Alinteri J. of Agr. Sci. (2021) 36(1): 01-06 http://dergipark.gov.tr/alinterizbd e-ISSN: 2587-2249 http://www.alinteridergisi.com/ info@alinteridergisi.com DOI:10.47059/alinteri/V36I1/AJAS21001 RESEARCH ARTICLE Determination of Resistance Levels to Fusarium oxysporum f. sp. melonis and ZYMV and Homogeneity in Some Melon Genotypes Ayşe Nur Çetin1*• Ali Tevfik Uncu2 • Fatıma Şen3 • Şeyma Nur Erdeğer3 • Önder Türkmen4 1* Ahi Evran University, Faculty of Agriculture, Department of Horticulture, Kırşehir/Turkey. E-mail: aysenurctn32@gmail.com 2 Necmettin Erbakan University, Faculty of Science, Department of Molecular Biology and Genetics, Konya/Turkey. 3 Necmettin Erbakan University, Institute of Science, Department of Molecular Biology and Genetics, Konya/Turkey. 4 Selçuk University, Faculty of Agriculture, Department of Horticulture, Konya/Turkey. ARTICLE INFO ABSTRACT Article History: Received: 22.04.2020 Accepted: 09.06.2020 Available Online: 02.02.2021 ZYMV and Fusarium oxysporum f. sp. melonis are one of the main disease factors limiting melon cultivation. ZYMV (Zucchini Yellow Mosaic Virus) is one of the most important diseases caused by potyvirus and causing the most important yield losses in melons. Another important disease agent, Fusarium oxysporum f. sp. Melonis, is a soil-borne disease with four races FOM 0, 1, 2, 1-2. The most common races are 1 and 2 in Turkey. This study, 87 melon accessories ZYMV and Fom 1 and Fom 2 races resistance levels and homogeneity testing levels of genotypes were determined. Result of the study, when the resistance among the genotypes for two races was examined, Fom 1 and Fom 2 strains, 23 genotypes were found to have homozygous resistance alleles against to both races, while for Fom 1 there were 46 allele resistance lines in total, and 30 genotypes had homozygous resistance alleles, 16 of them had heterozygous resistance alleles. This situation for Fom 2, it was found that there were 75 allele resistant alleles, 69 genotypes had homozygous allele and 16 genotypes had heterozygous allele. All genotypes are sensitive against to ZYMV. Homogeneity levels,29 of the genotypes were observed to be between 85-95%. Keywords: Melon Fusarium Oxysporum f. sp. Melonis Zymv Resistance Homogeneity Please cite this paper as follows: Çetin, A.N., Uncu, A.T., Şen, F., Erdeğer, Ş.N. and Türkmen, Ö. (2021). Determination of Resistance Levels to Fusarium oxysporum f. sp. melonis and ZYMV and Homogeneity in Some Melon Genotypes. Alinteri Journal of Agriculture Sciences, 36(1): 01-06. doi: 10.47059/alinteri/V36I1/AJAS21001 Introduction In order to prevent losing this treasure and to enable the usage of this material in improvement efforts, many researchers from all regions of our country have conducted studies aimed at determining the resistance against to some melon diseases and identifying through morphological and molecular markers as well as selection research (Şensoy, 2005; Atalmış, 2007; Sığva, 2008; Sarı et al., 2009). Melon production in Turkey is carried out with local genotypes and hybrid seeds on the market (Sarı et al., 2010). However, while local genotypes are superior in quality (taste, aroma etc.), due to lower fertility, disease resistance and adaptation capabilities compared to hybrids, their cultivation area has been reduced. When the diseases that cause this decline are considered, ZYMV and Fusarium Wilt, which are two most important disease factor in melons, stand out. ZYMV (Zucchini Yellow Mosaic Virus) that Melon is an important