Microbiology Research - Academic Journals

African Journal of 

Microbiology Research 

Volume 5 Number 32 30 December, 2011 

ISSN 1996-0808

About AJMR 

The African Journal of Microbiology Research is published monthly (one volume per year) by Academic 

Journals. 

The African Journal of Microbiology Research (ISSN 1996-0808, IMPACT FACTOR 0.533) is an open access 

journal that provides rapid publication (weekly) of articles in all areas of Microbiology such as: Environmental 

Microbiology, Clinical Microbiology, Immunology, Viriology, Bacteriology, Phycology, Mycology and 

Parasitology, Protozoology, Microbial Ecology, Probiotics and Prebiotics, Molecular Microbiology, 

Biotechnology, Food Microbiology, Industrial Microbiology, Cell Physiology, Environmental Biotechnology, 

Genetics, Enzymology, Molecular and Cellular Biology, Plant Pathology, Entomology, Biomedical Sciences, 

Botany and Plant Sciences, Soil and Environmental Sciences, Zoology, Endocrinology, Toxicology. The Journal 

welcomes the submission of manuscripts that meet the general criteria of significance and scientific excellence. 

Papers will be published shortly after acceptance. All articles are peer-reviewed. 

Submission of Manuscript 

Submit manuscripts as e-mail attachment to the Editorial Office at: ajmr@acadjournals.org. A manuscript 

number will be mailed to the corresponding author shortly after submission. 

The African Journal of Microbiology Research will only accept manuscripts submitted as e-mail attachments. 

Please read the Instructions for Authors before submitting your manuscript. The manuscript files should be 

given the last name of the first author.

Editors 

Prof. Dr. Stefan Schmidt 

Applied and Environmental Microbiology 

School of Biochemistry, Genetics and Microbiology 

University of KwaZulu-Natal 

Private Bag X01 

Scottsville, Pietermaritzburg 3209 

South Africa. 

E-mail: ajmr.acadjourn@gmail.com 

Prof. Veronica Chima Nwosu (nee Dike) 

Department of Microbiology and Immunology 

Kunming Medical University 

Kunming 650031, 

China. 

Donovan Anthony McGrowder 

Dr. Jianfeng Wu 

Dept. of Environmental Health Sciences, 

School of Public Health, 

University of Michigan 

USA 

Dr. Ahmet Yilmaz Coban 

OMU Medical School, 

Department of Medical Microbiology, 

Samsun, 

Turkey.

Editorial Board 

Dr. Kwang Young Song 

Department of Biological Engineering, 

School of Biological and Chemical Engineering, 

Yanbian Universityof Science and Technology, 

Yanji, 

China. 

Dr. Kamel Belhamel 

Faculty of Technology, 

University of Bejaia 

Algeria. 

Dr. Sladjana Jevremovic 

Institute for Biological Research 

Sinisa Stankovic, 

Belgrade, 

Serbia. 

Dr. Tamer Edirne 

Dept. of Family Medicine, Univ. of Pamukkale 

Turkey. 

Dr. R. Balaji Raja M.Tech (Ph.D) 

Assistant Professor, 

Department of Biotechnology, 

School of Bioengineering, 

SRM University, 

Chennai. 

India 

Dr. Mohd Fuat ABD Razak 

Institute for Medical Research 

Malaysia. 

Dr. Minglei Wang 

University of Illinois at Urbana-Champaign 

USA. 

Dr. Davide Pacifico 

Istituto di Virologia Vegetale – CNR 

Italy. 

Prof. Branislava Kocic 

Specaialist of Microbiology and Parasitology 

University of Nis, School of Medicine Institute 

for Public Health Nis, Bul. Z. Djindjica 50, 18000 Nis 

Serbia. 

Dr. Ntobeko A. B. Ntusi 

Cardiac Clinic, Department of Medicine, 

University of Cape Town and 

Department of Cardiovascular Medicine, 

University of Oxford 

South Africa and 

United Kingdom. 

Prof. N. S. Alzoreky 

Food Science & Nutrition Department, 

College of Agricultural Sciences & Food, 

King Faisal University, 

Saudi Arabia. 

Dr. Sivakumar Swaminathan 

Department of Agronomy, 

College of Agriculture and Life Sciences, 

Iowa State University, 

Ames, Iowa 50011 

USA. 

Dr. Alfredo J. Anceno. 

School of Environment, Resources and Development (SERD), 

Asian Institute of Technology, 

Thailand. 

Dr. Okonko, Iheanyi Omezuruike 

Department of Virology, 

Faculty of Basic Medical Sciences, 

College of Medicine, 

University of Ibadan, 

University College Hospital, 

Ibadan, 

Nigeria. 

Dr. S. Meena Kumari 

Department of Biosciences 

Faculty of Science 

University of Mauritius 

Reduit 

Mauritius. 

Luki Subehi 

Parasitology & Mycology Dept, 

Baghaeei Lab., 

Shams Abadi St. 

Isfahan 

Iran.

Electronic submission of manuscripts is strongly 

encouraged, provided that the text, tables, and figures are 

included in a single Microsoft Word file (preferably in Arial 

font). 

The cover letter should include the corresponding author's 

full address and telephone/fax numbers and should be in 

an e-mail message sent to the Editor, with the file, whose 

name should begin with the first author's surname, as an 

attachment. 

Article Types 

Three types of manuscripts may be submitted: 

Regular articles: These should describe new and carefully 

confirmed findings, and experimental procedures should 

be given in sufficient detail for others to verify the work. 

The length of a full paper should be the minimum required 

to describe and interpret the work clearly. 

Short Communications: A Short Communication is suitable 

for recording the results of complete small investigations 

or giving details of new models or hypotheses, innovative 

methods, techniques or apparatus. The style of main 

sections need not conform to that of full-length papers. 

Short communications are 2 to 4 printed pages (about 6 to 

12 manuscript pages) in length. 

Reviews: Submissions of reviews and perspectives covering 

topics of current interest are welcome and encouraged. 

Reviews should be concise and no longer than 4-6 printed 

pages (about 12 to 18 manuscript pages). Reviews are also 

peer-reviewed. 

Review Process 

Instructions for Author 

All manuscripts are reviewed by an editor and members of 

the Editorial Board or qualified outside reviewers. Authors 

cannot nominate reviewers. Only reviewers randomly 

selected from our database with specialization in the 

subject area will be contacted to evaluate the manuscripts. 

The process will be blind review. 

Decisions will be made as rapidly as possible, and the 

journal strives to return reviewers’ comments to authors as 

fast as possible. The editorial board will re-review 

manuscripts that are accepted pending revision. It is the 

goal of the AJMR to publish manuscripts within weeks 

after submission. 

Regular articles 

All portions of the manuscript must be typed doublespaced 

and all pages numbered starting from the title 

page. 

The Title should be a brief phrase describing the 

contents of the paper. The Title Page should include the 

authors' full names and affiliations, the name of the 

corresponding author along with phone, fax and E-mail 

information. Present addresses of authors should 

appear as a footnote. 

The Abstract should be informative and completely selfexplanatory, 

briefly present the topic, state the scope of 

the experiments, indicate significant data, and point out 

major findings and conclusions. The Abstract should be 

100 to 200 words in length.. Complete sentences, active 

verbs, and the third person should be used, and the 

abstract should be written in the past tense. Standard 

nomenclature should be used and abbreviations should 

be avoided. No literature should be cited. 

Following the abstract, about 3 to 10 key words that will 

provide indexing references should be listed. 

A list of non-standard Abbreviations should be added. 

In general, non-standard abbreviations should be used 

only when the full term is very long and used often. 

Each abbreviation should be spelled out and introduced 

in parentheses the first time it is used in the text. Only 

recommended SI units should be used. Authors should 

use the solidus presentation (mg/ml). Standard 

abbreviations (such as ATP and DNA) need not be 

defined. 

The Introduction should provide a clear statement of 

the problem, the relevant literature on the subject, and 

the proposed approach or solution. It should be 

understandable to colleagues from a broad range of 

scientific disciplines. 

Materials and methods should be complete enough 

to allow experiments to be reproduced. However, only 

truly new procedures should be described in detail; 

previously published procedures should be cited, and 

important modifications of published procedures should 

be mentioned briefly. Capitalize trade names and 

include the manufacturer's name and address. 

Subheadings should be used. Methods in general use 

need not be described in detail.

Results should be presented with clarity and precision. 

The results should be written in the past tense when 

describing findings in the authors' experiments. 

Previously published findings should be written in the 

present tense. Results should be explained, but largely 

without referring to the literature. Discussion, 

speculation and detailed interpretation of data should 

not be included in the Results but should be put into the 

Discussion section. 

The Discussion should interpret the findings in view of 

the results obtained in this and in past studies on this 

topic. State the conclusions in a few sentences at the end 

of the paper. The Results and Discussion sections can 

include subheadings, and when appropriate, both 

sections can be combined. 

The Acknowledgments of people, grants, funds, etc 

should be brief. 

Tables should be kept to a minimum and be designed to 

be as simple as possible. Tables are to be typed doublespaced 

throughout, including headings and footnotes. 

Each table should be on a separate page, numbered 

consecutively in Arabic numerals and supplied with a 

heading and a legend. Tables should be self-explanatory 

without reference to the text. The details of the methods 

used in the experiments should preferably be described 

in the legend instead of in the text. The same data should 

not be presented in both table and graph form or 

repeated in the text. 

Figure legends should be typed in numerical order on a 

separate sheet. Graphics should be prepared using 

applications capable of generating high resolution GIF, 

TIFF, JPEG or Powerpoint before pasting in the Microsoft 

Word manuscript file. Tables should be prepared in 

Microsoft Word. Use Arabic numerals to designate 

figures and upper case letters for their parts (Figure 1). 

Begin each legend with a title and include sufficient 

description so that the figure is understandable without 

reading the text of the manuscript. Information given in 

legends should not be repeated in the text. 

References: In the text, a reference identified by means 

of an author‘s name should be followed by the date of 

the reference in parentheses. When there are more than 

two authors, only the first author‘s name should be 

mentioned, followed by ’et al‘. In the event that an 

author cited has had two or more works published during 

the same year, the reference, both in the text and in the 

reference list, should be identified by a lower case letter 

like ’a‘ and ’b‘ after the date to distinguish the works. 

Examples: 

Abayomi (2000), Agindotan et al. (2003), (Kelebeni, 

1983), (Usman and Smith, 1992), (Chege, 1998; 

1987a,b; Tijani, 1993,1995), (Kumasi et al., 2001) 

References should be listed at the end of the paper in 

alphabetical order. Articles in preparation or articles 

submitted for publication, unpublished observations, 

personal communications, etc. should not be included 

in the reference list but should only be mentioned in 

the article text (e.g., A. Kingori, University of Nairobi, 

Kenya, personal communication). Journal names are 

abbreviated according to Chemical Abstracts. Authors 

are fully responsible for the accuracy of the references. 

Examples: 

Chikere CB, Omoni VT and Chikere BO (2008). 

Distribution of potential nosocomial pathogens in a 

hospital environment. Afr. J. Biotechnol. 7: 3535-3539. 

Moran GJ, Amii RN, Abrahamian FM, Talan DA (2005). 

Methicillinresistant Staphylococcus aureus in 

community-acquired skin infections. Emerg. Infect. Dis. 

11: 928-930. 

Pitout JDD, Church DL, Gregson DB, Chow BL, 

McCracken M, Mulvey M, Laupland KB (2007). 

Molecular epidemiology of CTXM-producing 

Escherichia coli in the Calgary Health Region: 

emergence of CTX-M-15-producing isolates. 

Antimicrob. Agents Chemother. 51: 1281-1286. 

Pelczar JR, Harley JP, Klein DA (1993). Microbiology: 

Concepts and Applications. McGraw-Hill Inc., New York, 

pp. 591-603. 

Short Communications 

Short Communications are limited to a maximum of 

two figures and one table. They should present a 

complete study that is more limited in scope than is 

found in full-length papers. The items of manuscript 

preparation listed above apply to Short 

Communications with the following differences: (1) 

Abstracts are limited to 100 words; (2) instead of a 

separate Materials and Methods section, experimental 

procedures may be incorporated into Figure Legends 

and Table footnotes; (3) Results and Discussion should 

be combined into a single section. 

Proofs and Reprints: Electronic proofs will be sent (email 

attachment) to the corresponding author as a PDF 

file. Page proofs are considered to be the final version 

of the manuscript. With the exception of typographical 

or minor clerical errors, no changes will be made in the 

manuscript at the proof stage.

Fees and Charges: Authors are required to pay a $550 handling fee. Publication of an article in the African Journal of 

Microbiology Research is not contingent upon the author's ability to pay the charges. Neither is acceptance to pay the 

handling fee a guarantee that the paper will be accepted for publication. Authors may still request (in advance) that 

the editorial office waive some of the handling fee under special circumstances. 

Copyright: © 2012, Academic Journals. 

All rights Reserved. In accessing this journal, you agree that you will access the contents for your own personal use 

but not for any commercial use. Any use and or copies of this Journal in whole or in part must include the customary 

bibliographic citation, including author attribution, date and article title. 

Submission of a manuscript implies: that the work described has not been published before (except in the form of an 

abstract or as part of a published lecture, or thesis) that it is not under consideration for publication elsewhere; that if 

and when the manuscript is accepted for publication, the authors agree to automatic transfer of the copyright to the 

publisher. 

Disclaimer of Warranties 

In no event shall Academic Journals be liable for any special, incidental, indirect, or consequential damages of any 

kind arising out of or in connection with the use of the articles or other material derived from the AJMR whether or 

not advised of the possibility of damage, and on any theory of liability. 

This publication is provided "as is" without warranty of any kind, either expressed or implied, including, but not 

limited to, the implied warranties of merchantability, fitness for a particular purpose, or non-infringement. 

Descriptions of, or references to, products or publications does not imply endorsement of that product or publication. 

While every effort is made by Academic Journals to see that no inaccurate or misleading data, opinion or statements 

appear in this publication, they wish to make it clear that the data and opinions appearing in the articles and 

advertisements herein are the responsibility of the contributor or advertiser concerned. Academic Journals makes no 

warranty of any kind, either express or implied, regarding the quality, accuracy, availability, or validity of the data or 

information in this publication or of any other publication to which it may be linked.

International African Journal Journal of Medicine of Microbiology and Medical Research Sciences 

Table of Contents: Volume 5 Number 32 30 December, 2011 

nces 

Review 

ARTICLES 

Utility and importance of walnut, Juglans regia Linn: A review 5796 

Nael Abu Taha and Mohammed A. Al-wadaan 

The use of gamma irradiation in agriculture 5806 

Issa. Piri, Mehdi. Babayan, Abolfazl. Tavassoli and Mehdi. Javaheri 

Research Articles 

In vitro antiviral activities of Jrani caprifig latex and its related terpenes 5812 

Houda LAZREG AREF, Mahjoub AOUNI, Jean Pierre CHAUMON, Khaled SAID 

and Abdelwaheb FEKIH 

Role of the quorum-sensing system in biofilm formation and virulence of 

Aeromonas hydrophila 5819 

Weihua Chu, Yan Jiang, Liu Yongwang and Wei Zhu 

Detection of H9N2 avian influenza virus in various organs of experimentally 

infected chickens 5826 

Somayeh Asadzadeh Manjili, Iradj sohrabi Haghdoost, Pejman Mortazavi, 

Hamid Habibi, Hadi lashini and Esmaeil Saberfar 

Biological wastewater treatment: Microbiology, chemistry, and diversity 

measurement of ammonia oxidizing bacteria 5831 

AYANDA Olushola Sunday and AKINSOJI Olatunbosun Seun

Table of Content: Volume 6 Number 23 21 June, 2012 


nces 

ARTICLES 

ARTICLES 

Purification 

Influence 

and 

of ciprofloxacin 

Characterization 

on glioma 

of 56 

cell 

kDa 

line 

cold 

GL26: 

active 

A 

Protease 

new application 

from 

for 

Serratia 

an old 

marcescens 

antibiotic 

5841 

A.L. 

Abdolreza 

TARIQ, A. 

Esmaeilzadeh, 

L. REYAZ and J. 

Massoumeh 

JOHN PRABAKARAN 

Ebtekar, Alireza Biglari and 

Zuhair Mohammad Hassan 4891 

Overlap effects of cyromazine concentration, treatment method and rearing 

temperature 

Identification 

on 

of 

the 

microbial 

Southern 

diversity 

cowpea 

in 

weevil 

caecal 

(Callosobruchus 

content of broiler 

maculatus 

chicken 

F.) 

reared 

S. Nathiya, 

on cowpea 

G. Dhinakar Raj, A. Rajasekar, D. Vijayalakshmi and T. Devasena 

5848 

4897 

Fahd Abdu Al-Mekhlafi, Ashraf Mohamed Ali Mashaly, Ahmed A. Mahmoud 

Abdel Mageed, Mohamed AhmedWadaan and Nazar M. Al-Mallah 

Microbial quality of some non-sterile pharmaceutical products sourced 

from some retail pharmacies in Lagos, Nigeria 

Antioxidant 

Adeola Anifowoshe 

and antibacterial 

R., Opara 

activities 

Morrison 

of 

I. 

Camptotheca 

and Adeleye Isaac 

acuminate 

A. 

D. 

4903 

seed oil 5854 

Lin Wang, Zhiwei Yang, Sicen Wang, Shuqiu Wang and Junxing Liu 

Molecular detection of adhesins genes and biofilm formation in methicillin 

resistant Staphylococcus aureus 

Preparation, 

Karima BEKIR, 

characterization 

Omayma HADDAD, 

and in 

Mohammed 

vitro antimicrobial 

GRISSA, 

activity 

Kamel CHAIEB, 

of 

compound 

Amina BAKHROUF 

sustained-release 

and Salem 

periodontal 

IBRAHIM ELGARSSDI 

suppository of 

4908 

ornidazole and pefloxacin mesylate 5863 

Rui Liu, Yan Jiang, Yan-hua Duan, Nan Li, Guo-dong Zhang, Xin Nie 

and 

Amylase 

Lu-chuan 

production 

Liu 

by moderately halophilic Bacillus cereus in solid 

state fermentation 

P. Vijayabaskar, D. Jayalakshmi and T. Shankar 4918 

Emergence of oligoclonal Acinetobacter baumannii nosocomial infection in 

a Hospital in Nepal 5872 

Badri 

Networking 

Thapa, Chanwit 

clusters 

Tribuddharat 

and sequence 

and 

characteristics 

Sulochana Mahat 

of clustered 

Basnet 

regularly 

interspaced short palindromic repeats (CRISPR) direct repeats and their 

evolutionary comparison with cas1 genes in lactic acid bacteria 

The 

Kaibo 

effects 

Deng, 

of bifidobacterium 

Fei Liu, Chuntao 

lactis 

Gu and 

and 

Guicheng 

galactooligosaccharide 

Huo 

(GOS) on 

4927 

ileum and distal colon motility: In vitro study 5877 

Nevcihan Gursoy 

Antibacterial screening of the root, stem and leaf extracts of Terminalia albida sc. 

elliot on selected pathogenic bacteria 

S. M. Ayodele, G. Alpheus and O. M. Iruaga 1457


nces 

ARTICLES 

Cloning, expression and characterization of a glucose dehydrogenase from 

Bacillus sp. G3 in Escherichia coli 5882 

Xuejiao Chen, Haitao Ding, Yiqing Du, Hui Lin, Zeli Li and Yuhua Zhao 

Investigation of bioremediation of arsenic by bacteria isolated from 

contaminated soil 5889 

Hadis Ghodsi, Mehran Hoodaji, Arezoo Tahmourespour and 

Mohammad Mehdi Gheisari 

Effects of temperature on recruitment and phytoplankton community 

composition 5896 

Xiao Tan 

Assessing antibiotic resistance profiles in Escherichia coli and Salmonella 

species from groundwater in the Mafikeng area, South Africa 5902 

Philemon Thabo Phokela, Collins Njie Ateba and David Tonderai Kawadza 

Determination of hepatitis C virus genotypes among HCV positive patients 

in Shahrekord, Iran 5910 

Elahe Tajbakhsh, Abbas Dosti, Sara Tajbakhsh, Manochehr Momeni and 

Forough Tajbakhsh 

Analysis of agricultural input-output based on Cobb–Douglas production 

function in Hebei Province, North China 5916 

Zaijian Yuan


nces 

ARTICLES 

Management of viral disease in banana using certified and virus tested 

plant material 5923 

El-Dougdoug, Kh. A. and M. M. El-Shamy 

Scavenging and anti-fatigue activity of Wu-Wei-Zi aqueous extracts 5933 

Chen Xiang and Zhang Guohai 

Proteomic analysis of differentially expressed proteins in intestinal epithelial 

cell in response to Enteroinvasive Escherichia coli infection and Lactobacillus 

plantarun treatment 5941 

Zhongwei Zhang and Minghua Mao 

A survey on the prevalence of poultry salmonellosis and detection of different 

Salmonella serovars isolated from poultry in broiler chicken farms 5950 

Jafar Akbarmehr 

Isolation and exploitation of Aspergillus ochraceus RM82 against human 

pathogenic bacteria 5955 

Riaz Muhammad, Sajid Ali and Bashir Ahmad 

Seroprevalence of avian origin H3N2 canine influenza virus infection in pet 

dogs in Shenzhen, China 5960 

Fu-Rong Zhao, Shou-Jun Li, Dong-Hui Zhou, Ning Chen, Yan-Zhong Zhang, 

Wen-Bao Qi, Pei-Rong Jiao, Ming Liao, Guang-Zhi Tong and Gui-Hong Zhang


nces 

ARTICLES 

Assessment of inflammatory cytokines and soluble adhesion molecules in 

patients with systemic inflammatory response syndrome in an intensive 

care unit of a Saudi tertiary hospital 5964 

Obeid E. Obeid and Manal I. Hassan 

Seroprevalence of hepatitis-A virus among children aged 1-16 years in 

Eastern Anatolia, Turkey 5969 

Uğur DEVECI, Cemal USTUN and Ozlem HAMANCA 

Diversity of nifH gene sequences in the sediments of South China Sea 5972 

Lixian Wu, Yanhua Cui and Sanfeng Chen 

Difference in photoinhibition and photoprotection between seedings and 

saplings leaves of Taxus cuspidata under high irradiance 5978 

Wei Li, Yu-Sen Zhao and Zhi-Qiang Zhou 

Response of Cercospora beticola in sugar beet at different cultivars and 

fertilization level 5985 

Yong-Gang Li, Li Zhang and Feng-Ming Mang 

In vitro antioxidant activities of polysaccharides from endophytic fungus 

Fusarium oxysporum Dzf17 5990 

Peiqin Li, Chao Luo, Weibo Sun, Shiqiong Lu, Yan Mou, Youliang Peng 

and Ligang Zhou 

Production of calcium gluconate from cassava by Penicillium citrinum 

SCG-112 5994 

Hai-Yan Sun, Pingjuan Zhao, Juanhua Li, Enshi Liu and Ming Peng

African Journal of Microbiology Research Vol. 5(32), pp. 5796-5805, 30 December, 2011 

Available online at http://www.academicjournals.org/AJMR 

ISSN 1996-0808 ©2011 Academic Journals 

DOI: 10.5897/AJMR11.610 

Review 

Utility and importance of walnut, Juglans regia Linn: A 

review 

Nael Abu Taha and Mohammed A. Al-wadaan 

Chair of Advanced Proteomics and Cytomics Research, Faculty of Science, King Saud University, Riyadh 11415, 

Saudi Arabia. 

Accepted 9 September, 2011 

Juglans regia Linn is a medicinal plant that has been widely used in traditional medicine for a wide 

array of ailments that include helminthiasis, diarrhea, sinusitis, stomachache, arthritis, asthma, eczema, 

scrofula, skin disorders, and various endocrine diseases such as diabetes mellitus, anorexia, thyroid 

dysfunctions, cancer and infectious diseases. The present review, attempts to provide comprehensive 

information on the ethnobotanical use, pharmacology, nutritional value, preclinical and clinical studies, 

toxicity, other uses and current research prospects of the Juglans regia L. Currently, there is a renewed 

interest in walnut, and several investigations aimed at scientific validation of its traditional uses and a 

humble scientific investigation aimed at isolation and identification of active constituents of crude 

extracts. 

Key words: Juglans regia, nutritional value, bioactivity, clinical trial, traditional use, toxicity. 

INTRODUCTION 

Origin and distribution 

Walnut (Juglans regia L.) is the most widespread tree nut 

in the world. The tree is commonly called as the Persian 

walnut, white walnut, English walnut or common walnut. 

It belongs to juglandaceae and has the scientific name 

Juglans regia. The walnut tree species is native to the old 

world. It is native in a region stretching from the Balkans 

eastward to the western Himalayan chain (Fernandez- 

Lopez et al., 2000) and was cultivated in Europe as early 

as 1000 BC. At present, walnut is cultivated commercially 

*Corresponding author. E-mail: nabutaha@ksu.edu.sa. 

Abbreviations: FAs, Fatty acids; PUFAs, polyunsaturated fatty 

acids; AA, amino acid; MICs, minimum inhibitory 

concentrations; IC50, half maximal inhibitory concentration; 

TMV, tobacco mosaic virus; DPPH, 2,2-diphenyl-1picrylhydrazyl; 

LDL, low-density lipoprotein; CCl4, carbon 

tetrachloride; LDH, lactate dehydrogenase; GSH, glutathione; 

GR, glutathione reductase; GOT, glutamyl oxaloacetic 

transaminase; GPT, glutamyl pyruvic transaminase; TG, 

triglycerides; EDV, endothelium-dependent vasodilation; CP, 

cyclophosphamide. 

throughout southern Europe, northern Africa, eastern 

Asia, the USA and western South America. World 

production of whole walnut was around 1.5 × 106 t in 

2008 (FAO, 2008). China is the leading world producer, 

followed by the USA, Iran, Turkey, Ukraine, Romania, 

France and India, but production in other countries such 

as Chile and Argentina has increased rapidly in recent 

years (Martinez et al., 2010). 

Walnut composition and nutritional value 

Walnut has been used globally in human nutrition since 

ancient times. The high protein and oil contents of the 

kernels of Juglans regia L. (Juglandacea) make this fruit 

indispensable for human nutrition. Therefore, the walnut 

is classified as a strategic species for human nutrition 

and is included in the FAO list of priority plants (Gandev, 

2007). The seed part of the fruit (kernel) is consumed 

fresh, toasted, or mixed with other confectionaries. In the 

Middle East walnuts are added alone or along with 

almonds, date, and raisin as a special pastry preparation 

called Ma'moul. Walnuts are nutrient-rich food due to 

high contents of fats, proteins, vitamins and minerals. 

They are also good source of flavonoids, sterols, pectic

Table 1. Nutritional value of Juglans regia L. 

Principle Value per 100 g 

Vitamins (USDA, 2010) 

Folates 98 mcg 

Niacin 1.125 mg 

Pantothenic acid o.570 mg 

Pyridoxine 0.537mg 

Riboflavin 0.150 mg 

Thiamin 0.541 mg 

Vitamin A 20 IU 

Vitamin C 1.3 mg 

Vitamin E-y 20.83 mg 

Vitamin K 207 mcg 

Minerals 

Potassium 441 mg 

Phosphorus 346 mg 

Calcium 98 mg 

Magnesium 158 mg 

sodium 2 mg 

Iron 2.9 mg 

Copper 1.5 mg 

Manganese 3.8 mg 

zinc 3.09 mg 

Aluminum 0.58 mg 

Fatty acids (Muradoglu et al., 2010) 

Unsaturated fatty acids 

Palmitoleic acid C16:1 0.77 

Oleic acid C18:1 25.26 

Gadoleic acid C20:1 0.05 

Total MUFA 22.37 

Linoliec acid C18:2 57.10 

Lineliec acid C18:3 10.34 

Total PUFA 4.29 

Saturated fatty acid 

Myristic acid C14:0 0.24 

Palmitic acid C16:0 4.28 

Stearci acid C18:0 1.85 

Archidic acid C20:0 0.19 

Total SFA 7.21 

PUFA/SFA 9.91 

substances, phenolic acids and related polyphenols. The 

nutritional contents differs from a cultivar to another 

which can be influenced by genotype, cultivator, different 

ecology and different soil (Caglarirmak, 2003; Crews et 

al., 2005; Martinez et al., 2010; Muradoglu et al., 2010). 

The major components of walnut oil are triacylglycerols 

(980 g/kg oil), in which monounsaturated fatty acids (FAs) 

(mainly oleic acid) and polyunsaturated FAs (PUFAs; 

linoleic and α-linolenic acids) are present in high amounts 

in all genotypes (Table 1). Oil contents reported by 

Taha and Al-wadaan 5797 

Pereira et al. (2008) (78.83 to 82.4%) were higher than 

those reported by other researchers (Savage, 2001; 

Muradoglu et al., 2010). In general, the FA composition of 

walnut oil resembles that of soybean oil, but walnut oil 

contains a greater concentration of linolenic acid. In fact, 

among vegetable oils, walnut oil has one of the highest 

amounts of PUFAs (up to 78% of the total FA content). 

Walnuts have high amount of omega-6 and omega-3 

PUFA, which are essential dietary fatty acids. Clinical 

studies suggest that omega-3 PUFA have significant role 

in prevention of coronary heart disease (Davis et al., 

2007). Oil rich in oleic acid displays greater oxidative 

stability therefore; it could be widely used as frying oil. 

According to an investigation conducted by several 

researchers, It was found that the average value for 

protein was 18.1% (Amaral et al., 2003); Muradolu, 2005; 

Mitrovic et al., 1997; Muradoglu, 2010; Savage, 2001). 

They are mainly composed of glutelins (about 70% of the 

total seed proteins) together with lesser amounts of 

globulins (18%), albumins (7%) and prolamins (5%) 

(Martinez et al., 2010). The amino acid (AA) composition 

of walnut flour is dominated by the acidic AA residues of 

aspartate and glutamate together with relatively high 

levels of arginine. Walnut proteins contain all essential 

AAs required for the needs of a human adult. The 

lysine/arginine ratio in walnut proteins is lower than those 

observed in other common vegetable proteins, and this 

fact has been identified as a positive feature in the 

reduction of atherosclerosis development (Sza-Tao et al., 

2000; Venkatachakm and Sathe; 2006; Martinez et al., 

2010). Walnut cultivars analyzed have recorded rich 

mineral composition, especially potassium, magnesium, 

and calcium. The minimum and maximum macro and 

micro nutrient contents of walnut are presented in Table 1 

(Ravai, 1992; Payne, 1985; Souci et al., 1994; 

Cosmulescu et al., 2009). Walnuts contain high levels of 

potassium, phosphorus and magnesium and lower 

sodium. These elements play an important role for many 

enzymes activity especially as cofactor. 

Ethnobotanical use 

Juglans regia leaves have been used mostly in worldwide 

traditional medicines as antimicrobial, antihelmintic, 

astringent, keratolytic, antidiarrhoeal, hypoglycaemic, 

depurative, tonic, carminative, and for the treatment of 

sinusitis, cold and stomach ache (Girzu et al., 1998; 

Mouhajir et al., 2001; Vaidyaratnam, 2005). In Turkish 

folk medicine, fresh leaves applied on the naked body or 

forehead to reduce fever or on swelled joint to alleviate 

the rheumatic pain (Fujita et al., 1995; Yesilada, 2002). 

The kernel of J. regia has been used for the treatment of 

inflammatory bowel disease in Iranian traditional 

medicine (Kim et al., 2006). In Palestine, it is used for 

treatment of diabetes and asthma (Jaradat, 2005; Kaileh 

et al., 2007) and to treat prostate and vascular 

disturbance (Spaccarotella et al., 2008). The plant is

5798 Afr. J. Microbiol. Res. 

used as a topical remedy for dermal inflammation and 

excessive perspiration of the hands and feet. It is also a 

common home remedy for the treatment of chronic 

eczema and scrofula. The leaves of this plant is used 

topically to treat scalp itching and dandruff, sunburn and 

superficial burns as well as an adjunctive emollient in skin 

disorders (Gruenwald et al., 2001; Robbers et al., 1999; 

Ali-Shtayeh and Abu Ghdeib, 1999; Blumenthal, 2000; 

Baytop, 1999). It also has high anti-atherogenic potential 

and a remarkable osteoblastic activity that adds to the 

beneficial effect of a walnut enriched diet on 

cardioprotection and bone loss (Papoutsi et al., 2008). 

The bark, branches and exocarp of the immature green 

fruit of this medicinal plant have been used to treat 

gastric, liver and lung cancer a long time in China (Liu et 

al., 2004; Baytop, 1999). It is used by traditional healer in 

northeastern region of Mexico to protect against liver 

damage (Torres-gonzalea et al., 2011). The bark is used 

as miswaks for teeth cleaning (Ibrar et al., 2007). In 

Nepal the bark paste is useful in arthritis, skin diseases, 

toothache, and hair growth. Seed coat is used for healing 

wounds (Kunwar and Adhikari, 2005). The shell of 

Juglans regia is used in Calabria folk medicine to heal 

malaria (Tagarelli et al., 2010). 

Antibacterial activity 

Hot and cold solvent and aqueous extract of leaves, 

barks, fruits and green husks of J. regia from different 

countries revealed broad spectrum antibacterial activity 

against gram-positive and gram-negative bacteria viz. 

Bacillus cereus, Bacillus subtilis, Staphylococcus aureus, 

Pseudomonas aeruginosa, Escherichia coli, Klebsiella 

pneumoniae, Staphylococcus epidermidis, Micrococcus 

luteus, Salmonella typhimurium, Enterococcus faecalis, 

Bacillus thuringiensis, Protomonas extroquens, and 

Proteus sp. using agar streak method, disc diffusion 

method and microplate alalmar blue assay (Deshpande 

et al., 2011; Poyrazolu et al., 2010; Pereira et al., 2008; 

Oliveira et al., 2008; Pereira et al., 2007; Qa’dan et al., 

2005a b; Citoglu and Altanlar, 2003; Upadhyay et al., 

2010b). The antimicrobial activity against gram-negative 

bacteria were selective since not all the fruit extract of J. 

regia cultivator inhibited the growth of Pseudomonas 

aeruginosa and E. coli. cv. Lara inhibited the growth of 

K. pneumoniae (MIC of 100 mg/mL), cv. Mayette 

inhibited the development of P. aeruginosa and E. coli 

with minimum inhibitory concentrations (MICs) of 50 and 

10 mg/mL, respectively, and cv. Mellanaise inhibited the 

growth of E. coli and K. pneumoniae at concentration of 

100 mg/mL (Ali-Shtayah et al., 1999). Mexican aqueous 

bark and leaves extract exhibited no antimycobacterial 

activity. Only the hexane and methanol extract showed 

antimycobacterial activity with MIC of 100 and 125 mg/ml, 

respectively using Soxhlet extractor (Cruz-Vega et al., 

2008). Over 45% of Iranian clinical isolates of 

Helicobacter pylori strain were inhibited by J. regia 

aqueous and equal mixture of methanol, diethyl ether and 

petroleum benzene extract (Nariman et al., 2004). In a 

recent study, juglone was shown to potently inhibit the 

three key enzymes from Helicobacter pylori, 

cystathionine γ-synthase (HpCGS), malonyl-CoAacyl 

carrier protein transacylase (HpFabD), and βhydroxyacyl-ACP 

dehydratase (HpFabZ) with the half 

maximal inhibitory concentration (IC50) values of 7.0±0.7, 

20±1, and 30±4 μmol/L, respectively. Therefore, HpCGS, 

HpFabD, and HpFabZ are considered to be the potential 

targets of juglone (Kong et al., 2008). The antibacterial 

activity of Jordanian J. regia leaves extract to acne 

developing organism revealed that 12.5% S. epidermidis 

isolates were resistant to the leaf extract where as all 

Propionibacterium acnes isolates were sensitive even to 

10% of the extract (Qa'dan et al., 2005b). 

Antifungal activity 

J. regia fruits, leaves and bark aqueous and solvents 

extract exhibited antifungal activity against wide range of 

fungi using disc diffusion method, agar dilution method, 

agar streak dilution and Raddish method. Pereira et al. 

(2008) reported that all the walnut varieties exhibited 

antifungal activity against Candida albicans and 

Cryptococcus neoformans when soxhleted with light 

petroleum ether (b.p. 40-60°C). The higher inhibition was 

observed with cv. Lara extract (MIC of 1 mg/mL). 

However, C. albicans and C. neoformans were only 

resistant to cv Mallanaise extract. Cold extraction of fruit, 

leaves and bark inhibited the growth of Microsporum 

canis, Trichophyton mentagrophytes, and Trichophyton 

violaceum (Ali-Shtayah et al., 1999). On the other hand, 

the aqueous extract of green husks showed no antifungal 

activity against C. albicans and C. neoformans (Oliveira 

et al., 2008). Methanol, acetone, chloroform and ethyl 

acetate bark extract revealed antifungal activity against 

A. niger, Alternaria alternata, Trihoderma viresn, 

fusarium solani, Pichia guiliermondii, Pichia jadinii and all 

Candida speices tested (Upadhyay et al., 2010c; Ahmad 

et al., 1973). 

Antiviral activity 

Mei-zhi et al. (2007) reported that 95% ethanol and ethyl 

acetate leaves extract of J. regia, inhibited tobacco 

mosaic virus (TMV). The methanol extract of J. regia 

inhibited Sindbis virus at a minimum concentration of 1.5 

µg/ml (Mouhajir et al., 2001). 

Antioxidant activity 

The antioxidant potential of ethyl acetate, butanol, meta-

nol, ether and aqueous methanol extract of walnut 

kernels, husks and leaves were measured by different 

methods such as reducing power, scavenging activity on 

2,2-diphenyl-1-picrylhydrazyl (DPPH) radicals and lipid 

oxidation inhibition by β-carotene linoleate system. All the 

extracts showed strong antioxidant activity (Qamar and 

Sultana, 2011; Carvalho et al., 2010; Abbasi et al., 2010; 

Rahimipanah et al., 2010; Zhang et al., 2009b; Almeida 

et al., 2008; Oliveira et al., 2008; Pereira et al., 2008; 

Pereira et al., 2007; Fukuda et al., 2003). Bullo et al. 

(2010) reported a decrease in the antioxidant burden 

observed in enzymatic and non-enzymatic antioxidant 

systems after the consumption of a whole-walnut or a 

walnut-skin diet in C57BL/6 mice. The same author also 

reported that consumption of walnuts and walnut skins 

have no deleterious effect on low-density lipoprotein 

(LDL) oxidizing capability, despite their higher contents of 

omega-6 PUFAs. Several phenolic compounds isolated 

from J. regia such as pyrogallol, p-hydroxybenzoic acid, 

vanillic acid, ethyl gallate, protocatechuic acid, gallic acid, 

3,4,8,9,10-pentahydroxydibenzo pyran-6-one, tannins, 

glansrins, adenosine, adenine, etc, could provide a 

chemical basis for some of the health benefits claimed for 

J. regia in foods and folk medicine (Zhang et al., 2009a; 

Fukuda et al., 2003). 

Antidiabetic activity 

Fukuda et al. (2004) demonstrated a strong inhibitory 

activity of walnut polyphenols and the polyphenolic 

components like Casuarictin, tellimagradin II and 

Tellimagradin I on different enzymes like glycosidase, 

sucrose, maltase and amylase. In addition to the above 

findings, researchers also noticed that walnut polyphenolrich 

fraction has triglyceride lowering effect and urine 

peroxide lowering effect in genetically inherited Type II 

diabetes mellitus (db/db) mice at the dose of 

200mg/kg/day. The consumption of walnut leaf pellets in 

alloxan induced diabetic rats at the dose of 185 mg/kg 

reduced fasting blood sugar significantly and the 

histomorphometric study of pancreas showed a sign of 

regeneration of β-cells in the treated group (Jelodar et al., 

2007). J. regia leaves methanolic extract at dose of 250 

mg/kg decreases the postprandinal plasma blood glucose 

levels in both short and long term models. The plant 

extract significantly inhibited α-glucosidase activity in vitro 

for both maltase and sucrase enzymes and showed no 

changes in the insulin and glut-4 genes expression. The 

author attributed the inhibitory action of the plant extract 

to gallic acid and caffeoylquinic acid in the leaves 

(Teimori et al., 2010). 

Anthelmintic activity 

Kale et al. (2011) reported that stem park of J. regia 


acetone extract exhibited significant activity at all dilution 

tested when compared to the Albendazole standard 

against Eicinia feotida. The benzene, methanol and 

ethanol soxhlet extracts of J. regia stem bark on adult 

Indian earthworm, Pheretima posthuma exhibited 

significant anthelmintic activity as comparable to that of 

standard drug Piperazine citrate (Upadhyay et al., 

2010a). The 95% ethanol, petroleum ether and ethyl 

acetate extract of green walnut hull have obvious antifeeding 

effect on armyworm and the small vegetablemoth. 

The research group indicated that anti-feeding rate, 

death rates as well as growth inhibition rate of armyworm 

have correspondingly changed in dose dependant 

manner (Me-zhi et al., 2006). 

Anti-inflammatory activity 

The ethanolic extracts of J. regia leaves exhibited potent 

anti-inflammatory activity as potent as indomethacin 

against carrageenan-induced hind paw edema model in 

mice without inducing any gastric damage (Erdemoglu et 

al., 2003). Mokhtari et al. (2008) stated that the alcohol 

extract of walnut leaves in dose of 1.5 mg/kg caused a 

significant nociception decrease in acute phase of 

formalin test where as the aqueous (2.87 and 1.64 g/kg) 

and ethanolic (2.044 and 1.17 g/kg) extracts of leaves 

showed antinociceptive activity in hotplate test 

suggesting a promising analgesic and anti-inflammatory 

agents against diseases such as rheumatoid arthritis. On 

the basis of Qamar and Sultana (2011) result, a 

protective role of methanolic J. regia extract against CSEinduced 

acute lung toxicity in Wistar rats was suggested. 

The extract significantly decreased the levels of Lactate 

dehydrogenase (LDH), total cell count, total protein and 

increased the glutathione (GSH) level in bronchoalveolar 

lavage fluid. It also significantly restored the levels of 

Glutathione reductase (GR), catalase and reduced the 

xanthine oxidase (XO) activity in lung tissue. 

Antidepressant activity 

The macerated hexane extract of J. regia fruit produced 

significant antidepressant activity at both doses of 100 

and 150 mg/kg body weight when compared with 

standard drug fluoxetine on male Wistar rats. The 

antidepressant activity was evaluated by forced 

swimming and tail suspension test (Rath and Pradhan, 

2009). 

Antityrosinase activity 

Ozer et al. (2007) suggested that gel formulation 

containing ellagic acid and plant leaves extract of J. regia 

is effective in treating uneven skin pigmentation. The 

ethanolic leaves extract could be suggested as new


sources of skin-whitening agents. Aitani and Shimoda 

(2005) reported that melanin formation was inhibited at 

concentration 1 to 30 μg/ml in Pre-cultured B16 

melanoma cells incubated with medium containing walnut 

polyphenols and their result indicated that walnut 

polyphenols is more superior to the popular skinlightening 

agent, ascorbic acid and arbutin upon data 

comparison. 

Hepatoprotective activity 

Orally fed Walnut polyphenols prepared from the 

kernelpellicle demonstrated a dose dependent lowering 

effect in glutamyl oxaloacetic transaminase (GOT) and 

glutamyl pyruvic transaminase (GPT) in carbon 

tetrachloride (CCl4) induced liver damage in mice model 

after a single oral administration (200 g/kg). Result 

indicated that walnut polyphenols is more superior to 

Curcumin, a commonly used hepatoprotective agent. The 

effect of each active component of in vitro evaluation of 

walnut polyphenols on CCl4-induced cytotoxicity in 

primary cultured rat hepatocytes showed that 

tellimagrandin I, casuarictin, tellimagrandin II, and rugosin 

C (Figure 1) are inhibitory on CCl4-induced cytotoxicity in 

primary cultured rat hepatocytes however, tellimagrandin 

I of walnut polyphenols is believed to be the most 

important active compound responsible for 

hepatoprotective effect (Hiroshi et al., 2008). The same 

author, Hiroshi et al. (2006) reported that 50% EtOH 

extract from endocarps of walnuts on mice liver injury 

models induced by carbon tetrachloride at the dose of 

100 and 200 mg/kg significantly suppressed GOT and 

GPT deviations. Polyphenolic constituents, 

tellimagrandins I and II, rugosin C and casuarictin were 

found to be principal constituents with hepatoprotective 

activity against oxidative damage. 

Hypotriglyceridemic activity 

Oral administration of a polyphenol-rich extract (WP) from 

walnuts (100 and 200 mg/kg) in high fat diet fed mice 

significantly reduced liver weight and serum triglycerides 

(TG) where as hepatic β-oxidation in cytosol, including 

peroxisome, was enhanced by WP (50-200 mg/kg). A 

polyphenol-rich extract was found to possess 

hypotriglyceridemic activity via enhancement of 

peroxisomal fatty acid β-oxidation in the liver. These 

results suggest that tellimagrandin I is involved in the 

hypotriglyceridemic mechanism (Shimoda et al., 2009). 

Anticancer activity 

Juglone has been reported to inhibit intestinal 

carcinogenesis induced by azoxymethane in rats and 

might be a promising chemopreventive agent in human 

intestinal neoplasia (Sugie et al., 1998). Juglone was also 

proven to be a potent cytotoxic agent in vitro in human 

tumor cell lines, including human colon carcinoma (HCT- 

15) cells, human leukemia (HL-60) cells and doxorubicinresistant 

human leukemia (HL-60R) cells (Kamei et al., 

1998; Segura-Aguilaretal, 1992). In a recent study, 

Juglone inhibited the growth and induce apoptosis of 

sarcoma and 180 SGC-7901 cells in vivo. The 

mechanism is mediated by the activation of the 

mitochondrial death pathway, which requires the 

generation of reactive oxygen species (ROS), downregulation 

of Bcl-2 protein expression and up-regulation 

of Bax protein expression (Ji et al., 2011). Walnut 

methanolic extracts obtained from J. regia seed, green 

husk and leaf showed concentration dependent growth 

inhibition against human renal cancer cell lines A-498, 

769-P and the colon cancer cell line Caco-2. Concerning 

A-498 renal cancer cells, all extracts exhibited similar 

growth inhibition activity (IC50 values between 0.226 and 

0.291 mg/mL), while 769-P renal and Caco-2 colon 

cancer cells, walnut leaf extract showed a higher 

antiproliferative efficiency (IC50 values of 0.352 and 0.229 

mg/mL, respectively) than green husk or seed extracts 

(Carvalho et al., 2010). The tested dried fine powder of J. 

regia light petroleum seed extract in cancer induced in 

Swiss albino mice with the help of 7,12- 

Dimethylbenz(a)anthracene (DMBA) and croton oil 

showed the petroleum extract was significant in reducing 

the cancer cells (Kumudhavalli et al., 2010). 

Other medicinal uses 

Willis et al. (2009) examined the effects of walnut diet on 

motor and cognitive ability in aged rats for 8 weeks. The 

three treated groups (2, 6 and 9%) revealed that the 2% 

walnut diet improved performance on rod walking, while 

the 6% walnut diet improved performance on the medium 

plank walk; the higher dose of the 9% walnut diet 

impaired reference memory, however the researcher 

attributed this to the number of polyphenolic compounds 

that could be negatively effecting reference memory at a 

higher dose. A 2004 study by the NYS Institute for Basic 

Research in Developmental Disabilities (OMRDD) 

revealed that methanolic extract of walnut was able to 

inhibit and defibrillize fibrillar amyloid β- protein (the 

principal component of amyloid plaques in the brains of 

patients with Alzheimer's). It is proposed that 

polyphenolic compounds present in walnuts may be 

responsible for its anti-amyloidogenic activity (Chauhan 

et al., 2004). Similarly, it was found that two of its major 

components in walnuts, gallic and ellagic acid, act as 

"dual-inhibitors" of the enzyme acetylcholinesterase 

which, in association with amyloid inhibits protein 

aggregation, and inhibit the site of acetylcholinesterase 

responsible for the breakdown of acetylcholine. These 

results suggest that walnuts may reduce the risk or delay

HO 

HO 

HO 

HO 

OH 

OH 

O 

O 

O 

O 

O 

HO 

OH 

O 

O 

HO 

O 

Strictinin (Shimoda et al., 2009) 

R3 

OH 

OH 

R1 R2 Juglanin A 

(JA) 

R1=CH3O R2=OH R3==O 

(Liu et 

2008) 

Rhoiptelol 

(RH) 

Juglanin (C ) 

R1=CH3O 

R1=OH 

R2=OH 

R2=H 

R3=-OH 

R3==O 

al., 

OH O 

O 

Juglone (Kong et al., 2008) 

OCH 3 

O 

OH 

Juglanin B (Liu et al., 2008) 

Figure 1. Chemical structures of compounds isolated from Juglans regia L. 

Figure 1 contd. 

Taha and Al-wadaan 5801


the onset of Alzheimer's disease by maintaining amyloidprotein 

in the soluble form and prevent the breakdown of 

acetylcholine (Society for Neuroscience, 2007). 

Clinical study 

A daily intake of 43 to 57g of walnuts incorporated into 

Japanese diet for 4 weeks to 40 healthy Japanese men 

and women lowered blood cholesterol, particularly in 

women (Iwamoto et al., 2000). In double-blind case with 

either plasma triglyceride (TG) concentration more that 

350 mg/dl or total cholesterol concentration more that 

250 mg/dl were randomized into two groups, group A 

subject were administered 6 capsules, each filled with 

500 mg of the extracted walnut oil, per day for 45 days, 

group B individual serve as control and received placebo 

for 45 days. The result of this lowered plasma triglyceride 

level by 19 to 33% (Zibaeenezhad et al., 2003). Ros et al. 

(2004) reported that substituting walnuts for 

monounsaturated fat in a Mediterranean diet improves 

endothelium-dependent vasodilation (EDV) in 

hypercholesterolemic subjects. A daily intake of 8-13 

walnuts for 4 weeks significantly improves the EDV of 21 

hypercholesterolemic males and females. 

On the other hand, walnut-enriched meals effectively 

prevented post prandial lipidemia where triacylglycerol 

was significantly reduced (Bellido et al., 2004). 

Spaccarotella et al. (2008) assessed the effect of walnuts 

on markers of prostate cancer between 45 and 75 years 

of age. Results suggest that walnuts improved serum γ-T 

and α-T: γ-T, two biomarkers that are important in 

prostate and vascular health. Total bilirubin, total protein, 

albumin, aspartate aminotransferase (AST), alanine 

aminotransferase (ALT), lactate dehydrogenase (LDH), 

leucine aminopeptidase (LAP), gammaglutamyltranspeptidase 

(γ-GTP), cholinesterase, 

amylase, lipase, Lecithin: cholesterol acyltransferase (L- 

CAT), LDL-cholesterol, total cholesterol, triglyceride, 

phospholipid, free fatty acid (FFA), high-density 

lipoprotein (HDL)-cholesterol, Na, K, serum Fe, total iron 

binding capacity (TIBC), unsaturated iron binding 

capacity (UIBC), urea nitrogen, uric acid, glucose, 

hemocytes revealed no abnormal reading for four male 

volunteers were given oral walnut polyphenols at the 

dose of 50 mg/day for 4 weeks (Oryza, 2007). 

Toxicity 

A review of the literature showed that juglone can cause 

irritant reactions as well as skin hyper pigmentation but, 

although it has been found to be a strong sensitizer in 

guinea pigs, contact allergy is considered a very rare 

event in man (Wood and Calnan, 1976; Hausen, 1981). 

However, a case report of 65- year-old woman 

complaints of skin hyper pigmentation and large tense 

blisters involving the palms and fingers caused by the 

cumulative effect of 15 kilos of walnuts shelled in the 3 

days was reported by Bonamonte et al. (2001). Haque et 

al. (2003) investigated the modulatory effects of walnut 

aqueous extract on the toxicity of an anticancer drug, 

cyclophosphamide (CP) with special reference to 

protection against disruption of drug metabolizing and 

antioxidant enzymes during the chemotherapy. The 

extract showed a significant increase in the activity and 

level of glutathione and glutathione peroxidase in both 

liver and kidney tissues and catalase in liver only. While 

the extract CP treated group showed a significant 

decrease in the lipid peroxidation in liver and kidneys 

when compared with the CP-treated group. Aqueous 

extract from J. regia leaves reduced 3-(4,5-Dimethyl 

thiazol-2yl)-2,5-diphenyl tetrazolium bromide (MTT) 

formation by about 60% at concentration of 500 µl/ml on 

HepG2 cell. Additionally, the co-culture of HepG2 with 

THP1 revealed no sign of any negative effect at all 

concentration tested after exposure to the extract. The 

investigator also reported no significant changes of LDH 

and albumin levels on the culture medium after 24 h of 

exposure to the extract (Saad et al., 2006). 

Hosseinzadeh et al. (2011) calculated the half-maximal 

lethal dose (LD50) values of intraperitoneal injection of J. 

regia aqueous and ethanolic leaves extract and found it 

to be 5.5 and 3.3 g/kg, respectively. Acute dermal toxicity 

studies showed that petroleum ether extract of J. regia 

gives lethal effect at 2000 mg/kg (Kumudhavalli et al., 

2010). 

Other uses 

The seeds contain unusual fatty acids which are 

industrially important, as they are used in protective 

coatings, dispersants, pharmaceuticals, cosmetics, soaps 

and a variety of synthetic intermediates as stabilizers in 

plastic formulations (Hosamani et al., 2000; Eganathan et 

al., 2006). The wood is of very high quality, and is used to 

make furniture, and gunstocks. The dye is used as a 

coloring and tonic for dark hair (Brwon, 1995). The unripe 

fruits are pickled in vinegar (Facciola, 1990). 

Conclusions 

The present review article documents the publications on 

walnut and its constituents in the recent and last few 

years. The paper highlights the traditional use of this 

plant and some scientific validation of the claimed 

biological activity in vivo as well as in vitro. To best of our 

knowledge and internet survey only one case of contact 

dermatitis was reported after shelling 15 kilos of walnuts. 

The toxicological studies of various secondary 

metabolites which contribute to its medicinal value are 

still in its infancy and are becoming an important limiting 

factor for utilizing the metabolites as therapeutic agent. 

Besides, isolation and characterization of active

secondary metabolites responsible for various biological 

activities have not yet been structurally elucidated, mode 

of action, target organ of toxicity and molecular 

mechanism also need to be investigated. Further trials in 

humans are required to determine the efficacy of walnut 

extract or one or more of its constituents and to establish 

what, if any, adverse effects are observed. 

ACKNOWLEDGEMENT 

The authors extend their appreciation to the Deanship of 

Scientific Research at king Saud Univer-sity for funding 

the work through the research group pro-ject No. RGP- 

VPP-028 

REFERENCES 

Abbasi MA, Raza A, Riaz T, Shahzadi T, Aziz-ur-Rehman, Jahangir M, 

Shahwar D, Siddiqui SZ, Chaudhary AR, Ahmad N (2010). 

Investigation on the volatile constituents of Juglans regia and their in 

vitro antioxidant potential. Pakistan Acad. Sci., 47:137-141. 

Ahmad S, Mukhtar, Wahid A, Bukhari AQS (1973). Fungistatic Action of 

Juglans. Antimicrob. Agents Chemother., 3:436-438. 

Aitani M, Shimoda H (2005).The Effect of Ascorbic Acid and Arbutin on 

B16 Melanoma cells. Japan Food Sci.,44: 58-63. 

Akhtar N, Ali M, Alam MS (2009). New phytoconstituents from the stem 

bark of Juglans regia L. J. Saudi. Chem. Soc., 13: 111-118. 

Ali-Shtayeh MS, Abu Ghdeib SI (1999). Antifungal activity of plant 

extracts against dermatophytes. Mycoses., 42: 665-772. 

Almeida IF, Fernandes E, Lima JLFC, Costa PC, Bahia MF (2008). 

Walnut (Juglans regia) leaf extracts are strong scavengers of prooxidant 

reactive species. Food Chem., 106:1014-1020. 

Amaral JS, Casal S, Pereira J, Seabra R, Oliveira B (2003). 

Determination of sterol and fatty acid compositions, oxidative stability, 

and nutritional value of six walnut (Juglans regia L.) cultivars grown in 

Portugal. J. Agric. Food Chem., 51: 7698-7702. 

Baytop T (1999). Therapy with Medicinal Plants in Turkey (Past and 

Present), 2nd Ed., Nobel Medicine Publisher, Turkey. 

Bellido C, Lopez-Miranda J, Blanco-Colio LM, Perez-Martinez P, 

Muriana FJ, Martin-Ventura JL, Marin C, Gomez P, Fuentes F, Egido, 

Perez-Jimenez F (2004). Butter and walnuts, but not olive oil, elicit 

postprandial activation of nuclear transcription factor κB in peripheral 

blood mononuclear cells from healthy men. Am. J. Clin. Nutr., 80: 

1487-1491. 

Blumenthal M (2000). Herbal Medicine (Expanded Commision E 

Monographs), Integrative Medicine Communications, Newton 

Publisher, England. 

Bonamonte D, Foti C, Angelini G (2001). Hyperpigmentation and 

contact dermatitis due to Juglans regia. Contact Dermatitis., 44: 101. 

Brwon D (1995). Encyclopedia of herbs and their uses. Dorling 

Kindersley publishers, London. 

Bullo M, Nogues MR, Lopez-Uriarte P, Salas-Salvado J, Romeu M 

(2010). Effect of whole walnuts and walnut-skin extracts on oxidant 

status in mice. J. Nutr., 26: 823-828. 

Caglarirmak N (2003). Biochemical and physical properties of some 

walnut genotypes (Juglans regia L). Nahrung Food 47:28–32. 

Carvalho M, Ferreira PJ, Mendes VS, Silva R, Pereira JA, Jenimo C. 

Silva BM (2010). Human cancer cell antiproliferative and antioxidant 

activities of Juglans regia L. Food Chem. Toxicol., 48: 441-447. 

Chauhan N, Wang KC, Wegiel J, Malik MN (2004). Walnut extract 

inhibits the fibrillization of amyloid beta-protein, and also defibrillizes 

its preformed fibrils. Cur. Alzheimer Res., 1:183-188. 

Citoglu GS, Altanlar N (2003). Antimicrobial activity of some plants used 

in folk medicine. J. Fac. Pharm. Ankara., 32:159-163. 

Company, New York. 

Cosmulescu S, Baciu A, Achim G, Botu M, Trandafir I (2009). Mineral 


composition of fruits in different walnut (Juglans regia L.) Cultivars. Not. 

Bot. Hort. Agrobot. Cluj., 37:156-160. 

Crews C, Hough P, Godward J, Brereton P, Lees M, Guiet S (2005). 

Study of the main constituents of some authentic walnut oils. J. Agric. 

Food. Chem., 53:4853-4860. 

Cruz-Vega DE, Verde-Star MJ, Salinas-Gonzalez N, Rosales- 

Hernandez B, Estrada-Garcia I, Mendez-Aragon P, Carranza- 

Rosales P, Gonzalez-Garza MT, Castro-Garza J (2008). 

Antimycobacterial activity of Juglans regia, Juglans mollis, Carya 

illinoensis and Bocconia frutescens. Phytother. Res., 22:557-559. 

Davis L, Stonehouse W, Loots DT, Mukuddem-Petersen J, Van Der 

Westhuizen F, Hanekom SJ, Jerling JC (2007). The effects of high 

walnut and cashew nut diets on the antioxidant status of subjects with 

metabolic syndrome. Eur. J. Nutr., 46: 155-164. 

Deshpande RR, Kale AR, Ruikar AD, Panvalkar PS. Kulkarni AA, 

Deshpande NR, Salvekar JP (2011). Antimicrobial Activity Of 

different extracts of Juglans Regia L. against Oral Microflora. Int. J. 

Pharm. Pharm. Sci., 3:200-201. 

Eganathan P, Subramanian HMSR, Latha R, Srinivasa Rao, C (2006). 

Oil Analysis in Seeds of Salicornia Brachiata, Ind. Crops Prod., 

23:177. 

Erdemoglu N, Kupeli E, Yesilada E (2003). Anti-inflammatory and 

antinociceptive activity assessment of plants used as remedy in 

Turkish folk medicine. J. Ethnopharmacol., 89: 123-129. 

Facciola S (1990). Cornucopoia . A source book of edible plants. 

kampong Publisher,USA. 

FAO (2008). FAOSTAT Data. Food and Agriculture Organisation, 

Rome. 

Fernandez-Lopez J, Aleta N, Alıas R (2000). Forest Genetic Resources 

Conservation of Juglans regia L. IPGRI Publishers, Rome. 

Fujita T, Sezik E, Tabata M, Yesilada E, Honda G, Takeda Y, Tanaka 

T, Takaishi Y (1995). Traditional medicine in Turkey VII. Folk 

medicine in Middle and West Black Sea regions. Econ. Bot., 49: 406- 

422. 

Fukuda T, Ito H, Yoshida T (2004). Effect of the walnut polyphenol 

fraction on oxidative stress in type 33 2 diabetes mice. Biofactors., 2: 

251-253. 

Fukuda T, Ito H, Yoshida Y (2003). Antioxidative polyphenols from 

walnuts (Juglans regia L.) Phytochem., 63: 795-801. 

Gandev, S (2007). Budding and grafting of the walnut (Juglans regia L.) 

and their effectiveness in Bulgaria (Review). Bulgar. J. Agri. Sci., 

13:683-689. 

Girzu M, Carnat A, Privat AM, Fialip J, Carnat AP, Lamaison JL (1998). 

Sedative effect of walnut leaf extract and juglone, an isolated 

constituents. Pharm. Biol., 36: 280-286. 

Gruenwald J, Brendler T, Jaenjke C (2001). PDR for Herbal Medicines, 

Medicinal Economic 

Hanusa LJ, Goldshlag P, Dembitskya VM (2008). Identification of 

cyclopropyl fatty acids in walnut (Juglans regia L.) OIL Biomed Pap. 

Med. Fac. Univ. Palacky Olomouc. Czech. Repub., 152:41-45. 

Haque R, Bin-Hafeez B, Parvez S, Pandey S, Sayeed I, Ali M, 

Raisuddin S (2003). Aqueous extract of walnut (Juglans regia L.) 

protects mice against cyclophosphamide-induced biochemical 

toxicity. Hum. Exp. Toxicol., 22:473-80. 

Hausen B (1981). Woods injurious to human health. Berlin: Publisher, 

Walter de Gruyter, pp 119–121. 

Hiroshi S, Junji T, Toshiyuki F, Hideyuki I, Tsuyoshi H, Takashi 

Y(2006). Hepatoprotective constituents in endocarps of walnut. J. 

Pharm. Soc. Japan 126:108-109. 

Hiroshi S, Tanaka J, Kikuchi M, Fukuda T, Ito H, Hatano T, Yoshida T 

(2008). Walnut polyphenols prevent liver damage induced by carbon 

tetrachloride and d-galactosamine: hepatoprotective hydrolyzable 

tannins in the kernel pellicles of walnut. J. Agric. Food Chem., 56: 

4444-4449. 

Hosamani, KM, Sattigeri RM (2000). Industrial utilization of Rivea 

Ornata seed oil: A moderate source of vernolic acid. Ind. Crops 

Prod., 12: 93. 

Hosseinzadeh H, Zarei H, Taghiabadi E (2011). Antinociceptive, anti- 

Inflammatory and acute toxicity effects of juglans regia L. Leaves in 

mice. Iran Red Crescent Med. J., 13:27-33. 

Ibrar MFH, Sultan A (2007). Ethnobotanical studies on plant resources 

of Ranyal Hill, District Shangla, Pakistan. Pak.J.Bot., 39:329-337.


Iwamoto M, Sato M, Kono M, Hirooka Y, Saka K, Takeshita A, Imaizumi 

K (2000).Walnuts lower serum cholesterol in Japanese men and 

women. J. Nutr., 130: 171-176. 

Jaradat NA (2005). Medical plants utilized in Palestinian folk medicine 

for treatment of diabetes mellitus and cardiac diseases. J. Al-Aqsa 

Unv., 19:1-28 

Jelodar G, Mohsen M, Shahram S (2007). Effect of walnut leaf, 

coriander and pomegranate on blood glucose and histopathology of 

pancreas of alloxan induced diabetic rats. Afr. J. Trad. CAM., 43: 

299-305. 

Ji Y, hong-YuanQua Z, XiangZou (2011). Juglone induced apoptosis in 

human gastric cancer SGC-7901cells via the mitochondrial pathway. 

Exp. Toxicol. Pathol., 63: 69-78. 

Kaileh Mb, Berghea WV, Boonec E, Essawib T, Haegemana G (2007). 

Screening of indigenous Palestinian medicinal plants for potential 

anti-inflammatory and cytotoxic activity J. Ethnopharmacol., 113: 510- 

516 

Kale AA, Sucheta A, Gaikwada, Gayatri S, Kamblea NR, Deshpandea, 

Salvekara JP (2011). In vitro anthelmintic activity of stem bark of 

Juglans regia L. J. Chem. Pharm. Res., 3:298-302. 

Kamei H, Koide T, Kojima T, Hashimoto Y, Hasegawa M (1998). 

Inhibition of cell growth in culture by quinones. Cancer Biother 

Radiopharm., 13:185–8. 

Kim HG, Cho JH, Jeong EY, Lim JH, Lee SH, Lee HS (2006). Growthinhibiting 

activity of active component isolated from Terminalia 

chebula fruits against intestinal bacteria. J. Food Prot., 69:2205-2209. 

Kong Y, Zhang L, Yang Z, Han C, Li-hong (2008). Natural product 

Juglone targets three key enzymes from Helicobacter pylori: inhibition 

assay with crystal structure characterization. Acta Pharmacologica 

Sinica., 29: 870-876. 

Kumudhavalli MV, Jayakar B, Kumar GA (2010). Phytochemical and 

pharmacological evaluation of the dried fruit of the plant Juglans regia 

linn. Oil Drug Invent. Today 2: 362-365. 

Kunwar RM, Adhikari N (2005). Ethnomedicine of Dolpa district, Nepal: 

the plants, their vernacular names and uses. J. Ecol. App., 8:43-49 

Liu J, Meng M, Li C, Huang X, Di D (2008). Simultaneous determination 

of three diarylheptanoids and an alpha-tetralone derivative in the 

green walnut husks (Juglans regia L.) by high-performance liquid 

chromatography with photodiode array detector. J. Chromatogr. A., 

1190: 80-85. 

Liu L, LiW, KoikeK, Zhang S, Nikaido T (2004). Newalphatetralonylglucosides 

from the fruit of Juglans mandshurica. 

Chem.Pharm.Bull. Tokyo 52:566-569. 

Martinez ML, Labuckas DO, Lamarque AL, Maestri DM (2010). Walnut 

(Juglans regia L.): genetic resources, chemistry, by-products. J. Sci. 

Food. Agric., 90: 1959-1967. 

Mei-zhi Z, Bing-nian J, Cai-xia J, Chao-bin L (2007). Study on 

Extraction Conditions of Active Antiviral Substance from Walnut 

Leaves. Chemistry and Industry of Forest Products. 02 [Abstract]. 

Mei-zhi Z, Feng-yun Z , Hua W, Wei W (2006). A Study on the 

Bioactivity of Secondary Metabolites from Walnut Green Gull 

University. Journal of Northwest Forestry University-01 [Abstract]. 

Mitrovic M, Stanisavljevic M, Danjanovic JG (1997). Biochemical 

composition of fruits of some important walnut cultivars and 

selections. Proceeding of the third International walnut held at 

Alcobaca, Portugal, Congress. Acta. Hortcult 442: 205- 207. 

Mokhtari M, Shariati M, Sadeghi N (2008). Effect of alcohol extract from 

leave Juglans regia on antinociceptive induced by morphine in 

formalin test. Med. Sci. J. Islam. Azad. Uni., 18: 85-90. 

Mouhajir F, Hudson JB, Rejdali M, Towers GHN )2001(. Multiple 

antiviral activities of endemic medicinal plants used by Berber people 

of Morocco. Pharm. Biol., 39: 364-374. 

Muradoglu FH, Oguz I, Yildiz K, Yilmaz H (2010). Some chemical 

composition of walnut (Juglans regia L.) selections from Eastern 

Turkey. Afr. J. Agric. Res., 5: 2379-2385. 

Muradolu F (2005). Selection of promosing genotypes in native walnut 

(Juglans regia L.) populations of Hakkari central and Ahlat (Bitlis) 

districht, and genetic diversty. PhD dissertation, University of 

Yuzuncu Yil, Turkey. 

Nariman F, Eftekhar F, Habibi Z, Falsafi T (2004). Anti-Helicobacter 

pylori activities of six Iranian Plants. Helicobacter., 9:2. 

Oliveira I, Sousa A, Ferreira ICFR, Bento A, stevinhol LE, Pereira JA 

(2008). Total phenols, antioxidant potential and antimicrobial activity of 

walnut (Juglans regia L.) green husks. Food Chem. Toxicol., 46: 

2326-2331. 

Oryza (2007). Hepatoprotective and anti-oxidative extract for metabolic 

syndrome walnut polyphenol. ver.1.0 HS Oryza Oil and Fat Chemical 

Co., Ltd 

(http://www.oryza.co.jp/html/english/pdf/Walnut_polyphenol1.0.pdf). 

Ozer B, Kivc MB (2007). Antityrosinase activity of some plant extracts 

and formulations containing ellagic acid. Pharm. Biol., 45: 519-524. 

Papoutsi Z, Kassi E, Chinou I, Halabalaki M, Skaltsounis LA, 

Moutsatsou P (2008). Walnut extract (Juglans regia L.) and its 

component ellagic acid exhibit anti-inflammatory activity in human 

aorta endothelial cells and osteoblastic activity in the cell line KS483. 

British J. Nutr., 99:715-722. 

Payne T (1985). California walnuts and light food. Cereal Foods World 

30: 215-218. 

Pereira JA, Oliveira I, Sousa A, Ferreira ICFR, Bento A, Estevinho L 

(2008). Bioactive properties and chemical composition of six walnut 

(Juglans regia L.) cultivars. Food Chem. Toxicol., 46: 2103-2111. 

Poyrazolu EC, Biyik H (2010). Antimicrobial activity of the ethanol 

extracts of some plants natural growing in Aydin, Turkey. Afr. J. 

Microbiol. Res., 4: 2318-2323. 

Qa’dan F, Al-Adham1 IS, Nahrstedt A. (2005a). Characterization of 

antimicrobial polymeric procyanidins from Juglans regia leaf extract. 

Eur. J. Sci. Res., 11:438-443. 

Qa’dan F, Thewaini A, Ali D, Afifi R, Elkhawad A, Matalka K 

(2005b).The Antimicrobial Activities of Psidium guajava and Juglans 

regia Leaf Extracts to acne-developing organisms. Am. J. Chin. Med., 

33: 197–204. 

Qamar W, Sultana S (2011). Polyphenols from Juglans regia L. 

(Walnut) kernel modulate cigarette smoke extract induced acute 

inflammation, oxidative stress and lung injury in Wistar rats. Hum. 

Exp. Toxicol., 30:499-506. 

Rahimipanah M, Hamedi M, Mirzapour M (2010). Antioxidant activity 

and phenolic contents of Persian walnut (Juglans regia L.) green 

husk extract. Afr. J. Food Sci. Technol., 1:105-111. 

Rath BP, Pradhan D (2009). Antidepressant Activity of Juglans regia L. 

fruit extract. Int. J. Toxicol. Pharmacol. Res., 1: 24-26. 

Ravai M (1992). Quality characteristics of califonia walnuts. Cereal 

Foods World 37: 362-366. 

Robbers JE, Tyler VE (1999). Tyler's Herbs of Choise: The therapeutic 

use of phytomedicinals, The Havvorth Herbal Press, New York. 

Ros E, Nnez I, Perez-Heras A, Merce S, Gilabert R, Casals E, Deulofeu 

R (2004). Walnut diet improves endothelial functions in 

hypercholesterolemic subject. Circulation 109: 1609-1614. 

Saad B, Dakwar S, Said O, Abu-Hijleh G, Al-Battah F, Kmeel A, 

Aziazeh H (2006). Evaluation of medicinal plant hepatotoxicity in cocultures 

of hepatocytes and monocytes. eCAM., 3:93-98. 

Salicornia Brachiata, Ind. Crops Prod., 23:177. 

Savage GP (2001). Chemical composition of walnuts (Juglans regia L.) 

grown in New Zealand. Plant Foods Hum. Nutr., 56: 75-82. 

Segura-Aguilar J, Jonsson K, Tidefelt U, Paul C (1992). The cytotoxic 

effects of 5-OH-1, 4-naphthoquinone and 5, 8-diOH-1,4naphthoquinone 

on doxorubicin-resistant human leukemia cells (HL- 

60). Leuk Res., 16: 631–637. 

Shimoda H, Tanaka J, Kikuchi M, Fukuda T, Ito H, Hatano T, Yoshida T 

(2009). Effect of polyphenol-rich extract from walnut on diet-induced 

hypertriglyceridemia in mice via enhancement of fatty acid oxidation 

in the liver. J. Agric. Food Chem., 57:1786-92. 

Society for Neuroscience (2007). "News Release: Diet of walnuts, 

blueberries improve cognition; may help maintain brain function", 

Society for Neuroscience, 5 November 2007 

[http://www.sfn.org/index.aspx?pagename=news_110507b]. 

Souci SW, Fachmann W, Kraut H (1994). Food composition and 

nutrition tables. Medpharm, CRC Press, Stuttgart. 

Spaccarotella KJ, Kris-Etherton PM, Stone WL, Bagshaw DM, Fishell 

VK, West SG, Lawrence FR, Hartman TJ (2008). The effect of 

walnut intake on factors related to prostate and vascular health in 

older men. Nutr. J., 7:13. 

Sugie S, Okamoto K, Rahman KM, Tanaka T, Kawai K, Yamahara J 

(1998). Inhibitory effects of plumbagin and juglone on azoxymethane- 

induced intestinal carcinogenesis in rats. Cancer Lett., 127:177–183.

Sze-Tao KWC, Sathe SK (2000).Walnut (Juglans regia L): proximate 

composition, protein solubility, protein amino acid composition and 

protein in vitro digestibility. J. Sci. Food Agric., 80:1393–1401. 

Tagarelli G, Tagarelli A, Piro A (2010). Folk medicine used to heal 

malaria in Calabria (southern Italy). J. Ethnobiol. Ethnomed., 6:27 

Teimori M, Montasser KS, Ghafarzadegan R, Hajiaghaee R (2010). 

Study of Hypoglycemic Effect of Juglans regia leaves and its 

Mechanism, J. Med. Plants 9:57-65. 

Torres-Gonzalez (2011). Protective effect of four Mexican plants against 

CCl4 –induced damage in the hyh7 human hepatoma cell. Annals 

hematology., 10:73-79. 

Upadhyay V, Kambhoja S, Harshaleena K (2010c). Antifungal activity 

and preliminary phytochemical analysis of stem bark extracts of 

Juglans regia linn. IJPBA., 1:442-447 

Upadhyay V, Kambhoja S, Harshaleena K, Veeresh, Dhruva K (2010a) 

Anthelmintic activity of the stem bark of Juglans regia Linn. Res J. 

Pharm. Phytochem. (RJPP) 2: 465-467 

Upadhyay V, Kambhoja S, Leena HK (2010b). Antibacterial activity and 

preliminary phytochemical analysis of stem bark extract of juglans 

regia linn. Pharmacologyonline 3: 274-279 Newsletter. 

USDA (2010). National Nutrient Database for Standard Reference, 

Release 23. 

Vaidyaratnam PSV (2005). Indian Medicinal Plants a Compendium of 

500 species. Orient Longman Private Limited, Chennai 3: 264-65. 


Venkatachakm M, Sathe SK (2006) Chemical composition of selected 

edible nut seeds. J. Agric. Food. Chem., 54:4705–4714. 

Willis L, Shukitt-Hale B, Cheng V, Joseph J (2009). Dose-dependent 

effects of walnuts on motor and cognitive function in aged rats. Br. J. 

Nutr., 101: 1140-1144. 

Woods B, Calnan CD (1976). Toxic woods. Br. J. Dermatol., 94 (suppl, 

13): 17. 

Yesilada E (2002). Biodiversity in Turkish Folk Medicine. In: Sener, B. 

(Ed.), Biodiversity: Biomolecular Aspects of Biodiversity and 

Innovative Utilization. Kluwer Academic/Plenum Publishers, London, 

pp. 119–135. 

Zhang J, Jun-xi L, Fei Z, Duo-long D (2009a). Chemical constituents in 

green walnut husks of Juglans regia. Chinese Traditional and Herbal 

Drugs. 06 [Abstract]. 

Zhang Z, Liao L, Moore J, Wua T, Wang Z (2009b). Antioxidant 

phenolic compounds from walnut kernels (Juglans regia L.). Food 

Chem., 113: 160-165. 

Zibaeenezhad MJ, Rezaiezadeh M, Mowla A, Ayatollahi SMT, 

Panjehshahin MR (2003). Antihypertriglyceridemic effect of walnut oil. 

Angiology., 54: 4.




DOI: 10.5897/AJMR11.949 

Review 

The use of gamma irradiation in agriculture 

Issa. Piri 1 , Mehdi. Babayan 2* , Abolfazl. Tavassoli 2 and Mehdi. Javaheri 2 

1 Departmant of Agriculture, Payame noor University, PO Box 19395-4697, IR. Of Iran. 

2 Department of Agriculture, Esfarayen Branch, Islamic Azad University, Esfarayen, Iran. 

Accepted 9 November, 2011 

Lately, radiation technology is widely used to produce changes in the product characteristics leading to 

the development of new products. Gamma irradiation is capable of hydrolyzing chemical bonds, 

thereby cleaving large molecules of starch into smaller fragments of dextrin that may be either 

electrically charged or uncharged as free radicals. These changes may affect the physical and 

rheological properties of irradiated foods, resulting in increased solubility of starch, decreased swelling 

power, and decreased viscosity of starch paste. Irradiation of gamma rays on bud wood can produce 

higher frequencies of mutation, leading to the creation of new variants compared to the control. 

Macronutrients (carbohydrates, proteins and lipids) content are relatively stable against irradiation 

doses up to 10 kGy, on the other hand, gamma irradiation affects proteins by causing conformational 

changes, oxidation of amino acids, rupturing of covalent bonds and formation of protein free radicals. 

Radiation mediated morphological, structural and functional changes in a plant are governed by the 

intensity and duration of the gamma irradiation. 

Key words: Irradiation, Foods sterilized, Mutation, Biochemical change, Agriculture. 

INTRODUCTION 

Irradiation is an ionic, no-heat process that continues to 

receive attention as a preservation and functional 

modification agent in polymer research and application 

(Abu et al., 2006). It was considered as one of the 

physical modification methods of nature polysaccharide 

(Hai et al., 2003; Relleve et al., 2005; Rombo et al., 

2004). In comparison with other physical modification 

methods, such as microwave, UV, ultrahigh hydrostatic 

pressure and hydrothermal treatment, irradiation 

treatment is rapid, convenient and more extensive 

because ionizing energy penetrates through the 

polysaccharide granule rapidly (Bao et al., 2005). This 

process is useful in solving various agricultural problems: 

reduction of post-harvest losses through suppressing 

sprouting and contamination, eradication or control of 

insect pests, reduction of food-borne diseases and in 

extension of shelf life, and breeding of high performance 

well adapted and disease resistant agricultural crop 

varieties (Andress, 1994; Emovon, 1996). 

*Corresponding author. E-mail: M_ATS57@yahoo.com. 

Mutation 

Nuclear techniques, in contrast to conventional breeding 

techniques, are widely applied in agriculture for improving 

genetically diversity. Unlike conventional breeding 

procedures which involve the production of new genetic 

combinations from already existing parental genes, 

nuclear technology causes exclusively new gene 

combinations with high mutation frequency. Basic tool of 

nuclear technology for crop improvement is the use of 

ionizing radiation which causes induced mutations in 

plants. These mutations might be beneficial and have 

higher economical values (Abdul et al., 2010). 

Mutagenesis has already been used to improve many 

useful traits affecting plant size, flowering time and fruit 

ripening, fruit color, self compatibility, self thinning, and 

resistance to pathogens. Nowadays, the number of 

cultivars derived from mutation induction increases 

constantly (Hearn, 2001; Maluszynski et al., 1995). 

Inducing mutations by gamma rays has been effectively 

used with several species of Citrus. Irradiation of gamma 

rays on bud wood can produce higher frequencies of 

mutation leading to the creation of new variants

compared to the control. Radio sensitivity (LD 50) of 

acute exposure of Citrus ranges from 40 to 100 Gy 

(Sanada and Amano, 1998; Sparow, 1968) depending on 

species and varieties. Scion (bud wood), seeds, foral 

stage embryos, and in vitro material of Citrus were 

exposed to gamma rays. Citrus sunki was irradiated with 

20 or 40 Gy of gamma rays at three different foral stages 

(Spiegel-Roy and Padova, 1973) and nucellar seedling 

(Ikeda, 1976). A spine free mutant was selected from 

irradiated nuclear. In Citrus sinensis, immature seeds 

were exposed to gamma rays at the doses 80-100Gy 

(Sparow, 1968), while those polyembryonic seeds were 

exposed to gamma rays of 100Gy (Kukimura, 1976). Two 

seedless mutants were selected, leading to release of a 

new cultivar “Hongju 418 and Hongju 420” (Kukimura, 

1976). Citrus paradisi cv Hudson were exposed with 

thermal neutron, leading to release of a seedless mutant 

‘Star Ruby’ (Chen, 1991). Another fve nearly seedless 

mutants of Citrus paradisi cv Foster were also selected 

from irradiated bud wood at the dose 50 gray of gamma 

rays (Micke, 1985). Citrus limon cv Eureka and Israeli 

Villafranca were irradiated by 60 and 50 Gy of gamma 

rays respectively, and completely new seedless varieties 

were released (Hearn, 1985). A red color of flesh and 

juice mutant derived from 80 Gy gamma irradiation of 

Citrus paradisi cv Ruby Red was released as cultivar Rio 

Red in 1984 (Spiegel-Roy, 1985). Bud woods of pummel, 

mandarin and Navel Orange irradiated by gamma-rays at 

doses of 30 to 75 Gy showed high sensitivity at higher 

dose, while Valencia and grapefruit produced more 

seedless fruits from those at the higher doses (Wu, 

1986). Khatri et al. (2005) collected three high grain 

yielding and early maturing mutants by treating seeds of 

Brassica juncea L. cv. S-9 with gamma rays (750 to 

1000KGy) and EMS. 

Shah et al. (2001) developed a new oil seed Brassica 

napus L cv. ABASIN-95 by induced mutation. They 

exposed seeds of B. napus L. cv. Tower to 1.0, 1.2 and 

1.4 KGy gamma rays and the resulting new variety was 

high yielding, resistant to Alternaria blight and white rust. 

Irradiation of gamma rays (10-60 Gy) on calli in vitro 

proliferation stage resulted in high mortality at the dose of 

60 Gy (Predieri, 2001) When nucellus and embryonic 

mases of Citrus sinensis cv. Pera were exposed to 

gamma irradiation at the dose 0–160 Gy and 0–189 Gy 

respectively, normal growth of plantlets was obtained 

from irradiated nucellus exposed to 20 – 80 Gy 

(Froneman, 1996). 

Physiological changes in crop 

Gamma irradiation induced physiological changes in crop 

although, gamma radiation is a technology with immense 

applications in agriculture, industry and medicine, its 

potential exploitation in agriculture is limited mainly 

because of lack of information awareness on optimal 

Piri et al. 5807 

dose of irradiation which differs from one crop to another 

crop and from one application to another application. 

Radiation mediated morphological, structural and/or 

functional changes in a plant are governed by the 

intensity and duration of the gamma irradiation. In wheat, 

particularly, research efforts are needed to develop plant 

types with reduced height, which would enable them to 

tolerate gusty wind and contain losses due to lodging and 

subsequently grain yield. Mashev et al. (1995) used high 

irradiation dose of 5000–15 000 R to achieve a decrease 

in plant height and an increase in yield and suggested 

that even higher irradiation dose could be used to 

develop yield efficient wheat plant types. Wheat grains 

from irradiated plants were also rich in proteins and 

essential amino acids (Mashev et al., 1995). Din et al. 

(2003) studied the effect of gamma irradiation on different 

wheat varieties at seed irradiation dose of 10, 20, 30 and 

35 krad. A higher dose of 30 and 35 krad created some 

abnormalities in plant types for example, a tiller having 

two ears attached with each and/or prevalence of sterile 

ears etc. Mashev et al. (1995), observed a significant 

decline in grain yield of wheat at doses above 0.10 kGy, 

however, lower doses of 0.01 and 0.025 kGy increased 

grain yields. Spielmeyer et al. (2007) had used a high 

vigour breeding line vigour 18 to identify a QTL on 

chromosome 6A that accounted for up to 8% of the 

variation for coleoptile length, 14% of seedling leaf width 

and was associated with increased plant height. They 

found a SSR marker, NW 3106, nearest to the 6A QTL 

that was associated with greater leaf width in a breeding 

population. The Vigour 18 allele of the QTL on 

chromosome 6A promoted coleoptile length and leaf 

width not only during early plant growth but was also 

found to be associated with increased plant height at 

maturity (Spielmeyer et al., 2007). 

Biochemical change in crop 

Extensive research showed that the macronutrients 

(carbohydrates, proteins and lipids) content are relatively 

stable against irradiation doses up to 10 kGy (WHO, 

1994). However, Lee et al. (2005) reported that gamma 

irradiation affects proteins by causing conformational 

changes, oxidation of amino acids, rupturing of covalent 

bonds and formation of protein free radicals. Also, chemical 

changes in the proteins caused by gamma irradiation 

include fragmentation, cross-linking, aggregation and 

oxidation by oxygen radicals that are generated in the 

radiolysis of water. Gamma irradiation has a slight effect 

on the amino acid profile at recommended doses to foods 

(WHO, 1999). This effect could be related to the structure 

of each amino acid as revealed by many authors (Simic, 

1983; Urbain, 1986; Elias and Cohen, 1997; Matloubi et 

al., 2004; Erkan and Ozden, 2007). The previous authors 

concluded that simple amino acids increased upon 

irradiation, such as glycine, which undergo reductive


deamination and decarboxylation. In addition, aliphatic 

amino acids with increasing chain length, provide additional 

C–H bonds for interaction with OH radicals which 

reduces the extent of oxidative deamination. Wang and 

von Sonntage (1991) reported that sulfur containing as 

well as aromatic amino acids are, in general, the most 

sensitive to irradiation, while simple amino acids could be 

formed by destruction of other amino acids. Diehl (1995) 

and Matloubi et al. (2004) reported that there is a mutual 

protection exerted when different substances are 

irradiated together. 

The results of irradiating multiple compounds together 

will, generally, not cause much chemical change in any 

one of the compounds, when irradiated alone. The effects 

of gamma irradiation on physicochemical changes in 

proteins have been described in previous studies, where 

chemical trans-formations of amino acids, breakdown of 

peptide bonds, hydrogen and disulphide bridges were 

observed (Ambe et al., 1961; Bernofsky et al., 1959; 

Nisizawa, 1988; Puchala et al., 1979; Zabielski et al., 

1984). 

Delincee and Pushpa (1981) observed cross-linking of 

the chain influences of the tertiary structure of proteins 

and their physicochemical properties. Decomposition and 

denaturation were detected in irradiated proteins (Ciesla 

et al., 2000). The decrease of apparent amylose content 

was possibly originated from the breakage or cleavage of 

long chains in amylopectin caused by gamma irradiation 

(Wu et al., 2002). It also agreed with Descherider and 

Grant’s observation (Descherider, 1960; Grant and 

D’Apponlonia, 1991) that the decreasing apparent 

amylose content results from the shortening of 

polysaccharide chains. Ciesla et al. (2000), stated that 

indicating modification of proteins occurring after gamma 

irradiation similar to the transformations taking place 

under heating. 

Kanemaru, et al. (2005), reported that protein content 

for the irradiated semolina and semolina obtained from 

irradiated wheat grains was not affected with gamma 

irradiation and ranged around 10.6-10.9%. Similarly, 

these results also agreed with the findings of Marathe et 

al. (2002), Agundez-Arvizu et al. (2006) and Azzeh and 

Amr (2009). Kwon et al. (1988) concluded from their 

studies on a Korean garlic cultivar that immediately after 

gamma irradiation with 100 Gy there are no differences in 

the levels of linoleic, palmitic, oleic and linolenic acids, 

the predominant fatty acids of bulbs. 

The low radiation dose used could have produced its 

long-term effects in part by means of the stimulation of 

lipid degradation, possibly mediated through the action of 

free radicals that are known to be generated after 

irradiation (Katsaras et al., 1986; Voisine et al., 1991). In 

plant tissues subject to different forms of stress, polar 

lipids are degraded to generate free fatty acids and 

diacylglycerols, resulting in an eventual accumulation of 

TG as a defense mechanism (Olsson, 1995; Navari-Izzo 

et al., 1990). 

Effect of irradiation on crop growth and seed 

germination 

When ionizing radiation is absorbed in biological 

materials, it acts directly on critical cell targets or 

indirectly through the generation of metabolites that can 

modify important cell components. Low doses of gamma 

irradiation have been used to advantage in order to 

control the degree of ripeness and extend the shelf life of 

fruits and vegetables. The use of ionizing radiation 

depends on a country as food irradiation is illegal in some 

countries. Detection methods of ionizing radiation are 

also required for enforcing good control. Methods such as 

inhibition of seed germination and elongation of roots and 

shoots from germinating seeds have been reported for 

the detection of irradiated seeds of crop species 

(Qiongying et al., 1993; Zhu et al., 1993; Selvan and 

Thomas, 1999; Barros et al., 2000). Chaudhuri (2002) 

reported a simple and reliable method to detect gamma 

irradiated lentil seeds by germination efficiency and 

seedling growth test. 

There is a difference in the detection of irradiated 

seeds of kabuli -type chickpeas and wild Cicer species. 

Toker and Cagirgan (2004) reported that the shoot length 

of kabulitype chickpeas was induced by 100Gy irradiation 

as compared to the controls. For this reason, only 200, 

300 and 400 Gy doses were taken into account for 

irradiation. Chaudhuri (2002) found similar results with 

lentil. Villavicencio et al. (1998) showed that root growth 

and the almost totally retarded shoot elongation of 

irradiated common bean and mung bean were markedly 

reduced as compared to the non-irradiated checks. They 

stated that the critical dose that prevented shoot and root 

elongation varied among species and also ranged from 

genotype to genotype within species. The kabuli types 

were more affected than the desi ones. This is a certain 

and reliable way to identify the effects of gamma rays on 

Cicer seeds in a very short time. These effects might in 

time be developed into a method for irradiation detection. 

Higher doses inhibit germination. 

Chromatographic analysis of some herbal extracts 

indicated that changes in total yield and constituents of 

volatile oil following irradiation were ranged from none to 

slight depending upon dose-based irradiation in variety of 

herbs (IAEA, 1992; Venskutonis et al., 1996; Chatterjee 

et al., 2000). It can be assumed, therefore, that the dose 

which can be applied and hence extent to the microbial 

kill may be limited by undesirable changes in volatile oil 

constituents, their yield and flavor quality. Farag et al. 

(1995) that reported terpenes were converted to 

monoterpe-nesalcohols. b-Eudesmol, an oxygenated 

monoterpenes, was the major compound in this group, 

while verbenol, a-eudesmol, verbenone, and (E)-r-2menthen-1-ol 

were also detected. The a-and b-eudesmol 

were increased to 9.52% from 6.91%, with no major 

variation between the different irradiation doses. The 

remaining oxygenated terpene levels also did not vary

significantly during irradiation. Quantity of paeoniflorin in 

Paeoniae radix, i.e. no change with irradiation as cited by 

Yu et al. (2004). In addition, Owczarczyk et al. (2000) 

have reported that the content of biologically active 

substances, including the essential oils, flavonoids, 

glycosides, anthocyanins, and plants mucus did not 

change significantly after irradiation. Irradiation can also 

increase the alkaloids percentage in the different organs 

of plant, particularly the leaves (Abo Elseud, 1983; El- 

Kholy, 1987; Habba, 1989). The increase or decrease in 

the germination percentage was found to attributed to 

gamma rays treatments. The stimulating effects of 

gamma ray on germination may be attributed to the 

activation of RNA synthesis (Kuzin at al., 1975) on coster 

bean, or protein synthesis (Kuzin et al., 1976) which 

occurred during the early stage of germination after 

seeds irradiated with 4 K-rad. These results are in 

agreement with the findings of Grover and Dhanju, (1980) 

on Papaver somniferum and Donge et al. (1986) on tea 

seeds. Habba (1989) who reported that increasing the 

dose of gamma rays up to 100 Gy, gradually increased 

the germination percentage, and then decreased 

gradually with increasing the gamma ray dose in the 

second season in Hyoscyamus muticus. Hell et al., 

(1974) stated that on Phaseolus vulgaris, treating seeds 

with high rates of gamma radiation reduced germination. 

Abo Elsauod and Omran (1976) indicated that irradiation 

snap bean seeds with 50, 100 and 150 Gy resulted in 

greater percentage of germination than the control. 

Regarding the effect of GA on seed germination an 

increase in germination percentage was observed by 3 

increasing GA concentration was in confirmity with 

Ruminska et al. (1978) Who reported that the seed 3 

soaking, preceding the sowing, in solutions 500, 1000, 

1500 and 2000 ppm of GA improved germination ability 

of seven species of seeds, particularly good effects were 

achieved with Lavandula vera and Atropa belladonna 

where not only germination ability was not only increased 

but also accelerated and even shooting was obtained. 

Increase in higher germination percentage at higher 

doses might be due to their stimulating effects on 

activating RNA synthesis or protein synthesis (Kuzin et 

al., 1975; 1976) or it could be due to the elimination of 

germinating bacterial populations, their spores and mould 

fungi (Gruner et al., 1992) 

Food irradiation 

Research on food irradiation dates back to the turn of the 

twentieth century with the first United States of America 

and British patents being issued in 1905. It allowed the 

use of ionising radiation to kill bacteria in food (ICGFI 

1999). The United States have since amended their drug 

regulations to allow the irradiation of certain food 

products to control food-borne pathogens (USEPA 2002). 

Food irradiation is a process in which products are 

exposed to ionizing energy, such as gamma rays, 


electron beams and X-rays for a specified time (FDA, 

1986). A food is irradiated to utilize the destructive power 

of ionization radiation on the microorganisms with 

minimum changes in food constituents (Zenthen and 

Sorensen, 2003). Nowadays, irradiation of food is 

permitted in over than 60 countries for the purpose of 

food preservation by destruction of microbes, worms, 

insects and parasites, as well as for the inhibition of 

sprouting of potatoes and onions (IAEA, 2007). According 

to international health and safety authorities; Joint 

FAO/IAEA/WHO Expert Committee on the 

Wholesomeness of Irradiated Foods (JECFI), foods 

irradiated up to 10 kGy are considered safe and present 

no toxicological hazard and no special nutritional or 

microbiological problems in food (Anonymous, 1981). 

Gamma radiation of 30–1000 Gy has been applied to 

achieve a delay in the ripening of some fruits and 

vegetables (WHO 1988). A reduction in the amount of 

visible and total mould present in bread during a storage 

period of up to 20 weeks was reportedly achieved by 

applying a gamma radiation dose of 150 Gy to the flour 

(Adejumo 1998). Bansa and Appiah (2003) have also 

reported the successful use of gamma radiation dose of 

120 Gy to effectively inhibit sprouting in yams for six 

months under tropical ambient conditions. Furthermore, 

higher gamma radiation doses of 2–4 kGy have been 

used to successfully reduce the infection rate in sugar 

beet seeds (Rizk and Moussa 2003)while a dose of 

approximately 500 Gy has been employed to disinfect 

and also reduce microbial populations in cocoa beans 

(Adesuyi 1996). 

Foods sterilized 

During the last decade interest has increased in the 

methods of food sterilization and modification applying 

medium (1–10 kGy) and high doses (10–70 kGy) of 

irradiation as well as radiation processing of industrial 

products that contain starch. Foods sterilized at high 

doses may be consumed by immunologically depressed 

patients and can be stored at room temperature (for 

example bakery products, readily prepared meals). 

Radiation modification enables, moreover, removal of ant 

nutritional factors and inhibition of food allergies Doses of 

several dozen kGy are used for sterilization of 

pharmaceuticals and medical devices and for starch 

modification. Accordingly, it appears desirable to acquire 

knowledge about the functional and structural properties 

of foods and starch alone irradiated using medium and 

high doses and in the development of appropriate 

physicochemical testing methods. 

CONCLUSION 

Many investigate on effect of gamma radiation on crop 

were carried out and their results showed usage of


gamma radiation have different effect on crop such as 

Biochemical and physiological change, growth and 

germination inhibition. Inhibition of seed germination and 

elongation of roots and shoots from germinating seeds 

have been reported for the detection of irradiated seeds 

of crop species. Gamma irradiation affects proteins by 

causing conformational changes, oxidation of amino 

acids, rupturing of covalent bonds and formation of 

protein free radicals. Also, chemical changes in the 

proteins caused by gamma irradiation include fragmentation, 

cross-linking, aggregation and oxidation by oxygen 

radicals that are generated in the radiolysis of water. 

Irradiation is effective method for microbiological 

decontamination of them, and the content of essential 

biologically active substances and pharmacological 

activity of medicinal herbs not change significantly with 

irradiation. 

REFERENCES 

Abdul Majeed, Asif Ur Rehman Khan, Habib Ahmad, Zahir Muhammad 

(2010). Gamma irradiation effect on some growth parameters of 

Lepidium sativum L. ARPN, J. Agric. Biol. Sci., 5(1): 39-42. 

Abo Elseud MA (1983). Biochemical Studies on Some Medicinal Plants 

As Affected By Radiation And Protective Agents. M.Sc. Thesis, Fac. 

Agric. Menoufia Univ., 65-69. 

Abu JO, Muller K, Duodu KG, Minnaar A (2005). Functional properties 

of cowpea (Vigna unguiculata L. Walp) flours and pastes as affected 

by c-irradiation. Food Chem., 93: 103–111. 

Adejumo J (1998). Food preservation by gamma irradiation BSc Project 

Department of Physics, Obafemi Awolowo University, Ile-Ife, Nigeria. 

Adesuyi SA (1996). Use of irradiation for post-harvest preservation of 

crops with special reference to Nigeria, J. Irradiation National Dev., 

11: 46–9. 

Agundez-Arvizu Z, Fernandez-Ramirez M, Arce-Corrales M, Cruz- 

Zaragoza E, Melendrez R, Chenov V, Barboza Flores M (2006). 

Gamma irradiation effects on commercial Mexican bread making 

wheat flour. Nucl. Instrum. Methods Phys. Res. B, 245: 455–458. 

Ambe KS, Kumta US, Tappel AI (1961). Radiation damage to 

cytochrome C and hemoglobin. Radiat. Res., 15: 709–719. 

Andress EL, Delaplane KS, Schuler GA (1994). Food Irradiation. Fact 

sheet HE 8467 (Institute of Food and Agricultural Sciences University 

of Florida, USA). 

Anonymous (1981). Wholesomeness of irradiated food report of a joint 

FAO/IAEA/ WHO expert committee. Technical Report Series: 659. 

WHO, Geneva. 

Azzeh F, Amr A (2009). Effect of gamma irradiation on physical 

characteristics of Jordanian durum wheat and quality of semolina and 

lasagna products. Radiat. Phys. Chem., 78: 818–822. 

Bansa D, Appiah V (2003). Preservation of yams by gamma radiation J. 

Ghana Sci. Assoc., 1: 3. 

Bao JS, Ao ZH, Jane JL (2005). Characterization of physical properties 

of flour and starch obtained from gamma-irradiated white rice. Starch, 

57: 480–487. 

Barros AC, Freund MTL, Villavicencio ALCH, Delin-cee H, Arthur V 

(2000). Identification of irradiated wheat by germination test, DNA 

comet assay and electron spin resonance. Radiat. Phys. Chem., 63: 

423–426. 

Bernofsky C, Fox Jr. JB, Schweigert BS (1959). Biochemistry of 

myoglobin VI: the effect of low dosage gamma irradiation on beef 

myoglobin. Arch. Biochem. Biophys., 80: 9–21. 

Chatterjee S, Variyar PS, Gholap AS, Pudwal-Desai SR, Bongir- war 

DR (2000). Effect of g-irradiation on the volatile oil constituents of 

turmeric (Curcuma longa). Food Res. Int., 33: 103–106. 

Chaudhuri SK (2002). A simple and reliable method to detect gamma 

irradiated lentil (Lens culinaris.) seeds by germination efficiency and 

seedling growth test. Radiat. Phys. Chem., 64: 131–136. 

Chen S (1991). Studies on the seedless character of Citrus induced by 

irradiation. Mutat. Breeding Newslett., 37: 8-9. 

Ciesla K, Roos Y, Gluszewski W (2000). Denaturation processes in 

gamma irradiated proteins studied by differential scanning 

calorimetry. Radiat. Phys. Chem., 58: 233–243. 

Descherider AR (1960). Changes in starch and its degradation products 

on irradiating wheat flour with gamma rays. Starch/Staerke 12: 197. 

Diehl J (1995). Safety of Irradiated Foods, second ed. Marcel Dekker, 

New York, USA. pp. 89-95. 

Din R, Ahmed QK, Jehan S (2003). Studies for days taken to earing 

initiation and earing completion in M1 generation of different wheat 

genotypes irradiated with various doses of gamma radiation. Asian J. 

Plant Sci., 2: 894–896. 

Elias P, Cohen A (1997). Radiation Chemistry of Major Food 

Components. Elsevier Scientific, Amsterdam, Netherlands. 159-163. 

Emovon EU (1996). Keynote Address: Symposium Irradiation for 

National Development (Shelda Science and Technology Complex, 

SHESTCO, Abuja, Nigeria). pp. 156-164. 

Erkan N, Ozden O (2007). The changes of fatty acid and amino acid 

compositions in sea bream (Sparus aurata) during irradiation 

process. Radiat. Phys. Chem., 76: 1636–1641. 

Farag SED, Aziz Attia ESA (1995). Effect of irradiation on the 

microbiological status and flavouring materials of selected spices. 

Eur. Food Res. Technol., 201: 283–288. 

FDA (1986). Irradiation in the production, processing and handling of 

food. Food and Drug Administration (Federal Register), 51(75): 

13376–13399. 

Froneman IJ (1996). Producing seedless Citrus cultivars with gamma 

irradiation. Proc Int. Soc. Citriculture, pp.159-163. 

Grant LA, D’ Aponlonia BL (1991). Effect of low-level gamma radiation 

on water-soluble non-starchy polysaccharides isolated from hard red 

spring wheat flour and bran. Cereal Chem., 68: 651. 

Grover IS, Dhanju MS (1980). Effect of gamma radiation on the 

germination of papaver somniferum and papaver. rhoeas. Indian J. 

Plant Physiol., (1979), 22(1): 75-77. Hort. Abst., 1980, 50: 6595. 

Habba IE (1989). Physiological Effect of Gamma Rays on Growth And 

Productivity Of Hyoscyamus muticus L. and Atropa belladonna L. 

Ph.D. Thesis, Fac. Agric. Cairo Univ., Cairo, Egypt. 65-73. 

Hai L, Diep TB, Nagasawa N, Yoshii F, Kume T (2003). Radiation 

depolymerization of chitosan to prepare oligomers. Nucl. Instrum. 

Methods Phys. Res. B, 208: 466–470. 

Hearn CJ (1985). Development of seedless grapefruit cultivars through 

budwood irradiation. Hortscience, 20: 84. 

Hearn CJ (2001). Development of seedless grapefruit cultivars through 

budwood irradiation. Hortscience, 20: 84. 

Hell KG, Silveira M (1974). Imbibition and germination of gamma 

irradiation Phaseolus vulgaris seeds. Field Crop Abst., 38(6): 300. 

IAEA (1992). Irradiation of spices, herbs and other vegetable 

seasonings. IAEA-TECDOC-639. 

IAEA (2007). Food Irradiation: A Powerful Nuclear Tool for Food Safety. 

Retrieved from: http://www.IAEA-food-irrad-tool0807S. 

ICGFI (International Consultative Group of Food Irradiation) (1999). 

Facts about food irradiation. Series of fact sheets (Vienna: ICGFI). 

Ikeda F (1976). Induced bud sports in Citrus sunski from Nucellar 

seedlings. In: Improvement of vegetatively propagated plants and 

tree crops through induced mutation, 95-96: 12. 

Katsaras J, Stinson RH, Kendal EJ, McKersie BD (1986). Structural 

simulation of free radical damage in amodelmembrane system: a 

smallangle X-ray diffraction study. Biochim. Biophys. Acta 861: 243– 

250. 

Kukimura HF (1976). Brief description of mutation in vegetatively 

propagated and tree crops. Gamma Field Symp., 15: 79-82. 

Kuzin AM, Vagabova ME Revin AF (1976). Molecular mechanisms of 

the stimulating action of ionizing radiation on seeds. 2. Activation of 

protein and high molecular RNA synthesis. Radiobiologiya, 16: 259- 

261. 

Kuzin AM, Vagabova ME, Prinak-Mirolyubov VN (1975). Molecular 

mechanisms of the stimulating effect of ionizing radiation on seed. 

Activation of RNA synthesis. Radiobiologiya., 15: 747-750. 

Kwon JH, Yoon HS, Byun MW, Cho HO (1988). Chemical changes in 

garlic bulbs resulting from ionizing energy treatment at sproutinhibition 

dose. J. Kor. Agric. Chem. Soc., 31: 147–153.

Lee S, Lee M, Song K (2005). Effect of gamma-irradiation on the 

physicochemical properties of gluten films. Food Chem., 92: 621– 

925. 

Maluszynski M (1995). Application of in vivo and in vitro mutation 

techniques for crop improvement. Euphytica, 85: 303–315. 

Marathe S, Machaiah J, Rao B, Pednekar M, Sudha Rao V (2002). 

Extension of shelf life of whole-wheat flour by gamma radiation. Int. J. 

Food Sci. Technol., 37: 163–168. 

Mashev N, Vassilev G, Ivanov K (1995). A study of N-allyl N-2 pyridyl 

thiourea and gamma radiation treatment on growth and quality of 

peas and wheat. Bulgerian J. Plant Physiol., 21(4): 56–63. 

Matloubi H, Aflaki F, Hadjiesadegan M (2004). Effect of gamma 

irradiation on amino acids content of baby food proteins. J. Food 

Compos. Anal., 17: 133–139. 

Micke A (1985). Plant cultivars derived from mutation induction or the 

use of induced mutants in crop breeding. Mutation Breeding Rev., 3: 

1-92. 

Navari-Izzo F, Vangioni N, Quartacci MF (1990). Lipids of soybean and 

sunflowers seedlings grown under drought conditions. 

Phytochemistry, 29: 2119–2123. 

Nisizawa M (1988). Radiation induced sol–gel transition of protein: 

effect of radiation on amino-acid composition and viscosity. J. Appl. 

Polym. Sci., 36: 979–981. 

Olsson M (1995). Alterations in lipid composition, lipid peroxidation and 

anti-oxidative protection during senescence in drought stressed 

plants and non-drought stressed plants of Pisum sativum. Plant 

Physiol. Biochem., 33: 547–553. 

Owczarczyk HB, Migdal W, Kedzia B (2000). The pharmacological 

activity of medical herbs after microbiological decontamination by 

irradiation. Radiat. Phys. Chem., 57: 331–335. 

Predieri S (2001). Mutation induction and tissue culture in improving 

fruits. Plant Cell. Tissue and Organ Culture 64: 185-210. 

Puchala M, Szweda-Lewandowska Z, Leyko W (1979). g-Irradiation of 

aqueous solutions of human hemoglobin in atmosphers of air and 

argon. Radiat. Res., 78: 379–389. 

