- Access to this full-text is provided by Pensoft Publishers.
Download available
Content available from Mycokeys
This content is subject to copyright. Terms and conditions apply.
Diaporthalean fungi causing canker and dieback from Mount Dongling in China 67
Diaporthalean fungi associated with canker and
dieback of trees from Mount Dongling in Beijing, China
Haiyan Zhu1, Meng Pan1, Guido Bonthond2, Chengming Tian1, Xinlei Fan1
1 e Key Laboratory for Silviculture and Conservation of Ministry of Education, Beijing Forestry University,
Beijing 100083, China 2 GEOMAR Helmholtz Centre for Ocean Research Kiel, Düsternbrooker Weg 20,
24105, Kiel, Germany
Corresponding author: Xinlei Fan (xinleifan@bjfu.edu.cn)
Academic editor: Kevin Hyde|Received8 July 2019|Accepted 23 September 2019|Published 16 October2019
Citation: Zhu H, Pan M, Bonthond G, Tian C, Fan X (2019) Diaporthalean fungi associated with canker and dieback
of trees from Mount Dongling in Beijing, China. MycoKeys 59: 67–94. https://doi.org/10.3897/mycokeys.59.38055
Abstract
Diaporthales is a fungal order comprising important plant pathogens, saprobes and endophytes on a wide
range of woody hosts. It is often dicult to dierentiate the pathogens in this order, since both the morphology
and disease symptoms are similar among the various species. In the current study, we obtained 15 representa-
tive diaporthalean isolates from six tree hosts belonging to plant families Betulaceae, Fagaceae, Juglandaceae,
Rosaceae, and Ulmaceae from Mount Dongling in China. Six species were identied residing in four families
of Diaporthales (Diaporthaceae, Erythrogloeaceae, Juglanconidaceae and Melanconidaceae). Based on mor-
phological comparison and the phylogenetic analyses of partial ITS, LSU, cal, his3, rpb2, tef1-α and tub2 gene
sequences, we identied ve known species (Diaporthe betulina, D. eres, D. rostrata, Juglamconis oblonga and
Melanconis stilbostoma) and one novel species (Dendrostoma donglinensis). ese results represent the rst study
of diaporthalean fungi associated with canker and dieback symptoms from Mount Dongling in Beijing, China.
Keywords
Ascomycota, Diaporthales, new species, phylogeny, taxonomy
Introduction
Diaporthales is an important order in class Sordariomycetes containing taxa that have
broad host ranges and widely distributed as plant pathogens, endophytes or saprobes
(Fan et al. 2018a, Crous et al. 2019). Most families of the Diaporthales are responsible
for diseases on a wide range of host plants, some of which are economically important
worldwide, causing anthracnose, blights, cankers, dieback, leaf spots and rots of root and
Copyright Haiyan Zhu et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
MycoKeys 59: 67–94 (2019)
doi: 10.3897/mycokeys.59.38055
http://mycokeys.pensoft.net
A peer-reviewed open-access journal
MycoKeys
Launched to accelerate biodiversity research
RESEARCH ARTICLE
Haiyan Zhu et al. / MycoKeys 59: 67–94 (2019)
68
fruit (Alvarez et al. 2016, Guarnaccia and Crous 2017, Voglmayr et al. 2017, Jiang et al.
2019a, Xavier et al. 2019, Fan et al. 2020). e order is characterized by perithecia often
with elongate beaks, immersed in stromatic tissues, producing deliquescent paraphyses
and unitunicate asci that generally deliquesce, become detached from the perithecial
wall when mature, and have a characteristic refractive apical annulus in sexual morph;
and acervuli, pycnidia or rarely synnemata, producing phialidic or annellidic conidiog-
enous cells with 0–1-septate conidia in asexual morph (Barr 1978, Rossman et al. 2007,
Fan et al. 2020). e classication of Diaporthales has been confused over the past
decades because of the wide variation in morphological characters. Several recent studies
have helped to resolve taxonomic problems of Diaporthales by multigene phylogenetic
analyses and accepted 30 families in the order (Senanayake et al. 2017, 2018, Braun et
al. 2018, Fan et al. 2018a, Crous et al. 2019, Guterres et al. 2019, Xavier et al. 2019).
Mount Dongling has a high diversity of plant species in western Beijing, which
is considered as a biodiversity hotspot with more than 1000 plant species (Ma et al.
1995). As more plant species were recorded in this region, the exploration of fungal
diversity gradually increased as most fungi are often linked to particular host plants as
parasites or endophytes. Alternaria, Diaporthe, Leptostroma, Pestalotiopsis and Phoma
were the most commonly isolated endophytic fungi from Pinus tabuliformis, and later
additional 38 endophytic taxa were identied from Acer truncatum from the Mount
Dongling (Guo et al. 2008, Sun et al. 2011). Further, pathogens of Botryosphaeriales
have been identied from Mount Dongling, including species from the genera Aplo-
sporella, Botryosphaeria and Phaeobotryon (Zhu et al. 2018).
During the trips to collect forest pathogens causing canker or dieback symptoms in
Mount Dongling in Beijing, several specimens associated with typical diaporthalean symp-
toms were collected from various tree hosts, i.e. Betula dahurica (Betulaceae), Juglans re-
gia, J. mandshurica (Juglandaceae), Prunus davidiana (Rosaceae) and Quercus mongolica
(Fagaceae). As the higher-level phylogeny of many genera within the diaporthalean taxa
remains largely unresolved in this region, the current study aims to clarify the systematics
and taxonomy of these diaporthalean fungi with detailed descriptions.
Materials and methods
Sampling and isolation
Fresh specimens of diaporthalean fungi were collected from infected branches of six
hosts from Mount Dongling in Beijing, China (Table 1), during the course of cognitive
practice at the Beijing Forestry University (BJFU). Diaporthalean canker symptoms
include elongated, slightly sunken and discolored areas in the bark, which often splits
along the canker margin, forming several prominent dark sporocarps immersed and
erumpent through the surface of the bark (Fig. 1). A total of 15 isolates were obtained
by removing the mucoid spore mass from conidiomata or ascomata of fresh material,
which was cut horizontally with a sterile blade and mixed in a drop of sterile water on a
Diaporthalean fungi causing canker and dieback from Mount Dongling in China 69
glass slide. e contents were broken up further with the blade until a spore suspension
was obtained. e suspension was spread over the surface of 1.8 % potato dextrose agar
(PDA). Single germinating spores were transferred on to fresh PDA plates. Specimens
and isolates were deposited in the Key Laboratory for Silviculture and Conservation
of the Ministry of Education in BJFU, and the working Collection of X.L. Fan (CF)
housed at the BJFU. Axenic cultures are maintained in the China Forestry Culture
Collection Centre (CFCC).
Morphology
Descriptions were performed based on morphological features of the ascomata or co-
nidiomata from infected host materials. e macro-morphological photographs were
captured using a Leica stereomicroscope (M205 FA) (structure and size of stromata,
structure and size of ectostromatic disc and ostioles). Micro-morphological observa-
tions (shape and size of conidiophores, asci and conidia/ascospores) were determined
under a Nikon Eclipse 80i microscope equipped with a Nikon digital sight DS-Ri2
high denition colour camera, using dierential interference contrast (DIC) illumina-
tion and the Nikon software NIS-Elements D Package v. 3.00. Adobe Bridge CS v. 6
and Adobe Photoshop CS v. 5 were used for the manual editing. Over 10 conidiomata/
ascomata, 10 asci and 30 conidia/ascospores were measured to calculate the mean size/
length and respective standard deviations (SD). Colony diameters were measured and
the colony features were described using the color charts of Rayner (1970). Nomen-
clatural novelties and descriptions were deposited in MycoBank (Crous et al. 2004).
