Curtis) Sacc., Syll. Fung. 4: 711. 1886. Basionym: Fusisporium pezizoideum Berk. & M.A. Curtis, Grevillea 3: 147. 1875. (See Fusarium sambucinum) Holotypus: ?K(M). Type locality: USA, Pennsylvania. Type substrate: Stems of herbaceous plants. Note: Synonyms fide Wollenweber & Reinking (1935). phacidioideum Fusarium Dearn., Mycologia 21: 331. 1929. Holotypus: JD 4303 in DAOM. Type locality: Canada, Vancouver, Stanley Park. Type substrate: Dead branches of Pseudotsuga taxifolia. 145 CROUS ET AL. Note: Status unclear; requires recollection from type locality and substrate. pharetrum Fusarium L. Lombard & Crous, Persoonia 43: 32. 2018 [2019]. Holotypus: CBS H-23621. Ex-type culture: CBS 144751 = CPC 30824. Type locality: South Africa. Type substrate: Aloidendron dichotomum. Descriptions and illustrations: See Lombard et al. (2019b). Diagnostic DNA barcodes: rpb1: MW928815; rpb2: MH484952; tef1: MH485043. phaseoli Fusarium (Burkh.) T. Aoki & O'Donnell, Mycologia 95: 671. 2003. Basionym: Fusarium martii f. phaseoli Burkh., Mem. Cornell Univ. Agric. Exp. Sta. 26: 1007. 1919. (See Fusarium azukiicola) Lectotypus (hic designatus, MBT 10000721): USA, New York, roots of Phaseolus vulgaris, 1919, W.H. Burkholder, in Mem. Cornell Univ. Agric. Exp. Sta. 26: 1009, fig. 134. Notes: Synonym fide Sandoval-Denis et al. (2019). Although Burkholder deposited several specimens in CUP, none are directly linked to the original protologue (Burkholder 1919). Several of these specimens appear to have been isolated from greenhouse assays undertaken by Burkholder. Therefore, an illustration accompanying the original protologue is designated here as lectotype. phialophorum Fusarium Maryani et al., Stud. Mycol. 92: 169. 2018 [2019]. Holotypus: InaCC F971 (preserved as metabolically inactive culture). Ex-type culture: InaCC F971. Type locality: Indonesia, South Kalimantan, Tanah Bumbu, Kampung Betung. Type substrate: Musa var. Pisang Awak. Descriptions and illustrations: See Maryani et al. (2019a). Diagnostic DNA barcodes: rpb1: LS479545; rpb2: LS479292; tef1: LS479741. phormii Fusarium Henn., Verh. Bot. Vereins Prov. Brandenburg 40: 175. 1898 [1899]. Colletotrichum phormii (Henn.) D.F. Farr & Rossman, Mycol. Res. 110: 1403. 2006. Synonym: Gloeosporium phormii (Henn.) Wollenw., Fusaria Autogr. Delin. No. 498. 1916, nom. illegit., Art. 53.1, non Gloeosporium phormii Sacc. 1915. Holotypus: B 70 0005220. Epitypus: CBS H-20720, designated in Damm et al. (2012). Ex-epitype: A.R. 3546 = CBS 118194. Type locality: Germany, Berlin. Type substrate: Phormium tenax. phragmiticola Fusarium Kirschst., Ann. Mycol. 34: 183. 1936, nom. inval., Art. 39.1. Authentic material: B 70 0100199, B 70 0100200, B 70010020. Original locality: Germany. Original substrate: Phragmites communis. phragmitis Fusarium Matsush., Icon. Microfung. Matsush. Lect.: 72. 1975, nom. inval., Art. 40.1. Authentic material: Not indicated. Original locality: Japan. Original substrate: Rotten wood of Fagus crenata. 146 phyllachorae Fusarium Henn., in de Wildeman, Mission E. Laurent, Fasc. 4: 363. 1907. Syntype: Laurent in B fide Hein (1988). Type locality: Democratic Republic of Congo, between Kinshasa and Kwamouth. Type substrate: Panicum maximum. Notes: Not Fusarium fide Wollenweber & Reinking (1935). Typification pending further study of the syntype in B. phyllogenum Fusarium (Cooke & Peck) Sacc., Syll. Fung. 4: 703. 1886. Basionym: Fusisporium phyllogenum Cooke & Peck, Rep. (Annual) New York State Mus. Nat. Hist. 29: 53. 1878. Syntype: NYSf2335. Type locality: USA, New York, Albany, Bethlehem. Type substrate: Erigeron annuum. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). Typification pending further study of the syntype in NYS. phyllophilum Fusarium Nirenberg & O'Donnell, Mycologia 90: 447. 1998. Holotypus: IMI 202874. Ex-type culture: BBA 63625 = CBS 216.76 = DAOM 225132 = IMI 375338 = NRRL 13617. Type locality: Italy. Type substrate: Dracaena deremensis. Descriptions and illustrations: See Nirenberg & O'Donnell (1998). Diagnostic DNA barcodes: rpb1: KF466399; rpb2: KF466410; tef1: KF466421. phyllostachydicola Fusarium W. Yamam., Trans. Mycol. Soc. Japan 3: 118. 1962. Basionym: Gibberella phyllostachydicola W. Yamam., Hyogo Univ. Agric. ser. Agric. Biol. 3: 15. 1957. Lectotypus (hic designatus, MBT 10000722): Japan, Tamba, Sasayama-cho, culms of Phyllostachys bambusoides, 31 Aug. 1956, W. Yamamoto, in Hyogo Univ. Agric. ser. Agric. Biol. 3: 17, figs 16–18. Descriptions and illustrations: See Yamamoto et al. (1957). Notes: This species requires recollection from the type host and locality. As no holotype specimen could be located, an illustration accompanying the original protologue is designated here as lectotype. pilosicola Fusarium Yilmaz et al., Persoonia 46: 152. 2021. Holotypus: PREM 63216. Ex-type culture: CMWF 1183 = NRRL 29124 = NY007.H7. Type locality: USA, Florida. Type substrate: Bidens pilosa. Descriptions and illustrations: See Yilmaz et al. (2021). Diagnostic DNA barcodes: rpb2: MN534248; tef1: MN534055. pininemorale Fusarium Herron et al., Stud. Mycol. 80: 146. 2015. Holotypus: PREM 60901. Ex-type culture: CBS 137240 = CMW 25243. Type locality: Colombia, Risaralda, Angela Maria (Santa Rosa). Type substrate: Pinus tecunumanii. Descriptions and illustrations: See Herron et al. (2015). Notes: Comparisons of recently generated sequences from the living ex-type (CBS 137240 = CMW 25243) of F. pininemorale indicate a strain transposition or contamination by another Fusarium species. Therefore, this species needs to be FUSARIUM recollected from the type locality and substrate or sequences need to be generated from the holotype specimen to confirm its phylogenetic affiliation. piperis Fusarium (F.C. Albuq.) O'Donnell et al., Index Fungorum 440: 3. 2020. Neocosmospora piperis (F.C. Albuq.) Sand.-Den. & Crous, Persoonia 43: 152. 2019. Basionym: Fusarium solani f. piperis F.C. Albuq., Circ. Inst. Agron. N. 5: 19. 1961. Holotypus: IAN 825 in the herbarium of Embrapa Amazo^nia Oriental. Epitypus: CBS H-23993, designated in Sandoval-Denis et al. (2019). Ex-epitype culture: CBS 145470 = CML 1888 = G.J.S. 8914 = NRRL 22570. Type locality: Brazil. Type substrate: Piper nigrum. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834241; rpb2: EU329513; tef1: AF178360.  si
c et al., Sci. Rep. 8(no. 1252): pisi Fusarium (F.R. Jones) A. Si 2. 2018, nom. inval., Art. F.5.1. Neocosmospora pisi (F.R. Jones) Sand.-Den. & Crous, Persoonia 43: 154. 2019. Basionym: Fusarium martii var. pisi F.R. Jones, J. Agric. Res. 26: 459. 1923. Synonyms: Fusarium solani f. pisi (F.R. Jones) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 28: 740. 1941. Fusarium vanettenii O'Donnell et al., Index Fungorum 440: 5. 2020. Fusarium solani var. martii ‘f 2’ Wollenw., Z. Parasitenk. (Berlin) 3: 290. 1931. Hypomyces solani f. sp. pisi Reichle, W.C. Snyder & Matuo, Nature 203: 664. 1964. Lectotypus: Jones (1923; fig. 1 on p. 463), designated in Sandoval-Denis et al. (2019). Epitypus: CBS H-23994, designated in Sandoval-Denis et al. (2019). Ex-epitype culture: ATCC MYA-4622 = CBS 123669 = NRRL 45880 = Vanetten 77-13-4. Type locality: USA. Type substrate: Sexual cross of parents from Pisum sativum and soil from a potato field.  si
c et al. (2018b) and Descriptions and illustrations: See Si Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: JX171543; rpb2: EU329640; tef1: FJ240352. plagianthi Fusarium (Dingley) O'Donnell & Geiser, Phytopathology 103: 404. 2013. Neocosmospora plagianthi (Dingley) L. Lombard & Crous, Stud. Mycol. 80: 227. 2015. Basionym: Nectria plagianthi Dingley, Trans. Roy. Soc. New Zealand 79: 196. 1951. ?Nectria pulverulenta Dingley, Trans. Roy. Soc. New Zealand 83: 657. 1956. Holotypus: PDD 10916. Type locality: New Zealand, Fiordland, Hollyford Valley. Type substrate: Plagianthus betulinus. Descriptions and illustrations: See Dingley (1951) and Samuels & Brayford (1994). www.studiesinmycology.org REDELIMITED platani Fusarium (L
ev.) Mont., Ann. Sci. Nat., Bot., s
er. 3, 11: 55. 1849. Basionym: Hymenula platani L
ev., Ann. Sci. Nat., Bot., s
er. 3, 9: 128. 1848 (See Fusarium nervisequum) Holotypus: ?PC. Type locality: France. Type substrate: Platanus orientalis. platanoidis Fusarium Oudem., Ned. Kruidk. Arch., s
er. 3, 2: 1131. 1904. Holotypus: ?L. Type locality: Netherlands, Gelderland Province, Nunspeet. Type substrate: Acer platanoides. Note: Not Fusarium fide Wollenweber & Reinking (1935). poae Fusarium (Peck) Wollenw., in Lewis, Bull. Maine. Agric. Exp. Sta. 219: 254. 1913 [1914]. Basionym: Sporotrichum poae Peck, Bull. New York State Mus. 67: 29. 1904 [1903]. Synonyms: Fusarium tricinctum f. poae (Peck) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 32: 663. 1945. Fusarium sporotrichiella var. poae (Peck) Bilaĭ, Yadovitye griby na zerne khlebnykh zlakov (Poisonous fungi on cereal seed): 86. 1953, nom. inval., Art. 39.1. Fusarium sporotrichiella var. poae (Peck) Bilaĭ, Microbiol. Zhurn. 49: 6. 1987, nom. inval., Arts. 35.1, 41.4. Sporotrichum anthophilum Peck, Bull. New York State Mus. 105: 28. 1906. Fusarium maydiperdum Bub
ak, Centralbl. Bakteriol. Parasitenk., 2. Abth. 31: 497. 1911. Holotypus: NYSf2393. Type locality: USA, New York, Geneva. Type substrate: Sheaths and culms of Poa pratensis. Epitypus (hic designatus, MBT 10000723): USA, North Dakota, Minot, from infected barley kernel, date and collector unknown, NRRL 26941 (preserved as metabolically inactive culture). Ex-epitype culture: NRRL 26941. Descriptions and illustrations: See Wollenweber & Reinking (1935), Booth (1971), Gerlach & Nirenberg (1982) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: KU171686; rpb2: KU171706; tef1: JABFFD010000730.1 Note: No living material linked to the holotype is available for this important mycotoxin producing species, and therefore, an epitype is designated here to provide taxonomic stability for this species. poincianae Fusarium Pass., Atti Reale Accad. Lincei, Rendiconti Cl. Sci. Fis., s
er. 4, 4: 105. 1888. Holotypus: Not located. Type locality: Italy, Parma. Type substrate: Poinciana gilliesii. Note: Not Fusarium fide Wollenweber & Reinking (1935). polymorphum Fusarium Matr., Rech. D
evel. Muc
ed.: 84. 1892. (See Fusarium sambucinum) Lectotypus (hic designatus, MBT 10000724): France, horse dung, 1892, L. Matruchot, in Rech. D
evel. Muc
ed., Pl. 7, figs 6–14. Notes: Synonym fide Wollenweber & Reinking (1935). As no holotype specimen could be located, an illustration accompanying the original protologue is designated here as lectotype. 147 CROUS ET AL. polymorphum Fusarium Marchal, Bull. Soc. Roy. Bot. Belgique 34: 145. 1895, nom. illegit., Art. 53.1. (See Fusarium aderholdii) Authentic material: Not located. Original locality: Belgium, Brussels. Original substrate: Homo sapiens. Notes: Synonym fide Wollenweber & Reinking (1935). polyphialidicum Fusarium Marasas et al., Mycologia 78: 678. 1986. (See Fusarium concolor) Holotypus: DAOM 192986. Ex-type culture: ATCC 60096 = CBS 961.87 = DAR 52851 = FRC M-2405 = MRC 3389 = NRRL 13459. Type locality: South Africa, Mpumalanga Province, Nelspruit. Type substrate: Plant debris in soil. Descriptions and illustrations: See Marasas et al. (1986). Diagnostic DNA barcodes: rpb1: JX171455; rpb2: JX171569; tef1: MH742681. poncetii Fusarium Guiart (as ‘ponceti’), Compt.-Rend. S
eances M
em. Soc. Biol. 73: 271. 1912, nom. inval., Art. 36.1(a). Authentic material: Not located. Original locality: ?France. Original substrate: Homo sapiens granuloma teleangiectaticum. Notes: Status unclear. Not treated by any of Wollenweber & Reinking (1935), Booth (1971), or Gerlach & Nirenberg (1982). Fusarium proliferatum var. minus Nirenberg, Mitt. Biol. Bundesanst. Land- Forstw. 169: 43. 1976. nom. inval., Art. 41.3. Lectotypus: Microfungi of the Solomon Islands and Papua-New Guinea: 11, fig 121.2, designated by Yilmaz et al. (2021). Lectotype locality: Papua New Guinea. Lectotype substrate: Forest soil. Epitypus: CBS 480.96 (preserved as metabolically inactive culture), designated by Yilmaz et al. (2021). Epitype locality: Papua New Guinea, Morobe Province, Bulolo. Epitype substrate: Forest soil. Ex-epitype culture: CBS 480.96 = IAM 14682 = NRRL 26427 = NY007.B6. Descriptions and illustrations: See Matsushima (1971), Yilmaz et al. (2021). Diagnostic DNA barcodes: rpb2: MN534272; tef1: MN534059. protoensiforme Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 3. 2020. Neocosmospora protoensiformis Sand.-Den. & Crous, Persoonia 43: 156. 2019. Holotypus: CBS H-23995. Ex-type culture: CBS 145471 = G.J.S. 90-168 = NRRL 22178. Type locality: Venezuela. Type substrate: Bark of dicot tree. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834244; rpb2: EU329498; tef1: AF178334. poolense Fusarium (as ‘poolensis’) Taubenh., Bull. Texas Agric. Exp. Sta. 260: 27. 1920. (See Fusarium oxysporum) Lectotypus (hic designatus, MBT 10000725): USA, Citrullus lanatus, 1920, J.J. Taubenhaus, in Bull. Texas Agric. Exp. Sta. 260: 30, fig. 8i. Notes: Synonym fide Wollenweber & Reinking (1935). As no holotype specimen could be located, an illustration accompanying the original protologue is designated here as lectotype. protractum Fusarium L
ev., Ann. Sci. Nat., Bot., s
er. 3, 9: 246. 1848. (See Fusarium lateritium) Holotypus: ?PC. Type locality: France, Romainville. Type substrate: Dead shoots of Solanum dulcamara. Note: Synonym fide Wollenweber & Reinking (1935). praegraminearum Fusarium Gr€afenhan & O'Donnell, Mycologia 108: 1232. 2016. Holotypus: PDD 47563. Ex-type culture: CBS 141369 = ICMP 8996 = NRRL 39664. Type locality: New Zealand, North Island, Levin (near Wellington). Type substrate: Litter in maize paddock. Descriptions and illustrations: See Gr€afenhan et al. (2016). Diagnostic DNA barcodes: rpb1: KX260125; rpb2: KX260126; tef1: KX260120. prunorum Fusarium McAlpine, Fungus Diseases of stone-fruit trees in Australia: 91. 1902. (See Fusarium candidum (Link) Sacc.) Lectotypus (hic designatus, MBT 10000726): Australia, Victoria, Melbourne, Burnley, from shriveled and blackened apricot fruit, Jun. 1900, D. McAlpine, in Fungus Diseases of stone-fruit trees in Australia (1902), pl. XX, fig. 42. Notes: Synonym fide Wollenweber & Reinking (1935). As no holotype specimen could be located, an illustration accompanying the original protologue is designated here as lectotype. prieskaense Fusarium G.J. Marais & Sand.-Den., Stud. Mycol. 98 (no. 100116): 50. 2021. Holotypus: CBS H-24660. Ex-type culture: CAMS 001176 = CBS 146498 = CPC 30826. Type locality: South Africa, Northern Cape Province, Prieska. Type substrate: Prunus spinosa. Descriptions and illustrations: See this study. Diagnostic DNA barcodes: rpb1: MW834190; rpb2: MW834007; tef1: MW834275. pseudacaciae Fusarium Rapaics, Z. Pflanzenkrankh. 25: 208. 1915. (See Fusarium lateritium) Holotypus: Not located. Type locality: Hungary, Debrecen. Type substrate: Robinia pseudoacaciae. Note: Synonym fide Wollenweber & Reinking (1935). proliferatum Fusarium (Matsush.) Nirenberg ex Gerlach & Nirenberg, Mitt. Biol. Bundesanst. Land- Forstw. 209: 309. 1982. Basionym: Cephalosporium proliferatum Matsush., Microfungi of the Solomon Islands and Papua-New Guinea: 11. 1971. Synonyms: Fusarium proliferatum (Matsush.) Nirenberg, Mitt. Biol. Bundesanst. Land- Forstw. 169: 38. 1976, nom. inval., Art. 41.3. 148 pseudensiforme Fusarium Samuels et al., Mycologia 103: 1323. 2011. Neocosmospora pseudensiformis Samuels et al., Mycologia 103: 1323. 2011. Holotypus: BPI 881226. Ex-type culture: CBS 125729 = FRC S-1834 = G.J.S 0295 = G.J.S 9318 = NRRL 46517. Type locality: Sri Lanka, Wagamba, Kurunegala, Arangakele. Type substrate: Bark of tree. FUSARIUM Descriptions and illustrations: See Nalim et al. (2011). Diagnostic DNA barcodes: rpb1: KC691615; rpb2: KC691645; tef1: KC691555. pseudoanthophilum Fusarium Nirenberg et al., Mycologia 90: 461. 1998. Holotypus: In B. Ex-type culture: BBA 69002 = CBS 414.97 = IMI 376112 = NRRL 25211. Type locality: Zimbabwe, Gambiza. Type substrate: Zea mays. Descriptions and illustrations: See Nirenberg et al. (1998). Diagnostic DNA barcodes: rpb1: MT010949; rpb2: MT010980; tef1: MK639073. pseudocircinatum Fusarium O'Donnell & Nirenberg, Mycologia 90: 448. 1998. Holotypus: B 70 0001689. Ex-type culture: BBA 69636 = CBS 126.73= CBS 449.97 = DAOM 225117 = IMI 375316 = NRRL 22946. Type locality: Ghana. Type substrate: Solanum sp. Descriptions and illustrations: See Nirenberg & O'Donnell (1998). Diagnostic DNA barcodes: rpb1: MG838070; rpb2: MN724939; tef1: MG838023. pseudoeffusum Fusarium Murashk., Proc. Siberian Agric. Acad. Omsk 3: 106. 1924. (See Fusarium acuminatum) Holotypus: Not located. Type locality: Russia, Siberia. Type substrate: Triticum polonicum. Note: Synonym fide Wollenweber & Reinking (1935). pseudograminearum Fusarium O'Donnell & T. Aoki, Mycologia 91: 604. 1999. Holotypus: BPI 746087. Ex-type culture: FRC R-5291 = NRRL 28062. Type locality: Australia, New South Wales, Young. Type substrate: Hordeum vulgare. Descriptions and illustrations: See Aoki & O'Donnell (1999). Diagnostic DNA barcodes: rpb1: JX171524; rpb2: JX171637; tef1: AF212468. pseudoheterosporum Fusarium Jacz., Bull. Soc. Mycol. France 28: 347. 1912. (See Fusarium avenaceum) Holotypus: Not located. Type locality: France. Type substrate: Lolium sp. and Triticum sp. Note: Synonym fide Wollenweber & Reinking (1935). pseudonectria Fusarium Speg., Anales Mus. Nac. Hist. Nat. Buenos Aires 6: 351. 1898 [1899]. (See Fusarium avenaceum) Holotypus: In LPS (Fungi Argent. n.v.c. no. 867) fide Farr (1973). Type locality: Ecuador, San Salvador Island. Type substrate: Dead culms of Poaceae. Note: Synonym fide Wollenweber & Reinking (1935). pseudonygamai Fusarium O'Donnell & Nirenberg, Mycologia 90: 449. 1998. Holotypus: B 70 0001688. Ex-type culture: BBA 69552 = CBS 417.97 = DAOM 225136 = FRC M-1166 = IMI 375342 = NRRL 13592. www.studiesinmycology.org REDELIMITED Type locality: Nigeria. Type substrate: Pennisetum typhoides. Descriptions and illustrations: See Nirenberg & O'Donnell (1998). Diagnostic DNA barcodes: rpb1: LT996205; rpb2: LT996152; tef1: AF160263. pseudoradicicola Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 3. 2020. Neocosmospora pseudoradicicola Sand.-Den. & Crous, Persoonia 43: 157. 2019. Holotypus: CBS H-23996. Ex-type culture: ARSEF 2313 = CBS 145472 = NRRL 25137. Type locality: Papua New Guinea, East New Britain, Keravat, Lowlands Agricultural Experiment Station. Type substrate: Diseased pods of Theobroma cacao. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW218133; rpb2: JF741084; tef1: JF740757. pseudotonkinense Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 3. 2020. Neocosmospora pseudotonkinensis Sand.-Den. & Crous, Persoonia 43: 159. 2019. Holotypus: CBS H-23997. Ex-type culture: CBS 143038. Type locality: Netherlands, Zuid-Holland Province, Leiden. Type substrate: Cornea of Homo sapiens. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb2: LR583867; tef1: LR583640. pteridis Fusarium Ellis & Everh., Proc. Acad. Nat. Sci. Philadelphia 45: 466. 1894. Septogloeum pteridis (Ellis & Everh.) Wollenw., Fusaria Autogr. Delin. 1: 446. 1916. Syntypes: In BPI, BRU, CUP, FLAS, ILL, ISC, MICH, MSC, MU, NEB, NY, OSC, PH, PUL, WIS & WSP. Type locality: USA, New Jersey, Gloucester, Newfield. Type substrate: Phyllachora flabella on Pteris aquilina. pucciniophilum Fusarium Sacc. & P. Syd., Syll. Fung. 14: 1128. 1899. Replaced synonym: Fusarium parasiticum Ellis & Kellerm., J. Mycol. 3 (11): 127. 1887, nom. illegit., Art. 53.1. (See Fusarium heterosporum) Holotypus: Kellerman & Swingle no. 1104 in NY. Type locality: USA, Kansas, Manhattan. Type substrate: Parasitic on Puccinia seymeriae on leaves of Solidago macrophylla. Note: Synonym fide Wollenweber & Reinking (1935). pulvinatum Fusarium (Link) Nees, Syst. Pilze: 32. 1817. Basionym: Atractium pulvinatum Link, Mag. Ges. Naturf. Freunde Berlin 8: 32. 1816. Holotypus: Not located. Type locality: Poland, Wrocław. Type substrate: Hanging scrub branches. Notes: Status unclear. Not treated by any of Wollenweber & Reinking (1935), Booth (1971), or Gerlach & Nirenberg (1982). pulvinatum Fusarium (Berk. & Broome) Sacc., Syll. Fung. 4: 699. 1886, nom. illegit., Art. 53.1. Basionym: Fusisporium pulvinatum Berk. & Broome, J. Linn. Soc., Bot. 14: 102. 1873 [1875]. (See Fusarium sambucinum) Holotypus: In K(M). 149 CROUS ET AL. Type locality: Sri Lanka. Type substrate: Bark. Note: Synonym fide Wollenweber & Reinking (1935). punctiforme Fusarium Durieu & Mont., Expl. Sci. Alg
erie 1: 335. 1848. (See Fusarium reticulatum) Holotypus: Not located. Type locality: Algeria. Type substrate: Citrus aurantium. Note: Synonym fide Wollenweber & Reinking (1935). purpurascens Fusarium Maryani et al., Stud. Mycol. 92: 160. 2018 [2019]. (see Fusarium odoratissimum) Holotypus: InaCC F886 (preserved as metabolically inactive culture). Ex-type culture: InaCC F886. Type locality: Indonesia, East Kalimantan, Kampung Salak Martadinata. Type substrate: Musa var. Pisang Kepok. Descriptions and illustrations: See Maryani et al. (2019a). Diagnostic DNA barcodes: rpb2: LS479385; tef1: LS479827. pusillum Fusarium Wollenw., Fusaria Autogr. Delin. 2: 550. 1924. (See Fusarium dimerum) Lectotypus (hic designatus, MBT 10000727): Germany, Solanum tuberosum, 1919, H.W. Wollenweber, in Fusaria Autogr. Delin. 2: 550. 1924. Note: As no holotype specimen could be located, an illustration accompanying the original protologue is designated here as lectotype. putaminum Fusarium (Thüm.) Sacc., Syll. Fung. 4: 703. 1886. Basionym: Fusisporium putaminum Thüm., Oesterr. Bot. Z. 27: 272. 1877. (See Fusarium lateritium) Holotypus: Not located. Type locality: Austria, Klosterneuburg. Type substrate: Prunus domestica. Note: Synonyms fide Wollenweber & Reinking (1935). putrefaciens Fusarium Osterw., Mitth. Thurgauischen Naturf. Ges. 16: 123. 1904. (See Fusarium avenaceum) Lectotypus (hic designatus, MBT 10000728): Switzerland, Zürich, fruit and seeds of Pyrus sp., 1904, collector unknown, in Osterwalder, Mitth. Thurgauischen Naturf. Ges. 16, tab. 2, figs 10–30. Notes: Synonym fide Wollenweber & Reinking (1935). As no holotype specimen could be located, an illustration accompanying the original protologue is designated here as lectotype. pyrinum Fusarium Schwein., Trans. Amer. Philos. Soc., n.s. 4: 302. 1834, unavailable, see Art. F.3.4. (See Fusarium lactis) pyrinum Fusarium (Fr.) Sacc., Syll. Fung. 4: 720. 1886. Basionym: Fusisporium pyrinum Fr., Syst. Mycol. 3: 445. 1832, nom. sanct. (See Fusarium avenaceum) Holotypus: Not located. Type locality: Sweden. Type substrate: Rotten fruit of Pyrus communis. Note: Synonym fide Wollenweber & Reinking (1935). 150 pyrochroum Fusarium (Desm.) Sacc., Michelia 1: 534. 1879. Calonectria pyrochroa (Desm.) Sacc., Michelia 1: 308. 1878. Basionym: Selenosporium pyrochroum Desm., Ann. Sci. Nat., Bot., s
er. 3, 14: 111. 1850. Synonyms: Nectria pyrochroa Desm., Pl. Crypt. N. France, ed. 2: no. 372. 1856. Calonectria daldiniana De Not., Comment. Soc. Crittog. Ital. 2: 477. 1867. Fusarium pyrochroum var. diatrypellicola P. Syd., Mycoth. March., Cent. 41: no. 4063. 1893. Nectria abnormis Henn., Hedwigia 36: 219. 1897. Holotypus: In ?PAD or PC. Type locality: France. Type substrate: Sambucus nigra. quercicola Fusarium Oudem., Ned. Kruidk. Arch., s
