SlideShare a Scribd company logo
1 of 29
Download to read offline
Università degli Studi di Firenze
Dipartimento di Scienze delle Produzioni Agroalimentari e dell’Ambiente (DISPAA)
Sezione di Patologia vegetale ed Entomologia
Action 16 & Action 17
Establishing a monitoring network to assess
lowland forest and urban plantation in Lombardy
and urban forest in Slovenia
Disease management in urban forests
Alessandro Ragazzi, Beatrice Ginetti, Salvatore Moricca
Phytopathology unit
www.pmnatura
Species: Acer pseudoplatanus, Quercus robur, Alnus cordata
Sampling years: 2005 , 2006
Sampling months: march…………october = 8
Number of sampled plants per species: 3 healthy and 3 declining = 18 (9 + 9)
Number of samples per plant: two plants every month = 288 (144 + 144)
Number of Petri dishes per sample: 5 = 1440 (720 + 720)
Number of Petri dishes evaluated (of the 5 dishes above): 3 = 864 (432 + 432)
Number of samples seeded per Petri dishe: 5 = 4320 (2160 + 2160)
Protocol of sampling and isolation
which pathogens have we found????
strakerenemy.blogspot.com
Biscogniauxia mediterranea (De Not) Kuntze
Agente di cancro carbonioso
Agent of charcoal canker
Protologo: Kuntze, O. 1891, Revisio generum plantarum: 398
Basionym: Sphaeria mediterranea De Not., 1851
Position in classification: Xylariaceae, Xylariales, Xylariomycetidae,
Sordariomycetes, Pezizomycotina, Ascomycota,
Biscogniauxia mediterranea (De Not) Kuntze
EPPO Alert list
Quercus spp.
Fraxinus excelsior
Fagus sylvatica
Castanea sativa
From Marocco
present all the
our peninsula,
including the
islands
Foto Capretti-Ragazzi
Botryosphaeria dothidea (Moug. ex Fr.) Ces. et De Not.
Agente di cancro corticale
Agent of cortical canker
Protologo: Cesati et De Notaris 1863, Comm. Soc. crittog.
Ital. 1 (4): 212
Sanctioning author: Fr. (SM2 : 423, Sphaeria dothidea)
Anamorph: Fusicoccum aesculi
Position in classification: Botryosphaeriaceae,
Botryosphaeriales, Ascomycota
Botryosphaeria dothidea (Moug. Ex Fr.) Ces. Et De Not.
EPPO Alert list
Acer
pseudoplatanus
Quercus rubra
Q. robur
Q. suber
Ostrya spp.
Platanus spp.
present all the our peninsula,
including the islands
Locus: DQ168265 466 bp DNA linear PLN 04.10-2005
Definition: Botryosphaeria dothidea isolate B5 internal transcribed
spacer 1. Partial sequence; 5.8 ribosomal RNA gene and internal transcribed
spacer 2, complete sequence; and 28S ribosomal gene, partial sequence.
Accession: DQ168265
Version: DQ168265; GI: 76563848
Reference: 1
Journal: Plant Disease
Origin:
1 GCGGGCCGCG GTCCTCCGCG GCCGGCCCCC CTCCCCGGGG GGTGGCCAGC
51 GCCCGCCAGA GGACCATCAA ACTCCAGTCA GTAAACGATG CATCTGAAAA
101 AACATTTAAT TTTAAACTAA AACC ...
151
Molecular characterization of Botryosphaeria dothidea
(target regions of ribosomial DNA )
Botryosphaeria parva
Pennycook & Samuels
Botryosphaeria obtusa
(Schwein.) Shoemaker
Neofusicoccum parvum
(Pennycook & Samuels) Crous, Slippers
& A.J.L. Phillips
Diplodia seriata De Not
Foto Capretti
……and a very high number of
endophytic fungi
(pathogens and other)
Plots Non thinned plot (2Ant)
State of healthy Symptomatic Asymptomatic
Endophytic fungi 2011 2012 2013 2011 2012 2013
Alternaria
alternata (Fr.: Fr.)
Keissl.
4.2 4.7 5.8 3.9 * *
Apiognomonia
quercina (Kleb)
Höhn
8.1a 3.1a 5.6a 4.4a 3.2a *
Aposphaereia sp. * * * - - -
Aureobasidium
pullulans (de Bary
et al.)
3.0 3.1 * 3.1 * *
Biscogniauxia
mediterranea (De
Not.) Kuntze
7.7a 3.1a 4.4a * * *
Botryosphaeria
dothidea (Moug et
al.)
51.6b 33.3b 41.4b 30.2b 17.6b 13.8a
Ceratocystis
coerulescens
(Münch) Bakshi
7.8a 4.3a 5.4a 4.9a 4.3a 4.1b
Chaetomium
indicum Corda
3.1 * * - -
Cladosporium
herbarum Pers.:
Fr.
- - - - - -
Curvularia lunata
(Wakker) Boedijn
8.1 * * 6.7 6.4 6.3
Diplodia mutila
(Fr.) Mont.
29.6c 17.4c 23.4c 17.1c 11.9c 10.4c
Tab. 3 – Endophytic fungi detected in twigs of symptomatic and asymptomatic tress, isolated from thinned (2At)
and non thinned (2Ant) plot in North Park (Lombardy, North Italy). The data show the average value of the
endophytic assemblage of seven trees present in both plots: Acer pseudoplatanus, Alnus cordata, Fraxinus
angustifolia, F. excelsior, F. ornus, Quercus cerris, Q. robur. The colonization frequency is expressed as percentage.
t = thinned; nt = non thinned
Tab. 3 – Endophytic fungi detected in twigs of symptomatic and
asymptomatic tress, isolated from thinned (2At) and non thinned
(2Ant) plot in North Park (Lombardy, North Italy). The data
show the average value of the endophytic assemblage of seven
trees present in both plots: Acer pseudoplatanus, Alnus cordata,
Fraxinus angustifolia, F. excelsior, F. ornus, Quercus cerris, Q.
robur. The colonization frequency is expressed as percentage.
t = thinned; nt = non thinned
Diplodina acerina
(Pass.) B. Sutton
6.8a 3.8a 4.9a 3.3a * *
Epicoccum nigrum
Link
6.4 6.6 5.9 7.1 7.6 7.3
Gliomastix
murorum (Corda)
S. Hughes
7.1 7.9 6.8 11.6 10.2 10.9
Glomerella
cingulata
(Stoneman et al.)
3.2 3.0 3.1 - - -
Gnomonia sp. * * * - - -
Nectria sp. 4.2 * * 3.6 4.2 4.1
Neofusicoccum
parvum
(Pennycook et
al.)
52.2b 30.3b 44.1b 28.7b 19.1b 17.6d
Phialocephala sp. 4.9 5.2 5.0 - - -
Phomopsis
quercina (Sacc.)
Höhn. ex Died.
8.2a 3.4a 5.1a 11.0d 4.1a 3.4b
Phomopsis
acerina Pirone &
J.C. Carter
4.2d 3.3a 4.1a 3.2a * 3.3b
Pseudovalsa
longipes (Tul.)
Sacc.
3.8d * * 4.3a 3.2a 3.9b
Ramichloridium
sp.
- - - - - -
Septoria alni
Sacc.
7.3a 3.3a 4.8a 4.2a 4.1a 3.2b
Trichoderma
atroviride P.
Karst.
18.8 16.4 16.6 20.9 18.8 17.4
Trichoderma
viride Pers.: Fries
19.1 17.7 17.6 20.6 18.8 18.9
Values in column followed by the same letter do not differ
significantly per P< 0,05. Duncan’s Multiple Range Test
performed according to the values of only fungal
(endophytic) pathogens.
*Isolation frequency below the 3% threshold
Outside the LIFE plots, we found
some important pathogens
a lot of Phytophthora species…
•Phytophthora lacustris
•Phytophthora taxon Pg chlamydo (1^ report in Italy)
•Phytophthora gonapodyides
•Phytophthora inundata
•Phytophthora taxon walnut (1^ report in Italy)
•Potential hybrid between P. lacustris et P. Pg chlamydo
The new pathogen Phytophthora acerina
(first description )
Phytophthora acerina B.Ginetti, T. Jung, D.E.L.
Cooke, S. Moricca sp. nov.
Phytophthora acerina B. Ginetti, T. Jung, D.E.L. Cooke , S. Moricca sp. nov.
Peronosporaceae, Incertae sedis, Oomycota, Chromista
not yet included in the EPPO lists
Acer
pseudoplatanus
Lombardia
causal agent of widespread sycamore maple mortality
Anthostoma decipiens (DC.) Nitschke
Agent of canker
Basionym:
Sphaeria decipiens DC., in Lamarck et de Candolle 1805
Sanctioning author: Fr.
Citations in published lists or literature: Saccardo's Syll. fung. I:
302; III: 263; XII: 21; XV: 45
Position in classification : Diatrypaceae, Xylariales, Xylariomycetidae,
Sordariomycetes, Pezizomycotina, Ascomycota
causal agent of widespread hornbeam mortality
>ITS Anthostoma decipiens
CAGGTCTCGTTGGTGACCAGCGGAGGGATCATTACAGAGTTATTTATCTCCTAACCTT
ATGTGAACTTACCTATGTTGCCTCGGCGAGGAAAGCCTACCCTGTAGTTACTTGGAG
