Content uploaded by Lars Chatrou
Author content
All content in this area was uploaded by Lars Chatrou
Content may be subject to copyright.
545
Wang & al. • Molecular phylogenetics of Dasymaschalon and all ied genera
TAX O N
61 (3) • June 2012: 545–558
INTRODUCTION
The genus Dasymaschalon (Hook. f. & Thomson) Dalla
Torre & Harms (Fig. 1A–C, H, I) comprises ca. 27 species of
small trees and shrubs (except D. grandif lorum Jing Wang,
Chalermglin & R.M.K. Saunders, which is a climber), with
a centre of diversity in continental Southeast Asia (Wang
& al., 2009). Molecular phylogenetic studies indicate that
Dasymaschalon is part of a well-supported subclade of tribe
Uvarieae in Annonaceae subfam. Annonoideae (the desmoid
clade), which also includes the genera Desmos Lou r. (Fig. 1D,
E, J), Friesodielsia Steenis (Fig. 1F, K) and Monanthotaxis
Baill. (Fig. 1G, L) (Richardson & al., 2004; Couvreur & al.,
2011; Chatrou & al., 2012). This is corroborated by palyno-
logical data, which shows that these genera have a putatively
synapomorphic inaperturate pollen type with a thin exine
and echinate ornamentation (Walker, 1971; Le Thomas, 1980,
1981; Bygrave, 2000; Doyle & Le Thomas, 2012). The majority
of species within the desmoid clade are furthermore character-
ized by monocarps with distinct constrictions between neigh-
bouring seeds and glaucous abaxial leaf surfaces. Molecular
phylogenetic studies by Richardson & al. (2004) and Couvreur
& al. (2011) indicate a close relationship of Dasymaschalon
and Desmos with Asian species of Friesodielsia, while Af rican
Friesodielsia species were inferred to be more closely related
to the African genus Monanthotaxis. These studies did not
result in nomenclatural changes, however, because of limited
species sampling (less than 5% of the ca. 170 species in the
desmoid clade), highlighting the need for molecular phyloge-
netic studies based on a denser taxon sampling.
Flower morphology readily distinguishes Dasymaschalon
from closely related genera. Unlike those of the vast majority
of Annonaceae, the flowers of Dasymaschalon only have one
whorl of three petals (Fig. 1A–C); these petals are alternately
A plastid DNA phylogeny of Dasymaschalon (Annonaceae) and
allied genera: Evidence for generic non-monophyly and the parallel
evolutionary loss of inner petals
Jing Wang,1 Daniel C. Thomas,1 Yvonne C.F. Su,1,2 Svenja Meinke,3 Lars W. Chatrou4
& Richard M.K. Saunders1
1 School of Biological Sciences, T he University of Hong Kong, Pokfulam Road, Hong Kong, P.R. China
2 Current address: Duke-NUS Graduate Medical School Singapore, 8 College Road, Singapore 169857
3 Netherlands Centre for Biodiversity Naturalis (section NHN), Leiden University, P.O. Box 9514, 2300 RA, Leiden, The Netherlands
4 Wageningen Universit y, Biosystematics Group, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands
Jing Wang and Daniel C. Thomas contributed equally to this work.
Authors for correspondence: Daniel C. Thomas, dthomas@hku.hk; Richard M.K. Saunders, saunders@hku.hk
Abstract
Dasymaschalon and the closely related genera Desmos, Friesodielsia and Monanthotaxis together comprise ca.
170 species of trees, shrubs and woody climbers distributed in tropical Africa and tropical Asia. These genera form the desmoid
clade, which, because of the presence of diverse flower and fruit syndromes including different types of pollination chambers
and moniliform monocarps, offers an opportunity to investigate potentially ecologically significant shifts in flower and fruit
characters. Despite its morphological diversity, however, generic delimitation within the desmoid clade is problematic and the
intergeneric relationships of the constituent genera are only poorly understood. Bayesian, maximum likelihood and maximum
parsimony analyses of plastid DNA sequence data (matK, psbA-trnH, ndhF, rbcL, trnL-F; ca. 5.4 kb; 52 taxa) were used to
clarify phylogenetic relationships within the desmoid clade. The evolution and taxonomic utility of selected fr uit and flower
characters was investigated with likelihood and parsimony ancestral character reconstructions. The results indicate problems
in the current delimitations of Dasymaschalon and Friesodielsia. Friesodielsia as cu r rently cir cumscribe d is polyphylet ic, with
African Friesodielsia species allied to the African genus Monanthotaxis, and only distantly related to Asian representatives.
The majority of Dasymaschalon species form a strongly supported clade, but three species are more closely related to Asian
species of Friesodielsia. Ancestral character reconstructions indicate that seed number and monocarp shape are of limited
value in generic circumscriptions, and that the three-petalled corolla characteristic of Dasymaschalon evolved independently
twice within the desmoid clade. Disruptions to homeotic gene expression or strong selective pressure for a partial enclosure
of the mature stamens and carpels by the corolla are hypothesised to underlie the parallel evolution of pollination chambers
formed by outer petal homologues subsequent to inner petal loss.
Keywords
Annonaceae; character evolution; Dasymaschalon; Friesodielsia; f lower morphology; phylogeny
Supplementary Material
The alignment files are available in the Supplementary Data section of the online version of this
article (http://www.ingentaconnect.com/content/iapt/tax).
546
TAX O N
61 (3) • June 2012: 545–558Wang & al. • Molecular phylogenetics of Dasymaschalon and all ied genera
positioned relative to the sepals and are homologous with the
outer petals of other Annonaceae species. The petals con-
verge apically and the broad petal margins adhere between
contiguous petals, forming a dome over the reproductive organs
(Fig. 1B), often with small basal apertures between the petals
(Fig. 1A). The enclosed floral chamber is likely to function in
the same way as the pollination chambers formed by the in-
ner petals in many other Annonaceae genera (Saunders, 2010,
2012). Another conspicuous character in Dasymaschalon is the
structure of the monocarps, which, if multi-seeded, show dis-
tinct constrictions between neighbouring seeds (Fig. 1H). Such
moniliform monocarps are unusual in Annonaceae, but are also
present in the closely related genus Desmos (Fig. 1J), which
consists of 26 species (Rainer & Chatrou, 2006) of woody
climbers distributed throughout Southeast Asia and northern
Australia. The similarities between Dasymaschalon and Des-
mos with regard to fruit mor pholog y have cau sed considerable
difficulty in identification in the absence of flowers, and, in
combination with similarities in stamen and carpel morphol-
ogy, have led some taxonomists to adopt a broader delimita-
tion of Desmos, inclusive of Dasymaschalon (Sinclair, 1955;
Maxwell, 1989; Li, 1993). Unlike those of Dasymaschalon,
however, Desmos flowers have two whorls of three petals, and
the inner petals are basally constricted around the reproductive
organs, forming a partially enclosed pollination chamber, with
the apical parts of the petals splayed outwards (Fig. 1D, E).
Dasymaschalon furthermore mainly comprises small trees,
whereas Desmos species are woody climbers. Based on these
differences in growth habit and floral morphology most authors
have treated Dasymaschalon and Desmos as distinct genera
(Wang & al., 2009, and references therein).
The present study was initially intended to clarify the phy-
logenetic relationships of Dasymaschalon within the desmoid
clade. Preliminary phylogenetic analyses of DNA sequence
data, however, surprisingly retrieved different species of the
genus within different clades, indicating a close relationship
of some Dasymaschalon species with Asian species of Frieso-
dielsia. There are thus several open questions with regard to the
phylogenetic relationships and systematics of Dasymaschalon
and the other constituent genera of the desmoid clade, which
require clarification: (1) Is Dasymaschalon in its current cir-
cumscription monophyletic, and does the single petal whorl
characteristic of the genus represent a synapomorphy of the
ca. 27 species placed in Dasymaschalon ? (2) Is Friesodielsia
polyphyletic as indicated in previous molecular phylogenetic
studies (Richardson & al., 2004; Couvreur & al., 2011), and,
if so, what are the phylogenetic affinities of its segregates? (3)
What are the intergeneric relationships within the desmoid
clade? Sequence data of five chloroplast DNA regions (matK,
ndhF, psbA-trnH spacer, rbcL, trnL-F) of 10 outgroup species
and 42 species of the constituent genera of the desmoid clade
were analysed to address these questions. Selected fruit and
flower characters were mapped onto the phylogeny to deter-
mine their utility for taxon circumscription, and to gain insights
into the evolution of flowers and fruits in Dasymaschalon and
allied genera.