Qiongying L, Yanhua K, Yuemei Z (1993). Studies on the method of 

identification of irradiated food. I. Seedling growth test. Radiat. Phys. 

Chem., 42: 387–389. 

Relleve L, Nagasawa N, Luan LQ Yagi T, Aranilla C, Abad L (2005). 

Degradation of carrageenan by radiation. Polymer Degradation and 

Stability, 87: 403–410. 

Rizk MA, Moussa TAA (2003). Impact of gamma irradiation stresses I. 

Response of gamma-irradiated sugarbeat seeds to infection by soilborne 

fungal pathogens Pak. J. Plant Pathol., 2: 28–38. 

Rombo GO, Taylor JRN, Minnaar A (2004). Irradiation of maize and 

bean flours: Effects on starch physicochemical properties. J. Sci. 

Food Agric., 84: 350–356. 

Ruminska A, Suchorska K, Weglarz Z (1978). Effect of gibberellic acid 

on seeds germination of some vegetable and medicinal plants. 

International Symposium on Spices and Medicinal plants, ISHS Acta 

Horticulturae 73: I . 

Sanada T, Amano E (1998). Induced mutation in fruit trees. In JAIN, 

Somaclonal variation and induced mutations in crop improvement. 

Kluwer Academic Publishers, England, pp. 401- 419. 

Selvan E, Thomas P (1999). A simple method to detect gammairradiated 

onions and shallots by root morphology. Radiat. Phys. 

Chem., 55: 423–427. 

Simic M (1983). Radiation chemistry of water-soluble food components. 

In: first ed. In: Josephon, E., Peterson, M. (Eds.), Preservation of Food 

by Ionizing Radiation, CRC Press, London, 2: 1–73. 

Sparow AH (1968). Radiosensitivity studies with woody plants. I. Acute 

gamma irradiation survival data for 28 species and predictions for 

190 species. Radiat. Bot., 8: 149-186. 

Spiegel-Roy P (1985). Seedless induced mutant in highly seeded lemon 

(Citrus limon). Mutation Breeding Newslett., 26: 1-2. 

Spiegel-Roy P, Padova R (1973). Radiosensitivity of Shamouti orange 

(Citrus sinensis) seeds and buds. Radiation Bot., 13: 105-110. 


Spielmeyer W, Hyles J, Joaquim P, Azanza F, Bonnett D, Ellis ME, 

Moore C, Richards RA (2007). A QTL on chromosome 6A in bread 

wheat (Triticum aestivum) is associated with longer coleoptiles, 

greater seedling vigour and final plant height. TAG Theoretical Appl. 

Gene., 115(1): 59–66. 

Toker C, Cagirgan MI (2004). Spectrum and frequency of induced 

mutations in chickpea. Int. Chickpea Pigeonpea Newslett. 11: 8–10. 

Urbain W (1986). Food Irradiation. Academic Press, Orlando, USA. 88- 

94. 

USEPA (United States Environmental Protection Agency) (2002). The 

history of food irradiation Bull. USEPA. 96-100. 

Venskutonis R, Poll L, Larsen M (1996). Effect of irradiation and storage 

on the composition of volatile compounds in Basil (Ocimum basilicum 

L.). Flavour Fragr. J., 11: 117–121. 

Villavicencio ALCH, Mancini-Filho J, Delinciee H (1998). Application of 

different techniques to identify the effects of irradiation on brazilian 

beans after six months storage. Radiat. Phys. Chem., 52: 161–166. 

Voisine R, V´ ezina LP, Willemont C (1991). Induction of senescencelike 

deterioration of micro small membranes from cauliflower by free 

radicals generated during gamma irradiation. Plant Physiol., 97: 545– 

550. 

Wang D, von Sonntage C (1991). Radiation industrial oxidation of 

phenylalanine. In: Leonardi, M., Raffi, J., Belliardo, J. (Eds.), 

Proceedings of the Workshop on Recent Advances on Detection of 

Irradiated Foods, BRC Information, Chemical Analysis Commission 

of the European Communities, Brussels, pp. 212–217 (Report EUR 

13331 En). 

WHO (World Health Organization) (1988). Food Irradiation: A 

Technique for Preserving and Improving the Safety of Food (WHO 

Publication in Collaboration with FAO). pp. 144-149. 

WHO (1994). Safety and Nutritional Adequacy of Irradiated Food. WHO, 

Geneva. WHO, 1999. High-dose Irradiation: Wholesomeness of Food 

Irradiated with Doses above 10 kGy. WHO, Geneva (WHO Technical 

Report Series no: 890). 120-124. 

Wu S (1986). Using Gamma-rays to induce mutations for seedlessness 

in Citrus. Mutat. Breeding Newslett., 27: 14. 

Yu YB, Jeong IY, Park HR, Oh H, Jung U, Jo SK (2004). Toxicological 

safety and stability of the components of an irradiated Korean 

medicinal herb, Paeoniae Radix. Radiat. Phys. Chem., 71: 115–119. 

Zabielski J, Kijowski J, Fiser W, Niewiarowicz A (1984). The effect of 

irradiation on technological properties and protein solubility of broiler 

chicken meat. J. Sci. Food Agric., 35: 662–670. 

Zenthen P, Sorensen L (2003). Food Preservation Technique. Wood 

head Publishing Limited, Cambridge. pp. 89-96. 

Zhu S, Kume T, Ishigaki I (1993). Detection of irradiated wheat by 

germination. Radiat. Phys. Chem., 42: 421–427. 

Kuzin AM, Vagabova ME, Prinak Mirolyubov VN (1975). Molecular 

mechanisms of the stimulating effect of ionizing radiation on seed. 

Activation of RNA synthesis. Radiobiologiya, 15: 747-750. 

Kuzin AM, Vagabova ME, Revin AF (1976). Molecular mechanisms of 

the stimulating action of ionizing radiation on seeds. 2. Activation of 

protein and high molecular RNA synthesis. Radiobiologiya, 16: 259- 

261. 

Gruner MM, Horvatic D, Kujundzic, Magdalenic B (1992). Effect of 

gamma irradiation on the lipid components of soy protein products. 

Nahrung, 36: 443-450. 

Shah SA, Ali I, Rahman K (2001). Abasin 95 a new oilseed rape cultivar 

developed through induced mutations. Mut. Breed. Newslett., 45: 3-4. 

Khatri A, Khan IA, Siddiqui MA, Raza S, Nizamani GS (2005). 

Evaluation of high yielding mutants of Brassica Juncea cv. S-9 

developed through Gamma rays and EMS. Pak. J. Bot., 37(2): 279- 

284.




DOI: 10.5897/AJMR10.104 

Full Length Research Paper 

In vitro antiviral activities of Jrani caprifig latex and its 

related terpenes 

Houda LAZREG AREF 1 *, Mahjoub AOUNI 2 , Jean Pierre CHAUMON 3 , Khaled SAID 1 and 

Abdelwaheb FEKIH 4 

1 Laboratoire de Génétique, Biodiversité et Valorisation des Bio ressources (UR 03ES09), 

Institut Supérieur de Biotechnologie, 5000 Monastir, Tunisie. 

2 Laboratoire des Maladies Transmissibles et Substances Biologiquement Actives, Faculté de Pharmacie 5000 Monastir, 

Tunisie. 

3 Laboratoire de Botanique et cryptogamie, Faculté de Pharmacie Besançon 25000 cedex, France. 

4 Laboratoire de Chimie, 03/UR/1202, Faculté de Médecine Dentaire, 5000 Monastir, Tunisie. 


The aim of this study was to search for new antiviral agents from Tunisian Jrani caprifig latex (Ficus 

carica L., Moraceae). Terpenes and coumarins were identified by gas chromatography–mass 

spectrometry (GC-MS) analysis in hexane and hexane ethyl-acetate (1:1, v/v) extracts, and used in 

experiments to test their influence on a series of viruses, namely Herpes simplex (HSV-1), Adenovirus 

(ADV) and Echovirus type 11 (ECV-11). To evaluate the capacity of the extracts inhibition of viruses 

replication cycles by preventing their adsorption and their penetrations in the cells (by interaction with 

the cellular receivers designed for these viruses) or by inhibition of their intracellular replication or by 

virus inhibition after a direct contact under microscopic observation of cytopathic effect (CPE). Extracts 

inhibited virus multiplication in tested techniques at the concentrations of 19.5 and 39 µg/ml, 

respectively. All extracts had no cytotoxic effect on Vero cells at all tested concentrations. In 

conclusion, some compounds of Jrani latex which possess antiviral activities may be due to the high 

level of Triterpens. Their mode of action against the tested viruses was found to be at all stages of 

multiplication, suggesting the potential use of this compound for treatment of the infection caused by 

these viruses. 

Key words: Ficus carica, caprifig, latex, HSV-1, HSV-2, ECV-11, ADV, coumarins, terpens. 

INTRODUCTION 

The use of herbs and medicinal plant as the first 

medicines is a universal phenomenon. Every culture on 

the earth, through written or oral tradition, has relied on 

the vast variety of natural chemistries found in plants for 

*Corresponding author. E-mail: ibrahimhoudarf@yahoo.fr. Tel: 

+216 97 654 133. Fax: 00216 73 568 900. 

Abbreviations: CPE, Cytopathic effect; PBS, phosphate 

buffered saline; MEM, minimum essential medium; FBS, fetal 

bovine serum; HSV-1, herpes simplex virus type 1; CPE, 

cytopathic effect. 

their therapeutic properties. All drugs from the plant are 

substances with a particular therapeutic action extracted 

from plants (Serrentino, 1991). The usage of herbal 

plants as traditional health remedies is the most popular 

for 80% of the world population in Asia, Latin America 

and Africa and is reported to have minimal side effect 

(Doughari, 2006). In this study Jrani caprifig variety which 

belongs to the genus Ficus carica L. (Moraceae) has 

been selected. Unlike common figs, the caprifig is a fig 

tree which produces both male and female flowers and is 

used to fertilize the female trees of the species. The 

name caprifig is derived from caprificus (or “goat fig” in 

Italian) (Storey et al., 1977) produces three crops of 

syconia. These are known by their Italian terms, profichi,

mammoni and mamme. The fig is a deciduous tree, 

which probably originated in Western Asia, and spread to 

the Mediterranean is commonly known as fig tree (Tous 

and Ferguson, 1996). Its products are widely used both 

as a food and in traditional medicine in the 

Mediterranean; the roots are used in treatment of 

leucoderma and ringworms and its fruits which are sweet, 

have antipyretic, purgative, aphrodisiac properties and 

have shown to be useful in inflammations and paralysis 

(Kirthikar and Basu, 1996). F. carica is claimed to be 

useful in liver and spleen disorders, to cure piles and in 

treatment of gout. The leaf decoction affected lipid 

catabolism in hyperglyceridemic rats (Perez et al., 1999). 

Several phytochemical investigations of F. carica leaves 

have been published, but with no biological data. 

Athnasios et al. (1962) have isolated prosalen, �sitosterol 

and Bergapten. Others have isolated 

triterpenoids (Abu-Mustafa et al., 1964). F. carica latex 

released on picking the fruits is used to treat skin tumors 

and warts (Ghazanfar, 1994). The first scientific investigation 

of the activity of fig latex was done by Ullman et al. 

(1945, 1952). The dialysate of the latex contained the 

active ingredient. Although, isolation of the active components 

was not pursued further, some pharmacological 

work was reported by Ullman (1952) and Ullman et al. 

(1952). Fig latex has also been tested for its anthelmitic 

activity (De-Amorin et al., 1999). 

In this modern age it is very important to provide 

scientific proof to justify the various medicinal uses of 

herbs. Herbal drugs are prescribed widely even when 

their biologically active components are unknown 

because of their effectiveness, fewer side effects and 

relatively low cost (Valiathan, 1998). However, we are not 

aware of a satisfactory remedy for serious viral diseases 

and search for effective and safe drugs. 

In this paper we describe the identification of a potent 

antiviral terpenes and coumarins from Tunisian caprifig 

latex, Jrani variety. 

MATERIALS AND METHODS 

Latex collection 

The Jrani caprifig latex was collected from unripe inedible fig fruit 

growing in Mesjed Aissa agricultural field located in the central cost 

of Tunisia. The latex was held in ice during the period of collection. 

The identification of this variety was established by Pr. Massoud 

MARS, professor of arboriculture at the high school of horticulture 

of Chott Meriam Sousse, Tunisia, Department of Agriculture, and 

Arboriculture, the code collection of the tree is JR1. This fig fruit 

was cat open from its top then slightly squeezed to collect few 

drops of latex directly into polyethylene centrifuge tubes, frozen 

immediately in Dry-Ice and maintained in frozen state at –30°C until 

the analyses were performed. 

Extracts preparation 

The gum, approximately 30% by weight in F. carica latex was 

Aref et al. 5813 

removed from the aqueous solution by centrifugation in a 

refrigerated centrifuge (Bakemann Avanti TM30) at 15 000 rpm for 

60 min at 0°C. The clear, straw-colored aqueous solution that was 

designated as a soluble material was frozen and stored at –30°C 

until required for analysis. 

100 g of defrosted F. carica latex were macerated, (on cold) in 

300 ml of methanol, over night, and repeated three times (Sarang 

et al., 2005), then evaporated under reduced pressure to afford (15 

g) of yellow brown solid extract product 1 (P1). 

The resulted residue was subjected to silica gel flash column 

chromatography eluted with hexane, hexane-ethyl acetate (1:1 v/v), 

and finally with ethyl acetate to obtain product 2 (P2), 3 (P3), and 4 

(P4) of 4.10 g, 2.10 g and 0.60 g, respectively. 

Furthermore, methanol was added to elute the polar compounds, 

which concentrated under reduced pressure, and then was redissolved 

in H2O, and re-extracted with chloroform to afford product 

5 (P5) of 3 g. All solvent were purchased from Merck, Germany. 

GC-MS analysis 

The analysis of Jrani caprifig latex hexane and ethyl-acetate (1/1, 

v/v) extracts was performed on a GC-MS HP model 1909S-433 

inert MSD (Agilent Technologies, J and W Scientific Products, Palo 

Alto, CA, USA), equipped with an Agilent Technologies capillary 

DB-5MS column (30 m in length; 0.25 mm i.d.; 0.25 mm film 

thickness), and coupled to a mass selective detector (MSD1909S- 

433, ionization voltage 70 eV; all Agilent, Santa Clara, CA). The 

carrier gas was He and was used at 1 ml/min flow rate. The oven 

temperature program was as follows: 2 min at 150°C ramped from 

150 to 240°C at 10°C/min and 1 min at 240°C then ramped from 

240 to 280°C at 5°C/min and 15 min at 280°C. The chromatograph 

was equipped with a split/splitless injector used in the split mode. 

The split ratio was 1:100. Bis-(trimethylsilyl)-acetamide (BSTFA) 

(100 ml) was added to 100 ml of extract. The control of the GC/MS 

system and the data peak processing were carried out by means of 

MSDCHEM software. Identification of components was assigned by 

matching their mass spectra with Wiley and NIST library data, 

standards of the main components. 

Cell and virus culture 

The cell line used was Cercopithecus aethiops African green 

monkey kidney cells (Vero cell line ATCC CCL-81). The cellular 

lines maintained in the laboratory of transmissible diseases and 

bioactive substance (Faculté de Pharmacie de Monastir). 

Briefly, the protocol used to obtain primary cell culture from the 

biopsy was as follows, each biopsy was washed three times with 

phosphate buffered saline (PBS) containing 200 units/ml of 

penicillin, 200 µg/ml of streptomycin and 0.5 µg/ml of amphotericin 

B. The skin was discarded the cartilage and the subcutaneous 

tissue were minced. Finely, the pieces of tissue were phased in 25 

cm 2 cell culture flasks with just enough growth medium, that is 

eagle minimum essential medium (MEM) with 2 mM L-glutamine, 

1% vitamins, 1% non essential amino acids, 100 units/ml of 

penicillin, 100 µg/ml of streptomycin, 0.25 µg/ml of amphotericin B, 

and 10% of fetal bovine serum (FBS) to cover the pieces of tissue 

when the fibroblasts had proliferated to 30 or 40% confluence, the 

pieces of tissue were discarded by gently shaking with PBS and 

again the cells were fed with 50% of used medium and 50% of 

fresh medium. When 80% confluence was reached, the cells were 

trypsinized and cultured in 150 cm 2 flasks. Once the cells had 

covered about 80% of the surface, they were trypsinized, 

centrifuged and cryopreserved. All cells were grown in MEM 

supplemented with 10% (FBS), 100 units/ml of penicillin, 100 µg/ml 

of streptomycin (4 ml), 2 mM L-glutamine (2 ml), 0.07% NaHCO3,


1% non essential amino acids and vitamin solution. The cultures 

were maintained at 37°C in humidified 5% CO2 atmosphere. 

Herpes Simplex (herpes Viridae family) virus Type 1 (HSV-1) 

was obtained from the Laboratoire des Maladies Transmissibles et 

Substances Biologiquement actives, Faculté de Pharmacie 5000 

Monastir Tunisia. Echovirus (ECV-11): Type 11 (Picornaviridae 

family) clinical strains. Adenovirus (ADV): non serotyped 

(Adenoviridae family) clinical stain. 

Titration of viral strains 

The virus strains were prepared from HSV-1 infected Vero cell 

cultures. The infected cultures were subjected to three cycles of 

freezing-thawing and centrifuged at 2000 rpm for 10 min. The 

supernatant was collected, titrated, and stored at – 80°C in 1 ml 

aliquots. Viral strain was carried out on 96-well flat-bottomed plate 

containing confluent cells into monolayer; decimal dilutions of the 

initial viral suspension were made then inoculated in to deprived 

cells from their growth medium. Each dilution was divided up in to a 

column of 8 wells at a density of 100 µl/well. The last column was 

reserved for control cells not infected by the virus and containing 

only the survival medium; then the plaque was incubated at 37°C in 

humidified 5% CO2 atmosphere and controlled every 24 h by taking 

note of each time the number of well showed a CPE, when the CPE 

ceased to progress (5 to 7 days). 

We evaluated the infectious title of the virus according to the 

method of Reed and Muench (1938) (Watanabe et al., 1994): the 

title of a virus is expressed by the TCID50 (infectious amount on 

cultured tissue), it shows the dilution of the viral suspension of 

which 50% of the cells degenerate. The exploitation of dilution DL50 

or TCID50 (in absolute value) corresponds to the dilution which is 

giving a degeneration immediately above 50%, increased product 

of the proportional distance X by the logarithm of dilution factor. The 

proportional distance X between two critical dilutions at which the 

TCID50 is located and obtained by spearman Kàber formula: X = (D 

> 50% - 50)/(D > 50% to D 50%). D > 50%: degeneration 

immediately grater than 50%. D < 50%: degeneration immediately 

lesser than 50% (Lorenz and Bögel, 1973). 

To titer the virus suspension, confluent monolayer Vero cells 

were grown in 96-well flat-bottomed plates, and were infected with 

0.1 ml of serial 12-fold dilutions of the virus suspension by 0.1 ml 

quadruplicated for a period of 48 h. The virus titer was 10 3.5 (the 

dilution of the virus required to TCID50/0.1ml lytic effect, 50% of the 

inoculated cultures). 

Solvent cytotoxicity assay 

The solutions of extracts were already prepared with 100 mg/ml, a 

serial dilutions (1, 1/10, 1/20, 1/40, 1/80, 1/160, 1/320, 1/640, 

1/1280, 1/2560 and 1/5120 mg/ml) were done in a medium, made 

up of RPMI 1640 supplemented with 1% L. glutamine, 2% of 

antibiotic and 10% (FBS) (serum of be worth fetal) (Chiang et al., 

2002). Cells monolayer were trypsinized, washed with culture 

medium and plated in 96-well flat-bottomed plate with 2. 10 4 cells 

per well. After 24 h of incubation, each diluted extract was added to 

the appropriate wells, some wells containing only cells with the 

medium of dilution [Cat 2% (FBS)] were taken as a cellular control 

and the plate were incubated for a further 48 h at 37°C in humidified 

incubator with 5% CO2. The supernatants were removed from the 

cells and cells viability during 5 days was evaluated by supervising 

the state of the cells until the appearance of cytopathic effect 

(CPE). That effect generally appears when cells become round and 

fall with repression of the cores in the cellular membranes, 

phenomenon observed during the cells bursting by a serial of 

freezing and defrosting. The results are obtained from triplicate 

assays with at least five extract concentrations. 

Antiviral activity assay 

Viral reproduction inhibitory, extract can act on the reproduction 

itself, or on the adsorption, or during the penetration of the virus in 

the cell. Three tests were carried out. 

Contact between the virus and the extract before inoculation with 

the cells. This test allowed us to know, if the extract is able to 

deteriorate the integrity of the virus and so to prevent it from 

carrying out its infectious process. Contact between cells and 

extract before virus attaching, and so, the extract has the possibility 

of acting on the cellular receivers and can therefore prevent the 

adsorption, thus the penetration of the virus in the cell. In both 

cases, extracts will prevent the adsorption and so the penetration of 

virus in the cell. 

Contact between cells and viral suspension then we add the 

extract. In this case, the virus has enough time to penetrate in the 

cell and to begin the replication process. The inhibition of viral 

multiplication after adding the extract was due to the blocking effect 

of the viral replication by the extract. These three tests were applied 

to the viruses and the two extracts (P2 and P3) of which their 

cytotoxicity has already being studied. 

Incubation of the extract with the viral suspension 

The various concentrations of the extract were contacted with the 

viral suspension from line 2 to 11 and from column B to G in 96-well 

flat-bottomed plate at a density of 10 TCID 50 /ml (v/v) equalized 

volumes (Grazìa et al., 2003). In line 1, non infected cells were held 

in their growth medium used as a negative control, line 12, columns 

A and H were reserved to infected cells as a positive control. The 

plate was incubated at 37°C for 1 h, and then inoculated on 

cultured Vero cells, presenting a confluent layer at a density of 200 

µl/well. The cells were again incubated at 37°C and observed for 5 

to 7 days until the appearance of a total CPE by the viral control 

(Ooi et al., 2004; Tshikalange et al., 2005). 

Incubation of the cells with the extract 

The incubation of the cells, which were separated from their growth 

medium were contacted with various concentrations of the extract 

at a density of 100 µl/well for 1 h at 37°C. Then, 100 µl of the viral 

suspension were added in each well of the plate which was again 

incubated at 37°C and observed for 5 to 7 days until the 

appearance of the viral CPE on the control as explained above 

(Beloin et al., 2005). 

Incubation of the cells with the viral suspension 

The cells were infected by the viral suspension at a density of 100 

µl/well incubated for 1 h at 37°C, then 100 µl/well of various extract 

concentrations were added, and incubated for 5 to 7 days until the 

appearance of total CPE on the viral control (Cos et al., 2002). 

These tests were performed in triplicate for the three viral strains, 

each test performed used as a negative control of none infected 

cells held in their growth medium, and as a positive control of the 

cells infected by the viruses at equal concentration used for all tests 

(Tshikalange et al., 2005; Beloin et al., 2005). The absence of the 

CPE at a concentration level of the extract when the viral control 

expresses a CPE indicates that the extract has an antiviral activity 

with a specific concentration (Meyer et al., 1996).

RESULTS 

GC-MS analysis 

The average percentage of individual compounds of 

caprifig latex (Jrani variety) hexanic and hexane ethyl 

acetate (v/v) extracts were presented in Tables 1 and 2, 

respectively. GC-MS analysis of extracts resulted in the 

identification of 36 and 17 compounds representing 96.12 

and 77.46%, respectively. Among the identified compounds, 

were sesquiterpens, triterpens, monoterpene 

(bornanone-3), coumarins and alcans, Furthermore, the 

most abundant compounds (> 8%) of extracts were 

lanosta-8 (13.17 and 30.82%), urs-12-en-24-oic acid 

(21.52 and 22.36%), aristolone (15.63 and 10.30%), 

olean-12-en-3-ol, (23.47, 3.66%), maragenin I acetate 

(8.78%) and A’-Neogammacer-22(29)-en-3-ol (22.06%). 

Extracts cytotoxicity assay 

The optical densities obtained after spectrophotometric 

measurement at 540 nm, were useful to determine the 

percentage of cellular viability. Only the concentrations 

having a little or no cytotoxic effect on the cells (cellular 

viability from 90 to 100%) were tested for antiviral activity. 

Effect of hexanic extract (P2) 

The observation of the cells state under a microscope 

after 48 h of contact with the extract and incubated at 

37°C did not show any CPE. We note that the percentage 

of cellular viability is higher than 90% at all concentrations 

of the extract. We can deduce that P2 does not 

have any cytotoxic effect on the cells. All tested 

concentrations were used thereafter for antiviral activity. 

Effects of ethyl acetate-hexane (v/v) extract (P3) 

We note that this extract does not have any cytotoxic 

effect on the Vero cells. Thus, all the concentrations were 

tested for antiviral activity. 

We could demonstrate for these tested extracts that all 

concentration range of the pure extract and the different 

dilutions were tolerable by the cells and gave a 

percentage of viability higher than 90%. From the 

cytotoxicity results of the tested extracts towards the Vero 

cells, we understand that a cellular fall, in the presence of 

an extract and of a virus was really due to the cytopathic 

effect CPE of the virus and not to the cytotoxic effect of 

the extract. 

Activity against HSV-1, ECV-11 and ADV 

The results of the three antiviral tests which were carried 

out against HSV-1, ECV-11 and ADV are presented in 

Table 3 and proved that P2 and P3 extracts had an 


antiviral activity by deteriorating the integrity of the virus 

and to prevent it, from carrying out its infectious course. 

These extracts acted on the cellular receivers and 

prevented the adsorption and the virus penetration in the 

cell and blocked the viral replication in the infected cell. It 

is noticed, that these positive tests which were obtained 

in all concentration range starting from the pure extracts 

to the highest dilution (1/5120). 

DISCUSSION 

Infectious diseases are leading cause of death world 

wide due to multidrug resistant strains of viruses. Many 

medicinal plants remain unexplored; screening of antiviral 

resistance modifying compounds from plants sources are 

expected to provide the basis for identifying leads for the 

isolation of therapeutically useful compounds. This study 

will definitely open scope for future utilization of the waste 

products for therapeutic purpose. 

The contact type of the first antiviral activity test 

showed the competition between extracts and viruses on 

the cellular receivers. If an extract is able to stick to the 

cellular receivers, it can prevent the adsorption and thus 

the penetration of the virus on the cells. In this case, the 

viral CPE will be absent and the antiviral activity of the 

extract in question will be proved. Among the studied 

latex extracts P2 and P3 proved to be active against 

three viral strains (HSV-1, ECV-11 and ADV). The 

sensitivity of HSV-1 against natural substances was also 

showed by Beloin et al. (2005) by testing various extracts 

of Momordica charantia (Cucurbitaceae). 

In the second test the virus had sufficient time to be 

adsorbed and penetrated in the cell. Thus, the absence 

of the viral CPE proved that the extract acted to prevent 

viral replication progress within the cell therefore, proving 

the antiviral activity of this extract. Both extracts P2 and 

P3 expressed an antiviral activity against these three 

tested strains. Thereafter, these extracts were able to 

inhibit simultaneously, the DNA viruses HSV-1 and ADV 

and ARN viruses ECV-11 replication. Cos et al. (2002) 

studied the antiviral activity of Colenrs kilimandschari and 

Leonotis neptaeflia extracts witch belongs to Lamiacées 

family. Only C. kilimandschari leaves extract showed an 

anti-HSV-1 capacity. The type contact of the third test 

showed no viral CPE, means that viruses were already 

inhibited, and showed the antiviral activity. 

These tests demonstrate that, ECV-11, HSV-1 and 

ADV were sensitive to both extracts. Grazia et al. (2003) 

studied the antiviral activity of essential oils from eight 

(Lamiaceae) plants of which Hyptes mutabilis did not 

detect any anti-HSV-1 activity. Therefore the studied 

extracts P2 and P3, were able to stop the replication 

cycles of HSV-1, ECV-11 and ADV by preventing their 

adsorption and their penetrations in the cells (by 

interaction with the cellular receivers designed for these 

viruses), or by inhibition of their intracellular replication, or 

by virus inhibition after a direct contact. These results


Table 1. Chemical composition of hexane extract obtained by GC/MS. 

Retention time 

(min) 

Area 

(%) 

Constituent 

Wiley library 

Reference No 

CAS No Quality 

4.70 0.06 GERMACRENE-D 121792 023986-74-5 98 

5.04 0.01 Delta-Cadinene 121465 000483-76-1 97 

7.03 0.33 2, 6, 10-Dodecatrien-1-ol 148283 004602-84-0 83 

8.88 0.05 Dodecan-2-on 93122 006175-49-1 72 

9.09 0.38 Hexadecanoic acid 213894 000112-39-0 98 

10.73 0.33 CIS-LINOLEIC ACID METHYL ESTER 243137 000112-63-0 99 

11.69 0.08 Pentadecane 134011 000629-62-9 96 

11.88 0.04 1, E-8, z-10-Hexadecatriene 145418 080625-33-8 87 

12.76 0.03 Tricosane 275685 000638-67-5 96 

13.90 0.13 Triacontane 34922 000638-68-6 91 

14.51 0.02 8-dimethoxynaphthalene 120716 105372-17-6 90 

15.76 0.51 Bis (2-ethylhexyl) phthalate 326908 000117-81-7 91 

16.30 0.05 Hexacosane 311168 000630-01-3 94 

16.72 0.06 7-Pentadecyne 128099 022089-89-0 64 

17.55 0.13 Heptacosane 32679 000593-49-7 95 

18.79 0.10 Octacosane 329269 000630-02-4 96 

19.23 0.33 Squalene 337959 007683-64-9 93 

20.05 0.13 Nanocosane 337002 000630-03-5 97 

20.61 0.37 Oxirane 345735 007200-26-2 89 

21.73 0.29 1-ethyl-3-acetyl-5 182541 112482-88-9 86 

22.51 0.72 4-methoxycarbonyl-2, 6-diphenylpyridine 237065 069209-39-8 74 

22.98 1.04 Bornanone-3 49880 013854-85-8 70 

23.38 0.19 1-ethyl-3-acetyl-5 182541 112482-88-9 78 

23.54 0.15 1, 6, 10, 14, 18, 22-Tetracosahexaen-3-ol 345737 054159-46-5 64 

23.67 1.02 [3.2] metacyclophane-10-ene 145464 121733-15-1 91 

24.79 0.77 5-HYDROXY-6 236998 063955-63-5 78 

27.96 0.98 9, 19-Cyclolanost-24-en-3-ol 345634 000469-38-5 93 

28.96 0.94 Beta.-Amyrin 345611 000559-70-6 83 

29.47 13.17 Lanosta-8 360770 002671-68-3 96 

30.20 0.24 6-Aza-B-homo-5.alpha.-cholestane 345497 066233-39-4 92 

30.25 0.37 Lupeol 345599 000545-47-1 87 

32.33 21.52 Urs-12-en-24-oic acid 360707 020475-86-9 91 

32.75 15.63 Aristolone 141923 006831-17-0 86 

32.95 23.47 Olean-12-en-3-ol 360750 001616-93-9 93 

33.38 8.78 Maragenin I acetate 360711 071545-16-9 89 

33.62 2.32 alpha.-amyrenyl acetate 360746 000863-76-3 64 

Table 2. Chemical composition of ethyl acetate extract obtained by GC/MS. 

Retention time 

(min) 

Area 

(%) 

Constituent 

Wiley library 

Reference No 

CAS No Quality 

8.424 0.10 (+)-Aromadendrene 121608 000489-39-4 96 

8.767 0.19 delta.-Cadinene 121454 000483-76-1 99 

9.174 1.08 1H-Cycloprop[e]azulen-7-ol 145016 006750-60-3 95 

10.398 0.72 Tetradecanal 133817 000124-25-4 81 

10.867 0.30 Hexadecanoic acid 213911 000112-39-0 93 

11.297 1.24 1H-Naphtho[2,1-b]pyran 238701 001227-93-6 94 

11.531 1.06 Heptadecene-(8)-carbonic acid-(1) 228686 000000-00-0 90

Table 2. Contd. 


19.616 30.75 Lanosta-8 360770 002671-68-3 95 

19.879 1.17 Silicone grease 392047 000000-00-0 58 

20.331 10.30 Olean-12-en-3-ol 360750 001616-93-9 93 

21.024 19.80 alpha.-Amyrenyl acetate 360746 000863-76-3 76 

22.597 10.82 A'-Neogammacer-22(29)-en-3-ol 360754 002085-25-8 86 

Total area: 77.5%. 

Table 3. Antiviral activity of Ficus carica extracts. 

Extracts 

Antiviral activity (%) 

P2 P3 

Extracts last dilution 1/5120 1/2560 

HSV 100 100 

(E+V) + C ECV 100 100 

ADV 100 100 

(C+E) + V 

(C+V) + E 

HSV 100 100 

ECV 100 100 

ADV 100 100 

HSV 100 100 

ECV 100 100 

ADV 100 100 

P2: hexanic extract; P3: (v/v) ethyl acetate-hexane extract; (E+V) + C: extract effect against 

virus; (C+E) + V: extract effect against Vero cells; (C+V) + E: extract effect against viral cycle 

after adsorption. 

confirmed the evidence that, P2 and P3 extracts had an 

interesting antiviral activity. 

ACKNOWLEDGEMENTS 

The authors are grateful to Pr. BEN OUADA Hafed 

Directeur de l’Institut Supérieur des Sciences Appliquées 

et de Technologie de MAHDIA. 

REFERENCES 

Abu-Mustafa E A, El Tawil BAH, Fayez MBE (1964). Constituents of 

local plants IV. Phytochemistry., 3: 701-703. 

Athnasios AK, El Kholy, Soliman G, Shaban MAM (1962). Constituents 

of the leaves of Ficus carica L. part I. Isolation of psoralen, 

Bergapten,i-taraxastorol and -sitosterof. Int. J. Chem. Soc., 62: 

4253-4254. 

Beloin N, Gbassor M, Akpagana K, Hudson J, de Soussa K, Koumagolo 

K, Arnason JT (2005). Ethnomedicinal uses of Momordica charantia 

(Cucurbitaceae) in Togo and relation to its phytochemistry and 

biological activity. J. Ethnopharmacol., 96: 49-55. 

Chiang LC, Chiang W, Chang MY, Ng LT, Lin CC (2002). Antiviral 

activity of Plantago major extracts and related compounds in vitro. 

Antiviral Res., 55: 53-62. 

Cos P, Hermans N, De Bruyne T, Apers S, Sindambiwe JB, Vanden 

Berghe D, Pieters L, Vlietinck AJ (2002). Further evaluation of 

Rwandan medicinal plant extracts for their antimicrobial and antiviral 

activities. J. Ethnophamacol., 79: 155-163. 

De-Amorin A, Borba HR, Carauta J P, Lopes D, Kaplan MA (1999). 

Anthelmintic activity of the latex of Ficus species. J. 

Ethnopharmacol., 64: 255-258. 

Doughari JH (2006). Antibacterial activity of Tamarindus indica Linn. 

Trop. J. Pharm. Res., 5: 597-603. 

Ghazanfar S (1994). A. Handbook of Arabian Medicinal Plants; CRC 

Press: Boca Raton., pp. 148. 

Grazìa CC, Talarico L, Almeida N, Colombres S, Duschatzky C, 

Damonte EB (2003). Virucidal activity of essential oils from aromatic 

plants of San Luis, Argentina. Phytother. Res., 17: 1073-1075. 

Kirthikar KR, Basu BD (1996). Indian medicinal plants. Vol. 3, 2nd ed, 

India: International Book Distributors, pp. 2329-2331. 

Lorenz RJ, Bögel K (1973). Laboratory techniques in rabies. In Kaplan 

MM, Koprowski H (eds), Laboratory Techniques and Virology, World 

health Organization, Genova, pp. 321. 

Meyer JJM, Afoloyan AJ, Taylor MB, Enelbrecht L (1996). Inhibition of 

herpes simplex virus type 1 by aqueous extracts from shoots of 

Helichrysum aureonitens (Asteracae). J. Ethnophamacol., 52: 41-43. 

Ooi LSM, Wang H, Luk C-W, Ooi VEC (2004 ). Anticancer and antiviral 

activities of Youngia japonica (L.) DC (Asteraceae, Compositae). J. 

Ethnopharmacol., 94: 117-122. 

Perez C, Canal JR, Campillo JE (1999). Hypotriglyceridaemic of Ficus 

carica leaves in experimental hypertriglyceridaemic rats. Phytother. 

Res., 13: 188-191. 

Sarang B, Anpurna K, Beenish K, Sheikh FA, Suri KA, Satti NK,


Musarat A, Qazi, GN (2005). Immunosuppressive properties of an ethyl 

acetate fraction from Euphorbia royleana. J. Ethnopharmacol., 99: 

185-192. 

Serrentino J (1991). How Natural Remedies Work. Harley and Marks 

Publishers, Point Robert, WA. pp. 20-22. 

Storey WB, Enderund JE, Saleeb WS, Nauer EM (1977). The Fig (Ficus 

carica Linnaeus). Its Biology, History, Culture and Utilisation. Jurupa 

Mountains Cultural Centre, California USA. 

Tous J, Ferguson L (1996). Mediterranean fruits. In J. Janick (Ed.), 

Progress in new crops. Arlington, VA: ASHS Press. pp. 416–430. 

Tshikalange TE, Meyer JJM, Hussein AA (2005). Antimicrobial activity, 

toxicity and the isolation of a bioactive compound from plants used to 

treat sexually transmitted diseases. J. Ethnopharmacol., 69: 515-519. 

Ullman SB (1952). The inhibitory and necrosis- inducing effects of the 

latex of Ficus carica L. on transplanted and spontaneous tumours. 

Exp. Med. Surg., 10: 26-49. 

Ullman SB, Clark GM, Roan KM (1952). The effects of the fraction R3 of 

the latex of Ficus carica L. on the tissues of mice bearing 

spontaneous mammary tumors. Exp. Med. Surg., 10:287-305. 

Ullman SB, Halberstaedter L, Leibowitz J (1945). Some 

Pharmacological and Biological Effects of the Latex of Ficus carica L. 

Exp. Med. Surg., 3: 11-23. 

Valiathan MS (1998). Healing plants. Curr. Sci., 75: 1122-1127. 

Watanabe W, Konno K, Ijichi K, Inonue H, Yokota T, Shigeta S (1994). 

MTT colorimetric system for the screening of anti-orthomyxo- and 

anti-paramyxoviral agents. J. Virol. Methods., 48: 257-265.

African Journal of Microbiology Research Vol. 5(32) pp. 5819-5825, 30 December, 2011 


ISSN 1996-0808 © 2011 Academic Journals 

DOI: 10.5897/AJMR10.684 


Role of the quorum-sensing system in biofilm formation 

and virulence of Aeromonas hydrophila 

Weihua Chu 1* , Yan Jiang 2 , Liu Yongwang 3 and Wei Zhu 1 

1 Department of microbiology, School of Life Science and Technology, China Pharmaceutical University, 

Nanjing, P. R. China, 210009. 

2 Jiangsu Entry-Exit Inspection and Quarantine Buearu, Nanjing P. R. China, 210001. 

3 College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, P. R. China, 210095. 

Accepted 28 March, 2011 

Aeromonas hydrophila is a pathogen that causes disease in a wide range of homeothermic and 

poikilothermic hosts due to its multifactorial virulence. The production of many of these virulence 

determinants is associated with high cell density, a phenomenon that might be regulated by quorum 

sensing. The quorum sensing system regulates the expression of several virulence factors in a wide 

variety of pathogenic bacteria. To investigate the pathogenic role of quorum sensing system in A. 

hydrophila, We constructed an ahyI mutant strain of a fish-clinical isolate YJ-1, named YJ-1∆AhyI. 

Compared with the wild-type strain, the ahyI mutant strain exhibited a significant decrease of total 

extracellular virulent activity, and decreased in biofilm formation, intraperitoneal LD50 of YJ-1∆AhyI were 

more than 10 9 CFU, about 10 4 times higher than the parent strain. These results suggest that A. 

hydrophila is able to regulate its extracellular virulent factors and biofilm formation by quorum sensing 

systems, and indicate that disruption of quorum sensing could be a good alternative strategy to combat 

infections caused by A. hydrophila. 

Key words: Aeromonas hydrophila, quorum sensing, biofilm, virulence factors. 

INTRODUCTION 

Aeromonas hydrophila is a ubiquitous Gram-negative 

bacterium of aquatic environments, which has been 

implicated as a causative agent of motile aeromonad 

septicemia in a variety of aquatic animals especially 

freshwater fish species (Hänninen et al., 1997). It causes 

gastrointestinal and extraintestinal infections in humans, 

including septicemia, wound infections, gastroenteritis 

and peritonitis (Daskalov, 2006). A number of virulence 

factors have been identified in A. hydrophila, such as, 

adhesins (e.g. pili), S-layers, exotoxins such as 

hemolysins and enterotoxin, and a repertoire of 

exoenzymes which digest cellular components such as 

proteases, amylases, and lipases 

(Cahill, 1990; 

Pemberton, 1997). 

Quorum sensing (QS) (Fuqua et al., 1994) is a mecha- 

*Corresponding author. E-mail: 

chuweihua2002@yahoo.com.cn. 

nism for controlling gene expression in response to an 

expanding bacterial population. In many Gram-negative 

bacteria, the diffusible quorum sensing signal molecule is 

a member of the N-acylhomoserine lactone (AHL) family 

(Fuqua et al., 1994; March and Bentley, 2004). Several 

virulence-associated phenotypes in pathogens have been 

shown to be controlled by their quorum sensing systems 

(Winzer and Williams, 2001). These phenotypes include 

biofilm formation (Croxatto et al., 2002), the production of 

virulence factors such as proteases (Swift et al., 1997, 

1999; Croxatto et al., 2002), haemolysin (Kim et al., 

2003), a type III secretion system (Henke and Bassler, 

2004), extracellular toxin (Manefield et al., 2000) and a 

siderophore (Lilley and Bassler, 2000). A. hydrophila has 

been found to have homologues of the Vibrio fischeri 

quorum sensing genes luxI and luxR, designated ahyI 

and ahyR (Swift et al., 1997). In this study, we explored 

the role of the ahyRI dependent QS system of A. 

hydrophila by construction an analysis of the ahyI mutant. 

We evaluated whether deletion of the ahyI


Table 1. Characteristics of bacterial strains and plasmids used in this study. 

Strains or plasmid Relevant characteristic(s) Source or reference 

A. hydrophila 

YJ-1 Virulent Chu, 2001 

YJ-1∆ahyI ahyI mutant strain of YJ-1 This study 

YJ-1∆ahyIRC Complement strain of YJ-1∆ahyI This study 

E. coli 

DH5α recA gyrA Laboratory stock 

CC118 

λpir lysogen of CC118 (∆(ara-leu) araD ∆lacX74 galE galK phoA20 thi-1 

rpsE rpoB argE(Am) recA1) 

Dennis et al., 1998 

S17-1 Smr Spr hdsR RP4-2 kan : : Tn7 tet : : Mu, integrated in the chromosome Simon et al., 1983 

C. violaceum 

CV026 

double mini-Tn5 mutant derived from C. violaceum ATCC31532, Hg r 

cviI::Tn5 xylE Km r , plus spontaneous Sm r 

McClean et al., 1997 

Plasmids 

pGEMT-Easy Cloning vector, Amp r resistant Promega 

pFS100 Km r , Pgp704 suicide vector Rubires et al., 1997 

pahyI - pFS100 harboring with an internal fragment of ahyI gene This study 

pGEMT-ahyIR harboring a 1972bp DNA fragment containing the ahyIR gene This study 

gene affected biofilm formation, motility, extracellular 

virulence and the pathogenicity in a fish model of 

infection. 


Bacterial strains, media and growth conditions 

The bacteria and plasmids used are listed in Table 1. Escherichia 

coli DH5α, plasmid-containing E. coli strains, A. hydrophila and its 

derivative strains were grown in LB medium, E. coli strains were 

grown at 37°C, while A. hydrophila strains were routinely grown at 

28°C, Chromobacterium violaceum CV026 was kindly provided by 

Dr. McLean (Texas State University) and was grown in LB medium 

at 30°C. Media were solidified with 1.5% (wt/vol) agar as needed. 

Antibiotics were added as required at the following final 

concentrations: ampicillin, 100 μg ml −1 ; kanamycin, 50 μg ml −1 . 

DNA manipulation 

Genomic DNA of A. hydrophila YJ-1 was prepared as previously 

described (Sambrook et al., 1989). Plasmid DNA from E. coli was 

extracted using a plasmid purification kit (Shanghai Shenggong Co. 

Shanghai) according to the manufacturer’s instructions. Taq DNA 

polymerase and restriction enzymes were obtained from Takara 

(Takara Bio. Inc., Dalian, China); and incubation conditions were as 

recommended by the suppliers. 

Construction of A. hydrophila ahyI mutant 

To obtain single defined insertion mutant in gene ahyI, we used a 

method based on the suicide pFS100 (Rubires et al., 1997). Briefle, 

an internal fragment of the selected gene was amplified by 

polymerase chain reaction (PCR) using A. hydrophila YJ-1 

chromosome, ligated into pGEM-Teasy (Promega). 

Oligonucleotides ahyI-F (5′ -CACGGGCAAAACGTTCATC-3’) and 

ahyI-R (5′ -ACGAGCTTTATCGCTTCCG-3’) were used to amplify 

the internal fragment of ahyI gene from A. hydrophila YJ-1 by PCR. 

The PCR product was ligated to pGEM-T vector (Promega) and 

transformed into E. coli DH5α. The internal fragment was recovered 

by EcoRl restriction digestion, and finally ligated into EcoRl 

digested suicide plasmid pFS100 plasmid vector. The ligation 

product was transformed into E. coli CC118 (λpir) and selected for 

kanamycin resistance. The recombinant plasmid was isolated and 

transformed into the A. hydrophila YJ-1 strain to obtain the ahyI 

insertion mutant. The insertion of plasmid on the chromosomes of 

the mutant was confirmed by PCR with appropriate primers. 

Complementation of the A. hydrophila YJ-1 ahyI mutant 

To complement the ahyI mutant strain of A. hydrophila, a 1972 bp 

fragment containing ahyRI open-reading frame (ORF), including its 

promoter, was amplified from A. hydrophila genomic DNA by using 

two primers ahyIR-F/SalI 5’- 

GGGGTCGACAGCAGCTTGTAATCCAACGC-3’ and ahyIR- 

R/EcolRI 5’-GGGGAATTCATGAACCGTCCAGCAGAGTGA-3’. The 

amplified product was ligated into pGMT-Easy vector creating 

pGEMT-ahyIR. pGEMT-ahyIR was then introduced into the YJ- 

1∆AhyI strain by electroporation. Clones exhibiting resistance to 

ampicillin (100 μg ml −1 ) were chosen for further study. The presence 

of luxS on pGEMT-ahyI was confirmed by sequencing. To exclude 

the possible influence from the vector, the empty vector was 

electroporated into A. hydrophila YJ-1∆AhyI as a control strain. 

AHL bioassays 

Chromobacterium violaceum CV026 was used as a biosensor to 

detect AHL. The AHL detection was applied by cross-streaking test

strains against C. violaceum CV026 on nutrient agar plate, in which 

the purple pigment violacein can be restored in response to the 

presence of AHL molecules. Briefly, strain CV026 was streaked at 

the center of the nutrient agar plate, the target bacteria were 

streaked on the same plate against CV026 line, if the target 

bacteria have AHL-producing ability, diffusible AHL produced by the 

target bacteria induces strain CV026 to produce a purple pigment 

(McClean et al., 1997). C. violaceum CV026 (a mini-Tn5 mutant) 

was used as an indicator strain for the detection of C4 and C6- 

HSLs. 

Motility assay 

LB medium containing 0.3% (wt/vol) agar was used to characterize 

the motility phenotype of wild type (wt) A. hydrophila YJ-1 and its 

ahyI mutant strain. The plates were then wrapped with Saran Wrap 

to prevent dehydration and incubated at 30°C for 12 to 14 h, and 

the motility was assessed by examining migration of bacteria 

through the agar from the center towards the periphery of the plate. 

Detection of extracellular virulence factors 

Some extracellular virulence factors activities were detected by 

patching bacteria on LB agar plates supplemented with different 

substrates (Swift et al., 1999). All strains were tested in duplicate, 

and when results were different, a third experiment was carried out 

to resolve the discrepancies. 

Hemolytic activity was tested on agar base (Oxoid) 

supplemented with 5% sheep erythrocytes. The culture was 

streaked onto the plates and incubated at 27℃ for 24 to 36 h, The 

presence of a clear colourless zone surrounding the colonies 

indicated β-hemolytic activity. Protease production and proteolytic 

activity was detected on 1.2% agar plates supplemented with 10% 

(v/v) sterile skimmed milk (105℃ for 30 min). The cultures were 

streaked on the skim milk agar plates and incubated at 27°C for 24 

to 36 h. Proteolytic strains caused a clearing zone around the 

colonies. Lipase activity was assayed on 0.5% tributyrin 

(Panreac,Barcelona, Spain) agar emulsified with 0.2% Triton X-100 

and incubated at 27°C for 24 to 36 h. The presence of a transparent 

zone around the colonies indicated lipase activity. Extracellular 

nucleases (DNases) were determined on Dnase agar plates (Difco) 

with 0.005% methyl green. The culture was streaked onto the plates 

and incubated at 27°C for 24 to 36 h, a pink halo around the 

colonies indicated nuclease activity. 

SDS-PAGE analysis of extracellular proteins 

To prepare extracellular proteins, A. hydrophila YJ-1 and YJ-1∆luxS 

were grown for 15 h and inoculated into 8 ml of fresh LB (1% 

inoculum). After incubation for 24 h, the cells were removed by 

centrifugation at 12,000 x g for 5 min and 4 ml of the separated 

culture supernatant was combined with 800 μl of 10% 

trichloroacetic acid. After 10 min at room temperature, the mixture 

was centrifuged and residues were solubilized in sample buffer 

composed of 62.5 mM Tris hydrochloride (pH 6.8), 10% glycerol, 

5% 2-mercaptoethanol, and 2% SDS. The protein samples were 

analyzed by SDS-PAGE using 8% gel and stained with Coomassie 

Brilliant Blue G-250. 

Morphological changes in epithelioma papillosum cyprini 

(EPC) cells induced by A. hydrophila 

Cytotoxicity of A. hydrophila strains was assayed with EPC cells. 

Chu et al. 5821 

The EPC cells were grown as a monolayer at 25°C in Eagle’s 

minimum essential medium (MEM; Sigma) supplemented with 10% 

fetal calf serum in a 5% CO2 atmosphere incubator, and harvested 

with trypsin ethylenediaminetetraacetic acid. A 900 μl aliquot of the 

cell suspension was inoculated to each well in a 24 well culture 

plate. After incubation for 24 h, EPC monolayers were infected with 

A. hydrophila cells (wt and QS mutant) suspended in phosphatebuffered 

saline (PBS) at a multiplicity of infection (MOI) (number of 

bacteria per cultured cell) of 1 and incubated for 30 min, after 

infection, the EPC cells were washed three times with PBS. The cell 

morphology were examined using an Axiover 25CFL phase-contrast 

inverted microscope (Carl-Zeiss) at 200 magnifications. 

Animal experiments 

50±3 g (mean ±SD) Carassius auratus gibelio were obtained from a 

aquaculture farm in Nanjing, Jiangsu Province, P. R. China. The C. 

auratus gibelio were kept in 100 L tanks supplied with aerated fresh 

water and fed with commercial pelleted diet twice a day. The water 

temperature was kept at (25±1)°C. Before manipulation, the fish 

were anesthetized with 1:15,000 tricaine methane sulfonate MS- 

222 (Sigma) in water. For 50% lethal dose (LD50) determinations, 

six groups of 10 fish were intraperitoneally (i.p.) injected with 0.1 ml 

of washed culture of A. hydrophila YJ-1 and of A. hydrophila ahyI 

mutant, emulsified in sterile phosphate-buffered saline containing 

10 3 to 10 9 CFU. The fish were observed for 7 days, and any dead 

specimen was removed for routine bacteriological examination. The 

experiment was carried out three times in duplicate, and the LD50 

was calculated by the statistical approach of Reed and Muench 

(1938). 

Biofilm assay 

A quantitative biofilm formation experiment was performed in a 

microtiter plate as described previously (O'Toole and Kolter, 1998), 

with minor modification. Briefly, bacteria were grown on LB agar, 

and several colonies were gently re-suspended in LB (with or 

without the appropriate antibiotic); 100 μl aliquots were placed in a 

microtiter plate (polystyrene) and incubated 48 h at 28°C without 

shaking. After the bacterial cultures were poured out, the plate was 

washed extensively with water, fixed with 2.5% glutaraldehyde, 

washed once with water, and stained with a 0.4% crystal violet 

solution. After solubilization of the crystal violet with ethanolacetone 

(80:20, vol/vol) the absorbance at 570 nm was determined 

using a microplate reader (Bio-Rad, Hercules, Calif.). 

Statistical analysis 

For animal studies, statistical analyses were performed using 

Fisher’s exact test. For all other studies, Student’s t test was used. 

RESULTS 

Characterization of ahyI mutant strain of A. 

hydrophila YJ-1 

An ahyI mutant strain YJ-1∆AhyI was constructed with a 

deletion of 147 bp of ahyI (GenBank accession 

no.X89469). The successful mutant of the ahyI gene was 

confirmed by PCR and DNA sequencing (data not 

shown). The CV026 bioassay revealed that the YJ-


Fig 1 

94,400 

66,200 

43, 00 0 

31,000 

20,100 

14,400 

Figure 1. SDS–PAGE analysis of extracellular proteins of A. 

hydrophila strains. Lane 1, YJ-1∆AhyI; lane 2, YJ-1, lane 3 

Molecular weight markers. 

1∆AhyI does not produce AHL signal molecules (data not 

shown). The motility of YJ-1∆AhyI was significantly less 

compared to that of the WT or the complemented strain. 

These results suggested that the quorum sensing system 

played an important role in A. hydrophila motility. The 

deletion of the ahyI gene did not alter bacterial growth 

kinetics over a tested period of 24 h. The analysis of 

extracellular enzyme activities revealed that the ahyI 

mutant could not produce the detectable extracellular 

proteases, haemolysin, amylase and Dnase, while A. 

hydrohila YJ-1 had a high level of extracellular enzyme 

activities. The extracellular protein profiles of YJ-1 and 

YJ-1∆AhyI were surveyed by SDS–PAGE analysis 

(Figure 1). Compared with the case of YJ-1, many protein 

bands were decreased clearly in YJ-1∆AhyI. 

Morphological changes of EPC cells induced by A. 

hydrophila ECP 

The cytotoxicity of A. hydrophila strains against A. 

hydrophila were EPC cells was further assessed, upon 

incubated with YJ-1, the ECP cells underwent a series of 

morphological changes. An monolayer EPC cells 

incubated with YJ-1∆AhyI appeared as a smooth sheet 

with the cells adhere tightly to the neighbors, while 

incubated with YJ-1, the cells first became slightly 

detached from one another, the smooth appearance was 

lost and then large holes separated cells, and last the 

cells became rounded and the spindle connections were 

lost (Figure 2). 

Role of quroum sensing in biofilm formation of A. 

hydrophila 

Biofilm formation of A. hydrophila wild-type and ahyI 

mutant strain, YJ-1∆AhyI was monitored in microtiter 

plates. As shown in Figure 3, biofilm formation of YJ- 

1∆AhyI was significantly decreased, compared with that 

of wild-type strain YJ-1, while the complemented strain of 

YJ-1∆AhyI, YJ-1∆AhyIC can form biofilm. Thus, quorum 

sensing has a distinct influence on biofilm formation in A. 

hydrophila. 

Fish infection 

To ascertain the role of quorum sensing system in the 

pathogenesis of A. hydrophila, the LD50 was determined 

for A. hydrophila YJ-1 and YJ-1∆AhyI by intraperitoneal 

challenge of C. auratus gibelio. As showed in Table 2, the 

LD50 values were more than 1.0 x 10 9 CFU bacteria for 

YJ-1∆AhyI and 6 x 10 5 CFU bacteria for wild-type 

respectively. Fish injected with the parental strain died 

more rapidly than those injected with YJ-1∆AhyI. All 

recorded deaths occurred within 4 days when the fish 

were injected with the wild type; however, deaths were 

recorded up to 6 days following injection when the fish 

were injected with YJ-1∆AhyI. The ahyI mutation led to a 

significant decrease in strain virulence, indicating that 

quorum sensing system has a role in the pathogenic 

mechanism of A. hydrophila. 

Examination of mortality showed typical clinical signs of 

hemorrhagic septicemia, mainly external lesions 

(abdominal distension at the injection site) and internal 

hemorrhages. To confirm stability of the insertional 

inactivated ahyI mutant gene, bacteria were isolated from 

dead fish inoculated with YJ-1∆AhyI, all conferring a Kan 

phenotype. 

DISCUSSION 

In animal and plant pathogens, such as Agrobacterium 

tumefaciens, Erwinia chrysanthemi, Pseudomonas 

aeruginosa, and Vibrio anguillarum, AHL systems control 

the expression of a number of exported products that are 

proven or putative virulence factors. For example, 

quorum sensing through AHLs has been shown to be 

involved in biofilm formation (Kjelleberg and Molinm, 

2002), competitive or cooperative bacterial interactions 

(Keller and Surette 2006) and virulence factors secretion. 

As described earlier, A. hydrophila produces a wide 

range of virulence factors. These virulence factors are 

expressed differently, depending on environmental and 

metabolic aspects of its current habitat. The regulation of 

many of these virulence factors is based on cell densitydependent 

cell-to-cell signaling, termed quorum sensing 

(Lynch et al., 2002; Bi et al., 2007; Khajanchi et al.,

A570 

a 

Figure 2. Micrographs of EPC cells infected with A. hydrophila YJ-1 (a) and YJ-1∆AhyI (b) at 5 h post 

infection. 

1.8 

1.6 

1.4 

1.2 

1 

0.8 

0.6 

0.4 

0.2 

0 

1 2 3 

Figure 3. The amount of biofilm formation for each strain was quantified by solubilizing the stained biofilm 

with ethanol : acetone and measuring the OD570. Each strain was tested in quadruplicate at each time point. 

Error bars indicate standard deviation. Lane 1, wide type Ah YJ-1, lane 2, YJ-1∆AhyIRC, lane 3, YJ-1∆AhyI. 

The results are representative of three experiments. 

Table 2. Calculations of LD50 strain YJ-1 and the ahyI mutant. 

Bacteria CFU/0.1 ml 

Mortality 

(no. dead/no. total) 

b 

Day of death 

(no. dead/no. total) 


YJ-1 

AhyI 

mutant 

YJ-1 AhyI mutant 

10 9 

10/10 1/10 1(5/10) 2(8/10) 3(10/10) 6(1/10) 

10 8 

10/10 1/10 1(5/10) 2(7/10) 4(10/10) 6(1/10) 

10 7 

8/10 0/10 1(4/10) 2(7/10) 4(8/10) NA * 

10 6 

6/10 0/10 1(3/10) 3(5/10) 4(6/10) NA * 

10 5 

3/10 0/10 3(4/10) 4(6/10) NA * 

10 4 

0/10 0/10 NA * NA * 

10 3 

0/10 0/10 NA * 

NA * 

control 0/10 NA * 

LD value(CFU/ml) 6 x10 5 

>10 9 

*NA, not applicable: no death due to A. hydrophila infection during the experiment.


2009). To explore the role of quorum sensing system in 

regulating the extracellular virulent factors secretion and 

biofilm formation, we constructed an ahyI mutant strain of 

a fish-clinical isolate YJ-1, named YJ-1∆AhyI. Inactivation 

of the ahyI gene of A. hydrophila did not result in 

noticeable changes in growth patterns compared with 

those of the wild-type strain. This finding indicates that 

ahyi has no significant effect on basic cellular metabolic 

processes required for growth of A. hydrophila in vitro. 

This is in contrast to some other bacteria in which luxS 

had an effect on growth, Lyon et al. (2001) reported that 

disruptions of Streptococcus pyogenes, s luxS shown a 

media-dependent growth defect, and the effect of quorum 

sensing on Vibrio harveyi growth rate can be either 

positive or negative (Nackerdien et al., 2008). 

Decreased virulence has been seen in ∆luxS mutants 

of several pathogenic bacteria (Winzer and Williams, 

2001). A Vibrio cholerae luxO mutant is severely defective 

in colonization of the small intestine in an infant mouse 

model, inactivation of the rhlA gene in P. aeruginosa 

prevents rhamnolipid production, disabling the protection 

against polymorphonuclear leukocytes (Van et al., 2009), 

and quorum sensing is necessary for the virulence of P. 

aeruginosa during urinary tract infection (Kumar et al., 

2009), and Vibrio alginolyticus luxO-luxRval regulatory 

system control the expression of alkaline serine protease 

(Rui et al., 2009). In contrast, the S. epidermidis luxS 

mutant shows increased virulence in a model of catheter- 

associated infection. Most likely, the increased virulence 

may be partly attributed to the increased synthesis of PIA 

and more-intense biofilm formation. In this study, 

virulence factors were detected by patching bacteria on 

LB agar plates supplemented with different substrates, 

and the results shown that the virulence factors were 

decreased in the ahyI mutant strain, and on the PAGE, 

many proteins bands were lost or decreased, this 

phenomena suggest that QS control the extracellular 

proteins production, these band not only include the 

virulence factors, this results is consistent with the report 

on the protease. 

The biofilm formation has been documented as survival 

strategy of pathogens, regulation of biofilm formation by 

quorum sensing systems has been shown in a number of 

bacteria. In vitro biofilm formation in A. hydrophila has 

been demonstrated using crystal violet staining assays as 

well as SEM. We could detect the difference between the 

parent strain and the QS mutant. Our data showed that 

the ahyI mutant strain was unable to develop a complete 

biofilm. This effect on biofilm formation by luxS in vitro 

was also observed in Streptococcal (Cvitkovitch et al., 

2003), Streptococcus (Kong et al., 2006) and V. cholerae 

(Waters et al., 2008), while the luxS mutant of 

Edwardsiella tarda (Xiao et al., 2009) and Streptococcus 

mutans (Huang et al., 2009) were considerably increased 

biofilm formation. Thus, the quorum sensing signaling 

molecules have contrasting effects on biofilm formation in 

different strains. 

In conclusion, we show quorum sensing system in A. 

hydrophila is functional for the secretion of extracellular 

virulence factors, the formation of mature biofilm and its 

pathogenicity, and these findings indicate that disrupt 

quorum sensing systems of pathogenic bacteria is a 

promising alternative for antibiotics in fighting bacterial 

infections. 


This work was supported by State Administration for 

Entry and Exit Inspection and Quarantine of P. R. China. 

The authors are much indebted to Dr. RJC McLean, 

Department of Biology, Texas State University, for 

generous provision of the AHL bioassay strain and for his 

helpful comments on the manuscript. 

REFERENCES 

Bi ZX, Liu YJ, Lu CP (2007). Contribution of AhyR to virulence of 

Aeromonas hydrophila J-1. Res. Vet. Sci., 83: 150-156. 

Cahill MM (1990). Virulence factors in motile Aeromonas species: a 

review. J. Appl. Bacteriol., 69: 1-16. 

Chu WH (2001). Studies on the pathology and control of the bacterial 

hemorrhage disease in a hybrid crussian carp. Reservoir Fisheries, 

21: 40. 

Croxatto A, Chalker VJ, Lauritz J, Jass J, Hardman A, Williams P, 

Camara M, Milton DL (2002). VanT, a homologue of Vibrio harveyi 

LuxR, regulates serine, metalloprotease, pigment, and biofilm 

production in Vibrio anguillarum. J. Bacteriol., 184: 1617–1629. 

Cvitkovitch DG, Li YH, Ellen RP (2003). Quorum sensing and biofilm 

formation in Streptococcal infections. J. Clin. Invest., 112: 1626-1632. 

Daskalov H (2006). The importance of Aeromonas hydrophila in food 

safety. Food Control, 17: 474-483. 

Dennis JJ, Zylstra GJ (1998). Plasposons: Modular self-cloning 

minitransposon derivatives for rapid genetic analysis of Gramnegative 

bacterial genomes. Appl. Environ. Microbiol., 64: 2710-2715. 

Fuqua WC, Winans SC, Greenberg EP (1994). Quorum sensing in 

bacteria-the LuxR-LuxI family of cell density-responsive 

transcriptional regulators. J. Bacteriol., 176: 269–275. 

Hänninen ML, Oivanen P, Hirvelä-Koski V (1997). Aeromonas species 

in fish, fish-eggs, shrimp and freshwater. Int. J. Food Microbiol., 34: 

17-26. 

Henke JM, Bassler BL (2004). Quorum sensing regulates type III 

secretion in Vibrio harveyi and Vibrio parahaemolyticus. J. Bacteriol., 

186: 3794–3805. 

Huang Z, Meric G, Liu Z, Ma R, Tang Z, Lejeune P (2009). luxS-based 

quorum-sensing signaling affects Biofilm formation in Streptococcus 

mutans. J. Mol. Microbiol. Biotechnol., 17: 12-19. 

Keller L, Surette MG (2006). Communication in bacteria: an ecological 

and evolutionary perspective. Nat. Rev. Microbiol., 4: 249–258. 

Khajanchi BK, Sha J, Kozlova EV, Erova TE, Suarez G, Sierra JC, 

Popov VL, Horneman AJ, Chopra AK (2009). N-Acylhomoserine 

lactones involved in quorum sensing control the type VI secretion 

system, biofilm formation, protease production, and in vivo virulence 

in a clinical isolate of Aeromonas hydrophila. Microbiol. 155: 3518- 

3531. 

Kim SY, Lee SE, Kim YR, Kim CH, Ryu PY, Choy HE, Chung SS, Rhee 

JH (2003). Regulation of Vibrio vulnificus virulence by the LuxS 

quorum-sensing system. Mol. Microbiol., 48: 1647–1664. 

Kjelleberg S, Molin S (2002). Is there a role for quorum sensing signals 

in bacterial biofilms? Curr. Opin. Microbiol., 5: 254–258. 

Kong KF, Cuong V, Michael O (2006). Staphylococcus quorum sensing 

in biofilm formation and infection. Int. J. Med. Microbiol., 296: 133- 

139.

Kumar R, Chhibber S, Harjai K (2009). Quorum sensing is necessary 

for the virulence of Pseudomonas aeruginosa during urinary tract 

infection. Kidney Int., 76: 286-292. 

Lilley BN, Bassler BL (2000). Regulation of quorum sensing in Vibrio 

harveyi by LuxO and sigma-54. Mol. Microbiol., 36: 940–954. 

Lynch MJ, Swift S, Kirke DF, Keevil CW, Dodd CER, Williams P (2002). 

The regulation of biofilm development by quorum sensing in 

Aeromonas hydrophila. Environ. Microbiol., 4: 18-28. 

Lyon WR, Madden JC, Levin JC, Stein JL, Caparon MG (2001). 

Mutation of luxS affects growth and virulence factor expression in 

Streptococcus pyogenes. Mol. Microbiol., 42: 145–157. 

Manefield M, Harris L, Rice SA, de Nys R, Kjelleberg S (2000). 

Inhibition of luminescence and virulence in the black tiger prawn 

(Penaeus monodon) pathogen Vibrio harveyi by intercellular signal 

antagonists. Appl .Environ. Microbiol., 66: 2079–2084. 

March JC, Bentley WE (2004). Quorum sensing and bacterial cross-talk 

in biotechnology. Cur. Opin. Biotechnol., 15: 495–502. 

McClean KH, Winson MK, Fish L, Taylor A, Chhabra SR, Camara M, 

Daykin M, Lamb JH, Swift S, Bycroft BW, Stewart GS, Williams P 

(1997). Quorum sensing and Chromobacterium violaceum: 

exploitation of violacein production and inhibition for the detection of 

N-acylhomoserine lactones. Microbiol., 143: 3703–3711. 

Nackerdien ZE, Keynan A, Bassler BL, Lederberg J, Thaler DS (2008). 

Quorum Sensing Influences Vibrio harveyi Growth Rates in a Manner 

Not Fully Accounted For by the Marker Effect of Bioluminescence. 

PLoS ONE 3(2): e1671. doi:10.1371/journal.pone.0001671. 

O'Toole GA, Kolter R (1998). Flagellar and twitching motility are 

necessary for Pseudomonas aeruginosa biofilm development. Mol. 

Microbiol., 30: 295-304. 

Pemberton JM, Kidd SP, Schmidt R (1997). Secreted enzymes of 

Aeromonas. FEMS Microbiol Lett. 152: 1-10. 

Penfold RJ, Pemberton JM (1992). An improved suicide vector for 

construction of chromosomal insertion mutations in bacteria. Gene., 

118: 145–146. 

Reed LJ, Muench H (1938). A simple method of estimating fifty percent 

endpoints. Am. J. Hyg., 27: 493–497. 

Rubires X, Saigí F, Pigué N, Climent N, Merino S, Albertí S, Tomás JM, 

Regué M (1997). A gene (wbbL) from Serratia marcescens N28b 

(O4) complements the rfb-50 mutation of Escherichia coli K-12 

derivates. J. Bacteriol., 179: 7581-7586. 

Rui HP, Liu Q, Wang QY, Ma Y, Liu H, Shi CB, Zhang YX (2009). Role of 

alkaline serine protease, Asp, in Vibrio alginolyticus virulence and 

regulation of its expression by LuxO-LuxR regulatory system. J. 

Microbiol. Biotechnol., 19: 431-438. 

Sambrook J, Fritsch E, Maniatis T (1989). Molecular Cloning: A 

Laboratory Manual, 2nd Ed, Cold Spring Harbor Laboratory, Press 

Cold Spring Harbor, New York, U.S.A. 

Simon R, Priefer U, Pühler A (1983). Vector plasmids for in vivo and in 

vitro manipulations of Gram-negative bacteria. In Molecular Genetics 

of the Bacteria–Plant Interaction, pp. 98–106. Edited by A. Pühler. 

Heidelberg: Springer. 


Swift S, Karlyshev AV, Fish L, Durant EL, Winson MK, Chhabra SR, 

Williams P, Macintyre S, Stewart GS (1997). Quorum sensing in 

Aeromonas hydrophila and Aeromonas salmonicida: identification of 

the LuxRI homologs AhyRI and AsaRI and their cognate Nacylhomoserine 

lactone signal molecules. J. Bacteriol., 179: 5271- 

5281. 

Swift S, Lynch MJ, Fish L, Kirke DF, Tomas JM, Stewart GSAB, Williams 

P (1999). Quorum sensing-dependent regulation and blockade of 

exoprotease production in Aeromonas hydrophila. Infect Immun., 67: 

5192–5199. 

Van GM, Christensen LD, Alhede M, Phipps R, Jensen PØ, 

Christophersen L, Pamp SJ, Moser C, Mikkelsen PJ, Koh AY, Tolker- 

Nielsen T, Pier GB, Høiby N, Givskov M, Bjarnsholt T (2009). 

Inactivation of the rhlA gene in Pseudomonas aeruginosa prevents 

rhamnolipid production, disabling the protection against 

polymorphonuclear leukocytes. APMIS., 117: 537-546. 

Waters CM, Lu W, Rabinowitz JD, Bassler BL (2008). Quorum sensing 

controls biofilm formation in Vibrio cholerae through modulation of 

cyclic di-GMP levels and repression of vpsT. J. Bacteriol., 190: 2527- 

2536. 

Winzer K, Williams P (2001). Quorum sensing and the regulation of 

virulence gene expression in pathogenic bacteria. Int. J. Med. 

Microbiol., 291: 131-143. 

Xiao J, Wang Q, Liu Q, Xu L, Wang X, Wu H, Zhang Y (2009). 

Characterization of Edwardsiella tarda rpoS: effect on serum 

resistance, chondroitinase activity, biofilm formation, and autoinducer 

synthetases expression. Appl. Microbiol. Biotechnol., 83: 151-60.




DOI: 10.5897/AJMR11.214 


Detection of H9N2 avian influenza virus in various 

organs of experimentally infected chickens 

Somayeh Asadzadeh Manjili 1 , Iradj sohrabi Haghdoost 1 , Pejman Mortazavi 1 , Hamid Habibi 2 , 

Hadi lashini 3 and Esmaeil Saberfar 3 * 

¹Department of veterinary pathology, Faculty of Specialized Veterinary Sciences, Islamic Azad University, Science and 

Researches Branch, Tehran, Iran. 

²Department of Veterinary, Saveh, Markazi Province, Iran. 

3 

Research Center for applied virology, Baqiyatallah University of Medical Sciences Tehran, IR Iran. 


H9N2 Avian influenza virus (AVI) infection is a major cause of economic losses in poultry industry. 

Therefore further study to explain the virus pathogenesis is necessary. In this study tissue tropism and 

dissemination of A/chicken/Iran/11T/99(H9N2) virus in various organs of specific pathogen free (SPF) 

chickens were investigated. Fifty 2-week-old chickens hatched from SPF eggs were divided randomly 

into two groups. Forty chicks in the experimental and ten chicks in the control group. Experimental 

chicks were inoculated intranasally-intraorally with the virus. Samples of lung, trachea, pancreas, 

thymus, spleen, brain, bursa of fabricius, proventriclus, cloaca and kidney were aseptically collected at 

1, 3, 5, 7, 9 and 10 day post inoculation (DPI). A reverse transcriptase polymerase chain Reaction (RT- 

PCR) test was performed for virus detection. Viral RNA was detected in the respiratory system on days 

3, 5 and 7 PI. The virus was also found in the kidney on days 3,5,7,9 PI and in the pancreas on days 3 

and 5 PI. Viral RNA was observed only on day 5 PI in cloaca. The virus was not detected in the blood, 

brain and immune system. The virus was not found from any organs on day 10 PI. These results 

suggest that H9N2 AIV has tropism for respiratory, digestive and urinary system following 

intranasal/intraoral inoculation. 

Key words: Avian influenza, H9N2, SPF, RT-PCR. 

INTRODUCTION 

Avian influenza viruses (AIVs) belong to the family 

orthomyxoviridae and to the type A influenza virus. These 

viruses are classified into subtypes based on their 

surface haemagglutinin (H) and neuraminidase (N) 

glycoproteins. So far, 16 different H subtypes (H1-H16) 

and 9 different N subtypes have been indentified 

(Fouchier et al., 2005). According to the pathogenicity of 

AIV to domestic and wild bird species these viruses are 

categorized into two pathotype groups including Highly 

Pathogenic Avian Influenza (HPAI) viruses and non- 

Highly Pathogenic Avian influenza (nHPAI) viruses 

*Corresponding author. E-mail: saberfar@yahoo.com. Tel: +98- 

21-66949644. 

(Capua and Alexander, 2006). The H9N2 AIV outbreaks 

occurred in domestic poultry in Asia and the Middle East 

since the 1990s, and have caused severe economic 

losses in many countries. In 1998 an AI outbreak in Iran 

caused great economic losses in poultry industry and an 

non-highly pathogenic avian influenza virus (H9N2) has 

been reported as causative agent (Pourbakhsh et al., 

2000). H9N2 AIVs induce significant troubles for the 

poultry industry in Iran due to decreased production, 

increased mortality and cost of vaccination. Avian 

influenza disease due to H9N2 subtype has been 

markedly common during 1994 to 1999 in many parts of 

the world (Vasfi Marandi and Bozorgmehrifard, 2002). 

H9N2 influenza viruses are also discussed to be one of 

the potential candidate for the next human widespread 

epidemic disease (Butt et al., 2005). Experimental infection

in specific pathogen-free (SPF) chickens announced that 

the H9N2 AIV is not capable to cause pathological 

lesions, severe clinical signs and mortality by itself (Lee 

et al., 2007; Pourbakhsh et al., 2000). During outbreaks 

of non-highly pathogenic AIVs co-infection with other 

pathogens especially in severe stress conditions may 

complicate the syndrome and induce sings of respiratory 

disease and even mortality in field. 

Because of widespread incident of the disease and 

ambiguous behavior of the H9N2 AIV further study to 

explain the virus pathogenesis is necessary. In a 

characteristic manner non-highly pathogenic AIVs have 

been isolated from respiratory exudate and feces of 

infected birds, and AIV nucleoprotein has been 

demonstrated in epithelial cells of the intestine, trachea, 

lungs and air sacs (Shalaby et al., 1994; Swayne et al., 

1994). LPAI viruses often need trypsin like enzyme 

activity to cleave the Hemagglutinin into HA1 and HA2 

proteins in order to make the infectious virus particle 

(Klenk et al., 1975). Hence respiratory and 

gastrointestinal epithelia that contain these types of 

enzyme and organs containing epithelial cells like 

pancreas and kidney are principal places for non-highly 

pathogenic AIV replication and lesion formation (Klenk et 

al., 1975; Shalaby et al., 1994). Anyway the pathway of 

virus distribution into these organs remains ambiguous 

and it needs more studies to be investigated well. Virus 

isolation in SPF chickens for identification of AI viruses is 

time consuming and require specific facilities. Molecular 

tests like reverse transcription PCR (RT-PCR) are being 

introduced in order to detection of AIV due to their 

premium such as rapidity, delicacy and sensitivity 

(Saberfar et al., 2008). The aim of this study was 

assessment of the H9N2 virus spreading in various 

organs of the infected SPF chickens at different days 

after inoculation. RT-PCR test was performed to 

diagnose the presence of the virus in different body 

tissues. It may further help us to investigate the virus 

pathogenesis. 


Virus strain 

The influenza virus A/chicken/Iran/11T/99 H9N2 that was isolated 

from outbreak among poultry in Iran,was provided by Razi Vaccine 

and Serum Research Institute (Karaj, Iran). The virus was 

propagated two times in the allantoic cavity of 9 to 11-day-old 

embryonated chicken specific pathogen free eggs. 

Hemagglutination (HA) titers of the viruses ranged from 512 to 1024 

HA unit, when tested according to the methods as described 

previously (Burleson et al., 1992). 

SPF chickens 

Fifty 2-week-old chickens hatched from SPF eggs were randomly 

divided in two groups (forty chicks in experimental group and ten 

chicks in control group). Both groups were housed in same 

condition in two separate isolated rooms. Feed and water were 

available ad libitum. 

Experimental design 

Manjili et al. 5827 

All birds were bled and serologically tested using Hemagglutination 

inhibition test (HI) (Burleson et al., 1992). They were negative for 

antibodies to H9N2 influenza virus antigens. Five chickens from 

treated group were sacrificed and their organs were investigated 

from virus detection. All of these samples were also negative for 

virus detection. Subsequently, chickens of the experimental group 

were inoculated via intranasal/intraoral routes with 120 µl of 

infectious allantoic fluid containing 10 7.5 EID 50 of the applied virus 

strain diluted in sterile PBS solution. The control group was 

received sterile PBS with the same manner. All the birds were 

monitored daily for 15 days to investigate the changes of antibody 

titre to H9N2 and mortality. Five chickens from the experimental 

group and one chicken from the control group were randomly 

selected on days 1, 3, 5, 7, 9 and 10 post inoculation (PI). They 

were bled and sacrificed. During this period, all chickens were 

observed if they have clinical signs of disease or not and 

observations were recorded. Necropsy was done on sacrificed 

chickens and all gross lesions were recorded. Samples of lung, 

trachea, pancreas, thymus, spleen, brain, bursa of fabricius, 

proventriclus, cloaca and kidney were aseptically collected for virus 

detection and RT-PCR assay. Blood samples were collected in 

EDTA tubes. Sera of the birds were also collected at the same days 

for HI test. All tissue samples were immediately stored at -70º until 

used. 

Serology 

Serum samples were collected on the pre-inoculation, first to 

fifteenth days post inoculation from all chickens and were tested 

against specific antibodies to H9 antigen by using 

Haemagglutination Inhibition (HI) test, according to the manual of 

standards for diagnostic test (OIE, 2008). 

Extraction of viral RNA 

RNA of blood and tissue samples was extracted using the RNX TM 

(-Plus) kit (CinnaGen Inc.) according to the manufacturer's protocol. 

50 to 100 mg of tissue or 100 µl of blood sample was mixed with 

1ml RNX and incubated at room temperature for 5 minutes. After 

addition of 200 µl chloroform and mixing, the liquid was clarified by 

centrifugation at 12,000 rpm at 4º for 15 min. The supernatant was 

transferred into a new tube and mixed with an equal volume of 

isopropanol followed by centrifugation at 12000 rpm at 4º for 15 

min. The pellet was washed with 1ml of 75% ethanol. Finally, the 

pellet was dissolved in 50 µl of DEPC treated water. 

RT-PCR 

The cDNA was synthesized using AccuPower RT-Premix kit 

(BioNeer corporation, South Korea) according to the manufacturer's 

protocol. The primer sequences are shown in Table 1. 1 µg of total 

RNA and 20 pmol of each primer were used for cDNA preparation. 

PCR was performed to amplify 510 bp fragment of matrix protein 

gene of influenza virus using the AccuPower PCR PreMix kit 

(BioNeer Corporation, South Korea).The reaction mixture contained 

5 µl cDNA in a final volume 20 µl was subjected to 94ºC for 5 min 

an 35 cycles of 94°C for 30 s, 49°C for 30 s, 72ºC for 40 s and 

followed by final extension at 72°C for 5 min. The PCR products 

were separated by electrophoresis using a 1.5% agarose gel in 

1xTBE buffer.


Table 1. RT-PCR Primer Sequences. 

Specificity primers sequences size 

Influenza A virus MF GGC TCT CAT GGA ATG GCT AA 510 

Influenza A virus MR CTG GCC TGA CTA GCA ACC TC 510 

Table 2. H9N2 serum antibody titration (Mean titer) of the test and control groups of chickens experimentally 

infected with H9N2 AI virus. 

DPI Day 0 Day 1 Day 3 Day 5 Day 7 Day 9 Day 10 Day 13 Day 15 

test Group 0 0 0.4 1.4 2.4 3.6 4 6.6 7.4 

control Group 0 0 0 0 0 0 0 0 0 

Figure 1. Results of the RT-PCR assay. 

Amplifying 510-bp segment of M gene of 

AIV. Lane 1: DNA marker (100-bp), Lane 2: 

negative control, lane 5,6 and 7: negative 

samples, lane 3: positive control, lane 4: 

positive sample. 

Amplified products were visualized under ultraviolet light after 

staining with 0.1 µg /ml ethidium bromide. A 100 base pair ladder 

was used as a molecular weight marker. 

RESULTS 

Clinical signs 

Daily monitoring did not show any sign of illness in the 

chickens from control group. The clinical signs observed 

in the inoculated chickens were depression, facial 

edema, conjunctivitis, ruffled feather, decrease feed 

consumption and diarrhoea. Clinical signs were observed 

from third day post inoculation. On day 7 PI the number 

of chickens showing clinical signs reduced. The clinical 

signs disappeared at 12 DPI. No mortality was recorded 

from each isolate. 

Gross Lesions 

No gross lesions were observed in the uninfected control 

group. In experimental chickens the lesions such as mild 

congestion of the trachea and lungs, hemorrhage in small 

intestine and pancreas and swollen kidneys were 

observed. 

HI test 

There was no evidence of any change in specific 

antibodies against AIV in pre and post inoculation of 

control chickens. As shown in Table 2 the mean of 

antibody titer was increased at 5 DPI and reached to 

at 15 DPI in the experimental group. 

RT-PCR 

The presence of the virus in various organs obtained 

from the inoculated and control birds at different DPI was 

determined by RT-PCR test. Tissue samples from 5 

different birds that had been taken before inoculation and 

samples from control group were all negative for virus 

detection. First positive samples were seen on day 3 PI 

and the last positive sample was detected on day 9 PI 

(Figure 1). The virus was detected in the trachea, lungs, 

pancreas, cloaca and kidney of infected birds during the 

experiment course. The results of the virus detection are 

shown in Table 3. The results show that most positive 

samples were detected on days 5 PI. All brain, blood, 

thymus, spleen, proventriclus and bursa of fabricius,

Manjili et al. 5829 

Table 3. The results of virus detection from various organs of SPF chickens at different days post inoculation with H9N2 AI virus. 

Day PI Group Tr L Th Sp Pr Cl Bu P K Br Bl 

1 T 

C 

3 T 

C 

5 T 

C 

7 T 

C 

9 T 

C 

10 T 

C 

0/5* 

0/1 

2/5 

0/1 

2/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

3/5 

0/1 

4/5 

0/1 

2/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

T= test group C= control group Tr= Trachea, L= Lung, Th= Thymus, Sp= Spleen, Pr= Proventriclus, Cl= Cloaca, Bu= Bursa of Fabricius, 

P= Pancreas, K= Kidney, Br= Brain, Bl= Blood. *= No. of positive samples/total samples taken. 

samples were negative for virus detection. 

DISCUSSION 

In this study tissue tropism and dissemination of H9N2 

virus throughout the various organs were evaluated 

following intranasal/intraoral inoculation. The clinical 

signs and gross lesions found at post mortem 

examination were alike and milder than lesions reported 

in naturally infected birds with H9N2 (Pourbakhsh et al., 

2000). Although In Some researches (Shalaby et al., 

1994; Swayne et al., 1994) as well as present study, 

inoculation of low pathogenicity AIVs in SPF or broiler 

chickens have produced absence of mortality, but 

mortality between 20 and 60% in natural outbreaks have 

been reported (Naeem et al., 2003; Nili et al., 2003; Vasfi 

Marandi and Bozorgmehrifard, 2002). Previous studies 

have shown that the M gene RT-PCR is sensitive and 

specific method for the detection of influenza A viruses of 

human and avian origin (Saberfar et al., 2009). 

In this study predominant infection in the respiratory 

organs was observed between days 3 and 7 PI. 

Detection of the virus from the trachea and lungs 

indicates that H9N2 AI virus is pneumotropic following 

intranasal/intraoral inoculation. Repetition of virus 

recovery in respiratory system was mostly higher for lung 

tissues. Viral RNA was identified in lung tissue on days 3, 

5 and 7 PI. Previous studies (Kwon et al., 2008) have 

reported that H9N2 viral antigen were detected in the 

trachea, lungs, thymus, spleen, bursa, cecal tonsils and 

0/5 

0/1 

0/5 

0/1 

2/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

1/5 

0/1 

4/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

2/5 

0/1 

3/5 

0/1 

1/5 

0/1 

1/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

0/5 

0/1 

kidneys of SPF chickens on day 5 PI. We observed 

infections that are localized to the GI tract at days 3 and 5 

PI. The H9N2 virus were detected in the cloaca at day 5 

PI and in the pancrease at day 3 and 5 PI. Detect of the 

H9N2 virus in cloaca only on day 5 PI perhaps originated 

in temporary replication of the virus in GI tract. Swayne 

and Halverson reported that LPAI viruses produce 

infections in respiratory and GI tracts of chickens. AIV 

nucleoprotein has been identified in epithelial cells of the 

trachea, lungs, and intestine (Shalaby et al., 1994; 

Slemons and Swayne, 1995; Swayne et al., 1994). 

Hablolvarid et al. (2004) detected nucleoproteins of the 

H9N2 virus in the trachea, lungs and cecal tonsils of 

experimentally infected 5-week-old SPF chickens using 

immunoperoxidase assay. We detected H9N2 virus in the 

pancreas on day 3 and 5 post inoculation. Shinya et al. 

(1995) reported positive immunoreaction to H5N3 virus 

antigen in the pancreas of inoculated chicks. Hablolvarid 

et al. (2003) detected H9N2 virus nucleoproteins in the 

pancreas of experimentally infected 5-week-old chickens 

using immunoperoxidase assay following intravenous 

inoculation. Sometimes LPAIV can spread further than 

the respiratory and GI tracts, replicate and cause lesions 

in primarily visceral organs including epithelial cells such 

as pancreas and kidney (Shalaby et al., 1994; Vasfi 

Marandi and Bozorgmehrifard, 2002). 

Mosleh et al. (2009) showed that 

A/Chicken/Iran/772/1998 (H9N2) had tissue tropism and 

pathogenicity for the respiratory system (lung and 

trachea), immune system (spleen), urinary system 

(kidneys) and digestive system of commercial broiler


chicks following IN inoculation. We observed 

predominant infection in the kidney at days 3, 5, 7, and 9 

PI. Virus detection in the kidney could indicate virus 

tropism for the urinary system as previously reported 

(Shalaby et al., 1994; Swayne and Slemons, 1995; Vasfi 

Marandi and Bozorgmehrifard, 2002). Swayne and 

Slemons (1994) reported that LPAIVs were nephrotropic 

following IV inoculation and pneumotropic following 

intranasal inoculation, but they did not detect the virus 

antigens in kidney using immunohistochemistry assay. In 

other study LPAI virus was not detected in parenchymal 

cells of the kidneys following IN inoculation (Swayne and 

Beck, 2005). In previous studies the H9N2 AIV detected 

from trachea, kidney and lung tissues using indirect 

immunoperoxidase test (Shamsedini et al., 2002). H9N2 

viral antigen was detected from different tissues of 

experimental infected three-week-old SPF chickens such 

as spleen, kidney, lung, trachea, thymus, bursa and cecal 

tonsil (Kwon et al., 2008). However In this study we did 

not detect the viral RNA in the lymphoid tissues. Viral 

RNA was not detected in the blood of the chickens in 

experimental group. Mosleh et al, (2009) did not also 

detect the virus from blood samples. 

Conclusion 

Most of the Non Highly Pathogenic AIVs have two basic 

amino acids at the proteolytic cleavage site of the 

hemagglutinin protein (Wood et al., 1993) and require 

cleavage by a trypsin-like enzyme to be infectious and 

perform multiple virus replication cycles (Klenk et al., 

1975). Respiratory and gastrointestinal tracts have this 

enzyme activity in some cells or lumenal contents and it 

is responsible for the GI and respiratory tracts being 

primary sites for LPAI virus replication and lesion 

production. Therefore more studies must be investigated 

to realise the ability of replication of the virus in the 

organs with no trypsin-like enzyme such as lymphoid 

tissues. The virus was not detected from any organs on 

day 10 PI. It might be resulted from increasing of the 

specific AIV antibody titer in chicken's blood. Current 

study showed that H9N2 AIV has tropism for the 

respiratory organs, urinary system and digestive system. 

REFERENCES 

Burleson FG, Chambers TM, Wiedbrauk DL (1992). Nucleic Acids 

Research 25: 3389-3402. A Laboratory Manual Academic Press. Inc. 

London. 

Butt KM, Smith GJ, chen H (2005). Human infection with an avian H9N2 

influenza A virus in Hong Kong in 2003. J. Clin. Microbiol., 43: 5760- 

5767. 

Capua I, Alexander DJ (2006). The challenge of avian influenza to the 

veterinary community Avian Pathol., 3: 189-205. 

Fouchier R, Munster V, Wallensten A, Bestebroer T, Herfst S, Smith D, 

Rimmelzwaan G, Olsen B, Osterhaus A (2005). characterization of a 

novel influenza A virus hemagglutinin subtype (H16) obtained from 

Black-Headed gulls. J. Virol., 79: 2814-2822. 

Hablolvarid MH, Sohrabi HI, Pourbakhsh SA, Gholami MR (2003). A 

study on histopathologic changes in chicken following intravenous 

inoculation with avian influenza virus A/Iran/259/1998 (H9N2). Arch. 

Razi Inst., 55: 41-54. 

Hablolvarid MH, Sohraby Haghdost I, Pourbakhsh SA, Gholami MR 

(2004). Histopathological study of intranasally inoculated 

A/chicken/Iran/259/1998 (H9N2) influenza virus in chicken. Arch. 

Razi Inst., 58: 51-62. 

Klenk HD, Rott R, Orlich M, Blodorn J (1975). Activation of influenza A 

viruses by trypsin treatment. Virology, 168: 426-439. 

Kwon JS, Lee HJ, Lee DH, Lee YJ, Mo IP, Nahm SS, Kim MJ, Lee JB, 

Park SY (2008). Immune response and pathogenesis in 

immunocompromised chickens in response to infection with H9N2 

Low phathogenic avian influenza virus. Virus Res., 133: 187-194. 

Lee YJ, Shin JY, Song HW, Kim JH, kwon YK, kwon JH, kim CJ, Webby 

RJ, Webster RG, Choi YK (2007). continuing evoluation of H9 

influenza viruses in korean poultry. Virology. 359: 313-323. 

Mosleh N, Dadras H, Mohammadi A (2009). Evaluation of H9N2 avian 

influenza virus dissemination in various organs of experimentally 

infected broiler chickens using RT-PCR. Iran. J. Vet. Res., 10: 12-20. 

Naeem K, Naurin M, Rashid S (2003). Seroprevalence of avian 

influenza virus and its relationship with increased mortality and 

decreased egg production. Avian Pathol., 32: 285-289. 

Nili H, Asasi K (2003). Avian influenza (H9N2) Outbreak in Iran. Avian 

Dis., 47: 828-837. 

Office International Des Epizooties (OIE) (2008) Chapter 2.3.4 Avian 

influenza In: MANUAL OF DIAGNOSTIC TESTS AND VACCINES 

FOR TERRESTRIAL ANIMALS (mammals, birds and bees). 

Pourbakhsh SA, khodashenas M, kianizadeh M, Goodarzi H (2000). 

Isolation and identification of avian influenza virus H9N2 subtype. 

Arch. Razi Inst., 51: 27-38. 

Saberfar E, Najafi A, Goodarzi Z, Lashini H (2009). Multiplex Reverse 

Transcription-PCR Assay for Detection of Type A Influenza Virus plus 

Differentiation of Avian H7 and H9 Hemagglutinin Subtypes in Iran. 

Iranian J Pub Health., 38: 29-34. 

Shalaby AA, Slemons RD Swayne DE (1994). pathological studies of 

A/chicken/Alabama/7395/75 (H4N8) influenza virus in specific 

pathogen free laying hens. Avian Dis., 38: 22-32. 

Shamsedini M, Bahmani-Nejad M Khazraee-Nia P (2002). The use of 

indirect immunoperoxidase assay in diagrosis of type A (H9N2) avian 

influenza virus antigen on frozen tissue sections. Arch. Razi Inst., 53: 

11-21. 

Shinya K, Awakura A, Shimada A, Silvano FD, Umemura T, Otsuka K 

(1995). Pathogenesis of pancreatic atrophy by avian influenza A virus 

infection. Avian Pathol., 24:623-632. 

Slemons RD, Swayne DE (1995). Tissue tropism and replicative 

properties of waterfowl-origin influenza viruses in chickens. Avian 

Dis., 39: 521-527. 

Swayne DE, Beck JR (2005). Experimental study to determine if lowpathogenicity 

and high-pathogenicity avian influenza viruses can be 

present in chicken breast and thigh meat following intranasal virus 

inoculation. Avian Dis., 49: 81-85. 

Swayne DE, Slemons RD (1994). comparative pathology of a chickenorigin 

and two duck-origin influenza virus isolates in chickens the 

effect of route of inoculation. Vet. Pathol., 31: 237-245. 

Swayne DE, Slemons RD (1995). comparative pathology of 

intravenously inoculated wild duck- and turkey-origin type A influenza 

Virus in chickens. Avian Dis., 39: 74-84. 

Vasfi MM, Bozorgmehrifard MH (2002). Isolation of H9N2 subtype of 

avian influenza viruses during an outbreak in chickens in Iran. Iran. 

Biomed. J., 6: 13-17. 

Wood GW, Mccauley JW, Bashiruddin JB, Alexander DJ (1993). 

Deduced acid sequences at the haemagglutinin cleavage site of 

avian influenza A viruses of H5 and H7 subtypes. Arch. Virol., 130: 

209-217.




DOI: 10.5897/AJMR11.307 


Biological wastewater treatment: Microbiology, 

chemistry, and diversity measurement of ammonia 

oxidizing bacteria 

AYANDA Olushola Sunday* and AKINSOJI Olatunbosun Seun 

Department of Chemistry, Faculty of Applied Sciences, Cape Peninsula University of Technology, Cape Town, 

South Africa. 


Nitrification is an important biological process in nitrogen cycling and has a significant effect on 

effluent quality in wastewater treatment. Nitrification occurs in two steps by two types of 

chemoautotrophic bacteria, the ammonia oxidizing bacteria (AOB) and nitrite oxidizing bacteria (NOB). 

The ammonia oxidizing bacteria is responsible for the oxidation of ammonia with oxygen into nitrite and 

is often the rate-limiting step in nitrification in wastewater treatment plants. Hence, a better 

understanding of the ecology, microbiology and chemistry of ammonia oxidizing bacteria in biological 

wastewater treatment systems is necessary in order to enhance treatment performance and control. A 

detailed review of various biological wastewater treatment processes, ammonia oxidizing bacteria and 

archaea; economic importance, problems, various molecular techniques for the investigation of the 

diversity and community structure, as well as the isolation of ammonia oxidizing bacteria were 

discussed. 

Key words: Wastewater, activated sludge process, nitrification, ammonia oxidizing bacteria, ammonia oxidizing 

archaea, nitrite oxidizing bacteria, PCR primers. 

INTRODUCTION 

Wastewater treatment is the process of taking 

wastewater and making it suitable for discharge back into 

the environment. Wastewater results from a number of 

different activities, including industrial activities, rainwater 

runoff and domestic activities (Van der Hoek, 2004; 

Thomas, 2005). No matter where the wastewater comes 

from, this water is full of bacteria, chemicals, and other 

contaminants. Wastewater treatment therefore reduces 

the contaminants to acceptable levels so as to be safe for 

discharge into the environment. There are two types of 

wastewater treatment systems: a biological treatment 

plant and a physical/chemical treatment plant. Either of 

the treatment plants are utilized depending on the nature 

and components of pollution but some other pollution will 

*Corresponding author. E-mail: osayanda@gmail.com. Tel.: 

+27784417935 or +2348054642362. 

require a combination of both wastewater treatment 

systems. When considering either a chemical or 

biological wastewater treatment for a particular 

application, it is very important to understand the sources 

of the wastewater generated, typical wastewater 

composition, discharge requirements, events and 

practices within a facility that can affect the quantity and 

quality of the wastewater, and pretreatment ramifications. 

Consideration of these factors will allow for maximization 

of the benefits the treatment plant will gain from effective 

wastewater treatment. 

The various wastewater treatment processes have the 

following objectives: To confer and preserve the inherent 

physical, chemical and biological qualities of water of 

different origins which make it suitable for specific uses 

such as water for drinking and for use in productive 

processes, to protect the public from health risks without 

causing any damage to the environment and to confer 

and preserve those characteristics of water in its natural


environment which are necessary for the conservation 

and development of fauna and aquatic vegetation, and 

for provision of drinking water for cattle and wild animals 

or for recreational and aesthetic purposes (Boari et al., 

1997). 

Ammonia wastewater treatments 

Nitrogen appears in wastewater as ammonia, nitrite, 

nitrate and organic nitrogen (Sotirakou, 1999). With the 

advancement in technology, there have been various 

biological and chemical wastewater treatments meant to 

address the problems of ammonia in wastewater 

(Jorgensen and Weatherley, 2003). The various 

treatment processes for treating ammonia include; lagoon 

systems, membrane bioreactor, fixed film treatment 

processes etc. 

Lagoon systems are not expensive and are much 

easier to operate than mechanical wastewater treatment 

systems. Its components use little concrete and built 

through excavation. However, the effluent quality can 

become substandard because it is hard to control the 

wastewater's temperature, return rate, and oxygen level 

inside the system (Middlebrooks et al., 1999). 

Membrane bioreactor (MBR) technology which 

combines biological-activated sludge process and 

membrane filtration has become more popular, abundant, 

and accepted in recent years for the treatment of many 

types of wastewaters, whereas the conventional activated 

sludge (CAS) process cannot cope with either 

composition of wastewater or fluctuations of wastewater 

flow rate (Jelena et al., 2007). The MBR has three 

essential components - the anoxic basin, the pre-aeration 

basins, and the MBR basin. The raw wastewater is 

poured into a fine screen for filtration, before placing it 

inside the anoxic basin. In the anoxic basin, the mixed 

liquor gushes into the pre-aeration basins until it reach 

the MBR basins. The fluids will then pass through the 

membranes of the MBR basins, wherein the membrane 

that pushes the effluent for disinfection is connected. The 

effluent must be sent first to the disinfection stage to 

ensure the quality of wastewater prior to release. The 

membranes lessen the repeat clarification process, 

making wastewater treatment more practical and 

convenient (Churchouse, 1997; Maryam et al., 2009). 

The MBR treatment process is known for its high effluent 

quality. Unlike other treatments, MBR treatment does not 

need additional filtration or clarification because the 

membranes are designed to clear the impurities in 

wastewater, and removes the total nitrogen from 

wastewater. The MBR machine is also less cumbersome 

and fits to small areas compared to other wastewater 

treatment machines. The costs involved in operating 

MBR are thus much higher compared to other 

wastewater systems. 

BOD removal and b iological nitrification can also be 

achieved using fixed film treatment (Park et al., 1996). 

This technique involves the use of microorganisms such 

as the ammonia oxidizing bacteria (AOB) to treat 

wastewater. It uses a trickling filter/activated sludge 

treatment process wherein a plastic media contains 

microorganisms, which will grow inside a tower where the 

wastewater is placed for treatment. It is then followed by 

activated sludge process. The trickling filters/activated 

sludge treatment process harness the best quality of 

wastewater. Trickling filters are more energy efficient and 

reduce the production of low quality effluent. The 

disadvantages of fixed film treatment include high solid 

retention and foul odour. 

Activated sludge process 

The activated sludge process is a system used for the 

treatment of sewage and industrial wastewaters that 

involves the mixture of biological mass and wastewater 

(Beychok, 1967). It is a complex biological wastewater 

treatment system that is currently designed for removing 

carbon (Akpor, 2011), phosphorus (Metcalf and Eddy, 

1991; Henze, 1996) and/or nitrogen constituents (Metcalf 

and Eddy, 1991; Larsdotter, 2006) in the wastewater. In 

activated sludge process, organic waste is fed to the 

system and leaves the process depending on the desired 

treatment efficiency set by the operator. The process 

begins by mixing the biological waste present in industrial 

wastewater or sewage with an aerobic bacterial culture in 

the reactor and air. This mixture is known as the mixed 

liquor. Once in the reactor, the mixed liquor is aerated for 

a particular period of time in order to ensure that this 

solution is fully mixed. This mixture therefore undergoes 

separation through the gravity clarifier, where the waste 

activated sludge is removed from the treatment and 

mixed with primary treated wastewater before it is 

recycled back to the beginning of the process in order to 

maintain the desired concentration of organisms and 

sludge. Lastly, the sludge goes through further treatment 

and the result of all this process is the treated wastewater 

that can be safely disposed to nature. A generalize 

schematic diagram of an activated sludge process is as 

shown in Figure 1. 

There are basically three types of activated sludge 

processes, they are conventional activated sludge 

processes (Brucculeri et al., 2005; Marcos, 2007), 

contact stabilization processes (Gujer and Jenkins, 1975) 

which uses two separate aeration processes, and the 

extended aeration processes (Lowe and Gaudy, 1989; 

Sotirakou et al., 1999). The different activated sludge 

processes all accomplish the biochemical reduction of 

organics using aeration basins and the return and waste 

sludge systems. It is the detention times, mixed liquor 

suspended solids (MLSS), and food/microorganism ratio 

(F:M) loadings that are different. Other modifications are 

oxidation ditch, complete mix activated sludge process,

Raw water 

Air 

Aeration tank 

Recycle sludge 

Clarifier-settler 

Water sludge 

To sludge treatment 

Figure 1. A generalize schematic diagram of an activated sludge process. 

step feed, tapered aeration and Kraus process. The 

different types of activated sludge plants include: 

Package plants, oxidation ditch, deep Shaft and surfaceaerated 

Basins/Lagoons (Beychok, 1967). 

Ammonium oxidizing bacteria and archaea 

Ammonia in water environments is toxic to fish and other 

aquatic life at high concentrations, and also contributes to 

eutrophication. Biodegradation and elimination of 

ammonia in wastewater is thus one of the main functions 

of wastewater treatment plants (WWTPs) and can be 

achieved by nitrification. Nitrification is the biological 

oxidation of ammonia with oxygen into nitrite followed by 

the oxidation of these nitrites into nitrates and can be 

represented by equation 1 and 2, respectively. A 

chemolithotrophic nitrification is a two-step process and is 

carried out by two different groups of organisms, the AOB 

and the nitrite oxidizing bacteria (NOB) (Bin et al., 2009). 

AOB are primarily responsible for the first step which is 

the oxidation of ammonia with oxygen into nitrite and 

often the rate-limiting step in nitrification. It is this process 

that is essential for the removal of ammonia from the 

wastewater. 

- + - 

NH3 + O2 → NO2 + 3H + 2e (1) 

- - + - 

NO2 + H2O → NO3 + 2H +2e (2) 

It is generally accepted that ammonia (NH3) and not 

+ 

ammonium (NH4 ) is used as substrate, and the 

ammonia/ammonium ratio may therefore affect the 

growth of AOB. AOB are obligatory chemolithoautotrophs 

and can be found among the beta-proteobacteria and 

gamma-proteobacteria (Purkhold, 2000). Most AOB are 

phylogenetically closely related to other activated sludge 

bacteria within the beta subdivision class of 

Proteobacteria (Harms, 2003). AOB are generally rodshaped, 

spherical, spirillar, or lobular, typically Gram- 

Ayanda and Akinsoji 5833 

Treated water 

negative, and flagellation of motile cells is polar to subpolar 

or peritrichous. Most species are aerobic but can 

grow at reduced oxygen partial pressure. Studies suggest 

that there are physiological and ecological differences 

between the different AOB genera and lineages and that 

environmental factors such as salinity, pH, and 

concentrations of ammonia and suspended particulate 

matter select for certain species of AOB (Kowalchuk and 

Steven, 2001; Bin et al., 2009). The physiological activity 

and abundance of AOB in wastewater processing is 

important in the design and operation of waste treatment 

systems, particularly since these organisms display low 

growth rate and high sensitivity to environmental 

disturbances and inhibitor (Okabe, 1999). 

Ammonia oxidizing archaea 

Autotrophic ammonia/ammonium oxidation was initially 

assumed to be restricted to aerobic AOB and anaerobic 

ammonium oxidizing (Anammox) bacteria until recent 

molecular and culture-dependent evidence showed that 

autotrophic ammonia oxidation also occurs in the domain 

Archaea. The first strain of ammonia oxidizing archaea 

(AOA), Nitrosopumilis maritimus, was isolated from the 

rocky substratum of a tropical marine aquarium tank 

(Erguder et al., 2009). Some evidences showed that AOA 

are more abundant than AOB in marine, lake waters and 

soil environments (Sonthiphand and Limpiyakorn, 2010). 

AOA have also been detected in activated sludge 

bioreactors by using specific PCR primers targeting 

archaeal amoA gene. However, AOA abundances 

seemed to be much lower (four orders or more) in most 

cases than AOB based on analysis of amoA gene copy 

number (Jin et al., 2010; Limpiyakorn et al., 2011). The 

factors influencing the presence or/and dominance of 

AOA in different environments are ammonium levels, 

salinity, temperature, organic carbon, dissolved oxygen 

(DO) levels, pH, sulphide levels, and phosphate levels.