DNA isolation, amplification and sequencing
Genomic DNA was extracted from colonies grown on cellophane-covered PDA using
a modied CTAB method (Doyle and Doyle 1990). e primers and PCR conditions
are listed in Table 2. DNA sequencing was performed using an ABI PRISM 3730XL
Figure 1. Disease symptoms associated with diaporthalean species. A, B Quercus mongolica C Juglans
regia D, E Juglans mandshurica F Betula dahurica.
Haiyan Zhu et al. / MycoKeys 59: 67–94 (2019)
70
Table 2. Genes used in this study with PCR primers, primer DNA sequence, optimal annealing temperature and corresponding references.
Locus Denition Primers Primer DNA sequence (5'–3') Optimal
annealing temp
(°C)
References of primers used
ITS internal transcribed spacer of ribosomal RNA ITS1 TCCGTAGGTGAACCTGCGG 51 White et al. 1990
ITS4 TCCTCCGCTTTTGATATGC
LSU large subunit of ribosomal RNA LR0R ACCCGCTGAACTTAAGC 55 Vilgalys and Hester 1990
LR7 TACTACCACCAAGATCT
cal Calmodulin CAL-228F GAGTTCAAGGAGGCCTTCTCCC 55 Carbone and Kohn 1999
CAL-737R CATCTTTCTGGCCATCATGG
rpb2 RNA polymerase II second largest subunit RPB2-5F GA(T/C)GA(T/C)(A/C)G(A/T)GATCA(T/C)TT(T/C)GG 52 Liu et al. 1999
RPB2-7cR CCCAT(A/G)GCTTG(T/C)TT(A/G)CCCAT
his3 histone H3 CYLH4F AGGTCCACTGGGTGGCAAG 58 Crous et al. 2004
H3-1b GCGGGCGAGCTGGATGTCCTT Glass and Donaldson 1995
tef-1αtranslation elongation factor 1-alpha EF1-668F CGGTCACTTGATCTACAAGTGC 55 Alves et al. 2008
EF1-1251R CCTCGAACTCACCAGTACCG
tub2 beta-tubulin Bt2a GGTAACCAAATCGGTGCTGCTTTG 55 Glass and Donaldson 1995
Bt2b ACCCTCAGTGTAGTGACCCTTGGC
Table 1. Isolates and GenBank accession numbers obtained from Mount Dongling in the current study. (NA – not applicable).
Species Strain Host GenBank accession numbers
ITS LSU Cal his3 rpb2 tef1-αtub2
Dendrostoma
donglinensis
CFCC 53148 Quercus mongolica MN266206 MN265880 NA NA MN315491 MN315480 NA
CFCC 53149 Quercus mongolica MN266207 MN265881 NA NA MN315492 MN315481 NA
CFCC 53150 Quercus mongolica MN266208 MN265882 NA NA MN315493 MN315482 NA
Diaporthe betulina CFCC 53144 Betula dahurica MN266200 MN265874 MN315462 MN315465 MN315498 MN315474 MN315470
Diaporthe eres CFCC 53145 Prunus davidiana MN266202 MN265876 NA NA MN315500 MN315476 MN315472
CFCC 53146 Prunus davidiana MN266201 MN265875 NA MN315466 MN315499 MN315475 MN315471
CFCC 53147 Juglans regia MN266203 MN265877 NA MN315467 MN315501 MN315477 MN315473
Diaporthe rostrata CFCC 53142 Juglans mandshurica MN266204 MN265878 MN315463 NA MN315489 MN315478 MN315468
CFCC 53143 Juglans mandshurica MN266205 MN265879 MN315464 NA MN315490 MN315479 MN315469
Juglanconis oblonga CFCC 53151 Juglans mandshurica MN266209 MN265883 NA NA MN315502 MN315483 NA
CFCC 53152 Juglans mandshurica MN266210 MN265884 NA NA MN315503 MN315484 NA
Melanconis stilbostoma CFCC 53128 Betula dahurica MN266211 MN265885 NA NA MN315494 MN315485 NA
CFCC 53129 Betula dahurica MN266212 MN265886 NA NA MN315495 MN315486 NA
CFCC 53130 Betula sp. MN266213 MN265887 NA NA MN315496 MN315487 NA
CFCC 53131 Betula sp. MN266214 MN265888 NA NA MN315497 MN315488 NA
Diaporthalean fungi causing canker and dieback from Mount Dongling in China 71
DNA Analyser with a BigDye Terminator Kit v.3.1 (Invitrogen, USA) at the Shang-
hai Invitrogen Biological Technology Company Limited (Beijing, China). e DNA
sequences obtained from forward and reverse primers were combined using SeqMan
v. 7.1.0 in the DNASTAR Lasergene Core Suite software (DNASTAR Inc., Madison,
WI, USA). Reference sequences were selected based on ex-type or ex-epitype sequences
available from relevant recently published literature (Rossman et al. 2007, Suetrong et
al. 2015, Norphanphoun et al. 2016, Hongsanan et al. 2017, Senanayake et al. 2017,
Voglmayr et al. 2017, Yang et al. 2018, Fan et al. 2018a, b, 2020) (Table1). Subse-
quent alignments for each gene were generated using MAFFT v.7 (Katoh and Standley
2013) and manually improved where necessary using MEGA v. 6 (Tamura et al. 2013).
Novel sequences generated in the current study were deposited in GenBank (Table 1,
Suppl. materials 1–3: Tables S1–S3) and the aligned matrices used for phylogenetic
analyses were submitted to TreeBASE (www.treebase.org; accession number: S24893).
Phylogenetic analyses
To infer the rst phylogenetic relationships at the family level, an initial alignment
combining the here generated and available ITS, LSU, rpb2 and tef1-α sequences was
compiled following Fan et al. (2018a). is alignment was analyzed based on Maximum
Parsimony (MP), Maximum Likelihood (ML), and Bayesian Inference (BI) methods.
e MP analysis was conducted using a heuristic search (1,000 bootstrap) by
PAUP v. 4.0b10 (Swoord 2003). e MP analysis was conducted with random se-
quence additions as option to stepwise-addition (1,000 bootstrap replicates and one
tree held at each addition step), and maxtrees limited to 100 by replicate. e tree
bisection and reconnection (TBR) was selected as option to the branch swapping al-
gorithm (Swoord 2003). e branches of zero length were collapsed and all equal-
ly most parsimonious trees were saved. Other calculated parsimony scores were tree
length (TL), consistency index (CI), retention index (RI) and rescaled consistency
(RC). e ML analysis was performed using a GTR site substitution model, including
a gamma-distributed rate heterogeneity and a proportion of invariant sites in PhyML
v. 3.0 (Guindon et al. 2010). e BI analysis was conducted using the best-t evolu-
tionary models for each partitioned locus estimated in MrModeltest v. 2.3 (Posada and
Crandall 1998) following the Akaike Information Criterion (AIC), with a Markov
Chain Monte Carlo (MCMC) algorithm in MrBayes v. 3.1.2 (Ronquist and Huelsen-
beck 2003). Two MCMC chains were run from random trees for 10 million genera-
tions and terminated when the average standard deviation of split frequencies dropped
below 0.01. Trees were saved in each 1,000 generations. e rst 25 % of trees were
discarded at the burn-in phase of each analysis, and the Bayesian posterior probabili-
ties (BPP) were calculated to assess the remaining trees (Rannala and Yang 1996). e
MP bootstrap support (BS) equal to or above 50 were shown at the rst and second
position in branches. e branches with signicant BPP equal to or above 0.95 were
thickened in the phylogram.