GCGAGCTACCCTGTAGCCCGCTGCTGGCTAACCCGTCGATGGACCATTCTAACTCTTG
TTTTTCTGTGGCACATCTGAATCGTTTATACTTAATAAGTTAAAACTTTCAACAACGGA
TCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATT
GCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAG
TGGGCATGCCTGTTCGAGCGTCATTTCGACCATCAAGTCTTATTTGCTTGGAGTTGGG
AATTTGCTTGCAAGTAATTCCTTAAAATTATTGGCGGAGTTGCGATAACCCCAAGCGT
AGTAATTATCTCTCGCTTTCGGTGTGTTAGCGCTGACATTTAGCCGTTAAACCCTCTAT
ATTTATGTAGGTTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAGC
Anthostoma decipiens 18S rRNA gene (partial), ITS1, 5.8S rRNA
gene, ITS2 and 28S rRNA gene (partial), strain IPV-FW349
GenBank: AM399021.1
First Match: Anthostoma decipiens 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, ITS2 and 28S
rRNA gene (partial), strain IPV-FW349
Score Expect Identities Gaps Strand Frame
1003 bits(543) 0.0() 559/566(99%) 3/566(0%) Plus/Plus
Query 8 CGTTGGTG-ACCAGCGGAGGGATCATTACAGAGTTATTTATCTCCT-AACCTTATGTGAA 65
||| |||| ||| ||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct 3 CGTAGGTGAACCTGCGGAGGGATCATTACAGAGTTATTTAACTCCTAAACCTTATGTGAA 62
Query 66 CTTACCTATGTTGCCTCGGCGAGGAAAGCCTACCCTGTAGTTACTTGGAGGCGAGCTACC 125
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct 63 CTTACCTATGTTGCCTCGGCGAGG-AAGCCTACCCTGTAGTTACTTGGAGGCGAGCTACC 121
Query 126 CTGTAGCCCGCTGCTGGCTAACCCGTCGATGGACCATTCTAACTCTTGTTTTTCTGTGGC 185
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 122 CTGTAGCCCGCTGCTGGCTAACCCGTCGATGGACCATTCTAACTCTTGTTTTTCTGTGGC 181
Query 186 ACATCTGAATCGTTTATACTTAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTG 245
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 182 ACATCTGAACCGTTTATACTTAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTG 241
Query 246 GCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT 305
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 242 GCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT 301
Query 306 CATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAG 365
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 302 CATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAG 361
Query 366 CGTCATTTCGACCATCAAGTCTTATTTGCTTGGAGTTGGGAATTTGCTTGCAAGTAATTC 425
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 362 CGTCATTTCGACCATCAAGTCTTATTTGCTTGGAGTTGGGAATTTGCTTGCAAGTAATTC 421
Query 426 CTTAAAATTATTGGCGGAGTTGCGATAACCCCAAGCGTAGTAATTATCTCTCGCTTTCGG 485
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 422 CTTAAAATTATTGGCGGAGTTGCGATAACCCCAAGCGTAGTAATTATCTCTCGCTTTCGG 481
Query 486 TGTGTTAGCGCTGACATTTAGCCGTTAAACCCTCTATATTTATGTAGGTTTGACCTCGGA 545
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 482 TGTGTTAGCGCTGACATTTAGCCGTTAAACCCTCTATATTTATGTAGGTTTGACCTCGGA 541
Query 546 TCAGGTAGGAATACCCGCTGAACTTA 571
||||||||||||||||||||||||||
Sbjct 542 TCAGGTAGGAATACCCGCTGAACTTA 567
Goidanich, 1954
Prophylaxis and/or treatment
Eliminate in winter death or diseased plants
Avoid sawdust, or limit its spread, during cutting and pruning
Remove and destroy the cut material
Extirpate the stumps
Avoid any type of wound
Prune only during the winter months
Protect large cutting surface with polyvinylic paste added with a
chemical compound or with biological mastic
Periodically check the large cutting surface to control the development
of the scaring process
Importe propagating material only from areas where there are not
reported some pathogens
Respect the distance in new plantations
Use resistant clones
Observe the decrees of obligatory control
Educate the staff that manages the urban green
General criteria for urban forest
Inform the citizenship
Make the treatment in the early morning or evening ones
Never make treatment in presence of wind
Prohibit access to treated areas
Ensure the protection of the operator
Use of chemical compounds at doses indicated on the label
Before proceeding to a treatment in urban
areas need to follow specific precautions:
www.magieraansaloni.it
Prescriptions at European level to adopt criteria in urban
and suburban area for a phytosanitary pruning
Prevent cutting, keeping the plants in appropriate conditions (distance)
Prevent cutting of large twigs and branches working on small branches, on which
the compartimentation is more easy
Cutting after windbreakage or traumatic wounds: need to trim the injured part
and protect the exposed tissues
Cutting due to decay or necrotic processes: make the cut on the surface healthy (15-
20 cm below the dead tissue). Protect the exposed tissues.
Cutting of twigs or branches dead: the practice of "Dead-wooding" is needed to
secure the plant, thereby eliminating not only the dead branches, but even those
with necrotic phenomena in extension
Lightening of the crown: fundamental in areas with presence of foliar fungal
agents. The lowest humidity values of a crown "lightened" in fact hamper many
pathogns. Moreover a lightened crown, in high windy areas, allows the wind to
traverse the crown without resistance, thus avoiding injuries, potential sites of entry
of pathogenic agents
The cutting must always be carried out in the vicinity of buds or other branches,
in order to allow the plant to form the healing tissue
Criteria to control Biscogniauxia mediterranea
(Franceschini, com. pers.)
Reduce the inoculum mass through the cutting of infected plants and
pruning of branches by way of desiccation or with cankers
Burn all the material or to carry it away, making sure to cover it with a cloth
during wood hauling
If the spread of the pathogen is not yet at epidemic level, we can cut as
simple coppice. The consequent "opening of the forest" create conditions less
favourable to the spread of the pathogen
If the pathogen reached an epidemic spreading is necessary to proceed as
coppice with standards or with a conversion to a high forest. In this case,
instead of preventing the further spread of the pathogen, is more important
to maintain soil moisture to avoid the plants come easily in water stress
resulting in colonization of its organs by the pathogen
Criteria to control Phytophthora spp.
.
.
Strict quarantine rules
Obligation to contact Regional plant protection services
Cortical treatments with phosphites and tacky at the base of the trunk,
repeating annually in the spring
Inspection of imported plants
In case we suspect the presence of Phytophthora in soil, it’s recommende soil
treatment, having uprooted and destroyed symptomatic plants, using
sunburn.
Criteria to control endophytic fungi
????????????????????????????????????????
Avoid thermic and water stress to the plants
Reduce the inoculum biomass by a phytosanitary pruning
Biological control in planta???
Pre-immunization??
The results of our work are perhaps the first to point
out that a thinning can lead to an increase
in the incidence of some fungal pathogenic
endophytes in forest trees.
Increase the biomass of leaves, understood as “a
territory” by colonizing
The Thinning
humbleness
diagnostic
capacity
training
meticulousness
The monitoring The prophylaxis
Disease management in urban forests