Ammonia monooxygenase 

Ammonia monooxygenase (AMO) is a membrane-bound 

enzyme in Nitrosomonas europaea and other autotrophic 

AOB of the beta and gamma-subclasses of 

Proteobacteria. The enzyme contains multiple subunits; 

amoA, amoB and amoC. All the three AMO genes have 

been cloned and sequenced from several AOB 

(McTavish et al., 1993). AMO is responsible for the 

conversion of ammonia to hydroxylamine. Hydroxylamine 

is then oxidized to nitrite by hydroxylamine 

oxidoreductase (HAO) in an endergonic reaction. HAO is 

an unusual enzyme with a highly complex structure, 

located as a soluble enzyme in the perplasmic space, but 

anchored in the cytoplasmic membrane. AMO and HAO 

enzymes are necessary for energy conversion during the 

oxidation of ammonia. The initial oxidation of ammonia, 

which yields hydroxylamine as a reduced product, is an 

O2-dependent reaction catalyzed by AMO: 

NH3 + O2 + 2e - + 2H + → NH2OH + H2O (4) 

Hydroxylamine is further oxidized to nitrite by HAO: 

- + - 

NH2OH + H2O → NO2 + 5H + 4e (5) 

Two of the four electrons generated from hydroxylamine 

are used to support the oxidation of additional ammonia 

molecules; the other two enter the electron transfer chain 

and are used for CO2 reduction and ATP biosynthesis 

(Wood, 1986). 

Ammonia monooxygenase subunit A (amoA) gene and 

16S rRNA genes has been widely used to analyze the 

diversity and abundance of AOB in various samples. 

Based on comparative analysis of 16S rRNA and amoA 

gene sequences, it was found that 16S rRNA gene is 

more conserved than amoA gene and the suggested 

similarity thresholds of 16S rRNA and amoA genes to 

define different AOB species are 97 and 80%, 

respectively (Ye and Zhang, 2011). 

Economic importance of ammonium oxidizing 

bacteria 

Nitrogenous wastes are increasing as a result of the 

expansion of animal husbandry, nitrogen-producing 

industries, and human activities and have therefore 

become a critical factor in environmental management. 

The removal of nitrogen from wastewater treatment is of 

extreme environmental importance. This is because the 

release of untreated waste can result to toxic effect on 

aquatic animals and can lead to eutrophication of the 

environment. Even in cases where treatment does not 

lead to successful denitrification, nitrification helps to 

avoid environmental contamination with potentially toxic 

ammonia salts (Painter, 1986). The broad specificity of 

the AMO complex common to all AOB often permits the 

co-oxidation of numerous recalcitrant aliphatic, aromatic, 

and halogenated molecules. AOB may also play a role in 

methane oxidation and biofilter systems. Biofilter systems 

have been used for the elimination of odours associated 

with waste treatment and composting (Bohn, 1992) and 

also for purposes as providing long-term filtering capacity 

suitable for manned spacecraft (Joshi et al., 2000). The 

reduction of ammonia released into the environment 

reduces the risk of local oxygen depletion. 

Problems associated with ammonia oxidizing 

bacteria 

AOB can lead to the production of the ozone-depleting 

gas NO or the greenhouse gas N2O either at low or high 

levels via partial-denitrification processes under reduced 

oxygen conditions (Cho and Kim, 2000). The process of 

ammonia oxidation leads to a net acidification of the 

environment. The acidification of forest soils may thus 

have a detrimental effect on tree, and high levels of 

nitrification may intensify problems involving the effects of 

acid rain. Nitrogen transformations that lead to an 

increased proton load can lead to the release of metals 

such as aluminum, which can contribute to root damage 

and forest decline. AOB may generate elevated levels of 

nitrous acid and can lead to corrosion of natural stones, 

historical monuments, and building materials (Meincke et 

al., 1989). 

Diversity, abundance and community structure 

measurement 

A better understanding of the microbial ecology of AOB 

and AOA in wastewater treatment systems could 

potentially enhance the treatment performance and 

control, and would also help engineers to utilize the 

functional characteristics of the microbial population to 

model and improve the design and operation of the 

systems (Wang et al., 2010). The development of culture 

independent molecular techniques has enhanced the 

ability of researchers to analyze environmental samples. 

Denaturing gradient gel electrophoresis (DGGE) 

DGGE is a molecular fingerprinting method that 

separates polymerase chain reaction (PCR)-generated 

DNA products. The technique enables sequence diversity 

of PCR-amplified genes from a large number of samples 

to be compared in one gel to reveal changes in 

community structure over time or space. This approach 

separates DNA sequences and allows 95% of single 

base sequence differences to be detected. This approach 

also has the ability to separate genomic sequences 

differing by more than one base (Muyzer et al., 1993). 

DGGE is a useful method for bacterial community

profiling by targeting the 16S rRNA and/or amoA genes 

of AOB (Nicolaisen and Ramsing, 2002). This method is 

less time consuming for comparing AOB communities 

than conventional analysis by cloning and sequencing. 

Hornek et al. (2006) reported the communities of AOB 

in activated sludge of a municipal wastewater treatment 

plant (WWTP) located in Linz (Austria) by the use of 

DGGE technique. DGGE analyses of PCR products 

generated by the amoA primers; amoA-1F, amoA-2R, 

amoAf-I, and amoAr-I were performed with the D-gene 

system. Selected bands were recovered, sequenced and 

subsequently submitted to BLAST to allocate to available 

partial amoA sequences. Sequences were aligned using 

the program ClustalX 1.81. The application of the primer 

set amoA-1F in combination with amoA-2R and amoAr-I 

was suggested for a rapid PCR-DGGE analysis, because 

they seem to complement each other to screen for 

present AOB in the environment. 

The microbial community composition and dominant 

bacterial populations in anoxic-oxic activated sludge from 

a full-scale WWTP in Liaoning, China were investigated 

with PCR-DGGE coupled with sequence analysis of 16S 

rRNA gene fragments from dominant bands by Ding et al 

(2011). PCR amplification of bacterial 16S rRNA gene 

fragments was performed using primer 968F-GC (5’-CGC 

CCG GGG CGC GCC CCG GGC GGG GCG GGG GCA 

CGG GGG GAA CGC GAA GAA CCT TAC-3’) and 

primer 1401R (5’-CGG TGT GTA CAA GGC CCG GGA 

ACG-3’) for the Domain Bacteria, corresponding to 

positions 968 and 1401 in the 16S rDNA of Escherichia 

coli, with a 40 bp-GC-rich sequence (5’- CGC CCG GGG 

CGC GCC CCG GGC GGG GCG GGG GCA CGG GGG 

G - 3’) attached to the 5’ end of the forward primer to 

stabilize the melting behavior of the DNA fragments. 

DGGE of the PCR amplified 16S rDNA was carried out 

using the DCodeTM Universal Mutation Detection 

System. The prominent DGGE bands were selected and 

excised for nucleotide sequence determination. The 

sequences obtained from the DGGE were then analyzed 

in comparison with the 16S rDNA sequences in the 

GenBank database by using the basic local alignment 

search tool (BLAST). The alignment was calculated by 

the neighbor-joining method using Clustal X. The 

phylogenetic affiliation of the sequences was further 

analyzed and a phylogenetic tree was plotted by Mega 

3.1 program. 

Because of high similarity of the 16S rDNA sequences 

that makes it difficult to identify closely related ammonia 

oxidizing species, some difficulties have been 

experienced in studying ammonia oxidizing bacterial 

diversity using DGGE of 16S rDNA gene sequence. 

Another method based on the same principle is the 

temperature gradient gel electrophoresis (TGGE). 

Real-time PCR 

Real-time PCR is a highly sensitive technique that 


facilitates amplification and quantification of a specific 

DNA sequence with the detection of the PCR product in 

real time. Quantification of DNA targets can easily be 

achieved by determination of the cycle when the PCR 

product can first be detected. Thus, Real-time PCR 

technique is reliable and reproducible for AOB and for 

evaluating correlations between microbial activities, cell 

numbers and population changes in time and space. 

Real-time PCR analysis has been applied to numerous 

environmental samples to reveal the comparative 

abundance of AOA and AOB. In many cases, according 

to Caffrey et al. (2007), the archaeal amoA gene 

outnumbered that of AOB. 

The abundance of amoA genes of AOB and AOA in 

activated sludge of seven full-scale wastewater treatment 

plants in Thailand was investigated by Limpiyakorn 

(2011). Quantitative real-time PCR was performed with 

duplicate sets of extracted DNA. Each set of extracted 

DNA was prepared by pooling the DNA extracted in 

triplicate, then diluted for four different 10-fold dilutions 

and a quantitative real-time PCR was carried out for 

each dilution in duplicate with a Brilliant II SYBR Green 

QPCR Master Mix in an Mx3005P instrument. Archaeal 

amoA genes were quantified using the primers ArchamoAF 

(5’-STA ATG GTC TGG CTT AGA CG-3’) and 

Arch-amoAR (5’-GCG GCC ATC CAT CTG TAT GT-3’), 

the quantification of bacterial amoA genes was performed 

using the primers amoA 1F (5’-GGG GTT TCT ACT GGT 

GGT-30) and amoA 2R (5’-CCC CTC KGS AAA GCC 

TTC TTC-3’) while AOB 16S rRNA gene was quantified 

using the primers CTO 189A/Bf (5’-GGA GRA AAG CAG 

GGG ATC G-3’), CTO189Cf (5’-GGA GGA AAG TAG 

GGG ATC G-3’), and CTO 654r (50-CTA GCY TTG TAG 

TTT CAA ACG C-3’). To confirm the single target 

fragment of the PCR amplified products, dissociation 

curves were analyzed and plotted at the end of every 

quantitative real-time PCR reaction and to verify the 

correct amplification of the target microorganisms’ DNA, 

few clones from the clone libraries constructed from the 

real-time PCR amplified products were randomly selected 

for sequencing and the results for every reaction tested 

verified the correct amplification of the target 

microorganisms’ DNA. 

Terminal restriction fragment length polymorphism 

(T-RFLP) 

T-RFLP is a molecular biology technique for profiling of 

microbial communities based on the position of a 

restriction site closest to a labeled end of an amplified 

gene. The method is based on the digestion of a mixture 

of PCR amplified variants of a single gene using one or 

more restriction enzymes and detecting the size of each 

of the individual resulting terminal fragments using a DNA 

sequencer. The result is a graph image where the X axis 

represents the sizes of the fragment and the Y axis 

represents their fluorescence intensity.


Wang et al. (2010) investigated the communities of 

AOB in activated sludge collected from eight wastewater 

treatment systems in Beijing using polymerase chain 

reaction (PCR) followed by T-RFLP, cloning, and 

sequencing of the α-subunit of the amoA gene. The 

primers amoA-1F (5’-GGG GTT TCT ACT GGT GGT-3’) 

and amoA-2R (5’-CCC CTC KGS AAA GCC TTC TTC-3’) 

were used to amplify a 491 base pairs (bp) fragment of 

the amoA gene of AOB. A Clone library was constructed 

and the software Clustal X 1.81 was used to align 

sequences of the recovered clones with other published 

amoA sequences and software Mega 4.0 was used to 

generate a phylogenetic tree using the neighbor joining 

method. Their results (T-RFLP fingerprint analysis) 

showed that the different wastewater treatment systems 

harbored distinct AOB communities and that the source 

of influent affected the AOB community with the WWTPs 

treating domestic wastewater containing a higher AOB 

diversity than those receiving mixed domestic and 

industrial wastewater. A combination of the results of 

sequencing the amoA gene and the T-RFLP profiles of 

clones clearly indicated which species each peak 

represented. 

The AOB populations in Marshall WWTP (an aeratedanoxic 

Orbal process treating 900 ~ 1,300 m 3 /day of 

domestic wastewater) and Nine Springs WWTP (a 

variation of the UCT process and treats 150,000 ~ 

200,000 m 3 /day of domestic wastewater) with T-RFLP 

was investigated by Park et al (2001). Primers amoA-1F 

and amoA-2R were used to amplify a 491-bp fragment of 

the amoA gene. 

The analysis was complemented by cloning and 

sequencing the amoA gene fragment to detect and 

identify AOB. 

TRFLP is one of several molecular methods aimed to 

generate a fingerprint of an unknown microbial 

community (Liu et al., 1997). Because of its relatively 

high resolution and reproducibility, T-RFLP has been 

widely used to assess the AOB community (Osborn et al., 

2000). 

Other molecular techniques are fluorescent in situ 

hybridization (FISH), restriction fragment length 

polymorphism (RFLP), amplified ribosomal DNA 

restriction analysis (ARDRA), singlestrandedconformation 

polymorphism (SSCP), randomly amplified 

polymorphic DNA (RAPD) or DNA amplification 

fingerprinting (DAF), bisbenzimide-polyethyleneglycol 

(Bb-PEG) electrophoresis, etc. 

Fluorescent in situ Hybridization (FISH) 

FISH (fluorescent in situ hybridization) is a cytogenetic 

technique developed by Christoph Lengauer that is used 

to detect and localize the presence or absence of specific 

DNA sequences on chromosomes. The technique is one 

of the methods that have been described for direct 

visualization of AOB. Hybridization techniques generally 

use directly extracted DNA as a “probe” for specific 

detection of various microorganism species. The 

application of In situ Hybridization approaches to AOB 

has been most effective in detecting AOB that dominate 

total bacterial community in environment such as the 

sewage treatment plants (Wagner et al., 1995). 

Restriction fragment length polymorphism (RFLP) 

RFLP is a technique that exploits variations in 

homologous DNA sequences. Ribotyping (RFLP of rRNA 

genes) combines restriction enzyme digestion of the total 

genomic DNA with a Southern analysis, in which rRNA 

gene-specific DNA probes are used. The hybridization 

pattern obtained is a characteristic of each organism. 

RFLP determines the multiplicity, the arrangement and 

the relative location of rRNA genes in bacterial genomes 

and also contain taxonomic information. Aakra et al. 

(1999) in their study, ribotyped 12 isolates of AOB, and 

the sequences of the 16s-23s rDNA intergenic spacer 

region (ISR) were determined and used in a phylogenetic 

study. 

Amplified ribosomal DNA restriction analysis 

(ARDRA) 

ARDRA is a DNA fingerprint technique based on PCR 

amplification of 16S ribosomal DNA using primers for 

conserved regions, followed by enzyme digestions and 

agarose gel electrophoresis (Smit el al., 1997). 

T-RFLP is different from ARDRA and RFLP in that only 

the terminal fragments (i.e. the labeled end or ends of the 

amplicon) are read and all other fragments ignored 

whereas all restriction fragments are visualized for 

ARDRA and RFLP. 

Singlestranded-conformation polymorphism (SSCP) 

With SSCP, DNA fragments such as PCR products 

obtained with primers specific for the 16S rRNA gene, are 

denatured and directly electrophoresed on a nondenaturing 

gel. Separation is based on differences in the 

folded conformation of single-stranded DNA, which 

influences the electrophoretic mobility. 

Randomly amplified polymorphic DNA (RAPD) and 

DNA amplification fingerprinting (DAF) 

RAPD and a similar approach termed DAF use short (5- 

10 nucleotides) random primers, which anneal at different 

sites of the genomic DNA, generating PCR products of 

various lengths. The products are separated on agarose

Table 1. PCR primers. 

Primers Sequences (5’ 3’) Target Reference 


AmoA-1F-Clamp a GGGGTTTCTACTGGTGGT amoA Nicolaisen and Ramsing (2002) 

AmoA-2R-Clamp a and b CCCCTCKGSAAAGCCTTCTTC amoA Nicolaisen and Ramsing (2002) 

AmoA-2R-KS b CCCCTCKGSAAAGCCTTCTTC amoA Nicolaisen and Ramsing (2002 

AmoA-2R-TS b CCCCTCTGSAAAGCCTTCTTC amoA Nicolaisen and Ramsing (2002) 

AmoA-2R-GS b CCCCTCGGSAAAGCCTTCTTC amoA Nicolaisen and Ramsing (2002) 

AmoA-2R-TC CCCCTCTGCAAAGCCTTCTTC amoA Nicolaisen and Ramsing (2002) 

AmoA-2R-TG CCCCTCTGGAAAGCCTTCTTC amoA Okano et al. (2004) 

AmoA-2R-GC CCCCTCGGCAAAGCCTTCTTC amoA Nicolaisen and Ramsing (2002) 

AmoA-2R-GG CCCCTCGGGAAAGCCTTCTTC amoA Nicolaisen and Ramsing (2002) 

Cren-amoAF ATGGTCTGGCTAAGACGMTGTA amoA Hallam et al. (2006) 

Arch-amoAR GCGGCCATCCATCTGTATGT amoA Francis et al. (2005) 

CTO189f-Clamp a and b GGAGRAAAGYAGGGGATCG 16s rDNA Kowalchuk et al. (1997) 

CTO654r b CTAGCYTTGTAGTTTCAAACGC 16s rDNA Kowalchuk et al. (1997) 

6R AGAAAGGAGGTGATCCAGCC 16s rDNA Dorsch and Stackebrandt (1992) 

7F GCCTTGTACACACCGC 16s rDNA Lane et al. (1985) 

9F GAGTTTGATCCTGGCTCAG Bacteria Dionisi et al. (2003) 

11F TGGCGAAGGCGGCCCCCTGGA 16s rDNA Edwards et al. (1989) 

13R GCCAAGGCATCCACCACATG 23s rDNA Gurtler and Stanisich (1996) 

23SF CCGAATGGGGAAACC 23s rDNA Gurtler and Stanisich (1996) 

23SR CCTTTCCCTCACGGTA 23s rDNA Gurtler and Stanisich (1996) 

1393R ACGGGCGGTGTGTAC Bacteria Dionisi et al. (2003) 

1055F ATGGCTGTCGTCAGCT Bacteria Dionisi et al. (2003) 

341F c TACGGGAGGCAGCAG Bacteria Lopez-Gutierrez et al. (2004) 

518R ATTACCGCGGCTGCTGG Bacteria Lopez-Gutierrez et al. (2004) 

a 

5’ GC-Clamp (CGCCGCGCGGCGGGCGGGGCGGGGGC); 

(CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG). 

or acrylamide gels, and visualized by ethidium bromide or 

silver staining (Muyzer, 1999). 

Bb-PEG Electrophoresis 

Electrophoresis is performed in agarose gels containing 

the DNA ligand bisbenzimide to which long chains of 

polyethyleneglycol (PEG) are covalently coupled. 

Bisbenzimide binds to adenine and thymine (A+T) rich 

sequence motifs in the DNA. Therefore, being loaded 

with the Bb-PEG conjugate, the A+T-rich DNA molecules 

are more retarded in the gel than the molecules which 

are low in A+T, and so separation is achieved (Muyzer, 

1999). 

PCR primers 

Primers are strands of nucleic acid that function as 

starting point for DNA synthesis. Some other PCR 

primers used in several other studies are presented in 

Table 1. Primers are required for DNA replication 

because the enzymes DNA polymerases, which catalyze 

b Degeneracies are shown in bold; 

c 5' GC-clamp 

the process can only add new nucleotides to an existing 

strand of DNA. The polymerase therefore starts 

replication at the 3’-end of the primer, and copies the 

opposite strand. 

Isolation of ammonia oxidizing bacteria 

AOB can be isolated in most aerobic environments where 

ammonia is available through the mineralization of 

organic matter or anthropogenic nitrogen sources, such 

as fertilizers and waste. AOB pure cultures are also 

obtained by picking colonies from a solid medium or by 

the use of dilution methods in liquid culture (Ford et al., 

1980; Schmidt and Belser, 1982). The selective medium 

used must be free of organic carbon sources and contain 

inhibitors of heterotrophic organisms, an ammonia 

source, and essential trace elements (MacDonald and 

Spokes, 1980). AOB are very difficult to handle as a 

result of their slow growth and low maximum growth 

yield, making their isolation and maintenance in pure 

culture difficult and time-consuming. Culture-dependent 

techniques such as selective plating and the most 

probable number (MPN) method have been used for the


enumeration of AOB; however, such techniques are 

thought to underestimate actual cell numbers. In addition 

to medium selectivity and bias, MPN underestimation 

may also stem from inadequate suspension of cells from 

solid substrates in the environmental sample or dispersal 

of flocks and microcolonies. Cell damage due to rigorous 

disruption methods or osmotic shock and the possible 

dependence on inter- or intraspecies interactions for 

growth may also generate inaccuracies (Kowalchuk and 

Steven, 2001). 

Conclusion 

Ammonia has been found to be very dangerous to water 

environment especially to fishes and other aquatic life, its 

high concentration is mostly responsible for this. It is 

therefore necessary to convert ammonia to other nitrogen 

compounds that will have little or no effect on water 

environment. An example of microorganisms widely used 

for this purpose are the AOB, they are used for the 

oxidation of ammonia into nitrite in biological WWTPs. 

AOB are ecologically important, being the only group of 

organisms that oxidize ammonia to nitrite in significant 

amounts, and they appear to be present in all 

environments in which nitrogen is mineralized (Aakra et 

al., 1999). Because these microorganisms display low 

growth rate and high sensitivity to environmental 

disturbances and inhibitor, the physiological activity and 

abundance of AOB in wastewater processing is important 

in the design and operation of waste treatment systems. 

AOB can be isolated in most aerobic environments as 

well as low-oxygen environments. The different 

techniques for the investigation of diversity and 

community structure of AOB are: denaturing gradient gel 

electrophoresis (DGGE), Real-Time PCR, fluorescent in 

situ hybridization (FISH), terminal restriction fragment 

length polymorphism (T-RFLP), restriction fragment 

length polymorphism (RFLP), amplified ribosomal DNA 

restriction analysis (ARDRA), singlestrandedconformation 

polymorphism (SSCP), randomly amplified 

polymorphic DNA (RAPD) or DNA amplification 

fingerprinting (DAF), and bisbenzimidepolyethyleneglycol 

(Bb-PEG) electrophoresis. Among the 

various techniques, DGGE appears to be the most 

frequently used community fingerprinting method. It 

allows a rapid comparison of the microbial communities 

between the samples and is generally used to detect 

shifts in microbial population under different 

environmental conditions. DGGE technique based on 

16S rDNA gene enables the investigation of the spatial 

and temporal variability of the population in environment, 

provide information on the predominant species in a 

community and analyze multiple samples simultaneously. 

However, it should also be noted that none of these 

methods is absolutely perfect; they all have their 

advantages and disadvantages (Muyzer, 1999). Hence, 

only a polyphasic approach combining different molecular 

biological techniques, microbiological methods, and 

methods to determine the environmental parameters will 

lead to an unbiased understanding of the role of 

microorganisms in their environment. 

REFERENCES 

Aakra A, Utaker JB, Nes IF (1999). RFLP of rRNA genes and 

sequencing of the 165-235 rDNA intergenic spacer region of 

ammonia-oxidizing bacteria: a phylogenetic approach. Int. J. Syst. 

Bacteriol., 49: 123-130. 

Akpor OB (2011). Wastewater effluent discharge: Effects and treatment 

processes. 3 rd International Conference on Chemical, Biological and 

Environmental Engineering, IACSIT Press, Singapore. 

Beychok MR (1967). Aqueous wastes from petroleum and 

petrochemical plants (1st ed.). John Wiley & Sons Ltd. LCCN 

67019834. 

Bin Z, Baosheng S, Min J, Huina L (2009). Population dynamic 

succession and quantification of ammonia-oxidizing bacteria in a 

membrane bioreactor treating municipal wastewater. J. Hazardous 

Mater., 165: 796–803. 

Boari G, Mancini IM, Trulli E (1997). Technologies for water and waste 

water treatment. Ciheam-Options mediteraneene, pp 261-287. 

Bohn H (1992). Consider biofiltration for decontaminating gases. Chem. 

Eng. Prog., 88:34–40. 

Brucculeri M, Bolzonella D, Battistoni P, Cecchi F (2005). Treatment of 

mixed municipal and winery wastewaters in a conventional activated 

sludge process: a case study. Wat. Sci. Technol., 51: 89-98. 

Caffrey JM, Bano N, Kalanetra K, Hollibaugh JT (2007). Ammonia 

oxidation and ammonia oxidizing bacteria and archaea from estuaries 

with differing histories of hypoxia. ISME J., 1: 660–662. 

Cho JC, Kim SJ (2000). Increase in bacterial community diversity in 

subsurface aquifers receiving livestock wastewater input. Appl. 

Environ. Microbiol., 66: 956–65. 

Churchouse S (1997). Membrane bioreactors for wastewater treatment 

- operating experiences with the Kubota submerged membrane 

activated sludge process. Membrane Technol., 83: 5-9. 

Ding L, Zhou Q, Wang L, Zhang Q (2011). Dynamics of bacterial 

community structure in a fullscale wastewater treatment plant with 

anoxic-oxic configuration using 16S rDNA PCR-DGGE fingerprints. 

Afri. J. Biotechnol., 10: 589-600. 

Dionisi HM, Hamrs G, Layton AC, Gregory IR, Parker J, Hawkins SA, 

Robinson KG, Sayler GS (2003). Power analysis for real-time PCR 

quantification of genes in activated sludge and analysis of the 

variability introduced by DNA extraction. Appl. Environ. Microbiol., 69: 

6597-6604. 

Dorsch M, Stackebrandt E (1992). Some modifications in the procedure 

of direct sequencing of PCR amplified 16s rDNA. J. Microbiol. 

Methods 16: 271-279. 

Edwards U, Rogall T, Blocker H, Emde M, Bottger EC (1989). Isolation 

and direct complete nucleotide determination of entire genes. 

Characterization of a gene coding for 16s ribosomal RNA. Nucleic 

Acids Res., 17: 7843-7853. 

Erguder TH, Boon BN, Wittebolle L, Marzorati M, Verstraete W (2009). 

Environmental factors shaping the ecological niches of ammonia 

oxidizing archaea. FEMS Microbiol. Rev., 33: 855–869. 

Ford DL, Curchwell RL, Kachtick JW (1980). Comprehensive analysis of 

nitrification of chemical processing wastewaters. J. Water Pollut. 

Control Fed., 52: 2726–45. 

Francis CA, Roberts KJ, Beman JM, Santoro AE, Oakley BB (2005). 

Ubiquity and diversity of ammonia-oxidizing archaea in water 

columns and sediments of the ocean. Proc. Natl. Acad. Sci., 102: 

14683–14688. 

Gujer W, Jenkins D (1975). The contact stabilization activated sludge 

process—oxygen utilization, sludge production and efficiency. Water 

Res., 9: 553-560. 

Gurtler V, Stanisich VA (1996). New approaches to typing and 

identification of bacteria using the 16s-23s rDNA spacer region. 

Microbiol., 142: 3-16.

Hallam SJ, Mincer TJ, Schleper C, Preston CM, Roberts K, Richardson 

PM, DeLong EF (2006). Pathways of carbon assimilation and 

ammonia oxidation suggested by environmental genomic analyses of 

marine crenarchaeota. PLoS Biol., 4: e95. 

Harms G, Layton AC, Dionisi HM, Gregory IR, Garrett VM, Hawkins SA, 

Robinson KG, Sayler GS (2003). Real-time PCR quantification of 

nitrifying bacteria in a municipal wastewater treatment plant. Environ. 

Sci. Technol., 37: 343–351. 

Henze M (1996). Biological phosphorus removal from wastewater: 

processes and technology. Water Quality International, pp 32-36. 

Hornek R, Pommerening-Roser A, Koops HP, Farnleitner AH, 

Kreuzinger N, Kirschner A, Mach RL (2006). Primers containing 

universal bases reduce multiple amoA gene specific DGGE band 

patterns when analysing the diversity of beta-ammonia oxidizers in 

the environment. J. Microbiol. Methods 66: 147–155. 

Jelena R, Marin M, Ivan M, Mira P, Damià B (2007). Membrane 

Bioreactor (MBR) as an Advanced Wastewater Treatment 

Technology. Hdb. Env. Chem., 5: 37–101. 

Jin T, Zhang T, Yan Q (2010). Characterization and quantification of 

ammonia-oxidizing archaea (AOA) and bacteria (AOB) in a nitrogenremoving 

reactor using T-RFLP and qPCR. Appl. Microbiol. 

Biotechnol., 87: 1167–1176. 

Jorgensen TC, Weatherley LR (2003). Ammonia removal from 

wastewater by ion exchange in the presence of organic 

contaminants. Water Res., 37: 1723-1728. 

Joshi JA, Hogan JA, Cowan RM, Strom PF, Finstein MS (2000). 

Biological removal of gaseous ammonia in biofilters: space travel and 

earth-based applications. J. Waste Manage. Assoc., 50: 1647–54. 

Kowalchuk GA, Stephen JR (2001). Ammonia-oxidizing bacteria: a 

model for molecular microbial ecology. Annu. Rev. Microbiol., 55: 

485–529. 

Kowalchuk GA, Stephen JR, De Boer W, Prosser JI, Embley TM, 

Woldendorp JW (1997). Analysis of ammonia-oxidizing bacteria of 

the beta subdivision of the class Proteobacteria in coastal sand 

dunes by denaturing gradient gel electrophoresis and sequencing of 

PCR-amplified 16S ribosomal DNA fragments. Appl. Environ. 

Microbiol., 63: 1489–1497. 

Lane DJ, Pace B, Olsen GJ, Stahl DA, Sogin ML, Pace NR (1985). 

Rapid determination of 16s ribosomal RNA sequences for 

phylogenetic analyses. Proc. Natl. Acad. Sci., 82: 6955-6959. 

Larsdotter K (2006). Microalgae for phosphorus removal from 

wastewater in a Nordic climate. Doctoral Thesis from the School of 

Biotechnology, Royal Institute of Technology, Stockholm, Sweden, 

ISBN: 91-7178-288-5. 

Limpiyakorn T, Sonthiphand P, Rongsayamanont C, Polprasert C 

(2011). Abundance of amoA genes of ammonia-oxidizing archaea 

and bacteria in activated sludge of full-scale wastewater treatment 

plants. Biores. Technol., 102: 3694–3701. 

Liu W, Marsh T, Cheng H, Forney L (1997). Characterization of 

microbial diversity by determining terminal restriction fragment length 

polymorphisms of genes encoding 16S rRNA. Appl. Environ. 

Microbiol., 63: 4516-4522. 

Lopez-Gutierrez JC, Henry S, Hallet S, Martin-Laurent F, Catroux G, 

Philippot L (2004). Quantification of a novel group of nitrate-reducing 

bacteria in environment by real-time PCR. J. Microbiol. Methods 57: 

399-407. 

Lowe WL, Gaudy AF (1989). Modified extended aeration process for 

removal and recovery of cadmium from wastewaters. Biotechnol. 

Bioeng., 34: 600-608. 

MacDonald RM, Spokes JR (1980). A selective and diagnostic medium 

for ammonia oxidizing bacteria. FEMS Microbiol. Lett., 8: 143–45. 

Marcos S (2007). Activated sludge and aerobic biofilm reactors. 

Biological Wastewater Treatment Series, IWA Publishing, Alliance 

House, 12 Caxton Street, London SW1H 0QS, UK, pp 1-313. 

Maryam TR, Tahereh K, Ali K (2009). Application of membrane 

separation processes in petrochemical industry: a review. 

Desalination 235: 199–244. 

McTavish H, Fuchs JA, Hooper AB (1993). Sequence of the gene 

coding for ammonia monooxygenase in Nitrosomonas europaea. J. 

Bacteriol., 175: 2436-2444. 

Meincke M, Kreig E, Bock E (1989). Nitrosovibrio spp., the dominant 

ammoniaoxidizing bacteria in building stones. Appl. Environ. 


Microbiol., 55: 2108–10. 

Metcalf, Eddy (1991). Wastewater Engineering. Treatment, disposal, 

reuse. 3rd edition, McGraw-Hill Int. Ed., Singapore. 

Middlebrooks EJ, Sherwood CR, Abraham P, Adams VD (1999). 

Nitrogen removal in wastewater stabilization lagoons, Presented at 

6th National Drinking Water and Wastewater Treatment Technology 

Transfer Workshop Kansas City, Missouri 64105. p. 38. 

Muyzer G (1999). Genetic fingerprinting of microbial communities – 

present status and future perspectives. Proceedings of the 8th 

International Symposium on Microbial Ecology Bell CR, Brylinsky M, 

Johnson-Green P (ed) Atlantic Canada Society for Microbial Ecology, 

Halifax, Canada, 10pp. 

Muyzer G, De Waal EC, Uitterlinden AG (1993). Profiling of complex 

microbial population by denaturing gradient gel electrophoresis 

analysis of polymerase chain reaction-amplified genes coding for 16S 

rRNA. Appl. Environ. Microbiol., 59: 695-700. 

Nicolaisen MH, Ramsing NB (2002). Denaturing gradient gel 

electrophoresis (DGGE) approaches to study the diversity of 

ammonia-oxidizing bacteria. J. Microbiol. Meth., 50: 189-203. 

Okabe S, Satoh H, Watanabe Y (1999). In situ analysis of nitrifying 

biofilms as determined by in situ hybridization and the use of 

microsensors. Appl. Environ. Microbiol., 65: 3182–3191. 

Okano Y, Hristova KR, Leutenegger CM, Jackson LE, Denison RF, 

Gebreyesus B, Lebauer D, Scow KM (2004). Application of real-time 

PCR to study effects of ammonium on population size of ammoniaoxidizing 

bacteria in soil. Appl. Environ. Microbiol., 70: 1008–1016. 

Osborn AM, Moore ERB, Timmis KN (2000). An evaluation of terminalrestriction 

fragment length polymorphism (TRFLP) analysis for the 

study of microbial community structure and dynamics. Environ. 

Microbiol., 2: 39–50. 

Painter HA (1986). Nitrification in the treatment of sewage and 

wastewaters. Spec. Publ. Soc. Gen. Microbiol., 20: 185–213. 

Park HD, Regan JM, Noguera DR (2001). Molecular analysis of 

ammonia-oxidizing bacterial populations in aerated-anoxic orbal 

processes. IWA Conference on microorganisms in activated sludge 

and biofilm processes, Rome. 

Park TJ, Lee HK, Kim SD, Kim WC (1996). Petrochemical wastewater 

treatment with aerated submerged fixed-film reactors (ASFFR) under 

high organic loading. Water Sci. Technol., 34: 9-16. 

Purkhold U, Pommerening-Roser A, Juretschko S, Schmid MC, Koops 

HP, Wagner M (2000). Phylogeny of all recognized species of 

ammonia oxidizers based on comparative 16S rRNA and amoA 

sequence analysis: implications for molecular diversity surveys. Appl. 


Schmidt EL, Belser LW (1982). Nitrifying bacteria. in Methods of soil 

analysis, part 2. Chemical and microbiological properties. ed Page A. 

(American Society of Agronomy, Inc., Crop Science Society of 

America, Inc., and Soil Science Society of America, Inc. Madison, 

Wis), pp 1027–1042. 

Smit E, Leeflang P, Wernars K (1997). Detection of shifts in microbial 

community structure and diversity in soil cause by coper 

contamination using amplified ribosomal DNA restriction analysis. 

FEMS Microbiol. Ecol., 23: 249-261. 

Sonthiphand P, Limpiyakorn T (2010). Communities of ammoniaoxidizing 

archaea and bacteria in enriched nitrifying activated sludge. 

World Acad. Sci. Eng. Technol., 64: 425-428. 

Sotirakou E, Kladitis G, Diamantis N, Grigoropoulou H (1999). Ammonia 

and phosphorus removal in municipal wastewater treatment plant 

with extended aeration. Global Nest: the Int. J., 1: 47-53. 

Thomas ES (2005). Biological wastewater treatment. Chemical 

engineering magazine, Access Intelligence, LLC, pp 1-6. 

Van der Hoek W (2004). A frame work for a global assessment of the 

extent of wastewater irrigation: The need for a common wastewater 

typology. In: Scott CA, Faruqui NI, Raschid-Sally L (eds.). 

Wastewater use in irrigated agriculture: Confronting the livelihood 

and environmental realities. CABI Publishing, Wallingford, IWMI, 

Colombo, IDRC, Ottawa, pp 11-24. 

Wagner M, Rath G, Amann R, Koops HP, Schleifer K (1995). In situ 

identification of ammonia oxidizing bacteria. Syst. Appl. Microbiol., 

18: 251-264. 

Wang X, Wen X, Criddle C, Wells G, Zhang J, Zhao Y (2010). 

Community analysis of ammonia oxidizing bacteria in activated


sludge of eight wastewater treatment systems. J. Environ. Sci., 22: 

627–634. 

wastewater stabilization lagoons, Presented at 6th National Drinking 

Water and Wastewater Treatment Technology Transfer Workshop 

Kansas City, Missouri 64105. 38pp. 

Wood PM (1986). Nitrification as a bacterial energy source, Nitrification 

Spec. Publ. Soc. Gen. Microbiol., IRL Press, Oxford. 20: 39-62. 

Ye L, Zhang T (2011). Ammonia-oxidizing bacteria dominates over 

ammonia-oxidizing archaea in a saline nitrification reactor under low 

DO and high nitrogen loading. Biotechnol. Bioeng,, 108: 2544-2552.




DOI: 10.5897/AJMR11.351 


Purification and Characterization of 56 KDa cold active 

Protease from Serratia marcescens 

A. L. TARIQ*, A. L. REYAZ and J. JOHN PRABAKARAN 

Department of Biotechnology, K.S.R College of Arts and Science Autonomous, Tiruchengode-637215, Tamilnadu, India. 

Accepted 30 July, 2011 

The extracellular cold active protease produced from Serratia marcescens TS1. The protease was 

purified to homogeneity from the production medium by ammonium sulphateation then followed by 

acetone precipitation with 80% saturation. The cold active protease was fractionized by 

diethylaminoethyl (DEAE) cellulose column chromotography. The molecular weight of protease was 

approximately 56 KDa. The isoelectric point was close to 6.4. The maximal activity towards casein was 

found at 40°C and its pH activity was at 8.0. The protease was strongly inactivated by HgCl2 metal ion 

and reactivated by FeSO4 thus indicated as metalloprotease. The protease was inhibited by Na2 

ethylenediaminetetraacetic acid (EDTA). The protease of S. marcescens TS1 showed a potential 

application in the laundry industry by removeing the blood, chocolate and egg youlk stains from the 

white cotton cloths in a short period without changing texture of cloths. 

Key words: Cold active Protease, S. marcescens TS1, extracellular protease, metalloprotease, laundry 

application. 

INTRODUCTION 

Serratia marcescens is a gram-negative bacteria 

belonging to the genus Serratia and family 

enterobacteriaceae (Grimont and Grimont, 2006). The 

protease secreted by Serratia marcescen was purified by 

thin layer chromatography (Matsuyama et al., 1986). The 

advance in biotechnological techniques and enzyme 

engineering paves way for industrial application of 

protease (White et al., 1973). Proteolytic enzymes from 

microorganisms may be located within the cell or 

excreted into the media (Kohlman et al., 1991). 

Proteases added to laundry detergent enable to release 

the proteinaceious materials from stained cloths (Masse 

and Tilburg, 1983). In addition it improves washing 

efficiency allows shorter period of agitation, often after a 

preliminary period of soaking (Nielsen et al., 1981; 

Demidyuk et al., 2008). Many other keratinolytic alkaline 

proteases were used in feed technology for the 

production of peptides for degrading waste keratinous 

materials in bathtub and drains in public places (Takami 

*Corresponding author. E-mail: tariqtasin@gmail.com. 

et al., 1992). It is now firmly established that enzymes in 

organic solvents can expand the applications of 

biocatalysts in synthetic chemistry (Zaks and Kilbanov, 

1984; Zaks, 1991). Some studies have demonstrated the 

possibility of using alkaline protease to catalyse peptide 

synthesis in organic solvents (Golobov et al., 1994). The 

mechanism in each case is the ability of an enzyme to 

cleave or cut proten target in to two or more pieces 

usually at a very specific cleavage sites (Mazzone et al., 

1990). 


Bacterial strains 

The psychrotrophic bacterial strain S. marcescens TS1 screened 

from the soil of dense apple garden around Badran Magam in 

Ksahmir at altitude of 1630 meters above the sea level. The 

bacterial strain was grown at 15°C for 24 h in casein enzyme 

hydrolysate medium (Rifaat et al., 2007). The strain TS1 has the 

high proteolytic activity was identified by morphological and 

biochemical test. Then confirmed based on 16s ribosomal 

deoxyribonucleic acid (rDNA) gene sequence which were submitted 

to the Gene Bank and compared with other bacteria by


phylogenetic analysis. 

Enzyme production 

The cold active protease was produced by following a method of 

Salamone and Wodzinski (1997) using the enzyme production 

medium Tryptone-yeast extract glucose broth containing: Tryptone 

5 g/L, Yeast extract 2.5 g/L, Glucose 1 g/L and pH 7.2. For the 

study of protease production 250 ml of medium was poured into 

1000 ml of Erlenmeyer flask capacity, were sterilized at 121°C for 

15 min. 

After cooling 0.5 ml of stationary phase culture of strain TS1 was 

inoculated and incubated on shaker at 28°C for 48 h. 

Enzyme purification 

The cold active protease was purified by following method of 

Matsumato et al. (1984) from culture broth by centrifuged at 8,944 

×g for 20 min at 4°C. The supernatant was collected and filtered 

through membrane filter having porosity of 0.022 μm at 4°C. To the 

supernatants ammonium sulphate was added slowly with 

continuous string to the final concentration of 80% saturation. The 

enzyme solution was allowed to stand for 24 h at 4°C and 

centrifuged at 8,944 ×g for 20 min. The precipitate was 

resuspended in 50 mM Tris HCl having pH 8.0 and further 

precipitated with acetone by adding slowly to the final concentration 

80% saturation and left for 1 h at 4°C. The pellet was obtained by 

centrifugation at 8,944 ×g for 20 min at 4°C and resuspended in 20 

mM Tris HCl pH 8.0 then dialyzed against 500 ml of 5 mM Tris-HCl 

pH 8.0 containing 1 mM MgCl2 over night at 4°C with stirring 

conditions. The dialyzate was centrifuged at 5,724 ×g for 20 min at 

4°C and supernatant were subjected to diethylaminoethyl (DEAE) - 

cellulose anion exchange column chromatography equilibrated with 

10 mM Tris-HCl buffer pH 8.3. The 15 ml of dialysate eluted with 10 

mM Tris-HCl buffer pH 8.3 at the flow rate of 20 ml/h. A linear 

gradient consisting of 50 ml of 10 mM Tris-HCl buffer pH 8.3 and 50 

ml of the same buffer with 0.3 M NaCl. The 5ml of fractions elute 

was collected and absorbance measure at 280 nm and enzyme 

activity was determined. 

Determination of protein content and assay of proteolytic 

activity 

The protein concentration of strain TS1 was determined by the 

method of Lowry et al. (1951) by taking bovine serum albumin as 

standard. The proteolytic activity was determined by following a 

method of Kunitz (1947) using casein as substrate. The substrate 

contained 3.75 ml of 1.0% casein in 100 mM Tris-HCl and 1 mM 

MgCl2 at pH 8.0. The 0.5 ml of protease sample was added to the 

substrate and incubated for half an hour at 30°C. After incubation, 

the reaction was quenched with 0.5 ml of 10% trichloro acetic acid. 

The quenched reaction mixture was centrifuged at 10000 rpm for 

10 min to pellet precipitated protein and absorbance for the 

supernatant was determined at 280nm. One unit of proteolytic was 

defined as the amount of enzyme that produced an increase of 

absorbance at 280 nm of 0.1 under the conditions of the assay. 

Molecular weight determination by sodium dodecyl sulfate 

polyacrylamide gel electrophoresis (SDS-PAGE) 

The molecular weight of the protein in strain TS1 was determined 

by the method of Laemmli et al. (1970) staining the protein with 

10% methanol, 7% acetic acid and 0.2% coomassie brilliant blue for 

4 h and destained with 10% methanol, 25% acetic acid solution for 

12 h. The molecular weight analysed by calculated the distance 

travelled by the protein marker and distance travelled by the 

sample. 

Isoelectric focusing of protein 

The isoelecric focusing of purified protease of strain TS1 was 

determined using mini-gel system (Robertson et al., 1987). The gel 

was placed in staining solution for 30 min and destained for one 

hour. The bands were observed in white light transilluminator. 

Effect of temperature on protease activity 

A 0.2 ml of cold acive protease of strain TS1 was added to the 

substrate mixture containing 1.5 ml of 1.0% (w/v) casein in 100 mM 

Tris-HCl in 1 mM MgCl2 at pH 8.0 and incubated at 25, 30, 35, 40, 

45, 50, 55, 60°C for 1 h. After the incubation, the proteolytic activity 

was determined by the protease assay, an optical density was 

measured at 280 nm. 

Effect of pH on protease activity 

A 0.2ml of cold acive protease of strain TS1 was added to the 

substrate mixture containing 1.5ml of 1% (w/v) casein, and 0.1 mM 

MgCl2 in various buffers. Such as Glycine-HCl buffer having pH 2.0, 

2.5, 3.0, 3.5, Acetate buffer having pH 4.0, 4.5, 5.0, 5.5, phosphate 

buffer having pH 6.0, 6.5, 7.0, Tris- HCl buffer having pH 7.5, 8.0, 

8.5, 9.0 and carbonate bicarbonate buffer having pH 9.5, 10.0, 

10.5, 11.0 and incubated at 37°C for 60 min. After incubation the 

proteolytic activity was determined by the protease assay. 

Effect of metal ions on protease activity 

A 0.2 ml of cold acive protease of strain TS1 was added to the 1.5 

ml of 0.1 M Tris-HCl pH 7.5 and to the same buffer supplemented 

with 100 �l of 8.3 mM of metal ions viz MgSO4, MnCl2, CaCl2, 

CuSO4, FeSO4, HgCl2 and ZnCl2 and mixtutes were incubated at 

room temperature 25°C for 30 min and proteolytic activity was 

determind by protease assay. In addition the purified protease 

sample preparation (200 �l/ml) was incubated for 30 min at 25°C in 

0.1 M acetate buffer having pH5 5.0 supplemented with (100 μl/ml) 

Na2EDTA and protease activity was determined by protease assay. 

Effect of inhibitors on protease activity 

A 0.2 ml of cold acive protease of strain TS1 preparation was 

added in to 1.5 ml of 0.1 M tris- hydrochloride buffer having pH 7.5 

and to the same buffer supplemented with 100 μl of various 

inhibitors 20 mM Na2EDTA, 8.3 mM iodioacetic acid, 8.3mM 

dithiothreitol, 8.3 mM leupeptin, 1% of 2 �-mercaptoethanol, 1% of 

tween-20 and 3% of ethanol and mixtutes were incubated at 25°C 

for 30 min and proteolytic activity was determind by protease assay. 

Assessment of detegent additive role of protease in laundry 

industry 

The application of cold active protease strain TS1 as detergent 

addivites in the laundry industry (Masse and Tillburg, 1983) was 

carried out by taking 100µl/ml of protease strain TS1 and 200mg/ml 

of wheel detergent on white cotton cloth pieces (10 ×10 cm) stained 

with human blood, chocolate and egg yolk. The stained clothes 

incubated at room temperature for 4 h and washed with water

Table1. Purification of Protease from S. marcescens TS1 in the supernatants of tryptone yeast extract glucose medium. 

S/N Purification 

Stage 

1 Cell free culture 

supernatant 

Ammonium 

2 

Sulphate fraction 

Volume 

(ml) 

Protein conc. protein 

(mg/ml) 

Total 

(mg) 

Activity 

(U/ml) 

Specific activity 

(U/mg) 

Total Recover 

activity (U) 

Tariq et al. 5843 

Purification 

fold 

2500 0.9 2250 864 960 2160000 1 100 

200 4.5 900 7890 1753.3 1578000 1.9 92 

3 Acetone fraction 50 5.9 295 23800 4033.8 1190000 4.2 70 

4. Dialysis 100 0.6 60 3950 6583.3 395000 6.9 60 

5. DEAE cellulose Fraction 50 0.3 15 2840 9466.6 142000 9.9 51 

then result was noted. 

RESULTS 

Bacterial soil isolate 

The total 211 strains were isolated from the soil 

and the potential cold actine proteolytic strain TS1 

was found gram negative rod shaped bacterium, 

non-flagellated, non motile, non endospore 

former. The colony morphological appreance 

found red pigmented convex, transparent in 

nature. The biochemical tests showed indole 

negative, methyl red negative, vogues proskauer 

positive and citrate positive, bacteria does not 

produce hydrogen sulphide gas. 16s rDNA gene 

sequences confirmed that it belongs to S. 

marcescens therefore this bacterium named as S. 

marcescens TS1 under Gene Bank ACC. No. 

GU046543. 

Enzyme purification 

The purification process showed that 80% 

ammonium sulphate saturation had precipitated 

the protease in the solution by salt out mechanism 

and further recovered with 80% acetone 

saturation. The dialysed cold active precipitated 

protease of S. marcescens strain TS1 

fractionalised by DEAE Cellulose anion 

exchanged chromatography with 10 mM Tris HCl 

buffer pH 8.3 were shown in Table 1. 

Determination of protein content and 

proteolytic activity of protease enzyme 

The proteolytic activity was 83.84 IU/ml in casein 

as substrate. The molecular weight of protease S. 

marcescens strain TS1 was found approximately 

56 KDa protein band when observed under white 

transilluminator (Figure 1) and isoelectric point 

was 6.4 in an ampholyte buffer having pH ranges 

from 2.0 to 11.0 (Figure 2). 

Effect of temperature on protease activity 

The maximium temperature for the cold active 

protease of S. marcescens TS1 was 20°C in 100 

mM Tris HCl buffer as shown in Figure 3. The 

activity declined rapidly above 25°C and was 

(%) 

negligible above 50°C. The enzyme retained its 

82% activity at 25°C when temperature increased 

the enzyme activity decreases rapidly and lost at 

50°C. 

Effect of pH on protease activity 

The hydrogen ion concentration of cold active 

protease S. marcescens strain TS1 was 8.5 with a 

sharp decrease in activity above pH 9.0. The 

protease had half maximal activity near pH 7.5 

and exhibited a little activity below pH 3.5. The 

protease retained its maximum activity from pH 

6.5 to 9.0 (Figure 4). 

Effect of metal ions on protease activity 

The metal ions have altered the protease activity 

of S. marcescens strain TS1. The HgCl2 and 

Na2EDTA have inactivated the protease at both 

pH 8.5 and pH 6.5. The protease have retained 

maximum activity in FeSO4, MgSO4, ZnCl2 and 

minimum activity in MnCl2, CaCl2, CuSO4 and lost 

its activity in HgCl2 and Na2EDTA (Table 2). The 

data indicates that cold active proteases of the S.


97 

85 

75 

70 

66 

55 

40 

L1 L2 

56 TS1 

Figure 1. Determination of molecular weight of proteases by 

ure 1. Determination sodium dodecyl of molecular sulphate weight agarose of gel proteases electrophoresis. by sodium L1— dodecyl sulphate agarose 

electrophoresis. Molecular marker mass standards: phosphorylase b (97 kDa), 

20, 25, 30, 35, 40, 45, 50 and 55°C for 30 min. The Serratia 

—Molecular tyrosine marker (85 mass kDa), standards: acid phosphate phosphorylase (75 kDa), b (97 bovine kDa), serum 

marcescens strain TS1 showed maximum activity at optimum 

tyrosine (85kDa), acid 

albumin (66 kDa), glutamic dehydrogenase (55 kDa) and 

25°C. 

sphate (75kDa), aldolase bovine (40 kDa), serum L2--Protease albumin (66 sample kDa), of glutamic S. marcescens dehydrogenase TS1 (55 kDa) and 

olase (40 kDa) (56 kDa). 

--Protease sample of S. marcescens TS1 (56kDa) 

showed the resistant against the all inhibitors except 20 

L2 L1 M 

mM EDTA. The protease retained 80% activity in 

iodioatic acid, 83% activity in 2-mercaptoethanol, 90% 

activity in tween 20, 87% activity in 3% ethanol, 73% 

activity in leupeptin but lost its activity in 20 mM EDTA 

9.6 

(Table 3). 

marcescens strain TS1was to be a metalloprotease 

because inactivated by the Na2EDTA and reactivated by 

the Mg 2+ , Fe 2+ , Zn 2+ is due to increase in the absorbance 

value at 280 nm and their residual enzyme activity. 

Effect of inhibitors on protease activity 

The cold active protease of S. marcescens strain TS1 

8.3 

Figure 3. Effect of Temperature on protease activity was 

examined in 100 mM Tris-HCl buffer having pH 8.0 at 5, 10, 15, 

Detergent application 

6.5 

There was the litte blood stain in the white cotton cloth 

which was treated with detergent only but the blood stain 

was completely removed from the white cotton cloths 

4.5 

which were treated with both detergent and protease of 

S.marcescens strain TS1. In case of chocklate and egg 

3.6 

yolk there was a stains even when treated with detergent 

but completely removed when treated with both detergent 

and protease of S. marcescens strain TS1. Thus 

Figure 2. Isoelectric focusing 

indicated that protease in presence of detergent removed 

2 . Isoelectric focusing electrophoretogram, electrophoretogram, pH 2.0 to 11.0 pH stained 2.0 to with 11.0 stained with coomassie blue. 

coomassie blue. M—Isoelectric focusing 

the stains completely from white cotton cloth pieces 

oelectric focusing standards: amyloglucosidase (pI 3.6), trypsin inhibitor (pI 4.5), carbonic 

standards: amyloglucosidase (pI 3.6), trypsin 

(Figure 5). 

ase II (pI 6.5), lentil inhibitor lectin (pI 4.5), (pI 8.3) carbonic and anhydrase ribonuclease II (pI A 6.5), (pI 9.6) 

L2--Serratia marcescens lentil lectin TS1 (pI 8.3) showing and ribonuclease pI 6.4 A (pI 9.6), 

L1 and L2--Serratia marcescens TS1 showing pI 

DISCUSSION 

6.4. 

The S. marcescens strain TSI secreates large 

extracellular enzyme protease in the surrounding medium 

(Yanagida et al., 1988). The production was stoped at 

early stationnary phase at that time maximium protease 

was produced (Henriette et al., 1993). The 80% 

ammonium sulphate saturation leads the precipitation of 

the protease at 4°C and fractional precipitation with 

acetone (Salamone and Wodzinski, 1997). The excess 

salt removed from protease by means of a dialysis 

(Morita et al., 1997). The dialyzate of S. marcescens 

strain TS1 purified by ion exchange chromatography

Enzyme Activity IU/ml 

60 

50 

40 

30 

20 

10 

0 

Effect of Hydrogen ion concentration 

Figure 4. Effect of pH on protease activity was examined in various buffers such as 

Glycine-HCl buffer having pH 2.0 to 3.5, Acetate buffer having pH 4.0 to 5.5, Phosphate 

buffer having pH 6.0 to7.0, Tris-HCl buffer having pH 7.5 to 9.0 and Carbonate-Bicarbonate 

buffer having pH 9.5 to 11.0 at 30°C for 30 min. The pH optimum of Serratia marcescens 

strain TS1 was at pH 8.5 Tris-HCl buffer. 

Table 2. Effect of metal ions on protease activity was examined in 8.3 mM 

of MgSO4, MnCl2, CaCl2, CuSO4, FeSO4, HgCl2 and ZnCl2 in 0.1 M Tris- 

HCl buffer having pH 7.5 at 25°C for 30 min. The metal ions HgCl2 and 20 

mM Na2EDTA have inactivated the protease of Serratia marcescens TS1. 

S/n Metal ion Residual protease activity (%) 

1 Native protease 100 

2 FeSO4 81 

3 MnCl2 22 

4 CaCl2 15 

5 CoSO4 11 

6 ZnCl2 70 

7 MgSO4 78 

8 HgCl2 00 

9 Na2EDTA 00 

Table 3. Effect of inhibitors on protease activity was examined in 20 mM EDTA, 8.3 

mM Iodioacetic acid, 8.3 mM Dithiothreitol, 8.3 mM Leupeptin, 1% of 2- β 

Mercaptoethanol, 1% of Tween 20 and 3% of ethanol in 0.1 M Tris-HCl having pH 

7.5 at 25°C for 30 min. The protease of Seratia marcescens strain TS1 was 

inactivated completely by 20 mM EDTA. 

S/N Inhibitor Residual protease activity (%) 

1 Native protease 100 

2 Iodioacetic acid 80 

3 2- Mercaptoethanol 83 

4 Tween 20 90 

5 3% Ethanol 8 

6 Dithiothreitol 73 

7 Leupeptin 82 

8 20 mM EDTA 00 

Tariq et al. 5845


relied on the attraction between oppositely charged 

particles. The net charge exhibited by these compounds 

was depends on their pka and pH of the solution. The 

proteolytic activity was determined by using casein as 

substrate (Kunitz, 1947) in Tris HCl buffer pH 8.0 showed 

the protease activity of 83.84 IU/ml. The purified 

exocellular protease turned out to be one polypeptide 

chain with a molecular weight of 56 KDa averages of the 

values obtained by SDS-PAGE (Laemmli, 1970). The 

isoelectric point of protease S. marcescens strain TS1 

was 6.4 (Robertson et al., 1987). As proteins are differing 

in the composition each and every protein has its own 

characteristic p I value. The optimal timperature of 

protease S. marcescens strain TS1was 40°C in Tris HCl 

buffer containing MgCl2 having pH 8.0. The protease 

activity lost when temperature increased at 60°C there 

was neglible activity. The protease activity was neglible 

when temperature increased from mesophilic bacteria is 

around 60°C (Boguslawski et al., 1983). A psychrotrophic 

Pseudomonas fluorescens 114 produced a protease with 

an optimal temperature of 35°C (Hamamoto, 1994), 37°C 

an antarctic yeast (Ray et al., 1992) and 40°C by 

psychrophilic vibrio sp. strain 5709 (Hamamoto et al., 

1995). The pH characteristics of cold proteases S. 

Figure 5. Washing test of protease Serratia marcescens strain TS1. 

1. A. Blood stained cotton cloth, B. Washed with detergent wheel only, 

C. Washed with both wheel detergent and protease of Serratia 

marcescens TS1 

II. A. Chocolate stained cotton cloth, B. Washed with wheel detergent 

only, C. Washed with both protease of Serratia marcescens TS1 and 

wheel detergent. 

III. A. Egg yolk stained cotton cloth, B. Washed with wheel detergent 

only, C. Washed with both protease of Serratia marcescens TS1 and 

detergent. 

marcescens strain TS1 showed high enzyme activity 

between 6.5 to 9.0 and maximum at 8.5 in Tris HCl buffer 

(Lyerly and Kreger, 1979). The metals ions HgCl2 and 

Na2EDTA completely inactivated the protease activity 

(Matsumoto et al., 1984) and reactivated by Mg 2+ , Fe 2+ , 

Zn 2+ and Mn 2+ are essential for the enzyme activity so 

named as metallprotease (Aiyappa and Haris, 1976). The 

20 mM EDTA inhibited the enzyme activity completely 

while as other inhibiters did not showed much impact on 

enzyme activity. The potease of S. marcescens TS1 

acted on the stains and degraded the protein bonds 

among the proteins present in the blood, chocolate, and 

egg yolk (Masse and Tilburg, 1983). The increased 

usage of these proteases as detergent additives is mainly 

due to the cleaning capabilities of these enzymes, 

environmentally acceptable and non phosphate 

detergents. 

Conclusion 

The cold active protease of Serrratia marcescens strain 

TS1found to more active to remove the dirts and stains 

from the clothes at low temperature in a short time

without damaging the nature of the cloth. So the 

economic values and enhencer actions will be boom to 

the detergent industry as detergent additives. 

REFERENCES 

Aiyappa PS, Harris JO (1976). The extracellular metalloprotease of 

Serratia marcescens: I. Purification and characterization. Mole 

Cellular Biochem., 13(2): 95-100. 

Boguslawski G, Shults JL, Yehle CO (1983). Purification and 

characterization of an extracellular protease from flavobacterium 

arborescens. Anal. Biochem., 132: 41-49. 

Demidyuk IV, Gasanov EV, Safina DR, Kostrov SV (2008). Structural 

organization of precursors of Thermolysin-like proteinases. J. 

Protein., 27: 343–354. 

Golobov MY, Stepanov VM, Voyushina TL, Morozoea IP, Adlvereutz P 

(1994). Side reactions in enzymatic peptide synthesis in organic 

media; Effect of enzyme, solvent and substrate concentration. Enzy. 

Micrbial Technol., 16:522-528. 

Grimont F, Grimont PAD (2006). The Genus Serratia. J. Prokaryotes., 

6:219-244. 

Hamamoto T, Kaneda M, Horikoshi K, Kudo T (1994). Characterization 

of a protease from psychrotroph, Pseudomonas fluroescens 114. 

Appl. Envinron. Microbiol., 60: 3878-3880. 

Hamamoto T, Kaneda M, Kudo T, Horikoshi K (1995). Characterization 

of protease from psychrophilic Vibrio sp. strain 5709. J. Mar. 

Biotechnol., 2: 219 -222. 

Henriette C, Zinebi S, Aumaitre MF, Petitdemange E, Petitdemange H 

(1993). Protease and lipase production by a strain of S. marcescens 

(532 S). J. Indstrl. Microbiol., 12:129-135. 

Kunitz M (1974). Crystalline soybean trypsin inhibitor.II.General 

properties. J. Gen. Physiol., 30:291-297. 

Laemmli UK (1970). Clearage of structural proteins during the assembly 

of the head of bacteriophage. J. T. Nat., 227: 680– 685. 

Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951). Protein 

measurement with the Folin phenol reagent. J. Biol. Chem., 193: 265- 

275. 

Lyerly D, Kreger A (1979). Purification and characterization of a S. 

marcescens metalloprotease. J. Infect. Immunity., 24(2): 411-421. 

Masse FWJ, Tilburg RV (1983). The benfit of detergents enzymes 

under changing washind conditions. J. Oil Chem. Soci., 60: 1672- 

1675. 

Matsumoto KMH, Takata K, Kamata R, Okamura R (1984). Purification 

and characterization of four proteases from clinical isolates of S. 

marcescens kums 3958. J. Bacteriol., 157(11): 225-232. 

Tariq et al. 5847 

Matsuyama T, Murakami T, Fujita M, Fujita S, Yano I (1986). 

Extracellular vesicle formation and biosurfactant production by 

Serratia marcescens. J. Genrl. Microbiol., 132: 865-875. 

Mazzone M, Catalani M, Costanzo D (1990). Evaluation of Serratia 

peptidase in acute or chronic inflamation of otorhinolaryngology 

pathology: a multicentre, double-blind, randomized trial verses 

placebo. J. Int. Med. Res., 18(5): 379-388. 

Morita Y, Kondoh K, Quamaral H, Sakaguchi T, Murakami Y, 

Yokoyama K, Tamiya E (1997). Purification and characterization of a 

cold-active protease from psychrotrophic S. marcescens AP3801. 

J.A.O.C.S., 74: 1377-1383. 

Nielsen MH, Jenson SJ, Outtrup H (1981). Enzymes for a low 

temperature washing. J. Amr. oil Chem. Soci., 58:644-649. 

Ray MK, Devi KU, Kumar GS, Shivaji S (1992). Extracelluar protease 

from the Antarctic yeast candida humicola, Ibid., 58: 1918 – 1923. 

Rifaat HM, Said OHE, Hassanein SM, Selim MSM (2007). Protease 

activity of some mesophilic Streptomycetes isolated from Egyptian 

habitats. J. Cultu. Collection., 5:16-24. 

Robertson EF, Dannelly HK, Malloy PJ, Reeves HC (1987). Rapid 

isoelectric focusing in a vertical polyacrylamide mini gel system. Anal. 

Biochem., 167: 290-294 

Salamone PR, Wodzinski RJ (1997). Production, purification and 

characterization of a 50-KDa extracellular metalloprotease from 

Serratia marcescens. Appl. Microbiol. Biotechnol., 48: 317-324. 

Takami HT, Akiba A, Horikoshi K (1992) Substrate specificity of 

Thermostable Alkaline Protease from Bacillus spp. No . AH – 101. 

Biosci. Biotechnol. Biochem., 56: 333-341. 

White A, Handler P, Smith E L (1973) Principles of Biochemistry. 5 th 

edition 1296. Williams and Wilkins. 787. 

Yanagida N, Uozumi T, Beppu T (1988). Specific excretion of S. 

marcescens protease through the outer membrane of Escherichia 

coli. J. Bacteriol., 166: 937-944. 

Zaks A (1991). Enzyme in organic solvent. In: Dordisk. J. S., ed 

Biocatalyst for industry. New York: Plenum Press. 166-180. 

Zaks A, Kilbanov AM (1984). Enzymatic catalysis in organic media at 

100°C. Enzy. Microb. Technol., 224:1145-1152.




DOI: 10.5897/AJMR11.703 


Overlap effects of cyromazine concentration, treatment 

method and rearing temperature on the Southern 

cowpea weevil (Callosobruchus maculatus F.) reared 

on cowpea 

Fahd Abdu Al-Mekhlafi 1 , Ashraf Mohamed Ali Mashaly 1 *, Ahmed A. Mahmoud Abdel Mageed 2 , 

Mohamed Ahmed Wadaan 1 and Nazar M. Al-Mallah 3 

1 Chair of Advanced Proteomics and Cytomics Research, Department of Zoology, College of Science, King Saud 

University, Riyadh 11451, Kingdom of Saudi Arabia. 

2 Department of Botany and Microbiology, King Saud University, Riyadh 11451, 

Kingdom of Saudi Arabia. 

3 Plant Protection Department, College of Agriculture and Forestry, Mosul University, Mosul, Iraq. 

Accepted 31 October, 2011 

Overlap of insect growth regulator (cyromazine) concentration, treatment method and rearing 

temperature was studied on the southern cowpea weevil, Callosobruchus maculatus F. (Bruchidae: 

Coleoptera), under laboratory conditions. A concentration of 5% cyromazine and dipping treatment at 

30°C showed a significant reduction in the reproductive rate by 0.5%. Moreover, increasing the 

cyromazine concentration led to a decrease in food consumption. Hence, treatment of cowpea seeds 

via dipping method provided more protection compared to spraying method. Also, the increase of 

cyromazine concentration led to an increase of generation's lifespan. The longest generation lifespan 

recorded was 33.33 days when treated with 5% cyromazine by dipping at 30°C. On the other hand, the 

shortest generation lifespan recorded was 25.33 days when treated with 1% cyromazine concentration 

by dipping at 30°C. This study showed that there is no effect of the overlap between studied factors, 

neither in the disparity of sex ratio nor in the disparity of males and females body weights. 

Key words: IGR, Insect pest, reproductive rate, sex ratio, Trigard, cyromazine. 

INTRODUCTION 

Legumes are considered as important crops in the world, 

as they are used for feeding human and animals in the 

form of green crops or dry seeds. Legumes are attacked 

by many insect pests in the field and in stores. The 

southern cowpeas weevil, Callosobruchus maculates, is 

one of the most common pests, with more than 35 kinds 

(in the field and stores) of which the most important of 

them is the cowpea weevil. This insect inflicts heavy 

losses to seeds up to 62%, since a single larva 

consumes about 50% of single seed weight during its 

*Corresponding author. E-mail: mmashely@ksu.edu.sa. Tel: 

+966552574903. Fax: +96614678514. 

development (Elazawe and Mahadi, 1983). Saplina 

(1980) reported that this insect is spread over more than 

30 countries around the world. Its ability to fly facilitates 

the operation of transferring from store to field and 

reverse easily. The damage is caused as a result of the 

larvae feeding on the growing seeds, and this damage 

increases as larvae continue to grow due to increasing 

consumption of seeds contents (Howe and Currie, 1964; 

Pajni, 1965; Elazawe et al., 1990). Bastos (1973) found 

out when testing 241 samples of cowpea seeds that the 

rate of hit with southern cowpea was 37.8% of the tested 

samples and after storage for 56 days the damage 

percentage reached 68.6%, which subsequently led to 

decrease of the trade value of cowpea seeds by 56%. 

The presence of residues in food, resistance develop-

ment by pest species, health risks (Arthur, 1996), 

increased cost (Hagstrum and Subramanyam, 2006) and 

toxicity to non-target organisms (Fields, 1992) has 

created strong concerns with the use of synthetic 

chemicals in controlling stored-product insects. Thus, 

insect growth regulators (IGR) are considered one of the 

most suitable alternative natural pesticides as they may 

adversely affect insects by regulating or inhibiting specific 

biochemical pathways or processes essential for insect 

growth and development. Some insects exposed to such 

compounds may die due to abnormal regulation of 

hormone-mediated cell or organ development. Other 

insects may die either from a prolonged exposure at the 

developmental stage to other mortality factors 

(susceptibility to natural enemies, environmental 

conditions, etc) or from an abnormal termination of a 

developmental stage itself (Tunaz, 2004). Miller et al. 

(1981) pointed out that the use of insect growth regulator 

(cyromazine) 0.25, 0.5 and 0.1% concentration against 

the larvae of Musca domestica Linn caused 95% 

mortality, recording rate of success of 3 to 10 over the 

growth regulator diflubenzuron. In addition, Saito (1988) 

reported that adding 75% of cyromazine to water resulted 

in 88% mortality amongst larvae of Liriomyza bryoniae 

Kalt. In an experiment involving the use of cyromazine at 

the rate of 0.1, 0.5 and 1.1% g/ kg weight of animal in the 

field of milk cows, Miller et al. (1996) found that its 

residue in cows' waste discouraged the development of 

M. domestica larvae. Levot and Sates (1998) also found 

that the use of cyromazine and dezinion each individually 

against M. domestica by concentration 0.4 g/L led to a 

reduction in the number of M. domestica at rate of 69% 

after one day of treatment and 99.97% in three days of 

treatment. Vazirianzadeh et al. (2007) concluded that 

cyromazine (Trigard) should be used in a larvicidal 

program to control house-fly. More importantly, insect 

growth regulators were considered to be better used in 

an integrated pest management program, rather than 

being used alone (Oberlander et al., 1997). 

The objectives of the current study were to determine 

the impact of overlapping between the different 

concentrations of growth regulator (cyromazine), 

treatment methods and the temperatures in the biological 

activity of southern cowpea weevils. 


Experimental insects 

The southern cowpea weevil, Callosobruchus maculatus F. 

(Bruchidae: Coleoptera), was obtained from an entomological 

research laboratory in the College of Agriculture and Forestry, 

University of Mosul. All cowpeas (Vigna unguiculata) seeds were 

put in glass jar (1/2 kg each). The southern cowpea weevils were 

added (20 weevil/jar), covered with a piece of cloth, bond with 

rubber firmly and then incubated at 30 ± 2°C or 50 ± 5% (Ishimoto 

et al., 1996). Cultures were renewed after each generation by 

taking the newly emerged insects for construction of a new culture 

to conduct further studies. 

Insect growth regulator (cyromazine) 

Al-Mekhlafi et al. 5849 

This pesticide works as a growth regulator and is used to control 

larvae of Diptera and Coleoptera. It is being used as a powder in 

water containing 750 g /kg effective cyromazine (N-cyclopropyl 1, 3, 

5-triazine-2, 4, 6-triamine) and sold under the names of various 

commercial (Larvadex, Premix) classifies toxically within the Class 

III according to the classification of the World Health Organization 

(WHO). Solutions of cyromazine were freshly prepared immediately 

prior to the experiments (Awad and Mulla, 1984). 

Pesticide bioassays 

Three concentrations of cyromazine were applied (1, 3 and 5%) in 

the treatment of chickpea seeds. Seeds (25 g per time) were 

treated twelve times and six times treated in a spraying manner 

using the Potter Tower at 5 lbs/inches pressure and 2.5 ml of 

cyromazine solution, ensuring coverage of the surface of seeds. 

The remaining six were treated by dipping in the cyromazine 

solution for 1 min. For the control, seeds were treated with water 

only. Drought seeds have been placed in plastic pots (7 × 7 cm) 

then five pairs (males and females) of newly emerged adults were 

transferred into each pot and covered with a piece of cloth sealed 

with a rubber bond. Pots were then incubated at 25 ± 1 or 30 ± 1°C 

and 50 ± 5% RH. Treatments were followed up to two successive 

generations to specify the overlap between different concentrations 

of cyromazine, treatment method and rearing temperature on the 

following: Reproductive rate of the southern cowpea weevils is 

calculated for two successive generations using the formula of 

Krebs (1978): 

r = 

dn / dt 

n 

Where r is the reproductive rate; n is the number of colony 

individuals; dn is the change in the number of colony individual; and 

dt is the change in time. 

The rate of food consumption was measured by weighing the 

treated seeds after the end of experiment and deducted from the 

original weight (25 g). Generation lifespan was calculated from the 

new adult emergence (from the pupae) until the advent of insects in 

the second-generation. Sex ratio and weight of males and females 

were tested by taking a random group of full complete insects each 

in pot and calculating the number of males and females and their 

weight. 

Data analysis 

For conducting the test and analyzing its data, the factorial 

completely randomized design and Duncan's multiple range tests to 

change the averages of endurable level 5% (Daoud and Elyass, 

1990) were used. 

RESULTS AND DISCUSSION 

The results presented in Table 1 indicate that increasing 

in the cyromazine concentration resulted in significant 

reduction in the reproductive rate of the treated southern 

cowpea weevils compared to control ones. Cyromazinetreated 

insects (with a concentration of 5%) showed 

reproductive rate of 2.58% compared to 36.1% in control 

ones. House et al. (1978) stated that when they used


Table 1. Summarized results of studied parameters on the southern cowpea weevil, C. maculatus, reared on cowpeas with the 

different concentrations of cyromazine, treatment methods and temperatures. 

Concentration (%) Treatment methods Temperatures 

1 3 5 Control Dipping Spraying 25°C 30°C 

Reproductive rate 23.3 C 8.74 B 2.58 A 36.11 D 14.41 A 21 B 18.50 B 16.9 A 

Food consumption 8.87 C 5.61 B 2.89 A 18.28 D 6.89 A 10.94 B 9.29 B 8.54 A 

Generation lifespan 28.7 C 29.79 B 30.67 A 27.71 D 28.81 B 29.63 A 31.79 A 26.65 B 

Sex ratio 

Average weights 

M 1.05 A 1.18 A 1.19 A 1.11 A 1.16 A 1.11 A 1.10 A 1.17 A 

F 1.14 A 1.05 A 1.05 A 1.04 A 1.07 A 1.07 A 1.07 A 1.07 A 

M 0.96 A 1.07 B 1.05 B 0.95 A 0.99 A 1.02 A 1.02 A 0.99 A 

F 1.36 A 1.59 B 1.42 A 1.44 A 1.42 A 1.49 A 1.45 A 1.46 A 

Averages of similar characters refer to the existence of significant differences at the 0.05% level of probability. M, Male; F, female. 

diflubenzuron to control the boll weevils, Anthonomus 

grandis (Boheman), at a rate of 35, 70 and 140 g/ha, 

there was an effective reduction in the total percentage of 

adult emergence from pupae (37.7, 22.21 and 15.8%, 

respectively). The use of 4 growth regulator, hydroprene, 

methoprene, diflubenzuron, and MV-678 to control 

Ephestia cautella (Walker) on the peanut, with increased 

concentration resulted to a decrease of adult emergence 

(Nickle, 1979). These growth regulators led to downregulation 

of the rate of the fertility among treated insects. 

In oblique-banded leafroller Choristoneura rosaceana 

(Harris), the pupation and adult emergence was 

significantly delayed at pyriproxyfen concentrations 

higher than 1 ppm (Sial and Brunner, 2010). 

Considering the effect of treatment methods on the 

reproductive rate, Table 1 shows a decrease in the 

southern cowpea weevils’ number when treated via 

dipping method (14.41%), compared with the spraying 

methods (21%). The production rate was monitored with 

temperature since it was 16.90 at 30°C, while at 25°C it 

was 18.50. Buholzer et al. (1992) also tested the 

efficiency of growth regulator (Match) at three different 

degrees of temperature 18, 24, 30°C in controlling cotton 

leaf worm Spodoptera littoralis (Boisd.) and reported a 

positive relation between temperature and the efficiency 

of the Match. The mortality rate increase accordingly with 

increase in temperature, perhaps that relevant to 

increasing of insect activity at high temperature leading to 

increase of growth regulator pick up. 

The data from overlap experiment indicated that 

dipping-treated cowpea seeds (in 5% cyromazine 

solution at 30°C) showed significant decrease of the 

production rate of the southern cowpea weevil, recording 

0.5, where it was 36.43 in spraying methods (Table 2). 

The obtained results as shown in Table 1 revealed that 

the rate of food consumption (8.87, 5.61, and 2.89 g) 

decreased when cyromazine concentration (1, 3, and 

5%) increased compared to control (18.28 g). A 

significant influence of treatment methods, preferring the 

dipping method over spraying one where the dipping 

method resulted in decrease in the rate of food 

consumption (6.89 g) compared to that of the spraying 

methods (10.94 g). Temperature also had a significant 

impact, where at 25°C the rate of food consumption was 

high (2.29 g), compared to that at 30°C (3.30 g). Gabouri 

(2000) mentioned that Southern cowpea weevils at 25°C 

consumed 17.17 g of the food during a complete 

generation in contrast with that raised at 30-35°C which 

consumed 12.38 g, and 10.88 g, respectively. Data from 

overlap experiment indicated that cowpea seeds treated 

via dipping method in 5% cyromazine solution at 30°C led 

to significant decrease of the food consumption rate of 

the southern cowpea weevil, recording 0.5, whereas it 

was 4.04% in spraying methods (Table 2). 

The generation lifespan reached 28.71, 29.79, and 

30.67 days at the concentration of 1, 3, and 5% 

respectively, in contrast with water treated control. The 

generation lifespan clearly decreased when the dipping 

method was applied at 28.81 days, while in spraying 

method was 29.63 days. Temperature plays important 

role; at 30°C the average of the generation lifespan was 

26.65 days, in contrast with generation lifespan at 25°C 

recorded 31.79 days (Table 1). The highest generation 

lifespan recorded was 33.33 days in spraying treatment 

at 5% concentration and 25°C, and the lowest generation 

lifespan was 26.33 days in dipping treatment at 1% 

concentration and 30°C (Table 2). Furthermore, Tables 1 

and 3 showed no significant differences observed for the 

sex ratio in any test concentration, treatment method and 

the temperature compared to the control. Similarly, in 

Chironomus riparius, no significant differences to solvent 

control were observed in any test concentration, although 

an exclusive production of males by Daphnia was 

observed with pyriproxyfen at 100 ng/L (Wang et al., 

2005; Tatarazako et al., 2003). Other studies with C. 

riparius which reported sex-related effects at sensitive 

(molecular) level also exist (Hahn et al., 2001; Hahn and 

Schulz, 2002). For example Hahn and Schulz (2002)


Table 2. Overlap effect of different concentrations of cyromazine, treatment methods and temperatures on the reproductive rate, food 

consumption rate and generation lifespan of the southern cowpea weevil, C. maculates reared on cowpeas. 

Concentration (%) Treatment method Temperature Reproductive rate Food consumption rate Generation lifespan 

1 

20.60 ± 0.26 

Dipping 

25 

F 7.23 ± 0.16 F 31.17 ± 0.17 C 

3 3.27 ± 0.15 C 4.93 ± 0.23 E 32.33 ± 0.17 B 

5 1.53 ± 0.15 B 2.56 ± 0.09 B 32.5 ± 0.29 AB 

Control 36.07 ± 0.23 J 12.72 ± 0.14 K 30.17 ± 0.17 D 

1 

30 ± 0.29 

Spraying 

I 11.18 ± 0.16 G 32 ± 0.50 B 

3 15.47 ± 0.15 E 7.75 ± 0.25 I 32.67 ± 0.33 AD 

5 4.9 ± 0.06 D 4.46 ± 0.07 DE 33.33 ± 0.33 A 

Control 36.2 ± 0.12 J 23.45 ± 0.21 N 30.17 ± 0.17 D 

1 

15.5 ± 0.29 

Dipping 

30 

E 7.02 ± 0.18 FH 25.33 ± 0.17 HI 

3 1.4 ± 0.21 B 3.19 ± 0.04 C 26.67 ± 0.33 H 

5 0.05 ± 0.06 A 0.50 ± 0.06 A 27.67 ± 0.17 F 

Control 36.43 ± 35 J 16.94 ± 0.24 L 24.67 ± 0.17 J 

1 

27.43 ± 0.07 

Spraying 

H 10.04 ± 0.28 J 26.33 ± 0.17 H 

3 14.83 ± 0.44 E 6.55 ± 0.16 F 27.5 ± 0.50 F 

5 3.4 ± 0.21 C 4.04 ± 0.18 D 29.17 ± 0.17 E 

Control 35.73 ± 0.15 J 20.02 ± 0.13 M 25.83 ± 0.17 HI 

Averages of similar characters refer to the existence of significant differences at the 0.05% level of probability. 

Table 3. Overlap effect of different concentrations of cyromazine, treatment methods and temperatures on the sex ratio 

of the southern cowpea weevil, C. maculates reared on cowpeas. 

Concentration (%) Treatment method Temperature 

Mean of the sex ratio ± S.E 

Male Female 

1 

1.05 ± 0.05 

Dipping 

A 1.12 ± 0.12 AB 

3 1.13 ± 0.13 A 1.O3 ± 0.02 AB 

5 1.09 ± 09 A 1.06 ± 0.06 AB 

Control 1.11 ± 0.08 A 1.06 ± 0.06 AB 

25 

1 

1.07 ± 0.07 

Spraying 

A 1.04 ± 0.03 AB 

3 1.15 ± 0.10 A 1.09 ± 0.09 AB 

5 1.09 ± 0.09 A 1.12 ± 0.08 AB 

Control 1.O7 ± 0.07 A 1.04 ± 0.04 AB 

1 

1 ± 0 

Dipping 

30 

A 1.32 ± 0.27 B 

3 1.25 ± 0.09 AB 1 ± 0 A 

5 1.47 ± 0.14 B 1 ± 0 A 

Control 1.17 ± 0.17 A 1 ± 0 A 

1 

1.07 ± 0.04 

Spraying 

A 1.O7 ± 0.07 AB 

3 1.19 ± 0.10 AB 1.06 ± 0.06 AB 

5 1.11 ± 0.08 A 1.04 ± 0.04 AB 

Control 1.07 ± 0.07 A 1.07 ± 0.07 AB 

Averages of similar characters refer to the existence of significant differences at the 0.05% level of probability.


Table 4. Overlap effect of different concentrations of cyromazine, treatment methods and temperatures on the average 

weights of the southern cowpea weevil, C. maculates reared on cowpeas. 

Concentration (%) Treatment method Temperature 

Mean of the average weights ± S.E 

Male Female 

1 

1.07 ± 0.7 

Dipping 

25 

CDE 1.37 ± 0.02 AB 

3 1.05 ± 0.05 BCDE 1.52 ± 0.02 BC 

5 1 ± 0.03 BCDE 1.53 ± 0.15 BC 

Control 1 ± 0.03 BCDE 1.45 ± 0.1 AB 

1 

0.95 ± 0.03 

Spraying 

ABCD 1.27 ± 0.07 A 

3 1.08 ± 0.04 CDE 1.83 ± 0.14 D 

5 1.02 ± 0.11 BCDE 1.30 ± 0.03 AB 

Control 1.02 ± 0.02 BCDE 1.32 ± 0.03 AB 

1 

0.82 ± 0.04 

Dipping 

30 

A 1.30 ± 0.09 AB 

3 1.02 ± 0.03 BCDE 1.32 ± 0.06 AB 

5 1.07 ± 0.04 CDE 1.37 ± 0.03 AB 

Control 0.92 ± 0.04 ABC 1.5 ± 0.06A BC 

1 

1 ± 0.05 

Spraying 

BCDE 1.52 ± 0.06 BC 

3 1.12 ± 0.02 DE 1.70 ± 0.06 CD 

5 1.13 ± 0.0 7E 1.48 ± 0.02 ABC 

Control 0.88 ± 0.05 AB 1.50 ± 0.05 ABC 

Averages of similar characters refer to the existence of significant differences at the 0.05% level of probability. 

observed a sex-related effect of tributyltin on the 

ecdysteroid synthesis and the imaginal disk development 

by C. riparius. In Leptomastix dactylopii (Howard), when 

kinoprene was applied, Rothwangl et al. (2004) found 

that the sex ratio was equivalent in the petri dish 

experiment, whereas in the cage experiment the sex ratio 

was biased toward males. 

Regarding the rate of male weight, the increase of 

cyromazine concentration led to increase of male weight 

recording 0.96, 1.5 and 1.7 mg at concentrations of 1, 3 

and 5, respectively (Table 1), in contrast with control 

treatment (0.95 mg). Also the study concluded a non 

significant effect of concentration, temperature and 

treatment method in the average of male weight 

recording 1.13 mg at 5% concentration using the 

spraying method at 30°C as the highest weight. However 

the lowest male weight recorded was 0.82 mg at 1% 

concentration via dipping method and at 30°C. For the 

female average weight, the weight recorded was 1.59 mg 

at concentration 3% and recorded 1.36, 1.42 mg at 1 and 

5% concentration, respectively. Taking together, these 

results showed no significant differences in the average 

weight of female between the two concentrations (1 and 

5%) and the control, but there was a little difference in 

female weight at 3% concentration. Also there were no 

differences in the female weight at 25 to 30°C and the 

two different methods of treatment (Table 1). The highest 

female average weight recorded was 1.83 mg at 3% 

concentration via spraying method at 25°C and the 

lowest weight recorded was 1.27 mg at 1% concentration 

via spraying method at 25°C (Table 4). Sial and Brunner 

(2010) studied the effect of pyriproxyfen, on obliquebanded 

leafroller C. rosaceana (Harris) and found that 

the weights of adults were significantly increased. 

In conclusion, the study of the overlap between 

cyromazine concentration, treatment method and 

temperature on the southern cowpea weevil for two 

successive generations indicated the existence of a 

difference in the reproductive rate, the rate of food 

consumption and average of generation lifespan. 

However, there was no effect neither in the disparity of 

sex ratio nor in the disparity in the weight of males and 

females. 


The authors extend their appreciation to the Deanship of 

Scientific Research at king Saud University for funding 

the work through the research group project no. RGP- 

VPP-028. 

REFERENCES 

Arthur FH (1996). Grain protectants: current status and prospects for 

the future. J. Stored Prod. Res. 32: 293-302.

Awad TI, Mulla MS (1984). Morphogenetic and histo pathological effects 

induced by the insect growth regulator Cyromazine in Musca 

domistica L Diptera: Muscidae. J. Med. Entomol. 21(4): 419-426. 

Bastos JAM (1973). Evaluations of the damage caused by the weevil C. 

maculatus (F.) in samples of coupea vigna sinensis (L) collected at 

Fortaleza ceara. Pesquisa Agropecualia Brasileira Seric Agronomia 

8(7):131-132, Cited by The Rev. Appl. Entomol., 64(2): 936. 

Buholzer F, Draber J, Bourgeois F, Guyer W (1992). CGA, 184; 699 

anew acylurea insecticide Med. Fac. Landbouw. Univ Gent. 57(3): 

790. 

Daoud KM, Elyass ZA (1990). Statistical methods for agricultural 

research, National Library of Printing and Publishing, University of 

Mosul, Iraq. 

Elazawe AF, Mahadi MT (1983). Stored products insect. Directorate of 

University Press, Mosul, Iraq. 

Elazawe AF, Quado IQ, Al Haydary HS (1990). Economic insects. Dar 

Al-Hekma Press, University of Baghdad, Iraq. 

Fields PG (1992). The control of stored-product insects and mites with 

extreme temperatures. J. Stored Prod. Res., 28: 89-118. 

Gabouri IAH (2000). Food preference of the Southern cowpea weevil, 

Callosobruchus maculatus (F.) (Bruchidae: Coleoptera) and the effect 

of different temperatures on the biology, Master thesis, Faculty of 

Agriculture and Forestry, University of Mosul, Iraq. 

Hagstrum DW, Subramanyam BH (2006). Fundamentals of Stored- 

Product Entomology. AACC International, St. Paul. 

Hahn T, Liess M, Schulz R (2001). Effects of the hormone mimetic 

insecticide tebufenozide on Chironomus riparius larvae in two 

different exposure setups. Ecotoxicol. Environ. Saf. 49(2): 171–178. 

Hahn T, Schulz R (2002). Ecdysteroid synthesis and imaginal disc 

development in the midge Chironomus riparius as biomarkers for 

endocrine effects of tributyltin. Environ. Toxicol. Chem. 21(5): 1052– 

1057. 

House VS, Ables JR, Jones SL, Bull DL (1978). Diflubenzuron for 

control of the Boll weevil in unisalated isolated cotton fields. J. Econ. 

Entomol. 71: 797-800. 

Howe RW, Currie JE (1964). Some laboratory observations on the rates 

of development mortality and oviposition of several species of 

Bruchidae breeding in stored pulses. Bull. Entomol. Res. 55(3): 437- 

477 

Ishimoto M, Sato T, Chrispeels MJ, kitamura K (1996). Bruchid 

resistance of transgenic azuki bean expressing seed amylase 

inhibitor of common bean. Entomolgia Experimentalis et Applicata, 

79: 309-315 

Krebs J (1978). The experimental analysis of distribution and 

abundance. Harper and Row Publishers. New York, U.S.A. 

Levot GW, Sastes N (1998). Effectiveness of amixture of Cyromazine 

and Diazinon for controlling fly strike on sheep, Aust. Vet. J. 76(5): 

343-344. 

Miller RW, Corlex C, Cohen CF (1981). (GA-19255 and CGA-72662: 

Efficacy against flies and possible mode of action and metabolism. 

South Western Entomol. 6(2): 272-278. 


Miller RW, Schmidtmann ET, Wauchope RD, Clegg CM, Herner AE, 

Weber H (1996). Urine delivery of Cyromazine for suppressing house 

and stable flies in outdoor dairy calf hutches. J. Econ. Entomol. 89(3): 

689-694. 

Nickle DA (1979). Insect Growth Regulators: New protectants against 

the almond moth in stored in shell peanuts. J. Econ. Entomol. 72: 

816-819 

Oberlander H, Silhacek DL, Shaaya E, Ishaaya I (1997). Current status 

and future perspectives of the use of insect growth regulators for the 

control of stored product insects. J. Stored Prod. Res. 33: 1-6 

Pajni HR (1965). Bioassay of insecticides relative toxicity of films of 

different insecticides against the adults of C. maculatus (F.). Res. Bull 

Bonjab Univ. 16(4): 559-341. 

Rothwangl KB, Cloyd RA, Wiedenmann RN (2004). Effects of insect 

growth regulators on citrus mealybug parasitoid Leptomastix 

dactylopii (Hymenoptera: Encyrtidae). J. Econ. Entomol. 97(4): 1239- 

44. 

Saito T (1988). Insecticide activity of several chemicals to the bryony 

Leafminer Liriomyza bryoniae and their application methods. Plant 

Protect. 35: 168-171 

Saplina GS (1980). Callosobruchus maculates. Zashchita Rastenii, 7: 

41. 

Sial AA, Brunner JF (2010). Lethal and Sublethal Effects of an Insect 

Growth Regulator, Pyriproxyfen, on Obliquebanded Leafroller 

(Lepidoptera: Tortricidae). J. Econ. Entomol. 103(2): 340-347. 

Tatarazako N, Oda S, Watanabe H, Morita M, Iguchi T (2003). Juvenile 

hormone agonists affect the occurrence of male Daphnia. 

Chemosphere, 53(8): 827–833 

Tunaz H (2004). Insect Growth Regulators for Insect Pest Control. 

Turkish J. Agric. Forest. 28: 377-387. 

Vazirianzadeh B, Jervis MA, Kidd NAC (2007). The Effects of Oral 

Application of Cyromazine and Triflumuron on House-Fly Larvae. 

Iranian J. Arthropod-Borne Dis. 1(2): 7-13. 

Wang HY, Olmstead AW, Li H, LeBlanc GA (2005). The screening of 

chemicals for juvenoid-related endocrine activity using the water flea 

Daphnia magna. Aquatic Toxicol. 74(3): 193–204.




DOI: 10.5897/AJMR11.707 


Antioxidant and antibacterial activities of Camptotheca 

acuminate D. seed oil 

Lin Wang 1, 2 , Zhiwei Yang 1* , Sicen Wang 3 , Shuqiu Wang 1 and Junxing Liu 1 * 

1 School of Basic Medical Sciences, Jiamusi University, Jiamusi 15400, P. R. China. 

2 The First Affiliated Hospital of Jiamusi University, Jiamusi 154003, P. R. China. 

3 Research and Engineering Center for Natural Medicine, Xi’an Jiaotong University, Xi’an 710061, P. R. China. 


This study was designed to explore the in vitro antioxidant and antibacterial activities of Camptotheca 

acuminate D. seed oil, which were extracted by supercritical fluid extraction (SFE) or petroleum ether 

extraction methods. The major constituent of the oil were described as (Z,Z,Z)-9,12,15-Octadecatrien-1ol 

(54.92%) and 2-[(trimethylsilyl)oxy]-3-[4-[(trimethylsilyl)oxy]phenyl]-trimethylsilyl ester (26.53%) in 

supercritical fluid and petroleum ether extracts. The oil and the components were subjected to screen 

for their possible antioxidant activity by 2, 2-diphenyl-1-picrylhydrazyl (DPPH) assay and β-carotene 

bleaching test. In the DPPH test system, free radical scavenging activities of supercritical fluid extracts 

and petroleum ether extracts were determined to be 7.55 ± 0.11% and 4.38 ± 0.08% (v/v), respectively. As 

to the β-carotene bleaching test system, the two values were 15.93 ± 0.11% and 6.87 ± 0.15% (v/v), 

respectively. The activities of antioxidant and antibacterial in components of petroleum ether were more 

efficient than in components of supercritical fluid extraction. As to the antimicrobial activities of the 

essential oil against 8 species bacterium, C. acuminate D. seed oil had remarkable antibacterial activity, 

especially to staphylococcus aureus (ATCC 6538). Thus, C. acuminate D. seed oil could be judged as a 

kind of patent drug which has antioxidant and antibacterial activity effectively. 

Key words: Camptotheca acuminate D. seed oil, antioxidant activities, antibacterial activities. 

INTRODUCTION 

Camptotheca acuminata Decaisne belongs to the family 

of Nyssaceae. It is a kind of deciduous and medicinal tree 

from south China and listed as an endangered species in 

China (Cheng et al., 2008; Li et al., 2002; (Yang et al, 

2011) DOI: 10.1002/qua.23046). The main active 

ingredients of C. acuminate D. extracts are quinoline and 

indole alkaloids (Wall et al., 1966). The camptothecin 

(CPT) (a terpenoid quinoline alkaloid) and its analogues 

are the potent topoisomerase I inhibitors, which have 

been used as the anticancer drugs to treat ovarian, lung 

and colorectal cancers or the antiviral agents (Li and 

*Corresponding author. E-mail: yzws-123@163.com. 

iujunxing0982@163.com, Tel: +086 0454 6166452. Fax: +086 

0454 8618355. 

Adair, 1994; Oberlies and Kroll, 2004). 

Some studies on anticancer activities of C. acuminata 

D. have been reported. However, the antioxidant activity 

of its seed oil has not yet been studied. The seed oil of C. 

acuminata D. possesses the potential as high-quality 

edible oil that is beneficial to health and valuable natural 

antioxidants in cosmetic and pharmaceutical industries. 

Industrial seed oils are generally obtained with the aid 

of mechanical process and organic solvent extraction 

(mainly hexane). The oil prepared by mechanical 

separation is of high quality, but in most cases the yield is 

low. Hexane extraction can achieve almost complete 

recovery of the oil, but the solvent is quite harmful to 

human health and environment, embarrassing the use in 

food, cosmetic and pharmaceutical industries. 

Supercritical fluid extraction (SFE) with supercritical 

carbon dioxide (SC-CO2) is an alternative method to

extract the oils from natural products and has received 

considerable attention (Gomes et al., 2007; Lu et al., 

2007; SalgIn, 2007). The oil obtained by SC-CO2 

extraction is of high quality, and the yield is comparable 

with those of organic solvent extractions (Friedrich et al., 

1982; Molero Gómez et al., 1996). In fact, CO2 extracts 

have been generally considered as safety in food 

applications (Gerard and May, 2002), and SFE has been 

served as a very potential technology in food and 

pharmaceutical operations (King, 2000). 

To the best of our knowledge, the antioxidant and 

antibacterial activities of C. acuminate D. seed oil in vitro 

have not yet been evaluated. Therefore, in this work, the 

oil will be separately extracted by SFE and petroleum 

ether extraction methods, and the activities will be 

evaluated by 2, 2-diphenyl-1-picrylhydrazyl (DPPH) 

assay, β-carotene bleaching test, as well as minimal 

inhibitory concentration (MIC) and minimal bactericidal 

concentration (MBC) determinations. We anticipate that 

the investigation will be of value in the development of 

antioxidant and antibacterial agents. 


Preparation of extract 

Isolation of C. acuminata seed oil by petroleum ether 

C. acuminate D. seeds were air dried at room temperature and 

ground, and 100 g were subjected to the distillation with a Britishtype 

clevenger apparatus at 100°C for 3 h. Then, the extracts were 

filtered and concentrated in vacuum at 45°C, yieldin g the seed soil 

in yellow. 

Supercritical carbon dioxide (SC-CO2) extraction 

C. acuminate D. seeds were air dried at room temperature and 

ground in a grinder with a mesh of 2 mm in diameter. Then, they 

were passed through a 0.5 mm sieve to obtain a fine powder. The 

extraction temperature was 45°C and the pressure was 5 .5 MPa. 

The flow rate was determined using a watch. The flow rate of CO2 

was 10 kg/h; and the extraction time was 2 h. Liquid CO2 was 

supplied from a gas cylinder. Before passing into the extraction 

vessel filled with the samples by pump, the liquid CO2 was adjusted 

to the desired pressure and heated to a specified temperature to 

reach the supercritical state. Finally, the extracts were lyophilized 

and kept in dark at 4°C until the next step. 

Gas chromatography 

The sample was diluted by ethyl acetate (1:100) and mixed. The 

analysis of the essential oil was performed using a VG platform II 

Gas chromatography-Mass spectroscopy (GC–MS) system 

equipped with an Rtx-5MS capillary column (30 × 0.25 mm; film 

thickness 0.25 mm). For the Rtx-5MS detection, the injector 

temperature was set at 280°C; split injection with a ratio of 100: 1; 

and the injection volume was 1 µl with a flow controlled by a linear 

model. Helium was the carrier gas at a flow rate of 1.6 ml/min. 

Starting from 60°C, the temperature was raised to 280 a t 10°C /min 

and held for 5 min. Injector and detector MS transfer line 

temperatures were set at 200 and 280°C, respecti vely, and the 

sample collection time was 3 min (m/z = 40 to 500). 


General description 

Wang et al. 5855 

Antioxidant activity was assessed by DPPH assay and β-carotene 

bleaching test. All data collected for each assay were the average 

of the measurements of three independent experiments. 

DPPH radical scavenging assay and the oil obtained by SC- 

CO2 extraction 

We measured the bleaching of purple-colored ethanol solution of 

DPPH. This spectrophotometric assay uses the stable radical 

DPPH as a reagent (Wu et al., 2010). An aliquot of the sample (100 

µl) was mixed with 1.4 ml of ethanol and then added to 1 ml of 

0.004% DPPH (Sigma–Aldrich) in ethanol. The mixture was 

vigorously shaken and then immediately placed in a UV–Vis 

spectrophotometer (AWARENESS) to monitor the decrease in 

absorbance at 517 nm. Monitoring was continued for 70 min until 

the reaction reached a plateau. Ascorbic acid (Sigma–Aldrich), a 

stable antioxidant, was used as a synthetic reference. The radical 

scavenging activities of samples were calculated as the inhibition 

percentage of DPPH according to the formula: 

Inhibition percentage (Ip) = [(AB-AA)/AB] ×100 (Yen and Duh, 1994) 

where AB and AA are the absorbance values of the blank sample 

and the tested samples examined after 70 min, respectively. 

β-Carotene-linoleic acid bleaching assay 

Antioxidant activity of the samples was determined with β-carotene 

bleaching test (Wu et al., 2010). Approximately 10 mg of β-carotene 

(type I synthetic, Sigma–Aldrich) was dissolved in 10 ml chloroform. 

The carotene–chloroform solution of 0.2 ml was pipetted into a 

boiling flask containing 20 mg linoleic acid (Sigma–Aldrich) and 200 

mg Tween 40 (Sigma–Aldrich). Chloroform was removed by a 

rotary evaporator (RE-52AA) at 40°C for 5 min, and to th e residue, 

50 mL of distilled water was added, slowly with vigorous agitation, 

to form an emulsion. The emulsion (5 ml) was added to a tube 

containing 0.2 ml of the sample solution and the absorbance was 

immediately measured at 470 nm against a blank consisting of an 

emulsion without β-carotene. The tubes were placed in a water bath 

at 50°C, and the oxidation of the emulsion was moni tored by a 

spectrophotometer at 470 nm over a period of 60 min. Control 

samples contained 10 ml of water instead. Butylated 

hydroxytoluene (BHT) (Sigma–Aldrich), a stable antioxidant, was 

used as a synthetic reference. The antioxidant activity was 

expressed as the inhibition percentage relative to the control after 

60 min incubation with the following equation: 

AA = 100(DRC - RS)/DRC 

Where AA, antioxidant activity; DRC, degradation rate of the control 

[ln(a/b)/60]; DRS, degradation rate in the presence of the sample 

[ln(a/b)/60]; a, absorbance at time 0; b, absorbance at 60 min. 

Antimicrobial activity 

The microorganisms used for testing antimicrobial sensitivity 

included Bacillus subtilis 6633, Staphylococcus aureus ATCC 6538


and Staphylococcus epidermidis ATCC 49134, Escherichia coli 

ATCC 11229, Proteus vulgaris, Pseudomonas aeruginosa, Candida 

albicans and Aspergillus niger V. Tiegh. They were obtained from 

the Center for Microbiology Research, Jiamusi Medical Research 

Institute. 

Minimal inhibitory concentration (MIC) and minimal 

bactericidal concentration (MBC) determination of 

Camptotheca acuminate D. seed oil 

The MIC and MBC were measured by the broth micro-dilution 

method (NCCLS, 2002). The essential oils were individually 

dissolved in sterilized physiological saline solution (0.9% w/v) 

supplemented with Tween 80 (Sigma) at a final concentration of 

0.5% (v/v). Serial doubling dilutions of the oils were prepared in a 

96-well microtiter (µL) plate in the range of 0.156 to 4.000% (v/v). 

Each essential oil dilution (100 µL) was dispensed into the wells of 

a microtiter plate, and each well was then inoculated with 100 µL of 

the suspension. The obtained suspensions were mixed with a 

micro-pipette. The final concentration of each strain was adjusted to 

10 5 to 10 6 CFU/mL. All microtiter plates against all microorganisms 

were incubated at 37°C for 24 h, except for A. niger that was 

incubated at 25°C for 5 days. After incubation, the wells were 

examined for the microorganism growth, and the MICs were 

determined. The MIC was defined as the lowest concentration of 

the essential oil at which the microorganism did not show visible 

growth. The MBCs were confirmed by reinoculating on agar plates 

with 10 µL of each culture medium from the microplates. The MBCs 

were defined as the lowest concentration of the essential oil at 

which incubated microorganisms were completely killed. 

Streptomycin and Amphotericin B were served as the positive 

controls. Each experiment was repeated for three times. 


Chemical composition 

We identified 50 components in the C. acuminate D. seed 

oil obtained by SC-CO2 extraction (Table 1). Fifty-three 

(53) components were identified in the oil obtained by 

petroleum ether (Table 2). The major components were 

(Z,Z,Z) - 9, 12, 15 - Octadecatrien- 1- oil (54.92%), 

octadecanoic acid (13.46%), n-hexadecanoic acid 

(11.63%) in the seed oil (Table 1) obtained by SC-CO2. 

While the major components were [4- 

[(trimethylsilyl)oxy]phenyl]-2-[(trimethylsilyl)oxy]-3-2propenoicacid 

trimethylsilyl ester (26.53%), gammasitosterol 

(23.49%), (Z,Z,Z)-9,12,15-octadecatrienoic 

acid, and methyl ester (19.19%) in the seed oil obtained 

by petroleum ether. 


The antioxidant activities of the essential C. acuminate D. 

seed oil obtained by SC-CO2 extraction or petroleum 

ether were determined by two complementary test 

systems: DPPH assay and β-carotene bleaching tests. 

The results of antioxidant activity in these test systems 

were collected and shown in Figures 1 to 3. In the DPPH 

test system, free radical - scavenging activity of C. 

acuminate D. seed oil obtained by SC-CO2 extraction 

was determined to be 81.39 ± 0.92%; whereas the oil 

obtained by petroleum ether was 87.13 ± 1.81% (Figure 

1). As for the lipid peroxidation inhibitory activity of the 

essential oil by the β-carotene bleaching test, the results 

were consistent with the data obtained from the DPPH 

test (Figure 2). Compared with BHT, the effects of C. 

acuminate D. seed oil obtained by SC-CO2 extraction or 

petroleum ether were 80.82 ± 0.32% and 85.47 ± 0.54%, 

respectively. The concentration of 50% inhibition (IC50) 

values of BHT, C. acuminate D. seed oil obtained by SC- 

CO2 or petroleum ether were 3.24 ± 0.12%, 7.55 ± 0.11% 

and 4.20 ± 0.08%, respectively (Figure 3). It seemed that 

the antioxidant activities of all the tested samples were 

mostly related to their concentrations, and the IC50 values 

of these two types of seed oil were both higher than that 

of the synthetic antioxidant BHT (Figures 2 and 3). 

Antimicrobial activity 

Minimal inhibitory concentration (MICs) and minimal 

bactericidal concentration (MBCs) of Camptotheca 

acuminate D. seed oil 

As shown in Tables 3 and 4, the essential oils exhibited 

inhibitory effects of all the testing organisms. The oil 

obtained by SC-CO2 exhibited somewhat higher 

antimicrobial activity on S. epidermidis ATCC 49134 

rather than other microorganisms; whereas the oil 

obtained by petroleum ether showed more potent on S. 

aureus ATCC 6538, P. aeruginosa and C. albicans. The 

antimicrobial activities of the seed oil obtained by SC-CO2 

against B. subtilis 6633, P. vulgaris and A. niger V. Tiegh 

were less than those of other microorganisms; whereas 

the oil obtained by petroleum ether showed less inhibitory 

effects on B. subtilis 6633 and P. vulgaris. The MICs of 

the oil obtained by SC-CO2 extraction ranged from 

0.625% (v/v) to more than 5.000% (v/v) for all testing 

microorganisms; while as to petroleum ether, the values 

ranged from 0.625% (v/v) to more than 5.000% (v/v). The 

MBCs were similar or even higher than the corresponding 

MIC values. 

The activity components of Camptotheca acuminate 

D. seed oil 

The essential oil of C. sativum obtained on hydrodistillation 

was analyzed by GC–MS. We identified 24 

components, representing 92.7% of the total oil. Table 1 

summarized the constituents identified by GC–MS 

analysis, their retention indices and area percentages 

(concentrations). The oil was dominated by aldehydes 

and alcohols, which accounted for 55.5 and 36.3%, 

respectively. The major aldehydes were 2E-decenal 

(15.9%) and decanal (14.3%), while the alcohols mainly 

consisted of 2E-decen-1-ol (14.2%) and n-decanol

Table 1. The chemical compositions of C. acuminate D. seed oil obtained by supercritical carbon dioxide extraction (SC-CO2). 