Haiyan Zhu et al. / MycoKeys 59: 67–94 (2019)
72
In addition to the above analyses, we provided separate phylogenetic trees for two
additional genera (Dendrostoma and Diaporthe) in Diaporthales, based on various gene
regions (see below) including the same parameters as in the analyses described above.
e branch support from MP and ML analyses was evaluated with a bootstrap support
(BS) method of 1,000 replicates (Hillis and Bull 1993). Phylograms were plotted in
Figtree v. 1.4.4 (http://tree.bio.ed.ac.uk/software/gtree) and edited in Adobe Illustra-
tor CS6 v.16.0.0 (https://www.adobe.com/cn/products/illustrator.html).
Results
Phylogenetic analysis
e combined matrix (ITS, LSU, rpb2 and tef1-α) of Diaporthales included 198 in-
group accessions (15 from the current study and 183 retrieved from GenBank) and
two outgroup taxa. e aligned matrix comprised 4,047 characters including gaps
(773 characters for ITS, 1,190 for LSU, 1,114 for rpb2 and 970 for tef1-α), of which
2,002 characters were constant, 158 variable characters were parsimony-uninformative
and 1,887 characters were variable and parsimony-informative. MP analyses generated
100 parsimonious trees of which the rst tree is presented in Fig. 2 (TL = 12,631,
CI= 0.313, RI = 0.792, RC = 0.248). e tree topologies of ML and BI analyses were
mostly similar to the generated MP tree. e 15 isolates obtained in this study were
clustered within the families Diaporthaceae, Erythrogloeaceae, Juglanconidaceae and
Melanconidaceae in Diaporthales (Fig. 2). To delimitate to the species level, phyloge-
netic trees for Dendrostoma and Diaporthe were constructed separately based on dier-
ent DNA datasets.
For the genus Diaporthe (Diaporthaceae), a concatenated ITS, cal, his3, tef1-α and
tub2 matrix was produced with 201 ingroup accessions (6 from this study and 195
retrieved from GenBank). e combined matrix comprised 3,237 characters including
gaps (544 characters for ITS, 593 for cal, 587 for his3, 645 for tef1-α and 868 for tub2)
of which 1,330 characters were constant, 442 variable characters parsimony-uninform-
ative and 1,465 characters variable and parsimony-informative. e MP analysis gen-
erated 100 parsimonious trees and the rst tree is presented in Fig. 3 (TL=12,978,
CI = 0.280, RI = 0.712, RC = 0.199). e isolates of Diaporthe clustered in three
dierent clades, corresponding to the three known species in this genus. e second
combined matrix (cal, tef1-α and tub2) focusing on the Diaporthe eres complex in-
cluded 56 ingroup accessions (4 from this study and 52 retrieved from GenBank). e
concatenated matrix comprised 1,198 characters including gaps (405 for cal, 363 for
tef1-α and 430 for tub2) of which 933 characters were constant, 112 variable charac-
ters parsimony-uninformative and 153 characters variable and parsimony-informative.
e MP analysis generated 100 parsimonious trees of which the rst is presented in
Fig. 4 (TL = 415, CI = 0.701, RI = 0.882, RC = 0.618). e tree topologies of the ML
and BI analyses were almost similar to the MP tree.
Diaporthalean fungi causing canker and dieback from Mount Dongling in China 73
Figure 2. Phylogram of Diaporthales based on combined ITS, LSU, rpb2 and tef1-α genes. e MP and
ML bootstrap support values above 50 % are shown at the rst and second position, respectively. ick-
ened branches represent posterior probabilities above 0.95 from the BI. Ex-type strains are in bold. Strains
from the current study are in blue.
Haiyan Zhu et al. / MycoKeys 59: 67–94 (2019)
74
Figure 2. Continued.
For the genus Dendrostoma (Erythrogloeaceae), ITS, rpb2 and tef1-α alignments
were concatenated, including 42 ingroup accessions (three from this study and 39
retrieved from GenBank) was produced. e full matrix comprised 2,400 characters
including gaps (561 characters for ITS, 1,078 for rpb2 and 761 for tef1-α), of which
1,486 characters are constant, 231 variable characters are parsimony-uninformative
and 683 characters are variable and parsimony-informative. e only parsimonious
tree generated in MP analyses is presented in Fig. 5 (TL = 1,691, CI = 0.707, RI =
0.835, RC = 0.591). Tree topologies of ML and BI analyses were mostly similar to the
MP tree. ree isolates of Dendrostoma represented a monophyletic clade with high
support value (MP/Ml/BI = 99/99/1) (marked in blue in Fig. 5).
Diaporthalean fungi causing canker and dieback from Mount Dongling in China 75
Figure 2. Continued.
Taxonomy
Diaporthaceae Höhn. ex Wehm., Am. J. Bot. 13: 638 (1926)
Type genus. Diaporthe Nitschke, Pyrenomyc. Germ. 2: 240 (1870).
Notes. Diaporthaceae was introduced by von Höhnel (1917) and subsequently
involved in confusing the taxonomy due to many genera with wide variation of mor-
phological characters and the majority without culture or DNA phylogeny. Senanay-
ake et al. (2017, 2018) accepted 14 genera in Diaporthaceae, including Allantoporthe,
Haiyan Zhu et al. / MycoKeys 59: 67–94 (2019)
76
Figure 3. Phylogram of Diaporthe based on combined ITS, tef1-α, tub2, cal and his3 genes. e MP
and ML bootstrap support values above 50 % are shown at the rst and second positions, respectively.
ickened branches represent posterior probabilities above 0.95 from the BI. Ex-type strains are in bold.
Strains from the current study are in blue.
Diaporthalean fungi causing canker and dieback from Mount Dongling in China 77
Figure 3. Continued.
Haiyan Zhu et al. / MycoKeys 59: 67–94 (2019)
78
Figure 3. Continued.
Diaporthalean fungi causing canker and dieback from Mount Dongling in China 79
Figure 4. Phylogram of Diaporthe eres complex based on combined cal, tef1-α and tub2 genes. e MP
and ML bootstrap support values above 50 % are shown at the rst and second positions, respectively.
ickened branches represent posterior probabilities above 0.95 from BI. Ex-type strains are in bold.
Strains from the current study are in blue.
Haiyan Zhu et al. / MycoKeys 59: 67–94 (2019)
80
Figure 5. Phylogram of Dendrostoma based on combined ITS, rpb2 and tef1-α genes. e MP and ML
bootstrap support values above 50 % are shown at the rst and second positions, respectively. ickened
branches represent posterior probabilities above 0.95 from the BI. Ex-type strains are in bold. Strains from
the current study are in blue.