MATERIALS AND METHODS
Taxon sampling. —
The dataset comprised 42 species
of the desmoid clade, including the type species of the four
constituent genera (Dasymaschalon dasymaschalum (Blume)
I.M. Turner, Desmos cochinchinensis Lour., Friesodielsia
cuneiformis (Blume) Steenis, Monanthotaxis congoensis
Baill.). Sequence data were obtained for 21 Dasymaschalon
accessions (representing ca. 78% of the species diversity of the
genus), eight accessions of Desmos (ca. 31% of spe cie s), six ac-
cessions of Friesodielsia (ca. 12% of species), and seven species
of Monanthotaxis (ca. 13% of species). Six closely related taxa
of tribe Uvarieae (Fissistigma polyanthoides Merr., Mitrella
kentii Miq., Sphaerocoryne gracilis (Engl. & Diels) Verdc.,
Sphaerocoryne sp., Toussaintia orientalis Verdc., Uvaria
lucida Boj. ex Sweet), and four species of the more distantly
related tribe Monodoreae (Hexalobus salicifolius Engl., Isolona
campanulata Engl. & Diels, Sanrafaelia ruffonammari Verdc.,
Uvariodendron molundense (Diels) R.E. Fr.) were selected as
outgroup based on previous studies (Zhou & al., 2009, 2010;
Couvreur & al., 2011). Existing DNA sequences were down-
loaded from the nucleotide database of the National Centre for
Biotechnology Information (http://www.ncbi.nlm.nih.gov), and
202 sequences were newly generated for this study (voucher
information and GenBank accession numbers are given in the
Appendix).
DNA extraction, amplification and sequencing. —
Genomic DNA was extracted from silica-dried or herbarium
material using the innuPrep Plant DNA Kit (Analytika Jena,
Jena, Germany) following the manufacturer’s instructions, or
using a modified cetyl trimethyl ammonium bromide (CTAB)
method (Doyle & Doyle, 1987; Erkens & al., 2008; Su & al.,
2008). For amplification each 25 μl PCR contained 12.55 μl
of ddH
2
O, 5 μl of 10× reaction buffer, 3 μl of MgCl
2
(25 mM),
0.5 μl dNTPs (10 mM each), 0.75 μl of each forward and re-
verse primer (10 μM), 1.25 μl bovine serum albumin (BSA,
Fig. 1.
Flower and fruit morphology in the desmoid clade (Dasymaschalon, Desmos, Friesodielsia, Monanthotaxis).
A,
Dasymaschalon lomen-
taceum flower, showing the apically connivent petals with basal aperture;
B,
Dasymaschalon trichophorum flower, with proximal petal re-
moved to show pollination chamber and pollinators (
Endaenidius sp., Curculionidae, Coleoptera
), scale bar = 5 mm;
C,
Dasymaschalon filipes
flowers, showing the long, narrow petals;
D,
Desmos chinensis flower;
E,
Desmos chinensis flower, showing basal constrictions of the three
inner petals around the reproductive organs;
F,
Friesodielsia desmoides flower, showing apically connivent inner petals and free outer petals;
G,
Monanthotaxis schweinfurthii flower;
H,
Dasymaschalon dasymaschalum fruit with multi-seeded monocarps;
I,
Dasymaschalon filipes fruit
with 1–2 seeds per monocarp;
J,
Desmos chinensis fruit with multi-seeded monocarps;
K,
Friesodielsia kingii fruit with single-seeded mono-
carps;
L,
Monanthotaxis boivinii fruit with 1–2 seeds per monocarp. — Photographs: A, Richard Saunders; B, D, E, J, Pang Chun Chiu; C, F, H,
I, K, Piya Chalermglin (reprinted with permission from Chalermglin, 2001); G, Thomas L.P. Couvreur; L, Lars W. Chatrou.
◄
547
Wang & al. • Molecular phylogenetics of Dasymaschalon and all ied genera
TAX O N
61 (3) • June 2012: 545–558
548
TAX O N
61 (3) • June 2012: 545–558Wang & al. • Molecular phylogenetics of Dasymaschalon and all ied genera
10 mg/ml), 0.2 μl of Flexitaq DNA polymerase (Promega, Mad-
ison, Wisconsin, U.S.A.) and 1 μl of DNA template. Primers
and protocols for the amplification of the matK, psbA-trnH,
trnL-F and rbcL regions were the same as in Su & al. (2008).
Primers designed by Olmstead & Sweere (1994) and Erkens
(2007) as well as several newly designed primers were used for
amplification of the ndhF region (Table 1). The ndhF amplif ica-
tion profile included template denaturation at 80°C for 5 min
followed by 32 cycles of denaturation at 95°C for 1 min, primer
annealing at 50°C for 1 min, followed by a ramp of 0.3°C/s to
65°C, and primer extension at 65°C for 4 min; followed by a
final extension step at 65°C for 5 min.
Amplifications using DNA extracted from herbarium
specimens frequently required several internal primer pairs
(Su & al., 2008; Table 1), and for some samples amplification
failed or only partial sequences were generated (see Table 2 for
percentages of missing data in each DNA region alignment).
Amplification products were visualized under UV light after
electrophoretic separation on a 1% agarose TBE gel stained
with SYBR Safe gel stain (Invitrogen, Carlsbad, California,
U.S.A.). PCR product purification and amplification using the
BigDye Terminator Cycle Sequencing Kit (Applied Biosys-
tems, Foster City, California, U.S.A.), and sequencing run on an
AB 3730 DNA Analyser (Applied Biosystems) were performed
by BGI (Hong Kong, P.R. China).
Alignment and phylogenetic analyses. —
Sequences
were assembled and edited using Geneious v.5.4.3 (Drum-
mond & al., 2010). The sequences were pre-aligned using the
MAFFT (Katoh & al., 2009) plugin in Geneious using the
automatic algorithm selection and default settings, and sub-
sequently manually checked and optimized. A 13 base pair
(bp) inversion was identified in the psbA-trnH region of five
species (Dasymaschalon filipes (Ridl.) Bân, Isolona campanu-
lata, Monanthotaxis congoensis, Uvariodendron molundense,
Uvaria lucida). These species are only distantly related in phy-
logenetic trees resulting from the analysis of the cpDNA nu-
cleotide data, indicating the homoplasy of this inversion (see
Pirie & al., 2006). This inversion and one mutational hotspot in
the psbA-trnH spacer, collectively ca. 1.2% of the alig ned posi-
tions, were excluded from the analyses because of problematic
homology assessment.
Bayesian and maximum likelihood (ML) phylogenetic re-
constructions were performed using the NSF teragrid applica-
tions of MrBayes v.3.1.2 (Huelsenbeck & Ronquist, 20 01; Ron-
quist & Huelsenbeck, 2003) and RAxML v.7.2.8 (Stamatakis,
2006), respectively, provided by the CIPRES Science Gateway
Table 1.
Primers used for the amplification of the ndhF cpDNA region.
Primer name Primer pair Primer sequence (5′–3′) Source
1F 1, 3 ATGGAACAKACATATSAATATGC Olmstead & Sweere, 1994
972R 1CATCATATAACCCAATTGAGAC Olmstead & Sweere, 1994
972F 2, 6 GTCTCAATTGGGTTATATGATG Olmstead & Sweere, 1994
2110R 2, 8 CCCCCTAYATATTTGATACCTTCTCC Olmstead & Sweere, 1994
584R 3CCTAAGATTCCTAATAATAAACCA This study
451F 4 TGGGAACTAGTGGGAATGTGCTCG This study
689R 4GGCATCAGGCAACCATACATGAAG Erkens, 2007
561F 5 TGGTTTATTATTAGGAATCTTAGG This study
1025R 5GCAGCTCGATAAGAACCTATACCTGG This study
1321R 6ATCCTGCCGCGGAACAAGCT This study
1216F 7 TGTGGTATTCCGCCCCTTGCT This study
1621R 7 TGTCTGACTCATGGGGATATGTGG This study
1598F 8 CCGCATATCCCCATGAGTCGGACA This study
Table 2.
Descriptive statistics of analysed plastid DNA sequence data matrices.
DNA region
Aligned
length
Excluded
sites
% Missing
data
Variable characters (%) Parsimony-informative characters (%)
Entire dataset Ingroup Entire dataset Ingroup
matK 780 0 3.9 123 (15.8) 56 (7.2) 55 (7.1) 34 (4.4)
ndhF 2041 0 25.3 530 (26.0) 218 (10.7) 243 (11.9) 111 (5.4)
psbA-trnH 410 67 5.0 114 (27.8) 69 (16.8) 60 (14.6) 36 (8.8)
rbcL 1342 0 5.3 109 (8.1) 54 (4.0) 45 (3.4) 27 (2.0)
trnL-F 916 0 4.5 129 (14.1) 64 (7.0) 55 (6.0) 30 (3.3)
Combined data 5489 67 12.5 1005 (18.3) 461 (8.4) 458 (8.3) 238 (4.3)
549
Wang & al. • Molecular phylogenetics of Dasymaschalon and all ied genera
TAX O N
61 (3) • June 2012: 545–558
(Miller & al., 2010). Maximum parsimony (MP) analyses were
performed in PAUP* v.4.0b10 (Swofford, 2002).
For the Bayesian analyses three partitioning schemes were
used: (1) five partitions based on DNA region identity; (2) two
partitions based on coding region (matK, ndhF, rbcL, and the
tRNA coding parts of the trnL-F region) and non-coding re-
gion ( psbA-trnH spacer, trnL-trnF spacer, trnL int ron) ident ity;
and (3) the cpDNA regions concatenated and analysed without
partitioning. Best-fitting nucleotide substitution models for
the concatenated matrix and each nucleotide sequence parti-
tion were determined with MrModeltest v.2 (Nylander, 2004)
using the Akaike information criterion (AIC). Overall perfor-
mance of analyses of unpartitioned and partitioned nucleotide
datasets was assessed with Bayes factor comparison imple-
mented in Tracer v.1.5 (Rambaut & Drummond, 2009), which
is based on marginal likelihood estimates using the method by
Newton & Raftery (1994) with modifications by Suchard & al.