er. 3, 2: 777. 1902. Holotypus: ?L. Type locality: Netherlands, Noord-Holland Province, Bussum. Type substrate: Quercus rubra. Note: Not Fusarium fide Wollenweber & Reinking (1935). quercinum Fusarium O'Donnell et al., Index Fungorum 440: 4. 2020. Neocosmospora quercicola Sand.-Den. & Crous, Persoonia 43: 159. 2019. Holotypus: CBS H-23998. Ex-type culture: CBS 141.90 = NRRL 22652. Type locality: Italy. Type substrate: Quercus cerris. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834247; rpb2: LR583869; tef1: DQ247634. radicicola Fusarium Wollenw., J. Agric. Res. 2: 257. 1914. (See Fusarium solani) Lectotypus: Plate XVI, fig. K, in Wollenweber (1914), designated in Sandoval-Denis et al. (2019). Lectotype locality: USA, Washington. Lectotype substrate: Solanum tuberosum. Note: Synonym fide Wollenweber & Reinking (1935) & SandovalDenis et al. (2019). ramigenum Fusarium O'Donnell & Nirenberg, Mycologia 90: 451. 1998. Holotypus: B 70 0001687. Ex-type culture: BBA 68592 = CBS 418.97 = DAOM 225137 = IMI 375343 = NRRL 25208. Type locality: USA, California. Type substrate: Ficus carica. Descriptions and illustrations: See Nirenberg & O'Donnell (1998). Diagnostic DNA barcodes: rpb1: KF466401; rpb2: KF466412; tef1: AF160267. ramosum Fusarium (Batista & H. Maia) O'Donnell et al., Index Fungorum 440: 4. 2020. Basionym: Hyaloflorea ramosa Bat. & H. Maia, Anais Soc. Biol. Pernambuco 13: 155. 1955. Synonyms: Neocosmospora ramosa (Bat. & H. Maia) L. Lombard & Crous, Stud. Mycol. 80: 227. 2015. (See Fusarium lichenicola C. Massal.) Holotypus: IMUR 410. Ex-type culture: CBS 509.63 = IMUR 410 = MUCL 8050. Type locality: Brazil. FUSARIUM Type substrate: Air. Diagnostic DNA barcodes: rpb2: LR583843; tef1: LR583618. Note: Synonymies fide Sandoval-Denis & Crous (2018). ramulicola Fusarium Sawada, Special Publ. Coll. Agric. Natl. Taiwan Univ. 8: 228. 1959, nom. inval., Art. 39.1. Authentic material: Not located. Original locality: Taiwan. Original substrate: Branches of Citrus tankan f. koshotankan. Note: This name is invalid because of missing Latin diagnosis. rectiphorum Fusarium Samuels et al. (as ‘rectiphorus’), Mycologia 103: 1324. 2011. Neocosmospora rectiphora Samuels et al., Mycologia 103: 1324. 2011. Neocosmospora bomiensis Z.Q. Zeng & W.Y. Zhuang, Phytotaxa 319: 177. 2017. Holotypus: BPI 881229. Ex-type culture: CBS 125727 = FRC S-1831 = G.J.S. 02-89. Type locality: Sri Lanka, Wagamba Province, vic. Kurunegala, Arangakele. Type substrate: Bark. Descriptions and illustrations: See Nalim et al. (2011). Diagnostic DNA barcodes: rpb1: MW834249; rpb2: LR583871; tef1: LR583641. redolens Fusarium Wollenw., Phytopathology 3: 29. 1913 and Ber. Deutsch. Bot. Ges. 31: 31. 1913. Synonyms: Fusarium oxysporum var. redolens (Wollenw.) W.L. Gordon, Canad. J. Bot. 30: 238. 1952. Fusarium solani var. redolens (Wollenw.) Bilaĭ, Fusarii (Biologija i sistematika): 288. 1955. ?Fusarium retusum Wellman, Phytopathology 33: 957. 1943. Holotypus: Not located. Type locality: Unknown. Type substrate: Pisum sativum. Lectotypus (hic designatus, MBT 10000729): Unknown, Pisum sativum, 1913, H.W. Wollenweber, in Phytopathology 3: 31, fig. E. Epitypus (hic designatus, MBT 10000730): Germany, BerlinDahlem, vascular bundle of Dianthus caryophyllus, 16 May 1959, D. Hantschke & W. Gerlach, CBS 360.87 (preserved as metabolically inactive culture). Ex-epitype culture: ATCC 16067 = BBA 9526 = CBS 248.61 = CBS 360.87 = DSM 62390 = NRRL 20426 = NRRL 25600. Descriptions and illustrations: See Gerlach & Pag (1961), Gerlach & Nirenberg (1982) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: MT409433; rpb2: MT409443; tef1: MT409453. Notes: As both protologue publications occurred more or less simultaneously for F. redolens, we select the illustration provided in Phytopathology as lectotype, since no holotype material could be located. Gerlach & Nirenberg (1983) considered CBS 248.61 (= CBS 360.87) a good representative of F. redolens, which was initially designated by Gerlach & Pag (1961) as representative of F. redolens f. sp. dianthi. Therefore, an epitype is designated here to provide taxonomic stability for this species. regulare Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 4. 2020. Neocosmospora regularis Sand.-Den. & Crous, Persoonia 43: 162. 2019. Holotypus: CBS H-23999. www.studiesinmycology.org REDELIMITED Ex-type culture: CBS 230.34 Type locality: Netherlands, Zeeland Province, Zuid Beveland, near Kloetinge. Type substrate: Pisum sativum. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb2: LR583873; tef1: LR583643. rekanum Fusarium Lynn & Marinc., Antonie van Leeuwenhoek 113: 816. 2020. Neocosmospora rekana (Lynn & Marinc.) L. Lombard & Sand.Den., comb. nov. MycoBank MB 837706. Basionym: Fusarium rekanum Lynn & Marinc., Antonie van Leeuwenhoek 113: 816. 2020. Holotypus: PREM 62333. Ex-type culture: CMW 52862 = PPRI 27163. Type locality: Indonesia, Sumatra, Riau, Pelalawan. Type substrate: Acacia crassicarpa infested with Euwallacea perbrevis. Descriptions and illustrations: See Lynn et al. (2020). Diagnostic DNA barcodes: rpb2: MN249137, MN249108; tef1: MN249151. Note: Based on the phylogenetic position of this species related to the ‘ambrosia’ clade as illustrated by Lynn et al. (2020), we provide a new combination in the genus Neocosmospora. reticulatum Fusarium Mont., Ann. Sci. Nat., Bot., s
er. 2, 20: 379. 1843. Synonyms: ?Fusarium leucoconium Corda, Icon. Fung. 1: 4. 1837. (fide Wollenweber & Reinking 1935). ?Fusarium punctiforme Durieu & Mont., Expl. Sci. Alg
erie 1: 335. 1848. Fusisporium flavidum Bonord., Bot. Zeitung (Berlin) 19: 194. 1861. Fusarium flavidum (Bonord.) Sacc., Syll. Fung. 4: 698. 1886. Fusarium ampelodesmi Fautrey & Roum., in Roumeguere, Rev. Mycol. (Toulouse) 13: 82. 1891. Fusarium epithele McAlpine, Fungus Diseases of Citrus trees in Australia: 80. 1899. Fusarium orchidis Petch, Ann. Roy. Bot. Gard. (Peradeniya) 6: 256. 1917. Fusarium negundinis Sherb., in Hubert, J. Agric. Res. 26: 451. 1923. Fusarium reticulatum var. negundinis (Sherb.) Wollenw., Z. Parasitenk. (Berlin) 3: 351. 1931. Fusarium heterosporum var. negundinis (Sherb.) Raillo, Fungi of the Genus Fusarium: 217. 1950. Fusarium reticulatum var. medium Wollenw., Z. Parasitenk. (Berlin) 3: 358. 1931. Lectotypus (hic designatus, MBT 10000731): France, NouvelleAquitaine, Saint-Sever, Citrullus sp., 1843, L. Dufour, in Montagne, Ann. Sci. Nat., Bot., 2 s
er. 20: 379: pl. 16, fig. 3. Epitypus (hic designatus, MBT 10000732): Germany, Rellingen/ Holstein, bark lesion of Sophora japonica, Jun. 1976, R. Schwarz, CBS 473.76 (preserved as metabolically inactive). Ex-epitype culture: BBA 63657 = CBS 473.76 = NRRL 20684. Descriptions and illustrations: See Gerlach & Nirenberg (1982). Diagnostic DNA barcodes: rpb1: MW928816; tef1: MW928841. Notes: Gerlach & Nirenberg (1983) considered CBS 473.76 a good representative of F. reticulatum. As no holotype specimen could be located, an illustration is designated as lectotype here and an epitype is designated to provide taxonomic stability for this species. retusum Fusarium Wellman, Phytopathology 33: 957. 1943. 151 CROUS ET AL. (See Fusarium oxysporum) Holotypus: Not located. Type locality: USA, Indiana. Type substrate: Solanum lycopersicum. rhabdophorum Fusarium Berk. & Broome, Ann. Mag. Nat. Hist., ser. 4, 17: 142. 1876. Holotypus: In K(M). Type locality: UK, Scotland, Forres. Type substrate: Dead sticks. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). rhizochromatistes Fusarium Sideris, Phytopathology 14: 212. 1924. (See Fusarium oxysporum) Lectotypus (hic designatus, MBT 10000733): USA, California, Stockton, roots of Allium cepa, 1924, C.P. Sideris, in Phytopathology 14, pl. XI. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration was designated as lectotype. rhizogenum Fusarium Pound & Clem., Bot. Surv. Nebraska 3: 12. 1894. (See Fusarium candidum Ehrenb.) Holotypus: NEB0040548. Type locality: USA, Lincoln. Type substrate: Roots of Malus domestica seedlings. Note: Synonym fide Wollenweber & Reinking (1935). rhizogenum Fusarium Aderh., Centralbl. Bacteriol. Parasitenk., 1. Abth., 6: 623. 1900, nom. illegit., Art. 53.1. (See Fusarium aderholdii) Authentic material: Not located. Original locality: Germany. Original substrate: Malus domestica. Notes: Synonym fide Wollenweber & Reinking (1935). The original publication could not be checked but Sorauer (1923) clearly stated that Aderhold only used the name Fusarium rhizogenum Pound & Clem. to describe a disease using the latter name. rhizophilum Fusarium Corda, Icon. Fung. 2: 3. 1838. Synonym: Fusisporium georginae Klotzsch, Herb. Viv. Mycol., Cent. 2: 186. 1832, nom. nud., Art. 38.1(a). (See Fusarium merismoides) Lectotypus (hic designatus, MBT 10000734): Czech Republic, Prague, roots of garden plants, 1838, A.C.J. Corda, in Icon. Fung. 2, Tab. VIII, fig. 15. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. rhizophorae Fusarium (Dayar.) O'Donnell et al., Index Fungorum 440: 4. 2020. Neocosmospora rhizophorae Dayar., Mycosphere 11: 112. 2020. Holotypus: MFLU 17-2588. Ex-type culture: MFLUCC 17-2461. Type locality: Thailand, Krabi Province, Phang Nga. Type substrate: Submerged wood of Rhizophora. Descriptions and illustrations: See Dayarathne et al. (2020) 152 rhodellum Fusarium McAlpine, Proc. Linn. Soc. New South Wales 24: 122. 1899. Lectotypus (hic designatus, MBT 10000735): Kerguelen Islands, Pringlea antiscorbutica, 1899, D. McAlpine, in Proc. Linn. Soc. New South Wales 24: Pl. XIII, Fig. 7. Notes: Not Fusarium fide I. Pascoe. No holotype specimen could be located and therefore an illustration is designated as lectotype. rhoicola Fusarium Fautrey, Rev. Mycol. (Toulouse) 17: 171. 1895. (See Fusarium graminearum) Holotypus: ?PC. Type locality: France via USA. Type substrate: Rhus toxicodendron. Note: Synonym fide Wollenweber & Reinking (1935). ricini Fusarium (B
erenger) Bizz., Fl. Ven. Critt. 1: 539. 1885. Basionym: Fusisporium ricini B
erenger, Mem. Accad. Agric. Verona 44: 257. 1866. (See Fusarium sambucinum) Holotypus: Not located. Type locality: Italy. Type substrate: Ricinus communis. Note: Synonym fide Wollenweber & Reinking (1935). rigidiusculum Fusarium (Berk. & Broome) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 32: 664. 1945. Basionym: Nectria rigidiuscula Berk. & Broome, J. Linn. Soc., Bot. 14: 116. 1873 [1875]. (See Fusarium colorans) Holotypus: ?K(M). Type locality: ?Sri Lanka. Type substrate: Bark. Note: Synonym fide Wollenweber & Reinking (1935). rimicola Fusarium Sacc. (as ‘rimicolum’), Michelia 2: 297. 1881. (See Fusarium lateritium) Holotypus: Not located. Type locality: Italy, Padua. Type substrate: Erythrina crista-galli. Note: Synonym fide Wollenweber & Reinking (1935). rimosum Fusarium (Peck) Sacc., Syll. Fung. 4: 713. 1886. Basionym: Fusisporium rimosum Peck, Rep. (Annual) New York State Mus. Nat. Hist. 30: 58. 1878. (See Fusarium merismoides) Holotypus: NYSf2609. Type locality: USA, New York, Albany. Type substrate: Cut ends of stalks of Zea mays. Note: Synonym fide Wollenweber & Reinking (1935). riograndense Fusarium Dall
e Rosa et al., J. Mycol. Med. 28: 33. 2018. Neocosmospora riograndensis (Dall
e Rosa et al.) Sand.-Den. & Crous, Persoonia 43: 165. 2019. Holotypus: UFMG-CM F12570. Ex-type culture: UFMG-CM F12570 = URM-7361. Type locality: Brazil, Rio Grande do Sul, Porto Alegre, Hospital de Clínicas de Porto Alegre. Type substrate: Nasal cavity of Homo sapiens. Descriptions and illustrations: See Dall
e Rosa et al. (2018). Diagnostic DNA barcodes: rpb2: KX534003; tef1: KX534002. FUSARIUM robiniae Fusarium Pass., Atti Reale Accad. Lincei, Rendiconti Cl. Sci. Fis., s
er. 4, 7: 51. 1891. (See Fusarium sarcochroum) Holotypus: ?PARMA. Type locality: Italy, Padua. Type substrate: Robinia pseudoacacia. Note: Synonym fide Wollenweber & Reinking (1935). robustum Fusarium Gerlach, Phytopathol. Z. 88: 36. 1977. Holotypus: In B. Isotypus: CBS H-629. Ex-type culture: BBA 63667 = CBS 637.76 = FRC R-5821 = IMI 322102 = NRRL 13392. Type locality: Argentina. Type substrate: Araucaria angustifolia. Descriptions and illustrations: See Gerlach (1977c). Diagnostic DNA barcodes: rpb2: MW928831; tef1: MW928842. roesleri Fusarium Thüm., Pilze Weinst.: 51. 1878. (See Fusarium merismoides) Lectotypus (hic designatus, MBT 10000736): Austria, Klosterneuburg, Vitis vinifera, 1878, K.A.E.J. Thümen, in Pilze Weinst. Tab. 3, fig. 7. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. rollandianum Fusarium Sacc., Syll. Fung. 11: 650. 1895. Replaced synonym: Fusarium cydoniae Roum. & Fautrey, Rev. Mycol. (Toulouse) 14: 170. 1892, nom. illegit., Art. 53.1, non Allescher 1892. Syntype: ILL00220295 (Fautrey, Fungi Sel. Gall. Exs. No. 6120). Type locality: France. Type substrate: Fruit of Cydonia vulgaris. Notes: Not Fusarium fide Wollenweber & Reinking (1935). Typification pending further study of the syntype lodged in ILL. rosae Fusarium (Preuss) Sacc., Syll. Fung. 4: 697. 1886. Basionym: Selenosporium rosae Preuss, Linnaea 24: 150. 1851. Holotypus: Not located; not preserved in B fide Holubov
aJechov
a et al. (1994). Type locality: Germany, Hoyerswerda. Type substrate: Rosa sp. Notes: Status unclear. Not treated by any of Wollenweber & Reinking (1935), Booth (1971), or Gerlach & Nirenberg (1982). roseobullatum Fusarium Wollenw. (as ‘roseo-bullatum’), Fusaria Autogr. Delin. 1: 117. 1916. Basionym: Fusarium bullatum var. roseum Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 201. 1915. (See Fusarium equiseti) Holotypus: ?CUP-007433. Type locality: USA, Iowa. Type substrate: Solanum tuberosum. Note: Synonym fide Wollenweber & Reinking (1935). roseolum Fusarium (H.O. Stephens ex Berk. & Broome) Sacc., Syll. Fung. 4: 710. 1886. Basionym: Fusisporium roseolum H.O. Stephens ex Berk. & Broome, Ann. Mag. Nat. Hist., ser. 2, 7: 178. 1851. (See Fusarium merismoides) Holotypus: ?K(M). www.studiesinmycology.org REDELIMITED Type locality: UK, Bristol. Type substrate: Decayed Solanum tuberosum. Note: Synonyms fide Wollenweber & Reinking (1935). roseum Fusarium Link, Mag. Ges. Naturf. Freunde Berlin 3: 10. 1809, nom. rej. (See Fusarium sambucinum) Lectotypus: In B, selected in Gams et al. (1997). Type locality: Germany. Type substrate: Malvaceae. Notes: Gams et al. (1997) proposed that the name, F. roseum be rejected due to ambiguity surrounding the type of this species, with F. sambucinum taking preference. This proposal was accepted in 1999 (see Gams 1999). rostratum Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: 30. 1910 [1913]. (See Fusarium graminearum) Lectotypus (hic designatus, MBT 10000737): Germany, Berlin, Triticum aestivum, 1913, O.A. Appel & H.W. Wollenweber, in Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: 30, Abb. 1, figs E1–E13. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. roumeguerei Fusarium Sacc. (as ‘roumegueri’), Syll. Fung. 4: 702. 1886, nom. illegit., Art. 52.1. Replaced synonym: Fusarium insidiosum Roum., Michelia 2 (6): 132. 1880. (See Fusarium lateritium) Type material: See Fusarium insidiosum. Note: Synonym fide Wollenweber & Reinking (1935). ruberrimum Fusarium Delacr., Bull. Soc. Mycol. France 6: 139. 1890. (See Fusarium avenaceum) Holotypus: ?PC. Type locality: France, Paris. Type substrate: Onobrychis viciifolia. Note: Synonym fide Wollenweber & Reinking (1935). rubi Fusarium (G. Winter) Berl. & Voglino, Add. Syll. Fung. 1–4: 391. 1886. Basionym: Fusisporium rubi G. Winter, in Rabenh., Fungi Eur. Extraeur Exs., Ed. Nov., Ser. Sec., Cent. 13 (resp. 33): 3280. 1885. Synonym: Ramularia rubi (G. Winter) Wollenw., Fusaria Autogr. Delin. 1: 470. 1916. Cercosporella rubi (G. Winter) Plakidas, J. Agricultural Research 54: 275. 1937. Syntypes: In BPI, CHRB, CUP, F, HAL, ISC, LSUM, MSC, MU, NEB & PH (Fungi Eur. Extraeur. Exs. no. 3280). Type locality: USA, Illinois, Cobden Type substrate: Rubus villosus Note: Status unclear fide Braun (1998). rubicolor Fusarium Berk. & Broome, Trans. Linn. Soc. London, Bot. 2: 68. 1883. Holotypus: ?K(M). Type locality: Australia, Queensland, Brisbane. Type substrate: Leaves of Eucalyptus sp. 153 CROUS ET AL. Note: Not Fusarium fide Wollenweber & Reinking (1935). rubiginosum Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: 108. 1910 [1913]. (See Fusarium culmorum) Lectotypus (hic designatus, MBT 10000738): Germany, Solanum tuberosum, 1913, O.A. Appel & H.W. Wollenweber, in Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: Tab. I, figs 31–48. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. rubrum Fusarium Parav., Ann. Mycol. 16: 311. 1918. (See Fusarium lactis) Lectotypus (hic designatus, MBT 10000739): Germany, core of Malus domestica fruit, 1918, E. Paravicini, in Ann. Mycol. 16, pl. 4, figs 23–33. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. rusci Fusarium (Sacc.) O'Donnell & Geiser, Phytopathology 103: 404. 2013. Basionym: Fusarium roseum var. rusci Sacc., Michelia 2: 294. 1881. Synonyms: Trichofusarium rusci (Sacc.) Bub
ak, Bull. Herb. Boissier, s
er. 2, 6: 488. 1906. Pycnofusarium rusci D. Hawksw. & Punith., Trans. Brit. Mycol. Soc. 61: 63. 1973. Syntype: BPI 453152. Type locality: Italy, Selva. Type substrate: Ruscus aculeatus. Notes: Examination of the syntype (BPI 453152) revealed that this species does not belong to the genus Fusarium, having a myrothecium-like morphology. Also see notes under Nothofusarium devonianum. russianum Fusarium Manns, Bull. North Dakota Agric. Exp. Sta. 259: 34. 1932. (See Fusarium acuminatum) Holotypus: Not located. Type locality: USA, North Dakota. Type substrate: Linum usitatissimum. Note: Synonym fide Wollenweber & Reinking (1935). ruticola Fusarium Fautrey & Roum. (as ‘rutaecola’), Rev. Mycol. (Toulouse) 13: 82. 1891. (See Fusarium avenaceum) Syntype: ?PC (Fungi Sel. Gall. Exs. No. 5686). Type locality: France, Noidan. Type substrate: Ruta graveolens. Note: Synonym fide Wollenweber & Reinking (1935). saccardoanum Fusarium P. Syd., Syll. Fung. 14: 1128. 1899. Replaced synonym: Fusarium sclerodermatis Peck, Rep. (Annual) Regents Univ. State New York New York State Mus. 43: 77. 1890, nom. illegit., Art. 53.1, non Fusarium sclerodermatis Oudem. 1889. (See Fusarium oxysporum) Holotypus: NYSf2731. Type locality: USA, New York, Suffolk, Manor, Long Island. Type substrate: Scleroderma vulgaris. Note: Synonym fide Wollenweber & Reinking (1935). 154 sacchari Fusarium (E.J. Butler) W. Gams, Cephalosporiumartige Schimmelpilze: 218. 1971. Basionym: Cephalosporium sacchari E.J. Butler, Mem. Dept. Agric. India, Bot. Ser. 6: 185. 1913. Synonyms: Fusarium neoceras Wollenw. & Reinking, Phytopathology 15: 164. 1925. Gibberella sacchari Summerell & J.F. Leslie, Mycologia 97: 719. 2005, nom. illegit., Art. 53.1, non Gibberella sacchari Speg. 1896. Fusarium desaboruense N. Maryani et al., Persoonia 43: 59. 2019. Lectotypus: In Mem. Dept. Agric. India, Bot. Ser. 6: 185, pl. II, figs 1–13. 1913, designated by Yilmaz et al. (2021). Epitypus: CBS 223.76 (preserved as metabolically inactive culture), designated by Yilmaz et al. (2021). Ex-epitype culture: BBA 63340 = CBS 223.76 = DAOM 225138 = IMI 202881 = NRRL 13999. Lectotype and epitype locality: India. Lectotype and epitype substrate: Saccharum officinarum. Descriptions and illustrations: See Butler & Khan (1913), Gams (1971), Gerlach & Nirenberg (1982), Leslie et al. (2005) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: JX171466; rpb2: JX171580; tef1: AF160278. salicicola Fusarium Allesch. (as ‘salicicolum’), Ber. Bayer. Bot. Ges. 4: 39. 1896. (See Fusarium avenaceum) Holotypus: In M. Type locality: Germany, München, forest near Großhesselohe. Type substrate: Dead branch of Salix caprea. Note: Synonym fide Wollenweber & Reinking (1935). salicinum Fusarium Corda, Icon. Fung. 3: 33. 1839. Typus: In PRM fide Pilat (1938). Type locality: Czech Republic, near Prague. Type substrate: Thin branches of Salix sp. Notes: Not Fusarium fide Wollenweber & Reinking (1935). Lectotypification pending study of material lodged in PRM. salicis Fusarium Fuckel, Fungi Rhen. Exs., Suppl., Fasc. 7, no. 2110. 1868. (See Fusarium lateritium) Syntype: S-F267709 (Fungi Rhen. Exs. no. 2110). Type locality: Germany, Hessen, Münchau, near Hattenheim Type substrate: Dry branches of Salix triandra. Notes: Synonym fide Wollenweber & Reinking (1935). Typification pending further study of the syntype lodged in S. salinense Fusarium Sand.-Den. et al., Persoonia 40: 15. 2017 [2018]. Holotypus: CBS H-23019. Ex-type culture: CBS 142420 = CPC 26973. Type locality: Italy, Sicily, Messina, Leni. Type substrate: Twigs of Citrus sinensis. Descriptions and illustrations: See Sandoval-Denis et al. (2018a). Diagnostic DNA barcodes: rpb1: LT746286; rpb2: LT746306; tef1: LT746193. salmonicolor Fusarium Berk. & M.A. Curtis, J. Linn. Soc., Bot. 10: 359. 1868 [1869]. Synonym: Fusidium salmonicolor (Berk. & M.A. Curtis) Wollenw., Fusaria Autogr. Delin. 1: 478. 1916. FUSARIUM Holotypus: In K(M). Type locality: Cuba. Type substrate: Dead twigs of unknown host. Notes: Synonym fide Wollenweber & Reinking (1935). This taxon needs to be recombined into the genus Neonectria but requires further investigation. samararum Fusarium Allesch., Ber. Bayer. Bot. Ges. 4: 39. 1896. (See Fusarium lateritium) Holotypus: In M. Type locality: Germany, München, Starnberg. Type substrate: Fallen fruits of Fraxinus excelsior. Note: Synonym fide Wollenweber & Reinking (1935). sambucinum Fusarium Fuckel, Fungi Rhen. Exs., Fasc. 3, no. 211. 1863, nom. cons. Synonyms: Fusarium roseum Link, Mag. Ges. Naturf. Freunde Berlin 3: 10. 1809, nom. rej. Fusidium roseum (Link) Link, Mag. Ges. Naturf. Freunde Berlin 8: 31. 1815 [1816]. Gibberella rosea (Link) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 32: 664. 1945. Sphaeria pulicaris Fr., Mykol. Hefte 2: 37. 1823. Gibbera pulicaris (Fr.) Fr., Summa Veg. Scand. 2: 402. 1849. Botryosphaeria pulicaris (Fr.) Ces. & De Not., Comment. Soc. Crittog. Ital. 1: 212. 1863. Nectria pulicaris (Fr.) Tul. & C. Tul., Select. Fung. Carpol. 3: 63. 1865.
Cucurbitaria pulicaris (Fr.) Qu
el., M
em. Soc. Emul. Montb
eliard, s
er. 2, 5: 511. 1875. Gibberella pulicaris (Fr.) Sacc., Michelia 1: 43. 1877. Fusarium sulphureum Schltdl., Fl. Berol. 2: 139. 1824, nom. rej. Fusidium sulphureum (Schltdl.) Link, in Willdenow, Sp. Pl. ed. 4, 6: 98. 1825. Fusarium discolor var. sulphureum (Schltdl.) Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: 115. 1910 [1913]. Sphaeria cyanogena Desm., Ann. Sci. Nat., Bot., s
er. 3, 10: 352. 1848. Botryosphaeria cyanogena (Desm.) Niessl, Verh. Naturf. Vereins Brünn 10: 197. 1872. Gibberella cyanogena (Desm.) Sacc., Syll. Fung. 2: 555. 1883. Calonectria cyanogena (Desm.) Lar.N. Vassiljeva, Nizshie Rasteniya, Griby i Mokhoobraznye Dalnego Vostoka Rossii, Griby. Tom 4. Pirenomitsety i Lokuloaskomitsety: 169. 1998. Fusarium maydis Kalchbr., Math. Term. Közlem. 3: 285. 1865, nom. rej. Fusisporium ricini B
erenger, Mem. Accad. Agric. Verona 44: 257. 1866, nom. rej. Fusarium ricini (B
erenger) Bizz., Fl. Ven. Critt. 1: 539. 1885. Fusarium subcarneum P. Crouan & H. Crouan, Fl. Finistere: 14. 1867, nom. rej. Fusarium violaceum P. Crouan & H. Crouan, Fl. Finistere: 14. 1867, nom. illegit., Art. 53.1. Fusisporium pezizoideum Berk. & M.A. Curtis, Grevillea 3: 147. 1875. Fusarium pezizoideum (Berk. & M.A. Curtis) Sacc., Syll. Fung. 4: 711. 1886. Fusisporium pulvinatum Berk. & Broome, J. Linn. Soc., Bot. 14: 102. 1873 [1875]. Fusarium pulvinatum (Berk. & Broome) Sacc., Syll. Fung. 4: 699. 1886, nom. illegit., Art. 53.1. Fusarium roseum var. buxi Sacc., Michelia 2: 294. 1881. www.studiesinmycology.org REDELIMITED Fusarium roseum var. calystegiae Sacc., Michelia 2: 294. 1881. Fusarium roseum var. cucubali-bacciferi Sacc., Michelia 2: 295. 1881. Fusarium roseum var. dulcamarae Sacc., Michelia 2: 295. 1881. Fusarium roseum var. filicis Sacc., Michelia 2: 295. 1881. Fusarium roseum var. fraxini Therry, Cryptog. Lyonn.: 5717. 1881. Fusarium roseum var. helianti Sacc., Michelia 2: 295. 1881. Fusarium roseum var. maydis Sacc., Michelia 2: 295. 1881. Fusarium roseum var. phytolaccae Sacc., Michelia 2: 294. 1881. Fusarium roseum var. rosae Sacc., Michelia 2: 295. 1881. Fusarium roseum var. vitalbae Sacc., Michelia 2: 294. 1881. Fusarium granulare Kalchbr., Crypt. Austro-Afric., no. 1068. 1874. Fusarium roseum var. dracaenae Roum., Fungi Sel. Gall. Exs., Cent. 19: 1869. 1882. Fusisporium tenuissimum Peck, Rep. (Annual) New York State Mus. Nat. Hist. 34: 48. 1883. Fusarium tenuissimum (Peck) Sacc., Syll. Fung. 4: 711. 1886. Fusisporium hordei Wm.G. Sm., Diseases of field and garden crops, chiefly as are caused by fungi: 212. 1884. Fusarium hordei (Wm.G. Sm.) Sacc., Syll. Fung. 11: 652. 1895. Gibberella pulicaris f. robiniae P. Syd., Mycoth. March., Cent. 14: 1544. 1887. Fusarium tenellum Sacc. & Briard, Rev. Mycol. (Toulouse) 7: 212. 1885. Fusarium asparagi Delacr., Bull. Soc. Mycol. France 6: 99. 1890, nom. illegit., Art. 53.1. Fusarium delacroixii Sacc., Syll. Fung. 10: 725. 1892. Fusarium fraxini Allesch., Ber. Bot. Vereines Landshut 12: 130. 1892. Fusarium polymorphum Matr., Rech. D
evel. Muc
ed.: 84. 1892. Fusarium roseum var. lonicerae Allesch., Ber. Bayer. Bot. Ges. 5: 22. 1897. Fusarium roseum f. visci Brunaud, Actes Soc. Linn. Bordeaux 52: 149. 1897. Fusarium pannosum Massee, Bull. Misc. Inform. Kew 1898: 117. 1898. Gibberella pulicaris var. subtropica Rehm, in Theissen, Ann. Mycol. 9: 63. 1911. Gibberella subtropica (Rehm) Wollenw., Fusaria Autogr. Delin. 1: 38. 1916. Botryosphaeria subtropica (Rehm) Weese, Sitzungsber. Akad. Wiss. Wien, Math.-Naturwiss. Cl., Abt. 1, 128: 708. 1919. Fusarium genevense Dasz., Bull. Soc. Bot. Geneve, s