Diaporthalean fungi causing canker and dieback from Mount Dongling in China 81
Apioporthella, Chaetoconis, Chiangraiomyces, Diaporthe, Hyaliappendispora, Leucodia-
porthe, Mazzantia, Ophiodiaporthe, Paradiaporthe, Phaeocytostroma, Phaeodiaporthe,
Pustulomyces, and Stenocarpella.
Diaporthe Nitschke, Pyrenomyc. Germ. 2: 240 (1870)
Type species. Diaporthe eres Nitschke, Pyrenomyc. Germ. 2: 245 (1870).
Notes. e genus Diaporthe (syn. Phomopsis) was established by Nitschke (1870). e
identication of Diaporthe was confused due to the historical species recognition criteria
based on overlapped morphology, culture characteristics and host aliation (Dissanayake
et al. 2017). e phylogenetic analysis recommended to delimitate taxa to the species level
was rst proposed by Udayanga et al. (2012) and later modied to include concatenated
alignments of ITS, cal1, his3, tef1-α, tub2 (Gomes et al. 2013). More than 1,050 epithets
for Diaporthe and 950 for Phomopsis are listed in Index Fungorum (August 2019). Dis-
sanayake et al. (2017) provided most type/ex-type species details and phylogenetic frame
with 172 species in this genus. Yang et al. (2018) summarized 15 species of Diaporthe as-
sociated with dieback disease of tree hosts in China and introduced 12 new species.
Diaporthe betulina C.M. Tian & Q. Yang, Mycokeys 39: 97 (2018)
Description. See Yang et al. (2018).
Material examined. CHINA, Beijing City, Mentougou District, Mount Dongling,
Xiaolongmen Forestry Centre (39°59'23.58"N, 115°27'05.00"E), from branches of
Betula dahurica Pall., 17 Aug. 2017, H.Y. Zhu & X.L. Fan, deposited by X.L. Fan, CF
2019831, living culture CFCC 53144.
Notes. Yang et al. (2018) described Diaporthe betulina from cankers of Betula
spp. in Heilongjiang Province. e only strain CFCC 53144 representing D. betu-
lina clusters in a well-supported clade and appear most closely related to D. betulae,
which was also isolated from Betula platyphylla in Sichuan Province (Du et al. 2016).
Diaporthe betulina (strain CFCC 52562) diers from D. betulae by its slender alpha
conidia (2.5–3 vs. 3–4 μm) (Du et al. 2016), and 13 bp for ITS, 7 bp for cal, 19 bp for
his, 12bp for tef and 6 bp for tub2 based on alignment of the concatenated ve-gene
deposited in TreeBASE (S24893). Both morphology and sequence data conrmed that
our isolates belong to this species.
Diaporthe eres Nitschke, Pyrenomyc. Germ. 2: 245 (1870)
Fig. 6
Description. Sexual morph: not observed. Asexual morph: Pycnidial stromata im-
mersed in bark, scattered, slightly erumpent through the bark surface, unilocular,
Haiyan Zhu et al. / MycoKeys 59: 67–94 (2019)
82
with a conspicuous central column. Central column beneath the disc more or less
conical, pale grey with yellow. Ectostromatic disc orange, elliptical, 160–300 μm in
diam., with one ostiole per disc. Ostiole dark brown to black, at the same level as or
slightly above the disc surface, 70–80 μm in diam. Locule single, 210–260 μm in
diam. Conidiophores cylindrical, hyaline, unbranched, straight or slightly curved,
tapering towards the apex, 12–13.5 × 2–3 μm. Conidiogenous cells enteroblastic,
phialidic. Alpha conidia hyaline, aseptate, smooth, ellipsoidal, biguttulate, rounded
at both ends, 6.5–8.5 × 2.5–3 (av. = 7.3± 0.5 × 2.8 ± 0.3, n = 30) μm. Beta conidia
were not observed.
Culture characteristics. Cultures on PDA are initially white, growing up to 4 cm
in diam. after 3 days, and becoming yellow green to brown after 7–10 days. Colonies
are flat felty with a thick texture at the marginal area, with a thin texture at the center,
abundant aerial mycelium, sterile.
Figure 6. Morphology of Diaporthe eres from Prunus davidiana (CF 2019808). A, B Habit of conidi-
omata on twig C , D transverse section of conidioma E longitudinal section through conidioma F conidi-
ophores and conidiogenous cells G alpha conidia H colonies on PDA at 3 days (left) and 30 days (right).
Scale bars: 1mm (A); 250μm (B–E); 10 μm (F, G ).
Diaporthalean fungi causing canker and dieback from Mount Dongling in China 83
Material examined. CHINA, Beijing City, Mentougou District, Mount Dongling,
Xiaolongmen Forestry Centre (39°58'06.45"N, 115°26'48.36"E), from branches of
Prunus davidiana (Carr.) Franch., 20 Aug. 2017, H.Y. Zhu & X.L. Fan, deposited by
X.L. Fan, CF 2019808, living culture CFCC 53146; ibid. CF 2019858, living culture
CFCC 53145. CHINA, Beijing City, Mentougou District, Mount Dongling, Xiao-
longmen ForestryCentre (39°57'47.49"N, 115°29'20.52"E), from branches of Juglans
regia L., 20 Aug. 2017, H.Y. Zhu & X.L. Fan, deposited by X.L. Fan, CF 2019801,
living culture CFCC 53147.
Notes. Diaporthe eres is the type species of Diaporthe, and is also the most common
species causing canker disease on a wide range of hosts (Gomes et al. 2013, Udayanga
et al. 2014, Dissanayake et al. 2017, Yang et al. 2018). Our isolates are associated
with canker disease of Prunus davidiana in China, which belong to the Diaporthe eres
species complex (Fig. 4). Fan et al. (2018c) treated many Diaporthe species as D. eres,
and showed the combined cal, tef1-α and tub2 genes provide a better topology than
the combined ve-gene phylogeny for the D. eres complex. Both sequence data and
morphology conrm that our isolates belong to this species (Fig. 4).
Diaporthe rostrata C.M. Tian, X.L. Fan & K.D. Hyde, Mycological Progress 14:
82 (2015)
≡ Diaporthe juglandicola C.M. Tian & Q. Yang. Mycosphere 8(5): 821 (2017)
Description. See Fan et al. (2015).
Material examined. CHINA, Beijing City, Mentougou District, Mount Dongling,
Xiaolongmen Forestry Centre (39°57'54.68"N, 115°27'45.27"E), from branches of
Juglans mandshurica Maxim., 22 Aug. 2017, H.Y. Zhu & X.L. Fan, deposited by X.L.
Fan, CF 2019807, living culture CFCC 53142; ibid. CF 2019910, living culture
CFCC 53143.
Notes. Fan et al. (2015) introduced Diaporthe rostrata from Juglans mandshurica
causing walnut dieback in China. Yang et al. (2017) introduced D. juglandicola as a
sister clade with D. rostrata, but it has no conspicuous rostrate necks on the bark. How-
ever, we recommend to treat D. juglandicola as a synonym of D. rostrate, based on the
same host species, and lacking of phylogenetic support to separate them after involving
our current materials (CF 2019807 and CF 2019910) with conspicuous rostrate necks.