More Related Content

What's hot

Gutell 082.jphy.2002.38.0807
Gutell 082.jphy.2002.38.0807Gutell 082.jphy.2002.38.0807
Gutell 082.jphy.2002.38.0807Robin Gutell
 
First Report of Cucumber mosaic virus causing chlorotic mottle on Pot Marigo...
First Report of Cucumber mosaic virus causing  chlorotic mottle on Pot Marigo...First Report of Cucumber mosaic virus causing  chlorotic mottle on Pot Marigo...
First Report of Cucumber mosaic virus causing chlorotic mottle on Pot Marigo...Gordana Zdjelar
 
Gpb minor seminor
Gpb  minor seminorGpb  minor seminor
Gpb minor seminorchaithram11
 
Detection and Subtype Identification of Blastocystis Isolates from Wastewater...
Detection and Subtype Identification of Blastocystis Isolates from Wastewater...Detection and Subtype Identification of Blastocystis Isolates from Wastewater...
Detection and Subtype Identification of Blastocystis Isolates from Wastewater...gon0603
 
Learning from the pathogen towards tailored-sustainable resistance : the case...
Learning from the pathogen towards tailored-sustainable resistance : the case...Learning from the pathogen towards tailored-sustainable resistance : the case...
Learning from the pathogen towards tailored-sustainable resistance : the case...CIAT
 
Characterization of pleiotropic adult plant resistance loci to wheat diseases
Characterization of pleiotropic adult plant resistance loci to wheat diseases Characterization of pleiotropic adult plant resistance loci to wheat diseases
Characterization of pleiotropic adult plant resistance loci to wheat diseases Borlaug Global Rust Initiative
 
Genome–Wide Analysis and Expression Pattern of the AP2/ERF Gene Family in Kiw...
Genome–Wide Analysis and Expression Pattern of the AP2/ERF Gene Family in Kiw...Genome–Wide Analysis and Expression Pattern of the AP2/ERF Gene Family in Kiw...
Genome–Wide Analysis and Expression Pattern of the AP2/ERF Gene Family in Kiw...Agriculture Journal IJOEAR
 
Arturo Brenes' presentation in the framework of the expert consultation on th...
Arturo Brenes' presentation in the framework of the expert consultation on th...Arturo Brenes' presentation in the framework of the expert consultation on th...
Arturo Brenes' presentation in the framework of the expert consultation on th...cwr_use
 
Molecular Basis for Genetic Resistance of Fusarium virguliforme, the Causal A...
Molecular Basis for Genetic Resistance of Fusarium virguliforme, the Causal A...Molecular Basis for Genetic Resistance of Fusarium virguliforme, the Causal A...
Molecular Basis for Genetic Resistance of Fusarium virguliforme, the Causal A...Chloe Siegel
 
Anther Culture of Pepper: Morphological Charactersitics of Fruits of Androgen...
Anther Culture of Pepper: Morphological Charactersitics of Fruits of Androgen...Anther Culture of Pepper: Morphological Charactersitics of Fruits of Androgen...
Anther Culture of Pepper: Morphological Charactersitics of Fruits of Androgen...researchagriculture
 
Evaluation of Brassica Germplasm for Resistance sources against White Rust
Evaluation of Brassica Germplasm for Resistance sources against White RustEvaluation of Brassica Germplasm for Resistance sources against White Rust
Evaluation of Brassica Germplasm for Resistance sources against White RustIJEAB
 
90 charlene m. mello - 7033769 - method for discovering one or more peptide...
90   charlene m. mello - 7033769 - method for discovering one or more peptide...90   charlene m. mello - 7033769 - method for discovering one or more peptide...
90 charlene m. mello - 7033769 - method for discovering one or more peptide...Mello_Patent_Registry
 
Valdez ASM Poster LM 3.25.15
Valdez ASM Poster LM 3.25.15Valdez ASM Poster LM 3.25.15
Valdez ASM Poster LM 3.25.15Reyna Valdez
 
Endosymbiont hunting in the metagenome of Asian citrus psyllid (Diaphorina ci...
Endosymbiont hunting in the metagenome of Asian citrus psyllid (Diaphorina ci...Endosymbiont hunting in the metagenome of Asian citrus psyllid (Diaphorina ci...
Endosymbiont hunting in the metagenome of Asian citrus psyllid (Diaphorina ci...Surya Saha
 
Phenotypic and genotypic typing of Salmonella enterica serovar Enteritidis is...
Phenotypic and genotypic typing of Salmonella enterica serovar Enteritidis is...Phenotypic and genotypic typing of Salmonella enterica serovar Enteritidis is...
Phenotypic and genotypic typing of Salmonella enterica serovar Enteritidis is...Intissar Guedda
 
8th Internation Wheat Conference E.Alwan poster
8th Internation Wheat Conference E.Alwan poster8th Internation Wheat Conference E.Alwan poster
8th Internation Wheat Conference E.Alwan posterICARDA
 

What's hot (20)

Gutell 082.jphy.2002.38.0807
Gutell 082.jphy.2002.38.0807Gutell 082.jphy.2002.38.0807
Gutell 082.jphy.2002.38.0807
 
First Report of Cucumber mosaic virus causing chlorotic mottle on Pot Marigo...
First Report of Cucumber mosaic virus causing  chlorotic mottle on Pot Marigo...First Report of Cucumber mosaic virus causing  chlorotic mottle on Pot Marigo...
First Report of Cucumber mosaic virus causing chlorotic mottle on Pot Marigo...
 
Gpb minor seminor
Gpb  minor seminorGpb  minor seminor
Gpb minor seminor
 
Detection and Subtype Identification of Blastocystis Isolates from Wastewater...
Detection and Subtype Identification of Blastocystis Isolates from Wastewater...Detection and Subtype Identification of Blastocystis Isolates from Wastewater...
Detection and Subtype Identification of Blastocystis Isolates from Wastewater...
 
Learning from the pathogen towards tailored-sustainable resistance : the case...
Learning from the pathogen towards tailored-sustainable resistance : the case...Learning from the pathogen towards tailored-sustainable resistance : the case...
Learning from the pathogen towards tailored-sustainable resistance : the case...
 
Characterization of pleiotropic adult plant resistance loci to wheat diseases
Characterization of pleiotropic adult plant resistance loci to wheat diseases Characterization of pleiotropic adult plant resistance loci to wheat diseases
Characterization of pleiotropic adult plant resistance loci to wheat diseases
 
Genome–Wide Analysis and Expression Pattern of the AP2/ERF Gene Family in Kiw...
Genome–Wide Analysis and Expression Pattern of the AP2/ERF Gene Family in Kiw...Genome–Wide Analysis and Expression Pattern of the AP2/ERF Gene Family in Kiw...
Genome–Wide Analysis and Expression Pattern of the AP2/ERF Gene Family in Kiw...
 