er. 2, 4: 305. 1912. Fusarium discolor Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: 114. 1913. Fusarium subpallidum Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 230. 1915. Fusarium roseum var. phaseoli Gonz. Frag., Trab. Mus. Nac. Cienc. Nat., Ser. Bot. 10: 173. 1916. Fusarium aridum O.A. Pratt, J. Agric. Res. 13: 89. 1918. Fusarium elongatum O.A. Pratt, J. Agric. Res. 13: 84. 1918, nom. illegit., Art. 53.1. Fusarium roseum var. zeae Cif., Bull. Soc. Bot. Ital. 1921: 73. 1921. Fusarium sambucinum var. medium Wollenw., Z. Parasitenk. (Berlin) 3: 358. 1931. Fusarium sambucinum f2 Wollenw., Z. Parasitenk. (Berlin) 3: 357. 1931. Fusarium sambucinum f3 Wollenw., Z. Parasitenk. (Berlin) 3: 357. 1931. 155 CROUS ET AL. Fusarium sambucinum f4 Wollenw., Z. Parasitenk. (Berlin) 3: 357. 1931. Fusarium sambucinum f6 Wollenw., Z. Parasitenk. (Berlin) 3: 358. 1931. Gibberella pulicaris var. minor Wollenw., Z. Parasitenk. (Berlin) 3: 356. 1931. Fusarium roseum f. phaseoli N. Barros, Revista Inst. Colomb. Agropecu. 1: 80. 1966. Fusarium roseum f. compactum Tivoli, Agronomie 8: 220. 1988, nom. inval., Arts. 35.1, 39.1. Fusarium roseum var. lavaterae-arboreae Thüm., Mycoth. Univ. Cent. 11: no. 1084. 1878. Lectotypus: G00266369. Type locality: Germany, Hessen. Type substrate: Dead branches of Sambucus nigra. Descriptions and illustrations: See Wollenweber & Reinking (1935), Booth (1971), Gerlach & Nirenberg (1982), Nelson et al. (1983), and Leslie & Summerell (2006). Notes: The taxonomy of F. sambucinum, the type species of the genus Fusarium, is confusing. Divergent species concepts have been derived from multiple taxonomic systems and the conflicting application of the older name F. roseum (Gams et al. 1997, Leslie & Summerell 2006). After examination of the type material, a proposal to conserve F. sambucinum against several earlier names was presented (Gams et al. 1997) and unanimously accepted by the committee for fungal taxonomy (Gams 1999). Further older valid synonymous names are in need to be rejected, notably Sphaeria pulicaris and Sphaeria cyanogena. samoense Fusarium Gehrm., Arbeiten Kaiserl. Biol. Anst. LandForstw. 9: 24. 1913. (See Fusarium verticillioides) Lectotypus (hic designatus, MBT 10000740): Samoa, cortex of Theobroma cacao, 1913, K. Gehrmann, in Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 9: Abb. 6, figs 1–3. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. sampaioi Fusarium Gonz. Frag., Bol. Soc. Brot. 2: 50. 1924. Synonym: Illosporium corallinum Roberge, in Desmazieres, Pl. Crypt. N. France, ed. 1, Fasc. 32: no. 1551. 1847 (pr. p. fide Hawksworth 1979). Marchandiomyces corallinus (Roberge) Diederich & D. Hawksw., Mycotaxon 37: 312. 1990 (pr. p. fide Diederich 1990). Aegerita physciae Vouaux, Bull. Trimestriel Soc. Mycol. France 30: 314. 1914. Holotypus: Not indicated. Several syntypes fide Hawksworth (1979). Type locality: Portugal, near Gaia, Alto da Bandeira; and near Tabuaço. Type substrate: Lichen thallus (on Lasallia pustulata, Parmelia saxatilis, P. soredians and P. exasperata; Physcia semipinnata, P. tenella, Phaeophyscia orbicularis and Physconia grisea). Notes: Hawksworth (1979), after examination of a syntype, concluded that the Fusarium name should be rejected since the studied material was based on discordant elements. Nevertheless, examination of all available syntypes is required to confirm these observations or otherwise, to fix the use of this name by lectotypification. samuelsii Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 4. 2020. 156 Neocosmospora samuelsii Sand.-Den. & Crous, Persoonia 43: 165. 2019. Holotypus: CBS H-24001. Ex-type culture: CBS 114067 = G.J.S. 89-70. Type locality: Guyana, Mount Wokomung, on ridge leading NW toward summit, 0.5–1 h walk from Base Camp. Type substrate: Bark. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834252; rpb2: LR583874; tef1: LR583644. sangayamense Fusarium Maryani et al., Stud. Mycol. 92: 187. 2018 [2019]. Holotypus: InaCC F960 (preserved as metabolically inactive culture). Ex-type culture: InaCC F960. Type locality: Indonesia, South Kalimantan, Kota Baru, Sengayam. Type substrate: Pseudostem of Musa var. Pisang Kepok. Descriptions and illustrations: See Maryani et al. (2019a). Diagnostic DNA barcodes: rpb1: LS479537; rpb2: LS479283; tef1: LS479732. sanguineum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 193. 1915. (See Fusarium acuminatum) Typus: ?CUP-007444. Type locality: USA, New York, Ithaca Type substrate: Solanum tuberosum. Notes: Synonym fide Wollenweber & Reinking (1935). Lectotypification pending study of material lodged in CUP. sapindophilum Fusarium Speg., Anales Mus. Nac. Hist. Nat. Buenos Aires 6: 351. 1898 [1899]. Synonym: Cercoseptoria sapindophila (Speg.) Cif., Mycopathol. Mycol. Appl. 6: 26. 1951. Holotypus: In LPS (Fungi Argent. n.v.c. no. 868). Type locality: Argentina, near Tucum
an. Type substrate: Living leaves of unknown climbing Sapindaceae. Note: Synonym fide Wollenweber & Reinking (1935). sarcochroum Fusarium (Desm.) Sacc., Michelia 1: 534. 1879. Basionym: Selenosporium sarcochroum Desm., Ann. Sci. Nat., Bot., s
er. 3, 14: 112. 1850. Synonyms: Fusarium diplosporum Cooke & Ellis, Grevillea 7: 38. 1878. Fusarium desciscens Oudem., Ned. Kruidk. Arch., s
er. 2, 5: 515. 1889. Fusarium robiniae Pass., Atti Reale Accad. Lincei, Rendiconti Cl. Sci. Fis., s
er. 4, 7: 51. 1891. Fusarium sarcochroum var. robiniae (Pass.) Wollenw., Z. Parasitenk. (Berlin) 3: 388. 1931.Fusarium sarcochroum f. polygalaemyrtifoliae Henn., Verh. Bot. Vereins Prov. Brandenburg 40: 174. 1898 [1899]. Fusarium sarcochroum var. casei Loubiere, Rech. Muc
edin
ees: 53. 1924. Gibberella pseudopulicaris Wollenw., Z. Parasitenk. (Berlin) 3: 387. 1931. Neotypus (hic designatus, MBT 10000741): Switzerland, Viscum album, 1977, W. Gerlach, CBS 745.79 (preserved as metabolically inactive culture). Ex-neotype culture: BBA 63714 = CBS 745.79 = NRRL 20472. Descriptions and illustrations: See Wollenweber & Reinking (1935), Raillo (1950), Bilaĭ (1955), Gerlach & Nirenberg (1982). FUSARIUM Diagnostic DNA barcodes: rpb1: JX171472; rpb2: JX171586; tef1: JABEXW010000634. Notes: No type material could be located. Therefore, CBS 745.79 is designated as neotype here. Both Gerlach & Nirenberg (1982) and O'Donnell et al. (2013) considered this isolate an authentic representation of this species. schawrowii Fusarium Speschnew (as ‘schawrovi‘), Arbeiten Kaukas. Stat. Seidenzucht 10: 1906. (See Fusarium lateritium) Holotypus: Not located. Type locality: Turkey, Anatolia. Type substrate: Branch of Morus sp. Note: Synonym fide Wollenweber & Reinking (1935). schiedermayeri Fusarium (Thüm.) Sacc., Syll. Fung. 4: 712. 1886. Basionym: Fusisporium schiedermayeri Thüm., Fungi Austr. Exs. Cent. 1: no. 78. 1871. (See Fusarium avenaceum) Syntypus: In HAL. Type locality: Austria, Linz. Type substrate: Ovaries of Luzula pilosa, in association with Ustilago luzulae. Note: Synonyms fide Wollenweber & Reinking (1935). schnablianum Fusarium Allesch., Hedwigia 34: 289. 1895. (See Fusarium avenaceum) Holotypus: In M. Type locality: Germany, Großhesselohe, near München. Type substrate: Decorticated branch of Acer pseudoplatanus. Note: Synonym fide Wollenweber & Reinking (1935). schribauxii Fusarium Delacr., Bull. Soc. Mycol. France 6: 99. 1890. (See Fusarium culmorum) Holotypus: ?PC. Type locality: France. Type substrate: Seeds of Triticum sativum, in association with Trichothecium roseum. Note: Synonym fide Wollenweber & Reinking (1935). schweinitzii Fusarium Ellis & Harkn., Bull. Torrey Bot. Club 8: 27. 1881. Colletotrichum crassipes (Speg.) Arx, Verh. Kon. Akad. Wetensch., Afd. Natuurk., Sect. 2, 51: 77. 1957. Basionym: Gloeosporium crassipes Speg., Rivista Vitic. Enol. 2: 405. 1878. Syntypes: In CHRB, CUP, ILL, MICH, MU, NEB, NYS, PH, PUL & WIS (Ellis, N. Amer. Fungi no. 539). Type locality: USA, New Jersey, Newfield. Type substrate: Vitis sp. vine Note: Synonym fide Wollenweber & Reinking (1935). scirpi Fusarium Lambotte & Fautrey, Fautrey, Fungi Sel. Gall. Exs. no. 6540. 1893. Synonyms: ?Fusoma helminthosporii Corda, Icon. Fung. 1: 7. 1837. ?Fusoma filiferum Preuss, Linnaea 25: 73. 1852. ?Fusarium filiferum (Preuss) Wollenw., Fusaria Autogr. Delin. 1: 220. 1916. ?Fusarium scirpi var. filiferum (Preuss) Wollenw., Fusaria Autogr. Delin. 3: 936. 1930. ?Fusisporium chenopodinum Thüm., Mycoth. Univ., Cent. 14: no. 1378. 1879. www.studiesinmycology.org REDELIMITED ?Fusarium chenopodinum (Thüm.) Sacc., Syll. Fung. 4: 701. 1886. ?Fusarium aloes Kalchbr. & Cooke (as ‘alo€es’), Grevillea 9: 23. 1880. ?Fusarium osteophilum Speg., Anales Soc. Ci. Argent. 10: 60. 1880. ?Fusisporium mucophytum W.G. Sm., Gard. Chron. n.s. 22: 245. 1884. ?Fusarium mucophytum (W.G. Sm.) Massee, Brit. Fung.-Fl. 3: 483. 1893. Fusarium equiseticola Allesch., Hedwigia 34: 289. 1895. Fusarium sclerotium Wollenw., Ber. Deutsch. Bot. Ges. 31: 301. 1913. Fusarium caudatum Wollenw., J. Agric. Res. 2: 262. 1914. Fusarium sclerodermatis var. lycoperdonis Picb., Bull. Ecol. Sup. Agron., Brno, R.C.S. Fac. Silvicult. 13: 27. 1929. Fusarium scirpi var. comma Wollenw., Fusaria Autogr. Delin. 3: 922. 1930. Fusarium scirpi var. nigrantum F.T. Benn. (as ‘nigrans’), Ann. Appl. Biol. 19: 26. 1932. Fusarium scirpi var. pallens F.T. Benn., Ann. Appl. Biol. 19: 21. 1932. Lectotypus (hic designatus, MBT 10000742): France, Schoenoplectus lacustris (= Scirpus lacustris), 1893, F. Fautrey, ILL00220730 (Fautrey, Fungi Sel. Gall. Exs. No. 6540). Epitypus (hic designatus, MBT 10000743): Australia, New South Wales, near Broken Hill, pasture soil, 1981, P.E. Nelson, CBS H-24069. Ex-epitype culture: CBS 447.84 = FRC R-6252 = NRRL 36478. Descriptions and illustrations: See Wollenweber (1916–1935), Wollenweber & Reinking (1935), Burgess et al. (1985) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb2: GQ505832; tef1: GQ505654. Notes: The epitypification of Fusarium scirpi by Xia et al. (2019) was not Code compliant as the holo- or lectotype was not correctly indicated (Art. 9.9). Here, the lectotype is clearly indicated, making the epitypification valid. sclerodermatis Fusarium Oudem., Ned. Kruidk. Arch., s
er. 2, 5: 516. 1889. (See Fusarium torulosum) Holotypus: ?L. Type locality: Netherlands, Zuid-Holland Province, Scheveningen. Type substrate: Rotten Scleroderma vulgaris. Note: Synonym fide Nirenberg (1995). sclerodermatis Fusarium Peck, Rep. (Annual) Regents Univ. State New York New York State Mus. 43: 77. 1890, nom. illegit., Art. 53.1. (See Fusarium oxysporum) Authentic material: NYSf2731. Original locality: USA, New York, Suffolk. Original substrate: Peridium of Scleroderma vulgaris. Notes: A later homonym of F. sclerodermatis Oudem. Saccardo (1892) published F. peckii as a replacement name which was again an illegitimate homonym; the taxon was later synonymised with F. oxysporum var. aurantiacum (Wollenweber & Reinking 1935). sclerostromaton Fusarium Sideris, Phytopathology 14: 213. 1924. (See Fusarium oxysporum) Holotypus: Not located. 157 CROUS ET AL. Type locality: USA, California, Delta, near Stockton. Type substrate: Roots of Allium sp. with symptoms of pink root disease. Note: Synonym fide Wollenweber & Reinking (1935). sclerotioides Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 214. 1915. (See Fusarium oxysporum) Typus: ?BPI 452971. Type locality: USA, New York, Ithaca. Type substrate: Solanum tuberosum. Notes: Synonym fide Wollenweber & Reinking (1935). Typification pending further study of the specimen lodged in BPI. sclerotioides Fusarium (Höhn.) Samuels & Rossman, Mycological Papers 164: 23. 1991, nom. illegit., Art. 53.1 Basionym: Stagonopsis sclerotioides Höhn., in Penther & Zederbauer, Ann. K. K. Naturhist. Hofmus. 20: 368. 1905. (See Fusarium kurdicum) Holotypus: FH00965353. Type locality: Turkey, near Erciyes Dagı. Type substrate: Thin twigs of Astragalus sp. sclerotium Fusarium Wollenw., Ber. Deutsch. Bot. Ges. 31: 30. 1913. (See Fusarium scirpi) Holotypus: Not located. Type locality: USA. Type substrate: Citrullus vulgaris and Lycopersicon esculentum. Note: Synonym fide Nirenberg (1995). scolecoides Fusarium Sacc. & Ellis, Miscellanea Mycologia 2: 18. 1885. (See Fusarium ciliatum) Holotypus: In PAD. Type locality: USA, Pennsylvania, Bethlehem. Type substrate: Branch of Robinia sp. Note: Synonym fide Wollenweber & Reinking (1935). secalis Fusarium F
ee, M
em. Soc. Mus. Hist. Nat. Strassbourg 3: 35. 1843. (See Fusarium heterosporum) Holotypus: Not located. Type locality: France. Type substrate: Spikes of Secale cereale. Note: Synonym fide Wollenweber & Reinking (1935). secalis Fusarium Jacz., Bull. Trimestriel Soc. Mycol. France 28: 346. 1912, nom. illegit., Art. 53.1. (See Fusarium nivale) Authentic material: Not located. Original locality: Russia, near Moscow. Original substrate: Grain of Secale sp. Note: Synonym fide Wollenweber & Reinking (1935). secorum Fusarium Secor et al., Fungal Biology 118: 767. 2014. Holotypus: BPI 892692. Ex-type culture: NRRL 62593. Type locality: USA, Minnesota, Sabin. Type substrate: Root of Beta vulgaris. Descriptions and illustrations: See Secor et al. (2014). Diagnostic DNA barcodes: rpb1: JABEEM010001657; rpb2: JABEEM010001483; tef1: KJ189225. sedimenticola Fusarium M.M. Wang et al., Botanica Marina 63: 174. 2020. 158 (See Fusarium keratoplasticum) Holotypus: HAMS 248044. Ex-type culture: CGMCC 3.19499 = LC12845. Type locality: China, South-West Indian Ocean. Type substrate: Deep-sea sediments. Descriptions and illustrations: See Jones et al. (2020). Diagnostic DNA barcodes: rpb2: MK190729; tef1: MK190727. Notes: Fusarium sedimenticola was recently introduced by Jones et al. (2020) in the FSSC (=Neocosmospora) isolated from deepsea sediment in the Indian Ocean. However, based on comparisons of both protologues and sequences using a larger sampling of N. keratoplastica isolates (results not shown), we consider F. sedimenticola a synonym under N. keratoplastica. seemenianum Fusarium Henn., in Seemen, Allg. Bot. Z. Syst. 2: 83. 1896. (See Fusarium avenaceum) Holotypus: B 70 0100194. Type locality: Germany, Borkum. Type substrate: Leaves of Platanthera bifolia var. robusta. Note: Synonym fide Wollenweber & Reinking (1935). semitectum Fusarium Berk. & Ravenel, Grevillea 3: 98. 1875. (See Fusarium incarnatum) Holotypus: ?K(M). Type locality: USA, Pennsylvania, Philadelphia. Type substrate: Petioles of Musa sp. serjaniae Fusarium Syd. & P. Syd., Beibl. Hedwigia 40: (2). 1901. Synonym: Cercospora serjaniae (Syd. & P. Syd.) Wollenw., Z. Parasitenk. (Berlin) 3: 496. 1931. Holotypus: S-F45658. Type locality: Mexico, Puebla, Tehuac
an. Type substrate: Leaves of Serjania racemosa. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935) and not Cercospora fide Crous & Braun (2003). serpentinum Fusarium J.W. Xia et al., Persoonia 43: 217. 2019. Holotypus: CBS H-24070. Ex-type culture: BBA 62209 = CBS 119880 = MRC 1813. Type locality: Unknown. Type substrate: Unknown. Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb2: MN170432; tef1: MN170499. setosum Fusarium Nirenberg & Samuels, Canad. J. Bot. 67: 3372. 1989. Setofusarium setosum (Samuels & Nirenberg) Sand.-Den. & Crous, Stud. Mycol. 98 (no. 100116): 75. 2021. Synonym: Nectria setofusarii Samuels & Nirenberg (as ‘setofusariae’), Canad. J. Bot. 67: 3372. 1989. Holotypus: NY00927992. Type locality: French Guiana, Piste de Saint-Elie, Km 16 on road between Sinnamary and St. Elie, ORSTOM research area, "ECEREX". Type substrate: Bark of living liana. Epitypus: CBS H-24723, designated in this study. Ex-epitype culture: CBS 635.92 = G.J.S. 88-12 = NRRL 36526. Epitype locality: French Guiana, Cayenne, 15 km from Remise, trail to Vidal-old farm, secondary forest. Epitype substrate: Bark. Descriptions and illustrations: See Samuels & Nirenberg (1989). Diagnostic DNA barcodes: rpb1: JX171539; rpb2: JX171651; tef1: MW834294. FUSARIUM sibiricum Fusarium Gagkaeva et al., Int. J. Food Microbiol. 147: 64. 2011. Holotypus: LEP 12652. Ex-type culture: MFG 11013 = NRRL 53430. Type locality: Russia, Khabarovsk. Type substrate: Grain of Avena sativa. Descriptions and illustrations: See Yli-Mattila et al. (2011). Diagnostic DNA barcodes: rpb1: MW233302; rpb2: HQ154472; tef1: HM744684. siculi Fusarium Sand.-Den. et al., Persoonia 40: 17. 2017 [2018]. Holotypus: CBS H-23021. Ex-type culture: CBS 142422 = CPC 27188. Type locality: Italy, Sicily, Catania, Patern
o. Type substrate: Citrus sinensis. Descriptions and illustrations: See Sandoval-Denis et al. (2018a). Diagnostic DNA barcodes: rpb1: LT746299; rpb2: LT746327; tef1: LT746214. silvicola Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 4. 2020. Neocosmospora silvicola Sand.-Den. & Crous, Persoonia 43: 167. 2019. Synonyms: Fusarium solani f. robiniae Matuo & Y. Sakurai, Ann. Phytophathol. Soc. Japan 30: 35. 1965. Hypomyces solani f. robiniae Matuo & Y. Sakurai, Ann. Phytophathol. Soc. Japan 30: 35. 1965. Nectria solani f. robiniae (Matuo & Y. Sakurai) G.R.W. Arnold, Z. Pilzk. 37: 193. 1972. Holotypus: CBS H-24002. Ex-type culture: CBS 123846 = G.J.S. 04-147. Type locality: USA, Tennessee, Great Smoky Mountains National Park. Type substrate: Fallen trunk of Liriodendron tulipifera. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834254; rpb2: LR583876; tef1: LR583646. sinense Fusarium Z.H. Zhao & G.Z. Lu (as ‘sinensis’), Mycologia 100: 747. 2008. Holotypus: IBE 000007. Ex-type culture: CBS 122710. Type locality: China, Shandong Province, Jinan. Type substrate: Seed of Triticum aestivum. Descriptions and illustrations: See Zhao & Lu (2008). Diagnostic DNA barcode: tef1: EF531235. socium Fusarium Sacc., Atti Ist. Veneto Sci. Lett. Arti, s
er. 6, 2: 450. 1884. (See Fusarium expansum) Holotypus: Not located. Type locality: France, Troyes. Type substrate: Cortex of Carpinus sp. in association with Stilbospora sp. and Nectria stilbosporae. Note: Synonym fide Wollenweber & Reinking (1935). solani Fusarium (Mart.) Sacc., Michelia 2: 296. 1881. Neocosmospora solani (Mart.) L. Lombard & Crous, Stud. Mycol. 80: 228. 2015. Basionym: Fusisporium solani Mart., Die Kartoffel-Epidemie der letzten Jahre oder die Stockf€aule und R€aude der Kartoffeln: 20. 1842. www.studiesinmycology.org REDELIMITED Synonyms: Fusisporium solani-tuberosi Desm., Ann. Sci. Nat., Bot., s
er. 3, 3: 359. 1845. Fusarium solani-tuberosi (Desm.) Sacc., Syll. Fung. 4: 189. 1886. Pionnotes solani-tuberosi (Desm.) Sacc., Syll. Fung. 4: 727. 1886. Fusisporium rhizophilum var. solani-tuberosi (Desm.) Westend., Bull. Acad. Roy. Sci. Belgique, Cl. Sci. 18(2): 413. 1852. Fusisporium candidum Bonord., Handb. Allg. Mykol.: 96. 1851, nom. illegit., Art. 53.1, non Fusarium candidum (Link) Sacc. 1886 Fusarium commutatum Sacc., Syll. Fung. 4: 710. 1886. Fusarium allii-sativi Allesch., Ber. Bot. Vereines Landshut 12: 131. 1892. Hymenula affinis (Fautrey & Lambotte) Wollenw., Fusaria Autogr. Delin. 1: 484. 1916 [pr. p. fide Booth (1971)]. Pionnotes viridis Lechmere, Compt. Rend. Hebd. S
eances Acad. Sci. 155: 178. 1912. Fusarium viride (Lechmere) Wollenw., Fusaria Autogr. Delin. 1: 418. 1916. Fusarium radicicola Wollenw., J. Agric. Res. 2: 257. 1914. Fusarium javanicum var. radicicola (Wollenw.) Wollenw., Z. Parasitenk. (Berlin) 3: 286. 1931. Fusarium solani f. radicicola (Wollenw.) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 28: 740. 1941. Fusarium eumartii C.W. Carp., J. Agric. Res. 5: 204. 1915. Fusarium solani var. eumartii (C.W. Carp.) Wollenw., Z. Parasitenk. (Berlin) 3: 452. 1931. Fusarium solani f. eumartii (C.W. Carp.) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 28: 740. 1941. Fusarium malli Taubenh., Bull. Texas Agric. Exp. Sta. 273: 25. 1921. Fusarium alluviale Wollenw. & Reinking, Phytopathology 15: 167. 1925. Fusarium aduncisporum Weimer & Harter, J. Agric. Res. 32: 312. 1926. Fusarium solani var. aduncisporum (Weimer & Harter) Wollenw., Fusaria Autogr. Delin. 3: 1035. 1930. Neocosmospora rubicola L. Lombard & Crous, Stud. Mycol. 80: 227. 2015. Lectotypus: Illustration tab. III, fig. 29 in von Martius (1842), designated in Schroers et al. (2016). Epitypus: CBS H-22335, designated in Schroers et al. (2016). Ex-epitype culture: CBS 140079 = FRC S-2364 = NRRL 66304. Epitype locality: Slovenia, Doljenska, Radohova. Epitype substrate: Rotten tuber of Solanum tuberosum. Descriptions and illustrations: See Wollenweber & Reinking (1935), Leslie & Summerell (2006), and Schroers et al. (2016). Diagnostic DNA barcodes: rpb1: MW218134; rpb2: KT313623; tef1: KT313611. solani-melongenae Fusarium O'Donnell et al., Index Fungorum 440: 4. 2020. Neocosmospora ipomoeae (Halst.) L. Lombard & Crous, Stud. Mycol. 80: 227. 2015. Basionym: Nectria ipomoeae Halst., Rep. (Annual) New Jersey Agric. Exp. Sta. 12: 281. 1891. Synonyms: Cucurbitaria ipomoeae (Halst.) Kuntze, Revis. Gen. Pl. 3: 461. 1898. Creonectria ipomoeae (Halst.) Seaver, N. Amer. Fl. 3: 22. 1910. Hypomyces ipomoeae (Halst.) Wollenw., Phytopathology 3: 34. 1913. Haematonectria ipomoeae (Halst.) Samuels & Nirenberg, Stud. Mycol. 42: 136. 1999. 159 CROUS ET AL. Nectria ipomoeae f. ipomoeae Halst., Rep. (Annual) New Jersey Agric. Exp. Sta. 12: 281. 1891. Nectria ipomoeae var. ipomoeae Halst., Rep. (Annual) New Jersey Agric. Exp. Sta. 12: 281. 1891. Hypomyces ipomoeae var. ipomoeae (Halst.) Wollenw., Phytopathology 3: 34. 1913. Hypomyces ipomoeae var. major Wollenw., Fusaria Autogr. Delin. 3: 826. 1930. ?Fusarium striatum Sherb., Cornell Univ. Agric. Exp. Sta. Mem. 6: 255. 1915 ?Fusarium solani var. striatum (Sherb.) Wollenw., Z. Parasitenk. (Berlin) 3: 451. 1931. Holotypus: BPI 552416. Type locality: USA, New Jersey, Mickleton. Type substrate: Solanum melongena. Note: This species requires epitypification from the type locality and host. solani-tuberosi Fusarium (Desm.) Sacc., Syll. Fung. 4: 189. 1886. Basionym: Fusisporium solani-tuberosi Desm., Ann. Sci. Nat., Bot., s
er. 3, 3: 359. 1845. (See Fusarium solani) Holotypus: ?PC. Type locality: France. Type substrate: Rotten tuber of Solanum tuberosum. Note: Synonyms fide Wollenweber & Reinking (1935). sophorae Fusarium Allesch., Beibl. Hedwigia 36: (164). 1897. (See Fusarium lateritium) Holotypus: In M. Type locality: Germany, Berlin, Sp€ath'sche Baumschulen. Type substrate: Sophora japonica. Note: Synonym fide Wollenweber & Reinking (1935). sorghi Fusarium Henn., Ann. Mus. Congo Belge, Bot., s
er. 5, 2: 105. 1907. (See Fusarium avenaceum) Syntype: Vanderyst 171 in B fide Hein (1988). Type locality: Democratic Republic of the Congo, Kisantu. Type substrate: Spikelet of Sorghum vulgare (= Sorghum bicolor). Note: Synonym fide Wollenweber & Reinking (1935). sororula Fusarium Herron et al., Stud. Mycol. 80: 146. 2015. Holotypus: PREM 60903. Ex-type culture: CBS 137242 = CMW 40578. Type locality: Colombia, Risaralda, Angela Maria (Santa Rosa). Type substrate: Stem cankers of Pinus patula. Descriptions and illustrations: See Herron et al. (2015). Notes: Comparisons of recently generated sequences from the living ex-type culture (CBS 137242 = CMW 40578) of F. sororula indicate a strain transposition or contamination by another Fusarium species. Therefore, this species needs to be recollected from the type locality and substrate or sequences need to be generated from the holotype specimen. spartinae Fusarium Ellis & Everh., J. Mycol. 8: 14. 1902. Septogloeum spartinae (Ellis & Everh.) Wollenw. & Reinking, Fusarien: 336. 1935. Holotypus: NY (fide Index Fungorum). Type locality: USA, California, Pacific Grove. Type substrate: Leaves of Spartina stricta. Note: Synonym fide Wollenweber & Reinking (1935). 160 spartum Fusarium S. Gargouri et al., Mycologia 112: 799. 2020. Holotypus: BPI 911207. Ex-type culture: NRRL 66896. Type locality: Tunisia, Kasserine Governorate. Type substrate: Rhizosphere of Macrochloa tenacissima. Descriptions and illustrations: See Gargouri et al. (2020). Diagnostic DNA barcodes: rpb1: MT409439; rpb2: MT409449; tef1: MT409459. spathulatum Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 4. 2020. Neocosmospora spathulata Sand.-Den. & Crous, Persoonia 43: 171. 2019. Holotypus: CBS H-24003. Ex-type culture: CBS 145474 = NRRL 28541 = UTHSC 98-1305. Type locality: USA, New England. Type substrate: Synovial fluid from Homo sapiens. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW218137; rpb2: EU329542; tef1: DQ246882. speiranthae Fusarium Henn. (as ‘speiranthis’), Verh. Bot. Vereins Prov. Brandenburg 40: 174. 1898. Colletotrichum dematium (Pers.) Grove, J. Bot. 56: 341. 1918. Basionym: Sphaeria dematium Pers., Syn. Meth. Fung.: 88. 1801. Synonyms: Exosporium dematium (Pers.) Link, in Willdenow, Sp. pl., Ed. 4, 6: 122. 1825. Vermicularia dematium (Pers.) Fr., Syst. Mycol. 3: 255. 1829.