Erythrogloeaceae Senan., Maharachch. & K.D. Hyde, Stud. Mycol. 86: 258 (2017)
Type genus. Erythrogloeum Petr. Sydowia 7: 378 (1953).
Notes. e family Erythrogloeaceae was recently introduced by Senanayake et al.
(2017) based on ITS, LSU, rpb2 and tef1-α, and included four genera (Chrysocrypta,
Dendrostoma, Disculoides and Erythrogloeum) (Fan et al. 2018a, Senanayake et al. 2018).
Haiyan Zhu et al. / MycoKeys 59: 67–94 (2019)
84
Dendrostoma X.L. Fan & C.M. Tian, Persoonia 40: 124 (2018)
Type species. Dendrostoma mali X.L. Fan & C.M. Tian, Persoonia 40: 124 (2018).
Notes. Dendrostoma was introduced by Fan et al. (2018a) as a phytopathogenic ge-
nus, causing canker diseases on several economic hardwoods such as Malus spectabilis,
Osmanthus fragrans and Quercus acutissima. Jiang et al. (2019b) accepted 14 species of
Dendrostoma using a concatenated matrix of four genes (ITS, LSU, rpb2 and tef1-α),
including 10 new species associated with chestnut and oak canker disease in China.
Here we recommend a set of three genes (ITS, rpb2 and tef1-α) to separate species of
this genus.
Dendrostoma donglinensis H.Y. Zhu & X.L. Fan, sp. nov.
MycoBank No: 832194
Fig. 7
Etymology. Named after the location where it was collected, Mount Dongling.
Holotype. CHINA, Beijing City, Mentougou District, Mount Dongling, Xi-
aolongmen Forestry Centre (39°58'19.62"N, 115°26'51.27"E), from branches of
Quercus mongolica Fisch. ex Ledeb., 18 Aug. 2017, H.Y. Zhu & X.L. Fan, deposited by
X.L. Fan, holotype CF 2019903, ex-type living culture CFCC 53148.
Description. Sexual morph: not observed. Asexual morph: Pycnidial stromata im-
mersed in the bark, scattered, erumpent through the surface of bark, unilocular, with
a conspicuous central column. Central column beneath the disc more or less conical,
yellow. Conceptacle absent. Ectostromatic disc hyaline, circular to ovoid, 750–1190
μm in diam., with a single ostiole per disc. Ostiole grey to black, at the same level as
the disc surface, 240–270 μm in diam. Locule single, circular to irregular, undivided,
550–750 μm in diam. Conidiophores hyaline, unbranched, approximately cylindrical.
Conidiogenous cells enteroblastic, phialidic. Conidia hyaline, fusoid, acute at each
end, smooth or occasional not smooth, aseptate, 16.5–20.5 × 2–3.5 (av. = 18 ± 1.1 ×
3 ± 0.3, n = 30) μm.
Culture characteristics. Cultures on PDA are initially white, growing slowly to 2
cm in diam. after 3 days and 4 cm after 14 days, becoming salmon in the center after
7–10 days. Growth stops when colony reaches 8 cm and cultures becoming salmon to
honey after the 30 days. Colonies are felty with a uniform texture; sterile.
Additional material examined. CHINA, Beijing City, Mentougou District,
Mount Dongling, Xiaolongmen ForestryCentre (39°58'19.62"N, 115°26'51.27"E),
from branches of Quercus mongolica Fisch. ex Ledeb., 18 Aug. 2017, H.Y. Zhu &
X.L. Fan, deposited by X.L. Fan, CF 2019887, living culture CFCC 53149; ibid. CF
2019805, living culture CFCC 53150.
Notes. Dendrostoma donglinensis is associated with canker disease of Quercus mon-
golica in China. It can be distinguished from its closest relative D. parasiticum by its
Diaporthalean fungi causing canker and dieback from Mount Dongling in China 85
Figure 7. Morphology of Dendrostoma donglinensis from Quercus mongolica (CF 2019903). A–E Habit
of conidiomata on twig F transverse section of conidioma G longitudinal section through conidioma
Hconidiophores and conidiogenous cells I conidia J colonies on PDA at 3 days (left) and 30 days (right).
Scale bars: 1mm (A); 500 μm (B–G); 10 μm (H, I).
Haiyan Zhu et al. / MycoKeys 59: 67–94 (2019)
86
fusoid, acute at each end and larger conidia (16.5–20.5 × 2–3.5 vs. 9.3–11.7 ×2.8–
3.3μm). e isolates are phylogenetically distinct from all other available strains of
Dendrostoma included in this study and we therefore describe this species as new, based
on DNA sequence data and morphology.
Juglanconidaceae Voglmayr & Jaklitsch, Persoonia 38: 142 (2017)
Type genus. Juglanconis Voglmayr & Jaklitsch, Persoonia 38: 142 (2017).
Notes. Juglanconidaceae was introduced by Voglmayr et al. (2017), including a
single genus Juglanconis.
Juglanconis Voglmayr & Jaklitsch, Persoonia 38: 142 (2017)
Type species. Juglanconis juglandina (Kunze) Voglmayr & Jaklitsch, Persoonia 38:
144 (2017).
Notes. Juglanconis was introduced by Voglmayr et al. (2017) to accommodate pre-
vious Melanconium juglandinum, M. oblongum and M. pterocaryae based on morpholo-
gy and DNA data of type materials. e genus is restricted to one host in Juglandaceae,
which is identied by having perithecial ascomata, 8-spored asci with an apical ring,
hyaline, bicelled ascospores in the sexual morph; and acervular conidiomata, brown
conidia with gelatinous sheaths in asexual morph (Voglmayr et al. 2017). Juglanconis
includes ve species (J. appendiculata, J. japonica, J. juglandina, J. oblonga and J. ptero-
caryae) (Voglmayr et al. 2019), of which J. juglandina and J. oblonga are common
pathogens in Juglans spp. in China (Fan et al. 2018b).
Juglanconis oblonga (Berk.) Voglmayr & Jaklitsch Persoonia 38: 147 (2017)
≡ Melanconium oblongum Berk., Grevillea 2 (22): 153 (1874)
≡ Diaporthe juglandis Ellis & Everh., Proc. Acad. Nat. Sci. Philadelphia 45: 448 (1893)
≡ Melanconis juglandis (Ellis & Everh.) A.H. Graves, Phytopathology 13: 311 (1923)
Description. See Fan et al. (2018b).
Material examined. CHINA, Beijing City, Mentougou District, Mount Dongling,
Xiaolongmen Forestry Centre (39°57'54.68"N, 115°27'45.27"E), from branches of Jug-
lans mandshurica Maxim., 22 Aug. 2017, H.Y. Zhu & X.L. Fan, deposited by X.L. Fan, CF
2019906, living culture CFCC 53151; ibid. CF 2019909, living culture CFCC 53152.
Notes. Juglanconis oblonga (previous Melanconium oblongum) is associated with
canker disease of Juglandaceae hosts in North America and Southeast Asia (Graves
1923, Voglmayr et al. 2017, Fan et al. 2018b). is species is similar to J. juglandina in
disease symptoms but can be distinguished by its longer conidia (22 × 12.5 compared
Diaporthalean fungi causing canker and dieback from Mount Dongling in China 87
to 20 × 13 μm) and DNA sequence data (Fan et al. 2018b). is species is a common
pathogen causing walnut canker in China (Fan et al. 2018b).