No. RT Compounds 

Molecular 

formula 


MW Relative 

1. 3.246 Nonane 128 C9H20 0.25 

2. 3.652 propyl-cyclohexane, 126 C9H18 0.10 

3. 4.097 Hexanoic acid 116 C6H12O2 0.19 

4. 4.443 (E,E)-2,4-Heptadienal, 110 C7H10O 0.14 

5. 4.627 1-ethyl-Cyclohexene, 110 C8H14 0.05 

6. 6.079 Phenylethyl Alcohol 122 C8H10O 0.06 

7. 8.510 8-Methylene-3 oxatricyclo[5.2.0.0(2,4)]nonane 136 C9H12O 0.13 

8. 8.552 (E,E)-2,4-Decadienal, 152 C10H16O 0.09 

9. 8.872 2,7-Dimethyl-1,3,7-Octatriene, 136 C10H16 0.33 

10. 12.737 7-Bromomethyl-Pentadec-7-ene, 302 C16H31Br 0.06 

11. 14.169 Tetradecanoic acid 228 C14H28O2 0.07 

12. 14.574 Heneicosane 296 C21H44 0.09 

13. 15.015 3,7,11,15-Tetramethyl-2-hexadecen-1-ol 296 C20H40O 0.07 

14. 15.090 6,10,14-Trimethyl-2-Pentadecanone, 268 C18H36O 0.09 

15. 15.225 Pentadecanoic acid 242 C15H30O2 0.06 

16. 15.417 1,2-Benzenedicarboxylic acid, bis(2-methylpropyl) ester 278 C16H22O4 0.79 

17. 15.888 1,2-Benzenedicarboxylic acid, butyl octyl ester 334 C20H30O4 0.09 

18. 16.077 9-Hexadecenoic acid 254 C16H30O2 0.14 

19. 16.329 n-Hexadecanoic acid 256 C16H32O2 11.63 


21. 17.217 Heptadecanoic acid 270 C17H34O2 0.07 

22. 17.424 1-Octadecanol 270 C18H38O 0.14 

23. 17.537 2,6,10,15-Tetramethyl-Heptadecane, 296 C21H44 0.12 

24. 17.618 (Z,Z,Z)-9,12,15-Octadecatrienoic acid, methyl ester, 292 C19H32O2 0.10 

25. 17.714 Phytol 296 C20H40O 0.15 

26. 18.195 (Z,Z,Z)-9,12,15-Octadecatrien-1-ol, 264 C18H32O 54.92 

27. 18.265 Octadecanoic acid 284 C18H36O2 13.46 

28. 18.917 cis,cis,cis-7,10,13-Hexadecatrienal 234 C16H26O 0.55 

29. 19.297 Pentacosane 352 C25H52 0.15 

30. 19.542 11,14,17-Eicosatrienoic acid, methyl ester 320 C21H36O2 0.29 

31. 19.882 E-8-Methyl-7-dodecen-1-ol acetate 240 C15H28O2 0.24 

32. 20.912 Tetratetracontane 618 C44H90 0.56 

33. 21.084 2-Mono-Palmitin, 330 C19H38O4 0.99 

34. 21.672 Pentatriacontane 492 C35H72 0.16 

35. 21.975 Octadecanal 268 C18H36O 0.07 

36. 22.281 (Z,Z)-9,12-Octadecadienoic acid, trimethylsilyl ester 352 C21H40O2Si 0.18 

37. 22.350 (all-Z)-4,7,10,13,16,19-Docosahexaenoic acid, methyl ester, 342 C23H34O2 0.14 

38. 22.502 E,Z-1,3,12-Nonadecatriene 262 C19H34 3.94 

39. 22.585 Methyl(Z)-5,11,14,17-eicosatetraenoate 318 C21H34O2 4.30 

40. 22.683 1-Mono-Stearin, 358 C21H42O4 0.63 

41. 23.251 1-Hentetracontanol 592 C41H84O 0.66 

42. 23.667 (all-E)- 2,6,10,15,19,23-hexamethyl-2,6,10,14,18,22 Tetracosahexaene, 410 C30H50 1.39 

43. 24.183 6,6-Dimethyl-Bicyclo[3.1.1] hept-2-ene-2-ethanol, 166 C11H18O 0.06 

44. 24.268 Triacontane 422 C30H62 0.66 

45. 24.331 17-Pentatriacontene 490 C35H70 0.51 

46. 24.540 2-Nonadecanone 282 C19H38O 0.14 

47. 25.074 8-Methyltocol 402 C27H46O2 0.18 

48. 26.091 Octadecanal 268 C18H36O 0.10 

49. 26.519 β-Tocopherol 416 C28H48O2 0.28 

50. 26.862 Tetratriacontane 478 C34H70 0.15


Table 2. The chemical compositions of C. acuminate D. seed oil obtained by petroleum ether. 

No. RT Compounds Molecular formula MW Relative 

1. 3.235 1,3,5,7-Cyclooctatetraene 104 C8H8 0.10 

2. 5.199 3,6-dimethyl-Decane, 170 C12H26 0.06 

3. 6.183 1,2,4,5-tetramethyl-Benzene, 134 C10H14 0.07 

4. 8.071 Pentadecane 212 C15H32 0.07 

5. 8.301 4,6-dimethyl-Dodecane, 198 C14H30 0.15 

6. 8.923 Heptadecane 240 C17H36 0.04 

7. 11.008 Acetamidocyclohexane 141 C8H15NO 0.07 

8. 11.120 Cetyl iodide 352 C16H33I 0.12 

9. 11.158 Heptadecane 240 C17H36 0.06 

10. 11.393 2,4-bis(1,1-dimethylethyl)-Phenol, 206 C14H22O 0.07 


12. 13.629 Eicosane 282 C20H42 0.08 

13. 14.103 Hexadecane 226 C16H34 0.04 

14. 14.177 Tetradecanoic acid 228 C14H28O2 0.11 

15. 15.008 5-Isopropyl-1-methyl-1-cyclohexene 138 C10H18 0.07 

16. 15.095 6,10,14-trimethyl-2-Pentadecanone, 268 C18H36O 0.06 

17. 15.419 1,2-Benzenedicarboxylic acid, bis(2-methylpropyl) ester 278 C16H22O4 0.16 

18. 15.600 diethyl-Borinic acid, 86 C4H11BO 0.05 

19. 15.878 2,6,10,14-tetramethyl-Hexadecane, 282 C20H42 0.06 

20. 16.270 n-Hexadecanoic acid 256 C16H32O2 3.19 

21. 17.424 1-Octadecanol 270 C18H38O 0.06 


23. 17.714 Phytol 296 C20H40O 0.13 

24. 18.037 (Z,Z,Z)-9,12,15-Octadecatrienoic acid, methyl ester, 292 C19H32O2 19.19 

25. 18.162 (Z,Z)-9,12-Octadecadienoic acid 280 C18H32O2 3.35 

26. 18.442 1,54-Dibromotetrapentacontane 914 C54H108Br2 0.60 

27. 19.292 Pentacosane 352 C25H52 0.11 

28. 20.118 Tetracosane 338 C24H50 0.08 

29. 20.792 trans-9-Octadecen-1-ol 268 C18H36O 0.09 

30. 20.910 Tetratetracontane 618 C44H90 0.37 

31. 21.078 2-mono-Palmitin, 330 C19H38O4 0.14 

32. 21.673 Pentatriacontane 492 C35H72 0.07 

33. 21.906 (3.beta.)-Ergost-5-en-3-ol, 400 C28H48O 1.98 

34. 22.142 3-Fluorobenzoic acid, 4-hexadecyl ester 364 C23H37FO2 0.23 

35. 22.342 1-Pent-3-ynylcyclopenta-1,3-diene 132 C10H12 0.10 

36. 22.441 1,54-dibromo-Tetrapentacontane, 914 C54H108Br2 0.46 

37. 22.489 9-Octadecenoic acid, (E,E,E)-1,2,3-propanetriyl ester, 884 C57H104O6 0.31 

38. 22.569 (Z,Z,Z)-9,12,15-Octadecatrienoic acid, ethyl ester, 306 C20H34O2 0.34 

39. 22.608 2-Nonadecanone 282 C19H38O 0.29 

40. 22.675 Stigmastane-3,6-dione 428 C29H48O2 0.18 

41. 23.250 Pentafluoropropionic acid, heptadecyl ester 402 C20H35F5O2 0.28 

42. 23.483 1-Hexadecanesulfonyl chloride 324 C16H33ClO2S 0.46 

43. 23.664 All-trans-Squalene 410 C30H50 0.85 

44. 24.167 [4-[(trimethylsilyl)oxy]phenyl]-2-[(trimethylsilyl)oxy]-3-2-Propenoic acid, trimethylsilyl ester 396 C18H32O4Si3 26.53 

45. 24.265 .gamma.-Sitosterol 414 C29H50O 23.49 

46. 24.578 Fucosterol 412 C29H48O 1.38 

47. 25.034 

[3S-(3.alpha.,5a.alpha.,7a.alpha.,11a.beta.,11b.alpha.)]-dodecahydro 

-3,8,8,11a-tetramethyl-5H-3,5a-Epoxynaphth[2,1-c]oxepin, , 

278 C18H30O2 1.39 

48. 25.318 Betulin 442 C30H50O2 0.43 

49. 25.560 Cedran-8-yl acetate 264 C17H28O2 3.32 

50. 25.725 Lup-20(29)-en-3-one 424 C30H48O 4.30 

51. 26.091 cis-1-Chloro-9-octadecene 286 C18H35Cl 0.52 

52. 26.323 Lupenyl acetate 468 C32H52O2 3.79 

53. 26.514 .beta.-Tocopherol 416 C28H48O2 0.41

The rate of DPPH elimination (%) 

Figure 1. The rate of DPPH elimination. Values of each curve are means ± SD (n, 3). p < 0.01. 

Inhibation ratio (%) 

100 

90 

80 

70 

60 

50 

40 

30 

20 

100 

90 

80 

70 

60 

50 

40 

30 

20 

10 

0 10 20 30 40 50 60 70 80 90 100 

Concentration (%) 

0 10 20 30 40 50 60 70 80 90 100 

Concentration (%) 

Figure 2. β-Carotene bleaching test. Values of each curve are means ± SD (n, 3). p < 0.01. 

(13.6%). Other aldehydes in appreciable amounts were 

2E-tridecen-1-al (6.75%), 2E-dodecenal (6.23%), 

dodecanal (4.36%) and undecanal (3.23%). The alcohol 

undecanol (3.37%) was also in fairly good amount. The 

monoterpenes apinene (0.04%) and linalool (0.32%) 

were in trace amounts. However, the chemical 

composition of the essential oil was different from that 

observed from Tunisian plant materials (Msaada et al., 

2007). Indeed, in the Tunisia study, the predominant 

oil 

Oil 

obtained 

obtain by SC-CO2 by SC-CO2 

oil obtained by petroleum ether 

oil Oil obtained obtain by by SC-CO2 


BHT 


aldehyde was 2E-dodecenal, while in our study, it was 

2E-decenal. The essential oil was evaluated for 

antimicrobial activity against pathogenic strains of Gram 

positive (S. aureus and Bacillus spp.) and Gram negative 

(E. coli, P. aeruginosae, S. typhi, Klebsiella pneumoniae, 

and Proteus mirabilis) bacteria. It was active against all 

the bacterial strains except P. aeruginasae. 

The oil also showed an obvious antifungal activity 

against C. albicans and P. aeruginosae, which also been


18 

16 

14 

12 

10 

8 

6 

4 

2 

0 

Figure 3. The concentration of 50% inhibition (IC50) values of C. acuminate D. seed oil 

obtained by SC-CO2 or petroleum ether. 

Table 3. The inhibitory effects of C. acuminate D. seed oil obtained 

by SC-CO2 against all the testing organisms. 

Bacterial strain MIC (%) MBC (%) 

B. subtilis 6633 >5 >5 

S. aureus ATCC 6538 1.25 1.25 

S. epidermidis ATCC 49134 0.625 2.5 

E. coli ATCC 11229 2.5 >5 

P. vulgaris >5 >5 

P. aeruginosa 2.5 >5 

C. albicans 1.25 5 

A. niger V. Tiegh >5 >5 

Table 4. The inhibitory effects of C. acuminate D. seed oil 

obtained by petroleum ether against all the testing organisms. 

Bacterial strain MIC (%) MBC (%) 

B. subtilis 6633 >5 >5 

S. aureus ATCC 6538 0.625 1.25 

S. epidermidis ATCC 49134 2.5 2.5 

E. coli ATCC 11229 5 >5 

P. vulgaris >5 >5 

P. aeruginosa 0.625 1.25 

C. albicans 0.625 2.5 

A. niger V. Tiegh 1.25 5 

DPPH ß-Carotene-linoleic 

acid inhibition 

oil Oil obtained obtain by SC-CO2 

SC-CO2 


observed to be resistant to the essential oils from other 

plants, such as Achillea holosericea (Magiatis et al., 

1999) and Stachys species (Skaltsa et al., 2003). This 

microorganism is less susceptible to the anti-microbial 

properties of essential oils than others, and its tolerance 

is thought to result from its outer membrane (Cox and 

Radolf, 2001). And the ability of essential oil to disrupt the 

permeability barrier of cell membrane structures and the 

accompanying loss of chemiosmotic control are the most 

likely reason for its lethal action (Cox and Radolf, 2001). 

This antimicrobial activity against bacteria and fungi has 

also been demonstrated in essential oils extracted from 

C. sativum seeds (Lo Cantore et al., 2004). Although the 

concentrations of the oil were generally about 100 times 

more than those of the standard antibiotics 

(chloramphenicol), they showed marked antibacterial and 

antifungal activities, as demonstrated by their zones of 

inhibition (Tables 3 to 6). This concentration difference 

between the essential oil and the standard antibiotic can 

be explained by the fact that the active components in the 

oil comprise only a fraction of the oil. Therefore, the 

concentration of the active components could be much 

lower than the standard antibiotics we used. Importantly, 

if the active components were isolated and purified, they 

would probably show higher antimicrobial activities than 

those observed here. Among the Gram negative bacteria, 

the oil was very active against K. pneumoniae and P. 

mirabilis. The best activity was observed for the Gram 

positive bacteria. In general, the oil showed greater

Table 5. The antimicrobial activity curve of oil obtained by SC-CO2. 

Concentration/Time MIC/2 MIC (MBC) 2MIC Control 

0 5600 7000 8400 6200 

1 4000 4400 600 10600 

2 4400 1700 0 18800 

4 2400 600 0 23800 

8 6300 0 0 28600 

12 9500 0 0 42400 

24 20100 0 0 61800 

30 21300 0 0 64600 

Table 6. The antimicrobial activity curve of oil obtained by petroleum ether. 

Concentration/Time MIC/2 MIC (MBC) 2MIC Control 

antibacterial activity than antifungal activity (Tables 3 to 

6). Aldehydes and alcohols are known to be active but 

with different specificity and activity levels, which is 

related not only to the functional group but also to 

hydrogen bonding parameters (Skaltsa et al., 2003). As a 

minor component in this study, linalool has been found to 

have antimicrobial activity against various microbes, 

except for P. aeruginosae (Carson and Riley, 1995), 

which is also known to inhibit spore germination and 

fungal growth. The inhibition of sporelation appeared to 

arise from respiratory suppression of aerial mycelia 

(Lahlou and Berrada, 2001). 

Conclusions 

Our study showed that C. acuminate D. seed oils had 

extraordinary antioxidant and antibacterial activity in vitro. 

Due to its virulence, this seed oil can work as natural 

antioxidants and antimicrobial, which is a promising 

alternative to the use of synthetic antioxidants in food 

supplement or in pharmaceutical and cosmetic industry. 

But there have been few studies on the activity of C. 

acuminate D. seed oil. In this study, we evaluated its 

inhibitory activity in several common bacteria and 

estimated its antioxidant effectiveness by β-carotene 

bleaching and DPPH tests. Our results further 

demonstrated that C. acuminate D. seed oil had 

0 9300 11100 10400 11500 

1 5700 4400 1100 14000 

2 5000 3800 300 19300 

4 3100 2200 200 24000 

8 400 1200 0 28800 

12 1000 200 0 53400 

24 8800 6900 0 68800 

30 10600 11300 0 74800 


remarkable antioxidant and antibacterial activity, 

especially S. aureus ATCC 6538. The seed oil possesses 

various biological functions, notably antibacterial and 

Antioxidant properties that can be widely used as 

alternative to synthetic antioxidant or antibacterial. 

Therefore, we hope our study provides a foundation for 

future research of extracting ingredients from plants or 

herbs as natural antioxidant and antibacterial. 


We are grateful for the financial supports from the Key 

Research Subject of Jiamusi University (No. Szj2008- 

016). 

REFERENCES 

Carson CF, Riley TV (1995). Antimicrobial activity of the major 

components of the essential oil of Melaleuca alternifolia. J. Appl. 

Bacteriol., 78(3): 264-269. 

Cheng Y, Li M, Xu T (2008). Potential of poly (amidoamine) dendrimers 

as drug carriers of camptothecin based on encapsulation studies. 

Eur. J. Med. Chem., 43(8): 1791-1795. 

Cox DL, Radolf JD (2001). Insertion of fluorescent fatty acid probes into 

the outer membranes of the pathogenic spirochaetes Treponema 

pallidum and Borrelia burgdorferi. Microbiology, 147(Pt 5): 1161-1169. 

Friedrich J, List G, Heakin A (1982). Petroleum-free extraction of oil 

from soybeans with supercritical CO2 J. Am. Oil Chem. Soc., 59(7): 

288-292.


Gerard D, May P (2002). Herb and spice carbon dioxide extractsversatile, 

safe ingredients for premium food and health food. Food 

Tech. p 1-5. 

Gomes PB, Mata VG, Rodrigues AE (2007). Production of rose 

geranium oil using supercritical fluid extraction. J. Supercrit. Fluids, 

41(1): 50-60. 

King JW (2000). Advances in critical fluid technology for food 

processing. Food Sci. Tech. Today, 14(4): 186-191. 

Lahlou M, Berrada R (2001). Composition and niticidal activity of 

essential oils of three chemotypes of Rosmarinas officinalis L. 

Pharmaceutical Biol., I41: 207-210. 

Li S, Adair KT (1994). Camptotheca acuminata Decaisne. Xi Shu, a 

promising anti-tumor and anti-viral tree for the 21st century. 

Nacogdoches: Stephen F. Austin State University Press. 

Li S, Yi Y, Wang Y, Zhang Z, Beasley RS (2002). Camptothecin 

accumulation and variations in camptotheca. Planta Med., 68(11): 

1010-1016. 

Lo Cantore P, Iacobellis NS, De Marco A, Capasso F, Senatore F 

(2004). Antibacterial Activity of Coriandrum sativum L. and 

Foeniculum vulgare Miller Var. vulgare (Miller) Essential Oils. J. Agric. 

Food Chem., 52(26): 7862-7866. 

Lu ZG, Zheng GC, Yu SM (2007). Composition analysis of groundcherry 

seed oil by supercritical CO_2 extraction. Food & Machinery, 2: 88- 

89+113. 

Magiatis P, Melliou E, Skaltsounis AL, Chinou IB, Mitaku S (1999). 

Chemical composition and antimicrobial activity of the essential oils 

of Pistacia lentiscus var. chia. Planta Med., 65(8): 749-752. 

Molero Gómez A, Pereyra López C, Martinez de la Ossa E (1996). 

Recovery of grape seed oil by liquid and supercritical carbon dioxide 

extraction: a comparison with conventional solvent extraction. Chem. 

Eng. J. Biochem. Eng. J., 61(3): 227-231. 

Msaada K, Hosni K, Taarit MB, Chahed T, Marzouk B (2007). Variations 

in the essential oil composition from different parts of Coriandrum 

sativum L. cultivated in Tunisia. Ital. J. Biochem., 56(1): 47-52. 

NCCLS (2002). In National Committee for Clinical Laboratory 

Standards. Reference method for broth dilution antifungal 

susceptibility testing of yeasts: proposed standard. P 1-25. 

Oberlies NH, Kroll DJ (2004). Camptothecin and Taxol: Historic 

Achievements in Natural Products Research. J. Nat. Prod., 67(2): 

129-135. 

SalgIn U (2007). Extraction of jojoba seed oil using supercritical 

CO2+ethanol mixture in green and high-tech separation process. J. 

Supercrit. Fluids, 39(3): 330-337. 

Skaltsa HD, Demetzos C, Lazari D, Sokovic M (2003). Essential oil 

analysis and antimicrobial activity of eight Stachys species from 

Greece. Phytochemistry, 64(3): 743-752. 

Wall ME, Wani MC, Cook CE, Palmer KH, McPhail AT, Sim GA (1966). 

Plant Antitumor Agents. I. The Isolation and Structure of 

Camptothecin, a Novel Alkaloidal Leukemia and Tumor Inhibitor from 

Camptotheca acuminata1, 2. J. Am. Chem. Soc., 88(16): 3888-3890. 

Wu N, Zu Y, Fu Y, Kong Y, Zhao J, Li X, Li J, Wink M, Efferth T (2010). 

Antioxidant Activities and Xanthine Oxidase Inhibitory Effects of 

Extracts and Main Polyphenolic Compounds Obtained from 

Geranium sibiricum L. J. Agric. Food Chem., 58(8): 4737-4743. 

Yang ZW, Wu XM, Zu YG, Yang G, ZHou LJ (DOI: 10.1002/qua.23046). 

Understanding the chiral recognitions between neuraminidases and 

inhibitors: studies with DFT, docking and MD methods Int. J. 

Quantum. Chem., 

Yen GC, Duh PD (1994). Scavenging Effect of Methanolic Extracts of 

Peanut Hulls on Free-Radical and Active-Oxygen Species. J. Agric. 

Food Chem., 42(3): 629-632.




DOI: 10.5897/AJMR11.729 


Preparation, characterization and in vitro antimicrobial 

activity of compound sustained-release periodontal 

suppository of ornidazole and pefloxacin mesylate 

Rui Liu, Yan Jiang, Yan-hua Duan, Nan Li, Guo-dong Zhang, Xin Nie and Lu-chuan Liu* 

Department of Stomatology, Research Institute of Surgery and Daping Hospital, the Third Military Medical University, 

Chongqing 400042, China. 

Accepted 26 August, 2011 

Local delivery of sustained-release drugs in periodontal pocket is an effective approach for the 

treatment of periodontitis. The present study aimed to optimize and characterize the sustained-release 

periodontal suppository of compound ornidazole and pefloxacin mesylate (O&P) in vitro. Before 

suppository was prepared, the combined effect of O&P against dominant anaerobe and facultative 

anaerobe in periodontitis was investigated and then the optimal ratio of each drug was determined. 

After the compound suppository of O&P was prepared by cold compression, the optimal content of the 

suppository was determined through evaluating the bacteriostatic effect and then the sustained-release 

level of optimized suppository was investigated. There was no incompatibility between ornidazole and 

pefloxacin mesylate. When being applied in combination, they could exert synergistic bacteriostatic 

effect against ‘porphyromonas gingivalid’ and ‘fusobacterium nucleatum’, and additive effect against 

‘prevotella intermedia’ and ‘peptostreptococcus spp’ and inhibit anaerobe growth at a low 

concentration. The optimal ratio of O&P is 2:3 and the optimal content of suppository 20% in vitro; this 

suppository could release both drugs in a sustained manner for 12 h. The compound suppository of 

O&P can serve as one of the potential candidates for the treatment of periodontitis and has favorable 

sustained-release ability which can meet the requirement of clinical treatment of periodontitis. 

Key words: Ornidazole, pefloxacin mesylate, periodontitis, sustained-release delivery system. 

INTRODUCTION 

Periodontitis is a group of dentoalveolar infections and 

remains one of the major causes of adult tooth loss. 

These infections involve a variety of bacteria in local 

periodontal tissues. Plaques and their products are the 

original cause of parodontopathy (Zambon, 1996). To 

date, numerous investigations have been confirmed that 

anaerobe is a dominant type of pathogenic bacteria, 

including Porphyromonas gingivalid (Pg), Fusobacterium 

nucleatum (Fn), Prevotella intermedia (Pi) and 

Peptostreptococcus spp (Ps). Additionally, these 

facultative anaerobe such as Staphylococcus aureus 

(Sa), Staphylococcus epidermidis (Se), etc (Takahashi, 

*Corresponding author. E-mail: liuvery001@163.com. Fax: 86- 

23-68715568. 

1998; Paju et al., 2009), also have synergistic action in 

the process of pathogenesis. Although, the use of 

systemic antibiotic treatment of periodontitis has shown 

some benefits, multiple systemic doses of antibiotics 

have several drawbacks including inadequate antibiotic 

concentration (subtherapeutic level) at the site of 

periodontal pocket and high plasma concentration. 

Inadequate antibiotic concentration is not able to 

continuously inhibit or kill the pathogenic microorganisms, 

and fail to control the periodontal inflammation which may 

facilitate the reconstruction of damaged tissues. High 

plasma concentration may be associated with bacterial 

resistance and occurrence of side effects (Bidault et al., 

2007a, b). These disadvantages have evoked an interest 

in the development of novel local drug delivery systems 

for the treatment of periodontal diseases (Greenstein, 

2006; Hussein et al., 2007).


With the development of modern pharmacy, sustainedrelease 

drug has been used in the treatment of 

parodontopathy (Vandekerckhove et al., 1997; Vyas et 

al., 2000). If a therapeutic effective concentration can be 

maintained in the periodontal pocket for a desired period, 

local sustained-release drug may significantly improve 

the therapeutic efficacy of periodontitis. Moreover, sideeffects 

can also be greatly decreased due to avoidance of 

high plasma concentration (Vyas et al., 2000). Ornidazole 

is a nitroimidazole antiprotozoal agent and has better 

anti-anaerobic activity than quinolones (Quirynen et al., 

2002). Although, anaerobe is the dominant population 

involving in periodontitis, facultative anaerobe also plays 

a part role in the periodontal destruction. Pefloxacin 

mesylate is a quinolone antibiotic and has better activity 

against facultative anaerobes than nitroimidazoles (Wang 

et al., 2007). In the present study, the optimal ratio and 

optimal content of ornidazole (O) and pefloxacin mesylate 

(P) were determined to prepare the compound O&P 

sustained-release periodontal suppository for the 

treatment of periodontitis. 


Dominant pathogenic bacteria of periodontitis 

Pg, Fn, Pi, Ps, Mutans streptococcu (Ms), Sa and Se are standard 

strain purchased from the R&D Department of P&G company. 

Instruments for experiments 

Agar medium (Shanghai Li Chen Biotechnology Co., Ltd.), drug 

susceptibility papers (Shanghai Wufeng Scientific Instruments Co., 

Ltd.), high performance liquid chromatograph (HPLC) (Shanghai 

Wufeng Scientific Instruments Co., Ltd.), O&P standard substance 

and chromatography-pure methanol (Shanghai Shengke 

Biotechnology Co., Ltd.) were used. SPSS13.0 was used for 

statistical analysis. 

In vitro study on the anti-microbic characteristic of O&P 

To investigate whether O&P have synergic anti-microbic action, the 

Kirby-Bauer test was applied. Round arid anti-microbic filter papers 

measuring 6 mm in diameter were prepared and soaked with 5 µg 

of ornidazole or pefloxacin mesylate, respectively. Then, these 

papers were put onto the agar plate containing Pg, Fn, Pi, Ps, Sa or 

Se. There were one ornidazole paper and one pefloxacin mesylate 

paper on each agar plate. Then, the synergic action was 

preliminarily estimated by the shape of intersecting angles between 

two inhibition rings. The interaction was further assessed by using 

agar dilution method and the effects evaluated with fractional 

inhibitory concentration (FIC) and minimun inhibitory concentration 

(MIC). In brief, Pg, Fn, Pi, Pa, Sa, Se (2 × 107 ml) were inoculated 

into a Mueller-Hinton broth and dispensed at 0.1 ml/well in 96-well 

plates. MICs were determined by a serial twofold dilution of 

ornidazole and/or pefloxacin mesylate from 2 to 1/32 of MIC alone. 

After 24 h of incubation at 37°C, the minimal compound 

concentration at which the ornidazole/pefloxacin mesylate 

prevented the growth of a given organism was determined and 

defined as the MIC of the compound. The MIC was determined in 

three independent assays. 

Screen on the optimal ratio of O&P 

In the agar plates of Pg, Fn, Pi, Ps and Fn, the ditch plate method 

of agar diffusion was employed to detect anti-anaerobic effects of 

O&P at different ratios. L36 (62) orthogonal table was designed to 

select the optimal ratio of O&P on the 4 strains of anaerobes. In the 

orthogonal table, O&P are two factors and each factor is classified 

into 6 levels. In the orthogonal experiment, there were 36 groups in 

which the ratio of O&P varied from 1:6 to 6:1 and only 23 groups 

were finally subjected to analysis because sever groups were 

integrated into one (for example ratios at 1:2, 2:4 and 3:6 were the 

same to 1:2) (Table 1). According to findings in the orthogonal 

experiment, the range of each factor was calculated: the larger the 

range, the higher the antibacterial effect. Single-factor analysis of 

variance was used to identify the critical point of ratio for each 

anaerobe. 

In order to get the optimal ratio, the MIC and MIC50 of dominant 

periodontal pathogenic bacteria were determined according to each 

critical point. 

Preparation of compound O&P sustained-release periodontal 

suppository 

A special mold (Figure 1) of suppository was designed according to 

anatomic shape and the depths of different periodontal pockets. 

Cold compression was employed for the preparation of suppository. 

The carrier which can reduce the application of antibacterial agents 

was composed of ethyl cellulose (EC) and hydroxypropyl methyl 

cellulose (HPMC). Firstly, EC was swollen with 95% alcohol, and 

then with sufficient distilled water. The glycerine, pefloxacin 

mesylate and ornidazole were added in a proper order. When all 

these materials were mixed sufficiently, HPMC was then added to 

the mixture. After agitation, alcohol was volatilized, the mixture was 

swollen to doughing time and then it was taken into the mold. 

Screening optimal content of compound O&P periodontal 

suppository 

Different contents (1, 2, 5, 10 and 20%) of O&P periodontal 

suppository were prepared. In every content group, three 

suppositories with same content were completely dissolved in 3 ml 

of purified water. After being filtrated, 5 μl of drug-filtrate was put 

into the drug -sensitive paper plates measuring 6 mm in diameter. 

So, in the paper plate of each group, the drug content was 0.5, 1, 

2.5, 5 and 10 μg; which corresponded to the contents of 

suppositories. Then, Kirby-Bauer method was used to estimate the 

bacteriostatic effect on the 4 strains of anaerobic bacteria (Pg, Fn, 

Pi and Ps), and 3 strains of facultative anaerobe (Ms, Sa and Se). 

The optimized content of suppository was determined by comparing 

the size of inhibition rings. 

Medicine release level of compound sustained-release 

periodontal suppository in vitro 

Cumulative release ratio of drugs was detected through HPLC. The 

conditions for HPLC were chromatographic column: C18 (250 × 4.6 

mm, 5 µm); mobile phase: 0.1 mol/L monopotassium phosphate 

solution-methanol (60:40); detecting wavelength: 277 nm; flow 

velocity: 1.0 ml/min; sampling size: 20 µl; column temperature: 

30°C. Firstly, the standard curves of O&P were delineated and the 

peak areas were corresponding to the drug concentration. Then, 

the suppositories with 20% drug were soaked into a beaker 

containing 5 ml of purified water and stirred every 10 min (n = 5). At 

the designed time points (0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 15, 

18 and 24 h), 200 µl of fluid were collected for the detection and

Table 1. Ratio of ornidazole and pefloxacin mesylate for testing. 

Rui et al. 5865 

Group 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 

Ornidazole 6 5 4 3 5 2 5 3 4 5 6 1 5 4 3 2 3 1 2 1 1 1 1 

Pefloxacin 1 1 1 1 2 1 3 2 3 4 5 1 6 5 4 3 5 2 5 3 4 5 6 

Figure 1. Mold for sustained-release periodontal suppository. The mould is opened (A) and the mould is 

closed (B). The mold of suppository is made of stainless steel. According to anatomic shape and the depth 

of different periodontal pockets, the die hole of anterior teeth is 3 ~ 4 mm in length, 2 mm in width and 350 

to 500 μm in thickness. The die hole of posterior teeth is 3 to 4 mm in length, 4 mm in width, 350 to 500 

μm in thickness. All the die holes are shuttle-shaped with obtuse margin. 

additional 200 µl of purified water was added to the beaker. The 

peak areas at different time points were measured by HPLC. 

According to the standard curve, average concentrations at different 

time points were calculated. Based on the average concentrations, 

the discharge amounts at different time points were obtained. 

Finally, the release curves of two drugs were delineated 

according to the time and corresponding release rate. 

RESULTS 

Anti-microbic characteristic of O&P 

On the anaerobe flat plate, the intersecting angles of two 

inhibition rings of two drugs displayed straightened or 

even evaginated which suggests they may have 

synergistic action against anaerobe (Figure 2A). On the 

facultative anaerobe flat plate, there was no inhibition 

rings of ornidazole (Figure 2B); which indicates that they 

have independent effect against facultative anaerobe and 

only pefloxacin mesylate exerts anti-anaerobic effect. FIC 

of two drugs against anaerobe were lower than 1, further 

demonstrating that both drugs can confer synergetic or 

additive effect against anaerobes when being used 

together; and they can inhibit the growth of anaerobes at 

a low concentration (Table 2). For the facultative 

anaerobe, when two drugs were used together, the 

concentration of pefloxacin was equal to or higher than its 

own MIC and the FIC was 1.0625, which suggests that, 

the activities of two drugs are independent and the 

bactriostatic effect depends on pefloxacin mesylate alone 

(Table 2). 

Optimization on the ratio of O&P 

The results of orthogonal test are shown in Table 3. 

Analysis showing the range of ornidazole and pefloxacin 

could be calculated (Table 4). The range of ornidazole 

was larger than that of pefloxacin which provides the 

evidence that ornidazole has high anti-anaerobic activity 

than pefloxacin mesylate. In each group, the length of 

bacteriostatic area at each ratio was analyzed by singlefactor 

analysis of variance. For the Pg, Fn, Pi and Ps, the 

critical point of the ratio of two drugs was 1:2, 2:3, 2:3 

and 1:1, respectively. According to the 3 critical points, 

the MIC and MIC50 of dominant periodontal pathogenic 

bacteria were determined (Table 5). The MIC of 

ornidazole against Pg, Fn, Pi, Ps was 0.062, 0.062, 0.125 

and 0.25 mg/L, respectively; showing that all these 4 

kinds of bacteria are very sensitive to ornidazole. The 

MIC of pefloxacin mesylate against these bacteria was 

0.25, 0.25, 0.5 and 4 mg/L, respectively; showing that 

pefloxacin mesylate has bacteriostatic effect on all the 4 

kinds of bacteria. The MIC of pefloxacin mesylate against 

Sa and Se was 0.062 and 0.125 mg/L, respectively; also 

showing a bacteriostatic effect. 

When ornidazole was combined with pefloxacin 

mesylate, the MIC of ornidazole or pefloxacin mesylate 

against anaerobes was lower than their own MIC. The 

results demonstrated that two drugs have synergic action


Figure 2. Compound synergic anti-microbic characteristic of ornidazole and pefloxacin mesylate with 

Kirby-Bauer method. The synergic anti-microbic characteristic of ornidazole and pefloxacin mesylate (A). 

On the anaerobe flat plate, the intersecting angles of two inhibition rings of two drugs displayed 

straightened or even evaginated which suggests they have synergistic action against anaerobe (B). The 

indenpedent anti-microbic characteristic of ornidazole and pefloxacin mesylate. On the facultative 

anaerobe flat plate, there was no inhibition rings of ornidazole, which suggests that two drugs have 

indenpedent actions against facultative anaerobe and the bactriostasis depends on pefloxacin mesylate 

alone. 

Table 2. FIC of compound ornidazole and pefloxacin mesylate. 

Bacterium Ornidazole (MIC) Pefloxacin mesylate (MIC) FIC 

Porphyromonas gingivalid 1/4 1/16 0.3125 

Anaerobe 

Fusobacterium nucleatum 

Prevotella intermedia 

1/4 

1/4 

1/8 

1/16 

0.375 

0.5625 

Peptostreptococcus spp 1/4 1/4 0.75 

Facultative anaerobe 

Staphylococcus aureus 1/16 1 1.0625 

Staphylococcus epiermidis 1/16 1 1.0625 

FIC = (MICDrug A in combination/MICDrug A alone) + (MICDrug B in combination/MICDrug B alone). FIC ≤ 0.5, 0.5 < FIC≤1, 1 < FIC ≤ 2, and > 2 were defined as 

synergistic, additive, independent, and antagonism, respectively. All FICs of two drugs against anaerobes were less than 1. For Pg and Fn, the 

FIC was less than 0.5 which suggests two drugs have synergistic action. For Pi and Ps, the FIC was between 0.5 and 1 which suggests two drugs 

have additive action. All FICs of two drugs against facultative anaerobes were higher than 1 but lower than 2. For Sa and Se, the FIC was 1.0625, 

which suggests two drugs have independent action and the bactriostatic effect depends on pefloxacin mesylate alone. 

against the anaerobic bacteria. Especially, MIC against 

Pg was kept constantly at 0.062 mg/L. The MIC at 3 

different ratios of O&P showed no significant difference 

against 4 kinds of anaerobic bacteria. The antiblastic 

effect was not significantly diminished when reducing the 

ratio of ornidazole or increasing that of pefloxacin. 

Optimal content of each drug in the compound O&P 

periodontal suppository 

The inhibition rings were examined at different drug 

contents ranging from 1 to 20% and results showed that 

the anti-bacterial effects of both drugs were dosedependent 

against the 7 major pathogenic bacteria 

(Figure 3A). The 20% drug had the strongest antibacterial 

effect against Sa (inhibition ring was 27 mm in 

diameter) and 1% drug had the weakest anti-bacterial 

effect against Ms (inhibition rings was 7.9 mm in 

diameter). The sizes of bacterial inhibition rings against 

the 7 different bacteria decreased in the following order: 

Ms, Ps, Pi, Fn, Pg, Se and Sa (Figure 3B). 

In vitro release of sustained-release periodontal 

suppository containing 20% drug 

HPLC showed the retaining times of ornidazole 

(Bodyguard Pharmaceutical Co. Ltd., China) and 

pefloxacin mesylate standard substance (North China

Table 3. Anti-anaerobic effect of different ratios of ornidazole and pefloxacin mesylate. 

Factor Anti-anaerobic effects (mm) 

No. O P Pg Fn Pi Ps 

y1 6 1 31.2±1.37 31.0±1.17 28.3±1.06 26.4±1.28 

y2 6 2 30.5±1.07 30.9±1.22 28.3±0.87 26.3±0.91 

y3 6 3 30.8±1.05 30.83±1.35 27.91±0.95 25.72±0.87 

y4 6 4 30.5±1.61 30.6±0.93 27.3±0.74 25.1±1.16 

y5 6 5 30.4 ±1.21 30.6±1.07 27.0±1.13 24.8±1.13 

y6 6 6 30.0±0.94 30.4±1.02 26.9±1.02 24.5±0.74 

y7 5 1 31.4±1.53 31.1±1.45 28.3±0.87 26.0±.1.03 

y8 5 2 31.0± 1.32 30.7±1.10 28.1±0.89 26.1±1.01 

y9 5 3 30.2±1.32 30.7±1.01 27.6±0.86 25.1±0.99 

y10 5 4 30.5±1.34 30.4±0.95 27.1±0.81 25.1±1.15 

y11 5 5 30.0±0.94 30.4±1.02 26.9±1.02 24.5±0.74 

y12 5 6 29.9±1.32 30.0±1.55 26.8±1.11 23.4±0.85 

y13 4 1 31.2± 1.36 31.1±1.42 28.2±0.94 26.4±0.96 

y14 4 2 30.86±1.05 30.83±1.35 27.91±0.95 25.72±0.87 

y15 4 3 29.9 ±1.26 30.5±1.09 27.3±0.97 25.0±0.99 

y16 4 4 30.0±0.94 30.4±1.02 26.9±1.02 24.5±0.74 

y17 4 5 29.9±1.33 29.8±1.07 26.8±1.22 23.2±0.67 

y18 4 6 30.1±1.05 29.5±1.06 26.7±1.01 22.8±0.99 

y19 3 1 30.5±1.07 30.9±1.22 28.3±0.87 26.3±0.91 

y20 3 2 30.5±1.61 30.6±0.93 27.3±0.74 25.1±1.16 

y21 3 3 30.0±0.94 30.4±1.02 26.9±1.02 24.5±0.74 

y22 3 4 30.2±1.50 30.0±1.02 26.9±0.99 22.9±0.87 

y23 3 5 29.3±1.33 29.0±0.94 26.5±0.74 22.8±1.02 

y24 3 6 29.2±1.52 28.6±0.72 25.9±1.00 22.6±1.20 

y25 2 1 30.4±1.29 30.8±1.37 27.7±1.13 25.5±1.35 

y26 2 2 30.0±0.94 30.4±1.02 26.9±1.02 24.5±0.74 

y27 2 3 30.1±1.05 29.5±1.06 26.7±1.01 22.8±0.99 

y28 2 4 29.2±1.52 28.6±0.72 25.9±1.00 22.6±1.20 

y29 2 5 28.3±0.95 27.6±0.96 24.2±1.16 22.4±1.29 

y30 2 6 27.1±1.12 26.5±1.16 23.6±1.01 21.8±0.94 

y31 1 1 30.0±0.94 30.4±1.02 26.9±1.02 24.5±0.74 

y32 1 2 29.2±1.52 28.6±0.72 25.9±1.00 22.6±1.20 

y33 1 3 27.1±1.12 26.5±1.16 23.6±1.01 21.8±0.94 

y34 1 4 26.7±1.17 26.0±0.81 22.7±0.91 21.5±1.02 

y35 1 5 26.0±1.13 25.5±0.89 22.1±1.15 20.2±0.98 

y36 1 6 26.0± 0.78 25.1±0.80 21.3±1.59 19.8±0.89 

Pharmaceutical Group Co. Ltd., China) were 10.1 and 

13.7 min, respectively (Figure 4A). The regression 

equation of ornidazole was y = 5.7507x + 1.0714, r = 

0.9993 (Figure 4B) and that of pefloxacin mesylate was y 

= 1.1279x + 0.9904, r = 0.9999 (Figure 4C). The peak 

areas, average concentrations and release amounts of 

O&P at different time points are shown in Tables 6 and 7. 

Ornidazole was released by 9.08% at 30 min, 59.50% at 

5 h and 98.30% at 13 h, while pefloxacin mesylate was 

released by 15.26% at 30 min, 45.00% at 5 h and 

96.01% at 13 h (Figure 4D). 

DISCUSSION 


The appearance of periodontal pocket is one of the 

important signs of periodontitis (Liu et al., 2003). The 

periodontal pocket provides a natural space for the local 

delivery system (Mundargi et al., 2007). Meanwhile, the 

gingival crevicular fluid provides a liquid medium for the 

release of drug from a carrier and for its distribution 

throughout the periodontium (Jain et al., 2008). 

Therefore, a therapeutic effective concentration of an 

anti-microbial agent could be maintained in the periodontal


Table 4. Antibacterial index of ornidazole and pefloxacin mesylate with range analysis. 

Bacterium Ornidazole Pefloxacin mesylate 

Porphyromonas gingivalid R (1) = 7.5955 R (2) = 2.6142 

Fusobacterium nucleatum R (1) = 3.3219 R (2) = 1.8027 

Prevotella intermedia R (1) = 8.3327 R (2) = 2.7861 

Peptostreptococcus spp R (1) = 10.8025 R (2) = 4.7611 

The range of ornidazole was larger than that of pefloxacin which provides the evidence that 

ornidazole has stronger sensitivity than pefloxacin mesylate against anaerobes. The range 

can be calculated from Table 3. R (1) = [ k 1 (1) — µ] 2 + [ k 2 (1) — µ] 2 + [ k 3 (1) — µ] 2 + [ k 4 (1) — 

µ] 2 (1) 2 (1) 2 (2) (2) 2 (2) 2 (2) 2 (2 ) 

+ [ k 5 — µ] + [ k 6 — µ] ; R = [ k 1 — µ] + [ k 2 — µ] + [ k 3 — µ] + [ k 4 — 

µ] 2 + [ k 5 (2) — µ] 2 + [ k 6 (2) — µ] 2 ; µ = (y1 + y2 + y3 + y4………. +.y36) × 1/36; k1 (1) = y1 + y2 + y3 + 

y4 + y5 + y6: k 1 (1) = 1/6 k1 (1) : k2 (1) = y7 + y8 + y9 + y10 + y11 + y12: k 2 (1) = 1/6 k2 (1) ; k1 (2) = y1 + y7 + 

(2) (2) (2) (2) (2) 

y13 + y19 + y25 + y31 k 1 = 1/6 k1 : k2 = y2 + y8 + y14 + y20 + y26 + y32: k 2 = 1/6 k2 and so 

on. 

Table 5. MIC in 4 strains of anaerobes and 3 strains of facultative anaerobes with 3 different critical points in ratio. 

Bacterium (strain) 

Ornidazole 

MIC/MIC50 

Pefloxacin mesylate 

MIC/MIC50 

1:1 

MIC/MIC50 

2:3 

MIC/MIC50 

1:2 

MIC/MIC50 

Pg 0.062 0.25 0.062 0.062 0.062 

Fn 0.062 0.25 0.062 0.062 0.125 

Pi 0.125 0.5 0.125 0.25 0.25 

Ps 0.25 4 0.25 0.5 1 

Sa >256 0.06~8/0.5 0.125~32/1 0.06~16/0.5 0.06~8/0.5 

Se >256 0.125~16/1 0.25~32/2 0.25~32/1 0.25~16/1 

Ms >256 0.125~64/4 0.25~64/8 0.25~64/4 0.125~64/4 

Figure 3. In vitro bacteriostatic effect of ornidazole and pefloxacin mesylate periodontal suppository with five different drug contents. 

Diameters of inhibition zones at five different drug contents against one bacterium (A); bacteriostatic effect against differ ent bacteria at 

different drug contents (B). An obvious dose-dependent manner was observed in the anti-bacterial effect against the 7 major suspected 

pathogenic bacteria.

Figure 4. In vitro release of sustained-release suppository containing 20% drug. Chromatography of ornidazole 

and pefloxacin mesylate standard substance (A); A represents ornidazole TR = 10.166 min and B pefloxacin TR 

= 13.722 min; the standard curve of ornidazole (B); the standard curve of pefloxacin mesylate (C) and the 

release curve of ornidazole and pefloxacin mesylate in vitro (D). 

Table 6. The peak area and delayed release of ornidazole in the periodontal suppository. 


Time (h) Peak area Average concentration (mg/ml) Release amount (mg) Accumulative release degrees (%) 

0.5 5.757 0.036 0.18 9.08 

1 8.781 0.055 0.10 14.63 

2 12.793 0.080 0.14 22.01 

3 20.629 0.129 0.26 36.25 

4 26.227 0.164 0.20 47.20 

5 32.623 0.204 0.23 59.50 

6 37.900 0.237 0.21 70.86 

7 41.579 0.260 0.16 79.47 

8 44.137 0.276 0.13 86.55 

9 47.816 0.299 0.07 90.18 

10 47.816 0.299 0.06 93.34 

11 48.775 0.305 0.03 96.79 

13 47.655 0.298 0.03 98.30 

pocket for a desired period, which is the basis of; and 

ensure the successful treatment of periodontitis. A variety 

of potentials of sustained-release preparations have been 

displayed in this treatment (Chen et al., 2006). In this


Table 7. The peak area and delayed release of pefloxacin mesylate in the periodontal suppository. 

Time (h) Peak area 

Average concentration 

(mg/ml) 

Release amount (mg) Accumulative release degrees (%) 

0.5 101.470 0.084 0.42 15.26 

1 155.154 0.128 0.24 24.10 

2 199.423 0.164 0.22 32.11 

3 215.410 0.177 0.10 35.80 

4 236.315 0.194 0.12 40.23 

5 258.449 0.212 0.13 45.00 

6 319.935 0.262 0.29 55.45 

7 388.110 0.317 0.33 67.62 

8 444.136 0.363 0.29 78.33 

9 467.500 0.382 0.17 84.48 

10 483.486 0.395 0.14 89.64 

11 498.243 0.407 0.14 94.57 

13 488.405 0.399 0.04 96.01 

study, in order to provide a high anti-microbial activity, we 

designed local compound O&P periodontal suppository 

which consisted of ornidazole, pefloxacin mesylate and 

carrier. The carrier was composed of EC and HPMC, 

materials widely used in controlled release system and its 

application reduced the content of antibacterial agents. 

The Kirby-Bauer test and FIC detection indicated that 

there was no incompatibility between ornidazole and 

pefloxacinmesylate, and they could exert synergetic 

effect against anaerobe and inhibit the anaerobic growth 

at a low concentration when they were applied together. 

For facultative anaerobe, however, the anti-bacterial 

effect depended on pefloxacin mesylate alone. In this 

study, the ratio of two drugs was for the first time 

optimized. Orthogonal experiment was performed to 

determine the optimal ratio against 4 strains of 

anaerobes. Through single-factor analysis of variance, 

three critical points of ratio were identified: 1:2, 2:3 and 

1:1. According to 3 critical points, the MIC and MIC50 of 

the dominant periodontal pathogenic bacteria were 

determined. Among the 3 different critical points, for the 

anaerobes, there were no significant differences in the 

anti-bacterial activities and their MIC. The present study 

also demonstrated that the antibacterial activities of the 

compound increased with the increase of pefloxacin 

when the anti--bacterial effect against facultative 

anaerobes was taken into account. Because two drugs 

have independent anti-bacterial effect against facultative 

anaerobe and the bactriostatic effect depends on 

pefloxacin mesylate alone; that is to say, the ratio of 1:2 is 

preferred. However, periodontal diseases are 

predominantly caused by anaerobic infection, and 

quinolones have been clinically applied for years, there is 

a possibility of drug resistance. 

In addition, ornidazole has first expose effect and its 

anti-bacterial effect is concentration dependent (Kamma 

et al., 2000). Moreover, the anti-bacterial activity of 

pefloxacin mesylate against anaerobes in vivo should be 

further studied (Appelbaum, 1999). Taking the reasons 

earlier mentioned into account, we speculate that the 

ratio of 2:3 is a preferred ratio. O&P are freely soluble in 

gingival crevicular fluid, and hence selection of releaseretarding 

excipient is necessary to achieve a constant 

input rate in the gingival crevicular (Paquette et al., 2008; 

Akncbay et al., 2007; Bosco et al., 2009). Because of its 

flexibility, HPMC (a hydrophilic polymer matrix) was used 

to obtain a desirable drug release profile and broad 

regulatory acceptance. HPMC has been well known to 

retard drug release by swelling in aqueous media (Li et 

al., 2005). However, for a water soluble drug, application 

of a hydrophilic matrix system alone is restricted because 

of rapid diffusion of dissolved drug through the hydrophilic 

gel network. In such circumstances, EC, one of 

hydrophobic polymers is required along with the HPMC 

for developing sustained-release delivery system (Barat 

et al., 2007). 

Incorporation of a high concentration of EC controls the 

drug release in a better manner, which may be attributed 

to the decreased penetration of solvent molecules in the 

presence of hydrophobic polymer, leading to decreased 

drug diffusion from the matrix (Bromberg et al., 2001). 

Furthermore, because of the presence of EC which is 

generally responsible for the hardness of suppository, the 

suppository is not susceptible to being cracked when it is 

held by pliers. The sustained-release materials used in 

this study have certain drug saturation. When the drug 

content is higher than 20%, the precipitation of drug may 

occur. So, 5 different contents (1, 2, 5, 10 and 20%) were 

applied. The optimal content was selected by comparing 

the size of inhibition rings. Statistical analysis 

demonstrated that content at 20% has obvious 

advantages. The in vitro experiment on the sustainedrelease 

periodontal suppository containing 20% drug 

revealed that the average release rates of ornidazole and

pefloxacin mesylate were 0.14 and 0.20 mg/h, 

respectively; and the accumulated release percentages 

of ornidazole and pefloxacin mesylate at 13 h were 98.3 

and 96.01%, respectively. Moreover, the initial burst 

release was not observed. All the parameters related to 

sustained-release behavior were within the limits 

proposed by the pharmacopeia. 

The present study indicated that the compound 

periodontal suppository containing 20% drug had potent 

sustained-release bacteriostatic effect against the 

suspected pathogenic bacteria. Especially, for the 

sensitive bacteria, the sustained-release could be 

sustained for about 24 h. For the non-sensitive bacteria 

such as Ps and Ms, the sustained-release could be 

sustained for about 10 h. These features demonstrated 

that the suppository can meet the requirement of 

sustained-release. So, in the treatment of periodontitis, 

the suppository may be medicated every other day. This 

study affirmatively provides a better understanding of the 

synergistic effect of O&P which may be helpful for the 

periodontal therapies. Our results provide convincing 

evidence and useful information for future clinical 

application of sustained-release periodontal suppository 

containing 20% drug. In future study, we will further 

optimize the periodontal suppository. For example, the 

ratio of sustained-release materials should be optimized 

which may prolong the sustained-release time. 

In addition, the therapeutic effect of periodontal 

suppository will be investigated in rats with ligatureinduced 

periodontitis. 


This work was supported by a grant from the Science and 

Technology foundation of Chongqing China (Project 

No.2004BB5065 and No.2009AC5019) 

REFERENCES 

Akncbay H, Senel S, Ay ZY (2007). Application of chitosan gel in the 

treatment of chronic periodontitis. J. Biomed. Mater. Res. B. Appl. 

Biomater. 80 (2): 290-296. 

Appelbaum PC (1999). Quinolone activity against anaerobes. Drugs 58 

Suppl 2: 60-64. 

Barat R, Srinatha A, Pandit JK, Mittal N, Anupurba S (2007). 

Ethylcellulose inserts of an orphan drug for periodontitis: preparation, 

in vitro, and clinical studies. Drug Deliv. 14 (8): 531-538. 

Bidault P, Chandad F, Grenier D (2007a). Risk of bacterial resistance 

associated with systemic antibiotic therapy in periodontology. J. Can. 

Dent. Assoc. 73(8): 721-725. 

Bidault P, Chandad F, Grenier D (2007b). Systemic antibiotic therapy in 

the treatment of periodontitis. J. Can. Dent. Assoc. 73(6): 515-520. 

Bosco JM, Lopes BM, Bosco AF, Spolidorio DM, Marcantonio RA 

(2009). Local application of tetracycline solution with a microbrush: 

an alternative treatment for persistent periodontitis. Quintessence. 

Int. 40(1): 29-40. 

Bromberg LE, Buxton DK, Friden PM (2001). Novel periodontal drug 

delivery system for treatment of periodontitis. J. Control Release, 

71(3): 251-259. 


Chen FM, Zhao YM, Wu H, Deng ZH, Wang QT, Zhou W, Liu Q, Dong 

GY, Li K, Wu ZF, Jin Y (2006). Enhancement of periodontal tissue 

regeneration by locally controlled delivery of insulin-like growth factor- 

I from dextran-co-gelatin microspheres. J. Control. Release. 114(2): 

209-222. 

Greenstein G (2006). Local drug delivery in the treatment of periodontal 

diseases: assessing the clinical significance of the results. J. 

Periodontol. 77 (4):565-578. 

Hussein I, Ranka M, Gilbert A, Davey K (2007). Locally delivered 

antimicrobials in the management of periodontitis: a critical review of 

the evidence for their use in practice. Dent. Update. 34(8): 494-496, 

499-502, 505-496. 

Jain N, Jain GK, Javed S, Iqbal Z, Talegaonkar S, Ahmad FJ, Khar RK 

(2008). Recent approaches for the treatment of periodontitis. Drug. 

Discov. Today. 13 (21-22):932-943. 

Kamma JJ, Nakou M, Mitsis FJ (2000). The clinical and microbiological 

effects of systemic ornidazole in sites with and without subgingival 

debridement in early-onset periodontitis patients. J. Periodontol. 

71(12): 1862-1873. 

Li CL, Martini LG, Ford JL, Roberts M (2005). The use of hypromellose 

in oral drug delivery. J. Pharm. Pharmacol. 57(5): 533-546. 

Liu L, Wen X, He H, Shi J, Ji C (2003). Species-specific DNA probe for 

the detection of Porphyromonas gingivalis from adult Chinese 

periodontal patients and healthy subjects. J. Periodontol. 74(7): 1000- 

1006. 

Mundargi RC, Srirangarajan S, Agnihotri SA, Patil SA, Ravindra S, Setty 

SB, Aminabhavi TM (2007). Development and evaluation of novel 

biodegradable microspheres based on poly(d,l-lactide-co-glycolide) 

and poly(epsilon-caprolactone) for controlled delivery of doxycycline 

in the treatment of human periodontal pocket: in vitro and in vivo 

studies. J. Control. Release, 119 (1):59-68. 

Paju S, Pussinen PJ, Suominen-Taipale L, Hyvonen M, Knuuttila M, 

Kononen E (2009). Detection of multiple pathogenic species in saliva 

is associated with periodontal infection in adults. J. Clin. Microbiol. 

47(1): 235-238. 

Paquette DW, Ryan ME, Wilder RS (2008). Locally delivered 

antimicrobials: clinical evidence and relevance. J. Dent. Hyg. 82 

Suppl 3: 10-15. 

Quirynen M, Teughels W, De Soete M, van Steenberghe D (2002) 

Topical antiseptics and antibiotics in the initial therapy of chronic adult 

periodontitis: Microbiological aspects. Periodontology, 28: 72-90. 

Takahashi K (1998). Microbiological, pathological, inflammatory, 

immunological and molecular biological aspects of periradicular 

disease. Int. Endod. J. 31(5): 311-325 

Vandekerckhove BN, Quirynen M, van Steenberghe D (1997). The use 

of tetracycline-containing controlled-release fibers in the treatment of 

refractory periodontitis. J. Periodontol. 68(4): 353-361 

Vyas SP, Sihorkar V, Mishra V (2000). Controlled and targeted drug 

delivery strategies towards intraperiodontal pocket diseases. J. Clin. 

Pharm. Ther. 25(1): 21-42. 

Wang LC, Chen XG, Zhong DY, Xu QC (2007). Study on poly(vinyl 

alcohol)/carboxymethyl-chitosan blend film as local drug delivery 

system. J. Mater. Sci. Mater. Med. 18(6): 1125-1133. 

Zambon JJ (1996). Periodontal diseases: microbial factors. Ann. 

Periodontol. 1(1): 879-925.




DOI: 10.5897/AJMR11.751 


Emergence of oligoclonal Acinetobacter baumannii 

nosocomial infection in a Hospital in Nepal 

Badri Thapa 1 , Chanwit Tribuddharat 2 and Sulochana Mahat Basnet 3 

1 Department of Microbiology, Kathmandu Medical College, Kathmandu, Nepal, Microbiology Section, Genesis 

Laboratory and Research, Kathmandu, Nepal. 

2 Department of Microbiology, Siriraj Hospital, Mahidol University, Bangkok, Thailand. 

3 Faculty of Health, University of Canberra, Canberra, Australia. 


The molecular epidemiology of fifteen clinical strains of Acinetobacter baumannii recovered from 

various clinical specimens from different wards during January to June, 2010 from a hospital in Nepal 

was evaluated. Kirby-Bauer disk diffusion test was used for determining in-vitro activities of antibiotics. 

Molecular epidemiology was investigated by polymerase chain reaction-randomly amplified 

polymorphic DNA (PCR-RAPD) and plasmid profiling. A. baumannii recovered were multidrug resistant. 

Isolates represented three antibiotypes (a, b and c). Isolates in antibiotype c (n=12) were resistant to all 

antibiotics tested while isolates in antibiotype a (n=2) was susceptible to netilmicin and b (n=1) was 

susceptible to aminoglycosides and fluoroquinolones tested. Four plasmid profiles (i) 1 isolate; (ii) 1 

isolate; (iii) 1 isolate; and (iv) 12 isolates and four PCR-RAPD types (I)1isolate; (II) 8 isolates; (III) 1 

isolate; (IV) 5 isolates revealed oligoclonal population of A. baumannii. Antibiotypes, plasmid profiles 

and PCR-RAPD types showed no empirical association. A. baumannii isolates were oligoclonal and 

multi-drug resistant. The emergence of multi-drug resistant oligoclonal population of this pathogen in a 

hospital warrants for development of appropriate antibiotic policies and immediate implementation of 

infection prevention and control measures. 

Key words: Acinetobacter baumannii, multidrug-resistant, oligoclonal, Nepal. 

INTRODUCTION 

Acinetobacter baumannii is emerging as a nosocomial 

pathogen around the globe. This pathogen is ubiquitous 

in the hospital environment, is multidrug, pandrug to 

extensively drug-resistant, can survive wide range of pH, 

salinity, humidity, and can thrive on almost all nutrient 

sources. They frequently colonize respiratory and 

digestive tract, skin, and throat causing wide array of 

infections especially in immunocompromised and 

debilitated patients admitted in intensive care units (ICU) 

(Montefour et al., 2008; Rosenthal and Tager, 1975; 

Somerville and Noble, 2008). Acinetobacter spp. is 

responsible for 3 to 4% of ventilator associated 

pneumonia and crude mortality rate due to A. baumannii 

*Corresponding author. E-mail: badri_bishal@yahoo.com. Tel: 

977-1-4426059. Fax: 977-1-4426461. 

is 30 to 70% (CDC, 1984). 

Since its emergence as nosocomial infection in USA in 

1991, A. baumannii has been isolated in numerous health 

care facilities and city, country and continent wide 

outbreak of this pathogen have been documented (Go et 

al., 1994; Peleg et al., 2008). This pathogen has 

successfully overcome therapeutic armament by 

accumulating its innate and acquired resistance 

repertoire (Peleg et al., 2008). A. baumannii resistant to 

all beta-lactams has already emerged (Peleg et al., 2008). 

Polymyxins, tigecycline and rifampin are considered as 

magic bullets to treat A. baumannii infections but 

resistant strains to these antibiotics are emerging (Ko et 

al., 2007; Thapa et al., 2009a). 

Multidrug resistant strains of Enterobacteriaceae like, 

Escherichia coli Klebsiella pneumoniae, Citrobacter spp., 

Proteus spp., and Enterobacter spp., have been the 

subject of attention in Nepal but nosocomial infection by

Table 1. Antibiotypes, plasmid profiles and PCR-RAPD types of isolates studied. 

Badri et al. 5873 

Isolates PCR-RAPD Plasmid profile Antibiotypes AST, sensitive to 

104 I iv c - 

106, 107, 1011, 1012, 1015, 1016 

II iv 

c 

- 

109 - 

1010 II iv a AK, G, K, NT, NX, CF 

108 III iii c - 

101 IV i a AK, G, K, NT, NX, CF 

102 IV ii b NT 

105,1013,1014 IV iv c - 

AST, Antibiotic susceptibility test; AK, Amikacin; G, Gentamicin; K, Kanamycin; NT, Netilmicin; NX, Norfloxacin; CF, Ciprofloxacin. 

non-Enterobacteriaceae, like A. baumannii is also 

emerging (Banjara et al., 2003; Gaur et al., 2007; Thapa 

et al., 2009b). Molecular studies of A. baumannii from 

Nepal are scarce. Here, we studied the molecular 

epidemiology of nosocomial strains of A. baumannii 

isolated from Nepal. 


Bacterial strains 

Out of 36 strains of A. baumannii isolated from various specimen 

sources in Microbiology laboratory of Kathmandu Medical College 

and Teaching Hospital (KMCTH), Kathmandu, Nepal during 6 

months period (January to June, 2010), 15 were studied. The 

isolates were identified based on the published reports (Malini et 

al., 2009). 

Antibiotic susceptibility test 

Antibiotic susceptibilities of these pathogens were tested using 

Kerby-Bauer disk diffusion assay following CLSI guidelines (CLSI, 

2005). The disk containing antibiotics (µg/disk) (HiMedia Pvt. Ltd, 

India) used were; Amoxicillin (20), Amoxicillin-Clavulanic acid 

(20+10), Piperacillin (100), Ceftizoxime (30), Ceftriaxone (30), 

Ceftazidime (30), Cefazolin (30), Cefoxitin (30), Amikacin (30), 

Gentamicin (30), Kanamycin (30), Netilmicin (30), Norfloxacin(10), 

and Ciprofloxacin (5). 

Genetic analysis 

Genomic and plasmid DNA from these isolates were extracted 

using Genomic DNA extraction Kit (Puregene, Minneapolis, 

Minnesota, USA) and Plasmid Miniprep (MN, Germany), 

respectively. polymerase chain reaction-randomly amplified 

polymorphic DNA (PCR-RAPD) was performed on Genomic DNA 

extract as described previously (Thapa et al., 2010). Briefly, PCR 

reaction was carried in 20 µl containing 50 ng of genomic DNA 

template, 0.2 µM primer (R003, 5’ CTTGACGCA 3’), 0.2 mM 

dNTPs (FINZYMES), 2.5 µl of supplied PCR buffer, and 1.0 U of 

Taq polymerase (FINZYMES). 5% dimethylsulfoxide was added 

into the reaction. The PCR (PERKIN ELMER) profile used was: 

initial denaturation at 94°C for 2 min; followed by 40 cycles of 94°C 

for 10 s, 36°C for 30 s, and 72°C for 1 min; and a final heating at 

72°C for 2 min. Amplified products and extracted plasmids were 

resolved in 1% TAE agarose (Research organics, inc. USA). 

Plasmid profiles were interpreted on the basis of the number and 

size of the plasmids. The study was approved by the institutional 

review board, Kathmandu Medical College, Nepal. 

RESULTS 

Antibiotic sensitivity test and antibiotype 

The in-vitro activities of 14 antibiotics were tested against 

these isolates. All strains were multidrug-resistant (Table 

1). Most of the isolates (n=13) were resistant to all 

antibiotics tested. All isolates were also resistant to betalactam 

antibiotics tested. Aminoglycosides and 

fluoroquinolones were effective against two isolates (101, 

1010) while netilmicin was only effective to an isolate, 

102. Based on the antibiotic susceptibility test these 

isolates were grouped into three antibiotypes, a, b, and c 

(Table 1). Most isolates (n=12) in antibiotype c were 

resistant to all antibiotics while antibiotype a (n=2) was 

sensitive to amino glycosides and fluroquinolones and b 

(n=1) was sensitive to netilmicin. 

Plasmid profile 

The size and number of the plasmids were able to 

categorize isolates into 4 plasmid profiles (i, ii, iii, and iv) 

(Figure 1 and Table 1). Most isolates (n=12) were 

grouped into plasmid profile iv while rest of the isolates 

represented individual plasmid profile type i, ii, and iii 

(Table 1). 

PCR-RAPD 

PCR-RAPD analysis of these strains revealed three 

RAPD types (I, II, and III) (Figure 2 and Table 1). Most of 

the isolates (n=8) accounted for type II and isolates 104 

and 108 accounted for type I and III, respectively. Few


Figure 1. RAPD for A. baumannii studied. Lane M, molecular weight marker (1 kb+, Invitrogen); 

Numbers above lanes (2-17) indicates the isolates. 

Figure 2. Plasmid profile of A. baumannii studied. 

Lane M, Molecular weight marker (1 kb + , Invitrogen); 

lanes (2-5) indicates different plasmid profiles. 

isolates (n=5) were not amplified and were grouped as 

type IV. 

DISCUSSION 

The indiscriminate use of antibiotics has led to the 

emergence of MDR, PDR and XDR strains of A. 

baumannii which was conventionally considered as less 

virulent and clinically unimportant. A. baumannii infection 

is a growing concern around the globe but the evidence 

of the emergence of this pathogen in Nepal is scarce. Out 

of 195 bacterial isolates obtained from surgical wound 

infection in Nepal, 13 bacterial species were identified 

and Acinetobacter spp. ranked 5th with the prevalence 

rate of 7.6%, and 9 strains were MDR (Banjara et al., 

2003). In this study, all A. baumannii isolates were 

multidrug resistant. All were resistant to beta-lactam 

antibiotics tested. Some isolates were resistant to all 

antibiotics tested (antibiotype c) while others were 

sensitive to aminoglycosides and fluoroquinolones. 

Strains resistant to these antibiotics and to carbapenems 

have already been reported elsewhere (Chaiwarith et al., 

2005; Thapa et al., 2010). At the time of conducting this 

study, carbapenems were just introduced in the clinical 

practice in Nepal and carbapenem susceptibility was not 

performed. Carbapenems including polymyxin, 

tigecycline, and rifampin in combination with other 

antibiotics which have been recommended for the 

management of multidrug-resistant A. baumannii can be 

the choices (Kasiakou et al., 2005; Thapa et al., 2009a). 

There are no current guidelines for treating A. baumannii 

in Nepal and the susceptibility data to these antibiotics 

should be generated before formulating such guidelines. 

The clonality of the isolates was evaluated using 

antibiotypes, plasmid profiles, and PCR-RAPD. The 

evaluation of genetic relatedness using PCR-RAPD is an 

easy, cost effective, and rapid (Thapa et al., 2010). Using 

this arbitrarily primed PCR, we successfully identified the 

circulating local oligoclones (I to IV). Similar olioglonal 

outbreaks of A. baumannii have been reported (Thapa et 

al., 2010; Naas et al., 2005; Jeon et al., 2005). Plasmid

profiling a conventional typing tool grouped these isolates 

into four types (i to iv), and the isolates were grouped into 

three antibiotypes (a, b and c). Type II PCR-RAPD clone 

was most commonly encountered (n=8). These isolates 

also had similar plasmid profile and antibiotype. Similar 

plasmid profiles (type iv) and antibiotypes (type a and c) 

were observed among the isolates in PCR-RAPD types II 

and IV suggesting transfer of plasmids and resistance 

genes among different lineages. Two isolates (101 

and102) within same PCR-RAPD type IV had 

independent plasmid profile and antibiotype. This 

reflected high rate of genetic promiscuity among similar 

genotypes. The difference of plasmid profiles and 

antibiotypes among different PCR-RAPD types can be 

explained by the high transformation capability of 

Acinetobacter spp. to expand its genetic pool of 

resistance (resistant plasmids and genes) (Metzgar et al., 

2004). The same genotype of A. baumannii was found 

circulating in different wards. This suggests that the 

particular clone is hovering between wards and urge for 

prompt detection and elimination of the source. 

Acinetobacter can be found in normal human skin, 

nosopharynx and digestive tract of hospitalized patients 

and infects debilitated and immunocompromised patients 

(Rosenthal and Tager, 1975). Most of the A. baumannii 

nosocomial outbreaks are also linked to the 

environmental sources in the hospital like, particles, air, 

injectable intravenous fluids, hands of medical staffs, and 

medical equipments (Deitz et al., 1988). These sources 

must be detected to control the spread of these clones. 

MDR international A. baumannii clones known as 

European clones I, II, and II have been reported in 

several European countries and also in United States 

(Nemec et al., 2004, van Dessel et al., 2004; Wroblewska 

et al., 2007). The rise in A. baumanni in United States 

has been contributed by the injured military personal 

returning from war in Iraq and Afghanistan (Scott et al., 

2007; Davis et al., 2005). There was also an increase in 

prevalence of MDR A. baumannii between 1997 to 2001 

in South American countries like, Argentina, Colombia, 

Chile, and Brazil (Tognim et al., 2004). Similarly, 

numerous PDR A. baumannii outbreaks have been 

reported from Asian hospitals (Thapa et al., 2010; Koh et 

al., 2007; Ying et al., 2006). Multidrug- and pandrugresistant 

A. baumannii have been reported from almost 

all continents and is now a global problem. 

This study, for the first time showed inter-ward spread 

of the A. baumannii clones and sensitized the need for 

monitoring of inter-institutional and international clones in 

Nepal. PCR-RAPD offers a dynamic platform to 

investigate clones in rapid and cost effective manner, has 

high sensitivity and high resolution for local 

epidemiological studies but it lacks reproducibility and 

produce categorical data that cannot be used to 

understand global epidemiology (Grundmann et al., 

1997). More robust molecular typing tool-multi locus 

sequence typing-is necessary to establish the spread of 

Badri et al. 5875 

these clones outside this institution (Bartual et al., 2005). 

In conclusion, oligoclonal multidrug resistant A. 

baumannii has emerged as a successful nosocomial 

pathogen in this hospital in Nepal and warrants for tracing 

and elimination of the source. Prudent use of antibiotics, 

infection control and prevention practices, monitoring of 

these multidrug oligoclonal A. baumannii will help to stop 

the emergence and spread of the pathogen and its 

resistance genes across Nepal and internationally. 


Authors would like to acknowledge Dr. Chanwit 

Tribuddharat, Department of Microbiology, Siriraj 

Hospital, Mahidol University, a coauthor of this study for 

providing laboratory space and reagents for this study. 

REFERENCES 

Banjara MR, Sharma AP, Joshi AB, Tuladhar NR, Ghimire P, Bhatta DR 

(2003). Surgical wound infections in patients of Tribhuvan University 

Teaching Hospital. Nepal Health Res Counc. 3: 41-45. 

Bartual S, Seifert H, Hippler C, Luzon MA, Wisplinghoff H, Rodriguez- 

Valera F (2005). Development of a multilocus sequence typing 

scheme for characterization of clinical isolates of Acinetobacter 

baumannii. J Clin Microbiol. 43: 4382-4390. 

Centers for Disease Control (CDC) (1984). Nosocomial infection 

surveillance. CDC Summ. 35:17SS-29SS. 

Clinical and Laboratory Standards Institute (CLSI ) (2005). Performance 

standards for antimicrobial susceptibility testing; 15th informational 

supplement. CLSI document M100-S15. Clinical Laboratory 

Standards Institute, Wayne, PA. 

Chaiwarith R, Mahattanaphak S, Boonchoo M, Supparatpinyo K, 

Sirisanthana K (2005). Pandrug-resistant Acinetobacter baumannii at 

Maharaj Nakorn Chaingmai Hospital. J. Infect. Dis. Antimicrob 

Agents, 22:1-8. 

Davis KA, Moran KA, McAllister CK, Gray PJ (2005). Multidrug-resistant 

Acinetobacter extremity infections in soldiers. Emerg. Infect. Dis. 11: 

1218-1224. 

Deitz JW, Goodrich JA, Brown WB (1988). Acinetobacter calcoaceticus 

foot infection following to high pressure injection injury: a case report. 

Foot Ankle. 8: 216-222. 

Naas T, Levy M, Hirschauer C, Marchandin H, Nordmann P (2005). 

Outbreak of carbapenem-resistant Acinetobacter baumannii 

producing the carbapenemase OXA-23 in a tertiary care hospital of 

Papeete, French Polynesia. J. Clin. Microbiol. 43: 4826-4829. 

Gaur A, Prakash A, Anupurba S, Mohapatra TM (2007). Possible role of 

integrase gene polymerase chain reaction as an epidemiological 

marker: study of multidrug-resistant Acinetobacter baumannii isolated 

from nosocomial infections. Int. J. Antimicrob Agents. 4: 446-450. 

Go ES, Urban C, Burns J, Kreiswirth B, Eisner W, Mariann N, Mosinka- 

Snipas K (1994). Clinical and molecular epidemiology of 

Acinetobacter infections sensitive only to polymyxin B and sulbactam. 

Lancet. 344: 1329-1332. 

Grundmann HJ, Towner KJ, Dijkshoorn L, Gerner-Smidt P, Maher M, 

Seifert H, et al (1997). Multicenter study using standardized protocols 

and reagents for evaluation of reproducibility of PCR-based 

fingerprinting of Acinetobacter spp. J. Clin. Microbiol. 35: 3071-3077. 

Jeon BC, Jeong SH, Bae IK, et al (2005). Investigation of a nosocomial 

outbreak of imipenemresistant Acinetobacter baumannii producing 

the OXA-23 β-lactamase in Korea. J Clin Microbiol. 43: 2241-2245. 

Kasiakou SK, Michalopoulos A, Soteriades ES, Samonis G, Sermaides 

GJ, Falagas ME (2005). Combination therapy with intravenous 

colistin for management of infections due to multidrug-resistant 

Gram-negative bacteria in patients without cystic fibrosis. Antimicrob


Agents Chemother, 49: 3136-3146. 

Ko KS, Suh JY, Kwon KT, Jung SI, Park KH, Kang CI, et al (2007). High 

rates of resistance to colistin and polymyxin B in subgroups of 

Acinetobacter baumannii isolates from Korea. J. Antimicrob 

Chemother. 60: 1163-1167. 

Koh TH, Sng TH, Wang GCY, Hsu LY, Zhao Y (2007). Carbapenemase 

and efflux pump genes in Acinetobacter calcoaceticus-Acinetobacter 

baumannii complex strains from Singapore. J. Antimicrob Chemother. 

5: 1173-1174. 

Malini A, Deepa EK, Gokul BN, Prasad SR (2009). Nonfermenting 

Gram-negative bacilli infections in tertiary care hospital in Kolar, 

Karnataka. J. Lab. Physician. 1: 62-66. 

Metzgar D, Bacher JM, Pezo V, Reader J, Doring V, Schimmel P 

(2004). Acinetobacter spp. ADP1: an ideal model organism for 

genetic analysis and genome engineering. Nucleic Acids Res. 

32:5780-5790. 

Montefour K, Frieden J, Hurst S, Helmich C, Headley D, Martin Mary 

(2008). An emerging multidrug resistant pathogen in critical care. Crit. 

Care Nurse. 28:15-25. 

Nemec A, Dijkshoorn L, van der Reijden TJ (2004). Long-term 

predominance of two pan-European clones among multi-resistant 

Acinetobacter baumannii strains in the Czech Republic. J. Med. 

Microbiol. 53:147-153. 

Peleg AY, Seifert H, Paterson DL (2008). Acinetobacter baumannii: 

Emergence of a successful pathogen. Clin Micobiol Rev. 21: 538– 

582. 

Rosenthal S, Tager IB (1975). Prevalence of Gram-negative rods in the 

normal pharyngeal flora. Ann Intern Med. 83: 355–337. 

Scott P, Deye G, Srinivasan A, Murray C, Moran K, Hulten E (2007). An 

Outbreak of Multidrug-resistant Acinetobacter baumanniicalcoaceticus 

complex infection in the US military health care system 

associated with military operations in Iraq. Clin. Infect. Dis. 44: 1577- 

1584. 

Somerville DA, Noble WC (1970). A note on the gram-negative bacilli of 

human skin. Eur. J. Clin. Biol. Res. 40: 669-670. 

Thapa B, Tribuddharat C, Rugdeekha S, Techachaiwiwat W, 

Srifuengfung S, Dhiraputra C (2009a). Rifampin resistance in 

carbapenem-resistant Acinetobacter baumannii in Siriraj Hospital, 

Thailand. Nepal Med. Coll. J. 11: 232-237. 

Thapa B, Adhikari P, Mahat K, Chhetri MR, Joshi LN (2009b). 

Multidrug-resistant nosocomial Citrobacter in a Hospital in 

Kathmandu. Nepal Med. Coll. J. 11: 195-199. 

Thapa B, Tribuddharat C, Srifuengfung S, Dhiraputra C (2010). High 

prevalence of blaOXA-23 in oligoclonal carbapenem resistant 

Acinetobacter baumannii from Siriraj Hospital, Madhidol University, 

Bangkok, Thailand. South East Asian J. Trop. Med. 4: 625-635. 

Tognim MC, Andrade SS, Silbert S, Gales AC, Jones RN, Sader HS 

(2004). Resistance trends of Acinetobacter spp. in Latin America and 

characterization of international dissemination of multi-drug resistant 

strains: five-year report of the SENTRY Antimicrobial Surveillance 

Program. Int. J. Infect. Dis. 8:284-291. 

Van Dessel H, Dijkshoorn L, Van der Reijden T, Bakker N, A Paauw, 

Van den Broek Pl (2004). Identification of a new geographically 

widespread multiresistant Acinetobacter baumannii clone from 

European hospitals. Res Microbiol. 155: 105-112. 

Wroblewska MM, Towner KJ, Marchel H, Luczak M (2007). Emergence 

and spread of carbapenem-resistant strains of Acinetobacter 

baumannii in a tertiary-care hospital in Poland. Clin Microbiol 

Infect.13: 490-496. 

Ying CM, Ling TK, Lee CC, Ling JM (2006). Characterization of 

carbapenem-resistant Acinetobacter baumannii in Shanghai and 

Hong Kong. J. Med. Microbiol.55: 799-802.




DOI: 10.5897/AJMR11.801 


The effects of bifidobacterium lactis and 

galactooligosaccharide (GOS) on ileum and distal colon 

motility: In vitro study 

Nevcihan Gursoy 

Department of Food Engineering, Faculty of Engineering, Cumhuriyet University, Sivas, TR-58140, Turkey. 

E-mail: ngursoy2@gmail.com and ngursoy@cumhuriyet.edu.tr. Tel: + 90-346-219 10 10 ext. 2889. 

Fax: + 90-346-219 11 77. 


Twenty one male Wistar albino rats each weighing approximately 280 g were used in this study. 

Animals were divided into three groups. The first group (n = 7) consisted of sham controls, in the 

second (n = 7), rats were administrated 0.1 g/1 ml/galactooligosaccharide by by oral gavage for 4 weeks. 

In the third group (n = 7), rats were administrated 10 9 CFU/1ml/day Bifidobacterium lactis by oral gavage 

for 4 weeks. After 4 weeks, rats were sacrified; ileum and proximal colon segments were removed. The 

spontaneous contractions of ileum and proximal colon were evaluated by using organ bath. It has been 

detected that both prebiotics and probiotics increased intestinal motility. While probiotics have effects 

on both ileum and proximal colon, prebiotics seem to be effective in colon. All data are expressed as 

mean ± SEM (standard error of mean). Statistical comparisons between groups were performed using 

general linear models of analysis of variance (ANOVA) followed by the Turkey test. 

Key words: Bifidobacterium lactis, galactooligosaccharide, ileum, rat, distal colon, in vitro. 

INTRODUCTION 

Epidemiological studies indicate that diet has a major 

impact on human health: a diet low in fat and high in fruit 

and vegetables has been correlated with a decreased 

incidence of so-called Western diseases such as 

coronary heart disease and colon cancer (Trock et al., 

1990). Such a diet contains not only nutrients that are 

readily absorbed in the small intestine but also coponents 

that escape digestion by pancreatic and small bowel 

enzymes. The latter are the principal substrates of the 

bacteria resident in the human intestinal tract. Since a 

Abbreviations: GOS, galactooligosaccharide; KBS, 

Krebsbicarbonate solution; CFU, colony forming units; 

NDO, non-digestible oligosaccharides; NaH2PO4, sodium 

phosphate; NaCl, sodium chloride; KCl, potassium 

chloride; CaCl2, calcium chloride; MgCl2, magnesium 

chloride; NaHCO3, sodium bicarbonate; SEM, standart 

error of mean; ANOVA, analysis of variance. 

number of nutritional health effects are mediated by the 

intestinal microflora, diet is key in influencing their 

composition and activity. It has been increasingly 

recognized that the bacterial community in the intestine 

influences human health and well-being (Cummings and 

Macfarlane, 1997). Consequently, nutrition may be 

considered as a tool for influencing the intestinal 

microbiota in such a way that harmful bacteria are 

suppressed and beneficial bacteria are stimulated. 

Dietary strategies that serve to support health-promoting 

effects of the intestinal microflora include the ingestion of 

probiotics (Goldin, 1998) and or prebiotics (Gibson and 

Roberfroid, 1995), as well as a diet rich in fiber (Salminen 

et al., 1998). 

Three approaches exist to increase the number of 

health-promoting organisms in the gastrointestinal tract. 

The first is the oral administration of live beneficial 

microorganisms. At present, these microorganisms, 

called probiotics, have been selected mostly from lactic 

acid bacteria and bifidobacteria that form a part of the


normal intestinal microflora of humans, these organisms 

are also indigenous to the colon. These bacteria have 

been suggested to be useful in the treatment of diarrhea 

(Rota virus, traveler‟s diarrhea, and Clostridium difficile), 

constipation, irritable bowel syndrome, and inflammatory 

bowel disease. They also have putative effects on 

enhancing the immune system and decreasing lactose 

intolerance (Bhutto and Morley, 2008). 

The mechanisms of probiotic action appear to be 

multifactorial. Probiotic bacteria can promote fermentation 

processes that metabolize varying quantities of 

lactic, acetic, and formic acids; synthesis of vitamins; and 

the production of antimicrobial bacteriocidins and fatty 

acids (Bourlioux et al., 2002). Probiotics can also affect 

innate intestinal host defenses, including strengthening 

intestinal tight junctions, increasing mucous secretion, 

enhancing motility, and producing metabolic products 

(amino acids such as arginine and glutamine and shortchain 

fatty acids) that secondarily function as protective 

nutrients. They contribute to microflora diversity, thus 

helping to establish a normal commensal flora that protect 

against potential microbial pathogens (Neu and Caicedo, 

2005). 

The second strategy for increasing their number is to 

supply those already present in the intestine with 

selective carbon and energy source that provides them 

with competitive advantage over other bacteria in this 

ecosystem, thus selectively modifying the composition of 

the microflora using dietary supplements. These selective 

dietary components were named “prebiotics”. 

A prebiotic has been defined as “a non-digestible food 

ingredient that beneficially affects the host by selectively 

stimulating the growth and or activity of one or a limited 

number of bacteria in the colon” (Gibson and Roberfroid, 

1995). Prebiotics are intended to modify the intestinal 

microbiota in such a way that bacterial activities 

advantageous to the host are stimulated and bacterial 

activities adverse to host health are suppressed. The 

concept of prebiotics arose from the observation that 

inulin and fructooligosaccharides selectively stimulate the 

growth of bifidobacteria (Potter et al., 1993; Cummings, 

1994) which are considered to be beneficial for human 

health (Gibson and Roberfroid, 1995). Although most 

research has been done on inulin and 

fructooligosaccharides, other non-digestible 

oligosaccharides (NDO) including xylooligosaccharides, 

galactooligosaccharides and isomalto oligosaccharides 

have also been tested for their prebiotic effect (Fuchs et 

al., 1999). The majority of candidate prebiotics are 

oligosaccharides but also include polysaccharides.To 

serve as a bacterial substrate in the colon, a prebiotic 

may not be hydrolyzed or absorbed in the upper part of 

the gastrointestinal tract. 

And the last approach is a mixture of probiotic and 

prebiotic “synbiotic” has recently been proposed to 

characterise health-enhancing food and supplements 

used as functional food ingredients in human (Kontula et 

al., 1998). 

Like probiotics, the prebiotics belong to a more general 

class of “colonic foods”, that is foods entering the colon 

and serving as substrates for the endogenous colonic 

bacteria, thus indirectly providing the host with energy, 

metabolihc substrate and essential micronutrients 

(Gibson and Roberfroid, 1995). 

Although it has been shown in clinical studies that pre 

and probiotics have positive effects on gastrointestinal 

motility, in vitro effects of pre and probiotics are not clear. 

In this study we aimed to investigate and compare the 

effects of pre and probiotics on gastrointestinal motility in 

different segments of gastrointestinal track. 


Animal preparation twenty one male Wistar albino rats each 

weighing approximately 280 g were used in this study. The study 

was approved by. Animals were divided into three groups. The first 

group (n = 7) consisted of sham controls in which rats were 

administrated 1% ml 0.9 NaCl/ day by oral gavage for 4 weeks. In 

the second group (n = 7), rats were administrated 0.1 g/1 ml/day 

galactooligosaccharide (GOS) used as a prebiotic by oral gavage 

for 4 weeks. In the third group (n = 7), rats were administrated 10 9 

CFU/1ml/day Bifidobacterium lactis used as a probiotic by oral 

gavage for 4 weeks. B. lactis were grown from frozen stocks (-80 

o C) prepared for ingestion and counted as in Kamiya at al. (2006). 

At the end of the four weeks, rats were killed by cervical dislocation. 

The abdomen was opened with a midline incision. Ileum and 

proximal colon was removed and placed in previously aerated (95% 

O2 and 5% CO2) Krebs-bicarbonate solution (composition in 

mmol/L: NaCl, 120; KCl, 4.6; CaCl2, 2.5; MgCl2, 1.2; NaHCO3, 22; 

NaH2PO4 and glucose 11.5). Whole full-thickness segments of 

ileum and proximal colon were placed in circular direction in a 10 

mL tissue baths, filled with pre-aerated Krebsbicarbonate solution 

(KBS) at 37°C. The upper end of the preparation was tied to an 

isometric transducer (Grass FT 03, Quincy, MA, USA) and 

preloaded with 1 to 1.5 g. Tissues were allowed to equilibrate for 30 

min. 

In vitro muscle contractility studies 

Muscle segments from each group were contracted with 80 mmol/L 

KCl to ensure that they worked properly at the beginning and end of 

each experiment. 

At the beginning of each experiment, 80 mmol/L KCl was added 

to the organ bath, and the contraction was considered as reference 

response. Subsequently, the amplitude of spontaneous 

contractions of the isolated Ileum and proximal colon muscle 

segments were calculated as a percentage of the contraction 

induced by KCl (80 mmol/L) from both control, prebiotic and 

probiotic groups. Changes in the frequency (number or min.) of 

spontaneous contractions were expressed as the number of 

contractions for 10 min intervals. Isometric tensions were recorded 

on a Grass model 79 E polygraph. All experiments were performed 

in duplicate. 

Data analysis 

All data are expressed as mean ± SEM (standard error of mean). 

Statistical comparisons between groups were performed using 

general linear models of analysis of variance (ANOVA) followed by 

the Turkey test and P-values of less than 0.05 were considered to 

be statistically significant.

RESULTS 

Figure 1. KCl (80 mmol/L) induced contractions of 

isolated ileum muscle segments in control, prebiotic 

and probiotic groups. No statistical difference was 

observed between groups (P > 0.05). 

Contractions induced by 80 mmol/L KCl were not 

significantly different between control, prebiotic and 

probiotic groups in isolated ileum smooth muscle 

segments which indicated that muscle segments from 

both groups worked properly (Figure 1). 

In the smooth muscle segments from ileum, the mean 

amplitude of the spontaneous contractions was 70.6 ± 

4.6 in the control group, 74.2 ± 5.2 in prebiotic group and 

95.5 ± 7.1 in probiotic group, respectively. There was no 

significant difference between the amplitude responses of 

control and prebiotic groups (p > 0.05). But the amplitude 

of probiotic group was significantly higher than both 

control and prebiotic groups (p < 0.05) (Figure 2A). 

In the smooth muscle segments from proximal colon, 

the mean amplitude of the spontaneous contractions was 

62.4 ± 3.5 in the control group, 81.4 ± 4.4 in prebiotic 

group and 87.5 ± 5.2 in probiotic group, respectively. 

Both amplitude responses of spontaneous contractions of 

Gursoy 5879 

Figure 2. Changes in the spontaneous contraction 

amplitudes of the isolated smooth muscle 

segments. A. Ileum B. Proximal Colon. 

prebiotic and probiotic groups were significantly high 

when compared to the control group (p < 0.05). There 

was significant difference between prebiotic and probiotic 

groups (p > 0.05) (Figure 2B). 

In the smooth muscle segments from ileum, the mean 

frequency of the spontaneous contractions was 27.2 ± 

1.6 in the control group, 28.8 ± 2.2 in prebiotic group and 

35.7 ± 4.1 in probiotic group, respectively. There was no 

significant difference between the frequency responses of 

control and prebiotic groups (p > 0.05). But the frequency 

of probiotic group was significantly higher than both 

control and prebiotic groups (p < 0.05) (Figure 3A). 

In the smooth muscle segments from proximal colon, 

the mean frequency of the spontaneous contractions was 

12.3 ± 1.5 in the control group, 11.1 ± 1.4 in prebiotic 

group and 17.5 ± 2.2 in probiotic group, respectively. 

Although there was no significant difference between the 

frequency responses of control and prebiotic groups (p > 

0.05), spontaneous contraction amplitude responses of 

probiotic group was significantly high when compared to 

the control and prebiotic groups (p < 0.05) (Figure 3B).


Figure 3. Changes in the spontaneous contraction 

frequency of the isolated smooth muscle segments. A. 

Ileum B. Proximal Colon. 

DISCUSSION 

The gut represents a complex and dynamic microbial 

ecosystem in which intestinal micro flora has an 

important and specific metabolic, trophic, and protective 

function. Normal gut structure and function are the endpoint 

of a complex set of interactions between the host 

and microorganisms colonizing the gut (Guarner and 

Malagelada, 2003). Bacteria can be used to improve 

human health. A bacterium that provides specific health 

benefits when consumed as a food component or 

supplement would be called a probiotic. A consensus 

definition of the term was issued a few years ago and 

states that oral probiotics are living microorganisms that 

upon ingestion in specific numbers exert health benefits 

beyond those of inherent basic nutrition (Guarner and 

Schaafsma, 1998; Guarner et al., 2005). While probiotics 

are the live microbial feed supplements that beneficially 

affect the host animal by improving its intestinal microbial 

balance (Fuller, 1989); prebiotics are defined as food 

ingredients that promote the growth or activity of a limited 

number of bacterial species for the benefit of host health 

(Gibson and Roberfroid, 1995). Organisms used as 

probiotics are most frequently of the Lactobacillus or 

Bifidobacterium species, and clinically beneficial effects 

of probiotics have been described in travellers‟ diarrhea, 

irritable bowel syndrome and inflammatory bowel disease 

(Walker and Buckley, 2006; Shanahan, 2007). 

There are many conflicting studies about the effects of 

pro and prebiotics on gastrointestinal motility. While some 

of these studies suggest that pro and prebiotics increase 

intestinal motility, others suggest opposite. It has been 

shown that Lactobacillus reuteri ingestion consistently 

alters the motility of colon segments in an ex vivo organ 

bath recording setup. The effect is a decrease in the 

amplitudes of contractions at constant luminal filling 

preasure, and an increase in the threshold luminal 

pressure required to evoke rhythmic contractions (Wang 

et al., 2010). On the other hand, an in vivo study showed 

that administration of probiotics induces increased 

colonic propulsive contractions and defecation rate in 

pigs (Ohashi et al., 2001). It has been shown in a human 

clinical study that probiotic supplements may have a 

positive effect on bowel movements among orthopedic 

rehabilitation elderly patients (Zaharoni et al., 2011). In 

addition, Tabbers et al. (2009) suggested that B. lactis 

strain DN-173 010 is effective in increasing stool 

frequency after 3 weeks of product consumption in 

children with functional constipation and a defecation 

frequency less than 3 weeks. 

There are little data available related to the influence of 

prebiotics on gastrointestinal motility in preterm infants. In 

a study in healthy preterm infants, Boehm et al. (2002) 

demonstrated that preterm infants fed with mother‟s milk 

had lower stool consistency and higher stool frequency 

than infants fed a preterm bovine milk formula. 

Supplementation of the same formula with a mixture of 

scGOS and lcFOS resulted in a reduction in stool 

consistency and an increase in stool frequency. More 

recently, Mihatsch et al. (2006) demonstrated a clinically 

relevant reduction in the gastrointestinal transit time in 

preterm infants fed a formula supplemented with these 

prebiotics. 

In this study, consistent with these positive studies, we 

found that probiotics increased spontaneous contraction 

amplitude and frequency of both ileum and proximal 

colon. On the other side, while prebiotics increasing 

spontaneous contraction amplitudes of proximal colon, 

did not changed spontaneous contraction amplitude of 

ileum. Also prebiotics did change neither spontaneous 

contraction frequency of ileum nor spontaneous 

contraction frequency of proximal colon. The difference 

between the effect of pro- and prebiotics on ileum 

spontaneous contraction amplitude may be related to the 

difference in physiology and bacterial colonization 

between ileum and proximal colon. It is clear that a 

complex, resident gut microflora is present in human

subjects. While the transit of residual foodstuffs through 

the stomach and small intestine is probably too rapid for 

the microbiota to exert a significant impact, this slows 

markedly in the colon. Colonic micro-organisms have 

ample opportunity to degrade available substrates 

(Cherbut, 2003; Gibson et al., 2004; Flint et al., 2008). 

Due to the high residence time of colonic contents, as 

well as a diverse and profuse flora, the colonic microbiota 

plays a more important role in host health and well-being 

than is the case in the small intestine. As a result, it has 

been defined that both prebiotics and probiotics 

increased intestinal motility. While probiotics have effects 

on both ileum and proximal colon, prebiotics seem to be 

effective in colon. The difference possibly related to the 

microbial flora. It is well known that changes in 

gastrointestinal micro flora exhibit an intestinal motility 

response and that such change can be initiated by 

addition of synbiotics to the diet. According to these 

findings it seems that food supplemented with probiotic 

and prebiotics would prevent impared motility seen in lots 

of gastrointestinal diseases. Further work is necessary in 

order to identify the underlying mechanisms responsible 

for diet/bacterial induced changes in gastrointestinal 

motility. 

REFERENCES 

Bhutto A, Morley JE (2008). The clinical significance of gastrointestinal 

changes with aging. Curr. Opin. Clin. Nutr. Metab. Care 11(5):651- 

660. 

Boehm G, Lidestri M, Casetta P, Jelinek J, Negretti F, Stahl B (2002). 

Supplementation of an oligosaccharide mixture to a bovine milk 

formula increases counts of faecal bifidobacteria in preterm infants. 

Arch. Dis. Child., 86:F178–81. 

Bourlioux P, Koletzko B, Guarner F, Braesco V (2002). The intestine 

and its microflora are partners for the protection of the host: report on 

the Danone Symposium „„The Intelligent Intestine,‟‟ held in Paris, 

June 14. Am. J. Clin. Nutr., 78:675-683. 

Cherbut C (2003). Motor effects of short-chain fatty acids and lactate in 

the gastrointestinal tract. Proc. Nutr. Soc., 62: 95–99. 

Cummings JH (1994). Anatomy and physiology of the human colon. 

ILSI Workshop on Colonic Microflora: Nutrition and health, Barcelona, 

Spain. 

Cummings JH, Macfarlane GT (1997). Colonic microflora: Nutr.Health 

Nutr., 13:476–478 

Flint HJ, Bayer EA, Rincon MT, Lamed R, White BA (2008). 

Polysaccharide utilization by gut bacteria: potential for new insights 

from genomic analysis. Nat. Rev. Microbiol., 6:121–131. 

Fuchs CS, Giovannucci EL, Colditz GA, Hunter DJ, Stampfer MJ, 

Rosner B, Speizer FE, Willett WC (1999). Dietary fiber and the risk of 

colorectal cancer and adenoma in women. Nutr. Engl. J. Med., 

340:169–176. 

Fuller R (1989). Probiotics in man and animals. J. App. Bacteriol., 66(5): 

365–378. 

Gibson GR, Probert HM, Van Loo JAE, Rastall RA, Roberfroid MB 

(2004). Dietary modulation of the human colonic microbiota: updating 

the concept of prebiotics. Nutr. Res. Rev., 17: 259–275. 

Gursoy 5881 

Gibson GR, Roberfroid MB (1995). Dietary modulation of the human 

colonic microbiota: introducing the concept of prebiotics. J. Nutr., 

125:1401–1412. 

Goldin BR (1998). Health benefits of probiotics. Br. J. Nutr., 80:S203– 

207. 

Guarner F, Malagelada JR (2003). Gut flora in health and disease. 

Lancet 361: 512-519. 

Guarner F, Perdigon G, Corthier G, Salminen S, Koletzko B, Morelli L 

(2005). "Should yoghurt cultures be considered probiotic?", Br. J. 

Nutr., 93(6):783-786. 

Guarner F, Schaafsma G (1989). Probiotics. Int. J. Food Microbiol., 39: 

237–238. 

Kamiya T, Wang L, Forsythe P, Goettsche G, Mao Y, Wang Y (2006). 

Inhibitory effects of Lactobacillus reuteri on visceral pain induced by 

colorectal distension in Sprague-Dawley rats. Gut., 55: 191–196. 

Kontula P, Jaskary J, Nollet L, De Smet I, Von Wright A, Poutanen K, 

Mattila-Sandholm T (1998). The colonization of the Simulator of the 

Human Intestinal Microbial Ecosystem (SHIME) by a probiotic strain 

fed in a fermented oat bran product: Effects on the gastrointestinal 

microbiota. Appl. Microbiol. Biotechnol., 50: 242–252. 

Mihatsch WA, Hoegel J, Pohlandt F (2006). Prebiotic oligosaccharides 

reduce stool viscosity and accelerate gastrointestinal transport in 

preterm infants. Acta Paediatr., 95:843–848. 

Neu J, Caicedo R (2005). Probiotics: protecting the intestinal 

ecosystem? J. Pediatr., 147(2):143-146. 

Ohashi Y, Inoue R, Tanaka K, Umesaki Y, Ushida K (2001). Strain 

gauge force transducer and its application in an pig model to evaluate 

the effect of probiotic on colonic motility. J. Nutr. Sci. Vitaminol., 47: 

351–356. 

Potter JD, Slattery ML, Bostick RM, Gapstur SM (1993). Colon cancer: 

a review of the epidemiology. Epidemiol. Rev., 15:499–545. 

Salminen S, Bouley C, Boutron-Ruault MC, Cummings JH, Franck A, 

Gibson GR, Isolauri E, Moreau MC, Roberfroid M, Rowland I (1998). 

Functional food science and gastrointestinal physiology and function. 

Br. J. Nutr., 80(1): S147–171. 

Shanahan F (2007). Irritable bowel syndrome: shifting the focus toward 

the gut microbiota. Gastroenterol., 133: 340–342. 

Tabbers MM, Chmielewska A, Roseboom MG, Boudet C, Perrin C, 

Szajewska H, Benninga MA (2009). Effect of the consumption of a 

fermented dairy product containing Bifidobacterium lactis DN-173 010 

on constipation in childhood: a multicenter randomised controlled trial 

(NTRTC: 1571). BMC Pediatr., 18:9-22. 

Trock B, Lanza E, Greenwald P (1990). Dietary fiber,vegetables,and 

colon cancer: critical review and meta-analyses of the epidemiologic 

evidence. J. Natl. Cancer Inst., 82:650–661. 

Walker R, Buckley M (2006). Probiotic microbes: the scientific basis. In 

A Report of the American Academy of Microbiology. Walker, R & 

Buckley, M. (Eds.) Washington, D.C.: American Society for 

Microbiology. 

Wang B, Mao YK, Diorio C, Wang L, Huizinga JD, Bienenstock J, 

Kunze W (2010). Lactobacillus reuteri ingestion and IK(Ca) channel 

blockade have similar effects on rat colon motility and myenteric 

neurones. Neurogastroenterol. Motil., 22(1):98-107. 

Zaharoni H, Rimon E, Vardi H, Friger M, Bolotin A, Shahar DR (2011). 

Probiotics improve bowel movements in hospitalized elderly patients- 

-the PROAGE study. J. Nutr. Health Aging., 15(3):215-220.

African Journal of Microbiology Research Vol. 5(32) pp. 5882-5888, 30 December, 2011 



DOI: 10.5897/AJMR11.831 


Cloning, expression and characterization of a glucose 

dehydrogenase from Bacillus sp. G3 in Escherichia coli 

Xuejiao Chen 1,2 , Haitao Ding 1 , Yiqing Du 1 , Hui Lin 1 , Zeli Li 1 and Yuhua Zhao 1 * 

1 Institute of Microbiology, College of Life Science, Zhejiang University, Hangzhou 310058, China. 

2 Hangzhou Wahaha Group Co., Ltd, Hangzhou 310000, China. 


The glucose dehydrogenase gene (gdh), cloned from Bacillus sp. G3, was composed of 786 bp 

nucleotide and the deduced protein molecular mass of one subunit was 28.1 kDa. The recombinant 

glucose dehydrogenase (rGDH-G3) was functionally expressed in Escherichia coli. The results revealed 

that expressed rGDH-G3 had a high specific activity of 371.9 U/mg at 25°C and pH 8.0, with oxidized 

nicotinamide adenine dinucleotide (NAD + ) as the cofactor. The enzyme was optimally active at 40°C and 

pH 9.0. The enzyme displayed broad specificity for other sugars such as D-galactose or maltose. The 

catalytic efficiency of the rGDH-G3 would be improved 4 times when oxidized nicotinamide adenine 

dinucleotide phosphate (NADP + ) was used as cofactor instead of NAD + . 

Key words: Bacillus sp. G3, enzymatic property, glucose dehydrogenase, inverse polymerase chain reaction 

(IPCR), optimal pH. 

INTRODUCTION 

Glucose dehydrogenase (GDH, EC 1.1.1.47), a member 

of the short-chain family of alcohol dehydrogenase, 

consists of four identical subunits (30 kDa) (Pauly and 

Pfleiderer, 1975), it catalyzes the oxidation of β-Dglucose 

to D-glucono-δ-lactone in the presence of 

cofactor oxidized nicotinamide adenine dinucleotide 

(NAD + ) or oxidized nicotinamide adenine dinucleotide 

phosphate (NADP + ), and it posses the property of dual 

*Corresponding author. E-mail: yhzhao225@zju.edu.cn. Tel: 86- 

571-88208557. Fax: 86-571-88206995. 

Abbreviations: gdh, Glucose dehydrogenase gene; GDH, 

glucose dehydrogenase; GDH-G3, glucose dehydrogenase 

from Bacillus sp. G3; PCR, polymerase chain reaction; IPCR, 

inverse PCR; ORF, open reading frame; rGDH-G3, recombinant 

glucose dehydrogenase; NAD + , oxidized nicotinamide adenine 

dinucleotide; NADP + , oxidized nicotinamide adenine 

dinucleotide phosphate; SDS-PAGE, sodium dodecyl sulfatepolyacrylamide 

gel electrophoresis. 

cofactor specificity. It has been shown that the GDH 

plays an important role in spore germination, and is a 

marker enzyme synthesized at sporulation stage 

(Nakatani et al., 1989). In recent years, GDH has been 

widely studied and used in many fields including biofuel 

cells (Okuda-Shimazaki et al., 2008), clinical tests (Du et 

al., 2008), and as a catalyst for coenzyme regeneration in 

large-scale chiral synthesis (Lin et al., 1999; Wong and 

Drueckhammer, 1985) . 

In order to meet the increasing demands for the above 

applications, the glucose dehydrogenase gene (gdh) of 

microorganism have been cloned and over-expressed in 

Escherichia coli from sporulating cells of Bacillus 

megaterium (Heilmann et al., 1988; Nagao et al., 1992) 

and Bacillus subtilis (Vasantha et al., 1983). The 

characteristics of GDH from B. megaterium (Makino et 

al., 1989a; Mitamura et al., 1989; Nagao et al., 1992) and 

B. subtilis (Fujita et al., 1977) have been investigated in 

detail. In this paper, we reported the results of a study 

that was aimed at isolating the gdh from Bacillus sp. G3, 

expressing in E. coli BL21 (DE3), as well as purifying and

characterizing this new enzyme. 


Bacterial strains, plasmid and chemicals 

Table 1. Oligonucleotide primers used for gdh isolation, DNA amplification and cloning. 

Primer Sequence 

dG3F 5’-GAYRTNATGATHAAYAAYGC-3’ 

dG3R 5’-ATRTANCCCATNGGDATCAT-3’ 

iG3F 5’-AATCGCTTCACGGCTTCC-3’ 

iG3R 5’-AGGGCGGATTGAAACTAA-3’ 

GDH3F 5’-GGAATTCCATATGTATAGTGATTTAGAAGGA-3’ 

GDH3R 5’-CGGGATCCTATTACCCACGCCCAGC-3’ 

a Underlined bases are restriction sites (NdeI in GDH3F and BamHI in GDH3R). 

The strain E. coli DH5α and E. coli BL21 (DE3) were used, 

respectively for cloning and expression. Bacillus sp.G3 used as the 

source of gdh was cloned and identified by our laboratory. Plasmids 

pMD19-T (Takara, Dalian, China) and pET28 (a+) (Invitrogen, 

Shanghai, China) were used as vectors for the cloning and 

expression of the gdh, respectively. Restriction enzymes and other 

modification enzymes, Taq DNA polymerase, and T4 DNA ligase 

were purchased from Takara, Dalian, China. Primers were 

synthesized by Invitrogen, Shanghai, China. Ni-NTA-resin was 

purchased from Invitrogen, Shanghai, China. DNA gel extraction kit 

was purchased from Axygen, Shanghai, China. NAD + and NADP + 

were purchased from Alfa Aesar, Tianjin, China. All other chemicals 

and solvents used were of analytical grade and available 

commercially. 

Enzyme activity assays 

The activity of glucose dehydrogenase from Bacillus sp. G3 (GDH- 

G3) was assayed by measuring the increase in absorbance of 

nicotinamide adenine dinucleotide (NADH) at 340 nm. The standard 

reaction mixture contained 100 mM sodium phosphate buffer (pH 

8.0), 200 mM glucose, and 1 mM NAD + with a final volume of 1 ml. 