Lasiella dematium (Pers.) Qu
el., M
em. Soc. Emul. Montb
eliard s
er. 2, 5: 518. 1875. Gloeosporium speiranthae (Henn.) Wollenw., Fusaria Autogr. Delin. 1: 500. 1916. Holotypus: In B fide Hein (1988). Type locality: Germany, Berlin, botanical garden. Type substrate: Leaves of Speirantha convallarioides. Notes: Wollenweber (1916) studied and illustrated authentic material of this species, recombining it in Gloeosporium. The shape of the conidia is similar to species in the Colletotrichum dematium species complex. However, the conidia are slightly broader than those of the ex-type strain of C. dematium (3.5–4.5 vs 3–4 μm, Damm et al. 2009); the synonymy needs to be confirmed. Publication data cited in name repositories (Allg. Bot. Z. Syst. 2: 83. 1896.) are incorrect and instead refer to the protologue of F. seemenianum (syn. F. avenaceum), an unrelated taxon. speiseri Fusarium Lindau, Rabenh. Krypt.-Fl. Ed. 2, 1(9): 580. 1909. (See Fusarium avenaceum). Holotypus: B 70 0100195. Type locality: Poland, Karthaus, Nýdek. Type substrate: Dead Auchenorrhyncha (cicada). Note: Synonym fide Wollenweber & Reinking (1935). spermogoniopsis Fusarium Jul. Müll., Ber. Deutsch. Bot. Ges. 3: 394. 1885. Hymenella spermogoniopsis (Jul. Müll.) L. Lombard & Sand.Den., comb. nov. MycoBank MB 837721. Basionym: Fusarium spermogoniopsis Jul. Müll., Ber. Deutsch. Bot. Ges. 3: 394. 1885. Synonym: Hymenula spermogoniopsis (Jul. Müll.) Wollenw., Fusaria Autogr. Delin. 1: 483. 1916. Syntypes: ?B 70 0100196, B 70 0100197 & B 700100198. FUSARIUM Type locality: Germany Type substrate: Sporocarps of Phragmidium subcorticium (= Phragmidium mucronatum) and on the uredo- and teliospores of Phragmidium rubi (= Phragmidium barclayi). Notes: Wollenweber (1916) provided a new combination for F. spermogoniopsis in the genus Hymenula. However, the generic name Hymenella (1822) predates the generic name Hymenula (1828) and therefore we provide a new combination in the latter genus. sphaeriae Fusarium Fuckel, Fungi Rhen. Exs., Fasc. 3, no. 212. 1863. (See Fusarium clematidis) Lectotypus: G00111017, designated in Gr€afenhan et al. (2011). Lectotype locality: Germany, Hessen, Reichartshausen near Oestrich-Winkel. Lectotype substrate: Parasitic on Leptosphaeria (Sphaeria) dioica, on Urtica dioica. sphaeriiforme Fusarium Sacc. (as ‘sphaeriaeforme’), Syll. Fung. 10: 723. 1892. Replaced synonym: Fusarium celtidis Pass., Atti Reale Accad. Lincei, Rendiconti Cl. Sci. Fis., s
er. 4, 7: 51. 1891, nom. illegit., Art. 53.1. (See Fusarium melanochlorum) Holotypus: ?PARMA. Type locality: Italy, Parma, Vigheffio. Type substrate: Dead branches of Celtis australis. Note: Synonyms fide Wollenweber & Reinking (1935). sphaeroideum Fusarium Pass., Atti Reale Accad. Lincei, Rendiconti Cl. Sci. Fis., s
er. 4, 4: 105. 1888. (See Fusarium lateritium) Holotypus: ?PARMA. Type locality: Italy, Parma. Type substrate: Branch of Ficus carica. Note: Synonym fide Wollenweber & Reinking (1935). sphaerosporum Fusarium Q.T. Chen & X.H. Fu, Acta Mycol. Sin., Suppl. 1: 331. 1987. Neocosmospora sphaerospora (Q.T. Chen & X.H. Fu) Sand.Den. & Crous, Persoonia 43: 173. 2019. Holotypus: HMAS 43749. Ex-type culture: NF 5840. Type locality: China, Guangdong Province, Maoming. Type substrate: Water from underground pipes of oilfield. Descriptions and illustrations: See Chen et al. (1987). spinaciae Fusarium Hungerf., Phytopathology 13: 209. 1923. (See Fusarium oxysporum) Lectotypus (hic designatus, MBT 10000744): USA, Idaho, roots of Spinacia oleracea, 1923, C.W. Hungerford, in Phytopathology 13: 208, fig. 4. Notes: Synonym fide Booth (1971). No holotype specimen could be located and therefore an illustration was designated as lectotype. spinosum Fusarium L. Lombard et al., Fungal Syst. Evol. 4: 195. 2019. Holotypus: CBS H-24020. Ex-type culture: CBS 122438. Type locality: Brazil. Type substrate: Galia melon imported into the Netherlands. Descriptions and illustrations: See Lombard et al. (2019a). www.studiesinmycology.org REDELIMITED Diagnostic DNA barcodes: rpb1: MN120729; rpb2: MN120747; tef1: MN120768. spinulosum Fusarium (Pfenning) O'Donnell et al., Index Fungorum 440: 4. 2020. Neocosmospora spinulosa Pfenning, Sydowia 47: 66. 1995. Holotypus: CBS H-5452a. Ex-type culture: CBS 321.93. Type locality: Brazil, Par
a, Capit~ao Poço. Type substrate: Soil under Theobroma cacao. Descriptions and illustrations: See Pfenning (1995). splendens Fusarium Matuo & Takah. Kobay., Trans. Mycol. Soc. Japan 2(4): 13. 1960, nom. inval., Art. 39.1. (See Fusarium matuoi) Authentic material: Not located. Original locality: Japan. Original substrate: Twigs of Albizzia julibrissin. Descriptions and illustrations: See Matuo & Kobayashi (1960) and Hosoya & Tubaki (2004). sporodochiale Fusarium L. Lombard & Crous, Fungal Syst. Evol. 4: 196. 2019. Holotypus: CBS H-12681. Ex-type culture: ATCC 14167 = CBS 220.61 = MUCL 8047 = NRRL 20842. Type locality: South Africa, Gauteng Province, Johannesburg. Type substrate: Soil. Descriptions and illustrations: See Lombard et al. (2019a). Diagnostic DNA barcodes: rpb1: MN120731; rpb2: MN120749; tef1: MN120770. sporotrichiella Fusarium Bilaĭ, Yadovitye griby na zerne khlebnykh zlakov: 86. 1953, nom. inval., Art. 39.1. (See Fusarium sporotrichioides) Authentic material: Not located. Original locality: Ukraine. Original substrate: Unknown. Descriptions and illustrations: See Bilaĭ (1955). Notes: This taxon was published as a new name for all the taxa in section Sporotrichiella. However, it is invalid as no type and Latin diagnosis were provided. Synonym fide Gerlach & Nirenberg (1982). sporotrichioides Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 183. 1915. Synonyms: Fusarium sporotrichiella var. sporotrichioides (Sherb.) Bilaĭ, Yadovitye griby na zerne khlebnykh zlakov (Poisonous fungi on cereal seed), Kiev: 87. 1953, nom. inval., Art. 39.1. Fusarium sporotrichiella Bilaĭ, Yadovitye griby na zerne khlebnykh zlakov (Poisonous fungi on cereal seed), Kiev: 86. 1953, nom. inval., Art. 39.1. Fusarium sporotrichioides var. minus Wollenw., Fusaria Autogr. Delin. 3: 886. 1930. Fusarium sporotrichioides subsp. minus (Wollenw.) Raillo, Fungi of the Genus Fusarium: 196. 1950. Lectotypus (hic designatus, MBT 10000745): USA, New York, rotten tubers of Solanum tuberosum, together with F. solani and F. oxysporum, 1915, C.D. Sherbakoff, in Mem. Cornell Univ. Agric. Exp. Sta. 6: 184, fig. 22. Notes: This economically important species requires epitypification from the type locality and substrate. No holotype 161 CROUS ET AL. specimen could be located and therefore an illustration was designated as lectotype. staphyleae Fusarium Samuels & Rogerson, Brittonia 36: 84. 1984. Geejayessia atrofusca (Schwein.) Schroers & Gr€afenhan, Stud. Mycol. 68: 126. 2011. Basionym: Sphaeria atrofusca Schwein., Trans. Amer. Philos. Soc., n.s. 4: 206. 1832. Synonyms: Valsaria atrofusca (Schwein.) Cooke ex Sacc., Syll. Fung. 9: 759. 1891. Nectria atrofusca (Schwein.) Ellis & Everh., N. Amer. Pyren.: 99. 1892. Pseudodiplodia atrofusca (Schwein.) Starb€ack, Bih. Kongl. Svenska Vetensk.-Akad. Handl. 19: 94. 1894. Cucurbitaria atrofusca (Schwein.) Kuntze, Revis. Gen. Pl. 3: 460. 1898. Creonectria atrofusca (Schwein.) Seaver, Mycologia 1: 186. 1909. Holotypus: In NY. Ex-type culture: ATCC 66906 = CBS 502.94 = IMI 345891 = NRRL 22120. Type locality: USA, Massachusetts, Berkshire, south of Ashley Falls, Bartholomew's Cobble. Type substrate: Branches of Staphylea trifolia. Descriptions and illustrations: See Samuels & Rogerson (1984) and Schroers et al. (2011).  si
c et al., Antonie van Leeuwenhoek 111: stercicola Fusarium Si 1793. 2018.  si
c et al.) Sand.-Den. & Crous, Neocosmospora stercicola (Si Persoonia 43: 173. 2019. Synonyms: Fusarium martii var. viride Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 247. 1915. Fusarium solani var. martii ‘f. 1’ Wollenw., Z. Parasitenk. (Berlin) 3: 290. 1931.  si
c et al., Antonie van LeeuFusarium witzenhausenense Si wenhoek 111: 1795. 2018. Fusarium xiangyunense F. Zhang et al. (as ‘xiangyunensis’), Phytotaxa 450: 278. 2020. nom. inval., Art. 40.8. Holotypus: CBS H-23352. Ex-type culture: CBS 142481 = DSM 106211 = FS 89. Type locality: Germany, Niedersachsen, Hannover. Type substrate: Compost yard waste plant debris.  si
c et al. (2018a). Descriptions and illustrations: See Si Diagnostic DNA barcodes: rpb1: MW834255; rpb2: LR583887; tef1: LR583658. stercorarium Fusarium Rostr., Meddel. Grønland 18: 74. 1894. Holotypus: C-F-92401 Type locality: Greenland, Vestfjord. Type substrate: Dung of Rangifer tarandus (reindeer). Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). stercoris Fusarium Fuckel, Fungi Rhen. Exs., Suppl., Fasc. 5: no. 1921. 1867 [and Jahrb. Nassauischen Vereins Naturk. 23–24: 369. 1870]. (See Fusarium avenaceum) Lectotypus (hic designatus, MBT 10000746): Germany, Hessen, Oestrich-Winkel, soil next to Peziza stercoraria, date unknown, K.W.G.L. Fuckel, Fungi Rhen. Exs., Suppl., Fasc. 5: no. 1921 in HAL. 162 Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore the exsiccate lodged in HAL is designated as lectotype. sterilihyphosum Fusarium Britz et al., Mycologia 94: 726. 2002. Holotypus: PREM 57302. Ex-type culture: NRRL 25623. Type locality: South Africa, Limpopo Province, Tzaneen, Letsitele area. Type substrate: Malformed inflorescence of Mangifera indica. Descriptions and illustrations: See Britz et al. (2002) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: MN193925; rpb2: MN193897; tef1: MN193869. sticticum Fusarium Berk. & M.A. Curtis, in Berkeley, Grevillea 3: 99. 1875. (See Fusarium lateritium) Holotypus: ?K(M). Type locality: USA, South Carolina. Type substrate: Twigs of Prunus persica. Note: Synonym fide Wollenweber & Reinking (1935). stictoides Fusarium Durieu & Mont., Explor. Sci. Alg
erie 1: 334. 1848. (See Fusarium graminearum) Holotypus: ?PC. Type locality: Algeria. Type substrate: Branch of flowering Agave sp. Note: Synonym fide Wollenweber & Reinking (1935). stilbaster Fusarium (Link) Link, Sp. pl., Ed. 4, 6: 106. 1825. Atractium stilbaster Link, Mag. Ges. Naturf. Freunde, Berlin 3: 10. 1809. Synonyms: Atractium fuscum Sacc., Syll. Fung. 2: 514. 1883. Stilbella fusca (Sacc.) Seifert, Stud. Mycol. 27: 77. 1985. Atractium flavoviride Sacc., Syll. Fung. 2: 514. 1883. Stilbum madidum Peck, Rep. (Annual) New York State Mus. Nat. Hist. 46: 115. 1894. Didymostilbe eichleriana Bres. & Sacc., Atti Congr. Bot. Palermo: 59. 1903. Didymostilbe obovoidea Matsush., Icon. Microfung. Matsush. lect.: 60. 1975. Lectotypus: Illustration published in Mag. Ges. Naturf. Freunde, Berlin 3, tab. I, fig. 11, designated in Gr€afenhan et al. (2011). Epitypus: CBS 410.67 (preserved as metabolically inactive culture), designated in Gr€afenhan et al. (2011). Ex-epitype culture: CBS 410.67. Epitype locality: Germany, Bayerischer Wald, Rachelseewand. Epitype substrate: Bark. Descriptions and illustrations: See Seifert (1985) and Gr€afenhan et al. (2011). Diagnostic DNA barcodes: rpb1: KM232206; tef1: KM231920. stilboides Fusarium Wollenw., Fusaria Autogr. Delin. 2: 615. 1924. Synonyms: Fusarium lateritium var. stilboides (Wollenw.) Bilaĭ, Fusarii (Biologija i sistematika): 266. 1955, nom. inval., Art. 41.5. Fusarium lateritium var. stilboides (Wollenw.) Bilaĭ, Mikrobiol. Zhurn. 49: 6. 1987. Fusarium lateritium var. longum Wollenw., Fusaria Autogr. Delin. 1: 385. 1916. FUSARIUM Fusarium fructigenum var. minus Wollenw., Z. Parasitenk. (Berlin) 3: 386. 1931. Fusarium stilboides var. minus (Wollenw.) Wollenw., Z. Parasitenk. (Berlin) 3: 333. 1931. Fusarium stilboides ‘f. 1’ Raillo, Fungi of the Genus Fusarium: 271. 1950. Gibberella stilboides W.L. Gordon ex C. Booth, The Genus Fusarium: 119. 1971. Lectotypus (hic designatus, MBT 10000747): Philippines, Los Ba~nos, living twigs of Citrus sp., invaded by coccids, 1917, O.A. Reinking, in Fusaria Autogr. Delin. 2: 615. Epitypus (hic designatus, MBT 10000748): Cook Islands, Citrus sp., Sep. 1978, G.F. Laundon, CBS 746.79 (preserved as metabolically inactive culture). Ex-epitype culture: BBA 63887 = CBS 746.79 = ICMP 10624 = NRRL 25485. Descriptions and illustrations: See Wollenweber (1924, 1930), Wollenweber & Reinking (1935), Doidge (1938), Raillo (1950), Booth (1971), and Gerlach & Nirenberg (1982). Diagnostic DNA barcodes: rpb1: MW928817; rpb2: MW928832; tef1: MW928843. Note: No holotype specimen could be located and therefore an illustration was designated as lectotype. stillatum Fusarium De Not. ex Sacc., in Berlese & Voglino, Syll. Fung., Addit. I–IV: 390. 1886. Myxosporium stillatum (De Not. ex Sacc.) Wollenw., Fusaria Autogr. Delin. 1: 490. 1916. Lectotypus (hic designatus, MBT 10000749): Italy, Valle Intrasca, at the bridge on Possaccio, dried stems of Genista tinctoria, 1862, G. de Notaris, S-F45664 [Baglietto, Cesati & Notaris, Erb. Critt. Ital. Ser. I no. 148 (1148)]. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore the exsiccate lodged in S is designated as lectotype. stoveri Fusarium C. Booth, The Genus Fusarium: 37. 1971. Microdochium stoveri (C. Booth) Samuels & I.C. Hallett, Trans. Brit. Mycol. Soc. 81: 481. 1983. Basionym: Micronectriella stoveri C. Booth, Mycol. Pap. 94: 3. 1964. Synonym: Monographella stoveri (C. Booth) Samuels & I.C. Hallett, Trans. Brit. Mycol. Soc. 81: 473. 1983. Holotypus: IMI 92905. Type locality: Honduras. Type substrate: Leaf of Musa sp. Descriptions and illustrations: See Booth (1964, 1971), Gerlach & Nirenberg (1982) and Samuels & Hallet (1983). striatum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 255. 1915. (See Fusarium solani-melongenae) Typus: ?CUP-007460. Type locality: USA, Colorado Type substrate: Solanum tuberosum. Notes: Synonym fide Nirenberg & Brielmaiers-Liebetanz, 1996 and Sandoval-Denis et al. (2019). Lectotypification pending study of material lodged in CUP. strobilinum Fusarium Corda, Icon. Fung. 1: 4. 1837. Sirococcus conigenus (Pers.) P.F. Cannon & Minter, Taxon 32: 577. 1983. Basionym: Hysterium conigenum Pers., Ann. Bot. (Usteri) 15: 30. 1795. www.studiesinmycology.org REDELIMITED Synonyms: Hypoderma conigenum (Pers.) DC., Fl. Franç., ed. 3, 2: 305. 1805. Hypodermopsis conigena (Pers.) Kuntze, Revis. Gen. Pl. 3: 487. 1898. Discella conigena (Pers.) Höhn., Mitt. Bot. Inst. T. H. Wien 6: 120. 1929. Ascochyta strobilina (Corda) Wollenw., Fusaria Autogr. Delin. 1: 505. 1916. Sphaeria strobilina Holl & J.C. Schmidt, Deutschl. Schw€amme, Erste Lieferung: 4. 1815, nom. inval., Art. 38.1(a). Sphaeria strobilina Holle & J.C. Schmidt ex Fr., Syst. Mycol. 2: 495. 1823. Dichaena strobilina (Holle & J.C. Schmidt ex Fr.) Fr., Summa Veg. Scand. 2: 403. 1849. Sporonema strobilinum Desm., Ann. Sci. Nat., Bot., s
er. 3, 18: 368. 1852. Plenodomus strobilinus (Desm.) Höhn., Sitzungsber. Kaiserl. Akad. Wiss. Wien, Math.-Naturwiss. Cl., Abt. 1, 119: 647. 1910. Discella strobilina (Desm.) Died., Krypt.-Fl. Brandenburg 9: 752. 1914. Sirococcus strobilinus (Desm.) Petr., Sydowia 1: 155. 1947, nom. illegit., Art. 53.1. Sirococcus strobilinus Preuss, Linnaea 26: 716. 1855. Phoma conigena P. Karst., Rev. Mycol. (Toulouse) 7: 106. 1885. Septoria parasitica R. Hartig, Z. Forst- Jagdwesen 1890: 1. 1890. Diplodina parasitica (R. Hartig) Prill., Maladies des Plantes Agricoles 2: fig. 365. 1897. Ascochyta parasitica Fautrey, Rev. Mycol. (Toulouse) 13: 79. 1891. Ascochyta piniperda Lindau, Nat. Pflanzenfam., Teil. I, 1: 367. 1900. Phoma conigena var. abieticola Sacc., Ann. Mycol. 3: 233. 1905. Typus: In PRM fide Pilat (1938). Type locality: Czech Republic, near Liberec (Reichenberg). Type substrate: Rotten cone scales of Pinus sp. Note: Typification pending study of material lodged in PRM. stromaticola Fusarium Henn., Bot. Jahrb. Syst. 28: 280. 1900. Dialonectria volutella (Ellis & Everh.) L. Lombard & Sand.Den., comb. nov. MycoBank MB 837722. Basionym: Fusarium volutella Ellis & Everh., Proc. Acad. Nat. Sci. Philadelphia 43: 93. 1891. Synonyms: Fusarium aquaeductuum var. medium Wollenw., Fusaria Autogr. Delin. 3: 844. 1930. Fusarium aquaeductuum subsp. medium (Wollenw.) Raillo, Fungi of the Genus Fusarium: 278. 1950. Dialonectria ullevolea Seifert & Gr€afenhan, Stud. Mycol. 68: 97. 2011. Holotypus: In B fide Hein (1988). Type locality: Japan, Tokyo. Type substrate: Old stroma of Dothideaceae, on Bambusa sp. branches with Zythia stromaticola. Notes: Synonym fide Wollenweber & Reinking (1935) and Gr€afenhan et al. (2011). The older epithet ‘volutella’ (1891) supersedes the epithet ‘ullevolea’ (2011) and, therefore, a new combination is provided. stromaticum Fusarium Delacr., Bull. Soc. Mycol. France 9: 186. 1893. (See Fusarium heterosporum) Holotypus: ?PC. Type locality: France, overseas department of Mayotte, Mayotte islands. 163 CROUS ET AL. Type substrate: Seeds of unknown Poaceae (= Gramineae). Note: Synonym fide Wollenweber & Reinking (1935). IMB 5238), which represents the ex-type culture (Gerlach & Nirenberg 1982), is designated as lectotype. subcarneum Fusarium P. Crouan & H. Crouan, Fl. Finistere: 14. 1867, nom. rej. (See Fusarium sambucinum) Authentic material: ?PC. Original locality: France, Brittany, Finistere, marshes. Original substrate: Twigs and dead leaves of Ulex sp. Note: Synonym fide Wollenweber & Reinking (1935). subnivale Fusarium Höhn., in Penther & Zederbauer, Ann. K. K. Naturhist. Hofmus. 20: 369. 1905. (See Fusarium dimerum) Holotypus: FH00965354. Type locality: Turkey, Anatolia. Type substrate: Stems and leaves of decayed Astragalus sp. Note: Synonym fide Wollenweber & Reinking (1935). subcorticale Fusarium Oudem., Ned. Kruidk. Arch., s
er. 3, 3: 135. 1898. (See Fusarium buxicola) Holotypus: ?L. Type locality: Netherlands, Zuid-Holland Province, Zorgvliet. Type substrate: Buxus sempervirens. Note: Synonym fide Wollenweber & Reinking (1935). subpallidum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. Mem. 6: 230. 1915. (See Fusarium sambucinum) Typus: ?CUP-007480. Type locality: USA, Louisiana, Edgerton. Type substrate: Solanum tuberosum. Notes: Synonym fide Wollenweber & Reinking (1935). Lectotypification pending study of material lodged in CUP. subglutinans Fusarium (Wollenw. & Reinking) P.E. Nelson et al., Fusarium species. An illustrated manual for identification: 135. 1983. Basionym: Fusarium moniliforme var. subglutinans Wollenw. & Reinking, Phytopathology 15: 163. 1925. Synonyms: Fusarium moniliforme f. subglutinans (Wollenw. & Reinking) C. Moreau, Rev. Mycol. (Paris) 17: 23. 1952. Fusarium sacchari var. subglutinans (Wollenw. & Reinking) Nirenberg, Mitt. Biol. Bundesanst. Land- Forstw. 169: 53. 1976. Gibberella fujikuroi var. subglutinans (Wollenw. & Reinking) E.T. Edwards, Agric. Gaz. New South Wales 44: 895. 1933 (Art. F.8.1, Note 2, Exs. 2). Gibberella subglutinans (Wollenw. & Reinking) P.E. Nelson et al., Fusarium species. An illustrated manual for identification (University Park): 135. 1983. Neotypus: CBS 747.97 (preserved as metabolically inactive culture), designated by Yilmaz et al. (2021). Ex-neotype culture: BBA 62451 = CBS 747.97 = DAOM 225141 = FRC M-36 = MRC 8554 = NRRL 22016 = NRRL 22114. Neotype locality: USA, Illinois, Saint Elmo. Neotype substrate: Zea mays. Descriptions and illustrations: See Booth (1971), Nirenberg (1976, 1981), Nelson et al. (1983), Pascoe (1990), Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: JX171486; rpb2: JX171599; tef1: HM057336. sublunatum Fusarium Reinking, Zentralbl. Bakteriol., 2. Abt. 89: 510. 1934. Synonyms: Fusarium elongatum Reinking, Zentralbl. Bakteriol. Parasitenk., Abt. 2, 89: 511. 1934, nom. illegit., Art. 53.1. Fusarium sambucinum var. sublunatum (Reinking) Bilaĭ, Mikrobiol. Zhurn. 49: 6. 1987, nom. inval., Art. 41.4, Note 1. Lectotypus (hic designatus, MBT 10000750): Costa Rica, Limon, soil in Musa sapientum plantation, 1933, O.A. Reinking, CBS 189.34 (preserved as metabolically inactive culture). Ex-type culture: BBA 62431 = CBS 189.34 = DSM 62431 = NRRL 13384 = NRRL 20840. Descriptions and illustrations: See Gerlach & Nirenberg (1982). Diagnostic DNA barcodes: rpb1: JX171451; rpb2: KX302935; tef1: KX302919. Notes: No holotype specimen could be located for F. sublunatum and therefore the metabolically inactive culture CBS 189.34 (= 164 subtectum Fusarium Roberge ex Desm., Pl. Crypt. N. France, ed. 1, Fasc. 29, no. 1428. 1845. Rhodesia subtecta (Roberge ex Desm.) Grove, British Stemand Leaf-Fungi (Coelomycetes) 2: 205. 1937. Synonyms: Myxosporina subtecta (Roberge ex Desm.) Höhn., in Weese, Ber. Deutsch. Bot. Ges. 37: 155. 1919, nom. inval., Art. 35.1. Myxosporina subtecta (Roberge ex Desm.) Höhn., Mitt. Bot. Inst. Tech. Hochsch. Wien 4: 74. 1927. Hainesia subtecta (Roberge ex Desm.) Grove, J. Bot. 70: 4. 1932. Hymenula psammae Oudem., Ned. Kruidk. Arch., s
er. 3, 1: 533. 1898. (fide Wollenweber & Reinking 1935). Syntypes: Pl. Crypt. N. France no. 1428 in ?BRU, PC & PH. Type locality: France. Type substrate: Dead leaves of Arundo arenaria. subtropicale Fusarium C. Pereira et al., Mycologia 110: 864. 2018. Holotypus: BPI 910644. Ex-type culture: CBS 144706 = NRRL 66764. Type locality: Brazil, Paran
a State, Guarapuava. Type substrate: Hordeum vulgare. Descriptions and illustrations: See Pereira et al. (2018). Diagnostic DNA barcodes: rpb1: MH706972; rpb2: MH706973; tef1: MH706974. subulatum Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: 131. 1913. Replaced synonym: Fusarium roseum var. lupini-albi Sacc., Michelia 2: 295. 1881. (See Fusarium avenaceum) Holotypus: Not located. Type locality: Italy, Selva. Type substrate: Lupinus albus. Note: Synonyms fide Wollenweber & Reinking (1935). subviolaceum Fusarium Roum. & Fautrey, Fungi Sel. Gall. Exs. no. 6022. 1892. (See Fusarium avenaceum) Syntype: ILL0020193 (Fungi Sel. Gall. Exs. no. 6022). Type locality: France, Jardin de Noidan. Type substrate: Dry stems of Asparagus officinalis. Note: Synonym fide Wollenweber & Reinking (1935). FUSARIUM succisae Fusarium Schröt. ex Sacc., Syll. Fung. 10: 724. 1892. Synonym: Fusisporium succisae J. Schröt., Hedwigia 13: 180. 1874, nom. inval., Art. 36.1(a). Lectotypus: ILL00076313 (Thümen, Mycoth. Univ. no. 675), designated by Yilmaz et al. (2021). Lectotype locality: Germany, Bavaria, Borussia. Lectotype substrate: Succisa pratensis. Epitypus: IMI 202876, designated by Yilmaz et al. (2021). Ex-epitype culture: BBA 12287 = BBA 63627 = CBS 219.76 = DAOM 225142 = IMI 202876 = IMI 375347 = NRRL 13613. Epitype locality: Germany. Epitype substrate: Succisa pratensis. Descriptions and illustrations: See Nirenberg (1976), Gerlach & Nirenberg (1982). Diagnostic DNA barcodes: rpb1: LT996207; rpb2: LT970764. sudanense Fusarium S.A. Ahmed et al., Antonie van Leeuwenhoek 110: 826. 2017. Holotypus: CBS H-22547. Ex-type culture: CBS 454.97. Type locality: Sudan. Type substrate: Plant debris of Striga hermonthica. Descriptions and illustrations: See Moussa et al. (2017). Diagnostic DNA barcodes: rpb1: LT996208; rpb2: LT996155; tef1: KU711697. sulawesiense Fusarium Maryani et al. (as ‘sulawense’), Persoonia 43: 65. 2019. Holotypus: InaCC F940 (preserved as metabolically inactive culture). Ex-type culture: InaCC F940. Type locality: Indonesia, South Sulawesi, Bone, Kecamatan Bengo, Desa Selli. Type substrate: Infected pseudostem of Musa acuminata var. Pisang Cere (AAA). Descriptions and illustrations: See Maryani et al. (2019b). Diagnostic DNA barcodes: rpb2: LS479855; tef1: LS479443. sulphureum Fusarium Schltdl., Fl. Berol. 2: 139. 1824, nom. rej. (See Fusarium sambucinum) Holotypus: HAL 1613 F. Type locality: Germany, Berlin. Type substrate: Rotting tuber of Solanum tuberosum. Note: Synonym fide Wollenweber & Reinking (1935). suttonianum Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index Fungorum 440: 4. 2020. Neocosmospora suttoniana Sand.-Den. & Crous, Persoonia 41: 123. 2018. Holotypus: CBS H-23224. Ex-type culture: CBS 143214 = FRC S-1423 = NRRL 32858. Type locality: USA, Louisiana. Type substrate: Homo sapiens. Descriptions and illustrations: See Sandoval-Denis & Crous (2018). Diagnostic DNA barcodes: rpb1: MW218138; rpb2: EU329630; tef1: DQ247163. tabacinum Fusarium (J.F.H. Beyma) W. Gams, Persoonia 5: 179. 1968. Basionym: Cephalosporium tabacinum J.F.H. Beyma, Zentralbl. Bakteriol. 2. Abt. 89: 240. 1933. www.studiesinmycology.org REDELIMITED Plectosphaerella cucumerina (Lindf.) W. Gams, in Domsch & Gams, Fungi in Agricultural Soils: 160. 1972. Basionym: Venturia cucumerina Lindf., Meddn Centralanst. Försksv. Jordbruksomr. Bot. Avd. 17: 7. 1919. Synonyms: Monographella cucumerina (Lindf.) Arx, Trans. Brit. Mycol. Soc. 83: 374. 1984. Microdochium tabacinum (J.F.H. Beyma) Arx, Trans. Brit. Mycol. Soc. 83: 374. 1984. Plectosporium tabacinum (J.F.H. Beyma) M.E. Palm, W. Gams & Nirenberg, Mycologia 87: 399. 1995. Plectosphaerella cucumeris Kleb., Phytopathol. Z. 1: 43. 1929. Micronectriella cucumeris (Kleb.) C. Booth, The Genus Fusarium: 39. 1971. Cephalosporium ciferrii Verona, Studio sulle cause microbiche che danneggiano la carta ed i libri: 30. 1939. Cephalosporiopsis imperfecta M. Moreau & Moreau, Rev. Mycol. (Paris) 6: 67. 1941, nom. inval., Art. 39.1. Neotypus: CBS H-7656, designated in Palm et al. (1995). Ex-neotype culture: CBS 137.33 = MUCL 9701 = NRRL 22455. Neotype locality: UK, England, Bristol. Neotype substrate: Stems of Nicotiana tabacum. Descriptions and illustrations: See Domsch et al. (2007), Carlucci et al. (2012), Giraldo & Crous (2019). tabacivorum Fusarium Delacr., Ann. Inst. Natl. Agron., ser. 2, 5: 207. 1906. (See Fusarium oxysporum) Holotypus: ?PC. Type locality: France, P
erigueux, Razac-sur-l'Isle. Type substrate: Nicotiana tabacum. Note: Synonym fide Wollenweber & Reinking (1935). tanahbumbuense Fusarium Maryani et al., Persoonia 43: 63. 2019. Holotypus: InaCC F965 (preserved as metabolically inactive culture). Ex-type culture: InaCC F965. Type locality: Indonesia, South Kalimantan, Tanah Bumbu, Kecamatan Kusan Hilir, Desa Betung. Type substrate: Pseudostem of Musa var. Pisang Hawa. Descriptions and illustrations: See Maryani et al. (2019b). Diagnostic DNA barcodes: rpb1: LS479877; rpb2: LS479863; tef1: LS479448. tardichlamydosporum Fusarium Maryani et al., Stud. Mycol. 92: 181. 2018 [2019]. Holotypus: InaCC F958 (preserved as metabolically inactive culture). Ex-type culture: InaCC F958. Type locality: Indonesia, East Nusa Tenggara, Sikka Flores, Desa Kota Uneng Kecamatan Alok. Type substrate: Pseudostem of Musa acuminata var. Pisang Barangan. Descriptions and illustrations: See Maryani et al. (2019a). Diagnostic DNA barcodes: rpb1: LS479534; rpb2: LS479280; tef1: LS479729. tardicrescens Fusarium Maryani et al., Persoonia 43: 69. 2019. Synonym: Fusarium tardicrescens Maryani et al., Stud. Mycol. 92: 185. 2018 [2019], nom. inval., Art. 40.7. Holotypus: CBS 102024 (preserved as metabolically inactive culture). 165 CROUS ET AL. Ex-type culture: CBS 102024 = NRRL 36113. Type locality: Malawi, Karonga, Misuku Hills. Type substrate: Musa sapientum cv. Harare. Descriptions and illustrations: See Maryani et al. (2019b). Diagnostic DNA barcodes: rpb1: LS479474; rpb2: LS479217; tef1: LS479665. tasmaniense Fusarium (McAlpine) Rossman (as ‘tasmanica’), Mycol. Pap. 150: 54. 1983. Basionym: Microcera tasmaniensis McAlpine, J. Dept. Agric. Victoria 2: 647. 1904. Synonyms: Discofusarium tasmaniense (McAlpine) Petch, Trans. Brit. Mycol. Soc. 7: 143, 165. 1921. Microcera myrtilaspis McAlpine, J. Dept. Agric. Victoria 2: 647. 1904. Calonectria coccidophaga Petch, Trans. Brit. Mycol. Soc. 7: 161. 1921. Nectria coccidophaga (Petch) Rossman, Mycotaxon 8: 499. 1979. Holotypus: VPRI 2744. Type locality: Australia, Tasmania. Type substrate: Parasitic on Aspidiotus sp. (scale) on Eucalyptus bark. Descriptions and illustrations: See Rossman (1983). Notes: Status unclear. Rossman (1983) studied the specimen in K(M) and recombined the asexual morph name in Fusarium, which is not supported by the features of the sexual-morph. This species most likely belongs to Microcera as originally specified by McAlpine (1904). temperatum Fusarium Scaufl. & Munaut, Mycologia 103: 593. 2011. Holotypus: MUCL 52463-H. Ex-type culture: MUCL 52463. Type locality: Belgium, Waals-Brabant Province, Chastre. Type substrate: Zea mays. Descriptions and illustrations: See Scauflaire et al. (2011). Diagnostic DNA barcode: tef1: KM487197. tenellum Fusarium Sacc. & Briard, Rev. Mycol. (Toulouse) 7: 212. 1885. (See Fusarium sambucinum) Holotypus: Not located. Type locality: France, Troyes. Type substrate: Rotten stem of Brassica oleracea. Note: Synonym fide Wollenweber & Reinking (1935). tenue Fusarium Corda, Icon. Fung. 1: 3. 1837. (See Fusarium avenaceum) Typus: In PRM fide Pilat (1938). Type locality: Czech Republic, near Prague. Type substrate: Rotting stem of an unidentified host. Notes: Synonym fide Wollenweber & Reinking (1935). Lectotypification pending study of material lodged in PRM. tenuicristatum Fusarium (S. Ueda & Udagawa) O'Donnell et al., Index Fungorum 440: 4. 2020. Basionym: Neocosmospora tenuicristata S. Ueda & Udagawa, Mycotaxon 16: 387. 1983. Synonym: Acremonium tenuicristatum S. Ueda & Udagawa, Mycotaxon 16: 387. 1983. Holotypus: NHL 2911. Type locality: Japan, Nagasaki. Type substrate: Marine sludge. 166 Descriptions and illustrations: See Ueda & Udagawa (1983). Notes: Status unclear. See Sandoval-Denis et al. (2019). tenuissimum Fusarium (Peck) Sacc., Syll. Fung. 4: 711. 1886. Basionym: Fusisporium tenuissimum Peck, Rep. (Annual) New York State Mus. Nat. Hist. 34: 48. 1883. 1881. (See Fusarium sambucinum) Holotypus: NYSf3163. Type locality: USA, New York, Schenectady. Type substrate: Dead stem of unidentified host. Note: Synonyms fide Wollenweber & Reinking (1935). tenuistipes Fusarium Sacc., Atti Mem. Reale Accad. Sci. Lett. Arti, Padova 33: 195. 1917. (See Fusarium incarnatum) Holotypus: In PAD. Type locality: Unknown. Type substrate: Pennisetum spicatum. Note: Synonym fide Wollenweber & Reinking (1935). terrestre Fusarium Manns, Bull. North Dakota Agric. Exp. Sta.: no. 259. 1932. (See Fusarium equiseti) Holotypus: Not located. Type locality: USA, North Dakota. Type substrate: Soil. Note: Synonym fide Wollenweber & Reinking (1935). terricola Fusarium Al-Hatmi et al., Antonie van Leeuwenhoek 110: 826. 2017. Holotypus: CBS H-22548. Ex-type culture: CBS 483.94. Type locality: Australia, Queensland. Type substrate: Desert soil. Descriptions and illustrations: See Moussa et al. (2017). Diagnostic DNA barcodes: rpb1: LT996209; rpb2: LT996156; tef1: KU711698. thapsinum Fusarium Klittich et al., Mycologia 89: 644. 1997. Synonym: Gibberella thapsina Klittich et al., Mycologia 89: 643. 1997. Holotypus: BPI 737885. Ex-type culture: ATCC 200522 = CBS 777.96 = FRC M-6564. Type locality: USA, Kansas. Type substrate: Stalk of Sorghum sp. Descriptions and illustrations: See Klittich et al. (1997). Diagnostic DNA barcodes: rpb1: MW928818; rpb2: MW928833; tef1: MW928844. theobromae Fusarium Appel & Strunk, Centralbl. Bacteriol., 2. Abth., 11: 635. 1904. Neocosmospora theobromae (Appel & Strunk) Sand.-Den. & Crous, Persoonia 43: 174. 2019. Synonyms: Fusarium javanicum var. theobromae (Appel & Strunk) Wollenw., Z. Parasitenk. (Berlin) 3: 483. 1931. Neotypus: BPI 453072, designated in Sandoval-Denis et al. (2019). Type locality: Cameroon, Victoria. Type substrate: Fruits and seeds of Theobroma cacao. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcode: tef1: LR583660. Notes: This Fusarium name was recently resurrected, neotypified, and transferred to Neocosmospora by Sandoval-Denis et al. (2019). DNA barcodes were generated from the neotype FUSARIUM specimen; however, epitypification. fresh collections are needed for theobromae Fusarium M.L. Lutz, Bull. Soc. Bot. France 53: L. 1907 [1906], nom. illegit., Art. 53.1. Diplocladium theobromae Sacc. & Trotter, Syll. Fung. 22: 1309. 1913. Authentic material: Not located. Original locality: Democratic Republic of S~ao Tom