Melanconidaceae G. Winter, Rabenh. Krypt. -Fl., Edn 2 (Leipzig) 1(2): 764 (1886)
Type genus. Melanconis Tul. & C. Tul., Select. Fung. Carpol. (Paris) 2: 115 (1863).
Notes. Melanconidaceae was introduced by Winter (1886) and has been subject
to some confusion due to the overlap in morphological characters between genera
and the absence of DNA sequence data supporting the family concept (Barr 1978).
Castlebury et al. (2002) and Rossman et al. (2007) restricted this family to a single
genus Melanconis based on LSU rDNA sequences, which was adapted by recent studies
(Senanayake et al. 2017, Fan et al. 2018b).
Melanconis Tul. & C. Tul., Select. Fung. Carpol. (Paris) 2: 115 (1863)
Type species. Melanconis stilbostoma (Fr.) Tul. & C. Tul., Select. Fung. Carpol. (Paris)
2: 115 (1863).
Notes. Melanconis was established by Tulasne & Tulasne (1863) based on Spha-
eria stilbostoma. Melanconis has approximately 105 species epithets recorded in Index
Fungorum (August 2019), but for most species no living cultures or DNA sequence
data are available. Rossman et al. (2007) suggested that many of the species previously
residing in Melanconis may belong elsewhere. Melanconis includes ve species (Melan-
conis alni, Ms. betulae, Ms. marginalis, Ms. itoana and the type species Ms. stilbostoma),
which were all restricted to the hosts in Betulaceae (Fan et al. 2016, 2018b).
Melanconis stilbostoma (Fr.) Tul. & C. Tul., Select. Fung. Carpol. (Paris) 2: 115 (1863)
Description. See Fan et al. (2016).
Material examined. CHINA, Beijing City, Mentougou District, Mount Dongling,
Xiaolongmen Forestry Centre (39°59'23.58"N, 115°27'05.00"E), from branches of
Betula dahurica Pall., 22 Aug. 2017, H.Y. Zhu & X.L. Fan, deposited by X.L. Fan,
CF 2019832, living culture CFCC 53128; ibid. CF 2019833, living culture CFCC
53129. CHINA, Beijing City, Mentougou District, Mount Dongling, Xiaolongmen
Forestry Centre (39°59'23.58"N, 115°27'05.00"E), from branches of Betula sp., 21
Aug. 2017, H.Y. Zhu & X.L. Fan, deposited by X.L. Fan, CF 2019871, living culture
CFCC 53130; ibid. CF 2019911, living culture CFCC 53131.
Notes. Melanconis stilbostoma is the type species of Melanconis and is thus far only
known to occur on Betula spp. with a global distribution (Fan et al. 2016). Betula
dahurica, B. pendula, B. rotundifolia, B. tianschanica and B. platyphylla are recorded
as hosts for Melanconis stilbostoma in China (Zhuang 2005, Fan et al. 2016, 2018b).
Haiyan Zhu et al. / MycoKeys 59: 67–94 (2019)
88
Discussion
In the present work six diaporthalean species were identied residing in four families
(Diaporthaceae, Erythrogloeaceae, Juglanconidaceae and Melanconidaceae) in the or-
der Diaporthales. ese include ve known species (Diaporthe betulina, D. eres, D.
rostrata, Juglanconis oblonga and Melanconis stilbostoma), and one new species (Den-
drostoma donglinensis). All specimens in the current study were collected from symp-
tomatic branches and twigs associated with canker or dieback diseases. Dendrostoma
(Erythrogloeaceae) species were isolated from Quercus mongolica (Fagaceae). Juglan-
conis (Juglanconidaceae) species were isolated from Juglans mandshurica (Juglandaceae)
and Melanconis (Melanconidaceae) species were isolated from Betula dahurica (Betu-
laceae), which suggests these fungi are host specic. Diaporthe (Diaporthaceae) species
were isolated from Betula dahurica (Betulaceae), Juglans regia, J. mandshurica (Juglan-
daceae), Prunus davidiana (Rosaceae) and Quercus mongolica (Fagaceae). is might
indicate that Diaporthe species are less host specic.
e classication of Diaporthales presented here follows the previous studies (Castle-
bury et al. 2002, Rossman et al. 2007) and discoveries of new taxa from many other
works (Suetrong et al. 2015, Dissanayake et al. 2017, Voglmayr et al. 2017, Senanayake
et al. 2017, 2018). We performed frequently and used four genes (ITS, LSU, rpb2 and
tef1-α) to evaluate the 30 families in this order, but it was found to be confusing in some
taxa such as Apoharknessia and Lasmenia in Apoharknessiaceae (Fig. 2). It suggests that
more studies using a multiphasic approach are still needed to clarify some issues in this
order. Diaporthales includes many phytopathogenic genera such as Dendrostoma, Dia-
porthe, Melanconis and Juglanconis, which have been reported causing canker disease of
tree hosts in China (Fan et al. 2016, 2018b, Yang et al. 2018, Jiang et al. 2019b). e
current study focuses on diaporthalean fungi in Mount Dongling of Beijing, which is
considered as a biodiversity hotspot with a high diversity for fungal species and (Guo
et al. 2008, Zhu et al. 2018). We hope that the descriptions and molecular data of dia-
porthalean fungi in this study could provide a resource for future studies in this region.
Acknowledgements
is study is nanced by the Fundamental Research Funds for the Central Universities
(2019ZY23), the National Natural Science Foundation of China (31670647) and the
College Student Research and Career-creation Program of Beijing (S201910022007).
References
Alvarez LV, Groenewald JZ, Crous PW (2016) Revising the Schizoparmaceae: Coniella and
its synonyms Pilidiella and Schizoparme. Studies in Mycology 85: 1–34. https://doi.
org/10.1016/j.simyco.2016.09.001
Diaporthalean fungi causing canker and dieback from Mount Dongling in China 89
Alves A, Crous PW, Correia A, Phillips AJL (2008) Morphological and molecular data re-
veal cryptic speciation in Lasiodiplodia theobromae. Fungal Diversity 28: 1–13. https://doi.
org/10.1002/yea.1554
Barr ME (1978) e Diaporthales in North America with emphasis on Gnomonia and its seg-
regates. Mycologia Memoir 7: 1–232.
Braun U, Nakashima C, Crous PW, Groenewald JZ, Moreno-Rico O, Rooney-Latham S,
Blomquist CL, Haas J, Marmolejo J (2018) Phylogeny and taxonomy of the genus Tubakia
s. lat. Fungal Systematics and Evolution 1: 41–99. https://doi.org/10.3114/fuse.2018.01.04
Carbone I, Kohn LM (1999) A method for designing primer sets for speciation studies in a-
mentous ascomycetes. Mycologia 91: 553–556. https://doi.org/10.2307/3761358
Castlebury LA, Rossman AY, Jaklitsch WJ, Vasilyeva LN (2002) A preliminary overview of the
Diaporthales based on large subunit nuclear ribosomal DNA sequences. Mycologia 94:
1017–1031. https://doi.org/10.1080/15572536.2003.11833157
Crous PW, Gams W, Stalpers JA, Robert V, Stegehuis G (2004) MycoBank: an online initiative
to launch mycology into the 21st century. Studies in Mycology 50: 19–22.