(2001). The criterion of 2ln Bayes factor of ≥10 was used as a
benchmark indicating very strong evidence in favour of one
strategy over another (Kass & Raftery, 1995). Four independ-
ent Metropolis-coupled Markov chain Monte Carlo (MCMC)
analyses were run. Each search used three incrementally heated
and one cold Markov chain, a temperature parameter setting of
0.18, and was run for 107 generations and sampled every 1000
generations. The parameters for character state frequencies,
the substit ution rates of the nucleotide substitution models, and
the rate variation among sites were unlinked across partitions.
Preliminary analyses resulted in nonsensically high estimates
of the rate multiplier of some partitions, which has been shown
to be a common phenomenon in partitioned analyses using
MrBayes (Brown & al., 2010; Marshall, 2010). Following rec-
ommendations by Marshall (2010), the mean branch length
prior was set from the default mean (0.1) to 0.01, which reduces
the likelihood of stochastic entrapment in local tree length
optima, and resulted in good convergence and realistic rate
multiplier estimates. Convergence was assessed by using the
standard deviation of split frequencies as convergence index
with values < 0.005 interpreted as indicating good convergence.
Tracer v.1.5 was used to determine whether the MCMC param-
eter samples were drawn from a stationary, unimodal distri-
bution, and whether adequate effective sample sizes for each
parameter (ESS > 200) were reached. Convergence of posterior
probabilities of splits within and between different runs was
visually checked using the Cumulative and Compare functions
in AWTY (Nylander & al., 2008). The initial 25% of samples of
each MCMC run were discarded as bu r n-in, and the post-burn-
in samples were summarized as a 50% majority-rule consensus
tree with nodal support summarized as posterior probabilities
and branch lengths averaged over all post-burn-in trees.
For the ML analyses the dataset was divided into five parti-
tions based on DNA region identity. One thousand inferences
were run from distinct random stepwise addition sequence
MP starting trees under the general time reversible nucleotide
substitution model (GTR; Tavaré, 1986) with among-site rate
variation modelled with a gamma distribution. Subsequently,
1000 non-parametric bootstraps were performed under the
partition data mode.
In the MP searches all characters were treated as unor-
dered, independent, and of equal weight. Gaps were treated
as missing data. A two-stage heu ristic search strategy was ap-
plied. In the first stage, heuristic tree searches were performed
using the following specifications: 1000 replicates with random
taxon sequence addition, tree bisection-reconnection branch-
swapping (TBR), keeping multiple shortest trees found during
branch-swapping (MulTrees = on), saving no more than 10 trees
per replicate, and all other search settings at default values. The
shortest trees found in the first stage were used as starting trees
in the second heuristic search using the same specifications as
in the first stage, except for swapping on all optimal starting
trees in the branch-swapping process (steepest = yes), and a
maximum of 10,000 trees saved. Clade support was estimated
with non-pa ramet ric bootstrapping with 10,000 re plicates with
simple sequence addition, TBR, maximally 10 trees saved per
replicate, and all other settings at default values.
Ancestral character state reconstruction —
Ancestral
morphological character states were reconstructed for two
flower and two fruit characters: (i) occurrence of an inner petal
whorl: 0 = absent; 1 = present; (ii) outer petal shape and leng t h /
width ratio: 0 = ovate, elliptic or triangular (length/width ratio
< 6); 1 = narrowly ovate, narrowly elliptic or narrowly trian-
gular (length/width ratio ≥ 6); (iii) monocarp shape: 0 = mon-
iliform; 1 = not moniliform; (iv) maximum seed number per
monocarp: 0 = 1; 1 = 2; 2 = > 2. Morphology was assessed us-
ing living material and herbarium material deposited in BKF,
CANT, HITBC, HKU, K, KUN, L, NY, P, PE, UC, and WAG.
Ancestral character states were reconstructed using likeli-
hood and parsimony methods implemented in Mesquite v.2.7.5
(Maddison & Maddison, 2011). For the likelihood reconstruc-
tion the Mk1 model (Markov k-state 1 parameter model; Lewis,
2001) was selected. Under this model any particular change is
equally probable, and the rate of change is the only parameter.
In the parsimony reconstructions character-state changes were
modelled as unordered. To account for phylogenetic uncertainty
the “Trace over trees” option was used, and the post-burn-in
trees from the MrBayes analyses were selected as input trees.
The 10 outgroup taxa were pruned from the 50% majority-rule
consensus tree from the Bayesian analyses prior to mapping
the reconstructions onto the tree. The results of the likelihood
reconstr uctions were summar ized usi ng the “Average Frequen-
cies across Trees” option estimating for each node the average
likelihood of each state across all trees possessing that node.
The resu lts of the pa rsimony reconst r uctions were summarized
using the “Count Trees with Uniquely Best States” option es-
timating for each node the number of times a single character
is reconstructed as most parsimonious. Reconstructions are
counted as equivocal when two or more states are reconstructed
as equally parsimonious at a particular node.
RESULT S
The concatenated alignment of the 52-taxon dataset con-
sisted of 5489 aligned positions. Descriptive statistics for
the concatenated dataset and its five nucleotide partitions,
550
TAX O N
61 (3) • June 2012: 545–558Wang & al. • Molecular phylogenetics of Dasymaschalon and all ied genera
including the number of aligned positions, the number and
percentage of excluded sites, the percentage of missing data,
the number and percentage of variable sites, and the number
and percentage of potentially parsimony-informative sites, are
given in Table 2.
Nucleotide substitution model selection using the AIC in-
dicated the GTR nucleotide substitution model with among-site
rate variation modelled with a gamma distribution (GTR +
Γ
)
as the best-fitting model for the matK and psbA-trnH parti-
tions. GTR +
Γ
combined with a proportion of invariable sites
(GTR +
Γ + I
) was selected for the ndhF, rbcL, and trnL-F parti-
tions, the non-coding data partition, the coding data partition,
as well as for the concatenated data matrix.
Partitioning considerably improved mean −lnL values in
the Bayesian analyses (mean −lnL
unpartitioned
= 17,679; mean
−lnL
2
partitions = 17,664; mean −lnL
5
partitions = 17,492). Bayes fac-
tor comparison indicated that the analyses using five partitions
based on region identity provided distinctly better explanations
of the data than both analyses using two partitions based on
coding and non-coding DNA region identity and analyses of
the unpartitioned dataset. The subsequent presentation of the
results of the Bayesian analyses is therefore limited to the trees
derived from the analyses using five partitions.
The 50% majority-rule consensus tree resulting from the
Bayesian analyses is shown in Fig. 2. Two main clades can
be distinguished within the strongly supported desmoid clade
(posterior clade probability, PP: 1; ML bootstrap percentage,
BP
ML
: 100; MP bootstrap percentage, BP
MP
: 100): Clade A
(PP: 1; BPML: 98; BPMP: 98) comprises a grade of three Afri-
can species of Friesodielsia and a clade consisting of species
belonging to the African genus Monanthotaxis. Clade A is
sister to clade B (PP: 1; BPML: 83; BPMP: 80), which consists
of all sampled species of Dasymaschalon and Desmos, as well
as Asian species of Friesodielsia.
Within clade B, three moderately to strongly supported
subclades can be differentiated (clades B1, B2 and B3), although
relationships among these subclades are not resolved or only
poorly supported. Clade B1 is well suppor ted (PP: 1; BP
ML
: 98;
BP
MP
: 93). It comprises a poorly supported clade of three Asian
Friesodielsia species and a moderately to well supported clade
of three Dasymaschalon species (D. filipes, D. longiflorum
(Roxb.) Finet & Gagnep., D. tibetense X.L. Hou). Clade B2 (PP:
1; BPML: 89; BPMP: 84) includes all eight species of Desmos
sampled. Clade B3 (PP: 1; BPML: 98; BPMP: 98) consists of all
Dasymaschalon species sampled other than those retrieved in
clade B1. The backbone of clade B3 is only poorly resolved
and poorly supported, but four moderately to well supported
subclades can be differentiated.
The results indicate that Friesodielsia is poly phyletic. Afri-
can Friesodielsia spe cies are ret r ieved in clade A and are closely
related to Monanthotaxis, whilst Asian Friesodielsia species fall
in clade B1. Dasymaschalon is not monophyletic as three species
in clade B1 show a closer relationship to Asian Friesodielsia
species than to the major Dasymaschalon clade (B3). Desmos
and Monanthotaxis are supported as monophyletic.
The results of the ancestral character reconstructions are
presented in Figs. 3–4.
DISCUSSION
Intergeneric relationships in the desmoid clade. —
The
present study represents the first molecular phylogenetic analy-
sis of the desmoid clade to be based on a moderately dense
species sampling (ca. 25% of the species diversity of the con-
stituent genera) including samples of the type species of the
four constituent genera. While Desmos and Monanthotaxis are
supported as monophyletic, the analyses reveal problems in the
delimitation of Dasymaschalon and Friesodielsia.