e and Príncipe. Original substrate: Fermented beans of Theobroma cacao. Note: Originally erroneously assigned to the genus Fusarium. thevetiae Fusarium Tassi, Atti Reale Accad. Fisiocrit. Siena, s
er. 4, 8: 238. 1897. Holotypus: ?SIENA. Type locality: India. Type substrate: Thevetia venenifera. Notes: Status unclear. A doubtful species fide Wollenweber & Reinking (1935). thuemenii Fusarium Sacc., Syll. Fung. 4: 722. 1886. Replaced synonym: Fusarium parasiticum Thüm., Nuovo Giorn. Bot. Ital. 12: 198. 1880, nom. illegit., Art. 53.1. (See Fusarium oxysporum) Holotypus: Not located. Type locality: Russia, Orenburg. Type substrate: Rotten branches of Betula verrucosa (= Betula pendula). Note: Synonym fide Wollenweber & Reinking (1935). tjaetaba Fusarium T.T.H. Vu et al., Fungal Diversity 77: 361. 2015 [2016]. Holotypus: RBG 5361. Ex-type culture: FRL14350 = NRRL 66243 = RBG 5361. Type locality: Australia, Northern Territory, Litchfield National Park. Type substrate: Sorghum interjectum. Descriptions and illustrations: See Laurence et al. (2016). Diagnostic DNA barcodes: rpb1: KP083267; rpb2: KP083275; tef1: KP083263. tjaynera Fusarium J.L. Walsh et al., Fungal Diversity 77: 361. 2015 [2016]. Holotypus: RBG 5367. Ex-type culture: NRRL 66246 = RBG 5367. Type locality: Australia, Northern Territory, Litchfield National Park. Type substrate: Triodia microstachya. Descriptions and illustrations: See Laurence et al. (2016). Diagnostic DNA barcodes: rpb1: KP083268; rpb2: KP083279; tef1: EF107152. tomentosum Fusarium Berk. & M.A. Curtis, J. Linn. Soc., Bot. 10: 359. 1868 [1869]. Holotypus: In K(M). Type locality: Cuba. Type substrate: Dead sticks. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). tonkinense Fusarium (Bugnic.) O'Donnell et al., Index Fungorum 440: 4. 2020. Neocosmospora tonkinensis (Bugnic.) Sand.-Den. & Crous, Persoonia 41: 126. 2018. www.studiesinmycology.org REDELIMITED Basionym: Cylindrocarpon tonkinense Bugnic., Encyclop. Mycol.11: 181. 1939. Synonym: Fusarium ershadii M. Papizadeh et al., Europ. J. Pl. Pathol. 151: 693. 2018, nom. illegit., Art. 52.1. Holotypus: IMI 113868. Ex-type culture: CBS 115.40 = IMI 113868. Type locality: Vietnam, Tonkin. Type substrate: Musa sapientum. Diagnostic DNA barcodes: rpb1: MW218140; rpb2: LT960564; tef1: LT906672. torreyae Fusarium T. Aoki et al., Mycologia 105: 314. 2013. Holotypus: BPI 884050. Ex-type culture: CBS 133858 = MAFF 243468 = NRRL 54151. Type locality: USA, Florida, Liberty County, Torreya State Park, Aspalaga Tract. Type substrate: Stem tissue of diseased Torreya taxifolia. Descriptions and illustrations: See Aoki et al. (2013). Diagnostic DNA barcodes: rpb1: MW928819; rpb2: MW928834; tef1: MW928845. tortuosum Fusarium Thüm. & Pass., Pilze Weinst.: 51. 1878. Neofabraea vagabunda (Desm.) P.R. Johnst., IMA Fungus 5: 103. 2014. Basionym: Phlyctema vagabunda Desm., Ann. Sci. Nat., Bot., s
er. 3, 8: 16. 1847. Synonyms: Rhabdospora vagabunda (Desm.) Zerov, Viznachnik gribiv Ukraini. T. 3. Nezaversheni gribi: 501. 1971, nom. inval., Art. 41.1. Rhabdospora vagabunda (Desm.) R.S. Mathur, Coelomycetes of India: 234. 1979. Gloeosporium tortuosum (Thüm. & Pass.) Sacc., Michelia 2: 117. 1880. Myxosporium tortuosum (Thüm. & Pass.) Allesch., Rabenh. Krypt.-Fl., Ed. 2, 1(7): 534. 1903. ?Fusarium obtusatum Corda, Icon. Fung. 1: 3. 1837. Fusarium bipunctatum Preuss, Linnaea 25: 741. 1852. Lituaria riessii Schulzer, Verh. K. K. Zool.-Bot. Ges. Wien 21: 1241. 1871. Gloeosporium riessii (Schulzer) Schulzer & Sacc., Hedwigia 23: 110. 1884. Gloeosporium tineum Sacc., Michelia 1: 219. 1878. Gloeosporium frigidum Sacc., Michelia 2: 168. 1880. Cylindrosporium frigidum (Sacc.) Vassiljevsky, Fungi Imperfecti Parasitici 2: 515. 1950. Gloeosporium pyrenoides Sacc. & Malbr., in Saccardo, Michelia 2: 633. 1882. Gloeosporium phillyreae Pass., Atti Reale Accad. Lincei, Rendiconti Cl. Sci. Fis., s
er. 4, 4: 103. 1888. Gloeosporium allantosporum Fautrey, Rev. Mycol. (Toulouse) 14: 97. 1892. Gloeosporium allantoideum Peck, Rep. (Annual) Regents Univ. State New York New York State Mus. 45: 81. 1893. Gloeosporium alutaceum Sacc., Malpighia 11: 317. 1897. Allantozythia alutacea (Sacc.) Höhn., Ann. Mycol. 22: 203. 1924. Phlyctema alutacea (Sacc.) Petr., Ann. Mycol. 27: 370. 1929. Fusarium japonicum Allesch., Beibl. Hedwigia 36: (164). 1897. Gloeosporium unedonis Traverso, R.C. Congr. Bot. Palermo, 1902: 3 (extr.). 1902. Trichoseptoria fructigena Maubl., Bull. Trimestriel Soc. Mycol. France 21: 95. 1905. Gloeosporium beguinotii Sacc., in Potebnia, Ann. Mycol. 5: 20. 167 CROUS ET AL. 1907. Cylindrosporium olivae Petri, Ann. Mycol. 5: 324. 1907. Gloeosporium olivae (Petri) Foschi, Ann. Sperim. Agrar, n.s. 9: 911. 1955. Gloeosporium album Osterw., Centralbl. Bacteriol. Parasitenk., 2. Abth., 18: 826. 1907. Gloeosporium diervillae Grove, J. Bot. 60: 145. 1922. Pezicula alba E.J. Guthrie, Trans. Brit. Mycol. Soc. 42: 504. 1959. Neofabraea alba (E.J. Guthrie) Verkley, Stud. Mycol. 44: 125. 1999. Holotypus: ?PARMA. Type locality: Italy, Parma. Type substrate: Dry twigs of Vitis vinifera. Note: Synonyms fide Wollenweber & Reinking (1935). torulosum Fusarium (Berk. & M.A. Curtis) Gruyter & J.H.M. Schneid., Jaarb. Plantenziektenkundige Dienst, Wageningen 1989/1990, no. 168: 135. 1991, nom. inval., Art. 41.4. Basionym: Fusidium torulosum Berk. & M.A. Curtis, Grevillea 3: 112. 1875. (See Fusarium torulosum (Berk. & M.A. Curtis) Nirenberg) torulosum Fusarium (Berk. & M.A. Curtis) Nirenberg, Mycopathologia 129: 136. 1995. Basionym: Fusidium torulosum Berk. & M.A. Curtis, Grevillea 3: 112. 1875. Synonyms: Fusoma torulosum (Berk. & M.A. Curtis) Sacc., Syll. Fung. 4: 220. 1886. Fusarium torulosum (Berk. & M.A. Curtis) Gruyter & J.H.M. Schneid., Jaarboek. Plantenziektenkundige Dienst. Wageningen 1989/1990 no. 168: 135. 1991, nom. inval., Art. 41.4. Fusarium sclerodermatis Oudem., Nederl. Kruidk. Arch. ser. 2, 5: 516. 1889. Fusarium sambucinum var. coeruleum Wollenw., Ann. Mycol. 15: 55. 1917. ?Gibberella pulicaris var. minor Wollenw., Z. Parasitenk. (Berlin) 3: 356. 1931. Syntype: ?Car Inf. no. 6034. in K(M). Type locality: USA, Pennsylvania, Michener. Type substrate: Decaying Brassica stalks or Pinus. Descriptions and illustrations: See Nirenberg (1995). toxicum Fusarium L. Lombard & J.W. Xia, Persoonia 43: 220. 2019. Holotypus: CBS H-24071. Ex-type culture: CBS 406.86 = FRC R-8507 = IMI 309347 = NRRL 25796. Type locality: Germany, Berlin. Type substrate: Soil. Descriptions and illustrations: See Xia et al. (2019). Diagnostic DNA barcodes: rpb2: MN170441; tef1: MN170508. tracheiphilum Fusarium (E.F. Sm.) Wollenw., Phytopathology 3: 29. 1913. Basionym: Neocosmospora vasinfecta var. tracheiphila E.F. Sm., Bull. Div. Veg. Physiol. Pathol. U.S.D.A. 17: 45. 1899. (See Fusarium neocosmosporiellum) Syntypes: IN BPI, F, FLAS, ISC, MICH, PUL, UC & WSP. Type locality: USA, South Carolina, James Island. Type substrate: Dead stem of Vigna sinensis. Note: Published as a new name for the sporodochial morph found on the authentic material of N. vasinfecta var. tracheiphila. 168 translucens Fusarium Berk. & Broome, Ann. Mag. Nat. Hist., ser. 4, 17: 141. 1876. Holotypus: ?K(M). Type locality: UK, Scotland, Glamis. Type substrate: Wood. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). transvaalense Fusarium Sand.-Den. et al., MycoKeys 34: 82. 2018. Holotypus: CBS H-23497. Ex-type culture: CBS 144211. Type locality: South Africa, Kruger National Park, Skukuza, Granite Supersite. Type substrate: Rhizosphere of Sida cordifolia. Descriptions and illustrations: See Sandoval-Denis et al. (2018b). Diagnostic DNA barcodes: rpb1: LT996210; rpb2: LT996157; tef1: LT996099. tremelloides Fusarium Grev., Scott. Crypt. Fl. 1: 10. 1822. Calloria tremelloides (Grev.) L. Lombard, comb. nov. MycoBank MB 837723. Basionym: Fusarium tremelloides Grev., Scott. Crypt. Fl. 1: 10. 1822. Synonyms: Peziza fusarioides Berk., Mag. Zool. Bot. 1: 46. 1837. Calloria fusarioides (Berk.) Fr., Summa Veg. Scand. 2: 359. 1849. Callorina fusarioides (Berk.) Korf, Phytologia 21: 203. 1971. Peziza neglecta Lib., Pl. Crypt. Arduenna Fasc. 1: no. 29. 1830. Calloria neglecta (Lib.) B. Hein, Beih. Willdenowia 9: 54. 1976. Holotypus: Not located. Type locality: UK, Scotland, near Edinburg. Type substrate: Dead stems of Urtica dioica. Notes: Synonyms fide Wollenweber & Reinking (1935). As the epithet of F. tremelloides (1822) takes priority above the epithet of C. neglecta (1830), a new combination is introduced here. trichothecioides Fusarium Wollenw., J. Wash. Acad. Sci. 2: 147. 1912. Synonyms: Fusarium sambucinum var. trichothecioides (Wollenw.) Bilaĭ, Fusarii (Biologija i sistematika): 268. 1955, nom. inval., Art. 41.1. Fusarium tuberivorum Wilcox & G.K. Link, Res. Bull. Nebraska Agric. Exp. Sta. 1: 48. 1913. Lectotypus (hic designatus, MBT 10000751): USA, rotten tuber of Solanum tuberosum, Aug. 1912, H.W. Wollenweber, in J. Wash. Acad. Sci. 2: 150, figs A–F. Descriptions and illustrations: See Booth (1971) and Gerlach & Nirenberg (1982). Notes: A putative synonym of F. sulphureum (Gordon 1959, Subramanian 1971, Gerlach & Nirenberg 1982) or F. sambucinum (Nelson et al. 1983, Nirenberg 1995). The taxonomy of this potato pathogen has not yet been resolved. As no holotype specimen was preserved (Gerlach & Nirenberg 1982), the figures accompanying the original protologue are designated as lectotype here. tricinctum Fusarium (Corda) Sacc., Syll. Fung. 4: 700. 1886. Basionym: Selenosporium tricinctum Corda, Icon. Fung. 2: 7. 1838. Synonyms: Fusarium sporotrichioides var. tricinctum (Corda) Raillo, Fungi of the Genus Fusarium: 197. 1950. FUSARIUM Fusarium sporotrichiella var. tricinctum (Corda) Bilaĭ, Yadovitye griby na zerne khlebnykh zlakov. Kiev: 87. 1953, nom. inval., Art. 39.1. Fusarium sporotrichiella var. tricinctum (Corda) Bilaĭ, Mikrobiol. Zhurn. 49: 7. 1987, nom. inval., Art. 35.1. ?Vermicularia subeffigurata γ helianthi Schwein., Trans. Amer. Philos. Soc., n.s. 4: 228. 1832 [1834]. ?Fusarium helianthi (Schwein.) Wollenw., Fusaria Autogr. Delin. 2: 555. 1924. Fusarium muentzii Delacr. (as ‘müntzii’), Bull. Soc. Mycol. France 8: 192. 1892. Fusarium citriforme Jamal., Valt. Maatalousk. Julk. 123: 11. 1943. Gibberella tricincta El-Gholl et al., Canad. J. Bot. 56: 2206. 1978. Lectotypus: PRM 155623 (designated in Holubov
a-Jechov
a et al. 1994). Type locality: Czech Republic, near Prague, Chuchle, Vyskocilka. Type substrate: Stem of Umbelliferae. Epitypus: In PRM, designated in Holubov
a-Jechov
a et al. (1994). Ex-epitype culture: BBA 64485 = CBS 393.93 = NRRL 25481. Epitype locality: Germany, Berlin. Epitype substrate: Culm base of Triticum aestivum. Descriptions and illustrations: See Holubov
a-Jechov
a et al. (1994) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: JX171516; rpb2: JX171629; tef1: MH582379. trifolii Fusarium Jacz., Jahrb. Pflanzenkrankh. Russlands. VIIVIII: Abt. 6. 1917. (See Fusarium oxysporum) Holotypus: Not located. Type locality: Russia, St. Petersburg. Type substrate: Root crown of Trifolium sp. Note: Synonym fide Wollenweber & Reinking (1935). triseptatum Fusarium L. Lombard & Crous, Persoonia 43: 34. 2018 [2019]. Holotypus: CBS H-23622. Ex-type culture: CBS 258.50 = NRRL 36389. Type locality: USA. Type substrate: Ipomoea batatas. Descriptions and illustrations: See Lombard et al. (2019b). Diagnostic DNA barcodes: rpb1: MW928820; rpb2: MH484873; tef1: MH484964. tritici Fusarium Liebman bis, Tidsskr. Landoekon., n.s., 2: 515. 1840. (See Fusarium avenaceum) Lectotypus (hic designates, MBT 10000752): Denmark, Triticum sp., in Tidsskr. Landoekon., n.s., 2: figs B, 1, 2. Notes: Synonymy fide Rostrup (1894). No holotype specimen could be located and therefore an illustration is designated as lectotype. tritici Fusarium Erikss., Fungi Paras. Scand. Exs. no. 400. 1891, nom. illegit., Art. 53.1. (See Fusarium nivale) Authentic material: CHRB-F-0007556. Original locality: Sweden, Stockholm. Original substrate: Triticum durum. Note: Synonym fide Wollenweber & Reinking (1935). truncatum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 155. 1915. www.studiesinmycology.org REDELIMITED (See Fusarium avenaceum) Typus: ?CUP-007429. Type locality: USA, New York. Type substrate: Solanum tuberosum. Note: Synonym fide Wollenweber & Reinking (1935). Lectotypification pending study of the material lodged in CUP. tuaranense Fusarium T. Aoki et al., Mycologia 111: 926. 2019. Neocosmospora tuaranensis (T. Aoki et al.) L. Lombard & Sand.-Den., comb. nov. MycoBank MB 837724. Basionym: Fusarium tuaranense T. Aoki et al., Mycologia 111: 926. 2019. Holotypus: BPI 910971. Ex-type culture: ATCC 16563 = MAFF 246842 = NRRL 22231. Type locality: Malaysia, Sabah State, Tuaran. Type substrate: Hevea brasiliensis damaged by an unknown ambrosia beetle. Descriptions and illustrations: See Aoki et al. (2019). Diagnostic DNA barcodes: rpb1: KC691600; rpb2: KC691660, KC691631; tef1: KC691542. Note: A new combination is provided in the genus Neocosmospora based on the phylogenetic relationship and morphology of this species (Aoki et al. 2019). tubercularioides Fusarium (Corda) Sacc., Syll. Fung. 4: 697. 1886. Basionym: Selenosporium tubercularioides Corda, Icon. Fung. 1: 7. 1837. (See Fusarium avenaceum) Typus: PRM 155625. Type locality: Czech Republic, Liberec, Hamrstejn (as ‘Sudetenland, Reichenberg, Hammerstein’). Type substrate: Dead branches of Rubus idaeus. Descriptions and illustrations: See Holubov
a-Jechov
a et al. (1994). Note: Synonym fide Wollenweber & Reinking (1935). Lectotypification pending study of the material lodged in PRM. tuberis Fusarium Preuss, Linnaea 24: 148. 1851. Holotypus: In B fide Jülich (1974). Type locality: Germany, Hoyerswerda. Type substrate: Tuber of Dahlia sp. Note: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). tuberivorum Fusarium Wilcox & G.K. Link, Res. Bull. Nebraska Agric. Exp. Sta. 1: 48. 1913. (See Fusarium trichothecioides) Lectotypus (hic designates, MBT 10000753): USA, Nebraska, Solanum tuberosum, in Res. Bull. Nebraska Agric. Exp. Sta. 1, Pl. 24. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. tucumaniae Fusarium T. Aoki et al., Mycologia 95: 664. 2003. (See Fusarium azukiicola) Holotypus: BPI 841955. Ex-type culture: MAFF 238418 = MJ-172 = NRRL 31096. Type locality: Argentina, Tucum
an, San Agustin. Type substrate: Glycine max. Descriptions and illustrations: See Aoki et al. (2003). Diagnostic DNA barcodes: rpb1: MAED01000445; rpb2: EU329557; tef1: GU170636. 169 CROUS ET AL. tumidum Fusarium Sherb., Phytopathology 18: 148. 1928. Synonym: Gibberella tumida P.G. Broadh. & P.R. Johnst., Mycol. Res. 98: 730. 1994. Syntypes: Krieger, Fungi Saxon. Exs. no. 2499 in BPI & HAL. Type locality: Germany. Type substrate: Heads of Sarothamnus scoparius. Note: Typification pending further study of the syntypes. tupiense Fusarium C.S. Lima et al., Mycologia 104: 1414. 2012. Holotypus: CMB-UB 22068. Ex-type culture: CML 262 = CMM 3655 = KSU 16195 = NRRL 53984. Type locality: Brazil, Minas Gerais, Lavras. Type substrate: Diseased tissue of Mangifera indica. Descriptions and illustrations: See Lima et al. (2012). Diagnostic DNA barcodes: rpb1: LR792583; rpb2: LR792619; tef1: GU737404. udum Fusarium E.J. Butler, Mem. Dept. Agric. India, Bot. Ser. 2(9): 54. 1910. Synonyms: Fusarium oxysporum f. sp. udum (E.J. Butler) W.C. Snyder & H.N. Hansen, Amer. J. Bot. 24: 66. 1940. Fusarium butleri Wollenw., Phytopathology 3: 38. 1913, nom. illegit., Art. 52.1. Fusarium lateritium var. uncinatum (Wollenw.) Wollenw., Z. Parasitenk. (Berlin) 3: 375. 1931. Fusarium vasinfectum var. crotalariae Kulkarni, Indian J. Agric. Sci. 4: 994. 1934. Fusarium udum f. sp. crotalariae (Kulkarni) Subram., The Genus Fusarium: 114. 1971. Fusarium udum var. cajani Padwick, Indian J. Agric. Sci. 10: 878. 1940. Fusarium lateritium f. cajani (Padwick) W.L. Gordon, Canad. J. Bot. 30: 232. 1952. Fusarium udum var. crotalariae Padwick, Indian J. Agric. Sci. 10: 877. 1940. Fusarium lateritium f. crotalariae (Padwick) W.L. Gordon, Canad. J. Bot. 30: 232. 1952. Gibberella indica B. Rai & R.S. Upadhyay, Mycologia 74: 343. 1982. Lectotypus: Butler (1910), Pl. IV, fig. 4, designated in Pfenning et al. (2019). Epitypus: UB23905, designated in Pfenning et al. (2019). Ex-epitype culture: BBA 65058 = CML 3238 = NRRL 25199. Type locality: India. Type substrate: Cajanus cajan. Descriptions and illustrations: See Wollenweber & Reinking (1935), Booth (1971), Subramanian (1971), Booth (1978), Gerlach & Nirenberg (1982) and Pfenning et al. (2019). Diagnostic DNA barcodes: rpb2: KY498875; tef1: MK639096. udum Fusarium (Berk.) Wollenw., Phytopathology 3: 38. 1913, nom. illegit., Art. 53.1. Basionym: Fusisporium udum Berk., Ann. Mag. Nat. Hist. 6: 438. 1841. (See Fusarium merismoides) Holotypus: ?K(M). Type locality: UK, King's Cliffe. Type substrate: Unidentified tree. Note: Synonyms fide Wollenweber & Reinking (1935). ulmi Fusarium P. Crouan & H. Crouan, Fl. Finistere: 14. 1867. (See Fusarium candidum (Link) Sacc.) Holotypus: ?PC. 170 Type locality: France, Finistere, edge of a stream. Type substrate: Roots of Ulmus sp. Note: Synonym fide Wollenweber & Reinking (1935). ulmicola Fusarium Dearn. & House, Circ. New York Stat. Mus. 24: 60. 1940, nom. inval., Art. 39.1. Authentic material: NYSf3256. Original locality: USA, New York, Albany, Ravena. Original substrate: Dead branches of Ulmus thomasii. Notes: Lacks a Latin diagnosis. Requires further investigation to confirm its taxonomic affiliation. uncinatum Fusarium Wollenw., Ann. Mycol. 15: 54. 1917. (See Fusarium udum) Holotypus: Not located. Type locality: India, Dehli, Pusa. Type substrate: Dried stem of Cajanus indicus. Note: Synonym fide Wollenweber & Reinking (1935) and Gerlach & Nirenberg (1982). uniseptatum Fusarium Höhn., Ann. Mycol. 1: 409. 1903. Synonyms: Cylindrocarpon uniseptatum (Höhn.) Wollenw., Fusaria Autogr. Delin. 2: 646. 1924. Ramularia uniseptata (Höhn.) Wollenw., Fusaria Autogr. Delin. 2: 646. 1924. Holotypus: Not located. Type locality: Austria, Vienna. Type substrate: Rotten Gleditsia triacanthos. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935) and not Ramularia fide Braun (1998). uredinicola Fusarium Jul. Müll., Ber. Deutsch. Bot. Ges. 3: 395. 1885. (See Fusarium avenaceum) Holotypus: Not located. Type locality: Germany. Type substrate: Aecidium of Phragmidium subcorticium (= Phragmidium mucronatum) and Phragmidium rubi (= Phragmidium barclayi). Note: Synonym fide Wollenweber & Reinking (1935). uredinicola Fusarium Pat. & Gaillard, Bull. Soc. Mycol. France 4: 127. 1888, nom. illegit., Art. 53.1. Synonym: Fusarium patouillardii Sacc. (as ‘patouillardi’), Syll. Fung. 10: 729. 1892. Authentic material: Not located. Original locality: Venezuela, Caracas. Original substrate: Parasitic on the bottom of spots of Puccinia pallidissima, between the perithecia of Darluca filum parasitised by the Puccinia sp. Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). uredinicola Fusarium Petch, Ann. Roy. Bot. Gard. (Peradeniya) 6: 256. 1917, nom. illegit., Art. 53.1. Authentic material: PDA 4731. Original locality: Sri Lanka, Hakgala. Original substrate: Parasitic on Uredo microglossa on leaves of Microglossa zeylanica. Notes: Status unclear. A probable synonym of F. solani var. minus (syn. Neocosmospora brevicona) according to Wollenweber & Reinking (1935). uredinophilum Fusarium Speg. (as ‘urediniphilum’), Anales Mus. Nac. Hist. Nat. Buenos Aires 31: 445. 1922. FUSARIUM Holotypus: In LPS (Fungi Parag. pp. 93–94, no. 262). Type locality: Paraguay, near Puerto Sajonia. Type substrate: Parasitic on the acervuli of Uredo cyclotrauma, on leaving leaves of Pithecellobium cauliflorum. Notes: Status unclear. Not treated by any of Wollenweber & Reinking (1935), Booth (1971), or Gerlach & Nirenberg (1982). uredinum Fusarium Ellis & Everh., N. Amer. Fungi, Ser. II, no. 2799. 1890, nom. inval., Art. 38.1(a). Ramularia uredinis (W. Voss) Sacc., Syll. Fung. 4: 199. 1886. Basionym: Cylindrosporium uredinis W. Voss, Verh. Zool.-Bot. Ges. Wien 29: 684. 1879. Synonym: Ramularia nambuana Henn., Hedwigia 43: 146. 1904. Authentic material: NY00928692. Original locality: USA, Wisconsin, Racine. Original substrate: Parasitic on uredinia of Melampsora salicina, on leaf of Salix sp. Notes: Wollenweber & Reinking (1935) considered F. uredinum a synonym of Cladosporium herbarum. It is quite possible that this common saprobic Cladosporium species also occurred on uredinia in N. Am. Fungi 2799, but it can be ruled out that Ellis & Everhard confused this dematiaceous hyphomycete characterised by having long conidiophores with thickened and darkened conidiogeneous loci and large catenate conidia with a colourless Fusarium. Davis (1915) found Ramularia uredinis, a common mucedinacous hyphomycete on Melampsora spp. on Populus and Salix, in material authentic for this name. This is undoubtedly correct. urticearum Fusarium (Corda) Sacc., Syll. Fung. 4: 698. 1886. Basionym: Selenosporium urticearum Corda, Icon. Fung. 2: 7. 1838. (See Fusarium lateritium) Lectotypus (hic designatus, MBT 10000754): Czech Republic, Prague, dead branches of Ficus elastica and Morus nigra, 1838. A.C.J. Corda, in Icon. Fung. 2, Tab. 9, fig. 30. Notes: Synonym fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. ussurianum Fusarium T. Aoki et al., Mycologia 101: 847. 2009. Holotypus: BPI 878845. Ex-type culture: CBS 123752 = NRRL 45681 = TG-2662/0. Type locality: Russia, Ussuriysk, Primorsky krai (Far East territory), agricultural field near the city Ussuriysk. Type substrate: Seed of Avena sativa. Descriptions and illustrations: See Yli-Mattila et al. (2009). Diagnostic DNA barcodes: rpb1: KM361648; rpb2: KM361666; tef1: FJ240301. ustilaginis Fusarium Kellerm. & Swingle, Rep. (Annual) Kansas Agric. Exp. Sta. 2: 285. 1890 [1889]. (See Fusarium avenaceum) Lectotypus (hic designatus, MBT 10000755): USA, Kansas, Manhattan, on Ustilago avenae, on Avena sativa, 1890, W.A. Kellerman & W.T. Swingle, in Rep. (Annual) Kansas Agric. Exp. Sta. 2, pl. IX, figs 1–13. Note: Synonym fide Wollenweber & Reinking (1935). ustilaginis Fusarium Rostr., Bot. Foren. Festskr. 54: 137. 1890, nom. illegit., Art. 53.1. (See Fusarium nivale) Authentic material: C-F-125286. Original locality: Denmark, Jutland, near Viborg. www.studiesinmycology.org REDELIMITED Original substrate: Parasitic on Ustilago grandis on Phragmites communis. Note: Synonym fide Wollenweber & Reinking (1935). vanettenii Fusarium O'Donnell et al., Index Fungorum 440: 5. 2020. Basionym: Fusarium martii var. pisi F.R. Jones, J. Agric. Res. 26: 459. 1923. (See Fusarium pisi) vasinfectum Fusarium G.F. Atk., Bull. Alabama Agric. Exp. Sta. 41: 28. 1892. (See Fusarium oxysporum) Holotypus: ?CUP-A-(0100)#1. Type locality: USA, Alabama, Montgomery, Mathews. Type substrate: Gossypium herbaceum. Note: Synonym fide Wollenweber & Reinking (1935). venenatum Fusarium Nirenberg, Mycopathologia 129: 136. 1995. Misapplied names: Fusarium sambucinum var. coeruleum Wollenw. sensu Booth, The Genus Fusarium: 171–172. 1971. Fusarium sambucinum var. coeruleum Wollenw. sensu Gerlach & Nirenberg, Mitt. Biol. Bundesanst. Land.- Forstw. 209: 213–216. 1982. Holotypus: CBS 458.93 (preserved as metabolically inactive culture). Ex-type culture: BBA 64537 = CBS 458.93 = NRRL 26228. Type locality: Austria. Type substrate: Culm of Triticum aestivum. Descriptions and illustrations: See Nirenberg (1995). Diagnostic DNA barcodes: rpb2: KM232382; tef1: KM231942. venerorum Fusarium Dounin & Goldmacher, Index of the plant diseases in the U.S. 5: 284–298. 1927. (See Fusarium avenaceum) Holotypus: Not located. Type locality: Unknown. Type substrate: Unknown. Note: Synonym fide Wollenweber & Reinking (1935). venezuelense Fusarium O'Donnell et al., Index Fungorum 440: 5. 2020. Neocosmospora robusta Sand.-Den. & Crous, Persoonia 43: 165. 2019, non Fusarium robustum Gerlach 1977. Holotypus: CBS H-24000. Ex-type culture: BBA 65682 = CBS 145473 = NRRL 22395. Type locality: Venezuela. Type substrate: Bark. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW834251; rpb2: EU329507; tef1: AF178341. ventricosum Fusarium Appel & Wollenw., Phytopathology 3: 32. 1913. Rectifusarium ventricosum (Appel & Wollenw.) L. Lombard & Crous, Stud. Mycol. 80: 229. 2015. Synonyms: Fusarium solani var. ventricosum (Appel & Wollenw.) Joffe, Pl. & Soil 38: 440. 1973. Fusarium cuneiforme Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 129. 1915. Hypomyces solani Reinke & Berth., Untersuch. Bot. Lab. Univ. Göttingen 1: 27. 1879. 171 CROUS ET AL. Hyponectria solani (Reinke & Berth.) Petch, J. Bot. 75. 220. 1937. Nectriopsis solani (Reinke & Berth.) C. Booth, Mycol. Pap. 74: 8. 1960. Nectria ventricosa Booth, The Genus Fusarium: 55. 1971. Holotypus: B 70 0021849. Epitypus: CBS H-21947, designated in Lombard et al. (2015). Ex-epitype culture: BBA 62452 = CBS 748.79 = NRRL 20846 = NRRL 22113. Type locality: Germany, Berlin. Type substrate: Tuber of Solanum tuberosum. Descriptions and illustrations: See Wollenweber (1917), Booth (1971) and Lombard et al. (2015). Diagnostic DNA barcodes: rpb1: JX171484; rpb2: JX171597; tef1: KM231924. Notes: Contrary to Wollenweber & Reinking (1935), Booth (1971) considered this species as different from F. argillaceum, which was later confirmed by Lombard et al. (2015). The same authors designated an epitype for this taxon and transferred it to the genus Rectifusarium as R. ventricosum. veratri Fusarium (Allesch.) Höhn., in Kab
at & Bub
ak, Fungi Imperf. Exs. No. 349. 1906. Gloeosporium veratri (Allesch.) Höhn., Mitt. Bot. Inst. Tech. Hochsch. Wien 4: 112. 1927. Basionym: Fusoma veratri Allesch., Ber. Bayer. Bot. Ges. 2: 19. 1892. Synonym: Septogloeum veratri (Allesch.) Wollenw., Fusaria Autogr. Delin. 1: 439. 1916. Holotypus: ?M. Type locality: Germany, Bavaria, Oberammergau. Type substrate: Leaves of Veratrum lobelianum. Notes: This species produces acervuli and 1-septate conidia with truncate basal cells. Therefore, it was transferred to Gloesporium (Helotiales, Dermataceae). verrucosum Fusarium (Pat.) O'Donnell & Geiser, Phytopathology 103: 404. 2013. Albonectria verrucosa (Pat.) Rossman & Samuels, Stud. Mycol. 42: 108. 1999. Basionym: Calonectria verrucosa Pat., Bull. Soc. Mycol. France 11: 228. 1895. Synonym: Nectria astromata Rossman, Mycotaxon 8: 550. 1979, non N. verrucosa (Schwein.) Sacc. Holotypus: In FH fide Rossman et al. (1999). Type locality: Ecuador, San Jorge. Type substrate: Chusquea sp. Descriptions and illustrations: See Rossman (1983) and Rossman et al. (1999). Notes: Although recently recombined in Fusarium (Geiser et al. 2013), the taxonomy of this species is uncertain. With 5–9(–13)septate ascospores, this species cannot be a member of Fusarium s. str., and the identity of the isolates included in recent phylogenetic estimates (CBS 102163, originally identified as F. concolor and NRRL 22566) cannot be confirmed at this stage. versicolor Fusarium Sacc., Syll. Fung. 16: 1099. 1902. (See Fusarium culmorum) Holotypus: In PAD. Type locality: France, C^ote-d’Or. Type substrate: Cortex of Cucurbita sp. Note: Synonym fide Wollenweber & Reinking (1935). versiforme Fusarium Kab