One microlitre (1 μl) diluted enzyme solution was added to the 

assay mixture and incubated at 25°C for 5 min. The apparent 

extinction coefficient of NADH was 6220 M –1 cm –1 . One unit of GDH 

activity was defined as the amount of enzyme required to release 1 

μM of NADH per minute at 25°C and the pH of 8.0. All assays were 

repeated three times. 

Cloning of the glucose dehydrogenase gene (gdh) 

To clone a fragment of gdh from Bacillus sp.G3, a polymerase 

chain reaction (PCR) strategy with degenerate primers were used. 

Primers dG3F and dG3R (Table 1) were designed based on the 

conserved amino acid sequence (D V/I MINNA and M V/I PMGYI) 

of GDHs from different species of Bacillus. The PCR was 

conducted under the following conditions: 94°C for 5 min; 5 cycles 

of 94°C for 30 s, 45°C for 30 s, 72°C for 30 s; followed by 30 cycles 

of 94°C for 30 s, 55°C for 30 s and 72°C for 30 s; and a terminal 

extension at 72°C for 2 min. After separation and purification, a 400 

bp PCR product was sequenced. The complete GDH-G3 gene was 

obtained by using the inverse PCR (IPCR) technique (Ochman et 

al., 1988). The genomic DNA from Bacillus sp.G3 was digested with 

several endonucleases, and then self-ligated by using T4 DNA 

Xuejiao et al. 5883 

ligase at 16°C overnight. The ligation products were used as 

template for IPCR. A pair of primers iG3F and iG3R (Table 1) used 

were designed based on the above product using Primer Premier 

5.0. And the reaction was conducted for 30 cycles: 94°C for 30 s, 

55°C for 30 s and 72°C for 3 min. The resultant fragment was 

sequenced, and then the complete GDH-G3 gene was assembled 

according to overlapping sequences from the two fragments. 

Construction of expression plasmid 

Recombinant DNA techniques were carried out according to 

standard methods described by Sambrook and Russell (2001). The 

open reading frame (ORF) of GDH-G3 was amplified by PCR with 

the genomic DNA of Bccillus sp. G3 as the template, and GDH3F 

and GDH3R (Table 1) as primers, respectively. The purified PCR 

product was digested with NdeI and BamHI, and ligated with the 

pET-28a (+) that was linearized with the same enzymes, forming a 

new ORF that encoded an N-terminal His6-tag. The recombined 

plasmids were transformed into E. coli DH5α competent cells for 

amplification. 

Expression and purification of recombinant glucose 

dehydrogenase (rGDH-G3) 

To express 6his-tagged gdh, the recombinant vector was 

transformed into E. coli BL21 (DE3) competent cells using CaCl2heat 

shock method (Sambrook and Russell, 2001). The positive 

transformants were cultured at 37°C in Luria–Bertani (LB) medium 

containing 50 μg ml -1 kanamycin to an OD600 = 0.6. After induction 

with 0.1 mM IPTG at 25°C for 16 h, the culture was harvested. The 

cell pellet was washed twice with Buffer A (25 mM NaH2PO4, 250 

mM NaCl, pH 8.0) and lysed by the ultrasonic disruption, followed 

by centrifugation at 14000 rpm for 30 min at 4°C. The supernatants 

were loaded onto a Ni-NTA-resin (Invitrogen, Shanghai, China) 

column pre-equilibrated with Buffer A. After washed with the Buffer 

B (25 mM NaH2PO4, 250 mM NaCl, 20 mM imidazole, pH 8.0), the 

rGDH-G3 was eluted with 10 ml Buffer C (50 mM NaH2PO4, 250 

mM NaCl, 250 mM imidazole, pH 8.0), and then supplemented with 

20% (v/v) glycerol. The purified enzyme fractions were dialyzed and 

stored at 4°C. The protein concentration was determined by the 

method of Bradford with BSA as the standard (Bradford, 1976). The 

purity and molecular mass of the enzyme was analyzed by 14% 

sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS- 

PAGE) (Laemmli, 1970) and stained with 0.05% Coomassie brilliant 

blue R-250 (Varghese and Diwan, 1983). 

Characterization of the recombinant glucose dehydrogenase 

(rGDH-G3) 

The optimal temperature of rGDH-G3 was studied at various


temperatures between 25 and 65°C under standard conditions. To 

determine the thermostability, the enzyme solution was 

preincubated in sodium phosphate buffer (25 mM, pH 8.0) at 25– 

65°C for 60 min, respectively. To investigate the optimum reaction 

pH range for rGDH-G3, four buffers were used and they include 100 

mM citrate buffer (pH 4.0–6.0), 100 mM sodium phosphate buffer 

(pH 6.0–8.0), 100 mM Tris/HCl (pH 7.0–9.0), and 100 mM 

Gly/NaOH (pH 8.5–10.5). The pH stability was determined by preincubating 

diluted enzyme in the above buffers at 25°C for 60 min. 

For kinetic studies, the reaction rates were measured for a variety 

of substrates concentrations and the kinetic parameters were 

evaluated by Lineweaver–Burk plots method. 


Isolation and sequence analysis of gdh from Bacillus 

sp.G3 

A BLAST search in the GenBank database showed that 

the fragment was highly identical to other gdh in the 

database (Table 1). Based on the conserved DNA 

sequence, a pair of gene-specific primers iG3F and iG3R 

(Table 1) for IPCR were designed. The digested genomic 

DNA from Bacillus sp.G3 was self-ligated, and was used 

as template for IPCR to clone the flanking sequence of 

the GDH-G3 gene. A notable 1500 bp band was amplified 

only from NdeI-digested genomic DNA. It was sequenced 

and then the complete GDH-G3 gene was assembled 

according to overlapping sequences of the two 

fragments. The DNA sequence of GDH-G3 gene showed 

significant homology (97-78% identities) with other gdh 

sequences present in NCBI. 

The nucleotide sequence of the gene and the deduced 

amino acid sequence were deposited in GenBank 

(Accession no. GQ402830). The gene contained a 786 

bp ORF encoding a subunit of 261 residues with a 

predicted molecular mass of 28.1 kDa. 

The deduced amino acid sequence of GDH-G3 showed 

99% (maximum) identity with GDH subunit from B. 

cereus BDRD-ST26 (Accession no. ZP_04269989) and 

B. cereus H3081.97 (Accession no. ZP_03238186). In 

addition, it showed more than 80% sequence homology 

with the GDHs from most species of Bacillus. Sequence 

alignment of the deduced amino acid sequence of the 

GDH-G3 with other GDH sequences in GenBank 

database revealed the presence of highly conserved 

regions (Figure 1). 

Expression and purification of glucose 

dehydrogenase (GDH) 

After transformation and induction, the recombinant 

plasmid was successfully expressed in heterologous host 

strain E. coli BL21 (DE3). The recombinant protein was 

further purified by using Ni 2+ -chelating affinity 

chromatography. With the His6-tag at the N terminus, 

which facilitated strongly binding of the protein to the Ni- 

NTA matrix, most unbound proteins were washed away 

by the wash buffer. As shown in Figure 2, portion of the 

enzyme was expressed in a highly soluble form and the 

purified enzyme revealed a single protein band 

corresponding to approximately 28 kDa on SDS-PAGE, 

which was agreed with the predicted 28.1 kDa molecular 

mass. After being purified 20-fold, the specific activity of 

the enzyme was 371.9 U/mg (25°C, pH 8.0, with NAD + as 

the cofactor). 

Effects of pH and temperature on enzyme activity 

The rGDH-G3 had optimal activity at 40°C (Figure 3A) 

and pH 9.0 (100 mM Tris/HCl, Figure 3B), respectively. 

The enzyme had more than 60% of the maximum activity 

in a pH range of 7.5–9.5 and a temperature range of 30- 

50°C. The assays of optimal temperature indicated that 

the activity increased in an almost linear fashion from 25- 

40°C, but decreased once the temperature was above 

45°C. The activity was hardly detected at temperature 

higher than 70°C. It was observed that the activity of 

rGDH-G3 was affected by the buffers used. The 

recombinant enzyme in Tris/HCl performed much better 

than in Gly/NaOH buffers, while sodium phosphate buffer 

was better than Tris/HCl at the same pH. 

As shown in Figure 3B, the pH/activity profile of GDH- 

G3 was similar to GDH-I, GDH-II and GDH-Iwg3 

(Mitamura et al., 1989), with the optimal activity shifted a 

little towards a higher value. Optimal rGDH-G3 activity 

occurred at pH 9.0 while that of others from B. 

megaterium (Mitamura et al., 1989), B. thuringiensis M 15 

(Boontim et al., 2004), B. subtilis (Fujita et al., 1977) 

occurred at pH 8.0, but the optimal pH in this study was 

lower than pH 9.5 for LsGDH from L. sphaericus G10 

(Ding et al., 2010). Figure 1 showed the amino acid 

residues in GDH-G3 that are different from the other 

GDHs. Maybe the surrounding residues near the 

acid/base catalytic center affect the protonation and then 

effect a change in optimal pH (Shibuya et al., 2005). 

Effects of pH and temperature on enzyme stability 

The assays of enzyme thermostability indicated that the 

enzyme was stable below 40°C. After 60 min incubation, 

there was 72% of enzyme activity remained with 40°C 

treatment, whereas only 29% of the activity remained at 

45°C (Figure 4A). The thermostability of GDH-G3 was 

similar to its homologous counterparts, except GDH-III 

from B. megaterium IAM1030. Nagao et al. (1992) have 

reported that the two alterations, Leu-167 to Gln and Ala- 

258 to Thr, weakened the intersubunit interaction of the 

tetramer of GDH-III (Nagao et al., 1992). Therefore, it 

could be presumed that, maybe, the replacement of Gln- 

167, Thr-258 of GDH-III with the Leu and Aln could have 

promoted the thermostability of GDH-G3. And it is

Figure 1. Sequence alignment of glucose dehydrogenases of Bacillus sp.G3 and other species of Bacillus. 

Sequences were aligned using Clustalx1.83. Identical residues and conserved substitutions are shaded 

black and gray by BOXSHADE 3.21 (K. Hofmann and M. Baron), respectively. GDH-I (Accession no. 

BAA14098.1), GDH-II (Accession no. BAA14100.1), GDH-III (Accession no. BAA01475.1), and GDH-IV 

(Accession no. BAA01476.1) were cloned from Bacillus megaterium IAM1030. GDH-Iwg3 (Accession no. 

1RWB_A) was cloned from Bacillus megaterium Iwg3. GDH-G3 (Accession no.ACU78107) was cloned 

from Bacillus sp. G3. 

possible that the presence of Leu-252 instead of Lys 

increased the heat resistance of GDH-G3, as described 

in previous reports (Makino et al., 1989b; Mitamura et al., 

1989). 

The pH-stability of GDH was examined by incubation at 

25°C at various pH for 60 min and measurement of 

residual activity taken. The rGDH-G3 preserved its 

activity at the pH range between 4.0 and 9.0 (Figure 4B). 

Almost all of the GDHs from Bacillus, either wide type or 

mutant, were stable in the range of pH 6.0-7.5, 

particularly at 6.0 or 6.5, but the rGDH-G3 was more 

stability at pH 7.0. The GDH-G3 and GDH-Iwg3 are 


similar in the sequence (88% identity), and stable in the 

acidic range although GDH-Iwg3’s stability was 

comparatively higher. The observed stability of the clones 

could be attributed to the effects of replacements as 

earlier reported by Mitamura et al. (1989). 

Substrate specificity and enzyme kinetics 

Table 2 illustrated that the rGDH-G3 possessed broad 

substrate specificity toward aldose sugars and 

disaccharides than others, particularly for D-galactose,


Figure 2. SDS-PAGE analysis of the rGDH-G3 from E. coli BL21 (DE3). Lane 

1, Uninduced cellular extract; Lane 2, induced protein sample; Lane 3, the 

recombinant GDH (corresponds to 28 kDa) purified by Ni 2+ -NTA; Lane M, 

standard protein molecular weight markers. 

Figure 3. Effects of pH and temperature on enzyme activity. A, Effect of temperature on enzyme activity of the rGDH- 

G3 from 25-65°C in 100 mM sodium phosphate buffer (pH 8.0); B, effect of pH on enzyme activity of the rGDH-G3. pH 

range from 4.0-10.5 was used with the following buffers: ◆, 100 mM citrate buffer (pH 4.0–6.0); △, 100 mM sodium 

phosphate buffer(pH 6.0–8.0); ■, 100 mM Tris/HCl (pH 7.0–9.0); ○, 100 mM Gly/NaOH (pH 8.5–10.5).


Figure 4. Effects of pH and temperature on enzyme stability. A, Thermostability of the rGDH-G3. After exposure for 60 min 

to the indicated temperature in sodium phosphate buffer (25 mM, pH 8.0). The activity of untreated rGDH-G3 was defined 

as 100% (319.8 U/mg protein); B, effect of pH on the stability of the rGDH-G3. The diluted enzyme pre-incubated in the 

different buffers (pH 4.0-10.5) at 25°C for 60 min. ■, 100 mM citrate buffer (pH 4.0–6.0); △, 100 mM sodium phosphate 

buffer(pH 6.0–8.0); ◆, 100 mM Tris/HCl (pH 7.0–9.0); ○, 100 mM Gly/NaOH (pH 8.5–10.5). The activity at pH 6.5 was 

defined as 100% (224.9 U/mg protein). 

Table 2. Substrate specificity of rGDH-G3. 

Substrate 

(0.2M) 

Relative activity (%) a 

GDH-G3 LsGDH GDH-Iwg3 GDH-I GDH-II GDH-IV GDH-III GDH-A GDH-B 

D-Glucose 100 100 100 100 100 100 100 100 100 

D-Mannose 7.1 7.6 13 16 5.4 11 2.6 2 1 

D-Galactose 22 17.3 3 5.8 1.8 3.8 0.9 0 0 

D-Fructose 0.6 0.5 1.5 1.7 0.4 0.6 0.1 0 0 

D-Arabinose 0.2 0


Table 3. The kinetic analysis of the recombinant GDH. 

Km (mM) a Vmax(μΜ s -1 mg -1 ) Kcat (s -1 ) b Kcat/Km (mM -1 s -1 ) 

D-glucose 31.8±0.4 0.82±0.05 23±1 0.73±0.06 

NAD + 0.210±0.001 5.131±0.005 144±0.1 687.5±3.6 

NADP + 0.0095±0.0018 1.20±0.02 33.8±0.6 3687±629 

a The kinetic parameters were determined as described in Materials and Methods. The Km of glucose was 

determined in the range of 10-200 mM, with a fixed NAD + 1 mM. The Km for NAD + (0.05–1 mM) and 

NADP + (0.005–0.1 mM) was determined with a fixed glucose concentration of 200 mM. 

b The values of Kcat were calculated for one subunit. 

(Mitamura et al., 1989). However, the amino acid 

residues involved in the kinetic constants are still 

unknown. Therefore, further studies based on directed 

evolution, site-directed mutagenesis and crystallography 

is necessary to unravel the exact relationship between 

structure and function of GDH-G3. 


This study was supported by the National Hi-Tech 

Research and Development Program (863) of China (No. 

2007AA06Z329), National Natural Science Foundation of 

China (31070079), the Science and Technology Project 

of Zhejiang Province (2008C13014-3), and the 

International Cooperation Project in Science and 

Technology of Zhejiang Province (No. 2008C14038). 

REFERENCES 

Bonete MJ, Pire C, FI LL, Camacho ML (1996). Glucose 

dehydrogenase from the halophilic archaeon Haloferax mediterranei: 

enzyme purification, characterisation and N-terminal sequence. 

FEBS Lett., 383(3): 227-229. 

Boontim N, Yoshimune K, Lumyong S, Moriguchi M (2004). Purification 

and characterization of D-glucose dehydrogenase from Bacillus 

thuringiensis M15. Ann Microbiol, 54(4): 481-492. 

Bradford MM ( 1976). Rapid and sensitive method for quantitation of 

microgram quantities of protein utilizing principle of protein-dye 

binding. Anal. Biochem., 72: 248-254. 

Ding HT, Du YQ, Liu DF, Li ZL, Chen XJ, Zhao YH (2010). Cloning and 

expression in E. coli of an organic solvent-tolerant and alkali-resistant 

glucose 1-dehydrogenase from Lysinibacillus sphaericus G10. 

Bioresour. Technol., 102(2): 1528-1536. 

Du P, Wu P, Cai C (2008). A glucose biosensor based on electrocatalytic 

oxidation of NADPH at single-walled carbon nanotubes functionalized 

with poly(nile blue A). J. Electroanal. Chem., 624(1-2): 21-26. 

Fujita Y, Ramaley R, Freese E (1977). Location and properties of 

glucose dehydrogenase in sporulating cells and spores of Bacillus 

subtilis. J. Bacteriol., 132(1): 282-293. 

Heilmann HJ, Magert HJ, Gassen HG (1988). Identification and isolation 

of glucose dehydrogenase genes of Bacillus megaterium M1286 and 

their expression in Escherichia coli. FEBS J., 174(3): 485-490. 

Laemmli UK (1970). Cleavage of structural proteins during the 

assembly of the head of bacteriophage T4. Nature, 227(5259): 680- 

685. 

Lin SS, Miyawaki O, Nakamura K (1999). Continuous production of Lcarnitine 

with NADH regeneration by a nanofiltration membrane 

reactor with coimmobilized L-carnitine dehydrogenase and glucose 

dehydrogenase. J. Biosci. Bioeng., 87(3): 361-364. 

Makino Y, Ding JY, Negoro S, Urabe I, Okada H (1989a). Purification 

and characterization of a new glucose dehydrogenase from 

vegetative cells of Bacillus megaterium. J. Ferment. Bioeng., 67(6): 

374-379. 

Makino Y, Negoro S, Urabe I, Okada H (1989b). Stability-increasing 

mutants of glucose dehydrogenase from Bacillus megaterium IWG3. 

J. Biol. Chem., 264(11): 6381-6385. 

Mitamura T, Urabe I, Okada H (1989). Enzymatic properties of isozymes 

and variants of glucose dehydrogenase from Bacillus megaterium. 

FEBS J., 186(1-2): 389-393. 

Nagao T, Mitamura T, Wang XH, Negoro S, Yomo T, Urabe I, Okada H 

(1992). Cloning, nucleotide sequences, and enzymatic properties of 

glucose dehydrogenase isozymes from Bacillus megaterium 

IAM1030. J. Bacteriol., 174(15): 5013-5020. 

Nakatani Y, Nicholson WL, Neitzke KD, Setlow P, Freese E (1989). 

Sigma G RNA polymerase controls forespore-specific expression of 

the glucose dehydrogenase operon in Bacillus subtilis. Nucleic Acids 

Res., 17(3): 999-1017. 

Ochman H, Gerber AS, Hartl DL (1988). Genetic applications of an 

inverse polymerase chain reaction. Genetics, 120(3): 621-623. 

Okuda-Shimazaki J, Kakehi N, Yamazaki T, Tomiyama M, Sode K 

(2008). Biofuel cell system employing thermostable glucose 

dehydrogenase. Biotechnol. Lett., 30(10): 1753-1758. 

Pauly HE, Pfleiderer G (1975). D-Glucose Dehydrogenase from 

Bacillus-Megaterium M-1286-Purification, Properties and Structure. 

H.S. Z. Physiol. Chem., 356(10): 1613-1623. 

Sambrook J, Russell DW (2001). Molecular cloning: a laboratory 

manual. Cold Spring Harbor Laboratory Press, New York, pp. 1.84- 

1.88, 1.116-1.119. 

Shibuya H, Kaneko S, Hayashi K (2005). A single amino acid 

substitution enhances the catalytic activity of family 11 xylanase at 

alkaline pH. Biosci. Biotechnol. Biochem., 69(8): 1492-1497. 

Varghese G, Diwan AM (1983). Simultaneous staining of proteins during 

polyacrylamide-gel electrophoresis in acidic gels by countermigration 

of coomassie Brilliant blue R-250. Anal. Biochem., 132: 481-483. 

Vasantha N, Uratani B, Ramaley RF, Freese E (1983). Isolation of a 

developmental gene of Bacillus subtilis and its expression in 

Escherichia coli. Proc. Natl. Acad. Sci. U. S. A., 80(3): 785-789. 

Wong CH, Drueckhammer DG (1985). Enzymatic synthesis of chiral 

hydroxy compounds using immobilized glucose dehydrogenase from 

Bacillus cereus for NAD(P)H regeneration. Bio-Technol, 3(7): 649- 

651.




DOI: 10.5897/AJMR11.837 


Investigation of bioremediation of arsenic by bacteria 

isolated from contaminated soil 

Hadis Ghodsi 1 , Mehran Hoodaji 1 *, Arezoo Tahmourespour 2 and Mohammad Mehdi Gheisari 3 

1 Department of soil science, Khorasgan (Isfahan) branch, Islamic Azad University, Isfahan, Iran. 

2 Department of microbiology, Khorasgan(Isfahan) branch, Islamic Azad University, Isfahan, Iran. 

3 Department of basic science, Khorasgan (Isfahan) branch, Islamic Azad University, Isfahan, Iran. 


The aims of this study are isolating arsenite-resistant bacteria from arsenic contaminated soil and the 

investigation of arsenite bioremediation efficiency by the most resistant isolates. Isolation of arseniteresistant 

bacteria and the minimum inhibitory concentration (MIC) were conducted by spread plate 

method and the agar dilution method on PHG-II agar plates supplemented with sodium arsenite 

respectively. The results showed that, 69 and 25% of arsenite resistant isolates were geram positive and 

negative bacilli, respectively. Its maximum MIC was 128 mM/L, which is related to such bacteria as 

Bacillus macerans, Bacillus megaterimand Corynebacterium vitarumen. There is a significant difference 

(P< 0.01) between three isolates in arsenite removal potential and arsenite bioaccumulation. The 

maximum percentage of arsenite removal potential (92%) and arsenite bioaccumulation (36%) were 

related to B. macerans. The removal efficiency of arsenite for B. macerans, C. (vitaromen) and B. 

megaterim were 60, 43 and 38% after 48 h of growth, respectively, while after 144 h of Bacillus macerans, 

Corynebacterium (vitaromen) growth and 120 h of Bacillus megaterimgrowth were 92, 80 and 73% 

respectively. The results also were shown the highest percentage of arsenite in biomass (36%), arsenate 

from oxidation (27%) were related to B. macerans, B. megaterium and B. megaterium. These results 

express the probability of finding more arsenic accumulating bacteria from the contaminated soil 

environment and can be concluded that arsenic resistant and/or accumulating bacteria, such as Bacillus 

sp., are widespread in the polluted soils and are valuable candidates for bioremediation of arsenic 

contaminated ecosystems. 

Key words: Arsenite, bacteria, bioremediation, MIC. 

INTRODUCTION 

Human activities over the centuries has contaminated 

many areas of developing and developed countries 

(Evangelou et al., 2007). Soil contamination with heavy 

metals is one of the great problems of modern societies. 

Heavy metals periodically increase in the environment 

due to industrial activities and technology development. 

Increasing of these pollutants in the environment is 

considered as a serious threat to human and 

environmental health (Banaa Araghi et al., 2010). Unlike 

many organic contaminants disintegrated in the soil, 

*Corresponding author. E.mail: m_hoodaji@khuisf.ac.ir. Tel/ 

Fax: 00983115354045. 

heavy metals are kept in the soil storage and according 

to their nature a group of pollutants are of most interest 

because of their danger and of course plenty of stability 

in most environments (Garbisu and Alkorta, 2001). 

Arsenic has long been an important environmental 

pollutant and in long term has been as a health risk to 

humans and other living organisms. In the past, arsenic 

compounds have been widely used in pesticides, 

herbicides and soil disinfectors, thus in some soils was in 

high concentrations (Pais and Jons, 1997). Arsenic is 

highly toxic metal element that annually threatens the 

health of millions of people in the world (Chen and Shao, 

2009). Inorganic arsenic forms are more dangerous than 

other forms for human health and in terms of 

classification fall in cancer-causing ingredient (Andrews,


2001). In recent decades following increasing 

environmental pollution by heavy metals, scientists 

attracted to biological purification methods. In most cases 

of cleaning the contaminated ecosystems with chemical 

methods involves heavy costs and irreparable damages 

(Brooks, 1995; Nwuche and ugoji, 2008). Therefore one 

appropriate method is using biological method. Generally 

population and microbial activities in soil and water 

contaminated with the presence of metal will be reduced 

and modified (Kelly et al., 1998). On the other hand 

resistant microorganisms have evolved mechanisms to 

tolerate the toxicity of heavy metals. Application of 

microorganisms for heavy metals remediation is 

considered as a natural, stable and economical solution. 

Previous researches have described the isolation and 

characterization of arsenic resistant bacteria from 

different environments and have indicated that these 

bacteria are able to grow chemolithotrophically with 

oxygen as an electron acceptor and As(III) as an electron 

donor (Duquesne et al., 2008; Santini et al., 2000). 

Arsenic-resistant bacteria play an important role in 

controlling the speciation and cycling of arsenic in the 

ecosystems (Inskeep et al., 2007). The aims of this study 

are isolating arsenite-resistant bacteria from arsenic 

contaminated soil and the investigation of arsenite 

bioremediation efficiency by high resistant isolates. 


Sampling 

Soil samples were collected from the three different points of soil 

surface (0-20 cm) of the Research Farm (in Lavark, Najaf Abad) 

located in southwest of Isfahan, Iran. This soil was contaminated 

previously with arsenic through using of urban sewage sludge. The 

samples were mixed, transferred to the laboratory, passed through 

2 mm sieve and used for physical-chemical and microbial analysis 

(Nwuche and ugoji, 2008). 

Arsenic measurement 

In this study to measure arsenic the spectrophotometry method was 

used along with a reagent called Leuco malachite green (LMG). In 

this method arsenic reacts with Potassium iodate (KIO3) in the 

acidic environment and iodine will be released. Released iodine 

oxidizes LMG to MG and changes the color to the color of 

malachite green. Detection range of arsenic concentration in this 

method is 0.09-0.9 micro g/ml. The MG dye shows maximum 

absorption at 617 nm (Revanasiddappa et al., 2007). 

Arsenite measurement (As III) 

Initially for the preparation of arsenite stock solution (1,000 μg ml), 

amount of 0.1734g NaAsO2 (sodium arsenite) resolved in 100 ml 

deionized distilled water. The standard solutions including 0.9-9.0 

μg of arsenite removed and poured in 10 ml volumetric balloons. 

Then 1 ml of Potassium iodate 1%, 0.5 ml of 1 M hydrochloric acid 

were added and the reaction mixture was shaked for 2 min. Then 

0.5 ml of 0.05 LMG was added with shaking. Finally 2 ml acetat 

buffer (pH =4.5) was added and heated (40°C) in a water bath for 5 

min, cooled and diluted with distilled water. After 5 min, absorbance 

of the dye was measured at 617 nm against the reagent blank. The 

concentration of arsenic (III) content was established by reference 

to the calibration graph (Revanasiddappa et al., 2007). 

Arsenate measurement (As V) 

After filtering of this sample a certain volume will be removed, then 

0.5 ml of 5% KI and 5 M HCL were added to the samples. All of the 

available arsenate were reduced to arsenite. In order to remove 

yellow to brown color which is due to the high amount of released 

iodine, the droplets of ascorbic acid were added (Pillai et al., 2000) 

then the amount of total arsenic in samples were measured by the 

method of arsenite measurment. 

Soil arsenic measurement 

One gram of soil sample was placed in the nickel plate that already 

covered its bottom with NaOH. Heat the Nickel plate in order to 

NaOH be fully melted and mixed with soil (alkaline digestion). After 

cooling, the nickel plate was immersed in HCL (0.5 N) and waited in 

order to be digested slowly (Almond, 1953) then the amount of 

arsenite was measured. 

Isolation of arsenite-resistant bacteria 

One gram of each soil samples was used to provide series. 0.1 ml 

of each dilution was added to each of PHG-II agar plates (4 g 

pepton, 1 g yeast extract and 2 g glucose and 15 g agar per liter) 

supplemented with 0.5 mM sodium arsenite (pH=7) by spread-plate 

method. The plates were incubated at 30°C for 3-5 days. This 

experiment was conducted in three replicates. After isolation of 

resistant colonies, their enrichment, purification and identification 

were done by the help of Gram Staining and biochemical tests 

(catalase- Licetinase- citrate – MR- VP -manitol fermentation and 

acid production - fermentation of glucose, sucrose and galactose - 

nitrate reduction test, urease and Esculine Hydrolysis) (Sneat et al., 

1989; Cappuccino and Sherman, 1996). 

Minimum inhibitory concentration (MIC) determination 

The (MIC) of arsenite at which no colony growth occurred was 

determined by the agar dilution method. PHG-II agar plates 

supplemented with different concentration of arsenite the level of 

resistance (0.5, 1, 2, 4, ... and 192 mM /L) were inoculatedas 

aseptically with a culture of bacterial isolates in exponential growth 

phase. The plates were incubated for 48 h at 35°C. Minimum 

concentration of arsenite allowing growth of the isolates was an 

indication of positive tolerance (Hassen et al., 1998). 

Growth curve and arsenite removal by bacterial strains 

The growth curve of the most resistant bacteria at sub MIC 

concentration of arsenite were monitored by measuring the optical 

density (OD) of the cultures at 600 nm using a spectrophotometer. 

At each intervales a certain volum of medium was removed, after 

measuring OD at 600 nm. It was centrifuged and filtered. Than, the 

arsenite and arsenate concentration were measured by the above 

mentioned method (Chen and Shao, 2008; Revanasiddappa et al., 

2007; Pillai et al., 2000). At the end of growth phase arsenite 

concentration in bacterial cell structure was measured by the 

method of Takeuchi et al., 2007. Briefly, the culture media were 

shake at 100 rpm, centrifuged at 5000 ×g at 4°C for 20 min. The

Table 1. Soil chemical and physical properties. 

Ghodsi et al. 5891 

Depth 

Texture 

Clay Silt Sand 

pH 

EC Pava Kava AsTotal As 5+ As 3+ 

(cm) (%) (dS.m -1 ) ( mg.kg -1 ) 

0-20 SiCL 35.83 48.83 15.34 7.63 2.6 10 203 60.2 40.3 19.7 

Table 2. The bichemical tests and MIC of the greatest arsenite resistant bacteria. 

Bacteria test Strain 4 Strain 8 Strain 10 

Spore + - + 

Catalase + + + 

Manitol + ND + 

VP - - - 

MR + + + 

Nitrate + + + 

Citrate - - + 

Glucose + + + 

Sucrose ND + + 

Urea ND + ND 

Probable general and species B. macerans C. (vitaromen) B. (megaterim) 

MIC 128 128 128 

pelletes were washed twice with distilled water and placed in an 

oven with 100°C temperature for drying. The dried sampels were 

weighted and digested with nitric asid. Then the arsenite 

concentration was measured at 617 nm by the spectrophotometric 

method. 


Statistical analysis was conducted using the SPSS System 

software. For comparison of means the Duncan test was used at 

the 5% probability level. 

RESULTS 

Soil physical and chemical properties 

The physical and chemical properties of soil is presented 

in Table 1. 

Resistance to arsenite 

The results showed that, 69 and 25% of arsenite resistant 

isolates were geram positive and negative bacilli, 

respectively and 6% of them were gram positive cocci. 

According to MIC determination results, the greatest 

resistance to arsenite has been related to gram positive 

bacilli. Its maximum MIC and MBC were 128 and 192 

mM/L respectively, which is related to such bacteria as B. 

macerans, B. megaterim and C. vitarumen (Table 2). 

Growth curve and arsenite removal by bacterial 

strains 

In Figure 1 growth curves of B. macerans, C. vitaromen, 

B. megaterium were shown in 128 mM arsenite. 

The removal efficiency of arsenite for Bacillus 

macerans, Corynebacterium (vitaromen) and Bacillus 

megaterimwere 60, 43 and 38% after 48 h of growth, 

respectively. While after 144 h of Bacillus macerans, 

Corynebacterium (vitaromen) growth and 120 h of 

Bacillus megaterim growth, the removal efficiency of 

arsenite were 92, 80 and 73% respectively (Figures 2, 3 

and 4). 

Finally, the percentage of arsenite in bacterial mass 

(bioaccumolation), arsenate from oxidation and remained 

arsenite were determined. The results were shown in 

Figure 5. The highest percentage of arsenite in biomass 

(36%), arsenate from oxidation (27%) were related to B. 

macerans, B. megaterium and B. megaterium. 

There is a significant difference (P< 0.01) between 

three isolates in arsenite removal potential and arsenite 

bioaccumulation (Figure 6). The maximum percentage of 

arsenite removal potential (92%) and arsenite 

bioaccumulation (36%) were related to B. macerans. 

DISCUSSION 

The first step in the identification of bacteria with the 

ability of bioremediation is isolation of resistant bacteria


OD (600 nm) 

0.35 

0.3 

0.25 

0.2 

0.15 

0.1 

0.05 

0 

0 12 24 32 48 60 72 84 96 108120132144156168180192 

Time Time (h) (hr) 

B. macerans C. vitaromen B. megatrium 

Figure 1. Bacterial growth curves of Bacillus macerans, Corynebacterium vitaromen and 

Bacillus megaterium in 128 mM of arsenite. 

Growth OD 

(600 nm) 

0.35 

0.3 

0.25 

0.2 

0.15 

0.1 

0.05 

0 

Growth Concentration 

0 24 48 72 96 Time 120(h) 144 168 

Time (hr) (h) 

100 

90 

80 

70 

60 

50 

40 

30 

20 

10 

0 

Concentration - 

arsenite (%) 

Figure 2. Growth and arsenite removal curvs of Bacillus macerans. 

Growth OD 

(600 nm) 

0.35 

0.3 

0.25 

0.2 

0.15 

0.1 

0.05 

0 

which tolerate high concentrations of heavy metals 

(Trevors et al., 1985). Most arsenic resistant bacteria are 

separated from arsenic-rich environments. In natural 

environments, the number of arsenite resistant bacteria is 


0 24 48 72 96 120 144 168 

Time (hr) (h) 

100 

90 

80 

70 

60 

50 

40 

30 

20 

10 

0 


arsenit (%) 

Figure 3. Growth and arsenite removal curvs of Corynebacterium vitaromen. 

less than arsenate resistant bacteria. Arsenate is more 

toxic than arsenite (Jackson et al., 2005). Among the 

isolated resistant strains from contaminated soil , three 

strains demonstrated dramatic resistance to arsenite 128

Growth OD 

(600 nm) 

0.3 

0.25 

0.2 

0.15 

0.1 

0.05 

0 


100 

0 24 48 72 96 120 144 

Time Time (h) (hr) 

90 

80 

70 

60 

50 

40 

30 

20 

10 

0 


arsenite (%) 

Figure 4. Growth and arsenite removal curvs of Bacillus megaterium. 

Figure 5. Arsenite in biomass (bioaccumulation), arsenate from oxidation and remaind arsenite 

percentage of A: Bacillus macerans, B: Corynebacterium vitaromen and C: Bacillus 

megaterium. 

100 

90 

80 

70 

60 

50 

40 

30 

20 

10 

0 

Mm. These arsenite-resistant strains were probably B. 

macerans, C. vitaromen and B. megaterium. 

Concentrations of metals used in this study are also used 

in the similar studies for bacteria that their medium 

contains extracted yeast. Abu-shnab et al. (2003) showed 

that in a contaminated soil the 11.1% of isolated bacteria 

(%) 

a 

b 

c 

Remove arsenite 

bioaccumulation 

a 

b 

c 

B. ( macerans) 

C. (vitaromen) 

B. (megaterium) 

Figure 6. The comparision of arsenite removal potential in 3 isolates. 


were resistant to As with the MIC of 20 mM/L. High levels 

of soil metal concentration can lead to achieving such a 

high MIC in resistant strains. Also Chitpirom et al. (2009), 

in Thailand, isolated arsenic-resistant bacteria from 

tannery effluent and agricultural soils that were belonged 

to Klebsiella, Pseudomonas, Comamonas and


Enterobacter genera with the MIC of 40 mM (arsenite) 

and 400 mM (arsenate). Pepi et al. (2007) isolated 3 

arsenic resistant genera (Aeromonas, Bacillus and 

Pseudomonas) from contaminated sediments with the 

MIC of 16.66 mM (arsenite) and 133.47 mM (arsenate). 

They also concluded that these bacteria are suitable for 

arsenic bioremediation in contaminated sediments. In a 

study by Luis et al. (2006) in Spain with the aim of 

biological removing of arsenic, Corynebacterium 

glutamicum with over 60 mM arsenite resistance 

identified as one of the most tolerant species to arsenic. 

This results are in agreement with our findings but our 

isolates could tolerate the higher concentration of 

arsenite that was related to high level of arsenite in soil. 

In the study after 144 h of B. macerans, C. vitaromen 

growth and 120 h of Bacillus (megaterium) growth, the 

removal efficiency of arsenite were 92, 80 and 73% 

respectively. The highest percentage of arsenite in 

biomass (36%), arsenate from oxidation (27%) were 

related to B. macerans, B. megaterium and B. 

megaterium. Among resistant isolates, B. macerans was 

able to remove 92% of arsenite in the medium and also 

store 36% of it in the cell mass which is introduced as 

superior strain in this regard. Studies by Mondal et al. 

(2008) on three strains of Ralstonia eutropha, 

Pseudomonas putida and Bacillus indicus showed that 

these strains were able to remove (67, 60 and 61% 

respectively) arsenic from wastewater. 

Takeuchi et al. (2007) could isolate a non- genetically 

engineered potent arsenic accumulating bacterium, 

Marinomonas communis, from marine and non marine 

environment in Japan which accumulated 2290 μg Asg 

dw -1 of arsenic in presence of 5 mg As/ l of arsenat 

(45.8%). Our results are in agree with Takeuchi et al. 

(2007) and although details of such mechanisms are not 

yet clear, accumulation of arsenic into the cell would be a 

result of higher uptake and lower efflux. The high 

effective concentration of As in this study and previous 

study (Takeuchi et al., 2007) could be related to the 

presence of arsenic resistance systems such as 

regulatory protein of the ars operon that has a specific 

binding site available for arsenite. However, presence of 

ars operon in bacteria is known to extrude arsenate from 

the cell by an efflux system. Consequently, arsenic is not 

accumulated in bacteria. Furthermore, the other known 

arsenic-resistant system, the phosphate-specific 

transport (Pst) system, would also lead to lower uptake of 

arsenat by the cell. Therefore, the present results 

obtained in our isolates and previousley isolated M. 

communis with its higher resistance and higher 

accumulation of arsenic contradict the known arsenic- 

resistant systems, suggesting existence of an as yet 

unknown arsenic resistance system for these strains. Cai 

et al. (1998) also could isolate Pseudomonas strains 

without the ars operon with a yet unknown arsenic 

resistance system. 

These results express the probability of finding more 

arsenic accumulation bacteria from the contaminated soil 

environment. It can be concluded that arsenic resistant 

and/or accumulating bacteria are widespread in the 

polluted soil environment,and that arsenic-accumulating 

bacteria such as Bacillus sp. are valuable candidates for 

arsenic contaminated ecosystems bioremediation. 

REFERENCES 

Abu-Shanab RAI, Delorme TA, Angle JS, Chaney RL, Ghanem K, 

Moawad H, Ghozlan HA (2003). Phenotypic characterization of 

microbes in rhizosphere of Alyssum murale. Int J Phyto 5: 367-380. 

Almond H (1953). Field method for determination of trace of arsenic in 

soils. J. Anal. Chem., 25: 1766-1767. 

Andrews JM (2001). Determination of minimum inhibitory 

Concentration. J. Antimicrob. Chemother., 48:5-16. 

Banaa AN, Hoodaji M, Afyuni M (2010). Use of EDTA and EDDS for 

enhanced zeamays’ phytoextraction of heavy metals from a 

contaminated soil. J. Residual. Sci. Tech., 7(3): 139- 145. 

Brookes PC (1995). The use of microbial parameters in monitoring soil 

pollution by heavy metals. J. Biol. Fertile Soils 19:269-279. 

Cai J, Salmon K, Du Bow MS (1998). A chromosomal ars opran 

homologue of Pseudomonas aeruginosa confers increased 

resistance to arsenic ana antimony in Escherichia coli. J. Microbiol., 

144:2705-2713. 

Cappuccino J, Sherman N (1996). Microbiology (a laboratory manual) . 

Benjamin/ Cumming publishing company INC. 

Chen Sh, Shao Z (2009). Isolation and diversity analysis of arsenite- 

resistant bacteria in communities enriched from deep- sea sediments 

of the South west Indian Ocean Ridge. J. Extremophiles 13:39-48. 

Chitpirom K, Akaracharanya A, Tanasupawat S, Leepipatpibooim N, 

Woong Kim K (2009). Isolation and characterization of arsenic 

resistant bacteria from tannery wastes and agricultural soils in 

Thailand. J. Ecol. Environ. Microbiol., 59(4): 649-656. 

Duquesne K, Lieutaud A, Ratouchniak J, Muller D, Lett M-C, Bonnefy V 

(2008). Arsenite oxidation by a chemoautotrophic moderately 

acidophilic Thiomonas sp.: from the strain isolation to the gene study. 


Evangelou MWH, Ebel M, Schaeffer A (2007). Chelate assisted 

phytoextraction of heavy metals from soil. Effect, mechanism, toxicity 

and fate of chelating agents. Chemosphere 68: 989-1004. 

Garbisu C, Alkorta I (2001). Phytoextraction: a cost- effective plant- 

based technology for the removal of metals from the environment. J. 

biores Technol., 77: 229-236. 

Hassen A, Saidi N, Cherif M and Boudabous A (1998). Resistance of 

environmental bacteria to heavy metals. Biores Technol., 64: 7-15. 

Inskeep WP, Maser RE, Hamamura N,Warelow TP,Ward SA, Santini 

JM (2007). Detection, diversity and expression of aerobic bacterial 

arsenite oxidase genes. Environ. Microbiol., 9:934–943. 

Jackson CR, Dugas SL, Harrison KG (2005). Enumeration and 

characterization of arsenat-resistant bacteria in arsenic free soils. J. 

Soil Biol. Biochem., 37(12): 2319-2322. 

Kelly JJ, Tate RL. (1998). Effects of heavy metals contamination and 

remediation on soil microbial communities in the vicinity of a zinc 

smelter. J. Environ. Qual., 27. pp: 1458-1467. 

Luis M, Ordonez E, Letek M, Gil J (2006). Corynebacterium glutamicum 

as a model bacterium for bioremediation of arsenic. Int. J. Microbiol., 

9: 207-215. 

Mondal P, Majumder CB, Mohanty B (2008). Growth of three bacteria in 

arsenic solution and their application for arsenic removal from 

wastewater. J. Basic Microbiol., 48(6): 521-525. 

Nwuche CO, Ugoji EO (2008). Effects of heavy metal pollution on the 

soil microbialactivity. J. Environ. Sci. Technol., 5:409-4140. 

Pais IJ, Benton Jons JR (1997). The hand book of trace elements. 

Publishing by: St. Luice press Boca Rrton Florida. 

Pepi M, Volterrani M, Renzi M, Marvasi M, Gasperini S, Franchi E, 

Focardi SE (2007). Arsenic-resistant bacteria isolated from 

contaminated sediments of the Orbetello Lagoon, Italy, and their 

characterization. J. Appl. Microbiol., 103(6):2299-308.

Pillai A, Sunitha G, Gupta VK (2000). A new system for the 

spectrophotometric determination of arsenic in environmental and 

biological semples. J. Anal. Chem. Acta 408: 111-115. 

Revanasiddappa HD, Dayananda BP, Kumar TNK (2007). A sensitive 

spectrophotometric method for the determination of arsenic in 

environmental sampeles. J. Environ. Chem. let., 5: 151-155. 

Santini JM, Sly LI, Schnagl RD, Macy JM (2000). A new 

chemolithotrophic arsenite-oxidizing bacterium isolated from a gold 

mine:phylogenetic, physiological and preliminary biochemical studies. 

Appl. Environ. Microbiol., 66:92–97. 


Sneat PH, Mair ANS, Sharp ME, Holt JG (1989). Bergeys manual of 

systematic bacteriology. Vol (2). Williams and Wilkins. 

Takeuchi M, kawahata H, Prasad Gupta L, Kita N, Morishita Y, Ono Y, 

Komai T (2007). Arsenic resistance and removal by marine and nonmarine 

bacteria. J Biotechnol 127: 434-442. 

Trevors JT, Oddie KM, Belliveau BH (1985). Metal resistance in 

bacteria. FEMS Microbiol. Lett., 32:39-54.




DOI: 10.5897/AJMR11.841 


Effects of temperature on recruitment and 

phytoplankton community composition 

Xiao Tan 

College of Environment, Hohai University, Nanjing 210098, China. E-mail: biotan@163.com. Tel: +8613057610908. 


Effects of temperature on phytoplankton recruitment and variations in phytoplankton community were 

studied by using hiemal sediment from Taihu Lake and performing a simulation experiment. Sediment 

samples were cultured in filtered lake water with elevated temperatures. Recruitment patterns and 

photosynthetic capacity of cyanobacteria, chlorophytes and diatoms were recorded, respectively. 

Results showed that recruitment of chlorophytes and diatoms was observed above 9°C, but recruitment 

of cyanobacteria was not evidently detected until 12.5°C. Chlorophytes dominated the phytoplankton 

community at 12.5 and 16�C, subsequently cyanobacteria established dominance above 19.5�C. In this 

study, algal cells remained weak photochemical vitality at lower temperatures before recruitment, which 

reactivated and increased gradually with elevated temperatures. 

Key words: Recruitment, temperature threshold, cyanobacteria, blooms, Taihu Lake, phytoplankton community. 

INTRODUCTION 

In winter, some species of phytoplankton are capable of 

dormancy on lake sediment after autumnal sedimentation 

(Tsujimura et al., 2000; Brunberg and Blomqvist, 2002). 

These benthic portions are able to renew growth and 

return to the pelagic phase with increased temperature in 

spring (Ståhl-Delbanco and Hansson, 2002; 

Karlsson-Elfgren and Brunberg, 2004; Verspagen et al., 

2005). Especially, in some eutrophic lakes, recruitment is 

a key process in cyanobacteria life cycle and blooms 

formation (Oliver and Ganf, 2000; Kong and Gao, 2005). 

Various versions of migration traps had been designed to 

study cyanobacteria recruitment in lakes (Hansson et al., 

1994; Brunberg and Blomqvist, 2003; Cao et al., 2005). In 

labs, some simulation experiments were performed to 

investigate influences of environmental factors on 

cyanobacteria recruitment (Ståhl-Delbanco and Hansson, 

2002; Li et al., 2004; Tao et al., 2005). According to these 

field studies and simulation experiment, temperature had 

been confirmed to play an important role in driving 

cyanobacteria recruitment (Latour et al., 2004a; Li et al., 

2004; Tao et al., 2005). However, previous studies mainly 

focused on the recruitment of some species of 

cyanobacteria and did not adequately analyze the 

variations in phytoplankton community composition 

synchronously. Furthermore, cyanobacteria undergo a 

series of biomass accumulation and population 

competitive processes with other algae from recruitment 

to dominance establishment before blooms formation 

(Cao et al., 2005). 

These processes remained to be further understood. 

Variable chlorophyll a fluorescence yield has become an 

important tool for studying phytoplankton photosynthesis 

(Schreiber, 1994; Oliver and Whittington, 1998), because 

it is sensitive to photon flux density and is reliable as a 

parameter to offer insight into the immediate past light 

history of phytoplankton (Zhang et al., 2008). The ratio of 

maximum variable fluorescence to the maximum yield 

(Fv/Fm) has been used to estimate changes in the 

proportion of functional reaction centers and as an 

indicator of the photosynthetic capacity of phytoplankton 

(Falkowski and Kolber, 1995). Moreover, PHYTO-PAM 

fluorometer allows a separate measurement of the 

fluorescence signal of each algal group in mixed 

phytoplankton populations. Accordingly, effects of 

temperature on photosynthetic capacity of different algal 

groups could be detected synchronously, which is an 

important physiological index to analyze recruitment and 

competitive processes (Latour et al., 2004a). In this

Figure 1. Location of the sampling site. 

paper, a simulation experiment was performed by using 

hiemal sediment samples from Taihu Lake, which were 

static cultured in light incubator, so as to study the 

temperature threshold for algae recruitment and effects of 

temperature changes on algal community composition. 

Additionally, variations of algal fluorescence were also 

analyzed to investigate responses of different algal 

groups to temperature changes. 


Lake and sampling site description 

Taihu Lake is a large eutrophic lake in China (with an area of 2, 338 

km 2 and the annual average water depth of 1.9 m and maximum of 

2.6 m) (Hu et al., 2006). Major cyanobacteria blooms composed of 

Microcystis spp. had appeared annually for decades in this lake 

(Chen et al., 2003). Meiliang Bay lies in the northern part of Taihu 

Lake, where serious blooms frequently occurred in summer (Chen 

et al., 2003; Tan et al., 2009). In the present study, the sampling site 

(31°28´46´´N, 120°11´34´´E) is located between Meiliang Bay and 

offshore regions (Figure 1). 

Sample collection and treatment 

On January 9, 2008, about 300 g of surface sediment (0 to 3 cm) 

was collected at the sampling site by a columnar sampler 

(KC-Denmark). During the sampling period, underwater 

environmental parameters (such as depth, water temperature, 

density of cyanobacteria cells and chlorophyll a concentration) were 

real-time recorded by using a multi-parameter water quality sonde 

(YSI 6600V2, USA). Sediment samples were transferred to 

Tan 5897 

laboratory immediately and were divided into three equal aliquots 

approximately. Each portion was laid on the bottom of a beaker. 

Subsequently, sterilized in situ lake water (5 L of 0.22 µm filtrate by 

Whatman GF/C membrane) were gently added. The three beakers 

were then incubated under an illumination intensity of 40 μmol 

photons m –2 s –1 , provided by cool white fluorescent lamps (36W 

FSL, China), with a light-dark period of 12/12 h . The incubation 

temperature increased along eight levels (5.5, 9, 12.5, 16, 19.5, 23, 

26.5 and 30�C), with each temperature being maintained for three 

days. 

Microscopic analysis of phytoplankton 

At the beginning and the end of each temperature level, 110 mL of 

the culture liquid were obtained gently from each beaker by a plastic 

tube (length=20 cm, diameter=2 cm). 10 ml of the culture liquid were 

used for algal fluorescence analysis immediately; the residual 100 

ml were fixed with Lugol’s iodine and sedimented for 48 h prior to 

microscopic analysis. Phytoplankton cell densities were enumerated 

by using a haemocytometer. And then, their specific growth rates 

(SGRs) were calculated according to the following equation: 

SGR = ln(Ct/C0)/t 

Where C0 is the initial cell density at the beginning of each 

temperature level, Ct is the cell density at the end and t is the 

duration of incubation period under each temperature level in days. 

Moreover, unicells, dividing cells (two connected cells), and colonies 

were enumerated. Colonies were grouped into consecutive groups: 

small colonies (cell number per colony between 2 and with a 

maximum of 10 cells), middle colonies (cell number per colony was 

up to 10 and maximum of 100 cells), and large colonies (cell number 

per colony with more than 100).


Table 1. Mean and ranges of real-time recorded environmental parameters at the sampling site. 

Environmental parameter Mean and ranges 

Depth (m) 1.95 (1.93 to 1.97) 

Water temperature (�C) 5.2 (5.1 to 5.3) 

Chlorophyll a (µg L -1 ) 0.09 (0.07 to 0.11) 

Cyanobacteria cell density (cells mL -1 ) 129 (118 to 139) 

14 

12 

10 

PHYTO-PAM fluorometer analysis 

Cell density (10 8 cells mL -1 

8 

6 

4 

2 

0 

Cyanobacteria 

Chlorophytes 

Diatom 

5.5 9 12.5 16 19.5 23 26.5 30 

Temperature ( ℃ ) 

Figure 2. Phytoplankton dynamics during the experiment. 

Algal fluorescence was measured by using a multiwavelength 

phytoplankton pulse-amplitude-modulated fluorometer (Phyto-PAM 

Walz, Germany) after dark adaption for 15 min. The Phyto-PAM 

fluorometer equipped with a special emitter-detector unit (Phyto-ED) 

for distinguishing cyanobacteria, chlorophytes and 

diatoms/dinoflagellates by means of four excitation wavelengths 

(665, 645, 520 and 470 nm). For instance, in chorophytes 

chlorophyll fluorescence is much more effectively excited by blue 

and red light (470, 645 and 665 nm) than by green light (520 nm). In 

the case of cyanobacteria, almost no chlorophyll fluorescence is 

excited by blue light (470 nm), while excitation at 645 nm is 

particular strong due to phycocyanin and allophycocyanin 

absorption. As for diatoms and dinoflagellates, excitation by blue 

(470 nm) and green (520 nm) is relatively high resulted from strong 

absorption by fucoxanthin, chlorophyll c and carotenoids. The 

fluorescence signals from the four wavelengths excitation were 

assigned to the three algal groups by using the Phyto-WIN software 

(version 1.47) and the reference spectra (Zhang et al., 2008). The 

maximal efficiency of photosystem II photochemistry was 

determined as Fv/Fm, which was used for an indicator of the 

photosynthetic capacity of phytoplankton (Falkowski and Kolber, 

1995). Fv/Fm was calculated by the following equation: 

Fv/Fm = (Fm - F0)/Fm 

Where F0 is the fluorescence of dark-adapted algal cells stimulated 

by a weak probe light immediately after 15 min of darkness and Fm 

is the maximum fluorescence signal after the closure of all reaction 

centers by 600 ms pulse of saturating irradiance (Schreiber et al., 

2002). 

RESULTS 

Environmental parameters at the sampling site 

Sediment samples were collected in a sunny and 

windless day. Environmental parameters at the sampling 

site are displayed in Table 1. During the sampling period, 

water depth of the sampling site fluctuated between 1.93 

and 1.97 m. This range was near to the average depth of 

Taihu Lake. Water temperature was about 5.2�C, which 

was very close to the initial culture temperature (5.5�C) 

and was easier for hiemal algae to accommodate. At the 

sampling site, chlorophyll a concentration and the density 

of cyanobacteria cells were fairly low in water. 

Phytoplankton dynamics 

According to the algae growth curves (Figure 2) and the 

calculated SGRs, recruitment of chlorophytes and 

diatoms was observed at 9�C, but the recruitment of

cyanobacteria was not evidently detected until 12.5�C. 

SGR of cyanobacteria peaked at 19.5�C (about 0.256 

D -1 ). As for chlorophytes and diatoms, the maximum of 

SGRs simultaneously appeared at 12.5�C, reaching to 

0.231 D -1 and 0.175 D -1 , respectively. Particularly, 

Microcystis spp. (such as Microcystis aeruginosa, 

Microcystis wesenbergii, and Microcystis flos-aquae) 

constituted the dominant species of cyanobacteria. After 

recruitment, pelagic Microcystis colonies experienced an 

enlargement process, but unicells and dividing cells 

occupied the highest proportion all along (Figure 3). 

Variations in phytoplankton community composition 

Phytoplankton community structure at different 

temperatures was displayed in Figure 4. At the lower 

temperatures (5.5 and 9�C), cyanobacteria, chlorophytes, 

diatoms and some species of euglenophyta or 

chrysophyta were found in the culture media. However, 

concentration of euglenophyta and chrysophyta cells did 

not markedly increase with elevated temperatures. Above 

12.5�C, phytoplankton community was overwhelmingly 

composed of cyanobacteria, chlorophytes, and diatoms. 

Specifically to say, chlorophytes established dominance 

at 12.5 and 16�C. Subsequently, cyanobacteria 

maintained dominant position above 19.5�C. 

Algal photosynthetic capacity 

The maximal efficiency of photosystem II photochemistry 

was measured at different temperature levels, and was 

demonstrated in Figure 5. Algae cells remained weak 

photochemical vitality before recruitment, their 

photosynthetic capacity increased gradually after 

recruitment. As for chlorophytes and diatoms, 

photosynthetic capacity peaked at 23�C, while that of 

cyanobacteria reached its peak value at 26.5�C. 

DISCUSSION 

Influences of environmental factors on algae recruitment 

had been investigated previously (Barbiero and Kann, 

1994; Ståhl-Delbanco and Hansson, 2002; Cao et al., 

2005; Tao et al., 2005). Based on most of the literature, 

temperature, light and sediment resuspension were 

recognized to be the most important driving factors (Tan 

et al., 2008). In this paper, a simulation experiment was 

performed by static culture in light incubator, aiming to 

study effects of temperature on algae recruitment and 

populations succession. According to the results, we 

inferred that the temperature threshold for cyanobacteria 

recruitment would be between 9 and 12.5�C, which was 

higher than that for chlorophytes and diatoms. This 

threshold range was in agreement with field studies in 

Tan 5899 

Taihu Lake made by other persons, who reported that 

benthic cyanobacteria started to grow in March when 

average temperature was about 10�C (Cao et al., 2005; 

Zhang et al., 2005). Previous studies indicated the protein 

synthesis of Microcystis aeruginosa accelerated when the 

temperature rose above 7�C, if below this threshold 

physiological metabolism of benthic cyanobacteria was 

bogged down (Càceres and Reynolds, 1984). 

It suggested that temperature plays an important role in 

the recovery of the active form of M. aeruginosa in spring 

(Latour et al., 2004b). Considering facilitated action of 

resuspension and bioturbation in lakes, migration of 

overwintering phytoplankton in sediment might be initiated 

at lower temperature than static incubation 

(Karlsson-elfgren et al., 2004; Verspagen et al., 2004). In 

the experiment, sterilized lake water from sampling site 

was used as culture medium. Therefore, at the beginning 

of recruitment pelagic algae all originated from sediments. 

Thereafter, increases in abundances of the pelagic algae 

could result from two sources: growth of the 

phytoplankton already present in water and the amounts 

of recruitment from sediments. These two portions both 

contributed to the development of phytoplankton in water. 

Thus, recruitment of phytoplankton played two roles: 

either as a source of initial pelagic growth or as a 

supplement to further pelagic development (Cao et al., 

2005). In the present study, recruitment of cyanobacteria 

initiated later than chlorophytes and diatoms, but higher 

SGR helped cyanobacteria establish and keep dominant 

position shortly after recruitment. Additionally, colony 

enlargement phenomena of Microcystis were also 

observed in the absence of zooplankton. Pelagic 

Microcystis mainly existed as unicells or small colonies 

comprising a couple of cells at lower temperatures and 

gradually formed large colonies after warming up. 

Two mechanisms are involved in the enlarging pattern: 

one is that colonies are formed when daughter cells of a 

recently divided cell remain in a regular arrangement 

during the reproductive process and the other is that 

formation of colonies is adhesion of already existing 

single cells (Lürling, 2003). Large colonies consisted of 

dozens or hundreds of cells, which could be conglutinated 

together by sheath to form blooms and effectively defend 

against grazing by zooplankton (Yang et al., 2006). Many 

Microcystis unicells and dividing cells coexisted with 

colonies after recruitment, the proportion of dividing cells 

showed a significant correlation to the frequency of 

dividing cells, which was mainly responsible for algae 

growth rate and cell viability (Latour et al., 2004b). Thus, 

rapid proliferation and colony enlargement strategy 

provided Microcystis with an effective competitive power. 

In contrast, chlorophytes and diatoms, did not maintain 

high growth rates for occupying ecological space, whose 

predominance was exceeded by cyanobacteria easily. 

Previous studies had successfully detected esterase 

activities of overwintering M. aeruginosa as an indicator 

for cell viability (Latour et al., 2004a).


100% 

80% 

60% 

40% 

20% 

0% 

Unicells Dividing cells Small colonies 

Middle colonies Large colonies 

5.5 9 12.5 16 19.5 23 26.5 30 

Temperature (℃) 

Figure 3. Percentages of Microcystis spp. unicells, dividing cells, and colonies. Colonies were 

grouped into consecutive groups: small colonies (cell number per colony from 3 to 10), middle colonies 

(cell number per colony between 10 and 100), and large colonies (cell number per colony more than 

100). 

100% 

75% 

50% 

25% 

0% 

other phytoplankton diatom chlorophytes cyanobacteria 

5.5 9 12.5 16 19.5 23 26.5 30 

Temperature (℃) 

Figure 4. Phytoplankton community composition at different temperature levels. 

Fv/Fm 

0.8 

0.7 

0.6 

0.5 

0.4 

0.3 

0.2 

0.1 

0 

Cyanobacteria Chlorophytes Diatoms 

5.5 9 12.5 16 19.5 23 26.5 30 

Temperature (°C) ( ℃ ) 

Figure 5. Photosynthetic capacities of cyanobacteria, chlorophytes and diatoms at 

different temperature levels.

While, esterase activities of different algal groups hardly 

could be measured separately in mixed samples. In the 

present study, photosynthetic capacities of cyanobacteria, 

chlorophytes and diatoms were analyzed by using 

Phyto-PAM (Walz, Germany) and displayed by Fv/Fm 

index, respectively, owing to the absence of 

dinoflagellates all along. Before recruitment, 

phytoplankton remained weak photochemical vitality, 

these dormant algae cells could be referred to as 

‘physiologically resting cells’ (Sicko-goad, 1986). They 

could be reactivated and increased gradually with 

elevated temperature (Li et al., 2004). Their maximum of 

photosynthetic capacity usually occurred at the optimum 

temperature for physiological metabolism (Blanchard et 

al., 1996). Interestingly, the maximal efficiency of 

photosystem II photochemistry did not change with growth 

rate synchronously. Frequency of algal dividing cells 

might be under the control of an endogenous component 

(Latour et al., 2004b), which merits further studies. 


This work was supported by the National Natural Science 

Foundation of China (31000220) and China Postdoctoral 

Foundation (20110491341). 

REFERENCES 

Barbiero RP, Kann J (1994). The importance of benthic recruitment to 

the population development of Aphanizomenon flos-aquae and 

internal loading in a shallow lake. J. Plankton Res., 16: 1581-1588. 

Blanchard G, Guarini JM, Richard P, Gros P, Mornet F (1996). 

Quantifying the short-term temperature effect on light-saturated 

photosynthesis of intertidal microphytobenthos. Mar. Ecol. Prog. Ser., 

134: 309-313. 

Brunberg AK, Blomqvist P (2002). Benthic overwintering of Microcystis 

colonies under different environmental conditions. J. Plankton Res., 

24:1247-1252. 

Brunberg AK, Blomqvist P (2003). Recruitment of Microcystis from lake 

sediments: the importance of littoral inocula. J. Phycol., 39: 58-63. 

Càceres O, Reynolds CS (1984). Some effects of artificiallyenhanced 

anoxia and the growth of Microcystis aeruginosa Kütz Emend, with 

special reference to the initiation of its annual cycle in lakes. Arch. 

Hydrobiol., 99: 379-397. 

Cao HS, Kong FX, Tan JK, Zhang XF, Tao Y, Yang Z (2005). 

Recruitment of total phytoplankton, chlorophytes and cyanobacteria 

from lake sediments recorded by photosynthetic pigments in a large, 

shallow lake (Lake Taihu, China). Internat. Rev. Hydrobiol., 90: 

345-355. 

Chen YW, Qin BQ, Teubner K, Dokulil M (2003). Long-term dynamics of 

phytoplankton assembles: Microcystis-domination in Lake Taihu, a 

large shallow lake in China. J. Plankton Res., 25: 445-453. 

Falkowski PG, Kolber Z (1995). Variations in chlorophyll fluorescence 

yields in phytoplankton in the world oceans. Aust. J. Plant Physiol., 

22: 341-355. 

Hansson LA, Rudstam LG, Johnson TB, Soranno P, Allen Y (1994). 

Patterns in algal recruitment from sediment to water in a dimictic, 

eutrophic lake. Can. J. Fish. Aquat. Sci., 51: 2825-2833. 

Hu WP, Jørgensen SE, Zhang FB (2006). A vertical-compressed 

three-dimensional ecological model in Lake Taihu, China. Ecol. 

Model., 190: 367-398. 

Karlsson-Elfgren I, Brunberg AK (2004). The importance of shallow 

sediments in the recruitment of Anabaena and Aphanizomenon 

Tan 5901 

(cyanophyceae). J. Phycol., 40: 831-836. 

Kong FX, GAO G (2005). Hypothesis on cyanobacteria bloom-forming 

mechanism in large shallow lakes. Acta Ecol. Sinica, 25: 589-595 (in 

Chinese with English abstract). 

Latour D, Giraudet H, Berthon JL (2004a). Frequency of dividing cells 

and viability of Microcystis aeruginosa in sediment of a eutrophic 

reservoir. Aquat. Microb. Ecol., 36: 117-122. 

Latour D, Sabido O, Salençon MJ, Giraudet H (2004b). Dynamics and 

metabolic activity of the benthic cyanobacterium Microcystis 

aeruginosa in the Grangent reservoir (France). J. Plankton Res., 26: 

1-8. 

Li KY, Song LR, Wan N (2004). Studies on recruitment and growth 

characteristic of Microcystis in sediment. Acta Hydrobiol. Sinica, 28: 

113-118 (in Chinese with English abstract). 

Lürling M (2003). Phenotypic plasticity in the green algae Desmodesmus 

and Scenedesmus with special reference to the induction of defensive 

morphology. Ann. Limnol. – Int. J. Lim., 39: 85 -101. 

Oliver RL, Ganf GG (2000). Freshwater blooms. In Whitton BA, Potts M 

(eds) The Ecology of Cynobacteria, Kluwer Academic Publishier, 

Netherlands, pp149-194. 

Oliver RL, Whittington J (1998). Using measurements of variable 

chlorophyll-a fluorescence to investigate the influences of water 

movement on the photochemistry of phytoplankton. Physical 

Processes in Lakes and Oceans. In Imberger J (ed), Physical 

Processes in Lake and Oceans. Coastal and Estuarine Studies, 

American Geophysical Union, Washington, pp 517-534. 

Schreiber U (1994). New emitter-detector-cuvette assembly for 

measuring modulated chlorophyll fluorescence of highly diluted 

suspensions in conjunctions with the standard PAM fluorometer. 

Zeitschrift für Naturforschung C – J. Biosci., 49: 646-656. 

Schreiber U, Gademann R, Bird P, Ralph PJ, Larkum AWD, Kühl M 

(2002). Apparent light requirement for activation of photosynthesis 

upon rehydration of desiccated beachrock microbial mats. J. Phycol., 

38: 125-134. 

Sicko-Goad L (1986). Rejuvenation of Melosira granulata 

(Bacillariophyceae) resting cells from the anoxic sediments of 

Douglas Lake, Michigan. II. electron microscopy. J. Phycol., 22: 28-35 

Ståhl-Delbanco A, Hansson LA (2002). Effects of bioturbation on 

recruitment of algal cells from the ‘seed bank’ of lake sediments. 

Limnol. Oceanogr., 47: 1836-1843 

Tan X, Kong FX, Zeng QF, Cao HS, Qian SQ, Zhang M (2009). 

Seasonal variation of Microcystis in Lake Taihu and its relationships 

with environmental factors. J. Environ. Sci., 21: 892-897. 

Tan X, Kong FX, Cao HS, Yu Y, Zhang M (2008). Recruitment of 

bloom-forming cyanobacteria and its driving factors. Afr. J. 

Biotechnol., 7: 4726-4731. 

Tao Y, Kong FX, CAO HS, ZHANG XF (2005). Laboratory investigations 

on recruitment of Microcystis in sediment of Taihu Lake. J. Lake Sci., 

17: 231-236 (in Chinese with English abstract). 

Tsujimura S, Tsukada H, Nakahara H, Nakajima T, Nishino M (2000). 

Seasonal variations of Microcystis populations in sediments of Lake 

Biwa, Japan. Hydrobiologia, 434: 183-192. 

Verspagen JMH, Snelder EOFM, Visser PM, Huisman JEF, Mur LR, 

Ibelings BW (2004). Recruitment of benthic Microcystis 

(cyanophyceae) to the water column: internal buoyancy changes or 

resuspension? J. Phycol., 40: 260-270. 

Verspagen JMH, Snelder EOFM, Visser PM, Jöhnk KD, Ibelings BW, 

Mur LR, Huisman JEF (2005). Benthic–pelagic coupling in the 

population dynamics of the harmful cyanobacterium Microcystis. 

Freshwater Biol., 50: 854-867. 

Yang Z, Kong FX, Shi XL, Cao HS (2006). Morphological response of 

Microcystis aeruginosa to grazing by different sorts of zooplankton. 

Hydrobiologia, 563: 225-230. 

Zhang M, Kong FX, Wu XD, Xing P (2008). Different photochemical 

responses of phytoplankters from the large shallow Taihu Lake of 

subtropical China in relation to light and mixing. Hydrobiologia, 603: 

267-278. 

Zhang XF, Kong FX, Cao HS, Tan JK, Tao Y, Wang ML (2005). 

Research on recruitment dynamics of bloom- forming cyanobacteria 

in Meiliang Bay, Taihu Lake. Chin. J. Appl. Ecol., 16:1346-1350 (in 

Chinese with English abstract).




DOI: 10.5897/AJMR11.934 


Assessing antibiotic resistance profiles in Escherichia 

coli and Salmonella species from groundwater in the 

Mafikeng area, South Africa 

Philemon Thabo Phokela, Collins Njie Ateba* and David Tonderai Kawadza 

Department of Biological Sciences, School of Environmental and Health Sciences, Faculty of Agriculture, Science and 

Technology, North-West University Mafikeng Campus, Private Bag X2046, South Africa. 


Escherichia coli and Salmonella species occur as normal flora in the gastrointestinal tract of animals 

and humans. However, pathogenic strains exist that cause disease in humans. Infections may result 

from the consumption of water and food contaminated with faeces of human and animal origin. In 

South Africa, residents of most rural communities rely on untreated ground water for survival. This 

practice results to the transfer of pathogenic micro-organism to humans and thus amplifies the need to 

identify contaminated water systems. Results obtained may adequately address water quality problems 

and hence protect public health. The study was conducted to isolate and determine the antibiotic 

resistance profiles of E. coli and Salmonella species from the groundwater obtained from two rural 

communities in the North-West province, S.A. Nineteen ground water samples were analyzed for 

characters of E. coli and Salmonella species. Only those isolates that satisfied all the primary (oxidase 

and the triple sugar iron) and secondary identification criteria (API 20E and rapid slide agglutination 

test) for E. coli and Salmonella species were used. A total of 63 E. coli and 64 Salmonella isolates were 

identified. The antibiotic susceptibilities of these isolates were evaluated against a panel of 10 

antibiotics. A large proportion (56.7 to 57.6%) of the E. coli isolated from both Dibate and Verdwall were 

resistant to vancomycin. Similarly, large proportions (51.5 to 78.8%) of the E. coli isolated from Verdwall 

were resistant to ampicilin and erythromycin when compared to those isolated from Dibate. 

Furthermore, a higher percentage (90.0 to 100%) of Salmonella isolated from both Dibate and Verdwall 

were resistant to ampicillin, erythromycin and vancomycin. AP-E-VA was the predominant phenotype 

for E. coli isolated from both Dibate and Verdwall in 40 and 20%, respectively, while the phenotypes AP- 

E-T-VA and AP-E-VA were dominant among the Salmonella species isolated in this study. The results 

indicated that E. coli and Salmonella could serve as indicator organisms necessary to assess the 

quality of ground water and their levels are critical parameters that could help to drive management 

strategies. This will limit the effect of these pathogens on consumers, as some water samples were 

visibly identified to be contaminated. 

Key words: Salmonella, E. coli, multiple antibiotic resistant (MAR), phenotype. 

INTRODUCTION 

Access to drinking water is a fundamental human need 

and therefore a basic right of every individual, since 

contaminated water jeopardizes both the physical and 

*Corresponding author. E-mail: atebacollins1@hotmail.com. 

social health to consumers (WHO, 2003). In South Africa, 

residents of most rural communities use untreated 

groundwater for drinking and household activities. 

Generally, ground water from boreholes in these rural 

communities is usually of poor quality that results from 

chemical and microbial contamination hence considered 

to be unsafe (Momba et al., 2003, 2005, 2006; Obi et al.,

2006). Despite this, it is still used for drinking by residents 

in many communities who do not usually have access to 

portable water. Residents of Dibate and Verdwall in the 

Mafikeng area face these same problems. Although the 

infections such as diarrhoea that are caused by 

pathogens in water can be self-limiting in some patients, 

they may also be life-threatening in infants, the elderly 

and immune-compromised individuals (Momba et al., 

2008). The high prevalence of Human immunodeficiency 

virus/ acquired immune deficiency syndrome (HIV/AIDS) 

in South Africa amplifies the risks associated with 

drinking water from these sources (Bessong et al., 2009). 

Antibiotic resistant faecal coliforms have been isolated 

from different water sources in the area (Mulamattathil et 

al., 2000). Multiple antibiotic resistant E. coli O157strains, 

enterococci species and Staphylococcus aureus have 

also been isolated from animal faeces, human stool 

samples and milk in the area (Ateba et al., 2008; Ateba 

and Bezuidenhout, 2008; Moneoang and Bezuidenhout, 

2009; Ateba et al., 2010). 

These isolates could be deposited in water bodies if 

proper hygiene standards are not implemented and later 

contaminate ground water (Sorum and L’Abee-Lund, 

2002). Consequently, this could contribute in the pool of 

antibiotic resistant genes among bacteria species in the 

area and hence negatively affect the treatment of 

infections caused by these pathogens. Under these circumstances, 

it is important to determine the prevalence 

of faecal bacterial contaminants in drinking water so as to 

reduce mortality caused by these pathogens. Prior to 

1994, between 14 to 18 million South Africans were not 

receiving adequate water supply (Momba et al., 2006). 

However, as of 2004 about 4 million inhabitants in South 

Africa still rely on untreated water sources which include 

rivers, ponds and springs (Kasrils, 2004). Recently, 3.3 

million inhabitants of South Africa were identified to be 

living without access to portable water while about 15.3 

million did not have access to adequate sanitation 

(Council for Scientific and Industrial Research, 2008). 

Although the government is continually setting up 

strategies to ensure that residents in rural communities 

have access to portable water, these facilities are usually 

faced with maintenance problems. Residents are often 

left with no option but to revert to use the unprotected 

water sources like boreholes (WRC, 1993). 

These unprotected water sources easily get contaminated 

with faecal matter of both human and animal 

origin through rainfall runoffs and human defecations 

(Ahmed et al., 2005). Bacteria that belong to the family of 

Enterobacteriaceae are a major threat to humans as they 

frequently contaminate drinking water and hence have 

the potential of causing water-borne diseases (Young, 

1996). However, it is difficult to determine the effect of 

these pathogens in rural societies due to the fact that 

individuals that encounter diarrhoea related infections 

rarely report cases to hospitals (Pascal et al., 2009). This 

amplifies the need to identify contaminated water systems 

so as to adequately address water quality 

Phokela et al. 5903 

problems and hence protect human health. Furthermore, 

there is a need to regularly determine the bacterial load in 

these water systems. This might reduce water borne 

infections in humans that live in these poverty driven 

communities. This could reduce the health risks 

associated with the pathogens that are found in ground 

water. The study was aimed at isolating and determining 

the antibiotic resistance profiles of E. coli and Salmonella 

species from ground water obtained from two rural 

communities in the North-West province of South Africa. 


Area of the study 

This research was conducted in the North-West University, 

Mafikeng Campus, North-West Province, South Africa. 19 ground 

water samples were collected from two rural communities in the 

Mafikeng area. This consisted of 10 from Dibate and 9 from 

Verdwall. Verdwall is situated approximately 5 km to Itsoseng and 

Dibate is on the west of Megacity shopping complex in Mmabatho. 

The samples were collected from both storage tanks and borehole 

taps. Prior to collecting the samples, the taps were made to run for 

about 1 min. Water samples were collected into sterile 500 ml 

Duran Schott bottles and were immediately transported on ice to 

the laboratory for analysis. 

Laboratory analysis 

Media utilized in the study 

To determine the bacterial load from water samples m-Fc, m-ENDO 

and plate count agar obtained from Biolab (UK) and supplied by 

Merck, South Africa were utilized. Plate count agar was used to 

determine the heterotrophic bacterial count while m-ENDO and m- 

Fc media were used to determine the total and faecal coliform 

counts, respectively. Salmonella-shigella agar (SSA) and eosin 

methylene blue agar (EMBA) were used to selectively isolate 

Salmonella species and E. coli, respectively. 

Determination of bacterial load 

Water samples were analyzed within 2 h upon arrival in the 

laboratory according to standard methods (APHA, 1998). Each 

sample was analyzed in triplicates. An aliquot of 100 ml from each 

sample was filtered using 0.45 µm filter paper (Whatman®Glass 

Microfiber GS Filterpaper) on a water pump machine (model 

Sartorius 16824). A sterile forcep was used to remove the 

membrane filters from the machine. These filter papers were placed 

on m-FC and m-ENDO agar, respectively. Aliquots of 50 µl of the 

samples were spread-plated on plate count agar. Plate count agar 

and m-ENDO agar plates were incubated at 37°C for 24 h while m- 

FC plates were incubated at 45°C for 48 h. 

After incubation typical blue colonies on the m-FC plates were 

regarded as potential faecal coliforms. However, on m-ENDO agar 

plates, characteristic metallic-sheen colonies were considered 

potential total coliform bacteria. These isolates were counted using 

a colony counter. The results were recorded and averages 

computed. The colonies on the agar were also counted and the 

results were reported as colony forming units (CFU) per 100 ml of 

sample plated.


Selective isolation of E. coli and Salmonella species 

Aliquots of 50 µl from each water sample was spread-plated onto 

eosin methylene blue agar (EMBA) and salmonella-shigella agar 

(SSA) plates for selective isolation of E. coli and Salmonella 

species, respectively. The plates were incubated at 37°C for 24 h. 

After incubation, characteristic metallic-sheen colonies on EMBA 

and pale yellow colonies with black spots on their centres on SSA 

were considered to be presumptive E. coli and Salmonella species, 

respectively. These isolates were sub-cultured on EMBA and SSA 

plates for E. coli and Salmonella species, respectively and the 

plates were incubated at 37°C for 24 h. Pure isolates for E. coli and 

Salmonella, respectively were retained for identification using 

specific biochemical tests. 

Control strains 

E. coli (ATCC 25922), Salmonella arizonae (ATCC 13314) and 

Salmonella paratyphi (ATCC 1950) were used as positive control 

strains in all experiments. 

Bacterial identification 

Presumptive isolates were identified using the following criteria. 

Cellular morphology 

Isolates were gram stained using the method of Cruikshank et al. 

(1975). All gram-negative isolates from EMBA and SSA plates were 

subjected to primary and secondary biochemical identification tests. 

Preliminary biochemical identification tests for E. coli and 

Salmonella spp 

Triple sugar iron agar test: Triple sugar iron (TSI) agar (Biolab) 

obtained from Merck, S.A. was used to determine the potential of E. 

coli and Salmonella isolates in utilizing three sugars, (glucose, 

sucrose and lactose) at final concentrations of 0.1, 1.0 and 1.0%, 

respectively. The test was performed as previously recommended 

by (United States Pharmacopeial Convention; Incorporated 2001). 

The results were recorded and data interpreted as previously 

determined by (Forbes and Weissfeld, 1998). 

Oxidase test: The oxidase test was performed using the oxidase 

test reagent from Pro-Lab Diagnostics, United Kingdom and the test 

was performed as instructed by the manufacturer (Whatman 

International Limited, Maidstone, England). All isolates that satisfied 

the preliminary identification criteria for E. coli and Salmonella, 

respectively were subjected to confirmatory biochemical 

identification test. 

Confirmatory identification tests for E. coli and Salmonella spp 

Analytical profile index (API) API 20E 

All the presumptive E. coli and Salmonella spp. were confirmed 

using the API 20E test which is a standardized test kit designed to 

facilitate the identification of bacteria that belong to the family 

Enterobacteriaceae. The test was performed as instructed by the 

manufacturer (BioMerieux®, France). The indices obtained after 

reading the results were interpreted using the API web software 

(BioMerieux® S.A). 

Antibiotic susceptibility test 

Antibiotic susceptibility tests were performed on all E. coli and 

Salmonella species to determine their antibiotic resistant profiles 

using the Kirby-Bauer disc diffusion technique (Kirby et al., 1966). 

Before antibiotic sensitivity testing, the isolates were revived by 

culturing onto EMBA and SSA plates for E. coli and Salmonella, 

respectively. The plates were incubated aerobically at 37°C for 24 

h. Bacterial suspensions were prepared using these pure isolates 

and aliquots of 100 µl from these suspensions were spread-plated 

on Mueller Hinton agar (Biolab, Merck, South Africa). The 

susceptibilities of the isolates against a panel of ten different 

antibiotic discs obtained from Mast Diagnostics, United Kingdom 

were determined. The antibiotic discs were gently pressed onto the 

inoculated Mueller Hinton agar to ensure intimate contact with the 

surface and plates were incubated aerobically at 37°C for 24 h 

(CLSI,1999) formerly (NCCLS, 1999). The antibiotic inhibition zone 

diameters were measured and results obtained were used to 

classify isolates as being resistant, intermediate resistant or 

susceptible to a particular antibiotic based on standard reference 

values (CLSI,1999) formerly (NCCLS, 1999). Table 1 indicates the 

details of antibiotics that were used in the study. The antibiotics 

tested are those to which resistance have been reported in the area 

(Ateba and Bezuidenhout, 2008; Bezuidenhout and Moneoang, 

2009). Moreover, some antibiotics that are used to treat human 

infections were also included. 

Multiple antibiotic resistant (MAR) phenotypes 

MAR phenotypes were generated for isolates that were resistant to 

3 and more antibiotics (Rota et al., 1996). Phenotypes were 

generated using the abbreviations that appear on the antibiotic 

discs. 


Statistical analysis was done using SPSS software (version 14.0). 

Pearson’s moment correlation product (P

Table 1. Details of antibiotics that were used in the study. 

Group Antibiotic Disc conc R I S 

Aminoglycosides 

Beta –Lactams 

S 300 μg d ≤11 12 to 14 ≥15 

Ne 30 μg c ≤12 13 to 16 ≥17 

K 30 μg c ≤13 14 to 17 ≥18 

Ap 10 μg a ≤11 12 to 14 ≥15 

GM 10 μg a ≤12 - ≥13 

Glycopeptides VA 30 μg c ≤9 10 to 11 ≥12 

Tetracyclines T 30 μg c ≤14 15 to 18 ≥19 

Quinolones Nor 10 μg a ≤12 13 to 16 ≥17 

Phenols C 30 μg c ≤12 13 to 17 ≥18 

Marcrolides E 15 μg b ≤13 14 to 22 ≥23 


The superscripts a to d indicate the generally accepted concentrations of the discs according to the standard method 

stipulated by the manufacturer, Mast Diagnostics, Merseyside, United Kingdom (mention the abbreviation here). 

Table 2. The total number of bacterial counts from the ground water samples obtained from Dibate and Verdwall villages, respectively. 

Sample no /source FCC TCC HPC Sample no /source FCC TCC HPC 

DW1 (Storage tank) 4 16 224 VW1 (Storage tank) 10 20 40 

DW2 (Pump) 8 30 374 VW2 (Storage tank) 1 4 15 

DW3 (Pump) 4 10 314 VW3 (Storage tank) 3 12 20 

DW4 (Pump) 6 28 172 VW4 (Pump) 5 10 32 

DW5 (Storage tank) 2 4 125 VW5 (Pump) 7 19 116 

DW6 (Pump) 8 170 250 VW6 (Pump) 4 16 286 

DW7 (Storage tank) 0 2 0 VW7 (Pump) 0 22 90 

DW8 (Pump) 0 2 28 VW8 (Pump) 1 1 6 

DW9 (Pump) 9 12 40 VW9 (Pump) 0 5 100 

DW10 (Storage tank) 1 1 4 

DW = Dibate water; VW = Verdwall water; FCC = Faecal coliform count (cfu/100 ml); TCC = Total coliform count (cfu/100 ml); HPC = 

Heterotrophic plate count (cfu/1ml). 

Table 3. The percentages of E. coli and Salmonella spp isolated from the two sampling sites. 

Bacterial species Sample area No isolated Percentage of E. coli and Salmonella isolated 

E. coli 


Dibate 30 47.6 

Verdwall 33 52.4 

Dibate 

Verdwall 

14 

50 

not reveal any contamination, it was observed that most 

water were contaminated with bacteria of faecal origin. 

However, an interesting observation was that the counts 

were higher in samples obtained from borehole pumps 

than in tanks. Table 2 also indicates that faecal coliform 

bacteria were identified in all but 1 water sample obtained 

from Vredwall. Despite this, total coliform bacteria and 

very high levels of heterotrophic bacteria were identified 

in these samples. It was identified that the number of 

21.9 

78.1 

colony forming units were generally higher for water 

samples obtained from borehole pumps than those in 

taps that are linked to storage tanks. 

Occurrence of E. coli and Salmonella spp. in ground 

water samples 

19 ground water samples that comprised of 10 and 9


Table 4. Percentage antibiotic resistance of E. coli and Salmonella isolated from the different sampling stations. 

Antibiotics 

E. coli (N=63) Salmonella spp (N=64) 

Sampling site Sampling site 

Dibate (N=30) Verdwall (N=33) Dibate (N=14) Verdwall (N=50) 

Ap 33.0 78.8 100 100 

E 20.0 51.5 92.9 90.0 

T 23.3 12.1 14.3 64.0 

GM 0 24.2 0 2.0 

VA 56.7 57.6 100 100 

Ne 0 30.0 0 4.0 

C 3.3 27.3 7.1 26.0 

K 0 27.3 0 30.0 

S 0 15.2 0 6.0 

Nor 0 9.1 0 16.0 

Ap (ampicillin), E (erythromycin), T (tetracycline),GM (gentamicin), VA (vancomycin), Ne (neomycin), C (chloramphenicol), K 

(kanamycin), S (streptomycin), Nor (norfloxacin). 

from Dibate and Verdwall villages respectively were 

collected directly from the pumps and storage tanks. 

These samples were analyzed for the presence of 

Salmonella spp. and E. coli, respectively. Isolates that 

satisfied both the preliminary and confirmatory identification 

tests for these pathogens were retained. A total of 

63 E. coli isolates and 64 Salmonella arizonae were 

positively identified as shown in Table 3. The proportion 

of both E. coli and Salmonella spp. isolated were higher 

(33) and 50, respectively in water samples obtained from 

Verdwall. Moreover, the proportion of Salmonella isolated 

from Verdwal (50) was higher when compared to those 

isolated from water obtained in Dibate (14). 

Antibiotic resistance of E. coli and Salmonella spp. in 

ground water samples 

All the E. coli and Salmonella isolated were tested to 

evaluate their susceptibilities to 10 different antibiotics. 

Results obtained are depicted in Table 4. A large 

proportion (51.5 to 78.8%) of the E. coli isolated from 

Verdwall was resistant to ampicillin and erythromycin 

when compared to those isolated from Dibate. Similarly, 

a large proportion (56.7 to 57.6%) of the E. coli isolates 

from both Dibate and Verdwall were resistant to 

vancomycin. Despite the fact that a small proportion (9.1 

to 30.3%) of the E. coli isolates from Verdwall were 

resistant to gentamicin, neomycin, kanamycin, 

streptomycin and norfloxacin, none of those isolated from 

Dibate were resistant to these antimicrobial agents. Small 

proportions (12.1 to 23.3%) of the E. coli isolates from 

both sample sites were resistant to tetracycline. A very 

large proportion (90.0 to 100%) of the Salmonella isolates 

from both Dibate and Verdwall were resistant to 

ampicillin, erythromycin and vancomycin. Despite the fact 

that only a small proportion (14.3%) of the Salmonella 

isolates from Dibate were resistant to tetracycline, a 

relatively larger proportion (64.0%) of those isolated from 

Verdwall were resistant to this drug. Salmonella isolates 

from Verdwall showed little resistance (2.0 to 30.0%) to 

gentamycin, neomycin, kanamycin, streptomycin and 

norfloxacin. However, none of those isolated from Dibate 

were resistant to these antimicrobial agents (Table 4). 

MAR phenotypes of E. coli isolated 

The predominant antibiotic resistant phenotypes that 

were determined for E. coli isolated from ground water 

were obtained from Dibate and Verdwall, respectively are 

shown in Table 5. The MAR phenotype AP-E-VA was 

dominant among 40.0 and 20.0% of the E. coli isolates 

from Dibate and Verdwall, respectively. Furthermore, the 

phenotype AP-T-VA was also identified in 40.0% of the 

isolates from Dibate (Table 5). Although none of the E. 

coli isolated from Dibate was resistant to more than four 

antibiotics, an isolate from Verdwall was resistant to nine 

of the ten antibiotics tested. However, all of the E. coli 

isolated from both sites sampled was resistant to three or 

more antibiotics. 

MAR phenotypes of Salmonella species isolated 

The dominant MAR phenotypes amongst Salmonella 

isolated from ground water in the sampled sites were AP- 

E-VA and AP-E-T-VA in 85.7 and 22% for those isolated 

from Dibate and Verdwall, respectively. Phenotypes AP- 

E-VA and AP-E-T-VA-K-C were also identified in 20 and 

14%, respectively for the Salmonella isolates obtained 

from Verdwall (Table 5). Salmonella species from Dibate 

were not resistant to more than four of the ten antibiotics 

tested. An isolate from Verdwall was resistant to eight of


Table 5. The predominant multiple antibiotic resistant (MAR) phenotypes for E. coli and Salmonella arizonae isolated from 

the different sampling sites. 

Specie Sampling site Phenotype No observed % 

E. coli 


Dibate (N=10) 

Verdwall (N=20) 

AP-E-VA 4 40.0 

AP-T-VA 4 40.0 

AP-E-VA 4 20.0 

AP-GM-E-VA 2 10.0 

Dibate (N=14) AP-E-VA 12 85.7 

Verdwall AP-E-T-VA 11 22.0 

(N=50) 

AP-E-VA 10 

AP-E-T-VA-K-C 7 

AP-VA-Nor 3 

E-T-VA 3 

Ap (ampicillin), E (erythromycin), T (tetracycline),GM (gentamicin), VA (vancomycin), Ne (neomycin), C 

(chloramphenicol), K (kanamycin), S (streptomycin), Nor (norfloxacin). 

the antibiotics tested. All the Salmonella species isolated 

from Dibate and a large proportion of those from Verdwall 

were resistant to three or more antibiotics MAR. 

DISCUSSION 

The primary objective of this study was to isolate E. coli 

and Salmonella species from ground water that is used 

for drinking by residents of two rural communities in the 

North-West Province, of South Africa. An analysis of the 

bacterial load in water samples was also investigated. E. 

coli and Salmonella species were successfully isolated 

and their identities were confirmed. Results indicated that 

a greater proportion (7 out 9) of the water samples from 

each site was contaminated with bacteria of faecal origin. 

Moreover, the levels of total coliforms and heterotrophic 

bacteria were high (Table 2). Similar studies have been 

conducted to evaluate the quality of drinking water, by 

means of determining the bacterial load in water samples 

(Nevondo and Cloete, 1999; Potgieter, 2007). In these 

studies it was reported that the proportion of indicator 

microorganisms was far beyond the standards recommended 

for potable water in South Africa (Nevondo and 

Cloete, 1999; Potgieter, 2007). However, the results 

obtained in the latter studies were higher than those 

reported herein although both E. coli and Salmonella 

species were the predominant coliform bacterial species 

that were most frequently isolated (Nevondo and Cloete, 

1999). E. coli isolated in the present study was not identified 

at strain level. Some of these isolates may belong to 

the serotype E. coli O157:H7 that is highly pathogenic to 

humans. Thus their presence in drinking water may have 

severe health implications on consumers. 

Another objective of the study was to determine the 

extent to which E. coli and Salmonella species isolated 

from ground water in these two rural communities are 

resistant to antibiotics. A motivation to this is the fact that 

previous studies conducted in the area involving E. coli 

and E. coli O157 strains from humans, cattle and pigs 

revealed that a large proportion of the isolates (50 to 

100%) were resistant to some antibiotics (Ateba and 

Bezuidenhout, 2008; Moneoang and Bezuidenhout, 

2009). The emergence of multidrug resistant Salmonella 

species in the developing countries has been attributed to 

the misuse of antibiotics in animals (Threlfall, 2002). This 

indicates the need to regulate the usage of antimicrobial 

agents as this may have severe implication on both the 

veterinary and health care profession (Mulamattathil et 

al., 2000). Results obtained in the present study revealed 

that MAR, defined as resistance to three or more 

antibiotics was observed in 30 (47.6%) and 64 (100%) of 

E. coli and Salmonella species, respectively. Several 

studies have shown that E. coli and Salmonella species 

isolated from ground water are resistant to multiple 

antibiotics (Armstrong et al., 1981; Harakeh et al., 2006). 

However, in the present study a greater proportion of 

Salmonella species were resistant to most of the 

antibiotics tested. 

A larger proportion of E. coli and Salmonella species 

isolated were resistant to ampicillin, erythromycin and 

vancomycin. Resistance to ampicillin may have resulted 

from the fact that the drug is frequently used in both 

veterinary and human medicine in the area. However, 

resistance to erythromycin and vancomycin was a course 

for concern since these antibiotics are not used on 

animals and humans in the study area. Similar 

observations have been reported (Oguttu, 2007; Ateba


and Bezuidenhout, 2008). E. coli and Salmonella species 

from both sites showed little or no resistance to 

gentamycin, neomycin, kanamycin, streptomycin and 

norfloxacin. However, both E. coli and Salmonella 

species from Verdwall showed high levels of resistant to 

these drugs as compared to those from Dibate (Table 4). 

This indicates the difficulty that may arise in treating 

water-borne infections in humans that are resident in 

Verdwall if caused by these multiple antibiotic resistant 

strains. A small proportion (3.3 to 27.3%) of the E. coli 

and Salmonella isolates showed resistance to 

chloramphenicol (Table 4). Chloramphenicol had been 

banned for inclusion as additives in feeds for animals 

(Bischoff et al., 2002). Moreover, it is not used in 

veterinary medicine in the area. The predominant MAR 

phenotypes for Salmonella and E. coli isolated was AP-E- 

VA, AP-E-VA and AP-GM-E-VA. Resistance phenotypes 

arise from different genetic determinants that present 

specific epidemiological features (Lanz et al., 2003). 

Consequently, an assessment of the resistance situation 

at genetic level would be of great importance in 

controlling antimicrobial resistance. Although a large 

proportion of these isolates were resistant to most of the 

antibiotics that were tested, high levels of resistance were 

observed against ampicillin. Although nothing is known 

about the distribution and contribution of antibiotic 

resistance genes in Salmonella species in the area, little 

has been documented for E. coli (Ateba and 

Bezuidenhout, 2008). This is therefore an aspect that 

needs further investigation. 


Authors are grateful to the North-West University, 

Mafikeng Campus for providing the funds and work space 

needed to conduct the research. And the assistance 

received from the laboratory technician Mrs. Rika Hyser 

is highly acknowledged. 

REFERENCES 

Ahmed W, Neller R, Katouli M (2005). Host spices-specific metabolic 

fingerprint database for Enterococci and Escherichia coli and its 

application to identify source of faecal contamination in surface water. 

Appl. Environ. Microbiol. 71(8): 4461-4468. 

American Public Health Association (APHA) (1998). Standard Methods 

for the examination of water and wastewater, 19 th edition. American 

Public Health Association, Washington DC. 

Armstrong JL, Shigeno DS, Calomiris JJ, Seidler RJ (1981). Antibiotic 

resistant bacteria in drinking water. Appl. Environ. Microbiol. 42(2): 

277-283. 

Ateba CN, Bezuidenhout CC (2008). Characterization of Escherichia 

coli O157 strains from humans, cattle and pigs in the North-West 

Province, South Africa. Int. J. Food Microbiol., 128: 181-188. 

Ateba CN, Mbewe M, Bezuidenhout CC (2008). The Prevalence of 

Escherichia coli O157 strains in cattle, pigs and humans in the North- 

West Province, South Africa. SAJS, 104: 7-8. 

Ateba CN, Mbewe M, Moneoang MS, Bezuidenhout CC (2010). 

Antibiotic resistant Staphylococcus aureus from milk in the Mafikeng 

Area, North West Province, South Africa. SAJS 106: (11/12) 1-6. 

Bessong PO, Odiyo JO, Musekene JN, Tessema A (2009). Spatial 

Distribution of Diarrhoea and Microbial Quality of Domestic Water 

during an Outbreak of Diarrhoea in the Tshikuwi Community in 

Vhenda, South Africa. J. Health Pop. Nutri., 27 (5): 652-659. 

Bischoff KM, White DG, McDermott PF, Zhao S, Gaines S, Maurer JJ, 

Nisbet DJ (2002). Characterization of chlororampenicol resistance in 

beta-haemolytic Escherichia coli associated with diarrhoea in 

neonatal swine. Clin. Microbiol., 40(2): 389-394. 

Council for Scientific and Industrial Research (CSIR) (2008). Water 

Quality and Pollution: Parliamentary Portfolio Committee on Water 

Affairs and Forestry. Pp. 1-173 

Cruikshank R, Duguid JP, Marmoin BP, Swain RH (1975). Medical 

Microbiology, 12 th ed. Longman, New York. (2): 3-4. 

Forbes S, Weissfeld (1998). Bailey and Scott’s diagnostic microbiology, 

10 th ed. Mosby, Inc., St. Louis, Mosby. 

Harakeh S, Yassine H, El-Faidel M (2006). Antibiotic resistant patterns 

of Escherichia coli and Salmonella strains in the aquatic Lebanese 

environments. Environ. Pollut., 143: 269-277. 

Kasrils R (2004). A decade of delivery. Minister of Water Affairs and 

Forestry. 

Kirby WMM, Bauer AW, Sherris JC, Turck M (1966). Antibiotic 

susceptibility testing by single disc method. Am. J. Clin. Pathol., 45: 

4. 

Lanz R, Kuhnert P, Boerlin P (2003). Antimicrobial resistance and 

resistance gene determinants in clinical Escherichia coli from 

different animal species in Switzerland. Vet. Microbiol., 91: 73-84. 

Momba MNB, Abongo BO, Mwambakana JN (2008). Prevalence of 

enterohaemorrhagic Escherichia coli O157:H7 in drinking water and 

its predicted impact on diarrhoeic HIV/AIDS patients in the Amathole 

District, Eastern Cape Province, South Africa. Water SA., 34(3): 365- 

372. 

Momba MNB, Makala N, Zani B, Brouckaert BM (2005). Key causes of 

drinking water quality failure in a rural small water supply of South 

Africa. In: JH Lehr and J Keeley (eds.) Water Encyclopedia- 

Domestic, Municipal, and Industrial Water Supply and Waste 

Disposal. John Wiley and Sons, Inc. New Jersey, pp. 221-227. 

Momba MNB, Ndaliso S, Binda MA (2003). Effect of a combined 

chlorine-monochloramine process on the inhibition of biofilm regrowth 

in potable water systems. Water Supp., 3(1-2): 215-221. 

Momba MNB, Tyafa Z, Makala N, Brouekaert BM, Obi CL (2006). Safe 

drinking water is still a dream in the rural areas of South Africa. Case 

study: The Eastern Cape Province. Water SA., 32(5): 715-720. 

Moneoang MS, Bezuidenhout CC (2009). Characterization of 

enterococci and E. coli isolated from commercial and communal pigs 

from Mafikeng in the North-West Province, South Africa. AJMR, 3(3): 

088-096. 

Mulamattathil SG, Esterhysen HA, Pretorius PJ (2000). Antibioticresistant 

gram-negative bacteria in a virtually closed water 

reticulation system. Appl. Microbiol., 88: 30-937. 

National Committee for Clinical Laboratory Standards. (NCCLS) (1999). 

Performance standards for antimicrobial disc and dilution 

susceptibility test for bacteria isolated from animals. National 

Committee for Clinical Laboratory Standards, Wayne, Pennsylvania, 

Approved Standards M, 31-A19 (11). 

Nevondo TS, Cloete TE (1999). Bacterial and chemical quality of water 

supply in the Dertig village settlement. Water SA. 25 (2): 215-220. 

Obi CL, Onabulu B, Igumbor EO, Ramalivhana J, Bessong PO, Van 

Rensburg EJ, Lukoto M, Green E, Ndou S, Mulaudzi TB (2006). The 

interesting cross-paths of HIV/AIDS and water in Southern Africa with 

special reference to South Africa. Water SA., 32 (3): 322-344. 

Oguttu JW (2007). Antimicrobial drug resistance of enteric bacteria from 

broilers fed antimicrobial growth enhances and exposed poultry 

abattoir workers. MSc thesis, University of Pretoria. 

Potgieter N (2007). Water storage in rural households: Intervention 

strategies to prevent water borne diseases. PhD thesis, University of 

Pretoria. 

Rota C, Yanguela J, Blanco D, Carrminana JJ, Arino A, Herrera A 

(1996). High prevalence of multiple resistance to antibiotics in 144 

Listeria isolates from Spanish dairy and meat products. Food 

Protect., 59: 938-943. 

Sorum H, L’Abee-Lund TM (2002). Antibiotic resistance in food-related 

bacteria result of interfering with the global web of bacterial genetics.

Int. J. Food Microbiol., 78: 43-56. 

Threlfall J (2002). Antimicrobial drug resistance in Salmonella: 

Problems and perspective in food and water-borne infections. FEMS 

Microbiol. Rev., 26: 141-148. 

United States Pharmacopeial Convention, Inc. (2001). The United 

States Pharmacopeia 25. Rockville, M.D. 

Water Research Commission (WRC) (1993). Guidelines on the cost 

effectiveness of rural water supply and sanitation projects. Water 

Research Commission Report No. 231/1/93, Pretoria. 


World Health Organisation (2003). Emerging Issues in Water and 

Infectious Disease, World Health Organisation, Geneva, Switzerland. 

Young P (1996). Safe drinking water: A call for global action. ASM 

News, 62: 349-352.




DOI: 10.5897/AJMR11.942 


Determination of hepatitis C virus genotypes among 

HCV positive patients in Shahrekord, Iran 

Elahe Tajbakhsh 1*, Abbas Dosti 2 , Sara Tajbakhsh 3 , Manochehr Momeni 4 and 

Forough Tajbakhsh 5 

1 Department of Microbiology, Faculty of Basic Sciences, Islamic Azad University Shahrekord branch, Shahrekord Iran. 

2 Department of Microbiology, Faculty of Basic Sciences, Islamic Azad University Shahrekord branch, Shahrekord Iran. 

3 University of Medical Sciences, Shahre-kord, Iran. 

4 Biotechnology Research Center, Islamic Azad University Shahrekord branch, Shahrekord Iran. 

5 Young Researchers Club, Islamic Azad University, Shahrekord Branch, Shahrekord-Iran. 


Hepatitis C is one of the most common causes of the liver failure and cancer and represents a major 

public health problem. Recent studies have focused on whether different hepatitis C virus (HCV) 

genotypes, are associated with different profiles of pathogenicity, infectivity and response to antiviral 

therapy. Genotyping system based on polymerase chain reaction (PCR) of the core region with 

genotype-specific PCR primers for the determination of HCV genotypes 1a, 1b, 2a, 2b, 3a, 3b, 4, 5a, and 

6a was developed. Different genotypes have been reported in different parts of the world. Genotype 1 is 

difficult to treat, while genotypes 2 and 3 are easy to treat. Therefore, identification of HCV genotype in 

patients is necessary to begin and follow up the treatment. In this study, viral genomic of 94 patients 

extracted from sera were detected by nested-real time (RT) PCR. PCR products were digested with 

proper enzymes and studied by restriction fragment length polymorphism (RFLP). The results of PCR- 

RFLP were as follows: 1a (54.26%), 1b (11.71%), 3a (27.66%), 2a (2.12%) and 4 (4.25%). This indicates 

that a high percentage of HCV infected patients. 

Key words: Genotyping, Hepatitis C Virus, PCR, RFLP, Iran. 

INTRODUCTION 

Hepatitis C virus (HCV) is a single stranded ribonucleic 

acid (RNA) virus; approximately 9.5 kb which belongs to 

the Flaviviridae family, HCV demonstrates a high degree 

of sequence variation throughout its genome (Choo et al., 

1989). HCV is a causative agent for chronic, acute and 

fulminant hepatitis (Alavian et al., 2002). The association 

of HCV among patients with cirrhosis of liver and 

*Corresponding author. E-mail: ee_tajbakhsh@yahoo.com or 

ee_tajbakhsh@iaushk.ac.ir. Tel/Fax: 0098 3813361060. 

Abbreviations; HCV, Hepatitis C virus; RT PCR, reverse 

transcriptation polymerase chain reaction; 5'-UTR, 5' 

untranslated region; DNA, deoxyribonucleic acid; RIBA, 

recombinant immunoblot assay. 

hepatocellular carcinoma has been reported (Alavian et 

al., 2006). HCV infection is a global health problem and it 

is estimated that 200 million people of the world 

population are infected with HCV (Lee et al., 2008). 

Serological tests detecting antibody to HCV have shown 

that HCV is the major etiological agent for both 

transfusion acquired and sporadic non-A, non-B hepatitis 

(Alter et al., 1989; Kuo et al., 1989; Mosley et al., 1990). 

Chronic hepatitis occurs in more than 50% of HCV 

infected patients and can lead to cirrhosis and liver 

cancer. HCV causes 20% of acute hepatitis cases, 70% 

of all chronic hepatitis cases, 40% of all cases of cirrhosis 

of the liver, 60% of hepatocellular carcinomas, and 30% 

of liver transplants in Europe. 

The study of genetic variability of HCV strains has led 

the consensus classification into six major genotypes. 

Some studies suggest that the clinical features of liver

disease depend on HCV genotypes (Farshad et al., 

2010). Classification of HCV is based on the diversity of 

the genome, and the criterion for HCV classification was 

proposed by Simmonds and colleagues (Simmonds et 

al., 1993). 

The HCV genotypes have been determined primarily 

based on analysis of partial genome sequences. The 

most extensive database exists for the 5'-UTR, core, E1, 

and NS5B (Bukh et al., 1992a; Furione et al., 1999). 

Whereas the 5'-UTR is highly conserved and therefore 

preferred for diagnosis, the core, envelope, and NS5B 

regions are less conserved and therefore highly 

discriminative and may be preferred for subtyping 

(Prescott et al., 1997). 

Sequence analysis of multiple strains of HCV has 

demonstrated that the nucleotide sequence can differ by 

as much as 30%. However, the levels of heterogeneity 

differ considerably among various regions of the virus. 

For example, sequence variation ranges from as little as 

10% in the 5' untranslated region (5'-UTR) to as much as 

50% or more within the E1 region. HCV isolates from 

around the world can be divided into distinct major 

groups or genotypes with about 66 to 69% nucleotide 

similarity, which can in turn be divided further into 

subtypes with about 77 to 80% nucleotide similarity 

(Chan et al., 1992; Bukh et al., 1993). 

Since the first report of the HCV genome by the Chiron 

research group numerous complete or partial nucleotide 

sequences of HCV isolates have been reported 

worldwide. Comparison of these sequences revealed 

marked genetic heterogeneity of the HCV genome 

(Okamato et al., 1990; 1992; Choo et al., 1991; 

Inchauspe et al., 1991). 

Investigators of HCV genotyping have used sequence 

analysis of HCV NS5, core, E1, and 5'-UTRs. HCV 

genotyping by Okamoto et al. using type-specific primers 

was first introduced by using primers specific for the core 

region. (Okamoto et al., 1996) This method lacked 

acceptable sensitivity and specificity (McOmish et al., 

1993). Several deoxyribonucleic acid (DNA) hybridization 

assays for HCV genotyping have been described. 

A commercial kit for HCV genotyping has been 

introduced in Europe by Innogenetics (InnoLipa, Belgium) 

and is based on hybridization of 5'- UTR amplification 

products with genotype specific probes. Others have 

used restriction enzymes to determine viral genotype by 

restriction fragment length polymorphism (RFLP). 