The inferred sister relationship between the African clade
A, including Monanthotaxis and some Friesodielsia species,
and the Asian clade B consisting of Desmos, Dasymaschalon
and some Friesodielsia species is consistent with the results of
the molecular phylogenetic analyses of Couvreur & al. (2011)
and palynological data. The pollen exine of Desmos, Dasy-
maschalon and Asian Friesodielsia species is predominantly
echinate, whereas that of Monanthotaxis and African Frieso-
dielsia species is verrucate to microbaculate (Walker, 1971).
Number of petals per whorl can show a certain degree
of plasticity in some Annonaceae species, e.g., some collec-
tions of D. longif lorum have only two petals per flowe r (Wang
& al., 2009), and changes of petal number within a whorl occur
frequently in Annonaceae and are generally of minor phyloge-
netic significance (Saunders, 2010). In contrast to this, single-
whorled corollas are relatively rare in Annonaceae and have,
apart from Dasymaschalon, evolved in only three other dispa-
rate lineages: within Anaxagorea A. St.-Hil. (subfam. Anax-
agoreoideae), Annickia Setten & Ma a s (subfam. Malmeoideae),
and Annona L. (subfam. Annonoideae) (Saunders, 2010). Given
the rarity of single-whorled, thre e-pet alled corollas in An non-
aceae, and the distinct flower morphology of Dasymaschalon
characterised by a pollination chamber formed by outer petal
homologues, the inferred non-monophyly of the genus is un-
expected. The majority of Dasymaschalon species fall into
one well supported clade (B3), which also includes the type
species of the genus, D. dasymaschalum. Dasymaschalon
could be rendered monophyletic, therefore, by removal of the
strongly supported clade consisting of the three species (D. fil-
ipes, D. longiflorum, D. tibetense) which fall in a strongly
supported clade with Asian Friesodielsia species (clade B1).
The Dasymaschalon species in clade B1 are characterized by
conspicuously long, narrow petals (Fig. 1C). Petal size is vari-
able in Dasymaschalon: D. evrardii has the smallest flowers,
with petals less than 1 cm long, whilst four taxa have petals
longer than 10 cm (D. grandiflorum: ca. 17 cm; D. megalan-
thum (Merr.) Merr.: 3.0–10.5 cm; D. f ilipes: 3.0–15.5 cm; and
D. longiflorum: 5.0–16.5 cm). Petal width does not show such
great variation, ranging from 5 to 35 mm; the resultant petal
length/width ratios are in the range 1.5–6.0 for all species in
clade B3, but 6–17 for those in clade B1 (Figs. 1C, 3B). Dasy-
maschalon filipes, D. longif lorum and D. tibetense also show
maximally two-seeded monocarps, which disti nguishes them
from most species in the genus. They share this character with
closely related Asian Friesodielsia species. However, the seed
number per monocarp is a highly variable character within the
desmoid clade and single-seeded or maximally two-seeded
551
Wang & al. • Molecular phylogenetics of Dasymaschalon and all ied genera
TAX O N
61 (3) • June 2012: 545–558
Dasymaschalon glaucum
Monanthotaxis congoensis
Monanthotaxis trichocarpa
Friesodielsia desmoides
Desmos chinensis
Dasymaschalon filipes
Dasymaschalon acuminatum
Dasymaschalon rostratum
Dasymaschalon trichophorum
Friesodielsia biglandulosa
Monanthotaxis buchananii
Dasymaschalon longiusculum
Desmos wardianus
Uvaria lucida
Dasymaschalon longiflorum
Dasymaschalon oblongatum
Dasymaschalon sootepense
Uvariodendron molundense
Desmos goezeanus
Fissistigma polyanthoides
Dasymaschalon lomentaceum
Monanthotaxis schweinfurthii
Dasymaschalon evrardii
Isolona campanulata
Dasymaschalon tibetense
Desmos cochinchinensis
Dasymaschalon clusiflorum
Desmos dumosus
Dasymaschalon borneense
Friesodielsia enghiana
Hexalobus salicifolius
Sanrafaelia ruffonammari
Dasymaschalon macrocalyx
Sphaerocoryne gracilis
Dasymaschalon dasymaschalum
Desmos elegans
Desmos sp.
Toussaintia orientalis
Mitrella kentii
Friesodielsia obovata
Monanthotaxis glomerulata
Dasymaschalon wallichii
Monanthotaxis fornicata
Friesodielsia cuneiformis
Dasymaschalon obtusipetalum
Desmos dinhensis
Dasymaschalon megalanthum
Dasymaschalon ellipticum
Friesodielsia sp.
Sphaerocoryne sp.
Monanthotaxis whytei
Dasymaschalon robinsonii
1/83/80
0.98/87/65
*/54/*
0.90/*/*
0.94/*/*
1/89/84
1/85/87
1/99/97
1/71/71
0.97/ 87/84
1/99/98
1/100/100
*/58/*
1/100/100
1/91/81
*/73/83
1/99/97
1/100/100
*/57/81
1/79/82
1/100/100
*/58/*
0.93/70/65
1/98/99
1/100/100
1/98/98
1/100/100
0.93/54/51
1/100/100
1/100/100
1/100/86
1/100/100
1/99/99
1/100/100
1/98/93
*/54/58
1/74/61
0.99/79/68
.91/68/88
1/95/93
1/98/98
1/99/98
COR
B2
A
B
B3
B1
Fig. 2.
Bayesian 50% majority-rule
consensus tree (cpDNA data: matK,
ndhF, psbA-trnH, rbcL, trnL-F; 52 taxa).
Bayesian posterior probability (PP) sup-
port values > 0.9 and bootstrap support
values > 50 of the maximum likeli-
hood (BPML) and maximum parsimony
(BPMP) analyses are indicated at each
node: PP/BPML/BPMP. Broken lines indi-
cate branches which lead to nodes with
a PP < 0.95 and/or BP < 70.
552
TAX O N
61 (3) • June 2012: 545–558Wang & al. • Molecular phylogenetics of Dasymaschalon and all ied genera
Fig. 3.
Ancestral character reconstructions for the desmoid clade:
A,
inner petal whorl presence/absence and
B,
petal length/width ratio. Likeli-
hood reconstructions (LR) are shown on the left
(A1, B 1)
; parsimony reconstructions (PR) on the right
(A2, B 2)
. Character reconstructions across
30,000 Bayesian input trees are summarised and mapped on the Bayesian majority-rule consensus tree (cpDNA data: matK, ndhF, psbA-trnH,
rbcL, trnL-F; 52 taxa). Pie charts in the likelihood reconstructions at each node show the percentage of node absence in the input trees and the
average likelihood received by each state across all input trees possessing that node. Pie charts in the parsimony reconstr uctions show the per-
centage of node absence, and the percentage of reconstructions of a single most parsimonious character at each node (reconstructions are counted
as equivocal when two or more states are reconstructed as equally parsimonious).
M. fornicata
M. trichocarpa
M. schweinfurthii
M. buchananii
M. whytei
M. congoensis
M. glomerulata
F. obovata
F. sp.
F. enghiana
Da. robinsonii
Da. lomentaceum
Da. wallichii
Da. dasymaschalum
Da. evrardii
Da. megalanthum
Da. oblongatum
Da. glaucum
Da. trichophorum
Da. macrocalyx
Da. ellipticum
Da. clusiflorum
Da. borneense
Da. sootepense
Da. obtusipetalum
Da. acuminatum
Da. rostratum
Da. longiusculum
De. dumosus
De. cochinchinensis
De. dinhensis
De. chinensis
De. sp.
De. wardianus
De. goezeanus
De. elegans
F. biglandulosa
F. cuneiformis
F. desmoides
Da. tibetense
Da. filipes
Da. longiflorum
A1) Inner petal whorl (LR)
Present
Absent
Node absent
M. fornicata
M. trichocarpa
M. schweinfurthii
M. buchananii
M. whytei
M. congoensis
M. glomerulata
F. obovata
F. sp.
F. enghiana
Da. robinsonii
Da. lomentaceum
Da. wallichii
Da. dasymaschalum
Da. evrardii
Da. megalanthum
Da. oblongatum
Da. glaucum
Da. trichophorum
Da. macrocalyx
Da. ellipticum
Da. clusiflorum
Da. borneense
Da. sootepense
Da. obtusipetalum
Da. acuminatum
Da. rostratum
Da. longiusculum
De. dumosus
De. cochinchinensis
De. dinhensis
De. chinensis
De. sp.
De. wardianus
De. goezeanus
De. elegans
F. biglandulosa
F. cuneiformis
F. desmoides
Da. tibetense
Da. filipes
Da. longiflorum
B1) Petal length/width ratio (LR)
< 6:1
≥ 6:1
Node absent
B2
A
B
B1
B3
Present
Absent
Equivocal
Node absent
B2
A
B
B1
B3
< 6:1
≥ 6:1
Node absent
A2) Inner petal whorl (PR)
B2) Petal length/width ratio (PR)
553
Wang & al. • Molecular phylogenetics of Dasymaschalon and all ied genera
TAX O N
61 (3) • June 2012: 545–558
Fig. 4.