at & Bub
ak, Hedwigia 44: 358. 1905. 172 Holotypus: BPI 453128. Type locality: Czech Republic, Bohemia, Turnov. Type substrate: Living leaves of Hosta sieboldii (syn. Hosta albomarginata). Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). verticillioides Fusarium (Sacc.) Nirenberg, Mitt. Biol. Bundesanst. Land- Forstw. 169: 26. 1976. Basionym: Oospora verticillioides Sacc., Fung. Ital., Fasc. 17–28: pl. 879. 1881. Synonyms: Alysidium verticillioides (Sacc.) Kuntze, Revis. Gen. Pl. 3: 442. 1898. Fusarium moniliforme J. Sheld., Annual Rep. Nebraska Agric. Exp. Sta. 17: 23. 1904. Gibberella moniliformis Wineland, J. Agric. Res. 28: 909. 1924. Lectotypus: Pl. 879 in Saccardo, Fung. Ital. (1881), designated by Yilmaz et al. (2021). Epitypus: CBS 218.76 (preserved as metabolically inactive culture), designated by Yilmaz et al. (2021). Ex-epitype culture: BBA 11782 = CBS 218.76 = DSM 62264 = IMI 202875 = NRRL 13993. Epitype locality: Germany. Epitype substrate: Zea mays. Descriptions and illustrations: See Nirenberg (1976, 1981), Gerlach & Nirenberg (1982) and Leslie & Summerell (2006). Diagnostic DNA barcodes: rpb1: MW402638; rpb2: MW928835; tef1: KF499582. veterinarium Fusarium L. Lombard & Crous, Persoonia 43: 35. 2018 [2019]. Holotypus: CBS H-23623. Ex-type culture: CBS 109898 = NRRL 36153. Type locality: Netherlands. Type substrate: Peritoneum of Selachimorpha (shark). Descriptions and illustrations: See Lombard et al. (2019b). Diagnostic DNA barcodes: rpb2: MH484899; tef1: MH484990. victoriae Fusarium Henn., in herb., fide Wollenweber, Fusaria Autogr. Delin. 1: 66. 1916. Macronectria jungneri (Henn.) C. Salgado & P. Chaverri, Fungal Diversity 80: 448. 2016. Basionym: Nectria jungneri Henn., Bot. Jahrb. Syst. 22: 75. 1895. Synonyms: Nectria eustoma Penz. & Sacc., Malpighia 11: 509. 1898. Nectria leucocoma Starb€ack, Bih. Kongl. Svenska Vetensk.Akad. Handl. 25: 28. 1899. Nectria cinereopapillata Henn. & E. Nyman, Monsunia 1: 161. 1900. Nectria striatospora Zimm., Centralbl. Bakteriol. Abt. 1, 7: 105. 1901. Cylindrocarpon victoriae Wollenw., Z. Parasitenk. (Berlin) 1: 161. 1928. Nectria azureo-ostiolata Yoshim. Doi, Mem. Nat. Sci. Mus. Tokyo 10: 23. 1977. Authentic material: In B fide Wollenweber, Fusaria Autogr. Delin. 1: 66. 1916. Original locality: Cameroon. Original substrate: Trunk of an unknown tree. vinosum Fusarium Massee, Brit. Fung.-Fl. 3: 479. 1893. (See Fusarium flocciferum) Holotypus: ?K(M). Type locality: UK. FUSARIUM REDELIMITED Type substrate: Decaying mast manufactured from Fagus sylvatica. Note: Synonym fide Wollenweber & Reinking (1935). Notes: Synonyms fide Wollenweber & Reinking (1935). No holotype specimen could be located and therefore an illustration is designated as lectotype. vinosum Fusarium Greco, Origine des Tumeurs (Etiologie du Cancer. etc.) et Observations de Mycoses (Blastomycoses. etc.) Argentines (Buenos Aires): 670. 1916, nom. illegit., Art. 53.1. Authentic material: Not located. Original locality: Argentina. Original substrate: Homo sapiens. Note: A late homonym of F. vinosum Massee. vogelii Fusarium Henn., Z. Pflanzenkrankh. 12: 16. 1902. Synonyms: Septosporium curvatum Rabenh. & A. Braun, Krankh. Pfl.: 14. 1854. Septoria curvata (Rabenh. & A. Braun) Sacc., Syll. Fung. 3: 484. 1884. Cercospora curvata (Rabenh. & A. Braun) Wollenw., Fusaria Autogr. Delin. 1: 451. 1916. Holotypus: In B (Kab
at & Bub
ak, Fungi Imp. Exs. 248) fide Hein (1988). Type locality: Poland, Dąbroszyn (former Tamsel). Type substrate: Leaf of Robinia pseudoacacia. Notes: Status unclear. Neither Fusarium fide Wollenweber & Reinking (1935) nor Cercospora fide Chupp (1954). violaceum Fusarium P. Crouan & H. Crouan, Fl. Finistere: 14. 1867, nom. illegit., Art. 53.1. (See Fusarium sambucinum) Authentic material: ?PC. Original locality: France, Brittany, Finistere, marshes. Original substrate: Bark of unknown tree. Notes: An illegitimate homonym of F. violaceum Fuckel (1863). Synonym fide Gams et al. (1997). violaceum Fusarium Fuckel, Fungi Rhen. Exs. No. 209. 1863. (See Fusarium caeruleum) Syntypes: In BPI, F, HAL, MICH, S & WSP (Fuckel, Fungi Rhen. Exs. No. 209). Type locality: Germany, Hessen, Oestrich. Type substrate: Solanum tuberosum. Note: Synonym fide Wollenweber & Reinking (1935) and Booth (1971). violae Fusarium F.A. Wolf, Mycologia 2: 21. 1910. (See Fusarium oxysporum) Holotypus: Not located. Type locality: USA, Nebraska, Lincoln. Type substrate: Stems and roots of Viola tricolor. Note: Synonym fide Wollenweber & Reinking (1935). virguliforme Fusarium O'Donnell & T. Aoki, Mycologia 95: 667. 2003. (See Fusarium azukicola) Holotypus: BPI 841956. Ex-type culture: MAFF 238553 = NRRL 31041 = Shuxian Li # 95. Type locality: USA, Illinois. Type substrate: Glycine max. Descriptions and illustrations: See Aoki et al. (2003). Diagnostic DNA barcodes: rpb1: JX171530; rpb2: JX171643; tef1: AY220193. viride Fusarium (Lechmere) Wollenw., Fusaria Autogr. Delin. 1: 418. 1916. Basionym: Pionnotes viridis Lechmere, Compt. Rend. Hebd. S
eances Acad. Sci. 155: 178. 1912. (See Fusarium solani) Holotypus: Not located. Type locality: Ivory Coast. Type substrate: Undetermined wood. Note: Synonyms fide Wollenweber & Reinking (1935). viticola Fusarium Thüm. (as ‘viticolum’), Pilze Weinst.: 52. 1878. Synonym: Fusarium herbarum var. viticola (Thüm.) Wollenw., Fusaria Autogr. Delin. 3: 898. 1930. (See Fusarium avenaceum) Lectotypus (hic designatus, MBT 10000756): Italy, Liguria, Genoa, Rapallo, dry twigs of Vitis vinifera, Jul. 1876, G. Passerini, in Thümen, Pilze Weinst. 1878: pl. 3, fig. 3. www.studiesinmycology.org volatile Fusarium Al-Hatmi et al., Fungal Syst. Evol. 4: 174. 2019. Holotypus: CBS H-24004. Ex-type culture: CBS 143874. Type locality: French Guiana, Cayenne. Type substrate: Bronchoalveolar lavage effusion from Homo sapiens with lung infection. Descriptions and illustrations: See Al-Hatmi et al. (2019). Diagnostic DNA barcodes: rpb2: LR596006; tef1: LR596007. volutella Fusarium Ellis & Everh., Proc. Acad. Nat. Sci. Philadelphia 43: 93. 1891. (See Fusarium stromaticum) Holotypus: Langlois 1505 in NY fide Index Fungorum. Type locality: USA, Louisiana, Saint Martinsville. Type substrate: Dead twigs of Nekemias arborea (syn. Ampelopsis arborea). Note: Synonym fide Wollenweber & Reinking (1935) and Gr€afenhan et al. (2011). vorosii Fusarium B. T
oth et al., Fungal Genet. Biol. 44: 1202. 2007. Holotypus: BPI 871658. Ex-type culture: NRRL 37605. Type locality: Hungary, Pest, Ipolydam
asd. Type substrate: Spikelet of Triticum aestivum. Descriptions and illustrations: See Starkey et al. (2007). Diagnostic DNA barcodes: rpb1: KM361647; rpb2: KM361665; tef1: DQ459745. waltergamsii Fusarium O'Donnell et al., Index Fungorum 440: 5. 2020. Neocosmospora gamsii Sand.-Den. & Crous, Persoonia 41: 116. 2018. Holotypus: CBS H-23226. Ex-type culture: CBS 143207 = NRRL 32323 = UTHSC 99-250. Type locality: USA, Pennsylvania. Type substrate: Bronchoalveolar lavage fluid from Homo sapiens. Descriptions and illustrations: See Sandoval-Denis & Crous (2018). Diagnostic DNA barcodes: rpb1: MW834223; rpb2: KM361665; tef1: DQ246951. werrikimbe Fusarium J.L. Walsh, L.W. Burgess, E.C.Y. Liew & B.A. Summerell, sp. nov. MycoBank MB 837725. 173 CROUS ET AL. Synonym: Fusarium werrikimbe J.L. Walsh, L.W. Burgess, E.C.Y. Liew & B.A. Summerell, Fungal Diversity 44: 155. 2010, nom. inval., Art. 40.7. Etymology: In reference to Werrikimbe National Park, the geographic origin of the isolates first recognised as belonging to this species. For diagnosis see Walsh et al., Fungal Diversity 44: 155. 2010. Holotypus: CBS 125535 (preserved as metabolically inactive culture). Ex-type culture: CBS 125535 = F19350 = RBG 5332. Type locality: Australia, New South Wales, Werrikimbe National Park. Type substrate: Sorghum leiocladum. Descriptions and illustrations: See Walsh et al. (2010). Diagnostic DNA barcodes: rpb1: MW928821; rpb2: MN534304; tef1: MW928846. Notes: Walsh et al. (2010) did not indicate the holotype for F. werrikimbe, rendering the name invalid (Art. 40.7). Here we validate the name. willkommii Fusarium Lindau, Rabenh. Krypt.-Fl. ed. 2, 1(9): 551. 1910. Replaced synonym: Fusarium candidum Sacc. & D. Sacc., Syll. Fung. 18: 674. 1906, nom. illegit., Art. 53.1, non Fusarium candidum Ehrenb. 1818. Lectotypus (hic designatus, MBT 10000757): Germany, Saxony, Fagus sylvatica, 1866, M. Willkomm, in Die mikroskopischen Feinde des Waldes 1, Tab. VI, figs 11–12. Notes: Lindau's description of F. willkommii was based on Willkomm's (1866: 103) description and illustration under the name Fusidium candidum Link as well as Saccardo's (l.c.) description under Fusarium candidum. Therefore, the illustration by Willkomm (1866) is designated as lectotype.  si
c et al., Antonie van Leeuwitzenhausenense Fusarium Si wenhoek 111: 1795. 2018. (See Fusarium stercicola) Holotypus: CBS H-23351. Ex-type culture: CBS 142480 = DSM 106212. Type locality: Germany, Hessen, Witzenhausen, NeuEichenberg. Type substrate: Branch of Hibiscus sp.  si
c et al. (2018a). Descriptions and illustrations: See Si Diagnostic DNA barcodes: rpb1: MG237865; rpb2: LR583886; tef1: KY556525. wolgense Fusarium Rodigin, Trudy Bashkir. Sel’. Khoz. Inst. 3: 101. 1942. Holotypus: Not located. Type locality: Russia, Volgograd (formerly Stalingrad). Type substrate: Fruit of Citrullus lanatus (syn. Citrullus vulgaris). Notes: Status unclear. Not treated by either of Booth (1971) and Gerlach & Nirenberg (1982). wollenweberi Fusarium Raillo, Fungi of the Genus Fusarium: 189. 1950, nom. illegit., Art. 52.1. (See Fusarium anthophilum) Authentic material: Not located. Original locality: Azerbaijan. Original substrate: Seeds and stems of Gossypium sp. Descriptions and illustrations: See Raillo (1950). Notes: Fusarium wollenweberi was published as a new combination, but no basionym was indicated. As a nomen novum, it can only be based on F. anthophilum, the only cited name, which 174 is a valid name. Therefore, F. wollenweberi would be illegitimate (nom. superfl., Art. 52.1.). Additionally, the condition for the introduction of a new species is also not met as a Latin diagnosis, necessary in 1950, is lacking. xiangyunense Fusarium F. Zhang et al. (as ‘xiangyunensis’), Phytotaxa 450: 278. 2020, nom. inval., Art. 40.8. (See Fusarium stercicola) Authentic material: DLU11-1, School of Agriculture and Biology, Dali University, China. Authentic culture: CGMCC 3.19676. Original locality: China, Yunnan, Xiangyun, Dali, Da-bo-na hotspring. Original substrate: Waterlogged soil. Descriptions and illustrations: See Zhang et al. (2020). Diagnostic DNA barcodes: rpb1: MH999281; tef1: MH992629. Note: Based on phylogenetic and morphological evidence provided by Zhang et al. (2020), this invalid name (Art. 40.8) belongs to the genus Neocosmospora and is a synonym of N. stercicola. xylarioides Fusarium Steyaert, Bull. Soc. Roy. Bot. Belgique 80: 42. 1948. Synonyms: Gibberella xylarioides (Steyaert) R. Heim & Saccas, Rev. Mycol. (Paris) 15 (Suppl. Colon.): 97. 1950. Fusarium oxysporum f. xylarioides (Steyaert) Delassus, Bull. sci. Minist. Colon., Sect. Agric. trop. 5: 347. 1954. Lectotypus (hic designatus, MBT 10000758): Central African Republic, Bangui, trunk of Coffea excelsa, 1939, H. Fr
ed
eric, in Steyaert, Bull. Soc. Roy. Bot. Belgique 80, pl. I, fig. 8. Epitypus (hic designatus, MBT 10001275): Ivory Coast, on trunk of Coffea sp., Feb. 1951, C. & M. Moreau, CBS 258.52 (preserved as metabolically inactive culture). Ex-epitype culture: CBS 258.52 = NRRL 25486. Descriptions and illustrations: See Steyaert (1948), Booth (1971), Gerlach & Nirenberg (1982) and Geiser et al. (2005). Diagnostic DNA barcodes: rpb1: JX171517; rpb2: JX171630; tef1: AY707136. Notes: A lectotype is designated here based on an illustration provided by Steyaert (1948) accompanying the original protologue. All attempts to locate the holotype specimen lodged at the Universit
e de Bangui (BANG), Central African Republic, as indicated by Steyaert (1948), failed. In addition, an epitype (CBS 258.52) is designated here to provide taxonomic stability for this important species. xyrophilum Fusarium I. Laraba et al., Mycologia 112: 45. 2019 [2020]. Holotypus: BPI 910919. Ex-type culture: FRC M-8921 = NRRL 62721. Type locality: Guyana, Cuyuni-Mazaruni, Kamakusa Mountain. Type substrate: Xyris surinamensis. Descriptions and illustrations: See Laraba et al. (2020). Diagnostic DNA barcodes: rpb1: MN193933; rpb2: MN193905; tef1: MN193877. yamamotoi Fusarium O'Donnell et al., Index Fungorum 440: 5. 2020. Replaced synonym: Nectria elegans W. Yamam. & Maeda, Hyogo Univ. Agric. ser. Agric. Biol. 3: 15. 1957, non Fusarium elegans Appel & Wollenw. 1910. Neocosmospora elegans (W. Yamam. & Maeda) Sand.-Den. & Crous, Persoonia 43: 127. 2019. Lectotypus: Figs 1–9, page 16, in Yamamoto et al. (1957), designated in Sandoval-Denis et al. (2019). FUSARIUM Epitypus: CBS H-23980, designated in Sandoval-Denis et al. (2019). Ex-epitype culture: ATCC 42366 = CBS 144396 = MAFF 238541 = NRRL 22277 = SUF XV-1. Type locality: Japan. Type substrate: Twigs and trunks of Zanthoxylum piperitum. Descriptions and illustrations: See Sandoval-Denis et al. (2019). Diagnostic DNA barcodes: rpb1: MW218113; rpb2: FJ240380; tef1: AF178336. yuccae Fusarium Cooke, Grevillea 7: 34. 1878, nom. inval., Art. 36.1(a). (See Fusarium lateritium) Authentic material: BPI 453149. Original locality: USA, South Carolina, Aiken. Original substrate: Yucca aloifolia. Note: Synonym fide Wollenweber & Reinking (1935). zanthoxyli Fusarium X. Zhou et al., Mycologia 108: 675. 2016. Holotypus: HMNWAFU XZ-Fyzs133-20130408 Ex-type culture: CBS 140838 = NRRL 66285. Type locality: China, Shaanxi, Tongchuan, Yaozhou, Sunyuan. Type substrate: Zanthoxylum bungeanum. Descriptions and illustrations: See Zhou et al. (2016). Diagnostic DNA barcodes: rpb1: KM520383; rpb2: KM236763; tef1: KM236703. zavianum Fusarium (Sacc.) Sacc., Syll. Fung. 4: 709. 1886. Basionym: Fusisporium zavianum Sacc., Michelia 1: 83. 1877. (See Fusarium lateritium) Holotypus: In PAD. Type locality: Italy, Vittorio. Type substrate: Vitis vinifera. Note: Synonyms fide Wollenweber & Reinking (1935). zeae Fusarium (Westend.) Sacc., Syll. Fung. 4: 713. 1886. Basionym: Fusisporium zeae Westend., Bull. Acad. Roy. Sci. Belgique, Cl. Sci. 18: 414. 1852. (non Fusisporium zeae Roum., Rev. Mycol. (Toulouse) 6: 163. 1884). (See Fusarium avenaceum) Holotypus: BR5020141668483. Type locality: Belgium, Kortrijk railway station. Type substrate: Rotting stalks of Zea mays. Note: Synonyms fide Wollenweber & Reinking (1935). zealandicum Fusarium Nirenberg & Samuels, Canad. J. Bot. 78: 1483. 2000. Geejayessia zealandica (Cooke) Schroers, Stud. Mycol. 68: 133. 2011. Basionym: Nectria zealandica Cooke, Grevillea 8: 65. 1879. Synonyms: Cucurbitaria zelandica (Cooke) Kuntze, Revis. Gen. Pl. 3: 462. 1898. Cosmospora zealandica (Cooke) Samuels & Nirenberg, Canad. J. Bot. 78: 1483. 2000. Holotypus: BPI 747915. Ex-type culture: BBA 64792 = CBS 111.93. Type locality: New Zealand, Auckland, Waitakere Ranges Regional Park, Cascades Kauri. Type substrate: Bark of Hoheria populnea. Descriptions and illustrations: See Nirenberg & Samuels (2000). Diagnostic DNA barcodes: rpb2: HM626684; tef1: HQ728148. ziziphinum Fusarium Pass., Erb. Critt. Ital. ser. 2 no. 1084. 1881. (See Fusarium lateritium) Syntype: F 982523 ( Erb. Critt. Ital. no. 1048). www.studiesinmycology.org REDELIMITED Type locality: Italy. Type substrate: Twigs of Ziziphus sinensis (syn. Ziziphus jujuba). Note: Synonym fide Wollenweber & Reinking (1935). zonatum Fusarium (Sherb.) Wollenw., Fusaria Autogr. Delin. 1: 392. 1916. Basionym: Fusarium lutulatum var. zonatum Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 214. 1915. (See Fusarium oxysporum) Typus: ?CUP-007453. Type locality: USA, New York, Ithaca. Type substrate: Solanum tuberosum. Notes: Synonym fide Wollenweber & Reinking (1935). Lectotypification pending study of the material lodged in CUP. zygopetali Fusarium Delacr., Bull. Soc. Mycol. France 13: 103. 1897. Holotypus: ?PC. Type locality: France, Paris, Luxembourg gardens. Type substrate: Leaves of Zygopetalum maculatum (syn. Zygopetalum mackayi). Notes: Status unclear. Not Fusarium fide Wollenweber & Reinking (1935). CONCLUSIONS The present study is the first to provide an up-to-date morphological, biochemical, and phylogenetic overview of the 20 fusarioid genera that are presently recognised in Nectriaceae. Morphological species recognition frequently fails to distinguish fusarioid taxa that have been described based on genealogical concordance phylogenetic species recognition (GCPSR sensu Taylor et al. 2000). To address this issue, we have established a new database, Fusarioid-ID, with accurate names for species and genera of fusarioid taxa. Although the phylogenetically most informative genes remain tef1, rpb1 and rpb2, additional markers such as act1, CaM, tub2, ITS and LSU are also incorporated. These genetic fragments can be amplified by PCR and sequenced using the primers indicated in Table 2. In the future, new species and other phylogenetically informative orthologous genes, will be added to resolve isolates at species and genus level. Researchers interested in obtaining reference strains should contact the Westerdijk Fungal Biodiversity Institute (https://wi.knaw.nl/page/Collection), which houses a large collection of phylogenetically diverse fusarioid taxa. As we have shown here, the phylogenetically derived argument that species under the node F1 should be considered members of “Fusarium” is not practical, as this circumscription would lead to a genus without apparent synapomorphies, as lineages outside the genus would also share its characteristics. However, the F3 node (corresponding to Fusarium s. str.) is resolved by all genetic markers so far analysed (e.g., see Geiser et al. 2021) and delineates the morphologically, ecologically, and biochemically well-delineated genus Fusarium. Fusarium s. str. does not have different sexual morphs, other than Gibberella. Fusarioid genera are not only morphologically distinct, but as we have shown in this study, correlate to different monophyletic groups and also differ in their biology and mycotoxin profiles. One of the reasons for the desire to classify any species producing conidia with foot-shaped basal cells into a single genus could be that plant pathologists and clinicians typically 175 CROUS ET AL. isolate conidia or obtain cultures from vegetative mycelium that inhabits their specimens. Also, Wollenweber and his successors may have primarily worked with vegetatively proliferating materials, although it was also Wollenweber (1924, 1926) who produced the first general synopsis of holomorphs in the Hypocreales. However, mainly Joan M. Dingley (1951, 1957), Colin Booth (1959), and especially Gary J. Samuels (Samuels 1976a, b, 1978, 1988, Samuels et al. 1991) significantly changed our points of view by systematically isolating ascospores obtained from ascomata, of which a vast majority were not gathered in agricultural fields but from woody or herbaceous substrata in forests of pantropical, species-rich regions. The result of their taxonomic considerations was an infrageneric subgrouping system in Nectria that was based on sexual and asexual connections. The classification of species according to morphological similarities in sexual morphs allowed understanding patterns of asexual characteristics that are unique for the sexually defined subgroups and eventually correlating sexual groupings with Wollenweber's section system. The diversity of nectria-like species Samuels looked at is huge and was eventually interpreted on the level of families, within which numerous genera were recognised or newly described (Rossman et al. 1999) with infrageneric, informal species groups of Nectria accepted at the genus level (e.g., see Chaverri et al. 2011 and subsequent studies). Applying the generic level to the numerous nectria-like subgroups producing fusarioid conidia is therefore another small but unavoidable step towards a taxonomic system that allows distinguishing natural diversity above the species level based on morphologically and phylogenetically well-defined units. When Colin Booth delivered his Presidential address to the British Mycological Society in 1977, he chose the title “Do you believe in genera?”. He addressed this topic based on his interpretation of Nectriaceae (Booth 1978). Booth subsequently showed that several “groups” of species formed fusarioid asexual morphs, namely Gibberella (now Fusarium s. str.), Haematonectria (now Neocosmospora), Nectria episphaeria (now Cosmosporella and Dialonectria), and Calonectria rigidiuscula (now Albonectria). Booth concluded that the “fusarium morphs” reflected “terms of convenience” rather than genealogical relationships. In moving to the one fungus = one name nomenclature (Hawksworth et al. 2011, Wingfield et al. 2012), Fusarium s. str. was chosen over Gibberella (Gr€afenhan et al. 2011, Schroers et al. 2011, Rossman et al. 2013). As the genus Fusarium was thus clearly well-defined, other Nectriaceae lineages with a fusarium-like morphology were recognised (Gr€afenhan et al. 2011, Schroers et al. 2011, Lombard et al. 2015, Lechat & Fournier 2015). As we have shown here, taxa are constantly being newly collected and added to the phylogeny of Nectriaceae. The only stable option forward is to apply and use the genus name Fusarium (= Gibberella) as more precisely defined based on its own monophyletic node as presented here (F3), supported by morphology, biochemistry, and biology. DISCLAIMER The present paper represents a separate initiative to Geiser et al. (NSF 1655980): A phylogenetic revisionary monograph of the genus Fusarium. 176 ACKNOWLEDGEMENTS The authors are grateful for the open discussions with David Geiser and Kerry O'Donnell who have also shared their datasets for comparison in this study, as well as several authors listed on their recent papers. Uwe Braun is thanked for his contributions in compiling the list of Fusarium names, and checking the names published on numerous old fungarium exsiccatae sheets. APPENDIX A. SUPPLEMENTARY DATA Supplementary data to this article can be found online at https:// doi.org/10.1016/j.simyco.2021.100116. REFERENCES Abbas HK, Mirocha CJ (1988). Isolation and purification of a hemorrhagic factor (wortmannin) from Fusarium oxysporum (N17B). Applied and Environmental Microbiology 54: 1268–1274. Abraham WR, Hanssen HP (1992). Fusoxysporone-a new type of diterpene from Fusarium oxysporum. Tetrahedron 48: 10559–10562. Al-Hatmi AMS, Ahmed SA, van Diepeningen AD, et al. (2018). Fusarium metavorans sp. nov.: The frequent opportunist ‘FSSC6’. Medical Mycology 56: S144–S152. Al-Hatmi AMS, Mirabolfathy M, Hagen F, et al. (2016). DNA barcoding, MALDITOF, and AFLP data support Fusarium ficicrescens as a distinct species within the Fusarium fujikuroi species complex. Fungal Biology 120: 265–278. Al-Hatmi AMS, Normand AC, van Diepeningen AD, et al. (2015). Rapid identification of clinical members of Fusarium fujikuroi complex using MALDITOF MS. Future Microbiology 10: 1939–1952. Al-Hatmi AMS, Sandoval-Denis M, Nabet C, et al. (2019). Fusarium volatile: a new potential pathogen from a human respiratory sample. Fungal Systematics and Evolution 4: 171–181. Aoki T, Kasson MT, Berger MC, et al. (2018). Fusarium oligoseptatum sp. nov., a mycosymbiont of the ambrosia beetle Euwallacea validus in the Eastern U.S. and typification of F. ambrosium. Fungal Systematics and Evolution 1: 23–39. Aoki T, O'Donnell K (1998). Fusarium kyushuense sp. nov. from Japan. Mycoscience 39: 1–6. Aoki T, O'Donnell K (1999). Morphological and molecular characterization of Fusarium pseudograminearum sp. nov., formerly recognized as the Group 1 population of F. graminearum. Mycologia 91: 597–609. Aoki T, O'Donnell K, Ichikawa K (2001). Fusarium fractiflexum sp. nov. and two other species within the Gibberella fujikuroi species complex recently discovered in Japan that form aerial conidia in false heads. Mycoscience 42: 461–478. Aoki T, O'Donnell K, Scandiani MM (2005). Sudden death syndrome of soybean in South America is caused by four species of Fusarium: Fusarium brasiliense sp. nov., F. cuneirostrum sp. nov., F. tucumaniae, and F. virguliforme. Mycoscience 46: 162–183. Aoki T, Scandiani MM, O'Donnell K (2012). Phenotypic, molecular phylogenetic, and pathogenetic characterization of Fusarium crassistipitatum sp. nov., a novel soybean sudden death syndrome pathogen from Argentina and Brazil. Mycoscience 53: 167–186. Aoki T, Smith JA, Kasson MT, et al. (2019). Three novel Ambrosia Fusarium Clade species producing clavate macroconidia known (F. floridanum and F. obliquiseptatum) or predicted (F. tuaranense) to be farmed by Euwallacea spp. (Coleoptera: Scolytinae) on woody hosts. Mycologia 111: 919–935. Aoki T, Smith JA, Mount LL, et al. (2013). Fusarium torreyae sp. nov., a pathogen causing canker disease of Florida torreya (Torreya taxifolia), a critically endangered conifer restricted to northern Florida and southwestern Georgia. Mycologia 105: 312–319. Aoki T, Tanaka F, Suga H, et al. (2012). Fusarium azukicola sp. nov., an exotic azuki bean root-rot pathogen in Hokkaido, Japan. Mycologia 104: 1068–1084. Aoki T, Vaughan MM, McCormick SP, et al. (2015). Fusarium dactylidis sp. nov., a novel nivalenol toxin-producing species sister to F. pseudograminearum isolated from orchard grass (Dactylis glomerata) in Oregon and New Zealand. Mycologia 107: 409–418. FUSARIUM Aoki T, Vaughan MM, McCormick SP, et al. (2015). Fusarium dactylidis sp. nov., a novel nivalenol toxin-producing species sister to F. pseudograminearum isolated from orchard grass (Dactylis glomerata) in Oregon and New Zealand. Mycologia 107: 409–418. Aoki T, Geiser DM, Kasson M, et al. (2020). Nomenclatural novelties. Index Fungorum 440: 1–5. Aoki T, O'Donnell K, Homma Y, et al. (2003). Sudden-death syndrome of soybean is caused by two morphologically and phylogenetically distinct species within the Fusarium solani species complex—F. virguliforme in North America and F. tucumaniae in South America. Mycologia 95: 660–684. Arnstein HRV, Cook AH (1947). Production of antibiotics by fungi. 3. Javanicin – an antibacterial pigment from Fusarium javanicum. Journal of the Chemical Society 1947: 1021–1028. Arya HC, Jain GL (1962). Fusarium wilt of Eucalyptus. Phytopathology 52: 638–642. Bachmann HP, Bobst C, Bütikofer U, et al. (2005). Occurrence and significance of Fusarium domesticum alias Anticollanti on smear-ripened cheeses. LWT Food Science and Technology 38: 399–407. Bamburg JR, Riggs NV, Strong FM (1968). The structures of toxins from two strains of Fusarium tricinctum. Tetrahedron 24: 3329–3336. Benyon FHL, Burgess LW, Sharp PJ (2000). Molecular genetic investigations and reclassification of Fusarium species in sections Fusarium and Roseum. Mycological Research 104: 1164–1174. Berkeley MJ, Broome CE (1876). Notices of British fungi (1501–1630). Annals and Magazine of Natural History 17: 129–145. Bezuidenhout SC, Gelderblom WC, Gorst-Allman CP, et al. (1988). Structure elucidation of the fumonisins, mycotoxins from Fusarium moniliforme. Journal of the Chemical Society, Chemical Communications 11: 743–745. Bilaĭ VI (1955). Fusarii (Biologija i sistematika). Isdatelstvo Akademii Nauk Ukraniskoi SSE, Kiev, Ukraine (in Russian). Bills GF, Gloer JB (2017). Biologically active secondary metabolites from the fungi. In: The Fungal Kingdom (Heitman J, Howlett BJ, Crous PW, et al., eds). ASM Press, Washington D.C.: 1087–1119. Booth C (1959). Studies of Pyrenomycetes: IV. Nectria (part 1). Mycological papers 73: 1–115. Booth C (1964). Studies on Pyrenomycetes. VII. Mycological Papers 94: 1–16. Booth C (1971). The genus Fusarium. Commonwealth Mycological Institute, Kew, Surrey, England. Booth C (1978). Presidential address: Do you believe in genera? Transactions of the British Mycological Society 71: 1–9. Braun U (1998). A monograph of Cercosporella, Ramularia and allied genera (phytopathogenic Hyphomycetes): Vol. 2. IHW-Verlag, Munich, Germany. Brayford D (1987). Fusarium bugnicourtii sp. nov., and its relationship to F. tumidum and F. tumidum var. coeruleum. Transactions of the British Mycological Society 89: 347–351. Britz H, Steenkamp ET, Coutinho TA, et al. (2002). Two new species of Fusarium section Liseola associated with mango malformation. Mycologia 94: 722–730. Brown W (1928). Studies in the genus Fusarium. VI. General description of strains, together with a discussion of the principles at present adopted in the classification of Fusarium. Annals of Botany 42: 285–304. Bugnicourt F (1952). Une espece fusarienne nouvelle, parasite du riz. Revue G