Crous PW, Schumacher RK, Akulov A, angavel R, Hernández-Restrepo M, Carnegie A,
Cheewangkoon R, Wingeld MJ, Summerell B, Quaedvlieg W, Coutinho TA, Roux J,
Wood AR, Giraldo A, Groenewald JZ (2019) New and Interesting Fungi. 2. Fungal Sys-
tematics and Evolution 3: 57–134. https://doi.org/10.3114/fuse.2019.03.06
Crous PW, Summerell BW, Shivas RG, Burgess TI, Decock CA, Dreyer LL, Granke
LL, Guest DI, Hardy GEStJ, Hausbeck MK, Hüberli D, Jung T, Koukol O, Len-
nox CL, Liew ECY, Lombard L, McTaggart AR, Pryke JS, Roets F, Saude C, Shut-
tleworth LA, Stukely MJC, Vánky K, Webster BJ, Windstam ST, Groenewald JZ
(2012) Fungal Planet description sheets: 107–127. Persoonia 28: 138–182. https://doi.
org/10.3767/003158512X652633
Dissanayake AJ, Phillips AJL, Hyde KD, Yan JY, Li XH (2017) e current status of species in
Diaporthe. Mycosphere 8: 1106–1156. https://doi.org/10.5943/mycosphere/8/5/5
Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue. Focus 12: 13–15. https://
doi.org/10.2307/2419362
Du Z, Fan XL, Hyde KD, Yang Q, Liang YM, Tian CM (2016) Phylogeny and morphology
reveal two new species of Diaporthe from Betula spp. in China. Phytotaxa 269: 90–102.
https://doi.org/10.11646/phytotaxa.269.2.2
Fan XL, Bezerra JDP, Tian CM, Crous PW (2020) Cytospora (Diaporthales) in China. Persoo-
nia 45: 1–45. https://doi.org/10.3767/persoonia.2020.45.01
Fan XL, Bezerra JDP, Tian CM, Crous PW (2018a) Families and genera of diaporthalean
fungi associated with canker and dieback of tree hosts. Persoonia 40: 119–134. https://doi.
org/10.3767/persoonia.2018.40.05
Fan XL, Du Z, Bezerra JDP, Tian CM (2018b) Taxonomic circumscription of melanconis-like
fungi causing canker disease in China. MycoKeys 42: 89–124. https://doi.org/10.3897/
mycokeys.42.29634
Fan XL, Yang Q, Bezerra JDP, Alvarez LV, Tian CM (2018c) Diaporthe from walnut tree (Jug-
lans regia) in China, with insight of the Diaporthe eres complex. Mycological Progress 17:
841–853. https://doi.org/10.1007/s11557-018-1395-4
Haiyan Zhu et al. / MycoKeys 59: 67–94 (2019)
90
Fan XL, Du Z, Liang YM, Tian CM (2016) Melanconis (Melanconidaceae) associated with Betula
spp. in China. Mycological Progress 15: 1–9. https://doi.org/10.1007/s11557-016-1163-2
Fan XL, Hyde KD, Udayanga D, Wu XY, Tian CM (2015) Diaporthe rostrata, a novel ascomy-
cete from Juglans mandshurica associated with walnut dieback. Mycological Progress 14:
1–8. https://doi.org/10.1007/s11557-015-1104-5
Glass NL, Donaldson GC (1995) Development of primer sets designed for use with the PCR
to amplify conserved genes from amentous ascomycetes. Applied and Environmental Mi-
crobiology 61: 1323–1330.
Gomes RR, Glienke C, Videira SIR, Lombard L, Groenewald JZ, Crous PW (2013) Diaporthe:
a genus of endophytic, saprobic and plant pathogenic fungi. Persoonia 31: 1–41. https://
doi.org/10.3767/003158513X666844
Graves AH (1923) e Melanconis disease of the butternut (Juglans cinerra L.). Phytopathplogy
13: 411–435.
Guarnaccia V, Crous PW (2017) Emerging citrus diseases in Europe caused by species of Dia-
porthe. IMA Fungus 8: 317–334. https://doi.org/10.5598/imafungus.2017.08.02.07
Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010) New al-
gorithms and methods to estimate maximum-likelihood phylogenies: assessing the per-
formance of PhyML 3.0. Systematic Biology 59: 307–321. https://doi.org/10.1093/
sysbio/syq010
Guo LD, Huang GR, Wang Y (2008) Seasonal and tissue age inuences on endophytic fungi of
Pinus tabulaeformis (Pinaceae) in the Dongling Mountains, Beijing. Journal of Integrative
Plant Biology 50: 997–1003. https://doi.org/10.1111/j.1744-7909.2008.00394.x
Guterres DC, Galvão-Elias S, Santos MDM, Souza BCP, Almeida CP, Pinho DB, Miller RNG,
Dianese JC (2019) Phylogenetic relationships of Phaeochorella parinarii and recognition of
a new family, Phaeochorellaceae (Diaporthales). Mycologia. https://doi.org/10.1080/002
75514.2019.1603025
Hillis DM, Bull JJ (1993) An empirical test of bootstrapping as a method for assessing con-
dence in phylogenetic analysis. Systematic Biology 42: 182–192. https://doi.org/10.1093/
sysbio/42.2.182
Hongsanan S, Maharachchikumbura SSN, Hyde KD, Samarakoon MC, Jeewon R, Zhao
Q, Al-Sadi AM, Bahkali AH (2017) An updated phylogeny of Sordariomycetes based
on phylogenetic and molecular clock evidence. Fungal Diversity 84: 1–17. https://doi.
org/10.1007/s13225-017-0384-2
Jiang N, Fan XL, Tian CM (2019a) Identication and pathogenicity of Cryphonectriaceae
species associated with chestnut canker in China. Plant Pathology 68: 1132–1145. https://
doi.org/10.1111/ppa.13033
Jiang N, Fan XL, Crous PW, Tian CM (2019b) Species of Dendrostoma (Erythrogloeaceae,
Diaporthales) associated with chestnut and oak canker diseases in China. MycoKeys 48:
67–96. https://doi.org/10.3897/mycokeys.48.31715
Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: im-
provements in performance and usability. Molecular biology and evolution 30: 772–780.
https://doi.org/10.1093/molbev/mst010
Diaporthalean fungi causing canker and dieback from Mount Dongling in China 91
Liu YJ, Whelen S, Hall BD (1999) Phylogenetic relationships among ascomycetes: evidence
from an RNA polymerse II subunit. Molecular Biology and Evolution 16: 1799–1808.
https://doi.org/10.1093/oxfordjournals.molbev.a026092
Ma KP, Guo XM, Yu SL (1995) On the characteristics of the ora of Mount Dongling area and
its relationship with a number of other mountainous oras in China. Bulletin Botanical
Research 15: 501–515.
Nitschke T (1870) Pyrenomycetes Germanici 2. Eduard Trewendt, Breslau.
Norphanphoun C, Hongsanan S, Doilom M, Bhat DJ, Wen TC, Bulgakov TS, Hyde KD
(2016) Lamproconiaceae fam. nov. to accommodate Lamproconium desmazieri. Phytotaxa
270: 89–102. https://doi.org/10.11646/phytotaxa.270.2.2
Posada D, Crandall KA (1998) Modeltest: testing the model of DNA substitution. Bioinfor-
matics 14: 817–818. https://doi.org/10.1093/bioinformatics/14.9.817
Rannala B, Yang Z (1996) Probability distribution of molecular evolutionary trees: a new
method of phylogenetic inference. Journal of Molecular Evolution 43: 304–311. https://
doi.org/10.1007/BF02338839
Rayner RW (1970) A Mycological Colour Chart. Commonwealth Mycological Institute, Kew.
Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572–1574. https://doi.org/10.1093/bioinformatics/btg180
Rossman AY, Farr DF, Castlebury LA (2007) A review of the phylogeny and biology of the
Diaporthales. Mycoscience 48: 135–144. https://doi.org/10.1007/S10267-007-0347-7
Senanayake IC, Crous PW, Groenewald JZ, Maharachchikumbura SSN, Jeewon R, Phil-
lips AJL, Bhat DJ, Perera RH, Li QR, Li WJ, Tangthirasunun N, Norphanphoun C,
Karunarathna SC, Erio C, Manawasighe IS, Al-Sadi AM, Hyde KD (2017) Families of
Diaporthales based on morphological and phylogenetic evidence. Studies in Mycology 86:
217–296. https://doi.org/10.1016/j.simyco.2017.07.003
Senanayake IC, Jeewon R, Chomnunti P, Wanasinghe DN, Norphanphoun C, Karunarathna
A, Pem D, Perera RH, Camporesi E, McKenzie EHC, Hyde KD, Karunarathna SC (2018)
Taxonomic circumscription of Diaporthales based on multigene phylogeny and morphol-
ogy. Fungal Diversity 93: 241–443. https://doi.org/10.1007/s13225-018-0410-z
Suetrong S, Klaysuban A, Sakayaroj J, Preedanon S, Ruang-Areerate P, Phongpaichit S, Pang
KL, Jones EBG (2015) Tirisporellaceae, a new family in the order Diaporthales (Sordari-
omycetes, Ascomycota). Cryptogamie Mycologie 36: 319–330. https://doi.org/10.7872/
crym/v36.iss3.2015.319
Sun X, Guo LD, Hyde KD (2011) Community composition of endophytic fungi in Acer trunca-
tum and their role in decomposition. Fungal diversity 47: 85–95. https://doi.org/10.1007/
s13225-010-0086-5
Swoord DL (2003) PAUP*: Phylogenetic Analysis Using Parsimony, * and Other Methods,
Version 4.0b10, Sinauer Associates, Sunderland.
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolution-
ary genetics analysis version 6.0. Molecular Biology and Evolution 30: 2725–2729. https://
doi.org/10.1093/molbev/mst197
Tulasne LR, Tulasne C (1863) Selecta Fungorum Carpologia, Vol. 2. Paris.
Haiyan Zhu et al. / MycoKeys 59: 67–94 (2019)
92
Udayanga D, Castlebury LA, Rossman AY, Chukeatirote E, Hyde KD (2014) Insights into the
genus Diaporthe: phylogenetic species delimitation in the D. eres species complex. Fungal
Diversity 67: 203–229. https://doi.org/10.1007/s13225-014-0297-2
Udayanga D, Liu XZ, Crous PW, McKenzie EHC, Chukeatirote E, Hyde KD (2012) A multi-
locus phylogenetic evaluation of Diaporthe (Phomopsis). Fungal Diversity 56: 157–171.
https://doi.org/10.1007/s13225-012-0190-9
Vilgalys R, Hester M (1990) Rapid genetic identifcation and mapping of enzymatically am-
plifed ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172:
4238–4246. https://doi.org/10.1128/jb.172.8.4238-4246.1990
Voglmayr H, Castlebury LA, Jaklitsch WM (2017) Juglanconis gen. nov. on Juglandaceae,
and the new family Juglanconidaceae (Diaporthales). Persoonia 38: 136–155. https://doi.
org/10.3767/003158517X694768
Voglmayr H, Jaklitsch WM, Mohammadi H, Chakusary MK (2019) e genus Juglanconis
(Diaporthales) on Pterocarya. Mycological Progress 18: 425–427. https://doi.org/10.1007/
s11557-018-01464-0
Von Höhnel F (1917) System der Diaportheen. Berichte der Deutschen Botanischen Gesells-
chaft 35: 631–638.
White TJ, Bruns T, Lee S, Taylor J (1990) Amplifcation and direct sequencing of fungal ribo-
somal RNA genes for phylogenetics. PCR Protocols: a guide to methods and applications
18: 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1
Winter G (1886) Fungi Australienses. Revue Mycologique Toulouse 8: 207–213.
Xavier KV, KC AN, Crous PW, Groenewald JZ, Vallad GE (2019) Dwiroopa punicae sp.
nov. (Dwiroopaceae fam. nov., Diaporthales), associated with leaf spot and fruit rot of
pomegranate (Punica granatum). Fungal Systematics and Evolution 4: 33–41. https://doi.
org/10.3114/fuse.2019.04.04
Yang Q, Fan XL, Du Z, Tian CM (2017) Diaporthe juglandicola sp. nov. (Diaporthales, Asco-
mycetes), evidenced by morphological characters and phylogenetic analysis. Mycosphere 8:
817–826. https://doi.org/10.5943/mycosphere/8/5/3
Yang Q, Fan XL, Guarnaccia V, Tian CM (2018) High diversity of Diaporthe species associated
with dieback diseases in China, with twelve new species described. MycoKeys 39: 97–149.
https://doi.org/10.3897/mycokeys.39.26914
Zhu HY, Tian CM, Fan XL (2018) Studies of botryosphaerialean fungi associated with canker
and dieback of tree hosts in Dongling Mountain of China. Phytotaxa 348: 63–76. https://
doi.org/10.11646/phytotaxa.348.2.1
Zhuang WY (2005) Fungi of northwestern China. Ithaca, NewYork.
Diaporthalean fungi causing canker and dieback from Mount Dongling in China 93
Supplementary material 1
Table S1. Isolates and GenBank accession numbers used in the phylogenetic anal-
yses of Diaporthales
Authors: Haiyan Zhu, Meng Pan, Guido Bonthond, Chengming Tian, Xinlei Fan
Data type: molecular data
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/mycokeys.59.38055.suppl1
Supplementary material 2
Table S2. Isolates and GenBank accession numbers used in the phylogenetic anal-
yses of Diaporthe
Authors: Haiyan Zhu, Meng Pan, Guido Bonthond, Chengming Tian, Xinlei Fan
Data type: molecular data
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/mycokeys.59.38055.suppl2
Supplementary material 3
Table S3. Isolates and GenBank accession numbers used in the phylogenetic anal-
yses of Diaporthe eres complex
Authors: Haiyan Zhu, Meng Pan, Guido Bonthond, Chengming Tian, Xinlei Fan
Data type: molecular data
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/mycokeys.59.38055.suppl3
Haiyan Zhu et al. / MycoKeys 59: 67–94 (2019)
94
Supplementary material 4
Table S4. Isolates and GenBank accession numbers used in the phylogenetic anal-
yses of Dendrostoma
Authors: Haiyan Zhu, Meng Pan, Guido Bonthond, Chengming Tian, Xinlei Fan
Data type: molecular data
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/mycokeys.59.38055.suppl4
Available via license: CC BY
Content may be subject to copyright.