In this method, a PCR-amplified DNA fragment is 

digested into fragments with different lengths by enzymes 

(restriction endonucleases) that recognize cleavage sites 

specific for each genotype (Stuyver et al., 1993). 

Although all these methods are able to identify the major 

genotypic groups, only direct nucleotide sequencing is 

efficient in discriminating subtypes (Bukh et al., 1995). 

In the current study, we have typed HCV strains with 

RFLP rapidly and reliably by digesting the amplified DNA 

from the primary specimens by selected restriction 

enzymes and some by sequencing. 


Serological data 

Tajbakhsh et al. 5911 

The sera were collected from 94 HCV infected patients, referred to 

Al Mahdi Laboratory (Shahrekord, Iran) during 2009-2010. All 

patients had elevated serum aminotransferases for at least 6 

months, a positive test for anti-HCV antibodies (third generation 

ELISA [ORTHO HCV 3.0 ELISA Test system; Ortho Diagnostics, 

Raritan, New Jersey, USA], the confirmatory recombinant 

immunoblot assay (RIBA) test (Inno-LIA TM HCV Score) and HCV 

RNA in serum by reverse transcription nested PCR for the 5'-UTR 

of the HCV genome (Simmonds et al., 1993). The average age was 

varying from 18 to 64 year. while the mean age was 41. 

HCV RNA extraction and cDNA synthesis 

For detection of HCV RNA in serum and for genotyping studies, 

RNA was extracted from 50 μl of serum by using STRP TM HCV 

detection kit (Cinna Gen Inc Company). For extraction of HCV RNA, 

add 50 μl serum to 450 μl cold RNX TM plus solution and vortex 

sample to dissolve clamps, then add 100 μl of chloroform and 

centrifuged at 12000 g and transfer the aqueous phase to a new 

tube then add equal volume of isopropanol, and stored at -20°C for 

at least 20 min, and centrifuged at 12000 g. Then discard aqueous 

phase and to the pellet 200 μl 70% ethanol and centrifuged at 

12000 g, and discard aqueous phase and dry the pellet (RNA). At 

least dissolve RNA in 30 μl DEPC treated water and stored in - 

70°C . According to the kit protocol, cDNA was synthesis and by use 

specific primers RT-PCR was done. 

PCR genotyping primers 

For specific and nested PCR, four oligonucleotide primers form 5'- 

UTR of HCV were designed using generunr (Hastings software) 

and synthesized at the Cinna Gene Company (Iran). In the first 

round of PCR, the primers corresponded to HCV-1 sense oriented 

nucleotides -268 to -251 F1 (AGCGTCTAGCCATGGCGT), 

numbered according to Bukh et al., (1992b) and antisense 

nucleotides -4 to -22 R1 (GCACGGTCTACGAGACCT). For the 

second round, the primer F2 (GTGGTCTGCGGAACCGG) 

corresponded to sense-oriented nucleotides -199 to -183 and R2 

(GGGCACTCGCAAGCACCC) corresponded to antisense 

nucleotides -26 to -43. 

PCR 

The first round was carried out for 30 cycles which consisted of 

initial denaturation at 94°C for 5 min, denaturation at 94°C for 35 s, 

annealing at 58°C for 40 s, extension at 72°C for 45 s and, the final 

extension at 72°C for 5 min. The second round was followed for 25 

cycles which consisted of initial denaturation at 94°C for 5 min, 

denaturation at 94°C for 35 s, annealing at 64°C for 40 s, extension 

at 72°C for 45 s, and the final extension at 72°C for 5 min. The 174bp 

second PCR product was submitted to electrophoresis by using 

a 1.5% agarose gel in 0.5X TBE buffer, and was visualized by 

ethidium bromide staining under ultraviolet light (Han et al., 1991). 

Genotyping by RFLP 

Total volumes of each nested-PCR product (25 μl) were divided into


Figure 1. Ethidium bromide stained gel of PCR products amplified 

with HCV primers. DNA 100 bp markers (lane M), samples positive 

(lanes 1, 2 and 3). 

Table 1. Demonstrates cutting sites of Hinf I, Apa I, EcoR II and Bsh1236 I restriction 

enzymes for different strains of HCV as published by Bukh et al. (1992). 

Genotype 

three tubes containing appropriate buffers. Restriction enzymes, 

Apa I, Hinf I, EcoR II and Bsh1236 (Fermentas, Co.) used as the 

following combinations: 1.Apa I / Hinf I; 2. EcoR II/Hinf I; 3. 

Bsh1236 I. The other enzymes were similar to McOmish et al 

(1994) method. 

The tubes were incubated with 1 U of the enzyme mixture for 3 h 

at 37°C. The digestion temperature was 37°C. If the samples could 

not be analyzed immediately after digestion, they were stored at - 

20°C before the analysis vertical 12% polyacrylamide gel 

electrophoresis and the digested products were heated for 5 min. 

After ethidium bromide staining, the DNA fragments were identified 

under ultraviolet light. Molecular weight 100 bp plus marker 

(Fermentas, Co.) and undigested PCR products was included in 

each analysis. The genotypes were deduced from the 

Segment (bp) 

Tube A Tube B Tube C 

1a 97 97 129 

1b 97 97 99 

2a 97 174 174 

2b 174 174 174 

3a 129 145 99 

3b 97 145 99 

4 97 145 129 

5 97 174 99 

6 97 97 174 

fragmentation patterns of the amplified DNA. 

RESULTS 

The 5'- UTR of 94 HCV positive serum samples were 

amplified and digested by appropriate restriction 

enzymes for genotype determination. The RFLP results 

revealed: 1a (54.26%), 1b (11.71%), 3a (27.66%), 2a 

(2.12%), 4 (4.25%). Figure 1 shows the 174 bp nested 

RT-PCR amplification of HCV RNA extracted from blood 

samples. Table 1 show fragments yielded upon restriction

A A B 

B 

C C D 

D 

E 

E 

Figure 2. 12% polyacrylamide gel electrophoresis of the digestion products 

of the amplified DNA from different genotypes. Marker; DNA 100 bp (lane 

M), A : Genotype 1a (129. 97 and 97 bp). B: Genotype 1b (99, 97 and 97 

bp), C: Genotype 2a (97, 174 and 174 bp), D: Genotype 3a (129, 145 and 

99 bp) E: Genotype 4 (97, 145 and 129 bp). 

enzyme digestion of 5'-UTR region. The cutting sites of 

restriction enzymes are shown (Tube A) Apa I/Hinf I; 

(Tube B) EcoR II /Hinf I; (Tube C) Bsh1236 I. 

Figure 2 demonstrates the analytical polyacrylamide 

gel electrophoresis of HCV types 1a, 1b, 2a, 3a and 4 

after digestion of the amplified DNA with the selected 

restriction enzymes. 

Genotyping of 94 sera from patients who were either 

recently infected by HCV or with history of previous HCV 

infection and positive PCR results were performed. The 

results of PCR-RFLP were as follows: 1a (54.26%), 1b 

(11.71%), 3a (27.66%), 2a (2.12%) and 4 (4.25%). This 


indicates that a high percentage of HCV infected patients 

in Iran are infected with 1a or 3a genotypes (Table 2). 

Out of 94 patients, 63 patients were male and 32 were 

female. Analysis of population previously infected with 

HCV showed that 26 patients (27 %) were less than 30 

years of age, 43 patients (45.74%) between 30-50 and 25 

patients (26.5%) were above 50 yr of age. The most 

frequent genotype in patients above 50 was 3a, while 1a 

genotype was more prevalent in patients under 50 years 

old. Hemodialysis patients and cases by known history of 

transfusion were known to be infected by only subtypes 

1a and 3a. Also the patients fewer than 30 year old were


Table 2. Hepatitis C virus genotypes in 94 Iranian patients with 

RFLP method. 

Genotype Number % 

1a 51 54/26 

1b 11 11/71 

2a 2 2/12 

3a 26 27/66 

4 4 4/25 

Total 94 100 

infected by only subtypes 1a and 3a. 

DISCUSSION 

The study of viral diversity provides a better understanding 

of the origin and dynamics of viral infections. 

Genetics variants of HCV are known to be widely spread 

around the world. Genotypes 1, 2 and 3 are found on all 

countries, but in some geographical areas, such as Africa 

and Southeast Asia, viral isolates are highly divergent 

and particular genotypes or subtypes are predominant 

(Moller et al., 1995). These data suggest the existence of 

a long term endemic infection in these areas and some 

researchers have hypothesized that HCV have originated 

in such places (Simmonds et al., 1993). 

Epidemiological studies in different regions of the world 

show the virus is distributed worldwide with prevalence 

varying between different countries from 0.2 up to 40%. It 

is clearly revealed that the incidence of HCV is higher 

among less developed nations. In Iran, HCV prevalence 

in general population is less than 1%. 

In our study HCV genotypes were found, 1a (54.26%), 

1b (11.73%), 3a (27.66%), 2a (2.12%), 4 (4.25%). HCV is 

highly variable, leading to the classification of at least six 

genotypes, each with several subtypes. This 

heterogeneity is, at least partly, responsible for lack of 

availability of an effective vaccine (Samimi-Rad et al., 

2004). Investigators of HCV genotyping have used 

sequence analysis of HCV NS5, Core, E1 and 5'-UTRs. 

However, direct sequencing is not practical on a large 

scale. RFLP has been used widely for this aim, especially 

for screening of large number of specimens. 

The use of 5'-UTR assay designed for the detection of 

HCV in clinical specimens provides a sensitive, 

standardized amplification protocol specifically designed 

for large-volume testing and rapid turnaround time and is 

also used widely for HCV genotyping by different 

investigators. In this report, we have focused on 

chronically infected group of patients, to determine the 

most prevalent genotypes in Iran (Ahmadi et al., 2006). 

RFLP of HCV PCR positive sera and sequencing of 

174 bp fragment of 5'-UTR region was used to achieve 

this purpose. In our study, HCV genotype 1a was the 

most frequent (%54/26), followed by genotype 3a 

(%27/66) and genotype 1b (%11/71). This is compatible 

with the findings of Zali et al. (2000), Samimi-Rad et al. 

(2004) and Ahmadi et al. (2006) in Iranian patient. 

Ahmad et al. (2006) reported 1a (%52.88), 3a (%27.57) 

and 1b (14%) genotypes HCV among Iranian patients by 

RFLP method. Samimi-Rad et al. (2004) found 1a (47%), 

3a (36%) and 1b (8%) genotypes HCV among Iranian 

patients, and revealed that genotype 1a is frequent in the 

South of Iran (70%), while 3a is more prevalent in the 

North-West of Iran (83%). 

In the present study, our data showed the same result 

as those demonstrated by Zali et al. (2000), Samimi-Rad 

et al. (2004) and Ahmadi et al. (2006). Although the 

frequency of genotype 1a was slightly higher in theses 

study. Patients infected by blood products more 

frequently had genotype 1a (57%), while younger drug 

users had genotype 3a (54%) more frequently (Farshad 

et al., 2010). 

Keyvani et al. (2007), reported HCV genotypes in Iran. 

In their study, genotype 1a with 39.7% had the highest 

frequency. Genotype 3a (27.5%) and 1b (12.1%) were 

the other frequent genotypes (Farshad et al., 2010). The 

prevalence of HCV among blood donors is less than 1% 

in Northern European countries (Choo et al., 1989). 

Higher rates have been reported in South East Asian 

countries, including India (1.5%), Malaysia (2.3%), and 

the Philippines (2.3%) (Farshad et al., 2010). 

The incidence in Japan is 1.2% (Kato et al., 1990). 

Alarming rates of 14.5% are reported in Egypt (Farshad 

et al., 2010). HCV genotype 4 is common in countries 

such as Yemen, Kuwait, Iraq, and Saudi Arabia (Samimi- 

Rad et al., 2004). 

However, in Turkey genotype 1b, in Pakistan 

genotypes 3a and 3b, in Uzbekistan 1a, 1b, 2a, 2k and 

3a, in Lebanon 1g are reported to be the dominant 

genotypes (Pavio and Lai, 2003). 

Genotype 4 is the main genotype circulating in most 

Arabic countries. In Bahrein 4a and in Saudi Arabia HCV 

genotype 4 were detected in 50% of patients and 

genotype 1b was found in nearly 40% of patients (Elahi et 

al., 2003). 

Genotype information is important when HCV treatment 

is being considered, since some genotypes respond 

more favorably to the medications. Genotype also determines 

the length of therapy, for example, treatment for 

genotypes 2 and 3 requires only 24 weeks while 

genotypes 1 and 4 require 48 weeks (44). 

In addition to treatment purposes, detection of HCV 

genotypes in different regions can be used for the 

purpose of molecular epidemiology (Pavio and Lai, 

2003). 

REFERENCES 

Alavian SM, Gholami B, Masarrat S (2002). Hepatitis C risk factor in 

Iranian volunteer blood donors: A case-control study. J. Gastroentroll. 

Hepatol., 17(10): 1092-1097.

Alavian SM, Gholami B, Massarat S (2006). Hepatitis C, Chronic Renal 

Failure, Control Is Possible! Hepatitis Monthly, 6 (2): 51-52. 

Alter HJ, Purcell RH, Shih JW, Melpolder JC, Houghton M, Choo QL, 

Kuo G (1989). Detection of antibody to hepatitis C virus in 

prospectively followed transfusion recipients with acute and chronic 

non-A, non-B hepatitis. Engl. J. Med., 30 (321): 1494-1500. 

Ahmadi pour MH, Keivani H, Sabahi F, Alavian SM (2006). 

Determination of HCV genotypes, in Iran by PCR-RFLP. Iranian J. 

Public Health, 35: 54-61. 

Bukh J, Puecell RH, Miller RH (1992a). Sequence analysis of The 5' 

non coding region of hepatitis C virus. Proc Natl. Acad. Sci. USA., 

89(11): 4942-4946. 

Bukh J, Purcell RH, Miller RH (1993). At least 12 genotypes of hepatitis 

C virus predicted by sequence analysis of the putative E1 gene of 

isolates collected worldwide. Proc. Natl. Acad. Sci., USA, 90(17): 

8234-8238. 

Bukh J, Purcell RH, Miller RH (1992b). Importance of primer selection 

for the detection of hepatitis C virus RNA with the polymerase chain 

reaction assay. Proc. Natl. Acad. Sci., USA, 1 89): 187-191. 

Bukh J, Miller RH, Purcell RH (1995). Genetic heterogeneity of hepatitis 

C virus: quasispecies and genotypes. Semin. Liver Dis., 15(1): 41-63. 

Chan SW, McOmish, Hlmes EC, Dow B, Peutherer JF, Follet E Yap PL, 

Simmonds P (1992). Analysis of a new hepatitis C virus type and its 

phylogenetic relationship to existing variant. J. Gen. Virol., 73: 1131- 

1141. 

Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M 

(1989). Isolation of a cDNA clone derived from a blood-borne non-A, 

non-B viral hepatitis genome. Science, 244: 359-62. 

Choo QL, Richman KH, Han JH, Berger K, Lee C, Dong C, Gallegos C, 

Coit D, Medina-Selby R , Barr PJ (1991). Genetic organization and 

diversity of the hepatitis C virus. Proc. Natl. Acad. Sci., USA, 88: 

2451–2455. 

Elahi E, Pourmand N, Chaung R, Rofoogaran A, Boisver J, Samimi Rad 

K, Davis RW, Ronaghi M (2003). Determination of hepatitis C virus 

genotype by pyrosequencing. J. Virol. Methods, 109(2): 171- 176. 

Farshad pour F, Makvandi M, Samarbafzadeh AR, Jalalifar MA (2010). 

Datermination of hepatitis C virus genotypes among blood donors in 

Ahvaz, Iran. Iranian J. Med. Microbiol., 28(1): 54-56 

Furione M, Simoncini L, Gatti M, Baldanti F, Revello MG, Gerna G 

(1999). HCV genotyping by three methods: analysis by discordant 

results based on sequencing. J. Clin. Virol., 13(3): 121-130. 

Han JH, Shyamala V, Richman KH, Brauer MJ, Irvine B, Urdea MS, 

Tekamp-Olson P, Kuo G, Choo QL, Houghton M. (1991). 

Charachterization of the terminal regions hepatitis C viral RNA: 

Identification of conserved sequence in the 5 untranslated region and 

poly A tails at the 3 end. Proc. Natl. Acad. Sci., 88 (5): 1711-1715. 

Inchauspe G, Zebedee SI, Lee DHH, Sugitani M, Nasoff M, A. M. Prince 

AM (1991). Genomic structure of the human prototype strain H of 

hepatitis C virus: comparison with American and Japanese isolates. 

Proc. Natl. Acad. Sci., USA, 88(22): 10292–10296. 

Kato N, Hijikata M, Ootsuyama Y, Nakagawa M, Ohkoshi S, Sugiura T, 

Shimotohono K (1990). Molecular cloning of the human hepatitis C 

virus genome from Japanese patients with non-A, non-B hepatitis. 

Acad. Sci., USA, 87(24): 9524–9528. 

Keyvani H, Alizadeh AH, Alavian SM, Ranjbar M, Hatami S (2007). 

Distribution frequency of hepatitis C virus genotypes in 2231 patients 

in Iran. Hepatol. Res., 37 (2): 101-103. 

Kuo G, Cho QL, Alter HJ, Gitnick GL, Redeker AG, Purcell RH, 

Miamura T, Finestag JL, Alter M J, Stevence C E, Tegtmeier GE, 

Bonono F, Colombo M, Lee W S, Kuo C, Berger K, Shuster JR, 

Overby LR, Bradley DW, Houghton M (1989). An assay for circulating 

antibodies to a major etiologic virus of human non-A, non-B hepatitis. 

Science, 244(4902): 362-364. 


Lee CM, Hung CH, Lu SN, Changchien CS (2008). Hepatitis C virus 

genotypes: Clinical relevance and therapeutic implications. Chang 

Gung Med. J., 31(1): 16-25. 

McOmish F, Yap PL, Dow BC, Follett EAC, Seed C, Keller AJ, Cobain 

TJ, Krusius T, Kolho E, Naukkarinen R, Lin C, Lai C, Leong S, 

Medgyest GA, Hejjas M, Kiyokawa H, Fukada K, Cuypers T, Saeed 

AA, AL-Rasheed AM, Lin M, Simmonds P (1994). Geographical 

distribution of hepatitis C virus genotypes in blood donors: an 

international collaborative survey. J. Clin. Microbiol., 32 (4): 884-892. 

McOmish F, Chan SW, Dow BC, Gillon J, Frame WD, Crawford RJ, Yap 

PL, Follett EA, Simmonds P (1993). Detection of three types of 

hepatitis C virus in blood donors: investigation of typespecific 

differences in serologic reactivity and rate of alanine amino 

transferase abnormalities. Transfusion, 33 (1): 7–13. 

Moller J, Holmes EC, Jarvis LM, Yap PL, Simmonds P (1995). 

Investigation of the pattern of hepatitis C virus sequence diversity in 

different geographical regions: implications for virus classification. 

The international HCV collaborative study group. J. Gen. Virol., 76 

(10): 2493-2507. 

Mosley JW, Aach RD, Hollinger FB, Stevens CE, Barbosa LH, Nemo 

GJ, Holland PV, Bancroft WH, Zimmerman HJ, Kuo G, Choo QL, 

Houghton M (1990). Non-A Non-B hepatitis and antibody to hepatitis 

C virus. JAMA, 263(1): 77-78. 

Okamoto H, Kurai K, Okada S, Yamamoto K, Iizuka H, Tanaka T, 

Fukuda S, Tsuda F, Mishiro S (1992). Full-length sequence of a 

hepatitis C virus genome having poor homology to reported isolates: 

comparative study of four distinct genotypes. Virology, 188: 331–341. 

Okamato H, Okada S, Sugiyama Y, Yotsumoto S, Tanaka T, Yoshizawa 

H, Tsuda F, Miyakawa Y, Mayumi M (1990). The 59-terminal 

sequence of the hepatitis C virus genome. Jpn J. Exp. Med., 60: 

167–177. 

Okamato H, Kobata S, Tokita H, Inoue T, Woodfield GD, Holland PV, 

Al-Knawy BA, Uzunalimoglu O, Miyakawa Y, Mayumi M. (1996). A 

second-generation method of genotyping hepatitis C virus by 

polymerase chain reaction with sense and antisense primers 

deduced from the core gene. J Virol Methods, 57(1) 31-45. 

Pavio N, Lai M (2003). The hepatitis C virus persistence: how to evade 

the immune system. J. Biosci., 28: 287-304. 

Prescott LE, Berger A, Pawlotsky JM, Conjeevaram P, Simmonds P 

(1997). Sequence analysis of hepatitis C virus variants producing 

discrepant results with two different genotyping assays. J. Med. 

Virol., 53 (3): 237-244. 

Samimi-Rad K, Nategh R, Malekzadeh R, Norder H, Magnius L (2004). 

Molecular pidemiology of hepatitis C virus in Iran as reflected by 

phylogenetic analysis of the NS5B region. J. Med. Virol., 74 (2): 246- 

252. 

Simmonds P, Holmes EC, Cha TA, Chan SW, McOmish F, Irvine B, 

Beall E, Yap PL, Kolberg J, Urdea MS (1993). Classification of 

hepatitis C virus into six major genotypes and a series of subtypes by 

phylogenetic analysis of the NS-5 region. J. Gen. Virol., 74 (11): 

2391-2399. 

Stuyver L, Rossau R, Wyseur A, Duhamel M, Vanderborght B, Van 

Heuverswyn H, Maertens G (1993). Typing of hepatitis C virus 

isolates and characterization of new subtypes using a line probe 

assay. J. Gen. Virol., 74: 1093-1102. 

Zali MR, Mayumi M, Raoufi M, Nowroozi A (2000). Hepatitis C virus 

genotypes in the Islamic Republic of Iran: a preliminary study. East 

Mediterr. Health J., 6 (2-3): 372-377.




DOI: 10.5897/AJMR11.961 


Analysis of agricultural input-output based on 

Cobb–Douglas production function in Hebei Province, 

North China 

Zaijian Yuan 

School of Economics and Management, Hebei University of Science and Technology, Shijiazhuang, Hebei 050018, 

PR China. E-mail: selfsurpass@163.com. 


This study is to analyze the temporal and spatial variation of the agricultural input-output and the 

relation between agricultural output and input factors in Hebei Province by Cobb-Douglas production 

function in which cultivated area, effective irrigation area, chemical fertilizer usage, agricultural 

machinery power, rural electricity consumption and manpower are taken as independent variables. It 

proves that the agricultural output, effective irrigation area, chemical fertilizer usage, agricultural 

machinery power and rural electricity consumption have an upward trend from 1999 to 2008, but the 

cultivated area and agricultural manpower have a downward trend. In terms of spatial distribution, the 

agricultural input and output in the southeastern part of the province are higher than those in northwest. 

In the 6 input factors, the effective irrigation area has the biggest influence on agricultural output, 

chemical fertilizer and agricultural machinery power of the second, and other factors have relatively 

small influence. Therefore, Hebei should pay attention to effective use of water resources and accelerate 

investment in technology and mechanization to promote agriculture sustainable development. 

Key words: Agricultural input-output, temporal and spatial variation, Cobb-Douglas production function. 

INTRODUCTION 

Agriculture is the human activity in which solar energy is 

utilized for the production of sugars that are used in the 

plant to construct carbohydrates, proteins, lipids and other 

compounds (Van and Rabbinge, 1997). Agricultural 

activity results in outputs, such as grain, potatoes, nutrient 

emissions and so on. Thus, agricultural production 

systems can be characterized by their inputs and outputs, 

that is, input-output combinations. Agriculture is a 

significant component of China’s economy constitution, 

accounting for 11.3% it of gross domestic product (GDP) 

and 23.1% of it employment rate (2008). China now 

accounts for over 18% of global agricultural production, 

substantially, more than traditional agricultural production 

and trade heavyweights such as the European Union, the 

United States, India and Brazil (Huang et al., 2009). 

Some research has been done on the input-output of 

China’s agriculture: Wu et al. (2008) constructed an 

input-output model for Changde City of Hunan Province 

using EViews software by choosing the production of 

agriculture as output factor and labor, fertilizer inputs, 

dynamic mechanical total, arable land area and the area 

of effective irrigation as input factor. Dong (2009) 

analyzed the relationship between input and output of 

agriculture in China by the partial least squares regression 

method, and the result showed that: the agricultural 

output is mainly affected by the expenditure for household 

management, the financial expenditure for supporting 

agriculture and the fertilizer input, and is less affected by 

the input of cultivated area. Jiang and Zhang (2010) 

established an input-output model about regional 

agriculture of the southern Xinjiang Province by principal 

component analysis according to the input and output 

data in the years 2002 to 2007. Unfortunately, previous 

studies were based on a single spatial scale (for example, 

one county, one province or the whole country) in short 

time series, and less attention has focused on the 

agricultural input-out of different temporal and spatial 

scales in China’s agriculture.

The main purpose of this paper is to analyze the 

agricultural input and output in the last 10 years. The 

objectives of this study are: 

1. To analyze temporal and spatial variation of agricultural 

input-output in Hebei Province; 

2. To construct an agricultural input-output potential model 

based on Cobb-Douglas production function; 

3. To analyze the main influence factors to affect the 

agricultural output in Hebei. 


Hebei Province 

Hebei Province (Figure 1) is 190,000 km 2 area with a population of 

69 million (2009), and is divided into 11 prefecture level cities 

(including 138 counties). The topography consists of mountains, hills, 

and plateaus in the northwest, and a broad plain in the central and 

southeastern region. A total of 34% of the area is cropland with 

mainly winter wheat and summer maize double cropping system 

(winter wheat is cultivated from early October to early June, summer 

maize is grown from mid-June to late September). 

The study area is located in a temperate and continental monsoon 

climate zone with a mean annual precipitation of 498 mm, 69% of 

which occurs between June and September (1999 to 2008). Mean 

annual temperature is 11°C (1999 to 2008). Precipitation and 

temperature decrease from southeast to northwest. 

Data 

The economic statistics data for each county from 1999 to 2008, 

including grain yield, grain price, cultivated area and effective 

irrigation area, chemical fertilizer usage, agricultural machinery 

power, rural electricity consumption, and rural manpower, were 

obtained from Hebei economic statistical yearbooks (2000 to 2009). 

Agricultural input-output potential model 

Agricultural input factors mainly include labor, irrigation, cultivated 

land, fertilizer, machinery power and electricity. Accordingly, the 

agricultural input-output potential model is focused on seven 

variables: output (Y, 10 4 Yuan), cultivated land area (Ac, ha), 

effective irrigation area (Ai, ha), rural electricity consumption (Ce, 

10 4 kWh), agricultural machinery power (Pm, KW), chemical 

fertilizer usage (Fc, T) and rural manpower (Mr, person). The 

relation of agricultural output and input can be expressed as, 

Y( t) 

� f ( Ac( 

t), 

Ai( 

t), 

Ce( 

t), 

Pm( 

t), 

Fc( 

t), 

Mr( 

t)) 

(1) 

In economics, the Cobb-Douglas functional form of production 

functions is widely used to represent the relationship of an output to 

inputs, and it appears to be a good approximation to actual 

production (Romer, 2001). So Cobb-Douglas production function is 

used and it is shown as below: 

� � � � � 

Y( 

t) 

A Ac( 

t) 

Ai( 

t) 

Ce( 

t) 

Pm( 

t) 

Fc( 

t) 

Mr( 

t) 

� 

� (2) 

where α, β, γ, δ, λ, and ψ are the output elasticities of cultivated land 

Yuan 5917 

area, effective irrigation area, rural electricity consumption, 

agricultural machinery power, chemical fertilizer usage and rural 

manpower respectively, and 0


Figure 1. Geographical position of Hebei Province. The contour lines and the points indicate average precipitation 

(1984 to 2008) and locations of weather stations respectively. 

manpower is the most, followed by Handan and 

Qinhuangdao is the least. 

Spatial variability of agricultural input-output 

In order to discuss the spatial variability of agricultural 

input-output, we analyzed the change of agricultural 

output and the six input factors from the periods of 1999 

and 2003 to 2004 and 2008 for 11 cities in Hebei and the 

results showed that: the agricultural output is increased in 

all cities and the value of Cangzhou is the largest and with 

Qinhuangdao is the smallest (Figure 4a); the cultivated 

land area is decreased except Langfang (Figure 4b); the 

effective irrigation area is increased except Shijiazhuang, 

Baoding and Qinhuangdao (Figure 4c); the rural electricity 

consumption is increased in all cities and the value of 

Tangshan is the largest (Figure 4d); the agricultural 

machinery power is increased in all cities and the value of 

Handan is the largest (Figure 4e); the chemical fertilizer 

usage is increased except Shijiazhuang and Langfang 

(Figure 4f); and the rural manpower is decreased except 

Qinhuangdao and Zhangjiakou (Figure 4g). 

Main influence factors to affect the agricultural output 

According to Equation 3, an agricultural input-output 

potential model was constructed by regression analysis 

based on county spatial scale, and it is shown as follows, 

lnY 

( t) 

� 7. 

87 � 0. 

14ln 

Ac( 

t) 

� 0. 

64ln 

Ai( 

t) 

� 0. 

07ln 

Ce( 

t) 

� 0. 

01ln 

Pm( 

t) 

� 0. 

09ln 

Fc( 

t) 

� 0. 

03ln 

Mr( 

t) 

F � 122. 

79 

2 

R � 0. 

85 ( n � 138) 

The elasticity coefficient of effective irrigation area 

(with0.64) is the highest which indicates that the effective 

irrigation area is the biggest influent factor on the 

( 7)

Ac (ha) 

Pm(ten thousand KW ) 

6500000 

6250000 

6000000 

5750000 

5500000 

10000 

9000 

8000 

7000 

6000 

(b) 

1999 2002 2005 2008 

(e) 

1999 2002 2005 2008 

Y (ten thousand yuan ) 

Ai (ha) 

Fc (t) 

6000000 

5000000 

4000000 

3000000 

2000000 

4500000 

4400000 

4300000 

4200000 

3100000 

3000000 

2900000 

2800000 

2700000 

2600000 

(a) 

1999 2002 2005 2008 

(c) 

1999 2002 2005 2008 

(f) 

1999 2002 2005 2008 

Ce (ten thousand Kwh ) 

Mr (person) 

4000000 

3500000 

3000000 

2500000 

2000000 

1500000 

17000000 

16500000 

16000000 

15500000 

15000000 

14500000 

14000000 

(d) 

Yuan 5919 

1999 2002 2005 2008 

(g) 

(a) 

1999 2002 2005 2008 

Figure 2. Annual agricultural output (a), cultivated land area (b), effective irrigation area (c), rural electricity consumption 

(d), agricultural machinery power (e), chemical fertilizer usage (f), and rural manpower (g) from 1999 to 2008 of Hebei 

Province. 

agricultural output in the 6 input factors; followed by 

chemical fertilizer usage (with 0.09) and rural manpower 

(with 0.03), while cultivated land area (with -0.14), rural 

electricity consumption (with -0.07) and agricultural 

machinery power (with 0.01) have relative small influence 

on the agricultural output. The sum of elasticity of the six 

input factors is 0.56 (


(a) 

(b) (c) (d) 

(e) (f) (g) 

Figure 3. Annual mean agricultural output (a), cultivated land area (b), effective irrigation area (c), rural electricity 

consumption (d), agricultural machinery power (e), chemical fertilizer usage (f), and rural manpower (g) from 1999 

to 2008 of 11 cities in Hebei Province. 

(a)

(a) 

(b) (c) (d) 

(a) 

Yuan 5921 

Figure 4. Change of agricultural output (a), cultivated land area (b), effective irrigation area (c), rural electricity consumption (d), 

agricultural machinery power (e), chemical fertilizer (f) and rural manpower (g) from the periods of 1999 to 2003 and 2004 to 2008 in 

Hebei Province. 

At present, one of the greatest challenges in Hebei is 

severe water shortage, driven by strong water demands 

from the huge population, and rapidly expanding 

irrigated-agriculture, commercial and domestic sectors. 

Agriculture has been specifically identified as the major 

water user, accounting for about 70% total water use here. 

Water-saving especially in agriculture should be promoted 

by decision makers, irrigation planners and 

agro-scientists. Water-saving measures such as the 

adoption of drought-resistant crop varieties, the 

readjustment of planting patterns, and the use of deficit 

irrigation and advanced tillage and mulching techniques 

could reduce water use by limiting soil evaporation and 

plant transpiration (Zhang et al., 2008). Agricultural 

water-saving in combination with the long-distance water 

transfer and optimized water reallocation, are necessary 

prerequisites for comprehensively redressing the 

worsening water shortage problems in Hebei.


There are many factors that affect agricultural output 

except the above six factors, such as temperature, 

precipitation and crop breed. In this study, we only 

analyzed the relation of agricultural output and six main 

input factors and found in the six factors, the effective 

irrigation area has the biggest influence on agricultural 

output. This study has provided scientific information for 

developing efficient irrigation practices to improve crop 

water productivity and help to maintain sustainable 

development of agriculture in Hebei. 


The paper was supported by the Natural Science 

Foundation of China (40901130) and the Instruction 

Project of Hebei Province Palace of Science 

(10457205D-2). We are also grateful to the editors and 

reviewers. 

REFERENCES 

Dong MS (2009). The relationship between input and output of 

agriculture in China: analysis based on partial least squares 

regression model. Technol. Econ., 28(1): 37-41 (in Chinese with 

English abstract). 

Huang JK, Liu Y, Martin W, Rozelle S (2009). Changes in trade and 

domestic distortions affecting China’s agriculture. Food Policy, 34: 

407-416. 

Jiang QS, Zhang XJ (2010). Regional agricultural input-output model 

and countermeasure for production and income increase of farmers in 

southern Xinjiang. J. Anhui Agric. Sci., 38(28): 15932-15935 (in 

Chinese with English abstract). 

Van Ittersum MK, Rabbinge R (1997). Concepts in production ecology 

for analysis and quantification of agricultural input-output 

combinations. Field Crops Res., 52, 197-208. 

Wu HL, He HB (2008). Research on agricultural production input-output 

model of Changde City. Econ. Res. guide, 11, 53-56 (in Chinese with 

English abstract). 

Zhang XY, Chen SY, Sun HY, Pei D, Wang YM (2008). Dry matter, 

harvest index, grain yield and water use efficiency as affected by 

water supply in winter wheat. Irrig. Sci., 27 (1), 1-10.




DOI: 10.5897/AJMR11.966 


Management of viral disease in banana using certified 

and virus tested plant material 

El-Dougdoug, Kh. A. 1 and M. M. El-Shamy 2 

1 Department of Microbiology, Faculty of Agriculture, Ain Shams University, P. O. Box 68 Hadayek Shobra 11241 Cairo, 

Egypt. 

2 Department of Botany, Faculty of Science, Menoufia University, Egypt. 


Viruses are major limitations to cultivation. These viruses were detected by double antibody sandwich 

enzyme-linked immunosorbent assay (DAS-ELISA) using specific polyclonal antibodies for Banana 

bunchy top virus (BBTV) and Cauliflower mosaic virus (CMV). Polymerase chain reaction, (PCR) based 

detection of a 500 bp amplicon from BBTV infected tissues and or a 600 bp amplicon from infection 

Brome mosaic virus (BMV) infected tissues confirmed the presence of the viruses in these plants. As 

well as the major deoxyribonucleic acid (DNA) fragments of expected size, 500 bp was amplified from 

BBTV infected tissues and the size of the major amplified product in BMV infected tissues was 600 bp. 

The application of banana meristem tip (0.3 mm) is more effective for BBTV and or BMV eradication in 

vitro. Chitosan (0.12%), treatment for infected plants was more effective for BBTV and BMV eradication 

in vivo. The results proved that there is five important precautions for success of the rouging program 

of banana viral control included: (1) To ensure that the nursery stock is clean and free from latent virus 

infection via starting tissue culture seedlings virus tested or suckers treated with 0.12% chitosan, (2) 

Detecting infected plants periodically every month by fortnightly inspection via external symptoms and 

every season by a DAS-ELISA test for the presence viral diseases (3) Rouging the infected plants after 

two inspections. The rouged plants were destroyed by burning at the end of growing season, (4) 

Spraying the plants and weeds with malathion and cilecron every two weeks alternatively to kill the 

aphid vectors from the first April to end of growing season is December, (5) Eradication of woods and 

grasses from plantations (secondary virus hosts) by digging up and inherbicide. Dealing with this 

problem as a community. 

Key words:Banana, nursery, orchard, banana bunchy top virus (BBTV), Brome mosaic virus (BMV) in vitro, in 

vivo, eradication, PCR, ELISA. 

INTRODUCTION 

Banana is one of the most important fruit in Egypt and 

cultivated in wide areas. Banana production increased to 

512.5 thousand metric tons and the average crop was 

11.27 to 13.71 feddan (Ministry of Agriculture, ARE, 

1996) as a result of cultivation of new varieties high in 

production. Two viruses, Banana bunchy top virus 

(BBTV) and banana Cauliflower mosaic virus Bean 

common mosaic virus (BCMV) are considered able as 

one of the limiting factors in the production of banana 

*Corresponding author. E-mail: magdyelshamy@yahoo.com. 

crop. The virus causes serious losses in many countries 

(about 20 to 30% and occasionally reaching 50 to 80%). 

They are usually spread from plant to plant in nature by 

insect vectors, but often are also transmitted over long 

distances and from one crop cycle to another in 

vegetative planting material. The use of healthy planting 

materials and destruction of infected or diseased plants 

are essential for the control of viruses. The control 

strategy using pathogen-free stocks is to dilute the effects 

of disease through the supply of large quantities of 

healthy planting material. An important feature of this 

approach is the maintenance of pathogen-free foundation 

materials, which are protected from re-infection (Ang and


Ong, 1998). 

Four factors influenced the success of a rouging 

program for the control of BBTV. These are incubation 

period of the virus, relative infection rate, detection 

efficiency and eradication efficiency (Allen, 1978). The 

control measures of BBTV consist of: (a) Early disease 

recognition and prompt eradication of infected plants, (b) 

Control of its insect vector, Pentalonia nigronervasa, (c) 

use of virus-free planting materials and (d) Quarantine for 

areas that are free from disease (Nakahara, 2000). 

This study aims to eradicate the banana viruses via 

detection of the virus from naturally infected banana 

plants and produced virus-free banana plants by applying 

two programs: Establishment of adeptic culture in vitro 

and continuation of banana plants growth and control the 

vectors and weeds in open field orchards and nursery. 


Source of plant materials 

The banana seedlings and suckers (200 samples with 20 to 30 cm) 

were collected from mother plants Musa spp. cv. Williams, 

Cavendish subgroup cultivated in Meet El-Attar, Benha, Qualubia 

Governorate. The mother plants exhibited BBTV and Brome mosaic 

virus (BMV) distinct external symptoms. The selected plants were 

investigated depending on serological and molecular detection. 

Virus detection 

The viruses were detected in naturally infected and treated banana 

plants, in this study, by their external symptoms. This was also by 

double antibody sandwich enzyme-linked immunosorbent assay 

(DAS-ELISA) and polymerase chain reaction (PCR). The virus 

isolates (BBTV and BMV) were detected in banana plants by DAS- 

ELISA according to Clark and Adam (1977) using specific poly 

clonal IgG BBTV and BMV. Enzyme-Linked Immunosorbent Assays 

(ELISA) Kits were provided by Sanofi Sante Animal Paris, France. 

PCR and reverse transcriptase PCR (RT-PCR) techniques were 

used to detect BBTV and BMV nucleic acids in banana plants. Total 

DNA of infected banana leaves was extracted using a version of 

CTAB (Cetyl trimethyl ammonium bromide) according to Dellaporta 

et al. (1983). Total Ribonucleic acids (RNA) of infected banana 

leaves were extracted according to Gibbs and Mackenzie (1997). 

PCR amplification of BBTV 

Oligonucleotide primers (Table 1) for PCR were derived from the 

published sequences of BBTV- DNA N (Harding et al., 1993). The 

PCR reactions were performed according to condition and 

parameters described by Harding et al. (1993). The complementary 

DNA (cDNA) of BMV-RNA was done using the CMV/CP 

complementary primer (Table 1) of the conserved ultimate of CMV- 

RNA-3 and Avion Myeloblastosis virus reverse transcriptase (AMV- 

RS). The PCR reaction was performed according to conditions and 

cycling parameters described by Quenmada et al. (1991). 

Preparation of chitosan 

Chitosan with a degree of deacetylation 72% was obtained from 

Aldrish Chemical Company. Chitosan was dissolved in 0.05% (W/V) 

acetic acid and pH was adjusted to 5.5 with NaOH (Mahmoud et al., 

2003). 

Two programs of virus controlling in banana plants were carried 

out. 

Establishment of an aseptic culture of banana 

Micropropagtion of banana in vitro 

The infected banana plants cv. Williams confirmed by PCR 

technique was used as source of meristems for tissue culture. 

Meristems tip 

The meristems were excised from shoot apices with rhizomatous 

base (about 2.5 cm² × 5 cm length). Individual meristem (the dome 

with 2 to 4 leaf primordial with rhizomatous base) were then excised 

with 0.3 mm under the binocular using fragments of a razor blade 

attached to a scalpel handles. The meristem tip was soaked in 

ethanol 76% for sec. before transferred to the culture medium. 

Individual meristem tip was cultured on MS starting medium. The 

cultured jars were incubated in growth room under incubation 

conditions at 3 weeks. The meristems were transferred on MS 

multiplication medium. Monthly subcultured of the plantlets to a 

fresh multiplication medium was carried on at subculture fourth. 

After that, the plantlets were transferred on MS rooting medium 

(Table 2). 

Virus indexing 

To be sure of virus free banana plantlets resulted by meristem tip 

culture confirmed using DAS-ELISA. 

No. of virus free plantlets 

Percentage of virus-free plantlets = × 100 

Total No. of survived plantlets 

Acclimatization 

Healthy plantlets that showed negative results by DAS-ELISA were 

removed from the culture jars. The roots were rinsed with tap water 

and shortened to 3 cm. The roots of plantlets were immersed in 

penlate solution (1 gL -1 ) and transferred into steam sterilized soil 

(peat: sand: vermiculite mixture by 2:1:1 ratio) in pots (12 cm Q) 

and covered with wet polyethylene for 10 days under greenhouse 

conditions. The air humidity exceeds 90% during the first days and 

decrease gradually. 

Production of banana seedlings under nursery 

Naturally infected banana plants cv. Williams exhibited typical 

bunchy top and stunting or mosaic symptoms (+ve results with 

DAS-ELISA) as well as healthy one was used to produce virus free 

banana seedlings. The corm of these plants was subjected to 

treatment with 0.5 to 1.0 ml of 0.12% chitosan. The treated 

seedlings were planted in clay soil at farm (30 × 20 m²³) in Meet El- 

Attar contains 200 lots and designed to produce virus-free banana 

seedlings. The distance between lots was 1 m². The seedlings were 

fixed to a 25 cm depth in the lots at the first march. 

The seedling (healthy and infected) were treated with chitosan by 

two ways. a- Injected by syringe in the corms and with paraffin wax

Table 1. Oligonucleotide primers for BBTV and CMV. 

Virus Nucleotide sequence 

BBTV Reverse 5`GCTAGGTATCCGAAGAATC-3` 

Forward 5`-TCAAACATGATATGTAATTC-3` 

CMV Reverse 5`-CCCCGGATCCTGGTCTCCTT-3 

Forward 5`-CCCCGGATCCACATCAYAGTTTTRAGRTTCAATTC-3 

Table 2. Chemical constituents of MS media for different growth stages of banana production in vitro. 

El-Dougdoug and El-Shamy 5925 

Constituents 

Starting 

Medium of growth stages 

Multiplication Rooting 

* -1 

Stock salts gL 4.5 4.5 4.5 

Sucrose gL -1 

30 30 30 

6-benzyl amino purine mgL -1 

3 5 - 

Nphthalene acetic acid mgL -1 

- - 2 

pH 5.8 5.8 5.8 

Phytagel gL -1 

2.2 2.2 - 

Agar gL -1 

- - 7 

Muo-inositol gL -1 

0.1 0.1 0.1 

Culture’s containers 250 ml 500 ml 500 ml 

Size of media/container 30 ml³ 

40 ml³ 

40 ml³ 

* Stock salts 

days for 2 months). After 6 months data were recorded on survival 

before planting. B- Sprayed with chitosen periodically (each 15 

percentage, average of shoot length or pant; number and leaf area, 

diameter of pseudostem, number and thickness of roots. Leaves 

tissues were obtained from the plants and tested by DAS-ELISA for 

the presence of BBTV and BMV. 

Eradication of banana virus in orchards 

The second content program was done in banana groves (aboutfive 

feddan including 200 lots) in banana groves, Meet Attar Benha, 

Qualubia Governorate. Mother banana plants were grown under 

natural conditions. The control program was based on: 

Detecting infected plants periodically every month by fortnightly 

inspection via external symptoms and DAS-ELISA test for the 

presence viral diseases. BBTV and BMV rouging the infected plants 

after two inspections. The rogued plants were destroyed by burning 

at the end of growing season. The plants and weeds were sprayed 

with malathion cilecron with 1.5% alternatively to the end of growing 

season in December. Eradication of woods and grasses from 

plantations (secondary virus hosts) by digging up and insecticide. 

The percentage of virus infection was determined four times by 

DAS-ELISA through this a program. 

RESULTS 

Virus detection 

It is easy to detect the viral infection on banana plants in 

the nursery and orchards because the external symptoms 

are clear and distinctive. 

Symptoms of BBTV 

The symptoms of infected banana with BBTV were dark 

green streaks on the midrib, reduced size, brittle of the 

leaves and gather at the top of plant making a resetting 

shape. Some leaves, veins are dark green colored and 

form a “hook” shape, as the midrib is approached 

(Figures 1a and b). 

Symptoms of CMV 

The symptoms of infected banana with Cauliflower 

mosaic virus (CMV) are characterized by a conspicuous 

molting and mosaic of the leaves, green streaks on 

midrib of leaves and are wavy (Figure 1c). Common 

observation of infected pants is stunted growth. In severe 

cases this is accompanied by rotting of the heart and 

central cylinder. 

Using DAS-ELISA, indicate the presence and the 

percentage of BBTV, BMV and mixing of them naturally 

infected banana cv. Williams was 73.6; 46.6 and 20%, 

respectively. It also noticed that banana plants infected 

with BBTV or and BMV gave less number of suckers 

compared with corresponding healthy ones. As well as,


Figure 1. Naturally infected banana plants exhibited different viral symptoms. Leaves are bunched up, narrow, stiff, 

upright and with yellow and irregular or wavy leaf margin (A, B and E). Petioles & leaf sheaths are mottled, streaked 

(A, D, and F). Healthy plant (C). 

the percentage of healthy suckers 26.5% resulted from 

infected banana plants. 

Molecular detection 

The total DNA of BBTV infected banana leaves was 

determined spectrophotometrically as 240 µg/0.02 g of 

tissues. The total RNA of infected banana leaves was 

measured spectrophotometrically as 150 ng/0.02 g of 

tissues as well as the purity of total DNA and Ribonucleic 

acid (RNA) as indicated by A260/A280 ratio was 1.72 and 

1.52, respectively. 

PCR as an enzymatic procedure was used successfully 

to detect very low amounts of nucleic acid belonging to 

several plant viruses with high sensitivity and specificity. 

The results showed that BBTV was detected in naturally 

infected leaves (Figure 2A) as amplicons of expected 

size, 500 bp were seen in only the infected tissues (Lane 

1 and 2). No amplification was obtained with uninfected 

banana leaves samples (Lane 3). 

The CMV-RNA was reverse transcriptased by Moloney 

Murine Leukemia Virus (MMLV) using the oligo-dt (5`- 

CCCCGGATCCTGGTCTCCTT-3`) as minus sense 

primers. 

The resulting complementary DNA (cDNA) was 

amplified by PCR using primers (CM1 and CM2) for coat 

protein gene. The PCR product was investigated using 

agarose gel electrophoresis analysis (Figure 2b). The 

size of the major amplified product in all samples was600 

bp (Lane 3 and 4). This product was not detected in 

uninfected leaves (Lane 3) 

Establishment of virus-free banana plants 

Production of virus-free banana seedlings in vitro 

This experiment aimed to study the meristem tip size 

related to virus elimination from BBTV and BMV infected 

banana plants. 

Meristem tip sizes of 0.3, 0.5 and 1.0 mm was excised 

from diseased banana plants BBTV or BMV under 

steromicroscope. They were cultured on starting MS 

medium and incubated under convenient conditions. 

After 6 weeks post-cultivation the meristems were 

developed to the shoot (Figure 3) and tested against 

BBTV and CMV virus-using with DAS-ELISA. The

p 

2642 

1500 

1000 

500 

400 

300 

200 

100 

M 1 2 

(A) 

3000 

2000 

1250 

1000 

750 

500 

250 

M 1 2 3 

600 bp 

(B) 


Figure 2. Agrose gel (0.7%) showing PCR products (CP gene amplified) of BBTV and BMV. 

(A)BBTV-PCR products Lanes 1,2 infected banana plants and Lane 3 healthy ones, (B) BMV- 

PCR products, Lanes 1,2 infected banana plants and Lane 3 healthy ones. M: DNA Molecular 

weight marker (XVI, Roche). The arrow indicates the correct size of amplified PCR products. 

(A) 

Figure 3. Different stages of healthy banana production in vitro 

from infected plants using (0.3 min) meristem tip culture. 

500 bp 

600 bp 

500 bp


Table 3. Production of virus-free banana seedlings using meristem tip culture in vitro. 

Size of 

Meristem (mm) 

Parameter 

BBTV BMV 

Survival (%) Virus free No. Virus infected No. Virus free (%) Virus free No. Virus infected No. Virus free (%) 

0.3 mm 75 65 10 86.66 70 5 93.33 

0.5 mm 85 45 40 52.94 50 35 58.82 

1.0 mm 100 10 90 10 12 88 12.00 

smallest size (0.3 mm) gave 75% survival with 

86.66 and 93.33% virus free (BBTV and BMV, 

respectively) plants. But using the size of 0.5 mm, 

gave 85% survival with 52.94 and 58.82 virus free 

plants (BBTV and BMV respectively). While using 

the size 1.0 mm gave 100% survival with 10 and 

12% of virus free plants (BBTV and BMV, 

respectively; Table 3). 

The explants (subculture 1) virus tested were 

transplanted on multiplication medium and incubated 

under convenient conditions. The explants 

(sub culture 2) were generated at subculture 6 on 

multiplication medium. The explants (subculture 6) 

were transplanted on rooting medium and 

incubated under convenient conditions at about 3 

to 4 weeks until formation of roots. 

Acclimatization 

The plantlets were adapted into steam-sterilized 

soil in pots and grown under greenhouse 

conditions (Figure 3). 

Production of virus-free banana seedling in 

nursery 

All banana suckers (200 samples) were tested 

against BBTV and BMV in nursery through two 

seasons via external symptoms and confirmed 

with DAS-ELISA test. The results revealed that, 

BBTV and BMV were detected in about 75 and 

45% (about 200 plants), respectively. The suckers 

treated by injection and spraying with 0.12% 

chitosan solution did not have any external viral 

symptoms. While, the percentage of BBTV 

infected plants in 1st and 2nd seasons were 9 and 

5% as well as BMV infected plants were 5 and 2% 

respectively by using DAS-ELISA test. So, 

chitosan showed actively against viral infection 

and induction of the plants growth: Whereas, the 

chitosan treatment due to increasing in survival of 

suckers with 14.5 and 10% compared with BBTV 

and BMV infected plants respectively. As 

investigation results of suckers excised from 

infected banana mother plants, it was found that 

the BBTV or BMV infection due to reduction in 

suckers growth whereas reduction in morphological 

characters (Table 4) compared with suckers 

excised from healthy mother plants. Data in Table 

4 show the effect of chitosan an morphological 

characters of infected banana plants after 6 

months post-chitosan treatment in vivo, data 

revealed that, the increasing of shoot length/plant; 

no. of leaves/plant, leaf area; diameter of 

pseudostem; corm diameter; No. of roots and root 

diameter of infected banana suckers with BBTV or 

BMV compared with pre-chitosan treatment 

(Table 4). As well as, increasing in chlorophyll a 

and b and carotenoids contents of infected 

banana plants treated with 0.12% chitosan, than 

un-treated banana ones. 

Continuation of growth of banana plants and 

virus control in orchards 

The application of the procedures as described in 

materials and methods very effective in controlling 

banana viruses and producing virus free suckers. 

The viruses were detected via external symptoms 

and confirmed by DAS-ELISA test. The data in 

Table 5 showed that, the previous procedures due 

to reduction of BBTV and BMV infected banana 

plants were 73.66, 29.2 and 15.5% in the first year 

to 4.25 and 1.75% in the second year, 

respectively. 

The present investigation also clearly indicated 

that, BBTV or BMV naturally infected banana 

mother plants gave lowest number of suckers 

compared with corresponding healthy plants. It 

also be noticed the lowest number of healthy 

suckers (1 and 3 suckers, respectively) compared 

with 6 sucker per healthy plant based on DAS- 

ELISA test. The percentage of virus in infection in 

cv. Williams was decreased season after season. 

It was 73.3 and 46.6% in first season(start 

experiment), 10.75 and 2.5% second season and 

3.50 and zero% in third season for BBTV and 

BMV, respectively. In addition, the number of 

healthy suckers per plant was increased 1, 4, 5 

(BBTV); 2, 5, 6 (BMV) and 3.5.6 (BBTV + BMV) at

Table 4. Effect of chitosan solution in growth of banana plants infected with BBTV and BMV * . 

Morphological 

parameters 


Treatments 

BBTV BMV 

Healthy Without chitosan Post chitosan treatment Without chitosan Post chitosan treatment 

Survival (%) 100 85.5 100 90 100 

Shoot length/plant (cm) 75 34 65 52 70 

No. of leaves/plant 5 7 8 5 6 

Leaf area (cm) 450 200 350 300 400 

Pseudostem diameter (cm) 20 9 15 12 17 

No. of roots/plant 10 8 9 8 10 

Thickness of roots 0.7 0.3 0.5 0.4 0.6 

Corm diameter (cm) 22 15 18 17 19 

Chlorophyll a 3.75 1.50 3.15 1.25 3.25 

Chlorophyll b 2.25 0.91 2.10 0.75 1.95 

Carotenoids 3.25 1.85 2.95 1.65 2.50 

* First season. 

Table 5. Percentage of BBTV and BMV infection in banana plants and their suckers growing under 

environmental conditions in orchards. 

Growing 

seasons 

1 st season 

2 nd season 

3 rd season 

1st, 2nd season respectively, (Table 5). 

On the other hand, the suckers associated of 

mother plants not appeared viral like symptoms as 

those of healthy ones in the field. The rate of 

infection was higher in the winter season than in 

Mother plants 

Parameters 

Percentage of infection 

Suckers per plant 

BBTV BMV BBTV BMV BBTV + BMV 

73.66* 

10.75* 

3.50* 

46.6 

2.5 

0.0 

5/6** 

2/6 

1/6 

4/6** 1/6 

0/6 

* Average of sucker plant -1 

calculated from 100 mother plants. ** No. of infected suckers/No. of total sucker plat, 

calculated from 100 plants based on DAS-ELISA test. 

the summer season. Young plants that were virus 

infected early after planting showed severe 

symptoms and never grow more than one meter 

at the end of growth season. Old plants that were 

virus infected showed no significant change in the 

3/6** 

1/6 

0/6 

growth. It was also observed that the suckers in 

the same lot may exhibit infection. But if one of 

the suckers is in one lot, the lot became infected 

after 3 month of planting. The mother plant rarely 

exhibited any symptoms by the end of growth


season. 

The eradication of viruses in banana groves in this 

experiment was based on: 1) periodically detection of 

BBTV and BMV via external symptoms and yearly by 

random method using ELISA test. 2) Rouging and 

destruction of the infected plants outside in the groves 

and +ve ELISA tested. The rouged plants destroyed by 

burning at the end of growing season. 3) At the same 

time control of aphid vectors by spraying with (0.2%) an 

effective insecticide. 4) Eradication of weeds and grasses 

by using glyphosate. 

DISCUSSION 

BBTV and BMV are of the most widespread banana 

viruses in different countries of the world (Smith et al., 

1990) which are concerned with banana cultivation in 

Egypt (Allam et al., 1988). In Egypt, the most threatening 

viral diseases are those caused by BBTV and BMV, 

these viruses are considered as limiting factors in banana 

production (Allam et al., 1988; El-Dougdoug et al., 2002). 

Banana plantations are propagated asexually by suckers 

since almost all of their cultivars are seedless or seed 

sterile. Banana diseases subjected to many natural 

caliseases constitute a major problem, virus diseases are 

serious as insect vectors are abundant and there are 

many alternate hosts. 

We noticed that, the first symptoms of banana infected 

with BBTV were dark green streaks on the lower portions 

of the midrib of the leaf; the fresh infected leaves were 

brittle, reduced in the size and gather at the top of plant 

making a resetting shape. These symptoms reported also 

by Allam et al. (1988), El-Sayed (1994), Othman et al. 

1996) and El-Dougdoug et al. (2006). The symptoms of 

BMV are characterized by a conspicuous interveinal 

chlorosis of the leaves. Common observation of infected 

(plants stunted growth. In severe cases this is 

accompanied by rotting of the heart leaf and central 

cylinder as stated by Nurhadi and Setyobudi (1998), 

Allam et al. (2000) and El-Dougdoug et al. (2006). 

All banana plants used for starting this work were found 

to be infected with either BBTV or BMV and were 

detected in leaf samples by different methods as the 

biological, serological and molecular. DAS-ELISA was 

used to detect BBTV and BMV because of their 

sensitivity, specificity and speed (Clark and Adam, 1977; 

El-Dougdoug et al., 2002, 2006). We obtained the same 

conclusion. 

A polymerase chain reaction (PCR) assay was 

developed for detection of BBTV and BMV of banana 

plants as well as single aphid (Xie and Hu, 1995). They 

added that, dot blot hybridization assay were as sensitive 

as ELISA, while PCR was 1.000 times more sensitive 

than dot blot immunoassay and ELISA. Furthermore El- 

Sayed (1994) found that PCR and dot blot hybridization 

were more sensitive than other traditional methods for the 

detection of BBTV and BMV. 

The smallest size of meristem tip 0.3 mm more 

effective for elimination of banana viruses than 0.5 and 

1.0 cm meristem size, whereas gave largest number of 

virus-free plants. 

The active growing points of the plant shoot are 

meristem and nodel cuttings. They contain the truly 

meristemic cells, which surrounded by leaf primordial and 

primary leaves. Since more differentiated vascular 

tissues are found in meristem from a distance. Vascular 

elements of the leaf primordial are still incipient, and have 

not yet made contact with main strand system in the 

stem. Therefore, virus particles can reach the 

meristematic region of the apex only through cell to cell 

movement slowly. For this reason, virus concentration 

decreases in both apical axillary buds of infected plants 

(Perez et al., 1999). 

Recent investigations of tissue culture methods proved 

that the number of virus free plants produced is inversely 

proportional to the size of the explants cultured. Thus, in 

some instances it is possible to excise a meristem tip free 

of the virus present in the infected parent and regenerate 

them into a healthy plant (Zilkah et al., 1992). Moreover, 

they indicated the importance of explants size in the 

successful elimination of some viruses and the role of 

certain host virus combination in determining the success 

of virus elimination (George, 1993). Virus eradication 

procedure depends partly on the nature of viruses; some 

of these viruses are more readily eliminated than others. 

The mechanism of such in vitro virus inactivation remains 

unknown, but whatever the explantation it seems 

probable that this type of virus eradication is more likely 

to occur if low, rather than high concentrations of virus 

particles are present in the tip (Walkey, 1991). 

Four factors influence the success of a rouging 

program for the control of BBTV. These are incubation 

period of the virus, relative infection rates, detection 

efficiency and eradication efficiency (Allen, 1978). The 

virus activity might be prevented by alternation of the 

charge on the virus particles caused by polybasic 

substances. Such effects could be produced by chitosan 

(Mahmoud et al., 2003). Usually chitosan is obtained 

from decaylation of chitin crusts in crustacea. The 

chitosan possess a wide biological activity including 

induction of many plant defense responses such as 

accumulation of chitinases, production of phytoalexin 

(Walter-Simmons et al., 1983); synthesis of proteinase 

inhibitors (Walter-Simmons et al., 1989), lignification 

(Barber et al., 1984) and callose synthesis (Lienart et al., 

1993). Chitosan was found to inhibit plant viral infections 

such as alfalfa mosaic virus, tobacco mosaic virus; potato 

virus X, peaut stunt virus, tobacco necrosis virus; 

cucumber mosaic virus and BBTV and BMV 

(Posppieszny et al., 1991 and Mahmoud et al., 2003). In 

addition, it was exhibited antiviroid action (Posppieszny, 

1997). Mahmoud et al. (2003) postulated that, chitosan 

may be substitute for the virus particles when attached to

cell receptors. Compared to suckers, the use of plantlets 

grown by tissue culture has many advantages. Tissue 

culture plantlets are cheaper and easier to propagate and 

transport. They have a higher survival rate in the field. 

They reduce the cost of controlling foliar diseases by 

50%. Their uniformity of growth makes it possible to 

control the time of flowering and harvesting and give a 

significant increase in yield and fruit quality (Hwang et al., 

1984). 

Tissue culture is now standard practice in banana 

propagation to ensure that the nursery stock is clean and 

free from latent infection of BBTV and BMV (Magnaye 

and Valnayor, 1995). For banana which is propagated 

vegetative, production of virus-free starting material 

(seedling and rhizomes) is very important to reduce yield 

loss due to over viral infection in field. Espino et al. 

(1998) reported that a control measure of BBTV consists 

of a) early disease recognition and prompt eradication of 

infected plants, b) Control of insect vector Pentalonia 

nigonervosa, c) use of virus-free planting materials and d) 

quarantine for areas that are free from the disease. 

Quarantine laws should be revised and enforced on the 

import of new suckers and on the movement of infected 

suckers within the country. With the use of tissue culture 

techniques disease free planting material (suckers) can 

be produced and used for new plantation (Leghari, 2002). 

To control banana viruses removing the infected plants, 

control woods and aphid vectors during the growing 

period, use virus-free planting materials and continuous 

monitoring and inspection of banana plants (Calo, 2005). 

It was noticed that for established plantings, effective 

control of the diseases requires early detection and 

immediate eradication of infected plants followed by 

replanting with disease free planting materials. As most 

banana virus produces character symptoms on the 

eaves, eradication was commonly done under 

symptomatology basis as stated by Nurhadi and 

Steyobudi (1998). 

The control program can be summarized as follows: 

Detecting infected mother plants periodically every month 

by fortnightly inspection via external symptoms and 

ELISA test for the presence of viral diseases. Rouging 

the infected plants after two inspections the rouge plants 

were destroyed by burning at the end of growing season. 

Spraying the plants and weeds with malathion to kill the 

aphid vectors every two weeks from first of April to the 

end of growing season in December), eradication of 

weeds and grasses from plantations (secondary virus 

hosts) by insecticide. Quarantie regulation must be 

implemented. This control program is similar to that done 

by Allam et al. (1988). 

REFERENCES 

Allam EK, Abo El-Aid AF, Abd El-Wahab S, Sowailam HF Ouf RA Omar 

MA Abo El-Nasr MM, Deiab AE, Mohammed AS, Sadik G (1988). 

Annual report of pests and diseases of banana in Egypt. Academic of 

Technology and Scientific Research Ministry of Scientific Research, 


Cairo, Egypt. (22): 79-85 

Allam EK,Othman A, El-Sawy A, Thabet SD (2000). Eradication of 

banana bunchy top virus (BBTV) and banana mosaic virus (BMV) 

from diseased banana plants. Annals Agric. Sci., Cairo, 45: 1: 33-48. 

Allen RN (1978). The spread of bunchy top disease within a banana 

plantation to rouging. Plant Dis. Survey, pp. 25-26. 

Ang OC, Ong L (1998). Virus and virus like diseases of banana and 

citrus in Malaysia: Status and Control Strategies. In: Imanaging 

banana and citrus diseases. Proceedings of a regional workshop on 

disease management of banana and citrus through the use of 

disease-free planting materials held in Davao City Philippines, pp. 

14-16. 

Barber MS, Bertram RF, Ride JP (1989). Chitin oligosaccharides elicit 

lignification in wounded leaves. Physiol. Molec. Plant Pathol., 34: 2- 

12. 

Calo T (2005). All about banana in Carage. Department of Science and 

Technology Carage Region. Extension Butuan City, Philippine. pp. 

321. 

Clark MF, Adams AN (1977). Characteristics of the microplate method 

of enzyme-linked immunosorbent assay for the detection of plant 

viruses. J. Gen. Virol., 34: 475-483. 

Dellaporta S, Wood J, Hicks JB (1983). A plant DNA mini preparation; 

Version II. Plant Mol. Biol. Rep., 1: 19-21. 

El-Dougdoug KHA, Taha RM, Hazaa AK (2002). Sensitivity of two 

banana cultivars for banana mosaic and banana bunchy top viruses. 

Az. J. Microbiol., 9(56): 268-280. 

El-Dougdoug KA, Hazaa MM, Hanan HA, Sabah Abo El-Maaty (2006). 

Eradication of banana virus from naturally infected banana plants. 1. 

Biological and Molecular detection of cucumber mosaic virus and 

banana bunchy top virus. J. Appl. Sci. Res., 2(12): 1156-1163. 

El-Sayed SA (1994). Studies on viruses affecting banana in Egypt. 

Ph.D. Thesis, Fac. Agric., Ain Shams Univ., Cairo, pp. 125. 

Espino RRC, Ligat BS, Magnaye LV, Espino TM (1998). Rehabitation of 

BBTV-affected Areas in the Philippines: Experiences and problems. 

In; managing banana and citrus diseases Proceedings of a regional 

workshop on disease management of banana and citrus through the 

use of disease free planting materials held in Davao City, Philippines, 

pp. 14-16. 

George EF (1993). Plant propagation by tissue culture (Part 1 and 2). 

Exeyetics Lid Edington, pp. 1361. 

Gibbs A, Mackenzie A (1997). A primer pair for amplifying part of the 

genome of all potyvirids by RT-PCR. J. Virological. Methods, 63: 9- 

16. 

Harding RM, Burns tM, Hafner G, Dietzgen RG, Dale JL (1993). 

Nucleotide sequence of one component of banana bunchy top virus 

genome contains a putative replicase gene. J. Gen. Virol., 74: 323- 

328. 

Hwang SC, Chen CL, Lin JC. Lin HL (1984). Cultivation of banana using 

plantlets from meristem culture. Hortic. Sci., 19: 231-233. 

Leghari HB (2002). Banana bunchy top virus in Sindi DAWN Business. 

The Internet Edition http://DAWN.com. 

Lienart Y, Gautier C, Dubois-Dauphin D, Domord A (1993). Chitin 

(chitosan) as elicitors in Rubus protoplasts RAA Mzzarelli ed., Chitin 

Enzymol., 1: 271-278. 

Magnaye LV, Valmayor RV (1995). BBTV, BMV and other viruses 

affecting banana, in Asia and bacific. Bureau of Plant industry, 

Davao, Philippines INIBAP Asia and Pacific Network. C/O PCARRD, 

Los Bafies, Layuna Laguina. Philippines, (19): 532-544. 

Mahmoud SYM, El-Dougdoug KhA, Abdel-Ghafar MH, Aly AS (2003). 

Inhibitory effects of chitosan and its derivatives on some plant 

viruses. N. Egypt. J. Microbiol., (4): 108-124. 

Nakahara L (2000). In: Banana bunchy top virus found in Kohala from 

net Keation @ Westhawaiitoday.com. 

Nurhadi A, Setyobudi L (1998). Status of banana and citrus viral 

diseases in Indonesia. In: Managing banana and citrus diseases. 

Proceedings of a regional workshop on disease among of banana 

and citrus through the use of disease-free planting materials held in 

Davao City, Philippines, 14-16. 

Othman B, El-Dougdoug KhA, Sadik M (1996). Detection of banana 

bunchy top virus in some banana plantations in Kalubia Governorate. 

Annals Agric. Sci., Ain Shams Univ., Cairo, 41(2): 627-634. 

Posppieszny H (1997). Antiviral activity of chitosan. Crop Protect.,


16(2): 105-106. 

Posppieszny H, Chirkov S, Atabekov JG (1991). Induction of antiviral 

resistance in plant by chitosan Plant Sci., (79): 64-68. 

Perez Tornero O, Burgas H, Egea J (1999). Introduction and 

establishment of apricot in vitro through the regeneration of shoots 

from meristem tip. In vitro cell. Dev. Biol. Plant, (85): 249-253. 

Quenmada H, Hostis BL, Gonsalves P, Reardon IM, Heinriksan R, 

Herbert EL, Sten LC, Slightom JL (1991). The nucleotide sequence of 

the 3` terminal regions of papaya ring-spot virus strains. W and P. J. 

Gen. Virol., (71): 203-210. 

Smith MK, Drew RA (1990). Current applications of tissue culture in 

plant propagation and improvement. Australian J. Plant Physiol., 

(17): 267-289. 

Walkey DA (1991). Applied plant virology. Chapman and Hall, London, 

pp. 338. 

Walter-Simmons M, Hadwiger L, Ryan CA (1983). Chitosan and pectic 

polysaccharides both induce the accumulation of the antifungal 

phytoalexin in pea pods and antinutrient proteinase inhibitors in 

tomato leaves. Biochem. Biophys. Res. Commun., (110): 194-199. 

Walter-Simmons M, Hadwiger L, Ryan CA (1984). Proteinase inhibitors 

synthesis in tomato leaves. Plant Physiol., (76): 787-790. 

Xie W, Hu J (1995). Molecular cloning sequence analysis and detection 

of banana bunchy top virus in Hawair, Phytopath., 85(3): 339-347. 

Zilkah S, Paingersh E, rotbanum A (1992). In vitro propagation of three 

M x M (Prunus avium X Prunus mahaleb) Cherry rootstocks Acta 

Hortic., 314: 93-97.




DOI: 10.5897/AJMR11.992 


Scavenging and anti-fatigue activity of Wu-Wei-Zi 

aqueous extracts 

Chen Xiang* and Zhang Guohai 

College of Physical Education, Wenzhou University, Wenzhou 325035, China. 


In this study, the radical scavenging properties and the anti-fatigue activity of Wu-Wei-Zi aqueous 

extracts (WAE) were evaluated, respectively. Forced swimming exercise of mice was carried out after 4 

weeks of WAE administration and biochemical parameters related to fatigue, such as blood lactic acid 

(BLA), blood urea nitrogen (BUN), hepatic glycogen (HG), superoxide dismutase (SOD) and glutathione 

peroxidase (GPX) contents were determined. Results showed that WAE had strong scavenging activity to 

superoxide anion and 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical. And it had significant anti-fatigue 

activity, which could not only increase the hepatic glycogen, SOD and GPX contents but also extend the 

swimming time of the mice. It indicated that WAE is worthy of further study. 

Key words: Scavenging, anti-fatigue, Wu-Wei-Zi, mice. 

INTRODUCTION 

Schisandra chinensis (Turcz.) Baill, a perennial lignifying 

liana, is mainly distributed in northeastern China. Fruits 

from S. chinensis (Turcz.) Baill, is called Wu-Wei-Zi in 

Chinese and is a traditional Chinese herb originally 

recorded in Shen Nong Ben Cao Jing (over 2000 year old 

Herbal Pharmacopoeia in China) (Xu et al., 2008; Kim et 

al., 2010). The main effective constituents of Wu-Wei-Zi 

are essentially oil and lignans (schisandrin A, 

deoxyschizandrin, schisandrin B and schisandrin C) (Gao 

et al., 2003; Ma et al., 2007). Wu-Wei-Zi has been used for 

nourishing heart and stomach and strengthening immune 

function in traditional Chinese medicine (Huang et al., 

2005; Ma et al., 2007). It is also used as a tonic for the 

treatment of chronic fatigue, night sweats, wasting 

disorders, irritability, palpitations and insomnia (Siwicki et 

al., 2004). Fatigue can be defined as the reversible decline 

in skeletal muscle contractile performance due to intense 

muscle activity (Mach et al., 2010). Fatigue can be divided 

into two categories: physical and mental fatigue. Physical 

fatigue is caused by such things as forced 

*Corresponding author. E-mail: tyxycx@gmail.com or 

tyxycx@wzu.edu.cn. Tel: +8613868551014. Fax: 

+86057786680835. 

exercise or swimming, while mental fatigue is caused by 

sleep deprivation, etc (Chen et al., 2009). 

There are several theories about the mechanisms of 

physical fatigue: ‘‘exhaustion theory”, ‘‘clogging theory”, 

‘‘radical theory”, ‘‘homeostasis disturbance theory”, 

‘‘protective inhibition theory” and ‘‘mutation theory” (Wang 

et al., 2008; You et al., 2011). The ‘‘radical theory” 

suggests that intense exercise can produce an imbalance 

between the body’s oxidation system and its anti-oxidation 

system. The accumulation of reactive free radicals will put 

the body in a state of oxidative stress and bring injury to 

the body by attacking large molecules and cell organs 

(Wang et al., 2008). Muscle cells contain several anti- 

oxidant defense mechanisms to protect themselves from 

free radical injury, including endogenous antioxidants and 

antioxidant enzymes. Moreover, many studies have 

indicated that exogenous dietary antioxidants can 

decrease the contribution of exercise-induced oxidative 

stress and improve the animal’s physiological condition. 

The reason may be that exogenous antioxidants can 

promote or interact with endogenous antioxidants to form 

a cooperative network of cellular antioxidants 

(Morillas-Ruiz et al., 2006; Mizuno et al., 2008; Muñoz et 

al., 2010). Reports from recent studies demonstrated that 

a large number of traditional Chinese herbs have been 

found to act as antioxidants by scavenging free


radicals/reactive oxygen species (ROS) and some of them 

have anti-fatigue activity (Yang et al., 2000; Morihara et al., 

2006; Yu et al., 2010). In traditional Chinese medicine, 

Wu-Wei-Zi has been widely used for the treatment of 

chronic fatigue (Saito et al., 1974). However, this has not 

been validated by scientific approach. Therefore, the 

present study was designed to determine the radical 

scavenging properties of WAE and Further the anti-fatigue 

activity of WAE was investigated through forced swimming 

exercise of mice. 


Plant materials 

Wu-Wei-Zi was purchased from Dongfeng Medicinal Materials 

Factory, Wenzhou, China and judged by Chinese Traditional 

Medicine Research Institute in Zhejiang and fitted for Chinese 

Pharmacopoeia. The voucher specimen (Number: WU-KO 0231) 

was deposited in the Herbarium of Wenzhou University. 

Chemicals and reagents 

Butylated hydroxytoluene (BHT), DPPH and nitro blue tetrazolium 

(NBT) were purchased from Sigma Chemicals Company (St. Louis, 

MO). Methionine was purchased from Sangon Biotech Company 

Limited (Shanghai, China). Riboflavin was purchased from Huamei 

Biochemical Company (Shanghai, China). BUN reagent kit was 

purchased from Biosino Biotechnology and Science Incoporated. 

(Beijing, China). BLA, HG, SOD and GPX reagent kits were 

purchased from Jianchen Biological Engineering Institute (Nanjing, 

China). All other chemicals were of analytical grade and were 

purchased from Zhejiang Chemical Reagent Company Limited 

(Hang Zhou, China). 

Experiment animal 

Male Kunming mice (3 month old, weighing 18 to 22 g) were obtained 

from the Animal Center of the Wenzhou Medical College, Wenzhou, 

China. To avoid possible individual’s differences, only male mice 

were studied in this study. Because male animals have small 

individuals differences and there is no obvious physical 

characteristics when compared with female animals. The study was 

carried out according to the ‘‘Principles of Laboratory Animal Care’’ 

World Health Organization (WHO) (Chronicle, 1985). The mice were 

acclimatized for 1 week before being used for the experiment. Before 

and during the experiment the mice were housed under controlled 

environmental conditions of temperature (22 ± 2°C) and a 12 h light 

and dark cycle and maintained on (unless otherwise stated) standard 

food pellets and tap water ad libitum. 

Preparation of Wu-Wei-Zi aqueous extracts 

WAE was prepared by boiling the dried Wu-Wei-Zi with distilled water 

for 5 h. The extract was filtered, freeze-dried and kept at 4°C. The 

yield of extraction was approximately 11.62% (w/w). The direct 

extract was dissolved in distilled water before being used. 

Superoxide anion radical scavenging assay 

Superoxide anion radical scavenging activity of WAE was 

determined according to the method described by Prasad et al. 

(2010) with slight modifications. Briefly, all solutions were prepared in 

0.2 M phosphate buffer (pH 7.4). The test samples at different 

concentrations (12.5, 25, 37.5 and 50 ug/ml) were mixed with 3 ml of 

reaction buffer solution (pH 7.4) containing 1.3 uM riboflavin, 0.02 M 

methionine and 5.1 uM NBT. The reaction solution was illuminated by 

exposing them to two 30 W fluorescent lamps for 20 min and the 

absorbance was measured at 560 nm. BHT was used as positive 

control. Superoxide anion radical scavenging activity (SRSA) was 

calculated by the following equation: 

1� 

A sample 

SRSA(%) 

� �100 

A 

control 

Where Acontrol and Asample represent the absorbance of blank control 

group and sample group under 560 nm. 

DPPH radical scavenging assay 

DPPH radical scavenging activity of WAE was determined according 

to the method described by Schlesier et al. (2002) with slight 

modifications. Briefly, 0.1 ml of the samples at different concen- 

trations (25, 50, 75 and 100 ug/ml) was mixed with 1 ml of 0.2 mM 

DPPH (dissolved in methanol). The reaction mixture was incubated 

for 20 min at 28°C under dark. The control contained all reagents 

without the sample while methanol was used as blank. The DPPH 

radical scavenging activity was determined by measuring the 

absorbance at 517 nm. BHT was used as positive control. DPPH 

radical scavenging activity (DRSA) was calculated by the following 

equation: 

1� 

A sample 

DRSA(%) 

� �100 

A 

control 

Where Acontrol and Asample represent the absorbance of blank control 

group and sample group under 510 nm. In this study, scavenging 

activity of the sample was expressed as 50% effective concentration 

(EC50), which represented the sample concentration (μg/ml) 

inhibiting 50% of the DPPH radical activity. 

Acute toxicity assay 

Acute toxicity test of WAE was carried out on Kunming mice 

(weighing 18 to 22 g) of the either sex. Animal were randomly divided 

into five equal groups (n = 10) and were orally administered with the 

WAE at 12.5, 25, 50, 100 and 200 g/kg body weight, respectively. 

The following profiles of animals were observed continuously for 2 h 

(Li et al., 2009). Behavioral profile: Alertness, restlessness, irritability 

and fearfulness; Neurological profile: Spontaneous activity, reactivity, 

touch response, pain response and gait; Autonomic profile: 

Defecation and urination. After a period of 24 and 72 h lethality or 

death was observed. 

Anti-fatigue activity assay 

Anti-fatigue activity of WAE was investigated through forced 

swimming exercise of mice. The model was a reliable measure of 

anti-fatigue treatment as established in both laboratory animals and 

humans (Tang et al., 2007; Zhang et al., 2009). WAE was given to 

mice at concentrations of 0, 5, 10 and 20 g/kg body weight, named as 

negative control dose group (CD group), low dose treatment group 

(LD group), middle-dose treatment group (MD group) and

Superoxide anion radical scavenging 

activity 

60 

50 

40 

30 

20 

10 

0 

* 

0 10 20 30 40 50 

* 

Concentration Concentration(ug/ml) (µg/ml) 

Figure 1. Superoxide anion radical scavenging activity of WAE and BHT. 

high-dose treatment group (HD group), respectively. Distilled water 

was given to mice in CD group. Samples were orally administered 

into mice using a feeding atraumatic needle, once per day for 4 

weeks. The doses of these treatments were chosen from literature 

references and pilot studies. After the final treatment with WAE, 

forced swimming exercise of mice was performed in acrylic plastic 

pool (50 × 50 × 40 cm) filled with water (25 ± 2°C) to a depth of 30 cm 

(Matsumoto et al., 1996). 

The mice were loaded with a steel washer weighing approximately 

5% of their body weight attached to the tail, which forced the mice to 

maintain continuous rapid leg movement (Misra et al., 2009). The 

mice were determined to be exhausted when they failed to rise to the 

surface to breathe after 10 s (Jung et al., 2007). This 10 s criterion 

was considered to correlate with exhaustion and was used as an 

indication of the maximum swimming capacity of the animal. Mice 

were removed at this point, before drowning. The exhaustive 

swimming time were observed. After the forced swimming exercise, 

the mice were allowed to rest for 30 min. Then they were 

anesthetized with ether and whole blood samples were collected in 

tubes by heart puncture to determine BLA, BUN, SOD and GPX 

contents using commercial kits. In addition, immediately after the 

blood had been collected, the liver was dissected out quickly from the 

mice, washed with physiological saline and dried with absorbent 

paper. Then the contents of HG were analyzed with commercial kits. 


All experiments were carried out in triplicate and all the data were 

expressed as means ± SD (standard deviation). The significance of 

statistics was evaluated using Student’s t-test and P < 0.05 was 

taken as being significant. 


Superoxide anion radical scavenging activity of WAE 

� 

� 

Among different ROS, 

O 2 is generated first. Although 

O 2 

is a relatively weak oxidant, it may decompose to form 

stronger ROS, such as singlet oxygen and hydroxyl radical 

* 

* 

Xiang and Guohai 5935 

WAE 

BHT 

� 

O 2 is also 

� 

( OH ), which initiates peroxidation of lipids. 

known to initiate indirectly the lipid peroxidation as a result 

� 

of the formation of H2O2, creating precursors of OH 

� 

(Qiao et al., 2009). Therefore, 

O2 scavenging is extremely 

important to antioxidant work. Superoxide anion radical 

scavenging activity of WAE was presented in Figure 1. In 

this study, WAE exhibited an excellent superoxide anion 

scavenging activity, and the scavenging effects of WAE 

were significant stronger than that of BHT (P < 0.05). The 

maximum DPPH radical scavenging activity of WAE was 

46.67±1.53%. 

DPPH radical scavenging activity of WAE 

DPPH free radical is a stable free radical, which has been 

widely accepted as a tool for estimating the free-radical 

scavenging activities of antioxidants (Hu et al., 2004). 

DPPH radical scavenging activity of WAE was presented 

in Figure 2, the EC50 of WAE and BHT were 21.29 and 

23.23 ug/ml, respectively. In this study, WAE showed 

moderate DPPH radical scavenging activity. The 

maximum DPPH radical scavenging activity of WAE was 

88.13±2.97%. Compared with the BHT, WAE performed 

higher activity on DPPH. In humans, muscular exercise 

promotes the production of ROS in the working muscle. 

Growing evidence indicates that ROS are responsible for 

exercise-induced protein oxidation and contribute highly to 

physical fatigue (Tharakan et al., 2005). Thus, treatments 

that reverse muscle fatigue may be acting through 

mechanisms that scavenge ROS. The present study 

established that WAE possessed superoxide anion and 

DPPH radical scavenging activity, which suggested that 

WAE may be beneficial to the alleviation of physical 

fatigue, so the WAE was used for the in vivo experiment in


DPPH radical scavenging activity (%) 

100 

80 

60 

40 

20 

0 

0 20 40 60 80 100 

Concentration Concentration(ug/ml) (µg/ml) 

Figure 2. DPPH radical scavenging activity of WAE and BHT. 

Exhaustive swimming time (min) 

20 

15 

10 

5 

0 

* 

CD LD MD HD 

Groups 

Figure 3. Effect of WAE on the exhaustive swimming time of mice. 

mice to estimate the anti-fatigue activity. 

Acute toxicity test 

Acute toxicity test revealed the non-toxic nature of the 

WAE. There was no lethality or any toxic reactions found 

at any of the doses selected until the end of the study 

period. 

* 

* 

WAE 

BHT 

Effect of WAE on the exhaustive swimming time of 

mice 

Swimming to exhaustion is an experimental exercise 

model to evaluate anti-fatigue activity; it works well for 

evaluating the endurance capacity of mice and gives a 

high reproducibility (Zhang et al., 2006; Yao and Li, 2010; 

You et al., 2011). Effects of WAE on the exhaustive 

swimming time of mice were presented in Figure 3. There

16 

14 

12 

10 

8 

6 

4 

2 

0 

Blood lactic acid(mmol/l) Blood urea nitrogen(mmol/l) 

* 

* 

* 

* * * 

CD LD MD HD 

Groups 

Figure 4. Effect of WAE on the blood lactic acid and blood urea nitrogen contents of mice. 

are significant differences in the exhaustive swimming 

time between the negative control group and each 

treatment group. The swimming time to exhaustion of the 

CD, LD, MD and HD groups were 7.4 ± 0.8, 11.7 ± 1.1, 

14.9 ± 1.0 and 16.8 ± 1.4 min, respectively. Thus, the 

exhaustive swimming time of the LD, MD and HD groups 

were significantly longer than that of the CD group (P < 

0.05). This result suggested that WAE had significant 

anti-fatigue activity. Fatigue is one of the most frequent 

physiological reactions. It often occurred in aging, cancer, 

depression, Human immunodeficiency virus (HIV) 

infection, multiple sclerosis and Parkinson’s disease 

(Tharakan et al., 2006). However, there were very few 

pharmacological drugs or therapies available for the 

treatment of fatigue (Uthayathas et al., 2007). Natural 

products not only could improve athletic ability, postpone 

fatigue and accelerate the elimination of fatigue in human 

beings, but also had few side effects (Kim et al., 2001). 

Data from previous investigations indicated that some 

traditional Chinese herbs extracts have anti-fatigue activity, 

including Radix Rehmanniae Preparata (Tan et al., 2011), 

Ganoderma lucidum (Guo et al., 2011), Cordyceps 

sinensis (Kumar et al., 2011), Acanthopanax senticosus 

(Zhang et al., 2010; Huang et al., 2011), Ginseng (Wang et 

al., 1983; Zhao et al., 2009; Wang et al., 2010), Eucommia 

(Deyama et al., 2001), Rhodiola rosea (Panossian et al., 

2007; Olsson et al., 2009), Cynomorium songaricum (Yu et 

al., 2010), Morinda officinalis (Zhang et al., 2009), etc. In 

the present study, it has also been shown that WAE 

enhanced the swimming capacity by lessening of fatigue in 

mice. To explore the mechanism of anti-fatigue activity, 

some biochemical parameters such as BLA, BUN, HG, 

SOD and GPX contents in the mice were determined after 

they have swam for 30 min. 


Effect of WAE on the BLA and BUN contents of mice 

BLA and BUN are important blood biochemical parameters 

related to fatigue (Xu and Luo, 2001). BLA is the glycolysis 

product of carbohydrate under an anaerobic condition and 

glycolysis is the main energy source for intense exercise in 

a short time (Ding et al., 2011). According to the study of 

Wilber (1959), violent swimming to exhaustion results in a 

significantly elevated BLA contents and the rate at which 

BLA accumulates in the blood showed an inverse relation 

to swimming time. Therefore, blood lactate acid represents 

the degree of fatigue after exercise and the condition of 

recovery (Wang et al., 2006). As shown in Figure 4, the 

BLA contents in the CD, LD, MD and HD groups were 

12.48 ± 0.86, 10.13 ± 0.79, 9.47 ± 0.96 and 8.56 ± 0.84 

mmol/l, respectively. Thus, the BLA contents in all treat- 

ment groups (LD, MD and HD groups) were lower than 

that in the CD group (P


Hepatic glycogen (mg/g) 

25 

20 

15 

10 

5 

0 

* 

CD LD MD HD 

Figure 5. Effect of WAE on the hepatic glycogen contents of mice. 

of protein for energy. 

Effect of WAE on the hepatic glycogen contents of 

mice 

The liver converts lactate back to glycogen and releases 

glycogen into the blood. Energy for exercise is derived 

initially from the breakdown of glycogen and later from 

circulation glycogen released by the liver and from 

non-esterified fatty acids (Dorchy, 2002). So increasing the 

HG storage conduces to enhancing the endurance 

capacity and locomotory capacity (Tang et al., 2008). HG 

is a sensitive parameters related to fatigue. Effects of WAE 

on the HG contents of mice were presented in Figure 5. 

There are significant differences in the HG contents 

between the negative control group and each treatment 

group. The HG contents of the CD, LD, MD and HD groups 

were 7.35 ± 1.21, 10.48 ±2.17, 15.69±3.19 and 

16.74±2.82 mg/g, respectively. Thus, the HG contents of 

the LD, MD and HD groups were significantly higher than 

that of the CD group (P < 0.05). This result suggests that 

the anti-fatigue activity of WAE may be related to the 

improvement in the metabolic control of exercise and the 

activation of energy metabolism (Wang et al., 2006). 

Effect of WAE on the SOD and GPX contents of mice 

It has been demonstrated that ROS are responsible for 

exercise-induced protein oxidation and contribute strongly 

Groups 

* 

to muscle fatigue (You et al., 2009). To protect against 

exercise-induced oxidative injury, muscle cells contain 

complex endogenous cellular defense mechanisms 

(enzymatic and non-enzymatic antioxidants) to eliminate 

ROS (Powers et al., 2004). Antioxidant agents such as 

reduced glutathione (GSH), vitamin C, E and enzymes 

such as SOD, catalase (CAT) and GPX, are important 

factors (Hassan and Schellhorn, 1988). SOD reduces 

superoxide to hydrogen peroxide; and GPX reduces 

hydrogen peroxide from the SOD reaction to water. In 

addition, GPX can reduce lipid peroxides directly (Finaud 

et al., 2006). Growing evidence indicates that the 

improvement in the activities of antioxidant enzymes can 

help to fight against fatigue (You et al., 2011). As shown in 

Figure 6, the SOD contents of the CD, LD, MD and HD 

groups were 96.54 ± 7.84, 146.81 ± 8.93, 163.48 ± 11.26 

and 171.29 ± 13.21 U/mg.pro, respectively. And the GPX 

contents of the CD, LD, MD, and HD groups were 4.68 ± 

0.94, 8.37 ± 1.23, 10.45 ± 1.17 and 12.67 ± 1.36 U/mg.pro, 

respectively. Thus, SOD and GPX contents of the LD, MD 

and HD groups were significantly higher than that of the 

CD group (P < 0.05). This result suggests that WAE can 

promote increase in the activities of these antioxidant 

enzymes and again supporting that WAE has anti-fatigue 

activity. 

Conclusions 

WAE had strong scavenging activity to superoxide anion 

and DPPH radical. And it had significant anti-fatigue 

*

200 

180 

160 

140 

120 

100 

80 

60 

40 

20 

0 

SOD(U/mg.pro) GPX(U/mg.pro) 

* 

* 

CD LD MD HD 

Groups 

Figure 6. Effect of WAE on the superoxide dismutase and glutathione peroxidase contents of mice. 

activity, which could not only extend the swimming time of 

the mice, increase the hepatic glycogen and antioxidant 

enzymes (SOD and GPX) contents, but also decrease the 

BLA and BUN contents. However, further research needs 

to be carried out to evaluate its antioxidant and anti-fatigue 

activity at cellular and molecular levels. 

REFERENCES 

Chen JR, Wang TJ, Huang HY, Chen LJ, Huang YS, Wang YJ, Tseng GF 

(2009). Fatigue reversibly reduced cortical and hippocampal dendritic 

spines concurrent with compromise of motor endurance and spatial 

memory. Neuroscience, 161(4):1104-1113. 

Deyama T, Nishibe S, Nakazawa Y (2001). Constituents and 

pharmacological effects of Eucommia and Siberian ginseng. Acta 

Pharmacol. Sin., 22(12):1057-1070. 

Ding JF, Li YY, Xu JJ, Su XR, GaoX, Yue FP (2011). Study on effect of 

jellyfish collagen hydrolysate on anti-fatigue and anti-oxidation. Food 

Hydrocol., 25: 1350-1353. 

Dorchy H (2002). Sports and type I diabetes: personal experience. Rev 

Med. Brux., 23(4):A211-217. 

Finaud J, Lac G, Filaire E (2006). Oxidative stress: Relationship with 

exercise and training. Sport. Med., 36: 327–358. 

Gao JP, Yu YQ, Chen DF (2003). Determination of lignans of Schisandra 

rubriflora by HPLC. Chin. Tradit. Herbal Drug., 34: 950-951. 

Guo Y, Luo X, Yu M, Zheng L (2011). Active ingredients and efficacies of 

Ganoderma lucidum cultivated on non-medicinal parts of Chinese 

medicinal herbs. Wei Sheng Wu Xue Bao, 51(6):764-768 

Hassan HM, Schellhorn HE (1988). Superoxide dismutase an antioxidant 

defense enzyme. In: Cerruti PA, Fridovich I, McCord JM (eds). 

Oxyradicals in Molecular Biology and Pathology. Alan R. Liss Inc, New 

York, pp. 183–93. 

Hu F, Lu R, Huang B, Liang M (2004). Free radical scavenging activity of 

extracts prepared from fresh leaves of selected Chinesemedicinal 

plants. Fitoterapia, 75(1):14-23. 

Huang LZ, Huang BK, Ye Q, Qin LP (2011). Bioactivity-guided 

fractionation for anti-fatigue property of Acanthopanax senticosus. J. 

Ethnopharmacol., 133(1):213-219. 

* 

* 


Huang T, Shen P, Shen Y (2005). Preparative separation and purification 

of deoxyschisandrin and gamma-schisandrin from Schisandra 

chinensis (Turcz.) Baill by high-speed counter-current chromatography. 

J. Chromatogr A., 1066(1-2): 239-242. 

Jung KA, Han D, Kwon EK, Lee CH, Kim YE (2007). Antifatigue effect of 

Rubus coreanus Miquel extract in mice. J. Med. Food, 10(4):689-693. 

Kim KM, Yu KW, Kang DH, Koh JH, Hong BS, Suh HJ (2001). Anti-stress 

and anti-fatigue effects of fermented rice bran. Biosci Biotechnol 

Biochem., 65(10):2294-2296. 

Kim MG, Lee CH, Lee HS (2010). Anti-platelet Aggregation Activity of 

Lignans Isolated from Schisandra chinensis Fruits. J. Korean Soc. 

Appl. Biol. Chem., 53(6): 740-745. 

Kumar R, Negi PS, Singh B, Ilavazhagan G, Bhargava K, Sethy NK 

(2011). Cordyceps sinensis promotes exercise endurance capacity of 

rats by activating skeletal muscle metabolic regulators. .J 

Ethnopharmacol., 136(1):260-266. 

Li F, Li Q, Gao D, Peng Y (2009). The optimal extraction parameters and 

anti-diabetic activity of flavonoids from Ipomoea batatas leaf. Afr J 

Tradit. Complement. Altern. Med., 6(2):195-202. 

Ma DY, Liu YQ, Liu SW, Li QD, Shan AS (2007). Influence of Ligustrum 

lucidum and Schisandra chinensis Fruits on Antioxidative Metabolism 

and Immunological Parameters of Layer Chicks. Asian-Aust. J. Anim. 

Sci., 20(9): 1438-1443. 

Mach J, Midgley AW, Dank S, Grant RS, Bentley DJ (2010). The Effect of 

Antioxidant Supplementation on Fatigue during Exercise: Potential 

Role for NAD+(H). Nutrients, 2: 319-329. 

Misra DS, Maiti R, Ghosh D (2009). Protection of swimming-induced 

oxidative stress in some vital organs by the treatment of composite 

extract of Withania somnifera, Ocimum sanctum and Zingiber 

officinalis in malerat. Afr. J. Tradit. Complement. Altern. Med., 

6(4):534-543. 

Morihara N, Ushijima M, Kashimoto N, Sumioka I, Nishihama T, Hayama 

M, Takeda H (2006). Aged garlic extract ameliorates physical fatigue. 

Biol. Pharm. Bull., 29(5):962-966. 

Morillas-Ruiz JM, Villegas García JA, López FJ, Vidal-Guevara ML, 

Zafrilla P (2006). Effects of polyphenolic antioxidants on 

exercise-induced oxidative stress. Clin. Nutr., 25(3):444-453. 

Muñoz ME, Galan AI, Palacios E, Diez MA, Muguerza B, Cobaleda C, 

Calvo JI, Aruoma OI, Sanchez-Garcia I, Jimenez R (2010). Effect of an 

antioxidant functional food beverage on exercise-induced oxidative 

stress: a long-term and large-scale clinical intervention study. 

* 

*


Toxicology, 278(1):101-111. 

Olsson EM, von Schéele B, Panossian AG (2009). A randomised, 

double-blind, placebo-controlled, parallel-group study of the 

standardised extract shr-5 of the roots of Rhodiola rosea in the 

treatment of subjects with stress-related fatigue. Planta Med., 

75(2):105-112. 

Panossian A, Hambardzumyan M, Hovhanissyan A, Wikman G (2007). 

The adaptogens rhodiola and schizandra modify the response to 

immobilization stress in rabbits by suppressing the increase of 

phosphorylated stress-activated protein kinase, nitric oxide and 

cortisol. Drug Target Insights, 2:39-54. 

Powers SK, DeRuisseau KC, Quindry J, Hamilton KL (2004). Dietary 

antioxidants and exercise. J. Sports Sci., 22(1):81-94. 

Prasad KN, Xie HH, Hao J, Yang B, Qiu SX, Wei XY (2010). Antioxidant 

and anticancer activities of 8-hydroxypsoralen isolated from wampee 

[Clausena lansium (Lour.) Skeels] peel. Food Chem. Qiao D, Ke C, Hu 

B, Luo JG, Ye H, Sun Y, Yan XY, Zeng XX (2009). Antioxidant activities 

of polysaccharides from Hyriopsis cumingii. Carbohyd. Polym., 78: 

199–204. 

Schlesier K, Harwat M, Böhm V, Bitsch R (2002). Assessment of 

antioxidant activity by using different in vitro methods. Free Radic. 

Res., 36(2): 177-87. 

Siwicki AK, Skopińska-Różewska E, Nartowska J, Małaczewska J, 

Wojcik R, Sommer E, Trapkowska S, Filewska M, Skurzak H (2004). 

Effect of Immunostim plus – a standardized fixed combination of 

Schizandra chinensis with Eleutherococcus senticosus extracts on 

granulocyte activity and tumor angiogenesis in mice. Bull. Vet. Inst. 

Pulawy., 48: 489-492. 

Tan W, Yu KQ, Liu YY, Ouyang MZ, Yan MH, Luo R, Zhao XS (2011). 

Anti-fatigue activity of polysaccharides extract from Radix 

Rehmanniae Preparata. Int. J. Biol. Macromol., Epub ahead of prin. 

Tang J, Hu ZY, Chen XW (2007). Free radical scavenging and antioxidant 

enzymes activation of polysaccharide extract from Nostoc 

sphaeroides. Am. J. Chin. Med., 5(5):887-896. 

Tang W, Zhang Y, Gao J, Ding X, Gao S (2008). The anti-fatigue effect of 

20(R)-ginsenoside Rg3 in mice by intranasally administratio. Biol. 

Pharm. Bull., 31(11):2024-2027. 

Tharakan B, Dhanasekaran M, Brown-Borg HM, Manyam BV (2006). 

Trichopus zeylanicus combats fatigue without amphetamine-mimetic 

activity. Phytother. Res., 20(3):165-168. 

Tharakan B, Dhanasekaran M, Manyam BV (2005). Antioxidant and DNA 

protecting properties of anti-fatigue herb Trichopus zeylanicus. 

Phytother Res., 19: 669-673. 

Uthayathas S, Karuppagounder SS, Tamer SI, Parameshwaran K, Degim 

T, Suppiramaniam V, Dhanasekaran M (2007). Evaluation of 

neuroprotective and anti-fatigue effects of sildenafil. Life Sci., 

81(12):988-992. 

Wang BX, Cui JC, Liu AJ, Wu SK (1983). Studies on the anti-fatigue 

effect of the saponins of stems and leaves of panax ginseng (SSLG). J. 

Tradit. Chin. Med., 3(2):89-94. 

Wang J, Li S, Fan Y, Chen Y, Liu D, Cheng H, Gao X, Zhou Y (2010). 

Anti-fatigue activity of the water-soluble polysaccharides isolated from 

Panax ginseng C. A. Meyer. J. Ethnopharmacol., 130(2):421-423 

Wang JJ, Shieh MJ, Kuo SL, Lee CL, Pan TM (2006). Effect of red mold 

rice on antifatigue and exercise-related changes in lipid peroxidation in 

endurance exercise. Appl. Microbiol. Biotechnol., 70(2):247-253. 

Wang L, Zhang HL, Lu R, Zhou YJ, Ma R, Lv JQ, Li XL, Chen LJ, Yao Z 

(2008). The decapeptide CMS001 enhances swimming endurance in 

mice. Peptides, 29(7):1176-1182. 

Wilber CG (1959). Some factors which are correlated with swimming 

capacity in guinea pigs. J. Appl. Physiol., 14(2):199-203. 

Wu IT (1999). The effects of serum biochemical value with different 

beverage to replenish and intermittent exercise in high intensity. Tahan 

Jr. College Engr. Business J., 13: 387-400. 

Xu GD, Luo QM (2001). A study on the relationship between blood acid 

lactate in motion and hemoglobin saturation density-a new 

hemoglobinmetry. Wuhan Ti Yu Xue Yuan Xue Bao., 35(3): 40–42. 

Xu M, Wang G, Xie H, Huang Q, Wang W, Jia Y (2008). Pharmacokinetic 

comparisons of schizandrin after oral administration of schizandrin 

monomer, Fructus Schisandrae aqueous extract and Sheng-Mai-San 

to rats. J. Ethnopharmacol., 115(3): 483-488. 

Yang QS, Zhao HL, Chen L (2000). Studies on senility retarding effect of 

qiangshengye liquid. Zhongguo Zhong Yao Za Zhi. 25(6):367-369. 

Yao LQ, Li FL (2010). Lycium barbarum polysaccharides ameliorates 

physical fatigue. Afr. J. Agric. Res., 5: 2153–2157. 

You LJ, Zhao MM, Regenstein JM, Ren JY (2011). In vitro antioxidant 

activity and in vivo anti-fatigue effect of loach (Misgurnus 

anguillicaudatus) peptides prepared by papain digestion. Food Chem., 

124: 188–194. 

You Y, Park J, Yoon HG, Lee YH, Hwang K, Lee J, Kim K, Lee KW, Shim 

S, Jun W (2009). Stimulatory effects of ferulic acid on endurance 

exercise capacity in mice. Biosci. Biotechnol. Biochem., 

73(6):1392-1397. 

Yu FR, Liu Y, Cui YZ, Chan EQ, Xie MR, McGuire PP, Yu FH (2010). 

Effects of a flavonoid extract from Cynomorium songaricum on the 

swimming endurance of rats. Am. J. Chin. Med., 38(1): 65-73. 

Zhang HL, Li J, Li G, Wang DM, Zhu LP, Yang DP (2009). Structural 

characterization and anti-fatigue activity of polysaccharides from the 

roots of Morinda officinalis. Int J Biol Macromol., 44(3): 257-261. 

Zhang XL, Ren F, Huang W, Ding RT, Zhou QS, Liu XW (2010). 

Anti-fatigue activity of extracts of stem bark from Acanthopanax 

senticosus. Molecules, 16(1):28-37. 

Zhang Y, Yao X, Bao B, Zhang Y (2006). Anti-fatigue activity of a 

triterpenoid-rich extract from Chinese bamboo shavings 

(Caulisbamfusae in taeniam). Phytother. Res., 20(10): 872-876. 

Zhao W, Zhang X, Wang W, Zhang L (2009). Experimental study for the 

anti-fatigue effect of ginseng general ginsenosides P.E. in vivo. Wei 

Sheng Yan Jiu., 38(2):184-187.




DOI: 10.5897/AJMR11.995 


Proteomic analysis of differentially expressed proteins 

in intestinal epithelial cell in response to Enteroinvasive 

Escherichia coli infection and Lactobacillus plantarun 

treatment 

Zhongwei Zhang and Minghua Mao* 

Department of Geriatrics, The 6th People’s Hospital Affiliated to Shanghai Jiaotong University, Shanghai 200233, China. 


A proteomic approach was taken to compare the proteomes of Enteroinvasive Escherichia coli (EIEC) 

infection alone, Lactobacillus plantarun pre-treatment and control group. Two-dimensional gel 

electrophoresis (2-DE), coupled with mass spectroscopy and protein database searching, 8 

differentially expressed proteins was identified. Of them, Glutathione Transferase (down-regulated), 

Peroxisomal enoyl-coenzyme (up-regulated) and Peroxiredoxin (up-regulated) in EIEC infection group 

were compared with control group which are all associated with antioxidant-related proteins. 

Glyceraldehyde-3-phosphate dehydrogenase (up-regulated) and Triosephosphate Isomerase (upregulated) 

were identified related with carbohydrate metabolism in EIEC infection group compared with 

control group. Keratin 8 (up-regulated) and hnRNP C1/C2 (down-regulated) were linked to antagonize 

cytoskeleton reorganization and apoptosis in L. plantarun pre-treatment group. Identification of these 

proteins provides insights that may lead to a better understanding of the molecular basis for EIEC 

infection process and L. plantarun protection function. 

Key words: Lactobacillus plantarun, Enteroinvasive Escherichia coli, tight junction. 

INTRODUCTION 

Enteroinvasive Escherichia coli (EIEC) is a human 

intestinal pathogen responsible for the majority of cases 

of endemic bacillary dysentery prevalent in developing 

country (Song et al., 2005). The underlying pathogenesis 

is proposed as follows (Parsot, 2005; Croxen and Finlay, 

2009). In the colonic mucosa, bacteria are supposed to 

cross the epithelial layer by invading M cells overlaying 

lymphoid follicles. Entry into epithelial cells involves 

rearrangements of the cell cytoskeleton (Cossart and 

Sansonetti, 2004). Bacteria released from M cells or 

*Corresponding author. E-mail:maominghuamnh@gmail.com. 

Tel: +86-021-64369181. Fax: +86-021-64701361. 

Abbreviations: EIEC, enteroinvasive Escherichia coli; EPEC, 

enteropathogenic Escherichia coli. 

epithelial cells interact with macrophages, escape from 

the phagocytic vacuole and induce apoptosis of infected 

cells. Apoptotic macrophages release pro-inflammatory 

cytokines facilitates further invasion by luminal bacteria 

(Steiner et al., 2000; Lahouassa et al., 2007). Recently, 

there are also evident that probiotic bacteria protect and 

enhance human intestinal epithelial barrier function. For 

example, enteropathogenic E. coli (EPEC)-induced 

neutrophil migration and EPEC binding to monolayers 

were inhibited by viable Lactobacillus plantarum but only 

when added to the monolayers before EPEC (Michail and 

Abernathy, 2003). 

Identically, live Streptococcus thermophilus 

(ST)/Lactobacillus acidophilus (LA) interact with intestinal 

epithelial cells to protect them from the deleterious effect 

of EIEC via mechanisms that include interference with 

pathogen adhesion and invasion (Resta-Lenert and 

Barrett, 2003; Resta-Lenert and Barrett, 2006). In


addition, L. plantarum have also been demonstrated 

reduce EIEC adhesion to Caco-2 by reducing intestinal 

permeability and increasing tight junction proteins (such 

as ZO-1, occludin and claudin-1 protein) in our previous 

reports (Qin et al., 2009). However, the detail mechanism 

was not very clear. Therefore, it is valuable to explore the 

regulation mechanism between L. plantarun, EIEC and 

intestinal epidermal-barrier function. In this study, we 

have, for the first time, taken a proteomic approach to 

identify differential proteins in EIEC infection alone, L. 

plantarun pre-treatment and control group. We anticipate 

these proteins may provide initial insights into the role of 

EIEC infection process and L. plantarun protection 

function. 