species of the Cucurbitaceae family in both production and consumption, and the total production of melons is 1.753.942 tones in Turkey while world production is 31.948.353 tones (Fao, 2017). Melon production in Turkey, however, has displayed a decrease of 3.3% in recent years (Tüik 2018). Turkey, which is a gene hub for melon, has a wide variety of local melon population with superior characteristics. Yet, our local genotpys are rapidly becoming extinct and these varieties cannot be used effectively in improvement programs (Atalmış, 2007). * Corresponding author: aysenurctn32@gmail.com ORCID: 0000-0002-0826-1243 1 Çetin, A.N., Uncu, A.T., Şen, F., Erdeğer, Ş.N. and Türkmen, Ö. (2021). Alınteri Journal of Agriculture Sciences 36(1): 01-06 originates from potyvirus is the primary cause of fertility loss in melon production (Lisa & Lecoq, 1984). Another important disease factor that limits melon production is Fusarium oxysporum f. sp. melonis (FOM), which originates from the soil and has four strains as FOM 0,1,2 and 1-2, all of which is present in Turkey. However, the most common races are 1 and 2. It has been found that especially diseases that emerge from fungal factors limit production of melons (Boyraz and Baştaş, 2005). Through molecular marker method, this study has been aimed to test resistance and consistency levels of 87 melon accessions against to ZYMV and Fusarium oxysporum f. sp. melonis FOM 1 and FOM 2 strains. Thus, by using molecular markers for selection from within this accession whose resistance against to ZYMV and Fusarium races are specified, it will be possible to use selected genotypes in future hybrid improvement programs. 𝑃𝐼𝐶 = 1 − 𝑘 𝑝2 𝑖=1 𝑖 (1) pii shows the frequency of the allele while k displays the total number of alleles for each locus. Microsatellite values for each locus are given as 1 for present and 0 for absent. This data was used in the calculation of The Nei index of genetic similarity (Nei and Li 1979).Population structure was determined by using SSR data through Structure (Pritchard et al. 2000) data analysis software. Determining the Level of Disease Resistance SCAR and SSR markers for resistance alleles belonging to Zym-1 and Zym-2 (Table 2) and Fom-1, Fom-2 (Table 3, Table 4) genome zones were displayed by genotyping, according to the protocol given for diversity analysis above. SNP markers related to disease resistance are shown in genotypes via protocol given below, through CAPs genotyping method. Materials and Methods Genotyping CAPs Markers Plant Material For genomic studies, PCR based CAPs markers have been applied according to the method specified by Konieczyn and Ausubel (1993). In CAPs marker analysis, DNA zone including a specific section peculiar to an allele is replicated through PCR and cut by using an applicable restriction enzyme to display the polymorphism between individuals. PCR reactions for CAPs markers have been applied according to the method suggested by Frary et al. (2004). According to this method, 25 µl reaction mixture contains 1 µl template DNA (40-60 ng/µl), 2.5 µl 10X PCR buffer solution(1x), 0.5 µl dNTP (0.2 mM), forward and reverse primers (10 pmol) 0.5 µl each, 0.25 µl Taq polymerase enzyme (0.25U) and 19.75 µl sterilized dH2O. PCR reactions have been conducted by using GeneAmp®PCR System 9700 (Applied Biosystems). It has been conducted by applying a PCR profile (for 35 cycles, at 94°C/5 minutes, 94°C/30 seconds, 50°C/45 seconds, 72°C/45 seconds, 72°C/5 minutes and kept at 4°C). Following