Ancestral character reconstructions for the desmoid clade:
A,
monocarp shape and
B,
maximum seed number per monocarp. Likelihood
reconstructions (LR) are shown on the left
(A1, B 1)
; parsimony reconstructions (PR) on the right
(A2, B 2)
. Charact er re const r uct ions across 30,0 00
Bayesian input trees are summarised and mapped on the Bayesian majority-rule consensus tree (cpDNA data: matK, ndhF, psbA-trnH, rbcL,
trnL-F; 52 taxa). Pie charts in the likelihood reconstructions at each node show the percentage of node absence in the input trees and the average
likelihood received by each state across all input trees possessing that node. Pie charts in the parsimony reconstructions show the percentage
of node absence, and the percentage of reconstructions of a single most parsimonious character at each node (reconstructions are counted as
equivocal when two or more states are reconstructed as equally parsimonious).
M. fornicata
M. trichocarpa
M. schweinfurthii
M. buchananii
M. whytei
M. congoensis
M. glomerulata
F. obovata
F. sp.
F. enghiana
Da. robinsonii
Da. lomentaceum
Da. wallichii
Da. dasymaschalum
Da. evrardii
Da. megalanthum
Da. oblongatum
Da. glaucum
Da. trichophorum
Da. macrocalyx
Da. ellipticum
Da. clusiflorum
Da. borneense
Da. sootepense
Da. obtusipetalum
Da. acuminatum
Da. rostratum
Da. longiusculum
De. dumosus
De. cochinchinensis
De. dinhensis
De. chinensis
De. sp.
De. wardianus
De. goezeanus
De. elegans
F. biglandulosa
F. cuneiformis
F. desmoides
Da. tibetense
Da. filipes
Da. longiflorum
B1) Maximum seed
number/monocarp (LR)
1
2
> 2
Unknown
Node absent
B2
A
B
B1
B3
Moniliform
Non-moniliform
Unknown
Equivocal
Node absent
M. fornicata
M. trichocarpa
M. schweinfurthii
M. buchananii
M. whytei
M. congoensis
M. glomerulata
F. obovata
F.
sp.
F. enghiana
Da. robinsonii
Da. lomentaceum
Da. wallichii
Da. dasymaschalum
Da. evrardii
Da. megalanthum
Da. oblongatum
Da. glaucum
Da. trichophorum
Da. macrocalyx
Da. ellipticum
Da. clusiflorum
Da. borneense
Da. sootepense
Da. obtusipetalum
Da. acuminatum
Da. rostratum
Da. longiusculum
De. dumosus
De. cochinchinensis
De. dinhensis
De. chinensis
De.
sp.
.
De. wardianus
De. goezeanus
De. elegans
F. biglandulosa
F. cuneiformis
F. desmoides
Da. tibetense
Da. filipes
Da. longiflorum
A1) Monocarp shape (LR)
Moniliform
Non-moniliform
Unknown
Node absent
B2
A
B
B1
B3
1
2
> 2
Unknown
Equivocal
Node absent
A2) Monocarp shape (PR)
B2) Maximum seed
number/monocarp (PR)
554
TAX O N
61 (3) • June 2012: 545–558Wang & al. • Molecular phylogenetics of Dasymaschalon and all ied genera
monocarps occur in several other groups, including subclades
of the major Dasymaschalon clade (Fig. 4B).
The congeneric status of African and Asian Friesodielsia
species has been questioned in palynological (Walker, 1971),
macromorphological (Verdcourt, 1971; Heusden, 1992) and
molecular phylogenetic studies (Bygrave, 2000; Richardson
& al., 2004; Couvreur & al., 2011). Palynological data (Walker,
1971) indicated that African Friesodielsia species with coarsely
verrucate pollen exines are not congeneric with Asian Frieso-
dielsia species, which have echinate pollen. Verdcourt (1971)
used macromorphological data to differentiate the monotypic
African subgenus Amblymitra Verdc. (Friesodielsia obovata
(Benth.) Verdc.), the small African subgenus Oxymitropsis
Verdc. (Friesodielsia enghiana (Diels) Verdc. ex Le Thomas,
F. hirsuta (Benth.) Steenis, F. velutina (Sprague & Hutch.)
Steenis) and the large African-Asian subgenus Friesodielsia
(the remaining species) in Friesodielsia. He stressed that Asian
and African species in F. subg. Friesodielsia may not be con-
generic, outlining the morphological differences: Asian Frieso-
dielsia species have elongate f lowers with outer petals that are
much longer than the inner, and monocarps with one or two
seeds, whilst African Friesodielsia species have wider flow-
ers with less marked difference in shape and size between the
inner and outer petals, and monocarps with one to five seeds.
Verdcourt (1971) also noted that morphological differences
between the small African subgenera (subg. Amblymitra, subg.
Oxymitropsis) and subg. Friesodielsia may warrant separation
of the former as distinct genera, although he refrained from
formalizing this. The hypotheses of a distant relationship be-
tween the African and Asian species of the genus were later
supported by molecular phylogenetic analyses by Richardson
& al. (2004), Couvreur & al. (2011) and Chatrou & al. (2012),
which included six, five and eight species of genera of the
desmoid clade, respectively. The phylogenetic analyses of rbcL
and trnL-F sequence data presented in the unpublished dis-
sertation by Bygrave (2000) included a slightly denser taxon
sampling (14 species from the desmoid clade), but while the
desmoid clade was strongly supported, most internal relation-
ships received only poor bootstrap support. In Bygrave’s analy-
ses, the African species Friesodielsia gracilipes (Benth.) Ste e -
nis (F. subg. Friesodielsia), however, was shown to be closely
related to Cleistochlamys Oliv., Sphaerocoryne (Boerl.) Scheff.
ex Ridl., and Toussaintia Boutique rather than the desmoid
clade (Bygrave, 2000). The analyses presented here corroborate
previous hypotheses of the polyphyletic status of Friesodiel-
sia and provide some new insights into the relationships of
the genus. African species in F. subg. Amblymitra and subg.
Oxymitropsis fall into a strongly supported clade with Monan-
thotaxis, and are only distantly related to Asian representatives
of Friesodielsia subg. Friesodielsia, including the type species
of the genus, F. cuneiformis. Asian Friesodielsia species fall
into a well supported clade with three species of the Asian
genus Dasymaschalon (D. filipes, D. longiflorum, D. tibetense).
Morphological character evolution in Dasymaschalon.
—
The basic floral architecture in Annonaceae includes two
whorls of three petals, although changes in petal number
(arising from the gain or loss of either single petals or entire
whorls of petals) have been extensively reported (reviewed by
Saunders, 2010). Dasymaschalon flower s have only three petals
(Fig. 1A–C), which are interpreted to be homologous with the
outer petals of other Annonaceae species based on their posi-
tion relative to the outer perianth whorl (Fig. 5A). The cha racter
reconstructions presented here indicate that the loss of inner
petals occurred independently in the two Dasymaschalon line -
ages (clades B1 and B3 in Fig. 3A).
Dasymaschalon f lowers are not only unusual in lacking
the inner whorl of petals, but also in the structure and func-
tion of the remaining petals. Although the three petals are
homologous with the outer petals of other Annonaceae, they
are structurally similar to the inner petals of many other An-
nonaceae species, including the closely related Friesodielsia
species (Fig. 1F): they are apically connivent, forming a par-
tially enclosed pollination chamber, and have correspondingly
broad margins that allow adhesion between contiguous petals.
Pollination chambers, although not ubiquitous, are a crucial
feature of the pollination biology of most Annonaceae species.
The suite of morphological changes in the “outer” petals so that
they resemble the pollination chamber-forming inner petals
may indicate strong selective advantages of a corolla partially
enclosing the mature reproductive organs. This provides a po-
tential functional explanation for the evolution of pollination
chambers in the two Dasymaschalon lineages subsequent to
the loss of the inner petals. Alternatively, however, the loss
of the inner petals and the correlated morphological changes
of the outer petals may be non-adaptive and explained by a
disruption to the homeotic control of floral organ identity in
accordance with the “ABC” model of floral genetic control
(Bowman & al., 1991; Coen & Meyerowitz, 1991). This model
has recently been shown to be applicable, albeit in a slightly
modified form, to early-divergent angiosperms, including An-
nonaceae (Kim & al., 2005). It can be hypothesized that the
genetic control of floral organ development in ancestors of the
two Dasymaschalon lineages may have been disrupted, with a
homeotic shift of inner petal to stamen identity, and an associ-
ated shift in the remaining petals from outer petal to inner petal
identity (Saunders, 2010).
The androecia of most Annonaceae f lowers possess an
outermost whorl of six stamens in three pairs (Ronse de Craene
& Smets, 1990; Leins & Erbar, 1996; Xu & Ronse de Craene,
2010), with the pairing either due to the transition between heli-
cal and whorled organ arrangements or due to stamen doubling
associated with differing sizes of petals and stamens (discussed
by Xu & Ronse de Craene, 2010). Dasymaschalon flowers pos-
sess an outermost whorl of four stamens alternately arranged
relative to the petals, with one pair and two solitary stamens
at the corners of a triangular floral meristem (Fig. 5). This
may indicate the gain of an outer whorl of stamens consistent
with the hypothesis of a homeotic shift in organ identity from
inner petals to stamens. Centripetal and centrifugal homeo-
tic shifts of organ identity have been hypothesised to explain
the flower morphology of several other Annonaceae species
(Saunders, 2010). Studies determining homeotic gene expres-
sion patterns in these species are required to further investigate
these hypotheses.