Preparation of bacteria 

L. plantarum strain CGMCC No.1258 collected from Institute of 

Science Life of Onlly, Shanghai Jiao Tong University, Shanghai, 

China, a gift from Dr. Hang Xiaomin (Institute of Science Life of 

Onlly, Shanghai Jiao Tong University, Shanghai, China) was 

maintained on MRS agar (Difco Laboratories, Detroit, MI, U.S.A.). 

Enteroinvasive Escherichia coli EIEC strain 0124:NM (ATCC 43893, 

serotype O124:NM) was obtained from the Center of Diseases 

Prevention and Control of Shanghai, China and maintained in LB 

medium (Difco Laboratories, Detroit, MI, U.S.A). They were 

cultivated at 37°C for 16 h to reach stationary phase. The L. 

plantarun and EIEC suspensions were centrifuged for 5 min at 1500 

× g. After removing the supernatant, the pellet was re-suspended in 

sterile PBS buffer to determine the bacterial concentration. 

Quantification of bacterial suspension was determined using a 

standard curve for visible absorbance (600 nm; Beckman DU-50 

spectrophotometer) and adjusted the final concentration to 1 × 

10 8 /ml. 

Preparation of monolayer 

DMEM supplemented with 10% fetal bovine serum, 1 × 10 5 U/L of 

penicillin and 100 mg/L streptomycin was used as a standard 

medium to cultivate Caco-2 cells (human colonic epithelial-like 

cancer cell line obtained from the Cell Institute Affiliated China 

Science Research Institute, Shanghai, China). When cell growing to 

80 to 90% fusion cells under 5% CO2 saturated humidity and 37°C 

conditions, 0.25% pancreatic enzyme with 0.03% EDTA was 

performed to digest cells to subculture (1:3). Then, the cells were 

inoculated to glass slide in six-well culture plate (gelatin treatment) 

and cell concentration was 5 × 104 cells/cm 2 . After 7 to 10 days, 

monolayer cells were collected and used in later experiment. 

Infection of intestinal epithelial monolayer 

Caco-2 cells were washed three times in Hank's balanced salt 

solution (Life Technologies) to remove the antibiotic media. For 

rapid infection of the monolayer, 100 μl EIEC at 1.0 × 10 8 /ml was 

added to the apical side of the cell culture insert, and the insert was 

placed in a 50 ml tube and centrifuged at 200 g for 4 min. L. 

plantarum (100 μl of 1.0 × 10 8 /ml) was added to the monolayers in 

different groups for 24 h. Caco-2 cells monolayers were cultured 

and served as the control group, Caco-2 cells were infected EIEC 

as the EIEC group, Caco-2 cells infected EIEC were co-incultured 

with L. plantarum as the L. plantarum group. The average number 

of Caco-2 cells in each monolayer was approximately 1 × 10 6 . The 

inoculation ratio of EIEC to Caco-2 cells was 100:1. The ratio of 

lactobacillus to EIEC was 10:1. 

Protein sample preparation 

The Caco-2 cells monolayer cells in each group were harvested by 

centrifugation, rinsed in phosphate-buffered saline and resuspended 

in 300 µl lysis buffer (9.5 M urea, 4% CHAPS, 65 mM 

DTT, 2% carrier ampholyte and protease inhibitor cocktail). Then, 

the Caco-2 cells were removed from the surface with a cell scraper 

and collected to a 1.5 Eppendorf tube. The crude extract solution 

was obtained by ultrasonic disruption (80 W, 2 min, with a 15 s 

interval every 10 s) and centrifugation (14000 rpm, 60 min). The 

resulting supernatant was concentrated on Biomax-5 K ultrafiltration 

membrane. The protein concentration was determined by a 

standard Bradford protein assay and stored at -80°C until use for 2- 

DE analysis. 

Gel electrophoresis and analysis 

First-dimensional electrophoresis was carried out using an IPGphor 

II (Amersham Biosciences) isoelectric focusing system. 100 g of 

total extract were loaded. IPG dry strips (pH 3-10, linear) were 

rehydrated at 30 V for 12 h. After rehydration, isoelectric focusing 

was performed under the following conditions: 500 V for 1 h, 1000 

V for 1 h, 8000 V for 6 h and 500 V for 4 h. After equilibration of the 

isoelectric focusing strips, SDS electrophoresis was performed on 

12.5% gels. SDS-PAGE was performed using a Hofer SE 600 

System (Amersham Biosciences): 15 mA for 30 min and 30 mA 

until the Bromophenol Blue front reached 0.5 cm of the gel. After 

two-dimensional gel electrophoresis, proteins were stained with 

silver for subsequent mass spectrometry. To ensure data reliability, 

sample preparation and 2-DE were performed in triplicate. Silverstained 

gels were scanned with Bio-Rad GS710 scanner. Images 

were analyzed using the specialized software program Image 

Master 2D Elite software (Amersham Biosciences). 

MALDI-TOF mass spectrometry and protein identification 

Proteins of interest were excised and digested in gel using trypsin 

for 20 h (sequencing grade, Promega, Charbonnie`res, France). 

Digest products were completely dehydrated in a vacuum 

centrifuge and resuspended in 10 ul of formic acid (2%), desalted 

using Zip Tips C18 (Millipore, Bedford, MA), eluted with acidαcyano-4-hydroxy-trans-cinnamic 

acid (Sigma, 5 mg/ml in 0.1% TFA) 

and loaded on the target of a Bruker-Daltonics AutoFlex TOF−TOF 

LIFT mass spectrometer (Bruker Daltonics, Bremen, Germany). 

Analysis was performed in reflectron mode with an accelerating 

voltage of 20 kV. Identification of proteins was performed using 

both Mascot and PeptIdent software (available at 

www.matrixscience.com and www.expasy.org/tools/peptident.html, 

respectively). Search parameters were as follows: database: 

NCBInr (release date: 20070326); taxonomy: homo sapiens 

(human); type of search: peptide mass fingerprint; enzyme: trypsin; 

fixed modifications: carbamidomethyl (C); mass values: 

monoisotopic; protein mass: unrestricted; peptide mass tolerance: ± 

100 ppm; peptide charge state: 1+; and max missed cleavages: 1. 

Statistics analysis 

All data were analyzed by SPSS13.0 and the results were

Table 1. Differentially expressed proteins between EIEC and normal group. 

Zhongwei and Minghua 5943 

Group ID Normal group EIEC infection group Group ID Normal group EIEC infection group 

3780 -6.46544 6.46544 4399 1.94149 -1.94149 

4075 -3.90939 3.90939 3676 -1.93011 1.93011 

3959 -3.35281 3.35281 4388 1.87136 -1.87136 

3969 -3.03349 3.03349 4118 -1.75635 1.75635 

4364 3.00393 -3.00393 4448 1.74678 -1.74678 

3863 -2.66937 2.66937 4106 -1.74489 1.74489 

3792 -2.48479 2.48479 3096 -1.6833 1.6833 

4435 2.46231 -2.46231 3410 -1.6324 1.6324 

4241 2.37954 -2.37954 3368 1.6012 -1.6012 

4445 2.30779 -2.30779 3392 1.56976 -1.56976 

4250 -2.30228 2.30228 3777 -1.56414 1.56414 

4110 -2.27937 2.27937 3597 -1.56405 1.56405 

4070 2.19601 -2.19601 3380 -1.51271 1.51271 

3299 -2.05878 2.05878 4050 -1.51244 1.51244 

4337 1.96883 -1.96883 2930 -1.50543 1.50543 

measured by average ± standard deviation. One-way ANOVA was 

performed on all experiments with Tukey Kramer post-hoc 

comparison. P < 0.05 was considered as statistically significant. 

RESULTS 

Differentially expressed proteins analysis 

The differentially expressed proteins between different 

groups were analyzed based on image master software 

(class report ratio > = 1.5). The results showed that there 

were 30 spots identified as differentially expressed 

between normal group and EIEC group. Of this, 19 genes 

were up-regulated and 11 genes were down-regulated 

expression compared with normal group (Table 1, Figures 

1 and 2). When comparison betweennormal group and L. 

plantarum group, the results indicated 25 differentially 

expressed proteins (14 genes up-regulated and 11 genes 

down-regulated) (Table 2, Figures 3 and 4). 15 

differentially expressed proteins were identified between 

L. plantarum group and EIEC group. Among them, 5 

genes were down-regulated expression, and 10 genes 

were up-regulated expression compared with EIEC group 

(Table 3, Figures 5 and 6). 

MALDI-TOF mass spectrometry and protein 

identification 

Total of 16 differentially expressed proteins were excised 

from 2-DE gels, in-gel digested by trypsin and subjected 

to MALDI-TOF-TOF/MS analysis. Of them, 8 differentially 

expressed proteins have been identified by NCBInr 

database searching (Table 4). 

DISCUSSION 

In this study, we have used 2-DE and MS to establish the 

proteomic profiles of intestinal epithelial cell in response 

to EIEC infection and L. plantarun pre-treatment. 2-DE 

was employed as it permits the identification of the 

alteration of protein isoforms and determination of protein 

expression levels and post translational modifications. 

The 2-DE gel in each group was analyzed to screen 

differentially expressed proteins by Image Master 2D Elite 

software. Based on this analysis, 16 significantly 

differential proteins was chosen to identify by MALDI- 

TOF-TOF/MS, of them, 8 differentially expressed proteins 

have been identified by NCBInr database searching. 

Literature searches were conducted for all the proteins 

identified in the up- and down-expressed lists to find 

possible links of the change in expression and their 

implications in intestinal epithelial cell in general. Most 

proteins identified show homology with antioxidantrelated 

proteins, such as glutathione transferase, 

peroxisomal enoyl-coenzyme A hydratase-like protein 

and peroxiredoxin. Glutathione-S-transferases (GSTs) 

are a family of Phase II detoxification enzymes that 

catalyse the conjugation of glutathione (GSH) to a wide 

variety of endogenous and exogenous electrophilic 

compounds (Townsend and Tew, 2003; Wu et al., 2004). 

GST was down-regulated expression in EIEC group, 

indicating decrease in detoxification function. This result 

led to EIEC invasion and damage intestinal epithelial cell. 

Peroxiredoxin 1 (PRDX1) is a ubiquitously expressed 

antioxidant with vital roles in basal metabolic functions. In 

addition, PRDX1 is involved in cell differentiation and 

proliferation, apoptosis and innate immunity (Daly et al., 

2008). In addition, glyceraldehyde-3-phosphate


Figure 1. Differently expression spots in EIEC and normal group. 

dehydrogenase (GAPDH) and triosephosphate 

isomerase (Tim) were also identified, which all play an 

important role in carbohydrate metabolism. 

Of them, GAPDH catalyzes the conversion of 

glyceraldehyde-3-phosphate to 1,3-bisphosphoglycerate 

in the glycolytic pathway. As part of the conversion, 

GAPDH converts NAD + to the high-energy electron 

carrier NADH. GAPDH has been referred to as a 

"housekeeping" protein based on the view that GAPDH 

gene expression remains constant under changing 

cellular conditions. Triosephosphate isomerase (TIM) is 

also an enzyme with a role in glycolysis and gluconeogenesis 

by catalyzing the interconversion between 

glyceraldehyde 3-phosphate and dihydroxyacetone 

phosphate (Moraes et al., 2011). Carbohydrate 

metabolism has been implicated in pathogenesis of 

enteroinva-sive E. coli (EIEC). In a cell culture model, an 

EIEC mutant defective in both glucose and mannose 

transport was significantly impaired in adherence and 

invasion (Gore and Payne, 2010). And Egea et al. (2007) 

found that GAPDH could be present in the surface of 

enteropathogenic (EHEC) and enterohaemorrhagic 

(EPEC) E. coli (all as Gram-negative bacteria) and 

GAPDH could adhere to the cell surface after cocultivation 

with Caco-2 cells. This may partially explain 

the pathogenesis of EHEC and EPEC infection. 

Therefore, in our study, we found GAPDH and TIM were 

up-regulated expression in EIEC group contrast to normal 

group, suggesting EIEC also express the GAPDH and 

increase its ability of adherence and invasion to Caco-2 

cells. 

Recently, GAPDH has also been known to contribute to 

a number of diverse cellular functions unrelated to 

glycolysis such as cytoskeletal organization, apoptosis 

and viral pathogenesis (Tatton et al., 2000). These may 

also be associated with Caco-2 cells damage and 

apoptosis upon EIEC infection. The clinical study found 

probiotics can restrain the damage effect of intestinal 

pathogenic bacteria, and can be used to treat acute 

diarrhea (Sazawal et al., 2006) and intestinal flora

Figure 2. Relative expression profile of differently expression spots in EIEC and normal group. 

Table 2. Differentially expressed proteins between L. plantarum and normal group. 


Group ID Normal group L. plantarum group Group ID Normal group L. plantarum group 

1122 -3.01255 3.01255 1118 -1.85844 1.85844 

1615 -2.79918 2.79918 1804 -1.78829 1.78829 

2007 -2.67766 2.67766 1955 1.75013 -1.75013 

900 -2.58965 2.58965 1698 1.72375 -1.72375 

1746 -2.56488 2.56488 639 -1.59668 1.59668 

1656 2.51169 -2.51169 925 -1.59597 1.59597 

1558 -2.49958 2.49958 1842 -1.5682 1.5682 

1944 2.46618 -2.46618 641 -1.55929 1.55929 

390 -2.04106 2.04106 1684 1.54977 -1.54977 

1917 1.99593 -1.99593 1754 1.53794 -1.53794 

1914 1.9928 -1.9928 638 -1.52214 1.52214 

1883 1.90046 -1.90046 2159 1.51294 -1.51294 

1886 1.89765 -1.89765 

(Kuehbacher et al., 2006). Keratin 8 was induced upregulated 

expression upon L. plantarum treatment. 

Keratins 8 and 18 belong to the keratin family of 

intermediate filament proteins and they can be covalently 

conjugated to constitute a hallmark for all simple epithelia 

(Gilbert et al., 2001; Magin et al., 2007). Phosphorylation 

in some sites may affect the structure and function of this 

protein and even cells signal transduction (Feng et al., 

1999; Ridge et al., 2005). Phosphorylation facilitates 

formation of Keratin 8/18 aggregates, but is not crucial.


Figure 3. Differently expression spots in L. plantarum and normal group. 

Figure 4. Relative expression profile of differently expression spots in L. plantarum and normal group.

Table 3. Differentially expressed proteins between L. plantarum and EIEC group. 


Group ID L. plantarum group EIEC group Group ID L. plantarum group EIEC group 

1313 -3.59685 3.59685 1829 1.90584 -1.90584 

1403 -3.56569 3.56569 1549 -1.79476 1.79476 

1043 -3.33972 3.33972 613 1.61932 -1.61932 

1217 -2.51966 2.51966 680 -1.57435 1.57435 

1792 -2.32483 2.32483 1341 1.55353 -1.55353 

1710 -2.29915 2.29915 927 -1.5412 1.5412 

1664 1.95007 -1.95007 1851 1.50677 -1.50677 

1413 -1.93483 1.93483 

Figure 5. Differently expression spots in L. plantarum and normal group. 

Keratin 8/18 would breakdown and reorganize during 

apoptosis. And at later stages of the apoptotic process, 

that is, when the integrity of the cytoplasmic membrane 

becomes compromised, keratin aggregates are shed 

from the cells (Schutte et al., 2004). Our study discovered 

the keratin-dependent protection of Caco-2 cells from


Figure 6. Relative expression profile of differently expression spots in L. plantarum and normal group. 

Table 4. Identification of differentially expressed proteins by NCBInr database searching. 

Spot No Protein ID Protein name 

1403 Gi|31645 Glyceraldehyde-3-phosphate dehydrogenase. 

1313 Gi|109082737 Predicted: heterogeneous nuclear ribonucleoprotein C (C1/C2) isoform 2 (Macaca mulatta). 

1217 Gi|62913980 KRT8 protein. 

1615 Gi|70995211 Peroxisomal enoyl-coenzyme A hydratase-like protein. 

2007 Gi|55959887 Peroxiredoxin 1. 

4445 Gi|20664358 

Chain A, crystal structure of a recombinant glutathione transferase, created by replacing the last 

seven residues of each subunit of the human class Pi isoenzyme with the additional C-terminal 

helix of human class alpha isoenzyme. 

4337 Gi|999892 Chain A, triosephosphate isomerase (Tim) (E.C.5.3.1.1) complexed with 2-phosphoglycolic acid. 

4435 Gi|20664358 

EIEC induced apoptotic challenge may be a key function 

of simple epithelial keratins (Jaquemar et al., 2003). And 

intermediate filament proteins might be induced overexpression 

by L. plantarum to antagonize the apoptosis 

and destructive effect on cytoskeleton by EIEC 

(Nishizawa et al., 2005). 

The heterogeneous nuclear ribonucleoprotein C1/C2 

(hnRNP-C1/C2) is one of the most abundant proteins in 

the nucleus, and shown to have roles in cellular 

differentiation and proliferation through post-transcriptional 

regulations of certain mRNA species (Williamson et 

Chain A, crystal structure of a recombinant glutathione transferase, created by replacing the last 

seven residues of each subunit of the human class Pi isoenzyme with the additional C-terminal 

helix of human class alpha isoenzyme. 

al., 2000). Many hnRNP-C1/C2 have been found to be 

phosphorylated in response to extracellular stimulations. 

These changes have been proposed to regulate splice 

site selection in pre-mRNA alternative splicing, which is 

recognized as the cause or the consequence of 

numerous human diseases such as tumors and 

inflammatory injuries (Zhu et al., 2003). Translocation of 

hnRNP C1/C2 from nuclei to cytoplasm in PMA-induced 

pro-apoptotic cells have been identified dependent on 

ROCK-mediated cytoskeleton rearrangement (Lee et al., 

2004). In our study, down-regulation of hnRNP-C1/C2

upon L. plantarum treatment might be as a novel 

mechanism to enhance the resistance of Caco-2 cells to 

apoptosis, inflammatory and indirectly decrease the 

hnRNP C1/C2 translocation. 

REFERENCES 

Cossart P, Sansonetti PJ (2004). Bacterial invasion: the paradigms of 

enteroinvasive pathogens. Science, 304(5668): 242-248. 

Croxen MA, Finlay BB (2009). Molecular mechanisms of Escherichia 

coli pathogenicity. Nat. Rev. Microbiol., 8(1): 26-38. 

Daly KA, Lefévre C, Nicholas K, Deane E, Williamson P (2008). 

Characterization and expression of Peroxiredoxin 1 in the neonatal 

tammar wallaby (Macropus eugenii). Comp. Biochem. Physiol. 

Biochem. Mol. Biol., 149(1): 108-119. 

Egea L, Aguilera L, Giménez R, Sorolla M, Aguilar J, Badía J, Baldoma 

L (2007). Role of secreted glyceraldehyde-3-phosphate 

dehydrogenase in the infection mechanism of enterohemorrhagic and 

enteropathogenic Escherichia coli: interaction of the extracellular 

enzyme with human plasminogen and fibrinogen. Int. J. Biochem. 

Cell Biol., 39(6): 1190-1203. 

Feng L, Zhou X, Liao J, Omary MB (1999). Pervanadate-mediated 

tyrosine phosphorylation of keratins 8 and 19 via a p38 mitogenactivated 

protein kinase-dependent pathway. J. Cell. Sci., 112(13): 

2081-2090. 

Gilbert S, Loranger A, Daigle N, Marceau N (2001). Simple epithelium 

keratins 8 and 18 provide resistance to Fas-mediated apoptosis. The 

protection occurs through a receptor-targeting modulation. J. Cell 

Biol., 154(4): 763-73. 

Gore AL, Payne SM (2010). CsrA and Cra influence Shigella flexneri 

pathogenesis. Infect Immun., 78(11): 4674-82. 

Jaquemar D, Kupriyanov S, Wankell M, Avis J, Benirschke K, Baribault 

H, Oshima RG (2003). Keratin 8 protection of placental barrier 

function. J. Cell Biol., 161(4): 749-56. 

Kuehbacher T, Ott SJ, Helwig U, Mimura T, Rizzello F, Kleessen B, 

Gionchetti P, Blaut M, Campieri M, F lsch UR (2006). Bacterial and 

fungal microbiota in relation to probiotic therapy (VSL# 3) in pouchitis. 

Gut., 55(6): 833-41. 

Lahouassa H, Moussay E, Rainard P, Riollet C (2007). Differential 

cytokine and chemokine responses of bovine mammary epithelial 

cells to Staphylococcus aureus and Escherichia coli. Cytokine., 38(1): 

12-21. 

Lee HH, Chien CL, Liao HK, Chen YJ, Chang ZF (2004). Nuclear efflux 

of heterogeneous nuclear ribonucleoprotein C1/C2 in apoptotic cells: 

a novel nuclear export dependent on Rho-associated kinase 

activation. J. Cell. Sci., 117(23): 5579-89. 

Magin TM, Vijayaraj P, Leube RE (2007). Structural and regulatory 

functions of keratins. Exp. Cell Res., 313(10): 2021-2032. 

Michail S, Abernathy F (2003). Lactobacillus plantarum inhibits the 

intestinal epithelial migration of neutrophils induced by 

enteropathogenic Escherichia coli. J. Pediatr. Gastroenterol. Nutr., 

36(3): 385-91. 


Moraes J, Arreola R, Cabrera N, Saramago L, Freitas D, Masuda A 

(2011). Structural and biochemical characterization of a recombinant 

triosephosphate isomerase from Rhipicephalus (Boophilus) 

microplus. Insect Biochem. Mol. Biol., 41(6): 400-9. 

Nishizawa M, Izawa I, Inoko A, Hayashi Y, Nagata K, Yokoyama T, 

Usukura J, Inagaki M (2005). Identification of trichoplein, a novel 

keratin filament-binding protein. J. Cell. Sci., 118(5): 1081-90. 

Parsot C (2005). Shigella spp. and enteroinvasive Escherichia coli 

pathogenicity factors. FEMS Microbiol. Lett., 252(1): 11-18. 

Qin H, Zhang Z, Hang X, Jiang Y (2009). L. plantarum prevents 

enteroinvasive Escherichia coli-induced tight junction proteins 

changes in intestinal epithelial cells. BMC Microbiol., 9(1): 63. 

Resta-Lenert S, Barrett K (2003). Live probiotics protect intestinal 

epithelial cells from the effects of infection with enteroinvasive 

Escherichia coli (EIEC). Gut., 52(7): 988-97. 

Resta-Lenert S, Barrett KE (2006). Probiotics and commensals reverse 

TNF-[alpha]-and IFN-[gamma]-induced dysfunction in human 

intestinal epithelial cells. Gastroenterology, 130(3): 731-746. 

Ridge KM, Linz L, Flitney FW, Kuczmarski ER, Chou YH, Omary MB, 

Sznajder JI, Goldman RD (2005). Keratin 8 phosphorylation by 

protein kinase C delta regulates shear stress-mediated disassembly 

of keratin intermediate filaments in alveolar epithelial cells. J. Biol. 

Chem., 280(34): 30400-5. 

Sazawal S, Hiremath G, Dhingra U, Malik P, Deb S, Black RE (2006). 

Efficacy of probiotics in prevention of acute diarrhoea: a metaanalysis 

of masked, randomised, placebo-controlled trials. Lancet 

Infect. Dis., 6(6): 374-382. 

Schutte B, Henfling M, K lgen W, Bouman M, Meex S, Leers MPG, Nap 

M, Bj rklund V, Bj rklund P, Bj rklund B (2004). Keratin 8/18 

breakdown and reorganization during apoptosis. Exp. Cell Res., 

297(1): 11-26. 

Song T, Toma C, Nakasone N, Iwanaga M (2005). Sensitive and rapid 

detection of Shigella and enteroinvasive Escherichia coli by a loopmediated 

isothermal amplification method. FEMS Microbiol. 

Immunol., 243(1): 259-263. 

Steiner TS, Nataro JP, Poteet-Smith CE, Smith JA, Guerrant RL (2000). 

Enteroaggregative Escherichia coli expresses a novel flagellin that 

causes IL-8 release from intestinal epithelial cells. J. Clin. Invest., 

105(12):1769-1778. 

Tatton WG, Chalmers-Redman RM, Elstner M, Leesch W, Jagodzinski 

FB, Stupak DP, Sugrue MM, Tatton NA (2000). Glyceraldehyde-3phosphate 

dehydrogenase in neurodegeneration and apoptosis 

signaling. J. Neural. Transm. Suppl., 60: 77-100. 

Townsend DM, Tew KD (2003). The role of glutathione-S-transferase in 

anti-cancer drug resistance. Oncogene, 22(47): 7369-7375. 

Williamson DJ, Banik-Maiti S, DeGregori J, Ruley HE (2000). hnRNP C 

is required for postimplantation mouse development but is 

dispensable for cell viability. Mol. Cell. Biol., 20(11): 4094-105. 

Wu G, Fang YZ, Yang S, Lupton JR, Turner ND (2004). Glutathione 

metabolism and its implications for health. J. Nutr., 134(3): 489-492. 

Zhu YQ, Lu Y, Tan XD (2003). Monochloramine induces reorganization 

of nuclear speckles and phosphorylation of SRp30 in human colonic 

epithelial cells: role of protein kinase C. Am. J. Physiol., Cell Physiol., 

285(5): C1294-303.




DOI: 10.5897/AJMR11.996 


A survey on the prevalence of poultry salmonellosis 

and detection of different Salmonella serovars isolated 

from poultry in broiler chicken farms 

Jafar Akbarmehr 

Department of Microbiology, Islamic Azad University, Sarab Branch, Sarab, Iran. E-mail: ja_mehr@yahoo.com. 


Salmonellosis is an important public health problem and food of poultry origin is one of the most 

common sources of human salmonellosis. The aim of this study was detection of Salmonella spp and 

determination of the prevalence of Salmonellosis in broiler poultry farms of Ardebil province, Iran. 

Salmonella detection by both conventional culture and multiplex PCR methods were performed on 400 

samples obtained from poultry. The samples were obtained from poultry farms of five different 

geographic zones (North, South, West, East and Central zone) of Ardebil province and were examined 

by standard microbiological tests. m-PCR technique was carried out with four and three pairs of 

specific primers for Salmonella typhimurium and Salmonella enteritidis respectively. Out of a total of 

400 samples, 37(9.25%) were positive for Salmonella by bacteriological tests. The highest prevalence of 

Salmonella was recorded in Central zone (10.43%) while the lowest prevalence was in South zone of 

Ardebil province (8%). Based on the m-PCR results among 37 isolated Salmonella, 11 serovars were S. 

typhimurium and 21 serovars were identified as S. enteritidis. Also, there was no significant difference 

between the prevalence rate of Salmonella in five different selected areas (P>0.05). For control and 

prevention programs of salmonellosis, the results of this study can be used by agriculture and health 

organizations in Iran. 

Key words: m-PCR, ardebil, salmonellosis, poultry. 

INTRODUCTION 

Salmonella species are gram negative, flagellated, 

facultatively anaerobic bacilli which are considered as 

major zoonotic pathogens for both animals and humans 

(Giannella et al., 1973). Salmonellosis is common 

throughout the world. The disease in humans usually 

takes the form of a self-limiting food poisoning but 

occasionally manifested as a serious systemic infection 

or enteric fever. Contaminated food is the major mode of 

transmission for non typhoidal Salmonella because 

salmonellosis is a zoonosis and has an enormous animal 

reservoir (Doyle and Beuchat, 2007). The most common 

animal reservoirs are chickens, turkeys, pigs and cows. 

Other domestic and wild animals also harbor these 

organisms. Salmonella enterica serovar enteritidis is a 

major cause of food borne disease and during last 

decade it has been isolated worldwide in increasing 

numbers. Furthermore S. enterica serovar Typhimurium 

is the most frequently isolated serovar worldwide 

(Madadgar et al., 2008). Dairy products, vegetables, 

fruits, shellfish, beef, poultry and eggs are the most 

common sources of human salmonellosis (Doyle and 

Beuchat, 2007). Poultry are commonly infected with a 

wide variety of S. enterica serovars. The two serovars 

that have been of most concern in recent years are S. 

enteritidis and Salmonella typhimurium (Madadgar et al., 

2008). Since 1987, Salmonella enteritidis has been the 

main cause of Salmonella poisoning in humans from 

poultry products (Doyle and Beuchat, 2007). In order to 

minimize the risk of human salmonellosis, 

epidemiological studies and microbiological control of the 

food chain is being increasingly applied. In recent years 

various molecular techniques have been used to improve 

the identification and differentiation of Salmonella 

serovars including: PCR-single-strand conformation

Akbarmehr 5951 

Table 1. Sequences of oligonucleotides used as primers in m- PCR for S. typhimurium (a) and S. enteritidis (b) (Rahn et al., 1992). 

Primer Sequence Target gene Amplicon fragment(bp) 

RfbJ-s 

RfbJ-as (a) 

5'-CCAJCACCAGTTCCAACTTGATAC 

5'-GGCTTCCGGCTTTATTGGTAAGCA 

rfbJ 663 

FliC-s 5'-ATAGCCATCTTTACCAGTTCCCCC 

FliC –as (a) 5'-GCTGCAACTGTTACAGGATATGCC 

FljB-s 5'-ACGAATGGTACGGCTTCTGTAACC 

FljB -as (a) 5'-TACCGTCGATAGTAACGACTTCGG 

ST 139-s 5'-GTGAAATTATCGCCACGTTCGGGCAA 

ST141-as (a) 5'-TCATCGCACCGTCAAAGGAACC 

ST11 5'-GCCAACCATTGCTAAATTGGCGCA 

ST14 (b) 5'-GGTAGAAATTCCCAGCGGGTACTGG 

S1 5'-GCCGTACACGAGCTTATAGA 

S4 (b) 5'-ACCTACAGGGGCACAATAAC 

SEFA2 5'-GCAGCGGTTACTATTGCAGC 

SEFA4 (b) 5'-TGTGACAGGGACATTTAGCG 

polymorphism analysis (Satheesh et al., 2002), genomic 

and phenotyping evaluation (Madadgar et al., 2008), 

pulsed field gel electrophoresis (Mhand et al., 1999; 

Thong, 1998), PCR assay (Hoorfar and Ahrens, 2000; 

Feeder et al., 2001; Kongmuang et al., 1994; Lin and 

Tsen, 1999; Malorny et al., 2003), RFLP (Aarts et al., 

1998). One of the most important used techniques for 

identification of Salmonella serovars is PCR technique 

using Salmonella genes (Kisiela and Kuczkowki, 2005). 

In 2004, Alvarez et al. (2004) have desecribed m- PCR 

as a method for Salmonella diagnosis that is simple, 

inexpensive and sensitive and enables the quick and 

precise detection of the most prevalent serotypes of 

Salmonella in human clinical samples. In recent years 

several studies were carried out by different authors in 

order to determine the prevalence of poultry 

salmonellosis in Iran. Based on these studies the 

prevalence of Salmonella in poultry were reported in 

different areas in Iran (Zahraei et al., 2005; Madadgar et 

al., 2008; Jamshidi et al., 2008; Akbarmehr, 2010). But 

until now epidemiological study about poultry 

salmonellosis in Ardebil province which is located in 

Northwest of Iran has not been widely studied. Therefore 

in the present study we investigated the poultry 

salmonellosis in broiler chicken farms of Ardebil province 

using conventional culture and mPCR assay. 


Sampling and microbiological tests 

This study was carried out in Ardebil province, Iran. The province 

fjlC 183 

fljB 526 

invA 284 

Random sequence 429 

spv 250 

sefA 310 

was divided into five different geographic areas as follows: North, 

South, west, East and Central zone. A total of 400 samples were 

collected from broiler poultry farms in the aforementioned areas 

from January 2010 to June 2011(60, 50, 85, 90, 115 samples were 

obtained from North, South, west, East and Central zone 

respectively). The samples were harvested from yolk sac, spleen, 

intestine and liver of chickens and examined by standard 

procedures (enrichment 24 h in selenite F (Merk) at 37°C, plated on 

XLD agar and incubated at 37°C for 24 h, confirmation of suspected 

colonies by biochemical tests) as described by Quinn et al. (1994). 

PCR amplification 

The Salmonella isolates were grown overnight at 37°C in brain 

heart infusion broth. 2 ml of the bacteria culture were centrifuged for 

10 min at 16000 rpm. Purified DNA was used as a templet for the 

PCR assay. For the m- PCR, seven primer pairs were used. Four 

pairs of primers were used for S. typhimurium and three pairs of 

them for S. enteritidis (Table 1). PCR was carried out in a 25 µl 

amplification mixture consisting of 200 mM dNTPs, 1 µm of each 

primer, 40 ng of genomic DNA, 1.5 mM MgCl2 and 1U of Taq DNA 

polymerase (fermentase). Amplification was performed in a thermal 

cycler (Biosystem). The cycling condition was as follows: initial 

denaturation at 95°C for 5 min, followed by 35 cycles of 

denaturation at 94°C for 60 s, annealing at 65°C for 30 s, 

elongation at 72°C for 30 s and final extenstion period for 7 min 

(Zahraei et al., 2005). Amplified products were subjected to 

electrophresis at 100 V on a 1.2% agarose gel for 1 h and a 100 bp 

DNA ladder was used as a size reference. After staining with 

ethidium bromide, the gel was documented and photographed 

under ultra violet light. S. typhimurium with ATCC- 14025 and S. 

enteritidis with RTCC-1624 were used as positive control. 

RESULTS 

The prevalence of salmonellosis in poultry in the five


Table 2. Prevalence of salmonellosis in the broiler farms of five selected zones of Ardebil province, Iran. 

Zone No. of examined samples No. positive samples Prevalence rate (%) 

North 60 5 8.33 

South 50 4 8 

West 85 8 9.4 

East 90 8 8.88 

Central 115 12 10.43 

Total 400 37 9.25 

Figure 1. Multiplex PCR with four pairs of primers for S .typhimurium isolated from poultry. The 183 bp bands 

produced by fliC gene (specific for S .typhimurium) and the 284 bp bands produced by invA gene (specific for 

the genus Salmonella). The 526 and 663 bp bands produced by fljB and rfbJ genes respectively. M: marker 

)100 bp). PC: positive control (S. typhimurium with ATCC- 14025). Lanes 1, 3 and 4 are positive samples for 

S. typhimurium. Lanes 2, 5, 6 and 7 are positive samples for genus of Salmonella. 

selected zones of Ardebil province are shown in Table 1. 

Out of a total 400 samples, 37(9.25%) were positive for 

Salmonella by bacteriological tests. As Table 2 shows the 

highest, prevalence was recorded in Central zone 

(10.43%) while the lowest prevalence was in south zone 

of Ardebil province (8%). MPCR technique which was 

carried out with specific primers for S. typhimurium and 

S. enteritidis (Table1). Among 37 isolated Salmonella, 11 

serovars of S. typhimurium and 21 serovars of S. 

enteritidis were confirmed by MPCR technique. Distribution 

of S. typhimurium and S. enteritidis in different 

geographic area of Ardebil province is shown in Table 2. 

Also, Figures 1 and 2 shows the MPCR results (Table 3) 

of S. typhimurium and S. enteritidis respectively. 

DISCUSSION 

M PC 1 2 3 4 5 6 7 

Salmonella is an important cause of food-borne 

infections. Most of these infections are caused by 

Salmonella originated from poultry (Doyle and Beuchat, 

2007). As Table 1 shows out of 400 samples which was 

examined by bacteriological tests 37(9.25%) of them had 

positive results for Salmonella strains. This finding is 

comparable to the reports of previous works from other 

cities and provinces in Iran. While some previous authors 

reported higher prevalences of Salmonella in poultry, the 

others reported lower prevalence compared to this study. 

In a study which was conducted in Fars province, Iran the 

prevalence of poultry salmonellosis was determined 

15.62% (Zahraei et al., 2005). Another survey which was 

conducted in Mashhad city, Iran; the prevalence of 

Salmonella in poultry carcasses was determined by 8.3% 

(Jamshidi et al., 2008). In 2010, Akbarmehr et al. (2010) 

reported the prevalence of poultry salmonellosis in Sarab 

city, Iran as 7.25%. According to Table 1 although the 

prevalence of Salmonella is widely distributed in all over 

the five selected geographic area in Ardebil province but 

the prevalence rates were varied from 8% (South zone) 

to 10.43% (Central zone). This may be due to 

confirement system of poultry farms in central zone of 

Ardebil province which provides the easily distribution of

6 

Figure 2. m-PCR with three pairs of primers for S. enteritidis isolated from poultry: the 250 bp bands 

produced by Salmonella plasmid virulent gene. The 310 bp bands produced by S.enteritidis fimbrial antigen 

gene and the 429 bp bands produced by randomly cloned sequence which is specific for the genus 

Salmonella. M: marker (100 bp). PC: positive control (S. enteritidis with RTCC-1624). Lanes 2, 3 and 5 are 

positive samples for S. enteritidis. Lanes 1, 4 and 6 are positive samples for genus of Salmonella. 

Akbarmehr 5953 

Table 3. Distribution of S. typhimurium and S. enteritidis in different geographic area of Ardebil province based on MPCR results. 

Zone No. of positive samples 

S. typhimurium 

No % 

S. enteritidis 

No % 

North 5 1 20 3 60 

South 4 1 25 3 75 

West 8 2 25 5 62.5 

East 8 3 37.5 4 50 

Central 12 4 33.33 6 50 

Total 37 11 29.72 21 56.75 

Salmonella between poultry farms. Although there were 

no significant differences between different prevalence 

rates (P>0.05). According to Figure 1, S. typhimurium 

serovars confirmed with four pairs of primers by m-PCR 

method. As Figure 1 shows the 284 bp bands produced 

by invA genes which were found in all of the S. 

typhimurium serovars. Primers targeting the rfbJ, fliC and 

fljB genes were used for specific identification of S. 

typhimurium which produced 663, 183 and 526 bp bands 

respectively. Olivera reported that the m-PCR technique 

using invA gene for detection of Salmonella and fliC gene 

for identification of S. typhimurium from poultry- related 

samples was 100% specific (Oliveira et al., 2002). Also, 

S. enteritidis serovars comfirmed with three pairs of 

primers in this study (Figure 2). 

The 429 bp bands were found in all of the Salmonella 

serovars produced by randomly cloned sequenced which 

were specific for the genus Salmonella. Salmonella 

plasmid virulent gene (Spv) and S. enteritidis fimbrial 

5 4 3 2 1 M PC 

antigen gene (sefA) (which produced 250 and 310 bp 

bands respectively) were used for specific identification of 

S. enteritidis serovars (Madadgar et al., 2008). Based on 

m-PCR results, S. enteritidis with 56.75% frequency and 

S. typhimurium with 29.72% frequency were the most 

common serovars in five different zones of poultry farms 

in Ardebil province. Out of 37 Salmonella isolates, 5 

(13.51%) were other seovars which were not identified in 

this study. It should be considered that the predominant 

Salmonella serovars differ in different countries. But in 

Iran many authors showed that S. enteritidis and S. 

typhimurium are the most prevalent serotypes of 

Salmonella (Zahraei et al., 2005; Akbarmehr et al., 2010; 

Madadgar et al., 2008). Because of the ability of 

Salmonella in poultry meat and egg that are not 

thoroughly cooked, poultry originated products are the 

main vehicle of transmission (Gianella, 1973). Finally the 

present research is the first precise study about 

epidemiology of salmonellosis in poultry farms of Ardebil


province, Iran using conventional culture and m-PCR 

Assay and our results revealed an important public health 

and veterinary problem which must be considered by 

agriculture and public health organizations in Iran. 


This work was supported by the Islamic Azad University 

of Sarab Branch. We are thankful to Mr. S. S. Taheri for 

his valuable collaboration. 

REFERENCES 

Aarts HJ, Vanlith J T, Keljer J (1998). High resolution genotyping of 

Salmonella Strains by AFLP fingerprinting. Lett. Appl. Microbiol., 

26:131-135. 

Akbarmehr J, zahraei Salehi T, Nikbakht Gh (2010). Identification of 

Salmonella isolated From poultry by MPCR technique and evaluation 

of their hsp groEL gene diversity based on the PCR-RFLP analysis. 

Afr. J. Microbiol. Res., 4(15):1599-16o4. 

Alvarez J, Sota M, Vivanco AB, Perales I, Cisterna R, Rementeria A, 

Garaizar J (2004). Development of multiplex PCR technique for 

detection and epidemiological typing of Salmonella in human clinical 

samples. J. Clin. Microbiol., 42:1734-1738. 

Doyle MP, Beuchat LR (2007). Food Microbiology.third edition ASM 

Press. Washington D.C., pp. 187-219. 

Feeder I, Nietfeld JC, Galland J, Yeary T, Sargeant JM, Oberst R, 

Tamplin ML, Luchansky JB(2001). Comparison of Cultivation and 

PCR hybridization for detection of Salmonella in porcine fecal and 

Water samples. J. Clin. Microbiol., 39:2477_2484 

Giannella RA, Formal SB, Dammin GJ (1973). Pathogenesis of 

salmonellosis :studies of fluid secretion, mucosal invasion, and 

morphological reaction in the rabit ileum. J. Clin. Invest., 52:441. 

Hoorfar JP, Ahrens P (2000).Automated 5' nuclease PCR assay for 

identification of Salmonella enterica .J. Clin. Microbiol., 38:3429- 

3435. 

Jamshidi A, Bassami MR, Afshari-Nic S (2008).Identification of 

Salmonella spp and Salmonella typhimurium by multiplex PCR-based 

assay from poultry caracasses in Mashhad –Iran. Int. J. Vet Res., 

3(1):43-48. 

Kisiela D, Kuczkowki M (2005). Differentiation of Salmonella gallinarum 

biovar gallinarum from Salmonella gallinarum biovar pullorum by 

PCR-RFLP of the fim H gene. J. Vet. Med., B52:214-218. 

Kongmuang U, Luk JMC, Lindberg AA (1994). Comparison of three 

stool- processing methods for detection of Salmonella serogroups 

B,C2, and D by PCR. J. Clin. Microbiol., 23:3072-3074. 

Lin JS, Tsen HY (1999). Development and use of polymerase chain 

reaction for the detection of S. typhimurium in stool and food 

samples. J. Food Prot., 62:1103-1110. 

Madadgar O, Zahraei Salehi T, Tadjbakhsh H, Mahzounieh M, 

Feizabadi M (2008). Genomic and phenotypic evaluation of 

Salmonella typhimurium and Salmonella enteritidis in Iran. Comp. 

Clin. Pathol., 17:229-235. 

Mhand RA, Brahimi N, Moustaoui N, Mdaghri NE, Amarouch H, Grimont 

F (1999). Characterization of extended spectrum beta lactamase 

producing Salmonella typhimurium by phenotypic and genotypic 

typing methods. J. Clin. Microbiol., 37:3769-3773. 

Malorny B, Hoorfar JC, Bunge C, Helmuth R (2003). Multicenter 

validation of the analytic accuracy of Salmonella PCR:towards an 

international standard . Appl. Environ. Microbiol., 69:290-296. 

Oliveira SD, Santos LRD, Schuch M T, Silva ABC, SalleT P, Canal CW 

(2002). Detection and identification of Salmonella from 

poultry_related samples by PCR. Vet. Microbiol., 87:25_35. 

Quinn PJ, Carter ME, Markey B, Carter GR (1994). Clinical Vet 

Microbiology .Wolf publishing. pp. 209-236. 

Rahn K, DeGrandis S, Clarke R, Mcewen S (1992). Amplification of an 

invA gene seguence of Salmonella typhimurium by polymerase chain 

reaction as a specific method of detection of Salmonella. Mol. Cell. 

Probe, 6:271_279. 

Satheesh N, Thong KL , Tikki P, Martin A (2002). Characterization of 

Salmonella serovars by PCR-Single-Strand Conformation 

Polymorphism analysis. J. Clin. Microbiol., pp. 2346-2351. 

Thong KL (1998).Molecular analysis of S.paratyphi A from outbreak in 

New Dehli, India. Emerg. Infect. Dis., 4:507-508. 

Zahraei Salehi T, Mahzounieh M, Saeedzadeh, A (2005).The isolation 

of antibiotic-resistant Salmonella from intestine and Liver of poultry in 

Shiraz province of Iran. Int. J. Poult. Sci., 4(5):320-322.




DOI: 10.5897/AJMR11.1000 


Isolation and exploitation of Aspergillus ochraceus 

RM82 against human pathogenic bacteria 

Riaz Muhammad, Sajid Ali and Bashir Ahmad* 

Pharma biotech Research Laboratory, Centre for Biotechnology and Microbiology, University of Peshawar, KPK, 

Pakistan. 


In the present research work, soil samples were collected from different hospitals of District Peshawar, 

Khyber Pakhtunkhwa, Pakistan, contaminated with hospital disposable materials. Aspergillus 

ochraceus was isolated from the soil through serial dilution followed by morphological identification. 

Furthermore, different strains of human pathogenic bacteria were isolated from hospitalized patient’s 

blood, urine and pus samples. The isolated A. ochraceus was tested against the isolated pathogenic 

bacterial strains for antimicrobial activities. Antibacterial results were observed against multi drugs 

resistant (MDR) human pathogenic bacteria. 

Key words: Aspergillus ochraceus, pustule, antimicrobial, multi drugs resistant. 

INTRODUCTION 

Multi drugs resistant bacteria such as methicilineresistant 

Staphylococcus aureus (MRSA) emerged during 

the last decade and clinically are the cause of serious 

problems (Levin and Andreasen, 1999). The last choice 

for the treatment of MDR is vancomycin. Due to 

vancomycin-resistant Enterococci (VRE) and 

vancomycin-intermediate resistant S. aureusarises a 

global health concerns (Gilmore and Hoch, 1999). 

Accordingly it is the cry of the day to exploit antibiotic 

producing microorganisms for the extraction of novel 

antimicrobial compounds against MDR, VRE and VISA 

(Levy, 1998). 

Although very important compounds have been 

extracted from microorganisms but antibiotics have 

prominent importance due to therapeutic value (McCarthy 

and Williams, 1990; Ouhdouch et al., 2001; Saadoun and 

Gharaibeh, 2003). It has been found that emergence of 

high antibacterial resistance is the alarming problem 

throughout the world. It is obvious from the irrational use 

*Corresponding author. E-mail: bashirdr2001@yahoo.com. Tel: 

+92-921-6701, Ext. 3070. 

of antibiotics that the efficacies of present antibiotics are 

decreasing slowly and steadily due to antibiotic 

resistance. In the perspective of documented reports it is 

the need of the hour to search for novel compounds 

(Barbara and Clewes, 2003; Shahghasi et al., 2004). 

Search for microorganisms producing novel antimicrobials, 

is still have prime importance due to the continuous 

emergence of antibiotic resistance (Zrimec et al., 2004). 

It has been found that the divers medium of soil has 

essential macro and micronutrients, playing a vital role in 

the metabolic pathways of microorganisms (Luzhetskyy 

et al., 2007; Thomashow et al., 2008). Since micro 

biologist believed that only a minute fraction of soil micro- 

flora has been identified (Thomashow et al., 2008). 

After the discovery of magic bullet penicillin, a lot of 

different antibiotics have been investigated and searched 

out largely from soil inhabiting microbes. During the last 

20-30 years, researchers interest in the soil inhabiting 

microorganism have been enhanced, due to the 

increased possibility of searching novel bioactive compounds, 

like antibiotics and enzymes, active in diverse 

environmental parameters (Nedialkova and Naidenova, 

2004). 

A large numbers of antimicrobial secondary metabolites


Table 1. Fungal strains isolated from soil samples collected from various hospitals of Peshawar. 

Name of Hospital No of soil samples fungi isolated 

Khyber teaching hospital 9 RM 75, RM76, RM77 

Lady Reading hospital 13 RM 78, RM79, RM80, RM81 

Hayatabad Medical complex 11 RM 82 (Selected), RM83, 

RM: specific code for isolated fungi RM82: Selected Aspergillusochraceus. 

extracted from microbe rich soil environment, including 

bacteria, actinomycetes and molds (Luzhetskyy et al., 

2007; Thomashow et al., 2008). Although some new 

bioactive compounds are under evaluation, however 

there is an emergency demand for the investigation and 

evaluation of novel bioactive compounds against 

bacterial and fungal pathogens and the bioactive product 

against these pathogens is the important key source to 

control them (Luzhetsky et al., 2007). In the light of above 

facts the objectives of the present research study were to 

isolate soil inhabiting fungi and then evaluate 

antimicrobial activities of isolated fungi against human 

pathogenic bacteria isolated from patient samples. 

Due to the world wide problem of antibiotic resistance 

our research work have profound importance to isolate 

and screen out such types of microorganisms which 

produce novel types of compounds against multi drugs 

resistant MDR bacteria. 


Collection of soil samples 

A total of 33 soil samples were collected from different hospitals of 

District Peshawar, Khyber Pakhtunkhwa, contaminated with 

hospitals disposable materials like disposable cottons, syringes and 

plastics. Soil samples were taken from surface to 10 cm depth from 

the selected sites in the sterilized polystyrene bags using sterilized 

gloves. All samples were immediately transferred to the laboratory 

and stored at 4°C till further use. 

Isolation of fungi 

Soil samples were serially diluted up to 10 -5 in distilled water and 

spread 1 ml sample on the Potato dextrose agar (PDA) and 

Sabroud dextrose agar (PDA) media and incubated for 3-5 days at 

28°C. Isolated fungi were further sub cultured and pu rified on PDA 

and SDA media (Table 1). 

Morphological identification of Aspergillusochraceus 

The isolated fungus was preliminary identified on the basis of fungal 

colony, color, growth pattern, diffusible pigments, hyphae, conidia 

and sporulation. 

Isolation of multi drug resistant human pathogenic bacteria 

Human pathogenic bacteria were isolated from patient’s blood, 

urine and pus samples. Blood and urine were collected from 

hospitalized patient in sterilized vials and bottles. Immediately 

brought to the pathology laboratory of Lady Reading Hospital 

Peshawar and were streaked on the selective media such as 

McConkey agar, Eosine Methylene Blue Agar, ManitolSalt Agar, 

Cysteine Lactose Electrolyte Deficient Agar, Bismith Sulphite Agar 

and Blood Agar. All petri plates were incubated at 37°C for 24 h. 

Identification of pathogenic bacteria 

All isolated pathogenic bacteria were identified on the basis of 

morphological and biochemical characteristics on selective media. 

After Gram staining, biochemical tests were carried out to identify 

the pathogenic bacteria up to species level. The following 

biochemical tests were performed for identification, DNase test, 

coagulase test, catalase test, haemolysis, Motility test, Urease test, 

Indole production test, Hydrogen sulphide (H2S) production 

fermentation test, Mannitol and Sucrose Triple Sugar Iron test for 

lactose/glucose fermentation, Oxidase test, Citrate utilization test, 

Nitrate reduction test, Methyl Red Voges Proskauer (MR-VP)Test 

(Monica, 2005). 

Sensitivity assay 

Disc diffusion assay was performed according to the procedure of 

Kirby bauer (CLSI, 2006), for all isolated pathogenic strains using 

10 different antibiotic discs. The turbidity of the indicator pathogenic 

bacteria was adjusted with McFarland solution and then dipped a 

sterilized cotton bud in the adjusted culture and prepared a uniform 

lawn on nutrient agar media for every isolated pathogen. Selected 

antibiotic discs were gently placed on the prepared lawn with equal 

distance using forcep. Then the nutrient agar plates were incubated 

at 37°C for 24 h. After 24 h the results for sensitivi ty were observed 

(Table 3). 

Preliminary tests for bioactive compounds production, by 

Aspergillusochraceus against human pathogenic bacteria 

Aspegillusochraceous was cultured in the PDA media and 

incubated for 5 days at 28°C. Human pathogenic strai ns were 

inoculated in 50 ml nutrient broth media and incubated in orbital 

shaker (150 rpm) at 37°C for 24 h. After 24 h 5 ml of broth culture 

was taken in sterilized test tubes and the turbidity of culture was 

adjusted with McFarland solution, normal saline was added for 

turbidity adjustment. Sterilized cotton bud was dipped in the 

adjusted indicator strains and prepares lawn of each pathogenic 

strain on the nutrient agar media. 

Pustules of 8 mm diameter was taken from already incubated 

culture on PDA media using cork borer of the same diameter and 

gently placed on each prepared lawn using sterilized forcep. All 

Petri dishes were incubated for 24 h at 37°C. After 24 h zone of 

inhibition around the pustule was observed (Table 2).

RESULTS 

Table 2. Antimicrobial activity of Aspergillusochraceus against human pathogenic bacteria. 

Pathogenic bacteria Antimicrobial activity 

Staphylococcus aureus /15 + 

Klebsiela spp /6 + 

Streptococcus spp /4 + 

Escherichia Coli/10 + 

Pseudomonas aureginosa /6 + 

Salmonella typhi/4 + 

+= positive. /15, 6, 4, 10, 6, 4=number antibiotic resistant bacteria isolated from patient samples. 

Isolation and identification of fungi 

Nine Fungal strains were isolated from 33 soil samples 

collected from different hospitals of Peshawar. Primarily 

one strain of fungi was selected for antimicrobial activity 

and identification. All other isolated fungi showed no 

activity against pathogenic strains and were not processed 

further. The selected strain was identified using 

variety of manuals and monographs based upon the 

morphology and colony characteristics, like growth 

pattern of colony, colorand exudates produced and 

sporulating structure like conidial head, types of 

conidiogenous cells, arrangement of conidia, sporangial 

head, types of spores, pycnidia, accervuli, sporodochia 

and ascocarps (Domsch et al., 1980; Salar and Aneja, 

2007). The fungus was identified as A. ochraceus. 

Determination of antimicrobial spectra of isolated 

fungi 

Isolated fungal strain was tested against 45 human 

pathogenic bacteria. Antimicrobial results were observed 

against both Gram positive and Gram negative 

pathogenic bacteria around 8 mm pustules. Significant 

results were observed against Gram positive bacteria 

which were15-20 mm zone of inhibition around the 

pustules. Good results were observed against Gram 

negative pathogenic bacteria, which were 10-15 mm 

zone of inhibition around 8 mm pustules except E. coli 

which were less than 10 mm (Table 2). 

Identification, sensitivity assay of pathogenic 

bacterial strains and antimicrobial activity of 

Aspergillusochraceus 

The bacterial isolates were identified on the basis of 

morphological and biochemical characteristics these 

includes, S. aureus, P. aeruginosa, S. typhi, 

streptococcus spp, klebsiella spp and E. coli. Majority of 

the isolated bacterial strains were resistant to two or 

Riaz et al. 5957 

more than two antibiotics. That is why these all isolated 

pathogens were considered multi drugs resistant for 

those antibiotics A. ochraceus showed activity against all 

MDR bacterial strains (Table 3). 

DISCUSSION 

Diverse groups of fungi exits in soil because of its natural 

habitat. Fungi are the second largest fraction of soil micro 

flora. Due to its nutritional requirements they survive as 

saprophytes in their natural habitat. Physical and 

chemical conditions of soil increases or decreases the 

population of fungi (Tariq et al., 2008). Many bioactive 

compounds have been isolated from soil fungi having 

structural novelty which become the important source for 

antibiotics developments. Six prescribed medicines out of 

20 recommended medications are from fungal source 

(Tangjang and Arunachalam, 2009). 

We isolated A. ochraceus which produced bioactive 

secondary metabolites against multi drugs resistant 

bacteria. 

Multi drugs resistant bacteria were isolated from 

patients samples and sensitivity assay was conducted. 

Isolated A. ochraceus showed significant results against 

both Gram positive and Gram negative MDR bacteria. 

In the previous studies A. ochraceus CL41582 was 

isolated which inhibited the growth of MDR S. aureus, S. 

pyogenes and E. faecalis (Yutaka et al., 2001). 

In this study we used 10 different antibiotics for 

sensitivity tests against isolated pathogenic bacteria 

(Cefotaxime, Cephradine, Levofloxacin, Sparfloxacin, 

Linezolid, Vancomycin, Teicoplanin, Fusidic acid, 

Cotrimaxazole, Chloramphenicol) to confirm antibiotic 

resistance. Pustules of 8 mm disc having diffused 

secondary metabolites of A. ochraceus were used 

against all isolated pathogens. 10-15 mm zone of 

inhibition was observed against Gram negative bacteria 

except E. coli which showed minimum activity. While 15- 

20 mm zone of inhibition was observed against Gram 

positive bacteria. 

Our results correlates with the previous study conducted 

on A. cohraceus a new compound was extracted 

from A. ochraceus which was active against MDR,


Table 3. Disc diffusion assay for all isolated pathogenic strains and anti-pathogenic activity of Aspergillus ochraceus. 

Pathogens used Anti-biotic discs 

CEF CEPH LEVO SPAR LINE VANCO TEICO FUS COT CHLO RM82 

Klebsiella spp R R R R S S S S R S + 

Klebsiella spp R R S S S S S S R S + 

Klebsiella spp R S S R S S S S S S + 

Klebsiella spp R S S S S S S S R S + 

Klebsiella spp S R S S S S S S S S + 

Klebsiella spp S R S S S S S S R S + 

Streptococcus R S S S S S S S R S + 

Streptococcus S S S S S S S S R S ++ 

Streptococcus R S S S R S S S S S + 

Streptococcus S R S S S S S S R S + 

P. aeruginosa R R R R S S S S S S + 

P. aeruginosa R R R S S S S S S S + 

P. aeruginosa S R I R S S S S S S + 

P. aeruginosa S S S S S S S S S S + 

P. aeruginosa S R R R S S S S S S + 

P. aeruginosa R R I S S S S R S S + 

S. aureus S S S S S S S R R S ++ 

S. aureus R S S R S S S S R S ++ 

S. aureus S S S S S S S S S S ++ 

S. aureus R S R R R S R S S S + 

S. aureus R R R R S S S R R R + 

S. aureus R S R R S S S R R R ++ 

S. aureus R R R R S S S S R R + 

S. aureus S R S S S S S S R S ++ 

S. aureus R S S R R S S S S S ++ 

S. aureus R S S R S S S S R S ++ 

S. aureus S R S S S S S S R S ++ 

S. aureus R R S S R S S S R S ++ 

S. aureus R S S S S S S S R R ++ 

S. aureus R S S S R S S S S S ++ 

S. aureus R S S S R S S S S R ++ 

E. coli R R S S S S R S S S -- 

E. coli R R R R S S S S S S -- 

E. coli R S S S S I S S R S -- 

E. coli R R S S S S S S R S -- 

E. coli R R S S S S S S R S -- 

E. coli S R S S S S S S S S -- 

E. coli R S R R S S S S S S -- 

E. coli S R R R S S S S S S -- 

E. coli S R S S S S S S S S -- 

E. coli S R S R S S S S S S -- 

S. typhi S R S S S S S R S R + 

S. typhi R R S S S S S S S S + 

S. typhi S R S S S S S S S S + 

S. typhi S R S S S S S S S S + 

S. aureus (cefr, genf, methr, MLSBr, penr, tetr, cipr and 

vans) were MDR clinical strain. S. pyogenes was MLSBr, 

kanr and str1". E. faecalis were also an MDR clinical 

strain (cefr, eryr, genf, chlr, kanr, tets and van1). 

Extracted compound from A. ochraceus showed no 

activity against E. coli (Yutaka et al., 2001).

In another study carried out on molds bioactive 

compounds seven fungal species were isolated and 

evaluated against clinical isolates, the results revealed 

the presence of bioactive compounds with antimicrobial 

activity against 22 clinical bacterial isolates including 

eleven isolates of Gram positive and remaining were 

Gram negative. The fractions extracted from molds were 

thoroughly more active on Gram positive bacteria than 

Gram negative (Amal and Mekawey, 2010). 

We used forty five clinical isolates and isolate nine 

fungal species, A. ochraceus have antibacterial activity. 

Significant antimicrobial activity was observed against 

Gram positive bacteria while good and minimum results 

were observed against Gram negative bacteria. In 

conclusion we need further evaluation and purification of 

bioactive fractions produced by A. ochraceus, so as to 

minimize resistance associated with MDR bacteria. 


Author is greatly thankful to the administration of Lady 

Reading Hospital (LRH), Peshawar especially Sardar Ali 

senior technician pathology laboratory LRH. We are also 

thankful for University of Peshawar to support us in this 

research. 

REFERENCES 

Amal AI, Mekawey (2010). The Antibiotic Properties of Several Strains 

of Fungi Australian Journal of Basic and Applied Sciences, 4(8): 

3441-3454. 

Barbara DJ, Clewes E (2003). Plant pathogenic Verticillium species: 

How many of them are there?"Molecular Plant Pathology, 4(4): 297- 

305. 

Clinical and Laboratory Standards Institute (CLSI) (2006).CLSI: 

Performance Standard for Antimicrobial Susceptibility Testing. 16 th 

Informational supplement. CLSI document M100-S16. 

Gilmore MS, Hoch JA (1999). A vancomycin surprise. Nature, 399: 524- 

527. 

Riaz et al. 5959 

Levy SB (1998). The challenge of antibiotic resistance. Scientific Am., 

pp. 46-53. 

Levin SA,Andreasen V (1999). Disease transmission dynamics and the 

evolution of antibiotic resistance inhospitals and communal settings. 

Proc. Natl. Acad. Sci.USA. pp. 800-801. 

Luzhetskyy A, Pelzer S, Bechthold A (2007). The future of natural 

products as a source of new antibiotics. Curr. Opin. Investigat. Drugs, 

8: 608-613. 

Shahghasi AGH, Shahidi, Fooladi MH, Mahdavi MJ (2004). 

Broadspectrim, a novel antibacterial from Streptomyces sp. 

Biotechnology, 3(2): 126-130. 

McCarthy AJ, Williams ST (1990). Methods for Studying the Ecology of 

Actinomycetes. Methods In Microbiology. Ed. by. Grigorova R and 

Norris JR, Academic Press Limited, London, 22: 533-363. 

Monica C (2005). District laboratory practice in tropical countries. 2 nd 

edition: pp. 62-72. 

Nedialkova D, Naidenova M (2004). Screening the antimicrobial activity 

of actinomycetes strains isolated from Antarctica. J. Cult. 

Collections, 4: 29-35. 

Domsch KH, Gams W, Anderson TH (1980). Compendium of Soil 

Fungi. Academic Press, London. 

Ouhdouch Y, Barakate M, Finanse C (2001). Actinomycetes of 

Moroccan habitats: Isolation and screening for antifungal activities. 

Eur. J. Soil Biol., 37: 69-74. 

Saadoun I, Gharaibeh R (2003).The Streptomyces flora of Badia region 

of Jordan and its potential as a source of antibiotics active against 

antibioticresistant bacteria. J. Arid Environ., 53: 365 - 371. 

Salar RK, Aneja KR (2007).Thermophilic fungi: Taxonomy and 

biogeography. J. Agri. Technol., 3: 77-107. 

Tangjang S, Arunachalam K (2009). Microbial population dynamics of 

soil under traditional agroforestry system in northern India. Res. J. 

Soil. Biol. 1: 1-7. 

Tariq M, Dawar M, Mehdi FA (2008). Studies on the rhizosphere 

mycoflora of mangroves. Turk. J. Bot., 32: 97-101. 

Thomashow LS, Bonsall RF, David M (2008). Detection of antibiotics 

produced by soil and rhizosphere microbes in situ. In: Karlovsky, P. 

(Ed.). Secondary Metabolites in Soil Ecology. Springer Berlin, 

Heidelberg, 23-36. 

Yutaka S, Hideo H, Taisuke I, Masaru I, Yoon. Jm, Yasuhiro K, Tatsuo 

Sa, Shinichi S, Akemi S, Yumiko S, Lori B, Joan D, Liang HH, Joyce 

S, Nakao K (2001). A New Antibiotic CJ-17,665 from Aspergillus 

ochraceus. J. Antibiotics, 54: 911 – 916. 

Zrimec MB, Zrimec AP, Slanc, Kreft S (2004).Screening for antibacterial 

activity in 72 species of wood-colonizing fungi by the Vibrio fisheri 

bioluminescence method. J. Basic Microbiol., 44(5): 407-412.




DOI: 10.5897/AJMR11.1082 


Seroprevalence of avian origin H3N2 canine influenza 

virus infection in pet dogs in Shenzhen, China 

Fu-Rong Zhao 1,2# , Shou-Jun Li 1# , Dong-Hui Zhou 2 , Ning Chen 3 , Yan-Zhong Zhang 4 , Wen-Bao 

Qi 1 , Pei-Rong Jiao 1 , Ming Liao 1 , Guang-Zhi Tong 5 and Gui-Hong Zhang 1 * 

1 College of Veterinary Medicine, South China Agricultural University, Guangzhou, Guangdong Province 510642, 

People’s Republic of China. 

2 State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, 

Lanzhou Veterinary Research Institute, CAAS, Lanzhou, Gansu Province 730046, People’s Republic of China. 

3 Shenzhen Institute for Drug Control, Shenzhen, Guangdong Province 518057, PR China. 

4 Shenzhen Rui-Peng Pet Hospitol, Shenzhen, Guangdong Province 518001, PR China. 

5 Division of Swine Infectious Diseases, Shanghai Veterinary Research Institute, CAAS Shanghai 200241,People’s 

Republic of China. 


Canine influenza virus (CIV) is an emerging pathogen that causes severe and acute respiratory disease 

in dogs. Canine influenza is caused by two subtypes of influenza. A virus: H3N2 and H3N8. In recent 

years, surveys of avian origin CIV infection in dogs have been reported worldwide. However, little is 

known about the prevalence of CIV in pet dogs in China. In the present study, the prevalence of avian 

origin CIV H3N2 in pet dogs in Shenzhen, Southern China was investigated using the enzyme-linked 

immunosorbent assay (ELISA) and hemagglutination inhibition (HI) assay. Thirty-one (6.71%) of the 462 

serum samples tested were seropositive for avian origin CIV by ELISA. Use of the HI test revealed the 

presence of anti-H3 antibodies in 28 (6.06%) of 462 serum samples. The prevalence ranged from 4.87% 

(HI) or 6.19% (ELISA) to 7.41% among dogs of different ages, with high prevalence in pet dogs of 1 to 3 

years old, but low prevalence in pet dogs ≤1 year. The seroprevalence in female dogs was 5.21%, and in 

male dogs it was 7.78% (ELISA) or 6.67% (HI). These findings demonstrated that avian origin canine 

influenza virus infection is prevalent in pet dogs and can spread rapidly through local dog populations, 

which indicates its potential for becoming established in pet dogs throughout China. 

Key words: Canine influenza virus, seropervalence, pet dog, enzyme-linked immunosorbent assay (ELISA), 

hemagglutination inhibition (HI) assay. 

INTRODUCTION 

Canine influenza virus (CIV) is a member of the influenza 

virus A genus in the family Orthomyxoviridae and an 

emerging pathogen that causes severe and acute 

respiratory disease in dogs (Jirjis et al., 2010; Lee et al., 

2010). CIV was first identified in racing greyhounds in 

*Corresponding author. E-mail: guihongzh@scau.edu.cn. 

#These authors contributed equally to this work. 

Florida in January 2004 (Payungporn et al., 2008). Canine 

influenza is caused by 2 subtypes of influenza A virus: 

H3N2 and H3N8. In 2005, the H3N8 CIV is known to be 

an equine-derived H3N8 influenza virus and was first 

identified in dogs in the United States, and in 2007, the 

H3N2 CIVs are of avian origin and detected in dogs in 

Korea and China (Crawford et al., 2005; Payungporn et al., 

2008; Song et al., 2011b; Lee et al., 2010; Li et al., 2010). 

Regardless of subtype, avian origin H3N8 or H3N2 CIV 

could infect nascent individuals and causes clinical signs. 

The most common sign of canine influenza is a mild

espiratory disease that resembles infectious 

tracheobronchitis. The experimental reproduction of the 

disease caused by H3N2 CIV induced clinical signs 

including coughing, sneezing, nasal discharge, fever, and 

shedding of the virus in nasal discharge (Song et al., 

2011a, 2009; Lee et al., 2010). In previous pathological 

findings, the infection produced a distinctively severe and 

persistent bronchopneumonia with neutrophil infiltration 

and apoptosis in the tracheal epithelium (Jung et al., 

2010). 

Epidemics of avian origin H3N2 CIV among dogs have 

been observed in Korea, specifically in contaminated 

kennels in veterinary clinics. Serologic and virological 

survey of the avian-origin H3N2 CIV in dogs in South 

Korea suggest that the epidemiological situation 

resembles that of equine origin H3N8 CIV currently 

circulating in the dog populations of the United States 

(Payungporn et al., 2008; Song et al., 2008; Lee et al., 

2009). However, no such serological or etiological studies 

have been carried out in pet dogs in Shenzhen, Southern 

China. 

The objectives of the present investigation were to 

examine avian origin H3N2 CIV in pet dogs in five pet 

hospitals in Shenzhen, Southern China under the present 

husbandry practice and animal welfare, and to evaluate 

the risk factors for CIV infection in different ages and 

genders of pet dogs. 


Study area 

Shenzhen is located in the very South of Guangdong province, 

overlooking HongKong to the South and bordering kowloon. It has 

an area of 1984.69 square meters, it is east to the Daya and Dapeng 

Bays, west to Pearl River, North to Dongguan and Huizhou and 

south to Hong Kong Special Administrative Regions of the People’s 

Republic of China. It consists of 6 districts: Luohu, Futian, Nanshan, 

Yantian, Bao’an and Longgang which the first two are mainly urban 

areas. It has a mild subtropical oceanic climate with an annual 

average temperature of 22.3°C. 

Serum preparation 

A total of 462 blood samples were collected from 5 different pet 

hospitals which are distributed in Futian and Luohu districts of 

Shenzhen city between May and July 2009. 82, 114, 127, 101 and 

38 blood samples were obtained from pet dogs in Cuizhu, Futian, 

Honggui, Meilin and Shangbu pet hospitals, respectively. These 

samples were put aside for solidification followed by centrifugation 

at 1,000 × g for 10 min, and supernatants were transferred to new 

centrifuge tubes and saved at -20℃ until use. 

Serological tests 

ELISA test 

The 462 serum samples described above were analyzed for 

CIV-specific antibodies by using a commercial ELISA Kit (Animal 

Zhao et al. 5961 

Genetics Inc., South Korea) that can detect anti-nucleoprotein (NP) 

antibodies based on competition principles. The use of this ELISA kit 

for CIV detection has been previously reported (Lee et al., 2009; An 

et al., 2010). Briefly, ELISA plates coated with the antigen 

(nucleoprotein) are incubated with an equal mixture of 50 µl serum 

and 50 µl anti AIV antibody-HRP (Horseradish Peroxidase, 1:100 

dilution in the conjugate diluent) for 30 min at 37°C. Then, the wells 

were washed 6 times with 350 µl of diluted washing solution. Then, 

100 µl substrate was added to each well and incubated for 10 

minutes at room temperature. Finally, 100 µl of stopping solution 

was added to each well. The absorbance of the wells was read with 

a bichromatic spectrophotometer at 450 nm with reference 

wavelength at 620 nm. Reading must be completed within 1 hour 

from the end of an assay. Positive and negative control sera were 

provided by the kit with 2 wells for each. 

The mean absorbance of the negative controls was calculated, 

and then the PI (Percent inhibition) value of each serum was 

calculated, using the following formula: 

PI value = [1-(OD sample/mean OD negative)] × 100 

Based on PI value, classification of each sample was as follows: 

PI


Table 1. Seroprevalence of canine influenza virus (CIV) in pet dogs in different pet hospitals in Shenzhen, 

southern China. 

Pet hospitals Examined number 

Seroprevalence (%) 

ELISA HI 

Cuizhu 82 17.07 (14/82) 14.63 (12/82) 

Futian 114 2.63 (3/114) 2.63 (3/114) 

Honggui 127 6.30 (8/127) 5.51 (7/127) 

Meilin 101 5.94 (6/101) 5.94 (6/101) 

Shangbu 38 0 (0/38) 0 (0/38) 

Total 462 6.71 (31/462) 6.06 (28/462) 

Table 2. Seroprevalence of canine influenza virus (CIV) in pet dogs of different ages and genders in Shenzhen, 

Southern China using ELISA and HI test. 

Variable Class 

Prevalence (%) 

ELISA HI 

Age (years) ≤1 6.19 (14/226) 4.87 (11/226) 

1-3 7.41 (10/135) 7.41 (10/135) 

> 3 6.93 (7/101) 6.93 (7/101) 

Gender Male 7.78 (21/270) 6.67 (18/270) 

Female 5.21 (10/192) 5.21 (10/192) 

namely 0, 2.63, 5.94, 6.30 and 17.07% of the samples 

from Shangbu, Futian, Meilin, Honggui and Cuizhu were 

CIV antibody-positive, respectively (Table 1). Among 

these positive pet dogs, seroprevalence varied in different 

age groups, ranging from 4.87% (HI) or 6.19% (ELISA) to 

7.41% (Table 2). The investigation also showed that the 

seroprevalence in female animals was 5.21%, and 7.78% 

(ELISA) or 6.67% (HI) in male animals using ELISA or HI 

(Table 2). All samples were also tested with other 

antigens (H1, H3, H5, H9) for HI test, and they were all 

negative. 

DISCUSSION 

Canine H3N2 influenza viruses of avian origin were 

recently isolated and found to induce disease in dogs in 

Korea (Song et al., 2008). Recently, four genetically 

similar canine influenza H3N2 viruses of avian origin were 

isolated in South China with severe respiratory disease (Li 

et al., 2010). The emergence of these canine influenza 

cases in China could result also from the ecological 

changes in China, especially as the changing of 

socio-economic circumstances, particularly in urban areas 

where dogs are continuing to be raised for food, in some 

circumstances. CIV replicates efficiently in the respiratory 

system of dogs and causes severe respiratory disease. 

Active replication of CIV in the canine respiratory system 

results in intense inflammatory responses central to the 

pathogenesis of H3N2 CIV (Lee et al., 2011). Most natural 

cases of H3N2 CIV died from associated respiratory 

diseases and the carcasses were generally quickly 

discarded by veterinarians for quarantine purposes. 

Here, we report for the first time the seroprevalence of 

avian origin CIV H3N2 infection in dogs in Shenzhen city, 

southern China. 31 of the 462 tested pet dogs were 

seropositive for CIV by Ab ELISA (6.71%), which is higher 

than that in Korea, New Zealand and Japan. The 

seroprevalence of avian H3N2 influenza in Korean pet 

dogs in 2007 was 0.48% (2/419) by ELISA (Lee et al., 

2009). In 2010, 16 (5.59%) of the 286 serum samples 

collected from pet dogs were CIV seropositive by ELISA 

in Korea (An et al., 2010). In New Zealand, the 251 dogs 

serum samples tested was not positive for CIV antibodies 

by indirect fluorescent antibody (IFA) (Knesl et al., 2009). 

In Japan, 12 (2.1%) of the 582 serum samples collected 

from dogs were HI-positive against human H3 virus, only 

one serum each from dogs was NI-positive against N2 

virus (Said et al, 2011). By comparison, 31 of 74 (42%) 

dogs were seropositive for antibodies against CIV H3N8 

in a metropolitan animal shelter (Holt et al., 2010). In 

Colorado, CIV H3N8 seroprevalence was 2.9% (4/140) for 

dogs seen by the Community Practice service and 4.5% 

(5/110) for dogs seen by other hospital services (P = 0.48) 

(Barrell et al., 2010). In Italy, CIV H1N1 seroprevalence 

was 0.7% (7/1061) for canine serum specimens in 2009 

(Dundon et al., 2010). 

In the present study, the seropositivity rates of avian 

origin H3N2 CIV in pet dogs differed depending on 

whether an ELISA or HI assay was performed. For

example, while ELISA text found that 6.30 and 17.07% of 

the pet dogs from Honggui and Cuizhu were exposed to 

avian origin CIV, the HI test detected seropositivity rates 

of 5.51 and 14.63%, respectively. While the HI assay is 

often used to detect antibodies against viral hemagglutinin 

(HA) in human and animal serum, it is not very reliable in 

detecting antibodies to avian influenza viruses in 

mammalian serum because nonspecific hemagglutination 

inhibitors in the sera can result in false positives (Lu et al., 

1982). In addition, Lee et al. (2009) found that the HI 

assay detected anti-influenza H3N2 virus antibodies 2 

days later than the NP-based ELISA test. These results 

suggest that the NP-based ELISA is a better method for 

the serological survey of CIV infections in pet dogs. 

Conclusions 

In summary, the present survey revealed a relatively low 

seropositivity of CIVs in pet dogs in Shenzhen, Southern 

China, which raises the concerns regarding the rapid 

spread of avian origin CIV in pet dogs in animal hospitals 

in China. These findings suggest that commercial 

vaccines against canine influenza virus must be 

developed and used in pet dog population. 


This project was supported in part by the National Natural 

Science Foundation of China (grant No. 30972233), the 

National Key Basic Research Program (Project 973) of 

China (grant no. 2011CB504700-G), the Natural Science 

Foundation of Guangdong Province (No. 

8251064201000008) and the Basic Conditions for 

Science and Technology Projects of Guangdong Province 

(No. 2011B060400015). 

REFERENCES 

An DJ, Jeoung HY, Jeong W, Chae S, Song DS, Oh JS, Park BK (2010). 

A serological survey of canine respiratory coronavirus and canine 

influenza virus in Korean dogs. J. Vet. Med. Sci., 72: 1217-1219. 

Barrell EA, Pecoraro HL, Torres-Henderson C, Morley PS, Lunn KF, 

Landolt GA (2010). Seroprevalence and risk factors for canine H3N8 

influenza virus exposure in household dogs in Colorado. J. Vet. Intern. 

Med., 24: 1524-1527. 

Crawford PC, Dubovi EJ, Castleman WL, Stephenson I, Gibbs EP, Chen 

L, Smith C, Hill RC, Ferro P, Pompey J, Bright RA, Medina MJ, 

Johnson CM, Olsen CW, Cox NJ, Klimov AI, Katz JM, Donis RO 

(2005). Transmission of equine influenza virus to dogs. Science, 310: 

482-485. 

Dundon WG, De Benedictis P, Viale E, Capua I (2010). Serologic 

evidence of pandemic (H1N1) 2009 infection in dogs, Italy. Emerg. 

Infect. Dis., 16: 2019-2021. 

Holt DE, Mover MR, Brown DC (2010). Serologic prevalence of 

antibodies against canine influenza virus (H3N8) in dogs in a 

metropolitan animal shelter. J. Am. Vet. Med. Assoc., 237: 71-73. 

Jirjis FF, Deshpande MS, Tubbs AL, Jayappa H, Lakshmanan N, 

Wasmoen TL (2010). Transmission of canine influenza virus (H3N8) 

Zhao et al. 5963 

among susceptible dogs. Vet. Microbiol., 144: 303-309. 

Jung K, Lee CS, Kang BK, Park BK, Oh JS, Song DS (2010). Pathology 

in dogs with experimental canine H3N2 influenza virus infection. Res. 

Vet. Sci., 88: 523-527. 

Knesl O, Allan FJ, Shields S (2009). The seroprevalence of canine 

respiratory coronavirus and canine influenza virus in dogs in New 

Zealand. N. Z. Vet. J., 57: 295-298. 

Lee C, Jung K, Oh J, Oh T, Han S, Hwang J, Yeom M, Son D, Kim J, 

Park B, Moon H, Song D, Kang B (2010). Protective efficacy and 

immunogenicity of an inactivated avian-origin H3N2 canine influenza 

vaccine in dogs challenged with the virulent virus. Vet. Microbiol., 143: 

184-188. 

Lee C, Song D, Kang B, Kang D, Yoo J, Jung K, Na G, Lee K, Park B, Oh 

J (2009). A serological survey of avian origin canine H3N2 influenza 

virus in dogs in Korea. Vet. Microbiol., 137: 359-362. 

Lee YN, Lee HJ, Lee DH, Kim JH, Park HM, Nahm SS, Lee JB, Park SY, 

Choi IS, Song CS (2011). Severe canine influenza in dogs correlates 

with hyperchemokinemia and high viral load. Virol., 417: 57-63. 

Li S, Shi Z, Jiao P, Zhang G, Zhong Z, Tian W, Long LP, Cai Z, Zhu X, 

Liao M, Wan XF (2010). Avian-origin H3N2 canine influenza A viruses 

in Southern China. Infect. Genet. Evol., 10: 1286-1288. 

Lu BL, Webster RG, Hinshaw VS (1982). Failure to detect 

hemagglutination-inhibiting antibodies with intact avian influenza 

virions. Infect. Immun., 38: 530-535. 

Payungporn S, Crawford PC, Kouo TS, Chen LM, Pompey J, Castleman 

WL, Dubovi EJ, Katz JM, Donis RO (2008). Influenza A virus (H3N8) 

in dogs with respiratory disease, Florida. Emerg. Infect. Dis., 14: 

902-908. 

Said AW, Usui T, Shinya K, Ono E, Ito T, Hikasa Y, Matsuu A, Takeuchi T, 

Sugiyama A, Nishii N, Yamaguchi T (2011). A sero-survey of subtype 

H3 influenza A virus infection in dogs and cats in Japan. J. Vet. Med. 

Sci., 73: 541-544. 

Song D, Kang B, Lee C, Jung K, Ha G, Kang D, Park S, Park B, Oh J 

(2008). Transmission of avian influenza virus (H3N2) to dogs. Emerg. 

Infect. Dis., 14: 741-746. 

Song D, Lee C, Kang B, Jung K, Oh T, Kim H, Park B, Oh J (2009). 

Experimental infection of dogs with avian-origin canine influenza A 

virus (H3N2). Emerg. Infect. Dis., 15: 56-58. 

Song D, Moon H, Jung K, Yeom M, Kim H, Han S, An D, Oh J, Kim J, 

Park B, Kang B (2011a). Association between nasal shedding and 

fever that influenza A (H3N2) induces in dogs. Virol. J., 8: 1. 

Song DS, An DJ, Moon HJ, Yeom MJ, Jeong HY, Jeong WS, Park SJ, 

Kim HK, Han SY, Oh JS, Park BK, Kim JK, Poo H, Webster RG, Jung 

K, Kang BK (2011b). Interspecies transmission of the canine influenza 

H3N2 virus to domestic cats in South Korea, 2010. J. Gen. Virol., 92: 

2350-2355.




DOI: 10.5897/AJMR11.1103 


Assessment of inflammatory cytokines and soluble 

adhesion molecules in patients with systemic 

inflammatory response syndrome in an intensive care 

unit of a Saudi tertiary hospital 

Obeid E. Obeid* and Manal I. Hassan 

Department of Microbiology, College of Medicine, University of Dammam, P.O. Box 2114, Dammam 31451, 

Saudi Arabia. 


Cytokines are endogenous inflammatory mediators, which play a central role in the pathophysiology of 

sepsis and in the expression of the adhesion molecules. The aims of this study are to analyze the levels 

of cytokines and the soluble adhesion in serum of infected (N = 68) and non-infected (N = 41) patients 

with systemic inflammatory response molecules (SIRS). 109 patients in the intensive care unit (ICU) of a 

tertiary hospital were included. IL-6, TNF-α, IL-10, IL-13, sICAM-1 and VCAM-1 were measured using 

enzyme-linked immunosorbent assay (ELISA). Patients with infectious SIRS, the levels of IL-6 varied 

between 27.65 to 39.6 pg/L(mean = 33.4 pg/L); the levels of sVCAM-1 varied between 543 and 1079 ng/ml 

(mean = 782 ng/ml) and the levels of sICAM-1 varied between 320 and 664 ng/ml (mean = 458 ng/ml). In 

patients with non-infectious SIRS the levels of IL-6 varied between 18.2 to 20.3 pg/L(mean 19.2 pg/L); 

the levels of sVCAM-1 varied between 251 and 635 ng/ml (mean = 286 ng/ml) and the levels of sICAM-1 

varied between 98 and 351 ng/ml (mean = 168 ng/ml). The levels of IL-6, sVCAM-1 and s ICAM-1 were 

significantly higher in septic patients than in non-septic patients (p = 0.002; p = 0.003 and p = 0.0002, 

respectively). There was no statistically significant difference in the levels of TNF-α, IL-10 and IL-13 

between infectious and non-infectious SIRS patients. Measurement of pro-and anti- inflammatory 

cytokines and soluble adhesion molecules may be useful in the follow up of ICU patients and in 

providing a point of care tests that will help in decision making and in management of ICU patients. 

Key words: Cytokines, adhesion molecules, enzyme-linked immunosorbent assay (ELISA), intensive care unit 

(ICU) patients. 

INTRODUCTION 

Systemic inflammation is a highly organized response to 

infectious and noninfectious threats to homeostasis 

(Shubin et al., 2011). The main effectors of systemic 

inflammation are inflammatory cytokines, such as tumor 

necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6; 

chemokines and other mediators of inflammation (Shubin 

et al., 2011; Kibe et al., 2011). 

Cytokines (including chemokines) are endogenous 

*Corresponding author. E-mail: oobeid@yahoo.com. Tel: 

00966509929487. 

inflammatory mediators, which play a central role in the 

pathophysiology of sepsis (Nagai et al, 2011). TNF-α is a 

principal pro-inflammatory cytokine that induces systemic 

inflammatory response against the infectious insult 

(Nagai et al., 2011). Other pro-inflammatory cytokines 

include IL-1β, IL6, IL-8, interferon (IFN) γ, and 

macrophage migration inhibitory factor (MIF) (Eggimann 

and Pittet, 2001; Martin et al., 1994; Goldie et al., 1995; 

Pinsky et al., 1993). Excessive production of proinflammatory 

cytokines by immunocompetent cells may 

induce systemic inflammatory response syndrome (SIRS) 

(Damas et al., 1992; Oda et al., 2005). 

Sepsis also activates the production and release of

specific anti-inflammatory substances, including the 

cytokine receptor antagonists, the soluble cytokine 

receptors and the anti-inflammatory cytokines (Makhija, 

2005; Delsesto and Opal, 2011; Tamayo et al., 2011). IL- 

10, IL-13 and transforming growth factor β (TGF- β) are 

anti-inflammatory cytokine, which probably have an 

important down-regulatory function in decreasing the 

production of various pro-inflammatory cytokines, such as 

TNF-α and IL-6 (Marchant et al., 1994; Martin et al., 

1997). 

Nosocomial infections (NIs) are today by far the 

commonest complications affecting hospitalised patients. 

Currently, 5 to 10% of patients admitted to acute care 

hospitals acquire one or more infections, and the risks 

have steadily increased during recent decades (Esposito 

and Leone, 2007; Jarvis, 2001). Although representing 

only 5 to 15% of hospital beds, intensive care units 

(ICUs) account for 10 to 25% of healthcare costs, 

corresponding to 1 to 2% of the gross national product of 

the United States (Esposito and Leone, 2007). 

Vascular cell adhesion molecule-1 (VCAM-1) and 

intercellular adhesion molecule-1 (ICAM-1) are mediators 

of endothelial-leukocyte adhesion in inflammatory states 

(Shapiro et al., 2010; Gando et al., 2005; Figueras-Aloy 

et al., 2007). They mediate 

tight binding and 

extravasation of leukocytes through endothelial cell 

junctions (Brenner et al., 2010). Low levels of adhesion 

molecules are detected in serum of normal individuals 

and several investigators have recently documented 

increased levels in patients with sepsis and other critical 

illnesses (Brenner et al., 2010; Cumming et al., 1997). 

There is interest in examining serum levels of adhesion 

molecules in sepsis and other inflammatory conditions 

and relating their measurement to outcome from critical 

illness (Newman et al., 1993). Up-regulation of 

membrane-bound and soluble forms of adhesion 

molecules and their corresponding ligands on endothelial 

cells is induced by inflammatory mediators, such as TNFα 

and IL-6. Soluble isoforms of adhesion molecules are 

critical for the early events of leukocyte recruitment 

(Jaber et al., 2009). 

The published data on the relationship between the 

serum levels of soluble adhesion molecules and SIRS is 

sparse. Serum levels of cytokines and adhesion 

molecules could be different in different groups of SIRS 

patients because of the differences in the underlying 

cause. The purpose of this study was to assess the level 

of cytokines and soluble adhesion molecules in different 

groups of SIRS patients in the ICU of a tertiary hospital. 


Study population 

All patients admitted to the ICU with SIRS over a period of 12 

months (2007 to 2008) were included (N = 109). The study was 

conducted in a tertiary hospital in Eastern Saudi Arabia (Alzahrani 

et al., 2009). Patients were categorized into the following groups: 

Obeid and Hassan 5965 

patients with sepsis (N = 68) and those with SIRS without infection 

(N = 41). Clinically suspected infection was defined by the attending 

physician including the suspicion of an ongoing infection, combined 

with the initiation of a diagnostic work-up. Patients with SIRS were 

defined as having two or more of the following criteria (Rosengart, 

2006): fever (body temperature >38°C) or hypothermia (body 

temperature 90 beat s min 1 ), 

tachypnea (>20 breaths min 1 ) and leukocytosis or leukopenia 

(white blood cell count >12 000 or


Table 1. Cytokines levels in infectious and non-infectious SIRS patients. 

Cytokine Level in infectious SIRS Level in non-infectious SIRS 

IL-6 27.65-39.6 pg/L(mean=33.4 pg/L) 18.2-20.3 pg/L(mean 19.2 pg/L) 

TNFα 2.5-5.6 pg/ml (mean 2.8 pg/ml) 2.3-4.2 pg/ml (mean 2.6 pg/ml) 

IL-10 11.2-14.2 pg/L(mean=13.4 pg/L) 10.7-14.8 pg/L(mean 12.7 pg/L) 

IL-13 22.5-39.2 pg/L(mean 31.5 pg/ml) 28.3-41.1 pg/L(mean=32.2 pg/ml) 

Table 2. levels of soluble adhesion molecules (SAM) in infectious and non-infectious SIRS patients. 

SAM Level in infectious SIRS Level in non- infectious SIRS 

sVCAM-1 543-1079 ng/ml (mean=782 ng/ml) 251-635 ng/ml (mean=286 ng/ml) 

sICAM 320-664 ng/ml (mean=458 ng/ml) 98-351 ng/ml (mean=168 ng/ml) 

patients with defined source of infection, blood stream 

infection, lower respiratory tract infection, soft tissue 

infection and urinary tract infection constituted the most 

common infections. 

The levels of proinflammatory cytokines were 

measures using enzyme-linked immunosorbent assay 

(ELISA) (Table 1). In patients with infectious SIRS, the 

levels of IL-6 varied between 27.65 to 39.6 pg/L(mean = 

33.4 pg/l) and in patients with non-infectious SIRS the 

levels varied between 18.2 to 20.3 pg/L(mean 19.2 pg/L). 

In patients with infectious SIRS, the levels of TNF-α 

varied between 2.5 to 5.6 pg/ml (mean 2.8 pg/ml) and in 

patients with non-infectious SIRS the levels varied 

between 2.3 to 4.2 pg/ml (mean = 2.6 pg/ml). The levels 

of IL-6 was significantly higher in septic patients than in 

non-septic patients (p = 0.002). There was no statistically 

significant difference in TNF-α levels between infectious 

and non-infectious SIRS patients. 

The levels of anti-inflammatory cytokines were 

measures using ELISA (Table 1). In patients with 

infectious SIRS, the levels of IL-10 varied between 11.2 

to 14.2 pg/L(mean = 13.4 pg/l) and in patients with noninfectious 

SIRS the levels varied between 10.7 to 14.8 

pg/L(mean 12.7 pg/l). In patients infectious SIRS, the 

levels of IL-13 varied between 22.5 to 39.2 pg/L(mean 

31.5 pg/ml) and in patients with non- infectious SIRS the 

levels varied between 28.3 to 41.1 pg/L(mean = 32.2 

pg/ml). There was no statistically significant difference in 

IL-10 and IL-13 levels between infectious and noninfectious 

SIRS patients. 

The levels of sICAM-1 and sVCAM-1 were measured 

using ELISA (Table 2). The levels of sVCAM-1 in patients 

with infectious varied between 543 and 1079 ng/ml 

(mean = 782 ng/ml) and in non-infectious SIRS the levels 

varied between 251 and 635 ng/ml (mean = 286 ng/ml). 

The levels of sICAM in infectious SIRS varied between 

320 and 664 ng/ml (mean = 458 ng/ml) and the levels in 

non-infectious SIRS varied between 98 and 351 ng/ml 

(mean = 168 ng/ml). The levels of sVCAM and sICAM 

were significantly higher in the infectious SIRS than noninfectious 

SIRS patients (p = 0.003 and = 0.0002 

respectively). 

DISCUSSION 

Excessive production of pro-inflammatory cytokines by 

immunocompetent cells can induce SIRS and that these 

cytokines may play an important role in the development 

of acute respiratory distress syndrome (ARDS) or 

multiple organ dysfunction syndromes (MODS) (Oda et 

al., 2005; Delsesto and Opal, 2011). It has been reported 

that blood levels of these pro-inflammatory cytokines are 

elevated in patients with ARDS and septic shock, and 

that measurement of blood levels of these cytokines is 

useful in evaluating the severity and in predicting the 

outcome of the patients with these pathophysiological 

conditions (Delsesto and Opal, 2011). Among these proinflammatory 

cytokines, IL-6 has a longer half-life than 

TNF-α and IL-1β and its blood level remains consistently 

elevated in the presence of various diseases (Tamayo et 

al., 2011). For these reasons, the measurement of 

cytokines such as IL-6 blood levels is potentially useful in 

severity assessment and outcome prediction in patients 

with septic shock, trauma, severe acute pancreatitis, and 

cardiogenic shock (Martin et al., 1997). The rapid 

measurement system that allows blood IL-6 levels to be 

measured within about 30 min using chemiluminescent 

enzyme immunoassay (CLEIA) has recently been 

reported. This system can yield results of IL-6 

measurement on approximately real-time basis when 

incorporated into the clinical laboratory test menu. The 

longer half-life of IL-6 in comparison with TNF-αmay 

explains why we can demonstrate a difference in the 

level of IL-6 and not in the level of TNF-α. 

IL-6 levels are significantly elevated in the majority of 

patients with sepsis and the circulating IL-6 levels have 

correlated with the severity of sepsis in most studies

(Damas et al., 1992; Oda et al., 2005). The persistently 

high levels of IL-6 have been associated with the 

development of multiple organ failure (MOF) and poor 

prognosis (Tamayo et al., 2011). It has been suggested 

that elevated IL-6 levels reflect the activation of 

inflammatory response in sepsis, although the exact role 

of IL-6 in the pathogenesis of sepsis is not clear. 

There was no statistically significant difference in IL-10 

and IL-13 levels between infectious and non-infectious 

SIRS patients. This could be explained by the short halflife 

that leads to transient increase in their level in the 

plasma which makes their measurement in the plasma 

more difficult. Although many cell types express IL-10 

mRNA, not all make detectable amounts of protein, and 

this variation can be accounted for by posttranscriptional 

mechanisms (Powell et al., 2000). Intra-cellular 

measurement of cytokines may provide more sensitive 

mean of cytokine analysis. 

Theoretically, these anti-inflammatory substances may 

have an important regulatory function in controlling and 

attenuating the systemic inflammatory response in sepsis 

(Delsesto and Opal 2011). However, patients with an 

excessive compensatory anti-inflammatory response 

syndrome may be immunosuppressed and at increased 

risk of infection or death. 

The published data on the relationship between the 

serum levels of soluble adhesion molecules and SIRS is 

sparse (Brenner et al., 2010). To assess the serum 

soluble adhesion molecules in the SIRS ICU patients, the 

levels of, soluble Inter-cellular adhesion molecule-1 

(sICAM-1) and Soluble Form of Vascular Cell Adhesion 

Molecule 1(sVCAM-1) were measured using ELISA. The 

levels of sVCAM and sICAM were significantly higher in 

the infectious SIRS than non-infectious SIRS patients. 

This could be due to the vital role of adhesion molecules 

in the process of leukocyte adhesion and migration that 

occur during inflammation. ICAM-1 participates in the 

adhesion of leukocytes to the endothelium and may be 

crucial in regulating leukocyte activation at a very early 

inflammatory response. Expression of adhesion 

molecules is regulated by cytokine activation and recent 

studies examined the role of sICAM-1 in neonatal 

infections, but with controversial results. 

Both mononuclear cells and endothelial cells secrete 

ICAM-1, and ICAM-l expression on endothelial cells is 

up-regulated by cytokines such as IL-6. ICAM-1 is a 

ligand for lymphocyte function-associated antigen-i (LFA- 

1) and is one of the receptors responsible for adhesion of 

T lymphocytes, monocytes and granulocytes to 

endothelium. VCAM-I is expressed on dendritic cells and 

vascular endothelium activated by TNF, IL-I and IL-4. It 

plays a major role in the adhesion of leucocytes to the 

endothelium by interaction with its ligand very late 

activation antigen-4 (VLA-4), which is expressed by 

lymphocytes and monocytes (Jaber et al., 2009). 

In conclusion, measurement of IL-6, sVCAM-1 and 

sICAM-1 appear to correlate with the development of 

Obeid and Hassan 5967 

infection and sepsis in SIRS patients. Measurement of 

pro-and anti-inflammatory cytokines and soluble 

adhesion molecules may be useful in the follow up of ICU 

patients and in providing a point of care tests that will 

help in decision making and in management of ICU 

patients. There is a need for more studies to establish a 

clear strategy for a diagnostic algorithm for cytokine and 

adhesion molecules measurements before such tests are 

eventually used in practice. 


Authors gratefully acknowledge the Dean of Scientific 

Research at the University of Dammam (grant No. 

90065) for the financial support. 

REFERENCES 

Alzahrani AJ, Hassan MI, Obeid OE, Diab AE, Qutub HO, Gupta RK 

(2009). Rapid detection of procalcitonin as an early marker of sepsis 

in intensive care unit in a tertiary hospital. Intern. J Med. Med. Sci., 1: 

516-522. 

Brenner T, Hofer S, Rosenhagen C, Steppan J, Lichtenstern C, Weitz J, 

Bruckner T, Lukic IK, Martin E, Bierhaus A, Hoffmann U, Weigand 

MA (2010). Macrophage migration inhibitory factor (MIF) and 

manganese superoxide dismutase (MnSOD) as early predictors for 

survival in patients with severe sepsis or septic shock. J. Surg. Res., 

164:163-171. 

Cumming CJ, Sessler CN, Beal LD, Fisher BJ, Best AM, Fowler III AA 

(1997). Soluble E-Selectin Levels in Sepsis and Critical Illness 

Correlation with Infection and Hemodynamic Dysfunction. Am. J. 

Respir. Crit. Care Med., 156: 431-437. 

Damas P, Ledoux D, Nys M, Vrindts Y, De Groote D, Franchimont P, 

Lamy M (1992). Cytokine serum level during severe sepsis in human 

IL-6 as a marker of severity. Ann. Surg., 215: 356–362. 

Delsesto D, Opal SM (2011). Future perspectives on regulating pro-and 

anti-inflammatory responses in sepsis. Contrib. Microbiol., 17:137- 

156. 

Eggimann P, Pittet D (2001). Infection control in the ICU. Chest, 120: 

2059–2093. 

Esposito S, Leone S (2007). Antimicrobial treatment for Intensive Care 

Unit (ICU) infections including the role of the infectious disease 

specialist. Intern. J. Antimicrb. Agents, 29: 494-500. 

Figueras-Aloy J, Gómez-López L, Rodríguez-Miguélez JM, Salvia- 

Roiges MD, Jordán-García I, Ferrer-Codina I, Carbonell-Estrany X, 

Jiménez-González R (2007). Serum soluble ICAM-1, VCAM-1, Lselectin, 

and P-selectin levels as markers of infection and their 

relation to clinical severity in neonatal sepsis. Am. J. Perinatol., 24: 

331-338. 

Gando S, Kameue T, Matsuda N, Hayakawa M, Hoshino H, Kato H 

(2005). Serial changes in neutrophil-endothelial activation markers 

during the course of sepsis associated with disseminated 

intravascular coagulation. Thromb. Res., 116: 91-100. 

Goldie AS, Fearon KC, Ross JA, Barclay GR, Jackson RE, Grant IS, 

Ramsay G, Blyth AS, Howie JC (1995). Natural cytokine antagonist 

and endogenous antiendotoxin core antibodies in sepsis syndrome. 

The sepsis intervention group. JAMA., 274: 172–177. 

Jaber SM, Hamed EA, Hamed SA (2009). Adhesion molecule levels in 

serum and cerebrospinal fluid in children with bacterial meningitis and 

sepsis. J. Pediatr. Neurosci., 4: 76-85. 

Jarvis WR (2001). Infection control and changing health-care delivery 

systems. Emerg. Infect. Dis., 7: 170–173. 

Kibe S, Adams K, Barlow G (2011). Diagnostic and prognostic 

biomarkers of sepsis in critical care. J. Antimicrob. Chemother., 2: 33- 

40.


Makhija P, Yadav S, Thakur A (2005). Tumor necrosis factor alpha and 

interleukin 6 in infants with sepsis. Indian Pediatr., 42: 1024-1028. 

Marchant A, Devière J, Byl B, De Groote D, Vincent JL, Goldman M 

(1994). Interleukin-10 production during septicemia. Lancet, 343: 

707–708. 

Martin C, Boisson C, Haccoun M, Thomachot L, Mege JL (1997). 

Patterns of cytokine evolution (tumor necrosis factor-α and 

interleukin-6 after septic shock, hemorrhagic shock, and severe 

trauma. Crit. Care Med., 25: 1813–1819. 

Martin C, Saux P, Mege JL, Perrin G, Papazian L, Gouin F (1994). 

Prognostic value of serum cytokines in septic shock. Intensive Care 

Med., 20: 272–277. 

Nagai M, Hirayama K, Ebihara I, Higuchi T, Imaizumi M, Maruyama H, 

Miyamoto Y, Kakita T, Ogawa Y, Fujita S, Shimohata H, Kobayashi M 

(2011). Serum TNF-Related and Weak Inducer of Apoptosis Levels in 

Septic Shock Patients. Ther. Apher. Dial., 15: 342-348. 

Newman W, Beall LD, Carson CW, Hunder GC, Graben N, Randhawa 

ZI, Gopal TV, Wiener-Kronish J, Matthay MA (1993). Soluble Eselectin 

is found in supernatants of activated endothelial cells and is 

elevated in the serum of patients with septic shock. J. Immunol., 150: 

644-654. 

Oda S, Hirasawa H, Shiga H, Nakanishi K, Matsuda K and Nakamua M 

(2005). Sequential measurement of IL-6 blood levels in patients with 

systemic inflammatory response syndrome (SIRS)/sepsis. Cytokine, 29: 

169-175. 

Pinsky MR, Vincent JL, Deviere J, Alegre M, Kahn RJ, Dupont E (1993). 

Serum cytokine levels in human septic shock. Relation to multiplesystem 

organ failure and mortality. Chest, 103: 565–575. 

Powell MJ, Thompson SA, Tone Y, Waldmann H, Tone M (2000). 

Posttranscriptional regulation of IL-10 gene expression through 

sequences in the 3'-untranslated region. J. Immunol., 165: 292-296. 

Rosengart MR (2006). Critical care medicine: landmarks and legends. 

Surg. Clin. North. Am., 86: 1305-1321. 

Shapiro NI, Schuetz P, Yano K, Sorasaki M, Parikh SM, Jones AE, 

Trzeciak S, Ngo L, Aird WC (2010). The association of endothelial 

cell signaling, severity of illness, and organ dysfunction in sepsis. 

Crit. Care, 4 :182. 

Shubin NJ, Monaghan SF, Ayala A (2011). Anti-inflammatory 

mechanisms of sepsis. Contrib. Microbiol., 17: 108-124. 

Tamayo E, Fernández A, Almansa R, Carrasco E, Heredia M, Lajo C, 

Goncalves L, Gómez-Herreras JI, de Lejarazu RO, Bermejo-Martin 

JF (2011). Pro- and anti-inflammatory responses are regulated 

simultaneously from the first moments of septic shock. Eur. Cytokine 

Netw., 22: 82-87.




DOI: 10.5897/AJMR11.1126 


Seroprevalence of hepatitis-A virus among children 

aged 1-16 years in Eastern Anatolia, Turkey 

Uğur DEVECI 1 , Cemal USTUN 2 * and Ozlem HAMANCA 3 

1 Department of Pediatric, Ministry of Health, Tunceli State Hospital, Tunceli –Turkey. 

2 Department of Infectious Diseases and Clinical Microbiology, Ministry of Health, Elazig Harput State Hospital, 

Elazig-Turkey. 

3 Department of Clinical Microbiology, Ministry of Health, Tunceli State Hospital, Tunceli-Turkey. 

Accepted 5 December, 2011 

This study aims to determine the seroprevalence of hepatitis A among children aged 1-16 years in 

eastern region of Turkey. The study was conducted at Tunceli State Hospital in Eastern Anatolia, 

Turkey. Anti-HAV IgM and Anti-HAV IgG antibodies were evaluated among 351 patients admitted to our 

pediatric policlinic. Anti-HAV IgM and Anti-HAV IgG serologic markers were determined using the ELISA 

method. The mean age of 351 pediatric patients was 7.5±4.2; of these, 198 (56.4%) were male and 153 

(43.6%) were female. A total of 305 (86.9%) cases in this study were seronegative against hepatitis A. 

Anti-HAV IgG was positive among 46 (13.1%) patients, of these 22 (47.8%) were male and 24 (52.2%) 

were female. The mean age of seropositive cases was 8.4±4.8. Anti-HAV IgM seropositivity was not 

detected in the study. The application of a routine hepatitis A vaccine among children will reduce the 

potential for the development of severe complications. 

Key words: Hepatitis A, seroprevalence, children, vaccination. 

INTRODUCTION 

Viral hepatitis is a major public health problem in 

developing and developed countries worldwide (Ustun et 

al., 2009). Hepatitis A infections spread predominantly by 

fecal-oral route and occur throughout the world. However 

the disease is seen most commonly in developing 

countries, where the prevalence rate approaches 100% 

in children by 5 years of age (Yazigi, 2007). The prevalence 

rate of hepatitis A has been reported as 64.4% 

overall in Turkey. The prevalence rate for western and 

central regions has been reported as 80% and it was 

more than 90% for south-eastern and eastern regions of 

Turkey (Ceyhan et al., 2008). 

The clinical spectrum of hepatitis A virus infection 

ranges from asymptomatic infection to fulminant hepatitis. 

Clinical manifestations depend on the age of the host: 

less than 30% of infected young children are 

*Corresponding author. E-mail: drcustun@gmail.com. Tel: +90 

532 6964378. 

symptomatic, while about 80% of infected adults manifest 

severe hepatitis with remarkably elevated serum 

aminotransferases (Jeong and Lee, 2010). Hepatitis A 

may lead to severe clinical manifestations, including 

fulminant hepatitis, in about 10-15% of adults. Thus, the 

outbreaks of hepatitis A can cause the severe economic 

and work force lost (Richardus et al., 2004). 

This study aims to determine the seroprevalence of 

hepatitis A virus among children aged 1-16 years and to 

observe the changes in the seroprevalence of hepatitis A 

and, whether the hepatitis A vaccination is necessary in 

Tunceli Province of Eastern Anatolia of Turkey or not. 


This retrospective study was conducted in Tunceli State Hospital, 

which is a general hospital that contains 150-beds and is located in 

Eastern Anatolia of Turkey, between August and December 2010. 

A total of 351 patients admitted to pediatric policlinic with any 

reason were included into the study. Patients aged between 1-16 

years, who have not any chronic liver disease were screened. The


Table 1. The demographic characteristics of 351 patients. 

Patient count (%) Mean Age ± Sd* Male (%) Female (%) 

All cases 351 (100) 7.5 ±4.2 198 (56.4) 153 (43.6) 

Seropositive cases 46 (13.1) 8.4 ±4.8 22 (47.8) 24 (52.2) 

Seronegative cases 305 (86.9) 7.4 ±4.0 176 (57.7) 129 (42.3) 

*Sd: Standard deviation. 

Table 2. The studies of hepatitis A seroprevalence conducted in Turkey. 