the amplification, PCR products have been checked by applying %1 agarose gel in order to determine whether amplification have occurred or not, and on conditions that it has then PCR products have been cut using a suitable (if necessary) restriction enzyme which provides polymorphism. For this process, 15 µl PCR product, 1.5 µl 10x cutting buffer solution (1x), 0.2 µl (100x) BSA (1x) (if necessary, for the enzyme), 0.5 µl restriction enzyme and 2.8 µl sterilized dH2O have been used. The reaction has been incubated for a minimum of 3 to 4 hours at suitable temperatures according to the enzyme type used. Finally, capillary electrophoresis system has been implemented to separate particles that were cut. In this study, 87 melon accessories belonging to Selko R&D Biotechnology Company were tested. Molecular studies were conducted on leaf samples from plants grown from these genotypes. Method DNA Isolation DNA isolation from melon leaf tissue samples was performed using Genomic DNA Purification Kit (Promega). Genetic Diversity Analysis and Determining the Levels of Homogeneity Polymorphic diversity SSR marker core set (listed below), which is selected by Hu, vd. (2015) among melon leaf DNA samples, was used (Table 1). For PCR reaction mixtures to be used in order to increase the number of SSR markers, 1x AmplitaqGold® PCR kit, 2.5 mM MgCl2, 200µM each dNTP (Promega), 300 nM each primer, 0.5 unit AmplitaqGold® polymerase enzyme (Applied Biosystems Foster City CA), 1.0µL melon leaf DNA and a protocol that contains dH2O instead of nuclease was prepared. Total reaction volume is 20µL. PCR products were replicated through the program below: for initial DNA denaturation, they were exposed to 95°C for 10 minutes; denaturation at 95°C for 30 seconds; annealing reaction at 60°C (temperature degrees may vary for primers) for 30 seconds and elongation at 72°C for 30 seconds (35 cycles); final elongation at 72°C for 10 minutes and kept at 4°C. SSR markers replicated from DNA samples belonging to these melon genotypes were imaged via Qiaxcel Fragment Analyzer (Qiagen Sample & Assay Technologies) capillary electrophoresis system. For each SSR marker, particles were divided into thousand-unit groups that represent alleles. PIC (Polymorphism Information Content) for each SSR marker was calculated through the formula introduced by Saal and Wricke (1999). 2 Çetin, A.N., Uncu, A.T., Şen, F., Erdeğer, Ş.N. and Türkmen, Ö. (2021). Alınteri Journal of Agriculture Sciences 36(1): 01-06 Table 1. Characterization of melon genetic resources, SSR marker core set list used in population structure determination analysis Name of Marker Chr Forward Primer (5'-3') Reverse Primer (5'-3') Size (bp) Motif DM0073 1 CTCATCGCAAAACCATATC AGTTTGTGGATCGTTTAGG 131 (GA)13 CMCT505 1 GACAGTAATCACCTCATCAAC GGGAATGTAAATTGGATATG 219 (CT)15(AT)12(AC)11 CMCTN4 1 AAAACAAAAGCTCTCCACGA CTTTCCTTTATTATGCCTACG 126 (CT)21 DM0298 2 GTTCGACGTTTACTCATCC AGTGAAAGATGGGTGCTTC 281 (CT)16 CMGAN271 2 CAACCCTCGAAACAAAAC AGAGAGGGGTTTGAAGTG 150 (GA)15 CMTCN66 3 CTCCGATCAATTTTACATCT GAATAAACTTGGTGTCCAAC 127 (TC)17 TJ10 3 ACGAGGAAAACGCAAAATCA TGAACGTGGACGACATTTTT 117 (CTT)5(CT)3 DM0263 4 AAGCCATTGTCCCACAAG CAGTGGTTCTGTAGCCATC 114 (AG)16 DE1368 4 GCGGAACCTGATTTTTCTG AATCCTCAAATACACATTTCC 215 (CTT)20 CMMS2_3 5 ATCACCCACCCCACCACTGCCAAAA CCTTGAAAAACCACCAACATAACAC 213 (GA)19 CMCTN2 5 CTGAAAGCAGTTTGTGTCGA AAAGAAGGAAGAGGCTGAGA 172 (CT)12 CMBR002 6 TGCAAATATTGTGAAGGCGA AATCCCCACTTGTTGGTTTG 114 (AG)22 CMTCN41 6 CCCCAAGATTCGTATTAATC TGGTAGTAGAGATGATATAC 