555
Wang & al. • Molecular phylogenetics of Dasymaschalon and all ied genera
TAX O N
61 (3) • June 2012: 545–558
A third possible explanation for the observed pattern of ap-
parently parallel evolution of the complex corolla syndrome in
the two Dasymaschalon clades is reticulation, chloroplast cap-
ture and subsequent diversification. The phylogenetic analyses
in the current study, as in previous studies on the phylogenetics
of Annonaceae, are solely based on cpDNA, so that reticulation
and chloroplast capture cannot be ruled out. This highlights
the need for the development of nuclear markers which work
reliably across Annonaceae.
The gynoecia of species in the desmoid clade are apocar-
pous and the monocarps are usually distinctly stipitate. Varia-
tion in monocarp shape in the desmoid clade is influenced by
the number of seeds per monocarp. In general, single-seeded
monocarps are globose or ellipsoid, whereas multi-seeded
monocarps typically show distinct constrictions between
neighbouring seeds (Fig. 4A, B). In some species single-seeded
and moniliform monocarps occur/are present in the same fruit
(Fig. 1I, L), but this reflects incomplete fertilization of ovules
rather than differences in ovule number.
The constrictions between seeds, and sequential ripening of
the single-seeded units in moniliform monocarps (e.g., Fig. 1J),
enable sequential removal of the single-seeded units from the
monocarp by birds, the primary frugivores, promoting effective
dispersal. Evolutionary changes in seed size are likely to be con-
strained by the beak gape of frugivorous birds. Dasymaschalon
sootepense Craib has the largest seeds in Dasymaschalon (17.5 –
24.0 mm long and 4–5 mm in diameter); although these seeds
are relatively long, their width remains within the maximum
beak gape of common bird frugivores, thereby enabling the
seeds to be swallowed whole and subsequently regurgitated.
Mult iple transitions from mult i-seeded monocar ps to max-
imally two-seeded or single-seeded monocarps are inferred
in the desmoid clade (Fig. 4B). The Asian Friesodielsia spe-
cies have single-seeded or maximally two-seeded monocarps
(e.g., F. kingii, Fig. 1K) distinguishing them from most African
representatives of the genus (Verdcourt, 1971). There is con-
siderable diversity of monocarp morphology and seed number
within all genera of the desmoid clade, however, and while seed
numbers are of considerable diagnostic value at species level,
they have limited utility in generic circumscriptions.
CONCLUSIONS
The genus Dasymaschalon has traditionally been circum-
scribed with the clear diagnostic characteristic of a single petal
whorl and the formation of a pollination chamber by petals
that are homologous to the outer petals of other Annonaceae
genera. The inferred non-monophyly of the genus is surprising
as the two inferred Dasymaschalon lineages share a complex
corolla syndrome. The evolution of this syndrome not only
involves the loss of the inner petal whorl, but a suite of associ-
ated morphological changes are required for the formation of an
“outer” petal pollination chamber that mirrors the inner petal
pollination chambers of other Annonaceae. This phenomenon
may be explained by the strong selective advantages of a corolla
partially enclosing the mature stamens and carpels, or as the
consequence of disruptions to homeotic gene expression with
the loss of inner petals (possibly resulting from a shift in organ
identity from inner petals to stamens, and therefore associated
Fig. 5.
Stamen arrangement in Dasymaschalon trichophorum.
A,
Mature flower with proximal petal removed, exposing stamens and carpels;
two of the outermost stamens indicated by arrows;
B,
flower bud after removal of perianth (scanning electron micrograph); outermost stamens
indicated in colour (scale bar: 0.25 mm). — A, B, Pang Chun Chiu s.n. (HKU). Photographs: A, Pang Chun Chiu; B, Zhou Wanqing.
556
TAX O N
61 (3) • June 2012: 545–558Wang & al. • Molecular phylogenetics of Dasymaschalon and all ied genera
Bowman, J.L., Smyth, D.R. & Meyerowitz, E.M. 1991. Genetic in-
teractions among floral homeotic genes of Arabidopsis. Develop-
ment 112: 1–20.
Brown, J.M., Hedtke, S.M., Lemmon, A.R . & Lemmon, E.M. 2010.
When trees grow too long: Investigating the causes of highly
inaccurate Bayesian branch length estimates. Syst. Biol. 59:
145–161.
Bygrave, P.C. 2000. Molecular systematics of the Annonaceae Juss.
Ph.D. thesis, University of Reading, Reading, U.K.
Chalermglin, P. 2001. Family Annonaceae. Bangkok: Ban & Suan.
Chatrou, L.W., Pirie, M.D., Erkens, R.H.J., Couvreur, T.L.P.,
Neubig, K.M., Abbott, J.R., Mols, J.B., Maas, J.W., Saunders,
R.M.K. & Chase, M.W. 2012. A new subfamilial and tribal clas-
sification of the pantropical flowering plant family Annonaceae
informed by molecular phylogenetics. Bot. J. Linn. Soc. 169: 5– 40.
Coen, E.S. & Meyerowitz, E.M. 1991. The war of the whorls: Genetic
interactions controlling flower development. Nature 353: 31–37.
Couvreur, T.L.P., Pirie, M.D., Chatrou, L.W., Saunders, R.M.K.,
Su, Y.C.F., Richardson, J.E. & Erkens, R.H.J. 2011. Early evo -
lutionary history of the flowering plant family Annonaceae: Steady
with the gain of an additional whorl of stamens), and the ho-
meotic shift in the remaining petals from outer petal to inner
petal identity.
The resu lts of the present study, with en hanced sampling of
taxa and DNA regions, corroborate previous hypotheses of the
polyphyly of Friesodielsia. More extensive taxon sampling and
morphological work will be necessary, however, to clarify (1)
whether the African Friesodielsia species should be transferred
to Monanthotaxis, or the African Friesodielsia-Monanthotaxis
clade should be segregated into two or more genera; and (2)
whether the three orphan Dasymaschalon species (D. filipes,
D. longiflorum, D. tibetense) should be separated as a distinct
genus or merged with Friesodielsia. A phylogenetic frame-
work based on a robust taxon-sample of Friesodielsia will be
essential as a basis for the re-circumscription of genera in the
desmoid clade. In addition, data from nuclear markers is re-
quired to investigate whether hybridisation and chloroplast cap-
ture have occurred in the evolutionary history of the desmoid
clade.
ACKNOWLEDGEMENTS
The research was supported by grants from the Hong Kong
Research Grants Council (HKU 7578/05M), awarded to RMKS and
YCFS, and a University of Hong Kong Research Committee grant,
awarded to RMKS. We are grateful to the curators of CANT, HITBC,
KUN, L, NY, P and WAG herbaria and Bogor Botanic Garden for
providing leaf material; Piya Chalermglin, Pang Chun Chiu, Wang
Ruijiang, Garry Sankowsky, Wisnu H. Ardi and Mark Hughes for
field collections; Sid Surveswaran for sequencing Dasymaschalon
acuminatum; Piya Chalermglin, Pang Chun Chiu, Thomas Couvreur
and Zhou Wanqi ng fo r the use of their photog raph s; Tang Chin Ch eung
for pr imer desig n; Laura Wong fo r tech n ica l assistan ce; and Ji m Doyle,
Thomas Couvreur and Michael Pirie for their constructive comments
on earlier versions of the manuscript.
LITERATURE CITED
diversification and boreotropical geodispersal. J. Biogeogr. 38:
664–680.
Doyle, J. & Doyle, J.L. 1987. A rapid DNA isolation method for small
quantities of fresh tissues. Phytochem. Bull. 19: 11–15.
Doyle, J.A. & Le Thomas, A. 2012. Evolution and phylogenetic sig-
nificance of pollen in Annonaceae. Bot. J. Linn. Soc. 169: 190 –221.
Drummond, A.J., Ashton, B., Buxton, S., Cheung, M., Cooper, A.,
Heled, J., Kearse, M., Moir, R., Stones-Havas, S., Sturrock, S.,
Thierer, T. & Wilson, A. 2010. Geneiou s, ve rsion 5.1. ht tp://w w w
.geneious.com/.
Erkens, R.H.J. 2007. From morphological nightmare to molecular
conundr um. Phylogenetic, evolutionary and ta xonomic studies on
Guatteria (Annonaceae). Ph.D. thesis, Ut recht Univer sit y, Utre cht ,
The Netherlands.
Erkens, R.H.J., Cross, H., Maas, J.W., Hoenselaar, K. & Chatrou,
L.W. 2008. Age and greenness of herbarium specimens as predic-
tor for successful extraction and amplification of DNA. Blumea
53: 407–428.
Heusden, E.C.H. van. 1992. Flowers of Annonaceae: Morphology,
classification, and evolution. Blumea Suppl. 7: 1–218.
Huelsenbeck, J.P. & Ronquist, F. 2001. MrBayes: Bayesian inference
of phylogenetic trees. Bioinformatics 17: 754–755.