Arturo Brenes' presentation in the framework of the expert consultation on th...
Arturo Brenes' presentation in the framework of the expert consultation on th...Arturo Brenes' presentation in the framework of the expert consultation on th...
Arturo Brenes' presentation in the framework of the expert consultation on th...
 
Molecular Basis for Genetic Resistance of Fusarium virguliforme, the Causal A...
Molecular Basis for Genetic Resistance of Fusarium virguliforme, the Causal A...Molecular Basis for Genetic Resistance of Fusarium virguliforme, the Causal A...
Molecular Basis for Genetic Resistance of Fusarium virguliforme, the Causal A...
 
Anther Culture of Pepper: Morphological Charactersitics of Fruits of Androgen...
Anther Culture of Pepper: Morphological Charactersitics of Fruits of Androgen...Anther Culture of Pepper: Morphological Charactersitics of Fruits of Androgen...
Anther Culture of Pepper: Morphological Charactersitics of Fruits of Androgen...
 
Evaluation of Brassica Germplasm for Resistance sources against White Rust
Evaluation of Brassica Germplasm for Resistance sources against White RustEvaluation of Brassica Germplasm for Resistance sources against White Rust
Evaluation of Brassica Germplasm for Resistance sources against White Rust
 
2010 production of anti hiv-1 calanolides in a callus culture
2010 production of anti hiv-1 calanolides in a callus culture2010 production of anti hiv-1 calanolides in a callus culture
2010 production of anti hiv-1 calanolides in a callus culture
 
90 charlene m. mello - 7033769 - method for discovering one or more peptide...
90   charlene m. mello - 7033769 - method for discovering one or more peptide...90   charlene m. mello - 7033769 - method for discovering one or more peptide...
90 charlene m. mello - 7033769 - method for discovering one or more peptide...
 
Valdez ASM Poster LM 3.25.15
Valdez ASM Poster LM 3.25.15Valdez ASM Poster LM 3.25.15
Valdez ASM Poster LM 3.25.15
 
Endosymbiont hunting in the metagenome of Asian citrus psyllid (Diaphorina ci...
Endosymbiont hunting in the metagenome of Asian citrus psyllid (Diaphorina ci...Endosymbiont hunting in the metagenome of Asian citrus psyllid (Diaphorina ci...
Endosymbiont hunting in the metagenome of Asian citrus psyllid (Diaphorina ci...
 
Phenotypic and genotypic typing of Salmonella enterica serovar Enteritidis is...
Phenotypic and genotypic typing of Salmonella enterica serovar Enteritidis is...Phenotypic and genotypic typing of Salmonella enterica serovar Enteritidis is...
Phenotypic and genotypic typing of Salmonella enterica serovar Enteritidis is...
 
16s r rna
16s r rna16s r rna
16s r rna
 
8th Internation Wheat Conference E.Alwan poster
8th Internation Wheat Conference E.Alwan poster8th Internation Wheat Conference E.Alwan poster
8th Internation Wheat Conference E.Alwan poster
 
Pierce Disease
Pierce DiseasePierce Disease
Pierce Disease
 
fermentation journal
fermentation journalfermentation journal
fermentation journal
 

Similar to Disease management in urban forests

Gutell 058.pnas.1996.093.11907
Gutell 058.pnas.1996.093.11907Gutell 058.pnas.1996.093.11907
Gutell 058.pnas.1996.093.11907Robin Gutell
 
Abrachium, a new genus in the Clathraceae, and Itajahya reassessed
Abrachium, a new genus in the Clathraceae, and Itajahya reassessedAbrachium, a new genus in the Clathraceae, and Itajahya reassessed
Abrachium, a new genus in the Clathraceae, and Itajahya reassessedRhudson Cruz
 
D_leucolena_poster_MRB
D_leucolena_poster_MRBD_leucolena_poster_MRB
D_leucolena_poster_MRBFreddy Castro
 
Heritable variations of Pteris biaurita L. discovered by ISSR markers in the ...
Heritable variations of Pteris biaurita L. discovered by ISSR markers in the ...Heritable variations of Pteris biaurita L. discovered by ISSR markers in the ...
Heritable variations of Pteris biaurita L. discovered by ISSR markers in the ...Journal of Research in Biology
 
Heritable variations of Pteris biaurita L. discovered by ISSR markers in the ...
Heritable variations of Pteris biaurita L. discovered by ISSR markers in the ...Heritable variations of Pteris biaurita L. discovered by ISSR markers in the ...
Heritable variations of Pteris biaurita L. discovered by ISSR markers in the ...Journal of Research in Biology
 
Thesis presentation
Thesis presentationThesis presentation
Thesis presentationAdam Juma
 
The International Journal of Engineering and Science (IJES)
The International Journal of Engineering and Science (IJES)The International Journal of Engineering and Science (IJES)
The International Journal of Engineering and Science (IJES)theijes
 
Colletotrichum gloeosporioides from mango Ataulfo: morphological, physiologic...
Colletotrichum gloeosporioides from mango Ataulfo: morphological, physiologic...Colletotrichum gloeosporioides from mango Ataulfo: morphological, physiologic...
Colletotrichum gloeosporioides from mango Ataulfo: morphological, physiologic...Journal of Research in Biology
 
Parabasalia (Excavata, Metamonada)
Parabasalia (Excavata, Metamonada)Parabasalia (Excavata, Metamonada)
Parabasalia (Excavata, Metamonada)EukRef
 
T patagoniensis Argentina
T patagoniensis ArgentinaT patagoniensis Argentina
T patagoniensis ArgentinaMabel Ribicich
 
Gutell 022.mbp.1992.52.0075
Gutell 022.mbp.1992.52.0075Gutell 022.mbp.1992.52.0075
Gutell 022.mbp.1992.52.0075Robin Gutell
 
9th Student Conference for Conservation Science, UK 2008
9th Student Conference for Conservation Science, UK 20089th Student Conference for Conservation Science, UK 2008
9th Student Conference for Conservation Science, UK 2008Dr. Amalesh Dhar
 
Alien Flora of Ballari District, Karnataka, India
Alien Flora of Ballari District, Karnataka, IndiaAlien Flora of Ballari District, Karnataka, India
Alien Flora of Ballari District, Karnataka, Indiaijtsrd
 
97 craig c. mello - 7282564 - rna interference pathway genes as tools for t...
97   craig c. mello - 7282564 - rna interference pathway genes as tools for t...97   craig c. mello - 7282564 - rna interference pathway genes as tools for t...
97 craig c. mello - 7282564 - rna interference pathway genes as tools for t...Mello_Patent_Registry
 
R genes in Plants
R genes in PlantsR genes in Plants
R genes in PlantsJana Pnr
 

Similar to Disease management in urban forests (20)

Gutell 058.pnas.1996.093.11907
Gutell 058.pnas.1996.093.11907Gutell 058.pnas.1996.093.11907
Gutell 058.pnas.1996.093.11907
 
Abrachium, a new genus in the Clathraceae, and Itajahya reassessed
Abrachium, a new genus in the Clathraceae, and Itajahya reassessedAbrachium, a new genus in the Clathraceae, and Itajahya reassessed
Abrachium, a new genus in the Clathraceae, and Itajahya reassessed
 
BG Journal Club
BG Journal ClubBG Journal Club
BG Journal Club
 
S97038_Science_Dec1999
S97038_Science_Dec1999S97038_Science_Dec1999
S97038_Science_Dec1999
 
D_leucolena_poster_MRB
D_leucolena_poster_MRBD_leucolena_poster_MRB
D_leucolena_poster_MRB
 
Heritable variations of Pteris biaurita L. discovered by ISSR markers in the ...
Heritable variations of Pteris biaurita L. discovered by ISSR markers in the ...Heritable variations of Pteris biaurita L. discovered by ISSR markers in the ...
Heritable variations of Pteris biaurita L. discovered by ISSR markers in the ...
 