129 (TC)12 DE1295 7 AAGGTCCAAACTTTGAGGG TATGCCCAATGGTACTTCC 113 (AG)11 CMMS30_3 7 TTCCCACCAGCCCAACGGACACACT GAGATACAGAAACGACGACTAACCT 271 (GA)16 CMTCN30 7 GGAGGGAAAGGAAAGAGAGA GGCAAGAAGATGGCAAAGAT 193 (TC)13 CMCTT144 8 CAAAAGGTTTCGATTGGTGGG AAATGGTGGGGGTTGAATAGG 192 (CTT)10 DE1245 8 GTCATCGACAAAGAAAGCC TTTGGCTAATGTCTTACATCTTC 215 (AAG)12 DE1400 9 AACTTTTGCTTTCCCTTCC TGGGGAATTAGGGTTAGATG 198 (CTT)16 CMCTN7 9 AATGACACTGCCCACATTCT AGGTTTTTCAATGGAGGGGA 130 (CT)20 CMCTN71 10 TCAATTTTTGCCAAACAAGC CAAGGACACAGATTTAATAC 160 (CT)11 CMTCN196 10 GGTCGTATGTTCTGCAGC TAATGGTGAAGAAGATAAGG 174 (TC)15 CMTCN62 11 AAGATCGCCTCTATCACAG ATTTGTACTCCCAACGCATC 145 (TC)15 CMGAN51 11 AAACCTTAACGATCTATTCG TCAAGAAGACGAAACTATTC 188 (GA)15 DE1113 12 TTATCATTGGAAACCAAAGC CCAACACTCTTAACCGCTC 217 (AAG)8 CMBR097 12 ATATTGATTGCTGGGAAAGG CTTTTTTGGCTTTATTGGGTC 159 (GA)14 Table 2. Selection markers of the Zym-1 and Zym-2resistance gene Name and type of marker Primer Ta (oC) CMAG362 /SSR F- TACATTATGGGTAAGGTAAG R- CCATCTCTTAACTTTCTCTC 51 Zym-1 marker Perin et al. (2002) CMBR551 /SSR F- GAGGCCTTTGTGGTTCGTAA R- AAAGAAATGGATAAAGGAAACAGA 50 Zym-2 marker Ritschel et al. (2004) Reference Table 3. Selection markers of the Fom-1 resistance gene Name and type of marker Primer 5’- 3’ Restriction enzyme NBSI-CAPS/CAPS TATTGCTAAAGCTGTTTTCAAAAGCG AACAAAAACTTTTCGATTTCCTAAGTT Alw261 62-CAPS/CAPS GGAGAAGATGCTAGAGCCATTC AATCGGGCATCCTGTTTTGG Ncol SB17645/SCAR AGGGAACGAGTTGAGAGAGCTAGA CGAGGATTCTTAACTAGCATGGA SV01574/SCAR TGACGCATGGAATGAAATAAA GCATGGCCAAGGTCGAATA SV061092/SCAR ACGCCCAGGTATCATATACACC ACGCCCAGGTTACGAAGTCA CAPS2/CAPS CAATTTTGGTTTCTTTGGATGG TTTCGAGGTTAGAGGTTTGTCA Taq1 Table 4. Selection markers of the Fom-2 resistance gene Name and type of marker Primer 5’- 3’ AM/SCAR CTTCATCACTATTCGAGGATGAC CTTTCTGCACACCAACCAAAAGG FM/SCAR GAAGATGCAAAGAAAAAGAGAAGG TCAATTATTAAACATTCTGATGCC CAPS2/CAPS GGAAGTGAGGTGTTGAATT TACACATTGGTCCGTTAGAC EcoR1 CAPS3/CAPS AGACGTAGCATTGCTTCTCTAG TGGCATCCTTCAGCACCTTC Xba1 3 Restriction enzyme Çetin, A.N., Uncu, A.T., Şen, F., Erdeğer, Ş.N. and Türkmen, Ö. (2021). Alınteri Journal of Agriculture Sciences 36(1): 01-06 use resistant varieties. However, this disease factor has 4 different strains and these strains are controlled by two different genes. For fusarium resistance, these two genes have to be present in the plant (Ünlü et al., 2009). Various resistance zones belonging to different Fusarium oxysporum f. sp. melonis strains that vary according to pathogen strains which have been reported so far were determined in the melon genome. As the conclusion of molecular genetic studies conducted, 2 dominant resistance loci have been specified. These loci are Fom-1 and Fom-2 gene sections respectively (Zink, 1992; Champaco, 1992; Pitrat, 1996; Alvarez et al., 2005). In our study, it has been detected that 23 genotypes have resistance alleles against these two Fusarium oxysporum f. sp. melonis (for Fom-1 and Fom-2) strains. For Fom-1, there are resistance alleles in 46 sequences in total and while 30 genotypes have homozygous resistance alleles, 16 of these have heterozygous resistance alleles. Considering Fom-2, 69 genotypes have homozygous resistance alleles while 16 have heterozygous resistance out of 75 total (Table 5). Results and Discussion Determining Fusarium Oxysporum f. sp. Melonis (Fom) Resistance Fusarium oxysporum f. sp. melonis (Fom) is an important pathogen that limits fertility in melons. In plants, fusarium oxysporum reaches xylem pipes by affecting root systems and passing through