Kass, R.E. & Raftery, A.E. 1995. Bayes factors. J. Amer. Statist. Assoc.
90: 773–795.
Katoh, K., Asimenos, G. & Toh, H. 2009. Multiple alignment of DNA
sequences with MAFFT. Meth. Molec. Biol. 537: 39–64.
Kim, S., Koh, J., Yoo, M.J., Kong, H.Z ., Hu, Y., Ma, H., Soltis, P.S.
& Soltis, D.E. 2005. Expression of floral MADS-box genes in
basal angios perms: Implica tions for the evolution of f lor al regula-
tors. Plant J. 43: 724–744.
Le Thomas, A. 1980. Ultrastructural characters of the pollen grains of
African Annonaceae and their significance for the phylogeny of
primitive angiosperms: First part. Pollen & Spores 22: 267–342.
Le Thomas, A. 1981. Ultrastructural characters of the pollen grains of
African Annonaceae and their significance for the phylogeny of
primitive angiosperms: Second part. Pollen & Spores 23: 5–36.
Leins, P. & Erbar, C. 1996. Early floral development studies in An-
nonaceae. Pp. 1–27 in: Morawetz, W. & Winkler, H. (eds.), Re-
productive morphology in Annonaceae. Vienna: Österreichische
Akademie der Wissenschaften.
Lewis, P.O. 2001. A likelihood approach to estimating phylogeny from
discrete morphological character data. Syst. Biol. 50: 913–925.
Li, P.T. 1993. Novelties in Annonaceae from Asia. Guihaia 13: 311–315.
Maddison, W.P. & Maddison, D.R. 2011. Mesqu ite: A mo dula r sys tem
for evolutionary analysis, ve r s ion 2.7.5. http://mesquiteproject.org/
mesquite/mesquite.html.
Marshall, D.C. 2010. Cryptic failure of partitioned Bayesian phylo-
genetic analyses: Lost in the land of long trees. Syst. Biol. 59:
108–117.
Maxwell, J.F. 1989. Botanical notes on the vascular flora of Chiang
Mai Province, Thailand. Nat. Hist. Bull. Siam Soc. 37: 177–185.
Miller, M.A., Pfeiffer, W. & Schwartz, T. 2010. Creating the CIPRES
Science Gateway for inference of large phylogenetic trees. Pp.
1–8 in: Proceedings of the Gateway Computing Environments
Workshop (GCE). New Orleans: IEEE.
Newton, M.A. & Raftery, A.E . 1994. Approximate Bayesian infer-
ence with the weighted likelihood bootstrap. J. Roy. Statist. Soc.,
Ser. B 56: 3–48.
Nylander, J.A.A. 2004. MrModeltest, version 2.3. http://www.abc
.se/~nylander.
Nylander, J.A.A., Wilgenbusch, J.C., Warren, D.L. & Swofford,
D.L. 2008. AWTY (Are we there yet?): A system for graphical
exploration of MCMC convergence in Bayesian phylogenetics.
Bioinformatics 24: 581–583.
Olmstead, R.G. & Sweere, J.A. 1994. Combining data in phylogenetic
syste matics: An empiric al ap proa ch us ing th ree molec ular data set s
in the Solanaceae. Syst. Biol. 43: 467–481.
557
Wang & al. • Molecular phylogenetics of Dasymaschalon and all ied genera
TAX O N
61 (3) • June 2012: 545–558
Appendix.
Species names and GenBank accession numbers of DNA sequences used in this study. Voucher data is given for accessions, for which DNA
sequences were newly obtained, using the following format: Taxon name, country, largest political subdivision, collector(s) and collector number, herbarium
acronym: matK, ndhF, psbA-trnH, trnL-F, rbcL GenBank accession numbers. –: missing data; *: newly generated sequences.
Dasymaschalon acuminatum Jing Wang & R.M.K. Saunders, Thailand, cultivated in the private collection of P. Chalermglin (Bangkok), Chalermglin 490520,
HKU: JQ768546*, JQ768587*, JQ768625*, JQ768666*, JQ768706*. Dasymaschalon borneense Nurmawati, Indonesia, Kalimantan Timur, Ambriansyah &
Ar if i n 1687, L: JQ768547*, –, JQ768626*, JQ768667*, JQ768707*. Dasymaschalon clusiflorum (Merr.) Merr., Philippines, Luzon, Ramos & Edaño 45293,
NY: JQ768548*, –, JQ768627*, JQ768668*, JQ768708*. Dasymaschalon dasymaschalum (Blume) I.M. Turner, Thailand, cultivated in the private collection
of P. Chaler mglin (Bangkok), Saunders 04/26, HKU: JQ768549*, JQ768588*, JQ768628*, JQ768669*, JQ768709*. Dasymaschalon ellipticum Nurmawati,
Brunei, Kalat & al. 15734, L: JQ768550*, JQ768589*, JQ768629*, JQ768670*, JQ768710*. Dasymaschalon evrardii Ast, Vietnam, Annam, Poila ne 9615, P:
JQ768551*, JQ768590*, JQ768630*, JQ768671*, JQ768711*. Dasymaschalon filipes (Rid l.) Bân , Thaila nd, Nakhon Si Thammarat, Van Beusek om & Phengkhlai
835, L: JQ76 8552*, JQ76 8591*, JQ768 631*, JQ76 8672*, JQ768 712*. Dasymaschalon glaucum Merr. & Chun, Thailand, Ratchaburi, Chalermglin 510521, HKU:
JQ768553*, JQ768592*, JQ768632*, JQ768673*, JQ768713*. Dasymaschalon lomentaceum Finet & Gagnep., Thailand, cultivated in the private collection
of P. Chalermglin (Bangkok), Saunders 04/5, HKU: JQ768554*, JQ768593*, JQ768633*, JQ768674*, JQ768714*. Dasymaschalon longiflorum (Roxb.) Finet
& Gagnep., India, Assam, Chand 55 67A , L: JQ768555*, JQ768594*, JQ768634*, JQ768675*, JQ768715*. Dasymaschalon longiusculum (Bân) Jing Wang &
R.M.K. Saunders, Vietnam, Tonkin, Van der Werff & Nguyen 142 92 , L: JQ768556*, –, JQ768635*, JQ768676*, JQ768716*. Dasymaschalon macrocalyx Finet
& Gagnep., Thailand, cultivated in the private collection of P. Chaler mglin (Bangkok), Saunders 04/6, HKU: JQ768557*, JQ768595*, JQ768636*, JQ768677*,
JQ768717*. Dasymaschalon megalanthum (Merr.) Jing Wang & R.M.K. Saunders, Philippines, Luzon, Ramos & Edaño 46641, UC: JQ768596*, JQ768596*,
JQ768637*, JQ768678*, JQ768718*. Dasymaschalon oblongatum Merr., Philippines, Luzon, Merrill 9703, NY: JQ768559*, JQ768597*, JQ768638*, JQ768679*,
JQ768719*. Dasymaschalon obtusipetalum Jing Wang, Chalermglin & R.M.K. Saunders, Thailand, Chiang Rai, Keßler 3271, L: JQ768560*, JQ768598*,
JQ768639*, JQ768680*, JQ768720*. Dasymaschalon robinsonii Ast, Vietnam, Annam, Poilane 6132, P: JQ768561*, –, JQ768640*, JQ768681*, JQ768721*.
Dasymaschalon rostratum Merr. & Chun, China, Guangdong, Wang 0626, HKU: JQ768562*, JQ768599*, JQ768641*, JQ768682*, JQ768722*. Dasymaschalon
sootepense Craib, Thailand, Chiang Mai, Kerr 13 64 , L: JQ768563*, JQ768600*, JQ768642*, JQ768683*, JQ768723*. Dasymaschalon tibetense X.L. Hou,
China, Tibet, Tibet team 74- 4348, KU N: JQ76 85 64*, JQ7686 01*, JQ 7686 43*, JQ76868 4*, JQ768724*. Dasymaschalon trichophorum Merr., China , Guan gdong ,
Wan g 63, HKU: JQ768565*, JQ768602*, JQ768644*, JQ768685*, JQ768725*. Dasymaschalon wallichii (Hook. f. & Thomson) Jing Wang & R.M.K. Saunders,
Malaysia, Johore, David 257, P: JQ768566*, –, JQ768645*, JQ768686*, JQ768726*. Desmos chinensis Lour., China, Hong Kong, Pang N2, HKU: JQ768567*,
JQ768603*, JQ768646*, JQ768687*, JQ768727*. Desmos cochinchinensis Lour., China, Yunnan, Wang 0612, HKU: JQ768568*, JQ768604*, JQ768647*,
JQ768688*, JQ768728*. Desmos dinhensis (Finet & Gagnep.) Merr., Vietnam, Meinke & Chalermglin M EI 013 , L: JQ768569*, JQ768605*, JQ768648*, –,
JQ768729*. Desmos dumosus (Roxb.) Saff., China, Yunnan, Wa ng 068, HKU: JQ768570*, JQ768606*, JQ768649*, JQ768689*, JQ768730*. Desmos elegans
(Thwaites) Saff., Sri Lanka, Galle, Kostermans 24761, L: JQ768571*, –, JQ768650*, JQ768690*, JQ768731*. Desmos goezeanus (F. Muell.) Jessup, Australia,
Queensland, Ford & Cinelli 0478 0, BRI: JQ768572*, JQ768607*, JQ768651*, JQ768691*, JQ768732*. Desmos sp., India, Sasidharan 3132, L: JQ768573*, –,
JQ768652*, JQ768692*, JQ768733*. Desmos wardianus (Bailey) Jessup, Australia, Queensland, Sankowsky 2664, BRI: JQ768574*, JQ768608*, JQ768653*,
JQ768693*, JQ768734*. Fissistigma polyanthoides (A. DC.) Merr., Thai lan d, Keßler 3232, WAG: JQ768575*, JQ768609*, JQ768654*, JQ768694*, JQ768735*.