enerale de Botanique 59: 13–18. Burgess LW, Forbes GA, Windels C, et al. (1993). Characterization and distribution of Fusarium acuminatum subsp. armeniacum subsp. nov. Mycologia 85: 119–124. Burgess LW, Nelson PE, Toussoun TA (1982). Characterization, geographic distribution and ecology of Fusarium crookwellense sp. nov. Transactions of the British Mycological Society 79: 497–505. Burgess LW, Nelson PE, Toussoun TA, et al. (1985). Fusarium scirpi: emended description and notes on geographic distribution. Mycologia 77: 212–218. Burgess LW, Summerell BA (2000). Taxonomy of Fusarium: Fusarium armeniacum stat. & comb. nov. Mycotaxon 75: 347–348. Burgess LW, Trimboli D (1986). Characterization and distribution of Fusarium nygamai, sp. nov. Mycologia 78: 223–229. Burkholder WH (1919). The dry root rot of bean. Memoirs of the Cornell University Agricultural Experimental Station 26: 1003–1033. Butler EJ, Khan AH (1913). Some new sugarcane diseases. Memoirs of the Department of Agriculture in India. Botanical Series 6: 181–208. Butler EJ (1910). The wilt disease of pigeon pea and the parasitism of Neocosmospora vasinfecta Smith. Memoirs of the Department of Agriculture in India 9: 1–64. Carbone I, Kohn LM (1999). A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91: 553–556. www.studiesinmycology.org REDELIMITED Cardoso AMS (2015). Caracterizaç~ao filogen
etica, biol
ogica e patog^enica de esp
ecies do complexo Fusarium solani associadas a podrid~ao do colo do maracujazeiro. MSc. dissertation. Departamento de Fitopatologia, Universidade Federal de Lavras, Brazil. Carlucci A, Raimondo ML, Santos J, et al. (2012). Plectosphaerella species associated with root and collar rots of horticultural crops in Southern Italy. Persoonia 28: 34–48. Castell
a G, Bragulat MR, Rubiales MV, et al. (1997). Malachite green agar, a new selective medium for Fusarium. Mycopathologia 137: 173–178. Cavalcanti AD, da Silva Santos AC, de Oliveira Ferro L, et al. (2020). Fusarium massalimae sp. nov. (F. lateritium species complex) occurs endophytically in leaves of Handroanthus chrysotrichus. Mycological Progress 19: 1133–1142. Chaverri P, Salgado C, Hirooka Y, et al. (2011). Delimitation of Neonectria and Cylindrocarpon (Nectriaceae, Hypocreales, Ascomycota) and related genera with cylindrocarpon-like anamorphs. Studies in Mycology 68: 57–78. Chen FJ (2000). Fusarium catenulatum sp. nov. from China. Mycosystema 19: 459–462. Chen QT, Fu XH, Chen YD (1987). Two petroliphilous taxa of Fusarium. Acta Mycologica Sinica Supplement 1: 328–333. Chupp C (1954). A monograph of the fungus genus Cercospora. Published by the author, Ithaca, New York. Ciferri R (1955). Observations on meliolicolous Hyphales from Santo Domingo. Sydowia 9: 296–335. Costa MM, Melo MP, Carmo FS, et al. (2021). Fusarium species from tropical grasses in Brazil and description of two new taxa. Mycological Progress 20: 61–72. Costa SS, Matos KS, Tessmann DJ, et al. (2016). Fusarium paranaense sp. nov., a member of the Fusarium solani species complex causes root rot on soybean in Brazil. Fungal Biology 120: 51–60. Crous PW, Braun U (2003). Mycosphaerella and its anamorphs: 1. Names published in Cercospora and Passalora. CBS Biodiversity Series 1: 1–571. Crous PW, Luangsa-ard JJ, Wingfield MJ, et al. (2018). Fungal Planet description sheets: 785–867. Persoonia 41: 238–417. Crous PW, Wingfield MJ, Burgess TI, et al. (2016). Fungal Planet description sheets: 469–557. Persoonia 37: 218–403. Crous PW, Shivas RG, Quaedvlieg W, et al. (2014). Fungal Planet description sheets: 214–280. Persoonia 32: 184–306. Crous PW, Summerell BA, Carnegie AJ, et al. (2009). Unravelling Mycosphaerella: do you believe in genera? Persoonia 23: 99–118. Crous PW, Verkley GJM, Groenewald JZ, et al. (2019). Fungal Biodiversity. In: Westerdijk Laboratory Manual Series 1. Westerdijk Fungal Biodiversity Institute, Utrecht, The Netherlands. Crous PW, Wingfield MJ, Burgess TI, et al. (2017). Fungal Planet description sheets: 625–715. Persoonia 39: 270–467. Crous PW, Wingfield MJ, Lombard L, et al. (2019). Fungal Planet description sheets: 951–1041. Persoonia 43: 223–425. Cummings MP, Meyer A (2005). Magic bullets and golden rules: Data sampling in molecular phylogenetics. Zoology 108: 329–336. Cutler HG, Arrendale RF, Springer JP, et al. (1987). Monorden from a novel source, Neocosmospora tenuicristata: Stereochemistry and plant growth regulatory properties. Agricultural and Biological Chemistry 51: 3331–3338. Dall
e Rosa P, Ramirez-Castrillon M, Valente P, et al. (2018). Fusarium riograndense sp. nov., a new species in the Fusarium solani species complex causing fungal rhinosinusitis. Journal de Mycologie M
edicale 28: 29–35. Damm U, Cannon PF, Woudenberg JHC, et al. (2012). The Colletotrichum acutatum species complex. Studies in Mycology 73: 37–113. Damm U, Cannon PF, Liu F, et al. (2013). The Colletotrichum orbiculare species complex: important plant pathogens and mycoherbicides. Fungal Diversity 61: 29–59. Damm U, Woudenberg JHC, Cannon PF, et al. (2009). Colletotrichum species with curved conidia from herbaceous hosts. Fungal Diversity 39: 45–87. Davis JJ (1915). Notes on parasitic fungi in Wisconsin – I. Transactions of the Wisconsin Academy of Sciences, Arts and Letters 18: 78–92. Dayarathne MC, Jones EBG, Maharachchikumbura SSN, et al. (2020). Morphomolecular characterization of microfungi associated with marine based habitats. Mycosphere 11: 1–188. de Hoog GS, Gerrits van den Ende AHG (1998). Molecular diagnostics of clinical strains of filamentous Basidiomycetes. Mycoses 41: 183–189. Diekmann H (1970). Metabolic products of microorganisms. 81. Occurrence and structures of coprogen B and dimerum acid. Archiv für Mikrobiologie 73: 65–76. 177 CROUS ET AL. de Vries GA, de Hoog GS, de Bruyn HP (1984). Phialophora cyanescens sp. nov. with Phaeosclera-like synanamorph, causing white-grain mycetoma in man. Antonie van Leeuwenhoek 50: 149–153. Dickinson CH (1968). Gliomastix Gu
eguen. Mycological Papers 115: 1–24. Diederich P (1990). New or interesting lichenicolous fungi 1. Species from Luxembourg. Mycotaxon 37: 297–330. Dingley JM (1951). The Hypocreales of New Zealand II. The genus Nectria. Transactions of the Royal Society of New Zealand 79: 177–202. Dingley JM (1957). Life-history studies of New Zealand species of Nectria Fr. Transactions of the Royal Society of New Zealand 83: 643–662. Doidge EM (1938). Some South African fusaria. Bothalia 3: 331–483. Domsch KH, Gams W, Anderson T-H (2007). Compendium of soil fungi. IHWVerlag, Eching, Germany. Edwards J, Auer D, de Alwis S-K, et al. (2016). Fusarium agapanthi sp. nov., a novel bikaverin and fusarubin-producing leaf and stem spot pathogen of Agapanthus praecox (African lily) from Australia and Italy. Mycologia 108: 981–992. Elmer WH, Marra RE (2011). New species of Fusarium associated with dieback of Spartina alterniflora in Atlantic salt marshes. Mycologia 103: 806–819. Evidente A, Conti L, Altomare C, et al. (1994). Fusapyrone and deoxyfusapyrone, two antifungal α-pyrones from Fusarium semitectum. Natural Toxins 2: 4–13. Ezekiel CN, Kraak B, Sandoval-Denis M, et al. (2020). Diversity and toxigenicity of fungi and description of Fusarium madaense sp. nov. from cereals, legumes and soils in north-central Nigeria. MycoKeys 67: 95–124. Farr ML (1973). An annotated list of Spegazzini's fungus taxa. Bibliotheca Mycologica 35: 503–507. Fawcett HS (1908). Fungi parastic upon Aleyrodes citri. Master of Science thesis. The University of the State of Florida, USA. Felsenstein J (1985). Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39: 783–791. Fisher NL, Burgess LW, Toussoun TA, et al. (1982). Carnation leaves as a substrate and for preserving cultures of Fusarium species. Phytopathology 72: 151–153. Forin N, Vizzini A, Nigris S, et al. (2020). Illuminating type collections of the “nectriaceous” fungi in Saccardo's fungarium. Persoonia 45: 221–249. Freeman S, Sharon M, Maymon M, et al. (2013). Fusarium euwallaceae sp. nov. – a symbiotic fungus of Euwallacea sp., an invasive ambrosia beetle in Israel and California. Mycologia 105: 1595–1606. Fuckel KWGL (1863). Fungi Rhenanae Exsiccatae, Fasc. I–VIII. Furumoto T, Fukuyama K, Hamasaki T, et al. (1995). Neovasipyrones and neovasifuranones: Four new metabolites related to neovasinin, a phytotoxin of the fungus, Neocosmospora vasinfecta. Phytochemistry 40: 745–751. Furumoto T, Hamasaki T, Nakajima H (1997). Vasinfectins A and B: new phytotoxins from Neocosmospora vasinfecta. Tetrahedron Letters 38: 5523–5524. Gargouri S, Balmas V, Burgess L, et al. (2020). An endophyte of Macrochloa tenacissima (esparto or needle grass) from Tunisia is a novel species in the Fusarium redolens species complex. Mycologia 112: 792–807. Gams W (1971). Cephalosporium-artige Schimmelpilze. Fischer, Stuttgart, Germany. Gams W (1999). Report of the Committee for Fungi: 8. Taxon 48: 807–810. Gams W, Gerlach M (1968). Beitr€age zur Systematic und Biologie von Plectosphaerella cucumeris und der zugehörigen Konidienform. Persoonia 5: 177–188. Gams W, Klamer M, O'Donnell K (1999). Fusarium miscanthi sp. nov. from Miscanthus litter. Mycologia 91: 263–268. Gams W, Nirenberg HI, Seifert KA, et al. (1997). (1275) Proposal to conserve the name Fusarium sambucinum (Hyphomycetes). Taxon 46: 111–113. Gao J, Radwan MM, Le
on F, et al. (2013). Neocosmospora sp.-derived resorcylic acid lactones with in vitro binding affinity for human opioid and cannabinoid receptors. Journal of Natural Products 76: 824–828. Geiser DM, Al-Hatmi AMS, Aoki T, et al. (2021). Phylogenomic analysis of a 55.1 kb 19-gene dataset resolves a monophyletic Fusarium that includes the Fusarium solani species complex. Phytopathology. https://doi.org/10.1094/ PHYTO-08-20-0330-LE. Geiser DM, Aoki T, Bacon CW, et al. (2013). One fungus, one name: Defining the genus Fusarium in a scientifically robust way that preserves longstanding use. Phytopathology 103: 400–408. Geiser DM, Juba JH, Wang B, et al. (2001). Fusarium hostae sp. nov., a relative of F. redolens with a Gibberella teleomorph. Mycologia 93: 670–678. Geiser DM, Lewis Ivey ML, Hakiza G, et al. (2005). Gibberella xylarioides (anamorph: Fusarium xylarioides), a causative agent of coffee wilt disease in Africa, is a previously unrecognized member of the G. fujikuroi species complex. Mycologia 97: 191–201. 178 Gerlach W (1977). Drei neue Variet€aten von Fusarium merismoides, F. larvarum und F. chlamydosporum. Phytopathologische Zeitschrift 90: 31–42. Gerlach W (1977). Fusarium lunulosporum spec. nov. von Grapefruit aus Südafrika, ein Fruchtf€auleerreger. Phytopathologische Zeitschrift 88: 280–284. Gerlach W (1977). Fusarium robustum spec. nov., der Erreger einer Stammf€aule an Araucaria angustifolia (Bertol.) O. Kuntze in Argentinien? Phytopathologische Zeitschrift 88: 29–37. Gerlach W, Nirenberg H (1982). The genus Fusarium – a pictorial atlas. Mitteilungen aus der Biologischen Bundesanstalt für Land- und Forstwirtschaft Berlin-Dahlem 209: 1–406. Gerlach W, Pag H (1961). Fusarium redolens Wr., seine phytopathologische Bedeutung und eine an Dianthus-Arten gef€aßparasit€are Form (F. redolens Wr. f. dianthi Gerlach). Phytopathologische Zeitschrift 42: 349–361. German-Fattal M (2001). Fusafungine, an antimicrobial with anti-inflammatory properties in respiratory tract infections. Clinical Drug Investigation 21: 653–670. Giraldo A, Crous PW (2019). Inside Plectosphaerellaceae. Studies in Mycology 92: 227–286. Gonz
alez CD, Chaverri P (2017). Corinectria, a new genus to accommodate Neonectria fuckeliana and C. constricta sp. nov. from Pinus radiata in Chile. Mycological Progress 16: 1015–1027. Gordon WL (1952). The occurrence of Fusarium species in Canada. II. Prevalence and taxonomy of Fusarium species in cereal seeds. Canadian Journal of Botany 30: 209–251. Gordon WL (1959). The occurrence of Fusarium species in Canada. VI. Taxonomy and geographic distribution of Fusarium species in plants, insects, and fungi. Canadian Journal of Botany 37: 257–290. Gr€afenhan T, Johnston PR, Vaughan MM, et al. (2016). Fusarium praegraminearum sp. nov., a novel nivalenol mycotoxin-producing pathogen from New Zealand can induce head blight on wheat. Mycologia 108: 1229–1239. Gr€afenhan T, Schroers H-J, Nirenberg HI, et al. (2011). An overview of the taxonomy, phylogeny, and typification of nectriaceous fungi in Cosmospora, Acremonium, Fusarium, Stilbella and Volutella. Studies in Mycology 68: 79–113. Grove JF, Pople M (1979). Metabolic products of Fusarium larvarum Fuckel. The fusarentins and the absolute configuration of monocerin. Journal of the Chemical Society, Perkin Transactions 1 1979: 2048–2051. Guarnaccia V, Sandoval-Denis M, Aiello D, et al. (2018). Neocosmospora perseae sp. nov., causing trunk cankers on avocado in Italy. Fungal Systematics and Evolution 1: 131–140. Guarnaccia V, Van Niekerk J, Crous PW, et al. (2021). Neocosmospora spp. associated with dry root rot of citrus in South Africa. Phytopathologia Mediterranea 60: 81–102. Guo Y, Zhang D, Tang W (2018). Fusarium graminearum double (triple) mutants generation using sexual crosses. Bio- 101: e2961. Guu J-R, Ju Y-M, Hsieh H-J (2007). Nectriaceous fungi collected from forests in Taiwan. Botanical Studies 48: 187–203. Hall TA (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. Hawksworth DL (1979). The lichenicolous Hyphomycetes. Bulletin of the British Museum (Natural History), Botany 6: 183–300. Hawksworth DL, Crous PW, Redhead SA, et al. (2011). The Amsterdam Declaration on Fungal Nomenclature. IMA Fungus 2: 105–112. Heath TA, Hedtke SM, Hillis DM (2008). Taxon sampling and the accuracy of phylogenetic analyses. Journal of Systematics and Evolution 46: 239–257. Hein B (1988). Liste der Arten und infraspecifischen Taxa von P. Hennings mit Angabe der Typen in den Herbarien des Botanischen Museums BerlinDahlem und des Instituts für Allgemeine Botanik in Hamburg. Englera 10: 1–374. Henderson J, Dobson V (1994). Eastern & Central Arrernte to English dictionary. IAD Press, Alice Springs, Australia. Herron DA, Wingfield MJ, Wingfield BD, et al. (2015). Novel taxa in the Fusarium fujikuroi species complex from Pinus spp. Studies in Mycology 80: 131–150. Hirooka Y, Rossman AY, Samuels GJ, et al. (2012). A monograph of Allantonectria, Nectria, and Pleonectria (Nectriaceae, Hypocreales, Ascomycota) and their pycnidial, sporodochial, and synnematous anamorphs. Studies in Mycology 71: 1–210. Hoang DT, Chernomor O, von Haeseler A, et al. (2018). UFBoot2: improving the ultrafast bootstrap approximation. Molecular Biology and Evolution 35: 518–522. FUSARIUM Holubov
a-Jechov
a V, Gams W, Nirenberg HI (1994). Revisiones Generum Obscurorum Hyphomycetum: a revision of the Selenosporium species described by A.C.J. Corda. Sydowia 46: 247–256. Hosoya T, Tubaki K (2004). Fusarium matuoi sp. nov. and its teleomorph Cosmospora matuoi sp. nov. Mycoscience 45: 261–270. Hu J, Chen C, Peever T, et al. (2012). Genomic characterization of the conditionally dispensable chromosome in Alternaria arborescens provides evidence for horizontal gene transfer. BMC Genomics 13: 171. Huang SK, Jeewon R, Hyde KD, et al. (2018). Novel taxa within Nectriaceae: Cosmosporella gen. nov. and Aquanectria sp. nov. from freshwater habitats in China. Cryptogamie, Mycologie 39: 169–192. Jacobs A, van Wyk PS, Marasas WFO, et al. (2010). Fusarium ananatum sp. nov. in the Gibberella fujikuroi species complex from pineapples with fruit rot in South Africa. Fungal Biology 114: 515–527. Jacobs-Venter A, Laraba I, Geiser D, et al. (2018). Molecular systematics of two sister clades, the Fusarium concolor and F. babinda species complexes, and the discovery of a novel microcycle macroconidium-producing species from South Africa. Mycologia 110: 1189–1204. Jamalainen EA (1943). Über die fusarien Finnlands II. Valtion Maatalouskoetoiminnan Julkaisuja 123: 1–24. Jang JH, Asami Y, Jang JP, et al. (2011). Fusarisetin A, an acinar morphogenesis inhibitor from a soil fungus, Fusarium sp. FN080326. Journal of the American Chemical Society 133: 6865–6867. Jiang Z, Barret MO, Boyd KG, et al. (2002). JM47, a cyclic tetrapeptide HC-toxin analogue from a marine Fusarium species. Phytochemistry 60: 33–38. Jim
enez M, Huerta T, Mateo R (1997). Mycotoxin production by Fusarium species isolated from bananas. Applied and Environmental Microbiology 63: 364–369. Joffe AZ (1974). A modern system of Fusarium taxonomy. Mycopathologia et Mycologia Applicata 53: 201–228. Jones EBG, Devadatha B, Abdel-Wahab MA, et al. (2020). Phylogeny of new marine Dothideomycetes and Sordariomycetes from mangroves and deepsea sediments. Botanica Marina 63: 155–181. Kalyaanamoorthy S, Minh BQ, Wong TKF, et al. (2017). ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587–589. Katoh K, Rozewicki J, Yamada KD (2019). MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics 20: 1160–1166. Kearse M, Moir R, Wilson A, et al. (2012). Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647–1649. Ker
enyi Z, Moretti A, Waalwijk C, et al. (2004). Mating type sequences in asexually reproducing Fusarium species. Applied and Environmental Microbiology 70: 4419–4423. Ker
enyi Z, Zeller KA, Hornok L, et al. (1999). Standardization of mating type terminology in the Gibberella fujikuroi species complex. Applied and Environmental Microbiology 65: 4071–4076. Kim W, Cavinder B, Proctor RH, et al. (2019). Comparative genomics and transcriptomics during sexual development gives insight into the life history of the cosmopolitan fungus Fusarium neocosmosporiellum. Frontiers in Microbiology 10: 1247. Kimura Y, Hamasaki T, Nakajima H (1981). Isolation, identification and biological activities of 8-O-methyl-javanicin produced by Fusarium solani. Agricultural and Biological Chemistry 45: 2653–2654. Kirk PM, Stalpers JA, Braun U, et al. (2013). A without-prejudice list of generic names of fungi for protection under the International Code of Nomenclature for algae, fungi, and plants. IMA Fungus 4: 381–443. Klittich C, Leslie JF (1988). Nitrate reduction mutants of Fusarium moniliforme. Genetics 118: 417–423. Klittich CJR, Leslie JF, Nelson PE, et al. (1997). Fusarium thapsinum (Gibberella thapsina): a new species in section Liseola from sorghum. Mycologia 89: 643–652. Komada H (1975). Development of a selective medium for quantitative isolation of Fusarium oxysporum from natural soil. Review of Plant Protection Research 8: 114–124. Kulkarni GB, Sajjan S, Koregrudar JB (2011). Pathogenicity of indole-acetic acid producing fungus Fusarium delphinoides strain GPK towards chick pea and pigeon pea. European Journal of Plant Pathology 131: 355–369. Kulkarni GB, Sanjeevkumar C, Kirankumar B, et al. (2013). Indole-3-acetic acid biosynthesis in Fusarium delphinoides strain GBK, a causal agent of wilt in chick pea. Applied Biochemistry and Biotechnology 169: 1292–1305. www.studiesinmycology.org REDELIMITED Kurobane I, Vining LC, Mcinnes AG, et al. (1980). Metabolites of Fusarium solani related to dihydrofusarubin. Journal of Antibiotics 33: 1376–1379. Kurtzman CP, Robnett CJ (1997). Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the largesubunit (26S) ribosomal DNA gene. Journal of Clinical Microbiology 35: 1216–1223. Kyekyeku JO, Kusari S, Adosraku RK, et al. (2017). Antibacterial secondary metabolites from an endophytic fungus. Fusarium solani JK10. Fitoterapia 119: 108–114. Laraba I, Keddad A, Boureghda H, et al. (2017). Fusarium algeriense, sp. nov., a novel toxigenic crown rot pathogen of durum wheat from Algeria is nested in the Fusarium burgessii species complex. Mycologia 109: 935–950. Laraba I, Kim HS, Proctor RH, et al. (2020). Fusarium xyrophilum, sp. nov., a member of the Fusarium fujikuroi species complex recovered from pseudoflowers on yellow-eyed grass (Xyris spp.) from Guyana. Mycologia 112: 39–51. Laurence MH, Summerell BA, Burgess LW, et al. (2011). Fusarium burgessii sp. nov. representing a novel lineage in the genus Fusarium. Fungal Diversity 49: 101–112. Laurence MH, Walsh JL, Shuttleworth LA, et al. (2016). Six novel species of Fusarium from natural ecosystems in Australia. Fungal Diversity 77: 349–366. Lechat C, Fournier J (2015). Varicosporella, a new aquatic genus in the Nectriaceae from France. Ascomycete.org 7: 1–8. Lechat C, Fournier J, Nord
en B (2015). Stylonectria norvegica (Nectriaceae), a new species from Norway. Ascomycete.org 7: 220–224. Lee HS, Lee C (2012). Structural analysis of a new cytotoxic demethylated analogue of neo-n-methylsansalvamide with a different peptide sequence produced by Fusarium solani isolated from potato. Journal of Agricultural and Food Chemistry 60: 4342–4347. Leslie JF, Summerell BA (2006). The Fusarium laboratory manual. Blackwell Publishing Professional, USA. Leslie JF, Summerell BA, Bullock S, et al. (2005). Description of Gibberella sacchari and neotypification of its anamorph Fusarium sacchari. Mycologia 97: 718–724. Lima CS, Pfenning LH, Costa SS, et al. (2012). Fusarium tupiense sp. nov., a member of the Gibberella fujikuroi complex that causes mango malformation in Brazil. Mycologia 104: 1408–1419. Lindegg G (1935). Cancro picciolare dell’acanto “Acanthus mollis” L. Rivista di Patologia Vegetale 25: 229–235. Link HF (1809). Observationes in ordines plantarum naturales. Dissertatio I Magazin der Gesellschaft Naturforschenden Freunde Berlin 3: 3–42. Liu D, Li XM, Li CS, et al. (2013). Sesterterpenes and 2H-pyran-2-ones (= α-pyrones) from the mangrove-derived endophytic fungus Fusarium proliferatum MA-84. Helvetica Chimica Acta 96: 437–444. Liu Q, Li JQ, Wingfield MJ, et al. (2020). Reconsideration of species boundaries and proposed DNA barcodes for Calonectria. Studies in Mycology 97: 100106. Liu YJ, Whelen S, Hall BD (1999). Phylogenetic relationships among ascomycetes: evidence from an RNA polymerase II subunit. Molecular Biology and Evolution 16: 1799–1808. Lombard L, Houbraken J, Decock C, et al. (2016). Generic hyper-diversity in Stachybotriaceae. Persoonia 36: 156–246. Lombard L, Sandoval-Denis M, Lamprecht SC, et al. (2019). Epitypification of Fusarium oxysporum – clearing the taxonomic chaos. Persoonia 43: 1–47. Lombard L, van der Merwe NA, Groenewald JZ, et al. (2014). Lineages in Nectriaceae: re-evaluating the generic status of Ilyonectria and allied genera. Phytopathologia Mediterranea 53: 515–532. Lombard L, van der Merwe NA, Groenewald JZ, et al. (2015). Generic concepts in Nectriaceae. Studies in Mycology 80: 189–245. Lombard L, van Doorn R, Crous PW (2019). Neotypification of Fusarium chlamydosporum – a reappraisal of a clinically important species complex. Fungal Systematics and Evolution 4: 183–200. Luo J, Zhuang WY (2008). Two new species of Cosmospora (Nectriaceae, Hypocreales) from China. Fungal Diversity 31: 83–93. Lynn KMT, Wingfield MJ, Duran A, et al. (2020). Euwallacea perbrevis (Coleoptera: Curculionidae: Scolytinae), a confirmed pest on Acacia crassicarpa in Riau, Indonesia, and a new fungal symbiont; Fusarium rekanum sp. nov. Antonie van Leeuwenhoek 113: 803–823. Madelin MF (1966). Trichothecium acridiorum (Trabut) comb. nov. on red locusts. Transactions of the British Mycological Society 49: 275–288. 179 CROUS ET AL. Marasas WFO, Nelson PE, Toussoun TA (1985). Fusarium dlaminii, a new species from Southern Africa. Mycologia 77: 971–975. Marasas WFO, Nelson PE, Toussoun TA, et al. (1986). Fusarium polyphialidicum, a new species from South Africa. Mycologia 78: 678–682. Marasas WFO, Rabie CJ, Lübben A, et al. (1987). Fusarium napiforme, a new species from millet and sorghum in Southern Africa. Mycologia 79: 910–914. Marasas WFO, Rheeder JP, Lamprecht SC, et al. (2001). Fusarium andiyazi sp. nov., a new species from sorghum. Mycologia 93: 1203–1210. Marasas WFO, Rheeder JP, Logrieco A, et al. (1998). Fusarium nelsonii and F. musarum: two new species in section Arthrosporiella related to F. camptoceras. Mycologia 90: 505–513. Marcano V, Benitez P, Palacios-Prü E (2001). Ecophysiological responses of a new Fusarium grown in non-aromatic hydrocarbon media  ƞ-C12. Revista de Ecología Latinoamericana 8: 1–19. Marinach-Patrice C, Lethuillier A, Marly A, et al. (2009). Use of mass spectrometry to identify clinical Fusarium isolates. Clinical Microbiology and Infection 15: 634–642. Maryani N, Lombard L, Poerba YS, et al. (2019). Phylogeny and genetic diversity of the banana Fusarium wilt pathogen Fusarium oxysporum f. sp. cubense in the Indonesian centre of origin. Studies in Mycology 92: 155–194. Maryani N, Sandoval-Denis M, Lombard L, et al. (2019). New endemic Fusarium species hitch-hiking with pathogenic Fusarium strains causing Panama disease in small-holder banana plots in Indonesia. Persoonia 43: 48–69. Matsushima T (1971). Microfungi of the Solomon Islands and Papua-New Guinea. Published by the author, Kobe, Japan. Matuo T, Kobayashi T (1960). A new Fusarium, the conidial stage of Hypocrea splendens Phil. et Plowr. Transactions of the Mycological Society of Japan 2(4): 13–15. McAlpine D (1904). Two new fungi parasitic on scale insects. Journal of the Department of Agriculture of Victoria 2: 646–648. Minh BQ, Nguyen MAT, von Haeseler A (2013). Ultrafast approximation for phylogenetic bootstrap. Molecular Biology and Evolution 30: 1188–1195. Minh Q, Hahn MW, Lanfear R (2020). New methods to calculate concordance factors for phylogenomic datasets. Molecular Biology and Evolution 37: 2727–2733. Minh Q, Schmidt HA, Chernomor O, et al. (2020). IQ-TREE2: new models and efficient methods for phylogenetic inference in the genomic era. Molecular Biology and Evolution 37: 1530–1534. Moussa TAA, Al-Zharani HS, Kadasa NMS, et al. (2017). Two new species of the Fusarium fujikuroi species complex isolated from the natural environment. Antonie van Leeuwenhoek 110: 819–832. Munkvold GP (2017). Fusarium species and their associated mycotoxins. In: Mycotoxigenic fungi: methods and protocols (Moretti A, Susca A, eds), Methods in Molecular Biology, 1542. Springer, Amsterdam: 51–106. Na F, Carrillo JD, Mayorquin JS, et al. (2018). Two novel fungal symbionts Fusarium kuroshium sp. nov. and Graphium kuroshium sp. nov. of Kuroshio shot hole borer (Euwallaceae sp. nr. fornicatus) cause fusarium dieback on woody host species in California. Plant Disease 102: 1154–1164. Nakajima H, Hamasaki T, Tanaka K, et al. (1989). Production of cyclosporin by fungi belonging to the genus Neocosmospora. Agricultural and Biological Chemistry 53: 2291–2292. Nakajima H, Shimomura K, Furumoto T, et al. (1995). Neovasipyridones A, B and C: Metabolites related to neovasinin, a phytotoxin of the fungus, Neocosmospora vasinfecta. Phytochemistry 40: 1643–1647. Nalim FA, Samuels GJ, Wijesundera RL, et al. (2011). New species from the Fusarium solani species complex derived from perithecia and soil in the OldWorld tropics. Mycologia 103: 1302–1330. Nash S, Snyder WC (1962). Quantitative estimations by plate counts of propagules of the bean root rot Fusarium in field soils. Phytopathology 52: 567–572. Nelson PE, Dignani MC, Anaissie EJ (1994). Taxonomy, biology, and clinical aspects of Fusarium species. Clinical Microbiology Reviews 7: 479–504. Nelson PE, Toussoun TA, Burgess LW (1987). Characterization of Fusarium beomiforme sp. nov. Mycologia 79: 884–889. Nelson PE, Toussoun TA, Marasas WFO (1983). Fusarium species: An illustrated manual for identification. Pennsylvania State University Press, USA. Nelson PE, Toussoun TA, Marasas WFO (1995). Neotypification and emended description of Fusarium anguioides. Mycologia 87: 543–546. Nenkep V, Yun K, Son BW (2016). Oxysporizoline, an antibacterial polycyclic quinazoline alkaloid from the marine-mudflat-derived fungus Fusarium oxysporum. Journal of Antibiotics 69: 709–711. 180 Nguyen LT, Schmidt HA, von Haeseler A, et al. (2015). IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32: 268–274. Nilsson RH, Tedersoo L, Abarenkov K, et al. (2012). Five simple guidelines for establishing basic authenticity and reliability of newly generated fungal ITS sequences. Mycokeys 4: 37–63. Nirenberg HI (1976). Untersuchungen über die morphologische und biologische Differenzierung in der Fusarium-Sektion Liseola. Mitteilungen aus der Biologischen Bundesanstalt für Land- und Forstwirtschaft Berlin-Dahlem 169: 1–117. Nirenberg HI (1981). A simplified method for identifying Fusarium spp. occurring on wheat. Canadian Journal of Botany 59: 1599–1609. Nirenberg HI (1990). Recent advances in the taxonomy of Fusarium. Studies in Mycology 32: 91–101. Nirenberg HI (1995). Morphological differentiation of Fusarium sambucinum Fuckel sensu stricto, F. torulosum (Berk. & Curt.) Nirenberg comb. nov. and F. venenatum Nirenberg comb. nov. Mycopathologia 129: 131–141. Nirenberg HI, Aoki T (1997). Fusarium nisikadoi, a new species from Japan. Mycoscience 38: 329–333. Nirenberg HI, Brielmaiers-Liebetanz U (1996). Nectria ipomoeae Halst., anamorph: Fusarium striatum Sherb. on Passiflora edulis Sims. Nachrichtenblatt des Deutschen Pflanzenschutzdienstes 48: 270–275. Nirenberg HI, Hagedorn G (2008). Fusarium nematophilum spec. nov. – ein neuer Nematoden-assoziierter Pilz. Nachrichtenblatt des Deutschen Pflanzenschutzdienstes 60: 213–216. Nirenberg HI, O'Donnell K (1998). New Fusarium species and combinations within the Gibberella fujikuroi species complex. Mycologia 90: 434–458. Nirenberg HI, Samuels GJ (2000). Nectria and Fusarium. II. Cosmospora zealandica comb. nov. and its anamorph, Fusarium zealandicum sp. nov. Canadian Journal of Botany 78: 1482–1487. Nirenberg HI, O'Donnell K, Kroschel J, et al. (1998). Two new species of Fusarium: Fusarium brevicatenulatum from the noxious weed Striga asiatica and Fusarium pseudoanthophilum from Zea mays in Zimbabwe. Mycologia 90: 459–463. Nylander JAA (2004). MrModeltest v. 2. Evolutionary Biology Centre. Uppsala University. Programme distributed by the author. O'Donnell K (1993). Fusarium and its near relatives. In: The fungal holomorph: mitotic, meiotic and pleomorphic speciation in fungal systematics (Reynolds DR, Taylor JW, eds). CAB International, UK: 225–233. O'Donnell K (2000). Molecular phylogeny of the Nectria haematococca– Fusarium solani species complex. Mycologia 92: 919–938. O'Donnell K, Al-Hatmi AMS, Aoki T, et al. (2020). No to Neocosmospora: Phylogenomic and practical reasons for continued inclusion of the Fusarium solani species complex in the genus Fusarium. mSphere 5: e00810–e00820. O'Donnell K, Cigelnik E (1997). Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetics and Evolution 7: 103–116. O'Donnell K, Cigelnik E, Nirenberg HI (1998). Molecular systematics and phylogeography of the Gibberella fujikuroi species complex. Mycologia 90: 465–493. O'Donnell K, Kistler HC, Cigelnik E, et al. (1998). Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proceedings of the National Academy of Sciences of the USA 95: 2044–2049. O'Donnell K, Kistler HC, Tacke BK, et al. (2000). Gene genealogies reveal global phylogeographic structure and reproductive isolation among lineages of Fusarium graminearum, the fungus causing wheat scab. Proceedings of the National Academy of Sciences of the USA 97: 7905–7910. O'Donnell K, McCormick SP, Busman M, et al. (2018). Marasas et al. 1984 “Toxigenic Fusarium species: Identity and mycotoxicology” revisited. Mycologia 110: 1058–1080. O'Donnell K, Nirenberg HI, Aoki T, et al. (2000). A multigene phylogeny of the Gibberella fujikuroi species complex: detection of additional phylogenetically distinct species. Mycoscience 41: 61–78. O'Donnell K, Rooney AP, Proctor RH, et al. (2013). Phylogenetic analyses of RPB1 and RPB2 support a middle Cretaceous origin for a clade comprising all agriculturally and medically important fusaria. Fungal Genetics and Biology 52: 20–31. O'Donnell K, Sarver BAJ, Brandt M, et al. (2007). Phylogenetic diversity and microsphere array-based genotyping of human pathogenic fusaria, including isolates from the multistate contact lens-associated U.S. keratitis outbreak of 2005 and 2006. Journal of Clinical Microbiology 45: 2235–2248. FUSARIUM O'Donnell K, Sutton DA, Fothergill A, et al. (2008). Molecular phylogenetic diversity, multilocus haplotype nomenclature, and in vitro antifungal resistance within the Fusarium solani species complex. Journal of Clinical Microbiology 46: 2477–2490. O'Donnell K, Sutton DA, Rinaldi MG, et al. (2009). Novel multilocus sequence typing scheme reveals high genetic diversity of human pathogenic members of the Fusarium incarnatum-F. equiseti and F. chlamydosporum species complexes within the United States. Journal of Clinical Microbiology 47: 3851–3861. O'Donnell K, Sutton DA, Rinaldi MG, et al. (2010). Internet-accessible DNA sequence database for identifying fusaria from human and animal infections. Journal of Clinical Microbiology 48: 3708–3718. O'Donnell K, Sutton DA, Wiederhold N, et al. (2016). Veterinary fusarioses within the United States. Journal of Clinical Microbiology 54: 2813–2819. O'Donnell K, Ward TJ, Aberra D, et al. (2008). Multilocus genotyping and molecular phylogenetics resolve a novel head blight pathogen within the Fusarium graminearum species complex from Ethiopia. Fungal Genetics and Biology 45: 1514–1522. O'Donnell K, Ward TJ, Geiser DM, et al. (2004). Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genetics and Biology 41: 600–623. Ohshima S, Yanagisawa M, Katoh A, et al. (1994). Fusarium merismoides CORDA NR 6356, the source of the protein kinase C inhibitor, azepinostatin. Taxonomy, yield improvement, fermentation and biological activity. Journal of Antibiotics 47: 639–647. Otero-Colina G, Rodríquez-Alvarado G, Fern