epidermis and cortex tissues, and after this step, it uses xylem as a vessel to root into the plant (Bishop & Cooper, 1983). While the fungus is within the xylem, it forms mycelium spores and these microspores can move through the plant along xylems. Thus, the factor spreads through the plant. The fungus causes lesions, chlorosis and wilt by releasing lytic enzymes and toxins (Perl -Treves, R. et al., 2010). The disease may affect on melon plants throughout their growth period, making it impossible to yield produce in cultivation areas where infection is profound. Although physical and biological struggle along with cultural measures have a decreasing effect, these are not enough to provide necessary containment. The most effective method against to this soil-based pathogen is to Table 5. Disease testing results Name of Genotype Fom-1 Fom-2 ZYMV Name of Genotype Fom-1 Fom2 ZYMV Name of Genotype Fom-1 Fom-2 ZYMV 1 RR RR rr 67 rr RR rr 133 rr RR rr 2 rr rr rr 68 rr RR rr 134 RR RR rr 3 rr rr rr 69 RR RR rr 135 Rr RR rr 7 Rr RR rr 73 rr rr rr 136 rr RR rr 9 RR RR rr 75 rr RR rr 137 RR Rr rr 10 rr RR rr 77 RR RR rr 138 rr RR rr 11 RR Rr rr 78 rr RR rr 139 RR RR rr 16 rr RR rr 81 rr rr rr 141 rr RR rr 17 RR RR rr 83 RR RR rr 142 rr rr rr 18 Rr RR rr 85 rr rr rr 147 RR RR rr 21 Rr RR rr 86 RR Rr rr 150 RR RR rr 22 Rr RR rr 87 RR RR rr 151 rr RR rr 24 rr rr rr 89 RR RR rr 152 rr RR rr 25 RR RR rr 92 RR Rr rr 154 RR RR rr 27 RR Rr rr 94 rr RR rr 157 RR RR rr 29 Rr RR rr 95 rr rr rr 158-1 RR RR rr 30 Rr RR rr 100 rr RR rr 158-2 RR RR rr 38 Rr rr rr 102 rr RR rr 160 rr RR rr 41 rr RR rr 105 Rr RR rr 162 rr RR rr 43 RR Rr rr 106 Rr RR rr 164 rr RR rr 44 rr RR rr 106-1 Rr RR rr 165 Rr RR rr 45 rr RR rr 107 Rr RR rr 170 Rr RR rr 46 rr rr rr 108 rr RR rr 180 rr RR rr 53 rr RR rr 113 rr RR rr 186 RR RR rr 57 rr RR rr 114 rr RR rr 208 Rr RR rr 61 rr RR rr 117 RR RR rr 214 RR RR rr 63 rr rr rr 118 RR RR rr 218 rr RR rr 64 rr rr rr 125 RR RR rr 220 rr RR rr 66 Rr RR rr 129 RR RR rr yakup RR RR rr 4 Çetin, A.N., Uncu, A.T., Şen, F., Erdeğer, Ş.N. and Türkmen, Ö. (2021). Alınteri Journal of Agriculture Sciences 36(1): 01-06 studies have been conducted for 15 years (Tanksley, 1983). Especially in melon selection studies, many scientific studies have proved that MAS applications are much faster, reliable and cheaper than phenotypic selection or biochemical analysis (Şensoy, 2005; Sığva, 2008; Sarı et al., 2009). Listing the variations within grown species and distribution of these variations are extremely important for selection programs (Bliss, 1981). In the context of this study, due to the fact that current melon gene pool is to be used as selection material, consistency of melon population was determined by characterizing the gene pool with molecular markers (Figure 1). Considering the homogeneity among the genotypes, it has been observed that 29 genotypes have a consistency level of 85-95%(Table 6). Determining ZYMV (Zucchini Yellow Mosaic Virus) Resistance ZYMV (Zucchini Yellow Mosaic Virus) that originates from potyvirus is the primary cause of fertility loss in melon production (Lisa & Lecoq, 1984).As Danin-Poleg et al. reported in 1997, ZYMV resistance in melons is controlled by three loci and lack of allele even in only one of these three genome zones breaks the resistance. Two loci found for ZYMV resistance are respectively Zym-1 and Zym-2. In this study, these three loci were used for molecular genetic selections. At the end of the study, all genotypes were found susceptible