Friesodielsia biglandulosa (Blume) Steenis, Indonesia, Slik 3809, L: –, JQ768610*, JQ768655*, –, JQ768736*. Friesodielsia cuneiformis (Blume) Steenis,
Indonesia, cultivated at Bogor Botanic Gardens, Ardi 54, HKU: JQ768576*, JQ768611*, –, JQ768695*, JQ768737*. Friesodielsia desmoides (Craib) Steenis,
Thailand, Keßler 3189, WAG: JQ768577*, JQ768612*, JQ768656*, JQ768696*, JQ768738*. Friesodielsia enghiana (Diels) Verdc. ex Le Thomas, Gabon,
Ogooué-Maritime,
Harris 8708, E
: JQ768578*, JQ768613*, JQ768657*, JQ768697*, JQ768739*. Friesodielsia obovata (Benth.) Verdc., U.K., cultivated at the
Royal Botanic Garden Kew, Chase 40526, K: JQ768579*, JQ768614*, JQ768658*, JQ768698*, JQ768740*. Friesodielsia sp., Gabo n, Ogooué -Ivindo, Wieringa
Pirie, M.D., Chatrou, L.W., Mols, J.B., Erkens, R.H. J. & Ooster-
hof, J. 2006. ‘Andean-centred’ genera in the short-branch clade of
Annonaceae: Testing biogeographical hypotheses using phylogeny
reconstruction and molecular dating. J. Biogeogr. 33: 31–46.
Rainer, H. & Chatrou, L.W. 2006. Global taxonomic/nomenclatural
index for the plant family Annonaceae Juss. ht t p://herbar ium.
botanik.univie.ac.at/annonaceae/listTax.php.
Rambaut, A. & Drummond, A.J. 2009. Tracer, version 1.5. http://
beast.bio.ed.ac.uk/Tracer.
Richardson, J.E., Chatrou, L.W., Mols, J.B., Erkens, R.H.J. & Pirie,
M.D. 2004. Historical biogeography of two cosmopolitan families
of flowering plants: Annonaceae and Rhamnaceae. Philos. Trans.,
Ser. B 359: 1495–1508.
Ronquist, F. & Huelsenbeck, J.P. 2003. MrBaye s 3: Bayesian phyloge-
netic inference under mixed models. Bioinformatics 19: 1572 –1574.
Ronse de Craene, L. & Smets, E. 1990. The f loral development of
Popowia whitei (Annonaceae). Nord. J. Bot. 10: 411–420.
Saunders, R.M.K. 2010. Floral evolution in the Annonace ae: Hypoth-
eses of homeotic mutations and functional convergence. Biol. Rev.
Cambridge Philos. Soc. 85: 571–591.
Saunders, R.M.K. 2012. The diversity and evolution of pollination
systems in Annonaceae. Bot. J. Linn. Soc. 169: 222–244.
Sinclair, J. 1955. A revision of the Malayan Annonaceae. Gard. Bull.
Singapore 14: 149–516.
Stamatak is, A. 2006. RAxML-VI-HPC: Maximum likelihood-based
phylogenetic analyses with thousands of taxa and mixed models.
Bioinformatics 22: 2688–2690.
Su, Y.C.F., Smith, G.J.D. & Saunders, R .M.K. 2008. Phylogeny of the
basal angiosperm genus Pseuduvaria (Annonac eae) inferre d from
five chloroplast DNA regions, with interpretation of morphological
character evolution. Molec. Phylogenet. Evol. 48: 188–206.
Suchard, M.A., Weiss, R .E. & Sinsheimer, J.S. 2001. Bayesian selec-
tion of continuous-time Markov chain evolutionary models. Molec.
Biol. Evol. 18: 1001–1013.
Swofford, D.L. 2002. PAUP*: Phylogenetic analysis using parsimony
(*and other methods), version 4.0b10, Sunderland, Massachusetts:
Sinauer.
Tavaré, S. 1986. Some probabilistic and statistical problems in the
analysis of DNA sequences. Pp. 57–86 in: Miura, R.D. (ed.), Some
mathematical questions in biology: DNA sequence analysis. Prov i-
dence, Rhode Island: American Mathematical Society.
Verdcourt, B. 1971. Notes on East African Annonaceae. Kew Bull.
25: 1–34.
Walker, J.W. 1971. Pollen morphology, phytogeography, and phylogeny
of the Annonaceae. Contr. Gray Herb. 202: 1–131.
Wang, J., Chalermgl in, P. & Saunders, R.M.K. 2009. The genus
Dasymaschalon (An non acea e) in Thai land . Syst. Bot. 34: 252–265.
Xu, F. & Ronse de Craene, L. 2010. Floral ontogeny of Annonaceae:
Evidence for high variability in f loral form. Ann. Bot. (Oxford)
106: 591–605.
Zhou, L., Su, Y.C.F., Chalermglin, P. & Saunders, R.M.K. 2010.
Molecular phylogenetics of Uvaria (Annonaceae): Relationships
with Balonga, Dasoclema and Australian species of Melodor um.
Bot. J. Linn. Soc. 163: 33–43.
Zhou, L., Su, Y.C.F. & Saunders, R.M.K. 2009. Molecular phyloge-
netic support for a broader delimitation of Uvaria (Annonaceae),
inclusive of Anomianthus, Cyathostemma, Ellipeia, Ellipeiopsis
and Rauwenhoffia. Syst. Biodivers. 7: 249–258.
558
TAX O N
61 (3) • June 2012: 545–558Wang & al. • Molecular phylogenetics of Dasymaschalon and all ied genera
& al. 3605, WAG: JQ768580*, JQ768615*, JQ768659*, JQ768699*, JQ768741*. Hexalobus salicifolius E ngl .: E U16969 4, EU169 714, EU169 738, EU169761,
EU16 9783. Isolona campanulata Engl. & Diels: AY238963, EF179301, DQ125127, AY238954, AY231287 and AY238947. Mi trella kentii (Blume) Miq.,
Malaysia,
Gardette 2239, L:
FJ743751, JQ768616*, FJ743789, AY841633, AY841711. Monanthotaxis buchananii (Engl.) Verdc., Kenya, Coast, Robertson
7544 , WAG: JQ768581*, JQ768617*, JQ768660*, JQ768700*, JQ768742*. Monanthotaxis congoensis Baill., Netherlands, cultivated at Utrecht Botanic Gar-
den, Chatrou 489, U: JQ768582*, JQ768618*, JQ768661*, JQ768701*, JQ768743*. Monanthotaxis fornicata (Baill.) Verdc., Tanzania, Morogoro, Couvreur
89, WAG: JQ768583*, JQ768619*, JQ768662*, JQ768702*, JQ768744*. Monanthotaxis glomerulata (Le Thomas) Verdc., Gabon, Ogooué-Lolo, Sosef 2016,
WAG: JQ76858 4*, JQ768620*, JQ76 8663*, JQ768703*, JQ76 8745*. Monanthotaxis schweinfurthii (Engl. & Diels) Verdc., Gabon, Ogooué-Ivindo, Sosef 2238,
WAG: JQ768585*, JQ768621*, JQ768664*, JQ768704*, JQ768746*. Monanthotaxis trichocarpa (Engl. & Diels) Verdc., Tanzania, Tanga, Couvreur 14, WAG:
JQ768586*, JQ768622*, JQ768665*, JQ768705*, JQ768747*. Monanthotaxis whytei (Stapf) Verdc.: EF179278, EF179304, EF179315, AY841635, AY841713.
Sanrafaelia ruffonammari Verdc.: EU169703, EU169724, EU169746, EU169768, EU169790. Sphaerocoryne gracilis (Engl. & Diels) Verdc., Kenya, Coast,
Robertson 7554, WAG: EU169688, JQ768623*, EU169732, EU169755, EU169777. Sphaerocoryne sp., Thailand, cultivated in the private collection of P. Chal-
ermglin (Bangkok), Saunders 07/4, HKU: AY518878, JQ768624*, FJ743788, AY319071, AY319185. Toussaintia orientalis Verdc.: EU169689, EU169710,
EU169733, EU169756, EU169778. Uvaria lucida Bent h.: AY23896 6, EF179310 , AY8 41440 , AY238957, AY231290 and AY238950. Uvariodendron molundense
(Diels) R.E. Fr.: EU169707, EU169727, EU169750, EU169772, EU169794.
Appendix.
Continued.