Heritable variations of Pteris biaurita L. discovered by ISSR markers in the ...
Heritable variations of Pteris biaurita L. discovered by ISSR markers in the ...Heritable variations of Pteris biaurita L. discovered by ISSR markers in the ...
Heritable variations of Pteris biaurita L. discovered by ISSR markers in the ...
 
Thesis presentation
Thesis presentationThesis presentation
Thesis presentation
 
Conrad Schoch - Saturday Closing Plenary
Conrad Schoch - Saturday Closing PlenaryConrad Schoch - Saturday Closing Plenary
Conrad Schoch - Saturday Closing Plenary
 
The International Journal of Engineering and Science (IJES)
The International Journal of Engineering and Science (IJES)The International Journal of Engineering and Science (IJES)
The International Journal of Engineering and Science (IJES)
 
Colletotrichum gloeosporioides from mango Ataulfo: morphological, physiologic...
Colletotrichum gloeosporioides from mango Ataulfo: morphological, physiologic...Colletotrichum gloeosporioides from mango Ataulfo: morphological, physiologic...
Colletotrichum gloeosporioides from mango Ataulfo: morphological, physiologic...
 
Parabasalia (Excavata, Metamonada)
Parabasalia (Excavata, Metamonada)Parabasalia (Excavata, Metamonada)
Parabasalia (Excavata, Metamonada)
 
T patagoniensis Argentina
T patagoniensis ArgentinaT patagoniensis Argentina
T patagoniensis Argentina
 
Grimmett.et.al-2
Grimmett.et.al-2Grimmett.et.al-2
Grimmett.et.al-2
 
Gutell 022.mbp.1992.52.0075
Gutell 022.mbp.1992.52.0075Gutell 022.mbp.1992.52.0075
Gutell 022.mbp.1992.52.0075
 
Heslopharrisonassisiweb
HeslopharrisonassisiwebHeslopharrisonassisiweb
Heslopharrisonassisiweb
 
9th Student Conference for Conservation Science, UK 2008
9th Student Conference for Conservation Science, UK 20089th Student Conference for Conservation Science, UK 2008
9th Student Conference for Conservation Science, UK 2008
 
Alien Flora of Ballari District, Karnataka, India
Alien Flora of Ballari District, Karnataka, IndiaAlien Flora of Ballari District, Karnataka, India
Alien Flora of Ballari District, Karnataka, India
 
97 craig c. mello - 7282564 - rna interference pathway genes as tools for t...
97   craig c. mello - 7282564 - rna interference pathway genes as tools for t...97   craig c. mello - 7282564 - rna interference pathway genes as tools for t...
97 craig c. mello - 7282564 - rna interference pathway genes as tools for t...
 
R genes in Plants
R genes in PlantsR genes in Plants
R genes in Plants
 

More from EmonfurProject

Padoa schioppa fauna monitoring
Padoa schioppa fauna monitoringPadoa schioppa fauna monitoring
Padoa schioppa fauna monitoringEmonfurProject
 
Kutnar flora and_vegetation
Kutnar flora and_vegetationKutnar flora and_vegetation
Kutnar flora and_vegetationEmonfurProject
 
Jurc et urban forest health problems_slo
Jurc et urban forest health problems_slo Jurc et urban forest health problems_slo
Jurc et urban forest health problems_slo EmonfurProject
 
Digiovinazzo vegetation and_flora_it
Digiovinazzo vegetation and_flora_itDigiovinazzo vegetation and_flora_it
Digiovinazzo vegetation and_flora_itEmonfurProject
 
Maarten de groot_ birds_and_insects_slo
Maarten de groot_ birds_and_insects_slo Maarten de groot_ birds_and_insects_slo
Maarten de groot_ birds_and_insects_slo EmonfurProject
 
Colangelo synergies it
Colangelo synergies itColangelo synergies it
Colangelo synergies itEmonfurProject
 
Colangelo_introduction
Colangelo_introductionColangelo_introduction
Colangelo_introductionEmonfurProject
 
Colangelo forests results_it
Colangelo forests results_itColangelo forests results_it
Colangelo forests results_itEmonfurProject
 
Preliminary results of soil monitoring of slovenian partner slo
Preliminary results of soil monitoring of slovenian partner sloPreliminary results of soil monitoring of slovenian partner slo
Preliminary results of soil monitoring of slovenian partner sloEmonfurProject
 
Emonfur protocol sanesi
Emonfur protocol sanesiEmonfur protocol sanesi
Emonfur protocol sanesiEmonfurProject
 
Bisconti gini la carta_di_milano
Bisconti gini la carta_di_milanoBisconti gini la carta_di_milano
Bisconti gini la carta_di_milanoEmonfurProject
 
Selleri esperienze dalla_europa
Selleri esperienze dalla_europaSelleri esperienze dalla_europa
Selleri esperienze dalla_europaEmonfurProject
 
Calvo sanesi i_risultati_emonfur
Calvo sanesi i_risultati_emonfur Calvo sanesi i_risultati_emonfur
Calvo sanesi i_risultati_emonfur EmonfurProject
 
Ozone upf rupel_emonfur_17062014_pptx
Ozone upf rupel_emonfur_17062014_pptxOzone upf rupel_emonfur_17062014_pptx
Ozone upf rupel_emonfur_17062014_pptxEmonfurProject
 
Bozic kobe emonfur_17062014_ppt
Bozic kobe emonfur_17062014_ppt Bozic kobe emonfur_17062014_ppt
Bozic kobe emonfur_17062014_ppt EmonfurProject
 
Miglietta_il bene albero
Miglietta_il bene alberoMiglietta_il bene albero
Miglietta_il bene alberoEmonfurProject
 

More from EmonfurProject (20)

Padoa schioppa fauna monitoring
Padoa schioppa fauna monitoringPadoa schioppa fauna monitoring
Padoa schioppa fauna monitoring
 
Kutnar flora and_vegetation
Kutnar flora and_vegetationKutnar flora and_vegetation
Kutnar flora and_vegetation
 
Skudnik emonfur
Skudnik emonfurSkudnik emonfur
Skudnik emonfur
 
Jurc et urban forest health problems_slo
Jurc et urban forest health problems_slo Jurc et urban forest health problems_slo
Jurc et urban forest health problems_slo
 
Ginetti patologia it
Ginetti patologia itGinetti patologia it
Ginetti patologia it
 
Digiovinazzo vegetation and_flora_it
Digiovinazzo vegetation and_flora_itDigiovinazzo vegetation and_flora_it
Digiovinazzo vegetation and_flora_it
 
Maarten de groot_ birds_and_insects_slo
Maarten de groot_ birds_and_insects_slo Maarten de groot_ birds_and_insects_slo
Maarten de groot_ birds_and_insects_slo
 
Colangelo synergies it
Colangelo synergies itColangelo synergies it
Colangelo synergies it
 
Colangelo_introduction
Colangelo_introductionColangelo_introduction
Colangelo_introduction
 
Colangelo forests results_it
Colangelo forests results_itColangelo forests results_it
Colangelo forests results_it
 
Preliminary results of soil monitoring of slovenian partner slo
Preliminary results of soil monitoring of slovenian partner sloPreliminary results of soil monitoring of slovenian partner slo
Preliminary results of soil monitoring of slovenian partner slo
 