Researcher Location of Turkey Date Age Case number Seropositivity rate (%) 

Kanra et al. (2002) General 2002 1-4 years 727 42.7 

Alabaz et al. (2005) Southern 2005 12 months 147 36.1 

Ozen et al. (2006) Eastern 2006 3-6 years 286 17.5 

Ceyhan et al. (2008) Southeastern 2006 0-14 years 701 90 

Aslan et al. (2001) Southeastern 1999 2-64 years 400 66.5 

Tekay (2006) Eastern 2004 0-14 years 416 63 

Present study Eastern 2010 1-16 years 351 13.1 

data of hepatitis A serological markers were retrospectively 

collected from patients’ files. Anti-HAV IgM and Anti-HAV IgG 

serological markers were tested by using the ELISA method (Abbott 

Architect I 2000 SR). 

Statistical analysis of the data was done by SPSS for Windows 

16.0 software (SPSS Inc, Chicago, USA). Student’s t-test was used 

to compare the data of patients. 

RESULTS 

The demographic characteristics of 351 patients are 

shown in Table 1. Anti-HAV IgG seropositivity was found 

among 46 (13.1%) patients. Anti-HAV IgM seropositivity 

was not detected in any case during study period. There 

were no statistical significant differences between 

seropositive and seronagative cases in terms of the 

mean age of cases (p=0.7). 

DISCUSSION 

To our knowledge, this is the first study to investigate the 

seroprevalence of hepatitis A virus in Tunceli Province in 

Eastern of Turkey. The seroprevalence rates of hepatitis 

A virus in previous studies conducted in the eastern and 

south-eastern region of our country is presented in Table 

2. According to these results, the seroprevalence rate of 

hepatitis A virus in our study was lower than the other 

studies presented in Table 2. This discordance has been 

considered probably due to the high socioeconomic level 

of population admitted to our hospital. Also, improved 

sanitary and hygienic condition of the population included 

to present study because of the fact that the present 

government has increased the investment for sewerage, 

and sanitary and hygienic condition in our region in the 

last 8 years. In Turkey, socio-economic improvements 

and drinking water quality have been followed by a 

decrease in HAV infection. [http://www.saglik.gov.tr]. Our 

lowest rate of hepatitis A virus seropositivity among 

children indicates the requirement of vaccination against 

hepatitis A virus; because hepatitis A leads to severe 

complication as the child gets older. Nowadays, age of 

exposure to hepatitis A virus infection is increasing 

towards puberty worldwide. This is probably because of 

the epidemiological changes of hepatitis A virus (Jeong 

and Lee, 2010). Similarly, nowadays, hepatitis A virus is 

the most common detected cause of fulminant hepatitis 

among children in our country as well as worldwide 

(Santos et al., 2009; Aydogdu et al., 2003). In this study, 

being the 8.4±4.8 years of the mean age of hepatitis A 

seropositivity may be due to the exposure to hepatitis A 

during school and nursery school age. Improved sanitary 

conditions and hygienic practices have reduced the 

incidence of HAV infection, especially in developed 

countries. Reduction in the number of new cases is 

generally accompanied by a shift in the age of first 

contact with HAV towards older age groups. As a 

consequence, both the severity of the reported cases and 

the risk of outbreaks of disease would increase (Ceyhan 

et al., 2008). In the present study, the reason for not 

detecting anti HAV IgM seropositivity may be due to the 

population including to the study and the time of study 

which was made between August and December 2010. 

In our country, Topal et al. (2011) have reported that 

the seropositivity rate of hepatitis A virus among children 

aged between 1-6 years is 9.4% in western region. Ince 

et al. (2011) have reported that the seroprevalence rate 

of hepatitis A virus among infants aged 12-month old is

23.5% in central region. It is noticed that Turkey has 

intermediate endemicity of hepatitis A infections, and 

endemicity may be change by the geographical and 

socio-economic conditions (Ceyhan et al., 2008). The 

results of present study have confirmed this condition as 

the reported previous studies. The lower results from this 

study have shown that the age of exposure to hepatitis A 

has increased toward puberty. Thus, the vaccination is 

necessary for children older than 2 years in order to 

prevent the severe complications of the disease among 

adults. 

Routine vaccination of young children can prevent 

infection at a later age which likely would be more 

serious. Universal vaccination of young children in Israel 

and Catalonia has resulted in significant reductions in the 

incidence of hepatitis A disease in these countries 

(Dagan et al., 2005; Dominguez et al., 2004). 

The limitation of this study is that its results do not 

indicate the general population of our region, because 

this study is limited with patients admitted to pediatric 

policlinic. 

Conclusion 

The present study demonstrated that the age of exposure 

to hepatitis A infection has been increasing towards 

puberty in our region. The immunization against hepatitis 

A is necessary. The application of a routine hepatitis A 

vaccine among children will reduce the potential for the 

development of severe complications. 

REFERENCES 

Alabaz D, Aksaray N, Alhan E, Yaman A (2005). Decline of maternal 

hepatitis A antibodies during the first two years of life in infants born 

in Turkey. Am. J. Trop. Med. Hyg., 73: 457-459. 

Aslan G, Seyrek A, Iscan A, Sevinc E, Ulukanligil M, Bakir M (2001). 

Hepatit A seroprevalence in Sanliurfa. J. Viral. Hepat., 7: 270-273. 

Deveci et al. 5971 

Aydogdu S, Ozgenc F, Yurtsever S, Akman SA, Tokat Y, Yagcı RV 

(2003). Our experience with fulminant hepatic failure in Turkish 

children: etiology and outcome. J. Trop. Pediatr., 49: 367-370. 

Ceyhan M, Yıldırım I, Kurt N (2008). Differences in hepatitis A 

seroprevalence among geographical regions in Turkey: a need for 

regional vaccination recommendations. J. Viral. Hepat., l5: 69-72. 

Dagan R, Leventhal A, Anis E, Slater P, Ashur Y, Shouval D (2005). 

Incidence of hepatitis A in Israel following universal immunization of 

toddlers. JAMA, 294(2): 202–210. 

Dominguez A, Bruguera M, Plans P, Costa J, Salleras L (2004). 

Prevalence of hepatitis A antibodies in schoolchildren in Catalonia 

(Spain) after the introduction of universal hepatitis A immunization. J. 

Med. Virol., 73(2): 172–176. 

Ince TO, Yalcın S, Yurdakok K, Ozmert EN (2011), Hepatitis A 

seroprevalence among infants aged 12 months in Ankara. Turk J. 

Pediatr., 53:114-116. 

Jeong SH, Lee HS (2010). Hepatitis A: clinical manifestations and 

management. J. Intervirol., 53(1): 15-19. 

Kanra G, Tezcan S, Badur S and Turkish National Study Team (2002). 

Hepatitis A seroprevalence in a random sample of the Turkish 

population by simultaneous EPI cluster and comparison with surveys 

in Turkey. Turk. J. Pediatr., 44: 204-210. 

Ozen M, Yologlu S, Isık Y, Tekerekoglu MS (2006). Anti-HAV IgG 

seropositivity in children aged 2-16 years who were admitted to 

Turgut Ozal Medical Center. Turk. J. Pediatr. Arch., 41: 36-40. 

Richardus JH, Vos D, Veldhuijzen IK, Groen J (2004). Seroprevalence 

of hepatitis A virus antibodies in Turkish and Moroccan children in 

Rotterdam. J. Med. Virol., 72:197- 202. 

Santos DC, Martinho JM, Pacheco-Moreira LF(2009). Fulminant 

hepatitis failure in adults and children from a Public Hospital in Rio de 

Janerio, Brasil. Braz. J. Infect. Dis., 13: 323-329. 

Tekay F (2006). Hepatitis A frequency in children aged between 0-14 

years who admitted to Hakkâri State Hospital. Dicle Med. J., 33: 245- 

247. 

Topal E, Hatipoglu N, Turel O, Aydogmus C, Hatipoglu H, Erkal S, 

Siraneci R (2011). Seroprevalence of Hepatitis A and Hepatitis A 

vaccination rate in preschool age in Istanbul Urban. J. Pediatr. Inf., 5: 

12-15. 

Ustun C, Basuguy E, Deveci U (2009). Seroprevalence of hepatitis B 

and hepatitis C in children admitted to pediatric surgery policilinic. 

Nobel Med., 5 (Sup. 1): 4-9. 

Yazigi N (2007). Viral Hepatitis. In: Kliegman virus RM, Behrman RE, 

Jenson HB, Stanton BF. Nelson textbook of pediatrics. 18th ed. 

Philadelphia: Saunders, pp. 1680-1690.




DOI: 10.5897/AJMR11.1173 


Diversity of nifH gene sequences in the sediments of 

South China Sea 

Lixian Wu 1,2# , Yanhua Cui 3# and Sanfeng Chen 1 * 

1 State Key Laboratory of Agrobiotechnology and College of Biological Sciences, China Agricultural University, 

Beijing 100193, China. 

2 Department of Pathogen Biology, Hainan Medical University, Haikou 571101, China. 

3 School of Food Science and Engineering, Harbin Institute of Technology, Harbin 150090, China. 


In order to contribute to knowledge about structure of marine diazotrophic communities in the 

sediments of South China Sea, the molecular diversity of the nifH gene, which encodes the Fe protein 

of the nitrogenase complex, was assessed by polymerase chain reaction (PCR) amplification using 

PolF/R primers, followed by cloning and sequencing. Sequences of nifH genes were amplified from 

environmental deoxyribonucleic acid (DNA) samples collected during three stations including shallow 

sea (75 m, station L10), shelf (450 m, station L2) and deep sea (1000 m, station L21), and covering an 

area between 17 to 19°N and 111 to 119°E. Samples from shallow sea contained β-, and δ- 

proteobacteria; the shelf contained α-, β-, δ- proteobacteria; the deep sea contained α-, δ-, γproteobacteria, 

firmicutes, and green nonsulfur (GNS) bacterium. These results suggested that 

diazotroph was significant component potentially contributing to nitrogen fixation in South China Sea. 

Key words: nifH, diversity, sediment, the South China Sea. 

INTRODUCTION 

The diazotroph, which is a fundamental component of 

ecosystems, catalyses the reduction of atmospheric N2 

gas to biologically available ammonium, providing an 

important source of fixed nitrogen for the biosphere (Moir, 

2011). Most microorganisms that perform biological N2 

fixation with the nitrogen fixation (nif) gene cluster (Rees 

et al., 2005). The nifH gene, which encodes the iron 

protein of nitrogenase, is a highly conserved functional 

gene useful in phylogenetic studies (Zehr et al., 2003). 

Culture-independent and molecular methods were 

developed and applied in assessment of diazotroph 

diversity by amplifying, cloning and sequencing of the 

nifH gene from environmental DNA samples (Falcon et 

*Corresponding author. E-mail: chensf@cau.edu.cn. Tel: +86 

10 62731551. Fax: +86 10 62731551. 

#, The first and the second authors contributed equally to this 

work. 

al., 2002; Jenkins et al., 2004; Moisander et al., 2007, 

2008; Langlois et al., 2008). The diversity of diazotrophs 

was accessed in many different habitats by this 

approach, including soils, freshwater and saltwater lakes, 

salt marshes, deep-sea vents and so on (Falcon et al., 

2002; Jenkins et al., 2004; Moisander et al., 2007, 2008; 

Langlois et al., 2008). 

The South China Sea (SCS) is one of the largest 

marginal seas in the tropical Pacific that potentially 

shares microbial community components from coastal 

and open ocean ecosystems (Moisander et al., 2008). 

The SCS has a deep basin with a maximum depth of 

5000 m and a shelf less than 100 m deep, the conditions 

such as warm, permanently stratified, oligotrophic, and 

dust rich. The environment is favorable for nitrogen 

fixation (Karl et al., 2002; Moisander et al., 2008; Zhang 

et al., 2011). 

In the present study, diazotrophic bacteria associated 

with sediments were investigated by the diversity analysis 

of sequences amplified by polymerase chain reaction 

(PCR) from deoxyribonucleic acid (DNA) extracted from

different depths of the SCS. The amplified nifH products 

were characterized by DNA sequencing and were 

compared with the sequences of nitrogenase genes 

available in database from different environment. 

Investigations of nifH diversity and phylogenetic analysis 

in the SCS sediments may help to understand the 

distribution of diazotrophic bacteria. 


Sampling and DNA extraction 

Samples were collected from the subsurface sediment of the SCS 

of different depths of water column in the range of 70-1,000 m. 

Samples from shallow sea (75 m, station L10), shelf (450 m, station 

L2) and deep sea (1000 m, station L21). Three sediment samples 

were collected during the month of July 2007; collection was three 

times in one sample. Undisturbed surface sediments down to 1-5 m 

depth were sampled using sterile techniques and stored in liquid 

nitrogen during the cruise and at -80°C after returning to the 

laboratory. Sediment DNA was extracted by a previously 

established procedure (Zhou et al., 1997). 

Polymerase chain reaction (PCR), cloning and restriction 

fragment length polymorphism (RFLP) analysis 

Bacterial nitrogenase reductase genes were amplified with primers 

PolF (5'-TGCGAYCCSAARGCBGAC TC-3') and PolR (5'-ATS 

GCCATCATYTCRCCGGA-3') (Poly et al., 2001). Thermal cycling 

conditions were 95°C for 5 min, followed by 30 cycles of 94°C for 

30 s, 53°C for 1 min, 72°C for 40 s, and a final extension step of 

72°C for 5 min. The PCR products were then cloned using a 

TAKARA TA cloning kit (TOYOBO Shanghai, Shanghai, China). 

PCR amplification products containing the right-size (402 bp) insert 

were digested with 1 U of restriction enzymes Mbo Ι, Rsa Ι, Msp Ι 

(MBI) for 4 to 8 h at 37°C. The restriction profiles were evaluated by 

electrophoresis in 3% agarose gel. Clones that produced the same 

RFLP pattern were grouped together and considered 

representatives of the same operational taxonomic unit (OTU). The 

PCR products showing different RFLP patterns were randomly 

selected for sequencing. Plasmid DNA was prepared and 

sequenced, at least twice in both directions, by using an ABI 

PRISM 377 DNA sequencer (Perkin-Elmer Cetus Instruments, 

Norwalk, CT). 

Sequence alignment and phylogenetic analysis 

The product of about 402 bp fragment was obtained by PCR 

reaction. The sequences of nifH gene from the NCBI GenBank 

database were selected on the basis of sequence similarity to one 

or more of the marine sequences. These diazotrophs sequences 

were utilized for phylogenetic reconstructions. Protein sequences 

for each major sequence cluster were aligned in Clustal W 

(Thompson et al., 1994). Maximum likelihood phylogenies were 

constructed in MEGA (ver. 5.0) by the Bootstrap method using pair 

wise deletion of gaps and missing data with 1000 bootstrap 

resamplings (Tamura et al., 2011). 

Nucleotide sequence accession numbers 

The nifH sequences determined in this study are available in the 

GenBank database, accession numbers HM063747-HM063831. 


Analysis of all nifH clones in three stations 

Lixian et al. 5973 

The nifH gene has been one of the most important 

functional genes used when studying diversity in 

numerous habitats in last few years. In this study, the 

nifH gene was used as a molecular marker for studying 

the diazotrophic diversity and abundance in the SCS 

sediments in three stations. A total of 203 nifH clones 

from three sediment samples were obtained (station L10, 

43 clones; station L2, 91 clones; station L21, 69 clones). 

The diversity of nifH sequences was analyzed by 

restriction fragment length polymorphism (RFLP), and 48 

restriction profiles were obtained in this study. The 

deduced amino acid sequences shared 39% to 99% 

similarity to the closest match GenBank nifH and nifH-like 

sequences. Phylogenetic analysis indicated that most 

nifH protein sequences might be obtained from currently 

uncultured or uncharacterized bacteria, and covered 

diverse environments. The similarity of sequenced nifH 

genes ranged from 73 to 100% between each other. 

nifH diversity in station L10 

In shallow sea (75 m, station L10), 9 protein sequences 

(43 clones) clustered into three major groups, including βδ- 

subdivisions of proteobacteria (Figure 1). The most 

sequences were belonging to δ-proteobacteria, including 

L10-H10, L10-H66, L10-H134, L10-H192, L10-H244, 

L10-H290 and L10-H297. These sequences were very 

similar to sequences previously recovered from various 

environments, including rhizosphere of plant, soil, corals, 

oligotrophic tropical sea grass bed communities, salt 

marsh, beach, marine sediment, and bay (Zhang et al., 

2006; Musat et al., 2006; Coelho et al., 2008; Lovell et 

al., 2008; Teng et al., 2009). These sequences showed 

high homology with nifH genes of the Desulfovibrio sp. 

(Desulfovibrio magneticus, Desulfovibrio aespoeenisis), 

Desulfonatronospira thiodism, Sinorhizobium sp., and 

Bradyrhizobium japonicum. The sequences L10-H134 

and L10-H290 had high identity with sequences 

previously recovered from northern South China Sea 

(ADT90055.1), Chesapeake Bay (AAZ06761.1), Jiaozhou 

Bay (ACN77086.1), eastern Mediterranean Sea 

(ABQ50774.1, Man-Aharonovich et al., 2007). The L10- 

H10, L10-H244, and L10-H297 showed a high homology 

with the nifH gene of Sinorhizobium sp. TJ170 and 

Methylococcus capsulatus str. 

The β-proteobacteria cluster contains L10-H200 and 

L10-H243. The protein sequence L10-H200 had a high 

identity with with the nifH genes of Dechloromonas sp. 

SIUL and Zoogloea oryzae. The latter bacterium was 

isolated from rice paddy soil (Xie and Yokota, 2006). The 

protein sequence L10-H243 showed a high homology 

with the nifH gene of uncultured bacterium which was


Figure 1. Phylogenetic trees for nifH of the station L10 constructed in MEGA (ver. 5.0) based on amino acid 

sequences using the Bootstrap method. Phylogenetic relationships were bootstrapped 1000 times, and 

bootstrap values are shown. 

found in the eastern Mediterranean Sea (Man- 

Aharonovich et al., 2007). 


In shelf site (450 m, station L2), 20 protein sequences (91 

clones) clustered into four major groups, including α-, β-, 

δ- subdivisions of proteobacteria (Figure 2). The αproteobacteria 

cluster contained a distinct sequence L2- 

H81. It had a 98% protein sequence similarity with the 

nifH sequences affiliated with Azospirillum brasilense, an 

aerobic, plant growth-promoting rhizobacteria (PGPR) 

isolated from cereal root (Umali-Garcia et al., 1980; 

Steenhoudt and Vanderleyden, 2000; Bashan et al., 

2004; Cui et al., 2006). 

Among the β-proteobacteria, Dechloromonas sp. SIUL 

was the dominant diazotroph covering 50.5% (46/91) of 

the clone library. These protein sequences showed high 

similarity to sequences previously obtained from various 

environments, including rhizospheres, soil, corals, coast, 

salt marsh, eastern Mediterranean Sea, and wastewater 

(Man-Aharonovich et al., 2007; Bowers et al., 2008). The 

protein sequences L2-H1, L2-H9 and L2-H10 showed 

high identity with Dechloromonas sp. SIUL. The protein 

sequences L2-H39 and L2-H111 had 92.9% similarity of 

uncultured marine bacteria (ADT89967 and ADT89983) 

which were found in the northern SCS (Kong et al., 

2011). 

The most sequences belonging to δ-proteobacteria, 

including L2-H3, L2-H4, L2-H6, L2-H15, L2-H18, L2-H19, 

L2-H22, L2-H37, L2-H66, L2-H75, L2-H90, L2-H95, L2- 

H106 and L2-H142. The protein sequences of L2-H3, L2- 

H75, L2-H90 and L2-H106 showed 89%-91% similarity 

with nifH sequences of uncultured bacterium (AAT48890, 

AAT48897) which were found in the Tibetan plateau 

(Zhang et al., 2006). L2-H4 and L2-H22 had high protein 

sequence identity with the nifH sequences of B. 

japonicum which is a species of legume-root nodulating, 

microsymbiotic nitrogen-fixing bacterium species (Dashti 

et al., 1997). L2-H6, L2-H15, L2-H18, L2-H37, L2-H66 

and L2-H142 had high identity of protein sequences with 

nifH sequences of Desulfuromonas acetoxidans DSM 

684 and Desulfovibrio dechloracetivorans (Ju et al., 

2007). 


In deep sea (1000 m, station L21), 19 protein sequences 

(69 clones) clustered into seven major groups, including 

α-, δ-, γ-proteobacteria, firmicutes, and green nonsulfur 

(GNS) bacterium (Figure 3). 

The α-proteobacteria cluster contained a single protein 

sequence L21-H146. It had a 91% protein sequence 

similarity with the nifH sequences of A. brasilense which 

is an important diazotroph isolated from cereal root 

(Umali-Garcia et al., 1980; Steenhoudt and

Figure 2. Phylogenetic trees for nifH of the station L2 constructed in MEGA (ver. 5.0) based 

on amino acid sequences using the Bootstrap method. Phylogenetic relationships were 

bootstrapped 1000 times, and bootstrap values are shown. 

Vanderleyden, 2000; Bashan et al., 2004; Cui et al., 

2006). 

The most sequences belonging to δ-proteobacteria, 

formed the dominant diazotrophic group, including L21- 

H23, L21-H45, L21-H89, L21-H151, L21-H187, L21- 

H209, L21-H212 and L21-H408. The L21-H212 had 90% 

similarity with nifH sequence of uncultured bacterium 


(ADT89832.1) which was isolated from the northern SCS 

(Kong et al., 2011). The L21-H151 had high identity with 

nifH sequence of uncultured bacterium (ADT89817.1) 

which was also isolated from the northern SCS (Kong et 

al., 2011). The sequence L21-H408 showed 90% 

similarity with nifH sequence of Pelobacter carbinolicus 

DSM 2380. The sequences L21-23, L21-H45, L21-89,


Figure 3. Phylogenetic trees for nifH of the station L21 constructed in MEGA (ver. 5.0) based 

on amino acid sequences using the Bootstrap method. Phylogenetic relationships were 

bootstrapped 1000 times, and bootstrap values are shown. 

L21-H187, and L21-H209 showed high identity with nifH 

sequence of B. japonicum, Methylocella tundra and 

Sinorhizobium sp. TJ170. 

The protein sequences L21-H267, L21-H345 and L21- 

H391 belong to the γ-proteobacteria cluster. L21-H267 

had 90% similarity of uncultured marine bacterium 

(ADT89806) which was found in the northern SCS (Kong 

et al., 2011). L21-H345 showed 90% protein similarity 

with Klebsiella pneumoniae which was isolated from the 

root surface of rice (Liu et al., 2011). The L21-H391 had a 

90% protein sequence similarity with different 

environmental sequences, including African sweet potato 

(AAN78189.1; Reiter et al., 2003), Italian white truffle 

Tuber magnatum (Barbieri et al., 2010), rhizosphere of 

mangrove, coastal microbial mats. 

The L21-H27 and L21-H417 belong to firmicutes

cluster, which had high identity with nifH sequences of 

firmicutes Paenibacillus sp. The GNS bacterium cluster 

contained L21-H1, L21-H35, L21-H37, H21-H234 and 

L21-H326. These protein sequences showed high 

similarity with Dehalococcoides ethenogenes 195 

(Seshadri et al., 2005). 

In this study, we examined the phylogenetic diversity 

and abundance of diazotrophs in the SCS by analysis of 

nifH gene from three different stations. The results 

indicated that deep sea sediment had higher diversity of 

diazotrophic bacteria than those of shelf site and shallow 

sea. 


This work was supported by the National Nature Science 

Foundation of China (Grant No. 30470028). 

REFERENCES 

Barbieri E, Ceccaroli P, Saltarelli R, Guidi C, Potenza L, Basaglia M, 

Fontana F, Baldan E, Casella S, Ryahi O, Zambonelli A, Stocchi V 

(2010). New evidence for nitrogen fixation within the Italian white 

truffle,Tuber magnatum. Fungal Biol., 114(11-12): 936-942. 

Bashan Y, Holguin G, de-Bashan LE (2004). Azospirillum-plant 

relationships: physiological, molecular, agricultural, and 

environmental advances (1997-2003). Can. J. Microbiol., 50: 521- 

577. 

Bowers TH, Reid NM, Lloyd-Jones G (2008). Composition of nifH in a 

wastewater treatment system reliant on N2 fixation. Appl. Microbiol. 

Biotechnol., 79 (5): 811-818. 

Coelho MR, de Vos M, Carneiro NP, Marriel IE, Paiva E, Seldin L 

(2008). Diversity of nifH gene pools in the rhizosphere of two cultivars 

of sorghum (Sorghum bicolor) treated with contrasting levels of 

nitrogen fertilizer. FEMS Microbiol. Lett., 279 (1): 15-22. 

Cui YH, Tu R, Guan Y, Chen SF (2006). Cloning, sequencing and 

characterization of the Azospirillum brasilense fhuE gene. Curr. 

Microbiol., 52(3): 169-177. 

Dashti N, Zhang F, Hynes R, Smith D L (1997). Application of plant 

growth-promoting rhizobacteria to soybean (Glycine max [L.] Merr.) 

increases protein and dry matter yield under short-season conditions. 

Plant Soil, 188 (1): 33-41. 

Falcon LI, Cipriano F, Chistoserdov AY, Carpenter EJ (2002). Diversity 

of diazotrophic unicellular cyanobacteria in the tropical North Atlantic 

Ocean. Appl. Environ. Microbiol., 68: 5760-5764. 

Jenkins BD, Steward GF, Short SM, Ward BB, Zehr JP (2004). 

Fingerprinting diazotroph communities in the Chesapeake Bay by 

using a DNA macroarray. Appl. Environ. Microbiol., 70: 1767-1776. 

Ju X, Zhao L, Sun B (2007). Nitrogen fixation by reductively 

dechlorinating bacteria. Environ. Microbiol., 9 (4): 1078-1083. 

Karl D, Michaels A, Bergman B, Capone D, Carpenter E, Letelier R, 

Lipschultz F, Paerl H, Sigman D, Stal L (2002). Dinitrogen fixation in 

the world's oceans. Biogeochemistry, 57/58: 47-98. 

Kong LL, Jing HM, Kataoka T, Sun J, Liu HB (2011). Phylogenetic 

diversity and spatio-temporal distribution of nitrogenase genes (nifH) 

in the northern South China Sea. Aquat. Microbial. Ecol., 65: 15-27. 

Langlois RJ, Hummer D, LaRoche J (2008). Abundances and 

distributions of the dominant nifH phylotypes in the Northern Atlantic 

Ocean. Appl. Environ. Microbiol., 74: 1922-1931. 

Liu Y, Wang H, Sun XL, Yang HL, Wang YS, Song W (2011). Study on 

mechanisms of colonization of nitrogen-fixing PGPB, Klebsiella 

pneumoniae NG14 on the root surface of rice and the formation of 

biofilm. Curr. Microbiol., 62(4): 1113-1122. 

Lovell CR, Decker PV, Bagwell CE, Thompson S, Matsui GY (2008). 

Analysis of a diverse assemblage of diazotrophic bacteria from 


Spartina alterniflora using DGGE and clone library screening. J. 

Microbiol. Methods, 73 (2): 160-171. 

Man-Aharonovich D, Kress N, Zeev EB, Berman-Frank I, Beja O (2007). 

Molecular ecology of nifH genes and transcripts in the eastern 

Mediterranean Sea. Environ. Microbiol., 9(9): 2354-2363. 

Moir JWB (editor) (2011). Nitrogen Cycling in Bacteria: Molecular 

Analysis. Caister Academic Press. ISBN 978-1-904455-86-8. 

Moisander PH, Beinart RA, Voss M, Zehr JP (2008). Diversity and 

abundance of diazotrophic microorganisms in the South China Sea 

during intermonsoon. ISME J., 2: 954-967. 

Moisander PH, Morrison AE, Ward BB, Jenkins BD, Zehr JP (2007). 

Spatial-temporal variability in diazotroph assemblages in 

Chesapeake Bay using an oligonucleotide nifH microarray. Environ. 

Microbiol., 9: 1823-1835. 

Musat F, Harder J, Widdel F (2006). Study of nitrogen fixation in 

microbial communities of oil-contaminated marine sediment 

microcosms. Environ. Microbiol., 8 (10), 1834-1843. 

Poly F, Monrozier LJ, Bally R (2001). Improvement in the RFLP 

procedure for studying the diversity of nifH genes in communities of 

nitrogen fixers in soil. Res. Microbiol., 152: 95-103. 

Rees DC, Akif Tezcan F, Haynes CA, Walton MY, Andrade S, Einsle O, 

Howard JB (2005). Structural basis of biological nitrogen fixation. 

Philos. Transact. A Math. Phys. Eng. Sci., 363: 971-984. 

Reiter B, Burgmann H, Burg K, Sessitsch A (2003). Endophytic nifH 

gene diversity in African sweet potato Can. J. Microbiol., 49 (9): 549- 

555. 

Seshadri R, Adrian L, Fouts DE, Eisen JA, Phillippy AM, Methe BA, 

Ward NL, Nelson WC, Deboy RT, Khouri HM, Kolonay JF, Dodson 

RJ, Daugherty SC, Brinkac LM, Sullivan SA, Madupu R, Nelson KE, 

Kang KH, Impraim M, Tran K, Robinson JM, Forberger HA, Fraser 

CM, Zinder SH, Heidelberg JF (2005). Genome sequence of the 

PCE-dechlorinating bacterium Dehalococcoides ethenogenes. 

Science, 307 (5706): 105-108. 

Steenhoudt O, Vanderleyden J (2000). Azospirillum, a freeliving 

nitrogen-fixing bacterium closely associated with grasses: genetic, 

biochemical and ecological aspects. FEMS Microbiol. Rev., 24: 487- 

506. 

Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) 

MEGA5: Molecular evolutionary genetics analysis using maximum 

likelihood, evolutionary distance, and maximum parsimony methods. 

Mol. Biol. Evol., 28: 2731-2739. 

Teng Q, Sun B, Fu X, Li S, Cui Z, Cao H (2009). Analysis of nifH gene 

diversity in red soil amended with manure in Jiangxi, South China. J. 

Microbiol., 47 (2): 135-141. 

Thompson JD, Higgins DG, Gibson TJ (1994). CLUSTAL W: improving 

the sensitivity of progressive multiple sequence alignment through 

sequence weighting, position specific gap penalties and weight matrix 

choice. Nucleic Acids Res., 22(22): 4673-4680. 

Umali-Garcia M, Hubbell D, Gaskins M, Dazzo F (1980). Association of 

Azospirillum with grass roots. Appl. Environ. Microbiol., 39: 219-226. 

Xie CH, Yokota A (2006). Zoogloea oryzae sp. nov., a nitrogen-fixing 

bacterium isolated from rice paddy soil, and reclassification of the 

strain ATCC 19623 as Crabtreella saccharophila gen. nov., sp. Nov. 

Int. J. Syst. Evol. Microbiol., 56 (PT 3): 619-624. 

Zehr JP, Jenkins BD, Short SM, Steward GF (2003). Nitrogenase gene 

diversity and microbial community structure: a cross-system 

comparison. Environ. Microbiol., 5: 539-554. 

Zhang Y, Zhao ZH, Sun J, Jiao NZ (2011). Diversity and distribution of 

diazotrophic communities in the South China Sea deep basin with 

mesoscale cyclonic eddy perturbations. FEMS Microbiol. Ecol., 78(3): 

417-427. 

Zhang Y, Li D, Wang H, Xiao Q, Liu X (2006). Molecular diversity of 

nitrogen-fixing bacteria from the Tibetan Plateau, China. FEMS 

Microbiol. Lett., 260 (2): 134-142. 

Zhou J, Davey ME, Figueras JB, Rivkina E, Gilichinsky D, Tiedje JM 

(1997). Phylogenetic diversity of a bacterial community determined 

from Siberian tundra soil DNA. Microbiology, 143: 3913-3919.




DOI: 10.5897/AJMR11.1216 


Difference in photoinhibition and photoprotection 

between seedings and saplings leaves of Taxus 

cuspidata under high irradiance 

Wei Li 1 , Yu-Sen Zhao 1 * and Zhi-Qiang Zhou 2 

1 College of Forestry, Northeast Forestry University, Harbin 150040, China. 

2 Key Laboratory of Forest Plant Ecology, Northeast Forestry University, Harbin 150040, China. 


The differences in chloroplast pigments, gas exchange and photosystemII (PSII) photochemistry as well 

as xanthophyll in seeding and sapling leaves of Taxus cuspidata grown in full sunlight were examined. 

Compared with the sapling leaves, the chlorophyll content, photosynthetic capacity and light intensity 

for saturation of photosynthesis were lower in seeding leaves. The response curves of PSII 

photochemistry demonstrated that both seeding and sapling leaves occurred a down-regulation of PSII 

photochemistry at high irradiance, more serious down-regulation being examined in seeding leaves. 

And the down-regulation of PSII photochemistry occurred significantly when measured at midday, 

indicating that photoinhibition occurred heavily in seeding leaves when exposed to high light. The 

actual PSII efficiency (ΦPSII) and the efficiency of excitation capture by open PSII centers drastically 

decreased with the increase of non-photochemical quenching (NPQ) at midday. The photorespiration 

rate in seeding leaves was lower than that in sapling leaves under high irradiance. The results indicated 

that the xanthophlly cycle was activated in both the seeding and sapling leaves at midday and an 

increase of de-epoxidation were observed, but a little higher level of de-epoxidation was measured in 

seeding leaves. The xanthophyll cycle may play an important role in the dissipation of excess light 

energy associated with NPQ to avoid photodamage. Our results suggested that photoinhibition 

occurred in seeding leaves significantly due to lower capacity of CO2 assimilation, photorespiration and 

the light intensity for saturation of photosynthesis, as well as the lower PSII photochemistry at high 

irradiance; therefore the T. cuspidata seeding could not adapt to growing at high irradiance. 

Key words: Japanese yew (Taxus cuspidata Sieb, et Zucc.), photosynthesis, chlorophyll fluorescence, 

photorespiration, xanthophyll cycle. 

INTRODUCTION 

Japanese yew (Taxus cuspidata Sieb, et Zucc.) is a rare 

relic plant of the ‘tertiary period’, which has a wide 

geographical distribution (Potenko, 2001). It grows in 

vegetated mixed forests in mountainous regions. Taxol, 

an effective anticancer drug extracted from the bark of 

Japanese yew, receives attention (Kobayashi et al., 

1994). Japanese yew is a declining species, but 

conservation strategies have been developed (Potenko, 

2001). As we known, high light may decrease the rate of 

*Corresponding author. E-mail: ysz_1957@163.com. 

photosynthesis in plant which may cause the 

photoinhibition (Müller et al., 2001; Huang et al., 2006). 

Japanese yew is a shade-tolerant species (Iszkulo and 

Boratynski, 2006). The saplings can survive in both shady 

and sunny environments, but the seedlings are always 

observed under the canopy of mature trees (Iszkulo and 

Boratynski, 2006). Therefore, when the Japanese yew 

seedings are exposed to the high light, photoinhibition 

could occur in Japanese yew seeding leaves. However, 

plants have developed some photoprotective 

mechanisms to protect the photosynthesis apparatus 

against photodamage (Lu et al., 2003; Chow, 1994; 

Anderson et al., 1997). Dissipation of excess excitation

energy as heat in order to minimize photodamage to PSII 

reaction centers is well known to be one of the 

mechanisms for the protection of the photosynthetic 

apparatus, which involves the xanthophyll cycle (Guo et 

al., 2009). 

In the xanthophyll cycle, excess light energy absorbed 

by antennae complexes of photosystem II is converted to 

heat, which prevent the formation of reactive oxygen. In 

this process, violaxanthin (V) is converted to zeaxanthin 

(Z) and antheraxanthin (A) under conditions of excess 

excitation energy (Demmig-Adams and Adams, 1992; 

Gilmore, 1997; Horton et al., 1996). And photorespiration 

pathway is reported as a very important photoprotection 

mechanism against photooxidation and photoinhibition 

(Kozaki and Takeba, 1996; Jiang et al., 2006; Niyogi, 

1999). Photorespiration could act as a sink for excess 

excitation energy in photosynthetic apparatus when CO2 

assimilation is reduced (Niyogi, 1999). In this study, we 

conducted an experiment to determine the differences 

between T. cuspidata seeding and sapling leaves in the 

CO2 assimilation capacity, photorespiration capacity and 

xanthophyll cycle-dependent energy dissipation under 

high irradiance and whether the T. cuspidata seeding 

could adapt to full sun light. 


Plant material 

The research was carried out from March to August, 2010 in the 

Botanical Garden of North East Forestry University. The 30 T. 

cuspidata seedings of 4 years and the 16 ones of 15 years which 

grew in plastic pots (25 cm in diameter and 20 cm in height; 80 cm 

in diameter and 70 cm in height, respectively) were transplanted 

from 70% PPFD (photosynthetic photon flux density) of full sunlight 

to 90% PPFD of full sunlight. After 4 weeks under 90% PPFD of full 

sunlight, they were moved to the full sunlight. Six weeks later when 

the T. cuspidata seedlings and saplings were acclimated to full sun 

light, the current-year leaves from the mid-crown on the south side 

of each tree were studied as the experimental materials. 

Gas change measurements 

Photosynthetic rate-photosynthetic photon flux density (Pn-PFD) 

response curves were made at leaf chamber temperature of 30° 

and at 350 μmolmol -1 CO2 with an open gas exchange system (Li- 

6400). PFDs were fixed in a sequence of 1800, 1600, 1200, 800, 

600, 400, 200, 100, 500 μmolmolm -2 s -1 . Photosynthetic rate was 

monitored at two O2 concentrations: 21% O2 + 350 μmolmol -1 CO2 

and 2% O2 + 350 μmolmol -1 CO2 under 1400 μmolmolm -2 s -1 PFD and 

this was used to calculate photorespiration. 

Chlorophyll fluorescence measurements 

Chlorophyll fluorescence was measured with a pulse-modulated 

fluoremeter (FMS-2, Hansatech, UK). Before each measurement, 

the sample leaf was dark-adapted for 35 min with dark leaf clips. To 

determine the Fo (initial fluorescence), the low modulated 

measuring light (3000 m -2 s -1 ) to obtain the Fm (maximal chl fluorescence). Fv/Fm 

(the maximum quantum yield of photosystemII; Fv, the variable Chl 

fluorescence yield is defined as Fm - Fo) was calculated 

automatically. Fs (the steady-state fluorescence) and Fm’ (the 

maximum Chl fluorescence level) during exposure to illumination 

were also measured. The actual PSII efficiency (ΦPSII) was 

calculated as (Fm’-Fs)/Fm’ (Genty et al., 1989). Non-photochemical 

quenching (NPQ) was calculated as (Fm/Fm’) -1 according to Bilger 

and Björkman (1990). 

To examine the light response curves for the fluorescence 

parameters of T. cuspidata sapling leaves and seeding leaves, the 

Fo was measured at first and then a saturating pulse was applied to 

determine the Fv/Fm. The actinic light was increased in a sequence 

of 100, 200, 400, 600, 800, 1000 and 1400 in steps. Each PFD was 

maintained at least 10 min. 

Pigment determination 

The content of chlorophyll in leaf were extracted with 80% acetone, 

being analyzed with a UV-2800 system (Hitachi, Japan) according 

to Lichtenthaler (1987). Leaf samples were taken at morning. The 

content of carotenoid components of xanthophyll was extracted with 

100% acetone under the ice-cold condition. Then the extracts were 

filtered through a 0.45 μm filter. Leaf samples were taken at 

predawn and midday. Afterwards, they were immediately frozen into 

liquid nitrogen. The content of the carotenoid components of 

xanthophyll were analyzed in the method described by Thayer and 

Björkman (1990) for 5 times. 

Statistical analyses 

Data of measurements were analyzed by using SPSS 10.0. The 

least significant differences between the means were calculated at 

95% confidence level. Plots and fit curves were performed by using 

Sigmaplot10.0. Unless otherwise indicated, the significant 

differences between seedings and saplings were given at P


Table 1. Differences in chlorophll pigments between T. cuspidata seeding and sapling leaves. Each 

value is means of ± S.E. n = 5. 

Variable Chl a (mg g -2 FW) Chl b (mg g -2 FW) Chl a+b (mg g -2 FW) Chl a/b (mg m -2 ) 

Seeding 314 ± 10 a 88 ± 2 a 443 ± 7 a 3.56 ± 0.06 a 

Sapling 362 ± 7 b 98 ± 1 b 487 ± 4 b 3.62 ± 0.09 a 

Pn(μmol m -2 s -1 ) 

12 

10 

8 

6 

4 

2 

0 

-2 

Figure 1. Light response curves for photosynthesis of T. cuspidata seedings and saplings leaves 

measured at 26°C and the 350 μmolmol -1 CO2 in the chamber. (△) and (▲) represent sapling leaves 

and seeding leaves, respectively. Values are means ± S.E., n = 3 – 5. 

than that of seeding leaves. Sapling leaves had higher 

CO2 assimilation capacity under high irradiance. Similarly, 

photorespiratory in sapling leaves also showed higher 

than that in seeding leaves (Figure 2). 

Response of Chl fluorescence parameters to 

changes in irradiance 

With the irradiance increasing, the decrease in ΦPSII and 

Fv’/Fm’ and an increase in NPQ were observed in 

seeding and sapling leaves, but the sapling leaves had 

higher ΦPSII and Fv’/Fm’ than the seeding ones. 

However, NPQ in seeding leaves was significantly higher 

than sapling ones. The results showed that a greater 

down-regulation of PSII efficiency in seeding leaves in 

high light (Figure 3). 

0 500 1000 1500 2000 

PFD(μmol m -2 s -1 ) 

Fluorescence parameters at predawn and midday 

A significant decline in Fv/Fm, ΦPSII and Fv’/Fm’ were 

observed at midday in the seeding and sapling leaves, 

but a considerable increase in NPQ. Compared with 

seeding leaves, sapling leaves showed higher values for 

Fv/Fm, ΦPSII and Fv’/Fm’ and lower values for NPQ at 

midday (Table 2). 

The xanthophyll cycle under high irradiance 

There were significant differences between Japanese 

yew in the content of xanthophyll. We observed that the 

relative xanthophyll pool size (A + V + Z)/Chl in seeding 

leaves was higher than that in sapling leaves (Figure 4A, 

B and C). Compared with sapling leaves, the de-

Figure 2. Light response curves for photorespiratory of T. cuspidata seedings and saplings 

leaves measured at 26°C. (△) and (▲) represent sapling leaves and seeding leaves, 

respectively. Values are means ± S.E., n = 3 – 5. 

epoxidation components of the xanthophyll cycle 

pigments were more increased in seeding leaves at 

midday. And the results showed an increase in (A + Z)/(A 

+ Z + V) ratio in seeding and sapling leaves at midday. 

DISCUSSION 

Pr (μmol m -2 s -1 ) 

5 

4 

3 

2 

1 

0 

0 200 400 600 800 1000 1200 1400 1600 1800 

The data that sapling leaves had higher chlorophyll 

content, Chla/Chlb ratio (Table 1) and photosynthetic 

capacity (Figure 1) indicated that sapling leaves had a 

more developed photosynthetic apparatus, which more 

excited energy would be used in CO2 assimilation rather 

than dissipated. The long exposure to high irradiance 

levels is a major source of stress to the photosynthetic 

apparatus (Genty et al., 1989). When CO2 assimilation is 

restricted, photorespiration also acts as a key role in the 

protection of leaves against high irradiation and uses 

energy. Sapling leaves had more capacity to allocate 

excited energy to photorespiration than seeding ones at 

high irradiance (Figure 2). Increased allocation of excited 

energy of photorespiration can maintain the utilization of 

excited energy by allowing metabolism to continue using 

the products of photosynthetic electron transport. This 

can mitigate the deleterious effects such as 

photodamage. The maximal efficiency of PSII 

photochemistry (Fv/Fm) showed only a slight decrease in 

PFD (μmol m -2 s -1 ) 

Li et al. 5981 

seeding leaves when measured at predawn, indicating 

that seeding leaves had almost the same primary 

photochemistry as sapling leaves (Table 2), so the activity 

of PSII may not be the limiting step of photosynthesis in 

seeding leaves. 

With an increasing series of irradiances, the values of 

ΦPSII and Fv’/Fm’ decreased gradually (Figure 3A, B and 

C). However, decrease in PSII efficiency (ΦPSII) and the 

efficiency of excitation energy captured by open PSII 

centers (Fv’/Fm’) in seeding leaves revealed a downregulation 

of PSII in the light-response curves. The 

changes in the light response curves of PSII 

photochemistry in seeding leaves also showed higher 

stepwise increases in NPQ at high PFDs. This 

demonstrated that seeding leaves had to dissipate 

excess excitation energy as more heat when exposed to 

high light. It has been reported that xanthophyll cycle is 

an important photoprotection mechanism correlated to 

energy dissipation in plants to avoid photodamage. The 

data demonstrated that a ‘little more’ de-epoxidation 

components (A + Z) were observed in seeding leaves 

than that in sapling leaves when measured at midday, 

which was associated with NPQ. The results showed that 

an increase in NPQ in both seeding and sapling leaves at 

midday was associated with an increase in content of (A 

+ Z) and increase in (A + Z)/(V + A + Z) ration. The higher 

content of (A + Z) and the higher (A + Z)/(V + A + Z) ration


ΦPSII 

NPQ 

0.9 

0.8 

0.7 

0.6 

0.5 

A 

PFD(μmolm 

C 

-2 s -1 0.5 

0.4 

0.3 

4.0 

PFD(μmolm 

0 200 400 600 800 1000 1200 1400 1600 

) 

3.5 

-2 s -1 0.4 

0.3 

0.2 

0 200 400 600 800 1000 

) 

1200 1400 

PFD(μmolm -2 s -1 0.5 

0.4 

PFD(μmolm 

0.3 

0 200 400 600 800 1000 

) 

1 

4.0 

-2 s -1 0.5 

0.4 

0.3 

0.2 

0 200 400 600 800 1000 

) 

1200 1400 

3.0 

2.5 

2.0 

1.5 

1.0 

0.5 

PFD(μmolm-2s-1 0.0 

0.5 

0 200 400 600 8000.0 1000 1200 1400 1600 

0 ) 200 400 600 800 1000 1200 1400 1600 

Figure 3. Responses of actual PSII efficiency (ΦPSII, A), the efficiency of excitation capture by open PSII reaction centers 

(Fv’/Fm’, B) and non-photochemical quenching (NPQ, C) to PFDs in T. cuspidata seeding (▲) and sapling (△) leaves. Values 

are means ± S.E., n = 3. 

Table 2. Differential changes of chlorophyll fluorescence ratios in the maximal efficiency of PSII 

photochemistry (Fv/Fm), actual PSII efficiency (ΦPSII), the efficiency of excitation energy capture by 

open PSII centers (Fv’/Fm’) and non-photochemical quenching (NPQ) in T. cuspidata seeding and 

sapling leaves at predawn and midday with PFD 1500 μmol�m- 2 �s -1 . Values are means ± S.E., n = 4. 

Variables 

Seeding Sapling 

Predawn Midday Predawn Midday 

Fv/Fm 0.8�0.01 0.655�0.02 0.841�0.04 0.798�0.01 

ΦPSII 0.587�0.01 0.344�0.02 0.616�0.01 0.476�0.02 

Fv’/Fm’ 0.695�0.01 0.483�0.02 0.816�0.154 0.71�0.01 

NPQ 1.37�0.04 2.702�0.133 1.147�0.02 2.227�0.07 

at high irradiance might act as a strengthened 

acclimation to cope with excess irradiance. 

In conclusion, seeding leaves can dissipate the excess 

energy by xanthophyll cycle, but photoinhibition occurred 

ΦPSII 

NPQ 

C 

0.9 

A 

0.8 

0.7 

0.6 

3.5 

3.0 

2.5 

2.0 

1.5 

1.0 

C 

A 

Fv'/Fm' 

0.9 

0.8 

0.7 

0.6 

C 

A 

PFD(μmolm -2 s -1 ) 

B 

Fv'/Fm' 

0.9 

B 

0.8 

0.7 

0.6 

in seeding leaves due to lower capacity of CO2 

assimilation and photorespiration and the light intensity 

for saturation of photosynthesis as well as the lower PSII 

photochemistry at high irradiance. 

B 

B

(V+A+Z)(mmol mol -1 ) 

[(A+Z)/(V+A+Z)]% 

140 140 

120 120 

100 100 


80 

60 

40 

20 

0 

[(A+Z)/(V+A+Z)]% 

80 

60 

40 

20 

REFERENCES 

0 

0.6 0.6 

0.5 0.5 

0.4 0.4 

0.3 0.3 

0.2 0.2 

0.1 0.1 

0.0 0.0 

seeding seeding leaves leaves sapling 0 sapling leaves leaves 

different different age age 

seeding seeding leaves leaves sapling sapling leaves leaves 

different different age 0.0 age 


Figure 4. Changes of xanthophyll cycle pigment pool size, the de-epoxidation components per Chl, and conversion state 

of the xanthophyll cycle (A + Z)/(A + Z + V) in T. cuspidata seeding and sapling leaves. Samples were taken at predawn 

(■black bars) and at midday (□empty bars). Values are means ± S.E., n = 3. 

Anderson JM, Park YI, Chow W (1997). Photoinactivation and 

photoprotection of photosystem II in nature. Physiol Plant, 100(2): 

214-223. 

Bilger W, Bj rkman O (1990). Role of the xanthophyll cycle in 

photoprotection elucidated by measurements of light-induced 

absorbance changes, fluorescence and photosynthesis in leaves of 

Hedera canariensis. Photosyn. Res., 25(3): 173-185. 

Chow W (1994). Photoprotection and photoinhibitory damage. Adv. Mol. 

Cell Biol., 10: 151-196. 

Demmig-Adams B, Adams Iii W (1992). Photoprotection and other 

responses of plants to high light stress. Annu. Rev. Plant Biol., 43(1): 

599-626. 

Genty B, Briantais JM, Baker NR (1989). The relationship between the 

quantum yield of photosynthetic electron transport and quenching of 

chlorophyll fluorescence. Biophys. Acta., 990(1): 87-92. 

Gilmore AM (1997). Mechanistic aspects of xanthophyll 

cycle©\dependent photoprotection in higher plant chloroplasts and 

leaves. Physiol Plant., 99(1): 197-209. 

Guo WD, Guo YP, Liu JR, Mattson N (2009). Midday depression of 

photosynthesis is related with carboxylation efficiency decrease and 


[(A+Z)/(V+A+Z)]% 

140 

120 

100 

80 

60 

40 

20 

0.6 

0.5 

0.4 

0.3 

0.2 

0.1 

(A+Z)(mmol mol -1 ) 

70 

A A 60 60 

A 

B B 

C 

C 


70 

50 

40 

30 

20 

10 

0 

50 

40 

30 

20 

10 

seeding leaves sapling leaves 

different age 

seeding leaves sapling leaves 

different age 

0 

seeding seeding leaves leaves sapling sapling 0leavesleaves 

different different age age 

C 

seeding leaves sap 

different age 

D1 degradation in bayberry (Myrica rubra) plants. Sci. Hortic., 123(2): 

188-196. 

Horton P, Ruban A, Walters R (1996). Regulation of light harvesting in 

green plants. Annu Rev Plant Biol., 47(1): 655-684. 

Huang L, Zheng J, Zhang Y, Hu W, Mao W, Zhou Y, Yu J (2006). Diurnal 

variations in gas exchange, chlorophyll fluorescence quenching and 

light allocation in soybean leaves: The cause for midday depression 

in CO2 assimilation. Sci. Hortic., 110(2): 214-218. 

Iszkulo G, Boratynski A (2006). Analysis of the relationship between 

photosynthetic photon flux density and natural Taxus baccata 

seedlings occurrence. Acta Oecol., 29(1): 78-84. 

Jiang CD, Gao HY, Zou Q, Jiang GM, Li LH (2006). Leaf orientation, 

photorespiration and xanthophyll cycle protect young soybean leaves 

against high irradiance in field. Environ. Exp. Bot., 55(1-2): 87-96. 

Kobayashi J, Ogiwara A, Hosoyama H, Shigemori H, Yoshida N, Sasaki 

T, Li Y, Iwasaki S, Naito M, Tsuruo T (1994). Taxuspines A∼C, new 

taxoids from Japanese yew Taxus cuspidata inhibiting drug transport 

activity of P-glycoprotein in multidrug-resistant cells. Tetrahedron., 

50(25): 7401-7416. 

Kozaki A, Takeba G (1996). Photorespiration protects C3 plants from 

photooxidation. nature, 384: 557-560. 

Lichtenthaler HK (1987). [34] Chlorophylls and carotenoids: Pigments of 


70 

60 

50 

40 

30 

20 

10


photosynthetic biomembranes. Meth. Enzymol., 148: 350-382. 

Lu Q, Wen X, Lu C, Zhang Q, Kuang T (2003). Photoinhibition and 

photoprotection in senescent leaves of field-grown wheat plants. 

Plant Physiol. Biochem., 41(8): 749-754. 

Müller P, Li XP, Niyogi KK (2001). Non-photochemical quenching. A 

response to excess light energy. Plant Physiol., 125(4): 1558. 

Niyogi KK (1999). Photoprotection revisited: genetic and molecular 

approaches. Annu Rev Plant Biol., 50(1): 333-359. 

Potenko VV (2001). Inheritance of allozymes and genetic variation in 

natural population of Japanese yew in Petrov Island, Russia. For. 

Genet., 8(4): 307-314. 

Thayer SS, Bj rkman O (1990). Leaf xanthophyll content and 

composition in sun and shade determined by HPLC. Photosyn. Res., 

23(3): 331-343.




DOI: 10.5897/AJMR11.1331 


Response of Cercospora beticola in sugar beet at 

different cultivars and fertilization level 

Yong-Gang Li*, Li Zhang and Feng-Ming Mang 

Department of Plant Protection, Agricultural College, Northeast Agricultural University, Harbin Heilongjiang, 150030, 

People’s Republic of China. 


Cercospora leaf spot (CLS) caused by Cercospora beticola is one of the most destructive foliar disease 

of sugar beets in all sugar beet-growing areas worldwide. In this study, field trials were carried out to 

determine the effect of CLS at different cultivars and fertilization level. The result showed that level of 

resistance against C. beticola from 20 variables were differed significantly (PBETA356>Hi0940>KWS6167>KWS8138>KWS4121>Hi0166>DVA02234>BETA807> KWS0142> 

Ma096> KWS9522> IS0436> BSTO2431> Ma097> BETA464> BETA812> KWS9145> Hi0474> Hi0732. But, 

Strong and weak of same varieties resistance from three locations apart from 100 km away of this trial 

series were significantly different. Levels of resistance against C. beticola from optimized fertilization 

were significant different (P 

N2P2K0 > N2P2K2> N2P1K2> N1P2K1> N2P3K2> N2P2K3 > N2P0K2> N1P2K2> N3P2K2> N1P1K2> N0P0K0> N0P2K2. 

So, resistance against C. beticola improved after balance fertilizing. It is possible to reduce the 

pathogen appearance by using varieties resistance and balance fertilizing, which enhanced host 

resistance to soft rot disease in a way. 

Key word: Sugar beet, cercospora leaf spot, varieties, resistance, fertilization level. 

INTRODUCTION 

Cercospora leaf spot (CLS) caused by Cercospora 

beticola is one of the most destructive foliar disease of 

sugar beets in all sugar beet-growing areas worldwide 

(Malandrakis et al., 2006). Control of CLS in Greece and 

other areas in a warm climate and irrigation is based 

mainly on frequent fungicide applications (Karaoglanidis 

and Ioannidis, 2010). However, serious problems have 

resulted from the extensive appearance of fungicide 

resistant C. beticola isolates to the intensively used 

benzimidazoles, organotin fungicides and sterol 

biosynthesis inhibiting triazoles. 

Agricultural scientists are becoming aware of the 

potential contribution of farmers in developing integrated 

management of crop diseases in general (Bentley and 

*Corresponding author: E-mail: neaulyg@yahoo.cn. 

Thiele, 1999). Much disease management practices such 

as the applications of fungicides and fumigant; focus on 

controlling pathogens is often too late to be effective, 

when disease symptoms are apparent. A more reliable 

approach is to concentrate on the period before infection 

occurs and encourage conditions that are unfavorable to 

the pathogen and favorable to the plant (Wolf and 

Verreet, 2002; Ghorbani et al., 2008). 

Various control strategies, including host-plant 

resistance, resistant cultivars, integrated control and 

biological control have been developed. Breeding efforts 

to generate Cercospora resistance in sugar beet started 

in the 1920s by Munerati (1920). Historically, resistance 

was introgressed from the wild sea beet, Beet vulgaris L. 

spp. Maritima (Hecker and Helmerick, 1985). Additional 

resistant accessions were also found in other subspecies 

of B. vulgaris and in other sections of the genus Beta, 

namely Corollinae, Nanae and Procumbentes (Asher et


al., 2001). Resistant against C. beticola is a quantitative 

trait based on the additive effects of at least four to five 

major resistance genes (Smith and Gaskill, 1970). 

Therefore, sugar beet lines are selected for resistant 

against C. beticola in the greenhouse using artificial 

inoculation or in regions where natural infection occurs 

annually, namely Italy and Greece in southern Europe 

(Byford, 1996). As the climatic conditions in these 

countries are different from Germany, resistance of sugar 

beet varieties is influenced by environmental and 

cultivation factors (Märländer et al., 2003). 

However, the exact number of host genes involved is 

unknown (Weiland and Koch, 2004). Due to highly 

variable climatic conditions on a single location, resistant 

cultivars adapted to the different sugar beet-growing 

areas worldwide where C. beticola occurs regularly are 

available (Byford, 1996; Mechelke, 2000; Pfleiderer and 

Schäufele, 2000). Host resistance is not efficient to 

prevent infection by C. beticola entirely but reduces the 

pathogen’s development (Rossi et al., 2000). Therefore, 

sugar beet lines selected for resistant against C. beticola 

are unreliable in different regions and variable climatic 

conditions in commercial breeding. 

Soil conditions for plant growth can influence the 

occurrence and severity of plant diseases. Managing and 

exploiting the suppressive effects of the soil environment 

as part of an integrated control strategy could make a 

significant contribution to agricultural sustainability and 

environmental quality (Quimby et al., 2002). 

In this study, the impact of different cultivars and 

fertilization levels on CLS disease severity under natural 

infection in Heilongjiang, China in 2010. In this study, 

field trials were carried out to determine the effect of CLS 

at different cultivars and fertilization level. Secondly, 

resistant against C. beticola in different geographic 

regions were determined. 


Detection of disease resistant against C. beticola for sugar 

beet varieties 

Sugar beet cultivars (KWS0142, KWS0149, KWS9145, KWS8138, 

KWS6167, KWS9522, KWS4121, BETA807, BETA356, BETA464, 

BETA812, BSTO2431, Ma096, Ma097, Hi0940, Hi0166, Hi0732, 

Hi0474, DVA02234, IS0436) differing in the level of resistant 

against C. beticola were used in this study. One location with 

severe disease occurrence in 2009 was selected to determine 

cultivars resistant against C. beticola under natural infection in 

Heilongjiang, China in 2010. Three locations apart from 100 km 

away with severe disease occurrence were selected to determine 

KWS1049 and KWS4121 cultivars resistant against C. beticola of 

different geographic area. 

Field trials were sown between mid and end of April with 70 cm 

distance between rows. The distances between plants within rows 

in the natural infection trial was 40 cm, and the trials were manually 

thinned to a density of 49,500 to 52,500 plants ha −1 in seedling trays 

filled with a standard soil. Weed control were carried out according 

to local standards. 

Response of sugar beet against C. beticola at different 

fertilization level 

Field experiments with Sugar beet cultivars KWS0149 were 

conducted in a location of Heilongjiang province in 2010. Soil 

nutrients of tested field were obtained under large of 0~15 cm. 

Organic matter was measured, including the contents of organic 

matter, available nitrogen, available phosphorus and available 

potassium etc. for the pre-test. The results showed that the organic 

matter content is medium rate (20.18~50.20 g·kg -1 ) in tested field 

soils, ranging from (118.12~204.20 mg N·kg -1 , 7.18~14.32 mg 

P·kg -1 , 44.75~139.57 mg K·kg -1 ). Field trials were sown with 70 cm 

distance between rows. A 140 cm wide protective belt is left without 

fertilization by using randomized group (every group mean 5.6 m 2 ) 

design with 4 replications. 

Traditional fertilization and optimized fertilization were using to 

analyze effect of sugar beet against C. beticola at different 

fertilization level in this study. Nitrogen (N), phosphors (P) and 

potassium (K) were replaced respectively by using carbamide (N), 

diammonium phosphate (P), kalium sulfuricum (K). 

Fertilizer application rates of traditional fertilization were designed 

as the treatments of 600 kg·ha -1 (240 kg N·ha -1 ,195 kg P·ha -1 ,165 

kg K·ha -1 ), 675 kg·ha -1 (270 kg N·ha -1 , 210 kg P·ha -1 ,195 kg K·ha -1 ), 

750 kg·ha -1 (300 kg N·ha -1 ,255 kg P·ha -1 ,195 kg K·ha -1 ), 825 kg·ha -1 

(375 kg N·ha -1 , 270 kg P·ha -1 ,180 kg K·ha -1 ), and 900 kg·ha -1 (420 

kg N·ha -1 , 255 kg P·ha -1 , 225 kg K·ha -1 ). 

Fertilizer application rates of optimized fertilization were N0P0K0, 

N0P2K2, N1P2K2, N2P0K2, N2P1K2, N2P2K2, N2P3K2, N2P2K0, N2P2K1, 

N2P2K3, N3P2K2, N1P1K2, N1P2K1, and N2P1K1 (Detailed data refer to 

Table 4). 

Disease assessment 

Disease index severity of all individual sugar beet plants per 

treatment was assessed according to the modified agronomica 

disease index severity (Vereijssen et al., 2003; Battilani et al., 

1990), which covers a scale from 0 (healthy) to 9 (totally destroyed 

foliage). Disease index severity in each treatment group was 

estimated in the middle of August, 2010 using a scale of 0 to 9: 0 = 

no symptoms on fully leaves; 1= few disease spots of most leaves; 

3 = most disease spots of most leaves; 5 =most disease spots of 

most leaves, dead lateral 1 to 3 leaves; 7 = most disease spots of 

most leaves, dead lateral 3 to 5 leaves; 9 = most disease spots of 

most leaves, all leaves and leafstalk dead or whole plant dead. 

Statistics 

Analysis of variance was carried out with the programme SPSS 

version 13.0 (SPSS Inc., Chicago, IL, USA). Significant differences 

were indicated with different letters for probabilities (P Hi0940 

>KWS6167> KWS8138>KWS4121> Hi0166> DVA0-2234 

> BETA807> KWS0142> Ma096> KWS9522> IS0436>

Table 1. The resistance determination of sugar beet varieties against C. beticola. 

Cultivars Disease index Cultivars Disease index 

KWS0142 17.36±0.54 abcde Ma096 19.01±0.89 bcdef 

KWS0149 13.08±0.49 a Ma097 20.86±1.01 cdefg 

KWS9145 23.95±2.85 fgh Hi0940 15.31±0.25 abc 

KWS8138 16.30±0.86 abcd Hi0166 16.79±0.25 abcd 

KWS6167 15.81±0.25 ab Hi0732 27.61±1.39 h 

KWS9522 19.14±0.81 bcdef DVA0-2234 16.79±1.31 abcd 

BETA807 17.04±1.13 abcd BSTO-2431 19.38±1.60 bcdef 

BETA356 14.62±4.40 ab IS0436 19.26±1.86 bcdef 

BETA464 21.73±2.51 cdef Hi0474 25.80±2.50 gh 

BETA812 22.84±1.39 efgh KWS4121 16.54±1.38 abcd 

Data are treatment means of pooled data ± standard errors. Values of each column followed by different 

letters are significantly different at P Ma097> BETA464> BETA812> KWS9145> 

Hi0474> Hi0732 (Table 1). 

Three locations apart from 100 km away with severe 

disease were selected to analyze relationship between 

KWS1049, KWS4121 cultivars resistant against C. 

beticola and different geographic area. The result showed 

that level of same varieties resistance from different 

geographic area were significant different (Table 2). 

Response of sugar beet against C. beticola at 

different fertilization level 

Traditional fertilization was designed to analyze cultivars 

resistant against C. beticola. The results showed that 

level of resistant against C. beticola from traditional 

fertilization were not significant different (Table 3). 

Optimized fertilization was designed to analyze 

cultivars resistant against C. beticola from different 

Table 2. The determination of sugar beet resistant against 

C. beticola from different geographic area. 

Breeds Different regions Disease index 

KWS1049 1 13.08±0.49 a 

2 27.66±0.25 c 

3 17.12±1.72 b 

KWS4121 1 16.54±1.38 a 

2 29.14±1.37 b 

3 19.35±3.74 a 

The distance among the three zones (1,2,3) is 100 km; Data are 

treatment means of pooled data ± standard errors. Different 

letters for the same assessment date indicate significant 

different at P N2P2K1> N2P2K0 > 

N2P2K2> N2P1K2> N1P2K1> N2P3K2> N2P2K3 > N2P0K2> 

N1P2K2> N3P2K2> N1P1K2> N0P0K0> N0P2K2. 

DISCUSSION 

In this study, we aimed to estimate effect of different 

cultivars and fertilization level under natural infection 

against C. beticola in Heilongjiang, China. The 20 

cultivars resistant against C. beticola were evaluated 

under natural infection in cultivar trial series. The result 

showed that KWS series varieties had the character of 

high resistance to disease in Heilongjiang, such as


Table 3. The determination of resistant against C. beticola from traditional fertilization. 

Sum (kg·ha -1 ) Carbamide (kg·ha -1 ) Diammonium phosphate (kg·ha -1 ) Potassium sulfate (kg·ha -1 ) Disease index 

600 240 195 165 20.99±1.37 a 

675 270 210 195 22.47±1.73 a 

750 300 255 195 21.97±0.99 a 

825 375 270 180 23.21±1.73 a 

900 420 255 225 21.48±1.96 a 

Data are treatment means of pooled data ± standard errors. Different letters for the same assessment date indicate significant different at P

suggested that the plants in pots or field plots which 

received NK (N 90 kg ha -1 ) + (K 40 kg ha -1 ) were more 

resistant to infection than plants which received N (alone) 

or P (alone) or NP and PK combinations. Such results 

provide interesting evidence to support the view that 

balanced soil fertility could lead to better sugar beet 

resistant against C. beticola. 

All in all, a comparative study of resistance 

determination of sugar beet varieties against C. beticola 

is needed to understand better from different geographic 

area in order to design comprehensive control on CLS. 

Accumulation of more knowledge regarding control of 

CLS should stimulate further conversion of conventional 

systems of sugar beet production, which incorporate 

agro-ecological strategies to optimize soil fertilization, 

sugar beet varieties diversity management and more 

natural systems of disease regulation without incurring 

much yield. 


Authors wish to thank to Heilongjing Postdoctoral 

Science Foundation (LRB09-279), Dr. Start-Up fund 

research of Northeast Agricultural University (2009RC48) 

and Ministry of Agriculture Key Laboratory Foundation of 

Cold Crop Physiology Ecology (Northeast Agricultural 

University) for financial support. 

REFERENCES 

Agrios GN (1997). Climate change and plant diseases in Ontario. Plant 

pathology. Academic Press, San Diego. 

Asher MJC, Luterbacher MC, Frese L (2001). Wild Beta species as a 

source of resistance to sugar-beet pests and diseases. Int. Sugar J., 

103: 447–456. 

Battilani P, Beltrami G, Meriggini P, Ponti I, Rossi A, Rossi V, Rosso F, 

Tugnoli V, Zocca A (1990). Nuovo indirizzi, di difesa anticercosporica. 

L’Informatore Agrario, 46:53–70. 

Bentley JW, Thiele G (1999). Bibliography: Farmer knowledge and 

management of crop disease. Agriculture and Human Values, 16: 

75–81. 

Bouarab K, Melton R, Peart D, Baulcombe D, Osbourn A (2002). A 

saponin-detoxifying enzyme mediates suppression of plant defences. 

Nat., 418: 889–892. 

Byford WJ (1996). A survey of foliar diseases of sugar beet and their 

control in Europe. Paper presented at the 59 th IIRB Congress, 

Brussels. 

Ghorbani R, Wilcockson S, Koocheki A, Leifert C (2008). Soil 

management for sustainable crop disease control: a review. Environ. 

Chem. Lett., 6(3): 149-162. 

Hauck P, Thilmony R, He SY (2003). A Pseudomonas syringae type III 

effector suppresses cell wall-based extracellular defense in 

susceptible Arabidopsis plants. Proc. Natl. Acad. Sci. USA., 100(14): 

8577–8582. 

Hecker RJ, Helmerick RH (1985). Sugar-beet breeding in the Unites 

States. In Progress in Plant Breeding—1 (Russell GE, ed.). London: 

Butterworths, pp. 37–61. 

Karaoglanidis SG, Ioannidis MP (2010). Fungicide resistance of 

Cercospora beticola in Europe. In Cercospora leaf spot of sugar beet 

and related species, ed. R.T. Lartey, J.J. Weiland, L. Panella, P.W. 

Crous, and C.E. Windels, St. Paul, MN: The American 

Phytopathological Soc., pp. 189–211. 


Malandrakis AA, Markoglou AN, Nikou DC, Vontas JG, Ziogas BN 

(2006). CLS caused by Cercospora beticola is one of the most 

serious diseases of sugar beets with world-wide economic 

importance. European J. Plant Pathol., 116: 155–166. 

Märländer B, Hoffmann C, Koch HJ, Ladewig E, Merkes R, Petersen J, 

Stockfisch N (2003). Environmental Situation and Yield Performance 

of the Sugar Beet Crop in Germany: Heading for Sustainable 

Development. J. Agronomy Crop Sci., 189: 201–226. 

Mechelke W (2000). Züchtungs-und Sortenstrategien zur Resistenz bei 

Zuckerrüben gegenüber Cercospora beticola. Zuckerindustrie, 125: 

688–692. 

Munerati O (1920). Osservazione e Richerche sulla Barbabietola da 

Zucchero. Observations and Research on Sugar Beet-Part 1. reprint 

1999. Tipografica della R. Accademia dei Lincei. 

Pfleiderer UE, Schäufele WR (2000). Development of a testing method 

for resistant against Cercospora beticola in sugar beet. In M. J. C. 

Asher, B. Holtschulte, M. R. Molard, F. Rosso, G. Steinrücken, & R. 

Beckers (Eds.), Cercospora beticola Sacc. Biology, agronomic 

influence and control measures in sugar beet. Advan. Sugar Beet 

Res., 2: 147-153. 

Quimby PC, King LR, Grey WE (2002). Biological control as a means of 

enhancing the sustainability of crop/land management systems. 

Agric. Ecosyst. Environ., 88:147–152. 

Rossi V, Battilani P, Chiusa G, Giosuè S, Languasco L, Racca P 

(2000). Components of rate-reducing resistance to CLS in sugar 

beet: conidiation length, spore yield. J. Plant Pathol., 82: 125–131. 

Schmidt K, Heberle B, Kurrasch J, Nehls R, Stahl DJ (2004). 

Suppression of phenylalanine ammonia lyase expression in sugar 

beet by the fungal pathogen Cercospora beticola is mediated at the 

core promoter of the gene. Plant Molecular Biol., 55: 835–852. 

Sharma SR, Kolte SJ (1994). Effect of soil-applied NPK fertilizers on 

severity of black spot disease (Alternaria brassicae) and yield of 

oilseed rape, Plant Soil, 167: 313-320. 

Smith GA, Gaskill JO (1970). Inheritance of resistance to CLS in 

sugarbeet. J. Am. Society of Sugar Beet Technol., 16: 172–180. 

Vereijssen J, Schneider JHM, Termorshuizen AJ, Jeger MJ (2003). 

Comparison of two disease assessment keys to assess Cercospora 

beticola in sugar beet. Crop Protection 1: 201–209. 

Walters D, Walsh D, Newton A, Lyon G (2005). Induced resistance for 

plant disease control: maximizing the efficacy of resistance elicitors. 

Phytopathol., 95:1368–1373. 

Weiland J, Koch G (2004). Sugarbeet leaf spot disease (Cercospora 

beticola Sacc.). Pathogen profile. Molecular Plant Pathol., 5:157–166. 

Wolf PFJ, Verreet JA (2002). The IPM sugar beet model, an integrated 

pest management system in Germany for the control of fungal leaf 

diseases in sugar beet. Plant Dise., 86: 336-344.




DOI: 10.5897/AJMR11.1342 


In vitro antioxidant activities of polysaccharides from 

endophytic fungus Fusarium oxysporum Dzf17 

Peiqin Li, Chao Luo, Weibo Sun, Shiqiong Lu, Yan Mou, Youliang Peng and Ligang Zhou* 

College of Agronomy and Biotechnology, China Agricultural University, Beijing 100193, China. 


Three polysaccharides, namely exopolysaccharide (EPS), water-extracted mycelial polysaccharide 

(WPS) and sodium hydroxide-extracted mycelial polysaccharide (SPS), from the endophytic fungus 

Fusarium oxysporum Dzf17 were investigated for their in vitro antioxidant activities. Among them, SPS 

was the most active antioxidant component, and WPS exhibited moderate antioxidant activity. The 

median effective concentration (EC50) values of the polysaccharides were 162.38 µg/ml (for WPS), 63.37 

µg/ml (for SPS) by DPPH radical scavenging activity assay, and 54.54 µg/ml (for WPS) and 44.91 µg/ml 

(for SPS) by using ferrous ions chelating activity assay. The polysaccharides from F. oxysporum Dzf17 

could be an alternative source as the antioxidant components. 

Key words: Antioxidant activity, polysaccharides, endophytic fungus, Fusarium oxysporum Dzf17. 

INTRODUCTION 

Fungi have been regarded as important resources of 

natural bioactive compounds with a variety of 

bioactivities, and have been widely applied in agriculture, 

medicine and food industry (Greve et al., 2010; Zhong 

and Xiao, 2009; Zhou et al, 2010). Plant endophytic fungi 

are a special group of fungi that reside within plant 

tissues intercellularly or intracellularly without causing 

any apparent symptoms of disease (Wilson, 1995). In the 

past two decades, many valuable bioactive compounds 

with antimicrobial, insecticidal, cytotoxic and anticancer 

activities have been successfully obtained from the 

endophytic fungi (Kharwar et al., 2011; Verma et al., 

2009; Zhao et al., 2011). These bioactive compounds 

could be mainly classified as alkaloids, terpenoids, 

steroids, quinones, isocoumarins, lignans, 

phenylpropanoids, phenols and polysaccharides (Aly et 

al., 2010; Yu et al., 2010; Zhang et al., 2006). To the best 

of our knowledge, the antioxidant activities of the 

polysaccharides from endophytic fungi have been rarely 

reported, though there were some reports from other 

fungi (Liu et al., 1997; Ooi and Liu, 1999). 

Fusarium oxysporum Dzf17 is an endophytic fungus 

*Corresponding author. E-mail: lgzhou@cau.edu.cn. 

isolated from the rhizomes of Dioscorea zingiberensis, 

a well known traditional Chinese medicinal herb 

indigenous to the south of China (Li and Ni, 2011; Zhang 

et al., 2009). Three polysaccharides, namely 

exopolysaccharide (EPS), water-extracted mycelial 

polysaccharide (WPS) and sodium hydroxide-extracted 

mycelial polysaccharide (SPS), prepared from F. 

oxysporum Dzf17 were observed in our previous study to 

have enhancement effects on cell growth and diosgenin 

accumulation in D. zingiberensis cell cultures (Li et al., 

2011). The purpose of this study was to investigate the 

antioxidant activities of three kinds of polysaccharides 

from the endophytic fungus F. oxysporum Dzf17 in order 

to provide fundamental data for the research and 

application of the polysaccharides from this fungus. 


General 

The microplate spectrophotometer (PowerWave HT, BioTek 

Instruments, USA) was employed to measure the light absorption 

value. 1, 1-Diphenyl-2-picrylhydrazyl (DPPH) was purchased from 

Sigma-Aldrich (USA) in Beijing. 3-(2-Pyridyl)-5,6-bis (4-phenylsulfonic 

acid)-1,2,4-triazine (ferrozine) was obtained from Johnson 

Matthey (UK) in Beijing. Butylated hydroxytoluene (BHT), ferrous 

chloride (FeCl2), and ethylene diamine tetraacetic acid (EDTA) were

ought from Beijing Chemical Company. All other chemicals and 

reagents were of analytical grade. 

Endophytic fungus and culture conditions 

The endophytic fungus F. oxysporum Dzf17 (GenBank accession 

number EU543260) was isolated from the healthy rhizomes of the 

medicinal plant D. zingiberensis C. H. Wright (Dioscoreaceae) in 

our previous study (Zhang et al., 2009). The living culture has been 

deposited in China General Microbiological Culture Collection 

Center (CGMCC) under the number CGMCC 2472. It was also 

maintained on potato dextrose agar (PDA) slants at 25°C, and in 

40% glycerol at -70°C at the Herbarium of the College o f Agronomy 

and Biotechnology, China Agricultural University. The mycelia were 

grown in a 1000 ml Erlenmeryer flask containing 300 ml of liquid 

medium consisting of glucose (50 g/L), peptone (13 g/L), NaCl (0.6 

g/L), K2HPO4 (0.6 g/L), and MgSO4•7H2O (0.2 g/L). About 500 

flasks were used. All flasks were maintained at 25°C on a rotary 

shaker at 150 rpm for 14 days. A total of 150 L of fermentation broth 

was harvested. The mycelia were separated from the supernatant 

by centrifugation at 7,741 ×g for 20 min. Mycelia were washed twice 

with deionized water, then lyophilized. About 600 g of mycelia in dry 

weight (dw) was obtained. 

Preparation of polysaccharides 

The preparation process of exopolysaccharide (EPS) has described 

in our previous study (Li et al., 2011). Briefly, the supernatant was 

concentrated under vacuum at 60°C by a rotary evaporat or to a 

proper volume and mixed with three volumes of 95% ethanol, then 

kept at 4ºC for 48 h. After that, the solution was centrifuged at 

17,418 × g for 15 min, and the precipitate from ethanol dispersion 

was collected as crude EPS which was further subjected to 

deproteination with Sevag reagent (chloroform-n-butanol at 4:1, 

v/v), decolorization with H2O2, and re-movement of small molecular 

impurities by dialysis. Polysaccharide mixture with molecular weight 

greater than 8,000 to 14,000 Da was kept in dialysis tube. The 

carbohydrate content of EPS was measured by the method of 

anthrone-sulfuric acid spectrophotography (Wang et al., 2007), 

which involved sulfuric acid hydrolysis of the sample in the 

presence of anthrone agent at 100°C. The absorbance a t 620 nm 

was measured and calibrated to carbohydrate content using 

glucose as a reference. After lyophilization, the purified EPS (31.98 

g) was stored in a desiccator at room temperature. 

Water-extracted mycelial polysaccharide (WPS) and sodium 

hydroxide-extracted mycelial polysaccharide (SPS) were also 

prepared according to our previous research (Li et al., 2011). 

Briefly, the lyophilized mycelia (600 g) were powdered in a high 

disintegrator, and then subjected to heat circumfluence extraction at 

50°C by 95% ethanol-petroleum ether at 1:1 (v/v) as t he refluxing 

solvent to remove monosaccharide, disaccharide and lipid. The 

ratio of mycelia powder (g) to refluxing solvent (ml) was 1:5 (w/v). 

Defatted mycelial powder was obtained by centrifugation (7,741 × g, 

20 min) and drying in an oven at 40°C for 2 h, and t hen immersed 

in hot water at 90°C for 2 h with the ratio of water (ml) to the 

material (g) as 30:1 (v/w). After that, centrifugation was carried out 

at 7,741 × g for 20 min to separate the residue and the supernatant. 

The supernatant was condensed to a certain volume under vacuum 

at 60°C, and then mixed with three volumes of 95% et hanol, then 

kept at 4°C for 48 h. The following procedure for poly saccharide 

preparation and purification was the same as the treatments of 

exopolysaccharide (EPS). The gained polysaccharide (33.24 g) was 

named as water-extracted mycelial polysaccharide (WPS). The 

residue not containing WPS was further extracted with 10% sodium 

hydroxide (NaOH) solution at room temperature for 24 h. The 

remaining steps were the same as the treatments of EPS. The 


obtained polysaccharide (35.89 g) was designated as sodium 

hydroxide-extracted mycelial polysaccharide (SPS). 

In vitro antioxidant activity assay 

The polysaccharides were subjected to a screening for antioxidant 

activity by two complementary tests, namely the DPPH radical 

scavenging assay and ferrous ions chelating assay, The free radical 

scavenging activity of different antioxidants was measured in terms 

of hydrogen donating or radical scavenging ability of the stable free 

radical DPPH (1,1-diphenyl-2-picryhydrazyl) (Ono et al., 2008). The 

scavenging activity of DPPH was measured according to the 

method reported by Qiao et al. (2009) with some modifications. 

Briefly, DPPH dehydrated alcohol solution (0.2 mg/ml, 100 µl) and 

polysaccharide water solution (100 µl) were added to each well of 

the microplate and mixed. The mixture was shaken vigorously and 

allowed to stand at room temperature in the dark for 30 min. The 

absorbance was measured at 517 nm against a blank. Butylated 

hydroxy toluene (BHT) was used as the positive control. Lower 

absorbance of the reaction mixture indicates higher free-radical 

scavenging activity. All the tests were performed in triplicate and the 

graph was plotted with the mean values and standard deviations. 

The scavenging activity was calculated by the following equation: 

Scavenging activity (%) = [A0-(A1-A2)]×100/A0. 

Where A0 is the absorbance of DPPH solution without tested 

samples, A1 is the absorbance of the sample, and A2 is the 

absorbance of the sample under identical conditions as A1 with 

water instead of DPPH solution. 

The median effective concentration (EC50) value was calculated 

using the linear relation between the effective probability and 

concentration logarithm according to the method of Sakuma (1998). 

Metal ions chelating activity was determined according to the 

method of Wang et al. (2010) with some modifications. Briefly, 

polysaccharide solution (50 µl) was mixed with FeCl2 solution (0.2 

mg/ml, 30 µl), and shaken vigorously. The ferrozine solution (2 

mg/ml, 70 µl) was then added to the reaction solution. The reaction 

mixture was shaken vigorously and left standing at room 

temperature for 10 min. After the mixture reached equilibrium, the 

absorbance of the solution was then measured at wavelength 560 

nm using a microplate spectrophotometer. EDTA was used as the 

positive control. Lower absorbance of the reaction mixture indicates 

higher chelating activity. All the tests were performed in triplicate 

and the graph was plotted with the mean values and standard 

deviations. The ferrous ions chelating effect was calculated as the 

percentage (%) of inhibition of ferrozine-Fe 2+ complex formation 

determined as: 

Chelating activity (%) = [B0-(B1-B2)]×100/B0. 

Where B0 is the absorbance of reaction solution without tested 

samples, B1 is the absorbance of the sample and B2 is the 

absorbance of the sample under identical conditions as B1 with 

water instead of ferrozine solution. 

The EC50 value calculation for ferrous ions chelating activity was 

the same as that for DPPH radical scavenging activity. 


DPPH radical scavenging activity 

DPPH has been widely adopted as a reference for 

evaluating the free radical scavenging activities of the


Scavenging activity of DPPH 

(%) 

120 

100 

80 

60 

40 

20 

0 

BHT EPS 

WPS SPS 

5 10 20 50 100 150 200 250 300 

Polysaccharide concentration (µg/ml) 

Figure 1. DPPH radical scavenging activity of the polysaccharides. 

Table 1. EC50 values of the polysaccharides for antioxidant activity. 

EC50 (µg/ml) 

Assay 

EPS WPS SPS CK + 

DPPH scavenging activity - 162.38a 63.37c 74.94b 

Ferrous ions chelating activity - 54.54a 44.91b 28.86c 

The positive controls (CK + ) for DPPH scavenging and ferrous ions 

chelating assays are BHT and EDTA, respectively. '-' means that EC50 

values cannot be obtained at the test concentrations. Different letters 

in each row indicate significant differences of the antioxidant activity for 

each assay at p = 0.0.5. 

concentrations of 7 to 200 µg/ml, the chelating activity of 

natural compounds (Amarowicz et al., 2004). The DPPH 

radical scavenging effects of the polysaccharides EPS, 

WPS and SPS from F. oxysporum Dzf17 were presented 

in Figure 1. Among them, SPS exhibited the strongest 

scavenging DPPH activity at concentrations of 5 to 100 

µg/ml, showing a good linear dependence between SPS 

concentration and DPPH scavenging activity. In contrast, 

WPS showed moderate, and EPS showed nonantioxidant 

activity. When WPS was at concentration of 

300 µg/ml, the scavenging activity was 84.27%. The EC50 

values (shown in Table 1) of WPS and SPS for 

antioxidant activity were 162.38 µg/ml and 63.37 µg/ml, 

respectively. 

Ferrous ions chelating activity 

Ferrous ions chelating activity was employed as another 

indicator to assess the quantity of the antioxidants 

(Lianhe et al., 2011; Xiao et al., 2011). In this research, 

the chelating activities of the polysaccharides from F. 

oxysporum Dzf17 on ferrous ions (Fe 2+ ) were 

investigated, which were presented in Figure 2. All the 

tested samples showed evident Fe 2+ chelating activity in 

a concentration-dependent manner except EPS. At 

Chelating activity (%) 

120 

100 

80 

60 

40 

20 

0 

EDTA EPS 

WPS SPS 

7 13 20 27 33 67 100 133 167 200 

Polysaccharide concentration (µg/ml) 

Figure 2. Ferrous ions chelating activity of the polysaccharides. 

EPS varied only from 3.36 to 9.09%, which did not show 

its antioxidant activity. WPS or SPS showed stronger 

chelating activity than that of EPS, but slightly weaker 

than that of the positive control (EDTA). When the 

concentration of WPS was changed from 7 to 100 µg/ml, 

the chelating activity was rapidly increased from 5.59 to 

84.07% showing a good linearity. With the concentration 

of WPS varied from 100 to 200 µg/ml, the chelating 

activity showed a gently increase with the value of 84.07 

to 94.59%. The chelating activity of SPS exhibited the 

same trend but slightly stronger than that of WPS. The 

EC50 values (shown in Table 1) of WPS and SPS for 

antioxidant activity were 54.54 and 44.91 µg/ml, 

respectively. 

In summary, this is the first report on the antioxidant 

activities of the polysaccharides from the endophytic 

fungus F. oxysporum Dzf17. Among three 

polysaccharides, SPS was the most active antioxidant 

component, WPS showed moderate, and EPS showed 

non-antioxidant activity. The antioxidant activity results of 

the polysaccharides obtained by two complementary 

assays were similar which indicated that they should 

have similar antioxidant mechanisms. DPPH is a stable 

free radical with a maximum absorption at 517 nm and 

can be readily scavenged by the antioxidants (e.g., 

phenolics, flavonoids, carotenoids and polysaccharides) 

which have hydrogen donating groups (Muller et al., 

2011; Paixao et al., 2007; Qiao et al., 2009). Ferrozine 

quantitatively forms complexes with Fe 2+ . In the presence 

of other chelating agents (e.g., polysaccharide), the 

complex formation is disrupted with the result that the red 

color of the complex was decreased (Yamaguchi et al., 

2000). As the antioxidant mechanisms of polysaccharides 

are very complicated, other methods such as OH free 

radical scavenging and reducing powder assays should 

be employed in our further investigation (Huang et al., 

2005). In our previous study, WPS was found to be the 

most effective polysaccharide to have enhancement 

effects on cell growth and diosgenin accumulation in D. 

zingiberensis cell cultures (Li et al., 2011). WPS showed

moderate antioxidant activity in this investigation which 

means that WPS should be studied in detail for its 

enhancing effect on secondary metabolite biosynthesis 

and antioxidant activity. The present study will provide 

additional data for supporting the utilization and development 

of the polysaccharides from F. oxysporum Dzf17 as 

the antioxidant components. Further studies to clarify 

other biological activities (e.g. immunoregulatory and 

antitumor activities) of the polysaccharides, their preparation 

on a large scale, composition including protein and 

carbohydrate percentage, antioxidant mechanisms, as 

well as the physiological and ecological roles of the 

polysaccharides on host plant cells are now in progress. 


This work was co-financed by the grants from the Natural 

Science Foundation of Beijing (6092015), the program for 

Changjiang Scholars and Innovative Research Team in 

University of China (IRT1042), and the National Natural 

Science Foundation of China (30871662 and 31071710). 

REFERENCES 

Aly AH, Debbab A, Kjer J, Proksch P (2010). Fungal endophytes from 

higher plants: a prolific source of phytochemicals and other bioactive 

natural products. Fungal Divers, 41: 1-16. 

Amarowicz R, Pegg RB, Rahimi-Moghaddam P, Barl B, Weil JA (2004). 

Free radical scavenging capacity and antioxidant activity of selected 

plant species from the Canadian prairies. Food Chem., 84: 551-562. 

Greve H, Mohamed IE, Pontius A, Kehraus S, Gross H, Konig GM 

(2010). Fungal metabolites: structural diversity as incentive for 

anticancer drug development. Phytochem. Rev., 9: 537-545. 

Huang D, Ou B, Prior RL (2005). The chemistry behind antioxidant 

capacity assays. J. Agric. Food Chem., 53: 1841-1856. 

Kharwar RN, Mishra A, Gong SK, Stierle A, Stierle D (2011). Anticancer 

compounds derived from fungal endophytes: their importance and 

future challenges. Nat. Prod. Rep., 28: 1208-1228. 

Li N, Ni J (2011). Treatment of wastewater from Dioscorea 

zingiberensis tubes used for producing steroid hormones in a 

microbial fuel cell. Bioresource Technol., 102: 2731-2735. 

Li P, Mou Y, Shan T, Xu J, Li Y, Lu S, Zhou L (2011). Effects of 

polysaccharide elicitors from endophytic Fusarium oxysporium Dzf17 

on growth and diosgenin production in cell suspension culture of 

Dioscorea zingiberensis. Molecules, 16: 9003-9016. 

Lianhe Z, Li W, Xing H, Zhengxing C (2011). Antioxidant activities of 

seed extracts from Dalbergia odorifera. Afr. J. Biotechnol., 10: 11658- 

11667. 

Liu F, Ooi VEC, Chang ST (1997). Free radical scavenging activities of 

mushroom polysaccharide extracts. Life Sci., 60: 763-771. 


Muller L, Frohlich K, Bohm V (2011). Comparative antioxidant activities 

of carotenoids measured by ferric reducing antioxidant power 

(FRAP), ABTS bleaching assay (αTEAC), DPPH assay and peroxyl 

radical scavenging assay. Food Chem., 129: 139-148. 

Ono M, Oda E, Tanaka T, Lida Y, Yamasaki T, Masuoka C, Ikeda T, 

Nohara T (2008). DPPH radical-scavenging effect on some 

constituents from the aerial parts of Lippia triphylla. J. Nat. Med., 62: 

101-106. 

Ooi VEC, Liu F (1999). A review of pharmacological activities of 

mushroom polysaccharides. Int. J. Med. Mushrooms, 1: 195-206. 

Paixao N, Perestrelo R, Marques JC, Camara JS (2007). Relationship 

between antioxidant capacity and total phenolic content of red, rose 

and white wines. Food Chem., 105: 204-214. 

Qiao D, Ke C, Hu B, Luo J, Ye H, Sun Y, Yan X, Zeng X (2009). 

Antioxidant activities of polysaccharides from Hyriopsis cumingii. 

Carbohyd. Polym., 78: 199-204. 

Sakuma M (1988). Probit analysis of preference data. Appl. Entomol. 

Zool., 33: 339-347. 

Verma VC, Kharmar RN, Strobel GA (2009). Chemical and functional 

diversity of natural products from plant associated endophytic fungi. 

Nat. Prod. Commun., 4: 1511-1532. 

Wang J, Zhao J, Liu H, Zhou L, Liu Z, Wang J, Han J, Yu Z, Yang F 

(2010). Chemical analysis and biological activity of the essential oils 

of two Valerianaceous species from China: Nardostachys chinensis 

and Valeriana officinalis. Molecules, 15: 6411-6422. 

Wang Z, Luo D, Ena C (2007). Optimization of polysaccharides 

extraction from Gynostemma pentaphyllum Makino using uniform 

design. Carbohyd. Polym., 69: 311-317. 

Wilson D (1995). Endophyte – the evolution of a term, and clarification 

of its use and definition. Oikos, 73: 274-276. 

Xiao J, Xiao D, Sun Z, Xiao Y, Zhong J (2011). Antioxidative potential of 

polysaccharide fractions produced from traditional Chinese medicinal 

macrofungus Cordyceps jiangxiensis in vitro. Afr. J. Biotechnol., 10: 

6607-6615. 

Yamaguchi F, Ariga T, Yoshimira Y, Nakazawa H (2000). Antioxidant 

and anti-glycation of carcinol from Garcinia indica fruit rind. J. Agric. 

Food Chem., 48: 180-185. 

Yu HS, Zhang L, Li L, Zheng CJ, Guo L, Li WC, Sun PX, Qin LP (2010). 

Recent developments and future prospects of antimicrobial 

metabolites produced by endophytes. Mycrobiol. Res., 165: 437-449. 

Zhang HW, Song YC, Tan RX (2006). Biology and chemistry of 

endophytes. Nat. Prod. Rep., 23: 753-771. 

Zhang R, Li P, Xu L, Chen Y, Sui P, Zhou L, Li J (2009). Enhancement 

of diosgenin production in Dioscorea zingiberensis cell culture by 

oligosaccharide elicitor from its endophytic fungus Fusarium 

oxysporum Dzf17. Nat. Prod. Commun., 4: 1459-1462. 

Zhao J, Shan T, Mou Y, Zhou L (2011). Plant-derived bioactive 

compounds produced by endophytic fungi. Mini-Rev. Med. Chem., 11: 

159-168. 

Zhong J-J, Xiao J-H (2009). Secondary metabolites from higher fungi: 

discovery, bioactivity, and bioproduction. Adv. Biochem. Eng. 

Biotechnol., 113: 79-150. 

Zhou L, Zhou J, Shan T, Cai X, Peng Y (2010). Spirobisnaphthalenes 

from fungi and their biological activities. Mini-Rev. Med. Chem., 10: 

977-989.




DOI: 10.5897/AJMR11.1426 


Production of calcium gluconate from cassava by 

Penicillium citrinum SCG-112 

Hai-Yan Sun 1,2 , Pingjuan Zhao 1,2 , Juanhua Li 1 , Enshi Liu 1 and Ming Peng 1,2 * 

1 Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, 

Key Laboratory of Tropical Crop Biotechnology, Ministry of Agriculture, Haikou 571101, China. 

2 School of Agriculture, Hainan University, Haikou 571101, China. 


The feasibility of using cassava powder as the main material for production of calcium gluconate by 

Penicillium citrinum SCG-112 was evaluated in this study. The effect of incubation temperature, initial 

pH of the medium and inoculum size on production of calcium gluconate was investigated. The 

maximum yield of calcium gluconate (155 g/L) was obtained after 36 h incubation. The result was both 

technically competitive and economically attractive. 

Key words: Calcium gluconate, cassava, Penicillium citrinum. 

INTRODUCTION 

Calcium gluconate (C12H22CaO14·H2O) finds extensive 

applications in the pharmaceutical and food industry. 

Research is ongoing to increase the production of this 

salt to meet its commercial demand (Bayraktar and 

Mehmetoglu, 2001). Most studies on calcium gluconate 

production have focused on the use of pure or easily 

fermentable substrates such as glucose or sucrose 

(Mariam et al., 2010; Liang et al., 2010). Due to the high 

costs of these pure materials, the process is less 

economic for industrial applications. The production cost 

of calcium gluconate might be significantly reduced if 

cheap raw materials could be used, such as starchy and 

cellulosic materials. Cassava is one of the most efficient 

crops in terms of carbohydrate production. It is a tropical 

perennial plant that grows on poor or depleted soils in 

which the yields of other crops are very low (Peters, 

2007). Cassava is very rich in starch. Starch content of 

cassava root and dry cassava powder reached about 30 

and 70%, respectively (Shen et al., 2009). Therefore, 

cassava has been successfully used as the main material 

for production of ethanol, lactic acid and sugar etc. 

*Corresponding author. E-mail: hysun168@126.com. Tel: +86- 

898-66963161. Fax: +86-898-66890978. 

(Shanavas et al., 2011; Kostinek et al., 2007; Abdul et al., 

2005; Gaouar et al., 1998). Production of calcium 

gluconate from cassava is a promising strategy, for it will 

decrease the production cost. However, till now there is 

still no report regarding adoption of cassava as the 

substrate for production of calcium gluconate. 

In the present study, the starch in cassava was 

enzymatically hydrolyzed (liquefaction with α-amylase 

and saccharification with glucoamylase) into glucose, 

which acted as the main material for production of 

calcium gluconate by a high-producing calcium gluconate 

strain, Penicillium citrinum SCG-112. 


Strain 

P. citrinum SCG-112, a newly isolated calcium gluconate producer, 

was used in this study for its high yield of calcium gluconate. It was 

maintained on slants of potato dextrose agar and subcultured every 

month. The conidial suspension with the spores concentration of 

10 8 /ml was prepared form 3-4 day old slant of the strain. 

Medium and fermentation 

Cassava powder with the starch content of about 70% was 

purchased from local market in China. All other material and

Table 1. Effect of temperature on production of calcium gluconate from cassava by Penicillium 

citrinum SCG-112. 

Temperature (°C) 

Maximum yield of 

calcium gluconate (g/L) 

Time consumed to reach the 

maximum yield (h) 

30 100±1.2 64 

31 105±1.3 64 

32 106±2.0 60 

33 108±0.8 60 

34 108±0.6 56 

35 106±1.5 48 

36 108±1.1 44 

37 110±0.7 40 

38 91±3.4 40 

39 82±2.0 36 

40 65±1.2 36 

chemicals were also commercially available. Cassava powder was 

mixed with water to prepared cassava slurry with the concentration 

of 300 g/L. Thermo-stable α-amylase was added into the slurry 

according to 15 U per g cassava powder. Then the slurry was 

liquefied by heating it to 110°C and keeping at 110 °C for 5 min, 

then cooling it to 90°C and keep at 90°C for 2 h. Th e liquefied 

cassava was centrifugated and squeezed to remove cassava 

residues. The pH of obtained clarifying solution was adjusted to 4.6- 

4.8, added gulucoamylase at the ratio of 200 U per g cassava 

powder. After saccharification at 60°C for 24 h, the s tarch in 

cassava powder was converted to glucose thoroughly. The final 

glucose solution diluted to the concentration of 150 g/L with water 

was used for preparing medium for production of calcium 

gluconate. The basal medium containing (g/L): glucose 150, 

(NH4)2SO4 0.5, K2HPO4 0.05, CaCO3 42, natural pH (about pH 5.0). 

50 ml medium in 500-ml flasks were autoclaved at 121°C for 15 

min. One flask was inoculated with 1 ml spore suspension (10 8 

spores/ml) and incubated on a rotary shake with the speed of 250 

rpm. When the glucose in the medium reached less than 1 g/L, 

fermentation was terminated. During the process the sample was 

withdrawn at regular intervals to determine calcium gluconate yield 

and glucose concentration. The optimal levels of incubation 

temperature, initial pH of the medium, inoculum size were 

determined by varying them in the basal medium. 

Analytical methods 

Calcium gluconate present in the supernatant sample was 

determined by disodium ethylene diamine tetra acetic acid (dEDTA) 

titration. The glucose in the medium was measured by SBA-80C 

biosensor analyzer (Institute of Biology, Shandong Academy of 

Sciences, China), which could provide quick measurements of 

glucose based on technology of the immobilized oxidases. All the 

experiments were run parallel in a set of triplicates. All values given 

are means of three determinations ± standard deviation. 


Effect of incubation temperature on production of 

calcium gluconate from cassava by P. citrinum SCG- 

112 

As shown in Table 1, 37°C proved to be the best 

Sun et al. 5995 

temperature for calcium gluconate in the present study. 

Incubation at lower temperature resulted in longer time to 

reach the maximum yield, though the maximum yield was 

near to the yield at 37°C. Meantime, temperature hi gher 

37°C is not conducive to the production of calcium 

gluconate, neither. The possible reason for the observation 

is that higher temperature affected the fungus 

harmfully, and then decreased the calcium gluconate 

production. 

Effect of initial pH on production of calcium 

gluconate from cassava by P. citrinum SCG-112 

Table 2 indicated that the optimum pH of calcium 

gluconate production from cassava by P. citrinum was pH 

6.5. pH less or more than 6.5 both decreased calcium 

gluconate synthesis. The possible reason may be that at 

pH 6.5, the strain grown best and its mycelia produced 

maximal enzyme glucose oxidase, then brought highest 

yield of calcium gluconate. These results are in agreement 

with the result reported previously by Sheu et al. 

(2002), Munk and Hanus (2005) and Mariam et al. 

(2010). 

Effect of inoculum size on production of calcium 

gluconate from cassava by P. citrinum SCG-112 

The inoculum size also plays a significant role in the 

fermentation process. As shown in Table 3, maximum 

yield was obtained when the inoculum size was 2 ml 

spore suspension (with the count of 10 8 / ml) per flask. A 

lower level of inoculum size may not be sufficient for 

initiating growth and enzyme synthesis. An increase in 

inoculum size ensures a rapid proliferation of biomass 

and enzyme synthesis. After a certain limit, production 

could decrease because of depletion of nutrients due to 

the enhanced biomass, which would result in a decrease


Table 2. Effect of initial pH on production of calcium gluconate from cassava by Penicillium 


Initial pH 

Maximum yield of calcium 

gluconate (g/L) 

Time consumed to reach 

the maximum yield (h) 

4.0 60±0.3 48 

4.5 86±1.5 44 

5.0 94±1.1 44 

5.5 110±3.1 40 

6.0 120±2.0 40 

6.5 133±1.3 40 

7.0 121±1.2 40 

7.5 112±0.9 44 

8.0 105±1.0 44 

Table 3. Effect of inoculum size on production of calcium gluconate from cassava by Penicillium 


Inoculum size (10 8 

spores/mL) 

in metabolic activity (Kashyap et al., 2002). A balance 

between the proliferating biomass and available substrate 

material would yield maximum enzyme. 

Conclusion 

Based on optimization, the fermentation conditions for 

production of calcium gluconate from cassava by P. 

citrinum SCG-112 and the maximum yield of calcium 

gluconate (155 g/L) was obtained after 36 h. This result is 

significantly competitive compared with the recent 

relevant report, in which the maximum yield was 110.35 

g/L after 72 h incubation. The other advantage of our 

study is: we used a kind of relatively cheaper material 

(cassava) while other researchers adopted expensive 

pure chemicals (such as glucose). Therefore, the study 

not only brings technical advantage, but also it is 

economically attractive. 


This research was supported by Chinese 973 Project (no. 

Maximum yield of 

calcium gluconate (g/L) 

Time consumed to reach 

the maximum yield (h) 

0.5 126±0.4 60 

1.0 133±0.7 40 

1.5 141±1.9 40 

2.0 155±2.3 36 

2.5 132±1.4 36 

3.0 128±1.0 32 

3.5 113±0.3 32 

4.0 102±1.3 32 

4.5 100±0.2 32 

5.0 96±0.9 32 

2010CB126600), National natural science fund (no. 

31000029), the Institute Fund of Institute of Tropical 

Bioscience and Biotechnology in Chinese Academy of 

Tropical Agricultural Sciences (no. ITBBKF1010, no. 

ITBBZD0951 and ITTBB110103), Hainan introduction 

and composition special program (no. YJJC2011004 and 

2011 Hainan Province graduate incretion program (no. 

Hyb2011-4). 

REFERENCES 

Abdul G, Shingo O, Takao K (2005). Production of L-Lactic Acid from 

Fresh Cassava Roots Slurried with Tofu Liquid Waste by 

Streptococcus bovis. J. Biosci. Bioeng., 100(6):606–612. 

Bayraktar E, Mehmetoglu U (2001). Back mixing and liquid hold-up in a 

concurrent up-flow packed bed bioreactor. Chem. Eng. Commun., 

185: 125–140. 

Gaouar O, Zakhia N, Aymard C, Rios GM (1998). Production of maltose 

syrup by bioconversion of cassava starch in an ultrafiltration reactor. 

Ind. Crop Prod., 7: 159–167. 

Kostinek M, Specht I, Edward VA, Pinto C, Egounlety M, Sossa C, 

Mbugua S, Dortu C, Thonart P, Taljaard L, Mengu M, Franz CMAP, 

Holzapfel WH (2007). Characterisation and biochemical properties of 

predominant lactic acid bacteria from fermenting cassava for 

selection as starter cultures. Int. J. Food Microbiol., 114: 342–351.

Liang JJ, Li XY, Guan W, Pang CW, Mai ZM (2010). Study on 

mutagenesis of oxidase-producing Aspergillus niger and its 

fermentation condition of calcium gluconate production. Sci. Technol. 

Food Ind., 31(12):218-220. 

Mariam I, Nagra SA, Haq I, Ali S (2010). Application of 2-factorial 

design on the enhanced production of calcium gluconate by a mutant 

strain of Aspergillus niger. Bioresour. Technol., 101:4075–4080. 

Munk P, Hanus F (2005). Factors influencing glucose oxidase activity 

and gluconate production in submerged cultivation of Aspergillus 

niger. Folia Microbiol., 83:20–27. 

Shanavas S, Padmaja G, Moorthy SN, Sajeev MS, Sheriff JT (2011). 

Process optimization for bioethanol production from cassava starch 

using novel eco-friendly enzymes. Biomass Bioenergy, 35:901-909. 

Sun et al. 5997 

Shen NK, Wang QY, Lu Y, Qin Y, Huang RB (2009). Study on the highconcentration 

mash and high-temperature fermentation of cassava. 

Liquor Making, 37(5):47-51 

Sheu DC, Duan KJ, Cheng CY, Bi JL, Chen JY (2002). Continuous 

production of high-content fructo-oligosaccharides by a complex cell 

system. Biotechnol. Prog., 18:1282–1286. 

Peters D (2007). Raw materials. Adv. Biochem. Eng. Biotechnol., 105: 

1–30.

UPCOMING CONFERENCES 

7th Conference of the World Mycotoxin Forum and 

XIIIth IUPAC International Symposium on Mycotoxins and Phycotoxins, 

Rotterdam, Netherlands, 5 Nov 2012 

13th International Congress on Yeasts, Madison, USA, 

26-30 Aug 2012

Conferences and Advert 

August 2012 

13th International Congress on Yeasts, Madison, USA, 26 Aug 2012 

September 2012 

6th International Congress on Biocatalysis, Hamburg, Germany, 2 Sep 2012 

9th International Congress on Extremophiles, Sevilla, Spain, 10 Sep 2012 

October 2012 

Actinobacteria within Soils: Capacities for Mutualsim, Symbiosis and Pathogenesis, 

Muenster, Germany, 25 Oct 2012 

November 2012 

7th Conference of the World Mycotoxin Forum and XIIIth IUPAC International 

Symposium on Mycotoxins and Phycotoxins, Rotterdam, Netherlands, 5 Nov 2012 

December 2012 

Marine Microbiology and Biotechnology: Biodiscovery, Biodiversity and 

Bioremediation, Cork, Ireland, 19 Dec 2012 

International Conference on Pathology and Microbiology, Bangkok, Thailand, 26 Dec 

2012

African Journal of 

Microbiology Research 

Related Journals Published by Academic Journals 

■ Journal of Cell and Animal Biology 

■ African Journal of Biotechnology 

■ Biotechnology and Molecular Biology Reviews 

■ African Journal of Microbiology Research 

■ African Journal of Biochemistry Research 

■ Journal of Bacteriology Research

Microbiology Research - Academic Journals

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?