to ZYMV (Table 5). Determining the Levels of Homogeneity Melon is one of the first garden plants that Marker Assisted Selection (MAS) was implemented on and these Table 6. The levels of homogeneity Name of Genotype The Levels of Homogeneity Name of Genotype The Levels of Homogeneity Name of Genotype The Levels of Homogeneity Name of Genotype The Levels of Homogeneity 1 %85-90 53 %75-80 102 %75-80 151 %75-80 2 %75-80 57 %80-83 105 %80-85 152 %55-65 3 %75-80 61 %75-80 106 %75-80 154 %65-68 7 %75-80 63 %70-75 106-1 %85-90 157 %85-90 9 %80-85 64 %80-85 107 %85-90 158-1 %85-90 10 %80-85 66 %60-70 108 %80-85 158-2 %88-90 11 %85-90 67 %80-85 113 %90-93 160 %75-80 16 %85-90 68 %55-60 114 %85-90 162 %70-75 17 %90-95 69 %85-90 117 %85-90 164 %65-68 18 %75-80 73 * 118 %85-90 165 %75-80 21 %75-80 75 %85-90 125 * 170 %75-80 22 %65-70 77 %75-80 129 %80-85 180 %90-94 24 %70-75 78 %85-90 133 %80-85 186 %85-90 25 %85-90 81 %75-80 134 %70-75 208 * 27 %90-93 83 %85-90 135 %75-80 214 %55-60 29 * 85 %80-85 136 %60-70 218 * 30 %75-80 86 %85-90 137 %75-80 220 * 38 %75-80 87 %85-90 138 %75-80 yakup * 41 %80-85 89 * 139 %60-70 43 %80-85 92 %85-90 141 %75-80 44 %85-90 94 %85-90 142 %90-95 45 %85-90 95 %55-60 147 %75-80 46 %75-80 100 %75-80 150 %85-90 Conclusion MAS studies in melon disease resistance selection have been completed successfully using molecular markers belonging to these two diseases. The study will facilitate detecting the existence of Zym-1and Zym-2 and Fom-1, Fom-2 genome zones which need to be selected with molecular markers and further research into gene pyramiding that will be conducted by using molecular selection in studies that aim to develop new melon species. This study will also act as a road map for more efficient usage of valuable melon genetic resources. References Alvarez, J.M., González-Torres, R., Mallor, C., and GómezGuillamón, M.L., 2005. Potential Sources of Resistance to Fusarium Wilt and Powdery Mildew in Melons. Hort Science, 40(6):1657-1660. https://doi.org/10.21273/HORTSCI.40.6.1657 Atalmış, F., 2007. Studies on Morphological and Molecular Identification of Melon Varieties in Aegean Region. Master Thesis. Ege University, İzmir, Turkey. 5 Çetin, A.N., Uncu, A.T., Şen, F., Erdeğer, Ş.N. and Türkmen, Ö. (2021). Alınteri Journal of Agriculture Sciences 36(1): 01-06 Bishop, C.D., and Cooper, R.M., 1983. An Ultrastructural Study of Vascular Colonization in Three Vascular Wilt Diseases, 1. Colonization of Susceptible Cultivars. Physiological Plant Pathology, 23(3): 323–343. Populations. The American Genetics, 67(1): 170-181. Baştaş, K.K., 2005. Prevalence of Melon Disease and Pathogenicity of Isolated Species in Konya Province. Selcuk Faculty of Agriculture Journal, 19(37): Saal, B., and Wricke, G. 1999. Development of Simple Sequence Repeat Markers in Rye (Secale cereale L.). Genome, 42(5): 964-972. https://doi.org/10.1139/g99-052 Champaco, E.R., Martyn, R.D., and Miller, M.E., 1992. Evaluation of Muskmelon Germplasm for Resistance to Fusarium Wilt. Subtropical Plant Science, 45: 39–42. Sarı, N., Solmaz, I., Yetisir, H., Ekiz, H., and Yucel, Y., 2009. New Fusarium Wilt Resistant Melon (Cucumis melo var. Cantalupensis) Varieties Developed by Dihaploidization. Acta Horticulturae, 871: 267-272. https://doi.org/10.17660/ActaHortic.2010.871.35. Danin-Poleg, Y., Paris, H.S., Cohen, S., Rabinowitch, H.D., and Karchi, Z., 1997. Oligogenic inheritance of resistance to Zucchini yellow mosaic virus in melons. Euphytica, 93(3): 331-337. Sarı, N., Solmaz, I., Kıllı, O., Kasapoğlu, S., and