Comolli suolo
Comolli suoloComolli suolo
Comolli suolo
 
Bascietto
BasciettoBascietto
Bascietto
 
Emonfur protocol sanesi
Emonfur protocol sanesiEmonfur protocol sanesi
Emonfur protocol sanesi
 
Bisconti gini la carta_di_milano
Bisconti gini la carta_di_milanoBisconti gini la carta_di_milano
Bisconti gini la carta_di_milano
 
Selleri esperienze dalla_europa
Selleri esperienze dalla_europaSelleri esperienze dalla_europa
Selleri esperienze dalla_europa
 
Calvo sanesi i_risultati_emonfur
Calvo sanesi i_risultati_emonfur Calvo sanesi i_risultati_emonfur
Calvo sanesi i_risultati_emonfur
 
Ozone upf rupel_emonfur_17062014_pptx
Ozone upf rupel_emonfur_17062014_pptxOzone upf rupel_emonfur_17062014_pptx
Ozone upf rupel_emonfur_17062014_pptx
 
Bozic kobe emonfur_17062014_ppt
Bozic kobe emonfur_17062014_ppt Bozic kobe emonfur_17062014_ppt
Bozic kobe emonfur_17062014_ppt
 
Miglietta_il bene albero
Miglietta_il bene alberoMiglietta_il bene albero
Miglietta_il bene albero
 

Recently uploaded

Artificial intelligence in the post-deep learning era
Artificial intelligence in the post-deep learning eraArtificial intelligence in the post-deep learning era
Artificial intelligence in the post-deep learning eraDeakin University
 
Science&tech:THE INFORMATION AGE STS.pdf
Science&tech:THE INFORMATION AGE STS.pdfScience&tech:THE INFORMATION AGE STS.pdf
Science&tech:THE INFORMATION AGE STS.pdfjimielynbastida
 
"Federated learning: out of reach no matter how close",Oleksandr Lapshyn
"Federated learning: out of reach no matter how close",Oleksandr Lapshyn"Federated learning: out of reach no matter how close",Oleksandr Lapshyn
"Federated learning: out of reach no matter how close",Oleksandr LapshynFwdays
 
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024BookNet Canada
 
SIEMENS: RAPUNZEL – A Tale About Knowledge Graph
SIEMENS: RAPUNZEL – A Tale About Knowledge GraphSIEMENS: RAPUNZEL – A Tale About Knowledge Graph
SIEMENS: RAPUNZEL – A Tale About Knowledge GraphNeo4j
 
Install Stable Diffusion in windows machine
Install Stable Diffusion in windows machineInstall Stable Diffusion in windows machine
Install Stable Diffusion in windows machinePadma Pradeep
 
Tech-Forward - Achieving Business Readiness For Copilot in Microsoft 365
Tech-Forward - Achieving Business Readiness For Copilot in Microsoft 365Tech-Forward - Achieving Business Readiness For Copilot in Microsoft 365
Tech-Forward - Achieving Business Readiness For Copilot in Microsoft 3652toLead Limited
 
Benefits Of Flutter Compared To Other Frameworks
Benefits Of Flutter Compared To Other FrameworksBenefits Of Flutter Compared To Other Frameworks
Benefits Of Flutter Compared To Other FrameworksSoftradix Technologies
 
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...Patryk Bandurski
 
Designing IA for AI - Information Architecture Conference 2024
Designing IA for AI - Information Architecture Conference 2024Designing IA for AI - Information Architecture Conference 2024
Designing IA for AI - Information Architecture Conference 2024Enterprise Knowledge
 
CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):comworks
 
Scanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsScanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsRizwan Syed
 
"LLMs for Python Engineers: Advanced Data Analysis and Semantic Kernel",Oleks...
"LLMs for Python Engineers: Advanced Data Analysis and Semantic Kernel",Oleks..."LLMs for Python Engineers: Advanced Data Analysis and Semantic Kernel",Oleks...
"LLMs for Python Engineers: Advanced Data Analysis and Semantic Kernel",Oleks...Fwdays
 
Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?Mattias Andersson
 
Unlocking the Potential of the Cloud for IBM Power Systems
Unlocking the Potential of the Cloud for IBM Power SystemsUnlocking the Potential of the Cloud for IBM Power Systems
Unlocking the Potential of the Cloud for IBM Power SystemsPrecisely
 
Pigging Solutions Piggable Sweeping Elbows
Pigging Solutions Piggable Sweeping ElbowsPigging Solutions Piggable Sweeping Elbows
Pigging Solutions Piggable Sweeping ElbowsPigging Solutions
 
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmaticsKotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmaticsAndrey Dotsenko
 
Bluetooth Controlled Car with Arduino.pdf
Bluetooth Controlled Car with Arduino.pdfBluetooth Controlled Car with Arduino.pdf
Bluetooth Controlled Car with Arduino.pdfngoud9212
 

Recently uploaded (20)

Artificial intelligence in the post-deep learning era
Artificial intelligence in the post-deep learning eraArtificial intelligence in the post-deep learning era
Artificial intelligence in the post-deep learning era
 
Science&tech:THE INFORMATION AGE STS.pdf
Science&tech:THE INFORMATION AGE STS.pdfScience&tech:THE INFORMATION AGE STS.pdf
Science&tech:THE INFORMATION AGE STS.pdf
 
"Federated learning: out of reach no matter how close",Oleksandr Lapshyn
"Federated learning: out of reach no matter how close",Oleksandr Lapshyn"Federated learning: out of reach no matter how close",Oleksandr Lapshyn
"Federated learning: out of reach no matter how close",Oleksandr Lapshyn
 
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
 
DMCC Future of Trade Web3 - Special Edition
DMCC Future of Trade Web3 - Special EditionDMCC Future of Trade Web3 - Special Edition
DMCC Future of Trade Web3 - Special Edition
 
SIEMENS: RAPUNZEL – A Tale About Knowledge Graph
SIEMENS: RAPUNZEL – A Tale About Knowledge GraphSIEMENS: RAPUNZEL – A Tale About Knowledge Graph
SIEMENS: RAPUNZEL – A Tale About Knowledge Graph
 
Install Stable Diffusion in windows machine
Install Stable Diffusion in windows machineInstall Stable Diffusion in windows machine
Install Stable Diffusion in windows machine
 
Tech-Forward - Achieving Business Readiness For Copilot in Microsoft 365
Tech-Forward - Achieving Business Readiness For Copilot in Microsoft 365Tech-Forward - Achieving Business Readiness For Copilot in Microsoft 365
Tech-Forward - Achieving Business Readiness For Copilot in Microsoft 365
 
Benefits Of Flutter Compared To Other Frameworks
Benefits Of Flutter Compared To Other FrameworksBenefits Of Flutter Compared To Other Frameworks
Benefits Of Flutter Compared To Other Frameworks
 
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
 
Designing IA for AI - Information Architecture Conference 2024
Designing IA for AI - Information Architecture Conference 2024Designing IA for AI - Information Architecture Conference 2024
Designing IA for AI - Information Architecture Conference 2024
 
CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):
 
Scanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsScanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL Certs
 
"LLMs for Python Engineers: Advanced Data Analysis and Semantic Kernel",Oleks...
"LLMs for Python Engineers: Advanced Data Analysis and Semantic Kernel",Oleks..."LLMs for Python Engineers: Advanced Data Analysis and Semantic Kernel",Oleks...
"LLMs for Python Engineers: Advanced Data Analysis and Semantic Kernel",Oleks...
 
Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?
 