andez-Pavía S, et al. (2010). Identification and characterization of a novel etiological agent of mango malformation disease in Mexico, Fusarium mexicanum sp. nov. Phytopathology 100: 1176–1184. Padwick GW (1945). Notes on Indian fungi III. Mycological Papers 12: 1–12. Palm ME, Gams W, Nirenberg HI (1995). Plectosporium, a new genus for Fusarium tabacinum, the anamorph of Plectosphaerella cucumerina. Mycologia 87: 397–406. Parish CA, Smith SK, Calati K, et al. (2008). Isolation and structure elucidation of parnafungins, antifungal natural products that inhibit mRNA polyadenylation. Journal of the American Chemical Society 130: 7060–7066. Pascoe IG (1990). Fusarium morphology I: Identification and characterization of a third conidial type, the mesoconidium. Mycotaxon 37: 121–160. Pasinetti L, Buzzati-Traverso A (1935). Su alcune forme di cancrena delle cactacee dovute a nuovi micromiceti e ad un batterio. Giornale Botanico Italiano 42: 89–123. Paziani MH, Carvalho LT, Melhem MSC, et al. (2020). First comprehensive report of clinical Fusarium strains isolated in the state of Sao Paulo (Brazil) and identified by MALDI-TOF MS and molecular biology. Microorganisms 8: 66. Penzig AGO (1882). Funghi agrumicoli: contribuzione allo studio dei funghi parassiti degli agrumi. Padova, Italy. Pereira CB, Ward TJ, Tessmann DJ, et al. (2018). Fusarium subtropicale, sp. nov., a novel nivalenol mycotoxin–producing species isolated from barley (Hordeum vulgare) in Brazil and sister to F. praegraminearum. Mycologia 110: 860–871. Perera RH, Hyde KD, Maharachchikumbura SSN, et al. (2020). Fungi on wild seeds and fruits. Mycosphere 11: 2108–2480. Petch T (1920). Studies in entomogenous fungi. The Nectriae parasitic on scale insects. Transactions of the British Mycological Society 7: 133–166. Pfenning L (1995). A new species of Neocosmospora from Brazil. Sydowia 47: 65–69. Pfenning LH, de Melo MP, Costa MM, et al. (2019). Fusarium udum revisited: a common, but poorly understood member of the Fusarium fujikuroi species complex. Mycological Progress 18: 107–117. Phan HT, Burgess LW, Summerell BA, et al. (2004). Gibberella gaditjirrii (Fusarium gaditjirrii) sp. nov., a new species from tropical grasses in Australia. Studies in Mycology 50: 261–272. Pilat A (1938). Liste der von A. C. J. Corda beschriebenen Pilzarten, mit Angabe der Originalexemplare, die im Herbarium des Nationalmuseums in Prag aufbewahrt sind. Acta Musei Nationalis Pragae, Botanica no. 3, 1B no. 10. Plattner PA, Nager U, Boller A (1948). Welkstoffe und Antibiotika. 7. Mitteilung. Über die Isolierung neuartiger Antibiotika aus Fusarien. Helvetica Chimica Acta 31: 594–602. Price MN, Dehal PS, Arkin AP (2010). FastTree 2 – approximately maximumlikelihood trees for large alignments. PLoS ONE 5: e9490. www.studiesinmycology.org REDELIMITED Quaedvlieg W, Kema GHJ, Groenewald JZ, et al. (2011). Zymoseptoria gen. nov.: a new genus to accommodate Septoria-like species occurring on graminicolous hosts. Persoonia 26: 57–69. Raillo AI (1950). Griby roda Fusarium. Gosudarstv. Izd. Sel’skochoz. Lit., Moskva. Rambaut A, Drummond AJ, Xie D, et al. (2018). Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Systematic Biology 67: 901–904. Rayner RW (1970). A mycological colour chart. CMI and British Mycological Society, Kew, Surrey, UK. Reeb V, Lutzoni F, Roux C (2004). Contribution of RPB2 to multilocus phylogenetic studies of the euascomycetes (Pezizomycotina, Fungi) with special emphasis on the lichen-forming Acarosporaceae and evolution of polyspory. Molecular Phylogenetics and Evolution 32: 1036–1060. Reddy GL, Reddy SM (1992). Production of IAA by some species of Fusarium. National Academy Science Letters, India 15: 247–249. Renner MK, Jensen PR, Fenical W (2000). Mangicols: structures and biosynthesis of a new class of sesterterpene polyols from a marine fungus of the genus Fusarium. Journal of Organic Chemistry 65: 4843–4852. Rheeder JP, Marasas WF, Nelson PE (1996). Fusarium globosum, a new species from corn in southern Africa. Mycologia 88: 509–513. Ronquist F, Huelsenbeck JP (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574. Roos A (1977). Physiology and pathogenicity of Neocosmospora vasinfecta EF Smith. PhD thesis. ETH Zurich, Switzerland. Rossman AY (1979). A preliminary account of the taxa described in Calonectria. Mycotaxon 8: 485–558. Rossman AY (1983). The phragmosporous species of Nectria and related genera. Mycological Papers 150: 1–164. Rossman AY, Allen WC, Braun U, et al. (2016). Overlooked competing asexual and sexually typified generic names of Ascomycota with recommendations for their use or protection. IMA Fungus 7: 289–308. Rossman AY, Samuels GJ, Rogerson CT, et al. (1999). Genera of Bionectriaceae, Hypocreaceae and Nectriaceae (Hypocreales, Ascomycetes). Studies in Mycology 42: 1–248. Rossman AY, Seifert KA (2011). Phylogenetic revision of taxonomic concepts in the Hypocreales and other Ascomycota. A tribute to Gary J. Samuels. Studies in Mycology volume 68, CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands. Rossman AY, Seifert KA, Samuels GJ, et al. (2013). Genera of Bionectriaceae, Hypocreaceae and Nectriaceae (Hypocreales) proposed for acceptance and rejection. IMA Fungus 4: 41–51. Rostrup E (1894). Sygdomme hos Landbrugsplanter foraarsagede af Snyltesvampe. Botanisches Zentralblatt 15: 284–285. Saccardo PA (1892). Supplementum Universale, Pars II. DiscomyceteaeHyphomyceteae. Sylloge Fungorum 10: 1–964. Saccardo PA (1899). Sylloge fungorum 14: 725–1316. Saccardo PA (1906). Notae mycologicae. Series VII. Annales Mycologici 4: 273–278. Salgado-Salazar C, Rossman AY, Chaverri P (2016). The genus Thelonectria (Nectriaceae, Hypocreales, Ascomycota) and closely related species with cylindrocarpon-like asexual states. Fungal Diversity 80: 411–455. Salichos L, Stamatakis A, Rokas A (2014). Novel information theory-based measures for quantifying incongruence among phylogenetic trees. Molecular Biology and Evolution 31: 1261–1271. Samson RA (1974). Paecilomyces and some allied hyphomycetes. Studies in Mycology 6: 1–119. Samson RA, Visagie CM, Houbraken J, et al. (2014). Phylogeny, identification and nomenclature of the genus Aspergillus. Studies in Mycology 78: 141–173. Samuels GJ (1976). A revision of the fungi formerly classified in Nectria subg. Hyphonectria. Memoirs of the New York Botanical Garden 26: 1–126. Samuels GJ (1976). Perfect states of Acremonium the genera Nectria, Actiniopsis, Ijuhya, Neohenningsia, Ophiodictyon, and Peristomialis. New Zealand Journal of Botany 14: 231–260. Samuels GJ (1978). Some species of Nectria having Cylindrocarpon imperfect states. New Zealand Journal of Botany 16: 73–82. Samuels GJ (1988). Fungicolous, Lichenicolous, and Myxomyceticolous Species of Hypocreopsis, Nectriopsis, Nectria, Peristomialis, and Trichonectria. New York Botanical Garden 48: 1–78. Samuels GJ, Brayford D (1994). Species of Nectria (sensu lato) with red perithecia and striate ascospores. Sydowia 46: 75–161. 181 CROUS ET AL. Samuels GJ, Rogerson CT (1984). Nectria atrofusca and its anamorph, Fusarium staphyleae, a parasite of Staphylea trifolia in eastern North America. Brittonia 36: 81–85. Samuels GJ, Doi Y, Rogerson CT (1990). Hypocreales. In: Contributions toward a mycobiota of Indonesia: Hypocreales, synnematous Hyphomycetes, Aphyllophorales, Phragmobasidiomycetes, and Myxomycetes (Samuels GJ, ed). New York Botanical Garden, New York: 6–108. Samuels GJ, Hallett IC (1983). Microdochium stoveri and Monographella stoveri new combinations for Fusarium stoveri and Micronectriella stoveri. Transactions of the British Mycological Society 81: 473–483. Samuels GJ, Lu B, Chaverri P, et al. (2009). Cyanonectria, a new genus for Nectria cyanostoma and its Fusarium anamorph. Mycologial Progress 8: 49–58. Samuels GJ, Nirenberg H (1989). Nectria and Fusarium. I. Nectria setofusariae and its anamorph Fusarium setosum. Canadian Journal of Botany 67: 3372–3377. Samuels GJ, Rossman AY, Lowen R, Rogerson CT (1991). A synopsis of Nectria subgen. Dialonectria. Mycological Papers 164: 1–48. Sandoval-Denis M, Crous PW (2018). Removing chaos from confusion: assigning names to common human and animal pathogens in Neocosmospora. Persoonia 41: 109–129. Sandoval-Denis M, Guarnaccia V, Polizzi G, et al. (2018). Symptomatic Citrus trees reveal a new pathogenic lineage in Fusarium and two new Neocosmospora species. Persoonia 40: 1–25. Sandoval-Denis M, Lombard L, Crous PW (2019). Back to the roots: a reappraisal of Neocosmospora. Persoonia 43: 90–185. Sandoval-Denis M, Swart WJ, Crous PW (2018). New Fusarium species from the Kruger National Park, South Africa. MycoKeys 34: 63–92. Sangalang AE, Summerell BA, Burgess LW, et al. (1995). Taxonomy of Fusarium: characterization of Fusarium avenaceum subsp. aywerte and Fusarium avenaceum subsp. nurragi. Mycological Research 99: 287–290. Santos ACS, Trindade JVC, Lima CS, et al. (2019). Morphology, phylogeny, and sexual stage of Fusarium caatingaense and Fusarium pernambucanum, new species of the Fusarium incarnatum-equiseti species complex associated with insects in Brazil. Mycologia 111: 244–259. Sarver BAJ, Ward TJ, Gale LR, et al. (2011). Novel Fusarium head blight pathogens from Nepal and Louisiana revealed by multilocus genealogical concordance. Fungal Genetics and Biology 48: 1096–1107. Sawai K, Okuno T, Terada Y, et al. (1981). Isolation and properties of two antifungal substances from Fusarium solani. Agricultural and Biological Chemistry 45: 1223–1228. Scauflaire J, Gourgue M, Munaut F (2011). Fusarium temperatum sp. nov. from maize, an emergent species closely related to Fusarium subglutinans. Mycologia 103: 586–597. Schneider R, Dalchow J (1975). Fusarium inflexum spec. nov., als Erreger einer Welkekrankheit an Vicia faba L. in Deutschland. Phytopathologische Zeitschrift 82: 70–82. Schoch CL, Seifert KA, Huhndorf S, et al. (2012). Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences of the United States of America 109: 6241–6246. Schroers H-J, Baayen RP, Meffert JP, et al. (2004). Fusarium foetens, a new species pathogenic to begonia elatior hybrids (Begonia x hiemalis) and the sister taxon of the Fusarium oxysporum species complex. Mycologia 96: 393–406. Schroers H-J, Gr€afenhan T, Nirenberg HI, et al. (2011). A revision of Cyanonectria and Geejayessis gen. nov., and related species with fusarium-like anamorphs. Studies in Mycology 68: 115–138. Schroers H-J, O'Donnell K, Lamprecht SC, et al. (2009). Taxonomy and phylogeny of the Fusarium dimerum species group. Mycologia 101: 44–70. Schroers HJ, Samuels GJ, Zhang N, et al. (2016). Epitypification of Fusisporium (Fusarium) solani and its assignment to a common phylogenetic species in the Fusarium solani species complex. Mycologia 108: 806–819. Secor GA, Rivera-Varas V, Christ DS, et al. (2014). Characterization of Fusarium secorum, a new species causing Fusarium yellowing decline of sugar beet in north central USA. Fungal Biology 118: 764–775. Seifert KA (1985). A monograph of Stilbella and some allied Hyphomycetes. Studies in Mycology 27: 1–235. Seifert KA (1996). FusKey: Fusarium interactive key. Agriculture & Agri-Food Canada. Research Branch, Eastern Cereal & Oilseed Research Centre, Canada. 182 Seifert KA (2013). Pionnotes, a synonym of Dacrymyces rather than Fusarium. Mycotaxon 123: 205–211. Seifert KA, Gr€afenhan T (2012). Lectotypification and characterization of the natural phenotype of Fusarium bactridioides. Mycotaxon 120: 415–422. Shang QJ, Phookamsak R, Camporesi E, et al. (2018). The holomorph of Fusarium celtidicola sp. nov. from Celtis australis. Phytotaxa 361: 251–265. Sherbakoff CD (1915). Fusaria of potatoes. Memoirs of the Cornell University Agricultural Experimental Station 6: 87–270. Sibilia C (1925). Due specie di Fusarium parasite di piantine di Conifere: Fusarium fuliginosporum n. sp. e F. echinosporum n. sp. Annals of the Institute of Forestry (Firenze) II 1: 77–97.  si
c A, Al-Hatmi AMS, Ba
canovi
c-Si  si
c J, et al. (2018). Two new species of the Si Fusarium solani species complex isolated from compost and hibiscus (Hibiscus sp.). Antonie van Leeuwenhoek 111: 1785–1805.  si
c A, Ba
canovi
c-Si  si
c J, Al-Hatmi AMS, et al. (2018). The ‘forma specialis’ Si issue in Fusarium: A case study in Fusarium solani f. sp. pisi. Scientific Reports 8: 1252. Skovgaard K, Rosendahl S, O'Donnell K, et al. (2003). Fusarium commune is a new species identified by morphological and molecular phylogenetic data. Mycologia 95: 630–636. Sleiman S, Halliday CL, Chapman B, et al. (2016). Performance of matrixassisted laser desorption ionization time of flight mass spectrometry for identification of Aspergillus, Scedosporium, and Fusarium spp. in the Australian clinical setting. Journal of Clinical Microbiology 54: 2182–2186. Snyder WC, Hansen HN (1940). The species concept in Fusarium. American Journal of Botany 27: 64–67. Snyder WC, Hansen HN (1941). The species concept in Fusarium with reference to section Martiella. American Journal of Botany 28: 738–742. Sogonov MV, Castlebury LA, Rossman AY, et al. (2007). The type species of Apiognomonia, A. veneta, with its Discula anamorph is distinct from A. errabunda. Mycological Research 111: 693–709. Sorauer P (1923). Handbuch der Pflanzenkrankheiten. Verlagbuchhandlung Paul Parey, Berlin, Germany. Sørensen JL, Akk E, Thrane U, et al. (2013). Production of fusarielins by Fusarium. International Journal of Food Microbiology 160: 206–211. Stamatakis A (2014). RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30: 1312–1313. Starkey DE, Ward TJ, Aoki T, et al. (2007). Global molecular surveillance reveals novel Fusarium head blight species and trichothecene toxin diversity. Fungal Genetics and Biology 44: 1191–1204. Steenkamp ET, Wingfield BD, Coutinho TA, et al. (2000). PCR-based identification of MAT-1 and MAT-2 in the Gibberella fujikuroi species complex. Applied and Environmental Microbiology 66: 4378–4382. Steyaert RL (1948). Contribution a l’
etude des parasites des v
eg
etaux du Congo Belge. Bulletin de la Soci
et
e Royale de Botanique de Belgique T80, Fasc 1/ 2: 11–58. € Strasser PP (1910). Fünfter Nachtrag zur Pilzflora des Sonntagberges (N.-O.), 1909. Verhandlungen der Zoologisch-Botanischen Gesellschaft Wien 60: 303–335. Stukenbrock EH, Jørgensen FG, Zala M, et al. (2010). Whole-genome and chromosome evolution associated with host adaptation and speciation of the wheat pathogen Mycosphaerella graminicola. PLoS Genetics 6: e1001189. Subrahmanyam A (1983). Fusarium laceratum. Mykosen 26: 478–480. Subramanian CV (1971). Hyphomycetes. An account of Indian species, except Cercosporae. Indian Council of Agricultural Research, New Delhi, India. Sugimoto Y, Ahmed NE, Yasuda N, et al. (2002). Trichothecene inhibitors of Striga hermonthica germination produced by Fusarium solani. Weed Science 50: 658–661. Summerell BA, Rugg CA, Burgess LW (1995). Characterization of Fusarium babinda sp. nov. Mycological Research 99: 1345–1348. Summerell BA, Salleh B, Leslie JF (2003). A utilitarian approach to Fusarium identification. Plant Disease 87: 117–128. Sutton BC (1986). Presidential address: Improvizations on conidial themes. Transactions of the British Mycological Society 86: 1–38. Sydow H, Sydow P (1939). Fungi aequatorienses. Annales Mycologici 37: 275–438. Tatsuno T, Saito M, Enomoto M, et al. (1968). Nivalenol, a toxic principle of Fusarium nivale. Chemical and Pharmaceutical Bulletin 16: 2519–2520. Taubenhaus JJ (1920). Wilts of the watermelon and related crops (Fusarium wilts of cucurbits.). Bulletin of the Texas Agricultural Experiment Station 260: 3–49. FUSARIUM Taylor JW (2014). Appropriately sized genera and appropriately ranked higher taxa. IMA Fungus 5: 1–2. Taylor JW, Jacobson DJ, Kroken S, et al. (2000). Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31: 21–32. Thines M (2019). An evolutionary framework for host shifts–jumping ships for survival. New Phytologist 224: 605–617. Tianpanich K, Prachy S, Wiyakrutta S, et al. (2011). Radical scavenging and antioxidant activities of isocoumarins and a phthalide from the endophyte fungus Colletotrichum sp. Journal of Natural Products 74: 79–81. Tio ML, Burgess W, Nelson PE, et al. (1977). Techniques for the isolation, culture, and preservation of the Fusaria. Australasian Plant Pathology Society Newsletter 6: 11–13. Torbati M, Arzanlou M, Sandoval-Denis M, et al. (2019). Multigene phylogeny reveals new fungicolous species in the Fusarium tricinctum species complex and novel hosts in the genus Fusarium from Iran. Mycological Progress 18: 119–133. Torp M, Nirenberg HI (2004). Fusarium langsethiae sp. nov. on cereals in Europe. International Journal of Food Microbiology 95: 247–256. Triest D, De Cremer K, Pi
erard D, et al. (2016). Unique phylogenetic lineage found in the Fusarium-like clade after re-examining BCCM/IHEM fungal culture collection material. Mycobiology 44: 121–130. Triest D, Stubbe D, de Cremer K, et al. (2015). Use of matrix-assisted laser desorption ionization–time of flight mass spectrometry for identification of molds of the Fusarium genus. Journal of Clinical Microbiology 53: 465–476. Tulloch M (1972). The genus Myrothecium Tode ex Fr. Mycological Papers 130: 1–42. Turland NJ, Wiersema JH, Barrie FR, et al. (eds) (2018). International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code). Regnum Vegetabile 159. Koeltz Botanical Books, Glashütten, Germany. Ueda S, Udagawa S (1983). A new Japanese species of Neocosmospora from marine sludges. Mycotaxon 16: 387–395. Ueno Y, Ishii K, Sakai K, et al. (1972). Toxicological approaches to the metabolites of fusaria. IV. Microbial survey on "bean hulls poisoning of horses" with the isolation of toxic trichothecenes, neosolaniol and T-2 toxin of Fusarium solani M-1-1. Japanese Journal of Experimental Medicine 42: 187–203. Urry WH, Wehrmeister HL, Hodge EB, et al. (1966). The structure of zearalenone. Tetrahedron Letters 7: 3109–3114. van Hove F, Waalwijk C, Logrieco A, et al. (2011). Gibberella musae (Fusarium musae) sp. nov., a recently discovered species from banana is sister to F. verticillioides. Mycologia 103: 570–585. van Wyk PS, Scholtz DJ, Los O (1986). A selective medium for the isolation of Fusarium spp. from soil debris. Phytophylactica 18: 67–69. Vellinga EC, Kuyper TW, Ammirati J, et al. (2015). Six simple guidelines for introducing new genera of fungi. IMA fungus 6: 65–68. Vesonder RF, Tjarks LW, Rohwedder WK, et al. (1979). Equisetin, an antibiotic from Fusarium equiseti NRRL 5537, identified as a derivative of n-methyl2,4-pyrollidone. Journal of Antibiotics 32: 759–761. Vilgalys R (2003). Taxonomic misidentification in public DNA databases. New Phytologist 160: 4–5. Vilgalys R, Hester M (1990). Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238–4246. Vilgalys R, Sun BL (1994). Ancient and recent patterns of geographic speciation in the oyster mushroom Pleurotus revealed by phylogenetic analysis of ribosomal DNA sequences. Proceedings of the National Academy of Science of the USA 91: 4599–4603. Vincens F (1915). Deux champignons entomophytes sur L
epidopteres, r
ecolt
es au nord du Br
esil. Bulletin de la Soci
et
e Mycologique de France 31: 25–28. Visagie CM, Houbraken J, Frisvad JC, et al. (2014). Identification and nomenclature of the genus Penicillium. Studies in Mycology 78: 343–371. Voglmayr H, Thines M (2007). Phylogenetic relationships and nomenclature of Bremiella sphaerosperma (Chromista, Peronosporales). Mycotaxon 100: 11–20. von Bargen KW, Niehaus EM, Bergander K, et al. (2013). Structure elucidation and antimalarial activity of apicidin F: an apicidin-like compound produced by Fusarium fujikuroi. Journal of Natural Products 76: 2136–2140. von Höhnel F (1915). Fragmente zur Mykologie (XVII. Mitteilung, Nr. 876 bis 943). Sitzungsberichte der mathematisch-naturwissenschaftlichen Klasse der Kaiserlichen Akademie der Wissenschaften, Wien 124: 49–159. www.studiesinmycology.org REDELIMITED Walker J (1962). Notes on plant parasitic fungi. I. Proceedings of the Linnean Society of New South Wales 87: 162–176. Walsh JL, Laurence MH, Liew ECY, et al. (2010). Fusarium: two endophytic novel species from tropical grasses of northern Australia. Fungal Diversity 44: 149–159. Wang MM, Chen Q, Diao YZ, et al. (2019). Fusarium incarnatum-equiseti complex from China. Persoonia 43: 70–89. Ward TJ, Bielawski JP, Kistler HC, et al. (2002). Ancestral polymorphism and adaptive evolution in the trichothecene mycotoxin gene cluster of phytopathogenic Fusarium. Proceedings of the National Academy of Sciences of the USA 99: 9278–9283. Wergen B (2018). Handbook of Ascomycota. Vol. Ib. Pyrenomycetes s.l. mit zweifach septierten bis mauerförmigen Sporen. Funghiparadise Productions, Germany. White TJ, Bruns T, Lee S, et al. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR protocols: a guide to methods and applications (Innes MA, Gelfand DH, Sninsky JJ, et al., eds). Academic Press, USA: 315–322. Wigmann EF, Behr J, Vogel RF, et al. (2019). MALDI-TOF MS fingerprinting for identification and differentiation of species within the Fusarium fujikuroi species complex. Applied Microbiology and Biotechnology 103: 5323–5337. Willkomm M (1866). Die mikroskopischen Feinde des Waldes: Naturwissenschaftliche Beitr€age zur Kenntniss der Baum- und Holzkrankheiten, für Forstm€anner und Botaniker, bearbeitet und in zwanglosen Heften herausgegeben. G. Schönfeld's Buchhandlung, Dresden, Germany. Wingfield MJ, De Beer ZW, Slippers B, et al. (2012). One fungus, one name promotes progressive plant pathology. Molecular Plant Pathology 13: 604–613. Wollenweber HW (1914). Identification of species of Fusarium occurring on the sweet potato, Ipomoea batatas. Journal of Agricultural Research 2: 251–285. Wollenweber HW (1916–1935). Fusaria autographice delineata. Selbstverlag, Berlin, Germany. Wollenweber HW (1924). Pyrenomyceten-Studien. I. Angewandte Botanik 6: 300–313. Wollenweber HW (1926). Pyrenomyceten-Studien. II. Angewandte Botanik 8: 168–212. Wollenweber HW (1934). Fusarium bactridioides sp. nov., associated with Cronartium. Science New York 79: 572. Wollenweber HW (1943). Fusarium-Monographie. II. Fungi parasitici et saprophytici. Zentralblatt für Bakteriologie Abt. 2 106: 104–135. Wollenweber HW, Reinking OA (1925). Aliquot Fusaria tropicalia nova vel revisa. Phytopathology 15: 155–169. Wollenweber HW, Reinking OA (1935). Die Fusarien. Verlagsbuchandlung Paul Parey, Berlin, Germany. Woudenberg JHC, Aveskamp MM, de Gruyter J, et al. (2009). Multiple Didymella teleomorphs are linked to the Phoma clematidina morphotype. Persoonia 22: 56–62. Xia JW, Sandoval-Denis M, Crous PW, et al. (2019). Numbers to names – reappraisal of the Fusarium incarnatum-equiseti species complex. Persoonia 43: 186–221. Xu Y, Vinas M, Alsarraq A, et al. (2019). Bis-naphthopyrone pigments protect filamentous ascomycetes from a wide range of predators. Nature Communications 10: 3579. Yamamoto W, Maeda M, Oyasu N (1957). Some Nectriaceae and Elsinoe species from Japan. Science Reports of the Hyogo University of Agriculture. Series agricultural biology 3: 15–18. Yilmaz N, Sandoval-Denis M, Lombard L, et al. (2021). Redefining species limits in the Fusarium fujikuroi species complex. Persoonia 46: 129–162. Yli-Mattila T, Ward T, O'Donnell K, et al. (2011). Fusarium sibiricum sp. nov, a novel type A trichothecene-producing Fusarium from northern Asia closely related to F. sporotrichioides and F. langsethiae. International Journal of Food Microbiology 147: 58–68. Yli-Mattila Y, Gagkaeva T, Ward TJ, et al. (2009). A novel Asian clade within the Fusarium graminearum species complex includes a newly discovered cereal head blight pathogen from the Far East of Russia. Mycologia 101: 841–852. Yoshida K, Saitoh H, Fujisawa S, et al. (2009). Association genetics reveals three novel avirulence genes from the rice blast fungal pathogen Magnaporthe oryzae. The Plant Cell 21: 1573–1591. 183 CROUS ET AL. Yoshizawa T, Morooka N (1973). Deoxynivalenol and its monoacetate: new mycotoxins from Fusarium roseum and moldy barley. Agricultural and Biological Chemistry 37: 2933–2934. Zeller KA, Summerell BA, Bullock S, et al. (2003). Gibberella konza (Fusarium konzum) sp. nov. from prairie grasses, a new species in the Gibberella fujikuroi species complex. Mycologia 95: 943–954. Zeng ZQ, Zhuang WY (2017). Eight new combinations of Bionectriaceae and Nectriaceae. Mycosystema 36: 278–281. Zeng ZQ, Zhuang WY (2017). Two new species of Neocosmospora from China. Phytotaxa 319: 175–183. Zeng ZQ, Zheng HD, Wang XC, et al. (2020). Ascomycetes from the Qilian Mountains, China – Hypocreales. MycoKeys 71: 119–137. Zhang FA, Liu S-R, Zhou X-J, et al. (2020). Fusarium xiangyunensis (Nectriaceae), a remarkable new species of the Nematophagus fungi from Yunnan, China. Phytotaxa 450: 273–284. Zhang XM, Zhuang WY (2003). Re-examinations of Bionectriaceae and Nectriaceae (Hypocreales) from temperate China on deposit in HMAS. Nova Hedwigia 76: 191–200. 184 Zhao ZH, Lu GZ (2008). Fusarium sinensis sp. nov., a new species from wheat in China. Mycologia 100: 746–751. Zhou G, Qiao L, Zhang X, et al. (2019). Fusaricates H-K and fusalanones A-B from a mangrove endophytic fungus Fusarium solani HDN15-410. Phytochemistry 158: 13–19. Zhou X, O'Donnell K, Aoki T, et al. (2016). Two novel Fusarium species that cause canker disease of prickly ash (Zanthoxylum bungeanum) in northern China form a novel clade with Fusarium torreyae. Mycologia 108: 668–681. Zhuang WY, Nong Y, Luo J (2007). New species and new Chinese records of Bionectriaceae and Nectriaceae (Hypocreales, Ascomycetes) from Hubei, China. Fungal Diversity 24: 347–357. Zoutman DE, Sigler L (1991). Mycetoma on the foot caused by Cylindrocarpon destructans. Journal of Clinical Microbiology 29: 1839–1855. Zwickl DJ, Hillis DM (2002). Increased taxon sampling greatly reduces phylogenetic error. Systematic Biology 51: 588–598.