Gürsoy, I., 2010. Morphological Characterization of Yuvave Kırkağaç Melon Pure Lines Developed by Dihaploidization Technique. VIII. sebzetarımısempozyu me, Van, Turkey, 195-200. https://doi.org/10.1023/A:1002944432083 2017. Production Quantity http://www.fao.org/faostat/en/#data Human Ritschel, P.S., De Lima Lins, T.C., Tristan, R.L., Buso, G.S.C., Buso, J.A., and Ferreira, M.E., 2004. Development of Microsatellite Markers FromAn Enriched Genomic Library for Genetic Analysis of Melon (Cucumis melo L.). BMC Plant Biology, 4: 9. https://doi.org/10.1186/1471-2229-4-9. Bliss, F.A., 1981. Utilization of Vegetable Germplasm. Hort Science, 16: 129–132. FAO. of https://doi.org/10.1086/302959. https://doi.org/10.1016/0048-4059(83)90018-8 Boyraz, N., and Salvation Fusarium University 100-105. Journal Data. Şensoy, S., 2005. Türkiye'dekikav's genotype in the present genetic Varyasyonunv Important Some Fungal Disease Investigation with Acquired Resistance to the Fenotipikv Molecular Road. Ph.D Thesis. YüzüncüYıl University. Van, Turkey. Hu, J., Wang, P., Su, Y., Wang, R., Li, Q., and Sun, K., 2015. Microsatellite Diversity, Population Structure, and Core Collection Formation in Melon Germplasm. Plant Molecular Biology Reporter, 33(3): 439-447. https://doi.org/10.1007/s11105-014-0757-6 Sığva, H.Ö., 2008. Determination of Genetic Diversity and Antioxidant Content of National Melon (Cucumis melo) Collection. Master Thesis. Izmir Institute of Technology. Izmir Turkey. Konieczny, A., and Ausubel, F.M., 1993. A procedure for mapping Arabidopsis mutations using co‐dominant ecotype‐specific PCR‐based markers. The plant journal, 4(2): 403-410. Tanksley, S.D., 1983. Molecular markers in plant breeding. Plant Molecular Biology Reporter, 1(1): 3-8. Lisa, V., and Lecoq, H., 1984. Zucchini Yellow Mosaic Virus. CMI/AA B Descriptions of Plant Viruses, No. 282. Nei, M., and Li, W.H., 1979. Mathematical Model for Studying Genetic Variation in Terms of Restriction Endonucleases. Proceedings of the National Academy of Sciences, 76(10): 5269-5273. TÜİK. 2018. Herbal Production Statistics. Ünlü, M., Ertok, R., and Fırat, A.F., 2009. Fusarium Oxysporum F. Sp. Potential of Two Melon Pure Lines to be used as rootstock. Western Mediterranean Agricultural Research Institute Derim Journal, 26(2): 20-29. https://doi.org/10.1073/pnas.76.10.5269. Périn, C., Hagen, L.S., DeConto, V., Katzir, N., Danin-Poleg, Y., Portnoy, V., Baudracco-Arnas, S., Chadoeuf, J., Dogimont, C., and Pitrat, M., 2002. A Reference Map of Cucumis Melo Based on Two Recombinant Inbred Line Populations. Theoretical and Applied Genetics, 104(6-7): 1017-1034. Zink, F.W., 1992. Genetics of resistance to Fusarium oxysporum f. sp. melonins races 0 and 2 in muskmelon cultivars Honey Dew, Iroquois, and Delicious 51. Plant disease, 76(2): 162-166. https://doi.org/10.1007/s00122-002-0864-x. Perl-Treves, R., Zvirina, R.T., Hermana, R., Brotman, Y., Denisovc, Y., Belausov, E., and Freeman, S., 2010. Differential Colonization and Defence Responses of Resistant and Susceptible Melon Lines Infected By Fusarium Oxysporum Race 1,2. Plant Pathology, 59(3): 576-585. https://doi.org/10.1111/j.1365-3059.2009.02225.x. Pitrat, M., Risser, G., Bertrand, F., Blancard, D., and Lecoq, H., 1996. Evaluation of A Melon Collection for Disease Resistances. In 5. Eucarpia Meeting on Cucurbit Genetics and Breeding, Málaga, Spain, 49-58. Pritchard, J.K., Stephens, M., Rosenberg, N.A., and Donnelly, P., 2000. Association Mapping in Structured 6