E-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptx
E-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptxE-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptx
E-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptx
 
Unlocking the Potential of the Cloud for IBM Power Systems
Unlocking the Potential of the Cloud for IBM Power SystemsUnlocking the Potential of the Cloud for IBM Power Systems
Unlocking the Potential of the Cloud for IBM Power Systems
 
Pigging Solutions Piggable Sweeping Elbows
Pigging Solutions Piggable Sweeping ElbowsPigging Solutions Piggable Sweeping Elbows
Pigging Solutions Piggable Sweeping Elbows
 
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmaticsKotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
 
Bluetooth Controlled Car with Arduino.pdf
Bluetooth Controlled Car with Arduino.pdfBluetooth Controlled Car with Arduino.pdf
Bluetooth Controlled Car with Arduino.pdf
 

Disease management in urban forests

  • 1. Università degli Studi di Firenze Dipartimento di Scienze delle Produzioni Agroalimentari e dell’Ambiente (DISPAA) Sezione di Patologia vegetale ed Entomologia Action 16 & Action 17 Establishing a monitoring network to assess lowland forest and urban plantation in Lombardy and urban forest in Slovenia
  • 2. Disease management in urban forests Alessandro Ragazzi, Beatrice Ginetti, Salvatore Moricca Phytopathology unit www.pmnatura
  • 3. Species: Acer pseudoplatanus, Quercus robur, Alnus cordata Sampling years: 2005 , 2006 Sampling months: march…………october = 8 Number of sampled plants per species: 3 healthy and 3 declining = 18 (9 + 9) Number of samples per plant: two plants every month = 288 (144 + 144) Number of Petri dishes per sample: 5 = 1440 (720 + 720) Number of Petri dishes evaluated (of the 5 dishes above): 3 = 864 (432 + 432) Number of samples seeded per Petri dishe: 5 = 4320 (2160 + 2160) Protocol of sampling and isolation
  • 4. which pathogens have we found???? strakerenemy.blogspot.com
  • 5. Biscogniauxia mediterranea (De Not) Kuntze Agente di cancro carbonioso Agent of charcoal canker Protologo: Kuntze, O. 1891, Revisio generum plantarum: 398 Basionym: Sphaeria mediterranea De Not., 1851 Position in classification: Xylariaceae, Xylariales, Xylariomycetidae, Sordariomycetes, Pezizomycotina, Ascomycota,
  • 6. Biscogniauxia mediterranea (De Not) Kuntze EPPO Alert list Quercus spp. Fraxinus excelsior Fagus sylvatica Castanea sativa From Marocco present all the our peninsula, including the islands Foto Capretti-Ragazzi
  • 7. Botryosphaeria dothidea (Moug. ex Fr.) Ces. et De Not. Agente di cancro corticale Agent of cortical canker Protologo: Cesati et De Notaris 1863, Comm. Soc. crittog. Ital. 1 (4): 212 Sanctioning author: Fr. (SM2 : 423, Sphaeria dothidea) Anamorph: Fusicoccum aesculi Position in classification: Botryosphaeriaceae, Botryosphaeriales, Ascomycota
  • 8. Botryosphaeria dothidea (Moug. Ex Fr.) Ces. Et De Not. EPPO Alert list Acer pseudoplatanus Quercus rubra Q. robur Q. suber Ostrya spp. Platanus spp. present all the our peninsula, including the islands
  • 9. Locus: DQ168265 466 bp DNA linear PLN 04.10-2005 Definition: Botryosphaeria dothidea isolate B5 internal transcribed spacer 1. Partial sequence; 5.8 ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal gene, partial sequence. Accession: DQ168265 Version: DQ168265; GI: 76563848 Reference: 1 Journal: Plant Disease Origin: 1 GCGGGCCGCG GTCCTCCGCG GCCGGCCCCC CTCCCCGGGG GGTGGCCAGC 51 GCCCGCCAGA GGACCATCAA ACTCCAGTCA GTAAACGATG CATCTGAAAA 101 AACATTTAAT TTTAAACTAA AACC ... 151 Molecular characterization of Botryosphaeria dothidea (target regions of ribosomial DNA )
  • 10. Botryosphaeria parva Pennycook & Samuels Botryosphaeria obtusa (Schwein.) Shoemaker Neofusicoccum parvum (Pennycook & Samuels) Crous, Slippers & A.J.L. Phillips Diplodia seriata De Not Foto Capretti
  • 11. ……and a very high number of endophytic fungi (pathogens and other)
  • 12. Plots Non thinned plot (2Ant) State of healthy Symptomatic Asymptomatic Endophytic fungi 2011 2012 2013 2011 2012 2013 Alternaria alternata (Fr.: Fr.) Keissl. 4.2 4.7 5.8 3.9 * * Apiognomonia quercina (Kleb) Höhn 8.1a 3.1a 5.6a 4.4a 3.2a * Aposphaereia sp. * * * - - - Aureobasidium pullulans (de Bary et al.) 3.0 3.1 * 3.1 * * Biscogniauxia mediterranea (De Not.) Kuntze 7.7a 3.1a 4.4a * * * Botryosphaeria dothidea (Moug et al.) 51.6b 33.3b 41.4b 30.2b 17.6b 13.8a Ceratocystis coerulescens (Münch) Bakshi 7.8a 4.3a 5.4a 4.9a 4.3a 4.1b Chaetomium indicum Corda 3.1 * * - - Cladosporium herbarum Pers.: Fr. - - - - - - Curvularia lunata (Wakker) Boedijn 8.1 * * 6.7 6.4 6.3 Diplodia mutila (Fr.) Mont. 29.6c 17.4c 23.4c 17.1c 11.9c 10.4c Tab. 3 – Endophytic fungi detected in twigs of symptomatic and asymptomatic tress, isolated from thinned (2At) and non thinned (2Ant) plot in North Park (Lombardy, North Italy). The data show the average value of the endophytic assemblage of seven trees present in both plots: Acer pseudoplatanus, Alnus cordata, Fraxinus angustifolia, F. excelsior, F. ornus, Quercus cerris, Q. robur. The colonization frequency is expressed as percentage. t = thinned; nt = non thinned Tab. 3 – Endophytic fungi detected in twigs of symptomatic and asymptomatic tress, isolated from thinned (2At) and non thinned (2Ant) plot in North Park (Lombardy, North Italy). The data show the average value of the endophytic assemblage of seven trees present in both plots: Acer pseudoplatanus, Alnus cordata, Fraxinus angustifolia, F. excelsior, F. ornus, Quercus cerris, Q. robur. The colonization frequency is expressed as percentage. t = thinned; nt = non thinned
  • 13. Diplodina acerina (Pass.) B. Sutton 6.8a 3.8a 4.9a 3.3a * * Epicoccum nigrum Link 6.4 6.6 5.9 7.1 7.6 7.3 Gliomastix murorum (Corda) S. Hughes 7.1 7.9 6.8 11.6 10.2 10.9 Glomerella cingulata (Stoneman et al.) 3.2 3.0 3.1 - - - Gnomonia sp. * * * - - - Nectria sp. 4.2 * * 3.6 4.2 4.1 Neofusicoccum parvum (Pennycook et al.) 52.2b 30.3b 44.1b 28.7b 19.1b 17.6d Phialocephala sp. 4.9 5.2 5.0 - - - Phomopsis quercina (Sacc.) Höhn. ex Died. 8.2a 3.4a 5.1a 11.0d 4.1a 3.4b Phomopsis acerina Pirone & J.C. Carter 4.2d 3.3a 4.1a 3.2a * 3.3b Pseudovalsa longipes (Tul.) Sacc. 3.8d * * 4.3a 3.2a 3.9b Ramichloridium sp. - - - - - - Septoria alni Sacc. 7.3a 3.3a 4.8a 4.2a 4.1a 3.2b Trichoderma atroviride P. Karst. 18.8 16.4 16.6 20.9 18.8 17.4 Trichoderma viride Pers.: Fries 19.1 17.7 17.6 20.6 18.8 18.9 Values in column followed by the same letter do not differ significantly per P< 0,05. Duncan’s Multiple Range Test performed according to the values of only fungal (endophytic) pathogens. *Isolation frequency below the 3% threshold
  • 14. Outside the LIFE plots, we found some important pathogens
  • 15. a lot of Phytophthora species… •Phytophthora lacustris •Phytophthora taxon Pg chlamydo (1^ report in Italy) •Phytophthora gonapodyides •Phytophthora inundata •Phytophthora taxon walnut (1^ report in Italy) •Potential hybrid between P. lacustris et P. Pg chlamydo The new pathogen Phytophthora acerina (first description ) Phytophthora acerina B.Ginetti, T. Jung, D.E.L. Cooke, S. Moricca sp. nov.
  • 16. Phytophthora acerina B. Ginetti, T. Jung, D.E.L. Cooke , S. Moricca sp. nov. Peronosporaceae, Incertae sedis, Oomycota, Chromista not yet included in the EPPO lists Acer pseudoplatanus Lombardia causal agent of widespread sycamore maple mortality
  • 17. Anthostoma decipiens (DC.) Nitschke Agent of canker Basionym: Sphaeria decipiens DC., in Lamarck et de Candolle 1805 Sanctioning author: Fr. Citations in published lists or literature: Saccardo's Syll. fung. I: 302; III: 263; XII: 21; XV: 45 Position in classification : Diatrypaceae, Xylariales, Xylariomycetidae, Sordariomycetes, Pezizomycotina, Ascomycota causal agent of widespread hornbeam mortality
  • 19. First Match: Anthostoma decipiens 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, ITS2 and 28S rRNA gene (partial), strain IPV-FW349 Score Expect Identities Gaps Strand Frame 1003 bits(543) 0.0() 559/566(99%) 3/566(0%) Plus/Plus Query 8 CGTTGGTG-ACCAGCGGAGGGATCATTACAGAGTTATTTATCTCCT-AACCTTATGTGAA 65 ||| |||| ||| ||||||||||||||||||||||||||| ||||| ||||||||||||| Sbjct 3 CGTAGGTGAACCTGCGGAGGGATCATTACAGAGTTATTTAACTCCTAAACCTTATGTGAA 62 Query 66 CTTACCTATGTTGCCTCGGCGAGGAAAGCCTACCCTGTAGTTACTTGGAGGCGAGCTACC 125 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct 63 CTTACCTATGTTGCCTCGGCGAGG-AAGCCTACCCTGTAGTTACTTGGAGGCGAGCTACC 121 Query 126 CTGTAGCCCGCTGCTGGCTAACCCGTCGATGGACCATTCTAACTCTTGTTTTTCTGTGGC 185 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 122 CTGTAGCCCGCTGCTGGCTAACCCGTCGATGGACCATTCTAACTCTTGTTTTTCTGTGGC 181 Query 186 ACATCTGAATCGTTTATACTTAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTG 245 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 182 ACATCTGAACCGTTTATACTTAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTG 241 Query 246 GCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 242 GCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT 301 Query 306 CATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAG 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 302 CATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAG 361 Query 366 CGTCATTTCGACCATCAAGTCTTATTTGCTTGGAGTTGGGAATTTGCTTGCAAGTAATTC 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 362 CGTCATTTCGACCATCAAGTCTTATTTGCTTGGAGTTGGGAATTTGCTTGCAAGTAATTC 421 Query 426 CTTAAAATTATTGGCGGAGTTGCGATAACCCCAAGCGTAGTAATTATCTCTCGCTTTCGG 485 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 422 CTTAAAATTATTGGCGGAGTTGCGATAACCCCAAGCGTAGTAATTATCTCTCGCTTTCGG 481 Query 486 TGTGTTAGCGCTGACATTTAGCCGTTAAACCCTCTATATTTATGTAGGTTTGACCTCGGA 545 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 482 TGTGTTAGCGCTGACATTTAGCCGTTAAACCCTCTATATTTATGTAGGTTTGACCTCGGA 541 Query 546 TCAGGTAGGAATACCCGCTGAACTTA 571 |||||||||||||||||||||||||| Sbjct 542 TCAGGTAGGAATACCCGCTGAACTTA 567
  • 21. Eliminate in winter death or diseased plants Avoid sawdust, or limit its spread, during cutting and pruning Remove and destroy the cut material Extirpate the stumps Avoid any type of wound Prune only during the winter months Protect large cutting surface with polyvinylic paste added with a chemical compound or with biological mastic Periodically check the large cutting surface to control the development of the scaring process Importe propagating material only from areas where there are not reported some pathogens Respect the distance in new plantations Use resistant clones Observe the decrees of obligatory control Educate the staff that manages the urban green General criteria for urban forest
  • 22. Inform the citizenship Make the treatment in the early morning or evening ones Never make treatment in presence of wind Prohibit access to treated areas Ensure the protection of the operator Use of chemical compounds at doses indicated on the label Before proceeding to a treatment in urban areas need to follow specific precautions: www.magieraansaloni.it
  • 23. Prescriptions at European level to adopt criteria in urban and suburban area for a phytosanitary pruning Prevent cutting, keeping the plants in appropriate conditions (distance) Prevent cutting of large twigs and branches working on small branches, on which the compartimentation is more easy Cutting after windbreakage or traumatic wounds: need to trim the injured part and protect the exposed tissues Cutting due to decay or necrotic processes: make the cut on the surface healthy (15- 20 cm below the dead tissue). Protect the exposed tissues. Cutting of twigs or branches dead: the practice of "Dead-wooding" is needed to secure the plant, thereby eliminating not only the dead branches, but even those with necrotic phenomena in extension Lightening of the crown: fundamental in areas with presence of foliar fungal agents. The lowest humidity values of a crown "lightened" in fact hamper many pathogns. Moreover a lightened crown, in high windy areas, allows the wind to traverse the crown without resistance, thus avoiding injuries, potential sites of entry of pathogenic agents The cutting must always be carried out in the vicinity of buds or other branches, in order to allow the plant to form the healing tissue
  • 24. Criteria to control Biscogniauxia mediterranea (Franceschini, com. pers.) Reduce the inoculum mass through the cutting of infected plants and pruning of branches by way of desiccation or with cankers Burn all the material or to carry it away, making sure to cover it with a cloth during wood hauling If the spread of the pathogen is not yet at epidemic level, we can cut as simple coppice. The consequent "opening of the forest" create conditions less favourable to the spread of the pathogen If the pathogen reached an epidemic spreading is necessary to proceed as coppice with standards or with a conversion to a high forest. In this case, instead of preventing the further spread of the pathogen, is more important to maintain soil moisture to avoid the plants come easily in water stress resulting in colonization of its organs by the pathogen
  • 25. Criteria to control Phytophthora spp. . . Strict quarantine rules Obligation to contact Regional plant protection services Cortical treatments with phosphites and tacky at the base of the trunk, repeating annually in the spring Inspection of imported plants In case we suspect the presence of Phytophthora in soil, it’s recommende soil treatment, having uprooted and destroyed symptomatic plants, using sunburn.
  • 26. Criteria to control endophytic fungi ???????????????????????????????????????? Avoid thermic and water stress to the plants Reduce the inoculum biomass by a phytosanitary pruning Biological control in planta??? Pre-immunization??
  • 27. The results of our work are perhaps the first to point out that a thinning can lead to an increase in the incidence of some fungal pathogenic endophytes in forest trees. Increase the biomass of leaves, understood as “a territory” by colonizing The Thinning